ADVANCES IN CANCER RESEARCH VOLUME 53
This Page Intentionally Left Blank
ADVANCES IN CANCER RESEARCH Edited by
GEO...
23 downloads
1422 Views
16MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
ADVANCES IN CANCER RESEARCH VOLUME 53
This Page Intentionally Left Blank
ADVANCES IN CANCER RESEARCH Edited by
GEORGE F. VANDE WOUDE NCI-Frederick Cancer Research Facility Frederick, Maryland
GEORGE KLEIN Department of Tumor Biology Karolinska lnstitutet Stockholm, Sweden
Volume 53
ACADEMIC PRESS, INC. Harcourt Brace Jovanovlch, Publirhers
San Diego New York Berkeley Boston London Sydney Tokyo Toronto
COPYRIGHT 0 1989 BY ACADEMIC PRESS, INC. All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the publisher.
ACADEMIC PRESS, INC. San Diego, California 92101 United Kingdom Edition published hq ACADEMIC PRESS LIMITED 24-28 Oval Road, London NWI 7DX
LIBRARY OF CONGRESS CATALOG CARD NUMBER:
ISBN 0-12-006653-X
(alk. paper)
PRINTED IN THE UNITED STATES OF AMERICA
89909192
9
8
1
6
5
4
3
2
1
52-13360
CONTENTS
CONTRIBUTORS TO VOLUME5 3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
ix
Serum-inducible Genes
BARRETTJ. ROLLINS AND CHARLES D. STILES I. Introduction .................. 11. History: The .......................... 111. Biochemistry: The Role of Transcription and Translation in the Mitogenic Response to Serum .............. IV. Molecular Biology: Serum-Inducible Genes and Their Products . . . . . . . . . . . . . . V. Perspectives . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VI. Addendum.. . . . . . . .... ................ References . . . . . . . . .... ................
1 3 5
8 21 22 25
Malaria, Epstein-Barr Virus, and the Genesis of Lymphomas CHRISTINE I. 11. 111. IV. V.
A. FACER AND J. H.L. PLAYFAIR
Introduction ................................ The Epstein-Barr Virus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Burkitt’s Lymphoma Malaria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Malaria and the Immune System
...............................
34 46
68
A Review of Kaposi’s Sarcoma JANE
I. 11. 111. IV.
ARMES
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Clinical Features and Epidemiology of Kaposi’s Sarcoma ..................... Pathology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cell of Origin of KS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . V
73 73 76 76
vi
CONTENTS
Neoplasm or Hyperplasia? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . V. KS . VI . Etiology of KS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VII . Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
79
80 85 85
The Relationship between MHC Antigen Expression and Metastasis JACOB
GOPAS.BRACHARAGER.ZISMAN. MENASHEBAR.ELI. GUNTERJ . HAMMERLING. AND SHRAGA SEGAL
89 I . Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . I1. MHC Antigens. Tumorigenicity. and Metastasis in Animal Models . . . . . . . . . . . 91 111. MHC Regulation of Antitumor Immunity by Cytotoxic T Cells . . . . . . . . . . . . . . . 93 97 I v. MHC Regulation of Antitumor Immunity by NK Cells ...................... V. MHC Antigens. Tbmorigenicity. and Metastasis in Man ..................... 103 VI . Summary and Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 106 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
Genetics of Tumor Susceptibility in the Mouse: MHC and Non-MHC Genes
P. DEMANT. L . c. J . M . OOMEN.
AND
M . OUDSHOORN-SNOEK
I . Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . I1 . Site of Action of Tumor Susceptibility Genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111. Biology of Tumor Susceptibility Genes IV. Genetic Definition of lhmor Susceptibi V. Major Histocompatibility Complex-Structure and Function . . . . VI . Susceptibility to Epithelial Tumors and the Role of MHC .................... VII . Tumor Susceptibility Genes: Molecular and Cellular Perspective . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
117 119
150 169 170
Perspectives on the Role of MHC Antigens
BRUCEE . ELLIOTT.DOUGLAS A . CARLOW. ANNA-MARIE RODRICKS. AND ANDREWWADE I. I1 . I11. IV.
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Basis of Tumor Immunology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . The Biologyof MHC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . MHC Function . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
161
182 186 191
CONTENTS V. VI. VII. VIII. IX.
X.
MHC Expression in Malignancy.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Evidence for a Role of MHC Antigens in Malignancy ....................... Proposed Function of MHC in Malignancy ....... Regulation of Altered Class I MHC Expression in Malignancy. . . . . . . . . . . . . . . . Organ- and Tissue-Specific Effects on Immune Surveillance and Tumor Progression . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Concluding Remarks References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
vii 193 200 209 220 229 232 234
Antioxidants-Carcinogenic and Chemopreventive Properties
NOBUYUKI ITO I. 11. 111. IV. V. VI. VII.
INDEX
AND
MASAOHIROSE
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tumorigenic Effects of Antioxidants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Histopathological Characteristics of Antioxidant-Induced Tumors . . . . . . . . . . . . . Possible Mechanisms of Action of BHA in Forestomach Tumorigenesis . . . . . . . . . Modification of Carcinogenesis by Antioxidants Evaluation of Antioxidants as Human Hazards or Chemopreventers of Human Carcinogenesis Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . .......
.....................................................................
247 249 258 269 270 288 291 293 303
This Page Intentionally Left Blank
CONTRIBUTORS TO VOLUME 53 Numbers in parentheses indicate the pages on which the authors' contributions begin.
JANEARMES,Institute of Cancer Research, Chester Beatty Laboratories, London, England, SW3 6JB (73) MENASHEBAR-ELI,Department of Microbiology and Immunology, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheua 84 105, Israel (89) DOUGLASA . CARLOW,Mount Sinai Hospital Research Institute, Toronto, Ontario, Canada, M5G 1 x 5 (181) I? DEMANT,Division of Molecular Genetics, The Netherlands Cancer Institute, 1066 CX Amsterdam, T h e Netherlands (117) BRUCEE. ELLIOTT,Division of Cancer Research, Department of Pathology, Queen's University, Kingston, Ontario, Canada, K7L 3N6 (181) CHRISTINEA. FACER,Department of Haematology, T h e London Hospital Medical College, London, England, El 2AD ( 3 3 ) JACOB GOPAS,T h e Institute of Oncology, Soroku Medical Center, and Department of Microbiology and Immunology, Faculty of Health Sciences, Ben-Gunbn University of the Negev, Beer-Sheva 84 105, Israel (89) GUNTERJ. HAMMERLING, Institute f o r Immunology and Genetics, German Cancer Research Center, 0-6900 Heidelberg, Federal Republic of Germany (89) MASAOHIROSE,First Department of Pathology, Nagoya City University, Medical School, Mizuho-cho, Mizuho-ku, Nagoya 467, Japan (247) NOBUYUKI ITO, First Department of Pathology, Nagoya City University, Medical School, Mizuho-cho, Mizuho-ku, Nagoya 467,Jafian (247) L. C. J. M . OOMEN,Division of Molecular Genetics, T h e Netherlands Cancer Institute, 1066 CX Amsterdam, T h e Netherlands (117) M. OUDSHOORN-SNOEK, Division of Molecular Genetics, T h e Netherlands Cancer Institute, 1066 CX Amsterdam, T h e Netherlands (117) ix
X
CONTRIBUTORS TO VOLUME 59
J. H. L. PLAYFAIR, Department of Immunology, University College and Middlesex School of Medicine, London, England, W1P 9PG ( 3 3 ) BRACHARACER-ZISMAN,Department of Microbiology and Immunology, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Shew 84 105, Israel (89) ANNA-MARIE RODRICKS, Department of Oncology Research, Toronto General Hospital, Toronto, Ontario, Canada, M I G 2C4 (181) BARRETTJ . ROLLINS,Dimkion of Medicine, Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts 02115 (1) SHRAGASEGAL,Department of Microbiology and Immunology, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Shew 84 105, Israel (89) CHARLESD. STILES,Dimkion of Cellular and Molecular Biology, DanaFarber Cancer Institute, and Department of Microbiology and Molecular Genetics, Haruard Medical School, Boston, Massachusetts 02115 (1) ANDREWWADE, M I R Office, Faculty of Medicine, University of Calgay , Calgay,Alberta, Canada, T 2 N 1N4 (181)
SERUM-INDUCIBLE GENES Barrett J. Rollins' and Charles D. Stilest 'Oivision 01 Medicine. Dana-Farber Cancer Institute, Harvard Medical school, Boston, Massachusetts 02115 tDivision of Cellular and Molecular Biology, Dana-Fartmr Cancer Institute. and Department of Microbiology and Molecular Genetics, Harvard Medical School, Boston, Massachusetts 02115
I. Introduction 11. History: The Mitogenic Response to Serum A. Serum Requirement for Animal Cell Growth in Vitro B. Two Stages in the Mitogenic Response to Serum: Competence and Progression C. The Functional Components of Serum 111. Biochemistry: The Role of Transcription and Translation in the Mitogenic Response to Serum A. Relatively Minor Quantitative Transcriptional Changes in the Mitogenic Response to Serum B. Serum-Induced Transcription of Proliferation-Specific mRNA C. Requirement of Gene Expression for the Establishment of Competence IV. Molecular Biology: Serum-Inducible Genes and Their Products A. Proliferation-Related Proteins B. Growth Factor-Inducible mRNAs Detected by Differential Screening of Gene and cDNA Libraries C. Growth Factor-Inducible mRNAs Derived from Identified Genes D. Other Serum-Inducible mRNAs V. Perspectives VI. Addendum References
I. Introduction
Eagle, Temin, Holley, and others share in the important discovery that serum contains growth factors that are required for animal cell proliferation in vitro. The mitogenic response to these serum growth factors depends on transcription of unique-sequence genes and translation of their cognate mRNAs. Paradoxically, there is little change in the rate of transcription or translation during cell growth. Likewise there is little change in the complexity of mRNA during transit through the cell cycle. This paradox has been resolved by the observation that serum growth factors stimulate expression of a small number of vary labile messenger RNAs in their target cells. Specific gene sequences induced by serum growth factors have been identified. Of the many growth factors contained in serum, four have been exten1 ADVANCES IN CANCER RESEARCH, VOL. 53
Copyright 0 1989 by Academic Press, Inc. All rights of reproduction in any form reserved.
2
BAHRE’IT J . ROLLINS A N D C H A H L E S D. S T I L E S
sively studied in the context of the cell cycle and oncogene expression. These are platelet-derived growth factor (PDGF), epidermal growth factor (EGF), insulin like growth factors (IGF), and transforming growth factor p (TGF-P). This review will focus on genes for which expression is regulated by these four agents. Such genes can be grouped into two sets. The first consists of genes that respond to growth factors as a secondary consequence of transit through the cell cycle. For convenience, our laboratory refers to these as “progression genes.” The abundance of progression mRNAs fluctuates in cycling cells, and their induction is blocked when growth factors are added together with protein synthesis inhibitors such as cycloheximide. By these criteria, the progression genes encode familiar proteins such as the histones, thymidine kinase, and dihydrofolate reductase. Some cellular protooncogenes such as p53 and c-myb may also be contained within this group. The expression of other serum-inducible genes is clearly not dictated by cell cycle traverse. These have been termed “immediate early genes” by Nathans and colleagues and “cell division cycle genes” by Baserga. Our own laboratory refers to them as “competence genes”-a term that will be used hereafter only through force of habit. This set of genes is defined by superinduction of their expression in the presence of a growth factor plus a protein synthesis inhibitor. This review is primarily concerned with the structure and function of this set of genes. At least three cellular protooncogenes (c-myc, c-fos, and c-jun) are members of the competence gene family. The proteins encoded by these genes appear to function as intracellular mediators of the mitogenic response to growth factors such as PDGF. Other competence genes encode nuclear proteins that may be functionally related to these protooncogenes, although a direct link to cell cycle control and neoplasia has yet to be established. Still other competence genes encode proteins that cannot possibly function as intracellular mediators of growth factor action for the simple reason that they are secretory proteins. These proteins may play a systemic role in growth factor physiology. This review draws heavily on data generated by the examination of competence gene expression in density-inhibited murine connective tissue cells such as 3T3 cells. However, the central features of competence gene expression transcend cell and tissue boundaries. The response of lymphocytes to plant lectins such as concanavalin A (Con A) is especially instructive, and some of these data are reviewed. The molecular biology of the mechanisms that underlie competence gene induction is a rapidly developing area of investigation that is beyond the scope of this article. Readers are directed to several excellent reviews on signal transduction (Nishizuka, 1986; Rozengurt, 1986; Berridge, 1987).
SERUM-INDUCIBLE G E N E S
3
II. History: The Mitogenic Response to Serum
A. SERUMREQUIREMENTFOR ANIMALCELLGROWTHin Vitro In the late 1940s and 1950s, the growth requirements of animal cells in culture were explored systematically by Eagle, Fisher, Puck, and others. Their studies led to a disappointing, but inescapable conclusion, which was formally described by Eagle (1955). No matter how enriched and complex the nutrient medium may be, animal cells could not proliferate unless a small amount of animal protein, typically blood serum, was present in the medium. The extent of cellular proliferation, and the final saturation density that normal fibroblasts attain in culture was shown to be proportional to the concentration of serum in the medium (Holley and Kiernan, 1968; Clarke et al., 1970). When normal fibroblasts in culture were deprived of serum for one or more days, they entered a state of Go growth arrest. Addition of high concentrations of serum to these cells induced them to leave the Go state, progress through the G, phase of the cell cycle, replicate their DNA, and divide (Todaro et al., 1965; Burk, 1966, 1970; Wiebel and Baserga, 1969; Clarke et al., 1970; Dulbecco, 1970). The induction of DNA synthesis by serum occurred after a well-defined lag time of 12-16 hr after serum treatment. The precise length of this G , lag phase was cell type-specific, but was completely independent of the concentration of serum to which the cells were exposed (Temin, 1971; Brooks, 1975). It appeared that serum was inducing a metabolic change in cells that required 12-16 hr before it resulted in DNA synthesis. What was the nature of the metabolic change? The two opposing hypotheses were (1) that cells in low concentrations of serum were nutritionally starved, and exposure to high concentrations of serum simply replenished the cells’ nutrient pools, allowing them to resume growth; and (2) that serum induced the synthesis of a relatively short-lived macromolecular substance, the accumulation of which was necessary for cells to pass through G , into S phase (Pardee, 1974). Transient exposure, or “pulse” experiments argued against the first hypothesis. If quiescent cells in low concentrations of serum were exposed to high serum concentrations for only 3 hr and then placed back into low serum, the cells still underwent DNA synthesis after the obligatory 12-hr delay (Todaro et al., 1965; Wiebel and Baserga, 1969; Burk, 1970; Temin, 1971). Rather than replenishing nutrients, serum induced a metabolic change that persisted in the absence of continuous exposure to serum. Furthermore, cells were committed to this metabolic change after a relatively brief exposure to serum.
4
BARRETT J. ROLLINS A N D CHARLES D . STILES
B. Two STAGESI N THE MITOGENICRESPONSETO SERUM:COMPETENCE AND PROGRESSION Attempts to isolate the mitogenic activity contained in serum had been fraught with failure for many years. Fractionation of serum usually led to attenuation or loss of activity (Paul et al., 1971; Pierson and Temin, 1972), suggesting that serum contained multiple factors that acted synergistically to induce proliferation. The first step toward solving this problem came from the observation of Balk (1971) that while chick fibroblasts grew rapidly in serum, they grew poorly in platelet-depleted plasma. In fact, a heated extract of purified platelets could be shown to reconstitute serum activity when added back to platelet-free plasma (Kohler and Lipton, 1974; Ross et a l . , 1974; Rutherford and Ross, 1976). The activity in platelet extracts was subsequently identified as PDGF (Antoniades et al., 1979; Heldin et al., 1979). The discovery that platelet extract plus plasma could reconstitute serum carried a corollary observation that platelet extract alone or plasma alone were not mitogenic. Experiments in the late 1970s demonstrated that these two components of serum work sequentially on their target cells. Plateletderived growth factor exerted its effects first, and by itself induced a state termed competence (Pledger et al., 1977). When competent cells were exposed to platelet-poor plasma (PPP), they progressed through the cell cycle (Pledger et al., 1977, 1978; Vogel et al., 1978). Cells not previously treated with PDGF (i.e., not competent) would not respond to plasma. This two-step mitogenic sequence was initially discovered in fibroblasts. It has a direct parallel, however, in the mitogenic activation of resting T lymphocytes. If Go-arrested T cells are treated only with lectin (Con A or phytohemagglutinin, PHA), antigen, phorbol esters, or anti-T-cell receptor antibodies, they do not proliferate. While not sufficient to induce proliferation, these stimuli are necessary, and they all induce the appearance of the receptor for interleukin 2 (IL-2) on the T-cell surface (Robb et al., 1981; Cantrell and Smith, 1983, 1984; Stern and Smith, 1986). At a critical level of IL-2 receptor expression, binding of IL-2 to its receptors will induce cells to enter S phase (Leonard et al., 1982; Smith et al., 1983; Cantrell and Smith, 1984; Stern and Smith, 1986). Thus the initial exposure to lectin, antigen, phorbol ester, or anti-T-cell receptor is analogous to the induction of competence in fibroblasts by PDGF. Subsequent exposure to IL-2 is analogous to the cell cycle progression induced in competent fibroblasts by plasma. Just as treatment of fibroblasts with plasma alone does not induce cell cycle progression, treatment of noncompetent T cells with IL-2 alone does not .lead to DNA synthesis (Stern and Smith, 1986). Extensive similarities in the patterns of gene expression between competent fibroblasts and T lymphocytes will be described in detail later.
SERUM-INDUCIBLE GENES
5
C. THE FUNCTIONAL COMPONENTS OF SERUM The studies of Pledger et al. (1977)and Vogel et al. (1978)established that PDGF regulated the initial event in the mitogenic response of 3T3 cells, namely competence. The same studies indicated, however, that treating cells with PDGF alone was not sufficient for eliciting an optimal mitogenic response. Other factors contained in the PPP fraction of blood regulated progression of PDGF-treated cells through G, and into the S phase of the cell cycle. Subsequent work showed that the active components in plasma were the IGF’s and EGF or an EGF-like agent such as TGF-ol (Stiles et al., 1979). The history, biochemistry, and biology of PDGF (Ross et al., 1986), EGF and TGF-a (Carpenter and Cohen, 1979; Derynck et al., 1984; Lee et al., 1985), and the IGF’s (Blundell and Humbel, 1980) have been reviewed. For fibroblasts, the last functional component of serum to be identified was TGF-P (Massague, 1987; Sporn et al., 1986). Studies by Assoian et al. (1984) and Roberts et al. (1985) showed that TGF-P cooperated with PDGF and the progression factors (EGF and IGF’s) to promote anchorage-independent fibroblast growth. Later studies from the laboratories of Moses, Sporn, and others (reviewed in Massague, 1987; Sporn et al., 1986) showed that TGF-P would also inhibit the growth of most nonfibroblast cell types.
Ill. Biochemistry: The Role of Transcription and Translation in the Mitogenic Response to Serum
A. RELATIVELY MINORQUANTITATIVE TRANSCRIPTIONAL CHANGES IN THE MITOGENIC RESPONSE TO SERUM An extensive literature has documented alterations in macromolecular synthesis in response to serum. Many cell types, from fibroblasts to lymphocytes, have been shown to increase their rate of protein synthesis during the G, lag period (Lieberman and Ove, 1962; Todaro et al., 1965; Stanners and Becker, 1971; Ahearn et al., 1974; Johnson et al., 1974). Much of this increase appears due to the ability of serum to chase cytoplasmic mRNA from the unbound state into polyribosomes (Levine et al., 1965; Stanners and Becker, 1971; Rudland, 1974). In addition, however, the overall rate of RNA synthesis increases during the G, lag, and does so before the increase in protein synthesis occurs (Lieberman and Ove, 1962; Lieberman et al., 1963a; Levine et al., 1965; Todaro et al., 1965; Burk, 1970; Abelson et al., 1974; Johnson et al., 1974, 1975). The degree of increased RNA synthesis is the same even if cells are exposed to serum for a 3-hr pulse (Todaro et al., 1965; Burk, 1970; Johnson et al., 1974). The details of the RNA response to
6
BARRETIT J. HOLLINS A N D CHARLES D. STILES
serum are complex. The general increase in cytoplasmic RNA in stimulated cells is primarily due to an increase in ribosomal (rRNA) synthesis, but the relative increase in mRNA is much greater than that of rRNA (Johnson et al., 1974). The appearance of increased amounts of mRNA in the cytoplasm is due to an increased rate of processing and transfer of mRNA out of the nucleus, since the rate of hnRNA synthesis does not alter after serum treatment (Mauck and Green, 1973; Rovera et al., 1974; Johnson et al., 1975). Are these increases in the rate of protein and RNA synthesis necessary in order for cells to progress into S phase? This question has been answered by experiments using metabolic inhibitors. Addition of cycloheximide or puromycin to serum-stimulated cells prevents DNA synthesis (Harris, 1959; Powell, 1962; Lieberman and Ove, 1962; Terasima and Yasukawa, 1966; Kim et al., 1968; Wiebel and Baserga, 1969; Temin, 1971; Brooks, 1977). Inhibition of DNA synthesis occurs only if the inhibitors are added during the G , lag phase. They are no longer effective if the cells have already entered S phase (Mueller et al., 1962; Brooks, 1977). Similarly, treatment of cells with actinomycin D or 5,6-dichloro-a-~ribofuranosyl-benzimidazole (DRB) during the G, lag phase inhibits entry into S phase (Harris, 1959; Lieberman et al., 1963a,b; Baserga et al., 1965; Temin, 1971). There is also a genetic basis for the assertion that mRNA synthesis is required for progression into S phase. A temperature-sensitive cell cycle mutant of baby hamster kidney (BHK) cells has been described that does not synthesize DNA after serum stimulation at the restrictive temperature. This phenotype is caused by a temperature-sensitive mutation of RNA polymerase I1 (Rossini and Baserga, 1978). Furthermore, normal cell cycle responses to serum can be reinstated by microinjection of wildtype polymerase I1 into the nuclei of these mutant cells (Waechter et n l . , 1984). The metabolic inhibitor studies also suggest that the mRNAs and cognate proteins that are required for S-phase progression are unstable. Otherwise, their resynthesis during G, would not be necessary. Over 20 years ago, this hypothesis was tested by treating Chinese hamster ovary cells with serum followed by actinomycin D and cycloheximide. If cycloheximide is removed early after serum stimulation, these cells can still go on to synthesize DNA. By progressively delaying the removal of cycloheximide and determining the time at which DNA synthesis no longer occurs, the half-life of growthessential mRNAs can be estimated. This value was 2.9 hr (Tobey et n l . , 1966). Since cycloheximide alone can also inhibit RNA synthesis (Schniederman et aZ., 1971), the growth-essential product with a half-life of <3 hr could, in fact, be RNA or protein. The prescience of these results is impressive in the light of present knowledge about the metabolism of seruminducible gene products (see later).
7
SERUM-INDUCIBLE GENES
B. SERUM-INDUCED TRANSCRIPTION OF PROLIFERATION-SPECIFIC MRNA
The metabolic inhibitor studies cited earlier suggested that the seruminduced synthesis of mRNA and/or protein is necessary for resting cells to progress through G, and enter S phase. The studies did not, however, show that these newly synthesized macromolecules were specific for the proliferative state. In other words, the question left unanswered by these experiments was whether quiescent cells simply needed more of the mRNA and protein they already had in order to reenter the cell cycle, or whether they needed new species. The results of solution hybridization experiments suggested that growing cells did express genes that were not expressed in quiescent cells. Analysis of Rot kinetics of the mRNA from quiescent and serum stimulated cells showed no detectable differences in the complexity of these RNA populations, despite the 4- to 5-fold increased amount of RNA in the stimulated cells (Williams and Penman, 1975; Getz et al., 1976). In one study, however, cross-hybridization of quiescent cDNA to stimulated-cell mRNA was performed after removal of common, shared sequences. This revealed that 3% of the mRNA sequences present in proliferating cells were not present in resting cells. [When the cross-hybridization was carried out in the opposite direction, 3% of the mRNA sequences found in resting cells were not found in proliferating cells (Williams and Penman, 1975).] The authors of a second study (Getz et al., 1976) hybridized to completion cDNA from serum-stimulated cells to mRNA from quiescent cells. In this case, 57% less hybridization occurred compared to the hybridization of cDNA from serum-stimulated cells to mRNA from serum-stimulated cells-that is, self to self. In contrast to the results of Williams and Penman (1975), there was no difference in the amount of hybridization that occurred when cDNA from quiescent cells was hybridized to mRNA from either serum-stimulated or quiescent cells. Thus results obtained by two different techniques suggested that the vast majority of serum-induced mRNA species were not different from those already present in quiescent cells. However, a small percentage of the serum-inducible mRNAs were unique. Considering the abundance of rare sequence mRNA, the number of new mRNA species could be from 200 to 700 per cell. This suggested the possibility, but did not demonstrate, that serum could induce proliferation by inducing the expression of a small number of otherwise silent growth-related genes. C. REQUIREMENT OF G E N EEXPRESSION FOR COMPETENCE
THE
ESTABLISHMENT OF
As described in Section II,B, the earliest physiologic eEect of serum on quiescent cells is the estaldishment of competence, an effect mediated by
8
BARREIIT J . ROLLINS A N D CHARLES D. STILES
PDGF. What is the competent state? The methods used to answer this question were based on the properties of the various serum components described earlier. Since cells need competence factors such as PDGF to grow, their culture in the absence of PDGF (i.e., in PPP alone) will maintain them in a nonproliferative, Go-arrested state (Rutherford and Ross, 1976; Pledger et al., 1977). Addition of purified PDGF to such cells allows the isolated analysis of the establishment of competence. The salient characteristics of the establishment of competence are the following:
1. Cells can be made competent by a brief (30 min) exposure to PDGF (Pledger et al., 1977). 2. The competent state is stable for 13 hrs following removal of PDGF (Pledger et al., 1977). 3. Competence requires the synthesis of new RNA (Smith and Stiles, 1981). 4. Fusing a PDGF-treated cell to a quiescent cell results in the induction of competence in the untreated recipient (Smith and Stiles, 1981). 5. This transfer depends on the ability of the donor cell to synthesize RNA, but not protein; however, protein synthesis in the recipient cell is necessary. These data suggested that induction of competence was a result of RNA synthesis, that is, induced gene expression. The data did not distinguish between the induced expression of genes already being transcribed at a low level and the induced expression of genes that were not transcribed at all in the absence of PDGF. At the time these observations were made, however, the techniques of molecular analysis of gene expression were becoming widely accessible. These techniques demonstrated that the establishment of competence depended on the expression of otherwise silent genes, as described later. IV. Molecular Biology: Serum-Inducible Genes and Their Products
A. PROLIFERATION-RELATED PROTEINS One approach to the identification of proliferation-related proteins is to compare the proteins made by growth-controlled cells to those made by cells that have lost their growth control. Thus the major excretory protein (MEP) was identified as a M, 35,000 protein secreted by virally, chemically, or “spontaneously” transformed cells, which was not synthesized by normal cells (Gottesman, 1978; Doherty et al., 1985). Similarly, Croy and Pardee
SERUM-INDUCIBLE GENES
9
(1983) identified a M, 68,000 protein whose rate of synthesis and stability was greater in chemically transformed cells than in normal cells in the G, phase of the cell cycle. A protein with these characteristics fulfilled Pardee’s postulates that a short-lived protein was responsible for transition through the G, restriction point (Pardee, 1974). Such a protein might be expected to be expressed constitutively in transformed cells. Still, however, the functions of MEP and the M , 68,000 protein are unknown. Proliferation-related proteins have also been identified by their appearance in cells after stimulation by serum or serum growth factors. Treatment of 3T3 cells with serum leads to the synthesis of actin, collagen, and histone (Riddle et al., 1979). Several other proteins can be identified that appear only transiently. These include proteins of M, 80,000 (Ley, 1975), M, 50,000 (Gates and Friedkin, 1978), and M , 26,000 (Thomas et a l . , 1981). Actinomycin D inhibits the appearance of some, but not all of these proteins, suggesting the presence of transcriptional as well as translational control over their expression. Purified growth factors and other agents also lead to the induced appearance of specific proteins. The phorbol ester, 12-0-tetradecanoylphorbol-13-acetate (TPA) induces the synthesis of a cell-associated M, 32,000 protein within 2 hr of treatment in 3T3 cells (Hiwasa et al., 1982). The expression of this protein is controlled at the mRNA level, since TPA treatment induces the appearance of an increased amount of translatable mRNA for this protein. Treatment of Swiss 3T3 cells with fibroblast growth factor, EGF, PDGF, or TPA leads to the secretion of a M, 30,000-38,000 protein called mitogen-releasable protein (MRP) (Nilsen-Hamilton et al., 1980; Parfett et d., 1985). The MRP appears within 8 hr of stimulation with maximal secretion occurring at 24-36 hr. Its association with induction of the proliferative state is unclear, since its secretion is inhibited in cells prevented from entering S phase by hydroxyurea (Nilsen-Hamilton et al., 1980). Unlike MEP, MRP is not expressed in virally transformed cells, and while the presence of its mRNA can be demonstrated in BALB/c 3T3 cells, no protein is detectable (Parfett et al., 1985). Again, hnctions for these proteins have not been determined. Finally, Scher and colleagues (Pledger et al., 1981; Scher et al., 1983) have shown that treatment of quiescent BALB/c 3T3 cells with purified PDGF leads to the rapid appearance of four proteins in the range of M, 29,000-70,000. Control over their expression is exerted at the level of mRNA synthesis. In fact, PDGF can induce a generalized increase in translatable mRNAs within 2 hr in 3T3 cells (Hendrickson and Scher, 1983). These proteins are constitutively expressed in transformed 3T3 cells, and one of them (pII) has been shown to be identical to MEP (Scher et al., 1983).
10
BARRE’IT J . ROLLINS A N D CHARLES D. STILES
B. GROWTHFACTOR-INDUCIBLE mRNAs DETECTED SCREENING OF GENEA N D cDNA LIBRARIES
ny
DIFFERENTIAL
Differential screening of cDNA libraries has proved to be a powerful tool for the identification of growth-specific gene sequences. In general terms, a cDNA library is constructed using the mRNA from cells that are actively proliferating or that have been treated with a growth-promoting agent. The resulting clones are arrayed in duplicate, and one of the identical arrays is probed with radiolabeled cDNA derived from the mRNA of quiescent, nongrowing cells. The replicate array is probed with radiolabeled cDNA derived from the mRNA of growing or mitogen-treated cells. Clones that hybridize to the probe from proliferating cells but not to the probe from quiescent cells presumably contain sequences expressed at higher levels in proliferating cells. Alternatively, the radiolabeled cDNA probe from proliferating cells can be hybridized to unlabeled RNA or cDNA from quiescent cells, and the annealed species removed. This “subtracted probe” can be used to screen the cDNA library for proliferation-associated sequences. There are limits to the sensitivity of these protocols. Direct differential screening cannot detect sequences representing
1. Serum-lnducible Gene Expression Many investigators have isolated genes the expression of which is induced by whole serum. The following discussion presents, in roughly chronologic order, the results of such studies. It should be remembered, however, that serum contains several different growth factors and that not all serum-inducible genes will be PDGF-inducible, for example, and as such would not be involved in the establishment of competence. Nathans and colleagues have performed differential screening using two different cDNA libraries. The first was derived from cells that had been exposed to serum for 12 hr (Linzer and Nathans, 1983). Screening revealed that 0.5% of the cDNA clones represented sequences that were inducible by serum. One clone bore sequence similarity, but not identity, to mouse prolactin and was called proliferin (PLF) (Linzer and Nathans, 1984). Proliferin encodes a secreted protein that is expressed at high levels in placenta (Linzer et al., 1985). In fact, PLF is identical to the MRP described in Section IV,A. (Parfett et al., 1985). Considering the biology of serum-induced proliferation, it seemed unlikely that sequences such as these, whose maximal expression occurred at S phase (Linzer and Nathans, 1983),would play a role in the early response to
SERUM-INDUCIBLE GENES
11
serum. Thus Lau and Nathans (1985) screened a second cDNA library derived from 3T3 cells that had been treated with serum for only 3 hr in the presence of cycloheximide. Only 0.06% of the cDNA clones in this library represented inducible sequences, and of these there were <40 independent, non-cross-hybridizing sequences. One clone represented p-actin (Lau and Nathans, 1985). Five others were found to be transcriptionally induced at 40-120 min after serum stimulation and, like the competence genes (see later), superinduced in the presence of cycloheximide (Lau and Nathans, 1987). By analogy to the DNA viruses, these sequences were said to derive from immediate early genes. One of these clones bears homology to the protooncogene c-jun and has been named j u n B (Ryder et al., 1988). The protein product of c-jun is almost certainly identical to the transcription factor AP-1 (Bohman et a l . , 1987; Angel et al., 1988) (discussed more fully later). It seems likely, therefore, that jun B will also turn out to be a transcription factor that may modulate the expression of other proliferationrelated genes. Baserga and colleagues constructed a cDNA library from ts13 cells, a cell cycle mutant of BHK cells, treated for 6 hr with serum at their permissive temperature. Differential screening of this library showed that 0.8% of the clones represented serum-inducible sequences (Hirschhorn et al., 1984). Three of the genes could be induced by serum even at the restrictive temperature and in the presence of cycloheximide (Rittling et al., 1985), suggesting that their expression was directly induced by serum rather than induced as a result of cell cycle traverse. By analogy to the well-defined mutations in yeast, these sequences were said to have arisen from cdc (cell division cycle) genes. No direct evidence for their role in the cell cycle has been demonstrated yet. Sequence analysis has shown that one of these genes is identical to vimentin (Ide et al., 1986), and the predicted protein of another shows strong amino acid sequence similarity to a mitochondria1 ADP/ATP carrier (Battini et al., 1987). The third gene is similar to the calcium-binding domain of the p subunit of the SlOO protein (Calabretta et al., 1986a), suggesting that its hnction may be related to the cation fluxes that arc induced by growth factors in their target cells. The gene for this cDNA, called calcyclin, has been cloned (Ferrari et al., 1987), and promoter analysis has identified serum- and PDGF-responsive transcriptional elements (Ghezzo et al., 1988). In addition to hamster cells, the expression of these genes can be induced in human fibroblasts (Calabretta et al., 1985; Rittling et al., 1986) and in mouse fibroblasts (Rittling et al., 1985; Liu et al., 1985; Gibson et al., 1986). Vimentin and the ADP/ATP carrier, but not calcyclin, can be induced by treating peripheral blood mononuclear cells (PBMC) with PHA (Calabretta
12
BARRETT J . HOLLINS A N D CHARLES D. STILES
et al., 1985; Kaczmarek, 1985a,b; Gibson et al., 1986). If these PBMC preparations are cleared of adherent cells (i.e., monocytes and macrophages), PHA will only induce the ADP/ATP carrier (Kaczmarek et al., 1985a). Thus the expression of some of these genes, namely vimentin and calcyclin, appears to be cell type-specific. Parenthetically, calcyclin is expressed at high levels in myeloblasts from patients with acute myelogenous leukemia (Calabretta et al., 1986b). The significance of this expression is unknown. Denhardt and colleagues (Edwards and Denhardt, 1985; Edwards et al., 1985) synthesized single-stranded cDNA from 3T3 cells grown in serum. Abundant sequences were removed by hybridizing this material to mHNA from the same cells and passing the mixture over hydroxylapatite. The flowthrough single-stranded cDNA was used to build a library of 8000 clones. Differential screening revealed that many of the sequences actually decreased in abundance after serum stimulation. (Some of these were mitochondria] sequences whose decrease was more apparent than real as a result of an increase in nuclear RNA. One decreasing sequence was, however, derived from nuclear-encoded mRNA.) Several other sequences demonstrated induction after serum treatment. One of these contained a copy of an abundant, dispersed repetitive element, termed B2 (Krayev et al., 1982). This result is reminiscent of the ability of E G F to induce transcription of the VL30 repetitive element (see later). There is also evidence for cell cycle regulation of other endogenous repetitive elements (Augenlicht and Halsey, 1985), suggesting that this may be a general phenomenon associated with serum-induced proliferation. Again in consideration of the biology of inducible growth, Sukhatme et al., (1987) searched for genes that were likely to be involved in proliferative pathways in all cell types. Their criteria for such genes included rapid and transient activation by serum in the absence of protein synthesis, evolutionary conservation, and induction by different growth stimuli in diverse cell types. They differentially screened a cDNA library from BALB/c 3T3 cells treated with serum for 3 hr in the presence of cycloheximide. Of 10,000 clones screened, 0.8%represented inducible sequences. Half of these have been resolved into seven non-cross-hybridizing families. One clone was derived from c-fos, which satisfies their criteria and demonstrates the validity of their approach. Another sequence, termed egr-1 (for early growth response), displayed rapid induction in serum-stimulated fibroblasts, PHAstimulated T cells, ADP-stimulated kidney epithelial cells, and insulin-stimulated hepatoma cells (Sukhatme et al., 1987). Differential screening of a cDNA library from PC12 cells treated with nerve growth factor and cycloheximide resulted in identification of the identical sequence (as well as c-fos (Millbrandt, 1987). A function for the egr-1 protein has been inferred from its sequence. The
SERUM-INDUCIBLE GENES
13
predicted protein has three consensus zinc-finger repeat units (Sukhatme et al., 1988). This structure has been identified in the DNA-binding region of transcription factors such as TFIIIA (Miller et al., 1985) and is required in TFIIIA for initiation of transcription of the Xenopus laeuis 5s rRNA gene (Engelke et al., 1980). Zinc-fingers are also a structural feature of the proteins of segmentation genes in Drosophila, such as Kriippel (Preiss et al., 1985; Rosenberg et al., 1985). These proteins are believed to be transcription factors involved in developmental regulation. Thus the egr-1 protein is likely to be a transcription factor, although this has not been demonstrated directly. Interestingly, human egr-1 maps to 5q25-31, a chromosomal region in which deletions are associated with several leukemic and preleukemic syndromes (van den Berghe et al., 1985). An increasing number of regulatory proteins have been found to contain zinc-finger regions. This structure may represent a common essential element in several regulated pathways characterized by differential gene expression, including cell proliferation. For this reason, zinc-finger genes have been isolated on a structural basis alone. For example, the zinc-finger domain of the Drosophila Kriippel gene has been used to probe a mouse genomic library at low stringency (Chowdhury et al., 1987; Chavrier et al., 1988a). Several clones have been isolated that contain zinc-finger sequences. Chavrier et al. (1988b) have added this structural screening to the usual differential screening. They differentially screened a cDNA library from NIH 3T3 cells treated for 4 hr with serum and cycloheximide. The 70 clones representing inducible sequences were then screened with the Kriippel zinc-finger probe. One clone, called AC16, hybridized to the probe and was found to be derived from one of the genomic clones, called Krox 20, that had been identified earlier by Kriippel hybridization to the genomic library (Chavrier et al., 1988a). The mRNA for AC16 is induced within 15 min by serum and superinduced in the presence of cycloheximide. Its predicted protein has three zinc-finger regions with sequences in the fingers bearing similarity to the transcription factor SP1. Although this review has considered all proliferation-related genes identified to date, its primary focus has been those genes the expression of which is associated with the establishment of competence. As described in Section II,C., serum contains many growth factors, only one of which, namely PDGF, can induce competence. The other growth factors in serum, such as the IGF’s and TGF-P, can also modulate gene expression, although they are not competence factors. Thus among the serum-inducible mRNAs identified by differential screening, there should be mRNAs derived from genes that are not involved in the establishment of competence. As molecular-cloning techniques have improved, an increasing number of serum-inducible genes have been identified. For example, Almendral et al. (1988) differentially screened a cDNA library prepared from NIH 3T3 cells stimulated with
14
BAHRE'IT J . HOLLINS A N D CHARLES D. STILES
serum for 4 hr in the presence of cycloheximide. Of 200,000 phage plaques screened, 1.2% represented serum-inducible species, and of these, 82 noncross-hybridizing families could be identified, including c-myc and c-fos. While this is still a relatively small number of genes, it is greater than the 30-50 generally recognized in earlier studies or in the studies using a purified growth factor such as PDGF (see earlier). Some of these genes have the notable property of being transcriptionally active in the absence of serum, suggesting that serum induces the accumulation of their mRNAs by inducing their increased stability. mRNAs with this property have been identified by differential screening for IGF I-inducible sequences in 3T3 cells (Zumstein and Stiles, 1987)(see later). Since IGF I is present in serum, it is possible that some of the mRNAs identified by Almendral et al. (1988) will turn out to be IGF I-inducible, and thus not involved in the establishment of competence.
2 . PDGF-lnducible Gene Expression: Competence Genes In 1983, Stiles and colleagues (Cochran et al., 1983) used differential screening to identify gene sequences induced by PDGF. As described in Sections II,B and III,C, a brief exposure to PDGF induces competence in target cells by means of a transcriptionally dependent event. With this biology in mind, a cDNA library was prepared from 3T3 cells that had been treated with PDGF for only 3 hr. Differential screening of 8000 clones identified five families of inducible sequences representing 0.3% of the library. Two of these sequences, JE and KC, displayed substantial induction following PDGF treatment. The JE mRNA, for example, underwent 30-fold induction after 3 hr of PDGF treatment to an abundance level of 3000 copies per cell. As predicted for genes involved in the immediate response to growth factors, these mRNAs can be induced by PDGF in the presence of protein synthesis inhibitors. This suggested that no newly synthesized protein intermediate was required for their induction. In fact, cycloheximide alone could induce accumulation of their mRNAs, and in the presence of cycloheximide, PDGF superinduced these messages. Sequence and expression analysis of JE and KC showed that they encode secreted proteins (Hollins et al., 1988a; Oquendo et a l . , 1989). The KC protein is part of a family of proteins whose members include platelet factor 4 (Deuel et al., 1977; Hermodson et al., 1977), and connective tissue activating peptide i i I (Castor et al., 1983; J. C. Holt et al., 1986). It appears to be the murine homolog of the gro gene, described in humans and hamsters (Anisowicz et al., 1987).The JE protein is also a member of a large family of proteins. In this case, the function of the other members is unknown, but they all share the characteristic of being induced as part of a proliferative or activation signal. Other family members include TCA-3, a secreted pro-
SERUM-INDUCIBLE G E N E S
15
tein of activated T cells (Burd et al. 1987), MIP-2, a macrophage secretory protein of activated T cells (Wolpe et al., 1988), and LD78, a TPA-inducible protein from human tonsillar lymphocytes (Obaru et al., 1986). The expression of the JE and KC genes is restricted to particular cell types. KC can be expressed in mouse fibroblasts (Cochran et al., 1983) and macrophage-depleted PBMC (Kaczmarek et a1.,1985a,b). JE can be expressed in mouse fibroblasts (Cochran et al., 1983) and endothelial cells (Takehara et al., 1987), but not in epithelial cells or macrophage-depleted PBMC (Kaczmarek et al., 1985a,b). The tissue-specific pattern of expression of these genes may be related to their function, but this has not been demonstrated. A third gene derived from this library, termed r-fos (Cochran et al., 1984) or JB (Cochran et al., 1983), was found to have some nucleic acid sequence similarity to the protooncogene c-fos. While r-fos has not been further analyzed, the existence of fos-related genes and antigens (Cohen and Curran, 1988) will be discussed later. It has not been established whether or not these three PDGF-inducible genes play any role in the cell’s proliferative response to PDGF. The final two of the original five non-cross-hybridizing families of PDGF-inducible sequences have not been analyzed. 3. EGF-Inducible Gene Expression Genes inducible by E G F have also been identified by differential screening protocols. A cDNA library from polyoma-transformed rat 3T3 cells has been screened with a homologous probe from which normal rat 3T3 sequences has been subtracted. Of the five sequence families isolated, one novel sequence, TR1, was found to be induced by EGF (Matrisian et al., 1985a). Its role in cell growth is unclear, since mRNA identified by this sequence was not induced by serum. To look directly for EGF-inducible sequences, Matrisian et al., (1985b)differentially screened a cDNA library from rat 3T3 cells treated with EGF. This procedure identified sequences derived from actin and from four enzymes involved in glucose metabolism. Whatever role the protein products of these genes play in cell growth, they are clearly not mediators of the growth response to serum. 4 . IGF-Inducible Gene Expression Zumstein and Stiles (1987) were able to demonstrate the existence of IGF I-inducible mRNAs by differentially screening a cDNA library derived from IGF I-treated 3T3 cells. Approximately 0.15% of the clones in this library appeared to be derived from IGF I-inducible mRNAs. The induced expression of the majority of these mRNAs could occur in the presence of actinomycin D. Thus the accumulation of IGF I-inducible mRNAs is probably due to an enhancement of their stability by IGF I. Nothing is known
16
BARRETT J. ROLLINS AND CHARLES D . STILES
about the protein products of these genes or their function. Their expression, however, was correlated with enhanced survival of 3T3 cells in serum-free culture medium.
5. TGF-@-InducibleGene Expression There has been no systematic search for TGF-@-inducible mRNAs by differential screening, but several genes have been directly shown to be TGF-P-inducible. Most of the products of TGF-P-inducible genes are likely to be involved in this growth factor’s ability to elicit anchorage-independent growth. For example, TGF-P can induce the expression of both collagen and fibronectin (Ignotz and Massague, 1986; Ignotz et al., 1987). In fact, deletion mapping of the collagen a2(I) promoter shows that nuclear factor I (NFI) binding mediates the transcriptional activation of this gene by TGF-P (Rossi et al., 1988). In addition, TGF-@can induce the expression of c-sis (Leof et al., 1986), suggesting the presence of an autocrine growth-stimulatory pathway triggered by TGF-@ in some cell types. 6. VL.30 The first example of cloning a growth-related gene sequence was actually an exception to the technique of differential screening described earlier, although the concept is the same. In 1982, Foster and colleagues (1982) stimulated AKR-2B mouse embryo fibroblasts with EGF. They screened duplicate arrays of a mouse genomic library with cDNA derived from the stimulated cells, and cDNA derived from quiescent cells. Three clones that hybridized to the probe from stimulated cells did not hybridize to the probe from quiescent cells. All three clones contained a repetitive element, called VL30, related to an endogenous retrovirus (Foster et al., 1982). It was then shown directly that EGF induced the appearance in AKR-2B cells of polyadenylated RNA that hybridizes to VL30 sequences (Courtney et al., 1982). The significance of this induction and its possible role in the proliferative response is unknown.
7 . Host Genes Associated with SV40 Transformation Also in 1982, Levine and colleagues (Schutzbank et al., 1982) constructed a cDNA library using the mRNA from simian virus 40 (SV40)-transformed 3T3 cells. This library was differentially screened using radiolabeled mRNA from the same SV40-transformed 3T3 cells and from the normal parental 3T3 cell line. Of only 430 clones screened, 9 displayed increased expression in SV40-3T3 cells compared to normal 3T3 cells. The following year, Rigby and colleagues (Scott et al., 1983) also made a cDNA library from SV40transformed 3T3 cells. In this case, 64,000 clones were screened with a subtracted probe from the SV40 transformants. Forty-two clones belonging
SERUM-INDUCIBLE GENES
17
to four non-cross-hybridizing sets were isolated. One of these clones, called pAG64, was found to consist of two separable sequences. One set of sequences hybridized to a repetitive genomic element, while the other hybridized to a unique element (Brickell et al., 1983). The unique element corresponded to the mRNA for the major histocompatibility antigen H2-D, (Brickell et al., 1985). The observation that treatment of mouse spleen cells with PHA led to the expression of pAG64 (Brickell et al., 1983) strengthened the association between this gene’s induced expression and cellular proliferation.
8. Gene Expression-Induced T Lymphocytes Differential screening has also been used to identify proliferation-related genes in T lymphocytes. One TPA- and PHA-inducible sequence of unknown function has been isolated from Jurkat cells (Arya et al., 1984), and several uncharacterized inducible clones have been identified in human T cells treated with Con A and cycloheximide (Forsdyke, 1985). A central feature of T-cell activation (which may also be true for fibroblasts) is that induction of proliferation is accompanied by the secretion of a large number of proteins. It has been estimated that when resting T-helper cells are activated, as many as 15% of their newly synthesized proteins are secreted (Zurawski et al., 1986). Thus it is not surprising that several of the inducible genes isolated from T cells encode secreted proteins. These include characterized proteins such as preproenkephalin (Zurawski et al., 1986), as well as uncharacterized secreted proteins such as TCA-3 (Burd et al., 1987). The latter protein bears a high degree of similarity to the PDGF-inducible JE protein from fibroblasts. C. GROWTHFACTOR-INDUCIBLE mRNAs
OF
IDENTIFIED GENES
Once the concept of growth factor-modulated gene expression was established, a search began to identify known genes whose expression could be induced as part of a proliferative signal. For many cell types, this search centered on oncogenes, while for T lymphocytes, it also included T-cell growth factors and their receptors.
1. c-myc Expression of the c-myc protooncogene is induced in cells within 1-2 hr of the administration of a proliferative stimulus in a number of experimental systems. These include PDGF-treated fibroblasts (Kelly et al., 1983; Greenberg and Ziff, 1984), lipopolysaccharide-treated B lymphocytes (Kelly et al., 1983), T lymphocytes treated with Con A, PHA, or anti-T-cell receptor (Kelly et al., 1983; Reed et al., 1986; Kronke et al., 1985; Granelli-Piperno et
18
BARRETr J . ROLLINS AND CHARLES 1). STILES
al., 1986; Shipp and Rheinherz, 1987), thyroid cells treated with thyroidstimulating hormone (TSH) (Colletta et al., 1986; Tromentano et al., 1986), IL-%treated mast cell precursors (Conscience et al., 1986), and regenerating liver (Makino et al., 1984; Goyette et al., 1984). Like other competence genes, c-myc mRNA can be superinduced in the presence of cycloheximide. In T cells, increased expression of c-myc accompanies both the induction of competence by anti-T-cell receptor antibodies (Shipp and Rheinherz, 1987) or phorbol esters (Granelli-Piperno et al., 1986), and the induction of progression by IL-2 (Reed et d.,1985; Granelli-Piperno et d., 1986; Shipp and Rheinherz, 1987). Several independent lines of evidence have firmly established a role for cinyc in cell growth. Deregulated expression of c-myc mRNA reduces or eliminates the cell’s requirement for exogenous growth factors (Armelin et al., 1984; Keath et al., 1984; Mougneau et al., 1984; Vennstrom et al., 1984; Rapp et al., 1985; Kelekar and Cole, 1986; Sorrentino et al., 1986; Stern et al., 1986; Cory et al., 1987). Microinjection of the c-myc protein into 3T3 cells also partially abrogates the need for serum in order for cells to enter S phase (Kaczmarek et al., 1985~).Finally, addition of c-myc antisense oligonucleotides to PHA-treated T cells inhibits their progression into S phase (Heikkila et al., 1987). Under certain conditions, cells can be induced to proliferate in the absence of c-myc expression, suggesting that the role of c-myc in proliferation is complex (Coughlin et al., 1985; Rozengurt and Sinnett-Smith, 1987). How c-myc exerts its mitogenic affect is unclear. The c-myc protein is a nuclear, DNA-binding protein (Persson and Leder, 1984), and on one hand, it may serve as a trans-acting transcriptional activator. For example, transfecting cells with a c-myc expression plasmid leads to increased transcription from the promoter of a cotransfected Drosophila heat shock gene (Kingston et al., 1984). On the other hand, there is evidence that the c-myc protein may directly promote DNA synthesis (Studzinski et al., 1986; Iguchi-Ariga et ul., 1987a,b;Classon et al., 1987). However, these findings are controversial (Gutierrez et al., 1987). 2. c-fos The protooncogene c-fos also encodes a nuclear phosphoprotein that binds, perhaps indirectly, to DNA (Sambucetti and Curran, 1986). Like cmyc, c-fos expression is induced in a variety of growth-stimulatory situations: PDGF or serum treatment of fibroblasts (Greenberg and Ziff, 1984; Kruijer et al., 1984; Muller et al., 1984; Cochran et al., 1984), Con A or phorbol ester treatment of T lymphocytes (Granelli-Piperno et al., 1986; Reed et al., 1986; Moore et al., 1986), IL-3 treatment of mast cell precursors (Conscience et al., 1986), and TSH treatment of thyroid cells (Colletta et al.,
SERUM-INDUCIBLE GENES
19
1986; Tromentano et al., 1986). Again, this induction occurs in the presence of cycloheximide, placing c-fos in the category of competence or immediate early genes. In contrast to c-myc, c-fos mRNA is induced within 10-15 min of growth stimulation and is undetectable by 120 min. Also unlike c-myc, cfos induction is restricted to cells in Go growth arrest in several cell types, including BALB/c 3T3 cells (Rollins et al., 1987)and T cells (Granelli-Piperno et al., 1986; Reed et al., 1986). However, this appears not to be true in other cell types (Bravo et al., 1986). Expression of c-fos is not uniformly associated with cell growth. For example, nerve growth factor-mediated differentiation of PC-12 cells and retinoic acid-induced differentiation of F9 teratocarcinoma cells are both accompanied by increased c-fos expression and cessation of growth (Curran and Morgan, 1985; Greenberg et al., 1985; Muller and Wagner, 1984). In 3T3 cells, however, expression of antisense c-fos transcripts prevents serum or PDGF-induced c-fos expression, and these cells remain arrested in Go/G1 (J. T. Holt et al., 1986; Nishikura and Murray, 1987). Nuclear microinjection of antibodies directed against the c-fos protein will achieve the same results (Riabowol et al., 1988). In the 3T3 cell system, c-fos, like c-myc, appears to be an intracellular mediator of the growth response to serum or PDGF. Recent data have shed light on the function of the c-fos protein. Cotransfection of v-fos with plasmids bearing test promoters demonstrated that v-fos expression was associated with trans-acting transcriptional activity, and that this activity was relatively target sequence-specific (Setoyama et al., 1986). Spiegelman and Curran and their colleagues have shown that a protein complex that includes the c-fos protein binds to the recognition site for the HeLa cell transcription factor AP-1 (Distel et al., 1987; Rauscher et al., 1988b; Franza et al., 1988). Thus c-fos is involved in the transcriptional regulation of other genes that presumably function in the growth response. The interaction between the c-fos protein complex and DNA may or may not be mediated directly by the c-fos protein (see later). It should also be mentioned that there are c-fos-related genes (Cochran et al., 1984) and c-fosrelated antigens (Curran and Morgan, 1985; Morgan and Curran, 1986; Sambucetti and Curran, 1986; Cohen and Curran, 1988) that behave in the same manner as c-fos. Whether they, too, are involved in transcriptional regulation remains to be demonstrated. As mentioned earlier, the c-fos protein complex binds specifically to the AP-1 transcription factor-binding site. This binding site shows strong sequence similarity to the binding site for the yeast transcriptional activator, GCN4 (Hope and Struhl, 1985; Angel et al., 1987; Lee et al., 1987). GCN4, in turn, shares amino acid sequence similarity in its DNA-binding domain with the viral oncogene c-jun (Maki et al., 1987; Vogt et al., 1987). And, as predicted, the product of the c-jun protooncogene is a sequence-specific
20
BARRETT J . ROLLINS AND CHARLES D . STILES
trans-activator of transcription similar to AP-1 (Bohman et al., 1987; Angel et al., 1988). 3. c-jun
Is the c-fos protein also similar to AP-1 or c-jun, or is its interaction with the AP-1-binding site mediated through another protein in the complex? In oiuo, the c-fos protein is intimately associated with another protein, called p39 (Curran et al., 1985). It is now known that p39 is the protein product of c-jun (Rauscher et al., 1988a). Thus the interaction of the c-fos complex with AP-1-binding sites is mediated through c-junlp39 contained in the complex. Furthermore, c-jun expression can be induced by serum with the same rapid response as that of c-fos, placing c-jun in the category of competence or immediate early genes (Rauscher et al., 1988a). Parenthetically, c-fos protein made by in uitro translation (i.e.. in the absence of associated c-jun /p39) also binds DNA, although probably not at AP-1 sites. This leaves open the possibility that the FOS protein itself may be a trans-acting transcriptional factor with a sequence specificity different from c-junlp39lAP-1. As noted before, a serum-inducible c-jun-related gene, j u n B , has been isolated. Genomic blotting analysis suggests the presence of a family of jun-related genes (Ryder et al., 1988). Thus there may be several serum-inducible transcription factors, each with a different sequence specificity. Together, they could orchestrate the pleiotropic response to serum growth factors. 4. Other Protooncogenes
Growth factors can induce the expression of other protooncogenes, but these differ from c-myc, c-jun, and c-fos in their delayed expression after stimulation. For example, serum induces the appearance of p53 mRNA and protein 6 hr after treatment, with maximal expression occurring at S phase (Reich and Levine, 1984). In 3T3 cells, serum can stimulate p53 expression in the absence of protein synthesis (Rittling et al., 1985), while in phorbol ester-treated T cells, cycloheximide decreases the level of p53 expression (Reed et al., 1986). Thus the question of whether p53 is a competence gene has not been definitely answered. Functionally, however, microinjection of a p53 expression plasmid into 3T3 cells could induce DNA synthesis in the presence of PPP (Kaczmarek et al., 1986). Conversely, microinjection of anti-p53 antibodies can partially block serum-stimulated DNA synthesis (Mercer et al., 1982, 1984). Thus p53 may also be an intracellular mediator of the response to competence factors. Both c-Ki-ras and c-Ha-ras expression can also be induced late in G, in 3T3 cells by serum (Campisi et al., 1984; Muller et al., 1984)or in regenerating liver by partial hepatectomy or carbon tetrachloride treatment (Goyette et al., 1983, 1984). The induction is only 3- to 5-fold in cultured cells and its significance is unclear.
SERUM-INDUCIBLE GENES
21
The protooncogene c-myb encodes a nuclear protein similar to c-fos,cmyc, and c-jun. Its expression is induced late in G, by serum treatment of fibroblasts (Thompson et al., 1986) and IL-2 treatment of T lymphocytes (Stern and Smith, 1986).Treatment of T cells with phorbol esters will induce c-myb expression, but protein synthesis is required (Reed et al. ,1986). Treatment of T cells with anti-T-cell receptor or anti-T11 antibodies will also induce c-myb expression, but only if the antibodies are mitogenic (Shipp and Rheinherz, 1987). Thus induced c-myb expression is not a direct response to growth factor treatment. Presumably IL-2 and IL-2 receptor must be synthesized and allowed to interact before c-myb expression can occur in T lymphocytes. 5. T-Lymphocyte-Specijc mlWAs
As mentioned before, the competence and progression model of cell growth applies well to T lymphocytes. In addition to c-myc, c-fos, and egr-l , other competence or immediate early genes expressed in T cells include IL-2, the IL-2 receptor, and y-interferon (IFNy) (Meuer et al., 1984; Reed et al., 1986; Granelli-Piperno et al., 1986). Stimulation of resting T cells with phorbol esters also induces expression of the transferrin receptor (Kronke et al., 1985; Reed et al., 1986), but this response requires protein synthesis, suggesting that it is not a direct response to growth stimulation. As with cmyb expression, induction of the transferrin receptor is probably due to synthesis of IL-2 and the IL-2 receptor (Neckers and Cossman, 1983). D. OTHERSERUM-INDUCIBLE mRNAs There are scattered reports of other genes whose expression is induced as a part of a growth-stimulatory program. As with many of the genes already described, these have not been shown to play a causal role in cell proliferation. They include actin (Greenberg and Ziff, 1984), calmodulin (Chafouleas et al., 1984), prolactin (Johnson et al., 1980; Murdock et al., 1982), M-CSF (Rollins et al., 1988a), and IL-6 (Kohase et al., 1987). Finally, expression of mRNA for the glucose transporter has been shown to be induced by PDGF (Rollins et al., 1988b). While the protein product of this gene is certainly related to cellular proliferation, no experiments have demonstrated its direct role in the mitogenic response to growth factors. V. Perspectives
This review has described, first, how cell biology and biochemistry predicted that gene expression would regulate cellular proliferation, and second, the extent to which there is evidence to support that prediction. The existence of growth genes is now well established and, as suggested by the
22
BAHRETT J. ROLLINS A N D CHARLES D. STILES
RNA hybridization kinetics experiments described in Section 111,B, the number of proliferation-specific mRNA sequences is small. Most of the differential screening analyses have identified fewer than 50 independent, noncross-hybridizing sequences. Those sequences identified directly (i.e., not by means of screening cDNA libraries) do not add substantially to this number. Tables I and I1 list the genes that have been identified as growth factorinducible. The genes are listed by functional category and by inducer, and the lists reveal that c-myc and c-fos (and probably c-jun, egr-1, and AC-16) do fulfill the predicted function of intracellular mediators of a growthstimulatory signal. Other genes, such as those for IL-2 and the IL-2 receptor, function in an extracellular and autocrine manner to achieve cell cycle progression. A third category of genes includes those for which the products are predicted to be intracellular, but for which the functions in growth are unclear. The unexpected category of growth factor-inducible genes is that of genes whose products are secreted. For T lymphocytes, cells known to affect their environment by means of lymphokines, the secretion of IL-2, IFNy, enkephalin, and even TCA-3 may not be surprising. Why, however, should fibroblasts secrete the products of the J E and KClgro genes so rapidly and directly after being stimulated to proliferate? Other inducible gene products from these cells, such as M-CSF and IL-6, are cytokines having heterologous cells as their targets. It seems likely that many of the as yet undefined inducible secretory gene products are also cytokines. The existence of growth factor-inducible secreted proteins serves as a reminder that in uiuo, cellular proliferation takes place in a larger context, namely the organism. T lymphocytes proliferate in response to antigenic challenge, and their secreted products help in the systemic response to foreign invaders. Fibroblasts proliferate in response to wounding or inflammation. Their proliferation-induced secretory products may have a systemic role to play in the organism’s defense against these insults. The role of gene expression in regulating cell proliferation is becoming more clearly understood. Major areas requiring further investigation include (1)how occupation of a growth factor receptor by its ligand results in gene expression, (2) the target genes for the newly identified inducible transcription factors, and (3) the functions of the so far undefined growth factorinducible genes. VI. Addendum
Since this review was written, several papers have appeared describing new members of the JE and KC family of proteins described in Sections
SERUM-INDUCIBLE GENES
TABLE I GROWTHFACTOH-INDUCIBLE GENES" Gene products Transcription factors c-jun/p39/AP-l AC 16/Krox-20? egr-I? c-fos c-myc? fos-related antigens? c-jun B? Nuclear proteins c-myc P53 Cytoplasmic proteins Signal transduction c-ras Calmodulin Calcyclin? Structural Actin Vimentin Other ADP/ATP carrier Cell surface proteins IL-2 receptor Glucose transporter pAG64/H2-Dd Secreted proteins JE KClgro IL-2 PLF IFNy IL-6 M-CSF Enkephalin TCA-3 Collagen Fibronectin Undefined cdc genes Immediate early genes M RP IGF I-inducible genes (1
Listed by function.
Section in text IV,C,3 IV,B,l IV.B.1 IV.C.2 and 3 IV,C, 1 IV,C,2 IV,B, 1 IV,C, 1 IV,C,4
IV,C,4 IV, D IV,B, 1 IV, D IV, B, 1 IV, B, 1 IV.C.5 IV, D IV,B,7 IV,B,2 IV,B,2 IV,C,5 IV,B, 1 IV,C,5 1V.D IV, D IV,B,8 IV,B,8 IV,B,5 IV,B,5 IV,B,l IV,B,l 1V.A; IV, B, 1 IV,B,4
24
B A R R E I T J . ROLLINS A N D CHARLES D. STILES
TABLE I1 GROWTHFACTOR-INDUCIBLE GENESIN NONHEMATOLOGICCELLS" Inducer Serum Cell division cycle (cdc) genes Calcyclin Vimentin ADPIATP carrier PLF Immediate early genes c-jun B Actin egr-1 AClGIKror-20 P53 c-ras PDGF Competence genes JE,KC c-myc c-fos fos-related antigens c-junlp39IAP-1 IL-6 M-CSF Glucose transporter EGF Glycolytic enzymes TR1 IGFs PI-15, PI-33 TGF-P Collagen, fibronectin a
Comments
Section in text
Identified by differential screening of cDNA library from BHK cells serumtreated for 6 lir
IV,B,l
Identified in 3T3 cells serum-treated for 12 hr Identified in 3T3 cells serum-treated for 3 hr
IV, B, 1 IV, B, 1
IV,B,1 Induced Induced Induced Induced
within within in late in late
15 min 15 min G, G,
IV, B, 1 IV,B,1 IV,C,4 IV,C,4
Identified in 3T3 cells PDGF-treated for 3 hr
IV,B,2
Induced Induced Induced Induced Induced Induced Induced
IV,C,l IV,C,2 IV,C,Z IV,C,3 IV,D IV, D IV, D
in in in in in in in
1-2 hr 15 min 15 min 15 min 1-2 hr 1-2 hr 4-6 hr
Identified by differential screening Identified in polyoma-transformed rat 3T3 cells
IV,B,3 IV,B,3
Identified by differential screening; fiinction unknown
IV,B,4
IV,B,5
Listed by inducing agents.
IV,B,2 and V. These include JE-like proteins: Act-2, the cDNA of which was isolated by differential screening of a cDNA library from phorbol myristate acetate (PMA)- and PHA-activated T lymphocytes (Lipes et al., 1988); and RANTES, whose cDNA was isolated by subtractive hybridization (activated T lymphocyte minus B lymphocyte) (Schall et al., 1988). Both are distinct
SERUM-INDUCIBLE GENES
25
from the three other JE-like proteins. Other family members more closely related to KC include 3-10c, a Staphylococcus enterotoxin-induced protein from human peripheral blood leukocytes (Schmid and Weissmann, 1987); IP-10, an IFNy-induced protein from the human monocytoid line, U937 (Luster and Ravetch, 1987);and 9E3 (Sugano et al., 1987)or CEF4 (Bedard et al., 1987) a protein present in src-transformed avian cells. The majority of these proteins are secreted upon activating cells that normally secrete cytokines as part of their activation or mitogenic program. This suggests that these proteins may also be cytokines of some sort. In addition, Richmond et al., (1988) have shown that gro is an authentic cytokine: it is a melanoma autocrine growth factor. The number of identified members of this superfamily of secreted proteins continues to increase, attesting to the importance of their physiologic role, which in large measure remains to be determined. ACKNOWLEDGMENTS The authors wish to thank Rhonda M.Walker for help in the preparation of this manuscript.
REFERENCES Abelson, H. T. Johnson, L. F., Penman, S . , and Green, H. (1974). Cell 1, 161-165. Ahearn, T., Sampson, J., and Kay, J. E. (1974). Nature (London) 248, 519-521. Almendral, 1. M., Sommer, D., Macdonald-Bravo, H., Burckjardt, J., Perera, J.. and Bravo, R. (1988). Mol. Cell. Biol. 8, 2140-2148. Angel, P., Imagawa, M., Chiu, R . , Stein, B., Imbra, R. J., Rahmsdorf, H. J., Jonat, C., Herrlich, P., and Karin, M. (1987). Cell 49, 729-739. Angel, P., Allegretto, E. A., Okino, S. T., Hattori, K., Boyle, W. J.. Hunter, T., and Karin, M. (1988). Nature (London) 332, 166-171. Anisowicz, A., Bardwell, L., and Sager, R. (1987). Proc. Natl. Acad. Sci. USA 84, 7188-7192. Antoniades, H. N., Scher, C. D., and Stiles, C. D. (1979). Proc. Natl. Acad. Sci. USA 76, 1809-1813. Armelin, H. A., Armelin, M. C. S., Kelly, K., Stewart, T., Leder, P., Cochran, B. C., and Stiles, C. D. (1984). Nature (London) 310, 655-660. Arya, S. K., Wong-Staal, F., and Gallo, R. C. (1984). Mol. Cell. Biol. 4, 2540-2542. Assoian, R. K . , Grotendorst, G. R., Miller, D. M., and Sporn, M. B. (1984). Nature (London) 309,804-806. Augenlicht, L. H., and Halsey, H. (1985). Proc. Natl. Acad. Sci. USA 82, 1946-1949. Balk, S. D. (1971). Proc. Natl. Acad. Sci. USA 68, 271-275. Baserga, R., Estensen, R. D., Petersen, R. 0..and Layde, J. P. (1965). Proc. Natl. Acad. Sci. USA 54, 745-751. Battini, R., Ferrari, S . , Kaczmarek, L., Calabretta, B., Chen, S.-T., and Baserga, R. (1987)./. Biol. Chem. 262, 4355-4359. Bedard, P.-A., Alcorta, D., Simmons, D. L., Luk, K.-C., and Erikson, R. L. (1987). Proc. Natl. Acad. Sci. USA 84, 6715-6719. Berridge, M. J . (1987). Biochem. Biophys. Res. Commun. 907, 33-45. Blundell, J. L., and Humbel, R. E. (1980). Nature (London) 287, 781-787. Bohman, D., Bos, T. J., Admon, A., Nishimura, T., Vogt, P. K., andTjian, R. (1987). Science 238, 1386-1392.
26
BARRETI' J. ROLLINS A N D CHAR'LES D . STILES
Bravo, R., Burckhardt, J., Curran, T., and Muller, R. (1986). E M B O J. 5, 695-700. Brickell, P. M., Latchman, D. S . , Murphy, D., Willison, K., and Rigby. P. W. J. (1983). Nature (London) 306, 756-760. Brickell, P. M . , Latchman, D. S., Murphy, D., Willison. K., and Rigby, P. W. J. (1985). Nature (London) 316, 162-163. Brooks, R. F. (1975).J. Cell. Physiol. 80, 369-378. Brooks, R . F. (1977). Cell 12, 311-317. Burd, P. R., Freeman, G . J . , Wilson, S. D., Berman, M., DeKruyff, R.,Billings, P. R., and Dorf, M. E. (1987).J. Zmmunol. 134, 3126-3131. Burk, R. R. (1966). Nature (London) 212, 1261-1262. Burk, R. R. (1970). E x p . Cell. Res. 63, 309-316. Calabretta, B., Kaczmarek, L., Mars, W., Ochoa, D., Gibson, C. W., Hirschhorn, R. R., and Baserga, R. (1985). Proc. Natl. Acad. Sci. USA 82, 4463-4467. Calabretta, B., Battini, R., Kaczmarek, L., de Riel, J. K., and Baserga, R. (1986a).J. B i d . Chem. 261, 12628-12632. Calabretta, B., Venturelli, D., Kaczmarek, L., Narni, F., Talpaz, M., Anderson, B., Beran, M., Baserga, R. (1986b). Proc. Natl. Acad. Sci. USA 83, 1495-1498. Campisi, J., Gray, H. E., Pardee, A. B., Dean, M., and Sonnenschein, G . E. (1984). Cell 36, 241-247. Cantrell, D. A., and Smith, K. A. (1983).J. E x p . M e d . 158, 1895-1911. Cantrell, D. A., and Smith, K. A. (1984). Science 224, 1312-1316. Carpenter, G., and Cohen, S. (1979). Annu. Reu. Biochem. 48, 193-216. Castor, C. W., Miller, J. W., and Walz, D. A. (1983). Proc. Natl. Acad. Sci USA 80, 765-769. Chafouleas, J. G . , Lagace, L., Bolton, W. E., Boyd, A. E., 111, and Means, A. R. (1984). Cell 36, 73-81. Chavrier, P., Lemaire, P., Revelant, O., Bravo, R . , arid Charnay, P. (1988a). Mol. Cell. B i d . 8, 1319-1326. Chavrier, P., Zerial, M., Lemaire, P., Almendral, J., Bravo, R., and Charnay, P. (19881)). E M B O J. 7, 29-35. Chowdhury, K., Deutsch. V., and Gruss, P. (1987). Cell 48, 771-778. Clarke, G. D., Stoker, M . G. P., Ludlow, A., and Thornton, M. (1970). Nature (London) 227, 798-801. Classon, M., Henrikkson, M., Sumegi, J., Klein, G . , and Hammaskjold, M.-L. (1987). Nature (London) 330, 272-274. Cochran, B. C., Reffel, A. C., and Stiles, C. D. (1983). Cell 33, 939-947. Cochran, B. C., Zullo, J . , Verma, I. M., and Stiles, C. D. (1984). Science, 226, 1080-1082. Cohen, D. R . , and Curran, T. (1988). Mol. Cell. B i d . 8, 2063-2069. Colletta, G . , Cirafici, A. M., and Vecchio, G. (1986). Science 233, 458-460. Conscience, J.-F., Verrier, B., and Martin, G. (1986). E M B O J. 5, 317-323. Cory, S., Bernard, 0.. Bowtell, D., Schrader, S . , and Schrader, J. W. (1987). Oncogene Res. 1, 61-76. Coughlin, S. R., Lee, W. M. F., Williams, P. W., Giels, G . M., and Williams, L. T. (1985). Cell 43, 243-251. Courtney, M. G., Schmidt, L. J., and Getz, M. J. (1982). Cancer Res. 42, 569-576. Croy, R. G., and Pardee, A. B. (1983). Proc. Natl. Acad. Sci USA 80, 4699-4703. Curran, T.,and Morgan, J. I. (1985). Science 229, 265-268. Curran, T., van Beveren, C., Ling, N., and Verma, I. M. (1985). M o l . Cell. B i d . 5, 167-172. Derynck, R . , Roberts, A. B., Winkler, M. E., Chen, E. Y., and Goeddel, D. V. (1984).Cell 38, 287-297. Deuel, T. F., Kerim, P. S . , Farmer, M., and Henrikson, R. L. (1977). Proc. Natl. Acud. Sci. USA 74, 2256-2258.
SERUM-INDUCIBLE GENES
27
Distel, R. J., Ro. H.-S., Rosen, B. S . , Groves, D. L., and Spiegelman, B. M. (1987). Cell 49, 835-844. Doherty, P. J . Hua, L., Liau, G., Gal, S . , Graham, D. E., Sobel, M., and Gottesman, M. M . (1985). Mol. Cell. Biol. 5, 466-473. Dulbecco, R. (1970). Nature (London) 227, 802-806. Eagle, H. (1955). Science 122, 501-504. Edwards, D. R., and Denhardt, D. T. (1985). Exp. Cell Res. 157, 127-143. Edwards, D. R., Parfett, C. L. J., and Denhardt, D. T. (1985). Mol. Cell. Biol. 5, 3280-3288. Engelke, D. R . , Ng, S.-Y., Shastry, B. S., and Roeder, R. (1980). Cell 19, 717-728. Ferrari, S . , Calabretta, B., de Riel, J. K., Battini, R., Ghezzo, F., Lauret, E., Griffin, C., Emanuel, B. S., Gurrieri, F., and Baserga, R. (1987). J. Biol. Chem. 262, 8325-8332. Forsdyke, D. R. (1985). Biochem. Biophys. Res. Commun. 129, 619-625. Foster, D. N., Schmidt, L., Hodgson, C. P., Moses, H. L., and Getz, M. J . (1982).Proc. Natl. Acad. Sci. USA 79, 7317-7321. Franza, B. R., Jr., Rauscher, F. J., 111, Josephs, S. F., and Cuuran, T. (1988). Science 239, 1150-1 153. Gates, B. J., and Friedkin, M. (1978). Proc. Natl. Acad. Sci. USA 75, 4959-4961. Getz, M. J., Elder, P. K., Benz, E . W., Stephens, R. E., and Moses, H. L. (1976).Cell7,255265. Ghezzo, F., Lauret, E., Ferrari, S . , and Baserga, R. (1988).J. Biol. Chem. 263, 4758-4763. Gibson, C. W., Rittling, S. R., Hirschhorn, R. R., Kaczmarek, L., Calabretta, B., Stiles, C. D., and Baserga, R. (1986). Mol. Cell. Biochem. 71, 61-69. Gottesman, M. M . (1978). Proc. Natl. Acad. Sci. USA 75, 2767-2771. Goyette, M., Petropoulos, C. J., Shank, P. R., and Fausto, N. (1983). Science 219, 510-512. Coyette, M., Petropoulos, C. J., Shank, P. R., and Fausto, N. (1984).Mol. Cell. Biol. 4, 14931498. Granelli-Piperno, A,, Andrus, L., and Steinman, R. M. (1986), J. Exp. Med. 163, 922-937. Greenberg, M. E., and Ziff, E. A. (1984). Nature (London) 311, 433-438. Greenberg, M. E . , Greene, L. A.. and Ziff, E. A. (1985).J. Biol. Chem. 260, 14101-14110. Gutierrez, C., Guo, Z.-S., Farrell-Towt, G . , Ju. M., and DePamphilis, M. C. (1987).Mol. Cell. Biol. 7, 4594-4598. Harris, H. (1959). Biochem. J. 72, 54-60. Heikkila, R., Schwab, G., Wickstrom, E., Loke, S. L., Pluznik, D. H., Watt, R., and Neckers, L. M. (1987). Nature (London) 328, 445-449. Heldin, C. H., Westermark, B., and Wasteson, A. (1979).Proc. Natl. Acad. Sci. USA 76,37223726. Hendrickson, S. L., and Scher, C . D. (1983). Mol. Cell. Biol. 3, 1478-1487. Hermodson, M., Schmer, G., and Kurachi, K. (1977).J. Biol. Chem. 252, 6276-6279. Hirschhorn, R. R., Aller, P., Yuan, Z.-A,, Gibson, C. W., and Baserga, R. (1984). Proc. Natl. Acad. Sci USA 81, 6004-6008. Hiwasa, T., Fuimura, S . , and Sakiyama, S. (1982).Proc. Natl. Acad. Sci. USA 79, 1800-1804. Holley, R. W., and Kiernan, J. A. (1968). Proc. Natl. Acad. Sci USA 60, 300-304. Holt, J. C . , Harris, M. E., Holt, A. M., Lange, E., Henschen, A., and Niewiarowski, S. (1986). Biochemistry 25, 1988-1996. Holt, J. T., Venkat Gopal, T., Moulton, A. D., and Nienhuis, A. W. (1986). Proc. Natl. Acad. Sci. USA 83, 4794-4798. Hope, I. A., and Struhl, K. (1985). Cell 43, 177-188. Ide, T., Ninomiya-Tsuji, Ferrari, S., Philiponis, V., and Baserga, R. (1986). Biochemistry 25, 7041-7046. Ignotz, R. A., and Massague, J. (1986).J. B i d . Chem. 261, 4337-4345. Ignotz, R. A., Endo, T., and Massague, J. (1987).J. Bid. Chem. 262, 6443-6446.
28
BAHRETT J. ROLLINS AND CHARLES D. STILES
Iguchi-Ariga, S. N . M., Itani, T., Kigi, Y., and Ariga, H. (1987a). EMBO J. 6, 2365-2371. Iguchi-Ariga, S. N. M., Itani, T., Kigi, Y., and Ariga, H. (1987b).Nucleic Acids Res. 15, 48894899. Johnson, L. F., Abelson, H. T.. Green, H., and Penman, S. (1974). Cell 1, 95-100. Johnson, L. F.,Williams, J. G., Abelson, H. T., Green, H., and Penman, S. (1975). Cell 4,6975. Johnson, L. K., Baxter, J. D., Vlodavsky, I . , and Gospodarowicz, D. (1980). Proc. Natl. Acad. Sci. USA 77, 394-398. Kaczmarek, L., Calabretta, B., and Baserga, R. (1985a). Biochem. Biophys. Res. Commun. 133, 410-416. Kaczmarek, L., Calabretta, B., and Baserga, R. (1985b).Proc. Natl. Acad. Sci. USA 82, 53755379. Kaczmarek, L., Hyland, J. K., Watt, R., Rosenberg, G . , and Baserga, R. (198%).Science 228, 1313-1315. Kaczmarek, L., Oren, M., and Baserga, R. (1986). Erp. Cell Res. 162, 268-272. Keath, E. J., Kelekar, A., and Cole, M. D. (1984). Cell 37, 521-528. Kelekar, A., and Cole, M . D. (1986). Mol. Cell. Biol. 6, 7-14. Kelly, K., Cochran, B. C., Stiles, C. D . , and Leder, P. (1983). Cell 35, 603-610. Kim, J. H., Gelbard, A. S., and Perez, A. G . (1968). Exp. Cell Res. 53, 478-487. Kingston, R. E., Baldwin, A. S., Jr., and Sharp, P. A. (1984). Nature (London) 312, 280-282. Kohase, M., May, L. T., Tamm, I., Vilcek, J., and Sehgal, P. B. (1987).Mol. Cell. Biol. 7,273280. Kohler, N., and Lipton, A. (1974). E x p . CeU Res. 87, 297-301. Krayev, A. S., Markusheva, T. V., Karnerov, D. A., Ryskov, A. P., Skryabin, K. G., Bayev, A. A,, and Georgiev, G. P. (1982). Nucleic Acids Res. 10, 7461-7475. Kronke, M., Leonard, W. J . , Depper, J. M.,and Greene, W. C. (1985).J. Exp. Med. 161,593598. Kruijer, W., Cooper, J . A., Hunter, T., and Verma, I. M. (1984). Nature (London) 312, 711716. Lau, L., and Nathans, D. (1985). E M B O J . 4, 3145-3151. Lau, L., and Nathans, D. (1987). Proc. Natl. Acad. Sci. USA 84, 1182-1186. Lee, D. C., Rose, T. M., Webb, N. R., and Todaro, G. J. (1985). Nature (London) 313, 489491. Lee, W., Mitchell, P., and Tjian, R. (1987). Cell 49, 741-752. Leof, E. B., Proper, J. A., Goustin, A. S . , Shipley, G. D., DiCorleta, P. E., and Moses, H. L. (1986). Proc. Natl. Sci. USA 83, 2453-2457. Leonard, W., Depper, J. M., Uchiyama, T., Smith, K. A., Waldmann, T. A,, and Greene, W. C. (1982). Nature (London) 300, 267-269. Levine, E. M., Becker, Y., Boone. C. W., and Eagle, H. (1965). Proc. Natl. Acad. Sci. USA 53, 350-355. Ley, K. D. (1975).J. Cell B i d . 66, 95-101. Lieberman, I., and Ove, P. (1962).J. B i d . Chem. 237, 1634-1642. Lieberman, I . , Abrams. R., Hunt, N., and Ove, P. (1963a). J. B i d Chem. 238, 3955-3962. Lieherrnan, I., Abrarns, R . , and Ove, P. (1963b).1.B i d . Chem. 238, 2141-2149. Linzer, D. 1. H., and Nathans, D. (1983). Proc. Natl. Acad. Sci. USA 80, 4271-4275. Linzer, D. I. H., and Nathans, D. (1984). Proc. Natl. Acad. Sci. USA 81, 4255-4259. Linzer, D. I. H., Lee, S.-J., Ogren, L., Talarnantes, F., and Nathans, D. (1985). Proc. Natl. Acad. Sci. USA 82, 4356-4359. Lipes, M. A., Napolitano, M., Jeang, K.-T., Chang, N. T., and Leonard, W. J. (1988). Proc. Natl. Acad. Sci. USA 85, 9704-9708.
SERUM-INDUCIBLE GENES
29
Liu, H. T., Gibson, C. W., Hirschhorn, R. R., Rittling, S., Baserga, R., and Mercer, W. E. (1985).1. Biol. Chem. 260, 3269-3274. Luster, A. D., and Ravetch, J. V. (1987). Mol. Cell. Biol. 7, 3723-3731. Maki, Y., Bos, T. J., Davis, C., Starbuck, and Vogt, P. K. (1987). Proc. Natl. Acad. Sci. USA 84, 2848-2852. Makino, R., Hayashi, K . , and Sugimura, T. (1984). Nature (London) 310, 697-698. Massague, J. (1987). Cell 49, 437-438. Matrisian, L. M., Glaichenhaus, N., Gesnel, M.-C., and Breathnach, R. (1985a).EMBOJ. 4, 1435-1440. Matrisian, L. M., Rautmann, G., Magun, B. E., and Breathnach, R. (1985b). Nucleic Acids Res. 13, 711-726. Mauck, J. C., and Green, H. (1973). Proc. Natl. Acad. Sci. USA 70, 2819-2822. Mercer, W. E., Nelson, D., DeLeo, A. B., Old, L. J., and Baserga, R. (1982). Proc. Natl. Acad. Sci. USA 79, 6309-6312. Mercer, W. E., Avignolo, C., and Baserga, R. (1984). Mol. Cell. Biol. 4, 276-281. Meuer, S. C., Hussey, B. E., Cantrell, D. A., Hodgdon, J. C., Schlossman, S. F., Smith, K. A., and Reinherz, E. L. (1984). Proc. Natl. Acad. S c i . USA 81, 1509-1513. Millbrandt, J. (1987). Science 238, 797-799. Miller, J . , McLachlan, A. D., and Klug, A. (1985). EMBOJ. 4, 1609-1614. Moore, J. P., Todd, J. A., Hesketh, T. R., and Metcalfe, J. C. (1986).J. Biol. Chem. 261,81588162. Morgan, J. I., and Curran, T. (1986). Nature (London) 322, 552-555. Mougneau, E., Lemieux, L., Rassoulzadegan, M., and Cuzin, F. (1984).Proc. Natl. Acad. Sci. USA 81, 5758-5762. Mueller, G . C., Kajiwara, K., Stubblefield, E., and Rueckert, R. R. (1962). Cancer Res. 22, 1084-1090. Muller, R., and Wagner, E. W. (1984). Nnture (London) 311, 438-442. Muller, R., Bravo, R., Burckhardt, J., and Curran, T. (1984).Nature (London) 312, 716-720. Murdock, G. H., Potter, E., Nicolaisen, A. K., Evans, R. M., and Rosenfeld, M. G. (1982). Nature (London) 300, 192-194. Neckers, L. M., and Cossman, J. (1983). Proc. Natl. Acad. Sci. USA 80, 3494-3498. Nilsen-Hamilton, M., Shapiro, M., Massoglia, S. L., and Hamilton, R. T. (1980). Cell 20, 1928. Nishikura, K., and Murray, J. M. (1987). Mol. Cell. Biol. 7, 639-649. Nishizuka, Y. (1986). Science 233, 305-312. Obaru, K., Fukuda, M., Maeda, S., and Shimada, K. (1986).J. Biochem. (Tokyo) 99,885-894. Oquendo, P., Alberta, J.. Wen, D. Z., Derynck, R., and Stiles, C. D. (1989).J. Biol. Chem. 264, 4133-4137. Pardee, A. B. (1974). Proc. Natl. Acad. Sci. USA 71, 1286-1290. Parfett, C. L. J., Hamilton, R. T., Howell, B. W., Edwards, D. R., Nilsen-Hamlton, M., and Denhardt, D. T. (1985). Mol. Cell. Biol. 5, 3289-3292. Paul, D., Lipton, A., and Klinger, I. (1971). Proc. Natl. Acad. Sci. USA 68, 645-648. Persson, H., and Leder, P. (1984). Science 225, 718-721. Pierson, R. W., and Temin, H. M. (1972).J. Cell. Physiol. 79, 319-330. Pledger, W. J., Stiles, C. D., Antoniades, H. N., and Scher, C. D. (1977). Proc. Natl. Acad. Sci. USA 74, 4481-4485. Pledger, W. J . , Stiles, C. D., Antoniades, H. N., and Scher, C. D. (1978). Proc. Natl. Acad. Sci. USA 75, 2839-2843. Pledger, W. J., Hart, C. A , , Locatell, K., and Scher, C. D. (1981). Proc. Natl. Acad. Sci. USA 78, 4358-4362.
30
BARRE'IT J . R O L L I N S A N D C H A R L E S D . STILES
Powell, W. F. (1962). Biochim. Biophys. Acta 55, 969-978. Preiss, A., Rosenberg, U. B., Kienlin, A., Seifert, E., and Jackle, H. (1985). Nature (London) 313, 27-32. Rapp, U. R., Cleveland, J. L., Brightman, K., Scott, A,, and Ihle, J . N. (1985). Nature (London) 317, 434-438. Rauscher, F. J., 111, Cohen, D. R., Curran, T., Bos, T. J., Vogt, P. K., Bohman, D ., Tjian, R.. and Franza, B. R., Jr. (1988a). Science 240, 1010-1016. Rauscher, F. J.. 111, Sambucetti, L. C., Curran, T., Distel, R. J . , and Spiegelman, B. M. (198813).Cell 52, 471-480. Reed, J. C., Sabath, D. E., Hoover, R . G., and Prystowsky, M. B. (1985). Mol. Cell. Biol. 5, 3361-3368. Reed, J. C., Alpers, J. D., Nowell, P. C., and Hoover, R. G. (1986).Proc. Natl. Acad. Sci. LISA 83, 3982-3986. Reich, N. C., and Levine, A. J. (1984). Nature (London)308, 199-210. Riabowol, K. Y., Vosatka, R. J., Ziff, E. B., Lamb, N . J., and Feramisco, J. R. (1988). Mol. Cell. B i d . 8, 1670-1676. Richmond, A., Balentien, E., Thomas, H. G., Flaggs, G., Barton, D. E., Spiess, J . , Bordoni, R . , Francke, U . , and Derynck, R. (1988). E M B O J . 7, 2025-2133. Riddle, V. G. H., Dubrow, R., and Pardee, A. B. (1979).Proc. Natl. Acad. Sci. USA 76, 12981302. Rittling, S. R., Gibson, C. W., Ferrari, S., and Baserga, R. (1985). Biochem. Biophys. Res. Commun. 132, 327-335. Rittling, S . R., Brooks, K. M., Cristofalo, V. 1.. and Baserga, R. (1986), Proc. Natl. Acad. Sci. USA 83, 3316-3320. Robb, R. J., Munck, A., and Smith, K. A. (1981).J . E r p . Med. 154, 1455-1474. Roberts, A. B., Anzano, M. A., Wakefield, L. M., Roche, N. S., Stern, D. F., and Sporn, M. B. (1985). Proc. Natl. Acad. Sci. USA 82, 119-123. Rollins, B. J., Morrison, E. D., and Stiles, C. D. (1987). Science 238, 1269-1271. Rollins, B. J., Morrison, E. D., and Stiles, C. D. (1988a).Proc. Natl. Acad. Sci. USA 85,37383742. Rollins, B. J., Morrison, E. D., Usher, P., and Flier, J. S. (1988b).J . Biol. Chem. 263, 1652316526. Rosenberg, U . B., Preiss, A., Seifert, E., Jackle, H., and Knipple, D. C. (1985). Nature (London) 313, 703-706. Ross, R . , Glomset, J . , Kariya, B., and Harker, L. (1974).Proc. Natl. Acad. Sci. USA 71, 12071210. Ross, R . , Raines, E. W., and Bowen-Pope, D. F. (1986). Cell 46, 155-169. Rossi, P., Karsenty, G . , Roberts, A. B., Roche, N . S.,Sporn, M. B., and de Combrugghe, B. (1988). Cell 52, 405-414. Rossini, M . , and Baserga, R . (1978). Biochemistry 17, 858-863. Rovera, G . , Mehta, S., and Maul, G. (1974). Exp. Cell Res. 89, 295-305. Rozengurt, E. (1986). Science 234, 161-166. Rozengurt. E., and Sinnett-Smith, J. W. (1987).J . Cell. Physiol. 131, 218-225. Rudland, P. S. (1974). Proc. Natl. Acad. Sci. USA 71, 750-754. Rutherford, R. B., and Ross, R. (1976)./. Cell Biol. 69, 196-203. Ryder, K., Lau, L. F . , and Nathans, D. (1988). Proc. Natl. Acad. Sci. USA 85, 1487-1491. Sambucetti, L. C., and Curran, T. (1986). Science 234, 1417-1419. Schall, T. J . . Jongstra, J., Dyer, B. J., Jorgensen, J., Clayberger, C., Davis, M. M., and Krensky, A. M. (1988).J . Zmmunol. 141, 1018-1025.
SERUM-INDUCIBLE GENES
31
Scher, C. D., Dick, R. L., Whipple, A. P., and Locatell, K. L. (1983). Mol. Cell. B i d . 3, 7081. Schmid, J . , and Weissmann, C. (1987).J. Intmunol. 139, 250-256. Schniederman, M. H . . Dewey, W. C., and Highfield, D. P. (1971).Exp. Cell Res. 67, 147-155. Schutzbank, T., Robinson, R., Oren, M., and Levine, A. J. (1982). Cell 30, 481-490. Scott, M. R. D., Westphal, K.-H.. and Righy, P. W. J . (1983). Cell 34, 557-567. Setoyama, C., Frunzio, R., Liau, G . , Mudryj, M., and de Combrugghe, B. (1986).Proc. Natl. Acad. Sci. USA 83, 3213-3217. Shipp, M. A., and Reinherz, E. L. (1987).J . Itnrnunol. 139, 2143-2148. Smith, J. C., and Stiles, C. D. (1981). Proc. Natl. Acad. Sci. USA 78, 4363-4367. Smith, K. A . , Favato, M. F., and Oroszlan, S. (1983).J . Zrnrnunol. 131, 1808-1815. Sorrentino, V., Drozdoff, V., McKinney, M. D., Zeitz, L., and Fleissner, E. (1986).Proc. Natl. Acad. Sci. USA 83, 8167-8171. Sporn, M. B., Roberts, A. B., Wakefield, L. M., and Assoian, R. K. (1986). Science 233, 532534. Stanners, C. P., and Becker, H. (1971).J. Cell. Physiol. 77, 31-42. Stern, D. F . , Roberts, A. B., Roche, N. S., Sporn, M. B., and Weinberg, R. A. (1986). Mol. Cell. Biol. 6, 870-877. Stern, J. B., and Smith, K. A. (1986). Science 233, 203-206. Stiles, C. D., Capone, G. T., Scher, C. D., Antoniades, H. N., Van Wyk, J. J . , and Pledger, W. J. (1979). Proc. Natl. Acad. Sci. USA 76, 1279-1283. Studzinski, G. P., Brelvi, 2. S., Feldman, S. C., and Watt, R. A. (1986).Science 234,467-471. Sugano, S . , Stoeckle, M. Y., and Hanafusa, H. (1987). Cell 49, 321-328. Sukhatme, V. P., Kartha, S . , Toback, F. G . , Tauh, R., Hoover, R. G., and Tsai-Morris. C.-H. (1987). Oncogene Res. 1, 343-355. Sukhatme, V. P., Cao, X., Chang, L. C., Tsai-Morris, C.-W., Stamenkovich, D., Ferreira, P. C. P., Cohen, D. R., Edwards, S. A., Shows, T. B., Curran, T., Le Beau, M. M., and Adamson, E. D. (1988). Cell 53, 37-43. Takehara, K., LeRoy, E. C., and Grotendorst, G . R. (1987). Cell 49, 415-422. Temin, H. M. (1971).J. Cell. Physiol. 78, 161-170. Terasima, T., and Yasukawa, M. (1966). E x p . Cell Res. 44, 669-672. Thomas, 6.. Thomas, G., and Luther, H. (1981). Proc. Natl. Acad. Sci. USA 78, 5712-5716. Thompson. C. B., Challoner, P. B., Neiman, P. E., and Groudine, M. (1986).Nature(London) 319, 374-380. Tohey, R. A., Anderson, E. C., and Petersen, D. F. (1966). Proc. Natl. Acad. Sci. USA 56, 1520-1527. Todaro, G. J., Lazar, 6. K., and Green, H. (1965).J . Cell. Cornp. Physiol. 66, 325-334. Tromentano, D., Chin, W. W., Moses, A. C., and Inghar, S. (1986).J . B i d . Chem. 261,39193922. van den Berghe, H., Vermaelen, K., Mecucci, C., Barbieri, D., and Tricot, G . (1985). Cytogenetics 17, 189-255. Vennstrom, B., Kahn, P., Adkins, B., Enrietto, P., Hayman, M. J., Graf, T., and Luciw, P. (1984). E M B O J. 3, 3223-3229. Vogel, A., Raines, E . , Kariya, B., Rivest, M.-J., and Ross, R. (1978). Proc. Natl. Acad. Sci. USA 75, 2810-2814. Vogt. P. K., Bos, T. J . , and Doolittle, R. F. (1987).Proc. Natl. Acad. Sci. USA 84, 3316-3319. Waechter, D. E., Avignolo, C., Freund, E., Riggenbach, C. M., Mercer, W. E., McGuire, P. M., and Baserga, R. (1984). Mol. Cell. Biochetn. 60, 77-82. Wiehel, F., and Baserga, R. (1969).J . Cell. Physiol. 74, 191-202.
32
BARRE'IT J . ROLLINS AND CHARLES D . STILES
Williams, J. G., and Penman, S. (1975). Cell 6, 197-206. Williams, J. G . , Hoffman, R . , and Penman, S. (1977). Cell 11, 901-907. Wolpe, S. D . , Davatelis, G . , Sherry, B., Beutler, B . , Hesse, D. G., Nguyen, H. T., Moldawer, L. L., Nathan, C. F . , Lowry, S. F . , and Cerami, A. (1988). I. E x p . Med. 167, 570-581. Zumstein, P., and Stiles, C. D. (1987). J . B i d . Chem. 263, 11252-11260. Zurawski, G., Benedik, M . , Kamb, B. J . , Abrams, J. S., Zurawski, S. M., and Lee, F. D. (1986). Science 232, 772-775.
MALARIA, EPSTEIN-BARR VIRUS, AND THE GENESIS OF LYMPHOMAS Christine A. Facer' and J. H. L. Playfairt 'Department of Haematology. The London Hospital Medical College, London, England E l 2AD tDePartment of Immunology, University College and Middlesex School of Medicine. London, England W1P 9PG
I. Introduction 11. The Epstein-Barr
Virus A. Virus Cycle and Immunological Control B. Immunoregulatory Defects C. EBV and B-Cell Neoplasia 111. Burkitt's Lymphoma A. Epidemiology B. Histology C. Evidence Linking EBV with eBL D. Chromosomal Translocations and Oncogenes E. Cofactors in the Genesis of BL F. Cytotoxicity to Lymphoma Cells G. Nature of the Target Cell IV. Malaria A. Malarial Endemicity B. Acquired Immunity to Malaria C. Evidence Linking Malaria with eBL D. Evidence for an Interaction between Malaria and EBV V. Malaria and the Immune System A. Protective Mechanisms of Host Immunity B. Parasite Evasion Mechanisms C. Pathological Consequences of Immunity D. Immunosuppression VI. Conclusions References
I. Introduction
Since the first description of African endemic Burkitt's lymphoma (eBL) in 1957, considerable thought and effort has gone into the understanding of this disease. Thus the most common cancer of children in the tropics has attracted admirable epidemiological studies that have linked the etiology of the lymphoma with the combined effect of a tropical disease agent, thought likely to be malaria, and infection with the Epstein-Barr virus (EBV). However, the etiology of African eBL still remains unclear and presents many medical and scientific challenges. For example, the involvement of malaria 33 ADVANCES I N CANCER RESEARCH, VOL. 53
Copyright Q 1989 by Academic Press. Inc.
All rights of reproduction in any form reserved.
34
CHRISTINE A. FACER A N D J. H . L. PLAYFAIR
needs elucidation. In addition, the observation that malaria-derived polypeptides appear to synergize with EBV in their effects on B cells (see Section IV) may well have implications on the final choice of antigens for inclusion into malaria subunit vaccines. The purpose of this review is to present an update and reappraisal of our current understanding of the pathogenesis of eBL with particular emphasis on the role of malaria and EBV and their respective interactions with the immune system in the genesis of the lymphoma. The first section will briefly cover the biology of EBV and its association with neoplasia together with a description of eBL with stress on the epidemiology of the disease, chromosomal translocations, and cofactors. This is followed by a description of recently acquired clinical and laboratory evidence implicating malaria as a possible cofactor. An infection with malaria results in a profound immunosuppression, both antibody- and cell-mediated, not only to the malaria parasite itself but also to a wide range of unrelated antigens. The next section covers the immunosuppressive features of malaria and their mechanisms to include evidence for malaria-induced immunosuppression to viruses. Finally, having collated all laboratory, clinical, and epidemiological data, we provide two possible hypotheses for the interaction of malaria and EBV in the pathogenesis of eBL. Future progress in our understanding of eBL may well evolve from convergence of interest in the immunology and molecular biology of both disease agents. II. The Epstein-Barr Virus
The following is in no way intended as a fully comprehensive account of the subject, and the reader is referred to several excellent reviews on EBV (Epstein and Achong, 1979; Crawford and Edwards, 1987). A vast literature has now accrued on the virus since its discovery and isolation from tumor tissue from a child in 1964 (Epstein et aZ., 1964). In fact, until the description of the human immunodeficiency virus (HIV), EBV was among the most researched, particularly in epidemiological and molecular terms, of all human viruses. It still remains a common widespread virus as indicated by seroepidemiological surveys (Henle and Henle, 1985). The Epstein-Barr virus is a potentially oncogenic primarily B lymphotropic, DNA herpesvirus of humans and subhuman primates. This restricted tropism relates to the distribution of the virus receptor, an epitope on the complement receptor 2 (CSdR, CR2, CD21) found on B lymphocytes (Delcayre et al., 1987). However, the virus also infects oropharyngeal and cervical epithelial cells, and reports have appeared of EBV DNA in CD4+ cells in three patients who developed fatal T-cell (CD4+) lymphomas (Jones et d.,1988) and in peripheral-blood CD4+ cells in a child with chronic active EBV infection (Kikuta et d . , 1988).
MALARIA, EBV,
A N D THE GENESIS OF LYMPHOMAS
35
Primary infection normally occurs in young children by horizontal transmission (virus in buccal “fluid”) without any accompanying disease. Following this exposure, virus-specific humoral and cellular immune responses develop but latent viral genomes persist in a small number of B lymphocytes (-1 x 105-10fi circulating B cells). Reactivation of these latent genomes produces a recrudescence of virus replication at some permissive site in the oropharynx. Socioeconomic class seems to be a very important factor in the age stratification of primary infection. Thus in developed countries in the Western world 90% of individuals are infected by adulthood, whereas in developing countries 99% of children are already infected by -3 years of age. A delayed primary infection to adolescence or beyond, is likely to be accompanied by the clinical symptoms of infectious mononucleosis (IM; for review see Epstein and Achong, 1979).
A. VIRUSCYCLE A N D IMMUNOLOGICAL CONTROL Following infection in uitro of susceptible small resting B cells (10%of the total circulating B cells in a healthy individual) by EBV, the cells undergo blast transformation, synthesize DNA, produce and secrete immunoglobulin (Ig; EBV is a potent B-cell mitogen), and eventually become immortalized into lymphoblastoid cell lines (LCL; Fig. 1). These EBV-transformed cells carry multiple copies of EBV DNA that replicate with host cell DNA and are transferred to daughter cells, leaving the viral genome copy number of each cell line constant. Recent evidence has shown that the terminal portion of virion DNA interacts with some specific (as yet unidentified) portion of host genome (Ragona et al., 1986). Only a minority of cells enter the productive phase resulting in viral progeny and cell death. There are a variety of EBVassociated antigens produced during this cycle of events (Fig. 1) (for review see Crawford and Edwards, 1987), and many of the coding genes have now been cloned. Interestingly, the pattern of EBV gene expression differs according to whether the virus is resident within a B cell or within an epithelial cell. This suggests that the host cell has some control over viral gene expression (B. Griffin, personal communication). Given that EBV in uitro replicates poorly in B cells (unless induced), how does it establish a productive infection in uiuo? It is now documented that the primary site of virus replication occurs not in B cells but in pharyngeal epithelial cells (Rickinson et al., 1985). Immunological control of EBV is maintained by both antibody and cell-mediated immune mechanisms. Virusneutralizing antibodies to glycoproteins associated with the virus replicative cycle (viral capsid antigen, VCA; early antigen, EA; membrane antigen, MA) have been extensively studied during primary infection (IM) and act by limiting the spread of virus from one target cell to another. The EBV serological profile in IM is distinct from that of healthy virus carriers or
36
CHRISTINE A. FACER A N D J. H . L. PLAYFAIR
FIG. 1. Sequence of EBV-encoded antigens following infection of a B lymphocyte. EBNA, EBV nuclear antigen; LYDMA, lymphocyte-detected membrane antigen; MA, membrane antigen; EA (D and R), early antigen (diffuse and restricted); VCA, viral capsid antigen.
immunosuppressed virus carriers. The latter group tend to have higher antiMA and -EA antibody titers when compared to healthy carriers (Rickinson, 1984). Cellular control mechanisms also come into action following a primary EBV infection. Studies have shown that the first line of defense are natural killer (NK) cells, the activity of which can be boosted by interferon (IFN) in vitro (Purtilo et al., 1984). Also activated rapidly during IM is an EBVspecific cytotoxic T-cell (CTL) response that is both class I and class I1 major histocompatibility complex (MHC)-restricted, although class I-restricted cells predominate. The class I1 antiviral CTL are of the helper cell phenotype and are CD4+ (Rickinson, 1986). It is likely that class I- and II-
MALARIA, EBV,
A N D THE GENESIS OF LYMPHOMAS
37
restricted CTL are important in viuo at different anatomical sites, or to eliminate altered cells of different tissues. Following every primary EBV infection, the cytotoxic effector cells play a vital role in the maintenance of immunological surveillance of the lifelong carrier state, whereby EBV is kept in check but never eliminated (Rickinson et al., 1981, 1985). The atypical lymphocytes seen in the peripheral blood in large numbers in IM are T cells presumably reactive to the viral infection (Sheldon et al., 1973). Similarly, the atypical lymphoblasts frequently seen in the peripheral blood of malaria patients (see Section IV, D) may be EBVspecific T cells. An in uitra T-cell regression assay based on the activity of CTL is now widely used for the assessment of defective EBV control in various immunodeficiency states (Moss et al., 1978). Originally, the viral-specific CTL were thought to recognize a single viral protein in association with MHC antigens. This viral determinant was named lymphocyte-detected membrane antigen (LYDMA) and was expressed on B cells soon after their infection and present on all LCL (Klein et al., 1976). However, it is now apparent that LYDMA is not a single entity but may well represent several processed viral antigens. For example, current evidence available suggests that the processed peptides of EBNA-2 may serve as LYDMA targets and that the lymphocyte membrane protein or LMP (a 60-kDa polypeptide with at least one domain exposed on the outer surface of the infected lymphocyte) may also act in this capacity. Evidence for the latter comes from the establishment of a murine model for effector cell responses to EBV. The transfection of the LMP gene into murine lymphoblasts induced both class I and class 11 antigen-restricted effector cells (Reiss et d.,1987). Experimental vaccination against EBV in laboratory animals may also result in the appearance of viral-specific CTL. Thus M. A. Epstein and colleagues (personal communication) have made the interesting observation that cotton-topped tamarins vaccinated with MA glycoprotein (gp 340) and a muramyl dipeptide analog formulation as adjuvant, not only produced very high titers of specific anti-gp 340 antibodies but also developed a good CTL response to the virus. B. IMMUNOREGULATORY DEFECTS A fully functional immune system is critical for the maintenance and control of an EBV infection. Failure may result in lymphomagenesis. Thus in Duncan’s syndrome (X-linked lymphoproliferative disease, XLP) there is a genetically determined failure of the specific T-cell response to EBV. As a result, the unchecked infected B cells become immortalized, resulting in a polyclonal B-cell lymphoproliferation that, in some cases, progresses to a
38
C HRISTINE A. FACER A N D J . H. L. PLAYFAIR
monoclonal proliferation and a monoclonal lymphoma (Abo et al., 1982). Prolonged immunosuppression can also predispose to defective humoral and cellular control over EBV. Thus a high incidence of tumors is seen in organ graft recipients receiving immunosuppressive therapy (Henle and Henle, 1985). These polyclonal tumors can progress to a malignant monoclonal lymphoma as in XLP (Hanto et al., 1982). The profound immunosuppression associated with HIV infection also predisposes to the development of polyclonal and monoclonal tumors. This aspect, particularly in relation to African AIDS (acquired immunodeficiency syndrome) and malaria, is discussed in Section VI of this review.
C. EBV
AND
B-CELLNEOPLASIA
Epstein-Barr virus is unique among the DNA viruses because of its strong association with two human malignancies, BL and nasopharyngeal carcinoma (NPC). The apparent differences in geographic distribution of the three main EBV-associated diseases (BL endemic in parts of Africa and New Guinea, NPC with a high incidence in Southeast Asia, and IM observed primarily in affluent countries) is now thought not to be related to strain variation, since no distinct antigenic differences or DNA sequences have been found (Bornkamm et al., 1980). A delay in primary EBV infection explains the apparent restriction of IM to Western countries. Thus genetic, environmental, nutritional, and other factors must explain the differences in distribution of BL and NPC. There are several distinct differences between the postransplant lymphomas and BL. The former are multiclonal and show no consistent chromosomal abnormality. Removal of the immunosuppressive treatment normally leads to regression of the tumors. In contrast, BL is a monoclonal tumor with characteristic chromosomal translocations, and the lymphoma cells are insensitive to T-cell control. The chromosomal translocations seen in BL that serve to activate oncogenes may be induced by the combined effects of EBV and malaria. Whatever the mechanisms behind these phenomena, they are as poorly understood as the spectrum of diseases attributed to the virus.
Ill. Burkitt’s Lymphoma A. EPIDEMIOLOGY
During the 1950s, Dennis Burkitt, a British surgeon working in Uganda, first described an extremely aggressive tumor occurring in African children, which had a predilection for certain sites such as the jaw and ovaries (Fig. 2)
MALARIA,
EBV,
A N D THE G E N E S I S OF LYMPHOMAS
39
FIG.2. Burkitt’s lymphoma ofthe jaw in a 5-year-old Zambian boy. (Photo: Acknowledgment to Dr. S. Lucas.)
(Burkitt, 1958). Now known as endemic Burkitt’s lymphoma (eBL), it is the most common and fastest-growing tumor of African children, with an incidence in endemic regions as high as 10 cases per 10,000 per year with a male predominance (boys 2.5 times as often afflicted as girls). For a full account of the epidemiology of BL the reader is referred to an excellent review of the
40
CHRISTINE A. FACER AND J . H. L. PLAYFAIR
FIG.3. World map showing the distribution of malaria and overlapping distribution of eBL. Hatched area, distribution of eBL; dotted area, distribution of malaria.
subject (de-Th6, 1982). The geographic restriction of BL to equatorial Africa and parts of New Guinea (Fig. 3) immediately alerts the malariologist, since it is in these regions that malaria is holoendemic (i.e., areas of heaviest malaria transmission as indicated by 75% of children with malaria-induced splenomegaly). This geographic association, first noted by Burkitt (1969), will be discussed in greater detail later. It is known that BL occurs in timespace clusters, (including multiple cases in one family) in some parts of Africa but not in others (Williams et al., 1978). Cases of the lymphoma occur rarely outside (designated sporadic BL, sBL) the high-incidence zones (Burkitt, 1969)and differ from the eBL in several respects (Table I). In particular, whereas 98% of African eBL cases are associated with EBV, only 12% of sBL cases are EBV-related (Crawford and Edwards, 1987). If EBV and a cofactor (found only in eBL regions) are to be implicated in the etiology of the tumor, any differences between eBL and sBL should be noted (Table I). The latest information suggests that there may be two classes of eBL. The first typically relapse within 3 months of treatment and remain drug-sensitive, and the second relapse within 5 years and are frequently drug-resistant. The possibility that different viral populations are involved is currently under investigation (B. G r a in , personal communication).
MALARIA, EBV,
A N D THE GENESIS OF LYMPHOMAS
41
TABLE I DIFFERENTIATION BETWEEN eBL AND sBL Feature Geographic distribution EBV genome positivity Immunoglobulin Cell differentiation stage c-myc Translocation breakpoints
0
eBL
sBL
Equatorial Africa, New Guinea 98% Cases
Europe, Middle East Japan, United States 12% Cases
Not secreted Early B cells
Secreted Late differentiated B cells. Truncates the c-tnyc gene within first intron or exon on chromosome 8
Clustered 5‘ of first c-myc exon on chromosome 8
Similar to mouse plasmacytomas.
B. HISTOLOGY Burkitt’s lymphoma is described as a poorly differentiated lymphocytic lymphoma (Burkitt and Wright, 1970). Macrophages scattered between the malignant B-lymphoid cells with cytoplasmic basophilia, give a “starry sky” effect, although this pattern is by no means pathognomonic in that it may also arise from other types of lymphomas.
C. EVIDENCE LINKING EBV
WITH
eBL
There is considerable seroepidemiological and histological evidence for an oncogenic role of EBV in eBL, as reviewed elsewhere (Epstein and Morgan, 1983)and summarized in Table 11. However, to date, all attempts to induce a malignant lymphoma phenotype i n uitro, either by infection of B cells with
EVIDENCEFOR EBV
TABLE I1 ETIOLOGICAL AGENT FOR eBL
AS AN
1. All children with eBL show high titers of antibodies to EB-viral antigens (and a unique pattern of reactivity). 2. Ninety-eight percent of cases of eBL show multiple copies (up to 1OOO) of the viral genome in tumor cells. 3. Pre-Burkitt sera show high titers (8-10 greater than the mean) of VCA antibodies. 4. EBV transforms B lymphocytes in oitro. 5. EBV transforms B lymphocytes in oioo to produce polyclonal tumors in subhuman primates and immunosuppressed subjects.
42
CHRISTINE
A.
FACER A N D J . H . L. PLAYFAIR
free virus or by transfection with EBV DNA, have met with failure. The reason for the existence of the EBV genome in different copy numbers and its maintenance in high copy numbers in eBL tumor cells remains unexplained. Two forms of EBV DNA have been detected: a circular DNA present in plasmids and a linear DNA integrated into the cellular DNA. In individual tumor cell lines, the site of EBV DNA integration remains stable and appears unrelated to the chromosomal translocations (see later). As mentioned earlier, the distribution of eBL does not appear to be related to EBV strain variation. However, serotyping for the variants of the EBNA-2 protein (EBNA-2A and -2B) in BL-endemic regions of New Guinea and Kenya, have shown that up to 40% of isolates tested typed as EBNA-2B (Young et al., 1986). Although type B isolates are rare in the West, the relevance of their distribution to the etiology of eBL remains questionable. EBNA-2 (a DNA-binding nuclear protein) is coded for by the LT-1 region of the viral genome and is regularly transcribed in immortalized cells (Klein and Klein, 1985a). Deletion of the LT-1 region results in failure of the virus to activate and immortalize normal lymphocytes (Menezes et al., 1975). Differences between EBNA-2A and -2B in this capacity are not known. D. CHROMOSOMAL TRANSLOCATIONS A N D ONCOGENES To date, all types of BL (endemic and sporadic) have been found to carry one of three specific chromosomal translocations (Table 111). The translocations involve a small segment of the long arm of chromosome 8 to one of three alternative sites on chromosomes 14, 22, or 2. The involvement of these sites is significant because the Ig heavy-chain genes, sites of active rearrangement, have been mapped to chromosome 14 and the X and K lightchain genes to chromosomes 22 and 2, respectively (Showe and Croce, 1987). It was suggested by Klein (1981) that an oncogene located at q 24 on chromosome 8 was activated as a result of the translocation by juxtaposition to a locus that is specifically and highly expressed in B cells. This speculation was supported when a cellular protooncogene (c-myc) was mapped to the translocated portion of chromosome 8 (Newmark, 1983). During the transTABLE I11 CHROMOSOMAL TRANSLOCATIONS I N BL Frequency Translocation
W)
Ig Gene Locus
t(8; 14) t(8; 22) t(8; 2)
75
Heavy chain (V, or J H ) Light chain Light chain
16 9
MALARIA,
EBV,
A N D THE G E N E S I S OF LYMPHOMAS
43
location, the c-myc locus is generally placed in a 5’-5‘ “head-to-head’’ configuration with one of the Ig heavy-chain regions (Klein and Klein, 198513). The interpretation of the mechanism whereby the c-myc-Ig juxtaposition activates c-myc is the subject of considerable research. However, current understanding suggests the following sequence of events leading to BL.
1. The c-myc protooncogene, well conserved and expressed in a variety of mammalian cell types, is important in controlling cellular differentiation and proliferation and is under strict homeostatic control (for review see Marcu, 1987). Its DNA-binding 62- to 64-kDa protein product has an indirect, as yet unknown role in DNA replication (Gutierrez et al., 1988), and is believed to be an intracellular mediator of mitogenic signals (Marcu, 1987). Expression of c-myc is downregulated in growth-arrested and differentiating cells. Alteration of normal c-myc expression by chromosomal translocation, retroviral insertion, or DNA amplification, is believed to represent an important step toward malignancy. 2. The current concept for activation of c-myc is dysregulation. The theory is that, following translocation to an active Ig locus, the c-myc gene comes under cis control and behaves as if it were part of the Ig locus itself (Klein and Klein, 1985b). Thus cells carrying the translocation and chronically stimulated to produce Ig (either antigen- or mitogen-induced), would have even greater enhanced c-myc expression. Interestingly, chronic malaria is an ideal candidate for provision of this stimulus (see next section). 3. Cells carrying the translocation would therefore be maintained in continuous division. That an enhanced c-myc expression is essential for the BL phenotype comes from the observation that when BL cells are fused with LCL (the latter represent a more advanced stage of B-cell maturation), the hybrids are phenotypically similar to their LCL parent (i.e., less malignant) and have a parallel downregulation of the translocated c-myc gene (Nishikura et al., 1983). Expression of c-myc is induced by mitogenic stimuli via activation of protein kinase C (Marcu, 1987). Interestingly, the level of protein kinase C in lymphocytes from malaria patients is two to three times greater than that in lymphocytes from control donors, indicating significant activation (and perhaps enhanced c-myc expression) of these cells (D. Gunapala and C. A. Facer, unpublished observations). It is important to note that the chromosomal translocations just mentioned can also be seen in the EBV-negative sBL (although the translocation breakpoints in EBL do differ; Table I) and in BL from non-malaria-endemic regions. Thus lymphomagenesis can proceed without the intervention of EBV or malaria. Klein and Klein (1986) have raised an interesting question. The break of the c-myc-carrying chromosome is assumed to be a random
44
CHRISTINE A. FACER A N D J. H . L. PLAYFAIR
event. Why then is c-myc so exclusively involved? One explanation is that other oncogene translocations to the Ig loci do occur but, unlike cells carrying c-myc translocations, come under strict growth control and are therefore never recognized. In addition, another question often raised is why the Ig loci are favored as recipients of the c-myc translocation. It is possible that DNA rearrangement during differentiation may be required to provide vulnerable recombination sites, and the only genes to do this are those of the immune system (Klein and Klein, 1985b).
E. COFACTORS I N THE GENESISOF BL Epstein-Barr virus lacks malignant capacity (per se), since (1)although it has a widespread distribution, high-incidence areas of BL and NPC are restricted, and (2)the lymphoblastoid cells resulting from transformation of B lymphocytes by EBV are not identical with lymphoma cells. In contrast to BL cells, they do not show chromosomal translocations, do not form colonies in soft agar, do not induce tumors in nu-nu mice (Nillson et al., 1977), and they differ phenotypically. However, it is pertinent to note that certain tumor promoters (e.g., 12-0-tetradecanoylphorbol-13-acetate; TPA) can upregulate c-myc expression when added to lymphoblastoid cells (Yamamoto and Zur Hausen, 1979). Although tumors can be induced in nonhuman primates following infection with EBV, these are polyclonal, develop within several weeks rather than years, and reveal no cytogenetic abnormalities (Johnson et al., 1983). These observations indicate that EBV cannot be the sole factor responsible for the development of BL, and that cofactors (promoters) present in BLendemic regions are involved. As mentioned earlier, holoendemic malaria, because of its relevant distribution and immunosuppressive potential, must be a prime suspect and will be discussed in greater detail in the following section of this review. Apart from malaria, other cofactors have been implicated (these of course could act in concert with malaria). For example, Purtilo and colleagues (1984) believe that, in African children, factors in addition to malaria render them mildly immunodeficient to EBV-namely, maleness, malnutrition, and infection with the measles virus. The fact that well-nourished children can develop BL and that a measles infection, though having a severe immunosuppressive effect (Borysiewicz et al., 1985), is only a single short acute infection, makes these two factors questionable. Other tropical parasitic disease might also be implicated. For example, two parasitic infections causing notable immunosuppression and polyclonal B-cell proliferation are African trypanosomiasis, or sleeping sickness, and schistosomiasis (Mortazavi-Milani et al., 1984; Bancroft and Askonas, 1985).
MALARIA, EBV,
AND THE GENESIS OF LYMPHOMAS
45
However, both infections are found characteristically in an older group of individuals outside the age range of BL patients. In addition, sleeping sickness is, of course, not found in other BL-endemic regions such a Papua New Guinea. Metabolic and nutritional deficiencies may also act as cofactors, perhaps alongside malaria. For example, the active metabolite of vitamin D,, la, 25dihydroxyvitamin D, I. la,25-(OH),-D3], is known to regulate the expression of c-myc whereby a deficiency enhances expression, and vice versa (Matsui et al., 1986; Manalagas, 1987). Does deficiency in vitamin D, occur in tropical Africa where BL is endemic? Surprisingly, clinical signs of vitamin D deficiency are common in tropical countries, since the low-calcium diet affects the efficiency of vitamin D utilization (Clements et al., 1987). Another study in East Africa has implicated the ingestion of an African medicinal herbal plant extract, which was found to enhance EBV-induced transformation in uitro (Osato et al., 1986). However, this does not explain the age prevalence of eBL unless, of course, the herbal medicine is given frequently for the treatment of malaria in children! The time-space clustering of eBL and the occasional familial reports suggest that a genetic component may be involved. Detailed studies are urgently required to determine if an HLA association exists and whether this relates to immunological control of EBV, malaria, or both infections. The report that two hemophiliac brothers infected by HIV who both developed EBV-positive BL, also had an identical HLA phenotype, makes it tempting to speculate that genetic factors played an important role in the evolution of the malignancy (Rechavi et al., 1987).
F. CYTOTOXICITY TO LYMPHOMA CELLS Two categories of in uitro-cytotoxic responses exist against lymphoma cells: (i) non-virus-specific responses mediated by NK and K cells, and (ii) allospecific responses mediated by T cells. Comparative studies using paired EBV-positive BL cell lines and LCL derived from the patient’s normal B cells superinfected in uitro with EBV, have shown that both are susceptible to EBV in vitro-activated NK cells (Rooney et al., 1984). However, the situation was different when sensitivity to CTL was assessed. Two groups have independently demonstrated that BL lines show relative CTL resistance whereas the autologous LCL were sensitive to lysis (Rooney et d., 1985);Torsteinsdottir et d., 1986). The reason for the discrepancy was not related to EBV strain variation but rather to the lower expression on BL cells of the following: EBNA-2 to 6, LMP, some leukocyte adhesion molecules, and certain class I polymorphic determinants. Thus using a sensitive radioimmunoassay with a monoclonal antibody
46
CHRISTINE A. FACER A N D J . H . L. PLAYFAIR
(mAb) to a common determinant of class I molecules, a 2- to 16-fold higher density of class I molecules was found on LCL compared to BL in over half the paired cell lines studied. Additionally, quantitative differences, located in the protein part of the class I molecule were also found (Jilg et al., 1986).
G . NATUREOF THE TARGET CELL Identification of the target B cell that finally evolves into a BL cell is important with regard to both the etiology of the lymphoma and the type of EBV infection established. Recent work based on a comparison of the surface phenotype of BL biopsy cells and BL lines established from these biopsy samples, has identified significant differences (Gregory et al., 1986). Thus using a selected panel of mAb, biopsy cells from cases of EBV-positive BL have been shown to possess a homogeneous surface phenotype with expression of the common acute lympholdastic leukemia antigen (CALLA, CDlO), the pan B surface marker (CD20), and the BL-associated glycolipid antigen (BLA). Unlike the BL cell lines, BL biopsy cells were always negative for the B-cell activation marker (CD23). The phenotypic differences were associated with differing patterns of viral gene expression. Thus BL cells showed a restricted pattern of EBV latent gene expression with either EBNA-2 or LMP or both not detectably expressed (Rowe et al., 1986). By contrast, BL cell lines progressed steadily after several passages in uitro to a more lymphoblastoid pattern of growth and synthesis of all the known latent gene products (EBNA-1, -2, -3, and LMP) as shown in Fig. 4. Immunohistological studies suggest that BL cells have a gerininal-cell (centroblast) origin. Malaria could play a role here, since it causes marked and chronic hyperactivity of germinal centers, so maintaining the cells in proliferating cycle and thereby increasing the chances of a random chromosomal translocation. A role for malaria would be enhanced if the centroblast involved represented a malaria antigen-stimulated cell. If this were the case then BL cells might be expected to produce mAb to malaria antigens. One obvious question leading from the centroblast hypothesis is why then is BL always extranodal? No explanation exists at present. IV. Malaria
Any discussion on a possible role for malaria in the genesis of eBL must first include consideration of aspects of the parasite and the disease pertinent to the situation. The following is only intended as a brief resum6 of the most relevant points. Various aspects of malaria have been reviewed by Strickland (1986).
P.
-1 d
m
m N
U
z a m z w-l
t
U
_1
m
-1
m
P.
a
n x C
0
c)
oi
.c a
48
CHRISTINE A. FACER A N D J . H . L. PLAYFAIR
A. MALARIALENDEMICITY Malaria is one of the most widespread diseases in the world, and conservative estimates indicate that some 200 million people carry the infection. A resurgence of malaria is currently under way as a result of the combined effects of insecticide resistance of the mosquito vector and the resistance of the parasite to chloroquine (CQ) and other antimalarial drugs. After the age of 12 months, almost every child in tropical Africa has malaria and at least 1 million children die of the disease every year. Malaria is an acute and chronic disease caused by protozoan parasites of the genus Plasmodium, and four species cause disease in humans: P . fahiparum, P. uiuax, P. malariae, and P. ouale. The most widely distributed is P . falciparum (predominantly in Africa, New Guinea, and parts of Asia), which can cause severe and frequently fatal malaria in children and nonimmune adults. Plasmodium uiuax, responsible for considerable morbidity but rare mortality, predominates in Latin America, Turkey, and the Indian subcontinent. It is not found in West African populations where the presence of the Duffy negative [ Fy(a-b-)] blood group phenotype confers resistance to the parasite. Plasmodium malariae has a wide distribution in the tropics and P . ovule occurs rarely in tropical Africa. Some of the primate plasmodia can produce disease in humans (natural or experimental), but such infections are rare and of no epidemiological significance. The distribution of malaria is shown in Fig. 3. The life cycle of the parasite is complex, involving multiple stages (sporozoites, merozoites, schizonts, and gametocytes) and the intervention of an anopheline mosquito as a vector (Fig. 5). The periodicity of schizogony varies among the species of Plasmodium, and it is schizogony that causes the classical intermittent fever and other symptoms of the infection. Following schizogony, merozoites are released into the blood where they invade susceptible erythrocytes and parasitemias of between 10 and 20% (parasitized red cells) are common with P . falciparum. In contrast, the other three species of malaria rarely cause parasitemias >2%. Malaria transmission, an important aspect of the disease when considering its involvement in eBL, presents two strikingly different epidemiological patterns. The stable form occurs where transmission is frequent normally throughout most of the year (holoendemic and hyperendemic areas). Thus inhabitants receive multiple new infections during the course of each year. Stable malaria is to be found throughout tropical Africa and parts of New Guinea, and is characterized by repeated severe infections and protracted periods of immunosuppression, most noticible in young children. Infected adults carry low (usually undetectable by standard light microscopy) parasitemias and thus rarely present with clinical symptoms of malaria. In contrast, unstable malaria presents in areas of low endemicity where transmis-
MALARIA,
EBV,
A N D THE GENESIS OF L Y M P H O M A S
49
FIG.5. Life cycle of Plasmodium falciparum. SZ, Sporozoite; MZ, merozoite; GT, gametocyte.
sion is seasonal-for example, the Indian subcontinent. The malaria immunity that develops in the indigenous population is low, and whenever infection occurs it is severe and spans all age groups including adults.
B. ACQUIREDIMMUNITY TO MALARIA The acquisition of immunity to malaria in endemic areas is renowned for the protracted period of time (some 10 years) necessary for its consolidation. Even after this period the immunity developed is not sterile, and it is estimated that around half of the adult population in endemic regions carry low-grade parasitemias without obvious clinical illness. The evolution of naturally acquired immunity, which is species-, strain-, and stage-specific, has been investigated by clinical and epidemiological
50
CHHISTINE A. FACER A N D 1. H . L. PLAYFAIH
studies in hyperendemic areas. Immune responses are complex and discussed in greater detail in Section V. Studies in The Gambia showed that infants up to the age of 6 months are rarely parasitemic (McGregor, 1986). Several malariostatic mechanisms may be in operation in the neonate to explain this situation, but the most effective of these is probably the transplacentally acquired malaria-specific IgG. This maternal Ig is gradually catabolized, and between 4 and 6 months of age, when a first parasitemia can be detected, titers are very low. As age progresses, so do episodes of acute malaria accompanied by high parasiternias and severe clinical illness (e.g., cerebral malaria). Peak severity of malaria is reached by the age of 2-3 years. If the child survives, then in the following years (3-10 years) he may have increasingly fewer attacks of severe malaria; interestingly, however, parasitemias can remain high, suggesting the development of “antitoxic” immunity, although there is no evidence as yet for its existence (but see Section V,A,2). The decreased clinical impact of malaria as age progresses bears an inverse relationship to the production of malaria-specific IgG, IgM, and IgA-thus implicating the importance of B-cell responses to the development of acquired immunity. Substantial increases in IgM followed by IgG, specific for the asexual stages of the parasite, have been described in African children (McGregor, 1986), with all subclasses of IgG showing malarial antibody activity (Facer, 1980b). Cellular immune responses are equally important in controlling parasite replication and growth and are discussed in greater detail later on (see Section V). It is becoming increasingly apparent that there may be a genetic diversity in the recognition of certain malaria antigens by CD4+ lymphocytes (in humans and in rodent models). This has obvious important implications in the case of antigens known to induce protective responses, particularly in relation to the development of potential malaria vaccines. In addition, nonspecific factors elaborated by leukocytes are known to cause intraerythrocytic death of the parasite (see Section V and reviews in Playfair, 1982; Allison, 1984). It is perhaps disheartening that, despite an accumulation of a wealth of data on the development of host protective mechanisms, today we still do not have one single in vitro assay or parameter than can confirm establishment of protective malaria immunity within an individual.
C . EVIDENCELINKING MALARIAWITH eBL 1 . Epidemiological and Clinical Evidence Several important developments in the last decade, particularly with respect to genetic events, have led to a closer understanding of the pathogenesis of BL. However, the etiology of the disease remains unclear. For
MALARIA,
EBV,
A N D T H E G E N E S I S OF LYMPHOMAS
51
TABLE IV EVIDENCE LINKING MALARIA WITH THE ETIOLOGY OF eBL E stahlished Endemic BL is only found in areas of holoendemic or hyperendemic malaria. Within a given endemic area, BL is not found (a) where there are pockets of no malaria or (b) in urban areas (absence of vector, use of antimalarials, insecticides, etc). Within an endemic area continuous malaria prophylaxis reduces incidence of BL. Within an endemic area the distribution of BL is similar to that for hyperreactive malarial splenomegaly. Peak age incidence of BL closely follows the peak age incidence of severe Plasmodium falciparum malaria. A correlation exists between P. falciparutn parasite rate and incidence of BL. Postmortem specimens from BL show heavy loading with malarial pigment. Experimental malaria infection of laboratory animals enhances the oncogenic potential of tumor viruses.
Unconfirmed The hemoglobin genotype AS may be underepresented in BL patients. A correlation exists between age incidence of BL and acquisition of maxiinurn levels of antimalarial immunoglobulin.
example, what is the sequence of molecular events that permits BL to develop at a frequency 20-100 times greater in tropical Africa than, say, in the United States? In contrast with most other cancers, BL has a well-defined epidemiological pattern that suggests the intervention of a cofactor within BL-endemic areas. There is now considerable epidemiological evidence for the role of malaria as a cofactor in the etiology of eBL (Table IV). The high degree of geographic correlation between the incidence rate of eBL and intensity of P . falciparum transmission, both on a global level and within individual countries, is undeniable (Fig. 3). Other species of malaria parasites are also transmitted in these areas, although P . falciparum predominates. Plasmodium ovule and P . malariae infections may possibly play a role but this is unlikely. Plasmodium vivax, though transmitted in East Africa, is of rare occurrence there; it is not found in West Africa at all and therefore does not explain cases of eBL found on that side of the continent. The correlation with intensive malaria transmission is demonstrated not only on a macroscale in terms of its worldwide distribution, but also on a microscale in terms of correlation with malaria infection. Thus Morrow (1985), in a study of BL on a district basis in Uganda, was able to show an
52
CHRISTINE A. FACER A N D J . H . L. PLAYFAIR
increased incidence of BL in areas where there was a high malaria parasite rate. However, no marked difference between malarial parasitemia in BL cases before diagnosis and in controls has been found (de-Th6 et al., 1978). An inverse association of BL with the hemoglobin AS genotype would provide strong evidence for the role of severe malaria. Sickle cells do not support the growth of parasites when exposed to low oxygen tensions in uitro, and this may explain why children with the sickle-cell trait tend to have a lower P . fulciparum parasitemias. As a result lower mortality rates, lower IgM levels, and reduced lymphoproliferation (as measured by spleen size) are found among AS individuals. However, most studies attempting to link BL with HbS have failed to reach statistical significance. Whether an inverse relationship exists between BL and other red-cell polymorphisms present in hyperendemic malarious areas requires assessment. For example, hereditary ovalocytosis, found on the coastal malarious regions of Papua New Guinea, protects against malaria (Castelino et ul., 1981). Are BL cases underrepresented in children with ovalocytosis? If so, then such information would provide strong supporting evidence for malaria as a cofactor. There is little difference between titers of malaria antibodies in BL patients and controls (Morrow, 1985). However, some of these studies had serious design problems, and a proportion of BL patients had received several courses of antimalarial drugs, which would have lowered the malariaspecific antibody titers. In addition, malaria antibody titers were assessed against the asexual parasite antigens using whole fixed parasites. We need to dissect the immune response to malaria in BL patients more closely to include antibody and cellular response to sporozoites and the sexual stages. Similarly, it is now possible to dissect the immune response to biochemically defined antigenic components of the erythrocytic (asexual) stages of the parasite using enzyme-linked immunosorbent assay (ELISA) and T-cell stimulation assays. For example, it would be of value to determine if children with high EBV VCA titers (i.e., those more likely to go on to develop BL) (de-ThC et al., 1978)respond differently to defined malaria antigens than do children with lower titers. As mentioned earlier, there is now evidence that a genetic components is involved in the immune response to the repeat region, (NANP),, of the P . falciparum circumsporozoite (CSP) protein (Grau et al., 1987b). Of interest here are preliminary findings from our laboratory showing that sera from patients with BL had significantly lower titers of anti(NANP), antibodies than did age-matched controls (C. A. Facer, unpublished observations). In a recent serological study of sera from BL patients, no linear correlation could be demonstrated between the markedly elevated titers of autoantibodies [anti-intermediate filament (IF) and anti-ssDNA] and VCA or EBNA titers (Vainio et al., 1983). The authors concluded that a factor inde-
MALARIA,
EBV,
A N D T H E G E N E S I S OF LYMPHOMAS
53
pendent of EBV causes an immunological balance and autoantibody production in the African children. That acute malaria infection may be the cause is supported by the observations that sera taken from Caucasian patients with an acute primary P . falciparum infection, also contain high titers of anti-IF autoantibodies (Mortazavi-Milani et al., 1983) and anti-ssDNA antibodies (Daniel-Ribeiro et al., 1984). Further support comes from the observation that normal human lymphocytes pulsed in vitro with malaria antigens produce a wide range of autoantibodies including those just mentioned (Kataaha
et al., 1984b). Finally, from 1978 to 1982, an attempt was made to suppress malaria in the entire child population of the North Mara region of Tanzania (Geser and Brubaker, 1985). The aim was to see whether by distributing minimal doses of C Q to all the children in the age group 5 10 years, the incidence of BL in the area would fall. Despite the increased case finding brought about by the research project, a decline in BL incidence was in fact observed. The catch was that cases had already begun to decline prior to the onset of C Q prophylaxis and that this fall was maintained in a control area where no prophylaxis was given. However, it cannot be ruled out that changes in the malaria burden did not contribute in some measure to the decline in BL during that period. Measurement of malaria parasitemias showed that just after malaria prophylaxis had been implemented, the prevalence of parasitemia dropped markedly but from then on climbed gradually despite continued prophylaxis. The reason for this was the progressive emergence of CQ-resistant P . fakiparum. Interestingly, since 1982, cases of BL have shown a dramatic increase from an incidence of 0.5 per 105 in 1981 to 7.0 per 105 in 1984, the highest figure since record-keeping began in 1964 (C. Draper and G . Brubaker, personal communication). This parallels a similar marked increase in malaria prevalence over the same period and tempts consideration that the two conditions are indeed related in some way. Chloroquine resistant strains of malaria may be more virulent because of their capacity to multiply at a faster rate as observed during in vitro culture (C. A. Facer, unpublished observation), and it is thus tempting to speculate that this feature might explain the dramatic increase in BL cases in this region. Obviously, more detailed epidemiological data are required to determine whether the progressive emergence of CQ-resistant P . falciparum is associated with an increase in cases of eBL. Another relevant observation to emerge from this study was that, during the period of effective malaria chemoprophylaxis, EBV VCA antibody titers remained stable. This suggests that the high VCA titers seen in malaria patients (Geser and Brubaker, 1985) may not result from polyclonal B-cell activation by malaria-derived mitogens. It is thought that high VCA titers reflect the severity of the original primary infection (de-Thb et al., 1978).
54
CHRISTINE A. FACER A N D J . H . L. PLAYFAIR
2 . Experimental Malaria and Virus-Induced Tumors Two studies in the past have indicated that mice experimentally infected with malaria develop a higher incidence of virus-induced lymphoma. Concurrent infection with a murine malaria parasite P. berghei yoelii, was found to enhance greatly the early incidence of malignant lymphoma (thymoma) in adult mice infected with Maloney virus (Salaman et al., 1969; Wedderburn, 1970). Of additional significance was the observation that concurrent infection with the virus greatly enhanced the malaria-related pathology (elevated parasitemia, anemia, splenomegaly). Thus the combination of an oncogenic virus and a malaria parasite enhanced the effect of either. In another study, 64% of mice infected with P. berghei eventually developed malignant lymphomas of viral origin (Jerusalem, 1968). The dual infection of the common marmoset (Callithrixjacchus) with P . knowlesi and EBV, however, failed to induce lymphoproliferative disease (Felton et al., 1984). But it must be acknowledged that the biology of the monkey parasite P. knowlesi is more akin to that of P. viuax than to P . falciparurn, and common marmosets are less susceptible to EBV-induced disease than their cousins the cotton-topped tamarins Sanguinus oedipus (Johnson et al., 1983).
D. EVIDENCE FOR
AN
INTERACTION BETWEEN MALARIA A N D EBV
Over the past few years a picture has begun to emerge of how malaria and EBV might interact, and Table V presents a summary of the relevant observations. TABLE V SUMMARY OF IMMUNOLOGICAL EVIDENCEFOR INTERACTION BETWEEN MALARIA AND EBV Malaria patients show impaired Tc control of EBV. NPC patients with high antimalarial antibody titers show enhanced defect in Tc control of EBV. Adult inhabitants of malaria-endemic regions show impaired Tc control of EBV. Lymphocytes from malaria patients spontaneously transform into LCL. Malaria antigens enhance normal lymphocyte transformation by EBV. Malaria-derived products stimulate D N A synthesis in established LCL. Malaria antigens are mitogenic for human B lyniphocytes (Tindependent and T-dependent) Animals infected with malaria shown impaired Tc responses to animal viruses.
MALARIA,
EBV,
AND THE GENESIS OF LYMPHOMAS
55
TABLE VI REGRESSIONOF EBV-INDUCEDB-CELLPROLIFERATION IN MALARIA
Group
Adults in malariaendemic region (Papua New Guinea) Children with acute Plasmodium fakiparum Adults with acute P. falciparum 0
Nonregressors at >5 X 105 cells/well
Nonregressors
14/55 (0/55p
25
References
(%)
4/9
44.4
8/20 (2/18)"
40.0
(OP
Moss et al. (1983)
Whittle et al. (1984)
(11.2p
Facer et al. (1987)
Values for controls (without malaria).
1 . EBV-Specific Tc Responses As discussed in Section 11, following a primary infection with EBV, specific HLA-restricted cytotoxic T lymphocytes (CD8+ and CD4+) play a control role in maintaining lifelong surveillance of the viral carrier state. Failure of this cellular surveillance leads to uncontrolled polyclonal proliferation of EBV-immortalized B cells. Thus organ graft recipients receiving therapeutic immunosuppressive regimens have high risk of developing malignant B-cell lymphomas. Removal of the immunosuppression results in tumor regression. Since malaria is markedly immunosuppressive (see Section V), does it have a similar effect on CTL control of EBV-positive B cells? The following studies (summarized in Table VI) provide evidence that it indeed does. Moss and colleagues (1983) compared the efficacy of EBV-specific T-cell cytotoxicity in adults from malaria-endemic and nonendemic regions of Papua New Guinea. There was a weaker control over EBV-infected B cells in the former group, indicating that even nonclinical malaria can result in a detectable immunosuppression to EBV. There was, however, no increase in the rate of spontaneous transformation (Moss and Burrows, 1986). In contrast, lymphocytes taken from adults with acute clinical malaria frequently spontaneously transform into LCL when placed in culture (Facer et al., 1984, 1987). Many of the transformed cells were B cells primed for malaria antigens, since, when cloned, the LCL proved to be a useful source of human mAb specific for a variety of P. falciparum antigens (P. K. Kataaha and C. A. Facer, unpublished observations).
56
CHRISTINE A. FACER A N D J , H . L. PWYFAJR
Whittle et al. (1984) examined a small group of Gambian children with acute P. falciparum malaria for evidence of abnormal EBV-specific T-cell cytotoxicity. Fifty percent of the group showed defective control of EBV in the in oitro assay, and this was reversible as shown by repeat experiments performed several weeks after therapeutic antimalarials. In our laboratory, acute primary P . falciparum infections in 20 nonimmune adults gave similar results (Facer et al., 1987). Taken together, the above observations indicate either an increased viral load within B-cells and/or a proportion of nonfunctional EBV-specific CD8+ cells. In agreement with Whittle and colleagues, we find that adult malaria patients also show a low CD4+-CD8+ ratio, sometimes to <1:0, as a result of a moderate decrease in CD4+ numbers and a markedly increased CD8+ population. The possibility of HIV infection of CD4+ lymphocytes can be excluded as a cause of the CD4+ lymphopenia, since the CD4+-CD8+ ratio rapidly returns to normal following treatment of the malaria and all patients were HIV-1 seronegative. The reduction in CD4+ numbers in the peripheral blood has been attributed to lymph node homing activities of these cells (Facer et a l . , 1986). The aforementioned studies thus show that during acute and chronic malaria the patient is likely to be in a sate of disequilibrium with regard to hostvirus balance, favoring poorly restrained polyclonal outgrowth of EBV-carrying B cells. Whatever the mechanism behind the reduced EBV control, the studies just discussed at last provide some immunological explanation for the geographic overlap of BL and malaria. The other EBV-associated human malignancy, NPC (a tumor of the squamous epithelium of the nasopharynx) is prevalent in parts of China and also appears in pockets of high incidence in North and Central Africa, Malaysia, and Iceland. Obviously some of these areas encompass regions endemic for P. falciparum malaria. It is of interest therefore that a report from Malaysia has described a greater defect of EBV-specific cytotoxicity in NPC patients living in malaria-endemic regions (who also had high anti-P. falciparum antibody titers) compared to NPC patients living outside these areas (Yadau and Prasad, 1985).
2 . Malaria Antigens and Lymphocyte Transformation Given that lymphocytes from malaria patients spontaneously transform in oitro, will lymphocytes from normal EBV-seropositive donors similarly transform if stimulated with malaria antigens in oitro? A recent comprehensive study showed that LCL can be obtained from the culture of peripheral blood mononuclear cells taken from normal donors if pulsed with supernatants from P. falciparum in oitro cultures (Kataaha et al., 1984a). In contrast, no enhancement of lymphocyte transformation was seen in control cultures containing either red-cell culture supernatants or mitogens (pokeweed mitogen, Salmonella paratyphi, Trypanosoma brucei homogenate, and P.
MALARIA,
EBV,
AND THE GENESIS OF LYMPHOMAS
57
knowlesi schizont sonicate). Transformation was via activation of EBV, since cells cocultured with the viral DNA polymerase inhibitor, phosphonoformic acid (PFA), along with malaria supernatants, failed to transform. Likewise, cord blood lymphocytes (which are EBV-negative) failed to transform when pulsed with malaria products (Facer et al., unpublished observations). Further experiments showed that the 195-kDa polypeptide purified from the schizonts of two different isolates of P.fakiparum (a West African and a Thai isolate) also enhanced lymphocyte transformation in oitro (Kataaha et al., 1984a). Since this polymorphic molecule is one candidate for inclusion into a malaria vaccine, further work is in progress to assess its EBV-enhancing potential. Cells from these immortalized LCL have been analyzed cytogenetically but were found to be diploid cells with normal G-banding patterns (Kataaha et al., 1984a). Enhancement of lymphocyte transformation may be partly explained by the fact that some malaria-derived products (including the 195-kDa polypeptide) are T-dependent and T-independent B-cell mitogens. Malaria-derived products released into the supernatants of continuous P . fakiparum cultures have mitogenic activity for a CD4+ subset. In contrast, the synthetic immunodominant sporozoite tetrapeptide (NANP),, preferentially activates both normal human B lymphocytes and EBV-genome-positive LCL (C. A. Facer and D. Gunapala, unpublished observations). Evidence that certain mitogens may enhance lymphocyte transformation by EBV originally came from the observation that phytohemagglutinin (PHA), a CD4+ mitogen, had enhancing activity identical to that of malaria antigens, in that it prevented cell cultures from EBV-seropositive donors from regressing (Moss et al., 1978). How PHA takes effect remains unknown, although the results suggested that a likely explanation was that it interfered with an initial T-cell activation phase rather than with the effector mechanism itself. In addition to mitogens, several other substances have been identified that, when added exogenously to cultures, are capable of enhancing lymphocyte transformation by EBV in oitro. These include the tumor promoter TPA (Yamamoto and Zur Hausen, 1979) and the potent DNA-alkylating agent and chemical carcinogen, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) (Henderson and Fronko, 1984). Both cause an increase in the number of EBV genome equivalents per cell and concurrent increased expression of EBV antigens. Although the molecular mechanism(s) responsible for enhancement of transformation is unknown, the data suggest that events associated with increased c-myc expression, DNA synthesis, or repair replication can enhance EBV-induced transformation. The possibility that malaria-derived products may be acting in a similar manner to TPA presents some challenging and exciting avenues for further investigation. For example, as mentioned earlier (Section 111,D), mitogens are capable of inducing c-myc expression, and this may also apply to malaria mitogens.
58
CHRISTINE A. FACER A N D J . H . L. PLAYFAIR
3. Malaria-Stimulated Cytokine Production One cytokine of current interest in the immunopathology of malaria is cachectin or tumor necrosis factor a (TNF-a). A high percentage (75%) of sera from malaria patients contain elevated levels of TNF-a (Scuderi et a l . , 1986). This monocyte-derived cytokine has been found to inhibit the proliferation and differentiation (Ig secretion) of EBV-transformed B cells (Janssen and Kabelitz, 1988).It is possible that the consistent production of large amounts of TNF-a in malaria may represent an attempt on behalf of the host to limit an expanding virus-positive B-cell population resulting from the intense parasite-stimulated specific and nonspecific drive toward Ig production. Conversely, rTNF was also found to promote survival and induce proliferation in the tumor cells of two malignancies-hairy-cell leukemia and B-chronic lymphocytic leukemia (Cordingly et al., 1988)-although in this case, both rTNF-stimulated cell lines were EBV-negative. Transforming growth factor, TGF-P, a B-cell-derived cytokine normally associated with inhibition of cell proliferation (Tucker et al., 1984), is generating interest as a potential nonspecific mediator produced in malaria to regulate parasitemia. An observation relevant to both EBV and the genesis of eBL is that TGF-f3 is capable of promoting cell proliferation in EBVpositive BL cell lines as well as EBV-positive LCL but not in normal B cells or EBV-negative BL cell lines (Blomhoff et al., 1987). The production of TGF-P during malaria could contribute to the unrestrained proliferation of EBV-infected B cells and thus perhaps initiate, as well as maintain, BL.
4 . Virus-Specific Tc Responses in Rodent Malaria Corroborative evidence for depression of virus-specific cytotoxic T-cell responses during malaria has come from an interesting study by Nickel1 et al. (1987). Mice with self-limiting P. yoelii or P. berghei infections exhibited a markedly impaired ability to mount specific CTL responses to immunization with three different viruses. The impaired CTL response was localized to the spleen (lymph node responses were normal) and was greatest during peak parasitemia. The nature of the defect remains undetermined.
V. Malaria and the Immune System
With its complex life cycle, which includes two extracellular and three intracellular stages in the mammalian host alone, all antigenically distinct, the malaria parasite stimulates many components of the immune system. In the parasite’s interaction with the system there exists a delicate balance between protective host mechanisms and the evasion strategies of the parasite. Unfortunately, in some instances a number of severe immunopatho-
MALARIA, EBV,
A N D THE GENESIS OF LYMPHOMAS
59
logical complications arise that may occasionally be fatal. Of these the one that currently seems most closely related to the BL problem is immunosuppression germinal center hyperactivity. A. PROTECTIVE MECHANISMS OF HOSTIMMUNITY
1 . The Liver Stage Antibody levels to the major surface antigen of the sporozoite (the CSP antigen) increase with age in patients from endemic areas (Nardin et al., 1979), and it is possible to protect mice against sporozoite infection by injecting high-titer mAb against CSP (Potocnjak et al., 1980. This led to attempts to design a vaccine based on peptides from the CSP, which has been shown to be partially effective in human volunteers (Herrington et al., 1987). Since then it has been unexpectedly found that the infected liver cell is susceptible to cytotoxicity by CD8+ T cells (Schofield et al., 1987a), and that the liver stage can also be interrupted by systemic injection of the cytokines TNF-a and y-interferon (IFNy), especially in combination (Schofield et al., 1987b). Thus cell-mediated immune mechanisms are evidently effective against this intracellular stage of the infection, and might be improved by a suitably designed vaccine.
2 . The Asexual Blood Stage The acquisition of immunity is also accompanied by the development of antibodies reacting with the merozoite, some of which prevent reinvasion of red cells in vitro (Cohen and Butcher, 1971). Other antibodies for which the incidence correlates fairly well with immunity include opsonins that promote phagocytosis of merozoites (Druilhe and Khusmith, 1987), and antibodies against defined antigens on the surface of parasitized red cells (Jouin et al., 1987). However, no individual type of antibody (nor indeed of immune response) has been found to correlate consistently with immune status (Playfair, 1982). Once inside the red cell, the parasite becomes sensitive to a number of nonspecific cytotoxic mechanisms, mostly of myeloid cell origin. These include reactive oxygen intermediates such as H,O,, which damages particularly those parasites within mature red cells (Dockrell and Playfair, 1983), cationic proteins from eosinophils (Waters et al., 1987), and a factor or factors present in tumor necrosis serum that was at first thought to be TNF (Taverne et al., 1981)-erroneously, because the recombinant molecule has no effect on the parasite in vitro (Taverne et al., 1987) and which now appears to be predominantly lipid peroxides (Rockett and Playfair, 1988). It
60
CHRISTINE A. FACER A N D J. H. L. PLAYFAIR
is likely that other cytotoxic factors still remain to be identified, since occasional human and animal sera are found that fail to support parasite growth in uitro. Jensen has found inhibitory sera to be particularly common in certain regions of Sudan; this toxicity does not appear to be due to antibody or TNF, and the as yet unidentified molecule has been named “crisis-forming factor” (CFF) (Jensen et al., 1984). It has not been ruled out that C F F is of dietary origin, but it is interesting that C F F is significantly commoner in patients with red-cell abnormalities [ HbAS; glucose-6-phosphate dehydrogenase (G6PD) deficiency] that in themselves confer relative protection against malaria. The fact that children in endemic areas appear to acquire immunity to the severe effects of malaria several years before their levels of parasitemia start to decline has suggested to some workers that immunity may develop against malaria toxins (McGregor et al., 1956). However, no such molecules have been definitely identified, although there is recent evidence that malariaderived molecules may stimulate macrophages to release potentially damaging substances such as TNF (see Section V,C,&). Tremendous efforts are currently being directed at the production of vaccines that would control the asexual blood stage. These are hampered by a number of factors, notably the extensive variation found in almost all potentially protective antigens and the lack of complete understanding of the precise form of immunity that is desirable (Perlmann, 1987). Nevertheless, one human trial has given encouraging results (Patarroyo et al., 1988), and many more are likely to follow in the next few years. Given the present state of knowledge, it does not seem likely that protection will be more than partial. 3. The Sexual Stage Considerable progress has been made in identifying antigens of the sexual stages (gametocytes and gametes) that, used as vaccines, induce a state of transmission-blocking immunity (Carter et al., 1988). This appears to be mainly based on antibody but, as with the other stages of infection, there is also evidence for nonantibody T-cell-mediated mechanisms. Such a vaccine would not directly benefit the recipient, and if used, will almost certainly be combined with vaccines against the liver and asexual blood stage.
B. PARASITE EVASION MECHANISMS
1. lntracellular Habitat The predominantly intracellular habitat, with only brief extracellular stages, allows the parasite to escape the effects of antibody for most of the life cycle. An additional advantage over other intracellular parasites is that the
MALARIA, EBV,
A N D THE GENESIS OF LYMPHOMAS
61
host cells-liver and (particularly) mature red cells-express little or no HLA antigens, which reduces their efficiency at inducing T-cell immunity.
2. Genetic Variability Different isolates of blood-stage malaria from different parts of the world, and even from the same locality, show extensive antigenic differences. Some of this is found in the soluble (S) antigens released by the parasite into the plasma (Howard et al., 1986), but also on membrane antigens thought to be important in inducing protective immunity (McBride et al., 1982). This variation does not usually seem to occur during the course of individual infections-as it does, for example, in African trypanosomiasis-and is probably more like the situation with many respiratory viruses and intestinal bacteria; nevertheless it imposes a severe restraint on the development of fully protective immunity and on the design of vaccines. However, variation of a potentially protective merozoite surface antigen has been reported in parasites that survived after vaccination and challenge (David et al., 1985). Curiously, the sporozoite does not appear to show antigenic variation, and there are some merozoite antigens that also seem to be stable.
3. Antigen Shedding At the time of schizont rupture, large amounts of soluble parasite antigen are released into the circulation, including the heat-stable S antigens (Anders, 1986). The role these play has long been controversial, one hypothesis being that they act to confuse the immune system by exposing it to numerous nonprotective antigens; the extensive variation in these antigens would fit with this idea. Another view is that they are responsible for pathological changes (see Section V,C). They may also include the polyclonal T- and Bcell mitogens mentioned earlier. C. PATHOLOGICAL CONSEQUENCES OF IMMUNITY Almost all the pathological changes in malaria have been suspected to have an immunological basis. They range from anemia (Facer et al., 1979; Facer, 1980a,b) and immune-complex kidney disease to severe cerebral and pulmonary manifestations. This field has been well reviewed (Marsh and Greenwood, 1986), and only a few particularly relevant aspects will be noted here.
1 . Autoantibodies in Malaria Numerous autoantibodies are found in patients with malaria, notably antiDNA, antilymphocyte, anti-Ig (rheumatoid factors), and anti-IF antibodies. Experiments in mice have suggested that this is not the pattern expected of polyclonal B-cell activation on its own, but rather of a heightened reactivity
62
CHRISTINE
A.
FACER A N D J. H. L. PLAYFAIR
to cross-reactive parasite antigens (Daniel-Ribeiro et al., 1983). In another mouse model, it was found that an antilymphocyte antibody apparently directed against a subpopulation of B cells was associated with a fatal outcome, and that nonlethal infections induced a suppressor T cell that downregulated it (De Souza and Playfair, 1983b). Similar antibodies have been found in human malaria (J. B. De Souza, J. H. L. Playfair and B. M . Greenwood, unpublished observations), and it would clearly be interesting to examine the sera of B L patients in this respect. It has been suggested that rheumatoid factors might be useful in enhancing the destruction of antibodycoated parasites (Green and Packer, 1984).
2. Role of Cytokines Considerable attention is being focused on the role of interleukins, interferons, and other cytokines in malaria. At one end of the scale, IFNy and TNF are thought to be important in protective immunity (see Section V,A). At the other end, overproduction of TNF has been associated with severe disease; this was particularly striking in a mouse model where mAb to TNF were able to prevent death from cerebral complications (Grau et al., 1987a). It has been shown that molecules derived from the asexual blood stage can directly stimulate macrophages to release TNF, which reopens the question of a malaria “toxin” (Bate et al., 1988). Somewhere between these two extremes are the findings, of great potential relevance to BL, that TNF can prevent the proliferative and secretory effects of EBV on B lymphocytes (Janssen and Kabelitz, 1988), while TGF-f3 can enhance the growth of EBVinfected B cells (Blomhoff et al., 1987).
3. Splenomegaly
A striking feature of malaria, particularly in the Far East, is a massive enlargement of the spleen in certain immune individuals. This used to be called the tropical splenomegaly syndrome (TSS), but the link with malaria has led to the adoption of a new name: hyperreactive malarial splenomegaly (HMS). This condition is associated with raised levels of IgM and of immune complexes, and it has been suggested that a defect in CD8+ (suppressor?) T cells is to blame, resulting in excessive B-cell proliferation (Weidanz, 1982). Whether this is related to the T-cell defects described earlier (see Section IV, D, 1) remains to be established. D. IMMUNOSUPPRESSION Almost all types of immune response have been found to be suppressed during malaria infection in one or other of the available animal models (Lelchuk and Playfair, 1980; Weidanz, 1982). Table VII summarizes the
MALARIA,
EBV,
A N D T H E G E N E S I S OF LYMPHOMAS
63
TABLE VII IMMUNOSUPPRESSION BY MALARIA Responses suppressed by malaria
Possible mechanisms of immunosuppression
Antibody (including response to polysaccharide vaccines) Contact sensitivity Delayed hypersensitivity Mitogens
Soluble parasite antigens Macrophage products (including prostaglandins) Suppressor T cells Clonal exhaustion Polyclonal B- and/or T-cell activation Antilymphocyte autoantibodies IL-2 inhibitor Other cytokines ( 7 X F - p ) and inhibitors
examples that seem the most relevant to the present chapter, but a few of these call for further comment.
1 . Antibody Responses That immunosuppression by relatively mild malaria can be of real significance was vividly shown by the results of vaccine trials in Nigeria with bacterial capsular polysaccharide vaccines: patients with malaria made less antibody to the bacterial antigens, and a single course of antimalarial chemotherapy before vaccination corrected this defect (Greenwood et al., 1981).In addition, it has been observed that reducing the incidence of malaria frequently leads to a reduction in deaths from other infectious diseases in the same area (Greenwood, 1987).
2 . Lymphocyte Subsets As mentioned earlier (Section V,C, l), lethal, but not nonlethal malaria infections in mice induce autoantibodies cytotoxic, in the presence of complement, to a subpopulation of B cells (De Souza and Playfair, 1983a). In addition, it was found that tumor necrosis serum, which contains T N F and many other macrophage products, is toxic to a subset of B cells (Playfair et al., 1982). Since T N F can be found in the serum during severe infections, it is possible that the lymphocytotoxic factor is also present in uiuo. Whether these antilymphocyte effects are important because they compromise the development of immunity or, on the contrary, because they represent an attempt to limit B-cell proliferation, is at present not clear.
3. Macrophages It has often been found that suppressed responses in uitro by cells from malaria-infected animals-for example, to mitogens (Taverne et al., 1986)can be restored by pretreatment with indomethacin or silica, suggesting that
64
CHRISTINE A. FACER AND J. H . L. PLAYFAIH
macrophage-derived prostaglandins might be responsible. When assayed by the production of TNF or of reactive oxygen intermediates, macrophages from the spleen and liver of mice are highly activated early in infection, although this activation appears subsequently to be suppressed (Dockrell et al., 1986).
4. Cytokines Production of TNF tends to increase during malaria, and the same is true of interleukin 1 (IL-1) (Lelchuk et al., 1984). However, IL-2 production is suppressed for the first 10 days of infection in mice, and this is associated with the appearance in the serum of an IL-&inhibitory molecule with many characteristics of the low-affinity IL-2 receptor (Lelchuk and Playfair, 1985; Male et al., 1985). A study of other interleukins would clearly be of the greatest interest. VI. Conclusions
In general most hypotheses concerning the etiology of eBL favor a multistep process of tumor development implicating the interaction between EBV and a cofactor(s) in the chain of events. There is no doubt from the considerable body of epidemiological evidence available, that hyperendemic malaria is a strong contender as a cofactor. More recently acquired clinical and experimental laboratory data offer immunological support for the cofactor role of malaria as discussed earlier. A common question asked is why, in a population exposed to EBV at an early age and, where, by the age of 3 years, 95% of children suffer from continuous bouts of P . falciparum malaria, only a small number of the doubly infected children develop BL. It is obvious that other factors must also be involved, perhaps an unusually early or heavy primary EBV infection. Another precondition or factor favorable for the development of BL, as suggested by the prospective BL study in the West Nile of Uganda, is that a heavy persistent virus load, evidenced by elevated anti-VCA titers in most pre-BL sera, is involved. Alternatively, the time-space clustering of BL cases implies that there exists a genetic predisposition to develop BL, although evidence for this has not been forthcoming to date and it requires more vigorous investigation. The genetic susceptibility may not necessarily relate to infection with EBV but to the susceptibility to develop more severe malaria. Indeed there is experimental evidence that, in the mouse model for malaria, the antibody response to the repetitive epitope of P . falciparum CSP, (NANP),,, is genetically restricted and strictly linked to the presence of a particular allele in the Z-A region of the H-2 complex (Grau et al., 1987b). One can postulate that an analogous genetic control of the antibody re-
MALARIA,
EBV,
AND THE GENESIS OF LYMPHOMAS
65
sponse to (NANP), peptides, and to whole P . falciparum sporozoites, could also exist in humans. This might explain the observation that a significant percentage of children living in malaria-endemic regions do not develop anti-NANP antibodies (Zavala et al., 1985).Obviously if a genetic element is involved, the situation may have relevance to the role of malaria as a cofactor, since a high titer of antibodies to (NANP), gives partial protection to malaria infection (Herrington et al., 1987), although this is not supported in another study (Marsh et al., 1988). Children not producing antibodies might be expected to have higher parasitemias, more severe disease, and consequently, more severe immunosuppression. As discussed earlier, there are three major immunological roles for malaria as a cofactor: as a stimulator of polyclonal B-cell proliferation, as a mediator of defective CTL response to EBV, and last, but not least, as an enhancer of EBV-induced lymphocyte transformation (and EBV genome amplification?). Children in equatorial Africa where BL is endemic, would experience all three effects during the protracted bouts of P . falciparum infection from the age of 6 months to -5 years. In fact, since immunosuppression to EBV is a feature even of asymptomatic malaria infections (Moss et al., 1983; Greenwood, 1987), these children would never be in a state of complete immune control over EBV, and B-cell proliferation would proceed in an unrestrained manner. The risk of all genetic accidents is directly related to the number of cell divisions, and malaria therefore enhances the chance of a chromosomal trans location. As mentioned under in Section III,G malaria is postulated as a risk factor for the genesis of BL in that is causes hyperactivity of germinal centers. This striking lymphoproliferative effect of malaria may well have a molecular basis. For example, a feature of P . falciparum proteins is the marked number of repeated immunogenic epitopes occurring at a number of different levels. Thus, cross-reactions are found within one block of repeats, between different blocks of repeats in the same protein, and between repeats in different proteins. It is envisaged that the repeated epitopes act as a “smokescreen” by causing hyperstimulation of irrelevant B-cell responses against critical “protective” epitopes of malaria antigens (Kemp et al., 1986; McCutchan et al., 1988). Such a network of cross-reacting epitopes may be responsible for causing the distinctive features of the immune response to malaria, such as the slow development of immunity to the parasite, hypergammaglobulinaemia, and autoantibody production. A possible mechanism behind this is that such a network of cross-reacting epitopes prevents the development of high affinity B-cell memory. Thus many B cells carrying somatic mutations in their surface Ig, fail to react with the original triggering epitope with sufficient affinity to be preserved. Instead they may react with one or more of the cross-reacting epitopes with a much higher affinity and
66
CHRISTINE A. FACER A N D J. H . L. PLAYFAIR
FIG.6. Sequential steps in Burkitt’s lymphomagenesis: two scenarios.
consequently proliferate. The failure of repeats to induce fully protective immunity thus results in continued infection and chronic antigenic stimulation. In what way could malaria and EBV be seen to interact to stimulate lymphomagenesis? Two scenarios are postulated. One, originally proposed by Klein and still a strong contender, describes EBV as the initiator and malaria as the promoter. It is envisaged that a primary EBV infection early in life might be a precondition of this hypothesis with the result that a large population of B cells becomes infected with EBV. The primary role of malaria as a promoter would then be to alter cytotoxic T-cell function and impair the host’s ability to control the growth and expansion of these immortalized B cells, thus greatly increasing the target cell population at risk of chromosomal translocation (scenario A; Fig. 6). In addition, the lymphoproliferative (antigenic and mitogenic) effect of malaria and subsequent drive toward Ig production, would enhance the chance of chromosomal aberrations. The resulting tumorigenic c-myc-Ig translocation probably represents a very rare accident but one that has a high selective advantage in the expansion process. Cells carrying the c-myc translocation and accompanying dysregulated c-myc transcription would proliferate and eventually lead to BL. Cytokine imbalance might enhance this process (see Section IV,D,3). Interestingly, the frequent occurrence of BL in patients with AIDS (Ziegler et al., 1982) may result from immunological alterations in this disease comparable to those of malaria. Here, however, HIV infection of CD4+ cells
MALARIA, EBV,
AND THE GENESIS OF LYMPHOMAS
67
results in a reduced helper T-cell population and severe immunosuppression including defective T-cell control over EBV (Crawford et al., 1984). It is too early yet to establish whether, in malaria-endemic regions of Africa, a combination of infection with malaria and HIV (common now in young African children given transfusions of HIV-unscreened blood for treatment of malarial anemia), both sharing the triple impact of B-cell activation, T-cell suppression, and EBV reactivation, leads to a greater incidence of BL in pediatric AIDS. The ineffective T-cell control of EBV induced by malaria may not be the sole explanation for why malaria predisposes only to EBV-positive and not to EBV-negative BL. Thus, although a severely impaired EBV-specific cytotoxicity exists in AIDS, for example, the lymphomas that these patients occasionally develop follow sBL in both the chromosomal translocation breakpoints and the infrequent association with EBV (Subar et al., 1988). A difference may therefore exist between the immunological control of EBV in malaria and in HIV infection. Thus, a recent serological study of AIDS patients found that VCA titers were not elevated in contrast to the situation seen in pre-Burkitt sera. The alternative scenario describes malaria as the initiator of events and EBV as a promoter of lymphomagenesis. Here, the polyclonal B-cell proliferation induced by malaria is envisaged as sufficiently severe as to allow an early chromosomal translocation. This would be followed by EBV infection of a cell already carrying the translocation and subsequent immortalization and expansion of this cell population (scenario B; Fig. 6). Neither hypothesis accounts for the fact that in uitro infection of B cells with EBV and stimulation of EBV-genome-negative or -positive B cells with malaria antigens has yet to produce a cell carrying a chromosomal translocation. Thus other factors-genetic, nutritional, or environmental-must be involved. Whatever the course of events leading to BL, it should be stressed that the final stages of tumorigenesis could be caused in other ways and be independent of both malaria and EBV. This would explain the few cases of EBV-genome-positive eBL in areas of Africa that are relatively malaria-free, and, of course, EBV-genome-negative BL. However, despite the many questions still to be answered, clues to the role of malaria as a cofactor are steadily accumulating. It is to be hoped that the use of the sophisticated techniques of molecular biology and the continuing epidemiological studies will complete the picture of Burkitt’s lymphomagenesis in the not too distant future. ACKNOWLEDGMENTS The authors’ work quoted in this article was supported by grants from the Wellcome Trust and the M.R.C.
68
CHRISTINE A. FACER A N D J. H . L. PLAYFAIR
REFERENCES Abo, W., Takada, K., Kamada, M., Imamura, M., Motoya, T., Iwanga, M., Aya,T., Yano, S., Nakao, T., and Osato, T. (1982). Lancet i, 1272. Allison, A. C. (1984). Contemp. Top. Immunobiol. 12, 463-490. Anders, R. F. (1986). Parasite Zmmunol. 8, 529-539. Bancroft, G . J . , and Askonas, B. A. (1985). In “Immunobiology and Pathogenesis of Trypanosomiasis” (I. A. Tizard, ed.), pp. 75-103. CRC Press, Boca Raton, Florida. Bate, C. A. W., Taverne, J., and Playfair, J. H. L. (1988). lmmunology 64, 227-231. Blomhoff, H. K., Smeland, E., Mustafa, A. S., Aodal, T., and Ohlsson, R. (1987). Eur. J . Zmmunol. 17, 299-301. Bornkamm, G . W., Delius, H., Zimber, U., Hudenwentz, J., and Epstein, M. A. (1980). J . Virol. 35, 603-618. Borysiewicz, L. K., Casali, P., Rogers, B., Morris, S., and Sissons, J. G . P. (1985). Clin. Exp. Zmmunol. 59, 29-36. Burkitt, D. (1958). Br. J. Surg. 46, 218. Burkitt, D. (1969).1. Natl. Cancer Znst. 42, 19. Burkitt, D., and Wright, D. H. (1970). “Burkitt’s Lymphoma.” Livingstone, Edinburgh. Carter, R., Kumar, N . , Quakyi, I., Good, M., Mendis, K., Greaves, T., and Miller, L. (1988).In “Progress in Allergy. Spec. Ed.: Malaria Immunology” P. Perlmann and H. Wigzell, eds.). pp. 193-214. Karger, Basel. Castelino, D., Saul, A., Myler, P., Kidson, C., Thomas, H., and Cooke, R. (1981). Southeast Asian J . Trop. Med. Public Health 12, 549-555. Clements, M. R . , Johnson, L., and Fraser, D. R. (1987). Nature (London) 325, 62-65. Cohen, S., and Butcher, G. A. (1971). Trans. R . SOC. Trop. Med. Hyg. 65, 125-135. Cordingly, F. T., Bianchi, A., Heslop, H., Vyakarnam, A., Turner, M., Meager, A,, and Breuner, M. (1988). Lancet 1, 969-971. Crawford, D. H., and Edwards, J. M . B. (1987). In “Principles and Practice of Clinical Virology” (A. Zuckerman, J. Banatvala, and J. Pattison, eds.), pp. 111-133. Wiley, New York. Crawford, D. H., Weller, I., Iliescu, V., and Wara, D. W. (1984). Br. J. Vener. Dis. 60, 258264. Daniel-Ribeiro, C., Druilhe, P., Monjour, L., Homberg, 1.-C., and Gentilini, M. (1983). Trans. R . SOC. Trop. Med. Hyg. 77, 185-188. Daniel-Ribeiro, C. T., de Roquefeuil, S., Druilhe, P., Monjour, L., Homberg, J.-C., and Gentilini, M. (1984). Trans. R . SOC. Trop. Med. Hyg. 78, 742-747. David, P. H., Hudson, D. E., Hadley, T. J., Klotz, F. W., and Miller, L. H. (1985). 1. Zmmunol. 134, 4146-4152. Delcayre, A. X., Fiandino, A., Barel, M., and Frade, R. (1987). Eur. J . Zmmunol. 17, 18271833. De Souza, J. B., and Playfair, J. H. L. (1983a). Parasite Zmmunol. 5, 257-265. De Souza, J. B., and Playfair, J. H. L. (1983b). Clin. Exp. lmmunol. 54, 110-116. de-Th6, G . (1982). In “The Herpes Virus I” (B. Roizman, ed.), pp. 25-103. Plenum, New York. de-Th6, G. Geser, A., Day, N. E . , Tukei, P. M., Williams, E. H., Beri, D. P., Smith, P. G . , Dean, A. G., Bornkamm, G. W., Feorino, P., and Henle, W. (1978). Nature (London) 274, 756-761. Dockrell, H. M., and Playfair, J. H. L. (1983). Infect. lmmun. 39, 456-459. Dockrell, H. M., Alavi, A.. and Playfair, J. H. L. (1986). Clin. Exp. lmmunol. 66, 37-43. Druilhe, P., and Khusmith, S. (1987). Epidemiological correlation between levels of antibodies promoting merozoite phagocytosis of Plasmodium falciparum and malaria-immune status. Infect. lmmun. 55, 888-891.
MALARIA,
EBV,
A N D T H E GENESIS OF LYMPHOMAS
69
Epstein, M. A., and Achong, B. G . (1979). “The Epstein-Barr Virus.” Springer-Verlag. Berlin and New York. Epstein, M. A., and Morgan, A. J. (1983). Clin. Exp. Zmmunol. 53, 257-271. Epstein, M. A., Achong, B. G . , and Barr, Y. M. (1964). Lancet i, 702. Facer, C. A. (1980a). Clin. Exp. Zmmunol. 39, 279-288. Facer, C. A. (1980b). Clin. Exp. Zmmunol. 41, 81-90. Facer, C. A., Bray, R. S., and Brown, J. (1979). Clin. Exp. Zmmunol. 35, 119-127. Faser, C. A., Kataaha, P. K., and Holborow E. J. (1984). Trans. R . Soc. Trop. Med. H y g . 79, 275-276. Facer, C. A,, Bentley, A., Withers, M., and Kataaha, P. K. (1986). Trans. R . SOC. Trop. Med. H y g . 80, 351-352. Facer, C. A,, Gunapala, D., and Davidson, R. (1987). Znt. Conf. Malaria Babesiosis, 3rd, Annecy, Fr. p. 130. Laveran Found., Lyon, France. Felton, S. C., Hoffmann, C. C., Kreier, J. P., and Glaser, R.(1984).Lab. Anim. Sci. 34, 164168. Geser, A., and Brubaker, G. (1985). I n “Burkitt’s Lymphoma: A Human Cancer Model” (G. Lenoir, G. O’Connor, and C. Olweny, eds.), Sci. Publ. No. 60, pp. 205-215. IARC, Lyons. Grau, G. B., Fijardo, F. L. F., Pignet, P.-F., Allet, B., Lambert, P.-H., and Vassalli, P. (1987a). Science 237, 1210. Grau, G . B., del Gindice, G., and Lambert, P.-H. (1987b). Parasitology 94, Suppl., 123-139. Green, T. J., and Packer, B. J. (1984). Infect. Zmmun. 46, 668-672. Greenwood, A. M., Greenwood, B. M., Bradley, A. K., Ball, P. A. J . , and Gillies, H. M. (1981). Ann. Trop. Med. Parasitol. 75, 261-263. Greenwood, B. M. (1987). Parasitol. Today 3, 206-214. Gregory, C. D., Edwards, C. F., Lipinski, M., Rusz, T., and Rickinson, A. B. (1986). Znt. Symp. EBV Assoc. Malig. Dis., 2nd p. 80. Gutierrez, C., Guo, 2. S., Burhans, W., de Pamphilis, M. L., and Farrell-Towt, G. (1988). Science 240, 1202. Hanto, D. W., Frizzera, G., Gajl-Peczalska, K. J., Sakamoto, J., Purtilo, D. T., Balfour, H. H., Simmons, R . L., and Najarian, J. S. (1982). N . Engl. J. Med. 306, 913. Henderson, E. E., and Fronko, G. (1984). Znt. J . Cancer 33, 331-338. Henle, W., and Henle, G. (1985). Ado. Viral Oncol. 5, 201-238. Herrington, D. A., Clyde, D. F., Losonsky, G., Cortesia, M., Murphy, J. R., Davis, J., Bagar, S.,Felix, A. M., Hiemer, E. P., Gilliesson, D., Nardin, E., Nussenzweig, R. S., Nussenzweis, V., Hollingdale, M.R., and Levine, M. M. (1987). Nature (London) 328, 257-259. Howard, R. J., Panton, L. J., Marsh, K., Ling, I. T., Winchell, E. J., and Wilson, R. J. M. (1986). Parasite Zmmunol. 8, 39-55. Janssen, 0.. and Kabelitz, D. (1988).J. Zmmunol. 140, 125-130. Jensen, J. B., Hoffman, S. L., Boland, M. T., Akood, M . A. S., Laughlin, I. W., Kurniawan, L., and Marwoto, H. A. (1984). Proc. Natl. Acad. Sci. USA 81,922-925. Jerusalem, C. (1968). Z. Tropenmed. Parasitol. 19, 94-108. Jilg, W., Markert, C., and Wolf, H. (1986). Zntl. Symp. EBV Assoc. Malig. Dis. 2nd p. 104. Johnson, D. R., Wolfe, L. G . , Leran, G., Klein, G., Ernberg, I., and Arman, P. (1983). Znt./. Cancer 31, 91-97. Jones, J . , Shurin, S., Abramowsky, C., Tubbs, R . , Sciotto, C., Wahl, R., Sands, J., Gottman, D., Katz, B., and Sklar, J. (1988). N. Engl. J . Med. 318, 733-741. Jouin, H., Dubois, P., Gysin, J., Fandeur, T., Mercereau-Puijalon, and Pereira da Silva, L. (1987). Infect. Zmm. 55, 1387-1392. Kataaha, P. K., Facer, C. A., and Holborow, E. J. (1984a).Clin. Exp. Zmmunol. 56,371-376.
70
CHRISTINE A. FACER A N D J. H . L. PLAYFAIH
Kataaha, P. K., Facer, C. A., and Holborow, E. J. (1984b). Parasite Zmmunol. 6, 481-492. Kemp, D. J . , et al. (1986). Parasitology 92, Supplement, S83-SlO8. Kikuta, H., Taguchi, Y., Tomizawa, K., Kojima, K., Kawamura, N., Ishizaka, A., Sakijama, Y., Matsumoto, S., Imai, S., Kinoshila, T.,Koizumi, S., Osato, T., Kobayashi, I., Hamada, I., and Hirai, K. (1988). Nature (London) 333, 455-457. Klein, G. (1981). Nature (London) 294, 313-316. Klein, G . , and Klein E. (1985a). Nature (London) 315, 190-195. Klein G., and Klein, E. (1985b). Zmmunol. Today 6, 208-215. Klein, G., and Klein, E. (1986). Cancer Res. 46, 4211-4224. Klein, G . , Klein, E., and Levine, P. H. (1976). Cancer Res. 36, 724-727. Lelchuk, R . , and Playfair, J. H. L. (1980). Clin. Exp. Zmmunol. 42, 428-435. Lelchuk, R., and Playfair, J. H. L. (1985). Immunology 56, 113-118. Lelchuk, R., Rose, G . , and Playfair. J. H. L. (1984). Cell. Zmmunol. 84, 253-263. McBride, J . S., Walliker, D., and Morgan, G. (1982). Science 217, 254-257. McGregor, I . A. (1986). Clin. Trop. Med. Commun. Dis. 1, 29-55. McGregor, I. A., Gilles, H. M., Walters, J. H., Davies, A. H., and Pearson, F. A. (1956). Br. Med. J . ii, 686-692. Male, D., Lelchuk, R., Curry, S., Pryce, G . , and Playfair, J. H. L. (1985). Zmmunology 56, 119-125. Manalagas, S. C. (1987). Lancet ii, 639. Marcu, K. B. (1987). BioEssays 6, 28-33. Marsh, K., and Greenwood, B. M. (1986). Clin. Trop. Med. Commun. Dis. 1, 91-125. Marsh, K., Hayes, R. H., Carson, D. M., Otoo, L., Shenton, F., Byass, P., Zavala, F., and Greenwood, B. M. (1988). Trans. R. Soc. Trop. Med. Hyg. 82, 532-537. Matsui, T., Takahashi, R., and Nakao, Y. (1986). Cancer Res. 46, 5827-5831. Menezes, J . , Liebold, W., and Klein, G. (1975). Exp. Cell Res. 92, 478-484. McCutchan, T. F., de la Cruz, V. F., Good, M. F., and Wellems, T. E. (1988). Prog. Allergy 41, 173-192. Morrow, R. H. (1985). I n “Burkitt’s Lymphoma: A Human Cancer Model” ( G . Lenoir, G. O’Connor, and C. Olweny, eds.), Sci. Publ. No. 60, pp. 177-185. IARC., Lyons. Mortazavi-Milani, S. M . , Stierle, H. E., and Holborow, E. J. (1983). Clin. Erp. Zmmunol. 55, 177- 182. Mortazavi-Milani, S. M., Facer, C. A., and Holborow, E. J. (1984). Zrnmunology 52, 423. Moss, D. J., and Burrows, S. (1986). Symp. EBV Assoc. Malig. Dis.2nd p. 89. Moss, D. J., Rickinson, A. B., and Pope, J. H. (1978). Znt. J . Cancer 22, 662-668. Moss, D. J . , Burrows, S., Castellino, D., Kane, R . , Pope, J. H., Rickinson, A. P., Alpers, H. P., and Heywood, P. F. (1983). Znt. J . Cancer 31, 727-732. Nardin, E. H., Nussenzweig, R. S., McCregor, 1. A., and Bryan, J. H. (1979). Science 206, 597-599. Newmark, P. (1983). Nature (London) 301, 111. Nickell, S. P., Freeman, R. R . , and Cole, G . A. (1987). Parasite Zmmunol. 9, 161-174. Nillson, K., Giovanella, B. C., Stehlin, J. S., and Klein, G . (1977). Znt. J . Cancer 19, 337-342. Nishikura, K . , Ar-Rushdi, A., Erikson, J., Watt, R . , Rovera, G., and Croce, C. H. (1983).Proc. Natl. Acad. Sci. USA 80, 4822-4826. Osato, T., Mizuno, F., Imai, S., Koizumi, S., Aya, T., Kinoshita, T., Tokuda, H., Ito, Y., Hira, N . , Hirota, M . , Ohigashi, H., Koshimizi, K., Kofi-Tsekpo, W., Were, J . , and Mugambi, M. (1986). Znt. Symp. EBV Assoc. Malig. Dis.2nd p. 110. Patarroyo, M. E., Amador, R., Clavijo, P., Moraino, A., Guzman, F., Ramero, P., Tascon, R., Franco, A., Murillo, L. A., Ponton, G . , and Trujillo, G . (1988).Nature (hndon)332, 158161.
MALARIA,
EBV,
A N D T H E GENESIS OF LYMPHOMAS
71
Perlmann, P. (1987). Nature (London) 328, 205-206. Playfair, J. H. L. (1982). Brit. Med. Bull. 38, 153-159. Playfair, J. H. L., De Souza, J. B., and Taverne, J. (1982). Clin. Exp. Zmmunol. 47, 753-755. Potocnjak, P., Yoshida, N., Nussenzweig, R. S . , and Nussenzweig, V. (1980).J . Exp. Med. 151, 1504. Purtilo, D., Harada, S., Bechtold, T., Yetz, J., Rogers, G., and Seshi, B. (1984). In “Pathogenesis of Leukaemias and Lymphomas: Environmental Influences” (I. Magrath, G. O’Connor, and B. Ramot, eds.), pp. 235-257. Raven, New York. Ragona, G., Frezza, D., Fruscalzo, A., Jocker, R., Rossi, N., Raimondi, E., Barletta, C., Carli, L., and Calaf, E. (1986). Cell Biol. Znt. Rep. 10, 315-321. Rechavi, G., Ben Bassat, I., Berkowicz, M., Martinowitz, U., Brok-Simoni, F., Neumann, Y., Vansover, A., Gotlieb-Stemalsky, T., and Ramot, B. (1987). Blood 70, 1713-1717. Reiss, C., Wang, D., Ghoh, D., Gaposchkin, C., and Kieff, E. (1987).J . Zmmunol. 139, 711714. Rickinson, A. B. (1984). Nature (London) 310, 99. Rickinson, A. B. (1986). In “The Epstein-Barr Virus: Recent Advances” (M. A. Epstein and 8 . G. Achong, eds.), p. 77. Heinemann, London. Rickinson, A. B., Moss, D. J., Wallace, L. E., Rowe, M., Misko, I. S., Epstein, M. A,, and Pope, J. H. (1981). Cancer Res. 41, 4216. Rickinson, A. B., Yao, Q. Y., and Wallace, L. E. (1985). Br. Med. Bull. 41, 75-79. Rockett, K., and Playfair, J. H. L. (1988). Infect. Zmmun. 56, 3180-3183. Rooney, C. H., Rickinson, A. B., Moss, D. J., Lenoir, G. M., and Epstein, M. A. (1984).Znt. J . Cancer 34, 339-348. Rooney, C. H., Rowe, H., Wallace, L. E., and Rickinson, A. B. (1985). Nature (London) 317, 629-631. Rowe, M., Gregory, C. D., Row, D. T., Farrell, P. J., and Rickinson, A. B. (1986). Znt. Symp. EBV Assoc. Malig. Dis., 2nd p. 80. Salaman, M. H., Wedderburn, N., and Bruce-Chwatt, L. J. (1969).J . Cen. Microbiol. 59,583. Schofield, L., Villaquiran, J., Ferreira, A., Shellekens, H . , and Nussenzweig, R. (1987a). Nature (London) 330, 664-666. Schofield, L., Ferreira, A., Altszuler, R., Nussenzweig, V., and Nussenzweig, R. (1987b).J. Zmmunol. 139, 2020-2025. Scuderi, P., Sterling, K. E., Lam, K. S., Finley, P. R., Ryan, K. J., Roy, C. G., Petersen, E., Shymen, D. J., and Salman, S. E. (1986). Lancet ii, 1364-1365. Sheldon, P. J., Papamichail, M., Hemsted, E. H., and Holborrow, E. J. (1973).Lancet i, 11531155. Showe, L. C., and Croce, C. M. (1987). Annu. Reu. Zmmunol. 5, 253-277. Strickland, G . T. (1986). Clin. Trop. Med. Communicable Dis. 1, 243-275. Subar, M., Neri, A., Inghirami, G . , Knowles, D. M., and Dalla-Favera, R. (1988). Blood, 72, 667-671. Taverne, J., Dockrell, H. M., and Playfair, J. H. L. (1981). Infect. Zmmun. 33, 83-89. Taverne, J., Treagust, J. D., and Playfair, J. H. L. (1986). Clin. Exp. Zmmunol. 66, 44-51. Taverne, J., Tavernier, J., Fiers, W., and Playfair, J. H. L. (1987)Clin. Erp. Zmmunol. 67, 1-5. Torsteinsdottir, S . , Masucci, M. G . , Enlin-Henriksson, B . , Brautbar, C., Ben-Bassat, H., Klein, G., and Klein, E. (1986). Proc. Natl. Acad. Sci. USA 83, 5620-5624. Tucker, R. F., Shipley, G., Moses, H., and Holley, R. W. (1984). Science 226, 705-707. Vainio, E., Lenoir, G. M., and Franklin, R. M. (1983). Clin. E x p . Zmmunol. 54, 387-396. Waters, L. S . , Taverne, J., Tai, P.-C., Spry, C. J. F., Targett, G . A. T., and Playfair, J. H. L. (1987). Infect. Immun. 55, 877-881. Wedderburn, N. (1970). Lancet ii, 1114-116.
72
CHHISTINE A. FACER A N D J . H . L. PLAYFAIH
Weidanz, B. P. Br. Med. Bull. 38, 167-172. Whittle, H. C., Brown, J., Marsh, K., Greenwood, B., Seidelin, P., Tighe, H., and Wedderburn, L. (1984). Nature (London) 312, 449-450. Williams, E. H . . Smith, P. G., Day, N. E., Gieser, A., Ellice, J., and Tukei, P. (1978). Br. 1. Cancer 37, 109-122. Yadau, M., and Prasad, U. (1985). Southeast Asian]. Trop. Med. Public Health 15, 234-237. Yamamoto, N., and Zur Hausen, H. (1979).Nature (London) 280, 244-245. Young, L. S., Rowe, M., Sculley, T. R., Moss, D. J., Pope, J. H., and Rickinson, A. B. (1986). lntl. Symp. EBV Assoc. Malig. Dis., 2nd p. 74. Zavala, F., Tam, J. P., Nussenweig, R. S., and Nussenweig, V. (1985). Fed. Proc. 44, 980. Ziegler, J., Ziegler, J., Miner, R . , Rosenbaum, E., Lenette, E., Shillitoe, E., Casavant, C., Drew, W., Mintz, L., Gershow, J . , Greenspan, J.. Beckstead, J., and Yamamoto, K. (1982). Lancet ii, 631-633.
A REVIEW OF KAPOSI’S SARCOMA Jane Armes Institute of Cancer Research, Chester Beam Laboratories, London, England SW3 6JB
I . Introduction 11. Clinical Features and Epidemiology of Kaposi’s Sarcoma A. Sporadic KS B. Endemic KS C. Epidemic KS D. Immunosuppression-Associated KS 111. Pathology IV. Cell of Origin of KS V. KS-Neoplasm or Hyperplasia? VI. Etiology of KS A. An Infectious Agent B. Angiogenic Factors C. Oncogenes D. Hormonal Influence VII. Conclusion References
1. Introduction
Kaposi’s sarcoma (KS) was first described over a century ago (Kaposi, 1872). It remained an uncommon tumor in Europe and the United States until the 1980s. However, there is currently an epidemic of KS, associated with the acquired immune deficiency syndrome (AIDS). This has stimulated renewed interest in the disease, its etiology, and pathogenesis.
11. Clinical Features and Epidemiology of Kaposi’s Sarcoma
There is a broad spectrum of clinical manifestations of KS, from a solitary lesion, which often presents as a red-brown papule or macule on the skin, to disseminated, multiple-organ involvement. In the latter the skin lesions become multiple and may coalesce, and there is widespread involvement of lymph nodes and viscera, particularly the lungs and the gastrointestinal tract. In some aggressive forms of KS, visceral dissemination does not occur, but the skin lesions become locally invasive. 73 ADVANCES IN CANCER RESEARCH, VOL. 53
Copyright 0 1989 by Academic Press. IIIC. All rights of reproduction in any form ~ P S C N C ~ .
74
JANE AHMES
Kaposi’s sarcoma can be categorized into four epidemiological types: sporadic, endemic, epidemic, and immunosuppression-associated.
A. SPORADICKS This is the category of KS originally described by Moricz Kaposi. Before the onset of the AIDS epidemic, most cases seen in Europe and America were of this type. The estimated annual rate of KS in the United States from 1973 until 1979 (before the outbreak of AIDS) was 0.29 per 100,000population of men and 0.07 per 100,000 population of women (Biggar et al., 1984). The male-female ratio ranges from -4 : 1 up to 10 : 1, and it usually occurs in the fifth to eighth decade. Studies show that there is an increased incidence of sporadic KS among people of Jewish and southern European extraction (DiGiovanna and Safai, 1981). The disease is not usually severe and is often limited to a single lesion, particularly on the lower leg. The skin lesions can ulcerate and may be treated by radiotherapy. Sporadic KS is only very rarely responsible for the death of the patient.
B. ENDEMICKS Kaposi’s sarcoma is endemic in sub-Saharan Africa, particularly Zaire, Rwanda, and Uganda, where it is responsible for up to 12%of all malignancies. In adults, the sex ratio is similar to sporadic KS, -10 males to 1female. However, the pronounced male predominance decreases in the younger patients, and in children the sex ratio is almost equal. The disease occurs as localized and indolent, locally aggressive, or disseminated forms. The clinical features and prognosis of localized, endemic KS is similar to those of sporadic KS. Skin lesions may occur singly or in crops, and sometimes lesions regress. Edema is common in the affected limb and can precede the appearance of the skin lesions. The prognosis of this form of KS is generally good, and patients usually survive for over 10 years after diagnosis. In locally aggressive KS a lesion or group of lesions invade underlying structures, and may even penetrate bone. Chemotherapy is usually effective at prolonging survival, although this form of KS has a worse prognosis than the local form. If untreated, patients may die within a year of onset of disease or, alternatively, may survive for more than 5 years, but with increasing disabilities and a large tumor burden. In disseminated endemic KS, skin lesions are accompanied by widespread visceral involvement, especially in the lymph nodes and the gastrointestinal tract, and the prognosis is poor.
75
A REVIEW OF KAPOSI’S SARCOMA
African children may have a clinical variant, a lymphadenopathic form of
KS, where skin lesions are few and atypical in site and form, or absent, but there are massive, symmetrical tumor deposits in the lymph nodes. These children usually die within 1 year of onset of the disease. C. EPIDEMIC KS There has been an enormous increase in the incidence of KS since 1979, in association with human immune deficiency virus (HIV) infection, the causative agent of AIDS. On average, -28% of people with AIDS present with KS, and 10% develop KS later during the course of AIDS. However, the incidence of KS is not uniform among AIDS patients, and KS is seen mainly in male homosexual AIDS patients. The clinical manifestations of epidemic KS are usually of an aggressive type, with multiple skin lesions and visceral dissemination, particularly in the lymph nodes and gastrointestinal tract. These patients have a poor prognosis, although the ultimate cause of death is more likely to be from infection than the effects of their KS. There has been a parallel occurrence of HIV-related KS in Africa, known as atypical African KS (Bayley et al., 1985). It is distinct from the usual endemic African KS and its incidence is increasing. Initially it was seen in younger patients, usually of a higher socioeconomic class than those with endemic KS. However, of late it is seen across the whole range of socioeconomic classes. It is a more acute disease with rapid visceral spread. Symmetrical and generalized lymph node involvement is very common. Interestingly, it has a male-female ratio of 5 : 1, compared to 10 : 1 for conventional endemic KS. The prognosis is relatively poor, with >50% of patients dead within a year of onset.
D. IMMUNOSUPPRESSION-ASSOCIATED KS This category includes patients who are immunosuppressed for reasons other than HIV infection. In one series (Penn, 1979), KS accounted for 3%of 600 malignancies among renal transplant recipients, an incidence of 150 times that seen in a normal Western population. The patients are usually younger than those who develop sporadic KS (mean age of onset is in the fourth decade), and their KS is closely related to the onset of their immunosuppressive therapy. Skin lesions are commonly seen in this form of KS, as is visceral involvement. Death is more often related to KS in this category of the disease than in sporadic KS. Immunosuppression-associated KS is most effectively treat-
-
76
J ANE AHMES
ed by removal or reduction of immunosuppressive therapy, if the immunosuppression is iatrogenic. This may result in regression of the tumor. In other cases chemotherapy or radiotherapy are sometimes successful. Ill. Pathology
Kaposi’s sarcoma has two major components: abnormal endothelial structures and spindle cell aggregations. Both are present in most lesions, but the proportion of either component can vary enormously. Histologically, KS is seen in three stages: patch, plaque, and nodular. The patch stage is probably the earliest and is the least cellular. It is composed of interlacing networks of thin-walled, dilated vessels with irregular outlines, which are lined by flattened endothelium. Spindle cell aggregations are few, and mitoses and cellular atypia are not seen. The plaque stage is more cellular and may represent a progression from the patch stage. The abnormal vasculature is still a predominant feature, but there are also collections of spindle cells. If the lesion is in the skin, it usually extends deeper in the dermis than the patch lesions. Again there are no mitoses nor cellular atypia. Many biopsy samples taken from AIDS patients show the patch and plaque morphology (Francis et al., 1986) (Fig. l ) , but these early lesions have also been reported in nonepidemic KS (Ackerman, 1979). In the nodular variety of KS (Figs. 2 and 3), there are well-defined aggregates of spindle cells and the tumor is much more cellular. Very small spaces, sometimes containing erythrocytes, are surrounded by spindle cells, and there is extravasation of erythrocytes among the spindle cells. Often the nodule is surrounded by a few thin-walled, dilated vessels reminiscent of the abnormal vessels seen in the patch and plaque stages. It is not clear whether nodular KS develops from patch and plaque lesions, or arises de novo. Usually the spindle cells do not show mitoses or cellular atypia. However, there is a histological variant, composed of spindle cells with a high mitotic rate and with cellular and nuclear pleomorphism. It is seen particularly in the locally aggressive, endemic form of KS. Postmortem findings from patients with disseminated KS (e.g., AIDSrelated), show that common sites of involvement other than skin are the lymph nodes, gastrointestinal tract, lungs, liver, and spleen. The histological patterns in these organs are similar to those described before. IV. Cell of Origin of KS
Kaposi’s sarcoma is thought to be a tumor of endothelial cells, mainly because of the presence of abnormal vessels within the tumor. Immu-
A REVIEW OF KAPOSI’S SARCOMA
FIG.2. Nodular KS. x 128.
77
78
JANE ARMES
FIG.3. Nodular KS as seen in Fig. 2, to illustrate well-defined border and surrounding abnormal vasculature. x 1280.
nohistochemical and ultrastructural techniques have been used to try to ascertain the nature of KS cells, and to attempt to determine whether KS is of vascular or lymphatic origin. Beckstead et al. (1985)used a combination of immunohistochemical, enzyme histochemical, and lectin-binding techniques to compare the profile of staining in KS lesions to that of normal vascular or lymphatic endothelium. Only the abnormal endothelial component stained reproducibly, and this had a profile more similar to normal lymphatic than vascular endothelium. However, the spindle cells failed to stain completely, or showed only patchy, weak staining with two of their seven endothelial markers. Jones et al. (1986) also concluded that the endothelial components of KS lesions had immunohistochemical properties shared with lymphatic endothelium. However, this conclusion was based on the rather negative evidence of the absence of staining of KS with the relevant antibodies, as seen in lymphatic endothelial cells, as opposed to the presence of staining with these markers in vascular endothelium. The spindle cell component did not stain consistently with their panel of endothelial markers. Alternatively, an immunohistochemical study by Rutgers et al. (1986) concluded that both the spindle and endothelial component were of vascular
A REVIEW OF KAPOSI’S SARCOMA
79
rather than lymphatic origin. Another study (Suzuki et al., 1986)found that KS tissue stains intensely with antibodies against HLA-A, B, and C antigens, as do normal blood vessels, whereas normal lymphatics do not. An ultrastructural marker of vascular endothelium is the Weibal-Palade body. This has not been seen in the spindle cells of KS (McNutt et al., 1983). In spite of these studies, which are consistent with an endothelial origin of KS, no conclusive evidence for the origin of the cells has yet been produced. One important problem in these studies is that most histochemical markers used for identifying endothelium have not been directly raised from endothelial-cell antigens. As a result their labeling specificity is poor. Other markers, such as the antibody to Von Willebrand factor, are known to be unreliable markers of endothelial cells (Beckstead et al., 1985), as the sensitivity varies substantially, depending on the processing of the tissue. Until a precise panel of endothelial-cell markers is available, the exact cellular origin of KS is difficult to define. An important possibility yet to be ruled out is that the excessive vascularity may represent overstimulation of normal vessels by angiogenic factors produced by abnormal neighboring cells. V. KS-Neoplasm
or Hyperplasia?
The concept of KS as a malignant neoplasm has been disputed and the hypothesis put forward that the early lesions, at least, are hyperplastic (Costa and Rabson, 1983; Brooks, 1986). The main reasons for this hypothesis are explained here. Kaposi’s sarcoma is commonly related to some form of immunosuppression (e.g., HIV infection and iatrogenic immunosuppression in transplant recipients). An interesting feature of KS is its ability to regress, particularly when the immune status returns toward normal. Regression is an unusual feature of any other neoplasm, and nowhere does it occur as consistently as in KS. Regression is more likely to occur in a lesion that is hyperplastic rather than truly neoplastic. In the former, growth is not completely autonomous, and regression may be explained by either the removal of the external stimulus to proliferation or the reimposition of a state of growth inhibition. Most solid malignant neoplasms begin as a primary tumor from which metastases subsequently develop. There are some peculiarities of KS that point to the disease being of multifocal origin from the outset. Lesions often occur simultaneously, in crops, and late-occurring lesions during the course of the disease may have the histological appearances of early lesions (i.e., the abnormal endothelial component predominates) (Reynolds et al., 1965). “Metastatic” lesions in the disseminated form of the disease do not occur at typical sites for metastases seen in any other tumor. Foci of KS occur at
80
J A N E ARMES
multiple sites along the bowel mucosa or submucosa, but not the serosa where most secondary gut tumors occur, and pulmonary lesions are also atypical. In uitro propagation of KS biopsy material has led to an outgrowth of cells that express some endothelial-cell markers and have been shown to contain chromosomal rearrangements (Delli-Bovi et al., 1986). These rearrangements, though clonal for one culture, differ from those of other KS cultures, even when the cultures originate from the same biopsy specimen. Such heterogeneity suggests that the tumor has not developed by a clonal expansion of a single cell, and therefore may be hyperplastic. Another indication that KS is a hyperplastic lesion consists of reports suggesting the presence of abnormal endothelial proliferation in clinically normal skin of AIDS patients (Schwartz et al., 1984; De Dobbeleer et al., 1987). In one study (De Dobbeleer et al., 1987), normal-looking skin samples were taken from four AIDS patients. Two of the patients had KS elsewhere at the time of biopsy and one developed KS 10 months later. The ultrastructure of the clinically normal skin closely resembled early KS lesions. Normal-looking skin from age-matched controls did not show any KSlike features. Whereas all the aforementioned points are consistent with KS being a hyperplastic proliferation, in some clinical forms of KS, such as locally aggressive endemic KS, the disease certainly behaves in a malignant fashion. A hypothesis to unify the extremes of behavior of the disease could be that there is one or many initial stimuli to endothelial proliferation that, when removed, may lead to regression of the tumor. If continued, this may result in a final progression of some cellular elements to true malignancy, with growth independent from the initiating stimuli. VI. Etiology of KS
The etiology of KS has not been clearly defined. However, many peculiarities of the tumor do indicate mechanisms that may be important.
A. AN INFECTIOUS AGENT An infectious agent associated with KS has been proposed for some time. Initially it was based on the geographic distribution of KS in Africa. Kaposi’s sarcoma is concentrated into a tumor belt in central sub-Saharan Africa, where it is one of the most commonly occurring tumors. The incidence falls off sharply north of the Sahara and more gradually toward the east and south. McHardy et al. (1984) reported an endemic KS in the West Nile district of
81
A REVIEW OF KAPOSI’S SARCOMA
TABLE I AIDS CASESREPORTED TO THE CENTERSFOR DISEASE CONTROL THROUGH MARCH 4, 1985, ACCORDING TO RISKGROUP“
Group Homosexual men Intravenous drug users Haitians Patients with hemophilia Sexual contacts of members of high-risk group Transfusion recipients Children “No identified risk or uncharacteristic” Total
Total number of patients
Number of patients with KSb
Percentage with KS
6293 1478 280 62 68
2264 63 29 1 3
36.0 4.3 10.4 1.6 4.4
104 104 308
2 7 48
1.9 6.7 15.6
8697
2417
27.8
Listed according to risk group. From Haverkos et al. (1985). KS, Kaposi’s sarcoma.
Uganda, where most cases were seen in people who lived above an altitude of 853 m. However, KS was not seen everywhere above this altitude and most cases were found in very close proximity to each other, although in sparsely populated areas. They also reported space-time clustering of cases, which has previously been reported in endemic KS (Owor and Hutt, 1977; Bland et al., 1977), although this did not reach statistical significance If one considers epidemic, HIV-associated KS, it is much more common among the homosexual population than any other risk group (Table I) (Haverkos et al., 1985). Among homosexuals with AIDS, 36% develop KS; however, only 1.6%of hemophiliacs with AIDS develop KS. In addition, there has been a decline in the proportion of AIDS cases presenting with KS in the face of an increase in the number of AIDS patients (Des Jarlais et al., 1987). These factors would suggest that there is a separate agent, other than HIV, which may be transmitted by sexual activity and hence is particularly likely to affect the homosexual population. The declining incidence of KS may parallel the recent decline of other sexually transmitted diseases seen in homosexual males such as gonorrhea and syphilis. In Africa HIV infection is frequently transmitted by heterosexual contact. It is therefore interesting to note that atypical, aggressive KS is a common manifestation of African AIDS. Also, this form of African KS affects women much more commonly than the conventional, endemic KS, and this may reflect the importance of their
82
JANE AAMES
increased contact to a sexually transmitted agent responsible for KS, other than HIV. These epidemiological studies have led to many experiments that have attempted to identify the proposed infectious agent. In early experiments (Giraldo et al., 1972), herpes-type particles were observed in five of eight tissue culture lines derived from different cases of African KS. However, this study has a number of serious drawbacks. The cultivated cells were heterogeneous, with cell types only defined on morphological grounds, raising the probability that fibroblasts and macrophages from normal adjacent skin were also being propagated. Furthermore, the cell cultures underwent morphological changes after 2-3 months propagation and only then were virus particles observed; hence contamination of cultures was a real possibility. Glaser et al. (1977) proceeded to characterize the virus found in one of these cultured lines and found it to have some properties shared with human cytomegalovirus (HCMV). Despite the limitations of such studies, these experiments, along with seroepidemiological studies showing a high incidence of CMV antibodies in European and American KS patients (Giraldo et al., 1975, 1978), set the trend for the association of CMV infection with KS. Later, Giraldo et al. (1980) identified the CMV genome in KS tissue biopsy samples using DNADNA reassociation kinetics and in situ hybridization, using purified virion DNA as a probe. However, it was later discovered (Riiger et al., 1984) that CMV DNA has sequences homologous to parts of the human genome, raising the possibility that these early CMV probes were hybridizing to such human DNA sequences. Evidence to support this hypothesis was reported by Ruger et al. (1984) using Southern blot analysis of KS tissue and hybridization to cloned CMV probes, which lacked the sequences homologous to normal human DNA. Most tumors examined did not contain detectable CMV DNA. The viral DNAs that were detected in some KS tissues were at concentrations that did not exceed the amounts sometimes seen in non-KS tissue in generalized CMV infection. Other workers who searched for CMV DNA using similar cloned probes (Delli-Bovi et al., 1986) did show hybridization in some samples of KS tissue, but hybridization also occurred in non-KS tissue taken from the same patients. There are problems in studying the relationship of CMV to KS, in that CMV infection is very common in the normal adult population (58% of pregnant white females were found to be antibody-positive in a study by Stern and Tucker, 1973), and people who are immunosuppressed have an especially high incidence of CMV reactivation and reinfection. It is also known that homosexual men have an extremely high prevalence of CMV
A REVIEW OF KAPOSI’S SARCOMA
83
antibody of up to 94% (Drew et al., 1981).As KS itself is more prevalent in immunosuppressed populations, rigorous controls are needed in any experiment that attempts to show that CMV is causally linked to KS, rather than found by chance alone. At present it appears that the initial studies that suggested a causal relationship between CMV and KS have not been substantiated. Other viruses have been considered, such as Epstein-Barr virus (Giraldo et al., 1975), hepatitis B virus (Siddiqui, 1983; Delli-Bovi et al., 1986), and HIV itself (Delli-Bovi et al., 1986), but again there is little evidence for any causal relationship. It seems that the infectious agent is proving elusive, yet the weight of epidemiological evidence for an infective etiology is too great to dismiss. An entirely new, undiscovered “Kaposi’s sarcoma virus” should be considered.
B. ANCIOCENICFACTORS An interesting aspect of KS is its close relationship with immunosuppression. Reduced immunosurveillance. alone is not enough to explain why KS is so common among immunosuppressed patients. If this was purely the case, one would expect the occurrence of KS to be overshadowed by more common tumors seen in the general population, such as lung and colonic cancers in the West, and hepatoma and bladder cancers in Africa. One has to consider if the immune imbalance itselfin some way positively selects for the development of KS. There is mounting evidence that endothelial-cell function is closely related to cells of the immune system. Supernatant from in uitro-activated T cells can induce HLA-DR antigen expression on endothelial cells (Stastny and Nunez, 1981). Mitogen- and antigen-stimulated T cells are known to release a lymphokine that either directly or indirectly induces angiogenesis (Auerbach and Sidky, 1979). Activated lymphoid cell lines produce a soluble factor that causes inhibition of endothelial-cell migration (Cohen et al., 1982). Macrophages activated either in uiuo or in uitro produce a soluble factor that causes neovascularization in the guinea pig cornea (Polverini et al., 1977). Some of these soluble factors responsible for angiogenesis have been identified (e.g., heparin and prostaglandin El); others have not yet been isolated, and it is likely that angiogenesis is only one of their many functions. So far, the interaction between immune cells and endothelial cells appears intricate and complicated. However, it seems that some molecules involved in the regulation of the immune system have additional effects on angiogenesis. It may be that the immune system imbalance seen during immunosuppression- is responsible for the increased circulation of factors with
84
JANE ARMES
angiogenic properties, or alternatively the loss of molecules with inhibitory effects on angiogenesis. Increased angiogenesis would account for this histological appearance of KS.
C. ONCOGENES The DNA extracted from KS lesions has been examined for the presence of oncogenic sequences. The first report of transforming sequences in KS DNA was by Lo and Liotta (1984). They extracted DNA from KS in subcutaneous tissue and lymph nodes from a homosexual man with extensive KS, and transfected the DNA into NIH-3T3 cells. The transformed colonies were found to contain human repetitive DNA sequences, and the DNA from these primary transformants could be used to generate secondary transformants in NIH-3T3 cells. Both primary and secondary transformants produced angiosarcomatous tumors when injected into nude mice. The DNA from transformed clones were probed for various known oncogenes (rasH, rasN, rasK, v-sis, v-src, v-fes) by Southern blot, but hybridization was not found. Hence the possibility of a new transforming oncogene present in KS was suggested. No further demonstration of this transforming element was reported until very recently (Delli-Bovi and Basilico, 1987; Delli-Bovi et al., 1987). In these studies, DNA from KS biopsy samples from several AIDS patients were transfected into NIH-3T3 cells. A single transformed focus resulted from one case only. This contained human repetitive DNA sequences, and DNA from this clone was capable of producing secondary transformants and tumors in nude mice. The transforming sequence was found to be 11 kb long, from which two mRNA molecules (1.2 and 3.2 kb) were transcribed. The protein translated from the 1 .%kb transcript was shown to have transforming properties and could promote growth in NIH-3T3 cells. The amino acid sequence showed significant homology to basic and acidic fibroblast growth factor; such growth factors are known to have strongly angiogenic properties. Hence, it was postulated that this new KS oncogene could produce an autocrine growth factor that stimulated angiogenesis. However, a serious drawback to this study was the inability to detect this KS oncogene in the original KS necropsy material. Therefore, there is a real chance that this transforming gene was generated through the transfection procedure itself. It also should be noted that only one among several KS specimens was capable of producing a transforming colony in NIH-3T3 cells. Further comparison of the transforming sequence from the KS necropsy specimen has shown homology with a new oncogene (hst) isolated from human stomach cancer and normal stomach mucosa (Sakamoto et ul., 1986; Taira et ul., 1987). However, it is also possible that the hst oncogene is produced during the transfection process, especially as one of the hst
A REVIEW OF KAPOSI’S SARCOMA
85
oncogene sequences was isolated during the transfection of NIH-3T3 cells with DNA prepared from normal stomach mucosa.
D. HORMONAL INFLUENCE
A feature of KS that is not seen in any other sarcoma is its predominance in males. This predominance is seen in most epidemiological categories, but far less so in children. This may suggest some hormonal effect on the disease process. How exactly this control is effected is unknown, and it cannot be entirely due to protection by estrogens, as the proportion of mature females who develop KS before and after the age of the menopause is the same for males in the corresponding age groups (Templeton, 1972). One would have expected an increase of KS in postmenopausal women if estrogens have a protective effect. Reversal of hormone profile has been tried with estrogen therapy, with little success (Templeton, 1972). VII. Conclusion
Even with recent advances in molecular and cellular biology, the exact mechanisms involved in the etiology and pathogenesis of KS are poorly understood. The production of reliable markers to the pathological KS cell would be of use especially in the examination of tissue sections and in tissue cultures. A reproducible culture system would be invaluable to detect individual agents important in the growth of the tumor. It may be that the suggested etiological mechanisms are of unequal importance in the different epidemiological and clinical types of KS, and perhaps KS is the common end point to a variety of initiating processes.
ACKNOWLEDGMENTS I would like to thank Professors A. Bayley and R. Weiss, and Drs D. Venter, C. Marshall, J. McKeating, and J. Weber for their help and advice in preparing this text, and the Cancer Research Campaign (United Kingdom) for financial support.
REFERENCES Ackerman, A. B. (1979). Am. J . Dermutopathol. 1, 165-172. Auerbach, R., and Sidky, Y. A. (1979). J . Zmmunol. 123, 751-754. Bayley, A. C., Downing, R. G . , Cheingsong-Popov, R., Tedder, R. S., Dalgleish, A. G . , and Weiss, R. A. (1985). Lancet i, 359-361. Beckstead, J. H . , Wood, G . S . , and Fletcher, V. (1985). Am. J . Pathol. 119, 294-300. Biggar, R. J . , Horm, J., Fraumeni, J. F., Jr., Greene, M. M., and Goedert, J. J. (1984).J . Natl. Cancer Inst. 73, 89-94. Bland, J. M., Mutoka, C . , and Hutt, M . S. R. (1977). East Afr. J . Med. Res. 4, 47-53.
86
JANE A R M E S
Brooks, J. J. (1986). Lancet ii, 1309-1311. Cohen, M. C., Picciano, P. T., Douglas, W. J . . Yoshida, T., Kreutzer, D. L., and Cohen, S. B. (1982). Science 215, 301-303. Costa, J., and Rabson, A. S. (1983). Lancet i, 58. De Dobbeleer, G., Godfrine, S., Andr6, J., Ledoux, M.,and DeMaubeuge, J. (1987). J. Cutaneous Patho!. 14, 154-157. Delli-Bovi, P., and Basilico, C. (1987). Proc. Natl. Acad. Sci. USA 84, 5660-5664. Delli-Bovi, P., Donti, E., Knowles, D. M., 11, Friedman-Kien, A., Luciw, P. A,, Dina, D., Dalla-Favera, R., and Basilico, C. (1986). Cancer Res. 46, 6333-6338. Delli-Bovi, P., Curatola, A. M., Kern, F. G., Greco, A,, Ittmann, M., and Basilico, C. (1987). Cell 50, 729-737. Des Jarlais, D. C., Stoneburner, R., Thomas, P., and Friedman, S. R. (1987). Lancet ii, 10241025. DiGiovanna, J. J., and Safai, B. (1981). Am. J. Med. 71, 779-783. Drew, W. L., Mintz, L., Miner, R . C., Sands, M.,and Ketterer, B. (1981).J. Infect. Dis. 143, 188-192. Francis, N. D., Parkin, J. M., Weber, J., and Boylston, A. W. (1986).J. Clin. Pathol. 39,469474. Giraldo, G., Beth, E., Coeur, P., Vogel, C. L., and Dhru, D. S. (1972).J. Natl. Cancer lnst. 49, 1495-1507. Giraldo, G., Beth, E., Kourilsky, F. M., Henle, W., Henle, G., Mike, V., Huraux, J. M., Anderson, H. K., Gharbi, M. R., Kyalwazi, S. K., and Puissant, A. (1975). Int. J. Cancer 15, 839-848. Giraldo, G., Beth, E., Henle, W., Henle, G., Mike, V., Safai, B., Huraux, J. M., McHardy, J., and De-The, G. (1978). lnt. J. Cancer 22, 126-131. Giraldo, G., Beth, E., and Huang, E . 4 . (1980). Int. J. Cancer 26, 23-29. Glaser, R., Ceder, L., St. Jeor, S., Michelson-Fiske, S., and Haquenau, F. (1977). J. Natl. Cancer lnst. 59, 55-60. Haverkos, H. W., Drotman, D. P., and Morgan, M. (1985). N. Engl. J. Med. 312, 1518. Jones, R . , Spaull, J.. Spry, C . , and Wilson Jones, E. (1986). J. Clin. Pathol. 39, 742-749. Kaposi, M. (1872). Arch. Dermutol. Syph. 4, 265-273. Lo, S.-C., and Liotta, L. A. (1984). Am. J. Pathol. 118, 7-13. McHardy, J., Williams, E. H., Geser, A., De-The, G., Beth, E., and Giraldo, G. (1984).Znt. J. Cancer 33, 203-212. McNutt, N. S., Fletcher, V., and Conant, M. A. (1983).Am. J. Pathol. 111, 62-77. Owor, R . , and Hutt, M . S. R. (1977). East Afr. J. Med. Res. 4, 55-57. Penn, I. (1979). Transplantation 27, 8-11. Polverini, P. J., Cotran, R . S., Gimbrone, M. A., Jr., and Unanue, E. R. (1977). Nature (London) 269, 804-806. Reynolds, W. A., Winkelmann, R. K., and Soule, E. H. (1965). Medicine 44, 419-441. Riiger, R . , Burmester, G. R., Kalden, J. R., Bienzle, U.,Braun, R., Safai, B., Sterry, W., and Fleckenstein, B. (1984). “Acquired Immune Deficiency Syndrome,” pp. 127-137. Alan R. Liss, New York. Rutgers, J. L., Wieczorek, R., Bonetti, F., Kaplan, K. L., Posnett, D. N., Friedman-Kim, A. E., and Knowles, D. M., I1 (1986). Am. J. Pathol. 122, 493-499. Sakamoto, H., Mori, M., Taira, M., Yoshida, T., Matsukawa, S., Shimizu, K., Sekiquchi, M., Terada, M., and Sugimura, T. (1986). Proc. Natl. Acad. Sci. USA 83, 3997-4001. Schwartz, J. L., Muhlbauer, J. E., and Steigbigel, R. T. (1984).J. Am. Acad. Dermatol. 11, 377-380. Siddiqui, A. (1983). Proc. Natl. Acad. Sci. USA 80, 4861-4864.
A REVIEW OF KAPOSI’S SARCOMA
87
Stastny, P., and Nunez, G . (1981). In “Transplantationand Clinical Immunology” (J. L. Touraine et al., eds.), pp. 132-139. Excerpta Med. Found., Amsterdam. Stem, H . , and Tucker, S. M . (1973). Br. Med. J . ii, 268-270. Suzuki, Y., Hashimoto, K., Crissman, J., Kanzaki, T., and Nishiyama, S. (1986).J . Cutaneous Pathol. 13, 408-419. Taira, M . , Yoshida, T., Miyagawa, K., Sakamoto, H . , Terada, M., and Sugimura, T. (1987). Proc. Natl. Acad. Sci. USA 84, 2980-2984. Templeton, A. C . (1972). Cancer (Phihdelphia) 30, 854-867.
This Page Intentionally Left Blank
THE RELATIONSHIP BETWEEN MHC ANTIGEN EXPRESSION AND METASTASIS Jacob Gopas,’t Bracha Rager-Zisman,t Menashe Bar-Eii,t Gunter J. HBmmerling,* and Shraga Segalt *Instituteof Oncology, Soroka Medical Center tbpartment of Microbiology and Immunology, Faculty of HeaRh Sciences, Ben-Gurion University of the Negev, Beer-Sheva 84 105, Israel $Institute for Immunology and Genetics, German Cancer Research Center, D-6900 Heidelberg. Federal Republic of Germany
I. Introduction 11. MHC Antigens, Tumorigenicity, and Metastasis in Animal Models 111. MHC Regulation of Antitumor Immunity by Cytotoxic T Cells
IV. MHC Regulation of Antitumor Immunity by NK Cells V. MHC Antigens, Tumorigenicity, and Metastasis in Human Beings VI. Summary and Conclusions References
I. Introduction
The elucidation of the structure of the products of the major histocompatibility complex (MHC) and the understanding of their crucial role in regulating the immune response have been the subject of intensive research over the last 20 years. The murine (H-2K, -D, and -L) and the human (HLA-A, -B, and -C) MHC class I molecules are expressed on the surface of almost all somatic cells as heterodimers composed of a 45,000-Da polymorphic glycoprotein noncovalently associated with an 11,600-Da invariable polypeptide, &-microglobulin (&m) (Nathenson et al., 1981; Kimball and Coligan, 1983; Bjorkman et al., 1987). These molecules are the classical transplantation antigens that mediate allogeneic tissue graft rejection (Snell et al., 1976), and they play a crucial role in the cellular immune response by functioning as the antigen-presenting molecules that enable cytotoxic T lymphocytes (CTL) to discriminate between foreign (nonself) antigens from self antigens. A foreign antigen, whether viral, tumor, or chemically modified, must be associated with the self-MHC molecule, on the cell surface in order to be recognized by CTL as a nonself antigen, a phenomenon known as MHC-restricted recognition, first described by Zinkernagel and Doherty (1979). In contrast, other class I-related molecules, encoded by the Qa-2,3 and 89 ADVANCES IN CANCER RESEARCH, VOL. 53
Copyright 0 1989 by Academic Press, Inc. All rights of reproduction in any form reserved.
90
JACOB GOPAS ET AL.
the Tla regions, are less polymorphic; their expression is limited to certain tissues and their function is largely unknown (Old and Stockert, 1977; Mellor et al., 1984). MHC class I1 genes code for the immune response-associated antigens (Ia) called I-A and I-E in the mouse and HLA-DP, -DQ, and -DR in human beings. These molecules are transmembrane heterodimers consisting of a 35-kDa a chain noncovalently associated with a 29-kDa p chain (Kaufman et al., 1984). The Ia molecules are highly polymorphic and are expressed primarily on the surface of B lymphocytes, macrophages, dendritic cells, and certain epithelial and nervous system cells. These molecules are recognized by antigen-specific receptors of helper T cells and regulate the proper interaction of the different subsets of cells involved in the development of the immune response to foreign antigens (Benacerraf, 1981; Hood et al., 1985). Both categories of molecules possess a common feature: they serve as a password between two cells of an individual, allowing the cells to recognize each other as belonging to the same organism, and thus enabling them to cooperate by virtue of their identity at the level of either class I or class I1 gene products. Specific self-recognition of at least one of these products in conjunction with nonspecific complementary interactions (Edwards, 1978; Staunton et a l . , 1988) are needed for the transmission of a specific message from one subpopulation to another. Major histocompatibility complex molecules have been also described as part of more general phenomena, involving such aspects as MHC-associated adhesion, homing, and contact inhibition (Dausset and Contu, 1980; Scofield et al., 1982), interaction with hormones (Allison et al., 1988) and viruses (Inada and Mims, 1984), as well as in association with cell membrane hormone and growth factor receptors (Due et al., 1986; Hosoi et a l . , 1988), transmembrane-regulated protein kinases (Curry et a l . , 1984; Newel et n l . , 1988), and membrane-associated filaments (Feltkamp et al., 1987), for all of which the common denominator is cell communication. Despite the considerable progress made in our understanding of the function of the MHC, its role in cancer and metastasis is still very unclear. The difficulty in understanding the role played by MHC products in malignancy stems from our present lack of understanding of the role that MHC molecules play in regulating cell-cell communication between the tumor cell and its environment both in immunological terms and beyond its immunological implications. The occurrence of metastases reflects the disruption of normal intercellular signals that allows the spread and proliferation of malignant cells and is one of the most urgent problems in the management of cancer. The ability of malignant cells to disseminate from a locally growing tumor and to form secondary lesions at near or distant sites is considered the most life-threatening aspect of cancer.
MHC
ANTIGEN EXPRESSION AND METASTASIS
91
Metastatic formation is a multistep, highly selective process; the fraction of cells with metastatic potential in primary tumors is variable, but usually small (
Axelrad and Klein (1956) were the first to study the correlation between levels of MHC expression in primary and metastatic tumors. Haywood and McKhann (1971) further investigated this question in 3-methylcholanthreneinduced tumors; cells with high metastatic ability were shown in their work to express high amounts of H-2 and low amounts of tumor-specific antigen (TSA), while low-metastatic cells expressed decreased quantities of H-2 and increased TSA amounts. Since these early studies a large body of information has accumulated regarding the substantial heterogeneity in the expression of MHC antigens among primary and metastatic lesions. Current efforts in this area are concentrated in establishing the contribution of specific MHC gene products to the process of tumor growth and spread and have identified differences in the regulatory functions of H-2D and H-2K gene products expressed on the tumor cells. Studies on the 3-methylcholanthrene-inducedT10 sarcoma, of (CSH/eb x C57BL/6)Fl origin, demonstrated that transfection of the Kk or Kb gene into H-2K-negative parental cells reduced their ability to grow and prevented metastasis (Wallich et al., 1985). The absence of K products but normal
92
J A C O B GOPAS ET AL.
presence of H-2Dk (De Baetselier et al., 1980; Katzav et d . ,1985)or by gene transfection of H-2Dk- variants (Gopas et al., 1988b), though not affecting tumor growth, correlated positively with metastatic potential. The observation that K and D end gene products affect in different ways the metastatic properties of tumor cells was first described in these studies. This phenomenon may be attributable to their possible different physiological functions, with mostly immunogenic activity of H-2K and suppressogenic activity of H-2D. Low and high metastatic sublines of the B16 melanoma have been well characterized (Fidler, 1973);therefore this system appears to be particularly suitable in determining the role played by MHC antigens in determining the metastatic phenotype. Low- and high-metastatic sublines would be expected to differ in their expression of MHC gene products. Results obtained with these cells pointed out that high levels of both Kb and Db were correlated to immunogenicity of the tumor cells and low metastatic ability (Gorelik et al., 1985). Interestingly treatment with interferon (IFN) of a low-H-2, highly invasive subline induced high levels of class I antigen expression but did not influence immunogenic and metastatic properties of the cells (Gorelik et al., 1988). This discrepancy can be explained by the fact that the effect of IFN was transient and the high levels of H-2 expression reverted in uitro to the initial low levels, by 7 days after IFN withdrawal. Results such as these point out the pitfalls in the interpretation of experimental results by which cells are treated in vitro and thereafter their behavior observed after inoculation into animals. A more complex situation was described in the C57BL/G-derived Lewis lung carcinoma (3LL) tumor; these cells grow across allogeneic barriers in spite of H-2 expression. The ability to grow in allogeneic mice was correlated with disproportional expression of class I products; lack, or relatively low expression of H-2Kb antigens and relatively high levels of H-2Db-encoded antigens (Isakov et aZ., 1981, 1982). Paradoxically, this tumor grew in allogeneic recipients in spite of the presence of CTL directed against H-2Db determinants (Isakov et al., 1983). Moreover, using allogeneic and congenic strains of mice, it was demonstrated that locally growing tumor cells developed spontaneous pulmonary metastasis only in mice that shared H-2Db antigens and the C57BL/6 genetic background (Isakov et al., 1981). The immune response evoked against H-2Db antigens in these cells in fully allogeneic BALB/c animals failed to reject the locally growing tumor mass, but was efficient enough to control metastatic spread. Analysis of H-2" expression by metastatic foci in syngeneic mice showed that following intrafootpad reinoculation, cells expressing high-H-2" antigens grow faster locally and developed more metastasis than cells with low
MHC
ANTIGEN EXPRESSION AND METASTASIS
93
expression. Moreover, when metastatic ability and differential expression of both Kb and Db was assessed it was concluded that metastatic potential did not depend entirely on the absolute levels of class I H-2b antigens, but rather correlated with the imbalance in expression of the K and D products (Eisenbach et al., 1983, 1984). Highly metastatic clones expressed relatively low levels of H-2Kb and high levels of H-2Db; nonmetastatic cells were found to express on the cell surface either high levels of both products or, alternatively, low levels of both H-2Kb and H-2Db. These findings and findings of others describing the growth of tumors in allogeneic hosts (Ostrand-Rosenberg and Cohan, 1981; Cohen et al., 1984; Cohen, 1985; De Giovanni et al., 1987) indicate that MHC-governed peripheral immunity is of utmost importance in preventing metastatic spread. These results also lead to two possible assumptions. One is that D-region products, especially as expressed on tumor cells, are not completely devoid of immunogenicity but may preferentially induce, in addition to effector CTL, suppressor cells and/or factors, which prevent local, but not peripheral cytotoxic activity. Thus, while in the allogeneic situation the host may produce highly effective CTL that can attack circulating tumor cells and prevent peripheral dissemination, they fail to prevent the local progression of the tumor. The second possibility is that while CTL are activated, they may face difficulties in extravasating through the walls of the de novo-formed draining capillaries of the growing tumor. 111. MHC Regulation of Antitumor Immunity by Cytotoxic T Cells
Host defense mechanisms against tumors can be broadly classified into two major systems, adoptive and nonadoptive immunity. Adoptive immunity is acquired, is antigen-specific, and is mediated by the presence of TSA and by MHC-restricted cytotoxic T lymphocytes with the Lyt-2+ /L3T4phenotype (Zinkernagel and Doherty, 1979; Dialynas et al., 1983). Nonadoptive immunity is provided at least in part by a small subset of heterogeneous population of lymphoid cells, termed natural killer (NK) cells that has the morphology of large granular lymphocytes (LGL) characterized by their ability to lyse spontaneously a variety of tumor, virus-infected, and nondifferentiated embryonal cells in a non-MHC-restricted fashion (Ortaldo and Herberman, 1984). Major histocompatibility complex-restricted cytotoxic T cells are recognized as one of the most fundamental mechanisms of the classical immune response and therefore are considered as the main candidates for mediation of resistance against tumor growth and tumor progression. Since this population of T cells can respond to cell surface antigens and destroy foreign tissues
94
JACOH GOPAS ET AL.
only in association with molecules encoded by MHC class I genes, this mechanism would be relevant for tumors with immunogenic TSA and aberrant M HC-encoded molecules. Major histocompatibility complex restriction as well as specific antigen recognition are largely mediated through the T-cell receptors (TCR) (Yague et al., 1985; Kronenberg et al., 1986; Tanaka et al., 1988a). One of the problems now facing immunologists is that of discovering the rules by which the binding of TCR to the antigen MHC complex is governed (Roberts et al., 1987). Latest findings favor the one-receptor model, in which a single TCR binds to a combination of class I molecules and antigen (Parham, 1984; Governman et al., 1986; Clayberger et al., 1987). Rajan and collaborators have selected a somatic-cell mutant that expresses a variant H-2Dd molecule that fails to serve as a target for alloreactive anti-Dd CTL. A single nucleotide change resulting in the substitution of glutamic acid to lysine, in residue 227 of the cxg domain, was identified (Potter et a l . , 1987). This work demonstrates that mutations in domains other than cxl or cxz, which are known to affect CTL recognition (Ajitkumar et al., 1988), can indirectly affect the conformation of the molecule, thus inhibiting CTL recognition. Because cytotoxic T cells have dual specificity, it seems reasonable to believe that modulation or mutation of the antigenic determinants expressed by tumor cells, or of the class I MHC antigens, are common mechanisms of escape from cytotoxic T-cell immune response, affecting immunosurveillance of tumors, their growth rate, and their metastatic potential (Doherty et aZ.,
1984). Most experimental tumors induced by viruses, carcinogens, and radiation generally express antigens that are easily recognized as foreign. Spontaneous tumors of unknown etiology apparently lack such antigens and therefore escape the immunological response (Klein and Klein, 1977). The lack of antigenicity of such tumors could be overcome by artificial modification of such cells. This was done by various techniques including nononcogenic virus infection (Lindenmann and Klein, 1967; Shimizu et al., 1984; Shirrmacher and Heicappell, 1987), chemical coupling and haptenization (Flood et al., 1987; Hamaoka et al., 1979; Lachmann and Sikora, 1978), enzyme treatment (Currie and Bagshawe, 1969; Bekesi et a l . , 1971), or somatic-cell hybridization with allogeneic cells (Watkins and Chen, 1969; Klein, 1979; Kuzumaki et al., 1979). In some of these studies it was demonstrated that as a result of the expression of new antigens, the tumors could elicit a response that in some cases was limited not only to the neoantigen, but also to the unmodified original cells (Yamaguchi et al., 1982; Hosokawa et al., 1983). It should be noted, however, that expressing a foreign antigen by itself is not always a sufficient condition for recognition by CTL. On the contrary, there is some experimental evidence to indicate that failure of the immune system
MHC
ANTIGEN EXPRESSION AND METASTASIS
95
to react against certain virally infected tumors is due not to the absence of TSA but rather to the downregulation of MHC molecules. This effect was demonstrated by treatment of tumor cells with various mutagenic and nonmutagenic drugs (Bonal et al., 1986; Elliot et al., 1987), by infection of tumor cells with oncogenic viruses such as adenovirus (Schrier et al., 1983), Moloney murine leukemia (Tanaka et d.,1988b), radiation leukemia virus (Meruelo et al., 1986), and Epstein-Barr virus (EBV; Masucci et al., 1987), or with a variety of nononcogenic viruses (Hecht and Summers, 1972; RagerZisman et d . , 1981; Jennings et d., 1985).A temporal relationship between the state of virus infection and susceptibility to CTL has been found in our studies with murine neuroblastoma cell lines. Acute infection of A strain (H-2k’d) murine neuroblastoma cells with measles virus caused a selective decrease in the expression of H-2Kk determinants. The acutely infected cells became less susceptible to virus-specific, syngeneic, or allogeneic CTL (Rager-Zisman et al., 1981), therefore reflecting a selective advantage with a likely immunological basis. Neuroblastoma cells persistently infected with the same virus were highly susceptible to measles-specific or allogeneic CTL and became nontumorigenic. It was found that unlike in the acute infection, the persistent infection upregulated the expression of the H-2Kk and H-2Dd determinants, thus providing the restriction element necessary for CTL response (Gopas et al., 1987). In several experimental systems the expression of the H-2K gene was associated with CTL recognition and with abrogation of tumorigenicity and metastasis. For example, in Gross virus-induced AKR leukemia, the specific loss of the Kk antigen was correlated with resistance to killing in uitro by CTL (Schmidt and Festenstein, 1982). Selection of Kk loss variants with a cloned cytotoxic T-cell line resulted in growth of cells that no longer expressed the relevant H-2K gene product, but that continued to express normal amounts of the H-2D products (Pan et al., 1987). These cells were nonimmunogenic and highly tumorigenic. Immunogenicity of this tumor was completely restored following the transfection of the H-2Kk gene (Hui et al., 1984). The K end was also found to be the restriction element for specific CTL in simian virus 40 (SV40)-transformed cells that are not tumorigenic in immunocompetent hosts. Repeated passage of SV40-induced tumors in immunocompromised hosts resulted in the isolation of cell variants that failed to express Kk, were resistant to killing by CTL, and were highly tumorigenic even in immunocompetent syngeneic recipients (Gooding, 1982; Rogers et al., 1983).The defect in K k expression in these cells was traced to rearrangement at or in the vicinity of the K k gene. Similarly, transfection of H-2K-negative B16 melanoma cells with syngeneic H-2Kb by Tanaka et al. (1985) was also shown to enhance immu-
96
JACOB GOPAS ET AL.
nogenicity and abrogate tumorigenicity of the transfected cells. With a vaccinia-Friend recombinant virus, it was shown that in susceptible mice, protective immunization was regulated by the expression of the H-2K region of tumor cells, while the H-2D region was involved in virus-induced immunosuppression (Morrison et al., 1987). An exception to the direct relationship between immunogenicity and increased H-2 expression has been observed by B. E. Elliott (personal communication). He and colleagues isolated high class I-expressing variants of a nonimmunogenic spontaneous mammary adenocarcinoma (SP1) after treatment with the D N A hypomethylating agent 5-azacytidine. This treatment failed to alter the immunogenicity of the tumor cells. The significance of this observation has not been resolved, but it may involve, among other possibilities, local in uivo modulation of H-2 expression (Elliot et aZ., 1987) or differentiation-dependent sensitivity of tumor cells to CTL (Torsteinsdottir et d.,1986; De Baetseher et al., 1988). Since it is now possible to modify tumor cells by gene transfer of MHC genes, we can assess directly the role of specific class I antigens in tumor rejection or progression. For example, transfection of the C57BL/G-derived 3LL tumor with an allogeneic class I H-2 gene, enhanced the immunogenicity of the transfected tumor cells, which were rejected by a host-mediated CTL response (Itaya et al., 1987). In addition, the transfected cells also enhanced antitumor transplantation resistance against the original tumors. The ability of allogeneic class I antigens on their own to enhance susceptibility of tumor cells to lysis by allospecific cytotoxic T cells is still debatable, since transfection of the murine A strain sarcoma tumor cells with a cloned H-2Kh gene did not reduce the tumorigenicity of this tumor nor increase the susceptibility of these cells to lysis by anti-H-2Kb CTL (Cole et al., 1987). These apparently conflicting results can be discussed in light of the work of Marrack and Kappler (1988), in which differential T-cell recognition of the same allogeneic I-E molecule is observed on different cell types. This work implies that recognition of allogeneic MHC is likely to involve associative recognition of self peptides, as originally proposed by Matzinger and Bevan (1977), which are tissue-specific and may vary from cell type to cell type. A second alternative explanation could be the involvement of hitherto-unknown cell-specific accessory molecules that might act to increase the strength of low-affinity TCR binding. Finally, it is possible that subpopulations of MHC molecules expressed on cell surfaces of different cell types are not all identical; differences in glycosylation, alternative RNA splicing leading to changes in amino acid sequence, or selective binding of cell-specific peptides may cause conformational changes, thus enhancing or impairing specific binding. It would be of interest to see if this observation may also apply to T-cell
MHC
ANTIGEN EXPRESSION A N D METASTASIS
97
recognition of allogeneic class I molecules. This may explain the array of regulatory properties associated with the different class I gene products and the sometimes puzzling correlation of metastasis with the expression of specific MHC products in different tumor systems. Qualitative variations in MHC expression on tumor cells have also been described by several investigators (Parmiani et al., 1979; Schmidt and Festenstein, 1980). Festenstein and collaborators have identified an aberrant allospecificity in the 36.16 thymoma cell line from AKR (H-2k) mice, which was specifically lysed by anti-Dd CTL (Schmidt and Festenstein, 1980; Festenstein and Schmidt, 1981), suggesting that this alien specificity is Dd-like. Indeed, structural variations from parental AKR DNA were later identified in the H-2 genes of AKR lymphomas (Hui et al., 1986). Another example suggesting the involvement of an alien, class I molecule serving as a restriction element for CTL has been described by No11 et al. (1987), in which the Rous sarcoma virus-transformed DOH cell line was demonstrated to be immunogenic and yet lacked expression of syngeneic MHC antigens. Studies performed on the ultraviolet (UV) light-induced murine skin tumor 1591 has demonstrated that tumor-specific CTL clones can be generated to reject cells expressing a unique TSA, which appears to be a novel MHC class I molecule that can be detected with monoclonal antibodies (Stauss et al., 1986; Schreiber et al., 1988). This finding might account for previously observed abnormal reactivity of alloantigen-specific antibodies with tumor cells and lends support to the identification of altered MHC class I products in other systems. It appears from the examples cited that alterations of class I antigens that affect the recognition of tumor cells by CTL can be due to (a) quantitative regulation or loss of specific class I antigens, (b)aberrant expression of class I molecules, and (c) generation of novel class I antigens. Since the development of metastatic foci depends in part on the ability of certain cells from the original tumor cell population to evade immune surveillance, as indicated by studies in immunosuppressed or immunodeficient animals, changes in the immunogenicity or MHC expression of transformed cells might provide certain advantages to potentially metastatic cells even when an immune response occurred against the locally growing tumor. IV. MHC Regulation of Antitumor Immunity by NK Cells
Much of the contemporary interest in the role of nonadoptive immunity against malignancy stems from the search for specific cytocidal mechanisms. In the early 1970s a novel mechanism was uncovered. It was found that lymphoid cells from normal mice or human donors were capable of spon-
98
JACOB GOPAS ET AL.
taneously lysing a variety of neoplastic or virus-infected target cells in vitro in a short-term assay (Herberman, 1980). The cells responsible for this spontaneous cytotoxicity were termed natural killer (NK) cells. Since the original discovery a large amount of data has accumulated to support the view that these cells play an important role in immunological control of hematopoiesis and of viral infections, and in the inhibition of metastatic spread (Herberman and Ortaldo, 1981; Hanna, 1986). Functional aspects of the NK system have not been fully elucidated. Nonetheless, it is clear that NK activity measured by in uitro cytolysis of a variety of target cells can be mediated by a heterogeneous population of lymphoid cells (Lanier et al., 1986). Originally it was reported that N K cells are naturally occurring cytotoxic cells active against certain malignancies as well as against various virus-infected cells, but soon after that they were also found to possess cytotoxic capability against some normal cellular components including lymphohematopoietic cells and normal fibroblasts (RagerZisman and Bloom, 1982). In addition to the naturally occurring NK cells, another population of lymphoid cells capable of lysing tumor cells after incubation in interleukin 2 (IL-2) was described. These cells, termed lymphokine-activated killer cells (LAK), differ from N K cells largely in their ability to kill fresh tumor targets (Rosenberg, 1988). Nonetheless N K and LAK cells share the common characteristic of mediating non-M HC-restricted functions, seemingly in the absence of antigen stimulation. Most of the evidence implicating N K cells as a defense mechanism against tumor growth and metastatic spread is based on the correlation between levels of NK-cell cytotoxic activity of the host or susceptibility of tumor cells to lysis by N K in uitro and the inhibition of growth of the same tumor cells in uiuo. For example, resistance against the growth of YAC and other lymphoma cells correlated with the levels of N K activity of the host (Kiessling et al., 1975; Riesenfeld et al., 1980). Beige (bg+/bg+)mice, defective in NK-cell activity, developed faster-growing tumors and at a higher frequency than normal syngeneic C57BL/6 mice after inoculation of NK-sensitive tumor cells (Karre et al., 1980a,b; Talmadge et al., 1980). On the other hand, athymic mice with high levels of NK-cell activity exhibited marked resistance against the growth of a variety of transplantable tumors (Warner et al., 1977). It is important to note that only tumor cells sensitive to in uitro lysis by NK cells exhibited a reduced growth rate or were completely rejected in uivo (Minato et al., 1979). When an NK-resistant fibrosarcoma cell line, selected in vitro from the NK-sensitive UV-2237 tumor cells was injected into the footpad of syngeneic mice, the NK-resistant cells developed into a palpable tumor in a significantly shorter time than cells of the NK-sensitive parent tumor. In uitro, the
MHC
ANTIGEN EXPRESSION AND METASTASIS
99
growth rates and generation-doubling time of the two tumor cell lines were similar in spite of the early emergence of the NK-resistant transplanted tumor cells. This may suggest that endogenous NK cells may influence the number of tumors while they are not effective in the control of tumor growth at later stages of tumor progression (Fidler et al., 1979). This assumption was further substantiated when NK-mediated destruction of iv-injected radiolabeled tumor cells was measured (Riccardi et al., 1980). This assay allows a precise assessment of the immediate NK-mediated destruction before other mechanisms become involved (Hanna and Fidler, 1980).A close correlation between tumor resistance in this in uiuo model and the levels and kinetics of NK cytotoxicity was observed. The rapidity of this in uiuo activity supports the view that NK cells may represent a first line of defense against hematogenous dissemination of tumor cells, especially since the bloodstream is the most common pathway for dissemination of cancer cells. Further evidence to support the role of N K cells in the destruction of circulating tumor cells and in the inhibition of metastatic development was provided by selective depletion and adoptive-transfer experiments with NK cells. Selective depletion of NK cells by treatment with anti-asialo-CM, antibodies or with anti-NK1.1 alloantiserum (Kasai et al., 1981; Pollack, 1982) significantly increased the incidence of metastases and prolonged the survival in the circulation of several NK-sensitive solid tumors (Barlozzari et al., 1985; Hanna and Burton, 1981). A single injection of cyclophosphamide (CY) 4 days before tumor transplantation markedly enhanced the development of pulmonary and extrapulmonary tumor metastases (Riccardi et al., 1980). Adoptive transfers of normal spleen cells 24 hr after tumor cell injection into CY-treated mice restored the ability of these mice to eliminate tumor cell spread and the formation of metastases. The effector cells active in the reconstitution experiments were non-T non-B and expressed NK1 and asialo-CM In addition, the abrogation of experimental metastasis in lungs of NK-depleted animals was achieved by adoptive transfers of relatively low numbers of highly purified cloned NK cells. In these studies only clones exhibiting lytic activity were effective (Warner and Dennert, 1982). Since IFN is a principal regulatory molecule of NK-cell activity, the role of the IFN-NK system in restriction of tumor growth in uiuo was tested. Nude mice were treated with anti-IFN serum. This treatment was shown to reduce both IFN production and NK activity in spleen cells. When persistently virus-infected tumor cells, which normally are rejected by nude mice, were transplanted into the IFN-treated mice, highly invasive and often metastatic tumors were formed (Minato et al., 1979). Similar results were obtained when primary human prostatic tumors were transplanted into these mice (Reid et al., 1981).
100
JACOB GOPAS ET AL.
Studies on the antimetastatic effects of NK-cell activation by biological response modifiers (BRM) also provide evidence in support of the in uiuo role of NK cells in the prevention and perhaps therapy of tumor metastasis. Prophylactic treatment with BRM that stimulate NK-cell activity prevents the development of tumor cell metastasis. However, such substances exhibit weak antimetastatic activity in hosts whose N K activity has been depleted by a variety of treatments (Herberman, 1986). The effect of BRM could be regained after reconstitution of the NK-suppressed animals with lymphoid cells. Further possible therapeutic efficacy in some patients with advanced metastatic disease has been reported with the combination of IL-2 administration and adoptive transfer of large numbers of LAK cells (Rosenberg et al., 1985). One cardinal unresolved question general to all forms of spontaneous killing is the basis for target cell recognition. Several specific target structure moieties including glycolipids and glycoproteins were proposed (Yogeeswaran et al., 1982; Hiserodt et al.,1985); nevertheless, the N K target structure still remains obscure, although it is widely accepted that unlike T cells, NK cells recognize their targets in a non-MHC-restricted fashion. This view has been challenged by Karre and colleagues (1986), who proposed a role for MHC class I glycoproteins in N K selective killing of target cells. Based on a series of studies using various cloned target cells derived from MHC class Iexpressing tumor cells, Karre has suggested that there is an inverse relationship between MHC class I glycoprotein expression and susceptibility to lysis by NK, and that NK cells are guided in their target selectivity by the diminished or aberrant expression of the histocompatibility gene products. According to Karre’s argument, cells expressing class I MHC products are targets for cytotoxic T cells, whereas cells that express diminished amounts or deviant structures of these antigens trigger the NK system. The data on which this hypothesis rests are limited and controversial, although there is some circumstantial evidence in its support. For example, H-2-negative cell variants of RBL-5 and EL-4 lymphoma selected after mutagenesis manifested higher levels of NK sensitivity to NK lysis than their parental H-2positive cell lines (Ljunggren and Karre, 1985; Karre et al., 1986). Transfer of YAC or B16 melanoma cells from in uiuo to in uitro culture was associated with a gradual increase in NK sensitivity and a reduction of H-2 antigen expression (Piontek et al., 1985; Taniguchi et al., 1985). The metastatic potential of B16 melanoma cells was closely related to increased MHC class I expression, and a correlation was found between reduced levels of M HC and increased susceptibility to NK (Taniguchi et al., 1985; Ljunggren and Karre, 1985; Kawano et al., 1986). The inverse correlation between H-2 and susceptibility to lysis was specific to the spontaneous cytotoxic activity mediated by NK cells. This population of cells showed higher killing activity of B16
MHC
ANTIGEN EXPRESSION AND METASTASIS
101
melanoma H-&negative cells, while LAK cells lysed more efficiently the H-2-positive tumor cells. In uivo experiments in this system showed that N K cells prevented the formation of pulmonary metastasis of B16 H-2-negative cells in normal syngeneic hosts, where LAK cells inhibited pulmonary metastasis of B16 H-2-positive cells in NK-depleted syngeneic hosts (Toshitani et al., 1987). Clones of a chemically induced fibrosarcoma (GR-9) showed also an inverse relationship between class I expression, N K susceptibility, and the metastatic phenotype (Garrido et al., 1988). Similar results were obtained when human EBV-transformed B-cell lines (Harel-Bellan et al., 1986) and a series of cloned human T-lymphoblastoid cell lines (Storkus et al., 1987) were investigated. In both studies, cell variants that lacked HLA class I molecules were highly sensitive to lysis. Although the experiments just summarized indicate that there is an inverse correlation between N K resistance, MHC expression, and the metastatic phenotype, this is by no means a general phenomenon and so far it has been shown in relatively few host tumor systems (Ljunggren et al., 1988). As previously mentioned, many tumor host systems have also been described in which a decrease in expression of class I MHC antigens is associated with increased malignancy, presumably due to the inability of host-specific CTL to recognize the tumor (Goodenow et al., 1985)and to putative resistance to NK activity (Gorelik, 1987). For example, an increase in the expression of H-2b class I antigens by two melanoma clones was associated with an increase of their susceptibility to NK or LAK cells (Gorelik, 1987). Similar treatments were obtained with tumor cells transformed with the E l A gene from adenovirus type 5, which expressed high levels of MHC class I antigens and showed high sensitivity to NK cells (Sowada et aZ., 1985; Cook et al., 1986). In this context it is important to note that treatment of H-2-deficient, nonmetastatic B16 melanoma cells with physiological doses of IFNy increased expression of H-2, induced resistance to NK, and reduced cellular growth in uitro, but increased malignancy as measured by lung colonization (Taniguchi et al., 1987). Although different laboratories have demonstrated that treatment of tumor cells with IFN y increase H-2 expression and concomitantly become more metastatic, there is a discrepancy among these same groups concerning the lung colonization ability in NK-impaired mice of cells with different H-2 expression. Some investigators found that cells with high H-2 expression were more metastatic than cells with low expression (Kawano et al., 1986; Lollini et al., 1987); some found the opposite (Ramani and Balkwill, 1987), while others found no difference (McMillan et al., 1987). It is obviously possible that methodological disparity (cell types, H-2 induction, anti-NK treatment, IFN dosage) could account for this discrepancy; however, it could also be due to NK-independent, H-2-related factors.
102
JACOB GOPAS ET AL.
To analyze further the relationship between expression of class I antigens and susceptibility to lysis by NK cells, experiments addressing the question whether absence or expression of specific K or D class I products affect NK recognition were performed by Dennert et al. (1988), who have reported that stimulation of H-2 expression of H-2d in lung carcinoma cells, or alternatively, H-2DP transfection of the cells had no influence on poly(1: C)induced NK cytolytic susceptibility. These transfectants were nonetheless effectively lysed by specific DP CTL (Bahler et al., 1987). In our studies with the T10 fibrosarcoma we analyzed two clones: IC9, which is nonmetastatic, lacks expression of H-2Kb,-Kk, and -Dk but expresses H-2Db; and IE7, which is metastatic, H-2Kb and H-2Kk-negative, but H-2Db- and H-2Dk-positive. We found an inverse correlation between the metastatic properties of the cells and susceptibility in uitro to lysis by virus-augmented NK cells. De novo expression of H-2K genes by transfection led to the generation of syngeneic CTL and to the elimination of the cells’ metastatic capacity (Wallich et al., 1985), yet had minor influence on the putative susceptibility of these clones to NK activity (Gopas et al., 1988a). Preliminary work on H-2Dk-transfected IC9 cells (Gopas et al., 1988b) showed no effect on the cells’ susceptibility to NK activity and inability to generate syngeneic CTL, although some of the clones became metastatic. By selection with antibody and complement, variants of the IE7 cells lacking H-2Dk were generated, which exhibited (contrary to the IE7 parent) a high degree of sensitivity to NK activity. These findings suggest that the H-2Dk gene product itself is not responsible for the resistance to NK, but possibly a product(s) that maps in its vicinity. One may speculate that the selection of H-2Dk-negative variants resulted in the concomitant loss of adjacent genes, possibly involving Qa or TZa elements. Therefore, in this context, transfection with the H-2 gene alone cannot restore expression of a wider DNA region that might have otherwise been lost in the naturalselection process of IC9. We interpret our results as indicating that there is no single quantitative, inverse correlation between metastatic potential, NK resistance, and MHC expression. Our results are in line with other reports in the literature in which the relevance of the MHC region, adjacent to but distinct from the H-2D locus, is involved in modulating the activity of NK cells, such as in the phenomenon of “hybrid resistance” in which F, hybrids react against transplants of parental normal cells (Cudkowicz and Stimpfling, 1965) and of a variety of tumors (Hellstrom, 1963). The influence of the genes (Hh) governing this phenomenon is observed at the level of effector activation (Kiessling et al., 1975; Daley et al., 1987) as well as that of target susceptibility (Rembecki et al., 1987). It has been suggested by Mifi et al. (1985)that recognition of Hh putative antigens apparently leads to the secretion of IFN a/p and the
MHC
ANTIGEN EXPRESSION AND METASTASIS
103
activation of NK cells, which lyse or inactivate parental donor cells transplanted into F, hybrids. The increased susceptibility to N K lysis of Dk “loss” variants also supports the hypothesis (Karre, 1985) that NK recognition of targets is guided by negative rather than positive signals-that is, by the absence rather than the presence of MHC cell surface molecules. High NK activity against parental tumor cells, as suggested by Kawano et al. (1988), may be operating through a mechanism that sorts out the incomplete self-M HC targets; tumor cells therefore require adequate expression of the host-type MHC for successhl metastasis in order to adhere at the metastatic site and to escape surveillance by the N K system. V. MHC Antigens, Turnorigenicity, and Metastasis in Man
Interest in the expression of class I and class I1 antigens by human tumor cells has been stimulated by the possibility that abnormalities in their expression represent the end result of immunoselective processes that provide tumor cells with mechanisms to escape from immune surveillance. The determination of M HC changes on tumors in comparison to normal tissues may as well help to define useful new markers in immunopathology. The development of monoclonal antibodies against specific HLA products and the use of sensitive histochemical preparations have shown that malignant transformation of cells may be associated with changes in the expression of HLA class I antigens (Ferrone et al., 1986). Several studies have pointed out that HLA class I antigens have a more restricted distribution in normal tissues of nonlymphoid origin than originally postulated (Natali et al., 1984a; Daar et al., 1984a); conversely, the expression of class I1 antigens has a broader tissue distribution than originally assumed, and these antigens have been shown to be expressed by a variety of cells that are not directly associated with the immune system (Solheim et al., 1986;Daar et al., 1984b). In addition, the gene products of the loci in the HLA-D region (DR, DQ, DP) display differential tissue expression (Natali et al., 1984b, 1986) and regulation (Giacomini et al., 1986).Furthermore, both class I and I1 antigens show the ability to be induced and modulated by a variety of stimuli that include immune interferon. Perturbation in the amounts and the structure of cell surface HLA antigens in human cells may have significant clinical implications. The distribution of HLA antigens of classes I and I1 has been described in many human tumors including colon, gastrointestinal, breast, and ovarian carcinomas, as well as in melanomas (Kabawat et al., 1983; Natali et al., 1985; Lopez-Nevot et al., 1986; Ruiter and Ferrone, 1986; Taramelli et al., 1986). In these studies it was also found that there is heterogeneity in the expression of
104
JACOB GOPAS ET AL.
these antigens among tumor cells within a lesion, among lesions removed from different patients, and between primary and autologous metastases. A number of neoplasms, however, have been shown not to express class I antigens, and in some, specific class I gene DNA rearrangements have been identified (Momburg et aZ., 1986; Bar-Eli et al., 1988). One can argue that tumor cells lacking class I antigens are those that can escape the host immune response. Therefore, metastases or recurrences should predominantly contain class I-negative cells. This assumption contrasts with empirical results showing the presence of class I antigens in cells of metastatic tumors (Natali et al., 1983; Taramelli et al., 1986). In addition, negative results should be interpreted cautiously, since in some cases the apparent inability to detect HLA expression on tumor cells could be overcome-as shown by Ottesen et al. (1988)-by treatment of the cells with neuroaminidase, suggesting that at least some of the quantitative differences observed could be due to masking of the membrane-bound HLA antigens by sialic acid glycoconjugates. Dissociation in the expression of the two subunits of HLA class I antigens has also been observed and originally described by Mauduit et al. (1983);in this work p-2m molecules are detected in various forms of cutaneous malignancies in the absence of class I heavy-chain expression. A similar finding was also observed in a high percentage of transitional-cell carcinomas of the bladder (I. Levin, personal communication). It can be speculated that heavy chains are expressed by the tumor cells and bind p-2m but are not detected by conventional monomorphic monoclonal antibodies. These class I heavy chains might be aberrant or represent other than the classical HLA-A, B, C molecules, such as Tla-Qa-like human equivalents (Stern et al., 1986), and may be expressed as a result of gene mutation or rearrangement, or by the influence of abnormal differentiation occurring in the transformed cells. However, many human tumors, particularly those of epithelial derivation, appear to express greatly reduced levels of surface class I molecules; they include basal cell carcinoma (Holden et al., 1983), squamous-cell carcinoma (Turbitt and Mackie, 1981), eccrine porocarcinoma (Holden et d., 1984), neuroblastoma (Lampson et aZ., 1983), and small-cell lung carcinoma (SCLC) (Doyle et al., 1985). It is interesting to note that SCLC typically exhibits more rapid growth and earlier metastasis than other lung malignancies, where decreased class I expression is not observed. The degree of malignancy for SCLC cells was also associated with the amplification of the c-myc oncogene. Cell lines of SLCC with the greatest level of c-myc amplification had the lowest level of HLA antigen expression (Doyle et al., 1985). Also in accordance with these findings, neuroblastoma (Lampson et al., 1983) and melanoma (Versteeg et al., 1988) cell lines with amplified N-myc and c-myc oncogenes, respectively, also demonstrated downregulation of MHC class I
MHC
ANTIGEN EXPRESSION AND METASTASIS
105
gene expression. These findings suggest that downregulation of MHC genes can be a common aspect of malignant transformation mediated by oncogenes. Alterations in MHC antigen expression are probably not accidental; the myc oncogene, and maybe other oncogenes such as K-rus (Alon et al., 1987; Maudsley and Morris, 1988) and clfos (Kushtai et al., 1988)-apart from being involved in growth, differentiation, and transformation of cellsare capable of modulating proteins that play a key role in immune recognition. The distribution of HLA antigens of classes I and I1 has been studied in detail in human melanoma. A number of findings indicate that the relative expression of both class I and class TI HLA molecules on the cells affects malignancy of the tumor. First, it has been reported that visceral metastases have a significantly lower class I expression than primary melanomas and locoregional metastasis (Brocker et al., 1985). Second, patients with low class I expression on their tumor cells had a significantly shorter survival than patients with a high class I HLA expression (van Duinen et al., 1988).Third, the expression of HLA-DR antigens in primary melanomas has been shown to be an adverse prognostic sign and is associated with high risk of metastasis, especially in the absence of DP, DQ, or ABC expression (D’Alessandro et al., 1987). Thus it is suggested that tumor progression and invasiveness correlate well with a decrease in class I antigen expression and the appearance of class I1 on melanoma cells (Fossati et al., 1986; Brocker et al., 1985). Class I HLA antigens appear to be able to restrict the interaction between cytotoxic T cells and melanoma cells (Anichini et al., 1985). Antitumor reactive CTL are detected in -70% of the patients (Vose and Bonnard, 1982; Vanky and Klein, 1982). In addition, these studies indicate that this reactivity may be classified as directed against TSA present on autologous cancer cells. To support these data, Mesler-Muul et al. (1987) have reported the identification of specific cytolytic tumor-infiltrating lymphocytes against autologous fresh melanomas that do not lyse normal cells or allogeneic tumor targets. Lysis of fresh tumor cells in uitro by autologous LGL has been also reported, a finding that suggests that, in addition to T cells, NK cells can kill autologous tumor cells in uitro. The functional activity of HLA class I1 antigens in the stimulation of autologous T cells is influenced by the source of tumor cells, since melanoma cells from primary lesions induce the proliferation of autologous T cells whereas those from metastatic lesions do not, possibly reflecting immunosuppressive mechanisms (Taramelli et al., 1984). The structure of class I1 antigens on melanoma cells appears to be similar to that of antigens synthesized by lymphoid cells except for differences in glycosylation (Alexander et al., 1984). In view of the role of carbohydrates in cell recognition (Ashwell
106
JACOB GOPAS ET AL.
and Morrel, 1977), it will be of interest to determine the functional implications of those changes. Imbalances in class I1 antigens have been observed also in murine lymphomas elicited with MCF 1233 virus (Zijlstra and Melief, 1986), in which the expression of particular alleles of I-A genes control the type of lymphoma that develops (T, B or non-T, non-B), and Oliver et al. (1986)have reported a significant positive association between HLA-DR5 antigen frequency and the development of seminomas in human beings. In conclusion, tumor progression in certain human malignancies may be associated with quantitative and/or qualitative changes in the expression of HLA antigens. Limited data are available regarding the mechanisms by which changes in the expression of these antigens occur and how they influence the biology of tumors and their interactions with the host’s immune system. Since experiments in animal models suggest that modulation of the expression of class I histocompatibility antigens on tumor cells can markedly change their malignant properties and their immunogenic properties in the host, further investigation, applying both molecular biology and immunochemical techniques in human tumors, may provide important information resulting in the development of new therapeutic approaches to malignant diseases. VI. Summary and Conclusions
From the studies summarized here a complex picture of the role played by MHC products in determining tumorigenicity and metastasis is emerging. In order to be able to understand this relationship better, it is necessary to consider several factors.
1. Each tumor system or neoplastic tissue is unique, and its behavior reflects the influence of cell-specific characteristics, as well as its ability to modulate other cells and tissues-including cells belonging to the immune system-and also to be modulated by other cells and soluble factors. 2. Since metastasis formation is a multistep process in which only small subpopulations of tumor cells with complex and defined phenotypes are able to colonize secondary tissues, elimination of even one single phenotypic component of this structured process can easily reverse the metastatic capacity of the cells. Acquisition of metastatic ability, on the other hand, would be a more difficult task, since any new characteristic expressed by the cells or induced experimentally, such as gene transfection or results of IFN treatment, must be expressed in a temporal manner and in concert with other cellular characteristics. Therefore, an experimental protocol measuring a specific element in determining metastasis can easily produce conflicting
MHC
ANTIGEN EXPRESSION AND METASTASIS
107
results, depending on the type of cells and genetic background of the host studied. 3. The level of specific MHC products on tumor cells is one among many other cell characteristics that may determine the metastatic potential of cells. Moreover, each of the class 1 MHC products, and the relationship among them, including other than the classical K, L, or D products (Brickell et al., 1983), should be regarded as independent entities, with possible different regulatory roles in cell-cell recognition, in a general sense, which may be involved in determining invasiveness and homing as well as recognition by the immune system. 4. Both specific T-cell and nonspecific natural mediated immunity (which is much less understood) are involved in the selection of the metastatic cell population. 5. Immunogenicity of tumors is not necessarily determined by high levels of MHC antigen expression; it is also dependent on the level of TSA. Thus, immunoselection mediated by T lymphocytes during metastasis formation could be directed against both MHC and TSA antigens. Therefore, low expression of MHC antigens by metastatic cells as a result of immunoselection is not always observed.
The existence of imbalances or aberrations in the expression of class I MHC-encoded antigens was found to be of importance in a variety of systems in the determination of both the malignant potential and the metastatic capacity of certain tumor cells. The question then arises as to the nature and the possible mechanism by which such deranged MHC expression influences the tumor’s malignant character. One explanation is obvious, as documented in numerous articles: the MHC glycoproteins play an obligatory and determinative role in the regulation of antigen recognition, and therefore the lack of expression of these glycoproteins at the level of the malignant cell may enable a tumor to evade immune surveillance. Recognition by T cells is mediated both by their polymorphic clonotypic receptors (TCRa, p or TCRy, 6) as well as by their nonpolymorphic receptors (i.e., CD4, CD8). Thus any genetic or epigenetic event that may influence the presence, integrity, and tertiary structure of any MHC protein domain may lead to an aberrant and/or abortive recognition of the tumor cell bearing this molecule. Furthermore, since evidence is accumulating that different effector and regulatory T cells may be activated, and their mode of action is determined by the differential expression and binding of their receptors to the appropriate molecules on the surface of target cells, one can then assume that structural changes in MHC glycoproteins may evoke both quantitative and, more important, qualitative different immune responses against tumors.
108
JACOB GOPAS ET AL.
We have cited earlier several works, including our own, that have demonstrated that in many murine tumors, irrespective of their mode of induction, one observes a characteristically common imbalance in MHC expression, namely, a preferential loss of H-2K and an enhanced and sometimes aberrant expression of H-2D. This is not an arbitrary finding, but it may indicate a selective advantage for tumor progression. H-2K and H-2D gene products are related but different both in structure and in function; H-2K may serve as a major restriction element, which elicits and amplifies efficiently immune reactions. This notion can be supported by experiments that enable expression of this molecule on tumor cells, by the effect of BRM, gene hypomethylation, or gene transfection. Expression of H-2K correlates with immunogenicity and loss of malignancy and metastatic potential. Conversely, the H-2D molecule has been found in several systems to induce mainly antitumor suppressive immune responses and regulation of some nonimmunological functions. From an immunological point of view the mechanism described seems by itself enough to provide a reasonable basis for the understanding of the association between malignancy and aberrant MHC expression, but the scenario may not be as simple as described, and we may now be facing a new reality in the understanding of the MHC system and its involvement in malignancy. Experimental data are being accumulated, pointing to a wider function of MHC molecules. Regulation of immune functions and immunocyte-target cell recognition seem to be only a minor fraction of a much broader functional responsibility. Major histocompatibility complex molecules may be participating in wider nonimmunological processes regulating cell-cell recognition in general, a function possibly acquired early in evolution. With this approach in mind we can envision that any quantitative or qualitative changes in MHC expression may free tumor cells not only from immune surveillance but also from the normal control mediated by both soluble and membrane-associated regulatory components of neighboring and distant cells. This approach may explain why loss of certain MHC products, but presence of others, leads to diminished tumorigenicity and metastatic capacity on one side and enhanced tumorigenicity on the other, seemingly in a paradoxical manner. But if one considers the possible nonimmunological cell-cell recognition functions of MHC products, one may find a rational explanation for such paradoxes. Specific imbalances or aberrant MHC expression on tumor cells may alter the normal communication capacity of the cell with its microenvironment and prevent, for example, the formation of a supporting substratum obligatory for local growth and development, eventually aborting its invasive capacity. Alternatively, the expression of a different repertoire of MHC molecules may enable autonomous tumor growth.
MHC
ANTIGEN EXPRESSION A N D METASTASIS
109
In conclusion, tumor cells may be selected against the expression of molecules with mainly immunoregulatory functions (i.e., H-2K) but express those MHC molecules that provide a selective advantage for continuous physiological communication of the tumor cell with its microenvironment (i.e., H-2D or other H-2 encoded molecules). We have based the foregoing discussion mainly on data available from well-described murine models. Studies on primary human tumors obviously lack the same level of detailed analysis, but since changes in class I and class I1 antigens have been widely reported in primary tumors and in metastases in cancer patients, it is expected that the relationship between HLA expression and malignancy will be more firmly established in human beings similarly to the observations in rodents, and may prove helpful in developing a more rational approach to diagnosis, staging, and grading, as well as in developing new immunotherapy strategies.
ACKNOWLEDGMENTS B. R. 2. and J. G. were supported by a grant from the Israel Cancer Research Fund, United States and Canada, M. B., G . J. H., and S. S. by a DKFZ Grant, Heidelberg, Federal Republic of Germany, and the National Council for Research Development, Israel. S. S. is the Joseph H . Krupp Professor of Cancer Immunobiology.
REFERENCES Afifi, M. S., Kumar, V., and Bennett, M. (1985).J . Itnmunol. 134, 3739-3745. Ajitkumar, P., Geier, S. S., Kesari, K. V., Borriello, F., Nakagawa, M., Bluestone. J. A,, Saper, M. A , , Wiley, D. C., and Nathenson, S. G. (1988). Cell 54, 47-56. Alexander, S . , Hubbard, S. C . , and Strominger, J. L. (1984).1. Imntunol. 133, 315-320. Allison, J., Campbell, I. L., Morahan, G., Mandel, T. E . , Harrison, L. C . , and Miller, J. F. A. P. (1988). Nature (London) 333, 529-533. Alon, Y., Hammerling, G . J.. Segal, S., and Bar-Eli, M. (1987). Cancer Res. 47, 2553-2557. Anichini, A,, Fossati, G., and Parmiani, G . (1985). Int. J. Cancer 35, 683-689. Ashwell, G . , and Morrel, A. G. (1977). Trends Biochetn. Sci. 2, 76-78. Axelrad, A,, and Klein, G. (1956). Transplant. Bull. 3, 100-107. Bahler, D. W . , Frelinger, L. W., and Lord, E. M. (1987).Proc. Natl. Acad. Sci. USA 84,45624566. Bar-Eli, M . , Battifora, H., and Cline, M. J. (1988). Hum. Genet. 76, 86-89. Barlozzari, T., Leenhardt, J., Herberman, R . B., and Reynold, C. (1985). J. Itnmunol. 134, 2783-2789. Bekesi, J. G., Saint-Arneault, G . , and Holland, J. E. (1971). Cancer Res. 31, 2130-2132. Benacerraf, B. (1981). Science 212, 1229-1234. Bjorkman, P. J . , Saper, M. A., Samroaui, B., Benett, W. S., Strominger, J. G., and Wiley, D. C. (1987). Nature (London) 329, 506-512. Bonal, F. J.. Pareja, E., Martin, J., Romero, C., and Garrido, F. (1986).J. Initnunogenet. 13, 179- 186. Boyse, E. A. (1970). In “lmmunosurveillance” (R. T. Smith and M. Landy, eds.), pp. 5-48. Academic Press, New York.
110
JACOB GOPAS ET AL.
Brickell, P. M . , Latchman, D. S., Murphy, I)., Willison, K.. and Rigby, P. W. J. (1983). Nature (London)306, 756-758. Brocker, E . B., Sitter, L., Bruggen. J., Ruiter, D. J., Macher, E., and Sorg, C. (1985). Int. J . Cancer 36, 29-35. Clayberger, C., Parham, P., Rothhard, 1.. Ludwig, 13. S., Schoolnik, K . , and Krensky, A. M. (1987). Nature (London) 330, 763-765. Cohen, D. (1985). Ado. Cancer Res. 43, 75-111. Cohen, D., Shalev, A., and Krup, M. (1984).J . Natl. Cancer Inst. 72, 395-401. Cole, G . A . , Clements, V. K., Garcia, E. P., and Ostrand-Hosenberg, S. (1987). Proc. Natl. Acad. Sci. USA 84, 8613-8617. Cook, J., Walker, T., Lewis, A. H., Ruley, H., Graham, R., and Pidler, S . (1986). Proc. Natl. Acad. Sci. USA 83, 6965-6970. Cudkowicz, G., and Stimpfling, J. H. (1965). Science 147, 1056-1059. Currie, G. A., and Bagshawe, K. D. (1969). Br. 1. Cancer 23, 141-149. Curry, R . A., Messner, R. P., and Johnson, G. J. (1984). Science 224, 509-511. Dam, A. S . , Fuggle, S. V., and Fabre, J. W. (1984a). Transplantation 38, 287-292. Dmr, A. S . , Fuggle, S . V., and Fabre, J . W. (1984b). Transplantation 38, 293-298. D’Alessandro, G . , Zardawi, I., Grace, J., McCarthy, W. H., and Hersey, P. (1987). Pathology 19, 339-346. Daley, J. P., Wrohlewsky, J. M., Kaminsky, S . G . , and Nakamura, I. (1987). Immctnogenetics 26, 21-30, Dausset, J . , and Contu, L. (1980). Hum. Zmnitrnol. 1, 5-57. D e Baetselier, P., Katmv, S . , Gorelik, E., Feldnian, M., and Segal, S. (1980).Natrrre(Londot1) 288, 179-181. De Baetselier, P., Roos, E., van Hecke. D., Verschaeve, L.. Brys, L., and Verschueren, H. (1988). Znt. J . Cancer 41, 720-726. De Giovanni, C . , Lollini, P. L., Nicoletti, G., Del Re, B., Scotlandi, K . , Prodi, G . , and Nanni, P. (1987). Exp. Clin. Inmunogenet. 4, 153-162. Dennert, G . , Landon. C., Lord, E. M . , Bahler, D., and Frelinger, J . G . (1988).J . Inimunol. 140, 2472-2475. Dialynas. D. P., Wilde, D. B., Marrack, P., Pierres, A., Wall, K. A,, Havran, W., Otten, C . , Loken, M. R., Pierres, M., Kappler. J., and Fitch, F. W. (1983). Iintnunol. Reo. 74, 2956. Iloherty, P. C., Knowles, B., and Wettestein, P. (1984). Ado. Cancer Res. 42, 1-65. Doyle, A., Martin, J.. Fune, K., Gazdat, A., Carney, D., Martin, S., Linnoila, l . , Cuttitta, F., Mulshine, J., Butin, P., and Minna, J . (1985).J . E x p . Med. 161, 1135-1151. Due, C., Sinionsen, M., and Olsson, L. (1986). Proc. Nud. Acad. Sci. USA 83, CfiO7-6011. Edwards, P. (1978). Nature (London) 271, 248-250. Eisenbach, L., Segal, S . , and Feldman, M. (1983). Znt. 1. Cancer 32, 113-117. Eisenbach, L., Hollander, N., Greenfeld, L., Yakor, H., Segal, S., and Feldinan M. (1984). Int. J . Cancer 34, 567-572. Elliot, B. E., Carlow, 13. A., Ivirney, L., Arnold, M., Hampton, N., and Bosman, P. (1987). Cancer Res. 47, 4915-4923. Feltkamp, C. A., Spiele, H., and Roos, E. (1987).1. Cell Sci. 88, 313-325. Ferrone, S . , Imberti, L., Natali, P. G., Schrier, P. I., and Ruiter, D. (1986). In “Monoclonal Antibodies in Cancer: Advances in Diagnostics and Treatment” (J. A. Roth, ed.), pp. 111139. Futura, New York. Festenstein, H., and Schmidt, W. (1981). Imtnunol. Rao. 60, 85-127. Fidler, I. (1973). Nature (London) 242, 148-150. Fidler, I . , Gersten, D., and Kripke, M. (1979). Cancer 39, 3816-3821.
MHC
ANTIGEN EXPRESSION A N D METASTASIS
111
Flood, P. M., Shreiber, H . , and Ron, Y. (1987).J. Zmmunol. 138, 3573-3579. Fossati, 6 . .Anichini, A., Taramelli, D., Balsari, A,, Gambacorti-Passerini, C., Kirkwood. J. M., and Permiani, G . (1986). Biochim. Biophys. Acta 865, 235-251. Garrido, F., Algarra, I., Perez, M., and Karre, K. (1988). Znt. Con5 Metastasis Res. Soc., , h i , Heidelberg. Giacomini, P., Aguzzi, A., and Ferrone, S. (1986). H y b r i d o m 5, 277-2138, Goodenow, R. S., Vogel, J. M., and Linsk, R. L. (1985). Science 230, 777-783. Gooding, L. R. (1982).J. Zmmunol. 129, 1306-1312. Gopas, J., Izhaki, D., Segal, S., and Rager-Zisman, B. (1987).Znt. Congr. Virol., 7th. Edmonton, Can. Gopas, J., Segal, S., Hammerling, G. J.. Bar-Eli, M., and Rager-Zisman, B. (1988a).Zmrnunol. Lett. 17, 260-266. Gopas, J., Segal, S . , Hammerling, 6 .J., Bar-Eli, M., and Rager-Zisman, 8. (198813).Znt. Conf. Metastasis Res. Soc., 2nd, Heidelberg. Gorelik, E. (1987). In “Immune Responses to Metastases” (R. B. Herberman, R. H. Wiltrout, and E . Gorelik, eds.), Vol. 1, pp. 35-55. CRC Press, Boca Raton, Florida. Gorelik, E., Peppoloni, S., Overton, R., and Herberman, R. (1985). Cancer Res. 45, 53415347. Gorelik, E., Gemji, Y., and Herberman, R. B. (1988).J. Immunol. 140, 2096-2102. Governman, J., Hunkapiller, T., and Hood, L. (1986). Cell 45, 475-484. Hamaoka, T., Fujiwdra, H., Teshima, K., Aoki, H., Yamamoto, H . , and Kitagawa, M. (1979).J. Exp. Med. 149, 185-199. Hanna, N. (1986). In “Immunobiology of Natural Killer Cells” (E. Lotzova and R. 8. Herberman, eds.), Vol. 2, pp. 1-10. CRC Press Boca Raton, Florida. Hanna, N., and Burton, R. (1981).J. Zmmunol. 127, 1754-1758. Hanna, N., and Fidler, I. J . (1980).J. Natl. Cancer Znst. 65, 801-805. Harel-Bellan, A., Quillet, A., Marchiol, C . , DeMars, R., Tursz, T., and Fradelizi, D. (1986). Proc. Nut/. Acad. Sci. USA 83, 5688-5693. Haywood, G., and McKhann, C. (1971).J. Exp. Med. 133, 1171-1187. Hecht, T. T., and Summers, D. F. (1972).J. Virol. 10, 578-585. Hellstrom, K. E. (1963). Nature (London) 199, 614-616. Herberman, R. B., ed. (1980). “Natural Cell Mediated Immunity Against Tumors.” Academic Press, New York. Herberman, R. B. (1986). Semin. Oncol. 13, 195-199. Herberman, R. B . . and Ortaldo, J. R. (1981). Science 214, 24-30. Hiserodt, J. C . , Laybourn, K. A,, and Varani, J. (1985).J. Zmmunol. 135, 1484-1487. Holden, C. A,, Sanderson, A. R., and MacDonald, D. M. (1983).J , Am. Acad. Dennuto/. 9, 867-871. Holden, C. A., Shaw, M., McKee. P. H., Sanderson, A. R., and MacDonald, D. M. (1984). Arch. Dennatol. 120, 732-735. Hood, L., Kronenberg, M., and Hunkapiller, T. (1985). Cell 40, 225-231. Hosoi, K., Kittur, D. S., and Edidin, M. (1988). FEBS Lett. 231, 371-377. Hosokawa, M . , Okayasu, T., Ikeda, K., Katoh, H., Suzuki, Y., and Kobayashi, H. (1983). Cancer Res. 43, 2301-2305. Hui, K. M., Grosveld, F., and Festenstein, H. (1984). Nature (London) 311, 750-752. Hui, K. M., Minamide, L., Prandoni, N., Festenstein, H., and Grosveld, F. 6. (1986). J . Immunogenet. 13, 117-121. Inada, T., and Mirns, C. A. (1984). Nature (London) 309, 59-61. Isakov, N., Feldman, M., and Segal, S. (1981).J. Nut/. Cancer Znst. 66, 919-924. Isakov, N., Feldnian, M., and Segal, S. (1982). Znousion Metastasis 2, 12-17.
112
JACOB GOPAS ET AL.
Isakov, N., Katzav, S.. Feldnian, M., and Segal, S . (1983).J . Natl. Cancer Inst. 71, 139-144. Itaya, T., Yamagiwa, S . . Okada, E., Oikawa, T., Kuaumaki, N.. Takeichi, N., Hosokawa, M . , and Kobayashi, H. (1987). Cancer Res. 47, 3136-3140. Jennings, S. R . , Rice, P. L., Klosazewski, E. D . , Anderson, R . W., Thompson, D. L.. and Tevethia, S. S. (1985).J . Virol. 56, 757-766. Kabawat, S. E., Bast, R. C., Jr., Welch, W. R., Knapp, R . C., and Bahn, A. K. (1983). I n t . J . Cancer 32, 547-554. Karre, K. (1985). In “Mechanisms of Cytotoxicity by Natural Killer Cells” (R. B. Herberinan and D. Callewaert, eds.), pp. 81-92. Academic Press, New York. Kiessling. R., Klein, G., and Roder, J. C. (l980a). Int. /. Cancer 26, Karre, K., Klein, G. 0.. 789-794. Karre, K., Lein, G. O., Kiessling, R., Klein, G., and Roder, J. C. (I980b). Nature (London) 284, 624-626. Karre, K., Ljunggrerr, H., Pionetek, G . , and Kiessling, R. (1986). Nature (Imadon) 319, 675678. Kasai, M . , Iwamori, M., Vagai, Y., Okoinura, K., and Tada, T. (1980). Eur. J . Ztnniirnol. 10, 175- 18 1. Katzav, S.. Segal, S . . and Feldman, M. (1985).J . Natl. Cancer Inst. 75, 307-317. Kaufnian, J . , Aufray, C., Korman, A. J., Shackelford, D. A., and Strominger, J. (1984). Cell 36, 139- 146. Kawano, Y. I . , Taniguchi, K., Toshitani, A., and Nomoto, K. (1986).J . Itntnunol. 136, 47294734. Kawdno, Y. I . , Taniguchi, K., Karre, K., Toshitani, A., and Nomoto, K. (1988). Cell Isntnunol. 111, 341-353. Kiessling. R . , Petranyi, G., Klein, G . , and Wigzell. H. (1975). Int. J . Cancer 15, 933-941. Kiniball, E. S., and Coligan, J . E. (1983). Contemp. Top. Mol. Itntnunol. 9, 1-63. Klein, G. (1979). Gann. Monogr. Cancer Res. No. 23. 225-238. Klein, G . , and Klein, E. (1977). Proc. Natl. Acad. Sci. USA 74, 2121-2125. Kronenberg, M.. Siu, G., Hood, L. E., and Shastri, N. (1986). Antiu. Rev. Iinmunol. 4, 529591. Kushtai, G . , Barzilay, J., Feldman, M., and Eisenbach, L. (1988). Oncogene 2, 119-127. Kuziimaki, N . , Ber. R . , More, I., Cochran, A. J.. Wiener, F., and Klein, G. (1979). Eur. 1. Cancer 15, 1253-1261. Lachmann, P. J., and Sikora, K. (1978). Nature (London) 271, 463-464. Lampson, L., Fisher, C., and Whelan, J. (1983).J . Itntnunol. 130, 2471-2474. Lanier, L. L., Phillips, J. H., Hackett, J.. Tutt. M., and Kunar, V. (1986).J . Imniunol. 137, 2735-2739. Lindenniann, J . , and Klein, P. A. (1967).J . E x p . Med. 126, 93-108. Ljunggren, H., and Karre, K . (1985)./. E x p . Med. 162, 1745-1759. Ljurrggren, H., Yaniasaki, T., C o ~ h i s P, . , Klein, G . , and Karre, K. (1988).J . Ex)). Med. 167, 730-735. Lollini, P. L., Giovanni. C.. del Re, B., Nicoletti, G . , Prodd, G.. and Nanni, P. (1987). Clitt. E x p . Metastasis 4, 277-287. Lopez-Nevot. M . A., Garcia, E., Pareja, E., Bonal, F. J.. Martin, J., Ruiz-Cabello. F., Serram, S., and Garrido, F. (1986).1. Inmunogenet. 13, 219-227. McMillan, T. J.. Rao, J . , Everett, C. A., and Hart, I. R . (1987). Int. J . Cancer 40, 659-663. Marrack, P., and Kappler, J. (1988). Natrrre (Imidon) 332, 840-843. Masucci, M . G.. Trosteindottir, S., Colonibani, J., Brautbar, C., Klein, E., and Klein, G. (1987). POC. Natl. Acad. Sci. USA 84, 457-4571. Matzinger, P., and Bevan, M. J . (1977). Cell. Inttnunol. 29, 1-5.
MHC
ANTIGEN EXPRESSION AND METASTASIS
113
Maudsley. D. J., and Morris, A. G. (1988).J. E x p . Med. 167, 706-711. Mauduit, G., Turbitt, M., and MacKie, R . M. (1983). Rr. J . Dematol. 109, 377-381. Mellor, A. L., Weiss, E. H., Kress, M., Jay, G., and Flavell, R. A. (1984). Cell36, 139-145. Meruelo, D., Kornreich, R., Rossamando, A., Pampeno, C., Boral, A,, Silver, J., Buxbaum, J., Weiss, E. H., D e v h , J. J . , Mellor, A. C., Flavell, R. A,, and Pellicer, A. (1986). Proc. Natl. Acad. Sci. USA 83, 4504-4508. Mesler-Muul, L., Spiess, P. J., Director, E. P., and Rosenberg, S . A . (1987).J . Itnmunol. 138, 989-995. Minato, N . , Bloom, B. R., Jones, C., Holland, J.. and Reid, L. M. (1979).J . Exp. Med. 149, 1117-1 133. Momburg, F., Moller, P., Moldenhauer, G . , and Hammerling, G . J. (1986).J . Itnmunogenet. 13, 195-199. Morrison, R. P., Earl, P. L., Nishio, J., Lodmell, D. L., Moss, B., and Chesebero, B. V. (1987). Nature (London) 322, 329-331. Natali, P. G., Giacomini, P., Bigotti, A,, Imai, K . , Nicotra, M . R . , Ng, A. K., and Ferrone, S. (1983). Cancer Res. 43, 660-668. Natali, P. G., Segatto, O., and Ferrone, S. (1984a). Irnmunogenetics 19, 109-116. Natali, P. G . , Bigotti, A , , and Nicotra, M. R. (1984b). Cancer Res. 44, 4679-4687. Natali, P. G . , Bigotti, A , , Cavaliere, R . , Lido, S.-K., Taniguchi, M., Matusi, M., and Ferrone, S. (1985). Cancer Res. 45, 2883-2889. Natali, P. G . , Bigotti, A,, and Cavaliere, R . (1986). Hum. Immunol. 15, 220-223. Nathenson, S. G . , Uehara, H., Ewenstein, B. M., Kindt, T. J., and Coligan, J. E. (1981). Annu. Reu. Biochem. 50, 1025-1052. Newell, M . K., Justement, L. B., Miles, C. R . , and Freed, J. H. (1988). J. Immunol. 140, 1930- 1938. Nicolson, G . L. (1987). Cancer Res. 47, 1473-1487. Noll, G . , Schmidt, W., and Baner, H. (1987). Eur. J . Immunol. 16, 531-536. Old, I. J . , and Stockert, E. (1977). Annu. Reo. Genet. 11, 127-165. Oliver, R. T., Stephenson, C., and Parkinson, M. (1986).J . Immunogenet. 13, 85-91. Ortaldo, J. R., and Herberman, B. R. (1984). Annu. Rev. Immunol. 2, 359-379. Ostrand-Rosenberg, S . , and Cohan, V. L. (1981).J. Immunol. 126, 2190-2193. Ottesen, S. S., Fromholt, V., and Kieler, J. (1988).Cancer Immunol. Immunother. 26, 83-86. Pan, S.,Abramczuk, and Knowles, B. (1987). Int. J . Cancer 39, 722-788. Parham, P. (1984). Itnmunol. Today 5, 89-92. Parmiani, G . , Carbone, G . , lnvenizzini, G., Pierotti, M. A.. Sensi, M. L., Rogers, M. J.. and Apella, E. (1979). Itnmunogenetics 9, 1-23. Piontek, G . , Tanignchi, K., Ljunggren, H., Gronberg, A., Kiessling, R., Klein, G., and Karre, K. (1985).J . Itntnunol. 135, 4281-4288. Pollack, S. (1982). In “ N K Cell and Other Natural Effector Cells” (R. Herberman, ed.), Vol. 2, pp. 1347-1358. Academic Press, New York. Potter, T. A , , Bluestone, J. A,, and Rajan, T. V. (1987).J . E x p . Med. 166, 956-966. Rager-Zisman, B., and Bloom, B. R. (1982). Springer Semin. Imtnunopathol. 4, 397-414. Rager-Zisman, B., Ju, G., Rajan, T. V., and Bloom, B. R. (1981). Cell. Zmmunol. 59, 019-329. Ramani, P., and Balkwill, F. R. (1987). Int. J . Cancer 40, 830-834. Reid, L. M . , Minato, N., Gresser, I., Holland, J.. Kadish, A,, and Bloom, B. R. (1981). Proc. Natl. Acad. Sci. USA 78, 1171-1175. Rembecki, R . M., Bennett, M., Kumar, V., and Potter, T. A. (1987).J . Itnmunol. 138, 27342738. Riccardi, C., Barlozzari, T., Santoni, A., Herberman, R . B., and Cesarini, C. (1980).J . I n m u nol. 126, 1284-1289.
114
J A C O B GOPAS ET AL.
Riesenfeld, I., Orn, A., Gidlund. M . , Axberg, I., Alm, 6. U . , and Wigzell, H. (1980). Znt. J . Cancer 25, 399-403. Roberts, T. E., Shipton, U . , and Moore, M. (1987). Int. J. Cancer 39, 436-441. Rogers, M., Gooding, L. R., Margulies, D. H.. and Evans, G. A. (1983). J. Inrnuttiol. 130, 2418-2422. Rosenberg, S. A. (1988). Iinmunol. Today 9, 58-62. Rosenberg, S. A., Lotze, M . T., and M i d L. M. (1985). N . Engl. J . Med. 313, 148551492, Ruiter, 1). J., and Ferrone, S. (1986). Proc. Znt. Conf. Skin Melanoma, I s t , Venice. Schmidt, W., and Festenstein, H. (1980).J . Initnunogenet. 7, 7-17. Schmidt, W., and Festenstein, H. (1982). Ini,iirtnogetietics 16, 257-264. Schreiber, H . , Ward, P. L . . Rowley, D. A., and Stauss, H. L. (1988).Annu. Reo. Zmmunol. 6 , 465-483. Schrier, P., Bernards, R., Vaessen, R., Howeling, A,, and van der Erb, A. (1983). Nuture ( h t i d ~ l n 305, ) 771-775. Scofield, V. L., Schlumpberger. J. M., West, L. A., and Weissman, I. L. (1982). Nature (London) 295, 499-505. Shimizu, Y., Fujiwara, H., Ueda, S., Wakamiya, N., Kato, S., and Harnaoka, T. (1984).Eirr. J. Iwnunol. 14, 839-843. Shirrmacher, V. (1985). Ado. Cancer Res. 43, 1-73. Shirrmaclier, V., and Heicappell, R. (1987). C h i . E x p . Metastasis 5, 147-156. Snell, G. 11..Dausset, J., and Nathenson, S. G. (1976). “Histocompatibility,” Academic Press, New York. Solheim, B. G., Moller, E., and Ferrone, S. (1986). “HLA Class I1 Antigens-A Comprehensive Review of Structure and Function.” Springer-Verlag, Berlin and New York. Sowada, Y., Fohring, B., Shenk, T., and Raska, K. (1985). Virology 147, 413-416. Sporn, M. B., and Roberts, A. B. (1988). Nature (London) 332, 217-219. Staitnton, D. E., Marlin, S. D., StrdtOWa, C., Ilustin, M. L., and Springer, T. A. (1988). Cell 52, 925-933. Stauss, H. L., Van Waes, C., Fink, M. A., Starr, B., and Schreiber, H. (1986).J. E x p . Med. 164, 1516-1530. Stern, P. L., Beresfbrd, N., Bell, S. N., Thotnpson, S., Jones, K., and Mellor, K. (1986).J. Ztnmttnogenet. 13, 133-136. Storkus, W. J., Howell, D. N., Saetas, R. D., Dawson, J. R., and Cresswell, P. (1987).J. I7lIftlUn~Jl.138, 1657-1659. Sutherland, R. M. (1988). Science 240, 177-184. Talmadge, J. E.. Meyers, K . M.. Prieur, 1). J., and Starkey, J. R. (1980).Nature (London) 284, 622-624. Tanaka, K., Isselbacher, K. J., Khoury, G., and Jay, G. (1985). Science 228, 26-30. Tanaka, K . , Yoshioka, T., Bieberich, C., and Jay, G . (l988a). Annu. Reu. Iitiniunol. 6,359-380. Tanaka, K., Gorelik, E., Nobumichi. H., and Jay, G . (19881)).Mol. Cell. B i d . (in press). Taniguchi, K., Karre, K., and Klein, G . (1985). Itit. J. Cancer 36, 503-507. Taniguchi, K., Petersson, M., Hoglund, P.Kiessling, R.. Klein, G . , and Karre, K. (1987).Proc. Natl. Acad. Sci. USA 84, 3405-3409. Taramelli, I). , Fossati, G . , and Balsari, A. (1984). I t i t . J. Cancer 34, 797-806. Tarameh, D.. Fossati, G., Mazzocchi, A., Delia, I]., Ferone, S., and Pariniani, C,. (1986). Cancer Res. 46, 433-439. Torsteinsdottir, S . , Massucci, M. G., Ehlin-Henriksson. B., Brautbar, C., Ben-Bassat, H . , Klein, G . , arid Klein, E. (1986).Proc. Natl. Acad. Sci. USA 83, 5620-5624. Toshitani, A., Taniguchi, K., Kawano, Y. I., and Nomoto, K. (1987).Cell. Znimunol. 108, 188202.
MHC
ANTIGEN EXPRESSION AND METASTASIS
115
Turbitt, M. L., and Mackie, R. M. (1981). Br. J. Dermntol. 104, 507-513. van Duinen, S. G., Ruiter, D. J., Broecker, E. B., van der Velde, E. A., Sorg, C., Welvaart, K., and Ferrone, S. (1988). Cancer Res. 48, 1019-1025. Vanky, F . , and Klein, E. (1982). Znt. J. Cancer 29, 547-553. Versteeg, R., Noordermeer, I. A., Kruse-Wolters, M., Ruiter, D. J., and Schrier, P. I. (1988). EMBO J. 7 , 1023-1029. Vose, B. M., and Bonnard, G. D. (1982). Nature (London) 296, 359-361. Wallich, R., Bulbuc, N., Hammerling, G. J., Katzav, S., Segal, S., and Feldman, M. (1985). Nature (London) 315, 301-305. Warner, J., and Dennert, G. (1982). Nature (London) 300, 31-33. Warner, N. L., Woodruff, M. F. A . , and Burton, R. C. (1977). Znt. J . Cancer 20, 146-152. Watkins, J. F., and Chen, L. (1969). Nature (London) 223, 1018-1022. Yague, J., White, J., Coleclough, C., Kappler, J., Palmer, E., and Marrack, P. (1985). Cell 42, 81-87. Yamaguchi, H., Moriuchi, T., Hosokawa, M., and Kobayashi, H. (1982). Cancer Immunol. Zmmunother. 12, 119-123. Yogeeswaran, G., Gronberg, A , , Hansson, M., Dalianis, T., Kiessling, R., and Welsh, R. M. (1981). Int. J. Cancer 28, 517-512. Zinkernagel, R. M., and Doherty, P. L. (1979). Adu. Zmrnunol. 27, 51-57. Zjilstra, M., and Melief, C. J. (1986).J. Exp. Med. 163, 1213-1216.
This Page Intentionally Left Blank
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE: MHC AND NON-MHC GENES P. Demant, L. C. J. M. Oomen, and M. Oudshoorn-Snoek Division of Molecular Genetics, The Netherlands Cancer Instiute, 1066 CX Amsterdam, The Netherlands
I. Introduction 11. Site of Action of Tumor Susceptibility Genes 111. Biology of Tumor Susceptibility Genes A. Oncogenes, Tumor Suppression Genes, and Tumor Susceptibility B. Tumor Susceptibility Genes and the Multistage Process of Neoplastic Development IV. Genetic Definition of Tumor Susceptibility Genes A. Multigenic Determination of Tumor Susceptibility B. Recombinant Inbred Strains C. Recombinant Congenic Strains D. Quantitative and Statistical Considerations E. From Genetic Mapping to Molecular Isolation of Genes V. Major Histocompatibility Complex-Structure and Function A. MHC Structure B. Interactions of non-MHC and MHC Genes C. Function of Class I and Class I1 Products D. MHC Phenotype of Tumor Cells E. Biological Importance of Altered MHC Expression F. MHC and MuLV-Induced Lymphomagenesis VI. Susceptibility to Epithelial Tumors and the Role of MHC A. Genetics of Lung Tumor Susceptibility B. Different Lung Tumor Types C. Site of Action of Genes Affecting Lung Tumors D. MHC Genes and Lung Tumor Susceptibility E. Mechanisms of MHC Effects on Lung Tumorigenesis F. MHC Effects on Tumorigenesis in Small Intestine G. MHC Effects on Tumorigenesis in Liver H. MHC and Mammary Tumor Susceptibility I. MHC and Tumorigenesis in Epithelial Organs-Summary VII. Tumor Susceptibility Genes: Molecular and Cellular Perspective References
I. Introduction
The role of genetic factors in tumor susceptibility in humans was originally recognized in rare instances of familial Occurrence of tumors of a certain type (for review see Schneider et al., 1986). Inbred strains of mice, developed in the first half of this century, also exhibit strain-specific susceptibility for 117 ADVANCES IN CANCER RESEARCH, VOL. 53
Copyright 0 1989 by Academic Press. Inc. All rights of reproduction in any form reserved.
118
P. DEMANT ET AL,
certain types of tumors (for reviews see Heston, 1963; Murphy, 1966).These observations in humans and mice stimulated efforts to identify the genetic factors responsible for tumor susceptibility, and to elucidate the mechanisms of their action. The ensuing genetic studies in mice and humans contributed evidence for some of the basic concepts in tumorigenesis: the viral etiology of tumors revealed by the role of “milk factor” in induction of mammary tumors in mice (Bittner, 1936), the evidence for tumor suppression genes (“anti-oncogenes”) resulting from analysis of the familial form of retinoblastoma (Knudson, 1985), the concept of the oncogenic effect of the integrated provirus, based on male autosomal transmission of mammary tumor virus or MTV (Bentvelzen, 1968). These developments indicate also the potential of future genetic studies to contribute to the understanding of the neoplastic process, since the mechanisms of action of most tumor susceptibility genes remain unknown. A considerable proportion of the genetic studies in the past decades has been directed toward the role of the major histocompatibility complex (MHC) in tumor susceptibility. This trend was started by the finding of Lilly et al. (1964) that H-2 haplotype influences susceptibility to Gross virusinduced leukemias in the mouse and has been fueled by the development and wide availability of H-2 congenic strains (Snell, 1958) and by the rapid accumulation of the knowledge about the structure and function of MHC. These studies provided a considerable body of information about the immune response against viruses and virally infected cells, especially in relation to leukemia. In this review we shall compare the general biological characteristics of tumor susceptibility genes and discuss the methods for their identification, particularly a novel genetic tool, the recombinant congenic strains (RCS), which may be used to identify the presently elusive non-MHC tumor susceptibility genes. Then we shall present a brief overview of the structure and function of the MHC of the mouse and its role in tumorigenesis. In the discussion of the genetics of susceptibility to specific types of tumors we shall concentrate on the tumors of epithelial origin. We shall review MHC and, where known, also non-MHC genes controlling susceptibility of mice to tumors of epithelial origin in mammary gland, lung, small intestine, and liver, and discuss the potential contribution of these studies to the understanding of the neoplastic process. Study of these tumors is of considerable importance, because the genetics of susceptibility to their induction is less well known than that of murine leukemias, and because the majority of human tumors is of epithelial origin. The genetic factors in leukemogenesis have been extensively reviewed elsewhere (e.g., Lilly and Mayer, 1980; Meruelo and Bach, 1983; Kozak, 1985). We shall argue that, contrary to the prevailing belief, a considerable part of the effects of the MHC on the
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
119
susceptibility to nonvirally induced tumors in epithelial organs is due to nonimmunological effects of the MHC, namely to the MHC effects on hormonal control of epithelial differentiation and function. What contributions to the understanding, manipulation, or prevention of cancer can be expected from the study of the genetics of tumor susceptibility? Obviously, the tumor susceptibility genes are likely to form a very heterogeneous family, and it is not possible to predict the actual mechanisms of action of individual tumor susceptibility genes or their normal function. However, by putting the question in reverse and asking what class of tumor susceptibility genes we have to investigate if we want to gain insight into certain aspects of the neoplastic process, it is possible to optimize the choice of the experimental genetic system.
II. Site of Action of Tumor Susceptibility Genes
The site of action of tumor susceptibility genes is important in these considerations. A gene that affects susceptibility of the target tissue to tumorigenesis is possibly involved in cellular functions relevant to certain aspects of the neoplastic development. In contrast, a gene that affects tumor development through extracellular systemic factors need not be involved in the actual neoplastic process. For example, immune-response genes affect tumorigenesis through immunological elimination of tumor cells. The site of action of tumor susceptibility genes has been studied in carcinogen induced lung tumors (Shapiro and Kirschbaum, 1951; Heston and Dunn, 1951; Heston and Steffee, 1957; Bentvelzen and Szalay, 1966), castration-induced adrenal tumors (Huseby, 1951), hormonally induced testicular tumors (Trentin and Gardner, 1958), virally induced mammary tumors (Dux and Miihlbock, 1968; Dux, 1981), and chemically induced leukemias (Ishizaka and Lilly, 1987). These tests compared tumorigenesis in the organs of a susceptible and a resistant strain in situ with tumorigenesis in these target organs or tissues when they were transplanted into F, hybrids of the two strains. In all these studies the difference in tumor induction between the organs of susceptible and resistant strains was manifest also when they were transplanted into F, hybrid hosts, indicating that the tumor susceptibility genes affect mainly the target organ itself, and only to a lesser extent or not at all the systemic factors of the host organism. The inbred mouse strains used in these studies differed from each other at a very large number of genes. In cases in which a tumor susceptibility gene is identified, it is possible to study specifically whether this gene operates systemically or affects the target tissue. This has been tested for the MHC genes affecting the susceptibility to MTV-induced mammary tumors by Dux
120
P. DEMANT ET AL.
and Demant (1987), who compared appearance of MTV-induced tumors in mammary glands in the strain C57BL/10 (H-2h, resistant) and its congenic partner strain BlO.A(5R) (H-2fi5,susceptible), and in mammary glands of these two strains transplanted into the F, hybrid hosts. In this experiment, the rate of tumor development differed between C57BL/10 and BlO.A(5R) females, but in the F, host the transplanted mammary glands of the two strains were equally susceptible. This indicates that the MHC affects development of MTV-induced mammary tumors through systemic factors, rather than affecting the susceptibility of the target tissue. This MHC effect on MTV-induced mammary tumors is likely to be similar to many instances of M HC-linked susceptibility to virally induced leukemias, which are generally due to defective immune response of mice with certain MHC haplotypes to murine leukemia virus (MuLV) virions and MuLV antigens on the cell surface. These effects of MHC genes are based on the same molecular mechanisms as the MHC effects on immune response against most viral antigensnamely the formation of complexes of viral proteins, or of their fragments, with the class I or class I1 MHC molecules. These complexes are recognized by the antigen receptors of cytotoxic or helper T lymphocytes, respectively (for discussion see Section V,C). Thus, while most tumor susceptibility genes affect the susceptibility of the cell to the neoplastic process, the MHC genes affecting susceptibility to virally induced tumors operate quite differently. They should be classified as immune-response genes affecting defense against virus infection (MuLV, MTV), rather than as tumor susceptibility genes. This view is supported by the finding that H-2 has very little, if any, influence on susceptibility to carcinogen-induced leukemias (Oomen et al., 1988), in contrast to the large effects of the H-2 genotype on susceptibility to virally induced leukemias. Schematically, three types of genetic effects can be recognized.
1. The MHC immune-response genes, affecting the immunological response, especially antibody production against viral antigens on virions or on virus-infected normal and tumor cells. These genes operate mainly systemically, and the molecular mechanism of their effects is well known; it is the general mechanism of antigen presentation by MHC products, and it is not related to the actual process of neoplastic development. 2. The MHC-linked genes with nonimmunological effects affecting susceptibility to hormonal regulation of cellular functions and expression of oncogenes. In some cases these genes were shown to operate in the tumor cell; in other cases the site of action is not yet known but is likely to reside in the target cell (see Section VI). 3. Non-MHC-linked genes. They form the majority of tumor susceptibility genes. Most of these genes affect the susceptibility of the target cell to the neoplastic process, and their systemic effect is in most instances small, if
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
121
any, although non-MHC genes that affect tumor susceptibility systemically (e.g., through control of immune response or hormone production) may also be demonstrated in the future. The molecular mechanism of action of these genes is generally not known, and their study will likely provide new information about the role of genetic factors in the neoplastic transformation of cells. 111. Biology of Tumor Susceptibility Genes
In order to assess correctly the potential contribution of the study of tumor susceptibility genes to tumor biology, it is necessary (1) to correlate the phenomenon of tumor susceptibility with the two presently investigated classes of genetic factors in tumorigenesis, that is, oncogenes and tumor suppression genes; and (2) to relate the effects of tumor susceptibility genes to the individual stages of the neoplastic process.
A.
TUMOR SUPPRESSION GENES, TUMORSUSCEPTIBILITY
ONCOGENES, AND
Oncogenes are genes involved in the neoplastic process (for review see Varmus, 1987; Bishop, 1987; Klein and Klein, 1986), because they have been found (1) to be present in tumor cells or potentially neoplastic cells in an altered form, as compared with normal cells, or, (2) to be expressed inappropriately in tumor cells, often as a result of an increased number of genes (trisomy, gene amplification) or increased transcription rate caused by alteration in the adjacent DNA by retroviral insertions or chromosomal translocations, and (3) to transform in uitro, upon transfection, suitable indicator cells. Tumor suppression genes (anti-oncogenes, Knudson, 1985) were identified originally in family studies in humans. Certain types of cancer exhibit familial aggregation in rare instances. In such families heterozygosity for a mutation of a certain chromosomal region has often been demonstrated (retinoblastoma, chromosome 13: Knudson, 1985; Wilms’ tumor, chromosome 11: Koufos et al., 1984; colon carcinoma or familial polyposis coli, chromosome 5) either cytologically or by molecular techniques (Solomon et al., 1987; Bodmer et al., 1987), indicating that a gene locus responsible for normal cellular function or differentiation and thus preventing or suppressing the tumorigenesis is located in this segment. In normal tissue in affected members of such families, the mutation has been heterozygous (i.e., one normal chromosome has been present), but in tumor cells a second deletion encompassing the postulated tumor suppression gene locus has been found. The tumor suppression genes are apparently involved in control of the normal differentiation of the cell. Frequent occurrence of deletions of certain
122
P. DEMANT ET AL.
chromosomal segments in some types of tumors suggests that such segments may also carry specific tumor suppression genes, for example chromosome 22 in neuroma and meningioma (Seizinger et al., 1986), and chromosome 17 in colon carcinoma (Fearon et al. 1987). Genetical and cytological information about localization of tumor suppression genes and availability of cells with homozygous deletions open the way for the molecular isolation of these genes. The retinoblastoma tumor suppression gene (Rb) has been cloned and extensively analyzed (see Section IV,E). The product of the adenovirus oncogene Eal can combine in the cell with the Rb-encoded protein, presumably preventing the Rb product from carrying out its function in the cell (Whyte et al., 1988). Oncogenes and tumor suppression genes offer the possibility of combining molecular and cellular approaches in the analysis of neoplastic transformation. The results of this effort revealed that oncogenes and possibly also tumor susceptibility genes are related to certain classes of genes responsible for regulation of normal functions of the cell: genes encoding growth factors, growth factor receptors, hormone receptors, proteins participating in certain stages of signal transduction, and nuclear proteins, some of which were shown to be DNA-binding proteins (Varmus, 1987; Bishop, 1987; Lee et al., 1987). Expression of these genes during various stages of prenatal and early postnatal development or during cell activation supports the notion that their primary function is regulation of cell differentiation and proliferation. These data are also compatible with the concept of cancer as a caricature of normal tissue renewal (Pierce and Speers, 1988). The pattern of expression of most protooncogenes in different cell lineages and developmental stages does not suggest a highly specific function of these genes in development (Bishop, 1983), the exception possibly being the int-l gene, which was reported to be homologous with the wing2ess developmental gene of Drosophila (Rijsewijk et al., 1987). What is the possible relationship between oncogenes and tumor suppression genes on one hand and tumor susceptibility genes on the other? Some tumor susceptibility genes may be related to the class of tumor suppression genes. An allele of a tumor suppression gene with an altered function or expression of its product would manifest itself as a tumor susceptibility gene (W. F. Bodmer, personal communication). Some tumor susceptibility genes may be related to cellular protooncogenes. The first such example is provided by Ryan et al. (1987), who observed that one of the factors affecting susceptibility to urethane induction of lung tumors is genetically linked or identical to the Kras-2 proto-oncogene in mice. This indicates that the Kras-2 gene may actually be one of the tumor susceptibility genes. There are several possibilities that could account for this observation. Kras-2 mutations are frequent in chemically induced lung tumors of mice (Stowers et al., 1987) and polymorphism of the structural gene might affect the frequency of muta-
GENETICS OF TUMOR SUSCEPTIBILITY I N THE M O U S E
123
tions either by modifying the access of the mutagen compound to the target DNA site or by affecting locally the efficiency of the DNA repair (Topal, 1988). Alternatively, the Kras-2-linked susceptibility might be due to adjacent sequences or closely linked genes that affect the expression of the Kras-2 gene. Genetic differences between mouse strains may influence the preferential retroviral integration sites found in tumors. Spontaneous lymphomas in the high lymphoma strain AKR are induced by mink cell focus-forming (MCF) virus, which is produced by recombination between ecotropic and xenotropic MuLV sequences in AKR mice. The recombinant inbred strains (RIS) produced between the AKR strain and the low-lymphoma strain DBAI2 (AK x D strains) exhibit strain-specific prevalence for certain types of leukopoietic tumors. In some strains, T lymphomas induced by MCF virus were prevalent, in other strains mainly B lymphomas caused by ecotropic virus were seen, and in one strain myeloid leukemias rather than lymphomas appeared (Mucenski et al., 1986, 1987). In the latter strain, the myeloid leukemias shared a common novel integration site, Eui-l, which has been found sporadically also in B-cell and pre-B-cell lymphomas in some, but not all AK x D RIS (Mucenski et al., 1988). Mucenski and colleagues suggest that the segregation of the genes between the RIS, including endogenous proviral loci, might affect the nature of the MuLV formed by recombination with available genomic sequences. This would in turn determine the type of tumor produced. In that case, the specific “tumor susceptibility loci” would be linked with the endogenous retroviral genes or with specific integration sites. Strain-specific differences in the variants of the produced ecotropic MuLV might also be responsible. However, still other genetic factors need to be postulated that determine the strain-related prevalence of myeloid or lymphoid tumors in strains producing ecotropic virus and exhibiting insertions at the Eui-l site in their tumors. Myeloid tumors in another strain, BxH-2, have a different ecotropic virus integration site, Eui-2 (Buchberg et al., 1987). An example of influence of a ‘normal’ cellular gene on the tumorigenic effects of an oncogene has been obtained in transgenic mice carrying c-myc and IgM heavy chain genes. The expression of gene coding for membrane-bound but not for secreted genes form of IgM suppressed the leukemogenic effect of the c-myc gene (Nussenzweig et al., 1988). This suppression correlates with the alteration of B-cell development by the immunoglobulin transgene. B. TUMORSUSCEPTIBILITY GENESAND THE MULTISTAGE PROCESSOF NEOPLASTIC DEVELOPMENT
The development of tumors is a multistep process. In several species the chemical induction of skin tumors can be divided into at least two stages:
124
P. D E M A N T E T A L .
initiation and promotion (reviewed in Slaga, 1983). Further evidence stems from the observations that tumor development often proceeds in discrete stepwise alterations from an incipient benign preneoplastic lesion toward a fully malignant phenotype (Foulds, 1969; Nowell, 1976; Farber and Cameron, 1980), and that malignant transformation by oncogenes in transfected cells or in transgenic mice appears to require multiple genetic changes in the cell (for reviews see, e.g., Klein and Klein, 1986; Groner et al., 1987), in the prospective oncogene (Duesberg, 1987; Temin, 1988), or in both. It appears that different tumor susceptibility genes affect different stages of this process. There are presently not many experimental models that allow precise staging of the effect of tumor susceptibility genes. However, numerous experiments with induction of skin tumors either by a completecarcinogenesis schedule or by a two-stage (initiation and promotion) procedure provided convincing evidence for stage-specific effects of tumor susceptibility genes. The relative susceptibility of inbred mouse strains to the complete-carcinogenesis protocol (tumor induction by a tumorigenic dose of a chemical carcinogen) or to two-stage carcinogenesis (subthreshold dose of a carcinogen, followed by repeated doses of a noncarcinogenic “promoting” agent) is quite different (Slaga and Fischer, 1983), indicating that the tumor susceptibility genes in these strains affect differently the various pathways of tumor induction. In several strains the susceptibility to complete carcinogenesis or response to different promoters in two-stage carcinogenesis on one hand were compared with the activation of promutagen-carcinogen, its binding to DNA, and DNA adduct formation on the other hand. Generally, with exception of the effect of the Ah (aromatic hydrocarbon responsiveness) locus (reviewed in Nebert and Gonzalez, 1987), there is no correlation between tumor susceptibility and carcinogen activation or DNA modifications by carcinogen. The strain SENCAR is much more susceptible to two-stage skin carcinogenesis, using dimethylbenzanthracene (DMBA) with 12-O-tetradecanoylphorbol-13-acetate (TPA)promotion, than both BALB/c (Hennings et al., 1981)and C57BL/6; however, with the DMBA complete-carcinogenesis protocol C57BL/6 mice are more susceptible than SENCAR mice (Reiners et al., 1984). These differences in tumor susceptibility do not correlate with the capacity of the keratinocytes to activate the carcinogen metabolically, nor with carcinogen-DNA binding or adduct formation (Reiners et a l . , 1984; Morse et al., 1987). The genetic difference in response to TPA treatment probably affects a step after binding of TPA to its membrane receptor, since the number and affinity of TPA receptors in different strains do not correlate with their genetic susceptibility to TPA promotion (Wheldrake et al., 1982). The response of inbred strains to different promoting agents may also vary (Naito et al., 1987). The course of the selection for heritable high susceptibil-
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
125
ity to TPA promotion (Fischer et al., 1987) suggests that several genes are involved, some of them affecting the susceptibility of skin to papilloma formation. Analogous to these data are the results with lung tumor induction by urethane and the promoting agent butylated hydroxytoluene (BHT). The promoting effect of BHT is strain-dependent and the genes responsible for the susceptibility to BHT promotion were shown to segregate in RIS (Malkinson and Beer, 1984). Induction of hepatocellular adenomas and carcinomas by treatment of newborn mice N-ethyl-N-nitrosourea (ENU) results in a high number of tumors in C3H strain and a low number of tumors in C57BL/6 strain; however, there is no difference between the two strains in the ethylation of hepatic DNA or in specific adduct formation (Drinkwater and Ginsler, 1986). Collectively, these data demonstrate stage-specific influence of tumor susceptibility genes and suggest that the genetic differences in tumor susceptibility generally affect the postinitiation stage of tumorigenesis. It has not been tested to what extent these genetic factors operate systemically. IV. Genetic Definition of Tumor Susceptibility Genes
Besides the MHC-linked genes, which are discussed in Sections V and VI, a large number of other genes also affecting tumor susceptibility exist. They are located on different chromosomes, and in many instances their effects are larger or at least as large as those of the MHC-linked genes. These genes remain largely unknown, and in studies concerned primarily with the MHC they are usually classified under the humble collective name “non-MHC” tumor susceptibility genes. They are of considerable interest, because they affect mainly the susceptibility of target cell to tumorigenesis. Their effect is revealed by interstrain differences in development and type of spontaneous or induced tumors. Tumorigenesis differs between inbred strains also qualitatively, rather than only quantitatively. Strains may differ in the type of tumors that arise in response to a certain carcinogenic agent. Also, tumors of the same tissue origin may differ between the strains in the degree of their differentiation or in the stage of progression toward malignancy. Strain-specific preference for certain retroviral integration sites in tumor DNA, as well as differences in responsiveness to various promoting agents and in location of the tumors, are other examples of “qualitative” effects of tumor susceptibility genes. Therefore, this “qualitative” aspect of tumor susceptibility genes must be kept in mind in the methodological discussion that follows, because for practical purposes the genetics of tumor susceptibility must be treated as a quantitative trait, by transforming, where necessary, qualitative data into
126
P. D E M A N T ET AL.
quantitative data. However, the aim and the perspective of the genetic studies is to define not only the genes that af€ect the quantitative aspects of the neoplastic process, but also those that determine the various qualitative features of tumors. In most instances of strain differences in tumor susceptibility several genes are involved. This makes the definition and mapping of these genes very difficult and in most cases virtually impossible. Therefore these genes have remained largely unidentified. In the following passages we will discuss the nature of the difficulties of analysis of non-MHC tumor susceptibility genes and propose a possible solution.
A. MULTIGENIC DETERMINATION OF TUMOR SUSCEPTIBILITY Tumor susceptibility must be analyzed as a quantitative genetic trait, because it is expressed as one or more of the quantitative parameters of tumor development: proportion of animals developing certain tumors (tumor incidence), number of tumors per animal (multiplicity), time of appearance of tumors, age at death caused by the tumor, tumor size, growth rate, number or size of metastases, and so on. In uitro assays of tumorigenesis also describe properties of cell populations in quantitative terms-number of foci of transformed cells, number of cells showing anchorage-independent growth, population-doubling time, and so forth. Such in uiuo or in uitro quantitative phenotypes are the outcome of an unknown number of steps or processes, each of them influenced by one or more genes. A difference between two strains or individuals with respect to such phenotypes can be caused by difference in one or more of these genes. In cases with multigenic differences, the values observed in segregation tests (F, or backcross mice) fail to form a small number of clearly defined phenotypic classes that are seen when difference in a single gene is involved. Therefore, various statistical methods for analysis of multigenically controlled quantitative characteristics in segregating populations were developed (reviewed in Roderick and Schlager, 1966; Falconer, 1963), and selection procedures for isolating genes controlling quantitative traits were proposed (Thoday, 1961). The disadvantage of these methods is that ad hocproduced genetically heterogeneous groups (F2, backcross, etc.) are used, in which each animal has a different genotype. Because a quantitative phenotype cannot be established reliably in a single mouse and because it is not possible to characterize such a population for a large number of segregating genetic markers, the establishment of a relationship between genotypes and phenotype is very difficult. Therefore, a genetic tool was needed that would provide genetically characterized homogeneous strains of mice carrying genes of two inbred strains segregated according to a regular pattern.
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
127
B. RECOMBINANT INBREDSTRAINS Bailey (1965, 1971) recognized the need for such a genetic tool and devised the recombinant inbred strains (RIS). Each RIS is the result of consecutive generations of brother-sister matings starting with an F, hybrid male and a female from a cross between two inbred strains. Using a number of pairs of F, mice, a series of RIS is produced (Fig. 1A). Each RIS received approximately half of its genes from each parental inbred strain, and the set of genes inherited from each parental strain is different in each RIS. The use of the RIS revolutionized mouse genetics, because it provided two essential advantages when compared to previously available methods. First, the individual RIS have been genotyped in order to establish which alleles of a particular gene were received from one parental strain and which from the other. As the RIS are maintained permanently in virtually homozygous state, the results of the typing of alleles of different genes become accumulated in time and provide eventually an equivalent of an extensively typed segregating population. This has a great economic advantage for linkage studies, because the established strain distribution pattern of a newly studied gene can be compared with that of all previously typed genes directly, without any further testing. Second, a quantitative phenotype, for example incidence of tumors or plasma level of a hormone, can be established with the same certainty as in an inbred strain, because all mice of an RIS are genotypically identical. The quantitative phenotypes observed in different RIS can then be compared with the strain distribution patterns of previously typed genes in order to find evidence for linkage. Gene mapping with the help of RIS has been very fruitful (Bailey, 1981; Taylor, 1978, 1980) in establishing linkage of various genes. It has been widely hoped that application of this efficient tool will also contribute to the identification of genes involved in tumor susceptibility. This unfortunately generally did not turn out to be the case. In most studies the quantitative phenotypes measured in different RIS (tumor incidence or tumor multiplicity) turned out to form a continuous range of values, rather than clear-cut phenotypic classes (Demant and Hart, 1986). Consequently, no exact information about the genes involved and their linkage relationship could be obtained. In general, therefore, the RIS are a less efficient tool in analysis of quantitative traits like tumor susceptibility. This shortcoming of the RIS applies to analysis of all multigenically controlled quantitative phenotypes, and it is primarily due to additive and nonadditive interactions between individual components of the multigenic system. The additive action of two or more susceptibility genes results in a quantitative phenotypic effect equal to the sum of the effects of individual genes. The correlation between the
128
P. DEMANT ET AL.
A
A
B
X
BROTHER X SISTER MATING I I I I I
I I I
I
3
RECOMBINANT I N B R E D S T R A I N S
I I I I I I I I ETC
I
AXB-A AXB-B AXB-C AXB-D
AXB-E
AXB-F
ETC.
FIG. 1. The scheme for production of (A) recornbinant inbred strains and (B) recombinant congenic strains.
quantitative phenotypes of RIS and their genotypes, which is essential for any genetic interpretation of the results, is distorted or destroyed by additive interactions, because very similar phenotypes may be caused by quite different genotypes. The negative effects of additive gene interaction on the resolution power of the RIS are illustrated in Tables I and 11, using a hypothetical example of analysis by a series of 16 RIS of tumor susceptibility controlled by three nonlinked loci. Very similar phenotypes are exhibited by genetically quite different RIS (Table 11, strains E, F versus 0, P, and A, B versus K, L). As a corollary of the disruption of the correlation between the phenotype and the genotype in the RIS, the linkage actually indicated by the
129
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
B
BACKCROSS
X
B
X
F,
x
Bc2(N,)
BACKCROSS
BROTHER
7
Bc2 (N,)
SISTER MATING
I
I
7 I I
I
I
ETC,
I
I
RECOMBINANT
CONGENIC
STRAINS
ACB-A
ACB-B
ACB-C
ACB-D
ACB-E
ACB-F
ETC,
FIG. 1.(B)
RIS for the studied phenotype is frequently spurious and misleading. A gene locus N in Tables I and 11, which is not involved in tumor susceptibility, exhibits the best correlation with it. Effects of nonadditive gene interactions, where the combined phenotypic effect of two or more genes is not equal to the sum of their individual effects, results in an even greater disruption of association between phenotype and genotype in the RIS. In addition, there is no complete representation of all possible genotypes in a series of RIS. Even with a small number of genes involved, the number of possible genotypes is considerable (2n, n = number of loci). They are not likely to be all represented in a series of RIS. For example, for n = 3 the
130
P. DEMANT ET AL.
TABLE I A QUANTITATIVE TRAITSTUDIEDWITH RIS AND RCS-A
MODEL".^
Strain designation A
RIS Locus 1 Locus 2 Locus 3 Locus N Phenotype RCS Locus 1 Locus 2 Locus 3 Locus N Phenotype
x x x x 100
B
C
D
E
F
G
H
I
J
x x u x
x x u x
x u x x
x u x x
u x x x
u x x x
x u u u
x u u u
100 90
90
80
80
u u u x
x u u u
0 5 0
x x x x
u u u u
u u u u
0
0 4 0
u x u u
K
L
M
N
O
P
u x u u
u x u u
u u x u
u u x u
u u u u
u u u u
70
70 50 50 40
40
30 30
0
0
u u u u
u u u x
u u u u
u u x u
u u u u
u u u u
u u u u
u u u u
0
0
0 3 0
0
0
0
0
x u u u
u u u u
0 5 0
0
u u u u
Modified from Demant and Hart (1986), with permission. Phenotype is given as a sum of percentages with parental strain phenotype: X = 100%and U = 0%. Three nonlinked genes: locus 1, X = 50%. U = 0%; locus 2, X = 40%. U = 0%; locus 3, X = 30%. U = 0%. Irrelevant gene: locus N, X = 0%. U = 0%. a
TABLE II A QUANTITATIVE TRAITSTUDIEDWITH RIS AND RCS-A
MODEL~JJ
Strain designation
RIS Locus I Locus 2 Locus 3 LocusN Phenotype RCS Locus 1 Locus 2 Locus 3 LocusN Phentotype
A
B
x x x
x x x
X
X 80
80
C
D
x x u
E
F
G
H
I
J
K
L
M
N
O
P
x x x u u x x u u u u u u x u u x x u u x x u u u u u x x x x u u u u x x u u
X X U U 100 100 30 30
U U 40 40
X 70
X 70
X X 80 80
U 0
U 0
U
U
30
30
x u u u u u
u x u
u u u u u u u u u u u u u u u u u u u u u u x u u u u x u u u u u u u x u u u
U 70
U 80
X 30
U 30
~
U 0
U 30
X U 30 30
U 30
U 30
U U 30 30
U 40
U 30
U
U
30 30
~~
Modified from Demant and Hart (1986), with permission, Phenotype is given as a sum of percentages with parental strain phenotype: X = 80%and U = 30%. Three nonlinked genes: locus 1, X = 40%. U = 0%;locus 2, X = 0%.U = -50%, locus 3, X = 406,U = 80%. Irrelevant gene: locus N, X = 06,U = 0%. a
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
131
probability that all 8 possible genotypes are represented in a series of 16 RIS is 0.31, and for n = 4 it is almost zero (Demant and Hart, 1986). The incomplete representation of all possible genotypic combinations in a series of RIS makes the assessment of the nature of genetic control of the studied trait difficult.
C. RECOMBINANTCONGENIC STRAINS
The multigenic nature of the control of quantitative phenotype is the principal obstacle in its genetic analysis using the RIS. Therefore, a different genetic tool is needed, one that would retain the advantageous characteristics of the RIS, but that would transform the multigenic effect into a set of single-gene effects, which could be subsequently mapped and analyzed separately. To this end, we devised a new analytical system, the recombinant congenic strains (RCS) (Demant and Hart, 1986). While each RIS received a unique ‘mixture’ of genes originating in approximately equal proportions from each of the two parental strains, in the RCS the genes of one parental inbred strain (the “donor” strain) are randomly ‘dispersed’ in small proportions in the genetic background of the second parental inbred strain (the “background” strain), to achieve the separation of the genes-components of a multigenic system. This is done by backcrossing repeatedly the donor strain to the background strain, and subsequently using pairs of backcross mice to produce a series of new strains by consecutive brother-sister mating (Fig. 1B). In this way, a series of R C S is produced, each R C S containing a different, relatively small set of genes originating from the donor strain. As a result, each of several genes affecting tumor susceptibility in the donor strain will very likely be transferred into a different RCS. Those R C S that received such genes from the donor strain will differ from the background strain in tumor susceptibility, while the majority of the R C S will be phenotypically identical to the background strain. The segregation of the genes relevant for tumor susceptibility in RIS and RCS and the resulting phenotypes are compared, using model situations with three unlinked loci, in Tables I and II. The R C S share with the RIS their two principal advantages. First, as the R C S become genotyped, the information about the distribution of the alleles from the two parental strains among individual R C S accumulates, and the strain distribution of each new traitlgene can be compared with that of the previously typed genes to obtain indication of linkage. Second, the quantitative phenotype of mice of each RCS can be determined reliably by testing the necessary number of animals, which are all identical genetically. Three series of R C S are being presently prepared and analyzed at our laboratory:
132
P. D E M A N T ET AL.
1. The HcB series with the background strain C3H/HeSnA, and the donor strain C57BL/lOScSnA; 2. The OcB series with the background strain 020/A, and the parental strain BlO.O20/Dem (this is an H-2 congenic strain carrying the H-2P" haplotype of 020/A on the C57BL/ lOScSnA background; the OcB series therefore contains non-H-2 genes of the C578Ll105c5nA strain spread on the 020/A genome); 3. The CcS series with the background strain BALB/cHeA, the donor strain STS/A.
These strains may be used to study the genetics of susceptibility to a variety of tumors, because the inbred strains which were used as their parents differ considerably both quantitatively and qualitatively in tumorigenesis in various organs. The main features of the tumor susceptibility resistance of these parental strains are summarized in Table 111.
D. QUANTITATIVE A N D STATISTICAL CONSIDERATIONS The rationale for the production procedure of RCS and the relevant computations have been given in detail by Demant and Hart (1986). The most useful scheme for the construction of the RCS is to produce the second backcross generation and to proceed then with continuous brother-sister mating. In that way, each RCS will receive 12.5% of genes from the donor strain. The sets of donor strain genes that are present in different RCS will overlap. Therefore, there is an effective upper limit to the total portion of the donor strain genes, which can be transferred into a set of RCS. A set of 20 RCS, each containing 12.5% of the donor strain genes, will contain 293% of the donor strain genome; a set of 16 RCS will contain 88% of the donor strain genome. In contrast to the RIS, for which the analytical power is barely affected by possible unintentional selection during the period of their establishment, more caution is required with the RCS. As discussed in detail elsewhere (Demant et a l . , 1988), an unintentional selection during the breeding of the RCS could result in deviation from the expected segregation of the donor strain's genes. As a result, a larger or a smaller proportion than expected might become transferred into the set of RCS, or certain parts of the genome might become overrepresented or underrepresented in the process. If these deviations were of a considerable magnitude, they could decrease or destroy the analytical power of the RCS. It is therefore advisable, at an intermediate stage of RCS production, to test the segregation of several nonlinked genetic markers. Tests of electrophoretical polymorphism of four unlinked enzymes in a set of RCS at an intermediate stage of inbreeding showed no significant deviation from the expected pattern (Demant et al., 1988).
*
TABLE 111 FEATURES OF TUMORSUSCEFTIBILITY RESISTANCE' HcB series
Lung tumors Intestinal tumors Mammary tumors Colon tumors Gross MuLV leukemia Liver tumors Myeloma Exocrine pancreatic nodules
OcB series
CcS series
C3H/HeASn
C57BL/lOScSnA
020/A
B10.020/Dem
BALB/cHeA
STS/A
n.d.6 n.d. susc. n.d. susc. susc. n.d. n.d.
Rest susc. Res. n.d. Res. Res . n.d. n.d.
SUSC.~ Res. Susc. n.d. n.d. n.d. n.d. Res.
Res. Susc. Res. n.d. n.d. n.d. n.d. n.d.
susc. Res. susc. Res. n.d. n.d. susc. susc.
susc. Res. Res. susc. n.d. n.d. Res. n.d.
a The data stem from our preliminary screening (M.A. van der Valk, L.C.J.M. Oomen et al., in preparation) with the exception of colon tumors and myeloma (E. Skamene, personal communication). The lung, intestinal, liver, and mammary tumors were induced by N-ethyl-N-nitrosourea treatment, accompanied, in the case of mammary tumors, with hormonal stimulation. The mammary tumors in the C3H-C57BL/lOScSn combination were induced by C3H-MTV (Miihlbock and Dux, 1981). The data on MuLV-induced leukemia are from literature (for references see Lilly and Mayer, 1980). The preneoplastic pancreatic nodules of exocrine cells in mice treated with ENU and hypophyseal isografts were observed by Dr. M.A. van der Valk at the Netherlands Cancer Institute (unpublished). n.d., not determined. Res., resistant. d Susc., susceptible.
134
P. DEMANT ET AL.
What is the resolution power of the RCS? The possibility to resolve with the help of RCS the individual components of a multigenic system affecting a quantitative trait depends on the proportion of donor strain genes in the RCS, on the total number of RCS in the set, and on the number of genes responsible for the quantitative difference between the two parental strains. These factors determine the probability that each gene of the donor strain that affects the analyzed trait is represented at least once in a set of RCS, and that no more than one such gene will be present in individual RCS. With 12.5% of donor strain’s genes in each RCS, a rational possibility exists to resolve traits controlled by up to five or six genes (Demant and Hart, 1986). With a higher number of genes involved, the analysis becomes more difK cult, but at least some of the genes involved may become readily identified. Establishment of linkage of the genes isolated in individual RCS by comparing their strain distribution pattern with that of previously typed polymorphic markers should be possible. However, the variance of the linkage estimated with RCS is higher than with RIS (Demant and Hart, 1986). Therefore, each linkage indicated by the RCS has to be confirmed by independent segregation test. This procedure is no more laborious than that using the RIS, since Bailey (1981) pointed out that every linkage indicated by the RIS has to be confirmed by an independent test too. The RCS complement other genetic systems available for analysis of interstrain differences. The basic characteristics of the available genetic systems are listed in Table IV. The special appeal of the RCS for study of tumor susceptibility is based on the fact that tumor susceptibility is often determined by several genes-a situation where the RCS are readily applicable. The choice of the optimal analytical system for any trait has preferably to be established in advance by a preliminary segregation test. A specific comment is required about the relative merits of the use of RCS (or RIS) on one hand, and transgenic mice on the other hand. Transgenic mice have turned out to be a very useful tool in analysis of biological effects of specific genes that were cloned and in many instances also coupled with a
APPROPRIATE
TABLE IV GENETICSYSTEMS FOR GENETICANALYSIS
OF INTERSTRAIN DIFFERENCES
Number of genes involved in the difference
1 2-6 37
Genetic test system
RIS RCS Congenic strains
Proportion of donor strain genome
0.5 0.125 so.01
Detection of linkage Possible Possible Not likely
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
135
desired promoter-enhancer element, or otherwise mutated. The transgenes become transferred through germ-line cells to following generations. By definition each such strain of transgenic mice is a specific instrument for the study of the introduced gene. Therefore, the transgenic mice represent a unigenic analytical system. In contrast, the RCS and RIS represent coordinate or correlational analytical systems, because they use the available information about the distribution of alleles of the genes of the two parental strains among the set RCS or RIS as a kind of set of coordinates, with which one can correlate any new genetic trait. The unigenic systems and coordinate systems differ in economy of scale, in kinds of genes that can be analyzed, and in the possible depth of analysis. Much like a set of numbers along the abscissa and ordinate can define a virtually unlimited number of points in a plane, with the coordinate-correlational system a virtually unlimited number of genes can be analyzed by a single set of 20-25 RIS or RCS, provided that the genes to be analyzed are present in different allelic forms in the two parental strains. With a unigenic system, on the other hand, for each gene a separate strain of transgenic mice is needed. The RIS and RCS can be used to study well-defined genes as well as to define the map genes that are as yet unknown. The transgenic mice can be used only with genes that are already defined and cloned. On the other hand, the possibilities of genetic manipulation of the studied gene offered by transgenic mice cannot be obtained by the RCS or RIS. Obviously, the two types of systems are mutually complementary. The genes defined by the RCS or RIS can be cloned and subsequently used for transgenesis. The congenic strains, which carry only a very small proportion of genetic material of the “donor” parental strain, are in some logistical aspects more similar to transgenic mice than to RCS or RIS.
E. FROMGENETICMAPPINGTO M O L E C U ~ R ISOLATIONOF GENES In order to use the tumor susceptibility genes as an effective tool for analysis of the neoplastic process, it is necessary to clone them. Although for a long time the information on map position of genes had little impact on their study with methods of molecular genetics, for the first time genes have been physically isolated on the basis of their map location. The retinoblastoma gene (Rb) located in the 414 band of the human chromosome 13 has been physically identified (Field et al., 1986) by the standard chromosomal walking procedure with cosmids derived from this chromosomal region serving as the starting points (Fung et al., 1987; Lee et al., 1987). Another locus associated with a disease syndrome, Duchenne muscular dystrophy, lo-
136
P. DEMANT ET AL.
calized on the X chromosome, has been identified by locus-specific probes (Kunkel et al., 1985) by utilizing the DNA of a male patient with a deletion at this locus in a phenol-emulsion reassociation technique (Kohne et al., 1977). Several technical developments make the task of identifying a gene on the basis of its chromosomal gene map location a realistic undertaking. 1. The use of interspecies somatic-cell hybrids, which carry a limited number (preferably only one) of the chromosomes of the species studied. This approach was originally used by Gusella et al. (1980) to isolate clones of human DNA from chromosome 11, using human HeLa cells-Chinese hamster ovary hybrid cell lines with defined chromosomal constitution. The clones containing human DNA were detected by hybridization with labeled DNA of the human HeLa cell line. An analogous approach has been used by Kasahara et al. (1987) to obtain a DNA library from the mouse chromosome 17. In this case, a cosmid library from a mouse-Chinese hamster line that contained mouse chromosomes 17 and 18 has been screened for cosmids containing mouse DNA with a murine highly repetitive sequence probe. Repetitive sequence-free fragments of such clones were used to identify those clones that carry the genetic material from chromosome 17. 2. Increase in the number of informative markers on mouse chromosomes. In addition to the almost 1200 genes with known chromosomal assignment, 660 different DNA probes or clones with known chromosomal assignment are contained in the listing in the Mouse News Letter for February 1988 (pp. 120-146), a large increase from 287 listed in the previous year (Mouse News Letter, February 1987, pp. 80-90). This trend is likely to continue for several years, and it will result in availability of suitable DNA markers spread with considerable density along the chromosomal DNA. In addition, a rapid expansion of the physically mapped segments of mouse genome can be expected. 3. Introduction of pulse field gradient electrophoresis (PFGE) (Schwartz and Cantor, 1984) and its modifications (Carle and Olson, 1984; Chu et al., 1986; Herrmann et al., 1987; Carle et al., 1986). The PFGE separates electrophoretically DNA fragments of size up to 9 megabase pairs-corresponding to k 5 centimorgans (cM) of the mouse gene map. The efficacy of this method in establishing order and orientation of genes and restriction sites on chromosomes has been demonstrated (e.g., Miller et al., 1987; Brown and Bird, 1986; Herrmann et al., 1987). 4. Another development that will facilitate the creation of physical maps for large segments of chromosomes is the technology of “chromosome jumping” (Poustka and Lehrach, 1986; Poustka et al., 1987). In this technique large fragments of DNA, obtained by digestion with low-frequency-cutting restriction endonucleases, are circularized using a suitable plasmid. The
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
137
circularized DNA is cut and the plasmid segments carrying the two ends of the long DNA fragments are cloned. The resulting clones provided probes defining two ends of a continuous DNA segment demarcated by specific restriction sites. The availability of large cloned fragments of DNA will enhance considerably the effectiveness of isolation and cloning of the genes that occupy a known map position. The ultimate resolution power of meiotic mapping is L O . 1-0.2 cM; this corresponds to *200-400 kb in mouse, and 100-200 kb in humans. The techniques available until recently did not allow cloning of segments >50 kb. Physical mapping of the interval between two genes, mapped meiotically, necessitated a laborious procedure of chromosome walking, using a noninterrupted set of cosmids containing overlapping segments of DNA. The development of methods for analysis and cloning of large segments of DNA allows far more efficient joining of reference points on the chromosome linkage map by defined DNA fragments. The method developed by Burke et a2. (1987) uses the yeast artificial chromosome system (YAC), which contains yeast genes serving as markers for insertion of exogenous DNA as well as sequences for autonomous replication, and for centromere function and generation of telomeres. This method has yielded cloned fragments of human DNA up to 460 kb long. V. Major Histocompatibility Cornplex-Structure
and Function
A. MHC STRUCTURE The MHC of mouse (H-2)and human (HLA) (located on chromosome 17 and 6, respectively) are among the most extensively studied segments of mammalian genome. They contain a number of genes of several classes (Fig. 2). The class I and class 11 genes encode cell surface glycoproteins involved in immune response through presentation of self and nonself antigens to T lymphocytes. Class I genes code for transmembrane polypeptide chains with molecular weight of 40,000-49,000; these molecules are noncovalently associated with a smaller polypeptide, microglo globulin (P2m; MW 12,000) encoded by a gene on another chromosome (2 in mouse, 15 in human). The class I genes encoding the classical transplantation antigens, which are present on almost all somatic cells, map to the K and D regions (Fig. 2). Another large group of class I genes is located in the Qa-Tla region. In the HLA complex the transplantation antigens are encoded by loci A, B , and C . Nonclassical class I genes, equivalents of the murine Qa-T2a region genes, map telomeric of the A locus (Orr and De Mars, 1981). Class I1 genes map into a region between K and D in mice, and centromeric of the class I loci in
138
P. DEMANT ET AL.
GENES
REQION
K
I
s
D
0.
Tla
CLASS
I
I1
111
I
I
I
FIG 2. Schematic map of the murine MHC (H-2 complex) on chromosome 17. The number of genes varies with haplotype. Most variation is observed for the class I genes. In the D region the number of genes varies from 1 (H-26) to 5 (H-29, in the Qa region from 1 (H-2f) to 10 (H-26). 21A, 21B, 21-Hydroxylase A and B; TNF, tumor necrosis factor.
humans. Class I1 genes code for membrane-bound glycoproteins consisting of two noncovalently-associated polypeptide chains, a and p, of MW 33,oO0-35,000 and 26,000-29,OoO, respectively. Molecular cloning has revealed the organization of the mouse MHC. Two mouse haplotypes were studied in detail (H-2d of BALBJc and H-2b of C57BL/10) (Weiss et al., 1984; Fisher et al., 1985). The MHC class I genes occur in families of 30-40 per haplotype, and the majority maps telomeric of the D region into the Qa-Tla region (Margulies et al., 1982; Winoto et al., 1983). Different haplotypes vary in number of class I genes. This is caused by duplications and deletions resulting most likely from unequal crossing over, which is facilitated by a great number of homologous genes in the MHC region. For instance, the Dd region of the H-2” haplotype contains five class I genes (H-2Dd, H-2Dzd, H-2D3”, H-2D4“, and H-2Ld, in contrast to only one class I gene in the H-2b haplotype (H-2Db). Only two antigens encoded by the Dd region are identified (i.e., H-2Dd and H-2Ld), although serological data (Ivanyi and Demant, 1979) and studies with cytotoxic T lymphocytes of Mann and Forman (1988) suggest the presence of another Dend-encoded class I molecule. A large variability in the number of class I genes in the Q a region of the murine MHC has been observed. This region contains from 1 (H-21) to 10 (H-2b, C57BL/10) class I genes (Eastman O’Neill et al., 1986). In contrast to the K - and D-region-encoded antigens that are expressed on almost all somatic cells, the membrane-bound products of the Qa-Tla region display a more limited tissue distribution; they are predominantly expressed on subpopulations of the hematopoietic cell lineage. The Qa-2 polypeptide encoded by the Q a region utilizes a different form of membrane attachment as compared to the H-2K and H-2D antigens, Qa-2, like Thy-1 and T r y p a n o s o m variant surface glycoprotein, is anchored to the cell membrane via a covalent linkage with phosphatidylinositol (Stiernberg et al., 1987). Telomeric of the mouse Qa region, a new subfamily of class I genes has been characterized, consisting of two or three members. One of them, Mbl, shows 60% nucleotide identity with other class I genes (Singer et al., 1988).
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
139
The H-2K and H-2D regions are extremely polymorphic: >50 alleles of the H-2K locus and 30 alleles of the H-2D locus have been found in laboratory and wild-mouse populations (Klein and Figueroa, 1981). In contrast, the class I-like genes mapping to the right of the H-2D region exhibit only limited polymorphism. It is believed that gene conversion mechanisms contribute significantly to the generation of polymorphism of the MHC. The changes in nucleotide sequence found in spontaneous mutations of H-2K and H-2D genes indicate that all mutations until now can be explained as exchange of sequence (gene conversion) with other polymorphic and nonpolymorphic genes from the K, D , and Qa-Tla regions by intergenic recombination (Mellor et al., 1983; Geliebter et al., 1986). This hypothesis is supported by the finding that certain H-2K and -D antigens share serological epitopes with Qa-Tla-region-encoded products (Ivanyi et al., 1982; Cook et al., 1983; Figueroa et al., 1983; Sharrow et al., 1984; Oudshoorn-Snoek et al., 1984). The polymorphism of class I1 genes is also likely generated by gene conversion events (Widera and Flavell, 1984). Genes encoding complement factors C4, C2, FB, and the C4-like Slp protein (Chaplin, 1985), the gene for the isoenzyme Neu-1 (Figueroa et al., 1982), 21-hydroxylase genes (White et al., 1984a), and genes encoding tumor necrosis factor a and P (TNF-a, TNF-P; Miiller et al., 1987) were also mapped within the stretch of 1.5 c M of the H-2 complex. Although these genes are unrelated to the class I and I1 genes, their location is conserved between the species and their location in the MHC might not be completely coincidental, The Ss protein was identified as the fourth component of the complement (Me0 et al., 1975; Lachmann et al., 1975; Curman et al., 1975). The C4 and the related Slp serum protein (Shrefler, 1976) consist of three polypeptide chains with molecular weights of -200,000, 75,000, and 83,000 (Roos et al., 1978). The complement components C2 and factor B (FB) encoded by Sregion genes exhibit structural polymorphism (Roos and Demant, 1982; Takahashi et al., 1984). The C2 and FB proteins are serine proteinases consisting of a single chain (MW 100,000 and 95,000, respectively). The 21-hydroxylase belongs to the cytochrome P-450 family and is involved in synthesis of cortisol. Its deficiency in the human leads to congenital adrenal hyperplasia (White et al., 198413). The two tumor necrosis factors TNF-a and -P, are involved in destruction of tumor cells and virally infected cells (for reviews see Butler and Cerami, 1986; Old, 1985). A gene located in the S-H-2D interval has been described, which is transcribed in B cells and macrophages (Tsuge et al., 1987). Between the C4 and FB genes of both H-2 and HLA complexes, another novel gene was identified that has an unusual periodic structure, is widely transcribed, and is not homologous to the other genes in the complex (Levi-Strauss et al., 1988). Murine leukemia virus sequences are present within the murine MHC; two viral sequences, Tlevl and Tlev2,
140
P. D E M A N T ET AL.
are found in the Tla region in certain haplotypes (Meruelo et al., 1984; Pampeno and Meruelo, 1986).
B. INTERACTIONS OF NON-MHCA N D MHC GENES Interactions between MHC genes and genes on other chromosomes have not yet been extensively analyzed. However, there is ample evidence that they do exist, and their significance for the biological effects of the MHC is at present probably underestimated. The known examples concern the effect of non-MHC-linked genes on the expression or function of the products of all three classes of MHC genes. The products of class I genes associate with the Pzm chain, which is encoded by a nonlinked gene. In the mouse, detectability of some Qa specificities is affected by the Pzm allele. The specificity Qa-9 is expressed on the cell surface in a high amount in the presence of a b allele and in a low amount in the presence of an a allele of Pzm (Sutton et al., 1983). An even more dramatic effect of Pzm has been seen with Qa-11. Until now, this Qa-Tlaregion specificity has been detected only in strains with a b allele of Pzm (van de Meugheuvel et al., 1985).In a complementation test, F, hybrids between two Qa-ll-negative strains, one with Qa-ll-positive haplotype but a allele of Pzm, and the other with Qa-ll-negative haplotype and b allele of Pzm, are Qa-ll-positive (Oudshoorn-Snoek et al., 1988). Conceivably, allelic forms of Pzm molecules may a e c t conformation of the class I molecules with which they associate. Whether this modification affects the function of class I molecules in antigen presentation is not known. Presently, unidentified nonMHC genes have been shown to affect the viral specificity recognized by cytotoxic T lymphocytes, even if the presenting class I molecule was the same (Plata et al., 1987). Expression of class I1 antigens on the cell surface is affected by non-MHC genes, too. This has been demonstrated in families with severe combined immunodeficiency (SCID), where a non-HLA-linked gene determined the deficient expression of class II molecules on lymphocytes of affected persons (de Preval et al., 1985).As the studies of the immune response in the mouse are usually carried out with congenic strains with different H - 2 haplotypes on the same genetic background, the effects of non-MHC genes may often escape attention. In humans, the heterogeneity of populations and differences in age and immunopathological history of tested persons are poorly defined, and therefore the influence of non-MHC genes on functions of MHC products cannot be analyzed effectively. A partial deficiency of C4 protein in plasma, caused by a non-HLA gene, has been documented in several generations of a large pedigree (Muir et ul,, 1984). This deficiency was characterized by decreased plasma levels of C4
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
141
without any signs of increased consumption or structural alterations. The inheritance was dominant. In order to obtain insight into the presently little-known but biologically relevant interactions of MHC and non-MHC genes, we decided to study in our laboratory the control of expression of H-2 class I11 genes by non-H-2linked genes. The various allelic structural and regulatory variants of C4 and S l p genes offer a very good possibility to analyze the interactions of different alleles of C4 and SZp with non-H-2-linked genes. This study (Bruisten and Demant, 1989) revealed that differences in plasma levels of C4 and Slp caused by non-H-2-linked genes are often at least as large as those caused by the allelic S-region regulatory variants. The non-H-2 genes act mainly at pretranslational level, and in the case of Slp, the low levels caused by nonH-2-linked genes cannot be corrected by testosterone treatment. Several non-H-2 genes are involved and their effects are often haplotype-specific. The similarity of the differences seen in these experiments to the genetic observations in humans (Muir et al., 1984) suggests that the regulation of C4 and Slp by non-H-2-linked genes may serve also as a paradigm for many instances of interactions of HLA and non-HLA genes. The well-characterized molecular and hormonal mechanisms of regulation of C4 and Slp in the mouse (Nonaka et al., 1986; Stavenhagen et al., 1987), and production of strains congenic for non-H-2-regulatory genes (Bruisten and Demant, 1989) offer possibilities for molecular and genetic characterization of the non-H-2regulatory factors, and later for identification of homologous genes in humans. C. FUNCTION OF CLASS I A N D CLASSI1 PRODUCTS
The function of the class I and I1 antigens encoded by the MHC is to present foreign antigens to T cells. Class I antigens are involved in antigen recognition by cytotoxic T lymphocytes (CTL) and class I1 molecules by T helper cells. Foreign antigens (e.g., viral antigens, tumor-associated antigens) are presented by both types of MHC molecules in an MHC“restricted” manner. Effector lymphocytes recognize foreign antigens only in association with MHC molecules identical to the MHC molecules on the antigen-presenting cells, thus T cells can respond to the foreign antigen only in the context of self MHC. The nature of the interaction between MHC molecule, foreign antigen, and T-cell receptor (TCR) is not yet completely understood. Evidence is accumulating that the MHC molecules are presenting the foreign antigen in a processed or degraded form. Class I1 antigens were found to bind immunodominant peptides (Babbitt et al., 1985; Buus et al., 1986; Guillet et al., 1987). Class I molecules presenting influenza virus antigens appeared to be associated with fragments of virus-produced nu-
142
P. DEMANT ET AL.
CLASS I MOLECULE
TARGET CELL
PLASMA MEMBRANE
CD3 FIG.3. Schematic interpretation of the interaction of a cytotoxic T cell recognizing its target. The T-cell receptor (TCR) recognizes the antigen-derived peptide, presented by the polymorphic part of the class I molecule, while CD8 is postulated to interact with monomorphic determinants in the class I proteins. (Adapted from Parnes, 1986, with permission.)
cleoprotein and not with the cell membrane-bound viral antigen (Townsend et al., 1986).This finding was surprising, since several reports exist supporting the hypothesis of association or interaction of MHC antigens and membrane-bound viral antigens (Schrader et al., 1975; Blank and Lilly, 1977; Kvist et al., 1978; Zarling et al., 1978; Senik and Neauport-Sautes, 1979). Some authors, however, reported negative results (Gomard et al., 1978; Fox and Weissmann, 1979). Our electron-microscopic observations also indicated that when nonspecific cocapping is prevented, no close association is detectable between MuLV or MTV viral antigens, and class I MHC molecules on the cell surface (Calafat et al., 1981). The recently accomplished resolution of the crystal structure of the HLA-A2 molecule (Bjorkman et al., 1987) opens new perspectives for understanding the antigen-presenting capacity of MHC molecules. A class I molecule consists of three external domains cil, ciz, cig, a transmembrane part, and a cytoplasmic tail (for a schematic interpretation, see Fig. 3). On top of the surface molecule, facing away from the membrane, a deep groove runs between two long ci helices derived from the cil and ci2 domains of the molecule. The data strongly suggest that this groove is the binding site for antigens. The groove is expected to accommodate peptides of 8-20 amino acids in length. The crystal structure of HLA-A2 presents an excellent model for a MHC molecule that
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
143
binds an antigen-derived peptide and in this way presents the foreign antigen of the TCR. The same model can theoretically be applied to class I1 antigens (Brown et aZ., 1988) that already have been shown to bind peptide molecules. Except for MHC molecules presenting antigen peptides to the TCR, several other molecules are involved in the cell-cell interactions during T-cell antigen recognition. T-cell differentiation antigens are believed to play an important role in addition to the TCR. CD4 (L3T4)-positive cells, mostly helper cells, are restricted by class I1 MHC proteins, while CD8 (Lyt-2) positive cells, mostly cytotoxic cells, are restricted by class I MHC proteins. It is hypothesized that CD4 and CD8 may be receptors for monomorphic determinants on class I1 and class I MHC molecules, respectively (reviewed in Parnes, 1986; see Fig. 3). The TCR itself is associated with CD3, a T-cellspecific protein that might be important for signal transduction. Although the role for class I and class I1 MHC molecules in antigen presentation is well established, the function for the products of the class I genes mapping in the Qa-Tla region and their human homologs (class IV antigens) is not yet clear. A locus controlling the cleavage rate of preimplantation embryos in the mouse has been mapped in the Q a region, and it was suggested that the Qa-2 antigen is the product of this Ped (preimplantationembryo development) gene (Warner et aZ., 1987). It was further suggested that alloreactive T cells bearing the TCR y6 chains recognize relatively nonpolymorphic antigenic determinants mapping to the H-2D, Qa. or TZa regions (Matis et al., 1987). D. MHC PHENOTYPE OF TUMOR CELLS Several types of variant MHC phenotypes have been observed in tumors. In some established mouse tumor transplantation lines or in oitro tumor cell lines, unexpected class I, H-2-like, specificities normally found only in other haplotypes have been reported (Garrido et al., 1976; Martin et aZ., 1977; Schmidt and Festenstein, 1980), and it has been speculated that the appearance of foreign H-2 class I antigens on tumors may provide the means by which the immune system can bring them under control. However, since the tumor cell lines used in the aforementioned studies are readily transplantable in syngeneic recipients, the reported antigenic change is not necessarily the target for immune reaction against tumors. The published data on “extra” specificities should be interpreted with caution, since in some cases antisera reacting with apparently foreign H-2 antigens on tumor cells were found in subsequent tests to react also with lymphocytes of the tumor host strain (Flaherty and Rinchik, 1978; Robinson and Schirrmacher, 1979). In another case, apparently alien antigens were found to be due to contamination of the tumor line (Robinson et al., 1981), or to previously unre-
144
P. DEMANT ET AL.
cognized mutation of an H-2 gene in the host strain (Vogel et al., 1988). All the reported “extra” specificities were detected on tumor lines that were maintained for a long time by transplantation or in uitro. Our data on primary AKR leukemias, that were tested with an extensive panel of alloantibodies and monoclonal antibodies, showed that alien antigens do not occur at all or only very rarely on these tumors (Oudshoorn-Snoek and Demant, 1983).Cross-reactions between H-2K and Qa-Tla region products (Ivanyi et al., 1982; Cook et al., 1983; Figueroa et al., 1983; Oudshoorn-Snoek et al., 1984; Sharrow et al., 1984) suggest that expression of a normally silent QaTla-region gene in tumor cells may generate an antigen reactive with H-2Kand/or H-2D-specific antibodies, and thus might be responsible for some cases of apparent “extra” specificities. The known products of the less polymorphic class I genes of the Qa-Tla region have been detected on tumor cells of mouse strains that do not express these antigens on normal cells (Old et al., 1963; Rosenson et al., 1981; Flaherty et a l . , 1982). The anomalously expressed Qa-2 antigens and some Tla gene products could not be distinguished biochemically from the antigens in those strains that normally express these molecules (Michaelson et al., 1983a,b). Firm evidence for expression of aberrant MHC class I antigens due to formation of new class I genes during the malignant process was obtained in the studies of UV-induced tumors. Unique class I antigens, not found on normal C3H tissue, are expressed on the UV-induced C3H fibrosarcoma 1591 (Philips et al., 1985; McMillan et a l . , 1985). The genes for the three identified aberrant class I products were cloned and sequenced, giving for the first time an insight into the molecular basis of expression of “alien” MHC specificities (Linsk et al., 1986). These novel class I genes have been found in the UV-induced C3H fibrosacroma 1591, which expresses at least three unique MHC class I antigens. Two of the genes are very homologous to each other and resemble the H-2Ld gene, while the third gene is a mosaic and possesses characteristics of H-2Kk gene. The novel genes are likely derived by recombination from the endogenous class I genes of the C3H mouse (Linsk et al., 1986). A special class of tumors with anomalous MHC phenotype are the teratocarcinomas, formed from murine embryonal carcinoma (EC) cells. They do not express MHC class I antigens (Artzt and Jacob, 1974). However, if differentiation is induced, MHC class I expression is observed (Croce et al., 1981; Morello et al., 1982). Rejection of teratocarcinoma lines transplanted into allogeneic recipients is often due to incompatibilities of K and D regions of the H-2 gene complex (Johnson et a l . , 1983). Preimmunization of hosts with L cells transformed by H-2Kb- or H-2D1>-containingcosmids leads to induction of radioresistant immunity against PCC3 (129/SvSL, H-2b)
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
145
teratocarcinoma cells (Demant and Oudshoorn-Snoek, 1985; Moser et al., 1985). PCCS teratocarcinoma cells injected in (C3H x C57BL/6)F1 hybrids grow and develop tumors in all hosts. If, however, Kh or Dh mutants are used to make the hybrid hosts, a higher resistance of PCC3 teratocarcinoma growth was observed, indicating the close relationship of the antigenic products of the EC cells and the H-2K and H-2D antigens (Demant and Oudshoorn-Snoek, 1985; Moser et al., 1986). These results suggest that EC cells of PCCS teratocarcinoma express antigenic molecules similar to the H-2Kb and H-2Db molecules. Class I-like structures have been identified on the cell surface of E C cells (Stern et al., 1986; Demant and OudshoornSnoek, 1985; Kvist et al., 1979), although the molecular nature of these antigens has still to be clarified. Several reports demonstrate quantitative changes in class I expression on tumors cells. A well-studied model is the AKR thymus-derived lymphoma. A marked increase in H-2k expression on thymocytes of most AKR lymphomas has been observed by several investigators (Chazan and Haran-Ghera, 1976; Kawashima et al., 1976; Zielinski et al., 1981). Large variations in expression levels were described for established AKR-derived cell lines, as well as for primary tumors (Schmidt et al., 1982, 1985; Oudshoorn-Snoek and Demant, 1983, 1986). In primary spontaneous tumors, elevated H-2K and H-2D expression could be correlated with the degree of MuLV expression (Oudshoorn-Snoek and Demant, 1986). Several reports indicate involvement of viruses and oncogenes in the regulation of MHC expression: class I antigens were found to be switched off after cell transformation by the oncogenic adenovirus-12 in contrast to transformation by the nononcogenic adenovirus-5 (Schrier et al., 1983). Rat cells expressing Ad5 E l a subregion are highly susceptible to cytotoxic T cells, and are only oncogenic in immunodeficient animals, whereas cells expressing Ad12 E l a have a low expression of class I antigens, and reduced susceptibility to T killer cells, and hence are oncogenic (Bernards et al., 1983). Gene transfer of N-myc to a human neuroblastoma cell line causes overexpression of the N-myc gene product paralleled by a reduction of MHC class I antigens (Bernards et al., 1986). Comparable results were obtained in c-myc-transfected melanoma cell lines (reviewed in Bernards, 1987). Enhancement of MHC expression by oncogenes is also observed. In a human B-cell line defective for class I1 antigens, transfection with v-H-ras or N-ras genes increased expression of class I1 antigens specifically but not of class I antigens (Hume et al., 1987). However, the opposite relationship, namely influence of MHC antigen on oncogene expression, was reported as well. Transfection of the H-2Dk gene into T10, Dk-negative cloned sarcoma cell lines not only leads to expression of H-2Dk but also to reduction of the expression of the Ki-ras oncogene, while transfection with H-2Kh had no effect (Alon et al., 1987).
146
P. DEMANT
Er AL.
Other examples of phenotypic M HC alterations were observed when primary tumor and metastases of methylcholanthrene (MC)-induced tumors (De Baetselier et al., 1980), or metastatic and nonmetastatic cloned cell lines of Lewis lung carcinoma were compared (Eisenbach et al., 1983). Moreover, a number of chemically induced primary fibrosarcomas appear to be MHC class I-deficient (Hammerling et al., 1987). For further discussion see Section V,E. Studies of human malignancies have also shown the occurrence of alterations of class I and class I1 phenotype. In Burkitt's lymphoma, specific downregulation of HLA-A-11 antigen expression has been observed (Masucci et al., 1987). The general class I1 phenotype of human lymphatic malignancies is identical to the phenotype belonging to the normal cells at the corresponding stage of differentiation (Radka et al., 1986). However, B-cell lymphomas frequently fail to express the complete set of class I1 antigens. A significant correlation between deficient class I1 antigen expression and high-grade malignancy with poor prognosis was observed (Momburg et al., 1987). Malignant melanoma provides an example of aberrant class I1 expression in nonlymphoid cells. Primary tumor cells, as well as their metastases and derived cell lines frequently express class I1 determinants (Wilson et al., 1979), and especially the DR subset of class 11 molecules (Winchester and Kunkel, 1980). The majority of melanoma cell lines express DP class I1 molecules as well (Pollack et al., 1983).
E. BIOLOGICAL IMPORTANCE OF ALTEREDMHC EXPRESSION Thymocytes infected with radiation-induced leukemia virus (RadLV) show increase of H-2 antigens (Meruelo et al., 1978). On RadLV-infected thymocytes H-2K molecules were significantly increased in cells of susceptible and resistant mice, whereas H-2D antigen increase was only found on thymocytes from resistant strains. It was proposed that increased H-2D expression plays a role in resistance to leukemia because it facilitates elimination of virus-infected cells by CTL (Meruelo, 1980). Alterations of MHC phenotype have been reported to be associated with the metastatic properties of the tumor cells in several models. D e Baetselier et al. (1980) found differences in the expression of H - 2 parental haplotypes between a local F, MC-induced tumor and its descendant pulmonary metastases. Cells isolated from lung metastases expressed both parental haplotypes (i.e., H-26 and H-2'9, whereas cells isolated from the local tumor expressed only the H-2b haplotype. Cell lines cloned from this tumor showed similar correlation of H-2 expression and metastatic properties (Kat-
GENETICS OF TUMOR SUSCEITIBILITY IN THE MOUSE
147
zav et al., 1983). The metastatic phenotype was found to be determined by the H-2Dk antigen, since in uiuo immunoselection of one such clone, IE7, that expresses H-2Db and H-2Dk showed that loss of class I expression abolished the metastatic potency of the cell clone. Immunoselection for H-2Dk-positive, H-2Db-negative cells, led even to increased metastatic capacity of the cell line (Katzav et ul., 1984). Transfection of the highly metastatic H-2Db/H-2Dk cells with cloned H-2K genes (Kb, Kk) reduced their tumorigenicity and abolished the formation of metastases in syngeneic mice, while the transfection of nonmetastatic cells of H-2Db phenotype with cloned H-2Dk genes resulted in shifting the cells to the metastatic phenotype (Wallich et al., 1985). Imbalance between expression of K- and D-region products was also found on cloned cell lines of Lewis lung carcinoma (H-29 (Eisenbach et al., 1983), which could be correlated with the metastatic properties of those cells. Not the absolute expression of Kb or Db glycoproteins, but the decrease in the K/D ratio was linked to the metastatic potential of the cloned cell lines. The biological significance of the large differences in absolute expression levels of MHC antigens is not yet clear. The modified antigenic profile of tumor cells might affect the T-cell surveillance of the tumor and hence its growth. For instance, the aggressiveness of SJL/J lymphomas was found to be correlated with the absence of the H-2DS antigens (Rosloniec et al., 1984). Cell lines derived from simian virus 40 (SV40)-transformed C3H fibroblasts that had been adapted to in uiuo growth, demonstrated that the oncogenic potential correlated with lack of H-2Kk expression. This alteration was due to mutation of the H-2Kk gene, although no integration of SV40 in this gene was observed (Rogers et al., 1983). In uitro studies have indeed shown a correlation between the immune response and quantitative variations of H-2 expression on target cells (Plata et al., 1981; Schmidt and Festenstein, 1982). In both studies impaired recognition and killing by specific cytotoxic T cells was associated with reduced levels of the relevant class I antigens. Since MHC class I antigens are necessary to present foreign antigens to CTL, the lack of the required restriction elements will impair or prevent the presentation of the particular tumor antigen to the immune system of the host. In this way the tumor cells may escape immune surveillance. This hypothesis is supported by the absent or reduced class I expression in various experimental tumor systems described earlier, and by the finding of reduced or nondetectable levels of class I antigen expression in certain malignant human tumors (review in Hammerling et al., 1987). More direct evidence comes from the experiments in which class I antigens are reexpressed by introduction of the respective genes by DNA-mediated gene transfer. For instance, the virus-induced AKR leukemia cell line
148
P. DEMANT ET AL.
K36, lacking H-2Kk expression, is highly tumorigenic in syngeneic AKR mice. Transfection of the H-2Kk gene resulted in expression of H-2Kk on cell surface as well as rejection of the tumor cells by the host (Hui et al., 1984). In primary AKR lymphomas, however, increased expression of H-2K and H-2D antigens was observed as a general phenomenon, and it did not obviously impair their growth (Oudshoorn-Snoek and Demant, 1986). This contradiction is probably explained by the different immune reactivity of the hosts, because with primary tumors the immune system has already failed to prevent the establishment and growth of the tumor. Since AKR mice have an impaired immune response (Green, 1984), MHC expression might not be very relevant for tumor protection. Alternatively, the discrepancy between the results obtained with transfectants and primary tumors may be a matter of balance between defense mechanisms by cytotoxic T cells and natural killer (NK) cells (see later). Finally, the higher expression of H-2K and H-2D antigens in primary lymphomas with high MuLV expression might be a secondary concomitant effect of genetic changes associated with high production of virus. The selective advantage for tumor growth conferred by these changes (MuLV incorporations) may be greater than the disadvantage of immunological vulnerability due to higher levels of H-2KID expression. Other class I transfection experiments as well demonstrated alteration of host-versus-tumor behavior, indicting a role for the immune system in tumor defense mechanisms. Tanaka et al. (1985)showed loss of oncogenicity due to reexpression of MHC class I proteins after DNA-mediated gene transfer of H-2Ld into highly tumorigenic adenovirus-12-transformed cells with impaired class I expression. Reintroduction of H-2Kk of Kb antigens in T10 sarcoma cells by DNAmediated gene transfer changed the metastatic phenotype to nonmetastatic in immunocompetent hosts, while in immunosuppressed mice the cell line was still metastatic (Wallich et al., 1985).In the same system introduction of the H-2Dk gene in an H-2Dk-deficient tumor clone resulted in shifting the phenotype from nonmetastatic to metastatic. Interestingly, this was paralleled by reduction of the expression of the cellular Ki-ras oncogene. These results suggest that the mechanism of metastatic potential is not a direct consequence of class I expression, but that MHC antigens regulate Ki-nus oncogene expression, which may determine the metastatic phenotype (Alon
et al., 1987). Transfection and expression of an allogeneic class I gene (H-2Kb) into a KkDd sarcoma, however, did not reduce the tumorigenicity of this tumor in syngeneic mice, suggesting that the presence of an “alien” alloantigen is insufficient for immune surveillance and tumor rejection (Cole et al., 1987). Apart from the role of CTL in immune surveillance, an alternative anti-
GENETICS OF TUMOR SUSCEPTIBILITY I N THE M O U S E
149
tumor immune defense strategy involving MHC products was proposed by Karre et al. (1986).They showed that loss of H-2 class I expression correlates with reduced malignancy. Lymphoma variants expressing low levels of H-2 are rejected, whereas high-H-2 expressors grow in syngeneic hosts. Since low-H-2 variants were NK-sensitive, it was suggested that NK cells are the effector cells in the immune defense that an unspecifically kill tumor cells lacking the host’s own MHC antigens that had escaped immune surveillance by CTL. From the different observations on the relationships between expression of H-2 class I products and growth behavior of various tumors, we can conclude that several mechanisms that often counteract each other might operate. The actual relationship between MHC expression and the effectiveness of immune response against tumors still has to be elucidated. In addition, the altered expression of MHC antigens can affect the behavior of tumor cells also nonimmunologically-through regulation of oncogene expression.
F. MHC A N D MuLV-INDUCEDLYMPHOMAGENESIS The resistance to tumor induction by MuLV is controlled by multiple genes. Some of these genes have been mapped to the MHC of the mouse (Lilly et al., 1964; Meruelo et al., 1977; Lonai and Haran-Ghera, 1980; Zijlstra and Melief, 1986). Several H-2-linked resistance genes were mapped for different types of MuLV, and assigned to several regions of the H-2 complex (reviewed in Zijlstra and Melief, 1986). The underlying mechanisms are supposed to be at least in part of immunological nature. The immune-response genes (class I1 genes) in the I region of the MHC are found to regulate the antibody response against MuLV virions (DebrB et al., 1980; Vlug et d.,1981) and MuLV antigens on MuLV-infected (tumor) cells (Aoki et al., 1968; Sato et al., 1973). These antibody responses are an important factor in resistance against some MuLV-induced lymphomas. The influence of class I antigens on susceptibility or resistance is related to the ability of the class I antigen in question to present the processed viral antigen to cytotoxic T cells. In some instances H-2 influences the relative proportion of MCF-induced T- and B-cell lymphomas among infected mice. The H-2 Z-A region influences the development of early T-cell lymphomas. Susceptible strains develop the early T lymphomas. A great part of the resistant strains, however, develop B-cell lymphomas later in life (Zijlstra et al., 1984; Vasmel et al., 1988). Immune T-cell response differences regulated by MHC class I1 I-A genes were proposed to be responsible for this effect (Vasmel et aZ., 1988).
150
P. D E M A N T ET AL.
VI. Susceptibility to Epithelial Tumors and the Role of MHC
A. GENETICSOF LUNGTUMORSUSCEPTIBILITY Since the original observation by Tyzzer (1907) that different families of mice exhibit different incidences of lung tumors, considerable effort has been paid to the analysis of the genes involved (reviewed in Heston, 1966). The study of the genetics of lung tumors was greatly enhanced when inbred strains of mice were developed and introduced, particularly when it was shown that susceptibility to spontaneous lung tumor development differed widely between certain strains. When lung tumors were induced with carcinogens, the inbred strains retained their relative rank order positions in degree of susceptibility they showed for spontaneous lung tumorigenesis (for reviews see, e.g., Stewart, 1959; Heston, 1966). Another observation that has been proven to be of great practical significance in the work on the genetics of lung tumors was that the degree of susceptibility of a particular strain could be measured by counting the number of induced lung tumors in each individual mouse. The average number per strain could be correlated with the incidence of induced tumors or the incidence of spontaneous tumors. All these properties of the lung tumor of the mouse have made it an experimental system of great value in the study of the genetics of tumorigenesis. Using various combinations of inbred strains, it has become well established that susceptibility to spontaneous as well as carcinogen-induced lung tumorigenesis is governed by multiple genes (for references see Table I), although in some studies (using the strain combinations A-C57BL and ABALB), only a single gene appeared to be involved (Bittner, 1938; Andervont, 1937, 1938a; Bloom and Falconer, 1964; Malkinson and Beer, 1983). The susceptibility is reflected by the number of mice with tumors or, in those cases where carcinogen treatment results in appearance of tumors in all mice, by the number of tumors per mouse and the time of appearance of tumors. As can be deduced from Table V, the A strain is in all instances tested the most susceptible of all inbred strains, whereas the C57BL strain is in almost all cases the most resistant. All other strains are classified between these two extremes with varying positions for individual strains, depending on the experimental scheme used. In the most extensive series of strains studied (van der Valk, 1981), apart from the strain differences listed in Table V, some other interesting observations were made. The strain A with MTV appeared to have more lung tumors than the A subline without MTV. Second, in strains BALB/c and A2G, males appeared to be more susceptible than females, whereas such a sex-related difference was not found in the other strains. This suggests that the genome of a particular strain may also
TABLE V STRAIN DIFFERENCES I N LUNGTUMORSUSCEPTIBILITY BETWEEN INBRED STRAINS OF MICE' Tumorinducing agentb DBA (sc) MC (iv) Urethane (ip) Urethane (ip) None Urethane (ip) ENU (ip) None ENU (transplacental) None
Urethane (ip)
Relative strain susceptibilityc
Hybrids studiedd
References
A > C > I, C3H, Y > M, D, C57BL A > C > Y, I, C3H > C57BL, L A, Bagg albino, NH, CBA > DBA, FA, FB A, KL, JU, RIII, CBA, C57BL A > 020, GR > CBA, C3H > DBA, C57BL A > 020, GR > CBA, C3H > DBA, C57BL A, Swiss, C3H, NZW, DBA12, C57BL16 C3H, LP, C57BL110, 129, DBA/2, CBA, C3H.K SWR, AKR, C57BL/6, C57L, DBA/2
None None None F, (15), Be1 (l),Bc2 (1) None Fi (10).F, (1), Bcl (1) None F, (8) None
Andervont (1938b) Shimkin (1940) Shapiro and Kirschbaum (1951) Bloom and Falconer (1964) Bentvelzen and Szalay (1966) Bentvelzen and Szalay (1966) Rice (1973) Smith et al. (1973) Diwan and Meier (1974)
A, MAS, BALB/c, ACR, A2G, 020, OIR, STS, GRS, RIII, LIS, WLL, TSI, CBA, LTS, DD, C3H, C57BL/MHe, BIR, BIMA, DBA/He, DBA/Li, C57BL/Li, C57P A, A.BY, SWR > SS, BALBlc, LS, 129, RIIIS > C57BL/6, HS, B10. D2(58N), BlO.A, C57BL/10, DBA/2, C3H, NZB, C57L, AKR, C57BR, C57BL16-bg
None
van der Valk (1981)
Fi (5), F, (2), Bcl (2)
Malkinson and Beer (1983)
Only those studies in which four or more different inbred strains were tested are included. DBA, 1,2,5,6-Dibenzanthracene;MC, methylcholanthrene; ENU, N-ethyl-N-nitrosourea. Route ofadministration is given in parentheses. Strain ranking in the order of decreasing susceptibility; > indicates that a substantial difference between successive (groups of) strains has been observed according to authors. F, and/or F, and/or backcross (Bc) hybrids studied; number of different crosses given in parentheses. a
152
P. D E M A N T ET AL.
determine whether or not sex-related effects on lung tumorigenesis occur. Associations have been also found between certain specific mutations and susceptibility to lung tumors (Heston, 1957). However, most of these mutations (lethal yellow, dwarf, obese, etc.) exhibit multiple gross phenotypic effects, and therefore it is not clear whether their effects on tumorigenesis are direct or secondary. In view of the finding (Oomen et al., 1989) that chemical induction of lung tumors can be modified by simultaneous administration of glucocorticoid hormone (see later), it is interesting to note that two of these mutations (dwarf and obese) affect hormonal metabolism. The genetics of susceptibility to chemically induced lung tumors has been subsequently studied using an extensive series of RIS between the A/J (susceptible) and C57BL/6J (resistant) strains (Malkinson et al., 1985). The results indicate that at least three genes are involved and thus confirm the existence of a multigene control of lung tumorigenesis. However, the authors could not identify these postulated genes. Ryan et al., (1987), using the same series of RIS, present evidence that the murine Kras-2 gene (or a closely linked genetic element) is one of the genetic factors influencing lung tumor susceptibility. In addition, they show that the allelic variation revealed by restriction-fragment-length polymorphism using a Kras-2 probe, correlates also in individual (C57BL/6J x A/J)F, and backcross mice and in 14 inbred strains with susceptibility or resistance to lung tumor induction. These data, together with the finding of Stowers et a1. (1987)that chemically induced lung tumors in mice contain a mutated transforming Kras-2 gene, strongly implicate the Kras-2 gene, which is located on chromosome 6, as one of the factors involved in susceptibility to lung tumorigenesis in the mouse. Thus, as was shown earlier for the H-2 complex (see later), this is the second example of a relationship between polymorphism of a gene and susceptibility to lung tumors.
B. DIFFERENT LUNGTUMOR TYPES In the mouse two major lung tumor types, alveolar and papillary, can be found. Histologically the papillary type is characterized by a papillary structure and growth into alveoli, bronchioli, and possibly bronchi, whereas the tumors of the alveolar type grow merely along the preexisting septa1 framework. Sometimes tumors of a mixed type occur, especially in older mice. They may represent a transition from the alveolar to the papillary type. The two main tumor types have been reported to differ in their biological behavior (for review see Kauffman et al., 1979):the papillary tumors appear to be more malignant than the alveolar tumors. The morphological characteristics of tumor cells, as revealed ultrastructurally, also differ between the tumor types: cells of alveolar tumors are similar to mature alveolar type 11 cells, whereas cells from papillary tumors are more similar to fetal (pre)alveolar
GENETICS OF TUMOR SUSCEPTIBILITY I N T H E M O U S E
153
type I1 cells (Rehm et al., 1988). The distinctive characteristics comprise cell and nuclear shape, the number of mature lamellar bodies, the number of microvilli, the nature of the glycogen deposits, and the occurrence of primary cilia. A difference between tumor types in glucocorticoid receptor has also been found; cells of papillary tumors show specific nuclear localization of glucocorticoid receptors, while these receptors are not found in alveolar tumor cells (Beer and Malkinson, 1984). Despite these important differences in behavior and cellular characteristics, both tumor types are believed to originate from alveolar type I1 cells (Rehm et al., 1988). Both tumor types can occur spontaneously as well as after induction with carcinogens; in the latter case mice often produce tumors of both types. In the genetic studies discussed in the previous section, lung tumorigenesis was evaluated without considering the tumor type(s) involved. It has, however, become apparent that the alveolar and papillary lung tumors occur in variable proportions in different inbred strains (Witschi, 1985; Beer and Malkinson, 1985) and H-2 congenic strains (Oomen et al., 1983), and hence their development is under different genetic control. In discussing the genetics of lung tumor susceptibility in mice, it is therefore important to take into account the particular tumor types encountered, as they may represent either (a) tumors derived from alveolar type I1 cells at different stages of differentiation or (b) tumors that have distinct differentiation potentials, although they were derived from similar alveolar type I1 cells.
C. SITE OF ACTION OF GENESAFFECTING LUNGTUMORS
The genes involved in lung tumorigenesis appear to act predominantly at the level of the target tissue rather than systemically (e.g., by affecting the immune response). Induction of tumors in lungs transplanted from susceptible and resistant strains into their F, hybrids have shown that susceptibility to carcinogen-induced tumorigenesis in three different strain combinations tested, resides mainly at the target cell level (Shapiro and Kirschbaum, 1951; Heston and Dunn, 1951; Heston and Steffee, 1957; Bentvelzen and Szalay, 1966). Allophenic mice, produced from fused blastomeres of strains susceptible and resistant for lung tumors, contain subpopulations of cells originating from each parental strain in most or all of their tissues. However, the lung tumors found in these allophenic mice were composed overwhelmingly of cells of the susceptible strain (Mintz et al., 1971). Formation of tumors containing almost solely the cells of the susceptible strain within the context of otherwise mosaic lung has been considered as a striking evidence of target cell-localized expression of susceptibility-controlling genes.
154
P. D E M A N T ET AL.
Several other studies have also indicated a relationship between properties intrinsic to the lung cells and susceptibility to lung tumorigenesis. Differences in proliferation of alveolar type I1 cells between strains were reported to correlate with susceptibility to carcinogen-induced lung tumorigenesis; alveolar type I1 cells of the most susceptible strain had the highest labeling index (Thaete et al., 1986). Previous studies using partly different strain combinations, however, did not find such correlation, but instead a correlation between the magnitude of the rebound in alveolar cell proliferation after carcinogen administration and lung tumor susceptibility was found (Shimkin et al., 1969; de Munter et al., 1979). A correlation between the number of putative target cells (alveolar type I1 cells) and lung tumor incidence and multiplicity in mice treated at adult age with varying doses of urethane was also reported (Dourson and O’Flaherty, 1982; O’Flaherty and Dourson, 1982). In a study on prenatal tumor induction by exposure of fetal mouse lung to ENU on different gestation days, a correlation between the resulting number of induced lung tumors and the total number of peripheral epithelial cells in cycle at the time of exposure was found. Furthermore the number of lung tumors per 106 cells in cycle was greatest when fetuses were exposed to ENU on days 15 and 16, as compared to day 17, 18, or 19 of pregnancy (Kauffman, 1976). Mice treated prenatally with ENU exhibit relatively more papillary tumors when the carcinogen is applied at early fetal age (day 10 of pregnancy) than when the treatment is given at a later stage of fetal life (day 15 of pregnancy) (Branstetter et al., 1988). These studies show that number, proliferation, and differentiation stage of target cells may be important factors in the genetically determined susceptibility to carcinogen-induced lung tumorigenesis. Together with the results obtained in lung transplantation studies and in allophenic mice (see earlier), this indicates that the genes involved in lung tumorigenesis indeed act primarily at the target cell level. D. MHC GENESAND LUNGTUMORSUSCEPTIBILITY The finding of Smith and Walford (1978) and Faraldo et al. (1979) that genes in or closely linked to the H-2complex are involved in lung tumorigenesis was the first example of allelic differences in polymorphic genes associated with susceptibility or resistance to lung tumors. Since then these original observations have been extended and the relationship between the H-2 complex and lung tumorigenesis has been firmly established (Table VI). In untreated mice (Smith and Walford, 1978; Faraldo et al., 1979) as well as mice treated with DMN (den Engelse et al., 1981), prenatally or postnatally with ENU (Oomen et al., 1983, 1988, respectively), urethane, and 4-nitro-
TABLE VI H-2 HAPLOTYPE AND LUNGTUMOR RESISTANCE
Background strain A
C57BL/lO
Tumor-inducing agent6
CONGENICSTRAINSOF MICE"
Haplotype-related relative susceptibility High
Intermediate
Low
References
None 4 NQO (sc)
Papillary NSc
Smith and Walford (1978) Miyashita and Moriwaki (1987)
Urethane (sc)
NS
Miyashita and Moriwaki (1987)
None None
Papillary Papillary
Smith and Walford (1978) Faraldo et al. (1979)
DMN (drinking water) ENU (transplacental)
Alveolar
den Engelse et al. (1981)
ENU (ip) C3H
Tumor type
IN
None
Alveolar, papillary Alveolar, papillary Papillary
h2, b4 a, i5
h2
h4, b b h4, b h4, b, i5 b
Oomen et al. (1983) Oomen et al. (1988) Smith and Walford (1978)
Only those studies in which significant differences between H-2 congenic strains were found are included. 4 NQO, 4-Nitroquinoline 1-oxide; DMN, dimethylnitrosamine; ENU, N-ethyl-N-nitrosourea. Route of administration given in parentheses. Not specified. a
b
156
P. D E M A N T ET
AL.
quinoline I-oxide (Miyashita and Moriwaki, 1987), lung tumor development is influenced by the H - 2 haplotype. Furthermore, in all these different experimental systems the H-2" haplotype is always associated with susceptibility and H-2" with resistance. Transplacental induction of lung tumors by ENU in the backcross progeny from a cross between H-2" and H-2" congenic mice, confirmed the H - 2 linkage of this influence and showed that H-2 does not operate through a maternal effect (Oomen and Demant, in preparation). However, in none of the studies just cited was it possible to assign unequivocally the H-2-related effects of a particular region of the H-2 complex. In all studies in which appropriate H - 2 recombinant strains were used (Faraldo et a l . , 1979; Oomen et al., 1983; Miyashita and Moriwaki, 1987; Ooinen et al., 1988), the results indicate involvement of more than one H - 2 gene. This is hardly surprising. First, the H - 2 complex contains several groups of structurally and functionally related genes of the same type derived by gene duplications (see Section V,A), and these related genes may affect tumorigenesis through the same mechanism. Second, the different classes of genes in the H - 2 complex might affect different steps in the neoplastic process. Thus several H - 2 genes might influence lung tumorigenesis either through the same or different mechanisms. Experiments studying the influence of H - 2 on different stages of tumorigenesis are required to elucidate the specific role of individual MHC genes. The two lung tumor types (alveolar and papillary) are differently influenced by H - 2 in mice from H - 2 congenic strains on the C57BL/10 background, treated either prenatally (Oomen et aZ., 1983) or postnatally (Oomen et d., 1988)with the carcinogen ENU. After prenatal treatment incidence and number of alveolar tumors was influenced by H - 2 haplotype. For papillary tumors, mean size but not incidence or number were haplotype-related, and this H - 2 effect on size of papillary tumors has been due to an H - 2 associated decrease in growth rate of papillary tumors, which probably sets in after 2 months of age (Oomen et al., 1983). In postnatally treated mice we showed that time of appearance and incidence of alveolar versus papillary tumors differ markedly in strains €3lO.A(2R)and BlO.A(5R),whereas no such differences were found in strains €310, BlO.A, and BlO.A(4R).Since the cells in alveolar and papillary lung tumors are similar to two distinct differentiation stages of alveolar type I1 cells (see the previous section), these findings indicate that H - 2 genes effect differentially certain specific steps of neoplastic development in the lung.
E. MECHANISMSOF MHC EFFECTSON LUNGTUMORICENESIS The mechanisms whereby the genes of the H - 2 complex influence lung tumorigenesis are still unexplained. Involvement of the immune system has
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
157
to be considered because of the well-known function of the MHC in regulation of the immune response (see Section V,C). The H-2-associated effects on tumorigenesis in tumors with a viral etiology (i.e., leukemias) are mainly due to haplotype-related differences in immunological defense mechanisms against the antigens encoded by the inducing virus (Zijlstra and Melief, 1986). However, for several reasons it is unlikely that the H-2 effects on lung tumorigenesis are exclusively or even predominantly immunological. First, in contrast to virally induced tumors, lung tumors are believed to be weakly antigenic (Shimkin and Stoner, 1975), and no viral etiology of lung tumors was as yet indicated. Second, thymus-dependent immunological defense mechanisms do not seem to play a major role in lung tumorigenesis, since athymic nude mice treated with carcinogen after birth (Stutman, 1974) or transplacentally (Anderson et al., 1978) did not display more lung tumors than their normal littermates. Studies on the effect of neonatal thymectomy on carcinogen-induced lung tumors are conflicting and inconclusive (for review see Shimkin and Stoner, 1975). Third, involvement of non-T-cell antitumor defense by macrophages or NK cells is also not demonstrated, since susceptibility to lung tumors is not affected in mice carrying the bg (beige) mutation, which diminishes considerably NK-cell activity (Malkinson and Beer, 1983). Apart from its function in the immune response, various effects of H-2 pointing to its influence on hormonally regulated phenomena were reported (Ivanyi et al., 1969; Ivanyi, 1975; Mickova and Ivanyi, 1975; Lafuse and Edidin, 1980). The best studied has been the H-2 influence on glucocorticoid-induced cleft palate in embryos (for references see Bonner and Tyan, 1983; Demant, 1985). In addition, H-2 influences the levels of glucocorticoid receptor in lung (reviewed in Goldman and Katsumata, 1986). It has been proposed that H-2 influences susceptibility to tumorigenesis also through hormonal mechanisms (Demant, 1986). The possible significance of hormonal mechanisms in H-2 effects on tuinorigenesis is suggested by the H-2 influence on mammary tumor induction by prolactin without involvement of MTV observed by Muhlbock and Dux (1981).This finding has been recently confirmed and extended in our laboratory (Ropcke et al., 1987; see also Section VI, H). Recently we have obtained evidence that the influence of the H-2 complex on lung tumor susceptibility may to a considerable extent be related to H-2 influence on glucocorticoid hormone affects on target cells (see later). Glucocorticoid hormone is the major factor regulating prenatal development and postnatal functioning of lung epithelium. The differentiation and functional development of the lung is regulated by endogenous glucocorticoid hormones (for reviews see Ballard, 1983; Smith, 1984) and involves epithelial-mesenchymal interactions (Chen and Little, 1987; Smith, 1984). A
158
P. DEMANT ET AL.
Mesenchyrnal
-
Epithelial Interactions
Glucocorticoid
-
FPF
+ +
Testosterone
1-
Alveolar type II cell
+
Thyroxin
Surfactant FIG. 4. Multihormonal regulation of fetal lung cell maturation.
major feature of lung maturation in the fetus and newborn is the production and secretion of surfactant by alveolar epithelial type 11 cells. Surfactant, composed mainly of phospholipids and proteins, is a surface-active material that covers the surface of the alveoli, reduces the surface tension at the airwater interface, and prevents the alveoli from collapse at expiration. Glucocorticoid acts on fibroblasts to synthesize and release the fibroblast pneumocyte factor (FPF), which stimulates the alveolar type I1 cells to synthesize and release surfactant (Smith, 1979; Post et al., 1984; Post and Smith, 1984; Torday et al., 1985) (Fig. 4). In addition to glucocorticoids, other hormones influence this process as well; they can either depress (androgens and insulin) or enhance (thyroxin) the fibroblast-mediated glucocorticoid effect on alveolar type 11 cells (Torday, 1975; Carlson et al., 1984; Smith and Sabry, 1983) (Fig. 4). These hormonal effects on lung maturation involving epithelial-mesenchymal interactions have been determined in an in vitro system, but their in uivo counterparts have been described as well (for reviews see Ballard, 1983; Smith, 1984). A very large number of studies in a variety of species, including human beings, has shown that administration of glucocorticoids to the immature fetus results in acceleration of lung maturation, which includes enhanced morphological maturation as well as enhanced production of surfactant. Likewise, the stimulating effect of thyroid hormones on fetal lung maturation has also been found to be effective in uiuo in rabbits and rats. The opposing effect of both androgens and insulin on the stimulating effect of glucocorticoid on lung maturation has been observed in the fetus as well. In several species, including humans, the sex of the fetus appears to have an important influence on the rate at which the fetal lung matures and on its
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
159
response to hormonal manipulation of this process. Prematurely born human male infants are at higher risk of developing respiratory distress syndrome (due to lung immaturity) than are female infants of similar gestational age, and prenatal glucocorticoid treatment of lung immaturity benefits only female fetuses, whereas male fetuses do not respond to therapy (for review see Torday and Nielsen, 1987). Experimental evidence obtained in other species strongly suggests that the sex difference in fetal lung maturation is mediated by androgens. With respect to insulin it has been shown that human infants born to mothers with insulin-dependent diabetes are at elevated risk of developing respiratory distress syndrome. Some observations suggest that fetal hyperinsulinemia may be related to the increased incidence of lung immaturity and that insulin might block the stimulating effect of glucocorticoid on lung maturation (Tsai et al., 1981). These findings indicate that hormonal regulation of the features of the mesenchymal-epithelial interactions during lung maturation revealed by in uitro studies, all have their in uiuo counterparts. Apart from the fibroblast-mediated effect on epithelium, the glucocorticoid hormones can also act directly (Post et al., 1984) on fetal alveolar type I1 cells, which contain glucocorticoid receptors (Beer et al., 1984). Glucocorticoid is also the main factor stimulating the generation and differentiation of alveolar spaces (Kauffman, 1977). We investigated whether the H - 2 effects on lung tumor susceptibility (see earlier) might be related to H - 2 influence on these hormonal effects (Oomen et al., 1989). We found that H - 2 influences the enhancing effect of glucocorticoid treatment on lung differentiation. The stimulatory effect of prenatal glucocorticoid treatment on the development of alveolar space in fetal lung is significantly affected by H - 2 haplotype: the increase in alveolar space is several times higher in strain B10 (H-2") than in strain BIO.A (H-2"). We also found that when carcinogen and glucocorticoid hormone are administered simultaneously to mouse embryos, this hormone treatment influences ENUinduced lung tumorigenesis (Oomen et al., 1989). The effect of glucocorticoid treatment is lung tumor type-specific; it affects the papillary tumors but not the alveolar tumors. The number (multiplicity) of papillary tumors is significantly affected by the hormone treatment, and the effect of treatment is influenced by H - 2 haplotype: in strain B10 (H-2") the mean number of papillary tumors is increased, whereas a decrease occurs in mice from the BIO.A (H-2") strain (Oomen et al., 1989). Both the alveolar and papillary tumors are believed to originate from the alveolar type 11 cell, but alveolar tumor cells resemble mature alveolar type I1 cells, while papillary tumor cells are more similar to fetal alveolar type I1 cells (Rehm et al., 1988). Fetal alveolar type I1 cells are likely to be susceptible to direct glucocorticoid action because they have, like the papillary tumor cells, specific nuclear glucocorticoid receptors (Beer et al., 1984; Beer
160
P. D E M A N T El’
AL.
and Malkinson, 1984), in contrast to mature alveolar type I1 cells and cells from alveolar tumors, which lack these receptors (Beer and Malkinson, 1984; Beer et al., 1983). It is likely that H - 2 affects susceptibility of immature fetal alveolar type II cells to direct or indirect glucocorticoid hormone effects, and that glucocorticoid-induced changes in differentiation state of fetal alveolar type I1 cells alter also their susceptibility to chemical carcinogenesis. The observation that these effects eventually alter the generation of papillary but not of alveolar tumors suggests that the type of the lung tumor is determined by the differentiation stage of the lung alveolar type I1 cell at the time of initiation, or shortly thereafter. Taken together these findings suggest that the H - 2 complex affects one or more steps in lung organogenesis and tumorigenesis through influence on hormonal regulation of cell differentiation. Since it is possible to study in vitro the functions of alveolar type I1 cells and of fetal lung fibroblasts separately (see earlier and Fig. 4), these techniques can be used to study the specific cellular and molecular processes where H - 2 genes affect differentiation and tumorigenesis.
F. MHC EFFECTSON TUMORIGENESIS I N SMALL INTESTINE We have frequently observed tumors of the small intestine in mice from H - 2 congenic strains on the C57BL/10 background treated prenatally or postnatally with the carcinogen ENU. These tumors were found to be adenocarcinomas of the epithelium, in which histologically different tumor cells resembling the four cell types of the normal intestinal epithelium (i.e., villus columnar, mucous, enteroendocrine, and Paneth cells) were present (Oomen et al., 1984). Since these different cells of the normal intestinal epithelium are believed to originate from common stem cells (Cheng and Leblond, 1974), the observed tumors seem to be derived from these stem cells. In the studies on the role of H - 2 in lung tumorigenesis discussed earlier, we observed also a relationship between H - 2 genes and susceptibility to the carcinogen-induced tumorigenesis in the small intestine. In mice from H - 2 congenic strains on the C57BL/10 background, treated postnatally with ENU, intestinal tumorigenesis is influenced by H - 2 haplotype. As Fig. 5 shows, the mean number of tumors per animal is significantly different between several of the H - 2 congenic strains tested (Oomen et al., 1988). The strain B10.A(2R) is highly susceptible and differs from the relatively resistant strains BlO.A(5R), BlO, and BlO.A(4R) in tumor incidence and number of tumors, while strain B1O.A is intermediate. Strain BlO.A(2R) takes an extreme position also with respect to the location of tumors in the small intestines: in this strain the majority of tumors is
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
4.5
161
mean number of tumors
4 3.5 3
2.5 2 1.5 1
BlO.A(PR)
BIO.A
BlO.A(BR)
610
BlO.A(4R)
FIG.5. Number and distribution of tumors along the small intestine of mice from five H-2 congenic strains on the C57BL/10 background treated postnatally with the carcinogen N-ethylN-nitrosourea. For each strain the mean number of tumors per tumor-bearing mouse (vertical axis; combined for females and males) found in the proximal (diagonal lines) and distal 20-cm segment (cross-hatching) of the small intestine is given.
located in the proximal part of the small intestine (duodenum and part of jejunum), whereas in strain BlO.A(4R)most tumors were found in the distal part (part of jejunum and ileum). In strains BlO.A, BlO.A(5R), and B10 the tumors are distributed more evenly along the small intestine (Fig. 5). This is, to our knowledge, the first example of a genetic influence on the location of a certain type of tumor in an organ. These findings may be related to the fact that the small intestine is a longitudinally specialized organ with the proximal and distal part having in many respects very different functions in the digestive process. Different haplotypes may have separate and diverse effects on maturation and function of the two parts of the small intestine, and hence influence also the appearance of tumors in each of them separately. Thus, the H-2 complex affects several parameters of tumorigenesis in the small intestine in congenic strains on the C57BL/10 background: tumor incidence, mean number of tumors per mouse, and the location of tumors along the small intestine. Because the intestine, like lung, is derived from embryonal foregut, and because differentiation and functional development of the small intestine is regulated by glucocorticoid hormone (Smith and Zinman, 1982; Henning, 1986), we investigated whether these H - 2 effects on tumorigenesis in the small intestine are influenced by glucocorticoid treatment. We found that a concomitant prenatal glucocorticoid treatment affects prenatally ENUinduced tumorigenesis in the intestine. Both the number of ENU-induced
162
P. D E M A N T ET AL.
tumors and their location in the small intestine were significantly affected by glucocorticoid treatment, and both effects were influenced by H - 2 haplotype. In strain BlO (H-2") the number of tumors was increased in males and decreased in females, while no effect of hormone treatment on tumor numbers has been seen in B1O.A mice or either sex. The location of the tumors in B10 and BIO.A mice treated prenatally with ENU was not different, but the concomitant glucocorticoid treatment affected it in strain BIO.A (H-2"), where hormone treatment resulted in a shift toward the proximal part of the intestine (Oomen et al., 1989). Thus a concomitant glucocorticoid treatment affects in a H - 2 haplotype-specific manner not only prenatally induced lung tumor development (see earlier), but also prenatal tumorigenesis in the intestine. We propose that the parallel effects of the H-2 genes on differentiation and tumorigenesis in the two developmentally related organs, lung and small intestine, observed in our experiments, may reflect a more general effect of the M HC on hormonal regulation of differentiation of epithelial tissues. These results may also offer a starting point to approach the problem of the relationship between the differentiation stage of target cells and their susceptibility to tumorigenesis.
G. MHC EFFECTSON TUMORIGENESIS I N LIVER The effects of H - 2 on tumorigenesis in the liver, be it spontaneously or chemically induced, have been studied in H - 2 congenic lines on the A, C3H, and C57BL/10 background. Smith and Walford (1978) showed that in mice on the A background spontaneous liver tumor incidence in males was affected by H - 2 haplotype. In mice from H - 2 congenic strains on the C3H background, known to be prone to liver tumor development, an H - 2 influence on spontaneous liver tumorigenesis was suggested also (Smith and Walford, 1978), but this finding could not be confirmed in another study (den Engelse et al., 1981). In both aforementioned studies H - 2 congenic strains on the C57BL/10 background were also included, but in none of these strains did a significant percentage of mice (males nor females) develop liver tumors, whether carcinogen was applied or not. In contrast, we have shown that a postnatal ENU treatment can induce a moderate to fairly high incidence of liver tumors in these strains, especially in males (Oomen et al., 1988). For two types of liver parenchymal tumors, hepatocellular adenomas and hepatocellular carcinomas (the latter tumors frequently give rise to metastases), we found that in males the H - 2 haplotype markedly influences their occurrence. For both liver tumor types, BlO.A(2R) proved to be the most susceptible strain, BlO.A(5R) the most resistant. The other strains tested, BlO.A, BlO.A(4R), and B10, were intermediate. For females no
GENETICS OF T U M O R SUSCEFTIBILITY I N THE MOUSE
163
differences between strains were found, either for hepatocellular adenomas or for hepatocellular carcinomas. Together these findings indicate that genes in or closely linked to the H - 2 complex are also involved in liver tumorigenesis. Whether their effect is observed depends, however, on the rest of the genome and the experimental system used. H. MHC
AND
MAMMARY TUMOR SUSCEPTIBILITY
The first evidence for the role of the mouse MHC in susceptibility to mammary tumors has been obtained by Muhlbock and Dux (1974) using H - 2 congenic strains on C57BL/ lOScSn background and C3H-MTV. The standard induction procedure in their experiments consisted of foster-nursing newborn mice on MTV-producing females and, after weaning, force-breeding the young females to provide appropriate hormonal stimulation for the mammary gland. The tests of the B10 strain and of 11 H - 2 congenic strains revealed that they differ widely in susceptibility, the strain B10 (H-2b) being the most resistant, the strains BlO.A(SR)( H - F ) being the most susceptible. The other strains were intermediate, forming a continuous range between the most susceptible and the most resistant strain (Muhlbock and Dux, 1974, 1981). Tests of F, hybrids between B10 and BlO.A(SR) revealed that the H-2-linked susceptibility is a dominant trait. As several recombinant haplotypes were present in this group of strains, it was possible to ascertain that the main genetic factors responsible for susceptibility map most likely into the central regions of H - 2 , between I - A and -D, and also to the right of S. In a separate test (Dux, 1983)influence of the TZa region has been demonstrated on C57BL/6 genetic background (Tlu" conferring relative resistance compared to TZub), but not on A strain background. In contrast to the clear evidence for the role of the H - 2 complex in susceptibility to mammary tumors, tests of congenic strains on B10 background differing at n o n - M H C histocompatibility loci H - 1 , H-3, H 4 , H - 7 , H-8, H - 9 , H - 1 2 , and H - 1 3 did not reveal any effect of these genes (A. Dux, unpublished observations). Subsequently, the role of the H - 2 complex in susceptibility to C3H-MTVinduced mammary tumors has been demonstrated by the same authors also on other genetic backgrounds. Differences in susceptibility were found between strains C3H (H-2'9 and C3H.Bl0 (H-2"), BALBlcHeA ( H - 2 9 and B A L B I c - H - ~(H-2b), ~ and 020/A ( H - 2 9 and 020.Q (previously named OIR, H-29). These tests confirm the linkage of mammary tumor susceptibility with the MHC. That non-MHC genes also play an important role has been revealed by the tests of strains sharing the same haplotype, H-29: DBA/A, 020.Q, and C57BLILiA-H-24 (formerly BIR). The latter strain was very resistant, while DBA and 0 2 0 . Q were relatively susceptible. While in all experiments just discussed C3H-MTV has been used, a series
164
P. DEMANT ET AL.
of experiments using DBA-MTV and GR-MTV revealed a complex interaction between the H-2 haplotype and MTV type in determining tumor susceptibility. The strains 0 2 0 and 020.Q without exogenous MTV both produce a moderate number of mammary tumors at a relatively high age. Infection with CSH-MTV leads to an increase in the tumor incidence and earlier appearance of tumors in 0 2 0 mice, while the strain 0 2 0 . Q is relatively resistant. On the other hand, infection with DBA-MTV leads to a reverse picture: a high tumor incidence and an early appearance of tumors in 020.Q mice, while the strain 0 2 0 is relatively resistant. Thus, the two haplotypes, H-2pz and H-24, have different effects on MTV-induced tumorigenesis depending on the type of MTV. The C57BLILiA-H-2'1 (BIR) mice are, similarly to 0 2 0 . Q (H-2'9 mice, more susceptible to DBA-MTV and GR-MTV than to C3H-MTV. The B10 mice (H-2b)are resistant to C3HMTV but susceptible to GR-MTV, while the congenic BlO.A(5R) mice (H-2i5) are equally susceptible to CSH-MTV and GR-MTV. However, the susceptibility is dependent not only on type of MTV, but also on the method of hormonal stimulation: the strain C57BL/LiA is very resistant to C3HMTV-induced tumors when force-breeding is used, but very susceptible with hypophyseal isografts as the source of hormonal stimulation. The H-2 congenic strains do not differ in the number, structure, or expression of endogenous MTV proviruses (Long et al., 1980). The H-2-linked susceptibility to MTV-induced mammary tumors probably reflects the effect of H-2 on immune response against the MTV. Blair et al. (1983) demonstrated that H-2 genotype influences plasma levels of MTV. Dux and Deinant (1987) showed that the effects of H-2 on susceptibility to CSH-MTVinduced mammary tumors are systemic (see Section 11), in contrast to the direct effects of non-MHC susceptibility genes on the susceptibility of mammary gland itself (for review see Dux, 1981). The H-2 complex influences also the susceptibility to hormonally induced mammary tumors in mice that are free of infectious MTV. The tumors are induced by hypophyseal isografts placed under kidney capsule. The isografts are severed from the direct blood supply from the hypothalamus, and thus the hypophyseal cells are freed from control by hypothalamic hormones. As a result, the hypophyseal cells proliferate and produce prolactin continuously, and possibly also other hormones as well, which stimulates proliferative and secretory activity of mammary epithelium (for review see Boot et n l . , 1981). In many strains, this stimulation leads to the appearance of mammary adenoacanthomas, in contrast to adenocarcinomas, which form the largest proportion of MTV-induced mammary tumors. The cells in these hormonally induced tumors, similarly to mammary epithelium of mice without infectious MTV, do not produce detectable MTV proteins (P. C. Hageman, personal communication); also, the transcripts of endogenous
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
165
MTV are present in very small amount, if at all (Ashley et al., 1980). Muhlbock and Dux (1971, 1981)demonstrated that H-2 genes influence the incidence and time of appearance of hormonally induced mammary tumors in C57BL/10 congenic strains. The strain pattern of relative susceptibility and resistance to this method of tumor induction differed from that for C3HMTV-induced tumors. Ropcke et al. (1987) have confirmed and extended this finding, and found that the congenic strains differ not only in the incidence and time of appearance of mammary tumors, but also in the behavior of the grafted hypophysis. The size of the hypophyseal graft differed highly significantly between the congenic strains, and so did the concentration of estrogen receptors in the hypophyseal graft. There has been no obvious correlation between the susceptibility to mammary tumor induction and these two H-2-influenced traits. However, analysis of additional data (Ropcke and Demant, in preparation) reveals that while in the strains that are relatively susceptible to mammary tumor induction no correlation exists between mammary susceptibility and size of the hypophyseal isografts, in strains that are more resistant to tumor induction, a significant correlation between the two parameters exists, because females with large grafts are more likely to produce tumors. Limited numbers of tests failed to indicate that plasma prolactin levels correlate with the appearance of the hormonally induced tumors (Van der Gugten et al., 1985; Ropcke et al., 1987), and Nagasawa et al. (1976) suggested that susceptibility of mammary gland to hormonal induction of tumors correlates with the proliferative and differentiative response of the gland to hormonal stimulation. Data from our laboratory suggest that the main mechanism of H-%linked susceptibility to hormonal induction of mammary tumors resides probably in the mammary gland, but that in the relatively resistant strains also the second effect of H-2, namely the effect on the growth rate of the hypophyseal graft, influences the tumorigenesis. The molecular mechanisms of these H-2 effects remain to be elucidated. Little is known about the non-MHC genes influencing the susceptibility to virally and hormonally induced mammary tumors. There is a difference in the susceptibility to C3H-MTV due to non-MHC genes between several H-2&inbred strains: C57BL/LiA (very resistant), B10 (resistant), BIMA (intermediate), and C3H. B10 and BALB. B10 (relatively susceptible) Muhlbock and Dux, 1981). The role of non-MHC genes was demonstrated also using RIS produced from the strains BALB/cBy (susceptible) and C57BL/6By (resistant) by Bailey (1971). Of the seven C x B RIS tested, one was resistant, one was more susceptible than BALB/cBy, and the rest were intermediate. This indicates involvement of two or more genes in the difference in susceptibility between BALB/cBy and C57BL/6By (Dux et al., 1978). Very large differences in susceptibility of inbred mouse strains have been
166
P. D E M A N T ET AL.
known to exist (for review see Hageman et aZ., 1981), and the genes involved affect mainly the susceptibility of the mammary gland itself rather than the systemic factors; that is, they are true tumor susceptibility genes (Dux, 1981). Tests using RIS did not until now lead to identification of these genes, because of the multigenic nature of the strain differences. The three series of RCS prepared in our laboratory each involve one parental strain that is susceptible and one that is resistant to mammary tumorigenesis (BALB/ cHe-STS/A, C3H/Sn-C57BL/lOScSn, and 020/A-BlO.O20/Dem, respectively). Their application might contribute to identification of the genetic factors involved in mammary tumorigenesis.
I. MHC
AND
TUMORIGENESIS IN EPITHELIAL ORGANS-SUMMARY
More than 70%of tumors in humans are of epithelial origin as compared to 8% leukemias (Silverberg and Lubera, 1986). The study of the genetics of susceptibility to tumorigenesis in organs like lung, mammary gland, liver, and small intestine can help to assess how the specific risk of a number of common types of cancer is associated with certain genes. Such studies also have theoretical importance. The epithelial cells of these organs carry out very different functions, but the regulation of their development, maturation, and function exhibits common principal features, namely finely tuned multihormonal regulation, which is partly mediated by modulatory effects of mesenchyme. Therefore, these organs provide the opportunity to study the common features of the relationship between differentiation and susceptibility to oncogenesis. The data on MHC influence on tumor susceptibility in the epithelial organs-lung, small intestine, liver, and mammary gland-indicate that several different effects of the H - 2 gene complex are operating. The experiments with mammary tumorigenesis yield several types of effects, depending on the induction scheme. In virally induced tumors, systemic effect of H - 2 predominates (Dux and Demant, 1987), and the haplotype effects are specific for the type of MTV used. This suggests that H - 2 genes influence immune response against MTV antigens on virions or cells. Other effects are seen with hormonally induced mammary tumors (Miihlbock and Dux, 1981), which do not produce MTV proteins in any appreciable amount. The H - 2 genotype affects not only the incidence and time of appearance of mammary tumors, but also the behavior of the heterotopic hypophyseal isograft used to induce the tumors (Ropcke et d., 1987).The growth of the isograft under the kidney capsule correlates in resistant strains with the appearance of tumors. Besides the possible immunological effects, the H - 2 apparently influences the formation of hormonally induced tumors through two mechanisms-one
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
167
that might affect the response of mammary gland to hormonal stimulation, and the other that likely influences the hormonal stimulus itself. In addition, H-2 genotype appears to influence the levels of estrogen hormone receptors in the transplanted hypophysis (Ropcke et al., 1987). These data illustrate that the H-2 complex can affect several nonimmunological processes, some of which may be relevant for development of tumors. Gronberg et al. (1983),have shown that mice of H-2 congenic strains differ in susceptibility to epithelial tumors of skin and to lymphomas after peroral treatment with DMBA. There has been no correlation with NK-cell activity. Koizumi et al. (1987) described H-2-linked differences in Ah receptor levels and Ah inducibility by P-naphthoflavone, but because of differences in the strains tested in the two studies, it is not clear to what extent the results of Gronberg et al. (1983) might be due to differences in metabolic processing of DMBA. In the studies on tumor induction with the directly acting carcinogenmutagen ENU, the need for metabolic activation of the carcinogen is avoided. Polymorphism of genes influencing such metabolic steps, which per se are not related in any way to the neoplastic transformation itself, will therefore not influence the results. Because ENU induces tumors in a variety of organs, the effects of the same genes on tumorigenesis in different organs may be analyzed. The results obtained in H-2 congenic strains on C57BL/lOScSn background (Oomen et al., 1988, and unpublished observations) indicate that the MHC affects susceptibility of lung, small intestine, and liver to ENU carcinogenesis. It has been proposed that many of the effects of H-2 on tumorigenesis are due to nonimmunological biological functions of H-2 (Demant, 1986). The effectiveness of experimental modification of prenatal E NU-induced tumorigenesis by glucocorticoid treatment and the influence of H-2 genotype on the effects of this hormonal manipulation indicate that MHC influences the susceptibility to chemical carcinogenesis through effects on hormonal regulation of cell differentiation (Oomen et al., 1989). The hormonal regulation of function of lung epithelium persists throughout the life cycle. Therefore, the effects of MHC on this regulation might possibly also affect postnatally induced tumors. These observations raise two questions of considerable theoretical and practical interest: (1) what products of the H - 2 gene complex are involved and how do they operate; and (2) what is the mechanism of these effects of MHC on susceptibility to tumor induction? The nonimmunological effects of the MHC may be due to the class I or class I1 genes, one or more genes of the heterogeneous group of class 111 genes, or presently yet unknown genes. The class I and class I1 genes have been shown to associate with various hormone or growth factor receptors on cell membranes (Schreiber et al., 1984; Due et al., 1986; Kitur et al., 1987),
168
P. DEMANT E T AL.
or proteins inside the cell (Anderson et al., 1985; see also Section V). The intracellular binding of class I or class I1 antigens to biologically important molecules might disturb their metabolism, function, or secretion (for discussion see Parham, 1988). The latter mechanism might be related to the insulin-dependent diabetes mellitus in transgenic mice expressing class I (Allison et a l . , 1988) or class I1 (Sarvetnick et a l . , 1988; Lo et al., 1988) molecules in pancreatic p cells. The discoveries of two unexpected genes with unknown functions in the S region of the H-2 complex and the mapping of the two genes for tumor necrosis factor between S and H-2D (see Section V) suggest that some biological effects of H-2 might be due to genes other than class I or class 11. This question can be resolved by mapping the studied effects to specific regions of the H-2 gene complex and by identifying subsequently the relevant genes by transfection or transgenesis. How do the nonimmunological effects of MHC genes affect susceptibility of cells to tumorigenesis? The available data suggest that the H-2-linked genes affect the susceptibility of cells to regulation of their differentiation state by hormones, especially glucocorticoids. The differentiation state of the cells determines their susceptibility to neoplastic transformation. This has been demonstrated in a variety of experiments using transformation by oncogenes (for review see Klein and Klein, 1986). The results of these studies suggest that, in the spectrum of the possible differentiation stages of a cell, only certain stages-the “differentiation window”-allow the transformation by the oncogene. The factors influencing the outcome of the in vitrotransformation experiments appear to operate after the action of the oncogene product (Klein and Klein, 1986). The alteration of susceptibility to tumorigenesis by the effects of H-2 on hormone susceptibility might be brought about through modification of function of cell surface hormone receptors (see earlier), or modulation of signal transduction, possibly through altered glucocorticoid effects on phospholipase A, (Irvine, 1982), which is an important enzyme in arachidonic acid metabolism (Burgoyne et al., 1987). Another possibility is H-2 influence on expression of oncogenes (see Section 111,A). Glucocorticoids have also been shown to inhibit the tumor promotion (Slaga, 1980), and it would be interesting to investigate whether this effect is influenced by H-2. The study of the relationships between hormonally regulated cell differentiation and susceptibility to tumorigenesis, and the role of MHC genes therein, offers the possibilities of analyzing well-defined host factors that regulate the behavior of the cells. These factors are the ones involved in normal regulation of development and function of various tissues in mammals, and therefore the results of such studies would likely be applicable to actual processes of tumorigenesis. In addition, these studies may provide a better insight into the nonimmunological functions of the MHC, and into
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
169
their evolutionary relationship with other MHC functions. Such information would benefit also the understanding of the relationship between the M HC and susceptibility to various diseases. VII. Tumor Susceptibility Genes: Molecular and Cellular Perspective
The discussion of tumor susceptibility genes in the preceding sections has been necessarily selective and limited in extent. Nevertheless, the present state of knowledge and technology warrants the proposition that, in addition to previous achievements, the long-standing promise of contribution of genetic studies of cancer to the understanding of basic processes in neoplasia will be made true also in the near future. This proposition is based on several premises. 1. The possibility now exists of genetic and molecular identification of tumor susceptibility genes. The use of RCS offers a rational perspective of genetic definition and mapping of a number of tumor susceptibility genes. The current advances in manipulation and cloning of large fragments of DNA and progress in physical mapping of genomic DNA make the cloning of the genes with known meiotic map position more feasible than before. The combination of the genetic and molecular approaches may become a powerful tool for actual molecular isolation of tumor susceptibility genes, which have been escaping identification for such a long time. 2. A better insight into the biological nature of the effects of tumor susceptibility genes will allow a more appropriate and purposeful choice of experimental models. By studying those genes that affect the susceptibility of the cell to tumorigenesis, a link of genetic studies with other relevant issues of neoplastic transformation can be made. A more precise understanding of individual stages of the neoplastic process offers better possibilities for identification of the specific steps at which the tumor susceptibility genes operate. Recognition that the tumor susceptibility genes generally affect the postinitiation stages of tumorigenesis is the first step along this path. A better definition of differentiation stages of normal and tumor cells, and better experimental possibilities of their manipulation, will contribute to the understanding of the “differentiation window” for tumorigenic action of oncogenes. 3. Advances have been made in our understanding of the molecular nature of the neoplastic process. Identification of numerous oncogenes, protooncogenes, and tumor suppression genes offers a host of possibilities of characterization and experimental manipulation of normal or tumor cells, which can be used to study the mechanisms of action of tumor susceptibility
170
P. D E M A N T ET AL.
genes. In the preceding period these advances have led to the recognition that genetic changes indeed lie at the basis of the neoplastic transformation, an understanding that the genes involved are not specific “cancer genes” but rather genes involved in a variety of normal functions of the cell, and that each of these genes contributes to only one or a few of the several steps required to change a normal cell into a neoplastic cell. Thus, the apparent a priori principal differences among oncogenes, tumor suppression genes, and tumor susceptibility genes will in many cases disappear. We propose that the three groups of genes overlap and interact to a considerable extent. The action of oncogenes and tumor suppression genes can be understood only when the critical substrates for the action of their products are identified. The demonstration of genetic linkage of lung tumor susceptibility with the protooncogene Kras-2 (Ryan et al., 1987), the effect of the H-2Dk gene on the expression of the Kras-2 gene (Alon et al., 1987), and evidence for a genetically determined preference for certain retrovirus integration sites in tumors (Mucenski et al., 1988) indicate close interactions between tumor susceptibility genes and oncogenes. The analysis of interactions with the known oncogenes and tumor suppression genes is one of the main tasks in the study of tumor susceptibility genes. Cloning of tumor susceptibility genes will considerably advance the possibility of experimental study of these interactions.
ACKNOWLEDGMENTS We thank Dr. A. Dux for careful reading of Section VI and many useful comments, Dr. M. A. van der Valk for discussions and suggestions in the course of preparation of the manuscript, and Mrs. M. Sonne and Mrs. T. van Diepen for unrelentingly efficient and attentive typing and reediting the manuscript.
REFERENCES Allison, J . , Campbell, 1. L., Morahan, G., Mandel, T. E., Harrison, L. C., and Miller, J. F. A. P. (1988). Nature (Imadon) 333, 529-533. Alon, Y., Hammerling, G . J., Segal, S., and Bar-Eli, M. (1987). Cancer Res. 47, 2553-2557. Anderson, L. M., Budinger, J. M., Maronpot, R. R., and Good, R . A. (1978). Cancer Res. 38, 137-141. Anderson, M., Paabo, S., Milsson, T., and Peterson, P. (1985). Cell 43, 215-222. Andervont, H. B. (1937). Public Health Rep. 52, 304-315. Andervont, H . B. (1938a). Public Health Rep. 53, 232-237. Andervont, H. B. (1938b). Public Health Rep. 53, 1647-1655. Aoki, T., Boyse, E. A., and Old, L. J. (1968).1.Natl. Cancer Znst. 41, 97-101. Artzt, K . , and Jacob, F. (1974). Transplantation 17, 632-634. Ashley, R. L., Cardiff, R. D., and Fanning, T. G. (1980)./. Natl. Cancer Znst. 65, 977-986. Babbitt, B. P., Allen, P. M., Matsneda, G., Haber, E., and Unanwe, E. R. (1985). Nature (London) 317, 359-361.
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
171
Bailey, D. w. (1965). TfQnsplQntQtiOn 3, 531-534. Bailey, D. W. (1971). Transplantation 11, 325. Bailey, D. W. (1981). In “The Mouse in Biomedical Research” (H. L. Foster, J. D. Small, and J. G. Fox, eds.), pp. 223-239. Academic Press, New York. Ballard, P. L. (1983). Prog. Clin. B i d . Res. 140, 103-117. Beer, D. G., and Malkinson, A. M. (1984). Cancer Res. 44, 3546-3553. Beer, D. G., and Malkinson, A. M . (1985).J . Natl. Cancer Znst. 75, 963-969. Beer, D. G., Cunha, G. R., and Malkinson, A. M. (1983). Lab. Znoest. 49, 725-734. Beer, D. G., Butley, M. S., Cunha, G . R., and Malkinson, A. M. (1984). Deo. Biol. 105, 351364. Bentvelzen, P. A. J. (1968). “Genetical Control of the Vertical Transmission of the Miihlbock Mammary Tumor Virus in the GR Mouse Strain.” Hollandia, Amsterdam. Bentvelzen, P. A. J.. and Szalay, G . (1966). In “Lung Tumors in Animals,” Proceedings Third Quadrennial Conference on Cancer. (L. Severi, ed.), pp. 835-844. Univ. of Perugia, Perugia. Bernards, R. (1987). Trends Genet. 3, 298-301. Bernards, R., Schrier, P. I., Houweling, A., Bos, J. L., van der Eb, A. J., Zijlstra, M., and Melief, C. J. (1983). Nature (London) 305, 776-779. Bernards, R., Dessian, S. U., and Weinberg, R. A. (1986). Cell 47, 667-674. Beutler, B., and Cerami, A. (1986). Nature (London) 320, 584-588. Bishop, J. M. (1983). Annu. Reu. Biochern. 52, 301-354. Bishop, J. M. (1987). Science 235, 305-311. Bittner, J. J. (1936). Science 84, 162-163. Bittner, J. J. (1938). Public Health Rep. 53, 2197-2202. Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennet, W. S., Strominger, J. L., and Wiley, D. C. (1987). Nature (London) 329, 506-512. Blair, P. B., Danilows, J. A., and Newly, C. (1983). In “Cancer: Etiology and Prevention” (R. G . Crispen, ed.), pp. 141-150. Elsevier, Amsterdam. Blank, K. J., and Lilly, F. (1977). Nature (London) 269, 808-809. Bloom, J. L., and Falconer, D. S. (1964).J. Natl. Cancer Znst. 33, 607-618. Bodmer, W. F., Bailey, C. J., Bodmer, J., Russey, H. J. R., Ellis, A., Gorman, P., Lucibello, F. C., Murday, V. A,, Rider, S. H., Scambler, P., Sheer, D., Solomon, E., and Spurr, N. K. (1987). Nature (London) 328, 614-616. Bonner, J. J., and Tyan, M. L. (1983). Genetics 103, 263-276. Boot, L. M., Kwa, H. G., and Ropcke, G . (1981). In “Mammary Tumors in the Mouse” (J. Hilgers, and M. Sluyser, eds.), pp. 117-200. Elsevier/North-Holland, Amsterdam. Branstetter, D. G., Stoner, G . D., Budd, C., Conran, P. B., and Goldblatt, P. J. (1988). Cancer Res. 48, 379-386. Brown, J. H., Jardetzky, T., Saper, M. A., Samraoui, B., Bjorkman, P. J., and Wiley, D. C. (1988). Nature (London) 332, 845-850. Brown, W. R. A., and Bird, A. P. (1986). Nature (London) 322, 477-481. Bruisten, S. M., and Demant, P. (1989). Zrnrnunogenetics 29, 6-13. Buchberg, A. M., Bedigian, H. G., Taylor, B. A., Brownell, E., Ihle, J. N., Nagata, S., LeBeau, M. M., et al. (1987). Mouse News Lett. 79, 62. Burgoyne, R. D., Cheek, T. R., and O’Sullivan, A. J. (1987). Trends B i d . Sci. 12, 332-333. Burke, D. T., Carle, G. F . , and Olson, M. W. (1987). Science, 236, 806-812. Buus, S . , Sette, A , , Colon, S. M . , Jenis, D. M., and Grey, H. M. (1986). Cell 47, 1071-1077. Calafat, J., Demant, P., and Jansen, H. (1981).Zrnrnunogenetics 14, 203-220. Carle, G. F., and Olson, M. V. (1984). Nucleic Acids Res. 12, 5647-5664. Carle, G . F., Frank, M., and Olson, M. V. (1986). Science 232, 65-68.
172
P. DEMANT ET AL.
Carlson, K. S . . Smith, B. T., and Post, M. (1984).J . Appl. Physiol. 57, 1577-1579. Chaplin. D. D. (1985). Immunol. Reo. 87, 61-80. Chazan, R . , and Haran-Ghcra, N. (1976). Cell Immunol. 23, 356-375. Chen, J.-M., and Little, C. D. (1987). Deo. Biol. 120, 311-321. Cheng, H., and Leblond, C. P. (1974). Am. J . Anat. 141, 537-562. Chu, G., Vollrath, D., and Davis, D. W. (1986). Science, 234, 1582-1585. Cole, G. A., Cole, G. A,, Clements, V. K., Garcia, E. P., and Ostrand-Rosenberg, S. (1987). Proc. Natl. Acad. Sci. USA 84, 8613-8617. Cook, R. G., Jenkins, R. N . , Flaherty, L., and Rich, R. R. (1983).1. Immunol. 130, 1293-1299. Croce, C. M., Linnenbach, A , , Huebner, K., Parnes, J. R., Margulies, D. H., Apella, E., and Seidman, J. G. (1981). Proc. Natl. Acad. Sci. USA 78, 5754-5758. Curman, B., &berg, L., Sandberg, L., Malmheden-Eriksson, I., Stalenheim, G., Rask, L., and Peterson, P. A. (1975). Nature (London) 258, 243-245. De Baetselier, P., Katzav, S., Gorelik, E., Feldman, M., and Segal, S. (1980).Nature (London) 288, 179-181. Debr6, P., Boyer, B., Gisselbrecht, S., Bismuth, A,, and Levy, J. P. (1980). Eur. J . Immunol. 10, 914-918. Demant, P. (1985). Immunogenetics 22, 183-188. Demant, P. (1986).J . Immunogenet. 13, 61-67. Demant, P., and Hart, A. A. M. (1986). Immunogenetics 24, 416-422. Demant, P., and Oudshoorn-Snoek. M. (1985). Immunogenetics 22, 543-552. Demant, P., Hart, A. A. M., and van Zutphen, L. F. M. (1988). In “New Developments in Biosciences” (A. C. Beynen and H. A. Solleveld, eds.), pp. 209-214. Nijhoff, Dordrecht, Netherlands. de Munter, H. K., den Engelse, L., and Emmelot, P. (1979). Chem.-Biol. Interact. 24, 299316. den Engelse, L., Oomen, L. C. J. M., van der Valk, M. A., Hart, A. A. M., Dux, A., and Emmelot, P. (1981). Int. J . Cancer 28, 119-208. de Preval, C., Lisowska-Grospierre, B., Locke, M . , Griscelli, C., and Mach, B. (1985). Nature (London) 318, 291-293. Diwan, B. A,, and Meier. H. (1974). Cancer Res. 34, 764-767. Dourson, M. L., and O’Flaherty, E. J. (1982).J. Natl. Cancer Inst. 69, 851-857. Drinkwater, N. R . , and Ginsler, J. J. (1986). Carcinogenesis 7, 10, 1701-1707. Due, C., Simonsen, M.. and Olsson, L. (1986). Proc. Natl. Acad. Sci. USA 83, 60076011. Duesberg, P. H. (1987). Proc. Natl. Acad. Sci. USA 84, 2117-2124. Dux, A., (1981). In “Mammary Tumors in the Mouse” (J. Hilgers and M. Sluyser, eds.), pp. 515-544. Elsevier, Amsterdam. Dux, A. (1983). Transplant. Proc. 15, 2101-2103. Dux, A., and Demant, P. (1987). Znt. J . Cancer 40, 372-377. Dux, A,, and Miihlbock, 0.(1968).J . Natl. Cancer Inst. 40, 1259-1265. Dux, A,, Mblbock, O., and Bailey, D. W. (1978).1. Natl. Cancer Inst. 61, 1125-1129. Eastman O’Neill, A,, Reid, K . , Garberi, J. C., Karl, M., and Flaherty, L. (1986).Zinmunogenet~ C S24, 368-373. Eisenhach, L., Segal, S., and Feldman, M. (1983). Int. J . Cancer 32, 113-120. Falconer. D. S. (1963). In “Methodology in Mammalian Genetics” (W. J. Burdette, ed.), pp. 193-216. Holden-Day, San Francisco, California. Faraldo, M . J . , Dux, A., Mblbock, O., and Hart, G . (1979). Immunogenetics 9, 383-404. Farber, E., and Cameron, R. (1980). Ado. Cancer Res. 31, 125-226. Fearon, E. R . , Hamilton, B., and Vogelstein, B. (1987). Science 238, 193-197.
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
173
Field, S. H., Bernards, R., Rogelj, S., Weinberg, R. A., Rappaport, J. M., Albert, D. M., and Dryja, T. P. (1986). Nature (London) 323, 643-646. Figueroa, F., Klein, D., Twearson, S., and Klein, J. (1982). J. Zmmunol. 129, 2089-2093. Figueroa, F., Zaleska-Rutcznyska, A., Kusnierczyk, P., and Klein, J. (1983). Transplantation 35, 391-393. Fischer, S. M., O’Connell, J. F., Conti, C. J., Tacker, K. C., Fries, J. W., Patrick, K. E., Adams, L. M., and Slaga, T. J. (1987). Carcinogenesis 8, 421-424. Fisher, D. A., Hunt, S. W., and Hood, L. (1985).J. Exp. Med. 163, 528-548. Flaherty, L., and Rinchik, E. (1978). Nature (London) 273-52-53. Flaherty, L., Karl, M., and Reinisch, C. L. (1982). Zmmunogenetics 16, 329-337. Foulds, L. (1969). “Neoplastic Development.” Academic Press, New York. Fox, R. I., and Weissmann, I. L. (1979).J. Zmmunol. 122, 1697-1704. Fung, Y. K. T., Murphree, A. L., T’Ang, A., Qiau, J., Hinrichs, S. H., and Benedict, W. F. (1987). Science 236, 1657-1661. Garrido, F., Schirrmacher, V., and Festenstein, H. (1976). Nature (London) 259, 228-230. Geliebter, J., Zeff, R. A., Schulze, D. H., Pease, L. R., Weiss, E. H., Mellor, A. L., Flavell, R. A., and Nathenson, S. G. (1986). Mol. Cell. Biol. 6(2), 645-652. Goldman, A. S., and Katsumata, M. (1986). Arch. Biochem. Biophys. 249, 316-325. Gornard, E., Levy, J. P., Plata, F., Henin, Y., Duprez, V., Bismuth, A,, and Reme, T. (1978). Eur. J . Zmmunol. 8, 228-236. Green, W. R. (1984).J. Zmmunol. 132, 2665-2671. Gronberg, A,, Cochran, A. J., Kaerre, K., Klein, G . , Klein, G . O., and Kiessling, R. (1983). Znt. J. Cancer 32, 247-252. G on er , B., Schoenenberger, C. A,, and Andres, A. C. (1987). Trends Genet. 3, 306-308. Guillet, J. G., h i , M. Z., Briner, T. J., Buurs, S . , Sette, A., Grey, H. M., Smith, J. A,, and Gefter, M. L. (1987). Science 235, 865-870. Gusella, J. F., Keys, C. H., Varsanyi-Breiner, A,, et 01. (1980). Proc. Natl. Acad. Sci. USA 77, 2829-2833. Hammerling, G. J . , Klar, D., Puelm, W., Momburg, F., and Moldenhauer, G. (1987). Biochim. Biophys. Acta 907, 245-259. Hagernan, P. C . , Calafat, J., and Hilgers, J. (1981). I n “Mammary Tumors in the Mouse” (J. Hilgers and M. Sluyser, eds.), pp. 391-464. Elsevier, Amsterdam. Henning, S. J. (1986). Proc. Nutr. SOC. 45, 39-44. Hennings, H., Devor, D., Wenk, M. L., Slaga, T. J., Former, B., Colburn, N. H., Bowden, G. T., Elgio, K., and Yuspa, S. H. (1981). Cancer Res. 41, 773-779. Herrmann, B. G., Barlow, D. P., and Lehrach, H. (1987). Cell 48, 813-825. Heston, W. E. (1957). Cytologia 202, Suppl., 219-224. Heston, W. E. (1963). I n “Genetics in Neoplasia” (W. J. Burdette, ed.), pp. 247-268. HoldenDay, San Francisco, California. Heston, W. E. (1966). I n “Lung Tumors in Animals” (L. Severi, ed.), pp. XLIII-LVI. University of Perugia, Perugia, Italy. Heston, W. E., and Dunn, T. B. (1951).J. Natl. Cancer Znst. 11, 1057-1071. Heston, W. E., and Steffee, C. H. (1957).J. Natl. Cancer Znst. 18, 779-790. Hui, K., Grosveld, F., and Festenstein, H. (1984). Nature (London) 311, 750-752. Hume, C. R., Accolla, R. S . , and Lee, J . S . (1987).Proc. Natl. Acad. Sci. USA 84, 8603-8607. Huseby, R. A. (1951). Cancer Res. 11, 954-961. Irvine, R. F. (1982). Biochem. J. 204, 3-16. Ishizaka, S. T., and Lilly, F. (1987).J. Exp. Med. 166, 565-570. Ivanyi, D., and Demant, P. (1979). Zmmunogenetics 8, 539-550. Ivanyi, D., Cherry, M., and Demant, P. (1982). Zmrnunogenetics 15, 477-484.
174
P. DEMANT ET AL.
Ivanyi, P. (1975). Folia Biol. (Prague) 21, 444-448. Ivanyi, P., Vojtiskova, M., Demant, P., and Mickova, M . (1969). Folia B i d . (Prague) 6, 401421. Johnson, L. L., Clipson, L. J., Dove, W. F., Feilbach, J.. Maher, L. 1.. and Shedlovsky. A. (1983). Zminunogenetics 18, 137-145. Karre, K., Ljunggren, H. G., Pointek, G., and Kiessling, R. (1986). Nature(London) 119,675678. Kasahara, M., Figueroa, F., and Klein, J. (1987). Proc. Natl. Acad. Sci. USA 84, 3325-3328. Katzav, S., De Baetselier, P., Tartakovsky, B., Feldman, M., and Segal, S . (1983).I. Natl. Cancer Znst. 71, 317-324. Katzav, S . , Segal, S., and Feldman, M . (1984).I. Natl. Cancer Znst. 33, 407-415. Kauffman, S. L. (1976).J . Natl. Cancer Inst. 57, 821-825. Kauffman, S. L. (1977). Lab. Znoest. 36, 395-401. Kaufmann, S. L., Alexander, L., and Sass, L. (1979). Lab. Znoest. 40, 708-716. Kawashima, K., Ikeda, H., Stockert, E., Takahashi, T., and Old, L. J. (1976).I . Exp. Med. 144, 193-208. Kitur, D., Shimizu, Y., DeMars, R., and Edidin, M. (1987). Proc. Natl. Acad. Sci. USA 84, 1351-1355. Klein, G., and Klein, E. (1986). Cancer Res. 46, 3211-3224. Klein, J., and Figueroa, F. (1981). Zmmunol. Reo. 60, 23-57. Knudson, A. G., Jr. (1985). Cancer Res. 45, 1437-1443. Kohne, D. E., Levison, S. A., and Byers, M. J. (1977). Biochemistry 16, 5329-5341. Koizumi, A , , Walford, R. L., and Hasegawa, L. (1987). Zmmunogenetics 26, 169-173. Koufos, A., Hansen, M . F., Lampkin, 9. C., et al. (1984). Nature (London) 309, 170-172. Kozak, C. A. (1985). Ado. Cancer Res. 44, 295-336. Kunkel, L. M.,Monaco, A. P., Middlesworth, W., Ochs, H. D., and Latt, S. A. (1985). Proc. Natl. Acad. Sci. USA 82, 4778-4782. Kvist, S., Oestberg, L., Persson, H., Philipson, L., and Peterson, P. A. (1978). Proc. Natl. Acad. Sci. USA 75, 5674-5678. Kvist, S., Oestberg, L., and Peterson, P. A. (1979). Proc. Natl. Acad. Sci. USA 76,4051-4055. Lachmann, P. J., Grennan, D., Martin, A., and Demant, P. (1975). Nature (London)258,242. Lafuse, W., and Edidin, M. (1980). Biochemistry 8, 49-54. Lee, W. H., Booktein, R., Hong. F., Young, L. J., Shew, J. Y., and Lee, E. Y. H. (1987). Science 235, 1394-1399. Levi-Straws, M., Carroll, M. C., Steinmetz, M., and Meo, T.(1988). Science 240, 201-202. Lilly, F., and Mayer, A. (1980). I n “Viral Oncology” (G. Klein, ed.). pp. 89-108. Raven, New York. Lilly, F., Boyse, E. A., and Old, L. J. (1964). Lancet ii, 1207-1209. Linsk, R., Vogel, J., Strauss, H., Forman, J., and Goodenow, R. S. (1986).J . E x p . Med. 64, 794-813. Lo, D., Burkly, L., Widera, G., Cowing, C., Flavell, R . A., Palmiter, R. D., and Brinster, R. L. (1988). Cell 53, 159-168. Lonai, P., and Haran-Ghera, N. (1980). Zmmunogenetics 11, 21-29. Long, C. A., Dumaswala, U. J.. Tancin, S. L., andvaidya, A. B. (1980).Virology 103,167-177. McMillan, M., Lewis, K. D., and Rovner, D. M. (1985). Proc. Natl. Acad. Sci. USA 82,54855489. Malkinson, A. M., and Beer, D. S. (1983). /. Natl. Cancer Znst. 70, 931-936. Malkinson, A. M.,and Beer, D. S. (1984). I . Natl. Cancer Znst. 73, 925-933. Malkinson, A. M., Nesbitt, M. N., and Skamene, E. (1985)./. Natl. Cancer Znst. 75,971-974. Mann, D. W., and Forman, J. (1988). Zmmunogenetics 28, 38-45.
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
175
Margulies, D. H., Evans, G. A., Flaherty, L., and Seidman, J. G. (1982).Nature (London)295, 168-170. Martin, W. J., Gipson, T. G., and Rice, J. M. (1977). Nature (London) 265, 738-739. Masucci, M. G . , Torsteinsdottir. S . , Colombani, J., Brautbar, C., Klein, E., and Klein, G . (1987). Proc. Natl. Acad. Sci. USA 84, 4567-4571. Matis, L. A,, Cron, R., and Bluestone, J. A. (1987). Nature (London) 330, 262-264. Mellor, A. L., Weiss, E. H., Ramachandran, K., and Flavell, R. A. (1983). Nature (London) 306, 792-795. Meo, T., Krasteff, T.. and Shreffler, D. C. (1975). Proc. Natl. Acad. Sci. USA 72, 4536-4540. Meruelo, D. (1980).J. Zmmunogenet. 7, 81-90. Meruelo, D., and Bach, R. (1983). Ado. Cancer Res. 40, 107-188. Meruelo, D., Lieberman, M., Ginzton, N., Deak, B., and McDevitt, H. 0. (1977).J. Exp. Med. 146, 1079-1087. Meruelo, D., Nimelstein, S. H., Jones, P. P., Lieberman, M., and McDevitt, H. 0. (1978).J. Exp. Med. 147, 470-487. Meruelo, D., Kornreich, R., Rossomando, A,, Pampeno, C., Mellor, A. L., Weiss, E. H., Flavell, R. A , , and Pellicer, A. (1984). Proc. Natl. Acad. Sci. USA 81, 1804-1808. Michaelson, J., Boyse, E. A , , Chorney, M., Flaherty. L., Fleissner, E., Haemmerling, V., Reinisch, C., et 01. (1983a). Transplant. Proc. 15, 2033-2038. Michaelson, J., Rosenson, R. S., Reinisch, C. L., and Flaherty, L. (1983b).Zinmunogenetics 18, 155-157. Mickova, M . , and Ivanyi, P. (1975). Folio Biol. (Prague) 21, 435-436. Miller, U . , Stephan, D., Philippsen, P., and Steinmetz, M. (1987). EMBO J. 6, 369-373. Mintz, B., Custer, R. P., and Donnelly, A. J. (1971). Znt. Reu. Exp. Pathol. 10, 143-179. Miyashita, N., and Moriwaki, K. (1987). Gann 78, 494-498. Momburg, F., Herrmann, B., Moltenhauer, G., and Moeller, P. (1987).Znt. J. Cancer 40,598603. Morello, D., Daniel, F., Baldacci, P.. Cayre, Y., Gachelin, G., and Kourilsky, P. (1982). Nature (London) 296, 260-262. Morse, M. A., Baird, W. M.,and Carlson, G. P. (1987). Cancer Res. 47, 4571-4575. Moser, A. R., Johnson, L. L., and Dove, W. F., (1985). Zmmunogenetics 22, 533-541. Moser, A. R., Shedlovsky, A , , and Johnson, J. L. (1986). Zmmunogenetics 23, 271-273. Mucenski, M. L., Taylor, B. A,, Jenkins, N. A,, andcopeland, N. G. (1986). Mol. Cell. Biol. 6, 4236-4243. Mucenski, M. L., Taylor, B. A , , Copeland, N. G., and Jenkins, N. A. (1987).J. Virol. 61,29292933. Mucenski, M. L., Taylor, B. A,, Ihle, J. N., Hartley, J. W., Morse, H. C., Jenkins, N. A , , and Copeland, N. G. (1988). Mol. Cell. Biol. 8, 301-308. Miihlbock, O., and Dux, A. (1971). Transplant. Proc. 3, 1247-1250. Miihlbock, O., and Dux, A. (1974).1. Natl. Cancer Znst. 53, 993-996. Miihlbock, 0.. and Dux, A. (1981). In “Mammary Tumors in the Mouse” 0. Hilgers and M. Sluyser, eds.), pp. 545-572. Elsevier/North-Holland, Amsterdam. Muller, U . , Jongeneel, C. V . , Nedospasov, S . A., Fischer-Lindahl, K . , and Steinmetz, M . (1987). Nature (London) 325, 265-267. Muir, W. A., Hedrick, S . , Alper, C. A., Ratnoff, 0. D., Schacter, B., and Wisniesky, J. J. (1984).I. Clin. Znuest. 74, 1509-1514. Murphy, E. D. (1966). In “Biology of Laboratory Mouse” (E. L. Green, ed.), pp. 521-570. McGraw-Hill, New York. Nagasawa, H., Yanai, R., Taniguchi, H.. Tokuzen, R., and Nakahara, W. (1976). J . Natl. Cancer Znst. 57, 425-429.
176
P. DEMANT ET AL.
Naito, M . , Naito, Y., and DiCiovanni, J. (1987). Carcinogenesis 8, 1807-1815. Nebert, D. W., and Gonzalez, F. J. (1987). Annu. Reo. Biochem. 56, 945-993. Nonaka, M . , Kimura, H., Yeul, Y. D., Yokoyama, S . , Nakayama, K., andTakahashi, M. (1986). Proc. Natl. Acad. Sci. USA 83, 7883-7887. Nowell, P. C. (1976). Science 194, 23-28. Nussenzweig, M. C., Schmidt, E. V., Shaw, A. C., Sinn, E., Campos-Torres, J., MatheyPrevot, B., Pattengale, P. K., and Leder, P. A. (1988). Nature (London) 336, 446-450. O’Flaherty, E. J., and Dourson, M. L. (1982).J. Natl. Cancer Inst. 69, 859-865. Old, L. J. (1985). Science 230, 630-632. Old, L. J., Boyse, E. A., and Stockert, E. (1963).J. Natl. Cancer Inst. 31, 977-986. Oomen, L. C. J. M . , Demant, P., Hart, A. A. M., and Emmelot, P. (1983). Int. /. Cancer 31, 447-454. Oomen, L. C. J. M., van der Valk, M. A . , and Emmelot, P. (1984). Cancer Lett. 25, 71-79. Oomen, L. C. J . M., van der Valk, M. A,, Demant, P., and Emmelot, P. (1988). Cancer Res. 48, 6634-6641. Oomen, L. C. J. M . , van der Valk, M. A , , Hart, A. A. M., and Demant, P. (1989).J. Natl. Cancer Inst. 81, 512-5517, Orr, H. T., and De Mars, R . (1983). Nature (London) 302, 534-536. Oudshoorn-Snoek, M . , and Demant, P. (1983). Transplant. Proc. 15, 2104-2106. Oudshoorn-Snoek, M . , and Demant, P. (1986). Int. J. Cancer 37, 303-310. Oudshoorn-Snoek, M . , Mcllor, A. L., Flavell, R. A , , and Demant, P. (1984). Imtnunogenetics 19, 461-474. Oudshoorn-Snoek, M., Raghoebier, S . , Flaherty, L., and Demant, P. (1988). In “MHC + X Complex Formation and Antibody Induction” (P. Ivanyi, ed.), pp. 134-137. Springer. Verlag, Berlin and New York. Pampeno, C. L., and Meruelo, D, (1986).J. Virol. 58, 296-306. Parham, P. (1988). Nature (London) 333, 500-503. Parnes, J. R. (1986). Trends Genet. 3, 179-183. Philipps, C., McMillan, M., Flood, P. M . , Murphy, D. B., Forman, J . , Lancki, I]., Womack, J. E., et al. (1985). Proc. Natl. Acad. Sci. USA 82, 5140-5144. Pierce, C. B., and Speers, W. C. (1988). Cancer Res. 48, 1996-2004. Plata, F., Tilkin, A. F., Levy, J. P., and Lilly, F. (1981).J. Exp. Med. 154, 1795-1810. Plata, F., Langlade-Demoyen, P., Abastado, J. P., Berbar, T., and Kourilsky, P. (1987). Cell 48, 231-240. Pollack, M . S . , Chin-Louie, J . , and Moshief, R. D. (1983). Hunt. Immunol. 9, 75. Post, M., and Smith, B. T. (1984). Biochim. Biophys. Acta 793, 297-299. Post, M., Floros, J., and Smith, B. T. (1984). Nature (London) 308, 284-286. Poustka, A,, and Lehrach, H. (1986). Trends Genet. 2, 174-179. Poustka, A., Pohk, T. M., Barlow, D. P., Frischauf, A. M., and Lehrach, H. (1987). Nature (London) 325, 353-355. Radka, S. F., Charron, D. J., and Brodsky, F. M. (1986). Hum. Immunol. 16, 390-400. Rehm, S., Ward, J. M . , ten Have-Opbroek, A. A. W., Anderson, L. M . , Singh, G., Katyal, S. L., and Rice, J. M. (1988). Cancer Res. 48, 148-160. Reiners, J. J., Jr., Nesnow, S., and Slaga, T. J. (1984). Carcinogenesis 5, 301-307. Rice, J. M. (1973).In “Transplacental Carcinogenesis” (L. Thomatis and V. Mohr, eds.), Vol. 4. pp. 71-83. IARC Sci. Publ., Lyons. Rijsewijk, F., Schuermann, M.. Wagenaar, E., Parren, P., Wiegel, D., and Nusse, R. (1987). Cell 50, 649-657. Robinson, P. J., and Schirrmacher, V. (1979). Eur. J. Immunol. 9, 61-66.
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
177
Robinson, P. J., Sege, K., Altevogt, P., Peterson, P. A., Lundrin, L., Garrido, F., and Schirrmacher, V. (1981). Irnrnunogenetics 13, 261-265. Roderick, T. H., and Schlager, G. (1966). In “Biology of the Laboratory Mouse” (E. L. Green, ed.), pp. 151-164. McGraw-Hill, New York. Rogers, M. J., Gooding, L. R., Margulies, D. H., and Evans, G . A. (1983).J . Zrnmunol. 130, 2418-2422. Roos, M . H., and Demant, P. (1982). lrnrnunogenetics 15, 23-30. Roos, M. H., Atkinson, J . P., and Shreffler, D. C. (1978).J . Zrnmunol. 121, 1106-1115. Ropcke, E., Sluyser, M., and Demant, P. (1987). In “H-2 Antigens: Genes, Molecules, and Functions” (C. S. David, ed.), pp. 681-689. Plenum, New York. Rosenson, R. S . , Flaherty, L., and Reinisch, C. L. (1981).J. Zmrnunol. 126, 2253-2257. Rosloniec, E. F . , Kuhn, M. H., Genyea, C. A., Reed, A. H., Jennings, J. J . , Giraldo, A. A,, Beisel, K. W., and Lerman, S. P. (1984).J . Zmrnunol. 132, 945-952. Ryan, J., Barker, P. E., Neshitt, M. N., and Ruddle, F. H. (1987).J . Natl. Cancer Inst. 79, 1351-1357. Sarvetnik, N., Liggitt, D., Pitts, S. L., Hansen, S. E., and Stewart, T. A. (1988). Cell 52,773782. Sato, H . , Boyse, E. A., Aoki, T., Iritani, C., and Old, L. J. (1973).J . E x p . Med. 138, 593606.
Schmidt, W., and Festenstein, H. (1980).J . Zrnrnunogenet. 7, 7-17. Schmidt, W., and Festenstein, H. (1982). Irnrnunogenetics 16, 257-264. Schmidt, W., Alonzo, A., Leben, L., and Festenstein, H. (1982). In “Alien Histocompatibility Antigens in Cancer” (M. M. Bortin and R. L. Truitt, eds.), pp. 64-67. Grune & Stratton, New York. Schmidt, W., Henseling, U., Bevec, D., Alonzo, A. D. R., and Festenstein, H. (1985). Ztnmunogenetics 22, 483-494. Schneider, N. R . , Williams, W. R., and Chaganti, R . S. K. (1986).Adv. Cancer Res. 47, 1-36. Schrader, J. W., Cunningham, B. A., and Edelman, G. M. (1975). Proc. Natl. Acad. Sci. LISA 72, 5W-5070. Schreiber, A. B., Schlessinger, J., and Edidin, M. (1984).J . Cell Biol. 98, 725-731. Schrier, P. I . , Bernards, R., Vaessen, R. T. M. J., Houweling, A , , and van der Eb, A. (1983). Nature (London) 305, 771-775. Schwartz, D. C., and Cantor, C. R. (1984). Cell 3, 67-75. Seizinger, B. R . , Maruza, R. L., and Gusella, J. F. (1986). Nature (London) 322, 644-647. Senik, A,, and Neauport-Sautes, C. (1979).J . lrnrnunol. 122, 1461-1467. Shapiro, 1. R . , and Kirschbaum, A. (1951). Cancer Res. 11, 644-647. Sharrow, S . , Flaherty, L., and Sachs, D. H. (1984).J . Exp. Med. 159, 21-40. Shimkin, M . B. (1940). Arch. Pathul. 29, 229-238. Shimkin, M . B., and Stoner, G. D. (1975). Ado. Can. Res. 21, 1-58. Shimkin, M. B., Sasaki, T., McDonough, M., Baserga, R., Thatcher, D., and Wieder, R . (1969). Cancer Res. 29, 994-998. Shreffler, D. C . (1976). Transplant. Rev. 32, 140-167. Silverberg, E., and Lubera, J. (1986). CA-Cancer J. Clin. 36, 9-16. Singer, D. S., Hare, J., Golding, H., Flaherty, L., and Rudikoff, S . (1988).lrnrnunogenetics 28, 13-21. Slaga, T. J. (1980). In “Carcinogenesis” (T. J. Slaga, ed.), pp. 111-126. Raven, New York. Slaga, T. J . (1983). Environ. Health Perspect. 50, 3-14. Slaga, T. J . , and Fischer, S. M. (1983). Prog. E x p . Tumor Res. 26, 85-109. Smith, B. T. (1979). Science 204, 1094-1095.
178
P. DEMANT ET AL.
Smith, B. T. (1984). In “Pulmonary Surfactant” (B. Robertson, L. M. G . van Golde, and J. J. Batenburg, eds.), pp. 357-381. Elsevier, Amsterdam. Smith, B. T., and Sabry, K. (1983). Proc. Natl. Acad. Sci. USA 80, 1951-1954. Smith, B. T., and Zinman, H. M. (1982). Pediatr. Res. 16, 117. Smith, G . S . , and Walford, R. L. (1978). Birth Defects 14, 281-312. Smith, G . S . . Walford, R. L., and Mickey, M. R. (1973).J . Natl. Cancer Inst. 50, 1195-1213. Snell, G . D. (1958).J . Natl. Cancer Inst. 21, 843-877. Solomon, E., Voss, R., Hall, V., Bodmer, W. F., Jass, J. R . , Jeffreys, A. J., Lucibello, F. C., et al. (1987). Nature (London) 328, 616-619. Stavenhagen, J., Loreni, F., Hemenway, C., Kalff, M., and Robins, D. M . (1987). Mol. Cell. B i d . 7, 1716-1724. Stern, P. L., Beresford, N., Bell, S. M., Thomson, S., Jones, K., and Mellor, A. (1986). J . Immunogenet. 13, 133-140. Stewart, H. L. (1959). In “Physiopathology of Cancer” (F. Homburger, ed.), pp. 18-38. Harper, New York. Stiernberg, J., Low, M. G . , Flaherty, L., and Kinkade, P.W. (1987).J. Zmmunol. 38, 38773884. Stowers, S . J., Glover, P. L., Reynolds, S. H., Boonen, L. R.,Maronpot, R. R., andAnderson, M. W. (1987). Cancer Res. 47, 3212-3219. Stutman, 0. (1974). Science 183, 534-536. Sutton, V. R., Hogarth, P. M., and McKenzie, I. F. C. (1983).J . Zmmunol. 131, 1363-1367. Takahashi, S., Fukuoka, Y., Moriwaki, K., Okuda, T., Tachibani, T., Natsuume-Sakai, S., and Takahashi, M. (1984). lmmunogenetics 19, 493-501. Tanaka, K., Isselbacher, K. J . , Khoury, G . , and Jay, G . (1985). Science 228, 26-30. Taylor, B. A. (1978). In “Origins of Inbred Mice” (H. C. Morse, ed.), pp. 423-438. Academic Press, New York. Taylor, B. A. (1980). In “Genetic Control of Natural Resistance to Infection and Malignancy” (E. Skamene, P. A. L. Kougsharb, and M. Landy, eds.), pp. 1-8. Academic Press, New York. Temin, H. M. (1988). Cancer Res. 48, 1697-1701. Thaete, L. G., Beer, D. G., and Malkinson, A. M. (1986). Cancer Res. 46, 5335-5338. Thoday, J. M . (1961). Nature (London) 191, 368-370. Topal, M. D. (1988). Carcinogenesis 9, 5, 691-696. Torday, J . S. (1975). Biochim. Biophys. Acta 835, 23-28. Torday, J. S . , and Nielsen, H. C. (1987). E x p . Lung Res. 12, 1-19. Torday, J. S . , Post, M., and Smith, B. T. (1985). Am. J . Physiol. 249, 173-176. Townsend, A. R. M., Rothbard, J., Gotch, F. M., Bahadur, D., Wraith, D., and McMichael, W. J. (1986). Cell 44, 959-968. Trentin, J. J., and Gardner, W. U. (1958). Cancer Res. 18, 110-112. Tsai, M. Y., Josephson, M. W., and Brown, D. M. (1981). Biochim. Biophys. Acta 664, 174181. Tsuge, I., Shen, F. W., Steinmetz, M., and Boyse, E. A. (1987). Immunogenetics26,378-380. Tyzzer, E. E. (1907).J . Med. Res. 17, 199-211. van de Meugheuvel, W., van Seventer, G . , and Demant, P. (1985).J . Immunol. 134, 25072512. van der Gugten, A. A., Roepcke, G., van Nie, R., and Hilgers, J. (1985). Cancer Res. 45,34483453. van der Valk, M. A. (1981). In “Mammary Tumors in the Mouse” 0.Hilgers and M. Sluyser, eds.), pp. 46-115. Elsevier/North-Holland, Amsterdam.
GENETICS OF TUMOR SUSCEPTIBILITY IN THE MOUSE
179
Varmus, H. E. (1987).Science 236, 1337-1339. Vasmel, W. L. E., Zijlstra, M., Radaszkiewicz, T., Leupers, C. J. M., de Goede, R. E. Y.. and Melief, C. J. M. (1988).J. Virol. 62, 3156-3166. Vlug, A., Schoenrnakers, H. J., and Melief, C. J. M. (1981).J. Immunol. 126, 2355-2360. Vogel, J. M., Cranmer Davis, A . , McKinney, D. M., McMillan, M., Martin, V. J., and Goodenow, R. S. (1988).J. E r p . Med. 168, 1781-1800. Wallich, R., Bulbuc, N., Haemmerling, G. J . , Katzav, S., Segal, S., and Feldrnan, M. (1985). Nature (London) 315, 301-305. Warner, C. M . , Gallnick, S. 0.. Flaherty, L., and Goldband, S. B. (1987).Biol. Reprod. 36, 611-616. Weiss, E. H., Golden, L., Fahrner, K., Mellor, A., Devlin, J. J., Bullman, H., Tiddens, H., et ol. (1984).Nature (London) 310, 650-655. Wheldrake, J. F., Marshall, J., Ramli, J., and Murray, A. W. (1982).Carcinogenesis 3, 805807. White, P. C.,Chaplin, D. D., Weiss, J. H., Dupont, B., New, M. I., and Seidman, J. 6. (1984a).Nature (London) 312, 465-467. White, P. C., New, M. J., and Dupont, B. (1984b).Proc. Natl. Acad. Sci. LISA 81,7505-7509. Whyte, P., Buchkovich, K. J . , Horowitz, J. M . , Friend, S. H., Raybuck, M., Weinberg, R. A,, and Harlow, E. (1988).Nature (London) 134, 124-129. Widera, G., and Flavell, R. A. (1984).EMBOJ. 3, 1221-1225. Wilson, 8. S., Indiveri, F., Pellegrino, M. A , , and Ferrone, S. (1979).J . E x p . Med. 149,658668. Winchester, R. J., and Kunkel, H. G . (1980).Ado. Zmmunol. 28, 221. Winoto, A., Steinmetz, M., and Hood, L. (1983).Proc. Natl. Acad. Sci. USA 80, 3425-3429. Witschi, H. P. (1985).In “Cancer of the Respiratory Tract: Predisposing Factors” (M. J. Mass, J. M. Siegfried, V. E. Steele, and S. Nesnow, eds.), Carcinogenesis, Vol. 8,pp. 147-158. Raven, New York. Zarling, D. A , , Keshet, I., Watson, A., and Bach, F. H. (1978).Scand. J. Zmmunol.8,497-508. Zielinski, C. C., Waters, D. L., Datta, S. K., and Waksal, S. D. (1981).Cell. Immunol. 59, 355-366. Zijlstra, M . , and Melief, C. J. M. (1986).Biochim. Biophys. Acta 865, 197-231. Zijlstra, M., d e Goede, R. E. Y., Schoenmakers, H., Radaszkiewicz, T., and Melief, C. J. M. (1984).Virology 139, 198-211.
This Page Intentionally Left Blank
PERSPECTIVES ON THE ROLE OF MHC ANTIGENS IN NORMAL AND MALIGNANT CELL DEVELOPMENT Bruce E. Elliott,* Douglas A. Carlow,t Anna-Marie Rodricks,* and Andrew Wade5 'Division of Cancer Research. Department of Pathology, Queen's University. Kingston. Ontario, Canada. K7L 3N6 tMounf Sinai Hospital Research Institute, Toronto, Ontario, Canada M5G 1X5 +Department of Oncology Research. Toronto General Hospital, Toronto. Ontario, Canada, M5G 2C4 SMlR Office, Faculty of Medicine, University of Calgary, Calgary, Alberta, Canada, T2N 1N4
I. Introduction 11. Basis of Tumor Immunology
A. Immunosurveillance Theory of Cancer: Current Concepts B. The Nature of Tumor Rejection Antigens 111. The Biology of M H C A. The MHC Gene Family B. Expression of MHC in Normal Tissue IV. MHC Function A. The MHC-Antigen-T-cell Interaction B. T-cell Adhesion Molecules (CAM) C. Nonimmunological Role of MHC V. MHC Expression in Malignancy A. Clinical Cancer B. Animal Tumor Models VI. Evidence for a Role of M H C Antigens in Malignancy A. Influence of Oncogenes and Oncogenic Viruses B. Gene Transfection Strategies VII. Proposed Function of M H C in Malignancy A. Transplantation Studies and Relevance to MHC and Cancer B. Role of MHC in NK Recognition and Natural Resistance VIII. Regulation of Altered Class I MHC Expression in Malignancy A. General Features of M H C Gene Regulation B. Regulation of Class I M H C in Malignancy IX. Organ- and Tissue-Specific Effects on Immune Surveillance and Tumor Progression A. Compartmentalization of the Immune System B. Influence of Tissue Site on Tumor Growth and Metastasis: Implications for Studies on Tumor Immunogenicity X. Concluding Remarks References
I. Introduction
Over the past decade, the concept that increased expression of class I major histocompatibility complex (M HC)' antigens facilitates T-cell immune 'Abbreviations: Ad, adenovirus; APC, antigen-presenting cell; P2m, &-microglobulin; BL, Burkitt's lymphoma; CAT, chlorainphenacol acetyltransferase; Con A, concanavalin A; EBV,
ADVANCES IN CANCER RESEARCH. VOL. 53
Copyright 0 1989 by Academic Prcss, lac. All riehtr or rmroduction in anv form N W N
~
182
B R U C E E. ELLIOTT ET AL.
defense against cancer has received much attention and some significant support. Another recent development is that in certain tumor systems (e.g., lymphomas and melanomas), augmented expression of class I MHC antigens appears to be associated with increased growth and metastasis, and acquired resistance to natural killer (NK) cells. Depending on the tumor system, augmentation of class I MHC expression could facilitate, compromise, or be of no consequence in progressive malignant disease. The purpose of the present article is (a) to provide an update on the basic properties of MHC biology and function, (b) to review the controversial literature on the involvement of MHC in host antitumor defense, (c)to discuss possible mechanisms of MHC regulation in normal and malignant cells, and (d) to present a new perspective, namely the influence of tissue microenvironment and of tissue-specific lymphocyte migration on host-tumor immune interactions. There are many extensive reviews on the role of class I MHC antigens in malignancy (Doherty et al., 1984; Festenstein and Labeta, 1987; Linsk and Goodenow, 1986; Vogel et d., 1987; Tanaka et al., 1988b; Hammerling et al., 1987a,b). It is our intention in this article to examine those properties of MHC molecules in normal cells that may be relevant to malignancy, to raise important questions for future study, and to emphasize a cautious approach in extrapolating to human malignancies. II. Basis of Tumor Immunology
Two critical issues in tumor immunology have remained controversial despite extensive investigation. The first contention is that immunosurveillance is an active process in defense against cancer, and the second is that tumor-specific antigens exist. Since current views on the putative role of MHC in malignancy are influenced by our understanding of these issues, they are briefly reviewed here.
A. IMMUNOSURVEILLANCE THEORY OF CANCER: CURRENT CONCEPTS Since the demonstration by Gorer (1938) that genes encoding major transplantation antigens control susceptibility to tumor transplants, most tumor transplantation studies were carried out in syngeneic systems. Initially, the use of chemically or virally induced tumors predominated (Gross, 1943; Old Epstein-Barr virus; IL, interleukin; IFN, interferon; LGL, large granular leukocyte; LAK, lyniphokine-activated killers; MC, methylcholanthrene; MHC, major histocompatibility c o n plex; mHA, minor histocompatibility antigen; MNNG, N‘-methyl-”-nitro N-nitrosoguanidille; MuMTV, murine mammary tumor virus; NK, natural killers; PKC, protein kinase C; SV40, simian virus 40; Tc, cytotoxic T lymphocyte; Th, helper T lymphocyte; TPA, 12-0tetradecanoylphorhol-13-acetate;UV, ultraviolet.
MHC
ANTIGENS IN NORMAL AND MALIGNANT DEVELOPMENT
183
and Boyse, 1964; Klein, 1973). These tumor systems, against which strong immunity in syngeneic hosts could be demonstrated (Hellstrom and Hellstrom, 1969), formed the context in which the immunosurveillance theory of cancer developed. The theory states that malignancies express foreign determinants that can be potential targets of the immune system (Burnet, 1964). However, there are two main criticisms of the immunosurveillance theory. The first criticism concerns the existence of tumor-specific antigens in human malignancy. The roots of serious skepticism arose with reports of Foley (1953), and Prehn (1975), that animal tumors arising spontaneously (i.e., in the absence of known carcinogens) did not display detectable immunogenicity. In addition, it was shown by Stutman (1981) and Parker et al. (1982) that athymic nulnu mice and normal nu/+ littermates develop spontaneous tumors at similar frequencies. The height of skepticism was expressed by Hewitt et al. (1976), who were the first to elaborate in detail on this theme, publishing a series of studies showing that spontaneously arising tumors when transplanted into syngeneic hosts elicited no detectable immunity. In this study, inbred mice from the same colony in which the tumor arose were used, to avoid genetic drift (Bailey, 1982). On the basis of these findings, Hewitt argued that such spontaneously arising tumors “are the only appropriate models of human cancer.” Epidemiological evidence clearly shows that the majority of human cancers are induced by physical and chemical carcinogens (Doll, 1980). Because transplantation experiments cannot be done in humans, it is not known whether human tumors express tumor-specific antigens analogous to experimentally induced animal tumors. Moreover, it is not clear at present how spontaneous animal tumors relate to human malignancy. The second criticism concerns the immunopotentiation of autologous tumor growth during carcinogenesis in v i m . Prehn (1977) pointed out that certain types of immunostimulation could result in reduced latency and enhanced tumor growth, a finding not predicted by the immunosurveillance theory. Indeed, a correlative analysis revealed that tumors with higher immunogenicity often had shorter latencies (Prehn and Bartlett, 1987). Two mechanisms have been proposed to explain this phenomenon. Helper T cell (Th) subsets may be stimulated by the tumor, followed by local release of growth-promoting lymphokines, or certain antigenic epitopes on tumors might stimulate immunosuppression or tolerance in tumor-bearing hosts. Thus, immune responses if elicited are not necessarily detrimental to the development of a neoplasm. Animal systems that have received much interest as possible models of certain human malignancies include ultraviolet-induced fibrosarcomas (Hostetler and Kripkie, 1988), and viral-induced leukemias [e.g., radiation leukemia virus (Meruelo, 1979) and Simian virus 40 (SV40) (Pan et al.,
184
BRUCE E. ELLIOlT ET AL.
1987)l. The antigens expressed on such tumors may be representative of corresponding human malignancies such as melanomas (Mukherji and MacAlister, 1983) and human T-cell lymphotropic virus type I (HTLV-1)associated T-cell leukemias (Stoolman and Rosen, 1983; Levine et a l . , 1988), respectively. Immunosurveillance against such tumors is likely to occur, but the final outcome may depend on the nature of the immune response elicited, and the ability of the tumor to generate variants resistant to immunological restraint (Boon, 1983; Urban et al., 1982; Dennis et al., 1981). In summary, the views on immunosurveillance in cancer remain highly polarized and, over time, the consensus of opinion has swung several times from one extreme to another. The possibility that non-T mechanisms such as NK cells (see Section VII,B) are involved has further complicated the issue. Nevertheless, certain experimentally induced animal tumor systems have proved useful for studies on tumor rejection antigens.
B. THE NATUREOF TUMOR REJECTIONANTIGENS In contrast to the MHC-encoded transplantation antigens, the molecular identification of tumor-specific rejection antigens has eluded most biochemical and genetic analyses. Essentially every putative tumor-specific antigen described in human or animal malignancies was found to be expressed on normal adult or fetal tissue (Old, 1981).There is no evidence that any of these antigens can be effectively targeted by the immune system. Three candidates for the elusive tumor-specific molecules have been described in experimentally induced animal tumor systems (Srivastava and Old, 1988; Schreiber et al., 1988; De Plaen et al., 1988). Preliminary molecular characterization of these structures has been carried out and is summarized here. One group includes the tumor-specific antigens of chemically induced rodent tumors (Srivastava and Old, 1988). An important feature of these antigens is their extensive diversity. In a series of 25 independently derived tumors, no cross-reactivity was found (Basombrio, 1970); two or more sarcomas induced in the same mouse, or induced by different carcinogens, have been suggested to have distinct antigens (Basombrio, 1970; Globerson and Feldman, 1964). Studies by Srivastava and Old (1988) have led to the proposal that this class of polymorphic tumor rejection antigens belongs to a family of surface glycoproteins, designated gp 96. The gp 96 proteins represent a family of molecules encoded by a single gene that is located on chromosome 10 (mouse) (P. K. Srivastava, M. Kozak, and L. J. Old, unpublished observations) and is expressed in both malignant and normal tissue. These molecules can be isolated from carcinogen-induced tumors and appear to carry immunodominant determinants (Srivastava et a l . , 1987).
MHC
ANTIGENS I N NORMAL AND MALIGNANT DEVELOPMENT
185
Partial sequence analysis has revealed no tumor-specific nucleotide polymorphisms, although modifications in the amino acid sequence of restricted regions of the molecule have not been excluded. Further work is necessary to resolve the polymorphisms at the molecular level and to prove, using gene transfection strategies, that g p 96 molecules can confer tumor antigenicityhmmunogenicity . A second type of murine tumor rejection antigen includes those induced by mutagenesis in an already malignant cell. This process, known as tumor xenogenization, results in the induction of immunogenic variants bearing unique antigens capable of stimulating a strong cytolytic T-cell response (Wolfel et al., 1987). One such antigen, called P91A glycoprotein, has been characterized by D e Plaen et al. (1988). This molecule carries antigenic determinants induced by N’-methyl-N’-nitro-N-nitrosoguanidine (MNNG) and has been partially characterized on immunogenic variants of the mastocytoma P815 (Wolfel et al., 1987). The gene encoding P91A has been transfected into the parental P815 tumor and shown to confer immunogenicity and susceptibility to cytotoxic T lymphocytes (Tc). The P91A gene lacks homology with any known gene, and its nucleotide sequence differs from the wild-type gene in untreated tumor cells by a single nucleotide. These results clearly show that point mutations induced by certain mutagens can lead to the expression of novel antigens on tumor cells. Whether the P91 antigen is related to gp 96 antigens, which are found on already-established tumors that have not undergone subsequent mutagen treatment, remains unresolved. Nevertheless, both the P91 and gp 96 antigen systems provide an interesting approach to examine the molecular interactions that can determine tumor immunogenicity. A third antigen system that has received much attention is the ultravioletinduced sarcoma antigens (Schreiber et al., 1988). A detailed molecular analysis of one such tumor antigen, 1591, has illustrated the difficulties in the tumor antigen field. After extensive investigation, it was found that the 1591 tumor expressed three novel MHC class I molecules (Stauss et al., 1986), in addition to the two normal k haplotype MHC class I molecules (Philipps et al., 1985). These results suggested that new MHC-like molecules were generated in the process of ultraviolet-induced transformation. Unexpectedly, the genes encoding two of the molecules, 149 and 166, were 100% homologous in their encoding regions to L4 and D4 (Linsk et aE., 1986; Lee et al., 1988). The third molecule, 216, was clearly distinct from K 4 (G. Jay, personal communication), and no strain carrying the 216 gene has yet been identified. This finding raises the possibility that the 149 and 216 genes were not the result of mutational changes during tumorigenesis but represented allogeneic class I genes derived from residual heterozygosity (Bailey, 1982), or from genetic contamination of the C3H animal that gave rise to the
186
BRUCE E. ELLIOTT ET AL.
1591 tumor. Previous analyses suggested that genetic drift or genetic contamination of the present-day C3H strain in which 1591 was induced was unlikely in that (a) eight other tumor induced in the same experiment and in the same group of mice did not express these antigens, (b) seven polymorphic isoenzymes showed the typical C3H strain-specific pattern in the 1591 tumor, (c) the tumor expressed all known Kk- and Dk-specific epitopes, and (d) the novel antigens were expressed on both 1591 tumor cells from the first transplant generation and solid 1591 tumors that had never been passaged in uitro (Philipps et al., 1985). Because no DNA from autochthonous nonmalignant tissues was available, a direct comparison of the three novel 1591 genes with DNA from normal tissue of the animal bearing the original tumor was not possible (Schreiber et al., 1988). This study underlies the importance of comparing putative tumor antigen genes with control DNA from the host of tumor origin. A key question in animal tumor systems is whether a gene encoding a particular tumor antigen is the result of somatic mutation or is already present on normal cells of the animal from which the tumor was isolated originally. An answer to this question may provide important insight into the nature of putative tumor-specific antigens in human malignancy. Ill. The Biology of MHC
While scientists have been struggling with the identity of tumor rejection antigens, class I MHC molecules have received increasing attention as the self-component of the antigen-MHC complex recognized by T cells. A brief review of the basic biology of MHC molecules relevant to cancer is now presented.
A. THE MHC GENEFAMILY The MHC is a multigene family, -3000 kb in size, located on chromosome 17 in the mouse (Steinmetz and Hood, 1983; Flavell et a l . , 1986) and chromosome 6 in humans (Wake, 1986;Trowsdale, 1987). Given the scope of this review, only the salient features of class I MHC gene organization are discussed. [See Maziarz et al. (1988) and Koller et al. (1987, 1988) for more extensive reviews.] In the mouse, the MHC consists of 25-35 class I loci, depending on the mouse strain, grouped into four regions, designated H - 2 K , H - 2 D , Qa, and Tla. The organization of the human MHC genes bears many similarities to mouse (Fig. 1). At least 17 HLA loci have been identified, including HLA-A, -B, and -C (Koller et al., 1987) analogous to H - 2 K , -Dand -L in mouse. In addition, several nonclassical class I HLA genes similar to the murine Qa-Tla genes have also been identified, three of which have
MHC
ANTIGENS IN NORMAL AND MALIGNANT DEVELOPMENT CLASS 111
CLASS I1 I
DP -
DX Bd
1
DR BBBBa
-
187
CLASS I I
BC
II
E
A
I
I I
CLASS I
FIG.1. Organization of the genes in the human (HLA) and mouse (H-2) MHC. Each box represents a single locus. Expressed and nonexpressed genes are indicated by closed and open symbols, respectively. The number of loci in each region depends on the haplotype. A number of class I genes downstream from HLA-A have been recently described. Homologous genes in the mouse are indicated by dashed lines. The H-2 map shown here represents the BALB/c (H-29 haplotype (Steinmetz et al., 1981). In contrast, C3H ( H - 2 k ) and B10 (H-2b) haplotypes have only one gene at the D region and no L gene. The Tla region consists of only 10 genes in the B10 haplotype and is completely deleted in the C3H haplotype (Mellor et 01.. 1984; R. Goodenow, personal communication).
been shown to be expressed (Koller et al., 1987, 1988; Shimizu et al., 1988; Geraghty et al., 1987). Class I MHC genes encode a 45-kDa glycoprotein that is noncovalently linked to P,-microglobulin (P2m), a 12-kDa peptide encoded by genes on chromosome 2 in mouse and chromosome 12 in humans. Analysis of the gene sequences from mice of the H-2* (Kvist et al., 1983; Lalanne et al., 1983), H-2b (Weiss et al., 1983), and H-2k (Arnold et al., 1984; Watts et al., 1987) haplotypes indicates a fairly high conservation of primary sequence within both introns and exons (Steinmetz et al., 1981; Weiss et al., 1984; Lalanne et al., 1988). Data from both human and mouse systems have shown that class I genes consist of eight exons that encode a leader sequence, three extracellular domains (al, az,a3),a transmembrane domain, and three cytoplasmic domains (Malissen et al., 1982; Hood et al., 1983; Koller et al., 1987). There are some exceptions to this general organization, particularly with certain nonclassical genes. For example, QlO lacks a trans-
188
B R U C E E. ELLIOTT ET AL.
membrane domain (Cosman et al., 1982), and HLA-6.0 lacks the cytoplasmic domain (Geraghty et al., 1987). An important feature of the MHC gene family is the wide range of allelic polymorphisms at various MHC loci (Hunkapiller and Hood, 1986). In the mouse, -50 class I K, D , and L alleles have been identified (Hood et al., 1983). A similar range of MHC polymorphisms has been described in the HLA-A, -B,and -C, genes (Parham et a l . , 1988b; Parham, 1987). In contrast, the Qa and Tla regions show very little polymorphism. Analysis of nucleotide sequence has shown that alleles can differ by one to >lo0 substitutions and the antigenic differences are equally variable (Parham et al., 1988a). In the class I genes, the variable regions have similar locations in various alleles of the same locus within and between species. For example, HLA-A alleles (e.g., A l , A3.1, A3.2, A l l ) have closer homology to chimpanzee ChLA-A locus alleles such as Ch25, than with the HLA-B or HLA-C alleles (Lawlor et al., 1988). Similarly, HLA-B has closer homology to ChLAB , and HLA-C, to ChLA-C. At the level of amino acid sequence, distinct variable regions of MHC class I molecules are located in the cil and ci2 domains, whereas the cig domain remains highly conserved (Parham et al., 1988a). The variabilities observed relate to point substitutions and recombinational events in the corresponding genes. Analysis of HLA-A, -B,and -C genes indicate that genetic exchange between alleles of the same locus has contributed more to the generation of diversity than genetic exchange events between alleles at different loci (Parham et al., 1988a,b). However the role of exchange events between genes at different loci could also occur, as has been hypothesized for shared residues between the H-2K" gene and certain Qa-Tla genes (Nathenson et al., 1986). The latter mechanism does not appear to have major impact in generating HLA-A, -B, and -C diversities. Major histocompatibility complex polymorphisms have provided a basis for our understanding of the molecular nature of immunological (i.e., MHCantigen interactions) and nonimmunological functions of MHC molecules (see Section IV).
B. EXPRESSION OF MHC
IN
NORMALTISSUE
In order to assess whether MHC antigens are abnormally expressed during malignancy, an understanding of the patterns of MHC antigen expression during ontogeny, in normal tissue, and during normal cell development is essential. 1. Tissue Distribution
Class I MHC antigens are expressed on virtually all adult tissues, though at varying levels (Klein, 1975). The organ with the highest MHC antigen
MHC
ANTIGENS I N NORMAL A N D MALIGNANT DEVELOPMENT
189
expression is the spleen, followed by other lymphoid organs. The lowest expression is on muscle and nervous tissue. Liver MHC antigen expression is primarily associated with Kupffer cells and, to a much lesser degree, with parenchymal cells. The primary distribution of “classical” class I MHC antigens in the gut, glands, lung, and kidney is on epithelial-derived cells. In addition, vascular endothelial cells also express MHC antigens. In contrast to class I MHC molecules, class I1 molecules exhibit a more restricted tissue distribution mainly on B cells, some T cells, and specialized antigen-presenting cells (APC; Klein, 1975). Most tissues exhibit augmentation of both class I and class I1 MHC antigens in response to various lymphokines, including a-and y-interferon (IFNa, IFNy) and certain growth factors (Collins et al., 1984). Allograft rejection and graft-versus-host disease can also trigger expression of class I and class I1 MHC antigens in various tissues, for example, skin and kidney (de Waal et al., 1983; Wadgymar et al., 1984). Since many epithelial, endothelial, and lymphoreticular cell subsets have antigen-presenting function (Kaye et al., 1985; Tzehoval et al., 1983), these cell types could facilitate local presentation of antigens, lymphocyte triggering, and homing. In addition to the tissue-specific pattern of class I and class I1 MHC expression, there are also quantitative differences in the pattern of locusspecific gene products expressed. In the mouse, the H-2K gene product is generally expressed at higher levels than H-2D or -L gene products, as a result of subtle differences in the biosynthetic pathways (Le and Doyle, 1982) (see Section VIII). Class I1 molecules (DR, DP, and DQ in the human), though expressed on all normal or Epstein-Barr virus (EBV)-induced B-cell lines, exhibit noncoordinate patterns of expression in certain nonlymphoreticular tissues (e.g., gastric epithelial cells, lung bronchiole epithelium, and melanocytes; Natali et al., 1986; Rognum et al., 1987; Sakai et al., 1987). In some cases, DP-, DQ-, or DR-negative cells can express increased levels of class I1 antigens following IFNy treatment (Collins et al., 1984). The noncoordinate expression of class I and class I1 MHC molecules on certain cell subtypes could significantly influence the antigen-presenting potential of these cells.
2 . Ontogeny In contrast to adult tissue, class I MHC antigens are not expressed during early stages of embryogenesis [i.e., before day 2 (P2m) or day 10 (class I MHC)] in the mouse (Ozato et al., 1985; Flavell et al., 1986). For this reason, class I MHC expression is considered to be developmentally regulated (see later). During this period the intact embryo is still responsive to IFN treatment (Ozato et al., 1985). However, MHC genes isolated from teratocarcinomas, which lack MHC antigens, are expressed after transfection into L cells, confirming that the genes are functional (Holmes and
190
BRUCE E. ELLIOTT ET AL.
Parham, 1985). Lala and colleagues (1983a,b) have carefully examined histologically the distribution of class I MHC antigens in the early embryo using a sensitive radioimmunoassay. They reported that the first tissues to exhibit detectable class I MHC antigens were late morulae and early blastocytes. However, at the late-blastocyte stage MHC antigens are no longer detectable. This stage-specific loss or masking of MHC antigens corresponds to the time of implantation, providing a possible explanation for the lack of immunogenicity of the semiallogenic conceptus (Lala et al., 1983b). By day 10 of gestation, fetal MHC antigens are again detectable in the spongiotrophoblast, which forms the outer layer of the placenta, closest to the uterine wall. The labyrinth that forms the inner layer remains negative (Raghupathy et al., 1983). Injection of monoclonal antibodies against class I MHC antigens (Chatterjee-Hasrouni and Lala, 1982) has localized fetal MHC determinants in direct contact with the maternal spinal arteries. Thus class I MHC antigens are clearly expressed in early embryos at or near the fetal-maternal interface. The expression of “nonclassical” class I MHC mRNAs by Northern blotting with probes that can identify exons encoding the transmembrane domain of different class I antigens has been examined (Wegmann, 1987; Hunzinger, 1987).By this approach, certain fetal Tla gene products, including T1 (and/or T l l ) , T3 (and/or T13), and T7,were observed in 10-day to 14day placentas. Further studies are required to determine which mRNA species are translated and expressed on the cell surface, and what cell types are involved. A different nonclassical MHC gene, the QlO MHC molecule, is produced by the visceral endoderm (as early as 10 days gestation) (Stein et al., 1986), and by adult liver cells (Mellor et al., 1984). Because the QlO gene lacks a transmembrane domain, its product is secreted. The function of the T1, T3, T7, and QlO molecules is unknown. Some investigators have proposed that they may be involved in immune suppression in the region of the maternal-fetal barrier (Lala et al., 1983b; Clark et al., 1986). The ontogeny studies raise the question whether aberrant expression of nonclassical class I mRNA species occurs during malignancy, and may provide a possible insight into the mechanisms of deregulation of MHC expression in tumors.
3. Differentiution and Cell Cycle-Specijlc Expression Although MHC antigens are widely expressed, their cell surface density is highly variable. In general, more differentiated cells within the same lineage tend to express a greater density of MHC antigens. For example, lymphocytes in the medulla of the thymus are less differentiated and tend to express a lower density of MHC antigens than T cells in the cortex of the thymus, which are more differentiated, or in the periphery (Klein, 1975). In certain nonlymphoid systems, such as transitional bladder epithelium, a gradient of
MHC
ANTIGENS I N NORMAL A N D MALIGNANT DEVELOPMENT
191
increasing @,m expression, an indicator of class I surface expression, is observed on more differentiated cells compared to cells in the basal (stem cell) layer (G. Dotsikas, B. E. Elliott, and W. Mackillop, unpublished observations). Although class I MHC is not a definitive marker of differentiation, quantitative changes have been observed to correlate with different stages of maturation in certain cell lineages. It is also possible that class I MHC density is cell cycle-dependent. Studies by Matsui et al. (1986b) have indicated that class I MHC antigen expression on phytohemagglutinin-activated T cells and antigen-activated Tcell clones increases in GI phase and decreased in G,, whereas class I1 antigen density increases in G, (Matsui et al., 1986a,b). These researchers were the first to express the changes in terms of surface antigen density, using a flow cytometry approach, not influenced by synchrony induction methods or fixation. These findings are consistent with reports that tumor target cells are often more sensitive to T-cell-specific lysis in G , than in G, phases (Leneva and Svet-Moldavsky, 1974). Since cells at different stages of maturation have distinct cell cycle characteristics, differentiation-associated changes in MHC expression could also be cell cycle-related. IV. MHC Function
Although the most clearly understood function of class I MHC molecules is as a self-component recognized by MHC-restricted T cells, nonimmunological roles have also been proposed. Both concepts are briefly reviewed in this section to provide a basis for later discussions on MHC function in malignancy (Section VII).
A. THE MHC-ANTIGEN-T-CELLINTERACTION
The question of what portion of the MHC molecule determines its association with antigen is important in understanding the nature of T-cell recognition of tumor-associated antigens as well as escape of tumor cells from the immune system. Molecular analysis of MHC structure-function relationships were first carried out in allogeneic systems. Experiments involving hybrid molecules created by exon exchange between intraspecies class I genomic clones demonstrated that the two external domains of the class I molecule, aland a,, contain the polymorphic determinants recognized by most allospecific T-cell clones (Stroynowski et al., 1985; Arnold et a l . , 1985; Ajitkumar et a l . , 1988). The highly conserved a3 domain does not directly interact with antigen or the T-cell receptor. Exon-shuffling experiments in which murine a1and a2 domains are linked to the human a3 domain have shown that ag can influence recognition of antigenic determinants located
192
BRUCE E. ELLIOTT ET AL.
within a land a2 domains (Maziarz et at., 1988). Using X-ray crystallography, Bjorkman et al. (1988) have shown that antigenic peptides bind to a cleft between the a1and a2 domains. Analogous approaches are likely to be very informative in determining the molecular nature of the epitopes of the M HC-antigen complex on tumor cells recognized by the T-cell immune system. B. T-CELLADHESION MOLECULES (CAM) In addition to MHC-antigen and T-cell receptor interactions, new evidence has shown molecules such as CD2, CD4, and CD8 on T-cell subsets appear to function as CAM in the binding of antigen-specific T cells to target antigen-bearing cells (Bierer and Burakoff, 1988; Bierer et al., 1988). These workers have demonstrated interactions between CD8 and the a3 domain of class I (Ratnofsky et al., 1987), CD4 and class I1 (Sleckman et al., 1987), and CD2 and LFA-3 (Bierer et al., 1989). In addition, LFA-1 was shown to interact with I-CAM-1 (Marlin and Springer, 1987). The general approach (for CD2, CD4, and CD8 molecules) was to transfect genes encoding each “receptor” into T-cell hybridomas, and to test for binding to purified ligand incorporated into liposomes and enhancement of an antigen-specific response, interleukin 2 (IL-2) secretion (Bierer and Burakoff, 1988). The possibility that the class I-CD8 reaction can occur on non-T cells was demonstrated by Norment et al. (1988). These workers showed direct binding of human CD8 molecules in transfected Chinese hamster ovary cells to class I MHC molecules on human B cells. Binding was proportional to the amount of CD8 expressed, and was specifically inhibited with anti-CD8 and anticlass I MHC monoclonal antibodies. These results confirm that CD8 can interact with class I MHC molecules independent of the T-cell receptor. The antigen-independent adhesion reactions described here could facilitate subsequent antigen-specific recognition events in low-affinity, low-avidity receptor-target interactions, as might occur in certain malignancies. C. NONIMMUNOLOGICAL ROLE
OF
MHC
In addition to the immunological role of MHC molecules just described, it is also possible that MHC has nonimmunological functions. Two such putative roles are discussed here. First, it has been proposed that class I MHC antigens are involved as CAM in many cell-cell interactions, similar to those described for CD8 on T cells in Section IV,B (Edidin, 1983, 1986). It has been suggested that MHC molecules may have primitive recognition functions similar to fusion molecules in self-nonself discrimination as is displayed by tunicates (Scofield et al., 1982a,b). This possibility is an area for future investigation.
MHC
ANTIGENS I N NORMAL A N D MALIGNANT DEVELOPMENT
193
Second, there is accumulating evidence that class I MHC molecules might be functionally associated with a variety of peptide hormone receptors, including insulin (Simonsen et al., 1985), glucagon (Edidin, 1986), epidermal growth factor (Schreiber et al., 1984) and y-endorphin (Claas et al., 1986). Two main sources of evidence have been provided to support an association of receptor molecules with class I MHC heavy chains. Coprecipitation of HLA molecules and insulin receptor with and without crosslinking agents has been demonstrated (Phillips et al., 1986). Inhibition of receptor function occurs when receptor-bearing cells are incubated with both ligand and antiHLA antibodies (Schreiber et al., 1984).Although the functional significance of associations of class I MHC molecules with certain surface receptors is not known, it has been proposed that class I molecules might facilitate local concentration of ligand (Edidin, 1988). Barber et al. (1988) have examined the molecular association of class I heavy chains with P2m and other surface structures. They have shown that (1) dissociation of P2m to form “free” class I heavy chains can occur once the cell surface location of class I heavy chains has been attained; (2) dissociation from P2m can result in a conformational change in epitopes on the a1and a2 domains of surface-expressed class I heavy chains; and (3) there are differences in the epitopes expressed on the C-terminus domain of free and p,m-associated class I molecules (detected by antibodies specific for the Cterminal regions). These findings raise the possibility that the altered confirmation of the molecule delivers a signal to the intracellular environment. Barber et al. (1988) and others (Edidin, 1988) have proposed that free class I MHC chains can interact with hormone receptors as well as other self or nonself molecules in a manner similar to the association with P2m, thereby influencing many cellular functions. The formal proof and functional significance of this hypothesis remain to be demonstrated. Although there is no direct evidence that MHC plays a nonimmunological role in malignancy, this possibility offers a new avenue for investigation. V. MHC Expression in Malignancy
Correlative studies on MHC expression in human malignancies are important because they provide a link between experimental studies and clinical relevance. Information from correlative studies has been helpful in the interpretation of results from animal tumor models.
A. CLINICAL CANCER There is now a vast literature describing the expression of HLA-A, -B, -C, and -D antigens in human malignancy (Doherty et al., 1984; Tanaka et al.,
194
BRUCE E. ELLIOTT ET AL.
1988a; Bernards, 1987; Hammerling et al., 1987a,b). However, there are several problems in interpreting the clinical data summarized here. (a) Absolute comparisons among the different reports are difficult because of the nonquantitative, subjective nature of the techniques used. (b) Essentially all studies have involved frozen sections stained by immunofluorescence or iinmunoperoxidase. Frozen sections make histological localization of antigens more difficult than paraffin-embedded tissues, and virtually preclude the possibility of retrospective and follow-up studies of individual cancer cases. S. Ferrone (personal communication) has produced monoclonal antiHLA antibodies that react with fixed tissues; such antibodies are likely to become widely used in this field. (c) With few exceptions, in all the studies reported so far, the class I-specific antibodies used did not distinguish among HLA-A, -B, and -C subregion products. Rees et al. (1988) have used specific antibodies to detect loss of polymorphic A2 and Bw4 antigens in colon carcinoma in patients typed for the respective specificities. In addition, the recent availability of a nonpolymorphic HLA-B-specific antibody (S. Ferrone, personal communication) and of HLA-A, -B, and -C-specific oligonucleotide probes (Davidson et al., 1985) makes it now possible to detect noncoordinate expression of certain class I HLA genes in any haplotype. (d) Finally, because the technique is nonquantitative with sensitivity levels difficult to define, expression of trace levels of MHC antigens could be below the threshold level of detectability, yet might be functionally relevant. Given these limitations, a representative sample of the literature in which identical antibodies (i.e., the HLA framework antibody W6/32, the Pzmspecific antibody BBM1, and the HLA-DR-specific antibody L243) are used is shown in Table I. Analysis of MHC levels on certain tumors has suggested a decreased level of MHC expression compared to normal tissue: examples are infiltrating ductal carcinomas (Natali et al., 1983, 1986), basal cell carcinomas (Turbitt and Mackie, 1981; Holden et al., 1983), and mucinous colorectal carcinomas (van den Ingh et al., 1987). Very few of these data have been analyzed in a statistically rigorous manner. In one study of colorectal carcinoma (Momburg et al., 1986), a significant correlation between loss of class I MHC and degree of dedifferentiation (as assessed by morphology) was found. N o correlation with the stage of tumor progression was observed, and many metastases were found not to be different in their MHC phenotype compared to the primary tumor. In contrast to class I HLA molecules, locus-specific class I1 (DR, DP, DQ) molecules can readily be distinguished by monoclonal antibodies against nonpolymorphic determinants. Certain B-cell lymphomas have been shown to lack at least one of the three HLA-D subregion products. In certain cases, such as colorectal carcinoma (Momburg et al., 1986) and lung carcinoma
MHC
ANTIGENS IN NORMAL AND MALIGNANT DEVELOPMENT
195
TABLE I SUMMARY OF COMPARISONS OF MHC ANTIGENS ON BENIGN AND MALIGNANT HUMAN TISSUES4 Proportion of tumors lacking (N = total number examined) Histological diagnosis
HLA-A, -B, -C
Pem
HLA-DR
Reference6
Breast (carcinoma) Ductal infiltrating Medullary Lobular
53% (58) 0% (7) 78% (9)
22% (32) 0% (7) 20% (5)
73% (52) 0% (7) 67% (9)
1 1 2 1 1-3
Other (tubular, mucoid) Benign mammary lesions Squamous-cell carcinoma Keratoacanthoma Basal cell carcinoma Basal cell papilloma Eccrine porocarcinoma Benign eccrine poroma Colorectal carcinoma Mucinous Nonmucinous Colorectal adenoma Gastric carcinoma Gastric epithelium Bladder carcinoma Bladder urothelium Endometrial carcinoma Endometrium Lung Small-cell lung carcinoma Non-small-cell lung carcinoma Normal lung epithelium Malignant melanoma Normal melanocytes B-Cell lymphoma Burkitt's lymphoma
67%
(6)
0% (16)*
NTc NT NT NT NT NT 75% (8) 0% (lo)* 0% (3) NT NT NT NT 50% (8) 0% (13)* 100% (3) NT NT (3)* NT 28% (36) 0% (8)* 44% (66) ( A l l y 100% (5)* 0%
NT
67%
0% (16)*
50%
(6)
0% (6) 100% (21) 83% (6) 50% (lo)* 100% (5)* 75% (8) 0% (lo)* 0% (3) NT NT 32% (185p 0% (17p NT NT 100% (3) 81% (32) 28% (77) 0% (3)* 0% (log)* 25% (36) NT 89% (26) NT
(6)
0% (16)*
2
NT
4
NT NT NT NT NT
4 4, 5 4
5 5
75% (8) 90% (10) 0% (3) 47% (15) 0% (15) NT NT 75% (8) 0% (13)*
NT NT NT
11 12 12
NT NT 44% (36) 100%
NT NT
6 6, 7<' 6, 7" 8 8 9 9 10 10
(8)
11 12 1, 13 13 14 15, 16
(continued)
196
BRUCE E. ELLIOTT E?’ AL.
TABLE I (Continued) Proportion of tumors lacking
(N = total number examined) Histologicdl diagnosis EBV-transformed B-cell lines Neuroblastoma
HLA-A, -B, -C
Pzm
(5)
0% (6)
80% (10)
90% (10)
0%
HLA-DR 0% NT
(6)
Reference” 15, 16 17
0 Representative published data on the expression of HLA-A, -B, -C or Pem and HLA-DR in frozen tissue sections are summarized. Percentage of total tumors with no detectable marker is indicated. Some tissues were clearly heterogeneous (indicated I)y asterisk). Antibodies used: HLA-A,-B,-C; W6/32 (Barnstable et a / . , 1978); Pzm, BBMl (Brodsky, Bodmer, and Parham, 1979); HLA-DR, L243 (Lampson and Levy, 1979). References: 1. Natali et al. (1983);2. Whitwell et al. (1984);3. Rowe and Beverley (1984);4. Turbitt and Mackie (1981);5. Holden et al. (1983);6 . van den Ingh et a/. (1987);7. Momburg et a!. (1986); 8. Sakai et a / . (1987); 9. G. Dotsikas, 8. Elliott, and W. J. Mackillop (unpublished observations); 10. Ferguson et al. (1985); 11. Doyle et a / . (1985); 12. Funa et (11. (1986); 13. Ruiter et al. (1982); 14. Moller et a / . (1987); 15. Masucci et al. (1987); 16. Torsteinsdottir et a / . (1988); 17. Whelan et al. (1985). NT, Not tested. 1‘ Statistical analysis was carried out. Percentage of tumors with some negative areas (5% were completely negative). f HLA-A11 was expressed 10-fold less on EBV-positive Burkitt’s lymphoma lines than on EBV-transformed lymphoblastoid cell lines.
‘)
(Natali et al., 1986), de novo expression of class I1 MHC antigens was observed. van Vreeswijk et al. (1988) have carried out an extensive study of primary and metastatic melanoma cells. They observed differential expression of DR, DP, and DQ molecules in primary metastatic disease. HLADR and -DP antigens were expressed in a higher percentage of metastatic than of primary melanomas and there was no marked difference in HLA-DQ antigens (van Duinen et al., 1988). These workers examined the relationship between HLA-I/HLA-I1 levels on melanoma tumors and patient survival. They found that prolonged survival correlated with decreased HLA-I1 compared to HLA-I expression, whereas shorter survival time correlated with elevated HLA-I and HLA-I1 expression. In summary, although there are examples of certain changes in MHC expression occurring in some malignancies, there is no general rule about changes associated with malignant transformation of cells, and none of the changes described thus far is specific to the malignant process. Depending on the malignancy and the type of analysis, correlations between MHC expression and malignancy can be direct, inverse, or nonexistent. Since few statistical analyses of the data have been performed, it is unclear at this time whether this type of analysis will have any prognostic or therapeutic value.
MHC
ANTIGENS I N NORMAL AND MALIGNANT DEVELOPMENT
197
B. ANIMALTUMORMODELS As discussed in Section I,B, the etiology of experimental animal tumors may be very important in determining whether MHC expression can influence their immunogenicity. The involvement of class I MHC would be expected to be most profound in those tumors that express targetable antigens and antigen-presenting capacity. A brief review of the commonly used experimental animal tumors and their respective patterns of the MHC expression follows. Most animal tumors studied are established cell lines derived from tumors of diverse etiology. These tumors fall into two main categories: tumors induced by RNA or DNA viruses, and non-viral-induced tumors. RNA tumor viruses, which include RadLV murine mammary tumor virus (MuMTV), and Moloney sarcoma virus, can be transmitted either horizontally by infection of animal hosts, or vertically. Vertically transmitted proviral sequences (e.g., derived from MuMTV) occur at unique insertion sites in the genome in different mouse strains (Callahan et al., 1982; Traina et al., 1981). Activation of endogenous proviral sequences in some strains can be tissue-specific, causing malignant transformation of a restricted cell population (Sonnenberg et al., 1987; for review see Coffin, 1982). Transformation by DNA viruses can also occur, as in adenoviruses (Schrier et al., 1983)and SV40 (Pan et al., 1987). Virally induced tumors represent clear models of carcinogenesis, and usually express viral-associated surface antigens. Nonviral tumors include tumors induced experimentally with a wide variety of agents including chemical carcinogens, ultraviolet light, and y irradiation (reviewed in Schrieber et al., 1988). The mechanism of carcinogenesis and the degree of antigenicity of non-viral-induced tumors is highly variable. For some carcinogens (e.g., methylcholanthrene or MC) antigenicity is proportional to the concentration of carcinogen used (Prehn, 1975). Also included in this category are the spontaneously arising tumors with unknown etiology, as defined by Hewitt et al. (1976). These tumors appear to be nonimmunogenic and may express very few (if any) antigenic determinants. In contrast to studies of MHC in human cancer, there are essentially no reports on MHC levels on autochthonous animal tumors and normal tissue counterparts in situ. Virtually all studies of MHC expression in animal malignancies have been carried out using established cell lines that have been in culture for several months to 10 years. Both quantitative and qualitative variations in class I MHC expression have been observed (Table 11). Many of the virally induced tumors showed lack of both H-2K and H-2D antigens. Carcinogen-induced and spontaneous tumors often showed variable levels of MHC expression, including coordinate loss of H-2K, -D, and -L antigens (e.g., GR9 sarcoma, SP1 spontaneous mammary carcinoma, and line 1 lung
TABLE I1 SUMMARY OF COMPARISON OF ALTERED MHC EXPRESSION AND IMMUNOGENICITY ON RODENTTUMOFLSWITH TUMORS
Inducing agent I
W
33
Tumor class
Designation
Original MHC Haplotype
Virus (in uiuo oncogenesis)
SV40 RadLV Gross MuLV Moloney Moloney Chemical or radiation MC
Pattern of MHC expression
K
D
growth
+
Fibrosarcoma Lymphoma Lymphoma Lymphoma Lymphoma
SV-C3H-V1 C.GV; R.GV YAC-1 B4R, BM4R, BM5R
H-2k (C3H) H-2b (C57BLlKa) H-2d (BALB/c) H-2a (AIJ) K k Db; B DbIlKf Df; K b DdlU Df
-
Sarcoma
GR9 (imm-)
H-2h (BALBIc)
-
MC
Mastocytoma
MC
Sarcoma
uv
Melanoma
(imm+) P815 (imm-) (imm+). L-T10 (met-)d M-T10 (met+)d K 1 7 m (imm-) (imm+).
H-2d (DBAIP) Hk-2" X H-2' (C57BL16 X C3 HeB) H S k (C3H HeN)
In uiuo
+ -
-
+ + +' b+/kb+/k+
-
+ + +
+ + -c
+ +
+/-
+
+ I --c
-e
Susceptibility to T c ~
Referencesh
Spontaneous Mammary carcinoma Mammary carcinoma Lung carcinoma Lymphoma Rhabdomyo sarmma Teratocarcinema
(D
a
TA3
H-2' (C3H)
-
+
+
+(D')
10
SPl
H-2& (CBA)
-
-
+
-
11
3LL (met-) (met+) RCS5 SP5
H-2b (C57BL/6)
-I+ -
-/+.
+ +
+(Db) +(Db) NT NT
12
NT NT
15
40ZAX
H-2= (SJL) H - 2 d x H-2b (BALBlc x C57BL/6) H-2b (129)
+
+a
-
d+/b+
d+lb+ (Ld-)
-
-
+
+h
+
+ + -h
13 14
Data using allospecific Tc are shown. Target MHC antigens detected are indicated in parentheses. References: 1. Gooding (1982); 2. Meruelo (1979);3. Plata et al. (1981);4.Dukuabus et al. (1981); 5. Baldacci et al. (1983);6. Garrido et al. (1986);7. Boon (1983); 8. Katzav et al. (1983);9. Hostetler and Kripkie (1988); 10. Codington et al. (1983); 11. Carlow et al. (1985); 12. Eisenhach et al. (1983); 13. Rosloniec et al. (1984); 14. B. E. Elliott and G. Evans (unpublished observations); 15. Ostrand-Rosenberg and Cohan (1981). Immunogenic (imm+) variant clones were selected after treatment with MNNG. No change in MHC antigen'expression was observed. Imm+ clones stimulated a tumor-specific Tc response, which cross-reacted with the parent tumor (Boon, 1983). Representative metastatic (met+) and nonmetastatic (met-) lines derived from the L-TI0 sarcoma are shown. Only met+ lines expressed D'. e Immunogenic variants were selected after treatment with UV light. Increases in class I MHC antigen expression did not correlate with immunogenicity. f NT, Not tested. g Local tumor growth showed heterogeneity of class I MHC expression; metastatic lines (met+) always expressed K-/D+ phenotype. h Teratocarcinomas become H-2+ during rejection in genetically resistant mice.
200
BRUCE E . E L L I O T ET AL.
carcinoma), noncoordinate loss of H-2K, -D, or -L antigens (e.g., TA3 carcinoma: K k - , D k + ; RCS5: KS+,DS-;and SP5: K d + / b + , D d + / b + , L d - )and , coordinate expression of both H-2K and H-2D antigens (e.g., P815: K d + , D d + )(Table 11). Thus, there appears to be no consistent pattern of MHC expression on established animal tumor cell lines. Transplantation of low class I MHC-expressing tumor cell lines into syngeneic or nude mouse recipients can sometimes result in augmentation of tumor-derived class I antigens (Holtkamp et al., 1979; Petersson et al., 1987). Elliott et al. (1988) have demonstrated that the tissue site of injection can influence the level of class I antigens expressed (see Section IX,B). The significance (if any) of these fluctuations in MHC expression on tumor progression are unknown. Nevertheless in situ levels of class I MHC should be monitored in experiments designed to examine the role of MHC in malignancy. There have been several studies of MHC expression in metastasis. Katzav et al. (1983)and Eisenbach et al. (1983) have demonstrated an imbalance of D- versus K-antigen expression in metastatic lines derived from the T10 sarcoma and the 3LL carcinoma, respectively. Elliott et al. (1988) have shown lack of class I K and D antigens on metastatic lung nodules of a mammary carcinoma SP1 compared to the primary intramammary SP1 tumor, which is heterogeneous with respect to MHC expression (see also Section IX, B). In addition, several workers have reported increased metastasis following daily injection of IFNT, which enhances class I MHC expression into animals injected with B16 melanoma (Taniguchi et al., 1987; Zoller et al., 1988) and line 1lung carcinoma (E. Lord, personal communication). The interesting aspect of these findings is that in certain tumor systems a consistent change, either an increase or decrease, in MHC expression was observed in metastatic cells compared to the parent tumor from which they were derived. These experiments raise the question whether altered MHC expression on certain tumors is causally related to tumor progression, in particular the metastatic process. VI. Evidence for a Role of MHC Antigens in Malignancy
The correlative studies of MHC in clinical cancer raise the question whether altered expression of MHC antigens on tumors is causally related to the malignant process. Two main approaches to this question are described here: studies of oncogenes and oncogenic viruses, and gene transfection experiments. A.
INFLUENCE OF ONCOGENES AND ONCOCENIC VIRUSES
Infection with oncogenic viruses and transformation with certain oncogenes can alter cell growth characteristics leading to transformation (re-
MHC
ANTIGENS IN NORMAL A N D MALIGNANT DEVELOPMENT
201
viewed extensively in Garrett, 1986; Chiarugi et al., 1987; Bishop, 1985; Weinstein, 1987; Nishimura and Sekiya, 1987). In some cases, transformation is associated with altered class I MHC expression and immunogenicity. Examples of these phenomena are briefly reviewed here.
1 . Oncogenic Viruses The study of human adenoviruses provided the first evidence for the existence of specific genes that are capable of downregulating cell surface expression of class I MHC antigens. In these studies, baby rat kidney fibroblasts transformed with human adenovirus-12 (Ad12), but not adenovirus-5 (Ads), had greatly reduced expression of MHC class I antigens, were resistant to allogeneic cytotoxic T lymphocytes (Tc), and were highly tumorigenic in syngeneic rats (Schrier et al., 1983; Bernards et al., 1983). These findings have been extended to a murine system by Tanaka et al. (1985), who have shown that transfection of an exogenous MHC gene under control of an SV40 promoter resulted in expression of the transfected MHC gene and abolished tumorigenicity of Adl2-transformed cells. These results provided strong evidence that MHC antigen expression is important in immune rejection of at least Adl2-transformed cells. Schrier et al. (1983)have shown that both oncogenesis and MHC suppression are mediated by the Ad12 E1A product. However, other effects of E1A proteins have been described. Haddada et al. (1986) have shown that transformation with Ad2 and Ad5 E1A genes can increase susceptibility to N K cells and activated macrophages with concomitant reduced tumorigenicity. Thus, reduction of class I MHC antigen expression may not be the only parameter distinguishing adenovirus-transformed cells with different tumorigenicity (Lewis and Cook, 1985). Infection with EBV is also associated with altered class I MHC expression. Certain EBV-positive Burkitt’s lymphoma (BL) cells are refractory to autologous EBV-specific Tc. Subsequent data have shown that resistance of BL cells to Tc is often associated with down-regulation of certain HLA-A antigens (e.g., A l l ) and of the EBV-encoded latent membrane protein, compared to EBV-transformed cell lines from the same patient (Masucci et al., 1987; Torsteinsdottir et al., 1988).Low HLA-All-expressing sublines were also more resistant to alloactivated Tc. Burkitt lymphoma cells exhibit reciprocal chromosomal translocations that juxtapose the c-myc gene to an immunoglobulin gene enhancer (Klein, 1983). Klein and Klein (1986) have recently proposed that the translocations act at a point where a previously expanded B-cell clone is programmed to return to the Go stage as a long lived memory cell. Due to the constitutive activation of the c-myc sequences, the cell must remain in cycle, and undergoes certain alterations such as reduced MHC expression. However, whether expression of c-myc is
202
BRUCE E. ELLIOTT' ET AL.
related to suppression of class I MHC antigens is not known (see also Section VII1,B). Altered expression of class I antigens has been observed in cells transformed by many other viruses. Infection with certain retroviruses (Flyer et al., 1985), polyomavirus (Majello et al., 1985), and SV40 (Brickell et al., 1985) is often associated with increased MHC expression. The effect is not consistent among different cell lines tested: Racioppi et al. (1988) have shown that a single retrovirus can have a stimulatory, a suppressive, or no effect on class I MHC expression, depending on the cell line tested. In addition, when some virally transformed cells with increased M HC antigen expression were repeatedly passaged in vivo, tumors with increased growth potential appeared that expressed reduced levels of H-2k-encoded antigens. The possibility that the change in MHC expression reflected immunological selection pressure in viuo is unresolved.
2 . Oncogenes and M H C (myc, fos, and ras) Considering the fact that very few human cancers have been shown to be caused by viruses, the physiological relevance of the viral studies to human cancer is questionable. Similar findings have been reported upon transfection with certain oncogenes including c-fos, and some members of the myc family of genes (e.g., c-myc or N-myc). One nuclear oncogene that appears to be often associated with altered class I MHC expression is c-fos. Barzilay et al. (1987) have shown that the expression of class I MHC mRNA and c-fos mRNA in differentiating human leukemia cells are temporally related. Induction of class I MHC by 12-0tetradecanoylphorbol-13-acetate(TPA) or dimethyl sulfoxide was preceded by a transient burst of c-fos expression (peaking at 2-4 hr posttreatment). A similar positive correlation between MHC and c-fos expression was found in other tumor systems, including PC12 pheochromocytoma, and the Lewis lung carcinoma (Kushtai et al., 1988). In the latter system, low-metastatic clones constitutively express c-fos and high levels of H-2b molecules, while high metastatic clones that are deficient in H-2 expression do not express c-fos. Transfection of c-fos or v-fos into H-2K-negative cells elevates the levels of H-2 proteins and abrogates the metastatic phenotype. Whether this finding applies to other tumor systems remains to be demonstrated. Nevertheless, it is tempting to speculate that the c-fos product may in some way influence class I MHC expression. A possible mechanism for c-fos-mediated control of MHC expression is proposed in Section VII1,B. An inverse correlation between expression of certain members of the myc family of oncogenes and class I MHC expression has been shown in certain malignancies. Bernards et al. (1986) have demonstrated that class I MHC mRNA and cell surface expression in neuroblastoma cells correlates inverse-
MHC
ANTIGENS IN NORMAL AND MALIGNANT DEVELOPMENT
203
ly with N-myc expression. Transfection of rat neuroblastoma cells with Nmyc results in downregulation of class I MHC expression. Reversion to low N-myc expression correlated with elevated MHC expression. However, not all N-myc-expressing tumors show this effect. Preliminary results from Alt et al. (A. Ma, R. Dildrop, and F. A h ) have shown that HLA class I genes remain expressed in a series of spontaneous pre-B cell tumors arising in Nmyc-transgenic mice, or in Ableson virus transformed pre-B cell tumors (both of which express high levels of N-myc). Another group (D. Feltner and C. Thiele, personal communication) have shown that transfection of N-myc into an adrenal-derived neuroblastoma line and a neuroepithelioma yields tumor lines with elevated expression of N-myc while constitutive expression of HLA class I molecules is maintained. These results are distinct from those of Bernards et al. who used a rat glioneuroblastoma as a recipient tumor line. Thiele and Feltner propose that the stage of differentiation at which the tumor is transfected, rather than the level of N-myc expression per se, is important in determining whether HLA expression will be affected. This hypothesis is particularly attractive since MHC class I expression is developmentally regulated (see Section 111,B). Analogous to the findings of Bernards et al. (1986), Versteeg et al. (1988) have shown that transfection of c-myc into 11independent human melanoma cell lines results in reduction of class I MHC expression. These workers also showed that treatment with IFNT fully restores class I MHC and Pzm expression, while suppressing c-myc mRNA levels. It should be noted that not all malignancies showed a consistent effect (Racioppi et al., 1988). Thus regulation of c-myc and MHC gene expression appear to be inversely related only in certain tumor systems (Mechti et al., 1985). Several investigators have examined the relationship between the ras oncogene family, class I MHC expression, and NK susceptibility, since expression of this oncogene has been shown to correlate with metastasis in a number of rodent tumor systems. Alon et al. (1987) have shown that K-ras mRNA levels were elevated in low MHC-expressing variants of the T10 sarcoma; these low MHC variants exhibited increased metastatic ability. Johnson et al. (1985)have shown that Rat-l fibroblasts transfected with vKiras exhibited enhanced susceptibility to NK cells. Trimble et al. (1986), using a vector with an inducible metallothionein gene promoter, showed that acquired susceptibility to NK cells correlated with increased expression of the H-ras gene transfected into C3HlOT4 cells. In preliminary experiments, class I MHC expression appeared to be elevated on Rat-l fibroblast transfectants, however, in further experiments with inducible H-ras transfectants, no correlation was observed (B. E. Elliott, P. Johnson, and J. Roder, unpublished observation). An independent series of transfections of H-ras into CSHlOTi cells, carried out by Greenberg et al. (1987), showed no
204
B R U C E E. ELLIOTT ET AL.
change in class I MHC expression (B. E. Elliott, A. Greenberg, unpublished observations). Thus, there is no general correlation of rus gene activation and MHC expression. The relationship between N K susceptibility, metastasis, and H-rus expression has recently been carefully analyzed by Greenberg et ul. (1987a), using a series of H-ras transfected CSHlOTi cells. Evaluation of N K susceptibility in uitro did not predict metastatic ability. However, increased N K susceptibility did inversely correlate with the ability of H-rus-transfected tumor cells to implant in the lung within 48 h after injection. The level of Hrus RNA did not correlate with the initial rate of lung implantation, however, it did correlate with the ultimate metastatic potential. These findings indicate that N K cells have an important effect early in the course of the disease, but at later stages H-rus alters the cell in such a way leading to escape from N K attack. Gingras et ul. (1988) later demonstrated that increased metastatic ability of H-rus-expressing cells correlates with increased responsiveness to transforming growth factor+. These findings emphasize the importance of in uiuo correlates of tumor progression in association of oncogene expression with NK susceptibility. In summary, there is strong evidence that certain oncogenic viruses and oncogenes can influence class I MHC expression in some tumor systems. Because transformation with these genes has pleiotropic effects, it is difficult to determine whether the accompanying altered MHC phenotype is directly related to tumor-forming ability.
B. GENETRANSFECTION STRATEGIES The most direct approach to delineate a role of class I MHC in malignancy is the transfection of MHC genes into low MHC-expressing tumors. There are at least two potential problems with gene transfection strategies. First, as reported by Hammerling et ul. (1987a,b), not all tumor cells are permissive hosts for expression of transfected genes. This problem can sometimes be circumvented by using vectors with strong promoters such as the SV40 promoter (Tanaka et ul., 1985) and the metallothionine promoter (Weis and Seidman, 1985; Carlow et ul., 1989). Second, the transfection procedure itself could significantly modify the expression of MHC and non-MHC genes, thereby affecting immunogenic or tumorigenic properties. Kerbel et ul. (1987) have demonstrated that 10-15% of clones transfected with the pSV2 neor vector alone (not bearing the gene for neomycin resistance) showed altered in uiuo growth, metastasis, or MHC expression compared to untransfected controls. Dr. G . Nicolson (personal communication) has re-
MHC
ANTIGENS IN NORMAL AND MALIGNANT DEVELOPMENT
205
ported similar findings with a rat adenosarcoma transfected with the H-ras gene or treated with calcium phosphate alone. The altered phenotype could result directly from the neo" gene (von Melchner and Housman, 1987), or indirectly from insertional mutagenesis. In addition, the trauma of the calcium phosphate transfection procedure itself could influence normal gene expression. Evidence for the latter possibility is provided by the observation that electroporation, which is a less traumatic gene transfection procedure, does not show this effect (R. S. Kerbel, personal communication). Retrovirus vectors are useful because relatively few gene copies can be stably integrated with high efficiency, thus providing more control over the transfection process. Approaches involving retrovirus vectors (which allow transfection of limited copies at high frequency (Berger and Bernstein, 1985), transgenic mice (Muller et al., 1988), and antisense mRNA (Kim and Wold, 1985)offer potential advantages for future studies of MHC in malignancy. Despite these limitations, two main effects of transfected MHC genes have been observed in different tumor systems. These are attenuation of in uiuo tumor growth and metastasis, and in uitro protection of tumor cells from NK cell-mediated lysis. Data supporting these effects are summarized here.
1 . Attenuation of Tumor Growth Table 111 summarizes work by laboratories involved with transfection approaches in which in uiuo immunogenicity and metastasis were examined. The effects of MHC gene transfection on tumor growth can be exemplified by three main patterns as determined by the degree of acquired immunogenicity. In the first category, low MHC-expressing experimentally induced tumors become immunogenic (i.e., nontumorigenic) upon transfection with KID or L genes. In all cases, augmentation ofclass I MHC antigens clearly correlated with attenuated tumor growth. However, there are several problems in extrapolating these results to other tumor systems. First, since tumors in this group are experimentally induced, they express viral andlor tumor-associated antigens, which would be recognized by MHCrestricted T cells. The requirements for MHC expression for immune recognition of this class of tumors is therefore not surprising. Second, very few studies include control transfections with a gene for an unrelated surface antigen. The work of Tanaka et al. (1988b) is unique in this regard, demonstrating that transfection of class I but not class I1 MHC genes can abrogate growth of a BL-6 melanoma cell line. These experiments confirm the importance of class I MHC antigens at least in certain malignancies. In some cases, the ability of immunogenic high MHC-expressing transfectants to immunize naive recipients against the original tumor was tested (Wallich et al., 1985;
TABLE 111 EXPERIMENTAL TUMORMODELS USEDTO STUDY MHC
Category
Tumor designation
Inducing agent
A
C57AT1 C3ATl IC9
Ad12 Ad12 MC
B
c
Tumor type
Strain of origin
Fibrosarcoma Fibrosamma Sarcoma
C57BL/6 (H-2') C3H (H-2') C57 X C3H
(H-2'Ik) C57 X C3H (H-269 C57BL/6 (H-2b) AKR (H-2k) C57BL/6 (H-2b)
Increased MHC Recipient expressiona tested Ld Ld Kk,K Kk,Kb
IE7
MC
Sarcoma
C57AT1 K36 3LL
Ad12 Leukemia virus Spontaneous
B16 Line1
Spontaneous Spontaneous
C57BL/6 (H-26) BALB/c ( H - 2 9
Kb DP
Sal
A/J (H-2a)
Kb
SP1
Dibenzanthracene Spontaneous
Fibrosarcoma Leukemia Lung carcinoma Melanoma Lung carcinoma Sarcoma Carcinoma
CBA (H-Zk)
Kk/Dkc
SP5
Spontaneous
Rhabdomyosarcoma
BALB/c X C57BL16
Ld
(H-2d/b)
Kb Kk Kb
IN
MALIGNANCY
In uioo Immunoprimed genic
Metastatic
BALBlc
NT NT
Tanaka et al. (1985)
C57 X C3H C57 X C3H C57BL/6 AKR C57BL16
-b
Wallich et al. (1985)
NT NT NT
C57BL/6 BALB/c X PJ A/J
NT NT NT NT
CBA
NT NT NT
BALBlc
-6
X
C57BL16) NT
a
b c
References
CaP0,-mediated MHC gene tranfection. Primary tumor grew but metastasis was abrogated in mice injected with Kb+/Kk+transfectants. 5-Azacytidine-induced variants.
Tanaka et al. (1986) Hui et al. (1984) G.J. Hammerling (unpublished) Tanaka et al. (1986 Bahler et al. (1987) Cole et al. (1987) Carlow et al. (1985, 1989) B.E. Elliott and 6 . Evans (unpublished)
MHC
ANTIGENS I N NORMAL AND MALIGNANT DEVELOPMENT
207
Hui et al., 1984; Tanaka et al., 1988b). In these three studies, cross-immunization against the parent tumor was observed. The parent tumor is therefore antigenic but incapable of stimulating the host immune system. Presumably the level of class I MHC antigens is insufficient for stimulation of Tc or Th precursors. The second category of tumors showed no change in growth in naive mice following transfection with MHC genes (Ostrand-Rosenberg et al., 1987; Cole et al., 1987). If mice were preimmunized with one high MHC-expressing transfectant, all MHC-transfected lines grew less well than in control mice. No consistent immunoprotection against the parent line was observed. The treatment of cells used for immunization may be important. For example, Tanaka et al. (1988b) used viable cells at a nontumorigenic (low) dose, whereas Bahler et al. (1987) used irradiated tumor cells at a higher dose. Taken together, these results show that even the expression of allogeneic determinants is sometimes insufficient to stimulate rejection of certain tumors. The requirement for in uiuo priming in triggering immune rejection has important implications in the mechanism of T-cell activation (discussed in Section VI1,A). The third category of tumors showed no detectable immunogenicity regardless of in uiuo priming. Two tumors with these characteristics are a spontaneous mammary carcinoma (SP1) that developed in the Queen’s University mouse colony, and a rhabdomyosarcoma (SP5) that arose in the colony at Jackson Laboratory, Bar Harbor, Maine. Transplantation of established tumor lines was carried out in syngeneic mice in the colony from which the tumors arose. These tumors showed no detectable immunogenicity either in uiuo or in uitro, and therefore fulfilled the criteria of spontaneous tumors as defined by Hewitt et al. (1976). The SP1 tumor showed only trace levels of class I MHC expression as determined by radioimmunoassay and antibody absorption experiments (Carlow et al., 1985; Elliott et al., 1989). Most immunogenic variants isolated from 5-azacytidine(5-Aza)-treated SP1 (clone 10.1) cells (i.e., which exhibited attenuated growth in normal animals but progressive growth in T cell-deficient nude mice) showed enhanced levels of H-2D or H-2K and D antigens (Carlow et al., 1985; Elliott et al., 1987). Reversion of immunogenic clones to a nonimmunogenic phenotype was accompanied by a concomitant reduction in class I MHC antigen expression. In contrast, virtually all high and low MHC-expressing variants, directly isolated from SP1 (clone 10.1)following treatment with 5-Aza, were found to grow as efficiently as the parent tumor in either naive or preimmunized recipients (Carlow et al., 1989). Furthermore, no protection against the parent tumor was demonstrated, and daily infusion of 1FN.r-which augmented the level of class I MHC on SP1 (clone 10.1) cells in situ-had no
208
B R U C E E . ELLIOTT ET AL.
effect on the in vioo growth of 10.1 cells; P. Frost and colleagues (unpublished observations) have confirmed this finding using spontaneous high and low MHC-expressing clones isolated by flow cytometry from the SP1 tumor. Thus although augmentation of class I antigens may contribute to the acquired immunogenic phenotype of SP1, this alteration does not alone lead to immune rejection of S P l cells. The second tumor, SP5, expressed class I H-2Kbjd and H-2Db/d antigens, but not H-2Ld antigens. Transfection of the Ld gene had no significant influence on in vivo growth behavior of SP5 (B. E. Elliott and G. Evans, unpublished observations). Thus the potential for class I MHC to modulate tumor growth depends on both the tumor and the immune status of the host. It is unclear at the moment which category of experimental tumors is most clinically relevant; nevertheless, the third category, in which tumors appear to be immunologically inert, clearly represents a very challenging model.
2 . Protection from N K Susceptibility Genetic analysis has revealed a linkage with MHC of mouse strains with high and low N K effector levels (Kiessling et al., 1977; Klein et al., 1978; Carlson et al., 1984). This finding has raised the question whether the level of class I antigens on the surface of tumor targets can affect NK susceptibility. Karre and colleagues (Ljunggren and Karre, 1985; Karre et al., 1986) have demonstrated that in certain lymphoma systems and in the B16 melanoma system, NK susceptibility increased on low M HC-expressing variants (Table IV). This inverse relationship between N K susceptibility and MHC expression is also observed in the survival and outgrowth of MHC+ NK- variants following injection of mixtures of MHC+ N K - and MHCNK+ cells (Ljunggren and Karre, 1985). From these studies, Karre et al. (1986) proposed the hypothesis that class I MHC expression and NK susceptibility were inversely related. Karre's initial work prompted several laboratories to test this hypothesis by transfecting MHC genes into low MHC-expressing NK-sensitive tumors (see Table V). Carlow et aZ. (1989) have demonstrated a reduction in NK susceptibility of the prototype NK target YAC-1 following transfection of the Kb gene. G . J. Hammerling (personal communication) showed a similar effect in a NK-sensitive MHC- subline of EL4 transfected with K'?.. The same Kb gene did not alter NK susceptibility of the fibrosarcoma line T10 (Gopas et aZ., 1988), implying that some tumors simply do not show the effect. Dennert et al. (1988)have demonstrated that the low MHC-expressing BALB/c-derived lung carcinoma line 1 remains sensitive to poly(1:C)boosted NK cells following transfection with K P ; the same line exhibits reduced N K susceptibility following transfection with K b (G. J. Hammerling,
MHC
ANTIGENS IN NORMAL A N D MALIGNANT DEVELOPMENT
209
personal communication). This phenomenon is further supported by the results of Cresswell’s laboratory (Storkus et al., 1988) with a class I HLA antigen-negative lymphoblastoid cell line transfected with HLA-A and HLAB genes: HLA-Bw58 expression correlated with a linear reduction in NK susceptibility; transfection of HLA-A3 and -B7 also showed a protective effect. The protective effect was observed with freshly isolated NK effectors (LGL), but was not observed with lymphokine-activated killer (LAK) effectors. Transfection of murine MHC genes (Db and Kb) into human target cells had no effect on NK susceptibility to human NK effectors. The conclusion from these studies is that in certain tumor systems, transfection of certain MHC genes can directly influence NK susceptibility of targets. A key question now is whether, in these systems, MHC gene products are directly or indirectly involved. VII. Proposed Function of MHC in Malignancy
Studies of MHC gene transfection have clearly shown that augmentation of MHC antigen expression can markedly alter the immunogenicity and NK susceptibility of certain tumors. Attention is now being focused on the molecular mechanisms mediating these effects, and what additional tumor or host factors can influence progressive tumor growth. A brief discussion of the potential relevance of MHC molecules in the immunological aspects of the tumor-host relationship follows.
A. TRANSPLANTATION STUDIES A N D RELEVANCETO MHC
AND
CANCER
The immunology of allograft rejection offers a useful model to study the contribution of the MHC in the rejection of antigenic, and therefore “immunologically targetable” tissue. In this system the form of the transplanted tissue and the antigenic disparity between donor and recipient can be more or less thoroughly defined. This section discusses findings from in uiuo transplantation studies that bear on the proposal that M H C antigens expressed by tumor cells have some “role” in the tumor-host interaction. The rejection of minor histocompatibility antigen (mHA) disparate murine tumors (Schrader and Edelman, 1976; Korngold and Doherty, 1984) and of syngeneic chemically induced murine tumors is an MHC-restricted, T-celldependent process. Studies of short-term bulk culture (Vanky et al., 1987)or cloning (Roberts et al., 1987) of human peripheral blood lymphocytes from tumor-bearing patients have provided evidence for a class I MHC-restricted cytolytic T-cell response to autologous tumors. T cells generally recognize foreign antigens on tumor cells, or mHA on allogeneic parenchymal cells, via several distinct pathways. Antigen could
TABLE IV IN RODENTAND COMPARISONSOF M H C EXPRESSION, NK SUSCEFTIBILITY, AND TLJMOFUCENICITY HUMANTUMORMODELS:VARIANT SELECTIONSTRATEGIES Species Mouse
Tumor designation YAC-1 YAC-1 A. H-2RBL5 RMA-H-2 sel EM-MA EM-MAH-2 sel B16
SP1 (10.1)
Tumor class
Conjugate formation
Tumorigenicityc NT NT
EMS
+ + + +
EMS EMS
NT NT
+
-
NT NT NT NT
+ (met+) + (met-)
Treatmentn
Lymphoma
EMS
Lymphoma
-
Lymphoma
Melanoma Mammary carcinoma
IFNT 5-Aza 5-Aza
MHC expression
NK susceptibilityb
References’ 1
+ -
2
-
+
-
3 6
Human
-
EBVinduced
B-Cell lymphoma
IFNT
+
HSB
T-Lymphoblastoid cell line Leukemia-
-
-
-J
+
HMy2
derived B-wll line
y irradia-
-
tionf
+
+
-
+ +
+
NT NT
+
-
-
NT NT
+
+
NT NT
-
-
Cells were treated with the indicated drug, and selection of H-2- versus H-2+ cells was carried out. EMS, Ethylmethane sulfonate; IFNy, interferon y; 5-Am, 5-azacytidine (see references for details). Unstimulated murine spleen cells and human peripheral blood leukocytes were used as N K effectors. c Growth in normal syngeneic recipients. References: 1. Piontek et al. (1985);2. Karre et al. (1986).3. Taniguchi et al. (1987); 4. Harel-Bellan et al. (1986);5. Storkus et al. (1987);6. S. MacNaughton, H. Pross, and B. E. Elliott (unpublished observations). High MHC-expressing immunogenic clones were isolated following 5-Am treatment (S. MacNaughton, H. Pross, and B. E. Elliot, unpublished observations), and tested for NK susceptiblty compared to the parent tumor. Poly (1:C)-boosted splenic NK cells were used. f High and low MHC-expressing clones of HSB and HMy2 leukemia cell lines were isolated following limiting dilution and anti-class I HLA antibody selection, respectively.
TABLE V CORRELATION OF MHC EXPRESSION AND N K SUSCEPTIBILITT USING MHC GENETRANSFECTION STRATEGIES
Species
Tumor designation
Mouse
YAC-1
Lymphoma
EL4
Lymphoma
Line 1
Lung carcinoma
T10
Sarcoma
B16
Melanoma
Hepa Ova
Hepatoma
Daudi
B-Cell lymphoma
(B-LCL)
B-Lymphoblastoid cell line
Tumor class
Transfected MHC gene
Activation of effector cells
+ [Poly(I:C)] +
Human
[Poly(I:C)]
NK susceptibility
Referencesa
+ + + + + + + + + + + + -
+ (All groups) K562
Erythroleukemia HLA-A2
+ +
9
a References: 1. Carlow et al. (1989);2. G. Hammerling (personal communication); 3. Dennert et a / . (1988);4. Gopas et al. (1988);5. G. Jay (personal communication); 6. Ostrand-Rosenberg et a / . (1987); 7. Peraranau et a/. (1988); 8. Storkus et a/. (1988); 9. k i d e n and Kornbluth (1988).
MHC
ANTIGENS IN NORMAL AND MALIGNANT DEVELOPMENT
213
be presented directly by antigen-bearing neoplastic or allogeneic tissues in a class I-restricted context. Alternatively, antigen could be handled indirectly by release and subsequent uptake by specialized APC and presented in a class II-restricted context. Parameters that may influence the relative contribution of each of these pathways to the immune response include (a) the relative capacity of antigen-bearing cells to supply the accessory signals required to present antigen effectively directly to responding T cells in a class I-restricted context, (b) the quantity and form (soluble or particulate) of antigen released by antigen-bearing tissue as a consequence of cell death or shedding, (c) the accessibility of released antigen to an environment where an immune response can develop, and (d) the nature of host-recipient APC present in the environment. In vivo competition between processed peptide with self peptides for binding to MHC molecules (Adorini et al., 1988)and the alleged inability of some APC to process and present particulate antigen for class I-restricted responses (Bevan, 1987; Moore et al., 1988) may limit the efficiency of indirect handling of cellular antigen (Pilarski, 1986; Morrison et al., 1988; Ando et al., 1988).Thus, effective presentation of tumor antigen in a class I-restricted manner may be subject to the influence of the quantity and/or quality of class I antigens expressed by tumor cells themselves, and the tumor’s relative capacity to deliver accessory signals required for stimulation of resting T cells. 1 . Effects of M H C Quantitative Variation on Afferent-Efferent T-cell Responses A number of variables could influence interactions between T cells and tumor cells. These include the presence of accessory molecules, glycosylation patterns, affinity of the T-cell receptor (primary versus secondary Tc precursor), and quantity-density of MHC molecules (Sprent and Schaefer, 1989). The absolute numbers of MHC molecules on a given cell surface required to deliver activating signals via the T-cell receptor will likely vary depending on the responder/effector and stimulator-target under construction (Flyer et al., 1985).General quantitative information about the relative requirements for class I antigen expression using in vitro models is described later. The impact of altered class I antigen density on class I-restricted responses may be considered at two levels: Tc precursor stimulation (afferent) and Tcmediated lysis of a target cell (efferent). For reasons of practical convenience, the large proportion of data accumulated so far has focused on the influence of class I density on efferent T-cell function. Interferon-mediated increases in class I antigen expression have been paralleled by enhanced susceptibility to class I alloantigen-specific Tc (Bukowski and Welsh, 1985; Laf€erty et al., 1983; Flyer et al., 1985).Variations of 2- to 10-fold in class I
214
BRUCE E. ELLIOlT ET AL.
expression correlate with significant effects on target cell susceptibility (Kuppers et al., 1981; Flores and Gilmer, 1984; Lesley et d . , 1974; Celis et al., 1979; LaRerty et al., 1983; Suranyi et al., 1987). Properties other than class I expression, such as constituents of the target cell matrix, may also influence target cell susceptibility (Herrmann et al., 1982; Flores and Gilmer, 1984; Russell et al., 1978). Studies on the requirements for effective afferent stimulation of memory Tc precursors by class I alloantigen-bearing liposomes indicated that 10-fold differences in total MHC content or X-fold differences in MHC density (protein-lipid ratio) significantly influence the generation of secondary Tc precursors (Herrmann et al., 1982). Goldstein and Mescher (1986, 1987), using cell-sized silica beads with surface-bound class I alloantigens, demonstrated a pronounced threshold density requirement for stimulation of secondary Tc precursor over a 4-fold range of class I alloantigen density. Evidence for a threshold requirement for primary allospecific Tc responses has been found using paraformaldehyde-fixed clonal tumor cell variants expressing varying levels of class I antigens (Carlow et al., 1989).
2 . Effector-Cell Zdentity in Allograft and Tumor Cell Rejection The exclusive involvement of Lyt-2 (class I-restricted) effector cells in graft rejection would implicate greater potential importance of class I antigen expressed by antigen-bearing tumors. The respective contributions of class I-restricted and class 11-restricted T cells in allograft rejection have been the subject of a controversy too extensive to be described here, and the reader is referred to reviews on the subject by Mason and Morris (1986) and Sprent et al. (1986). Numerous reports have supported a major role for Lyt-2+ cells during graft rejection, and a summary of relevant findings follows. +
1. Donor-specific Lyt-2+ Tc have been directly isolated within both major and minor alloantigen-bearing allografts undergoing rejection.
2. Purified unprimed Lyt-2+ cells are directly capable of rejecting IaH-2-different tumor cells (Sprent and Schaefer, 1988). Sensitized Lyt-2+ cells are also a primary requirement for allograft rejection in some adoptive transfer systems. For example, adoptive transfer of sensitized Lyt-2 cells alone is necessary and sufficient for rejection of class I-disparate pancreatic islet (Prowse et al., 1983) or thyroid (Warren and Pembrey, 1986) allografts. 3. Cloned Lyt-2+ Tc specific for mHA mediate tissue destruction in uivo (Tyler et al., 1984). 4. When combined with cells of the Th phenotype, Lyt-2+ cells can accelerate graft rejection. 5. Lyt-2 cells, and in particular Lyt-2+ interleukin-2 (IL-2) secretors, +
+
MHC
ANTIGENS IN NORMAL AND MALIGNANT DEVELOPMENT
215
are critical for rejection of class I-disparate skin allografts (Rosenberg et al., 1986). When class I alloantigen-specific Th cells are functionally absent, rejection depends to a greater extent on class II-restricted L3T4 cells (Wheelahan and McKenzie, 1987; Rosenberg et al., 1986, 1987). The apparently reduced involvement of Lyt-2 cells in mediating skin graft rejection across mHA incompatibilities (Wheelahan and McKenzie, 1987) may therefore reflect a functional deficit of class I-restricted Th cells. Allograft reactions against mHA incompatibilities are presumably akin to responses likely to be elicited against tumor cells. Depending on the tumor system used, it has been shown that both Lyt-2+ and/or L3T4+ cells may be preferentially required (Infante et al., 1988; Ozawa et al., 1988). +
3. Requirements f o r Direct Priming of Class Z-Restricted T Cells As reviewed by Sprent and Schaefer (1989), there is considerable controversy over the nature of the antigen presenting cell capable of stimulating full Tc function from unprimed T cells. To date, much of the controversy has centered on the relative APC potency of various lymphoreticular subpopulations. The eficacy of antigen presentation by nonlymphoreticular cells, more relevant in the context of most malignancies, remains largely unexplored. Direct stimulation of class I-restricted T cells by tumor cells could occur if tumor cells provided accessory signals in addition to the antigenMHC complex. What specific accessory signals would be required? The essence of the accessory signal is also controversial. Classical views hold that signal 2 is a “myth” that may simply reflect involvement of additional cell surface molecules/properties that physically reinforce or interfere with delivery of signal 1, T cell receptor recognition of antigen + class I MHC. The requirements for stimulating full cytolytic function from class I-restricted/ specific T cells has been examined using two experimental systems, responses of thymocytes and responses of purified peripheral CD8+ spleen or lymph node T cells to antigen or mitogen. Using whole thymocytes, Takai et al. (1988) showed that IL-6 was required in addition to IL-2 and concanavalin A (Con A) to generate functional Tc. A broad range of cell types produced IL-6 (Poupart et al., 1987; Sehgal et al., 1987), including T cells (Hodgkin et al., 1988). Proliferative T-cell responses were generated from Ia- nylon-nonadherent thymocytes if cultured with Con A, IL-1 plus accessory cells, or IL-1-pretreated accessory cells (Inaba et al., 1988). Stimulation by IL-1 of IL-6 release from accessory cells has yet to be formally demonstrated. Interleukins 1 and 6 synergize in the thymocyte proliferative response to Con A (Helle et al., 1988). A role for IL-6 in Tc responses of purified peripheral T cells was not clarified at the time this review was written. Tc can be generated from CD8 + peripheral T cells in the presence of IL-2 and Con A (Takai et a l . ,
216
BRUCE E. ELLIO’IT ET AL.
1988), or allogeneic spleen and either IL-2 or IL-4 (Widmer and Grabstein, 1987). Apparently IL-6 is required for the Con A-stimulated release of IL-2 from peripheral T cells (Garman et al., 1987). Thus one may propose that the requirements for Tc responses from mature thymocytes and peripheral T cells are essentially the same. A source of IL-2 and 1L-6 is required. For both thymocyte and peripheral T-cell responses, IL-6 appears to be critical either directly on Tc precursors or indirectly via costimulation of IL-2 synthesis. Given our current understanding of the mechanisms of activation for full class I-restricted/specific T-cell function, tumor cells would need to contribute substantively for effective direct delivery of immunogenic signals to class I-restricted T cells. Surprisingly, some class 11 MHC-negative tumors can provide the accessory signals required to generate full Tc function (Romani and Mage, 1985; Sprent and Schaefer, 1986), but this capability does not appear to apply to other tumors (Talmage, 1980; Sprent and Schaefer, 1986).
4 . Contribution of MHC to the in Viuo Destruction of Antigen-Bearing Tissue During allograft rejection, M HC antigen expression is frequently increased (So et al., 1987; Lems et al., 1987; Forbes et aZ., 1986; de Waal et d.,1983; Steininger et d.,1985).The increase in MHC expression is one of what may be a number of phenotypic changes that may facilitate lymphocyte homing (Doherty and Allan, 1986) and lead to heightened immunogenicity of the grafted tissue (Ferry et al., 1987; de Waal et al., 1983).Observations in graft enhancement models have introduced an interesting result bearing on the significance of elevated MHC expression of graft rejection. Graft acceptance may be “enhanced” by infusion of either donor class I antigenspecific monoclonal antibodies (Lems et al., 1987) or donor blood. Allogeneic grafts transplanted after enhancement by donor blood may exhibit donor M HC induction, be infiltrated by host cells exhibiting cytolytic specificity for donor alloantigen, and yet remain intact (Armstrong et al., 1987; Dallman et al., 1987; Wood et al., 1988).Thus, even the induction of donor MHC antigens and the presence of donor-specific effector cells within the graft can be insufficient to cause graft rejection. These observations demonstrate once again the apparently high level of network sophistication that may override effective graft rejection.
5. Antigenicity without Immunogenicity Is there any theoretical basis to propose that antigenic human tumors could bear targetable antigen but be invisible to the immune system? If yes, such a condition could explain, in large part, the difficulties in obtaining experimental or epidemiological evidence for immune surveillance. Indeed
MHC
ANTIGENS IN NORMAL AND MALIGNANT DEVELOPMENT
217
experiments in transplantation have revealed some provocative data bearing on this question. In essence, these experiments consist of the successful transplantation of allogeneic tissues once cells with relatively potent APC function have been eliminated from the graft. Furthermore, prolonged engraftment can lead to a state of apparent tolerance to donor alloantigen. The experimental and theoretical models to account for these results have been articulated by LafFerty and associates (LafFertyand Simeonovic, 1984; Gill et al., 1988).The implications for the discussion of a “role” for MHC in malignancy are straightforward. If the net potential for a given tumor to present tumor antigen effectively directly to T cells dwindles, so may the relevance of antigen and MHC antigen expression to the ultimate outcome of the malignancy. It is in this context that these recent developments in transplant theory bear on the central questions of immune surveillance and more specifically tumor immunogenicity. The experimental basis for these proposals has emerged from successful transplantation of cultured thymus (Ready et al., 1984; Von Boehmer and Schubiger, 1984), pancreatic islets (Bowen et al., 1981; Talmage, 1980), and thyroid tissue (La Rosa and Talmage, 1985) across strong histocompatibility barriers. Preculturing these tissues at low temperature, in hyperbaric oxygen, or in the presence of deoxyguanosine preferentially removes bone marrow-derived APC, while leaving parenchymal tissues relatively intact. After culturing, grafts may fail to induce an effective rejection response and yet remain susceptible to immunological attack from donor antigen-specific effectors generated by stimulation of recipient-type T cells with donor-type APC (thymus, Benson et al., 1987; islets, Gill et al., 1988; Zitron et al., 1981; Bowen et al., 1981). However, cultured allografts that are transplanted and remain intact for a prolonged period can eventually produce a state of donorspecific nonresponsiveness in the recipient (Zitron et al., 1981; Bowen et al., 1981; Faustman et al., 1982; Silvers et al., 1987; Gill et al., 1988). In some cases, the development of the donor antigen-specific nonresponsive state depends on both graft persistence and coordinate immunosuppression (Lim and White, 1988). The mechanism for this graft-induced form of nonresponsiveness might be mediated by suppressor cells (Faustman et al., 1982) or antibody-mediated enhancement (Gill et al., 1988), and may be a reflection of normal mechanisms to limit autoreactivity to “parenchymal self’ (Kelly et
al., 1985). These data emphasize the importance of effective antigen-presenting function by antigen-bearing tissue. The fact that allogeneic thymic epithelium, for example, can survive in a nonimmunosuppressed recipient once APC have been removed illustrates two important points. First, normal tissues can express an antigenic, but nonimmunogenic, phenotype. Second,
218
BRUCE E. ELLIOTT ET AL.
in the case of at least some antigen-bearing tissues, indirect handling of antigen by host APC and subsequent delivery of immunogenic signals may be inefficient, and in this sense, elevate the potential importance of direct presentation by antigen-bearing tumor cells themselves. The implications of these conclusions for the current discussion of MHC and malignancy are clear. Insofar as direct priming of the immune response by tumor cells can occur, levels of MHC expression could have a bearing on the tumor-host relationship. However, as discussed in Section VI,B and Table 111, some high MHC-expressing tumors failed to elicit a graft rejection even in an allogeneic context (Bahler et al., 1987; Cole et al., 1987). Thus, there are reasonable grounds to question the extent to which tumors express both targetable antigen and a phenotype that would permit the direct and efficient delivery of immunogenic signals. B. ROLEOF MHC
IN
N K RECOGNITIONA N D NATURAL RESISTANCE
Natural resistance was first noted by Snell (1958), who demonstrated that certain lymphomas grew better in syngeneic mice than in semiallogeneic F, hybrids. Cudkowicz and Bennett (1971) described F, hybrid resistance to parental bone marrow cells transplanted into irradiated semiallogeneic F, recipients. F, resistance to parental bone marrow was not influenced by preimmunization and could not be adoptively transferred. Because of the close relationship between natural resistance and NK susceptibility (Carlson et al., 1984), investigators have looked for a similar role of MHC in these two Eunctions. Natural killer cells were initially considered as mediators of natural resistance in viuo, since they have similar origins (i.e., are bone marrowderived) and follow similar kinetics (Kiessling et al., 1977; Klein et al., 1978). Genetic analyses of natural resistance and NK activity originally suggested a similar strain distribution of high- and low-responder phenotypes, and of polygenic control linked to both H-2 and non-H-2 loci (Cudkowicz and Bennett, 1971; Klein et d.,1978). However, later studies by Carlson et al. (1984) have shown that these two phenomena are not subject to identical genetic control. These workers reasoned that because many studies were carried out with NK-susceptible tumor lines, it was difficult to distinguish between recognition events dependent on tumor-host H-2 nonidentity and an H-2associated NK-activity gene. They have examined in vivo resistance to cell lines with reduced susceptibility to NK-mediated lysis as assessed in conventional assays (i.e., survival of radiolabeled tumor cells). Their results demonstrated that H-2-associated resistance to NK-insensitive lymphoid tumors is under different genetic control from that regulating NK-cell activity in vitro. Furthermore, the finding that the strain distribution patterns for N K activity
MHC
ANTIGENS I N NORMAL AND MALIGNANT DEVELOPMENT
219
in uitro (versus YAC-1) and in uiuo resistance to an NK-resistant variant of the L1210 tumor were different, indicates that H-2-associated natural resistance is not simply an in uiuo manifestation of NK activity. Additional mechanisms must be involved, such as H-%dependent activation of H-2independent NK cells, nonclassical NK effectors that distinguish self from nonself (e.g., via hybrid determinants that could define differences between host and tumor cells), and H-2 mismatching between the transplanted cells and the nonsyngeneic microenvironment, thereby altering local seeding and survival (McCulloch and Till, 1963). Thus, MHC or MHC-linked genes are likely to be involved in natural resistance, but this phenomenon does not appear to be a simple in uiuo manifestation of NK activity. An elegant series of experiments by Hoglund et al. (1988) have provided some insight into the mechanism of MHC control of the N K component of natural resistance. These workers have shown that gain of a new MHC antigen in C57BL/6 (H-2h)recipients (by introduction of the Dd transgene) results in NK-mediated rejection of parental strain H-2b-positive tumor cells in uiuo. Thus nonresponsiveness to RBL-5 lymphoma cells can be broken either by introduction of foreign H-2 genes at the host level, or by selection against H-2 gene expression at the tumor level. The results support the idea that NK cells survey body compartments for cells showing absence (or reduced expression) of certain MHC-like surface markers (Karre et al., 1986; Ljunggren and Karre, 1985). Further work is required to confirm these findings in other tumor systems and to elucidate the mechanisms involved. The question what stage(s) in the NK-target interaction are affected by MHC remains unknown. There are several steps in the NK-cell lysis phenomenon including adhesion, recognition, triggering, and effector stages. No clear correlation between conjugate formation, which is a measure of the earlier stages of the interaction, and NK lysis of high and low MHC-expressing lines has been reported. Karre’s group observed no difference in conjugate formation by MHC- and MHC+ variations, indicating that a postbinding inhibitory signal was involved in allowing MHC cells to escape killing (Ljunggren et al., 1988). In contrast, other groups did observe a clear difference in conjugate formation (Storkus et al., 1987). Karre noted that coldtarget competition correlated better with differential end point lysis of MHC and MHC- cells than effector target conjugate-binding properties. These findings illustrate the importance of postbinding events, critical for cold-target competition and killing. In summary, M HC antigens can clearly influence the susceptibility of certain tumors to NK lysis. In the phenomenon of natural resistance the type of MHC in addition to the amount expressed are important. Further work is required to determine the molecular mechanisms involved. +
+
220
BRUCE E . ELLIO'lT ET AL.
VIII. Regulation of Altered Class I MHC Expression in Malignancy
In Section V it was pointed out that, at least in certain rodent experimental tumor models, augmentation of class I MHC antigen expression can significantly alter tumor immunogenicity. These findings have prompted several laboratories to examine the mechanisms of altered M HC expression in malignancy. This section outlines general features of MHC regulation and gives examples of malignancies with specific lesions leading to altered MHC expression.
A. GENERAL FEATURES OF MHC GENEREGULATION
1 . Transcriptional Control Although some studies have identified transcriptional enhancers of certain human MHC genes (Sullivan and Peterlin, 1987), emphasis in this section will be on the regulation of murine MHC gene expression for which a number of regulatory factors and corresponding elements have been described. Regulation of gene transcription can be controlled by cis-acting elements, trans-acting factors, or changes to the genes themselves (e.g., methylation). Since class I genes are potentially regulated by all three of these mechanisms, each is discussed in turn. a. Regulatory Elements. The promoter region of class I genes has been found to contain a TATA box (position -25 bp from the CAP site), a CCAAT box (-51 bp), GC-rich regions (-516 to -506 and -193 to -159), and consensus sequences for the heat shock element (-367 to -354) and the IFN response element (-165 to -137) (Kimura et al., 1986) (Fig. 2). Enhancer sequences could be demonstrated at positions -193 to -159 (enhancer A) and -120 to -61 (enhancer B) using hybrid genes consisting of portions of the class I promoter attached to the chloramphenicol acetyltransferase (CAT) reporter gene. Using these constructs, no sequences upstream of -600 bp influenced CAT expression in either a positive or negative direction (Kimura et al., 1986). It is interesting to note that many of these regions are conserved in the promoters of most class I genes but were absent for the most part from P2m. One notable exception was that the P2m promoter contained a 33-bp fragment from the enhancer A sequence, but in the opposite orientation to that found in the class I promoter (Kimura et al., 1986). It is becoming increasingly evident that cis-acting elements may act as control sequences that bind trans-acting factors to direct developmental and tissue-specific gene expression (Maniatis et al., 1987; Ptashne, 1986). Some or all of the cis-acting elements just outlined may be potential sites for modifying MHC transcription. In particular, factors have been identified
MHC
221
ANTIGENS IN NORMAL A N D MALIGNANT DEVELOPMENT TATA -25
ICS S+/ -1.4kb
-167
I
I
I I
-367
-354
-203
-138 I
I
,
-161
ENH A
HEAT SHOCK
I
-121
I
I
-61 -
-51
ENHB
CCAAT
I CAP//
3'
cs
L S
/ *
a1
a2
a3H
FIG. 2. 5'-Noncoding and coding sequences of the class I MHC gene. Numbers indicate the position of nucleotides upstream from the CAP site. ICS, IFN consensus sequence; ENH A, enhancer A; ENH B, enhancer B. Boxes indicate positions of exons. L, leader sequence; aI.a2, a3 refer to exons encoding external domains; TM, transmembrane domain; IC, intracytoplasmic domains.
that bind to the GGGCGG (i.e., SP1: Dynan and Tjian, 1985)and CCAAT (Maity et al., 1988; Santoro et al., 1988)sequences, the heat shock element (Carlson et al., 1984; Wu, 1984), and the IFN response element (Shirayoshi et al., 1988). With respect to murine class I MHC genes, a number of nuclear factors have been shown to bind sequences upstream from the gene (Shirayoshi et al., 1987; Baldwin and Sharp, 1987; Klein et al., 1968; Yano et al., 1987)(Fig. 3). One of these factors (H2TFl) has been cloned by Singh et al. (1988).Three different laboratories have described factors that bind to a common sequence termed region I (TGGGGA'ITCCCCA) within the enhancer A sequence of class I genes (Shirayoshi et d . ,1987; Israel et d . ,1987;
W@ I1
-203
1
Ld
-220
0
P
orQ(&-Jm
A.
'
El-'?
461 -
1
.
4 54
-1M
0
0
435
GCCAGGCGGTGAGGTCAGGGGTGGGGAAGCCCAGGGC~GGGA~CCCCATCTCCTCAG~CAC~CTGCACCTA -161
.201
ENH A
-167
-130
IFN CONSENSUS SEQUENCE (ICS) FIG. 3. Summary of DNA-binding proteins specific for enhancer A of 5'-noncoding sequence of the Ld gene. Regions I, II, and I11 of enhancer A are shown as defined by Shirayoshi et al. (1987). NF-KB, H2TF1, and KBFl refer to factors that bind to region I and are functionally related to expression of the Ld gene. The proteins, AP-1 (product of the jun oncogene) and AP-2, bind to region 11; however, their function is not known. A third class of factor has been shown by Ozato and colleagues to hind to region IZI (Burke and Ozato, 1988). but no function has yet been ascribed. ENH A, Enhancer A; IFN, interferon.
222
BRUCE E. ELLIOTT ET AL.
Yano et al., 1987). One of these factors (KBF1) also binds to a sequence within the promoter of the &m gene (Yano et al., 1987). Shirayoshi et al. (1987) have described two additional factors that bind to regions designated ‘I1and Ill, respectively, of enhancer A; however, their functional role is not known. Region I of the class I gene is of particular interest, since it also binds at low affinity to a factor that interacts with the K gene enhancer (NF-KB), (Baldwin and Sharp, 1988; Sen and Baltimore, 1986). Since NF-KB is produced in B lymphocytes, this factor could play a role in class I MHC gene expression in this cell type. In addition, the nuclear proteins AP-1, a product of the c-jun oncogene (Angel et al., 1987), and AP-2 can bind to the class I regulatory element (Imagawa et al., 1987; Lee et al., 1987; Bohmann et al., 1987). The AP-1-binding element (AATI’AGTCAGCAACCATA) is present in region ZI of enhancer A and is unable to compete for binding of factors to regions Z and 111 (K. Ozato et al., personal communication). However, to date there is no evidence that APlIAP2 binding to region I1 can influence class I MHC gene expression. The function of regions I1 and 111 of enhancer A and their DNA binding proteins remains unknown. Although much of the work is still in the preliminary stages, a functional role has been suggested for several of these elements within the promoter of class I genes. Sequences within, or close to, the IFN response element are required in order for a response to IFN to be seen (Israel et al., 1986; Korber et al., 1987; Sugita et al., 1987; Vogel et al., 1986), although sequences 3’ to the promoter are also required (Korber et al., 1987). Upon stimulation of lymphocyte or fibroblast cell lines with IFNa/P, at least two nuclear factors are induced in these cells (Shirayoshi et al., 1988).They have been shown to bind the IFN response element and possibly play a role in increasing class I gene transcription. Using competition studies, at least two factors (H2TF1 and KBFl) that bind the enhancer A (region I) sequence in the class I promoter can be shown to be responsible for turning on gene expression (Baldwin and Sharp, 1987; Israel et al., 1987). No role has yet been identified for the heat shock element in the class I promoter, although in preliminary experiments we have been unable to detect a reproducible change in the surface expression of MHC on the SP1 (clone 10.1) tumor, or in CAT activity of L cells transfected with the CAT gene under control of the MHC promoter, following incubation for 10 min at 44°C (A. Wade, R. G. Deeley, and B. E. Elliott, unpublished observations). The enhancer A sequence has been shown to have a downregulating effect on MHC gene expression in undifferentiated F9 embryonal carcinoma cells (Miyazaki et al., 1986). These cells do not express MHC mRNA in their undifferentiated state (Morello et al., 1982), but the genes become active following retinoic acid-induced differentiation (Croce et al., 1981), with the enhancer sequence losing its negative regulatory influence (Miyazaki et al., 1986). Similarly, the enhancer
MHC
ANTIGENS I N NORMAL AND MALIGNANT DEVELOPMENT
223
sequence (-195 to -161 bp) downregulated gene expression in cell lines derived from early embryos, but not in cells derived from mid- to late-stage embryos (reviewed in Burke and Ozato, 1988). Nuclear extracts from neonatal liver showed no binding activity in region Z of enhancer A, indicating that expression of the trans-acting factor is not turned on until late in development. In contrast to the murine (H-2) class I gene system, the regulation of human class I genes has only recently been studied. A promising approach has been developed by Chamberlain et al. (1988) to demonstrate tissuespecific expression of human class I MHC genes in transgenic mice. Results in this system indicate that the HLA.B7 gene has regulatory elements (in the region -12 kb to -.66 kb of the 5‘ flanking sequence) which respond to murine regulatory factors and that this gene may share a tissue-specific regulatory mechanism with H-2K, distinguishing it from H-2D. This approach will continue to generate new information about regulatory sequences in the HLA class I gene family. Although our understanding of transcriptional regulation is still far from complete, it appears that both cis-acting elements and trans-acting factors play important roles in regulating class I gene expression during normal development and in response to such factors as IFN. It is still not clear what regulates the preferential expression of one class I antigen over another in a particular tissue, the coordinate expression of class I heavy chain and Pzm, or the tissue-specific expression levels of these genes (see Section VIII, A,2). b. Altered MHC Gene Methylation Status. Apart from promoter-mediated events, MHC gene transcription has often been associated with alterations in the pattern of methylation of cystine residues within the gene itself. Sequence analysis has revealed a high concentration of CpG residues in the 5’ region of class I, Pzm, and class I1 MHC genes (Tykocinski and Max, 1984). The presence of CG clusters in the 5’ region of MHC genes is consistent with their involvement in gene expression, as many regulatory elements are located upstream to the coding sequence of the gene. The putative mechanism by which DNA methylation and CG clusters regulate gene expression may involve their structural influence on DNA conformation. Bird (1986) has proposed that CG clusters are able to interact with nuclear components and that methylation of these regions leads to inactivation of associated genes. At least for certain genes such as thymidine kinase (Reilly et al., 1982), transcriptional activity has been inversely correlated with the level of DNA methylation near that gene. Several studies have correlated DNA methylation with the developmental (Tanaka et al., 1983; Daniel-Vedele et al., 1985) and tissue-specific (Miyada and Wallace, 1986; Carrington et al., 1985)expression of some MHC genes. However, variable results are often obtained when probes specific for different regions of the
224
BRUCE E . ELLIOIT ET AL.
gene are used. On the one hand, hypomethylation of QlO gene sequences is observed in the liver with an exon 3 probe, whereas hypermethylation parallels increased QlO mRNA levels when an exon 7 probe is employed (Tanaka et al., 1986). In addition, hypermethylation of the CG-rich 5' region of H-2K has been shown to correlate with expression, although hypomethylation in the structural portion of the gene was observed (Tanaka et al., 1983). On the other hand, inactivation of H-2 genes has been associated with general hypermethylation of MHC DNA in RadLV-induced tumors (Meruelo et al., 1986). Carrington et al. (1985)have shown a decrease in DNA methylation correlated with an increase in HLA-DR gene expression. In studies of MHC and Pzm expression on the SP1 mammary carcinoma and 5-Aza-derived variants, changes in total Pzm gene methylation occurred following drug treatment, but no correlation with expression of P2m and class I MHC was seen (A,-M. Rodricks, B. White, and B. E. Elliott, unpublished observations). The variable results observed in these various systems may be due to methylation sites not detected by .the methyl-sensitive restriction endonuclease employed (HpaII), or to the specificity of the probe used.
2 . Posttranscriptional Control Relatively little is known of the posttranscriptional processes that regulate MHC class I expression. We do know, however, that following translation of the mRNA, the nascent polypeptide chain is actively passed through the endoplasmic reticulum (ER) and the signal amino acid sequence is cleaved on the luminal side of the membrane. It is during this period that the class I heavy chain associates with Pzm and a core of oligosaccharides is attached to the polypeptide. If chain association does not occur during, or shortly after (5- 10 min) synthesis, the heavy chain apparently undergoes a conformational change that subsequently inhibits Pzm association and expression of allelic epitopes (Krangel et al., 1979; Ploegh et al., 1979; Owen and Kissonerghis, 1980). The presence of Pzm appears to be a prerequisite for the transport of the heavy chain from the ER to the Golgi compartment. Studies employing Xenopus laeuis oocytes microinjected with translatable mRNA show that class I heavy chains accumulate in the ER in the absence of Pzm (Severinsson and Peterson, 1984; Kinnon and Owen, 1986). Terminal glycosylation takes place at the Golgi compartment, and class I antigen expression at the cell surface follows (Owen and Kissonerghis, 1980; Dobberstein et a l . , 1979). Mature class I bound cell surface molecules exist as freely rotating monomers until they are shed from the cell surface as large lipid-containing particles (Emerson and Cone, 1981). Because association of Pzm with class I heavy chains is required for the functional conformation of the molecule, Pzm represents an important control step in expression of MHC molecules. Although some quantitative differences exist among different tissues (e.g., the Pzm mRNA level in kidney is
MHC
ANTIGENS I N NORMAL AND MALIGNANT DEVELOPMENT
225
32% that of spleen; Morello et al., 1985), the majority of studies support coordinate regulation of P2m and class I heavy chains (Lalanne et al., 1985; Transy et al., 1984). Although the class I heavy-chain and P2m genes are structurally encoded on separate chromosomes, they share a common factor, KBF1, binding to their respective enhancers (Yano et al., 1987), and an IFN response sequence (Kimura et al., 1986) (see Section VIII,A,l). These shared regulatory mechanisms may be involved in coordinate regulation of class I H-2 and P2m gene expression. Noncoordinate expression of different class I MHC loci appears to occur frequently in malignancy (see Table 11)as well as in normal cells (O’Neill and McKenzie, 1980). One explanation for this is proposed by Beck et al. (1986). These workers showed that N-linked oligosaccharides were processed more slowly on Ld than Dd molecules. These findings suggest that differences in the rate of terminal glycosylation might lead to differential expression of class I heavy chains. It is also possible that locus-specific cis-acting control elements are involved. In summary, there are many levels at which altered MHC regulation can occur. All are potentially important in controlling the functional expression of class I molecules. B. REGULATION OF CLASSI MHC
IN
MALIGNANCY
Since our understanding of MHC regulation in normal cells is incomplete, a discussion of its regulation during carcinogenesis must be labeled speculative. Perturbation of any process detailed previously would be expected to alter class I antigen expression. At present, work has focused on two general areas: (1)oncogene influences on MHC expression, and (2) changes in class I mRNA within tumors.
1 . Oncogene Influences on M H C Regulation Although the mechanism by which various oncogenes appear to be associated with altered MHC expression is not known, several findings provide some insight into this question. Oncogenes whose product is itself a transcription factor have the potential to regulate class I MHC transcription directly (Fig. 3). The c-jun oncogene is a likely candidate (Haluska et al., 1988), since this gene encodes the DNA-binding protein AP-1 (Bohmann et al., 1987), which was found to bind within the class I gene (enhancer A, region I , see Section VIII,A,2 and Fig. 3). In addition, the c-fos product has been shown to interact with AP-1, thereby stimulating transcription of the AP-l-responsive element (Chiu et al., 1988). Less well-understood nuclear oncogenes such as the myc family (Kaibuchi et al., 1986) might also exert regulatory effects on the class I genes. Oncogenes such as ras whose product (P21) perturbs the CAMPor protein
226
BRUCE E . ELLIOTT ET AL.
kinase C (PKC) pathways (Stern et al., 1986; Chiarugi et al., 1987) could indirectly influence MHC gene transcription. For example, CAMP can activate transcription factor AP-2, while PKC can activate AP-1, AP-2, and NF-KBfactors (Imagawa et al., 1987). As mentioned before, both AP-1 and AP-2 are activated by TPA via PKC (Lee et al., 1987), and can bind to region I1 of enhancer A of the 5' regulatory region of MHC, although the functional significance of this binding remains unknown. These factors and their binding properties are distinct from the binding of factors H2TF1, NF-KB, and KBF1, described in Section VIII,A,l (Burke and Ozato, 1988). The multiplicity of, and interrelationships among, various transacting factors and oncogenes is depicted in Fig. 4. In contrast to the transcription factors just described, Ad12 E1A has been shown not to bind to or influence the function of enhancer A. Vaessen et al. (1987) have shown that the primary event in E1A-mediated suppression of class I MHC is posttranscriptional, most likely involving RNA processing or transport to the cytoplasm. It also is possible that some oncogenes could elicit effects at a posttranslational level. One example includes oncogenes (e.g., c-fps), which are capable of perturbing phospholipase C, an enzyme specific for phosphatidylinositol (Jackowski et al., 1986). MHC antigens such as Qa-2 that are anchored to the membrane via a phospholipid tail (Stroynowski et al., 1987) cold be potential targets of phospholipase C activity, resulting in selective release from the cell membrane. Although very speculative, this discussion points out the multiplicity of trans-acting factors and regulating elements that could potentially affect MHC gene expression. 2. Changes in Class I within Tumors
There are numerous reports of altered class I MHC expression in malignancy. Hammerling et al. (1987a) have described two types of commonly occurring lesions. Type I tumors expressed P2m but no class I heavy-chain mRNA or protein. Only trace levels of transfected class I MHC expression were observed in type I tumors. However, both exogenous and endogenous MHC genes were induced by IFN. The most likely explanation for the defect is lack of an appropriate trans-acting factor. In contrast, type II tumors showed lack of class I heavy-chain mRNA and peptide, and were noninducible with IFN. The nature of the defect in this class of tumor remains unknown. There are other tumors that do not fit into the two categories described here (Table VI). One type includes tumors that are defective in both Pzm and class I mRNA production [e.g., line 1lung carcinoma (Bahler et al., 1988), and the SP1 mammary carcinoma (Elliott et al., 1989)]. Both class I MHC and P2m were inducible with IFN; however, line 1was a permissible host for expression of transfected MHC genes. Another type includes tumors
MHC
ANTIGENS IN NORMAL A N D MALIGNANT DEVELOPMENT
227
, TNF
FIG. 4. Proposed model of trans-acting factors in MHC expression. A proposed model of the network of DNA-binding factors in MHC regulation is shown. The activities of AP-1, AP-2, and NK-KB are modulated by protein kinase C (PKC), which in turn is activated by the second messenger, diacylglycerol, or directly by TPA (Imagawa et al., 1987). AP-2 can also be activated by cyclic AMP (CAMP),the production of which is catalyzed by adenylate cyclase (AC). Transformation by the ras gene product P21 leads to perturbation of both PKC and AC signal transduction pathways and may therefore indirectly modulate the function of both AP-1 and AP-2 proteins (Imagawa et al., 1987). The c-fos protein interacts with c-junlAP-1, thereby stimulating transcription of the AP-1 responsive element (Chiu et al., 1988). Tumor necrosis factor (TNF) and IFNalP interact via an unknown pathway with the IFN consensus sequence (ICS) (Burke and Ozato, 1988). Enhancer A-binding proteins NF-KBand KBFl cross-react with the enhancer region of the ZgK and P2m genes, respectively. PM, Plasma membrane; NM, nuclear membrane.
with class I heavy chains but lacking P2m peptides. Two types of P2m defects have been described. One exhibits normal levels of P2m mRNA but no P2m peptide, indicating a posttranscriptional control (e.g., YAC-1 A. H-2-loss variants; Ljunggren et al., 1989). The other lacks both P2m mRNA and P2m peptides (e.g., R1.1 mutants (Parnes et d., 1986)). Finally, H-2-10s variants have been described that express intact class I and P2m chains, but these chains somehow fail to associate to form a functional MHC molecule (e.g.,
TABLE VI OF VARIOUSLEVELSOF REGULATIONOF CLASSI MHC EXPRESSION IN MALIGNANCY EXAMPLES Tumor Examined Endogenous MHC
Class I gene Pem gene
Class I mRNA P2m mRNA P2m Peptide Class I peptide Surface MHC expression Induction with IFN Transfected MHC Expression Induction with I F N a
f L
Type I*
Type IIb
SPlc
Line 1 lung carcinomad
YAC-1 Variantse
R1.1 Mutantsf
RBLS Variantsa
Present Present
Present Present
Present Present
Present Present
Present Present
Present Deletion
Present Present
-
+ + +
-
+ +
-
-
+ Trace
+
-
LOW LOW NT
+ ++
NT NT
+ + +
+
-
+ + -
-
+ + ++
NT NT
Includes 15-20% of MC-induced sarcomas (Hammerling et al. 1987a) and Adl2-transformed tumors (Schrier et al. 1983). Includes the 3LL carcinoma and the IC9 MC-induced sarcoma (Hammerling et al. 1987a). Elliott et a!. (1989). Bahler et al. (1988). Ljunggren et al. (1988). TL/H-e-loss variants isolated following MNNG mutagenesis of R1.1 (C58 mouse) thymoma (Parnes et al., 1986). Ljunggren et al. (1988)
+ +
NT NT
NT NT
MHC
ANTIGENS IN NORMAL AND MALIGNANT DEVELOPMENT
229
RBL-5 variants RMA-S and RMB-S; Ljunggren et al., 1989). Thus, defects at both transcriptional and posttranscriptional levels have been described. In certain cases (see Table 111), correction of the defect by MHC gene transfection was shown to increase the immunogenicity of the tumor in question. IX. Organ- and Tissue-Specific Effects on Immune Surveillance and Tumor Progression
There are many aspects of the host-tumor relationship relevant to the question of MHC and cancer. One issue that has received little attention in tumor immunology is the influence of local microenvironment. Several studies have demonstrated both immunological and nonimmunological influences of tissue site on tumor growth. From an immunological viewpoint, tissue-specific patterns of lymphocyte migration can led to preferential enrichment of distinct T- and B-cell subsets in different organs (Butcher, 1986). From a nonimmunological perspective, it is well established that organ and tissue site can influence differentiation, growth, metastasis of malignant cells (Fidler, 1984; Hart, 1982; Tarin et al., 1984; Giavazzi et al., 1986). Organ preference in growth and dissemination of tumor cells, and in the homing of lymphocytes are complementary aspects of host-tumor interactions that could significantly influence the outcome of host immune surveillance of cancer.
A. COMPARTMENTALIZATION OF THE IMMUNESYSTEM An important aspect of the host immune defense system is its organ compartmentalization. The fact that effector cell types exhibit specific patterns of migration and recirculation has great importance in assessing the role of such effector cells in host defense. This field has been extensively reviewed elsewhere (Butcher, 1986) and is briefly summarized here. There are three major compartments of the immune system: nonrecirculating (humoral), recirculating (via lymphatics into the thoracic duct), and interstitial (e.g., skin, and glandular tissue). Different lymphocyte subsets show distinct patterns of distribution among these compartments. The nonrecirculating pool includes pre-B cells (bone marrow), pre-T cells (thymus), and N K cells. Recirculating cells include mature virgin T and B cells, antigen-activated large T and B blasts, and long-term memory cells. Recirculation of resting lymphocytes occurs by migration via the postcapillary venules of the lymph node (Butcher, 1986). This process involves organ-specific adhesion of the lymphocytes to the high endothelial cells followed by specific ligand interactions between the lymphocyte and the endothelial cell. Butche r and colleagues have identified a 90-kDa glycoprotein class of lymphocyte surface homing receptors for endothelium in murine (Butcher, 1986) and
230
BRUCE E. ELLIOTT ET A L .
human systems (Jalkanen et al., 1987). An antibody (MEL-14), which inhibits lymphocyte binding to peripheral lymph node but not Peyer’s patch endothelium, was generated against the mouse 90-kDa glycoprotein (Butcher, 1986). Likewise, an antibody (HERMES-3) that inhibits binding to mucosal endothelium was generated by immunization with a human mucosal HEV (high endothelial venu1e)-specific 85- to 95-kDa glycoprotein (Jalkanen et al., 1987). In addition, tissue-specific ligands, designated addressins, have been identified on mucosal (MECA-367, Streeter et al., 1988b) and peripheral lymph node (MECA-79, Streeter et al., 1988a) endothelial cells. Mesenteric lymph nodes express both MECA-367 and MECA-79, and show binding of both types of lymphocytes. Interestingly, HERMES-3 epitopes were also detected to lamina propria and mammary gland lymph node endothelium, raising the possibility that these organs have specificities of lymphocyte migration similar to Peyer’s patches. Nonlymphoreticular cells such as mature granulocytes, monocytes, and neutrophils also express MEL-14 and HERMES-3 epitopes, raising the possibility that migration of these cell types might also be influenced by tissue-specific receptors (Butcher, 1986). Superimposed on the trafficking pattern of resting lymphocytes is the very directed antigen-specific homing of large activated blasts. These cells home preferentially back to their tissue of origin and are most numerous at the challenge site because of antigen-specific memory cell proliferation (Butcher, 1986). T- and B-cell receptor repertoires therefore can be distinct at different tissue sites. In addition, LAK cells, macrophages, and polymorphonuclear cells are capable of migrating throughout the body nonspecifically, and are responsive to various lymphokines and chemotactic factors. The consequence of organ-specific recirculation of lymphocytes is that different effector cell types are likely to be important in immune surveillance and tumor rejection in different organ sites. On the one hand, tumors spreading by the lymphatic system would be influenced primarily by T cells and LAK but not NK cells. On the other hand, tumors that originate in or enter into the systemic circulation (e.g., certain leukemias and lymphomas, and cells from solid tumors that have undergone extravasation) would be immediately susceptible to NK cells, with T cells playing a later role if appropriate immune activation occurs.
B. INFLUENCE OF TISSUESITE ON TUMORGROWTHA N D METASTASIS: IMPLICATIONS FOR STUDIESON TUMOR IMMUNOGENICITY There is a growing body of evidence that tumor growth and metastasis in rodents and in humans depends on the interaction of tumor cells with host factors including organ microenvironment (Fidler, 1984; Tarin et al., 1984;
MHC
ANTIGENS IN NORMAL AND MALIGNANT DEVELOPMENT
231
Giavazzi et al.,1986; Natio et al., 1986). Most human soft tissue tumors grow slowly, and are poorly, if at all metastatic, when transplanted subcutaneously into nude mice. However, outgrowth of highly metastatic cells occur following injection in nude mice of certain human renal and bladder carcinomas into orthotopic sites (corresponding to the tissue site of tumor origin; Natio et al., 1986; Aherling et al., 1987). The reasons for this observation are complex and reflect properties of both the tumor and the host. The site of tumor injection can also influence the pattern of tumor differentiation. For example, both stromal and epithelial components of the mammary gland can influence growth and differentiation of normal (Hoshino, 1962), preneoplastic (DeOme et al., 1959), and neoplastic (Miller and McInerney, 1988) mammary cells. In addition, terminal differentiation of teratocarcinoma cells, leading to nonmalignant growth, occurs following injection into the blastocyst (Pierce et al., 1982). Thus tissue microenvironment can significantly influence growth and differentiation of malignant cells. Elliott et al. (1987)have examined the influence of host microenvironment on tumor growth behavior and on expression of class I MHC molecules using a low MHC-expressing mammary carcinoma, SP1. They demonstrated increased expression of class I MHC antigens and luminal and basal epithelial markers on 30-40% of SP1 cells during growth in the mammary gland compared to the subcutaneous site. The SP1 tumor is nonmetastatic from the subcutaneous site, but lung metastases developed in -35% of animals bearing intramammary tumor transplants. All lung metastases lacked MHC antigens but retained expression of both luminal and epithelial markers. The phenotypic alterations were stable in that tumor cells from metastatic nodules maintained metastatic and low MHC-expressing phenotypes when reinjected into either sc or intramammary sites. These experiments clearly indicate that tissue microenvironment can influence expression of immunologically important surface antigens, including MHC molecules. Such phenotypic alterations could have important impact on host-tumor interactions, and the outgrowth of more progressive tumor subpopulations. Indeed, preliminary karyotypic analysis indicates that selection and/or induction of rare SPl tumor subpopulations occurs during intramammary growth and metastasis. In summary, studies have shown that organ microenvironment can significantly influence both immune and nonimmune host-tumor interactions. The impact of anatomical compartmentalization of the immune system is that different organs possess distinct subsets of immunocompetent cells. Tissuespecific influences (e.g., extracellular matrix components, growth factors, and hormones) can also alter tumor growth, differentiation, and metastasis. Tissue microenvironment should therefore receive careful consideration in studies of tumor immunogenicity.
232
BRUCE E. ELLIOlT ET AL.
X. Concluding Remarks
From the studies reviewed in this article, it is clear that at least in certain animal tumor models class I MHC antigens can influence in uiuo tumor growth. Whether altered MHC expression can influence human malignancies is not known. There are several important questions that address this issue. Some of these are described here as future areas of investigation.
1. Can Altered Class I MHC Expression Affect the lmmunogenicity of Human Cancer? To date, there is no direct evidence for immunosurveillance of human cancer, except in certain rare diseases involving a suppression of the immune system (e.g., Kaposi’s sarcoma in patients with acquired immunodeficiency syndrome; Ziegler, 1987). Therefore, we cannot predict how altered MHC antigen expression would affect immunogenicity of human tumors. At some point the relevance of MHC antigens in malignancy has to be tested directly in real human cancer situations. In uitro p2m and HLA gene transfection studies as described by Perarnau et al. (1988)and Storkus et al. (1989) respectively, (Section VI,B) indicate that at least in certain cultured human cell lines, MHC can directly influence one component of host defense, namely susceptibility to NK cells. To test the effect of increased MHC expression on tumor immunogenicity and patient survival, in uiuo immunizations are required. Such a strategy has already been tested by Degiovanni et al. (1988).These workers have demonstrated that in uiuo immunization of a stage I melanoma patient with autologous melanoma cells mutagenized with MNNG treatment can trigger a Tc response that cross-reacts with the autologous parent tumor in vitro. Perhaps a similar approach with transfected HLA genes would be informative. Whether such immunization processes would lead to an immunoprotective response against the original tumor deserves serious investigation.
2 . What Can W e Learn from Animal Tumor Models? The message from work with animal tumor models is that with the exception of studies with inherently immunogenic tumors (i.e., experimentally induced tumor systems), augmentation of class I MHC antigen levels does not alone render tumors immunogenic (see Table 111). Nevertheless, certain immunogenic animal tumors, such as the ultraviolet-induced sarcomas or melanomas, may be useful models of corresponding human cancers with similar etiologies. Animal tumor models will be required to determine whether augmentation of MHC levels and/or host immune status, using biological response modifiers such as IFN and IL, can effectively promote immune responsiveness to malignancies.
MHC
ANTIGENS I N NORMAL AND MALIGNANT DEVELOPMENT
233
3. The Impact of Tumor Heterogeneity: What Tumor Subtype Should be Targeted? An important property of tumors relevant to immunosurveillance is their inherent instability leading to intratumor heterogeneity (Nowell, 1976; Heppner, 1982; Nicolson, 1987). There are two levels of heterogeneity that could affect the outcome of host-tumor immune interactions: the generation of antigen-loss or MHC-loss variants, and variation in tumor stem cell potential (Von Hoff et al., 1983). In most cases the outgrowth of more malignant phenotypes (e.g., antigen-MHC-loss or metastatic variants) occurs by selection of tumor subpopulations present in the primary tumor at low frequency or by induction of new tumor subtypes (Boon, 1983; Urban et al., 1982; Dennis et al., 1981; Elliott et al., 1989). Studies of tumor stem cells (i.e., cells with proliferative and differentiating ability; Johns and Mills, 1983; Sutherland et al., 1983; Von Hoff et al., 1983) indicate that stem cells in human tumors often represent a very low frequency (10-15%) of the total tumor mass. Thus the vast majority of malignant cells may have substantially different phenotypic-genotypic properties than the stem cells. An understanding of the mechanisms by which tumors can alter their immunogenic, metastatic, and stem cell phenotypes is therefore critical in assessing the role of MHC antigens in human malignancy.
4 . What Are the Requirements for Tumors to Stimulate Class 1-Restricted T Cells? One of the resounding observations to emerge from tumor transplantation studies is that cells are not all endowed with equal ability to present alloantigen. The precise nature of the immunogenic interaction between T-cell and APC, and the consequence of delivery of suboptimal accessory signals by tumor cells is unresolved and potentially complex. Efforts to promote more effective delivery of accessory signals by tumors themselves, MHC expression being one relatively simple example, may prove fruitful. In this sense the limited but significant success of increasing tumor immunogenicity by MHC gene transfection represents the beginning of a formal strategy to “convince” the tumor cell to present putative antigen as effectively as possible.
5. Finally, Is There a Nonimmunological Aspect of MHC Function Relevant to the Biology of Malignancy? It is clear that the scope of MHC functions extends beyond immunological boundaries, but it is premature to speculate about whether such functions are relevant in any way to progressive malignant disease.
234
BRUCE E. E L L I O l T ET AL.
ACKNOWLEDGMENTS We wish to thank the many authors referred to in this article for kindly making available new information in press or as personal communications at the time of writing. In addition, Dr. Peter Cresswell, Dr. Soldano Ferrone, Dr. Arnold Greenberg, Dr. Tina Haliotis, Dr. Keiko Ozato, Dr. Peter Parham, Dr. Hans Schrieber, and Dr. Thomas Wegmann generously assisted in critically reviewing portions of this manuscript. We also acknowledge the meticulous editing and typing assistance of Joan Dentry and Sandra Tirelli. This work was supported by grants to Dr. Bruce E. Elliott from the National Cancer Institute of Canada and the Medical Research Council of Canada. Dr. Bruce E. Elliott is a Terry Fox Research Scientist of the National Cancer Institute of Canada, Dr. Douglas A. Carlow is supported by the Leukemia Society of Canada. Dr. Andrew Wade was supported by a fellowship from the Medical Research Council of Canada.
REFERENCES Adorini, T., Muller, S., Cardinaux, F., Lehmann, P. V., Falconi, F., and Nagy, Z. A. (1988). Nature (London) 334, 623-625. Aherling, T. E., Dubeau, L., and Jones, P. A. (1987). Cancer Res. 47, 6660-6665. Ajitkumar, P., Geier, S. S., Kesari, K. V., Borriello, F., Nakagawa, M., Bluestone, J . A,, Saper, M. A., Wiley, D. C., and Nathenson, S. G . (1988). Cell 54, 47-56. Alon, Y., Hammerling, G. J., Segal, S., and Bar-Eli, M. (1987). Cancer Res. 47, 2553-2557. Ando, K. I . , Nakashimi, I., Nagase, F., Isobe, K. I.. Kawashima, K., Hasegawa, Y., Yoshida, T., Iwamoto, T., Hasegawa, T., Muro, Y.,and Ohashi, M. (1988).J. Zmmunol. 40, 723729. Angel, P., Imagawa, M., Chiu, R., Stein, B., Imbra, R. J., Rahmsdorf, H. J., Jonat, C., Herrlich, P., and Karin, M. (1987). Cell 49, 729-739. Armstrong, H. E. , Bolton, E. M., McMillan, I., Spencer, S. C., and Bradley, J. A. (1987).J. E x p . Med. 165, 891-907. Arnold, L. B., Burgert, H.-G., Archibald, A. L., and Kvist, S. (1984). Nucleic Acids Res. 12, 9473-9487. Arnold, L. B . , Horstmann, U., Kuon, W., Burgert, H. G., Hammerling, G. J., and Kvist, S. (1985). Proc. Natl. Acad. Sci. USA 82, 7030-7034. Bahler, D. W., Frelinger, J. G., Harwell, L. W., and Lord, E. M. (1987). Proc. Natl. Acad. S c i . USA 84, 4562-4566. Bahler, D. W., Cerosaletti, K. M., Lord, E. M., and Frelinger, J. G. (1988).J. Zmmunol. 140, 4003-4012. Bailey, D. W. (1982).J. Zmmunol. 5, 23-24. Baldacci, P., Pozo, F., Gisselbrecht, S., and Kourilsky, P. (1983).J. E x p . Med. 158, 1294-1306. Baldwin, A. S., J r . , and Sharp, P. A. (1987). Mol. Cell. Biol. 7, 305-313. Baldwin, A. S . , Jr., and Sharp, P. A. (1988). Proc. Natl. Acad. Sci. USA 85, 723-727. Barber, B., Smith, M. H., Allen, H., and Williams, D. B. (1988). In “MHC + X: Complex Formation and Antibody Induction” (P. Ivanyi, ed.). Springer-Verlag, Berlin and New York. Barnstable, C. J . , Bodmer, W. F., Brown, G., Galfre, G., Milstein, C., Williams, A. F., and Ziegler, A. (1978) Cell 14, 9-20. Barzilay, J., Kushtai, G., Feldman, M., and Eisenbach, L. (1987). Leukemia 1, 198-204. Basombrio, M. A. (1970). Cancer Res. 30, 2458-2462.
MHC
ANTIGENS I N NORMAL AND MALIGNANT DEVELOPMENT
235
Beck, J. C., Hansen, T. H., and Lee, D. R. (1986)J. Zmmunol. 137, 916-923. Benson, M. T., Buckley, G . , Jenkinson, E. J., and Owen, J. T. T. (1987).Zmmunology 60,593596. Berger, S. A,, and Bernstein, A. (1985). Mol. Cell. B i d . 5, 305-312. Bernards, R . , (1987). Trends Genet. 3, 298-301. Bernards, R . , Schrier, P. I., Houweling, A., Bos, J. L., Van der Eb, A. J., Zijlstra, M., and Melief, C. J. M. (1983). Nature (London) 305, 776-779. Bernards, R., Dessain, S. K., and Weinberg, R. A. (1986). Cell 47, 667-674. Bevan, M. (1987). Nature (London) 325, 192-194. Bierer, B. E., and Burakoff, S. J. (1988). FASEB J. 2, 2584-2590. Bierer, B. E., Peterson, A., Barbosa, J., Seed, B., and Burakoff, S. J. (1988). Proc. Natl. Acad. Sci. USA 85, 1194-1198. Bierer, B. E., Sleckman, B. P., Ratnofsky, S. E., and Burakoff, S. J. (1989). Annu. Reo. Zmmunol. 7, 573-599. Bird, A. P. (1986). Nature (London) 321, 209-213. Bishop, J. M . (1985). Cell 42, 23-38. Bishop, J. M. (1987). Science 235, 305-311. Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S., Strominger, J. L., and Wiley, D. C. (1988). Nature (London) 329, 512-518. Bohmann, D., Bos, T. J . , Admon, A., Nishimura, T., Vogt, P. K., andTjian, R. (1987). Science 238, 1386-1392. Boon, T. (1983). Ado. Cancer Res. 39, 121-151. Bowen, K. M., Prowse, S. J., and LalTerty, K. J. (1981). Science 213, 1261-1262. Brickell, P. M . , Latchman, D. S., Murphy, D., Willison, K., and Rigby, P. W. J. (1985). Nature (London) 316, 162-163. Brodsky, F. M., Bodmer, W. F., and Parham, P. (1979) Eur. J. Zmmunol. 9, 536-545. Bukowski, J. F., and Welsh, R. M. (1985)./. E x p . Med. 161, 257-262. Burke, P. A,, and Ozato, K. (1989). In “The Year in Immunology-1988”0. M. Cruse and R. E. Lewis, eds.) 4, 23-40. Burnet, M. (1964). N . Engl. J. Med. 20, 154-158. Butcher, E. C. (1986). Curr. Top. Microbiol. Zmmunol. 128, 85-122. Callahan, R . , Drohan, W., Gallahan, D., D’Hoostelaere, L., and Potter, M. (1982).Proc. Natl. Acad. Sci. USA 79, 4113-4117. Carlow, D. A., Kerbel, R. S.,Feltis, J. T., and Elliott, B. E. (1985).J. Natl. Cancer Inst. 75, 271-301. Carlow, D. A., Kerbel, R. S., and Elliott, 8. E. (1989).J. Natl. Cancer Inst. (in press). Carlson, G . A., Taylor, B. A., Marshall, S. T., and Greenberg, A. H. (1984). Zmmunogenetics 20, 287-300. Carrington, M . N . , Salter, R. D., Cresswell, P., and Ting, J. P.-Y. (1985). lmmunogenetics 22, 219-229. Celis, E., Hale, A. H., Russell, J. H., and Eisen, H. N. (1979).J. Zmmunol. 122, 954-958. Chamberlain, J. W., Nolan, J. A,, Conrad, P. J . , Vasavada, H. A,, Ganguly, S., Janeway, C. A., Jr., and Weissman, S. M. (1988). Proc. Natl. Acad. Sci. USA 85, 7690-7694. Chatterjee-Hasrouni, S., and Lala, P. K. (1982).J. E x p . Med. 155, 1679-1689. Chiarugi, V., Ruggiero, M., and Porciatti, F. (1987). Cancer Znoest. 5, 215-229. Chiu, R . , Boyle, W. J., Meek, J., Smeal, T., Hunter, T., and Karin, M. (1988). Cell 54, 541552. Claas, F. H. J., van Ree, J. M., and Verhoeven, W. M. A. (1986). Hum. Zmmunol. 15, 347. Clark, D. A., Slapsys, R . , Chaput, A., Walker, C., Brierley, J.. Daya, S., and Rosenthal, K. L. (1986). Am. J. Reprod. Zmmunol. Microbiol. 10, 100-104.
236
BRUCE E. ELLIOTT ET AL.
Codington, J. F., Das, H. R., Dalianis, T.. Klein, G., Miller, S . C., and Silber, C. (1983). Cancer Res. 43, 4373-4381. Coffin, J. (1982). In “RNA Tumor Viruses” (R. Wiess, N . Teich, H. Varmus, and J. Coffin, eds.), pp. 1109-1204. Cold Spring Harbor Lab., Cold Spring Harbor, New York. Cole, G . A,, Clements, V. K., Garcia, E. P., and Ostrand-Rosenberg, S. (1987). Proc. Natl. Acad. Sci. USA 84, 8613-8617. Collins, T., Korman, A. J., Wake, C. T., Boss, J. M., Kappes, D. J., Fiers, W., Auk, K. A,, Girnbrone, M. A., Strominger, J. L., and Pober, J. S . (1984). Proc. Natl. Acad. Sci. USA 81, 4917-4921.
Cosman, D., Kress, M., Khoury, G., and Jay, G. (1982). Proc. Natl. Acad. Sci. USA 79,49474951.
Croce, C. M., Linnenbach, A., Huebner, K., Parnes, J. R . , Margulies, D. H., Appella, E., and Seidman, J. G . (1981). Proc. Natl. Acad. Sci. USA 78, 5754-5758. Cudkowicz, G., and Bennett, M. (1971). J . E x p . Med. 134, 82-102. Dallman, M. J., Wood, K. J., and Morris, P. J. (1987). /. Exp. Med. 165, 566-571. Daniel-Vedele, F., Israil, A , , Benicourt, C., and Kourilsky, P. (1985). Zmmunogenetics21,601611.
Davidson, W. F., Kress, M., Khoury, G., and Jay. G. (1985).J . Biol. Chem. 260, 13414-13423. Degiovanni, G . , Lahaye, T., Herin, M., Hainaut, P., and Boon, T. (1988). Eur. J . Zmmunol. 18, 671-676.
Dennert, G., Landon, C., Lord, E. M., Bahler, D. W., and Frelinger, J. G. (1988). J . Zmmu-
nol. 140, 2472-2475. Dennis, J., Donaghue, T., Florian, M., and Kerbel, R. S. (1981). Nature (London) 292, 242245.
DeOme, K. B., Faulkin, L. J., Bern, H. A.. and Blair, P. B. (1959). Cancer Res. 10,515-525. De Plaen, E., Lurquin, C., Van Pel, A., Mariam, B., Szikora, J.-P., Wolfel, T., Sibille, C., Chomez, P., and Boon, T. (1988). Proc. Natl. Acad. Sci. USA 85, 2274-2278. de Waal, R. M. W., Bogrnan, M. J. J., Maass, C. N., Cornelissen, L. M . H., Tax, W. M. J., and Koene, R. A. P. (1983). Nature (London) 303, 426-429. Dobberstein, B., Garoff, H., and Warren, G. (1979). Cell 17, 759-769. Doherty, P. C., and Allan, J. E. (1986). Eur. J . Zmmunol. 16, 1237-1242. Doherty, P. C., Knowles, B., and Wettstein, P. J. (1984). Ado. Cancer Res. 42, 1-65. Doll, R. (1980). Cancer (Amsterdam) 45, 2475-2485. Doyle, A., Martin, W. J., Funa, K., Gazdar, A,, Carney, D., Martin, S . E., Linnoila, L., Cuttitta, F., Mulshine, J., Bunn, P., and Minna, J. (1985). J . E x p . Med. 161, 1135-1151. Dukuabus, T., Ahrlund-Richter, L., Merino, L.,Klein, E., and Klein, G. (1981). Zmmirnogenetics 12, 371-380. Dynan, W. S . , and Tjian, R . (1985). Nature (London) 316, 774-778. Edidin, M. (1983). Immunol. Today 4, 269-270. Edidin, M. (1986). Hum. Zinmunol. 15, 357-365. Edidin, M. (1988). Zmmunol. Today 9, 218-219. Eisenbach, L., Segal, S . , and Feldrnan, M. (1983). Znt. J . Cancer 32, 113-120. Elliott, B. E., Carlow, D. A., Ivimey, L., Arnold, M., Hampton, N., and Bosman, P. (1987). Cancer Res. 47, 4915-4923. Elliott, B. E., Maxwell, L., Arnold, M., Wei, W. Z., and Miller, F. R. (1988). Cancer Res. 48, 7237- 7245.
Elliott, 8. E., Brissette, L., Deeley, R. G., Mudrik, K., Marshall, J., and Holden, J. J. A. (1989). Cancer Res. (in press). Emerson, S. G . , and Cone, R. E. (1981). J . Zmmunol. 127, 482-488. Faustrnan, D., Hauptfield, V., Lacy, P. E., and Davie, D. (1982). Proc. Natl. Acad. Sci. USA 79, 4153-4155.
MHC
ANTIGENS I N NORMAL AND MALIGNANT DEVELOPMENT
237
Ferguson, A., Moore, M., and Fox, H. (1985). Br. J. Cancer 52, 551-563. Ferry, B., Halttunen, J., Leszczynski, D., Schellekous, H., Meide, P. H., and Hayry, P. (1987). Transplantation 44, 499-503. Festenstein, H., and Labeta, M. (1987). In “H-2 Antigens: Genes, Molecules and Function” (C. S. David, ed.), pp. 589-610. Plenum, New York. Fidler, 1. J. (1984). In “Cancer Invasion and Metastasis: Biologic and Therapeutic” ( G . L. Nicolson and L. Milas, eds.), pp. 5-26. Raven, New York. Flavell, R. A., Allen, H., Burkly, L. C., Sherman, D. H., Waneck, G. L., and Widera, G. (1986). Science 233, 433-437. Flores, R. V., and Gilmer, P. J. (1984).J . Zmmunol. 132, 2767-2774. Flyer, D. C., Burakoff, S. J., and Faller, D. V. (1985).J. Zmmunol. 135, 2287-2292. Foley, E. J. (1953). Cancer Res. 13, 835-837. Forbes, R. D. C., Parfrey, N. A., Gomersall, M., Darden, A. G., and Guttman, R. D. (1986).J. Erp. Med. 164, 1239-1258. Funa, K., Gazdar, A. F., Minna, J. D., and Linnoila, R. I. (1986). Lob. Znoest. 55, 186-193. Garman, R. D., Jacobs, K. A., Clark, S. C., and Riulet, D. A. (1987). Proc. Natl. Acad. Sci. USA 84, 7629-7633. Garrett, C. T. (1986). Clin. Chim. Acta 156, 1-40. Garrido, M. L., Perez, M., Delgado. C., Rojano, J., Algarra, I., Garrido, A,, and Garrido, F. (1986).J. Zmmunogenet. 13, 159-167. Ceraghty, D. E., Koller, B. H., and Orr, H. T (1987). Proc. Natl. Acad. Sci. USA 84, 91459149. Giavazzi, R . , Campbell, D. E., Jessup, J. M., Cleary, K., and Fidler, I. J. (1986). Cancer Res. 46, 1928-1933. Gill, R. G., Wang, Y., and Lafferty, K. J. (1988). Transplant. Proc. 20, 61-63. Gingras, C., Goldberg, G., Greenberg, A. H., and Wright, J. A. (1988).Cancer Res. 48,69997003. Globerson, A,, and Feldman, M. (1964).J. Natl. Cancer Znst. 32, 1229-1243. Goldstein, S. A. N., and Mescher, M. F. (1986).J . Zmmunol. 137, 3383-3392. Goldstein, S. A. N., and Mescher, M. F. (1987).J. Zmmunol. 138, 2034-2043. Gooding, L. R. (1982).J. Zmmunol. 129, 1306-1312. Gopas, J., Segal, S . , Hammerling, G., Bar-Eli, M., and Rager-Zisman, B. (1988). Zmmunol. Lett. 17, 261-265. Corer, P. A. (1938).J . Pathol. Bacteriol. 47, 231-252. Greenberg, A. H., Egan, S. E., Jarolim, L., Gingras, M.-C., and Wright, J. A. (1987). Cancer Res. 47, 4801-4805. Gross, L. (1943). Cancer Res. 3, 326-333. Haddada, H., Lewis, A. M., Jr., Sogn, J. A., Coligan, J. E., Cook, J. L., Walker, T. A., and Levine, A. S. (1986). Proc. Natl. Acad. Sci. USA 83, 9684-9688. Haluska, F. G., Huebner, K., Isobe, M., Nishimura, T., Croce, C. M., and Vogt, P. K. (1988). Proc. Natl. Acad. Sci. USA 85, 2215-2218. Hammerling, G . J., Klar, D., Pulm, W., Momburg, F., and Moldenhauer, G. (1987a). Biochim. Biophys. Acta 907, 245-259. Hammerling, C. J., Klar, D., Maschek, U . , Pulm, W., and Strumhofel, K. (1987b). In “H-2 Antigens: Genes, Molecules and Function” (S. C. David, ed.), pp. 705-718. Plenum, New York. Harel-Bellan, A,, Quillet, A,, Marchiol, C., DeMars, R., Tursz, T., and Fradelizi, D. (1986). Proc. Natl. Acad. Sci. USA 83, 5688-5692. Hart, 1. R. (1982). Cancer Metastasis Reo. 1, 5-17. Helle, M., Brakenhoff, J. P. S., De Groot, E. R. D., and Aarden, L. A. (1988). Eur. J. Zmmunol. 18, 957-959.
238
BRUCE E. ELLIOTT ET AL.
Hellstrom, K. E., and Hellstrom, I. (1969). Ado. Cancer Res. 12, 167-216. Heppner, G . H. (1982). Cancer Res. 44, 2259-2265. Herrmann, S. H., Weinburger, O., Burakoff, S. J., and Mescher, M. F. (1982). J . lmmunol. 128, 1968-1974. Hewitt. H. B., Blake, E. R . . and Walder, A. S. (1976). Br. J . Cancer 33, 241-259. Hodgkin, P., Bond, M. W., O'Garra, A., Frank, G., Lee, F ., Coffman, R. L., Zlotnik, A,, and Howard, M. (1988). J , lmmunol. 141, 151-157. Hoglund, P., Ljunggren, H.-G., Ohlen, C., Ahrlund-Richter, L., Bieberich, C., Jay, G . , Scangos, G., Klein, G., and Karre, K. (1988). J . Erp. Med. 168, 1469-1474. Holden, C. A., Sanderson, A. R., and MacDonald, D. M. (1983). J . Am. Acad. Dennatol. 9, 867-871. Holmes, N., and Parham, P. (1985). EMBO J . 4, 2849-2854. Holtkamp, B., Lindahl, K. F., Segall, M., and Rajewsky, K. (1979). lmmunogenetics 9, 405421. Hood, L., Steinmetz, M., and Malissen, B. (1983). Annu. Reo. lmmunol. 1, 529-568. Hoshino, K. J. (1962). J . Natl. Cancer lnst. 29, 835-851. Hostetler, L. W., and Kripkie, M. L. (1988). J . lmmunol. 140, 666-670. Hui, K., Groxveld, F., and Festenstein, H. (1984). Nature (London) 311, 750-752. Hunkapiller, T., and Hood, L. (1986). Nature (London) 323, 15-16. Hunziger, R. (1987). Ph.D. Thesis, Univ. of Alberta, Edmonton. Imagawa, M., Chiu, R . , and Karin, M. (1987). Cell 51, 251-260. Inaba, K., Witmer, K., Pack, M. D., Inaba, M., Muramatsu, S., and Steinman, R. M. (1988).J . E x p . Med. 167, 149-162. Infante, A. J., Boulware, S . , and Cagle, M. (1988). J . lmmunol. 140, 2462-2465. Israel, A., Kimura, A., Fournier, A,, Fellous, M., and Kourilsky, P. (1986). Nature (London) 322, 743-746. Israel, A., Kimura, A., Kieran, M., Yano, O., Kanellopoulos, J., LeBail, O., and Kourilsky, P. (1987). Proc. Natl. Acad. S c i . USA 84, 2653-2657. Jackowski, S . , Rettenmier, C. W., Sherr, C. J., and Rock, C. 0.(1986). J . B i d . Chem. 261, 4978-4985. Jalkanen, S . , Bargatze, R. F., de 10s Toyos, J . , and Butcher, E. C. (1987).J. Cell B i d . 105,983990. Johns, M. E . , and Mills, S. E. (1983). Cancer (Philadelphia)52, 1401-1404. Johnson, P. W., Baubock, C., and Roder, J . C. (1985). J . Erp. Med. 162, 1732-1733. Kaibucbi, K., Tsuda, T., Kikuchi, A., Tanimoto, T., Yamashita, T., and Takai, Y. (1986).J. Biol. Chem. 261, 1187-1192. Karre, K., Ljunggren, H. G., Piontek, G., and Kiessling, R. (1986). Nature (London) 319,675678. Katzav, S., De Baetselier, P., Tartakovsky, B., Feldman, M., and Segal, S. (1983). J . Natl. Cancer lnst. 71, 317-324. Kaye, P. M., Chain, B. M., and Feldmann, M. (1985). J . lmmunol. 134, 1930-1934. Kelly, C. J., Silvers, W. K., and Neilson, E. G . , (1985). J . E x p . Med. 162, 1892-1902. Kerbel, R. S., Waghorne, C., Man, M. S., Elliott, B. E., and Breitman, M. L. (1987). Proc. Natl. Acad. Sci. USA 84, 1263-1267. Kiessling, R . , Hochman, P. S., Haller, 0..Shearer, G. M., Wigzell, H., and Cudkowicz, G. (1977). Eur. J . lmmunol. 7, 655-663. Kim, S. K., and Wold, B. J. (1985). Cell 42, 129-138. Kimura, A., Israel, A., Le Bail, 0.. and Kourilsky, P. (1986). Cell 44, 261-272. Kinnon, C., and Owen, M. J. (1986). Mol. Immunol. 23, 525-532. Klein, E., Klein, G . , Nadkarni, J. S . , Nadkarni, J. J., Wigzell, H., and Clifford, P. (1968). Cancer Res. 28, 1300-1310.
MHC ANTIGENS
IN NORMAL AND MALIGNANT DEVELOPMENT
239
Klein, G . (1973). Harvey Lect. 69, 71-102. Klein, G. (1983). Cell 32, 311-315. Klein, G., and Klein, E. (1986). Cancer Res. 46, 3211-3224. Klein, G., Klein, G. O., Karre, K., and Kiessling, R. (1978).Zmmunogenetics7, 391-404. Klein, J. (1975). “Biology of the Mouse Histocompatibility-2 Complex,” pp. 329-330. SpringerVerlag, New York. Koller, B. H., Geraghty, D., Orr, H. T., Shimizu, Y.,and DeMars, R. (1987).Zmmunol. Res. 6, 1-10. Koller, 6. H., Geraghty, D. E., Shiniizu, Y., DeMars, R., and Orr, H. T. (1988).J. Zmmunol. 141, 897-904. Korber, B., Hood, L., and Stroynowski, I. (1987). Proc. Natl. Acad. Sci. USA 84, 3380-3384. Korngold, R., and Doherty, P. C. (1984). Scand. J. Zmmunol. 19, 175-180. Krangel, M. S., Orr, H. T., and Strominger, J. L. (1979). Cell 18, 979-991. Kuppers, R. C., Ballas, Z. K., Green, W. R., and Henney, C. S. (1981).J. Immunol. 127,500504. Kushtai, G., Barzilay, J., Feldman, M., and Eisenbach, L. (1988). Oncogene 2, 119-127. Kvist, S . , Roberts, L., and Dobherstein, B. (1983). E M B O J . 2, 245-254. LalTerty, K. J.. and Simeonovic, C. J. (1984). Transplant. Proc. 16, 927-930. LalTerty, K. J., Prowse, S. J., Agostino, M., and Simeonovic, C. J. (1983).Transplant. Proc. 15, 1366-1370. Lala, P. K., Chatterjee-Hasrouni, S., and Montgomery, 6. (1983a). Transplant. Proc. 15,883886. Lala, P. K., Chatterjee-Hasrouni, S., Kearns, M., Montgomery, B., and Colavincenzo, V. (1983b). Zmmunol. Reo. 75, 87-116. Lalanne, J.-L., Delarbre, C., Gachelin, G., and Kourilsky, P. (1983). Nucleic Acids Res. 11, 1567-1577. Lalanne, J.-L., Transy, C., Guerin, S., Darche, S., Meulien, P., and Kourilsky, P. (1985). Cell 41, 469-478. Lalanne, J.-L., Bregegere, F., Delarbre, C., Abastado, J. P., Gachelin, G., and Kourilsky, P. (1988). Nucleic Acids Res. 10, 1039-1049. Lampson, L. A,, and Levy, R. (1980).J. Zmmunol. 125, 293-299. La Rosa, F. G., and Talmage, D. W. (1985). Transplantation 39, 480-485. Lawlor, D. A., Ward, F. E., Ennis, P. D., Jackson, A. P., and Parham, P. (1988). Nature (London) 335, 263-271. Le, A. V., and Doyle, D. (1982). Biochemistry 21, 5730-5738. Lee, D. R., Rubocki, R. J., Lie, W.-R., and Hansen, T. H. (1988).J. Exp. Med. 168: 17191739. Lee, W., Mitchell, P., and Tjian, R. (1987). Cell 49, 741-752. Leiden, J. M., and Kornbluth, J . (1988). Nat. Zmmun. Cell Growth Regul. 7, 60-61. (Abstr.) Lerns, S. P., Jacobs, C. M. W., Capel, P. J. A., and Koene, R. A. P. (1987).J. Immunol. 138, 2082-2087. Leneva, M. V., and Svet-Moldavsky, G. J. (1974).J. Natl. Cuncer Znst. 52, 699-704. Lesley, J.. Hyman, R., and Dennert, G. (1974)./. Natl. Cancer Znst. 53, 1759-1765. Levine, P. H., Blattner, W. A., Clark, J . . Tarone, R., Maloney, E. M., Murphy, E. M., Gallo, R. C., Robert-Guroff, M., and Saxinger, W. C. (1988). Znt. J. Cancer 42, 7-12. Lewis, A. M., Jr., and Cook, J. L. (1985). Science 227, 15-20. Lim, S. L., and White, D. J. G. (1988).J. Exp. Med. 168, 807-810. Linsk, R. L., and Goodenow, R. S. (1986). Cancer Res. 6, 40-62. Linsk, R. L., Vogel, J., Stauss, H., Forman, J.. and Goodenow, R. S. (1986).J. Exp. Med. 164, 794-813. Ljunggren, H.-G., and Karre, K. (1985).J. Exp. Med. 162, 1745-1759.
240
BRUCE E. ELLIO’lT ET AL.
Ljunggren, H.-G., Ohlen, C., Hoglund, P., Yamasaki, T., Klein, G., and Karre, K. (1988). /. Zmmuno/. 140, 671-678. Ljunggren, H.-G., P s b o , J., Cochet, M . , Kling, G., Konrilsky, P., and Karre, K. (1989). J. Zmmunol. 142, 2911-2917. McCulloch, E. A., and Till, J. E. (1963). J. Cell. Comp. Physiol. 61, 301-308. Maity, S. N., Golumbek, P. T., Karsenty, G., and De Crombrugghe, B. (1988). Science 241, 582-585.
Majello, B., La Mantia, G. L., Simeone, A., Boncinelli, E., and Lania, L. (1985). Nature (London) 314, 457-459. Malissen, M, Malissen, B., and Jordan, B. R . (1982). Proc. Natl. Acad. Sci. USA 79, 893-897. Maniatis, T., Goodbourn, S . , and Fischer, J. A. (1987). Science 236, 1237-1245. Marlin, S. D., and Springer, T. A. (1987). Cell 51, 813-819. Mason, D. W., and Morris, P. J. (1986). Annu. Reu. Zmmunol. 4, 119-145. Masucci, M. G., Torsteinsdottir, S . , Colombani, J.. Brautbar, C., Klein, E., and Klein, G . (1987). Proc. Natl. Acad. Sci. USA 84, 4567-4571. Matsui, Y., Shapiro, H. M., Sheehy, M. J., Christenson, L., Staunton, D. E., Eynon, E. E., and Yunis, E. J. (1986a). Eur. J . Zmmunol. 16, 248-251. Matsui, Y., Staunton, D. E., Shapiro, H. M., and Yunis, E. J. (1986b). Hum. Zmmunol. 15, 285-301.
Maziarz, R. T., Burakoff, S. J., and Bluestone, J. A. (1988). J . Zmmunol. 140, 4372-4377. Mechti, N., Blanchard, J. M., Picchaczyk, M., Dani, C., Jeanteur, P., and Lebleu, B. (1985). In “The Interferon System” (F. Dianzani and G. B. Rossi, eds.), pp. 423-428. Raven, New York. Mellor, A., Weiss, E. H., Kress, M., Jay, G., and Flavell, R. A. (1984). Cell 36, 139-144. Meruelo, D. (1979). J . E r p . Med. 149, 898-909. Meruelo, D., Kornreich, R . , Rossomando, A., Pampino, C., Boral, A., Silver, J. L., Buxbaum, J., Weiss, E. H., Devlin, J. J., Mellor, A. L., Flavell, R . A., and Pellicer, A. (1986). Proc. Natl. Acad. Sci. USA 83, 4504-4508. Miller, F. R., and Mclnerney, D. (1988). Cancer Res. 48, 3698-3701. Miyada, C. G., and Wallace, R. B. (1986). Mol. Cell. Biol. 6, 315-317. Miyazaki, J.-I., Appella, E., Zhao, H., Forman, J., and Ozato, K. (1986). J. E x p . Med. 163, 856-871.
Moller, P., Herrmann, B., Moldenhauer, G., and Mornburg, F. (1987). Znt. J. Cancer 40, 3239.
Momburg, F., Degener, T., Bacchus, E., Moldenhauer, G., Hammerling, G . J . , and Moller, P. (1986). Znt. J. Cancer 37, 179-184. Moore, M. W., Carbone, F. R., and Bevan, M. (1988). Cell 54, 777-785. Morello, D., Daniel, F., Baldacci, P., Cayre, Y., Gachelin, G., and Kourilsky, P. (1982). Nature (London) 296, 260-262. Morello, D., Duprey, P.. Israel, A., and Babinet, C. (1985). Zmmunogenetics 220, 441-452. Morrison, L. A,, Braciale, V. L., and Braciale, T. J. (1988). J. Zmmunol. 141, 363-368. Mukherji, B., and MacAlister, T. J. (1983). J . E r p . Med. 158, 240-245. Muller, W. J., Sinn, E., Pattengale, P. K., Wallace, R . , and Leder, P. (1988). Cell54, 105-115. Natali, P. G., Giacomini, P., Bigotti, A., Imai, K., Nicotra, M. R., Ng, A. K., and Ferrone, S. (1983). Cancer Res. 43, 660-668. Natali, P., Bigotti, A., Cavalieri, R., Nicotra, M. R., Tecce, R., Manfredi, D., Chen, Y.-X., Nadler, L. M . , and Ferrone, S . (1986). flum. Zmmunol. 15, 220-233. Nathenson, S. G., Geliebter, J., Pfaffenbach, G . M., and Zeff, R. A. (1986). Annu. Rev.
Zmmunol. 4, 471-502. Natio, S . , von Eschenbach, A. C., Giavazzi, R., and Fidler, I. J. (1986). Cancer Res. 46, 41094115.
MHC
ANTIGENS I N NORMAL A N D MALIGNANT DEVELOPMENT
241
Nicolson, G. L. (1987). Cancer Res. 47, 1473-1487. Nishimura, S . , and Sekiya, T. (1987). Biochem. J. 243, 313-327. Norment, A. M., Salter, R. D., Parham, P., Engelhard, V. H., and Littman, D. R. (1988). Nature (bndon) 336, 79-81. Nowell, P. C. (1976). Science 194, 23-28. Old, L. J . (1981). Cancer Res. 41, 361-375. Old, L. J., and Boyse, E. A. (1964). Annu. Reo. Med. 15, 167-186. O’Neill, H. C., and McKenzie, I. F. C. (1980). lmmunogenetics 11, 225-239. Ostrand-Rosenberg, S., and Cohan, V. (1981).J. Zmmunol. 126, 2190-2197. Ostrand-Rosenberg, S . , Cole, G . A., Nishimura, M., Clements, V., Cheroutre, H., Hunt, S., 111, and Stroynowski, I. (1987). In “H-2 Antigens: Genes, Molecules and Function” (C. David, ed.), pp. 419-428. Plenum, New York. Owen, M. J., and Kissonerghis, A. M . (1980).J . Biol. Chem. 225, 9678-9684. Ozato, K., Wan, Y. J., and Orrison, B. M. (1985). Proc. Natl. A c Q ~Sci. . USA 82, 2427-2431. Ozawa, H., Iwaguchi, T., and Kataoka, T. (1988).J. lmmunol. 139, 3896-3901. Pan. S., Abramczuk, J., and Knowles, B. B. (1987). Znt. J . Cancer 39, 722-728. Parham, P. (1987). lmmunol. Res. 6, 153-178. Parham, P., Lawlor, D. A., Salter, R. D., Lomen, C. E., and Ennis, P. D. (1988a). I n “Immunobiology of HLA: Immunogenetics of Histocompatibility” (B. Dupont, ed.), pp. 10-33. Springer-Verlag, New York. Parham, P., Lomen, C. E., Lawlor, D. A., Ways, J. P., Holmes, N., Coppin, H. L., Salter, R. D., Wan, A. M., and Ennis, P. D. (1988b). Proc. Natl. A d . Sci. USA 85, 4005-4009. Parker, J. W., Joyce, J., and Pattengale, P. (1982). Proc. lnt. Workshop Nude Mice 3, 347357. Parnes, J. R . , Sizer, K. C., Seidman, J. G . , Stallings, V., and Hyman, R. (1986). E M B O J . 5, 103-1 11. Peraranau, B. M., Gillet, A. C., Hakem, R., Barad, M., and Lemonnier, F. A. (1988). J . Zmmunol. 141, 1383-1389. Petersson, M. G., Karre, K., Cochet, M., Kourilsky, P., and Kiessling, R. (1987). Cell Zmmunol. 108, 460-472. Philipps. C., McMillan, M., Flood, P. M., Murphy, D. B., Forman, F., Lancki, D., Womack, J . E., Goodenow, R. S . , and Schrieber, H. (1985). Proc. Not/. Acad. Sci. USA 82,51405144. Phillips, M .L., Mode, M. L., Delovitch, T. L., and Yip, C. C., (1986).Proc. Natl. Acad. Sci. USA 83, 3474-3478. Pierce, G . B., Pantazis, C. G . , Caldwell, J. E., and Wells, R. S. (1982). Cancer Res. 42, 10821087. Pilarski, L. (1986). TfQnSplQfltQtiofI 41, 521-526. Piontek, G. E., Taniguchi, K., Ljunggren, H . X . , Gronberg, A,, Kiessling, R., Klein, G., and Karre, K. (1985).J. Zmmunol. 135, 4281-4288. Plata, F., Tilkin, A,-F., Levy, J.-P., and Lilly, F. (1981).J . Exp. Med. 153, 1796-1810. Ploegh, H. L., Cannon, L. E., and Strominger, J. L. (1979). Proc. Nod. A d . Sci. USA 76, 2273-2277. Poupart, P., Vandenabeele, P., Cayphas, S . , Van Snick, J. V., Haegeman, G., Kruys, V., Fiers, W., and Content, J. (1987). EMBOJ. 6, 1219-1224. Prehn, R . T. (1975).J . Natl. Cancer Znst. 55, 189-190. Prehn, R. T. (1977).I . Nod. Cancer Znst. 59, 1043-1049. Prehn, R. T., and Bartlett, G. L. (1987). Znt. J . Cancer 39, 106-110. Prowse, S. J., Warren, H. S., Agostino, M., and M e r t y , K. J. (1983).Aust. 1.Exp. Med. Sci. 61, 181-185. Ptashne, M. (1986). Nature (London) 322, 697-699.
242
BRUCE E . ELLIO’IT ET AL.
Racioppi, L., Carhone, E., Grieco, M., Del Vecchio, L., Berlingieri, M. T., Fusco, A., Boncinelli, E., Zappacosta, S., and Fontana, S. (1988). Cancer Res. 48, 3816-3821. Raghupathy, P., Anderson, D. J., and Wegmann, T. G. (1983). In “Immunology of Reproduction” (T. G . Wegmann and T. J. Gill, eds.), pp. 229-250. Oxford Univ. Press, New York. Ratnofsky, S. E., Peterson, A., Greenstein, J. L., and Burakoff, S. J. (1987).J. Erp. Med. 166, 1747- 1757. Ready, A. R., Jenkenson, A. J.. Kingston, R., and Owen, J. J. T. (1984). Nature (London) 310, 231-233. Rees, R. C., Buckle, A.-M., Gelsthorpe, K., James, V., and Potter, C. W. (1988). Br. J. Cancer 57, 374-377. Reilly, J., Thomas, C., and Sen, A. (1982). Biochim. Biophys. Acta 697, 53-59. Roberts, T. E., Shipton, U., and Moore, M. (1987). Int. J. Cancer 39, 436-441. Rognum, T. O . , Brandtzaeg, P., Elgjo, K., and Fausa, 0. (1987). Br. J. Cancer 56, 1-6. Romani, L., and Mage, M. G. (1985). Eur. J . Zmmunol. 15, 1125-1130. Rooney, C. M., Rowe, M., Wallace, L. E., and Rickinson, A. B. (1985). Nature (London) 317, 629-631. Rosenberg, A. S., Mizouchi, T., and Singer, A. (1986). Nature (London) 372, 829-831. Rosenherg, A. S., Mizouchi, T., Sharrow, S. O., and Singer, A.(1987).J. Erp. Med. 165, 12961315. Rosloniec, E. F., Kuhn, M. H., Genyea, C. A., Reed, A. H., Jennings, J . J., Giraldo, A. A,, Beisel, K. W., and Lerman, S. P. (1984).J . Zmmunol. 132, 945-952. Rowe, D. J., and Beverley, P. C. L. (1984). Br. J. Cancer 49, 149-159. Ruiter, D. J.. Bhan, A. K., Harrist, T. J., Sober, A. J., and Mihm, M. C. (1982).J. Immunol. 129, 2808-2815. Russell, J. H., Hale, A. H., Ginns, L. C., and Eisen, H. N . (1978). Proc. Natl. Acad. Sci. USA 75, 441-445. Sakai, K., Takiguchi, M., Mori, S., Kobori, O., Morioka, Y., Inoko, H., Sekiguchi, M., and Kano, K. (1987).J. Natl. Cancer Znst. 79, 923-932. Santoro, C., Mermod, N.,Andrews, P. C., and Tjian, R. (1988). Nature (London) 334, 218224. Schrader, J. W., and Edelman, G. M. (1976).J. Exp. Med. 143, 601-614. Schreiber. A. B., Schlessinger, J., and Edidin, M. (1984).J. Cell Biol. 98, 725-731. Schreiher, H., Ward, P. L., Rowley, D. A., and Stauss, H. J. (1988).Annu. Rev. Zmmunol. 6, 465-483. Schrier, P. I . , Bernards, R., Vaessen, R. T. M. J., Houweling, A , , and Van der Eb, A. J. (1983). Nature (London) 315, 771-775. Scofield, V. L., Schlumpberger, J. M., and Weissman, I. L. (1982a). Am. Zool. 22, 783-794. Scofield, V. L., Schlumpberger, J. M., West, L. A., and Weissman, I. L. (1982h). Nature (London) 295, 499-501. Sehgal, P. B., May, L. T., Tamm, I., and Vilcek, J. (1987). Science 235, 731-732. Sen, R . , and Baltimore, D. (1986). Cell 47, 921-928. Severinsson, L., and Peterson, P. A. (1984).J . Cell Biol. 99, 226-232. Shimizu, Y., Geraghty, D. E., Koller, 8. H., Orr, H. T., and DeMars, R. (1988). Proc. Natl. Acad. Sci. USA 85, 227-231. Shirayoshi, Y., Miyazaki, J.-I., Burke, P. A., Hamada, K., Appella, E., and Ozato, K. (1987). Mol. Cell. Biol. 7, 4542-4548. Shirayoshi, Y . , Burke, P. A., AppeHa, E., and Ozato, K. (1988). Proc. Natl. Acad. Sci. USA 85, 5884-5888. Silvers, W. K., Kimura, H., Desquenne-Clark, L., and Miyamato, M. (1987). Immunol. Today 8, 185-190.
MHC
ANTIGENS IN NORMAL AND MALIGNANT DEVELOPMENT
243
Simonsen, M., Skjodt, K., and Crone, M . (1985). Prog. Allergy 36, 151-176. Singh, H., LeBowitz J. H., Baldwin, A. S., and Sharp, P. A. (1988). Cell 52, 415-423. Sleckman, B. P., Peterson, A., Jones, W. K., Foran, J. A,, Greenstein, J. L., Seed, B., and Burakoff, S. J. (1987). Nature (London) 328, 351-353. Snell, G. D. (1958).J. Natl. Cancer Znst. 21, 843-877. So, S. K. S., Platt, J. L., Ascher, N. L., and Shover, D. C. (1987). Transplantation 43, 79-85. Sonnenberg, A., Van Balen, P., Hilgers, J., Schuuring, E., and Nusse, R. (1987). EMBOJ. 6, 121-125. Sprent, J., and Schaefer, M. (1986). Nature (London) 322, 541-544. Sprent, J., and Schaefer, M. (1988).J. Zmmunol. 140, 2899-2902. Sprent, J., and Schaefer, M. (1989). Zmmunol. Today PO, 17-23. Sprent, J., Schaefer, M., Lo, D., and Korngold, R. (1986). Zmmunol. Reo. 91, 195-217. Srivastava, P. K., and Old, L. J. (1988). Zmmunol. Today 9, 78-83. Srivastava, R . , Chorney, M. J., Lawrance, S. K., Pan, J., Smith, Z., Smith, C. L., and Weissman, S. M. (1987). Proc. Natl. Acad. Sci. USA 84, 4224-4228. Stauss, H. J., Linsk, R., Fischer, A., Watts, S., Banasiak, D., Haberman, A., Clark, I., Forman, J., McMillan, M., Schreiber, H., and Goodenow, R. S. (1986).J. Zmmunogenet. 13, 101-111. Stein, P., Barra, Y., Jay, G., and Strickland, S. (1986). Mol. Cell. Biol. 6, 3397-3400. Steininger, B., Klempnauer, J., and Wonigeit, K. (1985). Transplantation 40, 234-239. Steinmetz, M., and Hood, L. (1983). Science 222, 727-733., Steinmetz, M., Frelinger, J. G., Fisher, D., Hunkapiller, T., Pereira, D., Weissman, S. M . , Uehara, H., Nathenson, S., and Hood, L. (1981). Cell 24, 125-134. Stern, D. F., Roberts, A. B., Roche, N. S . , Sporn, M. B., and Weinberg, R. A. (1986). Mol. Cell. Biol. 6, 870-877. Stoolman, L. M., and Rosen, S. D. (1983).J. Cell B i d . 96, 722-729. Storkus, W. J., Howell, D. N., Salter, R. D., Dawson, J. R., and Cresswell, P. (1987). J. Zmtnunol. 138, 1657-1660. Storkus, W. J., Alexander, J., Payne, J. A., Dawson, J. R., and Cresswell, P. (1989).Proc. Natl. Acad. Sci. USA 86, 2361-2364. Streeter, P. R . , Lakey Berg, E., Rouse, B. T. N., Bargatze, R. F., and Butcher, E. C. (1988a). Nature (London) 331, 41-46. Streeter, P. R . , Rouse, B. T. N., and Butcher, E. C. (198813)./. Cell Biol. 107, 1853-1862. Stroynowski, I., Clark, S., Henderson, L. A., Hood, L., McMillan, M., and Forman, J. (1985). J. Zmm~nol.135, 2160-2166. Stroynowski, I., Soloski, M., Low, M. G., and Hood, L. (1987). Cell 50, 759-768. Stutman, 0. (1981). Handb. Cancer Zmmunol. 7, 1-25. Sugita, K., Miyazaki, J.-I., Appella, E., and Ozato, K. (1987). Mol. Cell. Biol. 7, 2625-2630. Sullivan, K. E., and Peterlin, B. M. (1987). Mol. Cell. Bid. 7, 3315-3319. Suranyi, M. G., Bishop, G. A., Waugh, J., and Hall, B. M. (1987). Transplant. Proc. 19,28692872. Sutherland, C. M., Mather, F. J., Carter, R. D., Cerise, E. J., and Krementz, E. T. (1983). Surgery, 94, 370-375. Takai, Y., Wong, G. G., Clark, S. C., Burkaoff, S. J., and Herrmann, S. H. (1988).J. Zmmunol. 140, 508-512. Talmage, D. W. (1980). Diabetes 29, Suppl. 1, 105-106. Tanaka, K., Appella, E., and Jay, G. (1983). Cell 35, 457-465. Tanaka, K., Isselbacher, K. J, Khoury, G., and Jay, G. (1985). Science 228, 26-30. Tanaka, K., Barra, Y., Isselbacher, K. J., Khoury, G., and Jay, G. (1986).Proc. Natl. Acad. Sci. USA 83, 7598-7602.
244
BRUCE E. E L L l Ol T ET AL.
Tanaka, K., Gorelik. E., Watanabe, M., Hozumi, N., and Jay, G. (1988a). Mol. Cell. B i d . 8, 1857- 1861. Tanaka, K., Yoshioka, T., Bieberich, C., and Jay, G . (1988b).Annu. Reo. Zmmunol. 6,359-380. Taniguchi, K., Petersson, M ., Hoglund, P., Kiessling, R . , Klein, G . , and Karre, K. (1987). Proc. Natl. Acad. Sci. USA 84, 3405-3409. Tarin, D., Price, J . E., Kettlewell, M. G . W., Souter, R. G . , Vass, A. C. R . , and Crossley, B. (1984). Cancer Res. 44, 3584-3592. Torsteinsdottir, S., Brautbar, C., Klein, G., Klein, E., and Masucci, M. G. (1988). Int. J . Cancer 41, 913-919. Traina, V. L., Taylor, B. A., and Cohen, C. (1981).I. Virol. 40, 735-744. Transy, C., Lalanne, J . L., and Kourilsky, P. (1984). EMBOJ. 10, 2383-2386. Trimble, W. S . , Johnson, P. W., Hozumi, N., and Roder, J. C. (1986). Nature (London) 321, 782-784. Trowsdale, J. (1987). Zmmunol. Today 8, 35-36. Turbitt, M . L., and Mackie, R. M. (1981).1. Dermutol. 104, 507-513. Tykocinski, M. L., and Max, E. E. (1984). Nuckic Acids Res. 12, 4385-4396. Tyler, J. D., Galli, S. J., Snider, M . E., and Dvorak, A. M . (1984).]. Exp. Med. 159, 234-246. Tzehoval, E., De Baetselier, P., Ron, Y., Tartakovsky, B., Feldman, M., and Segal, S. (1983). Eur. 1. Zmmunol. 13, 89-94. Urban, J. L., Burton, R. C., Holland, J. M., Kripke, M. L., and Schreiber, H. (1982).J . E x p . Med. 155, 557-573. Vaessen, R . T. M. J., Houweling, A., and Van der Eb, A. J. (1987). Science 235, 1486-1488. van den lngh, H. F., Ruiter, D. J . , Grifioen, G., van Muijen, G. N. P., and Ferrone, S. (1987). Br. I. Cancer 55, 125-130. van Duinen, S. G., Ruiter, D. J., Broecker, E. B., van der Velde, E. A., Sorg, C., Welvaart, K., and Ferrone, S. (1988). Cancer Res. 48, 1019-1025. Vanky, F., Roberts, T., Klein, E., and Willems, J. (1987). Zmmunol. Lett. 16, 21-26. van Vreeswijk, H., Ruiter, D. J., Brocker, E. B., Welvaart, K., and Ferrone, S. (1988). 1. Invest. D e m t o l . 90, 755-760. Versteeg, R . , Noordermeer, I. A., Kruse-Wolters, M., Ruiter, D. J., and Schrier, P. I. (1988). E M B O ] . 7, 1023-1029. Vogel, J., Kress, M . , Khuory, G., and Jay, G. (1986). Mol. Cell. B i d . 6 , 3550-3554. Vogel, J., Tanaka, K., Hoekzema, G . S., and Jay, G. (1987). Cancer Metastasis Reo. 6 , 677683. Von Boehmer, H., and Schubiger, K. (1984). Eur. J . Immunol. 14, 1048-1052. Van Hoff, D. D., Clark, G. M.,Stogdill, B. J., Sarosoy, M. F., O'Brien, M . T., Casper, J . T., Mattox, D. E., Page, C. P., Cruz, A. B., and Sandbach, J. F. (1983). Cancer Res. 43, 1926-1931. von Melchner, H., and Housman, D. E. (1987). Oncogene 2, 137-140. Wadgymar, A . , Urmson, J., Baumal, R., and Halloran, P. F. (1984).1. Zmmunol. 132, 18261833. Wake, C. T. (1986). Mol. Biol. Med. 3, 1-11. Wallich, R . , Bulbuc, N., Hammerling, G . J., Katzav, S., and Segal, S. (1985).Nature(London) 315, 301-305. Warren, H. S., and Pembrey, R. G. (1986). Transplantation 41, 421-430. Watts, S . , Vogel, J. M., Harriman, W. D., Itoh, T., Stauss, H. J., and Goodenow, R. S . (1987). 1. Zmmunol. 139, 3878-3885. Wegmann, T. (1987). Proc. E M B O Workshop Tolerance, Basel Znst. Zmmunol. (P. Matzinger, M. Flajnik, H.-G., Rammensee, G. Stockinger, T. Rolink, and L. Nicklin, eds.), pp. 230240. Roche, Basel.
MHC
ANTIGENS IN NORMAL A N D MALIGNANT DEVELOPMENT
245
Weinstein, B. (1987).J. Cell. Biochem. 33, 213-224. Weis, J. H., and Seidman, J. G . (1985).I. Zmmunol. 134, 1999-2003. Weiss, E. H . , Golden, L., Zakut, R., Mellor, A,, Fahrner, K., Kvist, S., and Flavell, R. A. (1983). E M B O J. 2, 453-462. Weiss, E. H., Golden, L., Fahrner, K., Mellor, A. L., Devlin, J. J., Bullman, H., Tiddens, H., Bud, H., and Flavell, R. A. (1984). Nature (London) 310, 650-655. Wheelahan, J.. and McKenzie, I. F. C. (1987). Transplantation 44, 273-279. Whelan, J. P., Chatten, J., and Lampson, L. A. (1985). Cancer Res. 45, 5976-5983. Whitwell, H. L., Hughes, H. P. A., Moore, M., and Ahmed, A. (1984). Br. J. Cancer49, 161172. Widmer, M. B., and Grabstein, K. H. (1987). Nature (London) 326, 795-798. Wolfel, T. Van Pel, A., De Plaen, E., Lurquin, C., Maryanski, J. L., and Boon, T. (1987). lmmunogenetics 26, 178-187. Wood, K. J . , Hopely, A., Dallman, M. J., and Morris, P. J. (1988). Transplantation 45, 759767. Wu, C. (1984). Nature (London) 309, 229-234. Yano, O., Kanellopoulos, J., Kieran, M., Le Bail, O., Israel, A., and Kourilsky, P. (1987). EMBO J. 6, 3317-3324. Ziegler, J. L. (1987). Ann. Znst. Pasteur Zmmunol. 138, 253-260. Zitron, I. M., Ono, J . , Lacy, P. E., and Davie, J. M. (1981). Transplantation 32, 156-158. Zoller, M., Strubel, A., Hammerling, G., Adrighetto, G., Raz, A., and Ben-Ze’ev, A. (1988). Int. J. Cancer 41, 256-266.
This Page Intentionally Left Blank
ANTIOXIDANTS-CARCINOGENIC AND CHEMOPREVENTIVE PROPERTIES Nobuyuki It0 and Masao Hirose First Department of Pathology, Nagoya City University, Medical School. Mizuho-cho, Mizuho-ku, Nagoya 467, Japan
I. Introduction 11. Tumorigenic Effects of Antioxidants
111. IV.
V.
VI.
VII.
A. Carcinogenicity of BHA B. Tumorigenic Activity of Other Antioxidants Histopathological Characteristics of Antioxidant-Induced Tumors Possible Mechanisms of Action of BHA in Forestomach Tumorigenesis A. Tissue Distribution and Excretion of BHA B. I n Vitro and in Vioo Metabolism of BHA C. Effects of Other Chemicals on BHA-Induced Forestomach Hyperplasia D. Detection of Radicals during Metabolism of BHA Modification of Carcinogenesis by Antioxidants A. Modification by Antioxidant Treatment prior to, Simultaneous with, or Shortly after Carcinogen Administration B. Modification by Posttreatment with Antioxidants C. Antipromoting Activity of Antioxidants D. Modifcation by Blocking Nitrosamine Formation Evaluation of Antioxidants as Human Hazards or Chemopreventers of Human Carcinogenesis Summary References
I. Introduction
There are many synthetic and naturally occurring antioxidants in our environment. They are contained, for example, in foodstuffs, tobacco, plants, cosmetics, wood smoke, soap, oils, medicines, plastics, and rubbers, and are widely used as industrial chemicals. Some of them may even be synthesized by human beings in uiuo. Humans may thus be exposed to mixtures of synthetic or naturally occurring antioxidants orally from foodstuffs or through the skin from cosmetics. In addition to their antioxidant action, this group of compounds possesses various kinds of biological activities (Kahl, 1984).Antioxidants play very important roles as food additives and as cellular components or plasma constituents, because they prevent rancidity in fats that are present in foods or peroxidative stress in lipids that are present in serum by inhibiting radical formation through (a) chain reactions (phenolic antioxidants, tertiary amines, flavonoids), (b) decomposition of peroxides or 247 ADVANCES IN CANCER RESEARCH, VOL. 53
Copyright 8 1989 by Academic Press. Inc. All rights of reproduction in any form reserved.
248
NOBUYUKI IT0 A N D MASAO HIROSE
radicals (sulfur compounds, selenium, enzymic antioxidants, vitamins), (c) inactivation of catalytic metals (citric acid, phytic acid), or (d) synergism with other antioxidants (e.g., a-tocopherol and ascorbic acid). Synthetic antioxidants used as food additives include phenolic antioxidants such as butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), tert-butylhydroquinone (TBHQ), esters of gallic acid, esters of benzoic acid, vitamins such as DL-a-tocopherol (vitamin E, a-TP), sodium ascorbate (SA), ascorbic acid (vitamin C, AA) and its isomers, sulfur compounds such as 3,3’thiodipropionic acid and 5-(2-pyrizinyl)-4-methyl-1,2-dithiol-3-thione (oltiplaz), and phosphate compounds such as phytic acid. Naturally occurring antioxidants include phenolic compounds such as caffeic acid, gallic acids, eugenol, ferulic acid, catechol, chlorogenic acid, and nordihydroguaiaretic acid (NDGA), flavonoids such as quercetin, kaempferol, catechins, and fisetin, p-diketones such as n-tritriacontane-16,18-dione and curcumin, sesame lignans such as sesamolin and sesaminol gossypol, polyphenols such as ellagic acid, and vitamins such as @-carotene,y-oryzanol, SA (AA), and tocopherols. The antioxidants usually present in human serum include uric acid, cysteine, reduced glutathione (GSH), and mannitol, or enzymic antioxidants such as catalase, superoxide dismutase (SOD), and glutathione peroxidase. These antioxidants had long been considered to protect tissues or cells against oxidative damage, and thus to be protective agents against aging, atherosclerosis, shock or ischemic tissue damage, and poisoning by toxic agents. From an epidemiological point of view, there is also some evidence of a relationship between a decrease in the incidence of and mortality from cancer of certain organs and high consumption of antioxidants: for example, the risk of particular cancers in populations is in some areas inversely related to the amount of selenium in the environment (Shamberger et al., 1976).An inverse association between dietary intake of @-carotene(Peto et a l . , 1981; Hennekens et a l . , 1986) or vitamin C (Graham, 1983; Mirvish, 1986) and malignancy of certain organs, and a strong inverse relation between serum vitamin E and p-carotene, and the risk of all histological types of cancer and squamous-cell carcinoma of the lung, respectively, (Menkes et a l . , 1986) have been reported. The risk of certain cancers in populations is inversely related to the amount of selenium in the environment (Shamberger et al., 1976). Serum selenium level (Salonen et al., 1985;Willett et al., 1983)and dietary intake or serum level of @-carotene(Hennekens et al., 1986;Wald et al., 1984;Pet0 et al., 1981)or vitamin C (Peto et al., 1981;Graham, 1983) have been linked to certain cancers, and there is a strong inverse association between serum vitamin E or selenium and risk of breast and lung cancers (Wald et a l . , 1984; Menkes et al., 1986). Furthermore, risk of prostate
ANTIOXIDANTS AND CARCINOGENESIS
249
cancer is lower among populations with a high dietary intake of p-carotene (Ohno et al., 1988). Antioxidants are generally not mutagenic as evaluated by the Ames test, and may even inhibit the mutagenic activity of some chemicals (Kahl, 1984; Stich and Rosin, 1984; Namiki and Osawa, 1986). Moreover, they inhibit chemical carcinogenesis in various organs of rats or mice when they are given prior to and/or simultaneously with certain carcinogens. Therefore, antioxidants have been considered to have potential application as potent chemopreventers in humans. However, some antioxidants have been shown to enhance second-stage chemical carcinogenesis in rodents when administered after exposure to carcinogens. In addition, the synthetic antioxidant BHA, which is commonly used throughout the world as a food additive, was demonstrated to induce forestomach carcinomas in F344 rats of both sexes and in male Syrian golden hamsters. Since then, modifying effects of antioxidants on chemical carcinogenesis, the carcinogenic potential of antioxidants, and the mechanism(s) underlying antioxidant induction of tumors have been the focus of extensive investigations. As a result antioxidants were found to exert influence as promoters or inhibitors of carcinogenesis depending on the organ, and it was clearly shown that some can induce tumors in the forestomach as well as in the glandular stomach of rats and hamsters by apparently very different mechanisms from those applying to genotoxic carcinogens. It is therefore possible that antioxidants may play a role in chemical carcinogenesis in humans, as complete carcinogens, initiators, promoters, or inhibitors. The present review article covers the latest results of research on antioxidants, especially in relation to neoplastic and chemopreventive properties. II. Tumorigenic Effects of Antioxidants
A. CARCINOGENICITY OF BHA No antioxidant had been reported to be tumorigenic until 1983 when the synthetic antioxidant BHA was first demonstrated to be carcinogenic in forestomach epithelium (Fig. 1)of both male and female F344 rats (Ito et al., 1983). This finding stimulated extensive carcinogenicity studies in other animal species, because BHA is a common approved food additive used widely throughout the world. Subsequently, BHA was shown also to be carcinogenic to male Syrian golden hamster forestomach, although the results remained equivocal in B6C3F, mice even after continuous oral administration for c 1 0 4 weeks at doses of 0.5-1% in the diet. The carcinogenic dose was revealed to be 2% in rats and 1% in hamsters (Table 1) (Masui et
250
N O B U Y U K I IT0 A N D MASAO HIROSE
FIG. 1. Well-differentiated squamous-cell carcinoma of the forestomach epithelium of a rat treated with BHA for 104 weeks. Atypical squamous-cell nests with cornification are observed invading the subserosal tissue.
TABLEI PROLIFERATIVE AND NEOPLASTICLESIONSOF THE FORESTOMACH EPITHELIUMIN RATS, AMOUNTS OF BHA HAMSTERS,AND MICE RECEIVINGDIFFERENT
Animal species Rat
Hamster
Mouse
BHA in diet (%)
0 1 2 0 1 2 0 0.5
1
Effective number of animalsfJ 92 94 94 52 55 40 39 37 43
Number of animals with (%)
Hyperplasia
Papilloma
l(1.1) 92 (97.9)”
0 (0) 71 (75.5)” 86 (91.5)” 0 (0) 54 (98.2)” 38 (95.0)” 0 (0) 5 (13.5p 5 (14.3)E
93 (98.9)” 9 (17.3) 53 (96.4)” 40 (1Oa)l. 0 (0) 10 (27.0)ii 35 (81.4)iJ
Squamous-cell carcinoma
Number of animals sampled after the first appearance of cancer (rat, 48 weeks; hamster, 64 weeks; and mouse, 88 weeks). Significantly different from the value for the control group at p < 0.001. c Significantly different from the value for the control group at p < 0.05. 0
251
ANTIOXIDANTS AND CARCINOGENESIS
TABLE I1 PROLIFERATIVE AND NEOPLASTIC LESIONS OF THE FORESTOMACH EPITHELIUM IN F344 RATS GIVENDIETSCONTAINING BHA BHA in diet
(96)
(I
b c
Effective number of rats“
Number of rats with Hyperplasia
Papilloma
(a) Squamous-cell carcinoma
Those that survived 250 weeks. Significantly different from control group at p < 0.01. Significantly different from control group at p < 0.001.
al., 1986a, 1987), and the resulting incidence of squamous-cell carcinomas was in the range of 10-35% in both these species. Butylated hydroxyanisole also induced hyperplasias or papillomas in a dose-related manner in forestomach epithelium of rats, hamsters, and mice (Tables I and 11)Masui et al., 1986b; Ito et al., 1986a). No tumors that could be attributed to BHA administration were observed in any other organs and, to date, BHA is the only antioxidant classified in the category of “sufficient evidence of carcinogenicity in rats” as judged by the criteria of the International Agency for Research on Cancer (IARC). A number of other species have also been examined. For example, concentrations of BHA < l % in the diet were given to guinea pigs, which do not have a forestomach, for 20 months but did not cause any gross changes in the stomach epithelium (ILSI, 1984). In a subchronic experiment, cynomolgus monkeys (Macaca fascicularis) received S500 mg/kg body weight of BHA for 84 days, but no histopathological changes were observed in any organs, including the stomach (Iverson et al.,1985b). Weaning pups were treated with 0, 5, 50, and 250 mg/kg BHA for 15 months, but all organs examined appeared normal with the exception of liver injury in animals receiving the highest dosage (Wilder et al., 1960). Adult beagle dogs given BHA in the diet for 1 year at 0-100 mg/kg/day, also did not demonstrate any histopathological changes in any tissue (Hodge et al., 1964). Similarly, male and female beagle dogs maintained on diets containing BHA at concentrations of 0.25, 0.5, and 1%for 6 months, had no histopathological evidence of mucosal alteration attributable to antioxidant administration in the stomach, esophagus, or duodenum (Tobe et al. 1986). Although enzyme analysis of hepatic
252
N O B U Y U K I IT0 A N D MASAO HIROSE
tissue from male and female beagle dogs treated with 1 or 1.3% BHA in the diet for 180 days showed a significant increase in mixed-function oxidases, UDP-glucuronyltransferase, glutathione S-transferase, and epoxide hydrolase, again no histopathological changes were observed in the stomach or esophagus (Ikeda et al., 1986). However, dogs and monkeys have a longer life span than rats, mice, and hamsters, and therefore potential carcinogenicity in animals without forestomachs has not been fully evaluated. Commercial BHA is a mixture of 75-98% 3-tert-BHA (3-BHA) and 1-25% of 2-tert-BHA (2-BHA). It is of obvious importance to determine which isomer is more active in inducing forestomach tumors to allow human use of the potent antioxidant isomer with less toxic effects. Although in the shortterm experiment, hamsters treated with 1% 3-BHA in the diet for 20 weeks had far more pronounced hyperplasia and papillomas in the forestomach epithelium than those receiving 1% 2-BHA (Hirose et al., 1986d), Altmann and Grunow (1986) reported that rats that received a solution of 2-BHA isomer in arachis oil by intubation at a BHA dose of 1g/kg body weight for 10 days showed similar if less pronounced forestomach lesions than those observed with the 3-BHA isomer. However, data gained from continuousintubation experiments appear somewhat equivocal, because continuousgavage treatment with BHA induced less hyperplasia but more carcinomas of the forestomach than continuous dietary administration at an equivalent dose level, and moreover, the gavage vehicle alone seemed to induce hyperplasia (Newberne et al., 1986). It is generally accepted that carcinogens have both initiating activity and promoting activity in their target organs. Lack of mutagenic activity and even a potent antimutagenic effect of BHA in Salmonella and some other mutation tests (Kahl, 1984; IARC, 1986; Williams, 1986) suggest that BHA does not exert direct initiating potential. To study the initiating activity of BHA on the forestomach epithelium, male F344 rats were treated with 2% BHA in the diet for 24 weeks, followed by intragastric treatment with N methyl-N’-nitro-N-nitrosoguanidine(MNNG), 20 g/kg twice weekly, or 0.025% N-dibutylnitroamine (DBN) in drinking water continuously for 24 weeks. Histological examination demonstrated that the incidences of forestomach and esophageal tumors in rats treated with BHA followed by MNNG or DBN were not significantly different from those treated with MNNG or DBN alone (N. Ito and M. Hirose, unpublished observations). On the other hand, when male F344 rats were initiated with MNNG, DBN, or N-methylnitrosurea (MNU) followed by continuous oral treatment with 0.06-2% BHA for s19 months, BHA at doses >0.5% significantly promoted the development of forestomach tumors in a dose-related manner (Imaida et al., 1986; Shirai et al., 1984; Tsuda et id., 1984c; Takahashi et al., 1986; Williams, 1986; Fukushima et al., 1987b).
ANTIOXIDANTS A N D CARCINOGENESIS
253
Survey of the results available at present thus clearly indicates that the carcinogenic potential of BHA is limited to forestomach epithelium, and that similar squamous epithelium in the esophagus is not susceptible. The carcinogenic potential of BHA may be largely due to the 3-BHA isomer, which is more active as an antioxidant and is further characterized by weak initiating but strong promoting activity. B. TUMORIGENIC ACTIVITY OF OTHERANTIOXIDANTS The carcinogenic potential of a range of synthetic antioxidants used as food additives has been evaluated. One synthetic phenolic antioxidant, BHT, which is as potent as BHA as an antioxidant, was examined for carcinogenic activity in Wistar rats (Hirose et al., 1981) and B6C3F, mice (Shirai et al., 1982) of both sexes at dose levels of 0.25 or 1.0%, and 0.02, 0.1, or 0.5% in diet, respectively, for 6104 weeks. However, no tumors were induced that could be attributed to BHT treatment. On the other hand, treatment with 1% or 2% BHT in diet to male B6C3F, mice for 104 weeks was associated with an increased incidence of either hepatocellular adenomas or foci of alteration in a clear dose-dependent manner (Inai et al., 1988). Olsen et al. also demonstrated weak tumorigenicity for BHT in rat liver. Male and female F, rats were treated with BHT in the diet (0-500 mg/kg body weight per day), then mated, and the resulting male and female F, offspring were treated with 0-250 mg/kg body weight per day of BHT for 6 2 years. Significant dose-related increases in the numbers of hepatocellular adenomas and carcinomas were observed in male F, rats, and of hepatocellular adenomas in female F, rats (Olsen et al., 1983, 1986). Although there was an inverse dose relationship, male C3H mice fed diets containing 0.5% or 0.05% of BHT for 10 months also had significantly increased incidences of liver tumors over those kept on basal diet alone (Lindenschmidt et al., 1986). In support of these results, continuous oral treatment with 0.5-0.6% BHT showed weak promotion activity in two-stage hepatocarcinogenesis of rats initiated with N-2-fluorenylacetamide (2-AAF) (Peraino et al., 1977; Maeura and Williams, 1984). However, there is no clear evidence to date demonstrating unequivocal carcinogenicity of BHT in rodents. Although no standard carcinogenic bioassays have been reported for TBHQ, continuous feeding of this antioxidant for s 2 0 months at doses of 00.5% revealed no compound-related gross or microscopic lesions (Van Esch, 1986). Propyl gallate (PG) was also studied in F344 rats and B6C3F, mice by feeding at dietary levels of 5oO0-20,000 mg/kg, but no dose-related increase in incidences of tumors or differences in survival were found (Dacre, 1974; Abdo et al., 1983). However, continuous oral administration of diet containing PG at concentrations s l %for 2 years caused patchy hyperplasia of the
254
NOBUYUKI IT0 A N D MASAO HIROSE
forestomach epithelium (Lehman et al., 1951). The potential carcinogenicity of other gallates have not been fully evaluated (Van der Heijden et al., 1986). Since BHA was found to induce pronounced forestomach hyperplasia in a short period, and forestomach squamous-cell carcinoma in rats and hamsters in the long term, and since BHA strongly promoted the second stage of carcinogenesis in this organ, many other structurally related phenolic antioxidants were examined for associated proliferative activity in the forestomach epithelium as an aid to prediction of potential to induce forestomach tumors or of promoting action. Altmann et al. (1986) thus tested 3-BHA, 2BHA, TBHQ, 4-methoxyphenol, 1,4-dimethoxybenzene, hydroquinone, 3methoxyphenol, 2-methoxphenol, anisole, p-cresol, phenol, and BHT in short-term feeding studies in rats at a dose of 2% in diet (1% in the case of BHT). They found that 4-methoxyphenol was as active as 3-BHA in the induction of forestomach hyperplasia, and in addition, 4-methoxyphenol caused a circular deep ulceration parallel to the limiting ridge. Hydroquinone and TBHQ also induced hyperplasia, but this was less pronounced than with 3-BHA. They concluded that a methoxy group in the para position seemed to be important for hyperplasiagenic activity. They further examined the proliferative effects of BHA, BHT, TBHQ, propylparabene, methylparabene, 4-methoxyphenol, and 4-hydroxybenzoic acid esters administered to rats at doses of 2-4% in the diet by assessing [3H]thymidinelabeling index as a marker of cell proliferation in a 9- to 27-day feeding experiment, and found that BHT and TBHQ induced a lesser response than BHA and that PG was without effect. Propylparabene tended to induce proliferation in the prefundic region, whereas 4-methoxyphenol had a greater affinity for the middle region. In the 4-hydroxybenzoic acid ester series, the free acid and the methyl ester were without effect, while proliferative activity associated with ethyl, n-propyl, and n-butyl esters in the prefundic region of the forestomach increased with alkyl-chain length, in n-butyl ester being nearly as effective as BHA (Nera et al., 1984; Clayson et al., 1986; Rodrigues et al., 1986). In our laboratory, male F344 rats were given diet containing BHA, BHT, gallic acid, caf€eic acid, sesamol, chlorogenic acid, syringic acid, ferulic acid, eugenol, or esculin for 4 weeks at a level of 0.7% for BHT or 2% for the other compounds. Histological examination of the forestomach showed that whereas BHA induced hyperplasia mainly in the prefundic region near the esophageal sphincter, caf€eic acid induced pronounced hyperplasia throughout the forestomach epithelium, and sesamol caused development of large circular ulcers parallel to the limiting ridge with hyperplasia in the adjoining mucosa similar to that observed in rats treated with 4-methoxyphenol (Hirose et al., 1987e). In a midterm experiment (Hirose et al., 1986b), effects of 13 different synthetic or naturally occurring phenolic antioxidants were examined after continuous oral admin-
ANTIOXIDANTS A N D CARCINOGENESIS
255
istration to male Syrian golden hamsters for 20 weeks. The antioxidants studied included 1.5% catechol, 0.25% resorcinol, 0.5% hydroquinone, 1.5% p-methylphenol, 1.5% p-methoxyphenol, 1.5% p-tert-butylphenol, 3% propylparabene, 1% pyrogallol, 1% cafTeic acid, 0.25% methylhydroquinone, 0.5% TBHQ, 0.5% 2-tert-buty1-4-methylpheno1,and 1% BHA. Of these compounds, 2-tert-butyl-4-methylphenol and p-tert-butylphenol proved as effective as BHA in inducing forestomach hyperplasias and papillomas. Catechol, p-methylphenol, p-methoxyphenol, caffeic acid, methylhydroquinone, and pyrogallol were less active, and resorcinol, hydroquinone, propylparabene, and TBHQ lacked activity. The labeling index in the glandular stomach was also significantly increased in animals fed catechol and p-methoxyphenol. Since it appeared likely that the antioxidants that induced forestomach hyperplasia in the short-term experiment such as 4methoxyphenol, TBHQ, butylparabene, propylparabene, p-tertbutylphenol, 2-tert-butyl-4-methylpheno1, c d e i c acid, sesamol, and catechol might have carcinogenic potential or promotion activity in forestomach carcinogenesis, some antioxidants associated with increase in the labeling index in the forestomach or glandular stomach epithelium were investigated in long-term experiments. Male F344 rats were thus treated with BHA or with the naturally occurring antioxidants cafTeic aid or sesamol for 60 weeks at a dose of 2% in the diet. The incidences of forestomach papilloma in rats treated with BHA, caffeic acid, and sesamol were 15.8, 28.5, and 18.2%, respectively, and squamous-cell carcinomas were observed in 4.5% of rats treated with sesamol. Tumors were mostly located at the midregion in rats treated with caffeic acid or sesamol (Fig. 2), whereas they were located mainly in the prefundic region of rats given BHA. Gallic acid, which did not induce hyperplasia in a short-term experiment, also did not induce any tumors (Ito et al., 1989a). Previously it was reported that treatment of ACI rats with 0.5% cafFeic acid for 180 days followed by basal diet alone for life was not associated with tumor induction (Haga, 1987). This negative finding might have been due to the low concentration and short observation period, and our own results strongly indicate that these compounds are carcinogenic for rat forestomach epithelium in long-term experiments, and that there was a strong correlation between the potency to induce pronounced hyperplasia and tumorigenic activity in the forestomach epithelium. It is of interest that cafFeic acid has been shown either to be nonmutagenic or to inhibit mutagenic activity in some in vitro assays (Raj et al., 1983;Wargovich et al., 1985; Chan et al., 1986;'San and Chan, 1987), but does not induce DNA damage (Yamada et al., 1985). It is possible that some other phenolic antioxidants may have weak tumorigenic activity in the rat forestomach epithelium. Catechol, 2-tertbutyl-4-methylphenol, p-tert-butylphenol, 4-methoxyphenol, and methyl-
256
N O B U Y U K I IT0 A N D MASAO HIROSE
FIG. 2. Forestomach tumor of a rat treated with 2%sesamal for 60 weeks. The tumors were histologically identified as a papilloma and a squamous cell carcinoma.
hydroquinone, all of which induced cell proliferation in hamster forestomach and/or glandular stomach, were examined for their long-term effects in F344 male rats when administered at a dose of 0.8-1.5% in diet. After 51 weeks of treatment with catechol, p-tert-butylphenol, and 4-methoxyphenol, a 7% incidence in each case of papillomas and 40-100% incidence of hyperplasia in the forestomach epithelium were observed. In addition, catechol, one environmental contaminant present in cigarette smoke, coffee, vegetables such as onions, citrus fruits such as grapefruit, and in industrial products such as film developers or oxidative types of hair dyes, was demonstrated to induce adenocarcinomas and preneoplastic adenomatous hyperplasia at incidences of 20 and 1OO%, respectively, in the glandular stomach (Figs. 2 and 4) (Hirose et al., 1987d, 1988a). The results indicated that catechol is an unequivocal glandular stomach carcinogen. Catecho1 is not mutagenic in the SaZmonelZa system (Haworth et aZ., 1983), but it does increase the transformation frequency of BALB/3T3 cells treated with benzo[a]pyrene (BP) or P-propiolactone (Atchison et aZ., 1982), induces sister chromatin exchanges, delays cell division in human lymphocytes after treatment in culture (Morimoto and Wolff, 1980), and induces DNA breakage (Yamada et al., 1985). Therefore, catechol may possess limited initiating potential. We have found that treatment with 1.5% p-methylcatechol for 51 weeks also induced tumors in the forestomach and glandular stomach of rats (Hirose et aZ. 1989). It is of interest that both c d e i c acid and catechol are o-
257
ANTIOXIDANTS A N D CARCINOGENESIS
OH
WH3) b
OH
0J@
3
L
O
3-t-BHA
Sesamol
(Forestomach)
(Forestomach)
CIH
&OH
@OH (333
OH
@OH &ICHCOOH =
Catechol
p-meth ylcatechol
Caffeic acid
(Glandular stomach)
(Glandular stomach) (Forestomach)
(Forestomach)
FIG.3. Chemical structures and target organs of phenolic compounds that were found to induce tumors in rats.
dihydroxybenzene derivatives, this chemical structure possibly being responsible for the carcinogenic potential. In addition, BHA is metabolized to an o-dihydroxybenzene derivative as discussed later. The chemical structures of such tumorigenic antioxidants are presented in Fig. 3. No pathological changes were induced in animals receiving a diet containing S l %hydroquinone, a catechol isomer, for 2 years (IARC, 1977). And in a chronic feeding study, the naturally occurring antioxidant eugenol was demonstrated not to be carcinogenic in B6C3F, mice or F344 rats of both sexes. However, the incidence of hepatomas in male B6C3F, mice given repeated intraperitoneal injections of methyleugenol prior to weaning was significantly increased over the control group value (IARC, 1984). Carcinogenicity studies of flavonoids have yielded predominantly negative results, although quercetin, which was positive in the Salmonella mutagenicity test (MacGregor, 1986), was found to be associated with a markedly increased incidence of tumors in the small intestine and urinary bladder of rats treated with 0.1%in diet for I year (Pamukcu et al., 1980). Induction of an increased frequency of hepatomas in rats given 2% in diet has also been reported (Erturk et al., 1984). However, the carcinogenicity of quercetin is controversial because the majority of studies did not demonstrate any resultant tumor development in rats, mice, or hamsters when given at dietary levels of 0.1-10% (Saito et al., 1980; Hirono et al., 1981; Hosaka and Hirono,
258
NOBUYUKI IT0 A N D MASAO HIROSE
1981; Morino et al., 1982; Takahashi et al., 1983; Stoewsand et al., 1984; Ito et al., 1989). Quercetin did not show either initiation or promotion activity in the urinary bladder epithelium in rats (Hirose et al., 1983). The plant flavonoids, kaempferol (Takahashi et al., 1983) and rutin (Morino et nl., 1982), were found not to be carcinogenic in rats and hamsters. Although carcinogenicity studies of vitamin C and its isomers in rats and mice (Abe et al., 1984; Haseman et al., 1984), and of vitamin E in rats (Wheldon et nZ., 1983) gave negative results, it has been demonstrated that subcutaneous injections of 16 mg a-TP dissolved in 0.1 ml soya oil once a week did induce fibrosarcomas at the site of injection in 17 of 22 BALB/c male mice by the beginning of the seventeenth month (Constantinides and Harkey, 1985).The result did not conclusively indicate carcinogenicity for aTP itself but suggested that under particular environmental conditions, this vitamin could be a carcinogen. The observations just described suggest that although the number of tumorigenic antioxidants is as yet limited, further investigation may disclose more compounds of this class, particularly among the naturally occurring examples, that exert carcinogenic potential. Antioxidants appear not to have potent initiation activity in their target tissues as judged from their lack of mutagenic activities. Furthermore, the range of target organs of antioxidants is limited, and high dose levels are required for their induction of tumors. Ill. Histopathological Characteristics of Antioxidant-Induced Tumors
To date, clear tumorigenic activity has been demonstrated in the forestomach of rats treated with 2% BHA, 2%caf€eic acid, or 2% sesamol, and in the glandular stomach of rats given 0.8%catechol or 1.5%p-methylcatechol. These antioxidants induce characteristic epithelial proliferative lesions in their target organs preceding tumor development. Grossly, early lesions of the forestomach epithelium of rats or hamsters continuously fed BHA included diffuse thickening or focal nodular thickening with generation of a gray-white, dense, keratinlike substance on the mucosa. Lesions were preferentially found around the esophageal sphincter and along the lesser curvature. The forestomach of rats treated with caffeic acid showed similar lesion development throughout the epithelium, with focal, shallow ulceration accompanied by hemorrhage. In contrast, the forestomach of rats given sesamol became reduced in size because of the generation of scar tissue by circular ulcers parallel to the limiting ridge, the epithelium adjoining the ulcer being thickened without keratinlike materials (Hirose et aZ., 1987e). Similar lesions were observed in rats treated continuously with 2% 4-methoxyphenol diet (Rodrigues et al., 1986). Histopathologically, antioxidant-induced proliferative forestomach lesions
ANTIOXIDANTS A N D CARCINOGENESIS
259
in rats or hamsters can be divided into hyperplasia, papilloma, and carcinoma. In addition to these proliferative changes, infiltration of neutrophils, lymphocytes, plasma cells, or eosinophils in the epithelial layer as well as in the submucosa, with or without necrosis of epithelial cells or ulcer formation, are usually present within otherwise normal tissue or proliferative lesions. Histological features of induced hyperplasia in the forestomach have been found to differ depending on the chemical administered. Both upward diffuse hyperplasia and downward basal cell hyperplasia were induced by BHA; in addition, BHA caused development of epidermal cysts near the esophageal sphincter. In downward basal cell hyperplasia, cell nests have been very often observed proliferating into the submucosa, and therefore careful distinction from carcinoma is necessary. CafFeic acid induces upward papillary hyperplasia, but basal cell hyperplasia and cyst formation were less common, in contrast to the situation with BHA. Sesamol also induced papillary hyperplasia adjacent to chronic ulceration. Extensive epithelial necrosis was also observed, this lesion being preceded by ulcer formation. The response of the forestomach epithelium of rats or hamsters given BHA is very rapid. Hyperplasia appeared within 1 week after treatment with 2% BHA diet in rats (Altmann et al., 1985) and hamsters (Hirose et al., 1986d), and the labeling index increased within 3 days after treatment with BHA in hamsters (Hirose et al., 1986d). In comparison with this rapid hyperplastic response, the time taken for induction of forestomach tumors in animals is very long. For example, it takes -2 years to induce squamous-cell carcinomas in rats treated with BHA at a dose of 2% in the diet (Masui et al., 1986b), the tumors mainly developing in regions where the hyperplasia is most pronounced. Thus, in the forestomach of rats treated with BHA, tumors arise around the esophageal sphincter, while in animals treated with caf€eic acid there is no preferential localization, and in those treated with sesamol they arise adjacent to the ulcers. Three types of papillomas have been observed in antioxidant-treated rat forestomach. The first is characterized by upward papillary projection of squamous epithelium with fine stromal connective tissue (typical papilloma); the second demonstrates upward projection of squamous epithelium with excess stromal connective tissue (fibroepithelioma), and the third is a lesion that shows both upward papillary and downward basal cell growth with abundant connective tissue. The BHA-induced rat or hamster squamous-cell carcinomas were all of welldifferentiated type. Squamous-cell carcinomas possibly develop from fibroepitheliomas, from papillomas, or directly from the hyperplastic epithelium. Cancer cells usually arise from the basal layer and invade downward into the muscular layer and farther into adjacent tissues. However, there is controversy concerning the preneoplastic lesion induced by BHA. Masui et al. (1986a) showed that simple hyperplasia and
260
NOBUYUKI IT0 A N D MASAO HIROSE
papillomas, in which the epithelium proliferates upward without basal cell proliferation, induced in rats by continuous oral treatment with 2% BHA for 72 weeks, are reversible within 24 weeks after withdrawal of BHA. However, basal cell hyperplasia, in which the epithelium proliferated downward, persisted long after cessation of BHA administration. Iverson et al. (1985a) reported that proliferated stratified squamous epithelium in the forestomach of rats treated with 2% BHA for 13 weeks reverted 9 weeks after cessation of BHA, but multilayered basal cell processes remained in the lamina propria with connections to the basal cell layer. In hamsters, treatment with 2% BHA diet for 48 weeks induced hyperplasia, papilloma, and dysplastic lesions. When animals were maintained on basal diet alone for 24 weeks, hyperplasia and papilloma regressed, but the incidence of dysplastic lesion tended to increase. Although the question of whether such dysplastic lesions may develop into cancers remains unanswered, this lesion does seem important for hamster forestomach carcinogenesis by BHA (Masuda et al., 1988). Reversibilities of the forestomach epithelium lesions were compared in rats treated with the genotoxic carcinogens MNNG and 8-nitroquinoline, and the nongenotoxic carcinogens BHA and c d e i c acid for 24 weeks, and then basal diet alone for another 24 weeks. In rats treated with genotoxic forestomach carcinogen, the incidence of hyperplasia and/or carcinoma clearly increased after withdrawal of carcinogens. In contrast, those treated with nongenotoxic carcinogens decreased in incidence and grade of hyperplasia after cessation of carcinogen administration (Table 111) (Kagawa et al., 1988). Similarly, although continuous oral treatment with uracil to rats at a dose of 3% in diet for 15 weeks induced high yields of calculi and papillomatosis in the urinary bladder, with the exception of one papilloma, these had completely regressed in rats maintained on normal basal diet for 15 weeks after withdrawal of uracil diet (Shirai et al., 1986). In this case, papillomatosis was considered to be a response to chronic irritation by the calculi. By analogy, the forestomach lesions induced by BHA and caffeic acid could be the direct result of chronic irritation by these chemicals. Administration of 0.8% catechol in diet in male F344 rats induced lesions in glandular stomach having some similarities to those induced by BHA in the forestomach epithelium; that is, both BHA and catechol induced marked cell proliferation and epithelial damage before tumors developed (Hirose et al., 1987d, 1988a). Grossly, in catechol-treated animals the pyloric region of the glandular stomach becomes thickened diffusely with small ulcers (Fig. 4). Histopathologically, the induced lesions have been classified as diffuse hyperplasia, adenomatous hyperplasia, and adenocarcinoma (Fig. 5). Hyperplasia and adenomatous hyperplasia develop quickly, that is, within 6 weeks after treatment. However, it takes quite a long time before adenocarcinomas develop, and the resultant incidence is not high. The question of rever-
TABLE I11 FORESTOMACH LESIONSIN RATS NONGENOTOXIC OR GENOTOXIC CARCINOGENS
REVERSIBILITY OF
TREATEDWITH
Number of rats with (%)
Treatment (weeks) Chemicals-
BHA CaEeic acid
With chemical
Without chemical
Number of rats
24
24
0 24
9 10
24
0
9
24
24 0 24 0 24
MNNG
24
8-NQ
24 24
24 a
H yperplasia Moderate
Severe
9 (100) 9 (90) 9 (100)
7 (77.8) 0 9 (100)
0
10 8 6 10
8 (80)
0
8 (100) 6 (100) 2 (20)
4 (50) 6 (100) 0
0 8 (100)
10
8 (80)
0
MNNG, N-Methyl-N'-nitro-N-nitrosoguanidine; 8-NQ. 8-nitroquinoline.
Papilloma
0 l(ll.1)
4 (66.7) 0 1 (10)
Carcinoma 0 0 0 0 2 (25) 6 (100) 0
0
262
NOBUYUKI IT0 AND MASAO HIROSE
FIG.4. Stomach of a rat treated with 0.8% catechol for 51 weeks. The pyloric region of the glandular stomach is thickened diffusely, and focal thickening and ulceration are evident in the forestomach epithelium.
FIG.5. Adenocarcinoma of a rat treated with 0.8% catechol for 51 weeks. Atypical glands irregularly proliferating into the submucosa with dense connective tissue and infiltration of inflammatory cells.
ANTIOXIDANTS A N D CARCINOGENESIS
263
sibility of catechol-induced glandular stomach lesions is now under investigation. A neoplasm was defined by Willis as “an abnormal mass of tissue, the growth of which exceeds and is uncoordinated with that of the normal tissues and persists in the same excessive manner after the cessation of the stimuli which evoked the change.” According to this definition, papillary lesions in the forestomach of animals treated with BHA or caffeic acid, previously referred to as papillomas, cannot be considered as true neoplasms, but rather as papillary hyperplasia. These results indicate that continuous cell proliferation caused by chronic irritation may be responsible for the induction of forestomach tumors by antioxidants. In the case of genotoxic forestomach carcinogens, hyperplasias and papillomas have the potential for further development into carcinoma without additional carcinogenic stimulus, but this is not the case with the antioxidant-associated lesions. Although the cells in the basal layer may be important for the development of forestomach cancer in the latter case, it is still difficult to be certain about what may constitute the true preneoplastic lesion induced by antioxidants. IV. Possible Mechanisms of Action of BHA in Forestomach Tumorigenesis
In contrast to the genotoxic carcinogens, whose reactive species interact with nucleic acids in their target organs with or without metabolic activation, the mechanisms of action of the nongenotoxic (negative result by Ames test) BHA are still obscure. A. TISSUEDISTRIBUTION AND EXCRETION OF BHA Most of the orally administered 3-BHA is absorbed and rapidly excreted in urine, feces, and expired air within 2-4 days in rats (Astill et al., 1960; Golder et al., 1962; Ansari and Hendrix, 1985; Hirose et al., 1987b), dogs (Astill et al., 1962; Takizawa et al., 1985), humans (Astill et al., 1962; Daniel et al., 1967; El-Rashidy and Niazi, 1979; Castelli et al., 1984), and rabbits (Dacre and Denz, 1956). Examination of the radiocarbon labeling in various tissues of rats treated with a single intragastric dose of [ tert-butyl-14C]-3BHA (*Bu-3-BHA) or [tert-butyl-14C]-2-BHA (*Bu-2-BHA) periodically after administration revealed, however, that essentially similar levels persisted in the forestomach, glandular stomach, and esophagus-the latter two organs not being targets of BHA-at various intervals after administration (Ansari and Hendrix, 1985; Hirose et al., 1987b). The tissue distribution of radioactivity 7 days after intraperitoneal injection of [methyl-’4C]-3-BHA in beagle dogs did not differ between the cardia, corpus, and pylorus, with values being lower than in the other main organs (Takizawaet al., 1985). The
264
NOBUYUKI IT0 A N D MASAO HIHOSE
radiocarbon level in the forestomach of rats treated with *Bu-2-BHA was found to be higher than after treatment with *Bu-3-BHA. Considering that 3-BHA is more active than 2-BHA in the induction of forestomach lesions in rats and hamsters (Altmann and Grunow, 1986; Hirose et al., 1986d), the results therefore indicate that tissue distribution and carcinogenicity of BHA do not directly correlate. Metabolites of BHA in the urine and feces were analyzed in rats 6 hr after a single intragastric administration of labeled 2-BHA or 3-BHA. The major metabolites in urine after administration of 3-BHA were glucuronides (-42% of dosed 3-BHA), whereas after 2-BHA both ethereal sulfate (40% of dosed 2-BHA) and glucuronides (25%) were present. Minor metabolites in the urine of rats administered 3-BHA were unchanged 3-BHA and the sulfate of TBHQ, and unchanged 2-BHA in the 2-BHA case. The major metabolites in feces of rats after administration of 3-BHA and 2-BHA were unchanged 3-BHA (16%) and 2-BHA (9%), respectively. Minor metabolites of 3-BHA were di-3-BHA (2,2’-dihydroxy-3,3’-di-tert-butyl-5,5’-dimethoxydiphenyl), TBQ (tert-butylquinone), TBHQ, sulfate of TBHQ, glucuronide of 3-BHA and other unidentified metabolites, and in animals given 2-BHA they were TBQ, di-2-BHA (2,2’-dihydroxy-4,4’-di-tert-butyl-5,5‘-diineth~xydiphenyl), 2-TBOQ (4-tert-butyl-5-methoxy-1,2-benzoquinone), sulfates of 2-BHA, glucuronides of 2-BHA, and others (Hirose et al., 198813). Similar results were obtained from analysis of urine and feces of rats by other workers (Astill et al. 1960; Minegishi et al., 1981).In dogs, 60% of orally administered BHA was excreted as unchanged BHA in the feces within 3 days, the remainder finding its way into the urine largely as sulfate conjugates of BHA, TBHQ, and unidentified phenols. Human volunteer subjects, given 0.5-0.7 mg BHA/kg, yielded <1% of the dose as unchanged BHA in the urine, and 20-77% as glucuronides of BHA, mostly within 24 hr (Astill et al., 1962; Castelli et al., 1984). In another study, 24 hr after ingestion of 100 mg BHA, <1% of the dose was excreted in the urine as unchanged BHA, whereas 44 was lost as the glucuronide and 26% as the sulfate of BHA (El-Rashidy arid Niazi, 1983). Therefore, the major detoxifying metabolic pathway of orally administered BHA appear to be conjugation of the free hydroxy group with glucuronic acid and sulfate, regardless of the animal species.
B. In Vitro
AND
in Vivo METABOLISMOF BHA
In metabolism studies of BHA in vitro, several interesting metabolites have been identified. Incubation of [14C]-3-BHAwith four different enzyme systems [liver microsomes NADPH; liver microsomes cumene hydroperoxide; sheep seminal vesicle microsomes arachidonic acid; horseradish peroxidase (HRP) hydrogen peroxide] yielded a variety of products, in-
+
+
+
+
ANTIOXIDANTS A N D CARCINOGENESIS
265
cluding formaldehyde, di-3-BHA, and polar metabolites as well as reactive intermediates that bind irreversibly to proteins (Rahimtula, 1983). Di-2BHA was isolated as a product of the reaction of either commercial HRP or partially purified rat intestine peroxidase and hydrogen peroxide with 2BHA. Demonstration of di-2-BHA in plasma and homogenate of intestinal tissue of rats treated with 2-BHA indicated that such peroxidative oxidation also occurs in uiuo (Guarna et al., 1983; Sgaragli et al., 1980). Di-3-BHA is also formed by incubating 3-BHA with liver microsomes from rats given pnaphthoflavone (Armstrong and Wattenberg, 1985). Interaction of 3-BHA with liver microsomal cytochrome P-450 generates demethylated metabolites such as TBHQ and TBQ, which alter the monooxygenase function of liver microsomes to that of an oxidase. This stimulated oxidase activity was characterized by parallel increase in NADPH oxidation, oxygen consumption, and hydrogen peroxide formation. 3-BHA does not stimulate the NADPH oxidase activity of purified NADPH-cytochrome-c, (P-450) reductase alone, but the cytochrome P-450-dependent monooxygenase generates 3-BHA metabolite(s) capable of directly linking the reductase to the reduction of molecular oxygen without the further involvement of cytochrome P-450 (Cummings and Prough, 1983). The metabolism of 3-BHA was further examined using both rat and human liver microsomal fractions, purified isozymes of cytochrome P-450, and isolated rat hepatocytes (Cummings et al., 1985). TBHQ, TBQ, and polar metabolite(s) of 3-BHA were found in the presence of microsomal fractions or isolated cells, and BHA metabolism appeared to be mediated by cytochrome P-450, because the rate of formation of each of the metabolites of 3-BHA was increased by pretreatment of rats with either 5,6-benzoflavone or phenobarbital (PB). Importantly, a major metabolite was found to bind covalently to microsomal protein. In the presence of glutathione the rates of formation of the polar metabolite(s) were enhanced 3- to 4-fold, while covalently bound products were nearly stoichiometrically decreased. The increase in the amount of polar metabolite was due to the formation of 3-BHA-glutathione conjugate (Cummings et al., 1985). However, 3-BHA-glutathione conjugate has not yet been detected in viuo. When PB and 3-methylcholanhrene (3-MC) microsomes were compared for their ability to produce four BHA metabolites, PB microsomes generally gave the highest levels of all metabolites except the protein-binding form, whereas 3-MC microsomes gave the highest level of protein-bound adduct while other metabolites were relatively low (Rahimtula, 1983). Furthermore, [ring-14C]-3-BHA ("R-3-BHA) was shown to bind covalently to rat liver microsomal protein from rats given PB in the drinking water in the presence of NADPH, and binding was markedly decreased by addition of Lcysteine. The adduct may be the product of a reaction between TBQ and Lcysteine (deStafney et al., 1986). Armstrong and Wattenberg (1985) demon-
266
NOBUYUKI IT0 AND MASAO HIROSE
strated that incubation of 3-BHA with liver microsomes from rats given (3naphthoflavone by oral intubation produced two major and one minor metabolite. One of the former was TBOHQ (tert-butyl-4,5-dihydroxyanisole, 42% of the total metabolites present), which is easily oxidized to form TBOQ. The second major metabolite was TBHQ (54% of the total metabolites present), and the third, minor metabolite was di-3-BHA. They considered that TBHQ and TBOHQ may be responsible for some of the modulating effects of 3-BHA on chemical carcinogenesis. It is of importance to mention that these metabolites were identified mostly by incubation of BHA with liver microsome systems, and may not be directly correlated with the carcinogenic effect of BHA on rat forestomach epithelium. Therefore further investigations were performed in our laboratory to determine whether these metabolites were also formed in the forestomach epithelium. However, neither the in uiuo metabolism study using the TLC method after a single oral administration of 3-BHA, nor in vitro incubation of 3-BHA with the 9000-g supernatant of forestomach epithelium and gastric juice with or without addition of NADPH, demonstrated any metabolites (Hirose et al., 1987a). Since in uitro studies suggested that 3-BHA metabolite(s), presumably TBQ, TBOQ, and/or TBOHQ, bound to microsomal protein, binding studies of BHA to forestomach DNA, RNA, and protein were carried out. Six hours after intragastric administration of 1g/kg 'Bu-3-BHA or [methyl-14C]BHT (*Me-BHT), rats were sacrificed and DNA, RNA, and protein were isolated from forestomach, glandular stomach, liver, and kidney tissue. 3BHA did not covalently bind to forestomach DNA or RNA. Interestingly, the amounts of *Bu-3-BHA bound to forestomach protein were 13, 5,and 11 times higher than those bound to glandular stomach, liver, and kidney protein, respectively. However, the value for radioactivity was not significantly different from that of *Me-BHT, which was not associated with any induction of proliferative lesions in the forestomach epithelium (Hirose et a l . , 1987a). Lack of binding of BHA, TBQ, and TBOQ to forestomach DNA was further confirmed by the 32P postlabeling method (Saito et al., 1988). In another study, the binding levels of *R-3-BHA to microsomal proteins of the forestomach, glandular stomach, and liver were determined 24 hr after administration of *R-3-BHA. The result showed that forestomach microsomal protein contained 14 times as much bound radioactivity as glandular stomach and 12 times as much as liver (deStafney et al., 1986). These results indicate that BHA can be oxidatively metabolized in microsomes of the liver as well as in the forestomach epithelium, and that oxidative metabolite(s) can preferentially bind to microsomal proteins (probably thiols) of the forestomach epithelium. Lack of appreciable BHA-DNA adducts in the forestomach epithelium does not rule out the possibility that amounts below detection level can be formed, but it is evident that metabo-
ANTIOXIDANTS AND CARCINOGENESIS
267
lite(s) bound rapidly to proteins or other macromolecules. Interaction of BHA or its metabolites with DNA therefore does not seem important for the induction of forestomach neoplasia. C. EFFECTSOF OTHERCHEMICALS O N BHA-INDUCED FORESTOMACH HYPERPLASIA From in vitro studies, it is apparent that formation of 3-BHA metabolites can be increased by pretreatment of rats with microsomal enzyme inducers such as PB, P-naphthoflavone, or 5,6-benzoflavone. In our laboratory rats were treated with 1% BHA together with 0.05% PB or 0.05% polychlorinated biphenyl (PCB) in the diet for 4 weeks, with pretreatment with PB or PCB alone for 1 week, and then the forestomach epithelium was examined histopathologically. The incidence of forestomach hyperplasia in rats treated with BHA and PB was not significantly different from that treated with BHA alone. The decreased incidence of hyperplasia observed in rats treated with BHA and PCB may have been due to the reduction in food intake (Hirose et al., 1987~). During treatment with BHA, an inflammatory reaction develops in the mucosa. Therefore, the effects of antiinflammatory agents on BHA-induced forestomach hyperplasia were examined. Indomethacin, 6-aminocaproic acid, and FOY305 were all simultaneously administered with BHA for 52 weeks, but none of them affected the incidence of BHA-induced forestomach hyperplasia (Hirose et al., 1987c; Masuda et al., 1987). However, Rodrigues et al. (1986) showed that treatment with 0.5% aspirin, an antiinflammatory drug, did significantly inhibit proliferation in the forestomach epithelium of rats caused by 2% BHA. Interestingly, concomitant treatment with 0.25% diethylmaleate (DEM), a well-known thiol depleter, clearly inhibited the development of BHAinduced forestomach hyperplasia although in this case the level of GSH in the forestomach epithelium of rats treated with BHA plus DEM was elevated to twice that of animals receiving BHA alone (N. Ito and M. Hirose, unpublished observations). In contrast, the incidence of BHA-induced forestomach hyperplasia in rat was enhanced by the simultaneous treatment with 1% SA, a known antioxidant and reducing agent. Other antioxidants including BHT, a-TP, ethoxyquin (EQ), and PG did not exert such a clear enhancing effect (Hirose et al., 1987f; Masuda et al., 1987), and combined treatment with 1% GSH and 1% BHA for 1 week in rats pretreated with GSH for 1week did not inhibit the resultant induction of forestomach hyperplasia by BHA (Hirose et aE., 1986a). Although there are some discrepancies between data from in vitro and in vivo studies, the observed protection against BHA-induced forestomach hyperplasia associated with increased
268
NOBUYUKI IT0 A N D MASAO HIROSE
tissue GSH after DEM coadministration but failure to find GSH conjugates of BHA in forestomach epithelium suggest that GSH is not involved in detoxification of BHA through conjugate formation, but does play a role in reducing cellular damage caused by BHA metabolites or radical species, or may inhibit its oxidative metabolism.
D. DETECTIONOF RADICALSDURING METABOLISMOF BHA Much attention has been paid of late to the possible contribution of free radicals to the promotion of chemical carcinogenesis (Ames, 1983; Kensler and Trush, 1984; Schwarz et al., 1984; Troll et al., 1984; Kozumbo et al., 1985; Marnet, 1987; Perera et al., 1987). Until 1980, the accepted metabolic transformation of 3-BHA and 2-BHA was conjugation with glucuronic acid and sulfate. In 1980, however, Sgaragli et al. (1980) found free-radical species during peroxidative oxidation of 2-BHA. When BHA was incubated with HRP and hydrogen peroxide, an ESR signal that suggested that the radical was firmly bound to protein was recorded, and the radical generation preceded di-BHA formation. However, di-BHA formation through radical reaction is considered to play a role in the inactivation of BHA, because intraperitoneal injection of di-BHA at a dose of 720 mg/kg body weight was much less toxic than that of BHA at a dose of 50 mg/kg body weight (Sgaragli et al., 1980). The following metabolic pathway, which may be the source of radical formation, seems to be more important with regard to neoplastic activity of BHA on rat forestomach epithelium. During microsomal metabolism of 3BHA in the liver, as well as in the forestomach epithelium, TBHQ, TBQ, TBOHQ, TBOQ, and protein adducts are formed. The reaction could occur via redox cycling (Kappus and Sies, 1981). A proposed schematic metabolic pathway of BHA including redox cycling is presented in Fig. 6. 3-BHA is metabolized by microsomal enzymes to TBOHQ or TBHQ, the latter pathway being of presumed lesser importance because TBHQ did not induce forestomach tumors in rats. TBOHQ is unstable and can be quickly metabolized to a semiquinone radical and then TBOQ, which can bind to thiols. This pathway is reversible, and during redox cycling active oxygen species could be formed (i.e., 0, H,O,, lo2, or .OH), and these free radicals may bind to DNA, protein, and lipids. DNA binding may cause mutagenicity or carcinogenicity, protein binding may lead to enzyme damage, and lipid binding may induce lipid peroxidation and membrane damage (Kappus and Sies, 1981). However, it is not known which factor is most important in the carcinogenic process of BHA. One possible reason why no metabolites could be identified in forestomach epithelium of animals treated with BHA may he because metabolites have a very short life and may bind to proteins or other macromolecules very rapidly. Free radicals could not be detected by TLC or
269
ANTIOXIDANTS AND CARCINOGENESIS
OH
@c(cH3)3 m 3
BHA
\
Semiquinone
TBHQ OH
radical
TBQ
4
OH
OH
I
o(313
Alkyl radical
di-BHA
FIG. 6. Putative metabolic pathways of orally administered BHA. (Modified from Kappus and Sies, 1981).
HPLC methods, and efforts were made to detect ESR signals from the homogenates of rat forestomach epithelium using spin trap 5,5-di-methyl-lpyrroline-N-oxide (DMPO). Rat forestomach epithelium was homogenized in PBS and supernatant incubated with BHA in the presence of DMPO solution for 30 min at 37°C. The ESR signal was identical with that obtained from the xanthine-xanthine oxidase system. However, BHT, which is not carcinogenic for rat forestomach epithelium, did not give an ESR signal. Analysis of radical species generated is now under investigation. It is of interest that the catechol of 3-BHA, namely, 3-TBOHQ, is formed during 3-BHA metabolism, because another three catechol types of phenolic antioxidants have been shown to be carcinogenic: catechol itself ( U - d i hydroxybenzene), p-methylcatechol, and caffeic acid induced glandular stomach and forestomach tumors, respectively, in rats. Therefore, it is possible that chemicals that have the catechol structure can all act as sources of radicals that may be related to the carcinogenic process. However, incubation of catechol and c a e i c acid with homogenates of glandular stomach
270
NOBUYUKI IT0 A N D MASAO HIROSE
epithelium and forestomach epithelium, respectively, in the presence of DMPO gave no ESR signals (unpublished data). Kasai and Nishimura (1984) found that the hydroxylation of deoxyguanosine proceeds efficiently with various polyphenols in the presence of hydrogen peroxide (H,02) and ferric ions (Fe3+). For example, when deoxyguanosine was reacted with catechol, pyrogallol, or chlorogenic acid in the presence of H 202 and Fe3 , formation of 8-hydroxydeoxyguanosine (8-OHdG) was detected by HPLC. Hydroquinone yielded more 8-OH-dG than these chemicals. The extent of 8-OH-dG formation in DNA was comparable to that of DNA strand scission, although carcinogenicity and formation of 8OH-dG are not necessarily correlated because carcinogenicity has not been reported for hydroquinone. In another experiment, when rats were treated with potassium bromate, which possesses a strong oxidizing activity and is carcinogenic to rat kidney (Kurokawa et al., 1986), 8-OH-dG was formed in the kidney but not in the liver, a nontarget organ. The result clearly showed a positive correlation between the formation of 8-OH-dG in DNA and KBrO, carcinogenesis, and confirmed the involvement of oxygen radicals in this carcinogenic process (Kasai et al., 1987). Correlation between the tumorigenic activity of antioxidants such as BHA, catechol, caffeic acid, and sesamol, and formation of 8-OH-dG is presently under investigation. From the current data it is conceivable that radicals play a role in the chemical carcinogenesis (including promotion and carcinogenicity) of antioxidants, but direct confirmation has not yet been possible. +
V. Modification of Carcinogenesis by Antioxidants
Many antioxidants have been shown capable of modifying chemical or ultraviolet carcinogenesis in a broad spectrum of organs. In the earliest experimental modification study carried out in 1937, coal tar carcinogenesis was prevented by simultaneous treatment with wheat germ oil containing tocopherols (Davidson, 1934). Later on, Wattenberg found that synthetic antioxidants such as BHA, BHT, EQ, and some naturally occurring antioxidants were potent chemopreventers of chemical carcinogenesis when administered prior to, simultaneously with, or shortly d e r carcinogen exposure (Wattenberg, 1976, 1978a,b, 1980, 1983, 1985; Wattenberg and Lam, 1981). However, antioxidants have since been demonstrated to exert not only inhibitory but also enhancing effects on chemical carcinogenesis. In addition to direct effects themselves on the initiation and/or postinitiation neoplastic process, they can also exert an influence by blocking nitrosamine formation or reducing promotion activity of promoters such as 12-0tetradecanoylphorbol-13-acetate(TPA) in skin carcinogenesis, or high polyunsaturated fatty acid diet in colon and mammary gland carcinogenesis
ANTIOXIDANTS AND CARCINOGENESIS
27 1
(Tsuda et al., 1983; Kahl, 1984, 1986; Ito et al., 1984, 1985, 1986b,c, 1987; Ito and Hirose, 1987). The mechanisms underlying modification appear to vary with stage of interaction, but they may partly correlate with antioxidant action.
A. MODIFICATION BY ANTIOXIDANTTREATMENT PRIOR TO, SIMULTANEOUS WITH,OR SHORTLY AFTER CARCINOGEN ADMINISTRATION Carcinogens administered to animals are absorbed from the gastrointestinal tract or from the site of administration, and are then distributed throughout the body and metabolized in tissues including the liver and target sites. They are detoxified or activated enzymatically, and activated metabolites or reactive oxygen species then covalently bind to cellular macromolecules such as DNA, lipid, and protein, thus causing DNA or cellular damage followed by carcinogenesis. Antioxidants can modify the carcinogenic process at different stages, including (1)alteration of the metabolic activation of a precarcinogen by (a) inhibition of the activating enzyme or (b) alteration of the metabolic pattern of the carcinogen via selective enzyme induction; (2) prevention of the reaction between the ultimate carcinogen and DNA by (a) direct interaction with the carcinogenic species, (b) increased detoxication by antioxidant-inducible enzymes, or (c) competition between carcinogen and antioxidant in the binding process (Wattenberg, 1978a,b, 1985). Many examples of modifcation by antioxidants have been reported in the initiating stage of chemical carcinogenesis (Tables JV and V). Generally, antioxidants had long been believed to inhibit chemical carcinogenesis when given together with carcinogens, although some results have showed that inhibition is not a universal phenomenon. For example, simultaneous treatment with DBN and BHA or BHT clearly enhanced the subsequent development of hepatocellular carcinomas in rats, whereas forestomach hyperplasia was inhibited, and generation of urinary bladder lesions was not affected. The results strongly suggested that BHA and BHT might have stimulated the metabolic pathway from DBN to N-butyl-N-(3-oxobuty1)nitrosamine (BOPN-3) or N-butyl-N-(2-oxobutyI)nitrosamine (BOPN-2), which are thought to be ultimate hepatocarcinogens, but not that from DBN to N-butyl-N-(3-~arboxypropyl) nitrosamine (BCPN), which is the ultimate urinary bladder carcinogen (Imaida et aZ., 1988). A number of other cases in which simultaneous administration brought about an unexpected increase in yield have been reported. For example, BHT enhanced rat urinary bladder carcinogenesis given 2-AAF (Williams et al., 1983) and a-TP, and BHT increased 1,2-dimethylhydrazine (DMH)-induced carcinogenesis in mouse large intestine (Lindenschmidt et d.,1986), and BHA
MODIFYING EFFECTOF ANTIOXIDANTS ON
TABLE IV INITIATING STAGEOF CARCINOGENESIS IN ANIMALV
THE
Antioxidant Organ
Initiator
Species
Oral cavity Esophagus Forestomach
DMBA DBN MNU MNNG DHPN DBN BP BP 7,8-dihydrodiol DEN DMBA MNNG
Hamster Rat Rat Rat Rat Rat Mouse Mouse
DMH MNU DMH DMH
Rat Rat Mouse Rat
MNU AOM
Rat Rat
Glandular stomach Duodenum
Colon
Mouse Mouse Rat
BHA
BHT
c,
cf
EQ
t t
t 1 1 1
1 1
SA(AA)
a-TP
References
1
Shklar (1982);Trickler and Shklar (1987) Imaida et al. (1988) Shihata et 01. (1988) Balansky et 02. (1986); Newberne et 01. (1986) Shihata et al. (1988) Imaida et d . (1988) Wattenberg et a / . (1979, 1980) Wattenberg et 02. (1979)
c,
1 1 1 1 1
1
c, c,
c, c,
t 1 t , t ,
Clapp et 01. (1978) Wattenberg (1972) Tatsuta et al. (1983); Balansky et 01. (1986); Newberne et a2. (1987) Reddy et 02. (1982) Reddy et 02. (1982) Toth and Patil (1983) Reddy et 01. (1982); Colacchio and Memoli (1986) Reddy et 01. (1982) Weishurger et al. (1977)
Pancreas Liver
Kidney Urinary bladder
Lung
1
MAM acetate
Mouse
DMH DMH
Mouse Mouse
DMAB 2-AAF AFB, N-OH-AAF 3'-Me-DAB DMAB DBN DEN DMH 2-AAF
Rat Rat Rat Rat Rat Rat Rat Mouse Rat Rat
c,
DBN DMAB MNU DHPN MAM acetate BP 7,8dihydrodiol DMN NPYR
Rat Rat Rat Rat Mouse Mouse
c,
t t 1 1 1
Imaida et al. (1988) Shibata et al. (1988) Shibata et al. (1988) Shihata et a / . (1988) Reddy and Maeura (1984) Wattenberg et al. (1979)
Mouse Mouse
1 t
Chung e t a / . (1986) Chung et a / . (1986)
t 1
1 1 t
c,
1 1 1 1
t c,
1
t c,
Wattenberg and Sparnins (1979) Reddy et al. (1983);Reddy and Maeura (1984) Toth and Patil (1983) Clapp et al. (1979);Temple and El-Khatih (1987) Shibata et a/. (1988) Ulland et al. (1973);Williams et al. (1983) Williams et al. (1986); Manson et a!. (1987) Ulland e t a / . (1973) Daoud and Griffin (1980) Shibata et al. (1988) Imaida et al. (1988) Clapp et al. (1978) Reddy et al. (1982) Williams et al. (1983)
(continued)
TABLE IV (Continued) An tioxidant Organ
Mammary gland Ear duct
Skin Subcutis Lymphoid tissue
Initiator
Species
DMBA BP Urethane DEN Urethane Urethane DMBA
Mouse Mouse Mouse Mouse Mouse Mouse Rat
MNU DMH AOM DMAB DMBA DMBA 3-MC BP 7,sdihydrodiol
Rat Rat Rat Rat Mouse Mouse Mouse Mouse
BHA
BHT
EQ
SA(AA)
a-TP
1
1 1 c,
1 1
ir
1
1
c,
1 t ,
1 c,
1
1
1
c,
1
1 t ,
1
1
References Wattenberg (1973 Wattenberg (1973) Malkinson and Beer (1984) Clapp et ~ l (1978) . Malkinson and Thaete (1986) Wattenberg (1973) Wattenberg (1972); McCormick et d.(1984); . Cohen et ~ l (1986) Reddy et d.(1982) Reddy et ~ l (1982) . Weisburger et al. (1977) Shibata et nl. (1988) Slaga and Bracken (1977) Wattenberg (1972) Haber and Wissler (1962); Abdel-Galil (1986) Wattenberg et d.(1979)
" AA, Ascorbic acid; 2-AAF, N-2-fluorenylacetamide; AFB,, aflatoxin B,; AOM, azoxymethane, BBN, N-butyl-N-(4-hydroxybutyl)nitrosamine; BP, benDBN, N-dibutylnitrosamine; DEN, N-diethylnitrosamine; DHPN, dihydroxy-di-Nzo[a]pyrene; BP 7,s-dihydrodiol. (+)-trans-7,8-dihydrohenzo[a]pyrene; propylnitrosamine; DMAB, 3,2'-dimethyl-4-aminobiphenyl;DMBA, 7,12-dimethylbenz(o)anthracene;DMH, 1.2-dimethylhydrazine; DMN, N-dimethylnitrosamine; EQ, ethoxyquin; MAM, methylazoxymethanol; 3-MC, 3-methylcholanthrene; 3'-Me-DAB, 3'-methyl-4-dimethylaminoazobenzene;MNNG, N-methyl-N'-nitro-N-nitrosoguanidine; MNU, N-methylnitrosourea; N-OH-AAF, N-hydroxy-N-2-fluorenylacetamide; NPYR, N-nitrosopyrrolidine. SA, sodium ascorbate; a-TP, a-tocopherol. Symbols: f , promoting effect; 1, inhibitory effect; ++, no effect.
275
ANTIOXIDANTS AND CARCINOGENESIS
TABLE V EFFECTSOF PHENOLICANTIOXIDANTS ON
THE
STOMACH EPITHELIUM
Forestomach
Chemical Phenol 4-Methoxyphenol p-tert-But ylphenol BHA 2-tert-Butyl-4-methyIphenol BHT TBHQ Methylhydroquinone Catechol p-M ethylcatechol p-tert-Butylcatechol CaKeic acid Resorcinol Hydroquinone Ferulic acid Esculin Eugenol
Glandular stomach
Proliferative Effect on Effect on Proliferative Effect on activity, initiation, promotion, activity, promotion, rat mouse rat rat rat ++
++ + +++ +
+ + +++ + +++ -
++
1 .1T *
1 t t f
c,
c,
++
1 c,
1
t t t t
c, c, c,
-
++ ++ +
1
t t t c,
c, cf
c,
++
-
++
References: Wattenberg et al. (1980);Nera et al. (1984);Altmann et al. (1986);Newberne et al. (1986); Rodrigues et al. (1986); Hirose et al. (1987e. 1988a). -, No effect; +, weak; + +, strong, + + +, pronounced; f , enhancing effect; 1, inhibiting effect, ++, no effect, ? *, experiment was done in rats.
enhanced N-nitrosopyrrolidine (NPYR) - induced mouse lung tumor formation (Chung et al., 1986).The phenolic antioxidants catechol and pyrogallol markedly elevated the carcinogenicity of BP in the skin of female ICR/Ha Swiss mice (Van Durren and Goldschmidt, 1976),and catechol enhanced the esophageal but not the forestomach and nasal cavity tumor incidence in male MRC-Wistar rats treated with methyl-n-amylnitrosamine (Mirvish et al., 1985). In contrast, phenol, BHA, BHT, resorcinol, hydroquinone, esculin, and eugenol all inhibited papilloma induction in mice treated with 7,12-dimethylbenz[a]anthracene (DMBA) or BP (Van Durren and Goldschmidt, 1976;Slaga and Bracken, 1977). Mechanism(s) of inhibition of carcinogenesis by BHA, BHT, and other antioxidants have been investigated in a variety of experimental systems. Feeding BHA was found to alter the microsomal system [aryl hydrocarbon hydroxylase (AHH) was not changed, but cytochrome P-450 was increased], which is responsible for metabolizing BP in the liver of female A/HeJ mice,
276
NOBUYUKI ITO A N D MASAO HIROSE
and bringing about a decrease in BP metabolite binding to DNA (Speier and Wattenberg, 1975). This suggests that BHA decreased the formation of reactive metabolites of BP in the liver. The inhibition of carcinogenesis by BHA was also observed in the forestomach, lung, and lymphoid system of mice treated with (+)-trans-7,8-dihydrobenzo[a]pyrene(BP 7,8-dihydrodiol), indicating that the inhibitory action occurs subsequent to the formation of BP 7,8-dihydrodiol (Wattenberg et al., 1979). Treatment with BHA decreased the amount of the (+)-7P,8a-dihydroxy-9a, lOa-epoxy-7,8,9,lO-tetrahydrobenzo[a]pyrene (BP 7,8-diol-9,lO-epoxide 2) adduct in the lung and the liver to -45 and 25%, respectively, of carcinogen-alone values in A/HeJ female mice treated with BP. The decrease in the amount of this adduct in the lung appeared to correlate with the inhibition of pulmonary adenoma formation. Thus, BHA may inhibit BP-induced pulmonary adenoma forniation by reducing the amount of BP 7,8-diol-9,10-epoxide 2-DNA adducts formed in the lung tissue (Anderson et al.,1981). In addition to the alteration of phase I BP metabolism, levels of phase I1 detoxification enzymes were also changed by BHA given in the diet to A/HeJ mice. For example, the activities of cytosolic GSH S-transferase and UDP-glucuronyltransferase that conjugate BP were enhanced in the liver, forestomach, and other organs (Benson et aZ., 1978, 1979; Cha and Bueding, 1979; Lam et al., 1981; Saprnins and Wattenberg, 1981; De Long et al., 1985). The activity of epoxide hydrolase, which hydrolyzes electrophilic epoxide to their corresponding diols, has also been reported to be elevated by feeding of BHA (Benson et al., 1978; Cha et al., 1978; Lam et al., 1981). GSH S-transferase plays a particularly important role in detoxifying alkylating agents, epoxides, and other electrophilic substances by the formation of GSH conjugates (Smith et al., 1977). BHA also elevates the level of quinone reductase in oitro (Prochaska et al., 1985; De Long et al., 1986) and in the liver of mice (De Long et al., 1985), this enzyme also occupying a central position in drug metabolism. Quinone reductase protects against quinone toxicity by promoting two-electron reductions that divert quinones from oxidative cycling or direct interaction with critical nucleophiles (De Long et al.,1986). 3-BHA is more effective in the induction of GSH S-transferase and quinone reductase than 2-BHA in the liver, but is less effective than 2-BHA in the forestomach (Lam et al.,1981). Considering that 2-BHA is more active in the inhibition of BP-induced forestomach carcinogenesis than 3-BHA (Wattenberg et al., 1980), alteration of BP metabolism rather than activation of detoxifying enzymes may be more important for the inhibition of forestomach carcinogenesis by BHA. BHT has been demonstrated to inhibit forestomach carcinogenesis but does not influence hepatocarcinogenesis in female BALB/c mice when administered concomitantly with N-diethylnitrosamine (DEN) (Clapp et d.,
ANTIOXIDANTS A N D CARCINOGENESIS
277
1978). In this case, the binding of DEN and/or metabolites to cellular macromolecules of the forestomach of female BALB/c mice was decreased following pretreatment with BHT. However, a BHT-associated decrease in DEN binding was also observed in the forestomach of male animals and in the liver of both sexes, although the tumor incidences in these target organs for DEN carcinogenesis were not modified by BHT treatment. In the forestomach of female mice treated with BHT, binding of the antioxidant to cellular DNA and a secondary decrease in binding of DEN to cellular RNA species were observed. These results suggest that the BHT-associated decrease in the binding of DEN to DNA was of a generalized rather than a selective nature, this possibly being insufficient to account for the evidence protective effect. Thus the anticarcinogenic properties of BHT may be more complex than simple induction of enzymes that detoxify and/or inhibit activation of carcinogen (Daugherty, 1984). A direct action of BHT (competitive binding?) to macromolecules cannot be excluded. The possibility that antioxidants serve as nucleophiles that act as scavengers for electrophilic carcinogen intermediates was investigated applying a quantitative structure-activity relationship index (QSAR). Values for QSAR were formulated for a series of 22 phenolic inhibitors of carcinogenesis, taking account of their inhibition of forestomach tumor induction in BPtreated mice, as one biological parameter, and minimal topological differences (MTD), lipophilicities, quantum mechanics indices, and Hammett constants, as structural and physicochemical variables. The results indicated that antioxidizing potential is not directly responsible for the inhibitory properties of the investigated phenols (Niculescu-Duvilz et ul., 1985). In addition to synthetic antioxidants, some naturally occurring antioxidants have been shown to modify carcinogenesis. For example, ellagic acid, ferulic acid, and chlorogenic acid inhibited BP-induced lung carcinogenesis in mice by intraperitoneal and/or oral administration (Lesca, 1983), and caEeic acid and ferulic acid treatment was associated with reduction of forestomach carcinogenesis in mice treated with BP (Wattenberg et aZ., 1980). Ellagic acid also was found to inhibit 3-MC- and DMBA-induced skin tumorigenesis by feeding (Mukhtar et al., 1986)and topical application (Lesca, 1983), respectively, and in addition decreased lung and skin carcinogenesis induced by BP 7,8-dioI-9,10-epoxide 2 by intraperitoneal and topical application, respectively. However, the inhibition was less marked than for BP itself (Chang et al., 1985). The plant flavonoids robinetin, myricetin, and quercetin also proved effective in inhibiting BP 7,8-dioI-9,10-epoxide 2 lung carcinogenesis in newborn mice (Chang et aZ., 1985).Topical treatment with tannic acid, quercetin, myricetin, or anthrailavic acid to SENCAR mice 24 hr prior to or 30 min after the treatment with DMBA, BP, MNU, or 3-MC reduced the skin tumor multiplicity to 29-79% of the control level (Mukhtar
278
NOBUYUKI IT0 A N D M A S A O HIROSE
et al., 1988).In another experiment, esculin and quercetin inhibited the skin carcinogenicity of BP when given concomitantly to female ICR/Ha Swiss mice (Van Durren and Goldschmidt, 1976). Topical treatment with tannic acid, quercetin, or myricetin resulted in a reduction of [3H]-BP binding to epidermal DNA, and caused a greater inhibition of (+)-[3H]-7p,8a-dihydroxy-7,8-dihydro BP and [3H]-DMBA binding. The formation of BP 7,8diol-9,lO-epoxide 2-deoxyguanosine adducts was also reported to be substantially diminished in both epidermis and lung tissues (Das et al., 1987). Production of BP 7,8-diol-9,10-epoxide 2 is catalyzed by the cytochrome P-450-dependent microsomal enzyme AHH and the non-P-450-dependent microsomal enzyme epoxide hydrolase (Gelboin, 1980), and ellagic acid is a potent inhibitor of epidermal microsomal AHH activity in uitro and in uiuo in rat skin, liver, and kidney (Del Tito et al., 1983; Mukhtar et al., 1984; Das et al., 1985).On the surface it thus seems that the inhibition of DNA adduct formation is caused by reduced activation of BP into proximate carcinogen by ellagic acid. However, the extent of inhibition of metabolic activation of BP to the proximate carcinogen BP 7,8-dihydrodiol by these plant flavonoids did not correlate with their ability to inhibit adduct formation. Therefore it seems that suppressed activation may not be a major factor contributing to reduced adduct formation, but rather that secondary inactivation of BP 7,8diol-9,lO-epoxide 2 is the prime mechanism underlying the observed decrease in reaction between BP and DNA. This has thus been proposed as the basis for the anticarcinogenic nature of these flavonoids (Shah and Bhattacharya, 1986). Ellagic acid, which reduces the mutagenic activity of BP 7,8-diol-9.10-epoxide 2 (Wood et al., 1982), the only known ultimate carcinogenic metabolite of BP, inhibits BP 7,8-diol-9,10-epoxide 2-induced mouse pulmonary tumor formation when administered prior to carcinogen, but does not exert any effect on induction of lesions by BP itself (Chang et al., 1985). Therefore, antioxidants seem to act directly or indirectly at the level of the ultimate carcinogen. In support of this, it has been reported that ellagic acid can itself bind to DNA from explants of esophagus, colon, forestomach, bladder, trachea, lung, and liver, and that this interaction interferes with carcinogen-DNA adduct formation (Teel, 1986; Tee1 et ul., 1987). p-Carotene is a member of the antioxidant family that possesses only weak antioxidant activity and is contained in various vegetables. Treatment with a diet containing 22 mg p-carotene per kilogram significantly reduced the incidence and multiplicity of colon tumors in mice given subcutaneous injections of DMH (Temple and Basu, 1987), and topical treatment with pcarotene also significantly inhibited DMBA induction of tumors in the hamster cheek pouch (Suda et al., 1986). Inorganic and the less toxic organic selenium compounds such as p-methoxybenzeneselenol and benzylselenocyanate are potent first-stage inhibitors of chemical carcinogenesis in the skin (Shamberger, 1970), liver (Griffin, 1979; Tanaka et al., 1985), colon
ANTIOXIDANTS AND CARCINOGENESIS
279
(Jacobs et al., 1977, 1981; Griffin, 1979; Soullier et al., 1981; Reddy et al., 1985), pancreas (Birt et al., 1986), mammary gland (Harr et al., 1973; Thompson and Becci, 1980; Ip, 1981; Ip and Sinha, 1986; Medina and Shepherd, 1981; Welsch et al., 1981; Medina et al., 1983), glandular stomach (Kobayashi et al., 1986; Newberne et al., 1987), kidney (Reddy et al., 1985), forestomach (El-Bayoumy, 1985; Newberne et d., 1986), and esophagus (Nauss et al., 1986) of rats or mice when given as supplements in the diet or drinking water at concentrations S 5 ppm for inorganic selenium and S50 pprn for organic selenium. This modification of carcinogenesis by seleno compounds may be due to alteration of metabolic activation or detoxification through the induction of glutathione peroxidase (Griffin, 1979). The doses of antioxidants applied in the experiments just discussed were mostly <1.0% but were nevertheless still high compared to the permitted levels in foods for human consumption. The lowest dose of an antioxidant that was found effective for the inhibition of chemical carcinogenesis was 0.0003%; skin carcinogenesis in mice induced by 3-MC was strongly inhibited by oral administration of this level of ellagic acid (Mukhtar et al., 1986). However, this result appears exceptional. The question of dose dependence in inhibition of carcinogenesis has, however, received attention. For example, female CF, mice were treated with 0, 0.03, 0.1, 0.3,and 0.6% BHA in the diet and then given methylazoxymethanol (MAM) acetate. The resultant incidences of colon and lung tumors, and number of colon tumors per animal were significantly and doserelatedly inhibited (Reddy et d.,1983;Reddy and Maeura, 1984). There was also a significant overall inhibitory trend in mammary tumor incidence in rats that received long-term exposure to dietary BHT at concentrations of 300, 1000, 3000, and 6000 ppm before and during DMBA administration (Cohen et al., 1986). In our laboratory the effects of high (2%) and low (0.04%)doses of BHA were compared in rats treated with carcinogens. The high dose of BHA clearly enhanced urinary bladder carcinogenesis induced by 3,2’-dimethyl-4-aminobiphenyl (DMAB) or MNU, and forestomach carcinogenesis induced by MNU; it inhibited hepatocarcinogenesis induced by DMAB and lung carcinogenesis induced by dihydroxy-di-N-propylnitrosamine (DHPN). However, at the low dose level slight inhibitory effect on hepatocarcinogenesis induced by DMAB and enhancing effect on forestomach carcinogenesis induced by MNU were also observed (Shibata et al., 1988). Therefore, even low doses of antioxidants are effective for firststage modulation of chemical carcinogenesis.
B. MODIFICATIONBY POS-ITREATMENT WITH ANTIOXIDANTS The moddying effect of antioxidants on carcinogenesis when administered after carcinogen treatment has been examined in various organs by many
280
NOBUYUKI IT0 A N D MASAO HIROSE
investigators. In these experimental systems, carcinogens were given to rats as initiators, and antioxidants were given to rats subsequently in the promotion-modulation stage. As shown in Tables V and VI, antioxidants have promoting or inhibitory effects in various organs and their effects are different at various organ sites, in contrast to the situation with administration of antioxidants prior to and/or simultaneously with carcinogen exposure, when inhibition was generally observed. For example, BHA has been demonstrated to promote forestomach and urinary bladder carcinogenesis, while inhibiting lesion development in the liver and mammary gland. BHT promoted carcinogenesis of the urinary bladder, thyroid, and esophagus, whereas it inhibited ear duct and mammary gland carcinogenesis. Phenol, BHA, BHT, resorcinol, hydroquinone, esculin, and eugenol, which are effective in inhibiting mouse skin carcinogenesis by simultaneous treatment with carcinogen, promoted or were not effective in the second stage of skin carcinogenesis (Van Durren and Goldschmidt, 1976). Although they have not been extensively studied, some naturally occurring antioxidants also inhibit carcinogenesis; for example, inorganic or organic selenium reduced tumor development in the rat mammary gland initiated with DMBA (Thompson and Becci, 1980; Welsch et al., 1981; Thompson et al., 1984), in rat colon initiated with azoxymethane (AOM) (Reddy et a l . , 1988), and pcarotene inhibits oral cavity carcinogenesis in hamsters (Suda et al., 1986). On the other hand, continuous treatment with 1% caffeic acid in the diet enhanced DMBA-initiated forestomach carcinogenesis in female SD rats (Hirose et al., 19 8 8 ~ ). Dose level dependency of antioxidant promotion of carcinogenesis has been examined by some investigators. After exposure of rats pretreated with a single intragastric administration of 200 mg/kg body weight MNNG to 0.006, 0.03, 0.1, 0.3, 0.6, and 1.2% BHA for 20 weeks, a clear enhancement of squamous-cell carcinoma development in the forestomach was apparent at 1.2%; a slight enhancement occurred at 0.6%, but no enhancement was associated with the lower doses (Williams, 1986). In rats treated with 0.05% N-butyl-N-(4-hydroxybutyl)nitrosamine(BBN) for 2 weeks followed by 2.0, 1.0, and 0.5% BHA, or 1.0, 0.5, and 0.25% BHT in the diet for 22 weeks, promoting effects on urinary bladder carcinogenesis were found only in the highest-dose BHA and BHT groups (Fukushima et a l . , 1987a). A %week exposure to high levels (0.75%) of dietary BHT was sufficient to enhance significantly lung tumor development in A/ J mice pretreated with urethane, the lowest effective BHT concentration being 0.1% fed for 8 weeks (Witschi and Morse, 1983). Treatment with BHT at a concentration of 6000 ppm in rats subsequent to 2-AAF administration significantly enhanced the number of area of neoplastic lesions in the liver, while the same treatment with BHT at concentrations of 300, 1000, and 3000 ppm did not increase the develop-
MODIFYINGEFFECTOF ANTIOXIDANTS ON
TABLE VI SECONDSTAGEOF CARCINOCENESIS IN ANIMALS"
THE
Antioxidant Organ
Initiator
Species
Oral cavity Esophagus Forestomach
DMBA DBN MNNG
Hamster Rat Rat
Glandular stomach
DBN MNU DOPN MNNG
Rat Rat Hamster Rat
MNU MNU DMH MNNG DMH AOM DMH MNU DMH MNU DMH DOPN DEN
Rat Rat Rat Rat Rat Rat Rat Rat Mouse Mouse Hamster Hamster Rat
DEN + 2-AFF
Rat
Small intestine
Colon
Pancreas Liver
BHA
BHT
EQ
SA(AA)
SE
PG
a-TP
References
5.
Shklar et al. (1987) Fukushima et al. (1987h) Shirai et al. (1984, 1985h); Takahashi et al. (1986); Williams (1986) Fukushima et al. (1987b) Imaida et al. (1984);Tsuda et al. (1984~) Moore et al. (1987h) Shirai et al. (1984, 1985b); Takahashi et al. (1986); Williams (1986) Lindenschmidt et al. (1987) Tsuda et al. (1984~) Lindenschmidt et al. (1987) Takahashi et al. (1986) Shirai et al. (1985a) Weishurger et al. (1977) Lindenschmidt et al. (1987) Lindenschmidt et al. (1987) Lindenschmidt et al. (1986) Lindenschmidt et al. (1986) Moore et al. (1987a) Moore et al. (1987b) Imaida et al. (1983); Thamavit et al. (1985);Tsuda et al. (1984a) Masui et al. (1986~);Preat et al. (1986)
++
.1
c,
c)
c, c,
c,
c, c,
.1 c,
-
3
.
-
(continued)
TABLE VI (Continued) Antioxidant Organ
Initiator
Species
2-AFF EHEN DBN DHPN AFB, DOPN DEN DMH DBN EHEN DHPN DES, f3-E BBN
Rat Rat Rat Hamster Rat Hamster Hamster Hamster Hamster Rat Hamster Hamster Rat
DBN MNU DBN
Rat Rat Hamster
BHA
BHT
EQ
SA(AA)
SE
PG
a-TP
References
r.3 _-
t m a
Kidney
Urinary bladder
1 c,
t c,
1 c,
c,
c,
1 . 1 c,
c,
1
.1 1 c,
.1
t
c, c,
c,
t
t
t
1 t
t
t
4-3
c,
t
c,
t
t
t
t , c ,
c,
Maeura and Williams (1984) Tsuda d al. (1984b) Fukushima d al. (198%) Moore et al. (1986) Iverson et al. (1987) Moore et 01. (198%) Moore et 01. (1987a) Moore et al. (1987a) Moore et al. (1987a) Tsuda et al. (1984b) Moore et al. (1986) Liehr and Wheeler (1983) Fukushima et al. (1983, 1984, 1987a); Tamano et al. (1987); Imaida et al. (1983) Fukushima et al. (198%) Imaida et al. (1984);Tsuda et al. (1984~) Moore et al. (1987a)
Trachea Lung
Mammary gland Ear duct Thyroid
w
Skin Hematopoietic Prostate
DEN, DBN MNU DHPN, DBN Urethane, 3-MC, DMN DMBA
Rat
DMBA AOM MNU DHPN DMBA MNU DMAB
Rat Rat Rat Hamster Mouse Rat Rat
Hamster
t ,
Rat Hamster
c,
Moore et d. (1987a)
c,
c,
Imaida et QZ. (1984) Moore et QZ. (1986, 1987a)
c,
c,
t
Mouse
1
1
Witschi et d. (1977); Witschi and Morse (1983); Malkinson and Beer (1984)
1
-
4
c,
cf
4
McCormick et QZ. (1984); Hirose et QZ. (I=, 1988b) Hirose et d. (1986c, 198813) Weisburger et QZ. (1977) Imaida et al. (1984);Tsuda et d. (1%) Moore et oZ. (1986) Boutwell and Bosch (1959); Berry et QZ. (1978) Imaida et QZ. (1984); Tsuda et QZ. (1984~) Nakamura et d. (1988)
a AA, ascorbic acid; 2-AAF, N-2-fluorenylacetamide; AFB,, aflatoxin B,; AOM, azoxymethane; BBN, N-butyl-N-(4hydroxybutyl)nitrosamine;P-E, p-estraDMAB, 3,2'-dimethyl4diol; DBN, Ndibutylnitrosamine; DEN, N-diethylnitrosamine; DES, diethylstilbestrol; DHPN, dihydroxy-di-N-propylnitrosamine; aminobiphenyl; DMBA, 7,12-dimethylbenz(a)anthracene;DMH, 1,2-dimethylhydrazine; DMN, dimethynitrosamine; DOPN, 2,2'-dioxo-N-nitrosdpropylamine; EHEN, N-ethyl-N-hydroxyethylnitrosamine;EQ, ethoxyquin; 3-MC, 3-methylcholanthrene; MNNG, N-methyl-N'-nitro-N-nitrosoguanidine; MNU, N-methylnitrosourea; PG, propyl gallate; SA, sodium ascorbate; SE, sodium erythorbate; a-TP, a-tocopherol. Symbols: t , promoting effect; 1, inhibitory effect; c,,no effect.
284
NOBUYUKI I T 0 A N D MASAO HIROSE
ment of lesions (Maeura and Williams, 1984). Therefore, high concentrations of antioxidants appear to be required for modulation of carcinogenesis in the promotion stage, although chlorogenic acid has been reported to inhibit MAM-initiated carcinogenesis in hamsters when given at a level of 0.025% in the diet (Mori et al., 1986). The modifying effects of antioxidants are dependent on several factors such as species, strain, and age of animals, type and dose of initiators, and dose of antioxidants, and can be modulated by additional physical disorders such as inflammation, ulcer, cirrhosis, nephritis, and pulmonary fibrosis. The mechanisms by which antioxidants modify second-stage carcinogenesis are not known. As a rule, chemicals that exert promotive influence induce DNA synthesis or cell proliferation in their target tissues, and this is particularly true for chemicals that are not genotoxic in nature. For example, treatment with SA, sodium saccharin, BHA, or BHT, which are known promoters of rat bladder carcinogenesis, was associated with increased labeling indices and/or induced hyperplasia in the bladder epithelium in all cases, while AA, which did not exert any promotion, did not show any such effects. Similarly single oral administration of four rat hepatic tumor promotersclofibrate, DDT, PB, and thioacetamide-gave rise to a stimulation of DNA synthesis in the liver (Busser and Lutz, 1987). Continuous oral treatment with the phenolic antioxidants catechol, p-tert-butylphenol, or 2-tertbutyl-4-methylphenol alone induced hyperplasia in rat forestomach epithelium, and when they were administered subsequent to MNNG exposure, the incidence of forestomach squamous-cell carcinomas markedly increased (Table V). However, there are some exceptions suggesting that induction of cell proliferation is not necessarily indicative of promoting activity for chemical carcinogenesis. For example, continuous oral treatment with 1.5% 4methoxyphenol for 51 weeks induced hyperplasia and even a papilloma in rat forestomach, but when this chemical was given to rats after treatment with MNNG, the incidence of forestomach squamous-cell carcinomas was significantly reduced (Hirose et al., 1988a). Butylated hydroxytoluene stimulated proliferation of type 2 alveolar cells in strain A mice as a compensatory hyperplastic response to type 1 alveolar cell damage (Adamson et al., 1977), and also enhanced urethane-initiated lung tumor formation (Malkinson and Beer, 1984). However, 2-tert-butyl-4methylphenol, which is structurally similar to BHT and BHA and causes more pronounced lung damage, was not associated with increased tumor multiplicity when administered after treatment with urethane to BALB/cBy mice (Malkinson and Beer, 1984). Furthermore, treatment with the cytochrome P-450 inhibitor SKF 525A and piperonyl butoxide was reported to prevent BHT-induced lung toxicity in mice, but did not affect the ability of BHT to enhance lung tumorigenesis (Witschi and Kehrer, 1982; Witschi, 1986). These results thus suggest that the mechanism@)or metabolites re-
285
ANTIOXIDANTS A N D CARCINOGENESIS
sponsible for inducing cell proliferation may be separated independently from those involved in tumor promotion. Induction of ornithine decarboxylase (ODC) activity, production of active forms of oxygen, interaction with calcium- and phospholipid-dependent protein kinase C, increased prostaglandin synthesis, or inhibition of intercellular communication are all factors that may influence cell proliferation and/or promotion (Blumberg et al., 1984; Boutwell, 1984). Further detailed investigations are clearly necessary to clarify the exact mechanism(s) involved in each case. C. ANTIPROMOTINGACTIVITYOF ANTIOXIDANTS Antipromotion effects of antioxidants have been primarily demonstrated in the two-stage mouse skin carcinogenesis model. In this system mice are given a single topical application of DMBA as an initiator, then receive continuous topical treatment with TPA or teleocidin together with synthetic antioxidants such as BHA, BHT, a-TP, or other naturally occurring antioxidant species. As shown in Table VII, some antioxidants exert antipromoting activity. The observed inhibition of TPA-induced skin promotion may be partly due to a scavenging action of these antioxidants against TPA-induced superoxide anion radical. Schwarz et al. (1984)found that TPA induced '0; release in human peripheral leukocytes but not in epidermal-cell primary cultures derived from neonatal mouse epidermis or in the mouse epidermal cell line H E L 30 as measured by cytochrome c reduction. This '0,release TABLE VII ANTIPROMOTING ACTIVITY OF ANTIOXIDANTS" Antioxidants
Initiator
Quercetin (-)-Epigallocatechin gallate CuDIPS NDGA Morin, esculetin, a-TP (+)-&techin GSH, Cysteine, a-TP, N+SeO, BHA, BHT, disulfiram, 4-parahydroxyanisole p-Carotene BHA, BHT
DMBA DMBA
Promoter
Effect
References
Teleocidin Teleocidin
1 1
Nishino et al. (1984) Yoshizawa et al. (1987)
DMBA DMBA DMBA DMBA DMBA
TPA TPA TPA TPA TPA, Mezerein
1 1 .1
DMBA
TPA
Kensler et al. (1983) Nakadate et al. (1982a) Nakadate et al. (1984) Nakadate et al. (1984) Perchellet et a1. (1985, 1987) Slaga and Butler (1984)
DMBA DMBA
Croton oil Benzoyl peroxide
c)
.1 .1
Mathews-Roth (1982) Slaga and Butler (1984)
CuDIPS, Copper(II)-3,5-diisopropylsalicylate),;DMBA, 7,12-dimethyIbenz(a)anthracet GSH, reduced glutathione; NDGA, nordihydroguaiaretic acid; a-TP,a-tocopherol; TPA, 12-g: tetradecanoylphorhol-13-acetate.
286
N O B U Y U K I I T 0 A N D MASAO HIROSE
was strongly inhibited by copper(II)-(3,5-diisopropylsalicylate), (CuDIPS), and to a lesser extent by NDGA and quercetin, all of which are known as superoxide anion radical scavengers and detoxifiers. In an in uiuo experiment, CuDIPS (Egner and Kensler, 1985) and NDGA (Nakadate et al., 1982a) significantly inhibited TPA-induced skin tumor promotion in mice initiated with DMBA. In addition, TPA has been reported to stimulate chemiluminescence (CL) in SENCAR mouse epidermal cells in uitro. And this CL response can be inhibited by SOD and CuDIPS, but not by catalase and mannitol, the latter pair being a decomposer of H20, and a scavenger for hydroxy radicals, respectively. The CL response was also inhibited by the lipoxygenase inhibitor NDGA and benoxyprofen (Fischer and Adams, 1985). Treatment of mouse skin with TPA resulted in a sustained decrease in the basal levels of both SOD and catalase activity in the epidermis in uivo (Solanski et al., 1981). Induction of ODC in mouse epidermis also appears to be an important factor for TPA-induced skin tumor promotion (Marks et al., 1979; Takigawa et al., 1982). This TPA-induced ODC increase could be inhibited by indomethacin, a selective cyclooxygenase inhibitor, and by NDGA, a lipoxygenase inhibitor (Nakadate et al., 198213); significant reduction of TPAinduced ODC induction was also observed in mice treated with morin, fisetin, kaempferol, PG, esculetin, and BHA, all of which potently inhibit epidermal lipoxygenase activity. In addition, morin and esculetin treatment was associated with significant inhibition of skin tumor promotion. Thus, the inhibitory effects of flavonoids on TPA-induced ODC induction and tumor promotion roughly paralleled their lipoxygenase inhibition (Nakadate et al. , 1984). BHA, BHT, a-TP, methyl-BHA, TBHQ, and 2-tert-butylphenol are other potent inhibitors of TPA-induced ODC activity (Kozumbo et al., 1983), and of these, BHA and BHT were similarly shown to inhibit tumor promotion by TPA (Slaga and Butler, 1984). Benzoyl peroxide, lauroyl peroxide, and rn-chlorobenzoic acid, all free radical-generating compounds, promoted skin tumor formation in mice (Slaga et al., 1981; O’Connell et al., 1986), and the tumor-promoting activity of methyl ethyl ketone peroxide was, moreover, potentiated by DEM, which is known to deplete intracellular glutathione and consequently to induce lipid peroxidation and generation of radicals (Logani et al., 1984). These results thus suggest that antioxidants act by scavenging the superoxide anion radicals that are responsible for tumor promotion in the epidermis induced by treatment with TPA. D. MODIFICATIONBY BLOCKING NITROSAMINEFORMATION From the epidemiological viewpoint, some studies suggested that intake of nitrite and nitrate correlates with high incidence of human gastric cancer
ANTIOXIDANTS AND CARCINOGENESIS
287
(Cuelfo et al., 1976; Haenszel and Correa, 1975) and that this was due to formation of carcinogenic N-nitroso compounds in the stomach by reaction of nitrite with amines present in foods and certain drugs (Weisburger and Raineri, 1975; Weisburger et al., 1980; Weisburger, 1985). Some antioxidants have been shown to prevent nitrosation in uitro, or tumor formation in animals by preventing this reaction between nitrite and amines to form Nnitroso compounds. Ascorbic acid and a-TP are well-known inhibitors of nitrosation. For example, they significantly inhibit in uitro nitrosation of morpholine, piperazine, diemthylamine, and N-methylurea (Mirvish et al., 1972; Cooney et al., 1986; Mirvish, 1986; Norkus et al., 1986). The reaction of AA with nitrite proceeds with the reduction of 2 mol of nitrite to nonnitrosating nitric oxide per mole of AA, which is oxidized to dehydroascorbic acid. However, the nonnitrosating nitric oxide can, in the presence of oxygen, give rise to higher oxides to nitrogen, which are themselves powerful nitrosating species (Scanlan, 1983; Kyrtopoulos, 1987). Therefore, under certain conditions AA can catalyze nitrosation. Nevertheless, AA and SA both inhibited tumor formation in experimental animals induced by the reaction of nitrite with amines. For example, SA at 11.5 or 23 g/kg in the diet gave 89-98% inhibition of lung adenoma induction in the applied NaNO, plus piperazine, morpholine, or methylurea system (Mirvish et al., 1975). The concurrent administration of sodium ascorbate with ethylurea and sodium nitrite to pregnant hamsters also prevented the development of neurogenic tumors in the progeny (Rustia, 1975), and treatment with 7 g/kg diet AA together with aminopyrine and sodium nitrite similarly protected male SD rats against liver and lung tumor production, although not kidney lesion development (Chan and Fong, 1977). Administration of morpholine in the diet and sodium nitrite in the drinking water for life to male rats together with 22.7 g SA/kg in the diet resulted in a lower liver tumor incidence with a longer latency than without the antioxidant supplement (Mirvish et al., 1983). Phenolic antioxidants and flavonoids are also capable of blocking nitrosamine formation as demonstrated by investigations of BHA, cafleic acid, and ferulic acid for ability to react with nitrite in uitro and to inhibit nitrosamine formation in uiuo. In simulated gastric fluid, cafTeic acid and ferulic acid reacted rapidly and completely with an equimolar quantity of sodium nitrite. In rats receiving aminopyrine and nitrite, cafleic acid and ferulic acid blocked the elevation of serum N-nitrosodimethylamine levels and the serum glutamic pyruvic transaminase levels associated with hepatotoxicity. BHA was less effective than cafleic and ferulic acid both in uitro and in uiuo (Kuenzig et al., 1984). Although chlorogenic acid inhibited nitrosation of proline by nitrite to give N-nitrosoproline, resorcinol, catechin, p-nitrosophenol, and phenol all catalyzed the reaction in uitro and in viuo (Pigna-
288
NOBUYUKI IT0 AND MASAO HIROSE
telli et al., 1982). Syringol (2,6-dimethoxyphenol) was as effective as AA in inhibiting N-nitrosomorpholine formation in stomach and blood in the rat given morpholine and nitrite by gavage (Virk and Issenberg, 1986). In one carcinogenesis study, gallic acid strongly inhibited adenoma induction in mouse lung by morpholine plus NaNO, (Mirvish et al., 1975). Among different mono-, di-, and trihydroxybenzene species, 1,3,5-trihydroxybenzene was found to be most effective in nitrite depletion followed by 1,2,3-trihydroxybenzene, 1,2-dihydroxybenzene (catechol), and p-hydroxybenzene (hydroquinone) (Stich and Rosin, 1984). The mechanisms by which phenolic compounds inhibit nitrosation involve reduction of nitrite to nitric oxide (Challis and Bartlett, 1975), or formation of C-nitroso compounds (Challis, 1973) and mutagenic diazoquinone (Kikugawa and Kato, 1988). Therefore, the possibility remains that the C-nitroso compounds or diazoquinone formed could exert carcinogenic activity. Inhibition of nitrosation by AA is observed in human urine following sequential oral doses of nitrite and proline. However, the dose of antioxidant to return the N-nitrosoproline excretion to basal levels was far in excess of the proline administered (Wagner et al., 1985; Leaf et al., 1987). Humans take in -95 mg nitrate and 1.4 mg nitrite daily mainly from drinking water, vegetables, and cured meat (Knight et al., 1987), and nitrate can be easily converted to nitrite in uiuo by bacteria (Tannenbaum et al., 1974; Spiegelhalder et al., 1976). Therefore, consumption of high-antioxidant and low-nitrate diet, items such as fresh fruits, would be expected to exert a positive influence on prevention of N-nitroso compound-induced human carcinogenesis. However, SA itself is not to be recommended, since it has been shown to be a potent promoter of urinary bladder carcinogenesis in rats (Fukushima et al., 1983, 1984). VI. Evaluation of Antioxidants as Human Hazards or Chemopreventers of Human Carcinogenesis
As already mentioned, there are many synthetic and naturally occurring antioxidants in our environment. Humans may ingest considerable amounts of such compounds in foodstuffs, medicines such as vitamins C and E, and yoryzanol, or by absorption through the skin of antioxidant additives in cosmetics, antiseptics, disinfectants, and industrial chemicals. It is therefore possible that these antioxidants may indeed play a role in human carcinogenesis. Although there are some epidemiological and case control studies suggesting that high intake of antioxidants such as AA, a-TP, selenium, p-carotene, and vegetables that contain vitamins A, C, and E may lower the mortality rates for certain cancer types in humans (Shamberger et a l . , 1976; Pet0 et al., 1981; Graham, 1983; Willet et al., 1983; Wald et al., 1984;
ANTIOXIDANTS AND CARCINOGENESIS
289
Salonen et al., 1985; Hennekens et al., 1986; Menkes et al., 1986; Mirvish, 1986; Williams and Weisburger, 1986; Ohno et al., 1988), no such studies have been performed for phenolic antioxidants. For the human risk assessment of phenolic antioxidant exposure, and extrapolation from experimental data, it is of importance to take into account the target organ, dose level, and route of administration. BHA is carcinogenic to rat, hamster and possibly mouse forestomach epithelium, but this activity is strictly limited to the forestomach, and no carcinogenic potential for other squamous epithelia such as those lining the esophagus, oral cavity, or skin has been indicated (It0 et al., 1983, 1986a). Apparently BHA possesses neither clear initiating nor promoting action for the rat esophagus (N. Ito and M . Hirose, unpublished observations) or mouse skin (Boutwell and Bosch, 1959; Berry et al., 1978; Sato et al., 1988) and did not stimulate proliferative activity in the stomach of guinea pigs (ILSI, 1984), dogs (Wilder et al., 1960; Hodge et al., 1964; Ikeda et al., 1986; Tobe et al., 1986), or monkeys (Iverson et al., 1985b), none of which have a forestomach. Since humans do not have a forestomach either, it appears most unlikely that BHA is carcinogenic for the gastric epithelium of humans. Moreover, the threshold carcinogenic dose of BHA in rats is 2% in diet, a level that is exceedingly high as compared with the possible human exposure. The estimated daily dietary intake of BHA was reported to be -7 mg/person in a Canadian study (Kirkpatrick and Lauer, 1986), and therefore the carcinogenic dose in animals is nearly 10,000 times higher than the likely human exposure level. While catechol, which is present in certain foods (e.g., fruits, vegetables, coffee), in tobacco, in cosmetics such as hair dye, in film developers, and in wood smoke, induced adenocarcinomas in the rat glandular stomach, which is anatomically and biologically similar to human gastric epithelium (Hirose et al., 1987d, 1988a), the dose applied was 0.8% in diet. This is equivalent to a dose level of -20-30 g catechol per person per day, and since the amount of catechol and its conjugates excreted in urine in humans was reported to be 1.1-30 mg/day (von Euler and Lishajko, 1959; Carmella et al., 1982), the carcinogenic dose in rats is -1000-25,000 times higher than the estimated human exposure. However, the promotion potential of antioxidants may still be a more important factor in human environmental carcinogenesis, since experiments have shown that effective enhancement can be achieved by much lower levels than the carcinogenic dose in many cases. For example, catechol showed promotion activity in glandular stomach carcinogenesis at
290
NOBUYUKI IT0 A N D MASAO HIROSE
that is, mixtures of promoters at low concentrations that do not themselves exert promotion potential demonstrated strong activity (N. Ito and M . Hirose, unpublished observations). Similarly, the carcinogenic or hyperplasiagenic activity of BHA has been reported to be enhanced by concomitant treatment with SA (Hirose et al., 19870 or vitamin A (Hasegawa et nl., 1988), but inhibited by concomitant treatment with DEM, a glutathionedepleting agent (Hirose et al., 1987~).Therefore the effect may be considerably modified by changes in environmental or physiological conditions. Endogenous factors such as age, immunological condition, and other diseases of the target organ will also influence the effective dose for promotion of carcinogenesis. Available data thus indicate that low concentrations of carcinogens or promoters, even if they do not show activity per se, may indeed be important for human environmental carcinogenesis. Since the majority of antioxidants are ingested orally by humans, modification of carcinogenesis by intraperitoneal injection of BHT or the reported carcinogenic action of a-TP in the presence of fatty acids by subcutaneous administration might be criticized as inappropriate for the evaluation of human risk. However, this question depends on variation in metabolism and transport with different routes of application, a field that requires further study. Antioxidants that have demonstrated an inhibitory effect in experimental chemical carcinogenesis have been proposed as possible chemopreventers in humans. For example, SA (AA) and a-TP are used for medical care, and for the promotion of health including the hope for chemoprevention of cancer. Use of antioxidants has been suggested primarily on the basis of epidemiological findings, but naturally the in uiuo animal data that demonstrated that such compounds can inhibit initiation and/or promotion of chemical carcinogenesis (see Tables VI and VII) have played a role. However, the existence of adverse effects in experiments using a wide-organspectrum approach has indicated that care must be taken in application of antioxidants as chemopreventers. Necessary characteristics for an ideal chemopreventer include (1)lack of genotoxicity, (2) lack of carcinogenicity, (3) ability to inhibit initiation activity, (4)ability to inhibit promotion activity, (5)ability to block nitrosamine formation, (6) lack of any enhancing activity in carcinogenesis, (7) effective dose for prevention of carcinogenesis much lower than the toxic dose, and (8) commercial viability (inexpensive). For example, SA satisfies requirements 2, 3, 5, and 8, but not 1 and 6, whereas a-TP satisfies requirements 1 , 2 , 3 , 4 , 5 , and 8 but not 6. Therefore, neither SA nor a-TP is ideal as a chemopreventer. Selenium is a good possibility, although it must be borne in mind that it is toxic at low dose levels (>5 ppm). However, organic selenium has been reported to be as effective as the inorganic variety in inhibiting carcinogenesis at far lower
ANTIOXIDANTS AND CARCINOGENESIS
29 1
levels of toxicity (Reddy et al., 1985, 1988; Tanaka et al., 1985). One possible way to lower toxic effects without lowering the inhibitory potential is to mix antioxidants. For example, treatment with 1 ppm selenium alone did not inhibit mammary gland carcinogenesis of rats initiated with DMBA, but combined treatment with 1 ppm selenium and 500 pprn a-TP after exposure to DMBA was associated with a significant reduction of mammary gland tumor development (Ip, 1988). Ellagic acid and chlorogenic acid are of potential interest because they inhibit initiation and promotion of carcinogenesis, respectively, at low levels of administration in animals (Mori et al., 1986; Mukhtar et al., 1986), and chlorogenic acid also blocks nitrosamine formation (Pignatelli et al., 1982). The fact that antioxidants may show opposite effects in different organs particularly in the promotion stage, means, however, that a total-body approach using different carcinogenic initiators is necessary for reliable assessment of second-stage effects. The very high costs in terms of space and time needed for traditional long-term testing of individual chemicals underlies the increasing interest in application of in uiuo short-term tests to this problem (Aoki et al., 1987; Uwagawa et al., 1987; Asakawa et al., 1988; Fukushima et al., 1988; Ito et al., 1988). Such experimental systems may contribute greatly to the prevention of cancer in human beings. VII. Summary
Synthetic and naturally occurring antioxidants have a wide variety of biological actions in rodents in addition to their primary antioxidant activity. Some of the included biological effects are of direct interest in relation to studies of carcinogenicity and/or modulation of carcinogenesis. Since the synthetic antioxidant BHA was first found to exert carcinogenic potential in rat and hamster forestomach epithelium, many other synthetic and naturally occurring antioxidants have been examined for their ability to induce proliferative activity in the alimentary canal. These studies have revealed that caf€eic acid and sesamol are also tumorigenic for rat forestomach epithelium, whereas catechol and p-methylcatechol induce neoplasia in rat glandular stomach epithelium. Although the proliferative response is very rapid, with inflammation and ulceration, it takes a very long time before carcinomas develop. The proliferative lesions in the forestomach induced by BHA or c d e i c acid are largely reversible, in contrast to those induced by genotoxic carcinogens, which generally persist and develop into cancer. Therefore, chronic irritation is considered to be responsible for the induction of stomach cancer by antioxidants. Butylated hydroxyanisole can undergo oxidative metabolism in uitro, and some of the metabolites formed have the potential for binding to proteins. Neither BHA nor its metabolites
292
NOBUYUKI IT0 A N D MASAO HIHOSE
binds to DNA in uiuo, but protein binding in the forestomach was >10 times higher than that in the glandular stomach. It is thus conceivable that BHA is oxidatively metabolized in the forestomach epithelium (possibly entering into redox cycling), and reactive metabolites including semiquinone radicals or active oxygen species are responsible for the carcinogenesis by a mechanism involving binding to macromolecules. Many antioxidants have been shown to modify carcinogenesis, and as a rule, they inhibit the initiation stage by reducing the interaction between carcinogen and DNA. However, both promotion and inhibition have been reported for second-stage carcinogenesis, depending on the organ site, species of animal, or initiating carcinogen. They can also block reaction of amine and nitrite to form nitrosamines or reduce TPA promotion of skin carcinogenesis. Generally high doses of antioxidants are required for carcinoma induction or modification of chemical carcinogenesis. The significance of the reported tumorigenicity and strong promoting activity of antioxidants for forestomach epithelium of animals to the development of human cancer appears limited mainly because humans do not have a forestomach. The carcinogenic and strong promoting activities of catechol and its structurally related compounds on rat glandular stomach epithelium are of greater concern because this tissue is directly analogous to human gastric epithelium. Although the effective carcinogenic dose of catechol was found to be 0.8% in the diet, promoting potential was also exerted by lower doses (<0.4%). Whether this level is in fact directly comparable to the human situation requires more detailed data. However, the possibility of summation effects in the promotion stage and interaction with other predisposing factors, such as poor immunological condition and presence of disease in target organs, may indeed imply a role for antioxidants in cancer development in humans. Regarding the possibility of antioxidant application as chemopreventive agents, several problems should be taken into account. Reasonable chemopreventers should inhibit both initiating and promoting activity and nitrosamine formation, and should not be toxic. Ideal compounds have not yet been discovered, although potent chemopreventers might be included in the large range of naturally occurring antioxidants. Short-term in uiuo detection systems should be of assistance for assessment of the potential advantages and disadvantages of the various antioxidant species for humans. ACKNOWLEDGMENTS This work was supported in part by Grants-in-Aid for Cancer Research from the Ministry of Education, Science and Culture, a grant from the Ministry of Health and Welfare of Japan, a Grant-in-Aid from the Ministry of Health and Welfare for the Comprehensive 10-Year Strategy
ANTIOXIDANTS A N D CARCINOGENESIS
293
for Cancer Control, a grant from the Society for Promotion of Pathology of Nagoya, and a grant from the Experimental Pathological Association, Japan.
REFERENCES Abdel-Galil, A. M. (1986). Oncology 43, 335-337. Abdo, K. M., Huff, J. E., Haseman, J. K., Dieter, M. P., Boorman, G. A., Hildebrandt, P., Prejean, J. D., and Farnell, D. R. (1983).J . Am. Coll. Toxicol. 2, 425-433. Abe, I., Saito, S., Hori, K., Suzuki, M., and Sato, H. (1984). Exp. MoZ. Pathol. 41, 35-43. Adamson, I. Y. R., Bowden, D. H., Cote, M. G., and Witschi, H. P. (1977). Lab. Inwest. 36, 26-32. Altmann, H.-J., Grunow, N., Mohr, U., R.-Reichhelm, H. B., and Wester, P. W. (1986). Food Chem. Toxicol. 24, 1183-1188. Altmann, H.-J., Wester, P. W., Matthiaschk, G., Grunow, W., and Van Der Heijden, C. A. (1985). Food Chem. Toxicol. 23, 723-731. Ames, B. N. (1983). Science 221, 1256-1264. Anderson, M. W., Boroujerdi, M., and Wilson, A. G. (1981). Cancer Res. 41, 4309-4315. Ansari, G. A. S., and Hendrix, P. Y. (1985). Drug Metab. Dispos. 13, 535-541. Aoki, T., Asamoto, M., Ogiso, T., Tatematsu, M., and Ito, N. (1987). Proc. Jpn. Cancer Assoc. 46, 18. Armstrong, K. E. , and Wattenberg, L. W. (1985). Cancer Res. 45, 1507-1510. Asakawa, E., Tamano, S., Nakamura, A,, Maeda, M., and Fukushima, S. (1988). Proc. Jpn. Cancer Assoc. 47, 140. Astill, B. D., Fassett, D. W., and Roudabush, R. L. (1960). Biochern. J . 75, 543-551. Astill, B. D., Mills, J., Fassett, D. W., Roudabush, R. L., and Terhaar, C. J. (1962). Agric. Food Chem. 10, 315-319. Atchison, M., Chu, C.-S., Kakunaga, T., and Van Durren, B. L. (1982).J . Natl. Cancer Inst. 69, 503-508. Balansky, R. M., Blagoeva, P. M., Mircheva, 2. I., Stoitchev, I., and Chernozemski, I. (1986). J . Cancer Res. Clin. Oncol. 112, 272-275. Benson, A. M . , Batzinger, R. P., Ou, S.-Y. L., Bueding, E., Cha, Y.-N., andTalalay, P. (1978). Cancer Res. 38, 4486-4495. Benson, A. M . , Cha, Y.-N., Bueding, E., Heine, H. S., andTalalay, P. (1979).CancerRes. 39, 2971-2977. Berry, D. L., DiGiovanni, J., Juchau, M. R . , Bracken, W. M., Gleason, G. L., and Slaga, T. J. (1978). Res. Commun. Chem. Pathol. P h a m c o l . 20, 101-108. Birt, D. F., Julius, A. D., Runice, C. E., and Salmasi, S. (1986).J . Natl. Cancer Inst. 77, 12811286. Blumberg, P. M., Jaken, S., Koning, B., Sharkey, N. A., Leach, K. L., Jeng, A. Y., and Yeh, E. (1984). Biochem. P h a m c o l . 33, 933-940. Boutwell, R. K. (1984). In “Models, Mechanisms and Etiology of Tumor Promotion” (M. Borzsonyi, N. E. Day, K. Lapis, and H. Yamasaki, eds.), No. 56, pp. 3-11. IARC Sci. Publ. Lyon. Boutwell, R. K., and Bosch, D. (1959). Cancer Res. 19, 413-427. Busser, M.-T., and Lutz, W. K. (1987). Carcinogenesis 8, 1433-1437. Carmella, S. G., LaVoie, E. J., and Hecht, S. S. (1982). Food Chem. Toxicol. 20, 587-590. Castelli, M. G., Benfenati, E., Pastorelli, R . , Salmona, M., and Fanelli, R. (1984).FoodChern. Toxicol. 22, 901-904. Cha, Y.-N., and Bueding, E. (1979). Biochern. Pharmucol. 28, 1917-1921. Cha, Y.-N., and Martz, F., and Bueding, E. (1978). Cancer Res. 38, 4496-4498.
294
NOBUYUKI I T 0 A N D MASAO HIROSE
Challis, B. C. (1973). Nature (London) 244, 466. Challis, B. C., and Bartlett, C. D. (1975). Nature (London) 254, 532-533. Chan, R. I. M., San, R. H. C., and Stich, H. F. (1986). Cancer Lett. 31, 27-34. Chan, W. C., and Fong, Y. Y. (1977). lnt. J. Cancer 20, 268-270. Chang, R. L., Huang, M.-T., Wood, A. W., Wong, C.-Q., Newmark, H. L., Yagi, H., Sayer, J . M., Jerina, D. M., and Conney, A. H. (1985). Carcinogenesis 6, 1127-1133. Chung, F.-L., Wang, M., Carmella, S. G., and Hecht, S. S. (1986). Cancer Res. 46, 165-168. Clapp, N. K., Tyndall, R. L., Satterfield, L. C., Klima, W. C., and Bowles, N . D. (1978).J. Natl. Cancer lnst. 61, 177-182. Clapp, N. K., Boweles, N. D., Satterfield, L. C., and Klima, W. C. (1979). J. Natl. Cancer Inst. 63, 1081-1087. Clayson, D. B., Iverson, F., Nera, E., Lok, E., Rogers, C., Rodrigues, C., Page, E., and Karpinski, K. (1986). Food Chem. Toricol. 34, 1171-1182. Cohen, L. A., Choi, K., Numoto, S . , Reddy, M., Berke, B., and Weisburger, J. H. (1986).J . Natl. Cancer Inst. 76, 721-730. Colacchio, T. A., and Memoli, V. A. (1986). Arch. Surg. 121, 1421-1424. Constantinides, P., and Harkey, M. (1985). Virchow Arch. 405, 285-297. Cooney, R. V., Ross, P. D., and Bartolini, G . L. (1986). Cancer Lett. 32, 83-90. Cuello, C., Correa, P., Haenszel, W., Gordillo, G., Brown, C., Archer, M., andTannenbaurn, S. (1976).J . Natl. Cancer Inst. 57, 1015-1020. Curnmings, S. W., and Prough, R. A. (1983).J. Biol. C h m . 258, 12315-12319. Cummings, S. W., Ansari, G. A. S., Guengerich, F. P., Crouch, L. S., and Prough, R . A. (1985). Cancer Res. 45, 5617-5624. Dacre, J. C. (1974). Food Cosmet. Toricol. 12, 125-129. Dacre, J. C., and Denz, F. A. (1956). Biochem. J. 64, 777-782. Daniel, J. W., Gage, J. C., Jones, D. I., and Stevens, M. A. (1967). Food Cosmet. Toxicol. 5, 475-479. Daoud, A. H., and Griffin, A. C. (1980). Cancer Lett. 9, 299-304. Das, M., Bickers, D. R., and Mukhtar, H. (1985). Carcinogenesis 6, 1409-1413. Das, M., Khan, W. A., Asokan, P., Bickers, D. R., and Mukhtar, H. (1987). Cancer Res. 47, 767-773. Daugherty, J. P. (1984). Food Chem. Toricol. 22, 951-961. Davidson, J. R. (1934). Can. Med. Assoc. J. 31, 486. De Long, M. J., Prochaska, H. J., and Talalay, P. (1985). Cancer Res. 45, 546-551. De Long, M. J., Prochaska, H. J., and Talalay, P. (1986). Proc. Natl. Acad. Sci. USA 83, 787791. Del Tito, B. J., Jr., Mukhtar, H., and Bickers, D. R. (1983).Biochem. Biophys. Res. Commun. 114, 388-394. destafney, C . M., Prabhu, U. D. G . , Sparnins, V. L., and Wattenberg, L. W. (1986). Food Chem. Toxicol. 24, 1149-1157. Egner, P. A,, and Kensler, T. (1985). Carcinogenesis 6, 1167-1172. El-Bayoumy, K. (1985). Cancer Res. 45, 3631-3635. El-Rashidy, R . , and Niazi, S. (1979).J . Pharm. Sci. 68, 103-104. El-Rashidy, R., and Niazi, S. (1983). Biophann. Drug Dispos. 4, 389-396. Ertiirk, E., Hatcher, J. F., Nunoya, T., Pamukcu, A. M., and Bryan, G. T. (1984). Proc. Am. Assoc. Cancer Res. 25, 95. Fischer, S . , and Adams, L. M. (1985). Cancer Res. 45, 3130-3136. , Fukushirna, S . , Imaida, K., Sakata, T., Okamura, T., Shibata, M., and Ito, N . (1983). Cancer Res. 43, 4454-4457. Fukushima, S., Kurata, Y., Shibata, M., Ikawa, E., and Ito, N . (1984).Cancer Lett. 23, 29-37.
ANTIOXIDANTS A N D CARCINOGENESIS
295
Fukushima, S., Ogiso, T., Kurata, Y., Hirose, M., and Ito, N. (1987a). Cancer Lett. 34, 83-90. Fukushima, S . , Sakata, T., Tagawa, Y., Shibata, M., Hirose, M., and Ito, N. (1987b). Cancer Res. 47, 2113-2116. Fukushima, S., Hagiwara, A., Imaida, K., Shirai, T., Suzuki, M., and Ito, N. (1988). Proc. Jpn. Cancer Assoc. 47, 90. Gelboin, H. V. (1980). Physiol. Reo. 60, 1107-1166. Golder, W. S . , Ryan, A. J., and Wright, S. E. (1962). J . Pharm. Pharmucol. 14, 268-271. Graham, S. (1983). Epidemiol. Reo. 5, 38-50. Griffin, A. C. (1979). Ado. Cancer Res. 29, 419-442. Guarna, A . , Della Corte, L., Giovannini, M. G., De Sarlo, F., and Sgaragli, G. (1983). Drug Metab. Dispos. 11, 581-584. Haber, S. L., and Wissler, R. W. (1962). Proc. SOC. Exp. Biol. Med. 111, 774-775. Haenszel, W., and Correa, P. (1975). Cancer Res. 35, 3452-3459. Haga, M. (1987). In “Bioactive Molecules” (I. Hirono, ed.), Vol. 2, pp. 207-215. Kodansha, Tokyo and Elsevier, Amsterdam. Harr, J. R., Exon, J. H., Weswing, P. H., and Whanger, P. D. (1973). Clin. Toxicol. 6, 287293. Hasegawa, R., Takahashi, M., Furukawa, F., Toyoda, K., Sato, H., and Hayashi, Y. (1988). Gann 79, 320-328. Haseman, J. K.,Crawford, D. D., Huff, J. E . , Boorman, G. A , , and McConnell, E. E. (1984). J . Toxicol. Enoiron. Health 14, 621-639. Haworth, S . , Lawlor, T., Mortelmans, K., Speck, W., and Zeiger, E. (1983). Enoiron. Mutagen. 1, Suppl, 3-142. Hennekens, C . H., Mayrent, S. L., and Willett, W. (1986). Cancer (Philadelphia)58, 18371841. Hirono, I., Ueno, I., Hosaka, S . , Takahashi, H., Matsushima, H., Sugimura, T., and Natori, S. (1981). Cancer Lett. 13, 15-21. Hirose, M., Shibata, M., Hagiwara, A., Imaida, K., and Ito, N. (1981).Food Chem. Toxicol. 19, 147-151. Hirose, M., Fukushima, S., Sakata, T., Inui, M., and Ito, N. (1983). Cancer Lett. 21, 23-27. Hirose, M., Hagiwara, A., Masui, T.. Inoue, K., and Ito, N. (1986a). Cancer Lett. 30,169-174. Hirose, hl., Inoue, T., Asamoto, M., Tagawa, Y., and Ito, N. (1986b). Carcinogenesis 7, 12851289. Hirose, M., Masuda, A., Inoue, T., Fukushima, S., and Ito, N. (1986~).Carcinogenesis 7, 1155- 1159. Hirose, M., Masuda, A , , Kurata, Y., Ikawa, E., Mera, Y., and Ito, N. (1986d).J . Natl. Cancer Inst. 76, 143-149. Hirose, M., Asamoto, M., Hagiwara, A , , Ito, N., Kaneko, H., Sato, K., Takamatsu, Y., Yoshitake, A , , and Miyamoto, J. (1987a). Toxicology 45, 13-24. Hirose, M., Hagiwara, A., Inoue, K., Sakata, T., Ito, N., Kaneko, H., Yoshitake, A., and Miyamoto, J. (1987b). Toxicology 43, 139-147. Hirose, M., Inoue, T., Masuda, A , , Tsuda, H., and Ito, N. (1987~).Carcinogenesis 8, 15551558. Hirose, M., Kurata, Y . , Tsuda, H., Fukushima, S., and Ito, N. (1987d). Gann 78, 1144-1149. Hirose, M., Masuda, A., Imaida, K., Kagawa, M., Tsuda, H., and Ito, N. (1987e). Gann 78, 317-321. Hirose, M., Masuda, A , , Tsuda, H., Uwagawa, S . , and Ito, N . (19870. Carcinogenesis 8, 17311735. Hirose, M., Fukushima, S . , Kurata, Y., Tsuda, H., Tatematsu, M., and Ito, N. (1988a). Cancer Res. 48, 5310-5315.
296
NOBUYUKI I T 0 A N D MASAO HIHOSE
Hirose, M . , Hagiwara, A., Inoue, K., Ito, N., Kaneko, H., Saito, K., Matsunaga, H., Isobe, N., Yoshitake, A., and Miyamoto, J. (1988b). Toxicology 53, 33-43. Hirose, M., Masuda, A., Fukushima, S., and Ito, N. (1988~).Carcinogenesis 9, 101-104. Hirose, M., Yamaguchi, S., Fukushima, S., Hasegawa, R., Takahashi, S., and Ito, N. (1989). Cancer Res., in press. Hodge, H. C., Fassett, D. W., Maynard, E. A,, Downs, W. L., and Coye, R. D., Jr. (1964). Toxicol. A p p l . P h a m c o l . 6, 512-519. Hosaka, S., and Hirono, I. (1981). Gann 72, 327-328. IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Man (1977).Vol. 15, pp. 155-175. IARC, Lyon. IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Humans (1984). Vol. 34, pp. 75-97. IARC, Lyon. IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Humans (1986). Vol. 40, pp. 123-159. IARC, Lyon. Ikeda, G. J., Stewart, J. E., Sapienza, P. P., Peggins, J. O., 111, Michel, T. C., Olivito, V., Alam, H. Z., and O’Donnell, M. W., Jr. (1986). Food Chern. Toxicol. 24, 1201-1221. ILSI (1984). “Butylated Hydroxyanisole,” Monogr. Antioxident Tech. Comm., Int. Life Sci. Inst., Washington, D.C. Imaida, K., Fukushima, S . , Shirai, T., Ohtani, M., Nakanishi, K., and Ito, N . (1983). Carcinogenesis 4, 895-899. Imaida, K., Fukushima, S., Shirai, T., Masui, T., Ogiso, T., and Ito, N. (1984). Gann 75, 769775. Imaida, K., Fukushima, S . , Inoue, K., Masui, T., Hirose, M., and Ito, N. (1988). Cancer Lett. 43, 167-172. Inai, K., Kobuke, T., Nambu, S., Takemoto, T., Kou, E., Nishina, H., Fujihara, M., Yonehara, S., Suehiro, S., Tsuya, T., Horiuchi, K., and Tokuoka, S. (1988). Cann 79, 49-58. Ip, C. (1981). Cancer Res. 41, 2683-2686. Ip. C. (1988). Cancer Lett. 39, 239-246. Ip, C., and Sinha, D. (1981). Carcinogenesis 2, 435-438. Ito, N., and Hirose, M. (1987). Gann 78, 1011-1026. Ito, N., Fukushima, S., Hagiwara, A., Shibata, M., and Ogiso, T. (1983).J. Natl. Cancer Inst. 70, 343-352. Ito, N., Fukushima, S., Tsuda, H., Shirai, T., Tatematsu, M., and Imaida, K. (1984). In “Cellular Interactions by Environmental Tumor Promoters” (H. Fujiki et a l . , eds.), pp. 381-389. Jpn. Sci. Soc. Press, Tokyo/VNU Sci. Press, Utrecht. Ito, N., Fukushima, S., and Tsuda, H. (1985). CRC Crit. Rev. Toxicol. 15(2), 109-150. Ito, N., Fukushima, S . , Tamano, S . , Hirose, M., and Hagiwara, A. (1986a).J . Natl. Cancer Inst. 77, 1261-1265. Ito, N . , Hirose, M., Fukushima, S., Tsuda, H., Shirai, T., and Tatematsu, M. (1986b). Food C h m . Toxicol. 24, 1071-1082. Ito, N., Hirose, M., Fukushima, S., Tsuda, H., Tatematsu, M., and Asamoto, M. (1986~). Toxicol. Patbol. 14, 315-323. Ito, N . , Fukushima, S., and Hirose, M. (1987). I n “Toxicological Aspect of Food” (K. Miller, ed.), pp. 253-293. Elsevier, New York. Ito, N., Tsuda, H., Tatematsu, M., Tagawa, Y., Aoki, T., Uwagawd, S., Kagawa, M., Ogiso, T., Masui, T., Imaida, K . , Fukushima, S . , and Asamoto, M. (1988). Carcinogenesis 9, 387394. Ito, N . , Hagiwara, A . , Tamano, S,. Kagawa, M., Shibata, M., Kurata, Y., and Fukushima, S . (1989).J p n . I . Cancer Res., in press. Ito, N., Hirose, M., Hagiwara, A., and Takahashi, S. (1989a)I n “Antimutagenesis and Anticdr-
ANTIOXIDANTS AND CARCINOGENESIS
297
cinogenesis Mechanisms II”(Y. Kuroda, D. M. Shankel, and M. D. Waters, eds.) Plenum Press, New York, in press. Iverson, F., Lok, E., Nera, E., Karpinski, K., andclayson, D. B. (1985a).Toxicology35,l-ll. Iverson, F., Truelove, J., Nera, E., Wong, J., Lok, E., and Clayson, D. B. (1985b). Cancer Lett. 26, 43-50. Iverson, F., Campbell, J., Clayson, D. B., Hierlihy, S., Labossiere, E., and Hayward, S. (1987). Cancer Lett. 34, 139-144. Jacobs, M. M., Jansson, B., and Griffin, A. C. (1977). Cancer Lett. 2, 133-137. Jacobs, M. M., Frost, C. F., and Beams, F. A. (1981). Cancer Res. 41, 4458-4465. Kagawa, M., Fukushima, S., de Camargo, J. L., Ogawa, K., and Hirose, M. (1988). Proc. Jpn. Cancer Assoc. 47, 88. Kahl, R. (1984). Toxicology 33, 185-228. Kahl, R. (1986).J. Enoiron. Sci. Health C4, 47-92. Kappus, H., and Sies, H. (1981). ExperientM 37, 1233-1241. Kasai, H., and Nishimura, S. (1984). Gann 75, 565-566. Kasai, H., Nishimura, H., Kurokawa, Y., and Hayashi, Y. (1987).Carcinogenesis 8, 1959-1961. Kensler, T. W., and Trush, M. A. (1984). Enoiron. Mutagen. 6, 593-616. Kensler, T. W., Bush, D. M., and Kozumbo, W. J. (1983). Science 221, 75-77. Kikugawa, K., and Kato, T. (1988). Food Chem. Toxicol. 26, 209-214. Kirkpatrick, D. C., and Lauer, B. H. (1986). Food Chem. Toxicol. 24, 1035-1037. Knight, T. M . , Forman, D., Al-Dabhagh, S. A., and Doll, R. (1987). Food Chem. Toxicol. 25, 277-285. Kobayashi, M., Kogata, M., Yamamura, M., Takada, H., Hioki, K., and Yamamoto, M. (1986). Cancer Res. 46, 2266-2270. Kozumbo, W. J., Seed, J., and Kensler, T. W. (1983). Cancer Res. 43, 2555-2559. Kozumbo, W. J., Trush, M. A., and Kensler, T. W. (1985). Chem-Biol. Interact. 54, 199-207. Kuenzig, W., Chau, J., Norkus, E., Holowaschenko, H., Newmark, H ., Mergens, W., and Conney, A. H. (1984). Carcinogenesis 5, 309-313. Kurokawa, Y., Aoki, S., Matsushima, Y., Takamura, N . , Imazawa, T., and Hayashi, Y. (1986).J . Natl. Cancer lnst. 77, 977-982. Kyrtopoulos, S. A. (1987). Am. J. Clin. Nutr. 45, 1344-1350. Lam, L. K. T., Sparnins, V. L., Hochalter, J. B., and Wattenberg, L. W. (1981). Cancer Res. 41, 3940-3943. Leaf, C. D., Vecchio, A. J., Roe, D. A,, and Hotchkiss, J. H. (1987). Carcinogenesis 8, 791795. Lehman, A. G . , Fitzhugh, 0. G., Nelson, A. A., and Woodard, G. (1951). Ado. Food Res. 3, 197-208. Lesca, P. (1983). Carcinogenesis 4, 1651-1653. Liehr, J. G . , and Wheeler, W. J . (1983). Cancer Res. 43, 4638-4642. Lindenschmidt, R. C., Tryka, A. F., Goad, M. E., and Witschi, H. P. (1986). Toxicology 38, 151-160. Lindenschmidt, R. C., Tryka, A. F . , and Witschi, H. P. (1987).Fundam. Appl. Toxicol. 8,474481. Logani, M. K., Sambuco, C. P., Forbes, P. D., and Davies, R. E. (1984). Food Chem. Toxicol. 22, 879-882. McCormick, D. L., Major, N., and Moon, R. C. (1984). Cancer Res. 44, 2858-2863. McGregor, J. T. (1986).In “Plant Flavonoids in Biology and Medicine: Biochemical, Pharmacological, and Structure-Activity Relationship” (V. Cody, E. Middleton, Jr., and J. B. Harborns, eds.), pp. 411-424. Alan R. Liss, New York. Maeura, Y., and Williams, G. M. (1984). Food Chem. Toxicol. 22, 191-198.
298
NOBUYUKI IT0 A N D MASAO HIROSE
Malkinson, A. M., and Beer, D. S. (1984).J . Natl. Cancer Inst. 73, 925-933. Malkinson, A. M., and Thaete, L. (1986). Cancer Res. 46, 1694-1697. Manson, M . M., Green, J . A., and Driver, H. E. (1987). Carcinogenesis 8, 723-728. Marks, F., Bertsch, S.,and Fiirstenberger, G . (1979). Cancer Res. 39, 4183-4188. Marnett, L. J. (1987). Carcinogenesis 8, 1365-1373. Masuda, A , , Masui, T., Imaida, K., Maeda, M., and Hirose, M. (1987). Proc. Jpn. Cancer Assoc. 46, 26. Masuda, A., Hirose, M., Wada, S . , Mizoguchi, M., and Ito, N. (1988). Proc. Jpn. Cancer Assoc. 47, 120. Masui, T., Asamoto, M., Hirose, M., Fukushima, S., and Ito, N . (1986a). Gann 77, 854-857. Masui, T., Hirose, M.. Imaida, K., Fukushima, S . , Tamano, S . , and Ito, N. (1986b). Gann 77, 1083- 1090. Masui, T., Tsuda, H., Inoue, K., Ogiso, T., and Ito, N. (1986~).Gann 77, 231-237. Masui, T., Asamoto, M., Hirose, M., Fukushima, S., and Ito, N. (1987).Cancer Res. 47,51715174. Mathews-Roth, M. M. (1982). Oncology 39, 33-37. Medina, D., and Shepherd, F. (1981). Carcinogenesis 2, 451-455. Medina, D., Lane, H. W., and Tracey, C. M. (1983). Cancer Res. 43, Suppl., 2460s-2464s. Menkes, M . A,, Comstock, G. W., Vuilleumier, J. P., Helsing, K.-J., Rider, A. A,, and Brookmeyer, R. (1986). N. Engl. J . Med. 315, 1250-1254. Minegishi, K., Watanabe, M., and Yamaha, T. (1981). Chem. Pharm. Bull. 29, 1377-1381. Mirvish, S. S. (1986). Cancer (Philadelphia) 58, 1842-1850. Mirvish, S. S., Wallcave, L., Eagen, M., and Shubik, P. (1972). Science 177, 65-68. Mirvish, S. S., Cardesa, A., Wallcave, L., Shubik, P. (1975).J . Natl. Cancer Inst. 55,633-636. Mirvish, S. S . , Salmasi, S., Cohen, S. M., Patil, K., and Mahboubi, E. (1983).J. NatI. Cancer Imt. 71, 81-85. Mirvish, S. S., Salmasi, S., Lawson, T. A., Pour, P., and Sutherland, D. (1985).J . Natl. Cancer Inst. 74, 1283-1290. Moore, M. A., Thamavit, W., Tsuda, H., and Ito, N. (1986). Cancer Lett. 30, 153-160. Moore, M. A., Thamavit, W., and Ito, N. (1987a).J. Natl. Cancer Inst. 78, 295-301. Moore, M. A., Tsuda, H., Thamavit, W., Masui, T., and Ito, N. (1987b).J . Natl. Cancer Inst. 78, 289-293. Mori, H., Tanaka, T., Shima, H . , Kuniyasu, T., and Takahashi, M. (1986). Cancer Lett. 30,4954. Morimoto, K., and Wolff, S. (1980). Cancer Res. 40, 1189-1193. Morino, K., Matsukura, N., Kawachi, T.. Ohgaki, H., Sugimura, T., and Hirono, I. (1982). Carcinogenesis 3, 93-97. Mukhtar, H., Del Tito, B. J., Jr., Marcelo, C. L., Das, M., and Bickers, D. R. (1984). Carcinogenesis 5, 156551571, Mukhtar, H . , Das, M., and Bickers, D. R. (1986). Cancer Res. 46, 2262-2265. Mukhtar, H. , Das, M., Khan, W. A., Wang, Z. Y., Bik, D. P., and Bickers, I). R. (1988). Cancer Res. 48, 2361-2365. Nakadate, T., Yamamoto, S., Iseki, H., Sonoda, S.. Takemura, S., Ura, A., Hosoda, Y., and Kato, R. (1982a).Gann 73, 841-843. Nakadate, T., Yamamoto, S . , Ishii, M., and Kato, R. (1982b). Carcinogenesis 3, 1411-1414. Nakadate, T., Yamamoto, S.,Aizu, E., and Kato, R. (1984). Gann 75, 214-222. Nakamura, A., Shirai, T., Fukushima, S., Moore, M. A,, and Ito, N. (1988). Proc. Jpn. Cancer Assoc. 47, 141. Namiki, M., and Osawa, T. (1986). Basic Lije Sci. 39, 131-142. Nauss, K. M., Bueche, D., Soule, N., Fu, P., Yew, K., and Newberne, P. M . (1986). Cancer Lett. 33, 107-116.
ANTIOXIDANTS A N D CARCINOGENESIS
299
Nera, E. A., Lok, E., Iverson, F., Ormsby, E., Karpinski, K. F., and Clayson, D . B. (1984). Toxicology 32, 197-213. Newberne, P. M., Charnley, G., Adams, K., Cantor, M., Roth, D., Supharkam, V., and Fong, L. (1986). Food Chem. Toxicol. 24, 1111-1119. Newberne, P. M., Charnley, G . , Adams, K., Cantor, M., Suphakarn, V., Roth, D., and Schrager, T. F. (1987). Cancer Lett. 38, 149-163. Niculescu-Duviz, I., Simon, Z., Tiriac, S., Ionescu, A,, Mracec, M., and Voiculetz, N. (1985). Neoplasm 32, 695-707. Nishino, H., Iwashima, A., Fujiki, H., and Sugimura, T. (1984). Gann 75, 113-116. Norkus, E. P., Kuenzig, W. A., Chau, J., Mergens, W. J., and Conney, A. H. (1986). Carcinogenesis 7, 357-360. O’Connell, J. F., Klein-Szanto, A. J. P., DiGiovanni, D. M., Fries, J. W., and Slaga, T. J. (1986). Cancer Res. 46, 2863-2865. Ohno, Y., Yoshida, O., Oishi, K., Okada, K., Yamabe, H., and Schroeder, F. H. (1988). Cancer Res. 48, 1331-1336. Olsen, P., Bille, N., and Meyer, 0. (1983). Acta Pharmacol. Toxicol. 53, 433-434. Olsen, P., Meyer, O., Bille, N., and Wiirtzen, G. (1986). Food Chem. Toxicol. 24, 1-12. Pamukcu, A. M., Yalciner, S., Hatcher, J. F., and Bryan, G. T. (1980). Cancer Res. 40, 34683472. Peraino, C., Fry, R. J. M., StaEeldt, E., and Christopher, J. P. (1977). Food Cosmet. Toxicol. 15, 93-96. Perchellet, J.-P., Owen, M. D., Posey, T. D., Orten, D. K., and Schneider, B. A. (1985). Carcinogenesis 6, 567-573. Perchellet, J.-P., Abney, N. L., Thomas, R. M., Guislain, Y. L., and Perchellet, E. M. (1987). Cancer Res. 47, 477-485. Perera, M. I. R., Betschart, J. M.,Virji, M. A., Katyal, S. L., and Shinozuka, H. (1987). Toxicol. Pathol. 15, 51-59. Peto, R., Doll, R., Buckley, J. D., and Sporn, M. B. (1981). Nature (London) 290, 201-208. Pignatelli, B., Bereziat, J.-C., Descotes, G., and Bartsch, H. (1982). Carcinogenesis 3, 10451049. PrBat, V., de Gerlache, J., Lans, M., Taper, H., and Roberfroid, M. (1986). Carcinogenesis 7, 1025-1028. Prochaska, H. J., De Long, M. J.. and Talalay, P. (1985).Proc. Natl. Acad. Sci. USA 82,82328236. Rahimtula, A. (1983). Chem-Biol. Interact. 45, 125-135. Raj, A. S., Heddle, J. A., Newmark, H. L., and Kats, M. (1983). Mutat. Res. 124, 247-253. Reddy, B. S., and Maeura, Y. (1984).J . Natl. Cancer Znst. 72, 1181-1187. Reddy, B. S., Hirota, N., and Katayama, S. (1982). Carcinogenesis 3, 1097-1099. Reddy, B. S . , Maeura, Y., and Weisburger, J. H. (1983).J . Natl. Cancer Znst. 71, 1299-1305. Reddy, B. S . , Tanaka, T., and El-Bayoumy, K. (1985).J. Natl. Cancer Znst. 74, 1325-1328. Reddy, B. S . , Sugie, S., Maruyama, H., and Marra, P. (1988). Cancer Res. 48, 1777-1780. Rodrigues, C., Lok, E., Nera, E., Iverson, F., Page, D., Karpinski, K., and Clayson, D. B. (1986). Toxicology 38, 103-117. Rustia, M . (1975).J . Natl. Cancer Znst. 55, 1389-1394. Saito, D., Shirai, A,, Matsushima, T., Sugimura, T., and Hirono, I. (1980). Terntogen Carcinogen Mutagen l, 213-221. Saito, K., Yoshitake, A , , Asamoto, M., and Hirose, M. (1988). Proc. Jpn. Cancer Assoc. 47, 117. Salonen, J. T., Salonen, R., Lappetelgnen, R., MaenpSi, P. H., Alfthan, G., and Puska, P. (1985). Br. Med. J . No. 290, 417-420. San, R. H. C., and Chan, R. I. M. (1987). Mutat. Res. 177, 229-239.
300
NOBUYUKI IT0 A N D MASAO HIROSE
Sato, H., Takahashi, M., Furukawa, F., Miyakawa, Y., Hasegawa, R . , Toyoda, K., and Hayashi, Y. (1988). Cancer Lett. 38, 49-56. Scanlan, R. A. (1983). Cancer Res. 43, Suppl., 2435s-2440s. Schwarz, M., Peres, G., Kunz, W., Furstenberger, G., Kittstein, W., and Marks, F. (1984). Carcinogenesis 5, 1663-1670. Sgaragli, G., Della Corte, L . , Puliti, R.,De Sarlo, F., Francalanci, R . , Guarna, A., Dolara, P . , and Komarynsky, M. (1980). Biochem. P h a m c o l . 29, 763-769. Shah, G. M., and Bhattacharya, R. K. (1986). Chem.-Bid. Interact. 59, 1-15. Shamberger, R. J. (1970).J . Natl. Cancer Inst. 44, 931-936. Shamberger, R. J., Tytko, S. A., and Willis, C. E. (1976).Arch. Enuiron. Health 31,231-235. Shibata, M.. Tanaka, H., Hirose, M., Imaida, K., and Shirai, T. (1988). Proc. Jpn. Cancer Assoc. 47, 86. Shirai, T., Hagiwara, A,, Kurata, Y., Shibata, M . , Fukushima, S., and Ito, N. (1982). Food Chem. Toxicol. 20, 861-865. Shirai, T., Fukushima, S., Ohshima, M., Masuda, A., and Ito, N. (1984).J . Natl. Cancer Inst. 72, 1189-1198. Shirai, T., Ikawa, E., Hirose, M . , Thamavit, W., and Ito, N . (1985a).Carcinogenesis 6, 637639. Shirai, T., Masuda, A., Fukushima, S., Hosoda, K., and Ito, N. (1985b). Cancer Lett. 29, 283288. Shirai, T., Ikawa, E. , Fukushima, S., Masui, T., and Ito, N . (1986). Cancer Res. 46, 20622067. Shklar, G. (1982).J . Natl. Cancer Inst. 68, 791-797. Shklar, G., Schwartz, J., Trickler, D. P., and Niukian, K. (1987).J . Natl. Cancer Inst. 78,987992. Slaga, T. J., and Bracken, W. M. (1977). Cancer Res. 37, 1631-1635. Slaga, T. J., and Butler, A. P. (1984). In “Cellular Interactions by Environmental Tumor Promoters” (H. Fujiki et al., eds.), pp. 291-301. Jpn. Sci. SOC.Press, Tokyo/VNU Sci. Press, Utrecht. Slaga, T. J., Klein-Szanto, A. J. P., Triplett, L. L., Yotti, L. P., and Trosko, J. E. (1981). Science 218, 1023-1025. Smith, G. J.. Ohl, V. S., and Litwack, G. (1977). Cancer Res. 37, 8-14. Solanski, V., Rana, R. S., and Slaga, T. J. (1981). Carcinogenesis 2, 1141-1146. Soullier, B. K., Wilson, P. S., and Nigro, N. D. (1981). Cancer Lett. 12, 343-348. Sparnins, V. L., and Wattenberg, L. W. (1981).J . Natl. Cancer Inst. 66, 769-771. Speier, J. L., and Wattenberg, L. W. (1975).J . Natl. Cancer Inst. 55, 469-472. Spiegelhalder, B., Eisenbrand, G., and Preussmann, R.(1976).Food Cosmet. Toxicol. 14,545548. Stich, H. F., and Rosin, M. P. (1984).Ado. E x p . Med. B i d . 177, 1-29. Stoewsand, G. S., Anderson, J. L., Boyd, J. N., and Hrazdina, G. (1984).J . Toxicol. Enoiron. Health 14, 105- 114. Suda, D., Schwartz, J., and Shklar, G. (1986). Carcinogenesis 7, 711-715. Takahashi, H., Aiso, S., and Hirono, 1. (1983).J . Food Saf. 5, 55-60. Takahashi, M . , Furukawa, F., Toyoda, K., Sato, H., Hasegawa, R., and Hayashi, Y. (1986). Cancer Lett. 30, 161-168. Takigawa, M., Verma, A. K., Simsiman, R. C., and Boutwell, R. K. (1982). Biochem. Biophys. Res. Commun. 105, 969-976. Takizawa, Y., Matsuda, Y., and Yamashita, J. (1985). Toxicol. Lett. 27, 27-34. Tamano, S . , Fukushima, S., Shirai, T., Hirose, M., and Ito, N. (1987). Cancer Lett. 35, 39-46. Tanaka, T., Reddy, B. S., and El-Bayoumy, K. (1985). Cann 76, 462-467.
ANTIOXIDANTS AND CARCINOGENESIS
30 1
Tannenbaum, S. R., Sinskey, A. J., Weisman, M., and Bishop, W. (1974).J. Natl. Cancer Inst. 53, 79-84. Tatsuta, M., Mikuni, T., and Taniguchi, H. (1983). Znt. J . Cancer 32, 253-254. Teel, R. W. (1986). Cancer Lett. 30, 329-336. Teel, R. W., Martin, R. M., and Allahyari, R. (1987). Cancer Lett. 36, 203-211. Temple. N. J . , and Basu, T. K. (1987).J. Natl. Cancer Inst. 78, 1211-1214. Temple, N. J., and El-Khatib, S. M. (1987). Cancer Lett. 35, 71-77. Thamavit, W., Tatematsu, M., Ogiso, T., Mera, Y., Tsuda, H., and Ito, N. (1985). Cancer Lett. 27, 295-303. Thompson, H. J . , and Becci, P. J. (1980).J . Natl. Cancer Znst. 65, 1299-1301. Thompson, H. J., Meeker, L. D., and Kokoska, S. (1984). Cancer Res. 44, 2803-2806. Tobe, M., Furuya, T., Kawasaki, Y., Naito, K., Sekita, K., Matsumoto, K., Ochiai, T., Usui, A., Kokubo, T., Kanno, J., and Hayashi, Y. (1986). Food Chem. Toricol. 24, 1223-1228. Toth, B., and Patil, K. (1983).J . Natl. Cancer Znst. 70, 1107-1111. Trickle;, D., and Shklar, G . (1987).J. Natl. Cancer Inst. 78, 165-169. Troll, W., Frenkel, K., and Teebor, C. (1984). In “Cellular Interactions by Environmental Tumor Promoters” (H. Fujiki e t a / . , eds.), pp. 207-218. Jpn. Sci. SOC. Press, Tokyo/VNU Sci. Press, Utrecht. Tsuda, H., Fukushima, S., Imaida, K., Sakata, T., and Ito, N. (1983).Acta P h a m c o l . Toxicol. 55, 125-143. Tsuda, H., Hasegawa, R., Imaida, K., Masui, T., Moore, M. A , , and Ito, N. (1984a). Gann 75, 876-883. Tsuda, H., Sakata, T., Masui, T., Imaida, K., and Ito, N. (1984b). Carcinogenesis 5, 525-531. Tsuda, H., Sakata, T., Shirai, T., Kurata, Y., Tamano, S., and Ito, N. (1984~).Cancer Lett. 24, 19-27. Ulland, B. M., Weisburger, J. H., Yamamoto, R. S., and Weisburger, E. K. (1973). Food C o m t . To~icol.11, 199-207. Uwagawa, S., Kagawa, M., Ogiso, T., Hosoda, K., and Tsuda, H. (1987). Proc. J p n . Cancer Assoc. 46, 18. Van der Heijden, C. A., Janssen, P. J. C. hl., and Strik, J. J . T. W. A. (1986). Food Chem. Toxicol. 24, 1067-1070. Van Durren, B. L., and Coldschmidt, B. M. (1976). J . Natl. Cancer Znst. 56, 1237-1242. Van Esch, G . J. (1986). Food Chem. Toxicol. 24, 1063-1065. Virk, M. S . , and Issenberg, P. (1986). Carcinogenesis 7, 867-870. von Euler, U. S., and Lishajko, F. (1959). Nature (London) 183, 1123. Wagner, D. A., Shuker, D. E. G . , Bilmazes, C., Obiedzinski, M., Baker, I., Young, V. R., and Tannenbaum, S. R. (1985). Cancer Res. 45, 6519-6522. Wald, N. J., Boreham, J., Hayward, J. L., and Bulbrook, R. D. (1984).Br. J. Cancer 49,321324. Wargovich, M . J , , Eng, V. W. S., and Newmark, H. L. (1985). Food Cheni. Toxicol. 23, 4749. Wattenberg, L. W. (1972).J . Natl. Cancer Inst. 48, 1425-1430. Wattenberg, L. W. (1973).J. Natl. Cancer Znst. 50, 1541-1544. Wattenberg, L. W. (1976). In “Fundamentals in Cancer Prevention” (P. N. Magee et al., eds.), pp. 153-1643, Univ. of Tokyo Press, Tokyo/Univ. Park Press, Baltimore, Maryland. Wattenberg, L. W. (1978a).J. Natl. Cancer Znst. 60, 11-18. Wattenberg, L. W. (197813).Ado. Cancer Res. 26, 197-226. Wattenberg, L. W. (1980).J . Enuiron. Pathol. Toxicol. 3, 35-52. Wattenberg, L. W. (1983). Cancer Res. 43, Suppl., 2448s-2453s. Wattenberg, L. W., and Sparnins, V. L. (1979).J . Natl. Cancer Znst. 63, 219-222.
302
NOBUYUKI ITO A N D MASAO HIROSE
Wattenberg, L. W., Jerina. D. M., Lam, L. K. T., and Yagi, H. (1979).J . Natl. Cancer Znst. 62, 1103- 1106. Wattenberg, L. W., Coccia, J . B., and Lam, L. K. T. (1980). Cancer Res. 40, 2820-2823. Wattenberg, L. W., and Lam, L. K. T. (1981).I n “Inhibition ofTumor Induction and Development” (M. S . Zedeck and M. Lipkin, eds.), pp. 1-22. Plenum, New York. Weisburger, E. K., Evarts, R. P., and Wenk, M. L. (1977).Food Cosmet. Toricol. 15,139-141. Weisburger, J. H. (1985). Znt. J . Vitam. Nutr. Res., Suppl. 27, 381-402. Weisburger, J. H., and Raineri, R. (1975). Cancer Res. 35, 3469-3474. Weisburger, J. H., Marquardt, H., Hirota, N., Mori, H., and Williams, 6. H. (1980).J. Natl. Cancer Inst. 64, 163-167. Welsch, C. W., Goodrich-Smith, M., Brown, C. K., Greene, H. D., and Hamel, E. J. (1981). Carcinogenesis 2, 519-522. Wheldon, G . H., Bhatt, A., Keller, P., and Hummler, H. (1983). Znt. J . Vitam.Nutr. Res. 53, 287-296. Wilder, 0.H. M., Ostby, P. C., and Gregory, B. R. (1960).J . Agric. Food Chem. 8, 504-506. Willett, W. C., Polk, B. F., Morris, J. S., Stampfer, M. J . , Pressel, S., Rosner, B., Taylor, J. O., Schneider, K., and Hames, C. G . (1983). Lancet ii, 130-134. Williams, G . M. (1986). Food Chem. Toxicol. 24, 1163-1166. Williams, G . M., and Weisburger, J. H. (1986). Surg. Clin. North Am. 66, 873-889. Williams, G . M., Maeura, Y., and Weisburger, J. H. (1983). Cancer Lett. 19, 55-60. Williams, G . M., Tanaka, T., and Maeura, Y. (1986). Carcinogenesis 7, 1043-1050. Witschi, H. P. (1986). Cancer Res. 46, 2675-2679. Witschi, H. P., and Kehrer, J. P. (1982).J . Am. Coll. Toxicol. 1, 171-184. Witschi, H. P., and Morse, C. C. (1983).J . Natl. Cancer Znst. 71, 859-866. Witschi, H. P., Williamson, D.. and Lock, S . (1977).1. Natl. Cancer Znst. 58, 301-305. Wood, A. W., Huang, M.-T., Chang, R. L., Newmark, H. L., Lehr, R. E., Yagi, H., Sayer, J. M., Jerina, D. M., and Conney, A. H. (1982). Proc. Natl. Acad. Sci. USA 79,5513-5517. Yamada, K., Shirahata, S., Murakami, H., Nishiyama, K., Shinohara, K., and Omura, H. (1985). Agric. Biol. Chem. 49, 1423-1428. Yoshizawa, S., Horiuchi, T., Fujiki, H., Yoshida, T., Okuda, T., and Sugimura, T. (1987). Phytother. Res. 1, 44-47.
INDEX A Acquired immune deficiency syndrome (AIDS) Kaposi’s sarcoma and, 73-85; see also Kaposi’s sarcoma African endemic Burkitt’s lymphoma (eBL), 33-67; see also Burkitt’s lymphoma, endemic (eBL) Allograft rejection effector-cell identity in, 214-215 MHC antigen expression and, 216 Angiogenic factors in Kaposi’s sarcoma, 83-84
Antibody responses in malaria, 63 Antigen(s) malaria, lymphocyte transformation and, 56-57 MHC, 89-109; see also Major histocompatibility complex (MHC) antigens and MHC, interaction of, 191-192 tumor rejection, nature of, 184-186 Antigenicity without immunogenicity, 216-218
Antioxidants, 247-293 carcinogenesis by, modification of,
B B-cell neoplasia, Epstein-Barr virus and, 38
Burkitt’s lymphoma, endemic (eBL), 33-67 chromosomal translocations and, 42-44 cytotoxicity of cells in, 45-46 epidemiology of, 38-40 etiology of, malaria and, evidence linking, 51 evidence linking EBV with, 41-42 genesis of, cofactors in, 44-45 histology of, 41 oncogenes and, 42-44 target cell in, nature of, 46 Butylated hydroxyanisole (BHA) carcinogenicity of, 249-253 excretion of, 263-264 in forestomach tumorigenesis chemical effects on, 267-268 mechanism of action of, 263-270 metabolism of, 264-267 detection of radicals during, 268-270 tissue distribution of, 263-264 Butylated hydroxytoluene (BHT), carcinogenicity of, 253
270-288
C
antipromoting activity and, 285-286 by blocking nitrosamine formation, 286-288
by posttreatment, 279-285 by timing of treatment, 271-279 as chemopreventers of carcinogenesis, 288-291 as human hazards, evaluation of, 288-291 tumorigenic effects of, 249-258 tumors induced by, histopathological characteristics of, 258-263 Antitumor immunity by cytotoxic T cells, MHC regulation by, 93-97 by NK cells, MHC regulation by, 97-103 Autoantibodies in malaria, 61-62
c-fos, altered MHC expression and, 202-203
c-fos protooncogene, 18-20 c-jun protooncogene, 20 c-myc expression of, enhanced, endemic Burkitt’s lymphoma and, 43-44 MHC expression and, 203 c-myc protooncogene, 17-18 Calcyclin, 11, 12 Cancer clinical, MHC expression in, 193-196 immunosurveillance theory of, 182-184 Chromosomal translocations, endemic Burkitt’s lymphoma and, 42-44 303
304
INDEX
Competence establishment of, gene expression requirement for, 7-8 in mitogenic response to serum, 4 Competence genes, 2, 14-15 Cytokines in malaria, 62, 64 production of, malaria-stimulated, 58 Cytomegalovirus (CMV), Kaposi's sarcoma and, 82-83 Cytotoxic T cells, antitumor immunity by, MHC regulation by, 93-97
IGF-inducible, 15-16 PDGF-inducible, 14-15 serum-inducible, 10-14 TGF-&inducible, 16 growth factor-inducible, 22, 23 in nonhematologic cells, 24 host, associated with SV40 transformation, 16-17 MHC, 188-188 molecular isolation of, from genetic mapping to, 135-137 non-MHC and MHC, interactions of,
140-141
D cDNA libraries, differential screening of, growth factor-inducible mRNAs detected by, 10-17 Duncan's syndrome, immunoregulatory defects in, 37-38
E Epidermal growth factor (EGF) gene expression inducible by, 15 in serum, 5 Epithelial organ, tumorigenesis in, MHC effects on, 166-169 Epithelial tumors, susceptibility to, MHC and, 150-169 Epstein-Barr virus (EBV), 34-38 B-cell neoplasia and, 38 cycle of, immunological control and,
serum-inducible, 1-25 tumor suppression, tumor susceptibility genes and, 121-123 tumor susceptibility, 117-170; see also "hmor susceptibility genes Genetics of lung tumor susceptibility, 150-152 of tumor susceptibility, 117-170; see o h 'hmor susceptibility genes Growth, animal cell, serum requirement for, 3 Growth factor-inducible genes, 22, 23 in nonhematologic cells, 24 Growth factor-inducible mRNAs of identified genes, 17-21
H Hormonal infuence on Kaposi's sarcoma, 85
35-37 endemic Burkitt's lymphoma and, 41-42 immunoregulatory defects and, 37-38 malaria and, interaction between, evidence for, 54-58
I Immune surveillance, organ- and tissuespecific effects on, 229-231 Immune system, compartmentalization of,
229-230
G Gene@) affecting lung tumor, site of action of,
153-154 competence, 2, 14-15 expression of EGF-inducible, 15 for establishment of competence, 7-8
Immunity, antitumor by cytotoxic T cells, MHC regulation by,
93-97
by NK cells, MHC regulation by, 97-103 Immunological control, Epstein-Barr virus cycle and, 35-37 Immunology, tumor, basis of, 182-186 Immunosuppression by malaria, 62-64 Immunosurveillance theory of cancer,
182-184
305
INDEX
Insulin like growth factor (IGF) gene expression inducible by, 15-16 in serum, 5 Intestine, small, tumorigenesis in, MHC effects on, 160-162
K Kaposi’s sarcoma (KS), 73-85 angiogenic factors in, 83-84 cell of origin of, 76, 78-79 clinical features of, 73-76 endemic, 74-75 epidemic, 75 epidemiology of, 73-76 etiology of, 80-85 hormonal influence on, 85 hyperplastic lesions of, 79-80 immunosuppression-associated,75-76 infectious agent in, 80-83 as neoplasm, 79-80 oncogenes in, 84-85 pathology of, 76, 77-78 sporadic, 74
L
M Macrophages in malaria, 63-64 Major histocompatibility complex (MHC) and antigen, interaction of, 191-192 biology of, 186-191 class I changes in, in tumors, 226-229 expression of, immunogenicity of cancer and, 232 regulation of, in malignancy, 225-229 contribution of, to in vivo destruction of antigen-bearing tissue, 216 effects of on epithelial organ tumorigenesis,
166-169 on liver tumorigenesis, 162-163 on lung tumorigenesis, 156-160 on small intestine tumorigenesis,
160-162 epithelial tumor susceptibility and,
150-169 expression of, altered, biological importance of, 146-149 function of, 191-193 gene family of, 186-188 mammary tumor susceptibility and,
163-166 MuLV-induced lymphomagenesis and,
Liver, tumorigenesis in, MHC effects on,
162-163 Lung(s) tumor of genes affecting, site of action of,
153-154 genesis of, MHC effects on, mechanisms of, 156-160 susceptibility to genetics of, 150-152 MHC genes and, 154-156 types of, 152-153 tumorigenesis in, MHC effects on, mechanisms of, 156-160 Lymphocyte subsets in malaria, 63 Lymphocyte transformation, malaria antigens and, 56-57 Lymphoma, Burkitt’s, endemic, 33-67;see also Burkitt’s lymphoma, endemic (eBL) Lymphoma cells, cytotoxicity of, 45-46 Lymphomagenesis, MuLV-induced, MHC and, 149
149 in natural resistance, 218-220 in NK recognition, 218-220 nonimmunological role of, 192-193 in normal and malignant cell development, 181-234 phenotypes of tumor cells, 143-146 quantitative variation in, effects of, on afferent-efferent T-cell responses,
213-214 in regulation of antitumor immunity by cytotoxic T cells, 93-97 structure of, 137-1140 Major histocompatibility complex (MHC) antigens class I and class 11, function of, 141-143 expression of cell cycle-specific, 190-191 differentiation and, 190-191 in malignancy, 193-200 metastasis and, 89-109 in normal tissue, 188-191
306
INDEX
in malignancy evidence for role of, 200-209 function of, proposed, 209-219 transplantation studies and, 209-218 metastasis and in animal models, 91-93 in humans, 103-106 ontogeny of, 189-190 regulation of, oncogenes and, 225-226 and T-cell, interaction of, 191-192 tissue distribution of, 188-189 tumorigenicity and in animal models, 91-93 in humans, 103-106 Major histocompatibility complex (MHC) genes lung tumor susceptibility and, 154-156 and non-MHC genes, interactions of, 140-141
regulation of features of, 220-225 posttranscriptional, 224-225 transcriptional, 220-224 transfected, 204-209 protection from NK susceptibility and, 208-209 tumor growth attenuation and, 205-208
Major histocompatibility complex (MHC) immunity by NK cells, 97-103 Malaria, 46-64 acquired immunity to, 49-50 autoantibodies in, 61-62 cytokine production stimulated by, 58 cytokines in, 62 EBV and evidence linking, 50-54 interaction between, evidence for,
Malignancy MHC antigens in, role of, evidence for, 200-209
MHC expression in, 193-200 regulation of class I MHC in, 225-229 Mammary tumor susceptibility, MHC and, 163-166
Metastasis MHC antigens in in animal models, 91-93 expression and, 89-109 in humans, 103-106 tissue site and, 230-231 4-Methoxyphenol, tumorigenic activity of, 254
Mitogenic response to serum, 3-5 minor transcriptional changes in, 5-6 transcription and translation in, 5-8 MuLV-induced lymphomagenesis, MHC and, 149
N N-myc, MHC expression and, 203 Natural killer (NK) cells antitumor immunity by, MHC regulation by, 97-103 recognition of, MHC in, 218-220 susceptibility to, protection from, transfected MHC genes and, 208-209
Natural resistance, MHC in, 218-220 Neoplasia, B-cell, Epstein-Barr virus and, 38
Neoplasms, development of, multistage process of, tumor susceptibility genes and, 123-125
54-58
endemicity of, 48-49 host immunity in, protective mechanisms of, 59-60 immune system and, 58-64 immunity in, pathological consequences of, 61-62 immunosuppression by, 62-64 parasite mechanisms in, 80-61 rodent, virus-specificTc responses in, 58 splenomegaly in, 62 Malaria antigens, lymphocyte transformation and, 56-57
0 Oncogenes endemic Burkitt's lymphoma and, 42-44 influence of on malignancy, 202 on MHC relation, 225-226 in Kaposi's sarcoma, 84-85 tumor susceptibility genes and, 121-123 Oncogenic viruses, influence of, on malignancy, 201-202
307
INDEX
P Phenolic antioxidants, tumorigenic activity of, 254-257 Platelet-derived growth factor (PDGF), 2 competence and, 4, 5 gene expression inducible by, 14-15 Progression in mitogenic response to serum, 4 Proteins, proliferation-related, 8-9 Protooncogenes C-~OS, 18-20 c-jun, 20 c-myc, 17-18 mRNA, 17-21 C-~OS, 18-20 c-jun, 20 c-myc, 17-18
Q Quercetin, tumorigenic activity of, 257-258
transcription and translation in, 5-8 transcription of proliferation-specific mRNA induced by, 7 Small intestine, tumorigenesis in, MHC effects on, 160-162 Splenomegaly in malaria, 62 SV40 transformation, host genes associated with, 16-17
T T-cell adhesion molecules, 192 T cells class I-restricted, direct priming of, requirements for, 215-216 cytotoxic, antitumor immunity by, MHC regulation by, 93-97 gene expression-induced, 17 and MHC, interaction of, 191-192 mRNAs specific to, 21 and tumor cells, interactions between, MHC quantitative variation and, 213-214
R ras oncogenes, MHC expression and, 203-204
Resistance, natural, MHC in, 218-220 mRNA(s) growth factor-inducible detected by differential screening of gene and cDNA libraries, 10-17 of identified genes, 17-21 proliferation-specific, serum-induced transcription of, 7 T-lymphocyte specific, 21
S
Tc responses EBV-specific, 55-56 virus-specific, in rodent malaria, 58 tert-butylhydroquinone (TBHQ), tumorigenic activity of, 253-255 Tissues, MHC antigen distribution in, 188-189
'Itamforming growth factor /3 (TGF-/3) gene expression inducible by, 16 in serum, 5 lbmor(s) animal models of, MHC expression in, 197-200
antioxidant-induced, histopathological characteristics of, 258-263 class I, MHC expression in, 226-229 epithelial, susceptibility to, MHC and, 150-169
Sarcoma, Kaposi's, 73-85; see also Kaposi's sarcoma (KS) Serum animal cell growth and, 3 functional components of, 5 gene expression induced by, 20-24 genes inducible by, 1-25 mitogenic response to, 3-5 minor transcriptional changes in, 5-6
growth of attenuation of, transfected MHC genes and, 205-208 tissue site and, 230-231 lung, 150-160; see also Lung(s), tumor of mammary, susceptibility to, MHC and, 163-166
n m o r cells MHC phenotypes of, 143-146
INDEX rejection of, effector-cell identity in,
214-215 and T cells, interactions between, MHC quantitative variation and, 213-214 'hmor immunology basis of, 182-186 immunosurveillance theory in, 182-184 tumor rejection antigens in, 184-186 'hmor rejection antigens, nature of,
184-186 'hmor suppression genes, tumor susceptibility genes and, 121-123 'hmor susceptibility genes, 117-170 biology of, 121-125 genetic definition of, 125-137 molecular and cellular perspective on,
169-170 molecular isolation of, from genetic mapping to, 135-137 multistage process of neoplastic development and, 123-125 oncogenes and, 121-123 quantitativelstatisticalconsiderations on,
liver, MHC effects on, 162-163 lung, MHC effects on, mechanism of,
156-160
small intestine, MHC effects on, 160-162 'hmorigenic effects of antioxidants,
249-258 'hmorigenicity, MHC antigens in in animal models, 91-93 in humans, 103-106
v Vimentin, 11, 12 Virus(es) Epstein-Barr, 34-38; see also EpsteinBarr virus (EBV) oncogenic, influence of, on malignancy,
201-202
Vitamin D3, deficiency of, endemic Burkitt's lymphoma and, 45 VL 30, 16
132-133
recombinant congenic strains and,
131-132
recombinant inbred strains and, 127-131 site of action of, 119-121 tumor suppression genes and, 121-123 'hmorigenesis epithelial organ, MHC effect, 166-169 forestomach, BHA in, mechanism of action of, 263-270
X X-linked lymphoproliferative disease, immunoregulatory defects in, 37-38
z Zinc-finger regions in regulatory proteins, 13