METHODS IN ENZYMOLOGY Editors-in-Chief
JOHN N. ABELSON AND MELVIN I. SIMON Division of Biology California Institute of ...
22 downloads
1206 Views
15MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
METHODS IN ENZYMOLOGY Editors-in-Chief
JOHN N. ABELSON AND MELVIN I. SIMON Division of Biology California Institute of Technology Pasadena, California, USA Founding Editors
SIDNEY P. COLOWICK AND NATHAN O. KAPLAN
Academic Press is an imprint of Elsevier 525 B Street, Suite 1900, San Diego, CA 92101-4495, USA 30 Corporate Drive, Suite 400, Burlington, MA 01803, USA 32 Jamestown Road, London NW1 7BY, UK First edition 2009 Copyright # 2009, Elsevier Inc. All Rights Reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means electronic, mechanical, photocopying, recording or otherwise without the prior written permission of the publisher Permissions may be sought directly from Elsevier’s Science & Technology Rights Department in Oxford, UK: phone (+44) (0) 1865 843830; fax (+44) (0) 1865 853333; email: permissions@ elsevier.com. Alternatively you can submit your request online by visiting the Elsevier web site at http://elsevier.com/locate/permissions, and selecting Obtaining permission to use Elsevier material Notice No responsibility is assumed by the publisher for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions or ideas contained in the material herein. Because of rapid advances in the medical sciences, in particular, independent verification of diagnoses and drug dosages should be made For information on all Academic Press publications visit our website at elsevierdirect.com ISBN: 978-0-12-374591-0 ISSN: 0076-6879 Printed and bound in United States of America 09 10 11 12 10 9 8 7 6 5 4 3 2 1
CONTRIBUTORS
Brian Douglas Ames Department of Molecular Biology and Biochemistry, Department of Chemistry, University of California, Irvine, California, USA Jesu´s F. Aparicio Institute of Biotechnology INBIOTEC, and Microbiology Area, Biology Faculty, University of Leo´n, Leo´n, Spain Patrick Caffrey School of Biomolecular and Biomedical Science, University College Dublin, Dublin, Ireland David E. Cane Department of Chemistry, Brown University, Box H, Providence, Rhode Island, USA Yolande A. Chan Department of Bacteriology, University of Wisconsin-Madison, Madison, Wisconsin, USA Yi-Qiang Cheng Department of Chemistry and Biochemistry, and Department of Biological Sciences, University of Wisconsin-Milwaukee, Milwaukee, Wisconsin, USA Tarun Chopra Chemical Biology Laboratory, National Institute of Immunology, New Delhi, India Jane M. Coughlin Department of Chemistry, University of Wisconsin-Madison, Madison, Wisconsin, USA Russell J. Cox School of Chemistry, University of Bristol, Bristol, United Kingdom John E. Cronan Department of Biochemistry and Department of Microbiology, University of Illinois, Urbana, Illinois, USA Zixin Deng Laboratory of Microbial Metabolism and School of Life Sciences and Biotechnology, Shanghai Jiaotong University, Shanghai, China xiii
xiv
Contributors
Tadashi Eguchi Department of Chemistry and Materials Science, Tokyo Institute of Technology, Tokyo, Japan Rajesh S. Gokhale Chemical Biology Laboratory, National Institute of Immunology, New Delhi, India Hugo Gramajo Instituto de Biologı´a Molecular y Celular de Rosario (CONICET), Facultad de Ciencias Bioquı´micas y Farmace´uticas, Universidad Nacional de Rosario, Rosario, Argentina Lutz Heide Pharmazeutische Biologie, Pharmazeutisches Institut, Universita¨t Tu¨bingen, Tu¨bingen, Germany Geoffrey P. Horsman Division of Pharmaceutical Sciences, University of Wisconsin-Madison, Madison, Wisconsin, USA Hui Jiang Division of Pharmaceutical Sciences, University of Wisconsin-Madison, Madison, Wisconsin, USA Leonard Katz Synthetic Biology Engineering Research Center, University of California, Berkeley, Emeryville, California, USA Fumitaka Kudo Department of Chemistry, Tokyo Institute of Technology, Tokyo, Japan Steven G. Van Lanen Division of Pharmaceutical Sciences, College of Pharmacy, University of Kentucky, Lexington, Kentucky, USA Si-Kyu Lim Division of Pharmaceutical Sciences, University of Wisconsin-Madison, Madison, Wisconsin, USA Hung-wen Liu College of Pharmacy, Department of Chemistry and Biochemistry, and Institute for Cellular and Molecular Biology, University of Texas-Austin, Austin, Texas, USA Tiangang Liu Laboratory of Microbial Metabolism and School of Life Sciences and Biotechnology, Shanghai Jiaotong University, Shanghai, China, and Department of Chemistry, Brown University, Box H, Providence, Rhode Island, USA
Contributors
xv
Juan F. Martı´n Universidad de Leo´n, Dpto. Biologı´a Molecular – A´rea de Microbiologı´a, Fac. CC. Biolo´gicas y Ambientales and Institute of Biotechnology INBIOTEC, Leo´n, Spain Hugo G. Menzella Instituto de Biologı´a Molecular y Celular de Rosario (CONICET), Facultad de Ciencias Bioquı´micas y Farmace´uticas, Universidad Nacional de Rosario, Rosario, Argentina Salvador Peiru´ Instituto de Biologı´a Molecular y Celular de Rosario (CONICET), Facultad de Ciencias Bioquı´micas y Farmace´uticas, Universidad Nacional de Rosario, Rosario, Argentina Wolfgang Piepersberg Department of Chemical Microbiology, Bergische University Wuppertal, Wuppertal, Germany Scott R. Rajski Division of Pharmaceutical Sciences, University of Wisconsin-Madison, Madison, Wisconsin, USA Christopher D. Reeves Amyris Biotechnologies, Inc., Emeryville, California, USA Eduardo Rodriguez Instituto de Biologı´a Molecular y Celular de Rosario (CONICET), Facultad de Ciencias Bioquı´micas y Farmace´uticas, Universidad Nacional de Rosario, Rosario, Argentina Ben Shen Department of Chemistry and Division of Pharmaceutical Sciences, University of Wisconsin-Madison, Madison, Wisconsin, USA Thomas J. Simpson School of Chemistry, University of Bristol, Bristol, United Kingdom Yi Tang Department of Chemical and Biomolecular Engineering, University of CaliforniaLos Angeles, Los Angeles, California, USA Christopher J. Thibodeaux Institute for Cellular and Molecular Biology, University of Texas-Austin, Austin, Texas, USA Jacob Thomas Department of Microbiology, University of Illinois, Urbana, Illinois, USA
xvi
Contributors
Michael G. Thomas Department of Bacteriology, University of Wisconsin-Madison, Madison, Wisconsin, USA Shiou-Chuan (Sheryl) Tsai Department of Molecular Biology and Biochemistry, Department of Chemistry, Department of Pharmaceutical Sciences, University of California, Irvine, California, USA Udo F. Wehmeier Department of Sports Medicine, Bergische University Wuppertal, Wuppertal, Germany Kira J. Weissman Department of Pharmaceutical Biotechnology, Saarland University, Saarbru¨cken, Germany Jessica White-Phillip Institute for Cellular and Molecular Biology, University of Texas-Austin, Austin, Texas, USA Wenjun Zhang Department of Chemical and Biomolecular Engineering, University of CaliforniaLos Angeles, Los Angeles, California, USA Sergey Zotchev Department of Biotechnology, Norwegian University of Science and Technology, Trondheim, Norway
PREFACE
The complex structures of microbial natural products have fascinated chemists for decades. As the tools of chemistry and biochemistry were sharpened, huge advances in understanding natural product biosynthesis were made, but there were still barriers to a satisfactory understanding. Many such impediments were due to the instability of intermediates in the biosynthetic pathways, which hampered chemical analysis. At the same time, a frequent inability to obtain active cell–free preparations severely limited the success of biochemical approaches. A striking example of these limitations is provided by the polyketides, the largest and most important family of secondary metabolites. Chemistry and biochemistry had deduced the relationships between polyketide and fatty acid biosynthesis and had revealed the basic biochemical reactions involved, but there was little understanding of the ‘‘programming’’ of the enzymes, that is control of the variables that make the polyketides such a varied class of chemicals: choice of starter and extender units for carbon chain building, and control of chain length, degree of reduction of keto groups, and chirality of carbon and hydroxyl branches. Isolation of the actinomycete gene clusters that encode the polyketide synthases, their sequencing, and their manipulation into unnatural combinations in the early 1990s changed the landscape almost overnight. There followed a period in which genetics provided the primary stimulus to much of the research in natural product biosynthesis. Now, chemistry, genetics, enzymology, and structural studies are working synergistically to reveal the details of biochemical control. This two-volume set of Methods in Enzymology reflects these developments in the study of natural product biosynthesis. As expressed by Mel Simon in his invitation to edit the set, it is especially timely in view of the increasing need for novel bioactive natural products, especially antibiotics and anticancer drugs, and the new possibilities for addressing this need by carrying out ‘‘chemistry through genetics’’ and by studying the gamut of potential natural products revealed by the sequencing of microbial genomes. We begin Volume A with the isolation and screening of various kinds of microorganisms, to provide the raw material for subsequent fundamental studies or for the development of natural products as drugs. Then come three chapters dealing with the regulation of secondary metabolite production in actinomycetes—the group of filamentous soil bacteria that are preeminent secondary metabolite producers—and how an understanding of such regulation can furnish compounds that would otherwise be xvii
xviii
Preface
hard to obtain. Next are chapters covering the cloning and analysis of biosynthetic pathway genes and computer-based methods for predicting the products encoded by gene sets for two key classes of secondary metabolites, the polyketides and nonribosomal peptides, from DNA sequence data, as well as articles describing innovative approaches to probing their biosynthesis. Two final chapters in the first section deal with the biosynthesis of sugars and their attachment to secondary metabolite aglycones, thereby conferring biological activity. The section on peptide natural products begins with an overview of nonribosomal peptide biosynthesis, followed by a detailed description of methods for studying the biosynthesis of the amino acids and other precursors that function as building blocks in their assembly, as well as a chapter on the heterologous expression of nonribosomal peptide synthetase genes. Next come chapters on a specific class of compounds in this superfamily, the cephem beta-lactams, on a special type of iron-chelating siderophore, and on the important glycopeptide and lipopeptide families of antibiotics. Moving to ribosomally synthesized peptide natural products, two chapters cover the lantibiotics, a topic of increasing current focus in the search for antibiotics effective against resistant pathogens. We end Volume B with another example of ribosomally synthesised peptides, this time coupled with techniques for metagenomics mining. Volume B is dominated by the polyketides, reflecting their preeminence as natural products. Kira Weissman introduces polyketide synthesis and the different types of polyketide synthases, and puts the 16 chapters in this section elegantly into context, making redundant any further remarks here, except to note the absence of a chapter on the type III polyketide synthases, an omission stemming from the last-minute withdrawal of the author chosen for this topic. The section on aminocoumarins contains a single chapter that provides a particularly fine example of the application of molecular genetics to another class of compounds, with considerable potential for the generation of ‘‘unnatural natural products’’ by genetic engineering techniques first developed for the polyketides. The volume ends with a section on carbohydrate-type natural products, with two chapters on aminoglycosides and one on the biosynthesis of the TDPdeoxysugars that play such a crucial role in conferring biological activity on a whole range of secondary metabolites, harking back to the chapters on sugar biosynthesis in Volume A. Inevitably, the choice of topics to include in these volumes is somewhat arbitrary. The peptides and polyketides chose themselves because of their importance among natural products, especially as antibiotics, and because of the huge amount of recent research devoted to them. Historically, the aminoglycosides were centre-stage in the early days of antibiotic discovery—streptomycin was the first important actinomycete antibiotic to be described, and only the second, after penicillin, from any source to be a
Preface
xix
medical marvel—and they probably still make up the third largest chemical family of antibiotics, earning them a place in Volume B. Several other classes of microbial natural products were contenders for inclusion: aminocoumarins, terpenoids, and tetrapyrroles, among others. However, space constraints precluded inclusion of all of them, and in the end only the aminocoumarins made the cut. Hopefully, other classes will take their place in a further volume in due course, along with fuller coverage of natural product production by a wider range of microorganisms outside of the actinomycetes. I am most grateful for the enthusiastic response that greeted my invitations to contribute to this project. Inevitably, leaders in the field have many calls on their time, but it was most gratifying that nearly all my invitees either accepted or offered suggestions for alternative authors. I am especially grateful to Greg Challis, Chaitan Khosla, Tom Simpson, and Chris Walsh for their insightful ideas. To those who accepted—as well as to the many co-authors who were recruited to the writing—thank you for the time and effort that went into the preparation of the chapters and to the friendly way in which you all responded to my—usually minor—editorial suggestions, making my task a very pleasant one. DAVID A. HOPWOOD
METHODS IN ENZYMOLOGY
VOLUME I. Preparation and Assay of Enzymes Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME II. Preparation and Assay of Enzymes Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME III. Preparation and Assay of Substrates Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME IV. Special Techniques for the Enzymologist Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME V. Preparation and Assay of Enzymes Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME VI. Preparation and Assay of Enzymes (Continued) Preparation and Assay of Substrates Special Techniques Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME VII. Cumulative Subject Index Edited by SIDNEY P. COLOWICK AND NATHAN O. KAPLAN VOLUME VIII. Complex Carbohydrates Edited by ELIZABETH F. NEUFELD AND VICTOR GINSBURG VOLUME IX. Carbohydrate Metabolism Edited by WILLIS A. WOOD VOLUME X. Oxidation and Phosphorylation Edited by RONALD W. ESTABROOK AND MAYNARD E. PULLMAN VOLUME XI. Enzyme Structure Edited by C. H. W. HIRS VOLUME XII. Nucleic Acids (Parts A and B) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME XIII. Citric Acid Cycle Edited by J. M. LOWENSTEIN VOLUME XIV. Lipids Edited by J. M. LOWENSTEIN VOLUME XV. Steroids and Terpenoids Edited by RAYMOND B. CLAYTON xxi
xxii
Methods in Enzymology
VOLUME XVI. Fast Reactions Edited by KENNETH KUSTIN VOLUME XVII. Metabolism of Amino Acids and Amines (Parts A and B) Edited by HERBERT TABOR AND CELIA WHITE TABOR VOLUME XVIII. Vitamins and Coenzymes (Parts A, B, and C) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME XIX. Proteolytic Enzymes Edited by GERTRUDE E. PERLMANN AND LASZLO LORAND VOLUME XX. Nucleic Acids and Protein Synthesis (Part C) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME XXI. Nucleic Acids (Part D) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME XXII. Enzyme Purification and Related Techniques Edited by WILLIAM B. JAKOBY VOLUME XXIII. Photosynthesis (Part A) Edited by ANTHONY SAN PIETRO VOLUME XXIV. Photosynthesis and Nitrogen Fixation (Part B) Edited by ANTHONY SAN PIETRO VOLUME XXV. Enzyme Structure (Part B) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XXVI. Enzyme Structure (Part C) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XXVII. Enzyme Structure (Part D) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XXVIII. Complex Carbohydrates (Part B) Edited by VICTOR GINSBURG VOLUME XXIX. Nucleic Acids and Protein Synthesis (Part E) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME XXX. Nucleic Acids and Protein Synthesis (Part F) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME XXXI. Biomembranes (Part A) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME XXXII. Biomembranes (Part B) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME XXXIII. Cumulative Subject Index Volumes I-XXX Edited by MARTHA G. DENNIS AND EDWARD A. DENNIS VOLUME XXXIV. Affinity Techniques (Enzyme Purification: Part B) Edited by WILLIAM B. JAKOBY AND MEIR WILCHEK
Methods in Enzymology
VOLUME XXXV. Lipids (Part B) Edited by JOHN M. LOWENSTEIN VOLUME XXXVI. Hormone Action (Part A: Steroid Hormones) Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN VOLUME XXXVII. Hormone Action (Part B: Peptide Hormones) Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN VOLUME XXXVIII. Hormone Action (Part C: Cyclic Nucleotides) Edited by JOEL G. HARDMAN AND BERT W. O’MALLEY VOLUME XXXIX. Hormone Action (Part D: Isolated Cells, Tissues, and Organ Systems) Edited by JOEL G. HARDMAN AND BERT W. O’MALLEY VOLUME XL. Hormone Action (Part E: Nuclear Structure and Function) Edited by BERT W. O’MALLEY AND JOEL G. HARDMAN VOLUME XLI. Carbohydrate Metabolism (Part B) Edited by W. A. WOOD VOLUME XLII. Carbohydrate Metabolism (Part C) Edited by W. A. WOOD VOLUME XLIII. Antibiotics Edited by JOHN H. HASH VOLUME XLIV. Immobilized Enzymes Edited by KLAUS MOSBACH VOLUME XLV. Proteolytic Enzymes (Part B) Edited by LASZLO LORAND VOLUME XLVI. Affinity Labeling Edited by WILLIAM B. JAKOBY AND MEIR WILCHEK VOLUME XLVII. Enzyme Structure (Part E) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XLVIII. Enzyme Structure (Part F) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME XLIX. Enzyme Structure (Part G) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME L. Complex Carbohydrates (Part C) Edited by VICTOR GINSBURG VOLUME LI. Purine and Pyrimidine Nucleotide Metabolism Edited by PATRICIA A. HOFFEE AND MARY ELLEN JONES VOLUME LII. Biomembranes (Part C: Biological Oxidations) Edited by SIDNEY FLEISCHER AND LESTER PACKER
xxiii
xxiv
Methods in Enzymology
VOLUME LIII. Biomembranes (Part D: Biological Oxidations) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LIV. Biomembranes (Part E: Biological Oxidations) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LV. Biomembranes (Part F: Bioenergetics) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LVI. Biomembranes (Part G: Bioenergetics) Edited by SIDNEY FLEISCHER AND LESTER PACKER VOLUME LVII. Bioluminescence and Chemiluminescence Edited by MARLENE A. DELUCA VOLUME LVIII. Cell Culture Edited by WILLIAM B. JAKOBY AND IRA PASTAN VOLUME LIX. Nucleic Acids and Protein Synthesis (Part G) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME LX. Nucleic Acids and Protein Synthesis (Part H) Edited by KIVIE MOLDAVE AND LAWRENCE GROSSMAN VOLUME 61. Enzyme Structure (Part H) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 62. Vitamins and Coenzymes (Part D) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME 63. Enzyme Kinetics and Mechanism (Part A: Initial Rate and Inhibitor Methods) Edited by DANIEL L. PURICH VOLUME 64. Enzyme Kinetics and Mechanism (Part B: Isotopic Probes and Complex Enzyme Systems) Edited by DANIEL L. PURICH VOLUME 65. Nucleic Acids (Part I) Edited by LAWRENCE GROSSMAN AND KIVIE MOLDAVE VOLUME 66. Vitamins and Coenzymes (Part E) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME 67. Vitamins and Coenzymes (Part F) Edited by DONALD B. MCCORMICK AND LEMUEL D. WRIGHT VOLUME 68. Recombinant DNA Edited by RAY WU VOLUME 69. Photosynthesis and Nitrogen Fixation (Part C) Edited by ANTHONY SAN PIETRO VOLUME 70. Immunochemical Techniques (Part A) Edited by HELEN VAN VUNAKIS AND JOHN J. LANGONE
Methods in Enzymology
xxv
VOLUME 71. Lipids (Part C) Edited by JOHN M. LOWENSTEIN VOLUME 72. Lipids (Part D) Edited by JOHN M. LOWENSTEIN VOLUME 73. Immunochemical Techniques (Part B) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 74. Immunochemical Techniques (Part C) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 75. Cumulative Subject Index Volumes XXXI, XXXII, XXXIV–LX Edited by EDWARD A. DENNIS AND MARTHA G. DENNIS VOLUME 76. Hemoglobins Edited by ERALDO ANTONINI, LUIGI ROSSI-BERNARDI, AND EMILIA CHIANCONE VOLUME 77. Detoxication and Drug Metabolism Edited by WILLIAM B. JAKOBY VOLUME 78. Interferons (Part A) Edited by SIDNEY PESTKA VOLUME 79. Interferons (Part B) Edited by SIDNEY PESTKA VOLUME 80. Proteolytic Enzymes (Part C) Edited by LASZLO LORAND VOLUME 81. Biomembranes (Part H: Visual Pigments and Purple Membranes, I) Edited by LESTER PACKER VOLUME 82. Structural and Contractile Proteins (Part A: Extracellular Matrix) Edited by LEON W. CUNNINGHAM AND DIXIE W. FREDERIKSEN VOLUME 83. Complex Carbohydrates (Part D) Edited by VICTOR GINSBURG VOLUME 84. Immunochemical Techniques (Part D: Selected Immunoassays) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 85. Structural and Contractile Proteins (Part B: The Contractile Apparatus and the Cytoskeleton) Edited by DIXIE W. FREDERIKSEN AND LEON W. CUNNINGHAM VOLUME 86. Prostaglandins and Arachidonate Metabolites Edited by WILLIAM E. M. LANDS AND WILLIAM L. SMITH VOLUME 87. Enzyme Kinetics and Mechanism (Part C: Intermediates, Stereo-chemistry, and Rate Studies) Edited by DANIEL L. PURICH VOLUME 88. Biomembranes (Part I: Visual Pigments and Purple Membranes, II) Edited by LESTER PACKER
xxvi
Methods in Enzymology
VOLUME 89. Carbohydrate Metabolism (Part D) Edited by WILLIS A. WOOD VOLUME 90. Carbohydrate Metabolism (Part E) Edited by WILLIS A. WOOD VOLUME 91. Enzyme Structure (Part I) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 92. Immunochemical Techniques (Part E: Monoclonal Antibodies and General Immunoassay Methods) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 93. Immunochemical Techniques (Part F: Conventional Antibodies, Fc Receptors, and Cytotoxicity) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 94. Polyamines Edited by HERBERT TABOR AND CELIA WHITE TABOR VOLUME 95. Cumulative Subject Index Volumes 61–74, 76–80 Edited by EDWARD A. DENNIS AND MARTHA G. DENNIS VOLUME 96. Biomembranes [Part J: Membrane Biogenesis: Assembly and Targeting (General Methods; Eukaryotes)] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 97. Biomembranes [Part K: Membrane Biogenesis: Assembly and Targeting (Prokaryotes, Mitochondria, and Chloroplasts)] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 98. Biomembranes (Part L: Membrane Biogenesis: Processing and Recycling) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 99. Hormone Action (Part F: Protein Kinases) Edited by JACKIE D. CORBIN AND JOEL G. HARDMAN VOLUME 100. Recombinant DNA (Part B) Edited by RAY WU, LAWRENCE GROSSMAN, AND KIVIE MOLDAVE VOLUME 101. Recombinant DNA (Part C) Edited by RAY WU, LAWRENCE GROSSMAN, AND KIVIE MOLDAVE VOLUME 102. Hormone Action (Part G: Calmodulin and Calcium-Binding Proteins) Edited by ANTHONY R. MEANS AND BERT W. O’MALLEY VOLUME 103. Hormone Action (Part H: Neuroendocrine Peptides) Edited by P. MICHAEL CONN VOLUME 104. Enzyme Purification and Related Techniques (Part C) Edited by WILLIAM B. JAKOBY
Methods in Enzymology
xxvii
VOLUME 105. Oxygen Radicals in Biological Systems Edited by LESTER PACKER VOLUME 106. Posttranslational Modifications (Part A) Edited by FINN WOLD AND KIVIE MOLDAVE VOLUME 107. Posttranslational Modifications (Part B) Edited by FINN WOLD AND KIVIE MOLDAVE VOLUME 108. Immunochemical Techniques (Part G: Separation and Characterization of Lymphoid Cells) Edited by GIOVANNI DI SABATO, JOHN J. LANGONE, AND HELEN VAN VUNAKIS VOLUME 109. Hormone Action (Part I: Peptide Hormones) Edited by LUTZ BIRNBAUMER AND BERT W. O’MALLEY VOLUME 110. Steroids and Isoprenoids (Part A) Edited by JOHN H. LAW AND HANS C. RILLING VOLUME 111. Steroids and Isoprenoids (Part B) Edited by JOHN H. LAW AND HANS C. RILLING VOLUME 112. Drug and Enzyme Targeting (Part A) Edited by KENNETH J. WIDDER AND RALPH GREEN VOLUME 113. Glutamate, Glutamine, Glutathione, and Related Compounds Edited by ALTON MEISTER VOLUME 114. Diffraction Methods for Biological Macromolecules (Part A) Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF VOLUME 115. Diffraction Methods for Biological Macromolecules (Part B) Edited by HAROLD W. WYCKOFF, C. H. W. HIRS, AND SERGE N. TIMASHEFF VOLUME 116. Immunochemical Techniques (Part H: Effectors and Mediators of Lymphoid Cell Functions) Edited by GIOVANNI DI SABATO, JOHN J. LANGONE, AND HELEN VAN VUNAKIS VOLUME 117. Enzyme Structure (Part J) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 118. Plant Molecular Biology Edited by ARTHUR WEISSBACH AND HERBERT WEISSBACH VOLUME 119. Interferons (Part C) Edited by SIDNEY PESTKA VOLUME 120. Cumulative Subject Index Volumes 81–94, 96–101 VOLUME 121. Immunochemical Techniques (Part I: Hybridoma Technology and Monoclonal Antibodies) Edited by JOHN J. LANGONE AND HELEN VAN VUNAKIS VOLUME 122. Vitamins and Coenzymes (Part G) Edited by FRANK CHYTIL AND DONALD B. MCCORMICK
xxviii
Methods in Enzymology
VOLUME 123. Vitamins and Coenzymes (Part H) Edited by FRANK CHYTIL AND DONALD B. MCCORMICK VOLUME 124. Hormone Action (Part J: Neuroendocrine Peptides) Edited by P. MICHAEL CONN VOLUME 125. Biomembranes (Part M: Transport in Bacteria, Mitochondria, and Chloroplasts: General Approaches and Transport Systems) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 126. Biomembranes (Part N: Transport in Bacteria, Mitochondria, and Chloroplasts: Protonmotive Force) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 127. Biomembranes (Part O: Protons and Water: Structure and Translocation) Edited by LESTER PACKER VOLUME 128. Plasma Lipoproteins (Part A: Preparation, Structure, and Molecular Biology) Edited by JERE P. SEGREST AND JOHN J. ALBERS VOLUME 129. Plasma Lipoproteins (Part B: Characterization, Cell Biology, and Metabolism) Edited by JOHN J. ALBERS AND JERE P. SEGREST VOLUME 130. Enzyme Structure (Part K) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 131. Enzyme Structure (Part L) Edited by C. H. W. HIRS AND SERGE N. TIMASHEFF VOLUME 132. Immunochemical Techniques (Part J: Phagocytosis and Cell-Mediated Cytotoxicity) Edited by GIOVANNI DI SABATO AND JOHANNES EVERSE VOLUME 133. Bioluminescence and Chemiluminescence (Part B) Edited by MARLENE DELUCA AND WILLIAM D. MCELROY VOLUME 134. Structural and Contractile Proteins (Part C: The Contractile Apparatus and the Cytoskeleton) Edited by RICHARD B. VALLEE VOLUME 135. Immobilized Enzymes and Cells (Part B) Edited by KLAUS MOSBACH VOLUME 136. Immobilized Enzymes and Cells (Part C) Edited by KLAUS MOSBACH VOLUME 137. Immobilized Enzymes and Cells (Part D) Edited by KLAUS MOSBACH VOLUME 138. Complex Carbohydrates (Part E) Edited by VICTOR GINSBURG
Methods in Enzymology
xxix
VOLUME 139. Cellular Regulators (Part A: Calcium- and Calmodulin-Binding Proteins) Edited by ANTHONY R. MEANS AND P. MICHAEL CONN VOLUME 140. Cumulative Subject Index Volumes 102–119, 121–134 VOLUME 141. Cellular Regulators (Part B: Calcium and Lipids) Edited by P. MICHAEL CONN AND ANTHONY R. MEANS VOLUME 142. Metabolism of Aromatic Amino Acids and Amines Edited by SEYMOUR KAUFMAN VOLUME 143. Sulfur and Sulfur Amino Acids Edited by WILLIAM B. JAKOBY AND OWEN GRIFFITH VOLUME 144. Structural and Contractile Proteins (Part D: Extracellular Matrix) Edited by LEON W. CUNNINGHAM VOLUME 145. Structural and Contractile Proteins (Part E: Extracellular Matrix) Edited by LEON W. CUNNINGHAM VOLUME 146. Peptide Growth Factors (Part A) Edited by DAVID BARNES AND DAVID A. SIRBASKU VOLUME 147. Peptide Growth Factors (Part B) Edited by DAVID BARNES AND DAVID A. SIRBASKU VOLUME 148. Plant Cell Membranes Edited by LESTER PACKER AND ROLAND DOUCE VOLUME 149. Drug and Enzyme Targeting (Part B) Edited by RALPH GREEN AND KENNETH J. WIDDER VOLUME 150. Immunochemical Techniques (Part K: In Vitro Models of B and T Cell Functions and Lymphoid Cell Receptors) Edited by GIOVANNI DI SABATO VOLUME 151. Molecular Genetics of Mammalian Cells Edited by MICHAEL M. GOTTESMAN VOLUME 152. Guide to Molecular Cloning Techniques Edited by SHELBY L. BERGER AND ALAN R. KIMMEL VOLUME 153. Recombinant DNA (Part D) Edited by RAY WU AND LAWRENCE GROSSMAN VOLUME 154. Recombinant DNA (Part E) Edited by RAY WU AND LAWRENCE GROSSMAN VOLUME 155. Recombinant DNA (Part F) Edited by RAY WU VOLUME 156. Biomembranes (Part P: ATP-Driven Pumps and Related Transport: The Na, K-Pump) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
xxx
Methods in Enzymology
VOLUME 157. Biomembranes (Part Q: ATP-Driven Pumps and Related Transport: Calcium, Proton, and Potassium Pumps) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 158. Metalloproteins (Part A) Edited by JAMES F. RIORDAN AND BERT L. VALLEE VOLUME 159. Initiation and Termination of Cyclic Nucleotide Action Edited by JACKIE D. CORBIN AND ROGER A. JOHNSON VOLUME 160. Biomass (Part A: Cellulose and Hemicellulose) Edited by WILLIS A. WOOD AND SCOTT T. KELLOGG VOLUME 161. Biomass (Part B: Lignin, Pectin, and Chitin) Edited by WILLIS A. WOOD AND SCOTT T. KELLOGG VOLUME 162. Immunochemical Techniques (Part L: Chemotaxis and Inflammation) Edited by GIOVANNI DI SABATO VOLUME 163. Immunochemical Techniques (Part M: Chemotaxis and Inflammation) Edited by GIOVANNI DI SABATO VOLUME 164. Ribosomes Edited by HARRY F. NOLLER, JR., AND KIVIE MOLDAVE VOLUME 165. Microbial Toxins: Tools for Enzymology Edited by SIDNEY HARSHMAN VOLUME 166. Branched-Chain Amino Acids Edited by ROBERT HARRIS AND JOHN R. SOKATCH VOLUME 167. Cyanobacteria Edited by LESTER PACKER AND ALEXANDER N. GLAZER VOLUME 168. Hormone Action (Part K: Neuroendocrine Peptides) Edited by P. MICHAEL CONN VOLUME 169. Platelets: Receptors, Adhesion, Secretion (Part A) Edited by JACEK HAWIGER VOLUME 170. Nucleosomes Edited by PAUL M. WASSARMAN AND ROGER D. KORNBERG VOLUME 171. Biomembranes (Part R: Transport Theory: Cells and Model Membranes) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 172. Biomembranes (Part S: Transport: Membrane Isolation and Characterization) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER
Methods in Enzymology
xxxi
VOLUME 173. Biomembranes [Part T: Cellular and Subcellular Transport: Eukaryotic (Nonepithelial) Cells] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 174. Biomembranes [Part U: Cellular and Subcellular Transport: Eukaryotic (Nonepithelial) Cells] Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 175. Cumulative Subject Index Volumes 135–139, 141–167 VOLUME 176. Nuclear Magnetic Resonance (Part A: Spectral Techniques and Dynamics) Edited by NORMAN J. OPPENHEIMER AND THOMAS L. JAMES VOLUME 177. Nuclear Magnetic Resonance (Part B: Structure and Mechanism) Edited by NORMAN J. OPPENHEIMER AND THOMAS L. JAMES VOLUME 178. Antibodies, Antigens, and Molecular Mimicry Edited by JOHN J. LANGONE VOLUME 179. Complex Carbohydrates (Part F) Edited by VICTOR GINSBURG VOLUME 180. RNA Processing (Part A: General Methods) Edited by JAMES E. DAHLBERG AND JOHN N. ABELSON VOLUME 181. RNA Processing (Part B: Specific Methods) Edited by JAMES E. DAHLBERG AND JOHN N. ABELSON VOLUME 182. Guide to Protein Purification Edited by MURRAY P. DEUTSCHER VOLUME 183. Molecular Evolution: Computer Analysis of Protein and Nucleic Acid Sequences Edited by RUSSELL F. DOOLITTLE VOLUME 184. Avidin-Biotin Technology Edited by MEIR WILCHEK AND EDWARD A. BAYER VOLUME 185. Gene Expression Technology Edited by DAVID V. GOEDDEL VOLUME 186. Oxygen Radicals in Biological Systems (Part B: Oxygen Radicals and Antioxidants) Edited by LESTER PACKER AND ALEXANDER N. GLAZER VOLUME 187. Arachidonate Related Lipid Mediators Edited by ROBERT C. MURPHY AND FRANK A. FITZPATRICK VOLUME 188. Hydrocarbons and Methylotrophy Edited by MARY E. LIDSTROM VOLUME 189. Retinoids (Part A: Molecular and Metabolic Aspects) Edited by LESTER PACKER
xxxii
Methods in Enzymology
VOLUME 190. Retinoids (Part B: Cell Differentiation and Clinical Applications) Edited by LESTER PACKER VOLUME 191. Biomembranes (Part V: Cellular and Subcellular Transport: Epithelial Cells) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 192. Biomembranes (Part W: Cellular and Subcellular Transport: Epithelial Cells) Edited by SIDNEY FLEISCHER AND BECCA FLEISCHER VOLUME 193. Mass Spectrometry Edited by JAMES A. MCCLOSKEY VOLUME 194. Guide to Yeast Genetics and Molecular Biology Edited by CHRISTINE GUTHRIE AND GERALD R. FINK VOLUME 195. Adenylyl Cyclase, G Proteins, and Guanylyl Cyclase Edited by ROGER A. JOHNSON AND JACKIE D. CORBIN VOLUME 196. Molecular Motors and the Cytoskeleton Edited by RICHARD B. VALLEE VOLUME 197. Phospholipases Edited by EDWARD A. DENNIS VOLUME 198. Peptide Growth Factors (Part C) Edited by DAVID BARNES, J. P. MATHER, AND GORDON H. SATO VOLUME 199. Cumulative Subject Index Volumes 168–174, 176–194 VOLUME 200. Protein Phosphorylation (Part A: Protein Kinases: Assays, Purification, Antibodies, Functional Analysis, Cloning, and Expression) Edited by TONY HUNTER AND BARTHOLOMEW M. SEFTON VOLUME 201. Protein Phosphorylation (Part B: Analysis of Protein Phosphorylation, Protein Kinase Inhibitors, and Protein Phosphatases) Edited by TONY HUNTER AND BARTHOLOMEW M. SEFTON VOLUME 202. Molecular Design and Modeling: Concepts and Applications (Part A: Proteins, Peptides, and Enzymes) Edited by JOHN J. LANGONE VOLUME 203. Molecular Design and Modeling: Concepts and Applications (Part B: Antibodies and Antigens, Nucleic Acids, Polysaccharides, and Drugs) Edited by JOHN J. LANGONE VOLUME 204. Bacterial Genetic Systems Edited by JEFFREY H. MILLER VOLUME 205. Metallobiochemistry (Part B: Metallothionein and Related Molecules) Edited by JAMES F. RIORDAN AND BERT L. VALLEE
Methods in Enzymology
xxxiii
VOLUME 206. Cytochrome P450 Edited by MICHAEL R. WATERMAN AND ERIC F. JOHNSON VOLUME 207. Ion Channels Edited by BERNARDO RUDY AND LINDA E. IVERSON VOLUME 208. Protein–DNA Interactions Edited by ROBERT T. SAUER VOLUME 209. Phospholipid Biosynthesis Edited by EDWARD A. DENNIS AND DENNIS E. VANCE VOLUME 210. Numerical Computer Methods Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 211. DNA Structures (Part A: Synthesis and Physical Analysis of DNA) Edited by DAVID M. J. LILLEY AND JAMES E. DAHLBERG VOLUME 212. DNA Structures (Part B: Chemical and Electrophoretic Analysis of DNA) Edited by DAVID M. J. LILLEY AND JAMES E. DAHLBERG VOLUME 213. Carotenoids (Part A: Chemistry, Separation, Quantitation, and Antioxidation) Edited by LESTER PACKER VOLUME 214. Carotenoids (Part B: Metabolism, Genetics, and Biosynthesis) Edited by LESTER PACKER VOLUME 215. Platelets: Receptors, Adhesion, Secretion (Part B) Edited by JACEK J. HAWIGER VOLUME 216. Recombinant DNA (Part G) Edited by RAY WU VOLUME 217. Recombinant DNA (Part H) Edited by RAY WU VOLUME 218. Recombinant DNA (Part I) Edited by RAY WU VOLUME 219. Reconstitution of Intracellular Transport Edited by JAMES E. ROTHMAN VOLUME 220. Membrane Fusion Techniques (Part A) Edited by NEJAT DU¨ZGU¨NES, VOLUME 221. Membrane Fusion Techniques (Part B) Edited by NEJAT DU¨ZGU¨NES, VOLUME 222. Proteolytic Enzymes in Coagulation, Fibrinolysis, and Complement Activation (Part A: Mammalian Blood Coagulation Factors and Inhibitors) Edited by LASZLO LORAND AND KENNETH G. MANN
xxxiv
Methods in Enzymology
VOLUME 223. Proteolytic Enzymes in Coagulation, Fibrinolysis, and Complement Activation (Part B: Complement Activation, Fibrinolysis, and Nonmammalian Blood Coagulation Factors) Edited by LASZLO LORAND AND KENNETH G. MANN VOLUME 224. Molecular Evolution: Producing the Biochemical Data Edited by ELIZABETH ANNE ZIMMER, THOMAS J. WHITE, REBECCA L. CANN, AND ALLAN C. WILSON VOLUME 225. Guide to Techniques in Mouse Development Edited by PAUL M. WASSARMAN AND MELVIN L. DEPAMPHILIS VOLUME 226. Metallobiochemistry (Part C: Spectroscopic and Physical Methods for Probing Metal Ion Environments in Metalloenzymes and Metalloproteins) Edited by JAMES F. RIORDAN AND BERT L. VALLEE VOLUME 227. Metallobiochemistry (Part D: Physical and Spectroscopic Methods for Probing Metal Ion Environments in Metalloproteins) Edited by JAMES F. RIORDAN AND BERT L. VALLEE VOLUME 228. Aqueous Two-Phase Systems Edited by HARRY WALTER AND GO¨TE JOHANSSON VOLUME 229. Cumulative Subject Index Volumes 195–198, 200–227 VOLUME 230. Guide to Techniques in Glycobiology Edited by WILLIAM J. LENNARZ AND GERALD W. HART VOLUME 231. Hemoglobins (Part B: Biochemical and Analytical Methods) Edited by JOHANNES EVERSE, KIM D. VANDEGRIFF, AND ROBERT M. WINSLOW VOLUME 232. Hemoglobins (Part C: Biophysical Methods) Edited by JOHANNES EVERSE, KIM D. VANDEGRIFF, AND ROBERT M. WINSLOW VOLUME 233. Oxygen Radicals in Biological Systems (Part C) Edited by LESTER PACKER VOLUME 234. Oxygen Radicals in Biological Systems (Part D) Edited by LESTER PACKER VOLUME 235. Bacterial Pathogenesis (Part A: Identification and Regulation of Virulence Factors) Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL VOLUME 236. Bacterial Pathogenesis (Part B: Integration of Pathogenic Bacteria with Host Cells) Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL VOLUME 237. Heterotrimeric G Proteins Edited by RAVI IYENGAR VOLUME 238. Heterotrimeric G-Protein Effectors Edited by RAVI IYENGAR
Methods in Enzymology
xxxv
VOLUME 239. Nuclear Magnetic Resonance (Part C) Edited by THOMAS L. JAMES AND NORMAN J. OPPENHEIMER VOLUME 240. Numerical Computer Methods (Part B) Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 241. Retroviral Proteases Edited by LAWRENCE C. KUO AND JULES A. SHAFER VOLUME 242. Neoglycoconjugates (Part A) Edited by Y. C. LEE AND REIKO T. LEE VOLUME 243. Inorganic Microbial Sulfur Metabolism Edited by HARRY D. PECK, JR., AND JEAN LEGALL VOLUME 244. Proteolytic Enzymes: Serine and Cysteine Peptidases Edited by ALAN J. BARRETT VOLUME 245. Extracellular Matrix Components Edited by E. RUOSLAHTI AND E. ENGVALL VOLUME 246. Biochemical Spectroscopy Edited by KENNETH SAUER VOLUME 247. Neoglycoconjugates (Part B: Biomedical Applications) Edited by Y. C. LEE AND REIKO T. LEE VOLUME 248. Proteolytic Enzymes: Aspartic and Metallo Peptidases Edited by ALAN J. BARRETT VOLUME 249. Enzyme Kinetics and Mechanism (Part D: Developments in Enzyme Dynamics) Edited by DANIEL L. PURICH VOLUME 250. Lipid Modifications of Proteins Edited by PATRICK J. CASEY AND JANICE E. BUSS VOLUME 251. Biothiols (Part A: Monothiols and Dithiols, Protein Thiols, and Thiyl Radicals) Edited by LESTER PACKER VOLUME 252. Biothiols (Part B: Glutathione and Thioredoxin; Thiols in Signal Transduction and Gene Regulation) Edited by LESTER PACKER VOLUME 253. Adhesion of Microbial Pathogens Edited by RON J. DOYLE AND ITZHAK OFEK VOLUME 254. Oncogene Techniques Edited by PETER K. VOGT AND INDER M. VERMA VOLUME 255. Small GTPases and Their Regulators (Part A: Ras Family) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 256. Small GTPases and Their Regulators (Part B: Rho Family) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL
xxxvi
Methods in Enzymology
VOLUME 257. Small GTPases and Their Regulators (Part C: Proteins Involved in Transport) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 258. Redox-Active Amino Acids in Biology Edited by JUDITH P. KLINMAN VOLUME 259. Energetics of Biological Macromolecules Edited by MICHAEL L. JOHNSON AND GARY K. ACKERS VOLUME 260. Mitochondrial Biogenesis and Genetics (Part A) Edited by GIUSEPPE M. ATTARDI AND ANNE CHOMYN VOLUME 261. Nuclear Magnetic Resonance and Nucleic Acids Edited by THOMAS L. JAMES VOLUME 262. DNA Replication Edited by JUDITH L. CAMPBELL VOLUME 263. Plasma Lipoproteins (Part C: Quantitation) Edited by WILLIAM A. BRADLEY, SANDRA H. GIANTURCO, AND JERE P. SEGREST VOLUME 264. Mitochondrial Biogenesis and Genetics (Part B) Edited by GIUSEPPE M. ATTARDI AND ANNE CHOMYN VOLUME 265. Cumulative Subject Index Volumes 228, 230–262 VOLUME 266. Computer Methods for Macromolecular Sequence Analysis Edited by RUSSELL F. DOOLITTLE VOLUME 267. Combinatorial Chemistry Edited by JOHN N. ABELSON VOLUME 268. Nitric Oxide (Part A: Sources and Detection of NO; NO Synthase) Edited by LESTER PACKER VOLUME 269. Nitric Oxide (Part B: Physiological and Pathological Processes) Edited by LESTER PACKER VOLUME 270. High Resolution Separation and Analysis of Biological Macromolecules (Part A: Fundamentals) Edited by BARRY L. KARGER AND WILLIAM S. HANCOCK VOLUME 271. High Resolution Separation and Analysis of Biological Macromolecules (Part B: Applications) Edited by BARRY L. KARGER AND WILLIAM S. HANCOCK VOLUME 272. Cytochrome P450 (Part B) Edited by ERIC F. JOHNSON AND MICHAEL R. WATERMAN VOLUME 273. RNA Polymerase and Associated Factors (Part A) Edited by SANKAR ADHYA VOLUME 274. RNA Polymerase and Associated Factors (Part B) Edited by SANKAR ADHYA
Methods in Enzymology
xxxvii
VOLUME 275. Viral Polymerases and Related Proteins Edited by LAWRENCE C. KUO, DAVID B. OLSEN, AND STEVEN S. CARROLL VOLUME 276. Macromolecular Crystallography (Part A) Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET VOLUME 277. Macromolecular Crystallography (Part B) Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET VOLUME 278. Fluorescence Spectroscopy Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 279. Vitamins and Coenzymes (Part I) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 280. Vitamins and Coenzymes (Part J) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 281. Vitamins and Coenzymes (Part K) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 282. Vitamins and Coenzymes (Part L) Edited by DONALD B. MCCORMICK, JOHN W. SUTTIE, AND CONRAD WAGNER VOLUME 283. Cell Cycle Control Edited by WILLIAM G. DUNPHY VOLUME 284. Lipases (Part A: Biotechnology) Edited by BYRON RUBIN AND EDWARD A. DENNIS VOLUME 285. Cumulative Subject Index Volumes 263, 264, 266–284, 286–289 VOLUME 286. Lipases (Part B: Enzyme Characterization and Utilization) Edited by BYRON RUBIN AND EDWARD A. DENNIS VOLUME 287. Chemokines Edited by RICHARD HORUK VOLUME 288. Chemokine Receptors Edited by RICHARD HORUK VOLUME 289. Solid Phase Peptide Synthesis Edited by GREGG B. FIELDS VOLUME 290. Molecular Chaperones Edited by GEORGE H. LORIMER AND THOMAS BALDWIN VOLUME 291. Caged Compounds Edited by GERARD MARRIOTT VOLUME 292. ABC Transporters: Biochemical, Cellular, and Molecular Aspects Edited by SURESH V. AMBUDKAR AND MICHAEL M. GOTTESMAN VOLUME 293. Ion Channels (Part B) Edited by P. MICHAEL CONN
xxxviii
Methods in Enzymology
VOLUME 294. Ion Channels (Part C) Edited by P. MICHAEL CONN VOLUME 295. Energetics of Biological Macromolecules (Part B) Edited by GARY K. ACKERS AND MICHAEL L. JOHNSON VOLUME 296. Neurotransmitter Transporters Edited by SUSAN G. AMARA VOLUME 297. Photosynthesis: Molecular Biology of Energy Capture Edited by LEE MCINTOSH VOLUME 298. Molecular Motors and the Cytoskeleton (Part B) Edited by RICHARD B. VALLEE VOLUME 299. Oxidants and Antioxidants (Part A) Edited by LESTER PACKER VOLUME 300. Oxidants and Antioxidants (Part B) Edited by LESTER PACKER VOLUME 301. Nitric Oxide: Biological and Antioxidant Activities (Part C) Edited by LESTER PACKER VOLUME 302. Green Fluorescent Protein Edited by P. MICHAEL CONN VOLUME 303. cDNA Preparation and Display Edited by SHERMAN M. WEISSMAN VOLUME 304. Chromatin Edited by PAUL M. WASSARMAN AND ALAN P. WOLFFE VOLUME 305. Bioluminescence and Chemiluminescence (Part C) Edited by THOMAS O. BALDWIN AND MIRIAM M. ZIEGLER VOLUME 306. Expression of Recombinant Genes in Eukaryotic Systems Edited by JOSEPH C. GLORIOSO AND MARTIN C. SCHMIDT VOLUME 307. Confocal Microscopy Edited by P. MICHAEL CONN VOLUME 308. Enzyme Kinetics and Mechanism (Part E: Energetics of Enzyme Catalysis) Edited by DANIEL L. PURICH AND VERN L. SCHRAMM VOLUME 309. Amyloid, Prions, and Other Protein Aggregates Edited by RONALD WETZEL VOLUME 310. Biofilms Edited by RON J. DOYLE VOLUME 311. Sphingolipid Metabolism and Cell Signaling (Part A) Edited by ALFRED H. MERRILL, JR., AND YUSUF A. HANNUN
Methods in Enzymology
xxxix
VOLUME 312. Sphingolipid Metabolism and Cell Signaling (Part B) Edited by ALFRED H. MERRILL, JR., AND YUSUF A. HANNUN VOLUME 313. Antisense Technology (Part A: General Methods, Methods of Delivery, and RNA Studies) Edited by M. IAN PHILLIPS VOLUME 314. Antisense Technology (Part B: Applications) Edited by M. IAN PHILLIPS VOLUME 315. Vertebrate Phototransduction and the Visual Cycle (Part A) Edited by KRZYSZTOF PALCZEWSKI VOLUME 316. Vertebrate Phototransduction and the Visual Cycle (Part B) Edited by KRZYSZTOF PALCZEWSKI VOLUME 317. RNA–Ligand Interactions (Part A: Structural Biology Methods) Edited by DANIEL W. CELANDER AND JOHN N. ABELSON VOLUME 318. RNA–Ligand Interactions (Part B: Molecular Biology Methods) Edited by DANIEL W. CELANDER AND JOHN N. ABELSON VOLUME 319. Singlet Oxygen, UV-A, and Ozone Edited by LESTER PACKER AND HELMUT SIES VOLUME 320. Cumulative Subject Index Volumes 290–319 VOLUME 321. Numerical Computer Methods (Part C) Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 322. Apoptosis Edited by JOHN C. REED VOLUME 323. Energetics of Biological Macromolecules (Part C) Edited by MICHAEL L. JOHNSON AND GARY K. ACKERS VOLUME 324. Branched-Chain Amino Acids (Part B) Edited by ROBERT A. HARRIS AND JOHN R. SOKATCH VOLUME 325. Regulators and Effectors of Small GTPases (Part D: Rho Family) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 326. Applications of Chimeric Genes and Hybrid Proteins (Part A: Gene Expression and Protein Purification) Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON VOLUME 327. Applications of Chimeric Genes and Hybrid Proteins (Part B: Cell Biology and Physiology) Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON VOLUME 328. Applications of Chimeric Genes and Hybrid Proteins (Part C: Protein–Protein Interactions and Genomics) Edited by JEREMY THORNER, SCOTT D. EMR, AND JOHN N. ABELSON
xl
Methods in Enzymology
VOLUME 329. Regulators and Effectors of Small GTPases (Part E: GTPases Involved in Vesicular Traffic) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 330. Hyperthermophilic Enzymes (Part A) Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY VOLUME 331. Hyperthermophilic Enzymes (Part B) Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY VOLUME 332. Regulators and Effectors of Small GTPases (Part F: Ras Family I) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 333. Regulators and Effectors of Small GTPases (Part G: Ras Family II) Edited by W. E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 334. Hyperthermophilic Enzymes (Part C) Edited by MICHAEL W. W. ADAMS AND ROBERT M. KELLY VOLUME 335. Flavonoids and Other Polyphenols Edited by LESTER PACKER VOLUME 336. Microbial Growth in Biofilms (Part A: Developmental and Molecular Biological Aspects) Edited by RON J. DOYLE VOLUME 337. Microbial Growth in Biofilms (Part B: Special Environments and Physicochemical Aspects) Edited by RON J. DOYLE VOLUME 338. Nuclear Magnetic Resonance of Biological Macromolecules (Part A) Edited by THOMAS L. JAMES, VOLKER DO¨TSCH, AND ULI SCHMITZ VOLUME 339. Nuclear Magnetic Resonance of Biological Macromolecules (Part B) Edited by THOMAS L. JAMES, VOLKER DO¨TSCH, AND ULI SCHMITZ VOLUME 340. Drug–Nucleic Acid Interactions Edited by JONATHAN B. CHAIRES AND MICHAEL J. WARING VOLUME 341. Ribonucleases (Part A) Edited by ALLEN W. NICHOLSON VOLUME 342. Ribonucleases (Part B) Edited by ALLEN W. NICHOLSON VOLUME 343. G Protein Pathways (Part A: Receptors) Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT VOLUME 344. G Protein Pathways (Part B: G Proteins and Their Regulators) Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT VOLUME 345. G Protein Pathways (Part C: Effector Mechanisms) Edited by RAVI IYENGAR AND JOHN D. HILDEBRANDT
Methods in Enzymology
xli
VOLUME 346. Gene Therapy Methods Edited by M. IAN PHILLIPS VOLUME 347. Protein Sensors and Reactive Oxygen Species (Part A: Selenoproteins and Thioredoxin) Edited by HELMUT SIES AND LESTER PACKER VOLUME 348. Protein Sensors and Reactive Oxygen Species (Part B: Thiol Enzymes and Proteins) Edited by HELMUT SIES AND LESTER PACKER VOLUME 349. Superoxide Dismutase Edited by LESTER PACKER VOLUME 350. Guide to Yeast Genetics and Molecular and Cell Biology (Part B) Edited by CHRISTINE GUTHRIE AND GERALD R. FINK VOLUME 351. Guide to Yeast Genetics and Molecular and Cell Biology (Part C) Edited by CHRISTINE GUTHRIE AND GERALD R. FINK VOLUME 352. Redox Cell Biology and Genetics (Part A) Edited by CHANDAN K. SEN AND LESTER PACKER VOLUME 353. Redox Cell Biology and Genetics (Part B) Edited by CHANDAN K. SEN AND LESTER PACKER VOLUME 354. Enzyme Kinetics and Mechanisms (Part F: Detection and Characterization of Enzyme Reaction Intermediates) Edited by DANIEL L. PURICH VOLUME 355. Cumulative Subject Index Volumes 321–354 VOLUME 356. Laser Capture Microscopy and Microdissection Edited by P. MICHAEL CONN VOLUME 357. Cytochrome P450, Part C Edited by ERIC F. JOHNSON AND MICHAEL R. WATERMAN VOLUME 358. Bacterial Pathogenesis (Part C: Identification, Regulation, and Function of Virulence Factors) Edited by VIRGINIA L. CLARK AND PATRIK M. BAVOIL VOLUME 359. Nitric Oxide (Part D) Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 360. Biophotonics (Part A) Edited by GERARD MARRIOTT AND IAN PARKER VOLUME 361. Biophotonics (Part B) Edited by GERARD MARRIOTT AND IAN PARKER VOLUME 362. Recognition of Carbohydrates in Biological Systems (Part A) Edited by YUAN C. LEE AND REIKO T. LEE
xlii
Methods in Enzymology
VOLUME 363. Recognition of Carbohydrates in Biological Systems (Part B) Edited by YUAN C. LEE AND REIKO T. LEE VOLUME 364. Nuclear Receptors Edited by DAVID W. RUSSELL AND DAVID J. MANGELSDORF VOLUME 365. Differentiation of Embryonic Stem Cells Edited by PAUL M. WASSAUMAN AND GORDON M. KELLER VOLUME 366. Protein Phosphatases Edited by SUSANNE KLUMPP AND JOSEF KRIEGLSTEIN VOLUME 367. Liposomes (Part A) Edited by NEJAT DU¨ZGU¨NES, VOLUME 368. Macromolecular Crystallography (Part C) Edited by CHARLES W. CARTER, JR., AND ROBERT M. SWEET VOLUME 369. Combinational Chemistry (Part B) Edited by GUILLERMO A. MORALES AND BARRY A. BUNIN VOLUME 370. RNA Polymerases and Associated Factors (Part C) Edited by SANKAR L. ADHYA AND SUSAN GARGES VOLUME 371. RNA Polymerases and Associated Factors (Part D) Edited by SANKAR L. ADHYA AND SUSAN GARGES VOLUME 372. Liposomes (Part B) Edited by NEJAT DU¨ZGU¨NES, VOLUME 373. Liposomes (Part C) Edited by NEJAT DU¨ZGU¨NES, VOLUME 374. Macromolecular Crystallography (Part D) Edited by CHARLES W. CARTER, JR., AND ROBERT W. SWEET VOLUME 375. Chromatin and Chromatin Remodeling Enzymes (Part A) Edited by C. DAVID ALLIS AND CARL WU VOLUME 376. Chromatin and Chromatin Remodeling Enzymes (Part B) Edited by C. DAVID ALLIS AND CARL WU VOLUME 377. Chromatin and Chromatin Remodeling Enzymes (Part C) Edited by C. DAVID ALLIS AND CARL WU VOLUME 378. Quinones and Quinone Enzymes (Part A) Edited by HELMUT SIES AND LESTER PACKER VOLUME 379. Energetics of Biological Macromolecules (Part D) Edited by JO M. HOLT, MICHAEL L. JOHNSON, AND GARY K. ACKERS VOLUME 380. Energetics of Biological Macromolecules (Part E) Edited by JO M. HOLT, MICHAEL L. JOHNSON, AND GARY K. ACKERS VOLUME 381. Oxygen Sensing Edited by CHANDAN K. SEN AND GREGG L. SEMENZA
Methods in Enzymology
xliii
VOLUME 382. Quinones and Quinone Enzymes (Part B) Edited by HELMUT SIES AND LESTER PACKER VOLUME 383. Numerical Computer Methods (Part D) Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 384. Numerical Computer Methods (Part E) Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON VOLUME 385. Imaging in Biological Research (Part A) Edited by P. MICHAEL CONN VOLUME 386. Imaging in Biological Research (Part B) Edited by P. MICHAEL CONN VOLUME 387. Liposomes (Part D) Edited by NEJAT DU¨ZGU¨NES, VOLUME 388. Protein Engineering Edited by DAN E. ROBERTSON AND JOSEPH P. NOEL VOLUME 389. Regulators of G-Protein Signaling (Part A) Edited by DAVID P. SIDEROVSKI VOLUME 390. Regulators of G-Protein Signaling (Part B) Edited by DAVID P. SIDEROVSKI VOLUME 391. Liposomes (Part E) Edited by NEJAT DU¨ZGU¨NES, VOLUME 392. RNA Interference Edited by ENGELKE ROSSI VOLUME 393. Circadian Rhythms Edited by MICHAEL W. YOUNG VOLUME 394. Nuclear Magnetic Resonance of Biological Macromolecules (Part C) Edited by THOMAS L. JAMES VOLUME 395. Producing the Biochemical Data (Part B) Edited by ELIZABETH A. ZIMMER AND ERIC H. ROALSON VOLUME 396. Nitric Oxide (Part E) Edited by LESTER PACKER AND ENRIQUE CADENAS VOLUME 397. Environmental Microbiology Edited by JARED R. LEADBETTER VOLUME 398. Ubiquitin and Protein Degradation (Part A) Edited by RAYMOND J. DESHAIES VOLUME 399. Ubiquitin and Protein Degradation (Part B) Edited by RAYMOND J. DESHAIES VOLUME 400. Phase II Conjugation Enzymes and Transport Systems Edited by HELMUT SIES AND LESTER PACKER
xliv
Methods in Enzymology
VOLUME 401. Glutathione Transferases and Gamma Glutamyl Transpeptidases Edited by HELMUT SIES AND LESTER PACKER VOLUME 402. Biological Mass Spectrometry Edited by A. L. BURLINGAME VOLUME 403. GTPases Regulating Membrane Targeting and Fusion Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 404. GTPases Regulating Membrane Dynamics Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 405. Mass Spectrometry: Modified Proteins and Glycoconjugates Edited by A. L. BURLINGAME VOLUME 406. Regulators and Effectors of Small GTPases: Rho Family Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 407. Regulators and Effectors of Small GTPases: Ras Family Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 408. DNA Repair (Part A) Edited by JUDITH L. CAMPBELL AND PAUL MODRICH VOLUME 409. DNA Repair (Part B) Edited by JUDITH L. CAMPBELL AND PAUL MODRICH VOLUME 410. DNA Microarrays (Part A: Array Platforms and Web-Bench Protocols) Edited by ALAN KIMMEL AND BRIAN OLIVER VOLUME 411. DNA Microarrays (Part B: Databases and Statistics) Edited by ALAN KIMMEL AND BRIAN OLIVER VOLUME 412. Amyloid, Prions, and Other Protein Aggregates (Part B) Edited by INDU KHETERPAL AND RONALD WETZEL VOLUME 413. Amyloid, Prions, and Other Protein Aggregates (Part C) Edited by INDU KHETERPAL AND RONALD WETZEL VOLUME 414. Measuring Biological Responses with Automated Microscopy Edited by JAMES INGLESE VOLUME 415. Glycobiology Edited by MINORU FUKUDA VOLUME 416. Glycomics Edited by MINORU FUKUDA VOLUME 417. Functional Glycomics Edited by MINORU FUKUDA VOLUME 418. Embryonic Stem Cells Edited by IRINA KLIMANSKAYA AND ROBERT LANZA
Methods in Enzymology
xlv
VOLUME 419. Adult Stem Cells Edited by IRINA KLIMANSKAYA AND ROBERT LANZA VOLUME 420. Stem Cell Tools and Other Experimental Protocols Edited by IRINA KLIMANSKAYA AND ROBERT LANZA VOLUME 421. Advanced Bacterial Genetics: Use of Transposons and Phage for Genomic Engineering Edited by KELLY T. HUGHES VOLUME 422. Two-Component Signaling Systems, Part A Edited by MELVIN I. SIMON, BRIAN R. CRANE, AND ALEXANDRINE CRANE VOLUME 423. Two-Component Signaling Systems, Part B Edited by MELVIN I. SIMON, BRIAN R. CRANE, AND ALEXANDRINE CRANE VOLUME 424. RNA Editing Edited by JONATHA M. GOTT VOLUME 425. RNA Modification Edited by JONATHA M. GOTT VOLUME 426. Integrins Edited by DAVID CHERESH VOLUME 427. MicroRNA Methods Edited by JOHN J. ROSSI VOLUME 428. Osmosensing and Osmosignaling Edited by HELMUT SIES AND DIETER HAUSSINGER VOLUME 429. Translation Initiation: Extract Systems and Molecular Genetics Edited by JON LORSCH VOLUME 430. Translation Initiation: Reconstituted Systems and Biophysical Methods Edited by JON LORSCH VOLUME 431. Translation Initiation: Cell Biology, High-Throughput and Chemical-Based Approaches Edited by JON LORSCH VOLUME 432. Lipidomics and Bioactive Lipids: Mass-Spectrometry–Based Lipid Analysis Edited by H. ALEX BROWN VOLUME 433. Lipidomics and Bioactive Lipids: Specialized Analytical Methods and Lipids in Disease Edited by H. ALEX BROWN VOLUME 434. Lipidomics and Bioactive Lipids: Lipids and Cell Signaling Edited by H. ALEX BROWN VOLUME 435. Oxygen Biology and Hypoxia Edited by HELMUT SIES AND BERNHARD BRU¨NE
xlvi
Methods in Enzymology
VOLUME 436. Globins and Other Nitric Oxide-Reactive Protiens (Part A) Edited by ROBERT K. POOLE VOLUME 437. Globins and Other Nitric Oxide-Reactive Protiens (Part B) Edited by ROBERT K. POOLE VOLUME 438. Small GTPases in Disease (Part A) Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 439. Small GTPases in Disease (Part B) Edited by WILLIAM E. BALCH, CHANNING J. DER, AND ALAN HALL VOLUME 440. Nitric Oxide, Part F Oxidative and Nitrosative Stress in Redox Regulation of Cell Signaling Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 441. Nitric Oxide, Part G Oxidative and Nitrosative Stress in Redox Regulation of Cell Signaling Edited by ENRIQUE CADENAS AND LESTER PACKER VOLUME 442. Programmed Cell Death, General Principles for Studying Cell Death (Part A) Edited by ROYA KHOSRAVI-FAR, ZAHRA ZAKERI, RICHARD A. LOCKSHIN, AND MAURO PIACENTINI VOLUME 443. Angiogenesis: In Vitro Systems Edited by DAVID A. CHERESH VOLUME 444. Angiogenesis: In Vivo Systems (Part A) Edited by DAVID A. CHERESH VOLUME 445. Angiogenesis: In Vivo Systems (Part B) Edited by DAVID A. CHERESH VOLUME 446. Programmed Cell Death, The Biology and Therapeutic Implications of Cell Death (Part B) Edited by ROYA KHOSRAVI-FAR, ZAHRA ZAKERI, RICHARD A. LOCKSHIN, AND MAURO PIACENTINI VOLUME 447. RNA Turnover in Bacteria, Archaea and Organelles Edited by LYNNE E. MAQUAT AND CECILIA M. ARRAIANO VOLUME 448. RNA Turnover in Eukaryotes: Nucleases, Pathways and Analysis of mRNA Decay Edited by LYNNE E. MAQUAT AND MEGERDITCH KILEDJIAN VOLUME 449. RNA Turnover in Eukaryotes: Analysis of Specialized and Quality Control RNA Decay Pathways Edited by LYNNE E. MAQUAT AND MEGERDITCH KILEDJIAN VOLUME 450. Fluorescence Spectroscopy Edited by LUDWIG BRAND AND MICHAEL L. JOHNSON
Methods in Enzymology
xlvii
VOLUME 451. Autophagy: Lower Eukaryotes and Non-Mammalian Systems (Part A) Edited by DANIEL J. KLIONSKY VOLUME 452. Autophagy in Mammalian Systems (Part B) Edited by DANIEL J. KLIONSKY VOLUME 453. Autophagy in Disease and Clinical Applications (Part C) Edited by DANIEL J. KLIONSKY VOLUME 454. Computer Methods (Part A) Edited by MICHAEL L. JOHNSON AND LUDWIG BRAND VOLUME 455. Biothermodynamics (Part A) Edited by MICHAEL L. JOHNSON, JO M. HOLT, AND GARY K. ACKERS (RETIRED) VOLUME 456. Mitochondrial Function, Part A: Mitochondrial Electron Transport Complexes and Reactive Oxygen Species Edited by WILLIAM S. ALLISON AND IMMO E. SCHEFFLER VOLUME 457. Mitochondrial Function, Part B: Mitochondrial Protein Kinases, Protein Phosphatases and Mitochondrial Diseases Edited by WILLIAM S. ALLISON AND ANNE N. MURPHY VOLUME 458. Complex Enzymes in Microbial Natural Product Biosynthesis, Part A: Overview Articles and Peptides Edited by DAVID A. HOPWOOD VOLUME 459. Complex Enzymes in Microbial Natural Product Biosynthesis, Part B: Polyketides, Aminocoumarins and Carbohydrates Edited by DAVID A. HOPWOOD
C H A P T E R
O N E
Introduction to Polyketide Biosynthesis Kira J. Weissman Contents 3 6 6 8 9 12 13 13
1. Introduction 1.1. Types of PKS 1.2. Type II PKS 1.3. Type III PKS 1.4. Type I PKS 1.5. Combinatorial biosynthesis: Prospects and progress Acknowledgment References
1. Introduction Even among natural product-derived medicines, the polyketides stand out. The fungal-derived statins (Fig. 1.1) are the most successful cardiovascular drugs of all time (Roberts, 1996; Shepherd, 2006). Erythromycin A, a macrolide antibacterial, has been in clinical usage for 53 years (Washington and Wilson, 1985), while its semisynthetic derivative azithromycin (Zithromax) is one of the best-selling antibiotics in the world. The enediynes, relative newcomers to the polyketide stage, are among the most powerful anticancer agents yet discovered (Galm et al., 2005). More than a third of natural product and natural product-derived compounds approved as drugs in the 2005–2007 period were polyketides, while a host of others are advancing through clinical trials (Butler, 2008). As testimony to their importance, annual sales of polyketide-derived medicines routinely top US$20 billion. The endless variety of polyketide shape and structure (Fig. 1.1) continues to fascinate synthetic and natural product chemists alike. While synthetic
Department of Pharmaceutical Biotechnology, Saarland University, Saarbru¨cken, Germany Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04601-1
#
2009 Elsevier Inc. All rights reserved.
3
HO
O
O
O
OH
HO
O O
Mycolic acid Cell membrane component
HO O H
O O
Lovastatin Cholesterol lowering agent
HO
OH OH
O
O
O
OMe OMe MeO OH H O N O
OMe
O
O
OH
OH O MeHN
Erythromycin A Antibiotic
O
HO
OH OMe
Neocarzinostatin Anti-cancer
OH
Pederin Anti-cancer
MeO OH
O
HO2C
HO
O
OH
O
O
O
O
O
OH
HO
OH
OH OH NH2
OH OH
O
H2N OH
O
OH
O
Orsellinic acid
O O
O
OAc Squalestatin S1 Cholesterol lowering agent
OH O O
COOH
O 6-Methyl salicylic acid Antibiotic
O
Doxorubicin Anti-cancer
OH
OH OH O
OH OH
Amphotericin B Anti-fungal
HO
OH
O OH
OH
O CO2H HO HO2C O
OH
O
O
OH
O
OH
Monensin A Antibiotic
O
O
H H O
HO2C
O
OMe
O
MeO O
O
NMe2
HO O
O HO
O
O
O O
O
O O
Maitotoxin Cytotoxin
O
O
OH
HO HOO COOH
HO OH
20:5n3 Eicosapentaenoic acid Membrane components
O O
OH OH
NaO SO 3 OH OH
O
O
OSO3Na HO HO
OH
O
O OH
OH
O OH
OH O
O O
O OH
O
OH O
OH
O
OH OH
HO
O OH
Figure 1.1 Structures of representative polyketides, including prominent bioactivities.
OH OH
Introduction to Polyketide Biosynthesis
5
chemists tackle the challenge of recreating the compounds in the laboratory, natural products researchers try to deduce how nature went about constructing the molecules. The smallest polyketides, such as triacetic acid lactone (TAL) and 6-methylsalicylic acid (6-MSA), incorporate a mere six to eight carbons, while the biggest, maitotoxin, weighs in at a staggering 3422 daltons, with 164 carbons in the chain; in fact, maitotoxin is the largest, and most toxic nonbiopolymer known (Murata et al., 1994). A considerable number of polyketides, including doxorubicin, are highly rigidified, multicyclic aromatic compounds, derived from simple polyketone chains by alternative modes of folding and ring formation. Others, like erythromycin A, are substantially reduced, and are instead constrained into an active conformation by intramolecular end-to-end cyclization. Some polyketides masquerade as simpler metabolites—for example, the straightchain polyunsaturated fatty acids (PUFAs) of deep-sea microbes. In contrast, the intricately folded polyethers like monensin are origami-like in their complexity. Most polyketides bristle with diverse functionalities, but a few, including the enediynes, are also notable for their high reactivity. The majority of polyketide skeletons are elaborated by post-assembly reactions, many of which are required for the biological activity of the products; oxygenative tailoring is most common, followed closely by group transfer reactions, such as glycosylation and acylation. By the late 1980s, it was evident that despite their vast structural heterogeneity, all polyketides are assembled by a process closely resembling that of fatty acid formation (covered in Chapter 17 of this volume). Simple carboxylic acid derivatives (e.g., acetyl-CoA, malonyl-CoA, and methylmalonyl-CoA) are concatenated into linear chains by iterative Claisen condensation, followed in some cases by reductive modification of the resulting b-ketone groups (Fig. 1.2). However, the biochemical basis for programming alternative modes of polyketide construction to yield polyketones, partially reduced polyketides or fully reduced fatty acids, remained obscure; no obvious mechanism was available to explain the choice or number of building blocks and the order in which they are incorporated, the extent of redox adjustment following each round of chain extension, and the pattern of cyclization or lactonization of the resulting chains. The answer to this conundrum has emerged over several decades through sequencing and biochemical studies of hundreds of genes encoding for polyketide synthases (PKSs) and associated decorating enzymes; conveniently, these biosynthetic genes are often clustered together within the genomes of the producing organisms. PKS machineries turn out to be as complicated and varied as the molecules they produce—indeed, 10 chapters in this volume alone are dedicated to describing different types of PKS. In general, as the biosynthetic apparatus increases in sophistication, so does the complexity of the product.
6
Kira J. Weissman
O ACP/ CoA
O
O
S
R
OH
Condensation
O ACP/ CoA
KR
O R
O
KS
KS
S
O
S
Reduction
O ACP
S
O
HO
n Polyketone (type II, type III, fungal NR)
O
OH R
DH Dehydration
O
ER
O
O
ACP
S
R
Reduction
O ACP
S
OH O
HO
O R
Reduced polyketide (modular type I (cis and trans), fungal PR and HR, PKSE)
R
HO
n Fatty acid (PUFA synthases)
Figure 1.2 Generic reaction scheme for biosynthesis of both fatty acids and polyketides, illustrating how the basic reaction cycle of fatty acid biosynthesis can be shunted to generate diverse polyketide structures, incorporating different levels of reduction. PKSs that practice each type of chemistry are indicated.
1.1. Types of PKS PKSs have been classified into three broad categories: type I and type II— reflecting their relationship to previously characterized enzymes of fatty acid biosynthesis—and type III (an example of each type is given in Fig. 1.3, and the characteristic features are summarized in Table 1.1). However, these distinctions are neither hard nor fast, as many PKSs exhibit hybrid behavior (Moss et al., 2004; Shen, 2003; Wenzel and Mu¨ller, 2005a). Type II and III PKSs both generate aromatic molecules, but use a fundamentally different approach to building a reactive polycarbonyl chain, and channeling it into a particular cyclic fate.
1.2. Type II PKS Type II PKSs are iteratively acting complexes of discrete proteins, each of which has one or more specific functions in the pathway (Hertweck et al., 2007 and references therein). Chain initiation (most often with acetate) and elongation with malonate are accomplished by the ‘‘minimal PKS’’ which consists of two ketosynthase-like condensing enzymes (KSa and KSb, only the first of which contributes the active site for condensation), and an acyl carrier protein (ACP), to which the growing chain is covalently tethered as a thioester. A malonyl-CoA:ACP transferase (MCAT) activity likely helps recruit the extender units from primary metabolism. Additional enzymatic subunits (ketoreductases [KR], cyclases [CYC], and aromatases [ARO]) cooperate with the minimal PKS to direct the folding pattern of the nascent polyketide chain. The polyphenolic products of the PKS are often
7
Introduction to Polyketide Biosynthesis
A Type I PKS (noniterative) Load AT
Module 1
ACP
KS
KR
AT
S
ACP
KS
AT
ACP
KS
AT
DH
KR
ACP
S
S O
Offload
Module 3
Module 2
TE
S
O
O
OH
O
O
R OH
O
R OH R Reduced polyketide
B Type II PKS (iterative) n times KSa
KSb
KSa
ACP x S
S O
KSb
ACP x
y
y
SH
S
O
O
O
O
R O
n
R Polyketone
C Type III PKS (iterative and ACP-independent) CoAS KS
O O
S O R
O
n times
CoAS O
KS SH
O
n
R Polyketone
Figure 1.3 Schematic of the three types of PKS. (A) Type I PKSs consist of multifunctional polypeptides. Each subunit contains one or more modules that incorporate a set of individually folded catalytic domains. Each module typically acts once (noniteratively) to accomplish one round of chain extension and associated reductive processing reactions. For each module, both the building block added and the functionality established by the reductive activities are indicated (by color-coded bold bonds, and shading, respectively). (B) Type II PKSs comprise discrete catalytic functions that associate into a productive complex. The ‘‘minimal PKS’’ includes the KSa, KSb, and ACP domains, which iterate through a defined number of chain-extension cycles to construct a polyketone chain. The exact stoichiometry of the KSa/KSb/ACP complex remains to be determined. (C) Type III PKSs consist of a single multifunctional active site that, in cooperation with CoA-bound substrates, performs all the steps necessary to assemble a polyketone chain of defined length.
8
Kira J. Weissman
Table 1.1 Characteristic features of type I, II, and III PKS Type of PKS
Mode operation
Mode of substrate activation
Typical product
I I II III
Modular Iterative Iterative Iterative
ACP ACP ACP CoA
Reduced Aromatic and reduced Aromatic Aromatic
extensively remodeled by oxygenases, and decorated by glycosyl- and N-, O-, and C-methyltransferases (Rix et al., 2002 and references therein). Despite these broad-brush functional assignments deduced from structural, genetic, and in vitro studies, the exact roles of many type II PKS components remain uncertain. In addition, there is likely to be a significant degree of functional interdependence, hindering efforts to analyze the enzymes in isolation. Another complicating factor is the high inherent reactivity of the intermediate poly-b-ketone chains, which often leads to spontaneous chemistry when a reconstituted PKS is incomplete. The latest test tubebased approaches to precisely define the function of type II PKS enzymes and modifying activities, and how these efforts are likely to inform strategies to reconfigure aromatic polyketide biosynthesis by genetic engineering are reviewed in Chapter 16 of this volume.
1.3. Type III PKS In contrast to the multienzyme organization of type II PKSs, enzymes from the type III PKS superfamily of plants, fungi, and bacteria (also known as chalcone and stilbene synthases) use a single KS-like active site to catalyze the repetitive condensation of acetate units to a CoA-derivatized starter molecule, typically yielding mono- and bi-cyclic aromatic products (Austin and Noel, 2003, and references therein). Chain extension is often followed by intramolecular condensation and aromatization of the linear intermediate, all within the same PKS active site cavity. This ‘‘u¨ber-adaptable’’ group of catalysts (Austin et al., 2008) generates high diversity by varying the choice of acyl-CoA starter unit, the number of elongation steps (1 to 8), and the mechanism of cyclization. Downstream enzymes cause additional pathway branching, variably transforming the initial scaffolds to produce a range of different compounds. The relative architectural simplicity of the type III systems has enabled the rapid development of a mechanistic framework for these enzymes, providing insight into the factors mediating starter unit selection, chain extension and the control of ring formation. Nonetheless, several fundamental questions remain, particularly concerning the fungal and bacterial variants, which should be the subject of future work in the field.
Introduction to Polyketide Biosynthesis
9
1.4. Type I PKS Type I PKSs have proven to be both the most complicated, and yet most versatile of the three classes of catalyst. The diagnostic feature of these systems is the presence of multiple active sites within each polypeptide. In the iterative subcategory of type I PKS, a single multienzyme is used repeatedly. Despite this mechanistic commonality, this machinery is employed to assemble very different types of metabolites in a variety of microorganisms. Fungi contain three categories of iterative type I PKSs, termed nonreducing (NR), partially reducing (PR) and highly reducing (HR), reflecting the increasing incorporation of ketoreductase (KR), dehydratase (DH), and methylase (MT) activities into the multienzymes (Cox, 2007, and references therein). Correspondingly, their products range from very simple (e.g., orsellinic acid) to the highly complex (e.g., squalestatin S1) (Fig. 1.1). The functions of all domains in the NR-type PKS have recently been determined (Crawford et al., 2008; Ma et al., 2006), but the mechanism of the PR and HR synthases remains poorly understood. Here, the central challenge is to elucidate the molecular basis for the sophisticated programming of the PKSs, which allows a different subset of the constituent active sites to operate in each round of chain extension. The latest methodologies for studying these complex enzyme systems, both in vitro and in vivo, and the new insights that are emerging are reported in Chapter 3 of this volume. Nature also exploits a type I iterative PKS to generate long-chain polyunsaturated fatty acids (PUFAs) in psychrophilic marine microbes. These C20þ metabolites are thought to adapt the biophysical properties of the microbial cell membrane to the frigidity of polar and deep-sea environments (Metz et al., 2001; Napier, 2002; Nichols et al., 1999; Wallis et al., 2002). PKS-based PUFA biosynthesis actually came as a surprise, because until 2001, it was believed to be the preserve of terrestrial eukaryotes. In this more conventional pathway, unsaturated fatty acids are derived by elongation and subsequent desaturation of a precursor saturated fatty acid (Kaulmann and Hertweck, 2002). The PUFA PKSs, of which there are several variants, are distinct in both organization and mechanism from the fungal iterative PKS enzymes, and notably contain as many as nine tandem ACP domains ( Jiang et al., 2008). The unexpected discovery of these catalysts, as well as ongoing efforts to unravel their unique mode of biosynthesis are discussed in Chapter 4 of this volume. Chapter 5 of this volume describes the identification and characterization of the third type of iterative type I PKS, the PKSE family (Van Lanen and Shen, 2008 and references therein). These PKSs participate in formation of the enediyne class of polyketides in bacteria, and show sequence homology to the PUFA synthases. The hallmark of the enediynes, such as neocarzinostatin (Fig. 1.1), is an unsaturated core structure (called the
10
Kira J. Weissman
enediyne ‘‘warhead’’), comprising two acetylenic groups conjugated to a double bond, all of which are housed within a 9- or 10-membered ring. Maturation of the core typically involves addition of further building blocks, including deoxy- and thio-sugars, which together fine-tune the biological activity. The precursor to the core, a polyene, is assembled by an iterative type I PKS, which contains familiar catalytic activities (KS, AT, KR, DH), but additionally, an ACP, which does not resemble other known carrier proteins, and which occupies an atypical position within the linear domain sequence. As with the fungal systems, the most significant issue concerns PKS programming, as the DH operates in all chain extension cycles except the final one. Some clusters also contain a member of a separate family of iterative type I PKS, which show organizational similarity to the PR systems of fungi. In contrast to the single-module architecture of the iterative PKS, the modular type I PKSs (usually) incorporate a distinct set or module of enzymatic domains for every catalytic cycle (Fischbach and Walsh, 2006; Staunton and Weissman, 2001, and references therein). This design strategy has resulted in some of the largest proteins in nature even though, in the vast majority of cases, the multiple modules in each system are distributed over several protein subunits. For example, MLSA1 from the mycolactone PKS, which contains eight linked modules, has a molecular mass of 1.8 MDa (Stinear et al., 2004). The modular architecture is inherently flexible, a feature that presumably justifies its high metabolic expense. Each module can be designed to select a particular building block (the biogenesis of unusual extender units is addressed in Chapter 7 of this volume) and to perform a defined extent of reductive modification, often with important stereochemical consequences. The overall number of chain extension reactions in the pathway can also be varied, as can the portfolio of post-PKS tailoring reactions. The products of modular PKSs are correspondingly diverse, although large macrocyclic lactones predominate among known structures. The prototypical modular PKS (called ‘‘DEBS’’) is responsible for biosynthesis of the macrolide erythromycin A in the soil bacterium Saccharopolyspora erythraea (Fig. 1.1). It was the first to be discovered (Corte´s et al., 1990; Donadio et al., 1991), and remains the most intensively studied, serving as the lens through which all other modular PKS are viewed (Khosla et al., 2007). Notably, there is a strict colinearity between the complement of (active) domains in the PKS and the required sequence of biosynthetic transformations, which immediately revealed the biosynthetic logic of these systems. As this ‘‘one enzyme, one function’’ organization evokes the Ford method of car manufacture, modular PKSs have been dubbed molecular ‘‘assembly lines.’’ Chapter 6 of this volume discusses the DEBS story, from the initial discovery of the gene cluster in the early 1990s to the latest insights obtained from combined genetic and molecular biological approaches.
Introduction to Polyketide Biosynthesis
11
In parallel, Chapter 8 in volume 458 explains how the correlation between gene sequence and product architecture has enabled the development of bioinformatics approaches to predicting polyketide structural elements from available gene sequences. Biosynthesis of the polyene antifungal drugs such as candicidin and amphotericin B (Fig. 1.1) closely resembles that of erythromycin A, although post-assembly line decoration is comparatively minimal. The defining feature of these macrolides is a chromophore formed by three to seven conjugated double bonds. Among the polyene clusters is the largest modular PKS yet discovered, with 122 domains spread over nine proteins, for a total molecular mass of 4.7 MDa (McAlpine et al., 2005). Studies to elucidate the pathways to these molecules are reviewed in Chapters 10 and 11 of this volume. Linear polyene intermediates are also the precursors for a distinct structural class of polyketides produced by modular PKS systems, the polycyclic polyethers such as monensin A (Fig. 1.1). Late-stage cyclization to form the characteristic five- and six-membered ether rings is accomplished by epoxidation, followed by a cascade of epoxide openings and ring closures. Insights into the detailed mechanisms of polyether formation have recently emerged through the cloning and sequencing of several gene clusters, including those for monensin (Leadlay et al., 2001), nigericin (Harvey et al., 2007), nanchangmycin (Sun et al., 2003), tetronomycin (Demydchuk et al., 2008), and lasalocid (Smith et al., 2008). Chapter 9 of this volume covers the latest advances in this rapidly moving area. As discussed in Chapter 12 of this volume, modular PKS machinery is also used to biosynthesize an array of exotic lipids in mycobacteria, including the dimycocerosate esters, mycolic acids (Fig. 1.1), sulfolipids and mannosyl-b-1-phosphomycoketides (Gokhale et al., 2007, and references therein). In each case, the PKS is charged with a long-chain fatty acid recruited from primary metabolism. One particularly notable system is PKS12, a polypeptide that contains two fused modules. This multienzyme self-associates five times through terminal docking domains (Broadhurst et al., 2003) to form a supramolecular complex, which then catalyzes a total of five rounds of chain extension (Chopra et al., 2008). Although monomodular PKS subunits from other systems have been shown to act repeatedly (Olano et al., 2003; He and Hertweck, 2003), this is the first example in which iterative action in a pathway is achieved through the presence of multiple copies of the same polypeptide. Remarkably, nature has fashioned a second class of modular PKS (the socalled ‘‘trans-AT’’ or ‘‘AT-less’’ PKS), an apparent example of convergent evolution (Nguyen et al., 2008). The hallmark of these systems is that one or more AT domains is supplied as a free-standing protein, instead of being integrated into each module (Piel, 2002; Cheng et al., 2003). In fact, AT-less PKS systems are formally hybrids of type I and type II architecture, as the trans-AT domains perform chain loading in iterative fashion. The resulting
12
Kira J. Weissman
structures are also often chimeric, as many synthases incorporate machinery for chain extension with amino acids (so-called ‘‘non-ribosomal peptide synthetases [NRPSs]’’). Although the PKS domains sometimes occur in the same order as their ‘‘cis’’ counterparts, a large number of trans-AT modules exhibit conspicuous variations in domain composition, stoichiometry, and arrangement. Nonetheless, the polyketide portions of the metabolites exhibit remarkable overall structure similarity to those arising from classical cis systems. One distinctive feature of many trans-AT-derived polyketides, however, is the introduction of methyl-, or alternatively, ethyl-branching functionality at initially formed b-centers, as in the symbiont metabolite pederin (Fig. 1.1). Chapter 8 of this volume describes some representative AT-less PKSs, and details biochemical protocols to characterize essential components of these systems.
1.5. Combinatorial biosynthesis: Prospects and progress Even before the advent of the genetics era in polyketide biosynthesis, a central goal of research was to generate large collections of structural variants for evaluation as lead compounds. The discovery of the modular architecture of type I PKS immediately suggested a new strategy for polyketide drug discovery, as an adjunct to total and semisynthesis: the ‘‘mixing and matching’’ of different PKS components both within and between different synthases by genetic engineering (Weissman and Leadlay, 2005). Over the last several decades, this so-called ‘‘combinatorial biosynthesis’’ has resulted in over 200 new polyketides, but key challenges remain before the technology can be made routine. Chapter 13 of this volume presents a ‘‘how-to’’ guide for PKS engineering, including the latest tips for carrying out domain swaps and gene inactivations. The authors also provide pointers on the complementary mutasynthetic approach, in which chemically synthesized precursors are introduced into a pathway by targeted inactivation of an essential, early-stage enzyme (Kennedy, 2008; Weissman, 2007; Weist and Su¨ssmuth, 2005). One very significant impediment to genetic engineering is the enormous size of the genes encoding for modular PKS enzymes. This problem is further compounded by the lack of tools for genetic manipulation in a large number of polyketide-producing strains. A proven solution is to reconstitute biosynthesis in genetically friendlier hosts by wholesale transfer of gene sets (Wenzel and Mu¨ller, 2005b; Zhang et al., 2008), an approach that is not limited to type I PKS gene clusters. This heterologous expression technology, with an emphasis on host selection, is discussed in detail in Chapter 15 of this volume. E. coli is among the favored alternative hosts, as expression in this strain opens up the possibility of using new recombinogenic methods to manipulate gene clusters (Zhang et al., 1998, and see Chapter 7 of volume 458). Alternatively, PKS genes can be synthesized
Introduction to Polyketide Biosynthesis
13
from scratch, and then introduced into a strain of choice. This strategy simultaneously enables optimization of codon usage for efficient protein expression, and the introduction of specific restriction sites for convenient domain or module exchange experiments. Such de novo synthesis of polyketide pathways, and its application to the erythromycin system, is covered in detail in Chapter 14 of this volume. It is also clear that our ability to productively reconfigure PKS enzymes is intimately tied to our understanding of their function, and therefore the structural biology of PKS systems has been a central focus of research. Chapter 2 reviews methodologies and progress in the structure elucidation by NMR and X-ray crystallography of components from both type I and type II PKS, and how these efforts have informed our models for interdomain interactions in these systems. The powerful, complementary approach of using synthetic small molecules as structural and mechanistic probes is covered in Chapter 9 of volume 458. Taken together, the chapters in this volume reveal how nature exploits a common biosynthetic concept and a limited pool of simple building blocks to generate a remarkable assortment of polyketide metabolites, from linear, fatty-acid like structures, to tightly coiled aromatic molecules. However, as the recent discovery of the PUFA synthases demonstrates, our knowledge of PKS-catalyzed chemistry and architecture is likely to be incomplete, at best. Undoubtedly, the explosive growth in microbial genome data, encompassing sequences from soil, marine and symbiont metagenomes (Daniel, 2004; Taylor et al., 2007), will continue to reveal unexpected applications of PKS machineries. The real challenge will be to integrate the emerging information into coherent models for PKS operation, and to use the new insights to more efficiently engineer PKS enzymes to create novel metabolites of clinical value.
ACKNOWLEDGMENT Jim Staunton is thanked for critical reading of this manuscript.
REFERENCES Austin, M. B., and Noel, J. P. (2003). The chalcone synthase superfamily of type III polyketide synthases. Nat. Prod. Rep. 20, 79–110. Austin, M. B., O’Maille, P. E., and Noel, J. P. (2008). Evolving biosynthetic tangos negotiate mechanistic landscapes. Nat. Chem. Biol. 4, 217–222. Broadhurst, R. W., Nietlispach, D., Wheatcroft, M. P., Leadlay, P. F., and Weissman, K. J. (2003). The structure of docking domains in modular polyketide synthases. Chem. Biol. 10, 723–731. Butler, M. S. (2008). Natural products to drugs: Natural product-derived compounds in clinical trials. Nat. Prod. Rep. 25, 475–516. (http://bulletin.sciencebusiness.net/ebulletins/ showissue.php3?page¼/548/2050/6383).
14
Kira J. Weissman
Cheng, Y. Q., Tang, G. L., and Shen, B. (2003). Type I polyketide synthase requiring a discrete acyltransferase for polyketide biosynthesis. Proc. Natl. Acad. Sci. USA 100, 3149–3154. Chopra, T., Banerjee, S., Gupta, S., Yadav, G., Anand, S., Surolia, A., Roy, R. P., Mohanty, D., and Gokhale, R. S. (2008). Novel intermolecular iterative mechanism for biosynthesis of mycoketide synthase by a bimodular polyketide synthase. PLoS Biol. 6, 1584–1598. Corte´s, J., Haydock, S. F., Roberts, G. A., Bevitt, D. J., and Leadlay, P. F. (1990). An unusually large multifunctional polypeptide in the erythromycin-producing polyketide synthase of Saccharopolyspora erythraea. Nature 348, 176–178. Cox, R. J. (2007). Polyketides, proteins and genes in fungi: Programmed nano-machines begin to reveal their secrets. Org. Biomol. Chem. 5, 2010–2026. Crawford, J. M., Thomas, P. M., Scheerer, J. R., Vagstad, A. L., Kelleher, N. L., and Townsend, C. A. (2008). Deconstruction of iterative multidomain polyketide synthase function. Science 320, 243–246. Daniel, R. (2004). The soil metagenome—a rich resource for the discovery of novel natural products. Curr. Opin. Biotechnol. 15, 199–204. Demydchuk, Y., Sun, Y. H., Hong, H., Staunton, J., Spencer, J. B., and Leadlay, P. F. (2008). Analysis of the tetronomycin gene cluster: Insights into the biosynthesis of a polyether tetronate antibiotic. ChemBioChem 9, 1136–1145. Donadio, S., Staver, M. J., McAlpine, J. B., Swanson, S. J., and Katz, L. (1991). Modular organization of genes required for complex polyketide biosynthesis. Science 252, 675–679. Fischbach, M. A., and Walsh, C. T. (2006). Assembly-line enzymology for polyketide and nonribosomal peptide antibiotics: Logic, machinery, and mechanisms. Chem. Rev. 106, 3468–3496. Galm, U., Hager, M. H., Van Lanen, S. G., Ju, J., Thorson, J. S., and Shen, B. (2005). Antitumor antibiotics: Bleomycin, enediynes, and mitomycin. Chem. Rev. 105, 739–758. Gokhale, R. S., Saxena, P., Chopra, T., and Mohanty, D. (2007). Versatile polyketide enzymatic machinery for the biosynthesis of complex mycobacterial lipids. Nat. Prod. Rep. 24, 267–277. Harvey, B. M., Mironenko, T., Sun, Y. H., Hong, H., Deng, Z. X., Leadlay, P. F., Weissman, K. J., and Haydock, S. F. (2007). Insights into polyether biosynthesis from analysis of the nigericin biosynthetic gene cluster in Streptomyces sp DSM4137. Chem. Biol. 14, 703–714. He, J., and Hertweck, C. (2003). Iteration as programmed event during polyketide assembly; Molecular analysis of the aureothin biosynthesis gene cluster. Chem. Biol. 10, 1225–1232. Hertweck, C., Luzhetskyy, A., Rebets, Y., and Bechthold, A. (2007). Type II polyketide synthases: Gaining a deeper insight into enzymatic teamwork. Nat. Prod. Rep. 24, 162–190. Jiang, H., Zirkle, R., Metz, J. G., Braun, L., Richter, L., Van Lanen, S. G., and Shen, B. (2008). The role of tandem acyl carrier protein domains in polyunsaturated fatty acid biosynthesis. J. Am. Chem. Soc. 130, 6336–6337. Kaulmann, U., and Hertweck, C. (2002). Biosynthesis of polyunsaturated fatty acids by polyketide synthases. Angew. Chem. Int. Ed. 41, 1866–1869. Kennedy, J. (2008). Mutasynthesis, chemobiosynthesis, and back to semi-synthesis: Combining synthetic chemistry and biosynthetic engineering for diversifying natural products. Nat. Prod. Rep. 25, 25–34. Khosla, C., Tang, Y., Chen, A. Y., Schnarr, N. A., and Cane, D. E. (2007). Structure and mechanism of the 6-deoxyerythronolide B synthase. Annu. Rev. Biochem. 76, 195–221. Leadlay, P. F., Staunton, J., Oliynyk, M., Bisang, C., Corte´s, J., Frost, E., HughesThomas, Z. A., Jones, M. A., Kendrew, S. G., Lester, J. B., Long, P. F., McArthur, H. A., et al. (2001). Engineering of complex polyketide biosynthesis—insights
Introduction to Polyketide Biosynthesis
15
from sequencing of the monensin biosynthetic gene cluster. J. Ind. Microbiol. Biotechnol. 27, 360–367. Ma, Y., Smith, L. H., Cox, R. J., Beltran-Alvarez, P., Arthur, C. J., and Simpson, T. J. (2006). Catalytic relationships between type I and type II iterative polyketide synthases: The Aspergillus parasiticus norsolorinic acid synthase. ChemBioChem 7, 1951–1958. McAlpine, J. B., Bachmann, B. O., Piraee, M., Tremblay, S., Alarco, A. M., Zazopoulos, E., and Farnet, C. M. (2005). Microbial genomics as a guide to drug discovery and structural elucidation: ECO-02301, a novel antifungal agent, as an example. J. Nat. Prod. 68, 493–496. Metz, J. G., Roessler, P., Facciotti, D., Levering, C., Dittrich, F., Lassner, M., Valentine, R., Lardizabal, K., Domergue, F., Yamada, A., Yazawa, K., Knauf, V., et al. (2001). Production of polyunsaturated fatty acids by polyketide synthases in both prokaryotes and eukaryotes. Science 293, 290–293. Moss, S. J., Martin, C. J., and Wilkinson, B. (2004). Loss of co-linearity by modular polyketide synthases: A mechanism for the evolution of chemical diversity. Nat. Prod. Rep. 21, 575–593. Murata, M., Naoki, H., Matsunaga, S., Satake, M., and Yasumoto, T. (1994). Structure and partial stereochemical assignments for maitotoxin, the most toxic and largest natural non-biopolymer. J. Am. Chem. Soc. 116, 7098–7107. Napier, J. A. (2002). Plumbing the depths of PUFA biosynthesis: A novel polyketide synthase-like pathway from marine organisms. Trends Plant Sci. 7, 51–54. Nguyen, T., Ishida, K., Jenke-Kodama, H., Dittmann, E., Gurgui, C., Hochmuth, T., Taudien, S., Platzer, M., Hertweck, C., and Piel, J. (2008). Exploiting the mosaic structure of trans-acyltransferase polyketide synthases for natural product discovery and pathway dissection. Nat. Biotechnol. 26, 225–233. Nichols, D., Bowman, J., Sanderson, K., Nichols, C. M., Lewis, T., McMeekin, T., and Nichols, P. D. (1999). Developments with antarctic microorganisms: Culture collections, bioactivity screening, taxonomy, PUFA production and cold-adapted enzymes. Curr. Opin. Biotechnol. 10, 240–246. Olano, C., Wilkinson, B., Moss, S. J., Bran˜a, A. F., Me´ndez, C., Leadlay, P. F., and Salas, J. A. (2003). Evidence from engineered gene fusions for the repeated use of a module in a modular polyketide synthase. Chem. Commun. 2780–2782. Piel, J. (2002). A polyketide synthase-peptide synthetase gene cluster from an uncultured bacterial symbiont of Paederus beetles. Proc. Natl. Acad. Sci. USA 99, 14002–14007. Rix, U., Fischer, C., Remsing, L. L., and Rohr, J. (2002). Modification of post-PKS tailoring steps through combinatorial biosynthesis. Nat. Prod. Rep. 19, 542–580. Roberts, W. C. (1996). The underused miracle drugs: The statin drugs are to atherosclerosis what penicillin was to infectious disease. Am. J. Cardiol. 78, 377–378. Shen, B. (2003). Polyketide biosynthesis beyond the type I, II and III polyketide synthase paradigms. Curr. Opin. Chem. Biol. 7, 285–295. Shepherd, J. (2006). Who should receive a statin these days? Lessons from recent clinical trials. J. Intern. Med. 260, 305–319. Smith, L., Hong, H., Spencer, J. B., and Leadlay, P. F. (2008). Analysis of specific mutants in the lasalocid gene cluster: Evidence for enzymatic catalysis of a disfavoured polyether ring closure. ChemBioChem 9, 2967–2975. Staunton, J., and Weissman, K. J. (2001). Polyketide biosynthesis: A millennium review. Nat. Prod. Rep. 18, 380–416. Stinear, T. P., Mve-Obiang, A., Small, P. L., Frigui, W., Pryor, M. J., Brosch, R., Jenkin, G. A., Johnson, P. D., Davies, J. K., Lee, R. E., Adusumilli, S., Garnier, T., et al. (2004). Giant plasmid-encoded polyketide synthases produce the macrolide toxin of Mycobacterium ulcerans. Proc. Natl. Acad. Sci. USA 101, 1345–1349.
16
Kira J. Weissman
Sun, Y., Zhou, X., Dong, H., Tu, G., Wang, M., Wang, B., and Deng, Z. (2003). A complete gene cluster from Streptomyces nanchangensis NS3226 encoding biosynthesis of the polyether ionophore nanchangmycin. Chem. Biol. 10, 431–441. Taylor, M. W., Radax, R., Steger, D., and Wagner, M. (2007). Sponge-associated microorganisms: Evolution, ecology, and biotechnological potential. Microbiol. Mol. Biol. Rev. 71, 295–347. Van Lanen, S. G., and Shen, B. (2008). Biosynthesis of enediyne antitumor antibiotics. Curr. Top. Med. Chem. 8, 448–459. Wallis, J. G., Watts, J. L., and Browse, J. (2002). Polyunsaturated fatty acid synthesis: What will they think of next? Trends Biochem. Sci. 27, 467–473. Washington, J. A., and Wilson, W. R. (1985). Erythromycin: A microbial and clinical perspective after 30 years of clinical use (1). Mayo Clin. Proc. 60, 189–203. (http://www. emedexpert.com/facts/azithromycin-facts.shtml; http://www.wipo.int/sme/en/case_ studies/pliva.htm). Weissman, K. J. (2007). Mutasynthesis—uniting chemistry and genetics for drug discovery. Trends Biotechnol. 25, 139–142. Weissman, K. J., and Leadlay, P. F. (2005). Combinatorial biosynthesis of reduced polyketides. Nat. Rev. Microbiol. 3, 925–936. Weist, S., and Su¨ssmuth, R. D. (2005). Mutational biosynthesis—a tool for the generation of structural diversity in the biosynthesis of antibiotics. Appl. Microbiol. Biotechnol. 68, 141–150. Wenzel, S. C., and Mu¨ller, R. (2005a). Formation of novel secondary metabolites by bacterial multimodular assembly lines: Deviations from text book biosynthetic logic. Curr. Opin. Chem. Biol. 9, 447–458. Wenzel, S. C., and Mu¨ller, R. (2005b). Recent developments towards the heterologous expression of complex bacterial natural product biosynthetic pathways. Curr. Opin. Biotechnol. 16, 594–606. Zhang, H. R., Wang, Y., and Pfeifer, B. A. (2008). Bacterial hosts for natural product production. Mol. Pharm. 5, 212–225. Zhang, Y., Buchholz, F., Muyrers, J. P., and Stewart, F. A. (1998). A new logic for DNA engineering using recombination in Escherichia coli. Nat. Genet. 20, 123–128.
C H A P T E R
T W O
Structural Enzymology of Polyketide Synthases Shiou-Chuan (Sheryl) Tsai* and Brian Douglas Ames† Contents 18 19 21 22 22 24 27 30 32 36 37 39 40 40
1. 2. 3. 4.
Introduction Fatty Acid Synthase Different Types of PKS and a Summary of Structural Work Structural Enzymology of Individual Domains 4.1. The acyltransferase 4.2. The ketosynthase 4.3. The ketoreductase 4.4. The dehydratase of modular type I PKS 4.5. The aromatase/cyclase (ARO/CYC) of type II PKS 4.6. Acyl carrier protein 4.7. Thioesterase 5. Summary and Future Prospects Acknowledgments References
Abstract This chapter describes structural and associated enzymological studies of polyketide synthases, including isolated single domains and multidomain fragments. The sequence–structure–function relationship of polyketide biosynthesis, compared with homologous fatty acid synthesis, is discussed in detail. Structural enzymology sheds light on sequence and structural motifs that are important for the precise timing, substrate recognition, enzyme catalysis, and protein–protein interactions leading to the extraordinary structural diversity of naturally occurring polyketides.
* {
Department of Molecular Biology and Biochemistry, Department of Chemistry, Department of Pharmaceutical Sciences, University of California, Irvine, California, USA Department of Molecular Biology and Biochemistry, Department of Chemistry, University of California, Irvine, California, USA
Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04602-3
#
2009 Elsevier Inc. All rights reserved.
17
18
Shiou-Chuan (Sheryl) Tsai and Brian Douglas Ames
1. Introduction The past decade has witnessed significant advances in PKS structural biology for different types of PKSs that help visualize polyketide biosynthesis at all stages, including chain initiation, elongation, reduction, cyclization, and chain termination. Using x-ray crystallography or NMR, these studies help correlate PKS three-dimensional structures with substrate specificity and also help in elucidating the sequence–function–structure relationships that predict product outcome. With the recent publication of the striking porcine FAS crystal structure, we summarize advances in PKS structural biology during the past decade, and compare different types of FASs and PKSs, as well as their individual enzyme domains. The major methods used to determine PKS protein structures are NMR and x-ray crystallography. With the current advances in NMR instrumentation, software, and pulse sequence development, the upper limit of protein molecular weight for a given target can be as high as 80 kDa (Redfield, 2004; Zeeb and Balbach, 2004). Various pulse sequences offer a further powerful probe for protein conformational change, as well as residues that are important for protein–protein interaction and protein-ligand binding (Redfield, 2004; Zeeb and Balbach, 2004). The application of these NMR methodologies to PKS enzymology is presented in section 4 on the structure of the acyl-carrier protein (ACP). The general methodology for x-ray crystallography includes protein expression/purification, crystallization, crystal harvesting, x-ray diffraction, data processing, structure solution, model refinement and model validation. While mammalian fatty acid synthase (FAS) architecture can be visualized by electron microscopy (EM) (Asturias et al., 2005), PKS flexibility has resulted in highly variable conformations as detected by electron microscopy (Grant Jensen, personal communication), and such flexibility may also contribute to the relative difficulty in obtaining PKS megasynthase crystals (as compared to crystallizing the mammalian FASs). Nevertheless, the majority of single and didomain PKS fragments can be cloned into standard expression vectors (such as pET vectors), expressed in large quantity (up to 200 mg/l culture), and purified to more than 95% purity using Ni-affinity chromatography. The pure single and didomain PKS fragments can then be crystallized using standard vapor diffusion methods (Derewenda, 2004; McPherson, 2004; Rupp and Wang, 2004), followed by crystal harvest in cryoprotectant and cooling in liquid nitrogen (Pflugrath, 2004). Robotic automation of crystallization has greatly accelerated the discovery of initial crystal leads (Bard et al., 2004). Due to the high structural homology to FAS domains, many PKS domains have been solved by molecular replacement, using programs such as CNS (Brunger et al., 1998) or the CCP4 suite (Xx, 1994), although heavyatom methods are also applied using programs such as SOLVE (Terwilliger, 2004). Protein models are then built and refined by programs such as Coot
Structural Enzymology of Polyketide Synthases
19
(Emsley and Cowtan, 2004), further refined by programs such as CNS (Brunger et al., 1998) or the CCP4 suite (Xx, 1994), and verified by programs such as PROCHECK (Laskowski et al., 1993). As discussed in detail in Section 4, the conformational flexibility of many PKS domains renders the binding of enzyme inhibitors or substrates very useful to stabilize protein conformation for crystallization and improve diffraction data quality. However, the reactivity of these PKS enzyme domains sometimes also results in difficulty in the detection of substrate electron density maps. The above issues in the methodology of PKS structural enzymology, as well as the application and subsequent outcome of these methodologies, are discussed in details in Sections 3 and 4.
2. Fatty Acid Synthase The fatty acid synthase (FAS) is a multidomain protein complex (Maier et al., 2006) consisting of seven conserved protein domains (MAT, KS, KR, DH, ER, ACP and TE) that catalyze more than 50 reactions en route to the final fatty acid product. FASs can be classified as type I or type II (Fig. 2.1A). The crystal structures of all type II FAS domains have been solved, including the type II KS, MAT, KR, ER, DH, ACP, and TE domains (Leesong et al., 1996; Olsen et al., 1999; Price et al., 2001; Serre et al., 1995), and White et al. have provided an excellent review of type II FAS structural biology (White et al., 2005). The crystal structure of a type I FAS TE domain, as well as the NMR structure of a type I FAS ACP domain, have also been reported (Chakravarty et al., 2004) and reviewed (Smith and Tsai, 2007). The recently ˚ , has greatly published full-length mammalian type I FAS, solved to 3.2 A expanded our knowledge about the complicated domain–domain interactions in the megasynthase (Maier et al., 2008) (Fig. 2.1B, C), showing a homodimer that confirms the head-to-head model based on electron microscopy (Asturias et al., 2005) and biochemical results ( Joshi et al., 1997, 1998). The porcine FAS is separated into two portions: the lower condensing portion which contains the KS and MAT domains, and the upper chain-modifying portion which contains the DH, ER, and KR domains (Fig. 2.1B, C). Two additional nonenzymatic domains, termed cMe (an inactive methyltransferase) and cKR (a truncated KR), lie at the periphery of the upper portion (Fig. 2.1B, C).The central core of the X-shape architecture of type I FAS consists of KS, DH, and ER domains from both monomers, with an extensive dimer interface between KS, DH, and ER domains. The dimer is held together by KS–KS, DH–DH and KS–DH interactions. The head-to-head arrangement also implies that the ACP in either monomer (A or B) can interact with active sites of both monomers, consistent with previous biochemical studies ( Joshi et al., 1997; Witkowski et al., 2004). The DH–KS interaction connects the top and bottom of the
A Type I FAS
NH+3
Type II FAS
AT
KS
DH
AT
KS
ER
DH
ER
KR
KR
TE
ACP
ACP
COO−
TE
ER
B ER⬘
KR
KR⬘
ΨKR
ΨKR⬘
C ER KR
DH1
DH⬘ ΨME⬘
ACP anchor
Central connection
ΨKR
DH2
DH Mo
dif
Con
yin
g
ΨME
ΨME ACP
den
sing
TE C
KS LD
LD⬘ KS⬘ KS MAT⬘
LD MAT
N
MAT
˚ Figure 2.1 (A) Domain organization of type I and type II FAS. (B) Cartoon ribbon representation and (C) domain illustration of the 3.2-A porcine type I FAS structure.
Structural Enzymology of Polyketide Synthases
21
X-shaped architecture, and strongly suggests that the DH fold is important in maintaining FAS architecture. The AT and KR domains extend from the bottom and top of the protein, respectively, to form two asymmetric reaction chambers, one on either side of the central KS–DH–ER core. The flexible linker regions between KS–AT, AT–DH, DH–ER and ER–KR (Fig. 2.1C) facilitate the opening and closing of each reaction chamber, thus allowing the ACP-bound fatty acyl intermediate access to the active-site of each domain. Although there is no solid proof, the type II FAS is proposed to adopt a similar X-shaped architecture (Smith and Tsai, 2007) due to the high degree of conservation between type I and II FAS domains.
3. Different Types of PKS and a Summary of Structural Work Based on domain architecture, there are at least four distinct PKS types: modular type I, iterative type I, type II, and type III PKSs (Shen, 2003). Extensive progress has been made on the structural biology of DEBS (the erythromycin PKS) (Khosla et al., 2007), including crystal structures of KS3–AT3 (Tang et al., 2007), KS5–AT5 (Tang et al., 2006), KR1 (Keatinge-Clay and Stroud, 2006), DH4 (Keatinge-Clay, 2008), and TE (Tsai et al., 2001), and an NMR structure of ACP2 (Alekseyev et al., 2007) (the number following the domain name abbreviation indicates the module number), as well as KR1 of the tylosin PKS (Keatinge-Clay, 2007) and the TE domain from the pikromycin PKS (PIKS) (Akey et al., 2006; Giraldes et al., 2006; Pan et al., 2002; Tsai et al., 2002). An NMR structure of the intermodular linker region in DEBS has also been reported (Weissman, 2006). For the type II PKS, extensive progress has been made on the structural biology of Streptomyces coelicolor MAT (Keatinge-Clay et al., 2003), actinorhodin (act) KS/CLF (Keatinge-Clay et al., 2004), act KR (Hadfield et al., 2004; Korman et al., 2004, 2008), the R1128 priming ketosynthase ZhuH (Pan, et al., 2002; Witkowski et al., 2004), and the NMR structure of holo and apo act ACP (Crump et al., 1997; Evans et al., 2008), frenolicin ( fren) ACP (Li et al., 2003), and oxytetracycline (otc) ACP (Findlow et al., 2003). The crystal structures of the tetracenomycin (tcm) ARO/CYC, the whiE ARO/CYC, and the ZhuI ARO/CYC have been solved (Ames et al., 2008). Three fourth-ring cyclase structures have also been reported that are not included in this chapter (Kallio et al., 2006; Sultana et al., 2004; Thompson et al., 2004). For iterative type I PKSs, the unpublished crystal structures of the PksA PT and TE domains are discussed briefly. The linker regions in type I PKSs have been reviewed elsewhere (Smith and Tsai, 2007; Weissman, 2006).
22
Shiou-Chuan (Sheryl) Tsai and Brian Douglas Ames
4. Structural Enzymology of Individual Domains 4.1. The acyltransferase The crystal structures of DEBS AT3 and AT5, S. coelicolor MAT, E. coli MAT (FabD) and the porcine FAS AT domain have been reported (Keatinge-Clay et al., 2003; Serre et al., 1995; Tang et al., 2006, 2007). All ˚ . The AT five structures are highly similar, with an RMSD of 1.3 to 1.9 A structure has two domains: the larger core subdomain is similar to an a/bhydrolase fold, with a parallel b-sheet flanked on two sides by a-helices (Fig. 2.2A in grey); the smaller subdomain, an insertion typically between residues 130 to 200, has a ferredoxin fold that consists of a four-stranded antiparallel b-sheet capped by two helices (Fig. 2.2A in black). The active site lies in a cleft formed between the two subdomains. Protein–protein docking simulations were conducted using the DEBS AT3 and ACP3 homology models (Tang et al., 2007), although no apparent solution was obtained. The most important structural difference between the type I modular PKS AT domains and other MAT domains is that DEBS AT3 and AT5 have a much longer C-terminal helix (residues 857 to 867), presumably important for protein–protein interactions between AT and the KS-AT linker (Tang et al., 2006, 2007). Based on enzymological studies of the type II FAS MAT domain, a ping-pong bi bi mechanism is proposed for both type I and type II ATs of FAS and PKS that involves the active site Ser and His (Fig. 2.2B) (Ruch and Vagelos, 1973), while the 3-carboxylate of malonyl- or methylmalonyl-CoA can form charge–charge interactions with the side-chain of a highly conserved Arg (Keatinge-Clay et al., 2003; Rangan and Smith, 1997; Serre et al., 1995). In the S. coelicolor MAT structure, the backbone amides of Gln9 and Val98 were identified as the oxyanion hole (Keatinge-Clay et al., 2003). Remarkably, for both type I and type II AT domains, the acyl-enzyme complex is stable enough for detection (Dreier et al., 2001; Lau et al., 2000; Liou et al., 2003; Szafranska et al., 2002). The deacylation of acyl-enzyme occurs only in the presence of specific thiol nucleophiles such as phosphopantetheinylated ACP. This is a unique behavior among structurally related enzymes with an a/b hydrolase fold (Serre et al., 1995). In addition, based on the crystal structures of all five AT domains, the hydrophobic nature of the substrate-binding pocket should presumably discourage water binding in the cleft. For type I modular PKSs, the loading AT domain is promiscuous and can accept acetyl-, propionyl-, isopropionyl-, isobutyryl-, crotonyl-, phenylacetyl-, hydroxybutyryl-, and isopentyl-CoA both in vivo and in vitro (Del Vecchio et al., 2003; Hong et al., 2005; Lau et al., 1999, 2000; Liou and Khosla, 2003; Liou et al., 2003). On the other hand, the AT domains in the extender
23
Structural Enzymology of Polyketide Synthases
A 1 A 4
3
2
B B
His
H N N HO
His R O S
His
His
O Ser
H N
His O
Ser
O
NH R
O− NH Oxyanion S CoA
NH R ACP-SH
H N
NH R NH Oxyanion
CoA
Ser
H N
NH Oxyanion R = rest of acyl chain
O
CoA
O Ser
H N NH O Ser
R R
O− NH Oxyanion S ACP
O S ACP
Figure 2.2 (A) Overall fold of the AT domain (large domain in grey, small domain in black), and the four substrate motifs (see text for details) in red, green, purple, and blue, respectively. (B) Proposed mechanism for the AT domain.
modules (such as DEBS modules 1 to 6) are highly specific toward (2S)-methylmalonyl-CoA and the (2S)-methylmalonyl thioester of N-acetylcysteamine (NAC) (Lau et al., 1999; Liou and Khosla, 2003; Marsden et al., 1994). Therefore, the extending AT in DEBS serves as an important gatekeeper in macrolide biosynthesis (Khosla et al., 1999). Past biochemical and structural work identified four motifs to explain the observed AT specificity (Fig. 2.2A): (1) the ‘‘RVDVVQ’’ motif lies 30 residues upstream of the active-site Ser (Haydock et al., 1995; Yadav et al., 2003); (2) the GHSXG motif around the catalytic Ser (Haydock et al., 1995; Yadav et al., 2003); (3) the YASH motif 100 residues downstream of the active-site Ser (Haydock et al., 1995; Reeves et al., 2001), which based on a
24
Shiou-Chuan (Sheryl) Tsai and Brian Douglas Ames
systematic mutational analysis of DEBS AT domains is the dominant substrate specificity motif in type I modular PKSs among motifs 1, 2, and 3 (Reeves et al., 2001); and (4) the C-terminal region shown to be important for substrate specificity from domain swapping experiments (Lau et al., 1999). A detailed review of the above four motifs can be found in reference (Smith and Tsai, 2007). The recent 3.2-A˚ porcine FAS structure further demonstrates that F682 (part of Motif 1) and F553 (part of Motif 3) form a hydrophobic cavity, which may allow M499 to flip in and out to accommodate both methylmalonyl and malonyl moieties. In conclusion, the specificity between malonyl- versus methylmalonyl-CoA (or methylmalonyl- vs. propionyl-CoA) is likely to be a combinatorial result of different structural elements that interact throughout the entire protein fold, rather than an influence of a limited number of residues.
4.2. The ketosynthase The crystal structures of DEBS ketosynthase (KS) 3 (Tang et al., 2007) and KS5 (Tang et al., 2006), the actinorhodin KS/CLF (act KS/CLF) (Keatinge-Clay et al., 2004) and the R1128 priming KS (ZhuH) (Pan et al., 2002) will be compared with those of the type III PKS (Austin and Noel, 2003), type I (the porcine FAS) (Maier et al., 2008), and type II (the E. coli FabH, FabB, and FabF) KS domains (Olsen et al., 1999; Price et al., 2003; Qiu et al., 2005). All KS crystal structures from FASs and PKSs reveal a highly similar thiolase fold (Austin and Noel, 2003), consisting of two copies of a-b-a-b-a folds that form a five-layered core (2a-5b-2a-5b-2a): three layers of a-helices interspersed by two layers of b-sheet, with extensive connecting loops. A pseudotwofold axis lies between Na3 and Ca3 parallel to the dimer axis. The KSs can be divided into three subfamilies: (1) KAS I and II, including FabB, FabF, DEBS KS3 and KS5, the porcine FAS KS domain, and the act KS/CLF (Keatinge-Clay et al., 2004; Maier et al., 2008; Olsen et al., 1999; Price et al., 2003; Tang et al., 2006, 2007); (2) KAS III and the CHS-like type III PKS enzymes, including the priming KS ZhuH (Pan et al., 2002) from the R1128 PKS; (3) the biosynthetic and degradative thiolases. All three subfamilies conserve the core structural features, the extensive dimer interface, and the location of the active-site residues. There is also absolute conservation of the active-site Cys for covalent attachment of substrates and intermediates. However, there are major structural differences among the three subfamilies, mainly concerning the extent and structure of the loops on the opposite side of the substrate-binding pocket. These loops affect the position and identity of key catalytic residues (except the universally conserved Cys) as well as the different substrate chain-length specificities for CoA-linked or ACP-linked thioesters (Austin and Noel, 2003). The KSs are dimers with an extensive dimer interface stabilized by a pair of hydrogen-bonded, antiparallel b-strands, which creates a 14-stranded b-sheet spanning both monomers. In the DEBS KS5 structure, there is a long helix at the N-terminal that may facilitate KS
Structural Enzymology of Polyketide Synthases
25
dimerization and serve as a docking point for the upstream C-terminal docking domain of the previous module 4 (Tang et al., 2006). In the type I FAS and PKS, KS deletion experiments show that the dimeric nature of the KS domains is key in facilitating dimerization of the entire megasynthase (Witkowski et al., 2004). Similarly to the well-studied FabB and FabF KSs of E. coli, the extending KSs, including DEBS KS3 and KS5 and act KS/CLF, employ a Cys-His-His triad at the active center. The active-site triad and oxyanion hole of DEBS KS3 and KS5, act KS/CLF and porcine FAS KS domains can be overlapped perfectly, suggesting a similar catalytic mechanism (Witkowski et al., 2002; Zhang et al., 2006), initiated by the docking of acyl-ACP to an electropositive patch of KS. The proposed mechanism is similar between the priming (ZhuH) and extending (DEBS KS3 and KS5 and act KS/CLF) KSs, except that the catalytic triad of a priming KS consists of His-Asn-Cys. Furthermore, acyl-CoA, rather than acyl-ACP, first binds to ZhuH. The Asn versus His difference between the priming and elongation KSs helps explain why inhibitors such as cerulenin and thiolactomycin preferentially bind the elongation KSs (White et al., 2005). Despite a similar thiolase fold and enzyme mechanism, the specificity of type I and II FAS and PKS KSs varies significantly. The type I FAS KS domains are highly specific toward saturated acyl chains (Witkowski et al., 2002). In contrast, type I modular KS domains, such as the six KS domains in DEBS, have a wide range of substrate specificities that vary in length from diketide to decaketide, although some PKS KS domains appear to possess some specificity with regard to different b-carbon status (Khosla et al., 1999). The type II systems possess highly specific chain-length control that is pathway-specific for the priming and extending KSs. Examples include the C2–C4 priming preference of ZhuH (Pan et al., 2002; Qiu et al., 2005), or the act, tcm, and whiE KS/CLF which extend the polyketide chain to 16, 20, and 24 carbons, respectively (Tang et al., 2003). The observed substrate specificity of each KS domain can be explained by the size and shape of the KS substrate-binding channel, which can be divided into two halves, corresponding to the substrate-binding and PPT-binding regions (Fig. 2.3). The PPT-binding region stretches from the enzyme surface to the active-site Cys and this region is relatively well conserved, reflecting its universal role in binding the PPT moiety. In contrast, the acylbinding region varies significantly. While the binding pockets of FAS KS domains are hydrophobic and promote fatty acyl binding (Maier et al., 2008; Olsen et al., 1999; Price et al., 2003; Qiu et al., 2005), the acyl-binding pockets of PKS KS domains (such as DEBS KS3 and KS5, act KS/CLF and ZhuH) are amphipathic and allow hydrogen-bonding interactions with the carbonyl groups of the growing polyketide chain (Keatinge-Clay et al., 2004; Pan et al., 2002; Tang et al., 2006, 2007). The FAS KS domains have a hydrophobic, narrow pocket of a suitable size to specifically
A
B
D
E
C
F
G
Figure 2.3 The substrate binding channel of (A) the priming KS ZhuH, (B) the E. coli KAS I, (C) actinorhodin KS/CLF, (D) chalcone synthase, (E) porcine FAS KS domain, (F) DEBS KS5. The active site Cys is shown in spheres, and (G) The cyclization chamber of chalcone synthase (in green) compared to the linear polyketide-extending chamber in the act KS/CLF (in purple).
27
Structural Enzymology of Polyketide Synthases
accommodate their corresponding fatty acyl substrates (Fig. 2.3B) (Maier et al., 2008; Olsen et al., 1999; Price et al., 2003; Qiu et al., 2005), whereas the substrate pockets in DEBS KS3 and KS5 are much wider (Fig. 2.3F) (Tang et al., 2006, 2007), consistent with the substrate tolerance reported for type I modular PKS KS domains. In contrast, both priming and extending KSs of the type II PKS are more substrate-specific, reflected by the narrower acyl-binding pocket, similar to those in FAS KS domains. Significantly, mutations of four residues that define the bottom of the acyl pocket in act and tcm KS/CLF confirmed that the pocket size and shape indeed control polyketide-product chain length (Tang et al., 2003), with mutations in CLF being sufficient to alter chain length.
4.3. The ketoreductase Three ketoreductase (KR) crystal structures have been reported: for type I modular PKSs, crystal structures of the DEBS KR1 (EryKR1) (Keatinge-Clay and Stroud, 2006) and KR1 of tylosin PKS (TylKR1) (Keatinge-Clay, 2007) have been solved (Fig. 2.4A-B) and for type II PKS, the actinorhodin KR (act KR) crystal structure has been reported (Hadfield et al., 2004; Korman et al., 2004, 2008) (Fig. 2.4D). EryKR1 and TylKR1 reduce a diketide substrate C¼O to C-OH with ‘‘2R, 3R’’ and ‘‘2R, 3S’’ stereochemistry, respectively, so these two KRs choose opposite diketide epimers (at the 2 position) for the A
D
LID
B
LID
C
E
Figure 2.4 Crystal structures of (A) EryKR1, (B) TylKR1, (C) porcine FAS KR, (D) act KR dimer, (E) the act KR tetramer, colored as in (C), NADP in spheres. A to D are in the same orientation.
28
Shiou-Chuan (Sheryl) Tsai and Brian Douglas Ames
reduction reaction. In contrast, the actinorhodin KR (act KR) specifically reduces the C9 carbonyl group of a 16-carbon (octaketide) preassembled polyketide chain, which folds into the C7–C12 first-ring cyclized shuntproduct mutactin when expressed without downstream enzymes. The ketoreduction catalyzed by act KR, as well as by other type II PKS KR domains, is chemically identical to the corresponding fatty acid ketoreduction, yet with very different regio-specificities (O’Hagan, 1993). In both FASs and PKSs, the type I KR has two domains with the same protein fold: the catalytic subdomain and a truncated, noncatalytic structural subdomain. Both EryKR1 and TylKR1 are monomeric in solution and in crystal structure (Keatinge-Clay, 2007; Keatinge-Clay and Stroud, 2006). In contrast, the type II KR exists as a tetramer (Fig. 2.4) (Hadfield et al., 2004; Korman et al., 2004), and each monomer contains a single domain. Each domain (or each subdomain in type I KR) contains a short-chain dehydrogenase/reductase (SDR) fold consisting of a highly conserved Rossmann fold with two right-handed a-b-a-b-a motifs connected by a3, and the core region consists of a seven-stranded b-sheet flanked by a-helices (Fig. 2.4). The cofactor NADPH is bound at the junction of two a-b-a-b-a motifs in a highly conserved groove characteristic of the Rossmann fold (Persson et al., 2003). The polyketide substrate-binding pocket consists of a large cleft formed by helices a6-a7 and the loops between a4 and a5 (Fig. 2.4). The catalytic subdomains of EryKR1 and TylKR1, as well as act KR, have the typical SDR motifs, such as the TGxxxGxG motif (residues 2 to 19), the D63 and NNAG motifs (residues 89 to 92), the active-site tetrad Asn–Ser–Lys–Tyr, and the PG motif (residues187 to 188) (Persson et al., 2003). The biggest difference between the type I and II PKS KRs is a long insertion between helices 6 and 7 for act KR, and this may account for the different substrate specificities of type I and II PKS KRs. The monomeric type I KR orients its two subdomains (Fig. 2.4A-B) very similarly to a type II KR dimer (Fig. 2.4D), with extensive, mainly hydrophilic, interactions. The structural subdomains in EryKR1 and TylKR1 lack a cofactor-binding motif and the substrate-binding portion, thus rendering the structural subdomain inactive (Keatinge-Clay, 2007; KeatingeClay and Stroud, 2006). The type I KRs have additional b1-b8 and a4-aF interactions bridging the structural and catalytic subdomains and stabilizing the pseudodimeric KR protein fold. The act KR active-site tetrad consists of N114–S144–Y157–K161 (42 to 44). In contrast, the Asn and Lys positions are switched in EryKR1 and TylKR1 (K1776–S1800–Y1813–N1817) (Keatinge-Clay, 2007; KeatingeClay and Stroud, 2006). The KR tetrad lies near the nicotinamide ring of NADPH, where Tyr and Lys form hydrogen bonds with the NADPH ribose and nicotinamide ring. In act KR, four crystalline water molecules form extensive hydrogen bonds with N114 and K161 (Fig. 2.5A). These waters form a proton-relay network that is very similar to the one observed
29
Structural Enzymology of Polyketide Synthases
A
K161
Y157
N114
S144
O
O
H
H O
H
H O
H
⊕ H N H
H
H O
H
HO
H2
O3 O
H
H
O
O H
1 NADPH
N
H
O B
NADPH
Monomer B closed form
NADPH
Monomer A open form
NADPH
7.9 Å
Figure 2.5 (A) Proposed proton-relay mechanism for act KR. (B) The asymmetric unit contains monomers A (middle panel) and B (left panel) in open and closed conformations, respectively. Surface potentials are colored from negative (red) to positive (blue). When the open and closed conformations are overlapped (right panel, open in yellow, closed in purple), the major conformational change is in the flexible a6–a7 region.
in E. coli FabG-NADPþ (Price et al., 2004), leading to the hypothesis that the water-relay mechanism for FabG may also be applicable to act KR (Fig. 2.5A). In vitro assays indicate that type II PKS KRs have a different substrate specificity from that of FAS (Dutler et al., 1971; Joshi and Smith, 1993) and modular type I PKS KRs (Ostergaard et al., 2002), both of which can reduce linear and monocyclic ketones. The strong preference of act KR toward bicyclic polyketides supports the conclusion that its natural substrate is a cyclic polyketide, and detailed kinetic analysis showed that act KR proceeds through an ordered bi bi mechanism (Korman et al., 2008), in which the cofactor NADPH binds KR prior to the substrate
30
Shiou-Chuan (Sheryl) Tsai and Brian Douglas Ames
trans-1-decalone. The above results imply that the first ring is cyclized prior to ketoreduction, thus sterically constraining the ketoreduction and leading to a highly specific C9-reduction. The inhibitor emodin-bound act KR structure also revealed that act KR can exist with at least two different conformations (Korman et al., 2008): open and closed forms that differ in the 10-residue loop region (residues 199 to 209) between helices 6 and 7 (Fig. 2.5B). EryKR1 and TylKR1 also show similar conformational changes and loop movement in this region (Keatinge-Clay, 2007; Keatinge-Clay and Stroud, 2006), which may reflect different binding motifs during ketoreduction (Keatinge-Clay, 2007; Korman et al., 2008). The stereoselective signature motifs for the modular PKS KRs were previously proposed to be ‘‘LDD’’ and PxxxN (Caffrey, 2003; Reid et al., 2003), and the presence or absence of these motifs produce the 3R or 3S stereomer, respectively. The EryKR1 crystal structure shows that the 93–95 ‘‘LDD’’ motif lies in a loop adjacent to the active site (Keatinge-Clay and Stroud, 2006), and KR1 mutation indeed resulted in a switch of alcohol stereochemistry (Baerga-Ortiz et al., 2006; O’Hare et al., 2006). The 2-position stereochemistry is also affected by KR and its upstream KS domain. Based on extensive bioinformatic analysis guided by the crystal structures of EryKR1 and TylKR1, Keatinge-Clay categorized the type I KRs into six types to explain their observed stereochemistry at the 2- and 3-positions and developed a protocol to assign substituent stereochemistry accordingly (Keatinge-Clay, 2007). Similar studies on type II KRs (Korman et al., 2008) support the hypothesis that type II KR substrate specificity is defined by a combination of enzyme conformation, specific molecular interactions between the substrate and active-site residues, as well as substrate and protein flexibility due to the dynamic nature of the binding cleft.
4.4. The dehydratase of modular type I PKS DEBS DH4 catalyzes dehydration of a 2R-methyl-3R-OH pentaketide to afford a trans double bond (Keatinge-Clay, 2008). The recent report of the 1.8-A˚ DEBS DH4 crystal structure, combined with the porcine FAS structure, reveals that the DH domain in type I PKSs and FASs consists of two subdomains with limited sequence homology, yet each subdomain consists of the ‘‘hot-dog-in-a-bun’’ fold (Dillon and Bateman, 2004). The double hot-dog (DHD) fold exhibited by type I FAS and PKS DHs is similar to that of the dimeric type II bacterial DHs (such as E. coli FabA and FabZ ( Kimber et al., 2004; Leesong et al., 1996)), consisting of one hot-dog fold per monomer (Fig. 2.6A-B). The E. coli and human TE II are also reported to contain the DHD fold (Li et al., 2000). In each hot-dog subdomain, the long central helix—the hot-dog—is packed against a seven-stranded antiparallel b-sheet that forms the bun. In both the porcine FAS and DEBS DH4 structures, the two hot-dog subdomains of DH interact extensively to
A
B
C
H44
H44
D
N H
O
H N
H
O
D206 Q210
O
R1 H
H R2
O H O H H N
S55
+
N H
N
O
L51
L51
S
ACP
O
“Trans-” dehydration
H N
H
O
O− H
D206 Q210
R1
N H
O N H
N H R 2 S H
H O Wat1 H N
ACP
O
S55
Figure 2.6 Comparison of the double hot dog–fold and interior pocket of (A) DEBS DH4, (B) porcine FAS DH domain, and (C) PKSA PT domain. The active-site His and Asp are shown in sphere and sticks in upper and lower panels, respectively. The N- and C-terminal subdomains in each model are shown in darker and lighter shades, respectively. (D) Proposed mechanism for DH4.
32
Shiou-Chuan (Sheryl) Tsai and Brian Douglas Ames
form a 14-strand b-sheet with additional interactions between the hot-dog helices from each subdomain. In DH4, the catalytic H44 lies in the first subdomain as part of the HXXXGXXXXP motif (Joshi and Smith, 1993), where the conserved Gly is necessary to make a turn that enables van der Waals interactions between H44 and P53. The catalytic D206 within the DXXX(Q/H) motif lies in the second subdomain and hydrogen-bonds with the side chain of Q210 (itself anchored to Y158). The organization and interaction of catalytic residues described for DH4 are conserved in the porcine FAS DH. Additionally, both the ‘‘GYXYGPXF’’ and ‘‘LPFXW’’ motifs are highly conserved and help define the substrate pocket. The reaction catalyzed by type I and II FAS DHs is freely reversible with equilibrium favoring hydration (Heath and Rock, 1995; Witkowski et al., 2004). In type I PKS DHs, the equilibrium may also lean toward the hydrated polyketide, and a downstream KS or TE may pull the reaction forward toward the dehydrated polyketide (Tang et al., 1998; Wu et al., 2005). However, there is no obvious sequence motif associated with DHs that dehydrate substrates with or without a-substituents, indicating that the a-substituents may not be recognition factors for the PKS DHs. A catalytic mechanism was proposed for DH4 (Fig. 2.6D) in which H44 serves as the active-site base to deprotonate the a-carbon, while the b-hydroxyl group may be polarized by the helix-1 dipole, facilitating water elimination. The DH4 structure shows that the stereochemistry of the b-hydroxyl group in an incoming polyketide substrate may be the primary factor that determines if a cis or trans double bond is produced by the DH domain. For example, when an A-type KR provides DH with the 3S-OH substrate, the 3S-OH is hydrogen-bonded to D206 and the polyketide chain must rotate 120 degrees about the Ca–Cb bond. Thus, an elimination results in the formation of a cis double bond, as in the phoslactomycin DH1 and DH2 (Palaniappan et al., 2008) or rifamycin DH10 (Tang et al., 1998). Sequence comparison indicates that if DH does catalyze epimerization, the Leu and Pro in the ‘‘LPFXW’’ motif may be important (Keatinge-Clay, 2008). Further work is necessary to distinguish the above hypotheses.
4.5. The aromatase/cyclase (ARO/CYC) of type II PKS Based on previous studies of first-ring cyclization, there are at least three different classes of ARO/CYCs (Fig. 2.7A): (1) C9–C14 cyclization associated with monodomain ARO/CYCs, such as tcm ARO/CYC, WhiEORFVI (whiE ARO/CYC), and RemI (Alvarez et al., 1996; Fritzsche et al., 2008; Moore and Piel, 2000; Motamedi and Hutchinson, 1987; Zawada and Khosla, 1997); (2) C7–C12 cyclization in the absence of KR by monodomain ARO/CYCs such as ZhuI from the R1128 biosynthetic pathway (Tang et al., 2004), or didomain ARO/CYCs such as MtmQ from the mithramycin pathway (Lombo´ et al., 1996; Zhang et al., 2008) (3) the
O
O
O
O
O
O
Class 1: C9-C14 C7-C16
O 1
S-ACP
TcmN WhiE-ORFVI Reml
OH
OH
14
O
HO
H3CO
16
OH CO2CH3
O
7
whiE-encoded spore pigment (C24, structure unknown)
O 1
OCH3
OH OH O
O
OH
9
O
Tetracenomycin C (antibiotic/anticancer)
O O
OH
OH
S-ACP Resistomycin (antibiotic/antimor)
HO O
OH
Class 2: C7-C12 Zhul MtmQ
O
OH
O
OH
OH
R
R1128 A-D (anticancer) A: R = (CH2)2CH3 B: R = (CH2)3CH3 OH C: R = (CH ) CH(CH ) 2 2 3 2 D: R = (CH2)4CH3
O
12
HO
O HO
OH
O
O
O
S-ACP
7
O OSug H O
KR
OH
Mithramycin (antibiotic/antimor)
SugO OCH3 OH 2
OH
O O
O
O
OH
O
Class 3: C7-C12
12 9
7
HO
O
O S-ACP
ActVII Gris-ORF4
O
OH
O 7
Actinorhodin (antibiotic)
O
12 O
O
CO2H
O
OAC
S-ACP
OH
O
OH
O O
O
OH
Griseusin (antibiotic)
CO2H
Figure 2.7 The three types of ARO/CYCs. Class 1 proteins possess monodomain architecture and promote C9-C14 first-ring and C7-C16 second-ring cyclization of an unreduced polyketide intermediate. Class 2 ARO/CYCs are monodomain or didomain proteins that promote C7-C12 first-ring cyclization of an unreduced intermediate. Class 3 enzymes are didomain proteins that aromatize the first ring of an intermediate that has undergone C9-specific ketoreduction and C7-C12 first-ring cyclization.
34
Shiou-Chuan (Sheryl) Tsai and Brian Douglas Ames
didomain ARO/CYCs associated with KR-containing type II PKSs that aromatize C7–C12 first-ring cyclized polyketides, such as the actinorhodin (McDaniel et al., 1995) and griseusin (Zawada and Khosla, 1997) ARO/ CYCs. The best-studied monodomain ARO/CYC is tcm ARO/CYC, which consists of the N-terminal 160 residues of the bifunctional protein, TcmN (McDaniel et al., 1995; Zawada and Khosla, 1999). Following the production of the linear decaketide intermediate, tcm ARO/CYC is proposed to fold, cyclize and aromatize the ACP-tethered polyketide via aldol condensation and dehydration reactions (Shen and Hutchinson, 1996). Based on genetic analyses, it had been argued that the first cyclization of a linear polyketide chain may occur either in the active site of KS–CLF (KeatingeClay et al., 2004), in solution (without enzyme catalysis) (Hertweck et al., 2004), or in the binding pocket of KR or ARO/CYC (Zawada and Khosla, 1999). Similar observations on more than ten aromatic PKSs (except in enterocin, discussed below (Hertweck et al., 2004)) have led to the general conclusion that KR promotes C7–C12 cyclization (Crump et al., 1997; McDaniel et al., 1994), whereas the monodomain ARO/CYCs in nonreducing type II systems promote C9–C14 cyclization. The crystal structure and mutagenesis of act KR and tcm ARO/CYC support the hypothesis that cyclization in the KR or ARO/CYC substrate pocket may be a likely event. However, further validation is necessary. Three ARO/CYC structures have been solved: the tcm, whiE, and ZhuI ARO/CYCs, all three of which have a helix-grip fold (Gajhede et al., 1996; Iyer et al., 2001) consisting of a seven-stranded antiparallel b-sheet that partially surrounds (‘‘grips’’) a long C-terminal a-helix (Fig. 2.8). Two small helices between b1 and b2 form a helix-loop-helix motif that acts to seal one end of the b-sandwich. The topology of ARO/CYC is highly similar to that of members of the Bet v1-like superfamily (Iyer et al., 2001; Radauer et al., 2008), which commonly includes a large solvent-accessible pocket that binds small molecules such as phytosteroid hormones, lipids, enediyne, and cholesterol (Markovic-Housley et al., 2003; Mogensen et al., 2002; Pasternak et al., 2005; Radauer et al., 2008; Tsujishita and Hurley, 2000). However, unlike many Bet v1-like proteins with hydrophobic pockets, the ARO/CYC pocket is amphipathic with an approximately equal distribution of hydrophobic and hydrophilic residues. The ARO/CYC pocket dimensions and residue composition are appropriate for binding cyclized polyketide intermediates (Fig. 2.8E). Whereas the type II PKS ARO/CYC contains a helix-grip fold, all FAS DH (such as E. coli FabA) contain a hotdog fold (Dillon and Bateman, 2004; Leesong et al., 1996) (Fig. 2.8A-B) that is topologically different but similar in shape. In the hot-dog fold, the bsheets have strand-order 1–2–3–5–6–7–4, whereas the strand-order is 1–7– 6–5–4–3–2 for the helix-grip fold. Also, the central helix is tucked against the b-sheets in FabA, thus precluding formation of an interior pocket between the b-sheet and central helix aC. As multiple dehydration events
35
Structural Enzymology of Polyketide Synthases
C
TcmN ARO/CYC
A
A
N 1
C
B
6 C
7
90⬚
5
3
4
2
N
FabA
B
B
A
N
1
2
3 C
90⬚
5
4
C
D
N
N
C
C
WhiE ORFVI
Zhul
E F88
R82
20 Å 12 Å
7
N
C
C
6
A80 M91 L93 R69 S67 F50
W95 W108
W28
W65
L52 Q110 L129 Y35
T54
W65
N136
A80 M91 L93 S67 R69 W95 F50
T54
W108
W28 L52 Q110 L129
T133 F32
H128 E34 T132 D57
F88
R82
Y35
T133 F32
H128 E34 T132 N136 D57
Figure 2.8 Crystal structures of (A) tcm ARO/CYC, (B) FabA, (C) whiE ARO/CYC, (D) ZhuI ARO/CYC, and (E) The tcm ARO/CYC interior pocket.
are necessary in order to aromatize the rings formed during polyketide biosynthesis it has been suggested that PKS ARO/CYCs may act as DHs to catalyze aromatic ring formation (Hopwood, 1997). That both ARO/ CYC and DH catalyze dehydration reactions in evolutionarily related complexes suggests that they may play similar biological roles implied by their similar topologies. Based on site-directed mutagenesis, the tcm ARO/CYC crystal structure, and computer-simulated docking, a catalytic mechanism was proposed for tcm ARO/CYC (Ames et al., 2008) in which the polyketide carbonyl
36
Shiou-Chuan (Sheryl) Tsai and Brian Douglas Ames
oxygens are anchored in close proximity to S67, R69, Y35, and R82, and subsequent aldocyclization is promoted by electrostatic stabilization of pocket residues (with special attention to the possible involvement of the strictly conserved pocket residue, R69). The above proposal is further supported by the crystal structures of whiE and ZhuI ARO/CYC (Fig. 2.8C, D). The whiE ARO/CYC promotes C9-C14 first-ring and C7-C16 second-ring cyclizations of a 24-carbon polyketide, and ZhuI is the only reported monodomain C7–C12 first-ring-only cyclase (Marti et al., 2000; Yu et al., 1998). The overall structure and residue composition are similar between whiE and tcm ARO/CYCs, but subtle conformational and residue changes in the whiE ARO/CYC pocket increases the pocket space (compared to tcm ARO/CYC) to accommodate the binding of a C24 polyketide. In contrast, ZhuI has a much smaller pocket that accommodates a monocyclic C7–C12 cyclized intermediate (Fig. 2.8C, D). There are two observed folding patterns of aromatic polyketides which generally lead to unique cyclization regio-specificities (Thomas, 2001). S-type folding, promoted by type II PKSs, leads to C7–12 or C9–C14 first-ring cyclization depending on whether KR is present. In contrast, F-type folding patterns, promoted by the produce template (PT) domain of fungal nonreducing type I PKSs (Crawford et al., 2006, 2008; Udwary et al., 2002), include C2–C7, C4–C9, and C6–C11 first-ring cyclization. ˚ crystal structure and mutational analyses of the PksA PT domain The 1.8-A (manuscript in preparation) revealed that PT also has a DHD fold (Fig. 2.6C) and nearly all secondary structure elements are aligned with both DEBS DH4 ˚ of RMSD. Significantly, and porcine FAS DH domain with only 3 A similarly to ARO/CYC, PT has an interior pocket (Fig. 2.6C), and the reported F-fold patterns may be directly related to their corresponding PKS PT domain, in which the cyclization pattern is determined by pocket shape, while chain length is correlated with pocket size. In conclusion, PT may bind a fully extended linear polyketide that is ‘‘kinked’’ in the cyclization chamber to promote the F-folded cyclization pattern, while the ARO/CYC likely bends the ACP-bound polyketide into a hairpin, thus promoting the S-folded cyclization pattern.
4.6. Acyl carrier protein Recently, the first solved structure of an acyl carrier protein (ACP) from a type I modular PKS was reported for DEBS ACP2 (Alekseyev et al., 2007). Similar to the type I FAS ACP structure, the 10-kD DEBS ACP2 contains a three-helical bundle, and an additional short helix in the second loop also contributes to core helical packing. The conserved Ser in the universal ‘‘DSL’’ motif (where PPT is covalently attached) lies at the N-terminal end of helix-2, which is regarded as a universal ‘‘recognition helix’’ involved in interactions with other proteins (Crump et al., 1997; Findlow
Structural Enzymology of Polyketide Synthases
37
et al., 2003; Li et al., 2003; Reed et al., 2003; Zhang et al., 2003). Homology models of DEBS ACP domains (ACP1–6) (Alekseyev et al., 2007) suggest that protein–protein recognition of ACP domains is highly specific for their corresponding KS domains (Chen et al., 2006). Similar results were reported for type II PKS ACP domains, such as the act apo-ACP (Crump et al., 1997), the fren holo-ACP and otc ACP (Findlow et al., 2003; Li et al., 2003). These results are consistent with the ‘‘switch blade’’ theory based on the yeast FAS crystal structure (Leibundgut et al., 2008), in which the growing acyl chain (the blade) switches its nestling cavity from ACP to the KS (or other PKS enzymes) binding pocket, and the timing of blade switching is closely related to the degree of exposure between the polyketide intermediate and the solvent, which depends not only on the ACP ‘‘recognition helix’’ property, but also on the chemical structure of a given polyketide intermediate.
4.7. Thioesterase Three PKS thioesterase (TE) structures have been reported: the DEBS TE (Tsai et al., 2001), and the homologous pikromycin (PIKS) TE (Akey et al., 2006; Giraldes et al., 2006; Tsai et al., 2002), and the PksA TE in a nonreducing iterative type I PKS from aflatoxin biosynthesis (manuscript in preparation). All three structures exhibit the classic features of the a/b hydrolase fold (Fig. 2.9A-B), which consists of a central seven-stranded b-sheet with the second strand (b2) antiparallel to the remaining strands (Chakravarty et al., 2004; Giraldes et al., 2006; Tsai et al., 2001, 2002). While the active-site triad (Ser-His-Asp) and nearly all important secondary structure components are highly conserved, substrate specificity and regiospecificity vary significantly among different TEs. The PKS TE domains lack the characteristic aD helix of the a/b-hydrolase family, instead having an inserted ‘‘lid’’ region that is consistently observed in the DEBS (Tsai et al., 2001), PIKS (Akey et al., 2006; Giraldes et al., 2006; Tsai et al., 2002), surfactin synthetase (SrfA-C) (Bruner et al., 2002), fengycin synthetase (FenB) (Samel et al., 2006), and enterobactin (EntF ) (Frueh et al., 2008) TE structures. The lid region is also the most variable region among the TE domains (Fig. 2.9C). Because the substrate-binding region of the megasynthase TE is formed between the a/b-hydrolase core and the lid region inserted between b6 and b7, variability of the lid region is reflected in the highly variable substrate channel shape among different TEs. In the modular DEBS and PIKS TEs (Akey et al., 2006; Giraldes et al., 2006; Tsai et al., 2001, 2002), an unusual, 20-A˚ long amphipathic substrate channel passes through the entire protein, implying passage of the substrate through the protein (Fig. 2.9C) with the catalytic triad that carries out macrolactonization of a hydrophilic polyketide substrate located at the center. In contrast, the PksA TE substrate pocket adopts a closed conformation,
A
B 2005
Lid loop
1976
L1
1986
1853 1897
2018
L2
G1874 1870 1910 1936
S1937
2045 D
2048
2038
2083
D1964 1938
H2088 2097
N-term 2069 1878 2
4
A
3
B
5
C
6
7
N 1853 1891
E
8
F
2073
1882 1866
1925
1931 1953 1959 2032
2078
2108 C
C
PksA TE (closed)
SrfTE (closed)
FenTE (open)
Human TE (open)
Figure 2.9 (A, B) A typical TE structure with the PksA TE as an example. (C) Comparison of the lid region (yellow) of different megasynthase TE domains. The active site is red.
Structural Enzymology of Polyketide Synthases
39
sealed from both ends of the channel, to turn the pocket into a sealed hydrophobic ‘‘cyclization chamber’’ and protect the polyketide substrate from hydrolysis. The flexibility of the lid region is evident when a series of PIKS TE structures solved from crystals at different pH values were compared (Tsai et al., 2002), showing that the size of the substrate channel increases with increasing pH. The variable channel geometry is proposed to influence the regio-selectivity between the hydrolysis and macrocyclization/Claisen cyclization activities of type I PKS TEs. The crystal structures of DEBS and PIKS TE help rationalize the observed substrate specificity of modular PKS TEs (Giraldes et al., 2006; Tsai et al., 2001, 2002), and the chemical structures of the polyketide substrates are as important as the TE substrate residues in determining cyclization versus hydrolysis activity (Gokhale et al., 1999; Lu et al., 2002). Further work is necessary to fully determine residues important for PKS TE substrate specificity.
5. Summary and Future Prospects Recent revelations from crystallographic analysis of type I and type II PKSs have raised awareness of the extraordinary architecture of these megasynthases and offered a new perspective in visualizing some of the unsolved questions concerning polyketide biosynthesis. The 3.2-A˚ porcine FAS crystal structure has provided a framework for megasynthase architecture that may also apply to type I PKSs (Maier et al., 2008). Further, the DEBS KS-AT structures clearly show that the KS-AT and post-AT linkers are highly structured and closely interacting with both KS and AT domains, so that the linker regions contribute extensively to stabilization of the overall KS-AT structure (Tang et al., 2006, 2007). Clearly, we need to reconsider the original notion that the linkers merely serve as semi-flexible tethers that hold adjacent domains in proximity (Gokhale et al., 1999). In the future, studies of interdomain, intermodule, and interpolypeptide linker regions in type I PKSs should further determine their importance to dimer formation, polyketide chain transfer, and reaction timing. In the arena of type II PKSs, the detection of multienzyme complex formation should help shed light on how the ACPs gain access to each of the PKS enzyme domains. Because of the dynamic nature of this complex, x-ray crystallography, if successful at all, may only trap one snapshot of such a transient complex, and other techniques such as electron microscopy or NMR may be necessary to capture a series of protein motions during different stages of polyketide biosynthesis. The early successful application of electron microscopy to capture the FAS dynamic structures (Asturias et al., 2005) can serve as an excellent example for a similar study with type I and type II PKSs.
40
Shiou-Chuan (Sheryl) Tsai and Brian Douglas Ames
ACKNOWLEDGMENTS Our sincere thanks to David Hopwood, Chaitan Khosla, Joel Bruegger, Pouya Javidpour, and Ming Lee for their helpful suggestions and critical reading of the manuscript. Sheryl Tsai is supported by the Pew Foundation, the American Heart Association (0665164Y), and National Institutes of Health R01GM076330 and R21GM077264.
REFERENCES Akey, D. L., Kittendorf, J. D., Giraldes, J. W., Fecik, R. A., Sherman, D. H., and Smith, J. L. (2006). ‘‘Structural basis for macrolactonization by the pikromycin thioesterase.’’ Nat. Chem. Biol. 2(10), 537–542. Alekseyev, V. Y., Liu, C. W., Cane, D. E., Puglisi, J. D., and Khosla, C. (2007). ‘‘Solution structure and proposed domain domain recognition interface of an acyl carrier protein domain from a modular polyketide synthase.’’ Protein Sci. 16(10), 2093–2107. Alvarez, M. A., Fu, H., Khosla, C., Hopwood, D. A., and Bailey, J. E. (1996). ‘‘Engineered biosynthesis of novel polyketides: Properties of the whiE aromatase/cyclase.’’ Nat. Biotechnol. 14(3), 335–338. Ames, B. D., Korman, T. P., Zhang, W., Smith, P., Vu, T., Tang, Y., and Tsai, S. C. (2008). ‘‘Crystal structure and functional analysis of tetracenomycin ARO/CYC: Implications for cyclization specificity of aromatic polyketides.’’ Proc. Natl. Acad. Sci. 105(14), 5349–5354. Asturias, F. J., Chadick, J. Z., Cheung, I. K., Stark, H., Witkowski, A., Joshi, A. K., and Smith, S. (2005). ‘‘Structure and molecular organization of mammalian fatty acid synthase.’’ Nat. Struct. Mol. Biol. 12(3), 225–232. Austin, M. B., and Noel, J. P. (2003). ‘‘The chalcone synthase superfamily of type III polyketide synthases.’’ Nat. Prod. Rep. 20(1), 79–110. Baerga-Ortiz, A., Popovic, B., Siskos, A. P., O’Hare, H. M., Spiteller, D., Williams, M. G., Campillo, N., Spencer, J. B., and Leadlay, P. F. (2006). ‘‘Directed mutagenesis alters the stereochemistry of catalysis by isolated ketoreductase domains from the erythromycin polyketide synthase.’’ Chem. Biol. 13(3), 277–285. Bard, J., Ercolani, K., Svenson, K., Olland, A., and Somers, W. (2004). ‘‘Automated systems for protein crystallization.’’ Methods 34(3), 329–347. Bruner, S. D., Weber, T., Kohli, R. M., Schwarzer, D., Marahiel, M. A., Walsh, C. T., and Stubbs, M. T. (2002). ‘‘Structural basis for the cyclization of the lipopeptide antibiotic surfactin by the thioesterase domain SrfTE.’’ Structure 10(3), 301–310. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., GrosseKunstleve, R. W., Jiang, J. S., Kuszewski, J., Nilges, M., Pannu, N. S., Read, R. J., Rice, L. M., et al. (1998). ‘‘Crystallography & NMR system: A new software suite for macromolecular structure determination.’’ Acta Crystallogr. D Biol. Crystallogr. 54(Pt 5), 905–921. Caffrey, P. (2003). ‘‘Conserved amino acid residues correlating with ketoreductase stereospecificity in modular polyketide synthases.’’ Chembiochem 4(7), 654–657. Chakravarty, B., Gu, Z., Chirala, S. S., Wakil, S. J., and Quiocho, F. A. (2004). ‘‘Human fatty acid synthase: Structure and substrate selectivity of the thioesterase domain.’’ Proc. Natl. Acad. Sci. USA 101(44), 15567–15572. Chen, A. Y., Schnarr, N. A., Kim, C. Y., Cane, D. E., and Khosla, C. (2006). ‘‘Extender unit and acyl carrier protein specificity of ketosynthase domains of the 6-deoxyerythronolide B. synthase.’’ J. Am. Chem. Soc. 128(9), 3067–3074.
Structural Enzymology of Polyketide Synthases
41
Collaborative Computational Project, Number 4. (1994). Acta Crystallogr. D Biol. Crystallogr. 50, 760–763. Crawford, J. M., Dancy, B. C. R., Hill, E. A., Udwary, D. W., and Townsend, C. A. (2006). ‘‘Identification of a starter unit acyl-carrier protein transacylase domain in an iterative type I. polyketide synthase.’’ Proc. Natl. Acad. Sci. USA 103(45), 16728–16733. Crawford, J. M., Thomas, P. M., Scheerer, J. R., Vagstad, A. L., Kelleher, N. L., and Townsend, C. A. (2008). ‘‘Deconstruction of iterative multidomain polyketide synthase function.’’ Science 320(5873), 243–246. Crawford, J. M., Vagstad, A. L., Ehrlich, K. C., and Townsend, C. A. (2008). ‘‘Starter unit specificity directs genome mining of polyketide synthase pathways in fungi.’’ Bioorg. Chem. 36(1), 16–22. Crump, M. P., Crosby, J., Dempsey, C. E., Parkinson, J. A., Murray, M., Hopwood, D. A., and Simpson, T. J. (1997). ‘‘Solution structure of the actinorhodin polyketide synthase acyl carrier protein from Streptomyces coelicolor A3(2).’’ Biochemistry 36(20), 6000–6008. Del Vecchio, F., Petkovic, H., Kendrew, S. G., Low, L., Wilkinson, B., Lill, R., Cortes, J., Rudd, B. A., Staunton, J., and Leadlay, P. F. (2003). ‘‘Active-site residue, domain and module swaps in modular polyketide synthases.’’ J. Ind. Microbiol. Biotechnol. 30(8), 489–494. Derewenda, Z. S. (2004). ‘‘The use of recombinant methods and molecular engineering in protein crystallization.’’ Methods 34(3), 354–363. Dillon, S. C., and Bateman, A. (2004). ‘‘The hotdog fold: wrapping up a superfamily of thioesterases and dehydratases.’’ BMC Bioinformatics 5, 109–123. Dreier, J., Li, Q., and Khosla, C. (2001). ‘‘Malonyl-CoA:ACP transacylase from Streptomyces coelicolor has two alternative catalytically active nucleophiles.’’ Biochemistry 40 (41), 12407–12411. Dutler, H., Kull, A., and Mislin, R. (1971). ‘‘Fatty acid synthetase from pig liver. 2. Characterization of the enzyme complex with oxidoreductase activity for alicyclic ketones as a fatty acid synthetase.’’ Eur. J. Biochem. 22(2), 213–217. Emsley, P., and Cowtan, K. (2004). ‘‘Coot: model-building tools for molecular graphics.’’ Acta Crystallogr. D Biol. Crystallogr. 60(Pt 12 Pt 1), 2126–2132. Evans, S. E., Williams, C., Arthur, C. J., Burston, S. G., Simpson, T. J., Crosby, J., and Crump, M. P. (2008). ‘‘An ACP structural switch: conformational differences between the Apo and Holo forms of the actinorhodin polyketide synthase acyl carrier protein.’’ Chembiochem 9(15), 2424–2432. Findlow, S. C., Winsor, C., Simpson, T. J., Crosby, J., and Crump, M. P. (2003). ‘‘Solution structure and dynamics of oxytetracycline polyketide synthase acyl carrier protein from Streptomyces rimosus.’’ Biochemistry 42(28), 8423–8433. Fritzsche, K., Ishida, K., and Hertweck, C. (2008). ‘‘Orchestration of Discoid Polyketide Cyclization in the Resistomycin Pathway.’’ J. Am. Chem. Soc. 130(26), 8307–8316. Frueh, D. P., Arthanari, H., Koglin, A., Vosburg, D. A., Bennett, A. E., Walsh, C. T., and Wagner, G. (2008). ‘‘Dynamic thiolation-thioesterase structure of a non-ribosomal peptide synthetase.’’ Nature 454(7206), 903–906. Gajhede, M., Osmark, P., Poulsen, F. M., Ipsen, H., Larsen, J. N., Joost van Neerven, R. J., Schou, C., Lowenstein, H., and Spangfort, M. D. (1996). ‘‘X-ray and NMR structure of Bet v 1, the origin of birch pollen allergy.’’ Nat. Struct. Biol. 3(12), 1040–1045. Giraldes, J. W., Akey, D. L., Kittendorf, J. D., Sherman, D. H., Smith, J. L., and Fecik, R. A. (2006). ‘‘Structural and mechanistic insights into polyketide macrolactonization from polyketide-based affinity labels.’’ Nat. Chem. Biol. 2(10), 531–536. Gokhale, R. S., Tsiji, S. Y., Cane, D. E., and Khosla, C. (1999). ‘‘Dissecting and exploiting intermodular communication in polyketide synthases.’’ Science 284, 482–485.
42
Shiou-Chuan (Sheryl) Tsai and Brian Douglas Ames
Hadfield, A. T., Limpkin, C., Teartasin, W., Simpson, T. J., Crosby, J., and Crump, M. P. (2004). ‘‘The crystal structure of the actIII actinorhodin polyketide reductase: Proposed mechanism for ACP and polyketide binding.’’ Structure (Camb) 12(10), 1865–1875. Haydock, S., Aparicio, J., Molnar, I., T, S., Khaw, L., Konig, A., Marsden, A., Galloway, I., Staunton, J., and Leadlay, P. (1995). ‘‘Divergent sequence motifs correlated with the substrate specificity of (methyl)malonyl-CoA:acyl carrier protein transacylase domains in modular polyketide synthases.’’ FEBS Lett. 374, 246–248. Heath, R. J., and Rock, C. O. (1995). ‘‘Enoyl-acyl carrier protein reductase (fabI) plays a determinant role in completing cycles of fatty acid elongation in Escherichia coli.’’ J. Biol. Chem. 270, 26538–26542. Hertweck, C., Xiang, L., Kalaitzis, J. A., Cheng, Q., Palzer, M., and Moore, B. S. (2004). ‘‘Context-dependent behavior of the enterocin iterative polyketide synthase; a new model for ketoreduction.’’ Chem. Biol. 11(4), 461–468. Hong, H., Appleyard, A. N., Siskos, A. P., Garcia-Bernardo, J., Staunton, J., and Leadlay, P. F. (2005). ‘‘Chain initiation on type I. modular polyketide synthases revealed by limited proteolysis and ion-trap mass spectrometry.’’ FEBS J. 272(10), 2373–2387. Hopwood, D. A. (1997). ‘‘Genetic Contributions to Understanding Polyketide Synthases.’’ Chem. Rev. 97(7), 2465–2498. Iyer, L. M., Koonin, E. V., and Aravind, L. (2001). ‘‘Adaptations of the helix-grip fold for ligand binding and catalysis in the START domain superfamily.’’ Proteins 43, 134–144. Joshi, A. K., Rangan, V. S., and Smith, S. (1998). ‘‘Differential affinity labeling of the two subunits of the homodimeric animal fatty acid synthase allows isolation of heterodimers consisting of subunits that have been independently modified.’’ J. Biol. Chem. 273(9), 4937–4943. Joshi, A. K., and Smith, S. (1993). ‘‘Construction, expression, and characterization of a mutated animal fatty acid synthase deficient in the dehydrase function.’’ J. Biol. Chem. 268(30), 22508–22513. Joshi, A. K., Witkowski, A., and Smith, S. (1997). ‘‘Mapping of functional interactions between domains of the animal fatty acid synthase by mutant complementation in vitro.’’ Biochemistry 36(8), 2316–2322. Kallio, P., Sultana, A., Niemi, J., Mantsala, P., and Schneider, G. (2006). ‘‘Crystal structure of the polyketide cyclase AknH with bound substrate and product analogue: Implications for catalytic mechanism and product stereoselectivity.’’ J. Mol. Biol. 357(1), 210–220. Keatinge-Clay, A. (2008). ‘‘Crystal structure of the erythromycin polyketide synthase dehydratase.’’ J. Mol. Biol. 384(4), 941–953. Keatinge-Clay, A. T. (2007). ‘‘A tylosin ketoreductase reveals how chirality is determined in polyketides.’’ Chem. Biol. 14(8), 898–908. Keatinge-Clay, A. T., Maltby, D. A., Medzihradszky, K. F., Khosla, C., and Stroud, R. M. (2004). ‘‘An antibiotic factory caught in action.’’ Nat. Struct. Mol. Biol. 11, 888–893. Keatinge-Clay, A. T., Shelat, A. A., Savage, D. F., Tsai, S. C., Miercke, L. J., O’Connell, J. D. 3rd, Khosla, C., and Stroud, R. M. (2003). ‘‘Catalysis, specificity, and ACP docking site of Streptomyces coelicolor malonyl-CoA:ACP transacylase.’’ Structure 11(2), 147–154. Keatinge-Clay, A. T., and Stroud, R. M. (2006). ‘‘The structure of a ketoreductase determines the organization of the beta-carbon processing enzymes of modular polyketide synthases.’’ Structure 14(4), 737–748. Khosla, C., Gokhale, R. S., Jacobsen, J. R., and Cane, D. E. (1999). ‘‘Tolerance and specificity of polyketide synthases.’’ Annu. Rev. Biochem. 68, 219–253. Khosla, C., Tang, Y., Chen, A. Y., Schnarr, N. A., and Cane, D. E. (2007). ‘‘Structure and mechanism of the 6-deoxyerythronolide B. synthase.’’ Annu. Rev. Biochem. 76, 195–221. Kimber, M. S., Martin, F., Lu, Y., Houston, S., Vedadi, M., Dharamsi, A., Fiebig, K. M., Schmid, M., and Rock, C. O. (2004). ‘‘The structure of (3R)-hydroxyacyl-acyl carrier
Structural Enzymology of Polyketide Synthases
43
protein dehydratase (FabZ) from Pseudomonas aeruginosa.’’ J. Biol. Chem. 279(50), 52593–52602. Korman, T. P., Hill, J. A., Vu, T. N., and Tsai, S. C. (2004). ‘‘Structural analysis of actinorhodin polyketide ketoreductase: Cofactor binding and substrate specificity.’’ Biochemistry 43(46), 14529–14538. Korman, T. P., Tan, Y. H., Wong, J., Luo, R., and Tsai, S. C. (2008). ‘‘Inhibition kinetics and emodin cocrystal structure of a type II polyketide ketoreductase.’’ Biochemistry 47(7), 1837–1847. Laskowski, R. A., MacArthur, M. W., Moss, D. S., and Thornton, J. M. (1993). ‘‘PROCHECK: a program to check the stereochemical quality of protein structures.’’ J. Appl. Crystallogr. 26(2), 283–291. Lau, J., Cane, D. E., and Khosla, C. (2000). ‘‘Substrate specificity of the loading didomain of the erythromycin polyketide synthase.’’ Biochemistry 39(34), 10514–10520. Lau, J., Fu, H., Cane, D. E., and Khosla, C. (1999). ‘‘Dissecting the role of acyltransferase domains of modular polyketide synthases in the choice and stereochemical fate of extender units.’’ Biochemistry 38(5), 1643–1651. Leesong, M., Henderson, B. S., Gillig, J. R., Schwab, J. M., and Smith, J. L. (1996). ‘‘Structure of a dehydratase-isomerase from the bacterial pathway for biosynthesis of unsaturated fatty acids: two catalytic activities in one active site.’’ Structure 4(3), 253–264. Leibundgut, M., Maier, T., Jenni, S., and Ban, N. (2008). ‘‘The multienzyme architecture of eukaryotic fatty acid synthases.’’ Curr. Opin. Struct. Biol. 18(6), 714–725. Li, J., Derewenda, U., Dauter, Z., Smith, S., and Derwenda, Z. (2000). ‘‘Crystal structure of the Escherichia coli thioesterase II, a homolog of the human Nef-binding protein.’’ Nature Structural Biology 7, 555–559. Li, Q., Khosla, C., Puglisi, J. D., and Liu, C. W. (2003). ‘‘Solution structure and backbone dynamics of the holo form of the frenolicin acyl carrier protein.’’ Biochemistry 42(16), 4648–4657. Liou, G. F., and Khosla, C. (2003). ‘‘Building-block selectivity of polyketide synthases.’’ Curr. Opin. Chem. Biol. 7(2), 279–284. Liou, G. F., Lau, J., Cane, D. E., and Khosla, C. (2003). ‘‘Quantitative analysis of loading and extender acyltransferases of modular polyketide synthases.’’ Biochemistry 42(1), 200–207. Lombo´, F., Blanco, G., Ferna´ndez, E., Me´ndez, C., and Salas, J. (1996). ‘‘Characterization of Streptomyces argillaceus genes encoding a polyketide synthase involved in the biosynthesis of the antitumor mithramycin.’’ Gene 172(1), 87–91. Lu, H., Tsai, S. C., Khosla, C., and Cane, D. E. (2002). ‘‘Expression, site-directed mutagenesis, and steady state kinetic analysis of the terminal thioesterase domain of the methymycin/picromycin polyketide synthase.’’ Biochemistry 41(42), 12590–12597. Maier, T., Jenni, S., and Ban, N. (2006). ‘‘Architecture of mammalian fatty acid synthase at 4.5 A resolution.’’ Science 311(5765), 1258–1262. Maier, T., Leibundgut, M., and Ban, N. (2008). ‘‘The crystal structure of a mammalian fatty acid synthase.’’ Science 321(5894), 1315–1322. Markovic-Housley, Z., Degano, M., Lamba, D., Roepenack-Lahaye, E., Clemens, S., Susani, M., Ferreira, F., Scheiner, O., and Breiteneder, H. (2003). ‘‘Crystal structure of a hypoallergenic isoform of the major birch pollen allergen Bet v 1 and its likely biological function as a plant steroid carrier.’’ J. Mol. Biol. 325, 123–133. Marsden, A. F., Caffrey, P., Aparicio, J. F., Loughran, M. S., Staunton, J., and Leadlay, P. F. (1994). ‘‘Stereospecific acyl transfers on the erythromycin-producing polyketide synthase.’’ Science 263(5145), 378–380. Marti, T., Hu, Z., Pohl, N. L., Shah, A. N., and Khosla, C. (2000). ‘‘Cloning, nucleotide sequence, and heterologous expression of the biosynthetic gene cluster for R1128,
44
Shiou-Chuan (Sheryl) Tsai and Brian Douglas Ames
a non-steroidal estrogen receptor antagonist. Insights into an unusual priming mechanism.’’ J. Biol. Chem. 275(43), 33443–33448. McDaniel, R., Ebert-Khosla, S., Fu, H., Hopwood, D. A., and Khosla, C. (1994). ‘‘Engineered biosynthesis of novel polyketides: influence of a downstream enzyme on the catalytic specificity of a minimal aromatic polyketide synthase.’’ Proc. Natl. Acad. Sci. USA 91(24), 11542–11546. McDaniel, R., Ebert-Khosla, S., Hopwood, D. A., and Khosla, C. (1995). ‘‘Rational design of aromatic polyketide natural products by recombinant assembly of enzymatic subunits.’’ Nature 375(6532), 549–554. McPherson, A. (2004). ‘‘Introduction to protein crystallization.’’ Methods 34(3), 254–265. Mogensen, J. E., Wimmer, R., Larsen, J. N., Spangfort, M. D., and Otzen, D. E. (2002). ‘‘The major birch allergen, Bet v 1, shows affinity for a broad spectrum of physiological ligands.’’ J. Biol. Chem. 277(26), 23684–23692. Moore, B. S., and Piel, J. (2000). ‘‘Engineering biodiversity with type II polyketide synthase genes.’’ Antonie Van Leeuwenhoek 78(3-4), 391–398. Motamedi, H., and Hutchinson, C. R. (1987). ‘‘Cloning and heterologous expression of a gene cluster for the biosynthesis of tetracenomycin C, the anthracycline antitumor antibiotic of Streptomyces glaucescens.’’ Proc. Natl. Acad. Sci. USA 84(13), 4445–4449. O’Hagan, D. (1993). ‘‘Biosynthesis of fatty acid and polyketide metabolites.’’ Nat. Prod. Rep. 10(6), 593–624. O’Hare, H. M., Baerga-Ortiz, A., Popovic, B., Spencer, J. B., and Leadlay, P. F. (2006). ‘‘High-throughput mutagenesis to evaluate models of stereochemical control in ketoreductase domains from the erythromycin polyketide synthase.’’ Chem. Biol. 13(3), 287–296. Olsen, J. G., Kadziola, A., von Wettstein-Knowles, P., Siggaard-Andersen, M., Lindquist, Y., and Larsen, S. (1999). ‘‘The X-ray crystal structure of beta-ketoacyl [acyl carrier protein] synthase I.’’ FEBS Lett. 460(1), 46–52. Ostergaard, L. H., Kellenberger, L., Cortes, J., Roddis, M. P., Deacon, M., Staunton, J., and Leadlay, P. F. (2002). ‘‘Stereochemistry of catalysis by the ketoreductase activity in the first extension module of the erythromycin polyketide synthase.’’ Biochemistry 41(8), 2719–2726. Palaniappan, N., Alhamadsheh, M. M., and Reynolds, K. A. (2008). ‘‘cis-Delta(2,3)-double bond of phoslactomycins is generated by a post-PKS tailoring enzyme.’’ J. Am. Chem. Soc. 130(37), 12236–12237. Pan, H., Tsai, S., Meadows, E. S., Miercke, L. J., Keatinge-Clay, A. T., O’Connell, J., Khosla, C., and Stroud, R. M. (2002). ‘‘Crystal structure of the priming beta-ketosynthase from the R1128 polyketide biosynthetic pathway.’’ Structure 10(11), 1559–1568. Pasternak, O., Biesiadka, J., Dolot, R., Handschuh, L., Bujacz, G., Sikorski, M. M., and Jaskolski, M. (2005). ‘‘Structure of a yellow lupin pathogenesis-related PR-10 protein belonging to a novel subclass.’’ Acta. Cryst. D61, 99–107. Persson, B., Kallberg, Y., Oppermann, U., and Jornvall, H. (2003). ‘‘Coenzyme-based functional assignments of short-chain dehydrogenases/reductases (SDRs).’’ Chem. Biol. Interact. 143–144, 271–278. Pflugrath, J. W. (2004). ‘‘Macromolecular cryocrystallography–methods for cooling and mounting protein crystals at cryogenic temperatures.’’ Methods 34(3), 415–423. Price, A. C., Rock, C. O., and White, S. W. (2003). ‘‘The 1.3-Angstrom-resolution crystal structure of beta-ketoacyl-acyl carrier protein synthase II from Streptococcus pneumoniae.’’ J. Bacteriol. 185(14), 4136–4143. Price, A. C., Zhang, Y. M., Rock, C. O., and White, S. W. (2001). ‘‘Structure of betaketoacyl-[acyl carrier protein] reductase from Escherichia coli: Negative cooperativity and its structural basis.’’ Biochemistry 40(43), 12772–12781.
Structural Enzymology of Polyketide Synthases
45
Price, A. C., Zhang, Y. M., Rock, C. O., and White, S. W. (2004). ‘‘Cofactor-induced conformational rearrangements establish a catalytically competent active site and a proton relay conduit in FabG.’’ Structure (Camb) 12(3), 417–428. Qiu, X., Choudhry, A. E., Janson, C. A., Grooms, M., Daines, R. A., Lonsdale, J. T., and Khandekar, S. S. (2005). ‘‘Crystal structure and substrate specificity of the beta-ketoacylacyl carrier protein synthase III (FabH) from Staphylococcus aureus.’’ Protein Sci. 14(8), 2087–2094. Radauer, C., Lackner, P., and Breiteneder, H. (2008). ‘‘The Bet v 1 fold: an ancient, versatile scaffold for binding of large, hydrophobic ligands.’’ BMC Evolutionary Biology 8(1), 286. Rangan, V. S., and Smith, S. (1997). ‘‘Alteration of the substrate specificity of the malonylCoA/acetyl-CoA:ACP S-acyltransferase domain of the multifunctional fatty acid synthase by mutation of a single arginine residue.’’ J. Biol. Chem. 272, 11975–11978. Redfield, C. (2004). ‘‘Using nuclear magnetic resonance spectroscopy to study molten globule states of proteins.’’ Methods 34(1), 121–132. Reed, M. A., Schweizer, M., Szafranska, A. E., Arthur, C., Nicholson, T. P., Cox, R. J., Crosby, J., Crump, M. P., and Simpson, T. J. (2003). ‘‘The type I rat fatty acid synthase ACP shows structural homology and analogous biochemical properties to type II ACPs.’’ Org. Biomol. Chem. 1(3), 463–471. Reeves, C. D., Murli, S., Ashley, G. W., Piagentini, M., Hutchinson, C. R., and McDaniel, R. (2001). ‘‘Alteration of the substrate specificity of a modular polyketide synthase acyltransferase domain through site-specific mutations.’’ Biochemistry 40(51), 15464–15470. Reid, R., Piagentini, M., Rodriguez, E., Ashley, G., Viswanathan, N., Carney, J., Santi, D. V., Hutchinson, C. R., and McDaniel, R. (2003). ‘‘A model of structure and catalysis for ketoreductase domains in modular polyketide synthases.’’ Biochemistry 42(1), 72–79. Ruch, F. E., and Vagelos, P. R. (1973). ‘‘The isolation and general properties of Escherichia coli malonyl coenzyme A-acyl carrier protein transacylase.’’ J. Biol. Chem. 248, 8086–8094. Rupp, B., and Wang, J. (2004). ‘‘Predictive models for protein crystallization.’’ Methods 34(3), 390–407. Samel, S. A., Wagner, B., Marahiel, M. A., and Essen, L. O. (2006). ‘‘The thioesterase domain of the fengycin biosynthesis cluster: a structural base for the macrocyclization of a non-ribosomal lipopeptide.’’ J. Mol. Biol. 359(4), 876–889. Serre, L., Verbree, E. C., Dauter, Z., Stuitje, A. R., and Derewenda, Z. S. (1995). ‘‘The Escherichia coli malonyl-CoA:acyl carrier protein transacylase at 1.5-A resolution. Crystal structure of a fatty acid synthase component.’’ J. Biol. Chem. 270(22), 12961–12964. Shen, B. (2003). ‘‘Polyketide biosynthesis beyond the type I, II and III polyketide synthase paradigms.’’ Curr. Opin. Chem. Biol. 7(2), 285–295. Shen, B., and Hutchinson, C. R. (1996). ‘‘Deciphering the mechanism for the assembly of aromatic polyketides by a bacterial polyketide synthase.’’ Proc. Natl. Acad. Sci. 93, 6600–6604. Smith, S., and Tsai, S. C. (2007). ‘‘The type I. fatty acid and polyketide synthases: a tale of two megasynthases.’’ Nat. Prod. Rep. 24(5), 1041–1072. Sultana, A., Kallio, P., Jansson, A., Wang, J. S., Niemi, J., Mantsala, P., and Schneider, G. (2004). ‘‘Structure of the polyketide cyclase SnoaL reveals a novel mechanism for enzymatic aldol condensation.’’ EMBO J. 23(9), 1911–1921. Szafranska, A. E., Hitchman, T. S., Cox, R. J., Crosby, J., and Simpson, T. J. (2002). ‘‘Kinetic and mechanistic analysis of the malonyl CoA:ACP transacylase from Streptomyces coelicolor indicates a single catalytically competent serine nucleophile at the active site.’’ Biochemistry 41(5), 1421–1427.
46
Shiou-Chuan (Sheryl) Tsai and Brian Douglas Ames
Tang, L., Yoon, Y. J., Choi, C. Y., and Hutchinson, C. R. (1998). ‘‘Characterization of the enzymatic domains in the modular polyketide synthase involved in rifamycin B. biosynthesis by Amycolatopsis mediterranei.’’ Gene 216(2), 255–265. Tang, Y., Chen, A. Y., Kim, C. Y., Cane, D. E., and Khosla, C. (2007). ‘‘Structural and mechanistic analysis of protein interactions in module 3 of the 6-deoxyerythronolide B. synthase.’’ Chem. Biol. 14(8), 931–943. Tang, Y., Kim, C. Y., Mathews, G. II,, Cane, D. E., and Khosla, C. (2006). ‘‘The 2.7Angstrom crystal structure of a 194-kDa homodimeric fragment of the 6-deoxyerythronolide B. synthase.’’ Proc. Natl. Acad. Sci. USA 103(30), 11124–11129. Tang, Y., Lee, T. S., and Khosla, C. (2004). ‘‘Engineered biosynthesis of regioselectively modified aromatic polyketides using bimodular polyketide synthases.’’ PLoS Biol. 2(2), E31. Tang, Y., Tsai, S. C., and Khosla, C. (2003). ‘‘Polyketide chain length control by chain length factor.’’ J. Am. Chem. Soc. 125(42), 12708–12709. Terwilliger, T. (2004). ‘‘SOLVE and RESOLVE: Automated structure solution, density modification and model building.’’ J. Synchrotron Radiat. 11(Pt 1), 49–52. Thomas, R. (2001). ‘‘A biosynthetic classification of fungal and streptomycete fused-ring aromatic polyketides.’’ Chembiochem 2(9), 612–627. Thompson, T. B., Katayama, K., Watanabe, K., Hutchinson, C. R., and Rayment, I. (2004). ‘‘Structural and functional analysis of tetracenomycin F2 cyclase from Streptomyces glaucescens. A type II polyketide cyclase.’’ J. Biol. Chem. 279(36), 37956–37963. Tsai, S. C., Lu, H., Cane, D. E., Khosla, C., and Stroud, R. M. (2002). ‘‘Insights into channel architecture and substrate specificity from crystal structures of two macrocycleforming thioesterases of modular polyketide synthases.’’ Biochemistry 41(42), 12598–12606. Tsai, S. C., Miercke, L. J., Krucinski, J., Gokhale, R., Chen, J. C., Foster, P. G., Cane, D. E., Khosla, C., and Stroud, R. M. (2001). ‘‘Crystal structure of the macrocycle-forming thioesterase domain of the erythromycin polyketide synthase: Versatility from a unique substrate channel.’’ Proc. Natl. Acad. Sci. USA 98(26), 14808–14813. Tsujishita, Y., and Hurley, J. H. (2000). ‘‘Structure and lipid transport mechanism of a StAR-related domain.’’ Nat. Struct. Biol. 7(5), 408–414. Udwary, D. W., Merski, M., and Townsend, C. A. (2002). ‘‘A method for prediction of the locations of linker regions within large multifunctional proteins, and application to a type I. polyketide synthase.’’ J. Mol. Biol. 323(3), 585–598. Weissman, K. J. (2006). ‘‘The structural basis for docking in modular polyketide biosynthesis.’’ Chembiochem 7(3), 485–494. White, S. W., Zheng, J., Zhang, Y. M., and Rock, Y. M. (2005). ‘‘The structural biology of type II fatty acid biosynthesis.’’ Annu. Rev. Biochem. 74, 791–831. Witkowski, A., Ghosal, A., Joshi, A. K., Witkowska, H. E., Asturias, F. J., and Smith, S. (2004). ‘‘Head-to-head coiled arrangement of the subunits of the animal fatty acid synthase.’’ Chem. Biol. 11(12), 1667–1676. Witkowski, A., Joshi, A. K., and Smith, S. (2002). ‘‘Mechanism of the ß-ketoacyl synthase reaction catalyzed by the animal fatty acid synthase.’’ Biochemistry 41(35), 10877–10887. Witkowski, A., Joshi, A. K., and Smith, S. (2004). ‘‘Characterization of the beta-carbon processing reactions of the mammalian cytosolic fatty acid synthase: role of the central core.’’ Biochemistry 43(32), 10458–10466. Wu, J., Zaleski, T. J., Valenzano, C., Khosla, C., and Cane, D. E. (2005). ‘‘Polyketide double bond biosynthesis. Mechanistic analysis of the dehydratase-containing module 2 of the picromycin/methymycin polyketide synthase.’’ J. Am. Chem. Soc. 127(49), 17393–17404.
Structural Enzymology of Polyketide Synthases
47
Yadav, G., Gokhale, R. S., and Mohanty, D. (2003). ‘‘Computational approach for prediction of domain organization and substrate specificity of modular polyketide synthases.’’ J. Mol. Biol. 328(2), 335–363. Yu, T. W., Shen, Y., McDaniel, R., Floss, H. G., Khosla, C., Hopwood, D. A., and Moore, B. S. (1998). ‘‘Engineered Biosynthesis of Novel Polyketides from Streptomyces Spore Pigment Polyketide Synthases.’’ J. Am. Chem. Soc. 120(31), 7749–7759. Zawada, R. J., and Khosla, C. (1997). ‘‘Domain analysis of the molecular recognition features of aromatic polyketide synthase subunits.’’ J. Biol. Chem. 272(26), 16184–16188. Zawada, R. J., and Khosla, C. (1999). ‘‘Heterologous expression, purification, reconstitution and kinetic analysis of an extended type II polyketide synthase.’’ Chem. Biol. 6(9), 607–615. Zeeb, M., and Balbach, J. (2004). ‘‘Protein folding studied by real-time NMR spectroscopy.’’ Methods 34(1), 65–74. Zhang, W., Li, Y., and Tang, Y. (2008). ‘‘Engineered biosynthesis of bacterial aromatic polyketides in Escherichia coli.’’ Proc. Natl. Acad. Sci. 105(52), 20683–20688. Zhang, Y. M., Hurlbert, J., White, S. W., and Rock, C. O. (2006). ‘‘Roles of the active site water, histidine 303, and phenylalanine 396 in the catalytic mechanism of the elongation condensing enzyme of Streptococcus pneumoniae.’’ J. Biol. Chem. 281(25), 17390–17399. Zhang, Y. M., Wu, B., Zheng, J., and Rock, C. O. (2003). ‘‘Key residues responsible for acyl carrier protein and beta-ketoacyl-acyl carrier protein reductase (FabG) interaction.’’ J. Biol. Chem. 278(52), 52935–52943.
C H A P T E R
T H R E E
Fungal Type I Polyketide Synthases Russell J. Cox and Thomas J. Simpson Contents 50 54 57 57 61 64 66 66 69 72 74 74
1. Introduction 2. Partially Reducing PKSs: 6-Methylsalicylate Synthase 3. Nonreducing PKSs 3.1. Norsolorinic acid synthase 3.2. Tetrahydroxynaphthalene synthase 3.3. Bikaverin nonaketide synthase 4. Highly Reducing PKSs 4.1. Lovastatin (LNKS and LDKS) 4.2. HR PKS-NRPS: Fusarin and tenellin synthetases 5. NR/HR PKS Hybrid Systems: Zearalenone (ZAE1 and ZAE2) 6. Conclusions References
Abstract Fungi produce a wide variety of biologically active compounds, a large proportion of which are produced by the polyketide biosynthetic pathway. Fungal polyketides comprise a very large and structurally very diverse group, and many display important biological activities, including lovastatin, aflatoxins, and strobilurins. These are produced by very large multifunctional iterative enzymes, the iterative type I polyketide synthases (PKSs) whose closest structural and functional analogues are the mammalian fatty acid synthases. Although fungal polyketides were one of the first classes of secondary metabolites to be subject to extensive biosynthetic studies, they remain the least studied and understood at the enzyme level. This chapter presents an overview of methodologies that have been applied to in vivo and in vitro genetic and biochemical studies on the PKSs responsible for both aromatic and highly reduced polyketide metabolites, and which are providing an improved insight into how these highly complex enzymes function.
School of Chemistry, University of Bristol, Bristol, United Kingdom Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04603-5
#
2009 Elsevier Inc. All rights reserved.
49
50
Russell J. Cox and Thomas J. Simpson
1. Introduction Polyketides have long been recognized as one of the most important classes of fungal metabolites (Cox, 2007; O’Hagan, 1991). Fungal polyketides (Fig. 3.1) vary from the simplest monocyclic aromatic compounds, such as orsellinic acid and 6-methylsalicylic acid (6-MSA), to polyclic aromatics such as citrinin, deoxyherqueinone, and norsolorinic acid (NSA). Although initially associated with the formation of aromatic OMe R
Me
Me
Me
CO2H
O
Me
Me OH O
Norsolorinic acid
Deoxyherqueinone Me O
Me
OH
O
O HO
OH
O
O
OH
O
O
OH O
O
OH
O
O O
Me
O
O H
8’
7’
Me H
Me Zearalenone
Me
Me
Cl
OMe
MeO2C Strobilurin B
O Me
Me Me Xenovulence A
Lovastatin
O
OH
O
CO2H
Ph N H Ochratoxin A
O Me
CO2H O HO2C
O
OH
O
OH OH
O OH
Penicillic acid
MeO HO
H
O
H OH
O
Me
O OMe Aflatoxin B1
T-toxin
O O
HO Me
H Me
HO
O
O
O
O
OH Decarestrictine D
Me
OH
H Me
O
HO
Me Me
Citrinin
Orsellinic acid (R=OH) 6-methylsalicylicacid (R=H)
OH
OH
HO
O
HO2C
OH
OH O
O
HO
Me
O
Cl OH 8
O
Me
OH 1
Me
O
OH
O
R
Me
6 3 OH HO O MeO OMe THN (R=H) Bikaverin OH O Fumonisin B1 CO2H O ATHN (R=acetyl, MeCO-) AATHN (R=acetoacetyl, MeCOCH2CO-) OH OH Me O HO O Me OH N O O OH Me OH O HO O OH H Me O Me O SMA76a H Me Me Me HO LNKS hexaketide OH O Me 12 H Me 11 Monacolin J Equisetin 15 Me Me Me O N Me O Tenellin OH H O Me OH O HO CO2Me Me HO Me O Me H N Me HO Fusarin C H Dihydromonacolin L Me Me O N H R NH2
HO2C
OH Me
O
Me
pretenellin (R=H) protenellin D (R=OH)
Figure 3.1 Examples of polyketides synthesized by fungal type I iterative PKSs.
Fungal Type I Polyketide Synthases
51
compounds, many fungal polyketides are nonaromatic, such as the macrolides decarestrictine D, long-chain polyfunctional molecules exemplified by T-toxin, and the decalin, lovastatin. Many other metabolites consist of an aromatic ring attached to a more highly reduced moiety, such as zearalenone. Further diversity arises from extensive oxidative metabolism of preformed aromatic polyketides, such as penicillic acid from orsellinic acid and aflatoxin B1 from NSA. Yet other molecules contain a polyketide-derived moiety as part of a larger molecule, the remainder of which comes from other biosynthetic routes, such as the terpenoid humulene in the case of xenovulene A. Fungal polyketides have found wide use in pharmaceutical (Butler, 2005) and agricultural applications. Lovastatin, from Aspergillus terreus, was the progenitor of the now widely used statin group of cholesterol-lowering agents, and strobilurin, from Bolinea lutea, was the key lead for the development of the extensively used methoxyacrylate group of antifungal agents (Clough, 2000). In addition, mycotoxins such as the aflatoxins, ochratoxins, fuminosins, and zearalenone are of major economic importance due to the widespread problems in both human and animal health that can result from fungal contamination of growing and stored crops and foodstuffs. Although diverse in structure, fungal polyketides are defined by their common biosynthetic origin from condensation of simple acyl CoA thiolesters. As long ago as 1953, Birch realized that polyketide biosynthesis is related to fatty acid biosynthesis (Birch and Donovan, 1953), and some of the earliest applications of radioisotopes to natural product biosynthesis were to fungal polyketide metabolites, where the ease of fermentation and isolation of metabolites in pure form, and relatively efficient uptake of simple labeled precursors, facilitates the work (Hanson, 2008). In more recent years, fungal metabolites in general, and polyketides in particular, were the focus of the rapidly expanding applications of stable isotope–labeling methods in the 1970s and 1980s (Simpson, 1987). Fungal PKSs comprise large multifunctional multidomain proteins that assemble these simple acyl units in a highly programmed and iterative fashion to make a huge range of complex natural products, using the simple reactions of Claisen C–C bond formation, followed by varying degrees of reduction and C-methylation via S-adenosylmethionine, each of which is controlled by specific catalytic domains on the PKS (Simpson, 1995). The understanding of the relationship between fatty acid synthase (FAS) and PKS proteins, the application of molecular genetics, and more recently genomics, has greatly facilitated the discovery and understanding of polyketide synthases from diverse sources. The homology in catalytic function between FAS and PKS enzymes is preserved in their respective gene sequences. It is now clear (Cox, 2007) that fungal PKSs belong to the class of type I iterative synthases represented by mammalian FAS. Type I FAS proteins are large multifunctional proteins in which single (or occasionally two)
52
Russell J. Cox and Thomas J. Simpson
peptides contain the sequences for ketosynthase (KS), acyl carrier protein (ACP), malonyl/acyl transferase (MAT), ketoreductase (KR), dehydratase (DH), enoyl reductase (ER) and thiolesterase (TE) activities; these catalytic functions are carried out by particular functional domains. Similarly, the genes for type I PKS proteins are correspondingly large single open reading frames (ORFs) and type I PKSs consist of very large multifunctional proteins, typically 180 to 250 kDa, with individual functional domains. Fungal PKS genes often contain multiple introns, which must be removed prior to heterologous expression in bacteria or yeast. Thus, PKSs use much the same array of chemical reactions as FASs—but the key difference is that of programming: FASs have to control only chain length (i.e. the number of extensions), but PKSs are able to additionally control starter unit selection and the extent of reduction and dehydration during each condensation cycle. Fungal PKSs are also able to program the extent of chain methylation and the off-loading mechanism. The issue of programming is key to understanding and exploiting PKSs. In the case of the bacterial modular polyketide synthases, each condensation cycle is catalyzed by a discreet module containing all the catalytic domains required (Staunton and Weissman, 2001, and other chapters in this volume). In this case the program is explicit in the order and composition of the modules. However, for the iterative type I fungal PKSs, the program is cryptic—encoded in the PKS itself. Understanding the factors that control this programming is arguably the greatest remaining problem in natural product biosynthesis and also represents a great fundamental problem in enzyme catalysis. Thus, the huge structural variety of fungal polyketides is due to differences in programming of their PKS proteins—apparent increases in structural complexity are due to increasing use and control of reductive, dehydrative and methylating steps by the PKS. This must be due to differences in PKS protein sequence and structure. This fact has been exploited in the development of rapid methods for the cloning of fungal PKS genes associated with the biosynthesis of particular fungal polyketide types. Lazarus and Simpson realized that these subtle protein sequence differences should be reflected in DNA sequence and that polymerase chain reaction (PCR) primers could be designed to selectively amplify fragments of fungal PKS genes from fungal genomic DNA (or cDNA). In early work (Bingle et al., 1999), they hypothesized that fungal polyketides could be grouped into two classes: nonreduced (NR) compounds, such as orsellinic acid, NSA and 1,3,6,8-tetrahydroxynaphthalene (THN), and partially reduced (PR) compounds, such as 6-MSA. At the time, very few fungal PKS genes were known, and based on very limited sets of sequences they designed degenerate PCR primers that were complementary to conserved DNA sequences in the KS domains in fungal PKSs responsible for the biosynthesis of NR and PR compounds. Thus, sequences for the available PKS protein sequence KS domains were aligned and inspected
53
Fungal Type I Polyketide Synthases
for regions of high homology, and in particular, sequences that were conserved between PKS sequences for structurally similar compounds but different from conserved sequences for FAS proteins or PKS proteins for structurally different compounds. Additionally, the primers needed to be located away from regions known to harbor introns and be far enough apart to yield PCR products which would be easily analyzed by gel electrophoresis (about 700 bp in this case). Thus, one primer pair (designated LC1/LC2c) was designed to be selective for unreduced PKSs and another set (LC3/LC5c) (Fig. 3.2) for partially reduced PKSs. These primers incorporated degeneracy—that is, included either mixed bases or inosines at defined positions—in order to allow for codon variation in different template organisms. In initial experiments, genomic DNA was prepared from a number of fungi known to produce polyketides. PCR reactions were then performed using the PCR primer pairs, and the products separated by gel electrophoresis. In these reactions conditions were optimized for efficient product formation by varying the ratio of primer concentrations and by including varied amounts of Mg2þ ions and/or varying the PCR annealing temperature. In all cases it was possible to amplify sequences of the expected length. The PCR products were then cloned and sequenced. This showed that the cloned products were always the expected 700-bp fragments of KS domains of PKS genes. Tree-plot analysis, using both the known PKS sequences and
2270
0 1000
KS
KR
LC3 LC1 Cys (1600)
LC2c LC5c
Figure 3.2 PKS primers designed to selectively amplify regions of unreduced and partially reduced fungal PKS genes.
54
Russell J. Cox and Thomas J. Simpson
the PCR products, showed a clear relationship between the clades and the chemical structures of the PKS products (where known). Thus, the primers designed to amplify fragments of unreduced PKSs (LC1/LC2c) gave PCR products which closely grouped with the unreduced clade of known sequences. Likewise the LC3/LC5c primer-amplified products most closely grouped with the partially reduced PKS clade. This was an important result as it showed a clear link between sequence and chemical structure. Later (Nicholson et al., 2001), the same analysis was extended to the KS domains of highly reduced (HR) compounds, such as lovastatin, when DNA sequence data became available for the lovastatin nonaketide and diketide synthases (LNKS and LDKS, respectively) (Hendrickson et al., 1999). The availability of these sequences also allowed the development of selective PCR primers for C-methyltransferase (C-MeT) domains. This sequence analysis has been significantly extended as genomic approaches have been applied to fungi (Kroken et al., 2003). Full genome sequences have now been obtained for more than a dozen fungi. In each organism, many PKS genes have been discovered. For example, Aspergillus niger contains 34 PKS genes (Pel et al., 2007), so there are now several hundred fungal PKS genes known. Sequence comparison of all these new PKS genes, however, shows that the three classes of fungal PKS genes predicted by Simpson and Lazarus are the same three classes observed in the most recent sequence comparisons. Despite the fact that so many fungal PKS genes have been discovered, relatively few genes have been definitively linked to the biosynthesis of specific metabolites. In this chapter, examples of in vivo enzymological studies and associated in vitro genetic manipulations will be presented in outline, and where appropriate in more detail, by discussing progress with a selection of molecules chosen to represent the range of fungal polyketide structures. Further discussion of genetics (Hoffmeister and Keller, 2007), gene cloning (Schu¨mann and Hertweck, 2006), and other biosynthetic aspects (Simpson and Cox, 2009) can be found in a number of recent reviews.
2. Partially Reducing PKSs: 6-Methylsalicylate Synthase 6-Methylsalicylate synthase (MSAS) from Penicillium patulum, at 191 KDa, is one of the smallest type I PKS. It was the first fungal PKS to be purified, in 1970 (Dimroth et al., 1970), and purifications were subsequently described by a number of other workers (Beck et al., 1990; Scott et al., 1974). In 1992, a greatly improved method was described by ShoolinginJordan (Spencer and Jordan, 1992). The synthase was isolated in homogeneous form from P. patulum grown in liquid culture to ensure that the cells
Fungal Type I Polyketide Synthases
55
were all of approximately the same age and morphology. The mycelium was harvested after about 26 h when the enzyme level assayed by fluorimetric determination of 6-MSA (using an incubation mixture (in 2 ml) of Tris/ sulfate buffer, pH 7.6; 160 mM acetyl CoA, 0.4 mole; NADPH, 0.4 mM; BSA 2.5 mg; 0.2 to 1.0 m-unit of MSAS in a total volume of 2 ml at 25 for 10 min, initiated by addition of 0.4 mM of malonyl CoA) was at a maximum. Longer fermentation times lead to decreased yields of purified synthase due to increasing proteolysis in the older cultures. MSAS copurifies initially with P. patulum FAS, but the latter is removed during the purification steps of poly (ethyleneglycol) 6000 precipitation, DAE-sepharose ion-exchange, followed by hydroxyapatite chromatography, and finally FPLC Mono Q purification. The enzyme is highly susceptible to proteolytic degradation, so the purification is carried out in the presence of protease inhibitors phenylmethylsulfonyl fluoride (PMSF), benzamidine and 15% glycerol. It exists as a homotetramer, as determined by gel filtration using a Sephacryl S400 column. It is inactivated by 1,3-dibromopropane, leading to formation of cross-linked dimers, as evidenced by SDS gel electrophoresis. Acetyl CoA and malonyl CoA protect the enzyme against inhibition and dimerization. It will accept acetoacetate as an alternative starter to acetyl CoA. The enzyme also catalyses the formation of small amounts of triacetic acid lactone (TAL) and, in the absence of NADPH, this becomes the exclusive product. This truncation of polyketide chain elongation in the absence of a reductive capability is reminiscent of the lack of fidelity of in vivo chain elongation when the lovastatin and fusarin PKSs, LNKS and FUSS, respectively, are expressed in the absence of the accompanying trans-acting ER domains (see Section 4.1). When the incubation is carried out in the absence of both NADPH and acetyl CoA, other acyl CoA starter units can be utilized, but again only two chain-extending condensations take place, to give a series of alkyl-TAL derivatives, indicative of a ‘‘counting’’ mechanism for chain length control rather than the ‘‘measuring’’ mechanism established for the bacterial type II actinorhodin minimal PKS (Nicholson et al., 2003). Schweizer and coworkers used the purified MSAS to raise antibodies which were used for immunological screening of an Escherichia coli expression library of P. patulum genomic DNA (Beck et al., 1990). This led to isolation of the MSAS gene along with flanking sequences: 7.1 Kb of the cloned genomic DNA was sequenced, the MSAS gene being identified as a 5322-bp ORF coding for a protein of 1774 amino acids. The obtained cDNA revealed a 69-bp intron at the N-terminal part of the MSAS gene. It has a relatively low degree of similarity to the yeast and Penicillium FAS, and a significantly higher sequence similarity was found to the mammalian (rat) FAS. The domain structure is similar to the FAS, with an N-terminal KS followed by AT, DH, and KR domains, terminating with an ACP and no TE or similar release-mechanism domain (Fig. 3.3A).
56
A
Russell J. Cox and Thomas J. Simpson
AT
KS
Loading B
SAT
Core
DH
Processing
Extension KS
AT
ACP
KR
ACP TE/CLC
PT
lovC
ER
C
KS KS
D
KS
AT AT
AT
DH DH
C–MeT
(ER)
C–MeT
DH C–MeT (ER)
KR
ER
KR ACP
Other
ACP ACP
KR
C
A
lovB
C lovF
T R/DCK
Figure 3.3 Representative domain architectures of iterative PKS genes in fungi. (A) MSAS, a partially reducing (PR) PKS from Penicillium patulum; (B) general structure of a nonreducing (NR) PKS; (C) highly reducing (HR) PKSs, LNKS (lovb), and LDKS (lovF) from Aspergillus terreus, and the accessory reductase gene lovC; and (D) general structure of a HR PKS-NRPS. KS, b-ketoacylsynthase; AT, acyl (acetyl and/or malonyl) transferase; C-MeT, C-methyltransferase; DH, dehydratase; KR, ketoreductase; ACP, acyl carrier protein; SAT, starter unit, ACP transcylase; PT, product template; TE, thiolesterase; CLC, Claisen cyclase; ER, enoyl reductase; C, condensation; A, adenylation; T, thiolation/peptidyl carrier protein; R, reductase; DCK, Dieckmann cyclase.
Expression of P. patulum MSAS in heterologous hosts has allowed functional experiments to be performed. It was initially expressed in Streptomyces coelicolor CH999 (Bedford et al., 1995) and subsequently in E. coli and Saccharomyces cerevisiae (Kealey et al., 1998). The latter bacterial and yeast systems required coexpression with a phosphopantetheinyl transferase (PPTase), Sfp from Bacillus subtilis (Lambalot et al., 1996), to ensure that the encoded apo-ACP was converted to its active holo-form. The yields of 6-MSA in the bacterial systems were lower than in P. patulum, but the yeast expression resulted in yields which were twofold higher (1.7 g/l) than in the native host. A 6-MSA encoding gene, atX, was also identified in the genome of A. terreus via Southern blot analysis with the P. patulum MSAS gene (Fujii et al., 1996). Sequencing revealed a 5.5-kb ORF with a 70-bp intron,
Fungal Type I Polyketide Synthases
57
again near the N-terminus. The gene was cloned using the fungal expression vector PTAex3 into Aspergillus nidulans—the consequent production of 6-MSA establishing the function of ATX as a MSAS. The same group went on to develop an S. cerevisiae expression system in which two independent copies of ATX can be produced simultaneously (Moriguchi et al., 2006). This allowed deletion experiments showing that at the N-terminal, 44 amino acids could be removed without loss of activity but that a deletion of 88 amino acids resulted in removal of key KS residues and loss of 6-MSA production. At the C-terminus, removal of as few as nine amino acids resulted in loss of activity. In vivo recombinations of separate deletion mutants, each inactive in isolation, led to restoration of 6-MSAS production, showing that, for example the KS of one peptide chain must interact with the ACP of another. Further deletion analysis allowed the identification of a core interdomain (ID) region, between the DH and KR domains, which is essential for subunit–subunit interactions in the tetrameric structure. These experiments have recently been extended to introduce point mutations in all of the individual domains (Moriguchi et al., 2008). Coexpression of the same single domain mutants gave no 6-MSA production, but coexpression of mutants with different point mutations could all complement one another to restore 6-MSA production. Interestingly, coexpression of two KR mutants gave production of TAL.
3. Nonreducing PKSs 3.1. Norsolorinic acid synthase Norsolorinic acid (NSA) is the first isolable intermediate in the biosynthesis of the potent hepatocarcinogen aflatoxin B1 (Brown et al., 1999). Although initially believed to be a decaketide, formed from an acetate starter unit and nine malonate extender units, isotope labeling experiments suggested that it was likely to be an octaketide primed by a hexanoate starter (McKeown et al., 1996). This was given credence by, inter alia, genetic analysis which showed that transformation of Aspergillus parasiticus with a disruption construct, PXX, blocked aflatoxin biosynthesis (Chang et al., 1995). The disruption was attributed to a single crossover homologous integration event at a specific locus in the A. parasiticus genome, designated pksA. Sequence analysis suggested that pksA is a homologue of the A. nidulans wA gene, a PKS gene involved in conidial pigment biosynthesis (Fig. 3.3B). The sequence contained KS, AT and ACP domains, but no KR or ER were found. The pksA gene lies in the aflatoxin pathway gene cluster adjacent to nor-1, a gene required for conversion of NSA to the next proposed intermediate, averantin, suggesting that PksA was the PKS responsible for the biosynthesis of NSA. Subsequently, Townsend realized that hexA and
58
Russell J. Cox and Thomas J. Simpson
hexB, two genes encoding the a and b subunits of a typical yeast FAS, which were clustered with the NSA PKS, probably produced hexanoate for use as the NSA starter unit (Hitchman et al., 2001). He was able to partially purify (Watanabe and Townsend, 2002) a 1.4-MDa complex, NorS, consisting of these three proteins, from A. parasiticus by diafiltration of a cell-free extract (CFE) prepared from flash-frozen mycelium. The powdered mycelium was suspended in buffer comprising 100 mM potassium phosphate, pH 7.5, 50% glycerol, 2 mM DTT and 1 mM EDTA. The resulting suspension was stirred at 4 for 2 h and centrifuged at 20,000g to give the crude CFE. This was filtered through four layers of cheese cloth, followed by dialysis against buffer supplemented with 30% glycerol, and the final diafiltered CFE was prepared using an Amicon RA 2000 apparatus equipped with a 100,000molecular weight cut-off membrane. This CFE (10 ml) was assayed by incubation with 10 ml [2-14C]-malonyl CoA (25 mCi/ml) and 1 ml hexanoyl CoA (1 mg/ml) and 80 ml of cofactor solution containing NADPH, SAM and FAD (each 1 mg/ml) in distilled water. NSA was detected by TLC autoradiography or HPLC and scintillation counting of collected fractions. The problems associated with working with such a large, labile complex at wild type concentrations precluded further detailed studies. This led to two groups adopting a ‘‘deconstruction’’ approach involving cloning and heterologous expression of individual domains and subsets of the NSAS catalytic domains. A problem associated with this approach is the need to identify the domain boundaries and so the problem of cloning and expressing the part of the PKS gene which will produce soluble, stable, and active protein. The Townsend group has developed a bioinformatics method, the UMA algorithm, which predicts the inter-domain linker regions within related multidomain systems by combining protein sequence similarity, predicted secondary structure and local hydrophobicity (Udwary et al., 2002). The weightings ascribed to the different factors can be varied to give the best indication (low UMA score) of domain boundaries and hence potential cutting and cloning sites. This analysis has revealed (Fig. 3.3B) two hitherto unsuspected domains in NR PKSs (Crawford et al., 2006). The first is a central product template (PT) domain that may be involved in the control of polyketide intermediate chain-length, folding, and stabilization. The PT domain appears to be unrelated to the core ‘‘docking’’ domain of NR PKSs. Cox has carried out a phylogenetic analysis of PT domains from NR PKSs whose products are known and this does reveal a distinct relationship between chain length and clade structure of the resulting treeplot (Bailey et al., 2007). The second is an extended N-terminal domain that can now be seen to function as a starter unit-selecting domain: starter unit-ACP transacylase (SAT). Detailed in silico analysis of SAT domains revealed an unexpected similarity to known malonyl CoA: acyl carrier protein transacylases (malonyl transferases, MAT). The active sites of MAT enzymes contain a
Fungal Type I Polyketide Synthases
59
conserved GHSXG motif in which the conserved serine is known to form an O-acyl intermediate, with a downstream conserved histidine, to give the catalytic dyad (Serre et al., 1995). In the NSAS SAT domain, sequence alignment reveals a similar conserved GXCXG motif and conserved histidine, and it is proposed that the SAT domain substitutes the more reactive thiolester chemistry for the oxy-esters used by MATs in transferring the starter unit to the PKS ACP for subsequent chain elongation. The ACP and SAT domains were cloned, separately expressed, and purified. UMA was used to predict the linker region between the SAT and KS domains to select appropriate oligonucleotides for domain amplification. Three sites were chosen within the linker region for attachment of a C-terminal hexa-histidine (His6) tag in pET28a(þ) to generate pENTC1, pENTC2, and pENTC3. The SAT domain was expressed at 20 in E. coli Rosetta2(DE3), which codes for extra tRNAs to assist expression of eukaryotic genes. Of the three active enzymes, SAT3, arising from pENTC3, demonstrated the greatest stability, and so was used for all further experiments. To demonstrate Cys-117 involvement in the acyl transfer reaction, this proposed catalytic residue was mutated to yield C117A by overlap extension PCR (Ho et al., 1989). Priming sites within putative linker regions surrounding the ACP domain were predicted as above. Because this domain is internal, oligonucleotides were designed with multiple restriction endonuclease sequence tags to facilitate cloning of both the N- and C-terminal His6 tag fusions. The N-terminal His6 tag-fusion expression construct in pET28a(þ), pEACP, gave the soluble ACP domain in E. coli BL21(DE3). MALDI-TOF mass spectrometry indicated a mixture of apo- and holo-ACP, so the purified mixture was fully converted to the holo-ACP by reacting with CoA in the presence of Svp, a PPTase from Streptomyces verticillus (Sanchez et al., 2001). As a control, the invariant phosphopantetheine attachment site was mutated to yield S1746A. The ability of the isolated SAT domain to transfer hexanoate to the ACP domain was demonstrated by incubation of combinations of SAT, SATC117A, holo-ACP and ACP-S1764A, after dialysis against 100 mM potassium phosphate buffer (ph 7.0) in 10 mM final concentrations of each in the presence of 200 mM [1-14C]-hexanoyl CoA at 25 for 2 min. Reactions were quenched with SDS/loading buffer and separated on SDS/12% polyacrylamide gel which, after drying, was exposed to BioMax XAR film. This showed the covalent attachment of hexanoate to SAT and transfer to the holo-ACP. The ability of SAT to transfer different acyl groups was tested by using pantetheine as an acceptor in a modification of a procedure developed by Smith to monitor the ability of KS in mammalian FAS to accept and transfer fatty acyl groups to the ACP (Witkowski et al., 1997). To determine the relative rates, pantetheine (2.5 mM final) and acyl-CoAs (1 mM ) were mixed on ice in 100 mM potassium phosphate (pH 7.0). The mixture was preincubated at 28 for 1 min, and the reaction was started by the addition
60
Russell J. Cox and Thomas J. Simpson
of enzyme preincubated to 28 (0.5 mM final in 100 mM potassium phosphate, pH 7.0). The reaction mixture was incubated at 28 , and 100 ml aliquots were quenched in 100 ml of 8 M urea at room temperature for 2, 4, 6, and 8 min. The quenched reaction samples were frozen in liquid nitrogen and stored at -80 for HPLC analysis. For substrates ranging from acetyl to palmityl, SAT exhibits marked chain-length selectivity, with a strong preference for hexanoyl and octanoyl, with hexanoyl having the faster (about twofold) rate. In an extension of this work, Townsend has used protein database analysis to identify similar FAS-PKS hybrid systems in the pathogenic fungi Coccidioides immitis and Coccidioides posadasii (Crawford et al., 2008a). The NR PKS contains an SAT domain, and similar expression and substrate specificity studies indicate in this case a marked preference for octanoate. This may guide isolation and structure elucidation studies of the, as yet unidentified, metabolites. Further related work on THN synthase will be discussed in the following section. Complementary experiments on NSAS deconstruction have been reported by Cox and coworkers (Ma et al., 2006). They successfully expressed the NSAS AT and ACP as single biochemically active domains. The approach to identifying domain boundaries was simpler and involved performing multiple alignments using a commercial alignment package (AlignX, Invitrogen) and comparisons with type II PKS and FAS components. In contrast to the UMA approach, this allowed the isolation of an active AT (MAT) domain from A. parasiticus. The AT was initially expressed in insoluble form. A refolding strategy involving initial solubilization in CAPS buffer (N-cyclohexyl-3-aminopropanesulfonic acid) and N-lauryl sarcosine resulted in good yields of soluble AT protein, but this protein preparation proved unstable toward precipitation and was inactive in enzyme assays. Similarly, insoluble recombinant AT protein was obtained from the type I mammalian FAS when expressed in E. coli (Rangan and Smith, 1996). They, however, were able to successfully refold the FAS AT in vitro to give soluble active protein. They also showed that a range of AT clones of differing lengths behaved similarly (Rangan et al., 1997). Thus, two additional NSAS AT clones were constructed based on homology to expressed AT domains of the mammalian FAS. The longer of the two AT clones (ATlong) extends by an additional 26 aa at the C-terminus compared with the first AT clone, while the shorter of the two (ATshort) is six amino acids shorter than the first AT clone at the C-terminus. Both new constructs avoid the proline- and lysine-rich sequence (PKSKPK) at the N-terminus of the previous clone. These two new clones were subjected to expression trials, with similar results—very limited soluble protein was observed, with almost all protein produced as inclusion bodies. Good yields of soluble and active NSAS AT were finally achieved using commercially available TB medium (Overnight Express Instant TB Medium, Novagen), and slow overnight expression at 18 led to the
Fungal Type I Polyketide Synthases
61
production of significant amounts of soluble protein for all three AT clones. A single colony was picked and used to inoculate LB medium plus kanamycin (100 ml, 100 mg/ml), which was incubated until the OD600 reached 0.8-1.0 (about 5 h). The mixture was then stored overnight at 4 . The cells were pelleted by centrifugation (SLA 3000, 11,000 rpm, 15 min), then resuspended in fresh LB medium (50 ml) plus kanamycin (100 mg/ml). The resuspended pellet was used to inoculate instant TB medium (Novagen) plus kanamycin (1 l, 100 mg/ml), which was incubated at 37 and 250 rpm for 2 to 3 h, then at 18 and 250 rpm overnight. The cells were harvested by centrifugation (SLA 3000, 11,000 rpm, 15 min), resuspended in an appropriate buffer and stored at –20 until use. In particular, the ATlong clone gave exceptional amounts of soluble protein that could be purified by using Ni2þ affinity chromatography on His-Bind resin (Novagen) and gel filtration (Hiload 26/60 Superdex 75 column). The AT catalyzed the transfer of malonyl groups from CoA onto ACP, but failed to transfer potential starter groups, such as hexanoate, from CoA or FAS-ACP, confirming that it is not involved in PK chain-priming. A mass spectrometric acyl transfer assay was used in which NSAS holo-ACP (50 mM ) was incubated with malonyl CoA or hexanoyl CoA (50 mM—1 mM ) and NSAS ATlong (10 mM ) in phosphate buffer (20 mM, pH 7.5) at 30 . The total volume was 100 ml. After ˚ , Phenomenex) purification method 30 min, the C4 ( Jupiter 15, 300 A (Winston and Fitzgerald, 1998) was used to purify and desalt the reaction mixture prior to analysis by ESMS (QStar). Recently Townsend has reported that NSAS activity can be reconstructed in vitro from partially deconstructed systems (Crawford et al., 2008b). NSA synthetic activity can be observed in a series of systems in which a SAT-KS-MAT tridomain is incubated with varying combinations of the PT, ACP, and TE domains as single-, di- or tri-domain constructs. The importance of the PT domain is shown by the lack of product when it is omitted from the incubations. In the absence of the TE/CLC domain, efficient formation of the final carbocyclic ring is impaired, with a naphthopyrone product predominating. The necessity for the intact SAT-KS-MAT tridomain and its ability to then interact productively with single domains may have important structural implications and again finds parallels in the results from minimal type II PKS systems.
3.2. Tetrahydroxynaphthalene synthase The formally pentaketide-derived 1,3,6,8-terahydroxynaphthalene (THN) is produced in a number of plant pathogenic fungi where it is the key intermediate in the formation of melanin, which is essential for appressorial penetration of plants and thus for the mechanism of pathogenicity towards many commercially important crops (Bell and Wheeler, 1986). As such, the pathway is of great economic importance and a number of effective
62
Russell J. Cox and Thomas J. Simpson
agrochemicals work by inhibiting melanin formation. The conversion of THN to melanin is well understood and, in addition to the PKS responsible for its formation, there are clustered ‘‘ketoreductase’’ and dehydratase genes that act to convert THN to 1,3,8-tri- and 1,8-dihydroxynaphthalenes by successive reduction and dehydration sequences. These are interesting examples of postaromatization deoxygenations of polyketides that contrast with the normal processive mode of carbonyl modification. Interestingly, the fungal melanin ‘‘KRs’’ group with other fungal genes encoding postaromatization reductases, such as versicolorin reductase, and the S. coelicolor type II PKS actIII KR, rather than with the processive KRs of modular PKS and FAS systems (Nicholson, 2000). The dihydroxynaphthalene then undergoes an oxygenase (laccase)-mediated polymerization to produce the melanin pigment. THN is a symmetrical compound with no apparent starter unit. It was presumed to be a pentaketide formed by condensation of acetate with four malonates. A number of possibilities then exist for the folding and condensation of the presumed polyketide intermediate. The THNS-encoding gene has been cloned and sequenced from several fungi, including, as pks1, from Colletotrichum lagenarium (Fujii et al., 1999). Pks1 has been heterologously expressed in Aspergillus oryzae and partially purified (Fujii et al., 2000). The fungal expression plasmid pTAex3, containing the a-amylase (amyB) promoter of A. oryzae and auxotrophic marker argB of A. nidulans, was used. Pks1 gene expression plasmid pTAPSG was constructed based on the PKS1 genomic DNA plasmid pBSPKS. Thus, the N-terminal part of the PKS1 gene amplified by PCR, using its cDNA as a template, was ligated into Xba1/EcoR1-digested pBSPKS to give pBSPSG. The reconstructed pks1 ORF was then inserted into the EcoR1 cloning site just downstream of the amyB promoter of pTAex3 to construct expression plasmid pTAPSG. The argB host fungus A. oryzae M-2–3 was transformed by the protoplast-ethylene glycol method (Gomi et al., 1987). The transformants appearing on minimal plates after about 1 week were precultured in Czapek-Dox medium containing glucose and then transferred into an induction medium of Czapek-Dox containing starch. After 3 days of incubation, the culture medium was acidified with 1 M HCl and extracted with ethyl acetate. This led to the identification of a number of penta- and tetra-ketide metabolites, with THN as the major component. A cell-free extract was then prepared from mycelium from a 3-day-old culture grown at 30 on a rotary shaker at 200 rpm. The mycelium was harvested on a Buchner funnel, washed with distilled water, and flash frozen before pulverization. The resulting powder was suspended in 50 mM potassium phosphate buffer, pH 7.5, containing 30% glycerol, 2 mM b-mercaptoethanol, 1 mM EDTA, and 0.1 mM benzamidine. The mixture was stirred on ice for 20 min and then centrifuged at 10,000g for 20 min. The supernatant was filtered through four layers of gauze and the resulting
Fungal Type I Polyketide Synthases
63
CFE was subjected to ultracentrifugation at 50,000g for 1 h. The supernatant was further fractionated by ultracentrifugation at 21,000g for 2 h. SDS-Page analysis indicated an intense band at 230,000 kDa, corresponding to the molecular weight of the deduced PKS1 protein. Enzymatic synthesis of THN was confirmed by incubation of 150 ml of the CFE in 50 ml of 50 mM potassium phosphate buffer, pH 7.5, 25 ml of 100 mM acetyl CoA, 25 ml of 180 mM [2-14C]-malonyl CoA (5.55 105 dpm) for 30 min at 30 . After acidification with 50 ml of 6 M HCl, the reaction mixture was extracted with ethyl acetate. THN was detected as its tetra-acetate by TLC autoradiography after acetylation with acetic anhydride and pyridine, to establish in vitro synthesis of a multiaromatic ring fungal metabolite for the first time. The incubation and analysis conditions were then slightly modified to allow direct detection by HPLC. The incubations were repeated in the presence of [1-14C]-acetyl CoA and unlabeled malonyl CoA, and in the presence and absence of acetyl CoA with 14C-labeled malonate. In the absence of labeled malonate, THN production was detected by HPLC but it contained no radiolabel. In the other experiments, labeled THN was detected at the same level as before, regardless of the presence or absence of acetate. These experiments clearly demonstrated that no acetate primer was necessary, and this was rationalized by proposing that THNS uses malonate for both chain priming and elongation. While there is no precedent for this in fungal polyketide biosynthesis, the bacterial type III PKSs, such as RPPA, a THNS from S. coelicolor, has been shown to use only malonyl CoA (Funa et al., 1999). In common with several other fungal NR PKSs, PKS1/THNS has a terminal TE/CLC domain (Fig. 3.3B). Claisen cyclase (CLC) domains have been demonstrated to effect release of polyketide product from the PKS by a resorcinol ring-forming Claisen condensation reaction (Fujii et al., 2001). Subsequent work (Watanabe and Ebizuka, 2004) reexamined the products resulting from heterologous expression of PKS1 in A. oryzae. In addition to the major pentaketide product, THN (50%), they isolated the monocyclic pentaketide, a-acetylorsellinic acid (25%), the tetraketide orsellinic acid (10%) and, surprisingly, 15% of a hexaketide, 2-acetyl-1,3,6,8-tetrahydroxynaphthalene (ATHN). They then studied two PKS1 mutants in which the CLC domain had been excised or inactivated by point mutation of the presumed active-site serine (S2009A). Both of these mutants now produced predominantly (95%) the hexaketide product. They explained these observations by proposing a new role for the CLC in controlling chain length, specifically that it intercepted the polyketide intermediate from the ACP domain during chain elongation to produce the shorter chain-lengths. An alternative scenario which obviates the unusual need for malonate as a chain-starter in fungal polyketide biosynthesis, and that is consistent with the formation of THN as the major product of WT PKS1, is that the hexaketide precursor to ATHN is produced by PKS1, and that chainshortening occurs by loss of acetyl, to produce THN. This was indeed
64
Russell J. Cox and Thomas J. Simpson
suggested as long ago as 1983 (Bardshiri and Simpson, 1983), and has recently received experimental verification from Townsend who showed that the SAT domain from PKS1 and a number of other NR PKSs show a marked preference for acetyl CoA over longer-chain acyl CoAs and is essentially inactive towards malonyl CoA (Crawford et al., 2008c). It is possible that C. lagenarium harbors a homologue of AygP, which is known to effect loss of acetoacetate to form THN from the acetoacetyl analogue AATHN in Aspergillus fumigatus (Fujii et al., 2004). However, it is equally likely that THNS/PKS1 catalyses loss of acetyl via a retro-Claisen reaction as an essential part of the mechanism of cyclization and formation of the second aromatic ring.
3.3. Bikaverin nonaketide synthase Bikaverin is a tetracyclic nonaketide-derived metabolite of Gibberella fujikuroi. Its biosynthesis is mediated by the NR PKS gene, pks4. It provides the first example of an active PKS to be expressed and purified from E. coli. Tang and coworkers (Ma et al., 2007) used splice overlap extension PCR to amplify the uninterrupted gene from geonomic DNA from G. fujikuroi. The 6.1-kb gene was inserted into the expression vector pSMa76 which was introduced by transformation into E. coli BL21(DE3) for protein expression. For 1 l of liquid culture, the cells were grown at 37 in LB medium with 35 mg/ml kanamycin to an OD600 of 0.4, at which time the cells were incubated on ice for 10 min, and then induced with 0.1 mM IPTG for 16 h at 16 . The cells were harvested by centrifugation (3500 rpm, 10 min, 4 ), resuspended in 30 ml lysis buffer (20 mM Tris-HCl, pH 7.9, 0.5 M NaCl, 10 mM imidazole), and lysed using sonication on ice. Cellular debris was removed by centrifugation (15,000g, 1 h, 4 ). Ni-NTA agarose resin was added to the supernatant (1 ml/l of culture) and the solution was stirred at 4 for at least 2 h. The protein resin mixture was loaded into a gravityflow column and proteins were purified with increasing concentrations of imidazole in Buffer A (50 mM Tris-HCl, pH 7.9, 2 mM EDTA, 2 mM DTT). Purified proteins were concentrated and buffer exchanged into Buffer A þ 10% glycerol with Centriprep filter devices (Amicon Inc.). The final PKS4 enzyme was concentrated to 8 mg/ml, aliquoted, and flash frozen. SDS gel analysis showed a single band at 220 kDa. PKS4 was produced in an excellent yield of about 8 mg/l. The purified PKS4 (10 mM ) was assayed by incubation with 2 mM [2-14C]-malonyl CoA (4.5 mCi/mmol) in Buffer R (100 mM NaH2PO4, pH 7.4, 10% glycerol, 2 mM DTT) at room temperature. Individual aliquots (20 ml) were removed at different time points and were quenched with 250 ml of 99% ethyl acetate/1% acetic acid. The organic phase was separated, evaporated to dryness, re-dissolved in 20 ml of ethyl acetate, and the reaction mixture was separated by TLC with 99% ethyl acetate/1% acetic acid as the mobile phase. The resultant
Fungal Type I Polyketide Synthases
65
TLC plate, which was imaged and quantified by phosphoimager (InstantImager, Packard). This showed a new compound, which LC-MS analysis confirmed has a molecular weight of 322, in agreement with an unmethylated and unoxidized precursor of bikaverin. The identity of the new compound, SMA76a, was confirmed by scale-up of the in vitro reaction using the malonyl CoA synthase MatB from Rhizobium trifolii to generate malonyl CoA in situ from sodium malonate. The new compound was produced in a remarkable yield of about 100 mg/l. PKS4 appears to be efficiently phosphopantetheinylated by the endogenous E. coli holo-ACP synthase (ACPS), as assay of PKS4 expressed in E. coli BAP1, which contains a chromosomal copy of the broad-specificity PPTase Sfp, produced similar results to BL21(DE3) expression. This is in marked contrast to all previous studies on expression of PKS proteins or domains, such as expression of type II PKS ACPs, where efficient post-translational modification required coexpression of the ACP genes with a copy of the ACPS gene (Cox et al., 1997). Another feature is the apparent lack of requirement for acetyl CoA. This seemed to be consistent with the PKS4 lacking the coding sequence for the required cysteine in the CXCXG motif normally observed in SAT domains. However, Townsend has reported a frame-shift mutation in the published sequence on resequencing exons 1 and 2, which results in an alternative splicing pattern that does indeed contain the required motif (Crawford et al., 2008c). Using his SAT phosphopantetheine assay, he showed that the PKS4 SAT domain shows a preference for acetyl CoA and negligible activity with malonyl CoA. In light of these results and the THNS results discussed above, the suggested use of malonyl CoA as a starter appears unlikely and an alternative explanation for the apparent lack of requirement for acetyl CoA may be required. When various alkylacyl CoAs are added to the PKS4 incubation, PKS4 did not utilize any of the short-chain (C2 to C6) acyl CoAs but did produce two new benzopyrone metabolites when incubated with octanoyl CoA. This decreased the yield of SMA76a 10-fold. Significantly, the overall size of the new products is 18 carbons, the same as bikaverin and SMA76a. This is reminiscent of the bacterial type II minimal PKS where increasing the length of the starter unit decreases the number of condensations so that overall chain length remains constant (Nicholson et al., 2003). For the starter unit assays, alkylacyl-CoAs were each added to a final concentration of 2 mM. For LC-MS analysis, the same reaction mixture (100 ml) was prepared with unlabeled malonyl CoA (2 mM ). The organic residue was redissolved in methanol and analyzed by LC-MS with a Finnigan LCQ Deca XP quadrupole ion trap mass spectrometer using negative electrospray ionization and a Waters 2.1 100 mm C18 reverse-phase column. Samples were separated on a linear gradient of 5 to 95% CH3CN (v/v) over 30 min and 95% CH3CN (v/v) for a further 30 min in H2O supplemented with 0.05% (v/v) formic acid at a flow rate of 0.125 ml/min at room temperature.
66
Russell J. Cox and Thomas J. Simpson
4. Highly Reducing PKSs 4.1. Lovastatin (LNKS and LDKS) Lovastatin, a metabolite of A. terreus, is an inhibitor of the enzyme 3-hydroxy-3-methlyglutaryl (HMG) CoA reductase and thus is a potent inhibitor of cholesterol biosynthesis. Lovastatin and other natural and synthetic derivatives constitute the statin group of pharmaceutical agents which are amongst the major selling pharmaceutical agents of all time (Tobert, 2003). It is also the archetypal example of a metabolite produced via a highly reducing (HR) PKS and its biosynthesis has been the subject of extensive isotopic labeling, molecular genetic and biochemical studies (Sutherland et al., 2001). It comprises a decalin, formed by a presumed Diels-Alder cyclization of a highly reduced and monomethylated nonaketide precursor, to which is attached, via an ester linkage, a diketide-derived 3-methylbutyrate moiety. The biosynthetic genes were isolated by screening mutants of lovastatin-producing strains (Hendrickson et al., 1999). Several mutants were found which were deficient in production of either the nonaketide- or diketide-derived moieties, indicating that two separate PKSs were likely involved. A genomic cosmid library was constructed in an A. terreus/E. coli shuttle cosmid (pLO9) and this was used to complement the BX102 mutant, which was deficient in lovastatin production but which, when fed the nonaketide-derived monacolin J, efficiently converted it to lovastatin, suggesting that it was deficient in the gene encoding the lovastatin nonaketide synthase (LNKS). Comparison of crude protein extracts of the wild type and BX102 strains indicated that BX102 was completely deficient in a about 250-kDa protein. Conversely, a different polypeptide of about 220 kDa was missing from monacolin J–producing mutants. On transformation, one lovastatin-producing transformant was identified and the cosmid was recovered by in vitro packaging of its genomic DNA. In addition, cDNA libraries were prepared in the E. coli vector lgt11 using mRNA from a lovastatin-producing culture and were screened with antiserum raised against the 250-kDa protein. This led to the isolation of 18 clones. Two of these were found to hybridize to the BX102-complementing cosmid clone. One of the two isolated cDNA clones was then used to isolate overlapping clones from the genomic library to give an 11.6-kb region coding for the LNKS (Fig. 3.3C). Specific primers were then used to obtain the cDNA sequence by PCR. Using the LNKS gene (lovB) as a probe, Hutchinson and coworkers (Kennedy et al., 1999) isolated cosmids containing lovB and the surrounding genomic DNA from an A. terreus genomic library. DNA sequencing and analysis of cosmids pWHM1263 and pWHM1265 revealed 10 potential genes over 64 kb, whose functions could be predicted by sequence comparisons. Of these, two—lovB and lovF—encode PKSs, the latter the lovastatin diketide synthase (LDKS).
Fungal Type I Polyketide Synthases
67
To further investigate the role of lovB, it was heterologously expressed in A. nidulans under the control of the alcA promoter. This showed a major high molecular weight protein on SDS-polyacrylamide gel electrophoresis. The protein cross-reacted with antibodies to LNKS, confirming its overexpression. Further growth and induction by the alcA promoter resulted in the isolation of two compounds which were not immediately related to monacolin J. These were two monomethylated fully unsaturated hexaketide- and heptaketide-derived pyrones. An A. terreus mutant disrupted in the lovC gene, encoding a putative enoyl reductase (ER), was blocked in lovastatin production, but also produced the hexaketide pyrone metabolite. The formation of this truncated and incompletely processed polyketide suggested that LNKS and LovC must interact to produce the polyketide of the correct length and correct reduction and cyclization pattern. Thus, lovC was placed under the control of the alcA promoter and was used to transform strain WMH1738 containing LNKS. Transformant colonies were grown under inducing conditions for alcA and the extracts were analyzed by TLC and HPLC. Several transformants, including WHM1750, were found to produce dihydromonacolin L, which therefore must be the immediate product of LNKS (plus LovC), and greatly reduced amounts of the aberrant pyrones. The fact that LNKS and LovC together make the functional PKS for monacolin production was unexpected at the time and had few precedents, such as the formation of TAL from MSAS alluded to in Section 2 (Spencer and Jordan, 1992). While LNKS does possess a putative ER domain, this suggests that it is inactive, or at least inactive on its own, and that the PKS requires the trans association with the ER encoded by lovC to produce a fulllength, correctly reduced nonaketide. This has subsequently been observed with a number of other, hybrid, PKS-NRPS systems (Halo et al., 2008). An important step in lovastatin biosynthesis is the intramolecular DielsAlder cyclization of the polyunsaturated nonaketide or an earlier precursor. Using a combination of synthesis of putative substrates and purified LNKS, along with a careful analysis of presumed spontaneous cyclization and enzyme-mediated products, Vederas has provided evidence that LNKS does harbor such a Diels-Alderase activity (Auclair et al., 2000), but the evidence suggests that cyclization occurs on an enzyme bound hexaketide intermediate, suitably activated for the Diels-Alder reaction, which is subsequently extended to the nonaketide level. Further biochemical characterization of LovB has been obtained by expressing some of its constituent domains as stand-alone mono- and di-domains (Ma and Tang, 2007). Domain boundaries were identified via sequence alignment with bacterial type I PKSs and mammalian and fungal FASs. PCR primers were designed to amplify the designated target domains using the uninterrupted lovB sequence obtained by removal of the seven introns, using splice by overlap PCR. PET28a(þ) expression vectors were constructed for the KS-MAT didomain, the ACP monodomain and the
68
Russell J. Cox and Thomas J. Simpson
ACP-CON didomain. The KS-MAT (pSMA30) and CON (pSMA61) constructs were introduced by transformation into BL21(DE3) for protein expression and the ACP-containing constructs were introduced by transformation into BAP1 containing the broad spectrum PPTase gene sfp. Good yields of soluble protein were generally obtained. Addition of the CON domain (see Section 4.2 for further discussion) increased yields from 1 mg/l for the ACP alone to 15 mg/l for the didomain. These results contrast with the work of Townsend and Cox who both found E. coli expression of fungal NSAS domains to be very difficult (Section 3.1). The ability of the domains to accept acetate and malonate was assayed by incubation of the proteins (1—10 mM ) in buffer l (100 mM NaH2PO4, pH 7.4, 2 mM DTT, 10% glycerol) along with added acyl CoA (180 mM, 55 mCi/mmole) in a final volume of 10 ml. After 10 min at room temperature or on ice, reactions were quenched with one volume of SDSPAGE loading buffer lacking any reducing agents such as DTT or mercaptoethanol. The proteins were separated on 6% or 12% SDS-PAGE gels and analyzed using a phosphoimager. During purification of the KAS-MAT didomain, a truncated MAT domain was obtained as a result of proteolytic cleavage during cell lysis. Interestingly, the cleavage site, EY448/M449EPEQ, corresponds to a region that is highly conserved among fungal and bacterial type I PKSs (Rangan et al., 1997). Comparison with the crystal structure of the DEBS module-5 KS-AT from Saccharopolyspora erythrea (Tang et al., 2006) suggests that the cleavage site is at the start of a structurally highly ordered linker region. No similar proteolytic susceptibility was observed, however, during purification of the DEBS KS-AT or mammalian FAS-MAT didomains (Witkowski et al., 2004). Using this sequence information, the MAT domain was cloned and expressed in E. coli. An exceptionally high yield (50 mg/l) was obtained. The lovB MAT active site region contains two consecutive serines (GHS656S657G) and this diad appears to occur frequently in fungal PKSs. This contrasts with FAS MAT, where a single active-site serine is normal (GHSXG). Both sites in lovB MAT were separately lovB mutated to alanine, and labeling assays indicated that S656, which corresponds to the normal serine position, was the only one to be labeled from malonyl CoA. The amount of soluble protein obtained from the S656A mutant was similar to the wild type domain (50 mg/l), but the S657A mutant gave only poor yield (2 mg/l). It is suggested, therefore, that the second serine may contribute to the overall folding and structural integrity of the domain. Attempts to express the KS as a standalone protein failed to give soluble protein, similarly to efforts to express the NSAS KS. Proteolytic cleavage of the KS domain is also observed for the LovB protein itself. It can be expressed as soluble protein in reasonably high yields (5 mg/l) with a C-terminal His-tag in BAP1. During Ni affinity chromatography, however, a slightly smaller protein coeluted. Both bands were strongly labeled from [14C]-malonyl CoA, indicating that the smaller band must contain an intact MAT domain and has likely lost the KS.
Fungal Type I Polyketide Synthases
69
4.2. HR PKS-NRPS: Fusarin and tenellin synthetases LovB appears to have part of a non–ribosomal peptide synthase (NRPS) condensation (C or CON) domain downstream of the ACP. While this was surprising at the time, it was proposed (Cox, 2007) that this may be involved in release of the product from the synthase, either by activating water or the C-5 hydroxyl to form the d-lactone moiety of lovastatin directly. However, the presence of NRPS domains downstream of a fungal HR PKS is now known to be rather common. Cox and coworkers were investigating the biosynthesis of fusarin C, a toxic metabolite of inter alia Fusarium monilforme and Fusarium venenatum. Fusarin C is representative of a large group of fungal metabolites in which a highly reduced and often highly methylated polyketide moiety is fused to a pyrrolidone, tetramic acid, or pyridone moiety, of presumed Krebs cycle or amino acid origin. Using a cloning strategy previously applied to squalestatin (Cox et al., 2004), based on the use of degenerate C-MeT PCR primers, they were able to rapidly clone about 26 kb of genomic DNA from F. monilorme containing the fusarin synthetase and several other ORFs (Song et al., 2004). FUSS was shown to be the fusarin synthetase by inactivation of the gene and concomitant loss of metabolite production. They found that the fusarin synthetase (FUSS) combines an HR PKS with a full NRPS module (Fig. 3.3D), presumably in this case selective for the activation and incorporation of homoserine. This was confirmed by the synthesis and intact incorporation of [2-13C,15N] homoserine into fusarin C (Rees et al., 2007). Subsequent to this initial observation, a number of other tetramic acid/pyridone-containing metabolites, including equisetin (Sims et al., 2005) and tenellin (Eley et al., 2007), have been shown to be produced via similar PKS-NRPS systems. All of the PKS-NRPS genes so far reported terminate with an apparent reductase (R) domain (Fig. 3.3D) and, in the case of fusarin, this would be consistent with the required reductive cleavage of the homoserine thiolester linkage to the NRPS thiolation (peptidyl carrier protein/T) domain to give the corresponding aldehyde, followed by an aldol cyclization to give the final pyrrolidone ring. However, this is not the case with equisetin and tenellin, which both require an unreduced carboxylate/thiolester for tetramic acid formation. The reductase domain has been shown through heterologous expression (Halo et al., 2008) to act alternatively as a condensing (Dieckmann cyclase [DCK]) domain. This proposal has since been supported by overexpression of the equisetin R-domain and studies of its reactivity with substrate analogues (Sims and Schmidt, 2008). The C-terminal R-domain was cloned as a free-standing domain and also as a didomain with the adjacent T-domain and both were expressed in E. coli in His-tagged form and purified to homogeneity using Ni-NTA resin, followed by FPLC with a Superdex SD200 size-exclusion column. Synthetic substrates, N-acetyl- and N-acetoacetyl-alanine, were synthesized as their
70
Russell J. Cox and Thomas J. Simpson
N-acetylcysteamine (SNAC) and CoA thiolester derivatives. The CoA analogues were covalently linked to the T-domain using the usual sfp PPTase. Incubation with excess NADH or NADPH failed to give any evidence for reduction of the substrates when assayed by ESI-MS. The purified R-domain was incubated with the acetoacetyl-alanine thiolester substrates, both with and without NADPH, and the reactions monitored by TLC and GC-MS. At pH 8, nonenzymatic background formation of tetramic acid was rapid, while at pH 6, no tetramic acid formation was observed in the presence or absence of enzyme. It was found that pH 7.0 gives negligible nonenzymatic reaction but rapid enzyme-catalyzed production. The acetyl analogues were not substrates and no aldehyde or alcohol products were observed in the presence of NADPH, which was not required for tetramic acid formation. Two mechanisms are possible: either the enzyme catalyses a Dieckmann cyclization, or it recycles bound NADPH to both reduce and oxidize the substrate. Although this appears complicated, this mechanism has been demonstrated for sugar epimerase enzymes that are homologous with the R-domains (Mayer and Tanner, 2007). Interestingly, 3-methylorcinaldehyde synthase (MOS), which is responsible for the tetraketide-derived moiety in xenovulene A, is an NR PKS, which terminates with a C-terminal R-domain very similar in sequence to the fusarin and equisetin R-domains. In this case it is active as a reductase, removing the polyketide product from the PKS by reduction of the ACP-thiolester linkage to give the aldehyde product (Bailey et al., 2007). The fusarin PKS contains an ER domain which appears to be inactive, as no ER-mediated reduction is actually required for fusarin C production. The tenellin PKS (TENS) also contains an ER domain, which also appears to be inactive, cf. LNKS. However, the TENS gene cluster also contains an encoded LovC homologue, ORF3. Like LovC, this is essential for correct programming and fidelity in assembly of the polyketide precursor. When TENS was heterologously expressed in A. oryzae on its own, polyketidederived products were obtained. These were all tetramic acids, not pyridones, and contained polyketide moieties that not only lacked the essential ER-mediated reduction at carbons 11 and 12, but also differed in chain length, and methylation (Halo et al., 2008). In order to establish the essential role of the putative trans-acting ER encoded by orf3, a pTAex3 derivative was constructed in which selection was provided by a Basta-resistance (bar) cassette. B. bassiana is sensitive to the herbicide ammonium glufosinate (Basta) and can be used as a selection marker for the construction of both knockout (KO) and antisense RNA (see below) vectors. The argB gene was inactivated by truncation. This allowed cointroduction by transformation of the tenS/argB vector into A. oryzae. Dual selection was achieved by plating the transformants on a minimal medium lacking arginine and overlaying after 24 h with Basta, followed by subculturing single colonies into Bastacontaining liquid medium lacking arginine. Eleven clones were isolated
Fungal Type I Polyketide Synthases
71
which showed both Basta resistance and arginine prototrophy. PCR analysis of their genomic DNA confirmed the presence of both tensS and orf3. Five clones were grown in production medium and the extracts were examined by LC-MS. Four of the clones produced a single new compound, pretenellin A, which contained the correctly assembled polyketide portion fused to a phenylalanine-derived tetramic acid. To establish that pretenellin A was indeed an intermediate in tenellin biosynthesis, it was incubated in a CFE. A 10-day-old culture (500 ml) of a B. bassiana blocked mutant (tenS KO strain, Eley et al., 2007) grown in tenellin production medium was harvested by vacuum filtration. The extract was prepared using the method of Watanabe and Townsend (1998). The mycelium was thoroughly washed with distilled water, 35g wet-weight of the mycelium was flash frozen in liquid nitrogen, pulverized using a pestle and mortar, and re-suspended in 70 ml buffer solution (50 mM potassium phosphate, pH 7.5; 30% glycerol; 2 mM DTT; 100 mM PMSF, 100 mM benzamidine hydrochloride and 1 mM EDTA). The mixture was stirred for 2 h at 4 , then centrifuged at 20,000g for 20 min. The supernatant was decanted and used as CFE. 20 ml of 1 mg/ml solution of pretenellin A in acetone was added to 5 ml of CFE in a precooled 10-ml tube. The reaction was incubated at 25 for 30 min, then quenched by shaking with ethyl acetate (5 ml). The organic layer was carefully decanted after the mixture was allowed to settle and concentrated in vacuo. The sample was dissolved in 100 ml of HPLC methanol and subjected to LCMS analysis. Control experiments were conducted following the same protocols, using a boiled CFE solution. Two pyridone-containing metabolites, 15-hydroxytenellin and pyridovericin (also 15-hydroxylated but lacking the N-hydroxyl), were detected. These have also been detected as minor metabolites of the wild type strain of B. bassiana. Thus, it appears that the CFE has been elevated in the oxidase responsible for this extra side-chain hydroxylation. The gene responsible for the ring expansion has been demonstrated to be encoded by orf1 by gene KO, selective gene silencing and coexpression approaches. Gene KO strategies were previously used in B. bassiana through the insertion of an antibiotic-resistance cassette into the target gene via homologous recombination. However, the tenS KO required examination of nearly 100 individual clones to find a bone fide KO as the rate of ectopic integration of the selection marker in B. bassiana was high (>90%). In order to improve the chance of success, an RNA silencing approach was also used—specifically antisense RNA—as this avoids the requirement for homologous recombination (Heneghan et al., 2007). In order to construct KO vectors for orf1 and orf2, PCR was performed on B. bassiana genomic DNA to amplify 50 - and 30 -targeting fragments (about 700 to 1200 bp) for each ORF. All the PCR products were initially cloned into pENTR/ D-TOPO (Invitrogen), and the KO plasmids were constructed by inserting
72
Russell J. Cox and Thomas J. Simpson
a bar cassette (A. nidulans trpC promoter driving a Basta resistance gene) between the targeting fragments. Creation of an antisense RNA vector required choice of a suitable promoter. The A. nidulans gpdA (glyceraldehyde-3-phosphate dehydrogenase) promoter has previously been demonstrated to drive strong constitutive expression in B. bassiana (dos Reisa et al., 2004), so it was selected to ensure high levels of antisense RNA production. The promoter was amplified by PCR and inserted into vector pCB1530, which contains a selectable bar cassette. To enable rapid cloning of diverse gene fragments a Gateway cloning cassette (Shafran et al., 2008) was inserted ‘‘in reverse orientation’’ downstream of the gpdA promoter (i.e., with attR2 adjacent to the promoter), creating fungal expression vector pCBgpdA-GA. Orf1 and orf2 were amplified by PCR and cloned directionally into pENTR/D-TOPO (Invitrogen). Gateway recombination was then used to insert the fragments in antisense orientation with respect to the gpdA promoter into pCBgpdA-GA. The two linearized KO and two circular antisense RNA plasmids were then introduced into B. bassiana by PEGmediated protoplast transformation and selection for Basta resistance. A total of 18 potential Dorf1 KO and 17 Dorf2 KO transformants were obtained, in which the intended double crossovers would have resulted in gene KO. A total of 29 antisense RNA transformants were obtained for orf1 and 39 antisense RNA transformants for orf2. The KO and antisense transformants were grown in production medium, extracted and analyzed. Of the KO transformants, all but one showed the wild type phenotype, with only one orf1 transformant producing pretenellin A and its 16-hydroxy derivative, protenellin D. Several of the orf1 antisense RNA strains, however, produced pretenellin A and no detectable pyridones. Overall, analysis of these and related results confirm the role of TENS and ORF3 in production of pretenellin A, with ORF1 being responsible for ring-expansion of tetramic acid to pyridone and ORF2 for the final N-hydroxylation to produce tenellin.
5. NR/HR PKS Hybrid Systems: Zearalenone (ZAE1 and ZAE2) The studies described above on NSA biosynthesis (Section 3.1) attest to the ability of NR PKSs to accept chain primers from other synthases, in this case a dedicated FAS. It is now apparent that this is a more widespread phenomenon and that HR PKSs can also provide more complex polyketide-derived primers to be chain extended by an NR PKS. The best-studied example to date is the fungal toxin zearalenone, formally a nonaketide, whose structure indicates a high level of reductive modification early in the biosynthesis and no reduction during the latter (three) chain
Fungal Type I Polyketide Synthases
73
elongations. It has now been shown that the zearlaneone gene cluster from Gibberella zeae (Gaffoor and Trail, 2006) contains two iterative PKSs, PKS4 (ZEA2) and PKS13 (ZEA1), both of which are essential for zearalenone biosynthesis. The former contains the expected domains for a HR PKS, whereas the latter has the expected SAT, KS, MAT, and ACP, terminating with a thioesterase (TE). This has been given biochemical verification by Reeves and coworkers, who sequenced the gene clusters for the zearalenone analogues, hypothemycin, and radicicol biosynthesis from Hypomyces subiculosis and Pochonia chlamydosporia, respectively (Reeves et al., 2008), cloned and expressed a number of the genes from the hypothemycin cluster in both E. coli and yeast and showed that both the HR-PKS and NR-PKS must be simultaneously expressed in yeast for production of the zearalenone analogue 70 ,80 -dehydrozearalenone (DHZ). Hypothemycin cDNAs were expressed from the adh2 promoter in 2m-plasmid–based yeast-E. coli shuttle vectors (Mutka et al., 2006) in an S. cerevisiae strain developed for fungal PKS expression (Kealey et al., 1998). The HR-PKS cDNA was cloned into pKOS187-98A (LEU2 marker) as an NdeI-SbfI fragment to obtain pKOS518-118A. The NR-PKS was cloned into pKOS247-14-3 (TRP1 marker) cut with NdeI and EcoRI in a threepiece ligation with the 0.75-kb NdeI-AlwNI and 5.4-kb AlwNI-EcoRI fragments from pKOS518-117A to obtain pKOS518-120A. The P450 and FMO cDNAs were cloned into pKOS187-98A as NdeI-AvrII fragments to obtain pKOS518-116 and pKOS518-137A, respectively. The OMT cDNA was cloned as a 1.6-kb NdeI-EcoRI fragment from pKOS51892C into pKOS247-14-3 to obtain pKOS518-136A. Each cDNA expression cassette flanked by the adh2 promoter and terminator was moved into pKOS187-4e (URA3 marker) (Mutka et al., 2006), using the BssHII sites, to obtain pKOS518-137B (P450), pKOS518-138A (FMO), and pKOS518138D (OMT). Plasmids were introduced into yeast by the LiCl-PEG procedure, with plating on the appropriate complete minimal dropout agar plates (Teknova). Colonies were transferred to the appropriate liquid complete minimal dropout medium and grown at 30 to generate inoculum for YPD medium containing 2% glucose and 20 g/l of Amberlite XAD1180 resin (Alfa Aesar). After 24 h of incubation at 30 , the resin was collected and washed with water, and the products were eluted with methanol. The methanol was evaporated, and the residue was dissolved in 80% acetonitrile for HPLC analysis, which confirmed that expression of both PKS genes, but neither alone, gave DHZ. Adding expression of the O-methyltransferase (OMT), flavin mono-oxygenase (FMO) or cytochrome P450 to the strain brought about methylation, epoxidation, or hydroxylation of DHZ, respectively. In a related study, Tang and coworkers cloned, overexpressed, and purified the G. fujikuroi PKS13 and, using a small molecule mimic (the SNAC thiol ester of 10-hydroxydecanoic acid) of the natural hexaketide
74
Russell J. Cox and Thomas J. Simpson
precursor, showed that it is efficiently utilized to chain-prime PKS13, which then carries out the full set of chain extension, cyclization, aromatization, and macrolactone formation reactions (Zhou et al., 2008). Other fatty acyl CoAs from C-6 to C-16 were also utilized, with the highest activity with decanoyl CoA. In E. coli, PKS13 synthesized new compounds using endogenous acyl starter units or when the cultures were supplemented with a variety of synthetic precursors, demonstrating its potential for precursor-directed biosynthesis in vivo as well as in vitro.
6. Conclusions A combination of molecular genetic and enzymological studies have begun to shed light on how these complex iterative multifunctional enzyme systems actually work, but we still have little understanding of the fundamental programming mechanisms that govern starter unit selection and control of chain length, degree of methylation, and reduction. However, the studies described above do confirm that it will be possible to dissect these complex systems to study the functions of individual domains and subsets of domains at a biochemical level. This must be the key to achieving a full understanding of how programming works, and thus how it might be exploited for synthetic biology.
REFERENCES Auclair, K., Sutherland, A., Kennedy, J., Witter, D. J., Van der Heever, J. P., Hutchinson, C. R., and Vederas, J. C. (2000). Lovastatin nonaketide synthase catalyses an intramolecular Diels-Alder reaction of a substrate analogue. J. Am. Chem. Soc. 122, 11519–11520. Bailey, A. M., Cox, R. J., Harley, K., Lazarus, C. M., Simpson, T. J., and Skellam, E. (2007). Characterisation of 3-methylorcinaldehyde synthase (MOS) in Acremonium strictum: First observation of a reductive release mechanism during polyketide biosynthesis. Chem. Commun. 2007, 4053–4055. Bardshiri, E., and Simpson, T. J. (1983). 2H and 13C labelling studies on the biosynthesis of scytalone in Phialaphora lagerbergii. Tetrahedron 39, 3539–3542. Beck, J., Ripka, S., Siegner, A., Schiltz, E., and Schweizer, E. (1990). The multifunctional 6-methylsalicylic acid synthase gene of Penicillium patulum. Eur. J. Biochem. 192, 487–498. Bedford, D. J., Schweizer, E., Hopwood, D. A., and Khosla, C. (1995). Expression of a functional fungal polyketide synthase in the bacterium Streptomyces coelicolor A3(2). J. Bacteriol. 177, 4544–4548. Bell, A. A., and Wheeler, M. H. (1986). Biosynthesis and function of fungal melanins. Annu. Rev. Phytopathol. 24, 411–451. Bingle, L. E. H., Simpson, T. J., and Lazarus, C. M. (1999). Ketosynthase domain probes identify two subclasses of fungal polyketide synthase genes. Fungal Genet. Biol. 26, 209–223.
Fungal Type I Polyketide Synthases
75
Birch, A. J., and Donovan, F. W. (1953). Studies in relation to biosynthesis. I. Some possible routes to derivatives of orcinol and phloroglucinol. Aust. J. Chem. 6, 360–368. Butler, M. S. (2005). Natural products to drugs: Natural product derived compounds in clinical trials. Nat. Prod. Rep. 22, 162–195. Brown, M. P., Brown-Jenco, C. S., and Payne, G. A. (1999). Genetic and molecular analysis of aflatoxin biosynthesis. Fungal Genet. Biol. 26, 81–98. Chang, P. K., Cary, J. W., Yu, J., Bhatnagar, D., and Cleveland, T. E. (1995). The Aspergillus parasiticus polyketide synthase genepksA, a homolog of Aspergillus nidulans wA, is required for aflatoxin B1 biosynthesis. Mol. Gen. Genet. 248, 270–277. Clough, J. M. (2000). The strobilurin fungicides. In Wrigley, S. K., Hayes, M. A., Thomas, R., Chrystal, E. J. T., and Nicholson, N., eds., ‘‘Biodiversity: New Leads for the Pharmaceutical and Agrochemical Industries.’’ The Royal Society of Chemistry, Cambridge, 277–282. Cox, R. J. (2007). Polyketides, proteins and genes in fungi: Programmed nano-machines begin to reveal their secrets. Org. Biomol. Chem. 5, 2010–2016. Cox, R. J., Hitchman, T. S., Byrom, K. J., Findlow, S. C., Tanner, J. A., Crosby, J., and Simpson, T. J. (1997). Post-translational modification of heterologously expressed Streptomyces type II polyketide synthase acyl carrier proteins. FEBS Lett. 405, 267–273. Cox, R. J., Glod, F., Hurley, D., Lazarus, C. M., Nicholson, T. P., Rudd, B. A. M., Simpson, T. J., Wilkinson, B., and Zhang, Y. (2004). Rapid cloning and expression of a fungal polyketide synthase gene involved in squalestatin biosynthesis. Chem. Commun. 2260–2261. Crawford, J. M., Dancy, B. C. R., Hill, E. A., Udwary, D., and Townsend, C. A. (2006). Identification of a starer unit–acyl carrier protein transacylase domain in an iterative type I polyketide synthase. Proc. Natl. Acad. Sci. USA 103, 16728–16733. Crawford, J. M., Vagstad, A. L., Ehrlich, K. C., and Townsend, C. A. (2008a). Starter unit specificity directs genome mining of polyketide synthase pathways in fungi. Bioorg. Chem. 36, 16–22. Crawford, J. M., Thomas, P. M., Scheerer, J. R., Vagstad, A. L., Kelleher, N. L., and Townsend, C. A. (2008b). Deconstruction of iterative multidomain polyketide synthase function. Science 320, 243–246. Crawford, J. M., Vagstad, A. L., Whitworth, K. P., Ehrlich, K. C., and Townsend, C. A. (2008c). Synthetic strategy of nonreducing polyketide synthases and the origin of the classical ‘‘starter-unit effect.’’ ChemBioChem 9, 1019–1023. dos Reisa, M. C., Fungarob, M. H. P., Duartea, R. T. D., Furlanetoc, L., and Furlaneto, M. C. (2004). Agrobacterium tumefaciens–mediated genetic transformation of the entomopathogenic fungus Beauveria bassiana. J. Microbiol. Methods 58, 283–294. Eley, K. L., Halo, L. M., Song, Z., Powles, H., Cox, R. J., Bailey, A. M., Lazarus, C. M., and Simpson, T. J. (2007). Biosynthesis of the 2-pyridone tenellin in the insect pathogenic fungus Beauveria bassiana. ChemBioChem 8, 289–297. Dimroth, P., Hilde, W., and Lynen, F. (1990). Biosynthese von 6-methylsalicylsa¨ure. Eur. J. Biochem. 13, 98–110. Fujii, I., Ono, Y., Tada, H., Gomi, K., Ebizuka, Y., and Sankawa, U. (1996). Cloning of the polyketide synthase gene atX from Aspergillus terreus and its identification as the 6-methylsalicylic acid synthase gene by heterologous expression. Mol. Gen. Genet. 253, 1–10. Fujii, I., Mori, Y., Watanabe, A., Kubo, Y., Tsui, G., and Ebizuka, Y. (1999). Heterologous expression and product identification of Colletotrichum lagenarium polyketide synthase encoded by the PKS1 gene involved in melanin biosynthesis. Biosci. Biotechnol. Biochem. 63, 1445–1452. Fujii, I., Mori, Y., Watanabe, A., Kubo, Y., Tsui, G., and Ebizuka, Y. (2000). Enzymatic synthesis of 1,3,6,8-tetrahydroxynaphthalene solely from malonyl coenzyme A by a fungal iterative type I polyketide synthase PKS1. Biochemistry 39, 8853–8858.
76
Russell J. Cox and Thomas J. Simpson
Fujii, I., Watanabe, A., Sankawa, U., and Ebizuka, Y. (2001). Identification of Claisen cyclase domains in fungal polyketide synthase WA, a naphthopyrone synthase of Aspergillus nidulans. Chem. Biol. 8, 189–197. Fujii, I., Yasuoka, Y., Tsai, H. F., Chang, Y. C., Kwon-Chung, K. J., and Ebizka, Y. (2004). Hydrolytic polyketide shortening by Ayg1p, a novel enzyme involved in fungal melanin biosynthesis. J. Biol. Chem. 279, 44613–44620. Funa, N., Ohnishi, Y., Fujii, I., Shibuya, M., Ebizuka, Y., and Horinuchi, S. (1999). A new pathway for polyketide synthesis in microorganisms. Nature 400, 897–899. Gafoor, I., and Trail, F. (2006). Characterisation of two polyketide synthase genes involved in zearalenone biosynthesis in Giberella zeae. Appl. Environ. Microbiol. 72, 1793–1799. Gomi, K., Iimura, Y., and Hara, S. (1987). Integrative transformation of Aspergillus oryzae with a plasmid containing the Aspergillus nidulans argB gene. Agric. Biol. Chem. 51, 2549–2555. Halo, L. M., Marshall, J. W., Yakasai, A. A., Song, Z., Butts, C. P., Crump, M. P., Heneghan, M., Bailey, A. M., Simpson, T. J., Lazarus, C. M., and Cox, R. J. (2008). Authentic heterologous expression of the tenellin iterative polyketide synthase non-ribosomal peptide synthetase requires co-expression with an enoyl reductase. ChemBioChem. 9, 585–594. Halo, L. M., Heneghan, M., Yakasai, A. A., Song, Z., Williams, K., Bailey, A. M., Cox, R. J., Lazarus, C. M., and Simpson, T. J. (2008). Late-stage oxidations during the biosynthesis of the 2-pyridone tenellin in the entomopathogenic fungus Beauvaria bassiana. J. Am. Chem. Soc. 130, 17988–17996. Hanson, J. R. (2008). ‘‘Chemistry of fungi.’’ Royal Society of Chemistry, Cambridge. Hendrickson, L., Davis, C. R., Roach, C., Nguyen, D. K., Aldrich, T., McAda, P. C., and Reeves, C. D. (1999). Lovastatin biosynthesis in Aspergillus terreus: Characterization of blocked mutants, enzyme activities and a multifunctional polyketide synthase gene. Chem. Biol. 6, 429–439. Heneghan, M. N., Costa, A. M. S. B., Chalen, M. P., Mills, P. R., Bailey, A., and Foster, G. D. (2007). A comparison of methods for successful triggering of gene silencing in Coprinus cinereus. Mol. Biotechnol. 35, 283–284. Hitchman, T. S., Schmidt, E. W., Trail, F., Rarick, D., Linz, J. E., and Townsend, C. A. (2001). Hexanoate synthase, a specialized type I fatty acid synthase in aflatoxin B1 biosynthesis. Bioorg. Chem. 29, 293–297. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989). Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51–59. Hoffmeister, D., and Kelleher, N. P. (2007). Natural products and filamentous fungi: Enzymes, genes, and their regulation. Nat. Prod. Rep. 24, 393–416. Kealey, J. T., Liu, L., Santi, D. V., Betlach, M. C., and Barr, P. J. (1998). Production of a polyketide natural product in nonpolyketide-producing prokaryotic and eukaryotic hosts. Proc. Natl. Acad. Sci. USA 95, 505–509. Keatinge-Clay, A. T., Maltby, D. A., Medzihradszky, K. F., Khosla, C., and Stroud, R. M. (2004). An antibiotic factory caught in action. Nat. Struct. Mol. Biol. 11, 888–893. Kennedy, J., Auclair, K., Kendrew, S. G., Park, C., Vederas, J. C., and Hutchinson, C. R. (1999). Modulation of polyketide synthase activity by accessory proteins during lovastatin biosynthesis. Science 284, 1368–1372. Kroken, S., Glass, S. N. L., Taylor, J. W., Yoder, O. C., and Turgeon, B. G. (2003). Phylogenomic analysis of type I polyketide synthase genes in pathogenic and saprobic ascomycetes. Proc. Natl. Acad. Sci. USA 100, 15670–15675. Lambalot, R. H., Gehring, A. M., Flugel, R. S., Zuber, P., LaCelle, M., Marahiel, M. A., Reid, R., Khosla, C., and Walsh, C. T. (1996). A new enzyme superfamily—the phosphopantetheinyl transferases. Chem. Biol. 3, 923–936.
Fungal Type I Polyketide Synthases
77
Ma, S. M., Zhan, J., Watanabe, K., Xie, X., Zhang, W., Wang, C. C., and Tang, Y. (2007). Enzymatic synthesis of aromatic polyketides using PKS4 from Gibberella fujikuroi. J. Am. Chem. Soc. 129, 10642–10643. Ma, S. M., and Tang, Y. (2007). Biochemical characterization of the minimal polyketide synthase domains in the lovastatin nonaketide synthase LovB. FEBS J. 274, 2854–2864. Ma, Y., Smith, L. H., Cox, R. J., Beltran-Alvarez, P., Arthur, C. J., and Simpson, T. J. (2006). Catalytic relationships between type I and type II iterative polyketide synthases: The Aspergillus parasiticus norsolorinic acid synthase. ChemBioChem 7, 1951–1958. Mayer, A., and Tanner, M. E. (2007). Intermediate release by ADP-L-glycero-D-mannoheptose 6-epimerase. Biochemistry 46, 6149–6155. McKeown, D. S. J., McNicholas, C., Simpson, T. J., and Willett, N. J. (1996). Biosynthesis of norsolorinic acid and averufin: Substrate specificity of norsolorinic acid synthase. J. Chem. Soc. Chem. Commun. 301–302. Moriguchi, T., Ebizuka, Y., and Fujii, I. (2006). Analysis of subunit interactions in the iterative type I polyketide synthase ATX from Aspergillus terreus. ChemBioChem. 7, 1869–1874. Moriguchi, T., Ebizuka, Y., and Fujii, I. (2008). Domain–domain interactions in the iterative type I polyketide synthase ATX from Aspergillus terreus. ChemBioChem. 9, 1207–1212. Mutka, S. C., Bondi, S. M., Carney, J. R., Da Silva, N. A., and Kealey, J. T. (2006). Metabolioc pathway engineering for complex polyketide biosynthesis in Saccharomyces cerevisiae. FEMS Yeast Res. 6, 40–47. Nicholson, T. P. (2000). Design and development of oligonucleotide probes for novel fungal polyketide synthase genes. Ph.D. thesis, University of Bristol. Nicholson, T. P., Lazarus, C. M., Rudd, B. A. M., Dawson, M. J., Simpson, T. J., and Cox, R. J. (2001). Design and utility of oligonucleotide probes for fungal polyketide synthases. Chem. Biol. 8, 151–178. Nicholson, T. P., Winfield, C., Westcott, J., Crosby, J., Simpson, T. J., and Cox, R. J. (2003). First in vitro directed biosynthesis of new compounds by a minimal type II polyketide synthase: Evidence for the mechanism of chain length determination. Chem. Commun. 686–687. O’Hagan, D. (1991). ‘‘The polyketide metabolites.’’ Ellis Horwood, New York. Pel, H. J., de Winde, J. H., and Archer, D. B. (2007). Genome sequencing and analysis of the versatile cell factory Aspergillus niger CBS 513.88. Nat. Biotechnol. 25, 22–23. Rangan, V. S., and Smith, S. (1996). Expression in Escherichia coli and refolding of the malonyl-acetyltransferase domain of the multifunctional animal fatty acid synthase. J. Biol. Chem. 271, 31749–31755. Rangan, V. S., Serre, L., Witkowska, H. E., Bari, A., and Smith, S. (1997). Characterization of the malonyl/acetyltransacylase domain of the multifunctional animal fatty acid synthase by expression in Escherichia coli and refolding in vitro. Protein Eng. 10, 561–566. Rees, D. O., Bushby, N., Cox, R. J., Harding, J. R., Simpson, T. J., and Willis, C. L. (2007). Synthesis of [1,2–13C2,15N]-L-homoserine and its incorporation by the PKS-NRPS system of Fusarium moniliforme into the mycotoxin fusarin C. ChemBioChem 8, 46–50. Reeves, C. D., Hu, Z., Reid, R., and Kealey, T. J. (2008). Genes for biosynthesis of the fungal polyketides hypothemycin from Hypomyces subiculosus and radicicol from Pochonia chlamydosporia. Appl. Environ. Microbiol. 74, 5121–5129. Sa´nchez, C., Du, L., Edwards, D. J., Toney, M. D., and Shen, B. (2001). Cloning and characterization of a phosphopantetheinyl transferase from Streptomyces verticillus ATCC15003, the producer of the hybrid peptide–polyketide antitumor drug bleomycin. Chem. Biol. 8, 725–738. Schu¨mann, J., and Hertweck, C. (2006). Advances in cloning, functional analysis and heterologous expression of fungal polyketide synthase genes. J. Biotechnol. 124, 690–703.
78
Russell J. Cox and Thomas J. Simpson
Scott, A. I., Beadling, L. C., Georgopapdakou, N. C., and Subbarayan, C. R. (1974). Biosynthesis of polyketides: Purification and inhibition studies of 6-methylsalicylic acid synthase. Bioorg. Chem. 3, 238–248. Serre, L., Verbree, E. C., Dauter, Z., Stuitje, A. R., and Derewenda, Z. S. (1995). The Escherichia coli malonyl-CoA:Acyl carrier protein transacylase at 1.5-A˚ resolution. J. Biol. Chem. 270, 1296–12964. Shafran, H., Miyara, I., Eshed, R., Prusky, D., and Sherman, A. (2008). Development of new tools for studying gene function in fungi based on the Gateway system. Fung. Genet. Biol. 45, 1147–1154. Simpson, T. J. (1987). Applications of multinuclear NMR to structural and biosynthetic studies of polyketide microbial metabolites. Chem. Soc. Rev. 16, 123–160. Simpson, T. J. (1995). Polyketide biosynthesis. Chem. Ind. 1995, 407–411. Simpson, T. J., and Cox, R. J. (2009). Polyketide biosynthesis in fungi. In Begley, T. P., Wiley Encyclopaedia of Chemical Biology. Wiley, Chichester. Sims, J. W., Fillmore, J. P., Warner, D. D., and Schmidt, E. W. (2005). Equisetin biosynthesis in Fusarium heterosporum. Chem. Commun. 186–188. Sims, J. W., and Schmidt, E. W. (2008). Thioesterase-like role for fungal PKS-NRPS hybrid reductive domains. J. Am. Chem. Soc. 130, 11149–11151. Song, Z., Cox, R. J., Lazarus, C. M., and Simpson, T. J. (2004). Fusarin C biosynthesis in Fusarium moniliforme and Fusarium venenatum. ChemBioChem 6, 1196–1203. Spencer, J. B., and Jordan, P. M. (1992). Purification and properties of 6-methylsalicylic acid synthase from Penicillium patulum. Biochem. J. 288, 839–846. Staunton, J., and Weissman, K. J. (2001). Polyketide biosynthesis: A millennium review. Nat. Prod. Rep. 18, 380–416. Sutherland, A., Auclair, K., Kendrew, S. G., Park, C., and Vederas, J. C. (2001). Recent advances in the biosynthetic studies of lovastatin. Curr. Opin. Drug Discov. Dev. 4, 229–236. Tang, Y., Kim, C. Y., Mathews, I. I., Cane, D. E., and Khosla, C. (2006). The 2.7-angstrom crystal structure of a 194-kDa homodimeric fragment of the 6-deoxyerythronolide B synthase. Proc. Natl. Acad. Sci. USA 103, 11124–11129. Tobert, J. A. (2003). Lovastatin and beyond: The history of the HMG-CoA reductase inhibitors. Nat. Rev. Drug Discov. 2, 517–526. Udwary, D., Merski, M., and Townsend, C. (2002). A method for prediction of the locations of linker regions within large multifunctional proteins, and application to a type I polyketide synthase. J. Mol. Biol. 325, 585–598. Watanabe, C. M. H., and Townsend, C. A. (2002). Initial characterization of type I fatty acid synthase and polyketide synthase multienzyme complex NorS in the biosynthesis of aflatoxin B1. Chem. Biol. 9, 981–988. Witkowski, A., Joshi, A. K., and Smith, S. (1997). Characterization of the interthiol acyltransferase reaction catalyzed by the b-ketoacyl synthase domain of the animal fatty acid synthase. Biochemistry 36, 16338–16344. Watanabe, A., and Ebizuka, Y. (2004). Unprecedented mechanism of chain length determination in fungal aromatic polyketide synthases. Chem. Biol. 11, 1101–1106. Winston, R. L., and Fitzgerald, M. C. (1998). Concentration and desalting of protein samples for mass spectrometric analysis. Anal. Biochem. 262, 83–85. Zhou, H., Zhan, J., Watanabe, Xie, X., and Tang, Yi. (2008). A polyketide macrolactone synthase from the filamentous fungus Gibberella zeae. Proc. Natl. Acad. Sci. USA 105, 6249–6254.
C H A P T E R
F O U R
Tandem Acyl Carrier Protein Domains in Polyunsaturated Fatty Acid Synthases Hui Jiang,* Scott R. Rajski,* and Ben Shen*,† Contents 1. Introduction 2. Methods 2.1. Production of PUFAs in E. coli by expressing the PUFAS genes 2.2. Mapping the active sites of PfaA-ACPs by site-directed mutagenesis 2.3. Overproduction of each of the PfaA-ACPs 2.4. Overproduction of PfaE and Svp PPTases 2.5. In vivo and in vitro preparation of the holo-form of PfaA-ACPs 2.6. Elucidation of the relationship between PUFA production and the number of active ACPs 3. Conclusion Acknowledgement References
80 85 85 86 89 91 92 93 93 95 96
Abstract Polyunsaturated fatty acids (PUFAs) can be biosynthesized via aerobic pathways that rely on combinations of desaturases and elongases to convert saturated fatty acids to PUFAs or anaerobic pathways that exploit polyketide synthase (PKS)-like enzymes known as PUFA synthases for de novo synthesis from acyl CoA precursors. In contrast to most fatty acid synthases (FASs) and PKSs that contain a single acyl carrier protein (ACP) domain for each cycle of fatty acid or polyketide chain elongation, all PUFA synthases known to date contain tandem ACPs (ranging from five to nine). The roles and engineering potential of such tandem ACPs in PUFA synthases remain largely unknown, although the growing demand for PUFAs and decline of current sources dictate that a greater understanding of these PUFA synthases is not only warranted, but urgently needed. This chapter describes methods and protocols developed to
* {
Division of Pharmaceutical Sciences, University of Wisconsin-Madison, Madison, Wisconsin, USA Department of Chemistry, University of Wisconsin-Madison, Madison, Wisconsin, USA
Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04604-7
#
2009 Elsevier Inc. All rights reserved.
79
80
Hui Jiang et al.
dissect the role and underlying biochemistry of each of the PfaA-ACPs in the Shewanella japonica PUFA synthase for eicosapentaenoic acid (EPA) and docosapentaenoic acid (DPA) biosynthesis. These studies have set the stage to interrogate the roles of the other domains and subunits of the Pfa PUFA synthase in EPA and DPA biosynthesis. Applications of the methods and protocols described here to other PUFA synthases are therefore envisioned to help close the knowledge gap currently limiting microbial production of PUFAs via PUFA synthase engineering and heterologous expression.
1. Introduction Polyunsaturated fatty acids (PUFAs), such as arachidonic acid (AA), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA), are essential to human health and nutrition (Berge´ and Barnathan, 2005; Graham et al., 2007; Muskiet and Kemperman, 2006; Wallis et al., 2002) (Fig. 4.1). Oceanic fish and fish oil products are the typical sources of PUFAs (Graham et al., 2007). However, these sources possess a number of problems including poor taste, instability, and variability. Moreover, PUFAs from these sources are produced as complex mixtures requiring extensive purification (Berge´ and Barnathan, 2005). Global warming, pollution, and overfishing represent further challenges to the present and future availability of these vital nutrients (Graham et al., 2007). These considerations, compounded by the increasing knowledge of PUFAs’ beneficial roles in human health and a rapidly expanding global population, necessitate the development of new and sustainable PUFA sources to meet growing demand (Berge´ and Barnathan, 2005). Although industrial-scale production 5
1 CO2H CH3 w
Arachidonic acid (AA) 20:4Δ5,8,11,14 20:4n6 CO2H CH3 w Eicosapentaenoic acid (EPA) 20:5Δ5,8,11,14,17 20:5n3
10
7 CO2H CH3
13 16 19 Docosapentaenoic acid (DPA) 22:5Δ7,10,13,16,19 22:5n3 4 CO2H CH3 Docosahexaenoic acid (DHA) 22:6Δ4,7,10,13,16,19 22:6n3
Figure 4.1 Structures of selected polyunsaturated fatty acids, arachidonic acid, eicosapentaenoic acid, docosapentaenoic acid, and docosahexaenoic acid.
ACP Domains of PUFA Synthases
81
of PUFAs by total chemical synthesis is not yet a viable option, microbial fermentation offers an attractive alternative. The recently discovered genes and gene clusters encoding PUFA biosynthesis are sure to hasten the development of microbial sources of PUFAs, although much remains unknown about PUFA biosynthesis in microorganisms (Metz et al., 2001; Okuyama et al., 2007; Warude et al., 2006). PUFAs differ from other fatty acids in that they contain more than one double bond. The PUFA olefins, most commonly in the cis configuration, are at three-carbon intervals, with each double bond separated by a methylene group (Huang et al., 2004). Olefin positions are indicated by D and the number of the first carbon atom, bearing in mind that the carboxylic acid moiety contains C1; the most commonly used nomenclature starts with a number indicating the PUFA carbon chain length (Wallis et al., 2002). Thus, using this naming convention, AA is termed 20:4D5,8,11,14. More commonly, PUFAs are named in a fashion whereby the carbon count is followed by the number of double bonds and the position of the double bond closest to the terminal methyl group (o carbon) (Wallis et al., 2002). Using this nomenclature, AA is called 20:4n6. Similarly, EPA is 20:5D5,8,11,14,17 or 20:5n3, docosapentaenoic acid (DPA) is 22:5D7,10,13,16,19 or 22:5n3, and DHA is 22:6D4, 7,10,13,16,19 or 22:6n3 (Fig. 4.1). Both aerobic and anaerobic pathways for PUFA biosynthesis are known (Fig. 4.2). Aerobic synthesis of PUFAs utilizes saturated fatty acids as precursors, and desaturases introduce double bonds at specific positions, while elongases extend the resulting precursors in two-carbon increments (Berge´ and Barnathan, 2005; Uttaro, 2006; Warude et al., 2006). The specific set of desaturases and elongases present within any given cell dictates the biosynthetic route exploited and, accordingly, which PUFAs are produced (Uttaro, 2006). As depicted in Fig. 4.2, route A is believed to operate in marine primary producers of PUFAs, initiating the food chain of ‘‘oceanic’’ PUFAs that end in large carnivorous fish, currently the principal source of PUFAs, while route B is typical of mammalian cells (Berge´ and Barnathan, 2005). Mammals lack D12 and n3 desaturase activities and must therefore obtain linoleic acid (18:2n6) and a-linolenic acid (18:3n3) from their diets. Both 18:2n6 and 18:3n3 are produced in plants; conversion of 18:0 to 18:1n9 by D9 desaturase and subsequent processing by D12 desaturase affords 18:2n6 that either can be acted upon by D6 desaturase to afford 18:3n6 or by n3 desaturase to afford a-linolenic acid 18:3n3 (Berge´ and Barnathan, 2005). Aerobic biosynthesis of PUFAs has been rigorously evaluated, and interested readers are referred to recent reviews (Berge´ and Barnathan, 2005; Warude et al., 2006). Numerous bacterial strains are now also known to produce PUFAs under strictly anaerobic conditions, thus precluding the participation of oxygen-dependent enzymes such as the desaturases noted above
82
Hui Jiang et al.
Acetyl-CoA Malonyl-CoA Aerobic pathway
A
Anaerobic pathway
B
C
Linolenic acid 18:3Δ9,12,15 18:3n3
Linolenic acid 18:3Δ9,12,15 18:3n3
PUFA synthase
Δ6-desaturase Δ6-elongase 20:3Δ8,11,14 20:3n6
20:3Δ8,11,14 20:3n6 Δ5-desaturase
Δ5-elongase Δ4-desaturase DHA 22:6Δ4,7,10,13,16,19 22:6n3
DHA 22:6Δ4,7,10,13,16,19 22:6n3
EPA 20:5Δ5,8,11,14,17 20:5n3
EPA 20:5Δ5,8,11,14,17 20:5n3
EPA 20:5Δ5,8,11,14,17 20:5n3
Δ5-elongase Δ7-elongase Δ6-desaturase
DPA 22:5Δ7,10,13,16,19 22:5n3
Tetracosahexaenoic acid (THA) 24:6Δ6,9,12,15,18,21 24:6n3 b-oxidation DHA 22:6Δ4,7,10,13,16,19 22:6n3
Figure 4.2 Pathways for PUFA biosynthesis in different organisms. Routes A and B represent the aerobic PUFA biosynthetic pathways relying on the action of desaturases (O2-dependent) and elongases; transformations shared by the two paths are shaded. Route A is a direct pathway proposed to operate in many marine primary producers and to initiate the food chain of ‘‘oceanic’’ PUFAs. Route B is typical for mammalian cells and embedded in this route, DHA production from EPA results from two successive elongations, a D6 desaturation and a b-oxidation chain–shortening event. The anaerobic route C exploits a PKS-like PUFA synthase.
83
ACP Domains of PUFA Synthases
(Pereira et al., 2003). Instead, the anaerobic pathways exploit polyketide synthase (PKS)-like enzymes known as PUFA synthases for de novo synthesis of PUFAs from acyl CoA precursors (Hauvermale et al., 2006; Kaulmann and Hertweck, 2002; Metz et al., 2001; Okuyama et al., 2007). Gene clusters encoding PUFA synthases and associated enzymes have been found in both prokaryotic and eukaryotic marine organisms (Okuyama et al., 2007). Successful expression of the bacterial genes encoding EPA and DHA biosynthesis in heterologous hosts, leading to production of EPA and DHA, represented a landmark finding securing the importance and ubiquity of PUFA synthases in anaerobic PUFA biosynthesis (Okuyama et al., 2007). Thus, the pfa genes responsible for EPA and DHA production were first cloned as a cosmid carrying approximately 38 kb of DNA from Shewanella sp. SCRC2738 (Metz et al., 2001). Although this fragment contained 18 open reading frames, only 5 of them, named pfaA, pfaB, pfaC, pfaD, and pfaE, were subsequently found to be needed for EPA and DHA production in E. coli, thereby establishing the minimal gene set for PUFA biosynthesis. Homologues of the pfa genes have since been found in a myriad of PUFA-producing microorganisms, principally from marine sources (Kaulmann and Hertweck, 2002; Okuyama et al., 2007). While the pfaABCDE genes are both necessary and sufficient for EPA and DHA biosynthesis, subtle differences are apparent across the various PUFA biosynthetic gene clusters, as exemplified by those from Shewanella japonica (an EPA and DPA producer), Moritella marina (a DHA producer) (Orikasa et al., 2006), Photobacterium profundum (an EPA producer) (Sugihara et al., 2008), and the marine protist Schizochytrium (a DHA and DPA producer) (Hauvermale et al., 2006) (Fig. 4.3). Most notable among these differences are (1) the genetic organization of pfaE and homologues within PPTase
KS MAT 6
X
ACP
KR DH
AT
KS CLF DH
DH
ER
Shewanella (EPA/DPA) A PfaB
PfaA
PfaE PPTase
KS MAT 5
X
KS MAT 5
X
ACP
KR DH
PfaC
KS AT
KS CLF
DH
PfaD DH
ER
Moritella (DHA) B PfaE
Orf8
Orf9
ACP
KR DH
AT
Orf10 KS CLF DH
Orf11 DH
ER
Photobacter (EPA) C PfaA KS MAT
9
X
PfaB ACP
KR DH
KS CLF
PfaC AT
ER
PfaD DH
DH ER
Schizochytrium (DHA/DPA) D OrfA
OrfB
OrfC
Figure 4.3 Organization of selected PUFA biosynthetic gene clusters: (A) S. japonica (an EPA and DPA producer); (B) M. marina (a DHA producer); (C) P. profundum (an EPA producer); and (D) the marine protist Schizochytrium (a DHA and DPA producer).
84
Hui Jiang et al.
the clusters and (2) the tandem acyl carrier protein (ACP) domains (ranging from five to nine) encoded by pfaA and homologues. Thus, pfaE or homologues have been localized either within or remote from the PUFA biosynthetic gene clusters, encoding either discrete proteins or a domain fused to other PUFA synthase subunits. That PfaA or homologues known to date all contain tandem ACPs stands in striking contrast to the current paradigm for most fatty acid synthases (FASs) and PKSs that are characterized by a single ACP for each cycle of chain elongation. It is these unprecedented architectural and mechanistic features that have motivated careful dissection of PUFA gene clusters as well as efforts to correlate PUFA synthase functions implied by bioinformatics to bona fide biosynthetic transformations in vitro and in vivo. In spite of the significant progress made recently in our understanding of PUFA synthases in PUFA biosynthesis, the majority of studies focused on cloning and sequencing of relevant PUFA biosynthetic gene clusters. Accordingly, there remains a large gap in our ability to correlate sequence information to experimentally verifiable function. Crucial to the full realization of the potential of microbial production methods for PUFAs is the development of new methods specially designed to understand the intricate workings of PUFA synthases. Toward this end, we have recently expressed the S. japonica pfaABCDE genes in E. coli to produce EPA and DPA ( Jiang et al., 2008). Using the S. japonica genes as a model for PUFA synthases, we conducted in vitro and in vivo characterization of each ACP domain of the PfaA subunit. Specifically, we demonstrated that (1) each of the bioinformatically predicted ACPs can be phosphopantetheinylated by the promiscuous PPTase Svp in vitro; (2) PfaE can efficiently phosphopantetheinylate each of the PfaA-ACPs in vivo; (3) each of the tandem ACPs was functionally equivalent for PUFA biosynthesis, but the number of functional ACPs correlated directly to PUFA titers; and (4) PUFA product distributions were regulated in an ACP-independent fashion ( Jiang et al., 2008). Taken together, these findings provide new insight into the role of ACPs in PUFA synthases, as well as experimental evidence supporting the essential role of PfaE as a PPTase in PUFA biosynthesis. This chapter describes methods and protocols developed for characterizing the tandem ACPs of the Pfa PUFA synthase from S. japonica. They include: (1) production of PUFAs in E. coli via expression of the PUFA synthase genes; (2) mapping of the tandem ACP active sites by site-directed mutagenesis; (3) overproduction of each of the tandem ACPs; (4) overproduction of PPTases; (5) in vivo and in vitro preparation of holo-ACPs; and (6) elucidation of the relationship between PUFA production and the number of active ACPs. The strategies and methods described here should be applicable to other PUFA synthases and are envisioned to help close the knowledge gap currently limiting microbial production of PUFAs via PUFA synthase engineering and heterologous expression.
ACP Domains of PUFA Synthases
85
2. Methods 2.1. Production of PUFAs in E. coli by expressing the PUFAS genes The genes responsible for EPA and DPA biosynthesis from S. japonica have been previously cloned, sequenced, and analyzed (Weaver et al., 2007). A 39,669-bp DNA fragment harboring the five PUFA synthase genes pfaABCDE was cloned into SuperCos 1 (Stratagene, La Jolla, CA) to afford cosmid construct 3F3. Functional expression of pfaABCDE in E. coli was accomplished by adopting the three-plasmid-expression system based on three compatible vectors (Novagen, Madison, WI) of pETDuet-1 (for pfaA/pfaE), pACYCDuet-1 (for pfaB/pfaD), and pCOLADuet-1 (for pfaC). 1. Design and synthesize PCR primers for the amplification of DNA encoding the target genes. Add restriction sites to the primers to facilitate directional cloning. Use high-fidelity DNA polymerases, and sequence the PCR products to verify amplification fidelity. For large PCR fragments, use PCR to introduce cloning sites but replace the central portion of the target gene with genomic DNA to minimize PCR error. 2. Amplify the pfaE gene by PCR, and clone the PCR product as an NdeI-XhoI fragment into the same sites of pETDuet-1. 3. Amplify the 50 and 30 ends of pfaA by PCR, replace the central portion of the PCR product with an EcoRV-PflMI fragment of the genomic pfaA, and clone the entire pfaA gene as a BbsI-NotI fragment into the NcoI-NotI sites of pETDuet-1 that already contains pfaE (Step 2) to afford the expression plasmid pREZ67 (for pfaA/pfaE). 4. Amplify the pfaB and pfaD genes by PCR, and clone the PCR products as an NcoI-NotI and an NdeI-XhoI fragment, respectively, into the same sites of pACYCDuet-1 to afford the expression plasmid pREZ65 (for pfaB/pfaD). 5. Amplify the 50 and 30 ends of pfaC, replace the central portion of the PCR product with an AvrII fragment of the genomic pfaC, and clone the entire pfaC gene as an NdeI-XhoI fragment into the same sites of pCOLADuet-1 to afford the expression plasmid pREZ71 (for pfaC). 6. Co-introduce the three expression plasmids pREZ67, pREZ65, and pREZ71 into host strain E. coli BLR(DE3) by transformation. Select for transformants on LB agar supplemented with ampicillin (100 mg/ml), chloramphenicol (25 mg/ml), and kanamycin (50 mg/ml). 7. Pick a single colony from the plate, grow a seed inoculum in 3 ml of LB at 37 , transfer 0.5 ml of the seed inoculum to 50 ml of fresh LB medium, and incubate at 20 until the OD600 reaches 0.5. LB medium used for both seed and production culture is supplemented with ampicillin (100 mg/ml), chloramphenicol (25 mg/ml), and kanamycin (50 mg/ml).
86
Hui Jiang et al.
8. Induce PUFA synthase gene expression by adding 1 mM of isopropyl b-D-1-thiogalactopyranoside (IPTG), and incubate the culture at 20 for an additional 12 h. Collect the cell pellet by centrifugation for fatty acid methyl ester (FAME) analysis. 9. Add 2 ml of 1.5 M anhydrous HCl in methanol and 1 ml of toluene to the cell pellet from Step 8, stir the sample at 100 for 2 h, and cool it to room temperature. Collect the organic layer, wash it with 1 ml of saturated brine, and concentrate the sample to dryness by removing the solvent under reduced pressure. Identify and quantify the resulting FAMEs by GC and GC-MS analysis with authentic FAME standards.
2.2. Mapping the active sites of PfaA-ACPs by site-directed mutagenesis A general strategy to investigate the role of each of the ACP domains in PUFA synthase is to mutate, via site-directed mutagenesis, the active site Ser to Ala. The Ser residue of ACP is phosphopantatheinylated by the PPTase and subsequently used to tether the growing PUFA intermediate to the PUFA synthase in PUFA biosynthesis. Directed by bioinformatics, the Ser residue for each of the ACPs can be predicted and mutated to map their roles in PUFA synthase and PUFA biosynthesis. To systematically mutate each of the ACPs individually or combinatorially, two common cloning vectors pETm and pUCm, were first generated by inserting the pET-linker into the BglII-XhoI sites of pET28a and the pUC-linker into the EcoRI-HindIII sites of pUC18, respectively, to facilitate subclonings (Fig. 4.4). Additional modifications to the multicloning sites of pETm and pUCm may be necessary to accommodate the cloning needs for all individual ACPs. Boundaries of individual ACP domains can be determined by sequence analysis. DNA fragments encoding each ACP were cloned from pREZ67 (see Step 3, Section 1) into pETm or pUCm via several subcloning steps. Ser-to-Ala point mutation to each of the ACPs was generated by following the QuikChangeÒ site-directed mutagenesis protocol (Stratagene, La Jolla, CA) with primers summarized in Table 4.1. The resultant ACP mutants were then cloned back into pRE67 to replace the wild-type ACPs via several subcloning steps to afford 16 pREZ67-derived
Figure 4.4 DNA sequences of the pET-linker (A) and pUC-linker (B) in pETm and pUCm for constructing Ser-to-Ala point mutations in each of the PfaA-ACPs.
Table 4.1 PCR primers used for introducing a Ser-to-Ala point mutation into each of the PfaA-ACPs by QuikChange1 site-directed mutagenesis
a b c d
Primer
Sequencea
ACP1mu5b ACP1mu3b ACP5mu5c ACP5mu3c ACP6mu5d ACP6mu3d
50 -GCCGATTTAGGCATCGATGCAATTAAACGCGTTGAAATATTAGGTACT-30 50 -AGTACCTAATATTTCAACGCGTTTAATTGCATCGATGCCTAAATCGGC-30 50 -GCGGATTTAGGCATCGATGCAATTAAACGCGTTGAGATCTACTGACTT-30 50 -AAGTCAGTAGATCTCAACGCGTTTAATTGCATCGATGCCTAAATCCGC-30 50 -GCGGATTTAGGCATCGATGCAATTAAACGCGTTGAAATTTTAGGGACG-30 50 -CGTCCCTAAAATTTCAACGCGTTTAATTGCATCGATGCCTAAATCCGC-30
Codons designed for the Ser-to-Ala mutation are underlined. This pair of primers was used for mutagenizing the ACP1, ACP2, ACP3, and ACP4 domains of PfaA. This pair of primers was used for mutagenizing the ACP5 domain of PfaA. This pair of primers was used for mutagenizing the ACP6 domain of PfaA.
88
Hui Jiang et al.
expression plasmids carrying 16 combinations of Ser-to-Ala point mutations to each of the ACP domains of the PfaA subunit. Representative protocols used to produce the full panel of Ser-to-Ala mutants of ACPs are presented for plasmids pREZ67-1m and pREZ67-2m, in which a Ser-to-Ala point mutation is introduced specifically for ACP1 and ACP2 domains of PfaA, respectively. 2.2.1. Construction of pREZ67-1m [for pfaA-ACP1(S1300A)/pfaE] 1. Clone the 2.3-kb KpnI-BglII fragment of pREZ67 into the same sites of pETm to generate pACP1-5. Clone the 1.1-kb KpnI-EagI fragment of pACP1-5 into the same sites of pETm to generate pACP1. 2. Generate the PfaA-ACP1 (S1300A) mutation by following the QuikChange site-directed mutagenesis protocol using pACP1 as the template and ACP1mu5 and ACP1mu3 as primers (Table 4.1). 3. Add 10 units of DpnI directly to the PCR reaction mixture and digest at 37 for 1 h. Introduce 10 ml of the DpnI digested reaction mixture into E. coli DH5a by transformation. Select for transformants on LB agar supplemented with kanamycin (50 mg/ml). Pick a single colony to confirm the desired mutant construct (pACP1m) by sequencing. 4. Clone the 1.1-kb KpnI-EagI fragment of pACP1m back into the same sites of pACP1-5 to generate pACP1-5-1m. 5. Clone the 2.3-kb KpnI-BglII fragment of pACP1-5-1m back into the same sites of pREZ67 to generate pREZ67-1m. 2.2.2. Construction of pREZ67-2m [for pfaA-ACP2(S1406A)/pfaE] 1. Clone the 1.2-kb EagI-BglII fragment of pACP1-5 into the same sites of pETm to generate pACP2-5. Clone the 0.98-kb EagI-HindIII fragment of pACP2-5 into the same sites of pUCm to generate pUCACP2-4. Clone the 0.28-kb EagI-DraIII fragment of pUCACP2-4 into the same sites of pUCm to generate pUCACP2. 2. Generate the PfaA-ACP2 (S1406A) mutation by following the QuikChange site-directed mutagenesis protocol using pUCACP2 as the template and ACP1mu5 and ACP1mu3 as primers (Table 4.1). 3. Add 10 units of DpnI directly to the PCR reaction mixture and digest at 37 for 1 h. Introduce 10 ml of the DpnI-digested reaction mixture into E. coli DH5a by transformation. Select for transformants on LB agar supplemented with ampicillin (100 mg/ml). Pick a single colony to confirm the desired mutant construct (pUCACP2m) by sequencing. 4. Clone the 0.28-kb EagI-DraIII fragment of pUCACP2m back into the same sites of pUCACP2-4 to generate pUCACP2-4-2m. 5. Clone the 0.98-kb EagI-HindIII fragment of pUCACP2-4-2m back into the same sites of pACP2-5 to generate pACP2-5-2m.
89
ACP Domains of PUFA Synthases
6. Clone the 1.2-kb EagI-BglII fragment of pACP2-5-2m back into the same sites of pACP1-5 to generate pACP1-5-2m. 7. Clone the 2.3-kb KpnI and BglII fragment of pACP1-5-2m back into the same sites of pREZ67 to generate pREZ67-2m.
2.3. Overproduction of each of the PfaA-ACPs 1. Determine ACP boundaries by DNA sequence analysis. Design and synthesize PCR primers for the amplification of DNA encoding the target ACP domains. Incorporate the BamHI and NotI sites into the primers to facilitate directional cloning of the PCR products into pETDuet-1. 2. Amplify the DNAs encoding the six PfaA-ACPs from cosmid 3F3 using the primers summarized in Table 4.2. Clone the PCR products as BamHI-NotI fragments into the same sites of pETDuet-1 to afford pETDuet-1-based expression constructs. Sequence the constructs to verify PCR amplification fidelity. 3. Alternatively, amplify the DNA encoding PfaA-ACP1 from cosmid 3F3 using primers summarized in Table 4.2. Clone the PCR product as an NdeI-XhoI fragment into the same sites of pET28a to afford the pET28a-based expression constructs. Sequence the constructs to verify PCR amplification fidelity. 4. Introduce the expression constructs into host strain E. coli BL21(DE3) by transformation. Select for transformants on LB agar supplemented with ampicillin (100 mg/ml) for pETDuet-1 based expression constructs or kanamycin (50 mg/ml) for the pET28a based expression construct. 5. Pick a single colony from the plate, inoculate 3 ml of LB medium supplemented with ampicillin (100 mg/ml) or kanamycin (50 mg/ml), and incubate at 37 for 12 h. 6. Transfer 0.5 ml of the above culture to 50 ml of LB medium supplemented with ampicillin (100 mg/ml) or kanamycin (50 mg/ml), and grow cells at 37 until the OD600 reaches 0.5. Induce ACP expression by adding 1 mM IPTG, and continue incubation at 37 for 4 h. 7. Pellet cells by centrifugation at 4 and 9200g for 15 min, resuspend the cell pellet in 15 ml of buffer (50 mM Tris HCl, pH 8.0, 300 mM NaCl, 10 mM imidazole), add 1 mg of lysozyme, and keep cells on ice for 1 h. 8. Lyse cells by sonication on ice, centrifuge at 15,000 rpm for 1 h at 4 in a Beckman J2-HS centrifuge equipped with a JA-25.50 rotor (Beckman, Fullerton, CA), and collect the supernatant. 9. Add 2 ml of Ni-NTA agarose (Qiagen, Valencia, CA) to the supernatant, gently shake on ice for 1 h to allow the His6-tagged PfaA-ACPs to bind the Ni-NTA agarose, and load the Ni-NTA agarose-containing
Table 4.2 Primers used for PCR amplification of each of the pfaA-ACPs as well as pfaE from cosmid 3F3 Primer
Forward
Reverse
a b
Sequence
ACP1a ACP1b ACP2 ACP3 ACP4 ACP5 ACP6 pfaE ACP1a ACP1b ACP2 ACP3 ACP4 ACP5 ACP6 pfaE
For amplifying pfaA-ACP1 in Step 2 (Section 3). For amplifying pfaA-ACP1 in Step 3 (Section 3).
50 -GCGGGATCCAACAGCCCTGAGCTCACAAAA-30 50 -AGCCATATGACAGCCCTGAGCTCACAA-30 50 -GCGGGATCCATCAGGTCTTAGCGCAGAAAC-30 50 -GCGGGATCCATCTGGCCTTAGCGCTGAAAC-30 50 -GCGGGATCCATCTGGTCTTAGCGCAGAAAC-30 50 -GCGGGATCCATCAGGTTTAAGTGCGGAACA-30 50 -GCGGGATCCAACAGCCCTGAGCGCTGAGCA-30 50 -CAAGCGCATATGTCTTATTGCTATTATAAA-30 50 -CGCGCGGCCGCTTAGCCTGCGGCCGGTAGTTTA-30 50 -GGCCTCGAGTTATGCATTTGCAGTGTCGCT-30 50 -CGCGCGGCCGCTTAGCCTGCGGCGGGTAGTTTA-30 50 -CGCGCGGCCGCTTAACCAGCAGCGGGTAGCTTA-30 50 -CGCGCGGCCGCTTAGCCTGCGGCGGGTAGTTTA-30 50 -CGCGCGGCCGCTTAGCCTGCGGCGGGTAGTTTA-30 50 -CGCGCGGCCGCTTAGCCTGCGGCTGGCAGTTTA-30 50 -AGACTCGAGTCAGTTGGTTTTTATGAACATTT-30
91
ACP Domains of PUFA Synthases
solution onto a column. Wash the Ni-NTA agarose column with 30 ml of the buffer (50 mM Tris HCl, pH 8.0, 300 mM NaCl, 20 mM imidazole). 10. Elute the His6-tagged PfaA-ACPs with 2 ml of buffer (50 mM Tris HCl, pH 8.0, 300 mM NaCl, 300 mM imidazole), and dialyze ACP fractions against 250 ml of buffer (25 mM Tris HCl, pH 8.0, 25 mM NaCl, 10% glycerol). 11. Assess purity of the purified PfaA-ACPs by 15% SDS-PAGE (Fig. 4.5A). 12. Characterize the resultant PfaA-ACPs in apo-form by reverse phase HPLC analysis using a Jupiter C-18 column (5 mm, 300A˚, 250 4.6 mm, Phenomenex, Belmont, CA), and a gradient from 15 to 90% CH3CN in 0.1% TFA-H2O over 30 min at a flow rate of 1.0 ml/min, and UV detection at 220 nm (Fig. 4.5B). 13. Collect individual protein peaks from HPLC, lyophilize and characterize the resultant PfaA-ACPs in apo-form by ESI-MS analysis (Agilent 1000 HPLC-MSD SL instrument, Palo Alto, CA) (Table 4.3).
2.4. Overproduction of PfaE and Svp PPTases 1. Amplify the pfaE gene by PCR from cosmid 3F3 using the primers summarized in Table 4.2. Clone the PCR product as an NdeI-XhoI fragment into the same sites of pET28a to afford the expression construct. A kDa 50 40 30 25 20 15 10
Lane 1 2
B mAU at 220 nm 800 0
800
0
800
C I
kDa 50 40
II
30
III
20
0 10
12 14 Retention time (min)
1
2
Lane 3
4
15
Figure 4.5 Analysis of PfaA-ACPs and PfaE PPTase, and HPLC analysis of in vivo and in vitro phosphopantatheinylation of PfaA-ACP1. (A) 15% SDS-PAGE analysis of purified PfaA-ACP1: lane 1, protein markers, and lane 2, PfaA-ACP1 (100 amino acids, calculated mass: 10,896 Da). (B) HPLC analysis of PfaA-ACP1: (I) PfaA-ACP1 overproduced in E. coli; (II) PfaA-ACP1 overproduced in E. coli coexpressing pfaE; and (III) apo-PfaA-ACP1 incubated with Svp in vitro. (C) 15% SDS-PAGE analysis of purified PfaE: lane 1, protein markers; lane 2, total PfaE; lane 3, insoluble PfaE; and lane 4, soluble PfaE. ○, apo-PfaA-ACP1, , holo-PfaA-ACP1.
92
Hui Jiang et al.
Table 4.3 ESI-MS analysis of apo- and holo-forms of PfaA-ACPs examined Apo-form
ACP (# amino acids) c
ACP1 (116) ACP1 (100)d ACP2 (100) ACP3 (100) ACP4 (100) ACP5 (100) ACP6 (100) a b c d
Holo-form
Calculated
Found
Calculated
Found upon in vitro assaya
12454 10896 10781 10882 10869 10799 10797
12450 10894 10778 10879 10872 10802 10795
12794 11236 11121 11222 11207 11139 11137
12790 ND ND ND ND ND ND
Found upon in vivo assayb
ND 11232 11117 11218 11205 11134 11133
Phosphopantetheinylation of PfaA–ACP1 catalyzed by Svp PPTase in vitro. Phosphopantetheinylation of PfaA–ACPs by coexpression of pfaA-ACPs with pfaE in vivo. PfaA–ACP1 overproduced from the expression construct in Step 3 (Section 3). PfaA–ACP1 overproduced from the expression construct in Step 2 (Section 3).
2. Follow Steps 4 to 8 in Section 2.3, and vary fermentation temperature between 18 and 37 and IPTG concentration from 1 mM and 1 mM to optimize production of soluble PfaE. Follow Steps 9 to 11 in Section 2.3 to purify PfaE. Under the conditions examined, the His6-tagged PfaE was overproduced predominantly as an insoluble protein (Fig. 4.5C). 3. Follow the literature procedure to overproduce Svp as a soluble protein, purify it to homogeneity and use it as a promiscuous PPTase for in vitro phosphopantetheinylation of apo-PfaA-ACPs to generate holo-PfaAACPs (Sanchez et al., 2001).
2.5. In vivo and in vitro preparation of the holo-form of PfaA-ACPs 2.5.1. In vivo phosphopantetheinylation of PfaA-ACPs from apo- into holo-form by coexpression of pfaA-ACPs with pfaE 1. Clone pfaE as an NdeI-XhoI fragment (Step 2, Section 2.1) into the same sites of the pETDuet-1–based pfaA-ACP expression constructs (Step 2, Section 2.3) to afford expression constructs for each of the pfaA-ACPs coexpressed with pfaE. 2. Follow Steps 4 to 13 in Section 2.3 for expression, overproduction, purification, HPLC (Fig. 4.5C) and ESI-MS analysis (Table 4.3) of the resultant PfaA-ACPs in holoform.
93
ACP Domains of PUFA Synthases
2.5.2. In vitro phosphopantetheinylation of PfaA-ACP1 from apo-into holo-form by Svp 1. Prepare a typical in vitro phosphopantetheinylation reaction in 100 ml containing 100 mM apo-ACP, 500 mM CoA, 5 mM Svp, 12.5 mM MgCl2, and 2.5 mM DTT in 100 mM Tris HCl, pH 7.5. Incubate reactions at 25 for 30 min. 2. Analyze the conversion of apo- to holo-ACP by HPLC (Fig. 4.5B) and ESI-MS analysis (Table 4.3) as described in Steps 12 and 13 (Section 2.3).
2.6. Elucidation of the relationship between PUFA production and the number of active ACPs 1. Co-introduce each of the 16 pREZ67-derived expression plasmids (Section 2) with pREZ65 (Step 4, Section 2.1) and pREZ71 (Step 5, Section 2.1) into host strain E. coli BLR(DE3) by transformation to investigate PUFA titers resulting from different combinations of Ser-to-Ala point mutations to each of the ACP domains of the PfaA subunit (Section 2.2). Select for transformants on LB agar supplemented with ampicillin (100 mg/ml), chloramphenicol (25 mg/ml), and kanamycin (50 mg/ml). 2. Follow Steps 7 to 9 (Section 2.1) for pfa gene expression, PUFA production, and FAME preparation and analysis to correlate PUFA titers to number and relative location of active ACP domains within the PfaA mutant (Section 2.2). Representative data are shown in Table 4.4 and Fig. 4.6.
3. Conclusion Traditional sources of PUFAs (predominantly oceanic fish oils) are now widely recognized as being unsustainable due to global warming, pollution of the marine environment, overfishing, and a rapidly growing global population, among other problems (Graham et al., 2007). The discovery of PUFA production and subsequent cloning and sequencing of gene clusters encoding PUFA biosynthesis in a wide array of marine organisms have caused significant excitement for PUFA production via PUFA synthase expression and engineering (Wallis et al., 2002; Kaulmann and Hertweck, 2002; Berge´ and Barnathan, 2005). Key advantages for such an alternative source of PUFAs include (1) simpler PUFA profile (often one predominant product from microbial sources) rather than a complex
94
Hui Jiang et al.
Table 4.4 PUFA titers from recombinant strains harboring pfa PUFA synthase gene expression constructs that carry varying numbers of Ser-to-Ala point mutations in the ACP domains of the PfaA subunit
Wildtype PfaA Mutations to selected one of the six ACPs Mutations to selected two of the six ACPs Mutations to selected three of the six ACPs Mutations to selected four of the six ACPs Mutations to selected five of the six ACPs Mutations to all six ACPs a
No. of functional ACPs
% EPAa
% DPAa
6 5
8.9 0.3 7.7 0.8
1.4 0.1 1.3 0.2
4
8.2 0.3
1.2 0.1
3
6.6 0.3
0.7 0.1
2
5.4 0.2
0.6 0.1
1
3.3 0.5
0.3 0.1
0
0.0
0.0
Percent EPA and percent DPA values are percentages relative to total fatty acid content as determined by the FAME method.
% EPA production
8.0
6 4
6.0
3 2
2
5
0
1
3
4
4.0 1
2.0
0.0
0
0
5
Active ACP Inactive ACP
6
1
2 3 4 5 Number of active ACPs
6
Figure 4.6 Relationship between percent EPA yield (relative to total amount of fatty acids) and number of active ACP domains within PfaA. The horizontal axis indicates number of active, nonmutagenized, ACPs. The vertical axis indicates percent EPA production observed.
ACP Domains of PUFA Synthases
95
mixture currently obtained from fish or algal oils, thereby significantly reducing the expense associated with preparative PUFA purification, and (2) biotechnological opportunities to investigate and exploit, via heterologous expression and engineering strategies, the PUFA synthase genes for large-scale production by fermentation, titer improvement, and engineered production of specific PUFAs. The past few years have witnessed exponential growth in discovering PUFA biosynthetic gene clusters (Okuyama et al., 2007). Although it is now well accepted that PUFA synthase-catalyzed de novo biosynthesis of PUFAs from acyl CoA precursors is widespread, our understanding of the enzymology and biochemistry of PUFA synthases remains rudimentary, requiring the development and application of new research methods for mechanistic characterization. The potential of engineering PUFA synthase genes for PUFA production remains, to date, largely untapped. The methods and protocols described here have been instrumental in elucidating key elements of PUFA biosynthesis in S. japonica, a microbial EPA and DPA producer that we have studied as a model for PUFA synthase and PUFA biosynthesis. These studies have allowed us to conclude that each of the bioinformatically predicted tandem ACPs is phosphopantetheinylated and functionally equivalent but that the number of functional ACPs correlates directly to PUFA yields ( Jiang et al., 2008). We have further demonstrated that our finding on the roles of tandem ACPs from PfaA most likely are general for other PUFA synthases by constructing a hybrid PUFA synthase with subunits from both the S. japonica (an EPA and DPA producer) and M. marina (a DHA producer) PUFA synthases (Fig. 4.3). Examination of the PUFA profiles from the recombinant E. coli strains carrying the hybrid PUFA synthase led us to the conclusion that, while the overall PUFA titer directly depends on the total number of active ACPs, the determinant(s) of the final PUFA products is in contrast ACP-independent ( Jiang et al., 2008). These studies set the stage to interrogate other domains and subunits of PUFA synthase for their roles in controlling the final PUFA products and to engineer the PUFA biosynthetic machinery for improving production. Central to future engineering efforts is a continued and rigorous dissection of PUFA synthases from a broader selection of microbial PUFA producers. The ubiquity of tandem ACP domains among PUFA synthases as shown by bioinformatics, combined with the clear need to develop new PUFA sources, hints at the importance of enzymology and biochemistry experiments sure to benefit from the methods and protocols described herein.
ACKNOWLEDGEMENT This work was supported in part by a grant from Martek Biosciences Co., Columbia, MD.
96
Hui Jiang et al.
REFERENCES Berge´, J.-P., and Barnathan, G. (2005). Fatty acids from lipids of marine organisms: Molecular biodiversity, roles as biomarkers, biologically active compounds, and economical aspects. Adv. Biochem. Eng. Biotechnol. 96, 49–125. Graham, I. A., Larson, T., and Napier, J. A. (2007). Rational metabolic engineering of transgenic plants for biosynthesis of omega-3-polyunsaturates. Curr. Opinion Biotechnol. 18, 142–147. Hauvermale, A., Kuner, J., Rosenzweig, B., Guerra, D., Diltz, S., and Metz, J. G. (2006). Fatty acid production in Schizochytrium sp.: IInvolvement of a polyunsaturated fatty acid synthase and a type I fatty acid synthase. Lipids 41, 739–747. Huang, Y.-S., Pereira, S. L., and Leonard, A. E. (2004). Enzymes for transgenic biosynthesis of long-chain polyunsaturated fatty acids. Biochimie 86, 793–798. Jiang, H., Zirkle, R., Metz, J. G., Braun, L., Richter, L., Van Lanen, S. G., and Shen, B. (2008). The role of tandem acyl carrier protein domains in polyunsaturated fatty acid biosynthesis. J. Am. Chem. Soc. 130, 6336–6337. Kaulmann, U., and Hertweck, C. (2002). Biosynthesis of polyunsaturated fatty acids by polyketide synthases. Angew. Chem. Int. Ed. Engl. 41, 1866–1869. Metz, J. G., Roessler, P., Facciotti, D., Levering, C., Dittrich, F., Lassner, M., Valentine, R., Lardizabal, K., Domergue, F., Yamada, A., Yazawa, K., Knauf, V., et al. (2001). Production of polyunsaturated fatty acids by polyketide synthases in both prokaryotes and eukaryotes. Science 293, 290–293. Muskiet, F. A., and Kemperman, R. F. (2006). Folate and long-chain polyunsaturated fatty acids in psychiatric disease. J. Nutr. Biochem. 17, 717–727. Okuyama, H., Orikasa, Y., Nishida, T., Watanabe, K., and Morita, N. (2007). Bacterial genes responsible for the biosynthesis of eicosapentaenoic and docosahexaenoic acids and their heterologous expression. Appl. Environ. Microbiol. 73, 665–670. Orikasa, Y., Nishida, T., Hase, A., Watanabe, K., Morita, N., and Okuyama, H. (2006). A phosphopantetheinyl transferase gene essential for biosynthesis of n–3 polyunsaturated fatty acids from Moritella marina strain MP-1. FEBS Lett. 580, 4423–4429. Pereira, S. L., Leonard, A. E., and Mukerji, P. (2003). Recent advances in the study of fatty acid desaturases from animals and lower eukaryotes. Prostaglandins Leukot. Essent. Fatty Acids 68, 97–106. Sanchez, E. L., Du, L. C., Edwards, D. J., Toney, M. D., and Shen, B. (2001). Cloning and characterization of a phosphopantetheinyl transferase from Streptomyces verticillus ATCC15003, the producer of the hybrid peptide-polyketide antitumor drug bleomycin. Chem. Biol. 8, 725–738. Sugihara, S., Orikasa, Y., and Okuyama, H. (2008). An EntD-like phosphopantetheinyl transferase gene from Photobacterium profundum SS9 complements pfa genes of Moritella marina strain MP-1 involved in biosynthesis of docosahexaenoic acid. Biotechnol. Lett. 30, 411–414. Uttaro, A. D. (2006). Biosynthesis of polyunsaturated fatty acids in lower eukaryotes. IUBMG Life 58, 563–571. Wallis, J. G., Watts, J. L., and Browse, J. (2002). Polyunsaturated fatty acid synthesis: What will they think of next? Trends Biochem. Sci. 27, 467–473. Warude, D., Joshi, K., and Harsulkar, A. (2006). Polyunsaturated fatty acids: Biotechnology. Crit. Rev. Biotechnol. 26, 83–93. Weaver, C. A., Zirkle, R., and Metz, J. G. (2007). PUFA polyketide synthase systems and uses thereof. U.S. Patent 7217856.
C H A P T E R
F I V E
Iterative Type I Polyketide Synthases for Enediyne Core Biosynthesis Geoffrey P. Horsman,* Steven G. Van Lanen,† and Ben Shen*,‡ Contents 1. Introduction 2. Methods 2.1. PCR amplification of PKSE cassettes for predictive classification of new enediynes 2.2. Heterologous expression and overproduction of PKSE proteins 2.3. Production and isolation of the polyene intermediate from 9-membered PKSEs 2.4. Production of apo-ACPs from PKSE for in vitro functional analyses 2.5. In vitro preparation of holo-ACPs 3. Conclusion Acknowledgment References
98 101 101 103 105 107 108 109 111 111
Abstract Enediyne natural products are extremely potent antitumor antibiotics with a remarkable core structure consisting of two acetylenic groups conjugated to a double bond within either a 9- or 10-membered ring. Biosynthesis of this fascinating scaffold is catalyzed in part by an unusual iterative type I polyketide synthase, PKSE, that is shared among all enediyne biosynthetic pathways whose gene clusters have been sequenced to date. The PKSE is unusual in two main respects: (1) it contains an acyl carrier protein (ACP) domain with no sequence homology to any known proteins, and (2) it is self-phosphopantetheinylated by an integrated phosphopantetheinyl transferase (PPTase) domain. The unusual domain architecture and biochemistry of the PKSE hold promise both for the rapid identification of new enediyne natural products and for obtaining fundamental catalytic insights into enediyne biosynthesis. This chapter describes methods for rapid PCR-based classification of conserved enediyne biosynthetic genes, * {
{
Division of Pharmaceutical Sciences, University of Wisconsin-Madison, Madison, Wisconsin, USA Division of Pharmaceutical Sciences, College of Pharmacy, University of Kentucky, Lexington, Kentucky, USA Department of Chemistry, University of Wisconsin-Madison, Madison, Wisconsin, USA
Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04605-9
#
2009 Elsevier Inc. All rights reserved.
97
98
Geoffrey P. Horsman et al.
heterologous production of 9-membered PKSE proteins and isolation of the resulting polyene product, and in vitro characterization of the PKSE ACP domain.
1. Introduction The enediyne family of natural products are among the most potent anticancer drugs ever discovered (Wang and Xie, 1999). A neocarzinostatinpolymer conjugate SMANCSÒ (Maeda, 2001) and calicheamicin-antibody conjugate MylotargÒ (Sievers and Linenberger, 2001) are used clinically in Japan and the United States, respectively. While their extraordinary biological activity generates interest among clinicians, the unprecedented molecular architecture of the enediynes motivates biochemical studies to decipher the biosynthetic logic of their assembly. The structurally remarkable enediyne core, or so-called ‘‘warhead,’’ consists of two acetylenic groups conjugated to a double bond within either a 9- or 10-membered ring exemplified by C-1027 and calicheamicin, respectively (Fig. 5.1). Cytotoxicity arises from environmentally triggered cyclization of the enediyne core to yield a benzenoid diradical capable of abstracting hydrogen from DNA (Galm et al., 2005). Although elucidation of the biosynthetic pathways for the peripheral moieties has progressed rapidly in recent years, little is known about the assembly of the enediyne core itself, and fascinating enzymology surely awaits discovery (Van Lanen and Shen, 2008). Such detailed biochemical knowledge is required to generate improved enediyne analogues via rational manipulation of the biosynthetic machinery (Kennedy et al., 2007a,b). A de novo biosynthetic pathway involving a dedicated polyketide synthase (PKS) has only recently been shown to be responsible for production of the enediyne core. Although early studies employing isotope-labeling experiments established acetate as a precursor (Hensens et al., 1989; Lam et al., 1993; OCH3
O
SSSCH3 O
N H
O
O H3C (CH3)2N
O
CH3 OH OH
HO
O
O
O
O O O
O
O
NHCO2 CH3 CH3 N O OH H
OH O
CH3 S
OCH3
H3C
OCH3 NHEt
OCH3
I
OH O
O H3C HO
Cl
CH3O
NH2
C-1027
O
O OH
Calicheamicin
Figure 5.1 Structures of representative members of the 9-membered (C-1027) and 10-membered (calicheamicin) enediyne natural products.
Enediyne Polyketide Synthases
99
Tokiwa et al., 1992), these experiments could not distinguish whether the enediyne core originated from a dedicated PKS or from the degradation of a fatty acid precursor. However, five enediyne biosynthetic gene clusters— those for C-1027 (Liu et al., 2002), neocarzinostatin (Liu et al., 2005), maduropeptin (Van Lanen et al., 2007), calicheamicin (Ahlert et al., 2002), and dynemicin (Gao and Thorson, 2008)—have now been sequenced and each has been shown to possess a unique iterative type I PKS (PKSE) sharing significant sequence homology and domain architecture. The essential role of the PKSE was established when C-1027 production was abolished by disruption of the sgcE gene (i.e., the pksE gene from the C-1027 cluster) and restored upon complementation of the △sgcE mutation by expressing a functional copy of sgcE in trans (Liu et al., 2002). Similar results were obtained using the PKSE from the neocarzinostatin cluster, NcsE (Liu et al., 2005), and the maduropeptin cluster, MdpE (Van Lanen et al., 2007). Together, these results definitively establish the polyketide origin of the enediyne core. The unique, enediyne-specific pksE gene cassettes may be exploited to identify new enediyne biosynthetic gene clusters. Indeed, a universal PCR-based method has been developed whereby degenerate primers from conserved PKSE regions are used to rapidly amplify and clone additional pksE genes (Liu et al., 2003). Sequencing and phylogenetic analysis of the resulting minimal enediyne cassettes has revealed a clear genotypic distinction between 9- and 10-member-specific PKSEs. This distinction significantly aids prediction of unknown enediyne core structures directly from the pksE gene sequence. Thus, rapid PCR-based enediyne genotyping of new enediyne-producing isolates may direct the discovery of new members of the enediyne family of natural products. The availability of multiple pksE sequences has enabled bioinformatics analysis, which unambiguously identified four domains: a ketosynthase (KS), acyltransferase (AT), ketoreductase (KR), and dehydratase (DH). In both domain organization and sequence homology, PKSEs are most closely related to the polyunsaturated fatty acid (PUFA) synthases involved in the biosynthesis of docosahexaenoic acid in Moritella marina and eicosapentaenoic acid in Shewanella japonica ( Jiang et al., 2008; Metz et al., 2001) (Fig. 5.2A). (See Chapter 4 in this volume.) However, two unusual features distinguish the PKSEs as an unusual PKS family unique to enediyne biosynthesis. First, a region between the AT and KR domains was proposed to be an acyl carrier protein (ACP) based on identical architecture to the PUFA synthases (Fig. 5.2A), even though this region has no homology to any known proteins. Second, the C-terminal region was predicted to be a phosphopantetheinyl transferase (PPTase) capable of loading the phosphopantetheine (Ppant) cofactor onto the ACP (Zazopoulos et al., 2003). In contrast to typical ACP loading by a discrete PPTase, such selfphosphopantetheinylation is extremely rare (Fichtlscherer et al., 2000; Weissman et al., 2004). The above-described in vivo complementation
100
Geoffrey P. Horsman et al.
A PUFA synthase (∼2500 aa)
KS
AT
PKSE (∼1900 aa)
KS
AT
Multiple ACPs
ACP
KR
DH
KR
PPTase
9-membered specific accessory enzymes
B
DH
9-membered enediynes
O SCoA
O
ACP
PKSE
+
S
O
−
SCoA
O (7x)
–CO2 (7x)
R O
polyketide intermediate
10-membered enediynes
10-membered specific accessory enzymes
C
E10 (TE)
ACP
S
R
−
O O
OH CO2 + H2O
O Polyketide intermediate
1
3
5
7
9
11
13
15
Figure 5.2 PKSE domain organization and role in enediyne core biosynthesis. (A) Domain organization of PKSE is similar to that of the PUFA synthases. (B) Enediyne core biosynthesis carried out by PKSE and accessory enzymes is responsible for divergence of the polyketide intermediate into either 9- or 10-membered enediyne families of natural products. (C) Structure of the polyene product 1,3,5,7,9,11,13-pentadecaheptanene isolated upon coexpression of 9-membered pksE and pksE10 exemplified by sgcE/sgcE10 and ncsE/ncsE10.
system was used to demonstrate that Ser974Ala and Asp1827Ala variants of SgcE failed to restore C-1027 production in the △sgcE mutant (Zhang et al., 2008), consistent with the proposed roles of Ser974 as a site for Ppant modification on the ACP and Asp1827 as a PPTase catalytic residue. Although rapid genotyping and in vivo complementation revealed a domain architecture that is unique to the PKSEs, in vitro functional characterization is required to unambiguously identify the ACP and PPTase domains. Recent methods have been developed to biochemically characterize PKSEs, providing fascinating insights into their function (Zhang et al., 2008). For instance, the development of a heterologous expression system for 9-membered PKSEs led to the isolation of a polyene compound as the first
Enediyne Polyketide Synthases
101
isolable intermediate en route to enediyne core biosynthesis (Fig. 5.2B and C), and this intermediate could not be isolated from the aforementioned Ser974Ala or Asp1827Ala mutants of the ACP or PPTase, respectively. The roles of the ACP and PPTase domains were then confirmed by two crucial in vitro biochemical experiments employing both the wildtype SgcE and the respective Ser974Ala and Asp1827Ala site-directed mutants. First, peptide mapping of SgcE by Fourier-transform mass spectrometry clearly identified a þ340 amu mass shift associated with Ser974 of the ACP domain. Consistent with Ppant modification, the mass shift disappeared upon mutation of either the Ser974 of the ACP or the Asp1827 of the PPTase. Second, phosphopantetheinylation was definitively demonstrated by incubation of the ACP domain with the exogenous PPTase Svp (Sanchez et al., 2001). The conversion of apo-ACP to holo-ACP could be monitored by HPLC, and the substrate and product of this reaction could be isolated and identified by mass spectrometry. Moreover, the PPTase from the calicheamicin pathway was expressed and in vitro phosphopantetheinylation of several carrier proteins was demonstrated (Murugan and Liang, 2008). Together, these results establish PKSE as an iterative type I PKS of unusual domain architecture that self-phosphopantetheinylates a novel ACP domain. This chapter describes the protocols for identification and characterization of the iterative type I PKS for enediyne core biosynthesis (PKSEs): (1) PCR amplification of pksE cassettes for predictive classification of new enediynes; (2) heterologous expression and purification of 9-memberedspecific PKSE proteins in Escherichia coli; (3) production and isolation of the polyene intermediate produced by the 9-membered PKSEs; (4) heterologous expression and purification of 9-membered-specific ACP domains; and (5) their in vitro phosphopantetheinylation.
2. Methods 2.1. PCR amplification of PKSE cassettes for predictive classification of new enediynes 2.1.1. Primer design 1. Conserved regions of shared genes involved in enediyne core biosynthesis (including the PKSE) from the loci for C-1027, neocarzinostatin, and calicheamicin were used to construct degenerate primers (Fig. 5.3 and Table 5.1) (Liu et al., 2003). Primer pairs A–E and A–F, respectively, amplify 1.4- and 3.8-kb fragments of the N-terminal PKSE gene, whereas primer pairs C-H and D-H respectively amplify 2.9- and 0.9-kb fragments of the C-terminal region. The B–G primer pair is
102
Geoffrey P. Horsman et al.
A
A
C
B E
0
1
2
3
4
5
F 6
7
NcsE3
NcsE4
NcsE5
NcsE
SgcE3
SgcE4
SgcE5
SgcE
CalU5
CalU4
CalT3
CalE8
D H
G 8
9
10
11
12
13 kb
NcsE10
NCS SgcE10
C-1027 CalE7
CAL
B
Figure 5.3 Degenerate primer design for PCR-based amplification of PKSE fragments. (A) Location of primers in relation to the pksE and associated genes that together constitute a minimal pksE cassette from the neocarzinostatin (NCS), C-1027, and calicheamicin (CAL) biosynthetic clusters. (B) The conserved amino acid motifs used to design degenerate primers A to H. Numbers between motifs represent amino acid distance, and the noncoding regions between open reading frames (<10 nt) are denoted by a slash.
designed to generate a PCR product that overlaps the products of the A–F and C–H primer pairs. Generation of PCR products 1. Prepare genomic DNA from an enediyne-producing organism following a standard literature protocol. For example, a genomic DNA preparation may be readily prepared from gram-positive bacteria (Pospiech and Neumann, 1995). 2. Prepare a 50-ml PCR reaction mixture containing 1 ml diluted template DNA, 1X reaction buffer, 5% DMSO, 1.5 mM MgCl2, 0.5 mM of each primer, 0.2 mM of each dNTP, and 1 unit of Taq polymerase. 3. Place the PCR reaction in a thermocycler and initiate the following program: (a) 94 (5 min); (b) [94 (45 s), 60-65 (1.5 min), 72 (2 to 5 min)] 30 cycles; (c) 72 (7 min); and (d) hold at 4 . 4. Purification, subcloning, and sequencing of PCR products may be done following standard procedures.
Enediyne Polyketide Synthases
103
Table 5.1 Primers used for PCR Amplification of the pksE Genes Primer
Forward A B C D Reverse E F G H a
Sequencea
50 -CCCCGCVCACATCACSGSCCTCGCSGTGAA CATGCT-30 0 5 -GGCGGCGGVTACACSGTSGACGGMGCCTGC-30 50 -GACGAYCTGCACMTGAGCTCSATCACCGT CGGCCAG-30 50 -CARGTGTGCGTSCCSGACGCS-30 50 -GCAGGCKCCGTCSACSGTGTABCCGCCGCC-30 50 -CTGGCCGACGGTGATSGAGCTCAKGTGCAG RTCGTC-30 0 5 -CCCATSCCGACSCCGGACCASACSGACCAYTCCA-30 50 -ACGTTGCCGACSAGRTTSGTYTCCTCGAACCGAC-30
IUB codes for mixed base sites: M ¼ A or C; R ¼ A or G; S ¼ C or G; Y ¼ C or T; K ¼ G or T; V ¼ A, C, or G; B ¼ C, G, or T.
2.1.2. Sequence and phylogenetic analysis 1. Assemble the sequences of overlapped PCR fragments from at least five independent clones into contiguous regions using a standard software package, and identify probable open reading frames. 2. Compare the deduced protein sequences with other known proteins in the databases using available BLAST methods, and perform phylogenetic analysis using standard methods such as CLUSTALW and DRAWTREE (http://workbench.sdsc.edu).
2.2. Heterologous expression and overproduction of PKSE proteins 2.2.1. Generation of an E. coli expression construct for pksE 1. Prepare PCR primers suitable for amplification of the pksE gene and subsequent ligation-independent cloning as described by Novagen (Madison, WI). 2. Prepare a PCR reaction using the Expand Long Template PCR System from Roche (Indianapolis, IN) according to the manufacturer’s instructions. A typical PCR reaction includes 10- to 100-ng pksE-containing template DNA, 1X supplied buffer, 300 nM of each primer, 350 mM of each dNTP, 5% DMSO, and 2.5 U DNA polymerase per 50-ml reaction. 3. Initiate the following PCR program: (a) 94 (5 min); (b) [94 (10 s), 56 (30 s), 68 (40 s per kb of desired product)] 30 cycles; (c) 68 (7 min); and (d) hold at 4 .
104
Geoffrey P. Horsman et al.
4. Purify the PCR product as an electrophoretically resolved band from a 0.8 to 1% agarose gel using a standard procedure such as the QIAQuick gel purification kit (Qiagen, Valencia, CA). 5. Generate the expression construct by inserting the gel-purified PCR product into the pET-30 Xa/LIC vector by ligation-independent cloning as described by Novagen (Madison, WI), and sequence to confirm the fidelity of the PCR reaction. 2.2.2. Expression, overproduction, and purification of His6-tagged PKSE 1. Introduce the above pksE-containing pET-30 Xa/LIC expression construct into E. coli BL21(DE3) by transformation, and plate on LB medium supplemented with 50 mg/ml kanamycin. 2. Pick a single colony from the plate, inoculate 3 ml of LB medium supplemented with 50 mg/ml kanamycin and incubate at 37 for 12 h. 3. Transfer a 0.5-ml aliquot to 50 ml of LB medium containing 50 mg/ml kanamycin, grow for an additional 12 h at 37 and shake at 250 rpm. 4. Transfer 5 ml of the above culture to 500 ml of LB medium supplemented with 50 mg/ml kanamycin and incubate at 18 and 250 rpm. 5. When the optical density at 600 nm (OD600) reaches 0.5 (after approximately 10 h), induce PKSE expression by adding 0.1 mM of isopropyl b-D-1-thiogalactopyranoside (IPTG), and incubate the cells at 18 for a further 15 h with shaking at 250 rpm. 6. Pellet the cells by centrifugation at 4 and 9200g for 15 min. 7. On ice, use a pipette to resuspend the cell pellet in 15 ml of buffer (50 mM sodium phosphate, 300 mM NaCl, pH 8.0), and add the recommended amount of Complete protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany), 1 mg lysozyme, and 1 mg DNase I. 8. Lyse the cells by sonication on ice (10 s sonication per minute, repeated six times), then centrifuge at 15,000 rpm for 1 h at 4 in a Beckman J2-HS centrifuge equipped with a JA-25.50 rotor (Beckman, Fullerton, CA). Collect the supernatant, which should be noticeably yellow, and store on ice. 9. Add 2 ml of Ni-NTA agarose slurry (Qiagen, Valencia, CA) to the supernatant and gently shake on ice for 1 h in order to allow the His6tagged PKSE protein to bind to the Ni-NTA agarose. 10. Load the Ni-NTA agarose-containing solution onto a column and allow the liquid to drain away. Wash the Ni-NTA agarose with 30 ml of the above buffer supplemented with 10 mM imidazole. 11. Elute the His6-tagged PKSE protein with buffer containing 200 mM imidazole. Pool together the yellow PSKE-containing fractions and concentrate to <1 ml using a Vivaspin 50,000 MWCO ultrafiltration centrifugal device (Sartorius, Edgewood, NY).
105
Enediyne Polyketide Synthases
KDa
1
2
3
250 150 100 75
50 37
Figure 5.4 SDS-PAGE gel (8%) showing the molecular weight marker (lane 1) and PKSEs exemplified by NcsE (lane 2) and SgcE (lane 3). The PKSEs migrate at the expected molecular weight of 208 kDa.
12. The concentrated PKSE protein is then exchanged into a different buffer (20 mM Tris-Cl, 0.5 mM DTT, pH 8.0) using a PD-10 desalting column (GE Healthcare, Piscataway, NJ). 13. The purity of the PKSE protein may be assessed by 8% acrylamide SDSPAGE (Fig. 5.4), and the His6-tagged PKSE proteins may be used without further modification.
2.3. Production and isolation of the polyene intermediate from 9-membered PKSEs A polyene product, 1,3,5,7,9,11,13-pentadecaheptaene, has been identified as the first isolable intermediate produced by the PKSE en route to formation of the 9-membered enediyne core. Production of the polyene intermediate can be accomplished by heterologous expression of the PKSE in E. coli or Streptomyces to yield a covalent PKSE-polyene complex. The polyene may be released from the PKSE by coexpression of pksE10 from the same pathway, which encodes a thioesterase. 2.3.1. Generation of an E. coli expression construct for pksE10 1. Design primers to PCR-amplify the thioesterase gene, pksE10, using the primer sequence extensions required for subsequent cloning into pCDF-2 Ek/LIC using ligation-independent cloning (Novagen, Madison, WI). 2. Perform the PCR reaction using the Platinum Pfx DNA polymerase from Invitrogen (Carlsbad, CA). Although PCR parameters will have to
106
Geoffrey P. Horsman et al.
be optimized for each different pksE10 target amplicon, a typical 50 ml reaction contains 1X supplied buffer, 600 nM of each primer, 2.5 mM each dNTP, 1 mM MgSO4, 5% DMSO, and 2.5 U DNA polymerase, and the following thermocycling program: (a) 96 (2 min); (b) [96 (10 s), 56 (30 s), 68 (20 s)] 30 cycles; (c) 68 (7 min); and (4) hold at 4 . 3. Purify the PCR product as an electrophoretically resolved band from a 1% agarose gel using a standard procedure such as the QIAQuick gel purification kit (Qiagen, Valencia, CA). 4. Generate the expression construct by inserting the gel-purified PCR product into the pCDF-2 Ek/LIC vector by ligation-independent cloning as described by Novagen (Madison, WI), and sequence to confirm the fidelity of the PCR reaction. 2.3.2. Coexpression of pksE and pksE10 in E. coli to yield the free polyene product 1. Introduce the above pksE10-containing pCDF-2 Ek/LIC expression construct by transformation into E. coli BL21(DE3) cells already harboring the pksE-containing pET-30 Xa/LIC expression construct, and plate on LB medium supplemented with 50 mg/ml kanamycin and 50 mg/ml streptomycin. 2. Pick a single colony from the plate and inoculate 3 ml of LB medium supplemented with 50 mg/ml kanamycin and 50 mg/ml streptomycin and incubate at 37 for 12 h. 3. Transfer a 0.5-ml aliquot to 50 ml of LB medium containing 50 mg/ml kanamycin and 50 mg/ml streptomycin, grow for an additional 12 h at 37 and shake at 250 rpm. 4. Transfer 5 ml of the above culture to 500 ml of LB medium supplemented with 50 mg/ml kanamycin and 50 mg/ml streptomycin and incubate at 18 and 250 rpm. 5. When the optical density at 600 nm (OD600) reaches 0.5 (after approximately 10 h), induce PKSE expression by adding 0.1 mM of IPTG, and incubate the cells at 18 for a further 36 h with shaking at 250 rpm. 6. Pellet the cells by centrifugation at 4 and 9200g for 15 min. 2.3.3. Isolation of the polyene product 1. Resuspend the cell pellet in water to a density of 200 mg/ml, add 1 mg/ml lysozyme and incubate at room temperature for 30 min. 2. Complete cell lysis by sonication to homogeneity, then centrifuge at 15,000 rpm for 1 h at 4 in a Beckman J2-HS centrifuge equipped with a JA-25.50 rotor (Beckman, Fullerton, CA). Discard the supernatant. 3. Wash the cell debris with 100 mM sodium acetate, pH 6.0, and centrifuge as in Step 2 but for only 15 min. 4. Wash the cell debris with ethanol, and repeat centrifugation as in Step 3.
Enediyne Polyketide Synthases
107
5. Extract cell debris with ethyl acetate (1:100 wt/vol) and evaporate to dryness under reduced pressure. 6. Dissolve the dried sample in a minimal volume of chloroform and load on a polyamide 6 column (Sigma-Aldrich, St. Louis, MO) equilibrated with chloroform. Elute the sample from the column with chloroform, and concentrate the polyene-containing fraction. 7. Purify the concentrated sample by silica gel column chromatography eluted with hexane/chloroform (9:1), and concentrate the polyenecontaining fraction. 8. Purify the polyene further using a semipreparative C18 HPLC column (Apollo, 250 10 mm, 5 mm; Grace Davison, Deerfield, IL), and evaporate the appropriate fraction to dryness under reduced pressure. The resulting purified polyene product should be visible as a yellow powder.
2.4. Production of apo-ACPs from PKSE for in vitro functional analyses To definitively establish the identity of the unique ACP domain of the PKSE proteins, in vitro experiments are required. First, several versions of the ACP should be prepared, because the exact boundaries of the ACP domain are not clearly discernable from the sequence data. Second, the ACPs must be heterologously expressed and purified as nonphosphopantetheinylated proteins, or apo-ACPs, which may then be phosphopantetheinylated in vitro using a promiscuous PPTase such as Svp (Sanchez et al., 2001). Phosphopantetheinylation, or generation of holo-ACPs, is often detected by a shift in retention time in an HPLC chromatogram, and the identity confirmed by mass spectrometry. Moreover, the inability of mutant apo-ACPs to be phosphopantetheinylated can be used to identify the amino acid residue that is modified by the PPTase. 2.4.1. Overexpression in E. coli and production and purification of apo-ACPs 1. Use standard techniques to prepare several plasmid constructs for the expression of the pksE-ACP domain as His6-tagged ACP proteins in pRSF-2 Ek/LIC using ligation-independent cloning as described by Novagen (Madison, WI). 2. Introduce the above pksE-ACP-containing pRSF-2 Ek/LIC expression constructs into E. coli BL21(DE3) by transformation, and plate on LB medium supplemented with 150 mg/ml kanamycin. 3. Pick a single colony from the plate, inoculate 3 ml of LB medium supplemented with 150 mg/ml kanamycin and incubate at 37 for 12 h.
108
Geoffrey P. Horsman et al.
4. Transfer a 0.5 ml aliquot to 50 ml of LB medium containing 150 mg/ml kanamycin, grow for an additional 12 h at 37 and shake at 250 rpm. 5. Transfer 5 ml of the above culture to 500 ml of LB medium supplemented with 150 mg/ml kanamycin and incubate at 18 and 250 rpm. 6. When the optical density at 600 nm (OD600) reaches 0.5 (after approximately 10 h), induce His6-ACP expression by adding 0.1 mM of IPTG, and incubate the cells at 18 for a further 15 h with shaking at 250 rpm. 7. Pellet the cells by centrifugation at 4 and 9200g for 15 min. 8. On ice, use a pipette to resuspend the cell pellet in 15 ml of buffer (50 mM sodium phosphate, 300 mM NaCl, pH 8.0), and add the recommended amount of Complete protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany), 1 mg lysozyme, and 1 mg DNase I. 9. Lyse the cells by sonication on ice (10 s sonication per minute, repeated six times), then centrifuge at 15,000 rpm for 1 h at 4 in a Beckman J2-HS centrifuge equipped with a JA-25.50 rotor (Beckman, Fullerton, CA). Collect the supernatant and store on ice. 10. Add 2 ml of Ni-NTA agarose slurry (Qiagen, Valencia, CA) to the supernatant and gently shake on ice for 1 h in order to allow the His6tagged ACP protein to bind to the Ni-NTA agarose. 11. Load the Ni-NTA agarose-containing solution onto a column and allow the liquid to drain away. Wash the Ni-NTA agarose with 30 ml of the above buffer supplemented with 20 mM imidazole. 12. Elute the His6-tagged ACP proteins with buffer containing 200 mM imidazole. Pool together the ACP-containing fractions and concentrate to less than 1 ml using a Vivaspin 5000 MWCO ultrafiltration centrifugal device (Sartorius, Edgewood, NY). 13. The concentrated ACP proteins are then exchanged into a different buffer (20 mM Tris-Cl, 0.5 mM DTT, pH 8.0) using a PD-10 desalting column (GE Healthcare, Piscataway, NJ). 14. Protein purity can be assessed by 13.5% acrylamide SDS-PAGE (Fig. 5.5), and the His6-tagged ACP proteins are analyzed by mass spectrometry to ensure proper molecular weight, and then may be used without further modification.
2.5. In vitro preparation of holo-ACPs 1. Prepare a small-scale phosphopantetheinylation reaction (50 to 100 mL) in a 1.5-ml microcentrifuge tube with the following composition: 50 mM Tris-Cl pH 8.0, 10 mM MgCl2, 2 mM DTT, 0.2 mg/ml bovine serum albumin (BSA), 5 mM coenzyme A (CoA), 0.05 mM apo-ACP, and 10 mM PPTase such as Svp. 2. Incubate the reaction at 30 .
109
Enediyne Polyketide Synthases
1
2
3
4
5
6
KDa 31 22 14 6.5
Figure 5.5 SDS-PAGE gel (13.5%) of His6 -tagged ACP constructs: ACP81 (lane 1), ACP108 (lane 2), ACP136 (lane 3), ACP109 (lane 4), ACP212 (lane 5), and molecular weight marker (lane 6).
3. At various time points after initiating the reaction (such as 30, 60, 90, 120 min, etc.), remove an aliquot, quench the reaction with an equal volume of 0.1% trichloroacetic acid in 10% acetonitrile (Solvent A), and centrifuge in a bench-top microcentrifuge at maximum speed to remove insoluble material. ˚ column (250 4. Analyze the sample by HPLC with a Jupiter C4 300-A 4.6 mm, 5 mm; Phenomenex, La Jolla, CA) operated at a flow rate of 1 ml/min, monitoring absorbance at 220 nm. Elute the sample by the following series of linear gradients from solvent A to solvent B (0.1% trichloroacetic acid in 90% acetonitrile): (1) 0 to 5 min, 5% B; (2) 5 to 32 min, gradient from 5 to 95% B; (3) 32-40 min, hold at 95% B; and (4) 40 to 45 min, gradient from 95 to 5% B. 5. The conversion of apo- to holo-ACPs should be apparent by the appearance of a new peak with a shorter retention time (Fig. 5.6). Collect individual protein peaks, lyophilize to remove solvent, and analyze by mass spectrometry to confirm identities.
3. Conclusion The methods described have been used to successfully characterize the enediyne-specific iterative type I polyketide synthase (PKSE). The unique sequence and domain architecture of the PKSE has enabled a PCR-based screening method capable of rapidly identifying and classifying unknown PKSEs specific for either 9- or 10-membered enediyne cores. The ability
110
Geoffrey P. Horsman et al.
AU at 220 nm
Apo–ACP
Holo–ACP
0 min 2 min 30 min
60 min 90 min 120 min 28
Elution time (min)
36
Figure 5.6 Time-course analysis showing the in vitro 40 -phosphopantetheinylation of the apo-ACP81 domain of SgcE catalyzed by the Svp PPTase to generate holo-ACP.
to classify enediyne cores from sequence provides an exciting opportunity to focus discovery efforts on specific natural product drug leads. The heterologous expression of 9-membered PKSEs represents a highly significant step towards obtaining a detailed understanding of PKSE function, and has enabled the development of an additional method for isolation and identification of a new polyene compound as the first characterized biosynthetic intermediate en route to construction of the 9-membered enediyne core. Together with in vivo complementation and Fourier-transform mass spectrometry experiments not described in this chapter, results from the polyene isolation experiments helped to identify the unprecedented ACP and PPTase domains, as mutations in these PKSE domains abolished polyene production. Finally, methods used to overproduce, purify and carry out in vitro phosphopantetheinylation of PKSE ACP domains have enabled definitive functional assignment of this domain, as previous bioinformatics analyses revealed no homology to any known proteins. In summary, these methods were fundamental in enabling identification of the PKSE as an unusual self-phospopanthetheinylating PKS with a novel ACP domain, and lay the foundation for future discovery of new enediyne natural products and for the elucidation and engineering of 9- versus 10-membered PKSE selectivity.
Enediyne Polyketide Synthases
111
ACKNOWLEDGMENT This work was supported in part by National Institute of Health (NIH) grants CA78747 and CA113297. G.P.H. is the recipient of an Natural Sciences and Engineering Research Council (Canada) (NSERC) postdoctoral fellowship, and S.V.L. is the recipient of an NIH postdoctoral fellowship (CA1059845).
REFERENCES Ahlert, J., Shepard, E., Lomovskaya, N., Zazopoulos, E., Staffa, A., Bachmann, B. O., Huang, K., Fonstein, L., Czisny, A., Whitwam, R. E., Farnet, C. M., and Thorson, J. S. (2002). The calicheamicin gene cluster and its iterative type I enediyne PKS. Science 297, 1173–1176. Fichtlscherer, F., Wellein, C., Mittag, M., and Schweizer, E. (2000). A novel function of yeast fatty acid synthase—Subunit alpha is capable of self-pantetheinylation. Eur. J. Biochem. 267, 2666–2671. Galm, U., Hager, M. H., Van Lanen, S. G., Ju, J. H., Thorson, J. S., and Shen, B. (2005). Antitumor antibiotics: Bleomycin, enediynes, and mitomycin. Chem. Rev. 105, 739–758. Gao, Q., and Thorson, J. S. (2008). The biosynthetic genes encoding for the production of the dynemicin enediyne core in Micromonospora chersina ATCC53710. FEMS Microbiol. Lett. 282, 105–114. Hensens, O. D., Giner, J. L., and Goldberg, I. H. (1989). Biosynthesis of NCS chrom A, the chromophore of the antitumor antibiotic neocarzinostatin. J. Am. Chem. Soc. 111, 3295–3299. Jiang, H., Zirkle, R., Metz, J. G., Braun, L., Richter, L., Van Lanen, S. G., and Shen, B. (2008). The role of tandem acyl carrier protein domains in polyunsaturated fatty acid biosynthesis. J. Am. Chem. Soc. 130, 6336–6337. Kennedy, D. R., Gawron, L. S., Ju, J. H., Liu, W., Shen, B., and Beerman, T. A. (2007a). Single chemical modifications of the C-1027 enediyne core, a radiomimetic antitumor drug, affect both drug potency and the role of ataxia-telangiectasia mutated in cellular responses to DNA double-strand breaks. Cancer Res. 67, 773–781. Kennedy, D. R., Ju, J., Shen, B., and Beerman, T. A. (2007b). Designer enediynes generate DNA breaks, interstrand cross-links, or both, with concomitant changes in the regulation of DNA damage responses. Proc. Natl. Acad. Sci. USA 104, 17632–17637. Lam, K. S., Veitch, J. A., Golik, J., Krishnan, B., Klohr, S. E., Volk, K. J., Forenza, S., and Doyle, T. W. (1993). Biosynthesis of esperamicin A1, an enediyne antitumor antibiotic. J. Am. Chem. Soc. 115, 12340–12345. Liu, W., Ahlert, J., Gao, Q. J., Wendt-Pienkowski, E., Shen, B., and Thorson, J. S. (2003). Rapid PCR amplification of minimal enediyne polyketide synthase cassettes leads to a predictive familial classification model. Proc. Natl. Acad. Sci. USA 100, 11959–11963. Liu, W., Christenson, S. D., Standage, S., and Shen, B. (2002). Biosynthesis of the enediyne antitumor antibiotic C-1027. Science 297, 1170–1173. Liu, W., Nonaka, K., Nie, L. P., Zhang, J., Christenson, S. D., Bae, J., Van Lanen, S. G., Zazopoulos, E., Farnet, C. M., Yang, C. F., and Shen, B. (2005). The neocarzinostatin biosynthetic gene cluster from Streptomyces carzinostaticus ATCC 15944 involving two iterative type I polyketide synthases. Chem. Biol. 12, 293–302. Maeda, H. (2001). SMANCS and polymer-conjugated macromolecular drugs: Advantages in cancer chemotherapy. Adv. Drug Deliv. Rev. 46, 169–185.
112
Geoffrey P. Horsman et al.
Metz, J. G., Roessler, P., Facciotti, D., Levering, C., Dittrich, F., Lassner, M., Valentine, R., Lardizabal, K., Domergue, F., Yamada, A., Yazawa, K., Knauf, V., et al. (2001). Production of polyunsaturated fatty acids by polyketide synthases in both prokaryotes and eukaryotes. Science 293, 290–293. Murugan, E., and Liang, Z. X. (2008). Evidence for a novel phosphopantetheinyl transferase domain in the polyketide synthase for enediyne biosynthesis. FEBS Lett. 582, 1097–1103. Pospiech, A., and Neumann, B. (1995). A versatile quick-prep of genomic DNA from grampositive bacteria. Trends Genet. 11, 217–218. Sanchez, C., Du, L. C., Edwards, D. J., Toney, M. D., and Shen, B. (2001). Cloning and characterization of a phosphopantetheinyl transferase from Streptomyces verticillus ATCC15003, the producer of the hybrid peptide-polyketide antitumor drug bleomycin. Chem. Biol. 8, 725–738. Sievers, E. L., and Linenberger, M. (2001). Mylotarg: Antibody-targeted chemotherapy comes of age. Curr. Opin. Oncol. 13, 522–527. Tokiwa, Y., Miyoshisaitoh, M., Kobayashi, H., Sunaga, R., Konishi, M., Oki, T., and Iwasaki, S. (1992). Biosynthesis of dynemicin A, a 3-Ene-1,5-diyne antitumor antibiotic. J. Am. Chem. Soc. 114, 4107–4110. Van Lanen, S. G., Oh, T. J., Liu, W., Wendt-Pienkowski, E., and Shen, B. (2007). Characterization of the maduropeptin biosynthetic gene cluster from Actinomadura madurae ATCC 39144 supporting a unifying paradigm for enediyne biosynthesis. J. Am. Chem. Soc. 129, 13082–13094. Van Lanen, S. G., and Shen, B. (2008). Biosynthesis of enediyne antitumor antibiotics. Curr. Top. Med. Chem. 8, 448–459. Wang, X. W., and Xie, H. (1999). C-1027. Antineoplastic antibiotic. Drugs Future 24, 847–852. Weissman, K. J., Hong, H., Oliynyk, M., Siskos, A. P., and Leadlay, P. F. (2004). Identification of a phosphopantetheinyl transferase for erythromycin biosynthesis in Saccharopolyspora erythraea. ChemBioChem 5, 116–125. Zazopoulos, E., Huang, K. X., Staffa, A., Liu, W., Bachmann, B. O., Nonaka, K., Ahlert, J., Thorson, J. S., Shen, B., and Farnet, C. M. (2003). A genomics-guided approach for discovering and expressing cryptic metabolic pathways. Nat. Biotechnol. 21, 187–190. Zhang, J., Van Lanen, S. G., Ju, J. H., Liu, W., Dorrestein, P. C., Li, W. L., Kelleher, N. L., and Shen, B. (2008). A phosphopantetheinylating polyketide synthase producing a linear polyene to initiate enediyne antitumor antibiotic biosynthesis. Proc. Natl. Acad. Sci. USA 105, 1460–1465.
C H A P T E R
S I X
The DEBS Paradigm for Type I Modular Polyketide Synthases and Beyond Leonard Katz Contents 114 114 118 119 122 123 126 127 130 133 135 136 136
1. Introduction 2. DEBS and the Concept of a Module 2.1. Generalizability of the DEBS paradigm 3. Beyond the DEBS Paradigm 3.1. Specificity of the AT domains 3.2. Novel loading modules 3.3. Methylation domains 3.4. Trans PKS activities 3.5. Unusual modular organization 3.6. Unusual module functions 3.7. Intermodular interactions 4. Conclusion References
Abstract Polyketides are natural products that form the basis of numerous human and veterinary drugs. The biosynthesis of complex polyketides is carried out by polyketide synthases (PKSs), enzymes composed of multifunctional polypeptides that are assembled into large protein complexes. Nucleotide sequencing revealed that the PKS that produces the polyketide backbone of the antibiotic erythromycin, DEBS (for 6-deoxyerythronolide B synthase), contains a discrete domain for every enzymatic step of the corresponding biochemical pathway, that the domains are organized into modules each corresponding to a single extension (condensation and b-carbonyl processing) step in the biochemical pathway, that the organization of the domains is consistent from module to module, that faithful production of the polyketide 6-dEB requires that the domains are always used and never bypassed, that the PKS does not contain
Synthetic Biology Engineering Research Center, University of California, Berkeley Emeryville, California, USA Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04606-0
#
2009 Elsevier Inc. All rights reserved.
113
114
Leonard Katz
additional domains that are not used, and that the domains are organized in a linear array in the order of use in the biosynthesis of 6-dEB. Taken together, these properties are often referred to as the DEBS paradigm. In this chapter, the biosyntheses of numerous polyketides will be described to highlight the generalizability of the DEBS paradigm, but also to illustrate the range of deviations from the paradigm so far found in nature that contribute to product versatility.
1. Introduction The eryAI-III genes encoding deoxyerythronolide B synthase (DEBS), the polyketide synthase (PKS) responsible for the biosynthesis of 6-deoxyerythronolide B (6-dEB), the polyketide backbone of the macrolide antibiotic erythromycin (Fig. 6.1A) in the producing organism Saccharopolyspora erythraea, were the first PKS genes to be sequenced in their entirety (Caffrey et al., 1992; Cortes et al., 1990; Donadio and Katz, 1992; Donadio et al., 1991). The sequence revealed the organization and architecture that became the paradigm for type I PKSs—modularity—taken to mean that the structure of each of the building blocks that are assembled into the polyketide is overtly programmed by a specific set of functional domains sequestered in a large polypeptide, and that each module could specify its biochemical characteristics independently of the other modules contained within the PKS. In the 18 years since the original description of DEBS, numerous type I PKS systems have been sequenced and characterized, and many examples of overall architecture that differ from that described for DEBS have been uncovered. This chapter presents an overview of the organization and architecture of a variety of PKS systems, highlighting the differences found from the organization and architecture of DEBS. This treatment will not include every PKS system currently known, nor will it present an historical account of the differences observed. The goal is to demonstrate how numerous complicated structures of polyketides can be produced from a short list of enzymatic activities organized in a variety of ways.
2. DEBS and the Concept of a Module A PKS module is defined as a set of activities (domains) responsible for incorporating a particular precursor at a designated point in the nascent acyl chain and for determining its structure in the final polyketide produced. A two-dimensional representation of the modular organization of DEBS, along with the growing structure of the corresponding acyl chain into 6-DEB, is shown in Fig. 6.1A. In addition to the loading module, which
DEBS 1 Load
DEBS 2
DEBS 3 Module 4
Module 2 Module1
Module 6
Module 3
Module 5
End
ER KR AT ACP KS
AT
AT
S
S O
KR ACP KS
DH ACP
KS
AT ACP KS
S
KR
AT
KR ACP
S
KS
KR ACP KS
AT
AT
S
S
S O
O
HO
HO
O
O
O
HO
HO
O
HO
HO
O
HO
HO
O
HO
HO
O
HO
HO
O
HO 3 9 1
4 HO
OH
OH HO
O
L O
NH2
5
13
O
O 5
2
O
6
O
O
Erythromycin A
Figure 6.1
1
HO
O 2
ACP TE
(Continued)
OH
9
13
116
Leonard Katz
determines the starter acyl ester employed in the synthesis, DEBS has six extension modules that extend and cyclize the acyl chain into the 14-membered macrolactone, 6-dEB. The modules are numbered in the order in which they are used in nascent acyl chain synthesis. All DEBS extension modules have three common domains: KS, AT and ACP. The KS domain conducts the decarboxylative Claisen-like condensation between the resident growing chain attached via a thioester to a Cys residue in the active site and the extender unit. An additional potential function of the KS domain, although not apparent from the sequence, is known as gatekeeping. Studies on DEBS KS2 employing the feeding of diketide N-acetylcysteamine thioesters five carbons in length that mimic the structure of nascent chain predicted to be located on ACP1 at the end of the first condensation cycle showed that only the diketide with methyl and hydroxyl groups in the 2S,3R-configuration could be elongated beyond the diketide form (Luo et al., 1996; Weissman et al., 1998a). In later work performed at Kosan Biosciences, approximately half of the 154 hybrid PKSs constructed that were composed of the DEBS loading domain and two extender modules from a variety of naturally occurring PKSs and the DEBS TE domain produced detectable quantities of the triketide predicted by the construct (Menzella et al., 2005). More than half of the PKSs that originally failed to produce polyketide made the predicted compound when the hybrid module KS2 domain was replaced with the KS domain in the module that was immediately downstream in the naturally occurring PKS of the ACP domain present in module 1 of the hybrid (Chandran et al., 2006), lending credence to the argument that the KS domain plays a gate-keeping role in polyketide synthesis. The AT domain determines which precursor is incorporated at the given extension step; in the case of 6-DEB, each of the six extension AT domains incorporates 2-[S]-methylmalonyl CoA (Marsden et al., 1994). The ACP domain carries the extended chain via a thioester linkage to a phophopantetheine group linked to a resident Ser residue and presents it to the reductive domains for subsequent reduction, dehydration, and so on. Figure 6.1 Organization of the 6-deoxyerythronolide B synthase (DEBS) and the structure of erythromycin A. Stepwise growth of the polyketide chain is shown attached to the ACP domain of each module after full elaboration by the modular functions. Modules are labeled Load 1 through 6 and are delineated by the solid lines. The modules contained within each protein are shown by the block arrows. The polyketide backbone of erythromycin A is shown in black; all other atoms shown in gray originate from postpolyketide modifications, represented by dashed arrows.The circled numbers represent the condensation number and the corresponding atoms introduced into the polyketide chain.The numbers are placed at the position corresponding to the b-carbon or a-sidechain introduced at each condensation. ACP, acyl carrier protein; AT, acyltransferase; DH, dehydratase; ER, enoylreductase; KR, b-ketoreductase; KS, b-acyl ACP synthase, TE, thioesterase.
DEBS Paradigm
117
Module 3 of DEBS carries functional KS, AT and ACP domains (as well as a mutated, nonfunctional KR domain); the unreduced b-keto group generated at the third incorporation cycle persists through the remainder of the synthesis and becomes the 9-ketone of 6-DEB. Modules 1, 2, 5, and 6 have an additional KR domain that reduces the b-carbonyl generated by condensation into the corresponding hydroxyls present at C13, C11, C5, and C3, respectively, in 6-DEB. (The C13 OH is the lactone oxygen.) Module 4 has a full set of reductive domains, KR, DH, and ER, to yield the fully reduced methylene center at C7 of 6-DEB. The linear domain organization KS-AT(ER-DH)-KR-ACP is preserved in each of the modules. Each module is contained within a single polypeptide and each polypeptide contains two modules except DEBS1, which has the additional loading module, composed of an AT and ACP domain. The AT domain specifies the incorporation of propionyl CoA as the starting acyl unit (Weissman et al., 1998b). The thioesterase TE domain is appropriately located at the C terminus of module 6, and acts after nascent chain synthesis is completed to release the polyketide from DEBS and cyclize it into the 14-membered macrolactone. The stereochemistries of the methyl and hydroxyl groups in 6-dEB are programmed in DEBS. Attack of the KR domain on the b-ketone can take place from either side of the acyl chain, resulting in formation of the OH carrying the D or L configuration; the stereospecificity of the KR is determined by its structure, and knowledge of the sequence can allow prediction of the OH stereochemistry (Castonguay et al., 2007; O’Hare et al., 2006; Reid et al., 2003). Less is understood about how the configuration of the methyl side chain at each of the even-numbered positions of the 6-dEB ring is determined. Because all AT domains use the common precursor 2-[S]-methylmalonyl CoA, the stereochemistry of the methyl groups at C12, C8, and C6 of 6-dEB indicates that epimerization had occurred at some point in the synthesis employing modules 1, 3, and 4, respectively. It is currently thought that methyl stereochemistry is programmed in the KS domain but both the precise segment involved in epimerization, and whether epimerization takes place before or after the condensation event are not yet known (Holzbaur et al., 1999; Lau et al., 1999; Weissman et al., 1997). In addition to the functional domains present within each DEBS module, the proteins contain docking domains at the N- and/or C-termini to enable interaction with the correct modules to ensure the fidelity of polyketide biosynthesis. The docking domains are composed of short a-helical segments that form bundles when associated with their cognate partner module (Keatinge-Clay, 2008; Weissman, 2006); it is not yet possible to determine the partner relationships among docking domains by reading their sequences. The protein products of the eryAI-III genes are not capable of polyketide production without additional enzymatic activities. Fully functional DEBS
118
Leonard Katz
requires the activity of a phosphopantetheinyl transferase (PPTase) for activation of the ACP domains, enabling them to form thioester linkages with the extender precursors. Sequences corresponding to PPTase activity were not found in either the DEBS genes or within the adjacent erythromycin biosynthetic gene cluster. A discrete gene encoding the PPtase SePptII was recently identified from the genomic sequence of S. erythraea and shown to catalyze phophopantentheinylation of one of the DEBS ACP domains (Weissman et al., 2004). Interestingly, a second PPTase in S. erythraea, SePptI was identified within a PKS module, whose cognate polyketide has not yet been identified. SepPptI did not activate one of the DEBS ACPs tested. Though not absolutely required for synthesis, efficient, high-level 6-dEB production in S. eythraea requires a short-chain thioesterase designated TEII, whose gene is located in the ery biosynthetic cluster. Deletion of TEII resulted in high-level incorporation of an acetate, rather than propionate, as the starter (Hu et al., 2003). Substrate specificity of AT domains is discussed further below. Recent structural work on components of DEBS (reviewed in (Smith and Tsai, 2007)) indicate that the PKS complex contains homodimers of each of the three DEBS proteins and that the homodimers themselves possess a head-to-head arrangement, with tight interactions within the middle of the modules (the segment between the AT and KR domains) and very little interaction between the KS domains, AT domains, and ACP domains.
2.1. Generalizability of the DEBS paradigm The general paradigm for the structure of PKSs for polyketide biosynthesis that emerged from the understanding of the organization and architecture of DEBS has two fundamental components. First, each step in the biosynthesis of a complex polyketide is programmed by a discrete module which contains all the enzymatic activities required for the chemical events that take place (condensation, reduction, determination of the correct stereochemistry of the a- and b-side chains). Second, the fidelity of the synthesis is maintained by (1) the specificity of the AT domains in each module for the correct extender unit, (2) the faithful utilization of the domain activities in each module so that the required chemistries are never bypassed, and (3) the proper juxtaposition of the modules in the PKS complex so that the growing acyl chain is always passed to the correct module for the next step in the synthesis. Diversity of structures in the polyketide family can be achieved by (1) variation of the use of starter and extender units (programmed by AT domains), (2) variation in the degree of reduction from module to module, and (3) variation in the number of modules employed in the synthesis, all in keeping with the basic paradigm developed for DEBS. The PKS sequences of the 16-membered macrolactones tylactone backbone of the macrolide antibiotic tylosin and platenolide (spiramycin,
DEBS Paradigm
119
carbomycin, etc.) were among the first to appear after publication of the DEBS sequence (DeHoff et al., 1996; Kuhstoss et al., 1996). The sequence for the 16-membered macrolide chalcomycin followed some time later (Ward et al., 2004). As can be seen in Fig. 6.2, they consist of seven modules and contain AT domains for the specific incorporation of malonyl CoA, methylmalonyl CoA, or ethylmalonyl CoA, but the overall organization is remarkably similar to that of DEBS. Subsequent characterization of the PKSs for the biosynthesis of the 14-membered macrolactones oleandolide and narbonolide also revealed their similarity to DEBS, including the maintenance of the stereochemistry at equivalent positions of the macrolactone rings (reviewed in Katz and Ashley, 2005). (The pik PKS also produces the 12-membered macrolactone 10-deoxymethynolide, the backbone of methymycin as described in Section 3.7.2.) In general, colinearity between the arrangement of the modules at the level of DNA and their order of use in the biosynthesis of the corresponding polyketide was preserved in polyketides classified as macrolides, including the antibiotics shown in Fig. 6.1, as well as the antifungal compounds nystatin (18 modules), candicidin (18 modules), and oligomycin (16 modules) (reviewed in Ikeda and Omura, 2002). As PKS sequences from nonmacrolide polyketides from nonactinomycete hosts became available, however, differences from the DEBS organization began to appear. Nonetheless, most of the more than 40 PKS systems currently sequenced maintained a great deal of similarity to the DEBS paradigm and led to the question of whether knowledge of a PKS sequence would enable the prediction of the structure of the corresponding polyketide. As the number of sequences of AT domains increased, it was possible to establish a correspondence between AT domain sequence and the incorporation of a particular extender CoA (malonyl, methylmalonyl, ethylmalonyl, or methoxymalonyl) during synthesis (Haydock et al., 1995). On the other hand, translating PKS sequence into polyketide structure would also depend either on the preservation of colinearity between the order of the modules at the DNA level and their use in polyketide synthesis, or the ability to determine the docking specificities of the modules from examination of their docking sequences. Many systems have been uncovered in which colinearity is not preserved, nor is there yet a full understanding of modular docking specificities.
3. Beyond the DEBS Paradigm The remainder of this chapter deals with the major differences from the modular organization seen in DEBS in PKS systems discovered in the past 17 years. One or two examples of systems will be described that highlight the following changes or differences from DEBS: additional
O 2
OleA1
A
Load
Module 1
OleA2 Module 2
OleA3
Module 4
Module 3
Module 6
Module 5
KR KS
AT ACP KS
AT
ACP KS
KR AT
DH
End
KR
KR
KR ACP KS AT
KS AT
ACP
Oleandomycin
O
L
KS AT ACP KS AT
ACP
4 OH
ER Q
3
1
5
O
OH
OH
ACP TE 6
Oleandolide O 3
2
Methymycin
4
1 O
PikAI
B
PikAII
PikAIII
L
PikAIV
OH
O
O
5
Load
Module 1
Module 2
Module 4
Module 3
Module 6
Module 5
3
2
10-Deoxymethynolide
End
4
1
Narbomycin Pikromycin
ER AT ACP KS
AT
ACP KS
DH
DH KR
KR Q
KS
AT
ACP
KS AT ACP KS AT
KR
KR ACP
KS AT
ACP
KS AT ACP TE
O
L
5
OH
O
O 6
Narbonolide
TylGI
C
Load
Module 1
TylGII Module 2
KS
Q
AT ACP KS
AT
ACP KS
ACP
AT
TylGIV
Module 5
Module 3
Module 4
KS AT
DH ACP
Module 6
O
TylGV Module 7
4
3 2
End
ER
DH ER
DH KR
KR
TylGIII
5
Tylosin Rosaramicin
1 KR
KS AT ACP KS AT
KR
KR ACP
KS AT
ACP
KS AT
O
6
ACP TE
OH
O
L
OH
7
Tylactone
SrmGI
D Load
Module 1
SrmGII Module 2
KS
Q
AT ACP KS
AT
ACP KS
AT
ACP
Module 4
DH ACP
Module 6
O
SrmGV Module 7
KR
KS AT ACP KS AT
ACP
KS AT
ACP
KS AT
5
2
End 1
KR
KR
4
3
ER
DH ER KS AT
SrmGIV
Module 5
Module 3
DH KR
KR
SrmGIII
O
O 6
ACP TE
OH
O
L
OH
7
Platenolide
Spiramycin Carbomycin Niddamycin Platenomysin Leucomycin Midecamycin etc. 4
ChmGI
E Load
Module 1 KR
KS
Q
AT ACP KS
AT
ACP KS
ChmGII Module 2
ACP
Module 4
DH ER KS AT
ChmGIV
Module 5
Module 3
DH KR AT
ChmGII
KS AT ACP KS AT
Module 7
ACP
KS AT
ACP
3
End
O O
KR KS AT ACP TE
L
O
2
3
6 O
7
Chalcolactone
OH
O 5
2 1
KR
4
3
ER DH
ACP
Module 6
O
ChmGV
OH
5
2
Mycinose O
3 2
O
1
Chalcose
O
6 7
O L
Chalcomycin
Figure 6.2 Organization of PKSs of macrolide antibiotics and structure of the corresponding PKS macrolactone products A.The PKS protein components are shown as block arrows. Names of the antibiotics produced after post-polyketide modification are shown on the far right. The structure of chalcomycin is shown. KSQ, KS domain with active site Cys replaced with Gln residue. All other abbreviations, naming, numbering, and shading conventions duplicate those in Fig. 6.1.
121
DEBS Paradigm
domains, loss of specificity of AT domains, absence of domains for required functions, novel domain function and domain organization, and novel modular function. Discussion is limited to the functions that directly act on the carbon backbone of the polyketide chain. Functions that modify hydroxyl, methyl, or ethyl groups incorporated during polyketide biosynthesis will not be discussed. Unless otherwise indicated, the structures of the compounds described in this chapter are shown in Fig. 6.3.
O
R
OH
OH
OH
OH
4
O
R
L
1
2
3
4
1
OH
16 5
6
7
8
9
10
11
12
L
12
3
HO
6
L
2
4 O
7 O
7 O
OH
9
8
9
6
N
4
Oleandrose
7
O
8
3 2
O
OH
4
O
12
O 5
9
O
OH
OH OH
O
4
10
NH
11
Rapamycin
2
7
O
6
NH
1
L
OH
8
7
O
O
10
O 6
6
OH
1
9
12
NH
5
O
10 11
13
O
R L
O 3
O O
O
14 O
O
O OH
1
2
5 O
8
O
Epothilone C: R=H Epothilone D: R=CH3
Oleandrose
O
OH
1
O O
6
O
O
OH
N
Z,Z,E-premonensin A:R = 3 CH Z,Z,E-premonensin B:R = H
5
4
3
5
2
S
7
O O
O O
AvermectinB1a: R=
O
6
O 3
OH
4
O
Geldanamycin
HO
OH OH
O
1 14
5
O
2
P
O
3
2
L
L
12 2
3
H N 2
O
AvermectinB1b: R=
Phoslactomycin B
Rifamycin Doramectin: R=
6 9
8
9
7
5
4
L
3 2 S H N
O
1
Curacin A
9
8
H
O
H
OH
O L
1
13 4
OH
3
2
4
N
O
O
Rhizoxin D3
7 S
S 4
3
L
NH
O 5
OH
2
1
9
O
10
OH 1
3 2
O
O
O
11 OH 18 O
4
L
10 7
1 O
O O
O
O OH
O O
3
6
L
1
Bacillaene
25
N 8
5
Cl
O
5
7
Br
3
O
1 2
OH
6
O
OH 3 L
N 2
Jamaicamide A
1
N H
Leinamycin
Figure 6.3
S
8
S O
7
6
4
9 4
HO
Stigmatellin A
O
N H
NH
2
4
5
10
Bryostatin 1
O
O
L
O
6
11
O 8
9
O
OH
21
OH
9' 2
O
12 5
10
3
Myxothiazole A
O
8
8 O
9
4
HO
13
8 N H 8
5
O 2
O
O 7
6
8 O 6
N
N
6
12 O 5
OH
Myxovirescin A
2
Pederin
O
O
OH
1
7
O
3
OH 2
O
3
11 6
1
O
OH
17
OH
5
7
HO L
O
5
O
H N
ii HN
7
10
8
O O
6
O
OH
i
11
L
O 4
O
10
Continued.
O
O
S
122
Leonard Katz
6
5
O
2 4
7
15'
N
O
O 4
O N 8
N
5
6
HO 6
O
L
7
O O
OH
O
O 12
Mupirocin
2
1
OH
O
3
Virginiamycin M
O 5
OH
OH
17 O
O
L
8 O
7
3
2
5
4
O
N
15 1
3 N H
1
O
OH
L
2 L
OH
O
4
O
1
3
O 8
6
Disorazole A1 8
7
6
1
O 3
4
2 O 1
5
HO
O O
O
9 OH
7
6
4
3
N
Ambruticin VS3
5 7
L
5
10
NH 8 4
OH
OH 8
O
3
O
O
L
2
L 6
O
HO
OH
1
2
11
Myxalamid B
Soraphen A
5
6
7
17
8
OH
OH
16
O
OH
4 C 3 N
2
18
HO
4
9
15
O
1 H
O 9
19
8
L
14 O
7
6
5
4
3
2
O
1
O
H OH 13
O
12
11
10
OH
OH
L
OH
OH
Borrelidin
Etnangien
Figure 6.3 Structures of polyketides. Number and shading conventions duplicate those in Fig.6.1.
3.1. Specificity of the AT domains 3.1.1. Extension modules Fidelity of the structure of erythromycin is due in large part to the high specificity of the DEBS AT domains for the substrate 2-methylmalonyl CoA. Naturally occurring desmethyl analogues from unmutated S. erythraea strains have not been reported and could be made only by substitution of a DEBS AT domain with a malonyl CoA-specifying AT domain (Oliynyk et al., 1996; Ruan et al., 1997). Similar high specificity of the AT domains was found in all other PKS systems with a few notable exceptions. A single set of PKS genes was shown to produce both Z,Z,Epremonensins A and B, which differ in the side-chains at C16: A, ethyl; and B, methyl (Oliynyk et al., 2003). The AT domain of module 5, which resembles the methylmalonyl-specifying consensus AT sequences, can introduce either ethylmalonyl CoA or methylmalonyl CoA into the nascent polyketide chain. Similarly, the epo PKS genes were determined to produce both epothilones C and D, which differ by the single methyl group at C12; it was predicted, and subsequently confirmed, that the AT of module 4 could incorporate either malonyl CoA or methylmalonyl CoA (Molnar et al., 2000; Petkovic et al., 2008; Tang et al., 2000). To date, this is the only published example of an AT domain that specifies incorporation of malonyl- or methylmalonyl-CoA.
DEBS Paradigm
123
3.1.2. Loading modules The AT loading domains (ATL) have been found to have more relaxed substrate specificity than the AT domains of extender modules. The DEBS ATL domain displayed high specificity for propionyl CoA but could use acetyl CoA only when the producing host was depleted of propionyl CoA (Kao et al., 1994). The loading ATL domain of the avermectin PKS from Streptomyces avermitilis normally can use either isobutyryl CoA or 2-methylbutyryl CoA as the starter unit, leading to the generation of a family of avermectins (Ikeda et al., 1999) (Fig. 6.3). The ave PKS ATL domain can also utilize a variety of linear or cyclic fatty acids (presumably after the host converted them to their respective CoAs), including cylcohexanecarboxylate, which yields the commercial product doramectin (Denoya et al., 1995). Replacement of the loading domain of DEBS with the loading domain from the avermectin (ave) PKS resulted in the generation of triketides (using a construct LD-Mod1-Mod2-TE) containing branched side-chains (Marsden et al., 1998). Interestingly, exogenously fed branched or cyclic fatty acids at high levels could also be incorporated into the biosynthesis of erythromycin analogues by conversion to their respective CoAs and subsequent utilization as starter units by the DEBS AT loading domain (Pacey et al., 1998), suggesting a somewhat relaxed specificity of the DEBS AT loading domain, as well as an absence of a gate-keeping role for KS1.
3.2. Novel loading modules 3.2.1. KSQ domain Of the many sequenced type I PKS systems that use an AT domain to load the starter unit, most were found to contain a sequence immediately upstream of ATL that resembles a KS domain but in which the Cys residue at the active site is replaced by Gln (in streptomycete systems), or Ser or Tyr (in myxobacterial systems). The absence of the Cys residue renders the KSQ incapable of forming thioester linkages with acyl chains but they are still capable of the decarboxylation activity. Examination of the sequences of the adjacent ATL domains indicates that they load either malonyl or methylmalonyl CoA. After transfer to the adjacent ACPL domain, they are decarboxylated by the KSQ domain (and subsequently reduced) before movement to the KS domain of module 1 (Bisang et al., 1999; Witkowski et al., 1999). The ethyl side chain at C13 of the 14-membered macrolactones 6-DEB and narbonolide arise, therefore, by two distinct mechanisms. DEBS (Fig. 6.1) incorporates propionyl CoA directly (and transfers it to result in propionyl ACPL), whereas the pik PKS (Fig. 6.2) incorporates methylmalonyl CoA, then transfers it and decarboxylates it to propionyl ACPL. Because of the inherently tight specificities of extender domains in
124
Leonard Katz
general, in contrast to the somewhat relaxed specificities of ATL domains that use straight, branched, or cyclic fatty acids (e.g. DEBS, ave PKS), the KSQ-AT-ACP loading domain organization most likely ensures the faithful start of polyketide synthesis with a single starter unit. 3.2.2. AMP-ligase loading domain A different mechanism of activating and loading starter units was first revealed in the sequence of the rapamycin (Fig. 6.3) biosynthesis gene cluster (Schwecke et al., 1995) and later shown in a number of other PKS systems. In place of the (KSQ)-AT-ACP loading module, the loading modules of these systems contain a domain that activates a carboxylate through the formation of an AMP-adduct by a domain that resembles the activation (A) domains of nonribosomal peptide synthetases (NRPS), which ligate AMP with the carboxyl end of amino acids. The adenylylation loading domains have been given various names: they are referred to here as A domains. The canonical loading module consists of two domains, A and ACP, but individual loading modules may contain additional domains to modify the starter unit. In modules containing an A domain, the designation of the ACP domain is T, for thiolation, following the nomenclature used for NRPS systems, where PCP (peptidyl carrier protein) is used in place of ACP. In general, PKS systems containing the AMP-ligase–containing domain use cyclohexanecarboxylate units that are partially or fully oxidized (aromatic) and are usually modified with hydroxyl or amino side chains. The rifamycin (rif ) and geldanamycin (gdm), PKS loading modules consist of A and T domains, and load 3-amino-5-hydroxybenzoate, as do the loading modules of the herbimycin, mitomycin (mtm), and ansamitocin PKSs (structures not shown) (August et al., 1998; Mao et al., 1999; Rascher et al., 2003, 2005; Yu et al., 2002). Cyclohexanecarboxylate is produced via a multistep pathway in Streptomyces collinus and other organisms from shikimic acid (3,4,5-trihydroxycyclohexenecarboxylate) (reviewed in Moore and Hertweck, 2002). One of the intermediates in the pathway, 3,4-dihydroxycyclohexenecarboxylate, is used as the starter for the synthesis of rapamycin, ascomycin and FK506, but is reduced to 3,4-dihydroxycyclohexanecarboxyl-ACP by an ER domain present in the loading module (A-ER-T) of these PKS systems (Lowden et al., 2001; Schwecke et al., 1995; Wu et al., 2000). Cyclohexanecarboxylate, cyclohexenecarboxylate, and cycloheptanecarboxylate, all chemically synthesized analogues of the natural starter, could also be incorporated into the synthesis of rapamycin analogues by exogenous feeding of the free acids to the producing culture, Streptomyces hygroscopicus (Lowden et al., 2004). It is interesting to note that cyclohexanecarboxylate is a natural starter of phoslactomycin biosynthesis, which employs a PKS containing a starter ATL-ACP loading module. Cyclohexanecarboxylate is also the starter unit
DEBS Paradigm
125
for the synthesis of the polyketide ansatrienin A (structure not shown), but the sequence of the loading module of the corresponding PKS system has not been reported. Though the ATL or A loading domains show relaxed specificities for substrates, it is likely that they exhibit preferences for the most commonly used starter unit, hence the general appearance of either a single compound, or a mixture in which one is in high excess, when the producing host is cultivated under standard laboratory conditions. In addition, pathways that determine the levels of the cognate starter units are generally well regulated and the levels of alternative starters are minimized in the host. It is generally only when the culture conditions or the genetic background of the host are changed, such that the most preferred substrate is no longer present or that the levels of alternative substrates are raised, that mixtures of compounds begin to appear. 3.2.3. GNAT Domain The loading modules of the PKSs for the cyanobacterial polyketide curacin A (Chang et al., 2004), the myxobacterial polyketide myxovirescin A (Simunovic et al., 2006) and rhizoxin, a polyketide from a filamentous fungus (Brendel et al., 2007), all contain the following organization: an N-terminal AR (adapter region), a linker region of variable length, a GNAT domain, and an ACP domain. GNAT represents a superfamily of N-acyltransferase enzymes that catalyze acyl transfer to a primary amine. The pederin PKS contains a similar GNATL-ACPL loading module but lacks the AR domain (Piel, 2002). These three compounds appear to use acetyl CoA as the starter for polyketide biosynthesis. Extensive biochemical studies on the cloned and expressed curacin loading module revealed that the GNAT domain binds and decarboxylates malonyl CoA prior to its transfer to the ACPL domain. Both comparative biochemical studies between the GNATL-ACPL proteins carrying or lacking the AR domain, and structural studies of the loading module, indicated that the AR domain aids transfer of the acyl group to the ACP by directing transfer of the pantotheine moiety of the ACP domain into the active site of the GNATL domain (Gu et al., 2007). Decarboxylation of the starter unit prior to thioesterification is in contrast to the strategy used by KSQ-containing modules, wherein the KSQ domain most likely decarboxylates the malonyl-ACP unit. 3.2.4. Leinamycin loading module The first two steps in the biosynthesis of leinamycin, a hybrid nonribosomal peptide/polyketide, consists of condensation of the starter D-alanine with L-cysteine, followed by six successive condensations employing malonyl CoA as the extender unit, using six PKS modules (Tang et al., 2004a). The gene product LnmQ consists of the A-PCP (peptidyl carrier protein) didomain. The peptide LnmP is a discrete PCP. Recent biochemical
126
Leonard Katz
analysis has demonstrated that LnmQ binds D-alanine and then transfers it to LnmP, from which it undergoes condensation with the cysteinyl residue attached to the PCP of the NRPS module in LmnI (Tang et al., 2007). In the LNM system, LnmQ, the loading module is designated module 1 and the NRPS module, the first extender module, is designated module 2.
3.3. Methylation domains 3.3.1. O-Methylation O-methylations of hydroxyl groups in polyketide backbones usually take place after completion of acyl chain synthesis and are catalyzed by cytochrome P450 enzymes encoded by discrete genes that lie within the biosynthesis clusters. Notable exceptions occur in the biosynthesis of myxothiazol and stigmatellin A, polyketides produced by the myxobacterium Stigmatella aurantiaca. Myxothiazol contains two methoxy groups at positions corresponding to the 6th and 7th condensation cycles of biosynthesis and the corresponding modules of the stigmatellin PKS each contain the domain organization KS–AT–OM–KR–ACP (OM ¼ O-methyltransferase), suggesting that the O-methylations take place during, rather than after, nascent chain synthesis (Silakowski et al., 1999). Similarly, the modules implicated in the fourth and fifth cycles of stigmatellin A biosynthesis also contain OM domains (Gaitatzis et al., 2002). An OM domain was also identified in the sixth module of the jamaicamide PKS cluster and corresponded to the activity required for the presence of the 25-O-methyl group on the compound (Edwards et al., 2004). 3.3.2. C-Methylation: a-carbon Epothilone contains a geminyl dimethyl group at C4. Sequencing of the epo PKS revealed a functional domain for C-methylation (which uses the methyl donor S-adenosylmethionine) in module 8 (Molnar et al., 2000; Tang et al., 2000). The AT8 sequence resembles the consensus methylmalonyl-specifying AT cluster, so the geminyl dimethyl is produced by incorporation of methylmalonyl CoA, followed by single C-methylation of the a-carbon during the eighth condensation cycle. The CM domain is positioned between the AT and ACP domains (module 8 lacks reductive domains); hence the general KS-AT- . . . -ACP organization of DEBS is preserved. Geminyl dimethyls are also present at C-8 and C-18 of bryostatin but, as described below, because malonyl CoA is incorporated in each cycle of bryostatin biosynthesis, the geminyl dimethyl groups are produced by C-dimethylation of the a-carbons produced in the fourth and ninth condensation cycles, catalyzed by the corresponding CM domains present in modules 4 and 9 of the bryostatin PKS (Sudek et al., 2007). Similarly, the geminyl dimethyl group in pederin is introduced via dimethylation by the MT domain in module 2 (Piel, 2002). The methyl groups at C6 of
DEBS Paradigm
127
leinamycin, C13 of bacillaene, C9 of jamaicamide, and C15 and C150 of disorazole originate through single C-methylations of the a-carbons produced during the sixth, seventh, second, and second condensation cycles, respectively, each catalyzed by an MT domain present in their corresponding modules, as shown in Fig. 6.3 (Butcher et al., 2007; Carvalho et al., 2005; Edwards et al., 2004; Tang et al., 2004a).
3.4. Trans PKS activities Trans activities described here refer to discrete enzymes that are not covalently linked to PKS modules and act at specific points during synthesis of nascent acyl chains. These are distinguished from the ‘‘decorating’’ or modifying activities (O- or C-methylation, hydroxylation, glycosylation, etc.) that act after completion of polyketide chain biosynthesis. 3.4.1. AT First described for the PKS systems involved in the synthesis of pederin (Piel, 2002) and leinamycin (Cheng et al., 2003), a number of PKSs, including virginiamycin M (Pulsawat et al., 2007a), bryostatin (Sudek et al., 2007), myxovirescin A (Simunovic et al., 2006), disorazole (Carvalho et al., 2005), and rhizoxin (Brendel et al., 2007), that incorporate malonyl CoA exclusively at all positions of the nascent acyl chain, contain modules that lack the corresponding AT domains but are otherwise organized normally (KS-(DH-ER-KR)(MT)-ACP). Discrete ORFs that encode putative acyltransferase activities have been identified adjacent to the PKS gene cluster in most of these AT-less PKS systems and, in the bryostatin system, transacyltransferase activity has been confirmed in vivo and in vitro (Lopanik et al., 2008). Trans-acylation requires interaction between the ACP domain of the AT-less PKS module and the discrete acyltransferase, but the identities of the segments of the modules that undergo these interactions have not yet been determined. 3.4.2. KR Chalcomycin (Fig. 6.2) contains a 2,3-trans double bond in its polyketide backbone but module 7 of the chm PKS was shown to lack both the required KR and DH domains. Cloning of the chm PKS from the chalcomycin producer Streptomyces bikiniensis into Streptomyces fradiae resulted in the production of the expected 3-keto 16-membered macrolide, chalconolide (Fig. 6.2), indicating that 2,3-cis double-bond formation could either be bypassed during acyl chain synthesis, or was a postpolyketide tailoring event. A potential KR-determining ORF, designated chmU, was found to map about 4 kb downstream of the chm PKS but was not tested
128
Leonard Katz
for function. A DH-like domain was not uncovered in the chalcomycin biosynthesis cluster (Ward et al., 2004). 3.4.3. DH Phoslactomycin (PLM) contains 3 cis-double bonds: 14,15-, 12,13-, and the 2,3-bond in the 6-membered lactone. Modules 1 and 2 of the PLM PKS, which introduce the 14,15- and 12,13-atoms, respectively, contain the canonical KR–DH didomain (the KR domains of these modules are believed to produce the corresponding L-3-hydroxylacyl product required to yield the cis-double bond). On the other hand, module 7 of PLM, responsible for incorporation of the 2,3 atoms of the completed molecule, does not have a DH domain (Palaniappan et al., 2003). Bioinformatic analysis of both the PLM and fostreicin biosynthetic gene clusters uncovered a pair of homologous ORFs ( plmT2, ORF4, respectively) belonging to a family of NAD-dependent epimerases/dehydratases. Knockout of plmT2 resulted in the appearance of a PLM analogue containing a saturated lactone, indicating its involvement in the generation of the 2,3-cis double bond, likely as a post-PKS tailoring enzyme (Palaniappan et al., 2008). 3.4.3. HCS cassette: b-carbon methylation A number of polyketides, including virginiamycin, myxovirescin A, bacillaene, curacin A, mupirocin, pederin, bryostatin, and jamaicamide, contain unmodified or modified methyl side chains at odd-numbered positions on their polyketide backbones, corresponding to the positions of b-carbon atoms generated after condensation. b-Methyl side chains cannot be generated through incorporation of methylmalonyl units during condensation cycles; rather, they are produced though a three-step pathway illustrated in Fig. 6.4. The first step involves condensation of acetylACP with the unreduced b-carbon of the nascent polyketide chain (tethered to the corresponding ACP domain) resulting in production of
ACP
ACP
ACP S S O O
ACP ACP
ACP S
HCS
SH
SH [ECH1, ECH2]
O
S O
HO H2O CO2
O R
HO O
R
R
Figure 6.4 Scheme for the introduction of b-methyl side chains. Only the ACP domains of the modules that hold the nascent polyketide chains are shown. HCS, hydroxymethylglutaryl CoA synthase; ECH, enoyl CoA hydratase.
DEBS Paradigm
129
the b-OH-b-carboxymethyl intermediate. This step resembles condensation of the nucleophile donor, acetyl CoA, and the electrophile acceptor, acetoacetyl CoA, to produce hydroxymethylglutaryl CoA in the mevalonate biosynthetic pathway (Theisen et al., 2004), catalyzed by the enzyme hydroxymethylglutaryl CoA synthase; hence, the designation HCS for the enzymes that carry out this process in polyketide biosynthesis. In curacin A biosynthesis, HCS-mediated condensation takes place after the first condensation, acetoacetyl-ACP is the substrate for the HCS activity associated with the ORF designated CurD, and hydroxymethylglutaryl-ACP is produced. (In the other compounds listed above, b-carbonyl condensation takes place at later stages of polyketide synthesis.) Where a methyl side chain is the end-product of the reaction scheme, the b-OH-b-carboxymethyl intermediate then undergoes concerted dehydration catalyzed by an enoyl CoA-hydratase-like ORF designated ECH1 and decarboxylation, catalyzed by ECH2 to produce the b-methyl side and the corresponding adjacent double bond (Geders et al., 2007). (The order of the two reactions has not been determined.) In the case of pederin, the double bond is displaced to become an exomethylene in the formation of the 6-membered cyclic hemiacetal ring (Piel, 2002). In all instances except for bryostatin, an HCS–ECH1–ECH2 cassette consisting of three distinct ORFS was identified in the corresponding PKS cluster and, in at least two cases, was found to map immediately downstream of the module that carried the acyl chain substrate for carboxymethylation (Butcher et al., 2007; Pulsawat et al., 2007b; Simunovic and Muller, 2007; Wu et al., 2008). In jamaicamide biosynthesis, a yet to be identified halogenase acts at some stage of the process to produce the chloromethyl side chain (Edwards et al., 2004). A single HCS activity, BryR, was identified in the bryostatin PKS cluster but ECH activities were not found, correlating with the presence of (methyl)carboxymethylene side-chains at C13 and C21 (Sudek et al., 2007). Myxovirescin A contains modified b-methyl side-chains at C13 and C17. The methyl group at C17 is O-methylated, which probably arises via P450-mediated hydroxylation and O-methylation following HCS-directed b-methylation. The ethyl side-chain present at C13 was proposed to arise by employment of propionyl-ACP as the nucleophilic donor (Calderone et al., 2007). Two discrete HCS proteins, TaC and TacF, were identified in the PKS cluster, but only a single set of ECH1 and ECH2 activities, TaX and TaY, were found (Simunovic et al., 2006). Biochemical confirmation of HCS, ECH1 and ECH2 activities in vitro was obtained by Calderone et al. for the respective proteins of the bacillaene system, employing acetyl-AcpK as the nucleophile donor and a cloned segment of PksL containing the tandem ACP domains (PksL’) that was esterified on the panthetheine arm of the second ACP domain with an acetoacetyl moiety and the electrophile acceptor. Employing
130
Leonard Katz
high resolution mass spectrometry for detection, they found that the HCS (PksG) catalyzed the formation of hydroxymethylglutaryl-PksL’, and that the addition of the two ECH proteins, PksH and PksI, resulted in the formation of the predicted isopentenyl-PKSL’ product (Calderone et al., 2006). Analogous in vitro work demonstrated HCS activities for the two proteins TaC and TaF and ECH activities for TaX and TaY (Calderone et al., 2007). In the three instances cited, the substrate acetoacetyl-ACP was used successfully as the acceptor in HCS-mediated carboxymethylation, although the authentic substrate in each of these cases is a much larger molecule. Furthermore, acetyl-ACP is also not thought to be the donor for C-16 ethylation in myxovirescin synthesis.
3.5. Unusual modular organization 3.5.1. Multiple AT domains Soraphen A contains a phenyl side-chain adjacent to the lactone oxygen, indicating that benzoic acid is used as the starter unit. Sequencing of the cluster revealed the unusual loading module–module 1 organization ACPLKS1-AT1a-AT1b-KR1-ACP1 (Ligon et al., 2002; Wilkinson et al., 2001). A proposal advanced by Wilkinson et al. (Wilkinson et al., 2001) suggested the intermingling of domains of the loading module and module 1 where the starter unit, benzoyl CoA, binds to AT1a, and then is back-transferred to ACPL, followed by transfer to KS1, where it undergoes condensation with malonyl-ACP, which is transferred from AT1b to ACP1. Similar loading module–module 1 organizations (ACPL-KS1-ATL-AT1-DHKR1-ACP1) were found in the myxathiazole and myxalamid PKS clusters, where ATL was proposed to load the starter, isobutyryl CoA, and transfer it to ACPL (Silakowski et al., 1999, 2001). Tandem AT domains were also discovered in MmpC, a component of the mupirocin PKS, but a prediction of the role of MmpC in the biosynthesis of the polyketide could not be made (Wu et al., 2008). 3.5.2. Multiple ACP domains In the PKS clusters that produce bacillaene, mupirocin, virginiamycin M, and pederin, the modules that carry the nascent acyl chains that serve as acceptors for b-carboxymethylation contain two tandem ACP domains. The corresponding modules in the curacin A and jamaicamide clusters carry three tandem ACP domains. (The corresponding modules in the myxovirescin and bryostatin PKS systems were not identified.) The role of the tandem ACP domains in b-alkylation is not understood, nor has it been determined whether more than a single ACP domain is necessary for the three-step process to take place. Tandem ACP domains were also observed in module 8 of the ambruticin PKS cluster, and b-carboxymethylation was
131
DEBS Paradigm
proposed as an intermediate step, followed by a Favorski rearrangement to result in the loss of a carbon atom from the polyketide chain ( Julien et al., 2006). The canonical HCS-ECH1-ECH2 b-methylation cassette was not detected in the cluster, however. Tandem ACP domains were observed in module 2 of the disorazole PKS but the second ACP domain was found not to contain the active-site serine residue and is, therefore, inactive (Carvalho et al., 2005). Two ACP domains were also found in module 6 of the ‘‘AT-less’’ leinamycin PKS but were separated by the CM domain that is believed to introduce the a-methyl side chain at C-9. The corresponding module, module 6, has the domain organization KS-KR-ACP1-CM-ACP2 (Cheng et al., 2003). Site-directed mutagenesis indicated that either of the two ACP domains could independently support synthesis of leinamycin, but ACP2 was found to be fourfold more efficient at LmnG (AT)-catalyzed loading of malonate than ACP1 (Tang et al., 2006). 3.5.3. ‘‘Broken’’ modules Type I PKS modules typically reside within a single polypeptide chain, but departures from this paradigm have been observed. Seven examples are shown in Fig. 6.5, each illustrating separation between distinct modular domains. The seventh module of the myxalamid PKS is divided between MyxB1, which contains the KS and AT domains, and MyxB2, which carries the DH KR and ACP domains, as well as a nonfunctional ER domain designated ER (Silakowski et al., 2001). In the bacillaene PKS system, modules 4 and 8 are each split between two multimodular polypeptides: module 4 between PksJ and PksL, and module 8 between PksL Ambruticin
Myxalamid MyxB1
Lankacidin Module 7
Module 7
Module 6
MyxB2
Module 8 AmbE
KS
AT
DH
KR
Module 2 - 5
Module 1
AmbF
LkcA
ACP DH KS
KR
AT
DH ACP
KS
LkcB
LkcC
KR
AT
ACP
KS
ACP ACP
A
C
T
KS
DH
KR
Bacillaene
KS
Jamaicamide Module 4
Module 6 Module 5
Module 3
Module 8
Module 6
Module 7 PksL
PksJ KR
[Load - modules 1 - 2]
KS
DH ACP
KS
DH ACP
KS
KR ACP KS
JamM
PksM
KR
Disorazole
ACP ACP
KS
DH ACP
KS
KS ACP
AT
JamN
OM ACP
[Modules 9 - 10]
KS
Rhizoxin Module 4 DszB
KR KS
DH ACP
Module 3
Module 2
Module 3 DszA
[Mod 1 - 2]
CM ACP ACP
KS
RsxB
KR
DH ACP
KS
[Mod 5 - 8]
[NRPS1 - Mod 1]
KS
RsxC DH
KR ACP
KS
KR
CM ACP
KS
[Mod 4 - 6]
Figure 6.5 Organization of PKSs showing ‘‘broken’’ modules. Abbreviations, naming, numbering, and shading conventions duplicate those in Fig. 6.1.
132
Leonard Katz
and PksM (Butcher et al., 2007). In each case, the separations are between the KS and adjacent DH domains. (The bacillaene PKS is ‘‘AT-less.’’) In the disorazole PKS system, module 4 is split between the DH domain in DsxA and the KR domain in DsxB (Carvalho et al., 2005). In the rhizoxin system, the 3rd PKS module is split between the KR and CM domains in proteins RsxB and RsxC, respectively (Brendel et al., 2007), and in the ambruticin PKS system, the seventh module is divided between AmbE and AmbF, between the KR and ACP domains. In the etnangien PKS, which is composed of 20 modules distributed on six proteins, modules 3, 7, 10 and 14 are split between two proteins, and each split is located in a different interdomain region of the corresponding module (Menche et al., 2008). The most unusual case is in the lankacidin (Fig. 6.6B) PKS. Module 2 appears to be divided into three proteins, LkcA, LkcB, and LkcC, although it is possible that the KS domain at the terminus of LkcC is part of module 2 (Tatsuno et al., 2007). In each of these cases, it is not A
B StiG
StiH
StiI
LkcA
Module 7 [---------- Modules 8, 9, 10 ----------------]
A
C
PCP KS
LkcB
LkcC
LkcD
DH
KR CM ACP ACP KS 1 2
AT
DH KS
AT
ACP
KS
AT ACP
AT ACP Cy
KS
S
S
7
10
O 6
O
5
6
5
O
O
9
O 3
O
O
3 KS AT KR ACP
O
4 KS AT KR DH CM ACP 5 KS AT KR DH ACP
O
8
4
1 KS AT KR DH CM ACP 2 KS AT KR DH ACP
O
7
O
O
O
2
O 8 HN
1
1
7
Stigmatellin
18
2 1
H L
1
L
O
15
2
O 10
6
OH 3
5 4
OH
Lankacidin C
C
Module 5
Module 4
Module 5
ER
KS
AT
KR
DH
KR ACP
ACP
KS
AT
ACP
DH KS
ACP
S
S
HO
KS AT
Skip, DH only
DH
ACP
KS
ACP
KS AT
ACP
KS S
O
O
Stutter, Load extender
OH
OH
KR
S O
O
HO
ER KR
S
O
O
Module 5
ER
Full Module 5 activity
OH OH
N
S
S
N
S
N S
N
Figure 6.6 Iterative use of modules (stuttering). (A) Stigmatellin PKS. (B) Lankacidin PKS. (C) A model for cis-double bond formation by the epothilone PKS. Details are described in the text. Abbreviations, naming, numbering, and shading conventions duplicate those in Fig.6.1.
DEBS Paradigm
133
understood how the split module is held together so that the normal intramodular interactions, (AT–ACP, KS–ACP, and DH-, ER-, KR-, and CM-ACP) take place.
3.6. Unusual module functions 3.6.1. ‘‘Skipping’’ Skipping refers to the bypass of the utilization of a domain or an entire module in the production of a polyketide. For type I PKS systems, skipping is a rare event, but a small number of examples of this phenomenon have been reported. It is usually associated with the presence of additional functional domains or modules in a PKS for which there is no obvious need in the biosynthesis of the corresponding polyketide. Truncated derivatives of a number of polyketides, including the avermectin analogue nemadectin and epothilone, were observed in fermentation broths, but these molecules usually appeared at very low levels (Carter et al., 1988; Hardt et al., 2001). The subsequent discoveries of their respective PKS systems indicated that the truncated compounds could be produced by bypass of one or other module during biosynthesis, but the low levels detected underscored the fidelity of module-to-module chain passage. In the etnangien PKS, in which the organization of the modules appears to be colinear with the growth of the nascent polyketide chain, module 14, consisting of a KS and an ACP domain, does not appear to be used in the synthesis of the acyl chain (Menche et al., 2008). Interestingly, module 14 is split between the two domains between EtnG and EtnH, possibly allowing close physical contact between the two proteins to permit direct acyl chain transfer from ACP13 to KS15, thereby bypassing module 14 completely. In the disorazole PKS, a module consisting of KS and ACP domains—the PKS is AT-less—and contained entirely within but at the C-terminus of DszB, follows the seventh module and is not predicted to be used in the synthesis of the polyketide (Carvalho et al., 2005). Similarly, two tandem KS–ACP modules appear in DszC, downstream from NRPS module 8. These two modules are not predicted to be used in the biosynthesis of disorazole, but the TE domain, which lies downstream from the ACP domain of the second KS–ACP module, is predicted to be used in the formation of the head-to-tail polyketide dimer. It appears, therefore, that three modules are skipped in disorazole synthesis. A similar KS–ACP didomain module, also predicted not to be used in the synthesis of mupirocin, was found between modules 4 and 5 of the mupirocin PKS. Disruption of this module resulted in the loss of mupirocin production, indicating a yet-to-be-determined role in mupirocin biosynthesis (El-Sayed et al., 2003). An artificial PKS composed of DEBS Load-DEBS Module 1-Rapamycin Module 2-DEBS Module 2-TE was found to produce the predicted tetraketide but, surprisingly, only as a minor component of a
134
Leonard Katz
mixture that was largely composed of triketides that were the same as those produced from a PKS composed of DEBS Load-Module 1-Module 2-TE (Rowe et al., 2001). Subsequent mutagenesis work indicated that the rap ACP domain but not the rap KS domain was required for acyl chain skipping, indicating that the chain was transferred directly from DEBS ACP1 to rap ACP2 without forming the thioacyl intermediate on rap KS2, although it is possible that rap KS2 participated in the ACP1-toACP2 thiotransfer (Thomas et al., 2002). 3.6.2. Stuttering Stuttering is the term that is used to describe the iterative use of a module in polyketide chain growth and is usually implicated when the number of modules present in a PKS is fewer than the number of condensation events required for complete biosynthesis of the corresponding polyketide. It is usually possible to identify the iterative module by comparing the proposed segment of the completed polyketide to the structure of the segment predicted from the use of the module. Stigmatellin is built through ten condensation cycles from a PKS composed of nine modules. As shown in Fig. 6.6A, the last three condensations yield identical segments of the nascent chain that can be programmed by StiH or StiI, both of which are composed of KS-AT-ACP domains. Either StiH or StiI is used in two successive condensations in the growth of the polyketide chain (Gaitatzis et al., 2002). (It is also formally possible that StiH is bypassed and that StiJ is used three times.) Borrelidin is produced from eight condensations by a PKS composed of six extension modules (Olano et al., 2004). Module 5 (BorA5) of the borellidin PKS (KS –AT-DH-ER-ACP) is thought to be used in three successive chain extensions to introduce nine carbon atoms into the compound. The most unusual example of iterative use of a PKS module takes place during the biosynthesis of lankacidin C, a 17-membered macrolide, produced from eight condensations using from a PS/PKS composed of five modules (Tatsuno et al., 2007). The segment containing the domains KS-DH-CM-ACP1-ACP1-KS-AT, spread over four proteins, is thought to be used for the first five condensations, but employing a different set of reduction domains in each condensation cycle to yield to introduce ten carbon atoms into the polyketide backbone, reduced to varying extents (Fig. 6.6B). The biochemical basis of stuttering is not yet understood. Stuttering requires passage of the nascent acyl chain from the ACP domain to the KS domain of the same module. The ACP domain is then loaded with a second extender unit which undergoes condensation with the acyl chain tethered to the KS domain. Where the module used iteratively is contained within a multidomain polypeptide, it is most likely that the nascent chain is passed from the ACP to the KS domain on the same protein (intramodular
DEBS Paradigm
135
passage). On the other hand, if the module undergoing iterative use is present on a discrete protein, as in borrelidin or stigmatellin, it is possible that two or more proteins can form part of the PKS complex, thereby allowing forward, intermodular passage of the nascent acyl chain.
3.7. Intermodular interactions 3.7.1. cis-Double bond formation by the epo PKS The products of the epo PKS, epothilones C and D, contain a cis double bond at C12-C13 (Fig. 6.3), which would be expected to be introduced during the 4th condensation cycle of nascent chain growth and controlled by module 4, but module 4 was found not to contain the required DH domain normally required for the dehydration reaction (Molnar et al., 2000; Tang et al., 2000). Module 4 does have the required KR domain to generate the proposed L-3-hydroxyacyl chain (which would subsequently undergo syn elimination to generate the cis-double bond). Removal of the DH5 function resulted in the production of a compound lacking the 12,13-cis double bond, indicating that the DH5 domain is required to for cis-double bond formation (Tang et al., 2004b). The work reported left a number of still-to-be-resolved possibilities for the mechanism: (1) the cis-double bond is introduced during the fourth condensation cycle with the nascent chain attached to ACP4—the DH5 domain thus ‘‘reaches back’’ into module 4 to cause the 2,3-dehydration; (2) the chain is transferred from ACP4 to the ACP domain of module 5 without elongation (skipping), where it undergoes 2,3 dehydration by DH5 to generate the cis-double bond, then is transferred back to KS5 for the normal fifth condensation cycle (stuttering) that includes the generation of a trans double bond, which undergoes subsequent reduction (Fig. 6.6C); or (3) the chain is elongated normally in module 5, where it undergoes two DH5-mediated dehydrations, 2,3and 4,5- to generate the ultimate 10,11-trans double bond and 12,13-cis double bond, respectively. In all of these mechanisms, DH5 is proposed to act at two points in polyketide chain growth, to mediate the formation of two subsequent double bonds. 3.7.2. Chain termination in the pik PKS Sequencing of the macrolide biosynthetic cluster in Streptomyces venezuelae revealed that a single set of PKS-determining genes containing six modules was responsible for the synthesis of both the 12-membered macrolactone 10-deoxymethynolide and the 14-membered macrolactone narbonolide (Xue et al., 1998). The former could be made by the first five modules, the latter required all six modules, but the lactonizations to produce both products required the TE domain that was positioned at the C-terminus of module 6. Early work on this system suggested that production of the 12-membered lactone involved thiotransfer of the nascent acyl from
136
Leonard Katz
ACP5 to ACP6 without chain growth (skipping), where it could undergo TE-mediated release from the PKS and lactonization, and that a functional KS6 domain was required for thiotransfer (Beck et al., 2002, 2003). Recent work, however, has demonstrated that skipping from ACP5 to ACP6 does not take place but that the TE domain can interact with the nascent chain tethered to ACP5 to produce the 12-membered macrolactone or with the nascent chain attached to ACP6 to produce the 14-membered lactone. Hence, the TE domain can form interactions with ACP5 and ACP6. For the former, the full domain set of module 6 is required to allow proper docking between PikAIII and PikAIV to allow the TE domain to produce the 12-membered macrolactone (Kittendorf and Sherman, 2008).
4. Conclusion The basic tenets of the DEBS paradigm, that each step in the biosynthesis of a complex polyketide is programmed by a discrete module which contains all the enzymatic activities required for the chemical events that take place, and that structural diversity can be achieved through variation in the functional modular domains and though the employment of different numbers of modules, has held up well for the more than 50 PKS systems that have been characterized. The most pronounced departure has been the uncovering of AT-less PKS modules together with the trans AT domains that specify the use of malonyl CoA as the common extender in all nascent chain extensions, but the presence of a-C methylation domains in modules has enabled growing polyketides to acquire methyl side chains. Changes in the nature of the loading modules from the DEBS AT-ACP didomain have uncovered some loss of specificity of the use of starter units. b-Methyl side chains in polyketides introduced by the HCS–ECH1–ECH2 cassette is a departure from the DEBS paradigm, but can be viewed as trans modification to a nascent chain, similar to trans O- or aC-methylation. Modules that undergo skipping and stuttering also fall outside the DEBS paradigm, but these represent a small number of cases. In the main, the wide variety of new modules and new activities uncovered after the original description of DEBS has strengthened the belief that a wide variety of useful novel polyketides will be produced by directed or combinatorial module assembly.
REFERENCES August, P. R., Tang, L., Yoon, Y. J., Ning, S., Mu¨ller, R., Yu, T. W., Taylor, M., Hoffmann, D., Kim, C. G., Zhang, X., Hutchinson, C. R., and Floss, H. G. (1998). Biosynthesis of the ansamycin antibiotic rifamycin: Deductions from the molecular
DEBS Paradigm
137
analysis of the rif biosynthetic gene cluster of Amycolatopsis mediterranei S699. Chem. Biol. 5, 69–79. Beck, B. J., Aldrich, C. C., Fecik, R. A., Reynolds, K. A., and Sherman, D. H. (2003). Iterative chain elongation by a pikromycin monomodular polyketide synthase. J. Am. Chem. Soc. 125, 4682–4683. Beck, B. J., Yoon, Y. J., Reynolds, K. A., and Sherman, D. H. (2002). The hidden steps of domain skipping: Macrolactone ring size determination in the pikromycin modular polyketide synthase. Chem. Biol. 9, 575–583. Bisang, C., Long, P. F., Corte´s, J., Westcott, J., Crosby, J., Matharu, A. L., Cox, R. J., Simpson, T. J., Staunton, J., and Leadlay, P. F. (1999). A chain initiation factor common to both modular and aromatic polyketide synthases. Nature 401, 502–505. Brendel, N., Partida-Martinez, L. P., Scherlach, K., and Hertweck, C. (2007). A cryptic PKS-NRPS gene locus in the plant commensal Pseudomonas fluorescens Pf-5 codes for the biosynthesis of an antimitotic rhizoxin complex. Org. Biomol. Chem. 5, 2211–2213. Butcher, R. A., Schroeder, F. C., Fischbach, M. A., Straight, P. D., Kolter, R, Walsh, C. T., and Clardy, J (2007). The identification of bacillaene, the product of the PksX megacomplex in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 104, 1506–1509. Caffrey, P., Bevitt, D. J., Staunton, J., and Leadlay, P. F. (1992). Identification of DEBS 1, DEBS 2 and DEBS 3, the multienzyme polypeptides of the erythromycin-producing polyketide synthase from Saccharopolyspora erythraea. FEBS Lett. 304, 225–228. Calderone, C. T., Iwig, D. F., Dorrestein, P. C., Kelleher, N. L., and Walsh, C. T. (2007). Incorporation of nonmethyl branches by isoprenoid-like logic: Multiple beta-alkylation events in the biosynthesis of myxovirescin A1. Chem. Biol. 14, 835–846. Calderone, C. T., Kowtoniuk, W. E., Kelleher, N. L., Walsh, C. T., and Dorrestein, P. C. (2006). Convergence of isoprene and polyketide biosynthetic machinery: Isoprenyl-Scarrier proteins in the pksX pathway of Bacillus subtilis. Proc. Natl. Acad. Sci. USA 103, 8977–8982. Carter, G. T., Nietsche, J. A., Hertz, M. R., Williams, D. R., Siegel, M. M., Morton, G. O., James, J. C., and Borders, D. B. (1988). LL-F28249 antibiotic complex: A new family of antiparasitic macrocyclic lactones. Isolation, characterization and structures of LL-F28249 alpha, beta, gamma, lambda. J. Antibiot. (Tokyo) 41, 519–529. Carvalho, R., Reid, R., Viswanathan, N., Gramajo, H., and Julien, B. (2005). The biosynthetic genes for disorazoles, potent cytotoxic compounds that disrupt microtubule formation. Gene 359, 91–98. Castonguay, R., He, W., Chen, A. Y., Khosla, C., and Cane, D. E. (2007). Stereospecificity of ketoreductase domains of the 6-deoxyerythronolide B synthase. J. Am. Chem. Soc. 129, 13758–13769. Chandran, S. S., Menzella, H. G., Carney, J. R., and Santi, D. V. (2006). Activating hybrid modular interfaces in synthetic polyketide synthases by cassette replacement of ketosynthase domains. Chem. Biol. 13, 469–474. Chang, Z., Sitachitta, N., Rossi, J. V., Roberts, M. A., Flatt, P. M., Jia, J., Sherman, D. H., and Gerwick, W. H. (2004). Biosynthetic pathway and gene cluster analysis of curacin A, an antitubulin natural product from the tropical marine cyanobacterium Lyngbya majuscula. J. Nat. Prod. 67, 1356–1367. Cheng, Y. Q., Tang, G. L., and Shen, B. (2003). Type I polyketide synthase requiring a discrete acyltransferase for polyketide biosynthesis. Proc. Natl. Acad. Sci. USA 100, 3149–3154. Cortes, J., Haydock, S. F., Roberts, G. A., Bevitt, D. J., and Leadlay, P. F. (1990). An unusually large multifunctional polypeptide in the erythromycin-producing polyketide synthase of Saccharopolyspora erythraea. Nature 348, 176–178. DeHoff, B. S., Sutton, K. L., and Rosteck, P. R. Jr. (1996). Sequence of Streptomyces fradiae tylactone synthase gene tylG. GenBank Accession No. U78289.
138
Leonard Katz
Denoya, C. D., Fedechko, R. W., Hafner, E. W., McArthur, H. A., Morgenstern, M. R., Skinner, D. D., Stutzman-Engwall, K., Wax, R. G., and Wernau, W. C. (1995). A second branched-chain alpha-keto acid dehydrogenase gene cluster (bkdFGH) from Streptomyces avermitilis: Its relationship to avermectin biosynthesis and the construction of a bkdF mutant suitable for the production of novel antiparasitic avermectins. J. Bacteriol. 177, 3504–3511. Donadio, S., and Katz, L. (1992). Organization of the enzymatic domains in the multifunctional polyketide synthase involved in erythromycin formation in Saccharopolyspora erythraea. Gene 111, 51–60. Donadio, S., Staver, M. J., McAlpine, J. B., Swanson, S. J., and Katz, L. (1991). Modular organization of genes required for complex polyketide biosynthesis. Science 252, 675–679. Edwards, D. J., Marquez, B. L., Nogle, L. M., McPhail, K., Goeger, D. E., Roberts, M. A., and Gerwick, W. H. (2004). Structure and biosynthesis of the jamaicamides, new mixed polyketide-peptide neurotoxins from the marine cyanobacterium Lyngbya majuscula. Chem. Biol. 11, 817–833. El-Sayed, A. K., Hothersall, J., Cooper, S. M., Stephens, E., Simpson, T. J., and Thomas, C. M. (2003). Characterization of the mupirocin biosynthesis gene cluster from Pseudomonas fluorescens NCIMB 10586. Chem. Biol. 10, 419–430. Gaitatzis, N., Silakowski, B., Kunze, B., Nordsiek, G., Blo¨cker, H., Ho¨fle, G., and Mu¨ller, R. (2002). The biosynthesis of the aromatic myxobacterial electron transport inhibitor stigmatellin is directed by a novel type of modular polyketide synthase. J. Biol. Chem. 277, 13082–13090. Geders, T. W., Gu, L., Mowers, J. C., Liu, H., Gerwick, W. H., Ha˚kansson, K., Sherman, D. H., and Smith, J. L. (2007). Crystal structure of the ECH2 catalytic domain of CurF from Lyngbya majuscula. Insights into a decarboxylase involved in polyketide chain beta-branching. J. Biol. Chem. 282, 35954–35963. Gu, L., Geders, T. W., Wang, B., Gerwick, W. H., Ha˚kansson, K., Smith, J. L., and Sherman, D. H. (2007). GNAT-like strategy for polyketide chain initiation. Science 318, 970–974. Hardt, I. H., Steinmetz, H., Gerth, K., Sasse, F., Reichenbach, H., and Ho¨fle, G. (2001). New natural epothilones from Sorangium cellulosum, strains So ce90/B2 and So ce90/D13: Isolation, structure elucidation, and SAR studies. J. Nat. Prod. 64, 847–856. Haydock, S. F., Aparicio, J. F., Molna´r, I., Schwecke, T., Khaw, L. E., Ko¨nig, A., Marsden, A. F., Galloway, I. S., Staunton, J., and Leadlay, P. F. (1995). Divergent sequence motifs correlated with the substrate specificity of (methyl)malonyl-CoA:acyl carrier protein transacylase domains in modular polyketide synthases. FEBS Lett. 374, 246–248. Holzbaur, I. E., Ranganathan, A., Thomas, I. P., Kearney, D. J., Reather, J. A., Rudd, B. A., Staunton, J., and Leadlay, P. F. (1999). Molecular basis of Celmer’s rules: The role of two ketoreductase domains in the control of chirality by the erythromycin modular polyketide synthase. Chem. Biol. 6, 189–195. Hu, Z., Pfeifer, B. A., Chao, E., Murli, S., Kealey, J., Carney, J. R., Ashley, G., Khosla, C., and Hutchinson, C. R. (2003). A specific role of the Saccharopolyspora erythraea thioesterase II gene in the function of modular polyketide synthases. Microbiology 149, 2213–2225. Ikeda, H., Nonomiya, T., Usami, M., Ohta, T., and Omura, S. (1999). Organization of the biosynthetic gene cluster for the polyketide anthelmintic macrolide avermectin in Streptomyces avermitilis. Proc. Natl. Acad. Sci. USA 96, 9509–9514. Ikeda, H., and Omura, S. (2002). Biosynthesis, regulation, and genetics of macrolide production. In ‘‘Macrolide Antibiotics: Chemistry, Biology, and Practice.’’ (S. Omura, ed.), pp. 285–326. Academic Press, New York.
DEBS Paradigm
139
Julien, B., Tian, Z. Q., Reid, R., and Reeves, C. D. (2006). Analysis of the ambruticin and jerangolid gene clusters of Sorangium cellulosum reveals unusual mechanisms of polyketide biosynthesis. Chem. Biol. 13, 1277–1286. Kao, C. M., Katz, L., and Khosla, C. (1994). Engineered biosynthesis of a triketide lactone from an incomplete modular polyketide synthase. J. Am. Chem. Soc. 116, 11612–11613. Katz, L., and Ashley, G. W. (2005). Translation and protein synthesis: Macrolides. Chem. Rev. 105, 499–528. Keatinge-Clay, A. (2008). Crystal structure of the erythromycin polyketide synthase dehydratase. J. Mol. Biol. 384, 941–953. Kittendorf, J. D., and Sherman, D. H. (2008). The methymycin/pikromycin pathway: A model for metabolic diversity in natural product biosynthesis. Bioorg. Med. Chem. (epub). Kuhstoss, S., Huber, M., Turner, J. R., Paschal, J. W., and Rao, R. N. (1996). Production of a novel polyketide through the construction of a hybrid polyketide synthase. Gene 183, 231–236. Lau, J., Fu, H., Cane, D. E., and Khosla, C. (1999). Dissecting the role of acyltransferase domains of modular polyketide synthases in the choice and stereochemical fate of extender units. Biochemistry 38, 1643–1651. Ligon, J., Hill, S., Beck, J., Zirkle, R., Molna´r, I., Zawodny, J., Money, S., and Schupp, T. (2002). Characterization of the biosynthetic gene cluster for the antifungal polyketide soraphen A from Sorangium cellulosum So ce26. Gene 285, 257–267. Lopanik, N. B., Shields, J. A., Buchholz, T. J., Rath, C. M., Hothersall, J., Haygood, M. G., Ha˚kansson, K., Thomas, C. M., and Sherman, D. H. (2008). In vivo and in vitro transacylation by BryP, the putative bryostatin pathway acyltransferase derived from an uncultured marine symbiont. Chem. Biol. 15, 1175–1186. Lowden, P. A., Bo¨hm, G. A., Metcalfe, S., Staunton, J., and Leadlay, P. F. (2004). New rapamycin derivatives by precursor-directed biosynthesis. ChemBioChem 5, 535–538. Lowden, P. A., Wilkinson, B., Bo¨hm, G. A., Handa, S., Floss, H. G., Leadlay, P. F., and Staunton, J. (2001). Origin and true nature of the starter unit for the rapamycin polyketide synthase. Angew. Chem. Int. Ed. Engl. 40, 777–779. Luo, G., Pieper, R., Rosa, A., Khosla, C., and Cane, D. E. (1996). Erythromycin biosynthesis: Exploiting the catalytic versatility of the modular polyketide synthase. Bioorg. Med. Chem. 4, 995–999. Mao, Y., Varoglu, M., and Sherman, D. H. (1999). Molecular characterization and analysis of the biosynthetic gene cluster for the antitumor antibiotic mitomycin C from Streptomyces lavendulae NRRL 2564. Chem. Biol. 6, 251–263. Marsden, A. F., Caffrey, P., Aparicio, J. F., Loughran, M. S., Staunton, J., and Leadlay, P. F. (1994). Stereospecific acyl transfers on the erythromycin-producing polyketide synthase. Science 263, 378–380. Marsden, A. F., Wilkinson, B., Corte´s, J., Dunster, N. J., Staunton, J., and Leadlay, P. F. (1998). Engineering broader specificity into an antibiotic-producing polyketide synthase. Science 279, 199–202. Menche, D., Arikan, F., Perlova, O., Horstmann, N., Ahlbrecht, W., Wenzel, S. C., Jansen, R., Irschik, H., and Mu¨ller, R. (2008). Stereochemical determination and complex biosynthetic assembly of etnangien, a highly potent RNA polymerase inhibitor from the myxobacterium Sorangium cellulosum. J. Am. Chem. Soc. 130, 14234–14243. Menzella, H. G., Reid, R., Carney, J. R., Chandran, S. S., Reisinger, S. J., Patel, K. G., Hopwood, D. A., and Santi, D. V. (2005). Combinatorial polyketide biosynthesis by de novo design and rearrangement of modular polyketide synthase genes. Nat. Biotechnol. 23, 1171–1176. Molna´r, I., Schupp, T., Ono, M., Zirkle, R., Milnamow, M., Nowak-Thompson, B., Engel, N., Toupet, C., Stratmann, A., Cyr, D. D., Gorlach, J., Mayo, J. M., et al. (2000).
140
Leonard Katz
The biosynthetic gene cluster for the microtubule-stabilizing agents epothilones A and B from Sorangium cellulosum So ce90. Chem. Biol. 7, 97–109. Moore, B. S., and Hertweck, C. (2002). Biosynthesis and attachment of novel bacterial polyketide synthase starter units. Nat. Prod. Rep. 19, 70–99. O’Hare, H. M., Baerga-Ortiz, A., Popovic, B., Spencer, J. B., and Leadlay, P. F. (2006). High-throughput mutagenesis to evaluate models of stereochemical control in ketoreductase domains from the erythromycin polyketide synthase. Chem. Biol. 13, 287–296. Olano, C., Moss, S. J., Bran˜a, A. F., Sheridan, R. M., Math, V., Weston, A. J., Me´ndez, C., Leadlay, P. F., Wilkinson, B., and Salas, J. A. (2004). Biosynthesis of the angiogenesis inhibitor borrelidin by Streptomyces parvulus Tu4055: Cluster analysis and assignment of functions. Chem. Biol. 11, 87–97. Oliynyk, M., Brown, M. J., Corte´s, J., Staunton, J., and Leadlay, P. F. (1996). A hybrid modular polyketide synthase obtained by domain swapping. Chem. Biol. 3, 833–889. Oliynyk, M., Stark, C. B., Bhatt, A., Jones, M. A., Hughes-Thomas, Z. A., Wilkinson, C., Oliynyk, Z., Demydchuk, Y., Staunton, J., and Leadlay, P. F. (2003). Analysis of the biosynthetic gene cluster for the polyether antibiotic monensin in Streptomyces cinnamonensis and evidence for the role of monB and monC genes in oxidative cyclization. Mol. Microbiol. 49, 1179–1190. Pacey, M. S., Dirlam, J. P., Geldart, R. W., Leadlay, P. F., McArthur, H. A., McCormick, E. L., Monday, R. A., O’Connell, T. N., Staunton, J., and Winchester, T. J. (1998). Novel erythromycins from a recombinant Saccharopolyspora erythraea strain NRRL 2338 pIG1. I. Fermentation, isolation and biological activity. J. Antibiot. (Tokyo) 51, 1029–1034. Palaniappan, N., Alhamadsheh, M. M., and Reynolds, K. A. (2008). cis-Delta(2,3)–double bond of phoslactomycins is generated by a post-PKS tailoring enzyme. J. Am. Chem. Soc. 130, 12236–12237. Palaniappan, N., Kim, B. S., Sekiyama, Y., Osada, H., and Reynolds, K. A. (2003). Enhancement and selective production of phoslactomycin B, a protein phosphatase IIa inhibitor, through identification and engineering of the corresponding biosynthetic gene cluster. J. Biol. Chem. 278, 35552–35557. Petkovic´, H., Sandmann, A., Challis, I. R., Hecht, H. J., Silakowski, B., Low, L., Beeston, N., Kuscer, E., Garcia-Bernardo, J., Leadlay, P. F., Kendrew, S. G., Wilkinson, B., et al. (2008). Substrate specificity of the acyl transferase domains of EpoC from the epothilone polyketide synthase. Org. Biomol. Chem. 6, 500–506. Piel, J. (2002). A polyketide synthase-peptide synthetase gene cluster from an uncultured bacterial symbiont of Paederus beetles. Proc. Natl. Acad. Sci. USA 99, 14002–14007. Pulsawat, N., Kitani, S., Kinoshita, H., Lee, C. K., and Nihira, T. (2007a). Identification of the bkdAB gene cluster, a plausible source of the starter-unit for virginiamycin M production in Streptomyces virginiae. Arch. Microbiol. 187, 459–466. Pulsawat, N., Kitani, S., and Nihira, T. (2007b). Characterization of biosynthetic gene cluster for the production of virginiamycin M, a streptogramin type A antibiotic, in Streptomyces virginiae. Gene 393, 31–42. Rascher, A., Hu, Z., Buchanan, G. O., Reid, R., and Hutchinson, C. R. (2005). Insights into the biosynthesis of the benzoquinone ansamycins geldanamycin and herbimycin, obtained by gene sequencing and disruption. Appl. Environ. Microbiol. 71, 4862–4871. Rascher, A., Hu, Z., Viswanathan, N., Schirmer, A., Reid, R., Nierman, W. C., Lewis, M., and Hutchinson, C. R. (2003). Cloning and characterization of a gene cluster for geldanamycin production in Streptomyces hygroscopicus NRRL 3602. FEMS Microbiol. Lett. 218, 223–230. Reid, R., Piagentini, M., Rodriguez, E., Ashley, G., Viswanathan, N., Carney, J., Santi, D. V., Hutchinson, C. R., and McDaniel, R. (2003). A model of structure and
DEBS Paradigm
141
catalysis for ketoreductase domains in modular polyketide synthases. Biochemistry 42, 72–79. Rowe, C. J., Bo¨hm, I. U., Thomas, I. P., Wilkinson, B., Rudd, B. A., Foster, G., Blackaby, A. P., Sidebottom, P. J., Roddis, Y., Buss, A. D., Staunton, J., and Leadlay, P. F. (2001). Engineering a polyketide with a longer chain by insertion of an extra module into the erythromycin-producing polyketide synthase. Chem. Biol. 8, 475–485. Ruan, X., Pereda, A., Stassi, D. L., Zeidner, D., Summers, R. G., Jackson, M., Shivakumar, A., Kakavas, S., Staver, M. J., Donadio, S., and Katz, L. (1997). Acyltransferase domain substitutions in erythromycin polyketide synthase yield novel erythromycin derivatives. J. Bacteriol. 179, 6416–6425. Schwecke, T., Aparicio, J. F., Molna´r, I., Ko¨nig, A., Khaw, L. E., Haydock, S. F., Oliynyk, M., Caffrey, P., Corte´s, J., Lester, J. B., Bohm, G. T., Staunton, J., et al. (1995). The biosynthetic gene cluster for the polyketide immunosuppressant rapamycin. Proc. Natl. Acad. Sci. USA 92, 7839–7843. Silakowski, B., Nordsiek, G., Kunze, B., Blo¨cker, H., and Mu¨ller, R. (2001). Novel features in a combined polyketide synthase/non-ribosomal peptide synthetase: The myxalamid biosynthetic gene cluster of the myxobacterium Stigmatella aurantiaca Sga15. Chem. Biol. 8, 59–69. Silakowski, B., Schairer, H. U., Ehret, H., Kunze, B., Weinig, S., Nordsiek, G., Brandt, P., Blo¨cker, H., Ho¨fle, G., Beyer, S., and Mu¨ller, R. (1999). New lessons for combinatorial biosynthesis from myxobacteria. The myxothiazol biosynthetic gene cluster of Stigmatella aurantiaca DW4/3-1. J. Biol. Chem. 274, 37391–37399. Simunovic, V., and Muller, R. (2007). 3-hydroxy-3-methylglutaryl-CoA-like synthases direct the formation of methyl and ethyl side groups in the biosynthesis of the antibiotic myxovirescin A. ChemBioChem 8, 497–500. Simunovic, V., Zapp, J., Rachid, S., Krug, D., Meiser, P., and Mu¨ller, R. (2006). Myxovirescin A biosynthesis is directed by hybrid polyketide synthases/nonribosomal peptide synthetase, 3-hydroxy–3-methylglutaryl-CoA synthases, and trans-acting acyltransferases. ChemBioChem 7, 1206–1220. Smith, S., and Tsai, S. C. (2007). The type I fatty acid and polyketide synthases: A tale of two megasynthases. Nat. Prod. Rep. 24, 1041–1072. Sudek, S., Lopanik, N. B., Waggoner, L. E., Hildebrand, M., Anderson, C., Liu, H., Patel, A., Sherman, D. H., and Haygood, M. G. (2007). Identification of the putative bryostatin polyketide synthase gene cluster from ‘‘Candidatus Endobugula sertula,’’ the uncultivated microbial symbiont of the marine bryozoan Bugula neritina. J. Nat. Prod. 70, 67–74. Tang, G. L., Cheng, Y. Q., and Shen, B. (2004a). Leinamycin biosynthesis revealing unprecedented architectural complexity for a hybrid polyketide synthase and nonribosomal peptide synthetase. Chem. Biol. 11, 33–45. Tang, G. L., Cheng, Y. Q., and Shen, B. (2006). Polyketide chain skipping mechanism in the biosynthesis of the hybrid nonribosomal peptide-polyketide antitumor antibiotic leinamycin in Streptomyces atroolivaceus S–140. J. Nat. Prod. 69, 387–393. Tang, G. L., Cheng, Y. Q., and Shen, B. (2007). Chain initiation in the leinamycinproducing hybrid nonribosomal peptide/polyketide synthetase from Streptomyces atroolivaceus S-140. Discrete, monofunctional adenylation enzyme and peptidyl carrier protein that directly load D-alanine. J. Biol. Chem. 282, 20273–20282. Tang, L., Shah, S., Chung, L., Carney, J., Katz, L., Khosla, C., and Julien, B. (2000). Cloning and heterologous expression of the epothilone gene cluster. Science 287, 640–642. Tang, L., Ward, S., Chung, L., Carney, J. R., Li, Y., Reid, R., and Katz, L. (2004b). Elucidating the mechanism of cis double bond formation in epothilone biosynthesis. J. Am. Chem. Soc. 126, 46–47.
142
Leonard Katz
Tatsuno, S., Arakawa, K., and Kinashi, H. (2007). Analysis of modular-iterative mixed biosynthesis of lankacidin by heterologous expression and gene fusion. J. Antibiot. (Tokyo) 60, 700–708. Theisen, M. J., Misra, I., Saadat, D., Campobasso, N., Miziorko, H. M., and Harrison, D. H.. (2004). 3-hydroxy-3-methylglutaryl-CoA synthase intermediate complex observed in ‘‘real-time.’’ Proc. Natl. Acad. Sci. USA 101, 16442–16447. Thomas, I., Martin, C. J., Wilkinson, C. J., Staunton, J., and Leadlay, P. F. (2002). Skipping in a hybrid polyketide synthase. Evidence for ACP-to-ACP chain transfer. Chem. Biol. 9, 781–787. Ward, S. L., Hu, Z., Schirmer, A., Reid, R., Revill, W. P., Reeves, C. D., Petrakovsky, O. V., Dong, S. D., and Katz, L. (2004). The chalcomycin biosynthesis gene cluster from Streptomyces bikiniensis: Novel features of an unusual ketolide through expression of the chm PKS in Streptomyces fradiae. Antimicrob. Agents Chemother. 48, 4703–4712. Weissman, K. J. (2006). The structural basis for docking in modular polyketide biosynthesis. ChemBioChem 7, 485–494. Weissman, K. J., Bycroft, M., Cutter, A. L., Hanefeld, U., Frost, E. J., Timoney, M. C., Harris, R., Handa, S., Roddis, M., Staunton, J., and Leadlay, P. F. (1998a). Evaluating precursor-directed biosynthesis towards novel erythromycins through in vitro studies on a bimodular polyketide synthase. Chem. Biol. 5, 743–754. Weissman, K. J., Bycroft, M., Staunton, J., and Leadlay, P. F. (1998b). Origin of starter units for erythromycin biosynthesis. Biochemistry 37, 11012–11017. Weissman, K. J., Hong, H., Oliynyk, M., Siskos, A. P., and Leadlay, P. F. (2004). Identification of a phosphopantetheinyl transferase for erythromycin biosynthesis in Saccharopolyspora erythraea. ChemBioChem 5, 116–125. Weissman, K. J., Timoney, M., Bycroft, M., Grice, P., Hanefeld, U., Staunton, J., and Leadlay, P. F. (1997). The molecular basis of Celmer’s rules: The stereochemistry of the condensation step in chain extension on the erythromycin polyketide synthase. Biochemistry 36, 13849–13855. Wilkinson, C. J., Frost, E. J., Staunton, J., and Leadlay, P. F. (2001). Chain initiation on the soraphen-producing modular polyketide synthase from Sorangium cellulosum. Chem. Biol. 8, 1197–1208. Witkowski, A., Joshi, A. K., Lindqvist, Y., and Smith, S. (1999). Conversion of a betaketoacyl synthase to a malonyl decarboxylase by replacement of the active-site cysteine with glutamine. Biochemistry 38, 11643–11650. Wu, J., Hothersall, J., Mazzetti, C., O’Connell, Y., Shields, J. A., Rahman, A. S., Cox, R. J., Crosby, J., Simpson, T. J., Thomas, C. M., and Willis, C. L. (2008). In vivo mutational analysis of the mupirocin gene cluster reveals labile points in the biosynthetic pathway: The ‘‘leaky hosepipe’’ mechanism. ChemBioChem 9, 1500–1508. Wu, K., Chung, L., Revill, W. P., Katz, L., and Reeves, C. D. (2000). The FK520 gene cluster of Streptomyces hygroscopicus var. ascomyceticus (ATCC 14891) contains genes for biosynthesis of unusual polyketide extender units. Gene 251, 81–90. Xue, Y., Zhao, L., Liu, H. W., and Sherman, D. H. (1998). A gene cluster for macrolide antibiotic biosynthesis in Streptomyces venezuelae: Architecture of metabolic diversity. Proc. Natl. Acad. Sci. USA 95, 12111–12116. Yu, T. W., Bai, L., Clade, D., Hoffmann, D., Toelzer, S., Trinh, K. Q., Xu, J., Moss, S. J., Leistner, E., and Floss, H. G. (2002). The biosynthetic gene cluster of the maytansinoid antitumor agent ansamitocin from Actinosynnema pretiosum. Proc. Natl. Acad. Sci. USA 99, 7968–7973.
C H A P T E R
S E V E N
Formation and Characterization of Acyl Carrier Protein–Linked Polyketide Synthase Extender Units Yolande A. Chan and Michael G. Thomas Contents 144 147 147 147 148
1. Introduction 2. Overproduction and Purification of Recombinant Proteins 2.1. Principle 2.2. Materials 2.3. Heterologous overproduction of proteins 2.4. Purification of enzymes using batch-binding method with Nickel-NTA resin 3. Formation and Characterization of Hydroxymalonyl-ACP and Aminomalonyl-ACP 3.1. In vitro phosphopantetheinylation of the ACPs ZmaD and ZmaH 3.2. HPLC-based characterization of modified ACPs 3.3. Formation of (2R)-hydroxymalonyl-ACP 3.4. Formation of (2S)-aminomalonyl-ACP 3.5. MALDI-TOF MS analysis of ACPs 3.6. Other methods for characterizing enzymes involved in (2S)-aminomalonyl-ACP formation 3.7. Other methods for characterizing enzymes involved in (2R)-hydroxymalonyl-ACP formation References
149 151 151 152 154 157 158 160 161 161
Abstract Polyketide natural products are assembled by the condensation of an initiating precursor, or starter unit, with a series of additional precursors referred to as extender units. While there are a number of polyketide synthase starter units, there are currently only seven known polyketide synthase extender units. Polyketide synthase extender units thioesterified to coenzyme A have been
Department of Bacteriology, University of Wisconsin-Madison, Madison, Wisconsin, USA Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04607-2
#
2009 Elsevier Inc. All rights reserved.
143
144
Yolande A. Chan and Michael G. Thomas
known for some time; however, polyketide synthase extender units thioesterified to acyl carrier proteins (ACPs) have been identified only recently. Two of them, (2R)-hydroxymalonyl-ACP and (2S)-aminomalonyl-ACP, are found in the biosynthetic pathway of the antibiotic zwittermicin A in Bacillus cereus UW85. The focus of this chapter is the in vitro formation of (2R)-hydroxymalonyl-ACP and (2S)-aminomalonyl-ACP and the characterization of these extender units using high performance liquid chromatography and matrix-assisted laser desorption ionization time-of-flight mass spectrometry.
1. Introduction Polyketide synthases (PKSs) elongate the backbone of a polyketide using extender units, thioesterified carboxylic acid precursors covalently bound to either coenzyme A (CoA) or the 4’-phosphopantetheinyl (4’-Ppant) groups of holo-acyl carrier proteins (ACPs) (Chan et al., 2009). Those precursors bound to CoA are known as CoA-linked PKS extender units and include malonyl-CoA, (2S)-methylmalonyl-CoA, (2S)-ethylmalonyl-CoA, and the newly discovered chloroethylmalonyl-CoA. The ACP-linked PKS extender units include (2R)-methoxymalonyl-ACP, (2R)-hydroxymalonyl-ACP, and (2S)-aminomalonyl-ACP, which elongate a polyketide with methoxyacetyl, glycolyl, or glycyl units, respectively. The ACP-linked PKS extender units are attractive as potential tools for combinatorial biosynthesis because the substituents on the a-carbons (methoxy, hydroxyl, and amino groups) confer functionalities and hydrogenbonding potential not available through the use of any of the currently known CoA-linked extender units. The ‘‘unnatural’’ natural products generated through the heterologous introduction of these extender units may have enhanced biological or therapeutic activities; furthermore, the introduction of amino or hydroxyl groups could provide chemically reactive handles that could facilitate downstream semisynthetic chemical modifications to generate even more structural derivatives. An important first step towards the generation of new bioactive molecules using combinatorial biosynthesis is to understand how these ACP-linked PKS extender units are biosynthesized and incorporated. The biosynthesis of ACP-linked PKS extender units is also of great interest because of their occurrence in the biosynthetic pathways of some natural products with important biological and pharmacological activities. The first ACP-linked PKS extender unit to be proposed, (2R)-methoxymalonyl-ACP, is a precursor to a number of methoxyacetyl-containing polyketides, including FK520 (an immunosuppressant), ansamitocin (an anticancer agent), and soraphen (an antifungal) (Ligon et al., 2002; Wu et al., 2000; Yu et al., 2002). Labeling studies and extensive genetic
ACP–Linked Extender Units
145
investigations with a number of methoxyacetyl-containing polyketides have resulted in the identification of a set of five genes encoding enzymes involved in the biosynthesis of (2R)-methoxymalonyl-ACP (Byrne et al., 1993; Carroll et al., 2002; Kato et al., 2002; Reeves et al., 2002; Schuhmann et al., 2007; Wu et al., 2000). In FK520 biosynthesis, the enzyme FkbH is proposed to dephosphorylate and covalently tether the glycolytic substrate 1,3-bisphosphoglycerate (1,3-bPG) to the 4’-Ppant group of an ACP, forming glyceryl-FkbJ. Next, two enzymes FkbK (NADþ-dependent) and FkbI (FAD-dependent) catalyze the oxidation of glyceryl-FkbJ to the intermediate (2R)-hydroxymalonyl-FkbJ. The methyltransferase (MT) FkbG then catalyzes the O-methylation of (2R)-hydroxymalonyl-FkbJ to form (2R)-methoxymalonyl-FkbJ (Fig. 7.1A) (Wu et al., 2002). In soraphen biosynthesis, the proposal for (2R)-methoxymalonyl-ACP formation is slightly different due to the absence of an FkbH homolog (Ligon et al., 2002). SorC encodes a three-domain enzyme with an acyltransferase (AT), ACP, and MT domain. The AT domain is proposed to dephosphorylate and covalently tether 1,3-bPG to the ACP domain, forming glyceryl-SorC. This intermediate is oxidized by SorD and SorE to form (2R)-hydroxymalonyl-SorC, which is then methylated by the MT domain of SorC to form (2R)-methoxymalonyl-SorC (Fig. 7.1B). Alternatively, Floss and colleagues propose that the O-methylation of glyceryl-ACP occurs prior to the oxidation steps in the biosynthesis of soraphen and other methoxyacetylcontaining polyketides (Wenzel et al., 2006). Their proposal that methylation precedes oxidation is based on the occurrence of the MT domain adjacent to the ACP domain of SorC. Additional work is needed to determine the order of these events. To date, (2R)-methoxymalonylACP has not been reconstituted in vitro, although it has been generated in vivo in a heterologous system (Rude and Khosla, 2006). While (2R)-methoxymalonyl-ACP is a precursor in the biosynthesis of number of polyketides, the occurrences of (2R)-hydroxymalonyl-ACP and (2S)-aminomalonyl-ACP have been more limited. These precursors occur in the biosynthesis of the antibiotic zwittermicin A and may occur in the biosynthesis of some other polyketides (Chan et al., 2009; Walton et al., 2006; Wu et al., 2000). For example, based on labeling studies, (2R)hydroxymalonyl-ACP is a likely precursor in the biosynthesis of aflastatin A, an inhibitor of aflatoxin production (Ono et al., 1998). Future studies may also reveal its occurrence in the biosynthesis of other polyketides, such as amicoumacin B (Gebhardt et al., 2002) and galantin (Shoji et al., 1975). (2R)-hydroxymalonyl-ACP and (2S)-aminomalonyl-ACP have been reconstituted in vitro using heterologously overproduced zwittermicin A enzymes (Chan et al., 2006). We have shown that (2R)-hydroxymalonylACP formation proceeds in the following way: the substrate 1,3-bPG is dephosphorylated and covalently tethered to the 4’-Ppant group of holoZmaD, forming glyceryl-ZmaD, which is subsequently oxidized by ZmaG and ZmaE to form the final product, (2R)-hydroxymalonyl-ZmaD
146
Yolande A. Chan and Michael G. Thomas
A
O–
O P
O
O
SH H
–
FkbJ
OH
HO
S O
P
2P
–
O
O S
NAD+ NADH + H+
O
HO
FkbK
O
O –O
–O O
HO
FkbH
O
–O O
HO
Fkbl FAD
FkbG
O S
FADH
SAM
2
O O S
SAHC
i
FkbJ
FkbJ
FkbJ
FkbJ
1, 3-bisphosphoglycerate
B
O–
O P
H
O–
O HO
P
–O
O
NAD+ NADH + H+
S
S
FAD
O O
O S
FADH2
SAM
SAHC
S
AT ACP MT
AT ACP MT
AT ACP MT
AT ACP MT
SorC
SorC
SorC
SorC
O– 1, 3-bisphosphoglycerate
C
SorC
SorE
2Pi
O
O
HO
SorD
O
O O
O
HO
HO
–O
–O O
OH
SorC
SH O–
O P O
H ZmaD
OH
–
O
S 2Pi
O –O
O S
NAD+ NADH + H+
ZmaD
O
P
HO
ZmaG
O
O
O
HO
ZmaN
HO
–O O
HO
ZmaE FAD
O S
FADH2
ZmaD
ZmaD
–
O 1, 3-bisphosphoglycerate
SH
D
H HO ZmaJ
H2N O
O
H2N
S OH L-serine
ATP
AMP + PP
i
ZmaH
–O O
OH
ZmaH
ZmaG NAD+ NADH + H+
H2N O S ZmaH
O H2N
Zmal FAD
O FADH2
S ZmaH
Figure 7.1 (A) Proposed biosynthetic pathway for (2R)-methoxymalonyl-ACP formation in FK520 biosynthesis; (B) Proposed biosynthetic pathway for (2R)-methoxymalonyl-ACP formation in soraphen biosynthesis; (C) Biosynthetic pathway for (2R)-hydroxymalonyl-ACP formation in zwittermicin A biosynthesis; (D) Biosynthetic pathway for (2S)-aminomalonyl-ACP formation in zwittermicin A biosynthesis. SAM, S-adenosylmethionine; SAHC, S-adenosylhomocysteine.The enzymes involved in each pathway are described in the text.
(Fig. 7.1C). In our studies of (2S)-aminomalonyl-ACP formation, we have shown that the adenylation domain, ZmaJ, activates and covalently tethers L-serine to the 4’-Ppant group of holo-ZmaH to form seryl-ZmaH. ZmaG and ZmaI then oxidize seryl-ZmaH to form (2S)-aminomalonylZmaH (Fig. 7.1D). In this chapter we describe the in vitro reconstitution of (2R)-hydroxymalonyl-ACP and (2S)-aminomalonyl-ACP using heterologously purified enzymes from zwittermicin A biosynthesis and the characterization of these precursors using high performance liquid chromatography (HPLC) and matrix-assisted laser desorption time-of-flight mass spectrometry (MALDI-TOF MS).
ACP–Linked Extender Units
147
2. Overproduction and Purification of Recombinant Proteins 2.1. Principle Heterologous overproduction in Escherichia coli of the zwittermicin A biosynthetic enzymes yields soluble and functional proteins, facilitating the in vitro reconstitution of (2R)-hydroxymalonyl-ZmaD and (2S)-aminomalonyl-ZmaH. The use of constructs with N-terminal hexa-histidine tags allows the biosynthetic enzymes to be purified readily in high yield and with high purity using affinity chromatography with a nickel-based resin. The hexa-histidine tag of the protein-of-interest binds to the nickel resin, and the protein is eluted with increasing concentrations of imidazole, which has a higher affinity for the nickel resin. Here we describe the procedures for overproducing and purifying the enzymes required for forming (2R)-hydroxymalonyl-ZmaD and (2S)-aminomalonyl-ZmaH: ZmaD, ZmaE, ZmaG, ZmaN, ZmaH, ZmaI, and ZmaJ.
2.2. Materials Competent cells of E. coli strain BL21 (lDE3) in 100 ml aliquots, stored at –80 . Plasmid preparations of overexpression constructs for each of the biosynthetic genes: pET28b-zmaD, -zmaE, -zmaG, -zmaH, -zmaI, -zmaJ, and -zmaN (kanamycin-resistant) Plasmid preparations of an overexpression construct for Bacillus subtilis phosphopantetheinyl transferase: pET29-sfp (kanamycin-resistant) (Quadri et al., 1998) Kanamycin: 50 mg/ml, filter-sterilized with 0.2 mm filter Lysogeny broth (LB) medium: Autoclave a mixture containing 10 g tryptone, 5 g yeast extract, and 10 g NaCl per 1 l distilled H2O (dH2O) Lysogeny broth (LB) kanamycin agar: Prepare as described for LB medium, but add 15 g agar per 1 l dH2O. After autoclaving, cool to 65 and add kanamycin to 50 mg/ml. Pour 25 ml per plate Isopropyl-b-D-thiogalactopyranoside (IPTG): 0.1 M filter-sterilized with 0.2 mm filter Tris(hydroxymethyl)aminomethane (Tris) NaCl Glycerol His-tag purification buffer, prepared freshly: Using double-distilled H2O (ddH2O), prepare 300 ml of 20 mM Tris, 300 mM NaCl, 10% (v/v) glycerol, titrated to pH 8.0 with concentrated HCl
148
Yolande A. Chan and Michael G. Thomas
Nickel-nitroloacetic acid (Ni-NTA) agarose resin, a 1:1 slurry of resin and 20% ethanol (Qiagen, Valencia, CA) Imidazole: Using ddH2O, prepare 250 ml of a 2-M solution and filtersterilize using a Nalgene (Rochester, NY) filtration bottle. Protect solution from light by covering bottle in foil. Store at 4 2 Cracking buffer: Prepare 10 ml by adding the following: 1.2 ml 0.5 M Tris pH 6.8, 100 ml b-mercaptoethanol, 500 ml of 20% Sodium dodecyl sulfate (SDS) solution, 2.5 ml of 50% glycerol solution, 250 ml of 0.4% bromothymol blue solution, and 5.45 mL ddH2O Tris-Cl polyacrylamide gel (12% resolving gel, 5% stacking gel) with 10 30 ml wells 5 SDS-polyacrylamide gel electrophoresis (PAGE) running buffer: Dissolve 72 g glycine, 15 g Tris base, 5 g SDS in 1 l dH2O, pH 8.3 1 SDS-PAGE running buffer: Using dH2O, mix 200 ml of 5 SDSPAGE running buffer in a final volume of 1 l Broad-range protein molecular weight standard (Bio-Rad, Hercules, CA) 0.1% (w/v) Coomassie R-250 stain solution: Prepare by dissolving 1 g Coomassie R-250 in a 1-l solution containing 50% methanol and 10% acetic acid Destain solution: Prepare 1 l solution containing 45% methanol and 10% acetic acid Dialysis buffer for all proteins except ZmaG, prepared freshly: Using ddH2O, prepare 2 1 l (for each protein) consisting of 50 mM Tris, 100 mM NaCl, 10% (v/v) glycerol, titrated to pH 8.0 with concentrated HCl Dialysis buffer for ZmaG, prepared freshly: Prepare the same way as above dialysis buffer, but substitute 10% sucrose (w/v) for glycerol Snakeskin Pleated Dialysis Tubing (Pierce, Rockford, IL): 3000-Da molecular weight cut-off (MWCO) and 10,000-Da MWCO Dialysis clips and foam float Millipore Centriprep protein concentrators: YM-10 and YM-30 (10,000and 30,000-Da MWCO) Liquid nitrogen: Obtain 200 ml just before use
2.3. Heterologous overproduction of proteins 2.3.1. Procedure For optimal overproduction of the histidine-tagged proteins, each expression construct is freshly introduced by transformation into competent E. coli BL21 (lDE3) for heterologous overexpression. A microcentrifuge tube containing 100 ml of competent E. coli BL21 (lDE3) is thawed on ice and transferred to a sterile prechilled glass tube. Plasmid DNA (50 to 250 ng) is added to the competent cells, and the tube is incubated on ice. After 30 min, the cells are heat-shocked in a 42 water bath for 60 seconds, iced for 60 seconds, and 800 ml of fresh LB medium is added to the tube.
ACP–Linked Extender Units
149
The cells are allowed to recover for 50 min, growing in a 37 incubator shaker. Following recovery, 50 to 100 ml of the cells is plated to LB kanamycin agar, and the plate is incubated at 37 for 16 to 18 h. An average-sized colony is used to inoculate 50 ml of LB kanamycin (50 mg/ml) broth in a shake flask, which is incubated 16 to 18 h on a 37 shaker. LB kanamycin (50 mg/ml) broth (3 1 l, in 2.8-l shake flasks) is inoculated with 10 ml of the overnight culture and grown at 25 and 180 rpm. When OD600 reaches 0.4 to 0.6, the temperature is dropped to 15 for 2 h, after which the cells are induced by the addition of IPTG at a final concentration of 60 mM. The cells are grown an additional 16 to 18 h at 15 , 180 rpm. Cells are harvested by centrifugation at 7000 rpm (Beckman Model J2-21 centrifuge, KA-9 Kompspin rotor) at 4 , for 10 min. The cell pellets are transferred to tared 50-ml polypropylene tubes, and the wet weight of the cells is determined. Cell pellets can be used immediately or can be stored at –20 for 1 to 2 weeks, if necessary. If they are used at a later date, the frozen cells should be thawed on ice prior to proceeding with the purification.
2.4. Purification of enzymes using batch-binding method with Nickel-NTA resin 2.4.1. Procedure All materials involved in the purification steps, including tubes, buffers, cells, cell extracts, and Ni-NTA resin, should be kept at 4 C or on ice. The 5 and 1 SDS-PAGE running buffers, 0.1% Coomassie-blue stain solution, and Destain solution may be kept at 22 . Cell pellets are resuspended in a volume (in ml) of his-tag purification buffer that is three times the wet weight (in grams). Cells should be resuspended gently, without vortexing. Cells are lysed with two passages through a French pressure cell set at 1200 psi. Alternatively, cells may be lysed by sonication (Fisher 550 Sonic Dismembrator, power ¼ 5, 15 min sonication with 1 s on, 1 s off ). The lysed cells are centrifuged at 15,000 rpm (Beckman Model J221 centrifuge, JA-25.5 rotor), 4 , for 30 min. During centrifugation, the Ni-NTA agarose resin is prepared. One ml of the resuspended resin slurry is pipetted into each of two 50-ml polypropylene tubes. The 20% ethanol in which the resin is stored is washed away by adding 40 ml cold ddH2O to each of the resin-containing tubes and centrifuging at 2000 rpm (Beckman AllegraTM 6R centrifuge), 4 , for 5 min. The supernatant is carefully discarded by decanting or pipetting, and 40 ml cold his-tag buffer is added to the resin before centrifuging at 2000 rpm (Beckman AllegraTM 6R centrifuge), 4 , for 5 min. The resin should not be allowed to dry out at any time. Following centrifugation, the tubes containing resin with buffer are placed on ice. When the centrifugation of the cell-free extract is complete, the clarified cell-free extract is carefully decanted or pipetted into prechilled polypropylene tubes, and imidazole is
150
Yolande A. Chan and Michael G. Thomas
added to a final concentration of 5 mM. The his-tag buffer in the resincontaining tubes can then be removed and discarded, and the cell-free extract is added to the resin. The lids of the tubes are securely closed, and the tubes are placed flat in an ice bucket, which is then put on a flat-top shaker set at the lowest setting to gently agitate for 1 to 2 h. Next, the tubes are centrifuged at 2000 rpm (Beckman AllegraTM 6R centrifuge), 4 , for 5 min to pellet the resin, and the supernatant is carefully pipetted off. Immediately, using a small volume of his-tag buffer (5 mM imidazole) and a glass Pasteur pipette, the resin is gently transferred to a 25-ml column equipped with a stopcock. During the transfer, the stopcock should be closed. After the beads have settled, the stopcock is opened to drain the buffer until a small amount remains above the resin bed. The resin is then washed with 10 ml of histag buffer containing 5 mM imidazole, and the protein is eluted with a stepwise gradient of 5 ml of his-tag buffer containing increasing concentrations of imidazole (20, 40, 60, 100, and 250 mM ). Each fraction is collected into clean glass tubes on ice. ZmaE and ZmaI, the acyl-ACP dehydrogenases, purify with their FAD cofactors, resulting in vibrant yellow fractions. To determine which elutions contain purified protein, SDS-PAGE followed by Coomassie-blue straining of the gel is performed. Aliquots (10 ml) from each fraction are added to microcentrifuge tubes containing 10 ml of 2 cracking buffer. The samples are boiled at 100 for 5 min, cooled to 22 , and centrifuged briefly to remove the condensation from the lids of the tubes. A Tris-Cl polyacrylamide gel is run with 10 ml of each sample and 5 ml of the protein molecular weight standard. The gel is run at 150 V for 1 h, placed in a glass dish with a tight-fitting lid, stained with 0.1% Coomassie R-250 stain solution for 15 min, rinsed in ddH20, and destained in 50 ml of destain solution. The destain solution can be changed to fresh solution to continue destaining, if necessary. Based on observations from the gel, fractions containing purified protein are pooled and dialyzed in Snakeskin pleated dialysis tubing. All enzymes are dialyzed in 10,000-Da MWCO dialysis tubing, except for ZmaD and ZmaH, which should be dialyzed in 3000-Da MWCO tubing. To set up the dialysis, the tubing is cut to an appropriate size to contain the pooled fractions, prewet with the appropriate dialysis buffer, and closed at one end with the use of a dialysis clip. The protein is then carefully transferred to the tubing, and the second dialysis clip is fastened securely to seal the tubing. The foam float is affixed to one of the clips, and the dialysis assembly is placed in the dialysis buffer. It should be noted that the dialysis buffer for ZmaG should contain sucrose instead of glycerol, to minimize any potential inhibition of enzymatic activity by glycerol. With gentle stirring, dialysis should occur at 4 for 4 to 16 h, followed by an additional 4 h in fresh dialysis buffer. During dialysis, ZmaE and ZmaI retain their cofactors and remain yellow. Following dialysis, the protein is concentrated using Millipore Centriprep YM-10 or YM-30 protein concentrators, following the manufacturer’s instructions. Proteins
151
ACP–Linked Extender Units
kDa 200 100
ZmaD
ZmaE ZmaG ZmaH
Zmal ZmaJ
ZmaN
75 50 37 25 20 10
Figure 7.2 Analysis of purified proteins by SDS-PAGE (12%) followed by Coomassieblue staining. The following amounts of protein were loaded: 15 mg ZmaD, 4 mg ZmaE, 4 mg ZmaG,15 mg ZmaH,4 mg ZmaI, 3 mg ZmaJ, and 4 mg ZmaN.
are concentrated to about 1 mg/ml, and protein concentrations are determined from absorbances at 280 nm and the calculated molar extinction coefficients (ZmaD, 2,560 M–1cm–1; ZmaE, 44,410 M–1cm–1; ZmaG, 21,180 M–1cm–1; ZmaH, 2,560 M–1cm–1; ZmaI, 44,770 M–1cm–1; ZmaJ, 46,760 M–1cm–1; and ZmaN, 41,070 M–1cm–1). As soon as possible, the protein should be flash-frozen by pipetting the protein, drop by drop, into a Dewer containing about 200 ml of liquid nitrogen. The frozen protein pellets can then be transferred to cryotubes that have been cooled in dry ice. Protein is stored stably at –80 until further use. Per liter of culture, this procedure results in approximately 2 to 6 mg of ZmaE, ZmaG, ZmaI, ZmaJ, and ZmaN and approximately 6 to 8 mg of ZmaD and ZmaH (Fig. 7.2). We note that the same purification procedure can be followed to purify histidine-tagged Sfp.
3. Formation and Characterization of Hydroxymalonyl-ACP and Aminomalonyl-ACP 3.1. In vitro phosphopantetheinylation of the ACPs ZmaD and ZmaH 3.1.1. Principle As purified from E. coli as described above, the majority of ZmaD and ZmaH is in the inactive apo-form. Enzymes responsible for catalyzing the conversion from the apo- to holo-forms are known as phosphopantetheinyl transferases (PPTases), which transfer the 4’-Ppant group from CoA to a conserved serine residue of an ACP (Lambalot et al., 1996). One such
152
Yolande A. Chan and Michael G. Thomas
PPTase from B. subtilis is Sfp, which has been shown to act on a wide range of ACPs (Quadri et al., 1998). While phosphopantetheinylation is sometimes performed in vivo by coexpressing an ACP-overexpression construct and a PPTase-overexpression construct (Gokhale et al., 1999), we have found that this method has resulted in a significant proportion of inactive ACPs, presumably due to failed and/or improper phosphopantetheinylation. We have found that performing in vitro phosphopantetheinylation by incubating purified Sfp with the ACP of interest results in nearly complete conversion from the apo- to the holo-form, as determined by the HPLCbased procedure described later. The conversion of apo- to holo-ACPs using E. coli ACP synthase has been described previously; here we present a modified protocol for preparing holo-ZmaD and holo-ZmaH (Lambalot and Walsh, 1997). 3.1.2. Materials Tris buffer: 0.75 M, pH 7.5 MgCl2: 0.2 M Tris(2-carboxyethylphosphine) TCEP: 50 mM, pH 7.5 Coenzyme A (CoA): 20 mM and 2 mM apo-ZmaD, apo-ZmaH, and Sfp: As purified in the above procedure. 3.1.3. Procedure In a final volume of 200 ml, the reaction mixture for making holo-ZmaD contains 75 mM Tris pH 7.5, 10 mM MgCl2, 1 mM TCEP, 500 mM CoA, 12.5 mM ZmaD, and 1 mM Sfp. The reaction mixture for making holoZmaH contains 75 mM Tris pH 7.5, 10 mM MgCl2, 1 mM TCEP, 50 mM CoA, 12.5 mM ZmaH, and 1 mM Sfp. The reactions are carried out in 1.5-ml microcentrifuge tubes and incubated at 22 for 1 h to ensure maximal conversion. It should be noted that the apo- to holo-conversion for ZmaD proceeds less readily than that for ZmaH; thus, the reaction with ZmaD requires a higher concentration of CoA. A high amount of the ACP relative to Sfp (or other catalytic enzymes) is necessary because the ACP does not function catalytically in the reactions; rather, the ACP is the substrate and the modified ACP is the product, and sufficient quantities of ACP are required for detection.
3.2. HPLC-based characterization of modified ACPs 3.2.1. Principle Reverse-phase HPLC with a C18 peptide column is used to monitor the elution of peptides and proteins, based on their absorbance at 220 nm. We describe a method to detect the modifications of an ACP (i.e., apo- to holo- conversion) based on the different elution times of the ACP species from the HPLC column.
ACP–Linked Extender Units
153
3.2.2. Materials ACP-containing reaction mixtures to analyze (i.e., apo- and holo-ACP reactions) Analytical C18 peptide (mass spec) HPLC column, 4.6 250 mm, 5 mm ˚ , (catalog #218MS54, Vydac) and associated guard particle size, 300 A column (catalog #218GD54, Vydac) HPLC Solvent A: Filter 1 l ddH2O with 0.5 mm filter. Add trifluoroacetic acid (TFA) to a final concentration of 0.1% (vol/vol). HPLC Solvent B: Prepare 500 ml of HPLC-grade acetonitrile (ACN), 0.1% TFA (vol/vol) CO2(s)/ethanol bath: Prepare by adding 95% ethanol to crushed CO2(s) in a Styrofoam container 3.2.3. Procedure Samples to be analyzed are prepared. These may include samples prepared as described above for the in vitro phosphopantetheinylation of ZmaD and ZmaH; they may also include samples prepared according to the procedures described below for forming (2R)-hydroxymalonyl-ZmaD and (2S)aminomalonyl-ZmaH. Samples should contain relatively low glycerol concentrations, as glycerol can negatively affect peak resolution. Therefore, the enzyme preparations (in glycerol-containing buffers) should be at sufficiently high concentrations to minimize the amount of glycerol added to the reactions by the addition of enzymes. A sample (100 to 260 ml) is injected onto the column, which has been equilibrated first with a mixture of 80% solvent A/20% solvent B at a flow rate of 1 ml/min. The following program is used, with the flow rate set at 1 ml/min: 5 min at 80% A/20% B; 20 min linear gradient from 80% A/20% B to 20% A/80% B; 10 min isocratic at 20% A/80% B; 1 min linear gradient from 20% A/80% B to 80% A/20% B; 10 min isocratic at 80% A/20% B. The absorbance at 220 nm is monitored, with peaks corresponding to the elution of proteins. The peak corresponding to the ACP of interest may be collected in colorless microcentrifuge tubes (to minimize the potential for ‘‘extractables’’ by ACN), flash frozen in a CO2(s)/ethanol bath, and stored at –80 for further analysis (see below for MALDI-TOF MS analysis procedure). Figure 7.3 shows HPLC traces for apo- and holo-ZmaD, as well as apoand holo-ZmaH. The addition of 4’-Ppant prosthetic groups to the apo-ACPs results in shorter elution times for both holo-ACPs. The percent conversion from the apo- to holo-forms can be determined by calculating the area under the peaks. This method also enables one to determine how much holo-ACP has converted to an acylated or other form.
154
Yolande A. Chan and Michael G. Thomas
A Apo-ZmaD
Holo-ZmaD
S
16
18
20 Min
B
22
24
Apo-ZmaH
Holo-ZmaH
S
14
16
18
20
22
Min
Figure 7.3 HPLC analysis of (A) apo- and holo-ZmaD and (B) apo- and holo-ZmaH. S denotes Bacillus subtilis Sfp.
3.3. Formation of (2R)-hydroxymalonyl-ACP 3.3.1. Principle (2R)-Hydroxymalonyl-ZmaD formation is reconstituted in vitro, using 1,3bPG and the enzymes ZmaD, ZmaN, ZmaG, and ZmaE (Fig. 7.1C). The omission of ZmaG and ZmE from the reaction mixture results in the formation of glyceryl-ZmaD, a precursor to (2R)-hydroxymalonyl-ZmaD.
155
ACP–Linked Extender Units
The glycolytic substrate 1,3-bPG is not commercially available and therefore must be prepared enzymatically using available materials. 3.3.2. Materials Tris buffer: 0.75 M, pH 7.5 MgCl2: 0.2 M TCEP: 50 mM, pH 7.5 Coenzyme A (CoA): 20 mM (apo-)ZmaD, Sfp, ZmaN, ZmaG, ZmaE: As purified in the above procedure. NADþ: 13 mM FAD: 6.5 mM 3-Phosphoglycerate phosphokinase (3-PGPK): 0.5 U/ml D(-)3-Phosphoglycerate (3-PG): 10 mM Adenosine triphosphate (ATP): Freshly prepare 0.2 M solution. Titrate to pH 7 with 5 N NaOH. Potassium phosphate: 10 mM, pH 7.5 DL-Glyceraldehyde-3-phosphate (G3P): 25 mM Glyceraldehyde-3-phosphate dehydrogenase (GAPDH): 0.5 U/ml 3.3.3. Procedure The glycolytic substrate 1,3-bPG can be prepared using a couple of different methods (Fig. 7.4). The first method involves the ATP-dependent phosphorylation of 3-PG by 3-PGPK to form 1,3-bPG. The second method involves the NADþ-dependent oxidation and phosphorylation of G3P A –O
O –
O
O
O–
P
O
ATP
ADP
O 3-PGPK
OH 3-phosphoglycerate B
–O
O
O
P
–O
O O
O
P
O– O–
P O
–O
OH
1,3-bisphosphoglycerate
O– O
OH Glyceraldehyde-3-phosphate
O NAD+ + Pi NADH + H –O GAPDH
–O
O O P
O
P
O– O–
O OH
1,3-bisphosphoglycerate
Figure 7.4 Formation of 1,3-bisPG (A) from 3-PG by the action of 3-PGPK and (B) from G3P by the action of GAPDH.
156
Yolande A. Chan and Michael G. Thomas
to form 1,3-bPG. The enzymes and the substrates required for these conversions are available through Sigma-Aldrich (St. Louis, MO). To make (2R)-hydroxymalonyl-ZmaD using 3-PG and 3-PGPK as a source of 1,3-bPG, the following reaction is prepared in a final volume of 260 mL: 75 mM Tris pH 7.5, 10 mM MgCl2, 1 mM TCEP, 500 mM CoA, 12.5 mM ZmaD, 1 mM Sfp, 1 mM ZmaN, 200 mM NADþ, 100 mM FAD, 1 mM ZmaG, 1mM ZmaE, 1 U 3-PGPK, 250 mM 3-PG, and 5 mM ATP. Prior to adding ATP, the reaction is incubated at 22 for 1 h to allow for the conversion of apo- to holo-ZmaD. The complete reaction is initiated by the addition of ATP and incubated at 22 for 40 min. It is also possible to form (2R)-hydroxymalonyl-ZmaD in a slightly different way, by preforming glyceryl-ZmaD prior to the addition of ZmaG and ZmaE. In this method, a reaction to form holo-ZmaD is set up and incubated at 22 for 1 h. This reaction is in a volume of 200 ml and contains 75 mM Tris pH 7.5, 10 mM MgCl2, 1 mM TCEP, 500 mM CoA, 12.5 mM ZmaD, and 1 mM Sfp. Next, only the components involved in acylating holo-ZmaD are added (ZmaN, 3-PGPK, 3-PG, and ATP), and the reaction is incubated at 22 for 30 min. A sample of the reaction can be saved for at this point for analysis by HPLC and MALDI-TOF MS to ensure the intermediate glyceryl-ZmaD has been formed. Finally, the rest of the components are added to form (2R)-hydroxymalonyl-ZmaD (200 mM NADþ, 100 mM FAD, 1 mM ZmaG, and 1 mM ZmaE; final volume of 260 ml), and the reaction is incubated at 22 for 40 min. Our group and others have observed that commercially available 3-PG is contaminated with a trace amount of 3-PGPK (Chan et al., 2006; Dorrestein et al., 2006). A reaction containing all the above components except for added 3-PGPK results in the formation of (2R)-hydroxymalonyl-ZmaD, although this occurs at a much slower rate than when 3-PGPK is added (1.44 nmol/min with 3-PGPK, 0.08 nmol/min without 3-PGPK) (Chan et al., 2006). The second method for making 1,3-bPG bypasses this issue by utilizing commercially available G3P and GAPDH. Using this method, the following reaction mixture is set up in a final volume of 150 mL: 75 mM Tris pH 7.5, 10 mM MgCl2, 1 mM TCEP, 500 mM CoA, 12.5 mM ZmaD, 1 mM Sfp, 1 mM ZmaN, 200 mM NADþ, 100 mM FAD, 1 mM ZmaG, 1 mM ZmaE, 250 mM G3P, 250 mM potassium phosphate pH 7.5 and 1 U GAPDH. Holo-ZmaD is preformed by adding the following components and incubating the mixture at 22 for 1 h: Tris pH 7.5, MgCl2, TCEP, CoA, ZmaD, and Sfp. The rest of the components are then added to the tube, and the reaction is incubated at 22 for 40 min. It is also possible to preform glyceryl-ZmaD prior to forming (2R)-hydroxymalonylZmaD by omitting ZmaG, ZmaE, and their cofactors. HPLC analysis of reactions containing glyceryl-ZmaD and (2R)-hydroxymalonyl-ZmaD is performed, as described in the preceding section. As shown in Fig. 7.5, there is a shift in the elution time of glyceryl-ZmaD
157
ACP–Linked Extender Units
A
S
B
S N C E
S
G
N 16
18
20 Min
22
24
Figure 7.5 HPLC analysis of reaction mixtures containing (A) apo-ZmaD and Sfp; (B) apo-ZmaD, Sfp, and ZmaN; (C) apo-ZmaD, Sfp, ZmaN, ZmaG, and ZmaE. The arrows identify the peaks associated with the ZmaD derivatives. The letters above the peaks identify the proteins in the reaction mixture. S, Sfp; N, ZmaN; E, ZmaE, G, ZmaG.
relative to holo-ZmaD. For the complete reaction, there is a slight shift in the elution time relative to the glyceryl-ZmaD reaction. As discussed in a later section, these samples are analyzed further by MALDI-TOF MS.
3.4. Formation of (2S)-aminomalonyl-ACP 3.4.1. Principle (2S)-Aminomalonyl-ZmaH formation can be reconstituted in vitro, using L-serine and the enzymes ZmaH, ZmaJ, ZmaG, and ZmaI (Fig. 7.1D). The omission of ZmaG and ZmaI from the reaction mixture results in the formation of seryl-ZmaH, a precursor to (2S)-aminomalonyl-ZmaH. 3.4.2. Materials Tris buffer: 0.75 M, pH 7.5 MgCl2: 0.2 M TCEP: 50 mM, pH 7.5 Coenzyme A (CoA): 2 mM (apo-)ZmaH, ZmaG, ZmaI, ZmaJ, and Sfp: As purified in the above procedure NADþ: 13 mM
158
Yolande A. Chan and Michael G. Thomas
FAD: 6.5 mM L-serine: 10 mM ATP: Freshly prepare 0.2 M solution. Titrate to pH 7 with 5 N NaOH 3.4.3. Procedure To make (2S)-aminomalonyl-ZmaH, the following reaction is prepared in a final volume of 260 mL: 75 mM Tris pH 7.5, 10 mM MgCl2, 1 mM TCEP, 50 mM CoA, 12.5 mM ZmaH, 1 mM Sfp, 1 mM ZmaJ, 200 mM NADþ, 100 mM FAD, 1 mM ZmaG, 1 mM ZmaI, 250 mM L-serine, and 5 mM ATP. To preform holo-ZmaH, all the components except ATP are added, and the reaction is incubated at 22 for 1 h. The complete reaction is initiated by the addition of ATP and incubated at 22 for 40 min. It is also possible to form (2S)-aminomalonyl-ZmaH by preforming seryl-ZmaH prior to the addition of ZmaG, ZmaI, and their cofactors. In this method, a reaction to form holo-ZmaH is set up and incubated at 22 for 1 h. This reaction is in a volume of 200 ml and contains 75 mM Tris pH 7.5, 10 mM MgCl2, 1 mM TCEP, 50 mM CoA, 12.5 mM ZmaH, and 1 mM Sfp. Next, ZmaJ, serine, and ATP are added to the tube, and the reaction is incubated at 22 for 30 min. A sample of the reaction mixture can be saved at this point for analysis of seryl-ZmaH formation by HPLC and MALDI-TOF MS. Finally, the rest of the components are added (200 mM NADþ, 100 mM FAD, 1 mM ZmaG, and 1 mM ZmaI; final volume of 260 ml), and the complete reaction is incubated at 22 for 40 min. One should note that ZmaG catalyzes the oxidation of both glycerylZmaD and seryl-ZmaH and is required for the formation of both (2R)-hydroxymalonyl-ZmaD and (2S)-aminomalonyl-ZmaH. Interestingly, the enzymes catalyzing the second oxidations, ZmaE and ZmaI, are pathway-specific. Although ZmaI can function in both pathways, ZmaE can function only in the (2R)-hydroxymalonyl-ZmaD pathway. Likewise, ZmaN and ZmaJ are also pathway-specific, as neither enzyme can acylate/ aminoacylate the noncognate ACP. HPLC analysis of the reactions containing seryl-ZmaH and (2S)-aminomalonyl-ZmaH is performed. As shown in Fig. 7.6, the reaction for serylZmaH results in a shift in elution time, relative to holo-ZmaH. When the complete reaction is analyzed by HPLC, no shift in elution time occurs; instead, a broadening of the ZmaH-associated peak is observed. The peaks corresponding to ZmaH are collected and analyzed by MALDI-TOF MS.
3.5. MALDI-TOF MS analysis of ACPs 3.5.1. Principle MALDI-TOF MS analysis of ACPs allows one to determine whether an ACP has been modified, based on a comparison of the experimental masses with the theoretical masses for the different ACP species.
159
ACP–Linked Extender Units
A
S
B
S C
J
S 14
G 16
18
20
I
J 22
Min
Figure 7.6 HPLC analysis of ZmaH-containing reactions containing (A) apo-ZmaH and Sfp; (B) apo-ZmaH, Sfp, and ZmaJ; (C) apo-ZmaH, Sfp, ZmaJ, ZmaG, and ZmaI. The arrows identify the peaks associated with the ZmaH derivatives. The letters above the peaks identify the proteins in the reaction mixture. S, Sfp; G, ZmaG; I, ZmaI; J, ZmaJ.
3.5.2. Materials HPLC-purified ACPs to analyze (keep frozen at –80 ) Proteo-MassTM Protein MALDI-MS Calibration Kit (Sigma-Aldrich): includes ACN, 0.1% TFA, sinapinic acid, protein standards 50% ACN/0.05% TFA: Prepare 600 ml in a colorless microcentrifuge tube. Sinapinic acid matrix: Prepare 10 mg/ml solution in 600 ml 50% ACN/ 0.05% TFA solution. Vortex vigorously for 1 min. Let mixture settle for 10 min at bench. Matrix preparation is stable for 1 week at 22 if stored in the dark. Sample plate for MALDI-TOF MS (Applied Biosystems) 3.5.3. Procedure Prior to MALDI-TOF MS analysis, the HPLC-purified ACP samples must be prepared by lyophilizing. The ACP-containing microcentrifuge tubes are removed from –80 , opened, and placed inside 50 ml polypropylene tubes (one to two samples per tube). A Kimwipe is placed over the top of the polypropylene tube and secured with a rubber band. The tubes are then placed inside a lyophilizing vessel and lyophilized until the ACN has evaporated, leaving a white, powdery residue (8 h). The lyophilized protein is resuspended in 6 to 20 ml ddH2O and placed on ice until further use. The manufacturer’s instructions for preparing the protein standards apomyoglobin, cytochrome C, and bovine insulin are followed. It is
160
Yolande A. Chan and Michael G. Thomas
Table 7.1 MALDI-TOF MS analysis of HPLC-purified ZmaD and ZmaH derivatives Proteina
ZmaD apo-ZmaD holo-ZmaD glyceryl-ZmaD hydroxymalonyl-ZmaD glycolyl-ZmaDb ZmaH apo-ZmaH holo-ZmaH seryl-ZmaH aminomalonyl-ZmaH glycyl-ZmaH
Theoretical [MþH]þ
Experimental [MþH]þ
12,239 12,579 12,667 12,681 12,637
12,239 12,579 12,670b ND 12,636
11,609 11,949 12,037 12,051 12,007
11,605 11,946 12,038 ND 12,007
a
The mass of ZmaD and ZmaH derivatives is calculated after removal of the first methionine. The mass of glyceryl-ZmaD when G3P and GAPDH are used to make 1,3-bPG. Note: Mass is in Daltons. ND, not detected. b
advisable to aliquot the standards into several tubes to minimize the number of freeze-thaw cycles. A mixture containing the three standards is spotted onto the sample plate (spot 1 ml and 2 ml). The samples for analysis are prepared by adding 2 ml of a sample to a colorless microcentrifuge tube containing 2 ml of sinapinic acid. Matrix and sample are mixed by pipetting, and 1 to 2 ml of each sample is spotted onto the sample plate. The plate is allowed to dry completely before inserting the plate into the instrument chamber. The manufacturer’s instructions are followed for using the mass spectrometer, with the instrument set to linear, positive-ion mode. The standards are used to calibrate the instrument. Table 7.1 shows the theoretical and experimental masses for the various ZmaD and ZmaH species. The masses for the complete reactions for both the (2R)-hydroxymalonyl-ZmaD and (2S)-aminomalonyl-ZmaH pathways are consistent with the decarboxylated products, glycolyl-ZmaD and glycyl-ZmaH, respectively. These decarboxylations may occur due to the instability of (2R)-hydroxymalonyl-ZmaD and (2S)-aminomalonyl-ZmaH under the assay conditions (Chan et al., 2006); nevertheless, masses consistent with glycolyl-ZmaD and glycyl-ZmaH are indicative of (2R)-hydroxymalonyl-ZmaD and (2S)-aminomalonyl-ZmaH formation.
3.6. Other methods for characterizing enzymes involved in (2S)-aminomalonyl-ACP formation ZmaJ, the seryl-activating adenylation domain involved in (2S)-aminomalonyl-ZmaH formation, can be characterized using standard ATP/pyrophosphate (PPi)-exchange assays (Santi et al., 1974). These assays allow one
ACP–Linked Extender Units
161
to detect the exchange of 32P-isotope from [32P]-PPi into ATP, which only occurs through the formation of an aminoacyl-enzyme intermediate. Thus, the formation of bg-[32P]-ATP in the presence of L-serine indicates that ZmaJ can activate the amino acid. Other methods for characterizing ZmaH involve the use of [14C]L-serine. To show that ZmaH is covalently modified with L-serine, standard trichloroacetic acid (TCA) precipitation assays can be performed (Gehring et al., 1997; Quadri et al., 1999). ZmaH is incubated in a reaction buffer with ZmaJ, [14C]-L-serine, and ATP; then, the proteins are precipitated with TCA and analyzed by scintillation counting. The covalent modification of ZmaH also can be detected with or without TCA precipitation using SDS-PAGE followed by phosphorimaging of the dried gel.
3.7. Other methods for characterizing enzymes involved in (2R)-hydroxymalonyl-ACP formation With a source of radiolabeled 1,3-bPG, the acylation of ZmaD during (2R)hydroxymalonyl-ZmaD formation can be characterized using TCA precipitation assays and SDS-PAGE followed by phosphorimaging. Although [14C]-1,3-bPG is not available commercially, it can be synthesized from commercially available radiolabeled precursors and enzymes. In the simplest route, [14C(U)]-G3P can be purchased from American Radiolabeled Chemicals, Inc. (St. Louis, MO) and converted to [14C]-1,3-bPG using GAPDH, as described above for the formation of (2R)-hydroxymalonylZmaD. Alternatively, [14C]-1,3-bPG can be made using [14C(U)]-D-fructose 1,6-bisphosphate, fructose 1,6-bisphosphate aldolase, GAPDH, and triose phosphate isomerase, all of which are available through SigmaAldrich. The aldolase converts [14C(U)]-D-fructose 1,6-bisphosphate to [14C]-G3P and [14C]-dihydroxyacetone phosphate, the latter of which can be converted to [14C]-G3P using triose phosphate isomerase; GAPDH converts [14C]-G3P to [14C]-1,3-bPG.
REFERENCES Byrne, K. M., Shaflee, A., Nielsen, J., Arison, B., Monaghan, R. L., and Kaplan, L. (1993). The biosynthesis and enzymology of an immunosuppressant, immunomycin, produced by Streptomyces hygroscopicus var, ascomyceticus. Dev. Ind. Microbiol. 32, 29–45. Carroll, B. J., Moss, S. J., Bai, L., Kato, Y., Toelzer, S., Yu, T. W., and Floss, H. G. (2002). Identification of a set of genes involved in the formation of the substrate for the incorporation of the unusual ‘‘glycolate’’ chain extension unit in ansamitocin biosynthesis. J. Am. Chem. Soc. 124, 4176–4177. Chan, Y. A., Boyne II, M. T., Podevels, A. M., Klimowicz, A. K., Handelsman, J., Kelleher, N. L., and Thomas, M. G. (2006). Hydroxymalonyl-acyl carrier protein
162
Yolande A. Chan and Michael G. Thomas
(ACP). and aminomalonyl-ACP are two additional type I polyketide synthase extender units. Proc. Natl. Acad. Sci. USA 103, 14349–14354. Chan, Y. A., Podevels, A. M., Kevany, B. M., and Thomas, M. G. (2009). Biosynthesis of polyketide synthase extender units. Nat. Prod. Rep. 26, 90–114. Dorrestein, P. C., Van Lanen, S. G., Li, W., Zhao, C., Deng, Z., Shen, B., and Kelleher, N. L. (2006). The bifunctional glyceryl transferase/phosphatase OzmB belonging to the HAD superfamily that diverts 1,3-bisphosphoglycerate into polyketide biosynthesis. J. Am. Chem. Soc. 128, 10386–10387. Gebhardt, K., Schimana, J., Mu¨ller, J., Fiedler, H.-P., Kallenborn, H. G., Holzenka¨mpfer, M., Krastel, P., Zeeck, A., Vater, J., Ho¨ltzel, A., Schmid, D. G., Rheinheimer, J., et al. (2002). Screening for biologically active metabolites with endosymbiotic bacilli isolated from arthropods. FEMS Microbiol. Lett. 217, 199–205. Gehring, A. M., Bradley, K. A., and Walsh, C. T. (1997). Enterobactin biosynthesis in Escherichia coli: Isochorismate lyase (EntB) is a bifunctional enzyme that is phosphopantetheinylated by EntD and then acylated by EntE using ATP and 2,3-dihydroxybenzoate. Biochemistry 36, 8495–8503. Gokhale, R. S., Tsuji, S. Y., Cane, D. E., and Khosla, C. (1999). Dissecting and exploiting intermodular communication in polyketide synthases. Science 284, 482–485. Kato, Y., Bai, L., Xue, Q., Revill, W. P., Yu, T.-W., and Floss, H. G. (2002). Functional expression of genes involved in the biosynthesis of the novel polyketide chain extension unit, methoxymalonyl-acyl carrier protein, and engineered biosynthesis of 2-desmethyl2-methoxy-6-deoxyerythronolide B. J. Am. Chem. Soc. 124, 5268–5269. Lambalot, R. H., Gehring, A. M., Flugel, R. S., Zuber, P., LaCelle, M., Marahiel, M. A., Reid, R., Khosla, C., and Walsh, C. T. (1996). A new enzyme superfamily— the phosphopantetheinyl transferases. Chem. Biol. 3, 923–936. Lambalot, R. H., and Walsh, C. T. (1997). Holo-[acyl-carrier-protein] synthase of Escherichia coli. Methods Enzymol. 279, 254–262. Ligon, J., Hill, S., Beck, J., Zirkle, R., Molna´r, I., Zawodny, J., Money, S., and Schupp, T. (2002). Characterization of the biosynthetic gene cluster for the antifungal polyketide soraphen A from Sorangium cellulosum So ce26. Gene 285, 257–267. Ono, M., Sakuda, S., Ikeda, H., Furihata, K., Nakayama, J., Suzuki, A., and Isogai, A. (1998). Structures and biosynthesis of aflastatins: Novel inhibitors of aflatoxin production by Aspergillus parasiticus. J. Antibiot. 51, 1019–1028. Quadri, L. E., Keating, T. A., Patel, H. M., and Walsh, C. T. (1999). Assembly of the Pseudomonas aeruginosa nonribosomal peptide siderophore pyochelin: In vitro reconstitution of aryl–4, 2-bisthiazoline synthetase activity from PchD, PchE, and PchF. Biochemistry 38, 14941–14954. Quadri, L. E., Weinreb, P. H., Lei, M., Nakano, M. M., Zuber, P., and Walsh, C. T. (1998). Characterization of Sfp, a Bacillus subtilis phosphopantetheinyl transferase for peptidyl carrier protein domains in peptide synthetases. Biochemistry 37, 1585–1595. Reeves, C. D., Chung, L. M., Liu, Y., Xue, Q., Carney, J. R., Revill, W. P., and Katz, L. (2002). A new substrate specificity for acyl transferase domains of the ascomycin polyketide synthase in Streptomyces hygroscopicus. J. Biol. Chem. 277, 9155–9159. Rude, M. A., and Khosla, C. (2006). Production of ansamycin polyketide precursors in Escherichia coli. J. Antibiot. 59, 464–470. Santi, D. V., Webster, R. W., Jr., and Cleland, W. W. (1974). Kinetics of aminoacyl-tRNA synthetases catalyzed ATP-PPi exchange. Methods Enzymol. 29, 620–627. Schuhmann, T., Vollmar, D., and Grond, S. (2007). Biosynthetic origin of the methoxyl extender unit in bafilomycin and concanamycin using stereospecifically labeled precursors. J. Antibiot. 60, 52–60.
ACP–Linked Extender Units
163
Shoji, J., Sakazaki, R., Wakisaka, Y., Koizumi, K., Mayama, M., and Matsuura, S. (1975). Isolation of galantins I and II, water-soluble basic peptides. Studies on antibiotics from the genus Bacillus. J. Antibiot. 28, 122–125. Walton, L. J., Corre, C., and Challis, G. L. (2006). Mechanisms for incorporation of glycerol-derived precursors into polyketide metabolites. J. Ind. Microbiol. Biotechnol. 33, 105–120. Wenzel, S. C., Williamson, R. M., Gru¨nanger, C., Xu, J., Gerth, K., Martinez, R. A., Moss, S. J., Carroll, B. J., Grond, S., Unkefer, C. J., Mu¨ller, R., and Floss, H. G. (2006). On the biosynthetic origin of methoxymalonyl-acyl carrier protein, the substrate for incorporation of ‘‘glycolate’’ units into ansamitocin and soraphen A. J. Am. Chem. Soc. 128, 14325–14336. Wu, K., Chung, L., Revill, W. P., Katz, L., and Reeves, C. D. (2000). The FK520 gene cluster of Streptomyces hygroscopicus var. ascomyceticus (ATCC14891) contains genes for biosynthesis of unusual polyketide extender units. Gene 251, 81–90. Yu, T. W., Bai, L., Clade, D., Hoffman, D., Toelzer, S., Trinh, K. Q., Xu, J., Moss, S. J., Leistner, E., and Floss, H. G. (2002). The biosynthetic gene cluster of the maytansinoid antitumor agent ansamitocin from Actinosynnema pretiosum. Proc. Natl. Acad. Sci. USA 99, 7968–7973.
C H A P T E R
E I G H T
Type I Polyketide Synthases That Require Discrete Acyltransferases Yi-Qiang Cheng,*,† Jane M. Coughlin,‡ Si-Kyu Lim,§ and Ben Shen‡,§ Contents 1. Introduction 2. Methods 2.1. Heterologous expression and overproduction of apo-ACPs from AT-less PKS modules 2.2. In vitro preparation of holo-ACPs 2.3. Heterologous expression and overproduction of discrete ATs 2.4. In vitro assay for AT substrate specificity 2.5. In vitro assay of AT-catalyzed loading of acyl CoA extender substrate to holo-ACPs 3. Conclusion Acknowledgment References
166 174 174 175 177 177 179 182 183 183
Abstract The diverse structures of polyketide natural products are reflected by the equally diverse polyketide biosynthetic enzymes, namely polyketide synthases (PKSs). Three major classes of PKSs are known—noniterative type I PKSs, iterative type II PKSs and acyl carrier protein-independent type III PKSs, each of which consists of additional variants. One such variant is the noniterative type I PKS in which each PKS module lacks the cognate acyltransferase (AT) domain. The essential AT activity is instead provided by a discrete AT in trans. Termed ‘‘AT-less’’ type I PKSs, the loading of the malonate extender units by the discrete AT enzyme LnmG to each of the AT-less PKS modules of LnmI and LnmJ was confirmed experimentally for biosynthesis of the anticancer antibiotic leinamycin (LNM). The LNM PKS has since served as a model for the continuous
* {
{ }
Department of Biological Sciences, University of Wisconsin-Milwaukee, Milwaukee, Wisconsin, USA Department of Chemistry and Biochemistry, University of Wisconsin-Milwaukee, Milwaukee, Wisconsin, USA Department of Chemistry, University of Wisconsin-Madison, Madison, Wisconsin, USA Division of Pharmaceutical Sciences, University of Wisconsin-Madison, Madison, Wisconsin, USA
Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04608-4
#
2009 Elsevier Inc. All rights reserved.
165
166
Yi-Qiang Cheng et al.
discovery of numerous additional AT-less type I PKSs incorporating variable extender units. However, biochemical characterization of AT-less type I PKSs remains very limited, and the mechanism by which AT-less type I PKSs accommodate multiple extender units is unknown. This chapter provides the protocols used to establish and characterize the LNM PKS. Application of these methods to other AT-less type I PKSs should aid the biochemical characterization and hence possible exploitation of these unique PKSs for polyketide natural product structural diversity by combinatorial biosynthetic methods.
1. Introduction Polyketides constitute one of the largest families of natural products and many are biosynthesized by noniterative type I polyketide synthases (PKSs). Type I PKSs are multifunctional enzymes organized into modules, each of which harbors a set of distinct domains responsible for the catalysis of one cycle of polyketide chain elongation. Prototypically, a type I PKS elongation module contains minimally three domains—an acyltransferase (AT), an acyl carrier protein (ACP) and a b-ketoacyl synthase (KS)—that select, activate, and catalyze a decarboxylative Claisen condensation between the extender unit and the growing polyketide chain, generating a b-ketoacyl-S-ACP intermediate. Optional domains are found between the AT and ACP domains, which carry out the variable set of reductive modifications of the b-keto group before the ensuing cycle of chain extension (Shen, 2003; Staunton and Weissman, 2001). For a prototypic type I PKS, as exemplified by the 6-deoxyerythromycin B synthase (DEBS) for biosynthesis of the aglycone of the polyketide antibacterial antibiotic erythromycin A (Donadio and Katz, 1992), an AT domain is an integral part of every PKS module, and each AT domain functions only once, for the module in which it resides. Integral AT domains in such prototypic type I PKSs were thus termed cognate ATs (Cheng et al., 2003) (Fig. 8.1A). A distinct variant of the noniterative type I PKSs contains no cognate ATs but has a short segment of remnant AT sequence in some or all modules, depending on the pathway. This subclass of type I PKSs was named the AT-less type I PKSs and the remnant AT segment the AT docking domain (Fig. 8.1B and C). The essential AT activities are provided in trans by discrete AT enzymes encoded by genes that are physically separated from the PKS genes. Therefore AT-less type I PKSs require discrete ATs acting in trans to select the extender unit and load it onto the ACP domain (Cheng et al., 2003) (Figs. 8.1C and 8.2). The AT-less class of type I PKSs was first discovered during genetic and biochemical studies of leinamycin (LNM) biosynthesis in Streptomyces atroolivaceus S-140 (Cheng et al., 2002; Cheng et al., 2003; Tang et al., 2004).
167
Type I Polyketide Synthases that Require Discrete Acyltransferases
A
B Type I PKS
AT
Discrete AT and AT docking domain 1
KR KS
C
AT-less type I PKS KR
ACP SH
KS
~110 aa
AT ACP
SH Lnml (PKS module-3)
LnmG
NH2
GHS×G
1
AFHS
CO2H ~320 aa
Figure 8.1 Modular organization of type I polyketide synthases (PKSs). (A) A prototypical type I PKS module contains the cognate ATdomain and other domains. (B) An AT-less type I PKS module lacks the cognate AT domain but often contains a short segment of remnant AT residues. (C) The remnant AT segment lacks critical catalytic motifs (GHSxG and AFHS) and is therefore catalytically inactive, but may serve as a docking domain mediating the interactions between the discrete AT (LnmG) and AT-less PKS modules in LnmI and LnmJ (Tang et al., 2004).
LNM is a hybrid peptide-polyketide natural product that shows potent antitumor activity, most significantly against tumor cell lines that are resistant to clinically important anticancer drugs (Hara et al., 1989a,b). The lnm biosynthetic gene cluster consists of multiple genes encoding modular nonribosomal peptide synthetases (NRPSs), type I PKSs, and other components. The most striking feature of LNM PKSs is the lack of cognate AT domains in all six modules of the LnmI and LnmJ PKS proteins; instead, only a segment of remnant AT sequence was found in five of the six PKS modules after each KS domain (Figs. 8.1C and 8.2). Bioinformatic and genetic analyses identified lnmG as an essential AT-encoding gene, and biochemical studies subsequently confirmed LnmG as a discrete AT enzyme capable of loading the malonyl group from the extender unit substrate malonyl CoA onto the ACP domains in all six modules of the LnmI and LnmJ PKSs. On the basis of these findings, LnmI and LnmJ were hence proposed as the first AT-less type I PKSs, LnmG as the required trans-acting, discrete AT enzyme, and the remnant AT segments as AT docking domains (Figs. 8.1 and 8.2). Numerous additional AT-less type I PKSs have since been discovered (Fig. 8.3 and Table 8.1). However, unequivocal biochemical evidence validating this emerging subclass of AT-less type I PKSs remains scarce. Noniterative type I PKSs use malonyl CoA, methylmalonyl CoA, ethylmalonyl CoA, methoxymalonyl ACP, and in rare cases, hydroxymalonyl ACP or aminomalonyl ACP, as extender units in the biosynthesis of diverse polyketide natural products (Chan et al., 2006; Khosla et al., 1999). (See also Chapter 7 of this volume.) Biochemical studies (for LnmG) and substrate specificity predictions (for all others) suggest that most, if not all, discrete ATs known for AT-less type I PKSs use malonyl CoA as a substrate (Table 8.1 and Fig. 8.4). Possible exceptions to this finding include EtnB from the etnangien biosynthetic pathway (Menche et al., 2008) and KirCII from the kirromycin biosynthetic pathway (Weber et al., 2008), which appear to
Lnml
LnmQ/P Loading (module-1)
NRPS (module-2)
A
PCP Cy
PKS (module-3) OX
Cy A
PCP
S
LnmJ PKS (module-4) DH
KR KS
S
KS
ACP KS S
O
PKS (module-6)
KR
KR KS
ACP S
O
O
CH3
PKS (module-5)
ACP KS
O
O
NH2 HS
O
?
S O
O + CoAS
TE
S O
O
O
LnmG
?
ACP
O
O
O
O
AT ACP
ACP KS
S
[SAM]
O
O
LnmJ PKS (module-8)
KS
ACP KS
SH O
H2N
PKS (module-8)
KR
MT ACP
S O
PKS (module-7)
O O
O O
TE
S O O O
O
CH3
H3C OH
H3C O
CH3 CH3
O N
N S
H
SH O
O
OH CH3 CH3
OH N
N S
S
S
O O
H LNM
S
N NH2 CH3
Figure 8.2 A model for LNM biosynthesis featuring the LNM hybrid NRPS-PKS megasynthetase with the discrete ATenzyme LnmG that loads the malonyl CoA extender units onto all six modules on the LnmI and LnmJ PKSs (Cheng et al., 2003;Tang et al., 2004).
169
Type I Polyketide Synthases that Require Discrete Acyltransferases
H N OH O
OH O Pentapeptide
O
O
O
HO
N H
O
OH
OH
O
O
O
OH O
OH O
O
Alibicidin (predicted)
O
N
O
O O O O
O O OH
H N
OH O
OH O
O
OH OH O
Chivosazol A
O
Bryostatin 1
O
Bacillaene H2O3PO
O O O
O OH H O N
O
O O
OH O
O
OH
N
O
N
OH O
O
O
O
Lactimidomycin
Pederin
O
O
O
OH O
O
O
HN
O
Difficidin
Disorazol A HN
OH
HO O
OH
O
O
O
N H
O HO
O
O
O
O
O HO
HN O OH
O
O HO
OH N
Kirromycin
O
O
O
O
O
Iso-migrastatin O
O
Rhizoxin
OH HO
O
OH
N
O
O
O OH
OH O
O
O
Mupirocin (pseudomonic acid A)
N H
OH O CCl3
O
O
O N
HO
OH
O
Oxazolomycin
Neocarzilin A O O
O
O
O NH S O
O
O O
N NH H
O
NH
OH
N H
O N
HO
OH
OH OCH3
Virginiamycin M
OH
4
O
OH
O
O
O
S
OH
O
OH
O N
OH
N
OH
S
N H
S S OO
Leinamycin
Etnangien
FK228 O
HO O OH H O N O
H2N
O OH O
O
O
OH
O
OHN
O
O
NH
O
HN
O
OCH3
O OH
Lankacidin C
O
O
NH
HO
Onnamide A
OH
O N H
OH OH
OH
Myxovirescin (TA)
O
HO HO
Macrolactin
Figure 8.3 Natural products whose biosynthetic pathways are predicted to feature AT-less type I PKSs.
use succinyl CoA and ethylmalonyl CoA, respectively. An AT-less type I PKS that incorporates methoxymalonyl ACP as an extender unit has also been proposed, for the biosynthesis of oxazolomycin, the predicted discrete AT (OzmC) for which, however, shows little sequence homology to typical ATs known for PKSs. With the exception of LnmG, the actual substrate
170
Table 8.1 A compilation of natural products biosynthesized by AT-less type I PKSs, predicted enzyme properties, and respective producing organisms Compound (Reference)
PKS module
Discrete AT protein
Substrate specificitya
Gene cluster status
Organism
Albicidin (Huang et al., 2001; Royer et al., 2004) Bacillaene (Butcher et al., 2007; Chen et al., 2006; Kunst et al., 1997; Straight et al., 2007) Bryostatin (Hildebrand et al., 2004; Sudek et al., 2007)
2 PKS modules on AlbI (XabB)
1 AT on AlbXIII
Malonyl CoA
Cluster completed and confirmed
Xanthomonas albilineans
13 PKS modules on PksJLMNR (also known as BaeJLMNR)
1 AT on PksC, 1 AT on PksD, and 1 AT on PksE (also known as BaeCDE)
Malonyl CoA
Cluster completed and confirmed
Bacillus subtilis (B. amyloliquefaciens FZB 42)
13 PKS modules (1 nonfunctional) on BryABCD
2 ATs on BryP
Malonyl CoA
Putative cluster complete
Chivosazol (Perlova et al., 2006) Difficidin (Chen et al., 2006)
15 PKS modules on ChiBCDEF 13 PKS modules on DifFGHIJKL
1 AT on ChiA
Malonyl CoA
1 AT on DifA
Malonyl CoA
Cluster completed and confirmed Cluster completed and confirmed
Disorazol (Carvalho et al., 2005; Kopp et al., 2005)
10 PKS modules (3 nonfunctional) on DisABC (also known as DszABC) 20 PKS modules on EtnDEFGHI 2 PKS modules on DepBC 10 PKS modules on MgsEFG 14 PKS modules on KirAI-AVI with
1 AT on DisD (also known as DszD)
Malonyl CoA
Cluster completed and confirmed
‘‘Candidatus Endobugula sertula’’ (bacterial symbiont from bryozoan Bugula neritina) Sorangium cellulosum So ce56 Bacillus amyloliquefaciens FZB 42 Sorangium cellulosum So ce12
1 AT on EtnB and 2 ATs on EtnK No discrete AT identified 2 ATs on MgsB and 1 AT on MgsH 2 ATs on KirCI and 1 AT on KirCII
Malonyl CoA Succinyl CoA Malonyl CoA
Cluster completed and confirmed Cluster confirmed but possibly incomplete Cluster completed and confirmed Cluster completed and confirmed
Etnangien (Menche et al., 2008) FK228 (depsipeptide) (Cheng et al., 2007) Iso-Migrastatin (Farnet et al., 2002) Kirromycin (Weber et al., 2008)
Malonyl CoA Malonyl CoA Ethylmalonyl CoA
Sorangium cellulosum So ce1045 Chromobacterium violaceum No. 968 Streptomyces plantensis Streptomyces collinus Tu¨ 365
Lactimidomycin (Farnet et al., 2002) Lankacidin (Arakawa et al., 2005; Mochizuki et al., 2003) Leinamycin (Cheng et al., 2002, 2003; Tang et al., 2004, 2006) Macrolactin (polyketide 2) (Chen et al., 2006; Schneider et al., 2007) Mupirocin (pseudomonic acid A) (El-Sayed et al., 2003) Myxovirescin (antibiotic TA) (Paitan et al., 1999, 2001; Simunovic et al., 2006) Neocarzilin (Otsuka et al., 2004) Onnamide (Piel et al., 2004c, 2005)
2 AT domains on KirAVI 10 PKS modules on LtmEFG 5 PKS modules; on LkcACFG
171
Cluster completed and confirmed Cluster completed and confirmed
Streptomyces amphibiosporus Streptomyces rochei 7434AN4
Malonyl CoA
Cluster completed and confirmed
Streptomyces atroolivaceus S-140
1 AT on MlnA
Malonyl CoA
Cluster completed and confirmed
Bacillus amyloliquefaciens FZB 42
8 PKS modules on MmpABD
2 ATs on MmpC (deposited as MmpIII)
Malonyl CoA
Cluster completed and confirmed
Pseudomonas fluorescens NCIMB 10586
15 PKS modules (2 inactive) on TaIL, Ta-1 and TaOP
2 ATs on TaV
Malonyl CoA
Cluster completed and confirmed
Myxococcus xanthus DK1622
4 PKS modules on ORF4//5/6 with 2 AT domains 7 PKS modules on OnnB and OnnI. Several PKS modules still missing
No discrete AT identified
Malonyl CoA
Cluster completed and confirmed
No discrete AT identified
Malonyl CoA
Putative cluster incomplete
Streptomyces carzinostaticus var. F-41 Bacterial symbiont from sponge Theonella swinhoei
2 ATs on LtmB and 1 AT on LtmH 1 AT on LkcD
Malonyl CoA
6 PKS modules on LnmIJ
1 AT on LnmG
11 PKS modules on MlnBCDEFGH
Malonyl CoA
(continued)
Table 8.1
(continued)
Compound (Reference)
Oxazolomycin (Song et al., 2008; Zhao et al., 2006, 2009) Pederin (Piel, 2002; Piel, et al., 2004a, 2004b, 2004c, 2004d, 2005) Rhizoxin (PartidaMartinez and Hertweck, 2007) Rhizoxin S2 and analogues (Brendel et al., 2007) Unknown (Fritzler and Zhu, 2007; Zhu et al., 2002) Virginiamycin M (Pulsawat et al., 2007) a
PKS module
Discrete AT protein
10 PKS modules on OzmHIJKNQ
2 ATs on OzmM and 1 AT on OzmC
10 PKS modules on PedI and PedF; 4 optional PKS modules on PedH 12 PKS modules on RhiABCDEF (also known as RzxABCDEF) 12 PKS modules on RzxABCDEF
2 ATs on PedC and 1 AT on PedD
7 PKS modules with 2 AT domains on CpPKS1 7 PKS modules on VirAFGH
Only the substrate specificity of LnmG has been experimentally confirmed.
Substrate specificitya
Gene cluster status
Organism
Malonyl CoA Methoxymalonyl ACP Malonyl CoA
Cluster completed and confirmed
Streptomyces albus JA3453
Putative cluster complete
Bacterial symbiont of Paederus ssp. beetles
2 ATs on RhiG (also known as RzxG)
Malonyl CoA
Cluster completed and confirmed
Burkholderia rhizoxina
2 ATs on RzxG
Malonyl CoA
Cluster completed and confirmed
Pseudomonas fluorescens Pf-5
No discrete AT identified
Malonyl CoA
Putative cluster incomplete
Cryptosporidium parvum
1 AT on VirI
Malonyl CoA
Cluster completed and confirmed
Streptomyces virginiae
173
Type I Polyketide Synthases that Require Discrete Acyltransferases
Ave AT2 (BAA84474) KirAVI AT2 CAN89636 Rif AT2 (AAC01710) SorA AT2 (AAK19883) Rap AT2 (CAA60460) Con AT6 (AAZ94388) Nid AT6 (O30767) Sor AT3 (AAK19883) SorA AT7 (AAA79984) Con AT13 (AAZ94391) Ery AT2 (Q03131) KirAVI AT1 (CAN89636) Rap AT1 (CAA60460) Rif AT1 (AAC01710) KirCII AT BaeD AT EntK AT1 PedC AT KirCI AT1 MmpIII AT1 TaV AT1 OzmM AT1 RhiG AT1 BryP AT2 AlbXIII AT OzmC AT EntB AT FabD AT (BAA35900) LkcD AT LtmH AT MgsH AT Virl AT LnmG AT LtmB AT MgsB AT DisD AT KirCl AT2 OzmM AT2 MmpIII AT2 TaV AT2 RhiG AT2 BaeC BaeE AT DifA AT BryP AT ChiA AT Mln AT PedD AT EntK AT2
Cognate ATs (malonyl CoA specific)
Cognate ATs (methoxymalonyl ACP specific)
Cognate ATs (methylmalonyl CoA specific)
Discrete ATs
Figure 8.4 Phylogenetic analysis of cognate and discrete acyltransferases (ATs), highlighting substrate specificities. Phylogenetic analysis was performed by the neighborjoining method (Bruno et al., 2000). Discrete ATs form a loose but distinctive clade distant from the cognate ATs of prototypical PKSs. For discrete ATs, see Table 8.1 for references. For cognate ATs, NCBI accession numbers are given in parentheses.
specificities for all discrete ATs identified for AT-less type I PKSs to date remain to be experimentally proven. This chapter describes protocols for biochemical characterization of AT-less type I PKSs, as previously applied to establish and characterize the LNM PKS. They include (1) heterologous expression and overproduction of ACPs from AT-less type I PKS modules; (2) in vitro preparation of
174
Yi-Qiang Cheng et al.
D
A Self-acylation AT OH
CoAS
CoA
CoA
O O
O
O O
O
OH
OH O
Discrete AT
O
AT
O
O
ACP
O
Hydrolysis AT
B
C
D
Svp PPTase
Transacylation
Hydrolysis
3´,5´-ADP
apo-ACP
ACP
ACP SH
SH
S AT
AT
O
O
O
ACP
O O
Holo-ACP O
OH
O
O
O
O
Acylated ACP
O
Figure 8.5 Scheme depicting the reactions assayed by the protocols provided. (A) Selfacylation of a discrete AT at the active site Ser residue with the extender substrate malonyl CoA. (B) Conversion of apo-ACP to holo-ACP by attaching the 40 -phosphopantetheine group from CoA to the active site Ser residue by PPTases such as Svp. (C) Transfer of activated substrate from acylated AT to the SH-group of holo-ACP. (D) Spontaneous hydrolysis of acylated ATor acylated ACP.
holo-ACPs; (3) heterologous expression and overproduction of discrete ATs; (4) in vitro assay of AT substrate specificity; and (5) in vitro assay of AT-catalyzed loading of extender unit substrate onto holo-ACPs. The biochemical reactions examined are depicted in Fig. 8.5.
2. Methods 2.1. Heterologous expression and overproduction of apo-ACPs from AT-less PKS modules 1. Conduct sequence analysis (e.g., by ClustalW program [Thompson et al., 2002]) to determine the boundaries of individual ACP domains from AT-less type I PKS modules (Donadio and Katz, 1992). 2. Choose a host/vector system for heterologous gene expression [e.g., Escherichia coli BL21(DE3)/pET28a or pET37b from Novagen for overproduction of the gene product as His6-tagged fusion protein] and a subsequent protein purification system (e.g., by affinity chromatography on Ni-NTA resin from Qiagen). 3. Design and synthesize PCR primers for the amplification of DNA encoding the target ACP domains. Restriction sites (e.g., CATATG for NdeI and AAGCTT for HindIII) are routinely added to the primers to facilitate directional cloning.
Type I Polyketide Synthases that Require Discrete Acyltransferases
175
4. Amplify the DNA by PCR with a high-fidelity DNA polymerase (e.g., Pfu Turbo DNA polymerase from Strategene), clone the amplicon into pET28a or pET37b, and sequence the construct to verify DNA amplification fidelity. 5. Introduce individual expression constructs into host strain E. coli BL21 (DE3) cells by transformation or electroporation. Select for transformants on LB agar supplemented with 25 mg/ml of kanamycin. 6. Optimize culture conditions on a small scale for overproduction of soluble ACPs by following the manufacturer’s recommendations (e.g., the QIAexpressionist from Qiagen). 7. Scale up the culture volume for protein overproduction and proceed to purify sufficient amounts of individual ACPs for assays. We routinely grow 1 to 4 l of culture at 18 to 25 for 0.5 to 2 days and add 1 to 100 mM (final concentration) isopropyl b-D-1-thiogalactopyranoside (IPTG) to induce gene expression. We also routinely employ lysozyme and sonication to lyse cells, and use gravity Ni-NTA affinity chroma¨ KTA tography and subsequently anion exchange FPLC (e.g., the A system from Amersham Pharmacia) to obtain pure ACPs. 8. Examine protein fractions by SDS-PAGE and pool together the fractions with at least 95% purity. 9. Dialyze pooled protein samples against 25 mM Tris-HCl, pH 8.0, 25 mM NaCl, 2 mM DTT and 10% glycerol. 10. Re-examine the quality of the purified ACPs by SDS-PAGE (Fig. 8.6A), and determine their concentrations by Bradford assay (Bradford, 1976). 11. Aliquot (e.g., 500 ml per 1.5-ml tube) and store the ACP samples at –80 until use.
2.2. In vitro preparation of holo-ACPs PKS ACPs overproduced in E. coli under the conditions described above are generally in their nonphosphopantatheinylated apo-form. Apo-ACPs need to be converted into their functional holo-forms by attachment of the 40 phosphopantetheine group from CoA to the active-site Ser residue. This post-translational modification of apo-ACPs to holo-ACPs can be carried out in vitro with promiscuous 4-phosphopantetheinyl transferases (PPTases) such as Svp (Fig. 8.5) and followed by HPLC, MS, or autoradiography analysis (Lambalot et al., 1996; Sanchez et al., 2001). 2.2.1. In vitro preparation of holo-ACPs from apo-ACPs 1. Set up an analytical in vitro phosphopantetheinylation reaction in 100-ml volume as follows: (1) 25 ml of 4 X reaction buffer (400 mM TrisHCl, pH 7.5, 50 mM MgCl2, 10 mM DTT)l; (2) 10 ml of 2.5 mM CoA stock
176
Yi-Qiang Cheng et al.
A
C
KDa
KDa
1
2
3
4
5
6
7
8
200
200 116 97.4 66.2
116 97.4 66.2
1
2
LnmG (AT)
45.0
45.0 31.0 21.5 14.5
31.0 ACPs 21.5
B 1.0
UV at 220 nm (V)
I 0 2.0 II 0 1.0
III 0 12.5
15.0
17.5
20.0
22.5
25.0
Time (min)
Figure 8.6 (A) Purified LnmI and LnmJ ACPs on a 4 to 15% SDS-PAGE: lane1, molecular weight standards; lane 2, ACP3; lane 3, ACP4; lane 4, ACP5; lane 5, ACP6-1; lane 6, ACP6-2; lane 7, ACP7; lane 8, ACP8.The numbers after the ACPs refer to the PKS modules from which they are derived, with 6-1 and 6-2 to indicate the first and second ACPs, respectively, for PKS module 6. (B) HPLC analysis of carrier protein modification and LnmG-catalyzed loading of the extender substrate onto holo-ACP, as exemplified by ACP3: (I) apo-ACP3 (); (II) Svp-catalyzed conversion of apo-ACP to holo-ACPs (^); and (III) LnmG-catalyzed loading of malonyl CoA onto holo-ACP, showing holoACP3 (^) converted to malonyl-S-ACP3 (▼). (C) Purified discrete AT (LnmG) on a 4 to 15% SDS-PAGE: lane1, molecular weight standards; lane 2, LnmG.
(final concentration 250 mM) (use 3H-labeled CoA for autoradiography analysis); (3) 10 ml of apo-ACP (final concentration 10 mM ]; (4) 2 ml of Svp (final concentration 2 mM); and (5) add H2O to a total reaction volume of 100 ml. 2. Incubate the reaction at 25 for 30 to 60 min. 3. Add 900 ml of acetone to quench the reaction, and mix briefly by vortexing. 4. Freeze sample tube at –80 for at least 1 h to precipitate proteins, and pellet the proteins by centrifugation at 14,000 RPM for 20 min at 4 .
Type I Polyketide Synthases that Require Discrete Acyltransferases
177
5. Decant supernatant, and dry pellet briefly in the air with the cap open. 6. Redissolve pellet in 30 ml of 25 mM Tris-HCl, pH 7.5, 25 mM NaCl, 2 mM DTT and 10% glycerol. 7. Separate apo- and holo-ACPs from the reactions by HPLC with a Jupiter C-18 column (5 mm, 300 A˚, 250 4.6 mm, Phenomenex), and a gradient elution from 85% buffer A (H2O þ 0.1% formic acid) to 90% buffer B (acetonitrile þ 0.1% formic acid) in 25 min at a flow rate of 1 ml/min, with UV detection at 220 nm (Fig. 8.6B). Individual protein peaks are collected, lyophilized, and redissolved in 50 ml of H2O. 8. Determine the apo- and holo-ACPs by ESI-MS analysis in positive ionization mode on an Agilent 1000 HPLC-MSD SL instrument under standard operational conditions (Table 8.2). 9. Scale up the reaction volume three- to five-fold for preparative reactions, and aliquot and store the holo-ACP samples from Step 6 at –80 until use.
2.3. Heterologous expression and overproduction of discrete ATs 1. The majority of genes encoding discrete ATs for AT-less type I PKSs encode a single AT domain, but a few are predicted to encode tandem AT domains (see Table 8.1). For those that encode a single AT domain, use the entire open reading frame for heterologous expression. For those that encode tandem AT domains, conduct sequence analysis [e.g., by ClustalW program (Thompson et al., 2002)] to determine the boundaries of individual AT domains for heterologous expression, taking as much advantage as possible of their natural N- or C-terminus (Donadio and Katz, 1992). 2. Follow Steps 2 through 8 as described in Section 2.1, but replace the target genes with those encoding discrete ATs. 3. Dialyze pooled protein samples against 25 mM Tris-HCl, pH 7.0, 25 mM NaCl, 2 mM DTT and 10% glycerol. 4. Re-examine the quality of the purified ATs by SDS-PAGE (Fig. 8.6C), and determine their concentrations by Bradford assay (Bradford, 1976). 5. Aliquot (e.g., 500 ml per 1.5-ml tube) and store the AT samples at –80 until use.
2.4. In vitro assay for AT substrate specificity The protocol for a quasi-kinetic assay of AT substrate specificity was modified from previously published procedures (Liou et al., 2003; Szafranska et al., 2002). Acyl CoAs (use 14C-labeled acyl CoAs only for
Table 8.2 ESI-MS analysis of apo-, holo-, and malonyl-S-ACPs of the LnmI and LnmJ PKSs apo-ACP [M þ H]þ
a
holo-ACP [M þ H]þ
Malonyl-S-ACP [M þ H]þ
ACPsa
Calculated
Found
Calculated
Found
Calculated
Found
LnmI-ACP3 LnmJ-ACP4 LnmJ-ACP5 LnmJ-ACP6-1 LnmJ-ACP6-2 LnmJ-ACP7 LnmJ-ACP8
11,702 12,245 12,520 12,209 12,151 12,322 12,090
11,700 12,241 12,517 12,206 12,147 12,318 12,087
12,042 12,585 12,860 12,549 12,491 12,662 12,430
12,040 12,582 12,857 12,546 12,486 12,665 12,427
12,128 12,671 12,946 12,635 12,577 12,748 12,516
12,126 12,669 12,943 12,632 12,572 12,751 12,512
The numbers after ACPs refer to the LNM PKS modules from which they are derived, with 6-1 and 6-2 to indicate the first and second ACPs, respectively, for LNM PKS module 6.
Type I Polyketide Synthases that Require Discrete Acyltransferases
179
autoradiography analysis) used include malonyl CoA, methylmalonyl CoA, butyryl CoA, propionyl CoA, and acetyl CoA. 1. Set up a typical in vitro AT self-acylation reaction in a 200-ml volume for each acyl CoA as follows: (1) 100 ml of 2 X reaction buffer (100 mM phosphate buffer, pH 7.0, 0.4 mM DTT, 0.2 mM EDTA); (2) 10 ml of acyl CoA and (final acyl CoA concentration 20 mM and 8 108 DPM if 14C-labeled acyl CoA is included); (3) 5 ml of LnmG (final concentration 2 mM and add in Step 3 to initiate reaction); and (4) add H2O to a total reaction volume of 200 ml 2. Equilibrate all reagents on ice (0 ) for 15 min or longer, and perform assay on ice to slow down the reaction. 3. Initiate reaction by adding LnmG and quickly mix by pipetting up and down several times. 4. Transfer 25 ml of reaction mixture to a tube containing 50 ml of ice-cold 10% TCA at each of the seven time points: 0.5, 1, 2, 4, 8, 16 and 32 min. 5. Add 25 ml of 10-mg/ml BSA to each tube as a carrier protein and allow proteins to precipitate on ice for 15 min. 6. Pellet proteins by centrifugation at 14,000 RPM for 20 min at 4 . 7. Wash protein pellet twice with 100 ml of 10% ice-cold TCA. 8. Solubilize the pellet in 100 ml of 10 mM NaCl, 2% SDS solution at ambient temperature. 9. Mix with 5 ml of scintillation cocktail and count radioactivity in a scintillation counter (Beckman Coulter). 10. Plot the radioactivity counts as a function of time for each acyl CoA. Use the count of a 25-ml fraction directly from the original reaction (Step 4) as 100% DPM value. Normalize the 100% DPM values of individual acyl CoAs to that of malonyl CoA (Fig. 8.7A). 11. Similarly, assays can be performed with a fixed amount of AT enzyme (2 mM of LnmG) and variable concentrations of acyl CoA in 25-ml reaction for 2 min on ice (Fig. 8.7B).
2.5. In vitro assay of AT-catalyzed loading of acyl CoA extender substrate to holo-ACPs This assay can be carried out in two completely separate steps (continuing from the holo-ACPs prepared from Step 9, Section 2.2) or in two consecutive steps in a single tube (continuing from the holo-ACPs prepared from Step 2, Section 2.2). The protocol described below was modified from Lambalot et al. (1996) and Sanchez et al. (2001) and was developed for a typical analytical reaction. The loading of the acyl group from the acyl CoA substrate (malonyl CoA in the current example) onto holo-ACP can be followed by HPLC, MS or autoradiography analysis. Only the protocol for assay in a single tube is provided, which could be readily adapted for assay in
180
Yi-Qiang Cheng et al.
Radioactivity (100% DPM = 100,660)
A 3000 2500 2000 1500 1000 500 0 0.5
1
2 4 8 Time point (min)
16
32
Radioactivity (100% DPM = 115,050)
B 3500 3000 2500 2000 1500 1000 500 0 12.5
25
50
100
200
Substrate concentration (mM)
Figure 8.7 Determination of malonyl CoA as the preferred substrate of the discrete AT (LnmG): (A) time-course assays of ATself-acylation with malonyl CoA (▪), methylmalonyl CoA (^), butyryl CoA (▲), propionyl CoA (?), or acetyl CoA (○); and (B) assays with a fixed amount of AT enzyme (2 mM of LnmG) and variable concentrations of malonyl CoA (▪) or methylmalonyl CoA (^).
two separate steps. For preparative reactions, scale up reaction volumes three- to five-fold. 1. Add to the reaction tube from the Step 2 of Section 2.2 a 25-ml solution containing 2 mM LnmG and 200 mM [2-14C] malonyl CoA (5 108 DPM). 2a. For assaying one ACP in a time-course (Fig. 8.8A), incubate the reactions at 25 and quench the reactions by adding 900 ml of acetone at various time points (1, 2, 4, 8, 16, 32, 64, and 128 min). Mix briefly by vortexing.
181
Type I Polyketide Synthases that Require Discrete Acyltransferases
A KDa
2
1
3
5
4
6
7
8
116 97.4
I
LnmG
66.2 45.0 Svp
31.0 21.5 14.4
ACPs LnmG
II ACPs
B
Time (min) 1
2
4
8
16
32
64
128 LnmG
I Svp ACP3
LnmG
II
ACP3
Figure 8.8 In vitro assays of LnmG-catalyzed loading of malonyl CoA onto holo-ACPs of the LnmI and LnmJ PKSs: (A) Complete assay of individual ACPs in reactions with Svp, CoA, LnmG and [2-14C]malonyl CoA, as visualized on a 4 to 15% SDS-PAGE (I) and by phosphorimaging (II) (lane1, molecular mass standards and lanes 2 to 8, ACP3 to ACP8); and (B) time course of LnmG-catalyzed loading of [2-14C]malonyl CoA onto holo-ACP3, as visualized on a 4 to 15% SDS-PAGE (I) and by phosphorimaging (II).
2b. For assaying multiple ACPs at a fixed time point (Fig. 8.8B), incubate the reactions at 25 and quench by adding 900 ml of acetone at a fixed time point (2 min). Mix briefly by vortexing. 3. Freeze samples at –80 for at least 1 h to precipitate proteins and pellet the proteins by centrifugation at 14,000 RPM for 30 min at 4 . 4. Decant supernatant, and dry pellet briefly in the air with the cap open.
182
Yi-Qiang Cheng et al.
5. Follow Steps 6 to 8 of Section 2.2 to analyze the resultant acyl-S-ACPs by HPLC (Fig. 8.6B) and ESI-MS (Table 8.2). 6. Alternatively, redissolve protein pellets in 25 ml of 1 sampler buffer. 7. Analyze protein samples on a 4 to 15% SDS-PAGE gel (Bio-Rad), visualize proteins by Coomassie blue staining and record the gel image (Fig. 8.8). 8. Air dry the gel and expose it to a low-energy (LE) phosphor screen (Amersham Pharmacia) at ambient temperature for 3 to 7 days to acquire autoradiography with a phosphorimager (Molecular Dynamics) (Fig. 8.8).
3. Conclusion Bioinformatics analysis of gene clusters continues to unveil candidates encoding AT-less type I PKSs for natural product biosynthesis (Fig. 8.3 and Table 8.1). The LNM PKS, however, remains the only AT-less type I PKS that has been confirmed experimentally, with LnmG acting in trans as a discrete AT responsible for loading the extender substrate malonyl CoA to all six modules of the LnmI and LnmJ PKS proteins (Cheng et al., 2003). A significant knowledge gap exists between the predicted and experimentally validated involvement of AT-less type I PKSs in natural product biosynthesis, yet such information is absolutely required to realize the full potential of this subclass of novel PKSs in combinatorial biosynthesis for natural product structural diversity. It is hoped that methods devised for studies of the LNM PKS will be applicable to other AT-less type I PKSs, thereby aiding their biochemical and mechanistic characterization. Although gene expression in heterologous hosts such as E. coli is intrinsically unpredictable, overproduction of functional ACPs and discrete ATs generally does not constitute an insurmountable problem. ACPs overproduced in E. coli are often in the apo-form, but conversion to the functional holo-form is readily achievable thanks to the availability of promiscuous PPTases such as Svp (Sanchez et al., 2001) and Sfp (Lambalot et al., 1996). While conceptually straightforward, care must be taken in executing assays for the substrate specificity of discrete ATs, since AT self-acylation reaction is often rapid and followed by a gradual spontaneous hydrolysis, and assays for discrete AT-catalyzed loading of extender substrates to holo-ACPs, because the general protocol often requires specific optimization, and acylated ACPs also undergo slow hydrolysis under the assay conditions (Fig. 8.5). AT-less type I PKSs provide tremendous opportunities for PKS engineering. For instance, given that LnmG is responsible for the loading of the malonyl CoA extender unit to all six modules of the LnmI and LnmJ PKS, it was reasoned that LnmG could be a rate-limiting factor for LNM biosynthesis. Subsequent overexpression of lnmG under a strong promoter in the LNM-producing-strain S, atroolivaceus S-140 indeed resulted in improved
Type I Polyketide Synthases that Require Discrete Acyltransferases
183
LNM titers by three- to five-fold (Cheng et al., 2003; Tang et al., 2004). It is also very tempting to envision the application of lnmG and other discrete AT-encoding genes to either prototypical type I PKSs or AT-less type I PKSs to alter the extender-unit specificity by combinatorial methods, thereby further expanding the size and diversity of polyketide natural products. Finally, it is exciting to consider how these established methods designed with LNM in mind will also be applicable to decipher the mechanism by which AT-less type I PKSs accommodate multiple extender units. Take for instance the recently discovered discrete ATs from the etnangien biosynthetic pathway (EtnB) (Menche et al., 2008), the kirromycin biosynthetic pathway (KirCII) (Weber et al., 2008), and the oxazolomycin biosynthetic pathway (OzmC) (Zhao et al., 2009), whose predicted substrate specificities are for succinyl CoA, ethylmalonyl CoA, and methoxymalonyl ACP, respectively, in addition to other dedicated discrete ATs for malonyl CoA in the same pathway. If experimentally proven, EtnB, KirCII, and OzmC, together with their corresponding AT-less PKS machinery, would provide additional opportunities to introduce uncommon extender units for engineering novel natural products by combinatorial biosynthesis methods.
ACKNOWLEDGMENT This work was supported in part by National Institutes of Health grants CA106150 and CA113297.
REFERENCES Arakawa, K., Sugino, F., Kodama, K., Ishii, T., and Kinashi, H. (2005). Cyclization mechanism for the synthesis of macrocyclic antibiotic lankacidin in Streptomyces rochei. Chem. Biol. 12, 249–256. Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Brendel, N., Laila, P., Partida-Martinez, L. P., Scherlach, K., and Hertweck, C (2007). A cryptic PKS-NRPS gene locus in the plant commensal Pseudomonas fluorescens Pf–5 codes for the biosynthesis of an antimitotic rhizoxin complex. Org. Biomol. Chem. 5, 2211–2213. Bruno, W. J., Socci, N. D., and Halpern, A. L. (2000). Weighted neighbor joining: A likelihood-based approach to distance-based phylogeny reconstruction. Mol. Biol. Evol. 17, 189–197. Butcher, R. A., Schroeder, F. C., Fischbach, M. A., Straight, P. D., Kolter, R., Walsh, C. T., and Clardy, J. (2007). The identification of bacillaene, the product of the PksX megacomplex in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 104, 1506–1509. Carvalho, R., Reid, R., Viswanathan, N., Gramajo, H., and Julien, B. (2005). The biosynthetic genes for disorazoles, potent cytotoxic compounds that disrupt microtubule formation. Gene 359, 91–98.
184
Yi-Qiang Cheng et al.
Chan, Y. A., Boyne, M. T., Podevels, A. M., Klimowicz, A. K., Handelsman, J., Kelleher, N. L., and Thomas, M. G. (2006). Hydroxymalonyl-acyl carrier protein (ACP), and aminomalonyl-ACP are two additional type I polyketide synthase extender units. Proc. Natl. Acad. Sci. USA 103, 14349–14354. Chen, X. H., Vater, J., Piel, J., Franke, P., Scholz, R., Schneider, K., Koumoutsi, A., Hitzeroth, G., Grammel, N., Strittmatter, A. W., Gottschalk, G., Sussmuth, R. D., et al. (2006). Structural and functional characterization of three polyketide synthase gene clusters in Bacillus amyloliquefaciens FZB 42. J. Bacteriol 188, 4024–4036. Cheng, Y. Q., Tang, G. L., and Shen, B. (2002). Identification and localization of the gene cluster encoding biosynthesis of the antitumor macrolactam leinamycin in Streptomyces atroolivaceus S-140. J. Bacteriol 184, 7013–7024. Cheng, Y. Q., Tang, G. L., and Shen, B. (2003). Type I polyketide synthase requiring a discrete acyltransferase for polyketide biosynthesis. Proc. Natl. Acad. Sci. USA 100, 3149–3154. Cheng, Y. Q., Yang, M., and Matter, A. M. (2007). Characterization of a gene cluster responsible for the biosynthesis of anticancer agent FK228 in Chromobacterium violaceum No. 968. Appl. Environ. Microbiol. 73, 3460–3469. Donadio, S., and Katz, L. (1992). Organization of the enzymatic domains in the multifunctional polyketide synthase involved in erythromycin formation in Saccharopolyspora erythraea. Gene 111, 51–60. El-Sayed, A. K., Hothersall, J., Cooper, S. M., Stephens, E., Simpson, T. J., and Thomas, C. M. (2003). Characterization of the mupirocin biosynthesis gene cluster from Pseudomonas fluorescens NCIMB 10586. Chem. Biol. 10, 419–430. Farnet, C. M., Zazopoulos, E., Staffa, A, and Yang, X. (2002). International Patent WO 02/ 088176. Fritzler, J. M., and Zhu, G. (2007). Functional characterization of the acyl-[acyl carrier protein] ligase in the Cryptosporidium parvum giant polyketide synthase. Int. J. Parasitol 37, 307–316. Hara, M., Asano, K., Kawamoto, I., Takiguchi, T., Katsumata, S., Takahashi, K., and Nakano, H. (1989a). Leinamycin, a new antitumor antibiotic from Streptomyces: Producing organism, fermentation and isolation. J. Antibiot. (Tokyo) 42, 1768–1774. Hara, M., Takahashi, I., Yoshida, M., Asano, K., Kawamoto, I., Morimoto, M., and Nakano, H. (1989b). DC 107, a novel antitumor antibiotic produced by a Streptomyces sp. J. Antibiot. (Tokyo) 42, 333–335. Hildebrand, M., Waggoner, L. E., Liu, H., Sudek, S., Allen, S., Anderson, C., Sherman, D. H., and Haygood, M. (2004). BryA: An unusual modular polyketide synthase gene from the uncultivated bacterial symbiont of the marine bryozoan Bugula neritina. Chem. Biol. 11, 1543–1552. Huang, G., Zhang, L., and Birch, R. G. (2001). A multifunctional polyketide-peptide synthetase essential for albicidin biosynthesis in Xanthomonas albilineans. Microbiology 147, 631–642. Khosla, C., Gokhale, R. S., Jacobsen, J. R., and Cane, D. E. (1999). Tolerance and specificity of polyketide synthases. Annu. Rev. Biochem. 68, 219–253. Kopp, M., Irschik, H., Pradella, S., and Muller, R. (2005). Production of the tubulin destabilizer disorazol in Sorangium cellulosum: Biosynthetic machinery and regulatory genes. ChemBioChem 6, 1277–1286. Kunst, F., Ogasawara, N., Moszer, I., Albertini, A. M., Alloni, G., Azevedo, V., Bertero, M. G., Bessieres, P., Bolotin, A., Borchert, S., Borriss, R., Boursier, L., et al. (1997). The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390, 249–256. Lambalot, R. H., Gehring, A. M., Flugel, R. S., Zuber, P., LaCelle, M., Marahiel, M. A., Reid, R., Khosla, C., and Walsh, C. T. (1996). A new enzyme superfamily—the phosphopantetheinyl transferases. Chem. Biol. 3, 923–936.
Type I Polyketide Synthases that Require Discrete Acyltransferases
185
Liou, G. F., Lau, J., Cane, D. E., and Khosla, C. (2003). Quantitative analysis of loading and extender acyltransferases of modular polyketide synthases. Biochemistry 42, 200–207. Menche, D., Arikan, F., Perlova, O., Horstmann, N., Ahlbrecht, W., Wenzel, S. C., Jansen, R., Irschik, H., and Muller, R. (2008). Stereochemical determination and complex biosynthetic assembly of etnangien, a highly potent RNA polymerase inhibitor from the myxobacterium Sorangium cellulosum. J. Am. Chem. Soc. 130, 14234–14243. Mochizuki, S., Hiratsu, K., Suwa, M., Ishii, T., Sugino, F., Yamada, K., and Kinashi, H. (2003). The large linear plasmid pSLA2-L of Streptomyces rochei has an unusually condensed gene organization for secondary metabolism. Mol. Microbiol. 48, 1501–1510. Otsuka, M., Ichinose, K., Fujii, I., and Ebizuka, Y. (2004). Cloning, sequencing, and functional analysis of an iterative type I polyketide synthase gene cluster for biosynthesis of the antitumor chlorinated polyenone neocarzilin in ‘‘Streptomyces carzinostaticus.’’ Antimicrob. Agents Chemother. 48, 3468–3476. Paitan, Y., Alon, G., Orr, E., Ron, E. Z., and Rosenberg, E. (1999). The first gene in the biosynthesis of the polyketide antibiotic TA of Myxococcus xanthus codes for a unique PKS module coupled to a peptide synthetase. J. Mol. Biol. 286, 465–474. Paitan, Y., Orr, E, Ron, E.Z, and Rosenberg, E (2001). An unusual beta-ketoacyl:acyl carrier protein synthase and acyltransferase motifs in TaK, a putative protein required for biosynthesis of the antibiotic TA in Myxococcus xanthus. FEMS Microbiol. Lett. 203, 191–197. Partida-Martinez, L. P., and Hertweck, C. (2007). A gene cluster encoding rhizoxin biosynthesis in ‘‘Burkholderia rhizoxina,’’ the bacterial endosymbiont of the fungus Rhizopus microsporus. ChemBioChem 8, 41–45. Perlova, O. K., Kaiser, O., Hans, A., and Muller, R. (2006). Identification and analysis of the chivosazol biosynthetic gene cluster from the myxobacterial model strain Sorangium cellulosum So ce56. J. Biotechnol. 121, 174–191. Piel, J. (2002). A polyketide synthase-peptide synthetase gene cluster from an uncultured bacterial symbiont of Paederus beetles. Proc. Natl. Acad. Sci. USA 99, 14002–14007. Piel, J., Butzke, D., Fusetani, N., Hui, D., Platzer, M., Wen, G., and Matsunaga, S. (2005). Exploring the chemistry of uncultivated bacterial symbionts: Antitumor polyketides of the pederin family. J. Nat. Prod. 68, 472–479. Piel, J., Hofer, I., and Hui, D. (2004a). Evidence for a symbiosis island involved in horizontal acquisition of pederin biosynthetic capabilities by the bacterial symbiont of Paederus fuscipes beetles. J. Bacteriol. 186, 1280–1286. Piel, J., Hui, D., Fusetani, N., and Matsunaga, S. (2004b). Targeting modular polyketide synthases with iteratively acting acyltransferases from metagenomes of uncultured bacterial consortia. Environ. Microbiol. 6, 921–927. Piel, J., Hui, D., Wen, G., Butzke, D., Platzer, M., Fusetani, N., and Matsunaga, S. (2004c). Antitumor polyketide biosynthesis by an uncultivated bacterial symbiont of the marine sponge Theonella swinhoei. Proc. Natl. Acad. Sci. USA 101, 16222–16227. Piel, J., Wen, G., Platzer, M., and Hui, D. (2004d). Unprecedented diversity of catalytic domains in the first four modules of the putative pederin polyketide synthase. ChemBioChem 5, 93–98. Pulsawat, N., Kitani, S., and Nihira, T. (2007). Characterization of biosynthetic gene cluster for the production of virginiamycin M, a streptogramin type A antibiotic, in Streptomyces virginiae. Gene 393, 31–42. Royer, M., Costet, L., Vivien, E., Bes, M., Cousin, A., Damais, A., Pieretti, I., Savin, A., Megessier, S., Viard, M., Frutos, R., Gabriel, D. W., et al. (2004). Albicidin pathotoxin produced by Xanthomonas albilineans is encoded by three large PKS and NRPS genes present in a gene cluster also containing several putative modifying, regulatory, and resistance genes. Mol. Plant Microbe Interact 17, 414–427. Sanchez, C., Du, L., Edwards, D. J., Toney, M. D., and Shen, B. (2001). Cloning and characterization of a phosphopantetheinyl transferase from Streptomyces verticillus
186
Yi-Qiang Cheng et al.
ATCC15003, the producer of the hybrid peptide-polyketide antitumor drug bleomycin. Chem. Biol. 8, 725–738. Schneider, K., Chen, X. H., Vater, J, Franke, P, Nicholson, G, Borriss, R, and Su¨ssmuth, R. D. (2007). Macrolactin is the polyketide biosynthesis product of the pks2 cluster of Bacillus amyloliquefaciens FZB42. J. Nat. Prod. 70, 1417–1423. Shen, B. (2003). Polyketide biosynthesis beyond the type I, II and III polyketide synthase paradigms. Curr. Opin. Chem. Biol. 7, 285–295. Simunovic, V., Zapp, J., Rachid, S., Krug, D., Meiser, P., and Muller, R. (2006). Myxovirescin A biosynthesis is directed by hybrid polyketide synthases/nonribosomal peptide synthetase, 3-hydroxy-3-methylglutaryl-CoA synthases, and trans-acting acyltransferases. ChemBioChem 7, 1206–1220. Song, D., Coughlin, J., Ju, J., Zhou, X., Shen, B., Zhao, C., and Deng, Z. (2008). Alternative method for site-directed mutagenesis of complex polyketide synthase in Streptomyces albus JA3453. Acta Biochim. Biophys. Sin. (Shanghai) 40, 319–326. Staunton, J., and Weissman, K. J. (2001). Polyketide biosynthesis: A millennium review. Nat. Prod. Rep. 18, 380–416. Straight, P. D., Fischbach, M. A., Walsh, C. T., Rudner, D. Z., and Kolter, R. (2007). A singular enzymatic megacomplex from Bacillus subtilis. Proc. Natl. Acad. Sci. USA 104, 305–310. Sudek, S., Lopanik, N. B., Waggoner, L. E., Hildebrand, M., Anderson, C., Liu, H., Patel, A., Sherman, D. H., and Haygood, M. G. (2007). Identification of the putative bryostatin polyketide synthase gene cluster from ‘‘Candidatus Endobugula sertula’’ the uncultivated microbial symbiont of the marine bryozoan Bugula neritina. J. Nat. Prod. 70, 67–74. Szafranska, A. E., Hitchman, T. S., Cox, R. J., Crosby, J., and Simpson, T. J. (2002). Kinetic and mechanistic analysis of the malonyl CoA ACP transacylase from Streptomyces coelicolor indicates a single catalytically competent serine nucleophile at the active site. Biochemistry 41, 1421–1427. Tang, G. L., Cheng, Y. Q., and Shen, B. (2004). Leinamycin biosynthesis revealing unprecedented architectural complexity for a hybrid polyketide synthase and nonribosomal peptide synthetase. Chem. Biol. 11, 33–45. Tang, G. L., Cheng, Y. Q., and Shen, B. (2006). Polyketide chain skipping mechanism in the biosynthesis of the hybrid nonribosomal peptide-polyketide antitumor antibiotic leinamycin in Streptomyces atroolivaceus S-140. J. Nat. Prod. 69, 387–393. Thompson, J. D., Gibson, T. J., and Higgins, D. G. (2002). Multiple sequence alignment using. In ‘‘Current Protocols in Bioinformatics’’ (W. Clustal and X. Clustal, eds.), John Wiley & Son, Inc., Hoboken, NJ chapter 2, unit 2.3. Weber, T., Laiple, K. J., Pross, E. K., Textor, A., Grond, S., Welzel, K., Pelzer, S., Vente, A., and Wohlleben, W. (2008). Molecular analysis of the kirromycin biosynthetic gene cluster revealed beta-alanine as precursor of the pyridone moiety. Chem. Biol. 15, 175–188. Zhao, C., Ju, J., Christenson, S. D., Smith, W. C., Song, D., Zhou, X., Shen, B., and Deng, Z. (2006). Utilization of the methoxymalonyl-acyl carrier protein biosynthesis locus for cloning the oxazolomycin biosynthetic gene cluster from Streptomyces albus JA3453. J. Bacteriol 188, 4142–4147. Zhao, C., Coughlin, J. M., Song, D., Ju, J., Zhu, D., Wendt-Pienkowski, E., Zhou, X., Wang, Z., Shen, B., and Deng, Z. (2009). The oxazolomycin biosynthetic gene cluster from Streptomyces albus JA3453 unveils a hybrid peptide-polyketide pathway featuring an scyltransferase-less polyketide synthase that incorporates two distinct extender units. Submitted. Zhu, G., LaGier, M. J., Stejskal, F., Millership, J. J., Cai, X., and Keithly, J. S. (2002). Cryptosporidium parvum: The first protist known to encode a putative polyketide synthase. Gene 298, 79–89.
C H A P T E R
N I N E
The Enzymology of Polyether Biosynthesis Tiangang Liu,*,† David E. Cane,† and Zixin Deng* Contents 1. Introduction 2. Genetic Mining and Functional Analysis of Genes Specific to Polyether Biosynthetic Pathways 3. Premonensin, the Parent Unsaturated Monensin Polyketide 4. Epoxidases MonCI, NigCI, and NanO 5. Epoxide Hydrolases MonBI/BII, NigBI/BII, NanI, and Lsd19 6. NanE, a Polyether-Specific Thioesterase 6.1. In vitro studies of NanE thioesterase 7. Assay of Polyether Thioesterase Activity 7.1. Site-directed mutagenesis of NanE 8. Transcriptional Analysis of the Nanchangmycin Biosynthetic Pathway Genes 9. Conclusions Acknowledgments References
188 191 195 198 199 201 204 206 209 209 210 210 211
Abstract Polyether ionophore antibiotics are a special class of polyketides widely used in veterinary medicine, and as food additives in animal husbandry. In this article, we review current knowledge about the mechanism of polyether biosynthesis, and the genetic and biochemical strategies used for its study. Several clear differences distinguish it from traditional type I modular polyketide biosynthesis: polyether backbones are assembled by modular polyketide synthases but are modified by two key enzymes, epoxidase and epoxide hydrolase, to generate the product. All double bonds involved in the oxidative cyclization in the polyketide backbone are of E geometry. Chain release in the polyether biosynthetic pathway requires a special type II thioesterase which specifically hydrolyzes the polyether thioester. All these discoveries should be very helpful for a
* {
Laboratory of Microbial Metabolism and School of Life Sciences and Biotechnology, Shanghai Jiaotong University, Shanghai, China Department of Chemistry, Brown University, Box H, Providence, Rhode Island, USA
Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04609-6
#
2009 Elsevier Inc. All rights reserved.
187
188
Tiangang Liu et al.
deep understanding of the biosynthetic mechanism of this class of important natural compounds, and for the targeted engineering of polyether derivatives.
1. Introduction The polyether ionophores, a very large and important class of antibiotics of polyketide origin, are distinguished by their widespread use in veterinary medicine as coccidiostats, and in animal husbandry as food additives acting as growth promoters. These compounds are branched, polyoxygenated polyketides characteristically containing a carboxylate group and two or more ether and acetal rings that serve as ligands for a monovalent alkali metal cation or a divalent metal cation (Steinrauf et al., 1971; Westley, 1981). The binding of the metal cations within a hydrophobic matrix allows the sequestered cations to diffuse across cell membranes. The polyether ionophores therefore act as proton–metal cation antiporters that exert their antibiotic action by the destruction of physiological ion gradients. Recently, some of the most widely used polyethers, including nanchangmycin (also known as dianemycin) 1, monensin 2, nigericin 3, salinomycin 4, lasalocid A 5 and tetronomycin 6 (Fig. 9.1) have also been found to be active both in vitro and in vivo against drug-resistant malarial parasites (Gumila et al., 1997; Otoguro et al., 2001). Several polyethers are also reported to inhibit the replication of human immunodeficiency virus (HIV) (Nakamura et al., 1992). Early feeding experiments using isotopically labeled precursors demonstrated that the carbon skeleton and specific oxygen atoms of these polyethers are derived from simple acetate, propionate, and butyrate building blocks by a polyketide biosynthetic pathway, with additional ether oxygens originating from molecular oxygen (Cane and Hubbard, 1987; Cane et al., 1981, 1982; Day et al., 1973; Sood et al., 1984). Based on these observations, in 1983 Cane and Westley proposed a unified mechanistic and stereochemical model of polyether biosynthesis involving initial generation of a branched-chain, all-trans (E ), unsaturated fatty acid derivative of the appropriate chain length that would undergo oxidative cyclization to the corresponding polyether by stereospecific conversion to the corresponding polyepoxide, followed by or coupled with a cascade of nucleophilic cyclization reactions resulting in generation of the characteristic pattern of ether and spiroacetal rings of the parent polyether backbone (Cane et al., 1983). Additional late-stage modifications (glycosylations, O-methylations, hydroxylations) would then generate the mature polyether (Fig. 9.2A). In 1991, an intriguing modification of the original stereochemical model was proposed by Townsend and Basak, based on the iron-mediated oxidation of 1, 5-dienes, in which the unsaturated polyketide intermediate would have
OCH3
O HOOC
OH
H O
10
19
O
O
O
OH
O OCH3 HOOC
O
O HO
30
10 O
O
20 O
O
OH
1 nanchangmycin
2 monensin A
O HO
26 OH
OCH3 10 HOOC
O
20
O
O
O
O
OH O 10
HOOC O HO
O
30 OH
3 nigericin
O O
20
O OH
O
OH
4 salinomycin
20 20
10 COOH
OH O
H
O
H O H
OH
10 O
HH H
O
OH
5 lasalocid A
H2C
O
O– + Na
O H H OH
O H
H OCH3
6 tetronomycin
Figure 9.1 Structures of the representative polyethers nanchangmycin 1, monensin A 2, nigericin 3, salinomycin 4, lasalocid A 5, and tetronomycin 6, whose biosynthetic gene clusters have been cloned.
B. Townsend-Basak mechanism (1991)
A. Cane-Westley mechanism(1983) HO
HO O
HO
O
OH
HO2C
HO
O OH
O
HO2C 8 Z,Z,Z premonensin
7 E,E,E premonensin
[2+2] cycloaddition
epoxidation
HO
HO O HO HO2C
O
O
O
HO O
OH B–
Fe
O
O
HO2C
SN2 opening of epoxide rings 2 monensin A
O O
furan ring formation HO
HO HO2C
O
O
O
O
Fe
2 monensin A
Figure 9.2 Proposed mechanisms for oxidative cyclization to produce monensin. (A) Cane-Westley mechanism involving a polyepoxide cyclization cascade starting from E, E, E triene 7. (B) Townsend-Basak mechanism involving [2þ2] cycloadditions starting from the Z, Z, Z triene 8.
The Enzymology of Polyether Biosynthesis
191
exclusively cis-(Z)-double bonds (Townsend and Basak, 1991; McDonald and Towne, 1994) (Fig. 9.2B). As described below, this alternative hypothesis and several of its more recent variants have been firmly ruled out by more recent penetrating molecular genetic experiments. We present below a brief overview of current knowledge of the general mechanism of polyether biosynthesis, focusing on the main genetic and biochemical techniques that have been used to begin to unravel the details of the biosynthesis of this important class of natural products. In the first section we highlight the cloning of polyether biosynthetic gene clusters from the producer actinomycetes. The second section focuses on the strategies that established the all-E-double bond geometry of the unsaturated polyketide intermediate, and the third section describes functional studies of the epoxidase and epoxide hydrolase that convert the initially generated unsaturated polyketide to the polyether. We then describe in greater detail the identification of the novel discrete thioesterases of nanchangmycin and monensin biosynthesis that specifically hydrolyze polyether thioesters, thought to be the last step of polyether biosynthesis, the hydrolytic release of the free carboxylic acid from the acyl carrier protein-bound thioester intermediate. Finally, we describe initial results of transcriptional analysis of nanchangmycin biosynthesis. While the focus of the review is largely on the extensive studies of the monensin and nanchangmycin biosynthetic pathways, many of the techniques should be readily adapted to the study of other genes within the parent clusters or to polyether and related biosynthetic genes in other actinomycete producers.
2. Genetic Mining and Functional Analysis of Genes Specific to Polyether Biosynthetic Pathways Although gene clusters for modular polyketide synthases responsible for the biosynthesis of polyketide antibiotics were first described nearly 20 years ago (Cortes et al., 1990; Donadio et al., 1991), the first such gene cluster for the biosynthesis of a polyether, that of monensin, was reported only in 2001 (Leadlay et al., 2001). Since then, the full sequences of three additional polyether gene clusters, coding for the biosynthesis of nanchangmycin (Sun et al., 2003), nigericin/abierixin (Harvey et al., 2007), and tetronomycin (Demydchuk et al., 2008), have been determined. In each of these studies, the individual open reading frames (ORFs) were identified by standard bioinformatics software packages such as the Frameplot program (http://www.nih.go.jp/~jun/cgi-bin/frameplot.pl) (Ishikawa and Hotta, 1999). Tentative assignment of the probable biochemical function of each ORF was typically performed using the NCBI BLASTP and PSI-BLAST
192
Tiangang Liu et al.
packages (Altschul et al., 1997). The deduced genetic organization of each of the three polyether biosynthetic gene clusters is compared in Fig 9.3, illustrating the significant sequence identity of the counterpart polyetherspecific genes. In addition to exhibiting typical highly conserved modular type I PKS genes with the addition of unusual KS domains and discrete ACP domains, all three clusters display sets of orthologous genes unique to polyether biosynthetic clusters that have been shown with varying degrees of certainty to encode an epoxidase (nanO/monCI/nigCI), an epoxide hydrolase (nanI/monBI/BII/nigBI/BII) and a novel thioesterase (nanE/monCII/nigCII), each essential for the biosynthesis of nanchangmycin (Sun et al., 2003), monensin (Oliynyk et al., 2003), and nigericin/abierixin (Harvey et al., 2007), respectively. All three clusters also possess variable numbers of additional genes encoding a variety of activities such as Omethyltransferase, cytochrome P450 monooxygenase, and enzymes of deoxysugar biosynthesis that are utilized in tailoring of the final polyether product. Finally, additional genes are thought to be responsible for regulation of gene expression and metabolite transport. Most efforts to clone and identify the genes for polyether biosynthesis have relied on the screening of bacterial genomic libraries by Southern hybridization using heterologous probes based on the genes from known modular type I PKS clusters. The rationale behind these homology-based approaches lay in the obvious polyketide character of the polyether backbones and the likelihood that these metabolites would be assembled by homologous modular polyketide synthases. The use of less-specific probes
A
nanA10 nanA1 nanA2 nanA3
T1 T2 0
T3 T4
T5
10
nanA4
R1 R2 20
G5 30
E
nanA5 nanA6
40
M
G4
50
G3
O
nanA11 nanA8
nanP R3
G2 G1
60
nanA9 I
70
80
R4
G6
90
G7
100
G8 110 kb
Key Modular PKS genes Epoxidase
B
monAI monAII monAIII monAIV monAV monAVI
Polyether thioesterase
monAVIII monAVII
Cytochrome P450 Sugar biosynthetic genes
monKSX monACPX 0
CII E 10
T
RII AX
20
30
monH 40
50
CI BII BI
60
70
80
D
RI AIX 90
Transporter genes
100 kb
Auxiliary PKS genes Epoxide hydrolase
C
Type II thioesterase nigAI nigAII nigAIII
nigAIV
nigAV
nigAVI
nigAIX nigAVIII nigAVII
Methyltransferase
E
Regulatory genes CII
0
10
20
30
40
D
nigACPX 50
nigKSX 60
CI BII BI 70
80
90
100 kb
Figure 9.3 The organization of the biosynthetic gene clusters for the polyether antibiotics (A) nanchangmycin, (B) monensin, and (C) nigericin. The putative functions of the major genes are color-coded.
The Enzymology of Polyether Biosynthesis
193
based on the cytochrome P450s and O-methyltransferases that might be responsible for the late-stage hydroxylation and methylation steps of polyether biosynthesis was deemed to be inappropriate based on the widespread and nonspecific occurrence of such genes in Streptomyces genomes (Bentley et al., 2002; Ikeda et al., 2003; Oliynyk et al., 2007). For the isolation of the monensin biosynthetic gene cluster, a ketosynthase probe derived from the KS2 domain of the erythromycinproducing PKS of Saccharopolyspora erythraea (Oliynyk et al., 2003) was used to screen a cosmid library of genomic DNA from Streptomyces cinnamonensis (Leadlay et al., 2001). A candidate gene cluster harbored on 28 overlapping cosmids covering approximately 115 kb of contiguous DNA was selected from 40 positive candidates by restriction mapping using four restriction enzymes, and alignment and end-sequencing of the cosmids. This gene cluster was further confirmed by the generation of a largefragment deletion mutant, ABDmon, that had lost monensin production (Oliynyk et al., 2003). For the isolation of the nanchangmycin and the nigericin biosynthetic gene clusters, PKS-based probes gave multiple hybridization signals because modular type I PKS genes are very common in both polyether-producing microorganisms. A 3.2-kb fragment from the DEBS3 gene of the erythromycin-producing PKS (containing KR5, ACP5, KS6 and AT6) was used as the probe to clone the nanchangmycin gene cluster from Streptomyces nanchangensis NS3226, leading to the isolation of 90 cosmids from a genomic library of S. nanchangensis out of a total of 1920 clones (Sun et al., 2002). For the localization of the nanchangmycin gene cluster from the initially identified 90 candidates, the cosmids were ordered by agarose gel comparison of restriction enzyme digests as well as by Southern hybridization. After grouping of 75 of the original 90 clones into eight discrete clusters, one of these, Cluster A consisting of 17 cosmid clones spanning about 133 kb of contiguous DNA, was confirmed to be responsible for nanchangmycin biosynthesis by the generation of a targeted fragment deletion mutant SYH1 in which nanchangmycin production was abolished (Sun et al., 2002). To isolate the nigericin gene cluster, a 9.5-kb KpnI fragment from the rapamycin PKS cluster (encoding KS, AT, DH, KR, and ACP domains) was used to screen a genomic cosmid library from Streptomyces sp. DSM4137 (Harvey et al., 2007). Out of 1120 clones, 92 cosmids gave positive signals corresponding to 10 distinct clusters encoding apparent type I PKS genes (Haydock et al., 2004). Eventually the nigericin/abierixin biosynthetic gene cluster was localized by DNA sequencing and in silico analysis of the predicted modular PKS proteins to a 100-kb stretch found on four overlapping cosmid clones. A related, more focused, PCR-based strategy has also been used to identify the salinomycin biosynthetic gene cluster from Streptomyces albus
194
Tiangang Liu et al.
(Izumikawa et al., 2003). In this case, a pair of degenerate primers whose design was based on the conserved region of type I KS domains was used for PCR-amplification of S. albus DNA, giving rise to several native KS fragments of the expected size and sequence. One of these fragments was used to probe an S. albus genomic DNA library, leading to the isolation of a 4.5-kb BamHI fragment whose sequence strongly suggested that it might be part of the salinomycin PKS. The identity of the cluster was subsequently confirmed by using this same fragment for disruption of the salinomycin PKS. Although the homologous, PCR-generated probe showed improved specificity compared to the use of heterologous, PKS-derived probes, the success of cloning and confirmation of the polyether gene cluster was very much dependent on the abundance of modular type I PKSs in the specific genome target. Obviously the larger the number of competing PKS genes within the host genomic DNA, the more labor intensive will be the subcloning, screening, and sequencing effort required to isolate the desired polyether biosynthetic gene cluster. In our laboratory at Shanghai Jiaotong University we have recently been exploring the use of better-focused probes that are specific for polyether biosynthetic gene clusters. Comparison of the known polyether gene clusters at both the nucleotide and deduced amino acid sequence level reveals that the known and predicted epoxidase genes are not only highly conserved, especially in the motifs corresponding to the FAD cofactor and molecular oxygen binding sites, but are distinct from many other epoxidase genes from other pathways. Epoxidases such MonCI of the monensin pathway are thought to catalyze the first stage in the oxidative cyclization cascade by which the PKS-generated unsaturated polyketide intermediate is converted to the corresponding polyether. Based on the alignment of the conserved regions of four polyether epoxidase homologues (Fig. 9.4), several pairs of degenerate primers were designed. One pair of primers, NanO-J1 (50 -GTS ACC GTS GTG GAR CGY GAY-30 ) and NanO-J2 (50 -SGA NSC GCG CCC SGW GGC GTC-30 ; S¼C or G; About 500 bp NanO
VTVVERD
MonCl VTVVERD
DATGR SRL DATGRASRL DATGRGSRL
NigCl
VTVVERD
TmnC
VTVVERD
DA GRGSRL DASGRGSRL DATGRGSRL
Primer nanO-J1
Primer nanO-J2
Figure 9.4 Alignment of the conserved regions of the polyether epoxidases NanO, MonCI, NigCI, and TmnC, highlighting the positions corresponding to the designed degenerate primers nanO-J1 in the region conforming to the conserved motif of cofactor FAD binding site, and nanO-J2 in the region conforming to the conserved motif of the O2 binding site.
The Enzymology of Polyether Biosynthesis
195
R¼A or G; Y¼C or T; N¼A or C or G or T; W ¼ A or T) corresponding to the conserved upstream amino acid sequence VTVVERD and the downstream sequence DAT(S)GRA(G)SRL, respectively, was used to amplify by PCR to get a single specific product using as template genomic DNAs from the nanchangmycin, monensin, and nigericin producers. Each of the resultant PCR products was about 500 bp in size and was shown to match the predicted sequence. We are now exploring the use of these PCR-amplified epoxidase fragments as specific heterologous probes for new polyether gene clusters from known actinomycete polyether producers or new isolates. For example, we have recently identified several candidate polyether producers or polyether biosynthetic gene clusters by using these epoxidase-derived probes to screen noncultivatable microbial environmental DNA or other microbial sources (T. Liu et al., unpublished data).
3. Premonensin, the Parent Unsaturated Monensin Polyketide According to the original Cane-Westley hypothesis, formation of polyethers involves the initial generation of an all-trans (E )-unsaturated polyketide intermediate which is thought to undergo a series of stereospecific epoxidation reactions followed by or coupled to a cascade of cyclization reactions to generate the characteristic set of cyclic ether and acetal rings of the polyether (Cane et al., 1983). Notably, simple variations of this unifying hypothesis can account for the complete stereochemistry of all known polyether ionophores. In fact, the biosynthetic origins of the backbone carbon skeletons and individual oxygen atoms of several polyether antibiotics are in full accord with this proposal (Ajaz and Robinson, 1983; Cane and Hubbard, 1987; Cane et al., 1981, 1982; Hutchinson et al., 1981). On the other hand, direct verification of this unifying mechanistic hypothesis has proved elusive. While two groups reported independent total syntheses of the proposed linear monensin precursor, the (E,E,E )-triene premonensin, attempted conversion to monensin by feeding of the corresponding N-caprylcysteamine derivative to intact cultures of S. cinnamonensis was unsuccessful (Evans and DiMare, 1986; Holmes et al., 1988, 1990). These results, while not ruling out the postulated intermediacy of premonensin, left open the alternative possibility that the actual polyene intermediate might have one or more cis-(Z )-double bonds, as suggested by Townsend (Townsend and Basak, 1991), or even that oxidation might occur while the growing polyketide chain is elongated by the polyketide synthase. To address this critical issue, the Leadlay group in Cambridge applied a powerful molecular genetic strategy in which a thioesterase (TE) domain was fused to the C-terminus of an upstream PKS module, thereby facilitating
196
Tiangang Liu et al.
the hydrolytic release of the corresponding truncated polyketide intermediate (Cortes et al., 1995; Kao et al., 1995). To this end the TE domain from the erythromycin PKS (DEBS TE) was inserted into wildtype S. cinnamonensis by homologous recombination involving a single crossover into the monensin PKS so as to give two mutant strains, ZAHT-2 and ZAHT-1, in which the TE was fused immediately downstream of the ACP domains of modules 3 and 4 of the monensin PKS, respectively (Hughes-Thomas et al., 2003) (Fig. 9.5). The mutant strains each yielded the predicted truncated chain-elongation product, the tetraketide and the pentaketide 9, respectively, while monensin formation was completely suppressed. Detailed NMR analysis as well as comparison with synthetic standards established firmly that the disubstituted double bond in each of the two abortive polyketides had exclusively the (E )-stereochemistry. This result provided the first clear experimental evidence for the (E )-geometry of at least one of the double bonds of the proposed premonensin intermediate, while strongly suggesting that elongation of the entire parent polyketide chain precedes late-stage epoxidation and cyclization (Fig. 9.2A).
S. cinnamonensis wild -type monAI
monAII
monAIV
monAIII
1.4 Kb 0.8 Kb Kpnl MfeIMfeI XbaI DEBS TE Kpnl
Ligation pZAHT20
S. cinnamonensis ZAHT-1 monAI
monAII
KSQ AT ACP KS
O
S
AT
O
DH
ACP KS AT
S
O
Suicide vector 2.9 Kb
Single crossover monAIII
DEBS TE
ER DH KR
Sphl
monAIV
Vector
ER
KR ACP KS
S
DH KR AT
O
DH KR
ACP KS AT
S
O
ACP
S
TE
Release by TE
O
E geometry
O
O OH
O
9 pentaketide
O O
Figure 9.5 Strategy applied to confirm the geometry of the double bonds in the intermediate premonensin. Truncated polyketide synthases generated from the monensin PKS by integration of the DNA encoding the C-terminal thioesterase domain of the erythromycin-producing PKS into the C-terminal of extension module 4 of S. cinnamonensis in strain ZAHT-1 by a single crossover. The (E )-pentaketide 9 product was produced.
The Enzymology of Polyether Biosynthesis
197
The stereochemistry of the full-length (E,E,E )-polyketide triene was subsequently established by the construction of a series of blocked mutants of S. cinnamonensis from which the corresponding epoxidase gene, monCI, had been deleted by homologous recombination involving two successive single crossovers (Bhatt et al., 2005). The deletion of the targeted genes was achieved by inserting an Ohyg fragment encoding the hygromycin resistance gene (Blondelet-Rouault et al., 1997) between two PCR-amplified 1.2-kb fragments flanking the left and right chromosomal regions of monCI into a common BamHI site before insertion into a pKC1139 derivative that had been digested with HindIII and EcoRI so as to produce pABDCI. Since pKC1139 is a shuttle vector containing an apramycin resistance gene and the temperature-sensitive Streptomyces origin of replication from pSG5 (Kieser et al., 2000), incapable of replication at 40 , selection of a HygRAprR strain at 40 , after transfer of pABDCI by conjugation into S. cinnamonensis, could yield the deleted strain. An initial single crossover, followed by six rounds of propagation without antibiotic selection to allow for the second crossover, led to isolation of a desired HygRAprS colony (ABDCI). To eliminate any influence by MonBI and MonBII, which on the basis of bioinformatic analysis had originally been proposed to act as ‘‘isomerases’’ that might somehow convert (E )-double bonds to the corresponding (Z)-isomers (Leadlay et al., 2001; Oliynyk et al., 2003), the blocked mutants lacking monBI and monBII were generated from S. cinnamonensis ABDCI by an analogous strategy, giving the corresponding mutant strains ABDCIDBI, BHDCIDBII, and BHDCIDBIDBII. LC-MS analysis of crude organic extracts from each of these mutants indicated the complete absence of monensin and the formation of a pair of closely related (E,E,E ) triene lactones. The major peak in the LC-MS spectrum corresponded to the predicted mass of 10a, the d-lactone derivative of premonensin, accompanied by a minor component differing only by a single methylene unit, corresponding to the premonensin B derivative (Fig. 9.6). The structure and stereochemistry of 10a and 10b were fully confirmed by detailed NMR analysis of the purified products from a 7-l culture of mutant ABDCI. In particular, the NOESY NMR spectrum showed that all three double bonds in both of these lactones were exclusively of E geometry. The formation of the (E,E,E)-polyketide trienes 10a and 10b is fully consistent with the original mechanistic proposal of Cane and Westley, while firmly excluding all alternative mechanisms involving the generation of intermediates with Z double bonds (Leadlay et al., 2001; Oliynyk et al., 2003; Townsend and Basak, 1991) (Fig. 9.2). The fact that the double bond geometry of the isolated polyketide intermediates was independent of both MonBI and MonBII firmly ruled out the role that had initially been proposed for these two gene products as trans-cis double bond isomerases based on a perceived modest level of sequence similarity to known bacterial
198
Tiangang Liu et al.
S. cinnamonensis wild-type
monH
CI BII BI
Hygromycin resistance gene BamHI BamHI 1.2 kb 1.2 kb HindIII BamHI BamHI EcoRI
BamHI
HindIII
Ligation pABΔCI
40 °C
EcoRI
Ligation pKC1139
pKC1139
Double crossover
S. cinnamonensis ABΔCI
monH
BII BI
O
Release
O
OH O
O
HO
Hygromycin resistance gene
R
E,E,E-trienes 10a (R=CH3) and 10b (R=H)
Figure 9.6 Traditional knockout strategy used to generate mutants. The hygromycin resistance gene was cloned between the two arms for recombination, and the resistance gene replaced the target gene by double chromosomal crossing over. The intermediate (E, E, E)-triene lactones 10a and 10b accumulated in the monCI (ABDCI) deletion mutant.
D5-3-ketosteroid isomerases (Oliynyk et al., 2003). Indeed, as described below, MonBI and MonBII, which more closely resemble known epoxide hydrolases, are now thought to mediate the cascade nucleophilic cyclization of the proposed polyepoxide intermediates.
4. Epoxidases MonCI, NigCI, and NanO The accumulation of the (E, E, E )-triene lactones 10a and 10b in the S. cinnamonensis deletion mutant ABDCI provided strong evidence that the corresponding triene premonensin was the likely substrate for MonCI. This hypothesis was supported by complementation of S. cinnamonensis ABDCI by expression of MonCI carried on pMAJ21b under the control of the tipA promoter (Bhatt et al., 2005; Paget et al., 1999). Bioassay and HPLC-MS analysis of the crude extract showed that monensin production had been restored in ABDCI/pMAJ21b, while triene lactones 10a and 10b were no longer detectable. In earlier studies, the model unsaturated monoterpene ()-linalool 11 had been fed to the monensin-producing strain, S. cinnamonensis (Holmes et al., 1990). The resulting formation of linalool oxide 12, which could be explained by epoxidation of the electron-rich trisubstituted double bond of ()-linalool followed by epoxide-ring opening by nucleophilic attack by
199
The Enzymology of Polyether Biosynthesis
S. coelicolor/pMAJ21b MonCl epoxidase OH 11 (±)-linalool
O2
Epoxide hydrolase OH O
or spontaneous hydrolysis
O
OH 12 linalool oxide
Figure 9.7 Action of epoxidase MonCI on the model substrate ()-linalool 11 and the proposed action of MonB or NanI as the epoxide hydrolase acting on the intermediate to generate linalool oxide 12.
the nearby tertiary hydroxyl group, had suggested that S. cinnamonensis contains one or more enzymes with epoxidase activity. To prove that MonCI was responsible for the observed epoxidase activity, pMAJ21b carrying MonCI was introduced into Streptomyces coelicolor. Incubation of S. coelicolor/pMAJ21b with ()-linalool gave linalool oxide 12 with an efficiency 10- to 20-fold higher than that of wildtype S. coelicolor (Oliynyk et al., 2003) (Fig. 9.7). Based on their 60% sequence identity to MonCI, the homologous proteins NigCI in S. sp. DSM4137 and NanO in S. nanchangensis are also thought to serve as the analogous epoxidases in the corresponding nigericin and nanchangmycin biosynthetic pathways. The intriguing mechanism by which these epoxidases interact stereospecifically with their individual polyolefinic substrates remains to be resolved.
5. Epoxide Hydrolases MonBI/BII, NigBI/BII, NanI, and Lsd19 Sequence analysis of the monensin biosynthetic gene cluster had initially suggested that MonBI and BII might be responsible for trans-cis isomerization of the double bonds of a linear premonensin-like polyketide, with MonCII serving as the requisite epoxide hydrolase that catalyzes the cascade cyclization of the derived polyepoxide intermediate (Oliynyk et al., 2003). Gene deletion experiments, described above, ruled out any role for MonBI or BII in the isomerization of polyketide double bonds (Bhatt et al., 2005), while parallel studies established that MonCII was the thioesterase responsible for release of the mature polyether product from the acyl carrier protein (Harvey et al., 2006). These results prompted a re-examination of the roles of MonBI and BII as candidate epoxide cyclases. Comparison of the predicted MonBI and BII gene products to the Protein Database using the FUGUE homology recognition server (Shi et al., 2001) gave a number of hits in the a þ b barrel-fold superfamily, among which the closest structural template for MonBI and MonBII was the limonene epoxide hydrolase from Rhodococcus erythropolis (PDB entry ˚ ) (Arand et al., 2003). Based on alignment of the predicted 1NWW, 1.2 A
200
Tiangang Liu et al.
3D model of MonBI with this limonene epoxide hydrolase structure, E36 and E64 of MonBI were identified as plausible active site residues that might provide the requisite acid and base catalysis. To address directly the role of the monBI and monBII genes in monensin biosynthesis, in-frame deletion mutants of S. cinnamonensis deficient in one or both monB genes were generated using a strategy similar to that which had been used for the deletion of monCI. LC-MS analysis of the crude extracts of each mutant (ABDBI and ABDBII ) and the double mutant (ABDBIBII ) revealed the absence of even trace amounts of either monensin A or monensin B, confirming that both monB genes are essential for monensin production (Gallimore et al., 2006). Interestingly, these mutants did accumulate the corresponding C3-O-demethyl-monensin A and B metabolites at about 5% of the levels of monensin A and B in the wildtype, along with several other minor components (Gallimore et al., 2006) that were identified by introducing the monBII mutation into a high-level, monensin-producing industrial strain of S. cinnamonensis. Among the new metabolites identified by 2D NMR analysis were 9-epi-monensin A with the unnatural, epi-spiroacetal stereochemistry and the related C-26-deoxy9-epi-monensin A (Gallimore et al., 2006). Several faster-eluting polar metabolites displayed molecular ions of the same m/z as monensin A (693.5), monensin B and/or O-demethylmonensin A (679.5), and Odemethylmonensin B (665.5). It was proposed that these minor components most likely corresponded to abortive, partially cyclized triepoxide derivatives. Indeed, treatment of the individual HPLC-purified polar metabolites with HF resulted in the formation of products that coeluted with the corresponding monensin A, monensin B, or C-3-O-demethyl monensin B. The natural role of the MonB enzymes would therefore appear to be mediation of the cascade cyclization of the natural triepoxide intermediate generated by MonCI-catalyzed oxidation of (E,E,E )-premonensin. Whether these enzymes normally act alone or together, or in concert with MonCI, has yet to be determined. The homologous pair of proteins, NigBI and NigBII, from the nigericin biosynthetic gene cluster and the orthologous, pseudodimeric fusion protein NanI from the nanchangmycin biosynthetic gene cluster are each predicted to play analogous roles as epoxide cyclases in their respective polyether biosynthetic pathways, although these predictions remain to be tested either biochemically or by molecular genetic experiments. Recently, Oikawa and coworkers successfully cloned the lasalocid biosynthesis gene cluster and identified and over-expressed in E. coli BL21(DE3) an lsd19-encoded protein (Lsd19) with significant sequence similarity to MonB (Shichijo et al., 2008). The recombinant His6-tag-Lsd19 protein was directly purified on a Ni-NTA column. Interestingly, Lsd19 was able to convert the chemically synthesized substrate bis-epoxyprelasalocid 13 into lasalocid A 5 by a mechanism involving an energetically disfavored 6-endo-tet cyclization step,
201
The Enzymology of Polyether Biosynthesis
Lsd19 epoxide hydrolase
CO2H
OH
OH O
OH
O
O
6-endo-tet-cyclization
5 lasalocid A
13 bisepoxyprelasalocid OH
trichloroacetic acid 5-exo-tet-cyclization
CO2H OH
OH O
H
O
H O
14 isolasalocid A
Figure 9.8 Enzymatic conversion of synthetic bis-epoxyprelasalocid 13 by epoxide hydrolase Lsd19 to lasalocid A 5via a 6-endo-tet cyclization, and formation of isolasalocid 14 via a 5-exo-tet cyclization by treatment of 13 with trichloroacetic acid.
along with isolasalocid A 14 generated by a competing 5-exo-tet cyclization (Fig. 9.8). This discovery provided direct evidence that the MonB-like protein could indeed act as an epoxide hydrolase catalyzing stepwise cyclic ether formation, with the energetically disfavored 6-endo-tet cyclization that results in the formation of pyran ether ring being enzymatically catalyzed.
6. NanE, a Polyether-Specific Thioesterase Modular polyketide synthases responsible for the biosynthesis of macrolide antibiotics typically carry a dedicated, cis-acting thioesterase (TE) domain fused to the C-terminus of the most downstream PKS module, which releases the full-length polyketide product as the derived macrolactone. In contrast, the PKS gene clusters for monensin, nigericin, and nanchangmycin all lack an integrated, modular, type I TE domain (Harvey et al., 2007; Oliynyk et al., 2003; Sun et al., 2002, 2003). In the case of monensin biosynthesis, initial speculation had centered on two discrete ‘‘type II’’ TE domains encoded by monAX and monAIX. Disruption of either or both of these genes by replacement with a hygromycin resistance marker using homologous recombination resulted in only a modest decrease in monensin production, thereby ruling out a role for either of these genes in normal polyketide chain release, a conclusion that was supported by the finding that recombinant MonAIX did not hydrolyze the N-acetylcysteamine (SNAC) thioester of monensin or other model polyketide analogues (Harvey et al., 2006). For the nanchangmycin gene cluster, targeted inframe deletion of a putative metal-dependent thioesterase fused downstream of ACP14, which had originally been dubbed the CR domain on the assumption that it was a ‘‘chain-releasing’’ enzyme (Sun et al., 2003),
202
Tiangang Liu et al.
resulted in a 1000-fold decrease in nanchangmycin production (Liu et al., 2006). Polyether formation could not be restored, however, by in trans complementation by a CR domain or an ACP14-CR fusion domain under the control of the constitutively expressed ermE* promoter, while neither recombinant CR domain nor ACP14-CR di-domain could hydrolyze the nanchangmycin-SNAC thioester when tested in vitro (Liu et al., 2006). The homologous MonCII and NanE proteins were finally identified as the functional thioesterases of monensin and nanchangmycin biosynthesis, respectively, by a combination of gene inactivation and complementation experiments, as well as direct demonstration of the thioesterase activity of the corresponding recombinant proteins. Although both MonCII and NanE, as well as the closely related NigCII, belong to the common a/b hydrolase superfamily that also includes numerous modular PKS TE domains, the three type II polyether thioesterases form a distinct subfamily only distantly related to the TE domains of macrolide and nonribosomal peptide biosynthesis (Liu et al., 2006). The first evidence for the biochemical function of NanE in nanchangmycin biosynthesis came from targeted disruption of the nanE gene. Although S. nanchangensis is difficult to manipulate genetically by standard methods for Streptomyces (T. Kieser, 2000), the standard conjugation method has been improved by the use of a more effective shuttle vector and judicious selection of the medium used for conjugation. The shuttle vector pHZ1358 (Kieser et al., 2000; Gust et al., 2003; Sun et al., 2002) is well adapted for conjugative transfer from E. coli to Streptomyces and screening for double crossovers. The replicon of pHZ1358, which is derived from the multicopy plasmid pIJ101, is genetically very unstable in S. nanchangensis, resulting in its complete loss from this and other streptomycete hosts in the absence of positive selection pressure from the antibiotic thiostrepton. The efficiency of conjugation is also dramatically improved by the use of SFM medium (20 g soy flour suspended in 1 l tap water before autoclaving, followed by filtration of the cooled solution through four layers of gauze and addition of 20 g D-mannitol and 16 g agar and re-autoclaving) (Tsai et al., 2002). Other experimental conditions essential for efficient conjugation follow: (1) spores of the recipient strain should be freshly prepared by harvesting from 4- to 7-day cultures rather than using stocks of frozen spores; (2) the streptomycete spores suspended in 2 ml TES buffer (0.05 M, pH 8) must be heat-shocked at 50 for 10 min, then cooled to room temperature using tap water, before adding an equal volume (2 ml) of 2 pregermination medium (1% Difco yeast extract, 1% Difco casamino acid, 0.01 M CaCl2 [separately autoclaved and mixed well before use]); the mixture is then grown at 37 for 2.5 h to allow for germination; (3) the donor E. coli ET12567/pUZ8002 strain must be washed twice using fresh LB medium to remove the specific antibiotics (kanamycin and chloramphenicol) added to maintain the plasmid.
203
The Enzymology of Polyether Biosynthesis
This protocol, in combination with the method adapting PCRtargeting to Streptomyces (Gust et al., 2003), which enables the efficient replacement of the targeted chromosomal sequence by a selectable resistance gene marker generated by PCR, has been successfully applied to the inactivation of several genes in the nanchangmycin producer, S. nanchangensis. For example, this method has been used to replace the chromosomal glycotransferase gene nanG5 by an apramycin resistance gene (Fig. 9.9) to generate mutant LTDnanG5, which accumulated nanchangmycin aglycone (Liu et al., 2008). The method has also proved to be effective with several additional species of Streptomyces, including the validamycin producer, S. hygroscopicus 5008 (Bai et al., 2006), which had previously been recalcitrant to genetic manipulation. Using these methods, in-frame deletion of a 558-bp internal DNA fragment of nanE including the proposed catalytic triad required for thioesterase activity abolished all but traces of nanchangmycin production, without detectable accumulation of any recognizable late-stage polyketide or polyether intermediates, suggesting that hydrolytic release of the ACP-bound polyether might be the final step in nanchangmycin biosynthesis (Liu et al., 2006). The requirement for nanE was confirmed by in trans complementation of the LTDnanE mutant by introduction of a plasmid derived from pIB139 harboring nanE under control of the ermE* promoter. The thioesterase activity of NanE was then directly confirmed by the demonstration that recombinant NanE was able to hydrolyze nanchangmycin-SNAC. In the meantime, independent investigations confirmed a completely analogous role for the MonCII thioesterase in monensin biosynthesis. Although MonCII had originally been hypothesized to serve as an epoxide S. nanchangensis wild-type nanA6
Primer 1
39 nt
20 nt
aac(3)IV
nanG5 nanM
OriT
19 nt
3.2 kb
2.3 kb
3.2 kb
E.Coli ET12567/pUZ8002
39 nt primer 2 PCR BgLII
2.3 kb
BamHI
E.Coli BW25113/p1J790
pJTU1404
2.3 kb BgLII
BamHI
Ligation pHZ1358 10.8 kb
pJTU1403 37 °C
nanG5
3.2 kb
30 °C
Double crossover OH nanA6
aac(3)IV oriT
O
Produce HO
∇
S. nanchangensis LT nanG5
OH
O
19 O
O
O
15 nanchangmycin aglycone
O
O HO
OH
Figure 9.9 Use of PCR-targeting for the generation of S. nanchangensis mutants.Two long primers [59 nt (39þ20) and 58 nt (39þ19)] were used to amplify a cassette including a resistance gene and oriT for the representative knockout of the glycosyltransferase gene nanG5, resulting in production of the intermediate nanchangmycin aglycone 15.
204
Tiangang Liu et al.
cyclase, based on its perceived similarity to other hydrolases, the assignment of this latter role to MonBI and BII, as well as the demonstration that neither MonAX nor MonAIX were required for monensin biosynthesis, led to a reevaluation of the role of MonCII as the essential thioesterase (Harvey et al., 2006). Indeed, homology modeling suggested a close resemblance of MonCII to the a/b hydrolase aclacinomycin methylesterase ( Jansson et al., 2003) from Sarcina purpurascens (PDB ID: 1Q0Z). Complementation of the monensin nonproducing mutant S. cinnamonensis ABDCII by a plasmid harboring monCII restored monensin production. Interestingly, treatment of a crude cell-free extract of the ABDCII mutant with aqueous KOH resulted in release of trace amounts of monensin A, suggesting that the mature ACP-bound polyether is ordinarily released from the ACP by the action of the MonCII thioesterase.
6.1. In vitro studies of NanE thioesterase 6.1.1. Expression of NanE in Escherichia coli A PCR fragment carrying the nanE gene, engineered by PCR to carry NdeI and HindIII sites at both ends, was cloned into the corresponding sites of pET28a (Novagen). The derived plasmid harboring nanE was introduced by transformation into E. coli BL21 (DE3)/pLysS, and the resulting recombinant NanE protein was expressed carrying an N-terminal His6-tag. A single E. coli BL21(DE3)/pLysS colony was grown overnight at 37 in 5 ml of LB culture, which was then used to inoculate fresh LB medium (500 ml) in a 2-l flask supplemented with 30 mg/ml kanamycin and 25 mg/ml chloramphenicol to maintain the plasmids. The protein was induced at an OD600 of 0.8 with addition of 0.6 mM IPTG, and incubation was continued for 12 h at 24 (room temperature) (Liu et al., 2008). In comparison, when nanE was cloned into other vectors, such as pET30a and pET47b, for expression of NanE carrying a C-terminal His6-tag, or N-terminal His6-tag, the yield of protein was found to be much lower than the recombinant NanE expressed with pET28a. 6.1.2. Purification of His6tag-NanE Recombinant NanE protein was first subjected to metal-affinity chromatography using a Ni-NTA column to chelate the N-terminal His6-tag. Supernatant from the expression (30 ml) in Buffer A (50 mM Tris-HCl, 150 mM NaCl, pH 7.5) was loaded onto a 5-ml HisTrap HP Ni-NTA column by autoinjection at a flow rate of 1.5 ml/min. The column was then washed with 20 ml of buffer A (4 column volumes), followed by a 0 to 100% linear gradient of buffer B (50 mM Tris-HCl, 150 mM NaCl, 250 mM imidazole pH 7.5) over 100 ml (20 column volumes), and then a 20 ml 100% B wash (4 column volumes). The wildtype NanE was eluted in 45 to 60% Buffer B. The purity of protein (70%) was checked by SDS-PAGE. The protein was concentrated
The Enzymology of Polyether Biosynthesis
205
with a Centricon-10 concentrator (Amicon) to 2.5 ml and exchanged into buffer C (20 mM Tris-HCl, 10 mM NaCl, pH 8.0) with a PD-10 column (Pharmacia). The protein was then diluted to 3.5 ml and this sample was directly autoinjected onto the FPLC and purified by anion exchange on 20 ml HiTrap 16/10 Q/FF. The column was washed with 20 ml Buffer C (1 column volume), and eluted using a linear gradient of buffer D (20 mM Tris-HCl, 1M NaCl, pH 8.0): 0 to 30% D for 20 ml (1 column volume), 30 to 50% D for 40 ml (2 column volume), 50 to 100% D for 20 ml (1 column volume) and 100% D for 20 ml (1 column volume). The recombinant NanE was eluted from 35 to 40% Buffer B. The purity of protein was 85%, based on SDSPAGE. Finally, recombinant NanE was concentrated to 2 ml and further purified by gel filtration FPLC on Superdex 200. The column was equilibrated by washing with 240 ml (two-column volumes) of buffer E (50 mM phosphate buffer, pH 8.0) before injection. The NanE protein behaved as a dimer, eluting at 80 ml. The final purity of NanE was 95%, as determined by SDS-PAGE (Liu et al., 2008). 6.1.3. Removal of the His6-tag of recombinant NanE Removal of the N-terminal His6-tag from NanE was necessary for crystallographic studies. Due to the presence of an internal thrombin cut site in NanE, this protease cannot be used to remove the His6-tag. NanE carrying an HRV 3C protease target site downstream of the N-terminal His6-tag was therefore re-expressed by insertion into the BamHI and XhoI sites of the vector pET47b (Novagen). The resultant recombinant NanE protein (100 mg) was cleanly digested using one unit HRV 3C protease for 16 h at 4 in a Buffer A. Protease HRV 3C, which also carries a His6-tag, can be efficiently removed by passage through a Ni-NTA column. 6.1.4. Preparation of polyether-SNAC thioesters N-acetylcysteamine (SNAC) thioesters, which serve as analogues of the natural thioester linkage to the 20-A˚ phosphopantetheine arm of an acyl carrier protein, are commonly used for the assay of thioesterases of polyketide and non–ribosomal peptide biosynthesis. Several methods have been used to synthesize polyether-SNAC analogues (Harvey et al., 2006; Liu et al., 2006, 2008). In a representative procedure, polyether (0.03 mmol), diphenylphosphoryl azide (0.06 mmol), and Et3N (0.12 mmol) were added to 2 ml of CH2Cl2 under N2 and stirred at 4 for 2 h. N-Acetylcysteamine (0.12 mmol) was then added and the reaction was continued for another 24 h. The reaction mixture was partitioned between 0.1 N aqueous HCl (5 ml) and EtOAc (5 ml) and the aqueous layer was further extracted with EtOAc (25 ml). The organic extracts were washed with saturated NaCl (5 ml), dried over Na2SO4, concentrated under reduced pressure, and the resultant product was applied to a silica gel column with CuSO4-silica (2 cm) added to the top of the column to
206
Tiangang Liu et al.
remove the N-acetylcysteamine, giving the polyether-SNAC (50 to 60% yield). The polyether and derived polyether-SNAC were further separated by preparative RP-HPLC. The structure and purity of the polyetherSNAC were confirmed by NMR and HPLC-MS analysis (Cane et al., 2002; He et al., 2006) (Harvey et al., 2006; Liu et al., 2006, 2008).
7. Assay of Polyether Thioesterase Activity Thioesterase activity using SNAC thioesters as substrates is conveniently assayed by monitoring the release of free N-acetylcysteamine by reaction at room temperature with Ellman’s reagent (DTNB, 5,50 -dithio-2nitrobenzoate) to form the 3-thio-5-nitro-benzoate, which can be quantified by measuring the increase in UV absorbance at 412 nm (e ¼ 13, 600 M–1cm–1) in a UV spectrophotomer or using a 96-well plate reader. In some cases, DTNB can be included in the original incubation mixture and the reaction monitored continuously. If the DTNB inactivates the thioesterase, the DTNB must be added following quenching of the thioesterase reaction at a fixed time-point (Gokhale et al., 1999; Liu et al., 2006; Lu et al., 2002). In some cases it is more convenient to monitor the consumption of polyether directly by UV absorbance or by HPLC at appropriate time points (Fig. 9.10). Using these methods, both NanE and MonCII have been independently tested with a variety of polyether-SNAC and polyketide-SNAC substrate analogues. In a typical procedure, 10 mM NanE and 30 mM SNAC-thioester substrate were added to 500 ml of 50-mM phosphate buffer containing 5% methanol or 10% DMSO to dissolve the substrate, and the mixture was incubated overnight at 30 . MALDI-TOF MS and HPLC instruments can be used to conveniently detect the formation of polyether and long-chain polyketide products. The DTNB method was used to detect the hydrolysis of diketide-SNAC substrates. Figure 9.11 illustrates the substrates that were tested with NanE, which exhibited a strong preference for hydrolysis of polyether-SNAC derivatives while hydrolyzing both branched long- and short-chain polyketide-SNACs only poorly or not all (Liu et al., 2006). Similar experiments confirmed the role of MonCII as the thioesterase in the monensin pathway (Harvey et al., 2006). From the results of the steady-state kinetic analysis of NanE toward a range of SNAC substrates, nanchangmycin-SNAC was found to be the best substrate for NanE, strongly preferred over the corresponding aglycone lacking the deoxy sugar. Both in vivo and in vitro results indicated that attachment of the deoxy sugar to the nanchangmycin aglycone by the glycosyltransferase NanG5 occurs while the polyether is still bound to the ACP and prior to NanE-catalyzed chain release. The identity of the biosynthetically relevant ACP domain in S. nanchangensis remains to be determined.
20 Å phosphopantetheine arm
HS
H N
OH
H N O
S
Polyketide or polyether substrate
OH
H N O
O
N-acetylcycteamine O
ACP
H N
H N
HS
O
O
Polyketide or polyether substrate
Polyketide or polyether substrate
O O P O–
O O P O– O
Mimic
Polyketide or polyether substrate
Polyketide or polyether substrate
H N
S
SNAC
O
ACP
TE
–S
+
Free SNAC O
S
–O C 2
O
Polyketide or polyether substrate
S
O2N
H N
NO2 CO2–
Ellman’s reagent 5, 59-dithio-bis (2-nitrobenzoic acid)
TE CANS O 2N
Polyketide or polyether substrate
5
+
S
NO2 CO–2
–O C 2
3-thio-5-nitro-benzoate
l max = 412 nm, ε = 13,600 M–1 cm–1 Monitored by HPLC
Monitored by UV
Figure 9.10 Thioesterase activity assay by the use of DTNB to react with liberated HSNAC to generate 3-thio-5-nitro-benzoate with strong UVabsorbance at 412 nm, or by direct detection of polyether products by HPLC.
208
Tiangang Liu et al.
OCH3 H O
OH
O
O
O
NanE O
NACS
O
O
O
O HO
1
OH
16 nanchangmycin-SNAC OH
OH O
O
NanE O
NACS
O
O
O
O HO
15
OH
17 nanchangmycin aglycone-SNAC OH O OCH3
NanE O
NACS
O
O
O
O HO
2
MonCII OH
18 monensin-SNAC
OH O
O
NanE
O
O
NACS
O
O OH
O
N.R.
OH
19 salinomycin-SNAC O
OH
O
NACS
O
OH
NanE
O
NACS
HO 20 diketide-SNAC
O
HO
21 ketodiketide-SNAC OH
O
O
O NanE
NanE
N.R.
OH SNAC 22 hexaketide seco-lactone-SNAC
O
NanE
N.R.
OH SNAC 23 seco-7-dihydrolactone-SNAC
Figure 9.11 Polyether- and polyketide-SNAC substrates hydrolyzed by NanE and MonCII thioesterase. NR, no reaction.
The Enzymology of Polyether Biosynthesis
209
7.1. Site-directed mutagenesis of NanE The presumptive active site serine nucleophile of the NanE thioesterase was readily recognized by multiple sequence alignment with other thioesterases. Ser96 is located in a conserved GHSWG motif (Liu et al., 2008). Using the Modbase protein structure prediction package (http://modbase.compbio. ucsf.edu/modbase-cgi/index.cgi) (Pieper et al., 2006) to generate homology models for NanE suggested that His261 and Asp120 should be the nearest His and Asp residues to the putative active site Ser96, as deduced from alignment with a known a-amino acid ester hydrolase (PDB ID 1NX9; 13.00% sequence identity) (Barends et al., 2006). The residues predicted for the NanE catalytic triad also aligned with the independently predicted Ser103, His265, and Asp127 residues of MonCII (Harvey et al., 2006). The identity of each of the three components of the NanE catalytic triad of the NanE thioesterase was unambiguously identified by sitedirected mutagenesis, which abolished thioesterase activity in each case (Liu et al., 2008). The presence of Trp97 adjacent to the catalytic Ser96 in the conserved motif GHSWG is unique to the polyether thioesterases, with other polyketide thioesterases exhibiting a conserved GHSAG motif. Interestingly, while the W97A mutant of NanE lost the ability to hydrolyze the natural polyether substrate, nanchangmycin-SNAC, it retained thioesterase activity toward a simple diketide-SNAC.
8. Transcriptional Analysis of the Nanchangmycin Biosynthetic Pathway Genes The transcription of nanchangmycin biosynthetic genes was analyzed by RT-PCR in order to gain additional data on the order of biochemical events as well as the regulation of the pathway as a whole. Extraction of total RNA of S. nanchangensis was carried out using an RNeasy Mini Kit (QIAGEN), following the standard protocol for the isolation of total bacterial RNA, with some modifications. To measure the transcription of PKS genes in the nanchangmycin biosynthetic pathway, the RNA was directly extracted from 7-day S. nanchangensis spores treated with lysozyme solution for 10 to 20 min. For RT-PCR, the QIAGEN OneStep RT-PCR Kit was used following the manufacturer’s protocol. The RT-PCR experiments gave two important pieces of data. The first is that the nanE, nanA10 genes (corresponding to a discrete ACP), and nanO and nanI are coexpressed in the same operon (Liu et al., 2006). The second is that nanG5 is constitutive and is expressed earlier than the PKS genes (Liu et al., 2008).
210
Tiangang Liu et al.
9. Conclusions In spite of the significant progress that has been made in the understanding the molecular genetic and biochemical mechanisms of polyether biosynthesis, numerous important questions remain to be addressed. (1) Although it now appears very likely that the final step in the biosynthesis of both monensin and nanchangmycin is the thioesterase-catalyzed release of the mature polyether from its protein-bound state, the identity of the specific ACP domain to which the polyether is bound is not known in either case. The measured kcat values of NanE toward nachangmycinSNAC are unusually low, suggesting that attachment of the polyether to the physiological ACP may be required for full thioesterase activity. The functions of the unusual KSX and ACPX domains in the biosynthetic gene clusters for monensin, nanchangmycin, and nigericin remain uncertain. Deletion of these genes from S. cinnamonensis significantly decreased the yield of monensin but did not abolish it completely. It is possible that KSX is responsible for transfer of the initially-generated polyketide chain to ACPX, with subsequent oxidative cyclization and later-stage modifications occurring on the ACPX-bound intermediates, but further in vitro experiments will need to be carried out to test this hypothesis (Harvey et al., 2007). (2) The precise biochemical functions of the epoxidase and epoxide cyclase enzymes (MonCI and MonBI/BII; NanO and NanI) have yet to be demonstrated directly in vitro using the natural substrates. It remains unknown whether the two enzymes act successively or in concert, whether a discrete polyepoxide is actually generated, or whether the oxidative cyclization cascade takes place by a processive mechanism in which each oxidation is coupled to ether ring formation. Similarly, the mechanism by which the epoxidase recognizes the specific face of each double bond remains a matter of speculation, as does the order in which the individual double bonds are oxidized. Solution of these problems will require the collaborative efforts of multiple research groups to bring to bear the most powerful tools of molecular genetics, mechanistic enzymology, organic synthesis, and organic structure determination.
ACKNOWLEDGMENTS This work was supported in part by the Ministry of Science and Technology of China (973 and 863), the National Science Foundation of China, the Shanghai Municipal Council of Science and Technology, and Shanghai Leading Academic Discipline Project to Z.D., and in part by National Institutes of Health funding (GM22172) to D.E.C.
The Enzymology of Polyether Biosynthesis
211
REFERENCES Ajaz, A. A., and Robinson, J. A. (1983). The utilization of oxygen atoms from molecular oxygen during the biosynthesis of monensin-A. J. Chem. Soc. Chem. Commun. 12, 679–680. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Arand, M., Hallberg, B. M., Zou, J., Bergfors, T., Oesch, F., van der Werf, M. J., de Bont, J. A., Jones, T. A., and Mowbray, S. L. (2003). Structure of Rhodococcus erythropolis limonene-1,2-epoxide hydrolase reveals a novel active site. EMBO J. 22, 2583–2592. Bai, L., Li, L., Xu, H., Minagawa, K., Yu, Y., Zhang, Y., Zhou, X., Floss, H. G., Mahmud, T., and Deng, Z. (2006). Functional analysis of the validamycin biosynthetic gene cluster and engineered production of validoxylamine A. Chem. Biol. 13, 387–397. Barends, T. R., Polderman-Tijmes, J. J., Jekel, P. A., Williams, C., Wybenga, G., Janssen, D. B., and Dijkstra, B. W. (2006). Acetobacter turbidans alpha-amino acid ester hydrolase: How a single mutation improves an antibiotic-producing enzyme. J. Biol. Chem. 281, 5804–5810. Bentley, S. D., Chater, K. F., Cerdeno-Tarraga, A. M., Challis, G. L., Thomson, N. R., James, K. D., Harris, D. E., Quail, M. A., Kieser, H., Harper, D., Bateman, A., Brown, S., et al. (2002). Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417, 141–147. Bhatt, A., Stark, C. B., Harvey, B. M., Gallimore, A. R., Demydchuk, Y. A., Spencer, J. B., Staunton, J., and Leadlay, P. F. (2005). Accumulation of an E,E,E-triene by the monensin-producing polyketide synthase when oxidative cyclization is blocked. Angew. Chem. Int. Ed. Engl. 44, 7075–7078. Blondelet-Rouault, M. H., Weiser, J., Lebrihi, A., Branny, P., and Pernodet, J. L. (1997). Antibiotic resistance gene cassettes derived from the omega interposon for use in E. coli and Streptomyces. Gene 190, 315–317. Cane, D. E., Celmer, W. D., and Westley, J. W. (1983). Unified stereochemical model of polyether antibiotic structure and biogenesis. J. Am. Chem. Soc. 105, 3594–3600. Cane, D. E., and Hubbard, B. R. (1987). Polyether biosynthesis. 3. Origin of the carbon skeleton and oxygen atoms of lenoremycin. J. Am. Chem. Soc. 109, 6533–6535. Cane, D. E., Kudo, F., Kinoshita, K., and Khosla, C. (2002). Precursor-directed biosynthesis: Biochemical basis of the remarkable selectivity of the erythromycin polyketide synthase toward unsaturated triketides. Chem. Biol. 9, 131–142. Cane, D. E., Liang, T. C., and Hasler, H. (1982). Polyether biosynthesis. 2. Origin of the oxygen atoms of monensin A. J. Am. Chem. Soc. 104, 7274–7281. Cane, D. E., Liang, T. -C., and Hasler, H. (1981). Polyether biosynthesis. Origin of the oxygen atoms of monensin A. J. Am. Chem. Soc. 103, 5962–5965. Cortes, J., Haydock, S. F., Roberts, G. A., Bevitt, D. J., and Leadlay, P. F. (1990). An unusually large multifunctional polypeptide in the erythromycin-producing polyketide synthase of Saccharopolyspora erythraea. Nature 348, 176–178. Cortes, J., Wiesmann, K. E., Roberts, G. A., Brown, M. J., Staunton, J., and Leadlay, P. F. (1995). Repositioning of a domain in a modular polyketide synthase to promote specific chain cleavage. Science 268, 1487–1489. Day, L. E., Chamberlin, J. W., Gordee, E. Z., Chen, S., Gorman, M., Hamill, R. L., Ness, T., Weeks, R. E., and Stroshane, R. (1973). Biosynthesis of monensin. Antimicrob. Agents Chemother. 4, 410–414. Demydchuk, Y., Sun, Y., Hong, H., Staunton, J., Spencer, J. B., and Leadlay, P. F. (2008). Analysis of the tetronomycin gene cluster: Insights into the biosynthesis of a polyether tetronate antibiotic. ChemBioChem 9, 1136–1145.
212
Tiangang Liu et al.
Donadio, S., Staver, M. J., McAlpine, J. B., Swanson, S. J., and Katz, L. (1991). Modular organization of genes required for complex polyketide biosynthesis. Science 252, 675–679. Evans, D. A., and DiMare, M. (1986). Asymmetric synthesis of premonensin, a potential intermediate in the biosynthesis of monensin. J. Am. Chem. Soc. 108, 2476–2478. Gallimore, A. R., Stark, C. B., Bhatt, A., Harvey, B. M., Demydchuk, Y., BolanosGarcia, V., Fowler, D. J., Staunton, J., Leadlay, P. F., and Spencer, J. B. (2006). Evidence for the role of the monB genes in polyether ring formation during monensin biosynthesis. Chem. Biol. 13, 453–460. Gokhale, R. S., Hunziker, D., Cane, D. E., and Khosla, C. (1999). Mechanism and specificity of the terminal thioesterase domain from the erythromycin polyketide synthase. Chem. Biol. 6, 117–125. Gumila, C., Ancelin, M. L., Delort, A. M., Jeminet, G., and Vial, H. J. (1997). Characterization of the potent in vitro and in vivo antimalarial activities of ionophore compounds. Antimicrob. Agents Chemother. 41, 523–529. Gust, B., Challis, G. L., Fowler, K., Kieser, T., and Chater, K. F. (2003). PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc. Natl. Acad. Sci. USA 100, 1541–1546. Harvey, B. M., Hong, H., Jones, M. A., Hughes-Thomas, Z. A., Goss, R. M., Heathcote, M. L., Bolanos-Garcia, V. M., Kroutil, W., Staunton, J., Leadlay, P. F., and Spencer, J. B. (2006). Evidence that a novel thioesterase is responsible for polyketide chain release during biosynthesis of the polyether ionophore monensin. ChemBioChem 7, 1435–1442. Harvey, B. M., Mironenko, T., Sun, Y., Hong, H., Deng, Z., Leadlay, P. F., Weissman, K. J., and Haydock, S. F. (2007). Insights into polyether biosynthesis from analysis of the nigericin biosynthetic gene cluster in Streptomyces sp. DSM4137. Chem. Biol. 14, 703–714. Haydock, S. F., Mironenko, T., Ghoorahoo, H. I., and Leadlay, P. F. (2004). The putative elaiophylin biosynthetic gene cluster in Streptomyces sp. DSM4137 is adjacent to genes encoding adenosylcobalamin-dependent methylmalonyl CoA mutase and to genes for synthesis of cobalamin. J. Biotechnol. 113, 55–68. He, W., Wu, J., Khosla, C., and Cane, D. E. (2006). Macrolactonization to 10-deoxymethynolide catalyzed by the recombinant thioesterase of the picromycin/ methymycin polyketide synthase. Bioorg. Med. Chem. Lett. 16, 391–394. Holmes, D. S., Dyer, U. C., Russell, S., Sherringham, J. A., and Robinson, J. A. (1988). Total synthesis of a putative triene intermediate in monensin biosynthesis activated as a caprylcysteamine thiol ester. Tetrahedron Lett. 29, 6357–6360. Holmes, D. S., Sherringham, J. A., Dyer, U. C., Russell, S. T., and Robinson, J. A. (1990). Synthesis of putative intermediates on the monensin biosynthetic pathway and incorporation experiments with the monensin-producing organism. Helvetica Chim. Acta 73, 239–259. Hughes-Thomas, Z. A., Stark, C. B., Bohm, I. U., Staunton, J., and Leadlay, P. F. (2003). Intermediates released from a polyether-producing polyketide synthase provide insight into the mechanism of oxidative cyclization. Angew. Chem. Int. Ed. Engl. 42, 4475–4478. Hutchinson, C. R., Sherman, M. M., Vederas, J. C., and Nakashima, T. T. (1981). Biosynthesis of macrolides. 5. Regiochemistry of the labeling of lasalocid A by [13C,18O]-labeled precursors. J. Am. Chem. Soc. 103, 5953–5956. Ikeda, H., Ishikawa, J., Hanamoto, A., Shinose, M., Kikuchi, H., Shiba, T., Sakaki, Y., Hattori, M., and Omura, S. (2003). Complete genome sequence and comparative analysis of the industrial microorganism Streptomyces avermitilis. Nat. Biotechnol. 21, 526–531.
The Enzymology of Polyether Biosynthesis
213
Ishikawa, J., and Hotta, K. (1999). FramePlot: A new implementation of the frame analysis for predicting protein-coding regions in bacterial DNA with a high G þ C content. FEMS Microbiol. Lett. 174, 251–253. Izumikawa, M., Murata, M., Tachibana, K., Ebizuka, Y., and Fujii, I. (2003). Cloning of modular type I polyketide synthase genes from salinomycin producing strain of Streptomyces albus. Bioorg. Med. Chem. 11, 3401–3405. Jansson, A., Niemi, J., Mantsala, P., and Schneider, G. (2003). Crystal structure of aclacinomycin methylesterase with bound product analogues: Implications for anthracycline recognition and mechanism. J. Biol. Chem. 278, 39006–39013. Kao, C. M., Luo, G., Katz, L., Cane, D. E., and Khosla, C. (1995). Manipulation of macrolide ring size by directed mutagenesis of a modular polyketide synthase. J. Am. Chem. Soc. 117, 9105–9106. Kieser, T., Bibb, M. J., Buttner, M. J., Chater, K. F., and Hopwood, D. A. (2000). Practical Streptomyces Genetics. The John Innes Foundation, UK. ISBN 0-7084-0623-8. Leadlay, P. F., Staunton, J., Oliynyk, M., Bisang, C., Cortes, J., Frost, E., HughesThomas, Z. A., Jones, M. A., Kendrew, S. G., Lester, J. B., Long, P. F., McArthur, H. A., et al. (2001). Engineering of complex polyketide biosynthesis—insights from sequencing of the monensin biosynthetic gene cluster. J. Ind. Microbiol. Biotechnol. 27, 360–367. Liu, T., Lin, X., Zhou, X., Deng, Z., and Cane, D. E. (2008). Mechanism of thioesterasecatalyzed chain release in the biosynthesis of the polyether antibiotic nanchangmycin. Chem. Biol. 15, 449–458. Liu, T., You, D., Valenzano, C., Sun, Y., Li, J., Yu, Q., Zhou, X., Cane, D. E., and Deng, Z. (2006). Identification of NanE as the thioesterase for polyether chain release in nanchangmycin biosynthesis. Chem. Biol. 13, 945–955. Lu, H., Tsai, S. C., Khosla, C., and Cane, D. E. (2002). Expression, site-directed mutagenesis, and steady state kinetic analysis of the terminal thioesterase domain of the methymycin/picromycin polyketide synthase. Biochemistry 41, 12590–12597. McDonald, F. E., and Towne, T. B. (1994). syn-Oxidative polycyclization of hydroxy polyenes: A new approach to polyether synthesis. J. Am. Chem. Soc. 116, 7921–7922. Nakamura, M., Kunimoto, S., Takahashi, Y., Naganawa, H., Sakaue, M., Inoue, S., Ohno, T., and Takeuchi, T. (1992). Inhibitory effects of polyethers on human immunodeficiency virus replication. Antimicrob. Agents Chemother. 36, 492–494. Oliynyk, M., Samborskyy, M., Lester, J. B., Mironenko, T., Scott, N., Dickens, S., Haydock, S. F., and Leadlay, P. F. (2007). Complete genome sequence of the erythromycin-producing bacterium Saccharopolyspora erythraea NRRL23338. Nat. Biotechnol. 25, 447–453. Oliynyk, M., Stark, C. B., Bhatt, A., Jones, M. A., Hughes-Thomas, Z. A., Wilkinson, C., Oliynyk, Z., Demydchuk, Y., Staunton, J., and Leadlay, P. F. (2003). Analysis of the biosynthetic gene cluster for the polyether antibiotic monensin in Streptomyces cinnamonensis and evidence for the role of monB and monC genes in oxidative cyclization. Mol. Microbiol. 49, 1179–1190. Otoguro, K., Kohana, A., Manabe, C., Ishiyama, A., Ui, H., Shiomi, K., Yamada, H., and Omura, S. (2001). Potent antimalarial activities of polyether antibiotic, X-206. J. Antibiot. (Tokyo) 54, 658–663. Paget, M. S., Chamberlin, L., Atrih, A., Foster, S. J., and Buttner, M. J. (1999). Evidence that the extracytoplasmic function sigma factor sigmaE is required for normal cell wall structure in Streptomyces coelicolor A3(2). J. Bacteriol. 181, 204–211. Pieper, U., Eswar, N., Davis, F. P., Braberg, H., Madhusudhan, M. S., Rossi, A., MartiRenom, M., Karchin, R., Webb, B. M., Eramian, D., Shen, M. Y., Kelly, L., et al. (2006). MODBASE: A database of annotated comparative protein structure models and associated resources. Nucleic Acids Res. 34, D291–D295.
214
Tiangang Liu et al.
Shi, J., Blundell, T. L., and Mizuguchi, K. (2001). FUGUE: Sequence-structure homology recognition using environment-specific substitution tables and structure-dependent gap penalties. J. Mol. Biol. 310, 243–257. Shichijo, Y., Migita, A., Oguri, H., Watanabe, M., Tokiwano, T., Watanabe, K., and Oikawa, H. (2008). Epoxide hydrolase Lsd19 for polyether formation in the biosynthesis of lasalocid A: Direct experimental evidence on polyene-polyepoxide hypothesis in polyether biosynthesis. J. Am. Chem. Soc. 130, 12230–12231. Sood, G. R., Robinson, J. A., and Ajaz, A. A. (1984). Biosynthesis of the polyether antibiotic monensin-A. Incorporation of propionate-2-d2 and (R)- and (S)-propionate-2-d. J. Chem. Soc. Chem. Commun. 1421–1423. Steinrauf, L. K., Czerwinski, E. W., and Pinkerton, M. (1971). Comparison of the monovalent cation complexes of monensin, nigericin, and dianemycin. Biochem. Biophys. Res. Commun. 45, 1279–1283. Sun, Y., Zhou, X., Dong, H., Tu, G., Wang, M., Wang, B., and Deng, Z. (2003). A complete gene cluster from Streptomyces nanchangensis NS3226 encoding biosynthesis of the polyether ionophore nanchangmycin. Chem. Biol. 10, 431–441. Sun, Y., Zhou, X., Liu, J., Bao, K., Zhang, G., Tu, G., Kieser, T., and Deng, Z. (2002). ‘‘Streptomyces nanchangensis,’’ a producer of the insecticidal polyether antibiotic nanchangmycin and the antiparasitic macrolide meilingmycin, contains multiple polyketide gene clusters. Microbiology 148, 361–371. Townsend, C. A., and Basak, A. (1991). Experiments and speculations on the role of oxidative cyclization chemistry in natural product biosynthesis. Tetrahedron 47, 2591–2602. Tsai, S. C., Lu, H., Cane, D. E., Khosla, C., and Stroud, R. M. (2002). Insights into channel architecture and substrate specificity from crystal structures of two macrocycle-forming thioesterases of modular polyketide synthases. Biochemistry 41, 12598–12606. Westley, J. W. (1981). Polyether antibiotics—biosynthesis. Antibiotics (New York) 4, 41–73.
C H A P T E R
T E N
Enzymology of the Polyenes Pimaricin and Candicidin Biosynthesis Juan F. Martı´n* and Jesu´s F. Aparicio† Contents 1. Introduction 2. Pimaricin as a Prototype of Small Polyenes: Discovery and Properties 3. Pimaricin Biosynthesis in S. natalensis 3.1. The pimaricin gene cluster 3.2. Formation of pimaricinolide: The pimaricinolide synthase complex 3.3. Pimaricinolide tailoring and export 4. Regulation of Pimaricin Biosynthesis 4.1. Transcriptional regulators 4.2. Regulation by cholesterol oxidase 4.3. Inducers of pimaricin biosynthesis 4.4. Global regulatory mechanisms 5. Candicidin: A Prototype of ‘‘Aromatic’’ Polyenes 6. The Candicidin/FR-008 Gene Cluster 7. Biosynthesis of PABA: The pabAB and pabC Genes 8. The Polyketide Synthases 9. Monooxygenase Genes: Modifications of the Polyketide Chain 10. Transporter Genes 11. Genes Related to Mycosamine Biosynthesis 12. Regulatory Genes 13. Phosphate Represses Expression of the pabAB Gene 14. Future Perspectives Acknowledgments References
* {
216 217 218 218 218 223 224 224 225 226 226 228 229 230 233 234 235 236 236 237 237 238 238
Universidad de Leo´n, Dpto. Biologı´a Molecular – A´rea de Microbiologı´a, Fac. CC. Biolo´gicas y Ambientales and Institute of Biotechnology INBIOTEC, Leo´n, Spain Institute of Biotechnology INBIOTEC, and Microbiology Area, Biology Faculty, University of Leo´n, Leo´n, Spain
Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04610-2
#
2009 Elsevier Inc. All rights reserved.
215
216
Juan F. Martı´n and Jesu´s F. Aparicio
Abstract Pimaricin and candicidin are prototypical representatives of the ‘‘small’’ and the ‘‘aromatic’’ polyene macrolides, respectively. Pimaricin, produced by Streptomyces natalensis, is an important antifungal agent used in human therapy for the treatment of fungal keratitis, and in the food industry to prevent mould contamination. Five large polyketide synthase subunits are implicated in the formation of the pimaricin macrolactone ring, while P450 mono-oxygenases and a glycosyltransferase are responsible for ring ‘‘decoration.’’ Two transcriptional regulators directly modulate transcription of certain genes in the cluster; an extracellular cholesterol oxidase also participates in such control. Two regulatory locus external to the pimaricin gene cluster, encoding the two-component PhoR-PhoP system for phosphate limitation response, and a g-butyrolactone receptor, contribute to the control of pimaricin production. A quorum-sensing inducer of pimaricin biosynthesis (PI-factor) has been identified recently. Candicidin (also named FR-008) contains an aromatic para-aminoacetophenone moiety derived from para-aminobenzoic acid (PABA), which acts as a starter unit in the biosynthesis. Two genes in the candicidin cluster, pabAB and pabC, are involved in the biosynthesis of PABA. Six polyketide synthase subunits encoded by fscA to fscF, containing 21 modules, are involved in the synthesis of the candicidin aglycone. At least three genes ( fscO, fscP, and fscTE ) encode aglycone modification enzymes. Three genes—fscM1, M2, and M3—are involved in mycosamine biosynthesis and its attachment to the aglycone. The candicidin cluster also includes two ABC transporter genes and four putative transcriptional regulators. Expression of the PABA synthase gene ( pabAB) is drastically repressed by phosphate.
1. Introduction Polyene antibiotics constitute a large group of antifungal agents produced mainly by Streptomyces spp (Martı´n, 1977). Polyenes belong to the group of macrolide antibiotics, and are therefore characterized by a hydroxylated macrocyclic lactone ring normally containing one sugar (a few polyenes have no sugars, and others have two); their distinctive characteristic is the presence of a chromophore formed by a system of three to eight conjugated double bonds in the macrolactone ring (Caffrey et al., 2008; Omura and Tanaka, 1984). The polyene macrolides are always larger (up to twice the size) than those of standard 14- or 16-membered nonpolyene macrolides, with lactone rings of 26 to 44 carbon atoms (Aparicio et al., 2004). These molecules are amphipathic. The region where the chromophore lies has a planar, rigid lipophilic nature, while the hydroxylated region is typically flexible and hydrophilic. Most polyene macrolides have a sugar moiety in their macrocyclic ring, linked by a glycosidic bond. This is
Pimaricin and Candicidin Synthesis and Regulation
217
usually the amino-sugar mycosamine (3-amino-3,6-dideoxy-D-mannose), although some exceptions have been described (Aparicio et al., 2004; Martı´n, 1977, 1984). The macrolactone also incorporates a six-membered hemi-ketal ring with a carboxyl group formed by oxidation of a methyl branch. These three characteristics are believed to be the basis for the mode of action of these molecules, since they are responsible for their interaction with the sterol molecules in fungal cell membranes. These are predominantly ergosterol, and most polyenes show high affinity for it, forming complexes sustained by hydrophobic interactions between the hydrophobic portion of the polyene and the sterol, causing changes in membrane permeability that result in cell death (reviewed in Aparicio et al., 2004). Unfortunately, polyenes can also interact, although to a lesser extent, with the cholesterol present in mammalian membranes, causing toxic side effects when used for the treatment of systemic fungal infections. Despite this, polyene macrolides remain the antifungal drugs of choice, since resistance of fungal pathogens to these antibiotics is an extremely rare event. In addition to their antifungal properties, polyenes are also active against enveloped viruses, parasites and prion disease agents (Caffrey et al., 2008). In this article we describe the interesting enzymology of the pimaricin and candicidin biosynthetic systems. Practical details and protocols may be found in Chapter 11 in this volume and in the scientific literature cited in this article.
2. Pimaricin as a Prototype of Small Polyenes: Discovery and Properties Pimaricin, is a commercially important tetraene macrolide antifungal antibiotic produced by various Streptomyces strains. It represents an archetypical representative of the small glycosylated polyenes. Being a polyene, its antifungal activity lies in its specific interaction with membrane ergosterol, but unlike other polyenes this action is not exerted via permeabilization of the membrane (Welscher et al., 2008). Pimaricin is used mainly for the treatment of fungal keratitis (Aparicio et al., 2004), and also in the food industry to prevent mould contamination of cheese and other nonsterile foods. Pimaricin, also known as natamycin or tennecetin, was first obtained from a Streptomyces strain isolated from a soil sample from Pietermaritzburg, in the Natal province of South Africa (Struyk et al., 1957)—hence the term ‘‘natamycin,’’ and the name of its main producer, S. natalensis. It is also produced by other strains, such as S. chattanoogensis, and S. gilvosporeus. Patrick et al. (1958) were the first to show that pimaricin was a polyene antibiotic with tetraene structure and the empirical formula C34H49O14N, but its correct covalent structure was not established until 1966 (Golding
218
Juan F. Martı´n and Jesu´s F. Aparicio
et al., 1966), and its stereochemical structure only some 24 years later (Lancelin and Beau, 1990). The molecule consists of a 26-membered macrolactone ring with four conjugated double bonds that constitute the chromophore (Fig. 10.1). Like other polyene macrolides it also contains a mycosamine moiety linked to the macrolactone ring by a b-glycosidic bond at C15, and an exocyclic carboxy group at C12. A special feature of the pimaricin molecule is the presence of an epoxy group at C4–C5. As already mentioned, pimaricin is effective against fungal infections, particularly in the eye but, given its wide spectrum of activity, its low likelihood of causing microbial resistance, and especially its low toxicity to mammalian cells, it has also been widely used as a food preservative. It has been authorized both by the European Union (additive E235) and the U.S. Food and Drug Administration (FDA) for protecting foods from yeast and mold contamination and possible inherent risks of mycotoxin poisoning. Besides its major application on cheese and sausages, in some countries pimaricin is also used in other products such as juices, wine, sauces, fruit, fish, poultry, bakery products, and yoghurt. Notably, it is the only antifungal agent with a GRAS (generally regarded as safe) status.
3. Pimaricin Biosynthesis in S. natalensis 3.1. The pimaricin gene cluster The pimaricin gene cluster was identified by hybridization using as probes DNA from KS domains [the most highly conserved domains among PKS genes (Aparicio et al., 1996)] that direct the biosynthesis of the macrocyclic polyketide immunosuppressant rapamycin in S. hygroscopicus (Aparicio et al., 1996; Schwecke et al., 1995). DNA sequencing and analysis of the pimaricin biosynthetic genes revealed a cluster spanning about 100 kb and containing 18 genes (Fig. 10.2). The sequenced region encodes 13 PKS modules within five multifunctional enzymes, and 13 additional proteins that govern post-PKS modification of the polyketide skeleton, export and regulation of gene expression (Anto´n et al., 2004, 2007; Aparicio et al., 1999, 2000) (Table 10.1). In silico analysis of the pimaricin biosynthetic genes, together with the chemical structure of pimaricin and that of analogues produced by specific mutants, have allowed a model for pimaricin biosynthesis to be proposed (Fig. 10.3).
3.2. Formation of pimaricinolide: The pimaricinolide synthase complex Synthesis of the pimaricin macrolactone ring (pimaricinolide) is initiated by the PimS0 protein, which contains the domain structure CoA Ligase-ACPKSS-AT-ACP. The CoA ligase is thought to activate acetate, forming an
219
Pimaricin and Candicidin Synthesis and Regulation
O
OH HO
O O
O
OH
HOOC OH H2N HO H3C
O
O
Pimaricin OH HO
O O
HOOC
O
OH
OH H2N HO H3C
O O 4,5-de-epoxypimaricin OH
HO
O O
HOOC
OH
O
OH 12-carboxypimaricinolide OH HO
O O
OH
OH
O
Pimaricinolide
Figure 10.1 Structure of pimaricin and derivatives.
220
Juan F. Martı´n and Jesu´s F. Aparicio
0
20
M R
K
S4
S3
40
S2
60
I J A B E C GF S0
80
kb
S1
100
DH
Figure 10.2 Organization of the gene cluster for pimaricin biosynthesis. The transcriptional direction and the relative sizes of the genes are indicated by pointed boxes. PKS genes (S0-S4) are indicated in dark grey. Table 10.1 Functions of proteins encoded by the pimaricin biosynthetic gene cluster
PimS0 PimS1 PimS2 PimS3 PimS4 PimA PimB PimC PimD PimE PimF PimG PimH PimI PimJ PimK PimM PimR
PKS, loading module PKS, modules 1---4 PKS, modules 5---10 PKS, module 11 PKS, module 12 þ chain release and cyclization ABC transporter ABC transporter GDP-ketosugar aminotransferase P450 monooxygenase (epoxidase) Cholesterol oxidase Ferredoxin P450 monooxygenase Efflux pump Thioesterase (type II) GDP-mannose dehydratase Mycosamine transferase PAS regulator SARP-LAL regulator
acyladenylate that would be transferred by the ACP adjacent to the KSS, which would not catalyze any condensation reaction but would allow the transfer of the growing polyketide chain to the C-terminal ACP. This then feeds the acetyl moiety to the KS of module 1, PimS1, for the first elongation step (Aparicio et al., 1999). Alternatively, the CoA ligase and N-terminal ACP may represent vestiges of domains that activate another starter acid and so may be redundant. The PimS0 protein appears to generate an acetyl starter unit by decarboxylation of a malonyl group. This peculiar KS is also present in other polyene PKSs (Aparicio et al., 2003), and contains a Ser residue instead of the catalytic Cys of conventional condensing KS domains. Site-specific mutagenesis of the Ser residue to Cys in the nystatin PKS had no effect on nystatin biosynthesis (Brautaset et al., 2003), suggesting that either this residue is not important for decarboxylation of malonyl-CoA or that acetyl-CoA can be used as starter instead of malonyl-CoA.
PimS0
PimS1
Loading
Module1
Module2
Module3
Module4
DH
DH
DH
KR CoL
ACP
KS
AT
KS
ACP
AT
ACP
S
AT
KS
KR ACP
KS
AT
KR ACP
AT
Module5
KR ACP
DH KS
ACP
AT
O
HO
PimS3
ACP
KS
AT
KS
AT
S
S
ACP
KS
S
O
O
KS
ACP
KS
AT
S
S
HO
O
HO
HO
O
HO
HO
HO
O
HO
HO
HO
O
HO
HO
HO
HO
HO
HO HO HO
HO
HO
OH HO
O
OH
NH2
TE
HO
O
HO
ACP
O
HO
O
KR
S
HO
PimD
H3C
AT
HO
O
OH
KS
HO
O
HO HOOC
ACP
S
O
HO
O
AT
O
HO
O
DH
KR ACP
O
HO
HO
Module12
KR
O
HO
OH
AT
PimS4
Module11 DH
KR
KR ACP
Module10
Module9
Module8
KR
KR KS
S
O
Module7
Module6
KR
AT
S
O
O
O
KS
S
S
S
O
PimS2
O
HOOC
HO
O
OH
HO HO
PimK O H3C
OH
O
O
HO HO
NH2
OH HOOC
O
OH
PimS4(TE)
O PimG
OH GDP
O
GDP O
HO
OH
OH
GDP-mannose
PimJ, PimC
O HO
O O
O
CH2OH
OH HO
CH3
NH2 OH
GDP-mycosamine
Figure 10.3 (Continued)
OH
OH
O
222
Juan F. Martı´n and Jesu´s F. Aparicio
After initiation, synthesis of pimaricinolide continues on PimS1 (four modules) with the formation of most of the chromophore (three out of four conjugated double bonds). After the first four elongation steps carried out by PimS1, the chain is transferred to PimS2 for subsequent elongation. PimS2 (six modules), and subsequently PimS3 (one module) and PimS4 (one module) catalyze incorporation of eight further carboxylic acid building blocks and their appropriate modifications to generate the skeleton of pimaricin (Fig. 10.3). AT domains of type I modular PKSs fall into two distinct categories depending on whether their substrate is malonyl-CoA (or in the case of some ATs in ‘‘loading modules,’’ acetyl-CoA), or the longer-chain 2Smethylmalonyl-CoA (Marsden et al., 1994), as discussed in detail elsewhere (Haydock et al., 1995). All PIMS ATs belong to the class of acetate extenders except for module 7 AT, which incorporates propionate (Fig. 10.3) and is thought to be responsible for the incorporation of carbons 11, 12, and the exocyclic methyl group that will undergo later oxidation to form the free carboxyl function of the aglycone. The KR domain of module 9 is thought to be inactive, showing nonconservative replacements in the two highly conserved N-terminal glycines of the consensus motif GxGxxGxxxA for NADP(H) binding (Scrutton et al., 1990). Such an inactive KR should leave C9 as a carbonyl group, which would be required for the formation of the hemiketal ring of the mature pimaricin molecule upon interaction between the C9 keto ad C13 hydroxy groups (Fig. 10.1). Formation of this ring is thought to assist in the folding of the pimaricin polyketide chain to allow correct cyclization on completion of its synthesis. Finally, a thioesterase (TE) domain at the C-terminal end of PimS4 is involved in the release of the completed polyketide from the enzyme as a macrocyclic lactone (Sharma and Body, 2007) (Fig. 10.3). Yet another TE is encoded by the pimI gene. Remarkably, PimI showed very weak homology to the TE domain that forms part of module 12, suggesting that the two activities have different origins. PimI resembles ‘‘type II’’ TEs, which function as editing enzymes during polyketide biosynthesis to promote correct product accumulation (Kim et al., 2002). Figure 10.3 Model of pimaricin biosynthesis in S. natalensis. The loading module PimS0 activates an acetyl starter unit and four modular PKS proteins (PimS1 to PimS4) catalyze the sequential assembly of pimaricinolide from one methylmalonyl and 11 malonyl extender units. Each circle represents an enzymatic domain. ACP, acyl carrier protein; AT, acyltransferase; CoL, carboxylic acid:CoA ligase; DH, b-hydroxyacylthioester dehydratase; KR, b-ketoacyl-ACP reductase; KS, b-ketoacyl-ACP synthase;TE, thioesterase. The KR domain in black (module 9) is predicted to be nonfunctional. The AT in module 7 (grey) is predicted to incorporate a propionate extender unit. Lactonization of the acyl chain between C-1 and C-25 results in formation of the pimaricinolide ring. Bold lines indicate the 2-carbon building units of the polyketide chain. Pimaricinolide is converted to pimaricin in three steps, as shown.
Pimaricin and Candicidin Synthesis and Regulation
223
3.3. Pimaricinolide tailoring and export Three post-PKS modifications are required to convert pimaricolide into pimaricin. These include the formation of a glycosidic bond at C15 between the aglycone and mycosamine, oxidation of the methyl group at C12 to a carboxy, and epoxidation of the C4–C5 double bond. The pimaricin gene cluster contains a gene for a GDP-mannose dehydratase (PimJ). This suggests that the mycosamine sugar (3-amino,3,6-dideoxyD-mannose) is synthesized from GDP-mannose, which can be channeled from primary metabolism. A straightforward pathway to mycosamine starting from GDP-mannose would involve GDP-mannose dehydratase leading to GDP-4-keto-6-deoxy-D-mannose by a 3, 4 isomerization, to give GDP3-keto-6-deoxy-D-mannose followed by a transamination to form GDPmycosamine (Aparicio et al., 2003). Two mycosamine biosynthetic enzymes, the dehydratase PimJ, and the aminotransferase PimC, are encoded by the cluster, while an isomerase-encoding gene is missing (Aparicio et al., 2000). This feature is common to all known polyene clusters (Aparicio et al., 2003). The attachment of the mycosamine moiety is carried out by the glycosyltransferase PimK, a protein that resembles eukaryotic glucuronosyl transferases. Inactivation of pimK in S. natalensis resulted in the formation of the aglycone 4,5-de-epoxypimaricinolide as a major product (Fig. 10.1), indicating that glycosylation with mycosamine is the penultimate step (followed by epoxidation) in the pimaricin biosynthetic pathway (Fig. 10.2). This aglycone product turned out to be extremely unstable, and retained no antifungal activity, suggesting that the presence of the mycosamine sugar in the aglycone of the tetraene pimaricin is essential for the antifungal activity (unpublished results). Two cytochrome P450 monooxygenases are encoded in the cluster, PimD and PimG. Inactivation of pimD in S. natalensis resulted in the formation of 4, 5-de-epoxypimaricin (Fig. 10.1) as the only product (Mendes et al., 2001). The production of this compound at high yield indicated that the formation of the epoxide group at C4–C5 is the last step in pimaricin biosynthesis. The lack of epoxidation in the absence of glycosylation with mycosamine suggests that the oxidase shows strict specificity for the glycosylated polyene substrate. This gene was further characterized by overexpression of its product in Escherichia coli with a 6-His affinity tag. This enabled its kinetic analysis and the in vitro C4–C5 epoxidation of 4,5-deepoxypimaricin into pimaricin (Mendes et al., 2005). The lack of an efficient gene delivery system for the pimaricin producer, S. natalensis, has hampered functional analysis of the second monooxygenase, PimG. This enzyme is thought to constitute the C12 oxidase. This hypothesis was strengthened after inactivation of amphN, the pimG analogue in the amphotericin producer (Carmody et al., 2005), which demonstrated its involvement in exocyclic carboxyl group formation. The recent
224
Juan F. Martı´n and Jesu´s F. Aparicio
development of a gene transfer system based on intergeneric conjugation from E. coli (Enrı´quez et al., 2006), together with manipulation of the autonomously replicating plasmid pSNA1 found in the pimaricin producer (Mendes et al., 2000), will enable an easier manipulation of pimG and also of other genes responsible for pimaricin biosynthesis. Two ABC transporter-encoding genes are present in the pimaricin cluster, PimA and PimB, which are believed to be responsible for the secretion of pimaricin from the cell. Both contain transmembrane and nucleotide-binding domains, a feature that is typical of class 3 ABC transporters (Davidson et al., 2008). They are thought to associate to form a heterodimer that exports the antibiotic (Aparicio et al., 2003). An extra gene, pimH, coding for a putative efflux pump (Aparicio et al., 2000), lies at the right end of the pimaricin cluster and could also be involved in the export of pimaricin. This hypothesis has recently been strengthened after inactivation of the pimA and pimB homologues, nysH and nysG, which encode the nystatin ABC heterodimer transporter. Such mutants still exported a considerable amount of nystatin, suggesting the existence of alternative transport systems (Sletta et al., 2005). The presence of redundant transport systems for secretion of antibiotics and some other bioactive metabolites is well documented (Martı´n et al., 2005).
4. Regulation of Pimaricin Biosynthesis 4.1. Transcriptional regulators Two transcriptional regulators are encoded by the pimaricin gene cluster, PimR and PimM. PimR is the archetype of a new class of regulators that combine an N-terminal domain corresponding to the SARP family of transcriptional activators with a C-terminal half homologous to guanylate cyclases and large ATP-binding regulators of the LuxR family (LAL). Disruption of pimR totally abrogated transcription of pimE, encoding an oxidase (cholesterol oxidase) found in the middle of the pim cluster, and also reduced transcription of all the key enzyme-encoding genes for pimaricinolide construction to very low levels, thus blocking pimaricin production completely (Anto´n et al., 2004). The direct binding of PimR to the pimE promoter has recently been demonstrated by electrophoretic mobility-shift assays (EMSA) (unpublished data). PimM constitutes a second transcriptional activator of pimaricin biosynthesis. It is a regulator that combines an N-terminal PAS domain with a C-terminal HTH motif of the LuxR type. Unlike the majority of prokaryotic PAS domain-containing regulators, which function as sensor kinases of two-component systems (Taylor and Zhulin, 1999), PimM does not belong to a two-component system. Inactivation of pimM from the S. natalensis
Pimaricin and Candicidin Synthesis and Regulation
225
chromosome resulted in complete loss of pimaricin production, suggesting that PimM is a second positive regulator of pimaricin biosynthesis (Anto´n et al., 2007). Gene expression analyses by reverse transcriptase-polymerase chain reaction (RT-PCR) of the pimaricin gene cluster revealed the targets for the PimM regulatory protein. According to these analyses the genes responsible for initiation ( pimS0) and the first cycles of polyketide chain extension ( pimS1), are among the major targets for regulation, although other pim genes are also differentially affected, thus accounting for the lack of pimaricin production. Another notion derived from these experiments is that PimM plays its regulatory role independently of PimR (Anto´n et al., 2007). Recently, heterologous expression of PimM in E. coli and its purification has enabled the identification of a direct binding of this regulator to the promoter that controls the expression of pimS2, pimS3, and pimS4, the remaining three polyketide synthase genes responsible for the formation of pimaricinolide (Aparicio et al., 2000; J. F. Aparicio, unpublished data).
4.2. Regulation by cholesterol oxidase The location of a cholesterol oxidase-encoding gene ( pimE ) in the centre of the pimaricin gene cluster (Fig. 10.2) was a mystery since no obvious role for a cholesterol oxidase could be predicted in antifungal production (for a review of cholesterol oxidases and their effect on polyene macrolide biosynthesis, see Aparicio and Martı´n, 2008). Inactivation of its encoding gene, however, completely blocked pimaricin production, and gene complementation restored antibiotic biosynthesis, thus demonstrating its involvement in antifungal production (Mendes et al., 2007a). This finding was totally unexpected, given that PimE is an extracellular-type cholesterol oxidase. The enzyme was purified from S. natalensis culture broths and, surprisingly, it restored pimaricin production when added to DPimE mutant cultures or ‘‘resting cells.’’ Other cholesterol oxidases also triggered pimaricin production, suggesting that these enzymes could act as signaling proteins for polyene biosynthesis (Mendes et al., 2007a). It therefore seems plausible that PimE and other cholesterol oxidases could act as fungal sensors via ergosterol detection (ergosterol being the major sterol found in fungal membranes) and in response trigger, by an unknown mechanism, antifungal production. This regulatory model is an attractive paradigm because cholesterol oxidase genes are present in other known biosynthetic gene clusters of antifungal polyenes, such as filipin ( pteG) (Ikeda et al., 2003) and rimocidin/CE-108 (rimD) (Seco et al., 2004). All these polyketides are elicited by soil bacteria against their fungal competitors with ergosterol-containing membranes, and the production of such antibiotics would confer a selective advantage for the producing organisms (Aparicio and Martı´n, 2008).
226
Juan F. Martı´n and Jesu´s F. Aparicio
4.3. Inducers of pimaricin biosynthesis Secondary metabolism and cell differentiation in actinomycetes are often controlled by diffusible butyrolactones, which act as quorum-sensing signals (Horinouchi and Beppu, 1992). Recently, we identified, purified and characterized a novel quorum-sensing inducer (PI-factor; 2,3-diamino -2,3-bis (hydroxymethyl)-1,4-butanediol) (Fig. 10.4) in the pimaricin producer. Such molecules triggered pimaricin production in S. natalensis mutants that had lost their ability to produce pimaricin at nanomolar concentrations in a manner characteristic of quorum-sensing (Recio et al., 2004). Interestingly, S. natalensis seems to be able to integrate different quorum signals since A-factor from Streptomyces griseus (Hara and Beppu, 1982) also triggers pimaricin production in the mutants (Recio et al., 2004). The exact mechanism remains to be elucidated. No quorum-sensing inducers have been identified in other polyene producers to date, but it is conceivable that this kind of signal could constitute a common feature in the production of these compounds. During PI-factor purification, we isolated a second pimaricin-inducing fraction which contains glycerol (Recio et al., 2006). This compound, and also ethylene glycol and 1,2 or 1,3-propanediol, could elicit the production of pimaricin, although at much higher concentrations than PI-factor. Interestingly, glycerol also stimulated the production of seven different polyene macrolides by the respective wildtype producer strains, including nystatin by S. noursei, rimocidin by Streptomyces rimosus, candicidin by S. griseus, filipin by Streptomyces filipinensis, tetrafungin by Streptomyces albulus, eurocidin by Streptomyces eurocidicus, and fungichromin by Streptomyces cinnamoneum. Although the precise mechanism remains to be established, the action of glycerol seems to be independent of PI-factor induction effect (Recio et al., 2006).
4.4. Global regulatory mechanisms In Streptomyces species, the concentration of phosphate in the culture medium is one of the most important nutritional factors affecting secondary metabolite biosynthesis (Liras et al., 1990). Phosphate limitation triggers HO
NH2
HO OH H2N
OH
Figure 10.4 Structure of PI factor, a pimaricin inducer in S. natalensis.
Pimaricin and Candicidin Synthesis and Regulation
227
expression changes of a large number of genes, and this response is mediated by the two-component PhoR–PhoP system (Rodriguez-Garcı´a et al., 2007; Sola-Landa et al., 2003, 2005). Recently it has been demonstrated that concentrations of inorganic phosphate above 1 mM drastically reduced pimaricin production, and that this negative regulation is exerted at the transcriptional level in S. natalensis via the two-component PhoR–PhoP system (Mendes et al., 2007b). RT-PCR showed that at 10 mM phosphate, expression of all the pimaricin biosynthesis ( pim) genes, including the pathway-specific positive regulators pimR and pimM, are fully repressed. Functional analyses of mutants in the two-component system have also suggested that phosphate control of the pimaricin genes is mediated indirectly by PhoR-PhoP, involving modification of other regulators. Characterization of pimaricin production in phoP-disrupted mutants and in phoR-phoP deletion mutants revealed that both mutants showed reduced sensitivity to phosphate control and an important increase in antifungal production (up to 80%) (Mendes et al., 2007b). Transcriptional control by phosphate of genes involved in polyene macrolide antibiotic biosynthesis has also been reported for candicidin (Asturias et al., 1990), suggesting that production of other polyenes might be increased by manipulation of this regulatory locus. The presence of g-butyrolactones in different species of Streptomyces and their role in triggering secondary metabolite biosynthesis is well documented (Horinouchi and Beppu, 1992). They can be classified into three groups depending on the structural differences in the C2 side chain, including the A-factor type (Mori, 1983), virginiae butanolides (Yamada et al., 1987) and the IM-2 type (Sato et al., 1989); they all bind to specific receptor proteins which act as mediators of the signaling cascade (Beppu, 1995). A gene (sngR) encoding a butyrolactone-receptor protein has been reported in S. natalensis. Its characterization by disruption has led to the conclusion that SngR acts as a negative regulator of both sporulation and antifungal production (Lee et al., 2005). Recently, a gene located immediately upstream and divergently from sngR, which codes for a BarX homologue (SngA), has been proposed to act as a pleiotropic regulator, since its disruption resulted in a decrease in pimaricin production and in the appearance of an uncharacterized pigment (Lee et al., 2008). These regulators (BarX homologues) usually control the biosynthesis of the g-butyrolactone autoregulator, and the observed decrease in pimaricin could then be attributed to reduction in the concentration of a putative g-butyrolactone in the cells. However, we have never found a true butyrolactone in S. natalensis (Recio et al., 2004). It would be interesting to test if the receptor protein is specific for butyrolactones or whether it may interact with the PI-factor, and also to determine if there is any relationship between PI-factor regulation and the regulation exerted by SngA.
228
Juan F. Martı´n and Jesu´s F. Aparicio
5. Candicidin: A Prototype of ‘‘Aromatic’’ Polyenes Candicidin (Fig. 10.5), produced by Streptomyces griseus IMRU 3570, is the prototype of the group of polyene macrolides known as ‘‘aromatic polyenes ’ because they contain an aromatic ring as a side chain of the carbon skeleton of the macrolide ring (Martı´n, 1977). This group includes, in addition to candicidin (compound FR-008), ascosin, aureofungin, ayfactin, heptamycin, levorin, trichomycin, vacidin, and compound DJ400B2 among others (Martı´n, 1984). The aromatic ring corresponds to a paraaminoacetophenone (or an N-methyl para-aminoacetophenone) moiety. This fragment derives from PABA (Gil et al., 1985; Martı´n, 1977), as shown by incorporation of labeled precursors (Martı´n and Liras, 1976) and by enzymological studies on a specific PABA synthase encoded by a gene in the candicidin gene cluster (see below). These aromatic polyene macrolides show a very high activity against Candida, Saccharomyces and various filamentous fungi. Their minimal inhibitory concentrations are frequently in the range of 0.1 to 1 mg/ml, but they appear to be more toxic to humans than nonaromatic small polyene O O O
OH
CH3
OH O
H2N
CH3 CH3
R1
R2
O
R3
OH
R4
O
O OH
CH3 OH NH2 COOH OH
FR-008/candicidin complex
R1
R2
R3
R4
FR-008-III, -II
=O
H
OH
OH
FR-008-V, -I
OH
H
OH
OH
FR-008-VI, -IV
=O
OH
H
H
Figure 10.5 Structure of the candicidin/FR-008 components III,V, andVI, differing in the R1, R2, R3, and R4 substituents.The internal hemiketal ring (circled ) present in candicidin/FR-008-III, -V and -VI is absent from candicidin/FR-008-I, -II and -IV, respectively.
Pimaricin and Candicidin Synthesis and Regulation
229
macrolides like pimaricin; for this reason, the aromatic polyenes have found only a limited use as antifungal agents. Candicidin was studied in detail from the biosynthetic point of view (Criado et al., 1993; Gil et al., 1980, 1985). The gene cluster encoding most of the candicidin biosynthetic pathway was reported later (Campelo and Gil, 2002). Antibiotic FR-008, produced by Streptomyces sp FR-008, was initially described as a heptaene macrolide with the same p-aminoacetophenonecontaining aglycone as candicidin D from S. griseus. The carbohydrate moiety was reported to be different from mycosamine or perosamine (Hu et al., 1994). However the same research group has recently reported that the amino-sugar present in all FR-008 components is mycosamine and, therefore, antibiotic FR-008 is identical to candicidin (Zhou et al., 2008). The structural elucidation of candicidin (Zielinski et al., 1979) revealed that it consists of four components named candicidins A, B, C and D. Up to six components of FR-008 (named FR-008-I to VI) have been identified in the mixture extracted from cultures of Streptomyces spp. FR-008 (Fig. 10.5). Component FR-008-III was found to be identical to candicidin D (Zhou et al., 2008). FR-008-V lacks a carboxyl signal and contains an additional hydroxyl group at carbon-3 (Fig. 10.5) as compared to component FR008-III. Similarly, FR-008-VI differs from FR-008-III in lacking the hydroxyl groups at C-3 and C-13 and having an additional hydroxyl group at C-5 in FR-008-VI. FR-008-III, FR-008-V and FR-008-VI, containing the internal hemiketal ring, are the original components of the mixture, whereas components I, II and IV appear to be formed by spontaneous opening of the hemiketal ring during storage of the culture broth (Zhou et al., 2008). In summary, the chemical structures support the conclusion that candicidin and FR-008 are mixtures of identical components (Chen et al., 2003), and, therefore, the original name candicidin should be preferred. Here we use both names to give proper credit to the origin of the different gene sequences.
6. The Candicidin/FR-008 Gene Cluster The initial study of the candicidin gene cluster (Campelo and Gil, 2002) was followed by a more detailed characterization of the FR-008 cluster (Chen et al., 2003) (Fig. 10.6). The conclusion of Chen and coworkers is that the two gene clusters are essentially the same (96 to 100% identical nucleotides in all the genes sequenced in both strains). In the following description the gene designation proposed by Chen et al. (2003) is used because it is more comprehensive. A comparison
230
Juan F. Martı´n and Jesu´s F. Aparicio
pabAB fscA
fscC
fscB
fscF
fscE
fscD
fscO pabC RI RII RIII RIV MI MII F FE TE
Figure 10.6 Organization of the genes of the candicidin/FR-008 cluster. For simplicity, the fsc designation common to genes fscR1 to fscTE has been omitted. Note that the fscA gene, encoding the first module of the polyketide synthase with PABA-CoA ligase activity, lies immediately downstream of pabAB.
between the candicidin genes of S. griseus IMRU3570 and those of Streptomyces sp FR-008 is shown in Table 10.2. Twenty-one ORFs extending for 137.2 kb of contiguous DNA have been identified (Table 10.2).
7. Biosynthesis of PABA: The pabAB and pabC Genes Initial evidence based on the incorporation of labeled PABA established that PABA is the direct precursor of the para-aminobenzoyl-CoA starter unit of the polyketide chain (Martı´n and Liras, 1976; Martı´n and McDaniel, 1975). The PABA synthase of S. griseus, an enzyme involved in the biosynthesis of para-aminobenzoic acid from chorismic acid, was purified and characterized (Gil et al., 1980, 1985). This enzyme is also present in the fungimycin (another aromatic polyene) producer Streptomyces coelicolor var aminophylus, but not in several other Streptomyces strains that do not form aromatic polyenes. The enzyme was purified by DEAE-Biogel and Sephacryl S-200 filtration and showed an approximate molecular mass of 50 kDa. Cloning of the gene encoding this enzyme was the first step in elucidating the genetic basis of candicidin biosynthesis (Gil and Hopwood, 1983; Martı´n and Gil, 1983). In vivo formation of PABA synthase is repressed by the aromatic amino acids and PABA, but not by anthranilic acid. Inorganic phosphate strongly repressed but did not inhibit PABA synthase activity (Gil et al., 1985). Bioinformatic analysis of the PabAB protein revealed that it is a modified 4-amino-4-deoxychorismate (ADC) synthase containing both an amino transferase (type I) and a chorismate-binding motif. A similar enzyme has been found in Streptomyces venezuelae involved in chloramphenicol biosynthesis (Brown et al., 1996; Chang et al., 2001). The enzymes from S. griseus
Table 10.2 Deduced functions of the ORFS identified in candicidin/FR-008 gene cluster and comparison with other polyene pathway genes Homologous genes in other polyene pathways
FR-008 genes Strepomyces FR-008
S. griseus
aa No.
Product
Deduced function
pabAB
pabAB
723
ADC synthase
pabC
—a
257
ADC lyase
fscA
canP1
1,743
Type I PKS
fscB fscC fscD fscE fscF fscMI
canP2 canP3 canPF —a —a canG
5541 10,625 9550 7771 2049 458
Type I PKS Type I PKS Type I PKS Type I PKS Type I PKS GlycosylTransferase
fscMII
canA
352
fscMIII
canM
402
—a
458
GDP-ketosugar aminoTransferase GDP-mannose-4, 6-dehydratase FAD-dependent monooxygenase
Biosynthesis of starter unit PABA Biosynthesis of starter unit PABA Loading module and module 1 Modules 2—4 Modules 5—10 Modules 11—16 Modules 17—20 Modules 21 þ TE Attachment of mycosamine Mycosamine biosynthesis
fscO
Nys
Amph
Pim
—
—
—
—
—
—
nysA
amphA
pimS0
nysB nysC nysI nysJ nysK nysDI
amphB amphC amphI amphJ amphK amphDI
pimS1 pimS2 pimS3 pimS4 pimK
nysDII
amphDII
pimC
Mycosamine biosynthesis
nysDIII
amphDIII
pimJ
Putative tailoring enzyme
—
—
— (continued)
Table 10.2 (continued) Homologous genes in other polyene pathways
FR-008 genes
a
Strepomyces FR-008
S. griseus
aa No.
Product
Deduced function
Nys
Amph
Pim
fscP
canC
393
amphN
pimG
canF
64
nysM
amphM
pimF
fscTE
canT
285
Type II thioesterase
fscTI fscTII fscRI
canRA canRB —a
335 239 222
nysG nysH orf4
fscRII
orf1
942
Regulation
nysRIII
—
—
fscRIII
orf2
1036
Regulation
nysRII
—
—
fscRIV
orf3
1005
ABC Transporter ABC Transporter Transcriptional regulator Transcriptional regulator Transcriptional regulator Transcriptional regulator
Formation of carboxyl group at C—18 Electron transfer in P450 system Removal of aberrant intermediates Efflux of candicidin Efflux of candicidin Regulation
nysN
fscFE
Cytochrome P450 monooxygenase ferredoxin
Regulation
nysRI
—
—
The missing genes in the S. griseus candicidin cluster have not been sequenced yet.
nysE
— amphG amphH —
pimI pimA pimB —
233
Pimaricin and Candicidin Synthesis and Regulation
and Streptomyces sp. FR-008 are 93% identical at the amino acid level. Glutamine seems to be the amino donor in the formation of ADC, as occurs also in E. coli and other microorganisms with similar ADC enzymes. The role of PabAB seems to be synthesis of ADC from chorismic acid and glutamine (Fig. 10.7). In E. coli, this reaction is catalyzed by two enzymes encoded by pabA (amidotransferase subunit) and pabB (ADC synthase), whereas the S. griseus enzyme is a fused bifunctional protein. The pabAB gene is not involved in the biosynthesis of polyenes lacking the aromatic moiety and this gene is missing from the genomes of such Streptomyces species. Sequencing of the FR-008 cluster provided evidence for another gene, pabC, lying upstream of pabAB, although separated by several ORFs (Fig. 10.6). It encodes a 257-aa protein resembling ADC lyases from different bacteria and plants (Basset et al., 2004). This enzyme is likely to convert ADC synthesized by the PabAB protein to the aromatic PABA, releasing a molecule of pyruvate (Fig. 10.7). The pabC-homologous gene of the candicidin-producer S. griseus IMRU 3570 has not been sequenced and it would be interesting to clone and disrupt it to confirm its involvement in the biosynthesis of the aromatic moiety of these polyenes in two different strains.
8. The Polyketide Synthases Six ORFs encoding typical type I polyketide synthase subunits, containing 21 modules, lie in the right-hand part of the cluster (Fig. 10.6). They are named fscA to fscF. All of them except fscA (located downstream of pcbAB) are expressed in the same orientation (opposite that of pcbAB-fscA). The FscA protein contains a loading module with a putative N-terminal ATP-dependent carboxylic acid: CoA ligase, as proposed initially by Criado et al. (1993), and an ACP domain. Its role appears to be to load the CoAactivated para-aminobenzoic acid precursor to start the nascent polyketide chain (Campelo and Gil, 2002; Chen et al., 2003). The linkage of pabAB COOH
COOH
COOH
CH2
CH2 PabAB O
COOH
OH Chorismic acid
CO-S-CoA
O NH2 ADC
PabC COOH
Candicidin PABA-CoA ligase FscA NH2 canP1 PABA
NH2 PABA-CoA
Figure 10.7 Roles of PabAB and PabC in the biosynthesis of PABA from chorismic acid. ADC, 4-amino-4-deoxychorismate. PABA is activated to PABA-CoA by the CoAligase domain of the first PKS module (FscA or CanP1).
234
Juan F. Martı´n and Jesu´s F. Aparicio
and fscA (probably forming a transcriptional unit) in opposite orientation to all other PKS genes supports this role for the fscA-encoded protein. Similar loading domains have been found in the pimaricin gene cluster (Aparicio et al., 1999) and in those for other polyketides such as rapamycin (Schwecke et al., 1995). Each of the following polyketide synthase subunits, FscB, FscC, FscD, FscE, and FscF, contain, respectively, three, six, six, four and one modules. The PKS motifs contained in each module and some modifications observed in their active centers are indicated in Table 10.3.
9. Monooxygenase Genes: Modifications of the Polyketide Chain Recently, the biosynthesis of candicidin/FR-008 has been studied in more detail (Zhou et al., 2008). Of the components of the FR-008 complex isolated from the culture broth, three (components III, V, and VI) were confirmed as natural products, while the three others are believed to Table 10.3 Modules in each polyketide synthase of candicidin/FR-008 cluster PKS
Modules
1 FscA (loading domain) FscB 2,3,4 FscC
5,6,7,8,9,10
FscD
11,12,13,14,15,16
FscE
17,18,19,20
FscF
21,TE
Structure of motifs
CoA-ligase, ACP, KS, AT, ACP
The three AT domains have the mAT (methylmalonyl-specific) sequence Modules 5 to 10 all contain a DH-KR reduction loop and appear to be involved in the assembly of six double bonds of the chromophore. Modules 12, 14, 15, and 16 have the same KS-AT-KR-ACP domain structure, but KR15 appears to be defective, leaving C-15 unreduced as a carbonyl group (instead of a C-15 hydroxyl). The ER* domain in module 17 (KS-ATDH-ER*-KR-ACP) is shorter and probably inactive. An integrated thioesterase domain follows module 21. It is presumably involved in releasing the complete polyketide chain.
Pimaricin and Candicidin Synthesis and Regulation
235
originate by in vitro nonenzymatic conversion of the three natural compounds during purification. The three natural components differ from each other at C-3 and C-9. Inactivation of the KR21 domain (the first module of FscF) (Table 10.3) abolished production of candicidin V carrying a C-3 hydroxyl group. Inactivation of the DH18 motif abolished production of candicidin VI carrying a C-9 methylene. Combined inactivation created a mutant producing only candicidin III containing a C-3 ketone and a C-9 hydroxyl group (Zhou et al., 2008). These manipulations may be used to obtain more active candicidin/FR-008 components. Candicidin-III showed an antifungal activity similar to component VI and superior to candicidin V. Two genes of the FR-008 cluster, fscP and fscFE (Fig. 10.6), encode a P-450 monooxygenase and an associated ferredoxin. The FscP monooxygenase is similar to AmphN, NysN, and PimG in the amphotericin, nystatin and pimaricin gene clusters, respectively, and is likely to be involved in oxidation of the C-18 methyl branch to a carboxyl group (Aparicio et al., 2003; Carmody et al., 2005). Usually, oxidation of the methyl group stops at the alcohol stage, so it is likely that another enzyme (e.g., a dehydrogenase or an oxidase) may be involved in the conversion of the primary alcohol to the aldehyde and carboxylic acid. The genes encoding these additional enzymes are not located in the candicidin/FR-008 gene cluster, but these activities may be provided by related enzymes encoded by genes elsewhere in the genome. There is another gene, fscO, encoding a FAD-dependent monooxygenase in the sequenced FR-008 DNA, but its involvement in the biosynthesis of candicidin/FR-008, if any, is not clear (Chen et al., 2003).
10. Transporter Genes Two putative candicidin/FR-008 transporters are encoded by genes in the candicidin cluster of Streptomyces griseus (canRA and canRB) and in the FR-008 cluster ( fscT1 and fscTII). CanRA (FscTI) (335 aa) shows 49% identity to ATP-binding proteins belonging to the ABC transporter superfamily (Campelo and Gil, 2002) involved in the secretion of antibiotics and other secondary metabolites (Martı´n et al., 2005). CanRB (FscTII) (268 aa) is also similar to transmembrane proteins of the ABC transporter superfamily (up to 31% identity to different members of this family). Although gene disruption experiments are required to confirm the roles of CanRA and CanRB, it seems likely that these two proteins are involved in candicidin secretion, perhaps forming a heterodimeric transporter system.
236
Juan F. Martı´n and Jesu´s F. Aparicio
11. Genes Related to Mycosamine Biosynthesis Mycosamine (3-amino, 3-6 dideoxy D-mannose) is the amino sugar present in candicidin and most other polyene macrolides (Aparicio et al., 2003; Martı´n, 1977; Martı´n and Gil, 1979). The biosynthetic pathway of mycosamine and the genes in the candicidin/FR-008 clusters responsible for its formation are still obscure, but might well be similar to those of other polyenes (Aparicio et al., 2003; Byrne et al., 2003; Caffrey et al., 2008; Nedal et al., 2007). Three genes possibly related to mycosamine biosynthesis and attachment occur in the candicidin cluster. canA ( fscMII) encodes a protein (352 aa) with considerable similarity to EryC1 (for erythromycin biosynthesis) and other related proteins involved in sugar metabolism and outer cell-wall carbohydrate biosynthesis. These enzymes appear to be pyridoxal phosphate- or pyridoxamine-dependent aminotransferases or dehydrogenases (Kim et al., 1998). The presence of amino acid motifs involved in pyridoxal phosphate binding suggests that CanA is likely to be involved in introduction of the amino group at the 4-keto position of the sugar biosynthetic intermediate. CanA (Table 10.2) is about 70 to 75% identical to AmphDII, NysDII, and PimC in the amphotericin B, nystatin, and pimaricin gene clusters (see previous section on pimaricin). A second gene, canM ( fscMIII), encodes a protein (402 amino acids) closely resembling GDP-mannose-4,6-dehydratases and apparently involved in biosynthesis of the early intermediates of mycosamine. This protein is 66-69% identical to similar enzymes, PimJ, NysDIII, and AmphDIII, encoded by genes in the pimaricin, amphotericin, and nystatin gene clusters. A third gene, canG ( fscMI), encodes a protein (458 amino acids) with similarity (up to 27% identity) to eukaryotic enzymes of the UDP-glycosyltransferase family. This enzyme might be involved in the attachment of the ‘‘activated’’ mycosamine to the candicidin aglycone at C-21. It is similar to PimK, NysD1 and AmphD1, which correspond to glycosyl transferases involved in sugar attachment during pimaricin, nystatin and amphotericin biosynthesis (Caffrey et al., 2008). Further experimental work is, however, required to confirm the roles of these three genes.
12. Regulatory Genes Up to four putative regulatory genes occur in the FR-008 cluster ( fscRI, fscRII, fscRIII, and fscRIV ). At least three of them are also encoded by ORFs in the S. griseus candicidin cluster (orf1, orf2, orf3) (Table 10.2). These four genes belong to the LuxR family of transcriptional regulators.
Pimaricin and Candicidin Synthesis and Regulation
237
The presence of several regulatory genes in an antibiotic gene cluster is frequent (Anto´n et al., 2004, 2007; Aparicio et al., 1996; Bate et al., 1999, 2002), but it is unprecedented to find four regulatory genes belonging to the same family in one cluster. Replacement of fscRII and fscRIII (and part of fscRI ) by a cassette containing the apramycin and erythromycin resistance genes resulted in a nonproducer strain (Chen et al., 2003). The fscRIV gene was still present in this mutant, indicating that one (or more) of the three genes deleted was necessary for expression of the FR-008 genes. The proteins encoded by fscRI, RII and RIII appear to be positive regulators. It will be interesting to study the separate roles of each of these four regulatory genes and their targets in the candicidin/FR-008 gene cluster.
13. Phosphate Represses Expression of the pabAB Gene Following the initial cloning of the S. griseus pabAB gene, transcriptional analysis by Southern hybridization revealed a drastic reduction of expression of the pabAB gene in phosphate-supplemented cultures (Asturias et al., 1990). Supplementation of batch cultures of S. griseus IMRU3570 in SPG (soya peptone-glucose) medium with 7.5 mM inorganic phosphate, resulted in a 90% reduction of PABA synthase activity and a 95% reduction of candicidin production. Transcriptional studies of the pabAB gene showed that in SPG medium expression of pabAB was already high at 12 h of incubation. Addition of 7.5 mM phosphate at inoculation time reduced expression of the pabAB gene by 90 to 95%, in agreement with the data observed for the PABA synthase activity and candicidin production. Phosphate control in Streptomyces is mediated by the PhoR-PhoP twocomponent system (Sola-Landa et al., 2003, 2005, 2008). PhoP-binding sequences (PHO boxes) have been found in the upstream region of a number of genes in Streptomyces, including the pimaricin producer (Mendes et al., 2007b); phosphate control of expression of secondary metabolites proceeds through a cascade regulation mediated by pathway-specific transcriptional regulators (Martı´n, 2004).
14. Future Perspectives Although the cluster of genes for FR-008/candicidin biosynthesis is largely known, functional analysis of some genes is still required, particularly of the regulatory genes and the genes involved in candicidin secretion.
238
Juan F. Martı´n and Jesu´s F. Aparicio
The presence in the candicidin gene cluster of genes for the biosynthesis of PABA and its activation to para-aminobenzoyl-CoA opens the way for constructing novel aromatic polyenes derived from pimaricin and other small pentaenes or tetraenes. The use of the specific loading module FscA may facilitate the engineering of those novel polyene macrolides.
ACKNOWLEDGMENTS This work was supported by grants from the Spanish Ministry of Education and Science to J.F.M. (BIO2006-14853-C02-01) and J.F.A. (BIO2007-67585). We would like to thank the present and former members of the Antifungal Macrolides Laboratory at the INBIOTEC for their excellent research.
REFERENCES Anto´n, N., Mendes, M. V., Martı´n, J. F., and Aparicio, J. F. (2004). Identification of PimR as a positive regulator of pimaricin biosynthesis in Streptomyces natalensis. J. Bacteriol. 186, 2567–2575. Anto´n, N., Santos-Aberturas, J., Mendes, M. V., Guerra, S. M., Martı´n, J. F., and Aparicio, J. F. (2007). PimM, a PAS domain positive regulator of pimaricin biosynthesis in Streptomyces natalensis. Microbiology 153, 3174–3183. Aparicio, J. F., Molna´r, I., Schwecke, T., Ko¨nig, A., Haydock, S. F., Khaw, L. E., Staunton, J., and Leadlay, P. F. (1996). Organisation of the biosynthetic gene cluster for rapamycin in Streptomyces hygroscopicus: Analysis of the enzymatic domains in the modular polyketide synthase. Gene 169, 9–16. Aparicio, J. F., Colina, A. J., Ceballos, E., and Martı´n, J. F. (1999). The biosynthetic gene cluster for the 26-membered ring polyene macrolide pimaricin: A new polyketide synthase organization encoded by two subclusters separated by functionalization genes. J. Biol. Chem. 274, 10133–10139. Aparicio, J. F., Fouces, R., Mendes, M. V., Olivera, N., and Martı´n, J. F. (2000). A complex multienzyme system encoded by five polyketide synthase genes is involved in the biosynthesis of the 26-membered polyene macrolide pimaricin in Streptomyces natalensis. Chem. Biol. 7, 895–905. Aparicio, J. F., Caffrey, P., Gil, J. A., and Zotchev, S. B. (2003). Polyene antibiotic biosynthesis gene clusters. Appl. Microbiol. Biotechnol. 61, 179–188. Aparicio, J. F., Mendes, M. V., Anto´n, N., Recio, E., and Martı´n, J. F. (2004). Polyene macrolide antibiotic biosynthesis. Curr. Med. Chem. 1, 1645–1656. Aparicio, J. F., and Martı´n, J. F. (2008). Microbial cholesterol oxidase: Bioconversion enzymes or signal proteins? Mol. Biosys. 4, 804–809. Asturias, J. A., Liras, P., and Martı´n, J. F. (1990). Phosphate control of pabS gene transcription during candicidin biosynthesis. Gene 93, 79–84. Basset, G. J., Ravanel, S., Quinlivan, E. P., White, R., Giovannoni, J. J., Re´beille´, F., Nichols, B. P., Shinozaki, K., Seki, M., Gregory, J. F. 3rd, and Hanson, A. D. (2004). Folate synthesis in plants: The last step of the p-aminobenzoate branch is catalyzed by a plastidial aminodeoxychorismate lyase. Plant J. 40, 453–461. Bate, N., Butler, A. R., Gandecha, A. R., and Cundliffe, E. (1999). Multiple regulatory genes in the tylosin biosynthetic cluster of Streptomyces fradiae. Chem. Biol. 6, 617–624.
Pimaricin and Candicidin Synthesis and Regulation
239
Bate, N., Stratigopoulos, G., and Cundliffe, E. (2002). Differential roles of two SARPencoding regulatory genes during tylosin biosynthesis. Mol. Microbiol. 43, 449–548. Beppu, T. (1995). Signal transduction and secondary metabolism: Prospects for controlling productivity. Trends Biotechnol. 13, 264–269. Brautaset, T., Borgos, S. E., Sletta, H., Ellingsen, T. E., and Zotchev, S. B. (2003). Sitespecific mutagenesis and domain substitutions in the loading module of the nystatin polyketide synthase, and their effects on nystatin biosynthesis in Streptomyces noursei. J. Biol. Chem. 278, 14913–14919. Brown, M. P., Aidoo, K. A., and Vining, L. C. (1996). A role for pabAB, a p-aminobenzoate synthase gene of Streptomyces venezuelae ISP5230, in chloramphenicol biosynthesis. Microbiology 142, 1345–1355. Byrne, B., Carmody, M., Gibson, E., Rawlings, B., and Caffrey, P. (2003). Biosynthesis of deoxyamphotericins and deoxyamphoteronolides by engineered strains of Streptomyces nodosus. Chem. Biol. 10, 1215–1224. Caffrey, P., Aparicio, J. F., Malpartida, F., and Zotchev, S. B. (2008). Biosynthetic engineering of polyene macrolides towards generation of improved antifungal and antiparasitic agents. Curr. Top. Med. Chem. 8, 639–653. Campelo, A. B., and Gil, J. A. (2002). The candicidin gene cluster from Streptomyces griseus IMRU 3570. Microbiology 148, 51–59. Carmody, M., Murphy, B., Byrne, B., Power, P., Rai, D., Rawlings, B., and Caffrey, P. (2005). Biosynthesis of amphotericin derivatives lacking exocyclic carboxyl groups. J. Biol. Chem. 280, 34420–34426. Chang, Z., Sun, Y., He, J., and Vining, L. C. (2001). p-Aminobenzoic acid and chloramphenicol biosynthesis in Streptomyces venezuelae: Gene sets for a key enzyme, 4-amino-4deoxychorismate synthase. Microbiology 147, 2113–2126. Chen, S., Huang, X., Zhou, X., Bai, L., He, J., Jeong, K. J., Lee, S. Y., and Deng, Z. (2003). Organizational and mutational analysis of a complete FR-008/candicidin gene cluster encoding a structurally related polyene complex. Chem. Biol. 10, 1065–1076. Criado, L. M., Martı´n, J. F., and Gil, J. A. (1993). The pab gene of Streptomyces griseus, encoding p-aminobenzoic acid synthase, is located between genes possibly involved in candicidin biosynthesis. Gene 126, 135–139. Davidson, A. L., Dassa, E., Orelle, C., and Chen, J. (2008). Structure, function, and evolution of bacterial ATP-binding cassette systems. Microbiol. Mol. Biol. Rev. 72, 317–364. Enrı´quez, L. L., Mendes, M. V., Anto´n, N., Tunca, S., Guerra, S. M., Martı´n, J. F., and Aparicio, J. F. (2006). An efficient gene transfer system for the pimaricin producer Streptomyces natalensis. FEMS Microbiol. Lett. 257, 312–318. Gil, J. A., Liras, P., Naharro, G., Villanueva, J. R., and Martı´n, J. F. (1980). Regulation of the biosynthesis of candicidin by aromatic amino acids. J. Gen. Microbiol. 118, 189–195. Gil, J. A., and Hopwood, D. A. (1983). Cloning and expression of a p-aminobenzoic acid synthetase gene from the candicidin producer Streptomyces griseus. Gene 25, 119–132. Gil, J. A., Naharro, G., Villanueva, J. R., and Martı´n, J. F. (1985). Characterization and regulation of p-aminobenzoic acid synthase from Streptomyces griseus. J. Gen. Microbiol. 131, 1279–1287. Golding, B. T., Rickards, R. W., Meyer, W. E., Patrick, J. B., and Barber, M. (1966). Structure of macrolide antibiotic pimaricin. Tetrahedron Lett. 30, 3551–3557. Hara, O., and Beppu, T. (1982). Mutants blocked in streptomycin production in Streptomyces griseus—the role of A-factor. J. Antibiot. 35, 349–358. Haydock, S. F., Aparicio, J. F., Molna´r, I., Schwecke, T., Ko¨nig, A., Marsden, A. F. A., Galloway, I. S., Staunton, J., and Leadlay, P. F. (1995). Divergent sequence motifs correlated with the substrate specificity of (methyl)malonyl-CoA: Acyl carrier protein transacylase domains in modular polyketide synthases. FEBS Lett. 374, 246–248.
240
Juan F. Martı´n and Jesu´s F. Aparicio
Horinouchi, S., and Beppu, T. (1992). Autoregulatory factors and communication in actinomycetes. Annu. Rev. Microbiol. 46, 377–398. Hu, H., Bao, K., Zhou, X., Hopwood, D. A., Kieser, T., and Deng, Z. (1994). Repeated polyketide synthase modules involved in the biosynthesis of a heptaene macrolide by Streptomyces sp. FR-008. Mol. Microbiol. 14, 163–172. Ikeda, H., Ishikawa, J., Hanamoto, A., Shinose, M., Kikuchi, H., Shiba, T., Sakaki, Y., Hattori, M., and Omura, S. (2003). Complete genome sequence and comparative analysis of the industrial microorganism Streptomyces avermitilis. Nat. Biotechnol. 21, 526–531. Kim, B. S., Cropp, T. A., Beck, B. J., Sherman, D. H., and Reynolds, K. A. (2002). Biochemical evidence for an editing role of thioesterase II in the biosynthesis of the polyketide pikromycin. J. Biol. Chem. 277, 48028–48034. Kim, C. G., Yu, T. W., Fryhle, C. B., Handa, S., and Floss, H. G. (1998). 3-Amino-5hydroxybenzoic acid synthase, the terminal enzyme in the formation of the precursor of mC7N units in rifamycin and related antibiotics. J. Biol. Chem. 273, 6030–6040. Lancelin, J. M., and Beau, J. M. (1990). Stereostructure of pimaricin. J. Am. Chem. Soc. 112, 4060–4061. Lee, K. M., Lee, C. K., Choi, S. U., Park, H. R., Kitani, S., Nihira, T., and Hwang, Y. I. (2005). Cloning and in vivo functional analysis by disruption of a gene encoding the gamma-butyrolactone autoregulator receptor from Streptomyces natalensis. Arch. Microbiol. 184, 249–257. Lee, K. M., Lee, C. K., Choi, S. U., Park, H. R., and Hwang, Y. I. (2008). Functional analysis of a BarX homologue (SngA) as a pleiotropic regulator in Streptomyces natalensis. Arch. Microbiol. 189, 569–577. Liras, P., Asturias, J. A., and Martı´n, J. F. (1990). Phosphate control sequences involved in transcriptional regulation of antibiotic biosynthesis. Trends Biotechnol. 8, 184–189. Marsden, A. F. A., Caffrey, P., Aparicio, J. F., Loughran, M. S., Staunton, J., and Leadlay, P. F. (1994). Stereospecific acyl transfers on the erythromycin-producing polyketide synthase. Science 263, 378–380. Martı´n, J. F., and McDaniel, L. E. (1975). Specific inhibition of candicidin biosynthesis by the lipogenic inhibitor cerulenin. Biochem. Biophys. Acta 411, 186–194. Martı´n, J. F., and Liras, P. (1976). Rapid incorporation of precursors into candicidin by resting cells of Streptomyces griseus. J. Antibiot. 29, 1306–1309. Martı´n, J. F. (1977). Biosynthesis of polyene macrolide antibiotics. Ann. Rev. Microbiol. 31, 13–38. Martı´n, J. F., and Gil, J. A. (1979). Biosynthesis and attachment of amino sugars to polyene macrolide antibiotics. J. Antibiot. 32, 122–128. Martı´n, J. F., and Gil, J. A. (1983). Cloning of a gene involved in antibiotic synthesis. Bio/ Technology 1, 483–488. Martı´n, J. F. (1984). Biosynthesis regulation and genetics of polyene macrolide antibiotics. In ‘‘Macrolide Antibiotics: Chemistry, Biology and Practice.’’ (S. Omura, ed.), pp. 405–424. Academic Press, New York. Martı´n, J. F. (2004). Phosphate control of the biosynthesis of antibiotics and other secondary metabolites is mediated by the PhoR-PhoP system: An unfinished story. J. Bacteriol. 186, 5197–5201. Martı´n, J. F., Casqueiro, J., and Liras, P. (2005). Secretion systems for secondary metabolites: how producer cells send out messages of intercellular communication. Curr. Opin. Microbiol. 8, 282–293. Mendes, M. V., Aparicio, J. F., and Martı´n, J. F. (2000). Complete nucleotide sequence and characterization of pSNA1 from the pimaricin-producing Streptomyces natalensis that replicates by a rolling circle mechanism. Plasmid 43, 159–165.
Pimaricin and Candicidin Synthesis and Regulation
241
Mendes, M. V., Recio, E., Fouces, R., Luiten, R., Martin, J. F., and Aparicio, J. F. (2001). Engineered biosynthesis of novel polyenes: A pimaricin derivative produced by targeted gene disruption in Streptomyces natalensis. Chem. Biol. 8, 635–644. Mendes, M. V., Anto´n, N., Martı´n, J. F., and Aparicio, J. F. (2005). Characterization of the polyene macrolide P450 epoxidase from Streptomyces natalensis that converts deepoxypimaricin into pimaricin. Biochem. J. 386, 57–62. Mendes, M. V., Recio, E., Anto´n, N., Guerra, S. M., Santos-Aberturas, J., Martı´n, J. F., and Aparicio, J. F. (2007a). Cholesterol oxidases act as signalling proteins for the biosynthesis of the polyene macrolide pimaricin. Chem. Biol. 14, 279–290. Mendes, M. V., Tunca, S., Anto´n, N., Recio, E., Sola-Landa, A., Aparicio, J. F., and Martı´n, J. F. (2007b). The two-component phoR-phoP system of Streptomyces natalensis: Inactivation or deletion of phoP reduces the negative phosphate regulation of pimaricin biosynthesis. Metab. Eng. 9, 217–227. Mori, K. (1983). Revision of the absolute configuration of A-factor. Tetrahedron 39, 3107–3109. Nedal, A., Sletta, H., Brautaset, T., Borgos, S. E. F., Sekurova, O. N., Ellingsen, T. E., and Zotchev, S. B. (2007). Analysis of the mycosamine biosynthesis and attachment genes in the nystatin biosynthetic gene cluster of Streptomyces noursei ATCC 11455. Appl. Environ. Microbiol. 73, 7400–7407. Omura, S., and Tanaka, H. (1984). Production, structure and antifungal activity of polyene macrolides. In ‘‘Macrolide Antibiotics: Chemistry, Biology and Practice.’’ (S. Omura, ed.), pp. 351–404. Academic Press, New York. Patrick, J. B., Williams, R. P., and Webb, J. S. (1958). Pimaricin. 2. The structure of pimaricin. J. Am. Chem. Soc. 80, 6688–6689. Recio, E., Colina, A., Rumbero, A., Aparicio, J. F., and Martin, J. F. (2004). PI factor, a novel type quorum sensing inducer elicits pimaricin production in Streptomyces natalensis. J. Biol. Chem. 279, 41586–41593. Recio, E., Aparicio, J. F., Rumbero, A., and Martı´n, J. F. (2006). Glycerol, ethylene glycol and propanediol elicit pimaricin biosynthesis in the PI-factor defective strain Streptomyces natalensis npi287 and increase polyene production in several wild type actinomycetes. Microbiology 152, 3147–3156. Rodrı´guez-Garcı´a, A., Barreiro, C., Santos-Beneit, F., Sola-Landa, A., and Martı´n, J. F. (2007). Genome-wide transcriptomic and proteomic analysis of the primary response to phosphate limitation in Streptomyces coelicolor M145 and in a DeltaphoP mutant. Proteomics 7, 2410–2429. Sato, K., Nihira, T., Sakuda, S., Yanagimoto, M., and Yamada, Y. (1989). Isolation and structure of a new butyrolactone autoregulator from Streptomyces sp. FRI-5. J. Ferment. Bioeng. 68, 170–173. Schwecke, T., Aparicio, J. F., Molna´r, I., Ko¨nig, A., Khaw, L. E., Oliynyk, M., Haydock, S. F., Caffrey, P., Corte´s, J., Bo¨hm, G., Lester, J., Staunton, J., et al. (1995). The biosynthetic gene cluster for the polyketide immunosuppressant rapamycin. Proc. Natl. Acad. Sci. USA 92, 7839–7843. Scrutton, N. S., Berry, A., and Perham, R. N. (1990). Redesign of the coenzyme specificity of a dehydrogenase by protein engineering. Nature 343, 38–43. Seco, E. M., Perez-Zuniga, F. J., Rolon, M. S., and Malpartida, F. (2004). Starter unit choice determines the production of two tetraene macrolides, rimocidin and CE-108, in Streptomyces diastaticus var. 108. Chem. Biol. 11, 357–366. Sharma, K. K., and Boddy, C. M. (2007). The thioesterase domain from the pimaricin and erythromycin biosynthetic pathways can catalyze hydrolysis of simple thioester substrates. Bioorg. Med. Chem. Lett. 17, 3034–3037. Sletta, H., Borgos, S. E. F., Bruheim, P., Sekurova, O. N., Grasdalen, H., Aune, R., Ellingsen, T. E., and Zotchev, S. B. (2005). Nystatin biosynthesis and transport: nysH
242
Juan F. Martı´n and Jesu´s F. Aparicio
and nysG genes encoding a putative ABC transporter system are required for efficient conversion of 10-deoxynystatin to nystatin. Antimicrob. Agents. Chemother. 49, 4576–4583. Sola-Landa, A., Moura, R. S., and Martı´n, J. F. (2003). The two component PhoR-PhoP system controls both primary metabolism and secondary metabolite biosynthesis in Streptomyces lividans. Proc. Natl. Acad. Sci. USA 100, 6133–6138. Sola-Landa, A., Rodrı´guez-Garcı´a, A., Franco-Domı´nguez, E., and Martı´n, J. F. (2005). Binding of PhoP to promoters of phosphate regulated genes in Streptomyces coelicolor: Identification of PHO boxes. Mol. Microbiol. 56, 1373–1385. Sola-Landa, A., Rodrı´guez-Garcı´a, A., Apel, A. K., and Martı´n, J. F. (2008). Target genes and structure of the direct repeats in the DNA binding sequences of the response regulator PhoP in Streptomyces coelicolor. Nucleic Acids Res. 36, 1358–1368. Struyk, A. P., Hoette, I., Drost, G., Waisvisz, J. M., van Eek, T., and Hoogerheide, J. C. (1957). Pimaricin, a new antifungal antibiotic. Antibiot. Annu. 5, 878–885. Taylor, B. L., and Zhulin, I. B. (1999). PAS domains: Internal sensors of oxygen, redox potential, and light. Microbiol. Mol. Biol. Rev. 63, 479–506. Welscher, Y. M., ten Napel, H. H., Balague´, M. M., Souza, C. M., Riezman, H., de Kruijff, B., and Breukink, E. (2008). Natamycin blocks fungal growth by binding specifically to ergosterol without permeabilizing the membrane. J. Biol. Chem. 283, 6393–6401. Yamada, Y., Sugamura, K., Kondo, K., Yanagimoto, M., and Okada, H. (1987). The structure of inducing factors for virginiamycin production in Streptomyces virginiae. J. Antibiot. 40, 496–504. Zhou, Y., Li, J., Zhu, J., Chen, S., Bai, L., Zhou, X., Wu, H., and Deng, Z. (2008). Incomplete beta-ketone processing as a mechanism for polyene structural variation in the FR-008/candicidin complex. Chem. Biol. 15, 629–638. Zielinski, J., Borowy-Borowski, H., Golik, J., Gumieniak, J., Ziminski, T., KolodziEjczyk, P., Pawlak, J., and Borowski, E. (1979). The structure of levorin A2 and candicidin D. Tetrahedron Lett. 20, 1791–1794.
C H A P T E R
E L E V E N
Genetic Analysis of Nystatin and Amphotericin Biosynthesis Sergey Zotchev* and Patrick Caffrey† Contents 1. Introduction 2. Gene Inactivation and Replacement in the Nystatin Producer Streptomyces noursei 2.1. Conjugative transfer of a recombinant plasmid from E. coli ET12567 (pUZ8002) into S. noursei ATCC 11455 2.2. Gene inactivation in S. noursei 2.3. Gene replacement in S. noursei 3. Gene Inactivation and Replacement in the Amphotericin Producer Streptomyces nodosus 3.1. Phage-mediated gene replacement in S. nodosus 4. Production, Purification, and Characterization of Novel Amphotericin- and Nystatin-Related Polyenes 4.1. Production and identification of nystatin-related polyenes 4.2. Scaled-up production of nystatin analogues 4.3. Preparative LC-MS purification of nystatin analogues 5. Conclusion Acknowledgments References
244 246 247 248 248 249 252 254 254 255 255 256 256 256
Abstract The polyene macrolides nystatin A1 and amphotericin B are effective but toxic antifungal antibiotics that are also active against enveloped viruses, protozoan parasites and pathogenic prion proteins. This chapter describes methods for genetic manipulation of the amphotericin and nystatin producers, Streptomyces nodosus and Streptomyces noursei. These techniques have been used to engineer the biosynthesis of several analogues of both polyenes. Methods for production, identification, purification and characterization of new analogues are also discussed.
* {
Department of Biotechnology, Norwegian University of Science and Technology, Trondheim, Norway School of Biomolecular and Biomedical Science, University College Dublin, Dublin, Ireland
Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04611-4
#
2009 Elsevier Inc. All rights reserved.
243
244
Sergey Zotchev and Patrick Caffrey
1. Introduction Nystatin A1 and amphotericin B (Fig. 11.1) are medically important antifungal antibiotics produced by Streptomyces noursei and Streptomyces nodosus, respectively. The two polyene macrolides act initially by disrupting sterol-containing membranes, particularly the ergosterol-containing membranes of fungal cells (Bolard, 1986). They are also active against Leishmania parasites, enveloped viruses and prion disease agents (Hartsel and Bolard, 1996; Lemke et al., 2005). However, both drugs show low water solubility and severe toxicity. This has motivated efforts to generate improved analogues by chemical modification and by genetic manipulation of the producer organisms. The biosynthetic gene clusters for nystatin and amphotericin have been investigated intensively (reviewed by Aparicio et al., 2003). The nystatin and amphotericin polyketide synthases (PKSs) are closely related. Module 5 of the nystatin PKS has an enoyl reductase domain responsible for saturation of the final polyene chain between the diene and tetraene components (Fig. 11.1). The amphotericin PKS has a corresponding domain that is only partially active, possibly because of a reduced affinity for NADPH (Borgos et al., 2006a). As well as the heptaene amphotericin B, S. nodosus produces the tetraene amphotericin A, which has same polyene chain as nystatin. O Me OH Me
HO Me
O
OH
OH
OH
OH
O
NH2 COOH
O
OH
OH
OH
Me OH
O
Amphotericin B O Me
OH Me
HO Me
O
OH
OH
OH
OH
O OH
O OH
Me OH
O
NH2 COOH OH
Nystatin A1
Figure 11.1 Structures of amphotericin B and nystatin A1.
245
Genetic Analysis of Nystatin and Amphotericin Biosynthesis
For both polyenes, the late biosynthetic steps are oxidation of a methyl branch to an exocyclic carboxyl group, glycosylation with a mycosamine sugar residue and hydroxylation of the polyol region of the macrolactone ring. This hydroxylation occurs at C-10 for nystatin and at C-8 for amphotericin. Engineered biosynthesis has generated several amphotericin and nystatin analogues that retain antifungal activity and have reduced toxicity (reviewed by Caffrey et al., 2008). This has allowed investigation of structureactivity relationships for these polyenes and may eventually allow industrial production of less toxic derivatives by fermentation methods. There is considerable interest in assessing these analogues as improved antifungal drugs, and as treatments for diseases caused by prions, protozoan parasites and viruses (Soler et al., 2008; Brautaset et al., 2008). The progress with genetic engineering of the nystatin and amphotericin producers has relied on methods that have been comprehensively described by Hopwood et al. (1985) and by Kieser et al. (2000). The general strategy for gene replacement is summarized in Fig. 11.2. Engineered DNA is introduced on a vector that contains an antibiotic resistance gene but does not replicate autonomously in a viable streptomycete cell. A single crossover Antibiotic resistance Gene replacement construct Chromosome
Primary recombinant
Mutant
Figure 11.2 Overview of gene replacement in polyene-producing streptomycetes. An engineered gene is introduced by phage transduction or by conjugal transfer. The construct (phage genome or nonreplicating plasmid) integrates into the chromosome by homologous recombination. The vector contains an antibiotic resistance gene that allows selection of such primary recombinants. Screening for loss of this marker can yield mutants in which a second crossover has caused gene replacement. Another possible outcome is reversion to the parental genotype by crossing over in the same region as the first crossover. If the cloned fragment is internal to a gene, integration results in inactivation because vector DNA is inserted between the start and stop codons.
246
Sergey Zotchev and Patrick Caffrey
results in integration of the construct to give an antibiotic-resistant recombinant strain. Screening for loss of antibiotic resistance yields strains that have undergone either gene replacement or reversion to the parental genotype as a result of a second crossover. Where the cloned fragment is internal to a gene, insertional inactivation occurs after the first recombination because vector sequence interrupts the reading frame (Kieser et al., 2000). For introduction of recombinant DNA into the polyene producers, conjugation from Escherichia coli has been used with S. noursei, whereas phage transduction has been used with S. nodosus. Here we describe refinements to basic protocols that have been used to engineer the biosynthesis of nystatin and amphotericin analogues. Methods for characterization of these novel compounds are also discussed. Efficient production of polyene analogues by fermentation methods requires producer strains that give high yields (Olano et al., 2008). Methods for genetic manipulation that have given novel compounds will also be important for rational strain improvement to increase yields. Both S. noursei and S. nodosus are known to contain biosynthetic gene clusters for other natural products as well as the polyenes for which they are well known. Thus the ability to manipulate these streptomycetes genetically will be important in the future.
2. Gene Inactivation and Replacement in the Nystatin Producer Streptomyces noursei In order to perform genetic manipulation of bacteria, a robust system is required for introduction of DNA. The nystatin producer, S. noursei ATCC 11455, was found to be refractory to most of the standard methods, including protoplast transformation, electroporation, and transduction using actinomycete phage phiC31 (Brautaset et al., 2000; Zotchev et al., 2000). The only method that works reliably for S. noursei is intergeneric conjugation with E. coli. The donor strain is the nonmethylating (dam– dcm–) E. coli ET12567 (Flett et al., 1997) containing the helper plasmid pUZ8002 (Kieser et al., 2000). The nontransmissible pUZ8002 provides in trans the genes necessary for mobilization of conjugative plasmids containing the oriT origin of transfer replication (Mazodier et al., 1989). Suicide plasmids for gene disruption and replacement do not replicate in streptomycetes but can be propagated in E. coli. S. noursei DNA cloned in these plasmids can recombine with homologous chromosomal sequences to effect gene disruption and replacement. These vectors contain an oriT sequence and a ColE1 origin that allows autonomous replication in E. coli but not streptomycetes. The aacIV gene (Allmansberger et al., 1985) confers apramycin resistance on both E. coli and S. noursei and is included for selection of transconjugants.
Genetic Analysis of Nystatin and Amphotericin Biosynthesis
247
The pSET152 conjugative plasmid contains a phiC31 integrase gene and attP attachment site that allow site-specific integration into streptomycete chromosomes (Bierman et al., 1992). The conjugative plasmid pSOK804 contains an integrase gene and attachment site for the phage VWB (Sekurova et al., 2004). Both plasmids integrate into single sites in the S. noursei chromosome, although pSOK804 integrates more efficiently than pSET152. Integrating plasmids have been used in complementation of mutations in PKS and regulatory genes in S. noursei.
2.1. Conjugative transfer of a recombinant plasmid from E. coli ET12567 (pUZ8002) into S. noursei ATCC 11455 1. Grow E. coli ET12567 (pUZ8002) in LB medium (10 g tryptone, 5 g yeast extract, 5 g NaCl per liter) containing 25 mg/ml kanamycin and 20 mg/ml chloramphenicol and prepare competent cells using a standard procedure (Flett et al., 1997). 2. Transform competent cells with a recombinant plasmid carrying the apramycin resistance marker and select transformants on LB plates supplemented only with apramycin (50 mg/ml). 3. Incubate three or four transformants overnight in LB supplemented with 50 mg/ml apramycin, 25 mg/ml kanamycin and 20 mg/ml chloramphenicol. 4. Identify one transformant that grew well and dilute the overnight culture 1:50 in 20 ml of fresh LB medium supplemented with antibiotics as above. (Use of prewarmed (37 ) LB often helps to reduce the growth lag phase, and can sometimes reduce the time taken to reach the required OD value.) Incubate at 37 with shaking until the OD600 value reaches 0.4. It is important to monitor turbidity and not just rely on incubation time because some plasmids slow down the growth of E. coli ET12567 considerably. 5. Harvest the cells by centrifugation at 5000 rpm for 5 min, and wash once in 20 ml LB using the same centrifugation conditions. Resuspend the cell pellet in 2 ml LB and place on ice. These donor cells must be used for conjugation within 1 h. 6. Prepare a suspension of S. noursei spores in water. Spores from a fresh (not more than 1 week after sporulation) ISP2 agar (yeast extract, 10 g malt extract, 4 g dextrose, 20 g agar per liter, pH 7.2) plate are washed off with 5.5 ml of water and filtered through sterile cotton wool. This usually gives a spore concentration of approximately 5 109 CFU/ml. 7. Add 50 ml of the spore suspension to 500 ml 2 TY medium (10 g tryptone, 10 g yeast extract, 5 g NaCl per liter), mix briefly by vortexing and incubate 5 min at 50 . Leave the heat-shocked spore suspension to cool at room temperature for 15 min.
248
Sergey Zotchev and Patrick Caffrey
8. To a sterile microfuge tube, add 550 ml of heat-shocked spore suspension and mix with 500 ml of the E. coli donor cells (from Step 5). Centrifuge 1 min at 4000 rpm, remove 900 ml of the supernatant and resuspend the pellet in the remaining 150 ml of liquid. 9. Spread the suspension over the surface of two soya-flour mannitol (SFM) (20 g mannitol, 20 g soya flour, 20 g agar per liter tap water) agar plates (75 ml per plate) and incubate at 30 for 16 to 18 h. (Longer incubation times may result in outgrowth of false positives.) 10. Spread 1 ml of water containing 0.9 mg nalidixic acid (nalidixic acid stock solution [30 mg/ml] is made by dissolving the antibiotic in 0.1 M NaOH, not in water) and 1.5 mg apramycin evenly over the surface of each plate. (Be sure to destroy the white aerial mycelium [using the glass rod] that may have appeared on the plates. Remaining mycelium may give false positives. Note: Add nalidixic acid stock solution to the water first, mix by vortexing, and then add apramycin.) Leave to dry in a laminar flow cabinet for about 20 min. Incubate at 30 . Transconjugants are usually visible after 2 to 3 days. 11. Transfer the putative transconjugants onto fresh ISP2 plates supplemented with 50 mg/ml apramycin and 30 mg/ml nalidixic acid. Incubate at 30 until well-sporulated (usually 4 to 5 days).
2.2. Gene inactivation in S. noursei 1. To perform a gene inactivation in S. noursei, an internal fragment is cloned into a suicide conjugation vector (Zotchev et al., 2000). For efficient gene inactivation, the cloned gene fragment must be over 1.4 kb in size. 2. Transfer the recombinant plasmid into S. noursei using the conjugation procedure described above. Select for apramycin-resistant clones. 3. Isolate total DNA from at least eight putative transconjugants and analyze by Southern blot to confirm correct integration of the plasmid into the genome via a single crossover.
2.3. Gene replacement in S. noursei 1. To perform gene replacement in S. noursei, the engineered gene is cloned into a suicide vector. The sequences flanking the mutation should be at least 1.4 kb long and should not differ in size by more than 15 %. 2. Perform Steps 2 and 3 described in the protocol above. The plasmid can integrate through recombination in either the left or the right flanking region (Fig. 11.2). It is desirable to obtain both types of primary recombinant. In some cases, one type yields gene replacement mutants much more frequently after the second crossover.
Genetic Analysis of Nystatin and Amphotericin Biosynthesis
249
3. Streak one of the transconjugants with verified integration of the recombinant plasmid onto ISP2 agar devoid of antibiotics, and incubate for 4 to 5 days until well sporulated. 4. Re-streak spores onto a fresh ISP2 plate and repeat Step 3. 5. Suspend spores from the last plate in 20% (v/v) glycerol. Spread 100-ml volumes of 10–4, 10–5, and 10–6 dilutions onto predried ISP2 plates (five plates per dilution). Incubate for 3 to 4 days or until the colonies are beginning to sporulate. 6. Use sterile velvet to replica-plate the colonies onto ISP2 agar supplemented with 50 mg/ml apramycin. Incubate the replicas for 20 h at 28 . 7. Use the replicas to identify apramycin-sensitive colonies on the antibiotic-free plates. Transfer spores of putative mutants in parallel onto ISP2 and ISP2 supplemented with 50 mg/ml apramycin. Incubate for 3 days at 28 . 8. Compare growth of the colonies on the media with and without antibiotic. Clones that lose the vector after the second crossover will not grow on apramycin-containing medium (see Fig. 11.2 for details). 9. Isolate total DNA from at least eight putative mutants and analyze by Southern blotting to identify clones in which the second crossover has led to gene replacement rather than reversion to the parental genotype.
3. Gene Inactivation and Replacement in the Amphotericin Producer Streptomyces nodosus DNA can be introduced into S. nodosus by phage transduction (Caffrey et al., 2001), conjugation (Nikodinovic et al., 2003), or inefficiently by protoplast transformation (Power et al., 2008). In Streptomyces genetics in general, the phage transduction approach has fallen out of favor, with conjugation methods being preferred. However, most of the S. nodosus gene replacements have been carried out by transduction. The most timeconsuming steps in the process are (1) purification of high-quality vector DNA from phage particles, (2) transfection, and (3) screening of plaques for recombinant phages that contain inserts. These areas have been modified to allow more rapid construction of recombinant phages and enable multiple attempts at difficult gene replacements. The modified transduction method is no more laborious than conjugation. Chater and coworkers developed the phiC31 derivative KC515 that lacks the attP attachment site (Hopwood et al., 1985). Recombination can occur between the chromosome and homologous DNA cloned in the phage vector. A single crossover gives a lysogen that can be selected because the phage vector DNA includes antibiotic resistance genes. The phage
250
Sergey Zotchev and Patrick Caffrey
encodes the c repressor that silences lytic genes. A second crossover results in loss of the vector and antibiotic-resistance gene and can result in gene replacement (Fig. 11.2). Extraction of vector DNA from phage particles is laborious and time consuming. Bifunctional phiC31 vectors were first constructed by inserting the E. coli plasmid pBR322 (Chater, 1986). These constructs replicate as phages in streptomycetes and as plasmids in E. coli. They can be purified from E. coli relatively easily by plasmid isolation methods. Another bifunctional vector, KC-UCD1, has been constructed by replacing the viomycin resistance gene of KC515 with a fragment of the E. coli plasmid pACYC177 (Carmody et al., 2004). The resulting construct confers kanamycin and ampicillin resistance on E. coli and thiostrepton resistance on streptomycetes (Fig. 11.3). Another derivative, KC-UCD2, has been constructed by replacing the thiostrepton resistance gene of KC-UCD1 with an apramycin resistance gene (P. Caffrey, unpublished results). The available cloning sites are BamHI, PstI, and the blunt cutters ScaI and StuI (a methylationsensitive enzyme). Non-methylated KC-UCD1 DNA can be obtained by passaging the vector through E. coli ET12567. It is possible to clone inserts between the BamHI and PstI sites, between the BamHI and ScaI sites, or between the PstI and Stul sites. Digestion with these enzymes removes all or most of the pACYC177 fragment, so that inserts as large as 6 kb can be accommodated. Although E. coli can be transformed with intact KC-UCD1 DNA, transformation with vector-insert ligation mixes results in sizeable deletions. Transfection of Streptomyces lividans protoplasts with the same ligation mixes results in plaque formation.
3021 bp pACYC177 fragment PstI
BamHI P15 kanR PstI
BamHI KC515 vph
ScaI Pst I
StuI
tsr
StuI BamHI
Bgl II KC-UCD1
ampR
P15
kanR
tsr
Figure 11.3 Construction of KC-UCD1. P15 is the origin of replication from pACYC177. The ScaI, PstI, StuI and BamHI sites can be used for cloning. In KC-UCD2, the BamHI-Bgl II fragment containing the tsr gene is replaced with an apramycin resistance gene.
Genetic Analysis of Nystatin and Amphotericin Biosynthesis
251
Polyethylene glycol (PEG)-mediated transfection can give variable results. The quality of the PEG has long been recognized as a key factor. It is known that the detergent Triton X-100 can generate reactive peroxides as a result of the action of oxygen on the polyoxyethylene chain (Ashani and Catravas, 1980; Lever, 1977). Similar processes must occur with PEG. In the presence of ferrous ions, hydrogen peroxide can generate reactive hydroxyl radicals via the Fenton reaction. Hydroxyl radicals can damage DNA and cause lipid peroxidation in protoplast membranes. The transfection efficiencies can be improved by pretreating PEG solutions with antioxidants like DMSO or ascorbate. Fluka supply PEG1000 that is guaranteed to contain less than 0.001% peroxides. This remains useable without pretreatment for years. Detection of recombinant phages was previously carried out by plaque hybridization. Screening can be done by picking individual plaques into Difco nutrient broth (DNB) and by testing the resulting phage suspensions by PCR using primers specific for the insert (Khaw et al., 1998). As much as 5 ml of DNB in a 50-ml reaction mixture does not adversely affect amplification. Propagation of recombinant phages on S. nodosus usually yields thiostrepton-resistant lysogen colonies. Some recombinant phage genomes do not integrate into the chromosome, for reasons that are unclear. A possible limitation is that formation of a lysogen has to compete with lytic growth of the phage. In these cases, a second recombinant phage containing an overlapping region of the chromosome is constructed. This has generally led to success. Genomic DNA is isolated from putative lysogens and the presence of prophage DNA can be rapidly confirmed by PCR. Southern hybridization can be carried out to verify that the phage has integrated correctly. This can also by achieved by amplifying chromosome– prophage junctions by PCR. Primers should be designed to amplify regions found in true lysogens but not in free phage or parental chromosomal DNA. Lysogens are routinely subcultured several times in the absence of antibiotic to allow loss of the phage by a second crossover. Protoplasts are prepared, filtered, and regenerated to obtain colonies derived from single cells rather than networks of mycelial cells. Alternatively, the culture is plated on Streptomyces medium (1 g Lab Lemco powder, 1 g yeast extract, 2 g tryptone, 15 mg FeSO4, 10 g glucose per liter, pH 7.2) containing 1% (w/v) mannose to obtain spores. Colonies derived from single spores or protoplasts are plated on tryptic soy agar and tryptic soy agar containing 50 mg thiostrepton per milliliter. Clones that have lost the vector are thiostrepton-sensitive. Genomic DNA is then analyzed for the correct gene replacement by Southern analysis or by PCR. As a time-saving measure, protoplasts can be used as a source of chromosomal DNA template in PCR reactions. This eliminates the need to carry out multiple genomic DNA isolations. Intact spores can also provide chromosomal template DNA
252
Sergey Zotchev and Patrick Caffrey
in PCRs but the yield of product is somewhat lower than that obtained with protoplasts. The amphL and manA genes have been disrupted by insertional inactivation where internal fragments of around 1 kb were cloned into KC515 and KC-UCD1 (Byrne et al., 2003; Nic Lochlainn and Caffrey, 2009). However, homologous recombination with small fragments is inefficient.
3.1. Phage-mediated gene replacement in S. nodosus 1. Digest 0.5 mg KC-UCD1 DNA with the required restriction enzymes (e.g., BamHI-PstI, BamHI-ScaI, PstI-StuI). The small fragment should be detectable by agarose gel electrophoresis when digestion is complete. In control transfections (see below), completely digested (unligated) vector DNA gives no plaques. It is not necessary to dephosphorylate the ends of the vector. Usually the insert DNA fragment is excised from a pUC118 or pBCSK clone and ligated to the KC-UCD1 DNA without purification from the plasmid fragment. An insert:vector ratio of 2:1 is used in ligations. 2. Protoplasts for transfection are prepared from 25 ml of a 40-h tryptic soy (TS) broth culture of S. lividans 1326. Mycelium is washed twice in sterile 10.3% (w/v) sucrose then suspended in 4 ml P buffer containing 1 mg lysozyme per milliliter. (To make P buffer, 10.3 g sucrose, 25 mg K2SO4, 202 mg MgCl26H2O and 2 ml trace elements solution are dissolved in 80 ml water and autoclaved. The following are then added: 1ml 0.5% [w/v] KH2PO4, 10 ml 3.68% [w/v] CaCl22H2O and 10 ml 5.73% [w/v] TES [pH 7.2]. Trace elements solution contains 40 mg ZnCl2, 200 mg FeCl3, 10 mg CuCl32H2O, 10 mg MnCl24H2O, 10 mg Na2B4O710H2O per liter of H2O.) Phase-contrast microscopy is used to assess formation of spherical protoplasts from the network of branched filaments. The suspension is filtered through sterile cotton wool. Protoplasts are sedimented by centrifugation in a microfuge (7000 rpm for 5 min at room temperature) and washed three times in P buffer to remove lysozyme. The final pellet is resuspended in 2 ml P buffer. The concentration of protoplasts is around 106 per ml, as determined by viable counting after regeneration on R2YE agar. The suspension is divided into 100-ml aliquots and stored at –80 . Protoplasts remain useable for at least five years. Protoplasts are usually washed twice in P buffer before transfection, to remove the contents of lysed protoplasts. 3. Add approximately 0.5 mg ligated DNA in 10 to 50 ml protoplasts and mix. Then add 200 ml 25% (w/v) PEG1000 in P buffer. Add 20 ml of this mixture to 180 ml P buffer, make further serial 10-fold dilutions to 10–4 and pipette each dilution onto an R2YE plate. (R2YE agar contains 103 g sucrose, 0.25 g K2SO4, 10.12 g MgSO46H2O, 10 g
Genetic Analysis of Nystatin and Amphotericin Biosynthesis
4.
5.
6.
7.
8. 9.
253
glucose, 0.1 g casamino acids, 5 g yeast extract, 5.73 g TES, 2 ml trace elements solution and 22 g agar per liter. After autoclaving, the following sterile solutions are added: 10 ml 0.5% [w/v] KH2PO4, 4 ml 5-M CaCl22H2O, 15 ml 20% [w/v] L-proline, and 7ml 1M NaOH.) The protoplasts are overlaid with soft R2 agar containing 106 S. lividans 1326 spores per 100 ml. (Soft R2 is a 1:1 mixture of molten R2YE agar and P buffer. The P buffer is prewarmed to 50 before mixing.) After the top agar has set, the plates are incubated overnight at 30 . It is important to do a control transfection with KCUCD1 DNA. Sterile cut-off pipette tips are used to remove plugs of agar containing single plaques. Each agar plug is placed in a 400 ml volume of Difco nutrient broth containing 10 mM MgSO4 and 8 mM Ca(NO3)2. Phage particles are allowed to diffuse overnight at 4 . Screen for positive plaques by PCR with primers designed from the insert DNA. A 5-ml volume of phage suspension is used as a source of template DNA. A resuspended KC-UCD1 plaque is used as a negative control. As a positive control template, use approximately 1 pg plasmid containing the insert in DNB containing the divalent cations. Prepare stocks of positive phages. Each phage is plated on S. lividans 1326. Plates showing confluent or near-confluent lysis are overlaid with 10 ml sterile Difco nutrient broth containing 10 mM MgSO4 and 8 mM CaNO3. The plates are shaken at room temperature for 6 h. The liquid is drawn into a sterile 10-ml syringe and filtered through a 0.2-mm filter into a sterile universal bottle. The phage stock should remain viable at 4 for several years. The recombinant phage is plated on S. nodosus spores. Dilutions around those giving confluent lysis are overlaid with soft nutrient agar containing 50 mg thiostrepton per ml. Lysogens should appear within 7 to 10 days. Streak putative lysogens on tryptic soy agar containing 50 mg thiostrepton per ml to ensure that thiostrepton resistance is stable. Prepare genomic DNA from several lysogens. As a quick test, the presence of prophage DNA can be detected by PCR with primers specific for the phage genome. We have used SR1 [50 CTTCAAG TACGGCTTCGCTTCTGTC 30 ] and SR2 [50 AACGATCTGGT CAGTGCTGAACTTC 30 ] that match nucleotides 5388—5412 and 5892—5916 of the phiC31 genome sequence (Smith et al., 1999). This region is internal to the major capsid protein gene. PCRamplification of prophage-chromosome junctions or Southern analysis can reveal whether the recombinant phage has integrated as expected.
254
Sergey Zotchev and Patrick Caffrey
10. Subculture six times in the absence of thiostrepton and prepare spores or protoplasts. Plating of spores or regeneration of protoplasts gives colonies derived from single cells rather than a mass of mycelium. 11. Single colonies are streaked onto TSA and TSA plus thiostrepton to identify sensitive clones. 12. Isolate genomic DNA from sensitive clones and identify gene replacement mutants by PCR or Southern blotting. Protoplasts may be used as a source of template DNA for PCR.
4. Production, Purification, and Characterization of Novel Amphotericinand Nystatin-Related Polyenes Methods for industrial-scale extraction of nystatin and amphotericin have been reviewed by Worthen et al. (2001). Generally these procedures involve extraction of whole cultures with butanol or extraction of harvested mycelium with methanol. Concentration of methanol extracts gives a polyene precipitate that can be washed several times with water to give material that is approximately 80% pure. This approach works with analogues that are produced in good yield. In some cases, mutant strains produce low yields of analogues, particularly where early PKS modules have been engineered. Polyenes have characteristic UV-visible absorption spectra and low levels of polyenes can be detected in crude extracts by spectrophotometry. Gel filtration in methanol on Sephadex LH20 is a simple low-cost method for partial purification of crude polyenes prior to analytical HPLC or electrospray mass spectrometry. HPLC methods for purification of nystatin and amphotericin analogues have been described by Brautaset et al. (2002) and by Power et al. (2008). NMR studies on amphotericin and nystatin derivatives have been carried out by Rawlings and colleagues (Byrne et al., 2003; Carmody et al., 2005; Power et al., 2008) and by Lancelin and colleagues (Borgos et al., 2006b; Bruheim et al., 2004), respectively. Antifungal activity can be assessed by agar diffusion or broth microdilution assays (Arendrup et al., 2001). Hemolytic activity is assessed using horse erythrocytes (Seco et al., 2005).
4.1. Production and identification of nystatin-related polyenes 1. Inoculate 25 ml of liquid 3% TSB medium (Oxoid, UK) with 0.1 ml of S. noursei spore suspension (>108 CFU/ml) in a 250-ml baffled shakeflask, and incubate for 14 to 16 h at 28 with shaking at 250 rpm.
Genetic Analysis of Nystatin and Amphotericin Biosynthesis
255
2. Use 3 ml of the resulting culture to inoculate 100 ml of semidefined SAO-23 medium (Sekurova et al., 1999) in a 500-ml baffled shake-flask and incubate at 28 for 120 h with shaking (200 rpm, orbital movement amplitude 2.5 cm). To obtain optimal morphology, add 3 g of 2-mm glass beads to each flask. 3. Extract 1ml culture with 10 ml dimethyl sulfoxide (DMSO). 4. Perform LC-MS analysis of the DMSO extract on an Agilent 1100 HPLC connected to an Agilent MSD TOF mass spectrometer with electrospray ionization (ESI) in both positive and negative ion mode using the HPLC column Waters NovaPak C18 (150 2.1 mm) at a flow rate of 300 ml/min. The mobile phase is 10 mM ammonium acetate (pH 4.0) and acetonitrile (ACN). 5. Run the LC with a linear gradient from 30 to 70% ACN in 10 mM ammonium acetate (pH 4.0) for the first 10 min and then keep at 70% ACN for 5 min (Bruheim et al., 2004).
4.2. Scaled-up production of nystatin analogues 1. Fermentations are performed in 3-l fermentors with an initial medium (SAO-23) volume of 1 to 1.5 l, and an inoculum of 3% (v/v) grown in liquid 0.5 TSB medium in shake-flasks at 28 for 18 h. 2. Fermentations are run at 28 with constant aeration (0.25 VVM) and agitation is controlled to maintain the dissolved oxygen level higher than 30% saturation. The pH is maintained at 6.5 to 7.0 by addition of 2 M NaOH. 3. Polyene production is assayed by DMSO extraction of cultures and subsequent analysis by LC-MS on an Agilent 1100 HPLC system with an online diode array detector (DAD)—and a TOF mass-sensitive detector and electrospray ionization in the negative mode, as described in Bruheim et al., 2004.
4.3. Preparative LC-MS purification of nystatin analogues 1. For preparative isolation, polyenes are extracted from mycelium with 5 ml of MeOH per gram of cell pellet. The extract can be subjected to preparative HPLC either directly, or after concentration. Concentration is performed by adding 2.5 ml water to 5 ml extract, removing the liquid by vacuum evaporation until precipitation occurs, drying the precipitated analogue, and dissolving it in DMSO to a concentration of 1 to 2 mg/ml. 2. Subject the samples to preparative HPLC on the Agilent 1100 system with an online diode array detector (DAD)–Agilent MSD Trap mass spectrometer monitoring with flow split to the MSD and a fraction collector. A preparative Waters NovaPak C18 column (30 300 mm)
256
Sergey Zotchev and Patrick Caffrey
is used at 30 with a flow rate of 50 to 60 ml/min, using 0.5- to 2-ml injection volume. 3. Run the LC with a linear gradient from 20 to 70% MeOH or ACN in 10 mM ammonium acetate pH 4.0 for the first 10 to 15 min and then keep at 70 to 80% for 2 to 5 min (Borgos et al., 2006b; Bruheim et al., 2004). 4. The collected fractions are pooled, and an aliquot is reanalyzed by analytical LC-MS to determine the purity of the isolated compound. The purity and concentration of each engineered polyene are determined by reference to USP standards of nystatin and amphotericin B for tetraenes and heptaenes, respectively, assuming that molar extinction coefficients in the spectral regions of interest are unaltered. Peak UV absorptions at 309 nm and 386 nm, are used for tetraenes and heptaenes, respectively. Typically, 95 to 97% purity is achieved. 5. The rest of the sample is dried in a Speed-Vac centrifuge after the mobile phase was exchanged for a water-MeOH mixture (10 to 90%) by solidphase extraction (Oasis HLB SPE kit; Waters).
5. Conclusion Genetic manipulation of S. noursei and S. nodosus has yielded insights into polyene biosynthesis. This work has yielded analogues that may eventually become medically important. The ability to engineer genes in these organisms will be important in future mining of their genomes. This work may also assist basic research on homologous recombination in streptomycetes.
ACKNOWLEDGMENTS We thank Ha˚vard Sletta for providing details on production and purification of nystatin analogues.
REFERENCES Allmansberger, R., Brau, B., and Piepersberg, W. (1985). Genes for gentamicin-(3)N-acetyltransferases III and IV. II. Nucleotide sequences of three AAC(3)-III genes and evolutionary aspects. Mol. Gen. Genet. 198, 514–520. Aparicio, J. F., Caffrey, P., Gil, J., and Zotchev, S. B. (2003). Polyene antibiotic biosynthesis gene clusters. Appl. Microbiol. Biotechnol. 61, 179–188. Arendrup, M., Lundgren, B., Mller Jensen, I., Snder Hansen, B., and Frimodt-Mller, N. (2001). Comparison of Etest and a tablet diffusion test with the NCCLS broth microdilution method for fluconazole and amphotericin B susceptibility testing of Candida isolates. J. Antimicrob. Chemother. 47, 521–526.
Genetic Analysis of Nystatin and Amphotericin Biosynthesis
257
Ashani, Y., and Catravas, G. N. (1980). Highly reactive impurities in Triton X-100 and BRIJ 35. Partial characterization and removal. Anal. Biochem. 109, 55–62. Bierman, M., Logan, R., O’Brien, K., Seno, E. T., Rao, R. N., and Schoner, B. E. (1992). Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116, 43–49. Bolard, J. (1986). How do the polyene macrolide antibiotics affect cellular membrane properties? Biochim. Biophys. Acta 864, 257–304. Borgos, S. E. F., Sletta, H., Fjaervik, E., Brautaset, T., Ellingsen, T. E., Gulliksen, O. M., and Zotchev, S. B. (2006a). Effect of glucose limitation and specific mutations in the module 5 enoyl reductase domains in the nystatin and amphotericin polyketide synthases on polyene macrolide biosynthesis. Arch. Microbiol. 185, 165–171. Borgos, S. E. F., Tsan, P., Sletta, H., Ellingsen, T. E., Lancelin, J. M., and Zotchev, S. B. (2006b). Probing the structure-function relationship of polyene macrolides: Engineered biosynthesis of soluble nystatin analogues. J. Med. Chem. 49, 2431–2439. Brautaset, T., Sekurova, O. N., Sletta, H., Ellingsen, T. E., Strom, A. R., Valla, S., and Zotchev, S. B. (2000). Biosynthesis of the polyene antifungal antibiotic nystatin in Streptomyces noursei ATCC 11455: Analysis of the gene cluster and deduction of the biosynthetic pathway. Chem. Biol. 7, 395–403. Brautaset, T., Bruheim, P., Sletta, H., Hagen, L., Ellingsen, T. E., Strom, A. R., Valla, S., and Zotchev, S. B. (2002). Hexaene derivatives of nystatin produced as a result of an induced rearrangement within the nysC polyketide synthase gene in S. noursei ATCC 11455. Chem. Biol. 9, 367–373. Brautaset, T., Sletta, H., Nedal, A., Borgos, S. E. F., Degnes, K. F., Bakke, I., Volokhan, O., Sekurova, O. N., Treshalin, I. D., Mirchink, E. P., Dikiy, A., Ellingsen, T. E., Zotchev, S. B. (2008). Improved antifungal polyene macrolides via engineering of the nystatin biosynthetic genes in Streptomyces noursei. Chem. Biol. 15, 1198-1206. Bruheim, P., Borgos, S. E. F., Tsan, P., Sletta, H., Ellingsen, T. E., Lancelin, J. M., and Zotchev, S. B. (2004). Chemical diversity of polyene macrolides produced by Streptomyces noursei ATCC 11455 and recombinant strain ERD44 with genetically altered polyketide synthase NysC. Antimicrob. Agents Chemother. 48, 4120–4129. Byrne, B., Carmody, M., Gibson, E., Rawlings, B., and Caffrey, P. (2003). Biosynthesis of deoxyamphotericins and deoxyamphoteronolides by engineered strains of Streptomyces nodosus. Chem. Biol. 10, 1215–1224. Caffrey, P., Lynch, S., Flood, E., Finnan, S., and Oliynyk, M. (2001). Amphotericin biosynthesis in S. nodosus: Deductions from analysis of polyketide synthase and late genes. Chem. Biol. 8, 713–723. Caffrey, P., Aparicio, J. F., Malpartida, F., and Zotchev, S. B. (2008). Biosynthetic engineering of polyene macrolides for generation of improved antifungal and antiparasitic agents. Curr. Top. Med. Chem. 8, 639–653. Carmody, M., Byrne, B., Murphy, B., Breen, C., Lynch, S., Flood, E., Finnan, S., and Caffrey, P. (2004). Analysis and manipulation of amphotericin biosynthetic genes by means of modified phage KC515 transduction techniques. Gene 343, 107–115. Carmody, M., Murphy, B., Byrne, B., Power, P., Rai, D., Rawlings, B., and Caffrey, P. (2005). Biosynthesis of amphotericin derivatives lacking exocyclic carboxyl groups. J. Biol. Chem. 280, 34420–34426. Chater, K. F. (1986). Streptomyces phages and their applications to Streptomyces genetics. In ‘‘The Bacteria, A Treatise on Structure and Function,’’ (S. W. Queener and L. E. Day, eds.), vol. IX, pp. 119–158. Antibiotic-Producing Streptomycetes. pp. 119–158. Academic Press, Orlando, FL. Flett, F., Mersinias, V., and Smith, C. P. (1997). High efficiency intergeneric conjugal transfer of plasmid DNA from Escherichia coli to methyl-DNA restricting streptomycetes. FEMS Microbiol. Lett. 155, 223–229.
258
Sergey Zotchev and Patrick Caffrey
Hartsel, S., and Bolard, J. (1996). Amphotericin B: New life for an old drug. Trends Pharm. Sci. 17, 445–449. Hopwood, D. A., Bibb, M. J., Chater, K. F., Kieser, T., Bruton, C. J., Kieser, H. M., Lydiate, D. J., Smith, C. P., Ward, J. M., and Schrempf, H. (1985). ‘‘Genetic manipulation of Streptomyces: A laboratory manual’’ John Innes Foundation, Norwich, UK. Khaw, L. E., Bo¨hm, G. A., Metcalfe, S., Staunton, J., and Leadlay, P. F. (1998). Mutational biosynthesis of novel rapamycins by a strain of Streptomyces hygroscopicus NRRL 5491 disrupted in rapL, encoding a putative lysine cyclodeaminase. J. Bacteriol. 180, 809–814. Kieser, T., Bibb, M. J., Buttner, M. J., Chater, K. F., and Hopwood, D. A. (2000). ‘‘Practical Streptomyces genetics.’’ John Innes Foundation, Norwich, UK. Lemke, A., Kiderlen, A. F., and Kayser, O. (2005). Amphotericin B. Appl. Microbiol. Biotechnol. 68, 151–162. Lever, M. (1977). Peroxides in detergents as interfering factors in biochemical analysis. Anal. Biochem. 83, 274–284. Mazodier, P., Petter, R., and Thompson, C. (1989). Intergeneric conjugation between Escherichia coli and Streptomycesspecies. J. Bacteriol. 171, 3583–3585. Nic Lochlainn, L., and Caffrey, P. (2009). Phosphomannose isomerase and phosphomannomutase gene disruptions in Streptomyces nodosus: Impact on amphotericin biosynthesis and implications for glycosylation engineering. Metab. Eng. 11, 40–47. Nikodinovic, J., Barrow, K. D., and Chuck, J-A. (2003). High frequency transformation of the amphotericin-producing bacterium, Streptomyces nodosus. J. Microbiol. Meth. 55, 273–277. Olano, C., Lombo´, F., Me´ndez, C., and Salas, J. A. (2008). Improving production of bioactive secondary metabolites in actinomycetes by metabolic engineering. Metab. Eng. 10, 281–292. Power, P., Dunne, T., Murphy, B., Nic Lochlainn, L., Rai, D., Borissow, C., Rawlings, B., and Caffrey, P. (2008). Engineered biosynthesis of 7-oxo and 15-deoxy-15-oxo-amphotericins: Insights into structure-activity relationships in polyene antibiotics. Chem. Biol. 15, 78–86. Seco, E. M., Fotso, S., Laatsch, H., and Malpartida, F. (2005). A tailoring activity is responsible for generating polyene amide derivatives in Streptomyces diastaticus var. 108. Chem. Biol. 12, 1093–1101. Sekurova, O. N., Brautaset, T., Sletta, H., Borgos, S. E. F., Jakobsen, O. M., Ellingsen, T. E., Strom, A. R., Valla, S., and Zotchev, S. B. (2004). In vivo analysis of the regulatory genes in the nystatin biosynthetic gene cluster of Streptomyces noursei ATCC 11455 reveals their differential control over antibiotic biosynthesis. J. Bacteriol. 186, 1345–1354. Smith, M. C., Burns, R. N., Wilson, S. E., and Gregory, M. A. (1999). The complete genome sequence of the Streptomyces temperate phage phiC31: Evolutionary relationships to other viruses. Nucleic Acids Res. 27, 2145–2155. Soler, L., Caffrey, P., and McMahon, H. (2008). Effects of new amphotericin analogues on the scrapie isoform of the prion protein. Biochim. Biophys. Acta 1780, 1162–1167. Worthen, D. R., Jay, M., and Bummer, P. (2001). Methods for recovery and purification of polyene antifungals. Drug Dev. Ind. Pharm. 27, 277–286. Zotchev, S. B., Haugan, K., Sekurova, O., Sletta, H., Ellingsen, T. E., and Valla, S. (2000). Identification of a gene cluster for antibacterial polyketide-derived antibiotic biosynthesis in the nystatin producer Streptomyces noursei ATCC 11455. Microbiology 146, 611–619.
C H A P T E R
T W E LV E
Polyketide Versatility in the Biosynthesis of Complex Mycobacterial Cell Wall Lipids Tarun Chopra and Rajesh S. Gokhale Contents 1. 2. 3. 4.
Introduction Acetate and Propionate Feeding Studies Genome Sequencing and Identification of Polyketide Synthases Mycobacterial Polyketide Synthases 4.1. Biosynthesis of dimycocerosate esters (DIMs) by PKS15/1, PpsABCDE, and MAS 4.2. PKS2 is involved in biosynthesis of sulfolipids 4.3. PKS12 uses a novel ‘‘modularly iterative’’ mechanism for biosynthesis of mannosyl-b-1-phosphomycoketides 4.4. PKS13 catalyzes condensation of fatty-acyl chains during biosynthesis of mycolic acids 4.5. PKS3/4 is involved in the biosynthesis of phthenoic acids 4.6. PKS10, PKS7, PKS8, PKS17, PKS9, and PKS11 constitute an unusual PKS cluster 4.7. PKS18 is involved in biosynthesis of long-chain pyrones 4.8. MbtC and MbtD are involved in biosynthesis of iron-chelating siderophores from Mtb 4.9. PKS5 and PKS6 5. Techniques to Characterize PKS Enzymes 5.1. Product formation assay to study activity of PKS enzymes 5.2. Characterization of PKS derived saturated fatty acids References
260 265 266 267 267 270 272 273 277 278 279 280 281 282 282 282 284
Abstract Genome sequencing of Mycobacterium tuberculosis (Mtb) has revealed a large number of open reading frames homologous to polyketide synthases (PKSs). Since Mtb is not known to produce secondary metabolites, their presence in the
Chemical Biology Laboratory, National Institute of Immunology, New Delhi, India Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04612-6
#
2009 Elsevier Inc. All rights reserved.
259
260
Tarun Chopra and Rajesh S. Gokhale
Mtb genome was rather surprising. Research over the last decade has demonstrated that these PKSs are involved in the biosynthesis and assembly of complex lipids. The catalytic as well as mechanistic versatility of PKSs in producing acyl chains of Mtb lipidic metabolites are discussed here. We refer to the literature for most bench-level details, but include protocols for generally useful methods for analyzing the products of mycobacterial PKSs.
1. Introduction Mycobacterium tuberculosis (Mtb) is the etiologic agent of the human disease tuberculosis and remains a major cause of morbidity and mortality worldwide. Mtb bacilli are encapsulated by a complex cell envelope known to actively contribute toward virulence. This waxy barrier also provides protection to the bacterium from various therapeutic agents (Draper, 1998; Jarlier and Nikaido, 1994). Much of the early work on the chemical nature of the cell wall of Mtb was carried out by R.J. Anderson and T.B. Johnson at Yale University, where they focused on characterization of fat-like material present in the tubercle bacillus. While the initial instinct was for the presence of sterols, examination of both aqueous and solvent fractions did not yield any sterol-containing compounds. Purification and careful analysis of these fractions revealed many new and interesting chemical substances not usually found in the plant and animal kingdoms. These studies provided early leads for the presence of trehalose-containing compounds, phthiocerols, mycolic acids, and so on in mycobacteria (Anderson, 1941; Goren, 1972; Minnikin, 1982). Complete chemical characterization of these complex metabolites was carried out in subsequent years with the advent of new technologies and methodologies. It is now established that these chemical compounds are embedded as a highly complex network of sugars, proteins and lipids in the mycobacterial cell wall (Daffe and Draper, 1998; Lederer et al., 1975). The base of the mycobacterial cell wall consists of a plasma membrane that can be resolved into a thick outer layer and a thin inner layer using electron microscopy, as depicted in Fig. 12.1 (Paul and Beveridge, 1992; Zuber et al., 2008). The thickness of the outer layer is associated with the presence of carbohydrates and phospholipids, including phosphatidylinositol mannosides (PIMs). PIMs are involved in anchoring polysaccharides like lipoarabinomannan (LAM) and lipomannan (LM) in the cell wall (Brennan, 1988; Daffe´ and Lemassu, 2000; Guerardel et al., 2002; Pitarque et al., 2008). The plasma membrane also hosts a variety of other compounds like carotenoids, menaquinones and various glycosylphosphopolyprenols (Brennan and Nikaido, 1995; Daffe´ and Lemassu, 2000). Outside the plasma membrane, a complex polymer of peptidoglycan surrounds the mycobacteria and acts as a scaffold to which arabinogalactan moieties are connected by L-rhamnose-D-Nacetylglucosamine. The C-1 of N-acetylglucosamine is phosphodiesterified
261
PKS-Mediated Biosynthesis of Mycobacterial Lipids
Mycobactin
MPM
Porin HO HO O
O O P O– OH OH O
R
n O
O
OCH3
PDIMs
O O
R HO n N O O O N –OH NH O O R
R
O HN O N HO
Mycolic acids
LM portion of LAM Galactan Arabinose sugar Rhamanose Peptidoglycan PIMs Plasma membrane
Figure 12.1 Schematic representation of the mycobacterial cell envelope. MPM, mannosyl-b-1-phosphomycoketides; PDIM, phthiocerol dimycocerosates; PIM, phosphatidylinositol mannosides; LM, lipomannan; LAM, lipoarabinomannan.
to the hydroxyl moiety of C-6 of the muramic units of the peptidoglycan layer. The rhamnose moiety is connected to the galactan of the arabinoglactan layer, generating a bridge between the arabinogalactan and the peptidoglycan layer. Mycolic acids are esterified to these distal arabinose sugars of the arabinogalactan layer (Brennan, 2003; Brennan and Nikaido, 1995; McNeil et al., 1991; Misaki et al., 1974). Mycolic acids are also present as free mycolates or as esters of trehalose sugars called trehalose monomycolates (TMM) and trehalose dimycolates (TDM) (Bloch and Noll, 1955; Noll et al., 1956; Takayama et al., 2005). A number of other surface-exposed lipids like sulfolipids (SL), polyacyltrehaloses (PAT), phthiocerol dimycocerosates (PDIM), mannosyl-b-1-phosphomycoketides (MPM) and diacyl trehaloses (DAT) intercalate into the cell wall. This lipid-rich cell wall also harbors a number of proteins, including the antigen 85 complex and porins, which constitute the complex cell-wall assembly (Asselineau and Laneelle, 1998; Brennan and Nikaido, 1995; Draper, 1998; Gokhale et al., 2007b). In this article we describe the enzymology of the various components of the mycobacterial envelope, focusing on the role played by polyketide synthases (PKSs) in their biosynthesis. It is not feasible to provide standard protocols for studying all these varied processes. At the end of the article we give two protocols that we have found useful for product analysis, which can be adapted for assaying a wide range of compounds. Various techniques involved in analysis and characterization of mycobacterial enzymes are summarized in Tables 12.1 and 12.2.
262
Table 12.1 Techniques used to study biosynthetic pathways in mycobacteria Technique
Comments
References
Gene inactivation techniques
Gene inactivation along with mouse infection studies and biochemical analysis of mutant strains enables identification of gene function and its importance for virulence Random mutagenesis technique that enables generation of several gene mutants at a time Random mutagenesis technique that enables identification of conditionally essential genes Mutagenesis technique targeted towards a single gene
(Camacho et al., 1999; Hensel et al., 1995) (Murry et al., 2008; Sassetti et al., 2001) (Parish and Stoker, 2000)
1. Signature tagged mutagenesis (STM) 2. Transposon-site hybridization (TraSH) 3. Allelic exchange using suicide vectors 4. Allelic exchange using conditionally replicating vectors
5. Inducible expression of antisense RNA 6. Regulated gene expression by tetracycline inducible promoters Lipid analysis
Targeted mutagenesis technique that possesses high recombination efficiency. Utilizes temperaturesensitive plasmid or plasmid incompatibility delivery systems Conditional mutagenesis technique that enables reduction of target gene expression Conditional mutagenesis technique that enables a tighter regulation of target gene expression
(Guilhot et al., 1992; Pashley et al., 2003)
1. Useful in investigating the importance of the mutant gene in lipid biosynthesis 2. Analysis techniques include TLC and mass spectrometry 3. Different lipids can be analyzed by varying the solvent system used for TLC analysis
(Slayden and Barry, 2000) (Bhatt et al., 2007c; Constant et al., 2002; Kumar et al., 2007; Lea-Smith et al., 2007; Mougous et al., 2002; Waddell et al., 2005)
(Parish and Stoker, 1997) (Carroll et al., 2005)
Table 12.2 Biochemical assays used to characterize enzymes involved in lipid biosynthesis Enzymatic assays
Comments
1. PKS and FAS assays
1. PKSs and FASs are implicated in biosynthesis of most mycobacterial lipids 2. Product characterization using a combination of radio- TLC, radio-HPLC and mass spectrometric approaches
Type I PKSs/FASs Type II PKSs/FASs
Type III PKSs/FASs 2. FAAL/FACL assays
1. FAALs activate starter fatty acids as acyl adenylates for PKS proteins 2. Product characterization using radio-TLC, radio-HPLC and mass spectrometric approaches
3. Polyketide-associated proteins (Pap) A assays
1. PapA proteins demonstrate esterase activity 2. Product characterization using radio-TLC, radio-HPLC and mass spectrometric approaches
References
This article, (Chopra et al., 2008; Trivedi et al., 2005) (Gurvitz et al., 2008a; Kremer et al., 2001; Marrakchi et al., 2002; Sacco et al., 2007; Schaeffer et al., 2001a) (Funa et al., 2006; Ghosh et al., 2008; Saxena et al., 2003) (Arora et al., 2005; Ferreras et al., 2008; Trivedi et al., 2004)
(Kumar et al., 2007; Onwueme et al., 2004; Trivedi et al., 2005)
263
(continued)
Table 12.2 (continued) Enzymatic assays
Comments
References
4. Sulfotransferase (Stf ) assays
1. Stfs are responsible for transfer of a sulfuryl group from PAPS to a variety of substrates 2. Product characterization using radio-TLC, radio-HPLC and mass spectrometric approaches
(Mougous et al., 2004; Rivera-Marrero et al., 2002)
5. Acyl CoA carboxylase (ACC) assays
1. ACCs convert acetate and propionate units to malonyl CoA and methylmalonyl CoA which is utilized by the FAS and PKS enzymes 2. Product characterization using liquid scintillation counting and HPLC analysis
(Daniel et al., 2007; Gande et al., 2004; Oh et al., 2006; Rainwater and Kolattukudy, 1982)
6. Glycosyl-transferase (Gtf ) assays
1. Gtfs catalyze transfer of sugars onto various lipids 2. Product characterization using liquid scintillation counting, radio-TLC and mass spectrometric approaches
(Birch et al., 2008; Cooper et al., 2002; Pathak et al., 2002; Seidel et al., 2007)
265
PKS-Mediated Biosynthesis of Mycobacterial Lipids
2. Acetate and Propionate Feeding Studies Initial analysis of wax components from Mtb revealed a mixture of fatty acids ranging from saturated palmitic acid to a wide variety of methylbranched fatty acids. These included tuberculostearic acid (10-Methyl C18 fatty acid), dextrorotatory fatty acids analogous to phthienoic acid (trimethyl unsaturated C27 acid) and levorotatory fatty acids called mycocerosic acids (tetramethyl branched C28 to C32 acids) (Anderson, 1941; Asselineau, 1966; Asselineau and Laneelle, 1998; Brennan, 1988; Goren, 1972). While the structure and chemical nature of these compounds was elucidated using conventional chemical characterization techniques, the enzymology and biochemistry of their in vivo biosynthesis was not well understood. Key insights into the biosynthesis of branched-chain fatty acids were provided by precursor feeding experiments in Mtb (Fig. 12.2) (Gastambide Odier et al., 1963; Narumi et al., 1973; Yano and Kusunose, 1966). Radioactive 14C-propionate/14C-acetate units are converted to methylmalonyl CoA/ malonyl CoA, respectively, by biotin-dependent propionyl/acetyl CoA carboxylases (Rainwater and Kolattukudy, 1982; Rawlings, 1997; Savvi et al., 2008). These methylmalonate and malonate units are used by the fatty acid synthase (FAS) and PKS enzymatic machineries for biosynthesis of various O
R′
FATTY ACID (R′ = H, CH3)
∗ SCoA
HO R′
R′
Extender unit
AT
Exterior
O
O
R
R
SCoA
KS
∗ S
HO KS
CO 2
O
O FAS
KR DH
O ∗ S
KR DH
KR DH ER
ACP
O
ts
∗ S
R
OH O
KR
ACP
R′
duc
ro dp rate
u
Sat
∗ S
R
ER
R′
ACP
R′
Interior
R
O
O S
Starter unit
R′ = H
ACC/ PCC
∗ SCoA
∗ OH
R′
O
O
O
O
∗ OH
S PK
∗ S
R′
ACP
d
ate
r satu /un ted s ura oduct t a S pr
R′
ACP
R′
O R ACP
∗ S
R
R′ = H, CH3
Figure 12.2 Overview of the acetate/propionate feeding experiments with their channeling to FASs and PKSs. The radioactive carbon is marked with an asterisk (*). ACC/ PCC, acyl/propionyl CoA carboxylase; KS, ketosynthase; AT, acyl transferase; ACP, acyl carrier protein.
266
Tarun Chopra and Rajesh S. Gokhale
metabolites. Lipid analysis of Mtb grown in the presence of 14C-propionate as a tracer revealed incorporation of radioactive label into the branched end of mycocerosic acids (Gastambide Odier et al., 1963). However, the fatty acid synthase responsible for the biosynthesis of these methylated acids could not be identified and it took another 20 years before Kolattukudy and coworkers demonstrated the existence of another elongation system. This elongation system, referred to as mycocerosic acid synthase (MAS), resembled the FASs in all respects, except for exhibiting specificity for methylmalonyl CoA (Gastambide Odier et al., 1963; Rainwater and Kolattukudy, 1983). Cloning and expression of the mas gene and construction of a genetic knockout strain of Mycobacterium bovis BCG facilitated investigation of the in vivo role of MAS in mycobacterial biology (Azad et al., 1996; Mathur and Kolattukudy, 1992). 14Cpropionate feeding experiments with this knockout strain established a role of MAS in biosynthesis of mycosides (phenolic glycolipids), and this methodology provided a basis for analyzing the in vivo role of mycobacterial genes in the biosynthesis of various cell wall lipids (Azad et al., 1996). Moreover, the presence of other methylated fatty acids in mycobacteria suggested the existence of multiple mas-like genes (Azad et al., 1996; Kolattukudy et al., 1997; Mathur and Kolattukudy, 1992).
3. Genome Sequencing and Identification of Polyketide Synthases In agreement with the presence of a number of lipid metabolites unique to Mtb, genome sequencing revealed many genes involved in lipid metabolism (Cole et al., 1998; Natarajan et al., 2008). Apart from the type I and type II FAS systems involved in fatty acid biosynthesis, several gene clusters homologous to PKSs were identified. Sequence homology studies suggested mycobacteria to contain examples of all three polyketide biosynthetic systems. (Table 12.3) (Cole et al., 1998; Natarajan et al., 2008). Since PKSs from Streptomyces are involved in the biosynthesis of polyketide natural products (Hopwood, 1997; Katz and Donadio, 1993; O’Hagan, 1992; Sanchez et al., 2008), the existence of these homologues indicated the presence of polyketide metabolites in Mtb. Prior to the genome availability, sequencing around the mas gene cluster had indicated the presence of modular PKSs (Azad et al., 1997; Kolattukudy et al., 1997). Research over the last decade has given some fascinating insights into the role of these enzymes in mycobacterial biology, where they have been implicated in the biosynthesis of various virulence lipids (Chhabra and Gokhale, 2009; Gokhale et al., 2007a,b; Jackson et al., 2007). In the following sections, we summarize the advances made toward understanding the roles of these PKSs in mycobacterial lipid biosynthesis.
PKS-Mediated Biosynthesis of Mycobacterial Lipids
267
Table 12.3 List of mycobacterial PKSs in the H37Rv strain of Mtb along with their domain organizations
Gene name
Accession number
pks15 pks1 ppsA ppsB ppsC ppsD ppsE mas pks2 pks12
Rv2947c Rv2946c Rv2931 Rv2932 Rv2933 Rv2934 Rv2935 Rv2940c Rv3825c Rv2048c
pks13 pks6 pks3 pks4 pks10 pks7 pks8 pks17 pks9 pks11 pks18 pks5 MbtC MbtD pks14 pks16
Rv3800c Rv0405 Rv1180 Rv1181 Rv1660 Rv1661 Rv1662 Rv1663 Rv1664 Rv1665 Rv1372 Rv1527c Rv2382c Rv2381c Rv1342c Rv1013
Domain organization
KS AT-DH-ER-KR-ACP ACP-KS-AT-KR-ACP KS-AT-KR-ACP KS-AT-DH-ER-KR-ACP KS-AT-DH-KR-ACP KS-AT-ACP-C KS-AT-DH-ER-KR-ACP KS-AT-DH-ER-KR-ACP KS-AT-DH-ER-KR-ACP-KS-AT-DHER-KR-ACP ACP-KS-AT-ACP-TE ACP-KS-AT-ACP-TE KS AT-DH-ER-KR-ACP KS (Type III) KS-AT-DH-ER-KR-ACP KS-AT-DH-ER KR-ACP KSQ-AT-ACP KS (Type III) KS (Type III) KS-AT-DH-ER-KR-ACP KS AT-KR-ACP ErroneouslyWrongly annotated ErroneouslyWrongly annotated
4. Mycobacterial Polyketide Synthases 4.1. Biosynthesis of dimycocerosate esters (DIMs) by PKS15/1, PpsABCDE, and MAS Analysis of lipid extracts suggested a number of hydroxy compounds in mycobacteria (Asselineau, 1966). Among these, the methoxyglycols were termed as phthiocerols (3-methoxy, 4-methyl, 9,11-dihydroxy glycols) and were found to be esterified with mycocerosic acids. Interestingly, bovine strains of mycobacteria were found to contain a glycolipid called mycoside B,
268
Tarun Chopra and Rajesh S. Gokhale
which on hydrolysis yielded mycocerosic acids and a variant of phthiocerol called phenolthiocerol (p-glycosylated phenylglycol). Phenolthiocerol possesses a phthiocerol-like chain but ends with a phenolic moiety glycosylated with various sugars (Asselineau, 1966; Onwueme et al., 2005a). Together, the phthiocerol esters and the phenolthiocerol esters are referred to as DIMs. These esters are present on the cell surface of Mtb and have been implicated in its virulence (Camacho et al., 1999; Cox et al., 1999; Reed et al., 2004). Knockout studies provided early insights into the biosynthesis of these compounds. While the mas-disrupted mutant of M. bovis BCG was incapable of synthesizing mycocerosic acids (Azad et al., 1996), the ppsdisrupted mutant lacked PDIMs and phenolic glycolipids (PGLs) (Azad et al., 1997). Genome sequencing revealed that the genes involved in biosynthesis of these metabolites are clustered in a large 73-kb operon (Cole et al., 1998; Onwueme et al., 2005a). A combination of genetic and biochemical studies has now provided a comprehensive picture for biosynthesis of these compounds (Fig. 12.3). The biosynthesis of PGLs and PDIMs can be dissected into four steps: (1) priming of PpsA with appropriate PGLor PDIM-specific starter unit; (2) extension of the primer unit by PpsABCDE, leading to the generation of the diol; (3) biosynthesis of mycocerosic acids by MAS; and (4) esterification and final assembly. The biosynthesis of PGLs is initiated by utilizing a common metabolic intermediate, chorismate, which is converted to p-hydroxybenzoic acid (pHB) by a chorismate pyruvate-lyase, Rv2949c (Stadthagen et al., 2005). pHB is then activated and transferred to a type I iterative PKS15/1enzyme by FAAL22 (Ferreras et al., 2008). FAAL22 is a member of a newly discovered family of fatty acyl AMP ligases (FAALs) that activate fatty acids as acyl adenylates instead of acyl coenzyme A (Ferreras et al., 2008; Trivedi et al., 2004). PKS15/1 exhibits extender unit specificity for malonyl CoA and is believed to extend pHB to p-hydroxyphenylalkanoate (Fig. 12.3A). The H37Rv strain of Mtb is devoid of PGLs due to a frameshift mutation in this gene (Constant et al., 2002; Reed et al., 2004). The Beijing family of Mtb strains, as well as M. bovis BCG and Mycobacterium leprae, possess a functional copy of this gene and make PGLs (Daffe and Laneelle, 1988; Reed et al., 2004; Tsenova et al., 2005). The p-hydroxyphenylalkanoate chain is then transferred to the PpsA starter for PGL biosynthesis. The starter n-fatty acyl units for PDIM synthesis are provided by FAAL26, which also uses the novel acyl adenylate activation mechanism (Trivedi et al., 2004). From this stage onward, the biosynthesis of PGLs and PDIMs follows the same biosynthetic route (Fig. 12.3B). PpsA catalyzes extension of the starter units with malonyl CoA, which results in the formation of a monohydroxy fatty acid. This is due to the presence of a single ketoreductase (KR) auxillary domain in PpsA. The acyl chain thus generated is then transferred to PpsB, which catalyzes formation of a diol through another two-carbon condensation, followed by ketoreduction. PpsC adds a malonyl unit to the growing chain and also
269
PKS-Mediated Biosynthesis of Mycobacterial Lipids
PKS15/1 KS
COOH
COOH
OH Chorismate
OH pHB
ATP
S
S
O
FAAL22
CH2 Rv2949c O COOH
AT DH ER KR ACP
O
n
A
PPi AMP OH OH
B
AMP PPi
PpsA
PpsB
PpsC
PpsD
PpsE
PCP KS AT KR ACP
KS AT KR ACP
KS AT DH ER KR ACP
KS AT DH ER KR ACP
KS AT ACP C
SH
S
FAAL26 O
S
S
O
ATP
S
O
O
O
HO
HO
HO
HO
HO
S
S
S
O HO
O
S
O
O
S
S
O
O
OH
HO
HO
HO
HO
R2= –H, –CH3 HO
HO
HO
HO
HO HO
R1
–
R1=–(CH2)3–7 CH3
R1
R1
or
R1
OH
R1
R2
O
R1 R1
R1 R1
R1
C
R1
MAS
MAS KS AT DH ER KR ACP O
S
S O
PpsE
KS AT DH ER KR ACP SH
O
KS AT ACP C
S
S
S O R
2
O
PapA5 R2 R1 R3
O O O O
O
R5
R4
HO HO
R4 = –CH2CH3or –CH3 R5 = –OCH3or =O
R3
R3 = –(CH2)3-7 –CH 3
Mycocerosic acids
R3 R1
Figure 12.3 (A) Biosynthesis of pHB and loading onto PKS15/1. (B) Biosynthesis of diol component of PGLs and PDIMs by modular PpsABCDE machinery. (C) Biosynthesis of mycocerosic acids by iterative MAS and PapA5 mediated condensation with diol for the formation of PGLs and PDIMs. The ER domain in PpsD is a trans ER, which is not a part of the type I architecture of PpsD. For simplicity, it has been shown within the PpsD domain organization.
catalyzes complete reduction to a methylene group. PpsD, in conjunction with a trans-acting enoyl-reductase (ER), Rv2953, extends this chain further with a methylmalonyl moiety (Simeone et al., 2007; Trivedi et al., 2005). The final extension to a phenolphthiocerol or phthiocerol chain is performed by PpsE, which can utilize either malonyl CoA or methylmalonyl CoA extender units (Simeone et al., 2007; Trivedi et al., 2005). MAS possesses all three auxiliary domains (KR, dehydratase [DH] and ER) necessary for complete reduction of newly-generated b-carbonyl acyl chain. MAS carries out iterative condensation of multibranched fatty acids
270
Tarun Chopra and Rajesh S. Gokhale
by using medium- to long-chain fatty acyl CoA starters with methylmalonyl CoA extender units (Mathur and Kolattukudy, 1992; Onwueme et al., 2004; Trivedi et al., 2005). Polyketide-associated protein A5 (PapA5) interacts with MAS and brings about trans-esterification of mycocerosic acids onto the diol component of phthiocerol/phenolpthtiocerol (Fig. 12.3C) (Mathur and Kolattukudy, 1992; Onwueme et al., 2004; Trivedi et al., 2005). Final processing and transport of DIMs requires other proteins like Rv2951c and Mtf2, which bring about reduction of the 3-keto group and subsequent Omethylation of this hydroxyl group. The glycosylation of the phenyl ring in PGLs is carried out by glycosyl transferases, Rv2962c, Rv2958c, and Rv2957c, which modify the phenyl ring with addition of two rhamnose and one fucose sugars. The fucose ring is further modified by action of methyl transferases, which complete the assembly of tri-O-methyl-dirhamnosyl-phenolphthiocerol dimycocerosates (Onwueme et al., 2005b; Perez et al., 2004a,b). The transport of the fully assembled DIMs to the cell wall is proposed to be mediated by a transmembrane protein, MmpL7, which is thought to couple synthesis with transport by specifically interacting with PpsE ( Jain and Cox, 2005). DrrC and LppX are other accessory proteins that mediate the transport of DIMs to the periphery of the cell wall ( Jain and Cox, 2005; Onwueme et al., 2005a; Sulzenbacher et al., 2006).
4.2. PKS2 is involved in biosynthesis of sulfolipids Sulfolipids (SLs) were identified in the late 1950s from Mtb, while studying a sulfur-containing material capable of fixing the cationic dye neutral red (Dubos and Middlebrook, 1948; Middlebrook et al., 1959). Subsequent analysis of this material by Goren and coworkers revealed a mixture of highly related compounds, with the most abundant being sulfolipid-I (SL-I). Chemical analysis revealed a trehalose-2-sulfate (T2S) core, tetra-acylated with fatty acids. While one of the fatty acid substituents is a straight-chain fatty acid (primarily palmitate or stearate), the other three are long-chain methylated fatty acids called phthioceronic acid (PA) or hydroxy phthioceronic acids (HPA) (Goren, 1970a,b, 1971, 1976). Phthioceronic acids differ from mycocerosic acids in having an absolute configuration of S- (also referred to as L- based in older nomenclature) for the methyl-branched carbon, as compared to R- (or D-) in the case of mycocerosic acids (Asselineau, 1966). Gene inactivation and complementation studies clearly indicated an essential role for PKS2 in the biosynthesis of these unusual acids (Sirakova et al., 2001). PKS2 possesses a complete set of active sites to add a completely reduced ketide unit to the starter chain. By a mechanism analogous to MAS, PKS2 catalyzes the biosynthesis of long-chain branched fatty acids by iterative utilization of methylmalonyl CoA (Chopra and Gokhale, unpublished results). The hydroxyl-modification of PA to produce HPA could in principle involve a hydroxylase, which remains to be identified.
271
PKS-Mediated Biosynthesis of Mycobacterial Lipids
Other biosynthetic steps have been deciphered by generating mutants of Mtb lacking various enzymes involved in SL biosynthesis (Fig. 12.4). The biosynthesis is initiated by a sulfotransferase, Stf0, which transfers a sulfuryl group from 30 -phosphoadenosine-50 -phosphosulfate (PAPS) onto trehalose, thereby generating trehalose-2-sulfate (T2S) (Mougous et al., 2004). T2S is acylated either by a palmitate or a stearate unit at the 20 -position by PapA2 to produce monoacylated SL. This is followed by PapA1-mediated transfer of the phthioceranoyl group from PKS2 to the palmitoyl-/stearoyl-T2S, leading to the formation of the diacylated intermediate (Bhatt et al., 2007c; Kumar et al., 2007). FAAL23 is responsible for activation and loading of starter fatty-acyl chains onto PKS2 (Chopra and Gokhale, unpublished results) (Lynett and Stokes, 2007). Since PKS2 also lacks an appended TE domain for chain release, one would expect PapA1 to interact with and sequester the chain from PKS2 for its transesterification onto monoacylated sulfolipid. A transmembrane protein called MmpL8 is also present in the SL cluster and is believed to play an important role in transport of SLs across the cell wall. Disruption of MmpL8 by two independent groups led to the accumulation of diacylated intermediates, SL1278 or SL-N (Converse et al., 2003; Domenech et al., 2004). The conversion of di-acylated sulfolipid to
OH
OH O
HO OH
stf0
AMP PPi O
S
SH
S
O
Trehalose
OSO– O
?
O
3
OH OH
O O 16–18
R1
OH
OH
O
HO OH
OH
R1
PapA2
OH
OH OH
O HO
KS AT DH ER KR ACP
S
O
FAAL23 O
OH OH
O HO
KS AT DH ER KR ACP
ATP
OH O
PAP PAPS
OSO3– O
T2S
PKS2
PKS2
O HO OH
OH
R1
Monoacylated SL
PapA1 R1= –(CH2)3–7 –CH3
R1
OH
Phthioceronic acids
O
HO OH
OSO3–
O
? OH
O
4–9
O
Diacylated SL OH
O O
14,16
O
14,16
O
OSO3–
O O OH
O O 16–18
SL1
OH OH
O
4–9
O HO OH
O
O 16–18
4–9
14,16
O 4–9
14,16
O
Figure 12.4 Assembly of SL-1. Phthioceronic acids are biosynthesized by an iterative PKS2 and are utilized for SL-1 production.
272
Tarun Chopra and Rajesh S. Gokhale
the final tetra-acylated form requires further investigation. The exact biological function of SL-1 in mycobacterial biology is not clear and Mtb mutants of various enzymes involved in sulfolipid biosynthesis have not provided clear correlation to its virulence (Bertozzi and Schelle, 2008). Interestingly, a sulfolipid-deficient PKS2 knockout strain of Mtb retains its ability to stain with neutral red (Andreu et al., 2004; Cardona et al., 2006).
4.3. PKS12 uses a novel ‘‘modularly iterative’’ mechanism for biosynthesis of mannosyl-b-1-phosphomycoketides Mannosyl-b-1-phosphomycoketides (MPMs) are a group of antigenic phospholipids that were recently isolated from pathogenic species of mycobacteria (Moody et al., 2000). Chemically, MPMs are similar to the mammalian mannosyl-b-1-phosphodolichols and possess an identical mannose-phosphate head group. However, the two molecules differ in their alkyl chain, which probably contributes to antigenicity of MPMs (Moody, 2001). Initial studies had suggested an isoprenoid mode of biosynthesis for this alkyl segment (now referred to as the mycoketide) (Moody et al., 2000). Careful mass spectrometric analysis of MPMs, followed by gene inactivation of pks12, revealed a polyketide origin for this chain (Matsunaga et al., 2004). Pks12 is the largest open reading frame in the Mtb genome and codes for a bimodular PKS (Cole et al., 1998; Natarajan et al., 2008). The two modules of PKS12 were predicted to exhibit methylmalonate and malonate extender unit specificity and thus mycoketide synthesis was proposed to involve five alternate condensations of methylmalonyl and malonyl units by using an iterative mechanism of biosynthesis (Matsunaga et al., 2004). Such a mechanism would require transfer of the growing chain from the ACP of the second module to the KS active site of the first module. This transfer would require covalent transfer of acyl chains over very large distances between the catalytic domains of module 2 and module 1. Based on the threedimensional organization of FASs and PKSs this seems unlikely (Chopra et al., 2008; Khosla et al., 2007; Maier et al., 2006; Sherman and Smith, 2006) and presented an interesting challenge to the intramolecular paradigm of iterative catalysis. In order to dissect the programming by which PKS12 biosynthesizes mycoketide, a systematic analysis with purified 431 kDa protein was carried out. Since PKS modules are reported to ‘‘stutter’’ and ‘‘skip’’ during biosynthesis (Thomas et al., 2002; Wenzel et al., 2005; Wilkinson et al., 2000), it was important to ascertain the specificity of the two AT domains. The AT domain specificity was investigated by engineering a single module PKS12D1 protein. These studies demonstrated stringent methylmalonate and malonate specificity for module 1 and module 2, respectively, making it mandatory to use these two modules alternately. Biochemical analysis and
PKS-Mediated Biosynthesis of Mycobacterial Lipids
273
ultracentrifugation studies interestingly suggested formation of a large supramolecular assembly for these proteins. Since PKS12 was found to be active under these conditions, it was speculated that this could be the functionally competent form of the protein. Modular PKSs are known to form specific interactions through the linker proteins and investigation of these linker sequences by swapping or by mutagenesis emphasized their role in formation of this assembly. Further proof for this organization was provided by the demonstration of specific transfer of the acyl chain from (n–1) protein to the next protein (n) through interacting C- and N-terminus linkers. Thus, catalysis proceeded by formation of a specific self-organizing assembly involving multiple molecules of PKS12 and the mechanism was referred to as ‘‘modularly iterative’’. PKS12 provides a novel example of intermolecular iterative catalysis for PKSs (Chopra et al., 2008). A complete picture for biosynthesis of MPM could be drawn from analysis of the pks12 cluster in the mycobacterial genome. The release of the mycoketide chain from PKS12 could occur via two alternative mechanisms. LipT possesses an esterase motif and could carry out hydrolytic release of the chain, which undergoes reduction and processing to form mycoketide. The other possibility is a direct reductive release of mycoketide alcohol by Rv2047c, which resembles reductive domains from multifunctional non–ribosomal peptide synthetases. A swivel domain commonly found in phosphoenolpyruvate (PEP)—utilizing enzymes is also present in Rv2047c and could play a role in phosphorylation of the reduced mycoketide chain. Finally, the mannosylation could be carried out by a polyprenol monophosphomannose synthase, Ppm1, encoded in the cluster (Fig. 12.5). Although the exact role of MPM in the biology of mycobacteria is not known, being an activated form of mannose sugar, MPMs could play an important role in transfer of sugars across the cell membrane.
4.4. PKS13 catalyzes condensation of fatty-acyl chains during biosynthesis of mycolic acids Mycolic acids are the most abundant lipids found in the mycobacterial cell wall and are responsible for the ‘‘acid-fast’’ nature of mycobacteria. Initial characterization by Anderson in the late 1930s suggested a general formula of C88H176O4, and a characteristic property to yield normal hexacosanoic acid on pyrolytic distillation under vacuum (Asselineau, 1966; Asselineau and Laneelle, 1998). Detailed chemical characterization over the years has revealed them to be a-alkyl-b-hydroxy fatty acids, which are present either as mycolyl-esters or as free fatty acids in the cell wall (Asselineau and Lederer, 1950; Brennan and Nikaido, 1995; Goren, 1972). The mycolate structure can be broken down to a saturated alkyl chain condensed to a longer meromycolate chain, which may carry various modifications. These modifications on the meromycolate chain classify mycolic acids into alpha-,
274
Tarun Chopra and Rajesh S. Gokhale
PKS12
PKS12 KS AT DH ER KR ACP KS AT DH ER KR ACP
KS AT DH ER KR ACP KS AT DH ER KR ACP S O
R
O
S
O
R
S
S O
PKS12
S
S
O
O
S
O
KS AT DH ER KR ACP KS AT DH ER KR ACP
S
S
O
O
R R
R = H or C –C 1 4
R R
R
?
R
O R
HO
Mycoketide acid
R
? HO
R
Mycoketide alcohol O –O P O O–
HO HO HO
HO O
? R
Phospho-mycoketide
? O O P O O–
R
Mannosyl-b-1-Phospho mycoketide (MPM)
Figure 12.5 PKS12 follows a ‘‘modularly-iterative’’ mechanism for the biosynthesis of mycoketide, which is further phosphorylated and glycosylated for the formation of MPMs.
keto-, and methoxy-subgroups. a-mycolic acids contain two cyclo-propane rings on the meromycolate chain and are the major type of mycolic acids in most mycobacterial species. Keto- and methoxy-mycolic acids carry additional oxygen functionalities in the meromycolate chain and are often termed oxygenated mycolates (Barry et al., 1998; Minnikin and Polgar, 1967; Takayama et al., 2005; Toubiana et al., 1979). Mycolic acids have also been found to contain unsaturation in the meromycolate chain. TLC and mass spectrometric approaches for mycolic acid characterization now provide a means to discriminate between many closely related mycobacterial species (Asselineau and Laneelle, 1998; Marrakchi et al., 2008; Minnikin et al., 1984; Takayama et al., 2005). The biosynthetic pathway for mycolic acids uses both type I FAS (all enzymatic domains on a single polypeptide) and type II FAS (enzymatic domains on separate polypeptides) machinery for the synthesis of the chains, and a PKS called PKS13 for their condensation (Fig. 12.6). The biosynthesis can be described in three steps: (1) type I FAS-mediated biosynthesis of both the alpha-alkyl chain and the meromycolate precursor, (2) extension and modification of the meromycolate chain by type II FAS assembly, and (3) condensation of the two chains and export to the cell wall. Rv2524c is the type I FAS that utilizes acetyl CoA as the starter and carries out repetitive decarboxylative condensations with malonyl CoA to biosynthesize the hexacosanoyl CoA (alpha chain) and the meromycolate
275
PKS-Mediated Biosynthesis of Mycobacterial Lipids
KS AT DH ER KR ACP TE
KS AT DH ER KR ACP TE S
SH
S
O
O
S
SH
S
O
O
n
O
n
O
KS AT DH ER KR ACP TE
Type I FAS Rv2524c
KS AT DH ER KR ACP TE S
HO
n
O
n
SH
O– KS AT DH ER KR ACP TE
O
AcpM
n+2
S
SH
O O –O
O
SCoA
SCoA
α-chain AccD4, AccD5
O SCoA COO–
FabD
O –O
2-Carboxy hexaxosanoyl-CoA
SCoA
O O AcpM
S
x X = 11
FabH
PKS13 AcpM
O O
O S
x
AcpM
MabA
Type II FAS S
AMP PPi
ATP
SH S O
PKS13
S –OOC
ACP KS AT KR ACP TE
O
SH SH
FAAL32
O
S
O
KasA/ KasB
OH O x
S
ACP KS AT KR ACP TE
AcpM
AcpM dehydratase
O S X+2
AcpM
InhA O x
S
AcpM
C
ar
bo Rv ny 25 l r 09 ed uc tio
n
Meromycolate chain
Mature mycolic acids
Figure 12.6 Biosynthesis of mycolic acids requires formation of meromycolate-chain and a-chain through the type I FAS/type II FAS systems.This is followed by condensation by PKS13.
precursor (Bloch, 1977; Smith et al., 2003). The ketosynthase, FabH (Rv0533c), links the type I and II FAS pathways and catalyzes condensation of type I FAS-derived meromycolate precursor with malonyl units present on AcpM (Choi et al., 2000; Schaeffer et al., 2001a). The generation of malonyl-AcpM is catalyzed by the enzyme FabD (Kremer et al., 2001). Condensation of meromycolate precursor with malonyl CoA leads to chain extension by two units and is subjected to a cycle of keto-reduction, dehydration and enoyl-reduction, catalyzed by MabA (FabG1, Rv1483)
276
Tarun Chopra and Rajesh S. Gokhale
(Marrakchi et al., 2002), AcpM dehydratase (Cronan et al., 1988; Gurvitz et al., 2008b; Sacco et al., 2007), and InhA (Rv1484) (Gurvitz et al., 2008a), respectively (Fig. 12.6). InhA is inhibited by the antituberculosis drug isoniazid via formation of a covalent adduct with NAD+ (Cronan et al., 1988; Dessen et al., 1995; Gurvitz et al., 2008a,b; Marrakchi et al., 2000, 2002; Quemard et al., 1995). The extended chain is transferred to KasA (Rv2245) and KasB (Rv2246), which catalyze further extension using the same sets of enzymes (Bhatt et al., 2005, 2007a; Kremer et al., 2002; Schaeffer et al., 2001b; Slayden and Barry, 2002). It is proposed that while FabH catalyzes the initial condensation, KasA carries out extension to an intermediate stage, followed by extension to full-length meromycolate by KasB. The modifications in the meromycolate chain are brought about by various cyclopropane synthases and methyl transferases during the type II FAS-mediated chain extension cycles (Bhatt et al., 2007b; Marrakchi et al., 2008; Takayama et al., 2005). The condensation of the meromycolate and the alpha chain is brought about by PKS13, which has domain architecture of ACP-KS-AT-ACP-TE (Gokhale et al., 2007b; Portevin et al., 2004). The meromycolate chain from meromycolyl-AcpM is activated by FAAL32 and transferred to the KS domain of PKS13 through the N-terminal ACP domain (Trivedi et al., 2004). It is not clear whether FAAL32 directly interacts with AcpM and sequesters the chain or the chain is released prior to activation by FAAL32. Hexacosanoyl CoA, derived from the type I FAS pathway, is acted upon by two acyl CoA carboxylases, AccD4 and AccD5, leading to formation of 2-carboxy-hexacosanoyl CoA (Gande et al., 2004, 2007). Through the AT domain of PKS13, the 2-carboxy-hexacosanoyl CoA is transferred to the ACP domain where it undergoes a decarboxylative Claisen condensation with the meromycolate chain. Rv2509 is believed to carry out the final reduction of the b-keto group to a secondary alcohol for the formation of mature mycolates (Fig. 12.6) (Bhatt et al., 2008; Lea-Smith et al., 2007). It is proposed that the mature mycolic acids are transferred from the ACP domain of PKS13 to mannopyranosyl-1-phosphoheptaprenol (PL), which transfers the mycolyl-group further to trehalose-6-phosphate to yield trehalose-monomycolyl (TMM) phosphate. Dephosphorylation of TMMphosphate leads to formation of TMM, which is exported out to the cell wall. Enzymes responsible for transfer of mycolates from PKS13 to the cell wall have not been very well characterized. The extracellular mycolyl transferases called the Ag85 complex are proposed to catalyze the formation of TDM and arabinogalactan-mycolate from TMM (Bhatt et al., 2007b; Marrakchi et al., 2008; Takayama et al., 2005). Recent studies suggest new possible modes of lipid biosynthesis involving formation of long-chain fatty acids, including mycobacteric acids, by degradation of mycolic acids (Rafidinarivo et al., 2008).
277
PKS-Mediated Biosynthesis of Mycobacterial Lipids
4.5. PKS3/4 is involved in the biosynthesis of phthenoic acids One of the components of the Mtb wax fraction analyzed by Anderson and coworkers was dextrorotatory fatty acids called ‘‘phthioic acids’’ esterified to a sugar. These acids were initially thought to be completely saturated trimethylated fatty acids. Detailed chemical characterization by two independent research groups revealed their chemical nature as trimethylated a,b-unsaturated acids or 2,4,6-trimethyl tetracos-2-enoic acids. These acids were independently referred to as phthienoic acids or mycolipenic acids by the two groups (Fig. 12.7) (Asselineau, 1966; Asselineau et al., 1972). During the late 1980s, analysis of mycobacterial glycolipids revealed a penta-acylated compound where four phthienoyl-groups and one palmitoyl- or stearoyl-group were found to occupy the 2, 20 , 30 , 4, and 60 positions of trehalose sugars (Daffe et al., 1988). These compounds were termed polyacyltrehaloses (PATs) and were found in virulent human and bovine strains of mycobacteria (Fig. 12.7). Similarly, a number of triacylated trehalose (TATs) and diacylated trehalose (DATs) compounds containing various different acylations were identified (Besra et al., 1992; Cruaud et al., 1990; Lemassu et al., 1991; Munoz et al., 1997a,b). Biochemical analysis of a PKS3/4 mutant strain of Mtb suggested involvement of PKS3/4 in the biosynthesis of phthienoic acids. Interestingly, H37Rv genome sequencing had suggested pks3 and pks4 to be independent open reading frames. Subsequent analysis identified an error in sequencing and showed PKS3/4 to be a single protein with KS-AT-DH-ER-KR-ACP domain organization. The absence of PATs from the Mtb strain caused cells to stick to each other as a clump without affecting the overall growth rate (Dubey et al., 2002). This suggested PATs to be localized on the outer surface of the cell wall. In another study, a pks3/4 mutant Mtb strain showed improved efficiency of binding to the host cells (Rousseau et al., 2003a). However, this property did not affect the overall replication and persistence of the bacillus in the host cells.
O
O HO
O
OH O O
O
C17H35
O O
O O
C17H35
OH O O
C17H35 O
C17H35 C17H35
Figure 12.7 Structure of polyacyltrehaloses. One of the phthienoic acids is highlighted in the box.
278
Tarun Chopra and Rajesh S. Gokhale
The biochemical pathway involved in assembly of PATs has not been investigated. Analysis of the pks3 and pks4 genetic locus reveals genes which could participate in the complete assembly and transport of these lipids. FAAL21 could activate and load fatty acyl chains onto PKS3/4 for the biosynthesis of phthienoic acids. Also encoded in the cluster is a PKSassociated protein, PapA3, which could mediate trans-esterification of phthienoic acids onto trehalose sugars and MmpL10 for export of PATs to the outer cell wall.
4.6. PKS10, PKS7, PKS8, PKS17, PKS9, and PKS11 constitute an unusual PKS cluster The H37Rv genome encodes three genes homologous to type III PKSs. Interestingly, two of these genes, pks10 and pks11, are present on either side of four type I PKSs, constituting a pks cluster (pks10-pks7-pks8-pks17-pks9pks11) (Cole et al., 1998). PKS7 is 31% identical to MAS and contains all the three auxiliary domains that could completely reduce a ketide unit. PKS8 contains KS, AT, DH and ER domains and PKS17 contains KR and ACP domains. Together, PKS8 and PKS17 would form one complete module. PKS9 resembles loading modules of modular PKSs and comprises KS, AT and ACP domains. In PKS9, the active site cysteine of KS is mutated to glutamine and is referred to as a KSQ domain. This type of KSQ domain has been previously reported for certain modular PKSs, where they function as chain initiation factors similar to the chain length factor (CLF) of aromatic PKSs (Bisang et al., 1999). The genome of M. bovis has also revealed an identical genomic organization of the pks10-pks11 cluster, with the putative proteins sharing 98 to 100% sequence identity with the M. tuberculosis homologues (Garnier et al., 2003). However, M. avium subsp paratuberculosis shows slight variations in the genomic organization and the broken module is missing from the cluster (Fig. 12.8) (Li et al., 2005). The functional importance of the pks10-pks11 genomic cluster is yet to be established in Mtb and M. avium subsp paratuberculosis. Gene inactivation studies suggest a possible role of pks7 and pks11 in the biosynthesis of PDIMs (Rousseau et al., 2003b; Waddell et al., 2005). This could also be due to spontaneous loss of PDIMs from the mutant strains (Domenech et al., 2004). Another report suggested a role for pks8 and pks17 in the biosynthesis of methyl-branched unsaturated fatty acids that are esterified to acyltrehaloses and sulfated acyltrehaloses as minor constituents (Dubey et al., 2003). Biochemical characterization of PKS11 suggests that it may be able to produce resorcinolic metabolites, which are known for their involvement in cellular physiology and membrane chemistry in other organisms (Saxena and Gokhale, unpublished results) (Kozubek and Tyman, 1999). These amphiphilic molecules possess diverse biological functions and are active antimicrobial and antiparasitic compounds. They are also known to
279
PKS-Mediated Biosynthesis of Mycobacterial Lipids
PKS10
M. tuberculosis
KS (type III)
PKS10
M. bovis
KS (type III)
PKS10
M. avium ssp. paratuberculosis
Figure 12.8 species.
KS (type III)
PKS7 KS AT DH ER KR ACP
PKS7 KS AT DH ER KR ACP
PKS7 KS AT DH ER KR ACP
PKS8 KS AT DH ER
PKS8 KS AT DH ER
PKS9 KSQ AT ACP
PKS17
PKS9
PKS11
KR ACP
KSQ AT ACP
KS (type III)
PKS17
PKS9
PKS11
KR ACP
KSQ AT ACP
KS (type III)
PKS11 KS (type III)
Organization of the PKS10-PKS11 cluster in various mycobacterial
modulate oxidation of liposomal membranes and fatty acids (Gubernator et al., 1999). Interestingly, early analysis of unsaponifiable fraction of fats from M. leprae has demonstrated the presence of methoxylated resorcinolic metabolites called a- and b-leprosols (Asselineau, 1966; Bu’Lock and Hudson, 1969). Similar molecules have been recently shown to be essential for formation of metabolically dormant cysts in Azotobacter vinelandii (Funa et al., 2006). It is tempting to speculate that these metabolites may be produced under specific conditions in mycobacteria and may have a role to play in the onset of dormancy.
4.7. PKS18 is involved in biosynthesis of long-chain pyrones The third type III pks gene, pks18, is not flanked by PKS-related genes and shows 40 to 45% sequence homology with bacterial and plant type III PKSs. Sequence analysis of PKS18 shows conservation of the catalytic and key active site residues of this class of proteins (Cole et al., 1998). While no physiological role has been assigned to pks18, biochemical investigation of its product revealed remarkable specificity for long-chain aliphatic CoA analogues. This unusual substrate specificity is unprecedented in the chalcone synthase super-family of type III PKSs and has added a new functional relevance to these proteins. PKS18 efficiently produces long-chain a-pyrones when primed with the long fatty acyl CoAs (Rukmini et al., 2004; Sankaranarayanan et al., 2004; Saxena et al., 2003). Since the biochemical characterization of PKS18, a number of plant and bacterial homologues have been shown to utilize long-chain precursor molecules for the synthesis of acyl pyrones. Such acyl pyrones have been recently identified in the cell envelope of Azotobacter sp. (Abe et al., 2004, 2005; Austin et al., 2004; Funa et al., 2006; Zha et al., 2006).
280
Tarun Chopra and Rajesh S. Gokhale
4.8. MbtC and MbtD are involved in biosynthesis of iron-chelating siderophores from Mtb Siderophores are iron-chelating compounds (see Chapter 17 of volume 458) that were discovered in mycobacteria in the late 1950s while searching for factors important for the growth of M. paratuberculosis (Snow, 1970). Subsequent research has revealed two types of siderophores which collectively scavenge iron in the Fe (III) form from the host organism. Mycobactins or intracellular siderophores are found within the cell envelope of the mycobacteria and are believed to play a role in controlled release of iron inside the cell. Extracellular siderophores vary in composition and are called carboxymycobactin or exochelins depending on whether the organism is pathogenic or saprophytic (Ratledge, 2004; Ratledge and Marshall, 1972; Rodriguez, 2006). Chemically, mycobactin and carboxymycobactin have a central lysine core which is modified at both the a- and e-amino termini with a hydroxyaryloxazoline group and an alkyl group, respectively (Fig. 12.9). The alkyl group varies from C10 to C21 in the case of mycobactin and sometimes contains a cis-double bond. However, it is shorter in the case of carboxymycobactin and carries a free carboxy group at the end. It is this alkyl group that differentiates carboxymycobactin from mycobactin. On the carboxylend, lysine is modified with a polyketide-derived b-hydroxy butyrate group, which is further linked to another N-hydroxylated and cyclized lysine. All three modifications on lysine together constitute the iron-coordinating framework of mycobactins (Ratledge, 2004). Although the biochemical reconstitution of mycobactin assembly has not been carried out, two gene clusters—mbt1 and mbt2—are proposed to be involved in its biosynthesis (Quadri et al., 1998). Expression of these two clusters is believed to be mbt-2 L
M
N K
mbt-1 I
J
A
B
KS
AT KR ACP
C
D
MbtK MbtL MbtM
O
N
E
F
G H
FadE14
R n
MbtG
OH MbtA
OH
MbtE
N MbtB
O
O
H N
O N H
O
O
MbtF
O OH N MbtJ
MbtG
MbtC/MbtD
Mycobactin: n = 17, 19; R = CH3 Carboxymycobactin: n = 2–9; R = COOH
Figure 12.9 The mbt locus involved in the biosynthesis of mycobactins.The structures of mycobactin/carboxymycobactin are shown.The core lysine is shown in bold.
PKS-Mediated Biosynthesis of Mycobacterial Lipids
281
regulated by an iron-dependent IdeR repressor (Rodriguez, 2006; Rodriguez and Smith, 2003). mbt1 codes for MbtA to MbtJ, which are believed to participate in the assembly of the polyketide-peptide core (Quadri et al., 1998). mbt2 codes for enzymes responsible for modification of this core to the final metabolite (Krithika et al., 2006). The predicted pathway for assembly of mycobactin starts with the conversion of iso-chorismic acid to salicylic acid, which is activated by MbtA, a salicylate-AMP ligase, and loaded onto MbtB. MbtB is a non–ribosomal peptide synthetase and is expected to attach a Ser or Thr onto the salicylic acid core. It is this amino acid which is cyclized to an oxazoline ring, thus finishing the covalent assembly of the a-amino cap of lysine. MbtE is another NRPS and is thought to catalyzes the addition of the core lysine onto this cap (De Voss et al., 1999; Marshall and Ratledge, 1972; Snow, 1970). MbtC and MbtD are the two polyketide synthase subunits present in the cluster and code for the KS and AT-KR-ACP domains respectively. Together, they constitute a PKS enzyme believed to carry out the biosynthesis of the b-hydroxy butyrate group using acetyl and malonyl CoA units. Another NRPS called MbtF is proposed to transfer the final lysine onto the b-hydroxy butyrate group. The cyclization of this N-hydroxylated lysine group to a seven-membered lactam ring is proposed to be catalyzed by MbtJ (De Voss et al., 1999; Quadri et al., 1998). Modification of the e-amino termini of the core lysine is brought about by the mbt2 cluster, which codes for an N-acyl transferase (MbtK), an acyl carrier protein (MbtL), a fatty acyl AMP ligase (FAAL33 or MbtM), and an acyl CoA dehydrogenase (FadE14 or MbtN). FAAL33 activates and loads long-chain fatty acids onto MbtL, which are then transferred by MbtK onto the e-amino group of the core lysine. FadE14 is the enzyme responsible for the a,b-unsaturation present on the acyl chain. The N-hydroxylation of the lysine e-amino group has been shown to be catalyzed by the N6-hydroxylase, MbtG, from the mbt1 locus by using substrate mimics (Krithika et al., 2006). This enzyme belongs to a class of flavoprotein monooxygenase and uses molecular oxygen for hydroxylation. Although the biosynthesis of mycobactin has been dissected out in detail, the complete sequence of events that leads to its assembly has not been elucidated.
4.9. PKS5 and PKS6 While PKS5 is a type I PKS with a domain organization of KS-AT-DHER-KR-ACP, PKS6 is a type I PKS with domain architecture ACP-KSAT-ACP-TE, similar to PKS13 (Yadav et al., 2003). PKS5 is 66% identical to MAS, and biochemical analysis of a PKS5 mutant of Mtb reveals that its cell envelope composition is identical to that of the wildtype strain (Rousseau et al., 2003b). PKS5 could be involved in the biosynthesis of an unknown lipid which is a minor constituent of the cell wall. PKS6, on the
282
Tarun Chopra and Rajesh S. Gokhale
other hand, is implicated in the biosynthesis of an unknown polar metabolite (Waddell et al., 2005), and FAAL30 has been shown to be involved in the activation and transfer of starter fatty-acyl chains onto PKS6 (Trivedi et al., 2004; Waddell et al., 2005). Interestingly, an Mtb mutant of pks6 was impaired for growth in the lungs of Balb/c mice, suggesting that the PKS6derived metabolite may play an important role in mycobacterial survival and virulence (Camacho et al., 1999). PKS14 and PKS16 are wrongly annotated as PKSs in the H37Rv genome. PKS14 is a 120–amino acid protein with no conserved domains and PKS16 is a 544–amino acid protein belonging to the acyl activating super family of enzymes (Cole et al., 1998).
5. Techniques to Characterize PKS Enzymes 5.1. Product formation assay to study activity of PKS enzymes A protocol to assay mycobacterial PKSs involved in biosynthesis of acyl chains of virulent lipids is described below. 1. Purify the PKS in 100 mM phosphate buffer containing 10% glycerol and 1mM Tris (2-carboxy ethyl) phosphine hydrochloride (TCEP). The protein can be stored at –80 after snap-freezing in liquid nitrogen. 2. Set up an assay with 100 mM phosphate buffer (pH 7.2), 150 mM starter acyl NACs, 75 mM extender acyl CoA, 7.2 mM 14C- extender acyl CoA, 4 mM NADPH, 10% glycerol, 2 mM TCEP, and 2.5–4.5 mM protein in a 100-ml reaction volume. 3. Incubate the reactions at 30 C for 6 to 12 h. If the PKS has an appended TE domain or follows any other chain release mechanism, proceed to Step 5. 4. Carry out alkaline hydrolysis of the products by addition of a half-volume 45% KOH and heat at 70 for 10 min. 5. Acidify the reactions with 50% HCl and extract with freshly distilled ethyl acetate (300 ml 2). Pool the two extractions. 6. Vacuum dry the extractions and resuspend in a small volume of ethyl acetate (20 ml). This contains the reaction products and can be directly analyzed by various techniques like TLC, HPLC or mass spectrometry.
5.2. Characterization of PKS derived saturated fatty acids 1. Spot the extracted products after alkali hydrolysis on a silica gel TLC plate and run in 40:60:1 hexanes: ether: acetic acid. Expose the TLC to an imaging plate for 6 to 12 h and analyze radiolabeled products using a PhosphorImager. The fatty acid products run at an Rf of 0.5 (Fig. 12.10A).
A Solvent front
n C io ct N A in ea S te l R C 6ro ro h it -P ont W c
PKS12Δ1 products
Origin
1
2
Radioactive counts (volts) Radioactive counts (volts) Radioactive counts (volts)
B C12
1.0
0.5
Standard fatty acids
C6 C16
0.0
C18
C
PKS12Δ1 + C6 starter
C8
C10
C12
C14
C16
C18
29.46
32.49
36.60
42.45
0.2
0.1
0.0 1.0
MAS + C6 starter
0.5
23.29
0.0 20
30 40 Elution time in minutes
50
26.64
Elution time in minutes
Figure 12.10 (A) TLC-based characterization of PKS products. Lane1: PKS reaction primed with hexanoyl-starter. Lane 2: Control reaction in the absence of protein (Chopra et al., 2008). (B) HPLC analysis of PKS products eluted from TLC. The upper panel shows saturated fatty acids. In the middle panel are PKS12D1 products after priming with hexanoyl-starter. The lower panel shows various iterative products of MAS proteins; with increasing time, mono-, di-, tri-, and tetra-branched mycocerosic acids elute. (C) TLC analysis of HPLC-eluted PKS12D1 products (Chopra et al., 2008).
284
Tarun Chopra and Rajesh S. Gokhale
2. To carry out a radio-HPLC analysis of the product, set up fresh product formation assays with an increased 14C extender acyl CoA concentration of 25 mM while keeping the total extender acyl CoA concentration as 100 mM. Carry out alkali hydrolysis of the products and extract in ethyl acetate as discussed above. 3. Spot the extract on a TLC-plate and run in 40:60:1 hexanes: ether: acetic acid. Scrape off the band of interest (running at an Rf of 0.5) and carry out another extraction in ethyl acetate. Vacuum concentrate the products and inject on a C18 reverse-phase column on HPLC (gradient: 100% B in 20 min, 100% B in 40 min, 20% B in 60 min). Solvent A consists of H2O, and solvent B, 5% methanol in ACN with 0.1% formic acid. Alternatively, the extracted products from the reaction mix can be directly loaded on the HPLC. However, in this case the signal-to-noise ratio is lower in comparison and peaks are not as sharp as in the case of the eluted products. Analyze the HPLC eluate using an online radioactivity detector fitted to the HPLC in series with the UV detector. 4. Various iterative products from the PKS assay run as separate peaks on the HPLC and can be confirmed by running synthetic standards (Fig. 12.10B). Splitting the flow before the radioactive detector enables collection of these peaks and further TLC or mass spectrometric analysis (Fig. 12.10C).
REFERENCES Abe, I., Oguro, S., Utsumi, Y., Sano, Y., and Noguchi, H. (2005). Engineered biosynthesis of plant polyketides: Chain length control in an octaketide-producing plant type III polyketide synthase. J. Am. Chem. Soc. 127, 12709–12716. Abe, I., Watanabe, T., and Noguchi, H. (2004). Enzymatic formation of long-chain polyketide pyrones by plant type III polyketide synthases. Phytochemistry 65, 2447–2453. Anderson, R. J. (1941). Structural peculiarities of acid-fast bacterial lipids. Lipids Chem. Rev. 29, 225–243. Andreu, N., Gibert, I., Luquin, M., Kolattukudy, P. E., and Sirakova, T. (2004). Neutral red staining of cells of a sulfolipid-deficient Mycobacterium tuberculosis pks2 mutant proves that sulfolipids are not responsible for this cytochemical reaction. J. Clin. Microbiol. 42, 1379–1380. Arora, P., Vats, A., Saxena, P., Mohanty, D., and Gokhale, R. S. (2005). Promiscuous fatty acyl CoA ligases produce acyl-CoA and acyl-SNAC precursors for polyketide biosynthesis. J. Am. Chem. Soc. 127, 9388–9389. Asselineau, C. P., Montrozier, H. L., Prome, J. C., Savagnac, A. M., and Welby, M. (1972). [Polyunsaturated glycolipids synthesized by Mycobacterium phlei]. J. Biochem. Eur. J. Biochem. 28, 102–109. Asselineau, J. (1966). The bacterial lipids. In ‘‘Chemistry of Natural Products Series.’’ (Editions scientifiques Hermann). 4th ed. 372 p. Hermann, Holden-Day, Paris, San Francisco. Asselineau, J., and Laneelle, G. (1998). Mycobacterial lipids: A historical perspective. Front. Biosci. 3, e164–e174.
PKS-Mediated Biosynthesis of Mycobacterial Lipids
285
Asselineau, J., and Lederer, E. (1950). Structure of the mycolic acids of Mycobacteria. Nature 166, 782–783. Austin, M. B., Izumikawa, M., Bowman, M. E., Udwary, D. W., Ferrer, J. L., Moore, B. S., and Noel, J. P. (2004). Crystal structure of a bacterial type III polyketide synthase and enzymatic control of reactive polyketide intermediates. J. Biol. Chem. 279, 45162–45174. Azad, A. K., Sirakova, T. D., Fernandes, N. D., and Kolattukudy, P. E. (1997). Gene knockout reveals a novel gene cluster for the synthesis of a class of cell wall lipids unique to pathogenic mycobacteria. J. Biol. Chem. 272, 16741–16745. Azad, A. K., Sirakova, T. D., Rogers, L. M., and Kolattukudy, P. E. (1996). Targeted replacement of the mycocerosic acid synthase gene in Mycobacterium bovis BCG produces a mutant that lacks mycosides. Proc. Natl. Acad. Sci. USA 93, 4787–4792. Barry, C. E. 3rd, Lee, R. E., Mdluli, K., Sampson, A. E., Schroeder, B. G., Slayden, R. A., and Yuan, Y. (1998). Mycolic acids: Structure, biosynthesis and physiological functions. Prog. Lipid Res. 37, 143–179. Bertozzi, C. R., and Schelle, M. W. (2008). Sulfated metabolites from Mycobacterium tuberculosis: Sulfolipid-1 and beyond. In ‘‘The Mycobacterial Cell Envelope.’’ (D. Mamadou and J.-M. Reyrat, eds.), pp. 291–304. ASM Press, Washington, DC. Besra, G. S., Bolton, R. C., McNeil, M. R., Ridell, M., Simpson, K. E., Glushka, J., van Halbeek, H., Brennan, P. J., and Minnikin, D. E. (1992). Structural elucidation of a novel family of acyltrehaloses from Mycobacterium tuberculosis. Biochemistry 31, 9832–9837. Bhatt, A., Brown, A. K., Singh, A., Minnikin, D. E., and Besra, G. S. (2008). Loss of a mycobacterial gene encoding a reductase leads to an altered cell wall containing betaoxo-mycolic acid analogs and accumulation of ketones. Chem. Biol. 15, 930–939. Bhatt, A., Fujiwara, N., Bhatt, K., Gurcha, S. S., Kremer, L., Chen, B., Chan, J., Porcelli, S. A., Kobayashi, K., Besra, G. S., and Jacobs, W. R. Jr. (2007a). Deletion of kasB in Mycobacterium tuberculosis causes loss of acid-fastness and subclinical latent tuberculosis in immunocompetent mice. Proc. Natl. Acad. Sci. USA 104, 5157–5162. Bhatt, A., Kremer, L., Dai, A. Z., Sacchettini, J. C., and Jacobs, W. R. Jr. (2005). Conditional depletion of KasA, a key enzyme of mycolic acid biosynthesis, leads to mycobacterial cell lysis. J. Bacteriol. 187, 7596–7606. Bhatt, A., Molle, V., Besra, G. S., Jacobs, W. R. Jr., and Kremer, L. (2007b). The Mycobacterium tuberculosis FAS-II condensing enzymes: Their role in mycolic acid biosynthesis, acid-fastness, pathogenesis and in future drug development. Mol. Microbiol. 64, 1442–1454. Bhatt, K., Gurcha, S. S., Bhatt, A., Besra, G. S., and Jacobs, W. R. Jr. (2007c). Two polyketide-synthase-associated acyltransferases are required for sulfolipid biosynthesis in Mycobacterium tuberculosis. Microbiology 153, 513–520. Birch, H. L., Alderwick, L. J., Bhatt, A., Rittmann, D., Krumbach, K., Singh, A., Bai, Y., Lowary, T. L., Eggeling, L., and Besra, G. S. (2008). Biosynthesis of mycobacterial arabinogalactan: Identification of a novel alpha(1!3). arabinofuranosyltransferase. Mol. Microbiol. 69, 1191–1206. Bisang, C., Long, P. F., Cortes, J., Westcott, J., Crosby, J., Matharu, A. L., Cox, R. J., Simpson, T. J., Staunton, J., and Leadlay, P. F. (1999). A chain initiation factor common to both modular and aromatic polyketide synthases. Nature 401, 502–505. Bloch, H., and Noll, H. (1955). Studies on the virulence of Tubercle bacilli the effect of cord factor on murine tuberculosis. Br. J. Exp. Pathol. 36, 8–17. Bloch, K. (1977). Control mechanisms for fatty acid synthesis in Mycobacterium smegmatis. Adv. Enzymol. Relat. Areas Mol. Biol. 45, 1–84. Brennan, P. J. (1988). Mycobacterium and other actinomycetes. In ‘‘Microbial lipids’’ (C. Ratledge and S. G. Wilkinson, eds.), Vol. 1, pp. 203–298. Acad. Press, London. Brennan, P. J. (2003). Structure, function, and biogenesis of the cell wall of Mycobacterium tuberculosis. Tuberculosis (Edinb.) 83, 91–97.
286
Tarun Chopra and Rajesh S. Gokhale
Brennan, P. J., and Nikaido, H. (1995). The envelope of mycobacteria. Annu. Rev. Biochem. 64, 29–63. Bu’Lock, J. D., and Hudson, A. T. (1969). beta-Leprosol: The identification of a trialkylresorcinol from bacterial lipids. J. Chem. Soc. [Perkin 1] 1, 61–63. Camacho, L. R., Ensergueix, D., Perez, E., Gicquel, B., and Guilhot, C. (1999). Identification of a virulence gene cluster of Mycobacterium tuberculosis by signature-tagged transposon mutagenesis. Mol. Microbiol. 34, 257–267. Cardona, P. J., Soto, C. Y., Martin, C., Giquel, B., Agusti, G., Andreu, N., Guirado, E., Sirakova, T., Kolattukudy, P., Julian, E., and Luquin, M. (2006). Neutral-red reaction is related to virulence and cell wall methyl-branched lipids in Mycobacterium tuberculosis. Microbes Infect. 8, 183–190. Carroll, P., Muttucumaru, D. G., and Parish, T. (2005). Use of a tetracycline-inducible system for conditional expression in Mycobacterium tuberculosis and Mycobacterium smegmatis. Appl. Environ. Microbiol. 71, 3077–3084. Chhabra, A., and Gokhale, R. S. (2009). Novel paradigms of complex lipid biosynthetic machinery of Mycobacterium tuberculosis. In ‘‘Mycobacterium genomics and molecular biology’’ (T. Parish and A. Brown, eds.), pp. 65–78. Caister Academic Press, Norfolk, UK, 65–78. Choi, K. H., Kremer, L., Besra, G. S., and Rock, C. O. (2000). Identification and substrate specificity of beta-ketoacyl (acyl carrier protein). synthase III (mtFabH). from Mycobacterium tuberculosis. J. Biol. Chem. 275, 28201–28207. Chopra, T., Banerjee, S., Gupta, S., Yadav, G., Anand, S., Surolia, A., Roy, R. P., Mohanty, D., and Gokhale, R. S. (2008). Novel intermolecular iterative mechanism for biosynthesis of mycoketide catalyzed by a bimodular polyketide synthase. PLoS Biol. 6, e163. Cole, S. T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D., Gordon, S. V., Eiglmeier, K., Gas, S., Barry, C. E. 3rd, Tekaia, F., Badcock, K., et al. (1998). Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393, 537–544. Constant, P., Perez, E., Malaga, W., Laneelle, M. A., Saurel, O., Daffe, M., and Guilhot, C. (2002). Role of the pks15/1 gene in the biosynthesis of phenolglycolipids in the Mycobacterium tuberculosis complex. Evidence that all strains synthesize glycosylated p-hydroxybenzoic methyl esters and that strains devoid of phenolglycolipids harbor a frameshift mutation in the pks15/1 gene. J. Biol. Chem. 277, 38148–38158. Converse, S. E., Mougous, J. D., Leavell, M. D., Leary, J. A., Bertozzi, C. R., and Cox, J. S. (2003). MmpL8 is required for sulfolipid-1 biosynthesis and Mycobacterium tuberculosis virulence. Proc. Natl. Acad. Sci. USA 100, 6121–6126. Cooper, H. N., Gurcha, S. S., Nigou, J., Brennan, P. J., Belisle, J. T., Besra, G. S., and Young, D. (2002). Characterization of mycobacterial protein glycosyltransferase activity using synthetic peptide acceptors in a cell-free assay. Glycobiology 12, 427–434. Cox, J. S., Chen, B., McNeil, M., and Jacobs, W. R. Jr. (1999). Complex lipid determines tissue-specific replication of Mycobacterium tuberculosis in mice. Nature 402, 79–83. Cronan, J. E. Jr., Li, W. B., Coleman, R., Narasimhan, M., de Mendoza, D., and Schwab, J. M. (1988). Derived amino acid sequence and identification of active site residues of Escherichia coli beta-hydroxydecanoyl thioester dehydrase. J. Biol. Chem. 263, 4641–4646. Cruaud, P., Yamashita, J. T., Casabona, N. M., Papa, F., and David, H. L. (1990). Evaluation of a novel 2,3-diacyl-trehalose-20 -sulphate (SL-IV). antigen for case finding and diagnosis of leprosy and tuberculosis. Res. Microbiol. 141, 679–694. Daffe, M., and Draper, P. (1998). The envelope layers of mycobacteria with reference to their pathogenicity. Adv. Microb. Physiol. 39, 131–203.
PKS-Mediated Biosynthesis of Mycobacterial Lipids
287
Daffe, M., Lacave, C., Laneelle, M. A., Gillois, M., and Laneelle, G. (1988). Polyphthienoyl trehalose, glycolipids specific for virulent strains of the tubercle bacillus. J. Biochem. Eur. J. Biochem. 172, 579–584. Daffe, M., and Laneelle, M. A. (1988). Distribution of phthiocerol diester, phenolic mycosides and related compounds in mycobacteria. J. Gen. Microbiol. 134, 2049–2055. Daffe´, M., and Lemassu, A. (2000). Glycomicrobiology. In ‘‘Glycobiology of the mycobacterial surface in glycomicrobiology.’’ pp. 225–273. DOI: 10.1007/0-306-46821-2_8; http://www.springerlink.com/content/t62l575821788815. Daniel, J., Oh, T. J., Lee, C. M., and Kolattukudy, P. E. (2007). AccD6, a member of the Fas II locus, is a functional carboxyltransferase subunit of the acyl-coenzyme A carboxylase in Mycobacterium tuberculosis. J. Bacteriol. 189, 911–917. De Voss, J. J., Rutter, K., Schroeder, B. G., and Barry, C. E. 3rd (1999). Iron acquisition and metabolism by mycobacteria. J. Bacteriol. 181, 4443–4451. Dessen, A., Quemard, A., Blanchard, J. S., Jacobs, W. R. Jr., and Sacchettini, J. C. (1995). Crystal structure and function of the isoniazid target of Mycobacterium tuberculosis. Science 267, 1638–1641. Domenech, P., Reed, M. B., Dowd, C. S., Manca, C., Kaplan, G., and Barry, C. E. 3rd (2004). The role of MmpL8 in sulfatide biogenesis and virulence of Mycobacterium tuberculosis. J. Biol. Chem. 279, 21257–21265. Draper, P. (1998). The outer parts of the mycobacterial envelope as permeability barriers. Front. Biosci. 3, D1253–D1261. Dubey, V. S., Sirakova, T. D., Cynamon, M. H., and Kolattukudy, P. E. (2003). Biochemical function of msl5 (pks8 plus pks17). in Mycobacterium tuberculosis H37Rv: Biosynthesis of monomethyl branched unsaturated fatty acids. J. Bacteriol. 185, 4620–4625. Dubey, V. S., Sirakova, T. D., and Kolattukudy, P. E. (2002). Disruption of msl3 abolishes the synthesis of mycolipanoic and mycolipenic acids required for polyacyltrehalose synthesis in Mycobacterium tuberculosis H37Rv and causes cell aggregation. Mol. Microbiol. 45, 1451–1459. Dubos, R. J., and Middlebrook, G. (1948). Cytochemical reaction of virulent tubercle bacilli. Am. Rev. Tuberc. 58, 698. Ferreras, J. A., Stirrett, K. L., Lu, X., Ryu, J. S., Soll, C. E., Tan, D. S., and Quadri, L. E. (2008). Mycobacterial phenolic glycolipid virulence factor biosynthesis: mechanism and small-molecule inhibition of polyketide chain initiation. Chem. Biol. 15, 51–61. Funa, N., Ozawa, H., Hirata, A., and Horinouchi, S. (2006). Phenolic lipid synthesis by type III polyketide synthases is essential for cyst formation in Azotobacter vinelandii. Proc. Natl. Acad. Sci. USA 103, 6356–6361. Gande, R., Dover, L. G., Krumbach, K., Besra, G. S., Sahm, H., Oikawa, T., and Eggeling, L. (2007). The two carboxylases of Corynebacterium glutamicum essential for fatty acid and mycolic acid synthesis. J. Bacteriol. 189, 5257–5264. Gande, R., Gibson, K. J., Brown, A. K., Krumbach, K., Dover, L. G., Sahm, H., Shioyama, S., Oikawa, T., Besra, G. S., and Eggeling, L. (2004). Acyl-CoA carboxylases (accD2 and accD3), together with a unique polyketide synthase (Cg-pks), are key to mycolic acid biosynthesis in Corynebacterianeae such as Corynebacterium glutamicum and Mycobacterium tuberculosis. J. Biol. Chem. 279, 44847–44857. Garnier, T., Eiglmeier, K., Camus, J. C., Medina, N., Mansoor, H., Pryor, M., Duthoy, S., Grondin, S., Lacroix, C., Monsempe, C., Simon, S., Harris, B., et al. (2003). The complete genome sequence of Mycobacterium bovis. Proc. Natl. Acad. Sci. USA 100, 7877–7882. Gastambide Odier, M., Delaumeny, J. M., and Lederer, E. (1963). [Biosynthesis of C32mycocerosic acid; incorporation of propionic acid. Biochim. Biophys. Acta 70, 670–678. Ghosh, R., Chhabra, A., Phatale, P. A., Samrat, S. K., Sharma, J., Gosain, A., Mohanty, D., Saran, S., and Gokhale, R. S. (2008). Dissecting the functional role of polyketide
288
Tarun Chopra and Rajesh S. Gokhale
synthases in Dictyostelium discoideum: Biosynthesis of the differentiation regulating factor 4-methyl-5-pentylbenzene-1,3-diol. J. Biol. Chem. 283, 11348–11354. Gokhale, R. S., Sankaranarayanan, R., and Mohanty, D. (2007a). Versatility of polyketide synthases in generating metabolic diversity. Curr. Opin. Struct. Biol. 17, 736–743. Gokhale, R. S., Saxena, P., Chopra, T., and Mohanty, D. (2007b). Versatile polyketide enzymatic machinery for the biosynthesis of complex mycobacterial lipids. Nat. Prod. Rep. 24, 267–277. Goren, M. B. (1970a). Sulfolipid I of Mycobacterium tuberculosis, strain H37Rv. I. Purification and properties. Biochim. Biophys. Acta 210, 116–126. Goren, M. B. (1970b). Sulfolipid I of Mycobacterium tuberculosis, strain H37Rv. II. Structural studies. Biochim. Biophys. Acta 210, 127–138. Goren, M. B. (1972). Mycobacterial lipids: Selected topics. Bacteriol. Rev. 36, 33–64. Goren, M. B., Brokl, O., and Das, B. C. (1976). Sulfatides of Mycobacterium tuberculosis: The structure of the principal sulfatide (SL-I). Biochemistry 15, 2728–2735. Goren, M. B., Brokl, O., Das, B. C., and Lederer, E. (1971). Sulfolipid I of Mycobacterium tuberculosis, strain H37RV. Nature of the acyl substituents. Biochemistry 10, 72–81. Gubernator, J., Stasiuk, M., and Kozubek, A. (1999). Dual effect of alkylresorcinols, natural amphiphilic compounds, upon liposomal permeability. Biochim. Biophys. Acta 1418, 253–260. Guerardel, Y., Maes, E., Elass, E., Leroy, Y., Timmerman, P., Besra, G. S., Locht, C., Strecker, G., and Kremer, L. (2002). Structural study of lipomannan and lipoarabinomannan from Mycobacterium chelonae. Presence of unusual components with alpha 1,3-mannopyranose side chains. J. Biol. Chem. 277, 30635–30648. Guilhot, C., Gicquel, B., and Martin, C. (1992). Temperature-sensitive mutants of the Mycobacterium plasmid pAL5000. FEMS Microbiol. Lett. 77, 181–186. Gurvitz, A., Hiltunen, J. K., and Kastaniotis, A. J. (2008a). Function of heterologous Mycobacterium tuberculosis InhA, a type 2 fatty acid synthase enzyme involved in extending C20 fatty acids to C60-to-C90 mycolic acids, during de novo lipoic acid synthesis in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 74, 5078–5085. Gurvitz, A., Hiltunen, J. K., and Kastaniotis, A. J. (2008b). Identification of a novel mycobacterial 3-hydroxyacyl-thioester dehydratase, HtdZ (Rv0130), by functional complementation in yeast. J. Bacteriol. 190, 4088–4090. Hensel, M., Shea, J. E., Gleeson, C., Jones, M. D., Dalton, E., and Holden, D. W. (1995). Simultaneous identification of bacterial virulence genes by negative selection. Science 269, 400–403. Hopwood, D. A. (1997). Genetic contributions to understanding polyketide synthases. Chem. Rev. 97, 2465–2498. Jackson, M., Stadthagen, G., and Gicquel, B. (2007). Long-chain multiple methyl-branched fatty acid-containing lipids of Mycobacterium tuberculosis: Biosynthesis, transport, regulation and biological activities. Tuberculosis (Edinb.) 87, 78–86. Jain, M., and Cox, J. S. (2005). Interaction between polyketide synthase and transporter suggests coupled synthesis and export of virulence lipid in M. tuberculosis. PLoS Pathogens 1, e2. Jarlier, V., and Nikaido, H. (1994). Mycobacterial cell wall: Structure and role in natural resistance to antibiotics. FEMS Microbiol. Lett. 123, 11–18. Katz, L., and Donadio, S. (1993). Polyketide synthesis: Prospects for hybrid antibiotics. Annu. Rev. Microbiol. 47, 875–912. Khosla, C., Tang, Y., Chen, A. Y., Schnarr, N. A., and Cane, D. E. (2007). Structure and mechanism of the 6-deoxyerythronolide B synthase. Annu. Rev. Biochem. 76, 195–221. Kolattukudy, P. E., Fernandes, N. D., Azad, A. K., Fitzmaurice, A. M., and Sirakova, T. D. (1997). Biochemistry and molecular genetics of cell-wall lipid biosynthesis in mycobacteria. Mol. Microbiol. 24, 263–270.
PKS-Mediated Biosynthesis of Mycobacterial Lipids
289
Kozubek, A., and Tyman, J. H. (1999). Resorcinolic Lipids, the natural non-isoprenoid phenolic amphiphiles and their biological activity. Chem. Rev. 99, 1–26. Kremer, L., Dover, L. G., Carrere, S., Nampoothiri, K. M., Lesjean, S., Brown, A. K., Brennan, P. J., Minnikin, D. E., Locht, C., and Besra, G. S. (2002). Mycolic acid biosynthesis and enzymic characterization of the beta-ketoacyl-ACP synthase A-condensing enzyme from Mycobacterium tuberculosis. Biochem. J. 364, 423–430. Kremer, L., Nampoothiri, K. M., Lesjean, S., Dover, L. G., Graham, S., Betts, J., Brennan, P. J., Minnikin, D. E., Locht, C., and Besra, G. S. (2001). Biochemical characterization of acyl carrier protein (AcpM)., and malonyl-CoA:AcpM transacylase (mtFabD), two major components of Mycobacterium tuberculosis fatty acid synthase II. J. Biol. Chem. 276, 27967–27974. Krithika, R., Marathe, U., Saxena, P., Ansari, M. Z., Mohanty, D., and Gokhale, R. S. (2006). A genetic locus required for iron acquisition in Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA 103, 2069–2074. Kumar, P., Schelle, M. W., Jain, M., Lin, F. L., Petzold, C. J., Leavell, M. D., Leary, J. A., Cox, J. S., and Bertozzi, C. R. (2007). PapA1 and PapA2 are acyltransferases essential for the biosynthesis of the Mycobacterium tuberculosis virulence factor sulfolipid-1. Proc. Natl. Acad. Sci. USA 104, 11221–11226. Lea-Smith, D. J., Pyke, J. S., Tull, D., McConville, M. J., Coppel, R. L., and Crellin, P. K. (2007). The reductase that catalyzes mycolic motif synthesis is required for efficient attachment of mycolic acids to arabinogalactan. J. Biol. Chem. 282, 11000–11008. Lederer, E., Adam, A., Ciorbaru, R., Petit, J. F., and Wietzerbin, J. (1975). Cell walls of Mycobacteria and related organisms; chemistry and immunostimulant properties. Mol. Cell Mol. Cell Biochem. 7, 87–104. Lemassu, A., Laneelle, M. A., and Daffe, M. (1991). Revised structure of a trehalosecontaining immunoreactive glycolipid of Mycobacterium tuberculosis. FEMS Microbiol. Lett. 62, 171–175. Li, L., Bannantine, J. P., Zhang, Q., Amonsin, A., May, B. J., Alt, D., Banerji, N., Kanjilal, S., and Kapur, V. (2005). The complete genome sequence of Mycobacterium avium subspecies paratuberculosis. Proc. Natl. Acad. Sci. USA 102, 12344–12349. Lynett, J., and Stokes, R. W. (2007). Selection of transposon mutants of Mycobacterium tuberculosis with increased macrophage infectivity identifies fadD23 to be involved in sulfolipid production and association with macrophages. Microbiology 153, 3133–3140. Maier, T., Jenni, S., and Ban, N. (2006). Architecture of mammalian fatty acid synthase at 4. 5 A resolution. Science 311, 1258–1262. Marrakchi, H., Bardou, F., Laneelle, M. A., and Daffe, M. (2008). A comprehensive overview of mycolic acid structure and biosynthesis. In ‘‘The Mycobacterial Cell Envelope.’’ (D. Mamadou and J- M. Reyrat, eds.), pp. 41–62. ASM Press, Washington, DC. Marrakchi, H., Ducasse, S., Labesse, G., Montrozier, H., Margeat, E., Emorine, L., Charpentier, X., Daffe, M., and Quemard, A. (2002). MabA (FabG1), a Mycobacterium tuberculosis protein involved in the long-chain fatty acid elongation system FAS-II. Microbiology 148, 951–960. Marrakchi, H., Laneelle, G., and Quemard, A. (2000). InhA, a target of the antituberculous drug isoniazid, is involved in a mycobacterial fatty acid elongation system, FAS-II. Microbiology 146(Pt 2), 289–296. Marshall, B. J., and Ratledge, C. (1972). Salicylic acid biosynthesis and its control in Mycobacterium smegmatis. Biochim. Biophys. Acta 264, 106–116. Mathur, M., and Kolattukudy, P. E. (1992). Molecular cloning and sequencing of the gene for mycocerosic acid synthase, a novel fatty acid elongating multifunctional enzyme, from Mycobacterium tuberculosis var. bovis Bacillus Calmette-Guerin. J. Biol. Chem. 267, 19388–19395.
290
Tarun Chopra and Rajesh S. Gokhale
Matsunaga, I., Bhatt, A., Young, D. C., Cheng, T. Y., Eyles, S. J., Besra, G. S., Briken, V., Porcelli, S. A., Costello, C. E., Jacobs, W. R. Jr., and Moody, D. B. (2004). Mycobacterium tuberculosis pks12 produces a novel polyketide presented by CD1c to T cells. J. Exp. Med. 200, 1559–1569. McNeil, M., Daffe, M., and Brennan, P. J. (1991). Location of the mycolyl ester substituents in the cell walls of mycobacteria. J. Biol. Chem. 266, 13217–13223. Middlebrook, G., Coleman, C. M., and Schaefer, W. B. (1959). Sulfolipid from Virulent Tubercle Bacilli. Proc. Natl. Acad. Sci. USA 45, 1801–1804. Minnikin, D. E. (1982). Lipids: Complex lipids, their chemistry, biosynthesis and roles. In ‘‘The Biology of the Mycobacteria.’’ (C. Ratledge and J. Stanford, eds.), vol. 1, pp. 95–184. Academic Press, London. Minnikin, D. E., Minnikin, S. M., Parlett, J. H., Goodfellow, M., and Magnusson, M. (1984). Mycolic acid patterns of some species of Mycobacterium. Arch. Microbiol. 139, 225–231. Minnikin, D. E., and Polgar, N. (1967). The methoxymycolic and ketomycolic acids from human tubercle bacilli. Chem. Commun. (London) 22, 1172–1174. Misaki, A., Seto, N., and Azuma, I. (1974). Structure and immunological properties of D-arabino-D-galactans isolated from cell walls of Mycobacterium species. J. Biochem. 76, 15–27. Moody, D. B. (2001). Polyisoprenyl glycolipids as targets of CD1-mediated T cell responses. Cell. Mol. Life Sci. 58, 1461–1474. Moody, D. B., Ulrichs, T., Muhlecker, W., Young, D. C., Gurcha, S. S., Grant, E., Rosat, J. P., Brenner, M. B., Costello, C. E., Besra, G. S., and Porcelli, S. A. (2000). CD1c-mediated T-cell recognition of isoprenoid glycolipids in Mycobacterium tuberculosis infection. Nature 404, 884–888. Mougous, J. D., Leavell, M. D., Senaratne, R. H., Leigh, C. D., Williams, S. J., Riley, L. W., Leary, J. A., and Bertozzi, C. R. (2002). Discovery of sulfated metabolites in mycobacteria with a genetic and mass spectrometric approach. Proc. Natl. Acad. Sci. USA 99, 17037–17042. Mougous, J. D., Petzold, C. J., Senaratne, R. H., Lee, D. H., Akey, D. L., Lin, F. L., Munchel, S. E., Pratt, M. R., Riley, L. W., Leary, J. A., Berger, J. M., and Bertozzi, C. R. (2004). Identification, function and structure of the mycobacterial sulfotransferase that initiates sulfolipid-1 biosynthesis. Nat. Struct. Mol. Biol. 11, 721–729. Munoz, M., Laneelle, M. A., Luquin, M., Torrelles, J., Julian, E., Ausina, V., and Daffe, M. (1997a). Occurrence of an antigenic triacyl trehalose in clinical isolates and reference strains of Mycobacterium tuberculosis. FEMS Microbiol. Lett. 157, 251–259. Munoz, M., Luquin, M., Garcia-Barcelo, M., Julian, E., Ausina, V., and Laneelle, M. A. (1997b). Distribution of surface-exposed antigenic glycolipids in recent clinical isolates of Mycobacterium tuberculosis. Res. Microbiol. 148, 405–412. Murry, J. P., Sassetti, C. M., Lane, J. M., Xie, Z., and Rubin, E. J. (2008). Transposon site hybridization in Mycobacterium tuberculosis. Methods Mol. Biol 416, 45–59. Narumi, K., Keller, J. M., and Ballou, C. E. (1973). Biosynthesis of a mycobacterial lipopolysaccharide. Incorporation of (14C)acyl groups by whole cells in vivo. Biochem. J. 132, 329–340. Natarajan, V. T. D. M. and R. S. G., (2008). Biosynthesis of mycobacterial lipids by multifunctional polyketide synthases. In ‘‘The mycobacterial cell envelope.’’ (D. Mamadou and J.-M. Reyrat, eds.), pp. 235–248. ASM Press, Washington, DC. Noll, H., Bloch, H., Asselineau, J., and Lederer, E. (1956). The chemical structure of the cord factor of Mycobacterium tuberculosis. Biochim. Biophys. Acta 20, 299–309. Oh, T. J., Daniel, J., Kim, H. J., Sirakova, T. D., and Kolattukudy, P. E. (2006). Identification and characterization of Rv3281 as a novel subunit of a biotin-dependent acyl-CoA carboxylase in Mycobacterium tuberculosis H37Rv. J. Biol. Chem. 281, 3899–3908.
PKS-Mediated Biosynthesis of Mycobacterial Lipids
291
O’Hagan, D. (1992). Biosynthesis of polyketide metabolites. Nat. Prod. Rep. 9, 447–479. Onwueme, K. C., Ferreras, J. A., Buglino, J., Lima, C. D., and Quadri, L. E. (2004). Mycobacterial polyketide-associated proteins are acyltransferases: Proof of principle with Mycobacterium tuberculosis PapA5. Proc. Natl. Acad. Sci. USA 101, 4608–4613. Onwueme, K. C., Vos, C. J., Zurita, J., Ferreras, J. A., and Quadri, L. E. (2005a). The dimycocerosate ester polyketide virulence factors of mycobacteria. Prog. Lipid Res. 44, 259–302. Onwueme, K. C., Vos, C. J., Zurita, J., Soll, C. E., and Quadri, L. E. (2005b). Identification of phthiodiolone ketoreductase, an enzyme required for production of mycobacterial diacyl phthiocerol virulence factors. J. Bacteriol. 187, 4760–4766. Parish, T., and Stoker, N. G. (1997). Development and use of a conditional antisense mutagenesis system in mycobacteria. FEMS Microbiol. Lett. 154, 151–157. Parish, T., and Stoker, N. G. (2000). Use of a flexible cassette method to generate a double unmarked Mycobacterium tuberculosis tlyA plcABC mutant by gene replacement. Microbiology 146(Pt 8), 1969–1975. Pashley, C. A., Parish, T., McAdam, R. A., Duncan, K., and Stoker, N. G. (2003). Gene replacement in mycobacteria by using incompatible plasmids. Appl. Environ. Microbiol. 69, 517–523. Pathak, A. K., Pathak, V., Suling, W. J., Gurcha, S. S., Morehouse, C. B., Besra, G. S., Maddry, J. A., and Reynolds, R. C. (2002). Studies on n-octyl-5-(alpha-D-arabinofuranosyl)-beta-D-galactofuranosides for mycobacterial glycosyltransferase activity. Bioorg. Med. Chem. 10, 923–928. Paul, T. R., and Beveridge, T. J. (1992). Reevaluation of envelope profiles and cytoplasmic ultrastructure of mycobacteria processed by conventional embedding and freeze-substitution protocols. J. Bacteriol. 174, 6508–6517. Perez, E., Constant, P., Laval, F., Lemassu, A., Laneelle, M. A., Daffe, M., and Guilhot, C. (2004a). Molecular dissection of the role of two methyltransferases in the biosynthesis of phenolglycolipids and phthiocerol dimycoserosate in the Mycobacterium tuberculosis complex. J. Biol. Chem. 279, 42584–42592. Perez, E., Constant, P., Lemassu, A., Laval, F., Daffe, M., and Guilhot, C. (2004b). Characterization of three glycosyltransferases involved in the biosynthesis of the phenolic glycolipid antigens from the Mycobacterium tuberculosis complex. J. Biol. Chem. 279, 42574–42583. Pitarque, S., Larrouy-Maumus, G., Payre, B., Jackson, M., Puzo, G., and Nigou, J. (2008). The immunomodulatory lipoglycans, lipoarabinomannan and lipomannan, are exposed at the mycobacterial cell surface. Tuberculosis (Edinb.) 88, 560–565. Portevin, D., De Sousa-D’Auria, C., Houssin, C., Grimaldi, C., Chami, M., Daffe, M., and Guilhot, C. (2004). A polyketide synthase catalyzes the last condensation step of mycolic acid biosynthesis in mycobacteria and related organisms. Proc. Natl. Acad. Sci. USA 101, 314–319. Quadri, L. E., Sello, J., Keating, T. A., Weinreb, P. H., and Walsh, C. T. (1998). Identification of a Mycobacterium tuberculosis gene cluster encoding the biosynthetic enzymes for assembly of the virulence-conferring siderophore mycobactin. Chem. Biol. 5, 631–645. Quemard, A., Sacchettini, J. C., Dessen, A., Vilcheze, C., Bittman, R., Jacobs, W. R. Jr., and Blanchard, J. S. (1995). Enzymatic characterization of the target for isoniazid in Mycobacterium tuberculosis. Biochemistry 34, 8235–8241. Rafidinarivo, E., Laneelle, M. A., Montrozier, H., Valero-Guillen, P., Astola, J., Luquin, M., Prome, J. C., and Daffe, M. (2008). Trafficking pathways of mycolic acids: Structures, origin, mechanism of formation and storage form of mycobacteric acids. J. Lipid Res. 50(3), 477–490.
292
Tarun Chopra and Rajesh S. Gokhale
Rainwater, D. L., and Kolattukudy, P. E. (1982). Isolation and characterization of acyl coenzyme A carboxylases from Mycobacterium tuberculosis and Mycobacterium bovis, which produce multiple methyl-branched mycocerosic acids. J. Bacteriol. 151, 905–911. Rainwater, D. L., and Kolattukudy, P. E. (1983). Synthesis of mycocerosic acids from methylmalonyl coenzyme A by cell-free extracts of Mycobacterium tuberculosis var. bovis BCG. J. Biol. Chem. 258, 2979–2985. Ratledge, C. (2004). Iron, mycobacteria and tuberculosis. Tuberculosis (Edinb.) 84, 110–130. Ratledge, C., and Marshall, B. J. (1972). Iron transport in Mycobacterium smegmatis: The role of mycobactin. Biochim. Biophys. Acta 279, 58–74. Rawlings, B. J. (1997). Biosynthesis of fatty acids and related metabolites. Nat. Prod. Rep. 14, 335–358. Reed, M. B., Domenech, P., Manca, C., Su, H., Barczak, A. K., Kreiswirth, B. N., Kaplan, G., and Barry, C. E. 3rd (2004). A glycolipid of hypervirulent tuberculosis strains that inhibits the innate immune response. Nature 431, 84–87. Rivera-Marrero, C. A., Ritzenthaler, J. D., Newburn, S. A., Roman, J., and Cummings, R. D. (2002). Molecular cloning and expression of a novel glycolipid sulfotransferase in Mycobacterium tuberculosis. Microbiology 148, 783–792. Rodriguez, G. M. (2006). Control of iron metabolism in Mycobacterium tuberculosis. Trends Microbiol. 14, 320–327. Rodriguez, G. M., and Smith, I. (2003). Mechanisms of iron regulation in mycobacteria: Role in physiology and virulence. Mol. Microbiol. 47, 1485–1494. Rousseau, C., Neyrolles, O., Bordat, Y., Giroux, S., Sirakova, T. D., Prevost, M. C., Kolattukudy, P. E., Gicquel, B., and Jackson, M. (2003a). Deficiency in mycolipenateand mycosanoate-derived acyltrehaloses enhances early interactions of Mycobacterium tuberculosis with host cells. Cell. Microbiol. 5, 405–415. Rousseau, C., Sirakova, T. D., Dubey, V. S., Bordat, Y., Kolattukudy, P. E., Gicquel, B., and Jackson, M. (2003b). Virulence attenuation of two Mas-like polyketide synthase mutants of Mycobacterium tuberculosis. Microbiology 149, 1837–1847. Rukmini, R., Shanmugam, V. M., Saxena, P., Gokhale, R. S., and Sankaranarayanan, R. (2004). Crystallization and preliminary X-ray crystallographic investigations of an unusual type III polyketide synthase PKS18 from Mycobacterium tuberculosis. Acta Crystallogr. D Biol. Crystallogr. 60, 749–751. Sacco, E., Covarrubias, A. S., O’Hare, H. M., Carroll, P., Eynard, N., Jones, T. A., Parish, T., Daffe, M., Backbro, K., and Quemard, A. (2007). The missing piece of the type II fatty acid synthase system from Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA 104, 14628–14633. Sanchez, J. F., Chiang, Y. M., and Wang, C. C. (2008). Diversity of polyketide synthases found in the Aspergillus and Streptomyces genomes. Mol. Pharm. 5, 226–233. Sankaranarayanan, R., Saxena, P., Marathe, U. B., Gokhale, R. S., Shanmugam, V. M., and Rukmini, R. (2004). A novel tunnel in mycobacterial type III polyketide synthase reveals the structural basis for generating diverse metabolites. Nat. Struct. Mol. Biol. 11, 894–900. Sassetti, C. M., Boyd, D. H., and Rubin, E. J. (2001). Comprehensive identification of conditionally essential genes in mycobacteria. Proc. Natl. Acad. Sci. USA 98, 12712–12717. Savvi, S., Warner, D. F., Kana, B. D., McKinney, J. D., Mizrahi, V., and Dawes, S. S. (2008). Functional characterization of a vitamin B12-dependent methylmalonyl pathway in Mycobacterium tuberculosis: Implications for propionate metabolism during growth on fatty acids. J. Bacteriol. 190, 3886–3895. Saxena, P., Yadav, G., Mohanty, D., and Gokhale, R. S. (2003). A new family of type III polyketide synthases in Mycobacterium tuberculosis. J. Biol. Chem. 278, 44780–44790. Schaeffer, M. L., Agnihotri, G., Kallender, H., Brennan, P. J., and Lonsdale, J. T. (2001a). Expression, purification, and characterization of the Mycobacterium tuberculosis acyl carrier protein, AcpM. Biochim. Biophys. Acta 1532, 67–78.
PKS-Mediated Biosynthesis of Mycobacterial Lipids
293
Schaeffer, M. L., Agnihotri, G., Volker, C., Kallender, H., Brennan, P. J., and Lonsdale, J. T. (2001b). Purification and biochemical characterization of the Mycobacterium tuberculosis beta-ketoacyl-acyl carrier protein synthases KasA and KasB. J. Biol. Chem. 276, 47029–47037. Seidel, M., Alderwick, L. J., Birch, H. L., Sahm, H., Eggeling, L., and Besra, G. S. (2007). Identification of a novel arabinofuranosyltransferase AftB involved in a terminal step of cell wall arabinan biosynthesis in Corynebacterianeae, such as Corynebacterium glutamicum and Mycobacterium tuberculosis. J. Biol. Chem. 282, 14729–14740. Sherman, D. H., and Smith, J. L. (2006). Clearing the skies over modular polyketide synthases. ACS Chem. Biol. 1, 505–509. Simeone, R., Constant, P., Guilhot, C., Daffe, M., and Chalut, C. (2007). Identification of the missing trans-acting enoyl reductase required for phthiocerol dimycocerosate and phenolglycolipid biosynthesis in Mycobacterium tuberculosis. J. Bacteriol. 189, 4597–4602. Sirakova, T. D., Thirumala, A. K., Dubey, V. S., Sprecher, H., and Kolattukudy, P. E. (2001). The Mycobacterium tuberculosis pks2 gene encodes the synthase for the hepta- and octamethyl-branched fatty acids required for sulfolipid synthesis. J. Biol. Chem. 276, 16833–16839. Slayden, R. A., and Barry, C. E. 3rd (2000). Analysis of the lipids of Mycobacteriun tuberculosis. In ‘‘Methods in Molecular Medicine: Mycobacterium tuberculosis Protocols’’ (T. Parish and N. G. Stoker, eds.), pp. 229–246. Humana Press, Totowa, NJ. Slayden, R. A., and Barry, C. E. 3rd (2002). The role of KasA and KasB in the biosynthesis of meromycolic acids and isoniazid resistance in Mycobacterium tuberculosis. Tuberculosis (Edinb.) 82, 149–160. Smith, S., Witkowski, A., and Joshi, A. K. (2003). Structural and functional organization of the animal fatty acid synthase. Prog. Lipid Res. 42, 289–317. Snow, G. A. (1970). Mycobactins: Iron-chelating growth factors from mycobacteria. Bacteriol. Rev. 34, 99–125. Stadthagen, G., Kordulakova, J., Griffin, R., Constant, P., Bottova, I., Barilone, N., Gicquel, B., Daffe, M., and Jackson, M. (2005). p-Hydroxybenzoic acid synthesis in Mycobacterium tuberculosis. J. Biol. Chem. 280, 40699–40706. Sulzenbacher, G., Canaan, S., Bordat, Y., Neyrolles, O., Stadthagen, G., RoigZamboni, V., Rauzier, J., Maurin, D., Laval, F., Daffe, M., Cambillau, C., Gicquel, B., et al. (2006). LppX is a lipoprotein required for the translocation of phthiocerol dimycocerosates to the surface of Mycobacterium tuberculosis. EMBO J. 25, 1436–1444. Takayama, K., Wang, C., and Besra, G. S. (2005). Pathway to synthesis and processing of mycolic acids in Mycobacterium tuberculosis. Clin. Microbiol. Rev. 18, 81–101. Thomas, I., Martin, C. J., Wilkinson, C. J., Staunton, J., and Leadlay, P. F. (2002). Skipping in a hybrid polyketide synthase. Evidence for ACP-to-ACP chain transfer. Chem. Biol. 9, 781–787. Toubiana, R., Berlan, J., Sato, H., and Strain, M. (1979). Three types of mycolic acid from Mycobacterium tuberculosis Brevanne: Implications for structure-function relationships in pathogenesis. J. Bacteriol. 139, 205–211. Trivedi, O. A., Arora, P., Sridharan, V., Tickoo, R., Mohanty, D., and Gokhale, R. S. (2004). Enzymic activation and transfer of fatty acids as acyl-adenylates in mycobacteria. Nature 428, 441–445. Trivedi, O. A., Arora, P., Vats, A., Ansari, M. Z., Tickoo, R., Sridharan, V., Mohanty, D., and Gokhale, R. S. (2005). Dissecting the mechanism and assembly of a complex virulence mycobacterial lipid. Mol. Cell 17, 631–643. Tsenova, L., Ellison, E., Harbacheuski, R., Moreira, A. L., Kurepina, N., Reed, M. B., Mathema, B., Barry, C. E. 3rd, and Kaplan, G. (2005). Virulence of selected
294
Tarun Chopra and Rajesh S. Gokhale
Mycobacterium tuberculosis clinical isolates in the rabbit model of meningitis is dependent on phenolic glycolipid produced by the bacilli. J. Infect. Dis. 192, 98–106. Waddell, S. J., Chung, G. A., Gibson, K. J., Everett, M. J., Minnikin, D. E., Besra, G. S., and Butcher, P. D. (2005). Inactivation of polyketide synthase and related genes results in the loss of complex lipids in Mycobacterium tuberculosis H37Rv. Lett. Appl. Microbiol. 40, 201–206. Wenzel, S. C., Kunze, B., Hofle, G., Silakowski, B., Scharfe, M., Blocker, H., and Muller, R. (2005). Structure and biosynthesis of myxochromides S1–3 in Stigmatella aurantiaca: Evidence for an iterative bacterial type I polyketide synthase and for module skipping in nonribosomal peptide biosynthesis. ChemBioChem. 6, 375–385. Wilkinson, B., Foster, G., Rudd, B. A., Taylor, N. L., Blackaby, A. P., Sidebottom, P. J., Cooper, D. J., Dawson, M. J., Buss, A. D., Gaisser, S., Bohm, I. U., Rowe, C. J., et al. (2000). Novel octaketide macrolides related to 6-deoxyerythronolide B provide evidence for iterative operation of the erythromycin polyketide synthase. Chem. Biol. 7, 111–117. Yadav, G., Gokhale, R. S., and Mohanty, D. (2003). SEARCHPKS: A program for detection and analysis of polyketide synthase domains. Nucleic Acids Res. 31, 3654–3658. Yano, I., and Kusunose, M. (1966). Propionate incorporation into mycocerosic acid by resting cells of Mycobacterium tuberculosis bovis. Biochim. Biophys. Acta 116, 593–596. Zha, W., Rubin-Pitel, S. B., and Zhao, H. (2006). Characterization of the substrate specificity of PhlD, a type III polyketide synthase from Pseudomonas fluorescens. J. Biol. Chem. 281, 32036–32047. Zuber, B., Chami, M., Houssin, C., Dubochet, J., Griffiths, G., and Daffe, M. (2008). Direct visualization of the outer membrane of mycobacteria and corynebacteria in their native state. J. Bacteriol. 190, 5672–5680.
C H A P T E R
T H I R T E E N
Genetic Engineering to Produce Polyketide Analogues Christopher D. Reeves* and Eduardo Rodriguez† Contents 1. Introduction 2. AT Domain Replacement to Alter a-Carbon Substitution 3. Procedure for Engineering AT Replacements in the Chromosome 4. Engineering b-Carbon Processing 5. Engineering when only a Single Crossover Event is Possible 6. Heterologous Expression of Engineered PKS Genes 7. Chemobiosynthesis 8. Mutasynthesis 9. Gene Knockouts to Obtain Analogues References
296 300 301 305 308 309 311 313 314 315
Abstract Polyketides are pharmaceutically important and structurally diverse natural products. Creating analogues for drug development can be done with chemistry, but this is generally restricted to a few accessible functional groups. Analogues can also be made by genetic engineering, which is particularly effective for polyketides synthesized by a modular polyketide synthase (PKS). Such a PKS displays colinearity, which means that the structural features along the polyketide chain are determined by the catalytic specificities in corresponding modules along a molecular assembly line. The assembly line can be genetically engineered through addition, deletion, or mutation of catalytic domains or the reorganization of whole modules. Chemically synthesized precursors also can be fed to engineered assembly lines to further expand the repertoire of analogues. These various methods are discussed with an aim of providing a guide to the strategies most likely to succeed in a given circumstance. Recent information that could be relevant to future polyketide engineering projects is also discussed.
* {
Amyris Biotechnologies, Inc., Emeryville, California, USA Instituto de Biologı´a Molecular y Celular de Rosario (CONICET), Facultad de Ciencias Bioquı´micas y Farmace´uticas, Universidad Nacional de Rosario, Rosario, Argentina
Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04613-8
#
2009 Elsevier Inc. All rights reserved.
295
296
Christopher D. Reeves and Eduardo Rodriguez
1. Introduction Many polyketides have therapeutic value and some are well-known drugs. A small sample of the polyketides produced by assembly line enzymology include macrolide antibacterials, polyene antifungals, immunosuppressants related to rapamycin and FK506, ansamycin Hsp90 inhibitors, and epothilones, microtubule stabilizing anticancer agents. The drug properties of a polyketide, are not always ideal, but the process of developing a better polyketide drug is time consuming and expensive. Analogues must be generated to obtain a structure-activity relationship profile, but the complex structures of most polyketides restrict the use of medicinal chemistry for this purpose. Genetic engineering is an alternative way to make analogues, many of which would be difficult to make using chemistry. In the early 1990s, Donadio and Katz provided the first demonstration of modular PKS engineering with the erythromycin PKS, known as 6-deoxyerythronolide B synthase (DEBS) (Donadio and Katz, 1992; Donadio et al., 1991, 1992, 1993; Katz and Donadio, 1993). Subsequent work in several laboratories showed that DEBS was very pliable to a variety of engineering approaches. When two or three of the DEBS modules were used, various triketide lactones could be produced (Bedford et al., 1996; Cortes et al., 1995; McDaniel et al., 1997; Oliynyk et al., 1996) and when the complete DEBS was engineered, many 6-dEB or erythromycin analogues could be obtained (McDaniel et al., 1999; Ruan et al., 1997; Stassi et al., 1998; Xue et al., 1999). Individual catalytic domains or groups of domains were also studied in vitro with biochemical methods (Kumar et al., 2004). Detailed discussion of DEBS and the biosynthesis of erythromycin is found in Chapter 6 of this volume. A comprehensive description of assembly line enzymology is beyond the scope of this chapter. Various aspects are discussed both elsewhere in this volume and in many recent reviews (Fischbach and Walsh, 2006; Smith and Tsai, 2007; Van Lanen and Shen, 2008; Walsh, 2008; Weissman and Leadlay, 2005; Weissman and Muller, 2008). A representative diagram of assembly line enzymology is shown in Fig. 13.1, in this case synthesis of the microtubule stabilizing anticancer agent, epothilone, by a PKS composed of nine PKS modules and a non–ribosomal peptide synthetase (NRPS) module. NRPS modules are often found in PKS assembly lines and are also amenable to genetic engineering (see Chapter 20 of volume 458). Assembly line diagrams for other PKSs can be found in several other chapters of this volume. Although the epothilone PKS was one of the more difficult to engineer, inactivation of two of its KR domains did give some production of the expected products (Tang et al., 2005). The epothilone PKS is also a source of modules having unusual specificities that potentially can be used to
EpoA
EpoB
EpoC
L
1
2
EpoD 3
4
5
∗
KS
A
ACP
OX ACP
C
ACP
KS
S
S
AT KR
KR
AT
ACP KS
S
AT
8
AT KR
ACP
O
9 DH ER
KR
AT
ACP KS
KS
S
S
O
EpoF
DH MT
KR
ACP KS
S
O
O
7
DH ER
KR
AT
AT KR
ACP KS
KS
S
O
6
DH ER
DH AT DH
EpoE
ACP
KR
KS
ACP TE
S
S
O
AT
O
S
O
O
O
OH
O
OH
OH
O
R S
OH
N
R S
OH
N
R
S S
O HS
N
R S
NH
OH
N
R
O S R S
OH
OH
OH
N
R S
OH
N
9
13
S
11
OH
N
OH
N
S
O 1 O
OH
O
N
S
N
Figure 13.1 The PKS assembly line for epothilone biosynthesis. The six polypeptides of this megasynthase are shown at the top (EpoA to EpoF) as arrows from N- to C-terminus. The modules on these polypeptides are numbered below and the domain composition is shown schematically. The intermediate attached to the phosphopantetheine arm on the ACP domain is that expected just prior to its transfer to the downstream KS. This diagram illustrates various aspects of PKS engineering discussed in the text.
298
Christopher D. Reeves and Eduardo Rodriguez
construct novel PKSs (Menzella et al., 2005). To date there are well over a hundred modular PKS gene cluster sequences known, with more appearing nearly every week. In synthetic biology terms this represents a large collection of parts that could be used to engineer the production of novel polyketides. The number of polyketide structures that are theoretically possible from these assembly lines is huge, but this chapter is focused on engineering relative modest changes in a natural modular PKS in order to generate analogues for medicinal chemistry. The structure of each ‘‘ketide’’ unit of a polyketide is determined by the catalytic domains in each PKS module as shown in Fig. 13.2. Generating polyketide analogues involves deleting, inserting, mutating or replacing catalytic domains in a PKS module. Entire modules also can be rearranged to create a different assembly line. Feeding of chemically synthesized precursors to an assembly line engineered to accept them expands the possibilities still further. Some modular PKSs have been relatively pliable to engineering, DEBS being the prime example, but others have been difficult to engineer for reasons that are largely unknown. Unexpected results may be partly because a PKS does not always follow the strict correspondence shown in Fig. 13.2. Modules can contain domains that do not appear to be necessary based on the structure of the intermediate. For example, three modules of the epothilone PKS (L, 8, and 9) have dehydratase (DH) domains that appear unnecessary (Fig. 13.1). Module 8 also has an apparently unnecessary ketoreductase (KR) domain. The sequence of some of these apparently redundant domains suggests they are catalytically inactive, which may represent relics of a recent evolutionary event. On the other hand, domains that at first glance seem unnecessary might have a function. For example, ketoductase domains unable to catalyze ketoreduction can still epimerize the side chain on the a carbon (Keatinge-Clay, 2007). A catalytic activity that seems to be necessary also can be missing from a module. The 12,13 double bond of epothilone is predicted to arise by dehydration of the module 4 intermediate, yet module 4 contains no DH domain. Experiments have suggested that the DH in module 5 carries out this reaction (Tang et al., 2004). Occasionally, a PKS module catalyzes more than one condensation before passing its intermediate forward, a phenomenon referred to as ‘‘stuttering’’ and reviewed in Moss et al. (2004). An incomplete understanding of such deviations from colinearity or the correlation between domain organization and polyketide structure may have been the reason for the failure of some previous engineering attempts. An engineered PKS generally produces a lower titer of the analogue than the wildtype PKS produces of the original polyketide. This reduction in assembly line efficiency could be caused by disturbance of PKS structure or by the altered PKS intermediate being a poor substrate for the next module. When the downstream ketoacyl synthase (KS) domain acts as a gatekeeper, experiments have shown that catalytic efficiency can be increased by
AT specificity
KS
KS
KS AT
AT
ACP
KR
DH AT
ACP
O
OH
OH
O
OH
OH
O
OH
OH
O
OH
OH
KR ACP
DH
KS
AT
KR
ER
ACP
Malonyl-CoA
MethylmalonylCoA
MethoxymalonylACP
OMe
OMe O
OMe
OH
OMe
OH OMe
OMe
KS
OMe
KS
CMT
AT
AT
ACP
Additional Examples
O
OH
OMe
OMe
KS
KR
DH AT
ACP
KR
KS
OMT
AT ACP
ACP
OMe
OH R
R
Figure 13.2 (Continued)
300
Christopher D. Reeves and Eduardo Rodriguez
replacing the KS with one having better tolerance (Chandran et al., 2006). Post-PKS reactions, such as hydroxylation, glycosylation and methylation are often critical for the potency and other drug properties of a polyketide. An analogue produced by an engineered PKS may not be processed efficiently by the post-PKS pathway, and this can present additional obstacles to be overcome. Strategies for PKS engineering fall in two broad categories. Either the sequence of the PKS genes is altered directly in the chromosome of the original producing organism or the genes are cloned, altered in vitro (or in Escherichia coli), and expressed in a suitable host. When the original polyketide producing organism can be genetically manipulated and produces reasonable titers of the natural polyketide, it is often best to do the engineering in that strain to obtain the analogue in sufficient quantity. However, expressing engineered PKS genes in heterologous hosts can have significant advantages, especially for making large libraries of polyketide analogues (McDaniel et al., 1999). Given the structural diversity of polyketides, the diverse mechanisms of their biosynthesis, and the phylogenetic diversity of organisms that express polyketide pathways, it is not possible to provide detailed PKS engineering protocols that would be useful. Instead this chapter will provide generic procedures and guidelines for increasing the chance of success.
2. AT Domain Replacement to Alter a-Carbon Substitution An a-carbon side-chain on a polyketide can be changed by replacing the AT domain in the corresponding module with a heterologous AT domain having a different substrate specificity. The methylmalonyl-CoA-specific AT Figure 13.2 The ‘‘ketide’’ unit structure determined by the domain organization of some PKS modules. AT domain substrate specificity is shown in the left column. The specific stereoisomer produced by a module having a KR, but no DH or ER, is determined by the particular KR domain. KR domain sequence motifs apparently correlated with stereochemical outcome have been identified. The example on the bottom left is a module with a methylmalonyl-CoA-specific AT and a C-methyltransferase domain, which produces an a-gem-dimethyl. The next example shows two of the four stereoisomers possible with an ethylmalonyl-CoA specific AT. The next example at the bottom shows a cis double bond arising from a module that has both DH and KR domains, the latter determining this outcome. The bottom right example shows the trapping of an enol ether by an O-methyltransferase domain. Engineering a change in ketide structure is achieved by engineering the corresponding change in the domain organization of the module.
Genetic Engineering to Produce Polyketide Analogues
301
domains of the erythromycin PKS have been replaced with AT domains specific for malonyl-CoA (McDaniel et al., 1999; Petkovic et al., 2003; Ruan et al., 1997) and other substrates such as ethylmalonyl-CoA or methoxymalonyl-ACP (Kato et al., 2002; Stassi et al., 1998). The methoxymalonyl-ACP-specific AT domains of the ascomycin (FK-520) PKS of Streptomyces hygroscopicus have been replaced with malonyl and methylmalonyl transferases giving the predicted analogue (Reeves et al., 2002; Revill et al., 2002). After replacing six of the AT domains in the geldanamycin PKS with malonyl transferase domains, four gave the expected analogue (2-desmethyl, 6-desmethoxy, 8-desmethyl, and 14-desmethyl), although some also altered post-PKS reactions (Patel et al., 2004). The specificity of an AT domain, at least with respect to malonyl-CoA versus methylmalonylCoA substrates, is correlated with certain amino acid sequence motifs (Haydock et al., 1995; Smith and Tsai, 2007). In addition to AT replacement, specificity can be changed by mutating the sequence of these motifs (Reeves et al., 2001). Complete AT domain replacement is probably the strategy of choice unless it fails in a particular experiment, in which case site-specific mutagenesis provides a backup strategy.
3. Procedure for Engineering AT Replacements in the Chromosome 1. Design the AT replacement cassettes by first considering the amino acid sequence. Align the region around the AT to be replaced with heterologous AT domains having the desired substrate specificity. AT domain specificities in a given PKS are usually defined by applying the colinearity rule to the PKS sequence. Choose those AT domains that have sequences as similar as possible to the AT being replaced. An AT domain from another module of the same PKS may be used, but it is prudent to synthesize the encoding DNA with different codon choices to avoid undesired recombination events. Also use the sequence alignments to choose the junctions where the heterologous AT sequence and the native PKS sequence will be spliced together. Table 13.1 lists conserved sequence motifs found near the boundaries between PKS domains. Whether to include the sequence between the ketoacyl synthase (KS) and AT domains or the post-AT linker sequence in the replacement cannot be predicted and it is probably best to try the replacement both with and without these sequences. 2. Obtain DNA encoding the chosen heterologous AT domains either by PCR amplification or gene synthesis. Obtain the native PKS sequence upstream and downstream of the AT being replaced by PCR amplification of about 1000 base pair regions. Assembly of the AT replacement
302
Christopher D. Reeves and Eduardo Rodriguez
Table 13.1 Conserved sequence motifs between PKS domains
Region
Approx length (AA)
Boundary motifs
KS KS/AT linker AT Post-AT DH (1 and 2) KR structural ER KR ACP
430 100 330 25 240 190 320 250 80
(4–6)EPIAIV SGTNAHVIVE Not conserved VFVFPGQG GVAVDW(4–6) Not conserved YPFXXXXYWL (40–45)HXXXGXXXXP LPFAW(45–50) (6–8)RVNW EDQVAVR(14–16) (40–45)NFRDV GKIVLTXPX (4–6)LVTGG AWGXWA(75–90) (35–40)LGFDSL(35–40)
Notes: The actual sequence is that found in the erythromycin PKS. This table helps in locating these motifs in any given PKS. Some domain boundaries have no well-conserved motifs nearby, in which case the nearest motif that is conserved was chosen. The approximate number of amino acid residues between the motif and the actual boundary is given in parentheses. Precise identification of boundaries should be based on analysis of multiple PKS sequence alignments and three-dimensional homologue models.
cassettes from these three fragments (Fig. 13.3) can be done using several methods. Stitching by overlap extension (Heckman and Pease, 2007; Horton et al., 1993) is best, because it does not require the use of restriction sites at the junctions between the pieces. A proofreading polymerase, such as Phusion from Finnzymes, should be used for this method and the PCR primers should have 20-bp overlapping extensions. The ends of the cassette should have restriction sites that will facilitate cloning in the next step. 3. Clone the AT replacement cassettes into a vector that can be used for two-step double homologous recombination in the producing microorganism (Fig. 13.3). For many species of Streptomyces, either the plasmid pKC1139, which has a temperature-sensitive Streptomyces replicon, or the fC31 phage vector KC515 are excellent choices (Kieser et al., 2000). The simplest type of vector for this purpose, called a suicide vector, cannot be propagated in the polyketide producer unless it integrates into the chromosome by homologous recombination. Plasmids that contain an oriT site can often be introduced into the polyketide producing strain by conjugation from an E. coli strain. Many species of Streptomyces can only be transformed with DNA that is not methylated and the plasmid must be isolated or introduced by conjugation from a dam , dcm strain of E. coli. Site-directed mutagenesis may be required to eliminate interfering sites in the cassettes built in Step 2 before they can be cloned into the vector. 4. Introduce each AT replacement vector into the producing organism and select for colonies resistant to the marker expressed by the chosen vector.
303
Genetic Engineering to Produce Polyketide Analogues
Vector SM US AT∗ DS or Chromosome
US AT DS
First crossover Marker resistant isolates
US AT∗ DS
SM US AT DS
US AT DS
SM US AT∗ DS
Second crossover Marker sensitive isolates
US AT DS
Original polyketide
US AT∗ DS
Polyketide analog
Figure 13.3 Engineering an AT replacement in the chromosome of a polyketide producing strain. See the text for details. The vector must have a selectable marker (SM) functional in the polyketide producing strain and can have sequences to facilitate its delivery. A cassette consisting of a heterologous AT flanked by upstream (US) and downstream (DS) homologues is built and cloned into the vector. The first and second crossovers can occur between either the US or DS homologues. If these sequences are the same size, each crossover has an equal probability of occurring at the US or DS sequence. Small paired arrows indicate where primers should bind for PCR verification that the desired crossover event has occurred.
The method used to introduce the vector DNA (transformation, conjugation or transfection) will depend on the strain and the vector as just discussed. For all commonly used actinomycete vectors, the methods are well-described in Practical Streptomyces Genetics (Kieser et al., 2000). For vectors with a temperature-sensitive replicon, the strain also must be grown at the nonpermissive temperature to ensure that chromosomal recombination is the only mechanism for antibiotic resistant colonies to arise. 5. Pick drug resistant colonies and streak for pure clones. For Streptomyces and other filamentous microorganisms that can sporulate, the spores themselves should be streaked or plated for single colonies. For organisms that grow as single cells, such as myxobacteria, cyanobacteria, or pseudomonads, this is not necessary. 6. Verify correct integration using colony PCR with primer pairs that will amplify either the upstream or downstream flanking region only when adjacent to the heterologous AT sequence and inserted at the correct chromosomal locus (Fig. 13.3). Southern blot hybridization can also be
304
Christopher D. Reeves and Eduardo Rodriguez
used for this purpose, which, although more time consuming, provides more detail about the locus following integration. 7. Grow the verified strains in liquid medium without selection for several generations to allow a second crossover event to loop the construct out of the chromosome (Fig. 13.3). For Streptomyces and other filamentous microorganisms that sporulate, a spore stock must be generated after culturing in liquid to ensure that the subsequent colonies are clonal. For bacteria that grow as single cells this should not be necessary. 8. Identify clones in which the construct has looped out. For some microorganisms counter-selectable markers can be included in the vector used in step 3, allowing direct selection for the second crossover event. However, there are few reliable counter-selectable markers for most polyketide-producing microorganisms and the usual method of finding the desired strains is by replicating colonies from plates without antibiotic onto plates with antibiotic and then hunting for the rare clones that have become sensitive. The frequency of such clones ranges between 0.1% and 1% for most actinomycetes (Kieser et al., 2000). The second crossover can occur between the sequences that recombined to give integration or between the homologues on the opposite side of the heterologous AT. Only the latter case will give the desired AT replacement. If the flanking homologues are the same size, crossing over with each occurs with equal probability and, statistically, half the antibiotic-sensitive clones will carry the AT replacement. For the myxobacteria, colonies are very difficult to replicate because the cells grow slowly and migrate on the agar surface. Since a reliable counterselectable marker has not yet been found for most myxobacteria, they are difficult to engineer by double homologous recombination. 9. Identify antibiotic-sensitive clones with the AT replacement using PCR with primers that bind just outside the upstream and downstream homologues used for recombination (Fig. 13.3). Southern blot hybridization can also be used for this. In addition, grow each isolate in production medium, extract the broth, and analyze the extracts by a liquid chromatography–mass spectrometry (LC-MS) method that will detect the original polyketide and related analogues. If the AT replacement results in a complete switch of substrate specificity, the original polyketide will be absent and one or more new compounds should be seen. The LC-MS data usually provides strong evidence that an isolate makes the predicted analogue. However, interpretation of LC-MS data can be complicated when the product of an engineered PKS is processed differently by the post-PKS tailoring enzymes (Patel et al., 2004; Reeves et al., 2004). 10. For unequivocal proof of analogue structure, the engineered strain should be grown in larger-scale cultures, the products purified (typically using C18 column chromatography), and each fully characterized using
305
Genetic Engineering to Produce Polyketide Analogues
NMR and mass spectrometry. At this stage the purified analogues also should be evaluated for drug properties using in vitro assays. Preclinical testing in animals generally requires gram quantities of pure compound, which highlights the importance of doing the engineering in such a way as to obtain good titers of the polyketide analogues.
4. Engineering b-Carbon Processing The nascent b-ketone following a condensation is processed sequentially by a keto-reductase (KR), a dehydratase (DH) and an enoyl reductase (ER) domain, when present in the module. The first examples of PKS engineering were deletion of most of the KR domain of module 5 of the erythromycin PKS (using fortuitous restriction endonuclease sites), to obtain 5,6-dideoxy-5-oxoerythronolide B (Donadio et al., 1991) and mutation of two amino acids in the putative cofactor binding site of the module 4 ER domain to obtain D6,7-anhydroerythromycin C (Donadio et al., 1993). Subsequently the erythromycin PKS has been engineered in many different ways including replacement of sets of b-carbon processing domains with domains from heterologous PKS modules (McDaniel et al., 1999). The procedure for engineering different b-carbon processing in the chromosome of a polyketide producing strain will follow closely the steps already described for an AT replacement, except that sequences encoding b-carbon processing domains will be altered. Figure 13.4 gives examples of cassettes for ER deletion, insertion of a DH domain or replacement of one set of domains with another. Selecting the optimum points at which to join the native and heterologous sequences is aided by aligning the PKS sequences of interest and using Table 13.1 as a guide for locating domain
KS
AT
AT
ψKR
DH1 DH2
ψKR
KR
ER
KR
ACP
KS
ACP
DEBS module 1
DEBS module 4
Figure 13.4 Domain organization of PKS modules of different composition. Note where DH and ER domains are located when present. The smaller unlabeled black boxes represent flanking sequences on either side of the AT domain that are not part of the catalytic domain itself, but may have an important structural role. In the trans-AT PKSs lacking integral AT domains, these flanking sequences are still present.
306
Christopher D. Reeves and Eduardo Rodriguez
boundaries. However, not enough engineering has been done to specify the best junction points in a given situation. Engineering of b-carbon processing is complicated by the fact that the KR domain sets the chirality at both the a and b carbon atoms, with some KR domains epimerizing the a-carbon without reducing the b-ketone (KeatingeClay, 2007). Moreover, the stereochemistry set by the KR determines whether a cis or a trans double bond is formed during subsequent dehydration if there is an active DH domain in the module (Keatinge-Clay, 2007). When enoyl reduction occurs, the ER domain determines the stereochemistry at the a-carbon. A protocol for identifying the stereochemical outcome of a module from its organization and the sequence motifs in the KR domain has been presented (Keatinge-Clay, 2007). Most previous engineering of b-carbon processing was done well before this information was known, and future engineering that accounts for this aspect of assembly line enzymology should have better success at obtaining the desired analogues. Recent high-resolution crystal structure data for various portions of modular PKSs (Keatinge-Clay, 2007, 2008; Keatinge-Clay and Stroud, 2006; Khosla et al., 2007; Smith and Tsai, 2007; Tang et al., 2006, 2007), and for the entire mammalian fatty acid synthase (Maier et al., 2008) has better defined the boundaries between catalytic domains (Fig. 13.5 and Table 13.1). This structural data reveals extensive domain–domain interactions and we are just beginning to understand their importance for assembly line efficiency (Weissman and Muller, 2008). In future engineering efforts, in silico analysis of the relevant structures may allow the identification of residues in domain– domain interaction surfaces that, if mutated, might improve catalytic activity. An ER domain is inserted between two subdomains of the KR, one serving a structural role (cKR) and the other a catalytic role (KR) (Keatinge-Clay and Stroud, 2006). Although inactivation of an ER by site-specific mutagenesis was successful (Donadio et al., 1993), such a strategy could leave an ER able to bind its PKS intermediate and thus reduce assembly line efficiency. It may be preferable to delete ER domains at its boundaries, although this has yet to be tried. Insertion of an ER domain between the KR subdomains also seems likely to give the desired polyketide analogue, though it is important that the KR and DH domains generate the appropriate trans double-bond substrate for the inserted ER. The DH domain folds as two subdomains with the active site at the interface of those subdomains (Keatinge-Clay, 2008; Maier et al., 2008). Deletion of both DH subdomains at the proper boundaries should give an analogue with a hydroxyl in place of the double bond and with stereochemistry that may be predicted from the sequence of the KR (Keatinge-Clay, 2007). All known previous attempts to engineer a b-hydroxyl by inactivating a DH domain have resulted in a PKS that produced no product at all (unpublished results). However, this new information may allow such engineering to be done successfully in the future.
307
Genetic Engineering to Produce Polyketide Analogues
ER deletion to convert a saturated bond to a double bond ψKR KR
ψKR ER
KR
ψKR KR
DH insertion to convert a hydroxyl to a double bond AT
DH ψKR
AT ψKR KR AT
DH ψKR KR
Domain set replacement to convert a carbonyl to a methylene AT
DH ψKR ER
KR ACP
AT ψKR KR ACP AT DH ψKR
ER
KR ACP
Figure 13.5 Examples of cassettes that could be used to engineer b-carbon processing. Any of these cassettes would be used as described for AT replacement (Fig. 13.2). The sequence to be deleted, inserted or replaced may be a single b-carbon processing domain or the complete set found in a given module. Insertion or replacement of several b-carbon processing domains might give a cassette too large to fit in some vectors, in which case another vector or a heterologous expression strategy would be alternatives. The symbols are defined in the text and the DH domain represents the two subdomains shown in Fig. 13.3.
Whether to delete a domain completely or to inactivate it using point mutations probably depends on the context and other factors. For example, deletion of the KR domain in DEBS module 6 gave the desired 3-keto 6-dEB analogue, but also relaxed the specificity of the AT domain in the module so that 2-desmethyl-3-keto 6-dEB was also produced (McDaniel et al., 1999). In subsequent work, various putative catalytic residues in KR6 were mutated, not only achieving production of 3-keto 6-dEB as the sole analogue, but also identifying key residues in the active site of the KR domains (Reid et al., 2003). Deletion of the KR6 domain in the geldanamycin PKS gave production of the expected product with no affect on the other catalytic domains (Vetcher et al., 2005).
308
Christopher D. Reeves and Eduardo Rodriguez
5. Engineering when only a Single Crossover Event is Possible DNA can be introduced into some myxobacteria by conjugation from E. coli and if the plasmid carries homologous sequence it can integrate into the chromosome ( Jaoua et al., 1992; Kopp et al., 2004; Xia et al., 2008). On the other hand, it is very difficult to achieve domain replacements because a good counter selectable marker is not available and colonies are difficult to replicate. Despite this, some PKS engineering may be possible. For example, a construct was devised to change the AT specificity of the loading module of the ambruticin PKS of Sorangium cellulosum So ce10 by a single recombination event (Rodriguez, unpublished work). The first ambruticin PKS gene is relatively short, encoding only a loading module consisting of KS, AT and ACP domains ( Julien et al., 2006). Thus, a plasmid was constructed that carried a cassette composed of a heterologous promoter from the epothilone PKS, an N-terminally truncated KS from the ambruticin loading module, a malonyl-CoA specific AT from a different ambruticin module, and finally the loading module ACP (Fig. 13.6). Upon transfer of this plasmid into Sorangium by conjugation from E. coli, the construct could integrate into the chromosome by recombination with the KS, the AT or the ACP sequence. By screening a sufficient number of strains, one was found in which crossover had occurred at the KS PhR E. coli vector w oriT
P KSq Sorangium chromosome
P
KSq
ATm
P
ACP
KSq
ATm
ACP
ATmm
ACP
PhR
P KSq ATmm
ACP
Figure 13.6 PKS engineering in Sorangium cellulosum using a single crossover event. The first PKS gene for ambruticin biosynthesis is shown on the Sorangium chromosome with the promoter (white P) that drives expression of the entire set of PKS genes. This first PKS gene encodes a KSq, a methylmalonyl-CoA specific AT (ATmm) and an ACP for the loading module. A construct was built such that if crossing over occurred via the KSq as shown, a functional loading module gene would be created that had its AT replaced with one specific for malonyl-CoA (ATm). The heterologous promoter ( gray P) thus would drive expression of the remaining PKS genes, but the first gene would not be translated because of an N-terminal truncation. The desired crossover event was sufficiently frequent that desired strains were identified by screening the phleomycin resistant (PhR) exconjugants of Sorangium with a PCR assay.
Genetic Engineering to Produce Polyketide Analogues
309
sequence (Fig. 13.6) to give a strain in which the heterologous epo promoter drove transcription of the truncated loading module gene (which could not be translated into a functional protein) and the remaining downstream PKS genes, while the ambruticin promoter drove transcription of the engineered loading module gene carrying the malonyl-CoA-specific AT domain. As a result, the strain produced the ambruticin analogue predicted from the chromosomal engineering.
6. Heterologous Expression of Engineered PKS Genes If the original polyketide producing strain cannot be genetically manipulated, analogues may be obtained by expressing the engineered genes in a heterologous host. The use of a heterologous expression system also facilitates high-throughput PKS engineering, allowing many analogues to be produced in parallel. The first step is construction of cassettes to delete, insert or replace domains much as was described earlier for chromosomal engineering. In this case, however, the cassettes represent the first step in the construction of large plasmids designed for expression of the engineered PKS gene (Fig. 13.7). The remaining PKS genes, as well as genes for essential post-PKS reactions, or for synthesis of essential precursors, also must be expressed in the host to achieve production of an active analogue. The upstream and downstream sequences of the initial cassettes need not be the same length, but must have restriction sites at the ends that allow it to be inserted into the PKS gene and maintain the reading frame. The final expression constructs can be large and several methods are available to facilitate their construction. DNA encoding various sections of a PKS gene can be synthesized with desired codon usage and the required restriction sites. Cosmids can be used to increase the efficiency of introducing the large constructs into E. coli, although this requires that the construct be a size that can be packaged into the phage in vitro. The lRed/ET recombination system can be used to achieve insertion, deletion or replacement of domains directly in plasmids maintained in E. coli (Vetcher et al., 2005). Many different expression vectors are available, depending on the chosen host. The various PKS genes can be maintained on vectors that replicate autonomously or that integrate into the genome by homologous recombination or by site-specific integration. To keep the size of any one construct manageable, large PKS clusters can be expressed on separate vectors. Multiple plasmids have been used for combinatorial expression of engineered genes for the erythromycin PKS in Streptomyces coelicolor, generating a large library of 6-dEB analogues (Xue et al., 1999). Methods for the use of most actinomycete vectors are described in detail in Practical Streptomyces Genetics (Kieser et al., 2000) as well as in other chapters in this volume.
310
Christopher D. Reeves and Eduardo Rodriguez
Deleted sequence X
Y DS
US X
Y
or US
Heterologous sequence
X
DS
Y
Q
Z Engineered PKS gene Z
Q
Expression vector
Figure 13.7 Vector construction for heterologous expression of an engineered PKS gene. This diagram assumes that unique restriction enzyme sites (X, Y, Z, and Q) are conveniently located or can be introduced during stitching of the cassettes. The cassettes are made first (probably using PCR stitching by overlap extension) to join upstream (US) and downstream (DS) sequences to the heterologous sequence. Using sequential ligation reactions, the cassette is then built into the entire PKS gene and finally expressed in a chosen host.
E. coli has been used as a host to functionally express the full set of erythromycin biosynthetic genes from Saccharopolyspora erythraea (Peiru et al., 2005) and the full set of epothilone biosynthetic genes from S. cellulosum (Mutka et al., 2006). Although E. coli has the advantage of facile genetic manipulation, synthesis, and expression of large PKS genes is nevertheless quite challenging. Moreover, the level of polyketide production from E. coli has been relatively low, which limits the utility of an E. coli host for polyketide drug development. Production levels of polyketide analogues can be much higher when the host is phylogenetically close to the polyketide-producing strain. For example, several polyketides produced by various species of Streptomyces have been successfully made in host strains derived from S. coelicolor or S. lividans (Hu et al., 2005; McDaniel et al., 1999; Xue et al., 1999; Ziermann and Betlach, 1999). A strain of Streptomyces fradiae that produced almost 2 g/l of tylosin was found to be amenable to transformation by conjugation from E. coli DH5a
Genetic Engineering to Produce Polyketide Analogues
311
and was engineered for production of 16-membered macrolide analogues (see Chapter 15 of this volume). The tylosin PKS genes (tylGI-tylGV) in the strain were deleted by double homologous recombination leaving the tylGI promoter for expression of downstream post-PKS tailoring genes (Rodriguez et al., 2003). Integration of the tylosin PKS genes at the fC31 phage attachment site restored tylosin production. Some of the 16-membered macrolide PKS genes to be expressed encoded a module that used methoxymalonyl-ACP as a precursor. Therefore, a cassette to express a set of genes for biosynthesis of this precursor was integrated at the pSAM2 att site (Rodriguez et al., 2004). Integration of the midecamycin PKS genes from Streptomyces mycarofaciens under control of the tylGI promoter into this strain gave production of midecamycin. Such engineered S. fradiae host strains were used for combinatorial expression of different 16-membered macrolide PKS genes (Reeves et al., 2004), which gave results instructive for PKS engineering in general. All 16-membered macrolide PKSs are composed of five polypeptides and each polypeptide shares significant sequence similarity with the corresponding polypeptide of the other PKSs (Fig. 13.8). Differences between the macrolactone products of these PKSs arise from differences in substrate specificities of the AT domains and a missing KR domain for the chalcomycin PKS. Presumably these differences arose by relatively recent gene conversion events. The first two genes for the chalcomycin PKS and the last three from either the spiramycin or tylosin PKS were expressed in an S. fradiae clean host. The total titer of polyketides derived from these hybrid PKSs was almost equal on a molar basis to the titer of tylosin produced by the original strain. Thus modules appear to be very tolerant of different intermediates and the low titers of an analogue after PKS engineering is most likely due to perturbation of PKS structure. Despite the subtle differences in the structures of the natural and hybrid macrolactones, however, the P450 hydroxylase encoded by tylH in the S. fradiae host would not accept the chalcolactone-platenolide hybrid macrolide as a substrate. Furthermore, the P450 hydroxylase encoded by tylI converted the ethyl side chain of this hybrid to a carboxylate, instead of the usual aldehyde. To circumvent this obstacle, chmH, a tylH homolog from the chalcomycin gene cluster was integrated at the fBT1 att site and expressed via the tylGI promoter. This gave production of a novel and biologically active tylosin analogue derived by post-PKS tailoring of the chalcolactone-platenolide hybrid macrolide.
7. Chemobiosynthesis Chemobiosynthesis is a specific type of PKS engineering coupled with feeding of chemically synthesized precursors, which are used by the PKS and incorporated at the starter end of the polyketide chain. It has
KSq ATm
TylG
ACP
KSq
ChmG
AT ACP
KSq
SrmG
AT ACP
ATm KS
ATm KS
AT KS
ATm
KR ACP
ACP
KS
AT
KR ACP
KR
KS
AT
KR
DH
KS
O
ACP
ACP
KS
ACP
ATm
ATm ACP KS
DH
KS
DH KR AT ACP
O
DH
KS
DH KR KS AT ACP
DH KR
ATe
ATm ACP KS
DH KR
DH
KS
DH KR KS AT ACP
ATe
ATm ACP KS
ER KR ACP
KS KR ATm ACP
KS
KS KR ATm ACP
KS
KS KR ATx ACP
KS
KR AT
O
O
OH
KR ACP
AT
KR ACP
KR AT
O
OH
Tylactone
O
O
OH
O
O
OH O
Chalcolactone
ACP
TE
ER
O
OH
TE
ER
O
ACP
TE
O
O O
ACP
O
OH OH
O
O OH OH
Platenolide
Figure 13.8 Expressing combinations of different 16-membered macrolide PKS genes in a heterologous host. The five PKS polypeptides encoded by tylGI-V of S. fradiae, chmGI-V of S. bikiniensis and srmGI-V of S. ambofaciens are shown schematically with the differences in domains between them highlighted in black. The three natural macrolactone products, tylactone, chalcolactone and platenolide lead, respectively, to tylosin, chalcomycin, and spiramycin in the respective strains are shown below the PKS polypeptides. The chalcolactonetylactone and chalcolactone-platenolide hybrids formed by the first two chalcomycin PKS genes and the last three PKS genes for tylosin or spiramycin, respectively, are shown between the natural macrolactone structures.
Genetic Engineering to Produce Polyketide Analogues
313
been quite successful for the erythromycin PKS ( Jacobsen et al., 1997; Ward et al., 2007) and for a 16-membered macrolide PKS (Kinoshita et al., 2001). It was also used to obtain production of epothilone C from E. coli (Boddy et al., 2004). The first module of a PKS assembly line captures a starter unit and loads it onto the KS of the first extender module. These loading modules use a variety of mechanisms. Many are minimal PKS modules with a KS domain in which the active site cysteine is replaced by another residue, often a glutamine (a so-called KSQ domain). The AT domain of this type of loading module transfers a carboxyacyl extender unit onto the phosphopantetheine arm and the KS domain catalyzes its decarboxylation, generating the starter unit to be passed downstream. The erythromycin PKS and some others have a loading module with no KS and the AT is specific for propionyl-CoA (or some other acyl-CoA). Yet another type of loading module is an adenylation-thiolation didomain, which can pick up a free carboxylic acid using ATP to adenylate the carboxylate before transferring it to the phosphopantetheine arm, as is seen for the rapamycin PKS (Goss et al., 2006). The chemobiosynthesis strategy involves the following steps: 1. The loading module or, more typically, the first extender module of the PKS is rendered nonfunctional by introducing null mutations in the KS active site, or by deleting the N-terminus of the PKS up to the beginning of the KS of the second extender module. 2. Synthetic acyl-thioester precursors (e.g., diketide thioesters of N-acetylcysteamine) are fed to the resulting mutant strain. 3. If the KS domain of the first or second extender module will accept the synthetic thioesters as polyketide intermediates, analogues are produced that have incorporated the synthetic structure.
8. Mutasynthesis Mutasynthesis is a potential strategy for generating analogues when the PKS assembly line incorporates an atypical precursor and the biosynthesis of that precursor can be blocked through gene disruption. The strategy involves the following steps: 1. The biosynthetic pathway to the precursor is deleted by introducing null mutations into one or more of the genes encoding enzymes in that pathway. Such mutations can be introduced by classical mutagenesis, though it is more common to delete genes by double homologous recombination using methods similar to those described earlier for AT replacement. The resulting strain should no longer produce the polyketide product.
314
Christopher D. Reeves and Eduardo Rodriguez
2. For the strategy to work, it must be possible to restore polyketide production by adding the precursor to the culture. This shows that the precursor can be taken up by the cell, is not degraded, and is a substrate for the PKS assembly line. 3. If step 2 is successful, then chemically synthesized precursor analogues can be fed to the mutant strain, some of which may be taken up and incorporated to give corresponding polyketide analogues. The range of precursor analogues that can be accepted as substrates and incorporated varies for different PKS assembly lines. A successful example of this strategy was the production of nonquinone ansamycin analogues of geldanamycin by engineering a strain of Streptomyces hygroscopicus (Kim et al., 2007). The first KS domain of the geldanamycin PKS is primed with the starter unit 3-amino-5-hydroxybenzoic acid (AHBA), which requires a special pathway for its synthesis. When genes encoding enzymes of this pathway were disrupted, geldanamycin production was abolished unless the strain was fed AHBA. The feeding of several AHBA analogues to this mutant gave production of corresponding nonquinone geldanamycins. Several other examples of mutasynthesis have been reviewed (Weissman, 2007).
9. Gene Knockouts to Obtain Analogues It is not always necessary to engineer the PKS in order to obtain useful polyketide analogues. Inactivation of genes for discrete enzymes in a polyketide pathway often gives analogues. In the case of the complex PKS assembly line for ambruticin biosynthesis in S. cellulosum, this not only gave analogues, but also provided insight into ambruticin biosynthesis ( Julien et al., 2006). The procedure resembles that described for AT replacements earlier, but is much simpler. 1. A region of a gene to be knocked out is amplified by PCR. The region should be just downstream of the start codon and about 40% upstream of the distance to the stop codon. The primers should introduce an inframe stop codon at both ends of the PCR product to ensure that upon integration neither copy will be functional. 2. The PCR products are cloned into a pUC19-derived plasmid that contains a marker for selection in the polyketide producing strain (a bleomycin resistance gene is usually best for myxobacteria, while genes for resistance to thiostrepton, kanamycin, or hygromycin can be used with many actinomycetes) and the R6K oriT sequence, if the plasmid will be delivered by conjugation.
Genetic Engineering to Produce Polyketide Analogues
315
3. The resulting plasmid is introduced by conjugation or transformation and colonies resistant to the marker antibiotic are selected. These colonies usually represent the desired gene disruption, but should be verified by colony PCR. Some of the S. cellulosum So ce10 strains carrying disruptions generated by the above procedure produced novel ambruticin analogues that had bioactivity. One of the genes, ambM, encoded a discrete C-methyltransferase that acted in concert with a specific module in the assembly line as part of an unusual PKS reaction sequence. Knockout of this gene gave an analogue missing a C-methyl group known to be derived from the methyl carbon of methionine ( Julien et al., 2006).
REFERENCES Bedford, D., Jacobsen, J. R., Luo, G., and Khosla, C. (1996). A functional chimeric modular polyketide synthase generated via domain replacement. Chem. Biol. 3, 827–831. Boddy, C. N., Hotta, K., Tse, M. L., Watts, R. E., and Khosla, C. (2004). Precursordirected biosynthesis of epothilone in Escherichia coli. J. Am. Chem. Soc. 126, 7436–7437. Chandran, S. S., Menzella, H. G., Carney, J. R., and Santi, D. (2006). Activating hybrid modular interfaces in synthetic polyketide synthases by cassette replacement of ketosynthase domains. Chem. Biol. 13, 469–474. Cortes, J., Wiesmann, K. E., Roberts, G. A., Brown, M. J., Staunton, J, and Leadlay, P. F. (1995). Repositioning of a domain in a modular polyketide synthase to promote specific chain cleavage. Science 268, 1487–1489. Donadio, S., and Katz, L. (1992). Organization of the enzymatic domains in the multifunctional polyketide synthase involved in erythromycin formation in Saccharopolyspora erythraea. Gene 111, 51–60. Donadio, S., McAlpine, J. B., Sheldon, P. J., Jackson, M., and Katz, L. (1993). An erythromycin analog produced by reprogramming of polyketide synthesis. Proc. Natl. Acad. Sci. USA 90, 7119–7123. Donadio, S., Staver, M. J., McAlpine, J. B., Swanson, S. J., and Katz, L. (1991). Modular organization of genes required for complex polyketide biosynthesis. Science 252, 675–679. Donadio, S., Staver, M. J., McAlpine, J. B., Swanson, S. J., and Katz, L. (1992). Biosynthesis of the erythromycin macrolactone and a rational approach for producing hybrid macrolides. Gene 115, 97–103. Fischbach, M. A., and Walsh, C. T. (2006). Assembly-line enzymology for polyketide and nonribosomal peptide antibiotics: Logic, machinery, and mechanisms. Chem. Rev. 106, 3468–3496. Goss, R. J., Lanceron, S. E., Wise, N. J., and Moss, S. J. (2006). Generating rapamycin analogues by directed biosynthesis: Starter acid substrate specificity of mono-substituted cyclohexane carboxylic acids. Org. Biomol. Chem. 4, 4071–4073. Haydock, S. F., Aparicio, J. F., Molnar, I., Schwecke, T., Khaw, L. E., Ko¨nig, A., Marsden, A. F., Galloway, I. S., Staunton, J., and Leadlay, P. F. (1995). Divergent sequence motifs correlated with the substrate specificity of (methyl)malonyl-CoA:acyl carrier protein transacylase domains in modular polyketide synthases. FEBS Lett. 374, 246–248.
316
Christopher D. Reeves and Eduardo Rodriguez
Heckman, K. L., and Pease, L. R. (2007). Gene splicing and mutagenesis by PCR-driven overlap extension. Nat. Protoc. 2, 924–932. Horton, R. M., Ho, S. N., Pullen, J. K., Hunt, H. D., Cai, Z., and Pease, L. R. (1993). Gene splicing by overlap extension. Methods Enzymol. 217, 270–279. Hu, Z., Reid, R., and Gramajo, H. (2005). The leptomycin gene cluster and its heterologous expression in Streptomyces lividans. J. Antibiot. (Tokyo) 58, 625–633. Jacobsen, J. R., Hutchinson, C. R., Cane, D. E., and Khosla, C. (1997). Precursor-directed biosynthesis of erythromycin analogs by an engineered polyketide synthase. Science 277, 367–369. Jaoua, S., Neff, S., and Schupp, T. (1992). Transfer of mobilizable plasmids to Sorangium cellulosum and evidence for their integration into the chromosome. Plasmid 28, 157–165. Julien, B., Tian, Z. Q., Reid, R., and Reeves, C. D. (2006). Analysis of the ambruticin and jerangolid gene clusters of Sorangium cellulosum reveals unusual mechanisms of polyketide biosynthesis. Chem. Biol. 13, 1277–1286. Kato, Y., Bai, L., Xue, Q., Revill, W. P., Yu, T. W., and Floss, H. G. (2002). Functional expression of genes involved in the biosynthesis of the novel polyketide chain extension unit, methoxymalonyl-acyl carrier protein, and engineered biosynthesis of 2-desmethyl2-methoxy-6-deoxyerythronolide B. J. Am. Chem. Soc. 124, 5268–5269. Katz, L., and Donadio, S. (1993). Polyketide synthesis: Prospects for hybrid antibiotics. Annu. Rev. Microbiol. 47, 875–912. Keatinge-Clay, A. (2008). Crystal structure of the erythromycin polyketide synthase dehydratase. J. Mol. Biol. 384, 941–953. Keatinge-Clay, A. T. (2007). A tylosin ketoreductase reveals how chirality is determined in polyketides. Chem. Biol. 14, 898–908. Keatinge-Clay, A. T., and Stroud, R. M. (2006). The structure of a ketoreductase determines the organization of the beta-carbon processing enzymes of modular polyketide synthases. Structure 14, 737–748. Khosla, C., Tang, Y., Chen, A. Y., Schnarr, N. A., and Cane, D. E. (2007). Structure and mechanism of the 6-deoxyerythronolide B synthase. Annu. Rev. Biochem. 76, 195–221. Kieser, T., Bibb, M. J., Buttner, M. J., Chater, K. F., and Hopwood, D. A. (2000). ‘‘Practical Streptomyces Genetics.’’ John Innes Foundation, Norwich, UK. Kim, W., Lee, J. S., Lee, D., Cai, X. F., Shin, J. C., Lee, K., Lee, C. H., Ryu, S., Paik, S. G., Lee, J. J., and Hong, Y. S. (2007). Mutasynthesis of geldanamycin by the disruption of a gene producing starter unit: Generation of structural diversity at the benzoquinone ring. Chembiochem 8, 1491–1494. Kinoshita, K., Williard, P. G., Khosla, C., and Cane, D. E. (2001). Precursor-directed biosynthesis of 16-membered macrolides by the erythromycin polyketide synthase. J. Am. Chem. Soc. 123, 2495–2502. Kopp, M., Irschik, H., Gross, F., Perlova, O., Sandmann, A., Gerth, K., and Mu¨ller, R. (2004). Critical variations of conjugational DNA transfer into secondary metabolite multiproducing Sorangium cellulosum strains So ce12 and So ce56: Development of a mariner-based transposon mutagenesis system. J. Biotechnol. 107, 29–40. Kumar, P., Khosla, C., and Tang, Y. (2004). Manipulation and analysis of polyketide synthases. Methods Enzymol. 388, 269–293. Maier, T., Leibundgut, M., and Ban, N. (2008). The crystal structure of a mammalian fatty acid synthase. Science 321, 1315–1322. McDaniel, R., Kao, C. M., Hwang, S. J., and Khosla, C. (1997). Engineered intermodular and intramodular polyketide synthase fusions. Chem. Biol. 4, 667–674. McDaniel, R., Thamchaipenet, A., Gustafsson, C., Fu, H., Betlach, M., and Ashley, G. (1999). Multiple genetic modifications of the erythromycin polyketide synthase to produce a library of novel "unnatural" natural products. Proc. Natl. Acad. Sci. USA 96, 1846–1851.
Genetic Engineering to Produce Polyketide Analogues
317
Menzella, H. G., Reid, R., Carney, J. R., Chandran, S. S., Reisinger, S. J., Patel, K. G., Hopwood, D. A., and Santi, D. V. (2005). Combinatorial polyketide biosynthesis by de novo design and rearrangement of modular polyketide synthase genes. Nat. Biotechnol. 23, 1171–1176. Moss, S. J., Martin, C. J., and Wilkinson, B. (2004). Loss of co-linearity by modular polyketide synthases: A mechanism for the evolution of chemical diversity. Nat. Prod. Rep. 21, 575–593. Mutka, S. C., Carney, J. R., Liu, Y., and Kennedy, J. (2006). Heterologous production of epothilone C and D in Escherichia coli. Biochemistry 45, 1321–1330. Oliynyk, M., Brown, M. J., Cortes, J., Staunton, J., and Leadlay, P. F. (1996). A hybrid modular polyketide synthase obtained by domain swapping. Chem. Biol. 3, 833–839. Patel, K., Piagentini, M., Rascher, A., Tian, Z. Q., Buchanan, G. O., Regentin, R., Hu, Z., Hutchinson, C. R., and McDaniel, R. (2004). Engineered biosynthesis of geldanamycin analogs for Hsp90 inhibition. Chem. Biol. 11, 1625–1633. Peiru, S., Menzella, H. G., Rodriguez, E., Carney, J., and Gramajo, H. (2005). Production of the potent antibacterial polyketide erythromycin C in Escherichia coli. Appl. Environ. Microbiol. 71, 2539–2547. Petkovic, H., Lill, R. E., Sheridan, R. M., Wilkinson, B., McCormick, E. L., McArthur, H. A., Staunton, J., Leadlay, P. F., and Kendrew, S. G. (2003). A novel erythromycin, 6-desmethyl erythromycin D, made by substituting an acyltransferase domain of the erythromycin polyketide synthase. J. Antibiot. (Tokyo) 56, 543–551. Reeves, C. D., Chung, L. M., Liu, Y., Xue, Q., Carney, J. R., Revill, W. P., and Katz, L. (2002). A new substrate specificity for acyl transferase domains of the ascomycin polyketide synthase in Streptomyces hygroscopicus. J. Biol. Chem. 277, 9155–9159. Reeves, C. D., Murli, S., Ashley, G. W., Piagentini, M., Hutchinson, C. R., and McDaniel, R. (2001). Alteration of the substrate specificity of a modular polyketide synthase acyltransferase domain through site-specific mutations. Biochemistry 40, 15464–15470. Reeves, C. D., Ward, S. L., Revill, W. P., Suzuki, H., Marcus, M., Petrakovsky, O. V., Marquez, S., Fu, H., Dong, S. D., and Katz, L. (2004). Production of hybrid 16membered macrolides by expressing combinations of polyketide synthase genes in engineered Streptomyces fradiae hosts. Chem. Biol. 11, 1465–1472. Reid, R., Piagentini, M., Rodriguez, E., Ashley, G., Viswanathan, N., Carney, J., Santi, D. V., Hutchinson, C. R., and McDaniel, R. (2003). A model of structure and catalysis for ketoreductase domains in modular polyketide synthases. Biochemistry 42, 72–79. Revill, W. P., Voda, J., Reeves, C. R., Chung, L., Schirmer, A., Ashley, G., Carney, J. R., Fardis, M., Carreras, C. W., Zhou, Y., Feng, L., Tucker, E., et al. (2002). Genetically engineered analogs of ascomycin for nerve regeneration. J. Pharmacol. Exp. Ther. 302, 1278–1285. Rodriguez, E., Hu, Z., Ou, S., Volchegursky, Y., Hutchinson, C. R., and McDaniel, R. (2003). Rapid engineering of polyketide overproduction by gene transfer to industrially optimized strains. J. Ind. Microbiol. Biotechnol. 30, 480–488. Rodriguez, E., Ward, S., Fu, H., Revill, W. P., McDaniel, R., and Katz, L. (2004). Engineered biosynthesis of 16-membered macrolides that require methoxymalonylACP precursors in Streptomyces fradiae. Appl. Microbiol. Biotechnol. 66, 85–91. Ruan, X., Pereda, A., Stassi, D. L., Zeidner, D., Summers, R. G., Jackson, M., Shivakumar, A., Kakavas, S., Staver, M. J., Donadio, S., and Katz, L. (1997). Acyltransferase domain substitutions in erythromycin polyketide synthase yield novel erythromycin derivatives. J. Bacteriol. 179, 6416–6425. Smith, S., and Tsai, S. C. (2007). The type I fatty acid and polyketide synthases: A tale of two megasynthases. Nat. Prod. Rep. 24, 1041–1072.
318
Christopher D. Reeves and Eduardo Rodriguez
Stassi, D. L., Kakavas, S. J., Reynolds, K. A., Gunawardana, G., Swanson, S., Zeidner, D., Jackson, M., Liu, H., Buko, A., and Katz, L. (1998). Ethyl-substituted erythromycin derivatives produced by directed metabolic engineering. Proc. Natl. Acad. Sci. USA 95, 7305–7309. Tang, L., Chung, L., Carney, J. R., Starks, C. M., Licari, P., and Katz, L. (2005). Generation of new epothilones by genetic engineering of a polyketide synthase in Myxococcus xanthus. J. Antibiot. (Tokyo) 58, 178–184. Tang, L., Ward, S., Chung, L., Carney, J. R., Li, Y., Reid, R., and Katz, L. (2004). Elucidating the mechanism of cis double bond formation in epothilone biosynthesis. J. Am. Chem. Soc. 126, 46–47. Tang, Y., Chen, A. Y., Kim, C. Y., Cane, D. E., and Khosla, C. (2007). Structural and mechanistic analysis of protein interactions in module 3 of the 6-deoxyerythronolide B synthase. Chem. Biol. 14, 931–943. Tang, Y., Kim, C. Y., Mathews, II, Cane, D. E., and Khosla, C. (2006). The 2.7-Angstrom crystal structure of a 194-kDa homodimeric fragment of the 6-deoxyerythronolide B synthase. Proc. Natl. Acad. Sci. USA 103, 11124–11129. Van Lanen, S. G., and Shen, B. (2008). Advances in polyketide synthase structure and function. Curr. Opin. Drug Discov. Devel. 11, 186–195. Vetcher, L., Tian, Z. Q., McDaniel, R., Rascher, A., Revill, W. P., Hutchinson, C. R., and Hu, Z. (2005). Rapid engineering of the geldanamycin biosynthesis pathway by Red/ET recombination and gene complementation. Appl. Environ. Microbiol. 71, 1829–1835. Walsh, C. T. (2008). The chemical versatility of natural-product assembly lines. Acc. Chem. Res. 41, 4–10. Ward, S. L., Desai, R. P., Hu, Z., Gramajo, H., and Katz, L. (2007). Precursor-directed biosynthesis of 6-deoxyerythronolide B analogues is improved by removal of the initial catalytic sites of the polyketide synthase. J. Ind. Microbiol. Biotechnol. 34, 9–15. Weissman, K. J. (2007). Mutasynthesis - uniting chemistry and genetics for drug discovery. Trends Biotechnol. 25, 139–142. Weissman, K. J., and Leadlay, P. F. (2005). Combinatorial biosynthesis of reduced polyketides. Nat. Rev. Microbiol. 3, 925–936. Weissman, K. J., and Muller, R. (2008). Protein-protein interactions in multienzyme megasynthetases. Chembiochem 9, 826–848. Xia, Z. J., Wang, J., Hu, W., Liu, H., Gao, X. Z., Wu, Z. H., Zhang, P. Y., and Li, Y. Z. (2008). Improving conjugation efficacy of Sorangium cellulosum by the addition of dual selection antibiotics. J. Ind. Microbiol. Biotechnol. 35, 1157–1163. Xue, Q., Ashley, G., Hutchinson, C. R., and Santi, D. V. (1999). A multiplasmid approach to preparing large libraries of polyketides. Proc. Natl. Acad. Sci. USA 96, 11740–11745. Ziermann, R., and Betlach, M. C. (1999). Recombinant polyketide synthesis in Streptomyces: engineering of improved host strains. Biotechniques 26, 106–110.
C H A P T E R
F O U R T E E N
Design and Synthesis of Pathway Genes for Polyketide Biosynthesis Salvador Peiru´, Hugo Gramajo, and Hugo G. Menzella Contents 1. Introduction 2. Redesign of PKS Genes to Accommodate Unique Restriction Sites Flanking Individual Components and for Efficient Expression in E. coli 3. Validation of Synthetic PKS Gene Design 4. A Rapid Assay to Identify Productive Combinations of PKS Modules 5. Assembly of Larger Polyketide Synthases Using Information Gained with the Bimodular Assay 6. Design and Construction of Synthetic Operons for the Expression of Sugar Pathway Genes References
320
322 324 327 330 332 335
Abstract In this chapter we describe novel methods for the design and assembly of synthetic pathways for the synthesis of polyketides and tailoring sugars. First, a generic design for type I polyketide synthase genes is presented that allows their facile assembly for the expression of chimeric enzymes in an engineered Escherichia coli host. The sequences of the synthetic genes are based on naturally occurring polyketide synthase genes but they are redesigned by custom-made software to optimize codon usage to maximize expression in E. coli and to provide a standard set of restriction sites to allow combinatorial assembly into unnatural enzymes. The methodology has been validated by building a large number of bimodular mini-PKSs that make easily assayed triketide products. Learning from the successful bimodules, a conceptual advance was made by assembling genes encoding functional trimodular enzymes, capable of making tetraketide products. Second, methods for the rapid assembly and exchange of sugar pathway genes into functional operons
Instituto de Biologı´a Molecular y Celular de Rosario (CONICET), Facultad de Ciencias Bioquı´micas y Farmace´uticas, Universidad Nacional de Rosario, Rosario, Argentina Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04614-X
#
2009 Elsevier Inc. All rights reserved.
319
320
Salvador Peiru´ et al.
are described. The approach was validated by the assembly of the 15 genes for the synthesis of mycarose and desosamine in two operons, which yielded erythromycin C when coexpressed with the corresponding PKS genes. These methods are important enabling steps toward the goals of making designer drugs by polyketide synthase and sugar pathway engineering and, in the shorter term, producing by fermentation advanced intermediates for the synthesis of compounds that otherwise require large numbers of chemical steps.
1. Introduction Type I polyketide synthases (PKSs) that determine the biosynthesis of valuable natural products like erythromycin, epothilone, tacrolimus and many others consist of multiple catalytic domains forming a protein ‘‘assembly line.’’ The domains are associated in modules that determine the structure of a 2-carbon extender unit of the polyketide chain. Thus, the sequence of domains in the assembly line, directly reflecting the DNA sequence of the corresponding genes, determines the structure of the polyketide product. This simple logic led to genetic engineering of PKSs to make ‘‘unnatural natural products’’ (Walsh, 2003, 2004; Weissman and Leadlay, 2005) as shown in the early 1990s by research groups at Stanford and Cambridge (Cortez et al., 1995; Kao et al., 1994). They demonstrated that domains and modules could be reorganized to create novel enzymes capable of making a variety of unnatural compounds. The initial approaches in the field of genetic engineering of polyketides included adding, deleting or interchanging domains or whole modules in a PKS aimed to alter the number and structure of the 2-C units built into a polyketide. Whereas these might appear simple tasks for current genetic engineering technologies, they are encumbered by difficulties, and PKS engineering is far from being established in the high-throughput format required to provide the necessary flow of unnatural compounds in order to obtain ‘‘hits’’ with new biological properties. One problem is that most natural polyketide producers are not readily amenable to a complete range of genetic methodologies without considerable time-consuming effort. Most of them are slow-growing compared with commonly used laboratory strains, often requiring more than a month for a round of genetic manipulation, and many target organisms are so far uncultured. Therefore, there is a need for a ‘‘universal host’’ in which PKS components from different sources can be expressed and where combinatorial experiments can be performed rapidly and ideally in a high-throughput fashion (Pfeifer and Khosla, 2001).
Design and Synthesis of Pathway Genes for Polyketide Biosynthesis
321
A second problem is that natural PKS gene clusters are extraordinarily long (up to 200 kb), usually with a high GþC content and with highly repetitive coding sequences for successive modules. Rarely are there conserved restriction sites to facilitate domain or module exchange. Thus, there is a need for molecular biological tools to accelerate the assembly of chimeric PKS genes in order to find productive combinations. Expressing PKS genes in a more tractable host can circumvent some of these difficulties. Recently, Escherichia coli has been successfully engineered to produce polyketides (Murli et al., 2003; Pfeifer and Khosla, 2001). Since its genetic manipulation is so straightforward, it was chosen as a host for developing new methods for combinatorial biosynthesis of polyketides in the work described here. To avoid the problems of manipulating natural PKS genes, a first step was to develop a technology for facile synthesis of error-free 5 kb sequences of DNA—the average for complete PKS modules (Kodumal et al., 2004; Reisinger et al., 2006). Next, a generic design of PKS modules was created with unique restriction sites flanking their components to allow exchange as building blocks in an approach that has been dubbed ‘‘Legoization’’ (Menzella et al., 2005; Sherman, 2005). Finally, methods were developed to rapidly assemble and express simple chimeric PKSs and to screen for their activity in order to identify productive combinations to be used in the construction of larger, designer enzymes (Menzella et al., 2005; Menzella and Reeves, 2007). Another important aspect to be considered during polyketide engineering is that, in order to be fully active, many of these molecules require the attachment of sugar moieties on their core structure. The presence of these sugars, as well as other post-PKS modifications, is often essential to impart or enhance the biological activity of the molecule. Thus, heterologous expression of PKSs also requires the incorporation of complete glycosylation pathways into the host, to achieve the synthesis of a fully decorated molecule. The possibility of altering the glycosylation pattern of polyketides through genetic engineering is another promising tool for diversification of these compounds. Sugar biosynthesis genes are normally located within the polyketide gene cluster (Peiru´ et al., 2005). The heterologous expression of these sugar pathways typically requires the cloning of individual genes and their assembly into operons in order to have a controlled expression system under inducible promoters. As with PKS modules, several issues need to be considered for the construction of sugar operons. Here we describe practical experience with these genetic engineering tools. The ultimate goal is to produce complex molecules by creating multidomain PKSs combined with sugar tailoring genes to be used directly as drugs or as lead compounds for chemical optimization. Meanwhile, at a more modest level, even the combination of a few PKS modules can
322
Salvador Peiru´ et al.
produce molecules with multiple chiral centers (up to two per module) that are difficult to obtain by ordinary chemical synthesis (McDaniel et al., 2005). The production of such molecules made by fermentation to be used as intermediates for the synthesis of complex structures can avoid large numbers of chemical steps and significantly reduce manufacturing costs. Therefore, engineering synthetic polyketide synthases is a promising strategy to produce novel molecules for multiple applications.
2. Redesign of PKS Genes to Accommodate Unique Restriction Sites Flanking Individual Components and for Efficient Expression in E. coli The strategy involves the synthesis of redesigned genes containing a set of standard unique restriction sites at the borders of each PKS component, including domains, linkers and modules, to allow their facile interchange. To allocate these restriction sites, sequence conservation at domain edges was analyzed (Fig. 14.1) by aligning the amino acid sequences of more than 300 PKS modules. When the identified conserved sequences were reversetranslated to all possible DNA sequences, a conserved six-base-pair restriction site could be found in some cases. In modules where that sequence was not present, amino acids were changed to a sequence resembling one present in at least some PKSs or which was already known, from prior experimental evidence, not to disturb functionality. For the ketosynthase (KS) domain, an MfeI site was incorporated near the 50 edge by using bases 2 to 7 of nine bases coding for the amino acid sequence PIA at the beginning of this domain. Of the KS domains analyzed, 70% needed no change in amino acid sequence, and 30% required only conservative changes from V, L, or M. On the 30 edge of all KSs, the conserved GT can be encoded by the sequence for a KpnI site. At the 30 side of the acyl transferase (AT) domain, a PstI site was placed where PstI and XhoI have been used successfully by others (McDaniel et al., 1999; Oliynyk et al., 1996). A highly conserved sequence occurs in 90% of the modules as R-Y/F-W. The codons specifying the two amino acids C-terminal to the W of this motif were modified to introduce the PstI site coding for LQ. The dipeptide at this position is variable in the native sequence. However, in more than half the cases the first amino acid is L, and in 80% of these the second is hydrophilic or even charged. Thus, the LQ dipeptide was likely to be well tolerated. No constant sites were found allowing independent exchange of the reductive domains ketoreductase (KR), dehydratase (DH), enoyl reductase (ER). For modules containing a KR domain, an AgeI site could be
323
Design and Synthesis of Pathway Genes for Polyketide Biosynthesis
–54
5
Spe I eryM1 eryM2 eryM6 sorM6 epoM7 eryM5 gelM3 lepM10 rifM5 rapM2 epoM3 eryM3 rapM3 pikM6 Design
Mfe I PVA P I A P I A P I A P I A P I A P P P P P P P P P
1243 KS
LI
VA I A I A LA I A I A LA MA I A
2611 AT
Kpn I GT GT GT GT GT GT GT GT GT GT GT GT GT GT GT
Pst I RV W LE RF W LL RYW LA RF W LD RC W IE RYW LP HYW LT RF W LE HF W LS RYW LE RYW IE RYW LQ RY W LR S YW I S LQ
5029 DH
ER
6001 KR
Age I TG TG TG TG TG TG TG TG TG TG TG TG TG ∗∗ TG
ACP
XbaI/SpeI L A AE L G G L D AW L I G QQ I L R DS L L L TDV Y L ERL I R TEL I D GE L
G D A L V G F
T S H K G H A
L R DE L G G L G EL I F T L L S QA L E L R AR L V G L - DE L F T I S DE L A E SS
Figure 14.1 Conserved amino acid sequences at domain borders and the chosen design to generate the desired restriction sites for domain assembly. Restriction site positions are referenced to module 4 of DEBS. Numbering begins at the first residue of the motif EPIAIVon the N-terminal edge of the KS domain. Sequence homologues for 14 of the 140 modules used for the generic module design are shown. eryM3 and rapM3 contain an inactive KR domain. ery, erythromycin; sor, soraphen; epo, epothilone; gel, geldanamycin; lep, leptomycin; rif, rifamycin; rap, rapamycin; pik, pikromycin. (From Menzella et al., 2005. Reproduced with permission from Nature Journals.)
incorporated at its 50 edge to encode the TG dipeptide found in 132 of 137 native KR domains analyzed, while in the remaining five this domain was predicted to be inactive. When required, DH/ER pairs could be added, deleted, or exchanged using the PstI and AgeI sites. Finally, since the 50 boundary of the acyl carrier protein (ACP) domain is poorly defined, no unique restriction site could be placed there, so domain exchange required the use of an upstream unique site. Except for the minimal module containing only AT, KS, and ACP, this required comobilization of the reductive domains. At the 30 end of the module, an XbaI site was incorporated at a well-defined position next to the carboxy side of the ACP. There are two conserved L residues at positions 36 and 40 downstream of the active site serine of ACPs. The codons of the two amino acids at positions 41 and 42 were changed to the XbaI sequence coding for SS, already known not to affect functionality (Gokhale et al., 1999). To facilitate gene expression in E. coli, all the PKS genes were codonoptimized. For the gene design, a software package called GeMS ( Jayaraj et al., 2005) was developed, comprising a set of programs to predict restriction sites, perform codon optimization for expression in any host, assign or
324
Salvador Peiru´ et al.
eliminate restriction sites, separate long sequences into smaller fragments to facilitate synthesis, carry out Tm and stem-loop determinations, and design oligonucleotides to be used as raw material. GeMS accepts DNA or protein sequences and its output is a complete design report with a list of oligonucleotides to be used in the gene synthesis process. Using GeMS a complete collection of PKS components was designed and later synthesized, including 50 extender modules, 5 loading modules, 5 thioesterases, 30 intrapeptide linkers, and 20 pairs of docking domains, totaling 400 kb of synthetic DNA. All the building blocks contain the standard set of restriction sites to facilitate the assembly of hybrid PKSs. For codon optimization, a codon table was used representing the E. coli genome. For each amino acid in the target protein, the software randomly selects a codon in accordance with its distribution in the table. The optimized genes thus contain codons in the same proportion as in E. coli. Although all the gene design work described here was made using GeMS, many other free webbased programs like, for example, Gene Designer (http://www.dna20.com/ tools/genedesigner) and Optimizer (http://genomes.urv.es/OPTIMIZER) may serve well for this purpose.
3. Validation of Synthetic PKS Gene Design In the first attempt to validate the generic PKS gene design, the 31-kb gene cluster encoding the 6-deoxyerythronolide B (6dEB) synthase (DEBS) was assembled and expressed in an E. coli strain engineered for polyketide production (Menzella et al., 2006). In the redesigned cluster the total set of 15 restriction sites were accommodated flanking the individual domains (Fig. 14.1). For this, 20 amino acid substitutions were required to insert some of the MfeI and PstI sites and all of the SpeI/XbaI fusions. The PIA tripeptide needed for the MfeI site is naturally present in five of the six DEBS modules, and module 1 (Mod1) has a conserved PVA. The LQ dipeptide required for the PstI site is found naturally only in DEBS Mod3; four modules have L followed by E (Mod1), L (Mod2), P (Mod5) or A (Mod6), and Mod4 has an unusual PR sequence found in only 2% of PKS modules. The SpeI/ XbaI fusion used to connect all redesigned modules results in an SS dipeptide that is unnatural to all modules. Overall, in the final redesigned DEBS, 13 of the 20 amino acid changes accommodated the SpeI/XbaI junction, one accommodated the MfeI site of Mod1 and six accommodated the PstI sites in Mod 1, 2, 4, 5, and 6. For the rapid assembly of building blocks to create chimeric open reading frames a suitable method is described below. In the described gene design, NdeI and XbaI sites flank the coding region of the N-terminal PKS components (LM and docking domains); the coding regions of internal modules are flanked by SpeI and XbaI sites;
Design and Synthesis of Pathway Genes for Polyketide Biosynthesis
325
and the coding region of C-terminal components (docking domains and TE) are flanked by SpeI and EcoRI sites. All the PKS components were synthesized and cloned into pUC-based vectors containing an additional NotI site upstream of the coding region. 1. Create a multicopy vector with a polylinker containing NdeI-NotISpeI-EcoRI sites. 2. Initiate the assembly by inserting the C-terminal component of the ORF into the SpeI-EcoRI sites of the vector. 3. Clone the internal components sequentially as NcoI-XbaI fragments into the NcoI-SpeI sites of the vector. This SpeI/XbaI ligation destroys both sites, allowing the repetitive use of these enzymes to insert as many components as required. 4. Finally, clone the N-terminal component as an NdeI-XbaI fragment into the NdeI-SpeI sites to complete the assembly of the ORFs, which can be mobilized as NdeI-EcoRI fragments into expression vectors or used to assemble operons. To determine whether these amino acid changes introduced to accommodate the standard set of restriction sites affected function of the enzymes, protein expression levels of the three synthetic DEBS ORFs as well as 6dEB production were compared with those of the native sequences using the following method: 1. Introduce expression vectors for synthetic PKSs by co-transformation into E. coli K207-3[BL21△prpBCD::T7prom prpE, T7prom accA1pccB, T7prom sfp]. This strain is a derivative of BL21(DE3) with the propionate utilization operon (prpRBCD) and the methylmalonyl-CoA decarboxylase gene (ygfG) deleted and with chromosomal copies of sfp (phosphopantetheine transferase from Bacillus subtilis), prpE (endogenous propionyl-CoA ligase), and accA1/pccB (propionyl-CoA carboxylase from Streptomyces coelicolor) under the control of T7 promoters (Murli et al., 2003). Feeding propionate to this strain results in the accumulation of methylmalonyl-CoA, a polyketide synthase substrate produced by wildtype E. coli at very low levels. 2. Grow the resulting colonies in 3 ml LB containing appropriate antibiotics for selection at 37 to an OD600 ¼ 0.5. 3. Induce with IPTG (0.5 mM), and a mixture of sodium glutamate (50 mM), sodium succinate (50 mM), and sodium propionate (5 mM). 4. Incubate the induced cultures at 22 for 72 h with agitation. 5. Centrifuge 10 min at 10,000 g; remove the supernatant for polyketide analysis and cell pellet for protein expression analysis. 6. Extract cell-free supernatants (1 ml) twice with an equal volume of ethyl acetate. Dry the extracts in vacuo and dissolve in 1 ml of methanol. Analyze for 6dEB production as described in Menzella et al. (2006).
326
Salvador Peiru´ et al.
7. Re-suspend cell pellets in 1 ml 20-mM Tris, 150 mM NaCl, pH 7.5, containing 1 tablet of CompleteTM EDTA-free protease inhibitor cocktail (Roche) per 50 ml. 8. Disrupt by sonication, and centrifuge at 14,000g for 3 min. 9. Analyze soluble and insoluble fractions on NuPAGE Novex 3 to 8% Tris-Acetate gels (Invitrogen). Gels can be stained using Simply Blue SafeStain (Invitrogen) and analyzed using a UVP Bioimaging System with Labworks 4.0 software (UVP, Inc.). The synthetic components of DEBS ORFs were expressed using three compatible vectors (ColE1 for DEBS1, P15A for DEBS2, and RSF1010 for DEBS3), all under control of a T7 promoter. When individually expressed in the engineered E. coli strain K207-3, each codon-optimized ORF produced about fivefold more protein than its native counterpart, as did the complete set of three coexpressed synthetic ORFs. However, no polyketide product could be detected from the three coexpressed synthetic ORFs, while the wildtype PKS gene set produced 20 mg/l of 6dEB in shake-flask fermentations. To identify the defective module(s), chimeras of wildtype and synthetic ORFs were constructed by cotransformation of combinations using the three-plasmid system. Of the three possible chimeras containing one synthetic and two natural ORFs, only the combination containing synthetic DEBS2 produced no 6dEB. Since the synthetic DEBS2 contained the nonconserved PR-to-LQ mutation to accommodate the Mod4 PstI site, we converted the sequence back to PR. With this change, synthetic DEBS2 combined with DEBS1 and DEBS3 produced 6dEB, but at a level far below that obtained with the wildtype sequences. Further studies showed that expression of synthetic DEBS from the strong T7 promoters led to a significant reduction in the expression of the accessory genes accA and pccB required to produce methylmalonyl CoA in the E. coli K207-3 strain, and this could presumably account for the low levels of 6dEB observed. When expression of the three synthetic DEBS genes was driven by the lacUV5 promoter, three- to four-fold less PKS protein was observed than when expressed under control of the T7 promoter, but both the production levels of 6dEB and the expression of the accA and pccB genes were comparable to those observed with the wildtype sequences. In another validation example, the entire synthetic epothilone gene cluster—epoA, epoB, epoC, epoD, epoE, and epoF—and the C-terminal thioesterase were assembled and expressed in the E. coli K207-3 strain (Mutka et al., 2006). The expected products, epothilone C and D, were obtained, indicating that the 29 amino acid changes needed to insert the restriction sites into the redesigned genes could be tolerated to obtain a catalytically active PKS complex of approximately 2 MDa (monomeric mass). As in the case of DEBS, titers were improved when gene expression
Design and Synthesis of Pathway Genes for Polyketide Biosynthesis
327
was down-regulated by replacing the strong T7 promoters by an alternative, in this case by the PBAD arabinose-inducible promoter. In summary, with the sole exception of the PstI site in DEBS module 4, all the amino acid changes introduced to accommodate the restriction sites in the more than 70 kb of PKS genes for DEBS and epothilone were well tolerated. Strong evidence was also obtained to suggest that weaker promoters are needed to balance expression of the codon-optimized genes with that of the accessory proteins required for polyketide production, while stronger promoters may be necessary to achieve balance when the high-GC native genes are used.
4. A Rapid Assay to Identify Productive Combinations of PKS Modules In spite of initial excitement, in more than 15 years of PKS engineering only a few successful attempts to create functional unnatural module–module interfaces using wildtype PKS sequences have been reported (Gokhale et al., 1999; Kim et al., 2002; McDaniel et al., 1997; Ranganathan et al., 1999; Watanabe et al., 2003). Since unsuccessful attempts to create hybrid PKSs are rarely published, it is hard to anticipate how often two unrelated PKS modules could be successfully connected to yield the expected polyketide. Thus the possibilities and limitations of the combinatorial approach remain unclear. In order to address this fundamental issue, an in vivo assay was developed to rapidly screen interactions between unrelated PKS modules (Menzella et al., 2005). Here, two expression vectors with compatible origins of replication and different selectable markers capable of expressing equivalent amounts of protein from arabinose-inducible promoters were used (Fig. 14.2A). The ‘‘donor’’ vector contains the loading module (LM) of DEBS and the C-terminal docking domain of DEBS1 (DCeryM2), separated by unique XbaI and SpeI sites, so any synthetic module can be inserted into this plasmid in one step to create a fusion ORF of the class LMery-Module-DCeryM2. The ‘‘acceptor’’ vector contains the DEBS2 N-terminal linker (LNeryM3) and the DEBS thioesterase (TE), separated by unique MfeI and SpeI sites. Any synthetic PKS module can be cloned into this plasmid to create a second type of fusion ORF designated LNeryM3-ModuleTEery. In this in vivo assay, the two fusion proteins are coexpressed and the rapid detection of the predicted triketide product by LC/MS/MS reveals productive module–module interactions. To validate the assay 154 mini-PKSs of this kind were assembled, introduced into E. coli K207-3 (Murli et al., 2003) and the resulting clones cultured and tested for protein expression and production of the expected compounds using the following method:
A LM
LI
DNery5
DCery4
Donor module
PBAD
TE
Acceptor module
PBAD
Str
pAng
pBru
Clo
Car
ColE1
B LM
LI
DCery4
Module A
PBAD
DNery5
LI
Module B
Module C
PBAD
pAngII
Clo
Str
pCot
ColE1
Car
TE
Design and Synthesis of Pathway Genes for Polyketide Biosynthesis
329
1. Introduce the two expression vectors by co-transformation into E. coli K207-3. 2. Grow the resulting colonies in 3 ml LB containing antibiotics for selection at 37 to an OD600¼0.5. 3. Induce with IPTG (0.5 mM), arabinose (2 mg/ml) and a mixture of sodium glutamate (50 mM), sodium succinate (50 mM), and sodium propionate (5 mM). 4. Incubate the induced cultures at 22 for 72 h with agitation. 5. Centrifuge 10 min at 10,000g; remove the supernatant for polyketide analysis and cell pellet for protein expression analysis. 6. Acidify culture supernatants with phosphoric acid to pH 2.5. 7. Analyze for triketide production y LC/MS/MS as described in Ashley and Carney (2004). 8. Protein expression can be assessed following the same procedure described above for DEBS. Remarkably, almost half of the 154 bimodules produced the expected polyketide and each tested module functioned as a donor or acceptor in one or more contexts, indicating that all redesigned modules were catalytically competent, and further validating the generic PKS gene design. Interestingly, all the modules processed unnatural substrates, confirming their relaxed specificity (Gokhale et al., 1999; McDaniel et al., 1999; Ranganathan et al., 1999). Production of a triketide by the hybrid mini-PKSs must have involved overcoming several barriers. Potential obstacles to transfer of the propionyl moiety from the LM to the KS of each attached module include the foreign intrapeptide linkers, potential substrate intolerance by noncognate KS domains, or a requirement for possible ACP-KS interactions. Some of the unnatural fusions used the intrapeptide linker naturally associated with the module, and some others had the linker that normally separates LM from eryM1. Except for eryM1, none of the modules naturally accept and process a propionyl group, but all module fusions to LM produced the expected triketide in some bimodular combinations. The obtained results show that there is considerable flexibility in the intrapeptide linkers used to separate the LM and the first module, and the KS in all tested modules fused to the LM can elongate the propionyl moiety. Therefore, all donor modules form Figure 14.2 (A) The two classes of expression plasmid used to test bimodular interactions in E. coli: pAng vectors contain a CloDF13 replication origin, a streptomycin resistance selection marker and a PBAD promoter to drive expression of LM-Module-DCeryM2 ORFs. pBru vectors contain a ColE1 replication origin, a carbenicillin resistance selection marker and a PBAD promoter to drive expression of DNeryM3-Module-TE ORFs. (B) The two types of vectors used to express trimodular PKSs: pAngII vectors are similar to pAng, but DCeryM2 was replaced by DCeryM4. pCot plasmids are similar to pBru, but they express ORFs of the class DNeryM5-Mod-LI-Mod-TE. (From Menzella et al., 2007. Reproduced with permission from Elsevier.)
330
Salvador Peiru´ et al.
an acyl-ACP at the C terminus that can donate the diketide to a subsequent module. Transfer of the diketide through the hybrid interface to the KS of the acceptor module requires physical proximity of the ACP and KS, and possible protein–protein interactions between them (Wu et al., 2002); and elongation requires substrate tolerance by and catalytic activity of the KS (Watanabe et al., 2003). Since about half of the bimodules produced the predicted polyketide, and the modules were always connected by the eryM2-eryM3 linkers, this pair serves well as generic linkers to connect unrelated modules. The results of this study provided a clear indication of the possibilities of the PKS combinatorial biosynthesis approach since, to the best of our knowledge, this is the first analysis of the productivity of a large number of random module–module combinations. Encouragingly, it seems that unrelated PKS modules can be successfully connected to create functional pairs in many cases. On the other hand, the yields of polyketides obtained from the hybrid PKSs are typically at least one order of magnitude lower than those obtained from the natural bimodular pairs (Menzella et al., 2005). Importantly, the chosen assay can be easily adapted to a high-throughput format to rapidly screen for the most productive unrelated combinations of modules. In the above tests, all the acceptor modules processed a particular diketide from some donor modules but not from others, so recognition and elongation of the incoming diketide by the acceptor KS was unlikely to explain the failures. We attributed them instead to the absence of an appropriate ACP-KS protein–protein interaction (Wu et al., 2002). To address this issue, KS domains were combinatorially changed to activate inactive module pairs and optimize the yield of a desired polyketide product (Chandran et al., 2006). The unique MfeI-KpnI restriction sites flanking the KS domain in all the synthetic modules made this a simple task (Fig. 14.2). The feasibility of the approach was validated by resuscitating nine previously inactive bimodular PKSs. Such activation of hybrid modular interfaces by KS replacements provides a powerful tool to engineer synthetic PKSs. Of particular interest is the use of this procedure to incorporate into assembly lines unusual modules with rare activities that cannot be replaced easily just by seeking a more adaptable natural module with the same activity.
5. Assembly of Larger Polyketide Synthases Using Information Gained with the Bimodular Assay Polyketides with biological activity are much more complex than the triketides produced by the bimodular PKSs described above, and biosynthesis of such molecules requires the assembly of synthetic enzymes
Design and Synthesis of Pathway Genes for Polyketide Biosynthesis
331
containing multiple modules with several hybrid interfaces. Thus, it is imperative to employ the information gained with the simple test system to assemble larger PKSs. For this, a conceptual advance was made by developing the concept of ‘‘connectivity’’ to allow the overlapping of functional bimodules to build active trimodular PKSs. Connectivity describes the situation in which module B in a given bimodule extends the ketide offered by module A, and in another bimodule, module C extends the ketide offered by module B; then a trimodular PKS made by connecting module A to module C via module B should also be active. The library of bimodules previously described was constructed at random, and gave a success rate of 45%. Constructing trimodules by simply adding another module randomly should have had, at most, a 20% success rate. A recent publication (Menzella et al., 2007) showed that, using data from the bimodular library and the connectivity principle, an additional functional heterologous interface was constructed with a remarkably higher success rate. To prove the concept of connectivity, an expression system was developed to express trimodular PKSs (Fig. 14.2B). In this case a two-plasmid system was again used for the expression. The first plasmid encoded a fusion of the class LM-Mod-DC and the second plasmid a chimeric protein comprising DN-Mod-LI-Mod-TE. Given that the erythromycin LM and TE are functional in many heterologous bimodular PKS constructs, these domains were used for all the trimodular PKSs. The docking domains derived from eryM2 (DCeryM2) and eryM3 (DNeryM3) were successful at forming functional interactions between most single modules tested. However, we observed that the larger protein encoded by bimodular constructs in the pCot vector were better expressed when the N-terminal linker of eryM5 (DNeryM5) was used instead of DNeryM3. Using the unique restriction sites in our generic design, we examined several intrapeptide linkers to join the two modules in pCot, including the linker naturally associated with the first module and the one naturally present upstream of the N-terminus of the second module in this plasmid as well as foreign intrapeptide linkers (LIeryM6, LIeryM1) between the two modules, creating two unnatural junctions. The ability of bimodular constructs in pCot to interact and produce a polyketide was assessed and shown to be similar in all cases. Thus, it seems that all the tested linkers are equally efficient in connecting the modules. Several pairs of functional bimodules were overlapped to create 54 trimodular PKSs flanked by the DEBS LM and TE. Remarkably, 52 (96%) of the synthetic enzymes formed the expected tetraketide product. Twelve of the trimodules contain contiguous extender modules in the order in which they occur in their native PKS, but in 42 there are no naturally contiguous modules; nevertheless, 40 (95%) of these also produced the expected polyketide. Interestingly, in terms of substrate specificity these results suggest that the portion of the upcoming polyketide recognized by a
332
Salvador Peiru´ et al.
given module is in most cases the extension added by the previous module regardless of the length and complexity of the polyketide chain. The rational assembly of trimodular PKSs represents an important step toward the goal of making bioactive molecules by genetic engineering, both complete polyketides that cannot be isolated in significant quantities, and novel, ‘‘designer’’ molecules. The rationale should, for example, be applicable to building unnatural PKSs from scratch by combining individual artificial modules, as described here, as well as to adding or replacing ketide units in preexisting chains. It also provides a rational approach for ‘‘stitching’’ two or more strings of naturally contiguous modules together to make novel or inaccessible large polyketides. However, since yields of polyketide products were seen to decrease as a function of the number of unnatural junctions introduced, the efficiency of product formation will probably continue to decrease when further modules and heterologous interfaces are added. This limitation might be circumvented by using only the highest yielding trimodules as components, or by incorporating strings of as many naturally contiguous modules as possible when designing long chimeric PKSs so as to reduce the number of unnatural interfaces
6. Design and Construction of Synthetic Operons for the Expression of Sugar Pathway Genes The increasing knowledge and technologies related to PKS engineering represent a significant advance toward the ultimate goal of synthesizing rationally designed polyketides in E. coli. However, as in many naturally occurring polyketides, such novel compounds might also require several post-PKS biosynthetic steps in order to become bioactive. These polyketide ‘‘decoration’’ steps, which generally involve complex glycosylation processes, are absent in E. coli and thus need to be incorporated in this heterologous host in combination with the PKSs to produce fully decorated polyketides. Glycosylation of polyketides has been validated in E. coli, through the production of the antibiotic erythromycin C (EryC) (Peiru´ et al. 2005). This process involves the attachment of the deoxysugars TDP-L-mycarose and TDP-D-desosamine to the aglycon 6dEB (firstly hydroxylated to EB), to yield erythromycin D (EryD), which is further hydroxylated at C12 to obtain EryC. Two operons were constructed for this purpose, in order to have separate control of the two sugar biosynthetic pathways. The complete conversion of 6dEB to EryC requires functional expression of 17 genes with a variety of catalytic activities, comprising TDP-sugar biosynthesis, glycosyltransferases and hydroxylases. In this seminal work, all the
Design and Synthesis of Pathway Genes for Polyketide Biosynthesis
333
genes were individually amplified by PCR from Micromonospora megalomicea chromosomal DNA and a simple method was designed to allow sequential cloning of genes to build synthetic operons by adding suitable flanking restriction sites and translation signaling sequences (Fig. 14.3). NdeI and SpeI sites were introduced immediately 50 and 30 of each gene, respectively, to enable cloning into a special expression plasmid named pD2, containing XbaI-RBS-His5 coding sequence-NdeI-SpeI. The N-terminal His5 fusion, which can be omitted, introduces a short codon-optimized sequence that we have observed improves gene expression in most cases. It also provides a tag for further protein expression analysis and/or protein purification by means of anti-His5 antibodies. The flanking XbaI and SpeI sites that result from cloning the PCR-amplified ORFs into this plasmid permit the sequential cloning of genes as XbaI/SpeI fragments into the SpeI site of the acceptor vector, resulting in a growing string of genes separated by a minimal sequence. The obtained operons can be further mobilized as XbaI/SpeI fragments to vectors with different promoters, selection markers, or replication origins if required. A detailed method is described below. 1. Amplify by PCR the individual genes to be included in the synthetic operon. For the design of the upper primer, engineer an NdeI site overlapping the translational initiation codon (changing GTG start codons to ATG when necessary). For the design of the lower primer, engineer a SpeI site immediately downstream of the stop codon. 2. Create a special vector for the sequential cloning of the PCR products. For this purpose the pET24a expression vector (Novagen) can be modified by replacing the BamHI site in the polylinker by a SpeI site, and by deleting the 21-bp region between the XbaI site and the RBS. Alternatively, a His5 coding sequence can be added upstream of the NdeI site. 3. Clone each PCR-amplified sugar biosynthetic gene as an NdeI/SpeI fragment into the same sites of the modified pET24a vector. 4. Initiate the assembly by sequentially cloning each gene as XbaI/SpeI fragments into the SpeI site of the acceptor vector, making sure that the inserted gene is properly orientated. The intergenic XbaI/SpeI ligation destroys both sites, allowing the repetitive use of the remaining 30 SpeI site to insert as many components as required. 5. Finally, subclone the resulting operon as an XbaI/SpeI fragment into the expression vector with the appropriate promoter, selection marker and replication origins. Using this method, two operons were built: the ‘‘mycarose’’ operon, for the conversion of 6dEB up to 3-a-mycarosyl-EB (MEB), and the ‘‘desosamine’’ operon, for the conversion of MEB to EryC. The activity of both operons was found to be optimal in E. coli cultures grown at 22 , when induced in the presence of a plasmid for the overexpression of the E. coli chaperones GroES/GroEL, which improve solubility of the heterologous
334
Salvador Peiru´ et al.
eI
eI
Nd
Sp
PCR
eI eI Nd Sp
Xb
Sugar gene 1
eI
eI
Nd
PCR aI
Sp
Sugar gene 2
RBS His5
PT7 Lig
Lig Km
pD2
Xb
aI
RBS His5
eI
eI
aI
ColE1
Sp
Nd
eI
Xb
Sugar gene 1
Sp
Sugar gene 2
RBS His5
PT7
eI
Nd
PT7 SpeI
Km
pSugar 1
XbaI/SpeI
Km
pSugar 2
Lig
ColE1
ColE1 Xb
aI
RBS His5
eI
eI
Nd
Nd
Sugar gene 1
RBS His5
eI
Sp
Sugar gene 2
PT7 pOperon
Km
ColE1
Figure 14.3 Cloning strategy for the construction of sugar biosynthesis operons. Sugar genes are PCR-amplified, with flanking NdeI and SpeI sites, and cloned into pD2. This expression vector contains a ColE1replication origin, a kanamycin resistance selection marker, and adds an RBS and a His5 N-terminal fusion to the cloned gene, whose expression is driven by a PT7 promoter. The acceptor vector (pSugar 1) is digested with SpeI, and the second gene in the nascent operon is introduced as an XbaI/SpeI fragment. The process can be repeated with the resulting pOperon plasmid in a recursive fashion, until the entire operon is constructed.
Design and Synthesis of Pathway Genes for Polyketide Biosynthesis
335
proteins. Biosynthesis of EryC from propionate in K207-3 required cloning of the mycarose and desosamine operons into compatible vectors (RSF1030 and CloDF13, respectively), to allow coexpression with the three plasmids for the synthesis of DEBS and chaperones containing ColE1, RSF1010, and P15A origins of replication (Peiru´ et al., 2005). Codon-optimized versions of the genes involved in these pathways were not tested since the expression levels were satisfactory in all cases. Using a wildtype background the glycosylation yields achieved in the initial experiments were low (<1 mg/l of EryC). Later, a second-generation strain was created where several metabolic constraints related to the availability of TDP-sugar precursors in the E. coli working host were addressed. The E. coli K207-3 first-generation strain has been recently optimized for polyketide glycosylation by metabolic engineering, through the blocking of endogenous pathways that utilize the common TDP-sugar biosynthesis precursor, TDP-4-keto-6-deoxyglucose (Peiru´ et al., 2008). In addition, the macrolide efflux pump AcrAB-TolC was also disrupted in this strain, to avoid a premature export of the partially glycosylated precursors, which was also shown to be detrimental to the overall efficiency of the glycosylation process. The resulting E. coli strain, named LB19b, showed a significant increase in the production of TDP-L-mycarose and TDP-D-desosamine, which was reflected in a remarkable 100-fold improvement of EryD production from 6dEB in bioconversion experiments, compared with the parental K207-3 strain. The higher TDP-sugar production achievable with the LB19b strain permits an easier analysis of sugar pathways by LC/MS/MS. This, in combination with the described universal cloning strategy, allows a stepby-step monitoring of the growing operon, when adding genes following their predicted order in the biosynthetic pathway, by looking for the expected TDP-sugar intermediate (Peiru´ et al., 2007; Rodriguez et al., 2006). In this way, incorrect combinations or nonfunctional genes can be easily detected, and novel enzymatic activities or biosynthetic routes determined, providing new tools for gene function analysis, sugar pathway engineering, and production of novel glycosylated polyketides.
REFERENCES Ashley, G. W., and Carney, J. R. (2004). API-mass spectrometry of polyketides. I. A study on the fragmentation of triketide lactones. J. Antibiot. (Tokyo) 57, 224–234. Chandran, S. S., Menzella, H. G., Carney, J. R., and Santi, D. V. (2006). Activating hybrid modular interfaces in synthetic polyketide synthases by cassette replacement of ketosynthase domains. Chem. Biol. 13, 469–474. Cortes, J., Wiesmann, K. E., Roberts, G. A., Brown, M. J., Staunton, J., and Leadlay, P. F. (1995). Repositioning of a domain in a modular polyketide synthase to promote specific chain cleavage. Science 268, 1487–1489.
336
Salvador Peiru´ et al.
Gokhale, R. S., Tsuji, S. Y., Cane, D. E., and Khosla, C. (1999). Dissecting and exploiting intermodular communication in polyketide synthases. Science 284, 482–485. Jayaraj, S., Reid, R., and Santi, D. V. (2005). GeMS: An advanced software package for designing synthetic genes. Nucleic Acids Res. 33, 3011–3016. Kao, C. M., Katz, L., and Khosla, C. (1994). Engineered biosynthesis of a complete macrolactone in a heterologous host. Science 265, 509–512. Kodumal, S. J., Patel, K. G., Reid, R., Menzella, H. G., Welch, M., and Santi, D. V. (2004). Total synthesis of long DNA sequences: Synthesis of a contiguous 32-kb polyketide synthase gene cluster. Proc. Natl. Acad. Sci. USA 101, 15573–15578. Kim, B. S., Cropp, T. A., Florova, G., Lindsay, Y., Sherman, D. H., and Reynolds, K. A. (2002). An unexpected interaction between the modular polyketide synthases, erythromycin DEBS1 and pikromycin PikAIV, leads to efficient triketide lactone synthesis. Biochemistry 41, 10827–10833. McDaniel, R., Kao, C. M., Hwang, S. J., and Khosla, C. (1997). Engineered intermodular and intramodular polyketide synthase fusions. Chem. Biol. 4, 667–674. McDaniel, R., Thamchaipenet, A., Gustafsson, C., Fu, H., Betlach, M., and Ashley, G. (1999). Multiple genetic modifications of the erythromycin polyketide synthase to produce a library of novel ‘‘unnatural’’ natural products. Proc. Natl. Acad. Sci. USA 96, 1846–1851. McDaniel, R., Welch, M., and Hutchinson, C. R. (2005). Genetic approaches to polyketide antibiotics. 1. Chem. Rev. 105, 543–558. Menzella, H. G., Reid, R., Carney, J. R., Chandran, S. S., Reisinger, S. J., Patel, K. G., Hopwood, D. A., and Santi, D. V. (2005). Combinatorial polyketide biosynthesis by de novo design and rearrangement of modular polyketide synthase genes. Nat. Biotechnol. 23, 1171–1176. Menzella, H. G., Carney, J. R., and Santi, D. V. (2007). Rational design and assembly of synthetic trimodular polyketide synthases. Chem. Biol. 14, 143–151. Menzella, H. G., and Reeves, C. D. (2007). Combinatorial biosynthesis for drug development. Curr. Opin. Microbiol. 10, 238–245. Menzella, H. G., Reisinger, S. J., Welch, M., Kealey, J. T., Kennedy, J., Reid, R., Tran, C. Q., and Santi, D. V. (2006). Redesign, synthesis and functional expression of the 6-deoxyerythronolide B polyketide synthase gene cluster. J. Ind. Microbiol. Biotechnol. 33, 22–28. Murli, S., Kennedy, J., Dayem, L. C., Carney, J. R., and Kealey, J. T. (2003). Metabolic engineering of Escherichia coli for improved 6-deoxyerythronolide B production. J. Ind. Microbiol. Biotechnol. 30, 500–509. Mutka, S. C., Carney, J. R., Liu, Y., and Kennedy, J. (2006). Heterologous production of epothilone C and D in Escherichia coli. Biochemistry 45, 1321–1330. Oliynyk, M., Brown, M. J., Cortes, J., Staunton, J., and Leadlay, P. F. (1996). A hybrid modular polyketide synthase obtained by domain swapping. Chem. Biol. 3, 833–839. Peiru´, S., Menzella, H., Rodrı´guez, E., Carney, J., and Gramajo, H (2005). Production of the potent antibacterial polyketide erythromycin C in Escherichia coli. Appl. Environ. Microbiol. 71, 2539–2547. Peiru´, S., Rodriguez, E., Tran, C. Q., Carney, J., and Gramajo, H (2007). Characterization of the heterodimeric MegBIIa:MegBIIb aldo-keto reductase involved in the biosynthesis of L-mycarose from Micromonospora megalomicea. Biochemistry 46, 8100–8109. Peiru´, S., Rodriguez, E., Menzella, H., Carney, J., and Gramajo, H (2008). Metabolically engineered Escherichia coli for efficient production of glycosylated natural products. Microb. Biotechnol. 1(6), 476–486. Pfeifer B. A., and Khosla, C. (2001). Biosynthesis of polyketides in heterologous hosts. Microbiol. Mol. Biol. Rev. 65(1), 106–118. Ranganathan, A., Timoney, M., Bycroft, M., Cortes, J., Thomas, I. P., Wilkinson, B., Kellenberger, L., Hanefeld, U., Galloway, I. S., Staunton, J., and Leadlay, P. F. (1999).
Design and Synthesis of Pathway Genes for Polyketide Biosynthesis
337
Knowledge-based design of bimodular and trimodular polyketide synthases based on domain and module swaps: A route to simple statin analogues. Chem. Biol. 6, 731–741. Reisinger, S. J., Patel, K. G., and Santi, D. V. (2006). Total synthesis of multi-kilobase DNA sequences from oligonucleotides. Nat. Protoc. 1, 2596–2603. Rodrı´guez, E., Peiru´, S., Carney, J., and Gramajo, H (2006). In vivo Characterization of the dTDP-D-desosamine Biosynthetic Pathway of the Megalomicin Cluster from Micromonospora megalomicea. Microbiology 152(Pt3), 667–673. Sherman, D. H. (2005). The Lego-ization of polyketide biosynthesis. Nat. Biotechnol. 23, 1083–1084. Walsh, C (2003). ‘‘Antibiotics: Actions, origins, resistance.’’ ASM Press, Washington, DC. Walsh, C. (2004). Polyketide and nonribosomal peptide antibiotics: Modularity and versatility. Science 303, 1805–1810. Watanabe, K., Wang, C. C., Boddy, C. N., Cane, D. E., and Khosla, C. (2003). Understanding substrate specificity of polyketide synthase modules by generating hybrid multimodular synthases. J. Biol. Chem. 278, 42020–42026. Weissman, K. J., and Leadlay, P. F. (2005). Combinatorial biosynthesis of reduced polyketides. Nat. Rev. Microbiol. 3, 925–936. Wu, N., Cane, D. E., and Khosla, C. (2002). Quantitative analysis of the relative contributions of donor acyl carrier proteins, acceptor ketosynthases, and linker regions to intermodular transfer of intermediates in hybrid polyketide synthases. Biochemistry 41, 5056–5066.
C H A P T E R
F I F T E E N
Heterologous Production of Polyketides in Bacteria Eduardo Rodriguez, Hugo G. Menzella, and Hugo Gramajo Contents 1. Introduction 2. General Considerations for the Heterologous Expression of Polyketide Pathways 3. S. coelicolor as a Model System for Heterologous Expression of Polyketides 4. Procedure for the Heterologous Production of Polyketides in S. coelicolor 5. System Improvements for the Heterologous Production of Polyketides in Streptomyces spp. 5.1. Handling large PKS genes 5.2. Improving polyketide titers 5.3. Optimization of conjugation protocols for industrial strains 5.4. Optimizing polyketide precursors supply 6. Recent Developments for the Production of Polyketides in Nonactinomycete Bacteria 6.1. E. coli as heterologous host 6.2. Pseudomonas putida as heterologous host References
340 341 344 347 349 349 351 354 355 357 357 359 360
Abstract Polyketide natural products are among the most important microbial metabolites in human medicine and are widely used to treat both acute and degenerative diseases. The need to develop new drugs has prompted the idea of using heterologous systems for the expression of polyketide biosynthetic pathways. The basic idea behind this approach is to use heterologous bacterial systems with better growth and genetic characteristics that could support better production of a certain compound than the original host or that could allow the generation of novel analogues through combinatorial biosynthesis.
Instituto de Biologı´a Molecular y Celular de Rosario (CONICET), Facultad de Ciencias Bioquı´micas y Farmace´uticas, Universidad Nacional de Rosario, Rosario, Argentina Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04615-1
#
2009 Elsevier Inc. All rights reserved.
339
340
Eduardo Rodriguez et al.
Moreover, these hosts could be used to express ‘‘cryptic’’ secondary metabolic pathways or serve as surrogate hosts in metagenomics experiments in order to find potential new bioactive compounds. In this chapter we discuss recent advances in the heterologous production of polyketides in bacteria and describe some methodological improvements of the systems.
1. Introduction Natural products have played an extraordinary role in the discovery of useful compounds with important pharmacological properties. Many of these compounds belong to the polyketide and nonribosomal peptide families of natural products that are synthesized by complex enzymatic systems called polyketide synthases (PKS) and nonribosomal peptide synthetases (NRPS), respectively (Finking and Marahiel, 2004; Staunton and Weissman, 2001). Several polyketides and nonribosomal peptides are in clinical use and span a large range of medicinally important compounds such as antibiotics (vancomycin, erythromycin, oleandomycin), anticancer drugs (doxorubicin, bleomycin, epothilones), immunosuppressants (cyclosporin, rapamycin), antifungals (amphotericin B) and antiparasitic agents (ivermectin) (Clardy and Walsh, 2004; Khosla, 1997; Walsh, 2004). At present, the need for new antibiotics, prompted by the worldwide spread of antibiotic-resistant pathogenic bacteria, as well as the need for new bioactive molecules with improved or novel pharmacological properties, has prompted an intense interest in developing new techniques for discovering new polyketide analogues. Traditionally, polyketide-drug discovery has followed three routes: isolation and identification of new compounds from the biosphere, semisynthetic modification of existing drug scaffolds using medicinal chemistry, or using synthetic chemistry. Unfortunately, the structural complexity of polyketides poses a serious challenge to the large-scale organic synthesis of these natural compounds. More recently, and taking advantage of the structural and functional understanding of PKSs biosynthesis, scientists have turned toward a new technology referred to as combinatorial biosynthesis to produce novel natural products for drug development (Menzella and Reeves, 2007; Rodriguez and McDaniel, 2001; Weissman and Leadlay, 2005). See Chapter 13 in this volume. Although the three biological approaches mentioned above could yield new structures in the foreseeable future, they might all suffer from serious limitations, mainly related to the difficulty in obtaining economical large-scale production processes to manufacture complex natural products. Isolation of new compounds from their original hosts is often limited by the rudimentary knowledge or poor growth associated with the original producer. For instance, new molecules might come from fastidious
Heterologous Production of Polyketides in Bacteria
341
organisms that often fail to grow well outside their native environments, making the production and isolation of the natural compounds for widespread clinical use very difficult. Besides, these organisms mostly offer little opportunity for genetic manipulation, further complicating any attempt to improve the yields of any promising new molecule. In contrast, combinatorial biosynthesis has also proven to be a powerful technique to obtain new polyketide analogues (Cortes et al., 1995; Donadio and Sosio, 2003; Kao et al., 1995; Weber et al., 2003); however, the low efficiency of these experiments, usually related to the low activity of the genetically engineered PKSs, limits their routine use in industrial drug discovery. These limitations prompted the idea of developing robust heterologous hosts with improved growth properties, well developed fermentation processes and a complete genetic tool box, as surrogate hosts for the production of complex natural compounds. Two relatively recent advances support even further the need to develop generic host systems for the heterologous production of polyketides (and NRPSs). The first is related to the vast information generated by the completion of almost 700 bacterial genome sequences (www.genomesonline. org), which revealed innumerable ‘‘cryptic’’ secondary metabolite pathways, probably containing the information for the production of many so far unidentified compounds (Bode and Muller, 2005). The second relates to the development of a number of new techniques to screen expression libraries of multiple genomes from a target source for the isolation/production of novel secondary metabolites, an approach known as metagenomics (Fortman and Sherman, 2005; Streit and Schmitz, 2004).
2. General Considerations for the Heterologous Expression of Polyketide Pathways Several aspects associated with microbial polyketide biosynthesis make these pathways well suited for heterologous expression (Fig. 15.1). 1. One of the most remarkable features is that, so far, all known bacterial and fungal PKS-encoding genes have been found to exist as gene clusters (Fig. 15.1A). Moreover, regulatory functions involved in the transcriptional regulation of these genes, as well as self-resistance genes, are often associated with the biosynthetic genes. This is a key feature that facilitates both the isolation and the heterologous expression of the complete genetic information for the synthesis and secretion of these compounds. 2. PKSs are cytosolic multienzyme systems that do not require any intracellular substructure to maintain activity; therefore, if they are
A pks
B
Regulator
PKS gene cluster
Sugar biosynthesis Transport
Resistance
Precursor supply
Glucose
E
Methoxymalonyl-ACP
Allelic exchange
Malonate
Malonyl-CoA
AntibioticR phage attB
Acetate
Acetyl-CoA
Ethylmalony-CoA
“Clean Host”
TCA pksII
attP
Fatty acid
Succinyl-CoA
C
Isobutyryl-CoA
Butyryl-CoA
pksIII
pksI
pksIV
ori
ori
(2R) methylmalonyl-CoA
Methymalonate
D
Aminoacids
Propionate
Propionyl-CoA
(2S) methylmalonyl-CoA
KR AT ACP KS
AT
ACP OH
OH CoA
PPTase
O
O
F
Post-PKS Modifications
KR AT ACP KS
AT
ACP
P arm
P arm
SH
SH
O O
O
O
OH OH
O
O
HO O
O
N(CH3 )2 OH
OH
Figure 15.1 Schematic representation of heterologous production of polyketides in bacteria. (A) Polyketide gene clusters usually contain genes encoding transport proteins, biosynthetic precursor pathways, post-PKS modification and proteins associated with self-resistance. (B) Construction of a‘‘clean-host’’will help to avoid possible interference with endogenous polyketides and can also be used to introduce genetic
Heterologous Production of Polyketides in Bacteria
343
successfully expressed in a foreign cellular environment, they should support polyketide production if the appropriate substrates are available. 3. Another important feature that makes polyketides amenable to biosynthesis in heterologous systems is that even when PKSs can synthesize an extraordinary number of structurally diverse compounds, they do so by using only a small pool of precursors (usually short-chain carboxylic acids). This, together with the multiple metabolic routes that can synthesize the polyketide building blocks, allows the possibility of choosing from a wide range of possible heterologous hosts. 4. Considering that polyketides are naturally produced in the idiophase (i.e., after the period of rapid vegetative growth), it is possible to develop a two-stage fermentation process in which active cell growth is decoupled from the production phase. Based on these features, lateral transfer of a pathway of interest into a well-developed surrogate host has become an attractive alternative, both to overproduce the parent natural product itself and to generate novel analogues via biosynthetic engineering. On the other hand, reconstitution of polyketide biosynthesis in heterologous hosts is also an extraordinary challenge and several requirements need to be met before these molecules could be efficiently synthesized in a surrogate host. Some of the factors that could influence heterologous production of polyketides follow: 1. PKS genes (often coming from high-GC organisms) have to be efficiently transcribed/translated in the new host, so it is important that the GC content of the foreign genes and the host genome are matched. 2. Modular PKSs are large multienzymes that require proper folding and assembly to become functional; this is particularly challenging when the heterologous system chosen is not a natural polyketide producer (e.g., Escherichia coli). 3. Post-translational modification of the PKSs (covalent attachment of a phosphopantetheine group to a conserved serine residue of ACPs) needs to be adequately met for the protein to become active (Fig. 15.1D) (Lambalot and Walsh, 1995). 4. The biosynthetic precursors should be available in vivo in reasonable quantities at the correct time, which demands the availability of suitable fermentation protocols.
markers or attachment sites for site-specific recombination. (C) Transformation of the ‘‘clean-host’’ with the heterologous PKS genes cloned in replicative or integrative plasmids. (D) PKS proteins require post-translational modification, addition of a phosphopantetheine arm, to become functional. (E) Primary metabolism and specialised precursor pathways are necessary to provide the substrates (highlighted in bold ) for polyketide biosynthesis. (F) Polyketide production usually requires post-PKS modifications to generate bioactive compounds.
344
Eduardo Rodriguez et al.
5. The producer cell has to be protected against the possible toxicity of the biosynthetic products, or inducible promoters could be used that can be switched on after the cells stop growing. In this chapter we discuss some general aspects that should be considered before the selection of a heterologous system for the expression of PKSs. We also present a more thorough analysis of Streptomyces coelicolor as a model system for the heterologous production of polyketides and discuss some advantages and disadvantages of this particular system. Finally, we review some specific improvements carried out for the heterologous expression of PKSs in Streptomyces spp. and give examples of more recently developed hosts, like E. coli and Pseudomonas.
3. S. coelicolor as a Model System for Heterologous Expression of Polyketides Actinomycetes, which are high-GC Gram-positive bacteria, produce a vast range of secondary metabolites with important biological properties (O’Hagan, 1991). One member of this group of bacteria, Streptomyces, is the largest producer of pharmacologically relevant natural products, most of them belonging to the polyketide or NRPS families of compounds. Thus, the intrinsic characteristics of this genus make Streptomyces a well-suited organism for the heterologous production of these compounds (Hopwood and Khosla, 1992). The extensive development of the biology and genetics of S. coelicolor, plus its natural capacity to produce polyketides, made this bacterium one of the best candidates to be developed into a surrogate host for heterologous production of this family of compounds. The first host-vector system developed for expression of polyketide synthases in bacteria consisted of the S. coelicolor A3(2) derivative CH999 (see below) as a host and an SCP2*-derived plasmid, pRM5, as the expression vector (McDaniel et al., 1993a). The initial achievement of the system was the synthesis of products derived from the frenolicin (McDaniel et al., 1993b), oxytetracycline (Fu et al., 1994) and tetracenomycin (McDaniel et al., 1993a) type II aromatic polyketides, followed by expression of the entire Saccharopolyspora erythraea 6-deoxyerythronolide B synthase (DEBS) gene set (Kao et al., 1994). The latter represented the first example of heterologous production of a type I macrolide polyketide in bacteria and provided a platform for development of combinatorial biosynthesis technology (Kao et al., 1994; McDaniel et al., 1993a, 1999). This host system has also been used for the expression of a great variety of type I polyketides, including megalomycin (Hu et al., 2003a), oleandomycin, and picromycin (Tang et al., 2000) and 6-methylsalicylic acid (Bedford et al., 1995). Other type II polyketides have also been produced in S. coelicolor independently of
Heterologous Production of Polyketides in Bacteria
345
the CH999/pRM5 system. This was achieved by cloning the entire gene clusters of the PKSs in a variety of E. coli-Streptomyces shuttle vectors (see below), where transcription of the heterologous genes was usually driven by their own transcriptional signals (Gould et al., 1998; Hong et al., 1997; Ichinose et al., 2003; Kalaitzis and Moore, 2004). Although many heterologous hosts have now been used and/or specifically developed for the production of a vast array of different polyketides ( Julien and Shah, 2002; Kim et al., 1995; Martinez et al., 2004; Pfeifer et al., 2001; Rowe et al., 1998; Ziermann and Betlach, 1999), in this section we describe the most important features of the S. coelicolor CH999/pRM5 system and discuss, by using this system as a model, some advantages and disadvantages of using S. coelicolor as a generic host for the heterologous production of polyketides. One of the most desirable, but on the other hand cumbersome, aspects of a heterologous host dedicated to the production of polyketides is its intrinsic capacity to produce these compounds. With the idea to synthesize new polyketide analogues in S. coelicolor, and in order to eliminate any possible interference (precursor supply, cometabolites, regulatory conflict or interference with screening) from endogenous polyketides, a ‘‘clean’’ host of this strain, named CH999, was generated (Fig. 15.1B) (McDaniel et al., 1993a). For this, the entire actinorhodin gene cluster was deleted by homologous recombination and replaced by the ermE (erythromycin resistance) marker gene. CH999 also contains an additional mutation that blocks the biosynthesis of the red-pigment undecylprodigiosin (Khosla et al., 1992), reducing the background of compounds in the supernatant that could interfere with the detection/purification of the new products. At the time this strain was made, it was considered as a ‘‘polyketide-free’’ strain, considering that the other known polyketide produced by S. coelicolor, the WhiE pigment, was known to be associated with spore formation (Yu and Hopwood, 1995) and therefore not present in liquid media (Kelemen et al., 1998). However, genome sequence analysis uncovered three open reading frames encoding putative type III PKSs (Bentley et al., 2002). One of them has recently been characterized and related to the biosynthesis of germicidin (Song et al., 2006). Therefore, an improvement of the CH999 strain could be achieved by deleting these three PKS-encoding genes, minimizing the presence of putative precursor competing pathways or of unwanted compounds. To provide a suitable host/vector system, an expression vector called pRM5 was also developed (McDaniel et al., 1993a). The plasmid is a shuttle vector that contains the ColE1 replicon, which allows its propagation in E. coli for cloning purposes, and the low-copy SCP2* Streptomyces replicon (Fig. 15.1C). Convenient restriction sites (PacI/NsiI) were introduced in order to clone PKS genes under the control of the actI/actIII promoters, which are positively regulated by the actII-ORF4 activator gene also present
346
Eduardo Rodriguez et al.
in the plasmid. In this way expression of heterologous genes occurs at the transition from exponential growth to stationary-phase (Gramajo et al., 1993), mimicking the endogenous timing of polyketide biosynthesis in S. coelicolor. Although this promoter system has the most favorable characteristics with respect to both expression levels and induction at the onset of the stationary phase, other promoters, like tipA (Yu and Hopwood, 1995) and ermE (Wilkinson et al., 2002) have also been investigated and successfully used for PKS gene expression. One of the drawbacks of pRM5 and its derivative vectors is the absence of an oriT sequence that would allow its transfer from E. coli to Streptomyces by conjugation (Kieser et al., 2000). However, a wide variety of expression vectors with different characteristics (integrative, high copy number, low copy number) have been constructed and extensively used in S. coelicolor and in other Streptomyces species (Kieser et al., 2000). One limitation of the CH999/pRM5 system, and in general of most of the heterologous systems developed, is that production levels of secondary metabolites are generally low, typically in the range of 1 to 100 mg/l of culture. One of the important factors that could hinder production is the presence of limiting amounts of the substrates needed for product synthesis. In this regard we could predict that S. coelicolor is reasonably well adapted for the production of compounds that use either malonyl-CoA (both actinorhodin and the spore pigment WhiE are made from this substrate) methylmalonyl-CoA and/or ethylmalonyl-CoA (germicidin is synthesized using both substrates) in their synthesis. Therefore, this strain should be a suitable host for the biosynthesis of any polyketide that uses these shortchain acyl-CoAs as extender units, and this has been largely confirmed by the production of many foreign polyketides in this host, as discussed above (Fig. 15.1D). Some of the enzymes (pathways) involved in the biosynthesis of these a-carboxylated CoA thioesters have been well characterized in our laboratory and include the acyl-CoA carboxylase complexes (ACCase). At least three different ACCases are encoded within the S. coelicolor genome and two of them have been well characterized and shown to recognize some or all of the following substrates: acetyl-, propionyl-, and butyryl-Co A to produce malonyl-, methylmalonyl-, and ethylmalony-CoA as products (Diacovich et al., 2002; Rodriguez and Gramajo, 1999; Rodriguez et al., 2001). Interestingly, other routes that could provide methylmalonyl-CoA in S. coelicolor have been identified by genome analysis. The genes coding for the methylmalonyl-CoA mutase subunits are present in the genome of S. coelicolor and, if expressed at the correct time, the holo-enzyme could catalyze production of methylmalonyl-CoA from the TCA cycle intermediate succinyl-CoA (Bentley et al., 2000). So far, this pathway has remained unexplored in S. coelicolor, although it was shown to be relevant for the production of monensin in Streptomyces cinnamonensis (Vrijbloed et al., 1999) and for the production of erythromycin in Sac. erythraea
Heterologous Production of Polyketides in Bacteria
347
(Reeves et al., 2007). Finally, new pathways devoted to substrate production can be efficiently introduced into the producer strain (see below) (Fig. 15.1E). One inconvenience of working with S. coelicolor is that unmethylated DNA is required for transformation or conjugation experiments, which adds a step to the protocols, for isolation of unmethylated DNA from appropriate E. coli dam– dcm– strains, like ET12567 (Flett et al., 1997). This inconvenience was avoided by creating another ‘‘clean’’ host from a closely related strain, S. lividans 66. The genetically modified strain is called K4-114 and is equivalent to CH999 (Ziermann and Betlach, 1999). The main advantage is that S. lividans does not posses a restriction system for heterologously methylated DNA and the same genetic tools for S. coelicolor can be used (Kieser et al., 2000). Another problem encountered in heterologous polyketide production is that many of these compounds need post-PKS modification in order to generate a bioactive molecule. Tailoring enzymes commonly include cyclases, group transferases (e.g., C-, O-, and N-methyltransferases, glycosyltransferases, and acyltransferases), cytochrome P450-type oxygenases and oxidoreductases (Fig. 15.1F). Fortunately, these enzymes are usually in the same gene cluster next to the PKS genes and are cloned and expressed together in the heterologous host. A major issue, however, occurs with the glycosylation reactions, because the glycosyltransferases often utilize specialized TDP-deoxysugars, which are not present in the surrogate host. Therefore, all the genes representing the sugar biosynthesis pathway have to be coexpressed together with the PKS genes. One approach to overcome this problem consists in developing a two-step fermentation process; in the first the aglycone is made in the surrogate host and the purified molecule is fed to a fermentor containing the original producer impaired for PKS production where the compound can be naturally glycosylated.
4. Procedure for the Heterologous Production of Polyketides in S. coelicolor Although it will be impossible to define a standard protocol for the production of any polyketide found in nature, as an example of the most extended system used, here we describe general steps toward the heterologous production of polyketides in S. coelicolor CH999. 1. Previous knowledge of the precursors required for the biosynthesis of a particular polyketide will help to predict the success of using S. coelicolor as a heterologous host (Fig. 15.1E). This system has been extensively used for production of malonyl- and methylmalonyl-CoA–derived polyketides.
348
Eduardo Rodriguez et al.
If special precursors are needed to produce a particular polyketide, additional genes can be incorporated in separate plasmids, as will be discussed in the next section. Alternatively, some metabolites (as S-N-acetyl cysteamine–derivatives) can be added to fermentation media to generate the precursor needed ( Jacobsen et al., 1997). 2. Design and construction of an expression vector containing the entire PKS gene cluster of interest. For this, appropriate cloning sites at both ends of the PKS genes have to be engineered by PCR or gene synthesis (Kodumal et al., 2004). Considering that actinomycetes, the largest family of polyketides producers, have genomes with an average GC content of 70% or more, AT-rich restriction sites are rarely found in PKS genes of actinomycete origin, making these restriction sites very useful for cloning purposes. For example, in pKAO127 (Ziermann and Betlach, 1999), a pRM5 derivative, unique sites available for cloning are PacI, NdeI, NsiI, and EcoRI. Particularly useful are the NdeI and NsiI sites, which can be introduced at the start codon of the first PKS gene and at the stop codon of the last gene or module, respectively. This strategy leaves the gene cluster under the control of the actI promoter, which is tightly regulated by the ActII-ORF4 activator. Alternative vectors carrying others replicons, different selection markers, a cos sequence for in vitro phage packaging, oriT for conjugal transfer or site-specific integration systems have been developed and widely used for heterologous expression of PKS genes (Rodriguez et al., 2003; Xue et al., 1999; Ziermann and Betlach, 2000). 3. Select an appropriate delivery method for introducing DNA into the host (Fig. 15.1). Many actinomycetes permit the introduction of DNA through conjugal mating mediated by E. coli using the RP4 system. Therefore, if the shuttle vector used for cloning/expressing the PKS genes has an oriT, conjugation using E. coli as donor strain is the most appropriate method for delivering the plasmid into S. coelicolor. However, this strain, like some other actinomycetes, contains a strong restriction system that degrades methylated DNA when it is transferred from E. coli. This is circumvented by the use of the totally nonmethylating E. coli ET12567 strain containing the plasmid pUB307, which provides in trans the functions for the mobilization of the oriT-containing plasmid used for PKS cloning (Flett et al., 1997). A classical protocol for E. coli/Streptomyces conjugation can be found in Practical Streptomyces Genetics (Kieser et al., 2000). For expression vectors that are nonmobilizable (i.e., lack oriT ), a PEG-mediated transformation protocol could be efficiently used. Type I modular PKS genes usually contain repetitive highly homologous DNA regions presenting the conserved domains from different modules. Therefore, it is highly recommended to check by restriction digestions the integrity of the plasmid DNA isolated from ET12567, a
Heterologous Production of Polyketides in Bacteria
349
homologous recombination-proficient strain, before its introduction by transformation into S. coelicolor. Standard transformation protocols can be found in Practical Streptomyces Genetics (Kieser et al., 2000). 4. Once a bona fide S. coelicolor transformant has been selected it is possible to screen for the successful production of the heterologous polyketide by checking for its bioactivity (if it has one) or by using analytical methods like spectroscopic techniques (LC-MS).
5. System Improvements for the Heterologous Production of Polyketides in Streptomyces spp. As mentioned above, although S. coelicolor CH999 and its partner S. lividans K4-114 have been successfully used for the heterologous production of many polyketides, including type I PKS and hybrid NRPS/PKS gene clusters, there are still some limitations in the whole procedure that could be improved. One of them is related to the manipulation of large pieces of DNA (e.g., for cloning and transferring large type I modular PKSs), which usually requires several cloning steps. The second limitation is associated with the low production levels of heterologously expressed polyketides, especially when expression of engineered PKSs genes is involved or when precursor supply is inadequate. To solve these problems, several new methods and tools have been developed and are discussed below.
5.1. Handling large PKS genes 5.1.1. Assembling PKS pathways by DNA recombination Assembly of large PKS genes can be very tedious and is often one of the most problematic steps in the lateral transfer of a complete polyketide biosynthesis pathway. Some alternatives to straightforward cloning techniques have been successfully explored. For example, a pCK7 vector containing the complete 6dEB biosynthetic pathway was constructed entirely in E. coli using derivatives of pMAK705 that permit in vivo recombination between a temperature-sensitive and recipient plasmid (Kao et al., 1994). An alternative method for reconstructing large PKSs genes has been carried out by using the ET-cloning technology. This technique has recently been used for assembling the complete myxochromide S pathway from Stigmatella aurantiaca in E. coli and finally transferring it into Pseudomonas putida by conjugation (Wenzel et al., 2005). In addition, a series of pSET152derivative vectors containing a cos sequence that allows in vitro phage packaging for cloning large DNA fragments (up to 50 kb) with high efficiency, have been developed (Rodriguez et al., 2003).
350
Eduardo Rodriguez et al.
A new technology to synthesize accurately long pieces of DNA was used for the construction of more than 30-kb polyketide synthase gene cluster, concomitantly enabling the manipulation of codon usage and introduction of restriction sites (Kodumal et al., 2004). To this end, small ‘‘synthon’’ fragments of 500 bp are built using 40-bp oligos by automated PCR-based gene synthesis. These synthons are then efficiently joined together into 5-kb fragments using endonucleases and ‘‘ligation by selection.’’ 5.1.2. BAC plasmids An alternative strategy for introducing large PKS clusters into Streptomyces or other related actinomycetes would be to start from libraries made in bacterial artificial chromosomes (BAC plasmids), which can accommodate DNA inserts of 150 kb on average, but with a range from 100 to 300 kb. These BAC plasmids can be easily manipulated in E. coli and then transferred into Streptomyces by conjugation (Martinez et al., 2004). Because of their high cloning capacity they allow the cloning not only of the PKS biosynthetic genes but also regulatory and resistance functions of the specific system and even other genes involved in the modification of the aglycones and/or the genes involved in precursor biosynthesis that are sometimes associated with the specific pks cluster. Examples of successful expression of large gene clusters in heterologous hosts by using BACs are the production of daptomycin in S. lividans (Penn et al., 2006) or the biosynthesis of landomycin A in Streptomyces fradiae Tu¨2717 (von Mulert et al., 2004). 5.1.3. Multiplasmid approach Another strategy to solve the problem of manipulating large DNA fragments is by cloning each gene of a modular PKS cluster on different plasmids. This approach allows reduction of the sizes of the DNA fragments to be manipulated, thereby improving the cloning efficiency in addition to facilitating the mixing of plasmids carrying different PKS genes for combinatorial biosynthesis assays. This multiplasmid approach was validated using the eryA genes, where each of the eryAI-III genes encoding the three DEBS subunits was individually cloned under the actI promoter into three compatible Streptomyces vectors carrying different selection markers (Xue et al., PNAS 1999). The utility of this system in combinatorial biosynthesis was demonstrated by the generation of a library of modified polyketide macrolactones by combining plasmid-containing native or genetically engineered eryA genes. In addition, this system allowed combining entire protein subunits from different modular PKSs to create hybrid polyketide pathways. Thus, the pikAI and pikAII genes from the picromycin gene cluster of Streptomyces venezuelae and the eryAIII gene were cloned in two compatible expression vectors and cointroduced by transformation into S. lividans K4-114, yielding the hybrid macrolactone 3-hydroxynarbonolide (Tang et al., 2000).
Heterologous Production of Polyketides in Bacteria
351
Coexpression of the same pik genes with the oleAIII gene from the oleandomycin gene cluster of Streptomyces antibioticus was also successful. A series of hybrid polyketide pathways was then constructed by combining pik genes with hybrid eryA genes. This work represents a new strategy that complements earlier domain engineering approaches for combinatorial biosynthesis in which complete modules or PKS protein subunits, in addition to individual enzymatic domains, are used as building blocks for PKS engineering (Tang et al., 2000). See also Chapter 13 in this volume.
5.2. Improving polyketide titers A problem that is faced in the application of genetic engineering approaches to polyketide production is that heterologous expression of engineered or hybrid PKSs generally produces much less polyketide product than is made by the parent organism, presumably due to lower productivity of the engineered enzyme. Several strategies have been followed in order to improve the titer of heterologous polyketide production. 5.2.1. High copy–number plasmids In order to increase the expression levels of PKSs genes several mediumto high-copy replicons were unsuccessfully tested, presumably due to instability problems when containing large DNA inserts (Hu et al., 2003b). Interestingly, a high copy–number, SCP2-derived replicon with a 45-bp deletion (SCP2@), was isolated (Hu et al., 2003b). This SCP2@ can form cointegrates with other SCP2 derivatives, resulting in an increased copy number of the second replicon, and when used as vector for expression of PKS genes, caused a large increase in polyketide production. Although SCP2@ has not been tested in other host systems, SCP2*-derivative vectors have shown a broad host range, including Streptomyces parvulus, Streptomyces venezuelae, and Sac. erythraea. 5.2.2. Superhost-vector systems Classical strain improvement methodology, which involves multiple rounds of mutagenesis and screening, has been largely used in industry to generate strains of Streptomyces and related actinomycestes producing several grams per liter of polyketides like tylosin, erythromycin, avermectin, and so on (Parekh et al., 2000). Recently, studies of two industrial organisms, Sac. erythraea and S. fradiae, demonstrated that one reason for their overproduction capacity was associated with genetic changes that improve PKS expression, rather than from changes in the catalytic properties of the PKSs themselves in these industrial strains (Chng et al., 2008; Lum et al., 2004; Rodriguez et al., 2003). These results supported further development of these industrial strains as ‘‘superhosts’’ to enhance polyketide titers produced by native and genetically modified PKSs.
352
Eduardo Rodriguez et al.
As a first step in developing Sac. erythraea and S. fradiae strains as superhosts for the production of bioactive 14- and 16-membered macrolides, respectively, a ‘‘clean-host’’ version of each industrial strain was constructed by deleting the corresponding PKSs genes and leaving intact all the tailoring genes necessary for the decoration of the polyketides (Fig. 15.2). A ‘‘clean-host’’ version of the industrial Sac. erythraea strain, named K24-1, Tylosin PKS genes
PtylGI
attBFC31
attBpSAM2
S. fradiae Sugar biosynthesis
Sugar biosynthesis Allelic exchange PtylGI
attBF C31
attBpSAM2
“Clean host” S. fradiae K159-1
neoR
attPpSAM2
ori pUC18 PtylGI
Methoxymalonyl-ACP biosynthesis genes Conjugation withE. coli DH5`a /pBU307 attBF C31
PtylGI
PtylGI
neo
Methoxymalonyl-ACP biosynthesis genes attPF C31
apra
ori pUC18 Midecamycin PKS genes
PtylGI
Conjugation with E. coli DH5 a /pBU307 PtylGI
PtylGI
apra R
Midecamycin PKS genes
PtylGI
Sugar biosynthesis
Methoxymalonyl-ACP neoR biosynthesis genes
Fermentation
O
O CHO
O O
O
OH OH
P la te nolide
O O
O
HO O OH
O
N(CH3)2 O
OH
O
OH
3-4A⬘⬘-didespropionyl-midecamycin A3
Figure 15.2 Heterologous production of midecamycin-related compounds in S. fradiae.The first step involves the construction of a‘‘clean-host’’ by deleting the tyl PKS genes. Introduction of the methoxymalonyl-ACP pathway from the FK506 gene cluster was achieved by integrating it in the pSAM2attB site. Integration of the midecamycin PKS genes from Streptomyces mycarofaciens under the control of the tylGI promoter at the FC31 phage attachment site allowed the production of 3,400;-didespropionyl-midecamycin A3. All plasmids were delivered by conjugation from E. coli DH5a/pUB307.
Heterologous Production of Polyketides in Bacteria
353
was constructed by replacing the eryAI–III genes by the phage FC31 attB sequence from S. lividans, since sequence analysis had indicated that the phage attachment site was absent from this host (Rodriguez et al., 2003). In addition, an ermE* promoter was engineered downstream of the attB site to drive expression of four erythromycin biosynthetic genes located downstream of the eryAIII gene. The incorporation of an attB locus allowed an increase of at least 100-fold in the transformation frequency of FC31integrative vectors. This large increase in conjugation-integration efficiency allowed pSET152-derived vectors (Bierman et al., 1992), containing the entire set of DEBS genes (>30 kb), to be integrated into the K24-1 strain with high fidelity. Insertion of the FC31 attB site is a valuable tool with broad application in actinomycetes and other microorganisms, including Pseudomonas putida (Martinez et al., 2004). Similarly, a clean-host version of the industrial S. fradiae strain, K159-1, was constructed by deleting the tylGI-V genes encoding the tylosin PKS and leaving the tylGI promoter for expression of the deoxysugar genes downstream of the tylGV locus. Introduction of an attB site into S. fradiae was unnecessary because it already contains one. For both strains, and in agreement with results with S. coelicolor, it was found that only the native PKS promoter was capable of sustaining high polyketide titers, suggesting that the expression level of PKS genes is the primary factor associated with the overproducing capability of both strains. Recently, it was demonstrated that in the Sac. erythraea overproducer strain this effect was correlated with a higher expression level of BldD, a recently identified positive regulator of the erythromycin biosynthetic genes (Chng et al., 2008; Lum et al., 2004). The potential for using a previously optimized industrial microorganism as a host for improved polyketide production capitalizes on the intrinsic overproduction properties of the strain and on the extensive process development work already done to achieve optimal production conditions. The advantage of using such hosts for engineered polyketide overproduction was demonstrated by the enhanced production (50-fold improvement in titer) of erythromycin analogues expressing genetically engineered erythromycin PKSs in Sac. erythraea K24-1 compared to the production in a nonoptimized host like S. lividans K4-114 (Rodriguez et al., 2003). In addition, Sac. erythraea provided the ability to generate biologically active glycosylated derivatives of the structurally modified 6-dEB aglycones, and is therefore especially useful for overproduction of valuable erythromycin analogues or other compounds requiring these deoxysugars. The potential for using S. fradiae 159-1 was demonstrated by expressing a vast array of native and hybrid 16-membered macrolide PKSs from the tylosin, chalcomycin, midecamycin, and spiromycin gene clusters, thanks to the expanded precursor supply capability of the engineered strain, as discussed below (Reeves et al., 2004; Rodriguez et al., 2003, 2004; Ward et al., 2004).
354
Eduardo Rodriguez et al.
5.3. Optimization of conjugation protocols for industrial strains 5.3.1. Sac. erythaea 1. Harvest spores from one or two plates, filter through cotton, spin down, resuspend in 1 ml of 20% sterile glycerol and freeze at –80 . 2. Inoculate 20 ml of spore suspension (107 to 108 UFC) into 5 ml 2 YT and incubate at 30 with shaking for 1 to 2 h. 3. Spin down cells (recipient culture) and resuspend in a final volume of 100 ml. 4. Transform competent E. coli ET12567/pUB307 cells with an oriTcontaining vector and select for the marker of the incoming plasmid. ET12567 is used as donor strain since Sac. erythraea has a lower efficiency of transformation with methylated DNA. 5. Inoculate a colony into 5 ml LB containing chloramphenicol, kanamycin, and the antibiotic used to select for the oriT-containing plasmid and grow overnight at 30 . 6. Use half of the culture to check the integrity of the plasmid by restriction digestion. Modular PKSs usually contain large DNA fragments that can be highly homologous, which have the chance to rearrange in a recombination-proficient (RecAþ) strain like ET12567. 7. Spin down the rest of the cells, wash in 5 ml LB, and spin down again (donor culture). 8. Resuspend the donor culture with 100 ml of the recipient culture. 9. Spread on R5 plates containing 50 mg/ml nalidixic acid and incubate at 37 for 20 h. 10. Overlay with 3 ml of Soft Nutrient Agar (SNA) or sterile H2O containing 1 mg nalidixic acid and 1.5 mg of apramacyn and continue incubation at 34 for 48 h. 11. Streak potential exconjugants into new plates of selective media. 5.3.2. Cross-streak method for E. coli–streptomyces conjugation 1. 1 109 spores are pregerminated by heating for 10 min at 65 in 2 YT and then spread on conjugation plates (SFM for S. coelicolor and AS1 for S. fradiae). 2. Individual colonies of E. coli (ET12567/pUB307 for S. coelicolor or DH5a/pUB307 for S. fradiae) transformed with an oriT-containing vector are streaked on top of the conjugation plates containing the pregerminated spores and incubated 16 to 24 h at 30 . 3. Overlay with 3 ml of soft nutrient agar (SNA) or sterile water containing 1 mg nalidixic acid and 1.5 mg of the appropriate antibiotic and continue incubation at 30 . Since some Streptomyces colonies adhere to agar plates by digesting the agar (only if they contain the DagA agarase of S. coelicolor
Heterologous Production of Polyketides in Bacteria
355
A3(2)), E. coli colonies carrying different plasmids can be streaked on the same plate without mixing them after overlaying with the selective antibiotic. 4. Streak potential exconjugants into new plates of selective medium. This new conjugation protocol saves 1 day of work, since no overnight E. coli culture is necessary. Besides, this faster technique allows the conjugation of nearly 30 to 50 different colonies per plate, avoiding growing each E. coli clone individually before conjugation. The method is a potentially high-throughput technique that can be adapted for metagenomic research.
5.4. Optimizing polyketide precursors supply Identification of the precursors required for the biosynthesis of a particular polyketide, as well as the enzymatic pathways that generate them, are important steps that help to optimize the heterologous production of these natural compounds. Therefore, genetic manipulation of these pathways, either by overexpressing the native genes or by introducing heterologous genes for the reconstitution of new metabolic pathways, should increase the spectrum of PKS substrates in any particular host. Here we will describe the most important known polyketide precursor pathways and how these pathways were used for optimizing heterologous polyketide production. 5.4.1. Enhance precursor supply The classical extender units used for polyketide biosynthesis are malonylCoA and methylmalonyl-CoA, which generally come from primary metabolic pathways. The acyl-CoA carboxylase complexes (ACCase), characterized in S. coelicolor and other actinomycetes, are able to carboxylate acetyl- and propionyl-CoA to produce malonyl- and methylmalonyl-CoA, respectively (Diacovich et al., 2002; Rodriguez and Gramajo, 1999; Rodriguez et al., 2001). Alternatively, methylmalonyl-CoA can also derive from the Krebs intermediate succinyl-CoA through methylmalonyl-CoA mutase (MCM) (mutA y mutB) and methylmalonyl-CoA epimerase (meaB) (Korotkova and Lidstrom, 2004). Ethylmalonyl-CoA, used for the biosynthesis of several important 16-membered macrolide compounds like tylosin, can also be generated by carboxylation of butyryl-CoA by a substrate-tolerant ACCase complex (Diacovich et al., 2002). Crotonyl-CoA reductase encoded by the ccr genes is involved in the generation of butyryl-CoA from two acetate units, which has been shown to enhance ethylmalonyl-CoA incorporation and production of ethyl-substituted erythromycin derivative when the ccr gene from Streptomyces colinus was expressed in an engineered Sac. erythraea strain (Stassi et al., 1998). Other less common extender units like ethylmalonyl-CoA, methoxymalonyl-ACP, hydroxymalonyl-ACP, and
356
Eduardo Rodriguez et al.
aminomalonyl-ACP come from special pathways which sometimes are clustered with the polyketide biosynthetic genes (Wu et al., 2000). Knowledge from primary metabolic pathways can be used in order to enhance precursor supply. For example, over-expression of the acetyl-CoA carboxylase complex in S. coelicolor improves the concentration of malonylCoA and, as a consequence, increases the actinorhodin titer in laboratory conditions (Ryu et al., 2006). In Sac. erythraea, it was found that the methylmalonyl-CoA used for erythromycin biosynthesis comes from different pathways depending on the carbon source used (Reeves et al., 2006). In carbohydrate-based media methylmalonyl-CoA mutase acts as a drain of methylmalonyl-CoA, but in oil-based media MCM provides the methylmalonyl-CoA. This information was used to increase erythromycin production in an oil-based fermentation medium by engineering the methylmalonyl-CoA route through duplication of the methylmalonyl-CoA mutase operon (Reeves et al., 2007). 5.4.2. Incorporation of new precursor pathways Although S. coelicolor naturally produces malonyl-CoA–derived polyketides, it also has the capacity to produce several mg/l of 6-dEB, a propionyl-CoA/ methylmalonyl-CoA–derived polyketide. This is achieved by using, most probably, substrates generated by the endogenous ACCase complexes (Rodriguez and Gramajo, 1999). Moreover, Lombo et al. (2001) also demonstrated that by introducing into S. coelicolor CH999 a heterologous precursor pathway consisting of the MatB and MatC enzymes, a malonylCoA synthase, and a putative dicarboxylate transport protein able to convert exogenous malonate and methylmalonate into their corresponding CoA thioesters, the capacity of this strain to produce 6-dEB was improved threefold. In addition, the capacity of CH999 for precursor supply was expanded further by introducing a set of genes involved in the biosynthesis of the extender unit methoxymalonyl-ACP from the ascomycin gene cluster (Wu et al., 2000) and used for production of new 6-dEB analogues (Kato et al., 2002). Tylosin is a16-membered macrolide that requires malonyl-, methylmalonyl-, and ethylmalonyl-CoA precursors for its biosynthesis (Cundliffe et al., 2001). The polyketide production capacity of the industrial strain of S. fradiae mentioned above was also expanded by introducing the methoxymalonyl-ACP biosynthetic pathway of FK520 from Streptomyces hygroscopicus (Wu et al., 2000). The resulting strain can produce the four different precursors, malonyl-CoA, methylmalonyl-CoA, ethylmalonylCoA, and methoxymalonyl-ACP, and produced more than 2 g/l of a 16-membered macrolide through heterologous expression of native and hybrid PKSs from the tylosin, chalcomycin, spiromycin, and midecamycin gene clusters (Reeves et al., 2004; Rodriguez et al., 2003, 2004; Ward et al., 2004). These experiments not only allowed the production of large
Heterologous Production of Polyketides in Bacteria
357
amounts of new 16-memberd macrolides but also helped to study the flexibility of tailoring enzymes toward alternative aglycones. The modifications included glycosylation by TylMII, which adds mycaminose to the 5-hydroxyl group (Gandecha et al., 1997), oxidation at C-20 by the cytochrome P450 TylI (Merson-Davies and Cundliffe, 1994), and attachment of mycarose by TylCV (Bate et al., 2000). To introduce the genes for the methoxymalonyl-ACP pathway into S. fradiae, a new integrative vector containing elements of the pSAM2integration system was developed. This new vector is compatible with FC31 integrative plasmids and integrates with high efficiency at a specific tRNA locus. A set of five genes, fkbG-K (homologues to asm13-17), from the FK520 gene cluster of S. hygroscopicus, was assembled in plasmid pKOS24417a, carrying a site-specific integration system (the integrase intpSAM2 gene and the attachment site attPpSAM2 from pSAM2), and a selection marker compatible with pSET152-derived plasmids. In this plasmid the intpSAM2 gene is under the control of the intFC31 promoter rather than its natural promoter. This plasmid is compatible with FC31-derived vectors, permitting integration of PKS genes and precursor pathway genes on separate plasmids. Thus, integration of the fkbG-K cluster and the full mdm PKS genes in this host produced 1 g/l of 3, 4-didespropionylmidecamycin A3 (Fig. 15.2). Using the same expression system a hybrid chalcomycin-spiramycin PKS operon in S. fradiae yielded a new series of hybrid 16-membered macrolides (Reeves et al., 2004).
6. Recent Developments for the Production of Polyketides in Nonactinomycete Bacteria 6.1. E. coli as heterologous host E. coli is, without doubt, the best-studied bacterium from the physiological point of view. Besides, this strain also possess the best developed molecular biology protocols, the most abundant genetic tool box, and well-optimized fermentation protocols, which allow it to be grown to very high optical density (>150 OD590 nm) in less than 48 h in a simple and inexpensive medium. Furthermore, E. coli also has the best developed plasmid systems and expression vectors, which have been extensively used for the efficient production of recombinant proteins for industrial and pharmaceutical applications. Finally, it has long been used as a model for genetic and metabolic engineering. All these factors made E. coli one of the best candidates to be developed into a surrogate host for the expression of heterologous biosynthetic pathways for the production of industrially or pharmaceutically relevant molecules.
358
Eduardo Rodriguez et al.
However, a drawback is that E. coli is not an abundant producer of secondary metabolites, and so it probably lacks the intracellular machinery needed to make a wide range of natural products. E. coli, however, does produce some natural products in the terpenoid and NRP families, but not polyketides (Altincicek et al., 2001). Therefore, to convert E. coli into a producer of heterologous polyketides several limitations had to be addressed and overcome. The most important issues to be considered where: (1) to have a good expression/vector system that could accommodate and transcribe large fragments of DNA, (2) to find conditions in which the transcribed genes were efficiently translated into active (properly folded) proteins, (3) to find and introduce a tolerant phosphopantetheinyltransferase (PPTase) for efficient post-translational modification of ACPs, (4) to introduce the biosynthetic pathways needed to generate the appropriate substrates for the PKSs introduced, and (5) to coexpress resistance mechanisms toward the compound to be made if this presented toxicity or antibacterial activity. The first polyketide to be made in E. coli was 6dEB (Pfeifer et al., 2001). To achieve this, a BL21-derived E. coli strain was extensively engineered. A PPTase gene from Bacillus subtilis, sfp, was inserted into the prp operon responsible for propionate catabolism in E. coli, deleting the prpRBCD genes but leaving prpE under the inducible T7 promoter. The PrpE protein is necessary to convert exogenous propionate into propionyl-CoA, the starter unit of 6dEB and a substrate of the propionyl-CoA carboxylase (PCC) that converts it into (2S)-methylmalonyl-CoA, used as extender unit by DEBS for 6dEB biosynthesis, but propionate catabolism was abolished, thus avoiding wastage of this building unit. The accA2-pccB genes, coding for the two subunits of the PCC of S. coelicolor (Rodriguez and Gramajo, 1999), and the three debs genes were introduced on selectable pET plasmids (Novagene), allowing the successful production of 6dEB in E. coli (Pfeifer et al., 2001). In order to identify and optimize parameters that affect polyketide production in engineered E. coli, three independent pathways were later investigated for supply of the extender unit (2S)-methylmalonyl-CoA. These studies showed that the PCC pathway was predominant, as indicated by greater flux of 13C-propionate into 6dEB through the PCC pathway, compared to the S. coelicolor malonyl/methylmalonyl-CoA ligase (matB) pathway or the Propionibacterium shermanii methylmalonyl-CoA mutase/ epimerase pathway (Murli et al., 2003). The high GC content of the DNA of actinomycete PKS genes leads to an inappropriate bias in codon usage that usually causes poor translation of the proteins. To overcome this issue, extra copies of the rare AGG and CCC codons can be helpful (Schenk et al., 1995). Alternatively, a method for the semisynthetic synthesis of long and accurate DNA sequences could be used (Kodumal et al., 2004). The method enables the manipulation of the
Heterologous Production of Polyketides in Bacteria
359
codon bias and also deletion or insertion of restriction sites as desired without changing the encoded protein sequence. The applicability of this idea to natural product research was shown by the total synthesis of the complete debs genes cluster comprising 32 kb of contiguous synthetic DNA using conventional cloning methods. The synthetic gene cluster was finally expressed in E. coli and the corresponding product 6dEB was produced. This method is extremely powerful and provides the possibility to generate a tool box of several synthetic PKS modules from different biosynthetic gene clusters, which can then be combined to generate novel hybrid pathways to produce new compounds. In recent studies, coexpression of two biosynthetic gene clusters responsible for the production of deoxysugars, TDP-L-mycarose and TDP-D-desosamine, were also reconstituted in E. coli and when coexpressed with the debs genes, the P450 auxiliary proteins and the erythromycin resistance ermE gene, the potent antibiotic erythromycin C was produced (Peiru et al., 2005). Moreover, by carrying out metabolic engineering of three endogenous pathways that lead to the synthesis of TDP sugars in E. coli, we have greatly improved the intracellular levels of the common deoxysugar intermediate TDP-4-keto-6-deoxyglucose, resulting in increased production of the heterologous sugars TDP-L-mycarose and TDP-D-desosamine, both components of medically important polyketides. Bioconversion experiments carried out by feeding 6-deoxyerythronolide B (6-dEB) or 3-a-mycarosylerythronolide B (MEB) demonstrated that the genetically modified E. coli B strain was able to produce 60- and 25-fold more erythromycin D (EryD) than the original strain K207-3, respectively (Peiru et al., 2008). Several other natural compounds have now been successfully made in E. coli. One remarkable achievement was the production of epothilones C and D (Mutka et al., 2006). Here, several important genetic manipulations were made both to optimize expression of the substrate biosynthetic pathways and to enhance heterologous expression of the EpoD protein (765 kDa). For this, several genetic manipulations were done to split these proteins into two polypeptides that helped protein solubilization and allowed protein reconstitution. Also the use of pBAD promoters, inducible by arabinose, codon optimization and chaperone coexpression strategies were used to successfully produce the final compound. Other examples of heterologous biosynthesis of the products of PKS/ NRPS hybrids in E. coli, like yersiniabactin (Pfeifer et al., 2003) and the NRPS-like product echinomycin (Watanabe et al., 2006) have been reported.
6.2. Pseudomonas putida as heterologous host Unlike most secondary metabolite producing hosts, such as streptomycetes, pseudomonads grow easily and rapidly in culture and their metabolic versatility has transformed them into very useful organisms from the
360
Eduardo Rodriguez et al.
biotechnological point of view. As a heterologous host for the production of natural compounds, P. putida has several advantage compared with other systems. For example the high-GC genomic DNA content and the codon usage makes it more suitable than E. coli for the expression of actinomycete and myxobacterial genes. It also has a very promiscuous PPTase that allows it to activate PKSs and NRPSs from myxobacteria and Streptomyces spp. (Finking et al., 2002; Gross et al., 2005). Furthermore, because of the lack of intrinsic pathways for natural products, it is less likely that the expression of heterologous natural compound pathways could suffer substrate competition. P. putida has been successfully used for the production of myxochomide S, a compound produced by the myxobacterium Stigmatella aurantiaca (Wenzel et al., 2005) and for expression of a silent type III polyketide synthase, which was identified in the genome sequence of Sorangium cellulosum So ce56. The expression of this gene allowed the corresponding product flaviolin to be identified (Gross et al., 2006).
REFERENCES Altincicek, B., Kollas, A., Eberl, M., Wiesner, J., Sanderbrand, S., Hintz, M., Beck, E., and Jomaa, H. (2001). LytB, a novel gene of the 2-C-methyl-D-erythritol 4-phosphate pathway of isoprenoid biosynthesis in Escherichia coli. FEBS Lett. 499, 37–40. Bate, N., Butler, A. R., Smith, I. P., and Cundliffe, E. (2000). The mycarose-biosynthetic genes of Streptomyces fradiae, producer of tylosin. Microbiology 146(Pt 1), 139–146. Bedford, D. J., Schweizer, E., Hopwood, D. A., and Khosla, C. (1995). Expression of a functional fungal polyketide synthase in the bacterium Streptomyces coelicolor A3(2). J. Bacteriol. 177, 4544–4548. Bentley, S. D., Chater, K. F., Cerdeno-Tarraga, A. M., Challis, G. L., Thomson, N. R., James, K. D., Harris, D. E., Quail, M. A., Kieser, H., Harper, D., Bateman, A., Brown, S., et al. (2002). Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417, 141–147. Bierman, M., Logan, R., O’Brien, K., Seno, E. T., Rao, R. N., and Schoner, B. E. (1992). Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116, 43–49. Bode, H. B., and Muller, R. (2005). The impact of bacterial genomics on natural product research. Angew. Chem. Int. Ed. Engl. 44, 6828–6846. Clardy, J., and Walsh, C. (2004). Lessons from natural molecules. Nature 432, 829–837. Cortes, J., Wiesmann, K. E., Roberts, G. A., Brown, M. J., Staunton, J., and Leadlay, P. F. (1995). Repositioning of a domain in a modular polyketide synthase to promote specific chain cleavage. Science 268, 1487–1489. Cundliffe, E., Bate, N., Butler, A., Fish, S., Gandecha, A., and Merson-Davies, L. (2001). The tylosin-biosynthetic genes of Streptomyces fradiae. Antonie Van Leeuwenhoek 79, 229–234. Chng, C., Lum, A. M., Vroom, J. A., and Kao, C. M. (2008). A key developmental regulator controls the synthesis of the antibiotic erythromycin in Saccharopolyspora erythraea. Proc. Natl. Acad. Sci. USA 105, 11346–11351. Diacovich, L., Peiru, S., Kurth, D., Rodriguez, E., Podesta, F., Khosla, C., and Gramajo, H. (2002). Kinetic and structural analysis of a new group of Acyl-CoA carboxylases found in Streptomyces coelicolor A3(2). J. Biol. Chem. 277, 31228–31236.
Heterologous Production of Polyketides in Bacteria
361
Donadio, S., and Sosio, M. (2003). Strategies for combinatorial biosynthesis with modular polyketide synthases. Comb. Chem. High Throughput Screen 6, 489–500. Finking, R., and Marahiel, M. A. (2004). Biosynthesis of nonribosomal peptides1. Annu. Rev. Microbiol. 58, 453–488. Finking, R., Solsbacher, J., Konz, D., Schobert, M., Schafer, A., Jahn, D., and Marahiel, M. A. (2002). Characterization of a new type of phosphopantetheinyl transferase for fatty acid and siderophore synthesis in Pseudomonas aeruginosa. J. Biol. Chem. 277, 50293–50302. Flett, F., Mersinias, V., and Smith, C. P. (1997). High efficiency intergeneric conjugal transfer of plasmid DNA from Escherichia coli to methyl DNA-restricting streptomycetes. FEMS Microbiol. Lett. 155, 223–229. Fortman, J. L., and Sherman, D. H. (2005). Utilizing the power of microbial genetics to bridge the gap between the promise and the application of marine natural products. ChemBioChem 6, 960–978. Fu, H., Ebert-Khosla, S., Hopwood, D. A., and Khosla, C. (1994). Engineered biosynthesis of novel polyketides: Dissection of the catalytic specificity of the act ketoreductase. J. Am. Chem. Soc. 116, 4166–4170. Gandecha, A. R., Large, S. L., and Cundliffe, E. (1997). Analysis of four tylosin biosynthetic genes from the tylLM region of the Streptomyces fradiae genome. Gene 184, 197–203. Gould, S. J., Hong, S. T., and Carney, J. R. (1998). Cloning and heterologous expression of genes from the kinamycin biosynthetic pathway of Streptomyces murayamaensis. J. Antibiot. (Tokyo) 51, 50–57. Gramajo, H. C., Takano, E., and Bibb, M. J. (1993). Stationary-phase production of the antibiotic actinorhodin in Streptomyces coelicolor A3(2) is transcriptionally regulated. Mol. Microbiol. 7, 837–845. Gross, F., Gottschalk, D., and Muller, R. (2005). Posttranslational modification of myxobacterial carrier protein domains in Pseudomonas sp. by an intrinsic phosphopantetheinyl transferase. Appl. Microbiol. Biotechnol. 68, 66–74. Gross, F., Luniak, N., Perlova, O., Gaitatzis, N., Jenke-Kodama, H., Gerth, K., Gottschalk, D., Dittmann, E., and Muller, R. (2006). Bacterial type III polyketide synthases: Phylogenetic analysis and potential for the production of novel secondary metabolites by heterologous expression in pseudomonads. Arch. Microbiol. 185, 28–38. Hong, S. T., Carney, J. R., and Gould, S. J. (1997). Cloning and heterologous expression of the entire gene clusters for PD 116740 from Streptomyces strain WP 4669 and tetrangulol and tetrangomycin from Streptomyces rimosus NRRL 3016. J. Bacteriol. 179, 470–476. Hopwood, D. A., and Khosla, C. (1992). Genes for polyketide secondary metabolic pathways in microorganisms and plants. Ciba Found. Symp. 171, 88–106; discussion 106–112. Hu, Z., Desai, R. P., Volchegursky, Y., Leaf, T., Woo, E., Licari, P., Santi, D. V., Hutchinson, C. R., and McDaniel, R. (2003a). Approaches to stabilization of interdomain recombination in polyketide synthase gene expression plasmids. J. Ind. Microbiol. Biotechnol. 30, 161–167. Hu, Z., Hopwood, D. A., and Hutchinson, C. R. (2003b). Enhanced heterologous polyketide production in Streptomyces by exploiting plasmid co-integration. J. Ind. Microbiol. Biotechnol. 30, 516–522. Ichinose, K., Ozawa, M., Itou, K., Kunieda, K., and Ebizuka, Y. (2003). Cloning, sequencing and heterologous expression of the medermycin biosynthetic gene cluster of Streptomyces sp. AM–7161: Towards comparative analysis of the benzoisochromanequinone gene clusters. Microbiology 149, 1633–1645. Jacobsen, J. R., Hutchinson, C. R., Cane, D. E., and Khosla, C. (1997). Precursor-directed biosynthesis of erythromycin analogs by an engineered polyketide synthase. Science 277, 367–369.
362
Eduardo Rodriguez et al.
Julien, B., and Shah, S. (2002). Heterologous expression of epothilone biosynthetic genes in Myxococcus xanthus. Antimicrob. Agents Chemother. 46, 2772–2778. Kalaitzis, J. A., and Moore, B. S. (2004). Heterologous biosynthesis of truncated hexaketides derived from the actinorhodin polyketide synthase. J. Nat. Prod. 67, 1419–1422. Kao, C. M., Katz, L., and Khosla, C. (1994). Engineered biosynthesis of a complete macrolactone in a heterologous host. Science 265, 509–512. Kao, C. M., Luo, G., Katz, L., Cane, D. E., and Khosla, C. (1995). Manipulation of macrolide ring size by directed mutagenesis of a modular polyketide synthase. J. Am. Chem. Soc. 117, 9105–9106. Kato, Y., Bai, L., Xue, Q., Revill, W. P., Yu, T. W., and Floss, H. G. (2002). Functional expression of genes involved in the biosynthesis of the novel polyketide chain extension unit, methoxymalonyl-acyl carrier protein, and engineered biosynthesis of 2-desmethyl2-methoxy-6-deoxyerythronolide B. J. Am. Chem. Soc. 124, 5268–5269. Kelemen, G. H., Brian, P., Flardh, K., Chamberlin, L., Chater, K. F., and Buttner, M. J. (1998). Developmental regulation of transcription of whiE, a locus specifying the polyketide spore pigment in Streptomyces coelicolor A3 (2). J. Bacteriol. 180, 2515–2521. Khosla, C. (1997). Harnessing the biosynthetic potential of modular polyketide synthases. Chem. Rev. 97, 2577–2590. Khosla, C., Ebert-Khosla, S., and Hopwood, D. A. (1992). Targeted gene replacements in a Streptomyces polyketide synthase gene cluster: Role for the acyl carrier protein. Mol. Microbiol. 6, 3237–3249. Kieser, T., Bibb, M. J., Buttner, M. J., Chater, K. F., and Hopwood, D. A. (2000). ‘‘Practical Streptomyces genetics.’’ The John Innes Foundation, Norwich, UK. Kim, E. S., Cramer, K. D., Shreve, A. L., and Sherman, D. H. (1995). Heterologous expression of an engineered biosynthetic pathway: Functional dissection of type II polyketide synthase components in Streptomyces species. J. Bacteriol. 177, 1202–1207. Kodumal, S. J., Patel, K. G., Reid, R., Menzella, H. G., Welch, M., and Santi, D. V. (2004). Total synthesis of long DNA sequences: Synthesis of a contiguous 32-kb polyketide synthase gene cluster. Proc. Natl. Acad. Sci. USA 101, 15573–15578. Korotkova, N., and Lidstrom, M. E. (2004). MeaB is a component of the methylmalonylCoA mutase complex required for protection of the enzyme from inactivation. J. Biol. Chem. 279, 13652–13658. Lambalot, R. H., and Walsh, C. T. (1995). Cloning, overproduction, and characterization of the Escherichia coli holo-acyl carrier protein synthase. J. Biol. Chem. 270, 24658–24661. Lombo, F., Pfeifer, B., Leaf, T., Ou, S., Kim, Y. S., Cane, D. E., Licari, P., and Khosla, C. (2001). Enhancing the atom economy of polyketide biosynthetic processes through metabolic engineering. Biotechnol. Prog. 17, 612–617. Lum, A. M., Huang, J., Hutchinson, C. R., and Kao, C. M. (2004). Reverse engineering of industrial pharmaceutical-producing actinomycete strains using DNA microarrays. Metab. Eng. 6, 186–196. Martinez, A., Kolvek, S. J., Yip, C. L., Hopke, J., Brown, K. A., MacNeil, I. A., and Osburne, M. S. (2004). Genetically modified bacterial strains and novel bacterial artificial chromosome shuttle vectors for constructing environmental libraries and detecting heterologous natural products in multiple expression hosts. Appl. Environ. Microbiol. 70, 2452–2463. McDaniel, R., Ebert-Khosla, S., Hopwood, D. A., and Khosla, C. (1993a). Engineered biosynthesis of novel polyketides. Science 262, 1546–1550. McDaniel, R., Ebert-Khosla, S., Hopwood, D. A., and Khosla, C. (1993b). Engineered biosynthesis of novel polyketides: Manipulation and analysis of an aromatic polyketide synthase with unproven catalytic specificities. J. Am. Chem. Soc. 115, 11671–11675. McDaniel, R., Thamchaipenet, A., Gustafsson, C., Fu, H., Betlach, M., and Ashley, G. (1999). Multiple genetic modifications of the erythromycin polyketide synthase to
Heterologous Production of Polyketides in Bacteria
363
produce a library of novel ‘‘unnatural’’ natural products. Proc. Natl. Acad. Sci. USA 96, 1846–1851. Menzella, H. G., and Reeves, C. D. (2007). Combinatorial biosynthesis for drug development. Curr. Opin. Microbiol. 10, 238–245. Merson-Davies, L. A., and Cundliffe, E. (1994). Analysis of five tylosin biosynthetic genes from the tyllBA region of the Streptomyces fradiae genome. Mol. Microbiol. 13, 349–355. Murli, S., Kennedy, J., Dayem, L. C., Carney, J. R., and Kealey, J. T. (2003). Metabolic engineering of Escherichia coli for improved 6-deoxyerythronolide B production. J. Ind. Microbiol. Biotechnol. 30, 500–509. Mutka, S. C., Carney, J. R., Liu, Y., and Kennedy, J. (2006). Heterologous production of epothilone C and D in Escherichia coli. Biochemistry 45, 1321–1330. O’Hagan, D. (1991). ‘‘The polyketide metabolites.’’ Ellis Horwood, New York. Parekh, S., Vinci, V. A., and Strobel, R. J. (2000). Improvement of microbial strains and fermentation processes. Appl. Microbiol. Biotechnol. 54, 287–301. Peiru, S., Menzella, H. G., Rodriguez, E., Carney, J., and Gramajo, H. (2005). Production of the potent antibacterial polyketide erythromycin C in Escherichia coli. Appl. Environ. Microbiol. 71, 2539–2547. Peiru, S., Rodriguez, E., Menzella, H. G., Carney, J., and Gramajo, H. (2008). Metabolically engineered Escherichia coli for efficient production of glycosylated natural products. Microbial. Biotechnol. 1, 476–486. Penn, J., Li, X., Whiting, A., Latif, M., Gibson, T., Silva, C. J., Brian, P., Davies, J., Miao, V., Wrigley, S. K., and Baltz, R. H. (2006). Heterologous production of daptomycin in Streptomyces lividans. J. Ind. Microbiol. Biotechnol. 33, 121–128. Pfeifer, B. A., Admiraal, S. J., Gramajo, H., Cane, D. E., and Khosla, C. (2001). Biosynthesis of complex polyketides in a metabolically engineered strain of E. coli. Science 291, 1790–1792. Pfeifer, B. A., Wang, C. C., Walsh, C. T., and Khosla, C. (2003). Biosynthesis of Yersiniabactin, a complex polyketide-nonribosomal peptide, using Escherichia coli as a heterologous host. Appl. Environ. Microbiol. 69, 6698–6702. Reeves, A. R., Brikun, I. A., Cernota, W. H., Leach, B. I., Gonzalez, M. C., and Weber, J. M. (2006). Effects of methylmalonyl-CoA mutase gene knockouts on erythromycin production in carbohydrate-based and oil-based fermentations of Saccharopolyspora erythraea. J. Ind. Microbiol. Biotechnol. 33, 600–609. Reeves, A. R., Brikun, I. A., Cernota, W. H., Leach, B. I., Gonzalez, M. C., and Weber, J. M. (2007). Engineering of the methylmalonyl-CoA metabolite node of Saccharopolyspora erythraea for increased erythromycin production. Metab. Eng. 9, 293–303. Reeves, C. D., Ward, S. L., Revill, W. P., Suzuki, H., Marcus, M., Petrakovsky, O. V., Marquez, S., Fu, H., Dong, S. D., and Katz, L. (2004). Production of hybrid 16-membered macrolides by expressing combinations of polyketide synthase genes in engineered Streptomyces fradiae hosts. Chem. Biol. 11, 1465–1472. Rodriguez, E., Banchio, C., Diacovich, L., Bibb, M. J., and Gramajo, H. (2001). Role of an essential acyl coenzyme A carboxylase in the primary and secondary metabolism of Streptomyces coelicolor A3(2). Appl. Environ. Microbiol. 67, 4166–4176. Rodriguez, E., and Gramajo, H. (1999). Genetic and biochemical characterization of the alpha and beta components of a propionyl-CoA carboxylase complex of Streptomyces coelicolor A3(2). Microbiology 145(Pt 11), 3109–3119. Rodriguez, E., Hu, Z., Ou, S., Volchegursky, Y., Hutchinson, C. R., and McDaniel, R. (2003). Rapid engineering of polyketide overproduction by gene transfer to industrially optimized strains. J. Ind. Microbiol. Biotechnol. 30, 480–488. Rodriguez, E., and McDaniel, R. (2001). Combinatorial biosynthesis of antimicrobials and other natural products. Curr. Opin. Microbiol. 4, 526–534.
364
Eduardo Rodriguez et al.
Rodriguez, E., Ward, S., Fu, H., Revill, W. P., McDaniel, R., and Katz, L. (2004). Engineered biosynthesis of 16-membered macrolides that require methoxymalonylACP precursors in Streptomyces fradiae. Appl. Microbiol. Biotechnol. 66, 85–91. Rowe, C. J., Cortes, J., Gaisser, S., Staunton, J., and Leadlay, P. F. (1998). Construction of new vectors for high-level expression in actinomycetes. Gene 216, 215–223. Ryu, Y. G., Butler, M. J., Chater, K. F., and Lee, K. J. (2006). Engineering of primary carbohydrate metabolism for increased production of actinorhodin in Streptomyces coelicolor. Appl. Environ. Microbiol. 72, 7132–7139. Schenk, P. M., Baumann, S., Mattes, R., and Steinbiss, H. H. (1995). Improved high-level expression system for eukaryotic genes in Escherichia coli using T7 RNA polymerase and rare ArgtRNAs. Biotechniques 19, 196–198200. Song, L., Barona-Gomez, F., Corre, C., Xiang, L., Udwary, D. W., Austin, M. B., Noel, J. P., Moore, B. S., and Challis, G. L. (2006). Type III polyketide synthaseketoacyl-ACP starter unit and ethylmalonyl-CoA extender unit selectivity discovered by Streptomyces coelicolor genome mining. J. Am. Chem. Soc. 128, 14754–14755. Stassi, D. L., Kakavas, S. J., Reynolds, K. A., Gunawardana, G., Swanson, S., Zeidner, D., Jackson, M., Liu, H., Buko, A., and Katz, L. (1998). Ethyl-substituted erythromycin derivatives produced by directed metabolic engineering. Proc. Natl. Acad. Sci. USA 95, 7305–7309. Staunton, J., and Weissman, K. J. (2001). Polyketide biosynthesis: A millennium review. Nat. Prod. Rep. 18, 380–416. Streit, W. R., and Schmitz, R. A. (2004). Metagenomics—the key to the uncultured microbes. Curr. Opin. Microbiol. 7, 492–498. Tang, L., Fu, H., and McDaniel, R. (2000). Formation of functional heterologous complexes using subunits from the picromycin, erythromycin and oleandomycin polyketide synthases. Chem. Biol. 7, 77–84. von Mulert, U., Luzhetskyy, A., Hofmann, C., Mayer, A., and Bechthold, A. (2004). Expression of the landomycin biosynthetic gene cluster in a PKS mutant of Streptomyces fradiae is dependent on the coexpression of a putative transcriptional activator gene. FEMS Microbiol. Lett. 230, 91–97. Vrijbloed, J. W., Zerbe-Burkhardt, K., Ratnatilleke, A., Grubelnik-Leiser, A., and Robinson, J. A. (1999). Insertional inactivation of methylmalonyl coenzyme A (CoA). mutase and isobutyryl-CoA mutase genes in Streptomyces cinnamonensis: Influence on polyketide antibiotic biosynthesis. J. Bacteriol. 181, 5600–5605. Walsh, C. T. (2004). Polyketide and nonribosomal peptide antibiotics: Modularity and versatility. Science 303, 1805–1810. Ward, S. L., Hu, Z., Schirmer, A., Reid, R., Revill, W. P., Reeves, C. D., Petrakovsky, O. V., Dong, S. D., and Katz, L. (2004). Chalcomycin biosynthesis gene cluster from Streptomyces bikiniensis: Novel features of an unusual ketolide produced through expression of the chm polyketide synthase in Streptomyces fradiae. Antimicrob. Agents Chemother. 48, 4703–4712. Watanabe, K., Hotta, K., Praseuth, A. P., Koketsu, K., Migita, A., Boddy, C. N., Wang, C. C., Oguri, H., and Oikawa, H. (2006). Total biosynthesis of antitumor nonribosomal peptides in Escherichia coli. Nat. Chem. Biol. 2, 423–428. Weber, T., Welzel, K., Pelzer, S., Vente, A., and Wohlleben, W. (2003). Exploiting the genetic potential of polyketide producing streptomycetes. J. Biotechnol. 106, 221–232. Weissman, K. J., and Leadlay, P. F. (2005). Combinatorial biosynthesis of reduced polyketides. Nat. Rev. Microbiol. 3, 925–936. Wenzel, S. C., Gross, F., Zhang, Y., Fu, J., Stewart, A. F., and Muller, R. (2005). Heterologous expression of a myxobacterial natural products assembly line in pseudomonads via red/ET recombineering. Chem. Biol. 12, 349–356.
Heterologous Production of Polyketides in Bacteria
365
Wilkinson, C. J., Hughes-Thomas, Z. A., Martin, C. J., Bohm, I., Mironenko, T., Deacon, M., Wheatcroft, M., Wirtz, G., Staunton, J., and Leadlay, P. F. (2002). Increasing the efficiency of heterologous promoters in actinomycetes. J. Mol. Microbiol. Biotechnol. 4, 417–426. Wu, K., Chung, L., Revill, W. P., Katz, L., and Reeves, C. D. (2000). The FK520 gene cluster of Streptomyces hygroscopicus var. ascomyceticus (ATCC 14891) contains genes for biosynthesis of unusual polyketide extender units. Gene 251, 81–90. Xue, Q., Ashley, G., Hutchinson, C. R., and Santi, D. V. (1999). A multiplasmid approach to preparing large libraries of polyketides. Proc. Natl. Acad. Sci. USA 96, 11740–11745. Yu, T. W., and Hopwood, D. A. (1995). Ectopic expression of the Streptomyces coelicolor whiE genes for polyketide spore pigment synthesis and their interaction with the act genes for actinorhodin biosynthesis. Microbiology 141(Pt 11), 2779–2791. Ziermann, R., and Betlach, M. (2000). A two-vector system for the production of recombinant polyketides in Streptomyces. J. Ind. Microbiol. Biotechnol. 24, 46–50. Ziermann, R., and Betlach, M. C. (1999). Recombinant polyketide synthesis in Streptomyces: Engineering of improved host strains. Biotechniques 26, 106–110.
C H A P T E R
S I X T E E N
In Vitro Analysis of Type II Polyketide Synthase Wenjun Zhang and Yi Tang Contents 368 371 371 372 373 376 376 381
1. Introduction 2. Expression and Purification of Type II PKSs 2.1. Escherichia coli as a host for protein expression 2.2. ACP expression and modification 2.3. Streptomyces as a host for PKS expression 3. In Vitro Activity Assays 3.1. Minimal PKS activity assays 3.2. Starter unit synthesis and incorporation assays 3.3. Assays of tailoring enzymes responsible for aromatic polyketide scaffold formation: KR, ARO, and CYC 3.4. Assays of downstream tailoring enzymes Acknowledgments References
384 386 389 390
Abstract Bacterial type II polyketide synthases (PKSs) are responsible for the biosynthesis of therapeutically important aromatic polyketides, including daunorubicin and tetracycline. Discovery and cloning of the type II, actinorhodin biosynthetic gene cluster from Streptomyces coelicolor marked the beginning of a new era in natural product biosynthesis. While genetics has played an indispensable role in understanding the programming rules of this unique family of natural product biosynthetic pathways, in vitro reconstitution and characterization of individual protein components have provided important insights into their mechanisms and specificities. In this chapter, we will provide an overview of in vitro analysis of type II PKSs in recent years. We will first describe the expression and purification of individual type II PKS components from different sources. This will be followed by a detailed description of the most commonly employed assays used to study different components of the type II PKSs
Department of Chemical and Biomolecular Engineering, University of California-Los Angeles, Los Angeles, California, USA Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04616-3
#
2009 Elsevier Inc. All rights reserved.
367
368
Wenjun Zhang and Yi Tang
1. Introduction Aromatic polyketides (type II polyketides) constitute an important family of structurally diverse natural products (O’Hagan, 1991), including tetracyclines, anthracyclines (e.g., daunorubicin), aureolic acids (e.g., mithramycin), tetracenomycins, angucyclines (e.g., jadomycin and pradimicin), benzoisochromanequinones (e.g., actinorhodin and frenolicin), and so on (Fig. 16.1). Aromatic polyketides have a large range of medicinal applications, including the treatment of infectious diseases and cancer. For example, anthracyclines rank among the most important anticancer drugs in the market today (Batist, 2001); and tetracyclines and their semisynthetic derivatives are well-known broad-spectrum antibiotics with effective antimicrobial properties (Chopra and Roberts, 2001). Most known aromatic polyketides are produced by actinomycetes via type II polyketide synthases (PKSs) (Hertweck et al., 2007). The biosynthesis of type II polyketides has been studied extensively at the genetic level (Hopwood, 1997), starting with the cloning of the biosynthetic gene cluster of the model compound actinorhodin (Malpartida and Hopwood, 1984). Since then, genetic manipulations in both native producing hosts and in heterologous Streptomyces hosts (McDaniel et al., 1993), have led to the functional assignment of the enzymes involved in the many biosynthetic pathways. While genetics has played an indispensable role in revealing the programming rules of type II PKSs, a thorough understanding of the catalytic mechanisms and protein–protein interactions requires in vitro analysis. In contrast to type I PKSs in which catalytic domains are assembled linearly in multimodule megasynthases, type II PKSs are composed of dissociated enzymes. Each type II PKS gene cluster consists of genes encoding a minimal PKS and a collection of tailoring enzymes. The minimal PKS includes the ketosynthase (KS or KSa), the chain-length factor (CLF, alternatively referred to as KSb), and the acyl carrier protein (ACP) (Hertweck et al., 2007) (Fig. 16.2). The KS and CLF form a strongly associating heterodimer which is the site of the Claisen-like condensation of malonyl-ACP extender units. In addition, the malonyl-CoA:ACP acyltransferase (MAT) can be shared between fatty acid synthase (FAS) and PKS (Summers et al., 1995). The minimal PKS synthesizes a highly reactive polyb-ketone backbone, and the structural basis of the growing chain extruding in the active site of KS-CLF has been resolved (Keatinge-Clay et al., 2004). Interestingly, malonyl-CoA is used exclusively as the extender unit among all known type II PKSs, an invariant feature that is controlled by the highly stringent MAT (Koppisch and Khosla, 2003). Immediate tailoring enzymes, including ketoreductase (KR), cyclase (CYC), and aromatase (ARO), can regiospecifically reduce, cyclize, and dehydrate the polyketide chain,
O OH
OH
O
O O
O HO O
HO HO
O
O
O
OH O OH
O
OH
O NH2
H
H HO OH N Oxytetracycline O
OH
D O
OH
OH HN O
OH
O HO O
O
O O HN
OH O
HO HO
OH Daunorubicin
HO
OH
O
O
OH O
O
HO
OH OH Actinorhodin
O
COOH
O
R
O OH
O
O
N H
O
OH OH
O
Jadomycin B
Pradimicin
O
COOH
OH
HO OH
O OH
O
OH
O
Tetracenomycin
O
O NH2
O
OH O
O
O
O
OH O
OH O OH D
O
O
OH
O OH
HO
Mithramycin
O
O OH
O O
OH
OH
O
O
O
Frenolicin
O
R1128a: R=Me R1128b: R=Et R1128c: R=iPr R1128d: R=Pr
Figure 16.1 Examples of polyketides synthesized by type II PKSs.
370
Wenjun Zhang and Yi Tang
Minimal Type II PKS:
KS
CLF
MAT
ACP
Decarboxylative Priming O
SH
O
HO
S-CoA
ACP
O
S
HO
MAT
KS
O
CLF
O
-CO2
ACP
S−Enz
Chain Elongation =
ACP
O
O
-O
ACP
MAT
S-CoA +
O HS
O
ACP KS
O
S
O O
O-
KS
O
S
Growing Polyketide Chain
O
S
−
−S
O O
O
O
SH N N H H OH Phosphopantetheine arm
ACP
KS
S
S
KS
S O-
=
ACP
CO2 +
S+ HS−CoA
O O P O O-
ACP
+ O
HS
O
Figure 16.2 Minimal PKS catalyzed decarboxylative priming and chain elongation in poly-b-keto backbone formation of type II polyketides. KS, ketosynthase; CLF, chainlength factor; ACP, acyl carrier protein; MAT, malonyl-CoA:ACP acyltransferase.
respectively, to afford the polycyclic scaffolds of the aromatic polyketides. Subsequently, downstream tailoring enzymes such as methyltransferases, oxygenases, and glycosyltransferases can decorate the scaffold to yield a bioactive natural product (Rix et al., 2002). The structural diversities among aromatic natural products are derived from choices of starter units, variations in poly-b-ketone chain length, the regioselective cyclization steps and tailoring modifications. In vitro analysis of type II PKSs can be challenging for several reasons. First, a functional type II PKS requires simultaneous reconstitution of multiple enzymes in the same reaction, especially when working with the minimal PKS. Controlling the concentrations of the individual enzymes, their cofactors and precursors is therefore crucial to both product turnover and product structure. Determining the rate-limiting steps among the multitude of reactions is also important for analyzing the kinetics of the PKSs. Second, the poly-b-ketone backbone is highly unstable and spontaneous cyclization occurs rapidly under aqueous conditions. This makes resolving the enzymology of the minimal PKS and the immediate tailoring enzymes difficult. Third, many important cyclic intermediates of aromatic PKS pathways are inaccessible or highly insoluble, complicating biochemical characterization of downstream tailoring enzymes. Spontaneous oxidation of polycyclic phenols occurs rapidly to give quinone shunt products that are not substrates of the enzyme of interest. In the last 10 years, many of the challenges have been resolved and nearly all components of type II
In Vitro Analysis of Type II Polyketide Synthase
371
PKS have been reconstituted in vitro. The ensuing biochemical analyses have provided significant insights into the mechanism and specificity of the enzymes. This article will first describe the expression and purification of individual type II PKS components. This will be followed by a list of the most commonly employed assays used to analyze and reconstitute the PKS enzymes.
2. Expression and Purification of Type II PKSs 2.1. Escherichia coli as a host for protein expression E. coli is the most widely used expression host for bacterial proteins. Commercially available BL21(DE3) strain, in combination with pET vectors, are routinely used to express proteins containing N-terminal, C-terminal or both N- and C-terminal hexahistidine tags. Cloning of the target PKS gene can be readily accomplished by using the AT-rich restriction sites, such as NdeI, EcoRI, and HindIII, in vectors such as pET28 or pET21. These sites are absent from most PKS genes, which are generally of high GC-content. To compensate for the difference in codon usage between E. coli and actinomycetes, BL21-derived Rosetta strains (Novagen) that overexpress tRNAs for some codons such as CCC and CGG that are rare in E. coli while abundant in actinomycetes can be used. E. coli has been successfully used for expression of many type II PKS components, including ACP and numerous tailoring enzymes. General protein expression and purification procedures in our laboratory are described here (Zhang et al., 2007). The pET vector containing the target gene is introduced into E. coli BL21(DE3) or BAP1 strain by electroporation. A single colony is picked and grown in 5 ml starter culture of LB plus antibiotics at 37 overnight. This is used to inoculate 500 ml of large-scale LB culture (1:500 inoculation ratio), and the cells are shaken at 250 rpm at 37 until an OD600 of 0.4 to 0.6 is reached. At this time the cells are incubated on ice for 10 min, and then induced with 0.1 mM isopropyl thio-b-D-galactoside (IPTG) for 16 h at 16 . The inoculation ratio, IPTG concentration, induction time and temperature can be optimized for different proteins. The cells are then harvested by centrifugation (3500 rpm, 10 min, 4 ), re-suspended in 30 ml lysis buffer (20 mM Tris-HCl pH ¼ 7.9, 0.5 M NaCl, 10 mM imidazole, 2 mM DTT) and lysed using sonication on ice. Cellular debris is removed by centrifugation (15,000 g, 1 h, 4 ). Ni-NTA agarose (Qiagen) resin is added to the supernatant (2 ml/l of culture), and the solution is stirred at 4 for at least 2 h. The protein resin mixture is loaded into a gravity flow column and proteins are purified with increasing concentration of imidazole (up to 250 mM) in buffer A (20 mM Tris-HCl pH ¼ 7.9, 0.5 M NaCl, 5 mM imidazole, 2 mM DTT). The cell
372
Wenjun Zhang and Yi Tang
debris pellet is re-suspended with 8 M urea, frozen in liquid nitrogen, thawed on ice for 5 min, and centrifuged and analyzed for the presence of insoluble proteins. All fractions are checked by SDS-PAGE. Purified proteins are concentrated and buffer exchanged into buffer B (50 mM TrisHCl, pH ¼ 7.9, 2 mM EDTA, 2 mM DTT, 10% glycerol) with Centriprep filter devices (Amicon Ultra, Millipore). Protein concentrations are determined by the Bradford assay (Biorad). The eluted protein from a Ni-NTA column is about 50 to 90% pure, depending on the expression levels of individual proteins. In addition to the hexahistidine tag, the maltosebinding-protein (MBP) affinity tag is occasionally used to enhance the solubility of proteins in E. coli (Piel et al., 2000). The pMAL vectors are used together with the E. coli K12 TB1 strain, and an amylose resin affinity column is used to purify the fusion protein using standard protocols (New England Biolabs). To further purify the recombinant PKS proteins, ion-exchange chromatography is normally the second column of choice in our laboratory. Proteins obtained after Ni-NTA and ion-exchange column can achieve greater than 95% purity. Alternatively, gel filtration column chromatography is adopted by some laboratories to perform the post Ni-NTA purification (Shen and Hutchinson, 1996; Zawada and Khosla, 1999). A typical elution condition for the Sepharose column is 25 mM Tris HCl buffer (pH 8.0), 150 mM NaCl, 1 mM DTT with a flow rate of 0.5 ml/min. For example, using gel-filtration chromatography, the gris ARO/CYC and tcm ARO/CYC (partial TcmN) were determined to be monomers, while full length TcmN and act KR eluted as dimers (Zawada and Khosla, 1999). Various PKS components can also be loaded together onto the column to check the possibility of complex formation.
2.2. ACP expression and modification The small ACP (10 to 12 kDa) is an integral part of the minimal PKS and its expression warrants a separate section. Most of ACPs produced in BL21 (DE3) are in the apo form since the PKS ACPs are not substrates of the E. coli holo-ACP synthase. A notable exception is ZhuN from the R1128 pathway, which is produced in the holo form in BL21(DE3) (Meadows and Khosla, 2001). Coexpression of Sfp during ACP expression has led to the direct recovery of holo-ACPs from E. coli (Khosla et al., 1999). In a metabolic engineering approach, Khosla’s group has modified the BL21 (DE3) strain to contain a chromosomal copy of sfp under control of the T7 promoter (Pfeifer et al., 2001). The resulting BAP1 strain is able to produce nearly all type II ACPs in the holo form. A caveat of the BAP1 system is that if an ACP is highly overexpressed (>20 mg/l), the coexpressed Sfp level can be insufficient to phosphopantetheinylate all of the apo-ACP, resulting in a mixture of apo and holo forms.
In Vitro Analysis of Type II Polyketide Synthase
373
The complete conversion of apo-ACP to holo-ACP can be carried out in vitro using Sfp (Lambalot et al., 1996). A typical reaction buffer contains 75 mM MES-acetate (pH 6.0), 10 mM MgCl2 and 5 mM DTT. The molar ratios of CoA, apo-ACP, and Sfp are maintained at 5:1:0.1. The reaction is incubated at 30 overnight and holo-ACP can be purified using anionexchange chromatography (type II holo-ACPs elute at 350 mM NaCl). Furthermore, Sfp can utilize various acyl-CoAs and synthesize acyl-ACPs from apo-ACPs. To prepare acyl-ACP, DTT is omitted from the reaction buffer and 5% tetrabutylammonium chloride can be added to increase the solubility of acyl-ACP when medium- to long-chain fatty acyl-CoA is used. The modified ACP can be confirmed by mass spectrometry (MALDI MS or ESMS). Radiolabeled acyl-CoA can also be used to convert apo-ACP into radiolabeled acyl-ACP, which can then be purified by a PD-10 desalting column and concentrated with a 5000 MWCO filter device. The final concentrate can be applied to a SDS-PAGE gel and the amount of radioactivity can be quantified by autoradiography.
2.3. Streptomyces as a host for PKS expression E. coli is usually the first choice as a host for the heterologous expression of proteins; however, many type II PKS components are completely insoluble or inactive when expressed in E. coli. The most glaring representative of this list is the KS-CLF heterodimer of the minimal PKS, which has always been present as 100% inclusion bodies in E. coli despite repeated attempts by numerous groups. Therefore, Streptomyces coelicolor and Streptomyces lividans are widely used hosts for functional expression of KS-CLF and other enzymes that are not accessible via E. coli. These strains are genetically and physiologically closely related to the native hosts of most type II PKS, and can be manipulated with a powerful collection of genetic tools (Hopwood et al., 1985; Kieser et al., 2000). DNA transformation in these hosts can be performed with relatively high efficiencies, and several selection markers are available. In addition, convenient E. coli–Streptomyces shuttle vectors have been developed, facilitating the DNA manipulation in E. coli and protein expression in Streptomyces (Fig. 16.3). One of the best known shuttle vectors is pRM5 (McDaniel et al., 1993), which has served as the parent vector for numerous PKS expression constructs. It contains the following essential features: it has a ColE1 replicon for replication in E. coli and a SCP2* replicon for propagation in Streptomyces; it has an E. coli selection marker, bla, and a Streptomyces selection marker, tsr (thiostrepton resistance); the gene of interest is cloned under the control of the actI promoter, which is regulated by actII-ORF4 present on the same plasmid. A high level of PKS gene expression is observed at the beginning of the stationary phase of Streptomyces growth. In pRM5, the gene of interest is usually cloned between unique
374
Wenjun Zhang and Yi Tang
PactI Pac I
Nsi I Xba I Eco RI b-lac
act KR actII-ORF4 fd term
colEI ori tsr
pRM5
∼14 kb
SCP2∗
SCP2∗ ori
RBS ermEp∗
Nde I Hin dIII Eco RI Bam HI b-lac
pIJ101 ori
pUWL201PW
pUC18 ori
∼ 6.4 kb
ter
tsr Figure 16.3 Examples of E. coli^Streptomyces shuttle vectors. b-lac, Amp resistance gene; tsr, thiostrepton resistance; RBS, ribosome-binding site.
sites PacI (downstream of the actI promoter and preferred for the 50 end of the gene) and EcoRI (or NsiI, XbaI). A ribosome-binding site (RBS) is inserted upstream of the gene of interest via the 50 PCR primer (Zhang et al., 2006). The commonly used sequence of RBS is GGAGGAGCCCATATG (RBS is italicized). The shuttle vector portion of pRM5 is 14 kb in size, which may bring challenges for efficient molecular cloning.
In Vitro Analysis of Type II Polyketide Synthase
375
Digested vector mix is usually purified by ethanol precipitation without gel purification, and vortexing and harsh pipetting are avoided. The pRM5derived protein expression vector can be introduced into the expression strain (either S. coelicolor CH999 or S. lividans K4-114) (McDaniel et al., 1995; Ziermann and Betlach, 1999) using PEG-mediated protoplast transformation. Smaller Streptomyces expression vectors have been reported, such as pUWL201PW (6.4 kb) and pPWW50-Gen Poly (6.5 kb) (Doumith et al., 2000). pUWL201PW has bla and tsr selection markers, and ori derived from pUC18 and pIJ101 for E. coli and Streptomyces, respectively. Gene expression is driven by the constitutive promoter ermEp*, and the RBS and multiple cloning sites (MCSs) lie immediately downstream of the promoter, which simplifies molecular cloning. Vector pPWW50-Gen Poly resembles pUWL201PW in all these aspects, with a preinstalled N-terminal hexahistidine tag followed by MCSs. These vectors have been used in various Streptomyces hosts, such as S. lividans TK64, with good success. Other notable examples are pIJ6021 (7.8 kb) and pIJ4123 (9.2 kb), both inducible, high-copy-number expression vectors (Takano et al., 1995). The thiostrepton inducible strong promoter PtipA is used in these vectors, followed by RBS and MCSs. pIJ4123 is a derivative of pIJ6021 with a unique NdeI site positioned downstream from the hexahistidine sequence and thrombin cleavage site. Streptomyces hosts have been used to express and purify KS-CLF heterodimers of different type II PKSs, including those from act (Tang et al., 2003a), tcm (Tang et al., 2003a), oxy (Zhang et al., 2007), whiE (Tang, Y., unpublished data), sch (Lee et al., 2005), pms (Lee et al., 2005), and ent (Izumikawa et al., 2006) gene clusters. Typical culturing and initial purification procedures for Streptomyces/pRM5-derived systems are as follows: spore suspensions of the expression strain collected from a well-sporulated R2YE plate are used to inoculate 50 ml of R2YE liquid seed culture (supplemented with 50 mg/l thiostrepton) at 250 rpm and 30 for 2 to 3 days. This is then used to inoculate 4 500 ml of R2YE medium containing 50 mg/l thiostrepton (1:50 inoculation ratio). Mycelium from the stationary phase cultures (3 days) is collected by centrifugation and resuspended in 60 ml of disruption buffer (D-buffer: 250 mM sodium phosphate [pH 7.1], 0.3 mM sodium chloride, 2 mM DTT, 1 mM benzamidine, 2 mM EDTA, 3 mg/l leupeptin, 3 mg/l pepstatin, and 30% glycerol). Mycelium is then disrupted with a French press (sonication disruption can be used but the lysis efficiency is lower for Streptomyces), and insoluble cellular debris is removed by centrifugation (15,000 rpm, 1 h, 4 ). DNA is precipitated by adding 0.2% polyethyleneimine (PEI) and is removed by centrifugation (15000 rpm, 1 h, 4 . Ammonium sulfate precipitation can be used to precipitate KS-CLF, which can normally be found between the 30 and 50% cuts of (NH4)2SO4 (Tang et al., 2003a).
376
Wenjun Zhang and Yi Tang
If no purification tag is introduced into KS-CLF, multiple chromatography steps following ammonium sulfate precipitation provides an effective purification method. For example, the (NH4)2SO4 precipitated tcm KSCLF was re-dissolved in buffer E [100 mM NaH2PO4, 2 mM DTT, and 2 mM EDTA (pH 7.4)] and loaded onto a phenyl-sepharose column preequilibrated with buffer F (buffer E with 1.5 M (NH4)2SO4). The following gradient was then applied to the column: 100% buffer F from 0 to 30 min, 40% buffer F from 30 to 60 min, 10% buffer F from 60 to 200 min, and 0% buffer F from 200 to 240 min. The heterodimeric KS-CLF complex elutes near the end of the gradient (Tang et al., 2003a). Fractions containing tcm KS-CLF were pooled and buffer exchanged into buffer E and loaded onto a HiTrap-Q column pre-equilibrated with buffer E. Elution is performed with increasing concentration of NaCl in buffer E (0 to 400 mM ) and tcm KS-CLF elutes at NaCl concentration 200 mM. The KS-CLF obtained by this method is typically greater than 80% pure. An additional gel filtration step can further purify the enzyme. For hexahistidine-tagged KS-CLF, Ni-NTA and ion-exchange chromatography (if necessary) are applied, starting from re-suspending (NH4)2SO4 precipitated protein in buffer A, and following the protocols described earlier. Alternatively, the FLAG affinity tag has been introduced to the act CLF, which resulted in the recovery of high-purity KS-CLF that led to the crystallization of act KS-CLF (Keatinge-Clay et al., 2004). To purify FLAGtagged act KS-CLF, the phenyl-sepharose chromatography step was used as described previously. This is necessary to avoid fouling of the expensive Anti-FLAG resin. Fractions containing act KS-CLF are pooled and the buffer is exchanged into TBS buffer (50 mM Tris (pH 7.4), 0.15 M NaCl, and 10 mM CaCl2) and loaded onto a column packed with Anti-FLAG M1 agarose affinity gel (5 ml). The column is washed with 30 ml of TBS, and act KS-CLF is eluted with 3 5 ml of TBS containing 100 mg/ml FLAG peptide (Sigma). The eluent is then concentrated and the buffer is exchanged into buffer E containing 20% glycerol (Tang et al., 2003a). Although protein purification procedures are only discussed for KS-CLF using Streptomyces/ pRM5 derived systems here, other type II PKS components can be expressed and purified from Streptomyces using similar methods.
3. In Vitro Activity Assays 3.1. Minimal PKS activity assays 3.1.1. Product assays for minimal PKS The most direct method to assay the minimal PKS is to perform the product formation assay. The outcome of the assay will inform whether the purified enzyme components are active. Most type II minimal PKSs can utilize
In Vitro Analysis of Type II Polyketide Synthase
377
malonyl-CoA as both starter (decarboxylative priming) and extension units. Depending on the chain length specificity of the KS-CLF, a fixed set of products can be expected as result of spontaneous cyclization of the polyb-ketone backbone in the absence of tailoring enzymes. Examples of these products are octaketides SEK4 and SEK4b, decaketides SEK15 and SEK15b, and dodecaketides TW93c and TW93d (Fig. 16.4). Therefore, formation of these products can confirm the chain length specificity of the minimal PKS, or can be used to determine the product size of unknown minimal PKSs isolated from genome mining or metagenomic approaches. In addition, the product-based assays can test the overall catalytic efficiency of the minimal PKS complex. The reactions are typically performed in 100 mM NaH2PO4 with 1 to 20 mM KS-CLF, 20 to 50 mM holo-ACP, 2 mM malonyl-CoA, 0.1 to 1 mM MAT, 2 mM DTT, 10% glycerol. The use of DTT has been found to lead to undesired thioester reduction of acyl-S-ACP, and the less nucleophilic TCEP can be used to prevent oxidation of free thiols (Beltran-Alvarez et al., 2007). The reactions are incubated at 30 , and 100-ml reaction solution is extracted with 300 ml ethyl acetate (EA)/acetic acid (AcOH) (99:1) twice. The reactions can also be terminated by the addition of solid NaH2PO4 to saturation, or HCl to pH 3 and extracted with EA. The combined organic phases are evaporated to dryness, re-dissolved in 20 ml of DMSO and subjected to HPLC analysis. Alternatively, analytical scale solid-phase extraction columns (such as DSC-18, Supelco) can be used to isolate the compounds (Kallio et al., 2008). Reverse phase C18 column chromatography is used for aromatic polyketide analysis with mobile phases containing water and acetonitrile (supplemented with 0.1% trifluoroacetic acid [TFA]). In minimal PKS product assays, the substrate malonyl-CoA can also be generated in situ using the Rhizobium trifolii malonyl-CoA synthetase, MatB (An and Kim, 1998). MatB synthesizes malonyl-CoA from malonic acid and CoA in an ATP-dependent fashion. MatB can be expressed and purified from E. coli at very high levels (>30 mg/l). When MatB is used, the following reagents are added to the assay mixture in place of malonylCoA: 100 mM sodium malonate, 5 mM MgCl2, 20 mM ATP, 5 mM CoA, and 20 mM MatB. The MatB system has several important advantages over malonyl-CoA. (1) For large-scale in vitro production and characterization of polyketides, malonyl-CoA can become prohibitively expensive. Using MatB circumvents this obstacle and the much more economical free CoA is used. (2) Using MatB, different 13C-labeled malonic acid can be used as extender units to produce isotopically-labeled polyketide backbones. The most important application of 13C labeling is to confirm whether a particular product is derived from malonyl-CoA (hence is a polyketide) using LC/MS analysis. For example, when 12C-malonic acid is replaced by 2-13C-malonic acid, and 2-13C-malonyl-CoA is synthesized by MatB and is incorporated into the polyketide backbone, leading to a mass increase of
O
O
HO 8 X malonyl-CoA octaketide minimal PKS O
O O
O O
O
O
O 9
O 13
O S
Enz
CoA
10 X malonyl-CoA decaketide minimal PKS
O
11 O
S
O 9
O 5
7
15
12 X malonyl-CoA dodecaketide minimal PKS O
O
O 17
O
O
O 1 S
3
O
O
O
O
O
O
19 Enz
O
O
O
O 9
S
Enz
OH OH
OH 15 12 HO
10
HO OH 12
OH
O HO
7
O O
O HO SEK4
OH
O
O
HO
O
OH
OH O
14 O
HO
OH O 12
12
9
7
HO O
7
O
O
OH
HO O
O
7
HO
OH HO O
O
HO SEK4b
O
HO
O HO SEK15
O
SEK15b
O
HO
O TW93c
HO
Figure 16.4 Examples of polyketides produced in type II minimal PKS product^based assays.
O TW93d
O
In Vitro Analysis of Type II Polyketide Synthase
379
þ1 for each ketide unit. A mass increase of 8 and 10 should be observed for octaketides and decaketides, respectively. By comparing the mass of the product with a 12C or 13C precursor, the size of the polyketide products can be readily established. (3) Using MatB and triply 13C labeled malonic acid can produce polyketides that are isotopically labeled at each carbon, which will significantly enhance the 13C NMR signals and simplify the identification of products. The product-based assay has been used to investigate the polyketide chain length control mechanism (Tang et al., 2003b). Using homology structure–directed mutagenesis, key residues in the CLF were identified and manipulated to alter polyketide chain length. Mutant act KS/CLFs were purified from S. coelicolor and the distribution of octaketides and decaketides produced in vitro using the minimal PKS assay was analyzed. It was found that the point mutation F116A was sufficient to increase the levels of decaketides from 0% to over 60% of total polyketide products, and the F109A/F116A double mutant completely converted the act octaketide synthase into a decaketide synthase. Another application of product assays is to probe the starter unit selection and incorporation in type II polyketide synthesis (see Section 3.2). The HPLC or LC/MS analysis can be quantitative, but large amounts of proteins and substrates are needed, making this method impractical for kinetic assays. Instead, a more sensitive radioactive assay using 14C-labeled malonyl-CoA can be performed, which can be used to detect as little as 25 pmol of polyketide product (Dreier et al., 1999). For kinetic parameter determination, malonyl-CoA is usually added to 100 to 2000 mM (specific activity between 0.55 and 55 nCi/nmol). The minimal PKS components can be combined at different concentrations depending on the assay goal. Typically, KS-CLF can be added to a final concentration of 0.05 to 5 mM, holo-ACP to 0.1 to 200 mM, and MAT 1 to 1000 nM. The reactions are initiated by the addition of 2-14C-malonyl-CoA and the products are extracted in the same way as described above. Products are re-dissolved in 15 ml EA, separated by thin-layer chromatography (TLC) (EA/AcOH, 99:1) and quantified with a phosphorimager. A typical apparent Km of type II ACP is in the 1- to 7-mM range (Tang et al., 2003a), the Km of malonyl-CoA is in the 70- to 220-mM range (Dreier et al., 1999), and the apparent turnover kcat is between 0.1 to 0.5 min–1 (Dreier et al., 1999; Lee et al., 2005; Tang et al., 2003a). Recently, a continuous spectrophotometric method that measures the release of free CoA has been used to study the kinetics of act minimal PKS (Beltran-Alvarez et al., 2007). The free CoA generated as a result of malonyl-CoA consumption is used as a substrate by a-ketoglutarate dehydrogenase (KDH) to produce succinyl-CoA with concomitant reduction of NADþ to NADH, which can be followed spectrophotometrically at 340 nm. The final concentrations of the components in KDH assays were reported as follows: 100 mM phosphate
380
Wenjun Zhang and Yi Tang
buffer (pH 7.3), 1 mM EDTA, 1 mM tris(2-carboxyethyl)phosphine (TCEP), 2 mM a-ketoglutaric acid, 0.5 mM NADþ, 0.4 mM thiamine pyrophosphate (TPP), 1 mM MgCl2 and 80 mU KDH. The spectrophotometric assay is highly convenient and numerous assays can be performed in parallel. Since the assay measures release of CoA, this technique can be used to monitor the kinetics of any minimal PKS. 3.1.2. MAT-ACP labeling assay The malonyl-CoA:ACP transacylation assay catalyzed by MAT can be used to determine the rate of ACP malonylation in the minimal PKS. The data is important towards establishing the rate-limiting step of the product-based assay described above (Beltran-Alvarez et al., 2007). Typically, the kcat range of S. coelicolor MAT toward type II ACPs is 3000 to 9000 min–1, which indicates that the formation of malonyl-ACP is not the ratelimiting step in type II polyketide synthesis. However, when the ACP is mutated or engineered, the MAT:ACP interaction may be less efficient. It is notable here that at least act ACP has been shown to possess an intrinsic self-malonylation activity, albeit only at elevated concentrations of malonyl-CoA (Arthur et al., 2005). The conversion of holo-ACP to malonyl-ACP can be assayed using 14C-labeled malonyl-CoA (Summers et al., 1995). A typical reaction mixture contains 200 mM 2-14C-malonyl-CoA (55 mCi/mmol), 100 mM holoACP, 1 to 10 nM MAT, 1 mM DTT in 100 mM NaH2PO4 buffer (pH 7.0). Reactions are performed at 25 for short time intervals (usually less than 2 min). Aliquots (10 ml) are quenched by adding SDS-PAGE loading buffer and applied to a 4 to 20% SDS gel to separate ACPs from MAT and malonyl-CoA. The gel is subsequently dried and autoradiographed. Alternatively, a trichloroacetic acid (TCA) precipitation assay can be performed to precipitate malonyl-ACP, followed by scintillation counting. The protein gel autoradiography technique can also be used to detect covalent intermediates and malonyl transfer among minimal PKS components by incubating 14C-labeled malonyl-CoA with one or several of minimal PKS components (Carreras and Khosla, 1998). 3.1.3. KS-ACP protein–protein interaction assays The successful recognition between KS and ACP is essential for product turnover in a minimal PKS. The transient and noncovalent nature of these interactions hinders the direct observation of their compatibility, leaving the product-based assay the only investigation method. Recently, a new method was developed to trap the ACP during its interaction with KS, providing direct insight into the protein–protein interactions between ACP and KS (Worthington et al., 2008). Chemo-enzymatically synthesized CoA analogues and Sfp were used to produce crypto-ACPs, in which a nonhydrolyzable electrophilic probe was tethered in place of the thiol terminus of
In Vitro Analysis of Type II Polyketide Synthase
381
holo-ACP. A covalent crosslink is formed between KS and crypto-ACPs in the event of fruitful protein interactions. The complex can be detected by mobility shift during SDS-PAGE and can be confirmed by MALDI MS/MS analyses. 3.1.4. High-resolution mass spectrometry The application of electrospray ionization Fourier-transform mass spectrometry (ESI-FTMS) in the study of modular PKSs and NRPSs has been reviewed recently (Dorrestein and Kelleher, 2006). ESI-FTMS has the advantage of high resolution and mass accuracy compared to traditional mass spectrometry, and can be used to investigate substrate tolerance, timing of intermediate transfer and tailoring reactions on polypeptides of greater than 70 KDa. ESI-FTMS analysis has been employed in type II PKS study to observe the phosphopantetheinyl functionality of ACPs. Undoubtedly, ESI-FTMS will be a powerful tool in dissecting the individual steps of the minimal PKS, and provide significantly higher resolution snapshots than the aforementioned polyketide product-based assay and autoradiography. It is notable that a nonhydrolyzable malonyl-CoA analogue has been demonstrated to trap polyketide intermediates in iterative condensation, which may facilitate the detection of various protein-bound intermediates in type II PKS assembly by MS analysis (Spiteller et al., 2005).
3.2. Starter unit synthesis and incorporation assays The starter unit represents an attractive position to introduce structural variations into type II polyketides, especially considering that malonylCoA is the only extender unit accepted by all known type II PKSs. Most type II PKSs are primed by an acetate unit with acetyl-ACP or through the decarboxylation of a malonyl-ACP. Numerous medicinally important polyketides are initiated with nonacetate starter units (Fig. 16.1), including daunorubicin (propionate) (Bao et al., 1999), tetracycline (malonamate) (Zhang et al., 2006), frenolicin (butyrate) (Bibb et al., 1994), R1128 (medium-length alkylacyl groups) (Tang et al., 2004b), enterocin (benzoate) (Cheng et al., 2007), and hedamycin (a reduced polyketide starter unit) (Bililign et al., 2004). Genetic characterizations of the corresponding gene clusters has revealed the presence of various enzymes that can synthesize the starter unit, bypass the acetate priming, and transfer the starter unit to the minimal PKS. In vitro analyses of selected nonacetate-primed PKSs have revealed the enzymatic basis of these strategies. While biogenesis of starter units can be assayed independently, priming and incorporation of the starter units are frequently probed using the product-based assays in the presence of the minimal PKS.
382
Wenjun Zhang and Yi Tang
3.2.1. Direct priming of minimal PKS The starter unit specificity of the minimal PKS can be directly probed by adding acyl-CoA primers to the product assay described above. The typical reaction can consist of 1 mM KS-CLF, 200 nM MAT, 2 mM malonyl-CoA, 30 mM holo-ACP, and 2 mM of the desired acyl-CoA. The reaction can then be extracted with organic solvents and analyzed by either radio-TLC (if 2-14C malonyl-CoA is used) or LC-MS. An important finding of this assay is that many normally acetyl-primed minimal PKSs can instead be primed with alternative starter units. For example, the act KS-CLF was shown to be primed by either alkyl starter units such as C4 to C8 fatty acylCoAs (Nicholson et al., 2003), or aryl starter units such as benzyol-ACP (Izumikawa et al., 2006). Similarly, the tcm KS-CLF can be primed by C3 to C10 fatty acyl-CoAs to afford polyketides containing nonacetate starter units (Tang et al., 2004a). These results can also be extended to dodecaketide synthases such as spore-pigment sch and pradimicin ( pms) PKSs (Tang, Y., unpublished data). In each case, the resulting nonacetate primed products contained the same number of carbons in the polyketide backbone. The increases in sizes of the starter units led the corresponding decreases of the number of ketide units in the final polyketides, suggesting that the KS-CLF can maintain chain length through a ‘‘ruler’’ mechanism (Nicholson et al., 2003). The efficiency of starter unit incorporation varies between different minimal PKSs and the starter units. The efficiency of incorporating nonacetate primers can be improved by adding an acetylACP thioesterase such as ZhuC from the R1128 pathway (see Section 3.2.2) (Tang et al., 2004a). Recently fluoroacetate has been incorporated into an octaketide backbone in vitro (Hong et al., 2008). Fluoroacetyl-ACP was synthesized using fluoroacetyl-CoA, Sfp, and apo-ACP, and added to 30 mM act KS-CLF. The reaction was then preincubated at 30 for 10 min to facilitate loading of the fluoroacetyl starter unit onto the KS active site. This was followed by the addition of MAT and malonyl-CoA for chain elongation. A fluorinated variant of SEK4b was produced in addition to SEK4 and SEK4b, as determined by LC-MS and NMR analysis. 3.2.2. Starter unit biosynthesis The frenolicin, R1128 and daunorubicin PKSs each contains a b-ketoacyl: ACP synthase III (KSIII) enzyme that is required for the incorporation of the alkyl starter units. DpsC, the KSIII for daunorubicin, is found to specify the selection of propionyl-CoA as the starter unit during daunorubicin biosynthesis (Bao et al., 1999). Native DpsC was purified from S. lividans by multiple purification steps and was shown to have high substrate specificity toward propionyl-CoA. DpsC exhibited both KSIII and acyltransferase activities toward both DpsG (the ACP encoded in the daunorubicin
In Vitro Analysis of Type II Polyketide Synthase
383
biosynthetic gene cluster) and E. coli ACPp (the ACP of FAS). ES-MS/ HPLC was used to confirm formation of the adduct propionyl-DpsC, and trypsin digestion followed by ES-MS/HPLC analysis revealed that Ser118 is the active site of DpsC. ZhuH and FrenI are the gatekeeping KSIII in the R1128 and fren gene clusters, respectively. Both KSIIIs catalyze the condensation of a short-chain acyl-CoA with malonyl-ACP to yield a b-keto-alkylacyl-ACP species. Reduction of the b-keto-alkylacyl-ACP by the KR/DH/ER cascade associated with the endogenous FAS yields a saturated alkylacyl-ACP that is used to prime the minimal PKS (Tang et al., 2006). The acyl-CoA substrate specificity of ZhuH has been studied thoroughly in vitro using radiolabeled acyl-CoA precursors. Formation of radiolabeled b-keto-alkylacyl-ACP products were detected and quantified by using a TCA protein precipitation assay (Meadows and Khosla, 2001). Propionyl-CoA was shown to be the best substrate of ZhuH, and is the precursor to the compound R1128b. FrenI was found to be highly specific for acetyl-CoA, which led to the formation of the butyryl starter group present in frenolicin. Both the R1128 and frenolicin PKSs contain two ACPs. Upon initial gene cluster identification, the roles of the two ACPs were thought to be interchangeable. After expression and purification of all four ACPs from E. coli, the ACPs were assayed for their roles in the synthesis of the aromatic polyketides in vitro (Tang et al., 2003a). KS-CLFs from several pathways were mixed with each ACP and were assayed for the formation of polyketides using 2-14C-malony-CoA. Similarly, the KSIII enzymes from the two clusters were also assayed in the presence of these ACPs. Interestingly, one ACP from each gene cluster was found to be a dedicated priming ACPp (ZhuG/ FrenJ), while the other ACP was part of the minimal PKS (ZhuN/ FrenN). The functions of the two ACPs from each gene cluster cannot be interchanged as the KS-CLF and KSIII each displays high selectivity towards its cognate ACP. Surprisingly, a single residue was largely responsible for this orthogonality, as mutation of this residue in either ZhuG or ZhuN resulted in recognition of the mutant ACP by both KS-CLF and KSIII. A third member that is critical for the incorporation of the starter unit in R1128 is ZhuC, which was first identified to be a dedicated MAT based on primary sequence similarity to acyltransferases. However, in vivo reconstitution experiments showed that ZhuC was indispensable for the incorporation of the alkylacyl-ZhuG starter units generated by ZhuH. In vitro analysis of ZhuC confirmed its role as an acetyl-ACP thioesterase that attenuates the acetyl priming pathway in favor of nonacetate priming. When ZhuC was added to acetyl-ACP, which can be generated from apo-ACP, acetyl-CoA and Sfp as described in section 2.2, rapid hydrolysis of the acetyl group was observed and holo-ACP with a free thiol was recovered. The hydrolysis assay was performed using either TCA precipitation or SDS-PAGE gel
384
Wenjun Zhang and Yi Tang
autoradiography (Tang et al., 2004a). A typical reaction consists of radiolabeled acetyl-ACP, ZhuC, 2 mM DTT, and 10% glycerol in 100 mM NaH2PO4 buffer. The role of ZhuC was further confirmed by using the product-based assay described previously. When alkylacyl-ZhuG was added to a minimal PKS without ZhuC, acetyl-primed products were the dominant species produced by the KS-CLF. However, when ZhuC was added, the levels of acetyl-primed compounds were significantly attenuated, with a corresponding increase in the amount of alkylacyl-primed polyketides. Benzoyl-priming during enterocin biosynthesis requires the biosynthesis of the starter unit benzoyl-ACP. A benzoate-CoA ligase EncN can synthesize benzoyl-ACP using two different mechanisms (Izumikawa et al., 2006). The first route is to transfer the benzoyl group from benzoyl-CoA to benzoyl-ACP, which can subsequently prime the ent KS-CLF. The benzoyl-transferase activity was measured using 7-14C-benzoyl-CoA and holo-ACP in a TCA precipitation assay. ATP (or AMP/PPi) was found to be an essential cofactor and was proposed to be an allosteric modulator of EncN. The second route is the direct ligation of benzoate to ACP, catalyzed by EncN. The assay was performed in 100 mM Tris-HCl (pH 7.5) buffer with 5.0 mM ATP, 5.0 mM MgCl2, 5 to 50 mM holo-ACP, 20 to 100 mM benzoic acid, and 2 to 5 mM of EncN. Benzoyl-ACP was detected by MALDI-TOF MS analysis of TCA-precipitated ACP. Various holoACPs such as ent, act, and tcm ACPs can be modified with the benzoyl group by EncN.
3.3. Assays of tailoring enzymes responsible for aromatic polyketide scaffold formation: KR, ARO, and CYC Enzymes that act on the nascent polyketide backbone, such as KR, ARO and CYC, are commonly referred to as immediate tailoring enzymes. These enzymes regioselectively modify the reactive poly-b-keto backbone synthesized by the minimal PKS to generate the aromatic scaffold. The fate of the nascent type II PKSs can be divided into two paths, reduced and unreduced, dependent on the presence of C-9 KR (reduction at the ninth carbon from the carboxy terminus of the assembled polyketide). In the reduced path, the first ring is usually cyclized through C-7/C-12 connectivity. There is increasing evidence to suggest that the C-9 KR may be responsible for fixing this regioselectivity (Korman et al., 2008; Ma et al., 2008). The cyclized first ring can then be dehydrated/aromatized by a dedicated ARO. Examples of C-9 reduced aromatic polyketide include tetracycline and anthracyclines. In the unreduced path, the first ring can be spontaneously cyclized at C-7/C-12 or catalyzed by dedicated CYCs. Mithramycin is synthesized from this path. The unreduced polyketide backbone can also be cyclized via C-9/C-14 connectivity by dedicated CYCs to afford the D ring found in tetracenomycin and related compounds.
In Vitro Analysis of Type II Polyketide Synthase
385
In vitro assays with the immediate tailoring enzymes are typically performed in the presence of the minimal PKS, which serves to provide the otherwise inaccessible poly-b-ketone substrates in situ (Zawada and Khosla, 1999; Zhang et al., 2007). The KR or CYCs are added to final concentrations of two- to five-fold excess to that of KS-CLF, which are generally sufficient to completely reduce or cyclize the substrates, respectively. Through both in vivo genetic analysis and in vitro assays, it is evident that the C-9 KRs, and the first- and second-ring CYCs with the same regioselectivity in either path can be interchanged. The functional equivalence of these enzymes is highly useful during in vitro assays. An insoluble cyclase from the pathway of interest can be substituted with equivalent enzymes that can be solubly expressed in E. coli. We demonstrated this versatility in the reconstitution of oxytetracycline cyclization steps. To produce a tricyclic intermediate, we used the oxy minimal PKS, act C-9 KR, gris ARO, and oxy second ring CYC (Zhang et al., 2007). The native oxy C-9 KR and ARO were not solubly expressed in E. coli. Although stable protein–protein interactions are not detected between minimal PKS and immediate tailoring enzymes, kinetic assays reveal that the addition of some of these tailoring enzymes can dramatically increase the turnover rate of a minimal PKS (Zawada and Khosla, 1999). One possible explanation for the increase turnover rate is that enzymatic cyclization of the polyketide backbone increases the rate of product release from the ACP. Synthetic substrate mimics have been used to probe the activity of KRs. Although this can only provide limited insight into the natural functions of the KR, this method has been used to probe the substrate specificity and cofactor requirements of KRs. A typical kinetic assay for KR is performed in 100 mM NaH2PO4 (pH 7.4) containing 100 mM NADPH, 40 mM substrate analogue, and 35 nM enzyme. Two-percent DMSO is used in the reaction solution to increase the solubility of the synthetic substrates when necessary. The decrease of A340 from the conversion of NADPH to NADPþ is monitored by UV-vis spectrophotometer. Reaction velocities are calculated on the basis of the A340 molar absorption coefficient of NADPH (6220 M–1 cm–1). The act C-9 KR has been assayed using a series of synthetic substrate candidates, among which bicyclic compounds such as trans-1-decalone, 2-decalone and a-tetralone can be stereoselectively reduced (Korman et al., 2008). Synthetic analogues were also used as substrates in the enzymatic assay for RED1, a second stereospecific KR encoded in the act pathway (Itoh et al., 2007). RED1 is assigned to the reduction of a b-ketone group in an unstable bicyclic intermediate. Interestingly, RED1 prefers 3-oxo-4-naphthylburyric acid (ONBA) over the N-acetylcysteamine thioester or methyl ester versions of ONBA. The in vitro result strongly suggests that the in vivo substrate of RED1 is a free acid instead of an acyl thioester attached to act ACP. Four terminal-ring cyclases have been characterized individually in vitro due to the availability of stable substrates. These assays can directly test the
386
Wenjun Zhang and Yi Tang
substrate specificity and optimal reaction conditions of cyclases in the absence of any influence from a minimal PKS complex. DnrD and AknH have been shown to convert aklanonic acid methyl ester (AAME) to aklaviketone (AK) in the daunorubicin and aclacinomycin biosynthetic pathways, respectively (Kallio et al., 2006; Kendrew et al., 1999). Analogously, SnoaL was confirmed to catalyze nogalaviketone formation from nogalonic acid methyl ester (NAME) during nogalamycin biosynthesis (Sultana et al., 2004). In addition, the Tcm F2 cyclase TcmI, which cyclizes the last ring during tetracenomycin biosynthesis, was also characterized in vitro (Thompson et al., 2004). Cyclase assays were typically performed in 100 mM Tris-HCl buffer (pH 7.5) at 30 and the polyketide products are extracted by standard methods and analyzed by TLC or HPLC. Strong pH dependence was observed for these cyclases. Although the four enzymes are all fourth ring cyclases catalyzing intramolecular aldol condensation during decaketide formation, they have different substrate requirements and product outcomes. In contrast to TcmI, DnrD, AknH, and SnoaL recognize methyl esters of anthraquinone carboxylic acids, and no dehydration of the last ring occurs after cyclization. SonaL catalyzes the cyclization and affords nogalaviketone with an S-configuration, in contrast to the products of DnrD and AknH which have R-configurations. Since the stereoisomers of aklaviketone cannot be easily separated using conventional RP HPLC, the stereochemistry of products was determined using an aklavinone-10hydroxylase (RdmE)-coupled assay system, in which RdmE can only hydroxylate the species in the R-configuration (Kallio et al., 2006; Niemi et al., 1999).
3.4. Assays of downstream tailoring enzymes Polyketide downstream tailoring enzymes include methyltransferase, oxygenase, glycosyltransferase, acyltransferase, halogenase, aminotransferase, and so on, most of which are important for product structural variations and bioactivities. These enzymes are not limited to type II PKSs, and have also been found and studied in other polyketide and nonribosomal peptide biosynthetic pathways. Due to space limitations, only assays of methyltransferase, oxygenase and glycosyltransferase will be discussed in this section. 3.4.1. Methyltransferase Most methyltransferases use the cofactor S-adenosyl-L-methionine (SAM) and transfer its activated methyl moiety to substrates. A typical reaction mixture contains 100 mM KH2PO4 (pH 7.5), 80 mM SAM, 40 mM substrate, and 2 mM enzymes. Less than 10% DMSO, MeOH or other organic solvents are added to aqueous solutions to increase substrate solubility when needed. The presence of organic solvents in reaction solutions are common for assays involving type II PKS tailoring enzymes, since most of the
In Vitro Analysis of Type II Polyketide Synthase
387
substrates are polycyclic compounds that have only limited solubility in water. The reaction is incubated for 1 h at 37 , and the product is extracted and analyzed by HPLC. Radioactive SAM can be used to label the product and quantify the reaction by scintillation counting. At least five methyltransferases involved in aromatic polyketide biosynthesis have been characterized in vitro, including those that transfer a methyl group from SAM to oxygen, nitrogen, or carbon atom. TcmN and DnrK are O-methyltransferases that install the methyl groups on the D-ring phenols in tetracenomycin and daunorubicin, respectively ( Jansson et al., 2004; Shen and Hutchinson, 1996) (Fig. 16.1). During mithramycin biosynthesis, an O-methyltransferase and a C-methyltransferase have been identified and characterized (Lozano et al., 2000). Recently, the transformation of 4-amino-ATC to ATC has been reconstituted in vitro with OxyT, which is an N,N-dimethyltransfrease catalyzing the reaction in a stepwise manner (Zhang et al., 2008). 3.4.2. Oxygenases There are several types of oxygenases involved in modifying the aromatic polyketide scaffold, including anthrone oxygenases, flavin-dependent oxygenases, and cytochrome P-450 monooxygenases. They differ extensively in their substrate specificity, cofactor requirement and mode of action, and their activities are accordingly assayed by different methods. Example of anthrone oxygenases are TcmH, ActVA-ORF6 and AknX (Chung et al., 2002; Kendrew et al., 1997; Shen and Hutchinson, 1993). No apparent prosthetic group is found for oxygen activation, and no specific cofactor is needed for the activity of these oxygenases. In addition, the enzymes do not seem to be sensitive to pH (6.5 to 9.5) or temperature. Anthrone oxygenases usually have relaxed substrate specificity; for example, tetracenomycin F1 is recognized by ActVA-ORF6 and the substrate analog emodinanthrone has been used for AknX in vitro assay. The anthrone compounds have absorbance in the range of 400 to 500 nm which will be shifted after quinone formation; therefore, the reaction can be monitored spectrophotometrically according to the molecular extinction coefficient differences between the substrate and product at certain wavelength. Recently an interesting oxygenase, JadH from the jadomycin biosynthetic pathway, has been characterized (Chen et al., 2005). By testing different intermediates of the jad pathway as substrates, JadH was revealed to have both anthrone oxygenase and dehydrase/aromatase activities and relaxed substrate specificity. Flavin-dependent oxygenases catalyze versatile reactions including hydroxylations, epoxidations, Baeyer-Villiger and Favorskii rearrangements. The presence and identity of the prosthetic group can be determined as follows (Shen and Hutchinson, 1994): pure protein is boiled for 5 min, cooled on ice immediately, and centrifuged to pellet the denatured protein.
388
Wenjun Zhang and Yi Tang
The supernatant is then subjected to HPLC analysis to identify and quantify the flavin prosthetic group released by this process through comparison to FAD and FMN standards. The concentrations of FAD and FMN are determined according to their A450 molar absorption coefficient 11.3 mM–1 cm–1 and 12.2 mM–1 cm–1, respectively. Yellow holo-enzyme can be partially reconstituted from colorless apo-enzyme in vitro by mixing 1 mole of apo-enzyme, 10 mole of either FAD or FMN (dependent on native prosthetic group), 25 mM Tris-HCl (pH 8.0), 1 mM DTT, and incubating on ice for 1.5 h. NADPH is needed as a cofactor for almost all flavin-dependent oxygenases, while the optimal pH is different for each enzyme. Following the assay, the oxidized products can be analyzed by TLC or HPLC, and the reaction kinetics can be usually determined by monitoring NADPH or substrate consumption. 18O isotope incorporation reactions followed by MS analysis can be used to establish the origins of oxygen atom(s) in final products. 18O2 gas reactions have been carried out in a Thunberg cuvette, in which oxygen is completely removed with a combined vacuum and repeated nitrogen rinses before mixing the reaction components. 18O-H2O reactions are performed in the reaction buffer where H2O is replaced by 18O-H2O (Kallio et al., 2008). Examples of flavin-dependent oxygenases characterized thus far include the tri-hydroxylase TcmG/ElmG in tetracenomycin biosynthesis (Rafanan et al., 2000; Shen and Hutchinson, 1994), di-hydroxylase OxyL in tetracycline biosynthesis (Zhang et al., 2008), and PgaE and PgaM involved in gaudimycin C biosynthesis (Kallio et al., 2008). Reconstitution of EncM activity in vitro confirmed that EncM is responsible for catalyzing the Favorskii-like oxidative rearrangement during enterocin biosynthesis (Cheng et al., 2007). In addition, MtmOIV from the mithramycin biosynthetic pathway has been confirmed to adopt the Baeyer-Villiger mechanism by the isolation of the lactone intermediate premithramycin B-lactone in the in vitro reaction (Gibson et al., 2005). Very few cytochrome P-450 monooxygenases from type II PKSs have been characterized in vitro. Examples include EncR and DoxA, which have been purified from E. coli TB1 and S. lividans TK24, respectively (Piel et al., 2000; Walczak et al., 1999). An extinction coefficient of 91 M–1 cm–1 is employed to quantify the cytochrome P-450 heme using the absorbance difference between 450 and 490 nm. P-450 enzymes require electron transport from NADPH via ferredoxin and ferredoxin:NADPþ oxidoreductase. Instead of the natural P450:reductase pairs, commercially available spinach ferredoxin and spinach ferredoxin:NADPþ reductase (Sigma) are commonly used in assays. A relatively high concentration of NADPH is maintained to ensure electron shuttling efficiency, which can be realized by using NADPH together with the NADPH regenerating system (NADPþ, glucose-6-phosphate, and glucose-6-phosphate dehydrogenase) (Walczak et al., 1999). In addition, inhibition assays on P-450 are usually carried out using known inhibitors such as 4-methylpyrazole, quinidine,
In Vitro Analysis of Type II Polyketide Synthase
389
troleandomycin, sulfaphenazole, and ancymidol (Piel et al., 2000; Walczak et al., 1999). 3.4.3. Glycosyltransferases Although genes encoding glycosyltransferases are widely spread among type II polyketide gene clusters, very few of them have been characterized in vitro due to the difficulties associated with obtaining active enzymes, the aromatic aglycones or the NDP-deoxysugars. Recent examples are AknK and AknS, which are involved in the biosynthesis of aclacinomycin (Leimkuhler et al., 2007; Lu et al., 2004, 2005). The aklavinone aglycone was prepared through the degradation of commercially available aclacinomycin A, and the TDP sugars were synthesized chemically. A typical reaction buffer includes 75 mM Tris-HCl (pH 7.5) and 10 mM MgCl2. It is worth noting that AknS needs an activating protein partner, AknT, to be fully functional; AknT accelerates AknS turnover rate by 200-fold without affecting its Km. Both in vitro and in vivo analysis have revealed that many glycosyltransferases have relaxed substrate specificities toward sugar donors and aglycons (Hertweck et al., 2007), indicating the biocatalysis potential of this group of enzymes in generating novel glycosylated polyketides with improved pharmaceutical properties. 3.4.4. Enzymatic total synthesis Recently, in vitro enzymatic total synthesis has been demonstrated to be a powerful method of producing complex aromatic polyketides (Cheng et al., 2007). The aromatic polyketide enterocin was synthesized in a single reaction vessel from simple benzoate and malonate substrates (Cheng et al., 2007). The recombinant proteins EncA-B (KS-CLF), holo-EncC (ACP), FadD (MAT), EncN (benzoyl-ACP ligase), EncD (C-9 KR), EncM (flavin-dependent oxygenase), EncK (SAM-dependent methyltransferase), EncR (cytochrome P-450 monooxygenase), and MatB (malonyl-CoA synthetase) were mixed with substrates and necessary cofactors (ATP, Mg2þ, NADPH, SAM, ferredoxin, ferredoxin-NADPþ reductase) to afford enterocin in 25% overall yield. This method offers opportunities to produce and engineer aromatic polyketides without fermentation and genetic engineering of Streptomyces, and may lead to the in vitro enzymatic combinatorial synthesis of natural products.
ACKNOWLEDGMENTS Research in our laboratory on this topic has been supported by grants from the National Science Foundation (CBET #0545860) and Universitywide AIDS Research Program of the University of California (D06-LA-193). Yi Tang thanks Chaitan Khosla for introducing him to the genetics and biochemistry of type II PKSs.
390
Wenjun Zhang and Yi Tang
REFERENCES An, J. H., and Kim, Y. S. (1998). A gene cluster encoding malonyl-CoA decarboxylase (MatA), malonyl-CoA synthetase (MatB). and a putative dicarboxylate carrier protein (MatC). in Rhizobium trifolii—cloning, sequencing, and expression of the enzymes in Escherichia coli. Eur. J. Biochem. 257, 395–402. Arthur, C. J., Szafranska, A., Evans, S. E., Findlow, S. C., Burston, S. G., Owen, P., Clark-Lewis, I., Simpson, T. J., Crosby, J., and Crump, M. P. (2005). Self-malonylation is an intrinsic property of a chemically synthesized type II polyketide synthase acyl carrier protein. Biochemistry 44, 15414–15421. Bao, W., Sheldon, P. J., and Hutchinson, C. R. (1999). Purification and properties of the Streptomyces peucetius DpsC beta-ketoacyl:acyl carrier protein synthase III that specifies the propionate-starter unit for type II polyketide biosynthesis. Biochemistry 38, 9752–9757. Batist, G. (2001). Anthracyclines. Cancer Chemother. Biol. Response Modif. 19, 47–58. Beltran-Alvarez, P., Cox, R. J., Crosby, J., and Simpson, T. J. (2007). Dissecting the component reactions catalyzed by the actinorhodin minimal polyketide synthase. Biochemistry 46, 14672–14681. Bibb, M. J., Sherman, D. H., Omura, S., and Hopwood, D. A. (1994). Cloning, sequencing and deduced functions of a cluster of Streptomyces genes probably encoding biosynthesis of the polyketide antibiotic frenolicin. Gene 142, 31–39. Bililign, T., Hyun, C. G., Williams, J. S., Czisny, A. M., and Thorson, J. S. (2004). The hedamycin locus implicates a novel aromatic PKS priming mechanism. Chem. Biol. 11, 959–969. Carreras, C. W., and Khosla, C. (1998). Purification and in vitro reconstitution of the essential protein components of an aromatic polyketide synthase. Biochemistry 37, 2084–2088. Chen, Y. H., Wang, C. C., Greenwell, L., Rix, U., Hoffmeister, D., Vining, L. C., Rohr, J., and Yang, K. Q. (2005). Functional analyses of oxygenases in jadomycin biosynthesis and identification of JadH as a bifunctional oxygenase/dehydrase. J. Biol. Chem. 280, 22508–22514. Cheng, Q., Xiang, L., Izumikawa, M., Meluzzi, D., and Moore, B. S. (2007). Enzymatic total synthesis of enterocin polyketides. Nat. Chem. Biol. 3, 557–558. Chopra, I., and Roberts, M. (2001). Tetracycline antibiotics: Mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 65, 232–260. Chung, J. Y., Fujii, I., Harada, S., Sankawa, U., and Ebizuka, Y. (2002). Expression, purification, and characterization of AknX anthrone oxygenase, which is involved in aklavinone biosynthesis in Streptomyces galilaeus. J. Bacteriol. 184, 6115–6122. Dorrestein, P. C., and Kelleher, N. L. (2006). Dissecting non-ribosomal and polyketide biosynthetic machineries using electrospray ionization Fourier-transform mass spectrometry. Nat. Prod. Rep. 23, 893–918. Doumith, M., Weingarten, P., Wehmeier, U. F., Salah-Bey, K., Benhamou, B., Capdevila, C., Michel, J. M., Piepersberg, W., and Raynal, M. C. (2000). Analysis of genes involved in 6-deoxyhexose biosynthesis and transfer in Saccharopolyspora erythraea. Mol. Gen. Genet. 264, 477–485. Dreier, J., Shah, A. N., and Khosla, C. (1999). Kinetic analysis of the actinorhodin aromatic polyketide synthase. J. Biol. Chem. 274, 25108–25112. Gibson, M., Nur-e-alam, M., Lipata, F., Oliveira, M. A., and Rohr, J. (2005). Characterization of kinetics and products of the Baeyer-Villiger oxygenase MtmOIV, the key enzyme of the biosynthetic pathway toward the natural product anticancer drug mithramycin from Streptomyces argillaceus. J. Am. Chem. Soc. 127, 17594–17595.
In Vitro Analysis of Type II Polyketide Synthase
391
Hertweck, C., Luzhetskyy, A., Rebets, Y., and Bechthold, A. (2007). Type II polyketide synthases: Gaining a deeper insight into enzymatic teamwork. Nat. Prod. Rep. 24, 162–190. Hong, H., Spiteller, D., and Spencer, J. B. (2008). Incorporation of fluoroacetate into an aromatic polyketide and its influence on the mode of cyclization. Angew. Chem. Int. Ed. 47, 6028–6032. Hopwood, D., Bibb, M. J., Chater, K. F., Kieser, T., Bruton, C. J., Kieser, H. M., Lydiate, D. J., Smith, C. P., Ward, J. M., and Schrempf, H. (1985). ‘‘Genetic manipulation of Streptomyces: A laboratory manual.’’ The John Innes Foundation, Norwich, UK. Hopwood, D. A. (1997). Genetic contributions to understanding polyketide synthases. Chem. Rev. 97, 2465–2498. Itoh, T., Taguchi, T., Kimberley, M. R., Booker-Milburn, K. I., Stephenson, G. R., Ebizuka, Y., and Ichinose, K. (2007). Actinorhodin biosynthesis: Structural requirements for post-PKS tailoring intermediates revealed by functional analysis of ActVI-ORF1 reductase. Biochemistry 46, 8181–8188. Izumikawa, M., Cheng, Q., and Moore, B. S. (2006). Priming type II polyketide synthases via a type II nonribosomal peptide synthetase mechanism. J. Am. Chem. Soc. 128, 1428–1429. Jansson, A., Koskiniemi, H., Mantsala, P., Niemi, J., and Schneider, G. (2004). Crystal structure of a ternary complex of DnrK, a methyltransferase in daunorubicin biosynthesis, with bound products. J. Biol. Chem. 279, 41149–41156. Kallio, P., Liu, Z., Mantsala, P., Niemi, J., and Metsa-Ketela, M. (2008). Sequential action of two flavoenzymes, PgaE and PgaM, in angucycline biosynthesis: Chemoenzymatic synthesis of gaudimycin C. Chem. Biol. 15, 157–166. Kallio, P., Sultana, A., Niemi, J., Mantsala, P., and Schneider, G. (2006). Crystal structure of the polyketide cyclase AknH with bound substrate and product analogue: Implications for catalytic mechanism and product stereoselectivity. J. Mol. Biol. 357, 210–220. Keatinge-Clay, A. T., Maltby, D. A., Medzihradszky, K. F., Khosla, C., and Stroud, R. M. (2004). An antibiotic factory caught in action. Nat. Struct. Mol. Biol. 11, 888–893. Kendrew, S. G., Hopwood, D. A., and Marsh, E. N. (1997). Identification of a monooxygenase from Streptomyces coelicolor A3(2) involved in biosynthesis of actinorhodin: Purification and characterization of the recombinant enzyme. J. Bacteriol. 179, 4305–4310. Kendrew, S. G., Katayama, K., Deutsch, E., Madduri, K., and Hutchinson, C. R. (1999). DnrD cyclase involved in the biosynthesis of doxorubicin: Purification and characterization of the recombinant enzyme. Biochemistry 38, 4794–4799. Khosla, C., Gokhale, R. S., Jacobsen, J. R., and Cane, D. E. (1999). Tolerance and specificity of polyketide synthases. Annu. Rev. Biochem. 68, 219–253. Kieser, T., Bibb, M. J., Buttner, M. J., Chater, K. F., and Hopwood, D. A. (2000). ‘‘Practical Streptomyces genetics.’’ The John Innes Foundation, Norwich, UK. Koppisch, A. T., and Khosla, C. (2003). Structure-based mutagenesis of the malonyl-CoA: Acyl carrier protein transacylase from Streptomyces coelicolor. Biochemistry 42, 11057–11064. Korman, T. P., Tan, Y. H., Wong, J., Luo, R., and Tsai, S. C. (2008). Inhibition kinetics and emodin cocrystal structure of a type II polyketide ketoreductase. Biochemistry 47, 1837–1847. Lambalot, R. H., Gehring, A. M., Flugel, R. S., Zuber, P., LaCelle, M., Marahiel, M. A., Reid, R., Khosla, C., and Walsh, C. T. (1996). A new enzyme superfamily—the phosphopantetheinyl transferases. Chem. Biol. 3, 923–936. Lee, T. S., Khosla, C., and Tang, Y. (2005). Orthogonal protein interactions in spore pigment producing and antibiotic producing polyketide synthases. J. Antibiot. (Tokyo) 58, 663–666.
392
Wenjun Zhang and Yi Tang
Leimkuhler, C., Fridman, M., Lupoli, T., Walker, S., Walsh, C. T., and Kahne, D. (2007). Characterization of rhodosaminyl transfer by the AknS/AknT glycosylation complex and its use in reconstituting the biosynthetic pathway of aclacinomycin A. J. Am. Chem. Soc. 129, 10546–10550. Lozano, M. J., Remsing, L. L., Quiros, L. M., Brana, A. F., Fernandez, E., Sanchez, C., Mendez, C., Rohr, J., and Salas, J. A. (2000). Characterization of two polyketide methyltransferases involved in the biosynthesis of the antitumor drug mithramycin by Streptomyces argillaceus. J. Biol. Chem. 275, 3065–3074. Lu, W., Leimkuhler, C., Gatto, G. J. Jr., Kruger, R. G., Oberthur, M., Kahne, D., and Walsh, C. T. (2005). AknT is an activating protein for the glycosyltransferase AknS in L-aminodeoxysugar transfer to the aglycone of aclacinomycin A. Chem. Biol. 12, 527–534. Lu, W., Leimkuhler, C., Oberthur, M., Kahne, D., and Walsh, C. T. (2004). AknK is an L-2-deoxyfucosyltransferase in the biosynthesis of the anthracycline aclacinomycin A. Biochemistry 43, 4548–4558. Ma, S. M., Zhan, J., Xie, X., Watanabe, K., Tang, Y., and Zhang, W. (2008). Redirecting the cyclization steps of fungal polyketide synthase. J. Am. Chem. Soc. 130, 38–39. Malpartida, F., and Hopwood, D. A. (1984). Molecular cloning of the whole biosynthetic pathway of a Streptomyces antibiotic and its expression in a heterologous host. Nature 309, 462–464. McDaniel, R., Ebert-Khosla, S., Hopwood, D. A., and Khosla, C. (1993). Engineered biosynthesis of novel polyketides. Science 262, 1546–1550. McDaniel, R., Ebert-Khosla, S., Hopwood, D. A., and Khosla, C. (1995). Rational design of aromatic polyketide natural products by recombinant assembly of enzymatic subunits. Nature 375, 549–554. Meadows, E. S., and Khosla, C. (2001). In vitro reconstitution and analysis of the chain initiating enzymes of the R1128 polyketide synthase. Biochemistry 40, 14855–14861. Nicholson, T. P., Winfield, C., Westcott, J., Crosby, J., Simpson, T. J., and Cox, R. J. (2003). First in vitro directed biosynthesis of new compounds by a minimal type II polyketide synthase: Evidence for the mechanism of chain length determination. Chem. Commun. (Camb.) 6, 686–687. Niemi, J., Wang, Y., Airas, K., Ylihonko, K., Hakala, J., and Mantsala, P. (1999). Characterization of aklavinone-11-hydroxylase from Streptomyces purpurascens. Biochim. Biophys. Acta 1430, 57–64. O’Hagan, D. (1991). ‘‘The polyketide metabolites.’’ Ellis Howard, Chichester, UK. Pfeifer, B. A., Admiraal, S. J., Gramajo, H., Cane, D. E., and Khosla, C. (2001). Biosynthesis of complex polyketides in a metabolically engineered strain of E. coli. Science 291, 1790–1792. Piel, J., Hertweck, C., Shipley, P. R., Hunt, D. M., Newman, M. S., and Moore, B. S. (2000). Cloning, sequencing and analysis of the enterocin biosynthesis gene cluster from the marine isolate ‘‘Streptomyces maritimus’’: Evidence for the derailment of an aromatic polyketide synthase. Chem. Biol. 7, 943–955. Rafanan, E. R. Jr., Hutchinson, C. R., and Shen, B. (2000). Triple hydroxylation of tetracenomycin A2 to tetracenomycin C involving two molecules of O(2) and one molecule of H(2)O. Org. Lett. 2, 3225–3227. Rix, U., Fischer, C., Remsing, L. L., and Rohr, J. (2002). Modification of post-PKS tailoring steps through combinatorial biosynthesis. Nat. Prod. Rep. 19, 542–580. Shen, B., and Hutchinson, C. R. (1993). Tetracenomycin F1 monooxygenase: Oxidation of a naphthacenone to a naphthacenequinone in the biosynthesis of tetracenomycin C in Streptomyces glaucescens. Biochemistry 32, 6656–6663. Shen, B., and Hutchinson, C. R. (1994). Triple hydroxylation of tetracenomycin A2 to tetracenomycin C in Streptomyces glaucescens. Overexpression of the tcmG gene in Streptomyces lividans and characterization of the tetracenomycin A2 oxygenase. J. Biol. Chem. 269, 30726–30733.
In Vitro Analysis of Type II Polyketide Synthase
393
Shen, B., and Hutchinson, C. R. (1996). Deciphering the mechanism for the assembly of aromatic polyketides by a bacterial polyketide synthase. Proc. Natl. Acad. Sci. USA 93, 6600–6604. Spiteller, D., Waterman, C. L., and Spencer, J. B. (2005). A method for trapping intermediates of polyketide biosynthesis with a nonhydrolyzable malonyl-coenzyme A analogue. Angew. Chem. Int. Ed. 44, 7079–7082. Sultana, A., Kallio, P., Jansson, A., Wang, J. S., Niemi, J., Mantsala, P., and Schneider, G. (2004). Structure of the polyketide cyclase SnoaL reveals a novel mechanism for enzymatic aldol condensation. EMBO J. 23, 1911–1921. Summers, R. G., Ali, A., Shen, B., Wessel, W. A., and Hutchinson, C. R. (1995). Malonylcoenzyme A:acyl carrier protein acyltransferase of Streptomyces glaucescens: A possible link between fatty acid and polyketide biosynthesis. Biochemistry 34, 9389–9402. Takano, E., White, J., Thompson, C. J., and Bibb, M. J. (1995). Construction of thiostrepton-inducible, high–copy-number expression vectors for use in Streptomyces spp. Gene 166, 133–137. Tang, Y., Koppisch, A. T., and Khosla, C. (2004a). The acyltransferase homologue from the initiation module of the R1128 polyketide synthase is an acyl-ACP thioesterase that edits acetyl primer units. Biochemistry 43, 9546–9555. Tang, Y., Lee, T. S., and Khosla, C. (2004b). Engineered biosynthesis of regioselectively modified aromatic polyketides using bimodular polyketide synthases. PLoS Biol. 2, 227–238. Tang, Y., Lee, H. Y., Tang, Y., Kim, C. Y., Mathews, I., and Khosla, C. (2006). Structural and functional studies on SCO1815: A beta-ketoacyl-acyl carrier protein reductase from Streptomyces coelicolor A3(2). Biochemistry 45, 14085–14093. Tang, Y., Lee, T. S., Kobayashi, S., and Khosla, C. (2003a). Ketosynthases in the initiation and elongation modules of aromatic polyketide synthases have orthogonal acyl carrier protein specificity. Biochemistry 42, 6588–6595. Tang, Y., Tsai, S. C., and Khosla, C. (2003b). Polyketide chain length control by chain length factor. J. Am. Chem. Soc. 125, 12708–12709. Thompson, T. B., Katayama, K., Watanabe, K., Hutchinson, C. R., and Rayment, I. (2004). Structural and functional analysis of tetracenomycin F2 cyclase from Streptomyces glaucescens. A type II polyketide cyclase. J. Biol. Chem. 279, 37956–37963. Walczak, R. J., Dickens, M. L., Priestley, N. D., and Strohl, W. R. (1999). Purification, properties, and characterization of recombinant Streptomyces sp. strain C5 DoxA, a cytochrome P-450 catalyzing multiple steps in doxorubicin biosynthesis. J. Bacteriol. 181, 298–304. Worthington, A. S., Hur, G. H., Meier, J. L., Cheng, Q., Moore, B. S., and Burkart, M. D. (2008). Probing the compatibility of type II ketosynthase–carrier protein partners. Chem. Bio. Chem. 9, 2096–2103. Zawada, R. J., and Khosla, C. (1999). Heterologous expression, purification, reconstitution and kinetic analysis of an extended type II polyketide synthase. Chem. Biol. 6, 607–615. Zhang, W., Ames, B. D., Tsai, S. C., and Tang, Y. (2006). Engineered biosynthesis of a novel amidated polyketide, using the malonamyl-specific initiation module from the oxytetracycline polyketide synthase. Appl. Environ. Microbiol. 72, 2573–2580. Zhang, W., Watanabe, K., Cai, X., Jung, M. E., Tang, Y., and Zhan, J. (2008). Identifying the minimal enzymes required for anhydrotetracycline biosynthesis. J. Am. Chem. Soc. 130, 6068–6069. Zhang, W., Watanabe, K., Wang, C. C., and Tang, Y. (2007). Investigation of early tailoring reactions in the oxytetracycline biosynthetic pathway. J. Biol. Chem. 282, 25717–25725. Ziermann, R., and Betlach, M. C. (1999). Recombinant polyketide synthesis in Streptomyces: Engineering of improved host strains. Biotechniques 26, 106–110.
C H A P T E R
S E V E N T E E N
Bacterial Fatty Acid Synthesis and its Relationships with Polyketide Synthetic Pathways John E. Cronan*,† and Jacob Thomas* Contents 1. Introduction 2. Bacterial Fatty Acids 3. Acyl Carrier Protein, the Key Component of Bacterial Fatty Acid Synthesis 4. Overview of the Reactions of Fatty Acid Biosynthesis 5. The Initiation Steps of Fatty Acid Synthesis 6. The Enzymes of the Fatty Acid Elongation Cycle 6.1. The 3-ketoacyl-ACP synthase reaction (FabB, FabF, FabH) 6.2. 3-ketoacyl-ACP reductase (FabG) 6.3. The 3-hydroxyacyl-ACP dehydratase (FabZ) 6.4. The enoyl-ACP reductase (FabI) 7. Unsaturated Fatty Acid Synthesis in E. coli 7.1. The 3-hydroxydecanoyl-ACP dehydratase (FabA) 8. The Abundant Exceptions to the E. coli Fatty Acid Synthesis Paradigm 8.1. Branched-chain fatty acids 8.2. Anaerobic synthesis of unsaturated fatty acids 8.3. Diversity of enoyl-ACP reductases 8.4. Type I megasynthase fatty acid synthesis 9. Relationships between Fatty Acid Synthesis and Polyketide Synthesis 10. Methods for Study of Bacterial Fatty Acid Synthesis 10.1. Preparation of the holo and apo forms of E. coli ACP 10.2. Strains and plasmids used 10.3. Holo-ACP 10.4. Apo-ACP 10.5. Synthesis of Acyl-ACP substrates
* {
396 396 397 400 402 404 404 406 406 407 407 407 410 410 410 410 411 412 415 415 416 416 418 418
Department of Microbiology, University of Illinois, Urbana, Illinois, USA Department of Biochemistry, University of Illinois, Urbana, Illinois, USA
Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04617-5
#
2009 Elsevier Inc. All rights reserved.
395
396
John E. Cronan and Jacob Thomas
10.6. 10.7. 10.8. 10.9.
Purification of fatty acid synthetic enzymes Direct assays of fatty acid synthetic enzyme activities Reconstituted fatty acid synthesis systems Resolution of ACP species by conformationally sensitive gel electrophoresis 10.10. ACPs behave abnormally in SDS-polyacrylamide gel electrophoresis and gel filtration References
420 420 422 423 425 426
Abstract This review presents the most thoroughly studied bacterial fatty acid synthetic pathway, that of Escherichia coli and then discusses the exceptions to the E. coli pathway present in other bacteria. The known interrelationships between the fatty acid and polyketide synthetic pathways are also assessed, mainly in the Streptomyces group of bacteria. Finally, we present a compendium of methods for analysis of bacterial fatty acid synthetic pathways.
1. Introduction The primary role of bacterial fatty acids is to act as the hydrophobic component of the membrane lipids (generally phospholipids). In a number of bacteria, fatty acids also are found as components of storage lipids, the most prevalent being polyhydroxyalkanoic acids (although the lengths of the alkanoic chains are often too short to be considered fatty acids). Other bacteria accumulate storage forms reminiscent of eukaryotic lipids. Actinomycetes such as Streptomyces, Mycobacterium and Rhodococcus accumulate triglycerides (often having unusual acyl chains) whereas, upon growth on hydrocarbons, Acinetobacter and a variety of other hydrocarbon-utilizing bacteria accumulate wax esters in which a long chain fatty acid is esterified to a long chain fatty alcohol. Because accumulation of storage lipids usually depends on exogenous sources of acyl chains rather than de novo fatty acid synthesis, storage lipid fatty acids will not be further discussed. For the same reason postsynthetic modifications of fatty acyl chains such as cyclopropane ring formation (Grogan and Cronan, 1997) and cis-trans isomerization (Cronan, 2002) will also not be discussed.
2. Bacterial Fatty Acids The fatty acids synthesized by bacteria (Fig. 17.1) are similar to the most abundant species present in eukaryotic cells except that the bacterial acids tend to be slightly shorter, generally lack polyunsaturation and the monoenoic C18 acids have different double-bond positions. Moreover,
397
Bacterial Fatty Acid and Polyketide Synthesis
A
COOH
B
COOH
C
COOH
COOH
D
COOH
E OH F
COOH
Figure 17.1 Typical bacterial fatty acids. Structure A is hexadecanoic (palmitic) acid, a very abundant saturated fatty acid whereas structure B is cis-9-hexadecenoic (palmitoleic) acid which together with the product formed by one additional spin of the elongation cycle, cis-11-octadecenoic (cis-vaccenic) acid, are the dominant unsaturated species found in bacteria. Structure C isthe cyclopropanefattyacid cis-9,10-methylenehexadecanoic acid formed by methylene incorporation from S-adenosyl-L-methionine into phospholipid-bound palmitoleic acid.Thistogether with its C19 homologue are distributed very widely in bacteria. Structures D and E are C15 branched chain fatty acids where D is the anteiso species and E is the iso species. Structure F is 3-hydroxytetadecanoic acid, a major component of the lipid Aof most Gram-negative bacteria.
some bacteria make branched chain fatty acids, whereas others make 3-hydroxyacyl acids.
3. Acyl Carrier Protein, the Key Component of Bacterial Fatty Acid Synthesis The mechanism of the synthesis of saturated fatty acids is strongly conserved between bacteria and eukaryotes (the archaea synthesize isoprenoid-derived lipids) although the catalytic entities reside in markedly different protein arrangements. The pathway proceeds in two stages, initiation and cyclic elongation. Intermediates of the pathway are diverted to introduce the double bond of the unsaturated fatty acid species, to provide the 3-hydroxy and short chain fatty acids of the lipid A component of the outer membrane of typical Gram-negative bacteria (Raetz and Whitfield, 2002), the octanoyl-ACP used in the lipoic acid synthetic pathway, the
398
John E. Cronan and Jacob Thomas
unknown early intermediates of the biotin synthetic pathway and the acyl homoserine lactones of quorum sensing. A key feature of the fatty acid synthetic pathway is that all of the intermediates are covalently bound to a protein called acyl carrier protein (ACP), a small, very acidic and extremely soluble protein (Prescott and Vagelos, 1972). The carboxyl groups of the fatty acyl intermediates are in thioester linkage to the thiol of the 40 -phosphopanthetheine (40 -PP) prosthetic group which in turn is linked to Ser-36 of ACP through a phosphodiester bond. Such ACP thioesters are the substrates for the enzymes of the pathway. ACP is one of the most abundant proteins in E. coli and constitutes about 0.25% of the total soluble protein (6 to 8 104 molecules/cell) (Lu et al., 2007; Rock and Cronan, 1981). Indeed, ACP is reported to be the third most abundant protein present in E. coli (being slightly exceeded by RplL and TufB, two translation apparatus proteins) (Lu et al., 2007). The ACP secondary structure predicted from the amino acid sequence (Rock and Cronan, 1979) has been largely confirmed by high-resolution nuclear (NMR) magnetic resonance spectroscopy and x-ray crystallography. ACP (MW 8860) is composed of a preponderance of acidic residues largely grouped into three a-helices (helices I, II, and IV) oriented in an up-down-down topological arrangement to form a helical bundle plus a short fourth helix (helix III) that seems of lower stability and is found both almost parallel and almost perpendicular to the three helix bundle in the various structures now available (Kim and Prestegard, 1990; Roujeinikova et al., 2002b, 2007). The structural plasticity of ACP seen in the absence of acylation of the prosthetic group thiol is also seen, albeit to a lesser extent, in the acylated forms. The current picture is that ACP and its acylated derivatives can adopt many different structures by sliding and twisting the helices relative to one another and by rearranging the prosthetic group and loops. This plasticity may allow acyl groups to slide in and out of the hydrophobic cavity such that a compromise is achieved between shielding the acyl chain from solvent and allowing access to the thioester-proximal acyl carbon atoms such that fatty acid synthesis can proceed. If so, the dynamics of this process will depend on the polarity and length of the acyl chain and on interactions with the other fatty acid synthetic proteins. The prosthetic group of ACP undergoes metabolic turnover (Fig. 17.2) ( Jackowski and Rock, 1983; Thomas and Cronan, 2005) and the apoprotein is not only inactive in fatty acid synthesis but at high levels can be growth inhibitory (Keating et al., 1995). The primary enzyme catalyzing attachment of the prosthetic group is AcpS (De Lay and Cronan, 2006; Flugel et al., 2000) although a backup enzyme, AcpT, is also present (De Lay and Cronan, 2006; Flugel et al., 2000). AcpS and AcpT are 40 -phosphopantetheine transferases (40 -PP transferases) that transfer the 40 -phosphopantetheine portion from CoA to apo ACP to give holo-ACP plus 30 , 50 -ADP. Although the known 40 -PP transferases comprise a single
399
Bacterial Fatty Acid and Polyketide Synthesis
O
3´ 5´ -ADP
O P
O
O
OH
OH
OH SH
N H
HN
O
+
ACP
Coenzyme A
Apo-ACP
AcpS
ADP
3´ 5´ -ADP O
ATP O
Dephospho-coenzyme A
ACP
OH P
HN O
N H
SH
O
O
OH
Holo-ACP
PPi ATP
AcpH
O OH O- P
HN O
O
N H O
OH
SH
+
OH
ACP Apo-ACP
4´ - phosphopantetheine
Figure 17.2 ACP prosthetic group metabolism in E. coli. Apo-ACP, the product of the acpP gene, is nonfunctional in fatty acid synthesis. It is post-translationally activated by the attachment of a 40 -phosphopantetheine arm derived from coenzyme A, a reaction catalyzed by the holo-ACP synthase AcpS. Turnover of ACP involves removal of the prosthetic groupbyACP hydrolyase, AcpHwhichcan then be used in the synthesis of CoA.
protein superfamily, the quaternary structures of these proteins vary from monomers to trimers with E. coli AcpS reported to be dimeric (Lambalot and Walsh, 1997; McAllister et al., 2006). Unlike the enzymes that attach biotin and lipoic acid to their cognate proteins, the 40 -PP transferases are generally quite specific for their protein substrates (Lambalot et al., 1996) (see below). Although E. coli AcpS attaches the prosthetic group to many fatty acid ACPs, some other fatty acid ACPs are not substrates (De Lay and Cronan, 2007) and it fails to modify the structurally related carrier proteins of polyketide and nonribosomal polypeptide synthesis (Lambalot et al., 1996). However, Bacillus subtilis Sfp, which is responsible for modification of the carrier protein used in synthesis of surfactin, a nonribosomal peptide, readily modifies most carrier proteins regardless of origin or metabolic role (Lambalot et al., 1996). It is thought that ACP helix II is a major determinant of this substrate specificity (Mofid et al., 2002) Surprisingly, all known 40 -PP transferases accept acylated-CoA substrates and transfer acyl-40 -PP moieties to apo-ACP. E. coli AcpS utilizes acetyl-ACP in place of ACP at about half the catalytic efficiency and is
400
John E. Cronan and Jacob Thomas
also active with butyryl-, acetoacetyl-, and malonyl-CoAs (McAllister et al., 2006). Again, Sfp is much more promiscuous and transfers acyl-40 PP moieties modified with molecules such as biotin and fluorescein (Mercer and Burkart, 2007). It is unclear whether or not transfer of acyl-40 -PP moieties is physiologically relevant. However, the low levels of AcpS in E. coli argue that acyl-40 -PP transfer should be unable to replace a fatty acid synthetic enzyme such as FabD. Soon after the identification of the prosthetic group of ACP as 40 -PP and of the AcpS 40 -PP transferase, Vagelos and Larrabee (1967) reported an E. coli activity that removed the 40 -PP moiety of ACP (Fig. 17.2). The enzyme (called ACP hydrolyase and ACP phosphodiesterase) was purified (Fischl and Kennedy, 1990). ACP hydrolyase was shown to be an unusually stable enzyme of molecular weight 25,000 and an N-terminal sequence was reported. Unfortunately, the N-terminal sequence was found to be that of AzoR, a flavincontaining protein later shown to be an azoreductase (Nakanishi et al., 2001). Hence, it is clear that the N-terminal sequence determined was the sequence of a major contaminating protein rather than that of the phosphodiesterase. Regrettably this erroneous sequence attribution has led to many genes (often called acpD) being annotated in bacterial genomes as encoding ACP phosphodiesterase rather than azoreductase (Nakanishi et al., 2001). Thus, in order to prevent confusion with the mistaken AcpD annotations the recently identified gene was named acpH (Thomas and Cronan, 2005) based on the original enzyme name (ACP hydrolyase) given by Vagelos and Larrabee (Vagelos and Larrabee, 1967). The acpH gene was identified by expression cloning and was found to encode a protein of 23 kDa that readily aggregates upon overexpression (Thomas and Cronan, 2005; Thomas et al., 2007). Active enzyme was recovered by folding solubilized inclusion bodies and AcpH was found to be active on acyl-ACPs of fatty acyl chain lengths from C6 to C16. AcpH was active on Bacillus subtilis ACP, but inactive on Lactococcus lactis ACP. Strains carrying deletions of acpH are fully viable, but the ACP prosthetic group is metabolically stable unlike that of wildtype strains (Thomas and Cronan, 2005). Upon AcpH overproduction all of the cellular ACP is converted to the apo form (Thomas and Cronan, 2005). AcpH is not essential either in the laboratory or in the natural habitat (Thomas and Cronan, 2005). AcpH has been shown to be a noncanonical member of the HD phosphatase/phosphodiesterase family (Thomas et al., 2007).
4. Overview of the Reactions of Fatty Acid Biosynthesis The fatty acid synthesis system of E. coli is the archetype of the type II or dissociated fatty acid synthesis systems and the E. coli gene names are very often used for their homologues in other organisms. The precursors for fatty acid biosynthesis are derived from the acetyl-CoA pool. Malonyl-CoA is
401
Bacterial Fatty Acid and Polyketide Synthesis
required for all the elongation steps and is formed by the first step in fatty acid biosynthesis catalyzed by acetyl-CoA carboxylase. Malonyl-CoA is utilized for fatty acid biosynthesis only following its conversion to malonyl-ACP by malonyl-CoA:ACP transacylase (Fig. 17.3). Acetyl-CoA carboxylase will not be further discussed in this review since strictly speaking the enzyme is not a dedicated fatty acid synthesis enzyme because malonyl-CoA is used in synthesis of other molecules (e.g., polyketides). Moreover, a recent review of the E. coli and other multisubunit acetyl-CoA carboxylase is available (Cronan and Waldrop, 2002). There are three known mechanisms for the initiation of fatty acid biosynthesis in E. coli. First, FabH (3-ketoacyl-ACP synthase III) catalyzes the condensation of acetyl-CoA with malonyl-ACP to yield acetoacetylACP (Fig. 17.3). In the second pathway, the acetate moiety is first transferred from acetyl-CoA to acetyl-ACP by the transacylase activity of FabH. The acetyl-ACP is then condensed with malonyl-ACP by FabB (synthase I) or alternatively by FabF (synthase II). The third pathway involves the decarboxylation of malonyl-ACP by FabH, FabB or FabF to form acetylACP followed by subsequent condensation with malonyl-ACP. The evidence for the existence of these pathways and their relative contributions to the initiation of fatty acid biosynthesis is an area of current interest and is discussed in more detail below. The reactions of the fatty acid elongation cycle are outlined in Fig. 17.4. The first step is the Claisen condensation of malonyl-ACP with a growing acyl chain catalyzed by a 3-ketoacyl-ACP synthase (either FabB or FabF). This is the only irreversible step in the elongation cycle and thus it is not surprising that the 3-ketoacyl-ACP synthases play key roles in regulating the product distribution of the pathway. The 3-keto-thioester produced is reduced by FabG, an NADPH-dependent 3-ketoacyl-ACP reductase, followed by removal of a water molecule by FabZ, a 3-hydroxyacyl-ACP dehydratase. The final reduction is catalyzed by FabI, an enoyl-ACP reductase, to give an acyl-ACP, which can serve as a substrate for another round of elongation or, if of sufficient chain length, be transferred into complex lipids. The equilibrium of the FabI enoyl-ACP reductase reaction acts to pull the reversible 3-ketoacyl-ACP reductase and 3-hydroxyacyl-ACP dehydratase reactions to the right (Heath and Rock, 1995). Malonyl-CoA ACP AcpS
AcpH
P-PanSH CoA Apo-ACP
FabD
Acetyl-CoA FabH
Malonyl-ACP Acetoacetyl-ACP
Figure 17.3 The initiation steps in the type II fatty acid synthesis pathway of E. coli. Malonyl-CoA is converted to malonyl-ACP by malonyl transacylase (FabD). Fatty acid synthesis is initiated by FabH, which condenses malonyl-ACP with acetyl-CoA.
402
John E. Cronan and Jacob Thomas
(NADP+) NAD+ NADH (NADPH)
Acyl-ACP
FabI
Enoyl-ACP
E.coli fatty acid synthesis
Malonyl-ACP FabB FabF
ACP
3-Ketoacyl-ACP NADPH
H2O
FabG
FabZ 3-OH-acyl-ACP
NADP+
Figure 17.4 Production of unsaturated fatty acids. Unsaturated fatty acids arise from a branch in the biosynthetic pathway at the 3-hydroxydecanoyl-ACP intermediate. FabA is a unique 3-hydroxyacyl-ACP dehydratase that is capable for forming trans2-decenoyl-ACP and isomerizing this intermediate to cis-3-decenoyl-ACP. FabA is very selective for the 10-carbon substrates in vivo. FabB is absolutely required for the subsequent elongation of cis-3-decenoyl-ACP to 16:1-ACP. Interestingly, 16:1-ACP is a poor substrate for FabB, and its elongation to 18:1-ACP is controlled by the activity of FabF. FabF is a naturally temperature-sensitive enzyme, and this property account for the greater proportion of 18:1 in bacteria grown at low temperatures compared to those grown at higher temperatures. The trans-3-decenoyl-ACP is used by FabI followed by elongation by either FabB or FabF to form palmitic acid, the major saturated fatty acid in E. coli.
Two of the reactions of the cycle can be carried out by multiple discrete enzymes. As noted above in g-proteobacteria such as E. coli there are three 3-ketoacyl-ACP synthases and two 3-hydroxyacyl-ACP dehydratases are also present with one of each playing a key role in unsaturated fatty acid synthesis. Due to their differing substrate specificities, each isozyme makes a unique contribution to the regulation of the distribution of products from the pathway (see below). In most other bacteria that use the type II pathway there are two 3-ketoacyl-ACP synthases and two 3-hydroxyacyl-ACP dehydratases. However, in bacteria that synthesize branched chain fatty acids there can be three 3-ketoacyl-ACP synthases. The fatty acid biosynthetic pathway ends in the transfer of the acyl chains of the acyl-ACP end products by various acyltransferase systems. In general, transfer of the acyl chain is to a glycerol-based backbone molecule to form membrane lipids.
5. The Initiation Steps of Fatty Acid Synthesis The first step in fatty acid synthesis is condensation of a primer acylCoA with malonyl-ACP (Fig. 17.3). The conversion of malonyl-CoA to malonyl-ACP is catalyzed by malonyl-CoA:ACP transacylase, the product
Bacterial Fatty Acid and Polyketide Synthesis
403
of the fabD gene (Magnuson et al., 1992; Verwoert et al., 1992). FabD is a monomeric protein that accepts the malonyl moiety from malonyl-CoA to form a stable malonyl enzyme intermediate in which the malonyl moiety is in ester linkage to a serine hydroxyl (Oefner et al., 2006; Serre et al., 1995). Nucleophilic attack of this intermediate by the sulfhydryl of ACP gives malonyl-ACP, the major building block of fatty acids. Crystal structures of FabD, FabD complexed with malonate and the FabD-malonyl-CoA complex have been reported (Oefner et al., 2006; Serre et al., 1995). It should be noted that several polyketide ACPs have been reported to self-malonate (Arthur et al., 2005, 2006; Hitchman et al., 1998). That is, the malonyl moiety is transferred from CoA to ACP in the absence of malonyl-CoA: ACP transacylase. This reaction will be discussed below. In contrast to the reactions that produce malonyl-ACP, the reactions whereby the methyl carbon atom and the immediately adjacent carbon atom (the last two carbons of the fatty acid chain in chemical nomenclature) are incorporated into fatty acid remain somewhat unclear. In straight chain acids the methyl and penultimate carbons are derived from acetyl-CoA. Acetyl-CoA is a substrate for FabH (3-ketoacyl-ACP synthase III, which has also been called acetoacetyl-ACP synthase) and is incorporated directly to form the first four-carbon fatty acyl-ACP species ( Jackowski and Rock, 1987; Tsay et al., 1992a). In E. coli malonyl-ACP is utilized only in the elongation steps in fatty acid biosynthesis. However, FabH, FabB, and FabF are capable of initiating fatty acid synthesis in vitro in the absence of an added acetyl-ACP or acetyl-CoA as the primer. This synthesis occurs through a side reaction; decarboxylation of malonyl- ACP to give acetyl-ACP. This reaction is readily demonstrated in vitro (Alberts et al., 1972; McGuire et al., 2001), but its role in initiation in vivo awaits experimental verification. FabH has been shown to be essential for fatty acid synthesis in Lactococcus lactis by construction of a deletion mutant (Lai and Cronan, 2004). However, the deleted strain retains about 10% of the normal fatty acid synthetic ability indicating a partial bypass of FabH activity (Lai and Cronan, 2004). This seems likely to be due to malonyl-ACP decarboxylation followed by FabFcatalyzed condensation of the resulting acetyl-ACP with malonyl-ACP. However, this scenario requires experimental testing. Another possible source of acetyl-ACP would be transfer of acetyl-40 -PP from acetyl-CoA to apo ACP catalyzed by AcpS (see above). However, the intracellular level of AcpS activity seems far too low to provide the needed carbon flow. In the synthesis of branched chain acids acetyl-CoA is replaced by isovaleryl-CoA, isobutyryl-CoA, or 2-methylbutyryl-CoA, which are derived from the metabolic pathways for the amino acids, valine, leucine, and isoleucine (Wallace et al., 1995). The enzyme responsible for the synthesis of these acyl-CoAs is a specialized branched-chain–keto acid dehydrogenase complex, and mutations in the activity of this enzyme system result in strains that are auxotrophic for branched-chain acids
404
John E. Cronan and Jacob Thomas
(Cropp et al., 2000). Bacillus subtilis has two FabH homologues that accept the branched acyl-CoAs (Choi et al., 2000a) whereas Streptomyces glaucescens has only a single such enzyme (Han et al., 1998). It should be noted that the branched chain organisms also contain some straight chain acids and this is reflected in the fact that their FabH enzymes accept acetyl-CoA, although branched chain primers are the preferred substrates. In contrast, E. coli FabH ignores branched chain primers (Choi et al., 2000a).
6. The Enzymes of the Fatty Acid Elongation Cycle 6.1. The 3-ketoacyl-ACP synthase reaction (FabB, FabF, FabH) The first reaction of each cycle is the Claisen condensation of an acyl thioester (acyl-ACP or for FabH, acetyl-CoA) with malonyl-ACP to form a 3-ketoacyl-ACP plus ACP (or CoA). Three E. coli enzymes are known to catalyze 3-ketoacyl-ACP synthase reactions. These enzymes were referred to as synthases I, II and III, but more recently have come to be called FabB, FabF and FabH, respectively, after their gene names. The fabH and fabF genes are located within the fatty acid synthetic gene cluster (Rawlings and Cronan, 1992) whereas fabB maps alone at a distant site. Siggaard-Andersen and coworkers (1994) reported a putative fourth KAS activity in E. coli and assigned an open reading frame to this activity. However, this report was based on a series of indirect inferences and was in error; the gene sequenced was the fabF gene (Magnuson et al., 1995; Rawlings and Cronan, 1992) and the enzyme activity described seems likely to be a mixture of FabH with FabB and/or FabF. The three E. coli 3-ketoacyl-ACP synthases represent two classes of decarboxylating Claisen condensing enzymes (Heath and Rock, 2002; White et al., 2005). The FabB and FabF enzymes have Cys-His-His active sites whereas FabH has a CysHis-Asn active site triad. These differences are reflected in the rest of the primary sequences of the proteins. FabB and FabF are about 37% identical whereas alignment of either FabB or FabF with FabH gives only scattered alignments of very low quality. High-resolution crystal structures of all three enzymes are available (White et al., 2005). The functional FabB is composed of two identical subunits (Garwin et al., 1980b) and contains both malonyl-ACP and fatty acyl-ACP binding sites (D’Agnolo et al., 1975b). In the condensation reaction, the acyl group becomes covalently linked to a specific FabB cysteine sulfhydryl (D’Agnolo et al., 1975b). The acyl-enzyme undergoes condensation with malonylACP to form 3-ketoacyl-ACP, CO2, holo-ACP and free enzyme. Inhibition studies using cerulenin (see below) show the active site cysteine to be Cys-163 (Kauppinen et al., 1988).
Bacterial Fatty Acid and Polyketide Synthesis
405
Further investigation revealed the presence of a second long chain synthase activity in E. coli, FabF (D’Agnolo et al., 1975a). Like FabB, FabF has a dimeric structure and is inhibited by cerulenin (Ulrich et al., 1983), although FabF is less sensitive to the antibiotic than is FabB and is not essential for growth of E. coli. Both synthases are both capable of participating in saturated and unsaturated fatty acid synthesis. The enzymes have been shown, in vitro, to function similarly with all substrates except palmitoleoylACP; palmitoleoyl-ACP is an excellent substrate for FabF, but not for FabB (Edwards et al., 1997; Garwin et al., 1980b). This observation is consistent with the role of FabF in the regulation of fatty acid composition of the membrane phospholipid in response to temperature (see below). Mutant strains having fabB missense or null mutations (Garwin et al., 1980a), however, require unsaturated fatty acids for growth. Therefore, in vivo FabB must catalyze a key reaction in unsaturated fatty acid synthesis that FabF cannot. This reaction is probably the elongation of cis-3-decenoylACP, although this has not been demonstrated experimentally. This step is the rate-limiting step in unsaturated fatty acid synthesis (Clark et al., 1983). FabB overproduction has two known effects. First, overproduction of the enzyme overcomes its poor ability to elongate palmitoleoyl-ACP and an increased amount of cis-vaccenic acid is incorporated into phospholipid (de Mendoza et al., 1983). The increase, however, has no effect on the temperature regulation of fatty acid composition (de Mendoza et al., 1983). Second, excess cellular FabB renders E. coli resistant to the antibiotic thiolactomycin which is an inhibitor of all three 3-ketoacyl-ACP synthases. It was thought that FabB-catalyzed decarboxylation of malonyl-ACP offered the cell an alternative initiation pathway for fatty acid biosynthesis; malonyl-ACP decarboxylation to give acetyl-ACP that was used as a primer for chain elongation. The isolation of thiolactomycin-resistant strains that have a resistant FabB has borne out this hypothesis in vivo ( Jackowski et al., 2002). Moreover, in the presence of the antibiotic, excess FabB appears to allow the cell to bypass the standard FabH initiation pathway probably by decarboxylation of malonyl-ACP to form acetyl-ACP ( Jackowski et al., 2002; Tsay et al., 1992b). Given the above observations, FabB appears to be the only E. coli 3-ketoacyl-ACP synthase absolutely required for growth ( Jackowski et al., 2002; Tsay et al., 1992b). FabH is a dimeric protein of 33.5 kDa first detected as a condensation activity resistant to cerulenin both in vivo and in vitro ( Jackowski and Rock, 1987). Although cerulenin blocks the synthesis of long chain fatty acids, short chain (C4 to C8) acids linked to ACP are accumulated both in vivo and in cell extracts. The fabH gene has been shown to encode KAS III. As noted above the FabH sequence has no similarity to those of FabB or FabF, although there is good alignment with other enzymes known to catalyze condensation reactions. From the chain length of the acyl-ACPs produced and the behavior of fabB fabF double mutants mentioned above, it is clear
406
John E. Cronan and Jacob Thomas
that FabH does not participate in the progressive condensation steps of fatty acid synthesis that produce the long chain acids found in the phospholipids and lipid A. However, the enzyme could produce the fatty acid synthetic intermediates used in lipoic acid (and perhaps biotin) synthesis. However, the high activity of the enzyme suggests that it does not exclusively function in this pathway (E. coli requires only a few hundred lipoic acid molecules per cell).
6.2. 3-ketoacyl-ACP reductase (FabG) An open reading frame encoding a protein with strong similarities to several acetoacetyl-CoA reductases and particularly plant 3-ketoacyl-ACP reductases (>50 % identical residues) was found between the fabD and acpP genes in the fab gene cluster (Rawlings and Cronan, 1992). This gene was designated as fabG and is obligatorily co-transcribed with the upstream genes (Zhang and Cronan, 1996, 1998). Blocking fabG transcription blocked cell growth indicating that it is an essential gene (Zhang and Cronan, 1998). However, no mutants in this gene were available until the recent isolation of temperature-sensitive mutants of both E. coli and Salmonella enterica (Lai and Cronan, 2004). Strikingly, all of the mutations were located in or near the subunit interfaces of the FabG homotetramer suggesting that monomers and dimers of the enzyme are inactive. At the nonpermissive temperature, fatty acids synthesis was blocked in the fabG(Ts) mutants following the initial condensation such that only four carbon acyl-ACP species accumulated. Thus, only a single NADPH-specific 3-ketoacyl-ACP reductase exists in E. coli and it functions with all acyl chain lengths (Lai and Cronan, 2004). Crystal structures of FabG are available (White et al., 2005).
6.3. The 3-hydroxyacyl-ACP dehydratase (FabZ) This enzyme is not to be confused with the 3-hydroxydecanoyl-ACP dehydratase specifically required for introduction of the double bond of the unsaturated acids in E. coli and related bacteria. Prior biochemical data gave a puzzling picture of this reaction. One group reported that this step is catalyzed by a single enzyme active with substrates of all chain lengths (Birge et al., 1967) whereas another laboratory reported the presence of three enzymes specific for short, medium, and long chain length substrates (Mizugaki et al., 1968). More recent work with recombinant FabZ showed that the dehydratase efficiently catalyzed the dehydration of short chain 3-hydroxyacyl-ACPs and long chain saturated and unsaturated 3-hydroxyacyl-ACPs (Heath and Rock, 1996). The fabZ gene was isolated as a suppressor of a mutation in lipid A biosynthesis. The suppression is thought to be due to increased intracellular levels of 3-hydroxymyristoyl-ACP (Mohan et al., 1994). Unfortunately, the
Bacterial Fatty Acid and Polyketide Synthesis
407
phenotype of the original mutant strain is too feeble for physiological studies. Although no structure of E. coli FabZ is presently available, several FabZ homologue structures have been reported the most closely related of which is that of the Pseudomonas aeruginosa protein (Kimber et al., 2004). This FabZ shows sequence homology to FabA (which was a key to its discovery) and thus it was no surprise that the monomers have a hot-dog fold (see Section 7.1) and the active sites lie at the dimer interface. FabZ has a Glu residue in place of the active site Asp residue of FabA. This substitution was thought to play an important role in the differing specificities of the two enzymes. However, the discovery of a FabZ homologue (FabN) that has FabA activity and has a Glu active site residue (Wang and Cronan, 2004) indicates that this simple hypothesis is incorrect.
6.4. The enoyl-ACP reductase (FabI) Two forms of enoyl-ACP reductase, the last enzyme of the fatty acid cycle, were originally reported, one dependent on NADH and the other on NADPH (Weeks and Wakil, 1968). However, both activities were subsequently shown to be due to the same enzyme, FabI (Bergler et al., 1996), the sole enoyl-ACP reductase of E. coli (Heath and Rock, 1995). The identification of the protein encoded by this gene, now called fabI, was the result of studying mutants of E. coli and S. enterica resistant to diazaborines, a class of potent antimicrobial agents that inhibit lipid synthesis (Turnowsky et al., 1989). FabI is also the target of the widely used antimicrobial compound, triclosan (Heath et al., 1999; McMurry et al., 1998). FabI plays a role in the fatty acid synthesis cycle in that its action pulls the other reversible steps of the cycle (FabG, and FabZ) to the right such that each cycle of fatty acid biosynthesis is completed (Heath and Rock, 1995). Several FabI crystal structures (White et al., 2005) and a useful fabI temperature sensitive mutant (Bergler et al., 1994) are available. It should be noted that E. coli FabI has been reported to be inhibited by palmitoyl-CoA (Bergler et al., 1996). Although this has been ascribed a physiological role, it remains to be demonstrated that the observed inhibition is not due to the well-known detergent properties of long chain acyl-CoAs.
7. Unsaturated Fatty Acid Synthesis in E. coli 7.1. The 3-hydroxydecanoyl-ACP dehydratase (FabA) This enzyme essentially extracts a major fraction of the 3-hydroxydecanoylACP from the elongation cycle and introduces a cis double bond (Fig. 17.4). Following elongation of the cis-3-decenoyl-ACP by FabB (Fig. 17.5), these modified acyl chains are returned to the cycle for elongation to the long
408
John E. Cronan and Jacob Thomas
Octanoyl-ACP + Malonyl-ACP
3-OH-10-ACP FabA FabZ 10:1Δ2t-ACP FabB FabF 16:0-ACP
FabA (FabM) (FabN)
10:1Δ3c-ACP FabB (FabO) 16:1-ACP FabF 18:1-ACP
Figure 17.5 The elongation cycle. There are four steps in fatty acid elongation. Each new cycle of two-carbon elongation is initiated by the condensation of acyl-ACP and malonyl-ACP by one of the elongation condensing enzymes, FabB or FabF. The next step is the reduction of the 3-ketoacyl-ACP by the NADPH-dependent FabG. This 3-hydroxylacyl-ACP is dehydrated to trans-2-acyl-ACP by FabZ. The final step is the NADH-dependent reduction of enoyl-ACP to acyl-ACP by FabI.The parentheses show isozymes from other bacteria that catalyze the reaction shown.
chain unsaturated acids needed for phospholipid function (Bloch, 1971). 3-Hydroxydecanoyl-ACP dehydratase specifically catalyzes the dehydration of 3-hydroxydecanoyl-ACP to a mixture of trans-2-decenoyl-ACP and cis-3-decenoyl-ACP (Bloch, 1971). The reaction proceeds via the formation of trans-2-decenoyl-ACP as an enzyme-bound intermediate which can disassociate from the enzyme (Bloch, 1971). When disassociation occurs, the trans-2 intermediate is reduced by an enoyl-ACP reductase and subsequently converted to saturated fatty acids as in the standard elongation cycle (Clark et al., 1983; Guerra and Browse, 1990; Heath and Rock, 1996). Enzyme-bound trans-2-decenoyl-ACP, however, is isomerized to cis-3-decenoyl-ACP. The double bond is preserved and the cis-3 intermediate is elongated to the unsaturated fatty acids of E. coli, palmitoleic acid, and cis-vaccenic acid. The enzyme, a homodimer of 18 kDa subunits (Leesong et al., 1996), is distinct from the elongation cycle FabZ dehydratase discussed above, although the two enzymes contain sequences in common. The first mutants isolated that were blocked in fatty acid biosynthesis, called fabA, lacked 3-hydroxydecanoyl-ACP dehydratase (Silbert and Vagelos, 1967). These mutants are unable to synthesize unsaturated fatty acids, but synthesize saturated fatty acids normally. In vitro mutant fabA enzymes could form neither the cis-3 nor trans-2-decenoyl products (Cronan and Gelmann, 1973). This finding, along with the observation that saturated fatty acid synthesis continues in vivo indicated that another
Bacterial Fatty Acid and Polyketide Synthesis
409
dehydratase was available for saturated fatty acid synthesis, the enzyme, now called FabZ, which catalyzes the formation of trans-2-decenoyl-ACP, but cannot catalyze the isomerase reaction (Heath and Rock, 1996). In the absence of thermal regulation, the ratio of unsaturated to saturated fatty acids in E. coli is dependent on the levels of FabA and FabB. It was shown that overproduction of FabA in vivo failed to increase the level of unsaturated fatty acids, but significantly increased the amount of saturated fatty acids incorporated into membrane phospholipids (Clark et al., 1983). This indicated that, although FabA is required for the synthesis of unsaturated fatty acids, the level of enzyme activity does not limit the rate of unsaturated fatty acid synthesis. Introduction of multiple copies of the fabB gene (encoding synthase I) reversed the effect of dehydratase overproduction resulting in wildtype fatty acid compositions (Clark et al., 1983). Thus, the step more likely to limit the rate of unsaturated fatty acid synthesis is the elongation of cis-3-decenoyl-ACP catalyzed by FabB. The levels of expression of the fabA and fabB genes, therefore, appear to establish a basal ratio of unsaturated to saturated fatty acid synthesis in the absence of thermal regulation. Modulation of the fatty acid composition of membrane phospholipid in response to temperature shift is discussed below. FabA functions with acyl chain lengths from C4 to C12 in an in vitro fatty acid synthesis system reconstituted from purified enzymes (Heath and Rock, 1996). This is a considerably wider range of FabA substrates than originally reported in studies using synthetic model substrates (Bloch, 1971). The reasons for this disagreement are unclear, but it should be noted that the ratios of products produced by the enzyme using acyl-ACP substrates (Guerra and Browse, 1990) differs from that obtained using model substrates (Bloch, 1971). The mechanism of FabA has been thoroughly studied (Bloch, 1971; Schwab and Henderson, 1990) since it was the first enzyme for which a mechanism-activated ("suicide") inhibitor was described. This inhibitor, 3-decynoyl-N-acetylcysteamine, forms a covalent adduct with the active site histidine residue resulting in loss of all of the partial reactions of the enzyme (Bloch, 1971; Cronan et al., 1988; Leesong et al., 1996) The x-ray crystal structure of E. coli FabA was the first structure determined for an E. coli fatty acid synthetic protein. FabA was the first example of the ‘‘hot-dog’’ fold in which a long central a-helix is wrapped by a six-stranded antiparallel b-sheet (Leesong et al., 1996). FabA forms an unusually stable dimer and it seems that the dimerization is essential for activity since the two active sites are formed along the dimer interface with the critical His and Asp active site residues being contributed by different monomers (Leesong et al., 1996).
410
John E. Cronan and Jacob Thomas
8. The Abundant Exceptions to the E. coli Fatty Acid Synthesis Paradigm 8.1. Branched-chain fatty acids The synthesis of branched-chain fatty acids by use of FabH homologues has been discussed above. Such fatty acids occur widely in bacteria (e.g., Bacilli, Streptomyces, Staphylococci).
8.2. Anaerobic synthesis of unsaturated fatty acids The classical pathway of anaerobic unsaturated fatty acid synthesis in E. coli is not widely distributed in bacteria. Genomic analyses indicate that only the a- and g-proteobacteria encode the proteins of this pathway. Most other bacteria including many pathogens make unsaturated fatty acids under anaerobic conditions, but lack recognizable homologues of the key E. coli unsaturated fatty acid synthetic enzymes, FabA and FabB. Thus far, Streptococcus pneumoniae has been shown to introduce the cis double bond using FabM (Marrakchi et al., 2002), an isomerase of a sequence unrelated to FabA, that performs only one of the FabA reactions (FabA is both an isomerase and a dehydratase). In contrast, Enterococcus faecalis was shown to have proteins that are homologues of FabZ and FabF that perform the roles of FabA and FabB, respectively (Wang and Cronan, 2004). This work has been extended (Altabe et al., 2007; Lu et al., 2005). However, riddles remain in a number of bacteria (e.g., the clostridia and the lactic acid bacteria). Pseudomonas aeruginosa has not only the classical FabA-FabB pathway, but also two oxygen-requiring desaturase pathways, one of which uses endogenous phospholipid acyl chains whereas the other uses exogenous saturated fatty acids (Cronan, 2006a; Zhu et al., 2006). The bacilli also have desaturases that are induced by low-growth temperatures that utilize endogenous phospholipid acyl chains (Mansilla and de Mendoza, 2005). Other bacteria lack FabM, FabA, FabB, and desaturases, and lack extra copies of genes encoding FabZ and FabF homologues. Therefore, it seems that other pathways for unsaturated synthesis exist.
8.3. Diversity of enoyl-ACP reductases A curious and important divergence is seen in the conservation of bacterial fatty acid synthetic (FAS) proteins. Most FAS II enzymes are strongly conserved among bacteria both in sequence and (where data are available) in structure and most domains of the FAS I proteins are clearly derived from FAS II proteins (Cronan, 2004, 2006b). An exception is the last step of the elongation cycle, formation of a saturated acyl-ACP by reduction (generally NAD(P)H-dependent) of the enoyl-ACP double bond. As mentioned above
Bacterial Fatty Acid and Polyketide Synthesis
411
in E. coli this reaction is catalyzed by the product of the fabI gene that was discovered as the target for the antibacterial action of a set of diazaborine compounds (Bergler et al., 1994). FabI was later shown to also be the site of the antibacterial action of triclosan (McMurry et al., 1998), a compound used in antibacterial hand soaps and a large variety of other everyday products. Although FabI homologues are widely distributed in bacteria and other FAS II-containing organisms, the existence of a number of bacterial species naturally resistant to triclosan was soon recognized (Heath et al., 1999; Marrakchi et al., 2003). In these bacteria triclosan resistance was due to the presence of enoyl-ACP reductase isozymes of varying resistance to triclosan. Bacillus subtilis contains two isozymes, a FabI homologue and an isozyme called FabL that is moderately resistant to triclosan (Heath et al., 2000) and, like FabI, is a member of the short chain dehydrogenase reductase superfamily. Streptococcus pneumoniae contains a single enoyl-ACP reductase, FabK, that is refractory to triclosan and is a TIM barrel flavoprotein unrelated to the short chain dehydrogenase reductase isozymes (Marrakchi et al., 2003). A fourth class of enoyl-ACP reductase is present in vibrios and related bacteria (Massengo-Tiasse and Cronan, 2008). The diversity of the bacterial enoylACP reductases when compared to the lack of structural and mechanistic diversity seen in the other enzymes of the FAS II elongation cycle argues that naturally occurring compounds exist that selectively inhibit one or another of these enzymes. This hypothesis has recently been confirmed by the recent discoveries of natural enoyl-ACP reductase inhibitors of fungal origin that specifically target FabI (Cephalochromin) (Zheng et al., 2007) and FabK (Atromentin and Leucomelone) (Zheng et al., 2006).
8.4. Type I megasynthase fatty acid synthesis The most striking divergence from the E. coli type II fatty acid synthetic pathway is the type I megasynthase pathway found in the mycolic acidproducing branch of the Actimomycetales (mycobacteria, corynebacteria, rhodococci, and nocardiae) (Schweizer and Hofmann, 2004). Mycolic acids are high-molecular-weight a-alkyl b-hydroxy fatty acids (70 to 90 carbon atoms in length) composed of a species-specific ‘‘short’’ arm of 22 to 26 carbon atoms and a ‘‘long’’ meromycolic acid arm of 50 to 60 carbon atoms (although this arm is shorter in corynebacteria) (Gokhale et al., 2007; Schweizer and Hofmann, 2004). These essential molecules are found in the matrix of the cell wall and are formed by head-to-head Claisen-type condensations of two long-chain fatty acyl thioesters followed by reduction of the keto group. De novo synthesis of the long-chain fatty acid esters is accomplished by several strategies. In mycobacteria, the type II system is unable to perform de novo synthesis, which is the function of the type I system. The type I system synthesizes C16 and C26 saturated acyl-CoAs. The C16-CoA is elongated by the type II FabH protein and
412
John E. Cronan and Jacob Thomas
successive condensation (by two very long-chain FabF-like enzymes) and reduction cycles to give the C56-CoA. This is condensed with the C26CoA by the Pks13 polyketide synthase that catalyzes the Claisen condensation. Reduction of the resulting ketone by specific reductase gives the mycolic acids (Gokhale et al., 2007). It should be noted that the type I system may play only a minor role in the growth of pathogenic mycobacteria since they readily acquire host fatty acids. Excepting its specificity for long-chain lengths, the mycobacterial type II system is fairly typical. The multifunctional fatty acid synthesis (FAS) polypeptides of mycobacterial and corynebacteria contain all the functional domains required for de novo fatty acid synthesis (Schweizer and Hofmann, 2004). These domains are organized in the following order: acyltransferase, enoyl reductase, dehydratase, malonyl/palmitoyl transferase, acyl carrier protein, 3-ketoacyl reductase and 3-ketoacyl synthase. All intermediates generated remain enzyme-bound during the process of elongation and undergo transacylation to other catalytic sites within the enzyme. FAS I generates short-chain, fatty acyl-CoA primers that are further elongated by the type II system. It is remarkable that the domain order of the bacterial type I protein is precisely that given by in silico fusion of the yeast b and a fatty acid synthase subunits with b being the N-terminal partner (Schweizer and Hofmann, 2004). Moreover, both the bacterial type I protein and yeast enzymes are functional hexamers. It will be interesting to see if the bacterial type I protein has the fantastic porous barrel architecture of the fungal enzyme (Cronan, 2006c). Corynebacteria synthesize unsaturated fatty acids by use of a second type I synthase that contains a FabA-like domain (Schweizer and Hofmann, 2004). Mutational inactivation of the gene encoding this second synthase results in an unsaturated fatty acid requirement. However, some corynebacteria lack this second enzyme and make only saturated species (Schweizer and Hofmann, 2004), whereas others lack a type I protein and require fatty acids for growth (Tauch et al., 2005). Finally, it should be noted that proteins annotated as fatty acid synthetic proteins based on sequence homologies with the E. coli proteins can have no involvement in fatty acid synthesis. For example a Pseudomonas aeruginosa FabH homologue catalyzes a key step in the synthesis of an extracellular quinoline derivative (Zhang et al., 2008) that acts as a quorum-sensing molecule and a Mesorhizobium FabH homologue plays a role in biotin synthesis (Sullivan et al., 2001).
9. Relationships between Fatty Acid Synthesis and Polyketide Synthesis There seems no doubt that polyketide synthesis is an evolutionary descendant of fatty acid synthesis. The fatty acid synthase (FAS-I) responsible for de novo fatty acid synthesis in the cytosol of animal cells is
Bacterial Fatty Acid and Polyketide Synthesis
413
homologous in sequence and analogous in architecture with the very large family of type I modular polyketide synthases (PKSs). Both ‘‘megasynthase’’ assembly lines use homologous domains (ACP or PCP) to carry the growing fatty acid or polyketide via a pantetheine-linked thioester (Smith and Sherman, 2008). The common thioester chemistry, similar structures and the adaptable architecture have resulted in the proliferation of hybrid PKSFAS pathways found in phylogenetically diverse bacteria (Smith and Sherman, 2008). Indeed, the very complex lipids of mycobacteria are made via a partnership between an FAS and a modular PKS (Gokhale et al., 2007) and a class of fatty acids are produced by modular PKS systems (Metz et al., 2001; Wallis et al., 2002). This close relationship raises the question of whether or not FAS and PKS systems share enzymatic components. The two systems clearly share the precursors, acetyl-CoA and malonyl-CoA, but this is probably not a competitive situation because fatty acid synthesis proceeds primarily in growing cells, whereas polyketides are secondary metabolites whose synthesis generally occurs after a culture ceases net growth. Indeed, ectopic expression of sets of whiE-PKS genes presumed sufficient to assemble a carbon chain caused inhibition of early growth of the strains. This growth inhibition was not a nonspecific effect of the protein expression because it required all three genes to be expressed (subsets of two of the proteins gave no inhibition of growth). It has been reasonably proposed that this growth inhibition is due to competition between fatty acid synthesis and the inappropriately timed polyketide synthesis for precursors or proteins common to the two pathways (Yu and Hopwood, 1995). This hypothesis remains to be tested. The more interesting question is whether or not the fatty acid and polyketide synthetic pathways share protein components. This question has been addressed almost exclusively in bacteria of the genus Streptomyces due to the remarkable diversity of polyketides made by these bacteria and has focused on type II polyketide synthases which are composed of discrete monofunctional proteins (analogous to type II fatty acid synthesis) rather than the large, highly modular type I polyketide synthases in which interactions are ‘‘hard-wired.’’ The early finding that S. coelicolor contained three different ACP-like proteins, rather than the single protein expected if the fatty acid ACP (AcpP) could also function in polyketide synthesis, suggested that ACP was not a shared component (Revill et al., 1996). AcpP was identified by its constitutive expression, its genomic clustering with genes encoding other fatty acid synthetic proteins and its ability to function in E. coli fatty acid synthesis. In contrast, the remaining two proteins were developmentally regulated and one of these was shown to be required for synthesis of the polyketide, actinorhodin (Revill et al., 1996). Moreover, Streptomyces AcpPs were shown to only very weakly complement mutants lacking the actinorhodin ACP-like protein; only traces of the polyketide were produced (Khosla et al., 1992; Revill et al., 1996). Later work showed
414
John E. Cronan and Jacob Thomas
that AcpP and some PKS ACPs are modified by distinct phosphopantetheinyl transferases (the AcpS reaction of Fig. 17.2), although other PKS ACPs are modified by AcpS (Cox et al., 2002; Lu et al., 2008; Shen et al., 1992a; Walsh et al., 1997). Hence, some AcpS proteins are less specific for their acceptor protein than E. coli AcpS. Moreover, a few phosphopantetheinyl transferases such as B. subtilis Sfp are known to modify a wide diversity of ACP-like proteins (Finking et al., 2002; Mootz et al., 2001). Recently a new approach to test the compatibility of the ACPs of type II FAS and PKS systems has been developed (Worthington et al., 2008). This approach uses modified ACP species that carry a reactive electrophile in place of the thiol of the 40 -PP moiety. Interaction between one of these modified ACPs and a 3-ketoacyl-ACP synthase results in formation of a covalent bound between the ACP prosthetic group and the active site cysteine of a synthase. The systems compared were the E. coli FAS AcpP together with the E. coli FabB and FabF synthases and EncC (the ACP) and EncAB synthase of the Streptomyces maritimus polyketide, enterocin. Two different 40 -PP analogues were tested for each ACP. One analogue mimicked a short chain acyl-ACP whereas the other mimicked a longer chain species. As expected both the E. coli and S. maritimus ACP species reacted with their cognate synthase. Both versions of E. coli AcpP also reacted with S. maritimus EncAB. However, only a partially reciprocal result was seen in that FabF failed to react with either version of EncC, whereas FabB reacted only with EncC carrying the shorter analogue (Worthington et al., 2008). These findings raise the question of whether or not EncC functions in both the FAS and entericin pathways of S. maritimus even though the ACP is encoded in the gene cluster of the latter pathway. However, no S. maritimus genome sequence is available and thus the possibility of an FAS ACP cannot be evaluated at present. The other fatty acid synthetic protein suspected to play a role in polyketide synthesis is FabD, the malonyl-CoA:AcpP transacylase (Fig. 17.3). FabD proteins purified from Streptomyces were shown to be active on both AcpPs and type II PKS ACPs (Florova et al., 2002; Revill et al., 1995; Summers et al., 1995). These enzymes were demonstrated to be fatty acid synthetic proteins by their genomic clustering with other fatty acid genes and in one case the ability to functionally replace the E. coli FabD protein when expressed in E. coli (Summers et al., 1995). There seems only a single discrete malonyl-CoA:AcpP transacylase encoded in the S. coelicolor genome sequence (although domains of similar sequence are found in the modular type I PKS genes) and this is also the case in S. avermitilis. However, the genome of S. griseus subsp. griseus encodes three FabD homologues. Hence, there is a possibility that there may be malonyl-CoA:ACP transacylases targeted to specific PKS ACPs in some Streptomyces but not others. The malonyl-CoA:AcpP transacylase of S. glaucescens has been reported to play an indirect role in providing a building block for synthesis of the polyketide
Bacterial Fatty Acid and Polyketide Synthesis
415
tetracenomycin C (Florova et al., 2002). In vivo studies with deuterium labeled acetate indicates that, in direct contrast to fatty acid synthesis, the starter acetate unit is not derived directly from acetyl-CoA as shown by loss of deuterium upon incorporation into the polyketide. The starter unit is thought to be formed indirectly by synthesis of malonyl-CoA from acetyl-CoA followed by transfer of the malonyl moiety to the tetracenomycin ACP (TcmM) (Florova et al., 2002. The resulting malonyl-TcmM would then be decarboxylated to give acetyl-TcmM, the acetate moiety of which is the proposed starter unit (Florova et al., 2002). Although malonyl-ACP decarboxylation is a known side reaction of 3-ketoacylACP synthases, the identity of the enzyme catalyzing decarboxylation is unclear. However, FabH seems a strong possibility (Smirnova and Reynolds, 2001; Wallace et al., 1995). In mycobacteria the FAS II 3-ketoacyl-ACP synthase (KasA) has been found to interact with PpsB and PpsD, two polyketide modules involved in the biosynthesis of the virulence lipid, phthiocerol in E. coli (Kruh et al., 2008). The interaction with PpsB, a four-module PKS protein containing an ACP domain, was examined in detail. When PspB labeled with a longchain fatty acid was incubated with KasA and AcpM, the Mycobacterium AcpP, the acyl chain was transferred to both proteins and could be elongated when other FAS components were present. Hence, transfer of a PKS product to an FAS for further elongation seems possible. The reverse transfer did not occur. The PKS to FAS transfer was proposed to serve to increase the diversity of mycobacterial lipids (Kruh et al., 2008).
10. Methods for Study of Bacterial Fatty Acid Synthesis 10.1. Preparation of the holo and apo forms of E. coli ACP ACP is one of the most abundant proteins of E. coli and can readily be purified from wildtype cells. However, modern day preparations utilize high-level overexpression of the protein. In some cases the acpP gene has been modified by addition of N-terminal or C-terminal tags to aid purification of the encoded fusion protein. However, bacterial ACPs have atypical and highly conserved properties that make purification of the native proteins very facile. First, ACP is very acidic (isoelectric point of 4.1), small and extremely soluble (solutions of >40 mg/ml can be made). This solubility allows bulk purification steps such as precipitation of most other proteins with 50% 2-propanol or saturated ammonium sulfate while ACP remains in solution. We favor the 50% 2-propanol treatment since the 2-propanol does not interfere with ion exchange chromatography, the final step of the purification. The acidic nature of ACP results in very tight binding of
416
John E. Cronan and Jacob Thomas
ACP to strongly basic anion exchanger resins such as Q (quaternary ammonium) or the weakly basic anion exchanger, DEAE (often abbreviated D). We favor the DEAE matrix because it binds fewer contaminating proteins than Q. ACP is bound to the DEAE column at pH 6.1. At this pH the strongly acidic ACP binds tightly whereas most other proteins bind weakly (if at all) because the pH is below their isoelectric points. Second, ACP readily and quantitatively refolds following denaturation with heat, urea, guanidine or trichloroacetic acid (TCA). In the procedures below ACP species are routinely recovered and concentrated by TCA precipitation. The TCA can be removed by dialysis as below by washing the ACP precipitate with a pH 4.1 buffer followed by dissolution in a buffer of higher pH (Cronan and Klages, 1981). Both procedures remove any deoxycholate (used as a coprecipitant) remaining from the precipitation step. The procedure outlined below is modified from those described previously (Keating et al., 1995; Rock and Cronan, 1980, 1981) and applies to Escherichia coli ACP, but may be adaptable to the ACPs of other organisms provided that they have similar sizes and isoelectric points.
10.2. Strains and plasmids used The E. coli K-12 strain used for ACP expression is DK574 (Keating et al., 1995) which is strain SJ16 ( Jackowski and Rock, 1981) containing plasmid pMR19 (Rawlings, 1993) which encodes the structural gene for ACP from E. coli under control of a tac promoter and the Lacl repressor overexpression plasmid pMS421 (Grana et al., 1988). The strain also has a chromosomal lesion in the gene encoding the aspartate decarboxylase, panD. This mutation does not affect growth in rich medium but imposes a requirement for exogenous supplementation with the CoA precursor b-alanine in minimal medium (Cronan, 1982). This permits the isolation of radiolabeled ACP by supplementation with radioactive b-alanine. Plasmid pJT93 carrying the holo-ACP synthase gene acpS under control of a lac promoter was constructed as follows: acpS was amplified from E. coli K-12 genomic DNA. The PCR product was digested with restriction enzymes KpnI and PstI and ligated into the vector pDHC30 (Phillips et al., 2000) digested with the same enzymes. Plasmid pJT94 encoding acpH under lac promoter control was constructed in a similar fashion. The acpH gene was amplified from E. coli K-12 genomic DNA, the PCR product digested with enzymes KpnI and PstI and ligated into pDHC30 digested with the same enzymes.
10.3. Holo-ACP At high levels of expression acyl carrier protein is isolated primarily in the apo-form (Keating et al., 1995). To ensure complete phosphopantetheinylation of the protein, strain DK574 is additionally transformed with the
Bacterial Fatty Acid and Polyketide Synthesis
417
plasmid pJT93 expressing the Escherichia coli AcpS 40 -PP transferase under tac promoter control, a system similar to the BAP1 system for the purification of PKS ACPs discussed in Chapter 16 of this volume. Strain DK574 carrying pJT93 is cultured overnight in LB medium supplemented with 15 mg/ml kanamycin, 50 mg/ml streptomycin and 10 mg/ml chloramphenicol. This starter culture is diluted 100-fold into 500 ml of the same medium and incubated with shaking at 37 until it reaches an optical density of 0.8. When ACP labeled in the 40 -PP arm is desired, the following changes are made: the expression strain is cultured overnight in 5 ml M9 medium supplemented with 15 mg/ml kanamycin, 50 mg/ml streptomycin, 10 mg/ ml chloramphenicol, 0.4% glucose, and limiting (0.5 mM) b-alanine in order to reduce the CoA pools. These b-alanine starved cultures are then diluted 100-fold into 100 to 500 ml of M9 medium containing 0.4% glucose and 8 mM [3H] b-alanine (American Radiolabeled Chemicals) and grown to an optical density of 0.8. The expression of ACP and AcpS are simultaneously induced by the addition of 100 mM IPTG followed by incubation for a further 3 to 4 h. The cells are harvested by centrifugation at 17,700g for 10 min and washed in an equal volume of 50 mM Tris-HCl, pH 8.8. The cells are then resuspended in 5 ml AcpS reaction buffer (50 mM Tris-HCl pH 8.8, 10 mM MgCl2, 5 mM dithiothreitol) and lysed by sonication (six 20-s pulses) or by two passages through a French pressure cell. The cell lysate is cleared by centrifugation at 18,000g for 20 min at 4 , 1 mM CoA is added to the supernatant and incubated at 37 for 4 h. The alkaline pH and high concentration of dithiothreitol (DTT) also serve to hydrolyze acyl-ACP thioesters that may be present. At this stage, complete conversion to holoACP is verified by conformationally sensitive gel electrophoresis on a nondenaturing 20% polyacrylamide gel containing 0.5 M urea (Rock et al., 1981b) followed by staining with Coomassie Brilliant Blue 250. The treated cell extract is dialyzed against 50 mM potassium-2(N-morpholino)ethanesulfonic acid (K-MES) (pH 6.1) overnight or subjected to ultrafiltration using a centrifugal filter of MWCO 5000 with three buffer replacements. An equal volume of ice-cold isopropanol is added to the dialyzed extract and incubated with stirring at 4 for 2 to 14 h to allow precipitation of cellular protein. The suspension is cleared by centrifugation at 18,000g for 20 min at 4 . A Vivaspin D Maxi H DEAE centrifuge column (Sartorius) is equilibrated by two washes with 10 ml of 0.5 M K-MES, pH 6.1, and one wash with 10 ml of 25 mM K-MES, pH 6.1 at 2,000g. The supernatant resulting from centrifugation of the isopropanol treatment is applied to the Vivaspin column followed by two washes of the column with 10 ml 25 mM potassium-MES containing 0.3 M LiCl. ACP is eluted from the Vivaspin column with 10 ml of 25-mM K-MES containing 0.5 M LiCl. LiCl is preferred over NaCl as the latter results in the formation of sodium adducts of ACP which may interfere with downstream analyses
418
John E. Cronan and Jacob Thomas
such as mass spectrometry. ACP is precipitated from the eluate by the addition of TCA to a concentration of 5% together with sodium deoxycholate to 0.02% as a coprecipitant (Bensadoun and Weinstein, 1976) followed by incubation at 4 for 30 min. This suspension is centrifuged at 18,000g for 30 min and ACP is resuspended in 1 ml 0.5 M Tris-HCl, pH 8.0. The buffer containing the concentrated protein is replaced by dialysis against 25 mM K-MES, pH 6.1 containing 1 mM DTT and visualized by conformationally sensitive gel electrophoresis (see below) followed by staining with Coomassie Brilliant Blue 250. A 500-ml culture gives about 2 mg of pure ACP (the poorer medium used in preparation of tritium-labeled ACP results in about half this yield).
10.4. Apo-ACP Apo-ACP is often required in the study of 40 -PP transferases or as a substrate for the preparation of acyl-ACP thioesters using a 40 -PP transferase. In this case, the strain DK574 is transformed with the plasmid pJT94 expressing the AcpH ACP hydrolyase AcpH under tac control. Culture of the expression strain and coexpression of ACP and AcpH are carried out as described above. When expression is complete, cells are lysed by sonication or passage through a French pressure cell in 5 ml of AcpH buffer: 50 mM Tris-HCl pH 8.8, 25 mM MgCl2, 1 mM DTT, 0.2 mM MnCl2, and incubated for 4 h at 37 . The purification follows that of holo-ACP.
10.5. Synthesis of Acyl-ACP substrates It is often necessary to synthesize acyl-ACP thioesters as substrates for fatty acid synthesis enzymes. Acyl ACP thioesters may be enzymatically synthesized by three complementary methods. The first utilizes E. coli acyl ACP synthetase (Aas) to form an acyl ACP thioester using holo-ACP and free fatty acid as substrates. The acyl ACP synthetase of E. coli (Ray and Cronan, 1976) is a membrane protein later discovered to have two active sites, an Aas active site and 2-acylglycerophosphoethanolamine acyltransferase active site ( Jackowski et al., 1994). The overall reaction salvages lysophospholipids formed during lipoprotein synthesis by acylation ( Jackowski et al., 1994). The Aas activity of the protein has been extensively used for making acylACPs (Rock et al., 1981b; Shanklin, 2000). More recently, the gene encoding acyl ACP synthetase from Vibrio harveyi was identified and the protein (AasS) expressed and purified ( Jiang et al., 2006). AasS is a soluble cytoplasmic enzyme readily purified in hexahistidine-tagged form and so presents another attractive choice for synthesis of acyl-ACP thioesters. A typical reaction mixture consists of 20 mM ACP, 200 mM fatty acid and 170 nM AasS in a buffer containing 100 mM Tris-HCl (pH 7.8), 10 mM MgCl2, 1 mM TCEP, and 10 mM ATP in a reaction volume of 1 ml.
Bacterial Fatty Acid and Polyketide Synthesis
419
The reaction is allowed to proceed for 4 h at 37 and stopped by addition of two volumes of acetone and the proteins allowed to precipitate at –20 overnight. The precipitate is centrifuged at 18,000g for 20 min followed by two washes with three volumes of acetone. The pellet is air dried and resuspended in 20 mM Tris-HCl (pH 7.4) containing 1 mM Tris [2-carboxyethyl] phosphine (TCEP). For most purposes the acetone precipitation product will suffice, although it maybe further purified by chromatography on octyl-sepharose, if the acyl chain is C8 or longer (Rock et al., 1981b). It should be noted that the preferred substrates for AasS are saturated fatty acids of 5 to 16 carbon-atom–chain length (Shen et al., 1992b). For preparation of unsaturated acyl-ACPs E. coli Aas may be required. It should also be noted that AasS is active on only a subset of bacterial ACPs ( Jiang et al., 2006) whereas E. coli Aas has a broader specificity (Shanklin, 2000; Sharma et al., 2005). A second method for acyl-ACP synthesis is the use of a phosphopantetheinyl transferase such as the Sfp of Bacillus subtilis to transfer an acyl-phosphopantetheine group from acyl coenzyme A to apo ACP as discussed in Chapter 10 of volume 458, although the use of CoA thioesters makes this an expensive synthetic route and many acyl-CoAs are not commercially available. The third method is specific chemical acylation of the thiol of the ACP prosthetic group (Cronan and Klages, 1981). In the presence of high concentrations of imidazole at pH 6.5, N-acylimidazoles specifically acylate only the prosthetic group thiol; there is no acylation of the other nucleophilic groups of the protein and the reactions are often quantitative (Cronan and Klages, 1981; Roujeinikova et al., 2002a; Sharma et al., 2005). N-acylimidazoles are readily synthesized and can be used without purification. There, also, is a fourth synthetic method that is very specialized, but that fulfills a shortcoming of the other methods. Synthesis of 3-ketothioesters of ACP is problematical due to the instability of these species. As noted above M. tuberculosis FabH uses saturated acyl-CoAs of chain length C8–C12 as primers in the condensation reaction with malonyl-ACP to give 3-ketoacyl-ACPs two carbon atoms longer than the primer (Choi et al., 2000b). Therefore, M. tuberculosis FabH together with the appropriate acyl-CoA can be added to the reconstructed fatty acid synthesis system in place of the generic FabH and will generate the needed 3-ketoacyl-ACP in situ (Marrakchi et al., 2002). It should be noted that due to the lack of tryptophan and the paucity of other aromatic residues in E. coli ACP (and most other ACPs) standard protein colorimetric assays often seriously underestimate the concentrations of ACP and acyl-ACP solutions. For E. coli ACP a molar extinction coefficient of 1.8 103 at 278 nm has been determined based on amino acid analysis (Rock and Cronan, 1980) and a similar value is found in the older literature (Sauer et al., 1964). This value is accurate unless the ACP sample is grossly contaminated with nucleic acid (this is mainly tRNA that
420
John E. Cronan and Jacob Thomas
elutes from the DEAE matrix with ACP). Given overexpression of ACP this is not a problem, but when ACP was purified from wildtype cells (where the ratio of tRNA to ACP is much higher) this contamination was readily detected by inspection of the UV spectrum of the sample and the tRNA was readily removed by isoelectric point precipitation (Rock and Cronan, 1980). It should also be noted that Coomassie Blue staining of ACP also underestimates (by 5- to10-fold depending on the staining protocol) the amount of ACP present because of a lack of basic groups to bind the dye.
10.6. Purification of fatty acid synthetic enzymes Although each of the E. coli fatty acid synthetic enzymes has been purified from wildtype cells using classical chromatographic procedures, the enzymes are now almost invariably purified as fusion proteins carrying various purification tags, most often N-terminal hexahistidine tags (Heath and Rock, 1995; Hoang et al., 2002). Each of the E. coli and Pseudomonas aeruginosa fatty acid synthetic enzymes remains active with an N-terminal hexahistidine tag (although in most cases the activities of the tagged and native forms have not been compared directly). Similarly the fatty acid synthetic enzymes of a wide variety of organisms retain activity when hexahistidine tagged. Purification of soluble hexahistidine tagged proteins by metal chelate chromatography is routine in most laboratories and will not be described here. Although the tagging approach has also been successful with a wide variety of type II fatty acid synthetic enzymes, occasional problems have arisen. For example, a C-terminally hexahistidine tagged version of the Vibrio cholerae enoyl-ACP reductase, FabV, was several orders of magnitude less active that the native protein (Massengo-Tiasse and Cronan, 2008). In contrast the N-terminal hexahistidine tagged version was much more active than the C-terminally tagged version (although it was somewhat less active than the native protein in vivo). It should be noted that the nickel ions that bleed from the standard metal chelate chromatographic columns and the imidazole used for elution must be efficiently removed from the enzyme preparations. Niþþ can catalyze air oxidation of the thiol (usually DTT) added to insure reduction of ACP and enzyme cysteine residues. Oxidation results in inactive enzymes and inactivates ACP by formation of ACP disulfide-linked dimers. Imidazole can attack acyl thioesters to form acyl-imidazoles ( Jencks and Carriuolo, 1959).
10.7. Direct assays of fatty acid synthetic enzyme activities Although the acyl substrates of fatty acid synthesis are bound to ACP, some of the fatty acid synthetic enzymes show activity with acyl-CoA and acylN-acetylcysteamine substrates (Bloch, 1971; Heath et al., 2000; MassengoTiasse and Cronan, 2008). These latter substrates are generally less active
Bacterial Fatty Acid and Polyketide Synthesis
421
than the cognate ACP substrates and have lower VMAX and higher KM values consistent with their serving as model compounds. The simplest of the assays are determination of the 3-ketoacyl-ACP reductase (FabG) and enoyl-ACP reductase (FabI, FabL, FabV) activities because the progress of these reactions is readily monitored by oxidation of the reduced pyridine nucleotide substrate by spectrophotometry. Moreover, these enzymes are often active with commercially available acyl-CoA substrates (Choi et al., 2000b; Heath et al., 2000; Massengo-Tiasse and Cronan, 2008). Two of the enzymes, 3-ketoacyl-ACP synthase III (FabH) and malonylCoA:ACP transacylase (FabD) may be assayed by TCA precipitation assays (Alberts et al., 1974; Han et al., 1998). Short chain acyl-CoAs are soluble in TCA whereas acyl-ACPs are TCA insoluble. Hence, the conversion of a 14C-labeled acyl-CoA substrate to a 14C-labeled, ACP-bound acyl chain results in conversion of a TCA soluble compound to an insoluble compound. Therefore, a simple precipitation step followed by scintillation counting of the washed precipitates gives quantitative data. The 3-hydroxyacyl-ACP dehydratases (FabZ, FabA) may be assayed by hydration of the enoyl-thioester trans-2 double bond, the reversal of the physiological reaction. Loss of the characteristic adsorption of enoyl-thioesters at 263 nm can be followed spectrophotometrically (Bloch, 1971). This assay can be problematical using ACP thioesters and purified enzymes due to protein adsorption at this wavelength and CoA thioesters cannot be used since they absorb strongly at this wavelength. Moreover, assay of crude extracts is precluded by protein and nucleic acid absorption. For these reasons N-acetylcysteamine thioesters are the preferred substrates providing the enzyme will accept these model compounds. The reaction can also be run in the forward reaction by following the increase in absorption at 263 nm. The double-bond isomerization reactions catalyzed by FabA and FabM can likewise be followed by gain or loss of absorption at 263 nm (depending on the substrate used) since cis-3-acylthioesters do not absorb at this wavelength (Bloch, 1971; Marrakchi et al., 2002; Schwab et al., 1985). Determination of the long-chain 3-ketoacyl-ACP synthase (FabF, FabB) activity requires the most complicated of the assays since the enzymes generally require that both substrates (malonyl-ACP and the acyl-ACP) are ACP thioesters, which precludes TCA precipitation assays. The reaction uses malonyl-ACP labeled with 14C either at malonate carbon 2 of or at carbons 1 and 3 plus an unlabeled acyl-ACP. Following incubation with the long-chain 3-ketoacyl-ACP synthase the assay is stopped by addition of buffered sodium borohydride which cleaves the thioester bonds and reduces both the acyl thioester moiety and the newly introduced keto moiety to alcohol moieties (Edwards et al., 1997; Garwin et al., 1980b). The products are radioactive 1,3-acyl diols, a stable product that is readily extracted into toluene, a solvent compatible with direct scintillation counting (the product
422
John E. Cronan and Jacob Thomas
of malonyl-ACP reduction remains in the aqueous phase). It should be noted that both the 3-ketoacyl-ACP synthase and 3-hydroxyacyl-ACP dehydratase reactions can be followed spectrophotometrically using assays coupled to pyridine nucleotide conversion (oxidation or reduction, respectively) by 3-ketoacyl-ACP reductase (FabG) (Birge et al., 1967). However, this enzyme is not commercially available. We have chosen to give literature references on a range of bacteria rather than specific assay conditions since the assays used for the E. coli enzyme may not suffice for enzymes from other bacteria. For example, the FabH of Mycobacterium tuberculosis uses long-chain acyl-CoA substrates rather than acetyl-CoA (Choi et al., 2000b). Long chain acyl-CoAs are insoluble in TCA and thus the E. coli FabH TCA precipitation assay will not work. Instead, the appropriate assay would be the borohydride reduction assay used for FabF and FabB. A second example is the FabH proteins of Bacilli and Streptomyces where short branched-chain acyl-CoAs are used in place of acetyl-CoA (Heath et al., 2000; Li et al., 2005; Smirnova and Reynolds, 2001).
10.8. Reconstituted fatty acid synthesis systems Crude extracts of E. coli synthesize fatty acids when the extracts are supplemented with a thiol reducing agent, NADPH, malonyl-CoA, acetyl-CoA and ACP (Lennarz et al., 1962). An NADPH regenerating system is often included due to the potent NADH oxidase activity of membrane fragments in the crude extract (the pyridine nucleotide transhydrogenase present in the extracts interconverts NADPH and NADH). ACP is added to augment that of the extract and this is probably needed to compensate for the massive dilution relative to in vivo conditions resulting from extract preparation. If the malonyl-CoA is 14C labeled, the reaction can be followed by extraction of the synthesized fatty acids followed by scintillation counting (alternatively the acetyl-CoA can be labeled but incorporation is much less efficient). The reaction can also be followed by use of the conformationally sensitive gel electrophoresis system described below. If an extract deficient in the enzymatic step of interest is available, such extracts can be used to assay activity of an enzyme that catalyzes that step of fatty acid synthesis. Extracts deficient in specific enzymes can be obtained from a mutant strain lacking the enzyme to be assayed (Cronan et al., 1969; Gelmann and Cronan, 1972; Silbert and Vagelos, 1967). Another method is by treatment of the extract with an inhibitor that specifically and irreversibly inactivates the enzyme of interest (followed by removal of excess inhibitor before assay) (McGuire et al., 2001). In both cases the purified enzyme is then added to the deficient extract and its ability to restore fatty acid synthetic ability is measured. Similarly, if one has two mutant strains defective in fatty acid synthesis that have the same phenotype, the two extracts can be mixed. If the mutations are in the same gene (protein)
Bacterial Fatty Acid and Polyketide Synthesis
423
normal fatty acid synthesis will not be restored whereas if the strains are mutant in different genes, normal synthesis results. Such ‘‘extract complementation’’ assays were used to show that the E coli unsaturated fatty acid auxotrophs, fabA and fabB, had lesions in two different genes (Cronan et al., 1969) and demonstrated the enoyl-ACP reductase activities of FabV and FabK (Marrakchi et al., 2003; Massengo-Tiasse and Cronan, 2008). Another more flexible approach takes advantage of the ease with which the bacterial fatty acid synthesis proteins can be purified. In this approach (called ‘‘reconstructed fatty acid synthesis’’) each of the proteins is purified as the hexahistidine-tagged species and is then used to assemble a system that synthesizes fatty acids from 14C-labeled malonyl-CoA and acetyl-CoA using NADH and NADPH as cofactors (Heath and Rock, 1995, 1996). The products of the reaction have generally been assayed by the conformationally sensitive gel electrophoresis system described below although the solvent extraction used with extract complementation could also be used. Since the purity of each of component is readily tested by its omission, this system can be used to test functionality of any FAS candidate protein. A criticism of this approach is that in general equal masses of each enzyme were added which may not reflect the in vivo situation. However, this approach has subsequently been validated by mass spectrophotometric analysis of the levels of the fatty acid synthetic proteins in E. coli that indicate that the proteins (except ACP) are each present in a few thousands of molecules per cell (Lu et al., 2007). Since the subunit molecular weights of the E. coli fatty acid synthetic enzymes vary by only about twofold, use of equal masses of the enzymes in the reconstructed fatty acid synthesis system is not a great departure from the in vivo situation. Moreover, the chosen ratio of ACP to the synthetic enzymes also approximates the in vivo ratio. A similar reconstructed system was later assembled from the P. aeruginosa proteins (Hoang et al., 2002).
10.9. Resolution of ACP species by conformationally sensitive gel electrophoresis With the advent of facile synthesis of acyl-ACP species comparisons of the properties of E. coli ACP and long-chain acyl-ACPs showed that acyl-ACPs were more resistant to partial denaturation at elevated pH values (pH 9 to 9.5) than the nonacylated species (Rock and Cronan, 1979). The two protein species coeluted from size exclusion chromatography columns at neutral pH, whereas at pH 9.4 the nonacylated species eluted first. Since the two protein species had essentially the same mass and charge, the earlier elution indicated that the nonacylated species had a larger hydrodynamic radius and that the acyl group acted to stabilize ACP structure toward this pH-induced expansion. A greater degree of separation was obtained by polyacrylamide gel electrophoresis using the standard Tris-based buffer
424
John E. Cronan and Jacob Thomas
system generally used for SDS gels but with the SDS omitted (Cronan, 1982; Rock et al., 1981b). The pH of the separating gel in this system increases from pH 8.8 to about pH 9.5 during electrophoresis (Cronan, 1982), resulting in good resolution of acylated and nonacylated ACP species with the acylated species migrating more rapidly. Moreover, it was found that the acetyl-, butyryl-, hexanoyl-, and octanoyl-ACPs could be resolved with a direct relationship between electrophoretic mobility and acyl chain length (Cronan, 1982). During these investigations it was found that heating of the gel by electrical resistance increased resolution and when commercial temperature-controlled electrophoresis units became available, the system was standardized to 20% polyacrylamide gels run at 37 ( Jackowski and Rock, 1987). However, workers in the plant lipid field found that addition of various concentrations of urea to the gels markedly improved resolution of ACP species (Post-Beittenmiller et al., 1991), such that the separations could be done in a minigel format. Short chain acyl-ACP species were separated at low urea concentrations (0.5 to 1 M) whereas resolution of longer chain (C16–C18) species required higher urea concentrations (up to 5 M). Apo-, holo-, and acyl-ACP may be distinguished from each other by conformationally sensitive gel electrophoresis. This method takes advantage of the differential partial denaturation of ACP species under alkaline conditions in the presence of urea. ACP species carrying a hydrophobic acyl chain are more stable than holo-ACP which in turn is more stable than apoACP and ACP species acylated with hydrophilic acyl groups (e.g., malonylACP) (Rock et al., 1981a). In the gel systems commonly used to resolve ACP species, partially denaturing conditions are maintained by urea and alkaline pH and the mobility of a protein is inversely related to its hydrodynamic radius (all species of a given ACP have essentially the same net charge). Apo- and holo-ACP are best distinguished from each other by using a resolving gel composed of 20% acrylamide, 0.67% N, N0 -methylenebisacrylamide, 375 mM Tris-HCl (pH 8.8), 0.5 M urea, and a stacking gel of 5% acrylamide, 0.17% N, N0 -methylenebisacrylamide, 125 mM Tris-HCl, (pH 6.8). Both gels contain N, N, N0 , N0 -tetramethylethylenediamine, and polymerization is initiated by addition of ammonium persulfate to 0.04%. The minigels are loaded and the samples are subjected to electrophoresis at 120 V for 100 to 110 min in a running buffer containing 25 mM Tris-HCl and 0.19 M glycine. To resolve acyl-ACP thioesters, the concentration of urea is increased to 2.5 M and the gel is run at 120V for 120—150 min. The proteins is then visualized by staining the gel in a solution of 50% methanol, 10% acetic acid and 0.1% Coomassie Brilliant Blue R250 followed by destaining in a solution of 10% methanol and 10% acetic acid. If the protein samples are radioactive, the gel is dried and subjected to autoradiography or phosphorimaging. These gel systems have been very useful in analysis of fatty acid synthesis in vivo and in vitro and allow detection of each of the intermediates of the
Bacterial Fatty Acid and Polyketide Synthesis
425
early cycles of fatty acid synthesis. However, they must be augmented with other analytical techniques such at mass spectroscopy. This is because some intermediates are labile (such as 3-ketoacyl-ACPs) and others are difficult to resolve (trans-2-enoic and saturated species of the same chain length). Moreover, the presence of hydrophilic groups such as a 3-hydroxy moiety can be offset by greater hydrophobicity (increased chain length), which can complicate interpretation. The x-ray (Roujeinikova et al., 2002b, 2007) and NMR (Kim and Prestegard, 1989, 1990) structures of ACP provide some rationale for the observed properties of ACP and its acyl thioesters. These data confirmed the original prediction that ACP is structured into a four helix bundle although certain of the helixes are plastic and the protein probably exists in at least two conformations. The acyl chain stabilizes the structure mainly through hydrophobic interactions between the hydrocarbon portion of the acyl chain and residues of the hydrophobic cavity primarily formed by the last three helices of the protein. The prosthetic group also interacts with residues other than that to which it is attached accounting for the separation of the holo and apo forms of ACP. It must be noted that the system described above is for E. coli ACP and its acyl species. Despite the strong sequence conservation, bacterial ACPs differ markedly in their electrophoretic mobilities on these gels (de la Roche et al., 1997; De Lay and Cronan, 2007) and the urea concentrations must be optimized for each ACP. For example separation of the acyl species of the ACP-I and ACP-II of spinach (62% identity) required markedly different urea concentrations (Post-Beittenmiller et al., 1991). It should be noted that in the absence of urea, this gel system resolves ACP from the other proteins present in crude extracts of E. coli (Flugel et al., 2000). This is because other proteins are either too large to enter the gel or lack sufficient negative charge to migrate as rapidly as ACP (or both).
10.10. ACPs behave abnormally in SDS-polyacrylamide gel electrophoresis and gel filtration ACPs generally migrate abnormally in standard SDS-polyacrylamide gel electrophoresis systems because the highly charged nature of the protein results in aberrantly low SDS binding. Indeed, both E. coli and V. harveyi ACPs migrate as 20- to 22-kDa proteins despite having molecular weights of 8.6 kDa (de la Roche et al., 1997; Rock and Cronan, 1979). Long chain acyl-ACPs migrate more rapidly than ACP due to increased binding of SDS to the acyl group which imparts greater negative charge (Rock and Cronan, 1979). However, the thioester linkage of acyl-ACPs can be hydrolyzed during SDS gel electrophoresis. E. coli ACP migrates on gel filtration columns as though a protein of 19 to 20 kDa (Rock and Cronan, 1979). This is not due to dimer formation, but rather to the atypically large hydrodynamic radius of this very flexible and dynamic protein.
426
John E. Cronan and Jacob Thomas
REFERENCES Alberts, A. A., Majerus, P. W., and Vagelos, P. R. (1974). Malonyl-CoA acyl carrier protein transacylase. Methods Enzymol. 14, 53–56. Alberts, A. W., Bell, R. M., and Vagelos, P. R. (1972). Acyl carrier protein. XV. Studies of b-ketoacyl–acyl carrier protein synthetase. J. Biol. Chem. 247, 3190–3198. Altabe, S., Lopez, P., and de Mendoza, D. (2007). Isolation and characterization of unsaturated fatty acid auxotrophs of Streptococcus pneumoniae and Streptococcus mutans. J. Bacteriol. 189, 8139–8144. Arthur, C. J., Szafranska, A., Evans, S. E., Findlow, S. C., Burston, S. G., Owen, P., ClarkLewis, I., Simpson, T. J., Crosby, J., and Crump, M. P. (2005). Self-malonylation is an intrinsic property of a chemically synthesized type II polyketide synthase acyl carrier protein. Biochemistry 44, 15414–15421. Arthur, C. J., Szafranska, A. E., Long, J., Mills, J., Cox, R. J., Findlow, S. C., Simpson, T. J., Crump, M. P., and Crosby, J. (2006). The malonyl transferase activity of type II polyketide synthase acyl carrier proteins. Chem. Biol. 13, 587–596. Bensadoun, A., and Weinstein, D. (1976). Assay of proteins in the presence of interfering materials. Anal. Biochem. 70, 241–250. Bergler, H., Fuchsbichler, S., Hogenauer, G., and Turnowsky, F. (1996). The enoyl[acyl-carrier-protein] reductase (FabI) of Escherichia coli, which catalyzes a key regulatory step in fatty acid biosynthesis, accepts NADH and NADPH as cofactors and is inhibited by palmitoyl-CoA. Eur. J. Biochem. 242, 689–694. Bergler, H., Wallner, P., Ebeling, A., Leitinger, B., Fuchsbichler, S., Aschauer, H., Kollenz, G., Hogenauer, G., and Turnowsky, F. (1994). Protein EnvM is the NADHdependent enoyl-ACP reductase (FabI) of Escherichia coli. J. Biol. Chem. 269, 5493–5496. Birge, C. H., Silbert, D. F., and Vagelos, P. R. (1967). A b-hydroxydecanoyl-ACP dehydrase specific for saturated fatty acid biosynthesis in E. coli. Biochem. Biophys. Res. Commun. 29, 808–814. Bloch, K. (1971). b-hydroxydecanoyl thioester dehydrase. In ‘‘The Enzymes.’’ (P. D. Boyer, ed.), pp. 441–464. Academic Press, New York. Choi, K. H., Heath, R. J., and Rock, C. O. (2000a). b-ketoacyl–acyl carrier protein synthase III (FabH) is a determining factor in branched-chain fatty acid biosynthesis. J. Bacteriol. 182, 365–370. Choi, K. H., Kremer, L., Besra, G. S., and Rock, C. O. (2000b). Identification and substrate specificity of b-ketoacyl (acyl carrier protein) synthase III (mtFabH) from Mycobacterium tuberculosis. J. Biol. Chem. 275, 28201–28207. Clark, D. P., DeMendoza, D., Polacco, M. L., and Cronan, J. E. (1983). b-Hydroxydecanoyl thio ester dehydrase does not catalyze a rate-limiting step in Escherichia coli unsaturated fatty acid synthesis. Biochemistry 22, 5897–5902. Cox, R. J., Crosby, J., Daltrop, O., Glod, F., Jarzabek, M. E., Nicholson, T. P., Reed, M., Simpson, T. J., Smith, L. H., Soulas, F., Szafranska, A. E., and Westcott, J. (2002). Streptomyces coelicolor phosphopantetheinyl transferase: A promiscuous activator of polyketide and fatty acid synthase acyl carrier proteins. J. Chem. Soc., Perkin Trans 1, 1644–1649. Cronan, J. E. (2006a). A bacterium that has three pathways to regulate membrane lipid fluidity. Mol. Microbiol. 60, 256–259. Cronan, J. E. (2006b). Avant garde fatty acid synthesis by trypanosomes. Cell 126, 641–643. Cronan, J. E. (2006c). Remarkable structural variation within fatty acid megasynthases. Nat. Chem. Biol. 2, 232–234. Cronan, J. E., Jr. (1982). Molecular properties of short chain acyl thioesters of acyl carrier protein. J. Biol. Chem. 257, 5013–5017.
Bacterial Fatty Acid and Polyketide Synthesis
427
Cronan, J. E., Jr. (2002). Phospholipid modifications in bacteria. Curr. Opin. Microbiol. 5, 202–205. Cronan, J. E., Jr. (2004). The structure of mammalian fatty acid synthase turned back to front. Chem. Biol. 11, 1601–1602. Cronan, J. E., Birge, C. H., and Vagelos, P. R. (1969). Evidence for two genes specifically involved in unsaturated fatty acid biosynthesis in Escherichia coli. J. Bacteriol. 100, 601–604. Cronan, J. E., and Gelmann, E. P. (1973). An estimate of the minimum amount of unsaturated fatty acid required for growth of Escherichia coli. J. Biol. Chem. 248, 1188–1195. Cronan, J. E., and Klages, A. L. (1981). Chemical synthesis of acyl thioesters of acyl carrier protein with native structure. Proc. Natl. Acad. Sci. USA 78, 5440–5444. Cronan, J. E., Li, W. B., Coleman, R., Narasimhan, M., de Mendoza, D., and Schwab, J. M. (1988). Derived amino acid sequence and identification of active site residues of Escherichia coli b-hydroxydecanoyl thioester dehydrase. J. Biol. Chem. 263, 4641–4646. Cronan, J. E., and Waldrop, G. L. (2002). Multi-subunit acetyl-CoA carboxylases. Prog. Lipid Res. 41, 407–435. Cropp, T. A., Smogowicz, A. A., Hafner, E. W., Denoya, C. D., McArthur, H. A., and Reynolds, K. A. (2000). Fatty-acid biosynthesis in a branched-chain alpha-keto acid dehydrogenase mutant of Streptomyces avermitilis. Can. J. Microbiol. 46, 506–514. D’Agnolo, G., Rosenfeld, I. S., and Vagelos, P. R. (1975a). Multiple forms of b-ketoacyl– acyl carrier protein synthetase in Escherichia coli. J. Biol. Chem. 250, 5289–5294. D’Agnolo, G., Rosenfeld, I. S., and Vagelos, P. R. (1975b). b-Ketoacyl–acyl carrier protein synthetase. Characterization of the acyl-enzyme intermediate. J. Biol. Chem. 250, 5283–5288. de la Roche, M. A., Shen, Z., and Byers, D. M. (1997). Hydrodynamic properties of Vibrio harveyi acyl carrier protein and its fatty-acylated derivatives. Arch. Biochem. Biophys. 344, 159–164. De Lay, N. R., and Cronan, J. E. (2006). A genome rearrangement has orphaned the Escherichia coli K-12 AcpT phosphopantetheinyl transferase from its cognate Escherichia coli O157:H7 substrates. Mol. Microbiol. 61, 232–242. De Lay, N. R., and Cronan, J. E. (2007). In vivo functional analyses of the type II acyl carrier proteins of fatty acid biosynthesis. J. Biol. Chem. 282, 20319–20328. de Mendoza, D., Klages Ulrich, A., and Cronan, J. E., Jr. (1983). Thermal regulation of membrane fluidity in Escherichia coli. Effects of overproduction of b-ketoacyl–acyl carrier protein synthase I. J. Biol. Chem. 258, 2098–2101. Edwards, P., Nelsen, J. S., Metz, J. G., and Dehesh, K. (1997). Cloning of the fabF gene in an expression vector and in vitro characterization of recombinant fabF and fabB encoded enzymes from Escherichia coli. FEBS Lett. 402, 62–66. Finking, R., Solsbacher, J., Konz, D., Schobert, M., Schafer, A., Jahn, D., and Marahiel, M. A. (2002). Characterization of a new type of phosphopantetheinyl transferase for fatty acid and siderophore synthesis in Pseudomonas aeruginosa. J. Biol. Chem. 277, 50293–50302. Fischl, A. S., and Kennedy, E. P. (1990). Isolation and properties of acyl carrier protein phosphodiesterase of Escherichia coli. J. Bacteriol. 172, 5445–5449. Florova, G., Kazanina, G., and Reynolds, K. A. (2002). Enzymes involved in fatty acid and polyketide biosynthesis in Streptomyces glaucescens: Role of FabH and FabD and their acyl carrier protein specificity. Biochemistry 41, 10462–10471. Flugel, R. S., Hwangbo, Y., Lambalot, R. H., Cronan, J. E., Jr., and Walsh, C. T. (2000). Holo-(acyl carrier protein) synthase and phosphopantetheinyl transfer in Escherichia coli. J. Biol. Chem. 275, 959–968.
428
John E. Cronan and Jacob Thomas
Garwin, J. L., Klages, A. L., and Cronan, J. E., Jr. (1980a). b-ketoacyl–acyl carrier protein synthase II of Escherichia coli. Evidence for function in the thermal regulation of fatty acid synthesis. J. Biol. Chem. 255, 3263–3265. Garwin, J. L., Klages, A. L., and Cronan, J. E., Jr. (1980b). Structural, enzymatic, and genetic studies of b-ketoacyl–acyl carrier protein synthases I and II of Escherichia coli. J. Biol. Chem. 255, 11949–11956. Gelmann, E. P., and Cronan, J. E., Jr. (1972). Mutant of Escherichia coli deficient in the synthesis of cis-vaccenic acid. J. Bacteriol. 112, 381–387. Gokhale, R. S., Saxena, P., Chopra, T., and Mohanty, D. (2007). Versatile polyketide enzymatic machinery for the biosynthesis of complex mycobacterial lipids. Nat. Prod. Rep. 24, 267–277. Grana, D., Gardella, T., and Susskind, M. M. (1988). The effects of mutations in the ant promoter of phage P22 depend on context. Genetics 120, 319–327. Grogan, D. W., and Cronan, J. E., Jr. (1997). Cyclopropane ring formation in membrane lipids of bacteria. Microbiol. Mol. Biol. Rev. 61, 429–441. Guerra, D. J., and Browse, J. A. (1990). Escherichia coli b-hydroxydecanoyl thioester dehydrase reacts with native C10 acyl–acyl-carrier proteins of plant and bacterial origin. Arch. Biochem. Biophys. 280, 336–345. Han, L., Lobo, S., and Reynolds, K. A. (1998). Characterization of b-ketoacyl–acyl carrier protein synthase III from Streptomyces glaucescens and its role in initiation of fatty acid biosynthesis. J. Bacteriol. 180, 4481–4486. Heath, R. J., and Rock, C. O. (1995). Enoyl-acyl carrier protein reductase ( fabI ). plays a determinant role in completing cycles of fatty acid elongation in Escherichia coli. J. Biol. Chem. 270, 26538–26542. Heath, R. J., and Rock, C. O. (1996). Roles of the FabA and FabZ b-hydroxyacyl–acyl carrier protein dehydratases in Escherichia coli fatty acid biosynthesis. J. Biol. Chem. 271, 27795–27801. Heath, R. J., and Rock, C. O. (2002). The Claisen condensation in biology. Nat. Prod. Rep. 19, 581–596. Heath, R. J., Rubin, J. R., Holland, D. R., Zhang, E., Snow, M. E., and Rock, C. O. (1999). Mechanism of triclosan inhibition of bacterial fatty acid synthesis. J. Biol. Chem. 274, 11110–11114. Heath, R. J., Su, N., Murphy, C. K., and Rock, C. O. (2000). The enoyl-[acyl-carrierprotein] reductases FabI and FabL from Bacillus subtilis. J. Biol. Chem. 275, 40128–40133. Hitchman, T. S., Crosby, J., Byrom, K. J., Cox, R. J., and Simpson, T. J. (1998). Catalytic self-acylation of type II polyketide synthase acyl carrier proteins. Chem. BiolChem. Biol. 5, 35–47. Hoang, T. T., Sullivan, S. A., Cusick, J. K., and Schweizer, H. P. (2002). b-ketoacyl acyl carrier protein reductase (FabG) activity of the fatty acid biosynthetic pathway is a determining factor of 3-oxo-homoserine lactone acyl chain lengths. Microbiology 148, 3849–3856. Jackowski, S., Jackson, P. D., and Rock, C. O. (1994). Sequence and function of the aas gene in Escherichia coli. J. Biol. Chem. 269, 2921–2928. Jackowski, S., and Rock, C. O. (1981). Regulation of coenzyme A biosynthesis. J. Bacteriol. 148, 926–932. Jackowski, S., and Rock, C. O. (1983). Ratio of active to inactive forms of acyl carrier protein in Escherichia coli. J. Biol. Chem. 258, 15186–15191. Jackowski, S., and Rock, C. O. (1987). Acetoacetyl-acyl carrier protein synthase, a potential regulator of fatty acid biosynthesis in bacteria. J. Biol. Chem. 262, 7927–7931. Jackowski, S., Zhang, Y. M., Price, A. C., White, S. W., and Rock, C. O. (2002). A missense mutation in the fabB (b-ketoacyl–acyl carrier protein synthase I) gene confers thiolactomycin resistance to Escherichia coli. Antimicrob. Agents Chemother. 46, 1246–1252.
Bacterial Fatty Acid and Polyketide Synthesis
429
Jencks, W. P., and Carriuolo, J. (1959). Imidazole catalysis III. General base catalysis and the reactions of acetyl imidazole with thiols and amines. J. Biol. Chem. 234, 1280–1285. Jiang, Y., Chan, C. H., and Cronan, J. E. (2006). The soluble acyl–acyl carrier protein synthetase of Vibrio harveyi B392 is a member of the medium chain acyl-CoA synthetase family. Biochemistry 45, 10008–10019. Kauppinen, S., Siggaard-Anderson, M., and van Wettstein-Knowles, P. (1988). b-KetoacylACP synthase I of Escherichia coli: Nucleotide sequence of the fabB gene and identification of the cerulenin binding residue. Carlsberg Res. Commun. 53, 357–370. Keating, D. H., Carey, M. R., and Cronan, J. E., Jr. (1995). The unmodified (apo) form of Escherichia coli acyl carrier protein is a potent inhibitor of cell growth. J. Biol. Chem. 270, 22229–22235. Khosla, C., Ebert-Khosla, S., and Hopwood, D. A. (1992). Targeted gene replacements in a Streptomyces polyketide synthase gene cluster: Role for the acyl carrier protein. Mol. Microbiol. 6, 3237–3249. Kim, Y., and Prestegard, J. H. (1989). A dynamic model for the structure of acyl carrier protein in solution. Biochemistry 28, 8792–8797. Kim, Y., and Prestegard, J. H. (1990). Refinement of the NMR structures for acyl carrier protein with scalar coupling data. Proteins 8, 377–385. Kimber, M. S., Martin, F., Lu, Y., Houston, S., Vedadi, M., Dharamsi, A., Fiebig, K. M., Schmid, M., and Rock, C. O. (2004). The structure of (3R)-hydroxyacyl–acyl carrier protein dehydratase (FabZ) from Pseudomonas aeruginosa. J. Biol. Chem. 279, 52593–52602. Kruh, N. A., Borgaro, J. G., Ruzsicska, B. P., Xu, H., and Tonge, P. J. (2008). A novel interaction linking the FAS-II and Pdim biosynthetic pathways. J. Biol. Chem. 283, 31719–31725. Lai, C. Y., and Cronan, J. E. (2004). Isolation and characterization of b-ketoacyl–acyl carrier protein reductase ( fabG ) mutants of Escherichia coli and Salmonella enterica serovar Typhimurium. J. Bacteriol. 186, 1869–1878. Lambalot, R. H., Gehring, A. M., Flugel, R. S., Zuber, P., LaCelle, M., Marahiel, M. A., Reid, R., Khosla, C., and Walsh, C. T. (1996). A new enzyme superfamily— the phosphopantetheinyl transferases. Chem. Biol. 3, 923–936. Lambalot, R. H., and Walsh, C. T. (1997). Holo-[acyl-carrier-protein] synthase of Escherichia coli. Methods Enzymol. 279, 254–262. Leesong, M., Henderson, B. S., Gillig, J. R., Schwab, J. M., and Smith, J. L. (1996). Structure of a dehydratase-isomerase from the bacterial pathway for biosynthesis of unsaturated fatty acids: Two catalytic activities in one active site. Structure 4, 253–264. Lennarz, W. J., Light, R. J., and Bloch, K. (1962). A fatty acid synthetase from E. coli. Proc. Natl. Acad. Sci. USA 48, 840–846. Li, Y., Florova, G., and Reynolds, K. A. (2005). Alteration of the fatty acid profile of Streptomyces coelicolor by replacement of the initiation enzyme 3-ketoacyl acyl carrier protein synthase III (FabH). J. Bacteriol. 187, 3795–3799. Lu, P., Vogel, C., Wang, R., Yao, X., and Marcotte, E. M. (2007). Absolute protein expression profiling estimates the relative contributions of transcriptional and translational regulation. Nat. Biotechnol. 25, 117–124. Lu, Y. J., White, S. W., and Rock, C. O. (2005). Domain swapping between Enterococcus faecalis FabN and FabZ proteins localizes the structural determinants for isomerase activity. J. Biol. Chem. 280, 30342–30348. Lu, Y. W., San Roman, A. K., and Gehring, A. M. (2008). Role of phosphopantetheinyl transferase genes in antibiotic production by Streptomyces coelicolor. J. Bacteriol. 190, 6903–6908. Magnuson, K., Carey, M. R., and Cronan, J. E., Jr. (1995). The putative fabJ gene of Escherichia coli fatty acid synthesis is the fabF gene. J. Bacteriol. 177, 3593–3595.
430
John E. Cronan and Jacob Thomas
Magnuson, K., Oh, W., Larson, T. J., and Cronan, J. E., Jr. (1992). Cloning and nucleotide sequence of the fabD gene encoding malonyl coenzyme A-acyl carrier protein transacylase of Escherichia coli. FEBS Lett. 299, 262–266. Mansilla, M. C., and de Mendoza, D. (2005). The Bacillus subtilis desaturase: A model to understand phospholipid modification and temperature sensing. Arch. Microbiol. 183, 229–235. Marrakchi, H., Choi, K. H., and Rock, C. O. (2002). A new mechanism for anaerobic unsaturated fatty acid formation in Streptococcus pneumoniae. J. Biol. Chem. 277, 44809–44816. Marrakchi, H., Dewolf, W. E., Jr., Quinn, C., West, J., Polizzi, B. J., So, C. Y., Holmes, D. J., Reed, S. L., Heath, R. J., Payne, D. J., Rock, C. O., and Wallis, N. G. (2003). Characterization of Streptococcus pneumoniae enoyl-(acyl-carrier protein) reductase (FabK). Biochem. J. 370, 1055–1062. Massengo-Tiasse, R. P., and Cronan, J. E. (2008). Vibrio cholerae FabV defines a new class of enoyl-acyl carrier protein reductase. J. Biol. Chem. 283, 1308–1316. McAllister, K. A., Peery, R. B., and Zhao, G. (2006). Acyl carrier protein synthases from Gram-negative, Gram-positive, and atypical bacterial species: Biochemical and structural properties and physiological implications. J. Bacteriol. 188, 4737–4748. McGuire, K. A., Siggaard-Andersen, M., Bangera, M. G., Olsen, J. G., and von WettsteinKnowles, P. (2001). b-Ketoacyl-[acyl carrier protein] synthase I of Escherichia coli: Aspects of the condensation mechanism revealed by analyses of mutations in the active site pocket. Biochemistry 40, 9836–9845. McMurry, L. M., Oethinger, M., and Levy, S. B. (1998). Triclosan targets lipid synthesis. Nature 394, 531–532. Mercer, A. C., and Burkart, M. D. (2007). The ubiquitous carrier protein—a window to metabolite biosynthesis. Nat. Prod. Rep. 24, 750–773. Metz, J. G., Roessler, P., Facciotti, D., Levering, C., Dittrich, F., Lassner, M., Valentine, R., Lardizabal, K., Domergue, F., Yamada, A., Yazawa, K., Knauf, V., et al. (2001). Production of polyunsaturated fatty acids by polyketide synthases in both prokaryotes and eukaryotes. Science 293, 290–293. Mizugaki, M., Swindell, A. C., and Wakil, S. J. (1968). Intermediate- and long-chain b-hydroxyacyl-ACP dehydrases from E. coli fatty acid synthetase. Biochem. Biophys. Res. Commun. 33, 520–527. Mofid, M. R., Finking, R., and Marahiel, M. A. (2002). Recognition of hybrid peptidyl carrier proteins/acyl carrier proteins in nonribosomal peptide synthetase modules by the 40 -phosphopantetheinyl transferases AcpS and Sfp. J. Biol. Chem. 277, 17023–17031. Mohan, S., Kelly, T. M., Eveland, S. S., Raetz, C. R., and Anderson, M. S. (1994). An Escherichia coli gene ( fabZ ) encoding (3R)-hydroxymyristoyl acyl carrier protein dehydrase. Relation to fabA and suppression of mutations in lipid A biosynthesis. J. Biol. Chem. 269, 32896–32903. Mootz, H. D., Finking, R., and Marahiel, M. A. (2001). 40 -Phosphopantetheine transfer in primary and secondary metabolism of Bacillus subtilis. J. Biol. Chem. 276, 37289–37298. Nakanishi, M., Yatome, C., Ishida, N., and Kitade, Y. (2001). Putative ACP phosphodiesterase gene (acpD). encodes an azoreductase. J. Biol. Chem. 276, 46394–46399. Oefner, C., Schulz, H., D’Arcy, A., and Dale, G. E. (2006). Mapping the active site of Escherichia coli malonyl-CoA-acyl carrier protein transacylase (FabD) by protein crystallography. Acta Crystallogr. D Biol. Crystallogr. 62, 613–618. Phillips, G. J., Park, S. K., and Huber, D. (2000). High copy number plasmids compatible with commonly used cloning vectors. Biotechniques 28, 400–402, 404, 406 passim. Post-Beittenmiller, D., Jaworski, J. G., and Ohlrogge, J. B. (1991). In vivo pools of free and acylated acyl carrier proteins in spinach. Evidence for sites of regulation of fatty acid biosynthesis. J. Biol. Chem. 266, 1858–1865.
Bacterial Fatty Acid and Polyketide Synthesis
431
Prescott, D. J., and Vagelos, P. R. (1972). Acyl carrier protein. Adv. Enzymol. Relat. Areas Mol. Biol. 36, 269–311. Raetz, C. R., and Whitfield, C. (2002). Lipopolysaccharide endotoxins. Annu. Rev. Biochem. 71, 635–700. Rawlings, M. (1993). ‘‘Isolation and characterization of a gene and a genomic clone encoding acyl carrier protein from Escherichia coli.’’ University of Illinois, UrbanaChampaign. Rawlings, M., and Cronan, J. E., Jr. (1992). The gene encoding Escherichia coli acyl carrier protein lies within a cluster of fatty acid biosynthetic genes. J. Biol. Chem. 267, 5751–5754. Ray, T. K., and Cronan, J. E., Jr. (1976). Activation of long chain fatty acids with acyl carrier protein: Demonstration of a new enzyme, acyl–acyl carrier protein synthetase, in Escherichia coli. Proc. Natl. Acad. Sci. USA 73, 4374–4378. Revill, W. P., Bibb, M. J., and Hopwood, D. A. (1995). Purification of a malonyltransferase from Streptomyces coelicolor A3(2) and analysis of its genetic determinant. J. Bacteriol. 177, 3946–3952. Revill, W. P., Bibb, M. J., and Hopwood, D. A. (1996). Relationships between fatty acid and polyketide synthases from Streptomyces coelicolor A3(2): Characterization of the fatty acid synthase acyl carrier protein. J. Bacteriol. 178, 5660–5667. Rock, C. O., and Cronan, J. E. (1979). Re-evaluation of the solution structure of acyl carrier protein. J. Biol. Chem. 254, 9778–9785. Rock, C. O., and Cronan, J. E., Jr. (1980). Improved purification of acyl carrier protein. Anal. Biochem. 102, 362–364. Rock, C. O., and Cronan, J. E., Jr. (1981). Acyl carrier protein from Escherichia coli. Methods Enzymol. 71, 341–351. Rock, C. O., Cronan, J. E., Jr., and Armitage, I. M. (1981a). Molecular properties of acyl carrier protein derivatives. J. Biol. Chem. 256, 2669–2674. Rock, C. O., Garwin, J. L., and Cronan, J. E., Jr. (1981b). Preparative enzymatic synthesis of acyl–acyl carrier protein. Methods Enzymol. 72, 397–403. Roujeinikova, A., Baldock, C., Simon, W. J., Gilroy, J., Baker, P. J., Stuitje, A. R., Rice, D. W., Rafferty, J. B., and Slabas, A. R. (2002a). Crystallization and preliminary x-ray crystallographic studies on acyl-(acyl carrier protein) from Escherichia coli. Acta Crystallogr. D Biol. Crystallogr. 58, 330–332. Roujeinikova, A., Baldock, C., Simon, W. J., Gilroy, J., Baker, P. J., Stuitje, A. R., Rice, D. W., Slabas, A. R., and Rafferty, J. B. (2002b). X-ray crystallographic studies on butyryl-ACP reveal flexibility of the structure around a putative acyl chain binding site. Structure 10, 825–835. Roujeinikova, A., Simon, W. J., Gilroy, J., Rice, D. W., Rafferty, J. B., and Slabas, A. R. (2007). Structural studies of fatty acyl-(acyl carrier protein) thioesters reveal a hydrophobic binding cavity that can expand to fit longer substrates. J. Mol. Biol. 365, 135–145. Sauer, F., Pugh, E. L., Wakil, S. J., Delaney, R., and Hill, R. L. (1964). 2-Mercaptoethylamine and b-alanine as components of acyl carrier protein. Proc. Natl. Acad. Sci. USA 52, 1360–1366. Schwab, J., and Henderson, J. (1990). Enzyme-catalyzed allylic rearrangements. Chem. Rev. 90, 1203–1245. Schwab, J. M., Klassen, J. B., and Lin, D. C. (1985). b-Hydroxydecanoylthioester dehydrase: A rapid, convenient, and accurate product distribution assay. Anal. Biochem. 150, 121–124. Schweizer, E., and Hofmann, J. (2004). Microbial type I fatty acid synthases (FAS): Major players in a network of cellular FAS systems. Microbiol. Mol. Biol. Rev. 68, 501–517.
432
John E. Cronan and Jacob Thomas
Serre, L., Verbree, E. C., Dauter, Z., Stuitje, A. R., and Derewenda, Z. S. (1995). The Escherichia coli malonyl-CoA:acyl carrier protein transacylase at 1.5-A resolution. Crystal structure of a fatty acid synthase component. J. Biol. Chem. 270, 12961–12964. Shanklin, J. (2000). Overexpression and purification of the Escherichia coli inner membrane enzyme acyl–acyl carrier protein synthase in an active form. Protein Expr. Purif. 18, 355–360. Sharma, S. K., Modak, R., Sharma, S., Sharma, A. K., Sarma, S. P., Surolia, A., and Surolia, N. (2005). A novel approach for over-expression, characterization, and isotopic enrichment of a homogeneous species of acyl carrier protein from Plasmodium falciparum. Biochem. Biophys. Res. Commun. 330, 1019–1026. Shen, B., Summers, R. G., Gramajo, H., Bibb, M. J., and Hutchinson, C. R. (1992a). Purification and characterization of the acyl carrier protein of the Streptomyces glaucescens tetracenomycin C polyketide synthase. J. Bacteriol. 174, 3818–3821. Shen, Z., Fice, D., and Byers, D. M. (1992b). Preparation of fatty-acylated derivatives of acyl carrier protein using Vibrio harveyi acyl-ACP synthetase. Anal. Biochem. 204, 343–349. Siggaard-Andersen, M., Wissenbach, M., Chuck, J. A., Svendsen, I., Olsen, J. G., and von Wettstein-Knowles, P. (1994). The fabJ-encoded b-ketoacyl-[acyl carrier protein] synthase IV from Escherichia coli is sensitive to cerulenin and specific for short-chain substrates. Proc. Natl. Acad. Sci. USA 91, 11027–11031. Silbert, D. F., and Vagelos, P. R. (1967). Fatty acid mutant of E. coli lacking a b-hydroxydecanoyl thioester dehydrase. Proc. Natl. Acad. Sci. USA 58, 1579–1586. Smirnova, N., and Reynolds, K. A. (2001). Engineered fatty acid biosynthesis in Streptomyces by altered catalytic function of beta-ketoacyl–acyl carrier protein synthase III. J. Bacteriol. 183, 2335–2342. Smith, J. L., and Sherman, D. H. (2008). Biochemistry. An enzyme assembly line. Science 321, 1304–1305. Sullivan, J. T., Brown, S. D., Yocum, R. R., and Ronson, C. W. (2001). The bio operon on the acquired symbiosis island of Mesorhizobium sp. strain R7A includes a novel gene involved in pimeloyl-CoA synthesis. Microbiology 147, 1315–1322. Summers, R. G., Ali, A., Shen, B., Wessel, W. A., and Hutchinson, C. R. (1995). Malonylcoenzyme A:acyl carrier protein acyltransferase of Streptomyces glaucescens: A possible link between fatty acid and polyketide biosynthesis. Biochemistry 34, 9389–9402. Tauch, A., Kaiser, O., Hain, T., Goesmann, A., Weisshaar, B., Albersmeier, A., Bekel, T., Bischoff, N., Brune, I., Chakraborty, T., Kalinowski, J., Meyer, F., et al. (2005). Complete genome sequence and analysis of the multiresistant nosocomial pathogen Corynebacterium jeikeium K411, a lipid-requiring bacterium of the human skin flora. J. Bacteriol. 187, 4671–4682. Thomas, J., and Cronan, J. E. (2005). The enigmatic acyl carrier protein phosphodiesterase of Escherichia coli: Genetic and enzymological characterization. J. Biol. Chem. 280, 34675–34683. Thomas, J., Rigden, D. J., and Cronan, J. E. (2007). Acyl carrier protein phosphodiesterase (AcpH) of Escherichia coli is a non-canonical member of the HD phosphatase/phosphodiesterase family. Biochemistry 46, 129–136. Tsay, J. T., Oh, W., Larson, T. J., Jackowski, S., and Rock, C. O. (1992a). Isolation and characterization of the b-ketoacyl–acyl carrier protein synthase III gene ( fabH ) from Escherichia coli K-12. J. Biol. Chem. 267, 6807–6814. Tsay, J. T., Rock, C. O., and Jackowski, S. (1992b). Overproduction of b-ketoacyl–acyl carrier protein synthase I imparts thiolactomycin resistance to Escherichia coli K-12. J. Bacteriol. 174, 508–513. Turnowsky, F., Fuchs, K., Jeschek, C., and Hogenauer, G. (1989). envM genes of Salmonella typhimurium and Escherichia coli. J. Bacteriol. 171, 6555–6565.
Bacterial Fatty Acid and Polyketide Synthesis
433
Ulrich, A. K., de Mendoza, D., Garwin, J. L., and Cronan, J. E., Jr. (1983). Genetic and biochemical analyses of Escherichia coli mutants altered in the temperature-dependent regulation of membrane lipid composition. J. Bacteriol. 154, 221–230. Vagelos, P. R., and Larrabee, A. R. (1967). Acyl carrier protein. IX. Acyl carrier protein hydrolase. J. Biol. Chem. 242, 1776–1781. Verwoert, II, Verbree, E. C., van der Linden, K. H., Nijkamp, H. J., and Stuitje, A. R. (1992). Cloning, nucleotide sequence, and expression of the Escherichia coli fabD gene, encoding malonyl coenzyme A-acyl carrier protein transacylase. J. Bacteriol. 174, 2851–2857. Wallace, K. K., Zhao, B., McArthur, H. A., and Reynolds, K. A. (1995). In vivo analysis of straight-chain and branched-chain fatty acid biosynthesis in three actinomycetes. FEMS Microbiol. Lett. 131, 227–234. Wallis, J. G., Watts, J. L., and Browse, J. (2002). Polyunsaturated fatty acid synthesis: What will they think of next? Trends Biochem. Sci. 27, 467. Walsh, C. T., Gehring, A. M., Weinreb, P. H., Quadri, L. E., and Flugel, R. S. (1997). Post-translational modification of polyketide and nonribosomal peptide synthases. Curr. Opin. Chem. Biol. 1, 309–315. Wang, H., and Cronan, J. E. (2004). Functional replacement of the FabA and FabB proteins of Escherichia coli fatty acid synthesis by Enterococcus faecalis FabZ and FabF homologues. J. Biol. Chem. 279, 34489–34495. Weeks, G., and Wakil, S. J. (1968). Studies on the mechanism of fatty acid synthesis. 18. Preparation and general properties of the enoyl acyl carrier protein reductases from Escherichia coli. J. Biol. Chem. 243, 1180–1189. White, S. W., Zheng, J., Zhang, Y. M., and Rock, Y. M. (2005). The structural biology of type II fatty acid biosynthesis. Annu. Rev. Biochem. 74, 791–831. Worthington, A. S., Hur, G. H., Meier, J. L., Cheng, Q., Moore, B. S., and Burkart, M. D. (2008). Probing the compatibility of type II ketosynthase-carrier protein partners. ChemBioChem 9, 2096–2103. Yu, T. W., and Hopwood, D. A. (1995). Ectopic expression of the Streptomyces coelicolor whiE genes for polyketide spore pigment synthesis and their interaction with the act genes for actinorhodin biosynthesis. Microbiology 141, 2779–2791. Zhang, Y., and Cronan, J. E., Jr. (1996). Polar allele duplication for transcriptional analysis of consecutive essential genes: Application to a cluster of Escherichia coli fatty acid biosynthetic genes. J. Bacteriol. 178, 3614–3620. Zhang, Y., and Cronan, J. E., Jr. (1998). Transcriptional analysis of essential genes of the Escherichia coli fatty acid biosynthesis gene cluster by functional replacement with the analogous Salmonella typhimurium gene cluster. J. Bacteriol. 180, 3295–3303. Zhang, Y. M., Frank, M. W., Zhu, K., Mayasundari, A., and Rock, C. O. (2008). PqsD is responsible for the synthesis of DHQ, an extracellular metabolite produced by Pseudomonas aeruginosa. J. Biol. Chem. 283, 28788–28794. Zheng, C. J., Sohn, M. J., and Kim, W. G. (2006). Atromentin and leucomelone, the first inhibitors specific to enoyl-ACP reductase (FabK) of Streptococcus pneumoniae. J. Antibiot. (Tokyo) 59, 808–812. Zheng, C. J., Sohn, M. J., Lee, S., Hong, Y. S., Kwak, J. H., and Kim, W. G. (2007). Cephalochromin, a FabI-directed antibacterial of microbial origin. Biochem. Biophys. Res. Commun. 362, 1107–1112. Zhu, K., Choi, K. H., Schweizer, H. P., Rock, C. O., and Zhang, Y. M. (2006). Two aerobic pathways for the formation of unsaturated fatty acids in Pseudomonas aeruginosa. Mol. Microbiol. 60, 260–273.
C H A P T E R
E I G H T E E N
Aminocoumarins: Mutasynthesis, Chemoenzymatic Synthesis, and Metabolic Engineering Lutz Heide Contents 1. Introduction 2. Generation of Integrative Cosmids and Heterologous Expression of Novobiocin, Clorobiocin, and Coumermycin A1 Gene Clusters 3. Generation of Single and or Multiple Deletions in the Integrative Cosmids 4. Mutasynthetic Generation of New Aminocoumarin Antibiotics 5. In Vitro Amide Synthetase Assays for the Identification of Suitable Ring A Analogues for Mutasynthesis 6. Use of Various Amide Synthetase Genes for Expanding Mutasynthesis Product Range 7. Generation of Substrates for Chemoenzymatic Synthesis 8. Chemoenzymatic Synthesis of New Clorobiocin Analogues 9. Generation of New Aminocoumarin Antibiotics by Metabolic Engineering 10. Conclusion Acknowledgments References
438 441 442 444 446 447 447 449 451 453 453 454
Abstract The aminocoumarin antibiotics novobiocin, clorobiocin and coumermycin A1 are formed by different Streptomyces strains and are potent inhibitors of bacterial gyrase. Their biosynthetic gene clusters have been analyzed in detail by genetic and biochemical investigations. Heterologous expression of these gene clusters by site-specific integration into the genome of the fully sequenced host Streptomyces coelicolor A3(2) readily results in an accumulation of the antibiotics in yields similar to the wildtype strains.
Pharmazeutische Biologie, Pharmazeutisches Institut, Universita¨t Tu¨bingen, Tu¨bingen, Germany Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04618-7
#
2009 Elsevier Inc. All rights reserved.
437
438
Lutz Heide
In recent years, the aminocoumarins have developed into a model system for the generation of new antibiotics by genetic methods. Prior to heterologous expression in S. coelicolor, cosmids containing the complete biosynthetic clusters can be manipulated in Escherichia coli by l RED–mediated recombination, creating single or multiple gene replacements or gene deletions. Thereby, mutant strains are generated which are blocked in the synthesis of certain intermediates or in specific tailoring reactions. For instance, mutasynthetic experiments can subsequently be carried out to generate aminocoumarin antibiotics that contain modified acyl moieties attached to the aminocoumarin core, and chemoenzymatic synthesis can be employed for the acylation of the deoxysugar moiety of structural analogues of the aminocoumarin antibiotics. Metabolic engineering—the combination of gene deletions and foreign gene expression via replicative expression vectors—can be used to generate further structural variants of these antibiotics. These methods can be combined, allowing the generation of a wide variety of new compounds. This chapter may provide general pointers for the use of genetic methods in the generation of new antibiotics.
1. Introduction The aminocoumarin antibiotics novobiocin, clorobiocin and coumermycin A1 (Fig. 18.1), produced by different Streptomyces strains, are potent inhibitors of bacterial gyrase (Maxwell and Lawson, 2003). They show excellent antibacterial activity against Gram-positive pathogens, including methicillin-resistant strains. The first aminocoumarin to be discovered was novobiocin, which was licensed as an antibiotic for human therapy under the trade name AlbamycinÒ . Clorobiocin and coumermycin A1 are structurally similar to novobiocin and interact with gyrase in a similar fashion, but with significantly higher affinity than novobiocin. Notably, the latter two antibiotics are also potent inhibitors of topoisomerase IV, a second vital target in the bacterial cell. Simocyclinone D8 (Fig. 18.2) also contains the characteristic aminocoumarin moiety, but otherwise its structure is completely different from the aforementioned compounds. It is also a very potent gyrase inhibitor, but interestingly it acts on a completely different subunit of this heterotetrameric enzyme (Flatman et al., 2005). The structurally complex aminocoumarin antibiotic rubradirin (Kim et al., 2008) does not act on gyrase. No further aminocoumarin antibiotics have been discovered; therefore the chemical diversity of aminocoumarins found in nature appears to be limited. The total chemical synthesis of aminocoumarin antibiotics is possible, but only in a complicated multistep process (Ferroud et al., 1999). In recent years, however, the aminocoumarins have developed into a successful model system for expanding the chemical diversity of natural products by
439
Aminocoumarins
A
Ring C 6´ 6´´ CH3 7´´5´´ H3C O O 4´´ O 3´´
H3C
4´´´ 6´´´ HC 3
5´´´ N H
3´´´ C
OH 4´
5´
O 1´´ H
7´
O C
10 2 1
O 2´ O
8´ Cl
2´´ OH
H N 3´
3
6
Ring B
5
9
8
11 HC 3
4 OH H 3C
Ring A
O
O
O
CH
O
O
N
C
O
OH
O
Ring B
3
C
H
O
CH3
Clorobiocin
O
OH
Ring C
7
Ring A
OH
Novobiocin
NH2
2´´´
MePyC OH
Ring C
CH
HC 3
H3C
H
H 3C
O
O
O
CH
O
3
O
OH O
N
C
O
C
O C
O
3
H3C
MePyC
H N
O
O O
N H
Ring B
OH
C
O
Ring B
CH
O
O
3
Coumermycin A1
N
gyrB
nov E F
3
3
H
B
CH
CH
Ring C
MePyC
H
O
MePyDC
CH3
N
CH3
E F G
GY H I
H
J KL M
I JK L M
N
N 1
N 2
N 3
N 4
N 5
N 6
N 2
N 3
N 4
N 5
N 6
N 7
N 7
R
O P Q R S T U VW hal P
1kb
R
S T U V W Z gyrB
QR
R
parY
clo E
G Y H
I J K L M N1
OP
R R R R R 1 2a 2b 3 4
R 5
R 6
S T U V W gyrB
R
parY
R
cou
Ring A biosynthesis
Terminal pyrrole biosynthesis
3‘‘-O-acylation
Ring B biosynthesis
Central pyrrole biosynthesis
Resistance
Ring C biosynthesis
Amide and glycoside bond formation
Regulation
8‘-methylation/halogenation
4‘‘-O-methylation
Unknown
Figure 18.1 (A) Structures of aminocoumarin antibiotics.‘‘Ring A’’ ¼ 3-dimethylallyl4-hydroxybenzoyl moiety.‘‘Ring B’’ ¼ 3-amino-4,7-dihydroxy-coumarin moiety.‘‘Ring C’’ ¼ deoxysugar moiety. ‘‘MePyC’’ ¼ terminal 5-methyl-pyrrole-2-carboxyl moiety. ‘‘MePyDC’’ ¼central 3-methyl-pyrrole-2,4-dicarboxyl moiety. (B) Organization of the biosynthetic gene clusters for novobiocin (nov), clorobiocin (clo), and coumermycin A1 (cou). The sequences of these gene clusters are accessible in GenBank under accession numbers AF170880, AF329398, and AF235050, respectively.
O O HO
O OH
HO
O Cl
H O N C O
CH3
O O O
CH3
O
CH3 O
OH OH OH
Simocyclinone D8
Figure 18.2 Structure of simocyclinone D8.
OH
440
Lutz Heide
genetic methods. The basis for this development was the cloning of the biosynthetic gene clusters of these antibiotics (Fig. 18.1) and the detailed analysis of the function of the genes contained therein for catalysis of biosynthetic reactions, regulation and self-resistance. Figure 18.3 shows as
glucose-1HO phosphate HO
CH2OH
OPO32– dTTP
CloV
L-proline
HO
CloN4
PPi
CloI dTDP
OH
CloQ
C S CloH O
CloR OH
O
3,5-epimerization
H3C
CloR
CloN5
OH
O
O
HO
NH2
OH
FAD CloN3
CloU
FADH2
O2 CO2
HOOC
Ring B
HO
SAM
CO2
OH
??
dTDP
O
OH O2
HOOC
C S CloH O
HO
DMAPP
HOOC
CloJ CloK dTDP
NADH 4-hydroxyphenylpyruvate OH
O
NH2 CloW
C S
HOOC
OH
HO
O
HO
AMP
N H
O
C S CloH O
CloN5
CloN4
OH NAD++H+ CloF
AMP + PPi NH2
HO
H2O
CH3
O
CloH
NH2
CloT
C AMP O
N H
OH
HOOC
ATP
O
HO ATP
COOH
PPi
CH2OH
COOH
N H
prephenate
L-tyrosine HO
OH
COOH
O
NH2
O
O
OH
O ATP
C S
N H
H3C
CloN5
O
O
CloN5
H N
O
O
CH3 dTDP
O
OH
H N
O
O
HO HO
O C OH
Clo-hal
OH
HO
O C
Cl
CloN1
CloN2
OH
OH
CloS 4-ketoreduction H3C
C S O
HO
AMP + PPi
dTDP
O
HO
spontaneous?
N H
CloL
CH3
CloM
CloN5
H O N C
OH
C S O
N H
H3C
CloN1
O
CH3
O
O
HO
O
OH
Cl HO
OH CloP
4´´-O-methyl transfer
CloN6
5´´´-C-methyltransfer
CloN7
3´´-O-acyl transfer 10
5´
6´´ CH3 7´´5´´ H3C
H3C O 4´´
4´´´ 6´´´ H3C 5´´´ N
6´
H N 3´
O
O 2
C
7
1
3
8
9
11
1´´ O
O 3´´
3´´´ C
OH 4´
2´´ OH
H
7´
8´
O 2´ O
6
4 5
OH
Cl
Clorobiocin
O
2´´´
H
Figure 18.3 Biosynthetic pathway of clorobiocin.
OH
Ring A
Aminocoumarins
441
example the biosynthetic pathway of clorobiocin and the catalytic functions of the individual gene products in this process. Details of the functional analysis of the aminocoumarin clusters have been summarized in several reviews (Heide et al., 2008a; Li and Heide, 2004, 2006).
2. Generation of Integrative Cosmids and Heterologous Expression of Novobiocin, Clorobiocin, and Coumermycin A1 Gene Clusters For the generation of new aminocoumarins by genetic methods, heterologous expression of their gene clusters offers two principal advantages: one is the possibility to rapidly manipulate the clusters by l RED– mediated recombination in Escherichia coli, prior to integration into the genome of a Streptomyces strain that is more difficult to manipulate genetically; the second advantage is the possibility to work in a completely sequenced host with the potential to influence the supply of primary metabolic precursors and the expression of regulatory genes outside of the cluster in a systems biology approach (Rokem et al., 2007). The integration functions of phage FC31 (Thorpe et al., 2000) are used for site-specific integration of cosmids containing the entire aminocoumarin biosynthetic gene clusters into the genome of Streptomyces coelicolor M512 (Fig. 18.4). M512 (DredD DactII-ORF4 SCP1– SCP2–) is a derivative of the A3(2) wildtype and lacks the capacity to form three of the genuine antibiotics of S. coelicolor A3(2), that is, undecylprodigiosin, actinorhodin, and methylenomycin (Floriano and Bibb, 1996). The procedure for heterologous expression of the aminocoumarin clusters involves the following steps. 1. Cosmids containing the entire novobiocin or clorobiocin gene cluster in a SuperCosI vector (Stratagene) are generated from the genomic DNA of the respective producer strains using standard techniques (Sambrook and Russell, 2001). The coumermycin A1 gene cluster is relatively large (38.2 kb) and can hardly be obtained on a single cosmid by standard techniques. Therefore, it is obtained by ‘‘stitching’’ of the inserts of two overlapping cosmids, each containing parts of the cluster, using l RED– mediated recombination. This method is described in Vol. 458 Chapter 7 of this series and in Wolpert et al. (2008). 2. The DraI-BsaI fragment of pIJ787 (Eusta´quio et al., 2005), which contains the integrase gene and the attP site of phage FC31 as well as a tetracycline resistance gene and which is flanked by about 100 bp of b-lactamase (bla) sequence on one side and about 300 bp of bla sequence on the other side, is used to replace, via l RED–mediated recombination, the bla gene in the SuperCos1 backbone of the cosmids containing the aminocoumarin gene clusters, thereby generating the desired integrative cosmids.
442
Lutz Heide
A
912 bp B
13.7 kb
B
7274 bp
B B B B 3815 bp 5583 bp 4443 bp
ORF A B C D E F G H I J K L M N OP Q R S T U VW gyrBR ORF 13 7 6 21 20
Novobiocin cluster in integrative cosmid
T7 B
∼ 8.5 kb
B ∼ 10 kb
Unknown sequence
T3
neo int
B S. coelicolor M512 chromosome
attP
tet
attB
Site-specific integration
B
attL
Integration mutant
int
neo
B
B
tet
attR B
Nov-cluster 13 kb
∼ 5.2 kb
Figure 18.4 Schematic representation of site-specific integration of the novobiocin gene cluster into the genome of Streptomyces coelicolor M512. B ¼ BglII restriction sites.
3. Because of the potent methylation-dependent restriction system of S. coelicolor, cosmid DNA has to be passed through E. coli ET12567 as a nonmethylating host (MacNeil et al., 1992) prior to introduction into the Streptomyces host. 4. The integrative cosmids, still carrying the kanamycin resistance gene neo, are then introduced into S. coelicolor M512 via polyethylene glycol– mediated protoplast transformation (Kieser et al., 2000). Kanamycinresistant clones are checked for site-specific integration into the genome by Southern blot analysis. 5. Cultivation of the integration mutants in the production media for novobiocin (Kominek and Sebek, 1974), clorobiocin (see Section 4 below) and coumermycin A1 (Wolpert et al., 2008) results in the accumulation of the antibiotics in yields of 20 to 42 mg/l, 18 to 34 mg/l, and 7 mg/l, respectively.
3. Generation of Single and or Multiple Deletions in the Integrative Cosmids Single gene replacements or gene deletions within the integrative cosmids can be carried out by l RED–mediated recombination, for example using the apramycin resistance cassette of plasmid pIJ773, which is
Aminocoumarins
443
flanked by FLP recombinase recognition targets (FRT) (Gust et al., 2004). After gene replacement, this cassette can be conveniently removed by action of FLP recombinase, leading to excision of the DNA region between the FRT sites and leaving an 81-bp ‘‘scar’’ sequence. However, the presence of this scar sequence makes further knockouts in the same cosmid difficult, because it represents a functional FRT site as well as a target for l RED– mediated recombination. Therefore, another procedure has been developed which opens the possibility for multiple deletions within the cosmid insert. An apramycin-resistance cassette is generated by PCR using primers with either an XbaI or a SpeI recognition site between the apramycin resistance marker and the 39-bp flanking sequence for l RED–mediated recombination. XbaI and SpeI sites are rare in the GC-rich Streptomyces genome. After gene replacement, this cassette can be removed by digestion with XbaI and SpeI and re-ligation of the resulting compatible ends. This procedure leaves a minimal in-frame ‘‘scar’’ of 18 bp which is not recognized by XbaI or SpeI and which does not interfere with further gene deletions or replacements. This procedure is therefore the method of choice for modification of the aminocoumarin gene clusters in E. coli prior to their heterologous expression in S. coelicolor (see also Vol. 458 Chapter 7 of this series). It involves the following steps: 1. A fragment of 97 bp is amplified from pIJ773 (Gust et al., 2003) using primers FRT_P01f (5-CTG CAG GAA TTC GAT ATT CCG GGG ATC TCT AGA TCT-3) (the EcoRI, XbaI, and BglII restriction sites are underlined) and FRT_P01r (5-TGG CGG GGA TAT CGA AGT TCC-3) (the EcoRV restriction site is underlined). After digestion with EcoRI and EcoRV, this fragment is ligated into the same sites of pBluescript SK(-) (Stratagene) to give pUG017. 2. A second fragment of about 1 kb containing the apramycin resistance gene aac(3)IV is amplified from pIJ773 using primers apra_P03f (5-GGG GAT GAT ATC TTT ATC ACC ACC GAC TAT TTG-3) (the EcoRV restriction site is underlined) and apra_P02r (5-TCG ATA AGC TTG ATG ACT AGT CTG GAG CTG GAG CTG CTT CGA-3) (the HindIII and SpeI restriction sites are underlined). After digestion with EcoRV and HindIII, this fragment is ligated into the same sites of pUG017 to give pUG019. 3. The apramycin resistance cassette (approximately 1 kb) is excised from pUG019 by digestion with EcoRI and HindIII and amplified by PCR using the forward primer 5-(N)39 ATT CCG GGG ATC TCT AGA TCT-3 and the reverse primer 5-(N)39 ACT AGT CTG GAG CTG CTT C-3 ((N)39 represents 39-nucleotide extensions for l RED– mediated recombination, homologous to the regions upstream and downstream of the DNA fragment to be deleted; XbaI and SpeI restriction sites are underlined). Amplification is performed using the Expand High Fidelity PCR system (Roche Molecular Biochemicals) according
444
Lutz Heide
to the manufacturer’s instructions, with annealing temperatures of 45 and 48 , respectively. 4. The PCR product is used for gene replacement in cosmids via l RED– mediated recombination (Gust et al., 2003, 2004). 5. For excision of the resistance cassette after gene replacement, cosmid DNA is isolated from E. coli ET12567 and digested with XbaI and SpeI, and 100 ng of DNA is re-ligated overnight at 4 . E. coli XL1-Blue MRF0 cells are transformed with the ligation reaction. Apramycin-sensitive kanamycin-resistant clones are analyzed by restriction enzyme digestion and gel electrophoresis. 6. Subsequent gene deletions within the same cosmid follow the identical procedure.
4. Mutasynthetic Generation of New Aminocoumarin Antibiotics Mutasynthesis—the feeding of synthetic precursor analogues to mutants of microbial producer strains of natural products—is an important and powerful tool for drug discovery and lead optimization. In the aminocoumarin group of antibiotics, it is especially useful to replace the natural 3-dimethylallyl-4-hydroxybenzoyl moiety (termed ‘‘Ring A’’) of novobiocin and clorobiocin by synthetic analogues thereof. In clorobiocin biosynthesis, Ring A is formed via catalysis by the gene products of cloF, cloQ, and cloR (Fig. 18.3). When the prenyltransferase gene cloQ is inactivated, biosynthesis of this moiety is abolished. Since Ring A is the starter unit of the biosynthesis, no aminocoumarin antibiotics are accumulated by such a mutant. If, however, synthetic analogues of Ring A are added to the culture medium, they may be incorporated instead of Ring A and lead to the formation of new aminocoumarin antibiotics. Inactivation of cloQ is carried out by an in-frame deletion on an integrative cosmid containing the entire clorobiocin cluster, using the procedure described above. The entire mutasynthesis procedure involves the following steps: 1. The apramycin-resistance cassette for replacement of cloQ is generated by PCR amplification using pUG019 (see Section 3, Steps 1 and 2) as template with the primers cloQ_for (50-GGCGCGCCCATTGCT CACCGTCTTACCGACACCGTCCTTATTCCGGGGATCTC TAGATC-30) and cloQ_rev (50-CCCATGGTCGATTCCGTGT GTTGGTGAAGTGCGCGCAGACTAGTCTGGAGCTGCTTC30). Bold letters represent the homologous extensions to the DNA regions immediately upstream and downstream of cloQ. Underlined letters indicate the XbaI and SpeI restriction sites. PCR amplification is performed in a
Aminocoumarins
2.
3.
4.
5.
6.
7. 8. 9.
10.
445
50-ml volume with 50 ng template, 0.2 mM dNTPs, 50 pmol of each primer, and 5% (v/v) DMSO with the Expand High Fidelity PCR system (Roche Molecular Biochemicals): denaturation is at 94 C for 2 min, and then 10 cycles with denaturation at 94 for 45 s, annealing at 50 for 45 s, and elongation at 72 for 90 s, followed by 15 cycles with annealing at 55 for 45 s, and the last elongation step at 72 for 5 min. The PCR product is introduced by electroporation into E. coli BW25113/pIJ790 harboring a cosmid containing the entire clorobiocin cluster and the integration functions of phage FC31 (see Section 2). The resulting modified cosmid is isolated, introduced by transformation into the nonmethylating strain E. coli ET12567, reisolated, and digested with XbaI and SpeI to remove the apramycin-resistance cassette. Religation overnight at 4 gives the desired cosmid with the cloQ-defective clorobiocin cluster. The cloQ-defective cosmid isolated from E. coli ET12567 is introduced into S. coelicolor M512 by PEG-mediated protoplast transformation (Kieser et al., 2000). Clones resistant to kanamycin are selected, and integration of the cloQ-defective clorobiocin cluster into the genome is confirmed by Southern blot analysis. For mutasynthetic production of new aminocoumarins, the cloQ-defective heterologous expression strain is first precultured in YMG liquid medium (pH 7.3) containing 1% malt extract, 0.4% yeast extract, 0.4% glucose, and 25 mg/ml kanamycin at 30 and 180 rpm for 2 to 3 days. One milliliter of this YMG preculture is then used to inoculate 50 ml corn starch medium (pH 7.0) (1% corn starch [Becton-Dickinson, Heidelberg, Germany], 1% peptone [Roth, Karlsruhe, Germany], 0.5% meat extract [Merck, Darmstadt, Germany] and 25 mg/ml kanamycin), followed by cultivation for 2 days at 33 and 210 rpm. Five milliliters of this corn starch preculture are inoculated into 80 ml of production medium, prepared from 4.8% distillers’ solubles (SigmaAldrich, Deisenhofen, Germany), 3.7% glucose, 0.0024%CoCl2 6 H2O (at this point, the pH of the mixture is adjusted to 7.8), 0.6% CaCO3, 0.2% (NH4)2SO4, and 25 mg/ml kanamycin. At the time of inoculation of the production medium, 1 mg of the respective ring A analogue, dissolved in 200 ml ethanol, is added to 80 ml of culture medium. Cultivation is carried out in 500-ml baffled flasks for 7 to 10 days at 33 and 210 rpm. For preparative isolation of the products, a total culture volume of 800 ml is pooled and acidified with HCl to pH 4. Lipophilic components are removed by extraction with petrol ether, and subsequently the aqueous phase is extracted twice with an equal volume of ethyl acetate. The residue of the ethyl acetate extract after evaporation of the solvent is dissolved in 3 ml methanol and applied to a column (100 2.6 cm) of
446
Lutz Heide
Sephadex LH 20 (Amersham Biosciences) which is eluted with methanol. 11. The fractions after separation on Sephadex LH 20 are analyzed by HPLC using an analytical RP18 column and the solvent gradient mentioned below. Fractions containing novclobiocins are pooled and further purified on a preparative HPLC column (Multosphere 120 RP18-5, 250 20 mm, C&S Chromatographie Service, Du¨ren, Germany) using a linear gradient from 68 % to 100% MeOH in 0.2% aqueous acetic acid for 37 min and a flow rate of 2.5 ml/min. Detection is carried out by UV absorption at 340 nm. Examples of new aminocoumarins accessible by this procedure are described in Galm et al. (2004).
5. In Vitro Amide Synthetase Assays for the Identification of Suitable Ring A Analogues for Mutasynthesis The most important limiting step for the generation of new aminocoumarin antibiotics by the mutasynthetic procedure described above is the substrate tolerance of the amide synthetase CloL, which attaches the externally added ring A analogue via amide bond formation to the 3-amino group of the aminocoumarin moiety (see Fig. 18.3). In vitro enzyme assays with CloL can therefore be used to predict, with minimal requirement for time and material and with significant accuracy, whether or not a given ring A analogue will yield a new aminocoumarin antibiotic in mutasynthesis (Galm et al., 2004). Moreover, the range of aminocoumarins that can be produced by mutasynthesis can be significantly expanded if other amide synthetases, such as that of coumermycin A1 biosynthesis (CouL) or that of simocyclinone D8 biosynthesis (SimL) (Luft et al., 2005), are also investigated for their substrate tolerance for the respective ring A analogue. If found suitable, these amide synthetases are utilized in the mutasynthesis procedure (see Section 7). 1. The three amide synthetase genes cloL, couL, and siml are cloned into the expression vector pQE70 (Qiagen) according to the manufacturer’s protocol. 2. The C-terminally His6-tagged fusion proteins NovL, CouL, and SimL are expressed in E. coli XL1 Blue MRF0 (Stratagene) and purified by affinity chromatography on Ni-NTA agarose (Qiagen) according to the manufacturer’s protocol. 3. The assay for amide synthetase activity contains 1mM of the ring A analogue, 1 mM 3-amino-4,7-dihydroxy-8-methyl-coumarin, 5 mM ATP, 5 mM MnCl2, 50 mM Tris-HCl (pH 8.0), and 0.5 to 2 mg of the
Aminocoumarins
447
respective protein in a final volume of 100 ml. The reaction is carried out for 30 min at 30 and stopped by addition of 5 ml 1.5 M trichloroacetic acid. The assay mixture is extracted with 1 ml of ethyl acetate, the organic phase is evaporated, and the residue is dissolved in H2O/ methanol (50:50, v/v). HPLC analysis is carried out using a Multosphere RP18-5 column (250 4 mm; 5-mm particle size) with a linear gradient from 60 to 100% methanol in 1% aqueous formic acid and detection at 305 nm.
6. Use of Various Amide Synthetase Genes for Expanding Mutasynthesis Product Range Compounds which are found, in the enzyme assay described in Section 5, to be poorly accepted by CloL but readily by CouL (e.g., 3,5dimethyl-4-hydroxybenzoic acid), or by SimL (e.g., benzoic acid), can be successfully used in mutasynthesis if the suitable amide synthetase is cloned into an expression vector and introduced by transformation into the heterologous expression strain containing the cloQ-defective clorobiocin cluster. 1. The amide synthase genes couL and siml are cloned into the E. coliStreptomyces shuttle vector pUWL201, containing the ermE* promoter for strong constitutive expression (Doumith et al., 2000). 2. The couL or siml expression plasmids are introduced by transformation into S. coelicolor M512, harboring the cloQ-defective clorobiocin cluster, by PEG-mediated protoplast transformation (Kieser et al., 2000). 3. Subsequently, the mutasynthetic experiment is carried out as described above (Section 4, Steps 4 to 11), including 25 mg/ml thiostrepton in the cultivation media for selection of cells containing the couL or siml expression plasmids. Examples of new aminocoumarins accessible by expression of couL and siml in the cloQ-defective heterologous expression strain are described in Anderle et al. (2007b).
7. Generation of Substrates for Chemoenzymatic Synthesis The structural skeleton of novobiocin and clorobiocin consists of the 3-dimethylallyl-4-hydroxybenzoyl moiety (ring A), the 3-amino-4,7-dihydroxycoumarin moiety (ring B), substituted at position 8 with a methyl group or a chlorine atom, and the 5-methyl-L-rhamnose moiety (ring C).
448
Lutz Heide
In two final tailoring reactions of the biosynthesis, the deoxysugar moiety (ring C) is decorated with two further substituents (see Fig. 18.3): The 4-OH group of the deoxysugar is methylated by the SAM-dependent methyltransferases NovP or CloP, respectively; and the 3-OH group of the deoxysugar is acylated. In novobiocin biosynthesis, a carbamoyl group is attached via catalysis by the carbamoyl transferase NovN. In clorobiocin biosynthesis, the respective acyl group is a 5-methyl-pryrrol-2-carboxylmoiety, derived from proline via catalysis by CloN3, CloN4 and CloN5 and transferred from the acyl carrier protein CloN5 to the deoxysugar in a twostep process involving two acyl transferases, CloN2 and CloN7, and a further acyl carrier protein, CloN1 (see Fig. 18.3) (Garneau-Tsodikova et al., 2006). Methylation at position 5 of the pyrrole-2-carboxyl moiety takes place prior to attachment of this moiety to the deoxysugar (Anderle et al., 2007a). For the generation of new aminocoumarins by chemoenzymatic synthesis (and by organic-synthetic procedures), it is of interest to generate novobiocin or clorobiocin analogues which lack either the acyl moiety at position 3 of the deoxysugar, or the methyl group at position 4 of the deoxysugar, or both. This can conveniently be achieved by inactivation of the responsible genes on cosmids containing the respective gene cluster and by heterologous expression of the resulting cosmids, using the methods described above. As example, the generation of a clorobiocin analogue (termed novclobiocin 104) lacking the acyl moiety at position 3 of the deoxysugar is described here. 1. The apramycin resistance gene aac(3)IV is amplified from plasmid pUG019 (see Section 3, Steps 1 and 2) by PCR, with use of primers with 39-bp extensions homologous to the regions upstream and downstream of cloN7, that is, primer cloN7-f (50 -GGCAGACTCCCCAACAGCA GAGAGGACCAACTGAGCATGATTCCGGGGATCTCTAGA TC-30 ) and primer cloN7-r (50 -AGTGTGCGTGGTGCGCCAGCA CTCCGACAAGCACCGTTAACTAGTCTGGAGCTGCTTC-30 ). Bold letters represent the homologous extensions to the DNA regions immediately upstream and downstream of cloN7, including the putative start and stop codons of cloN7. PCR amplification is performed in a 50-ml volume with template (50 ng), dNTPs (0.2 mM), each primer (50 pmol) and DMSO (5% v/v), with use of the Expand High Fidelity PCR system (Roche Molecular Biochemicals): denaturation is at 94 for 2 min, then 10 cycles with denaturation at 94 for 45 s, annealing at 45 for 45 s and extension at 72 for 90 s, followed by 15 cycles with annealing at 48 , and the last elongation step at 72 for 5 min. 2. The PCR product is introduced by electroporation into E. coli BW25113/pIJ790 harboring an integrative cosmid with the entire clorobiocin cluster. l RED–mediated recombination results in the
Aminocoumarins
449
replacement of the entire open reading frame of cloN7 in the clorobiocin cluster with the apramycin resistance cassette, leaving only the start and the stop codons of cloN7 intact. The modified cosmid is isolated and analysed by restriction enzyme digestion. 3. Since cloN7 is situated at the end of a putative transcription unit, removal of the apramycin resistance cassette to avoid polar effects is unnecessary in this case. Note that in a similar experiment with cloN1, which is situated at the start of a putative transcription unit, it is advisable to remove the resistance cassette by digestion with XbaI and SpeI as described in Section 3, Step 5 (Freitag et al., 2005b). 4. The cloN7-deficient cosmid is then passed through the nonmethylating host E. coli ET12567 and introduced into S. coelicolor M512 as described in Section 2. Site-specific integration into the genome is confirmed by Southern blot analysis. 5. Cultivation of the resulting strain and preparative isolation of the desired product, novclobiocin 104, is carried out as described above for the mutasynthesis experiment (Section 4, Steps 4 to 11), with omission of Step 7, that is, without the external addition of a ring A analogue. A similar procedure can be used, for instance, in generating a strain defective in the methyltransferase gene cloP, which produces clorobiocin analogues lacking the methyl group at 4-OH of the deoxysugar (Freitag et al., 2005a).
8. Chemoenzymatic Synthesis of New Clorobiocin Analogues Most of the enzymes involved in the biosynthesis of the aminocoumarin antibiotics have meanwhile been overexpressed and purified, and are available for the chemoenzymatic generation of new aminocoumarins in vitro. The production of a hybrid antibiotic, containing a carbamoyl group typical of novobiocin in the deoxysugar, and a chlorine atom typical of clorobiocin in the aminocoumarin moiety, is given as an example. 1. The substrate novclobiocin 104, carrying a chlorine atom at position 8 of the aminocoumarin moiety and lacking the acyl group a 3-OH of the deoxysugar, is generated as described above (Section 8). 2. The carbamoyl transferase NovN is expressed and purified in the following way: novN is amplified from a cosmid containing the novobiocin biosynthetic gene cluster using the GC-RICH PCR system (Roche, Mannheim, Germany) and the primer pair novN-BclI (50 - GTG CTC GCT GAT CAG AAC GAC ATG -30 ) and novN-HindIII (50 - AAG GGA AGC TTT ACG GCC GCG AC -30 ). Introduced restriction sites
450
Lutz Heide
are underlined. The DNA fragment is directly ligated into the linearized vector pGEM-T (Promega), resulting in pXHNET. novN is released from pXHNET by digestion with BclI and HindIII and ligated into pRSET-B (Invitrogen), which has been digested with BamHI and HindIII, to give pXHNER. To obtain pXHNEG, pXHNER is fused with the vector pGM9 (Muth et al., 1989) via the HindIII restriction site. pXHNEG contains a kanamycin resistance gene. After transforming S. lividans T7 protoplasts with plasmid pXHNEG, cells are regenerated on R2YE plates and kanamycin- and thiostrepton-resistant colonies are selected. They are grown in YEME medium with kanamycin (10 mg/ml) at 28 for 48 h, and then 1 ml culture is transferred to 100-ml YEMEmedium with kanamycin (10 mg/ml) and thiostrepton (25 mg/ml), and cultured for further 24 h. The cells are harvested by centrifugation (10 min at 5000g) and incubated in ice-cold lysis buffer (50 mM NaH2PO4, pH 8.0, 300 mM NaCl, 15 mM imidazole, 0.2% triton 100 and 6 mg/ml lysozyme) for 30 min. The cell suspension is sonicated for 8 min (Branson Sonifier 250) and the cell debris is removed by centrifugation (30 min at 15,000g). The protein is purified from the soluble cell extract by metal affinity chromatography using Ni-nitrilotriacetic acid (Ni-NTA) resin (Qiagen) according to the manufacturer’s instructions. Subsequently, the Ni-NTA resin eluate is applied to a NAP 10 column (Amersham Biosciences) and eluted with 0.2 M Tris-HCl (pH 8.0). 3. For chemoenzymatic generation of the desired new aminocoumarin antibiotic, the carbamoyl transferase assay mixture contains 0.2 M TrisHCl (pH 8.0), 1 mM novclobiocin 104, 5 mM carbamoyl phosphate (as Liþ salt), 2 mM ATP, 2 mM MgCl2 and purified NovN (0.4 mM ) in a final volume of 5 ml. The reaction is carried out overnight at 30 and terminated by the addition of 250 ml 1.5 M trichloroacetic acid. The assay products are extracted twice with an equal volume of ethyl acetate. After evaporation of the organic solvent, the residue is dissolved in methanol, and the products are isolated by HPLC using the method described for the mutasynthesis experiments (see Section 4, Step 11). (Note that column chromatography on Sephadex LH 20 is unnecessary in this case, as the extract from the enzyme assay contains far less impurities than extracts from microbial cultures.) Using other substrates than novclobiocin 104, hybrid antibiotics with different structures can be obtained by this chemoenzymatic method: the preparative generation of 10 different aminocoumarin antibiotics is described in Xu et al. (2004). Furthermore, it is possible to generate variants of coumermycin A1 by tandem action of four biosynthetic enzymes, CouL, CouM, CouP, and NovN, using 3-methyl-pyrrole-2,4-dicarboxylic acid, the aminocoumarin moiety, dTDP-5-methyl-rhamnose and carbamoyl phosphate as substrates and ATP and SAM as cofactors (Freel Meyers
451
Aminocoumarins
et al., 2004). Additional chemoenzymatic approaches for generating new aminocoumarin antibiotics are described in Fridman et al. (2007) and Williams et al. (2008).
9. Generation of New Aminocoumarin Antibiotics by Metabolic Engineering The availability of biosynthetic gene clusters for aminocoumarin antibiotics of different structures and detailed knowledge of the genes contained in these clusters, form an excellent basis for the generation of new aminocoumarin antibiotics by rational metabolic engineering via combining gene inactivations and gene expressions. An example of the systematic generation of a series of new aminocoumarin antibiotics with different substituents at position 80 of the aminocoumarin moiety and position 3" of the deoxysugar is given in Fig. 18.5. These experiments can be carried out with the methods described above for generation of single and/or multiple deletions within integrative cosmids (see Section 3), for heterologous expression of the resulting modified biosynthetic gene clusters (see Section 2), and for the expression of additional biosynthetic genes using replicative expression vectors (see Section 6).
Novobiocin 3² 8¢ Carbamoyl CH3
Clorobiocin 3² 8¢ MePyC Cl
– methyltransferase novO Novclobiocin 117 3² 8¢ Carbamoyl H
Novclobiocin 104 3² 8¢ Cl H
– halogenase clo-hal
Novclobiocin 101 3² 8¢ MePyC H
+ halogenase clo-hal Novclobiocin 114 3² 8¢ Carbamoyl Cl
– acyl transferase cloN2
+ methyltransferase novO
Novclobiocin 102 3² 8¢ MePyC CH3
– acyl transferase cloN2
Novclobiocin 107 3² 8¢ H H
Side product Novclobiocin 103 3² 8¢ H CH3
Figure 18.5 Scheme showing routes for the generation of novobiocin and clorobiocin analogues by metabolic engineering of the producer strains. MePyC ¼ 5-Methylpyrrole-2-carboxyl moiety.
452
Lutz Heide
The following section therefore gives an overview of the steps involved, without describing the methods again in detail. Novobiocin can be produced in the heterologous host S. coelicolor M512, after stable integration of the complete novobiocin biosynthetic gene cluster into its genome (see Section 2). The productivity of the heterologous producer (31 mg/l) is similar to that of the natural producer, Streptomyces spheroides (35 mg/l). Inactivation of the methyltransferase gene novO, responsible for 80 -methylation of the aminocoumarin ring, in the novobiocin cluster, and heterologous expression of the resulting cosmid readily yields a strain which accumulates novclobiocin 117 (30 mg/l), the novobiocin analogue lacking the 80 -methyl group. When the halogenase gene clo-hal, responsible for 80 -halogenation of the aminocoumarin ring in clorobiocin biosynthesis, is cloned into the replicative expression plasmid pUWL201 and expressed in the novO-defective strain, the hybrid antibiotic novclobiocin 114 is produced, which carries the 3"-O-carbamoyl group typical of novobiocin, and the 80 -chlorine typical of clorobiocin (yield 14 mg/l). The clorobiocin producer Streptomyces roseochromogenes can be manipulated genetically with relative ease. The halogenase gene clo-hal can be inactivated in this strain by an in-frame deletion (Eusta´quio et al., 2003), which results in the production of the 80 -unsubstituted compound novclobiocin 101 (40 mg/l). Subsequently, the methyltransferase gene novO can be expressed in this strain using the replicative expression plasmid pUWL201. This leads to the formation of the hybrid antibiotic novclobiocin 102, which carries the 5-methyl-pyrrole-2-carboxyl group typical of clorobiocin at position 3", and the methyl group typical of novobiocin at position 80 (yield 43 mg/l). Besides novclobiocin 102, a side product can be isolated, carrying the methyl group at 80 , but no substituent at 3"-OH (i.e., novclobiocin 103 [11 mg/l]). This makes a separate experiment for the generation of novclobiocin 103 such as via inactivation of the carbamoyl transferase gene novN in the novobiocin cluster, unnecessary. The attachment of the 5-methyl-pyrrole-2-carboxyl (MePyC) moiety to the 3"-OH of noviose requires, besides other proteins, the acyltransferase CloN2. When the cloN2 gene in the clorobiocin producer S. roseochromogenes is inactivated, the resulting mutant accumulates novclobiocin 104, lacking the MePyC unit. This compound is produced in a yield of 85 mg/l, surpassing the productivity of clorobiocin in the wildtype. The gene cloN2 can also be inactivated in the clo-hal defective mutant described above. The resulting clo-hal – cloN2 – double mutant produces novclobiocin 107, which carries no substituent at 80 and at 3"-OH. Therefore, all compounds depicted in Fig. 18.5 can readily be obtained from genetically engineered producer strains. Metabolic engineering can also be carried out with genes from biosynthetic gene clusters outside of the aminocoumarin family. This can be demonstrated by inactivation of the methyltransferase gene cloN6, which
Aminocoumarins
453
is responsible for attachment of a methyl group at position 5 of the pyrrole2-carboxyl moiety of clorobiocin (Fig. 18.3), on an integrative cosmid containing the entire clorobiocin cluster. The cloN6-defective cluster is expressed in S. coelicolor M512 (using genomic integration) together with the halogenase gene hrmQ (using the replicative expression plasmid pUWL201). hrmQ is obtained from the biosynthetic gene cluster of hormaomycin (Reinscheid et al., 2005) and is presumed to be responsible for the attachment of a chlorine atom at position 5 of the pyrrole-2-carboxyl moiety of hormaomycin, which is structurally completely different from clorobiocin. This experiment results in the formation of a new clorobiocin derivative, carrying a chlorine atom rather than a methyl group at position 5 of the pyrrole-2-carboxyl moiety (Heide et al., 2008b).
10. Conclusion The family of aminocoumarin antibiotics provides an example for the generation of new antibiotics by genetic methods. The available detailed knowledge of the biosynthetic pathways and of the functions of the genes contained in the biosynthetic clusters facilitates such experiments. Limitations posed by the substrate specificity of biosynthetic enzymes can be overcome by expression of heterologous enzymes (e.g., amide synthetases) with appropriate specificities. Heterologous expression of the entire biosynthetic gene clusters in suitable expression hosts significantly accelerates the engineering procedures and offers excellent prospects to increase production rates by upregulating precursor supply and influencing regulatory cascades. These experiments exemplify that drug structures can be systematically altered by genetic engineering of the producer strains, avoiding the need for multistep organic synthesis. Such genetic methods are likely to become a cornerstone of programmes for drug discovery and development from microorganisms in future.
ACKNOWLEDGMENTS The author gratefully acknowledges the invaluable contributions of many colleagues, coworkers, and collaboration partners in the development of the methods described here, especially of S.-M. Li and B. Gust, as well as of C. Anderle, A. Eusta´quio, A. Freitag, U. Galm, H. Xu, L. Westrich, B. Kammerer, and many others. The work was financially supported from the Deutsche Forschungsgemeinschaft and from the European Community (IP 005244 ActinoGEN).
454
Lutz Heide
REFERENCES Anderle, C., Alt, S., Gulder, T., Bringmann, G., Kammerer, B., Gust, B., and Heide, L. (2007a). Biosynthesis of clorobiocin: Investigation of the transfer and methylation of the pyrrolyl-2-carboxyl moiety. Arch. Microbiol. 187, 227–237. Anderle, C., Hennig, S., Kammerer, B., Li, S. M., Wessjohann, L., Gust, B., and Heide, L. (2007b). Improved mutasynthetic approaches for the production of modified aminocoumarin antibiotics. Chem. Biol. 14, 955–967. Doumith, M., Weingarten, P., Wehmeier, U. F., Salah-Bey, K., Benhamou, B., Capdevila, C., Michel, J. M., Piepersberg, W., and Raynal, M. C. (2000). Analysis of genes involved in 6-deoxyhexose biosynthesis and transfer in Saccharopolyspora erythraea. Mol. Gen. Genet. 264, 477–485. Eusta´quio, A. S., Gust, B., Galm, U., Li, S. M., Chater, K. F., and Heide, L. (2005). Heterologous expression of novobiocin and clorobiocin biosynthetic gene clusters. Appl. Environ. Microbiol. 71, 2452–2459. Eusta´quio, A. S., Gust, B., Luft, T., Li, S. M., Chater, K. F., and Heide, L. (2003). Clorobiocin biosynthesis in Streptomyces. Identification of the halogenase and generation of structural analogs. Chem. Biol. 10, 279–288. Ferroud, D., Collard, J., Klich, M., Dupuis-Hamelin, C., Mauvais, P., Lassaigne, P., Bonnefoy, A., and Musicki, B. (1999). Synthesis and biological evaluation of coumarincarboxylic acids as inhibitors of gyrase B. L-rhamnose as an effective substitute for L-noviose. Bioorg. Med. Chem. Lett. 9, 2881–2886. Flatman, R. H., Howells, A. J., Heide, L., Fiedler, H. P., and Maxwell, A. (2005). Simocyclinone D8, an inhibitor of DNA gyrase with a novel mode of action. Antimicrob. Agents Chemother. 49, 1093–1100. Floriano, B., and Bibb, M. (1996). afsR is a pleiotropic but conditionally required regulatory gene for antibiotic production in Streptomyces coelicolor A3(2). Mol. Microbiol. 21, 385–396. Freel Meyers, C. L., Oberthur, M., Heide, L., Kahne, D., and Walsh, C. T. (2004). Assembly of dimeric variants of coumermycins by tandem action of the four biosynthetic enzymes CouL, CouM, CouP, and NovN. Biochemistry 43, 15022–15036. Freitag, A., Rapp, H., Heide, L., and Li, S. M. (2005a). Metabolic engineering of aminocoumarins: Inactivation of the methyltransferase gene cloP and generation of new clorobiocin derivatives in a heterologous host. ChemBioChem 6, 1411–1418. Freitag, A., Wemakor, E., Li, S. M., and Heide, L. (2005b). Acyl transfer in clorobiocin biosynthesis: Involvement of several proteins in the transfer of the pyrrole-2-carboxyl moiety to the deoxysugar. ChemBioChem 6, 2316–2325. Fridman, M., Balibar, C. J., Lupoli, T., Kahne, D., Walsh, C. T., and GarneauTsodikova, S. (2007). Chemoenzymatic formation of novel aminocoumarin antibiotics by the enzymes CouN1 and CouN7. Biochemistry 46, 8462–8471. Galm, U., Dessoy, M. A., Schmidt, J., Wessjohann, L. A., and Heide, L. (2004). In vitro and in vivo production of new aminocoumarins by a combined biochemical, genetic and synthetic approach. Chem. Biol. 11, 173–183. Garneau-Tsodikova, S., Stapon, A., Kahne, D., and Walsh, C. T. (2006). Installation of the pyrrolyl-2-carboxyl pharmacophore by CouN1 and CouN7 in the late biosynthetic steps of the aminocoumarin antibiotics clorobiocin and coumermycin A1. Biochemistry 45, 8568–8578. Gust, B., Challis, G. L., Fowler, K., Kieser, T., and Chater, K. F. (2003). PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc. Natl. Acad. Sci. USA 100, 1541–1546. Gust, B., Chandra, G., Jakimowicz, D., Yuqing, T., Bruton, C. J., and Chater, K. F. (2004). lambda RED–mediated genetic manipulation of antibiotic-producing Streptomyces. Adv. Appl. Microbiol. 54, 107–128.
Aminocoumarins
455
Heide, L., Gust, B., Anderle, C., and Li, S. M. (2008a). Combinatorial biosynthesis, metabolic engineering and mutasynthesis for the generation of new aminocoumarin antibiotics. Curr. Top. Med. Chem. 8, 667–79. Heide, L., Westrich, L., Anderle, C., Gust, B., Kammerer, B., and Piel, J. (2008b). Use of a halogenase of hormaomycin biosynthesis for formation of new clorobiocin analogues with 5-chloropyrrole moieties. ChemBioChem 9, 1992–1999. Kieser, T., Bibb, M. J., Buttner, M. J., Chater, K. F., and Hopwood, D. A. (2000). ‘‘Practical Streptomyces genetics.’’ Norwich, UK: John Innes Foundation, Norwich, UK. Kim, C. G., Lamichhane, J., Song, K. I., Nguyen, V. D., Kim, D. H., Jeong, T. S., Kang, S. H., Kim, K. W., Maharjan, J., Hong, Y. S., Kang, J. S., Yoo, J. C., et al. (2008). Biosynthesis of rubradirin as an ansamycin antibiotic from Streptomyces achromogenes var. rubradiris NRRL3061. Arch. Microbiol. 189, 463–473. Kominek, L. A., and Sebek, O. K. (1974). Biosynthesis of novobiocin and related coumarin antibiotics. Dev. Ind. Microbiol. 15, 60–69. Li, S. M., and Heide, L. (2004). Functional analysis of biosynthetic genes of aminocoumarins and production of hybrid antibiotics. Curr. Med. Chem. Anti-Infect. Agents 3, 279–295. Li, S. M., and Heide, L. (2006). The biosynthetic gene clusters of aminocoumarin antibiotics. Planta Med. 72, 1093–1099. Luft, T., Li, S. M., Scheible, H., Kammerer, B., and Heide, L. (2005). Overexpression, purification and characterization of SimL, an amide synthetase involved in simocyclinone biosynthesis. Arch. Microbiol. 183, 277–285. MacNeil, D. J., Gewain, K. M., Ruby, C. L., Dezeny, G., Gibbons, P. H., and MacNeil, T. (1992). Analysis of Streptomyces avermitilis genes required for avermectin biosynthesis utilizing a novel integration vector. Gene 111, 61–68. Maxwell, A., and Lawson, D. M. (2003). The ATP-binding site of type II topoisomerases as a target for antibacterial drugs. Curr. Top. Med. Chem. 3, 283–303. Muth, G., Nussbaumer, B., Wohlleben, W., and Puehler, A. (1989). A vector system with temperature-sensitive replication for gene disruption and mutational cloning in streptomycetes. Mol. Gen. Genet. 219, 341–348. Reinscheid, U. M., Zlatopolskiy, B. D., Griesinger, C., Zeeck, A., and de Meijere, A. (2005). The structure of hormaomycin and one of its all-peptide aza-analogues in solution: Syntheses and biological activities of new hormaomycin analogues. Chemistry 11, 2929–2945. Rokem, J. S., Lantz, A. E., and Nielsen, J. (2007). Systems biology of antibiotic production by microorganisms. Nat. Prod. Rep. 24, 1262–1287. Sambrook, J., and Russell, D. W. (2001). ‘‘Molecular cloning: A laboratory manual.’’ New York: Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Thorpe, H. M., Wilson, S. E., and Smith, M. C. (2000). Control of directionality in the sitespecific recombination system of the Streptomyces phage phiC31. Mol. Microbiol. 38, 232–241. Williams, G. J., Goff, R. D., Zhang, C., and Thorson, J. S. (2008). Optimizing glycosyltransferase specificity via ‘‘hot spot’’ saturation mutagenesis presents a catalyst for novobiocin glycorandomization. Chem. Biol. 15, 393–401. Wolpert, M., Heide, L., Kammerer, B., and Gust, B. (2008). Assembly and heterologous expression of the coumermycin A1 gene cluster and production of new derivatives by genetic engineering. ChemBioChem 9, 603–612. Xu, H., Heide, L., and Li, S. M. (2004). New aminocoumarin antibiotics formed by a combined mutational and chemoenzymatic approach utilizing the carbamoyltransferase NovN. Chem. Biol. 11, 655–662.
C H A P T E R
N I N E T E E N
Enzymology of Aminoglycoside Biosynthesis—Deduction from Gene Clusters Udo F. Wehmeier* and Wolfgang Piepersberg† Contents 1. Introduction 1.1. Basic concepts of CAG biosynthesis 1.2. Key to the biosynthetic classes of CAGs 2. Some Key Enzymes in the Biosyntheses of Aminoglycoside Antibiotics 2.1. Investigation of a dTDP-6-deoxyhexose pathway in STR-producing Streptomyces griseus subsp. griseus DSM 40236 2.2. dTDP-D-glucose synthase (StrD, RfbA) 2.3. dTDP-D-glucose 4,6-dehydratase (StrE, RfbB) 2.4. dTDP-4-6-glucose 3,5-epimerase (StrM, RfbC) 2.5. dTDP-L-rhamnose synthase (StrL, RfbD) 2.6. L-glutamine:scyllo-inosose aminotransferase StsC (EC 2.6.1.50) from Streptomyces griseus subsp. griseus DSM 40236 2.7. L-arginine:scyllo-inosamine-phosphate amidinotransferase StrB1 from Streptomyces griseus subsp. griseus DSM 40236 (ATCC 10137) 2.8. Streptomycin-phosphate phosphatase StrK (EC 3.1.3.39) from Streptomyces griseus subsp. griseus DSM 40236 (ATCC 10137) 2.9. Myo-inositol-2-dedydrogenase (IDH; scyllo-inosose synthase) ForG (EC 1.1.1.18) from Micromonospora olivasterospora DSM 43868 2.10. Glycosyltransferases involved in CAG pathways 2.11. KanM1, KanM2, and KanN of S. kanamyceticus DSM 40500
* {
460 464 467 469
469 470 471 471 471
472
473
473
475 476 477
Department of Sports Medicine, Bergische University Wuppertal, Wuppertal, Germany Department of Chemical Microbiology, Bergische University Wuppertal, Wuppertal, Germany
Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04619-9
#
2009 Elsevier Inc. All rights reserved.
459
460
Udo F. Wehmeier and Wolfgang Piepersberg
3. Acarbose and Related Metabolites 3.1. The synthesis and modification of C7-cyclitols 3.2. The biochemistry of carbophors: A unique system for the acquisition of glucose from starch in actinomycetes References
478 479 481 487
Abstract The classical aminoglycosides are, with very few exceptions, typically actinobacterial secondary metabolites with antimicrobial activities all mediated by inhibiting translation on the 30S subunit of the bacterial ribosome. Some chemically related natural products inhibit glucosidases by mimicking oligo-a1,4-glucosides. The biochemistry of the aminoglycoside biosynthetic pathways is still a developing field since none of the pathways has been analyzed to completeness as yet. In this chapter we treat the enzymology of aminoglycoside biosyntheses as far as it becomes apparent from recent investigations based on the availability of DNA sequence data of biosynthetic gene clusters for all major structural classes of these bacterial metabolites. We give a more general overview of the field, including descriptions of some key enzymes in various aminoglycoside pathways, whereas in Chapter 20 provides a detailed account of the better-studied enzymology thus far known for the neomycin and butirosin pathways.
1. Introduction Cyclitol-containing aminoglycosides (CAGs, see examples in Fig. 19.1) and some structurally related compounds (e.g., mycothiol) (Newton et al., 2006), with very few exceptions, are natural products of actinomycetes. After the discovery of the antibiotic streptomycin in 1943 (Schatz et al., 1944), this group of substances became one of the major groups of natural therapeutics in medicine and are still in focus of much molecular biological, biochemical, and pharmaceutical research (Fig. 19.1 and Table 19.1) (Arya, 2007; Piepersberg, et al., 2007; Piepersberg and Wehmeier, 2009). Producers of CAGs with antibiotic activity are members of the highGþC Gram-positive (Actinobacteria) genera Actinoplanes, Streptomyces, Streptosporangium, Saccharopolyspora, Streptoalloteichus, Micromonospora, Dactylosporangium, and Frankia; an exception is BTR, which is produced by Bacillus circulans, a bacterium belonging to the low-GþC Firmicutes. Two distinct targets are seen with CAGs, the bacterial ribosome (antibiotics) and alpha-glucosidases (enzyme inhibitors). All antibiotically active compounds of this class of secondary metabolites act on the 30S subunit of the bacterial ribosome by binding to one of at least four sites on the 16S rRNA; there they interfere with translation in distinctly different ways: (1) STR binds tightly to the sugar-phosphate backbone in four different
H 6´ CH2NH2 H3C NHCH3 O 4´ 6´ O 2 2´ OH 1´ Gentamicin C1 2´ NH HO 3´ 4 1´ HN NH2 NH2 GEN-C1 NH=C-NH2 4´ O 2 3´ 4 5 NH2 CHO O NH2 1´ CH3 OH 5´ 3 6 2 O NH2 2´ Streptomycin H3C 3´ HO O 3 6 2´ 5 OH O Spectinomycin HO O 1 NH2 STR OH 1´ 5 HO Kanamycin B 1˝ SPC O 1 6˝ H3C-NH 1˝ O CH OH KAN-B 2 5˝ O 3˝ 1˝ OH 5˝ HO 2˝ OH O 3˝ 4˝ OH O 2˝ 5´ 4˝ NH HO 2 CH3 6˝ OH 2˝ 6´ NH 6´ 6´ CH3 OH CH2NH2 CH2NH 6˝ OH 4´ CH 4˝ 2 3 4´ O Butirosin O HN O Neomycin C HO HO 2 2´ 2˝ OH 2´ 7˝ NH NEO-C BTR HO HO 1˝ 1´ HO HOH C 2 1˝ 2 NH2 4 NH 3´ NHCH3 OH Apramycin H OH 3´ NH 2 8´ 2 4 NH2 2 6´ 2 O APR O 6 O 3 5˝ OH 3 6 O NH-CO-CH-(CH2)2 -NH2 5´ O NH2 O O 5˝ HOH2C O 5 OH 1 2´ HOH2C O 5 OH 1 OH OH 1˝ O 1´ 4˝ 6˝´ 1˝ 2˝ 4˝ HO HN NH 4˝´ CH2NH2 3˝ 2˝ 3 2 2 1˝ OH 3˝ 2˝ O 4 OH O HO 7´ 2 6´ OH OH O O OH 2˝´ 1˝´ NH OH 2 HO 2´ HO 2´ 3´ OH 3˝´ 1´ 7 NH2 O HO 6´ 5 4 O HO NH HO 6 1 OH OH O 2 HO Validamycin A HO 1 6 3 2 HC OH 6´ 3 VAL 4´ HO NH2 CH3 H HN NHCH HN 2 3 6´ 1 O OH 3 HO 4´ OH HO O OH 7 4 O 1 HO 2´ 5´ Hygromycin B OH Fortimicin A O OH 1´ HO HO OH OH 3´ H N 1´ O HO HYG-B FOR-A 2 O OH 2 4 4 O HO O 3 6´ NH2 NH 1´ CH OH OH 2 O H OH 5 Acarbose OH HS OH O NH 2 HO O ACB 2´ OH HO 6 O 1 Mycothiol H3CHN OH OCH3 OH H N-H C-C=O OH 6 4
HO 5 O O
2
NH=C-NH2
3
1
NH 2 OH
OH
NH-CH3 1 4 6 3
HO
4´
2
Figure 19.1 Examples of the chemical structures of aminocyclitol-aminoglycosides (CAGs) and of some related actinomycete metabolites. Some of the major families of CAGs are produced as mixtures of several closely related end products, where the various components are distinguished by adding a capital letter to the trivial name. Acarbose, belonging to a family of products also called amylostatins, and validamycins are secreted actinomycete enzyme inhibitors and have no antibiotic activity. Mycothiol is a nonsecreted primary metabolite occuring in most or all actinobacteria and acting as the detoxifying thiol with a role similar to that of glutathione in other groups of organisms.
462 Table 19.1 Examples of CAGs for which sequence data for complete biosynthetic gene clusters are available.a Aminoglycoside (Family, Complexb)
Streptomycin (STR) Hydroxystreptomycin Spectinomycin (SPC) Neomycin (NEO) Butirosin (BTR) Ribostamycin (RIB) Paromomycin (PAR) Lividomycin (LIV) Kanamycin (KAN) Tobramycin (TOB) Apramycin (APR) Gentamicin (GEN)
Producing organism, Strain no.
STR-related family S. griseus ssp. griseus DSM 40236 S. glaucescens GLA.0 (DSM 40716) S. netropsis DSM 40093 NEO-related family S. fradiae DSM 40063 B. circulans ATCC 21557 S. ribosidificus NRRL B-11466 S. rimosus ssp. paromomycinus NRRL 2455 S. sp. (lividus) CBS 844.73 KAN-related familyc S. kanamyceticus DSM 40500 S. sp. (tenebrarius) DSM 40477 S. sp. (tenebrarius) DSM 40477 M. echinospora DSM 43036
Biosynthetic class c
Accession code
Genes in cluster
Ca-6DOH Ca-6DOH Ca-6DOH
AJ862840 AJ006985 U70376
23 (26–31)d 18
2DOS-GA (Cb1) 2DOS-GA (Cb1) 2DOS-GA (Cb1) 2DOS-GA (Cb1) 2DOS-GA (Cb1)
AJ629247 AB097196 AJ744850 AJ628955 AJ748832
22 25 20 22 23
2DOS-GA (Cb1) 2DOS-GA (Cb1) 2DOS-GA (Cb1) 2DOS-GA (Cb1)
AJ628422 AJ810851 AJ629123 AJ628149
21 21 30 32
Fortimicin (FOR) Fortimicin (FOR) Istamycin (IST) Hygromycin B (HYG-B)
Acarbose (ACB) Acarbose (ACB) Validamycin (VAL) a
FOR-rrelated family M. olivasterospora DSM 43868 Frankia sp. CcI3 S. tenjimariensis ATCC 31603 HYG-B-related family S. hygroscopicus ssp. hygroscopicus DSM 40578 ACB-related family Actinoplanes sp. SE 50/110 S. glaucescens GLA.0 (DSM 40716) S. hygrosc. ssp. limoneus IFO 12704
FOR-type (Ca) FOR-type (Ca) FOR-type (Cb1)
AJ628421 (34)d NC_007777.1 (34)d AJ845083 26
HYG-B-type (Cb1)
AJ628642
22
Cb2-Hex Cb2-Hex Cb2-Hex
Y18523 AM409314 DQ223652
25 24 22
Only the most complete stage of sequencing is given where multiple coverage of the same genomic area is reported. The majority of aminoglycosides designated by a common name are composed of a complex mixture; chemically distinct components in a complex are distinguished by adding capital letters, and in some cases additionally by figures to the name (e.g., gentamicin C1); aminoglycoside names are abbreviated as given below. c For definition see text. d The number of genes clearly belonging to these clusters is still unclear; the for gene cluster in Frankia sp. CcI3 was found by chance in the genome sequence of this organism. S., Streptomyces; Streptoallo, Streptoalloteichus; M., Micromonospora; B., Bacillus; S., Streptomyces; c, completely sequenced; p, partially sequenced; r, resistance gene(s) outside biosynthetic clusters; sp., species; ssp., subspecies. b
463
464
Udo F. Wehmeier and Wolfgang Piepersberg
regions of the 16 rRNA, at nucleotides 13, 526, 915, and 1490, thereby affecting the initial selection and proofreading steps by fixing the 30S subunit in its ram state, which lowers the fidelity of tRNA recognition in the A-site (Carter et al., 2000); (2) SPC binds to helix 34 and inhibits translocation of peptidyl-tRNA from the A- to the P-site (Carter et al., 2000); (3) KAS binds in the path of the mRNA between the P- and the E-sites, blocking initiator tRNA binding and thereby initiation of translation (Schluenzen et al., 2006); (4) the 2DOS-GA group of CAGs (e.g., NEOs, GENs) interact with the A-site portion of 16S rRNA helix 44, disturbing correct codon-anticodon pairing at the essential nucleotides A1492/A-1493 and also inhibiting 30S subunit assembly (Carter et al., 2000; Mehta and Champney, 2002); (5) HYG-B binds to another region in helix 44 controlling codon-anticodon interaction in the A-, P-, and E-sites, by interacting with nucleotides U-1406, C-1496, and U-1498, and inhibiting ribosomal fidelity, translocation, a ribosomal ATPase, and ribosome biogenesis, also on eukaryotic ribosomes (Brodersen et al., 2000; Borovinskaya et al., 2008; McGaha and Champney, 2007). The glucosidase inhibitors target the alpha-1,4-glucoside hydrolase center of alpha-amylases, amylomaltases and similar enzymes with their nonhydrolyzable N-glycosidically linked pseudodisaccharide unit (Brayer et al., 2000; Leemhuis et al., 2004). The recent analysis of the gene clusters for almost all of the well studied CAGs and related cyclitol-containing metabolites (Table 19.1) revealed that their biosynthetic pathways are all based largely on monofunctional enzymes catalyzing single steps in the pathway, in contrast to the multistep enzymology involved in the production of polyketides or non–ribosomal peptides (see respective chapters in this volume). This knowledge has provided access to a more intense study of the biochemistry involved in the biosynthesis of aminoglycosidic compounds, which has been started in a few cases. However, none of the pathways for CAGs has yet been elucidated completely on the basis of enzymology. Pathways for other CAG-like metabolites, such as mycothiol, do not use any biosynthetic concepts or enzymes with close similarity to those involved in CAG biosyntheses (Newton et al., 2006; Piepersberg et al., 2007).
1.1. Basic concepts of CAG biosynthesis Core components in practically all natural products of this group are cyclitol units which become decorated by side groups introduced (1) via modifying steps directly on the cyclitol and (2) by glycosylation with various sugar moieties, which (3) can become further modified by pathway-specific enzymes either before or after glycosyl transfer. This general principal of design can be used to classify the aminoglycosides into biosynthetic classes mostly comprising structurally related families of end products (Table 19.1).
465
Aminoglycoside Biosynthesis
A proposal for the definition of ‘‘pathway formulas’’ classifying the CAG pathways into a general system has been published previously (Piepersberg, 1997). Therein the cyclitol pathways were given a ‘‘C’’ code according to their biochemistry. Two distinct (amino-)cyclitol pathways are used in the initiation of CAG pathways (Fig. 19.2), one based on myo-inositol (Ca pathway), the other on 1-keto-2-deoxy-cylitols (Cb pathways). The primary precursors in both cases are aldosephosphates, D-glucose-6-phosphate in Ca and Cb1, and sedo-heptulose-7-phosphate in Cb2. Pathway Ca is used in the biosynthetic pathways for STR-related CAGs, FORs, and some others of minor importance (Table 19.1, Figs. 19.1 and 19.2). The Ca pathway starts with the two-step formation of myo-inositol in a pathway and is not encoded in the cognate biosynthetic gene clusters. The reason for this is that the two-step biosynthesis of myo-inositol via myo-inositolphosphate (alternatively designated as D-myo-inositol3-phosphate or L-myo-inositol-1-phosphate) occurs by a eukaryotic type L-myo-inositol-1-phosphate synthase (INO1, EC 5.5.1.4) and
Ca HO
OH 2
4 OH
HO
3 5
D-Glucose-6-P Cb1
6
OPO32–
OH 1
L-myo-Inositol-1-P
4 OH HO 3 HO 5
Sedo-Heptulose-7-P
6
2
OH 1 O
2,5-epi-valiolone
2-Deoxy-scyllo-inosose
MOD/GT
2-DOsIA
sIA
Cb2 HO 2 4 3 OH 6 7 5 HO 1 O HO OH
(6DOH)
(2x)
(UDP-NAGA) (6DOH)
STR, SPC, KAS
2-DOS (UDP-NAGA)
IST, FOR
Paromamine
HYG-B APR
NEO, RIB, BUT, PAR, LIV
ACB
VAL
KAN, TOB, GEN
Figure 19.2 Basic CAG pathways. The biosynthetic routes for (amino-)cyclitol and pseudodisaccharide (in case of the paromamine-based and FOR-related ACAGAs) formation are schematically represented in order to classify the aminoglycosides into biosynthetic families. For details, see text. (2DO)sIS, (2-deoxy-)scyllo-inosamine; NAGA, N-acetyl-glucosamine; 6DOH, 6-deoxyhexose component; MOD/GT ¼ modification and glycosylation phase in all pathways. For aminoglycoside product families seeTable19.1.
466
Udo F. Wehmeier and Wolfgang Piepersberg
myo-inositolphosphate phosphatase (IMP, SuhB; EC 3.1.3.25). In contrast to most other bacteria, these are essential metabolic activities in actinomycetes, because all actinobacteria produce mycothiol (the major cellular thiol and redox cocatalyst) as an essential metabolite. Actinobacterial genomes mostly harbor more then one gene, sometimes several genes with either Lmyo-inositol-1-phosphate synthase or inositol monophosphatase signatures. In some CAG gene clusters, however, a putative IMP enzyme for the dephosphorylation of myo-inositolphosphate seems to be encoded. For example, the strO gene in the str/sts-cluster of STR producers encodes a protein with monophosphatase signature; however, since the streptidine pathway involves two dephosphorylation steps, it is not clear at present whether StrO is catalyzing phosphorolysis from L-myo-inositol-1-phosphate (Walker, 1975; Piepersberg et al., 2007). Also, the spcA and forA genes in the respective clusters for SPC and FOR biosynthesis, which also involve a Ca cyclitol pathway, seem to encode IMP enzymes. The reason for this could be that the housekeeping enzyme activity of this enzyme is reduced in the mostly nonvegetative production phases for secondary metabolites to too low levels in these species. To render myo-inositol an aminotransferase substrate for the formation of scyllo-inosamine it has to be oxidized by a myo-inositol 2-dehydrogenase (IDH, EC 1.1.1.18). This enzyme activity, too, is normally not specific for CAG biosynthesis and seems to be encoded by all actinomycete genomes sequenced so far; it normally plays a role in the catabolism of myo-inositol in many organisms. However, in the STR- and SPC-pathways an IDH seems to be encoded by the respective gene clusters (StrI/StsB, SpcB/ SpcH) and a second cyclitol oxidase, a 1-aminocyclitol 3-dehydrogenase, prepares the cyclitol precursor later for a second transamination step. It was proven by us recently that in the FOR-producer the gene forG encodes an IDH and that the gene is essential for FOR production (see Section 2.9). In the Cb pathways the C6- and C7-cyclitols (Cb1 started by 2-deoxyscyllo-inosose synthase [see Chapter 20]; Cb2 started by 2-epi-5-epi-valiolone synthase [Stratmann et al., 1999]), being the precursors of e.g., 2-deoxystreptamine in the 2DOS-CAGs or of valienamine in the acarboserelated metabolites, are synthesized by enzymes (‘‘C-enzymes,’’ such as NeoC, KanC, AcbC) structurally closely related to and following the same mechanism as is used by dehydroquinate synthase (DHQS, EC 4.6.1.3). These enzymes are NADþ-dependent, cyclizing phosphate lyases and catalyze intramolecular aldol condensations on aldosephosphates, yielding nonphosphorylated 1-keto-2-deoxycyclitols. The Cb pathways immediately yield ketocyclitols which can be used directly as aminotransferase substrates. Thus the basic concept of CAG formation can be summarized as follows: (1) single-step enzymes—that is, enzymes with only one reaction centre, and mostly derived from sugar and cyclitol metabolism—successively activate, modify, and glycosidically link sugar precursors; (2) a second phase of decorating modification frequently follows after oligomerization; (3) the
Aminoglycoside Biosynthesis
467
distribution of modification phases over the pathway varies between biosynthetic classes; and (4) cyclitol amination is a common principle in a majority of CAGs, normally catalyzed by unusual L-glutamine–dependent cyclitol aminotransferases (see description of StsC in Section 2.6). These biosynthetic concepts are similarly found in the quite variable oligosaccharidic building blocks of bacterial heteropolysaccharides, normally used as cell wall components or extracellular surface material. Therefore, anabolic cell wall metabolism might be the evolutionary and ecological (cell protection) source of CAGs (Piepersberg, 2001).
1.2. Key to the biosynthetic classes of CAGs 1. Ca-6DOH: The biosynthesis of these pseudodi- or pseudotrisaccharides is based on the formation of a cyclitol unit via the Ca pathway (streptidine in STR; bluensidine in bluensomycin; actinamine in SPC; unmodified myo-inositol in KAS) followed by a glycosidic attachment of a preformed 6-deoxyhexose (6DOH) moiety. Most modification steps occur on the monomer level. In KAS the cyclitol becomes converted to D-chiro-inositol after having been glycosylated. For the STRs, biosynthetic enzymology has been studied to a considerable extent (see Section 2.1–2.8), whereas for the SPCs and KAS only a few data are available. 2. 2DOS-GA (Cb1): The core biosynthetic design of this largest and pharmaceutically most interesting group of CAGs is based on the formation, via the Cb1-pathway, of the 2-deoxydiaminocyclitol 2DOS from scyllo-inosose and its 4-glycosylation with D-glucosamine (GA), forming the characteristic intermediate paromamine (Fig. 19.2). The modifications on subunits are performed on both the monomer and oligomer levels; for example, various modifications important for the properties of the final products, such as transaminations, methylations, and epimerization, occur during the late pathways on the oligosaccharidic intermediates. The end products are pseudotri- or pseudotetra-saccharides; APR deviates structurally from this pattern, but nevertheless clearly is a member of this group. The biosynthetic route for GENs has been studied in detail by collecting a set of blocked mutants and studying the accumulation of intermediates in them (Kase et al., 1982). Biosynthetic enzymology has been studied to some extent for some of the NEO-related compounds, to a lesser extent, for the KANs/GENs, and not at all for APR. In the NEOfamily paromamine becomes 60 -transaminated and 5-ribosylated forming the pseudotrisaccharidic RIB, an antibiotically active end product itself (Table 19.1). In the BTR-pathway, RIB becomes 1-aminoacylated with 2-hydroxy-4-aminobutyric acid. In NEO-, PAR-, and LIV-producers RIB becomes further glucosaminylated in the 300 -position and modified in this fourth glycosidic moiety. In the KAN/GEN-family paromamine is
468
Udo F. Wehmeier and Wolfgang Piepersberg
6-glycosylated by neutral sugars, either a C6-pyranose (KAN) or a C5-pyranose (GEN). These pseudotrisaccharidic precursors are 60 - and 300 -transaminated and can be modified further by 300 -N- and 400 -C-methylation steps. In the producers of GEN-related CAGs a quite complicated, branching late pathway, characterized by 60 -C-methylation for only part of the pool of intermediates, 30 ,40 -didehydroxylation, 60 -epimerization, and 60 -N-methylation, creates a complex of related GEN products varying in proportion between individual producer strains (Piepersberg et al., 2007). Another unusual situation exists in the producers of the so-called nebramycin complex, to which TOB, a 30 -dehydroxy-KAN-B, and APR belong, though the latter is a single-substituted 2DOS derivative (Fig. 19.1). We and others have studied the genetics of TOB/APRbiosynthesis in two different organisms, S. sp. ‘‘tenebrarius’’ DSM 40477 (Table 19.1) and Streptoalloteichus hindustanus DSM 44523 (accession codes AJ875019 and AB103327). In both species, there are two independent tob- and apr-clusters, both encoding an almost complete pathway of their own; the TOB-pathway is equivalent to that of KAN-B. However, the two genes necessary for the 30 -dehydroxylation of KAN-B are located in the apr-cluster (aprD3, aprD4 genes), and this modification is shared between the two pathways (Piepersberg et al., 2007). 3. HYG-B-type (Cb1): Biosynthesis of the cyclitol in the third unique pathway is again based on the Cb1 product 2DOS. However, formation of the pseudotrisaccharidic end product principally deviates from the 2DOS-GA type by the glycosidic attachment of a neutral hexose to the 5-position of 2DOS and of an aminoheptose moiety via an unusual orthoester bond to the 20 - and 30 -positions of the hexose (cf. Fig. 19.1). The modification steps have to be assumed to occur on both the monomer and the oligomer levels; however, biosynthetic enzymes have not been studied in vitro. 4. FOR-type (Ca or Cb1): The biosynthesis is based on the formation of a monoamino cyclitol unit, scyllo-inosamine in FORs, and 2-deoxyscyllo-inosamine in ISTs, from either myo-inositolphosphate (Ca route) or scyllo-inosose (Cb1 route) and glycosidic attachment of a D-glucosamine moiety. The modification of subunits is achieved mostly on the condensed level of these pseudodisaccharides, whereby the cyclitol also becomes highly decorated with additional side groups (see the structure of FOR-A in Fig. 19.1). A reasonable picture of the complicated FOR- and IST-pathways comes from structural analyzes of intermediates accumulated in a series of mutants (Odakura et al., 1984). A significant paralleling between the FOR- and GEN-pathways, evident from the use of several common biosynthetic steps for 30 ,40 dehydroxylation and 60 -C-methylation, is reflected by a number of unique genes with very high DNA homology between the for- and gen-clusters (for details, see Piepersberg et al., 2007).
Aminoglycoside Biosynthesis
469
5. Cb2-Hex: The biosynthesis of these malto-oligosaccharide analogues is based on the formation of a C-7 cyclitol unit (valienol, valiolol, valienamine) via the Cb2 pathway and glycosidic attachment of (6-deoxy)hexose units; they are malto-oligosaccharide analogues, that is, linear chains of up to six (pseudo-)saccharidic units linked by glycosidic bonds structurally mimicking a-1,4-glucosides. Some enzymes involved in their biosynthesis and probable cyclic conversion have been studied (see Section 3).
2. Some Key Enzymes in the Biosyntheses of Aminoglycoside Antibiotics Some enzymology involved in key steps of the STR, NEO, KAN, and ACB-pathways investigated by us are described in subsequent sections; the other enzymes important for the biosyntheses of the 2DOS-CGA compounds BTR and NEO are described in Chapter 20.
2.1. Investigation of a dTDP-6-deoxyhexose pathway in STR-producing Streptomyces griseus subsp. griseus DSM 40236 In our analyses of the STR biosynthetic gene cluster and its encoded enzymatic tool box we found that four genes, strDEL and strM, organized in the two transcription units strDEL and strNB2M, had about equally high similarity to the dTDP-L-rhamnose biosynthetic genes in the rfb-locus of enterobacteria, that is, rfbA (rmlA), rfbB (rmlB), rfbC (rmlC), and rfbD (rmlD) from Gram-negative bacteria producing a lipopolysaccharide containing L-rhamnose (Reeves, 1993). These are equivalent to many genes occurring in all groups of bacteria and are mostly involved in the biosynthesis of extracellular polysaccharides; for example, Escherichia coli harbors a second set of rfbA,B-related genes, rffH and rffG, involved in the synthesis of enterobacterial common antigen. The encoded proteins have the following enzyme activities: RfbA (RmlA) is the dTDP-glucose synthase (glucose-1phosphate thymidylyltransferase; EC 2.7.7.24); RfbB (RmlB), the dTDP-glucose 4,6-dehydratase (EC 4.2.1.46); RfbC (RmlC), the dTDP4-keto-6-deoxyglucose (dTDP-6-deoxy-D-xylo-4-hexulose) 3,5-epimerase (EC 5.1.3.13); and RfbD (RmlD), the dTDP-L-rhamnose synthase (dTDP-6-deoxy-L-lyxo-4-hexulose reductase; EC 1.1.1.133). Grisebach and collaborators had first described a dTDP-hexose pathway involved in STR biosynthesis in S. griseus subsp. griseus N2-3-11 (equivalent to wildtype strain ATCC 10137, DSM 40236) (Ortmann et al., 1979; Grisebach, 1978). This was postulated to comprise the first three of the four steps of the dTDP-L-rhamnose pathway, forming dTDP-4-keto-L-rhamnose, and
470
Udo F. Wehmeier and Wolfgang Piepersberg
finally its reductive conversion to dTDP-dihydrostreptose. The final step should be similar to dTDP-L-rhamnose synthesis and was postulated to involve, besides reduction at C-5/C-6, a C-chain reorganization, such that C-3 of the hexose is branched out from the linear chain and, forming a furanosidic ring sugar with two C1-branches at the C-3 and C-4 atoms (cf. Fig. 19.1; positions 30 and 40 in the formula of STR). In order to correlate these earlier findings with the genetic record as it became evident from the str/sts-cluster, we investigated the enzyme activities of the heterologously produced proteins StrD,E,M,L in comparison to the well studied enzymes RfbA,B,C,D from Gram-negative bacteria; the dTDP-activated sugars were identified and their accumulation quantitatively measured by HPLC.
2.2. dTDP-D-glucose synthase (StrD, RfbA) This enzyme was tested either (1) in 500-ml assay volume at pH 8.0 and 37 containing 50 mM Tris/HCl buffer, 10 mM MgCl2, dTTP 2 mM, a-Dglucose-1-phosphate 10 mM, 170 ml PPi-reagent (Sigma Deisenhofen, Germany), enzyme preparations at an activity in the range of 1 to 100 nkat; or (2) in 300-ml final volumes with the same composition but with the addition of 35 nkat inorganic pyrophosphatase instead of PPi-reagent. The reaction was monitored in (1) by photometrically measuring the consumption of NADH at 340 nm; and in (2) 20-ml samples were withdrawn from 150-ml reaction mixtures, which were generally taken after 30, 45, or 60 min, and in which reactions were stopped by boiling for 1 min, and insoluble material was separated by centrifugation, and then subjected to HPLC analysis (Beckmann Instruments, Munich, Germany; pump module 125, autosampler 502, UV detector 166, radioisotope detector 171); nucleotide-activated sugars were measured at 260 nm for unlabeled compounds or on a radioisotope detector for 14C-labeled sugars. Chromatography was run on a reversed-phase column (Eurospher 100 C18, Knauer, Berlin, Germany; elution by 0 to 40% acetonitrile gradient). The background activity for dTDP-glucose synthase was surprisingly low in STRproducing S. griseus. StrD could be overexpressed to a considerable extent in Streptomyces lividans and E. coli; the product, dTDP-D-glucose, eluted at 35.9 min from the HPLC. Like the standard enzyme RfbA, StrD had maximal substrate specificities for dTTP and D-glucose-1-phosphate; only with the substrate combinations UTP/D-glucose-1-phosphate, dTTP/Dglucosamine-1-phosphate, and UTP/N-acetyl-D-glucosamine-1-phosphate could minor activities also be detected. RfbA and StrD are both feedback inhibited by dTDP-L-rhamnose; e.g., in reaction assays containing 10 mM and 2.5 mM of the substrates glucose-1-phosphate and dTTP, respectively, 445 mM of dTDP-L-rhamnose inhibited both enzymes to 71 to 72% residual activity.
Aminoglycoside Biosynthesis
471
2.3. dTDP-D-glucose 4,6-dehydratase (StrE, RfbB) These enzymes were measured in similar assays as in (1.b): 300-ml test volumes contained 50 mM Tris/HCl buffer (pH 7.5), 2 mM dTDP-glucose, and in the range of 1 to 100 nkat of enzyme activity; for the streptomycete enzyme sources the buffer concentration was enhanced to 150 mM and 1.5 mM NADþ was added. For detection of substrates/ products HPLC was used (see Section 2.2); dTDP-4-keto-6-deoxyglucose eluted at 37.8 min. The StrE protein turned out to be a dTDP-glucose 4,6dehydratase with very similar properties to RfbD, with the exception that StrE did not contain firmly bound NADþ as a prosthetic group, as is the case for RfbB. The 4,6-dehydratase background activities were quite low in S. griseus N2-3-11 (vegetative phase) and S. lividans TK23. StrE could be overexpressed in S. lividans, but not in E. coli. StrD did not convert other activated sugars, such as dUDP-D-glucose, UDP-D-glucose, or CDP-D-glucose.
2.4. dTDP-4-6-glucose 3,5-epimerase (StrM, RfbC) The 3,5-epimerase activity was assayed as a coupled reaction together with the subsequent dTDP-L-rhamnose synthase because it turned out that the equilibrium of the epimerization lies fully on the substrate side and no reaction could be detected in the absence of a product-consuming reaction. Test volumes of 300 ml contained 50 mM Tris/HCl buffer pH 7.5, 2 mM dTDP-4-keto-6-deoxyglucose, 2.5 mM NADPH, 35 nkat RfbD (nonlimiting enzyme activity), and variable concentrations of StrM or RfbC preparations. The 3,5-epimerase activity could be measured both photometrically by NADPH consumption and in HPLC separations, where the dTDP-L-rhamnose could be detected and eluted at 35.8 min. In both assay systems, identical values for the specific activity of StrM/RfbC were measured.
2.5. dTDP-L-rhamnose synthase (StrL, RfbD) This enzyme was assayed in the same test system as for the dTDP-4-6glucose 3,5-epimerase (see Section 2.4) with the difference that the content of StrM (RfbC) was fixed to 35 nkat and the activity of the dTDP-Lrhamnose synthase StrL (RfbD) was varied. Both StrL and RfbD could be highly overexpressed over the background activities of their donor strains and in E. coli BL21 and S. lividans TK23, respectively, and they have identical substrate and product specificities. Both enzymes are inhibited by their product dTDP-L-rhamnose; e.g., residual activity is 50 to 55% at a product concentration of 380 mM. Therefore, StrL clearly is a dTDP-L-rhamnose synthase and has no dTDP-dihydrostreptose synthase activity. To further
472
Udo F. Wehmeier and Wolfgang Piepersberg
exclude production of a different product (dTDP-L-dihydrostreptose) by StrL this enzyme was enriched from a protein preparation of the overproducing strain of S. lividans TK23 and tested in the presence of a RfbDfree RfbC preparation obtained by DEAE cellulose chromatography from the RfbC-overproducing strain of E. coli BL21. The nucleotide-activated sugar product was purified and analyzed by NMR as described elsewhere (Elling et al., 2005) and clearly was dTDP-L-rhamnose. Also, if [14C]dTDP-4-keto-6-deoxyglucose (prepared from 14C-a-D-glucose-1-phosphate by the reactions catalyzed by RfbA and RfbB; see Section 2.2–2.3) was incubated with cell-free extracts of S. griseus N2-3-11 from various culture states and for various incubation times using the same test conditions only [14C]-dTDP-L-rhamnose was yielded in all cases. Thus, no evidence for the presence of a dTDP-L-dihydrostreptose synthase with the same properties as a dTDP-L-rhamnose synthase (Grisebach, 1978; Wahl and Grisebach, 1979) could be detected in STR-producing S. griseus.
2.6. L-glutamine:scyllo-inosose aminotransferase StsC (EC 2.6.1.50) from Streptomyces griseus subsp. griseus DSM 40236 During the pioneering work on streptidine biosynthesis by Walker and collaborators (see overview in Walker, 1975a), the two aminotransferase (AT) activities needed for the introduction of two amino groups into the cyclitol moiety were identified. It turned out that the first step was dependent on L-glutamine as an amino donor and that unusually the alpha amino group of this amino acid was the donor group transferred, whereas in the second step L-alanine was the donor (Walker, 1975b,c). The first step, catalyzed by L-glutamine:scyllo-inosose (2,4,6/3,5-pentahydroxycyclohexanone) AT (EC 2.6.1.50), was correlated with a particular enzyme protein and gene product (StsC) only after most of the DNA sequence of the str/stscluster from the producer S. griseus and methods for overproduction of genetically engineered streptomycete genes became available (Ahlert et al., 1997; Hopwood et al., 1985). Since the str/sts-cluster contains three AT genes, strS, stsA, and stsC, identification of the first-step cyclitol AT had to include all three encoded enzymes. For this purpose, the three genes were subcloned in expression vectors for both E. coli BL21(DE3) (employing vectors pET11a, pET16b) and Streptomyces lividans (pIJ6021) (Takano et al., 1995), and introduced by transformation and overexpressed in both host systems. Except for low amounts of StsA, only insoluble inclusion bodies of all three proteins were obtained in E. coli. However, reasonable amounts of soluble protein of all three enzymes were yielded in the streptomycete host. In our laboratory, the three in vitro test systems described by Walker and coworkers (Walker, 1975b; Lucher et al., 1989) were used in all
Aminoglycoside Biosynthesis
473
investigations of the StsC enzyme (Ahlert et al., 1997): (1) for the qualitative measurement of this AT the monoamino product scyllo-inosamine (1-amino-1-deoxy-scyllo-inositol) and of the alpha-ketoglutaramate (2-oxoglutaramate) byproduct of the forward reaction were measured, when 2-deoxy-scyllo-inosose and L-glutamine were used as substrates; (2) for higher sensitivity the radioactive exchange reaction between [14C]labeled scyllo-inosamine and nonlabeled scyllo-inosose (backward reaction) was employed; (3) the forward reaction was also measured by use of [14C]scyllo-inosose as acceptor substrate in a test system similar to the first one, where the product, [14C]-labeled scyllo-inosamine was separated from the substrate by cation-exchange chromatography on Dowex 50W-X8. Later it was found that all the aminotransferases involved in the biosynthesis of the diaminocyclitol 2DOS (1-amino-1,2-dideoxy-scyllo-inositol; see Section 1.1 and Fig. 19.2) use the same mechanism as StsC and, based on primary structure similarity, are in the same subfamily of the aminotransferase I–II superfamily (Lucher et al., 1989; Piepersberg et al., 2007).
2.7. L-arginine:scyllo-inosamine-phosphate amidinotransferase StrB1 from Streptomyces griseus subsp. griseus DSM 40236 (ATCC 10137) During the pioneering work on streptidine biosynthesis by Walker and collaborators (Walker, 1975a,d) the two amidinotransferase activities involved in this branch of the STR pathway were first identified and in vitro test systems described. Later work on these enzymes always relied on the nonspecific test system developed by these authors, which uses hydroxylamine as acceptor and L-arginine as donor substrates and yields hydroxyguanidine as the product. Later a well characterized mutant strain (SD141) blocked in the first step amidinotransferase activity was also isolated from the wildtype strain of Streptomyces griseus subsp. griseus ATCC 10137 by others (Ohnuki et al., 1985). This mutant was subsequently used to identify the encoding gene, strB1, on cloned DNA from the same organism. The DNA sequence and regulation of transcriptional activity of this and the surrounding genes became available in genetic studies (Distler et al., 1987, 1992). More recently the crystal structure of the StrB1 protein was also determined (Fritsche et al., 1998).
2.8. Streptomycin-phosphate phosphatase StrK (EC 3.1.3.39) from Streptomyces griseus subsp. griseus DSM 40236 (ATCC 10137) The gene clusters for the production of STRs, PAR, LIV, and APR each encode a gene, strK, parZ, livZ, and aprZ, for an extracellular phosphatase homologous to and perfectly matching the domain structure of alkaline
474
Udo F. Wehmeier and Wolfgang Piepersberg
phosphatases (EC 3.1.3.39, alkPPc superfamily, pfam00245) (Mansouri et al., 1991). The supernatants of S. griseus DSM 40236 strain N2-3-11, fermented in 10 l of solid-free TSB (Oxoid, Hamburg, Germany) as the production medium, was tested after various times of culturing for STRphosphate phosphatase activity in the following way: assays contained in 100-ml volumes 30 mM Tris/HC1, pH 8.0, 10 mM MgC12, 40 to 60 mM substrate, and variable quantities of supernatants cleared by centrifugation (or enzyme preparations); incubation was at 30 . Hydrolysis was measured by the phosphocellulose paper-binding assay (Haas and Dowding, 1975) in 10-ml aliquots taken at various times from the above incubation mixtures. As specific substrates [32P]-labeled STR-6-phosphate and STR-300 -phosphate were prepared by use of the STR-resistance phosphotransferases AphD (APH(6)) and AphE (APH(300 )), both encoded in the same producer strain S. griseus N2-3-11, expressed from plasmids pJDM1 and pJDM40 as described (Distler and Piepersberg, 1985; Distler et al., 1985; Heinzel et al., 1988). After incubation these were separated from adenine nucleotides by passage over Dowex 1 8 (Serva, Heidelberg, FRG) and yielded specific radioactivities in the range of 10 to 20 mCi/m mol. STR-phosphate-specific phosphatase was partially purified from culture supernatants of S. griseus N2-3-11 by 70% ammonium sulphate precipitation followed by octyl-sepharose (Pharmacia, Freiburg, FRG) column chromatography (the enzyme was bound in the presence of 30% ammonium sulphate and was eluted with salt-free buffer). Also, StrK was cloned into Streptomyces vector pIJ702 (Katz et al., 1983) and expressed from the promoter of the mel gene in pKMWK1/S. lividans 66 strain TK23, then tested in its supernatant in the same way as above. STR-phosphate phosphatase activity first appeared 25 h after inoculation in the culture supernatant of S. griseus N2-3-11 and preceded the first appearance of STR, then paralleling the accumulation of the antibiotic and an increase of the pH to 8.5 in the medium. Maximum relative activity of STR-6-phosphate phosphatase was reached at a value of about 85% hydrolysis in a standard assay (40 ml supernatant; incubation time 30 min). The hydrolysis of STR-6-phosphate was about sixfold faster than that of STR-300 -phosphate. The enzyme was inactivated by temperatures above 60 and pH values below 7.0. Obviously, only very little StrK protein was made, since after enrichment no protein band of the expected size could be detected in polyacrylamide gels. The same enzyme in comparable relative activities was secreted into culture supernatants of S. lividans/pKMWK1 (strK). In contrast, the culture of the control strain (S. lividans/pIJ702) was free of any comparable phosphatase activity (Mansouri et al., 1991). Therefore, StrK was interpreted to be an alkaline phosphatase specific for STR phosphates (EC 3.1.3.39).
Aminoglycoside Biosynthesis
475
2.9. Myo-inositol-2-dedydrogenase (IDH; scyllo-inosose synthase) ForG (EC 1.1.1.18) from Micromonospora olivasterospora DSM 43868 In the FOR-production gene clusters (Table 19.1) a gene, forG, was found to encode a protein with highest similarity to possible IDH candidates encoded by the genomes of S. coelicolor A3(2) (e.g., 50% aa identity to SCO6255) and other actinomycetes. To test for this possibility we cloned, expressed, and assayed the ForG protein and knocked-out the forG-gene in the producer strain (Schuermann, B., Wehmeier, U. F., and Piepersberg, W., unpublished): The gene was amplified by PCR, using primers that introduced useful single restriction sites at both ends of the reading frame, cloned into various plasmid vectors and expression strains of E. coli and S. lividans 66, which were tested for overproduction of the soluble ForG protein. This goal could be achieved best in E. coli BL21(DE)-Rosetta/ pBSW3-forG (vector pET16b; Novagen, Darmstadt, Germany; forG-ORF N-terminally elongated by His-tag) by demonstrating a new band of approximately 40 kDa (calculated MW of native protein 36.8 kDa) in the supernatant of the crude extract after induction on protein gels (Scha¨gger and von Jagow, 1987). Preparation of enriched His-tag-ForG was achieved by Ni-NTA affinity chromatography. The ForG protein was tested for IDH activity by either (1) monitoring the absorption at 340 nm in 1-ml assay volumes containing 40 mM myo-inositol, 0.5 mM NADþ, 100 mM Tris/ HCl (pH 9.0), and various concentrations of enzyme preparations; or (2) by measuring the absorption at 570 nm in a more sensitive MTT-test (according to Lengeler and Lin, 1972) consisting of 600 ml mix A (3.3 ml 1 M Tris/ HCl, pH 9; 0.7 ml MTT (¼ (3-[4,5-dimethylthiazol-2-yl])-2,5-diphenyltetrazoliumbromide, 0.5 mg/ml); 0.02 ml Triton X-100; 3 ml H2O), 100 ml 0.4 M myo-inositol, 10 ml 0.5 mM NADþ, 100 ml 5-methylphenaziniummethosulfate (1 mg/ml), and 10 to 40 ml enzyme preparation. As controls, assays containing 0.1 U of commercial IDH (from Sigma-Aldrich, Steinheim, Germany) were also run. For direct detection and quantitation of newly formed scyllo-inosose, ion chromatography (DIONEX DX-500 system with electrochemical detector, and column material CarboPac MA1, and Chromelion 6.2 software, Dionex, Idstein, Germany) was employed. The results are summarized as follows: (1) ForG expression significantly enhanced background IDH activity in both E. coli and S. lividans (up to 20-fold); (2) an enrichment factor of 20-fold was again achieved after Ni-NTA chromatography; and (3) the ForG product was identified as scyllo-inosose by ion chromatography. Also, forG knock-out mutants were constructed by replacement of a 200-bp segment internal to the forG gene by the omega-aacC4 APR-resistance cassette (BlondeletRounault et al., 1997) in plasmid pBSW2 and by its introduction by transformation into protoplasts of the FOR-producer M. olivasterospora
476
Udo F. Wehmeier and Wolfgang Piepersberg
DSM 43868 according to a published method (Hasegawa et al., 1991). APR-resistant transformants generated by double crossing over with the native forG gene could be selected in which the native forG-gene had been knocked out, as proven by CR-experiments. These mutants no longer produced FOR (compared to the wildtype strain DSM 43868) as could be measured by lack of inhibition zone formation around agar plugs cut from fully grown plate cultures on a production medium (ATCC no. 5) and placed on fresh plates inoculated with spores of Bacillus subtilis as a tester strain. Therefore, the forG-gene is essential for FOR-production.
2.10. Glycosyltransferases involved in CAG pathways The glycosyltransferases (GTs) involved in the STR-related (Ca-6DOH) biosynthetic pathways are uncharacterized and practically nonidentified among the gene products of the respective gene clusters (str/sts, spc, and kas). For instance, in the case of the STR pathway of S. griseus, for which two GTs are necessary, StsF is the only candidate protein with some distant similarity to known GTs. The SpcF and KasA proteins are more reliable candidate GTs for the single glycosyltransfer steps involved in the SPC- and KAS-pathways, respectively (Piepersberget al., 2007). In this respect, better data are available for the biosyntheses of 2DOS-containing and related CAGs (see also Chapter 20). These are mostly Cb1 pathways (a few exceptions are made via the Ca pathway, e.g., FOR), in which an enzyme family of GTs, the strongly related ‘‘M-enzymes’’ (e.g., KanM, NeoM, ForM; glycosyltransferases group 1; data base accession: InterPro: IPR001296, pfam PF00534, Glycos_transf_1; e.g., KanM belonging to the cluster COG0438 of RfaG-like GTs), catalyze the first attachment of a sugar residue, 2-NAc-D-glucosaminyl, to position 4 of an aminocyclitol unit. The aminocyclitol is the diaminocyclitol 2DOS in the NEO-, KAN-, and HYG-B-related families; however, it can also be a monoaminocyclitol, scyllo-inosamine or 2-deoxy-scyllo-inosamine, as in the FOR- and ISTpathways, respectively (see Section 1.1). Several members of the ‘‘M’’enzymes and of the deacetylases, deacetylating NAc-glucosaminyl moieties are subsequently used in the respective pathways. Interestingly, the second N-acetylglucosaminyltransferase in the NEO-type pathways, NeoF, and related ‘‘F’’-enzymes in the BTR-, PAR-, and LIV-pathways, are not members of the ‘‘M’’-type subfamily of group 1 GTs, whereas the second GTs used in the KAN/GEN-type pathways (e.g., KanM2, are, though they are transferases for glucosyl- or xylosyl-residues). From the KAN and NEO pathways the following gene products have been studied in a comparative investigation in our laboratory and tested for enzymatic activity (Mandt, C., Wehmeier, U. F., and Piepersberg, W., unpublished data). Generally, for the genes kanM1, kanN, and kanM2 from the KAN producer Streptomyces kanamyceticus DSM 40500, the following cloning
Aminoglycoside Biosynthesis
477
strategy was employed. Genes were amplified from the genomic DNA of the wildtype CAG-producing strains as their ORFs by PCR using primers introducing unique restriction sites at both ends and ATG start codons, where GTG start codons are naturally present. PCR fragments were cloned into suitable E. coli selection plasmids, such as pUCPU21 (Wehmeier, U. F., unpublished), screened on X-Gal in E. coli DH5a and checked by sequencing. The respective genes were then subcloned into suitable E. coli/ Streptomyces shuttle and expression vectors, such as pUWL201PW (Doumith et al., 2000) or pJOE2775 (Khalameyzer et al., 1999), or into Streptomyces vectors, such as pMACP (Wehmeier, U. F., unpublished), which can be transferred by conjugation from E. coli ET12567/pUZ8002 to Streptomyces spp. and allow expression there. For comparative purposes, the same cloning and expression strategy was used for neoM, neoF, and neoD, from the NEO producer S. fradiae DSM 40063.
2.11. KanM1, KanM2, and KanN of S. kanamyceticus DSM 40500 KanM1 and KanM2 had been postulated to be the first and second step GTs forming a pseudotrisaccharidic intermediate (6-O-Glc-paromamine) via 4-O-NAc-D-glucosaminylation (20 -NAc-paromamine synthase) and 6-OD-glucosylation of 2DOS, using UDP-2-NAc-D-glucosamine and UDPD-glucose as donor substrates, respectively. KanN was assumed to be a monofunctional deacetylase deacetylating 20 -NAc-paromamine in the KAN-pathway; in contrast, the related deacetylase, NeoD, was shown to be a bifunctional N-deacetylase deacetylating both NAc-D-glucosaminyl residues during the formation of 6000 -hydroxy-NEO-C, that is, in 20 -NAc-paromamine, and in 2000 -NAc-6000 -hydroxy-NEO-C (Lewellyn and Spencer, 2006; Yokoyama et al., 2008). Structurally, both KanN and NeoD are members of the LmbE-related protein family (COG2120; pfam02585, PIG-L, GlcNAc-PI de-N-acetylase family). KanM1, KanN, NeoM, NeoF, and NeoD from the producer strains S. kanamyceticus and S. fradiae could be actively overexpressed, whereas KanM2 could only be expressed as insoluble protein aggregates and did not show enzymatic activity under the tested conditions. For testing the KanM1 and NeoM activities in cell-free extracts of the expression strains S. lividans 66 TK64/pCM201PW-kanM1 and S. lividans TK23/pCMW-neoM as compared to the background activity in the recipient strain plus vector plasmid (S. lividans TK23/pUWL201PW), assays of 300 ml of total volume contained 50 mM Tris/HCl, 10 mM MgCl2, 2 mM UDP-2-NAc-D-glucosamine, 1 mM 2DOS, and 30 ml of cell-free extract, pH 7.5 by incubation at 37 for up to 6 h. The result clearly revealed a conversion of 2DOS (RF 0.53) and UDP-NAc-D-glucosamine to 20 -NAcparomamine (RF 0.59); paromamine had an RF of 0.22 in the same TLC separation system (TLC plates were Silica Gel F254, Merck, Darmstadt,
478
Udo F. Wehmeier and Wolfgang Piepersberg
Germany; running solution was 50 mM KH2PO4); spots were visualized after development of plates by spraying with ninhydrin-solution and subsequent heating with a heat gun. Similarly, NeoF was tested for the third GT activity of the NEOpathway (2-NAc-glucosaminyltransferases II, 300 -NAc-glucosaminylation; cf. structure of NEO-C in Fig. 19.1) in extracts of S. lividans TK23/ pCMW-neoF with ribostamycin (5-ribosylparomamine; RF 0.40) as acceptor and UDP-NAc-D-glucosamine as donor substrates. The result was the detection of a new spot (RF 0.48; interpreted to be 2000 -NAcNEO-C), in the TLC system used (run in a solution of methanol/chloroform/12.5 % (w/v) ammonia in water ¼ 1/0.2/1; visualization of spots was as for NeoM assays). The product obtained in the NeoF assays was used as substrate in deacetylation assays with KanN and NeoD. The deacetylating activities of the proteins KanN and NeoD were tested by adding samples of cell-free extracts of the expression strain E. coli DH5a/ pCMJOE-kanD to various GT-assays, after being fully converted. Enzyme assays were incubated overnight at 37 in a total volume of 300 ml containing 50 mM Tris/HCl, pH 7.6, 10 mM MgCl2, 60 ml of KanM- or NeoFassay and 30 ml of cell-free supernatant with enriched NeoD. Aliquots of 2 ml of this enzyme assay were spotted on TLC plates (silica gel F254, Merck, Darmstadt, Germany) run in a solution of 50 mM KH2PO4, and visualized by spraying with ninhydrin-solution and subsequent heating with a heat gun. NeoD hydrolyzed both acetylated substrates to paromamine and NEO-C, respectively, thereby proving to be at least a bifunctional enzyme with a broader substrate range. KanN deacetylated only 20 -NAc-paromamine, but not 2000 -NAc-NEO-C, proving it to be a monofunctional deacetylase with a more restricted substrate range relative to NeoD. Kudo and Eguchi and collaborators recently published similar data for the same set of glycosyltransferase/deacetylase enzymes from the NEO-pathway (Yokoyama et al., 2008; see Chapter 20 in this volume).
3. Acarbose and Related Metabolites Acarbose (ACB; Fig. 19.1) is a pseudotetrasaccharide composed of the C7-cyclitol valienamine, 4,6-dideoxyglucose and maltose that is found, together with higher homologues (i.e., ACB-containing metabolites elongated up to 30 sugar residues bound to the maltose moiety and/or at C4 of the cyclitol; see Fig. 19.1) in the culture medium of Actinoplanes sp. SE50/110 when grown on starch or malto-oligosaccharides (reviewed in Wehmeier and Piepersberg, 2004). Similar secondary metabolites seem to be made by a wide range of bacteria, including nonactinomycetes (Mahmud et al., 2007). ACB is produced industrially using developed strains of Actinoplanes sp. SE50/110,
Aminoglycoside Biosynthesis
479
and it is used pharmaceutically (Glucobay/Precose) in the treatment of diabetes patients, to slow down the intestinal release of glucose. The ACB gene cluster from Actinoplanes sp. SE50/110 was identified and sequenced (Wehmeier, 2003; Wehmeier and Piepersberg, 2004; see Table 19.1). The 25 known acb genes from the producer strain Actinoplanes sp. SE50/110 encode various functions, including biosynthesis of a 6-deoxyhexose (6DOH) and a C7-cyclitol (valienol; a Cb2 product), intra- and extra-cellular anabolism and catabolism of alpha-1,4-glucosides, and uptake and export of (oligo)-saccharides. Recently, a second ACB biosynthetic gene cluster from Streptomyces glaucescens (gac cluster) was identified and sequenced (AM409314) (Rockser and Wehmeier, 2008). The differences between the set of encoded proteins in the acb and gac gene clusters indicate that (1) there is a major difference between the routes for C7-cyclitol formation (see Section 3.1) and (2) that a homologue of the acarviosyltransferase (AcbD) (see Section 3.2.1), an important enzyme in the extracellular metabolism of ACB, seems to be lacking in S. glaucescens GLA.0. This indicates not only that the latter strain produces a different metabolite spectrum compared to Actinoplanes sp. SE50/ 110, but also that the gac cluster encodes exporters, extracellular and ACBinsensitive starch-degrading enzymes, an ACB-specific importer, an intracellular amylomaltase, and an ACB kinase. We postulate that all these findings suggest a function of ACB and related compounds as a carbophor, that is, as an extracellular trap for glucose or malto-oligosaccharides, which, when attached to it, can only be imported and metabolically used by the various molecular tools provided by the acb or gac clusters and maybe its analogues, such as the val cluster in S. hygroscopicus. ssp. limoneus IFO 12704 (see Section 3.2).
3.1. The synthesis and modification of C7-cyclitols The Cb2 metabolite 2-epi-5-epi-valiolone is the common C7 cyclitol precursor in ACB (amylostatins), validamycins, and other biosynthetic pathways (Stratmann et al., 1999; reviewed in Wu et al., 2007). 2-epi-5epi-valiolone is synthesized from sedo-heptulose-7P by 2-epi-5-epi-valiolone synthases. The AcbC protein from Actinoplanes was the first member of this enzyme family to be studied (Stratmann et al., 1999). The sequence similarity of AcbC to the AroB-related DHQS proteins, cyclizing 3-deoxy-Darabino-heptulosonate 7-phosphate (DAHP) to dehydroquinate, suggested that this enzyme family catalyzes synthesis of the C7-cyclitol. The enzymatic activity of AcbC was proven using the AcbC protein enriched in extracts from strain S. lividans 1326/pAS8/7 (an overexpressing plasmid clone of acbC in vector pIJ6021) (Takano et al., 1995), which was shown to cyclize sedoheptulose 7-phosphate, but no other heptulose-7-P (Stratmann et al., 1999). The enzyme assay was carried out at 30 in a 100-ml volume containing 20 mM potassium phosphate (pH 7.4), 0.05 mM CoCl2, 2 mM KF, 1 mM NADH, 5 mM sedoheptulose 7-phosphate, and 100 mg of protein.
480
Udo F. Wehmeier and Wolfgang Piepersberg
The reaction of C7-cyclitol cyclases could be monitored by thin-layer chromatography analysis (solvent system, n-butanol:ethanol:H2O, 9:7:4). The product had the same properties as synthetic 2-epi-5-epi-[6-2H2]valiolone (Stratmann et al., 1999). Using the acbC gene as a probe, a number of gene clusters for C7-cyclitol containing metabolites have been identified, such as the gene clusters for validamycin A (VAL) (Bai et al., 2006; Singh et al., 2006; Wu et al., 2007). Meanwhile, a number of AcbC-like proteins have been identified and active site residues from the available 2-epi-5-epivaliolone synthases revealed striking dissimilarities with DHQ synthases because one-third of the active-site residues are consistently altered in 2-epi-5-epi-valiolone synthases (Wu et al., 2007). The next steps after the cyclization obviously differ remarkably in the various pathways. For the biosynthesis of ACB in Actinoplanes, Zhang et al. (2002) have shown that 2-epi-5-epi-valiolone is phosphorylated to 2-epi-5-epi-valiolone-7-P by the enzyme AcbM (tested in 25 mM Tris-HCl, 10 mM MgCl2, [20 mM NH4Cl] 10 mM 2-epi-5-epi-valiolone adjusted to pH 7.6, using cell free extracts from S. lividans TK64 harboring plasmids pCW4123M) (Zhang et al., 2002) and then 2-epi-5-epi-valiolone-7-P is epimerized to 5-epivaliolone-7-P by AcbO, a new type of epimerase, which is obviously cofactor independent (Zhang et al., 2003). The assays with AcbO were performed under the same conditions described above for AcbM using 2epi-5-epi-valiolone-7-P as substrate and cell-free extract from S. lividans TK64/pMJO7 (Zhang et al., 2003). In the biosynthesis of VAL, 2-epi-5epi-valiolone is first epimerized to 5-epi-valiolone, and then water is eliminated to give valienone. These two steps are catalyzed by the bifunctional enzymes (epimerase/dehydratase) ValK (val gene cluster from Streptomyces hygroscopicus 5008) (Bai et al., 2006) or VldD (vld gene cluster from Streptomyces hygroscopicus var. limoneus IFO 12703) (Singh et al., 2006), respectively. Then valienone is phosphorylated to valienone-7-P by a cyclitol kinase (Bai et al., 2006; Singh et al., 2006). Valienone-7-P is the precursor for both cyclitol moieties of validoxamine A, the unglycosylated precursor of validamycin A. In the S. glaucescens pathway for ACB, obviously a third variant is realized, where 2-epi-5-epi-valiolone is first epimerized by an epimerase GacJ and then water is eliminated, and the keto-group at C1 is reduced by the enzyme GacO (dehydratase/dehydrogenase) to give 1-epi-valienol, which is then phosphorylated by GacM to 1-epi-valienol-7-P (Rockser and Wehmeier, 2008). According to the proposals for ACB biosynthesis, the cyclitol is then activated by nucleotidyl-transferases, AcbR or GacR, respectively. The activation of the cyclitol is obviously conserved in a number of C7-cylitol pathways, as related nucleotidyltransferases are also encoded by the gene clusters for the biosynthetic routes for validamycins (Bai et al., 2006; Singh et al., 2006). NDP-1-epi-valienol-7-P is then transferred to a TDP-4-amino-4,6-deoxy-glucose by the glycosyltransferases (AcbI/GacI) to form acarviosine-7-P (Wehmeier and Piepersberg,
Aminoglycoside Biosynthesis
481
2004; Rockser and Wehmeier, 2008). TDP-4-amino-4,6-deoxy-glucose is synthesized using the standard biosynthetic routes for deoxyglucose. The genes acbA/gacA and acbB/gacB encode the TDP-glucose synthase (EC 2.7.7.24; AcbA/GacA) and the TDP-glucose-4,6-dehydratase (EC 4.2.1.46; AcbB/GacB), respectively. The enzymes are equivalent to StrD/E described in Section 2.2–2.3. The final modification step in this sugar pathway leading to TDP-4-amino-4,6-dideoxy-glucose is an amination catalyzed by AcbV/GacV. The enzymatic activity of AcbV was shown using dTDP-4,6dideoxy-glucose as a substrate (Diaz-Guardamino, M., and Piepersberg, W., unpublished). The enzymatic reaction was carried out in 100 mM Tris-HCl buffer (pH7.5) containing 4 mM dTDP-4-amino-4,6-dideoxy-glucose, 8 mM L-glutamic acid and 1 mM pyridoxalphosphate. The activities can be measured photometrically at g 340 nm in a coupled assay with the a-ketoglutarat dehydrogenase, which converts a-ketoglutarate in the presence of NAD and coenzymeA to succinyl-CoA. A HPLC-system was established by Chung et al. (2007), who analyzed the aminotransferase GerB, which is highly related to AcbV/GacV. The enzyme GerB also was characterized as a dTDP-4-amino-4,6-dideoxy-glucose-aminotransferase. Finally, two glucose moieties are attached to acarviosine-7-P by a second glycosyltransferase (AcbS/GacS). It is still not clear if AcbS/GacS transfer a glucose molecule twice or just a maltose. The last step is the export of ACB-7-P by the ABC exporters AcbWXY or GacWXY, respectively, and unphosphorylated ACB is released (Wehmeier and Piepersberg, 2004; see Fig. 19.3).
3.2. The biochemistry of carbophors: A unique system for the acquisition of glucose from starch in actinomycetes Since ACB is produced as part of a mixture of compounds differing by the number of a-1,4-bound glucose residues at both the reducing and the nonreducing ends, we hypothesize that despite its activity as an inhibitor of a-glucosidases, the benefits of ACB for the producing organism might stem from another function. We proposed that ACB and related compounds might function as ‘‘carbophors’’ (in analogy to the well-known siderophores): these metabolites are produced in order to prevent competitors in the natural habitat from utilizing starch as a carbon and energy source (Zhang et al., 2002; Wehmeier and Piepersberg, 2004). This could be achieved by their function as potent inhibitors of a-glucosidases and of transport systems mediating the uptake of malto-oligosaccharides. Increasing amounts of extracellular, unbound ACB could be used as acceptor molecules for the covalent binding by transglycosylation of glucose or malto-oligosaccharides by the action of the acarviosyltransferase, AcbD, and/or other extracellular a-glucosidases with high transglycosylation potency. The resulting longer homologues would be transported into the
482
Udo F. Wehmeier and Wolfgang Piepersberg
P P
NDP-valienol-7-P
Acbl
Acarviose-7-P
dTDP-4-amino-4,6-dideoxy-glucose AcbS P
(n)
Acarbose homologs-7-P (n)
P Acarbose-7-P
W
W
F
Glucose
AcbQ
AcbK Carbophor function
2x
X
G
Cytoplasm
Y
H
Out AcbD
Acarbose homologs
Acarbose (inhibitor function)
(n) AcbE, AcbZ Starch
Figure 19.3 Schematic representation of the‘‘carbophor’’ function of ACB.The figure illustrates schematically the biosynthesis and export of ACB, the extracellular modification, the reimport of higher ACB homologues and the intracellular ACB cycle in Actinoplanes sp. SE50/110 (acb cluster, Acb enzymes). The enzymes involved in the respective steps are indicated; for details see text. A similar carbophor cycle is encoded by the gac cluster from S. glaucescens GLA.O (see text).
cytoplasm by a specific importer system, where they would first become phosphorylated by an ACB kinase (AcbK/GacK) and then glucose units would be released and shuttled into metabolism (Fig. 19.3). Free ACB would be released to the environment again by an ACB exporter. The available biochemical data for Acb/Gac-proteins, which provide evidence for and could be involved in the carbophor cycle, are summarized here. 3.2.1. The acarviosyl transferase AcbD The acarviosyl transferase AcbD (Atase, EC2.4.1.19), encoded by the acb cluster of Actinoplanes sp. SE50/110, is a 76-kDa extracellular enzyme from Actinoplanes sp. SE50/110 that transfers the acarviosyl moiety from ACB to the 4-hydroxyl group of various sugars (Hemker et al., 2001; Leemhuis et al., 2004; Wehmeier, U. F., and Rockser, Y., unpublished). ATase has highest similarity to cyclodextrin glucanotransferases (CGTases), e.g., 42% sequence identity to CGTase from Thermoanaerobacterium thermosulfurigenes (P26827). Sequence alignments of AcbD with various a-amylase family enzymes revealed that the four short-sequence regions (I-IV) characteristic of the a-amylase family (Nakamura et al., 1993; Soogard et al., 1993; Uitdehaag et al., 1999) are present in ATase. Therefore, it was assumed
Aminoglycoside Biosynthesis
483
that the catalytic site architecture of AcbD is similar to those of other a-amylase family enzymes, and that the preference for ACB is probably the result of relatively small differences (e.g., point mutations) in or close to its active site (Leemhuis et al., 2004). It was shown by site-directed mutagenesis that the replacement of Gly140His and/or Gln327His change the specificity of Atase dramatically: The enzyme loses its ACB resistance and Atase function and gains CGTase and a-glucosidase activities (Leemhuis et al., 2004). From these observations, it was assumed that the presence of the His residues mentioned above at these positions is responsible for ACB sensitivity of a-glucosidic enzymes. However, the ACB resistant a-amylases AcbE and AcbZ encoded by the acb gene cluster and also the a-glucosidases and a-amylases encoded by the gac cluster from S. glaucescens GLA.O all contain His residues at these respective positions, and have the active site almost completely conserved when compared to other a-amylases. Thus, the origin of ACB resistance is still unclear. The acbD gene has been cloned and the secreted ATase AcbD was overproduced well in S. lividans strain TK23 when using the E. coli/ actinomycete shuttle vector pUWL201PW-AT (Leemhuis et al., 2004). Acarviosyl transferase activity was found in the culture medium, demonstrating that the signal sequence of ATase is also recognized by S. lividans. The ATase protein can be purified from the culture medium using a standard His-tag purification protocol, yielding about 4 mg of ATase protein per liter of culture (Leemhuis et al., 2004; Rockser and Wehmeier, unpublished). For the expression and purification of AcbD the culture was inoculated by a single colony directly after transformation and grown in Cerestar medium (Cerestar-malto-oligodextrins, 70 g; (NH4)SO4, 5g; yeast extract, 2 g; K2HPO4, 1 g; KH2PO4, 1 g; tri-sodium citrate, 5 g; MgCL2 6H2O, 1 g; FeCL3 6 H2O, 0.25 g; and CaCl2 2 H2O, 2 g; all components dissolved in 1.2 l distilled H2O and sterilized by filtration) for 72 h at 30 on a rotary shaker at 180 rpm. The mycelium was removed by centrifugation and the supernatant was filtered by gravity through glass fibers. Subsequently, 1 ml NiNTA Agarose suspension (Sigma-Aldrich) was added to 100 ml of supernatant and then filled up with Tris-HCl (pH 7.5, final concentration 20 mM ), NaCl (250 mM ), and imidazole (10 mM). This mixture was incubated at 4 for 4 h with gentle agitation. Then the NiNTA-agarose was washed twice with five volumes of buffer 2 (20 mM Tris-Cl, pH 7.5; 250 mM NaCl; 10 mM imidazole; and 1 mM CaCl2). The AcbD protein was eluted with the same buffer containing 250 mM imidazole. AcbD assays are carried out in Tris-HCl buffer (20 mM, pH 7.5) supplemented with 1 mM CaCl2 at 30 . AcbD activity was determined by measuring the transfer rate of the acarviosyl moiety from ACB (donor substrate) to malto-oligosaccharides (acceptor substrates). Reaction mixtures contained 1 to 20 mM ACB, 10 mM malto-oligosaccharides and
484
Udo F. Wehmeier and Wolfgang Piepersberg
about 10 mg of enzyme per milliliter. Reactions are started by adding enzyme and incubated for 1 to 4 h, then stopped by boiling samples for 5 min. The reactions can be monitored on Silica HPTLC plates (Merck) and should be run twice in acetonitrile/1-propanol/H2O (9/5/7). Visualization of products is obtained by a methanol solution containing 0.3% (w/v) N-(1naphtyl)ethylenediamine and 5% (v/v) H2SO4, followed by heating with a heat gun for a few minutes. ACB, higher ACB homologues, and malto-oligosaccharides can be separated on an HPLC system according to Leemhuis et al. (2004), or using a CarboPac PA200 anion exchange column (250 4 mm) (Dionex, Idstein, Germany) coupled to a CarboPac1 guard column. With eluent A (sodium hydroxide, 0.1 mM) and eluent B (0.6 M sodium acetate in 0.1 M sodium hydroxide) using the following gradient: 0 min, 3% eluent B; 20 min, 30% B; 30 min, 100% B; 30 to 35 min 100% B; 35 min, 3% B; 35 to 47 min 3% B; and 47 min end of run. Detection was performed with an ED50 electrochemical detector (Dionex) with an Au working electrode and an Ag/AgCl reference electrode with a sensitivity of 300 nC. The following pulse program should be used: þ0.1 volt (0 to 0.40 s); to 2.0 volts (0.41 to 0.42 s); þ0.6 volt (0.43 to 0.44 s); and –0.1 volt (0.44 to 0.45 s). 3.2.2. Starch-degrading enzymes Actinoplanes sp. SE50/110 produces two a-amylases (EC3.2.1.1): AcbE (1038 aa) and AcbZ (1103 aa) which represent a new a-glucosidase subfamily (Wehmeier, U. F., Merettig, N., and Rockser, Y., unpublished). They are long-chain acarbose-insensitive a-amylases. The four conserved sequence motifs in the catalytic domain of a-glucosidases and cyclodextrin synthases converting starch and maltodextrins and the three active site amino acid residues, D268, E302 and D375, the ‘‘catalytic triad’’ (Gilles et al., 1996; Nakamura et al., 1993; Soogard et al., 1993; Uitdehaag et al., 1999), are also conserved in AcbE and AcbZ. The activities of a-amylase can be determined using standard a-amylase tests with soluble starch and photometric detection, or the Dionex system described in Section 3.2.1 for AcbD. When using starch as a substrate, the degradation products produced by a-amylases (maltose, maltotriose, or higher malto-oligosaccharides) can be detected. The activities of ACB-insensitive a-amylases are determined in the presence of ACB (0.1 to 1 mM ) and soluble starch (0.1 to 0.5% in the test). With 1 mM ACB AcbE and AcbZ still exhibit more than 70% catalytic activity while ACB-sensitive enzymes are completely inhibited at these concentrations. Four a-glucosidic enzymes are encoded by the gac gene cluster from S. glaucescens GLA.O: GacE1, GacE2, GacZ1, and GacZ2. The two a-amylases GacZ1 and GacZ2 are related to long-chain a-amylases and both also contain a pullulan-binding domain. GacE2 is a short-chain secreted a-glucosidase, while the protein sequence from GacE1 contains
Aminoglycoside Biosynthesis
485
no signal peptide and seems to be a cytoplasmic enzyme. It remains to be shown if all these enzymes are ACB resistant. These S. glaucescens enzymes all contain the typical active sites found in all a-amylases or starch-degrading enzymes mentioned above and in Section 3.2.1 and, like AcbE and AcbZ from Actinoplanes, no changes are found within these active sites. We have first indications that GacE1 is a cytoplasmic ACB-resistant a-glucosidase and that the extracellular a-amylytic activities detected in the supernatant of S. glaucescens are insensitive toward ACB (Merettig, N., and Wehmeier, U. F., unpublished results). 3.2.3. Binding protein dependent ACB transporters Within the acb and gac cluster putative gene sets (acbHFG, gacFGH) encoding components of ATP-binding cassette (ABC) import systems were found that consist of a membrane-bound solute-binding protein (AcbH/GacH) and two membrane-spanning subunits (AcbFG/GacFG). As often observed for sugar ABC transport systems of Gram-positive bacteria, a gene encoding an ATPase component is lacking (Hurtubise et al., 1995; Schlo¨sser et al., 1999). However, genes encoding ABC proteins (MsiK, multiple sugar import ATPase) (Hurtubise et al., 1995; Schlo¨sser et al., 1997), which are probably part of the transporter complexes, had also been identified in Actinoplanes (Elvers, D., Scha¨fer, G., Brunkhorst, C., and Schneider, E., unpublished) and S. glaucescens (Rockser, Y., and Wehmeier, U. F., unpublished). The homology to members of the CUT 1 (carbohydrate uptake transporter) subfamily, the members of which predominantly transport di- and oligo-saccharides, made the transporters AcbFGH/GacFGH candidates for ACB uptake systems. We have studied this hypothesis (Wehmeier, U. F., in collaboration with Licht, A., Weidlich, D., Scheffel, F., and Schneider, E., Humboldt University Berlin, Germany). We (Brunkhorst et al., 2005) have shown that (1) the product of the acbH gene is induced under the same conditions as other genes of the acb cluster, (2) AcbH is attached to the cytoplasmic membrane, and (3) the purified His10–AcbH fusion protein binds ACB and its longer derivatives but not maltodextrins via surface plasmon resonance. Thus, the substrate binding site of AcbH has apparently evolved in such a way that it can discriminate maltooligosaccharides from pseudo-oligosaccharides. This is in contrast to maltose/maltodextrin binding proteins from E. coli and Alicyclobacillus acidocaldarius, which also bind ACB (Brunkhorst et al., 1999; Hu¨lsmann et al., 2000) and these data strongly support the carbophor model. Comparable data for GacH are still not available. The putative binding protein–dependent ABCimporter GacFGH from S. glaucescens is more related to maltose uptake systems from streptomycetes (45 to 60% identity to the maltose transporter MalFGH from S. coelicolor [NP626480—NP626482]) than to the relatives from Actinoplanes (only 22 to 25% identity). Therefore, it is still speculative which substrates are predominantly transported by the GacFGH-system. As
486
Udo F. Wehmeier and Wolfgang Piepersberg
a homologue to the Atase AcbD is not encoded by the gac cluster; the strain apparently produces a differently composed mixture of metabolites, which is obviously also reflected in the importer. 3.2.4. Cytoplasmic enzymes involved in ACB metabolism Two proteins are required to close the cytoplasmic ACB cycle, an amylomaltase and an ACB kinase. Proteins for these functions are encoded by the genes acbQ/gacQ and acbK/gacK, respectively, in the two gene clusters investigated. It was first shown by Pape and coworkers that Actinoplanes sp. SE50/110 produces an enzyme phosphorylating ACB at the 7-position and that 7-phospho-ACB does not inhibit the cytoplasmic and ACBsensitive amylomaltase activity of Actinoplanes sp. SE50/110 (Goeke et al., 1996; Drepper and Pape, 1996). The respective enzyme AcbK is encoded by the acb cluster from Actinoplanes sp. SE50/110 and a homologue GacK by the gac cluster from Streptomyces glaucescens GLA.O. The activities of the ACB kinases were determined in assays in a total volume of 20 ml including 10 mM ACB (or ACB homologues synthesized with AcbD, see Section 3.2.1), 10 mM ATP, 10 mM MgCl2, 20 mM NH4CL, 25 mM Tris-HCl (pH 7.6) using the enzymes overproduced in either E. coli BL21(DE3) or JM109 (DE3) (using pET11 or pET16 derivatives) or S. lividans TK23 or TK64 using the pUWL201 (Doumith et al., 2000) expression system. Both enzymes, AcbK and GacK, have been shown to phosphorylate ACB and also higher ACB homologues with similar rates (Rockser and Wehmeier, 2008, and unpublished results). Finally, the additional glucose residues of the 7-phospho-ACB homologues are hydrolyzed by the intracellular amylomaltases AcbQ or GacQ, respectively, being members of glycoside hydrolase family 77 (EC 2.4.1.25). Although both enzymes share high similarity with a-glucanotransferases involved in starch metabolism (e.g., about 60% identical aa residues with 4-alpha-glucanotransferase of Streptomyces coelicolor A3(2); NP_626885), they obviously are members of a new subgroup within this enzyme family and only small changes are responsible for their different substrate specificity. AcbQ was overproduced in E. coli DH5a using the rhamnose-inducible promoter from pJOE2702 (Volff et al., 1996). Preliminary data indicate that phosphorylated higher ACB homologues are hydrolyzed by AcbQ (Merettig, N., Y. Rockser, U. F. Wehmeier, unpublished). For these assays, AcbQ was incubated in buffer (25 mM Tris-HCl, pH 7.5, 10 mM MgCl2) with 10 mM substrate, and the hydrolysis of the substrates was analyzed by TLC according to Hemker et al. (2001). These data fit perfectly with our carbophor model.
Aminoglycoside Biosynthesis
487
REFERENCES Ahlert, J., Distler, J., Mansouri, K., and Piepersberg, W. (1997). Identification of stsC, the gene encoding the L-glutamine:scyllo-inosose aminotransferase from streptomycinproducing streptomycetes. Arch. Microbiol. 168, 102–113. Arya, D. P., (ed.), (2007). In ‘‘Aminoglycoside antibiotics. From chemical biology to drug discovery.’’ Wiley-Interscience, Hoboken, NJ. Bai, L., Li, L., Xu, H., Minagawa, K., Yu, Y., Zhang, Y., Zhou, X., Floss, H. G., Mahmud, T., and Deng, Z. (2006). Functional analysis of the validamycin biosynthetic gene cluster and engineered production of validoxylamine A. Chem. Biol. 13, 387–397. Beyer, S., Mayer, G., and Piepersberg, W. (1998). The StrQ protein encoded in the gene cluster for 50 -hydroxystreptomycin of Streptomyces glaucescens GLA. 0 is an alpha-Dglucose-1-phosphate cytidylyltransferase (CDP-D-glucose synthase). Eur. J. Biochem. 258, 1059–1067. Blondelet-Rounault, M.-H., Weiser, J., Lebrihi, A., Branny, P., and Pernodet, J.-L. (1997). Antibiotic resistance gene cassettes derived from the O interposon for use in E. coli and Streptomyces. Gene 190, 315–317. Borovinskaya, M. A., Shoji, S., Fredrick, K., and Cate, J. H. D. (2008). Structural basis for hygromycin B inhibition of protein biosynthesis. RNA 14, 1590–1599. Brayer, G. D., Sidhu, G., Maurus, R., Rydberg, E. H., Braun, C., Wang, Y., Nguyen, N. T., Overall, C. M., and Withers, S. G. (2000). Subsite mapping of the human pancreatic alpha-amylase active site through structural, kinetic, and mutagenesis techniques. Biochemistry 39, 4778–4791. Brodersen, D. E., Clemons, W. M., Carter, A. P., Morgan-Warren, R. J., Wimberly, B. T., and Ramakrishnan, V. (2000). The structural basis for the action of the antibiotics tetracycline, pactamycin, and hygromycin B on the 30S ribosomal subunit. Cell 103, 1143–1154. Brunkhorst, C., Andersen, C., and Schneider, E. (1999). Acarbose, a pseudooligosaccharide, is transported but not metabolized by the maltose-maltodextrin system of Escherichia coli. J. Bacteriol. 181, 2612–2619. Brunkhorst, C., Wehmeier, U. F., Piepersberg, W., and Schneider, E. (2005). The acbH gene of Actinoplanes sp. encodes a solute receptor with binding activities for acarbose and longer homologs. Res. Microbiol. 156, 322–327. Carter, A. P., Clemons, W. M., Brodersen, D. E., Morgan-Warren, R. T., Wimberly, B. T., and Ramakrishnan, V. (2000). Functional insights from the structure of the 30S ribosomal subunit and its interactions with antibiotics. Nature 407, 340–348. Chung, Y. S., Kim, D. H., Seo, W. M., Lee, H. C., Liou, K., Oh, T. J., and Sohng, J. K. (2007). Enzymatic synthesis of dTDP-4-amino-4,6-dideoxy-D-glucose using GerB (dTDP-4-keto-6-deoxy-D-glucose aminotransferase). Carbohydr. Res. 342, 1412–1418. Distler, J., and Piepersberg, W. (1985). Cloning and characterisation of a gene from Streptomyces griseus coding for a streptomycin phosphorylating activity. FEMS Microbiol. Lett. 28, 113–117. Distler, J., Ebert, A., Mansouri, K., Pissowotzki, K., Stockmann, M., and Piepersberg, W. (1987). Gene cluster for streptomycin biosynthesis in Streptomyces griseus: Nucleotide sequence of three genes and analysis of transcriptional activity. Nucleic Acids Res. 15, 8041–8056. Distler, J., Mansouri, K., and Piepersberg, W. (1985). Streptomycin biosynthesis in Streptomyces griseus II: Adjacent genomic location of biosynthetic genes and one of two streptomycin resistance genes. FEMS Microbiol. Lett. 30, 151–154. Distler, J., Mansouri, K., Mayer, G., Stockmann, M., and Piepersberg, W. (1992). Streptomycin biosynthesis and its regulation in Streptomycetes. Gene 115, 105–111.
488
Udo F. Wehmeier and Wolfgang Piepersberg
Doumith, M., Weingarten, P., Wehmeier, U. F., Salah-Bey, K., Benhamou, B., Capdevila, C., Michel, J.-M., Piepersberg, W., and Raynal, M-C. (2000). Analysis of genes involved in the 6-deoxyhexose biosynthesis and transfer in Saccharopolyspora erythraea. Mol. Gen. Genet. 264, 477–485. Drepper, A., and Pape, H. (1996). Acarbose 7-phosphotransferase from Actinoplanes sp.: Purification, properties, and possible physiological function. J. Antibiot. 49, 664–668. Eads, J. C., Beeby, M., Scapin, G., Yu, T. W., and Floss, H. G. (1999). Crystal structure of 3-amino-5-hydroxybenzoic acid (AHBA) synthase. Biochemistry 38, 9840–9849. Elling, L., Rupprath, C., Gu¨nther, N., Ro¨mer, U., Verseck, S., Weingarten, P., Dra¨ger, G., Kirschning, A., and Wolfgang Piepersberg, W. (2005). An enzyme module system for the synthesis of dTDP-activated deoxysugars from dTMP and sucrose. ChemBioChem 6, 1423–1430. Fritsche, E., Bergner, A., Humm, A., Piepersberg, W., and Huber, R. (1998). Crystal structure of L-arginine:inosamine-phosphate amidinotransferase StrB1 from Streptomyces griseus: An enzyme involved in streptomycin biosynthesis. Biochemistry 37, 17664–17672. Gilles, C., Astier, J.-P., Marchis-Mouren, G., Cambillau, C., and Payan, F. (1996). Crystal structure of pig pancreatic a-amylase isoenzym II, in complex with the carbohydrate inhibitor acarbose. Eur. J. Biochem. 238, 561–569. Goeke, K., Drepper, A., and Pape, H. (1996). Formation of acarbose phosphate by a cell-free extract from the acarbose producer Actinoplanes sp. J. Antibiot. 49, 661–663. Grisebach, H. G. (1978). Biosynthesis of sugar components of antibiotic substances. Adv. Carbohydr. Chem. Biochem. 35, 81–126. Haas, M. J., and Dowding, J. E. (1975). Aminoglycoside-modifying enzymes. Methods Enzymol. 43, 611–633. Hasegawa, M., Dairi, T., Ohta, T., and Hashimoto, E. (1991). A novel efficient genecloning system for Micromonospora strains. J. Bacteriol. 173, 7004–7011. Heinzel, P., Werbitzky, O., Distler, J., and Piepersberg, W. (1988). A second streptomycin resistance gene from Streptomyces griseus codes for streptomycin 300 -phosphotransferase. Relationship between antibiotic and protein kinases. Arch. Microbiol. 150, 184–192. Hemker, M., Stratmann, A., Goeke, K., Schro¨der, W., Lenz, J., Piepersberg, W., and Pape, H. (2001). Identification, cloning, expression, and characterization of the extracellular acarbose-modifying glycosyltransferase, AcbD, from Actinoplanes sp. strain SE50. J. Bacteriol. 183, 4484–4492. Hopwood, D. A., Bibb, M. J., Chater, K. F., Kieser, T., Bruton, C. J., Kieser, H. M., Lydiate, D. J., Smith, C. P., Ward, J. M., and Schrempf, H. (1985). ‘‘Genetic manipulation of Streptomyces: A laboratory manual.’’ The John Innes Foundation, Norwich, UK. Hu¨lsmann, A., Lurz, R., Scheffel, F., and Schneider, E. (2000). Maltose and maltodextrin transport in the thermoacidophilic Gram-positive bacterium Alicyclobacillus acidocaldarius is mediated by a high-affinity transport system that includes a maltose-binding protein tolerant to low pH. J. Bacteriol. 182, 6292–6301. Hurtubise, Y., Shareck, F., Kluepfel, D., and Morosoli, R. (1995). A cellulase/xylanasenegative mutant of Streptomyces lividans 1326 defective in cellobiose and xylobiose uptake is mutated in a gene encoding a protein homologous to ATP-binding proteins. Mol. Microbiol. 17, 367–377. Kase, H., Odakura, Y., Takazawa, Y., Kitamura, S., and Nakayama, K. (1982). Biosynthesis of sagamicicin and related aminoglycosides. In ‘‘Trends in Antibiotic Research: Genetics, Biosyntheses, Actions, and New Substances.’’ (H. Umezawa, A. L. Demain, T. Hata, and C. R. Hutchinson, eds.), pp. 195–212. Japan Antibiotics Research Association, Tokyo. Katz, E., Thompson, C. J., and Hopwood, D. A. (1983). Cloning and expression of the tyrosinase gene from Streptomyces antibioticus in Streptomyces lividans. J. Gen. Microbiol. 129, 2703–2714.
Aminoglycoside Biosynthesis
489
Khalameyzer, V., Fischer, I., Bornscheuer, U. T., and Altenbuchner, J. (1999). Screening, nucleotide sequence, and biochemical characterization of an esterase from Pseudomonas fluorescens with high activity towards lactones. Appl. Environ. Microbiol. 65, 477–482. Kharel, M. K., Subba, B., Lee, H. C., Liou, K., and Sohng, J. K. (2005). Characterization of L-glutamine:2-deoxy-scyllo-inosose aminotransferase (tbmB) from Streptomyces tenebrarius. Bioorg. Med. Chem. Lett. 15, 89–92. Kudo, F., Fujii, T., Kinoshita, S., and Eguchi, T. (2007). Unique O-ribosylation in the biosynthesis of butirosin. Bioorg. Med. Chem. 15, 4360–4368. Kudo, F., Yamamoto, Y., Yokoyama, K., Eguchi, T., and Kakinuma, K. (2005). Biosynthesis of 2-deoxystreptamine by three crucial enzymes in Streptomyces fradiae NBRC 12773. J. Antibiot. 58, 766–774. Leemhuis, H., Wehmeier, U. F., and Dijkhuizen, L. (2004). single mutation switches the reaction specificities of cyclodextrin glycosyltransferase and the acarbose modifying enzyme acarviosyl transferase. Biochemistry 43, 13204–13213. Lengeler, J., and Lin, E. C. C. (1972). Reversal of the mannitol-sorbitol diauxie in Escherichia coli. J. Bacteriol. 112, 840–848. Llewellyn, N. M., and Spencer, J. B. (2006). Biosynthesis of 2-deoxystreptamine-containing aminoglycoside antibiotics. Nat. Prod. Rep. 23, 864–874. Lucher, L. A., Chen, Y. M., and Walker, J. B. (1989). Reactions catalyzed by purified L-glutamine: Keto-scyllo-inositol aminotransferase, an enzyme required for biosynthesis of aminocyclitol antibiotics. Antimicrob. Agents Chemother. 33, 452–459. Mahmud, T., Flatt, P. M., and Wu, X. (2007). Biosynthesis of unusual aminocyclitolcontaining natural products. J. Nat. Prod. 70, 1384–1391. Mansouri, K., and Piepersberg, W. (1991). Genetics of streptomycin production in Streptomyces griseus: Nucleotide sequence of five genes, strFGHlK, including a phosphatase gene. Mol. Gen. Genet. 228, 459–469. Mehta, R., and Champney, W. S. (2002). 30S ribosomal subunit assembly is a target for inhibition by aminoglycosides in Escherichia coli. Antimicrob. Agents Chemother. 46, 1546–1549. Nakamura, A., Haga, K., and Yamane, K. (1993). Three histidine residues in the active center of cyclodextrin glucanotransferase from alkalophilic Bacillus sp. 1011: Effects of the replacement on pH dependence and transition-state stabilization. Biochemistry 32, 6624–6631. Newton, G. L., Ta, P., Bzymek, K. P., and Fahey, R. C. (2006). Biochemistry of the initial steps of mycothiol biosynthesis. J. Biol. Chem. 281, 33910–33920. Odakura, Y., Kase, H., Itoh, S., Sath, S., Takasawa, S., Takahashi, K., Shirahata, K., and Nakayama, K. (1984). Biosynthesis of astromicin and related antibiotics. II. Biosynthetic studies with blocked mutants of Micromonospora olivasterospora. J. Antibiot. 37, 1670–1680. Ohnuki, T., Imanaka, T., and Aiba, S. (1985). Self-cloning in Streptomyces griseus of an str gene cluster for streptomycin biosynthesis and streptomycin resistance. J. Bacteriol. 164, 85–94. Ortmann, R., Matern, U., Grisebach, H., Stadler, P., Sinnwell, V., and Paulsen, H. (1974). NADPH-dependent formation of thymidine diphosphodihydrostreptose from thymidine diphospho-D-glucose in a cell-free system from Streptomyces griseus and its correlation with streptomycin biosynthesis. Eur. J. Biochem. 43, 265–271. Piepersberg, W. (2001). Endogenous antimicrobial molecules: An ecological perspective. In ‘‘Molecular Medical Microbiology.’’ (M. Sussman, ed.), pp. 561–583. Academic Press, London. Piepersberg, W., Aboshanab, K., Schmidt-Beissner, H., and Wehmeier, U. F. (2007). The biochemistry and genetics of aminoglycoside producers. In ‘‘Aminoglycoside Antiobiotics: From Chemical Biology to Drug Discovery.’’ (D. P. Arya, ed.), pp. 15–118. WileyInterscience, Hoboken, NJ.
490
Udo F. Wehmeier and Wolfgang Piepersberg
Piepersberg, W., and Wehmeier, U. F. (2009). Aminoglycosides. Bioactive bacterial metabolites. In ‘‘Encyclopedia of microbiology.’’ 3rd edition, chapter 38 (Schaechter, ed.), Elsevier, Oxford (UK), in press. Pissowotzki, K., Mansouri, K., and Piepersberg, W. (1991). Genetics of streptomycin production in Streptomyces griseus: Molecular structure and putative function of genes strELMB2N. Mol. Gen. Genet. 231, 113–123. Reeves, P. (1993). Evolution of Salmonella O antigen variation by interspecific gene transfer on a large scale. Trends Genet. 9, 17–22. Rockser, Y., and Wehmeier, U. F. (2008). The gac-gene cluster for the production of acarbose from Streptomyces glaucescens GLA. O identification, isolation and characterization. J. Biotechnol. Epub ahead of print; PMID: 19059289. Scha¨gger, H., and von Jagow, G. (1987). Tricine-sodium dodecyl sulfat-polyacrylamid gel electrophoresis for the seperation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166, 368–379. Schatz, A., Bugie, E., and Waksman, S. (1944). Streptomycin: A substance exhibiting antibiotic activity against gram-positive and gram-negative bacteria. Proc. Soc. Exp. Biol. Med. 55, 66–69. Schlo¨sser, A., Kampers, T., and Schrempf, H. (1997). The Streptomyces ATP-binding component MsiK assists in cellobiose and maltose transport. J. Bacteriol. 179, 2092–2095. Schluenzen, F., Takemoto, C., Wilson, D. N., Kaminishi, T., Harms, J. M., HanawaSuetsugu, K., Szaflarski, W., Kawazoe, M., Shirouzu, M., Nierhaus, K. H., Yokoyama, S., and Fucini, P. (2006). The antibiotic kasugamycin mimics mRNA nucleotides to destabilize tRNA binding and inhibit canonical translation initiation. Nat. Struct. Mol. Biol 13, 871–878. Singh, D., Seo, M. J., Kwon, H. J., Rajkarnikar, A., Kim, K. R., Kim, S. O., and Suh, J. W. (2006). Genetic localization and heterologous expression of validamycin biosynthetic gene cluster isolated from Streptomyces hygroscopicus var. limoneus KCCM 11405 (IFO 12704). Gene 376, 13–23. Sogaard, M., Kadziola, A., Haser, R., and Svensson, B. (1993). Site-directed mutagenesis of histidine 93, aspartic acid 180, glutamic acid 205, Histidine 290, and aspartic acid 291 at the active site and tryptophan 279 at the raw starch binding site in barley alpha-amylase 1. J. Biol. Chem. 268, 22480–22484. Stratmann, A., Mahmud, T., Lee, S., Distler, J., Floss, H. G., and Piepersberg, W. (1999). The AcbC protein from Actinoplanes sp. SE50/110 is a C7-cyclitol synthase related to 3-dehydroquinate synthases and is involved in the biosynthesis of the a-glucosidase inhibitor acarbose. J. Biol. Chem. 274, 10889–10896. Studier, W. F., Rosenberg, A. H., Dunn, J. J., and Dubendorff, J. W. (1990). Use of the T7 RNA polymerase to direct expession of cloned genes. Methods Enzymol. 185, 61–89. Tabor, S., and Rchardson, C. C. (1985). A bacteriophage T7 polymerase/promoter system for controlled exclusive expression of specific genes. Proc. Natl. Acad. Sci. USA 82, 1074–1078. Takano, E., White, J., Thompson, C. J., and Bibb, M. J. (1995). Construction of thiostrepton-inducible, high-copy-number expression vectors for use in Streptomyces spp. Gene 166, 133–137. Thomas, M. G., Chan, Y. A., and Ozanick, S. G. (2003). Deciphering tuberactinomycin biosynthesis: Isolation, sequencing, and annotation of the viomycin biosynthetic gene cluster. Antimicrob. Agents Chemother. 47, 2823–2830. Uitdehaag, J. C. M., Mosi, R., Kalk, K. H., van der Veen, B. A., Dijkhuizen, L., Withers, S. G., and Dijkstra, B. W. (1999). X-ray structures along the reaction pathway of cyclodextrin glycosyltransferase elucidate catalysis in the alpha-amylase family. Nat. Struct. Biol. 6, 432–436.
Aminoglycoside Biosynthesis
491
Volff, J. N., Eichenseer, C., Viell, P., Piendl, W., and Altenbuchner, J. (1996). Nucleotide sequence and role in DNA amplification of the direct repeats composing the amplifiable element AUD1 of Streptomyces lividans 66. Mol. Microbiol. 21, 1037–1047. Wahl, H. P., and Grisebach, H. (1979). Biosynthesis of streptomycin. dTDP-dihydrostreptose synthase from Streptomyces griseus and dTDP-4-keto-L-rhamnose 3,5-epimerase from S. griseus and Escherichia coli Y10. Biochim. Biophys. Acta. 568, 243–252. Walker, J. B. (1975a). Pathways of biosynthesis of the guanidinated inositol moieties of streptomycin and bluensomycin. Methods Enzymol. 43, 429–433. Walker, J. B. (1975b). L-glutamine:keto-scyllo-inositol aminotransferase. Methods Enzymol. 43, 439–443. Walker, J. B. (1975c). L-alanine-1D–1-guanidino-1-deoxy-3-keto-scyllo-inositol aminotransferase. Methods Enzymol. 43, 462–465. Walker, J. B. (1975d). L-arginine:inosamine-P amidinotransferase(s). Methods Enzymol. 43, 451–458. Wehmeier, U. F. (2003). The biosynthesis and metabolism of acarbose in Actinoplanes SE50/ 110: A progress report. Biocat. Biotrans. 21, 279–285. Wehmeier, U. F., and Piepersberg, W. (2004). Biotechnology and molecular biology of the alpha-glucosidase inhibitor acarbose. Appl. Microbiol. Biotechnol. 63, 613–625. Wu, X., Flatt, P. M., Schlo¨rke, O., Zeeck, A., Dairi, T., and Mahmud, T. (2007). A comparative analysis of the sugar phosphate cyclase superfamily involved in primary and secondary metabolism. ChemBioChem 8, 239–248. Yokoyama, K., Kudo, F., Kuwahara, M., Inomata, K., Tamegai, H., Eguchi, T., and Kakinuma, K. (2005). Stereochemical recognition of doubly functional aminotransferase in 2-deoxystreptamine biosynthesis. J. Am. Chem. Soc. 127, 5869–5874. Yokoyama, K., Yamamoto, Y., Kudo, F., and Eguchi, T. (2008). Involvement of two distinct N-acetylglucosaminyltransferases and a dual-function deacetylase in neomycin biosynthesis. ChemBioChem 9, 865–869.
C H A P T E R
T W E N T Y
Biosynthetic Enzymes for the Aminoglycosides Butirosin and Neomycin Fumitaka Kudo* and Tadashi Eguchi† Contents 1. Introduction 2. General Method to Investigate Functions of the Biosynthetic Enzymes for Aminoglycosides 3. Neamine Biosynthetic Enzymes (Enzymes 17, and 20) 3.1. 2-Deoxy-scyllo-inosose (2DOI) synthase 3.2. L-Glutamine:DOI aminotransferase—a dual-function aminotransferase in 2DOS biosynthesis 3.3. 20 -N-Acetylparomamine synthase (UDP-GlcNAc:2DOS N-acetylglucosaminyltransferase) 3.4. 20 -N-Acetylparomamine deacetylase 3.5. FAD-dependent paromamine 60 -dehydrogenase 3.6. 60 -Dehydro-60 -oxoparomamine aminotransferase 4. Ribostamycin Biosynthetic Enzymes (Enzymes 8 and 9) 4.1. Phosphoribostamycin synthase (PRPP: neamine phosphoribosyltransferase) 4.2. Phosphoribostamycin phosphatase 5. Neomycin Biosynthetic Enzymes (Enzymes 57, 10, and 11) (Addition of Neosamine B to Ribostamycin) 5.1. UDP-GlcNAc:ribostamycin N-acetylglucosaminyltransferase 5.2. 2000 -N-Acetyl-6000 -deamino-6000 -hydroxyneomycin C deacetylase (repetitive function of 20 -N-acetylparomamine deacetylase) 5.3. 6000 -Deamino-6000 -hydroxyneomycin C dehydrogenase (probable repetitive function of paromamine 60 -dehydrogenase, uncharacterized) 5.4. 6000 -Deamino-6000 -dehydro-6000 -oxoneomycin C aminotransferase
* {
494 499 500 500 501 504 505 505 506 507 507 508 508 508 509
509 510
Department of Chemistry, Tokyo Institute of Technology, Tokyo, Japan Department of Chemistry and Materials Science, Tokyo Institute of Technology, Tokyo, Japan
Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04620-5
#
2009 Elsevier Inc. All rights reserved.
493
494
Fumitaka Kudo and Tadashi Eguchi
6. (S)-4-Amino-2-Hydroxybutyrate Biosynthetic Enzymes (Enzymes 1219) (Addition of AHBA to Ribostamycin) 6.1. g-L-glutamyl-ACP ligase and the pathway-specific acyl carrier protein 6.2. g-L-glutamyl ACP decarboxylase 6.3. g-L-glutamyl-4-aminobutyryl ACP mono-oxygenase and NAD(P)H:FMN oxidoreductase 6.4. g-L-glutamyl-4-amino-2-hydroxybutyryl ACP:ribostamycin g-L-glutamyl-4-amino-2-hydroxybutyryltransferase 6.5. g-L-glutamyl-butirosin B g-L-glutamyl cyclotransferase 7. Other Related Enzymes in the Biosynthesis of 2DOSContaining Aminoglycoside Antibiotics 8. Concluding Remarks and Future Perspectives References
510 511 512 513 514 514 515 516 516
Abstract Butirosin and neomycin belong to a family of clinically valuable 2-deoxystreptamine (2DOS)-containing aminoglycoside antibiotics. The biosynthetic gene clusters for butirosin and neomycin were identified in 2000 and in 2005, respectively. In recent years, most of the enzymes encoded in the gene clusters have been characterized, and thus almost all the biosynthetic steps leading to the final antibiotics have been understood. This knowledge could shed light on the complex biosynthetic pathways for other related structurally diverse aminoglycoside antibiotics. In this chapter, the enzymatic reactions in the biosynthesis of butirosin and neomycin are reviewed step by step.
1. Introduction The aminoglycosides are a well-known important class of clinically valuable antibiotics that interact with bacterial ribosomal RNA and inhibit protein synthesis. The majority of the aminoglycosides contain a unique aminocyclitol 2-deoxystreptamine (2DOS) moiety as the core, which is decorated with various aminosugars, leading to diverse structural molecules, including kanamycin, tobramycin, gentamicin, ribostamycin, butirosin, neomycin, paromomycin, lividomycin, apramycin, and hygromycin B. Other groups of aminoglycosides contain cyclitols either derived from myo-inosotol-1-phosphate or from sedo-heptulose-7-phosphate as reviewed in Chapter 19 of this volume. A number of biosynthetic studies on bioactive secondary metabolites, including the aminoglycosides, have been carried out not only to improve the productivity of the antibiotics and to modify the structures to combat newly emerging resistant pathogenic strains, but also to understand the molecular details of the enzymology that builds the complex structures. Initial incorporation studies and mutational analyses of
Butirosin and Neomycin Biosynthetic Enzymes
495
the producer microorganisms suggested plausible biosynthetic pathways. Also, enzymatic analyses with cell-free systems from the producer strains revealed each enzymatic reaction in the biosynthetic pathways. However, because the purification of secondary metabolic enzymes is generally too hard, due to the low amount of proteins in the cells, only a few enzymatic reactions have been confirmed from the native producer microorganisms. The development of molecular genetic techniques in Escherichia coli around 1980 allowed the cloning of biosynthetic genes and their subsequent heterologous expression to obtain the corresponding recombinant proteins. This strategy was applied to the 2DOS biosynthetic studies. In 1999, a key biosynthetic enzyme, 2-deoxy-scyllo-inosose (2DOI) synthase, which catalyzes the first step of 2DOS biosynthesis, was purified from the butirosin producer, Bacillus circulans (Kudo et al., 1999a), and its corresponding gene was subsequently cloned in E. coli (Kudo et al., 1999b). This discovery boosted the rapid identification of many 2DOS-containing aminoglycoside biosynthetic gene clusters, including those for butirosin, neomycin, kanamycin, tobramycin, gentamicin, ribostamycin, paromomycin, lividomycin, apramycin, istamycin, and hygromycin B, because microbial secondary metabolic biosynthetic genes are usually clustered in the genomes of the producing microorganisms. Consequently, during the last decade, most of the enzymes encoded by the butirosin and neomycin biosynthetic gene clusters have been enzymatically characterized, revealing almost all the biosynthetic steps in the pathways. The identification of the aminoglycoside biosynthetic gene clusters and bioinformatic analysis have been summarized in recent excellent reviews (Flatt and Mahmud, 2007; Piepersberg et al., 2007). Biosynthetic studies on 2DOS-containing aminoglycoside antibiotics were also recently reviewed (Llewellyn and Spencer, 2006). Thus, in this chapter, we focus step by step on the enzymatic reactions in the biosynthesis of butirosin and neomycin. Before we go through each enzyme in the biosynthesis of butirosin and neomycin, all biosynthetic enzymes encoded in the gene clusters are summarized in Table 20.1. Comparative analysis of the putative biosynthetic enzymes and chemical structures of 4,5-disubsituted 2DOS aminoglycosides (butirosin and neomycin) and 4,6-disubstituted 2DOS aminoglycosides (kanamycin, tobramycin, and gentamicin), clearly suggested a set of seven conserved enzymes (Table 20.1, enzymes 17) for the biosynthesis of the common neamine structure. Also, four proteins (Table 20.1, enzymes 8, 9, 21, and 22) were specifically encoded in the butirosin and neomycin biosynthetic gene clusters, indicating their involvement in the ribosylation of neamine to give ribostamycin. By comparing the other 4,5-disubsituted 2DOS aminoglycoside (paromomycin and lividomycin) biosynthetic gene clusters, two unique enzymes for neomycin-related structures (Table 20.1, enzymes 10 and 11) and nine unique enzymes for butirosin (Table 20.1, enzymes 1220) were classified with a reasonable degree of certainty.
496 Table 20.1 Butirosin and neomycin biosynthetic enzymes encoded in the gene clusters
Characterized function or putative function
Butirosin biosynthetic enzymes (aa, GI number)
Neomycin biosynthetic enzymes (aa, GI number)
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
368 (70720843), BtrC 418 (70720837), BtrS (R) 349a (70720845), BtrE 412c (70720839), BtrM 275 (70720844), BtrD 504 (70720855), BtrQ 432 (70720842), BtrB 604 (70720840), BtrL 213 (70720853), BtrP — — 87 (70720849), BtrI 419 (70720850), BtrJ 428 (70720851), BtrK 341 (70720852), BtrO 205c (70720834), BtrU (V) 302 (70720848), BtrH
430 (62857283) 424 (62857282) 340 (62857281) 421 (62857284) 279 (62857292) 541b(62857287) 416 (62857294) 660 (62857293) 233 (62857289) 366 (62857291) 299 (62857288) — — — — — —
2DOI synthase L-Gln:2DOI aminotransferase 2DOIA dehydrogenase (NADþ dependent) UDP-GlcNAc:2DOS GlcNAc transferase 20 -N-Acetylparomamine deacetylase Paromamine 60 -dehydrogenase L-Gln:60 -Oxoparomamine aminotransferase PRPP:neamine 5-phosphoribosyltransferase 500 -phosphoribostamycin phosphatase UDP-GlcNAc:ribostamycin GlcNAc transferase Neomycin 5000 -epimerase? (radical SAM enzyme) Acyl carrier protein (ACP) g-L-Glu-ACP ligase g-L-Glu-ACP decarboxylase g-L-Glu-GABA-ACP monooxygenase NAD(P)H:FMN oxidoreductase g-L-Glu-AHBA-ACP:ribostamycin g-L-Glu-AHBA transferase
18 19 20 21 22 23 24 25 26 27 28 29 30 a
g-L-Glu-butirosin g-L-glutamyl cyclotransferase Butirosin 300 -epimerase? 2DOIA dehydrogenase (radical SAM enzyme) Unknown Hypothetical protein ABC transporter ABC transporter Aminoglycoside N-acetyltransferase (resistant) ABC transporter ABC transporter Transcriptional regulator Transcriptional regulator Hypothetical protein
156 (70720847), BtrG 232 (70720846), BtrF 250 (70720838), BtrN 1225 (70720841), BtrA 87 (70720854), BtrV — — — 585 (70720856), BtrW 458< (70720857), BtrX 217 (70720833), BtrR1 (W) 380 (70720835), BtrR2 (U) 98c (70720836), BtrT
— — — 1321c (62857295) 83 (62857290) 646c (62857285) 594 (62857286) 287 (62857296) — — — — —
No enzymatic activity was observed, even though several reaction conditions were examined. Another probable repetitive function is not detected. c Several ORFs are deposited as different sizes. Notes: Uncharacterized proteins are indicated as italic and underlined. The hyphens indicate no homological ORFs encoded in the gene clusters. The symbols of ORFs encoded in the neomycin biosynthetic gene cluster were omitted to prevent confusion, since many same gene products are deposited as different symbols in the database. As one of reference, the GI numbers are listed from the accession code AB097196 for butirosin biosynthetic gene cluster (btr) and AB211959 for neomycin biosynthetic gene cluster (neo), which we deposited. G6P, D-glucose-6-phosphate; 2DOI, 2-deoxy-scyllo-inosose; 2DOIA, 2-deoxy-scyllo-inosamine; amino-DOI, 3-amino-2,3-dideoxy-scyllo-inosose; 2DOS, 2-deoxystreptamine; Gln, L-glutamine; Glu, L-glutamate; GABA, g-aminobutyrate; AHBA, (2S)-4-amino-2-hydroxybutyrate; ACP, acyl carrier protein; UDP, uridine 50 -diphosphate; GlcNAc, N-acetyl-D-glucosamine; PRPP, 5-phosphoribosyl-1-diphosphate;. NAD(H), nicotinamide adenine dinucleotide (and its reduced form); FAD(H2), flavin adenine dinucleotide(and its reduced form); FMN(H2), flavin mononucleotide(and its reduced form). b
497
498
Fumitaka Kudo and Tadashi Eguchi
Considering the putative functions from homology analysis with known functional enzymes, the enzymatic functions in each biosynthetic step were plausibly presumed and the expected enzymatic reactions were investigated with the recombinant proteins expressed in E. coli. Consequently, the overall biosynthetic pathways for butirosin and neomycin have been almost completely understood, as shown in Fig. 20.1, except for the epimerizations at the last steps and an oxidation reaction of 6000 -deamino-6000 -hydroxyneomycin C indicated as broken arrows. Although probable ABC transporters and regulatory proteins are not characterized, it is noteworthy that most of the proteins encoded in the gene clusters were found to be required for the construction of the relevant molecules. We also note that relatively large numbers of enzymes are repetitively used in the biosynthesis of the aminoglycosides. This fact may
2-
Common pathway
OPO3 O
HO HO
1
HO D-glucose-6-phosphate (G6P)
HO HO
5
AcHN H2N O HO
NH2 OH 2⬘-N-acetylparomamine
UDP-GIcNAc
2-deoxy-scyllo-inosamine (2DOIA)
HO HO
6
H2N HO HO
2
3-amino-2,3-dideoxyscyllo-inosose (amino-DOI) H
OH O H2N H2N O HO
NH2
O O H2N H2N O HO
NH2 HO
2-deoxystreptamine (2DOS)
HO HO
7 NH2
NH2 O H2N O HO
H2N
OH
Neamine
NH2 OH
NH2 O
HO HO
O
H2N H2N O NH2 O 2-O PO 3 O OH
8
H2N HO HO HO O
3 or 20 OH HO
OH Paromamine
NH2 HO HO
H2N HO HO
2 OH HO
2-deoxy-scyllo-inosose (2DOI)
OH O
HO HO
4
O
HO HO
OH
9 HO
H2N H2N O NH2 O O OH
PRPP HO OH Ribostamycin
HO OH
In S. fradiae
Ribostamycin
NH2 NH2 NH2 NH2 O O O O HO HO HO HO HO HO H2N H2N H2N H2N H2N H2N H2N H2N OO OO OO OO NH NH NH2 NH 2 7 2 6? HO 2 HO HO 11? HO O O O O OH OH OH OH
NH2 O H2N H2N OO NH2 HO O OH
HO HO
HO HO 10
O OH
O OH O
UDP-GlcNAc
5
OH OH
AcHN
OH
In B. circulans
H2N
OH
NH2 H2N H2N H O O N HO O OH
17
g -L-Glu-AHBA-ACP
13
NH+ 3 S
-O C 2
O L-Glu
OH
O OH
H2N
NH2 OH
O
OH
O
CO2-
N H
O
18
NH+ 3
NH2 H2N
H2N OO HO O
S
+H
3N
ACP
O
13
O
O HO HO H2N OH H2N 19? H OO N HO NH2 O OH OH O
Butirosin B
OH
O -O C 2
NH+ 3 L-Glu
OH
H N OH
HO OH
14 ACP
NH2
O
OH OH Neomycin B
H2N
OH Neomycin C
O
HO HO
HO OH
12 ACP-SH
O OH
O OH
O
NH2
O
HO HO Ribostamycin
O OH OH OH
O
H2N
N H
S O
15 and 16 ACP
O2
O
-O
2C
NH2
Butirosin A
OH N H
S
ACP
O NH3+ g -L-Glu-AHBA-ACP
Figure 20.1 Biosynthetic pathways for neomycin (in Streptomyces fradiae) and butirosin (in Bacillus circulans). The solid arrows indicate the enzymatically characterized reaction steps and the broken arrows show the uncharacterized reaction steps. The numbers over the arrows correspond to the enzymes listed inTable 20.1.The shunt pathways and reverse reactions are not shown.
Butirosin and Neomycin Biosynthetic Enzymes
499
mean that the producer microorganisms somehow minimize the set of enzymes to save energy or for the purposes of regulation. We now show each biosynthetic enzyme involved in the biosynthesis of butirosin and neomycin. Here, the biosynthetic steps are divided into those for neamine formation, ribostamycin formation, neomycin formation, and AHBA biosynthesis in the butirosin pathway. Due to space limitations, we omit mechanistic insights into the enzyme reactions and will discuss these issues elsewhere.
2. General Method to Investigate Functions of the Biosynthetic Enzymes for Aminoglycosides Chromosomal DNAs are first prepared from the cells of the producer microorganisms according to standard protocols such as those in Practical Streptomyces Genetics (Kieser et al., 2000). The aminoglycoside-producing microorganisms are often purchased from a stock center such as NBRC, JCM, or ATCC. Information on many aminoglycoside antibiotic biosynthetic genes is now widely available from public databases. Target genes are next amplified by standard PCR with designed primers having appropriate restriction sites and chromosomal DNA as a template. Usually, high-fidelity DNA polymerases such as PrimeSTAR HS DNA polymerase (TAKARA) and KOD plus DNA polymerase (TOYOBO) are used to obtain target DNA fragments. The amplified target DNAs are subcloned once into a commonly used standard plasmid vector such as pUC18, pT7Blue or pLITMUS28 according to a standard protocol (Sambrook et al., 2001). After confirmation of the sequences of the cloned DNAs, the target genes are inserted into the appropriate site of a suitable expression plasmid such as pET30, pET28 or pColdI. The expression plasmids with target genes are then introduced into an appropriate E. coli host such as BL21(DE3) for overexpression of the genes. The culture conditions (temperature, concentration of inducer compound such as isopropyl-b-D-thiogalactoside (IPTG), and media) depend on the target proteins. The E. coli cells expressing the target proteins are homogenized by use of a French Pressure Cell Press or sonic homogenizer to obtain the cell-free extract containing the recombinant proteins. His-tagged recombinant proteins are purified with Ni or Co affinity (such as Ni-NTA and TALON) chromatography. Also, conventional purification methods are applicable. Preparation of appropriate substrates is usually a difficult problem. Degradation of the parent antibiotics and chemical synthesis have been generally used up to now. However, once the sequenced biosynthetic enzymes have been functionally characterized, enzymatic synthesis could be used for the purpose.
500
Fumitaka Kudo and Tadashi Eguchi
The enzyme reaction products could be detected by LC-ESI-MS directly or HPLC after derivatization, for example, with dansyl chloride or dinitrofluorobenzene, which attach UV-absorbing functional groups to the amino groups. The enzyme reaction products can also be purified by cation exchange chromatography. After the salt forms of the aminoglycosides have been exchanged for hydrochloride or sulfate, NMR analysis should be performed. See original papers for the details of the experiments in this section.
3. Neamine Biosynthetic Enzymes (Enzymes 17, and 20) 3.1. 2-Deoxy-scyllo-inosose (2DOI) synthase 2-Deoxy-scyllo-inosose (2DOI) synthase catalyzes the first step in the biosynthesis of 2-deoxystreptamine (2DOS). The conversion of D-glucose6-phosphate (G6P) to 2DOI was first observed in a cell-free extract of neomycin-producing S. fradiae (Yamauchi and Kakinuma, 1992). The enzymatic conversion was then found to be an NADþ-dependent reaction. The corresponding enzyme, 2DOI synthase, was purified from the butirosin producing B. circulans SANK72073 (Kudo et al., 1999a). The native 2DOI synthase derived from B. circulans was isolated as a heterodimer, composed of a 40-kDa subunit and a 20-kDa subunit. The corresponding genes, btrC and btrC2, were separately cloned by reverse genetic methodology on the basis of the N-terminal amino acid sequences of the native enzyme (Kudo et al., 1999b; Tamegai et al., 2002a) Eq. (20.1). OPO32– HO HO
O
OH
HO D-glucose-6-phosphate (G6P)
2-deoxy-scyllo-inosose synthase NAD+ Co2+
O HO HO
OH HO 2-deoxy-scyllo-inosose (2DOI)
Pi
ð20:1Þ
The encoded protein sequences for the large subunit (BtrC) showed significant similarity to dehydroquinate (DHQ) synthase, which catalyzes carbocyclic formation from 3-deoxy-D-arabino-heptulosonate-7-phosphate in the shikimate pathway. The recombinant BtrC is composed of 368 amino acids, 40,746 Da and has 2DOI synthase activity with NADþ and Co2þ. The optimum pH is 7.5 to 8.0. Under the optimum reaction conditions (pH 7.7 and 46 C), the kinetic constants, kcat 1.0 s–1, Km (G6P) 2.1 10–4 M, Km (NADþ) 2.3 10–5 M, were determined. Except for the kinetic constants and stability, the biochemical properties are the same as those of the native heterodimeric enzyme (kcat 7.3 10–2 s–1, Km (G6P) 9.0 10–4 M, Km (NADþ) 1.7 10–4 M, at pH 7.7, 46 C). In addition
Butirosin and Neomycin Biosynthetic Enzymes
501
to G6P, 2-deoxy-G6P, 3-deoxy-G6P, 2-fluoro-G6P (Km 2.1 10–3 M) and 3-amino-G6P (Km 1.4 10–3 M) are accepted as substrates, although 4-deoxy-G6P, 2-amino-G6P and 3-fluoro-G6P were not accepted (Eguchi et al., 2002; Iwase et al., 1998). The crystal structure of BtrC was solved and showed significant similarity to DHQ synthase (Nango et al., 2008). Extensive mechanistic studies on 2DOI synthase have also been carried out and its similarity and dissimilarity to DHQ synthase were clearly elucidated (Hirayama et al., 2007; Huang et al., 2005b). The 2DOI synthases derived from the neomycin producer S. fradiae NBRC12773 (Kudo et al., 2005), the tobramycin/apramycin producer Streptoalloteichus hindustanus JCM3268 (Hirayama et al., 2006), the ribostamycin producer S. ribosidificus ATCC21294 (active enzyme was only expressed in S. lividans) (Subba et al., 2005), the kanamycin producer S. kanamyceticus ATCC12853 (Kharel et al., 2004b), and the tobramycin producer S. tenebrarius ATCC17920 (Kharel et al., 2004a) were shown to have activity. The kinetic constants for 2DOI synthase from S. hindustanus JCM3268 were found to be kcat 0.075 s–1, Km (G6P) 6.9 10–4 M (Hirayama et al., 2006). Among the 2DOI synthases, BtrC seems to be the most active enzyme thus far characterized. The 2DOI synthase homologous gene is a useful biomarker for the identification of the biosynthetic gene clusters for 2DOS-containing aminoglycoside antibiotics. 2DOI itself is thought to be a valuable material for the production of fine chemicals such as carbaglucose and aromatic compounds (Kakinuma et al., 2000). Thus, the 2DOI production system using the 2DOI synthase in E. coli has been greatly improved (Kogure et al., 2007). The small subunit of 2DOI synthase from B. circulans (BtrC2) was found to be an L-glutamine amidotransferase homologue involved in the newly identified pyridoxal-50 -phosphate (PLP) pathway in Bacillus (Burns et al., 2005). This small subunit suppresses the 2DOI synthase activity but significantly stabilizes the protein complex. Thus, it was speculated that this small subunit controls the 2DOI synthase activity in the cells of microorganisms to keep a certain concentration of the aminoglycoside and PLP, which is required for many transamination reactions in aminoglycoside biosynthesis.
3.2. L-Glutamine:DOI aminotransferase—a dual-function aminotransferase in 2DOS biosynthesis The two transaminations with L-glutamine as an amino donor in 2DOS biosynthesis Eqs. (20.2) and (20.3) were extensively studied by the Walker group with the native enzymes derived from the producer strains. They found that the transamination activity could not be separated, indicating that these two transaminations were catalyzed by the same enzyme in the strains (Lucher et al., 1989).
502
Fumitaka Kudo and Tadashi Eguchi
L-glutamine:
2-deoxy-scyllo-inosose aminotransferase∗
O HO HO
OH
PLP L-glutamine
HO
H2N HO HO
L-glutamine:
2-deoxy-scyllo-inosose aminotransferase∗
HO O
PLP L-glutamine
∗same enzyme
H2N HO HO
2-ketoglutaramate OH HO 2-deoxy-scyllo-inosamine (2DOIA)
ð20:2Þ
H2N HO 2-ketoglutaramate NH2 HO HO 2-deoxystreptamine (2DOS)
ð20:3Þ
Among the biosynthetic genes for butirosin, one open reading frame (ORF), BtrS (also called BtrR), showed significant homology to L-glutamine:scyllo-inosose aminotransferase in the biosynthesis of streptomycin (Ahlert et al., 1997), indicating that it could catalyze the amination of 2DOI to give 2-deoxy-scyllo-inosamine (2DOIA). In 2002, BtrS was found to be L-glutamine:2DOI aminotransferase and also the reverse reaction from 2DOS with pyruvate as an amino acceptor was detected, indicating that BtrS catalyzes two transaminations in DOS biosynthesis (Huang et al., 2002; Tamegai et al., 2002b). The structure of the reverse reaction product from 2DOS was confirmed as chiral 3-amino-2,3-dideoxy-scyllo-inosose (aminoDOI), indicating stereospecific recognition of two enantiotopic amino groups in 2DOS (Yokoyama et al., 2005). Substrate recognition studies showed that the a-positions of the ketones of the substrates are not so important, but functional groups at the b-position are critical for recognition by this dual-function enzyme. The forward reaction of the second transamination was also confirmed with the neomycin biosynthetic enzyme (Kudo et al., 2005). The crystal structure of this aminotransferase derived from B. circulans was solved and showed the tertiary structure of the enzyme, including its active site with PLP or PMP cofactors (Popovic et al., 2006). The substrate-docking model displayed some possible recognition amino acid residues, but the precise recognition mechanism of the distinguishable enantiotopic amino groups of 2DOS on the amino acid level is still unclear. Thus, detailed studies, including mutational studies, are needed to understand the recognition mechanism. In streptomycin biosynthesis, two different aminotransferases are known to be involved in the construction of the streptidine moiety (Ahlert et al., 1997; Walker and Walker, 1969). Thus, the recognition mechanism of this family of aminotransferase is quite interesting. The homologous aminotransferase derived from the neomycin producer S. fradiae NBRC12773 (Huang et al., 2005a; Kudo et al., 2005), and the tobramycin producer S. tenebrarius ATCC17920 (only the first transamination) (Kharel et al., 2005), have been shown to have the activity.
503
Butirosin and Neomycin Biosynthetic Enzymes
3.2.1. NAD-dependent 2-deoxy-scyllo-inosamine dehydrogenase This enzymatic reaction Eq. (20.4) was initially observed with a cell-free system from the neomycin producer S. fradiae and found to be an NADþdependent reaction (Suzukake et al., 1985). Thus, an NADþ-dependent dehydrogenase encoded in the biosynthetic gene cluster was postulated in this oxidation reaction. Only one NADþ-dependent dehydrogenase homologous protein is conserved in the biosynthetic gene clusters for similarly structured aminoglycoside antibiotics. The corresponding ORF from the neomycin producer S. fradiae NBRC12773 was then expressed in E. coli and the expected NADþ-dependent oxidation of 2DOIA was observed in the presence of zinc ion (Kudo et al., 2005). The product, amino-DOI, was indeed converted to 2DOS by the dual-function aminotransferase as mentioned above. However, this recombinant enzyme has not been purified yet to investigate the specific recognition mechanism. Although no other enzyme has been characterized so far, the other actinomycete enzymes seem to catalyze this oxidation reaction. Heterologous expression of several genes for kanamycin and gentamicin biosynthesis in Streptomyces clearly revealed that this type of NADþ-dependent dehydrogenase is involved in the biosynthesis (Kurumbang et al., 2008; Park et al., 2008). H2N HO HO
2-deoxy-scyllo-inosamine dehydrogenase OH HO
NAD+ in Streptomyces fradiae
H2N HO HO
HO O 3-amino-2,3-dideoxyscyllo-inosose (amino-DOI)
NADH
ð20:4Þ
On the other hand, the corresponding enzyme derived from B. circulans did not show the activity at all, since the enzyme lacks the catalytically important zinc-binding motif, which is required for the activity of this class of dehydrogenase. So, the true function of the protein in B. circulans is unclear at the moment. It may be just a relic during evolution or may function at another biosynthetic step, such as the epimerization at C-3’’ of butirosin. 3.2.2. Radical SAM 2-deoxy-scyllo-inosamine dehydrogenase A radical SAM dehydrogenase was found to catalyze the oxidation of 2DOIA to give amino-DOI in the biosynthesis of butirosin in B. circulans Eq. (20.5) (Yokoyama et al., 2007). It was really unprecedented that this type of enzyme should be involved in 2DOS biosynthesis. The enzyme BtrN encoded in the butirosin biosynthetic gene cluster possesses a CXXXCXXC motif conserved within the radical S-adenosyl-L-methionine (SAM) superfamily, which is an emerging group of enzymes that catalyze a wide range of radical reactions (Wang and Frey, 2007). The common mechanism found in all radical SAM enzymes is a reductive
504
Fumitaka Kudo and Tadashi Eguchi
cleavage of SAM to generate the 50 -deoxyadenosyl radical, which is subsequently used for radical reactions such as activation of other enzymes through generating a protein radical, sulfur insertion, C–C bond rearrangement, and amino group rearrangement. Disruption of btrN in the butirosin producer B. circulans blocked the biosynthetic pathway between 2DOIA and 2DOS. Further, in vitro assay of the overexpressed enzyme revealed that BtrN catalyzed the oxidation of 2DOIA under strictly anaerobic conditions along with consumption of an equimolar amount of SAM to produce 50 -deoxyadenosine, methionine, and amino-DOI. The BtrN reaction with [3-2H]2DOIA generated deuterated 50 -deoxyadenosine, while no deuterium was incorporated by incubation of unlabeled DOIA in the deuterium oxide buffer. These results indicated that the hydrogen atom at C-3 of 2DOIA was directly transferred to 50 -deoxyadenosine to give the radical intermediate of 2DOIA. The 2DOIA radical intermediate was also detected by EPR spectroscopy, clearly revealing the radical reaction mechanism (Yokoyama et al., 2008a). H2N HO HO HO
2-deoxy-scyllo-inosamine dehydrogenase OH
S-adenosyl-L-methionine in Bacillus circulans
H2N HO HO
HO O
+ methionine and 5´-deoxyadenosine
ð20:5Þ
3.3. 20 -N-Acetylparomamine synthase (UDP-GlcNAc:2DOS N-acetylglucosaminyltransferase) This glycosyltransfer reaction was presumed to be catalyzed by a retention-type of glycosyltransferase with nucleotidylyl sugars Eq. (20.6). Initially, NDPglucosamine was thought to be a sugar donor in paromamine synthesis. However, the existence of the following pathway-specific deacetylase (Truman et al., 2007) indicated that UDP-N-acetyl-D-glucosamine (UDPGlcNAc) is a most likely sugar donor. In the butirosin and neomycin biosynthetic gene clusters, only one obvious glycosyltranferase is encoded, suggesting that this type of enzyme catalyzes the glycosyl transfer reaction at this step. Although B. circulans-derived recombinant enzyme was not obtained as a soluble protein (unpublished), S. fradiae–derived recombinant enzyme was obtained in soluble form by coexpression with GroEL and GroES. The expected enzymatic reaction with 2DOS and UDP-GlcNAc in the presence of Mg2þ showed the production of 2’’-N-acetylparomamine, which was clearly confirmed by NMR (Yokoyama et al., 2008b). This enzyme has unfortunately not yet been purified to investigate the precise substrate specificity. Thus far, the impure enzymatic solution showed high specificity to UDPGlcNAc over UDP-glucose, suggesting a specific GlcNAc transfer enzyme.
505
Butirosin and Neomycin Biosynthetic Enzymes
H2N
HO HO
HO
NH2
UDP-N-acetylglucosamine: 2-deoxystreptamine N-acetylglucosaminyltransferase HO (2´-N-acetylparomamine synthase) HO UDP-GlcNAc Mg2+
OH O H2N O HO
+ UDP
AcHN
NH2
OH 2´-N-acetylparomamine
ð20:6Þ 3.4. 20 -N-Acetylparomamine deacetylase The functional characterization of this 20 -N-acetylparomamine deacetylase Eq. (20.7) was achieved with B. circulans- and S. fradiae–derived recombinant enzymes (Fan et al., 2008; Truman et al., 2007; Yokoyama et al., 2008b). Also, this enzyme was found to catalyze the deacetylation of 2000 -N-acetyl-6000 -deaminoneomycin C in the biosynthesis of neomycin (Fan et al., 2008; Yokoyama et al., 2008b). Thus, this family of enzyme seems to recognize only the N-acetylglucosamine moiety over the other moieties in aminoglycosides. This enzyme does not require any cofactor for its activity. Under neutral pH between 7.0 and 8.0, removal of the acetyl group from N-acetylated substrates is catalyzed. HO HO
OH O H2N O HO
2´-N-acetylparomamine deacetylase
AcHN
NH2 OH
HO HO
OH O H2N + acetic acid O NH2 HO OH Paromamine
H2N
ð20:7Þ
The gentamicin biosynthetic gene cluster was initially identified without this deacetylase homologous ORF, but recent reanalysis of the sequence revealed a deacetylase homologue, and the involvement of the gene in the biosynthesis was clearly confirmed by heterologous expression of all the enzymes required for gentamicin A2 construction (Park et al., 2008). Thus, a sequential pathway from G6P to paromamine has been verified as a common pathway to this class of antibiotics.
3.5. FAD-dependent paromamine 60 -dehydrogenase The remaining two steps to the most advanced common intermediate, neamine, in the 2DOS-containing aminoglycosides were presumed to be sequential oxidation and transamination reactions Eqs. (20.8) and (20.9). From the comparison of the gene clusters, two completely conserved common ORFs were found, encoding a FAD-dependent dehydrogenase and a PLP-dependent class III aminotransferase. The S. fradiae–derived
506
Fumitaka Kudo and Tadashi Eguchi
dehydrogenase was expressed in E. coli and the presence of the FAD cofactor in the protein was confirmed (Huang et al., 2007). The expected oxidation reaction of paromamine was successfully detected under aerobic conditions. On the other hand, removal of oxygen by flushing with argon gas caused a significant reduction in enzymatic activity, indicating reoxidation of the reduced FAD cofactor with molecular oxygen for the next catalytic cycle. The aldehyde product was converted to neamine by the following aminotransferase, suggesting that this FAD-dependent enzyme is involved in the oxidation step in neamine formation. This enzyme did not exhibit oxidation activity toward the possible biosynthetic intermediates UDP-GlcNAc, 20 -Nacetylparomamine, and paromomycin indicating the specific recognition of the paromamine molecule. However, this enzyme is presumed to catalyze the oxidation at C-6000 of 6000 -deamino-6000 -hydroxyneomycin C. In fact, our preliminary study of the corresponding enzymatic reaction showed the expected activity. This family of enzyme is encoded in the paromomycin biosynthetic gene cluster, although the paromamine moiety remains in the final product. Thus, the recognition mechanism of this possibly dual functional FAD-dependent dehydrogenase is interesting. HO HO
OH O H2N H2N O HO
Paromamine 6´-dehydrogenase
OH
NH2
FAD
H HO HO
O O H2N O HO
H2N
OH
NH2
ð20:8Þ Inactivation of the corresponding gene in tobramycin biosynthesis caused the production of 60 -deamino-60 -hydroxy-kanamycin C, supporting the idea that this enzyme is involved in the oxidation reaction in the neamine moiety of in the biosynthesis of kanamycin/tobramycin (Yu et al., 2008).
3.6. 60 -Dehydro-60 -oxoparomamine aminotransferase As mentioned above, this enzymatic activity was observed by coupled transformation from paromamine with the FAD-dependent enzyme and the PLP-dependent aminotransferase Eq. (20.9) (Huang et al., 2007). This aminotransferase exhibited the characteristic absorptions for enzyme-bound pyridoxal-50 -phosphate (PLP) and pyridoxamine-50 -phosphate (PMP). This aminotransferase preferred to use L-glutamine and L-glutamate as an amino donor in this reaction; L-leucine, L-lysine, L-arginine, L-aspartate, and S-adenosylmethionine were also accepted with reduced efficiency (Huang et al., 2007). The B. circulans-derived aminotransferase preferred to use L-glutamine rather than L-glutamate (unpublished).
507
Butirosin and Neomycin Biosynthetic Enzymes
H HO HO
O O H2N O HO
L–glutamine:6´-oxoparomamine aminotransferase
H2N
OH
NH2
HO HO
PLP L-glutamamine
NH2 O 2-ketoglutaramate H N H2N 2 O NH2 HO OH
ð20:9Þ
Neamine
In the gentamicin biosynthetic gene cluster, a total of four homologous aminotransferases are encoded and might be responsible for the aminotransfer reactions at specific carbons. So, precise characterization of substrate specificity of this type of aminotransferase should be important.
4. Ribostamycin Biosynthetic Enzymes (Enzymes 8 and 9) 4.1. Phosphoribostamycin synthase (PRPP: neamine phosphoribosyltransferase) Four conserved ORFs among the butirosin, neomycin, ribostamycin, paromomycin, and lividomycin biosynthetic gene clusters were presumed to be involved in the transformation of neamine to ribostamycin Eq. (20.10). All of the enzymes were expressed in E. coli, and all combination of the enzymes were examined to detect the expected ribosylation reaction with 5-phosphoribosyl-1-diphosphate as a possible ribosyl donor. As a result, one of the proteins was characterized as 5-phosphoribosyl-1-diphosphate:neamine 5-phosphoribosyltransferae and another was found to be 5’’-phosphoribostamycin phosphatase to give ribostamycin (Kudo et al., 2007). The other two proteins remain to be characterized, although they may be involved in the ribostamycin related chemistry in the biosynthesis. NH2 O HO HO H2N H2N O HO
5-phosphoribosy-1-diphosphate:neamine 5-phosphoribosyltransferase
OH
NH2
PRPP Mg2+
NH2 O H2N H2N O NH2 2–O PO O 3 O OH HO HO
PPi
ð20:10Þ
HO OH
Only the B. circulans–derived enzyme has been functionally characterized so far. Due to the instability of the protein, the substrate specificity was investigated with cell-free extracts of E. coli expressing this enzyme. As a result, paromamine was accepted as a substrate, but not kanamycin A. Thus, this enzyme seems to recognize the pseudodisaccharide structure of
508
Fumitaka Kudo and Tadashi Eguchi
2DOS-containing aminoglycosides. The enzyme was also found to have optimum catalytic activity at pH 7.5, at a temperature between 27 and 32 C, and required an essential divalent metal ion: optimally Mg2þ, Ni2þ, or Co2þ. However, further research is needed to solve the precise chemistry of this unique 5-phosphoribosyltransferase.
4.2. Phosphoribostamycin phosphatase As mentioned above, this enzymatic reaction was detected with a coupled reaction with PRPP:neamine 5-phosphoribosyltransferase (Kudo et al., 2007) Eq. (20.11). Only the B. circulans–derived enzyme has been characterized so far. The recombinant enzyme was purified and no metal requirement for the phosphatase activity was observed. The substrate specificity of the enzyme was also investigated with PRPP, ribose 5-phosphate, fructose 1,6-bisphosphate, fructose 6-phosphate, AMP, GMP, CMP, UMP, and TMP in addition to p-nitrophenyl phosphate, since authentic 500 -phosphoribostamycin was not available. p-Nitrophenyl phosphate was well hydrolyzed by this enzyme, and fructose 1,6-bisphosphate was also hydrolyzed, although the regiospecificity was not elucidated. The other possible substrates including PRPP were not hydrolyzed by this phosphatase at all. More studies are needed to solve the recognition mechanism of 500 -phosphoribostamycin phosphatase. HO HO
NH2 O HN H2N 2 OO O
2–O PO 3
5˝-phosphoribostamycin phosphatase NH2 OH
HO OH
NH2 O H2N H2N OO NH2 HO O OH
HO HO
HO OH Ribostamycin
Pi
ð20:11Þ
5. Neomycin Biosynthetic Enzymes (Enzymes 57, 10, and 11) (Addition of Neosamine B to Ribostamycin) 5.1. UDP-GlcNAc:ribostamycin N-acetylglucosaminyltransferase As shown in Table 20.1, two unique ORFs were identified in the neomycin, paromomycin, and lividomycin biosynthetic gene clusters. Among them, one ORF was found to encode a radical SAM enzyme, which was presumed not to be involved in the glycosylation event. Another ORF was found to show low similarity to some glycosyltransferases, especially at the C-terminal end. Thus, the enzyme derived from the neomycin producer S. fradiae was expressed in
509
Butirosin and Neomycin Biosynthetic Enzymes
E. coli and the glycosylation of ribostamycin with UDP-GlcNAc Eq. (20.12) was examined (Yokoyama et al., 2008b). The product, 2000 -N-acetyl-6000 deamino-6000 -hydroxyneomycin C, was clearly confirmed by NMR. This enzyme specifically recognized ribostamycin as glycosyl acceptor rather than 2DOS, paromamine, 20 -N-acetylparomamine, and neamine, and UDP-GlcNAc as glycosyl donor rather than UDP-Glc. This enzyme requires an essential divalent metal ion: optimally Mg2þ, Mn2þ, or Co2þ. NH2 O HO HO HN H2N 2 O NH2 HO OO OH HO OH
UDP-N-acetylglucosamine:ribostamycin N-acetylglucosaminyltransferase UDP-GlcNAc Mg2+
NH2 O HN H2N 2 O NH2 O HO O OH
HO HO
UDP
ð20:12Þ
O OH OH O AcHN OH OH 2˝´N-acetyl-6˝´-deamino-6˝´-hydroxyneomycin C
5.2. 2000 -N-Acetyl-6000 -deamino-6000 -hydroxyneomycin C deacetylase (repetitive function of 20 -N-acetylparomamine deacetylase) In the neomycin-related antibiotic biosynthetic gene clusters, only one obvious deacetylase functioning as 20 -N-acetylparomamine deacetylase is encoded, suggesting the repetitive use of the deacetylase Eq. (20.13). As expected, the enzyme also catalyzed the deacetylation of 2000 -N-acetyl-6000 deamino-6000 -hydroxyneomycin C to give 6000 -deamino-6000 -hydroxyneomycin C, which was confirmed by NMR (Yokoyama et al., 2008b). Thus, the enzyme seems to recognize only the N-acetylglucosamine moiety in aminoglycosides. NH2 O HO HO H N H2N 2˝´-N-acetyl-6˝´-deamino-6˝´-hydroxyneomycin C 2 O NH2 deacetylase HO O O OH
NH2 O H2N H2N O NH2 HO O O OH
HO HO
*Same enzyme as 2´-N-acetylparomamine deacetylase
O OH OH O OH AcHN OH
O OH OH O OH H2N OH
acetic acid
ð20:13Þ
5.3. 6000 -Deamino-6000 -hydroxyneomycin C dehydrogenase (probable repetitive function of paromamine 60 -dehydrogenase, uncharacterized) This oxidation reaction Eq. (20.14) was presumed to be catalyzed by paromamine 60 -dehydrogenase, since the reaction scheme appears to be similar to the oxidation of C-6 of the glucosamine moiety, and also other candidates are not found in the gene clusters. In fact, our preliminary study showed the oxidation activity of the enzyme (unpublished).
510
Fumitaka Kudo and Tadashi Eguchi NH2 O
HO HO
HN H2N 2 OO NH2 HO O OH
NH2 O
HO HO HO
6˝´-deamino-6˝´-hydroxyneomycin C 6˝´-dehydrogenase
H2N H2N OO O
OH
FAD
O OH H2N
ð20:14Þ
O OH OH OH
O
O OH
O
H2N
OH
NH2
OH
5.4. 6000 -Deamino-6000 -dehydro-6000 -oxoneomycin C aminotransferase This reverse reaction Eq. (20.15) was confirmed to be catalyzed by 60 -oxoparomamine aminotransferases derived from S. fradiae and B. circulans (Huang et al., 2007). Our preliminary result showed a sequential oxidation and transamination of 6000 -deamino-6000 -hydroxyneomycin C to neomycin C (unpublished). We are now in the process of confirming the structure of the product as neomycin C, not neomycin B, since an epimerization reaction was suspected during the sequential enzymatic reaction. HO HO
NH2 O H2N
HO
H2N OO NH2 O OH
NH2 O H2N H2N OO HO O
HO HO L-glutamine:6˝´-oxoneomycin C aminotransferase∗
OH
NH2 + 2-ketoglutaramate
PLP L-gluatamine
O OH H2N
O OH
O OH
∗ Same enzyme as L-glutamine: 6˝´-oxoparomamine aminotransferase
O OH H2N
O
NH2 OH
ð20:15Þ
OH Neomycin C
The last step of neomycin B biosynthesis appears to be the epimerization reaction at C-5000 of neomycin C to neomycin B, although the timing of the epimerization is not clear at present. A putative radical SAM enzyme, which is also encoded in the paromomaycin and lividomycin biosynthetic gene clusters, remains to be solved. This protein may catalyze the epimerization at C-5000 of neomycin C with a radical mechanism. Functional analysis of this enzyme derived from S. fradiae is in progress.
6. (S)-4-Amino-2-Hydroxybutyrate Biosynthetic Enzymes (Enzymes 1219) (Addition of AHBA to Ribostamycin) The (S)-4-amino-2-hydroxybutyryl (AHBA) moiety at 1-N of the 2DOS of butirosin is a structurally unique feature. It is well known that AHBA attachment on kanamycin A and dibekacin lead to the clinically valuable amikacin and arbekacin (Kondo and Hotta, 1999). Labeling studies
511
Butirosin and Neomycin Biosynthetic Enzymes
to seek the attachment of AHBA with several amino acids such as L-glutamate, g-aminobutyric acid (GABA), and AHBA were performed, showing that L-glutamate and GABA are direct precursors to the AHBA moiety of butirosin but not AHBA itself (Yukita et al., 2003). Thus, a certain activation reaction of the carboxyl group was presumed before the loading of the amino acid substituent. The butirosin biosynthetic gene cluster contains seven unique contiguous genes compared with the neomycin biosynthetic gene cluster (Table 20.1, 1215, 1719). The Spencer group expressed six of the seven enzymes and one probable NADH:FAD oxidoreductase encoded in the butirosin biosynthetic gene cluster and elegantly figured out the unique AHBA biosynthetic pathway and transfer reaction onto ribostamycin to give butirosin, as described in this section (Li et al., 2005; Llewellyn et al., 2007).
6.1. g-L-glutamyl-ACP ligase and the pathway-specific acyl carrier protein First of all, the pathway-specific acyl carrier protein (ACP) was characterized, since acyl-activated enzymology was presumed, as in the polyketide synthase and non–ribosomal peptide synthetase reactions. Initially, certain acyl ACP intermediates derived from L-glutamate or GABA were presumed from the previous incorporation study. The ACP was expressed in E. coli and the majority of the recombinant protein was obtained as the apo form of ACP. Therefore, the gene was then coexpressed with the wide-spectrum 40 -phosphopantetheine transferase (PPTase, Sfp) derived from B. subtilis to obtain the holo form of the ACP, which was confirmed by LC-ESI-MS. NH3+
g-L-glutamyl-ACP ligase∗
ACP-SH
–O C 2
ATP
S
ADP and Pi
ACP
ð20:16Þ
O
L-glutamate 2+, Mn2+
Mg
+H N 3
S O
g-L-glutamyl-g-aminobutyryl-ACP ligase∗
ACP
O –O
ATP L-glutamine Mg2+, Mn2+
∗same enzyme as the ligase at the first step
2C
NH3+
N H
S
ACP
ADP and Pi
O
ð20:17Þ
The second enzyme was g-L-glutamyl–ACP ligase, which shows weak local similarity to biotin carboxylase and carbamoyl phosphate synthase. These enzymes belong to the growing ATP grasp superfamily, which includes D-alanine:D-alanine ligase, glutathione synthetase, glycinamide ribonucleotide transformylase, and succinyl-CoA synthetase. These enzymes
512
Fumitaka Kudo and Tadashi Eguchi
exhibit a characteristic ATP-binding motif and possess ATP-dependent carboxyl-amine or carboxyl-thiol ligase activity. The reaction mechanism of the enzymes was proposed to involve the generation of acyl phosphate intermediate via hydrolysis of ATP to ADP. The enzyme was expressed in E. coli and the recombinant protein was found to require DTT in the buffer solution to prevent aggregation. The recombinant enzyme reacted with ATP and various amino acids including L-glutamate, D-glutamate, GABA, and AHBA in the presence of MgCl2, MnCl2, and KCl. Then, a possible ATPase activity was demonstrated by detecting ADP, which was coupled to the reaction of pyruvate kinase and NADH-dependent lactate dehydrogenase (LDH). As a result, only in the presence of L-glutamate, a decrease of NADH was observed, suggesting L-glutamate-dependent ATPase activity of the enzyme. Also, this observation implied the involvement of a possible L-glutamylphosphate intermediate, which can be transferred onto the holoACP. In fact, addition of the holo-ACP to the enzyme reaction gave L-glutamyl-S-ACP as product, which was detected by LC-ESI-MS Eq. (20.16). Since L-glutamate should be converted to AHBA through decarboxylation of the a-carboxy group, the g-carboxy group was presumed to be attached to the ACP. Obviously L-glutamate was found to be the best substrate for the reaction rather than GABA and AHBA, and consistent with the incorporation experiments. The incorporation of GABA into butirosin could be due to a weak activity of the enzyme.
6.2. g-L-glutamyl ACP decarboxylase The enzyme shows significant similarity to a PLP-dependent ornithine/arginine/diaminopimerate decarboxylase family and was thus thought to be involved in the decarboxylation of the a-carboxyl moiety of the L-glutamate portion Eq. (20.18). To investigate the expected decarboxylation activity, the expressed purified enzyme was added to the above-mentioned g-L-Glu–ACP ligase reaction mixture to detect the probable GABA-ACP intermediate. However, surprisingly, g-L-glutamyl-g-aminobutylyl–ACP was clearly observed by LC-ESI-MS. No g-L-Glu-g-L-Glu–ACP or GABA–ACP was observed in the reaction mixture, suggesting that after the decarboxylation of g-L-Glu–ACP to GABA–ACP by the decarboxylase, the resulting GABA– ACP was further glutamylated by g-Glu–ACP ligase to afford g-L-GluGABA–ACP. In fact, when the g-Glu–ACP ligase reaction was quenched by the addition of EDTA after g-L-Glu–ACP formation, and then the decarboxylase was added to the solution, the expected GABA-ACP was observed by LC-ESI-MS. This decarboxylase weakly accepted free amino acids, suggesting specific recognition of the acyl ACP. Thus, a series of transformations from the holo-ACP to g-L-Glu-GABA–ACP Eq. (20.16), (20.18), then (20.17) have been clearly demonstrated.
513
Butirosin and Neomycin Biosynthetic Enzymes
NH3+
S
–O
2C
g-L-glutamyl ACP decarboxylase
ACP
S
+H
3N
ACP
CO2
O
PLP
O
ð20:18Þ
6.3. g-L-glutamyl-4-aminobutyryl ACP mono-oxygenase and NAD(P)H:FMN oxidoreductase The third and fourth enzymes are involved in a two-component monooxygenase reaction, which is the stereospecific hydroxylation at C-2 of g-LGlu-GABA–ACP to give g-L-Glu-AHBA–ACP Eq. (20.19). One enzyme is g-L-Glu-GABA–ACP mono-oxygenase encoded in the butirosin-specific gene cassette. This enzyme shows sequence similarity to alkanesulfonate mono-oxygenase, which is involved in sulfur metabolism. This enzymatic reaction system utilizes two proteins to hydroxylate the substrate; one is an oxidoreductase that catalyzes the reduction of FMN with NAD(P)H as an electron donor, and the other is a mono-oxygenase that catalyzes the hydroxylation of the substrate in the presence of FMNH2 and molecular oxygen. In this two-component system, the oxidoreductase provides FMNH2 to the mono-oxygenase to reduce molecular oxygen to water and to attach a hydroxy group to the substrate. This sort of enzyme is encoded 20 kb upstream of the mono-oxygenase gene in the butirosin biosynthetic gene cluster. Thus, the enzyme was proposed to be the oxidoreductase to supply FADH2 to the mono-oxygenase. g-L-glutamyl-g-aminobutyryl-ACP monooxygenase O2 H2O
O –O
2C
NH3+
N H
S O
O
–O C 2
ACP FMNH2
NADH + H+
FMN
NH3+
OH N H
S
ACP
O
ð20:19Þ NAD+
NADH:FMN oxidoreductase
The purified recombinant oxidoreductase expressed in E. coli was found to contain FMN as the cofactor rather than FAD. Kinetic studies on this oxidoreductase were also conducted to characterize it as an NAD(P)H: FMN oxidoreductase, which reduces FMN to FMNH2 with NAD(P)H, presumably for the FMN-dependent mono-oxygenase. The mono-oxygenase was also expressed in E. coli and purified in colorless form, suggesting no bound flavin cofactor in the protein. Thus, free FMNH2 from the above-mentioned NADH:FMN oxidoreductase seemed to be used for the mono-oxygenase reaction. In fact, in the presence of the NADH:FMN oxidoreductase system, the recombinant monooxygenase catalyzed the hydroxylation of g-L-Glu-GABA–ACP to afford g-L-Glu-AHBA–ACP, which was detected by LC-ESI-MS. Indeed, FMN and molecular oxygen were required for the hydroxylation.
514
Fumitaka Kudo and Tadashi Eguchi
6.4. g-L-glutamyl-4-amino-2-hydroxybutyryl ACP: ribostamycin g-L-glutamyl-4-amino2-hydroxybutyryltransferase Two unpredictable functional enzymes encoded in the butirosin-specific biosynthetic gene cassette were then proposed to be involved in the AHBA acyl-transfer reaction to complete butirosin B biosynthesis Eqs. (20.20) and (20.21). Both enzymes were expressed in E. coli and purified to investigate the expected reaction with the above-mentioned g-L-Glu-AHBA–ACP, which was prepared by Sfp with synthetic g-L-Glu-AHBA-CoA, and ribostamycin as the acceptor substrate. The LC-ESI-MS analysis of the reaction clearly confirmed the production of butirosin B. When either of two enzymes was used for the reaction, only one of the reactions gave a new product, which corresponded to g-L-Glu-butirosin B. Thus, the enzyme was characterized as g-L-Glu-AHBA–ACP:ribostamycin g-L-Glu-AHBA transferase. Subsequently, another enzyme was found to be involved in the cleavage of the glutamyl moiety to give butirosin B. NH2 HO HO
NH2
O
H2N H2N O O HO O
g-L-glutamyl-4-amino-2-hydroxybutyryl ACP:ribostamycin g-L-glutamyl-4-amino-2-hydroxybutyryltransferase NH2 OH
-O
2C
HO OH
OH
O
NH+ 3
N H
S O
HO HO
O
H2N H2N O O HO O
OH
H N OH O
ACP HO OH
+ ACP
O N H
CO3NH+ 3
ð20:20Þ
In this two-enzyme reaction, 2DOS and paromamine were not converted to the corresponding AHBA derivatives. Neamine was less effectively converted to AHBA neamine than ribostamycin. Thus, as illustrated, ribostamycin is the only true substrate in butirosin biosynthesis. On the other hand, the related 4,5-disubstituted aminoglycosides, paromomycin and neomycin, were converted to the corresponding AHBA derivatives but not the 4,6-disubstituted aminoglycoside gentamicin C and kanamycin. However, interestingly, when a high concentration of the g-L-Glu-AHBA– ACP analog, g-L-Glu-AHBA–S-N-acetylcysteamine thioester (5 mM) was used for the g-L-Glu-AHBA transferase reaction, various aminoglycosides, including neomycin, paromomycin, 2DOS, paromamine, neamine, apramycin, kanamycin, and gentamicin C, were all acylated. Since the g-L-GluAHBA–SNAC thioester was also hydrolyzed by the following g-L-glutamyl cyclotransferase, stepwise addition of the two enzymes was required to complete the synthesis of the AHBA derivative (Llewellyn and Spencer, 2008). This chemoenzymatic method could be a promising approach to create a range of AHBA-containing aminoglycosides.
6.5. g-L-glutamyl-butirosin B g-L-glutamyl cyclotransferase As the above-mentioned results show, the enzyme responsible for the final step of AHBA attachment has been clarified as g-L-Glu cyclotransferase. Another product of the reaction, in addition to butirosin B, was found to be
515
Butirosin and Neomycin Biosynthetic Enzymes
pyroglutamate. Thus, this enzyme was characterized as a novel g-L-Glu-butirosin g-L-Glu cyclotransferase. The reaction mechanism was proposed as the direct nucleophilic transamidation of the a-amino group of the g-L-glutamyl moiety to give butirosin B and pyroglutamate Eq. (20.21). An alternative mechanism involving initial formation of a g-L-Glu-enzyme intermediate followed by pyroglutamate formation cannot be excluded. Further detailed biochemical studies are necessary to elucidate the reaction mechanism. NH2 HO HO HO
O H2N H2N O O O
HO OH
OH
H N OH
O
O N H
CO2– NH3+
γ-L-glutamyl-butirosin B γ-L-glutamyl-cyclotransferase
NH2 O
HO HO
H2N HO
H2N OO
O
H N OH
OH NH2
O + pyroglutamate
HO OH Butirosin B
ð20:21Þ
The only remaining butirosin-specific enzyme encoded in the cluster is a putative NADPþ-dependent dehydrogenase, which might be involved in the epimerization at C-300 of butirosin B and ribostamycin to butirosin A and xylostacin, respectively. Or the above-mentioned inactive enzyme as a NAD-dependent 2DOIA dehydrogenase might be involved in this reaction. At the present time, even the timing of the epimerization of the ribose moiety is not clear. Further investigation is therefore required to fully understand the epimerization reaction in the butirosin biosynthetic pathway.
7. Other Related Enzymes in the Biosynthesis of 2DOS-Containing Aminoglycoside Antibiotics Thus far, not so many enzymatic studies on kanamycin, tobramycin and gentamicin have been reported. Only several of the same enzymes in the biosynthesis of 2DOS, paromamine, and neamine have been characterized by enzymatic analyses and gene inactivation studies. Some of the enzymes from the kanamycin biosynthetic pathway are covered in Chapter 19 in this volume. Thus far, the basic enzymatic reactions from G6P to 2DOS, paromamine, and neamine are believed to be the same as characterized in butirosin and neomycin biosynthesis. Although several branching enzymatic reactions such as deamination, deoxygenations, methylations, and glycosylations should be involved, no specific enzyme for such reactions has been enzymatically characterized yet. One important study by heterologous expression of several enzymes encoded in the gentamicin biosynthetic gene cluster in Streptomyces venezuelae showed the involvement of a novel type of glycosyltransferase, which catalyzes xylose transfer onto paromamine in the biosynthesis of gentamicin (Park et al., 2008). Although detailed studies are required, this is definitely a branching enzyme among structurally diverse 2DOS-containing aminoglycoside antibiotics. Another recent important finding by gene
516
Fumitaka Kudo and Tadashi Eguchi
inactivation is that a radical SAM enzyme is involved after gentamicin A2 formation (Kim et al., 2008). Further enzymatic analysis will show more detailed enzymatic reaction mechanisms in this class of antibiotics.
8. Concluding Remarks and Future Perspectives The sequential biosynthetic pathways leading to butirosin and neomycin have been mostly enzymatically characterized. This knowledge shed light on the other related aminoglycoside biosynthetic enzymology. These researches also provided fundamental insights into unexpected enzymatic functions, such as the AHBA biosynthetic enzymes and radical SAM dehydrogenase. Thus, characterizations of secondary metabolite biosynthetic enzymes expand general knowledge of enzymatic catalysis, in addition to understanding complex secondary metabolism. The epimerization steps in both butirosin and neomycin biosynthetic pathways are still unclear. These enzymatic reactions should be quite unique to each biosynthetic pathway and thus expand the molecular diversity of aminoglycoside antibiotics. Although structurally related kanamycin-, tobramycin- and gentamicinspecific biosynthetic enzymes are not enzymatically characterized, the branching enzymes will be functionally characterized based on the knowledge of the butirosin and neomycin biosynthetic enzymes. Then, in future, combinatorial enzymatic synthesis of aminoglycoside antibiotics, which might produce significant biological activities, should be possible. For the purpose, in addition to characterization of enzymes, further detailed biochemical studies on the biosynthetic enzymes will be needed.
REFERENCES Ahlert, J., Distler, J., Mansouri, K., and Piepersberg, W. (1997). Identification of stsC, the gene encoding the L-glutamine:scyllo-inosose aminotransferase from streptomycinproducing Streptomycetes. Arch. Microbiol. 168, 102–113. Burns, K. E., Xiang, Y., Kinsland, C. L., McLafferty, F. W., and Begley, T. P. (2005). Reconstitution and biochemical characterization of a new pyridoxal-50 -phosphate biosynthetic pathway. J. Am. Chem. Soc. 127, 3682–3683. Eguchi, T., Sasaki, S., Huang, Z., and Kakinuma, K. (2002). Importance of specific hydrogen-bond donor-acceptor interactions for the key carbocycle-forming reaction catalyzed by 2-deoxy-scyllo-inosose synthase in the biosynthesis of 2-deoxystreptamine– containing aminocyclitol antibiotics. J. Org. Chem. 67, 3979–3984. Fan, Q., Huang, F., Leadlay, P. F., and Spencer, J. B. (2008). The neomycin biosynthetic gene cluster of Streptomyces fradiae NCIMB 8233: Genetic and biochemical evidence for the roles of two glycosyltransferases and a deacetylase. Org. Biomol. Chem. 6, 3306–3314. Flatt, P. M., and Mahmud, T. (2007). Biosynthesis of aminocyclitol-aminoglycoside antibiotics and related compounds. Nat. Prod. Rep. 24, 358–392.
Butirosin and Neomycin Biosynthetic Enzymes
517
Hirayama, T., Kudo, F., Huang, Z., and Eguchi, T. (2007). Role of glutamate 243 in the active site of 2-deoxy-scyllo-inosose synthase from Bacillus circulans. Bioorg. Med. Chem. 15, 418–423. Hirayama, T., Tamegai, H., Kudo, F., Kojima, K., Kakinuma, K., and Eguchi, T. (2006). Biosynthesis of 2-deoxystreptamine-containing antibiotics in Streptoalloteichus hindustanus JCM 3268: Characterization of 2-deoxy-scyllo-inosose synthase. J. Antibiot. 59, 358–361. Huang, F., Haydock, S. F., Mironenko, T., Spiteller, D., Li, Y., and Spencer, J. B. (2005a). The neomycin biosynthetic gene cluster of Streptomyces fradiae NCIMB 8233: Characterisation of an aminotransferase involved in the formation of 2-deoxystreptamine. Org. Biomol. Chem. 3, 1410–1418. Huang, F., Li, Y., Yu, J., and Spencer, J. B. (2002). Biosynthesis of aminoglycoside antibiotics: Cloning, expression and characterization of an aminotransferase involved in the pathway to 2-deoxystreptamine. Chem. Commun. 2860–2861. Huang, F., Spiteller, D., Koorbanally, N. A., Li, Y., Llewellyn, N. M., and Spencer, J. B. (2007). Elaboration of neosamine rings in the biosynthesis of neomycin and butirosin. ChemBioChem 8, 283–288. Huang, Z., Kakinuma, K., and Eguchi, T. (2005b). Stereospecificity of hydride transfer in NADþ-catalyzed 2-deoxy-scyllo-inosose synthase, the key enzyme in the biosynthesis of 2-deoxystreptamine-containing aminocyclitol antibiotics. Bioorg. Chem. 33, 82–89. Iwase, N., Kudo, F., Yamauchi, N., and Kakinuma, K. (1998). Biochemical studies on 2-deoxy-scyllo-inosose, an early intermediate in the biosynthesis of 2-deoxystreptamine. VII. Substrate specificity of 2-deoxy-scyllo-inosose synthase, the starter enzyme for 2-deoxystreptamine biosynthesis, toward deoxyglucose-6-phosphates and proposed mechanism. Biosci. Biotechnol. Biochem. 62, 2396–2407. Kakinuma, K., Nango, E., Kudo, F., Matsushima, Y., and Eguchi, T. (2000). An expeditious chemo-enzymatic route from glucose to catechol by the use of 2-deoxy-scyllo-inosose synthase. Tetrahedron Lett. 41, 1935–1938. Kharel, M. K., Basnet, D. B., Lee, H. C., Liou, K., Woo, J. S., Kim, B. G., and Sohng, J. K. (2004a). Isolation and characterization of the tobramycin biosynthetic gene cluster from Streptomyces tenebrarius. FEMS Microbiol. Lett. 230, 185–190. Kharel, M. K., Subba, B., Basnet, D. B., Woo, J. S., Lee, H. C., Liou, K., and Sohng, J. K. (2004b). A gene cluster for biosynthesis of kanamycin from Streptomyces kanamyceticus: Comparison with gentamicin biosynthetic gene cluster. Arch. Biochem. Biophy. 429, 204–214. Kharel, M. K., Subba, B., Lee, H. C., Liou, K., and Sohng, J. K. (2005). Characterization of L-glutamine:2-deoxy-scyllo-inosose aminotransferase (tbmB) from Streptomyces tenebrarius. Bioorg. Med. Chem. Lett. 15, 89–92. Kieser, T., Bibb, M. J., Buttner, M. J., Chater, K. F., and Hopwood, D. A. (2000). ‘‘Practical Streptomyces genetics.’’ Norwich, UK: The John Innes Foundation, Norwich, UK. Kim, J. Y., Suh, J. W., Kang, S. H., Phan, T. H., Park, S. H., and Kwon, H. J. (2008). Gene inactivation study of gntE reveals its role in the first step of pseudotrisaccharide modifications in gentamicin biosynthesis. Biochem. Biophys. Res. Commun. 372, 730–734. Kogure, T., Wakisaka, N., Takaku, H., and Takagi, M. (2007). Efficient production of 2-deoxy-scyllo-inosose from D-glucose by metabolically engineered recombinant Escherichia coli. J. Biotechnol. 129, 502–509. Kondo, S., and Hotta, K. (1999). Semisynthetic aminoglycoside antibiotics: Development and enzymatic modifications. J. Infect. Chemother. 5, 1–9. Kudo, F., Fujii, T., Kinoshita, S., and Eguchi, T. (2007). Unique O-ribosylation in the biosynthesis of butirosin. Bioorg. Med. Chem. 15, 4360–4368. Kudo, F., Hosomi, Y., Tamegai, H., and Kakinuma, K. (1999a). Purification and characterization of 2-deoxy-scyllo-inosose synthase derived from Bacillus circulans. A crucial
518
Fumitaka Kudo and Tadashi Eguchi
carbocyclization enzyme in the biosynthesis of 2-deoxystreptamine-containing aminoglycoside antibiotics. J. Antibiot. 52, 81–88. Kudo, F., Tamegai, H., Fujiwara, T., Tagami, U., Hirayama, K., and Kakinuma, K. (1999b). Molecular cloning of the gene for the key carbocycle-forming enzyme in the biosynthesis of 2-deoxystreptamine-containing aminocyclitol antibiotics and its comparison with dehydroquinate synthase. J. Antibiot. 52, 559–571. Kudo, F., Yamamoto, Y., Yokoyama, K., Eguchi, T., and Kakinuma, K. (2005). Biosynthesis of 2-deoxystreptamine by three crucial enzymes in Streptomyces fradiae NBRC 12773. J. Antibiot. 58, 766–774. Kurumbang, N. P., Oh, T. J., Liou, K., and Sohng, J. K. (2008). Heterologous production and detection of recombinant directing 2-deoxystreptamine (DOS). in the nonaminoglycoside-producing host Streptomyces venezuelae YJ003. J. Microbiol. Biotechnol. 18, 866–873. Li, Y., Llewellyn, N. M., Giri, R., Huang, F., and Spencer, J. B. (2005). Biosynthesis of the unique amino acid side chain of butirosin: Possible protective-group chemistry in an acyl carrier protein–mediated pathway. Chem. Biol. 12, 665–675. Llewellyn, N. M., Li, Y., and Spencer, J. B. (2007). Biosynthesis of butirosin: Transfer and deprotection of the unique amino acid side chain. Chem. Biol. 14, 379–386. Llewellyn, N. M., and Spencer, J. B. (2006). Biosynthesis of 2-deoxystreptamine-containing aminoglycoside antibiotics. Nat. Prod. Rep. 23, 864–874. Llewellyn, N. M., and Spencer, J. B. (2008). Chemoenzymatic acylation of aminoglycoside antibiotics. Chem. Commun. 3786–3788. Lucher, L. A., Chen, Y. M., and Walker, J. B. (1989). Reactions catalyzed by purified L-glutamine:keto-scyllo-inositol aminotransferase, an enzyme required for biosynthesis of aminocyclitol antibiotics. Antimicrob. Agents Chemother. 33, 452–459. Nango, E., Kumasaka, T., Hirayama, T., Tanaka, N., and Eguchi, T. (2008). Structure of 2-deoxy-scyllo-inosose synthase, a key enzyme in the biosynthesis of 2-deoxystreptaminecontaining aminoglycoside antibiotics, in complex with a mechanism-based inhibitor and NADþ. Proteins 70, 517–527. Park, J. W., Hong, J. S., Parajuli, N., Jung, W. S., Park, S. R., Lim, S. K., Sohng, J. K., and Yoon, Y. J. (2008). Genetic dissection of the biosynthetic route to gentamicin A2 by heterologous expression of its minimal gene set. Proc. Natl. Acad. Sci. USA 105, 8399–8404. Piepersberg, W., Aboshanab, K. M., Schmidt-BeiBner, H., and Wehmeier, U. F. (2007). The biochemistry and genetics of aminoglycoside producers. In ‘‘Aminoglycoside Antibiotics: From Chemical Biology to Drug Discovery.’’ (D. P. Arya, ed.), pp. 15–118. Wiley-Interscience, Hoboken, NJ. Popovic, B., Tang, X., Chirgadze, D. Y., Huang, F., Blundell, T. L., and Spencer, J. B. (2006). Crystal structures of the PLP- and PMP-bound forms of BtrR, a dual functional aminotransferase involved in butirosin biosynthesis. Proteins 65, 220–230. Sambrook, J., Fritsch, E. F., and Maniatis, T. (2001). ‘‘Molecular cloning:. A laboratory manual,’’ 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Subba, B., Kharel, M. K., Lee, H. C., Liou, K., Kim, B. -G., and Sohng, J. K. (2005). The ribostamycin biosynthetic gene cluster in Streptomyces ribosidificus: Comparison with butirosin biosynthesis. Mol. Cells 20, 90–96. Suzukake, K., Tokunaga, K., Hayashi, H., Hori, M., Uehara, Y., Ikeda, D., and Umezawa, H. (1985). Biosynthesis of 2-deoxystreptamine. J. Antibiot. 38, 1211–1218. Tamegai, H., Nango, E., Koike-Takeshita, A., Kudo, F., and Kakinuma, K. (2002a). Significance of the 20-kDa subunit of heterodimeric 2-deoxy-scyllo-inosose synthase for the biosynthesis of butirosin antibiotics in Bacillus circulans. Biosci. Biotechnol. Biochem. 66, 1538–1545.
Butirosin and Neomycin Biosynthetic Enzymes
519
Tamegai, H., Nango, E., Kuwahara, M., Yamamoto, H., Ota, Y., Kuriki, H., Eguchi, T., and Kakinuma, K. (2002b). Identification of L-glutamine: 2-deoxy-scyllo-inosose aminotransferase required for the biosynthesis of butirosin in Bacillus circulans. J. Antibiot. 55, 707–714. Truman, A. W., Huang, F., Llewellyn, N. M., and Spencer, J. B. (2007). Characterization of the enzyme BtrD from Bacillus circulans and revision of its functional assignment in the biosynthesis of butirosin. Angew. Chem. Int. Ed. Engl. 46, 1462–1464. Walker, J. B., and Walker, M. S. (1969). Streptomycin biosynthesis. Transamination reactions involving inosamines and inosadiamines. Biochemistry 8, 763–770. Wang, S. C., and Frey, P. A. (2007). S-adenosylmethionine as an oxidant: The radical SAM superfamily. Trends Biochem. Sci. 32, 101–110. Yamauchi, N., and Kakinuma, K. (1992). Biochemical studies on 2-deoxy-scyllo-inosose, an early intermediate in the biosynthesis of 2-deoxystreptamine. III. Confirmation of in vitro synthesis of 2-deoxy-scyllo-inosose, the earliest intermediate in the biosynthesis of 2-deoxystreptamine, using cell free preparations of Streptomyces fradiae. J. Antibiot. 45, 774–780. Yokoyama, K., Kudo, F., Kuwahara, M., Inomata, K., Tamegai, H., Eguchi, T., and Kakinuma, K. (2005). Stereochemical recognition of doubly functional aminotransferase in 2-deoxystreptamine biosynthesis. J. Am. Chem. Soc. 127, 5869–5874. Yokoyama, K., Numakura, M., Kudo, F., Ohmori, D., and Eguchi, T. (2007). Characterization and mechanistic study of a radical SAM dehydrogenase in the biosynthesis of butirosin. J. Am. Chem. Soc. 129, 15147–15155. Yokoyama, K., Ohmori, D., Kudo, F., and Eguchi, T. (2008a). Mechanistic study on the reaction of a radical SAM dehydrogenase BtrN by electron paramagnetic resonance spectroscopy. Biochemistry 47, 8950–8960. Yokoyama, K., Yamamoto, Y., Kudo, F., and Eguchi, T. (2008b). Involvement of two distinct N-acetylglucosaminyltransferases and a dual-function deacetylase in neomycin biosynthesis. ChemBioChem 9, 865–869. Yu, Y., Hou, X., Ni, X., and Xia, H. (2008). Biosynthesis of 30 -deoxy-carbamoylkanamycin C in a Streptomyces tenebrarius mutant strain by tacB gene disruption. J. Antibiot. 61, 63–69. Yukita, T., Nishida, H., Eguchi, T., and Kakinuma, K. (2003). Biosynthesis of (2R)4-amino-2-hydroxybutyric acid, unique and biologically significant substituent in butirosins. J. Antibiot. 56, 497–500.
C H A P T E R
T W E N T Y- O N E
Enzymatic Synthesis of TDP-Deoxysugars Jessica White-Phillip,* Christopher J. Thibodeaux,* and Hung-wen Liu*,†,‡ Contents 1. Introduction 2. Enzymatic Synthesis of TDP-a-D-glucose 2.1. Preparation of enzymes required for in vitro synthesis of TDP-a-D-glucose (5) 2.2. Enzymatic synthesis of TDP-a-D-glucose (5) 2.3. Purification of TDP-a-D-glucose (5) 3. Generation of TDP-4-keto-6-deoxy-a-D-glucose (6) 3.1. Generation of TDP-2,6-dideoxysugars 4. In vitro Reconstitution of Entire Deoxysugar Biosynthetic Pathways 4.1. One-pot synthesis of TDP-a-D-mycaminose (12) 4.2. Two-stage one-pot synthesis of TDP-b-L-mycarose (13) 4.3. Multistep enzymatic synthesis of TDP-a-D-forosamine (14) 4.4. TDP-a-D-desosamine (11) 5. Synthesis of Deoxysugars In Vivo by Metabolic Pathway Engineering 6. Summary Acknowledgment References
522 524 525 526 527 529 531 533 534 535 536 538 539 541 542 542
Abstract Many biologically active bacterial natural products contain highly modified deoxysugar residues that are often critical for the activity of the parent compounds. Most of these deoxysugars are secondary metabolites that are biosynthesized in the form of nucleotide diphosphate (NDP) sugars prior to their transfer to natural product aglycones by glycosyltransferases. Over the past decade, many biosynthetic pathways that lead to the formation of these
* { {
Institute for Cellular and Molecular Biology, University of Texas-Austin, Austin, Texas, USA College of Pharmacy, University of Texas-Austin, Austin, Texas, USA Department of Chemistry and Biochemistry, University of Texas-Austin, Austin, Texas, USA
Methods in Enzymology, Volume 459 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)04621-7
#
2009 Elsevier Inc. All rights reserved.
521
522
Jessica White-Phillip et al.
unusual sugars have been unraveled, and the mechanisms of many key enzymatic transformations involved in these pathways have been elucidated. However, obtaining workable quantities of NDP-deoxysugars for in vitro studies is often a difficult task. This limitation has hindered an in-depth investigation of the substrate specificity of deoxysugar biosynthetic enzymes, many of which are promiscuous with respect to their NDP-sugar substrates and are, thus, potentially useful catalysts for natural product glycoengineering. Presented in this review are procedures for the enzymatic synthesis and purification of a variety of NDP-deoxysugars, including some early intermediates in NDP-deoxysugar biosynthetic pathways, and highly modified NDP-deoxysugars that are late intermediates in their respective biosynthetic pathways. The procedures described herein could be used as general guidelines for the development of specific protocols for the synthesis of other NDP-deoxysugars.
1. Introduction Glycosylation is important for the biological activity of macrolide, peptide, and aminoglycoside antibiotics as well as numerous anticancer, antiparasitic, and antifungal agents of diverse biosynthetic origin (Lamb and Wright, 2005; Mendez and Salas, 2001; Walsh et al., 2003). These sugar residues play crucial biological roles in many natural products and their removal oftentimes results in the loss of biological activity (Mendez and Salas, 2001; Thorson et al., 2001; Weymouth-Wilson, 1997). The most chemically diverse group of carbohydrate moieties found in secondary metabolites are 6-deoxyhexoses, which are produced by a variety of organisms, but are most prevalent in actinomycetes, a group of soil bacteria that are a rich source of biologically active secondary metabolites (Salas and Mendez, 2007). For many of the natural product biosynthetic pathways found in these organisms, a combination of experimental evidence and database comparisons has been used to identify the deoxysugar biosynthetic genes and to delineate the corresponding biosynthetic pathways (reviewed in Thibodeaux et al., 2008). Altering and/or exchanging the sugar structures and points of aglycone attachment in natural products is a feasible route to enhance or vary the physiological properties of these compounds. Importantly, it has been discovered that many natural product glycosyltransferases (or GTs enzymes which link activated sugar donors to aglycone acceptors) exhibit relaxed substrate specificity. This discovery has resulted in an explosion in the use of these GTs to engineer natural products with altered glycosylation patterns, and has generated several broad and complementary glycoengineering strategies (Thibodeaux et al., 2007, 2008). For in vivo glycodiversification, deoxysugar biosynthetic pathways can be altered within a producing bacterial strain using gene disruption and/or heterologous gene
Enzymatic Synthesis of TDP-Deoxysugars
523
expression methods in order to reroute sugar biosynthetic intermediates to new final products. Alternatively, new biosynthetic pathways can be assembled in hosts that do not normally produce glycosylated natural products. Furthermore, these genetically engineered bacteria can be fed with non-native aglycones or they can be transformed with additional plasmids in order to produce novel compounds in a combinatorial fashion. In vitro, purified wildtype or engineered sugar biosynthetic enzymes can be used to synthesize specific natural product glycoforms, as well as to prepare libraries of novel glycoforms. A detailed understanding of the organization of deoxysugar biosynthetic machinery and of the biochemical properties of the enzymes involved in synthesizing and coupling these sugars to their aglycones is critical to the success of these enzymatic glycoengineering approaches. A significant limitation to in vitro glycodiversification efforts is the availability of activated sugar donor substrates for the promiscuous glycosyltransferases. There are several methods by which activated deoxysugar donors (i.e., NDP-deoxysugars) are generally obtained. Total chemical synthesis, though feasible, often requires significant technical expertise and can be plagued by low yields. Another approach for obtaining highly modified NDP-deoxysugars is to hydrolyze the desired reducing sugar from the natural product, and then to chemically synthesize the NDP sugar from the reducing sugar (Chang et al., 2000; Chen et al., 2002). The recently discovered in vitro reversibility of GT-catalyzed reactions may provide a new synthetic route to some NDP-deoxysugars (Bode and Muller, 2007; Melancon et al., 2006; Minami et al., 2005; Zhang et al., 2006), but it is not yet clear whether this will be a generally applicable method for NDP-deoxysugar synthesis. Thus, we envision that multistep enzymatic and chemoenzymatic synthesis will continue to play an important role in the production of structurally complex, NDP-activated deoxysugar donors for glycobiology and glycoengineering studies. Enzymatic synthesis is appealing for several reasons. Enzymes generally catalyze reactions with well-defined regio- and stereo-chemical preference and enzymes are a readily renewable resource. Furthermore, when manipulated in vitro, it is possible to present these enzymes with substrate analogues that contain chemically incorporated non-natural functional groups. Introduction of certain types of functional groups can allow further chemoselective derivitization to enhance the structural diversity of glycoform libraries (Fu et al., 2003). Here, we provide detailed protocols for the enzymatic synthesis and purification of several thymidine diphosphate (TDP)–activated deoxysugar intermediates that are common to many TDP-deoxysugar biosynthetic pathways in bacteria. These methods should be useful for researchers interested in obtaining workable quantities of a desired TDPdeoxysugar. We also highlight several successful examples of in vitro multistep enzymatic syntheses of highly modified TDP-deoxysugars and discuss how biosynthetic machinery can be manipulated in vivo to generate
524
Jessica White-Phillip et al.
desired deoxysugar structures. For more information on NDP-deoxysugar synthesis, bacterial deoxysugar biosynthesis, mechanistic studies of deoxysugar biosynthetic enzymes, and the application of these enzymes in glycoengineering efforts, the reader is directed to several recent and comprehensive reviews (He et al., 2000; He and Liu, 2002; Langenhan et al., 2005; Luzhetskyy et al., 2008; Mendez et al., 2008; Rupprath et al., 2005; Salas and Mendez, 2007; Thibodeaux et al., 2008).
2. Enzymatic Synthesis of TDP-a-D-glucose Most of the unusual deoxysugars produced by bacterial biosynthetic pathways are derived from a-D-glucose-1-phosphate (1) which is, in turn, derived from D-glucose (2) by direct anomeric phosphorylation, or from glucose-6-phosphate (3) by a phosphohexose mutase-catalyzed reaction (Scheme 21.1). A nucleotide monophosphate (NMP) moiety from a nucleotide triphosphate (NTP) is then coupled to (1) by a nucleotidylyltransferase to generate NDP-glucose (4). While some deoxysugars are derived from primary metabolites and can be activated with other NDP groups, the vast majority of bacterial deoxysugars used in glycosylation of secondary metabolites are TDP-sugars that are biosynthetically derived from TDP-a-Dglucose (5) (Thibodeaux et al., 2007, 2008). Because TDP-a-D-glucose (5) is rather costly, efficient methods for its preparation are desirable. Towards this end, we have developed an efficient and facile one-pot, two-step enzymatic synthesis for 5 (Scheme 21.2) using readily available enzymes and inexpensive substrates (Takahashi et al., 2006). In the first step of this reaction, thymidine is converted to thymidine triphosphate (TTP) by the
HO HO
OH O HO
D-glucose
HO HO
Anomeric kinase OH
(2)
OPO=3 O HO
HO HO Phosphohexose mutase
OH
OH O
= HO OPO3 Glucose 1-phosphate (1)
Nucleotidylyltransferase HO HO NTP
PPi
OH O HO OTDP
NDP-a-Dglucose (4) NDP = TDP (5)
Glucose 6-phosphate (3)
Scheme 21.1 Activation of the glycolytic intermediates D-glucose and glucose6-phosphate. D-Glucose (2) and glucose-6-phosphate (3) can be converted to aD-glucose-1-phosphate (1) by anomeric kinase and phosphohexose mutase, respectively. A nucleotide monophosphate (NMP) moiety is then tranferred from the corresponding NTP to 1 by a nucleotidylyltransferase to form NDP-a-D-glucose (4). Most deoxysugars produced in bacterial secondary metabolism are derived fromTDP-a-D-glucose (5).
525
Enzymatic Synthesis of TDP-Deoxysugars
Step 1 O H
N
Me
NDK
TMK TMP
O N O
HO
TK
ATP
ADP
TDP ATP
ADP
P O
ATP
ADP
O
O
_ O_
H
O
O O P _ O_ P O O O
HO PK
PK
N
Me
O N O HO
PK TTP
Pyr
PEP
Pyr
Pyr
PEP
PEP OH O
Step 2 O O O P O _ O O_ P O P O _ O O
_
HO HO
O H
N
HO OPO=3
Me
1
HO HO
O N O
HO OTDP
RfbA TTP
HO
OH O
PPi
TDP-a-D-glucose (5)
Scheme 21.2 Enzymatic synthesis of TDP-a-D-glucose (5). In the first step of TDP-aD-glucose (5) synthesis, thymidine triphosphate (TTP) is synthesized from thymidine by three successive ATP-dependent phosphorylations catalyzed by thymidine kinase (TK), thymidylate kinase (TMK), and nucleotide diphosphate kinase (NDK). ATP is only needed in catalytic amounts, due to a pyruvate kinase (PK) ATP regeneration system, which transfers a phosphate group from phosphoenol pyruvate (PEP) to ADP, yielding pyruvate (Pyr) and ATP. Removal of the enzymes and addition of a-D-glucose-1-phosphate (1) and RfbA (a thymidylyltransferase from S. enterica) leads to the synthesis of TDP-a-D-glucose (5).
sequential action of three separate ATP-dependent kinases (thymidine kinase [TK], thymidylate kinase [TMK], and nucleotide diphosphate kinase [NDK]). ATP is continually regenerated by pyruvate kinase at the expense of phosphoenol pyruvate (PEP). In the second step of the synthesis, a TMP moiety from TTP is coupled to a-D-glucose-1-phosphate (1) by RfbA, an a-D-glucose-1-phosphate thymidylyltransferase from Salmonella enterica. The resulting TDP-a-D-glucose (5) can then be purified or used directly for subsequent enzymatic transformation.
2.1. Preparation of enzymes required for in vitro synthesis of TDP-a-D-glucose (5) The genes encoding thymidine kinase (TK), thymidylate kinase (TMK), and nucleotide diphosphate kinase (NDK) can be amplified from the genomic DNA of Escherichia coli strain HMS174 and cloned in tandem into a single pET28b (þ) plasmid, such that each gene has its own ribosome binding site and a His6-tag. The three enzymes can then be coexpressed from the same plasmid in E. coli BL21(DE3) using standard growth and induction conditions. Typically, we inoculate LB medium (supplemented
526
Jessica White-Phillip et al.
with 50 mg/ml kanamycin) with a 1:500 dilution from an overnight culture, grow the cells at 37 , induce with 0.3 mM isopropyl a-thiogalactoside (IPTG) at OD600 readings of 0.4 to 0.6, and continue to grow for 18 h at 25 . Cells are then harvested by centrifugation, lysed by sonication, and centrifuged to remove cellular debris. The recombinant TK/TMK/NDK enzymes are then purified from the resulting supernatant using Ni-NTA affinity chromatography. We generally use 150 mM NaCl in our lysis, wash, and elution buffers, as opposed to the 300 mM recommended in the QIAexpressionist protocol. The mixture of purified TK/TMK/NDK enzymes is dialyzed against 50 mM potassium phosphate buffer (pH 7.5) containing 15% glycerol. In parallel, rabbit muscle pyruvate kinase from Sigma (purchased as a 400 to 800 units/mg ammonium sulfate precipitate) is dissolved in water to a concentration of 2500 units/ml, dialyzed against buffer (50 mM NaH2PO4, 300 mM NaCl, pH 8.0) to remove the ammonium sulfate, dispensed in 500-ml to 1-ml aliquots, flash frozen in liquid nitrogen, and stored at –80 . The rfbA gene is PCR-amplified from S. enterica serovar Typhimurium LT2 genomic DNA with an upstream ribosome binding site (RBS)/translational spacer element (TSE) and is inserted into a pUC18 vector. A (His)5-tag is added to the C-terminus of RfbA by PCR amplification of the rfbA insert of plasmid rfbA/pUC18. The newly synthesized gene is then cloned into the same vector, and the resulting plasmid, rfbA-(His)5/pUC18, introduced by transformation into BL21(DE3) for protein expression. Expression and purification conditions are identical to those for the TK/TMK/NDK enzymes, except that 100 mg/ml ampicillin is used for selection. Induction with IPTG is unnecessary. The approximate amount of RfbA purified from an average 6 l culture is 140 mg. Each liter of culture produces enough RfbA to perform one large-scale TDP-a-D-glucose synthesis reaction.
2.2. Enzymatic synthesis of TDP-a-D-glucose (5) In the first step of TDP-a-D-glucose synthesis, a 15-ml reaction mixture containing phosphoenol pyruvate (PEP, 85.6 mM ), thymidine (27 mM ), ATP (1.8 mM ), and MgCl2 (30 mM ) in 50 mM TrisHCl buffer (pH 7.5) is prepared. After the addition of these reagents, the pH of the solution is adjusted to 7.5 using NaOH or HCl prior to the addition of enzymes. Pyruvate kinase (PK, 1000 units) and 30 mg of the TK/TMK/NDK enzyme mixture are added to give final concentrations of 25 to 30 mM for each of the TK/TMK/NDK enzymes. The reaction mixture is incubated at 37 for 4 h, and then filtered through an Amicon ultrafiltration cell unit (YM-10 membrane) under nitrogen at 4 to remove the enzymes. The flowthrough is collected in a 50-ml conical tube and the pH adjusted to 7.5. This flowthrough contains TTP and will be used in the next step.
Enzymatic Synthesis of TDP-Deoxysugars
527
To synthesize TDP-a-D-glucose (5), a mixture containing TTP, a-Dglucose-1-phosphate (1, 4 mM ), MgCl2 (30 mM ), and recombinant RfbA (47 mM ) is prepared. This reaction mixture is incubated at 30 to 37 for 12 to 16 h. It is important to keep the Mg2þ ion concentration similar to that of TTP, as a high molar excess of Mg2þ (over TTP) is known to adversely affect the activity of RfbA (Amann et al., 2001). After the reaction is completed, any precipitate is removed by centrifugation at 5000g for 10 min at 4 . RfbA is then removed by filtering the supernatant through either a YM-10 Amicon stirred cell unit or a 50-ml conical centrifugal filter unit at 4 . TDP-D-glucose (5) present in the flowthrough can now be purified or used directly for the following enzymatic reactions.
2.3. Purification of TDP-a-D-glucose (5) TDP-a-D-glucose (5) can be purified with either anion exchange or sizeexclusion chromatography. When using the size-exclusion method, the sample containing 5 should be frozen and lyophilized to reduce the volume to 1 to 2 ml. It is important to note that many TDP-sugars degrade significantly if lyophilized to dryness without removing salts. For this reason, if the stability of a particular NDP-sugar is not known, it is always best to lyophilize to half-volume, dilute with the appropriate solvent, and lyophilize to half-volume again. This cycle can be repeated as necessary to exchange solvents or to remove volatile substances. When the concentrated TDP-a-D-glucose is thawed, the sample typically appears as a slightly yellowish syrup. If purifying by FPLC using a MonoQ column, the TDP-a-D-glucose sample does not need to be lyophilized/ concentrated before purification. 2.3.1. Purification using size-exclusion chromatography A P2 biogel (Biorad) column (2.5 100 cm) is packed following the manufacturer’s instructions and equilibrated with 1 l of filtered ddH2O at 4 . After washing, the solvent above the column bed is removed and the concentrated (1-2 ml) TDP-a-D-glucose-containing reaction mixture is carefully applied to the top of the resin bed. The sample is introduced into the resin by gravity flow, ensuring that the resin bed does not dry. After the sample has been loaded onto the column, water is used to elute the TDP-sugar product. An adjustable pneumatic pump is used to maintain the flow rate at about 6 to 12 ml per hour. Under these conditions, 5 will generally be eluted from the column around 24 to 48 h after loading. Fractions eluted from the P2 column can be analyzed by UV-Vis spectroscopy for the presence of 5 (e267 = 9600 M–1cm–1). Usually, there will be a sharp rise in absorbance in the first fraction containing 5, followed by 10 to 12 fractions with high absorbance readings, and then a sharp decrease in absorbance to baseline. The fractions comprising the absorbance plateau are individually frozen and lyophilized until their purity can be verified by HPLC or NMR spectroscopy.
528
Jessica White-Phillip et al.
To verify the purity of the fractions from the P2 size-exclusion column, HPLC analysis is performed using a Dionex Carbopac PA1 column and a 20-ml sample injection volume. With water as solvent A and 500 mM NH4OAc (adjusted to pH 7.0 with aqueous NH3) as solvent B, the following gradient elution is typically used: 5 to 20% B over 15 min, 20 to 60% B over 20 min, 60 to 100% B over 2 min, 3-min wash at 100% B, 100 to 5% B over 5 min, and re-equilibration at 5% B for 15 min. The flow rate is 1 ml/min and the detector is set at 267 nm. Under these conditions, the retention times for compounds are as follows: TDP-a-D-glucose (31 to 33 min), TMP (25 min), and TDP (41 to 42 min). In samples of high concentration, TDP-a-D-glucose (5) may be eluted anywhere from 30 to 34 min, but will still appear as a very sharp, well-defined peak in the HPLC trace. Fractions are pooled based on purity either before or after lyophilization. The final concentration of 5 in pooled fractions can be determined spectrophotometrically (e267 = 9600 M–1cm–1). The theoretical yield for this reaction is 228 mg (based on a 15 ml reaction and the substrate concentrations described in 1.2), but the actual yields range from 150 to 200 mg, depending on one’s experience with the methodology. Most commonly, one will find that 10% of the product will be greater than 90% pure, 40% will be 90 to 80% pure, 40% will be 80 to 70% pure, and the remaining 10% will be less than 70% pure. The most abundant contaminants using P2 size-exclusion chromatography as the method of purification are TMP and TDP, both of which can be removed by further FPLC purification. However, we have found that further purification is usually unnecessary if 5 is to be used in enzymatic reactions with high yield (i.e., >90% conversion). 2.3.2. FPLC Purification of TDP-a-D-glucose (5) As mentioned above, P2 chromatography will separate the majority of unreacted a-D-glucose-1-phosphate (1) from the desired TDP-a-D-glucose product (5). However, only about 10% of 5 will be greater than 90% pure, with the remainder being contaminated by TDP and TMP. The majority of TDP and TMP in these samples can be removed if the P2 fractions are subjected to anion exchange chromatography. It should be noted that, in many cases, the enzymatically synthesized TDP sugars can be purified directly by FPLC, bypassing the P2 purification step. Purification of 5 can be achieved by FPLC using a Mono Q 10/10 or 16/10 column with a gradient, where HPLC-grade water is buffer A and 400 mM NH4HCO3 in water (pH 8.2) is buffer B. Flow rates of 1 or 4 ml/min are used for the 10/10 and 16/10 columns, respectively. To elute 5, the following gradient is used: from 0 to 10% B over 0.5 column volumes, from 10 to 40% B over four column volumes (which will elute the TDP-sugar), and from 40 to 100% B over 0.5 column volumes. The column is then washed with 100% B for two-column volumes, followed by reduction to 0% B over 0.5 column volumes, and re-equilibration at 0% B over
Enzymatic Synthesis of TDP-Deoxysugars
529
three-column volumes. TDP-a-D-glucose (5) will be eluted at approximately 30 min. Other important peaks include TMP and TDP, which have retention times of 29 min and 34 min, respectively. Fractions containing the major peak from each injection should be lyophilized individually, redissolved in water, and lyophilized again to remove NH4HCO3. Alternatively, fractions can be desalted using a G-10 column (see Section 2.3.3), lyophilized, redissolved in water, and lyophilized again. The purities of these fractions should be analyzed by 1H and 31P NMR spectroscopy and typically range from 50 to 90%. If one begins with pre-purified 5 (from P2 column), the purity will be much higher, ranging from 75 to 95%. The most common residual contaminant is TMP. The resolution of the Mono-Q column is not sufficient to completely separate TMP from TDP-a-D-glucose (5) in cases of large injection volumes or high concentrations of samples. From this method, one can typically obtain an average of 25 mg of 90% pure TDP-a-D-glucose from 150-200 mg of 5. 2.3.3. Desalting FPLC fractions To desalt the FPLC fractions, a Sephadex G-10 desalting column (25 mm 50 cm) is prepared according to manufacturer’s instructions. After loading the FPLC fraction, the column is washed with 1 l HPLC-grade water using gravity flow (24 ml/h) at 4 . Fractions of 2 ml are collected over a period of 12 to 15 h. TDP-a-D-glucose is typically eluted over 5 to 10 fractions within 8 h. Fractions displaying significant absorbance at 267 nm are combined, lyophilized to near dryness, resuspended in HPLC-grade water, and lyophilized again to remove the remaining NH4HCO3 from the TDP-sugar. After desalting, TDP-a-D-glucose is quite stable and can be stored for months at – 80 , although multiple freeze–thaw cycles should be avoided. For the majority of enzymatic reactions, we have found that the presence of small amounts of contaminating TMP or TDP do not significantly affect subsequent enzymatic reactions. Thus, TDP-a-D-glucose of greater than 85% purity obtained after P2 size-exclusion chromatography or FPLC purification is generally sufficient. For applications that require a much higher substrate purity, such as kinetic analysis or in situ 1H NMR spectroscopic assays to determine the activity of sugar biosynthetic enzymes, the complete purification sequence of P2, FPLC, and G-10 chromatography should be followed to achieve greater than 95% purity.
3. Generation of TDP-4-keto-6-deoxy-aD-glucose (6) TDP-4-keto-6-deoxy-a-D-glucose (6) is produced from TDP-a-Dglucose (5) by the action of TDP-glucose-4,6-dehydratase (4,6-DH, Scheme 21.3). TDP-4-keto-6-deoxy-a-D-glucose is a common intermediate in many
530
Jessica White-Phillip et al.
OH O
HO HO
4,6-DH
O
Me
NAD+
HO OTDP
O
HO HO
OTDP
TDP-4-keto-6-deoxya-D-glucose (6)
TDP-a-D-glucose (5)
2-DH
O
Me
HO
3-KR Equatorial
O
O
Me
Me
O
O HO
O 8
OTDP
7
O maltol
3-KR Equatorial O
OTDP
3-AT
Me O HO
O OTDP
9
Me O
H2N 10
OTDP
Scheme 21.3 EarlyTDP-deoxysugar biosynthetic intermediates. The key intermediate in TDP-deoxysugar biosynthesis is TDP-4-keto-6-deoxy-a-D-glucose (6), which is synthesized from 5 by a TDP-glucose-4,6-dehydratase enzyme (4,6-DH). This intermediate is a branching point for the biosynthetic pathways of TDP-deoxysugars. For 2,6-dideoxyhexoses, 6 is converted to the unstable intermediate 7 by a 2-dehydratase (2-DH).This intermediate can then be reduced by a 3-ketoreductase (3-KR) to give 8 or 9, or it can be transaminated by a 3-aminotransferase (3-AT) to give10.
sugar biosynthetic pathways. The 4-keto group provides a chemically versatile handle that can be manipulated by deoxysugar biosynthetic enzymes to produce structurally diverse products. Due to such versatility, the ready availability of this sugar is important for the investigation of many interesting deoxysugar biosynthetic enzymes. Not surprisingly, several useful methods for the synthesis of 6 have been developed (Elling et al., 2005; Oh et al., 2003; Rupprath et al., 2005; Stein et al., 1998). To enzymatically synthesize this sugar, we cloned rfbB (the 4,6-DH from S. enterica serovar Typhimurium LT2) into the pUC18 vector and expressed the recombinant RfbB-(His)5 protein in E. coli BL21(DE3) in a manner similar to that described in Section 1.1 for the RfbA-(His)5 construct (Melancon et al., 2007; Takahashi et al., 2006). Recombinant RfbB was purified by affinity chromatography using Ni-NTA resin (Qiagen) according to the manufacturer’s instructions, with the exception that 10% glycerol was included in the lysis, wash, and elution buffers. RfbB was then dialyzed against 50 mM NaH2PO4 buffer, 300 mM NaCl, 15% glycerol (pH 8.0), concentrated, flash frozen in liquid nitrogen, and stored at –80 until use. The yield of RfbB is generally 80 mg per liter of growth culture.
Enzymatic Synthesis of TDP-Deoxysugars
531
A typical RfbB reaction contains 5 (25 mg) and RfbB (5 mg) in 2 ml of 50 mM TrisHCl buffer (pH 7.5). Incubation is carried out at 30 for 3 to 4 h. The reaction is slightly slower at 30 , but less degradation of 5 occurs at this temperature. Some published procedures (Amann et al., 2001; Stein et al., 1998) use alkaline phosphatase (2 units/ml) to suppress any competitive inhibition by TDP, but we have found its inclusion to be unnecessary. The progress of the reaction can be monitored by HPLC using a CarbopacPA1 column (Dionex). To assess the progress of the reaction, 20- to 30-ml reaction aliquots are removed at appropriate time intervals and subjected to a prewashed YM-10 microcon centrifugal filter unit to remove RfbB. The flowthrough is then injected into HPLC and the TDP-sugars (5 and 6) are eluted using the conditions described in Section 2.3.1. The retention times for 5 and 6 are 31 to 33 min and 33.5 to 35 min, respectively. The peak for 6 is slightly broader than that for 5. For maximum yields, it is best to use fresh RfbB enzyme that has not been subjected to multiple freeze–thaw cycles. Using this method, we have achieved a reproducible yield of 95% before purification. After the conversion of 5 to 6 is completed, RfbB can be removed by filtration though either an Amicon stirred cell unit equipped with a YM-10 membrane or a larger centrifugal filter unit. The filtrate, which contains 6, can be directly used in subsequent biosynthetic reactions or divided into smaller aliquots and frozen at –80 for future use. Desalting is necessary if the sample is lyophilized and stored in dry form.
3.1. Generation of TDP-2,6-dideoxysugars Another useful TDP-deoxysugar is TDP-4-keto-2,6-dideoxy-a-D-glucose (8), which is produced from TDP-4-keto-6-deoxy-a-D-glucose (6) at an early stage in the biosynthesis of 2,6-dideoxy sugars (Scheme 21.3). The 2-deoxygenation reaction is catalyzed by a group of enzymes called 2-dehydratases (2-DH) that employ a metal ion to convert 6 into a 3,4diketo sugar intermediate 7 (Chen et al., 1999; Draeger et al., 1999). The 3-keto group of 7 has one of two fates in different biosynthetic pathways: it can be reduced by a 3-ketoreductase (3-KR) to a hydroxyl group with either equatorial (8) or axial (9) stereochemistry, or it can be transaminated by a 3-aminotransferase (3-AT) to give a 3-aminosugar (10). Our group employs TylX3 (a 2-DH) and TylC1 (an axial 3-KR from the tylosin biosynthetic pathway of Streptomyces fradiae) to synthesize 9 from 6 (Chen et al., 1999; Takahashi et al., 2006), and TylX3 and KijD10 (an equatorial 3-KR from the kijanimicin biosynthetic gene cluster of Actinomadura kijaniata) to synthesize 8 from 6 (Zhang et al., 2007). In our experience, the generation of the equatorial 3-OH product (8) from 6 is straightforward, while synthesis of the axial 3-OH sugar (9) from 6 is more problematic. In both cases, excess reductase (5 or 2 molar excess, respectively of either TylC1 or KijD10 as compared to TylX3) is used to drive the reaction forward.
532
Jessica White-Phillip et al.
Cloning, expression and purification of TylX3, TylC1, and KijD10 have been described (Chen et al., 1999; Takahashi et al., 2006; Zhang et al., 2007). In general, these proteins are purified following the protocols given above for RfbA and RfbB. Importantly, 20% glycerol should be included in all purification buffers for TylX3, and 10% glycerol should be present in all reactions performed with TylX3. Due to the instability of the TylX3 product (Scheme 21.3, compound 7), TylX3 should be the last component added to initiate the coupled reactions. Both TylC1 and KijD10 are NADPH-dependent, but many other 3-KR enzymes utilize NADH. 3.1.1. Synthesis of TDP-4-keto-2,6-dideoxy sugars with equatorial C3-OH stereochemistry To synthesize the TDP-4-keto-2,6-dideoxy sugar (8) with equatorial C3-OH stereochemistry, a 3 ml reaction containing 6 (21.8 mM ), NADPH (53 mM ), and 10% glycerol in 50 mM TrisHCl buffer (pH 7.5) is prepared. KijD10 (360 nM ) and TylX3 (160 nM ) are added to initiate the reaction. The reaction mixture is incubated at 25 and the progress of the reaction is monitored by HPLC using the conditions described in section 1.3.1 (the retention times of 6 and 8 are 33 to 34 min and 32 to 33 min, respectively). A degradation product of 7 (maltol, see Scheme 21.3) eluted at 1.7 to 1.8 min is always observed. When freshly purified TylX3 and KijD10 are used, this reaction is complete within 2 to 3 h (after repeated freeze–thaw cycles, KijD10 loses activity). The TylX3/KijD10 coupled reaction is quite efficient and, on average, affords approximately 85% conversion to product (or 20 mg of 8 from 24 mg of 6). With freshly prepared enzyme, we have observed nearly quantitative conversion within 6 h. Prior to its use in any subsequent enzymatic reactions, compound 8 should be purified due to the presence of NADPþ and NADPH in the reaction. The sample (containing 8) should be filtered to remove enzymes and lyophilized to a yellow syrup. Importantly, the frozen sample must be removed from the lyophilizer as soon as it begins to thaw. If lyophilization is allowed to proceed to dryness, there is often substantial (>50%) degradation of the product. To purify 8 using P2 size-exclusion chromatography, the procedure provided in Section 2.3.1 should be followed, and 25 mM NH4HCO3 instead of ddH2O should be used to wash and equilibrate the column, and to elute the sample. A typical flow rate is 6-8 ml/h. Samples with absorbance at 267 nm begin to elute after 24 to 30 h, and continue for the next 12 to 20 h. As described for TDP-a-D-glucose (5), a similar absorbance plateau is commonly observed. However, 8 should be eluted towards the end of the plateau region ( just prior to the reduction of A267 back to baseline) over only 2 to 4 fractions. The fractions at the beginning of the plateau region contain NADPþ and NADPH. Generally, two of the four fractions are greater than 85% pure (as determined by HPLC), while one or two are of lower purity. The desired fractions are combined and
Enzymatic Synthesis of TDP-Deoxysugars
533
lyophilized. Care should be taken not to lyophilize to dryness, as this will cause significant degradation, as observed by 1H-NMR spectroscopy. Usually, approximately 10 mg of 8 (from 24 mg of 6) is recovered from this purification process (Zhang et al., 2007). 3.1.2. Synthesis of TDP-4-keto-2,6-dideoxy sugars with axial C3-OH stereochemistry To generate the TDP-4-keto-2,6-dideoxy sugar 9 with axial C3-OH stereochemistry, we use TylC1 in place of KijD10. A typical 3-ml reaction mixture contains 6 (21.8 mM ), NADPH (53 mM ), and 10% glycerol in 50 mM TrisHCl buffer (pH 7.5). TylC1 (40 mM ) and TylX3 (8 mM ) are added to initiate the reaction. The incubation is carried out at 25 and product formation is monitored by HPLC. Under the HPLC conditions described in Section 2.3.1, the retention times of substrate (6) and product (9) are 33.6 to 34 min and 32.3 to 33 min, respectively. Generation of 9 is not as facile as the C-3 equatorial product (8). We obtain approximately 50% conversion of 6 ! 9, even after overnight incubation. Gel filtration using a P2 column to remove NADPþ and NADPH can be carried out by the method described in Section 3.1.1 for compound 8, and typical yields are about 5 mg of purified sugar (from 24 mg of 6). Compound 9 can often be generated in situ in sufficient quantities to be processed by downstream biosynthetic enzymes.
4. In vitro Reconstitution of Entire Deoxysugar Biosynthetic Pathways Up to this point, we have summarized methodology to synthesize and purify several common (early) intermediates (5, 6, 8, and 9, Scheme 21.3) produced in deoxysugar biosynthetic pathways. These intermediates can be used as starting materials for more elaborate enzymatic syntheses. To date, only a handful of TDP-deoxysugar biosynthetic pathways have been fully reconstituted in vitro using native pathway enzymes. Some of these highly modified TDP-sugars (Scheme 21.4) that have been enzymatically prepared include TDP-a-D-desosamine (11), TDP-a-D-mycaminose (12) (Melancon et al., 2007), TDP-b-L-mycarose (13) (Takahashi et al., 2006), TDP-a-Dforosamine (14) (Hong et al., 2008), TDP-b-L-epivancosamine (Chen et al., 2000), and TDP-b-L-digitoxose (Zhang et al., 2007). Due to the variation in the reactivity and stability of different TDP-sugar intermediates, and to the differences in catalytic efficiencies of the various biosynthetic enzymes involved, there is no general protocol that can be used to synthesize all TDPsugars. Instead, syntheses must be optimized on a case-by-case basis. The fact that few in vitro sugar biosyntheses are known reflects the dearth of biochemical information available for deoxysugar biosynthetic enzymes, and clearly
534
H2N HO
Jessica White-Phillip et al.
Me
O
Me
DesII O
HO OTDP
O
Me
DesV
H2N
HO OTDP
21
O
DesVI
HO OTDP 23
22
Me Me2N
O
HO OTDP
11
DesI O
Me
O
HO
Me
Tyl1a
HO O
HO OTDP 6
O
Me
HO H2N
TylB
HO OTDP
O
HO
15
16
TylM1
HO Me2N
OTDP
Me
O
HO 12
OTDP
TylX3 SpnO Me
O
O
O
O
TylC1 OTDP
7
Me
HO
9
TylC3
O
O
Me
HO Me
OTDP
TylK
O
17
OH
OH O
Me
OTDP TylC2
O Me
OTDP
Me HO
O
OTDP
Me
18
13
SpnN O
Me
HO 8
O OTDP
SpnQ
O
Me
19
O
SpnR OTDP
H2N
Me
20
O
SpnS
OTDP
Me Me2N 14
O OTDP
Scheme 21.4 In vitro enzymatic synthesis of highly modified TDP-deoxysugars. Biosynthetic pathways for several highly modified TDP-deoxysugars (11 to 14) that have been synthesized in vitro using native pathway enzymes. See text for details.
suggests that more thorough kinetic investigations of these important enzymes are warranted. Here, we present procedures for the enzymatic synthesis of several TDP-deoxysugars (11 to 14) that have been investigated in our laboratory.
4.1. One-pot synthesis of TDP-a-D-mycaminose (12) The synthesis of TDP-a-D-mycaminose (TDP-3-N,N-dimethylamino3,6-dideoxy-a-D-glucose, 12, Scheme 21.4) from TDP-4-keto-6-deoxya-D-glucose (6) can be carried out in a single reaction using three enzymes (Tyl1a, TylB, and TylM1) from the tylosin biosynthetic pathway of S. fradiae (Scheme 21.4). Tyl1a and TylB catalyze the conversion of 6 to TDP-3-amino-3,6-dideoxy glucose (16) through a TDP-3-keto-6-deoxy sugar intermediate (15) (Melancon et al., 2007). TylM1 is an N, N-dimethyltransferase that converts 16 to TDP-a-D-mycaminose (12) (Chen et al., 1998, 2002). Genes encoding Tyl1a, TylB, and TylM1 can be cloned into either pET24b or pET28b, expressed in E. coli as the His6tagged fusion proteins, and purified using standard protocols. For the synthesis of TDP-a-D-mycaminose (12), compound 6, prepared as described in Section 3, is lyophilized and resuspended in 50 mM potassium phosphate buffer, pH 7.5. The reaction mixture contains 6 (1 mM ), 0 L-glutamate (30 mM ), pyridoxal 5 -phosphate (PLP, 150 mM ), S-adenosylL-methionine (SAM, 2 mM ), TylB (30 mM ), and TylM1 (60 mM ) in a total
Enzymatic Synthesis of TDP-Deoxysugars
535
volume of 2 ml of 50 mM potassium phosphate buffer (pH 7.5). Tyl1a (3 mM ) is added to initiate the reaction. It is best to use newly prepared enzymes and a high level of glycerol in the reaction mixture should be avoided. After 12 h at 25 , 40 to 60% conversion of 6 to 12 should be observed by HPLC. Using the HPLC protocol described in Section 2.3.1, retention times for TDP-sugars 12, 16, 6, and 15 are 7 to 8 min, 13 min, 35 to 36 min, and 39 min, respectively. In addition to the TDPsugar peaks, peaks for TDP (41.9 min), (2R,3R)-2-methyl-3,5-dihydroxy4-keto-2,3-dihydropyran, a degradation product of 15 (1.8 min), SAM and its degradation products (3.2 min, 21 min, and 23 min), and S-adenosyl-Lhomocysteine (2.1 min) are also visible. An Adsorbosphere SAX column can also be employed to purify 12 (Chen et al., 2002). This column is especially useful for isolating TDP-amino sugars, which are significantly more polar than most other TDP-deoxysugars (see Section 4.3). After the TDP-a-D-mycaminose (12) peak is collected, the sample can be readily desalted using HPLC for small-scale reactions, or by FPLC for large-scale preparations. When using HPLC, the sample is applied to an analytical C18 column and H2O is used to elute 12 (retention time is 5 to 10 min). For larger-scale preparations, FPLC purification can be carried out using the buffers and column described in Section 2.3.2, applying a linear gradient from 0 to 100% B over 25 min. Under these conditions, TDP-a-D-mycaminose (12) will elute at approximately 12.5 min. During FPLC purification, most of the unused substrate, TDP-4-keto-6-deoxy-aD-glucose (6, retention time 15 min), can be recovered and desalted using the G-10 column. The average yield from a 2-ml reaction mixture for the enzymatic synthesis of TDP-a-D-mycaminose is 11% (0.11 mg of 12 from 1 mg of 6), which is a threefold improvement over the chemical preparation method (Chen et al., 2002).
4.2. Two-stage one-pot synthesis of TDP-b-L-mycarose (13) The functions of each of the enzymes in TDP-b-L-mycarose (13) biosynthesis in the tylosin producer, S. fradiae, have been verified in vitro and are shown in Scheme 21.4 (Chen et al., 1999, 2001; Takahashi et al., 2005). From TDP-4-keto-6-deoxy-a-D-glucose (6), TylX3 and TylC1 catalyze the formation of 9. Following SAM-dependent C3 methylation of 9 by TylC3, compound 17 is converted to TDP-b-L-mycarose (13) by the sequential action of TylK, a 5-epimerase, and TylC2, an NADþ-dependent 4-ketoreductase. Two features make a one-pot synthesis of 13 attractive. First, as noted above, the instability of the TylX3 product (7) requires the presence of a 3-ketoreducatse (TylC1) to drive the reaction forward and to avoid the decomposition of 7 into TDP and maltol (Chen et al., 1999).
536
Jessica White-Phillip et al.
Second, the presence of the 4-ketoreductase (TylC2) is required in order to drive the formation of 13 from the epimerized TylK product (18), which is in equilibrium with 17 (Takahashi et al., 2005). Thus, a two-stage, one-pot synthesis of TDP-b-L-mycarose (13) was developed, wherein compound 6 is first generated by procedures similar to those outlined in Sections 2.2 and 3 with slight modifications (Takahashi et al., 2006). Following the completion of TTP synthesis from thymidine and ATP, the TM/TMK/NDK/PK enzymes are removed by ultrafiltration. Next, a-D-glucose-1-phosphate (1, 3 mM ) and RfbA (57 mM ) are added to the reaction mixture to convert 1 to 5. After a 30-min incubation period at 30 , RfbB (28 mM ) is added and the mixture is allowed to incubate for 1 h at 37 to convert 5 to 6. At this point, it is not necessary to remove either RfbA or RfbB from the incubation mixture. In the next stage of the reaction, the five TDP-b-L-mycarose (13) biosynthetic enzymes (TylX3/C1/C3/K/C2, 30 mM each) are added along with 6 mM NADPH and 3 mM SAM. The reaction is allowed to proceed for 1 h at room temperature to convert 6 to 13. The cloning, expression, and purification of the mycarose biosynthetic enzymes have been previously described (Chen et al., 1999, 2001; Takahashi et al., 2005). TDP-b-L-mycarose (13) is purified from the reaction mixture by FPLC using a MonoQ 10/10 column that is eluted with H2O over 2-column volumes, followed by a linear gradient from 0-280 mM NH4HCO3 buffer (pH 7.0) over 2-column volumes at a flow rate of 1 ml/min. Following FPLC purification of 13, desalting is carried out using a Sephadex G-10 column (see Section 2.3.3). The identity of 13 is confirmed by 1H NMR spectroscopy and high-resolution MS analysis (Takahashi et al., 2005). The final yield of TDP-b-L-mycarose (13) is 16% from glucose-1-phosphate (1) (Takahashi et al., 2006).
4.3. Multistep enzymatic synthesis of TDP-a-D-forosamine (14) TDP-a-D-forosamine is a highly modified tetradeoxy sugar produced during spinosyn biosynthesis in Saccharopolyspora spinosa (Scheme 21.4). Unlike the preparation of TDP-mycarose (13) from 6, a one-pot synthesis of 14 from 6 is impractical. This is mainly because the SpnQ-catalyzed reaction (8 ! 19) is sensitive to O2 and, therefore, must be conducted using deoxygenated buffers under anaerobic conditions or in the presence of sodium dithionite. We have recently demonstrated the activities for each of the TDP-a-D-forosamine biosynthetic enzymes in vitro (Hong et al., 2008). The activities of SpnO and SpnN (6 ! 7 ! 8) were established in a coupled assay by following the consumption (loss of absorbance at 340 nm) of NADPH by SpnN. Formation of the SpnN product (8) was verified by HPLC analysis as described in Hong et al., 2008. However, the yield of compound 8 is not as high as that obtained in the TylX3/KijD10 reaction
Enzymatic Synthesis of TDP-Deoxysugars
537
described in Section 3.1.1. Thus, for preparative purposes, we recommend using the optimized TylX3/KijD10 system to synthesize 8. SpnQ catalyzes the 3-deoxygenation of 8 to give 19. SpnQ is a [2Fe-2S] cluster containing pyridoxamine 50 -phosphate (PMP)–dependent enzyme, which is a homologue of E1—a mechanistically well-characterized 3-dehydrase from Yersinia pseudotuberculosis (reviewed in He et al., 2000). These 3-dehydrase enzymes also require a reductase component to complete their catalytic cycles, which involve single electron transfer radical chemistry. Because of the sensitivity of the [2Fe-2S] center in SpnQ to O2, the reaction must be carried out anaerobically. A typical SpnQ reaction contains compound 8 (0.7 mM ), PMP (250 mM ), SpnQ (30 mM ), NADPH (0.7 mM ), and a physiological reductase system comprised of either flavodoxin/flavodoxin reductase (30 mM each) or ferredoxin/ferredoxin reductase (30 mM each) in 50 mM potassium phosphate buffer (pH 7.5). Sodium dithionite (0.6 mM ) can also be used as the reductant. Production of 19 is monitored by HPLC (see below). The next step in the pathway is catalyzed by a PLP-dependent 4-aminotransferase, SpnR. The substrate of this enzyme, 19, can be generated in situ by SpnQ using the conditions described above. Following a 3-h incubation period at 24 to convert 8 ! 19, SpnQ, ferridoxin, and ferridoxin reductase are removed by ultrafiltration through a YM-10 membrane. SpnR (37 mM ), PLP (305 mM ), L-glutamate (12.2 mM ), and MgCl2 (1.2 mM ) are then added and the reaction mixture is incubated at 24 for an additional 2 h. The formation of the SpnR product (20) can be monitored by HPLC analysis (see below). The final N-methylation reaction to afford TDP-a-D-forosamine (14), catalyzed by the methyltransferase SpnS, is accomplished by the incubation of the SpnR product (20) with SpnS (10 mM ), SAM (2.0 mM ), MgCl2 (2.0 mM ), and DTT (2.0 mM ) in 50 mM potassium phosphate (pH 7.5) at 37 . Both monomethylated and dimethylated products are observed. The HPLC conditions used to resolve the TDP-a-D-forosamine biosynthetic intermediates are as follows. For the SpnO/N, SpnQ, and SpnQ/R reactions, a Dionex CarboPac PA1 analytical column (4 250 mm) equipped with a CarboPac PA1 guard column (4 50 mm) is employed, and the elution conditions are identical to those given in Section 2.3.1. Using a 1 ml/min flow rate and detection at 267 nm, the HPLC retention times for TDP-sugars 8, 19, and 20 are 33.4, 36.2, and 9.2 min, respectively. The above HPLC conditions cannot resolve the mono- and di-methylated SpnS-catalyzed reaction products from the other assay components. Thus, to purify these sugars, an Adsorbosphere SAX column (5 mm, 4.6 250 mm) is used. Here, a linear gradient from 0 to 20% buffer B (500 mM KH2PO4 buffer, pH 3.5) in buffer A (50 mM KH2PO4 buffer, pH 3.5) over 20 min is applied.
538
Jessica White-Phillip et al.
4.4. TDP-a-D-desosamine (11) TDP-a-D-desosamine is a 4,6-dideoxysugar found in several macrolide antibiotics, including erythromycin, oleandomycin, mycinamicin, methymycin/pikromycin, and megalomicin. The biosynthetic pathway for 11 (6 ! 21 ! 22 ! 23 ! 11, Scheme 21.4) has been fully established through biochemical studies of the pathway enzymes. DesI is a PLP-dependent 4-aminotransferase that converts 6 to 21 (Zhao et al., 2001). DesII, a member of the radical SAM enzyme superfamily, catalyzes the oxidative deamination of 21 to produce 22 (Szu et al., 2005). The PLP-dependent 3-aminotransferase, DesV, transaminates 22 to generate 23 (Szu et al., 2005; Zhao, 2000). The final step, N,N-dimethylation, is catalyzed by DesVI (Chang et al., 2000; Chen et al., 2002) to complete the biosynthesis of 11. Starting from 6, the DesV product (23) can be prepared in a one-pot, two-step reaction from 6 (Szu et al., 2005). In the first step of this synthesis, 6 is converted into 22 by the combined action of DesI and DesII. Due to the sensitivity of the [4Fe-4S] cluster of DesII to O2, and to the fact that this cluster must be reduced for activity, this coupled reaction must be performed anaerobically. Prior to the enzymatic synthesis, the inactive [4Fe-4S]2þ cluster of DesII (190 mM ) must be reduced under anaerobic conditions to the [4Fe-4S]1þ state by sodium dithionite (1.2 mM ) in 100 mM TrisHCl buffer (pH 8.0) for 40 min. The reduction of the [4Fe-4S]2þ cluster can be monitored by following the decrease in absorbance at 420 nm. A 1-ml reaction mixture containing compound 6 (0.6 mM ), L-glutamate (0.5 mM ), PLP (0.14 mM ), DesI (26 mM ), the abovereduced DesII (100 mM ), SAM (0.1 mM ), and DTT (2 mM ) in 100 mM TrisHCl buffer (pH 8.0) is carried out in an anaerobic chamber using degassed buffers. The reaction mixture is incubated at 25 for 3 h. At this point, DesV (100 mM ), along with additional L-glutamate (10 mM ) and PLP (0.8 mM ), are added to the reaction mixture and incubated at 25 for another 30 min. The DesI, DesII, and DesV enzymes are removed by ultrafiltration through a YM10 membrane, and the reaction progress is analyzed by HPLC using a Dionex anion exchange column (4 250 mm). Using a flow rate of 0.6 ml/min, detection at 267 nm, and a linear gradient from 20 to 35% of eluent B (1 M NH4OAc, pH 7.0) in eluent A (H2O) over 30 min, the retention times for compound 6 (the DesI substrate), compound 22 (the DesII product), and compound 23 (the DesV product) are 13.8, 28.2, and 3.7 min, respectively. It should also be noted that a preparative-scale enzymatic synthesis of the DesI product (compound 21) has been reported (Zhao et al., 2001). For the final step of TDP-a-D-desosamine (11) synthesis, a small-scale reaction (50 ml) containing 23 (1.2 mM ), DTT (2 mM ), SAM (10 mM ), and N,N-dimethyltransferase DesVI can be carried out for 3 h at 25 in 50 mM potassium phosphate buffer (pH 7.5). These conditions yield roughly
Enzymatic Synthesis of TDP-Deoxysugars
539
80% conversion of 23 ! 11 (Chen et al., 2002). The reaction products can be purified using an Adsorbosphere SAX column and the elution conditions given in Section 4.3. Under these conditions, the retention times for 23 and 11 are 6.5 and 17 min, respectively. A small amount of an N-monomethylated DesVI reaction intermediate may also be present (retention time 9.3 min). A preparative-scale synthesis of 11 from 23 (Chen et al., 2002) can be performed by incubating 23 (5.7 mM ), SAM (30 mM ), DTT (2 mM ), and DesVI (1.8 mg) in 1 ml of 50 mM potassium phosphate buffer (15% glycerol, pH 7.5) for 3 h at 25 . After removal of DesVI by ultrafiltration (YM-10 membrane), TDP-a-D-desosamine (11) is isolated by sizeexclusion chromatography using a P2 column (2 100 cm) with a 0.5 M NH4HCO3 solution as the eluent. Fractions containing 11 (identified by absorbance at 267 nm) are concentrated and further purified with an FPLC MonoQ HR (10/10) column using a flow rate of 3 ml/min and a linear gradient of 0-0.15 M NH4HCO3 over 15 min to elute compound 11 (retention time 8 min).
5. Synthesis of Deoxysugars In Vivo by Metabolic Pathway Engineering While using purified biosynthetic enzymes to synthesize TDP-deoxysugars in vitro is desirable, this approach may not always be feasible if the sugar biosynthetic enzymes required for a particular synthesis cannot be expressed and purified in suitable quantities, or are not stable. In these cases, an in vivo biosynthetic approach may be useful, wherein a glycosylated natural product is isolated from cultures of a producing bacterial strain, and the deoxysugar of interest is then recovered from the glycosylated product either through reverse GT catalysis or by hydrolysis and chemical derivitization. One method is to heterologously express the deoxysugar biosynthetic gene(s) of interest in a host that naturally produces glycosylated natural products with similar structures. In this case, it may be advantageous to disrupt some of the host’s deoxysugar biosynthetic genes to increase the intracellular concentration of the substrate(s) for the heterologously expressed biosynthetic enzyme(s). Another approach involves the expression of entire biosynthetic pathways in a non-producing, but tolerant strain such as Streptomyces lividans or Streptomyces albus. In these organisms, the heterologously expressed sugar biosynthetic enzymes will not have to compete with endogenous enzymes for their substrate, and the glycosylated products will be excreted from the host cells, limiting their toxicity. It should be noted that synthesis of TDP-deoxysugars in large quantities is not the primary focus of many of the in vivo pathway engineering studies reported in the literature, but the biological systems used in these studies
540
Jessica White-Phillip et al.
could potentially serve as good sources for TDP-deoxysugar production. Below we highlight some of our recent in vivo studies on deoxysugar biosynthesis and pathway engineering in Streptomyces venezuelae (Thibodeaux and Liu, 2007), an organism that produces several macrolide derivatives bearing D-desosamine moieties. The native biosynthetic pathways for production of D-desosaminylated 12and 14-membered ring macrolactones in S. venezuelae are shown in Scheme 21.5 (6 ! 21 ! 22 ! 23 ! 11 ! 24). In an attempt to generate TDP-a-Dmycaminose (12) in S. venezuelae, we constructed an S. venezuelae double knockout mutant (termed KdesI/desVII) lacking the 4-aminotransferase (DesI) that catalyzes 6 ! 21, and the endogenous desosaminyltransferase (DesVII) that catalyzes 11 ! 24 (Borisova et al., 1999; Melancon et al., 2005). This mutant was designed to enable the accumulation of 6, which could then be processed by heterologously expressed genes from the D-mycaminose pathway of S. fradiae (Scheme 21.5, 6 ! 15 ! 16 ! 12) in order to make 12—a deoxysugar that is not normally produced by S. venezuelae. The tyl1a, tylB, and tylM1 genes were heterologously expressed in this S. venezuelae mutant along with the genes required for mycaminosyltransfer H2N HO
Me
O Me
DesI
O
HO
HO OTDP 21
6
DesII Me
Me
O
HO O
H2N
Me
KdesI/FdtA
O
HO OTDP 23
HO H2N
O O
Me
R2 Me O O
R3
H2N
Me
O
OH
Me O
HO
16
Me
Me O
Me
O Me
Me
DesV
OTDP
Me Me O
Me
O
HO OTDP 27
HO Me
O
HO
Me
Me
Me
O
TylB/DesV Me
O Me
O
R1
HO Me
HO OTDP 15
DesV Me
O
KdesI/Tyl1a
HO OTDP 22
O
O
HO OTDP
OTDP
HO Me O Me HO HO DesVII 2N Me Me HO DesVIII O O DesVI Me2N MeHN HO Me O HO HO OTDP OTDP Me2N DesVII DesVII HO DesVIII DesVIII DesVI
DesVI Me Me2N
TylM1/DesVI
O
HO OTDP
Me
HO Me2N
HO
11
Me2N
O
O
Me
O
HO 24
KdesVII TylM2 TylM3
R1 HO Me2N
HO Me2N
OTDP
12 DesVII DesVIII
Me
O
O
R2
Me
O
HO 25
O
Me HO Me2N
R3
O
R1
HO Me
HO Me2N
HOMe O
O
MeHN
O
O
R1
R2
28 O
R1
HO 29
O
O
R2
HO 26
Scheme 21.5 Manipulating deoxysugar structures by metabolic pathway engineering. A combination of gene knock-out, heterologous gene expression, and precursor feeding experiments allowed the production of several novel compounds in Streptomyces venezuelae. See text for details.
Enzymatic Synthesis of TDP-Deoxysugars
541
(tylM2 and tylM3). When this strain was fed with tylactone (the native aglycone substrate of TylM2/M3), D-mycaminosylated tylactone (25) was generated (Melancon et al., 2005), indicating that the heterologously expressed tyl genes indeed converted 6 into 12. Interestingly, when the tyl1a gene alone was heterologously expressed in a separate S. venezuelae mutant that lacked only the desI gene (Scheme 21.5), novel D-mycaminosylated macrolide derivatives (26) were obtained (Borisova et al., 1999; Melancon et al., 2005). Thus, heterologous expression of a single S. fradiae gene (tyl1a) was sufficient to convert the native D-desosamine biosynthetic pathway into a D-mycaminose pathway in S. venezuelae. From this experiment, it is clear that several of the desosamine biosynthetic enzymes (DesV, DesVI, and DesVII/DesVIII) are capable of processing alternative TDP-deoxysugar substrates (each containing an equatorial 4-OH group that is not present in the natural substrates for DesV-VIII). The above example not only illustrates how deoxysugar biosynthesis can be manipulated in a producing strain by metabolic pathway engineering, but it also reveals the inherent relaxed substrate specificity of many deoxysugar biosynthetic enzymes—a property that should be useful for the synthesis or engineering of deoxysugar structures in other pathways. Indeed, we have exploited the relaxed substrate specificity of the desosamine biosynthetic enzymes to synthesize deoxysugars that have not yet been identified from natural sources (Melancon and Liu, 2007). For example, we expressed fdtA (from the Gram-negative Aneurinibacillus thermoaerophilus), a 3,4-ketoisomerase homologue of tyl1a that produces 27, the C4 epimer of compound 15 (Davis et al., 2007), in the S. venezuelae KdesI mutant. The mutant cultures were found to produce macrolide derivatives bearing either 4-epi-D-mycaminose (28) or 3-N-monomethyl-3-deoxy-Dfucose (29)—two unnatural deoxysugars.
6. Summary The deoxysugar moieties of many glycosylated bacterial secondary metabolites are often essential for the biological activity of these compounds. Changing the structure of these sugar moieties has the potential to generate new glycoforms with altered or improved biological activity. Thus, convenient methods for synthesizing highly modified deoxysugars with defined structures are desirable. Chemical synthesis of deoxysugars is feasible, but is often tedious, technically demanding, and typically suffers from low overall yields. On the other hand, in vitro and in vivo (chemo) enzymatic synthesis of activated nucleotide sugars exploits nature’s biosynthetic machinery and has several benefits over chemical synthesis methods. First, the enzymes used in these methods are a readily available, relatively
542
Jessica White-Phillip et al.
cheap, and renewable resource. Second, enzymes also typically enable more stringent control over the regio- and stereo-chemical outcome of a reaction. Third, these enzymatic reactions are performed under mild, biological conditions and nucleotide sugar purification usually requires only a few simple and familiar chromatographic steps. Here, we have outlined detailed synthesis and purification procedures for several common TDP-sugar intermediates as well as for several specific highly-modified TDP-deoxysugars. It is hoped that the procedures outlined here will provide useful guidelines for the development of synthetic protocols for other unusual sugars. This, in turn, should facilitate the development of workable quantities of glycoforms with defined (and potentially novel) sugar structures.
ACKNOWLEDGMENT We thank the National Institutes of Health (GM35906, GM54346) and the Welch Foundation (F-1511) for their generous support of our research work, and Christian P. Whitman from the College of Pharmacy, University of Texas, Austin, for his critical reading of the manuscript.
REFERENCES Amann, S., Drager, G., Rupprath, G., Kirschning, A., and Ellinga, L. (2001). Chemoenzymatic synthesis of dTDP-activated 2,6-dideoxysugars as building blocks of polyketide antibiotics. Carbohydr. Res. 335, 23–32. Bode, H. B., and Muller, R. (2007). Reversible sugar transfer by glycosyltransferases as a tool for natural product biosynthesis. Angew. Chem. Int. Ed. 46, 2147–2150. Borisova, S. A., Zhao, L., Sherman, D. H., and Liu, H.-w. (1999). Biosynthesis of desosamine: construction of a new macrolide carrying a genetically designed sugar moiety. Org. Lett. 1, 133–136. Chang, C., Zhao, L., Yamase, H., and Liu, H.-w. (2000). DesVI: A new member of the sugar N,N-dimethyltransferase family involved in the biosynthesis of desosamine. Angew. Chem. Int. Ed. 39, 2160–2163. Chen, H., Agnihotri, G., Guo, Z., Que, N. L. S., Chen, X., and Liu, H.-w. (1999). Biosynthesis of mycarose: Isolation and characterization of enzymes involved in the C-2 deoxygenation. J. Am. Chem. Soc. 121, 8124–8125. Chen, H., Guo, Z., and Liu, H.-w. (1998). Expression, purification, and characterization of TylM1, an N,N-dimethyltransferase involved in the biosynthesis of mycaminose. J. Am. Chem. Soc. 120, 9951–9952. Chen, H., Thomas, M. G., Hubbard, B. K., Losey, H. C., Walsh, C. T., and Burkart, M. D. (2000). Deoxysugars in glycopeptide antibiotics: Enzymatic synthesis of TDP-L-epivancosamine in chloroeremomycin biosynthesis. Proc. Natl. Acad. Sci. USA 97, 11942–11947. Chen, H., Yamase, H., Murakami, K., Chang, C. W., Zhao, L., Zhao, Z., and Liu, H.-w. (2002). Expression, purification, and characterization of two N,N-dimethyltransferases, tylM1 and desVI, involved in the biosynthesis of mycaminose and desosamine. Biochemistry 41, 9165–9183.
Enzymatic Synthesis of TDP-Deoxysugars
543
Chen, H., Zhao, Z., Hallis, T. M., Guo, Z., and Liu, H.-w. (2001). Insights into the branched-chain formation of mycarose: Methylation catalyzed by an (S)-adenosylmethionine-dependent methyltransferase. Angew. Chem. Int. Ed. 40, 607–610. Davis, M. L., Thoden, J. B., and Holden, H. M. (2007). The X-ray structure of dTDP-4keto-6-deoxy-D-glucose-3,4-ketoisomerase. J. Biol. Chem. 282, 19227–19236. Draeger, G., Park, S.-H., and Floss, H. G. (1999). Mechanism of the 2-deoxygenation step in the biosynthesis of the deoxyhexose moieties of the antibiotics granaticin and oleandomycin. J. Am. Chem. Soc. 121, 2611–2612. Elling, L., Rupprath, C., Gunther, N., Romer, U., Verseck, S., Weingarten, P., Drager, G., Kirschning, A., and Piepersberg, W. (2005). An enzyme module system for the synthesis of dTDP-activated deoxysugars from dTMP and sucrose. ChemBioChem 6, 1423–1430. Fu, X., Albermann, C., Jiang, J., Liao, J., Zhang, C., and Thorson, J. S. (2003). Antibiotic optimization via in vitro glycorandomization. Nat. Biotechnol. 21, 1467–1469. He, X., Agnihotri, G., and Liu, H.-w. (2000). Novel enzymatic mechanisms in carbohydrate metabolism. Chem. Rev. 100, 4615–4662. He, X., and Liu, H.-w. (2002). Mechanisms of enzymatic C–O bond cleavages in deoxyhexose biosynthesis. Curr. Opin. Chem. Biol. 6, 590–597. Hong, L., Zhao, Z., Melancon, C. E., 3rd, Zhang, H., and Liu, H.-w. (2008). In vitro characterization of the enzymes involved in TDP-D-forosamine biosynthesis in the spinosyn pathway of Saccharopolyspora spinosa. J. Am. Chem. Soc. 130, 4954–4967. Lamb, S., and Wright, G. (2005). Accessorizing natural products: Adding to nature’s toolbox. Proc. Natl. Acad. Sci. USA 102, 519–520. Langenhan, J. M., Griffith, B. R., and Thorson, J. S. (2005). Neoglycorandomization and chemoenzymatic glycorandomization: Two complementary tools for natural product diversification. J. Nat. Prod. 68, 1696–1711. Luzhetskyy, A., Mendez, C., Salas, J. A., and Bechthold, A. (2008). Glycosyltransferases, important tools for drug design. Curr. Top. Med. Chem. 8, 680–709. Melancon, C. E., 3rd, Hong, L., White, J. A., Liu, Y.-n., and Liu, H.-w. (2007). Characterization of TDP-4-keto-6-deoxy-D-glucose-3,4-ketoisomerase from the D-mycaminose biosynthetic pathway of Streptomyces fradiae: In vitro activity and substrate specificity studies. Biochemistry 46, 577–590. Melancon, C. E., 3rd, and Liu, H.-w. (2007). Engineered biosynthesis of macrolide derivatives bearing the non-natural deoxysugars 4-epi-D-mycaminose and 3-N-monomethyl3-deoxy-D-fucose. J. Am. Chem. Soc. 129, 4896–4897. Melancon, C. E., 3rd,, Thibodeaux, C. J., and Liu, H.-w. (2006). Glyco-stripping and glyco-swapping. ACS Chem. Biol. 1, 499–504. Melancon, C. E., 3rd, Yu, W.-L., and Liu, H.-w. (2005). TDP-mycaminose biosynthetic pathway revised and conversion of desosamine pathway to mycaminose pathway with one gene. J. Am. Chem. Soc. 127, 12240–12241. Mendez, C., Luzhetskyy, A., Bechthold, A., and Salas, J. A. (2008). Deoxysugars in bioactive natural products: Development of novel derivatives by altering the sugar pattern. Curr. Top. Med. Chem. 8, 710–724. Mendez, C., and Salas, J. A. (2001). Altering the glycosylation pattern of bioactive compounds. Trends Biotechnol. 19, 449–456. Minami, A., Kakinuma, K., and Eguchi, T. (2005). Aglycon switch approach toward unnatural glycosides from natural glycoside with glycosyltransferase VinC. Tetrahedron Lett. 46, 6187–6190. Oh, J., Lee, S.-G., Kim, B.-G., Sohng, J. K., Liou, K., and Lee, H. C. (2003). One-pot enzymatic production of dTDP-4-keto-6-deoxy-D-glucose from dTMP and glucose1-phosphate. Biotechnol. Bioeng. 84, 452–458.
544
Jessica White-Phillip et al.
Rupprath, C., Schumacher, T., and Elling, L. (2005). Nucleotide deoxysugars: Essential tools for the glycosylation engineering of novel bioactive compounds. Curr. Med. Chem. 12, 1637–1675. Salas, J. A., and Mendez, C. (2007). Engineering the glycosylation of natural products in actinomycetes. Trends Microbiol. 15, 219–232. Stein, A., Kula, M.-R., and Elling, L. (1998). Combined preparative enzymatic synthesis of dTDP-6-deoxy-4-keto-D-glucose from dTDP and sucrose. Glycoconj. J. 15, 139–145. Szu, P.-H., He, X., Zhao, L., and Liu, H.-w. (2005). Biosynthesis of TDP-D-desosamine: Identification of a strategy for C4 deoxygenation. Angew. Chem. Int. Ed. 44, 6742–6746. Takahashi, H., Liu, Y.-n., Chen, H., and Liu, H.-w. (2005). Biosynthesis of TDP-Lmycarose: The specificity of a single enzyme governs the outcome of the pathway. J. Am. Chem. Soc. 127, 9340–9341. Takahashi, H., Liu, Y.-n., and Liu, H.-w. (2006). A two-stage one-pot enzymatic synthesis of TDP-L-mycarose from thymidine and glucose-1-phosphate. J. Am. Chem. Soc. 128, 1432–1433. Thibodeaux, C. J., and Liu, H.-w. (2007). Manipulating nature’s sugar biosynthetic machineries for glycodiversification of macrolides: Recent advances and future prospects. Pure Appl. Chem. 79, 785–799. Thibodeaux, C. J., Melancon, C. E., 3rd, and Liu, H.-w. (2007). Unusual sugar biosynthesis and natural product glycodiversification. Nature 446, 1008–1016. Thibodeaux, C. J., Melancon, C. E., 3rd, and Liu, H.-w. (2008). Natural product sugar biosynthesis and enzymatic glycodiversification. Angew. Chem. Int. Ed. 47, 9814–9859. Thorson, J. S., Hosted, Jr., T. J., Jiang, J., Biggins, J. B., and Ahlert, J. (2001). Nature’s carbohydrate chemists: The enzymatic glycosylation of bioactive bacterial metabolites. Curr. Org. Chem 5, 139–167. Walsh, C. T., Freel Meyers, C. L., and Losey, H. C. (2003). Antibiotic glycosyltransferases: antibiotic maturation and prospects for reprogramming. J. Med. Chem. 46, 3425–3426. Weymouth-Wilson, A. C. (1997). The role of carbohydrates in biologically active natural products. Nat. Prod. Rep. 14, 99–110. Zhang, C., Griffith, B. R., Fu, Q., Albermann, C., Fu, X., Lee, I.-K., Li, L., and Thorson, J. S. (2006). Exploiting the reversibility of natural product glycosyltransferase-catalyzed reactions. Science 313, 1291–1294. Zhang, H., White-Phillip, J. A., Melancon, C. E., 3rd, Kwon, H.-j., Yu, W.-l., and Liu, H.-w. (2007). Elucidation of the kijanimicin gene cluster: Insights into the biosynthesis of spirotetronate antibiotics and nitrosugars. J. Am. Chem. Soc. 129, 14670–14683. Zhao, L. (2000). Biosynthetic studies of D-desosamine and engineered biosynthesis of methymycin/pikromycin analogues carrying modified deoxysugars. PhD thesis Minneapolis: University of Minnesota, Minneapolis. Zhao, L., Borisova, S., Yeung, S. M., and Liu, H.-w. (2001). Study of C-4 deoxygenation in the biosynthesis of desosamine: Evidence implicating a novel mechanism. J. Am. Chem. Soc. 123, 7909–7910.
Author Index
A Abe, I., 279 Aboshanab, K., 460, 464, 466, 468, 473, 476, 495 Adam, A., 260 Adams, P. D., 18, 19 Admiraal, S. J., 345, 358, 372 Adusumilli, S., 10 Agnihotri, G., 263, 275, 276, 531, 532, 535, 536, 537 Agusti, G., 272 Ahlbrecht, W., 167, 170, 183 Ahlert, J., 99, 101, 472, 473, 502, 522 Aiba, S., 473 Aidoo, K. A., 230 Airas, K., 386 Ajaz, A. A., 188, 195 Akey, D. L., 21, 27, 31, 37, 39, 264, 271 Alarco, A. M., 11 Albermann, C., 523 Albersmeier, A., 412 Albertini, A. M., 170 Alberts, A. A., 421 Alberts, A. W., 403 Alderwick, L. J., 264 Aldrich, T., 50, 62 Alekseyev, V. Y., 21, 36, 37 Alhamadsheh, M. M., 32 Ali, A., 368, 380, 414 Allen, S., 170 Allmansberger, R., 246 Alon, G., 170, 171 Alt, D., 278 Alt, S., 447 Altabe, S., 410 Altenbuchner, J., 477, 486 Altincicek, B., 358 Altschul, S. F., 192 Alvarez, M. A., 32 Amann, S., 527, 531 Ames, B. D., 17, 21, 35, 374, 381 Amonsin, A., 278 An, J. H., 377 Anand, S., 11, 263, 272, 273, 283 Ancelin, M. L., 188 Anderle, C., 441, 447, 448, 453 Andersen, C., 485 Anderson, C., 170 Anderson, M. S., 404 Anderson, R. J., 260, 265
Andreu, N., 272 Ansari, M. Z., 263, 269, 270, 281 Anto´n, N., 216, 217, 218, 223, 224, 225, 237 Aparicio, J. F., 23, 24, 215, 216, 217, 218, 220, 222, 223, 224, 225, 226, 227, 234, 235, 236, 237, 244, 245 Apel, A. K., 237 Appleyard, A. N., 22 Arakawa, K., 171 Arand, M., 199 Aravind, L., 34 Archer, D. B., 50 Arendrup, M., 254 Arikan, F., 167, 170, 183 Arison, B., 145 Armitage, I. M., 424 Arora, P., 263, 268, 269, 270, 276, 282 Arthanari, H., 37 Arthur, C. J., 9, 21, 37, 56, 380, 403 Arya, D. P., 460 Asano, K., 167 Aschauer, H., 407, 411 Ashani, Y., 251 Ashley, G., 30, 322, 329, 344, 348, 350 Ashley, G. W., 23, 24, 119, 329 Asselineau, C. P., 260, 261, 273, 274, 277 Asselineau, J., 261 Astier, J.-P., 484 Astola, J., 276 Asturias, F. J., 18, 19, 21, 23, 24, 25, 32, 39 Asturias, J. A., 226, 227, 237 Atrih, A., 198 Auclair, K., 62, 63 August, P. R., 12, 124 Aune, R., 224 Ausina, V., 277 Austin, M. B., 8, 24, 279, 345 Azad, A. K., 266, 268 Azevedo, V., 170 Azuma, I., 261 B Bachmann, B. O., 11, 99 Backbro, K., 263, 276 Badcock, K., 266, 268, 272, 278, 279, 282 Bae, J., 99 Baerga-Ortiz, Z., 30
545
546 Bai, L., 144, 145, 203, 229, 233, 234, 235, 237, 356, 480 Bai, Y., 264 Bailey, A., 72 Bailey, A. M., 54, 63, 65, 66, 67, 72 Bailey, J. E., 32 Baker, P. J., 398, 419, 425 Balague´, M. M., 217 Balbach, J., 18, 23, 24, 32 Baldock, C., 398, 419, 425 Balibar, C. J., 451 Ballou, C. E., 265 Baltz, R. H., 350 Ban, N., 19, 24, 25, 27, 37, 39, 268 Banchio, C., 346, 355 Banerjee, S., 11, 272, 273, 283 Banerji, N., 278 Bangera, M. G., 403, 422 Bannantine, J. P., 278 Bao, K., 193, 201, 202 Bao, W., 381, 382 Barber, M., 217 Barczak, A. K., 268 Bard, J., 18 Bardou, F., 274, 276 Bardshiri, E., 60 Barends, T. R., 209 Bari, A., 56, 64 Barilone, N., 268 Barnathan, G., 80, 81, 93 Barona-Gomez, F., 345 Barr, P. J., 52, 69 Barreiro, C., 227 Barrow, K. D., 249 Barry, C. E. III, 262, 266, 268, 272, 274, 276, 278, 279, 281, 283 Basak, A., 188, 191, 195, 197 Basnet, D. B., 501 Basset, G. J., 233 Bate, N., 237, 356, 357 Bateman, A., 30, 34, 193, 345, 346 Batist, G., 368 Bau, K., 229 Baumann, S., 358 Beadling, L. C., 50 Beau, J. M., 218 Bechthold, A., 6, 350, 368, 389, 524 Beck, B. J., 136, 222 Beck, E., 358 Beck, J., 50, 51, 145 Bedford, D. J., 52, 296, 344 Beeby, M., 488 Beeman, T. A., 98 Begley, T. P., 501 Bekel, T., 412 Belisle, J. T., 264 Bell, A. A., 57 Bell, R. M., 403 Beltran-Alvarez, P., 9, 56, 377, 379, 380
Author Index
Benhamou, B., 375, 447, 477, 486 Bennett, A. E., 37 Bensadoun, A., 418 Bentley, S. D., 193, 345, 346 Beppu, T., 226, 227 Berge´, J.-P., 80, 81, 93 Berger, J. M., 262, 267 Bergfors, T., 199 Bergler, H., 407, 411 Bergner, A., 473 Berlan, J., 274 Berry, A., 222 Bertero, M. G., 170 Bertozzi, C. R., 262, 263, 264, 271, 272 Bes, M., 170 Besra, G. S., 260, 261, 260, 261, 262, 263, 274, 271, 272, 274, 275, 276, 277, 278, 282, 419, 421, 422 Bessieres, P., 170 Betlach, M. C., 52, 69, 310, 322, 329, 344, 345, 347, 348, 375 Betts, J., 263, 275 Beveridge, T. J., 260 Bevitt, D. J., 10, 191 Beyer, S., 487 Bhatnagar, D., 53 Bhatt, A., 193, 197, 198, 199, 200, 262, 264, 271, 272, 276 Bhatt, K., 262, 271, 276 Bibb, M. J., 197, 202, 245, 246, 249, 346, 347, 348, 349, 355, 373, 375, 381, 413, 414, 441, 442, 445, 447, 472, 479, 499 Bierman, M., 247, 353 Biesiadka, J., 34 Biggins, J. B., 522 Bililign, T., 381 Bingle, L. E. H., 48 Birch, A. J., 47 Birch, H. L., 264 Birch, R. G., 170 Birge, C. H., 406, 422, 423 Bisang, C., 11, 123, 191, 193, 197, 278 Bischoff, N., 412 Bittman, R., 276 Blackaby, A. P., 272 Blanchard, J. S., 276 Blanco, G., 34 Bloch, H., 261, 275 Bloch, K., 408, 409, 420, 421, 422 Blocker, H., 272 Blondelet-Rouault, M. H., 197, 475 Blundell, T. L., 199, 502 Boddy, C. M., 222 Boddy, C. N., 313, 327, 330, 359 Bode, H. B., 341, 523 Bo¨hm, G., 218, 234 Bo¨hm, G. A., 251 Bohm, I. U., 196, 272, 346
547
Author Index
Bolanos-Garcia, V., 199, 200, 201, 204, 205, 206, 209 Bolard, J., 244 Bolotin, A., 170 Bolton, R. C., 273 Bondi, S. M., 69 Bonnefoy, A., 438 Booker-Milburn, K. I., 385 Borchert, S., 170 Bordat, Y., 270, 277, 278, 281 Borgaro, J. G., 415 Borgos, S. E. F., 220, 224, 236, 244, 247, 254, 255, 256, 258 Borisova, S. A., 538, 540, 541 Bornscheuer, U. T., 477 Borovinskaya, M. A., 464 Borowski, E., 229 Borowy-Borowski, H., 229 Borriss, R., 170, 171 Bottova, I., 268 Boursier, L., 170 Bowman, J., 9 Bowman, M. E., 276 Boyd, D. H., 262 Boyne, M. T. II, 145, 156, 160, 167 Braberg, H., 209 Bradford, M. M., 175, 177 Bradley, K. A., 161 Bran˜a, A. F., 11, 387 Branny, P., 197, 475 Brau, B., 246 Braun, C., 464 Braun, L., 9, 84, 95, 99 Brautaset, T., 220, 236, 244, 246, 247, 254, 255, 256, 258 Brayer, G. D., 464 Breen, C., 250 Breiteneder, H., 34 Brendel, N., 125, 127, 132, 172 Brennan, P. J., 261, 263, 264, 273, 275, 276, 277 Brenner, M. B., 272 Breukink, E., 217 Brian, P., 345, 350 Briken, V., 272 Brikun, I. A., 347, 356 Bringmann, G., 447 Broadhurst, R. W., 11 Brodersen, D. E., 464 Brokl, O., 270 Brosch, R., 10, 266, 268, 272, 278, 279, 282 Brown, A. K., 264, 276 Brown, K. A., 345, 350, 353 Brown, M. J., 196, 320, 322, 341 Brown, M. P., 53, 230 Brown, S., 193, 345, 346 Brown, S. D., 412 Brown-Jenco, C. S., 53
Browse, J., 9, 80, 81, 93, 408, 409, 413 Bruheim, P., 224, 254, 255, 256 Brune, I., 412 Bruner, S. D., 37 Brunger, A. T., 18, 19 Brunkhorst, C., 485 Bruno, W. J., 173 Bruton, C. J., 245, 249, 373, 443, 444, 472 Buchholz, F., 12, 13 Bugie, E., 460 Buglino, J., 263, 270 Bujacz, G., 34 Buko, A., 355 Bu’Lock, J. D., 275 Bummer, P., 254 Burkart, M. D., 380, 400, 414, 533 Burns, K. E., 501 Burns, R. N., 253 Burston, S. G., 21, 380, 403 Bushby, N., 65 Buss, A. D., 272 Butcher, P. D., 262, 278, 282 Butcher, R. A., 127, 129, 132, 170 Butler, A. R., 237, 356, 357 Butler, M. J., 356 Butler, M. S., 3, 47 Buttner, M. J., 197, 198, 202, 245, 246, 345, 346, 347, 348, 349, 373, 442, 445, 447, 499 Butts, C. P., 63, 65, 66 Butzke, D., 171, 172 Bycroft, M., 327, 329 Byers, D. M., 419, 425 Byrne, B., 223, 235, 236, 250, 252, 254 Byrne, K. M., 145 Byrom, K. J., 61, 403 Bzymek, K. P., 460, 464 C Caffrey, P., 23, 30, 114, 216, 217, 218, 220, 222, 223, 224, 234, 235, 236, 243, 244, 245, 249, 250, 252, 254 Cai, X., 172, 387, 388 Calderone, C. T., 129, 130 Camacho, L. R., 262, 268, 282 Cambillau, C., 270, 484 Camey, J. R., 69, 321, 323, 327, 330 Campelo, A. B., 229, 233, 235 Campillo, N., 30 Camus, J. C., 278 Canaan, S., 270 Cane, D. E., 10, 21, 22, 23, 24, 25, 27, 32, 36, 37, 39, 60, 64, 69, 152, 167, 177, 187, 188, 195, 196, 202, 203, 204, 205, 206, 209, 214, 272, 323, 327, 329, 330, 341, 345, 348, 356, 358, 372 Capdevila, C., 375, 447, 477, 486 Cardona, P. J., 272
548 Carey, M. R., 398, 404, 416 Carmody, M., 223, 235, 236, 250, 252, 254 Carney, J., 30, 321, 332, 335, 359 Carney, J. R., 145, 321, 325, 326, 329, 331, 345, 358, 359 Carreras, C. W., 380 Carrere, S., 276 Carriuolo, J., 420 Carroll, B. J., 145 Carroll, P., 262, 263, 276 Carter, A. P., 464 Carter, G. T., 133 Carvalho, R., 127, 131, 132, 133, 170 Cary, J. W., 53 Casabona, N. M., 277 Casqueiro, J., 224, 235 Castonguay, R., 117 Cate, J. H. D., 464 Catravas, G. N., 251 Ceballos, E., 218, 220, 234 Celmer, W. D., 188, 195 Cerdeno-Tarraga, A. M., 193, 345, 346 Cernota, W. H., 347, 356 Chadick, J. Z., 18, 19, 23, 24, 32, 39 Chakraborty, T., 412 Chakravarty, B., 19, 37 Chalen, M. P., 72 Challis, G. L., 145, 193, 202, 203, 345, 346, 443, 444 Chalut, C., 269 Chamberlin, J. W., 188 Chamberlin, L., 198, 345 Chami, M., 260, 276 Champney, W. S., 464 Chan, C. H., 418, 419 Chan, J., 276 Chan, Y. A., 143, 144, 145, 156, 160, 167, 490 Chandra, G., 443, 444 Chandran, S. S., 116, 300, 321, 323, 327, 330 Chang, C., 523, 538 Chang, C. W., 523, 534, 535, 538, 539 Chang, P. K., 53 Chang, Y. C., 60 Chang, Z., 125, 230 Charpentier, X., 263, 276 Chater, K. F., 193, 197, 202, 203, 245, 246, 249, 250, 345, 346, 347, 348, 349, 356, 373, 441, 442, 443, 444, 445, 447, 452, 472, 499 Chen, A. Y., 10, 21, 22, 24, 25, 27, 37, 39, 272 Chen, B., 268, 276 Chen, H., 523, 531, 532, 533, 534, 535, 536, 538, 539 Chen, J., 224 Chen, J. C., 21, 37, 39 Chen, S., 188, 229, 233, 234, 235, 237 Chen, X., 531, 532, 535, 536 Chen, X. H., 170, 171 Chen, Y. H., 387
Author Index
Chen, Y. M., 472, 473, 501 Cheng, Q., 34, 375, 380, 381, 382, 384, 388, 389, 414 Cheng, T. Y., 272 Cheng, Y. Q., 11, 127, 131, 165, 166, 167, 168, 170, 171, 182, 183 Cheung, I. K., 18, 19, 23, 24, 32, 39 Chhabra, A., 263, 266 Chiang, Y. M., 266 Chirala, S. S., 19, 37 Chirgadze, D. Y., 502 Chng, C., 251, 253 Choi, C. Y., 32 Choi, K. H., 275, 404, 410, 419, 421, 422 Choi, S. U., 227 Chopra, I., 368 Chopra, T., 11, 259, 261, 263, 272, 273, 276, 283, 411, 412, 413 Choudhry, A. E., 24, 25, 27 Christenson, S. D., 99 Chuck, J.-A., 249, 402 Chung, G. A., 262, 278, 282 Chung, J. Y., 387 Chung, L. M., 144, 145, 356 Chung, Y. S., 481 Churcher, C., 266, 268, 272, 278, 279, 282 Ciorbaru, R., 260 Clade, D., 144 Clardy, J., 170, 340 Clark, D. P., 403, 405, 407, 408, 409 Clark-Lewis, I., 380, 403 Cleland, W. W., 160 Clemens, S., 34 Clemons, W. M., 464 Cleveland, T. E., 53 Clore, G. M., 18, 19 Clough, J. M., 47 Cole, S. T., 266, 268, 272, 278, 279, 282 Coleman, C. M., 270 Coleman, R., 276, 409 Colina, A. J., 218, 220, 226, 227, 234 Collard, J., 438 Constant, P., 262, 268, 270 Converse, S. E., 271 Cooper, D. J., 272 Cooper, H. N., 264 Cooper, S. M., 171 Coppel, R. L., 262, 276 Corre, C., 145, 345 Cortes, J., 10, 11, 22, 114, 191, 193, 196, 197, 218, 234, 278, 296, 320, 322, 327, 329, 341, 345 Costa, A. M. S. B., 72 Costello, C. E., 272 Costet, L., 170 Coughlin, J. M., 165, 172, 183 Cousin, A., 170 Covarrubias, A. S., 263, 276
549
Author Index
Cowtan, K., 19 Cox, J. S., 262, 268, 270, 272 Cox, R. J., 9, 22, 37, 45, 46, 47, 50, 51, 54, 56, 61, 63, 65, 66, 67, 72, 177, 274, 377, 379, 380, 382, 403, 414 Cramer, K. D., 345 Crawford, J. M., 9, 36, 54, 56, 57, 60, 61 Crellin, P. K., 262, 276 Criado, L. M., 229, 233 Cronan, J. E., 395, 398, 399, 400, 399, 403, 406, 407, 408, 409, 410, 411, 412, 416, 418, 419, 420, 421, 423, 425 Cronan, J. E., Jr., 276, 396, 398, 400, 402, 403, 405, 407, 410, 411, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425 Cropp, T. A., 222, 327, 404 Crosby, J., 21, 22, 27, 28, 34, 36, 37, 51, 61, 177, 278, 377, 379, 380, 382, 403, 414 Cruaud, P., 277 Crump, M. P., 21, 27, 28, 34, 36, 37, 63, 65, 66, 380, 403 Cummings, R. D., 264 Cundliffe, E., 237, 356, 357 Cusick, J. K., 420, 423 Cynamon, M. H., 278 Czerwinski, E. W., 188 Czisny, A., 99 Czisny, A. M., 381 D Daffe, M., 260, 261, 260, 263, 268, 270, 274, 276, 277 D’Agnolo, G., 404, 405 Dai, A. Z., 276 Daines, R. A., 24, 25, 27 Dairi, T., 476, 479, 480 Dakrop, O., 414 Dale, G. E., 403 Dalton, E., 262 Damais, A., 170 Dancy, B. C. R., 36, 54 Daniel, J., 262, 263 Daniel, R., 13 D’Arcy, A., 403 Das, B. C., 270 Da Silva, N. A., 69 Dassa, E., 224 Dauter, Z., 19, 22, 30, 55, 403 David, H. L., 277 Davidson, A. L., 224 Davies, J., 350 Davies, J. K., 10 Davis, C. R., 50, 62 Davis, F. P., 209 Davis, M. L., 541 Dawes, S. S., 265 Dawson, M. J., 50, 272
Day, L. E., 188 Dayem, L. C., 321, 325, 358 Deacon, M., 346 DeBont, J. A., 199 Degano, M., 34 Dehesh, K., 405, 421 DeHoff, B. S., 119 de Kruijff, B., 217 Delaney, R., 419 DeLano, W. L., 18, 19 de la Roche, M. A., 425 Delaumeny, J. M., 265, 266 De Lay, N. R., 398, 399, 425 Delort, A. M., 188 Del Vecchio, F., 22 de Meijere, A., 453 de Mendoza, D., 276, 405, 408, 409, 410 Dempsey, C. E., 21, 34, 36, 37 Demydchuk, Y., 11, 191, 193, 197, 198, 199, 200 Deng, Z., 11, 156, 172, 183, 187, 191, 192, 193, 201, 202, 203, 204, 205, 206, 209, 210, 229, 233, 234, 235, 237, 480 Denoya, C. D., 123, 404 Derewenda, U., 30 Derewenda, Z. S., 18, 19, 22, 30, 55, 403 Desai, R. P., 344 De Sousa-D’Auria, C., 276 Dessen, A., 276 Dessoy, M. A., 446 Deutsch, E., 386 De Voss, J. J., 281 de Winde, J. H., 50 Dewolf, W. E., Jr., 411, 423 Dezeny, G., 442 Dharamsi, A., 30, 407 Diacovich, L., 346, 355 Dickens, M. L., 386 Dickens, S., 192, 193, 197, 198, 199, 201 Dijkhuizen, L., 464, 482, 483, 484 Dijkstra, B. W., 209, 482, 484 Dillon, S. C., 30, 34 Diltz, S., 83 DiMare, M., 195 Dimroth, P., 50 Distler, J., 466, 472, 473, 474, 479, 480, 502 Dittmann, E., 11, 360 Dittrich, F., 9, 81, 83, 99, 413 Dolot, R., 34 Domenech, P., 268, 271, 278 Domergue, F., 9, 81, 83, 99, 413 Donadio, S., 10, 114, 166, 174, 177, 191, 266, 296, 305, 306, 341 Dong, H., 11, 191, 192, 201 Dong, S. D., 353, 356, 357, 366 Donovan, F. W., 47 Dorrestein, P. C., 100, 156, 381 dos Reisa, M. C., 68 Doumith, M., 375, 447, 477, 486
550
Author Index
Dover, L. G., 264, 276 Dowd, C. S., 272, 278 Dowding, J. E., 474 Doyle, T. W., 98 Draeger, G., 531 Drager, G., 527, 531 Dra¨ger, G., 472, 530 Draper, P., 260, 261 Dreier, J., 22, 379 Drepper, A., 486 Drost, G., 217 Du, L., 175, 179, 182 Du, L. C., 55, 92, 101, 107 Duartea, R. T. D., 68 Dubendorff, J. W., 490 Dubey, V. S., 270, 276, 277, 278, 281 Dubochet, J., 260 Dubos, R. J., 270 Ducasse, S., 263, 276 Duncan, K., 262 Dunn, J. J., 490 Dupuis-Hamelin, C., 438 Duthoy, S., 278 Dutler, H., 29 Dyer, U. C., 195, 198 E Eads, J. C., 488 Ebeling, A., 407, 411 Eberl, M., 358 Ebert, A., 473 Ebert-Khosla, S., 34, 340, 344, 345, 368, 373, 375, 413 Ebizka, Y., 60 Ebizuka, Y., 52, 53, 58, 59, 171, 194, 345, 385, 387 Edwards, D. J., 55, 92, 101, 107, 126, 127, 129, 175, 179, 182 Edwards, P., 405, 421 Eggeling, L., 264, 276 Eguchi, T., 477, 478, 493, 501, 502, 503, 504, 505, 507, 508, 509, 511 Ehrlich, K. C., 36, 56, 60, 61 Eichenseer, C., 486 Eiglmeier, K., 266, 268, 272, 278, 279, 282 Elass, E., 260 Eley, K. L., 65, 67 Elling, L., 472, 524, 527, 530, 531 Ellingsen, T. E., 220, 224, 236, 244, 246, 247, 248, 254, 255, 256, 258 Ellison, E., 268 El-Sayed, A. K., 133, 171 Emorine, L., 263, 276 Emsley, P., 19 Enrı´quez, L. L., 224 Ensergueix, D., 262, 268, 282 Eramian, D., 209
Ercolani, K., 18 Eshed, R., 68 Essen, L. O., 37 Eswar, N., 209 Eusta´quio, A. S., 441, 452 Evans, D. A., 195 Evans, S. E., 21, 380, 403 Eveland, S. S., 406 Everett, M. J., 262, 278, 282 Eyles, S. J., 272 Eynard, N., 263, 276 F Facciotti, D., 9, 81, 83, 99, 413 Fahey, R. C., 460, 464 Famet, C. M., 99 Fan, Q., 505 Farnet, C. M., 11, 99, 170, 171 Fecik, R. A., 21, 27, 31, 37, 39 Fernandes, N. D., 266, 268 Fernandez, E., 34, 387 Ferreira, F., 34 Ferrer, J. L., 279 Ferreras, J. A., 263, 268, 270 Ferroud, D., 438 Fice, D., 419 Fichtlscherer, F., 99 Fiebig, K. M., 30, 407 Fiedler, H.-P., 145, 438 Fillmore, J. P., 65 Findlow, S. C., 21, 36, 37, 61, 380, 403 Finking, R., 340, 360, 399, 414 Finnan, S., 249, 250 Fischbach, M. A., 10, 170, 296 Fischer, C., 8, 388 Fischer, I., 477 Fischl, A. S., 400 Fish, S., 356 Fitzgerald, M. C., 57 Fitzmaurice, A. M., 266 Fjaervik, E., 244, 256 Flardh, K., 345 Flatman, R. H., 438 Flatt, P. M., 478, 479, 480, 495 Flett, F., 246, 247, 347, 348 Flood, E., 249, 250 Floriano, B., 441 Florova, G., 327, 422 Floss, H. G., 36, 144, 145, 203, 236, 356, 466, 479, 480, 488, 531 Flugel, R. S., 52, 151, 175, 179, 182, 373, 398, 399, 414, 425 Fonstein, L., 99 Forenza, S., 98 Fortman, J. L., 341 Foster, G. D., 72, 272 Foster, P. G., 21, 37, 39
551
Author Index
Foster, S. J., 198 Fotso, S., 254 Fouces, R., 218, 223, 224, 225 Fowler, C. B., 200 Fowler, K., 202, 203, 443, 444 Franco-Domı´nguez, E., 227, 237 Frank, M. W., 412 Franke, P., 170, 171 Fredrick, K., 464 Freel Meyers, C. L., 450, 522 Freitag, A., 449 Frey, P. A., 503 Fridman, M., 389, 451 Frigui, W., 10 Frimodt-Mller, N., 254 Fritsch, E. F., 499 Fritsche, E., 473 Fritzler, J. M., 172 Fritzsche, K., 33 Frost, E., 11, 191, 193, 197 Frueh, D. P., 37 Frutos, R., 170 Fryhle, C. B., 236 Fu, H., 22, 23, 24, 32, 34, 322, 329, 344, 350, 351, 356, 357, 366 Fu, J., 349, 360 Fu, Q., 523 Fu, X., 523 Fuchs, K., 407 Fuchsbichler, S., 407, 411 Fucini, P., 464 Fujii, I., 52, 53, 58, 59, 60, 171, 194, 387 Fujii, T., 478, 507, 508 Fujiwara, N., 276 Fujiwara, T., 495, 500 Funa, N., 59, 263, 279 Fungarob, M. H. P., 68 Furibata, K., 145 Furlaneto, M. C., 68 Furlanetoc, L., 68 Fusetani, N., 171, 172 G Gabriel, D. W., 170 Gafoor, I., 72 Gaisser, S., 272, 345 Gaitatzis, N., 126, 134, 360 Gajhede, M., 34 Gallimore, A. R., 197, 198, 199, 200 Galloway, I. S., 23, 24, 222, 327, 329 Galm, U., 3, 98, 441, 446 Gande, R., 264, 276 Gandecha, A. R., 237, 356, 357 Gao, Q., 99 Gao, Q. J., 99, 101 Garcia-Barcelo, M., 273 Garcia-Bernardo, J., 22
Gardella, T., 416 Garneau-Tsodikova, S., 448, 451 Garnier, T., 10, 263, 264, 268, 274, 275, 278 Garwin, J. L., 404, 405, 417, 418, 419, 421, 424 Gas, S., 266, 268, 272, 278, 279, 282 Gastambide Odier, M., 265, 266 Gatto, G. J., Jr., 389 Gawron, L. S., 98 Gebhardt, K., 145 Geders, T. W., 129 Gehring, A. M., 52, 151, 161, 175, 179, 182, 373, 399, 414 Gelmann, E. P., 408, 422 Georgopapdakou, N. C., 50 Gerth, K., 145, 360 Geurra, S. M., 224 Gewain, K. M., 442 Ghoorahoo, H. I., 193 Ghosal, A., 19, 21, 25, 32 Ghosh, R., 263 Gibbons, P. H., 442 Gibert, I., 272 Gibson, E., 236, 252, 254 Gibson, K. J., 264, 276, 278, 282 Gibson, M., 388 Gibson, T., 350 Gibson, T. J., 174, 177 Gicquel, B., 262, 266, 268, 277, 278, 281, 282 Gil, J. A., 220, 223, 224, 228, 229, 230, 233, 235, 236 Gilles, C., 484 Gillig, J. R., 19, 30, 34, 408, 409 Gillois, M., 277 Gilroy, J., 398, 419, 425 Giner, J. L., 98 Giovannoni, J. J., 233 Giquel, B., 272 Giraldes, J. W., 21, 27, 31, 37, 39 Giri, R., 511 Glass, S. N. L., 50 Gleeson, C., 262 Glod, F., 65, 414 Glushka, J., 277 Goeke, K., 482, 486 Goesmann, A., 412 Goff, R. D., 451 Gokhale, R. S., 11, 21, 23, 25, 37, 39, 152, 167, 206, 259, 261, 263, 266, 268, 270, 271, 272, 273, 276, 279, 281, 283, 323, 327, 329, 372, 411, 412, 413 Goldberg, I. H., 98 Golding, B. T., 217 Golik, J., 98, 229 Gomi, K., 52, 58 Gonzalez, M. C., 347, 356 Goodfelllow, M., 274 Gordee, E. Z., 188 Gordon, S. V., 266, 268, 272, 278, 279, 282
552 Goren, M. B., 260, 265, 270, 273 Gorman, M., 188 Gosain, A., 263 Goss, R. J., 313 Goss, R. M., 199, 201, 204, 205, 206, 209 Gottschalk, D., 360 Gottschalk, G., 170, 171 Gould, S. J., 345 Graham, I. A., 80, 93 Graham, S., 263, 276 Gramajo, H., 170, 319, 321, 332, 335, 339, 345, 346, 355, 356, 358, 359, 372, 414 Gramajo, H. C., 346 Grammel, N., 170, 171 Grana, D., 416 Grant, E., 272 Grasdalen, H., 224 Greenwell, L., 387 Gregory, J. F. III, 233 Gregory, M. A., 253 Griesinger, C., 453 Griffin, R., 268 Griffith, B. R., 523, 524 Griffiths, G., 260 Grimaldi, C., 276 Grisebach, H. G., 469, 472 Grogan, D. W., 396 Grond, S., 145, 167, 170, 183 Grondin, S., 278 Grooms, M., 24, 25, 27 Gros, P., 18, 19 Gross, F., 349, 360 Grosse-Kunstleve, R. W., 18, 19 Grubelnik-Leiser, A., 346 Gru¨nanger, C., 145 Gu, L., 125 Gu, Z., 19, 37 Gubernator, J., 279 Guerardel, Y., 260 Guerra, D., 83 Guerra, D. J., 408, 409 Guerra, S. M., 218, 225, 237 Guilhot, C., 262, 268, 270, 276, 282 Guirado, E., 272 Gulder, T., 447 Gulliksen, O. M., 244, 256 Gumieniak, J., 229 Gumila, C., 188 Gunawardana, G., 355 Gu¨nther, N., 472, 530 Guo, Z., 531, 532, 534, 535, 536 Gupta, S., 11, 263, 272, 273, 283 Gurcha, S. S., 263, 264, 272, 272, 276 Gurgui, C., 11 Gurvitz, A., 263, 276 Gust, B., 202, 203, 441, 442, 443, 444, 447, 448, 452, 453 Gustafsson, C., 322, 329, 344
Author Index H Haas, M. J., 474 Hadfield, A. T., 21, 27, 28 Hafner, E. W., 404 Haga, K., 482, 484 Hager, M. H., 3, 98 Hain, T., 412 Hakala, J., 386 Hallberg, B. M., 199 Hallis, T. M., 535, 536 Halo, L. M., 63, 65, 66, 67, 72 Halpern, A. L., 173 Hamill, R. L., 188 Han, L., 404, 421 Hanamoto, A., 193, 225 Hanawa-Suetsugu, K., 464 Handa, S., 236 Handelsman, J., 145, 156, 160, 167 Handschuh, L., 34 Hanefeld, U., 327, 329 Hans, A., 170 Hanson, A. D., 233 Hanson, J. R., 47 Hara, M., 167 Hara, O., 226 Hara, S., 58 Harada, S., 387 Harbacheuski, R., 268 Harding, J. R., 65 Hardt, I. H., 133 Harley, K., 54, 66 Harper, D., 193, 345, 346 Harris, B., 278 Harris, D., 266, 268, 272, 278, 279, 282 Harris, D. E., 193, 345, 346 Harris, J. M., 464 Harsulkar, A., 81 Hartsel, S., 244 Harvey, B. M., 11, 191, 192, 193, 197, 198, 199, 200, 201, 204, 205, 206, 209, 210 Hase, A., 83 Hasegawa, M., 476 Haser, R., 490 Hashimoto, E., 476 Hasler, H., 188, 195 Hattori, M., 193, 225 Haugan, K., 246, 248 Hauvermale, A., 83 Hayashi, H., 503 Haydock, S. F., 10, 11, 23, 24, 119, 191, 192, 193, 197, 198, 199, 201, 210, 218, 222, 234, 237, 301, 502 Haygood, M., 170 He, J., 11, 229, 230, 233, 235, 237 He, W., 206 He, X., 524, 537, 538
Author Index
Heath, R. J., 32, 400, 401, 404, 406, 407, 408, 409, 411, 420, 421, 422, 423 Heathcote, M. L., 199, 201, 204, 205, 206, 209 Heckman, K. L., 302 Heide, L., 437, 438, 441, 442, 446, 447, 448, 449, 450, 452, 453 Heinzel, P., 474 Hemker, M., 482, 486 Henderson, B. S., 19, 30, 34, 408, 409 Henderson, J., 409 Hendrickson, L., 50, 62 Heneghan, M., 63, 65, 66, 72 Heneghen, M. N., 72 Hennig, S., 448 Hensel, M., 262 Hensens, O. D., 98 Hertweck, C., 6, 9, 11, 33, 34, 50, 83, 93, 124, 172, 368, 389 Higgins, D. G., 174, 177 Hilde, W., 50 Hildebrand, M., 170 Hill, E. A., 36, 54 Hill, J. A., 21, 27, 28 Hill, R. L., 419 Hill, S., 145 Hiltunen, J. K., 262, 276 Hintz, M., 358 Hirata, A., 262, 279 Hiratsu, K., 171 Hirayama, T., 501 Hitchman, T. S., 22, 54, 61, 177, 403 Hitzeroth, G., 170, 171 Ho, S. N., 55 Hoang, T. T., 420, 423 Hochmuth, T., 11 Hoette, I., 217 Hoffman, D., 144 Hoffmeister, D., 50, 387 Hofle, G., 272 Hofmann, C., 350 Hofmann, J., 411, 412 Hogenauer, G., 405, 407, 411 Holden, D. W., 262 Holden, H. M., 541 Holland, D. R., 407, 411 Holmes, D. J., 410, 423 Holmes, D. S., 195, 198 Ho¨ltzel, A., 145 Holzbaur, I. E., 117 Holzenka¨mpfer, M., 145 Hong, H., 11, 22, 99, 191, 192, 193, 199, 201, 204, 205, 206, 209, 210, 382 Hong, J. S., 503, 505, 515 Hong, L., 530, 532, 533, 534, 536 Hong, S. T., 345 Hong, Y. S., 411, 438 Hoogerheide, J. C., 217 Hopke, J., 345, 350, 353
553 Hopwood, D. A., 21, 32, 34, 35, 36, 37, 52, 197, 202, 229, 230, 245, 246, 249, 266, 321, 323, 327, 330, 340, 344, 345, 346, 347, 348, 349, 351, 368, 373, 375, 381, 387, 413, 414, 442, 445, 447, 472, 474, 499 Hori, M., 503 Horinouchi, S., 226, 227, 262, 279 Horinuchi, S., 59 Horsman, G. P., 97 Horstmann, N., 167, 170, 183 Horton, R. M., 55, 302 Hosomi, Y., 495, 500 Hosted, T. J., Jr., 522 Hothersall, J., 171 Hotta, K., 191, 359, 510 Hou, X., 506 Houssin, C., 260, 276 Houston, S., 30, 407 Howells, A. J., 438 Hu, H., 229 Hu, Z., 36, 69, 118, 310, 344, 348, 349, 351, 353, 356, 364 Huang, F., 501, 502, 504, 505, 506, 510, 511 Huang, G., 170 Huang, J., 351, 353 Huang, K., 99 Huang, K. X., 99 Huang, X., 229, 233, 235, 237 Huang, Y.-S., 81 Huang, Z., 501 Hubbard, B. K., 533 Hubbard, B. R., 188, 195 Huber, D., 416 Huber, R., 473 Hudson, A. T., 275 Hughes-Thomas, Z. A., 11, 191, 193, 196, 197, 199, 201, 204, 205, 206, 209, 346 Hui, D., 171, 172 Hu¨lsmann, A., 485 Humm, A., 473 Hunt, H. D., 55 Hunziker, D., 206 Hur, G. H., 380, 414 Hurlbert, J., 25 Hurley, D., 65 Hurley, J. H., 34 Hurtubise, Y., 485 Hutchinson, C. R., 21, 23, 24, 30, 32, 34, 62, 63, 195, 322, 344, 348, 349, 350, 351, 353, 356, 364, 368, 372, 380, 381, 382, 386, 387, 388, 414 Hwang, S. J., 327 Hwang, Y. I., 227 Hwangbo, Y., 398, 425 Hyun, C. G., 381
554
Author Index I
Ichinose, K., 171, 345, 385 Iimura, Y., 58 Ikeda, D., 503 Ikeda, H., 119, 123, 145, 193, 225 Imanaka, T., 473 Inomata, K., 477, 478, 502 Inoue, S., 188 Ipsen, H., 34 Irschik, H., 167, 170, 183 Ishida, K., 11, 33 Ishida, N., 400 Ishii, T., 171 Ishikawa, J., 191, 193, 225 Ishiyama, A., 188 Isogai, A., 145 Itoh, S., 468 Itoh, T., 385 Itou, K., 345 Iwasaki, S., 99 Iwase, N., 501 Iyer, L. M., 34 Izumikawa, M., 194, 279, 375, 381, 382, 384, 388, 389 J Jackowski, S., 398, 403, 405, 416, 418, 424 Jackson, M., 260, 266, 268, 278, 279, 282, 355 Jackson, P. D., 418 Jacobs, W. R., Jr., 262, 268, 270, 272, 276, 277 Jacobsen, J. R., 23, 25, 167, 313, 348, 372 Jahn, D., 360, 414 Jain, M., 262, 263, 270, 271 Jakimowicz, D., 443, 444 Jakobsen, O. M., 247, 255 James, K. D., 193, 345, 346 Jansen, R., 167, 170, 183 Janson, C. A., 24, 25, 27 Janssen, D. B., 209 Jansson, A., 21, 204, 386, 387 Jaoua, S., 308 Jarlier, V., 260 Jarzabek, M. E., 414 Jaskolski, M., 34 Jaworski, J. G., 424, 425 Jay, M., 254 Jayaraj, S., 323 Jekel, P. A., 209 Jeminet, G., 188 Jencks, W. P., 420 Jenke-Kodama, H., 11, 360 Jenkin, G. A., 10 Jenni, S., 19, 37, 272 Jeong, K. L., 229, 233, 235, 237 Jeong, T. S., 438 Jeschek, C., 407
Jiang, H., 9, 79, 84, 95, 99 Jiang, J., 522, 523 Jiang, J. S., 18, 19 Jiang, Y., 418, 419 Johnson, P. D., 10 Jomaa, H., 358 Jones, M. A., 11, 191, 193, 197, 199, 201, 204, 205, 206, 209 Jones, M. D., 262 Jones, T. A., 199, 263, 276 Joost van Neerven, R. J., 34 Jordan, P. M., 50, 63 Jornvall, H., 28 Joshi, A. K., 18, 19, 21, 23, 24, 25, 29, 32, 39, 55, 64, 275 Joshi, K., 81 Ju, J., 3, 172, 183 Ju, J. H., 98, 100 Julian, E., 272, 276 Julien, B., 131, 170, 308, 314, 315, 345 Jung, M. E., 387, 388 Jung, W. S., 503, 505, 515 K Kadziola, A., 19, 24, 25, 27, 490 Kahne, D., 389, 448, 450, 451 Kaiser, O., 170, 412 Kakavas, S. J., 355 Kakinuma, K., 477, 478, 495, 500, 501, 502, 503, 511 Kalaitzis, J. A., 34, 345 Kalinowski, J., 412 Kalk, K. H., 482, 484 Kallberg, Y., 28 Kallenborn, H. G., 145 Kallender, H., 263, 275, 276 Kallio, P., 21, 377, 386, 388 Kaminishi, T., 464 Kammerer, B., 441, 442, 446, 447, 448, 453 Kampers, T., 485 Kana, B. D., 265 Kang, J. S., 438 Kang, S. H., 438, 500, 516 Kanjilal, S., 278 Kao, C. M., 123, 196, 251, 253, 320, 327, 341, 344, 349, 351, 353, 357 Kaplan, G., 268, 272, 279 Kaplan, L., 145 Kapur, V., 278 Karchin, R., 209 Kase, H., 468, 484 Kastaniotis, A. J., 263, 276 Katayama, K., 21, 386 Kato, Y., 145, 308, 314, 315, 356 Katsumata, S., 167 Katz, E., 474
Author Index
Katz, L., 10, 113, 114, 119, 144, 145, 166, 174, 177, 191, 196, 266, 296, 320, 341, 344, 349, 353, 355, 356, 357, 366 Kaulmann, U., 9, 83, 93 Kauppinen, S., 404 Kawamoto, I., 167 Kawazoe, M., 464 Kayser, O., 244 Kealey, J. T., 52, 69, 321, 324, 325, 331, 358 Kealey, T. J., 69 Keating, D. H., 398, 416 Keating, T. A., 161, 280, 281 Keatinge-Clay, A. T., 21, 22, 24, 25, 26, 27, 28, 30, 32, 34, 72, 117, 298, 306, 368, 376 Keithly, J. S., 172 Kelemen, G. H., 345 Kelleher, N. L., 9, 36, 57, 100, 145, 156, 160, 167, 381 Kelleher, N. P., 50 Kellenberger, L., 29, 327, 329 Keller, J. M., 265 Kelly, L., 209 Kelly, T. M., 406 Kemperman, R. F., 80 Kendrew, S. G., 11, 22, 62, 191, 193, 197, 386, 387 Kennedy, D. R., 98 Kennedy, E. P., 400 Kennedy, J., 12, 62, 63, 321, 324, 325, 326, 331, 358, 359 Kevany, B. M., 144, 145 Khalameyzer, V., 477 Khandekar, S. S., 24, 25, 27 Kharel, M. K., 489, 501, 502 Khaw, L., 23, 24 Khaw, L. E., 218, 234, 237, 251 Khosla, C., 10, 21, 22, 23, 24, 25, 26, 27, 32, 34, 36, 37, 39, 52, 60, 64, 69, 72, 145, 151, 152, 167, 175, 177, 179, 182, 196, 206, 214, 272, 306, 320, 323, 327, 329, 330, 340, 341, 344, 345, 346, 348, 349, 355, 356, 357, 358, 359, 368, 372, 373, 375, 376, 379, 380, 381, 382, 383, 384, 385, 399, 413 Kiderlen, A. F., 244 Kieser, H., 193, 201, 202, 245, 246, 345, 346, 347, 348, 349 Kieser, H. M., 245, 249, 373, 472 Kieser, T., 197, 202, 203, 229, 245, 249, 302, 303, 304, 309, 373, 442, 443, 444, 445, 447, 472, 499 Kikuchi, H., 193, 225 Kim, B.-G., 501 Kim, B. S., 222, 327 Kim, C. G., 236, 438 Kim, C. Y., 21, 22, 24, 25, 27, 37, 39, 60, 64, 69, 383 Kim, D. H., 438, 481 Kim, E. S., 345
555 Kim, H. J., 264 Kim, J. Y., 500, 516 Kim, K. R., 480 Kim, K. W., 438 Kim, S. O., 480 Kim, W., 314 Kim, W. G., 412 Kim, Y., 398, 425 Kim, Y. S., 356, 377 Kimber, M. S., 30, 407 Kimberley, M. R., 385 Kinashi, H., 171 Kinoshita, K., 206, 313 Kinoshita, S., 478, 507, 508 Kinsland, C. L., 501 Kirayama, K., 495, 500 Kirschning, A., 472, 527, 530, 531 Kitade, Y., 400 Kitamura, S., 484 Kitani, S., 172, 227 Kittendorf, J. D., 21, 27, 31, 37, 39, 136 Klages, A. L., 404, 417, 419, 421 Klages Ulrich, A., 405, 410 Klassen, J. B., 421 Klich, M., 438 Klimowicz, A. K., 145, 156, 160, 167 Klohr, S. E., 98 Kluepfel, D., 485 Knauf, V., 9, 81, 83, 99, 413 Kobayashi, H., 99 Kobayashi, K., 272 Kobayashi, S., 375, 376, 379, 383 Kodama, K., 171 Kodumal, S. J., 321, 348, 350, 358 Koglin, A., 37 Kogure, T., 501 Kohana, A., 188 Kohli, R. M., 37 Koike-Takeshita, A., 500 Koizumi, K., 145 Kojima, K., 501 Koketsu, K., 359 Kolattukudy, P. E., 262, 263, 264, 265, 268, 270, 271, 272, 278, 280 Kollas, A., 358 Kollenz, G., 407, 411 Kolodzi-Ejczyk, P., 229 Kolter, R., 170 Kolvek, S. J., 345, 350, 353 Kominek, L. A., 442 Kondo, K., 227 Kondo, S., 510 Ko¨nig, A., 23, 24, 218, 222, 234, 237 Konishi, M., 99 Konz, D., 360, 414 Koonin, E. V., 34 Koorbanally, N. A., 506, 510 Kopp, M., 170, 308
556
Author Index
Koppisch, A. T., 368, 382, 384 Kordulakova, J., 268 Korman, T. P., 21, 27, 28, 29, 30, 35, 384, 385 Korotkova, N., 355 Koskiniemi, H., 387 Koumoutsi, A., 170, 171 Kozubek, A., 278 Krastel, P., 145 Kreiswirth, B. N., 268 Kremer, L., 260, 260, 272, 273, 419, 421, 422 Krishnan, B., 98 Krithika, R., 281 Kroken, S., 50 Kroutil, W., 199, 201, 204, 205, 206, 209 Krucinski, J., 21, 37, 39 Krug, D., 171 Kruger, R. G., 389 Kruh, N. A., 415 Krumbach, K., 262, 263, 276 Kubo, Y., 58 Kudo, F., 206, 477, 478, 493, 495, 500, 501, 502, 503, 504, 505, 507, 508, 509 Kuhstoss, S., 119 Kula, M.-R., 530, 531 Kull, A., 29 Kumar, P., 262, 272, 296 Kumasaka, T., 501 Kuner, J., 83 Kunieda, K., 345 Kunimoto, S., 188 Kunst, F., 170 Kunze, B., 272 Kurepina, N., 268 Kuriki, H., 502 Kurth, D., 346, 355 Kurumbang, N. P., 503 Kusunose, M., 265 Kuszewski, J., 18, 19 Kuwahara, M., 477, 478, 502 Kwak, J. H., 411 Kwon, H.-J., 480, 500, 516, 531, 532, 533, 550 Kwon-Chung, K. J., 60 L Laatsch, H., 254 Labesse, G., 263, 276 Lacave, C., 273 LaCelle, M., 52, 151, 175, 179, 182, 373, 399 Lackner, P., 34 Lacroix, C., 278 LaGier, M. J., 172 Lai, C. Y., 403, 406 Laila, P., 172 Laiple, K. J., 167, 170, 183 Lam, K. S., 98 Lamb, S., 522 Lamba, D., 34
Lambalot, R. H., 52, 151, 152, 175, 179, 182, 343, 373, 398, 399, 425 Lamichhane, J., 438 Lancelin, J. M., 218, 254, 255, 256 Lane, J. M., 262 Laneelle, G., 261, 262, 265, 268, 274, 276, 277 Laneelle, M. A., 268, 270, 274, 276, 277 Langenhan, J. M., 524 Lantz, A. E., 441 Lardizabal, K., 9, 81, 83, 99, 413 Large, S. L., 357 Larrabee, A. R., 400 Larrouy-Maumus, G., 260 Larsen, J. N., 34 Larsen, S., 19, 24, 25, 27 Larson, T., 80, 93 Larson, T. J., 403, 404 Laskowski, R. A., 19 Lassaigne, P., 438 Lassner, M., 9, 81, 83, 99, 413 Latif, M., 350 Lau, J., 22, 23, 24, 117, 177 Laval, F., 266 Lawson, D. M., 438 Lazarus, C. M., 48, 50, 54, 63, 65, 66, 67, 72 Leach, B. I., 347, 356 Leadlay, P. F., 10, 11, 12, 22, 23, 24, 30, 99, 191, 192, 193, 196, 197, 198, 199, 200, 201, 204, 205, 206, 209, 210, 218, 222, 237, 251, 271, 278, 296, 320, 322, 327, 329, 340, 341, 345, 346, 505 Leaf, T., 344, 356 Leary, J. A., 262, 263, 271, 272 Lea-Smith, D. J., 262, 276 Leavell, M. D., 262, 268, 272 Lebrihi, A., 197, 475 Lederer, E., 260, 261, 266, 267, 270, 274 Lee, C. K., 227 Lee, C. M., 262 Lee, D. H., 263, 271 Lee, H. C., 481, 489, 501, 502, 530 Lee, H. Y., 383 Lee, I.-K., 523 Lee, K. J., 356 Lee, K. M., 227 Lee, R. E., 10, 274 Lee, S., 411, 466, 479, 480 Lee, S.-G., 530 Lee, S. Y., 229, 233, 235, 237 Lee, T. S., 32, 375, 376, 379, 381, 383 Lee, Y. S., 381 Leemhuis, H., 464, 482, 483, 484 Leesong, M., 19, 30, 34, 408, 409 Lei, M., 147, 152 Leibundgut, M., 19, 24, 25, 27, 37, 39 Leigh, C. D., 262 Leimkuhler, C., 389 Leistner, E., 144
557
Author Index
Leitinger, B., 407, 411 Lemassu, A., 260, 270, 277 Lemke, A., 244 Lengeler, J., 475 Lennarz, W. J., 422 Lenz, J., 482, 486 Leonard, A. E., 81, 83 Leroy, Y., 260 Lesjean, S., 262, 276 Lester, J. B., 11, 191, 192, 193, 197, 198, 199, 201, 218, 234 Lever, M., 251 Levering, C., 9, 81, 83, 99, 413 Levy, S. B., 407, 411 Lewis, T., 9 Li, J., 21, 30, 37, 202, 203, 205, 206, 209 Li, L., 278, 480, 523 Li, Q., 21, 22, 37 Li, S. M., 441, 446, 448, 449, 450, 452 Li, W., 156 Li, W. B., 276, 409 Li, W. L., 100 Li, X., 350 Li, Y., 34, 422, 502, 506, 510, 511 Liang, T.-C., 188, 195 Liang, X. Z., 101 Liao, J., 523 Licari, P., 344, 356 Lidstrom, M. E., 355 Light, R. J., 422 Ligon, J., 130, 145 Lill, R., 22 Lim, S.-K., 165, 503, 505, 515 Lima, C. D., 267, 268 Limpkin, C., 21, 27, 28 Lin, D. C., 421 Lin, E. C. C., 475 Lin, F. L., 262, 263, 271, 272 Lin, X., 203, 204, 205, 206, 209 Lindquist, Y., 19, 24, 25, 27 Lindsay, Y., 327 Linenberger, M., 98 Linz, J. E., 54 Liou, G. F., 22, 23, 177 Liou, K., 481, 489, 501, 502, 503, 530 Lipata, F., 388 Lipman, D. J., 192 Liras, P., 224, 226, 227, 235, 237 Liu, C. W., 21, 36, 37 Liu, H., 170, 355 Liu, H.-W., 521, 522, 523, 524, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 550 Liu, J., 193, 201, 202 Liu, L., 52, 69 Liu, T., 187, 202, 203, 204, 205, 206, 209 Liu, W., 99, 100, 101 Liu, Y., 145, 326, 359
Liu, Y.-N., 524, 530, 531, 532, 533, 535, 536 Liu, Z., 377, 388 Llewellyn, N. M., 489, 495, 504, 505, 506, 510, 511, 514 Lobo, S., 404, 421 Locht, C., 260, 262, 276 Logan, R., 247, 353 Lombo´, F., 34, 246, 356 Lomovskaya, N., 99 Long, J., 403 Long, P. F., 11, 191, 193, 197, 278 Lonsdale, J. T., 24, 25, 27, 263, 276 Lopanik, N. B., 127, 170 Lopez, P., 410 Losey, H. C., 522, 533 Loughran, M. S., 23, 222 Low, L., 22 Lowary, T. L., 263 Lowden, P. A., 124 Lowenstein, H., 34 Lozano, M. J., 387 Lu, H., 21, 37, 39, 206, 214 Lu, P., 398, 423 Lu, W., 389 Lu, X., 262, 268 Lu, Y., 30, 407 Lu, Y. W., 414 Lucher, L. A., 472, 473, 501 Luft, T., 446, 452 Luiten, R., 223 Lum, A. M., 251, 253, 351, 353 Lundgren, B., 254 Luniak, N., 360 Luo, G., 116, 196, 341 Luo, R., 21, 27, 29, 30, 384, 385 Lupoli, T., 389, 451 Luquin, M., 272, 277 Lurz, R., 485 Luzhetskyy, A., 6, 350, 368, 389, 524 Lydiate, D. J., 245, 249, 373, 472 Lynch, S., 249, 250 Lynen, F., 50 Lynett, J., 272 M Ma, S. M., 56, 60, 63, 384 Ma, Y., 9 MacArthur, M. W., 19 MacNeil, D. J., 442 MacNeil, I. A., 345, 350, 353 MacNeil, T., 442 Madden, T. L., 192 Maddry, J. A., 263 Madduri, K., 386 Madhusudhan, M. S., 209 Maeda, H., 98 Maes, E., 260
558 Magnuson, K., 403, 404 Magnusson, M., 274 Maharjan, J., 438 Mahmud, T., 203, 466, 478, 479, 480, 495 Maier, T., 19, 24, 25, 27, 37, 39, 268, 306 Majerus, P. W., 421 Malaga, W., 262, 268 Malpartida, F., 216, 217, 225, 236, 245, 254, 368 Maltby, D. A., 21, 24, 25, 34, 72, 368, 376 Manabe, C., 188 Manca, C., 268, 271, 278 Maniatis, T., 499 Mansilla, M. C., 410 Mansoor, H., 278 Mansouri, K., 472, 473, 474, 490, 502 Mantsala, P., 21, 204, 377, 386, 387, 388 Mao, Y., 124 Marahiel, M. A., 37, 52, 151, 175, 179, 182, 340, 360, 373, 399, 414 Marathe, U. B., 276, 280, 281 Marchis-Mouren, G., 484 Marcotte, E. M., 398, 423 Marcus, M., 356, 357, 366 Margeat, E., 262, 276 Markovic-Housley, Z., 34 Marquez, S., 356, 357, 366 Marrakchi, H., 262, 274, 276, 277, 410, 411, 419, 421, 423 Marsden, A. F. A., 23, 24, 116, 123, 222 Marsh, E. N., 387 Marshall, B. J., 280, 281 Marshall, J. W., 63, 65, 66 Marti, T., 36 Martin, C., 270, 272 Martin, C. J., 6, 273, 346 Martin, F., 30, 407 Martı´n, J. F., 215, 216, 217, 218, 220, 223, 224, 225, 226, 227, 228, 229, 230, 233, 234, 235, 236, 237 Martinez, A., 345, 350, 353 Martinez, R. A., 145 Marti-Renom, M., 209 Massengo-Tiasse, R. P., 411, 420, 421, 423 Matern, U., 469 Matharu, A. L., 278 Mathema, B., 268 Mathews, I., 383 Mathews, I. I., 21, 22, 24, 25, 27, 39, 60, 64, 69 Mathur, M., 266, 270 Matsunaga, I., 272 Matsunaga, S., 5, 171, 172 Matsushima, Y., 501 Matsuura, S., 145 Matter, A. M., 170 Mattes, R., 358 Maurin, D., 270 Maurus, R., 464 Mauvais, P., 438
Author Index
Maxwell, A., 438 May, B. J., 278 Mayama, M., 145 Mayasundari, A., 412 Mayer, A., 66, 350 Mayer, G., 487 Mazodier, P., 246 McAda, P. A., 50, 62 McAdam, R. A., 262 McAllister, K. A., 399, 400 McAlpine, J. B., 11, 191 McArthur, H. A., 11, 191, 193, 197, 404, 415 McConville, M. J., 265, 276 McDaniel, R., 23, 24, 30, 34, 36, 296, 300, 301, 305, 307, 310, 322, 327, 329, 340, 344, 345, 348, 349, 350, 351, 353, 356, 364, 368, 373, 375 McDonald, F. E., 191 McGuire, K. A., 403, 422 McKeown, D. S. J., 53 McKinney, J. D., 265 McLafferty, F. W., 501 McMahon, H., 245 McMeekin, T., 9 McMurry, L. M., 407, 411 McNeil, M. R., 261, 268, 277 McNicholas, C., 53 McPherson, A., 18 Mdluli, K., 274 Meadows, E. S., 21, 24, 26, 372, 383 Medina, N., 278 Medzihradszky, K. F., 21, 24, 25, 34, 72, 368, 376 Megessier, S., 170 Mehta, R., 464 Meier, J. L., 380, 414 Meiser, P., 171 Melancon, C. E. III, 522, 523, 524, 530, 531, 532, 533, 534, 536, 540, 541, 550 Meluzzi, D., 381, 388, 389 Menche, D., 132, 133, 167, 170, 183 Mendes, M. V., 216, 217, 218, 223, 224, 225, 227, 237 Me´ndez, C., 11, 34, 246, 387, 524 Menzella, H. G., 116, 298, 319, 321, 323, 324, 325, 327, 329, 330, 331, 332, 335, 339, 340, 348, 350, 358, 359 Mercer, A. C., 400 Mersinias, V., 246, 247, 347, 348 Merski, M., 36, 54 Merson-Davies, L. A., 356, 357 Metcalfe, S., 251 Metsa-Ketela, M., 377, 388 Metz, J. G., 9, 81, 83, 84, 85, 95, 99, 405, 413, 421 Meyer, F., 412 Meyer, W. E., 217 Miao, V., 350 Michel, J.-M., 375, 447, 477, 486
559
Author Index
Middlebrook, G., 270 Miercke, L. J., 21, 22, 24, 26, 37, 39 Migita, A., 200, 359 Miller, W., 192 Millership, J. J., 172 Mills, J., 403 Mills, P. R., 72 Minagawa, K., 203, 480 Minnikin, D. E., 260, 262, 274, 276, 277, 279, 282 Minnikin, S. M., 274 Mironenko, T., 11, 191, 192, 193, 197, 198, 199, 201, 210, 346, 502 Misaki, A., 261 Mislin, R., 29 Mittag, M., 99 Miyara, I., 68 Miyoshisaitoh, M., 99 Mizrahi, V., 266 Mizugaki, M., 406 Mizuguchi, K., 199 Mochizuki, S., 171 Modak, R., 434 Mofid, M. R., 399 Mogensen, J. E., 34 Mohan, S., 406 Mohanty, D., 11, 23, 259, 261, 262, 263, 265, 268, 269, 270, 271, 272, 273, 276, 279, 280, 281, 282, 283, 411, 412, 413 Molle, V., 261, 276 Mller Jensen, I., 254 Molnar, I., 23, 24, 122, 125, 126, 145, 218, 222, 234, 237 Monaghan, R. L., 145 Money, S., 145 Monsempe, C., 278 Montrozier, H. L., 262, 276, 277 Moody, D. B., 272 Moore, B. S., 32, 34, 36, 124, 282, 345, 375, 380, 381, 382, 384, 388, 389, 414 Mootz, H. D., 414 Morehouse, C. B., 263 Moreira, A. L., 268 Morgan-Warren, R. J., 464 Mori, K., 227 Mori, Y., 58 Moriguchi, T., 53 Morimoto, M., 167 Morita, N., 81, 83, 95 Morosoli, R., 485 Mosi, R., 482, 484 Moss, D. S., 19 Moss, S. J., 6, 11, 144, 145, 298 Moszer, I., 170 Motamedi, H., 32 Mougous, J. D., 262, 263, 271, 272 Moura, R. S., 227, 237 Mowbray, S. L., 199
Muchel, S. E., 263, 271 Muhlecker, W., 272 Mukerji, P., 83 Mu¨ller, J., 145 Mu¨ller, R., 6, 12, 129, 145, 167, 170, 171, 183, 271, 296, 306, 341, 349, 360, 523 Munoz, M., 277 Murakami, K., 523, 534, 535, 538, 539 Murata, M., 5, 194 Murli, S., 23, 24, 321, 325, 358 Murphy, B., 223, 235, 250, 254 Murphy, C. K., 411, 420, 421, 422 Murray, M., 21, 34, 36, 37 Murry, J. P., 264 Murugan, E., 101 Musicki, B., 438 Muskiet, F. A., 80 Muth, G., 450 Mutka, S. C., 69, 310, 326, 359 Muttucumaru, D. G., 264 Muyrers, J. P., 12, 13 Mve-Obiang, A., 10 N Naganawa, H., 188 Naharro, G., 228, 229, 230 Nakaido, H., 260, 261, 273 Nakamura, A., 482, 484 Nakamura, M., 188 Nakanishi, M., 400 Nakano, H., 167 Nakano, M. M., 147, 152 Nakashima, T. T., 195 Nakayama, J., 145 Nakayama, K., 468, 484 Nampoothiri, K. M., 262, 276 Nango, E., 500, 501, 502 Naoki, H., 5 Napier, J. A., 9, 80, 93 Narasimhan, M., 272, 409 Narumi, K., 266 Natarajan, V. T. D., 267, 272 Nedal, A., 236, 258 Nelsen, J. S., 405, 421 Ness, T., 188 Neumann, B., 102 Newburn, S. A., 264 Newton, G. L., 460, 464 Neyrolles, O., 270, 278 Nguyen, D. K., 50, 62 Nguyen, N. T., 464 Nguyen, T., 11 Nguyen, V. D., 438 Ni, X., 506 Nichols, B. P., 233 Nichols, C. M., 9 Nichols, D., 9
560
Author Index
Nichols, P. D., 9 Nicholson, G., 171 Nicholson, T. P., 37, 50, 51, 58, 61, 65, 382, 414 Nic Lochlainn, L., 252 Nie, L. P., 99 Nielsen, J., 145, 441 Niemi, J., 21, 204, 377, 386, 387, 388 Nierhaus, K. H., 464 Nietlispach, D., 11 Nigou, J., 260, 262 Nihira, T., 172, 227 Nijkamp, H. J., 403 Nikaido, H., 260 Nikodinovic, J., 249 Nilges, M., 18, 19 Nishida, T., 81, 83, 95, 511 Noel, J. P., 8, 24, 279, 345 Noguchi, H., 279 Noll, H., 261, 272 Nonaka, K., 99 Numakura, M., 503 Nur-e-alam, M., 388 Nussbaumer, B., 450 O Oberthur, M., 389, 450 O’Brien, K., 247, 353 O’Connell, J. D. III, 21, 22, 24, 26 Odakura, Y., 468, 484 Oefner, C., 403 Oesch, F., 199 Oethinger, M., 407, 411 Ogasawara, N., 170 Oguri, H., 200, 359 Oguro, S., 279 Oh, J., 530 Oh, T. J., 99, 215, 262, 263, 481, 503 Oh, W., 403, 404 O’Hagan, D., 28, 46, 267, 344, 368 O’Hare, H. M., 30, 117, 263, 276 Ohlrogge, J. B., 424, 425 Ohmori, D., 503, 504 Ohnishi, Y., 59 Ohno, T., 188 Ohnuki, T., 473 Ohta, T., 476 Oikawa, H., 200, 359 Oikawa, T., 262, 276 Okada, H., 227 Oki, T., 99 Okuyama, H., 81, 83, 95 Olano, C., 11, 134, 246 Oliveira, M. A., 388 Olivera, N., 218, 223, 224, 225 Oliynyk, M., 11, 99, 122, 191, 192, 193, 197, 198, 199, 201, 218, 234, 249, 296, 322 Oliynyk, Z., 193
Olland, A., 18 Olsen, J. G., 19, 24, 25, 27, 403, 405, 422 O’Maille, P. E., 8 Omura, S., 119, 188, 193, 216, 225, 381 Ono, M., 145 Ono, Y., 52 Onwueme, K. C., 265, 268, 270 Oppermann, U., 28 Orelle, C., 224 Orikasa, Y., 81, 83, 95 Orr, E., 171 Ortmann, R., 469 Osburne, M. S., 345, 350, 353 Osmark, P., 34 Ostergaard, L. H., 29 Ota, Y., 502 Otoguro, K., 188 Otsuka, M., 171 Otzen, D. E., 34 Ou, S., 348, 349, 353, 356, 364 Overall, C. M., 464 Owen, P., 380, 403 Ozanick, S. G., 490 Ozawa, H., 262, 279 Ozawa, M., 345 P Pacey, M. S., 123 Paget, M. S., 198 Paitan, Y., 171 Palaniappan, N., 32, 128 Palzer, M., 34 Pan, H., 21, 24, 26 Pannu, N. S., 18, 19 Papa, F., 273 Pape, H., 482, 486 Parajuli, N., 503, 505, 515 Parekh, S., 351 Parish, T., 262, 263, 276 Park, C., 62 Park, H. R., 227 Park, J. W., 503, 505, 515 Park, S. H., 500, 516 Park, S.-H., 531 Park, S. K., 416 Park, S. R., 503, 505, 515 Parkhill, J., 267, 268, 272, 276, 279, 282 Parkinson, J. A., 21, 34, 36, 37 Parlett, J. H., 274 Partida-Martinez, L. P., 172 Pashley, C. A., 262 Pasternak, O., 34 Patel, A., 170 Patel, H. M., 161 Patel, K., 301, 304 Patel, K. G., 321, 323, 327, 330, 348, 350, 358 Pathak, A. K., 263
561
Author Index
Pathak, V., 264 Patrick, J. B., 217 Paul, T. R., 260 Paulsen, H., 469 Pawlak, J., 229 Payan, F., 484 Payne, D. J., 411, 423 Payne, G. A., 53 Payre, G. A., 260 Pease, L. R., 55, 302 Peery, R. B., 399, 400 Peiru´, S., 310, 319, 321, 332, 335, 346, 355, 359 Pel, H. J., 50 Pelzer, S., 167, 170, 183, 341 Penn, J., 350 Pereira, S. L., 81, 83 Perez, E., 262, 268, 270, 282 Perez-Zuniga, F. J., 225 Perham, R. N., 222 Perlova, O. K., 167, 170, 183, 360 Pernodet, J.-L., 197, 475 Persson, B., 28 Petit, J. F., 260 Petkovic, H., 22, 122, 301 Petrakovsky, O. V., 353, 356, 357, 366 Petter, R., 246 Petzold, C. J., 262, 263, 271, 272 Pfeifer, B. A., 12, 345, 356, 358, 359, 372 Pflugrath, J. W., 18 Phan, T. H., 500, 516 Phatale, P. A., 262 Phillips, G. J., 416 Piagentini, M., 23, 24, 30 Piel, J., 11, 32, 125, 126, 127, 129, 170, 171, 172, 372, 388, 389, 453 Piendl, W., 486 Pieper, U., 209 Piepersberg, W., 246, 375, 447, 459, 460, 464, 465, 466, 467, 468, 472, 473, 474, 476, 477, 478, 479, 480, 481, 482, 485, 486, 487, 490, 495, 502, 530 Pieretti, I., 170 Pinkerton, M., 188 Piraee, M., 10 Pissowotzki, K., 473, 490 Pitarque, S., 260 Platzer, M., 11, 171, 172 Podesta, F., 346, 355 Podevels, A. M., 144, 145, 156, 160, 167 Pohl, N. L., 36 Polacco, M. L., 405, 408, 409 Polderman-Tijmes, J. J., 209 Polgar, N., 272 Polizzi, B. J., 411, 423 Popovic, B., 30, 502 Porcelli, S. A., 272, 276 Portevin, D., 276 Pospiech, A., 102
Post-Beittenmiller, D., 424, 425 Poulsen, F. M., 34 Power, P., 223, 235, 249, 254 Powles, H., 65, 67 Pradella, S., 170 Praseuth, A. P., 359 Pratt, M. R., 263, 271 Prescott, D. J., 398 Prestegard, J. H., 398, 425 Price, A. C., 19, 24, 25, 27, 29, 405 Priestley, N. D., 386 Prome, J. C., 277 Pross, E. K., 167, 170, 183 Prusky, D., 68 Pryor, M. J., 10, 278 Puehler, A., 450 Pugh, E. L., 419 Puglisi, J. D., 21, 36, 37 Pullen, J. K., 55 Pulsawat, N., 127, 129, 172 Puzo, G., 260 Pyke, J. S., 262, 276 Q Qiu, X., 24, 25, 27 Quadri, L. E., 147, 152, 161, 262, 267, 268, 270, 280, 281, 414 Quail, M. A., 193, 345, 346 Que, N. L., 531, 532, 535, 536 Quemard, A., 262, 263, 276 Quinlivan, E. P., 233 Quinn, C., 411, 423 Quiocho, F. A., 19, 37 Quiros, L. M., 387 R Rachid, S., 171 Radauer, C., 34 Radax, R., 13 Raetz, C. R., 397, 406 Rafanan, E. R., Jr., 388 Rafferty, J. B., 398, 419, 425 Rafidinarivo, E., 277 Rai, D., 223, 235, 254 Rainwater, D. L., 263, 266, 267 Rajkarnikar, A., 480 Rajski, S. R., 79 Ramakrishnan, V., 464 Rangan, V. S., 19, 22, 56, 64 Ranganathan, A., 327, 329 Rao, R. N., 247, 353 Rapp, H., 449 Rarick, D., 54 Rascher, A., 124 Ratledge, C., 280, 281 Ratnatilleke, A., 346 Rauzier, J., 270
562 Ravanel, S., 233 Rawlings, B., 223, 235, 236, 252, 254 Rawlings, B. J., 265 Rawlings, M., 404, 406, 416 Ray, T. K., 418 Rayment, I., 21, 386 Raynal, M.-C., 375, 447, 477, 486 Read, R. J., 18, 19 Re´beille´, F., 233 Rebets, Y., 6, 368, 389 Recio, E., 216, 217, 223, 225, 226, 227, 237 Redfield, C., 18, 23, 24, 32 Reed, M., 414 Reed, M. A., 37, 268 Reed, M. B., 268, 272, 279 Reed, S. L., 411, 423 Rees, D. O., 65 Reeves, A. R., 347, 356, 357, 366 Reeves, C. D., 23, 24, 69, 144, 145, 295, 301, 304, 311, 321, 340, 353, 356 Reeves, P., 469 Reeves, P. C., 50, 62 Reid, R., 30, 52, 69, 117, 151, 170, 175, 179, 182, 307, 321, 323, 324, 325, 327, 330, 331, 348, 350, 353, 356, 358, 373, 399 Reinscheid, U. M., 453 Reisinger, S. J., 321, 323, 324, 325, 327, 330, 331 Remakrishnan, V., 464 Remsing, L. L., 6, 387, 388 Revill, W. P., 144, 145, 301, 353, 356, 357, 366, 413, 414 Reynolds, K. A., 32, 222, 327, 355, 403, 415, 421, 422 Reynolds, R. C., 263 Rheinheimer, J., 145 Rice, D. W., 398, 419, 425 Rice, L. M., 18, 19 Richardson, C. C., 490 Richter, L., 9, 84, 95, 99 Rickards, R. W., 217 Ridell, M., 277 Riezman, H., 217 Rigden, D. J., 400 Riley, L. W., 262, 264, 271 Ripka, S., 50, 51 Rittmann, D., 264 Ritzenthaler, J. D., 264 Rivera-Marrero, 264 Rix, U., 8, 387, 388 Roach, C., 50, 62 Roberts, G. A., 10, 191, 196, 320, 341 Roberts, M., 368 Roberts, W. C., 3 Robinson, J. A., 188, 195, 198, 346 Rock, C. O., 19, 24, 25, 27, 30, 32, 37, 276, 398, 400, 403, 404, 405, 406, 407, 408, 409, 411, 412, 416, 417, 418, 419, 420, 421, 422, 423, 424
Author Index
Rock, Y. M., 19, 25, 405, 406, 407 Rockser, Y., 479, 480, 481, 483, 486 Rodriguez, E., 30, 295, 311, 321, 332, 335, 339, 340, 346, 348, 349, 353, 355, 356, 358, 359, 364 Rodriguez, G. M., 280 Rodrı´guez-Garcı´a, A., 227, 237 Roepenack-Lahaye, E., 34 Roessler, P., 9, 81, 83, 99, 413 Rogers, L. M., 267, 268 Rohr, J., 8, 387, 388 Roig-Zamboni, V., 270 Rokem, J. S., 441 Rolon, M. S., 225 Roman, J., 265 Romer, U., 472, 530 Ron, E. Z., 171 Ronson, C. W., 412 Rosat, J. P., 272 Rosenberg, A. H., 490 Rosenberg, E., 171 Rosenfeld, I. S., 404, 405 Rosenzweig, B., 83 Rossi, A., 209 Roujeinikova, A., 398, 419, 425 Rousseau, C., 278, 279, 282 Rowe, C. J., 134, 269, 345 Roy, R. P., 11, 262, 271, 272, 273, 281 Royer, M., 170 Ruan, X., 122, 296, 301 Rubin, E. J., 262 Rubin, J. R., 407, 411 Rubin-Pitel, S. B., 280 Ruby, C. L., 442 Ruch, F. E., 22 Rudd, B. A., 22, 50, 65, 272 Rude, M. A., 145 Rudner, D. Z., 170 Rukmini, R., 279 Rumbero, A., 226, 227 Rupp, B., 18, 24 Rupprath, C., 472, 524, 530 Rupprath, G., 527, 531 Russell, D. W., 441 Russell, S., 195, 198 Rutter, K., 277 Ruzsicka, B. P., 415 Rydberg, E. H., 464 Ryu, J. S., 262, 266 Ryu, Y. G., 356 S Sacchettini, J. C., 276 Sacco, E., 261, 276 Sahm, H., 262, 263, 276 Sakaki, Y., 193, 225 Sakaue, M., 188
Author Index
Sakazaki, R., 145 Sakuda, S., 145, 227 Salah-Bey, K., 375, 447, 477, 486 Salas, J. A., 11, 34, 246, 387, 524 Samborskyy, M., 192, 193, 197, 198, 199, 201 Sambrook, J., 441, 499 Samel, S. A., 37 Sampson, A. E., 274 Samrat, S. K., 262 Sanchez, C., 55, 101, 107, 175, 179, 182, 387 Sanchez, E. L., 92 Sanchez, J. F., 267 Sanderbrand, S., 358 Sanderson, K., 9 Sankaranarayanan, R., 262, 268, 276, 279, 282 Sankawa, U., 52, 387 Sano, Y., 280 San Roman, A. K., 414 Santi, D. V., 30, 52, 69, 160, 321, 323, 324, 325, 327, 329, 330, 331, 344, 348, 350, 358 Santos-Aberturas, J., 218, 225, 237 Santos-Beneit, F., 227 Saran, S., 262 Sarma, S. P., 434 Sasaki, S., 501 Sassetti, C. M., 262 Satake, M., 5 Sath, S., 468 Sato, H., 274 Sato, K., 227 Sauer, F., 419 Saunton, J., 11 Saurel, O., 262, 264 Savage, D. F., 21, 22 Savagnac, A. M., 277 Savin, A., 170 Savvi, S., 266 Saxena, P., 11, 262, 263, 265, 276, 279, 281, 282, 411, 412, 413 Scapin, G., 488 Schaefer, W. B., 270 Schaeffer, M. L., 263, 276 Schafer, A., 360, 414 Schaffer, A. A., 192 Scha¨gger, H., 475 Scharfe, M., 272 Schatz, A., 460 Scheerer, J. R., 9, 36, 57 Scheffel, F., 485 Scheible, H., 446 Scheiner, O., 34 Schelle, M. W., 262, 272 Schenk, P. M., 358 Scherlach, K., 172 Schiltz, E., 50, 51 Schimana, J., 145 Schirmer, A., 353, 356 Schlo¨rke, O., 479, 480
563 Schlo¨sser, A., 485 Schluenzen, F., 464 Schmid, D. G., 145 Schmid, M., 30, 407 Schmidt, E. W., 54, 65 Schmidt, J., 446 Schmidt-Beibner, H., 460, 464, 466, 468, 473, 476, 495 Schmitz, R. A., 341 Schnarr, N. A., 10, 21, 37, 272 Schneider, E., 485 Schneider, G., 21, 204, 386, 387 Schneider, K., 170, 171 Schobert, M., 360, 414 Scholz, R., 170, 171 Schoner, B. E., 247, 353 Schou, C., 34 Schrempf, H., 245, 249, 373, 472, 485 Schro¨der, W., 482, 486 Schroeder, B. G., 274, 281 Schroeder, F. C., 170 Schuhmann, T., 145 Schulz, H., 403 Schumacher, T., 524, 530 Schu¨mann, J., 50 Schupp, T., 145 Schwab, J. M., 19, 30, 34, 272, 408, 409, 421 Schwarzer, D., 37 Schwecke, T., 23, 24, 124, 218, 222, 234, 237 Schweizer, E., 50, 51, 52, 99, 344, 411, 412 Schweizer, H. P., 410, 420, 423 Schweizer, M., 37 Scott, A. I., 50 Scott, N., 192, 193, 197, 198, 199, 201 Scrutton, N. S., 222 Sebek, O. K., 442 Seco, E. M., 225, 254 Seidel, M., 264 Seki, M., 233 Sekurova, O. N., 224, 236, 246, 247, 248, 255, 258 Sello, J., 280, 281 Senaratne, R. H., 262, 263, 271 Seno, E. T., 247, 353 Seo, M. J., 480 Seo, W. M., 481 Serre, L., 19, 22, 55, 56, 64, 403 Seto, N., 261 Shaflee, A., 145 Shafran, H., 68 Shah, A. N., 36, 379 Shah, S., 345 Shanklin, J., 418, 419 Shanmugam, V. M., 279 Shareck, F., 485 Sharma, J., 263 Sharma, K. K., 222 Sharma, S., 434
564 Sharma, S. K., 434 Shea, J. E., 262 Shelat, A. A., 21, 22 Sheldon, P. J., 381, 382 Shen, B., 3, 6, 9, 11, 12, 21, 34, 55, 79, 84, 92, 95, 97, 98, 99, 100, 101, 107, 156, 165, 166, 167, 168, 171, 172, 175, 179, 182, 183, 296, 368, 372, 380, 387, 388, 414 Shen, M. Y., 209 Shen, Y., 36 Shen, Z., 419, 425 Shepard, E., 99 Shepherd, J., 3 Sherman, A., 68 Sherman, D. H., 21, 27, 31, 37, 39, 136, 170, 222, 272, 321, 327, 341, 345, 381, 413, 540, 541 Sherman, M. M., 195 Sherringham, J. A., 195 Shi, J., 199 Shiba, T., 193, 225 Shibuya, M., 59 Shichijo, Y., 200 Shinose, M., 193, 225 Shinozaki, K., 233 Shiomi, K., 188 Shioyama, S., 264, 276 Shirahata, K., 468 Shirouzu, M., 464 Shoji, J., 145 Shoji, S., 464 Shreve, A. L., 345 Sidebottom, P. J., 272 Sidhu, G., 464 Siegner, A., 50, 51 Sievers, E. L., 98 Siggaard-Andersen, M., 19, 24, 25, 27, 403, 404, 422 Sikorski, M. M., 34 Silakowski, B., 126, 130, 131, 272 Silbert, D. F., 406, 407, 422 Silva, C. J., 350 Simeone, R., 272 Simon, S., 274 Simon, W. J., 398, 419, 425 Simpson, K. E., 277 Simpson, T. J., 9, 21, 22, 27, 28, 34, 36, 37, 45, 47, 48, 50, 51, 53, 54, 56, 60, 61, 63, 65, 66, 67, 72, 171, 177, 274, 380, 379, 380, 382, 403, 414 Sims, J. W., 65 Simunovic, V., 125, 127, 129, 171 Singh, A., 263, 276 Singh, D., 480 Sinnwell, V., 469 Sirakova, T. D., 262, 263, 264, 268, 271, 272, 278, 279, 282 Siskos, A. P., 22, 30, 99 Skellam, E., 54, 66
Author Index
Slabas, A. R., 398, 419, 425 Slayden, R. A., 262, 274, 276 Sletta, H., 220, 224, 236, 244, 246, 247, 248, 254, 255, 256, 258 Small, P. L., 10 Smirnova, N., 415, 422 Smith, C. P., 245, 246, 247, 249, 347, 348, 373, 472 Smith, I., 278 Smith, I. P., 357 Smith, J. L., 19, 21, 27, 30, 31, 34, 37, 39, 272, 407, 409, 413 Smith, L. H., 9, 11, 56, 414 Smith, M. C., 253, 441 Smith, P., 21, 35 Smith, S., 18, 19, 21, 22, 23, 24, 25, 29, 30, 32, 39, 55, 56, 64, 118, 276, 296, 301, 306 Smith, W. C., 172 Smogowicz, A. A., 403 Snow, G. A., 280, 281 Snow, M. E., 405, 411 So, C. Y., 411, 423 Socci, N. D., 173 Sogaard, M., 490 Sohn, M. J., 411 Sohng, J. K., 481, 489, 501, 502, 503, 505, 515, 530 Sola-Landa, A., 227, 237 Soler, L., 245 Soll, C. E., 263, 268, 270 Solsbacher, J., 360, 414 Somers, W., 18 Snder Hansen, B., 254 Song, D., 172, 183 Song, K. I., 438 Song, L., 345 Song, Z., 63, 65, 66, 67, 72 Sood, G. R., 188 Sosio, M., 341 Soto, C. Y., 272 Soulas, F., 414 Souza, C. M., 217 Spangfort, M. D., 34 Spencer, J. B., 11, 30, 50, 63, 191, 197, 198, 199, 200, 201, 204, 205, 206, 209, 381, 382, 489, 495, 502, 504, 505, 506, 510, 511, 514 Spiteller, D., 30, 381, 382, 502, 506, 510 Sprecher, H., 270 Sridharan, V., 263, 268, 269, 270, 276, 282 Stadler, P., 469 Stadthagen, G., 267, 268, 269 Staffa, A., 99, 170, 171 Standage, S., 99 Stapon, A., 448 Stark, C. B., 193, 196, 197, 198, 199, 200 Stark, H., 18, 19, 23, 24, 32, 39 Stasiuk, M., 279 Stassi, D. L., 296, 301, 355
565
Author Index
Staunton, J., 10, 11, 22, 23, 24, 48, 166, 191, 193, 196, 197, 198, 199, 200, 201, 204, 205, 206, 209, 218, 222, 234, 237, 251, 269, 274, 320, 322, 327, 329, 340, 341, 345, 346 Staver, M. J., 10, 191 Steger, D., 13 Stein, A., 530, 531 Steinbiss, H. H., 358 Steinrauf, L. K., 188 Stejskal, F., 172 Stephens, E., 171 Stephenson, G. R., 385 Stewart, A. F., 349, 360 Stewart, F. A., 13 Stinear, T. P., 10 Stirrett, K. L., 263, 268 Stocker, N. G., 260 Stockmann, M., 473 Stokes, R. W., 272 Straight, P. D., 170 Strain, M., 274 Stratigopoulos, G., 237 Stratmann, A., 466, 479, 480, 482, 486 Strecker, G., 260 Streit, W. R., 341 Strittmatter, A. W., 170, 171 Strobel, R. J., 351 Strohl, W. R., 386 Strom, A. R., 246, 247, 254, 255 Stroshane, R., 188 Stroud, R. M., 21, 22, 24, 25, 26, 27, 28, 30, 34, 37, 39, 72, 214, 306, 368, 376 Struyk, A. P., 217 Stubbs, M. T., 37 Studier, W. F., 490 Stuitje, A. R., 19, 22, 55, 398, 403, 419, 425 Su, H., 268 Su, N., 411, 420, 421, 422 Subba, B., 489, 501, 502 Subbarayan, C. R., 50 Sudek, S., 126, 127, 129, 170 Sugamura, K., 227 Sugihara, S., 83 Sugino, F., 171 Suh, J. W., 480, 500, 516 Suling, W. J., 264 Sullivan, J. T., 412 Sullivan, S. A., 420, 423 Sultana, A., 21, 386 Sulzenbacher, G., 270 Summers, R. G., 368, 380, 414 Sun, Y., 11, 191, 192, 193, 201, 202, 203, 205, 206, 209, 210, 230 Sunaga, R., 99 Surolia, A., 11, 260, 267, 268, 269, 279, 434 Surolia, N., 434 Susani, M., 34 Susskind, M. M., 416
Su¨ssmuth, R. D., 12, 170, 171 Sutherland, A., 62, 63 Suwa, M., 171 Suzukake, K., 503 Suzuki, A., 145 Suzuki, H., 356, 357, 366 Svendsen, I., 405 Svenson, K., 18 Svensson, B., 490 Swanson, S., 355 Swanson, S. J., 10, 191 Swindell, A. C., 406 Szaflarski, W., 464 Szafranska, A. E., 22, 37, 177, 380, 400, 414 Szu, P.-H., 538 T Ta, P., 460, 464 Tabor, S., 490 Tachibana, K., 194 Tada, H., 52 Tagami, U., 495, 500 Taguchi, T., 385 Takagi, M., 501 Takahashi, H., 524, 530, 531, 532, 533, 535, 536 Takahashi, K., 167, 468 Takahashi, Y., 188 Takaku, H., 501 Takano, E., 346, 375, 472, 479 Takasawa, S., 468 Takayama, K., 261, 274, 276, 277 Takazawa, Y., 484 Takemoto, C., 464 Takeuchi, T., 188 Takiguchi, T., 167 Tamegai, H., 477, 478, 495, 500, 501, 502 Tammer, M. E., 66 Tan, D. S., 263, 268 Tan, Y. H., 21, 27, 29, 30, 384, 385 Tanaka, H., 216 Tanaka, N., 501 Tang, G. L., 11, 125, 126, 127, 131, 166, 167, 168, 171, 182, 183 Tang, L., 32, 124, 126, 135, 296, 298, 344, 350, 351 Tang, X., 502 Tang, Y., 10, 21, 22, 24, 25, 27, 32, 34, 35, 39, 60, 63, 64, 69, 70, 272, 306, 367, 371, 374, 375, 376, 379, 381, 382, 383, 384, 385, 387, 388 Tanner, J. A., 61 Tatsuno, S., 132, 134 Tauch, A., 412 Taudien, S., 11 Taylor, B. L., 224 Taylor, J. W., 50 Taylor, M. W., 13
566 Taylor, N. L., 271 Teartasin, W., 21, 27, 28 Tekaia, F., 267, 268, 272, 278, 279, 282 ten Napel, H. H., 217 Terwilliger, T., 18 Textor, A., 167, 170, 183 Thamchaipenet, A., 322, 329, 344 Theisen, M., 129 Thibodeaux, C. J., 521, 522, 523, 524, 540 Thirumala, A. K., 271 Thoden, J. B., 541 Thomas, C. M., 171 Thomas, I., 134, 272 Thomas, I. P., 327, 329 Thomas, J., 395, 400 Thomas, M. G., 143, 144, 145, 156, 160, 167, 490, 533 Thomas, P. M., 9, 36, 57 Thomas, R., 36 Thompson, C., 246 Thompson, C. J., 375, 472, 474, 479 Thompson, J. D., 174, 177 Thompson, T. B., 21, 386 Thomson, N. R., 193, 345, 346 Thornton, J. M., 19 Thorpe, H. M., 441 Thorson, J. S., 3, 98, 99, 101, 381, 451, 522, 523, 524 Tickoo, R., 263, 268, 269, 270, 276, 282 Timmerman, P., 260 Timoney, M., 327, 329 Tobert, J. A., 62 Toelzer, S., 144, 145 Tokiwa, Y., 99 Tokiwano, T., 200 Tokunaga, K., 503 Toney, M. D., 55, 92, 101, 107, 175, 179, 182 Tonge, P. J., 415 Torrelles, J., 277 Toubiana, R., 274 Towne, T. B., 191 Townsend, C. A., 9, 36, 54, 56, 57, 60, 61, 67, 188, 191, 195, 197 Trail, F., 54, 72 Tran, C. Q., 324, 325, 335 Tremblay, S., 11 Trinh, K. Q., 144 Trivedi, O. A., 263, 268, 269, 270, 276, 282 Truman, A. W., 504, 505 Tsai, H. F., 60 Tsai, S. C., 17, 19, 21, 22, 24, 25, 26, 27, 28, 29, 30, 35, 37, 39, 118, 206, 214, 296, 301, 306, 374, 379, 381, 384, 385 Tsan, P., 254, 255, 256 Tsay, J. T., 401, 403 Tsenova, L., 268 Tsui, G., 58 Tsuji, S. Y., 39, 152, 323, 327, 329
Author Index
Tsujishita, Y., 34 Tu, G., 11, 191, 192, 193, 201, 202 Tull, D., 264, 276 Tunca, S., 224, 227, 237 Turgeon, B. G., 50 Turnowsky, F., 406, 407, 411 Tyman, J. H., 275 U Udwary, D. W., 36, 54, 282, 345 Uehara, Y., 503 Ui, H., 188 Uitdehaag, J. C. M., 482, 484 Ulrich, A. K., 405 Ulrichs, T., 272 Umezawa, H., 503 Unkefer, C. J., 145 Utsumi, Y., 280 Uttaro, A. D., 81 V Vagelos, P. R., 22, 398, 400, 403, 404, 405, 407, 421, 422, 423 Vagstad, A. L., 9, 36, 56, 57, 60, 61 Valentine, R., 9, 81, 83, 99, 413 Valenzano, C., 32, 202, 203, 205, 206, 209 Valero-Guillen, P., 273 Valla, S., 246, 247, 248, 254, 255 Van der Heever, J. P., 63 van der Linden, K. H., 403 van der Veen, B. A., 482, 484 van der Werf, M. J., 199 van Eek, T., 217 van Halbeek, H., 277 Van Lanen, S. G., 3, 9, 84, 95, 97, 98, 99, 100, 156, 296 van Wettstein-Knowles, P., 404 Vater, J., 145, 170, 171 Vats, A., 264, 268 Vedadi, M., 30, 406 Vederas, J. C., 62, 63, 195 Veitch, J. A., 98 Vente, A., 341 Verbree, E. C., 19, 22, 55, 403 Verseck, S., 472, 530 Verwoert, I. I., 403 Vetcher, L., 307, 308 Vial, H. J., 188 Viard, M., 170 Viell, P., 486 Vilcheze, C., 272 Villanueva, J. R., 228, 229, 230 Vinci, V. A., 351 Vining, L. C., 230, 387 Viswanathan, N., 30, 170 Vivien, E., 170 Vogel, C., 398, 423
567
Author Index
Volchegursky, Y., 344, 348, 349, 353, 356, 364 Volff, J. N., 486 Volk, K. J., 98 Volker, C., 276 Vollmar, D., 145 von Jagow, G., 475 von Mulert, U., 350 von Wettstein-Knowles, P., 19, 24, 25, 27, 403, 404, 422 Vos, C. J., 268, 270 Vosburg, D. A., 37 Vrijbloed, J. W., 346 Vroom, J. A., 251, 253 Vu, T. N., 21, 27, 28, 35 W Waddell, S. J., 262, 279, 282 Waggoner, L. E., 170 Wagner, B., 37 Wagner, G., 37 Wagner, M., 13 Wahl, H. P., 472 Waisvisz, J. M., 217 Wakil, S. J., 19, 37, 406, 419 Wakisaka, N., 501 Wakisaka, Y., 145 Waksman, S., 460 Walczak, R. J., 386 Waldrop, G. L., 399 Walker, J. B., 466, 472, 473, 501, 502 Walker, M. S., 501, 502 Walker, S., 389 Wallace, K. K., 403, 415 Wallis, J. G., 9, 80, 81, 93, 413 Wallis, N. G., 411, 423 Wallner, P., 407, 411 Walsh, C. T., 10, 37, 52, 147, 151, 152, 161, 170, 175, 179, 182, 279, 281, 296, 317, 340, 343, 359, 373, 389, 398, 399, 414, 425, 448, 450, 451, 522, 533 Walton, L. J., 145 Wang, B., 11, 191, 192, 201 Wang, C., 261, 274, 276, 277 Wang, C. C., 60, 263, 327, 330, 359, 371, 375, 385, 387 Wang, H., 406, 410 Wang, J., 18, 24 Wang, J. S., 21, 386 Wang, M., 11, 191, 192, 201 Wang, R., 398, 423 Wang, S. C., 503 Wang, X. W., 98 Wang, Y., 12, 386, 464 Wang, Z., 172, 183 Ward, J. M., 245, 249, 373, 472 Ward, S., 356 Ward, S. L., 119, 128, 313, 353, 356, 357, 366
Warner, D. D., 65 Warner, D. F., 266 Warude, D., 81 Washington, J. A., 3 Watanabe, A., 58, 59 Watanabe, C. M. H., 54, 67 Watanabe, K., 21, 60, 70, 81, 83, 95, 200, 327, 330, 359, 371, 375, 384, 385, 386, 387, 388 Watanabe, M., 200 Watanabe, T., 280 Wateman, C. L., 381 Watts, J. L., 9, 80, 81, 93, 413 Weaver, C. A., 85 Webb, B. M., 209 Webb, J. S., 217 Weber, J. M., 347, 356 Weber, T., 37, 167, 170, 183, 341 Webster, R. W., Jr., 160 Weeks, G., 406 Weeks, R. E., 188 Wehmeier, U. F., 375, 447, 459, 460, 464, 466, 468, 473, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 495 Weingarten, P., 375, 447, 472, 477, 486, 530 Weinreb, P. H., 147, 152, 280, 281, 414 Weinstein, D., 418 Weiser, J., 197, 475 Weisshaar, B., 412 Weissman, K. J., 3, 10, 11, 12, 21, 48, 99, 116, 117, 118, 166, 191, 192, 193, 201, 210, 296, 306, 314, 320, 340 Weist, S., 12 Welby, M., 277 Welch, M., 321, 322, 324, 325, 331, 348, 350, 358 Wellein, C., 99 Welscher, Y. M., 217 Welzel, K., 167, 170, 183, 341 Wemakor, E., 449 Wen, G., 171, 172 Wendt-Pienkowski, E., 99, 101, 172, 183 Wenzel, S. C., 6, 12, 145, 167, 170, 183, 272, 349, 360 Werbitzky, O., 474 Wessel, W. A., 368, 380, 414 Wessjohann, L., 448 Wessjohann, L. A., 446 West, J., 411, 423 Westcott, J., 51, 61, 278, 382, 414 Westley, J. W., 188, 195, 214 Westrich, L., 453 Weymouth-Wilson, A. C., 522 Wheatcroft, M. P., 11, 346 Wheeler, M. H., 57 White, J., 375, 472, 479 White, J. A., 530, 532, 534 White, R., 233
568
Author Index
White, S. W., 19, 24, 25, 27, 29, 403, 405, 406, 407, 410 White-Phillip, J. A., 521, 531, 532, 533, 550 Whitfield, C., 397 Whiting, A., 350 Whitwam, R. E., 99 Whitworth, K. P., 60, 61 Wiesmann, K. E., 196, 320, 341 Wiesner, J., 358 Wietzerbin, J., 260 Wilkinson, B., 6, 11, 22, 65, 272, 327, 329 Wilkinson, C., 193 Wilkinson, C. J., 130, 269, 346 Willett, N. J., 53 Williams, C., 21, 209 Williams, G. J., 451 Williams, J. S., 381 Williams, K., 72 Williams, M. G., 30 Williams, R. P., 217 Williams, S. J., 263 Williamson, R. M., 145 Willis, C. L., 65 Wilson, D. N., 464 Wilson, S. E., 253, 441 Wilson, W. R., 3 Wimberly, B. T., 464 Wimmer, R., 34 Winfield, C., 51, 61, 382 Winsor, C., 21, 36, 37 Winston, R. L., 57 Wirtz, G., 346 Wissenbach, M., 405 Withers, S. G., 464, 482, 484 Witkowska, H. E., 19, 21, 25, 32, 56, 64 Witkowski, A., 18, 19, 21, 23, 24, 25, 32, 39, 55, 64, 123, 276 Witter, D. J., 63 Wohlleben, W., 341, 450 Wolpert, M., 441, 442 Wong, J., 21, 27, 29, 30, 384, 385 Woo, E., 344 Woo, J. S., 501 Worthen, D. R., 254 Worthington, A. S., 380, 414 Wright, G., 522 Wrigley, S. K., 350 Wu, B., 37 Wu, H., 229, 234, 235 Wu, J., 32, 130, 132, 206 Wu, K., 124, 144, 145, 356 Wu, N., 330 Wu, X., 478, 479, 480 Wybenga, G., 209 X Xia, H., 506 Xia, Z. J., 308
Xiang, L., 34, 345, 381, 388, 389 Xiang, Y., 501 Xie, H., 98 Xie, X., 60, 70, 384 Xie, Z., 260 Xu, H., 203, 415, 450, 480 Xu, J., 144, 145 Xue, Q., 145, 296, 309, 311, 348, 350, 356 Xue, Y., 135 Xx, X., 18, 19 Y Yadav, G., 11, 23, 262, 263, 271, 272, 273, 277, 280, 281, 282 Yakasai, A. A., 63, 65, 66, 72 Yamada, A., 9, 81, 83, 99, 413 Yamada, H., 188 Yamada, K., 171 Yamada, Y., 227 Yamamoto, Y., 477, 478, 501, 502, 503, 504, 505, 509 Yamane, K., 482, 484 Yamase, H., 523, 534, 535, 538, 539 Yamashita, J. T., 273 Yamauchi, N., 500, 501 Yanagimoto, M., 227 Yang, C. F., 99 Yang, K. Q., 387 Yang, M., 170 Yang, X., 170, 171 Yang, Y., 383 Yano, I., 266 Yao, X., 398, 423 Yasumoto, T., 5 Yasuoka, Y., 60 Yatome, C., 400 Yazawa, K., 9, 81, 83, 99, 413 Yeung, S. M., 538 Yip, C. L., 345, 350, 353 Ylihonko, K., 386 Yocum, R. R., 412 Yoder, O. C., 50 Yokoyama, K., 477, 478, 501, 502, 503, 504, 505, 509 Yokoyama, S., 464 Yoo, J. C., 438 Yoon, Y. J., 32, 503, 505, 515 Yoshida, M., 167 You, D., 202, 203, 205, 206, 209 Young, D., 263 Young, D. C., 272 Yu, J., 53, 502 Yu, Q., 202, 203, 205, 206, 209 Yu, T. W., 36, 124, 144, 145, 236, 345, 346, 356, 413, 488 Yu, W.-L., 531, 532, 533, 540, 541, 550 Yu, Y., 203, 480, 506 Yu, Y. J., 410
569
Author Index
Yuan, Y., 274 Yukita, T., 511 Yuqing, T., 443, 444 Z Zaleski, T. J., 32 Zapp, J., 171 Zawada, B. I., 32, 34 Zawada, R. J., 372, 385 Zawodny, J., 145 Zazopoulos, E., 11, 99, 170, 171 Zeeb, M., 18, 23, 24, 32 Zeeck, A., 145, 453, 479, 480 Zeidner, D., 355 Zerbe-Burkhardt, K., 346 Zha, W., 276 Zhan, J., 60, 70, 384, 387, 388 Zhang, C., 451, 523 Zhang, E., 407, 411 Zhang, G., 193, 201, 202 Zhang, H., 531, 532, 533, 536, 550 Zhang, H. R., 12 Zhang, J., 99, 100, 192 Zhang, L., 170 Zhang, Q., 278 Zhang, W., 21, 34, 35, 60, 367, 371, 374, 375, 381, 384, 385, 387, 388 Zhang, Y., 13, 65, 203, 349, 360, 405, 412, 480 Zhang, Y. M., 19, 25, 29, 37, 404, 405, 406, 407, 410 Zhang, Z., 192
Zhao, B., 403, 415 Zhao, C., 156, 172, 183 Zhao, G., 399, 400 Zhao, H., 280 Zhao, L., 523, 534, 535, 538, 539, 540, 541 Zhao, Z., 523, 533, 534, 535, 536, 538, 539 Zheng, C. J., 411 Zheng, J., 19, 25, 37, 402, 404, 405 Zhou, H., 70 Zhou, X., 11, 172, 183, 191, 192, 193, 201, 202, 203, 204, 205, 206, 209, 229, 233, 234, 235, 237, 480 Zhou, Y., 229, 234, 235 Zhu, D., 172, 183 Zhu, G., 172 Zhu, J., 229, 234, 235 Zhu, K., 410, 412 Zhulin, I. B., 224 Zielinski, J., 229 Ziermann, R., 310, 345, 347, 348, 375 Ziminski, T., 229 Zirkle, R., 9, 84, 85, 95, 99, 145 Zlatopolskiy, B. D., 453 Zotchev, S. B., 216, 217, 220, 223, 224, 235, 236, 243, 244, 245, 246, 247, 248, 254, 255, 256, 258 Zou, J., 199 Zuber, B., 260 Zuber, P., 52, 147, 151, 152, 175, 179, 182, 373, 399 Zurita, J., 268, 270
Subject Index
A AA, see Arachidonic acid Acarbose biosynthetic gene cluster, 463 structure, 461 synthesis, 465, 478–486 transporters, 485–486 Acarviosyl transferase, cyclitol-containing aminoglycoside synthesis, 482–484 N-Acetylcysteamine thioesters substrate preparation, 205–206, 208 thioesterase assays, 206–208 2000 -N-Acetyl-6000 -deamino6000 hydroxyneomycin C deacetylase, neomycin synthesis, 509 20 -N-Acetylparomamine deacetylase, cyclitolcontaining aminoglycoside synthesis, 505 20 -N-Acetylparomamine synthase, cyclitolcontaining aminoglycoside synthesis, 504 ACP, see Acyl carrier protein Actinorhodin, structure, 369 Acyl carrier protein acyltransferase-less type I polyketide synthase acyltransferase-catalyzed loading assay of acyl CoA extender substrate to holoprotein, 179–182 holoprotein preparation, 175–177 mass spectrometry characterization, 177–178 overexpression of recombinant apoprotein, 174–175 extender unit linkage, see Polyketide synthase extender units fatty acid synthesis in bacteria functions, 397–400 gel electrophoresis of species, 423–425 gel filtration of species, 425 preparation from Escherichia coli acyl substrate synthesis, 418–420 apoprotein, 418 holoprotein, 416–418 overview, 415–416 strains and plasmids, 416 iterative type I polyketide synthase apoprotein overexpression and purification, 107–108 holoprotein preparation in vitro, 108–109 multiple domains, 130–131
phosphopantetheinyl transferase activation, 118 polyketide synthase/fatty acid synthase structure, 36–37 tandem acyl carrier protein domains in polyunsaturated fatty acid synthases acyl carrier protein overexpression, 89–91 holoprotein preparation, 92–93 number of active acyl carrier proteins and fatty acid production, 93–94 phosphopantetheinyl transferase overexpression, 91–92 plasmid construction, 88–89 recombinant Shewanella japonica enzyme expression in Escherichia coli, 85–86 site-directed mutagenesis and active site mapping, 86–88 type II polyketide synthase assays ketosynthase–acyl carrier protein interaction assay, 380–381 malonyl-CoA:acyl carrier protein transacylation assay, 380 expression and modification for studies, 372–373 Acyltransferase domain, polyketide synthase discrete acyltransferase loading assay of acyl CoA extender substrate to holo-acyl carrier protein, 179–182 overexpression of recombinant enzyme, 177 substrate specificity assay, 177, 179 ketide unit structure determination by domains, 298–299 multiple domains, 130 phylogenetic analysis of cognate and discrete acyltransferases, 167, 173 replacement engineering a-carbon substitution alterations, 300–301 chromosomal insertion, 301–305 specificity extension modules, 122 loading modules AMP-ligase loading domain, 124–125 GNAT domain, 125 KSQ domain, 123–124 leinamycin loading module, 125–126 overview, 123 structure, 22–24
571
572 Acyltransferase-less type I polyketide synthases acyl carrier proteins acyltransferase-catalyzed loading assay of acyl CoA extender substrate to holoprotein, 179–180 holoprotein preparation, 175–177 mass spectrometry characterization, 177–178 overexpression of recombinant apoprotein, 174–175 discovery, 166–167 discrete acyltransferase overexpression of recombinant enzyme, 177 substrate specificity assay, 177, 179 modules, 166 phylogenetic analysis of cognate and discrete acyltransferases, 167, 173 products, 167, 169–172 prospects for study, 182–183 trans-polyketide synthase activities, 127 Albicidin structure, 169 synthesis, 170 Ambruticin VS3, structure, 122 Aminocoumarin antibiotics, see also specific drugs biosynthetic gene clusters deletions in integrative cosmids, 442–444 heterologous expression, 441–442 chemoenzymatic synthesis clorobiocin analogs, 449–451 substrate generation, 447–449 clorbiocin biosynthesis, 440 metabolic engineering, 451–453 mutasynthesis amide synthetase assays for suitable ring A analog identification, 446–447 genes for expanding product range, 447 generation of new antibiotics, 444–446 structures, 438–439 Aminoglycosides, see Cyclitol-containing aminoglycosides p-Aminobenzoic acid, biosynthesis, 230, 233, 238 AMP-ligase loading domain, polyketide synthase, 124–125 Amphotericin B antifungal activity, 244 biosynthesis gene clusters, 244–246 overview, 10 structure, 4, 244 Apramycin structure, 461 synthesis, 465 Arachidonic acid, synthesis, 80 L-Arginine:scyllo-inosamine-phosphate amidinotransferase, cyclitol-containing aminoglycoside synthesis, 473
Subject Index
Aromatase/cyclases, polyketide synthases classes, 32–34 polyketide synthase structure, 34–36 type II polyketide synthase assay, 384–386 Avermectins, structures, 121 B Bacillaene structure, 121, 169 synthesis, 170 Bacterial fatty acids, see also Cell wall, Mycobacteria tuberculosis acyl carrier protein functions, 397–400 gel electrophoresis of species, 423–425 gel filtration of species, 425 preparation from Escherichia coli acyl substrate synthesis, 418–420 apoprotein, 418 holoprotein, 416–418 overview, 415–416 strains and plasmids, 416 biosynthesis assays, 420–422 branched-chain fatty acids, 410 enoyl-acyl carrier protein reductase, 407, 410–411 enzyme purification, 420 3-hydroxyacyl-acyl carrier protein dehydratase, 407 3-ketoacyl-acyl carrier protein reductase, 406 3-ketoacyl-acyl carrier protein synthase, 404–406 overview, 400–402 type I megasynthase fatty acid synthesis, 411–412 overview, 396–397 polyketide synthesis relationship, 412–415 polyunsaturated fatty acid synthesis anaerobic synthesis, 410 gene clusters, 83–84 3-hydroxydecanoyl-acyl carrier protein dehydratase, 407–409 industrial synthesis, 93, 95 overview, 80–81, 400 pathways, 81–83 tandem acyl carrier protein domains in polyunsaturated fatty acid synthases acyl carrier protein overexpression, 89–91 holoprotein preparation, 92–93 number of active acyl carrier proteins and fatty acid production, 93–94 phosphopantetheinyl transferase overexpression, 91–92 plasmid construction, 88–89
573
Subject Index
recombinant Shewanella japonica enzyme expression in Escherichia coli, 85–86 site-directed mutagenesis and active site mapping, 86–88 reconstitution of synthesis systems, 422–423 Bikaverin nonaketide synthase, see Fungal type I polyketide synthases Borrelidin, structure, 122 Broken modules, polyketide synthase, 131–133 Bryostatin structure, 121, 169 synthesis, 170 Butirosin biosynthetic gene cluster, 462, 495–497 structure, 461 synthesis 20 -N-acetylparomamine deacetylase, 505 20 -N-acetylparomamine synthase, 504 60 -dehydro-60 -oxoparomamine aminotransferase, 506–507 2-deoxy-scyllo-inosose synthase, 500–501 g-L-glutamyl-acyl carrier protein decarboxylase, 512–513 g-L-glutamyl-acyl carrier protein ligase, 511–512 g-L-glutamyl-4-aminobutyryl acyl carrier protein monooxygenase, 513 g-L-glutamyl-4-amino-2-hydroxybutyryl acyl carrier protein:ribostamycin g-Lglutamyl-4-amino-2hydroxybutyryltransferase, 514 g-L-glutamyl-butirosin B g-L-glutamyl cyclotransferase, 514–515 L-glutamine:deoxy-scyllo-inosose aminotransferase ‘radical S-adenosylmethionine dehydrogenase, 503–504 NAD-dependent dehydrogenase, 503 overview, 501–502 overview, 465, 495.498 paromamine 60 -dehydrogenase, 505–506 phosphoribostamycin phosphatase, 508 phosphoribostamycin synthase, 507–508 C C-1027 anticancer activity, 98 structure, 98 CAGs, see Cyclitol-containing aminoglycosides Calcicheamicin anticancer activity, 98 structure, 98 Candidicin applications, 228–229 biosynthesis p-aminobenzoic acid biosynthesis, 230, 233 gene cluster, 229–232
monooxygenase genes, 234–235 mycosamine biosynthesis, 236 phosphate repression, 237 polyketide synthases, 233–234 prospects for study, 237–238 regulatory genes, 236–237 transporter genes, 235 structure, 216–217, 228 Carboxymycobactin siderophore synthesis, 280–281 structure, 280 Cell wall, Mycobacteria tuberculosis composition, 260–259 functions, 260 high-performance liquid chromatography of polyketide synthase-derived saturated fatty acids, 282–284 iron-chelating siderophore synthesis, 280–281 lipid biosynthesis acetate/propionate feeding studies, 265–266 assay of PKS5 and PKS6, 281–282 dimycocerosate ester synthesis, 267–270 enzyme characterization techniques, 263–264 pathway evaluation techniques, 262 PKS2 and sulfolipid synthesis, 270–272 PKS3/4 and phthenoic acid synthesis, 277–278 PKS10-PKS11 cluster, 278–279 PKS12 and mannosyl-b–1phosphomycoketide synthesis, 272–273 PKS13 and mycolic acid synthesis, 273–276 PKS18 and long-chain pyrone synthesis, 279 polyketide synthases identification with genome sequencing, 266 types and domain organizations, 267 Chalcomycin, synthesis, 120, 127 Chemobiosynthesis polyketide synthase engineering, 311, 313 thymidine diphosphate deoxysugars, see Thymidine diphosphate deoxysugars Chivoavol A structure, 169 synthesis, 170 Cholesterol oxidase, pimaricin synthesis regulation, 225 Clorbiocin, see also Aminocoumarin antibiotics biosynthetic gene clusters deletions in integrative cosmids, 442–444 heterologous expression, 441–442 chemoenzymatic synthesis of analogs, 449–451 structure, 439 synthesis, 440 Coumermycin A1, see also Aminocoumarin antibiotics biosynthetic gene clusters deletions in integrative cosmids, 442–444
574
Subject Index
Coumermycin A1, see also Aminocoumarin antibiotics (cont.) heterologous expression, 441–442 structure, 439 Curacin A structure, 121 synthesis, 130 Cyclitol-containing aminoglycosides, see also specific drugs biosynthesis butirosin, see Butirosin acarbose, 478–486 acarviosyl transferase, 482–484 L-arginine:scyllo-inosamine-phosphate amidinotransferase, 473 classes of products, 467–469 dTDP-D-glucose 4,6-dehydratase, 471 dTDP-4–6-glucose 3,5-epimerase, 471 dTDP-D-glucose synthase, 470 dTDP-L-rhamnose synthase, 471–472 expression of recombinant enzymes, 499–500 gene clusters, 462–464 L-glutamine:scyllo-inositol transaminase, 472–473 glycosyltransferases, 476–477 inositol-2-dehydrogenase, 475–476 KanM1, KanM2, and KanN, 477–478 neomycin, see Neomycin pathways, 464–467 prospects for study, 515–516 starch-degrading enzymes, 484–485 streptomycin-phosphate phosphatase, 473–474 structures, 461 therapeutic targets, 460, 464, 494–495 Cyclohexanecarboxylate, synthesis, 124–125 D Daunorubicin, structure, 369 6000 -Deamino-6000 -dehydro-6000 -oxoneomycin, neomycin synthesis, 510 6000 -Deamino-6000 -hydroxyneomycin C dehydrogenase, neomycin synthesis, 509–510 DEBS, see Deoxyerythronolide B synthase Dehydratase domain, polyketide synthase engineering for b-carbon processing alteration, 305–307 ketide unit structure determination by domains, 298–299 structure, 30–32 trans-polyketide synthase activities, 128 60 -Dehydro-60 -oxoparomamine aminotransferase, cyclitol-containing aminoglycoside synthesis, 506–507 Deoxyerythronolide B synthase
docking domains, 117 engineering, 296 modules, 114, 116–118 structure acyl carrier protein, 36–37 acyltransferase domain, 22–24 dehydratase domain, 30–32 examples, 21 fatty acid synthase homology, 18 ketoreductase domains, 27–30 ketosynthase domain, 24–27 nuclear magnetic resonance overview, 18, 21 paradigm generalization, 118–119, 136 prospects for study, 39 thioesterase, 37–39 X-ray crystallography overview, 18–19, 21 2-Deoxy-scyllo-inosose synthase, cyclitol-containing aminoglycoside synthesis, 500–501 Deoxythymidine diphosphate, see d TDP enzymes; Thymidine diphosphate sugars DHA, see Docosahexaenoic acid Difficidin structure, 169 synthesis, 170 Dimycocerosate esters, synthesis, 267–270 Disorazole structure, 122, 169 synthesis, 132, 170 Docosahexaenoic acid, synthesis, 80–83 Docosapentaenoic acid, synthesis, 80, 82–83 Doxorubicin, structure, 4–5 DPA, see Docosapentaenoic acid dTDP-D-glucose 4,6-dehydratase, cyclitolcontaining aminoglycoside synthesis, 471 dTDP-4–6-glucose 3,5-epimerase, cyclitolcontaining aminoglycoside synthesis, 471 dTDP-D-glucose synthase, cyclitol-containing aminoglycoside synthesis, 470 dTDP-L-rhamnose synthase, cyclitol-containing aminoglycoside synthesis, 471–472 E Eicosapentaenoic acid, synthesis, 80, 82–83 Enediyne synthesis, see Iterative type I polyketide synthase Enoyl-acyl carrier protein reductase diversity in bacteria, 410–411 fatty acid production in bacteria, 406–407 Enoyl reductase domain, polyketide synthase engineering for b-carbon processing alteration, 305–307 ketide unit structure determination by domains, 298–299 EPA, see Eicosapentaenoic acid Epo polyketide synthase, intermodular interactions, 135
575
Subject Index
Epothilone polyketide synthase assembly line, 296–297 engineering, 298 epothilone structures, 121 intermodular interactions, 135 stuttering modules, 132 Epoxidase, polyether biosynthesis, 198–199 Epoxide hydrolase, polyether biosynthesis, 199–201 Erythromycin A biosynthesis, 10, 115 structure, 4, 115 Etnangien structure, 122, 169 synthesis, 170 Extender units, see Polyketide synthase extender units F FAS, see Fatty acid synthase Fatty acids, see Bacterial fatty acids; Cell wall, Mycobacteria tuberculosis; Fatty acid synthase Fatty acid synthase classification, 19 domain organization, 19–21 electron microscopy, 18 fatty acid biosynthesis, 6 polyunsaturated fatty acid synthesis gene clusters, 83–84 industrial synthesis, 93, 95 overview, 80–81 pathways, 81–83 tandem acyl carrier protein domains in polyunsaturated fatty acid synthases acyl carrier protein overexpression, 89–91 holoprotein preparation, 92–93 number of active acyl carrier proteins and fatty acid production, 93–94 phosphopantetheinyl transferase overexpression, 91–92 plasmid construction, 88–89 recombinant Shewanella japonica enzyme expression in Escherichia coli, 85–86 site-directed mutagenesis and active site mapping, 86–88 structure acyl carrier protein, 36–37 acyltransferase domain, 22–24 dehydratase domain, 30–32 examples, 21 ketoreductase domains, 27–30 ketosynthase domain, 24–27 nuclear magnetic resonance overview, 18, 21 polyketide synthase homology, 18
prospects for study, 39 X-ray crystallography overview, 18–19, 21 FK228 structure, 169 synthesis, 170 Fortimicin A biosynthetic gene cluster, 463 structure, 461 synthesis, 465 FR-008, see Candidicin Frenolicin, structure, 369 Fungal type I polyketide synthases bikaverin nonaketide synthase expression and purification, 62–63 substrate specificity, 63 domains, 54 fusarin synthetase, 67–68 genome sequencing, 52 lovastatin synthesis Diels-Alder cyclization, 65 expression vectors, 65–66 polyketide synthases, 64 structure of synthases, 66 6-methyl salicylic acid domain architecture, 53–54 purification, 52–53 recombinant protein expression, 54–55 norsolorinic acid synthase aflatoxin synthesis role, 55 domain studies, 57–59 purification, 56 polymerase chain reaction primers, 51–52 products classes, 50 features, 49 structures, 48 structural overview, 49–50 tenellin synthetase, 68–70 tetrahydroxynaphthalene synthase cell-free extract, 60–61 domains, 61–62 expression, 60 functions, 59–60 zearalenone synthesis, 70–72 Fusarin synthetase, see Fungal type I polyketide synthases G Gel filtration, see Size-exclusion chromatography Geldanamycin, structure, 121 Gentamicin C1 biosynthetic gene cluster, 462 structure, 461 L-Glutamine:deoxy-scyllo-inosose aminotransferase, cyclitol-containing aminoglycoside synthesis NAD-dependent dehydrogenase, 503
576
Subject Index
L-Glutamine:deoxy-scyllo-inosose
aminotransferase, cyclitol-containing aminoglycoside synthesis (cont.) overview, 501–502 radical S-adenosylmethionine dehydrogenase, 503–504 L-Glutamine:scyllo-inositol transaminase, cyclitol-containing aminoglycoside synthesis, 472–473 g-L-Glutamyl-acyl carrier protein decarboxylase, butirosin synthesis, 512–513 g-L-Glutamyl-acyl carrier protein ligase, butirosin synthesis, 511–512 g-L-Glutamyl-4-aminobutyryl acyl carrier protein monooxygenase, butirosin synthesis, 513 g-L-Glutamyl-4-amino-2-hydroxybutyryl acyl carrier protein:ribostamycin g-L-glutamyl4-amino-2-hydroxybutyryltransferase, butirosin synthesis, 514 g-L-Glutamyl-butirosin B g-L-glutamyl cyclotransferase, butirosin synthesis, 514–515 Glycosyltransferase cyclitol-containing aminoglycoside synthesis, 476–477 type II polyketide synthase assay, 389 GNAT domain, polyketide synthase, 125 H HCS cassette, b-carbon methylation, 128–130 High-performance liquid chromatography modified acyl carrier protein characterization, 152–154 mycobacterial saturated fatty acids, 282–284 nystatin analogs, 254–256 type II polyketide synthase assay, 379 HMG-CoA synthase, see HCS cassette HPLC, see High-performance liquid chromatography 3-Hydroxyacyl-acyl carrier protein dehydratase assay, 421 fatty acid production in bacteria, 407 3-Hydroxydecanoyl-acyl carrier protein dehydratase, fatty acid production in bacteria, 407–409 Hygromycin B biosynthetic gene cluster, 463 structure, 461 synthesis, 465 I Inositol-2-dehydrogenase, cyclitol-containing aminoglycoside synthesis, 475–476 Iterative type I polyketide synthase acyl carrier protein preparation
apoprotein overexpression and purification, 107–108 holoprotein preparation in vitro, 108–109 domain organization, 99–101 heterologous expression in Escherichia coli expression construct generation, 103–104 histidine-tagged protein overproduction and purification, 104–105 overview, 98–99 polyene intermediate production and isolation coexpression of pksE and pksE10, 106 isolation of polyene product, 106–107 pksE10 expression construct, 105–106 polymerase chain reaction of PKSE cassettes for predictive classification of new enediynes amplification product generation, 102 primers, 101–103 sequencing and phylogenetic analysis, 103 J Jadomycin B, structure, 369 Jamaicamide structure, 121 synthesis, 130 K Kanamycin B biosynthetic gene cluster, 462 structure, 461 synthesis, 465, 477–478 3-Ketoacyl-acyl carrier protein reductase, fatty acid production in bacteria, 406 3-Ketoacyl-acyl carrier protein synthase assay, 421 fatty acid production in bacteria, 404–406 Ketoreductase domain, polyketide synthase engineering for b-carbon processing alteration, 305–307 ketide unit structure determination by domains, 298–299 structure, 27–30 trans-polyketide synthase b-ketoreductase activities, 127–128 type II polyketide synthase assay, 384–386 Ketosynthase acyl carrier protein interaction assay, 380–381 polyketide synthase structure, 24–27 Kirromycin structure, 169 synthesis, 170 KSQ domain, polyketide synthase, 123–124 L Lactimidomycin structure, 169 synthesis, 171
577
Subject Index
Lankacidin C structure, 169 synthesis, 171 Lankacidin polyketide synthase, stuttering modules, 132 Lasalocid A, structure, 189 Leinamycin loading module in polyketide synthase, 125–126 structure, 121 synthesis, 166–168 Lovastatin structure, 4 synthesis Diels-Alder cyclization, 65 expression vectors, 65–66 polyketide synthases, 64 structure of synthases, 66 Lsd19, polyether biosynthesis, 199–201 M Macrolactin structure, 169 synthesis, 171 Maitotoxin, structure, 4–5 Malonyl-Co:acyl carrier protein transacylase, assay, 380, 421 Mannosyl-b–1-phosphomycoketide, synthesis in mycobacteria, 272–273 MAS, dimycocerosate ester synthesis, 267–270 Mass spectrometry acyl carrier proteins characterization, 147–157 polyketide synthase extender units, 158–160 nystatin analogs, 253–254 type II polyketide synthase assay, 379, 381 MAT, see Malonyl-Co:acyl carrier protein transacylase MbtC, siderophore synthesis, 280–281 MbtD, siderophore synthesis, 280–281 Methylation domains, polyketide synthase C-methylation, 126–127 O-methylation, 126 6-Methyl salicylic acid structure, 4 synthase, see Fungal type I polyketide synthases Methyltransferase, type II polyketide synthase assay, 386–387 Mithramycin, structure, 369 MonBI/BII, polyether biosynthesis, 199–201 MonCI, polyether biosynthesis, 198–199 Monensin A biosynthetic gene clusters, 192–194 premonensin intermediate, 195–198 structure, 4, 189 synthesis, 190 Monooxygenase, candidicin synthesis, 234–235
MS, see Mass spectrometry Mupirocin structure, 122, 169 synthesis, 171 Mutasynthesis aminocoumarin antibiotics amide synthetase assays for suitable ring A analog identification, 446–447 genes for expanding product range, 447 generation of new antibiotics, 444–446 polyketide synthase engineering, 313–314 Mycobactin siderophore synthesis, 280–281 structure, 280 Mycolic acid, synthesis in mycobacteria, 273–276 Mycosamine, biosynthesis, 236 Mycothiol, structure, 461 Myxalamid B, structure, 122 Myxothiazole A, structure, 121 Myxovirescen structure, 121, 169 synthesis, 171 N Nanchangmycin biosynthetic genes clusters, 192–193 transcriptional analysis, 209 structure, 189 NanE N-acetylcysteamine thioester substrate preparation, 205–206, 208 assay, 206–208 expression in Escherichia coli, 204 histidine tag removal, 205 polyether biosynthesis overview, 201–204 purification of histidine-tagged protein, 204–205 site-directed mutagenesis, 209 NanI, polyether biosynthesis, 199–201 NanO, polyether biosynthesis, 198–199 Narbomycin, synthesis, 120 Neocarzinostatin, structure, 4 Neomycin biosynthetic gene cluster, 495–497 structure, 461 synthesis 2000 -N-acetyl-6000 -deamino6000 hydroxyneomycin C deacetylase, 509 20 -N-acetylparomamine deacetylase, 505 20 -N-acetylparomamine synthase, 504 6000 -deamino-6000 -dehydro-6000 oxoneomycin, 510 6000 -deamino-6000 -hydroxyneomycin C dehydrogenase, 509–510
578 Neomycin (cont.) 60 -dehydro-60 -oxoparomamine aminotransferase, 506–507 2-deoxy-scyllo-inosose synthase, 500–501 L-glutamine:deoxy-scyllo-inosose aminotransferase NAD-dependent dehydrogenase, 503 overview, 501–502 radical S-adenosylmethionine dehydrogenase, 503–504 overview, 465, 495.498 paromamine 60 -dehydrogenase, 505–506 phosphoribostamycin phosphatase, 508 phosphoribostamycin synthase, 507–508 UDP-GlcNAc:ribostamycin N-acetylglucosaminyltransferase, 508–509 NigBI/BII, polyether biosynthesis, 199–201 NigCI, polyether biosynthesis, 198–199 Nigericin biosynthetic gene clusters, 192–193 structure, 189 NMR, see Nuclear magnetic resonance Norsolorinic acid synthase, see Fungal type I polyketide synthases Novobiocin, see also Aminocoumarin antibiotics biosynthetic gene clusters deletions in integrative cosmids, 442–444 heterologous expression, 441–442 structure, 439 Nuclear magnetic resonance nystatin analogs, 254 polyketide synthase/fatty acid synthase structure acyl carrier protein, 36–37 acyltransferase domain, 22–24 aromatase/cyclases, 32–36 dehydratase domain, 30–32 examples, 21 ketoreductase domains, 27–30 ketosynthase domain, 24–27 overview, 18, 21 prospects for study, 39 thioesterase, 37–39 protein size limitations in structure elucidation, 18 Nystatin A1 analogs liquid chromatography–mass spectrometry purification, 255–256 production and identification, 254–255 scaled-up production, 255 antifungal activity, 244 biosynthesis gene clusters, 244–246 gene modification in Streptomyces nodosus overview, 249–252
Subject Index
phage-mediated gene replacement, 252–254 gene modification in Streptomyces noursei conjugative transfer of plasmid, 247–248 inactivation, 248 overview, 246–247 replacement, 248–249 structure, 244 O Oleandomycin, synthesis, 120 Onnamide A structure, 169 synthesis, 171 Orsellinic acid, structure, 4 Oxazolomycin structure, 169 synthesis, 172 Oxygenase, type II polyketide synthase assay, 387–389 Oxytetracycline, structure, 369 P PABA, see p-Aminobenzoic acid biosynthesis, 230, 233 Paromamine 60 -dehydrogenase, cyclitolcontaining aminoglycoside synthesis, 505–506 PCR, see Polymerase chain reaction Pederin structure, 4, 121, 169 synthesis, 172 Phoslactomycin B structure, 121 synthesis, 128 Phosphopantetheinyl transferase acyl carrier protein activation, 118 holoprotein preparation, 92–93 overexpression, 91–92 Phosphoribostamycin phosphatase, cyclitolcontaining aminoglycoside synthesis, 508 Phosphoribostamycin synthase, cyclitolcontaining aminoglycoside synthesis, 507–508 Pik polyketide synthase, intermodular interactions, 135–136 Pikromycin, synthesis, 120 Pimaricin applications, 218 biosynthesis in Streptomyces natalensis cholesterol oxidase regulation, 225 gene cluster, 218, 220 global regulation, 226–227 inducers, 226 pimarocinolide synthase complex, 218, 220, 222
Subject Index
pimarocinolide tailoring and export, 223–224 scheme, 221 transcriptional regulation, 224–225 discovery, 217 structure, 216–219 PKS, see Polyketide synthase PKSE, see Iterative type I polyketide synthase Platenolide, synthesis, 120 Polyketide production, heterologous bacteria Escherichia coli as heterologous host, 357–359 general considerations, 340–344 overview, 340–341 polyketide synthase engineering, see Polyketide synthase Pseudomonas putida as heterologous host, 359–360 Streptomyces coelicor conjugation protocol optimization Escherichia coli–Streptomyces cross-streak technique, 354–355 Saccharopolyspora erythraea, 354 large polyketide synthase genes assembly, 349–350 bacterial artificial chromosome plasmids, 350 multiplasmid approach, 350–351 model system features, 344–347 overview of steps, 347–349 polyketide titer improvement high copy number plasmids, 351 superhost vector systems, 351–353 precursor supply optimization enhancement of supply, 355–356 precursor pathway incorporation, 356–357 Polyketide synthase, see also Acyltransferase-less type I polyketide synthases; Deoxyerythronolide B synthase; Fungal type I polyketide synthases; Iterative type I polyketide synthase; specific products engineering acyltransferase replacements, 300–305 a-carbon alterations, 300–301 b-carbon processing, 305–307 chemobiosynthesis, 311, 313 gene knockouts, 314–315 heterologous expression of proteins, 309–312 ketide unit structure determination by domain organization, 298–299 mutasynthesis, 313–314 overview, 296–298 pathway gene design and synthesis assembly of large synthases, 330–332 module combination optimization assay, 327, 329–330
579 operon design and construction for sugar pathway gene expression, 332–335 overview, 320–322 restriction site incorporation for expression in Escherichia coli, 322–324 validation of synthetic gene design, 324–327 single crossover events, 308–309 strategies, 300 extender units, see Polyketide synthase extender units modular enzymes, 10–12 structure acyl carrier protein, 36–37 acyltransferase domain, 22–24 aromatase/cyclases, 32–36 dehydratase domain, 30–32 examples, 21 fatty acid synthase homology, 18 ketoreductase domains, 27–30 ketosynthase domain, 24–27 nuclear magnetic resonance overview, 18, 21 prospects for study, 39 thioesterase, 37–39 X-ray crystallography overview, 18–19, 21 type II enzymes, see Type II polyketide synthase types and features, 6–12 Polyketide synthase extender units, acyl carrier protein-linked biosynthesis, 144–146 zwittermicin A biosynthesis system reconstitution and characterization acylation studies, 161 (2R)-aminomalonyl-acyl carrier protein formation, 157–158 ATP/pyrophosphate exchange assays, 160–161 (2R)-hydroxymalonyl-acyl carrier protein formation, 154–157 mass spectrometry analysis of acyl carrier proteins, 158–160 phosphopantetheinylation of acyl carrier proteins, 151–152 recombinant protein overproduction and purification materials, 147–148 nickel affinity chromatography of histidine-tagged proteins, 149–151 overproduction in Escherichia coli, 148–149 principles, 147 reverse-phase high-performance liquid chromatography characterization of modified acyl carrier proteins, 152–154
580
Subject Index
Polyketide synthase extender units, acyl carrier protein-linked (cont.) serine modification studies, 161 Polymerase chain reaction fungal type I polyketide synthase primers, 51–52 PKSE cassettes for predictive classification of new enediynes amplification product generation, 102 primers, 101–103 sequencing and phylogenetic analysis, 103 Pradimicin, structure, 369 Premonensins structures, 121 synthesis, 195–198 Pthenoic acid, synthesis in mycobacteria, 277–278 R Rapamycin structure, 121 synthesis, 124 Rhizoxin structure, 121, 169 synthesis, 172 Rifamycin, structure, 121 Rosaramidin, synthesis, 120 S Salinomycin biosynthetic gene clusters, 193–194 structure, 189 Siderophore, synthesis in mycobacteria, 280–281 Simocyclinone D8, structure, 439 Single crossover event, polyketide synthase engineering Site-directed mutagenesis acyl carrier protein active site mapping, 86–88 NanE, 209 Size-exclusion chromatography acyl carrier proteins, 425 thymidine diphosphate-a-D-glucose, 527–528 Skipping modules, polyketide synthase, 133–134 Soraphen A, structure, 122 Spectinomycin biosynthetic gene cluster, 462 structure, 461 synthesis, 465 Squalestatin S1, structure, 4 Stigmatellin A, structure, 121 Stigmatellin polyketide synthase, stuttering modules, 132 Streptomycin biosynthetic gene cluster, 462 structure, 461 synthesis, 465, 469–477
Streptomycin-phosphate phosphatase, cyclitolcontaining aminoglycoside synthesis, 473–474 Stuttering modules, polyketide synthase, 134–135 Sulfolipids, synthesis in mycobacteria, 270–262 T Tenellin synthetase, see Fungal type I polyketide synthases Tetracenomycin, structure, 369 Tetrahydroxynaphthalene synthase, see Fungal type I polyketide synthases Tetronomycin, structure, 189 Thioesterase NanE and polyether biosynthesis N-acetylcysteamine thioester substrate preparation, 205–206, 208 assay, 206–208 expression in Escherichia coli, 204 histidine tag removal, 205 overview, 201–204 purification of histidine-tagged protein, 204–205 site-directed mutagenesis, 209 polyketide synthase structure, 37–39 Thymidine diphosphate deoxysugars biosynthetic pathway reconstitution overview, 533–534 thymidine diphosphate-a-D-desosamine synthesis, 538–539 thymidine diphosphate-a-D-forosamine synthesis, 536–537 thymidine diphosphate-a-D-mycaminose one-pot synthesis, 534–535 thymidine diphosphate-b-L-mycarose synthesis, 535–536 glycosylation, 522–523 metabolic pathway engineering for in vivo synthesis, 539–541 thymidine diphosphate-a-D-glucose enzymatic synthesis incubation conditions, 526–527 overview, 524–525 recombinant enzyme preparation, 525–526 purification liquid chromatography and desalting, 528–529 size-exclusion chromatography, 527–528 thymidine diphosphate-4-keto-6-deoxy-a-Dglucose 2,6-dideoxysugar generation, 531–533 enzymatic synthesis overview, 529–531 Tylactone, synthesis, 120 Tylosin, synthesis, 120 Type II polyketide synthase assays of individual enzyme activities
581
Subject Index
aromatase/cyclases, 384–386 glycosyltransferases, 389 ketoreductase, 384–386 methyltransferase, 386–387 oxygenases, 387–389 components, 368, 370 enzymatic total synthesis, 389 expression and purification acyl carrier protein expression and modification, 372–373 Escherichia coli as heterologous host, 371–372 Streptomyces as heterologous host, 373–376 gene clusters, 368 minimal activity assays ketosynthase–acyl carrier protein interaction assay, 380–381 malonyl-Co:acyl carrier protein transacylation assay, 380 mass spectrometry, 381 product assays, 376–380 products, 368–369 starter unit synthesis and incorporation assays direct priming of minimal polyketide synthase, 382 overview, 381 starter unit biosynthesis, 382–384 U UDP-GlcNAc:ribostamycin N-acetylglucosaminyltransferase, neomycin synthesis, 508–509 V Validamycin A biosynthetic gene cluster, 463 structure, 461 synthesis, 465 Virginiamycin M structure, 122, 169 synthesis, 172
X X-ray crystallography, polyketide synthase/fatty acid synthase structures acyl carrier protein, 36–37 acyltransferase domain, 22–24 aromatase/cyclases, 32–36 dehydratase domain, 30–32 examples, 21 ketoreductase domains, 27–30 ketosynthase domain, 24–27 overview, 18–19, 21 prospects for study, 39 thioesterase, 37–39 Z Zearalenone, synthesis, 70–72 Zwittermicin A, biosynthesis system reconstitution and characterization acylation studies, 161 (2R)-aminomalonyl-acyl carrier protein formation, 157–158 ATP/pyrophosphate exchange assays, 160–161 (2R)-hydroxymalonyl-acyl carrier protein formation, 154–157 mass spectrometry analysis of acyl carrier proteins, 158–160 phosphopantetheinylation of acyl carrier proteins, 151–152 recombinant protein overproduction and purification materials, 147–148 nickel affinity chromatography of histidinetagged proteins, 149–151 overproduction in Escherichia coli, 148–149 principles, 147 reverse-phase high-performance liquid chromatography characterization of modified acyl carrier proteins, 152–154 serine modification studies, 161