Inducible Gene Expression in Plants

00 Inducible Gene prelims

3/9/99 11:59 AM

Page i

INDUCIBLE GENE EXPRESSION IN PLANTS

00 Inducible Gene prelims

3/9/99 11:59 AM

Page ii

00 Inducible Gene prelims

3/9/99 11:59 AM

Page iii

Inducible Gene Expression in Plants Edited by

P.H.S. Reynolds Ministry of Research, Science and Technology PO Box 5336 Wellington New Zealand Formerly at: The Horticulture and Food Research Institute of New Zealand Palmerston North New Zealand

CABI Publishing

00 Inducible Gene prelims

3/9/99 11:59 AM

Page iv

CABI Publishing is a division of CAB International CABI Publishing CAB International Wallingford Oxon OX10 8DE UK Tel: +44 (0)1491 832111 Fax: +44 (0)1491 833508 Email: [email protected]

CABI Publishing 10 E 40th Street Suite 3203 New York, NY 10016 USA Tel: +1 212 481 7018 Fax: +1 212 686 7993 Email: [email protected]

© CAB International 1999. All rights reserved. No part of this publication may be reproduced in any form or by any means, electronically, mechanically, by photocopying, recording or otherwise, without the prior permission of the copyright owners. A catalogue record for this book is available from the British Library, London, UK. Library of Congress Cataloging-in-Publication Data Inducible gene expression in plants / edited by P.H.S. Reynolds. p. cm. Includes bibliographical references and index. ISBN 0–85199–259–5 (alk. paper) 1. Plant genetic regulation. 2. Plant gene expression. I. Reynolds, P. H. S. (Paul H. S.) QK981.4.I558 1998 572.89652––dc21

ISBN 0 85199 259 5 Typeset in 10/12pt Photina by Columns Design Ltd, Reading. Printed and bound in the UK at the University Press, Cambridge.

98–25843 CIP

00 Inducible Gene prelims

3/9/99 11:59 AM

Page v

Contents

Contributors 1 Inducible Control of Gene Expression: an Overview P.H.S. Reynolds 2 Use of the TN10-encoded Tetracycline Repressor to Control Gene Expression C. Gatz

vii 1

11

3 Ecdysteroid Agonist-inducible Control of Gene Expression in Plants A. Martinez and I. Jepson

23

4 Glucocorticoid-inducible Gene Expression in Plants T. Aoyama

43

5 Tissue-specific, Copper-controllable Gene Expression in Plants V.L. Mett and P.H.S. Reynolds

61

6 Nitrate Inducibility of Gene Expression Using the Nitrite Reductase Gene Promoter S.J. Rothstein and S. Sivasankar

83

7 Use of Heat-shock Promoters to Control Gene Expression in Plants R.T. Nagao and W.B. Gurley

97

8 Wound-inducible Genes in Plants L. Zhou and R. Thornburg

127

v

00 Inducible Gene prelims

vi

3/9/99 11:59 AM

Page vi

Contents

9 Developmental Targeting of Gene Expression by the Use of a Senescence-specific Promoter S. Gan and R.M. Amasino

169

10 Abscisic Acid- and Stress-induced Promoter Switches in the Control of Gene Expression Q. Shen and T.-H.D. Ho

187

11 Potential Use of Hormone-responsive Elements to Control Gene Expression in Plants T.J. Guilfoyle and G. Hagen

219

Index

237

00 Inducible Gene prelims

3/9/99 11:59 AM

Page vii

Contributors

Richard M. Amasino, Department of Biochemistry, 420 Henry Mall, University of Wisconsin, Madison, WI 53706-1569, USA. Takashi Aoyama, Institute for Chemical Research, Kyoto University, Uji, Kyoto 611, Japan. Susheng Gan, Tobacco and Health Research Institute and Department of Agronomy, Cooper and University Drives, University of Kentucky, Lexington, KY 40546-0236, USA. Christiane Gatz, Albrecht von Haller Institut für Pflanzenwissenschaften, Universität Göttingen, Untere Karspüle 2, 37073 Göttingen, Germany. Tom J. Guilfoyle, University of Missouri, Department of Biochemistry, 117 Schweitzer Hall, Columbia, MO 62511, USA. William B. Gurley, Department of Microbiology and Cell Science, University of Florida, Gainesville, FL 32611, USA. Gretchen Hagen, University of Missouri, Department of Biochemistry, 117 Schweitzer Hall, Columbia, MO 62511, USA. Tuan-Hua David Ho, Plant Biology Program, Department of Biology, Division of Biology and Biomedical Sciences, Washington University, St Louis, MO 63130, USA. Ian Jepson, Zeneca Agrochemicals, Jealott’s Hill Research Station, Bracknell, Berkshire RG42 6ET, UK. Alberto Martinez, Zeneca Agrochemicals, Jealott’s Hill Research Station, Bracknell, Berkshire RG42 6ET, UK. Vadim L. Mett, Plant Improvement Division, The Horticulture and Food Research Institute of New Zealand, Batchelar Research Centre, Highway 57, Private Bag 11030, Palmerston North, New Zealand. vii

00 Inducible Gene prelims

viii

3/9/99 11:59 AM

Page viii

Contributors

Ronald T. Nagao, Botany Department, University of Georgia, Athens, GA 30602, USA. Paul H.S. Reynolds, Plant Improvement Division, The Horticulture and Food Research Institute of New Zealand, Batchelar Research Centre, Highway 57, Private Bag 11030, Palmerston North, New Zealand. Steven J. Rothstein, Department of Molecular Biology and Genetics, University of Guelph, Guelph, Ontario N1G 2W1, Canada. Qingxi Shen, Monsanto Company, Mail Zone AA2G, 700 Chesterfield Village Parkway, Chesterfield, MO 63198, USA. Sobhana Sivasankar, Department of Molecular Biology and Genetics, University of Guelph, Guelph, Ontario N1G 2W1, Canada. Robert Thornburg, Department of Biochemistry and Biophysics, Iowa State University, Ames, IA 50011, USA. Lan Zhou, Department of Biochemistry and Biophysics, Iowa State University, Ames, IA 50011, USA.

01 Inducible Gene 01

3/9/99 11:59 AM

Page 1

Inducible Control of Gene Expression: an Overview

1

Paul H.S. Reynolds Plant Improvement Division, The Horticulture and Food Research Institute of New Zealand, Batchelar Research Centre, Highway 57, Private Bag 11030, Palmerston North, New Zealand

There is considerable interest in the use of inducible systems for the expression of genes introduced into plants, not only because they allow expression of genes which may, for example, be developmentally lethal, but also because they allow for controlled experiments to be performed in a true isogenic background. Such systems also find use in the manipulation of levels of expression in order to understand more fully individual gene function, or to provide a means for the overproduction or deletion, by reverse genetics, of a particular gene product. This is a rapidly developing area of plant molecular biological research. The need for inducible expression systems is high, not only for their obvious use as research tools, but also for their potential in the future in field-based systems for the inducible expression of desired characters. A wide range of promoter systems can be envisioned which could potentially allow inducible control of genes introduced into plants. These could be broadly described as falling into three general areas. Firstly, there are those which rely on plant-based developmental processes. Such promoters could, for example, include those regulated by plant hormones or which are otherwise developmentally regulated. The advantage of such systems is clearly that all components of the necessary signal transduction pathways are already present in the plant. They also provide a means for the coordinated expression of a gene product within a defined stage of plant growth and development. The second group of promoter systems includes control sequences which respond to particular environmental signals. These potential control systems include heat-shock- and senescence-specific promoters, as well as systems which are responsive to nutritional status. These sorts of promoter systems may well be attractive for the controlled expression of characters in the field, as opposed to the laboratory situation. This is because no application of specific © CAB International 1999. Inducible Gene Expression (ed. P.H.S. Reynolds)

1

01 Inducible Gene 01

2

3/9/99 11:59 AM

Page 2

P.H.S. Reynolds

inducers or defined conditions for growth are necessary, and the desired expression of a gene at a particular growth stage of the plant could be ‘selfregulating’. The third group of control systems comprises those promoters which are introduced from non-plant backgrounds. This includes animal hormone receptor/activators, antibiotic resistance control mechanisms from bacteria and promoters responsive to chemical inducers. Such systems require the introduction of the appropriate transcription factor systems into the plant background together with the inducible promoter. They have the potential advantage that the signal transduction systems are therefore unique to the gene which is being induced and allow timing of expression which is totally independent from the timetable of plant processes and from plant transcription factors.

CONTROL SYSTEMS FROM NON-PLANT BACKGROUNDS The advantage offered by the use of control systems from non-plant sources to be independent from plant processes also provides the disadvantage to their use outside the laboratory. That is, they frequently require modified growth conditions and/or the provision of specific inducers for their activation. For example, the copper-controllable system (Mett et al., 1993, 1996) is activated by copper levels commonly seen in the environment and so is not amenable for use in the field. The tetracycline (Gatz et al., 1992; Weinmann et al., 1994) and animal steroid hormone (Schena et al., 1991; Aoyama and Chua, 1997) systems require the provision of specific elicitors for their activation. None the less these systems offer enormous potential in laboratory-based studies to elucidate the roles of specific genes or to recover potentially lethal signal transduction mutants. The increasing sophistication of plant cell culture techniques and the emerging opportunities offered by the use of ‘plants as factories’ suggests that such promoters will have an important role to play in the commercial plant biotechnology of the future. A recently reported system uses an ethanol-inducible gene switch which may well be amenable to use in the field (Caddick et al., 1998). This system is based on the alc regulator from Aspergillus nidulans, a self-contained genetic system that controls cellular response to ethanol. The system developed for expression in plants utilizes the AlcR transcription factor expressed constitutively, together with the ‘gene of interest’ under the control of a promoter consisting of the CaMV 35S RNA promoter TATA sequences fused to the AlcR binding sites from the A. nidulans AlcA (alcohol dehydrogenase) promoter. Binding of the AlcR transcription factor to the chimeric promoter is responsive to the inducer, ethanol. In an experiment using the system with the chloramphenicol acetyl transferase (CAT) reporter as the ‘gene of interest’, CAT protein was barely detectable in the absence of ethanol. When ethanol was provided either by root drenching as a 1% solution or by foliar spray, there was strong induction of CAT

01 Inducible Gene 01

3/9/99 11:59 AM

Page 3

Inducible Control of Gene Expression: an Overview

3

activity to 50% of that obtained in plants transformed with the CAT reporter under control of the full CaMV 35S RNA promoter. Four promoter systems utilizing transcriptional control systems from outside the plant genome are reviewed here. These are the tetracycline repressor (Chapter 2) and the copper-controllable promoter (Chapter 5) systems. Chapters 3 and 4 discuss the use of mammalian nuclear receptor systems in controlled expression of genes introduced into plants.

Use of the Tn10-encoded tetracycline repressor to control gene expression In Gram-negative bacteria, the Tet repressor (TetR) negatively regulates expression of the tetracycline resistance gene. Induction of this resistance gene is mediated by tetracycline (tc) which binds to TetR and abolishes its DNAbinding activity, thus relieving the repression. This function of TetR is used in two ways to provide inducible expression in plants. 1. TetR is used to repress plant gene expression. This is achieved by the expression of the TetR gene in plants together with the ‘gene of interest’ under control of a chimeric promoter which contains target operator sequences which are bound by TetR about the TATA motif. Repression is relieved by providing tc to plants and the gene of interest is then expressed. 2. TetR is used to activate plant gene expression. This is achieved by expressing a fusion of TetR with the transcriptional activation domain of herpes simplex virus protein VP16 together with the ‘gene of interest’ under the control of a target promoter containing seven tet operators upstream of a minimal promoter. In the absence of tc the TetR-activation fusion binds to the operator sequence and is able to activate transcription. In the presence of tc the fusion protein no longer binds and transcriptional activation is not favoured.

Ecdysteroid agonist-inducible control of gene expression in plants A nuclear receptor functions both as a sensor for its ligand as well as a transcription factor regulating the expression of target genes by binding to specific DNA sequences. Nuclear receptors consist of at least four domains. The A/B and D domains function in transactivation and nuclear targeting, respectively. The DNA-binding (C) domain is the most conserved and consists of two zinc finger structures which bind specific DNA sequences. The carboxyl terminal (E) domain plays multiple roles in ligand binding, dimerization and transcriptional regulation. This domain structure of the nuclear receptors make them ideal candidates for engineering of novel receptors with unique behaviour. A low-background, highexpression system has been developed based on the Heliothis ecdysteroid ligandbinding domain and the glucocorticoid receptor transactivation and DNA-binding domains.

01 Inducible Gene 01

4

3/9/99 11:59 AM

Page 4

P.H.S. Reynolds

This two component system consists of an ‘effector’ which comprises a chimeric receptor containing the glucocorticoid receptor transactivation and DNA-binding domains fused to the Heliothis ecdysteroid receptor ligandbinding domain. The second ‘response’ component contains the ‘gene of interest’ under control of a chimeric promoter with six copies of the glucocorticoid response element fused to a minimal CaMV 35S RNA promoter. In the presence of a suitable ecdysone agonist the system is activated and transcription of the ‘gene of interest’ is initiated from the chimeric promoter.

Glucocorticoid-inducible gene expression in plants A novel glucocorticoid-inducible system which functions in transgenic plants has been developed. It uses only the hormone-binding domain of the glucocorticoid receptor protein as a regulatory domain in a chimeric transcription factor. The chimeric transcription factor ‘GVG’ consists of the yeast GAL4 DNAbinding domain, the transactivating domain of the herpes viral protein VP16 and the hormone-binding domain of the rat glucocorticoid receptor. This chimeric protein strongly activates transcription of the ‘gene of interest’ from a promoter which contains GAL4 upstream activating sequences only in the presence of glucocorticoid.

Tissue-specific copper-controllable gene expression in plants The copper-controllable system makes use of the yeast copper metallothionein regulatory system. In Saccharomyces cerevisiae this consists of a constitutively expressed metallo-responsive transcription factor, targeted to the nucleus, which activates yeast metallothionein transcription. This activation is mediated by copper ions which alter the conformation of the transcription factor allowing it to bind its cognate binding site in the metallothionein promoter, thus activating transcription. This mechanism has been translated into a plant background in a system in which there is constitutive expression of the ace1 gene and control of expression of the ‘gene of interest’ from a chimeric promoter consisting of a minimal promoter fused to the cognate binding site of the ACE1 transcription factor. In the presence of copper ions the ACE1 protein is competent to bind the chimeric promoter and so activate expression. Control over place of expression is effected by controlling the site of expression of the transcription factor.

PLANT PROMOTER SYSTEMS RESPONSIVE TO ENVIRONMENTAL SIGNALS Plants survive in the environment without the ability to avoid many of its rigours, unlike animals, who take shelter, hide or physically modify the

01 Inducible Gene 01

3/9/99 11:59 AM

Page 5

Inducible Control of Gene Expression: an Overview

5

environment to enhance survival. This means that plants have developed a wide range of mechanisms for defence against disease (Hammond-Kosack and Jones, 1997; Sticher et al., 1997), insect or other predator attack (Green and Ryan, 1972) and are able to respond to a wide range of chemical/nutritional threats provided by the environment. An increasing number of gene regulation systems which activate these processes have been elucidated and a number of these systems can readily be used to control the expression of introduced genes. Three systems amenable for use are described here in three review chapters which identify a wide range of current and potential future mechanisms for the control of gene expression by environmental signals. These are wound inducibility (Chapter 8), nutrient control of expression (specifically, nitrate inducibility, Chapter 6), together with a discussion of the heat-shock response and its applicability to inducible control of gene expression (Chapter 7).

Wound-inducible control of gene expression in plants A wide range of plant genes are induced in response to wounding. This chapter identifies classes of proteins produced and discusses the overall biochemical processes important in the wound response. Mechanisms of gene activation of seemingly unrelated proteins (the proteinase inhibitor genes of solanaceous plants and the vegetative storage proteins), in response to wounding are also examined.

Nitrate inducibility of gene expression using the nitrate reductase gene promoter The essential nutrient for plant growth, nitrate, is itself involved in the activation of genes required for its assimilation. The nitrite reductase gene promoter has been extensively studied and the promoter elements responsible for nitrateinducible expression have been identified. However, the mechanism of repression by both glutamine and asparagine has not yet been elucidated, nor have transcription factors binding identified sequence motifs important in nitrate inducibility been cloned. As more information becomes available and it is possible to construct chimeric promoters, the possibility exists for nutritional status control of expression to be obtained.

Use of heat-shock promoters to control gene expression in plants Heat induction of gene expression depends on the presence of heat-shock consensus elements in the promoter. There are three types of promoter: type A are totally dependent on heat-shock transcription factor binding to heat-shock

01 Inducible Gene 01

6

3/9/99 11:59 AM

Page 6

P.H.S. Reynolds

elements (HSEs) in the promoter; type B promoters exhibit HSE-dependent expression which is responsive to developmental signals under non-heat-shock conditions; and type C promoters have multiple mechanisms of induction, only one of which is dependent on HSEs. Heat-shock promoters have been used to provide an inducible expression system with which to answer a range of basic research questions from thermotolerance (Lee and Schoffl, 1996) to the role of the T-6B oncogene of Agrobacterium on plant growth and development (Tinland et al., 1992). Transient heat induction has been shown to be sufficient to express an introduced gene. Heat-shock promoters have been used in mutagenesis screens to isolate heatshock response regulatory mutants and to investigate the consequences of expression of genes which are normally down-regulated during the heat-shock response. There is a wide range of characterized heat-shock promoters available. To successfully express a gene using an inducible heat-shock promoter requires matching of the expression profile of the gene in question with the optimum parameters desired for transgenic expression.

PROMOTER SYSTEMS BASED ON PLANT DEVELOPMENTAL PROCESSES As more research is carried out in the area of development a greater understanding is being obtained of the genes which regulate these processes. The explosion of information in plant vegetative (Taylor, 1997) and floral (Ma, 1998) development will in the future provide elegant mechanisms for the targeted expression of characters in the reproductive growth phase of plant development. Continued research into the signalling mechanisms involved in plant–microbe interactions (Hahn, 1996) will create a fertile hunting ground for potential new inducible control systems. Recent research (Guilfoyle, 1997) has described specific sequence elements in hormone-responsive promoters which will, in the near future, allow the controlled expression of characters by endogenous regulatory pathways. Other plant developmental processes such as organogenesis (for example, the development of the leguminous root nodule (Long, 1996)) and senescence (Gan and Amasino, 1997) offer characterized promoter systems that are amenable for the controlled expression of introduced genes. Three inducible promoter systems which allow the expression of genes introduced into plants by developmental processes are covered. These are senescence-specific promoters (Chapter 9), together with promoters responsive to the plant hormones abscisic acid (ABA) (Chapter 10) and auxin (Chapter 11).

Developmental targeting of gene expression by the use of a senescencespecific promoter The process of senescence is driven by changes in gene expression, involving the activation and inactivation of specific sets of genes. Using differential screening

01 Inducible Gene 01

3/9/99 11:59 AM

Page 7

Inducible Control of Gene Expression: an Overview

7

techniques a number of senescence-associated genes (SAG) have been identified which are activated only during senescence. Two specific genes, SAG12 and SAG13 have transcripts which were only detected in senescing tissues. That is, these two genes were expressed in a highly senescence-specific manner. The promoter regions of both these genes have been fused to the GUS reporter and were shown, in Arabidopsis and tobacco, to direct expression in a senescence-specific manner. Although the signal transduction pathway which activates expression of these genes is not yet known, the identification of their promoter regions now makes it possible to specifically target the expression of genes introduced into plants in senescing tissues.

Abscisic acid-inducible promoters in the control of gene expression in plants Abscisic acid (ABA) appears to be a ‘stress hormone’. In addition to drought, other stresses such as cold and salinity also cause an increase in ABA content. ABA induces the expression of a variety of genes, including those encoding seed storage proteins and late embryogenesis abundant (lea) and RAB (response to ABA) proteins. It has also been implicated in the suppression of gene expression. Studies of the promoters of these genes has allowed the characterization of a core ACGT box which, together with a coupling element, gives ABA signal response specificity. Molecular switches have been constructed which demonstrate different levels of ABA induction and transcription strength. It is particularly significant that these switches function not only in the model barley aleurone tissue but in vegetative tissue as well.

Potential use of hormone-response elements to control gene expression in plants Hormone-response elements are minimal DNA sequence motifs that confer hormone responsiveness to a promoter. Recently, there has been considerable progress in the understanding of auxin response elements (AuxRE), such that there are now identified sequences which have been shown to function in synthetic composite promoters. Two major types of AuxRE, the ocs or as-1 elements (Ellis et al., 1987) and TGTCTC elements (Hagen et al., 1991), have been characterized and minimal sequences identified and tested for functionality in vivo. Ocs/as-1 elements, fused to minimal promoter-GUS reporter genes can be induced by most of the biologically active auxins and, most importantly, by inactive auxin analogues such as 2,3-D. The potential also exists to manipulate promoters with composite AuxRE to enable auxin regulation in unique tissuespecific, organ-specific or developmentally specific fashion.

01 Inducible Gene 01

3/9/99 11:59 AM

8

Page 8

P.H.S. Reynolds

CONCLUDING COMMENTS The utility of inducible promoter systems in laboratory-based research is selfevident and there is clear potential for their usefulness in the genetically modified plants of the future. For example, there is considerable concern about the place of genetically engineered plants in modern agriculture/horticulture and forestry. This concern is wide-ranging, from the effects of prolonged constitutive expression of pest resistance genes to the effects of expressed genes on the metabolism and fitness of the engineered plants. Studies which address the multiple effects caused at multiple trophic levels by the introduction of a new gene into a plant are only now beginning. The precise timing and control over place of expression are important aspects of the increasing sophistication in genetic engineering which in the future will be combined with the ability to control the chromosomal site of insertion. The boundaries to the development of different methods of control over expression of introduced genes are limited only by the scope of human ingenuity and its ability to trap and utilize the masterful and intricate systems that control the growth, development and survival of all organisms on the planet. For example, the universality of the heat-shock response has the potential to allow almost continuous expression of an introduced gene. The potential usefulness of woundinducible promoter systems for the control of expression of genes introduced to effect pest resistance is obvious. The precise timing of expression offered by the use of specific signal compounds which activate introduced non-plant control mechanisms can allow targeted expression of genes outside of intrinsic programmed control processes. In contrast, hormonal promoters allow control of expression of introduced genes as part of programmed developmental cycles. No one inducible control system can provide all of the answers. Clearly what is required is the careful analysis of all the available systems and selection of the one which is most amenable to the particular gene being expressed.

REFERENCES Aoyama, T. and Chua, N.-M. (1997) A glucocorticoid-mediated transcriptional induction system for transgenic plants. The Plant Journal 11, 605–612. Caddick, M.X., Greenland, A.J., Jepson, I., Krause K.-P., Qu, N., Riddell, K.V., Salter M.G., Schuch, W., Sonnewald, U. and Tomsett, A.B. (1998) An ethanol inducible gene switch for plants used to manipulate carbon metabolism. Nature Biotechnology 16, 177–180. Ellis, J.G., Llewellyn, D.J., Walker, J.C., Dennis, E.S. and Peacock, W.J. (1987) The ocs element: a 16 base pair palindrome essential for activity of the octopine synthase enhancer. The EMBO Journal 6, 3203–3208. Gan, S. and Amasino, R.M. (1997) Making sense of senescence. Molecular genetic regulation and manipulation of leaf senescence. Plant Physiology 113, 313–319. Gatz, C., Frohberg, C. and Wendenburg, R. (1992) Stringent repression and homogeneous de-repression by tetracycline of a modified CaMV 35S promoter in intact transgenic tobacco plants. The Plant Journal 2, 397–404.

01 Inducible Gene 01

3/9/99 11:59 AM

Page 9

Inducible Control of Gene Expression: an Overview

9

Green, T. and Ryan, C. (1972) Wound-induced proteinase inhibitor in plant leaves: a possible defense mechanism against insects. Science 175, 776–777. Guilfoyle, T.J. (1997) The structure of plant gene promoters. In: Setlow, J.K. (ed.) Genetic Engineering, Principles and Methods, Vol. 19. Plenum Press, New York, pp. 15–47. Hagen, G., Martin, G., Li, Y. and Guilfoyle, T.J. (1991) Auxin induced expression of the soybean GH3 promoter in transgenic tobacco plants. Plant Molecular Biology 17, 567–579. Hahn, M.G. (1996) Microbial elicitors and their receptors in plants. Annual Review of Phytopathology 34, 387–412. Hammond-Kosack, K.E. and Jones, J.D.G. (1997) Plant disease resistance genes. Annual Review of Plant Physiology and Plant Molecular Biology 48, 575–607. Lee, J.H. and Schoffl, F. (1996) An Hsp70 antisense gene affects the expression of HSP70/HSC70, the regulation of HSF, and the acquisition of thermotolerance in transgenic Arabidopsis thaliana. Molecular and General Genetics 252, 11–19. Long, S.R. (1996) Rhizobium symbiosis: Nod factors in perspective. The Plant Cell 8, 1885–1898. Ma, H. (1998) To be, or not to be, a flower – control of floral meristem identity. Trends in Genetics 14, 26–32. Mett, V.L., Lochhead, L.P. and Reynolds, P.H.S. (1993) Copper controllable gene expression system for whole plants. Proceedings of the National Academy of Sciences USA 90, 4567–4571. Mett, V.L., Podivinsky E., Tennant, A.M., Lochhead, L.P., Jones, W.T. and Reynolds, P.H.S. (1996) A system for tissue-specific copper controllable gene expression in transgenic plants: nodule-specific antisense of aspartate aminotransferase-P2. Transgenic Research 5, 105–113. Schena, M., Lloyd, A.M. and Davis, R.W. (1991) A steroid-inducible gene expression system for plant cells. Proceedings of the National Academy of Sciences USA 88, 10421–10425. Sticher, L., Mauch-Mani, B. and Metraux, J.P. (1997) Systemic acquired resistance. Annual Review of Phytopathology 35, 235–270. Taylor, C.B. (1997) Plant vegetative development: from seed and embryo to shoot and root. The Plant Cell 9, 981–988. Tinland, B., Fournier, P., Heckel, T. and Otten, L. (1992) Expression of a chimeric heatshock-inducible Agrobacterium 6b oncogene in Nicotiana rustica. Plant Molecular Biology 18, 921–930. Weinmann, P., Gossen, M., Hillen, W., Bujard, H. and Gatz, C. (1994) A chimeric transactivator allows tetracycline-responsive gene expression in whole plants. The Plant Journal 5, 559–569.

01 Inducible Gene 01

3/9/99 11:59 AM

Page 10

02 Inducible Gene 02

3/10/99 8:57 AM

Page 11

Use of the Tn10-encoded Tetracycline Repressor to Control Gene Expression

2

Christiane Gatz Albrecht von Haller Institut für Pflanzenwissenschaften, Universität Göttingen, Untere Karspüle 2, 37073 Göttingen, Germany

The Tn10-encoded Tet repressor (TetR) negatively regulates expression of the Tn10-encoded tetracycline resistance gene in Gram-negative bacteria (for review see Hillen and Berens, 1994). Induction is mediated by tetracycline (tc), which binds to TetR, thus abolishing its DNA-binding activity. Taking advantage of the high specificity of the TetR–tet operator interaction, the high affinity of tc to TetR and the favourable transport properties of tc, tc-regulatable gene expression systems have been developed for a variety of eukaryotes. This chapter reviews the features of TetR important for its use to regulate eukaryotic gene expression and describes two different approaches to use TetR for this purpose. Most recent applications of these systems in plants are briefly described.

THE Tn10-ENCODED Tet REPRESSOR (TetR) TetR regulates expression of its own gene (tetR) as well as expression of the tc resistance gene tetA (Fig. 2.1). Both genes are oriented with divergent polarity; between them is a central regulatory region with overlapping promoters and two tet operators. TetR, a dimer of two 24 kDa subunits, binds via a helix–turn–helix motif to two tet operators, resulting in repression of both genes. Induction is based on binding of tc to TetR, resulting in a TetR–tc complex being unable to bind to DNA. This efficient tc-dependent genetic switch might have evolved because of selective pressure against constitutive expression of the resistance gene; which is an integral membrane protein pumping tc out of the cell. The molecular mechanism of the TetR–tet operator interaction has been studied thoroughly (for review see Hillen and Berens, 1994). The sequence of the © CAB International 1999. Inducible Gene Expression (ed. P.H.S. Reynolds)

11

02 Inducible Gene 02

12

3/10/99 8:58 AM

Page 12

C. Gatz

Fig. 2.1. Genetic organization and mechanism of regulation of the Tn10-encoded tc-resistance determinant. Upper panel: autoregulatory expression of TetR (grey circles) leads to TetR levels that repress transcription of tetR and tetA by binding to the two operators O1 and O2. Lower panel: tc binds to TetR, enforcing its dissociation from the DNA, which leads to transcription of both genes. Tcresistance protein TetA, which is an integral membrane protein that exports tc out of the cell, is represented by cylinders.

two Tn10-encoded tet operators are shown in Fig. 2.2. Each operator is a 19 bp palindrome consisting of two 9 bp half sites flanking a central bp. Five of the 9 bps of each half site are directly contacted by amino acids of the N-terminal helix–turn–helix motif of TetR, thus contributing strongly to the specificity of the interaction. The binding constants at an assumed physiological salt concentration of 160 mM sodium chloride are 3 3 102 M21 for non-specific, and 2 3 1011 M21 for specific binding. The ratio of specific over non-specific binding constants (7 3 108) guarantees that non-specific DNA does not effectively compete with operator DNA for repressor binding. Considering the genome size of higher plants (6 3 1010 bp in the allo-diploid species tobacco) this high specificity of binding is an essential feature of TetR for its use in eukaryotes. TetR mutants with altered recognition specificities are also available, thus providing potentially valuable tools for further refinements of tc-dependent expression systems in higher plants. TetR-regulated promoter systems respond to tc, because binding of tc to TetR leads to a conformational change rendering the protein into a non-DNA-

02 Inducible Gene 02

3/10/99 8:58 AM

Page 13

Use of the Tn10-encoded Tetracycline Repressor

13

Fig. 2.2. Sequence of the two tet operators. Asterisks indicate the central bp of the palindrome, arrows illustrate the palindromic nature of the sequence and boxes indicate bp that are directly contacted by TetR.

binding conformation. The high association constant of the inducer tc to TetR (Kass = 3 3 109 M21) makes induction sensitive to even nanomolar concentrations of the drug. The crystal structure of the TetR–tc complex has offered insight into the conformational changes associated with the switch between inducing and repressing structures of TetR. Moreover it might provide clues to develop new inducing tc derivatives lacking antibiotic activities. Using a mutagenesis screen to isolate TetR mutants which repress prokaryotic gene expression in the presence of tc, a TetR mutant was isolated that requires tc for efficient binding to tet operator DNA. This mutant has been successfully used in mammalian systems to regulate gene expression in a reverse manner as compared to TetR (Gossen et al., 1995; see below). Apart from the Tn10-encoded tc-resistance determinant, similar operons have been found to be encoded by other transposons (Tn1721) or plasmids (RA1, pSC101, pJA 8122, pSL1456). They all show the same arrangement of tetA and tetR with tet operators being located overlapping to the promoters in the central regulatory region (Fig. 2.1). The amino acid sequences of the encoded proteins are 43–78% identical. Based on sequence analysis the different tc-resistance determinants are grouped into classes A to G. The operator sequences of the different classes show sequence similarities, but tet operators of classes A, C and G are only poorly recognized by class B and D repressors. This set of naturally occurring TetR derivatives with different operator binding specificities, combined with mutants differing in their response to various tc derivatives opens potential avenues for controlling several transgenes by individual repressor molecules.

USING TetR TO REPRESS PLANT GENE EXPRESSION In the prokaryotic system, TetR represses transcription by sterically interfering with binding of RNA polymerase to the promoter due to the overlapping arrangement of tet operators with promoter sequences. This principle of

02 Inducible Gene 02

14

3/10/99 8:58 AM

Page 14

C. Gatz

regulating gene expression is a common mechanism in bacteria but is found infrequently in higher eukaryotes, where protein–protein interactions are the primary mechanism to mediate stimulating or inhibitory effects on the transcription machinery. Nevertheless, initial experiments using transiently transformed protoplasts revealed that this principle of steric hindrance could also be applied to control a plant promoter (Gatz and Quail, 1988). Two operators were positioned flanking the TATA box of the cauliflower mosaic virus (CaMV) 35S promoter. Expression of TetR was achieved by putting tetR under the control of the wild-type (wt) CaMV 35S promoter. TetR was able to repress the modified CaMV 35S promoter, presumably by interfering with the assembly of a functional transcription initiation complex in this region of the promoter. Repression was relieved by addition of tc. Transfer of these regulatory modules to transgenic plants did not immediately result in an efficient expression system indicating that the principle of repression is less efficient when the target promoter is integrated into the chromosome. Two important adjustments had to be made. The chimeric CaMV 35S:tetR construct used in transient assays provided considerable lower TetR expression levels when integrated into the genome. By shortening the untranslated leader by 50 bp, steady-state levels of one million TetR molecules per cell were achieved in the transgenic situation (Gatz et al., 1991). Second, the location of the operators had to be adjusted. Systematic analysis of 22 CaMV 35S promoter derivatives containing a single tet operator in different positions (Fig. 2.3) demonstrated that repression by TetR depended very much on the exact location of the operator. For instance, when the distance between the 3′ end of the operator and the 5′ end of the TATA box was only 1 bp, repression was very efficient; repression was less efficient at a distance of 3 bp and at a distance of 5 bp no repression was observed (Frohberg et al., 1991). Also, when the distance between the 5′ end of the tet operator and the transcriptional start site exceeded 9 bp the operator was not able to contribute to repression in the presence of TetR (Heins et al., 1992). Whereas occupation of a single operator within the CaMV 35S promoter mediated repression in transiently transformed protoplasts, one operator was not efficient when integrated into the plant genome. However, integration of three operators into the CaMV 35S promoter, with each operator being able to contribute to repression as determined by transient analysis, led to the development of a tightly repressible CaMV 35S promoter derivative (Gatz et al., 1992). Thus, high TetR levels as well as multiple operator sites are required for efficient repression. In contrast with the prokaryotic system, where it only has to interfere with binding of RNA polymerase, TetR has to compete against at least 40 proteins in eukaryotic systems (Fig. 2.4), which cooperate to form a functional transcription initiation complex (Roeder, 1991). Sequence alterations in the vicinity of the TATA

Fig. 2.3. (Opposite) Schematic drawing of the promoter derivatives constructed to define functional operator locations. Using transient assays, 22 CaMV 35S:chloramphenicol acetyl transferase (cat) constructs were tested in TetR-encoding tobacco protoplasts.

02 Inducible Gene 02

3/10/99 8:58 AM

Page 15

Use of the Tn10-encoded Tetracycline Repressor

15

Fig. 2.3. (Continued) Expression was monitored after incubation of protoplasts with or without tc. Only the region from 282 to +30 of the CaMV 35S promoter derivatives is shown with each bp being represented by one square. Except for activating sequence-1 (as-1) and the TATA box, sequences can be replaced without altering promoter activity. The 19 bp tet operator is indicated as a black, grey or white box. Black boxes indicate locations, where TetR interferes with transcription; the grey box indicates a location, where TetR has a weaker negative effect on transcription; and white boxes indicate locations, where TetR has no effect on transcription. Only, the promoter with three operators mediates stringent repression in the transgenic situation. TSS, transcriptional start site.

02 Inducible Gene 02

16

3/10/99 8:59 AM

Page 16

C. Gatz

Fig. 2.4. Schematic representation of the use of TetR to repress transcription. TetR is synthesized under the control of a strong constitutive promoter (upper panel) and controls a target promoter in a tc-dependent manner (lower two panels). The DNA is represented as a string of white squares, the operators are indicated in black and the enhancer module is indicated as a white box. In the absence of the inducer tc (filled triangles), binding of TetR (grey circles) to the operators interferes with assembly of the transcription initiation complex at the TATA box (left panel). Binding of tc to TetR triggers a conformational change in the protein, so that it can no longer bind to DNA, enforcing rapid dissociation from the DNA. Thus, the multifactorial initiation complex, which contains TFIID, TFIIA, TFIIB, TFIIF, TFIIE, other associated factors and RNA polymerase II, can assemble and transcription is initiated (right panel). Tissue specificity of the system can be achieved by choosing appropriate enhancer modules of the target promoter.

box did not reduce expression from the CaMV 35S promoter (Gatz et al., 1992). In tobacco expression of this promoter can be modulated 500-fold by tc. The induction factor is independent of position effects. High-expressing plants have background GUS levels of 2000 pM 4-MU produced min21 (mg protein)21 and can be induced to 180,000 pM 4-MU produced min21 (mg protein)21; lowexpressing plants show, in the absence of tc, GUS levels barely distinguishable from GUS levels detectable in untransformed plants but can only be induced to 1000 to 2000 U. Induction of gene expression is achieved by tc treatment; only 0.1 mg l21 tc is required when single leaves are infiltrated (Gatz et al., 1991). Under these conditions, induction is extremely fast (10 min) reflecting the short signal transduction chain. At the whole plant level, various modes of tc treatment can

02 Inducible Gene 02

3/10/99 8:59 AM

Page 17

Use of the Tn10-encoded Tetracycline Repressor

17

be applied. Systemic induction can be achieved by cultivating plants in hydroponic culture (1 mg l21; Gatz et al., 1992). This method is somehow tedious, as the solution has to be renewed every other day. Depending on the size of the plants, full induction is achieved after 1 or 2 weeks. Alternatively, plants can be grown in sand or rockwool in a setup that allows drainage of the solution (Corlett et al., 1996). Unfortunately, tc treatment reduces root growth, but plant height, chlorophyll content and assimilation rates are only marginally affected. Daily painting of leaves with tc (10 mg l21) is an alternative method of induction. Tc stays in the painted leaf, so that local induction is possible. In tissue culture containers transpiration is not sufficient for homogenous distribution of the inducer but expression in roots and leaves touching the medium is highly induced (Gatz et al., 1992). If fresh tc is not added constantly, TetR turns transcription off again indicating that tc is not very stable in planta. The tc-inducible system has been used to express a dominant negative mutant of the TGA family of transcription factors in transgenic tobacco plants, leading to the conditional reduction of transcription factor complex ASF-1 (Rieping et al., 1994). Conditional reduction of ASF-1 provided the possibility to directly correlate the subsequent reduction of expression from a reporter construct with the reduction of ASF-1, thus concluding that low expression of the reporter construct was simply due to position effects. Plants expressing the Agrobacterium rhizogenes-encoded rolB gene grew normally in the absence of tc, and a very severe phenotype (chlorosis, stop of growth, no flower development) could be induced by adding tc to the hydroponic nutrient solution (Röder et al., 1994). Upon removal of tc, healthy leaves developed again. Tc-inducible expression of the Agrobacterium rhizogenes-encoded rolC gene allowed the analysis of primary effects of RolC on cytokinin levels, thus ruling out the possibility that homeostatic mechanisms might mask primary events (Faiss et al., 1996). Local tc-inducible expression of the Agrobacterium tumefaciensencoded ipt gene helped to prove that the consequences of enhanced cytokinin synthesis remained restricted to the site of hormone production (Faiss et al., 1997). The system further served to obtain transgenic plants overexpressing oat arginine decarboxylase (Masgrau et al., 1996) and S-adenosylmethionine decarboxylase (Kumar et al., 1995) and to evaluate their phenotypes under vegetative and reproductive growth. Originally, the system was developed for tobacco plants. Only one paper describes its use in potato (Kumar et al., 1995). Establishment of the system in tomato and Arabidopsis has failed. In tomato, high levels of TetR caused reduced shoot dry weight, leaf chlorophyll content and leaf size, and an altered photosynthetic capacity when grown in the summer (Corlett et al., 1996). This phenotype was almost completely reversed by the application of tc. In addition, the phenotype was not visible when plants were grown in the winter. Thus TetR seems to interfere with high growth rates under strong light conditions. In Arabidopsis, it seems that repressor concentrations sufficient for transcriptional control cannot be tolerated, a phenomenon that has been also reported for mammalian cells (Gossen et al., 1993).

02 Inducible Gene 02

18

3/10/99 8:59 AM

Page 18

C. Gatz

USING TetR TO ACTIVATE PLANT GENE EXPRESSION As originally described by Gossen and Bujard (1992), TetR can be turned into a tc-controlled transcriptional activator (tTA) when fused to the potent transcriptional activation domain of herpes simplex virus protein 16. Despite this C-terminal extension, TetR retains its DNA-binding activity and tcinducibility. tTA can regulate gene expression from a target promoter containing seven tet operators upstream of a minimal promoter over a range of five orders of magnitude in the mammalian HeLa cell line, which was stably transformed with the construct. The same principle was shown to work in transgenic tobacco plants, thus establishing a promoter system that can be shut off in the presence of tc (Weinmann et al., 1994). The advantage of this system is that background levels are lower than with the tc-inducible system described above. This is due to the fact that inactivation of tTA by tc leads to a target promoter that is not activated (Fig. 2.5). Basal expression from the TATA box in the absence of any activators is very low when the DNA is packed in chromatin. In contrast, repression depends on competition of TetR with a number of proteins assembling around the TATA box and even 99% occupancy of the binding sites only guarantees 100-fold repression. This can be explained by the free access of tTA to the operator sites, thus abolishing the requirement for high levels of tTA. In addition, 50% occupancy of binding sites can be sufficient for transcriptional activation, but is definitely not sufficient for stringent repression. The system has been shown to work in Arabidopsis (M. Roever, U. Treichelt, C. Gatz, J. Schiemann and R. Hehl, Braunschweig/Göttingen, 1995, personal communication). Thus, Arabidopsis seems to tolerate the amount of TetR derivatives needed for transcriptional activation. The tTA-based system has been successfully applied for measuring mRNA decay rates in tobacco BY-2 cells (Gil and Green, 1995). Because of the fast uptake of tc by suspension cultured cells, the target promoter can be shut off very efficiently which allows the observation of first-order decay of transcripts within 15 min after tc treatment. The tTA-dependent promoter provides an important alternative to using general inhibitors of polymerase II like actinomycin D. Actually, it proved to be essential in the analysis of the effect of the 3′-untranslated region of one of the small auxin up-regulated RNAs (SAUR) transcripts on mRNA stability. The destabilizing effect of the sequence was not visible when actinomycin D was used for half-life studies, which indicates that some mRNA decay pathways require ongoing transcription to function. Despite its favourable properties for measuring RNA or protein decay rates, the tTA-dependent expression system has not yet reached its optimum performance. First, expression levels in the absence of tc only reach 30% of the levels reached by the inducible system and drop as transgenic plants age (Weinmann et al., 1994). This problem has been solved recently by reconstructing the target promoter (S. Böhner, I. Lenk and C. Gatz, Göttingen, 1997, personal communication). In addition, cultivating plants permanently on tc to keep the promoter silent can be disadvantageous. A promising alternative

02 Inducible Gene 02

3/10/99 8:59 AM

Page 19

Use of the Tn10-encoded Tetracycline Repressor

19

Fig. 2.5. Schematic representation of the use of TetR to activate transcription. The fusion protein consisting of TetR and an activation domain (tTA) is synthesized under the control of a strong constitutive promoter (upper panel) and controls a target promoter in a tc-dependent manner (lower two panels). The DNA is represented as a string of white squares, the multimerized operators are indicated as a black box in brackets. In the absence of the effector tc (filled triangles), binding of tTA (grey pear-shaped symbol) to the operators activates transcription (left panel), by favouring the functional assembly of the initiation complex consisting of TFIID, TFIIA, TFIIB, TFIIF, TFIIE, other associated factors and polymerase II. Binding of tc to tTA triggers a conformational change in the protein, so that it can no longer bind to DNA and transcription is not activated (right panel). Whether some basal transcription factors keep sitting on the DNA is pure speculation. Tissue specificity of the system can be achieved by choosing appropriate promoters to drive expression of tTA.

was to use the above mentioned TetR mutant that binds to DNA only in the presence of tc (Gossen et al., 1995). Thus, by fusing this mutant to the VP16 domain, a chimeric transcriptional activator (rtTA) was made available. The activity of a target promoter can be induced by tc when rtTA is used, a principle that has been shown to work in mammalian cells. When either Arabidopsis or tobacco was transformed with this construct, no tc-inducible activation of the target promoter was observed. Although mRNA levels similar to tTA mRNA levels were found, no protein was detectable in Western blot analysis using TetR antibodies, indicating that rtTA cannot accumulate in plant cells. We have recently fused tTA to the glucocorticoid receptor hormonebinding domain, resulting in the transcriptional activator TGV, which renders

02 Inducible Gene 02

3/10/99 8:59 AM

20

Page 20

C. Gatz

transcriptional activation dexamethasone (dx)-inducible. A dx-inducible promoter was already established by combining the DNA-binding domain of yeast transcription factor GAL4 with the transcriptional activation domain of VP16 and the glucocorticoid receptor hormone-binding domain (Aoyama and Chua, 1997). This trimeric protein (GVG) activates an artificial promoter consisting of six GAL4 binding sites upstream of the 246 to +1 region of the 35S promoter. As the binding constant of GAL4 (Parthun and Jachnig, 1990) to its target sequence is 100-fold lower than the binding constant of TetR to the tet operators, it could well be that TGV might mediate higher expression levels as compared with GVG. However, this will have to be tested. In addition, background levels of the respective target promoters will have to be compared. An additional feature of TGV is that its activity can be abolished by addition of tc. It remains to be shown whether shutting down transcription by the addition of tc is kinetically more favourable than depletion of dx. The target promoter for tTA or TGV offers a number of useful options. A gene of interest under the control of this promoter can be introduced in either tTA or TGV expressing plants. If the transgene only interferes with regeneration, tTA expressing host plants are recommended. Regeneration could be done in the presence of tc and further analysis could be done without the need of any inducer. If regeneration is done in the absence of tc, expression is constitutive, but can be silenced later, e.g. if the transgene interferes with reproduction. Introduction of the construct into TGV expressing plants keeps the transgene silent in the absence of any chemical. Transcription can be induced and turned off by the subsequent addition of the effectors dx and tc. Moreover, induction can be done at the whole plant level with transcription turned off in selected leaves. In summary, several years of experience with the use of Tn10-encoded regulatory elements for regulating gene expression in eukaryotes has led to a variety of adjustments after the first publication of tc-controlled gene expression in 1988. As the principle of turning TetR into an activator by fusing it to other protein domains has proven to be a more successful strategy than using TetR as a bona fide repressor, the latest development of TGV controlling a target promoter in a dx- and tc-dependent manner seems to be the most promising way to flexibly regulate the expression of transgenes. REFERENCES Aoyama, T. and Chua, N.-H. (1997) A glucocorticoid-mediated transcriptional induction system for transgenic plants. The Plant Journal 11, 605–612. Corlett, J.E., Myatt, S.C. and Thompson, A.J. (1996) Toxicity symptoms caused by high expression of Tet repressor in tomato (Lycopersicon esculentum Mill. L.) are alleviated by tetracycline. Plant Cell Environment 19, 447–454. Faiss, M., Strnad, M., Redig, P., Dolezal, K., Hanus, J., Van Onckelen, H. and Schmülling, T. (1996) Chemically induced expression of the rolC-encoded b-glucosidase in transgenic tobacco plants and analysis of cytokinin metabolism: rolC does not hydrolyze endogenous cytokinin glucosides in plants. The Plant Journal 10, 33–46.

02 Inducible Gene 02

3/10/99 8:59 AM

Page 21

Use of the Tn10-encoded Tetracycline Repressor

21

Faiss, M., Zalubilova, J,, Strnad, M. and Schmülling, T. (1997) Conditional transgenic expression of the ipt gene indicates a function for cytokinins in paracrine signaling in whole tobacco plants. The Plant Journal 12, 401–415. Frohberg, C., Heins, L. and Gatz, C. (1991) Characterization of the interaction of plant transcription factors using a bacterial repressor protein. Proceedings of the National Academy of Sciences USA 88, 10470–10474. Gatz, C. and Quail, P.H. (1988) Tn10-encoded Tet repressor can regulate an operatorcontaining plant promoter. Proceedings of the National Academy of Sciences USA 85, 1394–1397. Gatz, C., Kaiser, A. and Wendenburg, R. (1991) Regulation of a modified CaMV 35S promoter by the Tn10-encoded Tet repressor in transgenic tobacco. Molecular and General Genetics 227, 229–237. Gatz, C., Frohberg, C. and Wendenburg, R. (1992) Stringent repression and homogeneous de-repression by tetracycline of a modified CaMV 35S promoter in intact transgenic tobacco plants. The Plant Journal 2, 397–404. Gil, P. and Green, P.J. (1995) Multiple regions of the Arabidopsis SAUR-AC1 gene control transcript abundance: the 3′-untranslated region functions as an mRNA instability determinant. The EMBO Journal 15, 1678–1686. Gossen, M. and Bujard, H. (1992) Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proceedings of the National Academy of Sciences USA 89, 5547–5551. Gossen, M., Bonin, A.L. and Bujard, H. (1993) Control of gene activity in higher eukaryotic cells by prokaryotic regulatory elements. Trends in Biochemical Science 18, 471–475. Gossen, M., Freundlieb, S., Bender, G., Müller, G., Hillen, W. and Bujard, H. (1995) Transcriptional activation by tetracycline in mammalian cells. Science 268, 1766–1769. Heins, L., Frohberg, C. and Gatz, C. (1992) The Tn10 encoded Tet repressor blocks early but not late steps of assembly of the RNA Polymerase II initiation complex in vivo. Molecular and General Genetics 232, 328–331. Hillen, W. and Berens, C. (1994) Mechanisms underlying expression of Tn10 encoded tetracycline resistance. Annual Review of Microbiology 48, 345–369. Kumar, A., Taylor, M.A., Arif, S.A.M. and Davies, H.V. (1995) Potato plants expression antisense and sense S-adenosylmethionine decarboxylase (SAMDC) transgenes show altered levels of polyamines and ethylene: antisense plants display abnormal phenotypes. The Plant Journal 9, 147–158. Masgrau, C., Altabella, T., Farrás, R., Flores, D., Thompson, A.J., Besford, R.T. and Tiburcio, A.F. (1996) Inducible overexpression of oat arginine decarboxylase in transgenic tobacco plants. The Plant Journal 11, 465–473. Parthun, M.R. and Jachnig, J.A. (1990) Purification and characterization of the yeast transcriptional activator GAL4. Journal of Biological Chemistry 265, 209–213. Rieping, M., Fritz, M., Prat, S. and Gatz, C. (1994) A dominant negative mutant of PG13 suppresses transcription from a cauliflower mosaic virus 35S truncated promoter in transgenic tobacco plants. Plant Cell 6, 1087–1098. Roeder, R.G. (1991) The complexities of eukaryotic transcription initiation: regulation of preinitiation complex assembly. Trends in Biochemical Sciences 16, 402–408. Röder, F.T., Schmülling, T. and Gatz, C. (1994) Efficiency of the tetracycline-dependent gene expression system: complete suppression and efficient induction of the rolB phenotype in transgenic plants. Molecular and General Genetics 243, 32–38.

02 Inducible Gene 02

22

3/10/99 8:59 AM

Page 22

C. Gatz

Weinmann, P., Gossen, M., Hillen, W., Bujard, H. and Gatz, C. (1994) A chimeric transactivator allows tetracycline-responsive gene expression in whole plants. The Plant Journal 5, 559–569.

03 Inducible Gene 03

3/9/99 12:20 PM

Page 23

Ecdysteroid Agonist-inducible Control of Gene Expression in Plants

3

Alberto Martinez and Ian Jepson Zeneca Agrochemicals, Jealott’s Hill Research Station, Bracknell, Berkshire RG42 6ET, UK

TRANSCRIPTIONAL CONTROL OF TRANSGENE EXPRESSION IN PLANTS A number of approaches have been reported for the chemical control of transgene expression in plants (Gatz, 1996). Several systems are available including those which rely on plant-inducible promoters as well as relief of repression systems which use bacterial operator repressors and heterologous promoter/transcription factor combinations. Plant promoters which display chemically inducible expression can be exploited to develop heterologous systems for gene regulation. This approach has been adopted in the case of the PR-1 promoter, the activity of which is induced by salicylic acid (Williams et al., 1992). Although this approach has been used successfully with both reporter and insecticidal genes, it may be of limited use due to unspecific induction by pathogens and other chemical triggers. Chemical-dependent regulation of the maize GST-27 promoter has been described using herbicide safeners (Jepson et al., 1994a, b). Inducible regulation was detected in transgenic plants, however, constitutive expression was observed in root tissues. Inducible regulation of transgenes in plants has been achieved by relief of repression or activation of transcription. In the case of the tetracycline (Gatz et al., 1992) and lacI (Wilde et al., 1992) systems, operator sequences were inserted within a target promoter region. The repressor protein binds to these operator sequences in the absence of ligand (i.e. tetracycline or isopropyl-β-Dthiogalacto pyranoside (IPTG)) preventing transcription of the target gene. Addition of the ligand prevents repressor binding to the operator sequence, thus transcription is initiated (Gatz et al., 1992; Wilde et al., 1992). The tetracycline © CAB International 1999. Inducible Gene Expression (ed. P.H.S. Reynolds)

23

03 Inducible Gene 03

3/9/99 12:20 PM

24

Page 24

A. Martinez and I. Jepson

system has been used in protoplasts and transgenic plants. Recently, the system was shown to tightly regulate mRNA levels of arginine decarboxylase in tobacco plants (Masgrau et al., 1997). The lacI system has been exemplified in tobacco protoplasts (Wilde et al., 1992). Due to the nature of their inducing chemicals (IPTG, tetracycline) it is likely these systems will be restricted to research applications only. Chemical-dependent induction of transcription can also be achieved by using ligand-dependent transcription factors and responsive promoter sequences. One such system is that based on the introduction of ACE1, a copperdependent transcriptional activator from yeast, into plants. The addition of inducer (i.e. Cu2+) leads to activation of reporter gene expression (Mett et al., 1993). A second gene control system based on components of the alcohol dehydrogenase regulon of Aspergillus nidulans has been used to provide chemical-inducible gene expression in plants. The alcR regulatory protein in the presence of certain alcohols and ketones will bind to the alcA promoter and achieve gene expression. This system has been used successfully in tobacco, oilseed rape (Sweetman et al., 1997; Tomsett et al., 1997) and tomato (Garoosi et al., 1997; Tomsett et al., 1997). Another example of a switch system based on heterologous transcription factors will be described later in the nuclear receptor section. Although the utility of these systems for research purposes has been documented, a number are not tightly regulated, exhibit low levels of inducible expression or utilize chemistry which is phytotoxic or incompatible with agricultural use.

NUCLEAR RECEPTORS Nuclear receptors are a large well-defined family of transcription factors with over 150 members. Although the presence of lipophilic hormones in mammalian and insect systems has been established for many years, the first nuclear receptors (glucocorticoid and oestrogen receptors) were not isolated until the mid-1980s (Mangelsdorf et al., 1995). Members of the steroid/retinoic acid/thyroid receptor superfamily have been isolated from both invertebrates and vertebrates and include receptors with different developmental functions. Many of these receptors lack a recognized ligand and are known as orphan receptors. The nuclear receptor superfamily encompasses four classes of receptors (Mangelsdorf et al., 1995). Class I are the steroid receptors which generally form homodimers. These receptors are bound by heat-shock proteins (Hsp70, Hsp90) and p59 to form a complex in the cytoplasm (e.g. glucocorticoid receptor (GR)). When bound by ligand, the receptor is released from the complex allowing translocation into the nucleus and binding to a cognate response element as a dimer (see Evans, 1988; Beato, 1991; Green and Chambon, 1988, for reviews). These receptors are only found in vertebrates and thus represent a new evolutionary branch of the superfamily (Mangelsdorf et

03 Inducible Gene 03

3/9/99 12:20 PM

Page 25

Ecdysteroid Agonist-inducible Control

25

al., 1995). Class II receptors, or retinoic-X receptor (RXR) heterodimers, are those belonging to the retinoic/thyroid receptor family. These receptors may interact with response elements as heterodimers. Class II receptors are normally found bound to DNA in the absence of ligand (Mangelsdorf et al., 1995). An example of class II receptors is in the ecdysteroid receptor (EcR) of insects which interacts with ultraspiracle (USP; insect homologue of RXR) to form a heterodimer responsive to ecdysone (Yao et al., 1992, 1993). Class III receptors or dimeric orphan receptors, bind as homodimers to direct repeats in the target promoter. Examples of this family are RXR or COUP (chicken ovalbumin upstream promoter transcription factor-1). Finally, Class IV, or monomeric orphan receptors, bind to extended core site, an example of which is SF1 (Mangelsdorf et al., 1995). Nuclear receptors have six different protein domains (Fig. 3.1a) (see Evans, 1988; Beato, 1991; Green and Chambon, 1988; Mangelsdorf et al., 1995 for reviews). Domains A and B are involved in ligand-independent transactivation. The DNA-binding domain, or domain C, is the best conserved region within the superfamily. This domain is between 66 and 68 amino acids long and has eight invariant cysteine residues implicated in the formation of zinc fingers which are responsible for interacting with DNA response elements. This domain also contributes to dimer formation. Domain D, or the hinge region, is variable and contains the sequences required for direct targeting to the nucleus. The ligandbinding domain is also well-conserved and is not only involved in interactions with ligands but also in dimerization and ligand-dependent activation. The F domain is highly variable in size, and has yet to be ascribed a function. The domain structure of the nuclear receptors make them ideal candidates for engineering of novel receptors with unique behaviour.

Inducible nuclear receptor systems in mammalian systems The use of a number of nuclear receptors for chemical-inducible transcription control has been illustrated in animal cells. Chimeric receptors based on a fusion of the Drosophila ecdysone ligand-binding domain with the glucocorticoid receptor (GR) DNA-binding domain were shown to activate reporter gene activity in HEK 293 and CV-1 cells in the presence of muristeroneA (an ecdysone agonist) (Christopherson et al., 1992). Activation levels were modulated by altering the transactivation domain of the chimeric receptor (Christopherson et al., 1992). The whole Drosophila EcR has been transformed into Chinese hamster ovary (CHO) cells. Addition of ponasteroneA (an ecdysone agonist) resulted in reporter gene activation (Yang et al., 1995), however, levels of activation were not high due to the reliance of the system on the weak transactivation domain of the EcR. No et al. (1996) recently constructed chimeric receptors based on the Drosophila ecdysone ligandbinding domain. The chimeric receptors contain strong transactivator sequences and a modified GR DNA-binding region. The expression levels in

03 Inducible Gene 03

26

3/9/99 12:20 PM

Page 26

A. Martinez and I. Jepson

Fig. 3.1. (a) Nuclear receptor structure. The receptors have six different domains: (A and B) transactivation domain; (C) DNA-binding domain; (D) hinge domain; (E) ligand-binding domain; and (F) C-terminus. (b) Ecdysteroids. MuristeroneA and 20hydroxyecdysone. (c) Non-steroidal compound belonging to the dibenzylhydrazine chemistry. RH5992 (Tebufenozide).

transformed mammalian cells were elevated by 20,000-fold following treatment with muristeroneA. This system was shown to activate gene expression in transgenic mice after the application of muristeroneA. Finally, a progesterone receptor (PR)-based transcription control system has been described (Wang et al., 1997) based on a PR mutant which activates gene expression in the presence of RU486 (an antiprogestin) (Vegeta et al., 1992). Here, the altered specificity ligand-binding domain was fused to the GAL4 DNA-binding domain and a strong transactivator sequence and was shown to activate gene

03 Inducible Gene 03

3/9/99 12:20 PM

Page 27

Ecdysteroid Agonist-inducible Control

27

expression in liver cells of transgenic mice by up to 33,000-fold following application of RU486 (Wang et al., 1997). Both systems used in transgenic mice have been optimized to reduce background levels and have high inducible levels in host cells. The work in mammalian systems has exemplified the modular nature of nuclear receptors and the advantages of manipulating these receptors. In plants, nuclear receptors have been used to control gene expression, and both transcriptional and post-translational approaches have been studied.

Transcriptional control Initial work in tobacco protoplasts demonstrated that expression of the rat glucocorticoid receptor in plants activated reporter gene activity in the presence of dexamethasone (Schena et al., 1991). However, the levels of induced activity were very low when compared to 35S CaMV:CAT controls. Transgenic plants containing the GR failed to induce in the presence of dexamethasone (Lloyd et al., 1994). An alternative system has been recently described in which the GAL4 DNA-binding domain was fused to the herpes simplex VP16 transactivation domain and the GR ligand-binding domain. Arabidopsis and tobacco transgenic plants containing VP16-GAL4-GR were induced with micromolar amounts of dexamethasone (Aoyama and Chua, 1997). Further development of chimeric receptors has used lacI mutants fused to transactivation domain of GAL4 and the GR ligand-binding domain (Moore et al., 1997). The mutant lacI sequences confer high binding affinity to operator sequences (Lehming et al., 1987, 1990). Expression levels in transformed Arabidopsis protoplasts were elevated in the presence of dexamethasone while in the absence of ligand the system remained silent (Moore et al., 1997). These systems show the utility of the nuclear receptor transcriptional control in plants. However, the nature of the GR-inducing compounds (agonists to mammalian glucocorticoid hormone) will restrict their use to research applications.

Post-transcriptional control Steroid receptor ligand-binding domains are amenable to use in the posttranscriptional control of gene expression. In this approach the GR ligandbinding domain is fused to transcription factors controlling plant development. The GR ligand-binding domain fusion causes compartmentalization of the transcription factor in the cytoplasm due to the binding of heat-shock proteins to GR sequences. The transcription factor fusion is released and translated into the nucleus upon inducer interaction with GR ligand-binding domain, where it binds to and activates target genes. This approach has been shown to work in fusions with transcription factors controlling trichoma development (Lloyd et al., 1994), leaf morphology (Aoyama et al., 1995) and flowering time (Simon et

03 Inducible Gene 03

3/9/99 12:20 PM

28

Page 28

A. Martinez and I. Jepson

al., 1996). The GR ligand-binding domain fusions show the flexibility of nuclear receptor components to control gene activity in plants. Although this approach is useful for research studies, it is limited to the regulation of transcription factors and it is difficult to assess the required amounts of transcription factor to deliver the effect.

ECDYSONE RECEPTORS The pleiotropic effect of the moulting hormone, 20-hydroxyecdysone (herein ecdysone) in insects, has been the focus of study for many decades. Ashburner et al. (1974 and references therein) showed that the addition of ecdysone to Drosophila third instar larvae salivary glands resulted in the induction of two sets of genes. The ‘early genes’ are induced upon addition of ecdysone and are necessary for the induction of the ‘late genes’. The induction of early gene expression is mediated by the ecdysone receptor which when bound by ligand activates transcription (Yao et al., 1993). The ecdysteroid receptor (EcR) was first isolated from Drosophila melanogaster and has been shown to be a member of the steroid/retinoic/ thyroid receptor superfamily (Koelle et al., 1991). A number of homologues have been isolated from other insects which show strong similarity to the Drosophila EcR. However, only the Drosophila (Koelle et al., 1991; Thomas et al., 1993; Yao et al., 1992, 1993) and Bombyx mori (Swevers et al., 1996) EcRs have been shown to be functional. We have isolated the Heliothis virescens EcR homologue by a combination of degenerate polymerase chain reaction (PCR), library screening and 5′RACE (Martinez et al., 1999). Figure 3.2 shows the alignment of the hinge and ligandbinding domains of the Drosophila, Bombyx and Heliothis EcR proteins. The Drosophila (Thomas et al., 1993; Yao et al., 1992, 1993), Bombyx (Swevers et al., 1996), Chironomus tentans (Elke et al., 1997), Aedes aegipti (Kapitskaya et al., 1996), Choristoneura fumiferana (Kothapalli et al., 1995) and Heliothis virescens (Martinez et al., 1999) EcR proteins have been shown to form a heterodimer with ultraspiracle (USP) suggesting that all these ecdysteroid receptors are part of the active ecdysone receptor. The EcR–USP complex binds ecdysone and subsequently activates reporter gene expression in mammalian cells (Yao et al., 1992, 1993). Yao et al. (1993) showed that EcR complexed with RXR, the mammalian counterpart of USP, was able to bind muristeroneA (an agonist of ecdysone, see below) but unable to bind ecdysone. The binding of muristeroneA to EcR–RXR is at lower affinity when compared to muristeroneA binding to the EcR–USP complex. Similar data have been obtained with the Heliothis EcR receptor in Chinese hamster ovary (CHO) cells in the presence of muristeroneA (Martinez et al., 1999). A chimeric receptor, containing the GR transactivation and DNA-binding domain fused to the hinge and ligand-binding domains of Drosophila EcR (Christopherson et al., 1992) or Heliothis EcR, were shown to activate reporter gene expression in mammalian cells in the presence of muristeroneA (Fig. 3.3) but did not activate expression in the presence of ecdysone.

03 Inducible Gene 03

3/9/99 12:20 PM

Page 29

Ecdysteroid Agonist-inducible Control

29

Fig. 3.2. Alignment of ecdysone ligand-binding domains from EcR proteins shown to be active. Bombyx mori (BmLBD, Swevers et al., 1995), Drosophila melanogaster (DmLBD, Koelle et al., 1991) and Heliothis virescens (HvLBD, Martinez et al., 1999). The sequence in bold is that of the ligand-binding domain (Domain E). Multiple sequence alignment was carried out using CLUSTAL in PCGENE version 1.0. * indicates residues are identical. . indicates conserved substitution.

ECDYSONE AGONISTS Ecdysteroid compounds Plants are a rich source of agonists of 20-hydroxyecdysone. One such compound is muristeroneA which was isolated from Ipomeoea calonyction. Blackford and coworkers (Blackford et al., 1996; Blackford and Dinan, 1997) have assayed a number of plants in order to ascertain the distribution of ecdysteroidal active compounds in the plant kingdom (Table 3.1). Two assay

03 Inducible Gene 03

30

3/9/99 12:20 PM

Page 30

A. Martinez and I. Jepson

Fig. 3.3. Ecdysone agonist transcriptional activation of reporter gene in mammalian cells. HEK 293 cells transfected with reporter and chimeric receptor show activation of lacZ reporter gene following treatment with 10 mM muristeroneA and 20 mM RH5992 mimic. The chimeric receptor contains the transactivation and DNA-binding domain of GR fused to the ligand-binding domain of the Heliothis ecdysteroid receptor.

systems were adopted. The first relies on immunodetection of ecdysteroid compounds, while the second is based on a cell division bioassay using Drosophila Kc cells. A number of plants have been found to contain ecdysteroidal compounds as judged by both assay methods. While certain species contain relatively high levels of ecdysone agonists, crop plants appear not to contain significant levels of these compounds. The Drosophila Kc cell bioassay has been used to determine the activity of purified ecdysteroids and was found to be a sensitive system for determination of ecdysone agonists (Harmatha and Dinan, 1997) and a good indicator of ecdysone agonist activity (Blackford et al., 1996). While these steroidal agonists are important to gain further understanding on ligand/receptor interactions, they are not suitable candidates for insecticides or transcription system triggers.

Non-steroidal compounds Steroidal compounds are complex, expensive to produce, hydrophilic in nature and detoxification processes in insects are well adapted to deal with them (Hsu, 1991). Despite efforts to discover non-steroidal chemistry mimicking the activity of ecdysone, little advance has been made until recently. A number of compounds from the dibenzylhydrazine chemistry have been shown to have insecticidal activity (Wing, 1988). These compounds bind with high affinity to

03 Inducible Gene 03

3/9/99 12:20 PM

Page 31

Ecdysteroid Agonist-inducible Control

31

Table 3.1. Activity of plant extracts and purified ecdysteroid. Plant

Beta vulgaris ssp. maritima Brassica oleracea cv. botrytis Brassica oleracea cv. capitata Lycopersicon esculentum Solanum tuberosum Dianthus caryophyllus Gossipium hirsutum Helianthus annus Brassica napus Oryza sativa Zea mays Sorghum bicolor Glycine max Nicotiana tabacum 20-Hydroxyecdysone PonasteroneA MakisteroneA a,

Common name

Radioimmunoassaya

Drosophila Kc cells

Sea beet

–

–

Blackford and Dinan, 1997

Cauliflower

–

–

Blackford and Dinan, 1997

Cabbage Tomato Potato Carnation Cotton Sunflower Rape, oilseed rape Rice Maize Sorghum Soybean Tobacco

– – – – 0.071 0.093 –

– – – – – – –

Blackford and Dinan, 1997 Blackford and Dinan, 1997 Blackford and Dinan, 1997 Blackford and Dinan, 1997 Blackford et al., 1996 Blackford et al., 1996 Blackford et al., 1996

0.094 – – – NL nt nt nt

– – – – – 7.5 3 1029 Mb 3.1 3 10210 Mb 1.3 3 1028 Mb

Reference

Blackford et al., 1996 Blackford et al., 1996 Blackford et al., 1996 Blackford et al., 1996 Blackford et al., 1996 Harmatha and Dinan, 1997 Harmatha and Dinan, 1997 Harmatha and Dinan, 1997

µg ecdysone equivalents g21 dry weight; b, ED50; NL, non-linear response; nt, not tested; 2, negative.

ecdysone receptors from insects (Wing, 1988; Wing et al., 1988; Dhadialla and Tzertzinis, 1997). The compounds when applied to growing larvae cause premature head encapsulation, preventing feeding, which leads to death (Wing, 1988). RH5992 (Fig. 3.1b) is a highly substituted member of the family with high activity in lepidopteran species (Carlson et al., 1992). This compound has a narrow spectrum of activity. Two other compounds are in development, RH0345 (Heller et al., 1992) and RH2485 (Carlson et al., 1996; Le et al., 1996), both of which have a different spectrum of activities. Other non-steroidal compounds have been reported in the literature, 3,5di-tert-butyl-4-hydroxy-N-isobutyl-benzamide (DTBHIB) (Mikitani, 1996) and 8-O-acetylharpagide (Elbrecht et al., 1996), but these show poor affinity when compared to ecdysone in cell extracts containing the Drosophila ecdysone receptor. The use of dibenzylhydrazines to control gene expression offers advantages over ecdysteroidal compounds as they are non-phytotoxic yet stable enough for use in the field.

ECDYSONE RECEPTOR SWITCH (ERS) The use of nuclear receptors to control gene transcription has been demonstrated in plants and discussed previously (Schena et al., 1991; Aoyama

03 Inducible Gene 03

32

3/9/99 12:20 PM

Page 32

A. Martinez and I. Jepson

and Chua, 1997; Moore et al., 1997). The systems described use dexamethasone, a steroidal compound which is unsuitable for field use. The ecdysone receptor presents an approach to design a novel inducible system for plants. The system is based on two components. The first component, the effector cassette, is a chimeric receptor containing the GR-transactivation and DNA-binding domain fused to the Heliothis EcR ligand-binding domain (Fig. 3.4). The second component, or reporter cassette, has six copies of the glucocorticoid response element (GRE) fused to the 260 minimal 35S CaMV promoter and βglucuronidase (GUS) gene (Fig. 3.4). A chimeric ecdysone receptor-based system has a number of attractive features as a gene switch. Synthetic, non-steroidal and non-phytotoxic chemistry is available and the system is modular in nature and may be modified. For example, the basal level can be manipulated by altering the minimal promoter context. Furthermore, the use of the GR components favours homodimer formation and thus negates the requirement of USP, the natural partner of EcR.

Transient expression of ecdysone chimeric receptor in maize protoplasts The effector and reporter constructs (Fig. 3.4) were tested in both maize and tobacco protoplasts in the presence of RH5992. Figure 3.5 shows that, in the absence of inducer, low levels of GUS expression were observed. Following treatment of maize and tobacco protoplasts with 100 mM or 10 mM RH5992, respectively, a significant increase in gene expression was observed. The absolute levels of expression observed in maize and tobacco protoplasts were 10% that of the 35S CaMV:GUS controls. These levels are similar to those reported in tobacco protoplasts transformed with GR (Schena et al., 1991). These data demonstrate the system functions in both monocotyledonous and dicotyledonous cells.

Transformation of tobacco with ERS The activation of reporter gene activity in protoplasts by the effector construct containing the Heliothis EcR ligand-binding domain showed the potential of the ERS system. However, Lloyd et al. (1994) reported that GR was also capable of inducing reporter gene expression in protoplasts but not in transgenic plants. This may be a result of poor transactivating potency of the GR sequences. In order to address this, we constructed a new effector cassette containing the strong transactivator domain from herpes simplex VP16 protein (Fig. 3.6) which has been shown to function in plants (Ma et al., 1988; Wilde et al., 1994; Aoyama et al., 1995; Weinmann et al., 1994; Aoyama and Chua, 1997). The effector and reporter gene cassettes were transferred to a Bin19 plant transformation vector to give pERS3.

03 Inducible Gene 03

3/9/99 12:21 PM

Page 33

Ecdysteroid Agonist-inducible Control

33

Fig. 3.4. The effector construct consists of transactivation and DNA-binding domains of the GR fused to the hinge and ligand-binding domains of Heliothis EcR. The reporter construct contains six repeats of glucocorticoid response element (GRE) fused to the 260 minimal 35S CaMV promoter and the reporter gene βglucoronidase.

Transgenic plant analysis Agrobacterium-mediated transformation with pERS3 yielded a transgenic plant population containing 60 independent transformants. PCR, using primer pairs 1–2 and 3–4 (Fig. 3.6), revealed 38 plants containing both effector and reporter cassettes. Seed was collected from and screened for reporter gene activity in the presence of RH5992 (0.1 mM). The assay system involved growing seed from the primary transformants in the presence or absence of inducer. The germinated seedlings were collected 2 days post-germination and GUS activity compared between induced and uninduced treatments

03 Inducible Gene 03

34

3/9/99 12:21 PM

Page 34

A. Martinez and I. Jepson

Fig. 3.5. RH5992 activates reporter gene expression in both maize and tobacco. (a) Maize protoplasts, transformed with both effector and reporter constructs, show activation of GUS reporter gene activity. RH5992 was applied at 100 mM. (b) Tobacco protoplasts were transformed with the dicot version of the effector and reporter constructs. The tobacco protoplast growth media was supplemented with 10 mM of RH5992. GUS activity is expressed as nmol 4-methylumbelliferyl h21 mg21 protein.

(Jefferson et al., 1987). The screen indicated that nine primary transgenic plants did not induce whilst two demonstrated constitutive GUS activity. Twenty-three plants were found to induce GUS activity in the presence of RH5992 ranging from 20 to 150% that of 35S CaMV:GUS seedlings. The induction levels observed throughout the population varied between two- and 430-fold. An example of one transgenic line is shown in Fig. 3.7. High inducibility of the GUS reporter gene was observed following treatment with muristeroneA and RH5992. Phenoxycarb, a juvenile hormone (JH) agonist, does not induce GUS activity even when applied at high levels (0.13 mM). The treatment of ERS3 plants with ecdysone has a small but significant effect on GUS reporter gene expression. The lack of a stronger ecdysone effect in ERS plants may be explained by the requirement for USP by EcR for efficient activation (Thomas et al., 1993; Yao et al., 1992, 1993). Ecdysone treatment of animal cells transfected with similar chimeric constructs failed to activate reporter gene activity (Christopherson et al., 1992), it is perhaps due to the metabolism of ecdysone in tobacco that renders it a better activator than expected. The GUS activity observed in transgenic seedlings treated with muristeroneA and RH5992 is comparable to that of 35S CaMV:GUS transgenic seedlings. The activity observed in plants is higher than that observed in transients and is likely to be due to the presence of VP16 in the modified effector construct. Similar results were observed in transients experiments with the VP16 chimeric receptor (data not shown). It is

03 Inducible Gene 03

3/9/99 12:21 PM

Page 35

Ecdysteroid Agonist-inducible Control

35

Fig. 3.6. ERS plant transformation vector. The effector and reporter cassettes were combined in a pBin19-based vector to give pEGS3. LB and RB denotes the left and right borders of the construct. Arrows denote the PCR primer positions.

important to note that the inducible GUS activity is from a segregating population of ERS3 seed while the 35S CaMV:GUS plants are homozygous. This implies that in homozygous ERS3 seedlings the RH5992 may exhibit improved inducibility with lower variability.

Ligand induction of ERS is dose dependent The effect of muristeroneA and RH5992 on reporter gene activity of a selected ERS3 plant is shown in Fig. 3.8. The experiment shows that RH5992 has a higher affinity for the chimeric receptor than muristeroneA, where maximal induction was observed with muristeroneA at 75 mM and RH5992 at 25 mM. The IC 50 (amount of compound required for 50% induction) was observed to be 7.5 mM for muristeroneA and 2 mM for RH5992. Comparisons between muristeroneA affinity and the non-steroidal compounds in insect systems have not been reported. However, it has been established that a homodimer of EcR binds muristeroneA with lower affinity than the native receptor (EcR/USP).

03 Inducible Gene 03

36

3/9/99 12:21 PM

Page 36

A. Martinez and I. Jepson

Fig. 3.7. Seed from EGS3-37 plant were grown for 2 days post-germination in the presence or absence of the following compounds: DMSO (1.8% v/v); muristeroneA (0.4 mM); RH5992 (0.05 mM); 20-hydroxyecdysone (0.1 mM); and phenoxycarb (0.13 mM). GUS activity is expressed as nmol 4-methyl umbelliferyl h21 mg21 protein.

Induction of ERS is specific The ERS can be activated by certain ecdysone agonists but not others. This has been demonstrated by the lack of activation in the presence of ecdysone, makisteroneA and ponasteroneA in maize protoplasts transformed with effector and reporter plasmid (data not shown). The data indicate that the chimeric ecdysone receptor has different ligand specificity to that of the native insect ecdysone receptor. The narrow specificity of the chimeric homodimeric receptor may be an advantage when the ERS is introduced into plant species containing endogenous ecdysteroids. Environmental factors may interfere with the activity of an inducible system by triggering activation when it is not required. To address this, an ERS3 line was subjected to a number of stresses. Two-day-old seedlings were subjected to 24 h 4°C incubation, heat-shock at 40°C for 2 h followed by 12 h recovery and 12 h heat-shock at 40°C with no recovery. The three replicate samples of ten seedlings were collected and assayed for GUS activity (Jefferson et al., 1987) following exposure to stress conditions. None of the treatments induced GUS activity above control seedling levels (data not shown). Six-week-old greenhouse ERS3 plants were wounded (second leaf was cut from midrib to edge six times each 1 cm apart), grown under waterlog or drought conditions. Samples from droughttreated, wounded and control leaves were taken 24 h post-treatment. Plant roots were submerged for 48 h and then samples were collected from leaves of the treated and untreated plant. All samples were assayed for GUS activity (Jefferson et al., 1987). The abiotic stresses tested to date give no induction of the ERS.

03 Inducible Gene 03

3/9/99 12:21 PM

Page 37

Ecdysteroid Agonist-inducible Control

37

Fig. 3.8. A dose response for a steroidal and non-steroidal inducer of the ecdysone receptor switch. Seeds from EGS3-44 plant were grown for 2 days in the presence of different amounts of muristeroneA or RH5992. The concentration of the compounds ranged from 0.1 mM to 100 nM. GUS activity is expressed as nmol 4-methyl umbelliferyl h21 mg21 protein.

CONCLUSIONS The experiments shown here demonstrate the use of the ecdysone-based transcription control system. We have shown that the ERS system activates reporter gene activity in the presence of inducer in protoplasts isolated from both monocotyledonous and dicotyledonous species. ERS-transformed tobacco plants treated with micromolar levels of a commercial ecdysteroid agonist RH5992 show comparable levels of expression to that seen with a strong constitutive promoter (35S CaMV:GUS). The ERS system is specific to ecdysone agonists and environmental factors (drought, water logging, high and low temperature, and wounding) do not trigger activation of the system. The ERS provides the basis for a plant-inducible system which has broad utility for both basic research and commercial applications.

ACKNOWLEDGEMENTS The authors acknowledge the support of Zeneca Agrochemicals in conducting this work. We also thank P. Broad, D. Scanlon, S. Green (Zeneca Pharmaceuticals), D. Pearson, B. Gross, P. Drayton, C. Sparks, J. Thompson and A. Greenland (Zeneca Agrochemicals) for discussions and practical help.

03 Inducible Gene 03

3/9/99 12:21 PM

38

Page 38

A. Martinez and I. Jepson

REFERENCES Aoyama, T. and Chua, N.-M. (1997) A glucocorticoid-mediated transcriptional induction system for transgenic plants. The Plant Journal 11, 605–612. Aoyama, T., Dong, C.-H., Wu, Y., Carabelli, M., Sessa, G., Ruberti, I., Morelli, G. and Chua, N.-H. (1995) Ectopic expression of the Arabidopsis transcriptional activator Athb-1 alters leaf cell fate in tobacco. Plant Cell 7, 1773–1785. Ashburner, M., Chihara, C., Meltzer, P. and Richards, G. (1974) Temporal control of puffing activity in polytene chromosomes. Cold Spring Harbor Symposium. Quantitative Biology 38, 655–662. Beato, M. (1991) Transcriptional control by nuclear receptors. Federation of American Societies for Experimental Biology Journal 5, 2044–2051. Blackford, M. and Dinan, L. (1997) The tomato moth Locanobia oleracea (Lepidoptera: Noctuidae) detoxifies ingested 20-hydroxyecdysone, but is susceptible to the agonist RH5849 and RH5992. Insect Biochemistry and Molecular Biology 27, 167–177. Blackford, M., Clarke, B. and Dinan, L. (1996) Tolerance of the Egyptian cotton leafworm Spodoptera littoralis (Lepidoptera: Noctuidae) to ingested phytoecdysteroids. Journal of Insect Physiology 42, 931–936. Carlson, G.R., Aller, H.E., Ramsay, R., Slawecki, R., Thirugnanam, M. and Wing, K. (1992) The insecticidal properties of non-steroidal ecdysone agonists. In: X Ecdysone workshop, Liverpool, April 6–9, 1992, p. 31. Carlson, G.R., Dhadialla, T.S., Ramsay, J.R., Thirugnanam, M., James, W.N., Aller, H.E., Hunter, R., Le, D.P. and Lidert, Z. (1996) New ecdysteroid agonist. In: XII Ecdysone workshop, Barcelona, July 22–26, 1996, p. 39. Christopherson, K.S., Melanie, M.R., Bajaj, V. and Godowski, P.J. (1992) Ecdysteroiddependent regulation of genes in mammalian cells by a Drosophila ecdysone receptor and chimeric transactivators. Proceedings of the National Academy of Sciences USA 89, 6314–6318. Dhadialla, T.S. and Tzertzinis, G. (1997) Characterisation and partial cloning of ecdysteroid receptor from a cotton boll weevil embryonic cell line. Archive Insect Biochemistry Physiology 35, 45–57. Elbrecht, A., Chen, Y., Jurgen, T., Hensens, O.D., Zink, B.L., Beck, H.T., Balick, M.J. and Borris, R. (1996) 8-O-Acetylharpagide is a nonsteroidal ecdysteroid agonist. Insect Biochemistry and Molecular Biology 26, 519–523. Elke, C., Vogtli, M., Rauch, P., Spindle-Barth, M. and Lezzi, M. (1997) Expression of EcR and USP in Escherichia coli: purification and functional studies. Archive Insect Biochemistry Physiology 35, 59–69. Evans, R.M. (1988) The steroid and thyroid hormone receptor superfamily: transcriptional regulators of development and physiology. Science 240, 889–895. Garoosi, G.A., Salter, M.G., Collin, H.A., Caddick, M.X. and Tomsett, A.B. (1997) The use of an inducible gene expression cassette for transgenic tomato. Journal of Experimental Botany 48S, 51. Gatz, C. (1996) Chemically inducible promoters in transgenic plants. Current Opinion in Biotechnology 7, 168–172. Gatz, C., Frohberg, C. and Wendenburg, R. (1992) Stringent repression and homogeneous de-repression by tetracycline of a modified CaMV 35S promoter in intact transgenic tobacco plants. The Plant Journal 2, 397–404. Green, S. and Chambon, P. (1988) Nuclear receptors enhance our understanding of transcriptional regulation. Trends in Genetics 4, 309–314.

03 Inducible Gene 03

3/9/99 12:21 PM

Page 39

Ecdysteroid Agonist-inducible Control

39

Harmatha, J. and Dinan, L. (1997) Biological activity of natural and synthetic ecdysteroids in the BII Bioassay. Archive Insect Biochemistry Physiology 35, 219–225. Heller, J.J., Mattioda, H., Klein, E. and Sagenmuller, A. (1992) Proceedings of the 1992 Brighton Crop Protection Conference – Pest and Diseases. British Crop Protection Council, Farnham Royal, pp. 59–65. Hsu, A.C.-T. (1991) 1,2-Diacyl-1-alkylhydrazines, A new class of insect growth regulator. In: Synthesis and Chemistry of Agrochemicals. American Chemical Society, pp. 478–490. Jefferson, R.A., Kavanagh, R.H. and Bevan, M.W. (1987) GUS fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. The EMBO Journal 8, 3901–3907. Jepson, I., Lay, V.J., Holt, D.C., Bright, S.W.J. and Greenland, A.J. (1994a) Cloning and characterisation of maize herbicide safener-induced cDNAs encoding subunits of glutathione S-transferase isoforms I, II and IV. Plant Molecular Biology 26, 1855–1866. Jepson, I., Bell, P., Bright, S., Holt, D., Wright, S. and Greenland, A. (1994b) Control of gene expression in transgenic plants using a chemically inducible promoter. Journal of Cellular Biochemistry 18A, 110. Kapitskaya, M., Wang, S., Cress, D.E., Dhadialla, T.S. and Raikhel, A.S. (1996) The mosquito ultraspiracle homologue, a partner of ecdysteroid receptor heterodimer: cloning and characterisation of isoforms expressed during vitellogenesis. Molecular and Cellular Endocrinology 121, 119–132. Koelle, M.R., Talbot, W.S., Segraves, W.A., Bender, M.T., Cherbas, P. and Hogness, D.S. (1991) The Drosophila EcR gene encodes an ecdysone receptor, a new member of the steroid receptor superfamily. Cell 67, 59–77. Kothapalli, R., Palli, S.R., Ladd, T.R., Sohi, S.S., Cress, D., Dhadialla, T.S., Tzertzinis, G. and Rethakaran, A. (1995) Cloning and developmental expression of the ecdysone receptor gene from the spruce budworm, Choristoneura fumiferana. Developmental Genetics 17, 319–330. Le, D.P., Thirugnanam, M., Lidert, Z., Carlson, G.R. and Byan, J.B. (1996) RH2485: a new selective insecticide for caterpillar control. Brighton Crop Protection Conference, Pest and Diseases 1996. British Crop Protection Council, Farnham Royal, pp. 481–486. Lehming, N., Sartoris, J., Niemoeller, M., Genenger, G., Wilcken-Bergmann, V. and Mueller-Hill, B. (1987) The interaction of the recognition helix of the lac operator. The EMBO Journal 6, 3145–3153. Lehming, N., Sartoris, J., Kisters-Woike, B., Wilcken-Bergmann, V. and Mueller-Hill, B. (1990) Mutant lac repressors with new specificities hint at rules for protein–DNA recognition. The EMBO Journal 9, 615–621. Lloyd, A.M., Schena, M., Walbot, V. and Davis, R.W. (1994) Epidermal cell fate determination in Arabidopsis: patterns defined by a steroid inducible regulator. Science 266, 436–439. Ma, J., Przibilla, E., Hu, J., Bogorad, L. and Ptashne, M. (1988) GAL4-VP16 is an unusually potent transcriptional activator. Nature (London) 334, 631–633. Mangelsdorf, D.J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P. and Evans, R. (1995) The nuclear receptor superfamily: the second decade. Cell 83, 835–839. Martinez, A,. Scanlon, D., Gross, B., Perara, A., Palli, S.R., Greenland, A., Windass, J., Pongs, O., Broad. P. and Jepson, I. (1999) Transcriptional activation of the cloned Heliothis virescens (Lepidoptera) ecdysteroid receptor (HvEcR) by muristeroneA. Insect Biochemistry and Molecular Biology (submitted).

03 Inducible Gene 03

40

3/9/99 12:21 PM

Page 40

A. Martinez and I. Jepson

Masgrau, C., Altabella, T., Farras, R., Flores, D., Thompson, A.J., Besford, R.T. and Tiburcio, A.F. (1997) Inducible overexpression of oat arginine decarboxylase in transgenic tobacco plants. The Plant Journal 11, 465–473. Mett, V.L. Lockhead, L.P. and Reynolds, P.H.S. (1993) Copper-controllable gene expression system for whole plants. Proceedings of the National Academy of Sciences USA 90, 4567–4571. Mikitani, K. (1996) A new nonsteroidal class of ligand for the ecdysteroid receptor 3,5di-tert-butyl-4-hydroxy-N-isobutyl-benzamide shows apparent insect molting hormone activities at molecular and cellular levels. Biochemical and Biophysical Research Communications 227, 427–432. Moore, I., Baroux, C., Gaelweiter, L., Grosskopt, D., Mader, P., Schell, J. and Palme, K. (1997) A transactivation system for regulating expression of transgenes in whole plants. Journal of Experimental Botany 48S, 51. No, D., Yao, T.-P. and Evans, R.M. (1996) Ecdysone inducible gene expression in mammalian cells and transgenic mice. Proceedings of the National Academy of Sciences USA 93, 2246–3351. Schena, M., Lloyd, A.M. and Davis, R.W. (1991) A steroid-inducible gene expression system for plant cells. Proceedings of the National Academy of Sciences USA 88, 10421–10425. Simon, R., Igeno, I.-M. and Coupland, G. (1996) Activation of floral meristem identity genes in Arabidopsis. Nature 384, 59–62. Sweetman, J.P., Paine, J.A.M., Greenland, A.J., Jones, H. and Jepson, I. (1997) Characterisation of an ethanol inducible gene switch in tobacco and oil seed rape. Journal of Experimental Botany 48S, 52. Swevers, L., Drevet, J.R., Lunke, M.D. and Iatrou, K. (1995) The silkmoth homolog of the Drosophila ecdysone receptor (B1 isoform): cloning and analysis of expression during follicular cell differentiation. Insect Biochemistry and Molecular Biology 25, 857–866. Swevers, L., Cherbas, L., Cherbas, P. and Iatrou, K. (1996) Bombyx EcR (BmEcR) and Bombyx USP (BMCF1) combine to form a functional ecdysone receptor. Insect Biochemistry and Molecular Biology 26, 217–221. Thomas, H.E., Stunnenberg, H.G. and Steward, A.F. (1993) Heterodimerisation of the Drosophila ecdysone receptor with retinoid X receptor and ultraspiracle. Nature 362, 471–475. Tomsett, A.B., Salter, M.G., Garoosi, G.A., Caddick, M.X., Paine, J.A.M., Sweetman, J., Greenland, A.J. and Jepson, I. (1997) A chemically-inducible gene cassette for transgenic plants. Journal of Experimental Botany 48S, 46. Vegeta, E., Allan, G.T., Schrader, W.T., Tsai, M.-J., McDonnell, D.P. and O’Malley, B.W. (1992) The mechanism of RU486 antagonism is dependent on the conformation of the carboxy-terminal tail of the human progesterone receptor. Cell 69, 703–713. Wang, Y., DeMayo, F.J., Tsai, S.Y. and O’Malley, B.W. (1997) Ligand-induced and liver expression in transgenic mice. Nature Biotechnology 15, 239–243. Weinmann, P., Gossen, M., Hillen, W., Bujard, H. and Gatz, C. (1994) A chimeric transactivator allows tetracycline-responsive gene expression in whole plants. The Plant Journal 5, 559–569. Wilde, R.J., Shufflebottom, D., Cooke, S., Jasinska, I., Merryweather, A., Beri, R., Brammar, W.J., Bevan, M. and Schuch, W. (1992) Control of gene expression in tobacco cells using a bacterial operator-repressor system. The EMBO Journal 11, 1251–1259.

03 Inducible Gene 03

3/9/99 12:21 PM

Page 41

Ecdysteroid Agonist-inducible Control

41

Wilde, R.J., Cooke, S.E., Brammar, W.J. and Schuch, W. (1994) Control of gene expression in plant cells using a 434:VP16 chimeric protein. Plant Molecular Biology 24, 381–388. Williams, S., Friedrich, L., Dincher, S., Carozzi, N., Kessmann, H., Ward, E. and Ryals, J. (1992) Chemical regulation of Bacillus thuringiensis d-endotoxin expression in transgenic plants. Biotechnology 10, 540–543. Wing, K.D. (1988) RH5948, a non steroidal ecdysone agonist: effects on a Drosophila cell line. Science 241, 467–469. Wing, K.D., Slawecki, R.A. and Carlson, G.R. (1988) RH5849, a nonsteroidal ecdysone agonist: effects on larval lepidoptera. Science 241, 470–472. Yang, G., Hannan, G.N., Lockett, T.J. and Hill, R.J. (1995) Functional transfer of an elementary ecdysone gene regulatory system to mammalian cells: transient transfections and stable cell lines. European Journal of Entomology 92, 379–389. Yao, T.P., Segraves, W.A., Oro, A.E., McKeown, M. and Evans, R.M. (1992) Drosophila ultraspiracle modulates ecdysone receptor function via heterodimer formation. Cell 71, 63–72. Yao, T.P., Forman, B.M., Jiang, Z., Cherbas, L., Chen, J.D., McKeown, M., Cherbas, P. and Evans, R.M. (1993) Functional ecodysone receptor is the product of EcR and ultraspiracle genes. Nature 366, 476–479.

03 Inducible Gene 03

3/9/99 12:21 PM

Page 42

04 Inducible Gene 04

3/16/99 11:09 AM

Page 43

Glucocorticoid-inducible Gene Expression in Plants

4

Takashi Aoyama Institute for Chemical Research, Kyoto University, Uji, Kyoto 611, Japan

INTRODUCTION Transgenic techniques have become a general approach in both basic and applied plant sciences. Many genes have been introduced into plants and expressed under the control of various promoters. Quite often ectopic overexpression of transgenes by a constitutively active promoter is sufficient to provide evidence of their actions. On the other hand, the judicious choice of the most appropriate promoter for transgene expression is critical in realizing the huge potential of transgenic plants. Many native promoters characterized in the literature can be used to express a transgene. Promoters active in specific cell types and responding to specific environmental stimuli or plant hormones are useful in limiting the location or the timing of transgene expression. Transgenic experiments with well-characterized promoters have actually provided us with valuable evidence for functions of plant genes. Although the use of native promoters is a promising way of expressing transgenes, other types of expression systems are still required for a variety of purposes. For example, in the case of a transgene product whose ectopic expression is toxic to plants, it is difficult to use native promoters acting either constitutively or at different developmental stages, because plants expressing the transgene cannot be maintained. A more common problem is the need to induce transgene expression without any pleiotropic effects on plants, i.e. the need to observe the effect of transgene expression. Transcriptional induction using native plant promoters responding to either environmental stimuli or plant hormones is necessarily accompanied by the normal physiological responses of the plant, which may complicate analysis of the effects of the transgenes. For these reasons, induction systems which differ from those © CAB International 1999. Inducible Gene Expression (ed. P.H.S. Reynolds)

43

04 Inducible Gene 04

44

3/16/99 11:09 AM

Page 44

T. Aoyama

normally found in plants, and which have no background level or pleiotropic effects, are highly desirable (for a review see Gatz, 1996). Three types of transcriptional induction systems have been developed as candidates for such an expression system. They are: (i) systems using the tetracycline repressor of the bacterial transposon TetR (Gatz et al., 1992; Weinmann et al., 1994); (ii) the copper ion-responding yeast transcription factor ACE1 (Mett et al., 1993); and (iii) the mammalian glucocorticoid receptor (GR) (Aoyama and Chua, 1997). This chapter describes the system using the GR regulatory mechanism. For many years, an induction system in plants based on GR has been thought of as ideal, since glucocorticoid is highly permeable in cells and has no detectable effects on plants. In fact, a system based on GR and glucocorticoid response elements (GREs) was used as an effective transient expression system in cultured plant cells (Schena et al., 1991), although the system did not work in transgenic plants (Lloyd et al., 1994). Recently, a novel glucocorticoidinducible transcription system that functions in transgenic plants has been developed, which uses only the hormone-binding domain (HBD) of the GR protein as a regulatory domain in a chimeric transcription factor (Aoyama and Chua, 1997). In the following sections, the regulation and utility of the GR HBD are outlined first. Then, the construction, use and characteristics of the glucocorticoid-inducible gene expression system are described. Finally, the potential of this steroid-inducible system as an ideal induction system in plants is discussed.

REGULATORY MECHANISM OF THE GR GR is a member of the nuclear receptor super-family. This family includes receptors for various hydrophobic ligands including thyroid hormones, vitamin D, retinoic acid and steroids (for reviews see: Evans, 1988; Green and Chambon, 1988; Beato, 1989; Laudet et al., 1992). Each nuclear receptor functions as the sensor for its ligand as well as a transcription factor regulating the expression of target genes by binding to specific cis-acting sequences. Nuclear receptors consist of at least four domains (Fig. 4.1a). The A/B and D domains function as a transactivating domain and a hinge domain, respectively. The DNA-binding (C) domain is the most conserved and contains two zinc finger structures which bind specific DNA sequences (Green et al., 1988; Umesono and Evans, 1989). The carboxyl terminal (E) domain plays a role in ligand-binding, dimerization, and transcriptional regulation (Rusconi and Yamamoto, 1987; Forman and Samuels, 1990). The E domains of hormone receptors are also called hormonebinding domains (HBDs). Many systems for the artificial regulation of gene expression have been developed which employ nuclear receptors and their specific cis-acting elements (Picard et al., 1990; No et al., 1996). Rather than using the nuclear receptors themselves, a more attractive approach for regulation of protein functions is to make use of the HBDs of

04 Inducible Gene 04

3/16/99 11:09 AM

Page 45

Glucocorticoid-inducible Gene Expression

45

(a) C9

N9 A/B

C

D

E (HBD)

(b) HSP90 complex Inactive

Functional domain

HBD

Hormone

Active Fig. 4.1. (a) General structure of nuclear receptor proteins (Evans, 1988; Green and Chambon, 1988; Forman and Samuels, 1990). The A/B, C and D domains function as a transactivating domain, a DNA-binding domain and a hinge domain, respectively. The E domain (HBD) plays a role in ligand binding, dimerization and regulation of transcription. (b) Model for the regulatory mechanism of HBDs (Picard et al., 1988; Beato, 1989; Picard, 1993, 1994). In the absence of hormone, the HBDs repress the function of sterically neighbouring domains by forming a complex with multiple proteins including the heat-shock protein HSP90 (inactive state). Hormone-binding releases the complex resulting in de-repression (active state).

steroid hormone receptors. HBDs can function as regulatory domains in cis with fusion proteins, as well as with their own receptors (Picard et al., 1988). A model of the regulatory mechanism of HBDs is illustrated in Fig. 4.1b. It is believed that, in the absence of ligands, HBDs repress the function of sterically neighbouring domains by forming a complex with multiple proteins including the heat-shock protein HSP90. Ligand binding releases the complex resulting in de-repression (Picard et al., 1988; Beato, 1989; Picard, 1993, 1994). Although the HSP90 complex is necessary for the regulation of HBDs, the interaction between the complex and the HBDs does not seem to be species-specific, since mammalian GR functions in other eukaryotes, including yeast and plants (Schena and Yamamoto, 1988; Schena et al., 1991). It is believed that this role of the HSP90 complex is evolutionarily conserved among eukaryotes (Stancato et al., 1996). Table 4.1 shows examples of experiments in which HBDs have been used for the regulation of heterologous proteins. The proteins listed include

Systems

References

E1A c-Myc Rev c-Fos c-Myb C/EBP v-Rel GATA-2 GAL4-VP16 MyoD c-Abl RafI GCN4 R ATHB1-VP16 Cre CO Fas GAL4-VP16

Transcription factor Transcription factor Post-transcriptional activator Transcription factor Transcription factor Transcription factor Transcription factor Transcription factor Transcription factor Transcription factor Tyrosine kinase Serine/threonine kinase Transcription factor Transcription factor Transcription factor Site-specific recombinase Putative transcription factor Cell surface receptor Transcription factor

GR ERa GR GR, ER ER GR, ER ER ER ER ER ER ER ER, MRb GR GR ER GR ER GR

Tissue culture cells Tissue culture cells Tissue culture cells Tissue culture cells Tissue culture cells Tissue culture cells Tissue culture cells Tissue culture cells Yeast Tissue culture cells Tissue culture cells Tissue culture cells Tissue culture cells Transgenic Arabidopsis Transgenic tobacco Tissue culture cells Transgenic Arabidopsis Tissue culture cells Transgenic plants

Picard et al., 1988 Eilers et al., 1989 Hope et al., 1990 Superti-Furga et al., 1991 Burk and Klempnauer, 1991 Umek et al., 1991 Boehmelt et al., 1992 Briegel et al., 1993 Louvion et al., 1993 Hollenberg et al., 1993 Jackson et al., 1993 Samuels et al., 1993 Fankhauser et al., 1994 Lloyd et al., 1994 Aoyama et al., 1995 Metzger et al., 1995 Simon et al., 1996 Kawaguchi et al., 1997 Aoyama and Chua, 1997

a

ER, oestrogen receptor; b MR, mineralocorticoid receptor.

Page 46

HBDs

3/16/99 11:09 AM

Functions

T. Aoyama

Proteins

04 Inducible Gene 04

46

Table 4.1. Heterologous proteins regulated by HBDs.

04 Inducible Gene 04

3/16/99 11:09 AM

Page 47

Glucocorticoid-inducible Gene Expression

47

not only transcription factors but also protein kinases (Jackson et al., 1993; Samuels et al., 1993), a site-specific DNA recombinase (Metzger et al., 1995) and a cell surface receptor (Kawaguchi et al., 1997). Initially, most experiments were performed with mammalian and avian tissue cultures. Although this method should work in transgenic mammals, it is difficult to analyse the results of such induction experiments in animals because of the effects of endogenous steroid hormones and their receptors. On the other hand, this induction system could become a powerful tool in transgenic plants, which have no natural receptors for the vertebrate steroids. Experiments in which transcription factors and a putative transcription factor were regulated with the rat GR HBD in transgenic plants have been described (Lloyd et al., 1994; Aoyama et al., 1995; Simon et al., 1996). The maize regulatory factor R belongs to the family of Myc-type transcription factors (Ludwig et al., 1989). Expression of this gene product complements the Arabidopsis regulatory mutation transparent testa glabra (ttg) (Lloyd et al., 1992). Lloyd et al. (1994) constructed a gene encoding a fusion protein between R and the rat GR (R-GR) HBD, and introduced it into the ttg mutant. In generated transgenic plants, trichome formation on the developing leaf epidermis was artificially induced by glucocorticoid treatment. In an experiment with ATHB-1, an Arabidopsis homeodomain protein (Ruberti et al., 1991), a chimeric transcription factor consisting of the ATHB-1 DNA-binding domain, the transactivating domain of the herpes viral protein VP16, and the rat GR HBD (HDZip1-VP16-GR) was expressed in transgenic tobacco plants (Aoyama et al., 1995). The transgenic plants showed aberrant palisade parenchyma development and de-etiolated phenotypes when grown in the dark only when they were treated with glucocorticoid. In another example, the GR HBD was fused to the putative transcription factor encoded by the Arabidopsis flowering-time gene CONSTANS (CO) (Putterill et al., 1995; Simon et al., 1996). Transgenic co mutant plants expressing the fusion protein (CO-GR) flowered earlier when treated with glucocorticoid. The artificial control of a protein function by HBDs is a very powerful technique for studying the regulatory cascade involving that protein. Fusion proteins formed from transcription factors and HBDs are especially useful for the analysis of a transcription network. Since the induction of transcriptional activation does not require de novo protein synthesis, we can identify those transcripts directly activated by that transcription factor from others which are activated indirectly, by using conditions in which protein synthesis is inhibited. Direct target genes of the Myc transcription factor have been identified using a fusion protein to an oestrogen receptor HBD in animal tissue cultures (Eilers et al., 1991; Grandori and Eisenman, 1997). It is anticipated that appropriate studies will be performed that reveal the network of transcriptional regulation involved in plant morphogenesis by using the induction systems for R-GR, HDZip1-VP16-GR and CO-GR. In general, it is difficult to construct a fusion protein with novel characteristics. We cannot always design a successful fusion protein, even if the 3-D

04 Inducible Gene 04

48

3/16/99 11:09 AM

Page 48

T. Aoyama

structure of each domain is known. One promising method is to mimic the design of a fusion protein that has already been found to work successfully. Therefore, fusion with the HBDs of steroid hormone receptors is one of the most promising ways of artificially regulating a protein’s function. The various applications of HBD fusion shown in Table 4.1 suggest that the HBD mechanism of regulating protein function in eukaryotes has the potential for widespread use.

CONSTRUCTION OF THE GVG SYSTEM Because the HBD of mammalian GR functions in transgenic plants, a transcriptional induction system was constructed using the HBD as a regulatory domain in a chimeric transcription factor. To avoid cross-communication with endogenous regulatory systems in plants, the other components of the system were also obtained from non-plant sources. The chimeric transcription factor consisted of the DNA-binding domain of the yeast GAL4 (Keegan et al., 1986), the transactivating domain of the herpes viral protein VP16 (Triezenberg et al., 1988), and the HBD of rat GR (Picard et al., 1988) (Fig. 4.2a). GAL4 belongs to the class of zinc finger proteins and binds to specific DNA sequences designated as GAL4 upstream activating sequences (UASGs) (Giniger et al., 1985). The minimum DNA-binding domain of GAL4 (amino acids 1–74) (Laughon and Gesteland, 1984) was used. The VP16 domain, an acidic-type transactivating domain, is expected to act as a strong transactivator in all cell types, because it interacts directly with general transcription factors, which are thought to be evolutionarily conserved among eukaryotes (Sadowski et al., 1988; Lin et al., 1991; Goodrich et al., 1993). Amino acids 413–490 of VP16 (Dalrymple et al., 1985) were fused to the C terminus of the GAL4 domain. The resulting fusion protein, GAL4–VP16, strongly activated transcription from a promoter containing six copies of UASG in a transient expression experiment assayed by particle bombardment of tobacco leaves (T. Aoyama et al., unpublished). The HBD of the rat GR (amino acids 519–795) (Miesfeld et al., 1986) was added to this strong transcription factor. The resulting transcription factor was designated as GVG because it consisted of one domain each from GAL4, VP16 and GR. The GVG protein strongly activates transcription from a promoter containing UASGs only in the presence of glucocorticoid. As shown in Fig. 4.2a, the coding sequence of GVG was placed between the 35S promoter of the cauliflower mosaic virus (Odell et al., 1985) and the polyA addition sequence of the pea ribulose bisphosphate carboxylase small subunit rbcS-E9 gene (Coruzzi et al., 1984). In the trans construct, the 35S promoter can be replaced by other promoters using restriction sites at its ends. The expression of GVG by a tissue-specific promoter allows us to induce transgene expression only in a specific tissue. A DNA fragment containing six copies of UASG was chosen as the cisacting element and placed upstream of the TATA box sequence of the 35S promoter. As shown in Fig. 4.2b, there are two restriction sites between the promoter and the polyA addition sequence of the pea rbcS-3A that can be used

04 Inducible Gene 04

3/16/99 11:09 AM

Page 49

Glucocorticoid-inducible Gene Expression

49

(a) Sse8387l 35S promoter

PmeI GAL4

XhoI

(b) GxGAL4 UAS

TATA

VP16

GR

E9

SpeI

3A

Fig. 4.2. Structures of the trans and cis constructs in the GVG system. (a) Structure of the trans construct. The DNA fragments encoding the chimeric transcription factor GVG was placed between the cauliflower mosaic virus 35S promoter (Odell et al., 1985) and the poly(A) addition sequence of the pea ribulose bisphosphate carboxylase small subunit rbcS-E9 (Coruzzi et al., 1984). The 35S promoter can be replaced with other promoters using the restriction sites indicated as Sse8387I and PmeI. (b) Structure of the cis construct. The inducible promoter contains six copies of the UASG and the TATA box region (246 to +1) of the 35S promoter. A DNA fragment to be transcribed inducibly can be placed between the promoter and the polyA addition sequence of the pea rbcS-3A (Fluhr et al., 1986) using the restriction sites indicated as XhoI and SpeI.

for cloning (Fluhr et al., 1986). We can make transgenic plants that express a specific, hormone-inducible, gene by cloning the coding region in the cis construct and introducing it into plants along with the trans construct.

INDUCTION EXPERIMENTS WITH THE GVG SYSTEM The inducibility of the GVG system has been studied in transgenic tobacco (Aoyama and Chua, 1997). The 35S-driven GVG gene was introduced into transgenic tobacco together with a cis construct containing the luciferase (luc) gene (de Wet et al., 1987) as a reporter. Induction of luciferase activity was observed when the transgenic tobacco plants were treated with dexamethasone (DEX), a strong synthetic glucocorticoid. The maximum expression level was over 100 times that of non-induction levels. The induction levels correlated with DEX concentrations ranging from 0.1 to 10 mM when the plants were grown on an agar medium containing DEX. In Northern hybridization analysis with RNAs from hydroponic plants, luc mRNA was detected 1 h after DEX treatment and levels increased to a maximum over 4 h (Aoyama and Chua, 1997). In this section, important aspects of induction experiments are described as well as the results of experiments with transgenic Arabidopsis.

04 Inducible Gene 04

50

3/16/99 11:10 AM

Page 50

T. Aoyama

The same cis and trans constructs used in transgenic tobacco were introduced into Arabidopsis thaliana (ecotype Columbia) and induction experiments were carried out with homozygous T3 plants. In experiments using whole plants, water flow through the vascular system and molecular diffusion are both factors involved in the delivery of glucocorticoid to tissues. Since glucocorticoid is a small hydrophobic chemical and diffuses directly into vertebrate cells without any special transport mechanisms, it is thought that glucocorticoid can also diffuse through plant cell walls and membranes. There are two general methods for treating plants with glucocorticoid. In the first, glucocorticoid is absorbed from the plant surface. Spraying is an easy way to deliver a glucocorticoid solution to the plant surface. This method is especially effective when the exposed epidermal tissue is the target of induction. Figure 4.3a shows the result of a spraying experiment with transgenic Arabidopsis carrying the luc reporter gene. In this experiment, induced luciferase activity was detectable within 30 min of spraying. The other group of methods involve the uptake of glucocorticoid by the vascular system, e.g. from roots or the cut ends of shoots. Induction can be stimulated by simply pouring DEX solution into a pot (Fig. 4.3b). This method allows us to perform induction experiments with healthy plants grown under natural conditions, although we cannot be certain how much DEX is taken up by individual plants. Hydroponic plants, cuttings and leaves all take up glucocorticoids through their roots or cut ends. As long as plants are grown under open air conditions, glucocorticoid is delivered through the vascular system to peripheral tissues quickly. In the experiment shown in Fig. 4.3b, the induction of luciferase activity was detectable in leaves 30 min after adding DEX. Under open air conditions, however, hormone concentrations are thought to vary throughout a plant. The hormone accumulates in leaves in higher concentrations, as a result of transpirational water flow. It is very difficult to deliver glucocorticoid uniformly throughout a plant. One possible way of doing so is by growing enclosed plants on an agar medium containing DEX under airtight conditions. Under these conditions, there is little

Fig. 4.3. (Opposite) Luciferase activity induced in Arabidopsis. Induction experiments were performed with transgenic Arabidopsis carrying the 35S-driven GVG gene and the luc reporter gene. (a) Transgenic plants grown in a pot for 4 weeks were sprayed with the luciferin solution containing 0.5 µM potassium luciferin and 0.01% (w/v) Tween 20. After 30 min, luciferase luminescence from the plants was imaged using a high-sensitivity camera system (Hamamatsu Photonic Systems) (left). Then the plants were sprayed with a solution containing 30 µM DEX and 0.01% (w/v) Tween 20. Twenty-four hours later, the plants were sprayed again with the luciferin solution and imaged (right). (b) Transgenic plants grown in a pot for 4 weeks were sprayed with the luciferin solution and luciferase luminescence from the plants was imaged as described above (left). Then a solution containing 30 µM DEX was poured into the pot. Twenty-four hours later, the plants were sprayed again with the luciferin solution and imaged (right).

04 Inducible Gene 04

3/16/99 11:10 AM

Page 51

Glucocorticoid-inducible Gene Expression

Fig. 4.3. (Continued)

51

04 Inducible Gene 04

52

3/16/99 11:10 AM

Page 52

T. Aoyama

transpirational water flow, so hormone concentrations remain relatively similar throughout the plant. The induction level of transgene expression can be controlled by varying the DEX concentration in the agar medium. Figure 4.4 shows how induction depends on the concentration of DEX. A good correlation between DEX concentrations and induction levels was obtained over concentrations from 3 nM to 300 nM. A significant level of induced luciferase activity was detected at a concentration of 3 nM or higher and the maximum induction level was over 1000 times higher than the non-induction level in Arabidopsis. In a similar experiment with tobacco (Aoyama and Chua, 1997), a 30-fold higher concentration was required for detectable induction and the maximum induction level was about 100 times that of the non-induction level. It is thought that both the high sensitivity and inducibility of Arabidopsis are due to the low non-induction level. Non-induction levels were generally lower in Arabidopsis than in tobacco, although levels vary among transgenic lines in both species.

Fig. 4.4. Luciferase activity induced by different concentrations of DEX. Transgenic Arabidopsis plants carrying the 35S-driven GVG gene and the luc reporter gene were germinated and grown on an agar medium for 14 days, then transferred to a fresh agar medium containing different concentrations of DEX for an additional 2 days. Relative luciferase activities were plotted against DEX concentrations. The value obtained at 0 nM DEX (the non-induction level) was arbitrarily set as 1. Extraction of luciferase and assays for relative luciferase activities were carried out as described by Millar et al. (1992).

04 Inducible Gene 04

3/16/99 11:10 AM

Page 53

Glucocorticoid-inducible Gene Expression

53

CHARACTERISTICS OF THE GVG SYSTEM One of the characteristics of an ideal induction system is that the inducer must not evoke pleiotropic effects that might complicate the analysis of the resulting phenomena. DEX, at least at the concentrations used in induction experiments, does not have any observable physiological effects in wild-type (wt) tobacco or Arabidopsis. Even in experiments in which DEX was assumed to accumulate at high concentrations in leaves, no adverse effects have been observed in the leaves. A class of steroids, the brassinosteroids, has strong physiological effects in plants (for reviews see Mandava, 1988; Li et al., 1996; Hooley, 1996). It is thought that glucocorticoids do not interact with the signal transduction pathway of brassinosteroids, since the molecular structure required for the biological activity of brassinosteroids (Yokota and Mori, 1992) is not found in glucocorticoids. Another requirement of an ideal induction system is that the noninduction level of transgene expression is minimal or absent. Most of the transgenic Arabidopsis lines carrying the 35S-promoter-driven GVG gene and the luc reporter gene have very low levels of luciferase activity under noninduction conditions. In some Arabidopsis lines, no activity was detected at noninduction levels. Nevertheless, there may be a basal level of constitutive induction because the inducible promoter of the GVG system contains an ideal TATA box sequence. It might be possible to find a transgenic plant whose noninduction level is zero by screening many transgenic lines, as both the noninduction and induction levels vary from line to line. As a case in point, transgenic Arabidopsis plants carrying the 35S-driven GVG gene and an inducible diphtheria toxin gene have been produced (T. Aoyama et al., unpublished). Expression of diphtheria toxin kills a cell even at a very low level (Palmitter et al., 1987; Thorsness et al., 1991). The plants that survived under non-induction conditions were killed immediately by DEX treatment, so the non-induction level of the toxin gene expression is believed to be almost zero in these plants. The characteristics of glucocorticoid as an inducer provide an advantage to the GVG system. Since glucocorticoid permeates cells easily, rapid induction of gene expression can be initiated in a variety of ways. By measuring luciferase activity, induction of gene expression was detectable within 30 min of DEX treatment under open air conditions. Glucocorticoid is one of the most-studied biological compounds and has many derivatives. The intensity and sustainability of induction vary with the use of different glucocorticoids (Aoyama and Chua, 1997). In an experiment with transgenic tobacco, plants treated with DEX maintained an induced level of luciferase activity for a longer period than those treated with triamcinolone acetonide, while both groups of plants showed the same initial level of induction. It is hypothesized that triamcinolone acetonide is less stable in plants than DEX. Over 100 different glucocorticoid derivatives are available from commercial sources. Some of these may be very stable in plants, while others are degraded rapidly. The respective types of

04 Inducible Gene 04

54

3/16/99 11:10 AM

Page 54

T. Aoyama

glucocorticoids would be useful for stable and transient induction. Moreover, glucocorticoid antagonists might be used for suppressing induction. It is possible to control the amount of transgene expression using the GVG system. As shown by the experiment in Fig. 4.4, the induction level can be regulated using different concentrations of DEX. This feature allows us to analyse dose-dependent effects of induced gene products under a constant genetic background. Such regulation, however, can only be performed effectively under enclosed conditions, where the concentration of DEX is relatively even throughout a plant. In open-air conditions, it is difficult to control the concentration of glucocorticoid throughout a plant, as discussed above. In such cases, the induction level might be regulated by using different glucocorticoids. The level of induced luciferase activity using an excess concentration of hydrocortisone, a natural glucocorticoid, was over 30-times less than that in response to DEX in tobacco (Aoyama and Chua, 1997).

PROSPECT OF THE STEROID-INDUCIBLE SYSTEM IN PLANTS The GVG system is the first steroid-inducible transcription system developed in transgenic plants. Although the system has been designed to work effectively in a variety of experiments, aspects of the system can be improved for specific experiments. First, modifications in the cis construct might reduce the noninduction level. It is hypothesized that replacement of the ideal TATA box sequence of the inducible promoter would decrease both the non-induction and induction levels. Such a modification would be effective in cases that require a low non-induction level rather than a high induction level. Conversely, increasing the number of UASG repeats might elevate induction levels. The trans construct, i.e. the GVG gene, can also be modified in many ways. Since each of the three domains that make up the GVG protein can function independently, they should be interchangeable with other domains of similar functions. A chimeric transcription factor consisting of the DNA-binding domain from ATHB-1 and the same VP16-GR cassette of the GVG protein worked as a regulatable transcription factor in transgenic tobacco (Aoyama et al., 1995). Many bacterial repressors, whose structures and functions are well characterized (e.g. lacI (Labow et al., 1990), LexA (Godowski et al., 1988) and TetR (Gossen and Bujard, 1992; Weimann et al., 1994)), might be used as alternative DNA-binding domains in the GVG system. With TetR it might be possible to develop a dual-control system, in which transgene expression is induced and repressed by glucocorticoid and tetracycline, respectively. Such a system would be very useful when quick induction and repression of transgene expression are both required. The HBD of the GVG protein can also be replaced by that of other hormone receptors. As shown in Table 4.1, the HBD of an oestrogen receptor (e.g. Eilers et al., 1989; Superti-Furga et al., 1991) and a mineralocorticoid receptor (Fankhauser et al., 1994) have both been used as regulatory domains in chimeric transcription factors. Using a different DNA-

04 Inducible Gene 04

3/16/99 11:10 AM

Page 55

Glucocorticoid-inducible Gene Expression

55

binding domain and the HBD of another steroid hormone receptor, it is possible to develop a second steroid induction system that could be used in combination with the GVG system. The promoter of the GVG gene can also be modified, as previously described. Induction of transgene expression in a specific tissue, so-called spacio-temporal gene expression, is possible using a tissue-specific promoter for the GVG gene. In unicellular systems, like yeast and tissue culture cells, we can perform induction uniformly and analyse the events that are induced in a single type of cell, but in multicellular organisms, such as higher plants, it is very difficult to perform induction uniformly in all cell types. Even assuming that uniform induction is possible, it would be difficult to assess the results due to the variety of responses by different cell types. Inducible gene expression in multicellular organisms is thus fundamentally different from that in unicellular systems. To overcome this weakness, induction should be limited to specific types of cells. Spatio-temporal gene expression by the GVG system will allow us to perform simpler induction experiments in complex organisms. The GVG system is designed to be very flexible and hence the steroidinducible system has the potential to become the ideal induction system in plants. As described above, an ideal induction system for plants should have no non-induction levels or pleiotropic effects. Even if such an ideal system exists theoretically, it is very difficult to prove that any system really satisfies these criteria. It is important that users of induction systems understand the characteristics of the systems thoroughly and carefully design each experiment to obtain the optimal results.

ACKNOWLEDGEMENTS Research by this laboratory has been supported in part by a Grant-in-Aid for scientific research on priority areas from the Ministry of Education, Science and Culture, Japan (09251210). I would like to thank Drs Nam-Hai Chua and Kazuhiko Umesono for their suggestions on the chapter.

REFERENCES Aoyama, T. and Chua, N.-H. (1997) A glucocorticoid-mediated transcriptional induction system for transgenic plants. The Plant Journal 11, 605–612. Aoyama, T., Dong, C.-H., Wu, Y., Carabelli, M., Sessa, G., Ruberti, I., Morelli, G. and Chua, N.-H. (1995) Ectopic expression of the Arabidopsis transcription activator Athb-1 alters leaf cell fate in tobacco. Plant Cell 7, 1773–1785. Beato, M. (1989) Gene regulation by steroid hormones. Cell 56, 335–344. Boehmelt, G., Walker, A., Kabrun, N., Mellitzer, G., Beug, H., Zenke, M. and Enrietto, P.J. (1992) Hormone-regulated v-rel estrogen receptor fusion protein: reversible induction of cell transformation and cellular gene expression. The EMBO Journal 11, 4641–4652.

04 Inducible Gene 04

56

3/16/99 11:10 AM

Page 56

T. Aoyama

Briegel, K., Lim, K.C., Plank, C., Beug, H., Engel, J.D. and Zenke, M. (1993) Ectopic expression of a conditional GATA-2/estrogen receptor chimera arrests erythroid differentiation in a hormone-dependent manner. Genes & Development 7, 1097–1109. Burk, O. and Klempnauer, K.H. (1991) Estrogen-dependent alterations in differentiation state of myeloid cells caused by a v-myb/estrogen receptor fusion protein. The EMBO Journal 10, 3713–3719. Coruzzi, G., Broglie, R., Edwards, C. and Chua, N.-H. (1984) Tissue-specific and lightregulated expression of a pea nuclear gene encoding the small subunit of ribulose1,5-bisphosphate carboxylase. The EMBO Journal 3, 1671–1679. Dalrymple, M.A., McGeoch, D.J., Davison, A.J. and Preston, C.M. (1985) DNA sequence of the herpes simplex virus type 1 gene whose product is responsible for transcriptional activation of immediate early promoters. Nucleic Acids Research 13, 7865–7879. de Wet, J.R., Wood, K.V., DeLuca, M., Helinski, D.R. and Subramani, S. (1987) Firefly luciferase gene: structure and expression in mammalian cells. Molecular and Cellular Biology 7, 725–737. Eilers, M., Picard, D., Yamamoto, K.R. and Bishop, J.M. (1989) Chimaeras of myc oncoprotein and steroid receptors cause hormone-dependent transformation of cells. Nature 340, 66–68. Eilers, M., Sabine, S. and Bishop, J.M. (1991) The MYC protein activates transcription of the a-prothymosin gene. The EMBO Journal 10, 133–141. Evans, R.M. (1988) The steroid and thyroid hormone receptor super-family. Science 240, 889–895. Fankhauser, C.P., Briand, P.A. and Picard, D. (1994) The hormone binding domain of the mineralcorticoid receptor can regulate heterologous activities in cis. Biochemical and Biophysical Research Communications 200, 195–201. Fluhr, R., Moses, P., Morelli, G., Coruzzi, G. and Chua, N.-H. (1986) Expression dynamics of the pea rbcS multigene family and organ distribution of the transcripts. The EMBO Journal 5, 2063–2071. Forman, B.M. and Samuels, H.H. (1990) Interaction among a subfamily of nuclear hormone receptors: the regulatory zipper model. Molecular Endocrinology 4, 1293–1301. Gatz, C. (1996) Chemically inducible promoters in transgenic plants. Current Opinion in Biotechnology 7, 168–172. Gatz, C., Frohberg, C. and Wendenburg, R. (1992) Stringent repression and homogeneous de-repression by tetracycline of a modified CaMV 35S promoter in intact transgenic tobacco plants. The Plant Journal 2, 397–404. Giniger, E., Varnum, S. and Ptashne, M. (1985) Specific DNA binding of GAL4, a positive regulatory protein of yeast. Cell 40, 767–774. Godowski, P.J., Picard, D. and Yamamoto, K.R. (1988) Signal transduction and transcriptional regulation by glucocorticoid receptor–LexA fusion proteins. Science 241, 812–816. Goodrich, J.A., Hoey, T., Thut, C.J., Admon, A. and Tjian, R. (1993) Drosophila TAFII40 interacts with both a VP16 activation domain and the basal transcription factor TFIIB. Cell 75, 519–530. Gossen, M. and Bujard, H. (1992) Tight control of gene expression in mammalian cells by tetracycline responsive promoters. Proceedings of the National Academy of Sciences USA 89, 5547–5551.

04 Inducible Gene 04

3/16/99 11:10 AM

Page 57

Glucocorticoid-inducible Gene Expression

57

Grandori, C. and Eisenman, R.N. (1997) Myc target genes. Trends in Biochemical Science 22, 177–181. Green, S. and Chambon, P. (1988) Nuclear receptors enhance our understanding of transcription regulation. Trends in Genetics 4, 309–314. Green, S., Kumar, V., Theulaz, I., Wahli, W. and Chambon, P. (1988) The N-terminal DNA-binding ‘zinc finger’ of the oestrogen and glucocorticoid receptors determines target gene specificity. The EMBO Journal 7, 3037–3044. Hollenberg, S.M., Cheng, P.F. and Weintraub, H. (1993) Use of a conditional MyoD transcription factor in studies of MyoD trans-activation and muscle determination. Proceedings of the National Academy of Sciences USA 90, 8028–8032. Hooley, R. (1996) Plant steroid hormones emerge from the dark. Trends in Genetics 12, 281–283. Hope, T.J., Huang, X.J., McDonald, D. and Parslow, T.G. (1990) Steroid receptor fusion of the human immunodeficiency virus type 1 Rev transactivator: mapping cryptic functions of the arginine-rich motif. Proceedings of the National Academy of Sciences USA 87, 7787–7791. Jackson, P., Baltimore, D. and Picard, D. (1993) Hormone-conditional transformation by fusion proteins of c-Abl and its transforming variants. The EMBO Journal 12, 2809–2819. Kawaguchi, Y., Takebayashi, H., Kakizuka, A., Arii, S., Kato, M. and Imamura, M. (1997) Expression of Fas–estrogen receptor fusion protein induces cell death in pancreatic cancer cell lines. Cancer Letters 116, 53–59. Keegan, L., Gill, G. and Ptashne, M. (1986) Separation of DNA binding from the transcription-activating function of eukaryotic regulatory protein. Science 231, 699–704. Labow, M.A., Bain, S.B., Shenk, T. and Levine, A.J. (1990) Conversion of the lac repressor into an allosterically regulated transcriptional activator for mammalian cells. Molecular and Cellular Biology 10, 3343–3356. Laudet, V., Hanni, C., Coll, J., Catzeflis, F. and Stehelin, D. (1992) Evolution of the nuclear receptor gene superfamily. The EMBO Journal 11, 1003–1013. Laughon, A. and Gesteland, R. (1984) Primary structure of the Saccharomyces cerevisiae GAL4 gene. Molecular and Cellular Biology 4, 260–267. Li, J., Nagpal, P., Vitart, V., McMorris T.C. and Chory, J. (1996) A role for brassinosteroids in light-dependent development of Arabidopsis. Science 272, 398–401. Lin, Y.-S., Maldonado, E., Reinberg, D. and Green, M.R. (1991) Binding of general transcription factor TFIIB to an acidic activating region. Nature 353, 569–571. Lloyd, A.M., Walbot, V. and Davis, R.W. (1992) Arabidopsis and Nicotiana anthocyanin production activated maize regulators R and C1. Science 258, 1773–1775. Lloyd, A.M., Schena, M., Walbot, V. and Davis, R.W. (1994) Epidermal cell fate determination in Arabidopsis: patterns defined by a steroid-inducible regulator. Science 266, 436–439. Louvion, J.-F., Havaux-Copf, B. and Picard, D. (1993) Fusion of GAL4-VP16 to a steroidbinding domain provides a tool for gratuitous induction of galactose-response genes in yeast. Gene 131, 129–134. Ludwig, S.R., Habera, L.F., Dellaporta, S.L. and Wessler, S.R. (1989) Lc, a member of the maize R gene family responsible for tissue-specific anthocyanin production, encodes a protein similar to transcriptional activators and contains the mychomology region. Proceedings of the National Academy of Sciences USA 86, 7092–7096.

04 Inducible Gene 04

58

3/16/99 11:10 AM

Page 58

T. Aoyama

Mandava, N.B. (1988) Plant growth-promoting brassinosteroids. Annual Review of Plant Physiology and Plant Molecular Biology 39, 23–52. Mett, V.L., Lockhead, L.P. and Reynolds, P.H.S. (1993) Copper controllable gene expression system for whole plants. Proceedings of the National Academy of Sciences USA 90, 4567–4571. Metzger, D., Clifford, J., Chiba, H. and Chambon, P. (1995) Conditional site-specific recombination in mammalian cells using a ligand-dependent chimeric Cre recombinase. Proceedings of the National Academy of Sciences USA 92, 6991–6995. Miesfeld, R., Rusconi, S., Godowski, P.J., Maler, B.A., Okret, S., Wikstroem, A.-C., Gustafsson, J.-A. and Yamamoto, K.R. (1986) Genetic complementation to a glucocorticoid receptor deficiency by expression of cloned receptor cDNA. Cell 46, 389–399. Millar, A.J., Short, S.R., Chua, N.-H. and Kay, S.A. (1992) A novel circadian phenotype based on firefly luciferase expression in transgenic plants. Plant Cell 4, 1075–1087. No, D., Yao, T.-P. and Evans, R.M. (1996) Ecdysone-inducible gene expression in mammalian cells and transgenic mice. Proceedings of the National Academy of Sciences USA 93, 3346–3351. Odell, J.T., Nagy, F. and Chua, N.-H. (1985) Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313, 810–812. Palmitter, R.D., Behringer, R.R., Quaife, C.J., Maxwell, F., Maxwell, I.H. and Brinster, R.L. (1987) Cell lineage ablation in transgenic mice by cell-specific expression of a toxin gene. Cell 50, 435–443. Picard, D. (1993) Steroid-binding domains for regulating the functions of heterologous proteins in cis. Trends in Cell Biology 3, 278–280. Picard, D. (1994) Regulation of protein function through expression of chimeric proteins. Current Opinion in Biotechnology 5, 511–515. Picard, D., Salser, S.J. and Yamamoto, K.R. (1988) A movable and regulable inactivation function within the steroid binding domain of the glucocorticoid receptor. Cell 54, 1073–1080. Picard, D., Schena, M. and Yamamoto, K.R. (1990) An inducible expression vector for both fision and budding yeast. Gene 86, 257–261. Putterill, J., Robson, F., Lee, K., Simon, R. and Coupland, G. (1995) The CONSTANS gene of Arabidopsis promotes flowering and encodes a protein showing similarities to zinc finger transcription factors. Cell 80, 847–857. Ruberti, I., Sessa, G., Lucchetti, S. and Morelli, G. (1991) A novel class of plant proteins containing a homeodomain with a closely linked leucine zipper motif. The EMBO Journal 10, 1787–1791. Rusconi, S. and Yamamoto, K.R. (1987) Functional dissection of the hormone and DNA binding activities of the glucocorticoid receptor. The EMBO Journal 6, 1309–1315. Sadowski, I., Ma, J., Triezenberg, S. and Ptashne, M. (1988) GAL4-VP16 is an unusually potent transcription activator. Nature 335, 563–564. Samuels, M.L., Weber, J.M., Bishop, J.M. and McMahon, M. (1993) Conditional transformation of cells and rapid activation of the mitogen-activated protein kinase cascade by an estradiol-dependent human raf-1. Molecular and Cellular Biology 13, 6241–6252. Schena, M. and Yamamoto, K.R. (1988) Mammalian glucocorticoid receptor derivatives enhance transcription in yeast. Science 241, 965–967. Schena, M., Lloyd, A.M. and Davis, R.W. (1991) A steroid-inducible gene expression system for plant cells. Proceedings of the National Academy of Sciences USA 88, 10421–10425.

04 Inducible Gene 04

3/16/99 11:10 AM

Page 59

Glucocorticoid-inducible Gene Expression

59

Simon, R., Igeno, M.I. and Coupland, G. (1996) Activation of floral meristem identity genes in Arabidopsis. Nature 384, 59–62. Stancato, L.F., Hutchison, K.A., Krishna, P. and Pratt, W.B. (1996) Animal and plant cell lysates share a conserved chaperone system that assembles the glucocorticoid receptor into a functional heterocomplex with hsp90. Biochemistry 35, 544–561. Superti-Furga, G., Gergers, G., Picard, D. and Busslinger, M. (1991) Hormone-dependent transcriptional regulation and cellular transformation by Fos-steroid receptor fusion proteins. Proceedings of the National Academy of Sciences USA 88, 5114–5118. Thorsness, M.K., Kansasamy, M.K., Nasrallah, M.E. and Nasrallah, J.B. (1991) A brassica S-locus gene promoter targets toxic gene expression and cell death to the pistil and pollen of transgenic Nicotiana. Developmental Biology 143, 173–184. Triezenberg, S.J., Kingsbury, R.C. and McKnight, S.L. (1988) Functional dissection of VP16, the transactivator of herpes simplex virus immediate early gene expression. Genes and Development 2, 718–729. Umek, R.M., Friedman, A.D. and McKnight, S.L. (1991) CCAAT-enhancer binding protein: a component of a differentiation switch. Science 251, 288–292. Umesono, K. and Evans, R.M. (1989) Determinants of target gene specificity for steroid/thyroid hormone receptors. Cell 57, 1139–1146. Weinmann, P., Gossen, M., Hillen, W., Bujard, H. and Gatz, C. (1994) A chimeric transactivator allows tetracycline-responsive gene expression in whole plants. The Plant Journal 5, 559–569. Yokota, T. and Mori, K. (1992) Molecular structure and biological activity of brassinolide and related brassinosteroids. In: Duax, W.L. and Bohl, M. (eds) Molecular Structure and Biological Activity of Steroids (Uni-science Report Series). CRC Press, Washington, DC, pp. 317–340.

04 Inducible Gene 04

3/16/99 11:10 AM

Page 60

05 Inducible Gene 05

3/16/99 11:12 AM

Page 61

Tissue-specific, Coppercontrollable Gene Expression in Plants

5

Vadim L. Mett and Paul H.S. Reynolds Plant Improvement Division, The Horticulture and Food Research Institute of New Zealand, Batchelar Research Centre, Highway 57, Private Bag 11030, Palmerston North, New Zealand

The copper-controllable gene expression system has been shown to give tight control over time and place of expression of a gene of interest in response to the application of copper to transformed plants either in the nutrient solution or as a foliar spray. Whilst the levels of expression from this system are not high when compared to the cauliflower mosaic virus (CaMV) 35S RNA promoter, they have been shown to be sufficient to, for example, drive effective antisense of a metabolic gene, to express plant hormone biosynthetic genes resulting in phenotype changes and to express potentially lethal avirulence genes. Perhaps the most significant aspect of this system is the tight control it effects allowing the recovery of transgenic plants expressing genes which are conditionally lethal or of plants carrying genes which, if expressed in tissue culture, would compromise plant developmental processes. The system has been successfully used in tobacco, Lotus and Arabidopsis backgrounds. Its functionality in Arabidopsis is particularly useful in that other systems, such as the tetracycline repressor, do not function in this background. On the other hand, experiments in poplar (S.H. Strauss, Oregon, USA, 1998, personal communication) have suggested that, in this plant, the copper system operates constitutively. Here, the basis of the copper-controllable system is described together with examples of its successful use in plants. A vector system for convenient use is presented, together with practical information on the conducting of experiments in plants.

© CAB International 1999. Inducible Gene Expression (ed. P.H.S. Reynolds)

61

05 Inducible Gene 05

62

3/16/99 11:12 AM

Page 62

V.L. Mett and P.H.S. Reynolds

BASIS AND FUNCTIONING OF THE COPPER-CONTROLLABLE EXPRESSION SYSTEM The copper-controllable gene expression mechanism is based on the yeast copper–metallothionein (MT) regulatory system with copper ion as the ‘inducer molecule’. The yeast copper–MT system, consists of a constitutively expressed activating copper-metallothionein expression-1 (ace1) gene which encodes a metallo-responsive transcription factor, targeted to the nucleus, which activates yeast MT gene transcription (Wright et al., 1988). This activation is mediated by copper ions which alter the conformation of the regulatory protein (Szczypka and Thiele, 1989) allowing it to bind to specific upstream sequences in the yeast MT promoter (Butt et al., 1984; Furst et al., 1988). The yeast copper–MT regulatory system thus represents a simple model in which the effective binding conformation of the regulatory protein to the MT promoter (and hence, activation of the MT gene) is controlled by the copper ion concentration (Thiele and Hamer, 1986). To translate this mechanism into a plant background (Fig. 5.1) would require constitutive expression of the ace1 gene using, for example, the CaMV 35S RNA promoter, together with a chimeric promoter to drive expression of the ‘gene of interest’ consisting of some basic plant-compatible TATA sequence together with the binding site for the ACE1 protein. MTs are characteristically low-molecular-weight, cysteine-rich polypeptides which fall into three classes based on the arrangement of their cysteine residues. Animals, yeasts and other fungi synthesize class I or II MTs which are encoded in the nuclear genome. Higher plants, on the other hand, produce phytochelatins (class III MTs), which are enzyme-synthesized peptides with the structure poly(γglutamyl-cysteinyl)glycine (Thiele, 1992). Recent evidence suggests that plants contain metal-binding proteins in addition to phytochelatins. Studies of the copper-tolerant flowering plant Mimulus guttatus have revealed that root extracts contain several copper-binding elements, only one of which is a phytochelatin (Grill et al., 1987). Interestingly, transcription of the MT-like genes investigated in this work did not appear to be induced by copper ions. In fact, half of the transcripts analysed were repressed by high copper ion concentrations. Genes encoding MT-like proteins have also been isolated from a range of other plants. Some plant MT-like genes are induced by metal treatment (DeFramond, 1991; Robinson et al., 1993; Zhou and Goldsbrough, 1994; Hsein et al., 1995) whilst others respond to different environmental and developmental signals such as senescence, abscission, wounding and tobacco mosaic virus (TMV) infection (Buchanan-Wollaston, 1994; Coupe et al., 1995; Choi et al., 1996). Even when ‘induced’ by copper, the level of induction driven from the promoters of these genes is low. For example, treatment of Arabidopsis seedlings with 50 µM CuSO4 for 30 h produced only a 5.5-fold increase in the level of MT2 mRNA, as determined by densitometry (Zhou and Goldsbrough, 1994). The exact role of MT-like plant proteins is yet to be determined though at present it does not seem to relate directly to metal tolerance but rather, may be important in the directed delivery of copper to protein complexes in which it is important.

05 Inducible Gene 05

3/16/99 11:12 AM

Page 63

Tissue-specific, Copper-controllable Gene Expression

Inactive

ACE1

Application of copper

ACE1

63

Active

Reporter protein

ACE1 p35S

ace 1

MRE

Reporter

Fig. 5.1. The copper-inducible expression system. The system consists of a constitutively expressed cysteine-rich nucleoprotein encoded by the ace1 gene, under the control of the CaMV 35S RNA promoter (p35S). This protein activates transcription of the ‘gene of interest’ (reporter) by binding to its cognate binding site (the metal regulatory element, MRE) in a chimeric promoter which also contains sequences necessary for transcription in plants. The competence of the ACE1 protein to bind the MRE is mediated by copper which alters its conformation to allow effective binding and activation of transcription from the chimeric promoter.

The key question, therefore, in investigating the feasibility of a coppercontrol system in plants (Fig. 5.1) is to determine: 1. Whether or not activation of the introduced yeast regulatory copper–MT system by manipulation of copper ion concentration is possible in plants against a background of multiple metal binding systems, and; 2. If such manipulation of copper ion levels has widespread physiological effects in the plant. To test the functioning of the system in plants a construct, containing the β-glucuronidase (GUS) reporter gene under control of the chimeric promoter (containing the ACE1-binding site and domain A from CaMV 35S RNA promoter) together with the ace1 gene fused to the CaMV 35S RNA promoter, was prepared and transgenic tobacco plants produced (Mett et al., 1993). Transgenic plants were also produced using a control construct which contained the GUS reporter under control of the chimeric promoter but from which the ACE1 coding region had been omitted. Clonal replicates were used in the experiments to allow direct comparisons of data to be made, since variation of expression due to differing sites of insertion into the tobacco genome could be avoided. Non-transformed plants gave an apparent fluorometric GUS activity of 20 pmol 4-methylumbelliferyl-β-glucuronide cleaved min21 mg21 protein (20 units mg21) (Fig. 5.2). This background activity, which was clearly not due to GUS expression, was identical in the presence or absence of copper

05 Inducible Gene 05

3/16/99 11:12 AM

Page 64

V.L. Mett and P.H.S. Reynolds

64

GUS activity (pmol min–1 mg–1 protein)

1200

900

600

300

0 Copper treatment Plant

(–) Wildtype

(+)

(–)

(+)

Controlconstruct

(–)

(+)

Fullconstruct

Fig. 5.2. Copper responsiveness of gene expression. Wild-type plants are nontransformed Nicotiana tabacum. Control-construct plants are N. tabacum transformed with a construct which contained the GUS reporter gene under control of a chimeric promoter consisting of a copy of the MRE fused to domain A of the CaMV 35S RNA promoter, but which does not contain the ace1 gene. Fullconstruct plants are N. tabacum transformed with a construct which contains the ace1 gene under control of the CaMV 35S RNA promoter, together with the GUS reporter under control of the chimeric promoter. Following an acclimatization period of 7 days after transfer of plants from agarose to solution culture, CuSO4 was added to the nutrient solution to a final concentration of 50 µM. After 5 days these plants (+) and plants grown in the absence of copper (2) were harvested and the leaves assayed fluorometrically for GUS activity.

ions. The control-construct plants showed the GUS assay background of 20 units mg21 in the absence of copper but, after 5 days in the presence of 50 µM copper, these plants showed a GUS activity of 40 units mg21 (Fig. 5.2). In contrast, the full-construct plants, grown in the presence of 50 µM CuSO4 for 5 days, showed an increase in leaf GUS specific activity to 1200 units mg21. Northern analysis confirmed the correct functioning of the whole yeast metallo-regulatory system transferred into the plants. The ace1 gene transcript was constitutively present, whereas the GUS transcript was detectable only in the presence of inducing copper ion concentrations. The fact that no copper induction was observed in plants transformed with the control-construct which did not contain the ace1 regulatory gene suggested that the yeast transcription

05 Inducible Gene 05

3/16/99 11:12 AM

Page 65

Tissue-specific, Copper-controllable Gene Expression

65

factor was essential for the functioning of the system in plants and that its nuclear targeting was unaffected in the plant background. The activity of the described chimeric promoter was shown to be directly dependent on the copper ion concentration. The copper ion concentration required for activation (in our hands 5 µM or higher) was shown to be significantly above that usually found in plant nutrient solutions (for example, standard MS medium contains copper at a concentration of 0.1 mM). Maintenance of plants for extended periods in the presence of the ‘inducing’ copper ion concentration in the nutrient solution resulted in development of copper toxicity symptoms. This problem could be circumvented by the application of copper ions in a foliar spray. The concentration of copper required in these sprays was considerably lower at 0.5 µM. It was further shown that if, following activation of GUS expression by addition of copper to the nutrient solution (or its application as a foliar spray), copper was then removed from the system then expression of the GUS gene was repressed; that is, the system could be used in experiments demanding precise timing of expression. Data showing the time-course of activation and repression of GUS expression in response to the addition and removal of 50 µM CuSO4 from the nutrient solution is shown in Fig. 5.3. GUS activity before the addition of copper was 48 units mg21. A twofold increase in specific activity was observed after 24 h, increasing to 1030 units mg21 after 4 days. Removal of CuSO4 from the nutrient solution resulted in a dramatic decrease in GUS activity to 80 units mg21 after 4 days. The same induction/repression was also observed in plants which had copper applied as a foliar spray. If leaves were sprayed to drip point daily with a 0.5 µM CuSO4 solution, maximal induction occurred after 5 days. If plants were thereafter sprayed to drip point daily with water, GUS activity decreased to background levels after a further 5 days. When plants were sprayed only once to drip point with the 0.5 µM copper solution, GUS activity was induced within 5 days and remained high for a further 7 days, before decreasing to background levels. In experiments using Arabidopsis, foliar application of 5 µM CuSO4 gave maximal induction of a GUS reporter gene after 4 days, but the period of maximal induction was short lived (F. Johnson-Potter, Australia, 1997, personal communication).

MODIFICATION OF THE SYSTEM TO OVERCOME BACKGROUND EXPRESSION IN ROOTS Whilst the system described above showed a very low background activity in the uninduced state in the leaves of transgenic plants, activity of the reporter enzyme GUS in roots was significant, even in half-strength MS growth medium with a concentration of CuSO4 (0.05 µM), which is below the induction threshold observed in leaves. Apparently this resulted from the presence of the ASF1 transcription factor binding site, which lies within the 35S promoter 90

05 Inducible Gene 05

3/16/99 11:12 AM

Page 66

V.L. Mett and P.H.S. Reynolds

66

1200

GUS activity (pmol min–1 mg–1 protein)

1000

800

600 Add copper

400

Remove copper

200

0 (Cu)–

1

2 Days

4

2

4 Days

Fig. 5.3. Time-course of activation/repression of gene expression. Following acclimatization, duplicate clonal Nicotiana tabacum plants transformed with the full construct (see Fig. 5.2) were harvested and the leaves assayed for GUS activity. The nutrient solution of the remaining ten plants was adjusted to contain 50 µM CuSO4, and duplicate plants were harvested after 1, 2 and 4 days, and leaves were assayed for GUS activity. The nutrient solution of the remaining plants was then changed to one lacking copper; duplicate plants were harvested, and the leaves were assayed for GUS activity after a further 2 and 4 days.

base pair (bp) domain A (Lam et al., 1989). Indeed, it has been shown that the 35S promoter 90 bp domain A is sufficient for low level constitutive expression in roots (Benfey and Chua, 1990). To eliminate this background expression of the system in the roots the ASF1 binding site was removed from the chimeric promoter leaving the 35S promoter 246 bp TATA fragment only. In addition, the effect of increasing the number of repeats of the MRE (metal regulatory element) fused in tandem to the TATA fragment (Mett et al., 1996) was investigated. Three variants of the chimeric promoter containing one, two or four copies of the MRE were constructed to evaluate the effect of the number of MRE on the level of expression. Due to the very close position of the expression cassette to the ace1 coding region under control of the potent CaMV 35S RNA promoter, the influence of the orientation (D (direct) or R (reverse)) of the chimeric promoter with respect to the direction of ace1 transcription was also investigated.

05 Inducible Gene 05

3/16/99 11:12 AM

Page 67

Tissue-specific, Copper-controllable Gene Expression

67

Tobacco plants from transformations in which the various chimeric promoter constructs were fused to the GUS reporter coding sequence, were used in an experiment in which GUS activity was measured in extracts from the roots and leaves of solution cultured plants before and after addition of copper to the medium. All plants showed very low GUS activity (typically between 20 and 100 units mg21) in the leaves and roots, in the absence of copper. Following induction with 50 µM CuSO4, all plants showed elevated GUS levels in the roots. However, there was no significant difference between plants for measured GUS activity regardless of the numbers of MRE present and, by inference, for the levels of activity of chimeric promoters containing one, two or four copies of MRE. This result could be explained by incorrect spacing between individual elements in comparison with the spacing of the two MRE in the native yeastmetallothionein promoter (Thiele and Hamer, 1986) or, despite high transcription, be due to low concentrations of ace1 protein actually being present in the nucleus. The lack of effect of orientation suggested low impact of the adjoining full 35S promoter which drives ace1 transcription. Over the total experiment, ‘4R’-transformed plants gave the highest GUS activity in roots after induction and the lowest background activity in the uninduced state, making this variant

Fig. 5.4. Copper-controllable gene expression system: vectors for convenient use. pPMB 768 and pPMB 7066 are pUC-based plasmids allowing for cloning of the gene of interest behind the desired chimeric promoter. pPMB 768 contains four tandem copies of the metal regulatory element (MRE) and the 246 bp fragment of the CaMV 35S RNA promoter (TATA), whereas pPMB 7066 contains only one copy of the MRE fused to domain A of the CaMV 35S promoter. pPMB 765 is a binary vector containing, in addition to the selectable marker gene and NotI site for cloning the gene of interest, the ace1 gene under control of the full CaMV 35S RNA promoter. The pPMB 7088 vector contains a promoterless ace1 gene with a HindIII site for cloning the desired tissue/organ-specific promoter.

05 Inducible Gene 05

68

3/16/99 11:12 AM

Page 68

V.L. Mett and P.H.S. Reynolds

the best candidate for copper-controllable gene expression in the roots of transgenic plants (see Fig. 5.4; pPMB 768/pPMB 765). The ‘4R’ tobacco plants were further investigated using four independent transformants (4R1, 4R2, 4R3, 4R4). Copper-induction experiments were performed on three re-regenerated clones from each independent transformant. One set of three clones was used as a minus copper control and a second set of clones was used to measure GUS activity after 5 days treatment with 50 µM CuSO4 in the nutrient solution. The third set of three clones was assayed for GUS activity 5 days after copper was removed from the nutrient solution. As shown in Table 5.1, very low GUS activity was observed in the roots before induction by the addition of 50 µM CuSO4 to the nutrient solution ((2) CuSO4). Five days after the addition of copper to the nutrient solution an up-to-160fold increase in GUS activity was observed ((+) CuSO4). When copper was then removed from the nutrient solution, a significant drop in GUS activity was observed after 5 days ((±) CuSO 4). These results clearly demonstrate that elimination of the ASF1-binding site has allowed tight control of expression in the roots. However, in all of these experiments using transgenic tobacco plants, very low GUS activity was measurable in the leaves before and after the induction (less than 50 units mg21). The introduction of an ASF2-binding site between MRE and TATA in the chimeric promoters did not restore expression in the leaves (data not shown, New Zealand, 1997), in spite of the fact that the ASF2binding site confers leaf expression when fused to domain A of the 35S promoter (Lam et al., 1989). It is therefore highly significant that recent experiments in Arabidopsis (Fumiaki Katagiri, USA, 1998, personal communication), using the pPMB 768/765 system (see Fig. 5.4) have allowed tight, copper-inducible control in leaves. Also, experiments performed in Arabidopsis seedlings with the pPMB 768/765 system using a GUS reporter gene, have revealed tight copperdependent expression both in leaves and in roots (S. Kurup and M. Holdsworth, UK, 1997, personal communication).

USE OF THE COPPER SYSTEM TO EFFECT CONTROL OVER PLACE, AS WELL AS TIME, OF EXPRESSION The ‘ideal’ gene expression system must provide both temporal and spatial control of a ‘gene of interest’ in transgenic plants. Tissue-specificity was introduced into the copper-controllable gene expression system by the use of a tissue-specific promoter to effect spatial control of the expression of the ACE1 transcription factor (Mett et al., 1996). As we were interested in the development of a tissue-specific coppercontrollable expression system for use in the nitrogen-fixing nodules of leguminous plants, the promoter of the nod45 gene from lupin (Rice et al., 1993) was used to drive the expression of the ace1 gene. The product of the nod45 gene, a late nodulin

05 Inducible Gene 05

3/16/99 11:12 AM

Page 69

Tissue-specific, Copper-controllable Gene Expression

69

Table 5.1. Copper inducibility of GUS expression in the roots of transgenic tobacco plants. GUS activitya (nmol min21 mg21 protein) Plant

(2) CuSO4

(+) CuSO4

(±) CuSO4

4R1 4R2 4R3 4R4

15.0 21.0 20.0 7.5

1665 820 1391 1216

140 120 85 20

a

Values given are the average of three clonal replicates for each treatment.

with unidentified function, is localized only in nitrogen-fixing nodules and activity of the promoter has been shown to be associated strictly with developed nodules (MacKnight et al., 1995). To demonstrate the feasibility of this approach, the GUS-expression cassette containing a chimeric promoter with four copies of the MRE was cloned into a plasmid containing the ace1 gene under control of the nod45 promoter in the reverse orientation with respect to the direction of ace1 transcription (pACENOD). A second construct containing the same GUS-expression cassette and the ace1 gene driven by the constitutive 35S promoter (pACE-in-ART), was used as a control. Both constructs were tested in ‘transgenic roots–wild-type tops’ Lotus corniculatus plants. After the development of nitrogen-fixing nodules (4 weeks) the plants were transferred into liquid culture and copper-induction experiments were performed. As shown in Fig. 5.5b histochemical GUS staining was localized only in nodules when expression of the ace1 gene was controlled by the nod45 promoter, whilst when transgenic roots were produced using the pACE-in-ART vector, GUS staining was also present in the tips of secondary roots (Fig. 5.5a). The apparent absence of GUS activity in the rest of the root tissue could be explained by the higher level of GUS expression in metabolically active cells of root tips. These results clearly demonstrated that the use of a specific promoter to limit the expression of the transcription factor ACE1 to a particular tissue/organ to be compatible with the copper-controllable system and to provide a mechanism to introduce tissue/organ-specificity into this system. Theoretically, it seems possible that the combination of an appropriate tissue/organ-specific promoter to drive the expression of the metallo-regulatory transcription factor ACE1 together with the elements of the chimeric promoter could be applicable to the temporal and spatial control of gene expression in any plant organ or tissue, provided that a TATA domain in the chimeric promoter has the capability to support expression in all tissues of the particular plant being used.

05 Inducible Gene 05

70

3/16/99 11:12 AM

Page 70

V.L. Mett and P.H.S. Reynolds

Fig. 5.5. Spatial control of GUS reporter gene expression in transgenic roots of Lotus corniculatus using the copper system. (a) Histochemical localization of GUS reporter gene activity in both roots and nodules of transgenic L. corniculatus roots transformed with the pPMB 768/pPMB 765 or ‘pACE-in-ART’ construct. (b) Histochemical localization of GUS reporter gene activity in nodules only of transgenic L. corniculatus roots transformed with the pPMB 768/pPMB 7088 or ‘pNOD-ACE’ construct in which expression of ACE1 is under the control of the nodule-specific nod45 promoter.

THE ‘EASE OF USE’ VECTORS FOR COPPER-CONTROLLABLE GENE EXPRESSION The copper-controllable gene expression system has been formulated for convenient use in four basic vectors (Fig. 5.4). Two of these are pUC-based plasmids allowing for cloning of the gene of interest and two are binary vectors for transfer to plants, one of which allows for control of the ace1 gene by an organ-specific promoter.

pPMB 768 This is a pUC119-based plasmid containing four copies of the MRE fused to the 246 bp fragment from the CaMV 35S RNA promoter, separated from a nos terminator by a cloning cassette. Following cloning of a gene of interest, the

05 Inducible Gene 05

3/16/99 11:12 AM

Page 71

Tissue-specific, Copper-controllable Gene Expression

71

sequence can then be excised NotI and cloned into the appropriate binary vector (pPMB 765 (p-ACE-in-ART) or pPMB 7088). In our experience, genes cloned under control of the chimeric promoter in this plasmid give inducible expression in roots with no expression in the absence of inducing copper concentrations. However, we see no leaf expression in tobacco, although there is clearly induction in leaves (F. Katagiri, Maryland, USA, 1998, personal communication) from this construct in Arabidopsis.

pPMB 7066 This is a pUC119-based plasmid containing one copy of the MRE fused to the 290 bp domain A from the CaMV 35S RNA promoter, separated from a nos terminator by a cloning cassette. Following cloning of a gene of interest, the sequence can then be excised NotI and cloned into the appropriate binary vector (pPMB 765 (pACE-in-ART) or pPMB 7088). Genes cloned under control of the chimeric promoter in this plasmid will give background expression in roots (at least in tobacco) in the absence of copper due to the 290 bp 35S promoter. Full control of expression has been obtained in leaves with no background expression in the absence of inducing copper concentrations. We have noticed a rather low percentage of tobacco transformants which demonstrate copper-inducible phenotype. At present, we cannot explain this phenomenon which results in the need to analyse a large number of primary transformants in order to find the appropriate phenotype.

pPMB 765 (pACE-in-ART) This is a binary vector for transfer to plants. It is based on the pART system of Gleave (1992). A NotI site allows for cloning of the gene of interest under control of the chosen chimeric promoter (from pPMB 768 or pPMB 7066). The ace1 gene is constitutively expressed throughout the plant and so gives expression of the induced gene in all plant organs under copper inducing conditions.

pPMB 7088 This is a binary vector for transfer to plants. It is based in the pART system of Gleave (1992). A NotI site allows for cloning of the gene of interest under control of the chosen chimeric promoter (from pPMB 768 or pPMB 7066). A HindIII site is provided 5′ to the ace1 gene to allow cloning of an organ-specific promoter. In this way the ace1 gene will be expressed only in the plant organ defined by the introduced promoter region and will give expression of the introduced gene (under inducing copper concentrations) only in that organ.

05 Inducible Gene 05

72

3/16/99 11:12 AM

Page 72

V.L. Mett and P.H.S. Reynolds

All the vectors are provided in an E. coli DH5a background. pPMB 768 and pPMB 7066 grow on LB amp, 100 µg ml21. pPMB 765 and pPMB 7088 grow on LB spec, 100 µg ml21.

USE OF THE SYSTEM FOR TISSUE-SPECIFIC ANTISENSE EXPERIMENTS Functional use of the system was demonstrated by its ability to drive effective antisense constructs in an organ-specific manner. The nodule-specific system was used to express antisense constructs of aspartate aminotransferase-P2 (AAT-P2) in transgenic L. corniculatus plants (Mett et al., 1996). Aspartate aminotransferase plays a key role in plant carbon and nitrogen metabolism. It exists as at least two isoenzymic forms in nodules and one of these, AAT-P2, is thought to function as part of the pathway which assimilates ammonia produced by the nitrogen fixation process (Reynolds and Farnden, 1979). Controlled, organ-specific expression of the antisense construct of this isoform offered the possibility of an in vivo demonstration of its direct role in the assimilation of ammonia into the amino acid asparagine. Three antisense constructs (7048, 7049 and 7050), derived from the lupin AAT-P2 cDNA (Reynolds et al., 1992), were expressed in transgenic L. corniculatus plants using the pACE-NOD vector (see Fig. 5.4 above and results in Table 5.2). Of the three constructs, 7050 gave the most effective antisense effect, with AAT-P2 enzyme activity below the level of detection in two of the three plants tested. In plant 7050-1 there was a 77% decrease in nodule asparagine concentration. In the 7049 plants, an antisense effect on AAT-P2 activity was seen in all three plants. However, in only one of these plants, 7049-1, was there a dramatic decrease in nodule asparagine concentration. This could be due to sufficient AAT-P2 activity remaining in the other plants to allow unimpeded asparagine synthesis. Full analysis of the 7048 plants was compromised by the lack of nodules in plant 7048-3(+) and the lack of an AAT-P2 determination in 7048-1(+), due to low nodule-weight. However, a significant antisense effect on AAT-P2 enzyme activity was seen in plant 7048-2 with only 18% of the AAT-P2 activity remaining after copper induction. A dramatic effect of AAT-P2 antisense expression on the nodule asparagine concentration was also observed, with 83% and 91% reductions observed in plants 7048-1 and 7048-2, respectively. Consistently, across the whole experiment, plants with very low or undetectable AAT-P2 activity showed large decreases in nodule asparagine concentration. In plants where the antisense effect was not high, or where significant residual levels of AAT-P2 activity (for example, plant 7049-3) remained, asparagine levels were either unaffected or only slightly reduced. In untransformed L. corniculatus plants there was no effect of copper on the activity of AAT-P2, and the asparagine levels in the nodules of these plants were comparable to those levels seen in the nodules of transformed plants which had not been exposed to antisense expression-inducing levels of copper.

05 Inducible Gene 05

3/16/99 11:12 AM

Page 73

Tissue-specific, Copper-controllable Gene Expression

73

Table 5.2. Effect of expression of AAT-P2 antisense constructs on nodule AAT-P2 enzyme activity and on nodule asparagine levels. AAT-P2 activity (mmol min21 g21 nodules) Plant 7048–1 7048–2 7048–3

Asparagine (mmol g21 nodules)

(+) Cu

(2) Cu

(+) Cu

(2) Cu

nd 0.051 No nodules

0.236 0.284 0.663

4.9 1.8 No nodules

28.6 19.1 40.4

0.593 0.609 1.042

8.7 28.8 36.3

37.6 44.9 34.3

0.342 No nodules 0.294

4.0 7.6 8.8

17.3 No nodules 19.4

7049–1 7049–2 7049–3

0.080 0.368 0.175

7050–1 7050–2 7050–3

<0.020 <0.020 0.098

nd, not determined.

These experiments have clearly demonstrated that the copper-inducible gene expression system described here is a useful system in a physiological situation, providing high enough levels of transcription from the chimeric promoter to produce a clear antisense effect. Furthermore, the use of this system has enabled a direct link to be established between the enzyme activity of the proplastid-localized AAT-P2 activity and the eventual synthesis of asparagine in the nodule. Experiments of this nature demand temporal and spatial control of expression, firstly to enable transgenic plants containing the antisense construct to be successfully regenerated and nodulated and, secondly to target the antisense effect to the particular plant organ being studied.

USE OF THE SYSTEM TO EXPRESS ‘CONDITIONAL-LETHAL’ GENES Expression of potentially lethal metabolic genes The enzyme L-asparaginase is present in many plant meristematic tissues where it plays an important role in the provision of nitrogen to the developing tissue. One exception to this is the nitrogen-fixing leguminous nodule. Upon establishment of an active symbiosis the expression of the L-asparaginase gene is dramatically reduced with a concomitant decrease in the measurable activity of L-asparaginase enzyme (Scott et al., 1976). This is essential to avoid the establishment of a futile metabolic cycle and so allow the export of asparagine from the nodule to fuel plant growth and development. The transcriptional repression of this gene has been shown to be associated with a 59 bp TATA proximal element (Vincze et al., 1994).

05 Inducible Gene 05

74

3/16/99 11:12 AM

Page 74

V.L. Mett and P.H.S. Reynolds

Fig. 5.6. Expression of L-asparaginase in transgenic Lotus corniculatus. Transgenic L. corniculatus plants were inoculated with Rhizobium loti NZP2037 and grown under minus N conditions. (a) Transformed L. corniculatus plants where L-asparaginase was expressed in a modified pNOD-ACE vector in which the L-asparaginase gene 59 bp repressor element had been inserted between the TATA and first MRE sequences. The first three plants were grown in the absence and the second three plants were grown in the presence of 5 µM CuSO4. (b) Lotus corniculatus plants transformed with an additional copy of the L-asparaginase open reading frame, expressed in the pNOD-ACE vector (see Fig. 5.5). The first three plants were grown in the absence and the second three plants in the presence of 5 µM copper.

05 Inducible Gene 05

3/16/99 11:12 AM

Page 75

Tissue-specific, Copper-controllable Gene Expression

75

The copper-controllable expression system has been used to allow transgenic plants to be obtained in which the consequences of nodule-specific expression of L-asparaginase can be observed in a mature, nodulated plant (E. Vincze and P.H.S. Reynolds, 1998, unpublished results). The results in Fig. 5.6b show transgenic L. corniculatus transformed with a copy of the L -asparaginase gene under control of the copper promoter. The first three plants were grown in the absence of copper and so did not express the L-asparaginase gene. The second three plants were grown in the presence of 5 µM CuSO4 and show the ‘conditional lethal’ phenotype due to the establishment of a metabolic futile cycle in which asparagine is both synthesized and degraded in the nodule. The copper system was further used in this research to allow demonstration of the functionality of the 59 bp TATA proximal element. Inclusion of this domain in the construct, between the MRE and TATA sequences, was sufficient to repress transcription of the introduced gene, even under copper-inducing conditions, and to allow the continuation of an effective symbiosis. The resulting plants were indistinguishable from wild-type (Fig. 5.6a).

Expression of bacterial avirulence genes Expression of bacterial avirulence genes in plants is sufficient to elicit the specific resistance response, providing the corresponding resistance gene is present in the plant background (Leister et al., 1996). For example, if the Pseudomonas syringae avirulence gene (avrRpt2) is placed under the control of the weak, constitutive RPS2 promoter and transformed to either RPS2 wild-type (RPS2 is the plant resistance gene which corresponds to avrRpt2) or to RPS2 mutant Arabidopsis plants, then transgenic plants are only recovered from the mutant plants. That is, in the absence of the corresponding receptor. When these experiments were performed using the copper-controllable gene expression system some interesting results were obtained (F. Katagiri, Maryland, USA, 1998, personal communication). Firstly, if the pPMB 7066 (see Fig. 5.4) system was used, which gives significant constitutive expression in roots, transgenic plants were only recovered when the RPS2 mutant background was used. In contrast, use of the pPMB 768-based system resulted in transgenic plants being generated in both the wild-type and mutant Arabidopsis RPS2 backgrounds. These data imply that, in this case, there is no background expression of the avrRpt2 gene in the absence of the copper inducer and attest to the tight control of expression provided by the pPMB 768-based system. When selected transgenic plants from the pPMB 768-avrRpt2/RPS2 wildtype experiment were treated with 10 µM copper a ‘hypersensitive response’ phenotype was observed. This phenotype was not seen when control

05 Inducible Gene 05

76

3/16/99 11:13 AM

Page 76

V.L. Mett and P.H.S. Reynolds

pPMB 768-avrRpt2/RPS2 mutant plants were treated with 10 µM copper. Plants which exhibit the copper-inducible resistance-response will be invaluable for the selection of mutants which have defects in the resistanceresponse signal transduction pathway; under inducing conditions such plants will survive.

USE OF THE SYSTEM TO CONTROL EXPRESSION OF PLANT HORMONES The cytokinin group of plant hormones regulates aspects of plant growth and development including the release of lateral buds from apical dominance and the delay of senescence. The tight temporal-control exhibited by the pPMB 768 system together with confinement of expression to the roots made it ideal for the control of expression of an introduced cytokinin synthase (ipt) gene (McKenzie et al., 1998). Uncontrolled cytokinin expression results in a grossly aberrant morphology in regenerating plants, whereas control of expression using the copper system

Fig. 5.7. Morphological comparison of transgenic tobacco lines containing a copper-inducible ipt gene. (a) Morphologically normal line ID8, 21 days after subculture on to a solid MS medium containing 150 mg ml21 kanamycin but which did not contain CuSO4. (b) Morphologically aberrant lines 1D9 and (c) 1R19, grown under the same conditions.

05 Inducible Gene 05

3/16/99 11:13 AM

Page 77

Tissue-specific, Copper-controllable Gene Expression

77

allowed recovery of morphologically normal plants under non-inducing conditions (McKenzie et al., 1998). Tobacco transformed with a construct containing the ipt gene under control of the copper-inducible promoter (Cu-ipt) was morphologically identical, under non-inductive conditions, to GUStransformed control plants transformed with the same construct except that the GUS receptor was expressed in places of ipt (Cu-GUS) in almost all lines produced (see for example, line ID8 in Fig. 5.7). However, three lines grew in an altered state which was indicative of cytokinin overproduction (see for example, lines ID9 and ID19 in Fig. 5.7), and this was confirmed by a full cytokinin analysis. The exogenous application of cytokinin to leaf tissue has been show to delay its senescence (Richmond and Lang, 1957) and this delayed senescence phenotype was observed in tissue-cultured plants transformed with a coppercontrolled ipt construct, and which were grown in the presence of copper (McKenzie et al., 1998). Following 97 days of treatment with 5, 10 or 50 µM

Fig. 5.8. Comparison of leaf senescence in Cu-GUS and Cu-ipt tobacco transformants following treatment with copper. Cu-GUS (left) and Cu-ipt (right) plants after 97 days growth in the presence of 50 µM CuSO4.

05 Inducible Gene 05

78

3/16/99 11:13 AM

Page 78

V.L. Mett and P.H.S. Reynolds

copper, the leaves of the Cu-ipt plants were clearly greener than the control CuGUS plants, under the same copper regime. The trend was most dramatic in plants treated with 50 µM copper (Fig. 5.8). An experiment carried out with clonal replicates of one line, grown under minus copper control and plus 50 µM copper conditions, showed only trace cytokinin concentration in the control plant, whereas the plus copper treatment plants showed a total cytokinin concentration of 132 pmol g21 fresh weight. Whole transgenic plants grown under copper-inducing conditions showed significant morphological changes indicating a release of lateral buds from apical dominance. Cu-ipt plants had significantly different morphology when compared with Cu-GUS controls after 30 days of exposure to copper. Whereas the controls displayed strong apical dominance, the Cu-ipt plants displayed a clear release of lateral buds from apical dominance. This was confirmed by significant increases in lateral bud number, lateral bud length, lateral bud leaf number and total plant leaf number, as well as the presence of stems on some of the lateral buds.

PRACTICAL USEFULNESS OF THE SYSTEM The preceding examples have shown that, whilst the level of expression obtained from the copper-controllable system is not high when compared with the CaMV 35S RNA promoter, it is sufficient to enable experiments to be performed which require expression of metabolic genes, genes involved in hormone biosynthesis and avirulence genes. The tight control over expression effected by the copper system has also been demonstrated with the recovery of plants expressing ‘conditional lethal’ constructs. Promoters giving high levels of expression frequently have background levels of expression high enough to prevent recovery of such plants. The aspartate aminotransferase antisense experiments demonstrate that expression from the copper-inducible promoter is sufficient to cause physiological effect. The AAT-P2 transcript is present in high levels (112 pg µg21 RNA) in 22-day-old legume root nodules (E. Podivinsky and P.H.S. Reynolds, 1998, unpublished results). This is, for example, 20 times higher than the transcript level of the AAT-P1 isoform (5 pg µg21 RNA). The control of expression of cytokinin and avirulence genes are examples of applications which demand tight control over expression. Without tight control, transgenic plants expressing the ipt gene are irrecoverable as there is either grossly aberrant morphology (see Fig. 5.7) or plantlets are simply unable to form roots. In the case of the expression of the avirulence gene avrRpt2, it is clear that tight control of expression of this gene was essential to enable the recovery of transgenic wildtype plants expressing the RPS2 resistance gene. In the case of the study of the effects of the ‘out of time’ expression of the L-asparaginase gene, use of the copper-inducible system also allowed the in vivo demonstration of the functionality of a transcriptional repression element.

05 Inducible Gene 05

3/16/99 11:13 AM

Page 79

Tissue-specific, Copper-controllable Gene Expression

79

The ability to recover plants expressing conditional lethal genes not only provides an environment in which the effects of expression can be determined in controlled experiments but also which allows the investigation of other factors involved in their expression. For example, in the avirulence gene study the ability to express this conditional lethal gene will allow the direct selection of mutants in signal transduction. The demonstration of the functionality of a repressor element implicated in the transcriptional repression of the L-asparaginase gene in nitrogenfixing legume root nodules was possible as, using the copper promoter, an experiment could be designed in which only those plants with constructs which included the repressor element would survive under copper-inducing conditions and in which the plants were totally dependent on nitrogen fixation.

PRACTICAL TIPS FOR USE OF THE COPPER-CONTROLLABLE SYSTEM We have obtained the best results for whole-plant induction of expression when plants are maintained in solution culture. Commonly used plant media such as vermiculite and pumice have been found to contain high enough concentrations of copper to activate the system. Our usual procedure has been to recover plants from tissue culture and, following transfer to solution culture, to maintain the plants in the absence of copper for 1–2 weeks. After this acclimatization period, copper is added to the nutrient solution at the desired concentration. Experiments using germinated seedlings of transgenic plants can be easily performed using standard solid media containing the desired copper ion concentration. Copper is toxic to plant roots. After 10 days exposure to 50 µM CuSO4, roots are already affected. To circumvent this problem we usually expose the roots to 50 µM copper for 4 days and thereafter maintain the plants in the presence of 5 µM copper. We have recently found that copper–ethylenediaminetetraacetic acid (EDTA) can act as a suitable inducer also, prolonged exposure of plants to Cu–EDTA did not result in toxicity to the roots.

ACKNOWLEDGEMENTS We wish to thank Drs Eva Vincze, Steve Strauss, Felicity Johnson-Potter, Fumiaki Katagiri, Smita Kurup and Michael Holdsworth for making available recent and unpublished results. We also wish to thank Michael Holdsworth for Fig. 5.1.

REFERENCES Benfey, P.N. and Chua, N.-H. (1990) The cauliflower mosaic virus 35S promoter: combinatorial regulation of transcription in plants. Science 250, 959–966.

05 Inducible Gene 05

80

3/16/99 11:13 AM

Page 80

V.L. Mett and P.H.S. Reynolds

Buchanan-Wollaston, V. (1994) Isolation of cDNA clones for genes that are expressed during leaf senescence in Brassica napus: identification of a gene encoding a senescence-specific metallothionein-like protein. Plant Physiology 105, 839–846. Butt, T.R., Sternberg, E.J., Gorman, J.A., Clark, P., Hamer. D., Rosenberg. M. and Crooke, S.T. (1984) Copper metallothionein of yeast, structure of the gene, and regulation of expression. Proceedings of the National Academy of Sciences USA 81, 3332–3336. Choi, D., Kim H.M., Yun, H.K., Park, J.-A., Kim, W.T. and Bok, S.H. (1996) Molecular cloning of a metallothionein-like gene from Nicotiana glutinosa L. and its induction by wounding and tobacco mosaic virus infection. Plant Physiology 112, 353–359. Coupe, S.A., Taylor, J.E. and Roberts, J.A. (1995) Characterisation of an mRNA encoding a metallothionein-like protein that accumulates during ethylene-promoted leaf abscission in Sambucus nigra L. leaflets. Planta 197, 442–447. DeFramond, A.J. (1991) A metallothionein-like gene from maize (Zea mays): cloning and characterisation. Federation of European Biochemical Societies Letters 290, 103–106. Furst, P., Hu, S., Hackett, R. and Hamer, D. (1988) Copper activates metalothionein gene transcription by altering the conformation of a specific DNA binding protein. Cell 55, 705–717. Gleave, A.P. (1992) A versatile binary vector system with a T-DNA organisational structure conductive to efficient integration of cloned DNA into the plant genome. Plant Molecular Biology 20, 1203–1207. Grill, E., Winnacker, E.L. and Zenk, M.H. (1987) Phytochelatins: the principal heavymetal complexing peptides of higher plants. Proceedings of the National Academy of Sciences USA 84, 439–443. Hsein, H.-M., Liu, W.-K. and Huang, P.C. (1995) A novel stress inducible metallothionein-like gene from rice. Plant Molecular Biology 28, 381–389. Lam, E., Benfey, P.N., Gilmartin, P.M., Fang, R.-X. and Chua, N.-H. (1989) Site-specific mutations alter in vitro factor binding and change promoter expression pattern in transgenic plants. Proceedings of the National Academy of Sciences USA 86, 7890–7894. Leister, D., Ballvora, A., Salamini, R. and Gebhardt, C.A. (1996) PCR based approach for isolating pathogen resistance genes from potato with a potential for wide application in plants. Nature Genetics 14, 421–429. MacKnight, R.C., Reynolds, P.H.S. and Farnden, K.J.F. (1995) Analysis of the lupin Nodulin-45 promoter: conserved regulatory sequences are important for promoter activity. Plant Molecular Biology 27, 457–466. McKenzie, M.J., Mett, V.L., Reynolds, P.H.S.and Jameson, P.E. (1998) Controlled cytokinin production in transgenic tobacco plants. Plant Physiology (in press). Mett, V.L., Lochhead, L.P. and Reynolds, P.H.S. (1993) Copper controllable gene expression system for whole plants. Proceedings of the National Academy of Sciences USA 90, 4567–4571. Mett, V.L., Podivinsky, E., Tennant, A.M., Lochhead, L.P., Jones, W.T. and Reynolds, P.H.S. (1996) A system for tissue-specific copper controllable gene expression in transgenic plants: nodule-specific antisense of aspartate aminotransferase-P2. Transgenic Research 5, 105–113. Reynolds, P.H.S. and Farnden, K.J.F (1979) The involvement of aspartate aminotransferases in ammonium assimilation in lupin nodules. Phytochemistry 18, 1625–1630.

05 Inducible Gene 05

3/16/99 11:13 AM

Page 81

Tissue-specific, Copper-controllable Gene Expression

81

Reynolds, P.H.S., Smith, L.A., Dickson, J.M.J.J., Jones, W.T., Jones, M., Rodber, K.A., Carne, A. and Liddane, C.P. (1992) Molecular cloning of a cDNA encoding aspartate aminotransferase-P2 from lupin root nodules. Plant Molecular Biology 19, 465–472. Rice, S.J., Grant, M.R., Reynolds, P.H.S. and Farnden, K.J.F. (1993) DNA sequence of nodulin 45 from Lupinus angustifolius. Plant Science 90, 155–166. Richmond, A.E. and Lang, A. (1957) Effect of kinetin on protein content and survival of detached Xanthium leaves. Science 125, 650–651. Robinson, N.J., Tommey, A.M., Kuske, C. and Jackson, P.J. (1993) Plant metallothioneins. Biochemistry Journal 295, 1–10. Scott, D.B., Robertson, J.G. and Farnden, K.J.F. (1976) Ammonia assimilation in lupin nodules. Nature 263, 703–705. Szczypka, M.S. and Thiele, D.J. (1989) A cysteine-rich nuclear protein activates yeast metallotionein gene transcription. Molecular Cell Biology 9, 421–429. Thiele, D.J. (1992) Metal-regulated transcription in eukaryotes. Nucleic Acids Research 20, 1183–1191. Thiele, D.J. and Hamer, D.H. (1986) Tenderly duplicated upstream control sequences mediate copper-induced transcription of the Saccharomyces cerevisiae coppermetallothionein gene. Molecular Cell Biology 6, 1158–1163. Vincze, E., Reeves, J.M., Lamping, E., Farnden, K.J.F. and Reynolds, P.H.S. (1994) Repression of the L-asparaginase gene during nodule development in Lupinus angustifolius. Plant Molecular Biology 26, 303–311. Wright, C.F., Hamer, D.H. and McKenney, K. (1988) Autoregulation of the yeast copper metallothionein gene depends on metal binding. Journal of Biological Chemistry 263, 1570–1574. Zhou, J. and Goldsbrough, P.B. (1994) Functional homologues of fungal metallothionein genes from Arabidopsis. Plant Cell 6, 875–884.

05 Inducible Gene 05

3/16/99 11:13 AM

Page 82

06 Inducible Gene 06

3/9/99 12:30 PM

Page 83

Nitrate Inducibility of Gene Expression Using the Nitrite Reductase Gene Promoter

6

Steven J. Rothstein and Sobhana Sivasankar Department of Molecular Biology and Genetics, University of Guelph, Guelph, Ontario N1G 2W1, Canada

INTRODUCTION Nitrogen is an essential nutrient required for plant growth, being a principal constituent of important macromolecules such as proteins, nucleic acids and chlorophyll. Nitrate is the predominant form of inorganic nitrogen utilized by plants in most agricultural situations. Other sources of inorganic nitrogen include atmospheric nitrogen, which is utilized by legumes and a very limited number of other plant species, and ammonium, which is rapidly nitrified to nitrate by soil bacteria in well-aerated soils. Nitrate in the environment is absorbed by plant roots by the action of specific uptake permease(s). Once absorbed, it can be reduced in the root itself, stored in vacuoles or transported to the shoot, where it can again undergo either vacuolar storage or reduction. Nitrate assimilation by plants involves its reduction to nitrite by nitrate reductase (NR), the conversion of nitrite to ammonium by nitrite reductase (NiR) and the incorporation of that ammonium into organic compounds through the cyclic action of the enzymes, glutamine synthetase (GS) and glutamine-2-oxoglutarate aminotransferase (GOGAT) (Fig. 6.1). Gene expression and enzyme activity of the various proteins involved in the nitrate assimilatory pathway are regulated by both endogenous and environmental stimuli including nitrate, light, sucrose, circadian rhythms and endproducts of assimilation, namely, glutamine and asparagine (for most recent reviews see, Crawford and Arst, 1993; Crawford, 1995; Sivasankar and Oaks, 1996). Nitrate, the substrate, serves as the primary and most important signal in regulating its own assimilation. The expression of the nitrate uptake system, NR and NiR, the most stringently regulated proteins in the nitrate assimilatory © CAB International 1999. Inducible Gene Expression (ed. P.H.S. Reynolds)

83

06 Inducible Gene 06

3/9/99 12:30 PM

Page 84

S.J. Rothstein and S. Sivasankar

84

– NO 3

– NO 3

Permease

– NO 3

Vacuole

NR – NO 2 Plastid – NO 2

NiR + NH 4

GS

Gln

GOGAT Glu

Fig. 6.1. Schematic representation of the nitrate assimilatory pathway in plants. NO32 enters the root cell by the action of specific uptake permease(s), and is reduced to NO22 in the cytosol by nitrate reductase (NR) or is stored in the vacuole. NO22 is reduced to NH4+ within the plastid by nitrite reductase (NiR) and NH4+ is incorporated into glutamine (Gln) by glutamine synthetase (GS). Glutamate (Glu) is derived from Gln by the action of glutamine-2-oxoglutarate aminotransferase (GOGAT). Gln and Glu are exported from the cell.

pathway, are coordinately induced by nitrate. In addition, nitrate also induces expression of GS and the ferredoxin-dependent GOGAT (Redinbaugh and Campbell, 1993). In this chapter, we examine in detail the current status of knowledge regarding nitrate-inducible gene expression, with particular emphasis on the spinach NiR gene. However, a brief overview of the other stimuli influencing nitrate assimilation is also presented to provide an understanding of the intricate regulatory machinery involved. Light is required for the optimum induction of NR and NiR gene expression in the presence of nitrate in photosynthetic tissue. In etiolated plants the induction by light occurs through phytochrome (Melzer et al., 1989; Neininger et al., 1992). In green plants the effect of light occurs through photosynthetic carbon fixation, and sucrose is capable of replacing light in the induction of NR mRNA (Kannangara and Woolhouse, 1967; Cheng et al., 1992). Light is also involved in the post-translational regulation of NR, whereby a protein phosphorylation/dephosphorylation mechanism permits rapid adjustment of nitrate-reduction rates to fluctuations in carbohydrate availability (reviewed by Lillo, 1994; Huber et al., 1996). Expression of NR and NiR is further controlled by circadian rhythms, with transcript levels increasing during the night and peaking during the early hours of the morning (Galangau et al., 1988; Bowsher et al., 1991; Deng et al., 1991). If NR activity is inhibited by substituting

06 Inducible Gene 06

3/9/99 12:30 PM

Page 85

Nitrate Inducibility Using the Nitrite Reductase Gene Promoter

85

molybdenum, which is integral to one of its functional domains, with tungstate, or if NR is inactivated by mutation, the circadian rhythmicity observed with NR mRNA is completely eliminated (Deng et al., 1989; Pouteau et al., 1989). Under these conditions NR transcript levels remain at high constitutive levels, suggesting that expression of the NR gene is inhibited by some product of nitrate assimilation when it reaches a certain concentration within the cell. Glutamine concentrations in cells are known to oscillate in a diurnal cycle in direct opposition to levels of NR mRNA (Deng et al., 1991). Exogenous addition of glutamine and asparagine to the plant growth medium can repress the uptake of nitrate as well as the transcription of NR and NiR (Vincentz et al., 1993; Sivasankar et al., 1997). The isolation of plant mutants defective in the regulation of nitrate assimilation has not been successful yet and our understanding of the molecular basis of this regulation is limited. On the other hand, the molecular nature of the regulatory machinery involved in nitrate assimilation, specifically in nitrate induction and nitrogen catabolite repression, has been unravelled to a considerable extent in the filamentous fungi, Neurospora crassa and Aspergillus nidulans. As recent research evidence indicates significant analogy between plant and fungal systems with regard to nitrate induction of NR and NiR, it is appropriate that a discussion of nitrate assimilation and its regulation in fungi precedes that in higher plants. REGULATION OF NO32 ASSIMILATION IN FUNGAL SYSTEMS In the filamentous fungi, N. crassa and A. nidulans, inorganic nitrate is utilized only when the cells are depleted of the preferred nitrogen sources, namely, ammonia, glutamate and glutamine. The nitrogen circuit in both organisms comprises a set of unlinked structural genes encoding enzymes that permit them to utilize secondary nitrogen sources, such as nitrate, purines and amino acids (Marzluf, 1981). These nitrogen-related enzymes include NR and NiR, involved in the assimilation of nitrate, purine catabolic enzymes, required for purine catabolism, and extracellular protease, L-amino acid oxidase and phenylalanine ammonia lyase, involved in the assimilation of proteins and amino acids. Expression of these unlinked genes is regulated by repression imposed by the preferred primary nitrogen sources, and by induction exerted by specific secondary nitrogen sources (Marzluf and Fu, 1989). Under conditions of nitrogen de-repression, global positive-acting regulatory proteins turn on the expression of these genes. At the same time, the action of pathway-specific regulatory proteins mediate the induction of specific enzymes in the circuit by their respective substrates. The utilization of nitrate requires the de novo synthesis of nitrate uptake permease(s) as well as that of NR and NiR. This occurs through nitrogen catabolite de-repression mediated by a single global positive-acting regulatory gene (nit-2 in N. crassa and areA in A. nidulans), and nitrate induction mediated by a pathway-specific regulatory gene (nit-4 in N. crassa and nirA in A. nidulans)

06 Inducible Gene 06

86

3/9/99 12:30 PM

Page 86

S.J. Rothstein and S. Sivasankar

(reviewed by Marzluf, 1993). The structural genes for NR and NiR in A. nidulans, niaD and niiA, respectively, are closely linked but transcribed in opposite directions implying coregulation by the common central region. In N. crassa, nit-3 and nit-6, encoding NR and NiR, respectively, are unlinked but are also coregulated by nitrogen de-repression and nitrate induction.

Global N regulatory genes, nit-2 and areA The molecular cloning of nit-2 of N. crassa and areA of A. nidulans has contributed greatly to the understanding of nitrogen control in filamentous fungi (Caddick et al., 1986; Fu and Marzluf, 1987). The NIT2 and AREA proteins contain a single Cys2/Cys2 type zinc finger motif with a central loop of 17 amino acids and an immediately adjacent downstream basic region, which together constitute a DNA-binding domain. This region shows strong sequence similarity to the finger motifs in the tissue-specific trans-acting GATA factor in mammals, except the latter consists of two adjacent finger motifs (Marzluf, 1993). NIT2 and AREA have 98% amino acid identity within their DNAbinding domains, and the nit-2 gene of N. crassa can complement an areA gene mutation in A. nidulans and turn on the expression of several nitrogen structural genes (Davis and Hynes, 1987). The DNA-binding domain of NIT2 comprising the zinc finger and the basic carboxy terminal region has been fused to β-galactosidase and expressed in an expression vector (Fu and Marzluf, 1990). In electrophoretic mobility-shift assays, the NIT2-βGAL fusion protein binds to three distinct sites in the 5′ promoter region of the N. crassa nit-3 gene, and to specific promoter sequences of the genes encoding allantoicase and Lamino acid oxidase (Fu and Marzluf, 1990; Xiao and Marzluf, 1993; Chiang and Marzluf, 1995). It also binds to several closely related sites in the promoter region between the divergently transcribed niaD and niiA genes of A. nidulans (Fu and Marzluf, 1990). NIT2-binding sites in these promoters are very different except for the presence of at least two copies of a core recognition sequence with a consensus of TATCTA (or TAGATA in the opposite strand) within an effective distance of not more than 30 bp of each other. If there is only a single GATA element or if the distance between the two GATA elements is more than 40 bp, binding affinity is reduced (Chiang and Marzluf, 1994). The orientation of the GATA elements and their flanking sequences have only a modest influence on binding; however, alteration of even a single nucleotide in any one of the two GATA core sequences eliminates binding. Site-directed mutagenesis leading to amino acid substitutions for Trp754 within the zinc finger loop of NIT2 results in a non-functional protein (Xiao and Marzluf, 1993). Substitution of Leu753 with alanine, valine or methionine gives a functional protein, but with altered specificity of binding. There are two NIT2binding sites within the nit-2 gene itself, which suggests that it might be subject to autogenous regulation (Chiang and Marzluf, 1994). However, the NIT2 and AREA proteins do not appear to be regulated themselves (Marzluf, 1993).

06 Inducible Gene 06

3/9/99 12:30 PM

Page 87

Nitrate Inducibility Using the Nitrite Reductase Gene Promoter

87

Pathway-specific N regulatory genes, nit-4 and nirA While NIT2 and AREA regulate the expression of several nitrogen-catabolic enzymes in a global manner, the expression of specific enzymes in the nitrogen circuit is under the control of pathway-specific regulatory proteins. In N. crassa, the nit-4 gene controls the nitrate-induced expression of nitrate reductase and nitrite reductase. The NIT4 protein contains a GAL4-like Cys6/Zn binuclear type zinc finger which constitutes the DNA-binding domain, a polyglutamine region composed of 27 glutamine residues occurring in the carboxy-terminus, and a glutamine-rich region occurring further upstream (Yuan et al., 1991). Dissection of the NIT4 protein with the yeast two-hybrid system using GAL4–NIT4 fusions identified its activation domain as the carboxy-terminus consisting of 385 amino acids which encompass the polyglutamine region, glutamine-rich region as well as a glycine-rich region (Feng and Marzluf, 1996). The latter two regions appear to be more important for activation than the polyglutamine region. All other regions of NIT4 including its DNA-binding domain fail to support transcriptional activation in yeast, indicating that the DNA-binding domain and activation domain of NIT4 are structurally and functionally separable. NIRA, the NIT4 homologue from A. nidulans, exhibits 60% amino acid identity with NIT4 at the amino-terminal half. However, the carboxy-terminal half is completely divergent in the two. A fusion of the aminoterminal half of NIT4 with the carboxy-terminal half of NIRA is functional in vivo in N. crassa and is capable of transforming a nit-4 mutant (Yuan et al., 1991). Thus, the glutamine-rich and glycine-rich regions in the C-terminus of NIT4 appear to be substituted by some domain in the C-terminus of NIRA. Electrophoretic mobility-shift assays and DNA-footprinting experiments reveal two NIT4-binding sites of different strengths in the promoter of the nit-3 gene, one of which is stronger with a symmetrical octameric sequence of TCCGCGGA (Fu et al., 1995). The related sequences in the nit-6 gene promoter include TCCGGTGA and TCCCTCGA. Three NIT2-binding sites and two NIT4binding sites are present in the 1.3 kb nit-3 promoter, of which two NIT2binding sites and two NIT4-binding sites which are clustered together are required for expression. Detectable transcription of nit-3 cannot be elicited by either NIT2 or NIT4 alone, but only by the combined presence of the two. On the basis of the clustered occurrence of NIT2- and NIT4-binding sites, the requirement of both proteins to elicit nit-3 expression and the observation that neither protein regulates the expression of the other, it is reasonable to presume a protein–protein interaction between NIT2 and NIT4. It has been postulated that NR might autogenously regulate its own expression by directly interacting with NIT4 (Tomsett and Garrett, 1981). This speculation is based on the fact that mutations in the nit-3 gene or in any of the NR cofactor genes result in the constitutive expression of nit-3 and nit-6 mRNA and protein in the absence of nitrate. The hypothesis was that in the absence of nitrate, the low levels of NR protein present in the cytoplasm binds to NIT4, but in the presence of nitrate NR binds to this substrate releasing NIT4 so that the

06 Inducible Gene 06

88

3/9/99 12:30 PM

Page 88

S.J. Rothstein and S. Sivasankar

regulatory protein can enter the nucleus to mediate transcription. However, both in vivo studies with the yeast two-hybrid system and direct in vitro binding experiments eliminate the possibility of a binding between NIT4 and NR (Feng and Marzluf, 1996).

Negative-acting regulatory gene, nmr Another nitrogen regulatory gene, nmr, in N. crassa, which is unlinked to nit-2, nit-4 or any of the nitrogen structural genes, appears to act negatively by preventing the expression of NR, NiR and other N-related genes in the presence of sufficient ammonia or glutamine (Premakumar et al., 1980; Dunn-Coleman et al., 1981). In nmr mutants, the nitrogen structural genes are constitutively expressed even in the presence of primary nitrogen sources. The NIT2 and NMR proteins are capable of interacting with each other, as demonstrated by mobility-shift experiments in vitro and the yeast two-hybrid system in vivo (Xiao et al., 1995). Two separate α-helical regions of NIT2, one which occurs within the zinc finger region, make direct contact with NMR. Mutations leading to single amino acid substitutions in the zinc finger of NIT2 abolish NIT2–NMR interaction. The nmr gene itself is not subject to regulation, and is constitutively expressed.

NITRATE INDUCIBILITY OF GENE EXPRESSION IN HIGHER PLANTS In higher plants, the nitrate uptake system, NR and NiR, are induced as a primary response to environmental nitrate. In addition to these, nitrate also induces the expression of GS and the ferredoxin-dependent GOGAT (Redinbaugh and Campbell, 1993). As energy, reductant and carbon skeletons are utilized in the uptake and reduction of nitrate and in the subsequent incorporation of reduced nitrogen into organic compounds, the expression of enzymes involved in the supply of these requirements may also be induced by nitrate (Fig. 6.1). One example is the ferredoxin-NADP+ oxidoreductase which supplies reductant for nitrite reduction in root plastids (Bowsher et al., 1993). Environmental nitrate leads to a series of other events as well, such as the transport of nitrate from root to shoot, proliferation of root tissue, changes in root to shoot growth ratios and enhancement of respiration (Redinbaugh and Campbell, 1991). Although these are physiologically and biochemically less defined than the responses mentioned earlier, the fact that these events occur indicate that nitrate could lead to gene expression in pathways both related and unrelated to nitrate assimilation. The first evidence for the ‘adaptive formation of NR’ in the presence of nitrate was presented by Tang and Wu in 1957. Research since then has led to the understanding that this induction occurs at the level of gene expression. In the absence of nitrate, the transcript level of NR is either very low or

06 Inducible Gene 06

3/9/99 12:30 PM

Page 89

Nitrate Inducibility Using the Nitrite Reductase Gene Promoter

89

undetectable in leaves and roots of plants. Upon the addition of nitrate there is a short lag phase, followed by a rapid increase in NR mRNA to a maximum level and then a decline to steady-state (Galangau et al., 1988; Melzer et al., 1989). RNA analysis and transcription assays with isolated nuclei indicate that nitrate induction of NR mRNA is due to de novo synthesis of transcript and not due to activation of pre-mRNA or reduced degradation of mRNA (Melzer et al., 1989; Callaci and Smarrelli, 1991).

NiR gene expression in response to nitrate The molecular nature of nitrate-induced gene expression in higher plants has been examined to the greatest extent using the spinach NiR gene promoter and the Arabidopsis NR gene promoter (Rastogi et al., 1993, 1997; Lin et al., 1994; Hwang et al., 1997). In this review, we concentrate on the analysis of the spinach NiR gene and its expression in the presence of nitrate. NiR catalyses the six-electron reduction of nitrite to ammonium, using reduced ferredoxin as reductant in chloroplasts of green leaves or a ferredoxin-like protein in root plastids (Suzuki et al., 1985; Wray, 1993). The ferredoxin-like protein obtains its reducing power from NADPH initially generated in the oxidative pentose phosphate pathway (Bowsher et al., 1989). The NiR enzyme is a monomeric protein of about 63 kDa containing sirohaem and a 4Fe4S centre as prosthetic groups (Siegel and Wilkerson, 1989). It is encoded by nuclear DNA and synthesized as a precursor protein with a N-terminal transit peptide targeting it to the chloroplast or plastid. There is only one NiR apoprotein gene per haploid genome in barley and spinach, while there are at least two in maize and four in tobacco (reviewed by Wray, 1993). The four NiR genes in tobacco are known to encode two distinct isoforms of the protein in shoots and a further two in roots. The spinach NiR gene, when transcribed, gives a 2.3 kb mRNA which codes for a protein of 594 amino acids (Back et al., 1988, 1991). There is a 32 amino acid extension at the N-terminus of the protein, serving as the chloroplast transit peptide. In spinach, nitrate is the primary determinant of NiR transcript level, while light affects enzyme synthesis (Seith et al., 1991). In barley and tobacco, on the other hand, both nitrate and light coact at the level of NiR gene transcription (Neininger et al., 1992). In barley, while both these signals determine transcription in leaves, nitrate alone is sufficient for gene expression in roots (Duncanson et al., 1992). Since there is only one NiR gene in barley expressed in both leaves and roots, it has been reasoned that the observed difference in nitrate and light inducibility of NiR in leaves and roots might occur in the signal transduction pathway leading to expression (Wray, 1993). This might also explain the difference in nitrate and light inducibility between spinach and tobacco, since the β-glucuronidase (GUS) reporter gene fused to the 3.1 kb upstream regulatory sequence of the spinach NiR gene and expressed in tobacco is induced by nitrate and light in accordance with the host, tobacco (Neininger et al., 1993).

06 Inducible Gene 06

3/9/99 12:30 PM

Page 90

S.J. Rothstein and S. Sivasankar

90

Analysis of a series of five deletions in the 3.1 kb upstream region of the spinach NiR gene, which were fused to the GUS reporter gene and expressed in transgenic tobacco, show that there is similar induction of GUS activity in the presence of nitrate in all deletion constructs between 23100 and 2330 (Rastogi et al., 1993) (Fig. 6.2). These deletions do not affect the qualitative nitrate-induced tissue-specific expression of GUS, which in all cases is confined to mesophyll cells in leaves and vascular tissue in stem and roots. Induction of GUS activity in roots and shoots occurs, respectively, within 2 h and 6 h, after first exposure to nitrate. When the NiR gene promoter is deleted to 2200, the nitrate-induced expression of GUS is lost indicating the presence of important cis-acting elements between 2330 and 2200 which mediate the induction of gene expression in response to nitrate. Further deletion analysis of the promoter between 2330 and 2200, in vivo DMS footprinting and electrophoretic mobility-shift assays reveal, for the first time, a significant similarity between higher plants and filamentous fungi in their regulatory machinery involved in nitrate induction (Rastogi et al., 1997). The GUS gene is expressed in response to nitrate in transgenic tobacco plants harbouring deletions from 2330 to 2230, but not in plants harbouring the 2200 deletion construct. This pin-points a cis-acting region involved in nitrate induction that is at least in part located between 2230 and 2200. In vivo DMS footprinting of the 2300 to 2130 region reveals several nitrate-inducible footprints, two of them being in the 2230 to 2180 region. This region of the spinach NiR promoter contains two adjacent GATA elements separated by 24 base pairs, located at 2214 to 2211 and at 2186 to 2183 (Fig. 6.3). The – NO 3 inducibility

TS GUS

–3100

+

+

–330

–

–200 +67

+

–225 +5 –225

–

Fig. 6.2. Schematic representation of 5′ and 3′ deletions of the spinach NiR promoter and nitrate inducibility of the GUS gene under the control of these promoter deletions. TS indicates transcription start site, + indicates induction by nitrate and 2 indicates lack of induction by nitrate.

06 Inducible Gene 06

3/9/99 12:30 PM

Page 91

Nitrate Inducibility Using the Nitrite Reductase Gene Promoter

91

Fig. 6.3. The 5′ upstream region of the spinach NiR gene promoter between 254 and 2294, which harbours the two GATA elements (boxed) and the A(C/G)TCA sequence motifs (underlined).

G-residues in both the GATA elements are DMS protected, suggesting the binding of trans-acting proteins to these cis-elements in the DNA. One possible reason for the lack of nitrate-induced GUS activity in transgenic tobacco plants harbouring the 2200 deletion construct could be the deletion of one of these two crucial GATA elements, specifically the one located between 2214 and 2211. However, one cannot rule out the possibility that there are other important cis-elements located in the 2230 to 2200 region which, upon deletion in the 2200 construct, leads to lack of nitrate-induced GUS expression. The 2240 to 2110 fragment of the spinach NiR gene promoter, which contains the two adjacent GATA consensus core elements, binds in vitro to a fusion protein comprising the zinc finger region of the NIT2 protein of N. crassa (Rastogi et al., 1997). Similarily, two upstream fragments of the nitrate reductase gene of Lycopersicon esculentum, each with a core GATA element, binds to a NIT2-βGAL fusion protein (Jarai et al., 1992). If a mutated version of the NIT2 protein is used, it fails to bind to the tomato NR promoter, indicating that the binding is specific. However, NIT2 binds more strongly to the nit-3 promoter DNA fragment than it does to the plant NR or NiR promoters, as indicated by dissociation kinetics and by competition in electrophoretic mobility-shift assays. GATA core elements are also present in the 5′ upstream region of genes encoding NR in tobacco, tomato, petunia and Arabidopsis (Salanoubat and Ha, 1993; Lin et al., 1994). However, their significance in nitrate-induced gene expression is not known at present. In Arabidopsis, however, the GATA sequences are further upstream of the regions 2238 and

06 Inducible Gene 06

92

3/9/99 12:30 PM

Page 92

S.J. Rothstein and S. Sivasankar

2330, identified as being sufficient to confer induction by nitrate in NR1 and NR2, respectively, which encode nitrate reductase (Lin et al., 1994). The importance of GATA elements in nitrate induction of the spinach NiR gene expressed in transgenic tobacco imply the existence of NIT2-like DNAbinding regulatory proteins in both spinach and tobacco. Several distinct GATAbinding proteins have been identified in tobacco including those involved in regulation of gene expression by circadian rhythm, light and phytochrome, but it is not known whether any of these mediate nitrate-induced gene expression (Anderson et al., 1994). A gene which encodes a zinc finger protein with 60% amino acid identity to the zinc finger domain of NIT2 has been cloned in tobacco (Daniel-Vedele and Caboche, 1993). However, it remains to be established whether this protein interacts with the NR and NiR gene promoters in tobacco, and whether it mediates nitrate-induced gene expression. All the constructs used in the analysis of the spinach NiR gene promoter contain a 130 bp 5′ untranslated leader sequence, which if deleted to +5 causes complete loss of nitrate-inducible expression (Sivasankar et al., 1998). However, the presence of at least 67 bp of the leader sequence together with the 2230 promoter region gives reporter gene expression in the presence of nitrate. This implies that the presence of both the region around 2230 as well as specific sequence motif(s) in the leader sequence are required for nitrate-induced expression of spinach NiR. In addition to the cis-acting elements discussed above, an AT-rich region followed by a sequence motif, A(C/G)TCA, has also been identified as being important for nitrate-induced gene expression, specifically in the case of Arabidopsis NR. The significance of this sequence was discovered by linker-scanning analysis of the 2238 and 2330 regions, respectively, of the NR1 and NR2 genes of Arabidopsis (Hwang et al., 1997). This motif is present in the 5′ flanking regions of NR and NiR genes of other plant species such as tobacco, maize, spinach, petunia, barley and kidney bean. In the spinach NiR gene promoter there are two of these motifs, one which occurs between 2200 bp and the transcription start site, and the other upstream of 2300 bp. Both of these are outside the region identified by promoter deletion analysis as being required for nitrate-induced expression (Rastogi et al., 1993, 1997). Thus these sequence motifs do not appear to be important for nitrate inducibility of the spinach NiR gene. In addition to induction by nitrate, the spinach NiR promoter is also repressed by nitrogen metabolites such as glutamine and asparagine. This repression by nitrogen metabolites occurs in the case of NR and NiR in other plant species such as maize and tobacco as well (Vincentz et al., 1993; Sivasankar et al., 1997). All deletion constructs of the spinach NiR gene promoter that respond to induction by nitrate are also subject to repression by glutamine and asparagine (Sivasankar et al., 1998). This implies one of three possibilities. One, cis-acting DNA-binding site(s) of a negative-acting regulatory protein mediating repression occurs in the same vicinity of the promoter as those of a positive-acting protein mediating induction. Two, a negative-acting regulatory protein, which does not require DNA binding to be functional,

06 Inducible Gene 06

3/9/99 12:30 PM

Page 93

Nitrate Inducibility Using the Nitrite Reductase Gene Promoter

93

interacts with a NIT2-like protein preventing the latter from mediating expression of nitrate-inducible genes in the presence of the repressor. Three, the nitrogen catabolites cause a primary repression of nitrate uptake, in which case the repression observed with the NiR promoter would be the result of reduced nitrate uptake.

CONCLUSIONS AND PERSPECTIVES Gene expression of NR and NiR, two key enzymes in the nitrate assimilatory pathway, is induced by nitrate and repressed by nitrogen metabolites in both higher plants and filamentous fungi. The presence of NIT2-binding GATA consensus elements in the spinach NiR promoter, its importance in nitrateinduced gene expression and the binding, in vitro, of the spinach NiR promoter and the tomato NR promoter to the N. crassa NIT2 zinc finger domain, are all lines of evidence indicating possible analogy between higher plants and filamentous fungi in their regulatory machinery leading to nitrate-induced expression. However, NIT2-binding sites may not be the only cis-acting elements required for gene expression in the presence of nitrate. It is possible that the combined presence of more than one regulatory motif in a full-length promoter is required for optimal nitrate-induced expression, at least with regard to the spinach NiR. Although the cis-acting elements involved in nitrate-induced gene expression have been analysed in some detail, the isolation of trans-acting factors mediating this phenomenon has not been successful so far, mostly due to the difficulty in isolating regulatory mutants. Thus our understanding of the molecular mechanisms underlying the induction of gene expression in the presence of nitrate is still in its infancy.

REFERENCES Anderson, S.L., Teakle, G.R., Martino-Catt, S.J. and Kay, S.A. (1994) Circadian clock- and phytochrome-regulated transcription is conferred by a 78 bp cis-acting domain of the Arabidopsis CAB2 promoter. The Plant Journal 6, 457–470. Back, E., Burkhart, W., Moyer, M., Privalle, L. and Rothstein, S. (1988) Isolation of cDNA clones coding for spinach nitrite reductase: Complete sequence and nitrate induction. Molecular and General Genetics 212, 20–26. Back, E., Dunne, W., Schneiderbauer, A., de Framond, A., Rastogi, R. and Rothstein, S.J. (1991) Isolation of the spinach nitrite reductase gene promoter which confers nitrate inducibility on GUS gene expression in transgenic tobacco. Plant Molecular Biology 17, 9–18. Bowsher, C.G., Hucklesby, D.P. and Emes, M.J. (1989) Nitrite reduction and carbohydrate metabolism in plastids purified from roots of Pisum sativum L. Planta 177, 359–366. Bowsher, C.G., Long, D.M., Oaks, A. and Rothstein, S.J. (1991) Effect of light/dark cycles on expression of nitrate assimilatory genes in maize shoots and roots. Plant Physiology 95, 281–285.

06 Inducible Gene 06

94

3/9/99 12:30 PM

Page 94

S.J. Rothstein and S. Sivasankar

Bowsher, C.G., Hucklesby, D.P. and Emes, M.J. (1993) Induction of ferredoxin-NADP+ oxidoreductase and ferredoxin synthesis in pea root plastids during nitrate assimilation. The Plant Journal 3, 463–467. Caddick, M.X., Arst, H.N., Taylor, L.H., Johnson, R.I. and Brownlee, A.G. (1986) Cloning of the regulatory gene areA mediating nitrogen metabolite repression in Aspergillus nidulans. The EMBO Journal 5, 1087–1090. Callaci, J.J. and Smarrelli, J. Jr. (1991) Regulation of the inducible nitrate reductase isoform from soybeans. Biochimica et Biophysica Acta 1088, 127–130. Cheng, C.-L., Acedo, G.N., Christinsin, M. and Cronkling, M.A. (1992) Sucrose mimics the light induction of Arabidopsis nitrate reductase gene transcription. Proceedings of the National Academy of Sciences USA 89, 1861–1864. Chiang, T.-Y. and Marzluf, G.A. (1994) DNA recognition by the NIT2 nitrogen regulatory protein: importance of the number, spacing and orientation of GATA core elements and their flanking sequences upon NIT2 binding. Biochemistry 33, 576–582. Chiang, T.-Y. and Marzluf, G.A. (1995) Binding affinity and functional significance of NIT2 and NIT4 binding sites in the promoter of the highly regulated nit-3 gene, which encodes nitrate reductase in Neurospora crassa. Journal of Bacteriology 177(21), 6093–6099. Crawford, N.M. (1995) Nitrate: nutrient and signal for plant growth. Plant Cell 7, 859–868. Crawford, N.M. and Arst, H.N.J. (1993) The molecular genetics of nitrate assimilation in fungi and plants. Annual Review of Genetics 27, 115–146. Daniel-Vedele, F. and Caboche, M. (1993) A tobacco cDNA clone encoding a GATA-1 zinc finger protein homologous to regulators of nitrogen metabolism in fungi. Molecular and General Genetics 240, 365–373. Davis, M.A. and Hynes, M.J. (1987) Complementation of areA2 regulatory gene mutations of Aspergillus nidulans by the heterologous regulatory gene nit-2 of Neurospora crassa. Proceedings of the National Academy of Sciences USA 84, 3753–3757. Deng, M.-D., Moureaux, T. and Caboche, M. (1989) Tungstate, a molybdate analogue inactivating nitrate reductase, deregulates the expression of the nitrate reductase structural gene. Plant Physiology 91, 304–309. Deng, M.-D., Moureaux, T., Cherel, I., Boutin, J.-P. and Caboche, M. (1991) Effects of nitrogen metabolites on the regulation and circadian expression of tobacco nitrate reductase. Plant Physiology and Biochemistry 29, 239–247. Duncanson, E., Ip, S.-M., Sherman, A., Kirk, D.W. and Wray, J.L. (1992) Synthesis of nitrite reductase is regulated differently in leaf and root of barley (Hordeum vulgare L.). Plant Science 87, 151–160. Dunn-Coleman, N.S., Tomsett, A.B. and Garrett, R.H. (1981) The regulation of nitrate assimilation in Neurospora crassa: biochemical analysis of NMR1 mutants. Molecular and General Genetics 182, 234–239. Feng, B. and Marzluf, G.A. (1996) The regulatory protein NIT4 that mediates nitrate induction in Neurospora crassa contains a complex tripartite activation domain with a novel leucine-rich, acidic motif. Current Genetics 29, 537–548. Fu, Y.-H. and Marzluf, G.A. (1987) Characterization of nit-2, the major nitrogen regulatory gene of Neurospora crassa. Molecular and Cellular Biology 7(5), 1691–1696. Fu, Y.-H. and Marzluf, G.A. (1990) nit-2, the major positive-acting nitrogen regulatory gene of Neurospora crassa, encodes a sequence-specific DNA-binding domain. Proceedings of the National Academy of Sciences USA 87, 5331–5335.

06 Inducible Gene 06

3/9/99 12:30 PM

Page 95

Nitrate Inducibility Using the Nitrite Reductase Gene Promoter

95

Fu, Y.-H., Feng, B., Evans, S. and Marzluf, G.A. (1995) Sequence-specific DNA binding by NIT4, the pathway-specific regulatory protein that mediates nitrate induction in Neurospora. Molecular Microbiology 15(5), 935–942. Galangau, F., Daniel-Vedele, F., Moureaux, T., Dorbe, M.-F., Leydecker, M.-T. and Caboche, M. (1988) Expression of leaf nitrate reductase genes from tomato and tobacco in relation to light–dark regimes and nitrate supply. Plant Physiology 88, 383–388. Huber, S.C., Bachmann, M. and Huber, J.L. (1996) Post-translational regulation of nitrate reductase activity: a role for Ca2+ and 14-3-3 proteins. Trends in Plant Science 1(12), 432–438. Hwang, C.-F., Lin, Y., D’Souza, T. and Cheng, C.-L. (1997) Sequences necessary for nitrate-dependent transcription of arabidopsis nitrate reductase genes. Plant Physiology 113, 853–862. Jarai, G., Truong, H.-N., Daniel-Vedele, F. and Marzluf, G.A. (1992) NIT2, the nitrogen regulatory protein of Neurospora crassa, binds upstream of nia, the tomato nitrate reductase gene, in vitro. Current Genetics 21, 37–41. Kannangara, C.G. and Woolhouse, H.W. (1967) The role of carbon dioxide, light and nitrate in the synthesis and degradation of nitrate reductase in leaves of Perilla frutescens. New Phytologist 66, 553–561. Lillo, C. (1994) Light regulation of nitrate reductase in green leaves of higher plants. Physiologia Plantarum 90, 616–620. Lin, Y., Hwang, C.-F., Brown, J.B. and Cheng, C.-L. (1994) 5′ proximal regions of Arabidopsis nitrate reductase genes direct nitrate-induced transcription in transgenic tobacco. Plant Physiology 106, 477–484. Marzluf, G.A. (1981) Regulation of nitrogen metabolism and gene expression in fungi. Microbiological Reviews 45, 437–461. Marzluf, G.A. (1993) Regulation of sulfur and nitrogen metabolism in filamentous fungi. Annual Review of Microbiology 47, 31–55. Marzluf, G.A. and Fu, Y.-H. (1989) Genetic regulation of nitrogen metabolism in Neurospora crassa. In: Wray, J.L. and Kinghorn, J.R. (eds) Molecular and Genetic Aspects of Nitrate Assimilation. Oxford Science Publications, Oxford, pp. 296–302. Melzer, J.M., Kleihofs, A. and Warner, R.L. (1989) Nitrate reductase regulation: effects of nitrate and light on nitrate reductase mRNA accumulation. Molecular and General Genetics 217, 341–346. Neininger, A., Kronenberger, J. and Mohr, H. (1992) Coaction of light, nitrate and a plastidic factor in controlling nitrite reductase gene expression in tobacco. Planta 187, 381–387. Neininger, A., Bichler, J., Schneiderbauer, A. and Mohr, H. (1993) Response of a nitritereductase 3.1-kilobase upstream regulatory sequence from spinach to nitrate and light in transgenic tobacco. Planta 189, 440–442. Pouteau, S., Cherel, I., Vaucheret, H. and Caboche, M. (1989) Nitrate reductase mRNA regulation in Nicotiana plumbaginifolia nitrate reductase-deficient mutants. Plant Cell 1, 1111–1120. Premakumar, R., Sorger, G.J. and Gooden, D. (1980) Repression of nitrate reductase in Neurospora studied by using L-methionine-DL-sulfoximine and glutamine auxotroph gln-lb. Journal of Bacteriology 143, 411–415. Rastogi, R., Back, E., Schneiderbauer, A., Bowsher, C.G., Moffatt, B. and Rothstein, S.J. (1993) A 330 bp region of the spinach nitrite reductase gene promoter directs nitrate-inducible tissue-specific expression in transgenic tobacco. Plant Journal 4, 317–326.

06 Inducible Gene 06

96

3/9/99 12:30 PM

Page 96

S.J. Rothstein and S. Sivasankar

Rastogi, R., Bate, N., Sivasankar, S. and Rothstein, S.J. (1997) Footprinting of the spinach nitrite reductase gene promoter reveals the preservation of nitrate regulatory elements between fungi and higher plants. Plant Molecular Biology 34, 465–476. Redinbaugh, M.G. and Campbell, W.H. (1991) Higher plant responses to environmental nitrate. Physiologia Plantarum 82, 640–650. Redinbaugh, M.G. and Campbell, W.H. (1993) Glutamine synthetase and ferredoxindependent glutamate synthase expression in the maize (Zea mays) root primary response to nitrate. Evidence for an organ-specific response. Plant Physiology 101(4), 1249–1255. Salanoubat, M. and Ha, D.B.D. (1993) Analysis of the petunia nitrate reductase apoenzyme-encoding gene: a first step for sequence modification analysis. Gene 128, 147–154. Seith, B., Schuster, C. and Mohr, H. (1991) Coaction of light, nitrate and a plastidic factor in controlling nitrite-reductase gene expression in spinach. Planta 184, 74–80. Siegel, L.M. and Wilkerson, J.Q. (1989) Structure and function of spinach ferredoxin nitrite reductase. In: Wray J.L. and Kinghorn, J.R. (eds) Molecular and Genetic Aspects of Nitrate Assimilation. Oxford Science Publications, Oxford, pp. 263–283. Sivasankar, S. and Oaks, A. (1996) Nitrate assimilation in higher plants: the effect of metabolites and light. Review. Plant Physiology and Biochemistry 34(5), 609–620. Sivasankar, S., Rothstein, S.J. and Oaks, A. (1997) Regulation of the accumulation and reduction of nitrate by nitrogen and carbon metabolites in Zea mays L. seedlings. Plant Physiology 114, 583–589. Sivasankar, S., Rastogi, R., Jackman, L., Oaks, A. and Rothstein, S.J. (1998) Analysis of cis-acting DNA elements mediating induction and repression of the spinach nitrate reductase gene. Planta 206, 66–71. Suzuki, A., Oaks, A., Jacquot, J.P., Vidal, J. and Gadal, P. (1985) An electron transport system in maize roots for reactions of glutamate synthase and nitrite reductase. Plant Physiology 78, 374–378. Tang, P.S. and Wu, H.Y. (1957) Adaptive formation of nitrate reductase in rice seedlings. Nature 179, 1355–1356. Tomsett, A.B. and Garrett, R.H. (1981) Biochemical analysis of mutants defective in nitrate assimilation in Neurospora crassa: evidence for autogenous control by nitrate reductase. Molecular and General Genetics 184, 183–190. Vincentz, M., Moureaux, T., Leydecker, M.-T., Vaucheret, H. and Caboche, M. (1993) Regulation of nitrate and nitrite reductase expression in Nicotiana plumbaginifolia leaves by nitrogen and carbon metabolites. Plant Journal 3, 315–324. Wray, J.L. (1993) Molecular biology, genetics and regulation of nitrite reduction in higher plants. Physiologia Plantarum 89, 607–612. Xiao, X.D. and Marzluf, G.A. (1993) Amino-acid substitutions in the zinc finger of NIT2, the nitrogen regulatory protein of Neurospora crassa, alter promoter element recognition. Current Genetics 24, 212–218. Xiao, X.D., Fu, Y.-H. and Marzluf, G.A. (1995) The negative-acting NMR regulatory protein of Neurospora crassa binds to and inhibits the DNA-binding activity of the positive-acting nitrogen regulatory protein NIT2. Biochemistry 34, 8861–8868. Yuan, G.-F., Fu, Y.-H. and Marzluf, G.A. (1991) nit-4, a pathway-specific regulatory gene of Neurospora crassa, encodes a protein with a putative binuclear zinc DNA-binding domain. Molecular and Cellular Biology 11(11), 5735–5745.

07 Inducible Gene 07

3/9/99 12:03 PM

Page 97

Use of Heat-shock Promoters to Control Gene Expression in Plants

7

Ronald T. Nagao1 and William B. Gurley2 1Botany

Department, University of Georgia, Athens, GA 30602, USA; 2Department of Microbiology and Cell Science, University of Florida, Gainesville, FL 32611, USA

INTRODUCTION Inducible gene systems are useful for a variety of reasons: they provide a means to manipulate levels of gene expression in order to better understand the functions of individual genes in an experimental setting, or allow the regulated production of large amounts of specific gene products in order to capitalize on the known function of a specific gene. The ability to introduce inducible promoters into plants by a variety of transformation procedures provides a flexible and powerful system to control foreign gene expression. Such regulation can be achieved by the use of promoters from developmental and cellspecific genes which are responsive to developmental cues, promoters induced by environmental stimuli, or promoters induced by chemical or synthetic compounds. Many considerations are important in the selection of a promoter for expression of an introduced gene. For example, use of a cell-specific or developmentally controlled promoter limits expression to a particular cell, tissue or developmental window which may be desirable for some genes, but may be too limited to be effective for other genes. With chemical inducers, regulation is not limited by localized expression but by the need for the constant presence or repeated application of the inducer which may be expensive, impractical and environmentally unsound. Additionally, the imposition of special growth conditions for the purpose of gene induction will not generally be useful in agricultural situations (Ward et al., 1993). And finally, a complication in the use of bacterial regulatory systems is that the metabolic principles that underlie chemical gene regulation in microbes do not readily extrapolate to plants. In some circumstances, depending on the gene in question, a general widespread expression may be more useful than cell-specific expression. Thus © CAB International 1999. Inducible Gene Expression (ed. P.H.S. Reynolds)

97

07 Inducible Gene 07

98

3/9/99 12:03 PM

Page 98

R.T. Nagao and W.B. Gurley

depending on a number of factors, including the properties of the gene product in question, species, economic and environmental constraints, and cultivation practices, a single promoter system is unlikely to be suitable for all situations. In this chapter we summarize the use of a heat-shock (HS) promoter system for inducible expression of introduced genes in transgenic plants. The HS promoter system offers numerous advantages, not the least of which is a system whose metabolic and regulatory principles readily extrapolate to all plants. In agricultural settings, the system inducer, heat, is naturally present without additional input or adverse environmental impact often associated with application of chemicals. Continued expression is assured by repeated activation of the system on an almost daily basis by the natural diurnal temperature cycle of the growing season. The HS promoter system offers an alternative to present systems that is reliable, economical and virtually maintenance free.

THE HEAT-SHOCK RESPONSE IN PLANTS High temperature stress is only one of many different stresses that plants and other organisms encounter. The needs dictated to respond to high temperature have evolved into a highly conserved phenomenon called the heat-shock response. The HS response was first observed in Drosophila (Ritossa, 1962) and is characterized by dramatic and rapid changes in both transcription and translation with the onset of heat stress (see Ashburner and Bonner, 1979). The HS response occurs in most, if not all, organisms ranging from bacteria and lower eukaryotes to mammals and plants. Heat-shock proteins (HSPs) are induced at different temperatures in different organisms, but in each case induction occurs at a temperature that constitutes a stress for that particular organism. In plants the HS response occurs after an elevation of approximately 8–12°C above the normal growing temperature and is characterized by a very rapid induction of HS gene transcription with a concomitant decline in the transcription of most other genes. Selective translation of HS mRNAs at HS temperatures (or rapid turnover of non-HS mRNAs in bacteria and yeast) results in selective and rapid accumulation of HSPs at elevated temperature. An additional feature of the HS response is the transient nature of HS gene expression, ranging from a few minutes in Escherichia coli to a few hours in higher eukaryotes. This characteristic of short-lived expression suggests that the response is self-regulated. While a common mechanism has not been demonstrated among various groups of organisms, the phenomenon is a highly conserved component of the HS response. One of the considerations in developing models to explain autoregulation is the observation that different HS promoters are induced with different kinetics of expression. Most aspects of differential expression can be accounted theoretically in the configuration of perfect and imperfect heat-shock consensus elements (HSEs) in the promoter as discussed in more detail later.

07 Inducible Gene 07

3/9/99 12:03 PM

Page 99

Use of Heat-shock Promoters

99

HSPs were originally defined by the property of being heat inducible. A number of classes of HSPs have been described and are generally designated by their approximate molecular weights in kDa as HSP100, HSP90, HSP70, HSP60 and low molecular weight (LMW) HSPs (15–30 kDa). Ubiquitin, a small protein involved in ATP-dependent proteolysis, does not have sequence homology to HSP classes but is also referred to as an HSP because of its heat inducibility (Hershko, 1988). One distinguishing feature of the plant HS response is the high abundance and complexity of the LMW HSPs (Key et al., 1981; Mansfield and Key, 1987). In most species of plants where it has been examined, the LMW HSPs number 20 or more different proteins compared to a much smaller number in other eukaryotes. For example, Drosophila has four major LMW HSP genes, while yeast and mammals have only one (Nagao et al., 1986; Lindquist and Craig, 1988). The LMW HSPs have been classified into at least six gene families targeted to different cellular components including the cytosol, chloroplasts, mitochondria and endoplasmic reticulum (LaFayette et al., 1996; for reviews see Vierling, 1991; Waters et al., 1996). A high diversity and the organellar localization of LMW HSPs are unique to plants. The extraordinary conservation of various aspects of the HS response has been used as a functional argument for the ancient origin of this complex of genes and regulatory circuits, and for its continued benefit to present day organisms. The evolution of HS promoters has been shaped by selection pressures that have favoured the rapid and large-scale induction of HSPs during emergency processes or conditions such as heat stress where abnormally folded/denatured proteins are produced. An overwhelming volume of data is consistent with this idea. A number of excellent reviews detail both the historical background and recent progress in protein folding and molecular chaperones (Lindquist and Craig, 1988; Ellis and van der Vies, 1991; Gething and Sambrook, 1992; Craig et al., 1993; Georgopoulos and Welch, 1993; Hendrick and Hartl, 1993; Parsell and Lindquist, 1993; Landry and Gierasch, 1994; Morimoto et al., 1994; Boston et al., 1996). Furthermore, a remarkable amount of research leads to the conclusion that not only is the HS response very complex with major features conserved among organisms, but members of the HSP families play a central role in a constantly increasing number of cellular functions. A number of important books and reviews have been written on various aspects of the subject (see Nover and Scharf, 1997; Waters et al., 1996; Boston et al., 1996 and references therein).

THERMOTOLERANCE Most organisms, including plants, can survive an otherwise lethal high temperature treatment if they are first pretreated at a non-lethal high temperature leading to HSP synthesis. This phenomenon is called induced or acquired thermotolerance. Many experiments have shown that the acquisition of thermotolerance correlates with conditions resulting in synthesis of HSPs

07 Inducible Gene 07

100

3/9/99 12:03 PM

Page 100

R.T. Nagao and W.B. Gurley

(Lin et al., 1984; Kimpel and Key, 1985; Nagao et al., 1986; Lindquist and Craig, 1988; Parsell and Lindquist, 1994). While the volume of correlative data is impressive, it does not prove the involvement of HSPs in thermotolerance. A compelling demonstration that an HSP is required for induced thermotolerance was demonstrated for Hsp104 from yeast. A deletion mutant lacking the HSP104 gene failed to acquire thermotolerance; however, reintroduction of the HSP104 gene rescued the thermotolerant phenotype (Sanchez and Lindquist, 1990). These results demonstrate that at least one HSP plays a critical role in cell survival at extreme temperatures. Similar verification of protein function was demonstrated for plants where HSP101 genes from soybean and Arabidopsis complemented a yeast HSP104 deletion mutant in acquiring thermotolerance (Lee et al., 1994; Schirmer et al., 1994). The focus of this chapter is on the transcriptional regulation of the HS response in plants and the use of HS promoters to control inducible transcription in plants. Emphasis is placed on plant examples of promoter function with possible uses as well as some considerations and precautions. As a foundation for the beneficial use of HS promoters, a summary discussion of HS promoter expression and the fundamentals of how HS promoters work and their organization and types are presented.

DEVELOPMENTAL EXPRESSION Although HSPs were initially defined as proteins whose expression is highly induced by elevated temperature, many recent studies indicate that these proteins are also regulated by a variety of environmental and developmental signals in animals (Pauli and Tissières, 1990; Arrigo and Landry, 1994) and plants (Zimmerman and Cohill, 1991). A number of reports have documented the expression or detection of LMW HSP mRNAs in cases other than induction by heat stress (see Waters et al., 1996). A remarkable aspect of induction of HSPs associated with development is that, typically, only certain classes of HSPs (e.g. LMW HSPs) and/or specific members of a class are expressed. This supports two ideas regarding the role of HSPs: (i) that HSPs can be functionally distinct between classes and perhaps even between members of the same class; and (ii) that HSPs so induced provide functions essential to the developmental process. The promoters regulating these genes must therefore be functionally distinct, either containing developmentally activated motifs or unique configurations of HS elements as discussed later.

POLLEN DEVELOPMENT Developmental regulation of HSP gene expression without the imposition of elevated temperature is illustrated in pollen development in several species including lily (Bouchard, 1990), maize (Dietrich et al., 1991; Atkinson et al.,

07 Inducible Gene 07

3/9/99 12:03 PM

Page 101

Use of Heat-shock Promoters

101

1993) and tobacco (Zarsky et al., 1995). In maize, HSP mRNA transcripts encoding 18 kDa HSPs are expressed in a stage-specific manner during microsporogenesis without heat stress (Dietrich et al., 1991; Atkinson et al., 1993). The genes encoding two 18 kDa HSPs are expressed and/or accumulate independently during microsporogenesis implying gene-specific developmental regulation rather than general activation of the HS or stress response (Atkinson et al., 1993). In tobacco pollen embryogenesis, Northern analysis showed that expression of a class I LMW HSP, NtHsp18P, is activated at normal temperatures during the dehydration phase of pollen development just before anthesis. It was further shown that these same transcripts accumulated when pollen embryogenesis was induced in vitro by starvation (Zarsky et al., 1995). Thus, while it has not been demonstrated that HSPs are directly involved in the induction of pollen embryogenesis, the selective and stage-specific induction of these genes implies that the expression of LMW HSPs plays an important role in pollen development.

POLLEN In general, mature pollen of most plant species lacks a normal HS response. In several species either no HSPs are synthesized in response to HS or, if synthesized, only a subset is made (Mascarenhas and Crone, 1996). Previous studies have shown that the typical HSPs cannot be induced by heat in germinating pollen of several species including maize (Cooper et al., 1984; Frova et al., 1989; Dupuis and Dumas, 1990; Hopf et al., 1992), lily (Schrauwen et al., 1986), petunia (Schrauwen et al., 1986), tobacco (Spena and Schell, 1987), tomato (Duck and Folk, 1994), and Tradescantia (Altschuler and Mascarenhas, 1982; Xiao and Mascarenhas, 1985). A notable exception is Sorghum pollen where immature pollen and in vitro germinating pollen synthesize a subset of HSPs made in vegetative tissues at heat stress temperatures (Frova et al., 1991). The importance of the lack of HSP induction in pollen for many temperate crop species is illustrated in maize where environmental stress, especially high temperature stress, can interfere with productivity. The pollination and fertilization period, which determines seed set, is particularly sensitive to stress, and substantial loss of yield occurs if heat stress coincides with these sensitive times (Herrero and Johnson, 1980). Even a minor improvement of pollen heat resistance (1–2°C) could have significant impact on crop yield. Mechanistically, it is known that HS treatment of germinating maize pollen does not induce HSPs, as in vegetative tissues (Hopf et al., 1992). While low levels of HS mRNAs were detected, accumulation of mRNAs to high levels did not occur. This failure to exhibit a typical HS response cannot be attributed to a general inability to transcribe genes, because α-tubulin is actively transcribed in maize pollen during heat stress (Hopf et al., 1992). This deficiency of promoter activation was also seen using Drosophila Hsp70 fused to a neomycin phosphotransferase

07 Inducible Gene 07

102

3/9/99 12:03 PM

Page 102

R.T. Nagao and W.B. Gurley

reporter gene which was expressed in all tissues of transgenic tobacco in response to HS except pollen (Spena and Schell, 1987). This general deficiency in promoter activation/recognition in response to high temperature in pollen is a major factor that must be overcome before improved heat-stress resistance in pollen can be attained. It would be interesting to measure HS transcription factor (HSF; discussed later) ratios and abundance to see if they are different in pollen and whether a change in HSF(s) could improve or modify the HS response of pollen.

EMBRYO DEVELOPMENT AND SEEDS The expression or detection of LMW HSP mRNAs in developing embryos of seeds from a number of different species including: sunflower (Almoguera and Jordano, 1992; Coca et al., 1994); sorghum (Howarth, 1990); pea (Vierling and Sun, 1989; DeRocher and Vierling, 1994); maize (Shen et al., 1994); and wheat (Helm and Abernethy, 1990) has been reported. Experiments performed under controlled environments demonstrated that expression of HSPs in seeds is due to endogenous developmental signals rather than stressful environmental signals (Coca et al., 1994; DeRocher and Vierling, 1994). Recent experiments using antibody detection of HSP17 demonstrated tissue-specific expression of HSP17 in developing seeds of different plant species including Lycopersicon esculentum, Pisum sativum, Zea mays, Vicia faba and Nicotiana rustica (zur Nieden et al., 1995). The intracellular localization showed species-specific variations, and, in contrast to heat stress, the developmentally regulated HSP17 is found mainly in the nucleus rather than forming large cytoplasmic aggregates (zur Nieden et al., 1995). HSP70 genes have also been shown to be differentially expressed during development. In pea leaves PsHSP71.2 is strictly heat inducible, PsHSC71.0 is present constitutively and PsHSP70b is constitutively expressed at low levels, but strongly induced by heat stress. PsHSP71.2 is also expressed in zygotic, but not maternal, organs of developing pea seeds, while PsHSC71.0 and PsHSP70b are expressed in maternal and zygotic organs throughout seed development (DeRocher and Vierling, 1995). Taken together these results further document the selective activation of HSP gene expression and the precise activation by specific HSP promoters under non-heat stress conditions. This selective activation of specific sets of HS promoters by developmental signals may be an important consideration for future use of HS promoters in engineering gene expression. Additional regulatory control of HS gene expression at the translational level was reported by Zimmerman et al. (1989) who showed that normal HSinduced transcription of HSP genes does not occur as undifferentiated carrot callus cells undergo the process of somatic embryogenesis. These globular embryos accumulate very low levels of HS mRNA for LMW HSPs (Zimmerman et al., 1989) and HSP70 (Lin et al., 1991) after HS, but are fully capable of synthesizing the full complement of HSPs at levels comparable to those of

07 Inducible Gene 07

3/9/99 12:03 PM

Page 103

Use of Heat-shock Promoters

103

heat-stressed callus cells (Zimmerman et al., 1989). The level of HSP synthesized is regulated by translational control where callus cells translate only a fraction of the abundant HS mRNAs they accumulate, while globular embryos more selectively translate the fewer HS mRNAs they contain (Zimmerman et al., 1989; Apuya and Zimmerman, 1995).

FLORAL DEVELOPMENT LMW HSPs are normally induced only under stress conditions except where a subset may accumulate during seed development or pollen maturation, as discussed. Expression in floral organs provides another example where LMW HSP genes are activated in response to developmental cues. An Arabidopsis HS promoter (HSP18.2) fused to the GUS reporter gene showed constitutive floral organ-specific expression under normal growth temperature (22°C). Under non-stress conditions the fusion gene is expressed in sepals, filaments and the styles of floral organs, suggesting the involvement of HSP18.2 gene during floral development (Tsukaya et al., 1993). Consistent with normal HS promoter activity, very high levels of GUS activity were induced by heat stress in all organs except seeds (Takahashi et al., 1992).

CONSTITUTIVE PROMOTERS WITH ENHANCED HEAT-SHOCK EXPRESSION Depending on the transgenic application of a promoter, one desirable expression type is constitutive expression at control temperatures but inducibility to higher levels upon HS. Two plant promoters with these general characteristics are the polyubiquitin genes, Ubi 1 and Ubi 2, from maize (Christensen et al., 1992) and the general stress gene, GmHsp26A, from soybean which encodes a glutathioneS-transferase (Czarnecka et al., 1984, 1988; Ulmasov et al., 1995). Studies among ubiquitin plant genes show some tissue specificity but most are constitutively expressed in all organs (Bond and Schlesinger, 1986; Finley et al., 1987; Burke et al., 1988; Christensen and Quail, 1989). The GmHsp26A gene has the additional property of being induced by many different stress agents or treatments (Czarnecka et al., 1984).

CONSTITUTIVE EXPRESSION OF LMW HSPS In general, the expression of LMW HSPs is programmed either by environmental stress or by special developmental situations. However, an example of constitutive expression of LMW HSPs is seen in the vegetative tissues of the resurrection plant Craterostigma plantagineum where expression was detected by immunocross-reactivity of antibodies raised to sunflower LMW HSPs. In

07 Inducible Gene 07

104

3/9/99 12:03 PM

Page 104

R.T. Nagao and W.B. Gurley

unstressed plants, the cross-reacting polypeptides showed homogeneous tissue distributions and were abundant in the roots and lower parts of the shoots (Alamillo et al., 1995).

WINTER ACCLIMATION Additional complexity of promoter function is indicated in woody plants where seasonal patterns of HSP70, cognate HSP70 (constitutive; HSC70) and BiP protein expression associated with winter acclimation were observed in each of eight species of woody plants (Wisniewski et al., 1996). Further research is required to determine whether the promoters of these genes contain specific environmental motifs for winter acclimation, or are induced, perhaps, by general desiccation stress. If non-HSE elements are responsible, prudence is required in the selection of a specific promoter for transgene expression, since many HS promoters may lack these specialized elements and may be inadequate to achieve the desired expression. It seems reasonable to suggest that this type of expression is a highly evolved extension to the HS response to insure HSP chaperone-like function during winter acclimation. The bulk of present data would suggest the need for this type of specialized function to be the exception rather than the rule.

INDUCTION BY OTHER STRESSES As research continues in the area of stress biology, more examples of selective expression of HSPs and HSP-like proteins associated with specific stresses, environmental factors or chemical agents are reported. One additional example to further illustrate the apparent diversity of potential inducing agents is the oxidative stress induction of a LMW HSP cDNA by ozone. In this example, a cDNA library from parsley plants was differentially screened using labelled reverse-transcribed poly(A+) RNA isolated from ozone-treated parsley plants (Eckey-Kaltenbach et al., 1997). In addition to isolating pathogenesis-related proteins (PR1-3 and PR1-4), a LMW HSP was also isolated. Northern analyses showed a transient induction of the three mRNA species after ozone fumigation. HS treatment resulted in an increase of LMW HSP mRNA, whereas no increase for transcripts of PR1-3 or PR1-4 was observed.

ORGANIZATION AND TYPES OF HEAT-SHOCK PROMOTERS Heat induction of gene expression is dependent on the presence of HS consensus elements (HSEs) in the promoter (Pelham, 1982). A trimer of the HS transcription factor (HSF) binds to these elements after the cell has experienced a heat stress and strongly activates transcription of HS genes (for review see Wu,

07 Inducible Gene 07

3/9/99 12:03 PM

Page 105

Use of Heat-shock Promoters

105

1995). For HSF1 in humans, the binding is very dependent on cooperativity between HSF trimers. This dependence on cooperativity in HSF binding is reflected in the organization of HS promoters which contain multiple HSEs with varying degrees of match to the consensus HSE core (5′-GAA-3′). A detailed functional analysis of the soybean Gmhsp15.5 promoter in vivo indicated that the optimum HSE core is preceded by an A and followed by G to give the sequence 5′-aGAAg-3′, or 5′-cTTCt-3′ depending on the orientation (Barros et al., 1992). Similar studies in Drosophila indicated that the core HSE is 5′-AGAAn-3′ (Cunniff and Morgan, 1994; Fernandes et al., 1994; Kroeger and Morimoto, 1994). For optimal function, an HSE must contain at least four recognizable HSE cores located 2 bp apart in an alternating array (5′-GAAnnTTCnnGAAnnTTC-3′). This provides for the binding of two trimers assuming that functional association of each HSF trimer with the promoter only requires that two of its subunits make strong contact with the promoter DNA (Perisic et al., 1989). There is usually at least one perfect HSE core within 30 bp upstream of TATAA embedded within a cluster of imperfect HSE cores to comprise site I (Fig. 7.1, class A) (Topol et al., 1985; Czarnecka-Verner et al., 1994; Wu, 1995). A single cluster of HSE cores usually contains one functional HSE. There are often two clusters of core elements located within approximately 120 bp upstream from the start of transcription (for plants see CzarneckaVerner et al., 1994; Gurley and Key, 1991). The first cluster at site I is TATAAproximal and usually shows greater homology to the HSE consensus. For full activation, HSFs must occupy both site I and site II clusters (Topol et al., 1985). In the Drosophila hsp70 promoter occupancy of the TATAA-distal site II is dependent on cooperative interactions with HSFs bound to site I. The affinity of HSF for site II is about ten times greater if site I is already occupied (Topol et al., 1985), and the cooperativity in binding between two adjacent HSEs is around 2000-fold (Xiao et al., 1991). Factors that affect HS promoter strength include the number and arrangement of HSE core sequences, the degree of match of HSE cores to the consensus, and the spacing between HSE clusters (Cohen and Meselson, 1984). The spacing of clusters determines the helical alignment of HSFs bound at the two sites which results in a periodic affect on the cooperativity of HSF binding, especially if one of the sites exhibits low affinity for HSF. However, if two high-affinity HSE sites are present, there is no requirement that the bound HSFs show stereo-specific alignment for transcriptional activation. Likewise, there seems to be no preferred alignment between HSFs and general transcription factors bound at the TATAA motif (Amin et al., 1994). In addition to HSEs, HS promoters usually contain auxiliary elements such as the GAGA factor binding site in Drosophila (Lee et al., 1992; Tsukiyama et al., 1994), or AT-rich elements in plants, that have little or no activity alone, but enhance heat-inducible expression when present upstream of HS genes (Czarnecka et al., 1992; Gurley et al., 1993). Proteins that bind auxiliary elements seem to facilitate the binding of HSF by occupying the promoter under non-stress conditions to keep the chromatin open and the HSEs and TATAA sequences accessible. In the case of the GAGA factor, nucleosome displacement

07 Inducible Gene 07

106

3/9/99 12:04 PM

Page 106

R.T. Nagao and W.B. Gurley

Fig. 7.1. General classes of heat-shock (HS) promoters. Class A promoters are primarily regulated by the binding of activated HSF under heat stress conditions. Auxiliary elements such as AT-rich sequences enhance the amplitude of heat induction. Class B promoters are also dependent on HSEs for activity, but require either specialized HSFs that are active under non-HS conditions, analogous to HSF2 in mammals, or tissue-specific recruitment of the normally stress-responsive HSF. The class B-1 promoter is designed to interact with specialized HSFs that do not rely on protein–protein cooperativity between trimers for DNA binding. The hypothetical class B-2 promoter illustrates a possible configuration involving other elements in addition to HSE cores that bind factors that are unable to activate transcription directly, but facilitate recruitment of HSF to the promoter to bind to the HSE. The third schematic shown with class B promoters represents a typical HS promoter (class A) that could be activated under non-HS conditions if hypothetical tissue-specific factors, or cellular conditions, activate the normal HSF which, in turn, would activate class A promoters in a developmentally specific manner. Class C promoters also usually contain HSEs but have other types of elements that independently activate transcription of HS genes under non-stress conditions. In some cases heat induction is minimal for class C promoters.

in vitro is ATP-dependent suggesting that chromatin remodelling involves an energy-dependent nucleosome sliding mechanism (Tsukiyama et al., 1994; Wall et al., 1995). There are also numerous examples of other types of cis-elements

07 Inducible Gene 07

3/9/99 12:04 PM

Page 107

Use of Heat-shock Promoters

107

being present in HS promoters intermingled with the HSE clusters. For example, steroid responsive elements are present in the Drosophila hsp23 and hsp27 genes (Kay et al., 1986; Riddihough and Pelham, 1986), and the human hsp70 gene contains elements for Sp1, CCAAT-box-binding factor (CTF) and the G1 element responsive to cell cycle activation (Greene et al., 1987; Morgan et al., 1987; Morgan, 1989; Taira et al., 1997). These additional elements have the ability to regulate transcription independently of the HSEs. In most organisms the arrangement and types of elements in HS promoters ranges from promoters containing only HSEs to those containing, in addition, multiple types of elements that confer varying degrees of HSEindependent regulation. The regulatory mechanisms of HS promoters can be grouped into three general classes, all of which typically show some degree of dependence on HSEs for activity (Fig. 7.1).

CLASS A PROMOTERS: TYPICAL HEAT-SHOCK REGULATION (HSEDEPENDENT) Heat-shock promoters with this type (Fig. 7.1, class A) are totally dependent on the binding of HSF proteins to HSEs at sites I and II or to clusters of HSEs that show less defined patterns of organization. Although the TATAA-proximal HSE cores usually show a relatively high degree of match with the consensus, HSEs having imperfect cores are quite common since the binding to imperfect cores is greatly facilitated by the cooperativity effect. Typical heat-regulated promoters often contain auxiliary cis elements as discussed above, but these elements are not strictly required for HSE function since experimental promoters with activity in plants have been constructed that only contain consensus HSEs (Strittmatter and Chua, 1987; Czarnecka et al., 1989; Treuter et al., 1993). The auxiliary elements probably exert their greatest effect in a natural context where HSEs are often imperfect and the chromatin may be less accessible than is the case in transient assays and in T-DNA-based vectors.

CLASS B PROMOTERS: HSE-DEPENDENT EXPRESSION RESPONSIVE TO DEVELOPMENTAL SIGNALS UNDER NON-HEAT-SHOCK CONDITIONS The defining characteristic for this class of promoter (class B) is its dependence on HSEs for developmental, or non-stress-related, induction. Although the details of mechanism have not been investigated for many promoters in this class, several scenarios seem plausible as outlined in Fig. 7.1. The first hypothetical model (class B-1) invokes a specialized-HSF binding to the HSEs and activating transcription without the involvement of other primary elements. The best example of this class of induction is hemin-induced hsp70 synthesis in human erythrocytes (Sistonen et al., 1992, 1994). Here transcription is mediated by HSF2 binding. Human HSF2 is not activated by heat stress

07 Inducible Gene 07

108

3/9/99 12:04 PM

Page 108

R.T. Nagao and W.B. Gurley

and is much less dependent on cooperativity in binding to multiple HSEs than HSF1 (Kroeger and Morimoto, 1994). It seems likely that the organization and degree of consensus match in the HSEs may be different for promoters targeted by HSF2 since imperfect sites cannot function well without the cooperativity effect. The degree of selectivity that HSF2 shows in promoter activation in mammalian cells is not well documented, but it seems feasible that the specificity in HSF2 versus HSF1 binding may reside in the organization and degree of homology in HSE cores, rather than in the presence of additional types of cis elements in the promoter. HSF2-regulated promoters are predicted to contain fewer, but higher consensus homology HSEs. Plants contain multiple classes of HSFs, but a group analogous to mammalian HSF2 has not been currently identified; thus, the applicability of class B-1 promoters to plants remains to be seen. There are also several other possible modes of regulation for developmentally specific, HSE-dependent activation. One mechanism illustrated in class B-2 promoters (Fig. 7.1) is that the HSF normally involved in the HS response may be recruited to the promoter under non-HS conditions in a tissue-specific manner, perhaps through interactions involving other regulatory factors that show a tissue-specific distribution. There are several theoretical ways in which the class B-2 promoter may function. In one scheme, as yet unidentified factors may bind to the promoter at their respective elements and recruit activated HSF through direct protein–protein interactions. These hypothetical factors are predicted to be unable to activate the promoter directly since class B-2 promoters are dependent on the presence of HSEs. A more likely scenario is that class B-2 promoters are highly synergistic in the recruitment of factors and components of the transcriptional preinitiation complex. In this model, illustrated in Fig. 7.2, the promoter contains low-affinity binding sites for HSFs (imperfect HSE cores) as well as imperfect binding sites for developmentally specific factors. The stable binding of both HSF and the developmental factor to the promoter would require that both types of factors simultaneously bind the promoter and make contact with components of the preinitiation complex which is loosely anchored to the promoter at the TATA motif. A three-way cooperativity involving the HSF, the developmental factor and the preinitiation complex would be required for a stable complex to exist. This model is most valid when all three sites of contact with the promoter are of low affinity and are, therefore, dependent on cooperative interactions with other proteins that also make contact with the promoter DNA. Although cooperative interactions at the promoter are most commonly thought to be involved in the recruitment of the preinitiation complex, the recruitment can function in the opposite direction with interactions by members of the preinitiation complex facilitating more stable binding of activator proteins to upstream elements. For example, the contribution of TBP–TATA interactions to activator-binding to low- and moderate-affinity sites upstream has been demonstrated using GAL4 DNA-binding domain–VP16 fusion proteins in yeast where the GAL4–VP16 fusion protein showed greater affinity for its binding site when a TATA motif was located nearby (Vashee and Kodadek, 1995).

07 Inducible Gene 07

3/9/99 12:04 PM

Page 109

Use of Heat-shock Promoters

109

Fig. 7.2. Hypothetical interactions of activator proteins and general transcription factors with two types of heat-shock (HS) promoters. The typical HS promoter (class A) is regulated by the binding of four trimers of the HSF to HSE sites I and II. Cooperative interactions between adjacent HSF trimers facilitate binding to the imperfect HSE cores of sites I and II. The class B-2 promoter is dependent on cooperativity in binding involving three components: HSF trimers; developmental factors; and the preinitiation complex. The affinity of each component alone for its respective binding site on the DNA is insufficient for promoter activation. Each component stabilizes the DNA binding of the other two components.

Note that the configuration of the class B-2 promoter is very similar to the class A promoter, with the main differences being the composition of the nonHSE elements and the affinities of the elements. Under non-stress conditions where the activated form of the heat stress-specific HSF is not abundant, the class B-2 promoter would only be activated under certain developmental situations as discussed above. However, during moderate to severe heat stress, the levels of activated HSF would be expected to be relatively high. Under these conditions, a class B-2 promoter may be activated due to the large amounts of

07 Inducible Gene 07

110

3/9/99 12:04 PM

Page 110

R.T. Nagao and W.B. Gurley

activated HSFs present in the nucleus that would override the need for cooperativity from developmentally specific factors in order to achieve inducible expression. A third possibility is that tissue-specific factors that bind to auxiliary elements may recruit HSF to the promoter under non-stress conditions. In this case, tissue- or developmentally specific recruitment of activated HSF present at low levels in non-stressed cells would provide the basis for the selective induction of a small subset of HS genes in select tissues. A problem with this last model is the need to postulate a highly efficient recruitment mechanism since activated HSF levels are likely to be very low under non-stress conditions. Alternatively, the interactions between the tissue-specific factor and HSF may result in HSF activation during the process of recruitment.

CLASS C PROMOTERS: MULTIPLE PATHWAY REGULATION (MIXTURE OF HSES AND OTHER ELEMENTS) The third class (class C) of HS promoters contains HSEs in addition to other cis elements that are unrelated to HSEs and independently regulated. These nonHSE elements differ from the auxiliary elements found in the first class of promoters in that they are capable of activating transcription alone. Promoters in this class have multiple mechanisms of induction, only one of which is dependent on HSEs (Sorger and Pelham, 1987). In non-plant sources, examples of these additional elements are the Sp1 element and CCAAT boxes in rat hsc73 (Sorger and Pelham, 1987) and human hsp70 (Morgan et al., 1987; Morgan, 1989), and the ecdysterone receptor-binding sequence in the Drosophila hsp27 gene (Mestril et al., 1986).

PLANT HEAT-SHOCK PROMOTERS In plants the distinctions between classes of HS promoters are not always clear. In most cases the difficulty in classification is due to the absence of information regarding the types of induction possible and the types of cis elements present in the promoter. Despite this lack of detailed information, many plant HS promoters can be tentatively placed into the first category (class A) since they appear to only be induced by heat and related stresses, and seem to contain no other recognizable consensus elements in the promoter. Examples include most of the promoters for the LMW HSPs (or small hsps, sHSPs) of soybean and other plants. Even though these genes are induced in vegetative tissues by a variety of stresses, including heavy metals, no study has unequivocally demonstrated the presence of functional elements other than typical HSEs and AT-rich auxiliary elements. In addition to heat-inducible expression, LMW HSPs are often expressed late in seed development at the stage associated with rapid desiccation, which

07 Inducible Gene 07

3/9/99 12:04 PM

Page 111

Use of Heat-shock Promoters

111

poses an interesting question of whether HSEs are capable of conferring a degree of developmental expression. Prändl and Schöffl (1996) showed that both heat-inducible expression and expression during late seed development were dependent on the presence of HSEs in the promoter. These experiments were conducted by monitoring the soybean Gmhsps17.3 B promoter and a minimal CaMV 35S promoter containing synthetic HSEs in transformed tobacco plants. The Gmhsps17.3 B promoter appears to represent a class B promoter with two clusters of HSE cores corresponding to sites I and II upstream from the putative TATA box; however, the spacing between several HSE cores is anomalous in site II. The function of site II may be aided by the presence of three CCAAT-box elements immediately upstream of site II from position 2312 to 2276 (Rieping and Schöffl, 1992). Although deletion of a region of the promoter containing the three putative CCAAT boxes greatly reduced transcriptional activity, it is not entirely clear that the CCAAT-box elements were responsible for activity since the DNA fragment in question also contained a cluster of two perfect and one imperfect HSE cores. Assuming that the normal stress-responsive HSFs are totally responsible for expression of the Gmhsps17.3 B promoter, expression in seeds under non-HS conditions suggests that a limited degree of developmental regulation may be imposed on class A HS promoters by the tissue distribution and abundance of the HSFs within the plant, not the promoter configuration. This conclusion is reinforced by the finding that DNA sequences controlling expression in seeds colocalized with HSEs in the Gmhsps17.3 B promoter and by the observation that seed expression could also be obtained by inserting synthetic HSE cores upstream of a minimal CaMV 35S TATA (Prändl and Schöffl, 1996). Superimposed on differential HSF distribution is the pattern physiological stress experienced by the different organs and tissues at any given stage of growth and development. Since LMW HSPs are often induced most strongly in mature leaves, vascular tissues and regions immediately above root tips (Prändl et al., 1995), the expectation is that HSFs will also be most abundant and physiological conditions optimal for HSF activation in these tissues. Expression in mature seeds is more problematic since expression is independent of prior heat stress. Two possible conditions may exist to explain this constitutive activity. One is that the normal stress-responsive HSF is activated by the special circumstances of the desiccating seed, and the other possibility is that a specialized HSF may be present in mature seeds that is activated by signals not related to heat stress. These two theoretical considerations for expression are incorporated in the description of HS promoters outlined in Fig. 7.1 by listing a class A promoter with the class B promoters as a special circumstance where a class A promoter may be expressed in a developmentally specific manner. In plants the best candidate for a HS promoter under multiple pathway control (class C) is the sunflower LMW HSP gene HaHsp17.7 G4 described by Almoguera et al. (1998). This gene is heat inducible in leaves and other vegetative tissues and is expressed in developing seeds. Expression in early seed maturation (16 days post-anthesis (dpa)) is independent of the HSE/HSF mechanism since

07 Inducible Gene 07

112

3/9/99 12:04 PM

Page 112

R.T. Nagao and W.B. Gurley

deletion of HSEs required for heat induction has little effect on early seed expression. The mechanism of promoter regulation changes during the course of seed maturation becoming increasingly dependent on HSEs by 20 and 28 days (late maturation or desiccation stage). Expression of HaHsp17.7 G4 in seeds occurs in the absence of heat stress at both early and late stages of development. Although it seems likely that expression during early maturation is HSE-independent, precise identification of the developmental element(s) responsible for expression at this stage is still not complete. This putative element has been mapped to a location within the site I HSE based on the results of a single construct that greatly reduced expression in 16 dpa seeds. A complicating factor is the lack of an easily recognizable non-HSE element at that location, while several other potential element motifs are located in the 5′ untranslated leader sequence. A more definitive identification of this seed maturation element awaits further study. The sunflower HaHsp17.6 G1 gene is expressed during seed development but is non-inducible by heat stress (Carranco et al., 1997). At present it is uncertain whether this promoter should be considered class B or class C depending on whether or not HSEs are involved in its expression. Although the HaHsp17.6 G1 promoter is not inducible by heat stress, a cluster of perfect and imperfect HSE cores is located approximately 50 bp upstream from the putative TATA box, a position that roughly corresponds to site II in class A promoters. It is possible that this HSE core interacts with HSFs in late maturation. However, the lack of heat-inducible expression in the seed and other tissues may indicate that additional factors are required for promoter activation to occur (class B-2 promoter, Figs 7.1 and 7.2). Without further information, it cannot be ruled out that a specialized HSF binds to the imperfect HSE at site II or that expression is completely independent of the HSEs and relies on uncharacterized elements. In the later case, the promoter would be classified as class C. Many genes encoding HSPs have been reported to be active in response to desiccation stress, ABA treatment, or in seeds, but in most cases it is not known whether their induction is dependent on HSEs (class B) or on other unrelated cis elements (class C). Although it seems likely that many of these promoters exhibit dual, or multiple pathway regulation, and should be considered as class C promoters, the involvement of HSEs in both heat stress and non-heat stress induction cannot be excluded.

HEAT-SHOCK TRANSCRIPTION FACTORS Many organisms have multiple HSFs that show varying degrees of specialization with regard to their role in the perception of environmental or developmental signals (for review see Wu, 1995). Of the four HSFs in mammals, only HSF1 is primarily specialized for responding to heat stress. HSF2 and HSF3 are involved in developmental expression of hsp genes, and HSF4 seems to have little activity and may play a role in keeping HS genes shut down under nonstress conditions (Nakai et al., 1997).

07 Inducible Gene 07

3/9/99 12:04 PM

Page 113

Use of Heat-shock Promoters

113

Multiple HSFs seem to be the rule in plants, with 14 characterized to date (for reviews see Nover et al., 1996; Nover and Scharf, 1997): three in tomato (Scharf et al., 1990, 1993; Treuter et al., 1993), five in soybean (CzarneckaVerner et al., 1995, 1998), three in maize (Gagliardi et al., 1995) and three in Arabidopsis (Hübel and Schöffl, 1994). Analysis of the amino acid composition of the highly conserved DNA-binding domains and the oligomerization domains indicates that plant HSFs can be grouped into two major phylogenetic classes, class A (eight members) and class B (six members) (Nover et al., 1996; Czarnecka-Verner et al., 1998). Both classes of HSFs appear to be widely distributed among plant species with class A1 present in tomato, maize and Arabidopsis; class A2 in tomato, maize, Arabidopsis and soybean; and class B HSFs present in soybean, tomato and Arabidopsis (Nover et al., 1996). Parsimony analysis of the DNA-binding domains of all known HSFs from plants, Drosophila, metazoans and fungi indicate that the plant classes are unique and cannot be easily assigned to functional groups such as HSF1 and HSF2 in animals by simple comparisons of amino acid sequence. The question of whether plants contain HSFs that are specialized for developmental roles (nonHS) analogous to HSF2 in mammals is still unresolved. In addition, there is no direct evidence that any of the heat-activated HSFs are tissue-specific in their distribution. It is known, however, that class A HSFs confer heat inducibility to HS promoters, and many of the class B HSFs are able to bind the HSE, but show no transcriptional activity in transient assays (Czarnecka-Verner et al., 1998). LpHSFB1 (LpHsf24) of tomato is in the B1 class, and is the only class B HSF to show transcriptional activity (Treuter et al., 1993). The finding that most of the class B HSFs lack transcriptional activity raises the possibility that these inactive HSFs function as repressors of HS genes under periods of non-stress (Czarnecka-Verner et al., 1998). The possibility of differential specificity in binding to HS promoters being exhibited by class A (activators) and class B (repressors) HSFs, with its implications regarding positive and negative regulation, is another parameter that must ultimately be considered in the design and use of HS promoters to engineer control of gene expression.

USE OF THE HEAT-SHOCK PROMOTER IN TRANSGENIC PLANT EXPERIMENTS The potential applications of a conditionally inducible promoter, such as an HS promoter, can be quite varied, encompassing a range of goals from the pursuit of basic research questions to targeted crop improvement, depending on the gene(s) of interest. For many purposes it is likely that any number of different HS promoters can be used. The first use of a HS promoter in plants was in the demonstration of conservation in HS promoter function by the heat-inducible transcription of the Drosophila hsp70 promoter in transgenic tobacco callus tissue (Spena et al., 1985) and later confirmed in regenerated tobacco plants (Spena and Schell, 1987). The direct involvement of the HSEs was shown when

07 Inducible Gene 07

114

3/9/99 12:04 PM

Page 114

R.T. Nagao and W.B. Gurley

the insertion of two overlapping HSE-like sequences into heterologous promoters conferred thermoinducibility in transgenic tobacco plants (Strittmatter and Chua, 1987). These experiments also demonstrated that the temperature of induction is independent of the origin of the promoter and dependent upon the induction temperature of the host plant. As illustration of other uses of HS promoters, a few selected examples will be presented.

RELATIVE STRENGTH OF HEAT-SHOCK PROMOTERS COMPARED WITH OTHER PLANT PROMOTERS Few studies have quantitatively compared the organ specificity and strength of different constitutive and inducible promoters. Holtorf et al. (1995) compared CaMV 35S, CaMV 35S-omega, Arabidopsis ubiquitin UBQ1, barley leaf thionin, the BTH6 promoter and a soybean HS promoter (GmHsp17.3B) in transgenic plants using the GUS reporter gene. The CaMV 35S promoter had the highest expression, which was enhanced two- to threefold by the addition of the TMV omega element without changing the organ specificity of expression. The barley thionin promoter was almost inactive, whereas the ubiquitin promoter expressed at an intermediate level. The soybean HS promoter was inducible up to 18-fold, but expression was lower than the ubiquitin promoter. It should be noted that while direct comparative promoter strength experiments have not been conducted for the HSP promoters, indirect evidence based on Northern analyses, hybrid-select translation and nuclear run-off transcription experiments indicate that GmHsp17.5E (see also below) is expressed at higher levels than GmHsp17.3B (Schöffl and Key, 1982; Kimpel et al., 1989; J. Key et al., Georgia, USA, unpublished data).

USE OF HEAT-SHOCK PROMOTERS TO ADDRESS QUESTIONS IN BASIC RESEARCH The soybean GmHsp17.3B HS promoter-gus fusion was used to analyse the HS response in tobacco and Arabidopsis (Prändl et al., 1995). It was shown that expression in both vegetative tissues and in developing seeds is dependent on HSEs located upstream of the TATA motif (Prändl and Schöffl, 1996). In both tobacco and Arabidopsis, high levels of GUS activity were detected in most vegetative tissues and also in flowers exclusively after heat stress with the highest levels of heat-inducible GUS activity found in the vascular tissues. As discussed above, developmental regulation of GUS activity was observed by the accumulation of high levels of GUS in transgenic tobacco seeds under non-stress conditions; however, the corresponding expression in seeds was not observed in transgenic Arabidopsis (Prändl et al., 1995). This lack of seed expression in Arabidopsis was unexpected, but underscores the need to carefully evaluate transgene expression in recipient plants, especially in the case of developmentally regulated promoters.

07 Inducible Gene 07

3/9/99 12:04 PM

Page 115

Use of Heat-shock Promoters

115

As outlined in the previous section, class B promoters can be regulated in several ways, some exclusively dependent on HSEs and specialized HSFs, and others relying in highly cooperative interactions between factors binding to developmentally regulated promoter elements and HSEs. Speculation regarding the lack of expression of GmHsp17.3B in Arabidopsis seeds is probably not useful until more is known regarding the types and activation states of HSFs present in Arabidopsis seeds through the course of embryonic development. Another example of the utilization of a HS promoter in basic research is the testing of antisense constructs of a tobacco Hsp70 gene to study thermotolerance and HSF regulation in Arabidopsis (Lee and Schöffl, 1996). In these experiments a tobacco Hsp70 gene in antisense orientation was cloned downstream of the soybean Gmhsp17.6-L HS promoter in order to reduce expression of endogenous Hsp70 genes in Arabidopsis. Northern analysis indicated that Hsp70 mRNA, which is only present after HS, was absent from antisense transgenic plants. Furthermore, Hsc70 mRNA, which is normally abundant at normal temperatures in wild-type plants, was markedly reduced in antisense transgenic plants and was totally absent after HS. In addition, Western analysis confirmed the reduction in HSP70 expression showing a significant reduction in HSP70/HSC70 proteins in transgenic antisense plants compared to wild-type Arabidopsis (Lee and Schöffl, 1996). The negative effect on the expression of Hsp70/Hsc70 transcripts was specific because mRNA levels of Hsp18 were heatinducible and detected at about the same levels in both transgenic and wild-type plants. The involvement of HSP70/HSC70 in the acquisition of thermotolerance was implied since heat stress assays indicated that basal thermotolerance (no prior heat stress) was not affected by underexpression of HSP70, but acquired thermotolerance (requires pre-shock treatment) was reduced by about 2°C. The conditional nature of HS promoter expression can also be exploited to look at the effects of over- or underexpression of non-HSP target genes. The conditional expression of the Hsp81-1 promoter of Arabidopsis was used to establish the subcellular localization of a small GTP-binding protein (ARA-4) in transgenic Arabidopsis plants (Ueda et al., 1996). Overexpression and heatinducible expression of this gene was examined, and at least two distinct forms of this protein were found in membrane and cytosolic fractions. The cytosolic form probably represents the unprocessed precursor. The membrane protein was predominantly localized on Golgi-derived vesicles, Golgi cisternae and the trans-Golgi network (Ueda et al., 1996). The inducibility of the Drosophila hsp70 promoter provided a useful experimental system to investigate the role of the T-6B oncogene of Agrobacterium on the growth and development of transgenic Nicotiana rustica (Tinland et al., 1992). Transformed progeny developed into normal plants, and hsp70-T-6b-construct expression was shown by Northern analysis and by heatdependent growth alterations at the level of whole seedlings. Upon wounding at normal temperature, hsp70-T-6b plants formed small tumours on leaves and stems. The tumour-forming agent was not diffusible. Protoplast cultures from hsp70-T-6b plants grew in the absence of hormones, unlike non-transformed

07 Inducible Gene 07

116

3/9/99 12:04 PM

Page 116

R.T. Nagao and W.B. Gurley

cells, which rapidly lost their sensitivity towards hormones and remained hormone sensitive for a significantly longer period. Thus, the T-6b gene product alters hormone sensitivity during the initial phases of protoplast culture (Tinland et al., 1992). The ability to induce T-6b expression, conferred by the HS promoter, was crucial to these experiments since premature expression would severely disturb normal development. In a novel application, the soybean HS gene promoter (GmHsp17.5E) has been used to direct heat-inducible expression of the FLP recombinase gene in plant cells, thereby regulating recombination mediated by the FLP/FRT system. This complex heterologous recombination system (yeast recombinase and soybean HS promoter) successfully altered stably transformed maize genomic DNA structure in vivo (Lyznik et al., 1995). The conditionally inducible activity of the GmHsp17.5E promoter in these experiments was increased approximately 100-fold over a comparable CaMV 35S regulated construct, demonstrating the effectiveness of the HS promoter in this application. In Arabidopsis, inducible expression of FLP recombinase was achieved from the soybean GmHsp17.6L HS promoter. The authors concluded from the results of these experiments that the timing of recombination leading to marked clonal sectors is readily controllable by the timing of the applied HS (Kilby et al., 1995).

TRANSIENT HEAT INDUCTION MAY BE SUFFICIENT TO ACHIEVE ADEQUATE EXPRESSION A heat-inducible expression cassette was constructed using the soybean GmHsp17.5E promoter to study the conditional expression of any sequence of interest in transgenic plants or plant tissues (Ainley and Key, 1990). The heatinducible production of a cytokinin in transgenic tobacco plants was tested by the insertion of an isopentenyl transferase gene into this HS cassette. Heatinduced synthesis of endogenous cytokinin produced several effects previously undocumented. Heat treatments of 1–2 h day21 for 1–4 days were sufficient for observable phenotypic changes 3–4 weeks after the heat treatment, indicating that transient heat induction is sufficient for expression (Ainley et al., 1993). Heat-inducible hygromycin resistance was attained in transgenic tobacco by a construct consisting of the soybean GmHsp17.5L promoter fused to a hygromycin phosphotransferase gene (Severin and Schöffl, 1990). Incubation for 1 h at 40°C daily, applied for several weeks, was sufficient to express a hygromycin-resistant phenotype. This experiment also demonstrates that in the case of an antibiotic selection screen, transient heat induction may be sufficient to accumulate enough product for resistance. These results raise the possibility that in other unrelated applications the HS promoter may be sufficiently induced by normal field growth conditions to make additional heat treatments unnecessary.

07 Inducible Gene 07

3/9/99 12:04 PM

Page 117

Use of Heat-shock Promoters

117

USE OF HEAT-SHOCK PROMOTER IN MUTAGENESIS SCREENS An HS promoter/reporter gene fusion was used in mutagenesis screens in an attempt to isolate HS response regulatory mutants. Such a screen was performed by Takahashi et al. (1992), where transgenic seeds from an Arabidopsis Hsp18.2 promoter/gus gene fusion were mutagenized and screened for the isolation of HS response-deficient regulatory mutants. Approximately 15,000 M2 plants were screened for decreased GUS inducibility of which three lines reproducibly exhibited reduced heat-inducible GUS activity in their progeny.

EXPRESSION OF GENES NORMALLY DOWN-REGULATED DURING THE HEAT-SHOCK RESPONSE One potentially very important use of HS gene promoters would be the expression of genes normally shut down during periods of high temperature stress. As described above, a general feature of the HS response is the cessation of the transcription and translation of most control temperature genes as the cell switches to synthesis of HSPs. Pathogenesis-related proteins (PR-proteins) are a heterogeneous group of host-encoded proteins that are induced in plants by pathogen attack or exposure to certain chemicals and are associated with the hypersensitive defence response. It has been reported that synthesis of PRproteins is suppressed upon shifting to elevated temperature (van Loon, 1975; Ohashi and Matsuoka, 1985). Thus, for many crop plants high-temperature stress suppresses the synthesis of defence proteins during a significant portion of the day when they are susceptible to pathogen infection. It is intriguing to speculate that natural pathogen resistance of many crop plants may be improved or extended by transformation with HS promoter/PR-protein fusions to induce expression of PR-proteins normally repressed by the HS response. If such constructs contribute to increased disease resistance, the economic and environmental benefits could be enormous, since increased disease resistance should lead directly to higher crop yields. Further economic benefit should be realized in that reduced application of chemicals may be required thus lowering the cost of production and the environmental burden of agrochemical application and its associated costs.

SUMMARY A unifying feature common to all conditions of HSP gene induction including, HS, development, dehydration or other stresses, is that each of these conditions or treatments can lead to the accumulation of denatured or abnormally folded proteins. Consistent with the chaperone concept of HSP function, the induction of HSP following these varied conditions serves to minimize and/or correct the

07 Inducible Gene 07

118

3/9/99 12:04 PM

Page 118

R.T. Nagao and W.B. Gurley

detrimental effects of misfolded proteins. It is apparent that not all HS promoters respond identically under similar conditions. Thus, the prudent investigator wanting to express a gene by an inducible HS promoter should try to match the expression profile of the gene in question with the optimum parameters desired for transgenic expression. For example, an experiment to use an HS promoter for conditional temperature induction of a toxic substance in transgenic plants may be impractical with many LMW HSP promoters because the inherent developmentally regulated expression could be lethal. Hence, selection of an HS promoter which is not developmentally regulated may be mandatory in certain circumstances. This applies to the inappropriate expression of any protein that can potentially interfere with development. Similar precautions would hold for unexpected results from other secondary inducers of HS promoter activity. While general precautions are easily stated, unfortunately in most cases sufficient experimental data to fully address the expression patterns of various HS promoters is unavailable to make a fully informed choice. Substantially more research is required to understand these and other parameters of the HS response to fully utilize the potential of the HSinducible promoter system. It is anticipated, however, that for most uses developmental gene expression or expression as a result of secondary inducers would not be a problem. In most situations, LMW HSP promoters would be suitable to achieve the highest inducible expression with minimal constitutive expression. If developmental expression is undesirable, a strictly heat-inducible Hsp70 promoter may be preferred because it may have lower developmental expression than some LMW HSP promoters, although further investigation would be required to confirm this. For some genes it may be desirable to have expression at normal temperatures and enhanced expression with elevated temperature. For such criteria an Hsp90 class promoter, or heat-inducible ubiquitin, or the soybean GmHsp26A promoter may be used. With further research, promoters with more desirable, or specialized, activation properties might be either identified or engineered. While there is a lot to be learned, the future is bright for the use of this inducible system for both investigation and crop improvement. The ever-increasing availability of transformation systems for plant species means that the ultimate potential will only be limited by the creative ingenuity and perseverance of scientists dedicated to basic research and the concept of making something better.

ACKNOWLEDGEMENTS We appreciate the technical assistance of Joyce Kochert in manuscript preparation. The research from the authors’ laboratories was supported by USDA grants 94-37100-0712 to J.L. Key and R.T. Nagao and by 95-37100-1617 to W.B. Gurley.

07 Inducible Gene 07

3/9/99 12:04 PM

Page 119

Use of Heat-shock Promoters

119

REFERENCES Ainley, W.M. and Key, J.L. (1990) Development of a heat shock inducible expression cassette for plants: characterization of parameters for its use in transient expression assays. Plant Molecular Biology 14, 949–967. Ainley, W.M., McNeil, K.J., Hill, J.W., Lingle, W.L., Simpson, R.B., Brenner, M.L., Nagao, R.T. and Key, J.L. (1993) Regulatable endogenous production of cytokinins up to ‘toxic’ levels in transgenic plants and plant tissues. Plant Molecular Biology 22, 13–23. Alamillo, J., Almoguera, C., Bartels, D. and Jordano, J. (1995) Constitutive expression of small heat shock proteins in vegetative tissues of the resurrection plant Craterostigma plantagineum. Plant Molecular Biology 29, 1093–1099. Almoguera, C. and Jordano, J. (1992) Developmental and environmental concurrent expression of sunflower dry-seed-stored low-molecular-weight heat-shock protein and Lea mRNAs. Plant Molecular Biology 19, 781–792. Almoguera, C., Prieto-Dapena, P. and Jordano, J. (1998) Dual regulation of a heat shock promoter during embryogenesis: stage-dependent role of heat shock elements. The Plant Journal 4, 437–446. Altschuler, M. and Mascarenhas, J.P. (1982) The synthesis of heat-shock and normal proteins at high temperatures in plants and their possible roles in survival under heat stress. In: Schlesinger, M.J., Ashburner, M. and Tissières, A. (eds) Heat Shock from Bacteria to Man. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, USA, pp. 321–327. Amin, J., Fernandez, M., Ananthan, J., Lis, J.T. and Voellmy, R. (1994) Cooperative binding of heat shock transcription factor to the Hsp70 promoter in vivo and in vitro. Journal of Biological Chemistry 269, 4804–4811. Apuya, N.R. and Zimmerman, J.L. (1995) Heat shock gene expression is controlled primarily at the translational level in carrot cells and somatic embryos. Plant Cell 4, 657–665. Arrigo, A.-P. and Landry, J. (1994) Expression and function of the low-molecular-weight heat shock proteins. In: Morimoto, R.I., Tissières, A. and Georgopoulos, C. (eds) The Biology of Heat Shock Proteins and Molecular Chaperones. Cold Spring Harbor Laboratory Press, Plainview, USA, pp. 335–373. Ashburner, M. and Bonner, J.J. (1979) The induction of gene activity in Drosophila by heat shock. Cell 17, 241–254. Atkinson, B.G., Raizada, M., Bouchard, R.A., Frappier, J.R.H. and Walden, D.B. (1993) The independent stage-specific expression of the 18-kDa heat shock protein genes during microsporogenesis in Zea mays L. Developmental Genetics 14, 15–26. Barros, M.D., Czarnecka, E. and Gurley, W.B. (1992) Mutational analysis of a plant heat shock element. Plant Molecular Biology 19, 665–675. Bond, U. and Schlesinger, M.J. (1986) The chicken ubiquitin gene contains a heat shock promoter and expresses an unstable mRNA in heat-shocked cells. Journal of Biological Chemistry 6, 4602–4610. Boston, R.S., Viitanen, P.V. and Vierling, E. (1996) Molecular chaperones and protein folding in plants. Plant Molecular Biology 32, 191–222. Bouchard, R.A. (1990) Characterization of expressed meiotic prophase repeat transcript clones of Lilium: meiosis-specific expression, relatedness, and affinities to small heat shock protein genes. Genome 33, 68–79. Burke, T.J., Callis, J. and Vierstra, R.D. (1988) Characterization of a polyubiquitin gene from Arabidopsis thaliana. Molecular and General Genetics 213, 435–443.

07 Inducible Gene 07

120

3/9/99 12:04 PM

Page 120

R.T. Nagao and W.B. Gurley

Carranco, R., Almoguera, C. and Jordano, J. (1997) A plant small heat shock protein gene expressed during zygotic embryogenesis, but non-inducible by heat stress. Journal of Biological Chemistry 272(43), 27470–27475. Christensen, A.H. and Quail, P.H. (1989) Sequence analysis and transcriptional regulation by heat shock of polyubiquitin transcripts from maize. Plant Molecular Biology 12, 619–632. Christensen, A.H., Sharrock, R.A. and Quail, P.H. (1992) Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Molecular Biology 18, 675–689. Coca, M.A., Almoguera, C. and Jordano, J. (1994) Expression of sunflower lowmolecular-weight heat-shock proteins during embryogenesis and persistence after germination: localization and possible functional implications. Plant Molecular Biology 25, 4790–4792. Cohen, R.S. and Meselson, M. (1984) Inducible transcription and puffing in Drosophila melanogaster transformed with hsp70-phage lambda hybrid heat shock genes. Proceedings of the National Academy of Sciences USA 81, 5509–5513. Cooper, P., Ho, T.-H.D. and Hauptmann, R.M. (1984) Tissue specificity of the heat shock response in maize. Plant Physiology 75, 431–441. Craig, E.A., Gambill, D. and Nelson, R.J. (1993) Heat shock proteins: molecular chaperones of protein biogenesis. Microbiological Reviews 57, 402–414. Cunniff, N.F.A. and Morgan, W.D. (1994) Analysis of heat shock element recognition by saturation mutagenesis of the human HSP70 gene promoter. Journal of Biological Chemistry 268, 8317–8324. Czarnecka, E., Edelman, L., Schöffl, F. and Key, J.L. (1984) Comparative analysis of physical stress responses in soybean seedlings using cloned heat shock cDNAs. Plant Molecular Biology 3, 45–58. Czarnecka, E., Nagao, R.T., Key, J.L. and Gurley, W.B. (1988) Characterization of Gmhsp26-A, a stress gene encoding a divergent heat shock protein of soybean: heavymetal-induced inhibition of intron processing. Molecular Cell Biology 8, 1113–1122. Czarnecka, E., Key, J.L. and Gurley, W.B. (1989) Regulatory domains of the Gmhsp17.5-E heat shock promoter of soybean: a mutational analysis. Molecular Cell Biology 9, 3457–3463. Czarnecka, E., Ingersoll, J.C. and Gurley, W.B. (1992) AT-rich promoter elements of soybean heat shock gene Gmhsp17.5E bind two distinct sets of nuclear proteins in vitro. Plant Molecular Biology 19, 985–1000. Czarnecka-Verner, E., Dulce-Barros, M. and Gurley, W.B. (1994) Regulation of heat shock gene expression. In: Basra, A.S. (ed.) Stress-Induced Gene Expression in Plants. Harwood Academic Publishers, Chur, Switzerland, pp. 131–161. Czarnecka-Verner, E., Yuan, C.-X., Fox, P.C. and Gurley, W.B. (1995) Isolation and characterization of six heat shock transcription factor genes from soybean. Plant Molecular Biology 29, 37–51. Czarnecka-Verner, E., Yuan, C.-X., Nover, L., Scharf, K.-D., Englich, G. and Gurley, W.B. (1998) Plant heat shock transcription factors: positive and negative aspects of regulation. Acta Physiologica Plantarum 19, 529–537. DeRocher, A.E. and Vierling, E. (1994) Developmental control of small heat shock protein expression during pea seed maturation. The Plant Journal 5, 93–102. DeRocher, A.E. and Vierling, E. (1995) Cytoplasmic HSP70 homologues of pea: differential expression in vegetative and embryonic organs. Plant Molecular Biology 27, 441–456.

07 Inducible Gene 07

3/9/99 12:04 PM

Page 121

Use of Heat-shock Promoters

121

Dietrich, P.S., Bouchard, R.A., Casey, E.S. and Sinibaldi, R.M. (1991) Isolation and characterization of a small heat shock protein gene from maize. Plant Physiology 96, 1268–1276. Duck, N.B. and Folk, W.R. (1994) Hsp70 heat shock protein cognate is expressed and stored in developing tomato pollen. Plant Molecular Biology 26, 1031–1039. Dupuis, I. and Dumas, C. (1990) Influence of temperature stress on in vitro fertilization and heat shock protein synthesis in maize (Zea mays L.) reproductive tissues. Plant Physiology 94, 665–670. Eckey-Kaltenbach, H., Kiefer, E., Grosskopf, E., Ernst, D. and Sandermann, H., Jr. (1997) Differential transcript induction of parsley pathogenesis-related proteins and of a small heat shock protein by ozone and heat shock. Plant Molecular Biology 33, 343–350. Ellis, R.J. and van der Vies, S.M. (1991) Molecular chaperones. Annual Review of Biochemistry 60, 321–347. Fernandes, M., Xiao, H. and Lis, J.T. (1994) Fine structure analyses of the Drosophila and Saccharomyces heat shock factor–heat shock interactions. Nucleic Acids Research 22, 167–173. Finley, D., Özkaynak, E. and Varshavsky, A. (1987) The yeast polyubiquitin gene is essential for resistance to high temperatures, starvation, and other stresses. Cell 48, 1035–1046. Frova, C., Taramino, G. and Binelli, G. (1989) Heat-shock proteins during pollen development in maize. Developmental Genetics 10, 324–332. Frova, C., Taramino, G. and Ottaviano, E. (1991) Sporophytic and gametophytic heat shock protein synthesis in Sorghum bicolor. Plant Science 73, 35–44. Gagliardi, D., Breton, C., Chaboud, A., Vergne, P. and Dumas, C. (1995) Expression of heat shock factor and heat shock protein 70 genes during maize pollen development. Plant Molecular Biology 29, 841–856. Georgopoulos, C. and Welch, W.J. (1993) Role of the major heat shock proteins as molecular chaperones. Annual Review of Cell Biology 9, 601–634. Gething, M.-J. and Sambrook, J. (1992) Protein folding in the cell. Nature 355, 33–45. Greene, J.M., Larin, Z., Taylor, I.C.A., Prentice, H., Gwinn, K.A. and Kingston, R.E. (1987) Multiple basal elements of a human hsp 70 promoter function differently in human and rodent cell lines. Molecular Cell Biology 7, 3646–3655. Gurley, W.B. and Key, J.L. (1991) Transcriptional regulation of the heat-shock response: a plant perspective. Biochemistry 30, 1–12. Gurley, W.B., Czarnecka, E. and Barros, M.D.C. (1993) Anatomy of a soybean heat shock promoter. In: Verma, D.P.S. (ed.) Control of Plant Gene Expression. CRC Press, Boca Raton, Florida, USA, pp. 103–123. Helm, K.W. and Abernethy, R.H. (1990) Heat shock proteins and their mRNAs in dry and early imbibing embryos of wheat. Plant Physiology 93, 1626–1633. Hendrick, J.P. and Hartl, F.-U. (1993) Molecular chaperone functions of heat-shock proteins. Annual Review of Biochemistry 62, 349–384. Herrero, M.P. and Johnson, R.R. (1980) High temperature stress and pollen viability of maize. Crop Science 20, 796–800. Hershko, A. (1988) Ubiquitin-mediated protein degradation. Journal of Biological Chemistry 263, 15237–15240. Holtorf, S., Apel, K. and Bohlmann, H. (1995) Comparison of different constitutive and inducible promoters for the overexpression of transgenes in Arabidopsis thaliana. Plant Molecular Biology 29, 637–646.

07 Inducible Gene 07

122

3/9/99 12:04 PM

Page 122

R.T. Nagao and W.B. Gurley

Hopf, N., Plesofsky-Vig, N. and Brambl, R. (1992) The heat shock response of pollen and other tissues of maize. Plant Molecular Biology 19, 623–630. Howarth, C. (1990) Heat shock proteins in Sorghum bicolor and Pennisetum americanum. II. Stored RNA in sorghum seed and its relationship to heat shock protein synthesis during germination. Plant, Cell and Environment 13, 57–64. Hübel, A. and Schöffl, F. (1994) Arabidopsis heat shock factor: isolation and characterization of the gene and the recombinant protein. Plant Molecular Biology 26, 353–362. Kay, R.J., Boissy, R.J., Russnak, R.H. and Candido, E.P.M. (1986) Efficient transcription of a Caenorhabditis elegans heat shock gene pair in mouse fibroblasts is dependent on multiple promoter elements which can function bidirectionally. Molecular Cell Biology 6, 3134–3143. Key, J.L., Lin, C.Y. and Chen, Y.M. (1981) Heat shock proteins of higher plants. Proceedings of the National Academy of Sciences USA 78, 3526–3530. Kilby, N.J., Davies, G.J., Snaith, M.R. and Murray, J.A.H. (1995) FLP recombinase in transgenic plants: constitutive activity in stably transformed tobacco and generation of marked cell clones in Arabidopsis. The Plant Journal 8, 637–652. Kimpel, J.A. and Key, J.L. (1985) Heat shock in plants. Trends in Biochemical Science 10, 353–357. Kimpel, J.A., Nagao, R.T., Goekjian, V. and Key, J.L. (1989) Regulation of the heat shock response in soybean seedlings. Plant Physiology 94, 988–995. Kroeger, P.E. and Morimoto, R.I. (1994) Selection of new HSF1 and HSF2 DNA-binding sites reveals differences in trimer cooperativity. Molecular Cell Biology 14, 7592–7603. LaFayette, P.R., Nagao, R.T., O’Grady, K., Vierling, E. and Key, J.L. (1996) Molecular characterization of cDNAs encoding low-molecular-weight heat shock proteins of soybean. Plant Molecular Biology 30, 159–169. Landry, S.J. and Gierasch, L.M. (1994) Polypeptide interactions with molecular chaperones and their relationship to in vivo protein folding. Annual Review of Biophysics and Biomolecular Structure 23, 645–669. Lee, H., Kraus, K.W., Wolfner, M.F. and Lis, J.T. (1992) DNA sequence requirements for generating paused polymerase at the start of hsp70. Genes and Development 6, 284–295. Lee, J.H. and Schöffl, F. (1996) An Hsp70 antisense gene affects the expression of HSP70/HSC70, the regulation of HSF, and the acquisition of thermotolerance in transgenic Arabidopsis thaliana. Molecular and General Genetics 252, 11–19. Lee, Y.-R.J., Nagao, R.T. and Key, J.L. (1994) A soybean 101-kD heat shock protein complements a yeast HSP104 deletion mutant in acquiring thermotolerance. Plant Cell 6, 1889–1897. Lin, C.Y., Roberts, J.K. and Key, J.L. (1984) Acquisition of thermotolerance in soybean seedlings: synthesis and accumulation of heat shock proteins and their cellular localization. Plant Physiology 74, 152–160. Lin, X.Y., Chern, M.S. and Zimmerman, J.L. (1991) Cloning and characterization of a carrot hsp70 Gene. Plant Molecular Biology 17, 1245–1249. Lindquist, S. and Craig, E.A. (1988) The heat shock proteins. Annual Review of Genetics 22, 631–677. Lyznik, L.A., Hirayama, L., Rao, K.V., Abad, A. and Hodges, T.K. (1995) Heat-inducible expression of FLP gene in maize cells. The Plant Journal 8, 177–186. Mansfield, M.A. and Key, J.L. (1987) Synthesis of the low molecular weight heat shock proteins in plants. Plant Physiology 84, 1007–1017.

07 Inducible Gene 07

3/9/99 12:04 PM

Page 123

Use of Heat-shock Promoters

123

Mascarenhas, J.P. and Crone, D.E. (1996) Pollen and the heat shock response. Sexual Plant Reproduction 9, 370–374. Mestril, R., Schiller, P., Amin, J., Klapper, H., Ananthan, J. and Voellmy, R. (1986) Heatshock and ecdysterone activation of the Drosophila hsp23 gene: a sequence element implied in developmental regulation. The EMBO Journal 5, 1667–1673. Morgan, W.D. (1989) Transcription factor Sp1 binds to and activates a human hsp70 gene promoter. Molecular Cell Biology 9, 4099–4104. Morgan, W.D., Williams, G.T., Morimoto, R.I., Greene, J., Kingston, R.E. and Tjian, R. (1987) Two transcriptional activators, CCAAT-box-binding transcription factor and heat shock transcription factor, interact with a human hsp70 gene promoter. Molecular Cell Biology 7, 1129–1138. Morimoto, R.I., Tissières, A. and Georgopoulos, C. (1994) Progress and perspectives on the biology of heat shock proteins and molecular chaperones. In: Morimoto, R.I., Tissières, A. and Georgopoulos, C. (eds) The Biology of Heat Shock Proteins and Molecular Chaperones. Cold Spring Harbor Laboratory Press, Plainview, USA, pp. 1–30. Nagao, R.T., Kimpel, J.A., Vierling, E. and Key, J.L. (1986) The heat shock response: a comparative analysis. In: Miflin, B.J. (ed.) Oxford Surveys of Plant Molecular & Cell Biology, Vol. 3. Oxford University Press, Oxford, UK, pp. 384–438. Nakai, A., Tanabe, M., Kawazoe, Y., Inazawa, J., Morimoto, R.I. and Nagata, K. (1997) HSF4, a new member of the human heat shock factor family which lacks properties of a transcriptional activator. Molecular Cell Biology 17, 469–481. Nover, L. and Scharf, K.-D. (1997) Heat stress proteins and transcription factors. Cell and Molecular Life Sciences 53, 80–103. Nover, L., Scharf, K.-D., Gagliardi, D., Vergne, P., Czarnecka-Verner, E. and Gurley, W.B. (1996) The HSF world: classification and properties of plant heat shock stress transcription factors. Cell Stress and Chaperones 1, 215–223. Ohashi, Y. and Matsuoka, K. (1985) Synthesis of stress proteins in tobacco leaves. Plant Cell Physiology 26, 473–480. Parsell, D.A. and Lindquist, S. (1993). The function of heat-shock proteins in stress tolerance: degradation and reactivation of damaged proteins. Annual Review of Genetics 27, 437–496. Parsell, D.A. and Lindquist, S. (1994) Heat shock proteins and stress tolerance. In: Morimoto, R.I., Tissières, A. and Georgopoulos, C. (eds) The Biology of Heat Shock Proteins and Molecular Chaperones. Cold Spring Harbor Laboratory Press, Plainview, USA, pp. 457–494. Pauli, D. and Tissières, A. (1990) Developmental expression of the heat shock genes in Drosophila melanogaster. In: Morimoto, R.I., Tissières, A. and Georgopoulos, C. (eds) Stress Proteins in Biology and Medicine. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, USA, pp. 361–378. Pelham, H.R.B. (1982) A regulatory upstream promoter element in the Drosophila HSP70 heat-shock gene. Cell 30, 517–528. Perisic, O., Xiao, H. and Lis, J.T. (1989) Stable binding of Drosophila heat shock factor to head-to-head and tail-to-tail repeats of a conserved 5 bp recognition unit. Cell 59, 797–806. Prändl, R. and Schöffl, F. (1996) Heat shock elements are involved in heat shock promoter activation during tobacco seed maturation. Plant Molecular Biology 31, 157–162. Prändl, R., Kloske, E. and Schöffl, F. (1995) Developmental regulation and tissue-specific differences of heat shock gene expression in transgenic tobacco and Arabidopsis plants. Plant Molecular Biology 28, 73–82.

07 Inducible Gene 07

124

3/9/99 12:04 PM

Page 124

R.T. Nagao and W.B. Gurley

Riddihough, G. and Pelham, H.R.B. (1986) Activation of the Drosophila hsp27 promoter by heat shock and by ecdysone involves independent and remote regulatory sequences. The EMBO Journal 5, 1653–1658. Rieping, M. and Schöffl, F. (1992) Synergistic effect of upstream sequences, CCAAT box elements, and HSE sequences for enhanced expression of chimeric heat shock genes in transgenic tobacco. Molecular and General Genetics 231, 226–232. Ritossa, F. (1962) A new puffing pattern induced by heat shock and DNP in Drosophila. Experimentia 18, 571–573. Sanchez, Y. and Lindquist, S. (1990) HSP104 required for induced thermotolerance. Science 248, 1112–1115. Scharf, K.-D., Rose, S., Zott, W., Schöffl, F. and Nover, L. (1990) Three tomato genes code for heat stress transcription factors with a region of remarkable homology to the DNA-binding domain of the yeast HSF. The EMBO Journal 9, 4495–4501. Scharf, K.-D., Rose, S., Thierfelder, J. and Nover, L. (1993) Two cDNAs for tomato heat stress transcription factors. Plant Physiology 102, 1355–1356. Schirmer, E.C., Lindquist, S. and Vierling, E. (1994) An Arabidopsis heat shock protein complements a thermotolerance defect in yeast. Plant Cell 6, 1899–1909. Schöffl, F. and Key, J.L. (1982) An analysis of mRNAs for a group of heat shock proteins of soybean using cloned cDNAs. Journal of Molecular and Applied Genetics 1, 301–314. Schrauwen, J.A.M., Reijnen, W.H., De Leeuw, H.C.G.M. and van Herpen, M.M.A. (1986) Response of pollen to heat stress. Acta Botanica Neerlandica 35, 321–327. Severin, K. and Schöffl, F. (1990) Heat-inducible hygromycin resistance in transgenic tobacco. Plant Molecular Biology 15, 827–833. Shen, B., Carneiro, N., Torres-Jerez, I., Stevenson, B., McCreery, T., Helentjaris, T., Baysdorfer, C., Almira, E., Ferl, R.J., Habben, J.E. and Larkins, B. (1994) Partial sequencing and mapping of clones from two maize cDNA libraries. Plant Molecular Biology 26, 1085–1101. Sistonen, L., Sarge, K.D., Phillips, B., Abravaya, K. and Morimoto, R.I. (1992) Activation of heat shock factor 2 during hemin-induced differentiation of human erythroleukemia cells. Molecular Cell Biology 12, 4104–4111. Sistonen, L., Sarge, K.D. and Morimoto, R.I. (1994) Human heat shock factors 1 and 2 are differentially activated and can synergistically induce hsp70 gene transcription. Molecular Cell Biology 14, 2087–2099. Sorger, P.K. and Pelham, H.R.B. (1987) Cloning and expression of a gene encoding hsc73, the major hsp70-like protein in unstressed rat cells. The EMBO Journal 6, 993–998. Spena, A. and Schell, J. (1987) The expression of a heat-inducible chimeric gene in transgenic tobacco plants. Molecular and General Genetics 206, 436–440. Spena, A., Hain, R., Ziervogel, U., Saedler, H. and Schell, J. (1985) Construction of a heatinducible gene for plants. Demonstration of heat-inducible activity of the Drosophila hsp70 promoter in plants. The EMBO Journal 4, 2739–2743. Strittmatter, G. and Chua, N.H. (1987) Artificial combination of two cis-regulatory elements generates a unique pattern of expression in transgenic plants. Proceedings of the National Academy of Sciences USA 84, 8986–8990. Taira, T., Narita, T., Iguchi-Ariga, S.M. and Ariga, H. (1997) A novel G1-specific enhancer identified in the human heat shock protein 70 gene. Nucleic Acids Research 25, 1975–1983. Takahashi, T., Naito, S. and Komeda, Y. (1992) The Arabidopsis HSP 18.2 promoter/GUS gene fusion in transgenic Arabidopsis plants: a powerful tool for the isolation of regulatory mutants of the heat-shock response. The Plant Journal 2, 751–761.

07 Inducible Gene 07

3/9/99 12:04 PM

Page 125

Use of Heat-shock Promoters

125

Tinland, B., Fournier, P., Heckel, T. and Otten, L. (1992) Expression of a chimeric heatshock-inducible Agrobacterium 6b oncogene in Nicotiana rustica. Plant Molecular Biology 18, 921–930. Topol, J., Ruden, D.M. and Parker, C.S. (1985) Sequences required for in vitro transcriptional activation of a Drosophila hsp70 gene. Cell 42, 527–537. Treuter, E., Nover, L., Ohme, K. and Scharf, K.-D. (1993) Promoter specificity and deletion analysis of three heat stress transcription factors of tomato. Molecular and General Genetics 240, 113–125. Tsukaya, H., Takahashi, T., Naito, S. and Komeda, Y. (1993) Floral organ-specific and constitutive expression of an Arabidopsis thaliana heat-shock HSP18.2:GUS fusion gene is retained even after homeotic conversion of flowers by mutation. Molecular and General Genetics 237, 26–32. Tsukiyama, T., Becker, P.B. and Wu, C. (1994) ATP-dependent nucleosome disruption at a heat-shock promoter mediated by binding of GAGA transcription factor. Nature 367, 525–532. Ueda, T., Anai, T., Tsukaya, H., Hirata, A. and Uchimiya, H. (1996) Characterization and subcellular localization of a small GTP-binding protein (Ara-4) from Arabidopsis: conditional expression under control of the promoter of the gene for heat-shock protein HSP81-1. Molecular and General Genetics 250, 533–539. Ulmasov, T., Ohmiya, A., Hagen, G. and Guilfoyle, T. (1995) The soybean GH2/4 gene that encodes a glutathione S-transferase has a promoter that is activated by a wide range of chemical agents. Plant Physiology 108, 919–927. van Loon, L.C. (1975) Polyacrylamide disk electrophoresis of the soluble leaf proteins from Nicotiana tabacum var. ‘Samsun’ and ‘Samsun NN’. III. Influence of temperature and virus strain on changes induced by tobacco mosaic virus. Physiological Plant Pathology 6, 289–300. Vashee, S. and Kodadek, T. (1995) The activation domain of GAL4 protein mediates cooperative promoter binding with general transcription factors in vivo. Proceedings of the National Academy of Sciences USA 92, 10683–10687. Vierling, E. (1991) The roles of heat shock proteins in plants. Annual Review of Plant Physiology and Plant Molecular Biology 42, 579–620. Vierling, E. and Sun, A. (1989) Developmental expression of heat shock proteins in higher plants. In: Cherry, J. (ed.) Environmental Stress in Plants. Springer-Verlag, Berlin, pp. 343–354. Wall, G., Varga-Weisz, P.D., Sandaltzopoulos, R. and Becker, P.B. (1995) Chromatin remodeling by GAGA factor and heat shock factor at the hypersensitive Drosophila hsp26 promoter in vitro. The EMBO Journal 14, 1727–1736. Ward, E.R., Ryals, J.A. and Miflin, B.J. (1993) Chemical regulation of transgene expression in plants. Plant Molecular Biology 22, 361–366. Waters, E.R., Lee, G.L. and Vierling, E. (1996) Evolution, structure and function of the small heat shock proteins in plants. Journal of Experimental Botany 47, 325–338. Wisniewski, M., Close, T.J., Artlip, T. and Arora, R. (1996) Seasonal patterns of dehydrins and 70-kDa heat-shock proteins in bark tissues of eight species of woody plants. Physiologia Plantarum 96, 496–505. Wu, C. (1995) Heat shock transcription factors: structure and regulation. Annual Review of Cell Developmental Biology 11, 441–469. Xiao, C.M. and Mascarenhas, J.P. (1985) High temperature-induced thermotolerance in pollen tubes of Tradescantia and heat-shock proteins. Plant Physiology 78, 887–890.

07 Inducible Gene 07

126

3/9/99 12:04 PM

Page 126

R.T. Nagao and W.B. Gurley

Xiao, H., Perisic, O. and Lis, J.T. (1991) Cooperative binding of Drosophila heat shock factor to arrays of a conserved 5 bp unit. Cell 64, 585–593. Zarsky, V., Garrido, D., Eller, N., Tupy, J., Vicente, O., Schöffl, F. and Heberle-Bors, E. (1995) The expression of a small heat shock gene is activated during induction of tobacco pollen embryogenesis by starvation. Plant, Cell and Environment 18, 139–147. Zimmerman, J.L. and Cohill, P.R. (1991) Heat shock and thermotolerance in plant and animal embryogenesis. New Biologist 3, 641–650. Zimmerman, J.L., Apuya, N., Darwish, K. and O’Carroll, C. (1989) Novel regulation of heat shock genes during carrot somatic embryo development. Plant Cell 1, 1137–1146. zur Nieden, U., Neumann, D., Bucka, A. and Nover, L. (1995) Tissue-specific localization of heat-stress proteins during embryo development. Planta 196, 530–538.

08 Inducible Gene 08

3/16/99 11:16 AM

Page 127

Wound-inducible Genes in Plants

8

Lan Zhou and Robert Thornburg Department of Biochemistry and Biophysics, Iowa State University, Ames, IA 50011, USA

INTRODUCTION All living organisms are involved in a constant struggle with and against other organisms to exploit their environment. Every organism exploits its own environmental niche to gain nutrients for growth and development. However, when multiple organisms interact, then a direct competition is established between those organisms. The organism that is better able to compete usually has an evolutionary advantage and is assured of survival. Some organisms move when in direct competition, however, because of their sedentary lifestyle, plants generally can not. Instead, plants have developed very potent biochemical responses that serve to protect their integrity and to limit the invasive nature of the competing organisms. Structurally, plants have a polyester coating composed of cutin and suberin (Kolatakuddy, 1980). This coating normally isolates the plant tissues from competing organisms and plants are therefore relatively immune from the presence of these competitors even on their surface. However, if a break or wound occurs in this surface coating, then competing organisms gain entrance into the plant’s tissues where they can cause injurious damage to those tissues. Consequently, plants have developed a complex response to wounding that dramatically alters the cellular physiology of plant tissues and results in the activation of defences. These defences are particularly potent against microorganisms and are even effective against small herbivores. The response of plants to wounding has been studied since the early 1970s when Green and Ryan (1972) discovered that an inhibitor of chymotrypsin in tomato leaves accumulated in response to wounding. Further, because chymotrypsin-like proteins do not occur in plants, but are common in insect © CAB International 1999. Inducible Gene Expression (ed. P.H.S. Reynolds)

127

08 Inducible Gene 08

128

3/16/99 11:16 AM

Page 128

L. Zhou and R. Thornburg

digestive tracts, they concluded that this inhibitor was part of a woundresponsive plant defence system. Since that time, at least 70 other proteins have been identified as also being wound-inducible. Appendix 8.1 provides a list of different genes that have been demonstrated to be wound-inducible. This list is not meant to be all inclusive, but it does give a broad perspective of both the number and classes of plant genes that have been identified to date as being wound-inducible. Many of these genes are discussed in some detail below. In addition, Appendix 8.1 provides additional information about the modes of regulation where known for each particular gene. In some cases, genes encoding a particular protein have been described from multiple species. There are sometimes differences in regulation of the genes between species for individual genes. In addition, many of the genes listed in Appendix 8.1 are members of multigene families. In these cases, the several members are often differentially regulated, with only one or a few members of the family being wound-inducible. Any attempt to adequately discuss the expression of 70 different proteins from at least 38 species across 20 families would result in a morass of contradictory information. We will, therefore, limit this chapter to two areas of discussion. First, because of this large number of proteins that are induced in response to a wound, we can identify the classes of proteins produced and begin to draw some conclusions about overall biochemical processes that are important in response to a wound. Secondly, there are a few wound-inducible proteins and their genes that have been studied in great detail, and the mechanisms of gene activation of several seemingly unrelated proteins (i.e. proteinase inhibitors of the Solanaceae and vegetative storage proteins of the Fabaceae) share many details of gene activation. Therefore, we will also examine the details of the mechanisms of gene activation for these well-studied systems.

THE MULTIPLE PHASES OF A WOUND RESPONSE Wounding results in the activation of many different genes within a plant. The types of genes and the timing of their activation allows the identification of different phases following a wound. Each of these phases of the woundinduction process biochemically solves a different problem that wounding causes the plant. These problems include: placing mechanical barriers to invading organisms; sealing the wound tissue; activating defensive compounds against invading organisms; and recovering from the wound. The sum of these processes results in recovery from a wound and a return to normal physiology.

The hydrogen peroxide response The initial phase of a wound-response is a rapid reaction to close the wound thereby protecting the plant from loss of cellular components and restricting

08 Inducible Gene 08

3/16/99 11:16 AM

Page 129

Wound-inducible Genes

129

entry of microorganisms into the plant tissues. This is composed of at least two general processes. Initially there is an almost immediate oxidative burst that results in a cross-linking of plant cell wall proteins (Bradley et al., 1992; Brisson et al., 1994). This oxidative burst can be detected within 15 s. The cross-linking of the cell wall proteins provides a structural barrier that inhibits the invasion of microorganisms. In addition, H2O2 from this oxidative burst is thought to activate some of the wound-inducible genes (Levine et al., 1994). Because H2O2 is itself toxic to plant cells (Lachman, 1986), numerous peroxidases are produced in response to a wound to limit peroxide accumulation (Diehn et al., 1993; Mohan et al., 1993).

Up-regulation of phenylpropanoids In addition to this peroxide response, there is a general up-regulation of genes encoding the phenylpropanoid pathway. The kinetics of this activation are also extremely rapid, with new mRNAs for these enzymes appearing within 15 min (Lawton et al., 1983; Templeton and Lamb, 1988). This up-regulation of the phenylpropanoid pathway genes may be regulated by the H2O2 burst because the direct addition of H2O2 to bean suspension cells induced the accumulation of mRNAs encoding phenylalanine ammonia-lyase, chalcone synthase and chalcone isomerase (Mehdy, 1994). The function of the up-regulation of these genes is to provide the cell with lignin precursors which can reseal the wounded surface and to provide cells with precursors of phenolic plant-defensive compounds.

Inactivation of photosynthetic translation The second phase of the wound response particularly in monocots, is a turn-off of photosynthetic protein translation by arresting the translation of nuclearencoded photosynthetic genes (Criqui et al., 1992; Reinbothe et al., 1993c). Because maintenance of the photosynthetic apparatus represents a major expenditure of cellular energy, repressing the synthesis of new proteins would save energy for the plant following the wound. Among these down-regulated proteins are those for the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (SSU, rbcS gene product) and several light-harvesting chlorophyll protein complex apoproteins (LHCPs, cab gene products). However, the changes in protein synthesis do not correspond to equivalent changes in the rbcS and cab transcript levels. Rather, these mRNAs are shifted to smaller polysomes in methyl jasmonate-exposed leaf tissues (Reinbothe et al., 1993a). Control mRNAs encoding leucyl-tRNA synthetase (LRS1, lrs1 gene product) neither changed its abundance nor its association with polysomes in methyl jasmonate-treated leaves and was translated into the corresponding polypeptide.

08 Inducible Gene 08

130

3/16/99 11:16 AM

Page 130

L. Zhou and R. Thornburg

Several mechanisms are responsible for this altered regulation of the photosynthetic machinery. First, methyl jasmonate induces a shift in the 5′ untranslated region of the rbcL transcript (Reinbothe et al., 1993b). The primary transcript is initiated at 2316 from the translation start codon. Under normal conditions, the 5′ end of the mature rbcL transcript is processed to yield a mRNA with a 59 bp 5′ untranslated region. Following jasmonate treatment, the mRNA is alternatively processed to give a 94 bp untranslated region. This alternatively spliced transcript contains within the 5 ′ untranslated region, a 35-base motif that has high complementarity to the 3 ′-terminus of the 16S rRNA. That portion of the 16S rRNA is involved in intramolecular base pairings within the ribosome and can associate with 30S but not with 70S complexes. Normal transcripts lacking this 35-base motif are active in terms of translation initiation. However, those transcripts having this sequence interfere with translation initiation by competing for ribosome binding leading to down-regulation of the large subunit which in turn leads to regulation of the small subunit. A second method that plants use to alter protein synthesis in stressed plant tissues involves the expression of ribosome-inactivating proteins. These have also been most highly studied in barley. One of these proteins, previously identified as a 60 kDa jasmonate-induced protein (JIP60), has been shown to cleave polysomes into ribosomal subunits (Chaudhry et al., 1994; Reinbothe et al., 1994b). Finally, chaperonins that interact with ribulose bisphosphate carboxylase/ oxygenase are also strongly repressed following wounding (Zabaleta et al., 1994), thereby further indicating the role of wounding on inhibition of photosynthesis.

Induction of ethylene biosynthesis In addition to being developmentally regulated, ethylene is synthesized following wounding. SAM synthase catalyses the formation of S-adenosyl-Lmethionine from methionine and ATP. Ethylene is then formed from S-adenosylL -methionine in two steps (Kende, 1989). The first step is catalysed by the enzyme aminocyclopropane carboxylic acid (ACC) synthase and the second step by ACC oxidase. These genes usually are developmentally expressed in fruit; however, each of the steps in this pathway is also wound-inducible. This wound induction is apparently self-propagating because these enzymes are also regulated by ethylene itself (O’Donnell et al., 1996). Because these genes rely on the synthesis of ethylene to regulate their wound-inducibility, they are often referred to as ethylene-related genes. Varieties of fruit that produce the highest levels of ethylene also induce higher levels of ethylene-related genes. Some of these genes have unknown functions (Parsons and Mattoo, 1991).

08 Inducible Gene 08

3/16/99 11:16 AM

Page 131

Wound-inducible Genes

131

Induction of plant defences A major phase of the wound response is a generalized activation of plant defences. Because the majority of microbial infections occur in plants following a wound, plants have developed a variety of biochemical defences to combat invading pathogens and even small herbivores. The accumulation of phytoalexins after wounding has been a particularly rich area for study. Phytoalexins are plant synthesized small molecular weight defensive compounds that have biological activity against microorganisms or herbivores. These include phenolic, terpenoid and alkaloid compounds that are a major component of plant secondary metabolism. Many different plant species have been shown to activate the synthesis of phytoalexins after a wound or after methyl jasmonate treatment (methyl jasmonate has a proposed role in the regulation of defence genes, see below). In the recent literature, some of the induced phytoalexins have been shown to include furanocoumarin biosynthesis in Apium graveolens leaves (Miksch and Boland, 1996); taxol biosynthesis in Taxus cuspidata suspension cultures (Mirjalili and Linden, 1996); momilactone in suspension-cultured rice cells (Nojiri et al., 1996); and alkaloid synthesis in Catharanthus roseus (Aerts et al., 1996). In these cases, wounding or treatment with jasmonates activates the genes encoding the biosynthetic pathways for these different biochemicals; however, for many of these the individual biochemical steps leading to phytoalexin biosynthesis are not known or have not been examined. Some secondary metabolites are effective even against large phytophagous insects. Ramputh and Brown (1996) report on the accumulation of the inhibitory neurotransmitter, γ-aminobutyric acid (GABA), following mechanical damage of soybean leaves. These authors also demonstrated that increasing levels of GABA decreased the survival of larvae and increased the length of time that larvae required to pupate. Leaf damage by herbivores in Nicotiana sylvestris produces a damage signal that dramatically increases de novo nicotine synthesis in the roots. The increased synthesis leads to increases in nicotine pools, which is then transported up the plant. This results in increased nicotine pools throughout the plant making plants more resistant to further herbivore attack (Baldwin et al., 1994). This signal, resulting in increased nicotine production, was later shown to be methyl jasmonate (Baldwin, 1996). In addition to the accumulation of the small molecular weight phytoalexins, plants also activate the synthesis of proteins following a wound. Many of these wound-inducible proteins are directly active against the growth of herbivores and microorganisms. Among these are the serine proteinase inhibitors (Ryan, 1981b), α-amylase inhibitors (Ishimoto and Chrispeels, 1996), chitinases (Broglie et al., 1991), β-glucanases (Mauch et al., 1988), osmotin (Grosset et al., 1990), lectins (Casalongué and Pont Lezica, 1985) and many others. Each of these enzymes or inhibitors performs a specific function in combating the invading herbivore or pathogen.

08 Inducible Gene 08

132

3/16/99 11:16 AM

Page 132

L. Zhou and R. Thornburg

The serine proteinase inhibitors and the α-amylase inhibitors are particularly effective against insects. These proteins block the digestive processes that liberate free amino acids or glucose in an insect’s digestive tract. By blocking these processes, the plant limits the nutrition that an insect can glean from the tissue it eats. While these processes may be rather ineffective against single insects that may move from plant to plant, they very effectively reduce the fecundity of developing larvae that grow and develop on a single plant. It should also be pointed out that while plants have many serine proteinase inhibitors, the presence of serine proteinases in plants is rare (Ryan, 1981a). Thus, plants apparently lack the specific target enzymes of these inhibitors. These enzymes are however very rich in the digestive tract of insects, and this has led to the conclusion that these inhibitors are targeted against insects. Chitinases and β-1,3-glucanases are other defensive enzymes that have no natural target in plants. Chitin does not exist in plants and β-1,3-glucans are not major components of plant cells. Chitin and β-1,3-glucans are found extensively in the cell walls of fungi, however. Thus, these defensive compounds are apparently directed against invading yeast and fungal microorganisms. The expression of these enzymes limits the growth and development of these microorganisms, especially during spore germination. Additional defensive proteins that accumulate in plants following a wound target other specific features of microorganisms or herbivores to limit their growth and development. Note that antibacterial responses and antiviral responses apparently require specific interactions with surface or intracellular receptors in plants that activate the hypersensitive responses (Reuber and Ausubel, 1996; Ritter and Dangl, 1996). These responses are mediated by different signal transduction pathways than the classical wound-induction pathways and in general do not cross communicate. Recently, however, studies on the overexpression of small GTP-binding proteins have demonstrated that altered regulation of these G-proteins can lead to cross-signalling between these two pathways (Sano et al., 1994; Sano and Ohashi, 1995).

Induction of storage proteins In plant families, vegetative storage proteins accumulate in leaves prior to anthesis, decline during pod filling and then accumulate again after seed maturation (Staswick, 1989). In woody species such as poplar trees, a similar set of proteins termed bark storage proteins accumulate in the autumn months in the protein storage vacuoles of the inner-bark parenchyma and xylem ray cells (Coleman et al., 1993). These proteins are remobilized during the spring bud-burst when active growth dictates a need for nitrogen. This pattern of expression is consistent with the role of these storage proteins as a temporary sink for nitrogen in the growing tissues. In addition to this developmental mode of gene regulation, these proteins are also induced by wounding and by jasmonates (Francheschi and Grimes,

08 Inducible Gene 08

3/16/99 11:16 AM

Page 133

Wound-inducible Genes

133

1991; Staswick et al., 1991; Mason et al., 1992). While the teleological reason for induction of these storage proteins following a wound is unclear, perhaps, these storage proteins serve to temporarily store nitrogen and carbon following a wound. This storage would help protect from the loss of these metabolites during the wound response. These wound-induced reserves could later serve as a source for new growth after the wound-recovery phase.

Return to normal physiology The final phase of the wound-response is a recovery phase that returns the plant cell to a normal physiology. This phase is much longer in duration than the earlier phases of the wound response, generally lasting from days to a week or so after the wound. Several unique processes occur during this phase. One of these processes includes the uptake of carbohydrates into the wounded tissues. It is known that both extracellular invertases (Sturm and Chrispeels, 1990) and sugar transporters (Truernit et al., 1996) are induced following wounding. The extracellular invertases cleave extracellular sucrose into its component sugars. The sugar transporters then re-internalize the monosaccharides. This process thereby limits the free carbohydrate content of the extracellular milieu for any invading microorganisms. Thus, wounding of plant tissues produces a large-scale alteration of plant metabolism that is initiated almost immediately following a wound. Numerous formerly quiescent genes are activated following a wound that mediate this altered metabolism. The changes include sealing the wound at the surface of the cell, limiting photosynthetic translation, induction of hormone biosynthesis, producing secondary metabolites and defence proteins, producing storage proteins and finally recovery after the wound to return to a normal physiology.

MECHANISM OF WOUND INDUCTION Because of the wide number of genes that are activated and the very different time frames during which these genes become activated, it is certain that numerous mechanisms are responsible for wound-inducible gene expression in plants. While some of these mechanisms may involve peroxide induction of gene expression (Levine et al., 1994), or ethylene (O’Donnell et al., 1996) perhaps the best characterized of the wound-inducible genes are the proteinase inhibitor genes of solanaceous plants and the vegetative storage protein genes that are similarly regulated. The remainder of this chapter will discuss the mechanism of wound induction of the proteinase inhibitor and vegetative storage protein genes.

08 Inducible Gene 08

3/16/99 11:16 AM

134

Page 134

L. Zhou and R. Thornburg

SYSTEMIC SIGNAL One of the most striking characteristics about the wound-inducibility of the proteinase inhibitor genes in solanaceous plants is the fact that local wounding triggers expression of these genes at a distal site. Currently there are two mechanisms that have been proposed to trigger the wound-induced systemic accumulation of these proteinase inhibitor genes. These mechanisms are mediated by either electrical or chemical signals.

Electrical signals Wildon et al. (1992) have shown that wounding of the cotyledons of a young tomato plant results in a slow moving action potential that propagates away from the site of the wound toward the upper leaves. In all cases, this action potential correlates with the induction of proteinase inhibitor genes. Plants are unique, in that they have symplastic connections that continue throughout the organism. These connections are made by plasmodesmata, and are well suited for electrical signals. This work has been confirmed (Herde et al., 1995; Stankovic and Davies, 1995) and expanded (Rhodes et al., 1996). Herde et al. (1995) showed that the electrical induction of the proteinase inhibitor genes correlated with alterations of the stomatal aperture. Stankovic and Davies (1995) showed that both electrically stimulated action potentials and flame-induced hydraulic signals could induce high levels of proteinase inhibitor mRNA. Rhodes et al. (1996) showed that the electrical signals travelled from the wounded cotyledon to distant unwounded leaves along sieve tubes and companion cells. While it is clear that such an electrical action potential stimulates the activation of the proteinase inhibitor genes in planta, the mechanisms that translate this action potential into a chemical form that activates gene transcription have not been fully elucidated. Recently, Herde et al. (1995) have shown that electrical current and localized heating induce the accumulation of abscisic acid (ABA) and jasmonate in wild-type plants to levels that approach that of wounding. They also demonstrate that ABA-deficient plants are able to synthesize jasmonate in response to heat, but not in response to wounding. While the mechanism of electrical signal transduction is unknown, there have been several ion channels identified in plants (Maathuis and Sanders, 1995; Lurin et al., 1996) that could possibly participate in this process. Additionally, one of the inhibitors of wound-inducible gene expression, acetylsalicylic acid, is known to disrupt H +/K + transporters at the plasma membrane (Glass and Dunlop, 1974). Also an induced oxidative stress has been shown to be the result of electrical pulses in maize plants (Sabri et al., 1996). It is also not clear whether the electrical stimulation of proteinase inhibitor gene induction is capable of inducing the wide variety of genes that wounding induces.

08 Inducible Gene 08

3/16/99 11:16 AM

Page 135

Wound-inducible Genes

135

Systemin One of the most intriguing recent findings in the area of plant biochemistry is the finding that polypeptide signals may function in the activation of plant defence genes in the same way that polypeptides activate defences in animal cells (Bergey et al., 1996). These studies were initiated by the original finding that a polypeptide from tomato leaves at very low concentrations was capable of initiating the signal transduction cascade leading to the expression of proteinase inhibitor genes in the absence of a wound (Pearce et al., 1991). A synthetic polypeptide identical to the one purified from plants was also active in proteinase inhibitor gene induction. Further this synthetic polypeptide was readily mobile in the phloem, as opposed to oligosaccharide signals (Baydoun and Fry, 1985). The cDNA and gene encoding the signalling molecule, systemin, have been isolated and characterized (McGurl and Ryan, 1992; McGurl et al., 1992). The signalling molecule, systemin, is synthesized from a 200 amino acid proprotein termed prosystemin that is encoded in 11 exons. The mRNA is found throughout the tomato plants with the exception of the roots. Its expression was also wound-inducible in leaves, indicating that its expression provides a selfamplification of the wound signal. Prosystemin must be proteolytically processed to release the active systemin peptide. Recently, Gu et al. (1996) reported on the wound induction of a leucine aminopeptidase that accumulates in tomato leaves. These authors speculate that this amino peptidase activity may be important for plant defence response possibly by processing of prosystemin to systemin. A correlation of the activity of the systemin polypeptide with its structure has been examined (Pearce et al., 1993). Alanine scanning mutations revealed two regions required for activity: the first at Pro13 and the other at Thr17 near the carboxyl-terminus of the peptide. Modifications at or near the carboxylterminus were especially effective in reducing the activity of the polypeptide although these modified systemins could compete with the native systemin interactions with its receptor. Alteration of systemin expression has been examined in transgenic tomato plants. Plants transformed with an antisense copy of prosystemin cDNA showed a dramatic suppression of proteinase inhibitor expression in the leaves of the transgenic plants (McGurl et al., 1992). An overexpression of prosystemin cDNA in tomato plants resulted in a constitutive expression of proteinase inhibitor proteins in leaves (McGurl et al., 1994). These plants were still wound-inducible, expressing high levels of proteinase inhibitors both locally and systemically following wounding. Systemin is also capable of inducing other plant defensive proteins including polyphenol oxidase (Constabel et al., 1995), indicating that systemin has a role in signalling plant defensive genes other than proteinase inhibitors. In this same study, these authors also grafted non-transformed, wildtype scions on to the transgenic root stock and demonstrated elevated levels of proteinase inhibitors in the non-transformed scions. These studies

08 Inducible Gene 08

3/16/99 11:16 AM

136

Page 136

L. Zhou and R. Thornburg

demonstrated that a signal could be transmitted from root stock transformed with the prosystemin cDNA through a graft junction to non-transformed leaves in the absence of wounding. To further investigate this systemic mobility of the systemin polypeptide, Narvaez-Vasquez et al. (1994) have used p-chloromercuribenzenesulphonic acid (PCMBS), an inhibitor of active apoplastic phloem loading. PCMBS was shown to be a powerful inhibitor of wound-induced and systemin-induced activation of proteinase inhibitor synthesis in tomato leaves. When placed on fresh wounds, PCMBS severely inhibited systemic induction of proteinase inhibitors, in both the presence and absence of exogenous systemin. This process could be reversed by addition of various sulphydryl compounds.

Localized interactions Once the long distance systemic signal reaches its local site of action, that signal (whether electrical or chemical) must be transduced to the nucleus of the cell where gene transcription occurs. Electrical signals are known to open ion channels in cells that could lead to a transducing chemical signal; but, the involvement of such ion channels has not been demonstrated with any of the chemical signals known to induce wound-inducible genes. Typically, chemical signals interact with a cell surface receptor that then transmits chemical energy across the membrane to the cytoplasm. Because of the variety and chemical diversity of the signals that are known to activate wound-inducible genes (polyanionic, plant cell wall fragments, (Bishop et al., 1981, 1984); polycationic, fungal cell wall fragments (WalkerSimmons and Ryan, 1984); sucrose (Johnson and Ryan, 1990); and the polypeptide, systemin (Pearce et al., 1991)) there should be numerous cell surface receptors. However to date, no cell surface receptor has been identified. There are, however, intriguing findings that imply the existence of such receptors. For example, elicitation of Eschscholzia cell cultures (Blechert et al., 1995) or tomato cells (Felix et al., 1993) leads to a rapid alkalinization of the growth medium, possibly implying the involvement of membrane transport or ion movement. This alkalinization of the medium occurred prior to jasmonate formation and inhibition of this alkalinization process by the protein kinase inhibitor staurosporine also inhibited jasmonate formation (Blechert et al., 1995). In addition, the interaction of oligosaccharide elicitors with cells leads to several alterations in the plasma membrane. It is known that wounded plant cells have increased membrane fragility (Walker-Simmons et al., 1984) perhaps due to phospholipase action. Further, elicitor treatment of cells led to the phosphorylation of various plant plasma membrane proteins in both potato and tomato (Farmer et al., 1989; Felix et al., 1993). In tomato both a 34 kDa and a 29 kDa protein were phosphorylated, but in potato only a 34 kDa phosphoprotein was detected. In contrast to this, the elicitation with systemin resulted

08 Inducible Gene 08

3/16/99 11:16 AM

Page 137

Wound-inducible Genes

137

in the hyperphosphorylation of a 27 kDa protein. These studies indicate that protein kinases may play an important role in the mechanism of signal transduction leading to defence gene expression. Indeed, Bögre et al. (1997) have recently reported that the MMK4 MAP kinase is activated within 1 min of wounding. This kinase shows maximal activity 5 min after wounding and then activity dissappears by 40 min after wounding. The specific role of this or other kinases in wound induction is unknown, however, protein kinase inhibitors such as staurosporine can block the synthesis of jasmonates which are intermediates in the signal transduction pathway (Blechert et al., 1995). Recent evidence provided by Dammann et al. (1997) demonstrate that an okadiac acid-sensitive protein phosphatase is involved in jasmonate-induced signal transduction in leaves; however, jasmonate-induced gene activation in roots does not require this protein phosphatase to activate gene transcription in roots. Thus, multiple pathways of signal transduction occur in different tissues.

Oxylipins As mentioned earlier, jasmonic acid and its methyl ester, methyl jasmonate, are active in inducing the accumulation of numerous wound-inducible gene products in plants. Northern analysis of methyl jasmonate-induced inhibitors I and II mRNAs in tomato leaves, and of lucerne trypsin inhibitor mRNA in lucerne leaves, indicated that nascent inhibitor mRNAs were transcriptionally regulated in a manner similar to wounding (Farmer and Ryan, 1990). Further, this induction was systemic (Farmer et al., 1992). After jasmonates were identified as potential mediators of the wound response, numerous investigators examined the levels of jasmonates in wounded plants. Creelman et al. (1992) used isotopically labelled standards to demonstrate that wounded soybean stems rapidly accumulated jasmonic acid and methyl jasmonate. Albrecht et al. (1993) used an enzyme-linked immunosorbent assay (ELISA) to show that levels of jasmonic acid rose immediately and transiently in leaves as a consequence of wounding. The rapid, but transient, synthesis of cis-jasmonic acid was demonstrated after insect attack and by microbial elicitor in plant suspension cultures (Blechert et al., 1995). Leaf damage in Nicotiana sylvestris rapidly caused the level of shootjasmonic acid pools to rise rapidly (<0.5 h). Root-jasmonic acid pools also rose in response to leaf damage, but more slowly (<2 h). The levels of jasmonic acid remained elevated for 24 h in shoots and 10 h in roots (Baldwin et al., 1994).

The pathways of jasmonic acid biosynthesis The synthesis of jasmonic acid requires that the starting products be liberated from membrane phospholipids. Ryu and Wang (1996) have demonstrated that phospholipase D is rapidly activated by wounding in the leaves of castor bean

08 Inducible Gene 08

138

3/16/99 11:16 AM

Page 138

L. Zhou and R. Thornburg

resulting in an accumulation of phosphatidic acid and free-choline throughout the leaf. New synthesis of phospholipase D mRNA was not observed following a wound, but rather, the wound-activation of the phospholipase resulted from intracellular translocation of the protein from the cytosol to membranes. Conconi et al. (1996) have found that the levels of linolenic acid (18:3) and linoleic acid (18:2) increased within 1 h of a wound. Presumably this is due to phospholipase A1 or A2 activity; although induction of these activities following a wound has not been demonstrated. After 1 h, they found a 15-fold excess of 18:3 over that required to account for the levels of newly synthesized jasmonic acid. The intracellular location of jasmonate biosynthesis is thought to be the chloroplast envelope membranes (Blée and Joyard, 1996). It is currently unclear whether the free fatty acids are liberated from chloroplast phospholipids or from other membranes and are transported to the chloroplast via lipid transfer proteins. The conversion of free 18:3 fatty acids into jasmonic acid occurs in five steps through an oxidative pathway. The intermediates are termed oxylipins and these intermediates also activate wound-inducible gene expression (Farmer et al., 1992). Initially, lipoxygenase catalyses the incorporation of molecular O2 into certain polyunsaturated fatty acids having a cis, cis-1,4pentadiene system to form a fatty acid hydroperoxide. Typically in plants, there are numerous lipoxygenases and only some isoforms of these enzymes are wound-inducible (Avdiushko et al., 1995; Royo et al., 1996). Thus, like many of the wound-inducible target genes, those genes which participate in the activation process are also wound-inducible. In addition, many of these lipoxygenases are induced by a variety of biochemical components such as fungal elicitor, plant and fungal cell wall oligosaccharides, and methyl jasmonate (Bohland et al., 1997). In Arabidopsis, the lipoxygenase involved in jasmonate biosynthesis is LOX2 (Bell et al., 1995). Cosuppression of LOX2 in transgenic plants leads to reduced levels of jasmonate biosynthesis as well as reduced levels of wound-inducible gene expression. The Arabidopsis lipoxygenase LOX2 that is involved in jasmonate biosynthesis is chloroplastic (Bell et al., 1995). Following the formation of 13-hydroperoxylinolenic acid, the enzyme allene oxide synthase forms an epoxide intermediate termed allene oxide. The flax allene oxide synthase contains a 58 amino acid chloroplast transit peptide (Harms et al., 1995). These same authors constitutively overexpressed the flax allene oxide synthase cDNA in transgenic potato plants. This expression led to an increase in the endogenous level of jasmonic acid within the plants. However, despite the fact that the transgenic plants had levels of jasmonates similar to those found in non-transgenic wounded plants, the wound-inducible pin2 genes were not constitutively expressed in the leaves of these plants (Harms et al., 1995). The reason for this lack of expression is not clear, but perhaps compartmentalization of the signalling factors is involved.

08 Inducible Gene 08

3/16/99 11:16 AM

Page 139

Wound-inducible Genes

139

Following the formation of allene oxide, a cyclooxygenase acts to form 12oxo-phosphodienoic acid (12-oxo-PDA). Originally the substrate for this enzymatic step was thought to be the 13-hydroperoxylinolenic acid (Vick et al., 1980); but, Harms et al. (1995) indicate that allene oxide may be the substrate for the cyclization. The ring double bond of the 12-oxo-PDA is then reduced by a NADP+-utilizing enzyme to form 12-oxo-PMA. This is the rate-limiting step of jasmonate biosynthesis (Vick and Zimmerman, 1986). Utilization of NADP+ is consistent with the localization of these enzymes in the chloroplast. Finally jasmonic acid is synthesized from the 12-oxo-PMA by three rounds of βoxidation. It is not clear whether a novel fatty acid β-oxidase functions in the synthesis of jasmonic acid or even whether coenzyme A derivatives or acylcarrier proteins are involved. It has also been proposed that a second oxylipin cascade exists in plants starting from linoleic acid via 15,16-dihydro-12-oxo-phytodienoic acid to 9,10-dihydrojasmonate (Blechert et al., 1995). Recently, the cDNA encoding allene oxide synthase has also been isolated from Arabidopsis thaliana (Laudert et al., 1996). After expression of this enzyme in Escherichia coli, the protein was enzymatically active with substrates derived from either linolenic acid or linoleic acid, verifying that there are indeed duplicate pathways to the synthesis of jasmonic acid and dihydrojasmonic acid. In addition, to the synthesis of jasmonates, a wide variety of other oxylipin products from n-hexenal to ketols to traumatic acid are also derived from these same intermediates (Avdiushko et al., 1995; Blée and Joyard, 1996). Whether these intermediates also have gene regulatory activity will require further examination. It is known, however, that n-hexenal accumulates in the released volatile gases of wounded plants and there has been speculation that this may be involved in rejection of plants by insects (Röse et al., 1996).

Inhibitors of oxylipin metabolism Numerous inhibitors of the expression of wound-inducible genes have been reported. By far the majority of these inhibitors occur in the oxylipin pathway. Inhibitors of lipoxygenases that inhibit wound-inducible gene expression include phenidone (Farmer et al., 1994), ursolic acid (Wasternack et al., 1994), SHAM and ZK139817 (Peña-Cortés et al., 1993). Propyl gallate and piroxicam (Peña-Cortés et al., 1993) and salicylic acid (Doherty et al., 1988; Peña-Cortez et al., 1993; Doares et al., 1995) are inhibitors of hydroperoxide dehydrase (cyclooxygenase). Numerous studies involving salicylic acid have demonstrated that this compound blocks activation of proteinase inhibitor genes by electrical signals (Doherty et al., 1988), oligouronide induction, systemin induction and linolenate induction (Doares et al., 1995) as well as transcription of the genes encoding proteinase inhibitor II, cathepsin D inhibitor and threonine deaminase (Peña-Cortés et al., 1993).

08 Inducible Gene 08

140

3/16/99 11:16 AM

Page 140

L. Zhou and R. Thornburg

Metabolism of jasmonates The synthesis of jasmonates is a relatively transient response. Usually, jasmonate levels decline rapidly following the burst of synthesis (Albrecht et al., 1993; Blechert et al., 1995; Conconi et al., 1996); yet many plant responses remain activated for many hours. In an attempt to explain this phenomenon, Krumm et al. (1995) have investigated the role of amino acid conjugation of jasmonates. These authors have prepared many jasmonate–amino acid conjugates. They have shown that many of these amino acid conjugates are inactive, however conjugates of leucine and isoleucine retain their activity. These authors speculate that these active conjugates may function in the longterm maintenance of jasmonate-mediated signalling in plants. Of the four possible stereoisomers of jasmonic acid, growth-inhibitory activity was associated with both of the 1R stereoisomers; however there was no observed difference between the inhibition of straight growth of oat coleoptiles indicating that there may be multiple receptors mediating jasmonate activities (Koda et al., 1992). Further, stereochemically locked cis- and trans-7methyl derivatives of methyl jasmonate have low biological activity suggesting that the introduction of the locking methyl group at position seven considerably lowers affinity for the jasmonate receptor, presumably owing to a steric effect (Koda et al., 1995).

Mutants in jasmonic acid synthesis and action An ethylmethanesulphonate mutant (jar1) of Arabidopsis thaliana has been isolated that showed decreased sensitivity to methyl jasmonate inhibition of root elongation (Staswick et al., 1992). The jasmonate-inducibility of leaf proteins was fourfold less in the jar1 mutants than in the wild-type Arabidopsis plants. Signalling mutants have also been prepared in tomato (Lightner et al., 1993). These mutants, JL1 and JL5, were blocked in the induction of proteinase inhibitor genes. These mutants were deficient in the systemic induction of both proteinase inhibitor I and II; however, these mutants showed some localized induction of proteinase inhibitors. These results were interpreted as suggesting that multiple signalling pathways (one systemic and another local) existed in response to wounding. Further, these mutants were fully responsive to the addition of methyl jasmonate, indicating that the lesion in these mutants was located somewhere upstream of the final step in jasmonate biosynthesis. Recently, Howe et al. (1996) demonstrated that the JL5 mutant are affected in octadecanoid metabolism between the synthesis of hydroperoxylinolenic acid and 12-oxo-phytodienoic acid. Other mutants have been selected using coronatine. Coronatine is a chlorosis-inducing phytotoxin produced by several pathovars of Pseudomonas syringae. In tomato, coronatine induces the accumulation of proteinase inhibitors (Palmer and Bender, 1995), but they are not protective against the

08 Inducible Gene 08

3/16/99 11:16 AM

Page 141

Wound-inducible Genes

141

Pseudomonas pathogen. Treatment of Arabidopsis plants with coronatine leads to inhibited root growth, anthocyanin accumulation and the induction of two proteins of 31 and 29 kDa (Feys et al., 1994). Similar responses are induced in response to jasmonates. Arabidopsis mutants have been isolated that are resistant to this phytotoxin (Feys et al., 1994) and these mutants are also insensitive to methyl jasmonate inhibition of root growth. These coi1 mutants were all male sterile, producing abnormal pollen and had reduced levels of the 31 kDa protein. These authors conclude that the COI1 protein controls jasmonate perception or response and also participates in flower development.

Jasmonates affect transcription After jasmonates are synthesized, it is unclear how the biological activity of these compounds are transmitted to the promoters of the various genes that they activate. However, there is a recent report of a jasmonate-binding protein that mediates the wound-inducible regulation of transcription of the potato proteinase inhibitor 2 gene (Gurevich et al., 1996). In this work, a fragment of the pin2 gene was isolated by PCR and used as an affinity sorbent. Nuclear proteins were bound and the sorbent was eluted with physiological concentrations of jasmonate. Four proteins were isolated by this procedure. The characterization of these proteins will require further studies. Another factor that affects proteinase inhibitor expression downstream of jasmonates was discovered by Schaller et al. (1995). These authors found that an inhibitor of some aminopeptidases, bestatin, was able to induce proteinase inhibitor genes without affecting systemin, octadecanoids or jasmonate. Furthermore, defence genes were induced by bestatin in the JL5 mutant tomato line that has a defect in the octadecanoid pathway. Thus, bestatin appears to function close to the level of transcription of wound-inducible genes. These authors speculate that a regulatory protease may be involved.

INVOLVEMENT OF ADDITIONAL HORMONE FACTORS ABA There is significant evidence that the initial stages of wound induction require the initial biosynthesis of ABA prior to transcription of wound-inducible genes (Peña-Cortés et al., 1989, 1991; Hildmann et al., 1992). These studies demonstrate that exogenous application of ABA induces a systemic pattern of proteinase inhibitor II mRNA accumulation that is identical to mechanical wounding. Numerous other wound-inducible genes are known to also be induced by ABA (see Appendix 8.1). These same authors also demonstrated that ABA-deficient plants do not respond to wounding unless ABA is supplied exogenously. There is also an increase in ABA in the leaves of tomato, potato

08 Inducible Gene 08

142

3/16/99 11:16 AM

Page 142

L. Zhou and R. Thornburg

and tobacco plants following a wound (Sanchez-Serrano et al., 1991). In contrast to this, no increase in ABA was observed in leaves incubated with jasmonic acid, suggesting that jasmonates act after ABA (Hildmann et al., 1992). Recently, Peña-Cortés et al. (1995) have shown that either electrical signals or systemin leads to an increase in ABA which in turn leads to an increase in jasmonic acid which then regulates gene transcription. According to this hypothesis, all jasmonate-regulated genes should also be ABA-regulated. Lee et al. (1996), however, have identified four genes by differential display which are regulated by jasmonate but are not regulated by ABA indicating that the signalling pathways for ABA and jasmonates function independently and not sequentially. Specific roles for ABA have been proposed. ABA might lead to the activation of a lipoxygenase that generates hydroperoxides from free fatty acids within the cell (Peña-Cortés et al., 1995). Further evidence to support this hypothesis is provided by Abián et al. (1991), who demonstrated alterations in oxylipin metabolism in maize embryos in response to ABA. It is also known that water stress also causes accumulation of ABA and activates a set of water-stress genes; however it does not induce wound-inducible genes (Hildmann et al., 1992). Thus different signal transduction mechanisms must regulate the ABA induction of these different sets of genes.

Mutants affecting ABA induction Because ABA has been identified as a factor involved in the activation of proteinase inhibitor genes following wounding, there have been several investigations examining wounding in ABA-deficient plants (Peña-Cortés et al., 1989, 1991). Several different ABA-deficient plant lines have been used to evaluate the involvement of ABA in wound-inducible gene expression. The tomato mutants used for these studies are flaca and sitiens and the potato mutant is droopy. In all of these plants, proteinase inhibitor genes are not expressed unless ABA is added. However, care should be taken in interpretations of the data derived from these hormone-deficient plants, because they are often pleiotrophic mutations. For example the tomato mutant, flaca, is known to have elevated levels of indoleacetic acid (IAA) in addition to reduced levels of ABA (Tal and Imber, 1970). Further, there are numerous examples in the literature that exogenous application of ABA to plant tissues can cause alterations in endogenous levels of IAA within those tissues (Chang and Jacobs, 1973; Anker, 1975; Wodzicki and Wodzicki, 1981; Terek, 1982; Pilet and Rebeaud, 1983; Dunlap and Robacker, 1990).

Ethylene As mentioned above, ethylene is synthesized following a wound and many wound-inducible genes are also responsive to ethylene. Recently, O’Donnell et al. (1996) have demonstrated that ethylene is absolutely required for wound

08 Inducible Gene 08

3/16/99 11:16 AM

Page 143

Wound-inducible Genes

143

induction of the proteinase inhibitor genes of tomato. These authors use norbornadiene, which is an inhibitor of ethylene synthesis (Sisler et al., 1990), and silver thiosulphate, which disrupts binding of ethylene to its receptor (Veen, 1987), to demonstrate that both jasmonic acid as well as ethylene are required for proteinase inhibitor gene expression. They propose that both ethylene and jasmonates are co-stimulatory for the other hormone, that is, after wounding the synthesis of ethylene induces higher jasmonate levels and endogenous jasmonates induce higher ethylene levels. In this way, a sufficient amount of these hormones accumulate to regulate the wound process (O’Donnell et al., 1996). Similar synergistic responses between ethylene and methyl jasmonate have been observed for the PR1 and PR5 pathogenesis-related proteins (Xu et al., 1994). Additional studies in support of this hypothesis come from the study of a tomato ethylene mutant, termed Never-ripe (NR), which have a partial loss of ethylene sensitivity (Yen et al., 1995). In these plants, the wound-induced accumulation of proteinase inhibitor transcripts is significantly delayed. Also, transgenic tomato plants expressing an antisense ACC oxidase do not accumulate proteinase inhibitor transcripts in response to wounding. Thus, these studies also suggest that ethylene is required for wound-inducible gene expression of the proteinase inhibitor genes.

Auxin Auxin also has been demonstrated to prevent expression of wound-inducible proteinase inhibitors (Kernan and Thornburg, 1989). This inhibition of expression occurs both in tissue-cultured cells as well as in whole plants. It was specific for biologically active auxins and occurred at near physiological IAA concentrations. Auxin inhibition of gene expression has been demonstrated for a number of wound-inducible genes (see Appendix 8.1). Auxin also inhibits other chemical inducers. Auxin has also been shown to strongly inhibited methyl jasmonate-induced wound-inducible gene expression in soybean suspension-cultured cells (DeWald et al., 1994) and the expression of βglucanase in response to fungal elicitor in tobacco and soybean cells (Jouanneau et al., 1991). Thornburg and Li (1991) have also demonstrated that IAA in bulk leaf tissues declines by two- to threefold following a wound and that the kinetics of IAA decline inversely correlate with the induction of wound-inducible gene expression. Other cellular machinery required for induction of wound-inducible genes has not been fully elucidated, however, recent work indicates that this is a rich field for study. It is known that small GTP-binding proteins can mediate crosssignalling between the wound- and pathogen-induced signal transduction pathways (Sano et al., 1994; Sano and Ohashi, 1995). More recently, these authors demonstrated that these transgenic plants overexpressing this small

08 Inducible Gene 08

3/16/99 11:16 AM

144

Page 144

L. Zhou and R. Thornburg

GTP-binding protein can synthesize jasmonates more rapidly than control plants. They also provide evidence based upon competition with 2-chloro-4cyclohexylamino-6-ethylamino-S-triazine (a potent cytokinin antagonist) that cytokinins may be essential for accumulation of wound-inducible proteinase inhibitor transcripts (Sano et al., 1996). Indeed it has been previously suggested that wounding enhances endogenous cytokinin activity in cucumber (Crane and Ross, 1986). From all of these studies, we can see the involvement of multiple long-range signals, both chemical and electrical, multiple short-range signals of plant and fungal origin, several signal transduction cascades involving GTP-binding proteins, kinases and phosphatases along with variations in multiple plant hormones, ethylene, cytokinins, auxin and ABA in addition to the biosynthesis of jasmonates. All of these factors clearly play a role in the transcriptional activation of wound-inducible genes. It cannot be argued that these factors are coordinated in a vastly complex, well-regulated network of responses leading to gene activation. In spite of all that is currently known about the expression of these genes, there is a long way to go before we fully understand woundinducible gene expression in plants.

REFERENCES Abián, J., Gelpi, E. and Pagès, M. (1991) Effect of abscisic acid on the linoleic acid metabolism in developing maize embryos. Plant Physiology 95, 1277–1283. Adams, C.A., Nelson, W.S., Nunberg, A.N. and Thomas, T.L. (1992) A wound-inducible member of the hydroxyproline-rich glycoprotein gene family in sunflower. Plant Physiology 99, 775–776. Aerts, R.J., Schafer, A., Hesse, M., Baumann, T.W. and Slusarensko, A. (1996) Signaling molecules and the synthesis of alkaloids in Catharanthus roseus seedlings. Phytochemistry 42, 417–422. Albrecht, T., Kehlen, A., Stahl, K., Knofel, H.D., Sembdner, G. and Weiler, E.W. (1993) Quantification of rapid, transient increases in jasmonic acid in wounded plants using a monoclonal antibody. Planta 191, 86–94. Andresen, I., Becker, W., Schlüter, K., Burges, J., Parthier, B. and Apel, K. (1992) The identification of leaf thionin as one of the main jasmonate-induced proteins of barley (Hordeum vulgare). Plant Molecular Biology 19, 193–204. Anker, L. (1975) Auxin-synthesis inhibition by abscisic acid, and its reversal by gibberellic acid. Acta Botanica Neerlandica 24, 339–347. Avdiushko, S., Croft, K.P.C., Brown, G.C., Jackson, D.M., Hamiltio-Kemp, T.R. and Hildebrand, D. (1995) Effect of volatile methyl jasmonate on the oxylipin pathway in tobacco, cucumber and Arabidopsis. Plant Physiology 109, 1227–1230. Baldwin, I.T. (1996) Methyl jasmonate-induced nicotine production in Nicotiana attenuata: inducing defenses in the field without wounding. Entomologia Experimentalis et Applicata 80, 213–220. Baldwin, I.T., Schmelz, E.A. and Ohnmeiss, T.E. (1994) Wound-induced changes in root and shoot jasmonic acid pools correlate with induced nicotine synthesis in Nicotiana sylvestris Spegazzini and Comes. Journal of Chemical Ecology 20, 2139–2157.

08 Inducible Gene 08

3/16/99 11:16 AM

Page 145

Wound-inducible Genes

145

Barry, C.S., Beatrix, B., Mondher, B., Cooper, W., Hamilton, A.J. and Grierson, D. (1996) Differential expression of the 1-aminocyclopropane-1-carboxylate oxidase gene family of tomato. The Plant Journal 9, 525–535. Baydoun, E. and Fry, S. (1985) The immobility of pectic substances in injured tomato leaves and its bearing on the identity of the wound hormone. Planta 165, 269–276. Bell, E. and Mullet, J.E. (1993) Characterization of an Arabidopsis lipoxygenase gene responsive to methyl jasmonate and wounding. Plant Physiology 103, 1133–1137. Bell, E., Creelman, R.A. and Mullet, J.E. (1995) A chloroplast lipoxygenase is required for wound-induced jasmonic acid accumulation in Arabidopsis. Proceedings of the National Academy of Sciences USA 92, 8675–8679. Bell-Lelong, D.A., Cusumano, J.C., Meyer, K. and Chapple, C. (1997) Cinnamate-4hydroxylase expression in Arabidopsis: regulation in response to development and the environment. Plant Physiology 113, 729–738. Bergey, D., Howe, G.A. and Ryan, C.A. (1996) Polypeptide signaling for plant defensive genes exhibits analogies to defense signaling in animals. Proceedings of the National Academy of Sciences USA 93, 12053–12058. Bishop, P., Pearce, G., Bryant, J. and Ryan, C. (1984) Isolation and characterization of the proteinase inhibitor-inducing factor from tomato leaves: identity and activity of poly- and oligogalacturonide fragments. Journal of Biological Chemistry 259, 13172–13177. Bishop, P.D., Makus, D.J., Pearce, G. and Ryan, C.A. (1981) Proteinase inhibitorinducing factor activity in tomato leaves resides in oligosaccharides enzymatically released from cell walls. Proceedings of the National Academy of Sciences USA 78, 3536–3540. Blechert, S., Brodschelm, W., Holder, S., Kammerer, L., Kutchan, T.M., Mueller, M.J., Xia, Z.Q. and Zenk, M.H. (1995) The octadecanoic pathway: signal molecules for the regulation of secondary pathways. Proceedings of the National Academy of Sciences USA 92, 4099–4105. Blée, E. and Joyard, J. (1996) Envelope membranes from spinach chloroplasts are a site of metabolism of fatty acid hydroperoxides. Plant Physiology 110, 445–454. Bögre, L., Ligterink, W., Meskiene, I., Barker, P.J., Heberle-Bors, E., Huskinsson, N.S. and Hirt, H. (1997) Wounding induces the rapid and transient activation of a specific MAP kinase pathway. Plant Cell 9, 75–83. Bohland, C., Balkenhohl, T., Loers, G., Feussner, I. and Grambow, H.J. (1997) Differential induction of lipoxygenase isoforms in wheat upon treatment with rust fungus elicitor, chitin oligosaccharides, chitosan and methyl jasmonate. Plant Physiology 114, 679–685. Bohlmann, H. and Apel, K. (1991) Thionins. Annual Review of Plant Physiology and Plant Molecular Biology 42, 227–240. Bolter, C.J. (1993) Methyl jasmonate induced papain inhibitor(s) in tomato leaves. Plant Physiology 103, 1347–1353. Botella, M.A., Xu, Y., Prabha, T.N., Zhao, Y., Narasimhan, M.L., Wilson, K., Nielsen, S.S., Bressan, R.A. and Hasegawa, P.M. (1996) Differential expression of soybean cysteine proteinase inhibitor genes during development and in response to wounding and methyl jasmonate. Plant Physiology 112, 1201–1210. Bradley, D.J., Kjellbom, P. and Lamb, C.J. (1992) Elicitor and wound-induced oxidative cross-linking of a proline-rich plant cell wall protein: a novel, rapid defense response. Cell 70, 21–30.

08 Inducible Gene 08

146

3/16/99 11:16 AM

Page 146

L. Zhou and R. Thornburg

Brignolas, F., Lacroix, B., Lieutier, F., Sauvard, D., Drouet, A., Claudot, A.-C., Yart, A., Berryman, A.A. and Christiansen, E. (1995) Induced responses in phenolic metabolism in two Norway spruce clones after wounding and inoculations with Ophiostoma poonicum, a bark beetle-associated fungus. Plant Physiology 109, 821–827. Brisson, L.F., Tenhaken, R. and Lamb, C. (1994) Function of oxidative cross-linking of cell wall structural proteins in plant disease resistance. Plant Cell 6, 1703–1712. Broglie, K., Chet, I., Holliday, M., Cressman, R., Biddle, P., Knowlton, S., Mauvais, C.J. and Broglie, R. (1991) Transgenic plants with enhanced resistance to the fungal pathogen Rhizoctonia solani. Science 254, 1194–1197. Brown, W.E. and Ryan, C.A. (1984) Isolation and characterization of a wound-inducible trypsin inhibitor from alfalfa leaves. Biochemistry 23, 3418–3422. Burnett, R.J., Maldonado-Mendoza, I.E., McKnight, T.D. and Nessler, C.L. (1993) Expression of a 3-hydroxy-3-methylglutaryl coenzyme A reductase gene from Camptotheca acuminata is differentially regulated by wounding and methyl jasmonate. Plant Physiology 103, 41–48. Callahan, A.M., Morgens, P.H., Wright, P. and Nichols, K.E. (1992) Comparison of Pch313 (pTOM13 Homolog) RNA accumulation during fruit softening and wounding of two phenotypically different peach cultivars. Plant Physiology 100, 482–488. Cardemil, L. and Riquelme, A. (1991) Expression of cell wall proteins in seeds and during early seedling growth of Araucaria araucana is a response to wound stress and is developmentally regulated. Journal of Experimental Botany 42, 415–421. Carollo, V.L. and Adams, D.O. (1996) The malic enzyme promoter directs wound-induced GUS expression in transgenic tobacco. Plant Physiology 111 (suppl.), 130 (abstr.). Casalongué, C. and Pont-Lezica, R. (1985) Potato lectin: a cell-wall glycoprotein. Plant Cell Physiology 26, 1533–1539. Chang, Y.-P. and Jacobs, W.P. (1973) The regulation of abscission and IAA by senescence factor and abscisic acid. American Journal of Botany 60, 10–16. Chaudhry, B., Muller-Uri, F., Cameron-Mills, V., Gough, S., Simpson, D., Skriver, K. and Mundy, J. (1994) The barley 60 kDa jasmonate-induced protein (JIP60) is a novel ribosome-inactivating protein. The Plant Journal 6, 815–824. Choi, D., Ward, B.L. and Bostock, R.M. (1992) Differential induction and suppression of potato 3-hydroxy-3-methylglutaryl coenzyme A reductase genes in response to Phytophthora infestans and to its elicitor arachidonic acid. Plant Cell 4, 1333–1344. Choi, D., Bostock, R.M., Avdiushko, S. and Hildebrand, D.F. (1994) Lipid-derived signals that discriminate wound- and pathogen-responsive isoprenoid pathways in plants: methyl jasmonate and the fungal elicitor arachidonic acid induce different 3-hydroxy-3-methylglutaryl-coenzyme A reductase genes and antimicrobial isoprenoids in Solanum tuberosum L. Proceedings of the National Academy of Sciences USA 91, 2329–2333. Clarke, A.E., Anderson, R.L. and Stone, B.A. (1979) Form and function of arabinogalactans and arabanogalactan-proteins. Phytochemistry 18, 521–540. Clarke, H.R.G., Davis, J.M., Wilbert, S.M., Bradshaw, J., Harvey D. and Gordon, M.P. (1994) Wound-induced and developmental activation of a poplar tree chitinase gene promoter in transgenic tobacco. Plant Molecular Biology 25, 799–815. Coleman, C.D., Englert, J.M., Chen, T.H.H. and Fuchigami, L.H. (1993) Physiological and environmental requirements for poplar (Populus deltoides) bark storage protein degradation. Plant Physiology 102, 53–59.

08 Inducible Gene 08

3/16/99 11:16 AM

Page 147

Wound-inducible Genes

147

Conconi, A., Miquel, M., Browse, J.A. and Ryan, C.A. (1996) Intracellular levels of free linolenic and linoleic acids increase in tomato leaves in response to wounding. Plant Physiology 111, 797–803. Condit, C.M. and Meagher, R.B. (1987) Expression of a gene encoding a glycine-rich protein in petunia. Molecular and Cellular Biology 7, 4273–4279. Constabel, C.P., Bergey, D.R. and Ryan, C.A. (1995) Systemin activates synthesis of wound-inducible tomato leaf polyphenol oxidase via the octadecanoid defense signaling pathway. Proceedings of the National Academy of Sciences USA 92, 407–411. Corbin, D.R., Sauer, N. and Lamb, C.J. (1987) Differential regulation of a hydroxyprolinerich glycoprotein gene family in wounded and infected plants. Molecular and Cellular Biology 7, 4337–4344. Cordero, M.J., Dora, R. and San Segundo, B. (1994) Expression of a maize proteinase inhibitor gene is induced in response to wounding and fungal infection: systemic wound-response of a monocot gene. The Plant Journal 6, 141–150. Crane, K.E. and Ross, C.W. (1986) Effects of wounding on cytokinin activity in cucumber cotyledons. Plant Physiology 82, 1151–1152. Creelman, R., Tierney, M.L. and Mullet, J.E. (1992) Jasmonic acid/methyl jasmonate accumulate in wounded soybean hypocotyls and modulate wound gene expression. Proceedings of the National Academy of Sciences USA 89, 4938–4941. Criqui, M.C., Durr, A., Parmentier, Y., Marbach, J., Fleck, J. and Jamet, E. (1992) How are photosynthetic genes repressed in freshly-isolated mesophyll protoplasts of Nicotiana sylvestris? Plant Physiology and Biochemistry 30, 597–601. Curtis, M.D., Rae, A.L., Rusu, A.G., Harrison, S.J. and Manners, J.M. (1997) A peroxidase gene promoter induced by phytopathogens and methyl jasmonate in transgenic plants. Molecular Plant–Microbe Interactions 10, 326–338. Dammann, C., Rojo, E. and Sanchez-Serrano, J.J. (1997) Abscisic acid and jasmonic acid activate wound-inducible genes in potato through separate, organ-specific signal transduction pathways. The Plant Journal 11, 773–782. Danielle, T. (1992) Regulation of expression of the glutamine synthase GLN-a gene of Phaseolus vulgaris L. PhD, University of Warwick, UK. Davis, J.M., Egelkrout, E.E., Coleman, G.D., Chen, T.H.H., Haissig, B.E., Reimenschneider, D.E. and Gordon, M.P. (1993) A family of wound-induced genes in Populus shares common features with genes encoding vegetative storage proteins. Plant Molecular Biology 23, 135–143. DeWald, D.B., Sadka, A. and Mullet, J.E. (1994) Sucrose modulation of soybean Vsp gene expression is inhibited by auxin. Plant Physiology 104, 439–444. Diallinas, G. and Kanellis, A.K. (1994) A phenylalanine ammonia-lyase gene from melon fruit: cDNA cloning, sequence and expression in response to development and wounding. Plant Molecular Biology 26, 473–479. Diehn, S.H., Burkhart, W. and Graham, J.S. (1993) Purification and partial amino acid sequence of a wound-inducible, developmentally regulated anionic peroxidase from soybean leaves. Biochemical and Biophysical Research Communications 195, 928–934. Doares, S.H., Narváez-Vásquez, J., Conconi, A. and Ryan, C.A. (1995) Salicylic acid inhibits synthesis of proteinase inhibitors in tomato leaves induced by systemin and jasmonic acid. Plant Physiology 108, 1741–1746. Doherty, H.M., Selvendran, R.R. and Bowles, D.J. (1988) The wound response of tomato plants can be inhibited by aspirin and related hydroxy-benzoic acids. Physiological and Molecular Plant Pathology 33, 377–384.

08 Inducible Gene 08

148

3/16/99 11:16 AM

Page 148

L. Zhou and R. Thornburg

Dunlap, J.R. and Robacker, K.M. (1990) Abscisic acid alters the metabolism of indole3-acetic acid in senescing flowers of Cucumis melo L. Plant Physiology 94, 870–874. Dyer, W.E., Henstrand, J.M., Handa, A.K. and Herrmann, K.M. (1989) Wounding induces the first enzyme of the shikimate pathway in Solanaceae. Proceedings of the National Academy of Sciences USA 86, 7370–7373. Ebener, W., Fowler, T.J., Suzuki, H., Shaver, J. and Tierney, M.L. (1993) Expression of DcPRP1 is linked to carrot storage root formation and is induced by wounding and auxin treatment. Plant Physiology 101, 259–265. Ellard-Ivey, M. and Douglas, C.J. (1996) Role of jasmonates in the elicitor- and woundinducible expression of defense genes in parsley and transgenic tobacco. Plant Physiology 112, 183–192. Farmer, E.E. and Ryan, C.A. (1990) Interplant communication: airborne methyl jasmonate induces synthesis of proteinase inhibitors in plant leaves. Proceedings of the National Academy of Sciences USA 87, 7713–7716. Farmer, E.E. and Ryan, C.A. (1992) Octadecanoid precursors of jasmonic acid activate the synthesis of wound-inducible proteinase inhibitors. Plant Cell 4, 129–134. Farmer, E.E., Pearce, G. and Ryan, C.A. (1989) In vitro phosphorylation of plant plasma membrane proteins in response to the proteinase inhibitor inducing factor. Proceedings of the National Academy of Sciences USA 86, 1539–1542. Farmer, E.E., Johnson, R.R. and Ryan, C.A. (1992) Regulation of expression of proteinase inhibitor genes by methyl jasmonate and jasmonic acid. Plant Physiology 98, 995–1002. Farmer, E.E., Caldelari, D., Pearce, G., Walker-Simmons, M.K. and Ryan, C.A. (1994) Diethyldithiocarbamic acid inhibits the octadecanoid signaling pathway for the wound induction of proteinase inhibitors in tomato leaves. Plant Physiology 106, 337–342. Felix, G., Regenass, M. and Boller, T. (1993) Specific perception of subnanomolar concentrations of chitin fragments by tomato cells: induction of extracellular alkalinization, changes in protein phosphorylation and establishment of a refractory state. The Plant Journal 4, 307–316. Feys, B.J.F., Benedetti, C.E., Penfold, C.N. and Turner, J.G. (1994) Arabidopsis mutants selected for resistance to the phytotoxin, coronatine, are male sterile, insensitive to methyl jasmonate, and resistant to a bacterial pathogen. Plant Cell 6, 751–759. Fincher, G.B., Stone, B.A. and Clarke, A.E. (1983) Arabinogalactan-proteins: structure, biosynthesis, and function. Annual Review of Plant Physiology 34, 21–45. Franceschi, V.R. and Grimes, H.D. (1991) Induction of soybean vegetative storage proteins and anthocyanins by low-level atmospheric methyl jasmonate. Proceedings of the National Academy of Sciences USA 88, 6745–6749. Frank, M.R., Deyneka, J.M. and Schuler, M.A. (1996) Cloning of wound-induced cytochrome P450 monooxygenases expressed in pea. Plant Physiology 110, 1035–1046. Glass, A.D.M. and Dunlop, J. (1974) Influence of phenolic acids on ion uptake: IV. Depolarization of membrane potentials. Plant Physiology 54, 855–858. Green, T. and Ryan, C. (1972) Wound-induced proteinase inhibitor in plant leaves: a possible defense mechanism against insects. Science 175, 776–777. Grimes, H.D., Koetje, D.S. and Franceschi, V.R. (1992) Expression, activity, and cellular accumulation of methyl jasmonate-responsive lipoxygenase in soybean seedlings. Plant Physiology 100, 433–443.

08 Inducible Gene 08

3/16/99 11:16 AM

Page 149

Wound-inducible Genes

149

Grosset, J., Marty, I., Chartier, Y. and Meyer, Y. (1990) mRNAs newly synthesized by tobacco mesophyll protoplasts are wound-inducible. Plant Molecular Biology 15, 485–496. Gu, Y.-Q., Chao, W.S. and Walling, L.L. (1996) Localization and post-translational processing of the wound-induced leucine aminopeptidase proteins of tomato. Journal of Biological Chemistry 271, 25880–25887. Guevara-García, A., Mosqueda-Cano, G., Argüello-Astorga, G., Simpson, J. and HerreraEstrella, L. (1993) Tissue-specific and wound-inducible pattern of expression of the mannopine synthase promoter is determined by the interaction between positive and negative cis-regulatory elements. The Plant Journal 4, 495–505. Gurevich, A.I., Tuzova, T.P., Shpak, E.D., Starkova, N.N., Esipov, R.S. and Miroshnikov, A.I. (1996) Mechanism of action of the plant hormone jasmonate. I. Jasmonateinteracting proteins that regulate transcription of the pinII potato gene. Bioorganicheskaya Khimiya 22, 101–107. Hansen, E., Harper, G., McPherson, M.J. and Atkinson, H.J. (1996) Differential expression patterns of the wound-inducible transgene wun1-uidA in potato roots following infection with either cyst or root knot nematodes. Physiological Molecular Plant Pathology 48, 161–170. Hansen, J.D. and Hannapel, D.J. (1992) A wound-inducible potato proteinase inhibitor gene expressed in non-tuber-bearing species is not sucrose inducible. Plant Physiology 100, 164–169. Harms, K., Atzorn, R., Brash, A., Kuhn, H., Wasternack, C., Willmitzer, L. and PeñaCortés, H. (1995) Expression of a flax allene oxide synthase cDNA leads to increased endogenous jasmonic acid (JA) levels in transgenic potato plants but not to a corresponding activation of JA-responding genes. Plant Cell 7, 1645–1654. Herde, O., Fuss, H., Peña-Cortés, H. and Fisahn, J. (1995) Proteinase inhibitor II gene expression induced by electrical stimulation and control of photosynthetic activity in tomato plants. Plant Cell Physiology 36, 737–742. Hildmann, T., Ebneth, M., Peña-Cortés, H., Sánchez-Serrano, J.J., Willmitzer, L. and Prat, S. (1992) General roles of abscisic and jasmonic acids in gene activation as a result of mechanical wounding. Plant Cell 4, 1157–1170. Holdsworth, M.J., Schuch, W. and Grierson, D. (1988) Organization and expression of a wound/ripening-related small multigene family from tomato. Plant Molecular Biology 11, 81–88. Howe, G.A., Lightner, J., Browse, J. and Ryan, C.A. (1996) An octadecanoid pathway mutant (JL5) of tomato is compromized in signaling for defense against insect attack. Plant Cell 8, 2067–2077. Ishikawa, A., Yoshihara, T. and Nakamura, K. (1994) Jasmonate-inducible expression of a potato cathepsin D inhibitor-GUS gene fusion in tobacco cells. Plant Molecular Biology 26, 403–414. Ishimoto, M. and Crispeels, M.J. (1996) Protective mechanism of the Mexican Bean Weevil against high levels of α-amylase inhibitor in the common bean. Plant Physiology 111, 393–401. Jacobsen, S.E. and Olszewski, N.E. (1996) Gibberellins regulate the abundance of RNAs with sequence similarity to proteinase inhibitors, dioxygenases and dehydrogenases. Planta 198, 78–86. Johnson, R. and Ryan, C.A. (1990) Wound-inducible potato inhibitor II genes: enhancement of expression by sucrose. Plant Molecular Biology 14, 527–536.

08 Inducible Gene 08

150

3/16/99 11:16 AM

Page 150

L. Zhou and R. Thornburg

Jouanneau, J.-P., Lapous, D. and Guern, J. (1991) In plant protoplasts, the spontaneous expression of defense reactions and the responsiveness to exogenous elicitors are under auxin control. Plant Physiology 96, 459–466. Kaufman, P.B., Ghosheh, N.S., LaCroix, J.D., Soni, S.L. and Ikuma, H. (1973) Regulation of invertase levels in Avena stem segments by gibberellic acid, sucrose, glucose and fructose. Plant Physiology 55, 221–228. Keith, B., Dong, X., Ausubel, F.M. and Fink, G.R. (1991) Differential induction of 3deoxy-D-arabino-heptulosonate-7-phosphate synthase genes in Arabidopsis thaliana by wounding and pathogenic attack. Proceedings of the National Academy of Sciences USA 88, 8821–8825. Keller, B., Sauer, N. and Lamb, C.J. (1988) Glycine-rich cell wall proteins in bean: gene structure and association of the protein with the vascular system. The EMBO Journal 7, 3625–3633. Kende, H. (1989) Enzymes of ethylene biosynthesis. Plant Physiology 91, 1–4. Kernan, A. and Thornburg, R.W. (1989) Auxin levels regulate the expression of a wound-inducible proteinase inhibitor II–chloramphenicol acetyl transferase gene fusion in vitro and in vivo. Plant Physiology 91, 73–78. Kim, C.-S., Kwak, J.-M., Nam, H.-G., Kim, K.-C. and Cho, B.-H. (1994) Isolation and characterization of two cDNA clones that are rapidly induced during the wound response of Arabidopsis thaliana. Plant Cell Reports 13, 340–343. Kim, W.T. and Yang, S.F. (1994) Structure and expression of cDNAs encoding 1aminocyclopropane-1-carboxylate oxidase homologs isolated from excized mung bean hypocotyls. Planta 194, 223–229. Kleis-San Francisco, S.M. and Tierney, M.L. (1990) Isolation and characterization of a proline-rich cell wall protein from soybean seedlings. Plant Physiology 94, 1897–1902. Knight, M.R., Campbell, A.K., Smith, M.S. and Trewavas, A.J. (1991) Transgenic plant aequorin reports the effects of touch and cold-shock and elicitors on cytoplasmic calcium. Nature 352, 524–526. Koda, Y. and Kikuta, Y. (1994) Wound-induced accumulation of jasmonic acid in tissues of potato tubers. Plant and Cell Physiology 35, 751–756. Koda, Y., Kuta, Y., Kitahara, T., Nishi, T. and Mori, K. (1992) Comparisons of various biological activities of stereoisomers of methyl jasmonate. Phytochemistry 31, 1111–1114. Koda, Y., Ward, J.L. and Beale, M.H. (1995) Biological activity of methyl 7-methyljasmonates. Phytochemistry 38, 821–823. Kolattukudy, P.E. (1980) Cutin, suberin, and waxes. In: Stumpf, P.K. and Conn, E.E. (eds) The Biochemistry of Plants. Academic Press, New York, pp. 571–644. Krumm, T., Bandemer, K. and Boland, W. (1995) Induction of volatile biosynthesis in the lima bean (Phaseolus lunatus) by leucine- and isoleucine conjugates of 1-oxoand 1-hydroxyindan-4-carboxylic acid: evidence for amino acid conjugates of jasmonic acid as intermediates in the octadecanoid signaling pathway. FEBS Letters 377, 523–529. Lachman, P.J. (1986) A common form of killing. Nature (London) 321, 560. Laudert, D., Pfannschmidt, U., Lottspeich, F., Hollander-Czytko, H. and Weiler, E.W. (1996) Cloning, molecular and functional characterization of Arabidopsis thaliana allene oxide synthase (CYP 74), the first enzyme of the octadecanoid pathway to jasmonates. Plant Molecular Biology 31, 323–335. Lawton, M.A. and Lamb, C.J. (1987) Transcriptional activation of plant defense genes by fungal elicitor, wounding and infection. Molecular Cell Biology 7, 335–341.

08 Inducible Gene 08

3/16/99 11:16 AM

Page 151

Wound-inducible Genes

151

Lawton, S., Dixon, R., Hahlbrock, H. and Lamb, C. (1983) Elicitor induction of mRNA activity: rapid effects of elicitor on phenylalanine ammonia-lyase and chalcone synthase mRNA activities in bean cells. Journal of Biochemistry 130, 131–139. Lee, D. and Douglas, C.J. (1996) Two divergent members of a tobacco 4-coumarate: coenzyme A ligase (4CL) gene family. Plant Physiology 112, 193–205. Lee, J., Prathier, B. and Löbler, M. (1996) Jasmonate signaling can be uncoupled from abscisic acid signaling in barley: identification of jasmonate-regulated transcripts which are not induced by abscisic acid. Planta 199, 625–632. Leopold, J., Hause, B., Lehmann, J., Graner, A., Parthier, B. and Wasternack, C. (1996) Isolation, characterization and expression of a cDNA coding for a jasmonateinducible protein of 37 kDa in barley leaves. Plant Cell and Environment 19, 675–684. Levine, A., Tenhaken, R., Dixon, R. and Lamb, C. (1994) H 2O 2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell 79, 583–593. Lewinsohn, E., Gijzen, M. and Croteau, R. (1992) Wound-inducible pinene cyclase from grand fir: purification, characterization and renaturation after SDS-PAGE. Archives of Biochemistry and Biophysics 293, 167–173. Lightner, J., Pearce, G., Ryan, C.A. and Browse, J. (1993) Isolation of signaling mutants of tomato (Lycopersicon esculentum). Molecular and General Genetics 241, 595–601. Lincoln, J.E., Campbell, A.D., Oetiker, J., Rottmann, W.H., Oeller, P.W., Shen, N.F. and Theologis, A. (1993) LE-ACS4, a fruit ripening and wound-induced 1-aminocyclopropane-1-carboxylate synthase gene of tomato (Lycopersicon esculentum): expression in Escherichia coli, structural characterization, expression characteristics, and phylogenetic analysis. Journal of Biological Chemistry 268, 19422–19430. Linthorst, H.J.M., van der Does, C., Brederode, F.T. and Bol, J.F. (1993) Circadian expression and induction by wounding of tobacco genes for cysteine proteinase. Plant Molecular Biology 21, 685–694. Liu, D., Li, N., Dube, S., Kalinski, A., Herman, E. and Mattoo, A.K. (1993) Molecular characterization of a rapidly and transiently wound-induced soybean (Glycine max L.) gene encoding 1-aminocyclopropane-1-carboxylate synthase. Plant Cell Physiology 34, 1151–1157. Liu, T.-H.A., Hannapel, D.J. and Stephens, L.C. (1997) Induction of cathepsin D inhibitor gene expression in response to methyl jasmonate. Journal of Plant Physiology 150, 279–282. Logemann, J. and Schell, J. (1989) Nucleotide sequence and regulated expression of a wound-inducible potato gene (wun1). Molecular and General Genetics 219, 81–88. Lurin, C., Geelen, D., Barbier-Brygoo, H., Guern, J. and Maurel, C. (1996) Cloning and functional expression of a plant voltage-dependent chloride channel. Plant Cell 8, 701–711. Maathuis, F.J. and Sanders, D. (1995) Contrasting roles in ion transport of two K(+)channel types in root cells of Arabidopsis thaliana. Planta 197, 456–464. Maldonado-Mendoza, I.F., Burnett, R.J., López-Meyer, M. and Nessler, C.L. (1994) Regulation of 3-hydroxy-3-methylglutaryl-coenzyme A reductase by wounding and methyl jasmonate. Plant Cell, Tissue and Organ Culture 38, 351–356. Mason, H.S. and Mullet, J.E. (1990) Expression of two soybean vegetative storage protein genes during development and in response to water deficit, wounding, and jasmonic acid. Plant Cell 2, 569–579.

08 Inducible Gene 08

152

3/16/99 11:16 AM

Page 152

L. Zhou and R. Thornburg

Mason, H.S., DeWald, D.B., Creelman, R.A. and Mullet, J.E. (1992) Coregulation of soybean vegetative storage protein gene expression by methyl jasmonate and soluble sugars. Plant Physiology 98, 859–867. Mauch, F., Mauch-Mani, B. and Boller, T. (1988) Antifungal hydrolases in pea tissue: II. Inhibition of fungal growth by combinations of chitinase and β-1,3-glucanase. Plant Physiology 88, 936–942. McGurl, B. and Ryan, C.A. (1992) The organization of the prosystemin gene. Plant Molecular Biology 20, 405–409. McGurl, B., Pearce, G., Orozco-Cardenas, M. and Ryan, C.A. (1992) Structure, expression and antisense inhibition of the systemin precursor gene. Science 255, 1570–1573. McGurl, B., Orozco-Cardenas, M., Pearce, G. and Ryan, C.A. (1994) Overexpression of the prosystemin gene in transgenic tomato plants generates a systemic signal that constitutively induces proteinase inhibitor synthesis. Proceedings of the National Academy of Sciences USA 91, 9799–9802. Medina, J., Hueros, G. and Carbonero, P. (1993) Cloning of cDNA, expression, and chromosomal location of genes encoding the three types of subunits of the barley tetrameric inhibitor of insect alpha-amylase. Plant Molecular Biology 23, 532–542. Mehdy, M.C. (1994) Active oxygen species in plant defense against pathogens. Plant Physiology 105, 467–472. Mehta, R.A., Warmbardt, R.D. and Mattoo, A.K. (1996) Tomato (Lycopersicon esculentum cv. Pik-Red) leaf carboxypeptidase: identification, N-terminal sequence, stress-regulation and specific localization in the paraveinal mesophyll vacuoles. Plant Cell Physiology 37, 806–815. Melan, M.A., Dong, X., Endara, M.E., Davis, K.R., Ausubel, F.M. and Peterman, T.K. (1993) An Arabidopsis thaliana lipoxygenase gene can be induced by pathogens, abscisic acid, and methyl jasmonate. Plant Physiology 101, 441–450. Meyer, B., Houlné, G., Pozueta-Romero, J., Schantz, M.-L. and Schantz, R. (1996) Fruitspecific expression of a defensin-type gene family in bell pepper. Plant Physiology 112, 615–622. Miksch, M. and Boland, W. (1996) Airborne methyl jasmonate stimulates the biosynthesis of furanocoumarins in the leaves of celery plants (Apium graveolens). Experientia 52, 739–743. Mirjalili, N. and Linden, J.C. (1996) Methyl jasmonate induced production of taxol in suspension cultures of Taxus cuspidata: ethylene interaction and induction models. Biotechnology Progress 12, 110–118. Mohan, R., Peruman, V. and Kolattukudy, P.E. (1993) Developmental and tissue-specific expression of a tomato anionic peroxidase gene by a minimal promoter, with wound and pathogen induction by an additional 5′-flanking region. Plant Molecular Biology 22, 475–490. Morelli, J.K., Shewmaker, C.K. and Vayda, M.E. (1994) Biphasic stimulation of translational activity correlates with induction of translation elongation factor 1 subunit a upon wounding in potato tubers. Plant Physiology 106, 897–903. Muday, G.K. and Herrmann, K.M. (1992) Wounding induces one of two isoenzymes of 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase in Solanum tuberosum. Plant Physiology 98, 496–500. Narvaez-Vasquez, J., Orozco-Cardenas, M.L. and Ryan, C.A. (1994) Sulfhydryl reagent modulates systemic signaling for wound-induced and systemin-induced proteinase inhibitor synthesis. Plant Physiology 105, 725–730.

08 Inducible Gene 08

3/16/99 11:16 AM

Page 153

Wound-inducible Genes

153

Nojiri, H., Sugimori, M., Yamane, H., Nishimura, Y., Yamada, A., Shibuya, N., Kodama, O., Murofushi, N. and Toshio, O. (1996) Involvement of jasmonic acid in elicitorinduced phytoalexin production in suspension-cultured rice cells. Plant Physiology 110, 387–392. O’Donnell, P.J., Calvert, C., Atzorn, R., Wasternack, C., Leyser, H.M.O. and Bowles, D.J. (1996) Ethylene as a signal mediating the wound response of tomato plants. Science 274, 1914–1917. Oh, S., Kwak, J.M., Kwun, I.C. and Gil, N.H. (1996) Rapid and transient induction of calmodulin-encoding gene(s) of Brassica napus by a touch stimulus. Plant Cell Reports 15, 586–590. Ohto, M., Nakamura-Kito, K. and Nakamura, K. (1992) Induction of expression of genes coding for sporamin and beta-amylase by polygalacturonic acid in leaf-petiole cuttings of sweet potato. Plant Physiology 99, 422–427. Palmer, D.A. and Bender, C.L. (1995) Ultrastructure of tomato leaf tissue treated with the pseudomonad phytotoxin coronatine and comparison with methyl jasmonate. Molecular Plant–Microbe Interactions 8, 683–692. Parmentier, Y., Durr, A., Marbach, J., Hirsinger, C., Criqui, M.-C., Fleck, J. and Jamet, E. (1995) A novel wound-inducible extensin is expressed early in newly isolated protoplasts of Nicotiana sylvestris. Plant Molecular Biology 29, 279–292. Parsons, B.L. and Mattoo, A.K. (1991) Wound-induced accumulation of specific transcripts in tomato fruit: interactions with fruit development, ethylene and light. Plant Molecular Biology 17, 453–464. Pearce, G., Johnson, S. and Ryan, C.A. (1993) Structure-activity of deleted and substituted systemin, an 18-amino acid polypeptide inducer of plant defensive genes. Journal of Biological Chemistry 268, 212–216. Pearce, G., Strydon, D., Johnson, S. and Ryan, C.A. (1991) A polypeptide from tomato leaves induces wound-inducible proteinase inhibitor proteins. Science 253, 895–898. Peña-Cortés, H., Sánchez-Serrano, J.J., Mertens, R., Willmitzer, L. and Prat, S. (1989) Abscisic acid is involved in the wound-induced expression of the proteinase inhibitor II gene in potato and tomato. Proceedings of the National Academy of Sciences USA 86, 9851–9855. Peña-Cortés, H., Willmitzer, L. and Sánchez-Serrano, J.J. (1991) Abscisic acid mediates wound induction but not developmental-specific expression of the proteinase inhibitor II gene family. Plant Cell 3, 963–972. Peña-Cortés, H., Liu, X.J., Sánchez-Serrano, J.J., Schmid, R. and Willmitzer, L. (1992) Factors affecting gene expression of patatin and proteinase-inhibitor-II gene families in detached potato leaves: implications for their co-expression in developing tubers. Planta 186, 495–502. Peña-Cortés, H., Albrecht, T., Prat, S., Weiler, E. and Willmitzer, L. (1993) Aspirin prevents wound-induced gene expression in tomato leaves by blocking jasmonic acid biosynthesis. Planta 191, 123–128. Peña-Cortés, H., Fisahn, J. and Willmitzer, L. (1995) Signals involved in wound-inducible proteinase inhibitor II gene expression in tomato and potato plants. Proceedings of the National Academy of Sciences USA 92, 4106–4113. Perez, A.G., Sanz, C., Richardson, D.G. and Olias, J.M. (1993) Methyl jasmonate vapor promotes beta-carotene synthesis and chlorophyll degradation in golden delicious apple peel. Journal of Plant Growth Regulation 12, 163–167. Pilet, P.E. and Rebeaud, J.E. (1983) Effect of abscisic acid on growth and indoyl-3-acetic acid levels in maize roots. Plant Science Letters 31, 117–122.

08 Inducible Gene 08

154

3/16/99 11:16 AM

Page 154

L. Zhou and R. Thornburg

Pozueta-Romero, J., Klein, M., Houlné, G., Schantz, M.-L., Meyer, B. and Schantz, R. (1995) Characterization of a family of genes encoding a fruit-specific woundstimulated protein of bell pepper (Capsicum annuum): identification of a new family of transposable elements. Plant Molecular Biology 28, 1011–1025. Ramputh, A.-I. and Brown, A.W. (1996) Rapid γ-aminobutyric acid synthesis and the inhibition of the growth and development of oblique-banded leaf-roller larvae. Plant Physiology 111, 1349–1352. Reinbothe, S., Reinbothe, C., Heintzen, C., Seidenbecher, C. and Parthier, B. (1993a) A methyl jasmonate-induced shift in the length of the 5′ untranslated region impairs translation of the plastid rbcL transcript in barley. The EMBO Journal 12, 1505–1512. Reinbothe, S., Reinbothe, C. and Parthier, B. (1993b) Methyl jasmonate represses translation initiation of a specific set of mRNAs in barley. The Plant Journal 4, 459–467. Reinbothe, S., Reinbothe, C. and Parthier, B. (1993c) Methyl jasmonate-regulated translation of nuclear-encoded chloroplast proteins in barley (Hordeum vulgare L. cv. Salome). Journal of Biological Chemistry 268, 10606–10611. Reinbothe, S., Mollenhauer, B. and Reinbothe, C. (1994a) JIPs and RIPs: the regulation of plant gene expression by jasmonates in response to environmental cues and pathogens. Plant Cell 6, 1197–1209. Reinbothe, S., Reinbothe, C., Lehmann, J., Becker, W., Apel, K. and Parthier, B. (1994b) JIP60, a methyl jasmonate-induced ribosome-inactivating protein involved in plant stress reactions. Proceedings of the National Academy of Sciences USA 91, 7012–7016. Reuber, T.L. and Ausubel, F.M. (1996) Isolation of Arabidopsis genes that differentiate between resistance responses mediated by the RPS2 and RPM1 disease resistance genes. Plant Cell 8, 241–249. Rhodes, J.D., Thain, J.F. and Wildon, D.C. (1996) The pathway for systemic electrical signal conduction in the wounded tomato plant. Planta 200, 50–57. Ritter, C. and Dangl, J.L. (1996) Interference between two specific pathogen recognition events mediated by distinct plant disease resistance genes. Plant Cell 8, 251–257. Roby, D., Toppan, A. and Esquerré-Tugayé, M.T. (1987) Cell surfaces in plant microorganism interactions. VIII. Increased proteinase inhibitor activity in melon plants in response to infection by Colletotrichum lagenarium or treatment with an elicitor fraction from this fungus. Physiological and Molecular Plant Pathology 30, 453–460. Rohrmeier, T. and Lehle, L. (1993) WIP1, a wound-inducible gene from maize with homology to Bowman-Birk proteinase inhibitors. Plant Molecular Biology 22, 783–792. Röse, U.S.R., Manukian, A., Heath, R.R. and Tumlinson, J.H. (1996) Volatile semiochemicals released from undamaged cotton leaves. Plant Physiology 111, 487–495. Royo, J., Vancanneyt, G., Pérez, A.G., Sanz, C., Störmann, K., Rosahl, S. and SánchezSerrano, J.J. (1996) Characterization of three potato lipoxygenases with distinct enzymatic activities and different organ-specific and wound-regulated expression patterns. Journal of Biological Chemistry 271, 21012–21029. Ryan, C.A. (1981a) Plant proteinases. In: Stumpf, P.K. and Conn, E.E. (eds) The Biochemistry of Plants: a Comprehensive Treatise, Vol. 6. Academic Press, New York, pp. 351–370. Ryan, C.A. (1981b) Proteinase inhibitors. In: Stumpf, P.K. and Conn, E.E. (eds) The Biochemistry of Plants: a Comprehensive Treatise, Vol. 6. Academic Press, New York, pp. 351–370.

08 Inducible Gene 08

3/16/99 11:16 AM

Page 155

Wound-inducible Genes

155

Ryu, S.B. and Wang, X. (1996) Activation of phospholipase D and the possible mechanism of activation in wound-induced lipid hydrolysis in castor bean leaves. Biochemica et Biophysica Acta 1303, 243–250. Saarikoski, P., Clapham, D. and von Arnold, S. (1996) A wound-inducible gene from Salix viminalis coding for a trypsin inhibitor. Plant Molecular Biology 31, 465–478. Sabri, N., Pelissier, B. and Teissie, J. (1996) Electropermeabilization of intact maize cells induces an oxidative stress. European Journal of Biochemistry 238, 737–743. Sadka, A., DeWald, D.B., May, G.D., Park, W.D. and Mullet, J.E. (1994) Phosphate modulates transcription of soybean VspB and other sugar-inducible genes. Plant Cell 6, 737–749. Sanchez-Serrano, J.J., Amati, S., Ebneth, M., Hildmann, T., Mertens, R., Peña-Cortés, H., Prat, S. and Willmitzer, L. (1991) The involvement of ABA in wound responses of plants. In: Davies, W.J. and Hones, H.G. (eds) Abscisic Acid Physiology and Biochemistry. Bios Scientific, Oxford, UK, pp. 201–216. Sano, H. and Ohashi, Y. (1995) Involvement of small GTP-binding proteins in defense signal-transduction pathways of higher plants. Proceedings of the National Academy of Sciences USA 92, 4138–4144. Sano, H., Seo, S., Orudgev, E., Youssefain, S., Ishizuka, K. and Ohashi, Y. (1994) Expression of the gene for a small GTP-binding protein in transgenic tobacco elevates endogenous cytokinin levels, abnormally induces salicylic acid in response to wounding and increases resistance to tobacco mosaic virus infection. Proceedings of the National Academy of Sciences USA 91, 10556–10560. Sano, H., Seo, S., Koizumi, N., Niki, T., Iwamura, H. and Ohashi, Y. (1996) Regulation by cytokinins of endogenous levels of jasmonic acid and salicylic acids in mechanically wounded tobacco plants. Plant Cell Physiology 37, 762–769. Sauer, N., Corbin, D.R., Keller, B. and Lamb, C.J. (1990) Cloning and characterization of a wound-specific hydroxyproline-rich glycoprotein in Phaseolus vulgaris. Plant, Cell and Environment 13, 257–266. Schaller, A. and Ryan, C.A. (1996) Molecular cloning of a tomato leaf cDNA encoding an aspartic protease, a systemic wound response protein. Plant Molecular Biology 31, 1073–1077. Schaller, A., Bergey, D.R. and Ryan, C.A. (1995) Induction of wound response genes in tomato leaves by bestatin, an inhibitor of aminopeptidases. Plant Cell 7, 1893–1898. Sheng, J., D’Ovidio, R. and Mehdy, M. (1991) Negative and positive regulation of a novel proline-rich protein mRNA by fungal elicitor and wounding. The Plant Journal 1, 345–354. Showalter, A.M., Butt, A.D. and Kim, S. (1992) Molecular details of tomato extensin and glycine-rich protein gene expression. Plant Molecular Biology 19, 205–215. Sisler, E.C., Blankenship, S.M. and Guest, M. (1990) Competition of cyclooctenes and cyclooctadienes for ethylene binding and activity in plants. Plant Growth Regulation 9, 157–164. Stanford, A.C., Northcote, D.H. and Bevan, M.W. (1990) Spatial and temporal patterns of transcription of a wound-induced gene in potato. The EMBO Journal 9, 593–603. Stankovic, B. and Davies, E. (1995) Direct electrical induction of gene expression in tomato plants. Journal of Cellular Biochemistry Supplement 21A, 503. Staswick, P.E. (1989) Developmental regulation and the influence of plant sinks on vegetative storage protein gene expression in soybean leaves. Plant Physiology 89, 309–315.

08 Inducible Gene 08

156

3/16/99 11:16 AM

Page 156

L. Zhou and R. Thornburg

Staswick, P.E., Huang, J.F. and Rhee, Y. (1991) Nitrogen and methyl jasmonate induction of soybean vegetative storage protein genes. Plant Physiology 96, 130–136. Staswick, P.E., Su, W. and Howell, S.H. (1992) Methyl jasmonate inhibition of root growth and induction of a leaf protein are decreased in an Arabidopsis thaliana mutant. Proceedings of the National Academy of Sciences USA 89, 6837–6840. Sturm, A. (1992) A wound-inducible glycine rich protein from Daucus carota with homology to single-stranded nucleic acid-binding proteins. Plant Physiology 99, 1689–1692. Sturm, A. and Chrispeels, M. (1990) cDNA cloning of carrot extracellular β-fructosidase and its expression in response to wounding and infection. Plant Cell 2, 1107–1119. Taipalensuu, J., Falk, A. and Rask, L. (1996) A wound- and methyl jasmonate-inducible transcript coding for a myrosinase-associated protein with similarities to an early nodulin. Plant Physiology 110, 483–491. Taipalensuu, J., Falk, A., Ek, B. and Rask, L. (1997) Myrosinase-binding proteins are derived from a large wound-inducible and repetitive transcript. European Journal of Biochemistry 243, 605–611. Tal, M. and Imber, D. (1970) Abnormal stomatal behavior and hormonal imbalance in flaca, a wilty mutant of tomato: II. Auxin- and abscisic acid-like activity. Plant Physiology 46, 373–376. Templeton, M.D. and Lamb, C.J. (1988) Elicitors and defense gene activation. Plant, Cell and Environment 11, 395–401. Terek, O.I. (1982) Endogenous auxin and gibberellin in bean plants. Fiziologia Rasterii (Sofia) VIII, 28–32. Teutsch, H.G., Hasenfratz, M.P., Lesot, A., Stoltz, C., Garnier, J.-M., Jeltsch, J.-M., Durst, F. and Werck-Reichhart, D. (1993) Isolation and sequence of a cDNA encoding the Jerusalem artichoke cinnamate 4-hydroxylase, a major plant cytochrome P450 involved in the general phenylpropanoid pathway. Proceedings of the National Academy of Sciences USA 90, 4102–4106. Thornburg, R.W. and Li, X. (1991) Wounding of the foliage of Nicotiana tabacum causes a decline in the levels of endogenous foliar IAA. Plant Physiology 96, 802–805. Truernit, E., Schmid, J., Epple, P., Illig, J. and Sauer, N. (1996) The sink-specific and stressregulated Arabidopsis STP4 gene: enhanced expression of a gene encoding a monosaccharide transporter by wounding, elicitors, and pathogen challenge. Plant Cell 8, 2169–2182. Truesdell, G.M. and Dickman, M.B. (1997) Isolation of pathogen/stress-inducible cDNAs from alfalfa by mRNA differential display. Plant Molecular Biology 33, 737–743. Tymowska-Lalanne, Z., Schwebel-Dugué, N., Lecharny, A. and Kreis, M. (1996) Expression and cis-acting elements of the Atbfruct1 gene from Arabidopsis thaliana encoding a cell wall invertase. Plant Physiology and Biochemistry 34, 431–442. Veen, H. (1987) Use of inhibitors of ethylene action. In: Reid, M.S. (ed.) Manipulation of Ethylene Responses in Horticulture. Acta Horticulturae 201, pp. 213–222 Vick, B.A. and Zimmerman, D.C. (1983) The biosynthesis of jasmonic acid: a physiological role for plant lipoxygenase. Biochemical and Biophysical Research Communications 111, 470–477. Vick, B.A. and Zimmerman, D.C. (1984) Biosynthesis of jasmonic acid by several plant species. Plant Physiology 75, 458–461. Vick, B.A. and Zimmerman, D.C. (1986) Characterization of 12-oxo-phytodienoic acid reductase in corn: the jasmonic acid pathway. Plant Physiology 80, 202–205.

08 Inducible Gene 08

3/16/99 11:16 AM

Page 157

Wound-inducible Genes

157

Vick, B.A., Feng, P. and Zimmerman, D.C. (1980) Formation of 12-[18O]-oxo-cis-10, cis15-phytodienoic acid from 13-[18O]-hydroperoxylinolenic acid by hydroperoxide cyclase. Lipids 15, 468–471. Vogt, T., Pollak, P., Tarlyn, N. and Taylor, L.P. (1994) Pollination- or wound-induced kaempferol accumulation in petunia stigmas enhances seed production. Plant Cell 6, 11–23. Walker-Simmons, M. and Ryan, C.A. (1984) Proteinase inhibitor synthesis in tomato leaves: induction by chitosan oligomers and chemically modified chitosan and chitin. Plant Physiology 76, 787–790. Walker-Simmons, M.K., Hollander-Czytko, H., Andersen, J.K. and Ryan, C.A. (1984) Proceedings of the National Academy of Sciences USA 81, 3737–3741. Wallace, W., Secor, J. and Schrader, L.E. (1984) Rapid accumulation of 4-aminobutyric acid and alanine in soybean leaves in response to abrupt transfer to lower temperature, darkness or mechanical manipulation. Plant Physiology 75, 170–175. Warner, S.A.J., Scott, R. and Draper, J. (1992) Characterization of a wound-induced transcript from the monocot asparagus that shares similarity with a class of intracellular pathogenesis-related (PR) proteins. Plant Molecular Biology 19, 555–561. Wasternack, C., Atzorn, R., Blume, B., Leopold, J. and Parthier, B. (1994) Ursolic acid inhibits synthesis of jasmonate-induced proteins in barley leaves. Phytochemistry 35, 49–54. Watson, A.T. and Cullimore, J.V. (1996) Characterization of the expression of the glutamine synthetase gln-a gene of Phaseolus vulgaris using promoter-reporter gene fusions in transgenic plants. Plant Science 120, 139–151. Weiss, C. and Bevan, M. (1991) Ethylene and a wound signal modulate local and systemic transcription of win2 genes in transgenic potato plants. Plant Physiology 96, 943–951. Wildon, D.C., Thain, J.F., Minchin, P.E.H., Gubb, I.R., Reilly, A.M., Skipper, Y.D., Doherty, H.M., O’Donnell, P.J. and Bowles, D.J. (1992) Electrical signaling and systemic proteinase inhibitor induction in the wounded plant. Nature (London) 360, 62–65. Wodzicki, T., J. and Wodzicki, A.B. (1981) Modulation of the oscillatory system involved in polar transport of auxin by other phytohormones. Physiologia Plantarum 53, 176–180. Xu, Y., Chang, P.F.L., Liu, D., Narasimhan, M.L., Raghothama, K.G., Hasegawa, P.M. and Bressan, R.A. (1994) Plant defense genes are synergistically induced by ethylene and methyl jasmonate. Plant Cell 6, 1077–1085. Yasuda, E., Ebinuma, H. and Hiroetsu, W. (1997) A novel glycine rich/hydrophobic 16 kDa polypeptide gene from tobacco: similarity to proline-rich protein genes and its wound-inducible and developmentally regulated expression. Plant Molecular Biology 33, 667–678. Yen, H.-C., Lee, S., Tanksley, S.D., Lanahan, M.B., Klee, H.J. and Giovannoni, J.J. (1995) The tomato Never-ripe locus regulates ethylene-inducible gene expression and is linked to a homolog of the Arabidopsis ETR1 gene. Plant Physiology 107, 1343–1353. Yeo, D., Abe, T., Abe, H., Sakurai, A., Takio, K., Dohmae, N., Takahashi, N. and Shigeo, Y. (1996) Partial characterization of a 17 kDa acidic protein, EFP, induced by thiocarbamate in the early flowering phase in Asparagus seedlings. Plant Cell Physiology 37, 935–940.

08 Inducible Gene 08

158

3/16/99 11:16 AM

Page 158

L. Zhou and R. Thornburg

Zabaleta, E., Assad, N., Oropeza, A., Salerno, G. and Herrera-Estrella, L. (1994) Expression of one of the members of the Arabidopsis chaperonin 60b gene family is developmentally regulated and wound-repressible. Plant Molecular Biology 24, 195–202. Zhang, L., Cohn, N.S. and Mitchell, J.P. (1996) Induction of a pea cell-wall invertase by wounding and its localized expression pattern in phloem. Plant Physiology 112, 1111–1117.

08 Inducible Gene 08

Appendix 8.1. Wound-inducible genes in plants. Induced by Protein

Species

Reference

Yes Yes Yes Yes

Yes Yes

Systemically induced Auxin repressible Inducible by water deficit Phosphate repressible; accumulates in protein inclusion bodies of plastids

McGurl et al., 1992 Mason and Mullet, 1990 Staswick et al., 1991 Franceschi and Grimes, 1991; Mason et al., 1992; Grimes et al., 1992; Sadka et al., 1994; DeWald et al., 1994; Bohland et al., 1997 Melan et al., 1993

Yes

Arabidopsis thaliana

AtLox2 (Lipoxygenase)

Arabidopsis thaliana

Yes

Yes

Allene oxide synthase Phospholipase D Leucine aminopeptidase

Yes Yes Yes

Yes

Calmodulin

Arabidopsis thaliana Ricinus communis Lycopersicon esculentum Solanum tuberosum Brassica napus

Glutathione-S-transferase

Arabidopsis thaliana

Yes

Yes

Yes

Inducible by ABA; inducible by both virulent and avirulent microorganisms Systemically induced; may be in chloroplast; inducible by ABA

LAP-A found in plastid Inducible by ABA Transient induction by touch stimulus

Bell and Mullet, 1993

Herde et al., 1995 Ryu and Wang, 1996 Gu et al., 1996 Hildemann et al., 1992 Oh et al., 1996 Kim et al., 1994 Continued over

159

AtLox1 (Lipoxygenase)

Page 159

Comment

Wound-inducible Genes

MeJA

3/16/99 11:16 AM

Wound induction/maintenance Prosystemin Lycopersicon esculentum Lipoxygenase Glycine max Pisum sativum Triticum aestivum

wound

Induced by Protein

Species

wound

Yes Yes

Nicotiana sylvestris Lycopersicon esculentum Petunia hybrida Phaseolus vulgaris Daucus carota Solanum tuberosum

Yes Yes Yes Yes Yes Yes

AGPs – arabinogalactan proteins

Acacia senegal

Yes

PRPs – proline-rich proteins

Glycine max

Yes

Phaseolus vulgaris Daucus carota Nicotiana tabacum

Yes Yes Yes

GRPs – glycine-rich proteins

Solanaceous lectins

Yes

Multiple forms, some induced by Agrobacterium infection or race-specific elicitor induction

Lawton and Lamb, 1987 Corbin et al., 1987 Cardemil and Riquelme, 1991 Parmentier et al., 1995 Sauer et al., 1990; Adams et al., 1992 Parmentier et al., 1995 Showalter et al., 1992 Condit and Meager, 1987 Keller et al., 1988 Sturm, 1992 Casalongué and Pont Lezica, 1985

Multiple forms some systemic; some induced locally by Agrobacterium infection or ABA; some repressed by wounding Developmentally expressed and woundinduced in tubers Arabinogalactan gums are secreted by wounded tissues Multiple forms; some developmentally expressed others wound-inducible

Clarke et al., 1979; Fincher et al., 1983 Keis-San Francisco and Tierney, 1990 Creelman et al., 1992 Sheng et al., 1991 Ebener et al., 1993; Yasuda et al., 1997

Page 160

Nicotiana sylvestris Helianthus annuus

Reference

3/16/99 11:16 AM

Yes Yes Yes

Comment

L. Zhou and R. Thornburg

Cell wall proteins HGRPs – hydroxyproline- Phaseolus vulgaris Araucaria araucana rich glycoproteins – Prosopsis chilensis extensins

MeJA

08 Inducible Gene 08

160

Appendix 8.1. Wound-inducible genes in plants (continued).

Yes

Ribosome inactivation protein

Chaudhry et al., 1994

Solanum tuberosum

Yes

Biphasic response

Arabidopsis thaliana

Repressed

RUBISCO binding protein Zabaleta et al., 1994

Arabidopsis thaliana

Yes

Lycopersicon esculentum Glycine max Cucumis melo

Yes Yes Yes

Cucumis melo

Yes

TOM13

Lycopersicon esculentum Vigna radiata Lycopersicon esculentum

Yes Yes Yes

Pch313

Prunus persica

Yes

ACC oxidase

ACO1

Morelli et al., 1994

Kim et al., 1994 Also ethylene induced

Callahan et al., 1992

Continued over

161

Repressed Induced by ethylene biosynthesis Induced by ethylene biosynthesis

Liu et al., 1993 Lincoln et al., 1993 Diallinas and Kanellis, 1994 Diallinas and Kanellis, 1994 Barry et al., 1996 Kim and Yang, 1994 Holdsworth et al., 1988

Wound-inducible Genes

Ethylene regulation S-adenosylmethionine synthase ACC synthase

Sturm, 1992

Page 161

Yes

3/16/99 11:16 AM

Daucus carota

GRP – single-stranded nucleic acid binding protein Elongation factor 1 subunit a Chaperonin 60b

08 Inducible Gene 08

Inhibition of photosynthetic translation JIP 60 Hordeum vulgare

Induced by

Sn1 and Sn2 (ethylene-related)

Capsicum annum

Yes

Sn1 shows developmental Pozueta-Romero et al., expression in fruit 1995 homology with latex proteins

Yes

Inducible with H2O2 Fruit developmental expression

Secondary metabolism/phytoalexin biosynthesis Phenylalanine ammonia Phaseolus vulgaris lyase Cucumis melo Cinnamate 4-hydroxylase Helianthus tuberosus Arabidopsis thaliana Pisum sativum 4-Coumarate:CoA ligase Nicotiana tabacum Petroselinum crispum Chalcone synthase

Chalcone isomerase

Caffeic acid methyl transferase

Yes Yes Yes Yes

Phaseolus vulgaris Cucumis melo

Yes Yes

Petunia hybrida Picea abies Phaseolus vulgaris Cucumis melo

Yes

Hordeum vulgare

Yes

MeJA

Yes

Comment

Constitutively expressed in old stem Inducible with H2O2

Inducible with H2O2 Yes

Not inducible by ABA

Reference

Mehdy, 1994

Bell-LeLong et al., 1997 Teutsch et al., 1993 Frank et al., 1996 Lee and Douglas, 1996 Ellard-Ivey and Douglas, 1996 Mehdy, 1994 Diallinas and Kanellis, 1994 Vogt et al., 1994 Brignolas et al., 1995 Mehdy, 1994 Diallinas and Kanellis, 1994 Lee et al., 1996

Page 162

wound

3/16/99 11:16 AM

Species

L. Zhou and R. Thornburg

Protein

08 Inducible Gene 08

162

Appendix 8.1. Wound-inducible genes in plants (continued).

Threonine dehydratase Polyphenol oxidase Stilbene synthase Myrosinase-binding proteins

Solanum tuberosum Lycopersicon esculentum Picea abies Brassica napus

Yes Yes Yes Yes

Yes Yes

Glutamine synthase

Phaseolus vulgaris

Yes

Malic enzyme

Lycopersicon esculentum

Yes

DAHPS 3-Deoxy-D-arabinoheptulosonate-7phosphate synthase

Solanum tuberosum Arabidopsis thaliana

Yes Yes

2-Oxoglutarate-dependent Lycopersicon esculentum dioxygenase

Petroselinum crispum

Yes

Yes

Yes

Continued over

163

Bergaptol methyltransferase

Yes

Choi et al., 1994 Maldonado-Mendoza et al., 1994; Burnett et al., 1993; Choi et al., 1992 ABA inducible Hildmann et al., 1992 Activated by systemin Constabel et al., 1995 Brignolas et al., 1995 Similar to ENOD8; Taipalensuu et al., 1996; constitutively expressed in Taipalensuu et al., 1997 seed Danielle, 1992; Watson and Cullimore, 1996 Induced by glutathione Carollo and Adams, 1996 and dithiothreitol First step of aromatic Dyer et al., 1989 amino acid synthesis Keith et al., 1991; may be chloroplast Muday and Herrmann, targeted; Mn2+ isozyme 1992 induced; Co2+ isozyme not induced Repressed by auxin; Jacobsen and Olszewski, repressed by GA3; 1996 induced by ABA Induced by fungal elicitor Ellard-Ivey and Douglas, 1996 Different isozymes expressed depending upon signal

Page 163

Yes Inhibited

3/16/99 11:16 AM

Yes Yes

08 Inducible Gene 08

Solanum tuberosum Camptotheca acuminata

Wound-inducible Genes

HMG CoA reductase

Induced by Species

wound

Glutamate decarboxylase

Glycine max

Yes

Proteinaceous plant defences Lycopersicon esculentum Proteinase inhibitor I

MeJA

Comment

Induced by rapid increase Wallace et al., 1984 Knight et al., 1991 in cytosolic Ca2+ Auxin repressible, sucrose induced Constitutive expression in tubers; developmentally expressed in fruits of wild species ABA and inducible Auxin repressible; phosphate repressible; constitutive expression in tubers and flower buds

Solanum tuberosum

Yes

Yes

Proteinase inhibitor II

Lycopersicon esculentum Solanum tuberosum

Yes Yes

Yes Yes

Trypsin inhibitor Cathepsin D inhibitor

Salix viminalix Solanum brevidens

Yes Yes

Yes

Inducible by chitinase

Solanum tuberosum

Yes

Yes

Auxin repressible; not sucrose induced; constitutive expression in tubers and flower buds

Lycopersicon esculentum Medicago sativa

No Yes

Yes

Numerous See text

Numerous See text

Saarikoski et al., 1996 Hansen and Hannapel, 1992 Liu et al., 1997; Ishikawa et al., 1994

Bolter, 1993 Brown and Ryan, 1984

Page 164

Yes

L. Zhou and R. Thornburg

Yes

Papain inhibitor Bowman Birk inhibitor

Reference

3/16/99 11:16 AM

Protein

08 Inducible Gene 08

164

Appendix 8.1. Wound-inducible genes in plants (continued).

Yes

Yes

Yes

Alpha amylase inhibitor Cysteine proteinase

Hordeum vulgare Nicotiana tabacum

Yes Yes

Aspartic protease Carboxypeptidase

Lycopersicon esculentum Lycopersicon esculentum

Yes Yes

WIP1

Zea mays

Yes

win4

Populus sp.

Yes

SRG (stress response gene) Medicago sativa

AoPR1 Wun1

Asparagus officialis Solanum tuberosum

Yes

Yes Yes

Copper ions lowered wound-induction of carboxypeptidase

Yes

Botella et al., 1996

Medina et al.,1993 Linthorst et al., 1993 Schaller and Ryan, 1996 Mehta et al., 1996

Rohrmeier and Lehle, 1993 Davis et al., 1993

Continued over

165

Systemic expression after wounding; identity with vegetative storage proteins Induced by Colletotrichum Truesdell and Dickman, trifolii elicitor; similar to a 1997 variety of stress-induced genes Warner et al., 1992 Induced by invading Logemann and Schell, nematodes; induced by 1989; Hansen et al., Phytophthora 1996

Page 165

Yes

3/16/99 11:16 AM

Glycine max

Cordero et al., 1994

Wound-inducible Genes

Cysteine proteinase inhibitor

Systemically induced; induced by fungal elicitors, ABA Both wounding and MJ induction requires ethylene Inhibited mRNA shows a circadian rhythm

08 Inducible Gene 08

Maize proteinase inhibitor Zea mays

Induced by

win2 (chitin binding protein)

Solanum tuberosum

Yes

Anionic peroxidase (tap1 and tap2)

β-1,3-Glucanase Osmotin (2)-Pinene synthase J1-defensin

Lycopersicon esculentum Glycine max Stylosanthes humilis Populus sp. Nicotiana tabacum Nicotiana tabacum Nicotiana tabacum Abies grandis Capsicum annuum

Yes Yes Yes Yes Yes Yes Yes Yes Yes

Thionin

Hordeum vulgare

Yes

Yes

Glycine max Arabidopsis thaliana

Yes Yes

Yes Yes

Ipomoea batatas

Yes

No

Ipomoea batatas

Yes

No

Chitinase

Storage proteins VSP – vegetative storage protein – (acid phosphatase) Sporamin

β-Amylase

MeJA

Comment

Reference

Systemic induction required both wounding and ethylene Induced by Verticillium elicitor and ABA

Stanford et al., 1990; Weiss and Bevan, 1991

Yes Systemically induced in Populus

Not affected by chitosan Accumulates in fruit during ripening Induced by powdery mildew Auxin repressible Sucrose induced; phosphate repressible Inducible by chitosan, sucrose, polygalacturonase and ABA; repressed by gibberellic acid Sucrose induced

Mohan et al., 1993 Diehn et al., 1993 Curtis et al., 1997 Clarke et al., 1994 Grosset et al., 1990 Grosset et al., 1990 Grosset et al., 1990 Lewinsohn et al., 1992 Meyer et al., 1996 Andresen et al., 1992; Bohlmann and Apel, 1991 Numerous See text Ohto et al., 1992

Ohto et al., 1992

Page 166

wound

3/16/99 11:16 AM

Species

L. Zhou and R. Thornburg

Protein

08 Inducible Gene 08

166

Appendix 8.1. Wound-inducible genes in plants (continued).

Early flowering protein Bark storage protein

Asparagus officialis Populus deltoides

Return to normal physiology β-Fructosidase Arabidopsis thaliana

Yes

Sucrose induced

Daucus carota Pisum sativum

Yes Yes

Arabidopsis thaliana

Yes

Inducible by chitin and bacterial elicitor

Yes Yes

Leopold et al., 1996 Induced by Agrobacterium Yasuda et al., 1997 tumefaciens Auxin repressible; Kim et al., 1993 inducible by salicylic acid Guevara-García et al., 1993

Proteins of unknown involvement 37 kDa protein Hordeum vulgare NT16 Nicotiana tabacum Nopaline synthase

Agrobacterium tumefaciens Yes

Mannopine synthase

Agrobacterium tumefaciens Yes

Yes

Yes

Induced by ABA

Page 167

Sturm and Chrispeels, 1990 Kaufman et al., 1973 Tymowska-Lalanne et al., 1996; Zhang et al., 1996 Truernit et al., 1996

Wound-inducible Genes

STP4 – (monosaccharide transporter)

Yes Yes

Inducible by glutamine Peña-Cortés et al., 1992 and sucrose; phosphate repressible; constitutive expression in tubers Induced by thiocarbamates Yeo et al., 1996 Davis et al., 1993

3/16/99 11:16 AM

Solanum tuberosum

08 Inducible Gene 08

Class-I patatin

167

08 Inducible Gene 08

3/16/99 11:16 AM

Page 168

09 Inducible Gene 09

3/16/99 11:16 AM

Page 169

Developmental Targeting of Gene Expression by the Use of a Senescence-specific Promoter

9

Susheng Gan1 and Richard M. Amasino2 1Tobacco

and Health Research Institute and Department of Agronomy, Cooper and University Drives, University of Kentucky, Lexington, KY 40546-0236, USA; 2Department of Biochemistry, 420 Henry Mall, University of Wisconsin, Madison, WI 53706-1569, USA

INTRODUCTION The terminal developmental phase in the life cycle of a plant is generally referred to as senescence. The lifespan of individual organs of a plant can be much shorter than that of the plant itself and the senescence of these specific organs is often studied (e.g. leaf senescence, floral senescence, fruit senescence or ripening, etc.). Plants exhibit two types of senescence: proliferative senescence and post-mitotic senescence. An example of proliferative senescence is the arrest of a shoot apical meristem in certain annual plants (Hensel et al., 1994). After a certain number of divisions the stem cells of the shoot apical meristem will stop mitotic division and therefore terminate the production of leaves or flowers. This type of senescence is observed in yeast and mammalian cells and is sometimes referred to as replicative senescence. In mammalian cells, telomere shortening may cause this cellular senescence (Bodnar et al., 1998). Postmitotic senescence occurs in organs such as leaves or petals. Once formed, cells in these organs rarely undergo cell division and thus their senescence is not due to an inability to divide. In this chapter, only leaf senescence, which is postmitotic senescence, will be discussed. Leaf senescence, like many other plant developmental processes, is a genetically controlled programme that is regulated by a complex array of environmental and internal factors (reviewed in Gan and Amasino, 1997). Moreover, this last phase of plant development is different from other developmental events not only temporally but also biochemically and genetically, which provides unique opportunities for targeting gene expression for both basic and © CAB International 1999. Inducible Gene Expression (ed. P.H.S. Reynolds)

169

09 Inducible Gene 09

170

3/16/99 11:16 AM

Page 170

S. Gan and R.M. Amasino

applied research. This chapter describes senescence-targeted isopentenyl transferase (IPT) gene expression using a senescence-specific promoter for studies of cytokinin biology and biotechnology.

LEAF SENESCENCE AND AGRICULTURE Leaves are the primary site where the photosynthetic machinery operates to fix CO2 into carbohydrates. However, when a leaf enters the terminal phase – senescence – anabolic processes such as photosynthesis are replaced by catabolism; e.g. chlorophyll is degraded (which contributes to leaf yellowing, a visible marker of senescence), leaf proteins, especially those in chloroplasts, are degraded, and the turnover of RNA and membrane lipids increases. For example, approximately 60% of total protein is degraded during Arabidopsis leaf senescence (Lohman et al., 1994). In many plant species it has been shown that the nutrients released by these catabolic pathways are re-allocated to support seed development and young tissue growth. Therefore, this degenerative process may play an important role in the evolution of plant fitness by providing a means to retain nutrients which are difficult to acquire and to provide those nutrients to the next generation. Although leaf senescence is thought to be an evolutionary adaptation to recycle nutrients, this process may have negative effects in an agricultural setting. During senescence, the photosynthetic capability of a leaf declines sharply. Therefore, leaf senescence may limit yield and/or dry weight of certain crops such as soybean and maize (Noodén, 1988a). Senescence also contributes to much of the postharvest loss of vegetable crops and limits the shelf-life of ornamental plants. In addition, a senescing leaf becomes more vulnerable to pathogenic infections.

THE ROLE OF CYTOKININS IN PLANT SENESCENCE Previous physiological and biochemical studies have shown that while there are many external and internal cues (such as nutrient deficiency, pathogen infection, temperature extremes, water stress, phytohormone levels, seed development) that induce senescence, there are only a few factors that retard senescence; among these factors is the level of the cytokinin class of phytohormones. The role of cytokinins in retarding leaf senescence was suggested in 1957 when Richmond and Lang found that kinetin treatment prevented the loss of protein and chlorophyll in detached cocklebur leaves (Richmond and Lang, 1957). Since then three lines of experimentation have been performed to investigate the inhibitory role of cytokinins in leaf senescence. One type involves adding exogenous cytokinin to leaves. These studies show that exogenously added cytokinin can inhibit senescence in some plant species while inconsistent

09 Inducible Gene 09

3/16/99 11:16 AM

Page 171

Developmental Targeting by the Use of a Senescence-specific Promoter 171

data were obtained from some other experiments (Noodén and Leopold, 1978). Another type of experiment involves measurement of endogenous cytokinin levels before and during senescence. These studies reveal an inverse correlation between cytokinin levels and the progression of senescence in a variety of tissues and plant species (reviewed by van Staden et al., 1988). The third type of experiment involves manipulation of endogenous cytokinin production in transgenic plants. As discussed later, the cloning of IPT, an Agrobacterium tumefaciens gene involved in cytokinin synthesis, has made it possible to genetically engineer cytokinin production in transgenic plants using a variety of promoters such as heat-shock- and light-inducible promoters (for review, see Gan and Amasino, 1995). When cytokinin levels in transgenic plants were elevated, leaf senescence was usually delayed. Although these lines of experimentation have provided much useful information on the effect of cytokinins in plant senescence, further studies are needed to define the specific role of cytokinins in this process. For example, there is much variability in the effects of cytokinin treatments, and analyses of endogenous cytokinin levels reveal only correlations between cytokinin levels and senescence. Furthermore, in the transgenic plants in which cytokinin production was manipulated by expression of the IPT gene from various promoters there were a variety of morphological and developmental aberrations because of the imprecision in targeting cytokinin production spatially, temporally and quantitatively. The abnormalities of the transgenic plants complicates the interpretation of the role of cytokinins because senescence is often under correlative control; i.e. the developmental state of various parts of the plant affects other parts to achieve a coordination of the senescence programme. Thus it is difficult to distinguish whether the delay of senescence in a transgenic plant is directly due to cytokinin production in leaves or due indirectly to the developmental alterations caused by cytokinin overproduction. If a leaf senescence-specific promoter is used to direct the expression of the cytokinin-synthesizing gene, IPT, cytokinin production in a transgenic plant will be targeted to leaves at the onset of senescence. This should prevent the aforementioned abnormalities associated with cytokinin production driven by other promoters, and the inhibitory role of cytokinins in leaf senescence can be specifically studied. In addition, this technology may provide a way to genetically manipulate senescence for agricultural improvement.

DEVELOPING A SYSTEM FOR TARGETING IPT EXPRESSION TO SENESCING LEAVES Identification of senescence-associated genes (SAGs) Senescence is accompanied by, and is likely to be driven by, changes in gene expression (Gan and Amasino, 1997). Many studies have demonstrated that a subset of gene transcripts increases in abundance while the levels of the

09 Inducible Gene 09

172

3/16/99 11:16 AM

Page 172

S. Gan and R.M. Amasino

majority of leaf mRNAs rapidly diminish with the progression of leaf senescence. This change was demonstrated using in vitro translation followed by gel electrophoresis to detect changes in translatable mRNA populations during senescence (Watanabe and Imaseki, 1982; Davies and Grierson, 1989; Becker and Apel, 1993; Buchanan-Wollaston, 1994; Smart et al., 1995). Although leaf senescence is associated with both activation and inactivation of distinct sets of genes, gene inactivation per se is not sufficient for causing senescence but rather, gene expression within leaf cells is required for senescence to proceed. This is because the senescence process can be blocked by inhibitors of RNA and protein synthesis (Noodén, 1988a). For this reason, efforts have been focused on the identification of genes whose expression is activated during senescence (i.e. senescence-associated genes or SAGs). Differential screening has been the main technique that has been employed for isolating SAGs (Davies and Grierson, 1989; Becker and Apel, 1993; Hensel et al., 1993; Taylor et al., 1993; Buchanan-Wollaston, 1994; Lohman et al., 1994; Smart et al., 1995). This technique involves: (i) construction of cDNA libraries using mRNAs of senescent tissues; (ii) making duplicate sets of filters of the cDNA library; and (iii) hybridization of one set of the filters with cDNA probes made from young, non-senescent tissues and the other set with senescent cDNA probes. Comparison of the two sets of filters allows one to identify cDNA clones that hybridize only to ‘senescent’ cDNA probes but not to non-senescent probes and therefore identify mRNAs that increase during senescence. Using this technique, we have previously identified six cDNA clones designated SAG12–SAG17 (Lohman et al., 1994). Nuclear run-on and Northern analyses revealed that transcription of both SAG12 and SAG13 was detected only in senescing tissues but not in young, non-senescent tissues, i.e. these two genes were expressed in a highly senescence-specific manner, while SAG14–SAG17 showed a moderate basal level expression in young tissues and an increased expression in senescing tissues (S. Gan and R.M. Amasino, USA, unpublished data). The senescence-specific expression of SAG12 as revealed by a RNA gel blot analysis is shown in Fig. 9.1. The gene organization of SAG12 and SAG13 have been characterized. SAG12, a single-copy gene which consists of two exons and one intron, encodes a protein that belongs to the superfamily of cysteine proteinases, which includes ICE and CED3. ICE/CED3 genes are involved in programmed cell death (PCD) in animals (Steller, 1995). SAG13, which consists of four exons and three introns, was duplicated recently in evolution; both copies have an identical sequence except for a single nucleotide polymorphism in the promoter region. SAG13 appears to encode a short-chain alcohol dehydrogenase related to TASSELSEED2 (TS2). TS2 is required for sex determination-related PCD in maize (DeLong et al., 1993). The promoter regions of both SAG12 and SAG13 have been fused to the β-glucuronidase (GUS) reporter gene, and in transgenic Arabidopsis and tobacco plants, these promoters direct GUS expression in a senescence-specific manner (S. Gan and R.M. Amasino, USA, unpublished data). Although the signal transduction pathways that regulate expression of

09 Inducible Gene 09

3/16/99 11:16 AM

Page 173

Developmental Targeting by the Use of a Senescence-specific Promoter 173

NS S1 S2 S3 S4 S5 Fig. 9.1. Northern blot analysis of SAG12 expression in rosette leaves of Arabidopsis thaliana (ecotype Landsberg erecta). Each lane contained 5 µg of total RNA from leaves at the indicated stages of senescence. NS, non-senescent, fully expanded leaves; S1, first visible signs of senescence: chlorophyll loss at leaf tip; S2, up to 25% loss of chlorophyll; S3, 25–50% loss of chlorophyll; S4, 40–75% loss of chlorophyll; S5, >75% loss of chlorophyll, leaves at this stage appeared completely yellow.

SAG12 and SAG13 remain unknown, the identification of their promoters has made it possible to target gene expression in senescing tissues.

The role of IPT in cytokinin production Although tRNA catabolites could provide some cytokinins, it is believed that cytokinins in planta are produced primarily through a de novo biosynthetic pathway, which branches from the mevalonate pathway at ∆3-isopentenylpyrophosphate (∆3-IPP). The first step is the transfer of the isopentenyl group from ∆2-IPP (isomerized from ∆3-IPP) to AMP, resulting in the formation of isopentenyladenosine ribotide that is then converted to various cytokinins (for reviews, see Binns, 1994; Gan and Amasino, 1996; Kaminek, 1992). This first step is catalysed by isopentenyl transferase (IPT). Although this enzyme activity has been detected in plant extracts, it has not been purified (Chen and Ertl, 1994) and the gene encoding it has not been characterized. The molecular analysis of the Ti (tumour-inducing) plasmid of A. tumefaciens has resulted in the identification of an IPT gene on the transferred DNA fragment

09 Inducible Gene 09

174

3/16/99 11:16 AM

Page 174

S. Gan and R.M. Amasino

(T-DNA) of the plasmid (Akiyoshi et al., 1984; Barry et al., 1984). The T-DNA IPT enzyme expressed in Escherichia coli has been shown to add the isopentenyl group into the N6 position of AMP (Akiyoshi et al., 1984; Barry et al., 1984). Since the identification of the T-DNA IPT gene, efforts have been made to express this gene in transgenic plants using a variety of promoters and strategies. These include promoters inducible by heat, light, tetracycline and wounding or infection (Medford et al., 1989; Schmülling et al., 1989; Smart et al., 1991; Smigocki, 1991; Ainley et al., 1993; Smigocki et al., 1993; Hamdi et al., 1995; Thomas et al., 1995; Faiss et al., 1997), tissue-specific promoters (elongation-zonespecific and fruit-specific) (Li et al., 1992; Martineau et al., 1994), constitutive promoters (CaMV 35S and the native IPT promoter) (Ooms et al., 1991; Smigocki and Owens, 1988), and transposition and random insertion approaches (Estruch et al., 1991; Hewelt et al., 1994). IPT transgenic Arabidopsis, cucumber, potato, tomato and tobacco plants displayed developmental and morphological changes that are characteristic of cytokinin overproduction in plants. Typically, these transgenic plants have a stunted stature, smaller leaves, underdeveloped vascular system and impaired root growth (reviewed in Gan and Amasino, 1996). Indeed, quantitative analyses of the cytokinin levels in some of the transgenic plants showed a significantly increased endogenous cytokinin production. For example, the zeatin level in tobacco plants expressing IPT under the control of a maize heatshock promoter was increased up to 50-fold over the level in non-heat-treated plants (Medford et al., 1989). Even under non-heat-shock conditions, the zeatin ribotide level was elevated sevenfold over non-transgenic controls, which most likely resulted from the ‘leaky’ expression of the maize heat-shock promoter (Medford et al., 1989). The ‘leaky’ expression level was below the sensitivity of Northern blot analysis; thus, the developmental abnormalities caused by traces of IPT expression are a sensitive test for promoter activity.

Use of SAG promoters to target IPT gene to senescing leaves To target IPT expression to senescing leaves, we constructed a chimeric gene consisting of the SAG12 promoter, the coding region of IPT and the terminal sequence of the nopaline synthase gene. As shown in Fig. 9.2, the expression of this construct in plant cells forms an autoregulatory loop for controlling cytokinin levels. At the onset of senescence the SAG12 promoter directs the expression of IPT in senescing leaf cells. The increased IPT enzyme activity results in the elevated cytokinin production, which prevents the leaf cells from senescing. The prevention of senescence in turn attenuates the SAG12 promoter because this promoter is active only in senescing cells. This negative feedback loop therefore prevents overproduction of cytokinins. Technically, a 2.18 kb SAG12 promoter fragment (including 106 bp of the 5′ untranslated region) from the EcoRV site at 22073 to an NcoI site (artificially created at the SAG12 start codon by oligomutagenesis) was fused to the IPT coding region (at the IPT translation start codon) along with the nopaline

09 Inducible Gene 09

3/16/99 11:17 AM

Page 175

Developmental Targeting by the Use of a Senescence-specific Promoter 175

Fig. 9.2. Use of the SAG12 promoter to target IPT gene to senescing leaves; rationale and plasmid construction. The senescence-specific SAG12 promoter was fused to IPT. After introduced into plant cells, this chimeric gene forms an autoregulatory loop: the SAG12 promoter directs IPT gene expression at the onset of leaf senescence, resulting in the production of cytokinins (e.g. isopentenyladenine). An increased cytokinin level in turn inhibits senescence, which leads to the suppression of the SAG12 promoter. The suppression of this promoter prevents cytokinin overproduction. LB and RB are left and right T-DNA border, respectively. E, EcoRV; N, NcoI; Sc, SacI; S/X or X/S, ligated SpeI and XbaI sites. Reproduced by permission of Science 270, 1986–1988.

synthase gene terminator. The SAG12 promoter–IPT construct (hereafter SAG12–IPT) was then cloned into a binary vector (pSG529 in Fig. 9.2) and transferred into A. tumefaciens strain LBA4404 for plant transformation.

CREATION AND CULTIVATION OF TRANSGENIC TOBACCO PLANTS Transformation of tobacco plants was performed by cocultivation of leaf discs of Nicotiana tabacum cv. Wisconsin 38 (hereafter, W38 or wild-type) with Agrobacterium. The regenerated plants (R1) were transplanted into a mixture of peat moss and vermiculite (1:1) saturated with nutrient solution (Peters 20–20–20 fertilizer at the concentration of 473 parts per million of nitrogen, Peters Fertilizer Products, W.R. Grace & Co.) and grown in a growth room at 25°C and 60% relative humidity under 120 mmol m22 s21 of continuous light (Gan and Amasino, 1995). These plants were scored for a delayed leaf senescence phenotype and allowed to self-pollinate to produce R2 seeds. These R2 seeds were put on agar plates containing 125 mg ml21 kanamycin to test for segregation of the inserted genes one of which confers resistance to kanamycin. All seedlings, including those of wild-type and kanamycin-resistant SAG12–IPT were transplanted into 3-litre clay pots containing nutrient solution-saturated

09 Inducible Gene 09

176

3/16/99 11:17 AM

Page 176

S. Gan and R.M. Amasino

peat/vermiculite mixture and grown in a greenhouse facility with a 16 h photoperiod at approximately 26°C. The plants were sub-irrigated as needed with water only, and no more nutrients were supplied thereafter.

PHENOTYPICAL, PHYSIOLOGICAL AND BIOCHEMICAL OBSERVATIONS OF SAG12–IPT TRANSGENIC PLANTS Phenotypically, the SAG12–IPT transgenic tobacco plants are developmentally normal except for markedly retarded leaf and floral senescence. All original transgenic plants (R1) produced viable seeds (R2). There were no observable differences as to their germination compared with that of the non-transgenic parental plants. Kanamycin-resistant transgenic R2 seedlings (12 plants for each line) were transplanted into a greenhouse for observation of their growth and development. All plants appeared normal except for significantly delayed leaf senescence. We then randomly chose one of the eight lines for examination of its R3 progeny in both a greenhouse and a growth chamber. Again, the transgenic plants appeared normal in all aspects of growth and development other than leaf and floral senescence. SAG12–IPT transgenic and non-transgenic seedlings showed equally developed leaf, shoot and root systems at 3.5 weeks old (Gan and Amasino, 1995). Both transgenic and wild-type plants formed visible flower buds after 6 weeks (Fig. 9.3a), and the first flowers opened at the same time. The numbers of flowers produced at the age of 12 weeks were very similar in control and transgenic plants (Fig. 9.3b). There were no statistically meaningful differences in overall plant height and leaf number on main stems (Gan and Amasino, 1995). There was also no observable difference in their root systems throughout development (data not shown). We did not anatomically examine the vascular system in the transgenic plants, but the leaf vein pattern appeared to be regular. Although the plants grew and developed normally, the retarded senescence progression in the SAG12–IPT transgenic plants was obvious. This difference in senescence between SAG12–IPT transgenic and wild-type plants can be observed in as early as 3.5-week-old seedlings; the cotyledons of wild-type seedlings were already senescing while those of transgenic plants were not (Gan and Amasino, 1995). As usual, senescence started from the bottom (Fig. 9.3a) through the middle (Fig. 9.3b) to the top (Fig. 9.3c) leaves in wild-type plants. By the time wild-type plants were 12 weeks old, senescence had progressed into the middle leaves; however, there was still no visible sign of yellowing even in the very bottom leaf on SAG12–IPT plants (Fig. 9.3b). By the time wild-type plants were 20 weeks old, the very top leaves had undergone senescence and flowering terminated after production of approximately 180 flowers; by contrast, there was still no visible chlorophyll loss even in the oldest leaves on SAG12–IPT plants and these plants were still producing flowers at that time (Fig. 9.3c). As a result of the extended flowering period, the SAG12–IPT plants produced more than 320 flowers (Gan and Amasino, 1995).

09 Inducible Gene 09

3/16/99 11:17 AM

Page 177

Developmental Targeting by the Use of a Senescence-specific Promoter 177

Fig. 9.3. Comparison of a SAG12–IPT transgenic tobacco (on the left in each panel) to wild-type (on the right) at various stages of development (a–c) or 30 days after detachment of leaves (d). (a) shows plants 6 weeks after seedlings were transplanted into soils, (b) 12 weeks and (c) 20 weeks. Reproduced by permission of Science 270, 1986–1988.

Not only was the flowering period prolonged in the SAG12–IPT transgenic plants, but the longevity of the petals of individual flowers was extended by over 50% from 3 days in wild-type plants to at least 4.5 days in the transgenic plants (Gan, 1995). Thus there were more non-senescent flowers on the floral stalks in transgenic plants than on the corresponding stalks of wild-type ones (Gan, 1995). To determine if senescence could be markedly delayed in detached leaves of SAG12–IPT plants, leaves that had just fully expanded from SAG12–IPT and wild-type plants (grown in a greenhouse) were excised at the petiole bottom, inserted in jars filled with water and maintained in a growth chamber. The

09 Inducible Gene 09

178

3/16/99 11:17 AM

Page 178

S. Gan and R.M. Amasino

leaves of wild-type plants started senescing in about 10 days while the leaves from SAG12–IPT plants remained green for over 40 days (Fig. 9.3d). Biochemically, the chlorophyll and protein levels of SAG12–IPT transgenic plants were higher than those of non-transgenic plants. Under the growth conditions used, the seventh leaf of wild-type plants had lost greater than 90% of chlorophyll and 70% of protein by 68 days after emergence. At that time, these leaves were brown and desiccated. In contrast, more than 70% of chlorophyll and protein were retained in 68-day-old leaves in plants containing SAG12–IPT (Gan, 1995). Physiologically, senescence-retarded leaves are photosynthetically active as measured by CO2 uptake. The photosynthetic rates were almost the same in upper non-senescent young leaves (leaf no. 22 and no. 26) on both SAG12–IPT and control plants. This rate remained unchanged in older leaves (no. 15 and no. 18) of SAG12–IPT plants but decreased to less than 15% in the senescing counterparts of the control plants. At the measurement time, the oldest leaf from which we made measurements was leaf no. 7 which still had one-third of the full photosynthetic capacity. The corresponding leaf no. 7 of control plants was completely senesced and desiccated by this time (Gan, 1995). Thus, cytokinin production can provide some preservation of photosynthetic capacity but cannot ultimately prevent photosynthetic decline from occurring. The degree of preservation appears to be dependent upon the growth conditions of the plants (Wingler et al., 1998). In our growth conditions, the preservation of photosynthetic activity in SAG12–IPT transgenic plants resulted in about 50% increases in both seed yield and dry weight accumulation with comparison to those of wild-type plants (Gan and Amasino, 1995). AUTONOMOUS NATURE OF SAG12–IPT SYSTEM The normal development of SAG12–IPT plants indicated that the autoregulatory system operated only in senescing leaves without exerting an effect on other parts of the plant through translocation of cytokinins. To further examine the autonomous nature of the system, we reciprocally grafted SAG12–IPT plants and wild-type plants to create genetically chimeric plants. Six pairs of such chimeric grafts were created. In either graft orientation, senescence progressed normally in leaves of wild-type parts of the chimeric plants but not in those leaves containing SAG12–IPT (Fig. 9.4), suggesting that cytokinin produced in the transgenic leaves is not translocated upwards or downwards in sufficient amounts to affect leaf senescence in the wild-type regions. MOLECULAR GENETIC EVIDENCE FOR THE AUTOREGULATORY NATURE OF SAG12–IPT SYSTEM We have hypothesized that production of cytokinin directed by the senescencespecific SAG12 promoter will inhibit senescence, which in turn will attenuate

09 Inducible Gene 09

3/16/99 11:17 AM

Page 179

Developmental Targeting by the Use of a Senescence-specific Promoter 179

Fig. 9.4. Senescence progression in grafted plants. The SAG12–IPT transgenic and wild-type tobacco plants were reciprocally grafted, and the grafts were grown in a greenhouse. Arrows indicate the graft junctions, the plant part above the junction is the scion and below the junction is the stock. The plant on the left had a wild-type scion and a SAG12–IPT transgenic stock, while the plant at the right had a SAG12–IPT scion and a wild-type stock. Reproduced by permission of Science 270, 1986–1988.

09 Inducible Gene 09

180

3/16/99 11:17 AM

Page 180

S. Gan and R.M. Amasino

the senescence-specific promoter and prevent further accumulation of cytokinin (Fig. 9.2). The fact that transgenic plants were phenotypically normal except for the effect on senescence indicated that this autoregulatory senescenceinhibition system appeared to be operating. To confirm that such autoregulation indeed exists in the transgenic plants, we measured the expression from the SAG12 promoter as a function of leaf age in the presence or absence of the SAG12–IPT transgene. To measure SAG12 promoter activity, we used the SAG12 promoter fused to GUS. In transgenic plants containing this SAG12–GUS construct, enzyme activity is detected at a very high level in senescing leaves (GUS activity profile 1 in Fig. 9.5b) but no activity is detected in non-senescent leaves (i.e. the senescence-specific expression of this Arabidopsis promoter is faithfully maintained in tobacco plants). If this SAG12–GUS construct is introduced into SAG12–IPT plants, GUS expression should be suppressed (GUS profile 2 in Fig. 9.5b) because the SAG12 promoter in the SAG12–GUS construct should be subject to the same negative feedback regulation (Fig. 9.5a). It should be noted that in these experiments the identical region of the SAG12 promoter was used to drive expression of IPT or GUS. We crossed a homozygous SAG12–IPT plant and a homozygous SAG12–GUS plant to create double hemizygous transgenic plants containing one copy of SAG12–IPT and one copy of SAG12–GUS. These homozygous plants were also crossed with wild-type W38 plants to create hemizygous SAG12–GUS and hemizygous SAG12–IPT plants (Fig. 9.5c). The GUS activity in leaf no. 7 of the SAG12–GUS plants increased sharply with the progression of senescence until the leaves were completely desiccated 71 days after their emergence. By contrast, GUS expression in the corresponding leaves of double hemizygous SAG12–GUS/SAG12–IPT plants was significantly suppressed and its activity maintained at a very low level slightly above the background detected in W38 and SAG12–IPT plants (Gan and Amasino, 1995), which was similar to the GUS activity profile 2 illustrated in Fig. 9.5b. This result demonstrates the existence of the proposed autoregulation. Furthermore, we investigated whether the cytokinin production in the proposed autoregulatory loop contributed to the suppression of gene expression from the SAG12 promoter. Protein and RNA samples were prepared from a leaf of a SAG12–GUS transgenic tobacco plant which had started senescing to provide a baseline of mRNA level (lane 1 of insert in Fig. 9.6) and GUS activity (column 1 in Fig. 9.6). Half of this leaf was treated with 50 µM 6-benzylaminopurine (BA, a cytokinin) once every 3 days, and the other half was treated with the same volume of buffer only (i.e. 2cytokinin). The leaf tissues were sampled 18 days after the start of treatment. At this time the leaf tissue receiving cytokinin treatment was rejuvenated while the leaf tissue without cytokinin application was completely yellowed. GUS expression was suppressed by cytokinin treatment (Fig. 9.6). The inhibition of senescence and the suppression of the SAG12–GUS expression by external cytokinin application are consistent with the proposed negative feedback exerted by cytokinin production.

09 Inducible Gene 09

3/16/99 11:17 AM

Page 181

Developmental Targeting by the Use of a Senescence-specific Promoter 181

Fig. 9.5. Investigation of the autoregulatory nature of the SAG12–IPT senescenceinhibition system. GUS activity in transgenic SAG12–GUS plants increases with the progression of leaf senescence (GUS activity profile 1 in (b)). However, when the SAG12–GUS is introduced in the SAG12–IPT background, the identical SAG12 promoter of the SAG12–GUS will be subject to the same negative feedback regulation by cytokinins as that of the SAG12 promoter in the SAG12–IPT plants (a), resulting in a suppressed GUS expression (GUS activity profile 2 in (b)). (c) outlines the genetic schemes used to create the SAG12–GUS/SAG12–IPT double hemizygous plants by crossing a homozygous SAG12–GUS plant to a homozygous SAG12–IPT plant. Both homozygotes were also crossed to wild-type (wt) plants to create plants hemizygous for SAG12–GUS and plants hemizygous for SAG12–IPT. The SAG12–IPT hemizygote and wt were used for GUS negative controls.

09 Inducible Gene 09

3/16/99 11:17 AM

182

Page 182

S. Gan and R.M. Amasino

Fig. 9.6. Effect of exogenous cytokinin on SAG12–GUS expression. GUS transcript levels (insert) were determined by RNA gel blot (10 µg lane21 total RNA), and GUS activity was assayed with 4-methylumbelliferyl-β-D-glucuronidase as substrate. Lane 1: samples from transgenic SAG12–GUS tobacco leaf at the earliest stages of senescence. Lanes 2 and 3 are from samples prepared 18 days after the time point shown in lane 1. Lane 2 shows the control treated with buffer only and lane 3 shows leaf samples treated at 3-day intervals with 50 µM 6-benzylaminopurine (BA).

CONCLUSIONS The utility of autoregulatory systems for studies of cytokinin biology An important tool for studying cytokinin biology is the development of transgenic plant strategies in which the A. tumefaciens IPT gene can be joined to various promoters to direct cytokinin production in a defined temporal and spatial pattern. Many such studies using a variety of plant species and a variety of promoters have demonstrated the effectiveness of IPT expression for cytokinin production in planta. These studies have also demonstrated the extreme sensitivity of many aspects of plant development to perturbations of cytokinin levels; in such studies the transgenic plants were generally abnormal, exhibiting reduced size, less developed vascular and root systems, reduced apical dominance and, in one study, defective fruit coloration (Martineau et al., 1994). An ideal transgenic system for the studies of hormone effects would allow precise targeting of hormone production quantitatively, spatially and temporally so that the relationship between hormone production and phenotype can be clearly determined. We have developed an autoregulatory senescence-inhibition system in which IPT was fused to a senescence-specific

09 Inducible Gene 09

3/16/99 11:17 AM

Page 183

Developmental Targeting by the Use of a Senescence-specific Promoter 183

promoter. At the onset of senescence, this promoter directs expression of IPT resulting in the synthesis of cytokinins which in turn attenuates the promoter by retarding senescence. This system has the following features that are useful for studying the role of cytokinin in leaf senescence: quantitatively the cytokinin production is precisely regulated and maintained at a minimum level that is sufficient for the inhibition of senescence; spatially the production of cytokinins has been precisely targeted to the senescing tissues of the shoot, and the produced cytokinin is not translocated in sufficient amounts (if any) to affect other parts of the plant (Fig. 9.4); and temporally the cytokinin production has been limited to a time when senescence starts. Because of these features, the transgenic plants exhibit no abnormalities in plant growth and development other than retarded leaf and floral senescence. Specifically, the longevity of certain leaves (from leaf emergence to the time 50% of chlorophyll lost) has been extended from 47 days in wild-type plants to >100 days in the transgenic plants. The longevity of floral petal has also been extended by 50%. This permits an examination of the relationship between locally produced cytokinin and retarded senescence without concern about possible complications associated with other effects caused by treatment to induce promoters (such as heat-shock) or abnormalities of plant development. The minimum dose of cytokinin that is sufficient for delaying leaf senescence is not known. Although a series of known concentrations of cytokinin can be externally applied, it is not known how much of the applied hormone has been transported to and taken up by a target tissue. An endogenous level of cytokinin can be measured from a healthy leaf, but it does not necessarily reflect the amount of cytokinin sufficient for the inhibition of leaf senescence. The autoregulatory cytokinin production system provides an opportunity for the quantification of cytokinin levels necessary for retarding senescence because, in this system, cytokinin should be maintained at a minimum level that is effective for delaying senescence.

Potential applications of an autoregulatory senescence-inhibition system Leaf senescence is thought to play an important role in the evolution of fitness by recycling nutrients from dying cells to actively growing parts such as reproductive organs (Noodén, 1988b). However, leaf senescence is not always desirable in agriculture. For example, the loss of assimilatory capacity as senescence progresses is thought to contribute to yield limitation in some monocarpic crops such as soybean (Noodén, 1984). Senescence also devalues ornamental plants and vegetables during transportation and storage. Forage crops such as lucerne generally lose some nutritional quality due to leaf senescence. Therefore, manipulation of leaf senescence with an autoregulatory senescence-inhibition system may result in agricultural benefits. In the transgenic plants containing this system, senescence of both detached and intact leaves is delayed (Fig. 9.3), the protein levels in senescence-delayed leaves

09 Inducible Gene 09

3/16/99 11:17 AM

184

Page 184

S. Gan and R.M. Amasino

have been preserved, the flowering period and the longevity of individual flowers have been prolonged, and seed yield and plant biomass have been increased. In transgenic plants there is often a transgene dosage effect; e.g. hemizygous and homozygous transgenic plants have different levels of transgene expression which can result in different phenotypes of hemizygous and homozygous plants (Hewelt et al., 1994). In our studies, there was no phenotypic difference among transgenic lines that contained one or more transgene loci nor between hemizygous and homozygous transgenic plants (data not shown). This lack of phenotypic variation presumably results from the autoregulatory feature; regardless of transgene position in the genome or copy number, the autoregulatory feature ‘titrated’ the level of cytokinin production to that required for senescence inhibition. Thus, we believe this autoregulatory system has potential in agricultural and horticultural applications.

REFERENCES Ainley, W.M., McNeil, K.J., Hill, J.W., Lingle, W.L., Simpson, R.B., Brenner, M.L., Nagao, R.T. and Key, J.L. (1993) Regulatable endogenous production of cytokinins up to ‘toxic’ levels in transgenic plants and plant tissues. Plant Molecular Biology 22, 13–24. Akiyoshi, D.E., Klee, H., Amasino, R.M., Nester, E.W. and Gordon, M. (1984) T-DNA of Agrobacterium tumefaciens encodes an enzyme of cytokinin biosynthesis. Proceedings of the National Academy of Sciences USA 81, 5994–5998. Barry, G.F., Rogers, S.G., Fraley, R.T. and Brand, L. (1984) Identification of a cloned cytokinin biosynthetic gene. Proceedings of the National Academy of Sciences USA 81, 4776–4780. Becker, W. and Apel, K. (1993) Differences in gene expression between natural and artificially induced leaf senescence. Planta 189, 74–79. Binns, A.N. (1994) Cytokinin accumulation and action: biochemical, genetic, and molecular approaches. Annual Review of Plant Physiology and Plant Molecular Biology 45, 173–196. Bodnar, A.G., Ouellette, M., Frolkis, M., Holt, S.E., Chiu, C.-P., Morin, G.B., Harley, C.B., Shay, J.W., Lichtsteiner, S. and Wright, W.E. (1998) Extension of life-span by introduction of telomerase into normal human cells. Science 279, 349–352. Buchanan-Wollaston, V. (1994) Isolation of cDNA clones for genes that are expressed during leaf senescence in Brassica napus. Identification of a gene encoding a senescence-specific metallothionein-like protein. Plant Physiology 105, 839–846. Chen, C.-M. and Ertl, J.R. (1994) Cytokinin biosynthetic enzymes in plants and slime mold. In: Mok, D.W.S. and Mok, M.C. (eds) Cytokinins: Chemistry, Activity, and Function. CRC Press, Boca Raton, USA, pp. 81–85. Davies, K.M. and Grierson, D. (1989) Identification of cDNA clones for tomato (Lycopersicon esculentum Mill.) mRNAs that accumulate during fruit ripening and leaf senescence in response to ethylene. Planta 179, 73–80. DeLong, A., Calderon-Urrea, A. and Dellaporta, S.L. (1993) Sex determination gene TASSELSEED2 of maize encodes a short-chain alcohol dehydrogenase required for stage-specific floral organ abortion. Cell 74, 757–768.

09 Inducible Gene 09

3/16/99 11:17 AM

Page 185

Developmental Targeting by the Use of a Senescence-specific Promoter 185 Estruch, J.J., Prinsen, E., Van Onckelen, H., Schell, J. and Spena, A. (1991) Viviparous leaves produced by somatic activation of an inactive cytokinin-synthesizing gene. Science 254, 1364–1367. Faiss, M., Zalubilova, J., Strnad, M. and Schmülling (1997) Conditional transgenic expression of the ipt gene indicates a function for cytokinins in paracrine signaling in whole tobacco plants. Plant Journal 12, 401–415. Gan, S. (1995) Molecular characterization and genetic manipulation of plant senescence. PhD thesis, University of Wisconsin-Madison, Madison, USA. Gan, S. and Amasino, R.M. (1995) Inhibition of leaf senescence by autoregulated production of cytokinin. Science 270, 1986–1988. Gan, S. and Amasino, R.M. (1996) Cytokinins in plant senescence: from spray and pray to clone and play. BioEssays 18, 557–565. Gan, S. and Amasino, R.M. (1997) Making sense of senescence. Molecular genetic regulation and manipulation of leaf senescence. Plant Physiology 113, 313–319. Hamdi, S., Creche, J., Garnier, F., Mars, M., Decendit, A., Gaspar, T. and Rideau, M. (1995) Cytokinin involvement in the control of coumarin accumulation in Nicotiana tabacum. Investigations with normal and transformed tissues carrying the isopentenyl transferase gene. Plant Physiology and Biochemistry 33, 283–288. Hensel, L.L., Grbic, V., Baumgarten, D.A. and Bleecker, A.B. (1993) Developmental and age-related processes that influence the longevity and senescence of photosynthetic tissues in Arabidopsis. Plant Cell 5, 553–564. Hensel, L.L., Nelson, M.A., Richmond, T.A. and Bleeker, A.B. (1994) The fate of inflorescence meristems is controlled by developing fruits in Arabidopsis. Plant Physiology 106, 863–876. Hewelt, A., Prinsen, E., Schell, J., Van Onckelen, H. and Schmülling, T. (1994) Promoter tagging with a promoterless ipt gene leads to cytokinin-induced phenotypic variability in transgenic tobacco plants: implications of gene dosage effects. Plant Journal 6, 879–891. Kaminek, M. (1992) Progress in cytokinin research. Trends in Biotechnology 10, 159–164. Li, Y., Hagen, G. and Guilfoyle, T.J. (1992) Altered morphology in transgenic tobacco plants that overproduce cytokinins in specific tissues and organs. Developmental Biology 153, 386–395. Lohman, K.N., Gan, S., John, M.C. and Amasino, R.M. (1994) Molecular analysis of natural leaf senescence in Arabidopsis thaliana. Physiologia Plantarum 92, 322–328. Martineau, B., Houck, C.M., Sheehy, R.E. and Hiatt, W.R. (1994) Fruit-specific expression of the A. tumefaciens isopentenyl transferase gene in tomato: effects on fruit ripening and defense-related gene expression in leaves. Plant Journal 5, 11–19. Medford, J.I., Horgan, R., El-Sawi, Z. and Klee, H.J. (1989) Alterations of endogeneous cytokinins in transgenic plants using a chimeric isopentenyl transferase gene. Plant Cell 1, 403–413. Noodén, L.D. (1984) Integration of soybean pod development and monocarpic senescence. Physiologia Plantarum 62, 273–284. Noodén, L.D. (1988a) The phenomenon of senescence and aging. In: Noodén, L.D. and Leopold, A.C. (eds) Senescence and Aging in Plants. Academic Press, San Diego, USA, pp. 1–50. Noodén, L.D. (1988b) Whole plant senescence. In: Noodén, L.D. and Leopold, A.C. (eds) Senescence and Aging in Plants. Academic Press, San Diego, USA, pp. 391–439.

09 Inducible Gene 09

186

3/16/99 11:17 AM

Page 186

S. Gan and R.M. Amasino

Noodén, L.D. and Leopold, A.C. (1978) Phytohormones and the endogenous regulation of senescence and abscission. In: Letham et al. (eds) Phytohormones and Related Compounds: a Comprehensive Treatise. Elsevier/North-Holland Biomedical Press, New York, USA, pp. 329–369. Ooms, G., Risiott, R., Kendall, A., Keys, A., Lawlor, D., Smith, S., Turner, J. and Young, A. (1991) Phenotypic changes in T-cyt-transformed potato plants are consistent with enhanced sensitivity of specific cell types to normal regulation by root-derived cytokinin. Plant Molecular Biology 17, 727–743. Richmond, A.E. and Lang, A. (1957) Effect of kinetin on protein content and survival of detached Xanthium leaves. Science 125, 650–651. Schmülling, T., Beinsberger, S., De Greef, J., Schell, J., Van Onckelen, H. and Spena, A. (1989) Construction of a heat-inducible chimeric gene to increase the cytokinin content in transgenic plant tissue. FEBS Letters 249, 401–406. Smart, C.M., Scofield, S.R., Bevan, M.W. and Dyer, T.A. (1991) Delayed leaf senescence in tobacco plants transformed with tmr, a gene for cytokinin production in Agrobacterium. Plant Cell 3, 647–656. Smart, C.M., Hosken, S.E., Thomas, H., Greaves, J.A., Blair, B.G. and Schuch, W. (1995) The timing of maize leaf senescence and characterization of senescence-related cDNAs. Physiologia Plantarum 93, 673–682. Smigocki, A.C. (1991) Cytokinin content and tissue distribution in plants transformed by a reconstructed isopentenyl transferase gene. Plant Molecular Biology 16, 105–115. Smigocki, A.C. and Owens, L.D. (1988) Cytokinin gene fused with a strong promoter enhances shoot organogenesis and zeatin levels in transformed plant cells. Proceedings of the National Academy of Sciences USA 85, 5131–5135. Smigocki, A.C., Neal, J.W., McCanna, I. and Douglass, L. (1993) Cytokinin-mediated insect resistance in Nicotiana plants transformed with the ipt gene. Plant Molecular Biology 23, 325–335. Steller, H. (1995) Mechanisms and genes of cellular suicide. Science 267, 1445–1449. Taylor, C.B., Bariola, P.A., Delcardayre, S.B., Raines, R.T. and Green, P.J. (1993) RNS2 – a senescence-associated RNase of Arabidopsis that diverged from the S-RNases before speciation. Proceedings of the National Academy of Sciences USA 90, 5118–5122. Thomas, J.C., Smigocki, A.C. and Bohnert, H.J. (1995) Light-induced expression of ipt from Agrobacterium tumefaciens results in cytokinin accumulation and osmotic stress symptoms in transgenic tobacco. Plant Molecular Biology 27, 225–235. van Staden, J., Cook, E. and Noodén, L.D. (1988) Cytokinins and senescence. In: Noodén, L.D. and Leopold, A.C. (eds) Senescence and Aging in Plants. Academic Press, San Diego, USA, pp. 281–328. Watanabe, A. and Imaseki, H. (1982) Changes in translatable mRNA in senescing wheat leaves. Plant and Cell Physiology 23, 489–497. Wingler, A., von Schaewen, A., Leegood, R.C., Lea, P.J. and Quick, W.P. (1998) Regulation of leaf senescence by cytokinin, sugars, and light effects on NADHdependent hydroxypyruvate reductase. Plant Physiology 116, 329–335.

10 Inducible Gene 10

3/16/99 11:18 AM

Page 187

Abscisic Acid- and Stressinduced Promoter Switches in the Control of Gene Expression

10

Qingxi Shen1 and Tuan-Hua David Ho Plant Biology Program, Department of Biology, Division of Biology and Biomedical Sciences, Washington University, St Louis, MO 63130, USA

INTRODUCTION Field-grown plants are constantly under unfavourable environmental conditions, such as drought, flooding, extreme temperatures, excessive salts, heavy metals, high intensity irradiation and infection by pathogenic agents. Because of their immobility, plants have to make necessary metabolic and structural adjustments to cope with stressful environmental conditions. To this end, the genetic programme in normal plants is altered by the stress stimuli to produce specific proteins and/or to activate biochemical pathways which are essential for survival. For example, flooded plant tissues synthesize alcohol dehydrogenase (ADH) to catalyse ethanol formation coupled to the oxidation of NADH, thereby maintaining glycolysis in the anaerobically stressed cells (Sachs and Ho, 1986). Some stress-induced proteins may play a role in structural alterations that protect cells from being damaged by the stress conditions. The cell wall hydroxyproline-rich proteins (HRGP) are induced in mechanically wounded tissues (Showalter and Varner, 1989). Because of their rigid structure, it is conceivable that the elevated levels of these proteins in the cell walls may help to seal off the tissues from further injuries. It has been estimated that biotic stresses routinely depress the yield of major US crops by more than 60% (Boyer, 1982; Table 10.1). Therefore, elucidating the mechanisms by which stresses exert adverse effects on the performance of crop plants would not only help us to understand the basic biology of stress responses but also facilitate the development of applications for enhancing stress 1

Current address: Monsanto Company, Mail Zone AA2G, 700 Chesterfield Village Parkway, Chesterfield, MO 63198, USA.

© CAB International 1999. Inducible Gene Expression (ed. P.H.S. Reynolds)

187

10 Inducible Gene 10

3/16/99 11:19 AM

188

Page 188

Q. Shen and T.-H.D. Ho

Table 10.1. Record yields, average yields and yield loss due to unfavourable physicochemical environments for major US crops. Values are kg ha21. Adapted from Boyer (1982). Crop

Record yield

Average yield

Loss due to environment

19,300 14,500 7,390 94,100

4,600 1,880 1,610 28,300 21.6%

12,700 11,900 5,120 50,900 69.1%

Corn Wheat Soybean Potato Mean % of record yield

tolerance. It has long been established that drought, cold and salinity stress conditions often enhance the synthesis of the phytohormone, abscisic acid (ABA), which in turn regulates many other processes including the closure of stomata and the alteration of gene expression (reviewed by Zeevaart and Creelmann, 1988). However, not all stress-induced gene expression is mediated by ABA. Using ABA-deficient Arabidopsis mutants, Gilmore and Thomashow (1991) and Lång and Palva (1992) have shown that certain genes can still be induced by cold even in the absence of elevated ABA. It has now become apparent that stress/ABA-induced genes could be grouped into two classes: those regulated by stress conditions independent of the stress-induced ABA synthesis; and those regulated by the stress-induced ABA (Shinozaki and Shinozaki-Yamaguchi, 1997; Liu et al., 1998). In this chapter, we will only emphasize the stress-regulated gene expression which is mediated by the stressinduced ABA. Several recent reviews have addressed issues related to stressregulated gene expression independent of the stress-induced ABA (Shinozaki and Yamaguchi, 1996; Bray, 1997).

GENES REGULATED BY ABA ABA is known to regulate the expression of a variety of genes, including those encoding seed storage proteins (Bray and Beachy, 1985), LEA (late embryogenesis abundant) and RAB (response to ABA) proteins in wheat, rice, barley, rape, cotton, maize, carrot and Arabidopsis (reviewed in Dure et al., 1989; Skriver and Mundy, 1990; Chandler and Robertson, 1994; Ingram and Bartels, 1996; Shinozaki and Shinozaki-Yamaguchi, 1997). Table 10.2 contains a comprehensive collection of stress/ABA-regulated genes and the pertinent information published before the end of 1997. Four sets of genes are included in this table: ABA-inducible genes, ABA-suppressible genes, genes mediating ABA responses and ABA biosynthesis genes. The accession numbers for each of these genes are also provided so that interested readers can retrieve more information about these genes from the National Center for Biotechnology

10 Inducible Gene 10

Table 10.2. Genes regulated by ABA, mediating ABA responses and involved in ABA biosynthesis. Gene

Description

Function

Accession

I. ABA-inducible genes

3/16/99 11:19 AM Page 189

X78585 Z17399 L24070 U01377 X67671 X67670 X62281 X59814 L21929 D10703 X68042 X66023 AC002376 Protein kinase L22302 Pyrroline-5-carboxylate synthetase B X86778 X51474 D64140 D64139 Thiol protease X74359 Lipoxygenase L04637 Pyrroline-5-carboxylate synthetase A X86777 AF003728 AF004393 X15348 Continued over

189

Arabidopsis thaliana (Columbia) cold-inducible mRNA Arabidopsis thaliana blue light-inducible intrinsic membrane protein Arabidopsis thaliana cold-inducible gene, complete cds Arabidopsis thaliana cold-inducible gene, complete cds Arabidopsis thaliana cold-inducible gene Arabidopsis thaliana cold-inducible gene Arabidopsis thaliana cold-inducible gene Arabidopsis thaliana cold-inducible mRNA Arabidopsis thaliana cold-inducible Arabidopsis thaliana drought-inducible gene, complete cds Arabidopsis thaliana drought-inducible gene Arabidopsis thaliana gene for embryogenesis abundant protein (LEA) Arabidopsis thaliana gene, homologous to wheat membrance protein Arabidopsis thaliana gene, complete cds Arabidopsis thaliana gene Arabidopsis thaliana gene for cold- and ABA-inducible protein Arabidopsis thaliana mRNA for LEA protein in group 3, complete cds Arabidopsis thaliana mRNA for LEA protein in group 5, complete cds Arabidopsis thaliana mRNA for putative thiol protease Arabidopsis thaliana mRNA, complete cds Arabidopsis thaliana mRNA Arabidopsis thaliana plasma membrane intrinsic protein Arabidopsis thaliana salt-stress-induced tonoplast intrinsic protein Brassica napus LEA mRNA

Abscisic Acid- and Stress-induced Promoter Switches

Di21 AthH2 cor15b cor15a lti78 lti65 kin2 cor47 Cor6.6/Kin1 rd22 rab18 D19h/GEA6 T1G11.19 ARSK1 p5csB kin1 Lea Lea A1494 Lox1 p5csA SIMIP SITIP Lea76

Accession

pBGA61 pcC3–06 Unknown Unknown pcC13–62 pcC27–04 pcC27–45 pcC6–19 gapC CDeT6–19 dsp-22 CDeT27–45 PIPc PIPb PIPa2 Unknown CDet11–24 Cpsps2 Cpsps1 CaMF CaMF-1 PKF1 gGmpm9 p24 LeaA2-D Lea3-D147

Bromus inermis complete cds Craterostigma plantagineum desiccation-related mRNA, complete cds Cicer arietinum LEA mRNA Cicer arietinum mRNA related to soybean calmodulin (L01431) Craterostigma plantagineum desiccation-related mRNA, complete cds Craterostigma plantagineum desiccation-related mRNA, complete cds Craterostigma plantagineum desiccation-related mRNA, complete cds Craterostigma plantagineum desiccation-related mRNA, complete cds Craterostigma plantagineum desiccation-related mRNA Craterostigma plantagineum desiccation-related mRNA Craterostigma plantagineum desiccation-related mRNA Craterostigma plantagineum desiccation-related mRNA Craterostigma plantagineum major intrinsic protein Craterostigma plantagineum major intrinsic protein Craterostigma plantagineum major intrinsic protein Craterostigma plantagineum mRNA hypothetical protein Craterostigma plantigineum Craterostigma plantigineum Craterostigma plantigineum Fagus sylvatica mRNA for CaMF protein Fagus sylvatica mRNA for CaMF-1 protein Fagus sylvatica mRNA for PKF1 protein Glycine max 16 kDa seed maturation protein (gGmpm9) gene exons 1–2 Glycine max Century 84 gene, complete cds Gossypium hirsutum LEA gene, complete cds Gossypium hirsutum LEA gene, complete cds

Aldose reductase

L12042 M62989 X79680 Y09853 M62991 M62987 M62990 M62988 X78307 X74067 X66598 X69883 AJ001294 AJ001293 AJ001292 Y11822 AJ002974 Y11795 Y11821 X97546 X97612 X97547 M97285 U09119 M83304 M81655

CaM protein

Glyceraldehyde-3-phosphate

Sucrose-phosphate synthase Sucrose-phosphate synthase Calmodulin Calmodulin

Oleosin isoform B

Page 190

Function

3/16/99 11:19 AM

Description

Q. Shen and T.-H.D. Ho

Gene

10 Inducible Gene 10

190

Table 10.2. Genes regulated by ABA, mediating ABA responses and involved in ABA biosynthesis (continued).

Continued over

Page 191

Aldose reductase

3/16/99 11:19 AM

Early light-induced protein Non-specific lipid-transfer protein

10 Inducible Gene 10

Dehydrin ACC oxidase

M81654 M88324 M88323 M88321 X54448 X54518 M83303 M19406 M19387 M19389 M19388 M19379 AJ002741 X92651 X92650 X92649 X92647 X92646 X92648 X78205 X69817 L19119 X57526 X72748 X62806 X62805

191

Gossypium hirsutum LEA gene, complete cds Gossypium hirsutum LEA gene, complete cds Gossypium hirsutum LEA gene, complete cds Gossypium hirsutum LEA gene, complete cds Gossypium hirsutum LEA gene Gossypium hirsutum LEA gene Gossypium hirsutum LEA gene Gossypium hirsutum LEA gene Gossypium hirsutum LEA gene Gossypium hirsutum LEA gene Gossypium hirsutum LEA gene Gossypium hirsutum LEA gene Helianthus annuus gene encoding dehydrin-like protein, partial Helianthus annuus mRNA for ACC oxidase-related protein Helianthus annuus mRNA for dehydrin-related protein Helianthus annuus mRNA for drought-induced protein Helianthus annuus mRNA for homologous dehydrin Helianthus annuus mRNA for homologous early light-induced protein Helianthus annuus mRNA for non-specific lipid-transfer protein Hordeum vulgare (Himalaya) HVA1 LEA gene Hordeum vulgare ABA7 mRNA for ABA-induced protein Hordeum vulgare ABA- and stress-inducible gene Hordeum vulgare gene Hordeum vulgare mRNA for dehydrin Hordeum vulgare mRNA for LEA protein Hordeum vulgare mRNA for LEA protein

Abscisic Acid- and Stress-induced Promoter Switches

Lea3-D11 Lea5-A Lea5-D Lea14-A Lea5 Lea2 LeaA2-A D113 D19 D34 D29 D11 pHAdhng1 Unknown Sdi-8 Unknown Unknown Unknown nsLTP HVA1 ABA7 HVA22 pG22–69 ABA3 B19.4 B19.3

O-methyltransferase Betaine aldehyde dehydrogenase Cysteine proteinase Endochitinase Dehydrin Endochitinase Anionic peroxidase Anionic peroxidase H1 histone-like Non-specific lipid transfer protein

Pyruvate, orthophosphate dikinase

Cytosolic copper/zinc-superoxide dismutase

X62804 X64254 U43498 D26448 AF007215 L19342 M97211 U77719 X15854 X15853 Z11842 M76552 U81996 X51904 X59930 S40947 M74189 X82489 M29279 D86598 Y08988 Y08987 Z25811 AF039573 L19435

Page 192

Hordeum vulgare mRNA for LEA protein Hordeum vulgare mRNA for seed protein Hordeum vulgare mRNA, partial cds Hordeum vulgare mRNA Lavatera thuringiaca stress-induced Lycopersicon chilense mRNA, complete cds Lycopersicon chilense mRNA Lycopersicon esculentum ethylene-responsive LEA-like Lycopersicon esculentum gene Lycopersicon esculentum gene Lycopersicon esculentum gene Lycopersicon esculentum LEA gene Lycopersicon esculentum Lycopersicon esculentum M. falcata environmental stress- and ABA-inducible mRNA Medicago sativa ABA- and environmental stress-inducible protein Medicago sativa environmental stress-inducible protein mRNA Mesembryanthemum crystallinum gene Nicotiana tabacum osmotin mRNA, complete cds Norway spruce mRNA for antifreeze-like protein, complete cds Oryza sativa ABA- and salt-regulated gene Oryza sativa ABA- and salt-regulated gene Oryza sativa ABA- and salt-regulated gene Oryza sativa ABA- and stress-inducible protein Oryza sativa gene

Accession

3/16/99 11:19 AM

B19.1 B32E pJRG5c1 pBAD LtCyp1 pcht28 PLC3015 ER5 TAP2 TAP1 LE20 LE25 le16 TAS14 pSM2075 pun90 Unknown ppd pOG af70 osr40g3 osr40g2 salT Asr1 SodCc1

Function

10 Inducible Gene 10

Description

Q. Shen and T.-H.D. Ho

Gene

192

Table 10.2. Genes regulated by ABA, mediating ABA responses and involved in ABA biosynthesis (continued).

Oryza sativa rab (rapidly response to ABA) gene Oryza sativa rab gene Oryza sativa rab gene Oryza sativa water-stress-inducible gene Phaseolus vulgaris cell wall-type 2 proline-rich protein Phaseolus vulgaris dehydrin mRNA, complete cds Phaseolus vulgaris gene Phaseolus vulgaris group 4-late embryogenesis abundant protein Phaseolus vulgaris LEA mRNA, partial cds Phaseolus vulgaris putative aquaporin-1mRNA, complete cds Phaseolus vulgaris putative osmoprotector LEA mRNA Picea glauca beta-coniferin mRNA, partial cds Picea glauca LEA mRNA, 3′ end of cds Picea glauca LEA mRNA, complete cds Picea glauca LEA mRNA, complete cds Picea glauca LEA mRNA, complete cds

Proline-rich cell wall protein Non-specific lipid transfer protein

U22102 X63126 D10424 Z68090 X95402 D63917 AF010582 X52422 X52423 X52424 Y00842 U72768 U54703 U72765 U72767 U72769 U97023 U72764 U19873 L47607 L47601 L47602 L47603

Continued over

Page 193

rab16B rab16C rab16D rab21 PvPRP2–37 Unknown PvLTP24 Unknown Pvprp1–12 Mip-1 PvLEA-18 WS2 EMB15 EMB3 EMB32 EMB23

Glyceraldehyde-3-phosphate dehydrogenase

L19434

3/16/99 11:19 AM

Oryza sativa LEA gene, complete cds Oryza sativa LEA gene Oryza sativa mRNA for ABA-inducible glycine-rich protein Oryza sativa mRNA for group 3 LEA (type I) protein Oryza sativa mRNA for novel protein Oryza sativa mRNA, complete cds Oryza sativa mRNA

10 Inducible Gene 10

Osem Emp1 T92 Oslea3 osr40c1 Rab24 GAPDH

Cytosolic copper/zinc-superoxide dismutase

193

Oryza sativa gene

Abscisic Acid- and Stress-induced Promoter Switches

SodCc2

PDR5

Basic peroxidase

L47605 L47606 U52865 AA430912 Z15127 Z15128 U93164 U55051 X89041 I60506 I60507 X83596 X67121 Y12424 L20756 X67846 X67845 X67844 X67843 X83597 U60202 X99095 U63831 Z22920

ABC transporter

Z70524

Metallothionein Endochitinase Endochitinase

RNA-binding protein Threonine deaminase Leucine aminopeptidase Cysteine proteinase inhibitor Cathepsin D inhibitor Lipoxygenase

Page 194

Picea glauca LEA mRNA Picea glauca lea-like protein mRNA, complete cds Pinus taeda water-stress-inducible protein (lp3-1) gene, complete cds Pisum sativum cDNA Pisum sativum mRNA for ABA-responsive protein Pisum sativum mRNA for ABA-responsive protein Prunus armeniaca ABA- and stress-induced ripening protein Pseudotsuga menziesii metallothionein-like protein mRNA, complete cds Riccia fluitans mRNA for landform specific protein Sequence 1 from patent US 5656474 Sequence 3 from patent US 5656474 Solanum commersonii dehydrin gene Solanum commersonii mRNA for osmotin-like protein Solanum commersonii mRNA Solanum lycopersicum ABA- and ripening-induced protein gene Solanum tuberosum ABA-, jasmonate- and wound-inducible mRNA Solanum tuberosum ABA-, jasmonate- and wound-inducible mRNA Solanum tuberosum ABA-, jasmonate- and wound-inducible mRNA Solanum tuberosum ABA-, jasmonate- and wound-inducible mRNA Solanum tuberosum gene Solanum tuberosum mRNA, complete cds Solanum tuberosum wound-induced mRNA Sorghum bicolor dehydrin mRNA, partial cds Spirodela polyrrhiza mRNA, induction by ABA is antagonized by cytokinin Spirodela polyrrhiza mRNA

Accession

3/16/99 11:19 AM

EMB35 EMB14 lp3-1 P393 ABR17 ABR18 pAPR141 PM2.1 Unknown Unknown Unknown dhn1 pA13 SGRP-1 Asr2 Td LAP Cys-pin cdi dhn1 POTLX-3 pin2 dhn2 p8/1/1

Function

10 Inducible Gene 10

Description

Q. Shen and T.-H.D. Ho

Gene

194

Table 10.2. Genes regulated by ABA, mediating ABA responses and involved in ABA biosynthesis (continued).

Lipase

Continued over

195

Superoxide dismutase

Page 195

Ferritin Ferritin

Z11693 Z21500 AA644713 U80037 Y00123 X59133 X56882 U43718 M81719 U09276 AA054809 AA054808 AA011868 X12564 X59138 X83077 X83076 T18666 M90554 W49866 T26946 X55388 L35913 X15994 U34726

3/16/99 11:19 AM

RNA-binding protein

synthase

10 Inducible Gene 10

D-myo-inositol-3-phosphate

Abscisic Acid- and Stress-induced Promoter Switches

tur1 Spirodela polyrrhiza mRNA H26 Stellaria longipes mRNA for dehydrin-like protein MA56 Sugarcane mature stalk Saccharum sp. cDNA clone, stress inducible PM-19 Triticum aestivum ABA-induced plasma membrane protein Em Triticum aestivum group 1 LEA Unknown Triticum aestivum mRNA for an ABA-responsive gene, rab pMA2005 Triticum aestivum mRNA for a group 3 LEA protein pMA1951 Triticum aestivum mRNA, partial cds Gbl1 Triticum aestivum storage protein gene, complete cds Orion Zea mays ABA- and ripening-inducible-like protein mRNA, complete zEST00632 Zea mays ABA- and salt-inducible cDNA clone zEST00630 Zea mays ABA- and salt-inducible cDNA clone zEST00463 Zea mays ABA- and salt-inducible cDNA clone Rab15 Zea mays ABA-inducible gene for glycine-rich protein rab28 Zea mays gene Fer2 Zea mays gene Fer1 Zea mays gene 5C02G05-T7 Zea mays glycine-rich protein from endosperm EMB5 Zea mays LEA mRNA, complete cds zEST00336 Zea mays leaf, Stratagene #937005 Zea mays cDNA clone zEST00278-5 Zea mays leaf, Stratagene #937005 Zea mays cDNA clone Emb564 Zea mays mRNA from an embryo-specific ABA-inducible gene LIP Zea mays mRNA, complete cds Rab17 Zea mays rab gene sod4 Zea mays superoxide dismutase 4 gene, partial cds

Description

Function

Accession

II. ABA-suppressible genes

Hordeum vulgare gene for α-amylase (EC 3.2.1.1) Hordeum vulgare α-amylase type B isozyme mRNA, complete cds α-amylase Hordeum vulgare ribulose-1,5-bisphosphate carboxylase small subunit Lycopersicon esculentum GA-inducible and ABA-suppressible gene Zea mays isocitrate lyase (ICL) mRNA, partial cds Isocitrate lyase

X54643 K02638 U43493 X63093 U69129

Arabidopsis thaliana G box factor 3 mRNA, complete cds Arabidopsis thaliana gene encoding ABI2 protein Arabidopsis thaliana gene encoding ABI3 protein Arabidopsis thaliana mRNA for ABI1 protein Craterostigma plantagineum gene Craterostigma plantagineum gene Craterostigma plantagineum gene Fagus sylvatica mRNA for GRPF1 protein Fagus sylvatica mRNA for GTP1 protein Helianthus annuus Dc3 promoter-binding factor-1 (DPBF-1) mRNA Helianthus annuus Dc3 promoter-binding factor-2 (DPBF-2) mRNA Hordeum vulgare mRNA for transcription factor EmBP-1 Hordeum vulgare mRNA for transcription factor vp1 Oryza sativa GBF-type bZIP protein OSBZ8 mRNA, complete cds Oryza sativa GBF-type bZIP protein OSBZ8 mRNA, complete cds Oryza sativa mRNA for Ca2+-binding EF hand protein Oryza sativa Nipponbare bZIP DNA-binding factor (osZIP-1a) mRNA

Embryo-specific transcription factor Phosphatase Phosphatase myb-related transcription factor myb-related transcription factor myb-related transcription factor samll GTP-binding protein samll GTP-binding protein bZIP transcription factors bZIP transcription factors

bZIP protein bZIP DNA-binding factor Ca2+-binding protein bZIP DNA-binding factor

U51850 AJ002473 Y08966 X77116 U33917 U33916 U33915 X98539 X98540 AF001453 AF001454 X98747 Y09939 U42208 U42208 X89891 U04295

Page 196

GBF3 ABI3 ABI2 ABI1 cpm7 cpm5 cpm10 GRPF1 GTP1 DPBF-1 DPBF-2 EmBP-1 vp1 OSBZ8 OSBZ8 efa27 osZIP-1a

Q. Shen and T.-H.D. Ho

III. Genes mediating ABA responses

3/16/99 11:19 AM

Amy1 pHV19 pJRG14C3 GAST1 ICL

10 Inducible Gene 10

Gene

196

Table 10.2. Genes regulated by ABA, mediating ABA responses and involved in ABA biosynthesis (continued).

U04296 U04297 U28645

Embryo-specific transcription factor Protein kinase bZIP DNA-binding factor bZIP DNA-binding factor Embryo-specific transcription factor

AJ003165 M94726 M62893 M63999 AJ001635

Zeaxanthin epoxidase

X95732 U95953

IV. ABA biosynthesis genes

ABA2 VP14

Nicotiana plumbaginifolia mRNA for zeaxanthin epoxidase Zea mays viviparous-14 (vp14) mRNA, complete cds

3/16/99 11:19 AM

bZIP DNA-binding factor bZIP DNA-binding factor Embryo-specific transcription factor

Page 197

Abscisic Acid- and Stress-induced Promoter Switches

PtABI3 PKABA1 EmBP-1b EmBP-1c VP1

Oryza sativa Nipponbare bZIP DNA-binding factor (osZIP-2a) mRNA Oryza sativa Nipponbare bZIP DNA-binding factor (osZIP-2b) mRNA Phaseolus vulgaris gene homologous to Z. mays VP1 and A. thaliana ABA3 Populus trichocarpa cv. Trichobel ABI3 gene Triticum aestivum ABA- and drought-inducible protein kinase mRNA Triticum aestivum DNA-binding protein (EmBP-1b) mRNA, complete cds Triticum aestivum DNA-binding protein (EmBP-1c) mRNA, partial cds Zea mays gene encoding VP1 protein

10 Inducible Gene 10

osZIP-2a osZIP-2b PvAlf

197

10 Inducible Gene 10

198

3/16/99 11:19 AM

Page 198

Q. Shen and T.-H.D. Ho

Information at the website: http://www.ncbi.nlm.nih.gov/. A large fraction of the stress/ABA-induced proteins are neither enzymes nor storage proteins. It has been suggested that they may function in protecting proteins and membranes from damage due to loss of water in the cytoplasm during desiccation usually at the last stage of seed development (Dure, 1993). For example, it has been shown that the level of LEA proteins is closely correlated with desiccation tolerance both in the naturally developing and germinating seeds (Blackman et al., 1991). However, a causal relationship between the level of LEA proteins and desiccation tolerance has yet to be demonstrated. Specific mRNAs and proteins, such as some RAB and LEA proteins, also accumulate in stressed vegetative tissues. Some of these proteins possess conserved, positively charged domains. It was initially suggested that they may bind nucleic acids and hence regulate gene expression (Mundy and Chua, 1988). In fact, pMAH9, a maize gene induced by ABA and water stress, encodes a protein containing the consensus sequence (RGFGFVXF) of RNA-binding protein (Gomez et al., 1988; Bandziulis et al., 1989). It has been shown that the protein, MA16, is indeed a RNA-binding protein with preference for guanosinerich and uridine-rich sequences (Ludevid et al., 1992). Therefore, ABAresponsive genes may encode RNA-regulatory proteins which might be capable of altering developmental events in plants. Other notable ABA-regulated genes include those encoding a barley aldose reductase (Bartels et al., 1991), a Craterostigma plantagineum cytosolic glyceraldehyde-3-phosphate dehydrogenase (Velasco et al., 1994) and a sucrose-phosphate synthase (Ingram et al., 1997), an L-isoaspartyl protein methyltransferase (Mudgett and Clarke, 1996) and a serine/threonine protein kinase (Anderberg and Walker-Simmons, 1992) in wheat, a thioprotease (Williams et al., 1994) and a proline biosynthesis enzyme (pyrroline-5-carboxylase synthetase) (Strizhov et al., 1997) in Arabidopsis, and a duckweed peroxidase (Chaloupkova and Smart, 1994). Some of these ABAinduced enzymes are involved in the biosynthesis of potential osmoprotectants, such as sugar alcohols and proline, thus their induction by ABA/stress appears to be physiologically relevant. In contrast to the large number of ABA-inducible genes, only a handful of genes are known to be suppressed by ABA, most of them being germination-specific enzymes such as α-amylase and protease in barley grains (Jacobsen and Chandler, 1987; Mikkonen et al., 1996).

MECHANISM OF ABA ACTION AND ABA-RESPONSIVE PROMOTERS The mechanism of ABA action has been the subject of intense interest to plant biologists for many years. Although little progress has been made concerning the initial perception of ABA by a putative receptor, there have been quite a few reports about signal transduction pathways, the cis-acting promoter sequences involved in ABA response and DNA-binding proteins interacting with the ABAresponsive cis-acting sequence. In barley aleurone layers, ABA induces dozens of genes and at least two of them, HVA1 and HVA22, have been shown to also

10 Inducible Gene 10

3/16/99 11:19 AM

Page 199

Abscisic Acid- and Stress-induced Promoter Switches

199

be induced by drought, salinity and temperature stress conditions (Fig. 10.1) (Hong et al., 1992; Shen et al., 1993). The promoters of these genes have been analysed by linking them to the coding region of a reporter gene, GUS, followed by analysis of GUS expression in barley tissues which have been transformed with these gene constructs via particle bombardment (biolistic technique). The analyses of these promoters have revealed sequences which are necessary and sufficient for ABA/stress induction. The prerequisite to analyse a promoter for ABA-responsive cis-acting sequence is to demonstrate that the transcription control is the main regulatory mechanism for a given gene. By comparing the level of HVA22 mRNA and fold of induction of GUS expression from the reporter construct, which contains the GUS coding sequence driven by the ABAresponsive HVA22 promoter, we have demonstrated that the regulation of the HVA22 promoter is mainly at the level of transcription (Shen et al., 1993). As shown in Fig. 10.2, the level of the HVA22 mRNA is well correlated with the fold of induction of GUS activity. This crucial experiment has clearly shown that the effect of ABA observed in transient studies using an ABA promoter/reporter gene construct reflects the in vivo effect of ABA on the expression of the native gene.

Definition of cis-acting promoter sequences which are necessary and sufficient for ABA-induced gene expression To delineate the sequences that are important for ABA response of these genes, several Rab and Lea genomic clones have been obtained. Sequence comparisons of the 5′ upstream sequence of these genes have identified conserved sequences that may be ABA-responsive DNA elements (Marcotte et al., 1989; Skriver et al., 1991). Transient assays have been conducted with protoplasts isolated from rice suspension cultures and chimeric genes with the wheat Em gene promoter linking to the coding region of the GUS gene. A 260 bp fragment (2168 to +92) of the Em gene triggers a 15- to 20-fold increase in GUS expression in the presence of ABA (Marcotte et al., 1989). A 75 bp fragment of this gene, when fused in either direction to a truncated 35S promoter, gives a more than tenfold induction of GUS activity in the presence of ABA (Guiltinan et al., 1990). In this region, there are three noticeable elements, designated as Em1a (GGACACGTGGC), Em1b (GCACACGTGC) and Em2 (CGAGCAGGC) (Guiltinan et al., 1990). With a similar system, Mundy et al. (1990) have reported that a promoter fragment between 2294 and 252 of the rice Rab16A gene is sufficient to confer ABA-dependent expression of the chloramphenicol acetyltransferase reporter gene in rice protoplasts. Sequence comparisons of ABA-inducible genes generate a consensus sequence with an ACGT-core. Skriver et al. (1991) have demonstrated that six copies of the sequence GTACGTGGCGC are able to confer ABA inducibility to a 246 35S minimal promoter (a sixfold induction). This type of sequence containing an ACGT core has since been named the ABA response element (ABRE).

10 Inducible Gene 10

3/16/99 11:19 AM

Page 200

Q. Shen and T.-H.D. Ho

200

Root

Shoot

Root

Shoot

Control ABA

Root

Root

Shoot

Root

Shoot

Shoot

Root

Shoot

Shoot

Root

Root

37°C

Root

Shoot

22°C

Root

22°C

Shoot

Shoot

1°C

Root

22°C Shoot

Control Dehydration Control NaCl

Fig. 10.1. Northern blot analysis showing ABA and stress induction of the HVA1 gene in 3-day-old barley seedlings. The plants were treated with ABA, drought (dehydration), NaCl, cold (1°C and recovery to 22°C) and heat (37°C). (From Straub et al., 1994.)

The ACGT core containing ABRE is conserved in all ABA-regulated genes for which sequence data are available (Michel et al., 1993). However, it is puzzling that the sequence is similar to the consensus G box motif found in a number of yeast promoters (Donald et al., 1990) and plant promoters responsive to visible and ultraviolet light (Schulze-Lefert et al., 1989) as well as in the anaerobically induced Adh-1 promoter from maize (Delisle and Ferl, 1990). This conserved G box/ABRE sequence is important for transcription of some of these genes, but none appear to be positively regulated by ABA. Furthermore, a sequence similar to ABRE/G box is also found in the promoters of genes of bacteria (Agrobacterium nopaline synthase, nos) and virus (CaMV 35S), yet none of them are known to be directly regulated by ABA. A similar sequence (E box: GGCCACGTGACC) is also found in the major later promoter of adenovirus and in certain mammalian promoters and can compete with the G box element for

10 Inducible Gene 10

3/16/99 11:19 AM

Page 201

Abscisic Acid- and Stress-induced Promoter Switches

201

Fig. 10.2. Dosage response curve of ABA-inducible HVA22 RNA accumulation (L) and dosage response of GUS gene expression driven by HVA22 promoter (l). For the Northern analysis, RNA was isolated from mature imbibed aleurone layers treated with ABA at the concentrations of 1029 to 1024 M respectively. Correspondingly, protein extract was prepared from mature half-seeds treated with or without 1029 to 1024 M ABA for 24 h, after the seeds having been shot with PDraIIIGU and the internal control pAMC18 constructs. The ABA induction was expressed as the ratio of normalized GUS activity of the samples treated with ABA over that of those incubated with buffer only. Each point represents the mean of at least six replicas. Each lane of Northern blot analysis was loaded with 5 µg of total RNA prepared from the aleurone layers treated without (control) or with 1029 to 1024 M ABA. The autoradiography was quantified with a computing densitometer (Model 300A, Molecular Dynamics, California). (From Shen et al., 1993.)

binding to plant nuclear extracts (Guiltinan et al., 1990). For the ease of presentation, we designate the G box/ABRE sequences as ACGT boxes for the rest of this chapter. The presence of ACGT boxes in non-ABA responsive promoters raises a question: what confers the specificity of ABA response? Is it the flanking sequence of the ACGT box or another cis-acting element? In order to address this question, we have analysed the barley HVA22 and HVA1 promoters following both the loss- and gain-of-function approaches. Specifically, we have performed transient-expression studies of the GUS reporter gene driven by the wild-type and various mutants of the HVA22 or HVA1 promoter (Shen et al., 1993; Straub et al., 1994; Shen and Ho, 1995; Shen et al., 1996). The DNA construct, containing the GUS gene driven by the promoters, is delivered into aleurone cells of barley embryo-less half-seeds by

10 Inducible Gene 10

202

3/16/99 11:19 AM

Page 202

Q. Shen and T.-H.D. Ho

particle bombardment. The bombarded seeds, after treatment with or without ABA, are homogenized, and GUS activities are determined. Because of the inherent variability of transfection efficiencies, another reporter gene, LUC, coding for luciferase from firefly, is included as an internal control. The LUCcoding sequence is driven by a non-ABA-responsive maize ubiquitin promoter (Bruce et al., 1989). Therefore, the measured GUS activity of one construct could be normalized with the luciferase activity from the same shot. This approach has led us to define the promoter sequences which are necessary and sufficient for ABA response in two ABA/stress-responsive barley genes, HVA22 and HVA1.

A short promoter fragment of HVA1 or HVA22 gene confers a high level of ABA induction To test whether the sequence containing ACGT boxes is able to confer ABA inducibility, short promoter fragments containing an ACGT box are linked to the 5′ end of a truncated (260) barley α-amylase gene (Amy64) promoter. While the control (Amy64 minimal promoter only) construct is not affected by ABA treatment, the addition of a 49 bp promoter fragment from the HVA22 gene in either orientation gives a high level (24–38-fold) of induction (1C+ and 1C2, Fig. 10.3). This 49 bp fragment contains an ACGT box named A3. Similarly, a 68 bp promoter fragment from the HVA1 gene is also able to confer a high level of ABA induction (Straub et al., 1994). Within this region, there is also an ACGT box (A2). These data suggest that all information necessary and sufficient for ABA response is present in these short promoter fragments. An ACGT box is necessary but not sufficient for ABA induction To determine the sequences within the 49 bp promoter region that govern the ABA responsiveness of the fragment, a linker-scan analysis has been performed with the construct 1C+ and the key observations are summarized in Fig. 10.4. The sequence of the promoter fragment is replaced at 10 base intervals. The most drastic reduction occurs with two mutants, LS-08 and LS-11; the absolute levels of GUS activities obtained from these constructs drop to below 5% of that obtained with the wild-type. Accordingly, the fold of induction decreases from the 44-fold in the case of wild-type to only fourfold for these two mutants (Fig. 10.4a). In construct LS-08 the ACGT box (A3) is mutated while in LS-11 the last 9 bp of the 49 bp promoter fragment is replaced with a random sequence. The results presented in Fig. 10.4 clearly indicate that in addition to an ACGT box, the last 9 bp are also necessary for ABA induction. This 9 bp represents a novel cis-acting sequence involving the ABA response and is denoted CE1 (coupling element). Sequences similar to CE1 are present in other ABA-responsive genes such as maize Rab17 (Vilardell et al., 1990) and rice Rab16A (Mundy and Chua, 1988). None of these elements have been tested to determine whether they are indeed involved in the ABA responsiveness of those genes. In light of the observations described above, it would be definitely worthwhile investigating whether they function as coupling elements for ABA responses in those genes.

10 Inducible Gene 10

3/16/99 11:19 AM

Page 203

Abscisic Acid- and Stress-induced Promoter Switches

203

Fig. 10.3. A 49 bp fragment containing A3 confers ABA inducibility to a minimal promoter. The minimal promoter (to 260) and the 5′ untranslated region (to +57) from the barley Amy64 α-amylase gene was fused to the 5′ end of HVA22 intron1–exon2–intron2 fragment (thin black angled line) (Shen and Ho, 1995). The 3′ region (black bar to the right of the GUS coding sequence) was from the HVA22 SphI–SphI genomic fragment, including the polyadenylation sequence (AATAAA). This minimal promoter (MP64) is not responsive to gibberellin or ABA. The 49 bp HVA22 promoter fragment, shown at the bottom, was fused in either positive (i.e. the same as in the native promoter) or negative orientation. The 2C+, 3C+ and 4C+ constructs contain two, three or four tandem copies of the 49 bp sequence, respectively. The numbering of the 49 bp fragment is relative to the transcription start site of the HVA22 gene. Relative GUS activity of each construct is the mean of four replicas. Error bars indicate the standard error of each set of replicas. 3 indicates fold of increase. (From Shen and Ho, 1995.)

A similar approach has been used to study the 68 bp HVA1 promoter fragment (Fig. 10.4b). This sequence is replaced at 10 or 12 bp intervals (fragments I to VI, Fig. 10.4b). The most drastic mutations are in fragment III and IV. When either of these two fragments is replaced with a random sequence,

10 Inducible Gene 10

204

3/16/99 11:20 AM

Page 204

Q. Shen and T.-H.D. Ho

Fig. 10.4. Linker-scan analyses of the short fragments from HVA22 and HVA1 genes define novel elements involved in the ABA response. The numbering of the fragments is relative to the transcription start site of the HVA22 or HVA1 gene. (a) The 49 bp HVA22 promoter sequence was mutated at 10 bp intervals. (b) The 68 bp HVA1 promoter sequence linker-scan analysis. These experiments demonstrate that both the ACGT box and a novel coupling element (either CE1 or CE3) are necessary for ABA response. (From Shen and Ho, 1995, and Shen et al., 1996.)

the ABA induction drops from 38- to fivefold, with the absolute level of GUS activity being less than 10% of that obtained with the wild-type fragment. The negative effect from the fragment IV is expected because it appears to be an

10 Inducible Gene 10

3/16/99 11:20 AM

Page 205

Abscisic Acid- and Stress-induced Promoter Switches

205

ACGT box (A2). In contrast, fragment III shares no homology with any of the cis-acting elements which may be involved in ABA response, including CE1. Hence, fragment III in the HVA1 promoter sequence has been designated as CE3 (coupling element 3).

An ACGT box could interact with either a distal or a proximal coupling element to confer ABA response It has been shown that to achieve a high level of ABA induction, the ACGT box sequence in the HVA22 promoter, i.e. A3, has to interact with a distal element, CE1, and that in HVA1 the ACGT box sequence, A2, needs to couple with the neighbouring sequence, CE3. Therefore, an exchanging experiment has been performed and it is demonstrated that the two ACGT boxes are fully exchangeable (Shen et al., 1996). Hence, it appears that an ACGT box can interact with either a distal coupling element (CE1) or a proximal element (CE3) to form a promoter complex capable of conferring a high level of ABA induction. Taking all these observations together, it appears that the ABA response relies on the interaction of an ACGT box and a coupling element. We therefore designate the promoter complex containing A3 and CE1 from the HVA22 gene ABA response complex 1 or ABRC1 and that from the HVA1 gene, containing A2 and CE3 ABA response complex 3 or ABRC3 (Fig. 10.5). The interaction of an ACGT box with the distal coupling element is different from that with a proximal element Although the ACGT box can interact with a distal or a proximal coupling element to confer a similar level of ABA induction, the coupling interaction

Fig. 10.5. The modular nature of ABA-response complexes in two ABA-responsive barley genes, HVA1 and HVA22. In HVA22, an ABA-response complex is composed of an ACGT box, A3 and a distal coupling element (CE1). In HVA1, in contrast, an ABA-response complex consists of an ACGT box, A2 and a proximal coupling element (CE3).

10 Inducible Gene 10

206

3/16/99 11:20 AM

Page 206

Q. Shen and T.-H.D. Ho

between these two cis-acting elements in ABRC1 appear to be quite different from that in ABRC3. The orientation of both cis-acting elements is critical for ABA induction in ABRC1 while the orientation of the ACGT box or CE3 in ABRC3 has less impact on the response of this complex to ABA (Shen, Q., Zhang, P. and Ho, T.-H.D., unpublished data). Reversing the orientation of A3 or CE1 reduces the induction level to about 20% of that of the wild-type sequence. When the orientations of both A3 and CE1 are reversed, the induction level drops to only 5% of that obtained from the wild-type ABRC1. These observations suggest that both A3 and CE1 have to be properly oriented in the promoter so that they can interact with each other to confer a high level of ABA induction. For the ABRC3 from the HVA1 gene promoter, the elements of A2 and CE3 are less sensitive to changes in orientation. Reversing the orientation of A2 results in a small decrease of ABA induction, up to 80% of the ABA induction level is retained in comparison with that of the wild-type ABRC3. In contrast, the orientation of CE3 is more critical than the A2 element in this complex. When CE3 is reversed, the induction level decreased to 40% of that of the wild-type ABRC3. When both elements are reversed, the mutant ABRC3 complex still confers up to 29% of ABA induction, much higher than the 5% from the double mutant of ABRC1 from the HVA22 gene.

The ABRC1, but not ABRC3, is phase-sensitive relative to their positions on the DNA double helix The two ABA-response promoter complexes, ABRC1 and ABRC3, are not only different in terms of their sensitivities to the orientation of two cis-acting elements, but these complexes also respond quite differently to the changes in the distance between the ACGT box and the coupling element (Shen, Q., Zhang, P. and Ho, T.-H.D., unpublished data). Figure 10.6 shows the ABA induction level obtained from ABRC1 and ABRC3 mutants in which the distance between the ACGT box and coupling elements is altered. When the A2 and CE1 are separated by an increment of 10, 20 or 30 bp, the induction level is always higher than elements separated by 5, 15 or 25 bp. For instance, the ABA induction is only fivefold when A3 is 5 bp apart from CE1. When the distance increases to 10 bp, the ABA induction rises to 16-fold. Because most DNA in a physiological condition is in the B-form conformation and each turn of B-form DNA consists of 10 bp, it is likely that the ABA induction from ABRC1 relies on the in-phase interaction between protein factors binding to A3 and CE1. Interestingly, the ABA induction level increases, in general, as the distance between the ACGT box and the coupling element is lengthened. For example, when A3 and CE1 are 30 bp apart, the induction level is as high as 26-fold, compared to 20-fold at 20 bp apart and 16-fold at 10 bp apart. In contrast, ABRC3, composed of A2 and CE3, does not appear to be phasesensitive. The highest induction (40-fold) is obtained with the wild-type complex, in which CE3 lies immediately upstream to A3. When a 5 bp sequence is inserted between the elements, the induction decreases to 26-fold. The induction level decreases as the distance between A2 and CE3 is lengthened. When

10 Inducible Gene 10

3/16/99 11:20 AM

Page 207

Abscisic Acid- and Stress-induced Promoter Switches

207

Fig. 10.6. The effect of distance between the ACGT box and CE elements on ABA responsiveness. For the HVA1 gene promoter, the ABA response decreased when the distance between CE3 and A2 elements is lengthened. For the HVA22 gene promoter, the distance between CE1 and A3 elements does not seem to be relevant; however, both elements must be in the same phase relative to the DNA double helix, to achieve the maximal ABA response. The solid line refers to the HVA1 gene promoter and the dashed line to the HVA22 gene promoter. (Shen, Q., Zhang, P. and Ho, T.-H.D., unpublished data.)

these two elements are 20 bp apart, the induction drops to 19-fold. A further increase of the distance to 25 bp results in almost complete loss of induction, only sixfold is obtained. Therefore, it appears that ABRC3 is distance-sensitive while ABRC1 is phase-sensitive.

Signal response specificity relies on the interaction of an ACGT box with a coupling element The ‘coupling model’ described above has at least partially resolved the puzzle for the involvement of ACGT box in responding to a variety of different environmental and physiological cues. As summarized in Fig. 10.7, similar to the observation that ABA response relies on the interaction of an ACGT box (A3, GCCACGTACA or A2, CCTACGTGGC) with a coupling element (CE1, TGCCACCGG or CE3, ACGCGTGTCCTC), the presence of both an ACGT box (Box II, TCCACGTGGC or Box III, TGTACGTGGA) and another element (Box I, GTCCCTCCAACCTAACC or Box IV, CTTCACTTGATGTATC) is necessary for the UV-light response of the chalcone synthase promoter (Schulze-Lefert et al., 1989). Specific point mutations within either Box II or Box I result in a dramatic reduction of light-induced gene expression (Block et al., 1990). Similarly, Donald

10 Inducible Gene 10

208

3/16/99 11:20 AM

Page 208

Q. Shen and T.-H.D. Ho

Fig. 10.7. Schematic model of signal-specific complexes. The ACGT cores in G box-like sequences are in boldface letters. The distance between the G box-like sequence and the coupling sequence is indicated by the number (N) of nucleotides. The coumaric acid-response complex is adopted from Loake et al. (1992), UV-lightresponse complexes are from Block et al. (1990), and white light-response complexes are from Donald and Cashmore (1990). (Modified from Shen and Ho, 1995.)

and Cashmore (1990) have reported that mutations in either G box (CTTCCACGTGGC, an ACGT box) or I box (I-1, AACGATAAGATT and I-2, AGCCGATAAGGG) dramatically reduce the expression from the lightresponsive Arabidopsis rbcS-1A gene. In the case of a chalcone synthase gene, the combination of H box (CCTACC-N7-CT) and ABRE (CACGTG) cis elements is

10 Inducible Gene 10

3/16/99 11:20 AM

Page 209

Abscisic Acid- and Stress-induced Promoter Switches

209

necessary for the response of this promoter to the phenylpropanoid-pathway intermediate ρ-coumaric acid (Loake et al., 1992). Although the ACGT box sequences in these genes are similar, elements interacting with them, as shown in Fig. 10.7, are different in the complexes involved in the response to ABA (Shen and Ho, 1995), coumaric acid (Loake et al., 1992), UV-light (SchulzeLefert et al., 1989a), and white light (Donald and Cashmore, 1990). Therefore, it appears that the signal response specificity is at least partially determined by the coupling elements (Fig. 10.7).

Construction of ABA switches with different levels of ABA induction and transcription strength The delineation of ABRC1 and ABRC3 leads to the conclusion that ACGT boxes in HVA1 and HVA22 promoters can confer a high level of ABA response provided that they are coupled with a distal or a proximal coupling element, namely CE1 or CE3. At the same time, several recombinant DNA constructs have been shown to be able to drive the expression of GUS reporter gene at high levels. These ABA-responsive promoter switches are summarized and their transcription strengths are shown in Fig. 10.8. One copy of the 49 bp HVA22 ABRC1 is able to confer more than 30-fold ABA induction and additional copies of ABRC1 added to the reporter construct led to even higher level of ABA induction (Fig. 10.8a). The 68 bp ABRC3 of HVA1 gene turns out to be even stronger than the HVA22 ABRC1; one copy of this fragment led to 20-fold induction with the absolute level of GUS activity twice as high as that obtained with the HVA22 ABRC1 (Fig. 10.8b). Moreover, the presence of two coupling elements further enhances the expression of the construct when they interact with the ACGT box either from HVA22 or HVA1 (Fig. 10.8c and d). ABA molecular switches are functional in vegetative tissues All of the observations mentioned above are obtained with aleurone tissues in barley seeds. However, it has been known that both HVA1 and HVA22 genes are also expressed in vegetative tissues (Hong et al., 1992; Shen, Q. and Ho, T.-H. D., unpublished results). To investigate whether the defined ABA-response complexes also function as ABA-responsive promoter switches in the vegetative tissues, constructs C17 containing the 49 bp HVA22 ABRC1 and C1 containing the 68 bp HVA1 ABRC3 have been introduced into 6-day-old barley leaf tissues. Data shown in Fig. 10.9 demonstrate that both ABA promoter complexes are able to confer ABA induction in vegetative tissues. As observed with the aleurone tissue, the HVA1 ABRC3 appears to be more responsive to ABA than the HVA22 ABRC1. ABA-responsive promoter switches are regulated by ABA, water deficit and NaCl treatment in stably transformed rice plants To test whether the ABRC1 defined in transient studies is functional in stably transformed plants, one or four tandem copies of ABRC1 are fused to the minimal (2100) promoter of the rice actin (Act1) promoter which is linked to

10 Inducible Gene 10

210

3/16/99 11:20 AM

Page 210

Q. Shen and T.-H.D. Ho

Fig. 10.8. Versions of DNA molecular switches controlling the expression of ABAinducible promoters. (a) HVA22 complex consists of an ACGT box (A3) and a distal CE1. The normalized GUS activity from the ABA-treated sample of the single copy ABRC1 construct is taken as 100% throughout the figure. ‘Fold’ stands for fold induction calculated as described (Shen et al., 1996). (b) The ABA-response complex in HVA1 promoter consists of an ACGT box (A2) and the proximal CE3. (c) and (d) The ternary ABA-response complexes consisting of two coupling elements and an ACGT box. (From Shen et al., 1996.)

the coding region of GUS reporter gene. The synthetic promoter is introduced into rice embryos from which stably transformed plants containing one or multiple copies of the transgene are generated. It is observed that transgenic plants containing a single-copy transgene have a higher level of GUS expression than those containing multiple copies. Northern blot analyses indicate that the ABRC1 in these transgenic rice plants are responsive to the following treatments: 50 µM ABA for 20 h, drought stress (withholding water for 6 days) and salt stress (150 mM NaCl for 72 h) (Su et al., 1998). Quantitative analyses of the GUS activities in the transgenic rice plants demonstrate that the ABA/stress induction of GUS expression varies from three- to eightfold depending on treatments and rice tissues studied. In all cases studied, however, synthetic promoters containing four copies of ABRC1 confer higher levels of ABA/stress induction than the promoter containing only a single copy of ABRC1. It should be noted that the long (up to 2100) minimal promoter may

10 Inducible Gene 10

3/16/99 11:21 AM

Page 211

Abscisic Acid- and Stress-induced Promoter Switches

211

Fig. 10.9. Both the 49 bp HVA22 promoter containing ABRC1 and the 68 bp HVA1 promoter containing ABRC3 are functional in a vegetative tissue. The DNA constructs were bombarded into leaf tissue from 6-day-old greenhouse-grown barley plants and treated with or without 1024 M ABA in H2O at 24°C for 24 h. The relative GUS activity of each construct is the mean of four replicas. The error bar indicates the standard error of each set of replicas. 3 indicates fold induction. (From Shen et al., 1996.)

account for the lower induction level observed. In the transient studies in barley, a much shorter (up to only 260) barley Amy6-4 promoter was used. As a result, much higher induction is obtained in these transient expression studies than in stably transformed rice plants (Shen and Ho, 1995). Experiments are ongoing to express the synthetic gene containing the shorter minimal promoter and one or four copies of ABRC1.

ABA signal transduction components Genetic analyses have led to the cloning of several genes regulating the sensitivity of plants to ABA (for review see Leung and Giradat, 1998). One of these genes is maize Viviparous-1, or VP1. It has been shown that the VP1 gene encodes a transcription factor involved in ABA induction (McCarty et al., 1991). The ABA-induced expression of some genes, for instance, maize Rab28 (Pla et al., 1991), is VP1-independent while the induction of others, such as the wheat Em gene (McCarty et al., 1991), is VP1-dependent. Although the data presented in Fig. 10.4 demonstrate that ABRC3 is different from ABRC1 in terms of their transcription strengths and structures, it is also likely that different ABRCs are mediated by different signal transduction pathways. To test this hypothesis, we cobombard the effector construct consisting of the maize VP1 coding sequence driven by a constitutive 35S promoter (McCarty et al., 1991) along with the

10 Inducible Gene 10

212

3/16/99 11:21 AM

Page 212

Q. Shen and T.-H.D. Ho

reporter construct, C1 (containing ABRC3) or C17 (containing ABRC1). McCarty et al. (1991) have shown that coexpression of VP1 in maize protoplasts enhanced the ABA response of the wheat Em promoter, and the presence of both VP1 and ABA has a synergistic effect (McCarty et al., 1991). As shown in the right half of Fig. 10.10, a similar pattern of VP1 activation on the ABRC3 of the barley ABA-responsive HVA1 Lea gene is observed in barley aleurone cells. Coexpression of VP1 leads to a fourfold induction of ABRC3, compared to the 14-fold induction by ABA. In the presence of ABA and VP1, the induction increases to 31-fold, suggesting a synergistic effect of ABA and VP1 on ABRC3. In contrast, ABRC1 does not appear to respond to VP1 at all (left half, Fig.10.10). In the absence of ABA, VP1 coexpression fails to activate ABRC1, giving no induction (13). The presence of both VP1 and ABA results in a 17-fold induction, similar to ABA treatment alone (15 3). Therefore, VP1 appears to be able to differentiate ABRC3 from ABRC1 in mediating ABA responses.

Fig. 10.10. ABRC3, but not ABRC1, is activated by the maize VP1 transcription regulator. The 35S-Sh-Vp1 construct containing the VP1 coding sequence driven by the 35S constitutive promoter was cobombarded into barley aleurone layers along with the construct containing ABRC1 (C17) or ABRC3 (C1) at 1 : 3 ratio (ABRC construct : Vp1 construct). Similar results were obtained at 1 : 0.2 ratio. Symbols below the bars indicate treatments with (+) or without (2) ABA- and the VP1effector construct. The relative GUS activity of each construct is the mean of four replicas. The error bar indicates the standard error of each set of replicas. 3 indicates fold induction. (From Shen et al., 1996.)

10 Inducible Gene 10

3/16/99 11:21 AM

Page 213

Abscisic Acid- and Stress-induced Promoter Switches

213

In addition to VP1, other genes governing the sensitivity of plant to ABA have been reported. A mutation of the Arabidopsis Era1 gene enhances sensitivity of the plant to ABA. The Era1 gene has been cloned and shown to encode the β-subunit of a protein farnesyl transferase (Cutler et al., 1996). ABA treatment alters the level of cellular Ca2+ concentration (Gilroy and Jones, 1992) and an ABA-inducible gene which encodes a novel plant Ca2+-binding protein in rice has been reported (Frandsen et al., 1996). More recently, Wu et al. (1997) have identified cyclic ADP-ribose (cADPR) as a signalling molecule in the ABA response and cADPR has been shown to exert its effects by way of calcium. Protein phosphorylation and dephosphorylation are also likely to be involved in ABA-regulated gene expression. An ABA- and stress-inducible gene cloned from wheat embryos encoded a protein with sequence homology to protein kinases, i.e. it contained the feathers of serine/threonine protein kinases, including all 12 conserved regions of the catalytic domain (Anderberg and Walker-Simmons, 1992). Recently, an ABA-induced mitogen-activated protein kinase activity has been suggested to be involved in ABA regulation in barley aleurone protoplasts (Knetsch et al., 1996). A mutation in the Arabidopsis gene, Abi1, encoding a protein phosphatase 2C abolishes ABA responsiveness (Leung et al., 1994; Meyer et al., 1994). The potential role of Abi1 and the ABA-induced protein kinase, PKABA1, has been tested in barley aleurone cells. It appears that the expression of the mutant Abi1 blocks the ABA induction of LEA genes, yet has no effect on the ABA suppression of GA-induced germination enzymes such as α-amylase. On the other hand, the constitutive expression of PKABA1 mimics the action of ABA in suppressing GA-induced α-amylase expression, but has no significant effect on the ABA induction of LEA genes. Thus, it has been suggested that the ABA/stress-regulated gene expression follows two distinct signal transduction pathways, i.e. the induction pathway mediated by Abi1 and the suppression pathway mediated by PKABA1 (Gomez-Cadenas et al., 1999). It is not clear, however, whether these two pathways share common early steps such as the elevation of cADPR and Ca+2 levels.

CONCLUSION AND POTENTIAL BIOTECHNOLOGY APPLICATIONS ABA-regulated gene expression has been under intensive studies for the past 15 years. Progress has been made in the cloning of ABA-regulated genes and the definition of cis-acting elements involved in the regulation of ABA response in promoters of these genes. The discovery of ABRCs demonstrates that a specific ABA response relies on the interaction of two cis-acting elements, an ACGT box and a coupling element (Shen et al., 1996). Although DNA-binding proteins interacting with ACGT boxes have been reported (Guiltinan et al., 1990), CE element-binding proteins have not been studied yet. It is expected that proteins interacting with CE elements will be isolated by techniques such as yeast-onehybrid system and expression library screening. Both protein kinases and

10 Inducible Gene 10

3/16/99 11:21 AM

214

Page 214

Q. Shen and T.-H.D. Ho

phosphatases have been reported to be involved in the regulation of ABA signal transduction pathways. In recent years different stress-tolerant transgenic plants have been obtained (Tarczynski et al., 1993; Kishore et al., 1995; Pilon-Smits et al., 1995; Holmström et al., 1996; Xu et al., 1996; Hayashi et al., 1997) by producing either low-molecular-weight osmoprotectants (such as glycine betaine, mannitol, inositol, proline, fructan or trehalose) or a LEA protein. However, under normal environmental conditions, overproduction of these compounds or proteins needs extra energy and building blocks and may hamper the normal growth of plants. Thus, it is desirable to generate transgenic plants that synthesize a high level of an osmoprotectants or a protein only under stress conditions. To this end, the ABA/stress-responsive ‘molecular switches’, naturally occurring or synthetic, described in this chapter would be valuable in driving the expression, only on demand, of genes whose products are beneficial in plant tissues under stresses. ACKNOWLEDGEMENT The original works published by Tuan-Hua David Ho and his associates were supported by US National Science Foundation grants (DCB-9006591 and IBN9408900) and US Department of Agriculture/National Research Initiative grants (91–37100–6625 and 94–37100–0316). REFERENCES Anderberg, R.J. and Walker-Simmons, M.K. (1992) Isolation of a wheat cDNA clone for an abscisic acid-inducible transcript with homology to protein kinase. Proceedings of the National Academy of Sciences USA 89, 10183–10187. Bandziulis, R.J., Swanson, M.S. and Dreyfuss, G. (1989) RNA-binding proteins as developmental regulators. Genes and Development 3, 431–437. Bartels, D., Engelhardt, K., Roncarati, R., Schneider, K., Rotter, M. and Salamini, F. (1991) An ABA and GA modulated gene expressed in the barley embryo encodes an aldose reductase related protein. The EMBO Journal 10, 1037–1043. Blackman, S.A., Wettlaufer, S.H., Obendorf, R.L. and Leopold, A.C. (1991) Maturation protein associated with desiccation tolerance in soybean. Plant Physiology 96, 868–874. Block, A., Dangl, J.L., Hahlbrock, K. and Schulze, L.P. (1990) Functional borders, genetic fine structure, and distance requirements of cis elements mediating light responsiveness of the parsley chalcone synthase promoter. Proceedings of the National Academy of Sciences USA 87(14), 5387–5391. Boyer, J. (1982) Plant productivity and environment: potential for increasing crop plant productivity, genotypic selection. Science 218, 443–448. Bray, E. (1997) Plant responses to water deficit. Trends in Plant Science 2, 48–54. Bray, E.A. and Beachy, R.N. (1985) Regulation by ABA of β-conglycinin expression in cultured developing soybean cotyledons. Plant Physiology 79, 746–750.

10 Inducible Gene 10

3/16/99 11:21 AM

Page 215

Abscisic Acid- and Stress-induced Promoter Switches

215

Bruce, W.B., Christensen, A.H., Klein, T., Fromm, M. and Quail, P.H. (1989) Photoregulation of a phytochrome gene promoter from oat transferred into rice by particle bombardment. Proceedings of the National Academy of Sciences USA 86, 9692–9696. Chaloupkova, K. and Smart, C.C. (1994) The abscisic acid induction of a novel peroxidase is antagonized by cytokinin in Spirodela polyrrhiza L. Plant Physiology 105(2), 497–507. Chandler, P.M. and Robertson, M. (1994) Gene expression regulated by abscisic acid and its regulation to stress tolerance. Annual Review of Plant Physiology and Plant Molecular Biology 45, 113–141. Cutler, S., Ghassemian, M., Bonetta, D., Cooney, S. and McCourt, P. (1996) A protein farnesyl transferase involved in abscisic acid signal transduction in Arabidopsis. Science 273, 1239–1241. Delisle, A.J. and Ferl, R.J. (1990) Characterization of the Arabidopsis Adh G-box binding factor. Plant Cell 2, 547–557. Donald, R.G.K. and Cashmore, A.R. (1990) Mutation of either G box or I box sequences profoundly affects expression from the Arabidopsis rbcS-1A promoter. The EMBO Journal 9, 1717–1726. Donald, R.G.K., Batschauer, A. and Cashmore, A.R. (1990) The plant G-box promoter sequences activate transcription in Saccharomyces cerevisae and is bound in vitro by a yeast activity similar to GBF, the plant G box binding factor. The EMBO Journal 9, 1727–1733. Dure, L. III (1993) A repeating 11-mer amino acid motif and plant desiccation. Plant Journal 3, 363–369. Dure, L. III, Crouch, M., Harada, J., Ho, T.-H.D., Mundy, J., Quatrano, R.S., Thomas, T. and Sung, Z.R. (1989) Common amino acid sequence domains among the LEA proteins of higher plants. Plant Molecular Biology 12, 475–486. Frandsen, G., Muller, U.F., Nielsen, M., Mundy, J. and Skriver, K. (1996) Novel plant Ca(2+)-binding protein expressed in response to abscisic acid and osmotic stress. Journal of Biological Chemistry 271, 343–348. Gilmour, S.J. and Thomashow, M.F. (1991) Cold acclimation and cold-regulated gene expression in ABA mutants of Arabidopsis thaliana. Plant Molecular Biology 17, 1233–1240. Gilroy, S. and Jones, R.L. (1992) Gibberellic acid and abscisic acid coordinately regulate cytoplasmic calcium and secretory activity in barley aleurone protoplasts. Proceedings of the National Academy of Sciences USA 89, 3591–3595. Gomez, J., Sanchez-Martinez, D., Stiefel, V., Rigau, J., Puigdomenech, P. and Pages, M. (1988) A gene induced by the plant hormone abscisic acid in response to water stress encodes a glycine-rich protein. Nature 334, 262–264. Gomez-Cadenas, A., Verhey, S.D., Holappa, L.D., Shen, Q., Ho, T.-H.D. and WalkerSimmons, M.K. (1999) An abscisic acid-induced protein kinase, PKABA1, mediates abscisic acid-suppressed gene expression in barley aleurone layers. Proceedings of the National Academy of Sciences USA (in press). Guiltinan, M.J., Marcotte, W.R., Jr and Quatrano, R.S. (1990) A plant leucine zipper protein that recognizes an abscisic acid response element. Science 250, 267–271. Hayashi, H., Alia, Mustardy, L., Deshnium, P., Ida, M. and Murata, N. (1997) Transformation of Arabidopsis thaliana with codA gene for choline oxidase; accumulation of glycinebetaine and enhanced tolerance to salt and cold stress. Plant Journal 12, 133–142.

10 Inducible Gene 10

216

3/16/99 11:21 AM

Page 216

Q. Shen and T.-H.D. Ho

Holmström, K.O., Mäntylä, E., Welin, B., Mandal, A., Palva, E.T., Tunnela, O.E. and Londesborough, J. (1996) Drought tolerance in tobacco. Nature 379, 683–684. Hong, B., Barg, R. and Ho, T.-H.D. (1992) Developmental and organ-specific expression of an ABA- and stress-induced protein in barley. Plant Molecular Biology 18, 663–674. Ingram, J. and Bartels, D. (1996) The molecular basis of dehydration tolerance in plants. Annual Review of Plant Physiology and Plant Molecular Biology 47, 377–403. Ingram, J., Chandler, J.W., Gallagher, L., Salamini, F. and Bartels, D. (1997) Analysis of cDNA clones encoding sucrose-phosphate synthase in relation to sugar interconversions associated with dehydration in the resurrection plant Craterostigma plantagineum Hochst. Plant Physiology 115, 113–121. Jacobsen, J.V. and Chandler, P.M. (1987) Gibberellin and abscisic acid in germinating cereals. In: Davies, P.J. (ed) Plant Hormones and their Role in Plant Growth and Development. Martinus Nijhoff, Dordrecht, pp. 164–193. Kishore, P., Hong, Z.L., Miao, G.H., Hu, C. and Verma, D. (1995) Overexpression of deltapyrroline-g-carboxylate synthetase increases proline production and confers osmotolerance in transgenic plants. Plant Physiology 108, 1387–1394. Knetsch, M.L.W., Wang, M., Snaar-Jagalska, B.E. and Heimovaara-dijkstra, S. (1996) Abscisic acid induces mitogen-activated protein kinase activation in barley aleurone protoplasts. Plant Cell 8, 1061–1067. Lång, V. and Palva, E.T. (1992) The expression of a rab-related gene, rab18, is induced by abscisic acid during the cold acclimation process of Arabidopsis thaliana (L.) Heynh. Plant Molecular Biology 20, 951–962. Leung, J. and Giradat, J. (1998) Abscisic acid signal transduction. Annual Review of Plant Physiology and Plant Molecular Biology 49, 199–222. Leung, J., Bouvier-Durand, M., Morris, P.C., Guerrier, D., Chefdor, F. and Giraudat, J. (1994) Arabidopsis ABA response gene ABI1: features of a calcium-modulated protein phosphatase. Science 264, 1448–1452. Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., Yamaguchi-Shinozki, K. and Shinozaki, K. (1998) Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 10, 1391–1406. Loake, G.J., Faktor, O., Lamb, C.J. and Dixon, R.A. (1992) Combination of H-box (CCTACCN7CT) and G-box (CACGTG) cis elements is necessary for feed-forward stimulation of a chalcone synthase promoter by the phenylpropanoid-pathway intermediate π-coumaric acid. Proceedings of the National Academy of Sciences USA 89, 9230–9234. Ludevid, M.D., Freire, M.A., Gomez, J., Burd, C.G., Albericio, F., Giralt, E., Dreyfuss, G. and Pages, M. (1992) RNA binding characteristics of a 16 kDa glycine-rich protein from maize. Plant Journal 2, 999–1003. Marcotte, W.R., Jr, Russell, S.H. and Quatrano, R.S. (1989) Abscisic acid-responsive sequences from the Em gene of wheat. Plant Cell 1, 969–976. McCarty, D.R., Hattori, T., Carson, C.B., Vasil, V., Lazar, M. and Vasil, I.K. (1991) The Viviparous-1 developmental gene of maize encodes a novel transcriptional activator. Cell 66, 895–905. Meyer, K., Leube, M.P. and Grill, E. (1994) A protein phosphatase 2C involved in ABA signal transduction in Arabidopsis thaliana. Science 264, 1452–1455.

10 Inducible Gene 10

3/16/99 11:21 AM

Page 217

Abscisic Acid- and Stress-induced Promoter Switches

217

Michel, D., Salamini, F., Bartels, D., Dale, P., Baga, M. and Szalay, A. (1993) Analysis of a desiccation and ABA-responsive promoter isolated from the resurrection plant Craterostigma plantagineum. Plant Journal 4, 29–40. Mikkonen, A., Porali, I., Cercos, M. and Ho, T.-H.D. (1996) A major cysteine proteinase, EPB, in germinating barley seeds: structure of two intronless genes and regulation of expression. Plant Molecular Biology 31, 239–254. Mudgett, M.B. and Clarke, S. (1996) A distinctly regulated protein repair L-isoaspartylmethyltransferase from Arabidopsis thaliana. Plant Molecular Biology 30, 723–737. Mundy, J. and Chua, N.H. (1988) Abscisic acid and water-stress induce the expression of a novel rice gene. The EMBO Journal 7, 2279–2286. Mundy, J., Yamaguchi-Shinozaki, K. and Chua, N.-H. (1990) Nuclear proteins bind conserved elements in the abscisic acid-responsive promoter of a rice rab gene. Proceedings of the National Academy of Sciences USA 87, 1406–1410. Pilon-Smits, E.A.H., Ebskamp, M.J.M., Paul, M.J., Jeuken, M.J.W., Weisbeek, P.J. and Smeekens, S.C.M. (1995) Improved performance of transgenic fructanaccumulating tobacco under drought stress. Plant Physiology 107, 125–130. Pla, M., Gomez, J., Goday, A. and Pages, M. (1991) Regulation of the abscisic acidresponsive gene rab28 in maize viviparous mutants. Molecular and General Genetics 230, 394–400. Sachs, M.M. and Ho, T.-H.D. (1986) Alteration of gene expression during environmental stress in plants. Annual Review of Plant Physiology 37, 363–376. Schulze-Lefert, P., Becker-Andre, M., Schulz, W., Hahlbrock, K. and Dangl, J.L. (1989a) Functional architecture of the light-responsive chalcone synthase promoter from parsley. Plant Cell 1, 707–714. Shen, Q. and Ho, T.-H.D. (1995) Functional dissection of an abscisic acid (ABA)-inducible gene reveals two independent ABA-responsive complexes each containing a G-box and a novel cis-acting element. Plant Cell 7, 295–307. Shen, Q., Uknes, S.J. and Ho, T.-H.D. (1993) Hormone response complex of a novel abscisic acid and cycloheximide inducible barley gene. Journal of Biological Chemistry 268, 23652–23660. Shen, Q., Zhang, P. and Ho, T.-H.D. (1996a) Modular nature of abscisic acid (ABA) response complexes: composite promoter units which are necessary and sufficient for ABA induction of gene expression in barley. Plant Cell 8, 1107–1119. Shinozaki, K. and Shinozaki-Yamaguchi, K. (1997) Gene expression and signal transduction in water-stress response. Plant Physiology 115, 327–334. Shinozaki, K. and Yamaguchi, S.K. (1996) Molecular responses to drought and cold stress. Current Opinion in Biotechnology 7, 161–167. Showalter, A.M. and Varner, J.E. (1989) Plant hydroxyproline-rich proteins. In: Marcus, A. (ed) The Biochemistry of Plants. Academic Press, Inc., pp. 484–520. Skriver, K. and Mundy, J. (1990) Gene expression in response to abscisic acid and osmotic stress. Plant Cell 2, 503–512. Skriver, K., Olsen, F.L., Rogers, J.C. and Mundy, J. (1991) Cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid. Proceedings of the National Academy of Sciences USA 88, 7266–7270. Straub, P.F., Shen, Q. and Ho, T.-H.D. (1994). Structure and promoter analysis of an ABAand stress-regulated barley gene, HVA1. Plant Molecular Biology 26, 617–630. Strizhov, N., Abraham, E., Okresz, L., Blickling, S., Zilberstein, A., Schell, J., Koncz, C. and Szabados, L. (1997) Differential expression of two P5CS genes controlling proline accumulation during salt-stress requires ABA and is regulated by ABA1, ABI1 and AXR2 in Arabidopsis. Plant Journal 12, 557–569.

10 Inducible Gene 10

218

3/16/99 11:21 AM

Page 218

Q. Shen and T.-H.D. Ho

Su, J., Shen, Q., Ho, T.-H.D. and Wu, R. (1998) Dehydration-stress-regulated transgene expression in stably transformed rice plants. Plant Physiology 117, 913–922. Tarczynski, M.C., Jensen, R.G. and Bohnert, H.J. (1993) Stress protection of transgenic tobacco by production of the osmolyte mannitol. Science 259, 508–510. Velasco, R., Salamini, F. and Bartels, D. (1994) Dehydration and ABA increase mRNA levels and enzyme activity of cytosolic GAPDH in the resurrection plant Craterostigma plantagineum. Plant Molecular Biology 26, 541–546. Vilardell, J., Goday, A., Freire, M.A., Torrent, M., Martínez, M.C., Torné, J.M. and Pagès, M. (1990) Gene sequence, developmental expression, and protein phosphorylation of RAB-17 in maize. Plant Molecular Biology 14, 423–432. Williams, J., Bulman, M., Huttly, A., Phillips, A. and Neill, S. (1994) Characterization of a cDNA from Arabidopsis thaliana encoding a potential thiol protease whose expression is induced independently by wilting and abscisic acid. Plant Molecular Biology 25, 259–270. Wu, Y., Kuzma, J., Marechal, E., Graeff, R., Lee, H.C., Foster, R. and Chua, N.-H. (1997) Abscisic acid signaling through cyclic ADP-ribose in plants. Science 278, 2126–2130. Xu, D., Duan, X., Wang, B., Hong, B., Ho, T.-H.D. and Wu, R. (1996) Expression of a late embryogenesis abundant protein gene, HVA1, from barley confers tolerance to water deficit and salt stress in transgenic rice. Plant Physiology 110, 249–257. Zeevaart, J.A.D. and Creelmann, R.A. (1988) Metabolism and physiology of abscisic acid. Annual Review of Plant Physiology and Plant Molecular Biology 39, 439–473.

11 Inducible Gene 11

3/16/99 11:24 AM

Page 219

Potential Use of Hormoneresponsive Elements to Control Gene Expression in Plants

11

Tom J. Guilfoyle and Gretchen Hagen University of Missouri, Department of Biochemistry, 117 Schweitzer Hall, Columbia, MO 62511, USA

INTRODUCTION Hormone-response elements (HREs) are minimal DNA sequence motifs that confer hormone responsiveness to a promoter. Over the last few years, a number of plant hormone-responsive promoters have been examined at the fine structure level, and these studies have defined minimal HREs for several plant hormones, including auxin (reviewed by Guilfoyle, 1997). Understanding how plant HREs function in terms of their minimal structures and identification of transcription factors that interact with HREs can give insight into the mechanisms of hormone-regulated gene expression and hormone action. This information can also provide a framework for engineering novel cis elements and trans factors that may function in ways which differ from natural HREs. In this chapter, we discuss several different types of auxin-response elements (AuxREs), including the octopine synthase (ocs) or activator sequence-1 (as-1) element, natural composite AuxREs containing TGTCTC elements, synthetic composite AuxREs, and synthetic TGTCTC AuxREs that function without a coupling element. We also briefly discuss the identification of trans factors that interact with these AuxREs. We do not attempt to discuss all types of auxinresponsive promoters or putative AuxREs because in most cases, the AuxREs have not been precisely mapped or functionally tested. We have restricted our discussion to two types of AuxREs, the ocs or as-1 elements and TGTCTC elements, that have been delimited to minimal sequences and tested for functionality in vivo.

© CAB International 1999. Inducible Gene Expression (ed. P.H.S. Reynolds)

219

11 Inducible Gene 11

3/16/99 11:24 AM

220

Page 220

T.J. Guilfoyle and G. Hagen

THE ocs/as-1 AuxRE The ocs element was originally identified as an enhancer element in the promoter of the Agrobacterium tumefaciens octopine synthase gene which is transferred to plant cells via the T-DNA (Ellis et al., 1987). Functional ocs elements were subsequently identified in other opine synthase genes (e.g. nopaline synthase and mannopine synthase) from A. tumefaciens T-DNAs and in the 275 region of the cauliflower mosaic virus (CaMV) 35S promoter (Bouchez et al., 1989; Fromm et al., 1989; Gatz et al., 1991; Leung et al., 1991; Fox et al., 1992; Kononowicz et al., 1992; Kim et al., 1993, 1994). In CaMV, this element is referred to as as-1 (Lam et al., 1989), and we refer to this family of enhancer elements as ocs/as-1. DNA sequences similar to the ocs/as-1 element are found also in the promoters of figwort mosaic virus (Cooke, 1990; Sanger et al., 1990), commelina yellow mottle virus (Medberry et al., 1992) and cassava vein mosaic virus (Verdaquer et al., 1996). The ocs/as-1 element within opine synthase and DNA-virus promoters has been reported to be activated by exogenous auxin application to plant cells and tissues (Langridge et al., 1989; An et al., 1990; Leung et al., 1991; Kim et al., 1994; Liu and Lam, 1994; Zhang and Singh, 1994). More recently, a soybean glutathione S-transferase (GST) gene, Gmhsp26-A (also referred to as GH2/4; Czarnecka et al., 1988; Hagen et al., 1988; Ulmasov et al., 1995a) and a tobacco GST gene, NT103 (Droog et al., 1995) have been shown to contain functional ocs/as-1 elements (Ellis et al., 1993; Ulmasov et al., 1994; van der Zaal et al., 1996). While ocs/as-1 elements within plant GST gene promoters have been functionally tested in only a few cases, this element appears to be a common feature in promoters of Type III GST genes (Marrs, 1996), which respond to exogenous auxins and a variety of other hormones, chemical agents (e.g. heavy metals, hydrogen peroxide, electrophiles), pathogens and wounding (Czarnecka et al., 1988; Hagen et al., 1988; Taylor et al., 1990; Takahashi et al., 1991; van der Zaal et al., 1991; Hahn and Strittmatter, 1994; Droog et al., 1995; Gough et al., 1995; Ulmasov et al., 1995a; Kusaba et al., 1996; van der Kop et al., 1996; Xiang et al., 1996; Marrs and Walbot, 1997). The ocs/as-1 element is a 20-bp DNA sequence that consists of a direct repeat separated by 4 bp, with the consensus sequence TGACGTAAGCGCTGACGTAA (Fig. 11.1). Functional ocs/as-1 elements do not generally contain a perfect consensus sequence, but instead contain variations of this element with exact spacing (i.e. 4 bp) separating the direct repeats. The spacing between the direct repeats has been shown to be crucial for ocs/as-1 element activity (Bouchez et al., 1989; Singh et al., 1989). The ocs/as-1 element contains tandem binding sites that resemble the cyclic AMP responsive element or CRE (i.e. consensus sequence TGACGTCA) found in mammalian genes (Roesler et al., 1988). The two binding sites in the ocs/as-1 element are functionally identical (Bouchez et al., 1989; Tokuhisa et al., 1990) and both binding sites must be occupied for ocs/as-1 element activity (Bouchez et al., 1989; Singh et al., 1989). Mutations in one of the two binding sites results in loss of ocs/as-1 element function. DNA-binding

11 Inducible Gene 11

3/16/99 11:24 AM

Page 221

Potential Use of Hormone-responsive Elements

221

Fig. 11.1. The ocs/as-1 and ocs/as-1-like elements in plant pathogen and GST gene promoters. A consensus or perfect ocs/as-1 element is shown above the naturally occurring ocs/as-1 elements from the octopine synthase (ocs) and nopaline synthase (nos) promoter in the T-DNA of Agrobacterium tumefaciens, 35S promoter (as-1) of cauliflower mosaic virus and promoters from plant class III GST genes from soybean (Gmhsp26A/GH2/4) and tobacco (Nt103-1, Nt103-35 and parA). For comparison, tandem AP-1 sites that regulate expression of the mouse GST-Ya gene promoter are shown at the bottom. Positions of the DNA elements relative to the transcription start sites are shown in parentheses.

proteins that interact with the ocs/as-1 element have been identified in plant nuclear extracts (Lam et al., 1989; Prat et al., 1989; Tokuhisa et al., 1990), and several basic region leucine zipper (bZIP) transcription factors that bind the ocs/as-1 element have been cloned from a variety of plants (Katagiri et al., 1989; Singh et al., 1990; Tabata et al., 1991; Ehrlich et al., 1992; Foley et al., 1993; Zhang et al., 1993; Miao et al., 1994; Lam and Lam, 1995). Transgenic tobacco plants that contain GUS reporter genes driven by natural promoters containing ocs/as-1 elements or synthetic promoters containing the ocs/as-1 element fused to a minimal promoter display specific patterns of GUS gene expression. In these transgenic tobacco seedlings, the highest level of GUS resporter gene expression is generally localized to the root tip (Benfey et al., 1989; Fromm et al., 1989; van der Zaal et al., 1991; Kononowicz et al., 1992; Niwa et al., 1994; Ulmasov et al., 1995a). Mutations in ocs/as-1 element can lead to altered patterns of gene expression (Lam et al., 1990). Ocs/as-l elements from CaMV, opine synthase and plant Class III GST promoters have been shown to be responsive to exogenous applications of auxins, salicylic acid (SA), and/or methyljasmonic acid (mJA) (Kim et al., 1993, 1994; Liu and Lam, 1994; Qin et al., 1994; Ulmasov et al., 1994; Zhang and Singh, 1994; Xiang et al., 1996). The ocs/as-1 elements from the soybean

11 Inducible Gene 11

222

3/16/99 11:24 AM

Page 222

T.J. Guilfoyle and G. Hagen

Gmhsp26-A and tobacco Nt103 genes have been reported to be equally responsive to both biologically active (e.g. indole acetic acid (IAA), αnaphthaleneacetic acid (a-NAA), (2,4-dichlorophenoxy) acetic acid (2,4-D), (2,4,5-trichlorophenoxy) acetic acid (2,4,5-T)) and biologically inactive or weak auxin analogues (e.g. 2,3-D, 2,4,6-T, β-NAA) as well as biologically active SA and biologically inactive SA analogues (e.g. 3-hydroxybenzoate) (Ulmasov et al., 1994; Droog et al., 1995; Xiang et al., 1996). These latter results suggest that the ocs/as-1 element may respond to signal transduction pathways that are activated by cellular stress (i.e. oxidative stress) induced by high levels of hormones or electrophilic agents as opposed to signal transduction pathways that respond only to biologically active hormones such as auxin, SA or mJA (discussed by Ulmasov et al., 1994; Zhang and Singh, 1994). In this respect, the ocs/as-1 element has some similarities to tandem AP-1 sites (Fig. 11.1) found within inducible promoters of animal cells (Ney et al., 1990; Okuda et al., 1990), including animal GST promoters that respond to oxidative stress (Friling et al., 1992; Daniel, 1993). Plant ocs/as-1 sites are like AP-1 sites in some animal GST promoters in that two tandem DNA-binding sites are required for promoter activity. Furthermore, those cloned plant transcription factors that bind to ocs/as-1 elements in vitro are bZIPs with similarity to Fos and Jun bZIP transcription factors (i.e. Fos, Jun) that bind to AP1 sites in some animal GST promoters (Diccianni et al., 1992; Daniel, 1993) and Yap1 and Yap2 bZIP transcription factors that bind to AP1 sites in some stress-responsive genes in yeast cells (Hirata et al., 1994; Ruis and Schuller, 1995).

NATURAL COMPOSITE AuxREs Auxin-responsive genes, such as soybean GH3, SAURs, Aux22 and Aux28 and pea PSIAA4/5 and PSIAA6, are activated specifically by biologically active auxins and not by other agents (Walker and Key, 1982; Hagen et al., 1984; Hagen and Guilfoyle, 1985; Theologis et al., 1985; Walker et al., 1985; McClure and Guilfoyle, 1987). The promoters in these genes contain no apparent ocs/as-1 element. Instead, these promoters contain one or more copies of a conserved element, TGTCTC, or some variation of this element (e.g. TGTCCC, TGTCAC) within small promoter-regions that confer auxin responsiveness (Hagen et al., 1991; Ballas et al., 1993, 1995; Li et al., 1994; Liu et al., 1994; Ulmasov et al., 1995b). Fine structure mapping of the AuxREs in the soybean GH3 promoter revealed that TGTCTC elements were critical for AuxRE function (Liu et al., 1994; Ulmasov et al., 1995b). The GH3 promoter contains three AuxREs that can function independently of one another, and each of these AuxREs, designated E1, D1 and D4, contributed to the overall activity and auxininducibility of the GH3 promoter and to the tissue- and organ-specific expression patterns of the GH3 gene. A diagram of the AuxREs in the GH3 promoter is shown in Fig. 11.2. Ulmasov et al. (1995b) showed that the

11 Inducible Gene 11

3/16/99 11:24 AM

Page 223

Potential Use of Hormone-responsive Elements

223

Fig. 11.2. Diagram of the soybean GH3 promoter and its composite AuxREs. A 300 bp GH3 promoter is shown with relative positions of three AuxREs: E1; D1; and D4. The D1 and D4 composite AuxREs contain a TGTCTC element (arrows). The E1 AuxRE contains a TGA box or G box that overlaps with a TGTCNC element (arrow showing inverse orientation). The transcription start site is indicated by an arrow at the top. Boxed sequences include TGA box or G box in E1 and functionally defined constitutive or coupling elements in D1 and D4.

sequence TGTCTC in the D1 and D4 AuxREs of the GH3 promoter confers auxin responsiveness when coupled to a closely associated constitutive element. These coupled elements are referred to as composite AuxREs. Composite AuxREs are defined as two adjacent or overlapping elements, a constitutive element and a TGTCTC element, that work in combination to confer auxin responsiveness to a promoter. A constitutive element is defined as an element that confers constitutive expression to a minimal promoter (i.e. 246 CaMV 35S RNA promoter)-GUS reporter gene in transfected protoplasts. The E1 AuxRE in the GH3 promoter has not been mapped in fine structure, but contains a G box binding site overlapping an inverted TGTCTC element that may function as a composite AuxRE (Liu et al., 1994, 1997). Ulmasov et al. (1995b) have pointed out that composite AuxREs share some similarities with composite HREs found in animal steroid-responsive genes (Yamamoto et al., 1992). The composite nature of the D1 and D4 AuxREs in the GH3 promoter is shown in Fig. 11.3. The D1 composite AuxRE is an 11 bp element (Ulmasov et al., 1995a). A multimerized D1 construct (D1-4) fused to a minimal promoterGUS reporter gene is induced about sixfold by auxin in transient assays with carrot protoplasts (Fig. 11.3). Mutations in the 3′ half of the TGTCTC (D1-3 and D1-5 constructs) result in loss of auxin responsiveness and a gain in constitutive expression, while a mutation 5′ to the TGTCTC element (D1-6) results in loss of promoter activity. These results along with other results (Ulmasov et al., 1994) indicate that in the D1 AuxRE, the TGTCTC represses constitutive expression and is required but not sufficient for auxin responsiveness. Constitutive expression is conferred by sequences upstream and including the 5′ region of the TGTCTC element (compare D1-1 construct with D1-3 and D1-5). Thus, the D1 AuxRE contains a constitutive element that overlaps with TGTCTC element.

11 Inducible Gene 11

224

3/16/99 11:24 AM

Page 224

T.J. Guilfoyle and G. Hagen

Fig. 11.3. Composite nature of TGTCTC AuxREs. The D1 and D4 series of constructs were derived from minimal AuxREs within the GH3 promoter. The synthetic series of constructs (G4) contained a yeast GAL4 DNA-binding site fused or not fused to a TGTCTC element. The TGTCTC element is underlined in the unmutated element in each series of constructs. Mutant nucleotides are shown in lower case letters. Each construct was fused as 3 (3X) or 4 (4X) tandem repeats to a minimal 246 CaMV 35S promoter-GUS reporter gene. Constructs were tested using transient assays in carrot protoplasts that were treated or not treated with the synthetic auxin, α-NAA. With the synthetic series of constructs, an effector plasmid encoding a transcription factor with a yeast GAL4 DNA-binding domain (i.e. recognizes the GAL4 DNA-binding sites) and a chicken cREL activation domain was cotransfected with the GUS reporter gene containing GAL4 DNA-binding sites. Details can be found in Ulmasov et al. (1995b).

A multimerized D4 construct (D4-6) fused to a minimal promoter-GUS reporter gene is induced about fivefold by auxin in transient assays with carrot protoplasts (Fig. 11.3). In contrast to the D1 AuxRE, the D4 composite AuxRE contains a constitutive element (construct D4-4) separated by 4 bp from the TGTCTC element. Like the D1 AuxRE, the D4 AuxRE requires a TGTCTC element for auxin responsiveness (construct D4-7), but this is not sufficient for auxin inducibility (constructs D4-8 and D4-2). Results summarized in Fig. 11.3 show that with both D1 and D4 composite AuxREs, the TGTCTC element represses the constitutive element when auxin levels are low, and the composite element is derepressed and activated when auxin levels are high. Because the TGTCTC element is not sufficient to confer auxin responsiveness to a minimal promoter, the mere presence of a TGTCTC or related element

11 Inducible Gene 11

3/16/99 11:24 AM

Page 225

Potential Use of Hormone-responsive Elements

225

in a promoter is not adequate criteria to define an AuxRE. TGTCTC elements that confer auxin responsiveness can only be identified by functional tests. Sitespecific mutations within the TGTCTC element indicate that the first four nucleotides, TGTC (nucleotide positions 1 to 4), are critically important for AuxRE function (Ulmasov et al., 1995b, 1997). While some substitutions in the last two nucleotides (nucleotide positions 5 and 6) of the TGTCTC element are tolerated, nucleotides 5 and 6 are, nevertheless, important for AuxRE activity (Ulmasov et al., 1997). The organization of AuxREs as composite elements provides a means of obtaining diverse patterns of gene expression with a single hormonal signal. Coupling or constitutive elements that function in composite elements may control the tissue and organ, developmental, and/or temporal specificity of hormone-induced expression for a particular gene. When multiple composite elements with different coupling elements are present in a promoter, the patterns of expression may become concerted or synergistic and, thus, more complex. Results that support this prediction come from observations on expression patterns displayed by the GH3 promoter-GUS reporter gene and each of the three GH3 AuxRE-minimal promoter-GUS reporter genes in transgenic tobacco or Arabidopsis plants (Hagen et al., 1991; Liu et al., 1994; Ulmasov et al., 1995b; Liu et al., 1997; Z.-B. Liu, 1995, unpublished results). D1, D4 and E1 GUS reporter genes showed distinct patterns of gene expression, while the full length (i.e. 592 bp) GH3 promoter construct displayed a wider range of expression patterns than individual AuxREs. Natural composite HREs have also been found in the promoters of abscisic acid-(ABA) and gibberellic acid-(GA) responsive genes. Shen and Ho (1995) and Shen et al. (1996) showed that a barley ABA-responsive promoter contained two modules of ABA response elements (ABREs). These each contained a G-box element and a coupling element that was situated near the G box. Both elements were required to confer ABA responsiveness to a minimal promoter-GUS reporter gene. Rogers and Rogers (1992) and Rogers et al. (1994) showed that a conserved GA response element (GARE) found in promoters of barley GAresponsive α-amylase genes required a nearby coupling element to function. Interestingly, Rogers and Rogers (1992) found that substitution of a G-box ABRE for the GARE in a barley α-amylase gene changed the HRE from GA-responsive to ABA-responsive. This latter result shows the versatility of a two element system and suggests that identical coupling elements might function with elements that confer ABA, GA and possibly other hormone responsiveness. It is likely that many inducible plant promoters contain composite response elements with one or more elements being specific for a given inducer (Guilfoyle, 1997).

SYNTHETIC COMPOSITE AuxREs To determine if the TGTCTC element could confer auxin responsiveness when paired with constitutive elements that were not resident in natural composite

11 Inducible Gene 11

226

3/16/99 11:24 AM

Page 226

T.J. Guilfoyle and G. Hagen

AuxREs, Ulmasov et al. (1995b and unpublished results) constructed two synthetic composite AuxREs. One of these constructs consisted of chicken c-Rel DNA-binding sites fused or not fused to TGTCTC. In the absence of the TGTCTC element, the c-Rel construct conferred constitutive expression to a minimal 246 CaMV 35S RNA promoter-GUS reporter gene when transfected in carrot suspension culture protoplasts, indicating that these protoplasts possessed an endogenous transcriptional activator that recognized the cRel DNA-binding sites. This constitutive expression was repressed when a TGTCTC element was placed immediately downstream of the c-Rel DNA-binding sites. Addition of auxin relieved this repression and resulted in activation (i.e. 12-fold auxin inducible; T. Ulmasov, unpublished results). A second GUS reporter construct contained yeast GAL4 DNA-binding sites fused or not fused to TGTCTC that were located upstream of a 246 CaMV 35S promoter (Fig. 11.3; Ulmasov et al., 1995b). These reporter constructs displayed no activity in protoplasts from suspension culture cells in the absence of a cotransfected transactivator that recognized the GAL4 DNA-binding sites. In the presence of a GAL4-cRel transactivator, the construct containing just GAL4 DNA-binding sites was constitutively expressed (Fig. 11.3; construct G4M), while the construct containing the fused TGTCTC sites was repressed in the absence of auxin and specifically induced when auxin was added to the protoplasts (construct G4T). The composite nature of this synthetic construct was verified by mutating the GAL4 DNA-binding site (construct mG4T). These results indicated that an array of composite AuxREs could be created by joining different types of constitutive or coupling elements with the TGTCTC element and suggested that the TGTCTC element might function as a global AuxRE within plant genomes. A wide variety of constitutive or coupling elements might function with TGTCTC, even foreign elements, when transactivators that recognize the coupling element and the TGTCTC element are present in plant cells.

SYNTHETIC SIMPLE AuxREs While natural AuxREs within promoters of genes that specifically respond to auxin may generally consist of composite elements, the question remained open whether TGTCTC and related elements might function as AuxREs in the absence of a coupling element if multimerized and properly organized. To test this possibility, Ulmasov et al. (1997a, b) constructed a number of direct tandem repeats and palindromic repeats of the TGTCTC element. A D1-4m construct was created by carrying out site-directed mutations in the constitutive portion of the natural 11 bp D1-4 composite AuxRE (Fig. 11.4). The multimerized (i.e. six or seven tandem direct repeats of 11 bp) D1-4m synthetic AuxRE was found to have several-fold greater activity and auxin inducibility (i.e. 30- to 50-fold) in transient assays with carrot protoplasts than the multimerized, natural D1-4 AuxRE (i.e. sixfold auxin inducible) or the 592 bp GH3 promoter itself (i.e.

11 Inducible Gene 11

3/16/99 11:24 AM

Page 227

Potential Use of Hormone-responsive Elements

227

Fig. 11.4. Simple TGTCTC AuxREs. The D series of constructs compares the natural D1-4 AuxRE with a mutant D1-4m AuxRE that appears to have no coupling element and functions as a simple AuxRE when multimerized. The P/ER series of constructs represent palindroXmic simple AuxREs containing alternating inverted (P3 or IR) and everted (ER) repeats. The P3(4X) construct contains 4 IRs and 3 ERs. P3(1X) represents one copy of the IR, ER7(1X) represents one copy of the ER in the P3(4X) construct. Nucleotide substitutions in mutant constructs (m) are shown in small case letters. Spacing distances between ER constructs are shown as ER0 through ER9. Constructs were tested using transient assays in carrot protoplasts that were treated or not treated with the synthetic auxin, α-NAA. Details can be found in Ulmasov et al. (1997).

13- to 16-fold auxin inducible; Liu et al., 1994; Ulmasov et al., 1997a). Furthermore, the D1-4m construct contained no apparent constitutive element, based upon tests with site-specific mutations in the TGTCTC element. In transgenic Arabidopsis plants, auxin activated the multimerized D1-4m construct by up to 50-fold in various plant organs and tissues, whereas a multimerized natural D1-4 construct was only five- to tenfold inducible with auxin (Ulmasov et al., 1997b). Another construct, P3(4X), consisting of four palindromic repeats of the TGTCTC element, was also found to be strongly induced by auxin in transient assays (i.e. >30-fold) (Fig. 11.4; Ulmasov et al., 1997a). Analysis of single copy

11 Inducible Gene 11

228

3/16/99 11:24 AM

Page 228

T.J. Guilfoyle and G. Hagen

palindromic constructs indicated that orientation and spacing of TGTCTC elements was important for auxin responsiveness. For example, while an inverted repeat (construct P3(1X)), showed no auxin responsiveness, an everted repeat (construct ER7(1X)) was auxin-responsive. Spacing between half-sites (constructs ER0 to ER9) and maintenance of the TGTCTC element within half-sites (constructs mP3(4X) and mER7(1X)) were found to be crucial for AuxRE function, with 7–8 nucleotides being the optimal spacing between half-sites. TGTCTC AuxREs that have been defined at the fine structure level (e.g. in the GH3 promoter) function as composite elements, and direct repeats or palindromic TGTCTC AuxREs may not be common in natural promoters. However, a database search for palindromic TGTCTC elements within auxinresponsive promoters revealed a possible candidate within the pea PS-IAA4/5 promoter (Ulmasov et al., 1997a). An everted repeat with a spacing of nine nucleotides, TGTCACccctataagGAGACA, was identified in an auxin-responsive region of the pea promoter (Ballas et al., 1993, 1995), and this was shown to function as an AuxRE in carrot protoplast transient assays (Ulmasov et al., 1997a). Results reported by Ballas et al. (1995) showed that a second element (i.e. TGTCCCat), located only 3 bp upstream of the palindromic element, within this auxin-responsive region of the PS-IAA4/5 promoter functioned as an AuxRE if the TGTCCCat was multimerized as tandem repeats. In this case, 12 tandem repeats of a TGTCCCat sequence were fused to a minimal PS-IAA4/5 (292 to +1)-CAT reporter gene and assayed in pea protoplasts. The activity and auxin responsiveness of this TGTCCCat construct was several-fold less, however, than the natural PS-IAA4/5 promoter construct. The natural PS-IAA4/5 promoter may use all three of these closely spaced TGTCNC elements as AuxREs that function as direct or palindromic repeats with or without coupling elements. Taken together, studies on repeats of the TGTCTC element (or TGTCNC) indicate that if properly multimerized and spaced, the TGTCTC element confers auxin inducibility in the absence of any obvious constitutive or coupling element. Thus, the TGTCTC element itself appears to be a minimal AuxRE, and these simple AuxREs resemble simple HREs described in animal steroid-responsive genes (Yamamoto et al., 1992). Ulmasov et al. (1997a) used the synthetic highly active palindromic TGTCTC AuxRE, P3(4X) as bait in a yeast one-hybrid screen to isolate a novel transcription factor that binds with specificity to TGTCTC AuxREs. This transcription factor is referred to as auxin response factor 1 or ARF1. ARF1 contains a novel N-terminal DNA-binding domain (i.e. this domain binds with specificity to TGTCNC sites) related to the C-terminal conserved region (referred to as the B3 region; Suzuki et al., 1997) found in ABA-type transactivators, viviparous-1 (VP1) and ABI3 (McCarty et al., 1991; Giraudat et al., 1992) and a C-terminal domain related to domains III and IV found in the Aux/IAA class of proteins (Ainley et al., 1988; Conner et al., 1990; Oeller et al., 1993; Abel et al., 1995). The binding characteristics of ARF1 to TGTCTC elements in vitro is perfectly correlated with the spacing and nucleotide composition requirements

11 Inducible Gene 11

3/16/99 11:24 AM

Page 229

Potential Use of Hormone-responsive Elements

229

for TGTCTC elements to function as AuxREs in vivo. A number of proteins related to ARF1 have been identified that show the same DNA-binding specificity as ARF1 (Ulmasov et al., 1997a; T. Ulmasov, unpublished results), suggesting that a complex set of proteins may interact on TGTCTC AuxREs.

USING HORMONE-RESPONSIVE PROMOTERS TO CONTROL GENE EXPRESSION Studies on the AuxREs discussed above, as well as studies on other plant HREs, suggest possible strategies for controlling gene expression with hormones and/or other chemical agents. Novel approaches to regulating the expression of selected genes might be achieved by taking advantage of the promoters containing the ocs/as-1 element or composite AuxREs and other composite plant HREs. Natural promoters that contain functional ocs/as-1 elements or ocs/as-1 elements fused to minimal promoters can be used to drive expression of heterologous genes by induction with a wide variety of agents. The natural Gmhsp26-A/GH2/4 gene is induced by heat-shock, arsenite, cadmium chloride, silver nitrate, copper chloride, sodium fluoride, potassium chloride, canavanine, polyethylene glycol, ABA, 2,4-D, 2,4,5-T, α-NAA, IAA, benzoic acid, cyclohexylacetic acid and kinetin (Czarnecka et al., 1984, 1988; Hagen et al., 1984, 1988; Hagen and Guilfoyle, 1985). A Gmhsp26-A/GH2/4-GUS reporter gene is induced by heat-shock, wounding, cadmium chloride, silver nitrate, iron sulphate, hydrogen peroxide, glutathione, dithiothreitol, cysteine, sodium fluoride, sodium chloride, 2,4-D, 2,3-D, 2,4,5-T, 2,4,6-T, α-NAA, β-NAA, IAA, SA, ABA, benzyladenine and mJA (Ulmasov et al., 1995a). A tobacco Nt103 promoter-GUS reporter gene is induced by 2,4-D, 2,3-D, 2,5-D, 2,6-D, 3,4-D, 3,5-D, α-NAA, β-NAA and SA (van der Zaal et al., 1996). Ocs/as-1 elements fused to minimal promoter-GUS reporter genes have been reported to be induced by most of the biologically active auxins and inactive auxin analogues mentioned above in transient assays with carrot protoplasts (Ulmasov et al., 1994) or in assays with transgenic lines of tobacco BY-2 suspension culture cells (van der Zaal et al., 1996). Taken together, the above results indicate that a number of biologically inactive chemical inducers could be used to control expression of selected genes containing promoters with ocs/as-1 elements. Biologically inactive auxin analogues like 2,3-D produce none of the growth responses elicited by biologically active auxins (e.g. 2,4-D, 2,4,5-T, α-NAA), but are about as effective as auxins in activating promoters containing at least some ocs/as-1 elements (Ulmasov et al., 1994, 1995a; van der Zaal et al., 1996). Biologically inactive auxin analogues over a concentration range of 1–1000 µM can activate these promoters 10- to 100-fold above basal activities in most organs and tissues. A variety of other electrophilic agents that lack biological activity might prove to be as effective or more effective than biologically inactive auxins

11 Inducible Gene 11

230

3/16/99 11:24 AM

Page 230

T.J. Guilfoyle and G. Hagen

in activating the ocs/as-1 element. It may be possible to design promoters with greater levels of inducibility by multimerizing the ocs/as-1 element or combining specific enhancer elements or coupling elements (Zhang et al., 1995) with the ocs/as-1 element. A potential negative aspect of using the ocs/as-1 element to control transcription of selected genes is that this element is responsive to wounding and most likely is responsive to internal perturbations in hormone levels (e.g. IAA, SA, mJA) and might also be responsive to a variety of other chemicals found in plant cells, including hydrogen peroxide, electrophiles, salts and reducing agents. Except in the case of wounding, however, it is unlikely that changes in endogenous hormone or other chemical concentrations are generally great enough to cause significant activation of the ocs/as-1 element in plants. High levels of basal expression in root tips for genes containing ocs/as-1 elements might result from extraordinarily high concentrations of one or more hormones and other inducing agents within this organ region. In combination with other cis elements, the ocs/as-1 element might be induced by either a wider or narrower spectrum of hormones and nonhormonal chemical agents. By building synthetic promoters containing specific cis elements along with the ocs/as-1 element, it might be possible to achieve that particular expression pattern and inducibility desired. The nucleotide composition of the ocs/as-1 element and surrounding nucleotides might also impact on the expression patterns. In the case with promoters that respond specifically to auxins, the control of gene expression is obviously much more restricted to the type of inducing agent employed. Because plants typically respond to exogenous auxin by undergoing abnormal growth and developmental processes, it would be difficult to use auxin-specific promoters to control gene expression by auxin application to plants. However, by manipulating AuxREs so that they respond in different ways to internal auxin concentrations, altered patterns of gene expression that have a beneficial effect on plant growth or development might be achievable. Higher levels of auxin-induced expression of auxin-responsive genes might be achieved by multimerizing their natural AuxREs. This has already been achieved with a subfragment of the GH3 promoter (J. Murfett, 1997, Columbia, Missouri, USA, unpublished results). In this case, a second copy of the D0 region of the GH3 promoter (see Fig. 11.2) was fused immediately upstream of the D0 element in the 2180 promoter/5′ UTR-GUS reporter gene (Liu et al., 1994). This promoter construct containing a tandem direct repeat of the D0 element was tested in transgenic Arabidopsis plants and found to have greater promoter activity and higher auxin inducibility than the natural GH3 promoter (J. Murfett, 1997, Columbia, Missouri, USA, unpublished results). Such constructs might also reduce the threshold level of auxin required to achieve a significant amount of gene expression. It may be possible to manipulate promoters with composite AuxREs so that genes will be regulated by auxins in unique tissue-specific, organ-specific or

11 Inducible Gene 11

3/16/99 11:24 AM

Page 231

Potential Use of Hormone-responsive Elements

231

developmentally specific manners. One possible way to modify expression of auxin-responsive genes is to delete, add or exchange natural composite AuxRE modules among different auxin-responsive or non-responsive promoters. Another possible means of creating novel auxin-responsive genes is to fuse TGTCTC elements with one or more tissue-, organ- or developmentally specific cis-acting elements that are not naturally under auxin control. Exchanging the TGTCTC in composite AuxREs for a G-box ABRE or a GARE might result in novel ABA- or GA-responsive genes. Modification of transcription factors that interact with AuxREs also provide a possible target for manipulating hormone-responsive gene expression. Because these transcription factors (i.e. bZIP proteins that bind ocs/as-1 elements and ARF proteins that bind TGTCTC elements) are modular with distinct DNA-binding, activation/repression and possibly protein–protein interaction domains, swapping domains among transcription factors and amino acid substitutions within domains may create transcription factors that regulate genes in novel ways. It may also be possible to modify hormoneresponsive gene expression by overexpressing these transcription factors in a constitutive or tissue/developmental-specific manner or by knocking out their expression (i.e. using antisense or gene disruption approaches).

REFERENCES Abel, S., Nguyen, M.D. and Theologis, A. (1995) The PS-IAA4/5-like family of early auxin-inducible mRNAs in Arabidopsis thaliana. Journal of Molecular Biology 251, 533–549. Ainley, W.M., Walker, J.C., Nagao, R.T. and Key, J.L. (1988) Sequence and characterization of two auxin-regulated genes from soybean. The Journal of Biological Chemistry 263, 10658–10666. An, G., Costa, M.A. and Ha, S.-B. (1990) Nopaline synthase promoter is wound inducible and auxin inducible. The Plant Cell 2, 225–233. Ballas, N., Wong, L.-M. and Theologis, A. (1993) Identification of the auxin-responsive element, AuxRE, in the primary indoleacetic acid-inducible gene, PS-IAA4/5, of pea (Pisum sativum). Journal of Molecular Biology 233, 580–596. Ballas, N., Wong, L.-M., Malcolm, K. and Theologis, A. (1995) Two auxin-responsive domains interact positively to induce expression of the early indoleacetic acidinducible gene PS-IAA4/5. Proceedings of the National Academy of Sciences USA 86, 3483–3487. Benfey, P.N., Ren, L. and Chua, N.-H. (1989) The CaMV 35S enhancer contains at least two domains which can confer different developmental and tissue-specific expression patterns. The EMBO Journal 8, 2195–2202. Bouchez, D., Tokuhisa, J.G., Llewellyln, D.J., Dennis, E.S. and Ellis, J.G. (1989) The ocselement is a component of the promoters of several T-DNA and plant viral genes. The EMBO Journal 8, 4199–4204. Conner, T.W., Goekjian, V.L., LaFayette, P.R. and Key, J.L. (1990) Structure and expression of two auxin-inducible genes from Arabidopsis. Plant Molecular Biology 15, 623–632.

11 Inducible Gene 11

232

3/16/99 11:24 AM

Page 232

T.J. Guilfoyle and G. Hagen

Cooke, R. (1990) The figwort mosaic virus gene VI promoter region contains a sequence highly homologous to the octopine synthase (ocs) enhancer element. Plant Molecular Biology 15, 181–182. Czarnecka, E., Edelman, L., Schoffl, F. and Key, J.L. (1984) Comparative analysis of physical stress responses in soybean seedlings using cloned heat shock cDNAs. Plant Molecular Biology 3, 45–58. Czarnecka, E., Nagao, R.T., Key, J.L. and Gurley, W.B. (1988) Characterization of Gmhsp26-A, a stress gene encoding a divergent heat shock protein of soybean: heavy-metal-induced inhibition of intron processing. Molecular and Cellular Biology 8, 1113–1122. Daniel, V. (1993) Glutathione S-transferases: gene structure and regulation of expression. CRC Critical Reviews in Biochemistry and Molecular Biology 28, 173–207. Diccianni, M.B., Imagawa, M. and Muramatsu, M. (1992) The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1. Nucleic Acids Research 20, 5153–5158. Droog, F.N.J., Spek, A., van der Kooy, A., de Ruyter, A., Hoge, H., Libbenga, K., Hooykaas, P.J.J. and van der Zaal, B. (1995) Promoter analysis of the auxin-regulated tobacco glutathione S-transferase Nt103-1 and Nt103-35. Plant Molecular Biology 29, 413–429. Ehrlich, K.C., Cary, J.W. and Ehrlich, M. (1992) A broad bean cDNA clone encoding a DNA-binding protein resembling mammalian CREB in its sequence specificity and DNA methylation sensitivity. Gene 117, 169–178. Ellis, J.G., Llewellyn, D.J., Walker, J.C., Dennis, E.S. and Peacock, W.J. (1987) The ocs element: a 16 base pair palindrome essential for activity of the octopine synthase enhancer. The EMBO Journal 6, 3203–3208. Ellis, J.G., Tokuhisa, J.G. Llewellyn, D.J., Bouchez, D., Singh, K., Dennis, E.S. and Peacock, W.J. (1993) Does the ocs-element occur as a functional component of the promoters of plant genes? The Plant Journal 4, 433–443. Foley, R.C., Grossman, C., Ellis, J.G., Llewellyn, D.J., Dennis, E.S., Peacock, W.J. and Singh, K.B. (1993) Isolation of a maize bZIP protein subfamily: candidates for the ocselement transcription factor. The Plant Journal 3, 669–679. Fox, C.P., Vasil, V., Vasil, K. and Gurley, W.B. (1992) Multiple ocs-like elements required for efficient transcription of the mannopine synthase gene of T-DNA in maize protoplast. Plant Molecular Biology 20, 219–233. Friling, R.S., Bergelson, S. and Daniel, V. (1992) Two adjacent AP-1-like binding sites from the electrophile-responsive element of the murine glutathione S-transferase Ya subunit gene. Proceedings of the National Academy of Sciences USA 89, 668–672. Fromm, H., Katagiri, F. and Chua, N.-H. (1989) An octopine synthase enhancer element directs tissue-specific expression and binds to ASF-1, a factor from tobacco nuclear extracts. The Plant Cell 1, 977–984. Gatz, C., Katzek, J., Prat, S. and Heyer, A. (1991) Repression of the CaMV 35S promoter by the octopine synthase enhancer element. FEBS Letters 293, 175–178. Giraudat, J., Hauge, B.M., Valon, C., Smalle, J., Parcy, F. and Goodman, H.M. (1992) Isolation of the Arabidopsis ABI3 gene by positional cloning. The Plant Cell 4, 1251–1261. Gough, G., Hemon, P., Tronchet, M., Lacomme, C., Marco, Y. and Roby, D. (1995) Developmental and pathogen-induced activation of an msr gene, str246C, from tobacco involves multiple regulatory elements. Molecular and General Genetics 247, 323–337.

11 Inducible Gene 11

3/16/99 11:24 AM

Page 233

Potential Use of Hormone-responsive Elements

233

Guilfoyle, T.J. (1997) The structure of plant gene promoters. In: Setlow, J.K. (ed.) Genetic Engineering, Principles and Methods, Vol. 19. Plenum Press, New York, pp. 15–47. Hagen, G. and Guilfoyle, T.J. (1985) Rapid induction of selective transcription by auxin. Molecular and Cellular Biology 5, 1197–1203. Hagen, G., Kleinschmidt, A.J. and Guilfoyle, T.J. (1984) Auxin-regulated gene expression in intact soybean hypocotyl and excized hypocotyl sections. Planta 16, 147–153. Hagen, G., Uhrhammer, N. and Guilfoyle, T.J. (1988) Regulation of expression of an auxin-induced soybean sequence by cadmium. The Journal of Biological Chemistry 263, 6442–6446. Hagen, G., Martin, G., Li, Y. and Guilfoyle, T.J. (1991) Auxin-induced expression of the soybean GH3 promoter in transgenic tobacco plants. Plant Molecular Biology 17, 567–579. Hahn, K. and Strittmatter, G. (1994) Pathogen-defense gene prp-1 from potato encodes an auxin-responsive glutathione S-transferase. European Journal of Biochemistry 226, 619–626. Hirata, D., Yano, K. and Miyakawa, T. (1994) Stress-induced transcriptional activation mediated by YAP1 and YAP2 genes that encode the Jun family of transcriptional activators in Saccharomyces cerevisiae. Molecular and General Genetics 242, 250–256. Katagiri, F., Lam, E. and Chua, N.-H. (1989) Two tobacco DNA-binding proteins with homology to the nuclear factor CREB. Nature 340, 727–730. Kim, S.R., Kim, Y. and An, G. (1993) Identification of methyljasmonate and salicylic acid response elements from nopaline synthase (nos) promoter. Plant Physiology 103, 97–103. Kim, S.R., Buckley, K., Costa, M.A. and An, G. (1994) A 20 nucleotide upstream element is essential for the nopaline synthase (nos) promoter activity. Plant Molecular Biology 24, 105–117. Kononowicz, H., Wang, E., Habeck, L.L. and Gelvin, S.B. (1992) Subdomains of the octopine synthase upstream activation element direct cell-specific expression in transgenic tobacco plants. The Plant Cell 4, 17–27. Kusaba, M., Takahashi, Y. and Nagata, T. (1996) A multiple-stimuli-responsive as-1related element of parA gene confers responsiveness to cadmium but not to copper. Plant Physiology 111, 1161–1167. Lam, E. and Lam, Y. (1995) Binding site requirements and differential representation of TGF factors in nuclear ASF-1 activity. Nucleic Acids Research 23, 3778–3785. Lam, E., Benfey, P.N., Gilmartin, P.M., Fang, R.X. and Chua, N.-H. (1989) Site-specific mutations alter in vitro binding and change promoter expression pattern in transgenic plants. Proceedings of the National Academy of Sciences USA 86, 7890–7894. Lam, E., Katagiri, F. and Chua, N.-H. (1990) Plant nuclear factor ASF-1 binds to an essential region of the nopaline synthase promoter. The Journal of Biological Chemistry 265, 9909–9913. Langridge, W.H.R., Fitzgerald, K.J., Koncz, D., Schell, J. and Szalay, A.A. (1989) Dual promoter of Agrobacterium tumefaciens mannopine synthase genes is regulated by plant growth hormones. Proceedings of the National Academy of Sciences USA 86, 3219–3223. Leung, J., Fukuda, H., Wing, D., Schell, J. and Masterson, R. (1991) Functional analysis of cis-elements, auxin response and early developmental profiles of the mannopine synthase bidirectional promoter. Molecular and General Genetics 230, 463–474. Li, Y., Liu, Z.-B., Shi, X., Hagen, G. and Guilfoyle, T.J. (1994) Auxin-inducible elements in the soybean SAUR promoters. Plant Physiology 106, 37–43.

11 Inducible Gene 11

234

3/16/99 11:24 AM

Page 234

T.J. Guilfoyle and G. Hagen

Liu, X. and Lam, E. (1994) Two binding sites for the plant transcription factor ASF-1 can respond to auxin treatments in transgenic tobacco. The Journal of Biological Chemistry 269, 668–675. Liu, Z.-B., Ulmasov, T., Shi, X., Hagen, G. and Guilfoyle, T.J. (1994) The soybean GH3 promoter contains multiple auxin-inducible elements. The Plant Cell 6, 645–657. Liu, Z.-B., Hagen, G., and Guilfoyle, T.J. (1997) A G-box binding protein from soybean binds to the E1 auxin response element in the soybean GH3 promoter and contains a proline-rich repression domain. Plant Physiology 115, 397–407. Marrs, K.A. (1996) The functions and regulation of glutathione S-transferases in plants. Annual Review of Plant Physiology and Plant Molecular Biology 47, 127–158. Marrs, K.A. and Walbot, V. (1997) Expression and RNA splicing of the maize glutathione S-transferase Bronze2 gene is regulated by cadmium and other stresses. Plant Physiology 113, 93–102. McCarty, D.R., Hattori, T., Carson, C.B., Vasil, V., Lazar, M., and Vasil, I.K. (1991) The viviparous-1 developmental gene of maize encodes a novel transcriptional activator. Cell 66, 895–905. McClure, B.A. and Guilfoyle, T. (1987) Characterization of a class of small auxininducible soybean polyadenylated RNAs. Plant Molecular Biology 9, 611–623. Medberry, S.L., Lockhart, B.E.L. and Olszewski, N.E. (1992) The commelina yellow mottle virus promoter is a strong promoter in vascular and reproductive tissues. The Plant Cell 4, 185–192. Miao, Z.H., Liu, X.J. and Lam, E. (1994) TGA3 is a distinct member of the TGA family of bZIP transcription factors in Arabidopsis thaliana. Plant Molecular Biology 25, 1–11. Ney, P.A., Sorrentino, B.B., McDonagh, K.T. and Nienhuis, A.W. (1990) Tandem AP-1binding sites with the human β-globin dominant control region function as an inducible enhancer in erythroid cells. Genes and Development 4, 993–1006. Niwa, Y., Muranaka, T., Baba, A. and Machida, Y. (1994) Organ-specific and auxininducible expression of two tobacco par A-related genes in transgenic plants. DNA Research 1, 213–221. Oeller, P.W., Keller, J.A., Parks, J.E., Silbert, J.E. and Theologis, A. (1993) Structural characterization of the early indoleacetic acid-inducible genes, PS-IAA4/5 and PS-IAA6, of pea (Pisum sativum L). Journal of Molecular Biology 233, 789–798. Okuda, A., Imagawa, M., Sakai, M. and Muramatsu, M. (1990) Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells. The EMBO Journal 9, 1131–1135. Prat, S., Willmitzer, L. and Sanchez-Serrano, J.J. (1989) Nuclear proteins binding to a cauliflower mosaic virus 35S truncated promoter. Molecular and General Genetics 217, 209–214. Qin, X.-F., Holuique, L., Horvath, D.M. and Chua, N.-H. (1994) Immediate early activation by salicylic acid via the cauliflower mosaic virus as-1 element. The Plant Cell 6, 863–874. Roesler, W.J., Vandenbark, G.R. and Hanson, R.W. (1988) Cyclic AMP and the induction of eukaryotic gene transcription. The Journal of Biological Chemistry 263, 9063–9066. Rogers, J.C. and Rogers, S.W. (1992) Definition and functional implications of gibberellin and abscisic acid cis-acting hormone response complexes. The Plant Cell 4, 1443–1451. Rogers, J.C., Lanahan, M.B. and Rogers, S.W. (1994) The cis-acting gibberellin response complex in high-pI α-amylase gene promoters. Plant Physiology 105, 151–158.

11 Inducible Gene 11

3/16/99 11:24 AM

Page 235

Potential Use of Hormone-responsive Elements

235

Ruis, H. and Schuller, C. (1995) Stress signaling in yeast. BioEssays 17, 959–965. Sanger, M., Daubert, S. and Godman, R. (1990) Characteristics of a strong promoter from figwort mosaic virus: comparison with analogous 35S promoter from cauliflower mosaic virus and the regulated mannopine synthase promoter. Plant Molecular Biology 14, 433–443. Shen, Q. and Ho, T.-H. D. (1995) Functional dissection of an abscisic acid (ABA)inducible gene reveals two independent ABA-responsive complexes each containing a G-box and an novel cis-acting element. The Plant Cell 7, 295–307. Shen, Q., Zhang, P. and Ho, T.-H.D. (1996) Modular nature of abscisic acid (ABA) response complexes: composite promoter units that are necessary and sufficient for ABA induction of gene expression in barley. The Plant Cell 8, 1107–1118. Singh, K., Tokuhisa, J.G., Dennis, E.S. and Peacock, W.J. (1989) Saturation mutagenesis of the octopine synthase enhancer: correlation of mutant phenotypes with binding of a nuclear protein factor. Proceedings of the National Academy of Sciences USA 86, 3733–3737. Singh, K., Dennis, E.S., Ellis, J.G., Llewellyn, D.J., Tokuhisa, J.G., Wahleithner, J.A. and Peacock, W.J. (1990) OCSBF-1, a maize ocs enhancer binding factor: isolation and expression during development. The Plant Cell 1, 891–903. Suzuki, M., Kao, C.Y. and McCarty, D.R. (1997) The conserved B3 domain of VIVIPAROUS1 has a cooperative DNA binding activity. The Plant Cell 9, 799–807. Tabata, T., Nakayama, T., Mikami, K. and Iwabuchi, M. (1991) HBP-1a and HBP-1b: leucine zipper-type transcription factors of wheat. The EMBO Journal 10, 1459–1467. Takahashi, Y., Kusaba M., Hiraoka, Y. and Nagata, T. (1991) Characterization of the auxinregulated par gene from tobacco mesophyll protoplasts. The Plant Journal 1, 327–332. Taylor, J.L., Fritzemeier, K.-H., Hauser, I., Kombrink, E., Rohwer, F., Schroder, M., Strittmatter, G. and Hahlbrock, K. (1990) Structural analysis and activation by fungal infection of a gene encoding a pathogenesis-related protein in potato. Molecular Plant–Microbe Interactions 3, 72–77. Theologis, A., Huynh, T.V. and Davis, R.W. (1985) Rapid induction of specific mRNAs by auxin in pea epicotyl tissue. Journal of Molecular Biology 183, 53–68. Tokuhisa, J.G., Singh, K., Dennis, E.S. and Peacock, W.J. (1990) A DNA-binding protein factor recognizes two binding domains within the octopine synthase enhancer element. The Plant Cell 2, 215–224. Ulmasov, T., Hagen, G. and Guilfoyle, T.J. (1994) The ocs element in the soybean GH2/4 promoter is activated by both active auxin and salicylic acid analogues. Plant Molecular Biology 26, 1055–1064. Ulmasov, T., Ohmiya, A., Hagen, G. and Guilfoyle, T.J. (1995a) The soybean GH2/4 gene that encodes a glutathione S-transferase has a promoter that is activated by a wide range of chemical agents. Plant Physiology 108, 919–927. Ulmasov, T., Liu, Z.-B., Hagen, G. and Guilfoyle, T.J. (1995b) Composite structure of auxin response elements. The Plant Cell 7, 1611–1623. Ulmasov, T., Hagen, G. and Guilfoyle, T.J. (1997a) ARF1, a transcription factor that binds auxin response elements. Science 276, 1865–1868. Ulmasov, T., Murfett, J., Hagen, G. and Guilfoyle, T.J. (1977b) Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 9, 1963–1971. van der Kop, D.A., Schuyer, M., Scheres, B., van der Zaal, B.J. and Hooykaas, P.J. (1996) Isolation and characterization of an auxin-inducible glutathione S-transferase gene of Arabidopsis thaliana. Plant Molecular Biology 30, 839–844.

11 Inducible Gene 11

236

3/16/99 11:24 AM

Page 236

T.J. Guilfoyle and G. Hagen

van der Zaal, E.J., Droog, F.N.J., Boot, C.J.M., Hensgens, L.A.M., Hoge, J.H.C., Schilperoort, R.A. and Libbenga, K.R. (1991) Promoters of auxin induced genes from tobacco can lead to auxin-inducible and root tip-specific expression. Plant Molecular Biology 16, 983–998. van der Zaal, E.J., Droog, F.N.J., Pieterse, F.J. and Hooykaas, P.J.J. (1996) Auxin-sensitive elements from promoters of tobacco GST genes and a consensus as-1-like element differ only in relative strength. Plant Physiology 110, 79–88. Verdaquer, B., de Kochko, A., Beachy, R.N. and Fauquet, C. (1996) Isolation and expression in transgenic tobacco and rice plants of the cassava vein mosaic virus (CVMV) promoter. Plant Molecular Biology 31, 1129–1139. Walker, J.C. and Key, J.L. (1982) Isolation of cloned cDNAs to auxin-responsive poly(A) RNAs of elongating soybean hypocotyl. Proceedings of the National Academy of Sciences USA 79, 7185–7189. Walker, J.C., Logocka, J., Edelman, L. and Key, J.L. (1985) An analysis of growth regulator interactions and gene expression during auxin-induced cell elongation using cloned complementary DNAs to auxin-responsive messenger RNAs. Plant Physiology 77, 847–850. Xiang, C., Miao, Z.H. and Lam, E. (1996) Coordinated activation of as-1-type elements and a tobacco glutathione S-transferase gene by auxins, salicylic acid, methyljasmonate and hydrogen peroxide. Plant Molecular Biology 32, 415–426. Yamamoto, K.R., Pearce, D., Thomas, J. and Miner, J. N. (1992) Combinatorial regulation at a mammalian composite response element. In: McKnight, S.L. and Yamamoto, K.R. (eds) Transcriptional Regulation. Cold Spring Harbor Laboratory Press, Plainview, New York, pp. 1169–1192. Zhang, B. and Singh, K.B. (1994) ocs element promoter sequences are activated by auxin and salicylic acid in Arabidopsis. Proceedings of the National Academy of Sciences USA 91, 2507–2511. Zhang, B., Foley, R. and Singh, K.B. (1993) Isolation and characterization of two related Arabidopsis ocs-element bZIP binding proteins. The Plant Journal 4, 711–716. Zhang, B., Chen, W., Foley, R., Buttner, M. and Singh, K.B. (1995) Interactions between distinct types of DNA binding proteins enhance binding to ocs element promoter sequences. The Plant Cell 7, 2241–2252.

12 Inducible Gene Index

3/16/99 11:26 AM

Page 237

Index

abscisic acid (ABA) 7 electrical stimulation, wounding 134 genes regulated by 188–198 induction ACGT box requirement 202–205 mutant affecting 142 mechanism of action 198–199 molecular switches biotechnology potential 214 construction 209–210 functional in vegetative tissues 209 regulation, rice plants 209–211 proteinase inhibitor genes 141–142 signal transduction components 211–213 stress-induced 188–214 abscisic acid (ABA) biosynthesis genes 188, 197 abscisic acid (ABA) response complexes (ABRC) 205–206, 209–210 phase sensitivities 206–207 signal transduction pathway mediation 211–213 abscisic acid (ABA) response elements (ABREs) 199–201, 225, 231

abscisic acid (ABA) response elements (ABREs)/G box sequence see ACGT boxes abscisic acid (ABA) responses, genes mediating 188, 195–196 abscisic acid (ABA)-inducible genes 188–195, 198 abscisic acid (ABA)-responsive promoters 198–199, 225 cis-acting promoter sequences 199–211, 213 potential biotechnology applications 213–214 abscisic acid (ABA)-suppressible genes 188, 195, 198 ace1 gene 62–63, 66, 68–71 ACE1 protein 4, 24, 44 copper-inducible expression system 63–64, 68 acetylsalicyclic acid 134 ACGT boxes 201 and ABA inducibility 202–205 proximal/distal coupling element interactions 205–206 signal specific complexes 207–209 actinomycin D 18 activator sequence-1 (as-1) 219 237

12 Inducible Gene Index

238

3/16/99 11:26 AM

Page 238

Index

see also auxin-response elements (AuxREs) Agrobacterium rhizogenes-encoded rol genes, tc-inducible expression 17 Agrobacterium T-6B oncogene 6, 115–116 Agrobacterium tumefaciens IPT gene 171, 173 octopine synthase gene 220 Agrobacterium-mediated transformation, ERS transgenic plants 33 allene oxide synthase 138–39 γ-aminobutyric acid (GABA) 131 aminocyclopropane carboxylic acid (ACC) synthase 130 α-amylase gene 225 α-amylase inhibitors 131–132 animal hormone receptor/activators 2 antisense constructs in copper-inducible gene expression 72–73 thermotolerance, Arabidopsis 115 apical dominance, Cu-GUS and Cu-ipt plants 78 Arabidopsis 35S-driven GVG gene 50–53 copper treatment effects 62, 65 copper-controllable gene expression 61, 68 Era1 gene, and ABA sensitivity 213 FLP recombinase expression 116 glucocorticoid treatment methods 50 GR HBD transmutants 47 heat-shock promoter 103 mutagenesis screen 117 heat-shock response 114–115 Hsp81-1 promoter conditional expression 115 jasmonate biosynthesis 138 leaf senescence 170 luciferase activity induction 50–53 NR gene promoter 89, 91–92 rbcS-1A gene 208 tc-controlled transcriptional activator 18 TetR repression 17 thermotolerance 115 ttg mutant 47

Arabidopsis protoplasts, lac1 system 27 Arabidopsis thaliana, ethylmethanesulphonate mutant 140 areA global regulatory gene 85–86 L-asparaginase gene expression 78–79 transgenic Lotus corniculatus 73–75 aspartate aminotransferase-P2 antisense expression 72–73, 78 Aspergillus nidulans alcohol dehydrogenase regulon 2, 24 areA global regulatory gene 85–86 niaD structural gene 86 niiA structural gene 86 nirA pathway-specific regulatory gene 85, 87–88 nitrate assimilation 85 auxin, role, proteinase inhibitor expression 143–144 auxin analogues, biologically inactive 229–230 auxin-response elements (AuxREs) 7, 219 as-1 element 219 gene modification 231 natural composite 222–225 soybean GH3 promoter multimerized constructs 222–224, 230 ocs element 219 ocs/as-1 element 220–222, 229–230 synthetic composite 225–226 synthetic simple 226–229 TGTCTC element 222–229, 231 use to control gene expression 229–231 auxin-responsive genes 222

bacterial avirulence gene expression, copper system 75 barley α-amylase gene 225 HVA1 and HVA22 genes 198–200 HVA1 and HVA22 promoters 199, 201–202 Lea gene 212 NiR gene 89 thionin promoter 114

12 Inducible Gene Index

3/16/99 11:26 AM

Page 239

Index bestatin 141 biotic stresses, impact on crop yield 187–188 Bombyx ecdysone receptor 28 brassinosteroids 53

cab gene transcripts 129 cauliflower mosaic virus (CaMV) 35S promoter 32–33, 48, 61, 114 in copper-inducible expression system 62–64 GUS copper-control system 63–65 GUS ecdysone transgenic seedlings 33–35, 37 natural composite AuxREs 224, 226 TetR repression 14–16 CCAAT-box binding factor 107, 111 cell surface receptors 136 chalcone isomerase 129 chalcone synthase 129 chalcone synthase gene 208 chalcone synthase promoter 207 chaperonins 130 chimeric transcription factors 54 see also GVG system chitinases 131–132 chloramphenicol acetyl transferase (CAT) 2–3, 14 p-chloromercuribenzenesulphonic acid 136 chymotrypsin inhibitor 127–128 conditional lethal gene expression, copper system 73–75 control systems from non-plant backgrounds 2–4 copper-controllable gene expression system 2, 4, 24, 44, 61–79 basis 62–63 copper foliar spray effects 65 effecting control over place and time of expression 68–69 expression of bacterial avirulence genes 75 expression of conditional lethal genes 73–75 functioning 63–65 GUS activity 63–65, 68, 76–78

239

ipt gene expression 76–78 practical tips for use 79 practical usefulness of 78–79 in roots, system modification 65–68 usage for tissue-specific antisense experiments 72–73 usage to control expression of plant hormones 76–78 vectors 69–70 copper–EDTA complex 79 copper-metallothionein (MT) regulatory system 4, 62–63 coronatine 140–141 coumaric acid 208–209 Craterostigma plantagineum 103 crop yield, biotic stress effects 187–188 cutin 127 cyclooxygenase 139 cytokinin biology, utility of autoregulatory systems 182–183 cytokinin production, IPT role in 173–174, 183 cytokinin synthase (ipt) gene expression 76–78 cytokinins effect on SAG12-GUS expression 180, 182 role in plant senescence 170–171, 183 role in proteinase gene inhibitor expression 144

dexamethasone 20, 27, 32, 49–51, 53 and luciferase activity induction 50, 52 dibenzylhydrazines 30–31 dimeric orphan receptors 25 Drosophila ecdysone receptor (EcR) 25, 28–29 GAGA factor binding site 105–106 heat-shock proteins 99, 101, 110, 113, 115 heat-shock response 98 Kc cell bioassay 30 steroid responsive elements 107

12 Inducible Gene Index

3/16/99 11:26 AM

240 ecdysone agonists 29–31 ecdysteroid compounds 29–30 non-steroidal compounds 30–31 ecdysone chimeric receptor, transient expression 32–34 ecdysone receptor switch (ERS) 32–33, 37 induction specificity 36 ligand induction, dose dependence 35 tobacco transformation 32 transgenic plant analysis 33–35 ecdysone receptors 25, 28–29 ecdysteroid agonists 3–4, 29–37 ecdysteroid compounds 29–30 in plants 29, 31 ecdysteroid receptor of insects 25 electrical action potential, proteinase inhibitor genes 134 Em gene 199 Em promoter 212 embryo development, heat-shock proteins 102–103 ERS see ecdysone receptor switch Escherichia coli, heat-shock response 98 ethanol-inducible gene switch 2 ethylene biosynthesis induction 130 effects, wound-inducible genes 142–143 eukaryotes heat-shock response 98 TetR repression of transcription 14–16 extracellular invertases 133

Fabaceae, vegetative storage proteins 128 floral development, heat-shock proteins 103 FLP recombinase gene, heat-inducible expression 116 fungal systems, nitrate assimilation regulation 85–88 furanocoumarin biosynthesis 131 fusion proteins 47–48

Page 240

Index GAGA factor binding site 105–106 GAL4 DNA-binding domain 4, 20, 27, 48, 108, 226 gibberellic acid responsive element (GARE) 225, 231 gibberellic acid responsive genes 225 global nitrogen regulatory genes 85–86 β-glucanases 131–132, 143 glucocorticoid characteristics as inducer 53–54 plant treatment methods 50–51 glucocorticoid-inducible gene expression 4, 19–20, 43–55 glucocorticoid receptor (GR) hormone-binding domain (HBD) 44–48 ligand-binding domain 20, 24–25, 27–28, 32 regulatory mechanism 44–48 glucocorticoid response elements (GREs) 44 β-glucuronidase gene see GUS glutamine synthetase (GS) 83–84, 88 glutamine-2-oxyglutarate aminotransferase (GOGAT) 83–84, 88 GmHsp 17.3 B promoter 111, 114–115 GmHsp 17.3 B promoter-GUS fusion 114 GmHsp 17.5 E promoter heat-inducible expression, FLP recombinase gene 116 transient heat induction 116 GmHsp 26-A gene 103, 220 GmHsp 26-A/GH2/4 gene 229 GUS (β-glucuronidase gene) 32 activity copper-control system 63–65, 66 ecdysone receptor switch 33–36 apical dominance 78 expression in roots 65–68 leaf senescence 77, 172 NiR fusion, transgenic tobacco 89–90 SAG fusion SAG12-IPT plants 180 transgenic Arabidopsis 172–173

12 Inducible Gene Index

3/16/99 11:26 AM

Page 241

Index GVG system 4, 20 characteristics 53–54 cis and trans constructs 49–50, 54 construction of 48–49 HBD alternatives 54–55 induction experiments 49–52 promoter modification 55 as steroid-inducible transcription system 54–55

HaHsp 17.6 G1 gene 112 HaHsp 17.7 G4 gene 111–112 HBD see hormone-binding domains heat-shock consensus elements (HSEs) 104–105 dependent activation 106–110 heat-shock regulation 107 multiple pathway regulation 110 heat-shock gene expression 98 heat-shock promoters 5–6, 8, 98–99 auxiliary elements 105–107 cis-elements 106–107, 110 class A 5–6, 106–107 class B 6, 106–107 B-1 promoters 107–108 B-2 promoters 108–110 class C 6, 110 consensus elements 104–105 with enhanced heat-shock expression 103 organization 104–107 in plants 110–112 relative strength compared to other promoters 114 transcription factor 104–105 transient heat induction 116 types 5–6, 105–106 use in basic research 114–116 use in mutagenesis screens 117 use in transgenic plant experiments 113–114 heat-shock proteins 98 constitutive expression 103–104 developmental expression 100–102, 106–110, 117–118 embryo development and seeds 102–103 floral development 103

241

gene expression, developmental regulation 100–101 induction by other stresses 104 induction in pollen 101–102 low molecular weight 99–104, 118 expression in plants 110–112 molecular weights 99 pollen development 100–101 role in thermotolerance 99–100 winter acclimation 104 heat-shock regulation, HSE-dependent 106–107 heat-shock response expression of genes down-regulated during high temperature stress 117 in plants 98–9 heat-shock transcription factors (HSF) 104–105, 107–110 in mammals 112 phylogenetic classes 113 in plants 113 Heliothis, ecdysone receptors 3–4, 28, 32–33 hemin-induced hsp70 synthesis, human erythrocytes 107–108 herpes viral protein (VP 16) 3, 20, 27, 32, 47–48 heterodimers 25 n-hexenal 139 high-temperature stress, heat-shock gene promoter use 117 homodimers 24–25, 36 hormone-binding domains (HBDs) 44–48 heterologous proteins regulated by 44–47 protein function control 47 regulatory mechanism 45 see also GVG system hormone-responsive elements (HREs) 219–231 natural composite 225 use to control gene expression 229–231 see also auxin-response elements (AuxREs) hsp genes 100, 102, 105, 107, 110, 112, 115

12 Inducible Gene Index

3/16/99 11:26 AM

242

Page 242

Index

HVA1 gene ABA and stress induction, barley seedlings 198–200 coupling element interactions 205–206 short promoter fragment, and ABA induction 202, 204 HVA1 promoter 201, 203 HVA22 gene 198–199, 205 ABA-inducible, GUS activity 2, 199, 201 coupling element interactions 205–206 short promoter fragment, and ABA induction 202–204 HVA22 promoter 201 interaction with distal/proximal coupling element 205 hydrogen peroxide response 128–129 13-hydroperoxylinolenic acid 138, 140 20-hydroxyecdysone 28–29 hydroxyproline-rich proteins, cell walls 187 hygromycin resistance, heat-inducible 116

induced thermotolerance 99–100 inducible gene systems 1–2, 97–98 invertases, extracellular 133 ipt (cytokinin synthase) gene expression 76–78, 116 IPT (isopentenyl transferase) gene 171 expression in transgenic plants 170, 174 role in cytokinin production 173–174

jasmonates 130, 132, 136 affect on transcription 141 electrical stimulation, wounding 134 metabolism 140 see also methyl jasmonate jasmonic acid biosynthetic pathways 137–139 stereoisomers 140 synthesis, mutants 140–141 in wound response 137

kanamycin-resistant SAG12-IPT tobacco plants 176–177

lac1 system 24, 27 Lea gene 199, 212 LEA proteins 198, 214 leaf senescence 169 and agriculture 170 application of autoregulatory senescence-inhibition system 183–184 Cu-ipt and Cu-GUS tobacco transformants 77 cytokinins role 170–171, 183 SAG promoters to target IPG gene 174–175 senescence-associated genes in 171–173 lectins 131 lethal metabolic gene expression, copper system 73–75 light-harvesting chlorophyll protein complex apoproteins 129 light-induced gene expression 207–209 lipoxygenase 138–139, 142 Lotus, copper-controllable gene expression 61 Lotus corniculatus AAT-P2 antisense constructs 72 L-asparaginase gene expression 73–75 roots, copper inducibility of GUS expression 67 low molecular weight heat-shock proteins 99–103, 118 constitutive expression 103–104 expression in plants 110–112 luciferase activity induction 202 through GVG system 49–50, 52–53

maize heat-shock promoter 174 Myc transcription factor 47 pMAH9 gene 198 polyubiquitin genes 103

12 Inducible Gene Index

3/16/99 11:26 AM

Page 243

Index Rab17 gene 202 VP1 gene, and ABRC activation 211–113 maize protoplasts, ecdysone chimeric receptor expression 3, 32–33 makisteroneA 36 mammalian systems, inducible nuclear receptor systems 25–27 metallothionein-copper regulatory system 4, 62–63 methyl jasmonate 129–131, 137, 140 Mimulus guttatus roots, copper-binding elements 62 mineralocorticoid receptors 46, 54 momilactone 131 monomeric orphan receptors 25 muristeroneA 25–26, 28–29, 35 mutagenesis screens, heat-shock promoter use 117

negative-acting nitrogen regulatory gene 88 neomycin phosphotransferase reporter gene 101–102 Neurospora crassa nit-2 global regulatory gene 85–86, 91 nit-3 structural gene 86, 91 nit-4 pathway-specific regulatory gene 85, 87 nit-6 structural gene 86 nitrate assimilation 85 Nicotiana rustica, T-6B oncogene expression 115–116 Nicotiana sylvestris, jasmonic acid role, wound response 137 Nicotiana tabacum see tobacco NiR enzyme, protein structure 89 NiR gene expression in response to nitrate 89–93 nirA pathway-specific regulatory gene 85, 87–88 nit-2 global regulatory gene 85–86, 91 nit-4 pathway-specific regulatory gene 85, 87–88 nitrate assimilation regulation, fungal systems 85–88

243

nitrate assimilatory pathway, plants 83–85 nitrate reductase 83 gene expression 5, 84–85, 88, 93 nitrate-inducibility of gene expression 5, 88–93 AT-rich region 92 cis-acting region 90–91 trans-acting region 91, 93 nitrite reductase 83 gene expression 84–85, 88, 93 see also spinach NiR gene nitrogen regulatory genes global 85–86 negative-acting 88 pathway-specific 85, 87–88 nmr negative-acting regulatory gene 88 nod45 promoter 67–69 nodule-specific system, AAT-P2 antisense expression 72–73, 78–79 norbornadiene 143 nuclear receptors classes 24–25, 44 in mammalian systems 25–27 post-transcriptional control 27–28 protein domains 25–26, 44–45 transcriptional control 27

ocs/as-1 element AuxRE 220, 229 activation through biologically inactive auxins 229–230 gene expression 221–222 hormonal induction 230 sequence structure 220–221 wounding concerns 230 octopine synthase (ocs) 219–220 see also auxin-response elements (AuxREs) oestrogen receptors 46, 54 okadiac acid-sensitive protein phosphatase 137 oligosaccharide elicitors 136 osmoprotectants 214 osmotin 131 12-oxo-phosphodienoic acid 139–140 oxylipin 137–139, 142 inhibitor metabolism 139 ozone, heat-shock protein induction 104

12 Inducible Gene Index

244

3/16/99 11:26 AM

Page 244

Index

pACE-in-ART vector 71 pathogenesis-related proteins 117 pathway-specific nitrogen regulatory genes 85, 87–88 peroxidases 129 phenidone 139 phenoxycarb 34 phenylalanine ammonia-lyase 129 phenylpropanoids, up-regulation 129 phospholipase D 137–138 photosynthetic translation inactivation, wound response 129–130 phytoalexins 131 phytochelatins 62 piroxicam 139 plant defence induction, wound response 131–132 plant hormone expression, copper system use 76–78 plant promoter systems responsive to environmental signals 1–2, 4–6 plant senescence cytokinins role in 170–171, 183 see also senescence-associated genes (SAGs) pollen, heat-shock response 101–102 pollen development, HSP gene expression 100–101 polyubiquitin genes 103 ponasteroneA 25, 36 poplar, copper-controllable gene expression 61 post-mitotic senescence 169 post-transcriptional control, nuclear receptors 27–28 pPMB 765 vector 71 pPMB 768 vector 70–71, 75–76 pPMB 7066 vector 70–71, 75 pPMB 7088 vector 71 progesterone receptor 26–27 prokaryotes, TetR repression of transcription 13–14 proliferative senescence 169 promoter systems 8 based on plant-based developmental processes 1, 6–7 types 1–2 propyl gallate 139

prosystemin cDNA 135–136 protein kinases 137 ABA-induced 213 proteinase inhibitor genes 128 abscisic acid role, wound-induction 141–142 auxin role 143–144 coronatine effects 140–141 cytokinin role 144 electrical action potential stimulation 134 ethylene role 143 jasmonic acid synthesis 140–141 systemin effects 135–136 wound-inducibility 128, 133–144 Pseudomonas syringae avirulence gene 75 coronatine pathovar 140 pUC-based plasmids 70–71

Rab genes 199, 202 RAB proteins 198 rat GR HBD 48 expression in transgenic plants 47 rbcL transcripts 130 rbcS gene product 129 replicative senescence 169 retinoic-X receptor 25 ribosome-inactivating proteins, expression 130 rice ABA responsive promoter switch regulation 209–211 Rab16A gene 202 roots copper toxicity to 79 copper-binding elements, Mimulus 62 copper-controllable gene expression modification 65–68 RPS2 promoter 75

S-adenosyl-L -methionine (SAM) synthase 130 SAG12-GUS construct 180 SAG12-IPT construct 174–175

12 Inducible Gene Index

3/16/99 11:26 AM

Page 245

Index SAG12-IPT transgenic tobacco plants autonomous nature 178–179 autoregulatory nature 178–182 biochemical observations 178 cytokinin effect 178, 180, 182 phenotypical observations 176–178 physiological observations 178 salicyclic acid 139 seeds, heat-shock proteins 102 senescence-associated genes (SAGs) identification 171–173 use to target IPT gene to senescing leaves 174–175 see also SAG12-IPT transgenic tobacco plants senescence-inhibition system, autoregulatory, applications 183–184 senescence-specific promoters 6–7, 169–184 developing a system for targeting IPT expression 171–175 see also IPT (isopentenyl transferase) gene serine proteinase inhibitors 131–132 silver thiosulphate 143 Solanaceae, proteinase inhibitors 128 soybean GH3 promoter, and composite AuxREs 222–225, 230 GmHsp 17.3 B promoter 111, 114 GmHsp 17.5 E promoter heat-inducible expression, FLP recombinase gene 116 transient heat induction 116 GmHsp 26-A gene 103, 220 spacio-temporal gene expression 55 spinach NiR gene 89, 92 deletion analysis, GUS fusion, transgenic tobacco 89–91 spinach NiR gene promoter 90 nitrate induction 91–92 nitrogen metabolite repression 92–93 spinach NiR promoter, importance of GATA core elements 90–92 staurosporine 136–137 steroid-inducible transcription system in plants 54–55

245

steroid receptor ligand-binding domains 24–25, 27–8 see also glucocorticoid storage protein induction, wound response 128, 132–133 stress-induced proteins 187 stress-regulated gene expression independent of stress-induced ABA 188 regulated by stress-induced ABA 188–198 stressed vegetative tissues, protein accumulation 198 suberin 127 sugar transporters 133 sunflower HaHsp 17.6 G1 gene 112 HaHsp 17.7 G4 gene 111–112 systemin 135–136

taxol biosynthesis 131 tc-controlled transcriptional activator (tTA) 18 fusion to glucocorticoid receptor-binding domain 19–20 mRNA decay rate measurement 18 use of 18–19 tc-inducible expression 15–17 tet operator sequences 12–13 tetA 11–13 tetR 11–13 TetR see Tn10-encoded tetracycline repressor (TetR) tetracycline repressor 2–3, 11–20, 23–24, 44 TGTCTC elements 231 natural composite AuxREs 222–225 synthetic composite AuxREs 225–226 synthetic simple AuxREs 226–229 D1-4 constructs 226–227 P3(4X) construct 227–228 TGV (transciptional activator) 19–20 thermotolerance 99–100 antisense constructs, Arabidopsis 115 thyroid receptors 24–25, 44

12 Inducible Gene Index

246

3/16/99 11:26 AM

Page 246

Index

Tn10-encoded tetracycline repressor (TetR) 2–3, 11–20, 23–24, 44 genetic organization and mechanism of regulation 11–12 tet operator sequences 12–13 TetR-tc binding 12–13 use to activate plant gene expression 18–20 use to repress plant gene expression 13–17 tobacco copper-controllable gene expression 61, 63–66 creation and cultivation of transgenic plants 175–176 Cu-ipt and Cu-GUS expression 76–77 heat-shock response 114 leaf senescence, Cu-ipt and Cu-GUS expression 77 luciferase activity induction 49 SAG12-IPT transgenic plants 176–182 spinach Nir gene-GUS fusion, deletion analysis 89–91 tc inducible-expression 16–17 transformation with ERS 32 see also SAG12-IPT transgenic tobacco plants tobacco protoplasts ecdysone chimeric receptor expression 3, 32–33 lac1 system 24, 27 tobacco roots, copper inducibility of GUS expression 67–69 tomato NR gene 91 NR promoter 93 TetR effects 17 transcriptional control nuclear receptors 27 transgene expression 23–24 transgenic plant analysis, ecdysone receptor switch 33–35 transgenic plants HS promoter use 113–114 rat GR HBD expression 47 see also specific plants, e.g. tobacco

triamcinolone acetonide 53 α-tubulin 101

ubiquitin 99, 103, 114, 202 ultra-violet induced gene expression 207–209 up-regulation of phenylpropanoids 129 ursolic acid 139

vectors, copper-controllable gene expression system 69–71 vegetative storage proteins 128, 132–133

wheat Em gene 199 Em promoter 212 white light-induced gene expression 207–209 winter acclimation, heat-shock proteins 104 wound induction, mechanism 133–141 wound response 127–128 ethylene biosynthesis induction 130 hydrogen peroxide response 128–129 photosynthetic translation inactivation 129–130 plant defence induction 131–132 return to normal physiology 133 storage protein induction 132–133 up-regulation of phenylpropanoids 129 wound-inducible genes in plants 128, 159–167 abscisic acid role 141–142 auxin role 143–144 cell surface receptors 136 cytokinin role 144 ethylene effects 142–143 jasmonic acid biosynthesis 137–141 oxylipin metabolism inhibitors 139

12 Inducible Gene Index

3/16/99 11:26 AM

Page 247

Index oxylipins 137 protein kinase role 136–137 see also proteinase inhibitor genes wound-inducible promoter system 5, 8 wound-inducible proteins 131–132

247

yeast copper-metallothionein regulatory system 4, 62–63

zeatin ribotide 174

12 Inducible Gene Index

3/16/99 11:26 AM

Page 248