Brain Mapping and Diseases

NEUROSCIENCE RESEARCH PROGRESS

BRAIN MAPPING AND DISEASES No part of this digital document may be reproduced, stored in a retrieval system or transmitted in any form or by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in rendering legal, medical or any other professional services.

NEUROSCIENCE RESEARCH PROGRESS Additional books in this series can be found on Nova’s website under the Series tab.

Additional E-books in this series can be found on Nova’s website under the E-books tab.

NEUROSCIENCE RESEARCH PROGRESS

BRAIN MAPPING AND DISEASES

DIANE E. SPINELLE EDITOR

Nova Science Publishers, Inc. New York

Copyright © 2011 by Nova Science Publishers, Inc. All rights reserved. No part of this book may be reproduced, stored in a retrieval system or transmitted in any form or by any means: electronic, electrostatic, magnetic, tape, mechanical photocopying, recording or otherwise without the written permission of the Publisher. For permission to use material from this book please contact us: Telephone 631-231-7269; Fax 631-231-8175 Web Site: http://www.novapublishers.com NOTICE TO THE READER The Publisher has taken reasonable care in the preparation of this book, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained in this book. The Publisher shall not be liable for any special, consequential, or exemplary damages resulting, in whole or in part, from the readers’ use of, or reliance upon, this material. Any parts of this book based on government reports are so indicated and copyright is claimed for those parts to the extent applicable to compilations of such works. Independent verification should be sought for any data, advice or recommendations contained in this book. In addition, no responsibility is assumed by the publisher for any injury and/or damage to persons or property arising from any methods, products, instructions, ideas or otherwise contained in this publication. This publication is designed to provide accurate and authoritative information with regard to the subject matter covered herein. It is sold with the clear understanding that the Publisher is not engaged in rendering legal or any other professional services. If legal or any other expert assistance is required, the services of a competent person should be sought. FROM A DECLARATION OF PARTICIPANTS JOINTLY ADOPTED BY A COMMITTEE OF THE AMERICAN BAR ASSOCIATION AND A COMMITTEE OF PUBLISHERS. Additional color graphics may be available in the e-book version of this book. LIBRARY OF CONGRESS CATALOGING-IN-PUBLICATION DATA Brain mapping and diseases / editor, Diane E. Spinelle. p. ; cm. Includes bibliographical references and index. ISBN 978-1-61122-623-2 (eBook) 1. Brain--Diseases. 2. Brain mapping. I. Spinelle, Diane E. [DNLM: 1. Brain Mapping. 2. Brain Diseases. WL 335] RC386.B727 2010 612.8'2--dc22 2010036427

Published by Nova Science Publishers, Inc. † New York

CONTENTS vii 

Preface Chapter 1

Hallmarks of Apoptotic-Like Cell Death in Response to Hypoxic Injury in Various Developmental Models are Closely Related to Brain Immaturity Jean-Luc Daval and Christiane Charriaut-Marlangue 

Chapter 2

DNA Damage Response and Apoptosis of Postmitotic Neurons Inna I. Kruman and Elena I. Schwartz 

Chapter 3

Tissue-, Period- and Site-Specificity of Somatic DNA Recombination in the Genomic Region, BC-1. Toyoki Maeda, Ryuzo Mizuno, Saburo Sakoda, Tomokazu Suzuki and Naoki Makino 

Chapter 4

Highlights in Understanding White Matter Ischemia James J.P. Alix and Michael G. Salter 

Chapter 5

Applications of Diffusion Tractography to the Study of Human Cognitive Functions Emi Takahashi 

1  19 

43 

61 

81 

Chapter 6

Effects of COX-2 Inhibitors on Brain Diseases Takako Takemiya and Kanato Yamagata 

101 

Chapter 7

Neuro-Physiological Studies in Creutzfeldt-Jakob’s Disease J. J. Ortega-Albás and A. L. Serrano-García 

131 

Chapter 8

Neurofilament Proteins in Brain Diseases Olivier Braissant 

153 

Chapter 9

Segmentation Propagation from Deformable Atlases for Brain Mapping and Analysis Marius George Linguraru, Tom Vercauteren,  Mauricio Reyes-Aguirre, Miguel Ángel González Ballester and Nicholas Ayache 

179 

vi

Contents

Chapter 10

Brain Mapping Alterations in Strabismus Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier and  Jorge Mendiola-Santibañez 

Chapter 11

Endovascular Brain Mapping: A Strategy for Intraoperative Visualization of Brain Parenchyma Functionality H. Charles Manning, Sheila D. Shay, Erich O. Richter, Swadeshmukul Santra and Robert A. Mericle 

Chapter 12

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin A Review Yair Lampl 

197 

249 

267 

Chapter 13

Regional Differences in Neonatal Sleep Electroencephalogram Karel Paul, Vladimír Krajča, Zdeněk Roth, Jan Melichar and Svojmil Petránek 

Chapter 14

Handedness of Children Determines Preferential Facial and Eye Movements Related to Hemispheric Specialization Carmina Arteaga and Adrián Poblano 

313 

Intact Environmental Habituation and Epinephrine-Induced Enhancement of Memory Consolidation for a Novel Object Recognition Task in Pre-Weanling Sprague-Dawley Rats Robert W. Flint, Shelby Hickey and Maryann Dobrowolski  Reviewed by Matthew Anderson 

323 

Chapter 15

Index

301 

339 

PREFACE Chapter 1 - With regard to the specificity of the developing brain, a better understanding of cellular mechanisms involved in perinatal hypoxic-ischemic injury would help to prevent neurological impairments. The authors therefore examined temporal features of brain injury in three different developmental models of oxygen deprivation capable of inducing apoptotic cell death. Nuclear staining by DAPI (4,6-diamidino-2-phenylindole) was used to identify healthy, apoptotic and necrotic nuclei as well as for cell counting in cultures and brain sections. DNA fragmentation was monitored by in situ terminal dUTP nick end labeling (TUNEL) and electrophoresis on agarose gels. Also, the expression profile of apoptosisrelated proteins Bax and Bcl-2 was studied by immunohistochemistry. In all cases, oxygen deprivation induced significant delayed cell death with morphological features of apoptosis and a progressive increase in the Bax/Bcl-2 protein ratio, except in the penumbra of the ischemic infarct where Bcl-2 remained predominant. As in the control newborn brain that still exhibited physiological death, hypoxia-associated DNA breakdown led to small fragments of ~200 bp in the cortex of hypoxic rat pups. Ladder pattern and TUNEL-positive cells exhibiting apoptotic bodies were only present in the penumbra of 7 day-old ischemic rats. These data indicate that hallmarks of hypoxia-induced apoptosis may vary according to brain maturity, possibly through specific nuclease activities. While retaining a part of the developmental death program, the newborn brain seems to be prone to an apoptotic-like response that resembles physiological programmed death. Chapter 2 - Programmed cell death or apoptosis is a relevant process in the physiology and pathology of the nervous system. Apoptosis is an organized form of cell death which is triggered by different factors including DNA damage. A growing body of evidence suggests that DNA damage and genomic instability are involved in neuronal abnormalities and may play a central role in neurodegeneration. DNA strand breaks and DNA lesions have been reported in Parkinson's and Alzheimer's diseases and as an early event after reperfusion of ischemic brain. DNA damage has been found to activate a cell death program in terminally differentiated postmitotic neurons. Since the genome is continuously damaged by a variety of endogenous and exogenous agents and the majority of DNA damage is produced by oxyradicals, generated by normal aerobic metabolism, neurons are particularly susceptible to DNA damage due to the high rate of oxidative metabolism. To maintain genomic integrity, cells are equipped with special defense mechanism, DNA damage response, to remove DNA damage by DNA repair pathways or eliminate damaged cells via apoptosis. Generally, differentiated cells, like neurons, are deficient in DNA repair and more vulnerable to DNA

viii

Diane E. Spinelle

damage-initiated apoptosis. For example, neurons are more vulnerable than astrocytes to DNA-damaging conditions such as ionizing radiation. Breast cancer patients receiving hemotherapy commonly experience long-lasting cognitive impairment. It is known that radiotherapy may cause CNS toxicity. DNA damaging agents including γ-irradiation induce neuronal apoptosis in vitro, suggesting the direct adverse effect of these DNA damaging agents on neurons. The importance of DNA repair for neuronal survival is illustrated by disorders observed in patients with hereditary DNA repair abnormalities. These disorders combine the predisposition to cancer with progressive neurodegeneration. Although indirect evidence suggests that DNA damage and repair mechanisms play critical roles in neuronal survival, the pathways involved are poorly understood. Recently, the authors have found that cell cycle activation is essential for DNA damage-induced neuronal apoptosis which suggests that the cell cycle machinery is a critical element of the DNA damage response not only in cycling but also in quiescent cells. Here, the authors discuss the DNA damage response in postmitotic neurons and possible mechanisms by which neurons are forced to apoptosis versus DNA repair thereby controlling cell fate. Elucidation of these mechanisms promises to provide multiple points of therapeutic intervention in neurodegenerative diseases. Chapter 3 - The nuclear circular DNA population has been analyzed in mouse brain cells. The brain is active in producing extrachromosomal nuclear circular DNA during the embryonic and newborn neonatal stage. One circular DNA, BC-1,1 was cloned from a mouse embryonic circular DNA library. The genomic region containing the BC-1 DNA sequence was shown to undergo somatic DNA recombination yielding a DNA deletion and circular DNA in mouse embryonic brain. The genomic BC-1 region is also active in DNA recombination in non-brain organ tissue such as the ocular lens and spleen. Although the BC1 region contains an evolutionally conservative DNA sequence homologous to the DNA sequence on human chromosome 3, the BC-1 does not contain any conventional exon and intron structure. The physiological significance and the molecular mechanism of the BC-1 DNA recombination and the BC-1 RNA expression are not clear. In this study, the DNA sequence surrounding the BC-1 region and BC-1 RNA expression are further analyzed as a first step in order to explain for the mechanism of the somatic BC-1 DNA recombinational events. Chapter 4 - The pathophysiology underlying the ischemic injury of white matter has, in recent times, been under intense investigation. As a result, significant inroads have been made in elucidating the mechanisms of injury that lead to pathology observed throughout life, from periventricular leukomalacia (PVL) in the neonate, to stroke in adulthood. To the surprise of many working in the field there are both remarkable similarities and important differences between the ischemic injury of the more classically studied grey matter and its white matter counterpart. In the mature CNS early studies using isolated white matter tracts first demonstrated the importance of the Na+-Ca2+ exchange protein in mediating a toxic Ca2+ influx. Ca2+ channels have also been implicated, by both providing the conduit for Ca2+ entry and mobilising Ca2+ from internal stores. More recently, NMDA and AMPA receptors have been shown to play important roles in the development of irreversible white matter injury, both in mature white matter and during an important developmental window. With regard to development, injury to white matter in the form of PVL is the primary pathology associated with the most common human birth disorder, cerebral palsy. Oligodendrocytes, the myelin forming cells of the central nervous system, have been a primary focus of research in this field and their progenitors have been shown to be especially susceptible to ischemic injury. A

Preface

ix

sound understanding of such pathways will be essential if successful therapeutic strategies are to be developed. Here, we review the remarkable progress made in what may still be viewed as a developing field, as researchers work towards unravelling the physiology behind the pathology. Chapter 5 - Functional neuroimaging studies have significantly advanced our understanding of human cognitive functions. However, much less is known about the anatomical connections underlying higher cognitive processes in humans. One of the reasons why anatomical studies have lagged behind functional studies is that there are methodological limitations on studying anatomical connections of the human brain in vivo. There are numerous detailed anatomical studies of non-human primates that serve as the basis of our understandings of connections in the brain. However, those techniques are not feasible in humans. Diffusion imaging is a new technique based on detecting the diffusion of water molecules from magnetic resonance images. Diffusion imaging allows non-invasive mapping of anatomical connections and gives a comprehensive picture of connectivity throughout the brain, but there are still numerous technical issues to be addressed. Here, I introduce our recent studies on large-scale anatomical connections underlying episodic memory in humans. We studied an entire network based on some episodic memory tasks, and applied several new approaches to assess our tractography results. Our main finding was that encoding-related areas in the left dorsolateral prefrontal cortex and the left ventrolateral prefrontal cortex connect with another encoding-related area in the left temporal cortex. This suggests that there are two pathways between prefrontal cortex and temporal cortex related to encoding processes in episodic memory. Further, I discuss future applications of diffusion imaging in the study of the human memory system. Chapter 6 - Cyclooxygenase-2COX-2expression is induced in the brain in various pathological conditions, such as fever, pain, and neurological disorders related to neuroinflammation. Therefore, it is important to elucidate the roles of COX-2 and the effects of COX-2 inhibitors in the central nervous system. Here, we review the modulatory roles of COX-2 and its product, prostaglandinE2 (PGE2, in fever and pain, and discuss the effects of COX-2 inhibitors. In addition, we will review the latest findings regarding the neuroprotective effects of COX-2 inhibitors on neuronal loss regarding neuroinflammation associated with brain diseases, including epilepsy, ischemia, amyotrophic lateral sclerosis, Parkinson’s disease, multiple sclerosis, and Alzheimer’s disease. We also discuss the roles of non-steroidal anti-inflammatory drugs (NSAIDs, such as COX inhibitors and peroxisome proliferator-activated receptor-γ PPAR-γ agonists. Brain diseases have neuroinflammatory aspects involving the activation of microglia related to neuronal loss, and PPAR-γ agonists have been shown to inhibit the activation of microglia. Furthermore, we address two common points concerning various diseases. We discuss the clinical application of selective COX-2 inhibitors to neuronal death induced by epilepsy and ischemia. The short-term and sub-acute cure achieved using selective COX-2 inhibitors matching the elevation of PGE2 is expected for treatment after onset of neuronal excitatory diseases to prevent neuronal loss. We also discuss the responses in vascular endothelial cells related to fever and epilepsy. In the endothelial cells, mPGES-1 is colocalized with COX-2, suggesting that the two enzymes are functionally linked and that brain endothelial cells play an essential role in PGE2 production during fever and epilepsy.

x

Diane E. Spinelle

Further analysis of COX-2 inhibitors may provide a better understanding of the process of neuropathological disorders, as well as facilitate the development of new treatment regimens. Chapter 7 - Neurophysiological studies in Creutzfeldt-Jakob Disease (CJD) are mostly centred on the appearance, during development of the disease, of an electroencephalogram (EEG) called “typical”, which converts the clinical suspicion into a likely diagnosis. Early diagnosis avoids another series of unnecessary procedures, prevents iatrogenic transmission and recognises the invariably fatal prognosis. The EEG as a diagnostic tool is based on interpreting a series of graphical elements that express the brain’s bio-electrical activity as a particular form of language. Its conventional meaning, mainly based on practical aspects, has allowed a series of basic electroencephalogram patterns to be defined. Performing an EEG comprises three major stages: the first is the detailed analysis of the graphical elements of which it is composed; the second, matching it with one of the defined patterns and, lastly, the identification of EEG patterns with a sociological value, i.e., trying to establish the appropriate electro-clinical correlation. Within the basic EEG pattern catalogue, the typical findings seen in the course of CJD are included in a large group of periodic activities. Nevertheless, two important aspects must be considered: on the one hand the fact that the EEG is a dynamic test that presents wide variations in the evolution of the disease and, on the other hand, the lack of typicality in the new variant of the disease (vCJD) and in the genetic subtypes that lead us to seek new ways of trying to establish a neurophysiological characterisation of the disease. In this chapter, in the first place, we will discuss the EEG findings in the course of the evolution of sporadic CJD and the aspects differentiating them from other phenotypes before explaining the current status and future prospects for neurophysiological studies. Chapter 8 - Neurofilaments are the main components of intermediate filaments in neurons, and are expressed under three different subunit proteins, NFL, NFM and NFH. Neurofilaments act with microtubules and microfilaments to form and maintain the neuronal structure and cell shape. Phosphorylation is the main post-translational modification of neurofilaments, which influences their polymerization and depolymerization, and is responsible for their correct assembly, transport, organization and function in the neuronal process. In particular, phosphorylation is essential for the repulsion of the neurofilament polymers in axons, which determines the axonal diameter and the velocity of electrical conduction. The phosphorylation state of neurofilaments is regulated in a complex manner, including interactions with the neighbouring glial cells. Abnormal expression, accumulation or post-translational modifications of neurofilament proteins are found in an increasing number of described neurological diseases, such as amyotrophic lateral sclerosis, Parkinson’s, Alzheimer’s and Charcot-Marie-Tooth diseases, or giant axonal neuropathy. Some of these diseases are associated with mutations discovered in the neurofilament genes. Recently, altered expression and phosphorylation states of neurofilament proteins have also been shown in metabolic diseases affecting the central nervous system either during development or in adulthood, such as hepatic encephalopathy due to hyperammonemia, methylmalonic and propionic acidemias, and diabetic neuropathy. Finally, accumulation of neurofilament proteins in the cerebrospinal fluid has been described as discriminating marker for patients with multiple sclerosis, and as predictor of long-term

Preface

xi

outcome after cardiac arrest. This review will focus on the most recent investigations on neurofilament proteins in neurodegenerative, neurodevelopmental and metabolic diseases, as well as on the use of neurofilaments as markers of diseases. Chapter 9 – Magnetic resonance imaging (MRI) is commonly employed for the depiction of soft tissues, most notably the human brain. Computer-aided image analysis techniques lead to image enhancement and automatic detection of anatomical structures. However, the intensity information contained in images does not often offer enough contrast to robustly obtain a good detection of all internal brain structures, not least the deep gray matter nuclei. We propose digital atlases that deform to fit the image data to be analyzed. In this application, deformable atlases are employed for the detection and segmentation of brain nuclei, to allow analysis of brain structures. Our fully automatic technique is based on a combination of rigid, affine and non-linear registration, a priori information on key anatomical landmarks and propagation of the information of the atlas. The Internet Brain Segmentation Repository (IBSR) data provide manually segmented brain data. Using prior anatomical knowledge in local brain areas from a randomly chosen brain scan (atlas), a first estimation of the deformation fields is calculated by affine registration. The image alignment is refined through a non-linear transformation to correct the segmentation of nuclei. The local segmentation results are greatly improved. They are robust over the patient data and in accordance with the clinical ground truth. Validation of results is assessed by comparing the automatic segmentation of deep gray nuclei by the proposed method with manual segmentation. The technique offers the accurate segmentation of difficultly identifiable brain structures in conjuncture with deformable atlases. Such automated processes allow the study of large image databases and provide consistent measurements over the data. The method has a wide range of clinical applications of high impact that span from size and intensity quantification to comprehensive (anatomical, functional, dynamic) analysis of internal brain structures. Chapter 10 - Congenital strabismus affects 3% of world population. Millions of persons suffer this condition, but still its origin or the reasons why not all patients respond to the traditional treatment are unknown. Until very recently, it was believed that congenital strabismus had no relation to cortical alterations; therefore, neuroimaging studies were only required when strabismus was present in premature infants or when brain damage was suspected. A preliminary study on strabismal patients in 1968 provided some insight into the incidence of the different presentations of strabismus in our institution, as well as the correlation among the various clinical signs. Based on this experience we decided to enlarge our sample. Using conventional EEG and digitized brain mapping (DBM) methods, we analyzed 195 young patients with clinical diagnosis of congenital strabismus –111 females (56.92%) and 84 males (43.08%); the age range was from 2 to 14 years. The DBM approach was done in real time. Given its low cost, security and availability, DBM turned to be a useful tool to evince some alterations in cerebral cortex related to congenital strabismus, especially dissociated strabismus. We also employed complementary neuroimaging methods for research purposes. From 195 DBM images, 56.4% exhibited various neuroelectric alterations, whereas 43.6% were considered normal. Abnormal DBM were more frequent in the dissociated strabismus group (64.95%) than in non-dissociated strabismus patients (42.6%); the rate of altered DBM images was higher in horizontal dissociated deviation cases (73.3%). Based on

xii

Diane E. Spinelle

these findings, we recommend the use of DBM in patients with dissociated strabismus, and in some cases the treatment must go beyond surgery and glasses. Some of our patients were subjected to different neuroimaging methods, such as single Photon emission tomography (SPECT), magnetic resonance imaging (MRI), granulometry, and proton nuclear magnetic resonance spectroscopy (1H NMRS) with the aim of correlating this data and gain further understanding on the origin of congenital strabismus, particularly dissociated strabismus cases. This chapter addresses aspects of congenital strabismus, as well as some of its cortical implications –neuroelectric, neurometabolic and morphometric. The illustrations are meant to make this interesting and scarcely-explored topic more accessible. Chapter 11 - Within the field of cognitive neuroscience, brain mapping strategies aim to localize neurological function within specific regions of the human brain. The burgeoning fields of functional magnetic resonance imaging (fMRI) and functional electrophysiology seek to map the human brain with ever-improving resolution. However, these functional strategies do not enable real-time, intraoperative discrimination of functional and nonfunctional brain parenchyma with precise, well-defined margins, as are necessary for surgical guidance and resection. To address the need for an intraoperative brain mapping strategy aimed specifically at neurosurgical guidance at resection, we have developed a novel brain mapping technique that we term preoperative endovascular brain mapping (PEBM). PEBM combines a super-selective, intraarterial approach with the delivery of visually detectable contrast agents to identify specific regions of functional and non-functional brain before and during craniotomy for brain resections. Our novel approach aims to avoid additional postoperative neurological deficits which would occur if functional brain parenchyma is inadvertently injured during an aggressive resection. Endovascular brain mapping aims to preserve brain function by providing a means of direct volumetric surgical guidance in realtime, whereby non-functional tissues are delineated by sharp, visible margins and can therefore be safely resected. The successful implementation of PEBM is highly dependent upon the proper selection and use of imaging probes, and we have developed a number of novel multimodal chemistries specifically aimed at PEBM. In this chapter, we will describe the PEBM technique in detail by highlighting its use in various small animal models, as well as our ongoing development of novel imaging probes suitable for PEBM. Chapter 12 - The investigation of techniques for neuroprotection plays a key role in brain research which involves finding a protective method for acute or chronic destruction of brain tissue. These methods are aimed either toward the necrotic pathway or the apoptotic one. The ability of acetylsalicylic acid (aspirin) to alleviate both destructive pathways is increasingly being recognized, as well as there being indirect evidence for its effective use in the attenuation of severity of neurologic diseases. The relation between the neuroprotective effects and the dosage of aspirin are not yet in agreement. The rationale of action appears to be aspirin’s direct and indirect specific effect on the nuclear factor Kappa β (NF Kappa-). Other targets of aspirin activity are the mitogen activated protein kinase (MAPK), the nitro oxide synthase (NOS) and the adenosine triphosphate (ATP). The protective effect of aspirin was studied in hypoxic damage, cerebral infarction, degenerative brain disease and epilepsy. An aspirin-induced apoptotic phenomenon was documented in gastric colon, lung and cervical cancer. Evidence of the same mechanism was shown also in brain malignant glioblastoma cells. The antiapoptotic and antitumoral effects are mediated by the Bcl-2 and

Preface

xiii

caspase-3 pathways, as well as the mitochondrial permeability transfer mechanism. The proand anti-apoptotic mechanisms studied in regards to brain ischemic events are still unresolved issues. However, data from direct and indirect in vitro and in vivo studies, as well as epidemiological studies, lead to the assumption that aspirin probably does have an in vivo protective effect in humans. The promising data from these experimental studies bode well for an optimistic view for the possibility of aspirin’s therapeutic use as a neuroprotective agent in human diseases of the central nervous system. Chapter 13 - Background and purpose: While EEG features of the maturation level and behavioral states are visually well distinguishable in fullterm newborns, the topographic differentiation of the EEG activity is mostly unclear in this age. The aim of the study was to find out wether the applied method of automatic analysis is capable of descerning topographic particulaities of the neonatal EEG. A quantitative description of the EEG signal can contribute to objective assessment of the functional condition of a neonatal brain and to rafinement of diagnostics of cerebral dysfunctions manifesting itself as “dysrhytmia”, “dysmaturity” or “disorganization”. Subjects and methods: We examined polygraphically 21 healthy, full-term newborns during sleep. From each EEG record, two five-minute samples were subject to off-line analysis and were described by 13 variables: spectral measures and features describing shape and variability of the signal. The data from individual infants were averaged and the number of variables was reduced by factor analysis. Results: All factors identified by factor analysis were statistically significantly influenced by the location of derivation. A large number of statistically significant differences was also found when comparing the data describing the activities from different regions of the same hemisphere. The data from the posterior-medial regions differed significantly from the other studied regions: They exhibited higher values of spectral features and notably higher variability. When comparing data from homotopic regions of the opposite hemispheres, we only established significant differences between the activities of the anterior-medial regions: The values of spectral features were higher on the right than on the left side. The activities from other homotopic regions did not differ significantly. Conclusion: The applied method of automatic analysis is capable of discerning differences in the sleep EEG activities from the individual regions of the neonatal brain. Significance: The capability of the used method to discriminate regional differences of the neonatal EEG represents a promise for their application in clinical practice. Chapter 14 - Background: Despite repeated demonstrations of asymmetries in several brain functions, the biological bases of such asymmetries have remained obscure The objective of study was to investigate development of lateralized facial and eye movements evoked by hemispheric stimulation in right-handed and left-handed children. Methods: Fifty children were tested according to handedness by four tests: I. Monosyllabic non-sense words, II. Tri-syllabic sense words, III. Visual field occlusion by black wall, and presentation of geometric objects to both hands separatelly, IV. Left eye and the temporal half visual field of the right eye occlusion with special goggles, afterwards asking children to assemble a three-piece puzzle; same tasks were performed contralaterally. Results: Right-handed children showed higher percentage of eye movements to right side when stimulated by tri-syllabic words, while left-handed children shown higher percentages of eyes movements to left side when stimulated by tri-syllabic words. Left-handed children spent more time in recognizing mono-syllabic words. Hand laterality correlated with tri-

xiv

Diane E. Spinelle

syllabic word recognition performance. Age contributed to laterality development in nearly all cases, except in second test. Conclusions: Eye and facial movements were found to be related to left- and right-hand preference and specialization for language development, as well as visual, haptic perception and recognition in an age-dependent fashion in a very complex process. Chapter 15 - Within- and between-session environmental habituation were examined in infant rats on postnatal days 14 and 15 in an open field. Using a computerized animal tracking system, rats showed decreases in the total distance traveled (m) and overall average speed (m/s) across 6 30-sec time blocks each day and from day 1 to day 2 of testing. Although the literature is inconclusive regarding the ontogeny of environmental habituation, these results provide clear evidence of both within-session and between-session habituation. On postnatal day 16, animals were returned to the open field with 2 identical objects for novel object recognition training. Animals were either tested immediately after training or were given a subcutaneous injection of saline or .01 mg/kg of epinephrine, followed by testing 2-hrs later. For testing animals were placed into the open field with one familiar and one novel object and the number of object explorations and the time spent exploring each object were recorded by the animal tracking system. From these measures the absolute mean preference for novelty and relative percent preference for novelty were computed. Only the relative percent preference for novelty based on the time spent exploring each object revealed significant differences among the groups. Post-hoc pair-wise comparisons indicated that saline animals tested 2-hrs after training performed significantly worse than epinephrine animals and worse than those tested immediately after training. This indicates a rapid rate of forgetting for object recognition memory which is effectively attenuated with post-training epinephrine. Versions of these chapters were also published in Brain Research Journal Volume 1, Numbers 1-4, edited by Frank Columbus, published by Nova Science Publishers, Inc. They were submitted for appropriate modifications in an effort to encourage wider dissemination of research.

In: Brain Mapping and Diseases Ed: Diane E. Spinelle

ISBN: 978-1-61122-065-0 © 2011 Nova Science Publishers, Inc.

Chapter 1

HALLMARKS OF APOPTOTIC-LIKE CELL DEATH IN RESPONSE TO HYPOXIC INJURY IN VARIOUS DEVELOPMENTAL MODELS ARE CLOSELY RELATED TO BRAIN IMMATURITY Jean-Luc Daval1,∗ and Christiane Charriaut-Marlangue2 1

INSERM U.724, Université Henri Poincaré, Faculté de Médecine, 9 avenue de la Forêt de Haye, F-54500 Vandoeuvre-lès-Nancy, France; 2 Groupe Hypoxie et Ischémie du Cerveau en Développement, Université Pierre et Marie Curie-Paris6, UMR-CNRS 7102, 9 quai St-Bernard, Paris, F-75005 France.

ABSTRACT With regard to the specificity of the developing brain, a better understanding of cellular mechanisms involved in perinatal hypoxic-ischemic injury would help to prevent neurological impairments. We therefore examined temporal features of brain injury in three different developmental models of oxygen deprivation capable of inducing apoptotic cell death. Nuclear staining by DAPI (4,6-diamidino-2-phenylindole) was used to identify healthy, apoptotic and necrotic nuclei as well as for cell counting in cultures and brain sections. DNA fragmentation was monitored by in situ terminal dUTP nick end labeling (TUNEL) and electrophoresis on agarose gels. Also, the expression profile of apoptosis-related proteins Bax and Bcl-2 was studied by immunohistochemistry. In all cases, oxygen deprivation induced significant delayed cell death with morphological features of apoptosis and a progressive increase in the Bax/Bcl-2 protein ratio, except in the penumbra of the ischemic infarct where Bcl-2 remained predominant. As in the control newborn brain that still exhibited physiological death, hypoxia-associated DNA breakdown led to small fragments of ~200 bp in the cortex of hypoxic rat pups. Ladder pattern and TUNEL-positive cells exhibiting apoptotic bodies were only present in the ∗

Correspondence concerning this article should be addressed to Dr. Jean-Luc Daval, INSERM U.724, Université Henri Poincaré, Faculté de Médecine, 9 avenue de la Forêt de Haye, F-54500 Vandoeuvre-lèsNancy, France. E-mail: [email protected].

2

Jean-Luc Daval and Christiane Charriaut-Marlangue penumbra of 7 day-old ischemic rats. These data indicate that hallmarks of hypoxiainduced apoptosis may vary according to brain maturity, possibly through specific nuclease activities. While retaining a part of the developmental death program, the newborn brain seems to be prone to an apoptotic-like response that resembles physiological programmed death.

INTRODUCTION Apoptosis is considered as the ubiquitous form of naturally occurring cell death that plays a fundamental role in brain development, as about half of the cells in the immature brain are eliminated by apoptosis (Oppenheim, 1991). This physiological process needs the activation of an intrinsic ‘death program’ requiring time and energy (Richter et al., 1996) as well as gene transcription and translation (Pittman et al., 1993). Indeed, the apoptotic cascade involves the participation of ‘killer’ proteins (e.g., Bax) generally present constitutively in the cell but normally repressed by their survival counterparts (e.g., Bcl-2). Morphologically, apoptosis is typified by cell shrinkage, chromatin condensation and subsequent nucleus fragmentation, with a specific pattern of DNA breakdown leading usually to multiple segments of approximately 200 bp in length. By contrast, the second form of cell death, namely necrosis, which has been implicated in cell destruction consecutive to severe trauma, induces cellular swelling, membrane disruption with leakage of cell contents to the extracellular space, and leads to random DNA degradation (Wyllie, 1981). In response to a variety of insults, all cells seem to be able to undergo apoptosis but there is compelling evidence to suggest that developing brain cells are more prone to programmed death by retaining a part of the developmental cell death program (Blaschke et al., 1996; Sidhu et al., 1997). Perinatal hypoxic-ischemic injury remains a major cause of mortality and cerebral morbidity, susceptible to generate permanent neurological sequelae (Volpe, 1987; Berger and Garnier, 1999). Whereas necrotic cell damage was first considered prevalent in response to hypoxia-ischemia, the participation of apoptosis has been largely documented, including in the developing brain (Beilharz et al., 1995; Charriaut-Marlangue et al., 1996; Bossenmeyer et al., 1998, Bossenmeyer-Pourié et al., 2002; Daval et al., 2004). In addition, some studies suggest an apoptotic-necrotic continuum in the consequences of acute cerebral ischemia (Nakajima et al., 2000; Benchoua et al., 2001). Since the developing brain displays specific properties and sensitivity to oxygen supply (Grafe, 1994), hallmarks of cell injury may thus vary according to brain maturity, and the present study was designed to gain a better understanding of the cellular mechanisms triggered by a severe hypoxic insult at various ages of the perinatal period. For this purpose, we compared hypoxia-associated features of cell death in three different developmental models of oxygen deprivation capable of inducing brain apoptosis, i.e. in cultured neurons from the embryonic rat forebrain exposed to 95% N2/5% CO2 (Bossenmeyer et al., 1998), in the rat neonate exposed to 100% N2, a model corresponding to birth asphyxia (Grojean et al., 2003), and in the 7-day-old rat pup subjected to transient unilateral focal ischemia followed by reperfusion (Renolleau et al., 1998). In contrast, exposure to 100% N2 in 7 day-old rat induced mainly necrosis and did not enter this study (JLD, unpublished results).

Hallmarks of Apoptotic-Like Cell Death in Response to Hypoxic Injury…

3

EXPERIMENTAL PROCEDURES Animals Experiments were conducted in respect to the French (Statement N° 04223) and European Community guidelines for the care and use of experimental animals. SpragueDawley female rats (R. Janvier, Le Genest-St-Isle, France) in the proestrus period, as shown by daily vaginal smears, were housed together with males for 24 h, and then maintained during gestation in separate cages under standard laboratory conditions on a 12:12 h light/dark cycle (lights on at 6:00 a.m.) with food and water available ad libitum.

Hypoxia in Neuronal Cell Cultures Primary cultured neurons were obtained from the embryonic rat brain as previously described (Bossenmeyer et al., 1998; Chihab et al., 1998; Bossenmeyer-Pourié et al., 1999a; Grojean et al., 2000). Forebrains of 14-day-old embryos were carefully collected, dissected free of meninges and dispersed in culture medium consisting of a mixture of Dulbecco's modified Eagle's medium (DMEM) and Ham's F12 medium (50:50, ICN Pharmaceuticals, Costa Mesa, CA) supplemented with 5% inactivated fetal calf serum (Valbiotech, Paris, France). After centrifugation at 700 g for 10 min, the pellet was dispersed in the same medium and passed through a 46 µm-pore size nylon mesh. Aliquots of the cell suspension were transferred into 35 mm Petri dishes (Falcon, Becton Dickinson, Le Pont-de-Claix, France) precoated with poly-L-lysine in order to obtain a final density of 106 cells/dish. Cultures were then placed at 37°C in a humidified atmosphere of 95% air/5% CO2. The following day, the culture medium was replaced with a fresh hormonally defined serum-free medium corresponding to the DMEM/Ham's F12 mixture enriched with human transferrin (1 mM), bovine insulin (1 mM), putrescine (0.1 mM), progesterone (10 nM), estradiol (1 pM), Na selenite (30 nM), and also containing fibroblast growth factor (2 ng/ml) and epidermal growth factor (10 ng/ml) (Sigma Chemicals, St Louis, MO). Two days later, the culture medium was renewed with serum-free medium in the absence of growth factors. After 6 days in vitro, neuronal cells were exposed to hypoxia for 6 h by transferring culture dishes to a humidified incubation chamber thermoregulated at 37°C and filled with 95% N2/5% CO2. Cultures were then returned to normoxic atmosphere, at 37°C, whereas control cells were constantly maintained under standard conditions. When used, 1 µM cycloheximide (CHX, Sigma Chemicals) was added to the culture medium prior to hypoxia and removed by changing the medium as soon as reoxygenation began. Cells were studied as a function of time until 96 h post-reoxygenation to assess the effects of hypoxia.

In Vivo Birth Hypoxia Between 8 to 24 h after delivery, the litter size was reduced to 10 pups for homogeneity, and 5 neonates were placed for 20 min in a thermostated plexiglas chamber flushed with 100% N2, whereas the remaining 5 pups were taken as matched controls and exposed to 21% O2/79% N2 for the same time. The rate of gas delivery inside the box was calculated to

4

Jean-Luc Daval and Christiane Charriaut-Marlangue

prevent any overpressure, and was fixed to 3 liters/min. Gas in excess was evacuated through a central lengthwise split on the top of the box. The temperature inside the chamber was adjusted to 36°C to maintain body temperature in the physiological range. Following exposure to gas, all rats were allowed to recover for 20 min in normoxic conditions, and they were then returned to their dams. In these conditions, the final rate of mortality in the hypoxia group was 4%, and surviving animals did not display significant suckling problems. Hypoxic and control rats were finally sacrificed by decapitation at various time intervals between 1 day and 13 days post-exposure. Their brains were rapidly collected and immediately frozen in methylbutane previously chilled to -30°C, and stored at -80°C in plastic bags until used. Thereafter, the brains were coated with embedding medium (4% carboxymethylcellulose in water), and cut at -20°C in a cryostat (Reichert Jung, Frigocut 2800, Les Ulis, France) to generate 5-µm coronal sections at the level of the rostral hippocampus, according to the developing rat brain atlas of Sherwood and Timiras (1970), and tissue sections were mounted onto glass slides for subsequent analyses.

In Vivo 7-Day Ischemia Ischemia was performed in 7 day-old rats (17-21 g) of both sexes, as previously described (Renolleau et al., 1998). Rat pups were anaesthetized with intraperitoneal injection of chloral hydrate (300 mg/kg). After 15 min, rats were positioned on their back and a median incision was made in the neck to expose left common carotid artery. Rats were then placed on the right side and an oblique skin incision was made between the ear and the eye. After excision of the temporal muscle, the cranial bone was removed from the frontal suture to a level below the zygomatic arch. Then, the left middle cerebral artery, exposed just after its apparition over the rhinal fissure, was coagulated at the inferior cerebral vein level. After this procedure, a clip was placed to occlude the left common carotid artery and was removed after 1 h. Carotid blood flow restoration was verified with the aid of a binocular loupe. Both neck and cranial skin incisions were then closed. During surgery, body temperature was maintained at 37-38°C. After awake, rat pups were transferred to their mother for time survival at 6, 24 and 48 h and 3 to 5 days after reperfusion.

Evaluation of Cell Damage Cell viability was measured in cultured neurons by the spectrophotometric method using 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT), according to Hansen et al. (1989). Neurons were incubated for 3 h at 37°C with MTT (500 µg/mL, Sigma Chemicals), washed twice with ice-cold phosphate-buffered saline (PBS), and lysed in dimethyl sulfoxide (DMSO) which solubilizes the residual formazan salt for subsequent quantification. Optical density was measured at 519 nm and data were compared to those obtained from sister control cells to which 100% viability was assigned. In vivo cell counts were performed to determine the percentage of damaged neurons in cerebral cortex. For this purpose, brain sections were fixed for 10 min in a mixture of ethanol:acetic acid (3:1), washed for 30 seconds in distilled water, air-dried, and then stained for 10 min with the fluorescent dye 4,6-diamidino-2-phenylindole (DAPI, Sigma Chemicals)

Hallmarks of Apoptotic-Like Cell Death in Response to Hypoxic Injury…

5

in phosphate-buffered saline (0.5 µg/ml) (Wolvetang et al., 1994). Sections were washed twice with distilled water, air-dried, and treated with anti-fading medium (10 mg/ml pphenyldiamine in 90% glycerol, pH 9.0). The number of cell nuclei which were labeled by DAPI was scored at an excitation wavelength of 365 nm under fluorescence microscopy (Zeiss Axioscop, Strasbourg, France). Cell density was measured in the infragranular part of the parietal cortex (layers III-V) at a 40 x magnification in at least 3 separate experiments by counting cells in 3 distinct section areas delineated by an ocular grid of 1/400 mm2. For each selected field, only cells with their nuclei present in the focal plane were counted. Numbers of cells were calculated per mm2 and finally reported as percentages of change from matched controls.

Monitoring of Apoptosis and Necrosis Morphological hallmarks of apoptosis and necrosis were analyzed both in cultured neurons and tissue sections after nuclear labeling by DAPI, as previously documented (Bossenmeyer et al., 1998; Chihab et al., 1998; Bossenmeyer-Pourié et al., 1999b; Grojean et al., 2000; Park et al., 1997). Indeed, it has been demonstrated that healthy cells exhibit intact round-shaped nuclei with diffuse fluorescence, indicative of homogeneous chromatin. Necrotic cells are characterized by highly refringent smaller nuclei with uniformly dispersed chromatin, while condensation and fragmentation of chromatin lead to typically shrunken nuclei in apoptotic cells, along with apoptotic bodies. Characteristic nuclei were scored under fluorescence microscopy (Zeiss Axioscop, Strasbourg, France) at an excitation wavelength of 365 nm in at least 3 separate experiments by counting concerned cells in at least 3 distinct areas of 100 cells.

Electrophoretic Detection of DNA Fragmentation At 48 h and 96 h post-reoxygenation, hypoxic and control cultured neurons were washed twice with PBS, scraped off in 2 ml PBS, and the contents of 5 dishes were pooled to be centrifuged for 5 min at 700 g. Following in vivo birth hypoxia or ischemia, rat pups were sacrificed at various time intervals and the brains were rapidly removed, dissected on a cold plate and stored at -80° C. Cell pellets or tissue samples from separate brains were processed for DNA isolation according to Laird et al. (1991).They were gently homogenized and lysed in 0.5 ml of lysis buffer (100 mM tris-HCl at pH 8.5, 5 mM EDTA, 0.2% sodium dodecyl sulfate (SDS), and 200 mM NaCl) containing 100 µg/ml proteinase K. After 16 h incubation at 55°C, DNA was precipitated by adding one volume isopropanol with continuous agitation for 15 min at room temperature. Following centrifugation at 13000 g for 5 min the pellet was air dried and dissolved in TE buffer (several hours), treated with RNAse A (20 µg/ml) for 2 h at 37°C and DNA content determined spectrophotometrically. DNA (10 µg/lane) was electrophoresed on a 1% agarose gel in 100 mM tris borate (60 V for 4 h) in the presence of 0.3 mg/ml ethidium bromide and visualized with UV illumination.

6

Jean-Luc Daval and Christiane Charriaut-Marlangue

Detection of DNA Breaks by Nick End-Labeling Sections were processed for DNA strand breaks (TUNEL assay) using the in situ Cell Death Detection Kit, Fluorescein (Roche, Meylan, France) according to the manufacturer’s instructions. TUNEL assay reveals apoptosis and necrosis as previously reported (CharriautMarlangue and Ben-Ari, 1995).

Bax and Bcl-2 Immunohistochemistry The expression of the two prototypic apoptosis-related proteins Bax and Bcl-2 was analyzed in cultured neurons and rat brain coronal sections. In vitro neuronal cells were rinsed twice with PBS, then fixed for 10 min in methanol at -10°C, and rinsed again with PBS. Non-specific binding sites for IgG were blocked by incubating the cells for 20 min with 10% horse serum (Gibco-BRL, Inchinnan, U.K.) in PBS. Thereafter, cultures were incubated for 60 min at room temperature in buffer containing the primary antibody., i.e. a rabbit polyclonal antibody against Bax (N-20, Santa Cruz, Tebu, France) diluted at 1/20 or a goat polyclonal antibody against Bcl-2 (N-19, Santa Cruz) diluted at 1/40. Following two washing steps to remove unfixed antibody, the cells were incubated for 120 min in the presence of a second-step antibody corresponding to either an anti-rabbit IgG conjugated to indocarbocyanine (Cy3, dilution 1/80) or an anti-goat IgG conjugated to rhodamine (TRITC, dilution1/100), both from Jackson ImmunoResearch Laboratories (West Grove, PA). Cultured cells were finally washed 3 times with PBS, coverslipped using mounting medium (Aquapolymount), and kept in the dark until fluorescence analysis by means of a Zeiss Axioscop microscope. For quantitative analysis, cell fluorescence activity was computerized from microphotographs, and mean intensity was calculated by using Adobe Photoshop® software and expressed as arbitrary units of mean emission per 1 000 pixels (Bossenmeyer-Pourié et al., 2002; Bossenmeyer-Pourié and Daval, 1998). The results were finally reported as Bax/Bcl-2 protein ratios as a function of time after reoxygenation as well as in normoxic control cultures processed in parallel. Both proteins were also analyzed in rat brain coronal sections of 7 µm-thickness previously fixed by incubating the slides for 10 min at 4°C in acetic acid:ethanol (1:3) in the presence of 30% hydrogen peroxide. In these conditions, brain sections were incubated at 4°C for 48 h with the primary antibody against Bax (dilution 1/20) or Bcl-2 (dilution 1/30), and secondary antibodies were used at 1/50 and 1/100, respectively, for subsequent measurements as described above. In the case of coronal sections from 7 day-old ischemic pups, Bax and Bcl-2 immunoreactivity was visualized by the avidin-biotin peroxidase (Elite ABC kit, Vecstastain, Vector, AbCys, France). The peroxidase activity was evidenced with the use of 3,3'-diaminobenzidin (DAB) and 0.02 % hydrogen peroxide. The counting of Bax- and Bcl-2 positive cells within the core and penumbra was performed in 3-5 sections (at the level of the anterior commissure) using a x40 objective, and results were reported as indicated above.

Hallmarks of Apoptotic-Like Cell Death in Response to Hypoxic Injury…

7

RESULTS Hypoxia in Neuronal Cell Cultures As illustrated in Table 1, a hypoxic episode in cultured neurons from the embryonic rat brain induced delayed cell death inasmuch as cell viability was not yet different from controls at 48 h post-reoxygenation. Thereafter, the number of living cells gradually decreased to reach 64% from controls at 96 h. At this experimental time point, a significant number of cell nuclei stained by the fluorescent dye DAPI exhibited characteristic apoptosis-related morphological features, such as condensed chromatin, whereas the presence of apoptotic bodies could be seen. Necrotic cells were also depicted, but the percentage of apoptotic nuclei increased more markedly, as revealed by cell counts. Moreover, a concomitant treatment with cycloheximide, a potent inhibitor of protein synthesis, had beneficial effects. In the presence of CHX, cell viability was not significantly affected and the number of apoptotic nuclei remained within control values (Table 1), suggesting that hypoxia triggers a programmed death process in cultured neurons. When DNA fragmentation was monitored on agarose gel, no significant degradation was observed at 48 h, in good agreement with viability and morphology data, whereas DNA fragmentation was shown at 96 h after the hypoxic insult (Figure 1). However, DNA alteration was only reflected by a smear, without visualization of a ‘ladder pattern’. Finally, immunohistochemical studies revealed detectable baseline values of the prototypic apoptosis-related proteins Bcl-2 and Bax. Following exposure to hypoxia, expression of the survival Bcl-2 protein transiently increased above control values at 48 h post-insult without apparent change in Bax expression, leading to a significantly reduced Bax/Bcl-2 ratio (Figure 2). At 96 h, Bcl-2 levels abruptly declined, while the expression of Bax was markedly stimulated, resulting in a robust increase of the final Bax/Bcl-2 ratio (Figure 2). Table 1. Effects of a 6-h exposure to hypoxia of cultured rat forebrain neurons on cell viability and nuclear hallmarks of necrosis and apoptosis at 48 h and 96 h postreoxygenation. Influence of cycloheximide.

Controls 48 h + 1 µM CHX Hypoxia 48 h + 1 µM CHX Controls 96 h + 1 µM CHX Hypoxia 96 h + 1 µM CHX

Cell viability (% from controls) 100.0 ± 4.6 90.6 ± 5.3 96.6 ± 4.3 92.0 ± 6.1 100.0 ± 5.8 86.4 ± 6.0* 63.6 ± 6.2** 88.5 ± 5.1*°°

Necrosis (% of total neurons) 4.9 ± 1.2 9.1 ± 2.3* 5.2 ± 1.1 11.0 ± 2.6*°° 5.6 ± 1.5 13.4 ± 2.6** 10.8 ± 2.8** 16.1 ± 3.0**°

Apoptosis (% of total neurons) 1.6 ± 0.6 1.2 ± 0.9 1.9 ± 0.9 1.3 ± 0.8 2.7 ± 0.8 2.8 ± 1.0 21.2 ± 5.7** 3.0 ± 1.2°°

Cell viability as well as rates of necrosis and apoptosis were analyzed as described in the method section. Data are reported as means ± S.D. obtained from 3 separate experiments. Statistically significant differences from controls: *p<0.05 and **p<0.01; Statistically significant differences from hypoxia alone: °p<0.05 and °°p<0.01 (Dunnett's test for multiple comparisons).

8

Jean-Luuc Daval and Christiane C Chaarriaut-Marlanngue

Fiigure 1. Temporal analysis on aggarose gel of DN NA isolated from m control and hyppoxic cultured neurons from thhe embryonic rat forebrain. DNA A was isolated froom cultured cellls at 48 h (H48) and 96 h post-reeoxygenation (H H96) and from matched m controls (C48 and C96). One representattive example is presented p for illuustration, annd similar profilees were obtainedd from 5 separatee experiments. (Size marker: Suuperladder mid 1-500 bp, Euurogentec, Paris, France).

Fiigure 2. Evolutio on of the Bax/Bccl-2 protein ratioo in cultured neuurons exposed to hypoxia for 6 hours and thheir normoxic co ontrols. Immunohhistochemical stuudies were perfoormed at 48 h annd 96 h post-hyppoxia and in m matched controls. Fluorescence acctivity was compputerized by means of Adobe Phhotoshop softwarre, and the prrotein ratio was calculated c at eacch time point. Thhe data representt mean values (± ± S.D.) obtained from 3 seeparate experimeents. Statisticallyy significant diffference from conntrols: ** p<0.011 (Dunnett's test for multiple coomparisons).

In n Vivo Birth h Hypoxia p were subbjected to hyppoxia within 24 h after birrth, no histopathological When rat pups allteration of the t cerebral cortex c could be noticed by b the four ensuing dayss. Then, a prrogressive deccline of the tootal number off cells labeledd by DAPI waas observed inn this brain sttructure, and maximal celll loss was seeen around 6 days post-reeoxygenation (Table 2).

Hallmarks of Apoptotic-Like Cell Death in Response to Hypoxic Injury…

9

Whereas examination of nuclear morphology depicted a significant number of cells exhibiting the characteristic hallmarks of both necrosis and apoptosis during early postnatal life in control animals, birth hypoxia was associated with a gradual elevation of the percentage of affected cells, with a peak observed at 6 days post-reoxygenation. The number of altered nuclei was then shown to decrease during the second week after hypoxia, and only the proportion of necrotic cells remained significantly augmented by comparison with controls at 13 days after the insult (Table 2). Surprisingly, no TUNEL-positive nuclei were detected on coronal sections tested at various time intervals after hypoxia (not shown). As illustrated in Figure 3, where only representative time-points are presented, analysis of DNA on agarose gel revealed similar fragmentation in control and hypoxic rat cortex during the first 3 days following exposure to gas. In these conditions, only one spot could be repeatedly visualized, and the size marker indicated that such fragments corresponded to ~200 bp. Between 5 and 7 days post-exposure, DNA fragmentation was exclusively seen in the cortex of hypoxic rats, with the absence of alteration in controls. Again, hypoxia led to DNA fragments of ~200 bp. At 13 days post-insult, no DNA fragmentation could be observed. Table 2. Temporal evolution of the number of cells and their nuclear morphological features of necrosis and apoptosis in the cerebral cortex of rats exposed to birth hypoxia for 20 min. Time postreoxygenation

Number of total cells (% from controls)

1 day 2 days 3 days 4 days 5 days 6 days 7 days 13 days

98.3 ± 5.7 98.3 ± 1.5 95.6 ± 1.7 86.5 ± 3.6** 80.6 ± 6.2** 77.1 ± 9.2** 78.7 ± 7.1** 78.5 ± 7.3**

Necrosis (%)

Apoptosis (%)

Controls 5.3 ± 0.5 3.2 ± 1.0 1.4 ± 1.2 1.2 ± 0.1 0.8 ± 1.1 2.7 ± 0.8 1.3 ±1.1 3.7 ±0.6

Controls 6.7 ± 1.3 4.3 ± 0.9 2.2 ± 0.8 2.4 ± 0.7 2.0 ± 0.3 3.1 ± 0.1 2.2 ± 0.2 2.9 ± 0.6

Hypoxia 4.8 ± 1.7 2.9 ± 1.0 1.8 ± 1.2 3.6 ± 0.8** 4.7 ± 0.6** 8.7 ± 0.7** 4.3 ± 0.1** 5.6 ± 0.3*

Hypoxia 4.8 ± 1.7 4.7 ± 0.8 2.2 ± 0.6 6.0 ± 0.5** 6.0 ± 0.5** 9.0 ± 0.6** 6.9 ± 0.6** 3.1 ± 0.5

Total number of cells was measured in the cerebral cortex as a function of time after hypoxia by cell counting following nuclear staining by DAPI and is expressed as a percentage from matched controls. Proportions of necrotic and apoptotic nuclei were calculated after DAPI labeling according to morphological hallmarks and are expressed as a percentage of total cells in both control and hypoxic rats. Data were obtained from 3 to 5 separate experiments using animals from different litters, and are given as means ± S.D. Statistically significant differences from controls: *p<0.05 and **p<0.01; Statistically significant differences from hypoxia alone: °p<0.05 and °°p<0.01 (Dunnett's test for multiple comparisons).

100

Jean-Luuc Daval and Christiane C Chaarriaut-Marlanngue

Fiigure 3. Temporal analysis on aggarose gel of DN NA isolated from m the cerebral corrtex of control and a hypoxic raats. Cortical DNA A was isolated at a 1 day (H1), 6 days d (H6) and 133 days (H13) aftter birth hypoxiaa and from m matched controls (C1, C6 and C13). One represenntative example is presented for illustration, andd similar prrofiles were obtaained from 5 sepparate experimennts.

Regarding Bax and Bcl--2, a significannt basal expression of both proteins was detected in thhe cortex of co ontrol animalss of 1-4 days of o age, and theeir levels tendeed to decreasee thereafter. The resulting Bax/Bcl-2 B ratio was globally maintained around 1 duriing the periodd examined Figure 4). Folllowing birth hypoxia, Bcll-2 was transiently overexxpressed at 3 days post(F innsult, and its expression e graadually declinned as a functiion of time, too be reduced by b 38% by coomparison to matched m contrrols at 13 dayys. Bax expression was simiilar to controlss at 3 days, annd then markeedly increasedd in response to t birth hypoxxia, depicting a significant elevation e of thhe Bax/Bcl-2 protein p ratio att the final stagge (Figure 4).

Fiigure 4. Evolutio on of the Bax/Bccl-2 protein ratioo in the cerebral cortex of rats exxposed to birth hypoxia and thheir matched con ntrols. Immunohiistochemical stuudies were perforrmed at 3 days, 6 days and 13 daays posthyypoxia and in co ontrol rat pups. Fluorescence F actiivity was analysed as described in the legend of Figure 2. Thhe data represen nt mean values (± ± S.D.) obtainedd from 3 separatee experiments. Sttatistically significant diifference from co ontrols: ** p<0.001 (Dunnett's tesst for multiple coomparisons).

Hallmarks of Apoptotic-Like Cell Death in Response to Hypoxic Injury…

11

In Vivo 7-Day Ischemia When 7-day old rat pups were subjected to ischemia, a cortical infarct was clearly delineated at 48 h of reperfusion, as previously documented (Renolleau et al., 1998). At this time point of recovery, a decline in the number of cells was recorded. Three zones were depicted, the core of the infarct, penumbra close to the core and distant penumbra in which 13, 34 and 52 % of surviving cells were respectively counted, as compared to the contralateral cortex (Table 3). With DAPI staining and examination of the nuclear morphology, cells exhibiting the characteristic hallmarks of apoptosis were significantly detected in the 2 penumbral zones, whereas nuclei with a necrotic profile were mainly observed in the core of the infarct (Table 3). Similar findings were obtained by the TUNEL assay. Whereas the presence of necrotic nuclei with flocculent chromatin was shown in the core (Figure 5 A, B), all of the TUNEL-positive nuclei in the penumbra demonstrated chromatin condensation and apoptotic body formation (Figure 5 C). Analysis of DNA fragmentation on agarose gel demonstrated DNA laddering in the ipsilateral cortex, which mainly corresponded to penumbral tissue, 5 days after the onset of ischemia, which was not present in the contralateral cortex (Figure 5D). Table 3. Temporal evolution of the number of cells and their nuclear morphological features of necrosis and apoptosis in the cerebral cortex of 7 day-old rats exposed to ischemia and killed at 48 h of reperfusion.

Contralateral cortex Ischemic Core Ischemic Penumbra (a) Ischemic Penumbra (b)

Number of total cells (per 0.01 mm2) 72.0 ± 1.4 12.3 ± 1.1** 31.5 ± 0.7** 48.5 ± 0.7**

Necrosis (% of total cells) 2.1 ± 0.5 82.3 ± 1.9** 6.3 ± 0.3** 4.2 ± 0.1

Apoptosis (% of total cells) 0.7 ± 0.1 13.3 ± 0.5** 58.1 ± 0.2** 30.6 ± 0.5**

Cell density as well as rates of necrosis and apoptosis were analyzed as described in the method section. Data are reported as means ± S.D. obtained from 3 separate experiments. Statistically significant differences from contralateral cortex (control): **p<0.01 (Dunnett's test for multiple comparisons). Penumbra (a) = close to the core; Penumbra (b) = distant from the core.

A basal Bax immunoreactivity was observed in a few cells scattered in the control cortex and in the contralateral side of ischemic brains whereas no Bcl-2-positive cells was detected. Quantification of the number of Bax-positive cells indicated a gradual elevation of their number after reperfusion in the core of the infarct in which a slight number of Bcl-2-positive cells were present. The resulting Bax/Bcl-2 ratio progressively increased between 6 and 24 h and was conspicuous at 48 h of reperfusion (Figure 6) in the core of the infarct. In contrast, Bcl-2-positive cells were still detected in the penumbra (close and distant from the core), leading to a similar Bax/Bcl-2 ratio at 24 h. Cell death in the penumbra began to be effective, as the Bax/Bcl-2 ration increased, at 48 h of recovery (Figure 6).

122

Jean-Luuc Daval and Christiane C Chaarriaut-Marlanngue

Fiigure 5. Typical illustration of DNA D fragmentatiion by the TUNE EL assay and agaarose gel of genoomic DNA from ischemic rat pups. A-C: Nucclei exhibited floocculent chromattin in the core (w white arrows in A and B) annd chromatin con ndensation and apoptotic a bodies in both core (A, B) and penumbbra (C). D: Tempporal annalysis on agarosse gel of DNA issolated from ipsiilateral (i) and coontralateral (c) cortex. c Cortical DNA D was isolated at 48 h (H H48), 4 days (D44) and 5 days (D5) post-ischemiaa and compared to control (C). Note N DNA fragmentation witth formation of a ladder at 5 days post-injury. Onne representativee example is preesented for illlustration, and siimilar profiles were w obtained froom 4 separate exxperiments. Bar represents r 100 (A A) and 20 µm m (B, C).

Fiigure 6. Evolutio on of the Bax/Bccl-2 positive celll ratio in the cereebral cortex of 7-day-old rats expposed to ischemia. Immuno ohistochemical studies s were performed at 6, 24 and 48 h post-ischemia. No Bcl--2 positive ceells and a few (2 to 4) Bax positiive cells have beeen detected in controls. The dataa represent meann values ± S..D. obtained from m 3 separate expperiments.

CONCLUSION N velopment, appoptosis is a crucial c event for f maintaininng the brain homeostasis h During dev annd setting up appropriate a neeuron-target ceell connectionns (Oppenheim m, 1991). In thhe rat brain, thhe physiologiccal death program does not take place exclusively duriing embryogennesis but is allso present during d early postnatal p development. Coonsistently, chharacteristic features f of

Hallmarks of Apoptotic-Like Cell Death in Response to Hypoxic Injury…

13

programmed cell death were observed during the life span of cultured neurons isolated from the forebrain of 14-day-old embryos as well as in the brains of rat pups by the first days of postnatal life. For example, baseline levels of Bax and Bcl-2 proteins were routinely detected in control samples, and higher Bax levels depicted by the first days of postnatal age are indicative of active apoptosis in the rat brain, although other members of the Bcl-2 family may play a critical role (Isenmann et al., 1998; Otter et al., 1998). In good agreement, the numbers of DAPI-labeled nuclei exhibiting morphological features of condensed chromatin were more elevated in the cortex of rats at 1 and 2 days of age. By contrast to the newborn brain, Bcl-2 was not detectable at baseline in the cerebral cortex of 7-day-old rats. Indeed, it is known that the expression of Bcl-2 in rodents is developmentally regulated, with highest levels present in the antenatal brain (Abe-Dohmae et al., 1993) where it would participate to the selection of surviving neurons during the period of physiological death. Finally, when DNA fragmentation was monitored by electrophoresis, significant amounts of small fragments corresponding to ~200 bp were repeatedly observed, in the absence of typical ladder pattern, in the cortex of control rats until 3 days of age, before to disappear in older animals. According to our criteria, necrotic cells were also detected in cultured neurons and even in the cortex of rat pups in the early postnatal period. It is known, however, that necrosis may appear as an ultimate feature of apoptosis (Nakajima et al., 2000; Benchoua et al., 2001), especially in culture condition where dying cells are not submitted to active phagocytosis (Bonfoco et al., 1995). All the above observations confirm the high propensity of developing brain cells to undergo apoptosis. The participation of apoptotic-like cell death has been widely described in various pathological states, including in post-mitotic neurons (see Sastry and Rao, 2000 for review). Exposure to hypoxia elicited delayed cell death in the three models examined. Programmed death was confirmed by the beneficial effects of cycloheximide in cultured neurons, as previously documented (Bossenmeyer et al., 1998; Papas et al., 1992), and was shown to require activation of caspases, especially caspase-3 in the various models (BossenmeyerPourié et al., 1999; 2000; Grojean et al., 2003; Benjelloun et al., 2003). Also, apoptotic death is known to be associated with an elevated Bax/Bcl-2 ratio within the cells (Otter et al., 1998). In this respect, Bcl-2 was transiently predominant at 48 h post-insult in cultured neurons. Then, Bcl-2 level decreased, in parallel with a substantial stimulation of Bax expression. By the same time, the presence of typically shrunken nuclei and a reduced number of viable cells were recorded. Such a temporal profile of protein expression was also depicted in the cortex of the asphyxiated newborn rat as well as in the core of the infarct following ischemia in the 7-day-old rat, and these findings are consistent with the view of an apoptotic-necrotic continuum in response to severe neuronal injury (Martin, 2001). In the penumbral area, a long-lasting stimulation of Bcl-2 was recorded, probably due to more effective homeostatic mechanisms and higher availability of energy compared to the core of the infarct where necrosis developed more rapidly. In the present study, DAPI staining, TUNEL assay and gel electrophoresis of extracted DNA were used to investigate alterations of nuclear DNA in response to hypoxia. Although chromatin condensation and formation of apoptotic bodies were visualized by DAPI in all cases, DNA fragmentation was demonstrated by the TUNEL assay following ischemia in 7 day-old rat pups but not after birth hypoxia. Similarly, DNA laddering was found in the former model but not in the latter, except fragments of ~200 bp. These results suggest that DNA fragmentation occurred in a different manner, probably dependent on the age of injured

14

Jean-Luc Daval and Christiane Charriaut-Marlangue

animals. DNA digestion at internucleosomal linker regions was recognized in 1980 as a characteristic feature of apoptosis, resulting in small double-stranded fragments of DNA that migrate in a ladder pattern (Wyllie, 1980). The fragmentation of ladder type has been attributed to the activities of Ca2+/Mg2+-activated endonucleases (Kyprianou et al., 1988), DNAse I (Arends et al., 1990) or DNAse II (Barry ane Eastmann, 1993). However, less extensive digestion of DNA to sizes of 50 and 300 kbp, corresponding to the loop and rosette structures of higher-order chromatin, occurs in several examples of apoptosis without or prior to processing to oligonucleosome-sized fragments and can be recognized by fractionation of genomic DNA on pulse field gel electrophoresis (Walker et al., 1991; Brown et al., 1993; Oberhammer at al., 1993). Such high molecular weight fragments have been shown following ischemia in the P7 rat pup as early as 4 h of recovery (Charriaut-Marlangue et al., 1999). They appeared prior to the detection of TUNEL-positive nuclei and DNA laddering, and have been previously reported in the brain of P7 rat subjected to the Rice model of hypoxiaischemia (Hou et al., 1997). Taken together, our results suggest that birth hypoxia may induce high molecular weight DNA fragments which cannot be detected on agarose gels, and 200 bp fragments were probably the result of an endogenous exonuclease activity. When neuronal cultures were submitted to hypoxia, a DNA smear was observed on agarose gels. Consistently, serum deprivation of PC12 cells was reported to induce apoptosis along with a DNA degradation as a smear which was prevented by aurintricarboxylic acid, an endonuclease inhibitor (Dessi et al., 1993). Furthermore, there is at least one in vitro example of apoptotic death in which DNA digestion is not detectable by sensitive methods, consistent with experimental evidence that nuclear events may not be required for apoptosis (Ucker et al., 1992). Finally, it is noteworthy that no DNA degradation could be seen at 13 days after birth asphyxia, along with the lack of apoptotic nuclei as depicted by DAPI staining. Such observations suggest the possibility of repair processes, in line with the remarkable plasticity of the juvenile brain. In conclusion, oxygen deprivation triggered delayed cell death that mainly corresponds to apoptosis, according to morphological and biochemical criteria, in the three experimental models investigated in the present study. The consequences of hypoxia in cultured neurons, which were shown to be dependent upon protein neosynthesis, are comparable to those observed in the newborn rat brain, these two models being theorically matched with regard to their developmental stages (Dichter, 1978). Furthermore, we have shown that when it was monitored by 4-6 days post-reoxygenation, DNA fragmentation elicited by birth asphyxia exhibited the same characteristics as DNA fragmentation consecutive to naturally occurring cell death in the newborn brain (i.e., TUNEL-negative in situ and leading solely to small fragments of approximately 200 bp on agarose gels). Conversely, hypoxia-ischemia in the 7day-old rat induced apototic cell death in the penumbra with characteristics closer to those reported in the adult brain, but with reduced level of necrosis compared to the adult (Li et al., 1998). Therefore, our results suggest that a shift may occur in the rat brain by the end of the first week of postnatal age with respect to the hallmarks of apoptotic-like cell injury in response to hypoxia, with brain manifestations in the neonate mainly corresponding to the developmental death pattern. These findings might account, at least partly, for the relative resistance of the immature brain to hypoxic insults.

Hallmarks of Apoptotic-Like Cell Death in Response to Hypoxic Injury…

15

REFERENCES Abe-Dohmae, S., Harada, N., Yamada, K., Tanaka, R. Bcl-2 gene is highly expressed during neurogenesis in the central nervous system. Biochem Biophys Res Commun, 1993, 191, 915-921. Arends, M.J., Morris, R.G., Wyllie, A.H. Apoptosis. The role of the endonuclease. Am J Pathol, 1990, 136, 593-608. Barry, M.A. and Eastmann, A. Identification of deoxyribonuclease II as an endonuclease involved in apoptosis. Arch Biochem Biophys, 1993, 300, 440-450. Beilharz, E.J., Williams, C.E., Dragunow, M., Sirimanne, E.S., Gluckman, P.D. Mechanisms of delayed cell death following hypoxic-ischemic injury in the immature rat: evidence for apoptosis during selective neuronal loss. Mol Brain Res, 1995, 29, 1-14. Berger, R., and Garnier, Y. Pathophysiology of perinatal brain damage. Brain Res Rev, 1999, 30, 107-134. Benchoua, A., Guégan, C., Couriaud, C., Hosseini, H., Sampaïo, N., Morin, D., Onténiente, B. Specific caspase pathways are activated in the two stages of cerebral infarction. J Neurosci, 2001, 21, 7127-7134. Benjelloun, N., Joly, L.M., Palmier, B., Plotkine, M., Charriaut-Marlangue, C. Apoptotic mitochondrial pathway in neuron and astrocyte after neonatal hypoxia-ischemia in the rat brain. Neuropathol & Applied Neurobiol, 2003, 29, 350-360. Blaschke, A.J., Staley, K., Chun, J. Widespread programmed cell death in proliferative and postmitotic regions of the fetal cerebral cortex. Development, 1996, 122, 1165-1174. Bonfoco, E., Kraine, D., Ankarcrona, M., Nicotera, P., Lipton, S.A. Apoptosis and necrosis: two distinct events induced, respectively, by mild and intense insults with N-methyl-Daspartate or nitric oxide/superoxide in cortical cell cultures. Proc Natl Acad Sci (USA), 1995, 92, 7162-7166. Bossenmeyer, C., Chihab, R., Muller, S., Schroeder, H., Daval, J.L. Hypoxia/reoxygenation induces apoptosis through biphasic induction of protein synthesis in central neurons. Brain Res, 1998, 787, 107-116. Bossenmeyer-Pourié C., Daval, J.L. Prevention from hypoxia-induced apoptosis by preconditioning: a mechanistic approach in cultured neurons from fetal rat forebrain. Mol Brain Res, 1998, 58, 237-239. Bossenmeyer-Pourié, C., Chihab, R., Schroeder, H., Daval, J.L. Transient hypoxia may lead to neuronal proliferation in the developing mammalian brain: from apoptosis to cell cycle completion. Neuroscience, 1999a, 91, 221-231. Bossenmeyer-Pourié, C., Koziel, V., Daval, J.L. CPP32/CASPASE-3-like proteases in hypoxia-induced apoptosis in developing brain neurons, Mol. Brain Res, 1999b 71, 225237. Bossenmeyer-Pourié, C., Koziel, V., Daval, J.L. Involvement of caspase-1 proteases in hypoxic brain injury. Effects of their inhibitors in developing neurons, Neuroscience, 2000, 95, 1157-1165. Bossenmeyer-Pourié, C., Lièvre V, Grojean S, Koziel, V., Pillot T., Daval, J.L. Sequential expression patterns of apoptosis- and cell cycle-related proteins in neuronal response to severe or mild transient hypoxia. Neuroscience, 2002, 114, 869-882.

16

Jean-Luc Daval and Christiane Charriaut-Marlangue

Brown, D., Sun, X., Cohen, G. Dexamethasone-induced apoptosis involves cleavage of DNA to large fragments prior to internucleosomal fragmentation. J Biol Chem, 1993, 268, 3037-3039. Charriaut-Marlangue, C., Ben-Ari, Y. A cautionary note on the use of TUNEL stain to describe apoptosis, NeuroReport, 1995, 7, 61-64. Charriaut-Marlangue, C., Aggoun-Zouaoui, D., Represa, A., Ben-Ari, Y. Apoptotic features in ischemia, epilepsy and gp 120 toxicity. Trends in Neurosci, 1996, 19, 109-114. Charriaut-Marlangue, C., Richard, E., Ben-Ari, Y. DNA damage and DNA damage-inducible protein Gadd45 following ischemia in the P7 neonatal rat. Dev Brain Res, 1999, 116, 133-140. Chihab, R., Ferry, C., Koziel, V., Monin, P., Daval, J.L. Sequential activation of activator protein-1-related transcription factors and JNK protein kinases may contribute to apoptotic death induced by transient hypoxia in developing brain neurons. Mol Brain Res, 1998, 63, 105-120. Daval, J.L., Pourié, G., Grojean, S., Lièvre, V., Strazielle, C., Blaise, S., Vert, P. Neonatal hypoxia triggers transient apoptosis followed by neurogenesis in the rat CA1 hippocampus. Pediatr Res, 2004, 55, 561-567. Dessi, F., Charriaut-Marlangue, C., Khrestchatisky, M., Ben-Ari, Y. Glutamate-induced neuronal death is not a programmed cell death in cerebellar culture. J Neurochem, 1993, 60, 1953-1955. Dichter, M.A. Rat cortical neurons in cell culture: culture methods, cell morphology, electrophysiology and synapse formation. Brain Res, 1978, 149, 279-293. Grojean, S., Koziel, V., Vert, P., Daval, J.L. Bilirubin induces apoptosis via activation of NMDA receptors in developing rat brain neurons. Exp Neurol, 2000, 166, 334-341. Grojean, S., Schroeder, H., Pourié, G., Charriaut-Marlangue, C., Koziel, V., Desor, D., Vert, P., Daval, J.L. Histopathological alterations and functional brain deficits after transient hypoxia in the newborn rat pup: a long term follow-up. Neurobiol Dis, 2003, 14, 265278. Grafe MR. Developmental changes in the sensitivity of the neonatal rat brain. Brain Res, 1994, 653,161-166. Hansen, M.B., Nielsen, S.E., Berg, K. Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill. J Immunol Meth, 1989, 119, 203-210. Hou, S., Tu, Y., Buchan, A., Huang, Z., Preston, E., Rasquinha, I., Robertson, G., MacManus, J. Increase in DNA lesions and the DNA damage indicator Gadd45 following transient ischemia. Biochem Cell Biol, 1997, 75,383-392. Isenmann, S., Stoll, G., Schroeter, M., Krajewski, S., Reed, J.C., Bahr, M. Differential regulation of Bax, Bcl-2, and Bcl-X proteins in focal cortical ischemia in the rat. Brain Pathol, 1998, 8, 49-63. Kyprianou, N., English, H.F., Isaacs, J.T. Activation of a Ca2+-Mg2+-dependent endonuclease as an early event in castration-induced prostatic cell death. Prostate, 1988, 13, 103-117. Laird, P., Zijderveld, A., Linders, K., Rudnicki, M., Jaenisch, R., Berns, A. Simplified mammalian DNA isolation procedure. Nucleic Acids Res, 1991, 19, 4293. Li, Y., Powers, C., Jiang, N., Chopp, M. Intact, injured, necrotic and apoptotic cells after focal cerebral ischemia in the rat. J Neurol Sci, 1998, 156, 119-132.

Hallmarks of Apoptotic-Like Cell Death in Response to Hypoxic Injury…

17

Martin, L.J. Neuronal cell death in nervous system development, disease, and injury. Int J Mol Med, 2000, 7, 455-478. Nakajima, W., Ishida, A., Lange, M.S., Gabrielson, K.L., Wilson, M.A., Martin, L.J., Blue, M.E., Johnston, M.V. Apoptosis has a prolonged role in the degeneration after hypoxic ischemia in the newborn rat. J Neurosci, 2000, 20, 7994-8004. Oberhammer, F., Wilson, J., Dive, C., Morris, I., Hickman, J., Wakeling, A., Walker, P., Sikorska, M. Apoptotic death in epithelial cells: cleavage of DNA to 300 and/or 50 kb fragments prior to or in the absence of internucleosomal fragmentation. EMBO J, 1993, 12, 3679-3684 Oppenheim, R.W. Cell death during development of the nervous system. Ann Rev Neurosci, 1991, 14, 453-501. Otter, I., Conus, S., Ravn, U., Rager, M., Olivier, R., Monney, L., Fabbro, D., Borner, C. The binding properties and biological activities of Bcl-2 and Bax in cells exposed to apoptotic stimuli. J Biol Chem, 1998, 273, 6110-6120. Papas, S., Crépel, V., Hasboun, D., Jorquera, I., Chinestra, P., Ben-Ari, Y. Cycloheximide reduces the effects of anoxic insult in vivo and in vitro. Eur J Neurosci, 1992, 4, 758-765. Park, D.S., Morris, E.J., Greene, L.A., Geller, H.M. G1/S cell cycle blockers and inhibitors of cyclin-dependent kinases suppress camptothecin-induced neuronal apoptosis. J Neurosci, 1997, 17, 1256-1270. Pittman, R.N., Wang, S., DiBenedetto, A.J., Mills, J.C. A system for characterizing cellular and molecular events in programmed neuronal cell death. J Neurosci, 1993, 13, 36693680. Renolleau, S., Aggoun-Zouaoui, D., Ben-Ari, Y., Charriaut-Marlangue, C. A model of transient unilateral focal ischemia with reperfusion in the P7 neonatal rat: morphological changes indicative of apoptosis. Stroke, 1998, 29, 1454-1461. Richter C, Schweizer M, Cossarizza A, Franceschi C. Control of apoptosis by the cellular ATP level. FEBS Lett, 1996, 378:107-110. Sastry, P.S., Rao, K.S. Apoptosis and the central nervous system. J Neurochem, 2000, 74, 120. Sherwood, N.M., Timiras, P.S. A stereotaxic atlas of the developing rat brain. Berkeley: University of California Press, 1970 Sidhu RS, Tuor UI, Del Bigio MR. Nuclear condensation and fragmentation following cerebral hypoxia-ischemia occurs more frequently in immature than older rats. Neurosci Lett, 1997, 223, 129-132. Ucker, D., Obermiller, P., Eckhart, W., Apgar, J., Berger, N., Meyers, J. Genome digestion is a dispensable consequence of physiological cell death mediated by cytotoxic T lymphocytes. Mol Cell Biol, 1992, 12, 3060-3069. Volpe, J.J. Neurology of the newborn. In: Volpe J.J. (Ed) Neurology of the Newborn. WB Saunders, Philadelphia, 1987, 236-280. Walker, P., Smith, C., Youdale, T., Leblanc, J., Whitfield, J., Sikorska, M. Topoisomerase IIreactive chemotherapeutic drugs induce apoptosis in thymocytes. Cancer Res, 1991, 51, 1078-1085. Wolvetang, E.J., Johnson, K.L., Krauer, K., Ralph, S.J., Linnane, A.W. Mitochondrial respiratory chain inhibitors induce apoptosis. FEBS Letters, 1994, 339, 40-44.

18

Jean-Luc Daval and Christiane Charriaut-Marlangue

Wyllie, A.H. Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activation. Nature, 1980, 284, 555-556. Wyllie, A.H. Cell death: a new classification separating apoptosis from necrosis. In: Bowen ID, Lockshin RA (eds) Cell Death in Biology and Pathology. London: Chapman and Hall, 1981, 9-34.

In: Brain Mapping and Diseases Ed: Diane E. Spinelle

ISBN: 978-1-61122-065-0 © 2011 Nova Science Publishers, Inc.

Chapter 2

DNA DAMAGE RESPONSE AND APOPTOSIS OF POSTMITOTIC NEURONS Inna I. Kruman1,∗ and Elena I. Schwartz2 1

2

Sun Health Research Institute, 1015 West Santa Fe Drive, Sun City, AZ 85351 Department of Pathology and Oncology, Georgetown University Medical Center, 3900 Reservoir RD NW, Washington, DC 20057

ABSTRACT Programmed cell death or apoptosis is a relevant process in the physiology and pathology of the nervous system. Apoptosis is an organized form of cell death which is triggered by different factors including DNA damage. A growing body of evidence suggests that DNA damage and genomic instability are involved in neuronal abnormalities and may play a central role in neurodegeneration. DNA strand breaks and DNA lesions have been reported in Parkinson's and Alzheimer's diseases and as an early event after reperfusion of ischemic brain. DNA damage has been found to activate a cell death program in terminally differentiated postmitotic neurons. Since the genome is continuously damaged by a variety of endogenous and exogenous agents and the majority of DNA damage is produced by oxyradicals, generated by normal aerobic metabolism, neurons are particularly susceptible to DNA damage due to the high rate of oxidative metabolism. To maintain genomic integrity, cells are equipped with special defense mechanism, DNA damage response, to remove DNA damage by DNA repair pathways or eliminate damaged cells via apoptosis. Generally, differentiated cells, like neurons, are deficient in DNA repair and more vulnerable to DNA damage-initiated apoptosis. For example, neurons are more vulnerable than astrocytes to DNA-damaging conditions such as ionizing radiation. Breast cancer patients receiving hemotherapy commonly experience long-lasting cognitive impairment. It is known that radiotherapy may cause CNS toxicity. DNA damaging agents including γ-irradiation induce neuronal apoptosis in vitro, suggesting the direct adverse effect of these DNA damaging agents on neurons. The ∗

Correspondence concerning this article should be addressed to Correspondence to: Inna Kruman, Ph.D.; Sun Health Research Institute, 1015 West Santa Fe Drive, Sun City, AZ 85351; Tel.: 623-876-5607; FAX 623876-5695; Email: [email protected].

20

Inna I. Kruman and Elena I. Schwartz importance of DNA repair for neuronal survival is illustrated by disorders observed in patients with hereditary DNA repair abnormalities. These disorders combine the predisposition to cancer with progressive neurodegeneration. Although indirect evidence suggests that DNA damage and repair mechanisms play critical roles in neuronal survival, the pathways involved are poorly understood. Recently, we have found that cell cycle activation is essential for DNA damage-induced neuronal apoptosis which suggests that the cell cycle machinery is a critical element of the DNA damage response not only in cycling but also in quiescent cells. Here, we discuss the DNA damage response in postmitotic neurons and possible mechanisms by which neurons are forced to apoptosis versus DNA repair thereby controlling cell fate. Elucidation of these mechanisms promises to provide multiple points of therapeutic intervention in neurodegenerative diseases.

INTRODUCTION Neuronal cell death is both a normal developmental process and the result of trauma or degenerative disorders. During development, a significant portion of neurons dies (Oppenheim, 1991), and this death is a part of normal process leading to appropriate matching of pre- and postsynaptic elements Greene et al., 2004). On the other hand, loss of neurons may be a part of the pathological process. Understanding the mechanisms of neuronal death, thus provides insights about nervous system development and anunderstanding of the pathogenesis of neurodegeneration. Apoptosis is a regulated form of cell death that is often likened to cellular suicide. Unlike necrosis, apoptosis is an active ATP-dependent biochemical process which is regulated through transcriptional, as well as post-translational mechanisms and is not accompanied by inflammation. Apoptotic cells undergo shrinkage, membrane blebbing, chromatin condensation, DNA fragmentation, and cellular disintegration followed by phagocytosis (Wyllie et al., 1980). Many neurons die by apoptosis during early CNS development (Burek and Oppenheim, 1996). In addition, apoptosis contributes to neuronal loss in a number of acute and chronic neurological diseases including stroke, Alzheimer’s disease (AD), and amyotrophic lateral sclerosis (ALS) (Friedlander, 2003; Honig and Rosenberg, 2000; Przedborski and Vila, 2003 and Yuan and Yankner, 2000). In general, neuronal apoptosis in these disorders is thought to be caused by toxic insults such as free-radical generation (Klein and Ackerman, 2003). The intracellular end point of many neurotoxic stimuli including excitotoxicity and exposure to amyloid β peptide (Aβ, an essential feature of Alzheimer's disease) is oxidative stress (Butterfield, 2002 and Lewen et al., 2000). Oxidative stress in the form of increased reactive oxygen species (ROS) appears to be a common apoptotic trigger leading to neurodegeneration (Carri et al., 2003; Klein and Ackerman, 2003). ROS include the superoxide anion, hydrogen peroxide, hydroxyl radical, peroxynitrite and lipid peroxides. ROS are constantly produced within the cell, in particular via mitochondrial oxidative metabolism and pathological processes such as inflammation. ROS are also secondary messengers in specific signaling pathways, generated by plasma membrane oxidases in response to growth factors and cytokines (Mahmoudi et al., 2006); they are and therefore, involved in normal cell signaling. The cell has a number of mechanisms of protection against oxidative damage (Offord et al., 2000), including direct interaction with antioxidants such as α-tocopherol, ascorbic acid and glutathione. In general, the balance between ROS levels and

DNA Damage Response and Apoptosis of Postmitotic Neurons

21

the activity of these defense mechanisms determines the degree of oxidative stress encountered by the cell. Neurons are highly susceptible to oxidative stress due to their high rate of oxidative metabolism and low level of antioxidant enzymes (Brook, 2000). ROS are thought to lead to apoptosis by the destruction of lipids, proteins, and nucleic acids (Kannan and Jain, 2000). DNA is perhaps the major target of ROS. In many neurodegenerative disorders, DNA damage is thought to contribute to neuronal loss. DNA damage has been found in chronic neurodegenerative conditions such as Parkinson’s (Alam et al., 1997; Jenner and Olanow, 1998) and Alzheimer’s diseases (Mecocci et al., 1998; Lovell and Markesbery, 2001), as well as amyotrophic lateral sclerosis (Bogdanov et al., 2000).

SHORT-TERM CONSEQUENCES

MUTATION MUTATION

CELL DEATH

SENESCENCE

LONG-TERM CONSEQUENCES

AGING

CANCER

NEURODEGENERATION

Figure 1. The consequences of non-repaired DNA damage.

THE DNA DAMAGE RESPONSE Living cells are continuously exposed to endogenous and environmental DNA-damaging agents. More than 104 DNA-damaging events occur in each mammalian cell every day from spontaneous decay, replication errors and cellular metabolism alone (Foray et al., 2003). A major portion of DNA damage occurs via ROS (Williams and Jeffrey, 2000). Exogenous damage may be caused by ultraviolet (UV) radiation from the sun, x- and gamma rays, hydrolysis or thermal disruption, certain plant toxins, such as botulin, or human-made mutagenic chemicals acting as DNA intercalating agents (Jeggo and Lobrich, 2006). If not repaired, some of these lesions are cytotoxic or mutagenic. A cell that has accumulated a large amount of DNA damage, or one that no longer effectively repairs damage, can enter one of three possible states:an irreversible state of dormancy, known as senescence, apoptosis, or mutagenesis and carcinogenesis (figure 1). The protection of genomic integrity, therefore, is a major challenge for living cells. To cope with the deadly consequences of DNA lesions, that interfere with essential DNA-dependent processes such as transcription and replication, cells are equipped with an efficient defense mechanism termed the DNA damage response. The

22

Inna I. Kruman and Elena I. Schwartz

function of the DNA damage response is to eliminate DNA damage through DNA repair or to remove cells with incurred DNA damage by means of apoptosis. DNA damage response mechanisms encompass pathways of DNA repair, cell cycle checkpoint arrest and apoptosis. Thus, two systems are essential for genome integrity, DNA repair and apoptosis (Shiloh, 2006). Cells defective in DNA repair tend to accumulate excess DNA damage, while cells defective in apoptotic process, tend to survive with excess DNA damage. In this regard, the cellular response to DNA damage is crucial for maintaining homeostasis, preventing the development of cancer and neurodegeneration. Defects in this response lead to severe “genomic instability syndromes” (Brooks, 2002). The many types of DNA lesions are rapidly detected, with subsequent activation of a web of signaling pathways which together compose the DNA damage response, culminating in the activation of cell-cycle checkpoints and appropriate DNA repair pathways, or the initiation of apoptotic programs.

DNA Damage Check Points Checkpoints tightly control progress throughout the cell cycle. Cells may be arrested at any of the checkpoints, and the DNA will be repaired, or alternately cells may die by apoptosis (Sancar et al., 2004). The latter is a mechanism to ensure that non-repairable DNA modifications are not passed on to the progeny of a damaged cell. The same proteins involved in regulating the orderly progression through the cell cycle are also involved in the checkpoint responses (Sancar et al., 2004). The process of DNA replication itself in addition to the usual DNA damaging insults, adds intrinsic risks, such as base misincorporation errors and stalled replication forks, which demand an immediate response from the checkpoint machinery to preserve genomic integrity. If left uncorrected, the errors may lead to the nucleotide sequence alterations and chromosomal rearrangements usually associated with cellular transformation (Kunkel and Bebenek, 2000). The integrity of the S-phase is monitored mainly via two phosphoinositide 3-kinase (PI3)-related kinases ATM (ataxia telangiectasia mutated) and ATR (ATM and Rad 3-related), which play critical roles in early signal transmission (Tibbetts et al, 2000; Abraham, 2003). These two serine/threonine kinases play a central role in signaling DNA damage (Abraham, 2003). G1- to S-phase transition requires the coordinated action of many proteins including members of the E2F family of transcription factors (Harbour and Dean 2000). E2F activity is required for the transcriptional induction of many genes required for cell cycle progression including cyclins, cyclin dependent kinases (CDKs) and enzymes involved in DNA replication. In addition, E2F functions in apoptosis following DNA damage and regulates expression of pro-apoptotic genes including apaf-1 and several caspases (DeGregori, 2002). ATM and ATR are thought to be involved in the transmission of signals from stalled replication forks through a multitude of signaling cascades. It has been found that E2F-1 protein levels, DNA binding activity and transcriptional activity are increased following exposure to UV light (O’Connor and Lu, 2000; Blattner et al et al., 1999) or other DNA-damaging agents (Meng et al., 1999). Thus, DNA-damage may induce apoptosis through E2F-1. In turn, the association of this apoptosis with S-phase may result from the fact that E2F-1 is in its free form (i.e. not complexed with retinoblastoma protein Rb (pRb) and thus most active during this phase of the cell-cycle (Harbour and Dean, 2000). The pRb and its related proteins (p107, p130) are thought to act as a checkpoint for G1/S

DNA Damage Response and Apoptosis of Postmitotic Neurons

23

transition in proliferating cells (Niida and Nakanishi, 2006). In its inactive state, pRb is nonphosphorylated and is believed to inhibit cell cycle progression by repressing E2F transcription factors. Upon mitogenic stimulation, pRb is phosphorylated by active cyclin D/CDK4/6 complexes and released from E2F, which results in the derepression and transactivation of E2F-target genes required for S phase entry (Harbour and Dean, 2000; Liu and Greene, 2001). However, there is evidence of the involvement of pRb, possibly activated and recruited to E2F-binding sites, in response to DNA damage (Knudsen et al., 2000). In addition, several genes involved in DNA repair were shown to be regulated by E2F. Deregulation of E2F upregulates the expression of genes involved in the DNA-damage response, e.g. ATM, BRCA1 and RAD51 (Polager et al., 2002; Ren et al., 2002; Berkovich and Ginsberg, 2003). The E2F1 protein has been shown to be stabilized and its levels to rise in response to DNA damage (Blattner et al., 1999; Lin et al., 2001). These findings support a role for E2F transcription factors in the DNA damage response. E2F regulation of DNA repair-associated genes at G1/S transition is consistent with the view that DNA replication is an error-prone process and that DNA repair is tightly linked to DNA synthesis (Boudsocq et al., 2002; Ren et al., 2002). Thus, the DNA damage response, apoptosis and the cell cycle share some common participants such as pRb, E2F, and ATM/ATR (King and Cidlowski, 1995; Stevaux and Dyson, 2002).

SENSORS

TRANSDUCERS Effector

Effector CELL-CYCLE CKECK POINTS

APOPTOSIS

DNA REPAIR

Figure 2. Outline of the DNA damage response pathway in mammalian cells.

The activation of cell cycle checkpoints arrests the cell cycle, while the damage is assessed and repaired. DNA damage response involves alterations in numerous physiological processes such as gene expression and protein synthesis, degradation and trafficking (Shiloh, 2006). The DNA damage response is executed through a series of steps (figure 2). First, the DNA lesions are detected by sensor proteins. Damage to DNA modifies the spatial configuration of the helix and these modifications can be detected by the cell. Transducers initiate a signal transduction cascade that amplifies the signal and conveys the damage signal

24

Inna I. Kruman and Elena I. Schwartz

to downstream effectors. When damage is localized, specific DNA repair molecules, which are part of the whole DNA repair machinery, are recruited and bind at the site of damage, inducing other molecules to bind and form a complex that facilitates the actual DNA repair mechanism. The transducers might also be involved in the assembly of DNA-repair complexes at the sites of DNA damage (Iliakis et al., 2003; Shiloh, 2003; Niida and Nakanishi, 2006). The vast majority of DNA damage affects the primary structure of the double helix. The bases, which are the main component of the double helix, are chemically modified by themselves. These modifications can disrupt the regular helical structure of DNA by introducing non-native chemical bonds or bulky adducts that are not consistent with the standard double helix (Veglia et al., 2003). There are four main types of chemical DNA damage that arise mainly from endogenous processes that generate ROS, especially superoxide and peroxides: oxidation of bases [e.g. 8oxo-7,8-dihydroguanine (8-oxoG)] and generation of DNA strand interruptions from reactive oxygen species: alkylation of bases (usually methylation); hydrolysis of bases, such as depurination and depyrimidination;. mismatch of bases, due to DNA replication, in which the wrong DNA base is stitched into place in a newly forming DNA strand (Hoeijmakers, 2001). Mitochondrial DNA is also vulnerable to damage. In this regard, the attack by oxyradicals especially affects mtDNA due to a highly oxidative environment inside mitochondria (Larsen et al., 2005).

DNA REPAIR DNA damage initiates various repair mechanisms that recognize and repair specific DNA lesions. The mechanism of DNA repair and the types of molecules involved depend on the type of DNA damage, as well as other factors including the response of signal transduction pathways and the efficiency of DNA repair machinery. Based on all these factors, the consequences for the cell after DNA damage may be variable (figure 3). Various repair mechanisms recognize and repair specific DNA lesions. DNA can be damaged by the introduction of single-strand breaks (SSBs), double-strand breaks (DSBs) and DNA adducts (that is, covalent modifications and crosslinking of individual pyrimidine or purine bases). The efficiency of DNA repair machinery depends on the type of information which is missing or damaged. If damage affects non-essential genes, cells stay superficially functional in contrast to cells with a loss of essential information in the genome. If possible, cells use the unmodified complementary strand of the DNA or the sister chromatid as a template to loosely recover the original information. Without access to a template, cells use an error-prone recovery mechanism known as translesion synthesis as a last resort (Friedberg et al., 2004). A typical DNA-repair pathway might involve DNA lesion detection, signaling to recruit DNA repair factors, the activation of DNA-repair enzymes, and disassembly or degradation of DNA-repair factors after the initial damage is fixed. The main DNA-repair pathways are: nucleotide-excision repair (NER) (which involves global genome repair (GGR) and transcription-coupled repair (TCR), base-excision repair (BER), mismatch repair (MMR), single-strand break (SSB) repair and double-strand break (DSB) repair which includes homologous recombination (HR) and non-homologous end joining (NHEJ) repair. There are two main mechanisms of DNA repair for damaged or inappropriate bases. One of them is direct chemical reversal of the damage. This mechanism is specific to the type of damage

DNA Damage Response and Apoptosis of Postmitotic Neurons

25

incurred. Another well-known mechanism is excision repair. In general, these mechanisms require removal of a damaged region by specialized nuclease systems and then DNA synthesis to fill the gap. NER, BER and MMR lead to the excision of the damaged or mispaired bases, whereas SSBR and DSBR (HR and NHEJ) allow the repair of SSBs and DSBs (figure 3). Although some DNA-repair processes are generally constitutively active, certain ones are activated in response to specific types of DNA lesions (Hoeijmakers, 2001).

DNA damage

Repairing Damaged Bases

Direct chemical reversal

Excision Repair

Base Excision Repair (BER)

Repairing Strand Breaks

Mismatch Repair (MMR)

Nucleotide Excision Repair (NER)

Global genome repair (GGR)

Single-Strand Breaks (SSBs)

Double-Strand Breaks (DSBs)

Homologous Recombinantion (HR)

Nonhomologous End-Joining (NHEJ)

Transcription-coupled repair (TCR)

Figure 3. The classification of DNA repair mechanisms.

Base Excision Repair The most common types of DNA damage are associated with the modificantions of DNA bases, such as uracil, which can arise in genomic DNA by misincorporation of dUMP or by the spontaneous deamination of cytosine to form a premutagenic lesion (Longerich and Storb, 2005). ROS the products of normal cellular respiration, also generate a variety of oxidized DNA base damage, including 8-oxoguanine, that is frequently used as a biomarker for oxidative DNA damage (ESCODD, 2002, 2003). The mutagenic and cytotoxic potential of such DNA base modifications suggests that they may be considered as factors in the induction of cancer and other diseases. These types of DNA damage are so common that they have their own cellular subsystem committed to repairing them. The most important and well-known mechanism is base excision repair (BER). In general, this mechanism requires removal of a damaged region by specialized nuclease systems and then DNA synthesis to fill the gap. BER involves five primary steps: (1) base excision, (2) AP site incision, (3) terminus "cleanup," (4) gap filling, and (5) nick ligation (Parikh et al., 1997). In the process of repair, corresponding DNA glycosylase removes a modified base from the DNA backbone, creating a transient abasic (AP) site (Nilsen et al., 1997; Slupphaug et al., 1991). AP endonuclease 1 (Ape1) cleaves the DNA backbone, which permits incorporation of a correct nucleotide by DNA

26

Inna I. Kruman and Elena I. Schwartz

polymerase β (β-pol) (Srivastava et al., 1998). Completion of BER is accomplished upon ligation (Dimitriadis et al., 1998).

Single-Strand Break Repair SSBs arise primarily from attack by ROS, whereas indirect SSBs are mainly normal intermediates of DNA BER, as a result of AP endonuclease activity and before they are "handed" to the next enzyme in the BER process, in a molecular relay. In addition to being the most common ‘endogenous’ lesion (thousands per cell per day) SSBs are also the most common lesions induced by exogenous genotoxins such as ionizing radiation, and alkylating agents (Caldecott, 2004). SSB repair contains four basic steps, beginning with DNA damage binding. SSB detection is largely achieved by the poly (ADP-ribose) polymerases, PARP-1 or PARP-2. A subset of SSBs arising during BER may also require detection or binding by PARPs. These proteins rapidly bind to and are activated by DNA strand breaks, and then covalently modify both themselves and other target proteins with poly (ADP-ribose).

Double-Strand Break Repair A type of DNA damage particularly hazardous to cells is a break to both strands in the double helix, double strand breaks (DSBs). DSBs are more common than was once expected and are estimated to occur at levels of 10 per cell per day in mammals. This is because they are caused not only by environmental sources, such as ionizing radiation and exposure to genotoxic compounds, but also, and more importantly, from endogenous sources, such as free radicals generated by oxidative respiration (Pfeiffer et al., 2000; Karanjawala et al., 2002). The stability of the mammalian genome therefore relies on efficient repair of DNA DSBs. Two mechanisms exist to repair this damage - non-homologous end-joining (NHEJ) and homologous recombination (HR) (Watson et al., 2004). The NHEJ pathway operates when the cell has not yet replicated the region of DNA on which the lesion has occurred. The process directly joins the two ends of the broken DNA strands without a template, losing sequence information in the process. Thus, this repair mechanism is necessarily mutagenic. However, if the cell is not dividing and has not replicated its DNA, the NHEJ pathway is the cell's only option (Wang et al., 2003). NHEJ involves DNA dependent protein kinase (DNAPK), a holoenzyme consisting of a catalytic subunit (DNA-PKcs) and a DNA binding and regulatory subunit, Ku heterodimers (Ku 70 and Ku 80), DNA ligase-IV (LIG4), XRCC4 and Artemis (Lieber, 1999; Ma et al., 2002). Mice deficient in LIG4 (or XRCC4) exhibit a pleiotropic phenotype, including late embryonic lethality, cellular growth defects, ionizingradiation sensitivity, and massive apoptosis of newly generated neurons (Gao et al., 1998; Barnes et al., 1998). Ku70- (Gu et al., 1997) and Ku80- (Nussenzweig et al., 1996) null mice exhibit a similar phenotype. The severe combined immune deficiency (SCID) mice which are deficient in DNA-PK-deficient exhibit severe immunodeficiency, and neurons are hypersensitive to DSB-induced apoptosis (Culmsee et al., 2001; Vemuri et al., 2001), suggesting the importance of NHEJ pathway. One of the very early events following DSBs is

DNA Damage Response and Apoptosis of Postmitotic Neurons

27

the phosphorylation of histone H2AX on serine 139 and simultaneously the autophosphorylation of Ser1981 of the nuclear protein kinase ataxia telangiectasia mutated (ATM) which is the primary DSB transducer (Sedelnikova et al., 2003; Bakkenist and Kastan, 2003). H2AX phosphorylation at serine 139 occurs at sites surrounding DSBs. Recent reports indicate that the dephosphorylation of γH2AX and dispersal of γH2AX foci in γ-irradiated cells correlate with DNA DSB repair (Rothkamm et al., 2003; MacPhail et al., 2003; Nazarov et al., 2003) and numerically correspond to DNA DSBs (Sedelnikova et al.,2002). The ATM function is critical for many aspects of the DSB response (Shiloh, 2003). After DSB induction, ATM is rapidly activated by autophosphorylation (Bakkenist and Kastan, 2003). Active ATM then phosphorylates different substrates, involved in the DNA damage response. An important mediator of cell-cycle checkpoints and damage-induced apoptosis is the tumor suppressor protein p53, which is activated by ATM via various posttranslational modifications (Meek, 2004) or by phosphorylating Mdm2, a ubiquitin ligase of p53, thereby targeting p53 for degradation (Stommel and Wahl, 204). In addition to its role in DNA NHEJ repair, DNA-PK plays important roles in the DNA damage response signaling (Jackson, 2002; Yang et al., 2003). The accumulating data point to an important role of p53 in the DNA-PK-mediated DNA damage signaling pathway (Achanta et al., 2001). Recent observations suggest that in contrast to ATM, DNA-PK is not involved in cell cycle checkpoint regulation through p53, but serves as an upstream regulator of the p53-mediated apoptosis pathway (Burma and Chen, 2004). On the other hand, DSB-induced apoptosis has been reported in p53-deficient cells (Lips and Kaina, 2001). Thus, the mechanisms by which DNA-PK and ATM work in DSB-induced signaling remain unclear. Another transcription factor that has been recently found to be a direct target of ATM is the Ca2+/cAMP response element binding protein (CREB), which is involved in various cellular growth pathways (Shi et al., 2004). The loss of ATM activity is associated with the autosomal recessive disorder ataxia-telangiectasia (A-T), which is characterized by neuronal degeneration, severe neuromotor dysfunction, immunodeficiency, chromosomal fragility, a marked predisposition to cancer, and sensitivity to ionizing radiation (Shiloh, 2003).

DNA DAMAGE IN THE NERVOUS SYSTEM DNA damage is an important initiator of neuronal cell death and has also been implicated in neurodegenerative conditions. Given that the DNA of postmitotic neurons is particularly susceptible to oxidative stress because of the high rate of oxidative metabolism in the brain, and also due to the fact that postmitotic neurons may live for many decades, DNA damage could be a critical factor in ageing and the progression of some pathologies. DNA strand breaks have been reported in neurons after reperfusion of ischemic tissue, well in advance of DNA fragmentation caused by the apoptotic process (Tobita et al., 1995; Chen et al., 1997; Cui et al., 2000). DNA damage has also been found in various chronic neurodegenerative conditions (Alam et al., 1997; Jenner and Olanow, 1998; Mecocci et al., 1998; Bogdanov et al., 2000; Lovell and Markesbery, 2001). A two-fold higher incidence of single-strand breaks and other alkali-labile DNA lesions are detected in the cerebral cortex of AD versus control brains (Mullaart et al., 1990). In this regard, factors known to be relevant to DNA damage, such as poly (ADP-ribose) polymerase (PARP) and p53, have been implicated in a variety of neurodegenerative diseases (Cosi et al., 1997). Thus, neuronal DNA damage often occurs as a

28

Inna I. Kruman and Elena I. Schwartz

result of oxidative stress (Ratan et al. 1994; Park et al. 1998; Martin et al. 2003). According to our data, elevated levels of oxo8dG in brains of APP mutant transgenic mice, a mouse model of Alzheimer’s disease, are correlated with increased levels of soluble Aβ1-42/Aβ1-40 (Kruman et al., 2004a). The amount of oxo8dG was found to be elevated in nuclear and mitochondrial DNA in neurons of diseased brain regions in patients with neurodegenerative disorders (Iida et al., 2002). The importance of DNA damage is illustrated further by the observation that neurological abnormalities are known to accompany defective DNA repair in various human syndromes such as ataxia telangiectasia and Cockayne syndrome (Rolig and McKinnon, 2000). Since neurons have a high metabolic rate and extensive exposure to oxidative stress, it is not surprising that defects in various branches of the DNA damage response lead to severe neurological demise (Brooks, 2002). In further support, mice deficient in a variety of DNA damage repair pathways display aberrant neuronal loss and impaired neural development (Gao et al., 1998; Sugo et al., 2000), demonstrating connections between DNA damage and neurodegeneration. The importance of DNA repair for the nervous system is illustrated by the fact that many neurological abnormalities and progressive neurodegeneration in patients with hereditary diseases are associated with defects in DNA repair (Rolig and McKinnon, 2000). The nervous system most likely has a DNA repair system largely similar to that found in other tissues (Brooks, 2002; Biton et al., 2006). Terminally differentiated neurons are able to repair DNA damage, although the process is slower than in proliferating cells, and neurons are more prone to DNA damage-initiated apoptosis (Gobbel et al., 1998; Morris and Geller, 1996). A close link between DSB DNA damage and neurodegeneration, essential during nervous system development, appears evident from many pathological data and observations with mouse knockouts. Thus, DNA damage is an important initiator of neuronal cell death implicated in neurodegenerative conditions.

DNA DAMAGE RESPONSE IN NEURONS Since neurons have an elevated rate of metabolism, particularly oxidative metabolism, which may result in accumulation of numerous lesions in the genome and may compromise transcription (Brooks, 2002), it would be logical to suggest that a mechanism exists to maintain the integrity of those genes needed for viable cell function. Neurons can repair DNA damage, but the process is slower than in proliferating cells, and neurons are known to be more prone to apoptosis (Gobbel et al., 1998). Upon terminal differentiation of neurons, there is a sharp decrease in global genomic repair (GGR). However, repair of active genes has been found to be maintained or even enhanced by differentiation (Ho and Hanawalt, 1991). Differentiated cells have been shown to repair transcribed genes using the specialized repair pathway termed transcription-coupled repair (TCR), which targets repair systems to transcribed genes (Nouspikel and Hanawalt, 2002). The mechanisms of this type of DNA repair are not yet fully understood. Several DNA repair systems, including base excision repair (BER) may be involved in TCR (Larsen et al., 2000 ).

DNA Damage Response and Apoptosis of Postmitotic Neurons

29

Role of Cell Cycle Reentry in the DNA Damage Response The DNA damage response has been investigated mainly in proliferating cells, which integrate cell cycle machinery with DNA damage signaling; the response is involved both in DNA repair and apoptosis (Shiloh, 2003; Lukas et al., 2004). Traditionally, neurons have been considered to be “locked” into the G0 phase of the cell cycle. Normally, the release of a cell from the resting G0 phase results in its entry into the first gap phase (G1), during which the cell prepares for DNA replication in the S phase. This is followed by the second gap phase (G2) and mitosis (M phase). While a number of studies have investigated the responses of proliferating cells to genotoxic agents, little is known about the DNA damage response in neurons and other terminally differentiated cells. Differentiated neurons are characterized by the reduction in the cellular levels of several DNA damage response proteins (Lukas et al., 2004; Nouspikel and Hanawalt, 2002; McMurray, 2005; Biton et al., 2006). While this observation is in keeping with the notion that resting cells must reenter the cell cycle in order to carry out DNA repair, a role for cell cycle activation in terminally differentiated cells remains unclear. This activation may be involved in the DNA damage response, DNA repair and apoptosis (Kruman, 2004; Kruman et al., 2004a). Evidence is emerging that in neurodegenerative diseases, neurons attempt to re-enter the cell cycle and this attempt is followed by programmed cell death (Kruman, 2004; Herrup et al., 2004). However, while terminally differentiated neurons retain the ability to reactivate the cell cycle, it rarely leads to neuronal proliferation but typically induces apoptosis (Wartiovaara et al., 2002; Husseman et al., 2000 and Liu and Greene, 2001). Consistent with this idea are the rare incidence of brain tumors of neuronal origin and the resistance of neurons to oncogenic transformation (Heintz, 1993). On the other hand, aneuploidy was demonstrated to be quite common in the brain of adult animals (Rehen et al., 2001), meaning that DNA replication in terminally differentiated cells may lead to aneuploidy. Nevertheless, re-expression and activation of cell cycle proteins have been observed in dying neurons of brains of patients with neurodegenerative disorders (Nagy et al., 1997; Husseman et al., 2000; Yang et al., 2001). Recently, a direct interaction between cell cycle machinery and the cell-intrinsic apoptotic program was demonstrated in postmitotic neurons with the observation that cdc2, a cell cycle regulator, directly initiates apoptosis via direct activation of Bad, a trigger of apoptosis (Konishi et al., 2002). The suppression of cell cycle-dependent kinase (CDK) activity has been shown to produce a neuroprotective effect both in vivo and in vitro (Park et al., 1997; O'Hare et al., 2002; Katchanov et al., 2001; Rideout et al., 2003), supporting the idea that cell cycle reentry underlies neuronal apoptosis. The suppression of ATM, a key player in the DNA damage response, was found to attenuate the damage-induced attempts to reenter cell cycle and consequently apoptosis following DNA damage in neurons (Kruman et al., 2004a). This can be linked to findings that neurons from ATM-deficient mice have demonstrated a striking resistance to DNA damage-induced apoptosis (Herzog et al., 1998; Chong et al., 2000; Macleod et al., 2003; Kruman et al., 2004a). Importantly, ATM deficiency rescued the apoptosis of neurons observed in Lig4, Ku70 or Ku80- knockout mice (Nussenzweig et al., 1996; Gu et al., 1997; Lee et al., 1997; Sekiguchi et al., 2001). This suggests that the disturbance of DSB repair resulting from the lack of NHEJ components (Lig4, Ku70 or Ku80) in neurons can be recognized by ATM in a pathway leading to apoptosis. In the developing nervous system, this process may serve to remove cells that suffer irreparable

30

Inna I. Kruman and Elena I. Schwartz

damage from the system (McKinnon, 2001), indicating that ATM may function to eliminate neural cells that have incurred DNA damage. On the other hand, the amount of unrepaired DNA after γ-irradiation was greater in cells from ataxia-telangiectasia patients than in cells from normal individuals (Cornforth and Bedford, 1985), underscoring the importance of ATM for DNA repair. Recently, we and others have shown that the DNA damage response in postmitotic neurons committed to apoptosis involves cell cycle- associated events (Klein et al., 2002; Kruman et al, 2004a). Previously, we found that suppression of the ATM function attenuates apoptosis and abrogates cell cycle reentry in postmitotic cortical neurons exposed to DNA-damaging agents (Kruman et al., 2004a). We have now extended this work by showing that ATM deficiency also affects cell cycle activation associated with DNA repair in neurons (figure 4), in keeping with the documented reduction in DNA repair efficiency in cells from ataxia-telangiectasia patients (Cornforth and Bedford, 1985). This reflects the intimate relationship between ATM, cell cycle activation, and DNA repair in postmitotic neurons, and further suggests that cell cycle reentry is a requisite component of the response to DNA damage essential for the execution of both apoptosis and DNA repair in neurons. Although it is widely accepted that postmitotic cells and tissues have decreased DNA repair capacity, several findings indicate that postmitotic cells such as muscle cells and neurons may up-regulate the expression of DNA glycosylases in certain conditions (Karahalil et al., 2002). Thus, oxoguanine-DNA glycosylase (OGG1; which recognizes and removes 8-oxoguanine) activity in rat heart increases significantly with age (Souza-Pinto et al., 1999). Up-regulation of mRNA levels of APE/Ref1, a multifunctional enzyme that has both an AP endonuclease activity and is essential for glycosylase initiated BER (Flaherty et al., 2001) in neurons, were shown to be high in certain hypothalamic nuclei, as well as in the hippocampus and cerebellum (Wilson et al., 1996). In brain, up-regulation of BER activity was detected after ischemia-reperfusion injury (Lin et al., 2000). Oxidative stress and oxidative DNA damage induce up-regulation of OGG1 activity associated with this type of DNA damage. In support of these observations, we found up-regulated levels of UNG mRNA in brains of cystathionine-β-synthase-knockout (CBS) mice compared to wild-type mice. CBS mice are characterized by hyperhomocysteinemia (Watanabe et al., 1995), which is associated with one-carbon metabolism impairment (itself associated with uracil misincorporation) (Duthie, 1999). Like the up-regulation of OGG1 in response to oxidative DNA damage, uracil misincorporation mediated by hyperhomocysteinemia induces up-regulation of UNG mRNA. The UNG activity is in general significantly higher in proliferating as compared with nonproliferating tissues (Aprelikova and Tomilin, 1982), and the expression of UNG has been demonstrated to be under cell cycle regulation (Nahelhus et al., 1997; Walsh et al., 1995). The inducibility of the BER enzymes, OGG1, UNG and APE/Ref1 may indicate that BER in general is essential for maintaining genomic integrity in the brain and that up-regulation of expression and/or activity of BER enzymes in brain tissue may be induced by DNA damage during certain challenges (e.g. hyperhomocysteinemia in CBS knockout mice or oxidative stress) and mediated by cell cycle activation in neurons. In cycling cells, the DNA damage response is comprised of cell cycle arrest at specific checkpoints, presumably to allow time for the damage to be repaired, or to activate the apoptotic program if the damage is too extensive to be repaired (Rhind and Russell, 2000). Cell cycle regulation is integrated with DNA repair mechanisms and even utilizes some common proteins (Slupphaug et al., 2003). ATM activated by DSBs phosphorylates key proteins that lead to cell cycle checkpoint arrest and/or apoptosis (Shiloh, 2003). In

DNA Damage Response and Apoptosis of Postmitotic Neurons

31

postmitotic, terminally differentiated neurons, signaling through cell cycle components is also essential for the response to DNA damage, but in contrast to cycling cells, which undergo growth arrest at specific checkpoints, the signaling in neurons is associated with activation of the cell cycle.

Cell Cycle Reentry and Neuronal Apoptosis

A

Ki-67 positive neurons (%)

Traditionally, neurons have been considered to rest in the G0 phase of the cell cycle. However, accumulating evidence suggests that postmitotic neurons re-express cell cycle markers with the occurrence of neuronal apoptosis (Liu and Greene, 2001; Herrup et al., 2004). These markers include cyclin D, which is involved in the G0-G1 transition, phosphorylated at Ser 795 retinoblastoma tumor suppressor protein (Rb) which is critical for activation of the cell cycle, the DNA helicase subunit minichromosome maintenance (Mcm) proteins 2-7 which assemble in the pre-replication complex, a nuclear antigen Ki-67, which is absent from resting (G0) cells, and cyclin E, a marker of G1-S transition (Becker and Bonni, 2004). Moreover, neurons are able to undergo full or partial DNA replication, showing that they have completed the S phase (Yang et al., 2001; Kruman et al., 2004a).

B

10

6 4 2 0 Con1

2 5 μM

12 Foci per cell

WT KO

*

8

*

10

WT KO

8 6 4 2 0

Con 1

6 2h

123h 5 μM

Figure 4. Suppression of ATM function prevents the cell cycle activation in cultured cortical neurons induced by subtoxic (5 μM) concentration of H2O2, and inhibits DNA repair. (A) Ki-67-positive neurons are reduced in cultures of cortical neurons derived from ATM knockout (ATM-/-) mice compared with those derived from wild-type (WT) following treatment for 12 h with 5 μM H2O2. (B) Cultures were exposed to either saline or subtoxic (5 μM) concentration of H2O2, during the indicated periods of time. Immunoreactivity for γ-H2AX was visualized with FITC (488, green). Cells were co-stained with PI. γ-H2AX foci were determined in at least 50 cells. Note significant reduction of γ-H2AX foci in cultures derived from wild-type (WT) mice after 12-h exposure to 5 μM compared to 6-h exposure in contrast to those derived from ATM knockout (ATM-/-) mice. Control (Con) represents the untreated culture. The values are the mean and SD (n=6); *p<0.01.

32

Inna I. Kruman and Elena I. Schwartz

DNA replication has been suggested to be lethal for neurons (Herrup et al., 2004). DNA damage-initiated apoptosis was shown to increase the expression of error-prone DNA polymerase β (Copani et al., 2002), whose physiological role appears restricted to DNA repair (Sobol et al., 1996). In neurons entering the S phase, polymerase β-directed DNA replication might produce additional DNA damage, thus contributing to the execution of apoptosis (Klein et al., 2002). Little is known about the mechanisms of the DNA damage response in terminally differentiated neurons, especially concerning its integration with cell cycle machinery. However, there is both in vitro and in vivo evidence of a link between DNA damage and cell cycle reentry in dying postmitotic neurons. Analysis of the X-harlequin (Hq) mutation in the gene encoding apoptosis-inducing factor (AIF) which is accompanied by oxidative stress, has demonstrated that in Hq mice, many cerebellar granule cells had newly synthesized nuclear DNA and were positive for oxo8dG, a marker of oxidative DNA damage (Klein et al., 2002). Using flow cytometry and BrdU incorporation analyses, we have demonstrated that cell cycle activation followed by apoptosis is induced by DNA damage and can be blocked along with the DNA damage response (Kruman et al., 2004a). Although these observations imply that induction of unscheduled cell cycle reentry is highly correlated with, and is likely induced by DNA damage, the mechanisms of the DNA damage response, its link to cell cycle machinery and roles of this machinery in DNA repair of postmitotic neurons are poorly defined. Both the cell cycle and apoptosis are controlled by a highly conserved machinery and exhibit morphological similarities of cell rounding and chromatin condensation. They also share some common participants such as ATM, E2F and p53 (King and Cidlowski, 1995; Matsumura et al., 2003). The in vivo evidence that cell cycle re-entry in postmitotic terminally differentiated neurons is associated with DNA damage came from the analysis of the X-linked harlequin (Hq) mutation in the gene encoding apoptosis-inducing factor (AIF) that causes progressive ataxia (Klein et al., 2002). In Hq mice, many but not all cerebellar granule cells had newly synthesized nuclear DNA, as demonstrated by BrdU incorporation, and were positive for caspase-3, indicating the association with apoptosis. In cycling cells, whether DNA damaging conditions cause growth arrest or apoptosis may depend in part on where the cell resides in the cell cycle when the insult is delivered. The fact that not all oxo8dG-positive neurons in brains of Hq mice were in the S-phase indicates that these neurons may enter the S-phase later and then die by apoptosis; aqlternately, these oxo8dGpositive neurons may repair the DNA and not enter the S-phase, with subsequent apoptosis, but instead continue normal functioning. Using flow cytometry and BrdU incorporation analyses, we have demonstrated that cell cycle activation followed by apoptosis is induced by DNA damage and can be blocked together with the DNA damage response (Kruman et al., 2004a). These observations and the detection of markers for oxidative DNA damage (long before neurodegeneration) demonstrate that induction of unscheduled cell cycle reentry is highly correlated with, and is likely induced by DNA damage. Furthermore, the amount of oxo8dG, a major oxidative DNA lesion that has been found to be elevated in neuronal DNA in brains of patients with neurodegenerative disorders (Migliore and Coppede, 2002). Increases in oxo8dG are also correlated with increased incidence of cancer (Helbock et al., 1998), endorsing the importance of the same factors in the pathogenesis of both types of disorders.

DNA Damage Response and Apoptosis of Postmitotic Neurons

33

CONCLUSION In summary, DNA damage may activate cell cycle machinery in postmitotic neurons as an essential part of the DNA damage response. Like in cycling cells, DNA damage may result in DNA repair or apoptosis if DNA damage is unrepaired, and the consequent loss of neurons by apoptosis could result in neurodegeneration. In addition, neurodegeneration is a hallmark of various diseases observed in patients with hereditary DNA repair disorders. The mechanisms by which a cell is forced into apoptosis versus DNA repair, or instead dies by a nonapoptotic mechanism from unrepaired DNA, are not clear. It is likely that both outcomes are managed by the DNA damage response. Suppression of ATM which is a proximal component of DNA damage response, attenuates both apoptosis and cell cycle reentry, suggesting that both cell cycle activation and apoptosis constitute the DNA damage response. ATM deficiency in humans is characterized by predisposition to cancer and progressive neurodegeneration suggesting the impairment of DNA repair when the main player in the DNA damage response does not act. Cortical neurons from ATM-deficient mice are more resistant to apoptosis initiated by DNA damage, suggesting that ATM may function to eliminate neural cells when they have incurred sufficient DNA damage. ATM suppression in neurons prevent cell cycle reentry, while cycling cells deficient in ATM exhibited defective cell cycle checkpoints, implying that neurons may be influenced by the same cell cycle checkpoints that govern apoptosis in cycling cells.

REFERENCES Abraham, RT. (2003). Checkpoint signaling: epigenetic events sound the DNA strand-breaks alarm to the ATM protein kinase. Bioessays. 25,627-630. Achanta, G; Pelicano, H; Feng, L; Plunkett, W; Huang, P. (2001). Interaction of p53 and DNA-PK in response to nucleoside analogues: potential role as a sensor complex for DNA damage. Cancer Res. 61,8723-8729. Alam, ZI; Jenner, A; Daniel, SE; Lees, AJ; Cairns, N;Marsden, CD; Jenner, P; Halliwell, B. (1997). Oxidative DNA damage in the parkinsonian brain: an apparent selective increase in 8-hydroxyguanine levels in substantia nigra. J. Neurochem. 69,1196-1203. Aprelikova, O N and Tomilin N V. (1982) Activity of uracil-DNA glycosylase in different rat tissues and in regenerating rat liver. FEBS Lett. 137,193-195 Bakkenist, CJ and Kastan, MB. (2003). DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature. 421,499-506. Barnes, DE; Stamp, G; Rosewell, I; Denzel, A; Lindahl, T. (1998). Targeted disruption of the gene encoding DNA ligase IV leads to lethality in embryonic mice. Curr. Biol. 8,13951398. Becker, EB and Bonni, A.(2004). Cell cycle regulation of neuronal apoptosis in development and disease. Prog. Neurobiol. 72,1-25. Berkovich, E and Ginsberg, D. (2003). ATM is a target for positive regulation by E2F-1. Oncogene.22,161-167. Bernstein, C; Bernstein, H; Payne CM; Garewal H. (2002). DNA repair/pro-apoptotic dualrole proteins in five major DNA repair pathways: fail-safe protection against carcinogenesis. Mutat. Res. 511,145-178.

34

Inna I. Kruman and Elena I. Schwartz

Biton, S; Dar, I, Mittelman, L; Pereg, Y; Barzilai, A; Shiloh Y. (2006). Nuclear ataxiatelangiectasia mutated (ATM) mediates the cellular response to DNA double strand breaks in human neuron-like cells. J. Biol. Chem. 281,17482-17491. Blattner, C; Tobiasch, E; Litfen, M; Rahmsdorf, HJ; Herrlich, P. (1999). DNA damage induced p53 stabilization: no indication for an involvement of p53 phosphorylation. Oncogene. 18,1723-1732. Bogdanov, M; Brown, RH; Matson, W; Smart, R; Hayden, D; O’Donnell; H, Flint Beal; M, Cudkowicz, M. (2000). Increased oxidative damage to DNA in ALS patients. Free Radic Biol. Med. 29,652-658. Brooks, PJ. DNA repair in neural cells: basic science and clinical implications (2002). Mut. Res. 509,93.-108 Boudsocq, F; Ling, H; Yang, W; Woodgate, R. (2002). Structure-based interpretation of missense mutations in Y-family DNA polymerases and their implications for polymerase function and lesion bypass. DNA Repair. (Amst). 1,343-358. Burek, MJ and Oppenheim, RW (1996). Programmed cell death in the developing nervous system. Brain Pathol. 6,427-446. Burma, S and Chen, DJ. (2004). Role of DNA-PK in the cellular response to DNA doublestrand breaks. DNA Repair. (Amst). 3,909-918. Butterfield, DA. (2002). Amyloid beta-peptide (1-42)-induced oxidative stress and neurotoxicity: implications for neurodegeneration in Alzheimer's disease brain. Free Radic. Res. 36,1307-1313. Caldecott, KW. (2004). DNA single-strand breaks and neurodegeneration. DNA Repair. (Amst). 3,875-882. Carri, NG.(2003). Multiple neurotrophic signalling: certain TGF molecules are involved in retinal development and maturation, but do they complement one another's actions? Cell Biol. Int. 27,1033-1036. Chen, J; Jin, K; Chen, M; Pei, W; Kawaguchi, K; Greenberg, DA; Simon, RP. (1997). Early detection of DNA strand breaks in the brain after transient focal ischemia: implications for the role of DNA damage in apoptosis and neuronal cell death. J. Neurochem. 69,232245. Chong, MJ; Murray, MR; Gosink, EC; Russell, HR; Srinivasan, A; Kapsetaki, M; Korsmeyer, SJ; McKinnon, P J. (2000). Atm and Bax cooperate in ionizing radiation-induced apoptosis in the central nervous system. Proc. Natl. Acad. Sci. U. S. A. 97.889-894. Copani, A; Sortino, MA; Caricasole A; Chiechio, S; Chisari, M; Battaglia, G; Giuffrida,Stella, AM; Vancheri, C; Nicoletti F. (2002). Erratic expression of DNA polymerases by beta-amyloid causes neuronal death. FASEB J. 16,2006-2008. Cornforth; M N and Bedford, JS. (1985). On the nature of a defect in cells from individuals with ataxia-telangiectasia. Science. 227,1589-1591. Cosi, C; Suzuki, H; Skaper, SD; Milani, D; Facci, L; Menegazzi, M; Vantini, G; Kanai, Y; Degryse, A; Colpaert, F; Koek, W; Marien MR. (1997). Poly(ADP-ribose) polymerase (PARP) revisited. A new role for an old enzyme: PARP involvement in neurodegeneration and PARP inhibitors as possible neuroprotective agents. Ann. N. Y. Acad. Sci. 825,366-379. Cui, J; Holmes, EH; Greene, TG; Liu, PK. (2000). Oxidative DNA damage precedes DNA fragmentation after experimental stroke in rat brain. FASEB J. 14,955-967.

DNA Damage Response and Apoptosis of Postmitotic Neurons

35

Culmsee, C; Bondada, S; Mattson, MP. (2001). Hippocampal neurons of mice deficient in DNA-dependent protein kinase exhibit increased vulnerability to DNA damage, oxidative stress and excitotoxicity. Brain Res. Mol. Brain Res. 87,257-262. DeGregori J. (2002). The genetics of the E2F family of transcription factors: shared functions and unique roles. Biochim. Biophys. Acta. 1602,131-150. Foray, N; Marot, D; Gabriel, A; Randrianarison, V; Carr, AM; Perricaudet, M; Ashworth, A; Jeggo, P. (2003). A subset of ATM- and ATR-dependent phosphorylation events requires the BRCA1 protein. EMBO J. 22,2860-28671. Dimitriadis, EK; Prasad, R; Vaske, MK; Chen, L; Tomkinson, AE; Lewis, MS; Wilson, SH. (1998). Thermodynamics of human DNA ligase I trimerization and association with DNA polymerase beta. J. Biol. Chem. 273,20540-20550. Duthie, G G. (1999) Determination of activity of antioxidants in human subjects. Proc. Nutr. Soc. 58,1015-1024 European Standards Committee on Oxidative DNA Damage (ESCODD). (2002). Comparative analysis of baseline 8-oxo-7,8-dihydroguanine in mammalian cell DNA, by different methods in different laboratories: an approach to consensus. Carcinogenesis. 23,2129-2133. European Standards Committee on Oxidative DNA Damage (ESCODD). (2003). Measurement of DNA oxidation in human cells by chromatographic and enzymic methods. Free Radic. Biol. Med. 34,1089-1099. Flaherty, DM; Monick, MM; Hunninghake, GW. (2001). AP endonucleases and the many functions of Ref-1. Am. J. Respir. Cell Mol. Biol. 25,664-667. Friedberg, EC; McDaniel, LD; Schultz, RA. (2004). The role of endogenous and exogenous DNA damage and mutagenesis. Curr. Opin. Genet. Dev. 14,5-10. Friedlander, RM. (2003). Apoptosis and caspases in neurodegenerative diseases. N. Engl. J. Med. 348,1365-1375. Gao, Y; Sun, Y; Frank, KM; Dikkes, P; Fujiwara, Y; Seidl, KJ; Sekiguchi JM; Rathbun, GA; Swat, W; Wang, J; Bronson, RT; Malynn BA; Bryans, M; Zhu, C; Chaudhuri J; Davidson, L; Ferrini, R J. (1998). Cell Biol. 119,493-501. Gobbel, GT; Bellinzona, M; Vogt, AR; Gupta, N; Fike, JR; Chan, PH. (1998). Response of postmitotic neurons to X-irradiation: implications for the role of DNA damage in neuronal apoptosis. J. Neurosci. 18,147-55. Greene, LA; Biswas, SC; Liu, DX. (2004). Cell cycle molecules and vertebrate neuron death: E2F at the hub. Cell Death Differ. 11,49-60. Gu, Y; Seidl, K J ; Rathbun, G A; Zhu, C; Manis, J P; van der Stoep, N; Davidson, L; Cheng, H L; Sekiguchi, J M; Frank, K; Stanhope-Baker, P; Schlissel, MS; Roth, DB; Alt, FW. (1997) Growth retardation and leaky SCID phenotype of Ku70-deficient mice. Immunity. 7,653-665. Harbour, JW and Dean, DC. (2000). The Rb/E2F pathway: expanding roles and emerging paradigms. Genes Dev.14,2393-2409. Heintz, N. (1993). Cell death and the cell cycle: a relationship between transformation and neurodegeneration? Trends Biochem. Sci. 18,157-159. Helbock, HJ; Beckman, KB; Shigenaga, MK; Walter, PB; Woodall, AA; Yeo, HC; Ames, BN.(1998). DNA oxidation matters: the HPLC-electrochemical detection assay of 8-oxodeoxyguanosine and 8-oxo-guanine. Proc. Natl. Acad. Sci. U. S. A. 95,288-293.

36

Inna I. Kruman and Elena I. Schwartz

Herrup, K; Neve, R; Ackerman, SL; Copani, A. (2004). Divide and die: cell cycle events as triggers of nerve cell death. J. Neurosci. 24,9232-9239. Herzog, KH; Kapsetaki, M; Morgan, JI; McKinnon, P.J., (1998). Requirement for ATM in ionizing radiation-induced cell death in the developing central nervous system. Science. 280,1089-1091. Herzog, KH; Chong, MJ; Kapsetaki, M; Morgan, JI; McKinnon PJ. (1998). Requirement for Atm in ionizing radiation-induced cell death in the developing central nervous system. Science. 280,1089-1091. Ho, L and Hanawalt, PC. (1991).Gene-specific DNA repair in terminally differentiating rat myoblasts. Mutat. Res. 255,123-141. Hoeijmakers, JH. (2001). Genome maintenance mechanisms for preventing cancer. Nature. 411,366-374. Honig, LS and Rosenberg, RN.(2000). Apoptosis and neurologic disease. Am. J. Med. 108,317-330. Husseman, JW; Nochlin, D; Vincent, I. (2000). Mitotic activation: A convergent mechanism for a cohort of neurodegenerative disease. Neurobiol. Aging. 21,815-828. Iida, T; Furuta, A; Nishioka, K; Nakabeppu, Y; Iwaki, T. (2002). Expression of 8-oxoguanine DNA glycosylase is reduced and associated with neurofibrillary tangles in Alzheimer's disease brain. Acta Neuropathol. (Berl). 103,20-25. Iliakis, G; Wang, Y; Guan, J; Wang, H. (2003). DNA damage checkpoint control in cells exposed to ionizing radiation. Oncogene. 22,5834-5847. Jackson, S. (2002). Sensing and repairing DNA double strand breaks. Carcinogenesis. 23, 687-696. Jeggo, PA and Lobrich M. (2006). Contribution of DNA repair and cell cycle checkpoint arrest to the maintenance of genomic stability. DNA Repair. (Amst). [Epub ahead of print] Jenner, P and Olanow, CW. (1998). Understanding cell death in Parkinson’s disease. Ann. Neurol. 44 (Suppl 1),S72-84 Johnson, RT; Gotoh, E; Mullinger, AM; Ryan, AJ; Shiloh, Y; Ziv, Y; Squires, S. (1999). Targeting in double-strand breaks to replicating DNA identifies a subpathway of DSB repair that is defective ataxia-telangiectasia cells. Biochem. Biophys. Res. Commun. 261,317-325. Kannan, K and Jain, SK. (2000). Oxidative stress and apoptosis. Pathophysiology. 7,153163. Karahalil, B; Hogue, BA; de Souza-Pinto; NC; Bohr, VA. (2002). Base excision repair capacity in mitochondria and nuclei: tissue-specific variations. FASEB J. 16,1895-1902. Karanjawala, ZE; Adachi, N; Irvine, RA; Oh, EK; Shibata, D; Schwarz, K; Hsieh, CL; Lieber, MR. (2002). The embryonic lethality in DNA ligase IV-deficient mice is rescued by deletion of Ku: implications for unifying the heterogeneous phenotypes of NHEJ mutants. DNA Repair. (Amst). 1, 1017-1026. Katchanov; J; Harms; C; Gertz; K; Hauck; L; Waeber; C; Hirt; L; Priller; J; von Harsdorf; R; Bruck, W; Hortnagl, H; Dirnagl, U; Bhide, PG; Endres, M. (2001). Mild cerebral ischemia induces loss of cyclin-dependent kinase inhibitors and activation of cell cycle machinery before delayed neuronal cell death. J. Neurosci. 21,5045-5053. King, KL and Cidlovski, JA (1995). Cell cycle and apoptosis: common pathways to life and death. J. Cell Biochem. 58,175-180.

DNA Damage Response and Apoptosis of Postmitotic Neurons

37

Klein, JA and Ackerman, SL. (2003). Oxidative stress, cell cycle, and neurodegeneration. J. Clin. Invest. 111,785-793. Klein, JA; Longo-Guess, CM; Rossmann, MP; Seburn, KL; Hurd, RE; Frankel, WN; Bronson, RT; Ackerman, SL. (2002). The harlequin mouse mutation downregulates apoptosis-inducing factor. Nature. 419,367-374. Knudsen, KE; Booth, D; Naderi, S; Sever-Chroneos, Z; Fribourg, AF; Hunton, IC; Feramisco, JR; Wang, JY; Knudsen; ES. (2000). RB-dependent S-phase response to DNA damage. Mol. Cell Biol. 20,7751-63. Konishi, Y; Lehtinen, M; Donovan, N; Bonni, A. (2002). Cdc2 phosphorylation of BAD links the cell cycle to the cell death machinery. Mol. Cell. 9,1005-1016. Kruman, II (2004). Why do neurons enter the cell cycle? Cell Cycle. 3,769-773. Kruman, II; Wersto, RP; Cardozo-Pelaez, F; Smilenov, L; Chan, SL; Chrest, FJ; Emokpae, R Jr; Gorospe, M; Mattson, MP. 2004a. Cell cycle activation linked to neuronal cell death initiated by DNA damage. Neuron. 41,549-561. Kruman, I; Schwartz, E; Kruman, Y; Cutler, RG; Zhu, X; Greig, NH; Mattson, MP.(2004). Suppression of uracil-DNA glycosylase induces neuronal apoptosis. J. Biol. Chem. 279,43952-60. Kunkel, TA and Bebenek, K. (2000). DNA replication fidelity. Annu Rev Biochem. 69,497529. Larsen, NB; Rasmussen, M; Rasmussen, LJ. (2005). Nuclear and mitochondrial DNA repair: similar pathways? Mitochondrion. 5,89-108. Larsen, E; Kwon, K; Coin, F; Egly, JM; Klungland, A. (2004). Transcription activities at 8oxoG lesions in DNA. DNA Repair. (Amst). 3,1457-1468. Lee, SE; Mitchell, RA; Cheng, A; Hendrickson, EA. (1997). Evidence for DNA-PKdependent and -independent DNA double-strand break repair pathways in mammalian cells as a function of the cell cycle. Mol. Cell Biol. 17,1425-1433. Lewen, A; Matz, P; Chan, PH.(2000). Free radical pathways in CNS injury. J. Neurotrauma. 17,871-890. Lieber, MR. (1999). The biochemistry and biological significance of nonhomologous DNA end joining: an essential repair process in multicellular eukaryotes. Genes Cells. 4, 77-85. Lin, LH; Cao, S; Yu, L; Cui, J; Hamilton, WJ; Liu, PK.(2000). Up-regulation of base excision repair activity for 8-hydroxy-2'-deoxyguanosine in the mouse brain after forebrain ischemia-reperfusion. J. Neurochem. 74,1098-10105. Lin, SC; Skapek, SX; Papermaster, DS; Hankin, M; Lee, EY. (2001). The proliferative and apoptotic activities of E2F1 in the mouse retina. Oncogene. 20,7073-7084. Lips, J and Kaina, B. (2001). DNA double-strand breaks trigger apoptosis in p53-deficient fibroblasts. Carcinogenesis. 22,579-585. Liu, DX and Greene, LA.(2001). Regulation of neuronal survival and death by E2Fdependent gene repression and derepression. Neuron. 32,425-438. Longerich, S and Storb, U. (2005). The contested role of uracil DNA glycosylase in immunoglobulin gene diversification. Trends Genet. 21,253-256. Lovell, MA and Markesbery, WR. (2001). Ratio of 8-hydroxyguanine in intact DNA to free 8-hydroxyguanine is increased in Alzheimer disease ventricular cerebrospinal fluid. Arch. Neurol. 58,392-396. Lukas, J; Lukas, C; Bartek, J. (2004). Mammalian cell cycle checkpoints: signalling pathways and their organization in space and time. DNA Repair (Amst). 3,997-1007.

38

Inna I. Kruman and Elena I. Schwartz

Ma, Y; Pannicke, U; Schwarz, K; Lieber, MR. (2002). Hairpin opening and overhang processing by an Artemis/DNA-dependent protein kinase complex in nonhomologous end joining and V(D)J recombination. Cell. 108,781-794. Macleod, MR; Ramage, L; McGregor, A; Seck, JR. (2003). Reduced NMDA-induced apoptosis in neurons lacking ataxia telangiectasia mutated protein. NeuroReport. 14,215217. MacPhail, S; Banath, J; Yu, T; Chu, E; Lambur, H; Olive, P. (2003). Expression of phosphorylated histone H2AX in cultured cell lines following exposure to X-rays. Int. J. Radiat Biol, 79,351–358. Mahmoudi, M; Mercer, J; Bennett, M. (2006). DNA damage and repair in atherosclerosis. Cardiovasc. Res. 71,259-268. Martin, FL; Williamson, SJ; Paleologou, KE; Hewitt, R; El-Agnaf, OM; Allsop, D. (2003). Fe(II)-induced DNA damage in alpha-synuclein-transfected human dopaminergic BE(2)M17 neuroblastoma cells: detection by the Comet assay. J. Neurochem. 87,620-630. Matsumura, S; Matsumura, T; Ozeki, S,; Fukushima, S; Yamazaki, H; Inoue, T; Inoue, T; Furusawa, Y; Eguchi-Kasai, K.(2003). Comparative analysis of G2 arrest after irradiation with 75 keV carbon-ion beams and 137Cs gamma-rays in a human lymphoblastoid cell line. Cancer Detect. Prev. 27,222-228. McKinnon, PJ.(2001). Ataxia telangiectasia: new neurons and ATM. Trends Mol. Med. 7,233-4. McMurray, CT.(2005). To die or not to die: DNA repair in neurons. Mutat. Res. 577,260-274 Mecocci, P; Polidori, MC; Ingegni, T; Cherubini, A; Chionne, F; Cecchetti, R; Senin, U. (1998). Oxidative damage to DNA in lymphocytes from AD patients. Neurology. 51,1014-1017. Meek, DW. (2004). The p53 response to DNA damage. DNA Repair (Amst). 3,1049-1056. Meng, RD; Phillips, P; El-Deiry, WS (1999). p53-independent increase in E2F-1 expression enhances the cytotoxic effects of etoposide and of adriamycin. Int. J. Oncol. 14,5-14. Migliore, L and Coppede, F. (2002). Genetic and environmental factors in cancer and neurodegenerative diseases. Mutat. Res. 512,135-153. Morris, EJ and Geller, HM. (1996). Induction of neuronal apoptosis by camptothecin, an inhibitor of DNA topoisomerase-I: evidence for cell cycle-independent toxicity. J. Cell Biol. 134, 757-770. Mullaart, E; Boerrigter, ME; Ravid, R; Swaab, DF; Vijg, J. (1990). Increased levels of DNA breaks in cerebral cortex of Alzheimer's disease patients. Neurobiol. Aging. 11,169-173. Nahelhus, TA; Haug, T; Singh, KK; Keshav, KF; Skorpen, F; Otterlei, M; Bharati, S; Lindmo, T; Benichou, S; Benarous, R; Krokan, HE. (1997). A sequence in the Nterminal region of human uracil- DNA glycosylase with homology to XPA interacts with the C-terminal part of the 34-kDa subunit of replication protein A. J. Biol. Chem. 272,6561-6566. Nagy, Z; Esiri, MM; Cato, AM; Smith, AD.(1997). Cell cycle markers in the hippocampus in Alzheimer's disease. Acta Neuropathol. (Berl). 94,6-15. Nazarov, I; Smirnova, A; Krutilina, R; Svetlova, MP; Solovjeva, LV; Nikiforov, AA; Oei, SL; Zalenskaya, IA; Yau, PM.; Bradbury, EM; Tomilin, NV. (2003). Dephosphorylation of histone g-H2AX during repair of DNA double-strand breaks in mammalian cells and its inhibition by calyculin A. Radiat. Res. 160,309–317.

DNA Damage Response and Apoptosis of Postmitotic Neurons

39

Niida, H and Nakanishi, M. (2006). DNA damage checkpoints in mammals. Mutagenesis. 21,3-9. Nilsen, H; Otterlei, M; Haug, T; Solum, K; Nagelhus, TA; Skorpen, F; Krokan, HE (1997). Nuclear and mitochondrial uracil-DNA glycosylases are generated by alternative splicing and transcription from different positions in the UNG gene. Nucleic Acids Res. 25,750755. Nouspikel, T and Hanawalt, PC. (2002). DNA repair in terminally differentiated cells. DNA Repair. (Amst). 1,59-75. Nussenzweig, A; Chen, C; da Costa Soares, V; Sanchez, M; Sokol, K; Nussenzweig, MC; Li, GC.(1996) Requirement for Ku80 in growth and immunoglobulin V(D)J recombination. Nature. 382,551-555. O'Connor, DJ and Lu, X. (2000). Stress signals induce transcriptionally inactive E2F-1 independently of p53 and Rb. Oncogene. 19,2369-2376. Offord, E; van Poppel, G; Tyrrell, R. (2000). Markers of oxidative damage and antioxidant protection: current status and relevance to disease. Free Radic Res. 33 Suppl, S5-19. O'Hare, M; Wang, F; Park, DS. (2002). Cyclin-dependent kinases as potential targets to improve stroke outcome. Pharmacol. Ther. 93,135-143. Oppenheim, RW. (1991). Cell death during development of the nervous system. Annu. Rev. Neurosci. 14,453-501. Parikh, SS; Mol, CD; Tainer, JA, (1997). Base excision repair enzyme family portrait: integrating the structure and chemistry of an entire DNA repair pathways. Structure. 5,1543-1550. Park, DS; Levine, B; Ferrari, G; Greene, L (1997). Cyclin dependent kinase inhibitors and dominant negative cyclin dependent kinase 4 and 6 promote survival of NGF-deprived sympathetic neurons. J. Neurosci. 17,8975-8983. Park, DS; Morris, EJ; Padmanabhan, J; Shelanski, MI; Geller, HM; Greene LA. (1998). Cyclin-dependent kinases participate in death of neurons evoked by DNA-damaging agents. J.Cell. Biol. 143,457-467. Pfeiffer, P; Goedecke, W; Obe, G. (2000). Mechanisms of DNA double-strand break repair and their potential to induce chromosomal aberrations. Mutagenesis. 15,289-302. Polager, S; Kalma, Y; Berkovich, E; Ginsberg, D. (2002). E2Fs up-regulate expression of genes involved in DNA replication, DNA repair and mitosis. Oncogene. 21,437-446. Przedborski, S and Vila, M. (2003). The 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine mouse model: a tool to explore the pathogenesis of Parkinson's disease. Ann. N. Y. Acad. Sci. 991,189-198. Ratan, RR; Murphy; TH; Baraban, JM. (1994). Oxidative stress induces apoptosis in embryonic cortical neurons. J. Neurochem. 62,376-379. Rehen, SK; McConnell, MJ; Kaushal, D; Kingsbury, MA; Yang, AH;Chun, J.(2001). Chromosomal variation in neurons of the developing and adult mammalian nervous system. Proc. Natl. Acad. Sci. U. S. A. 98,13361-13366. Ren, J; Datta, R; Shioya, H; Li, Y; Oki, E; Biedermann, V; Bharti, A; Kufe, D. (2002). p73beta is regulated by protein kinase Cdelta catalytic fragment generated in the apoptotic response to DNA damage. J. Biol. Chem. 277,33758-33765. Rhind, N and Russell, P. (2000). Checkpoints: it takes more than time to heal some wounds. Curr. Biol. 10,R908-R911.

40

Inna I. Kruman and Elena I. Schwartz

Rideout, HJ; Wang, Q; Park, DS; Stefanis, L. (2003). Cyclin-dependent kinase activity is required for apoptotic death but not inclusion formation in cortical neurons after proteasomal inhibition. J. Neurosci 23,1237-1245. Rolig, RL and McKinnon, PJ.(2000). Linking DNA damage and neurodegeneration. Trends Neuroscie. 23,417- 424. Rothkamm, K and Lobrich, M. (2003). Evidence for a lack of DNA double-strand break repair in human cells exposed to very low x-ray doses. Proc. Natl. Acad. Sci. USA. 100:5057–5062. Sancar A, Lindsey-Boltz LA, Unsal-Kacmaz K, Linn S. (2004). Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints. Annu. Rev. Biochem. 73,3985. Sedelnikova, OA; Rogakou, EP; Panyutin, IG; Bonner, WM. (2002). Quantitative detection of (125)IdU-induced DNA double-strand breaks with gamma-H2AX antibody. Radiat. Res. 158,486-492. Sedelnikova, OA; Pilch, DR; Redon, C; Bonner, WM. (2003). Histone H2AX in DNA damage and repair. Cancer Biol. Ther. 2,233-235. Sekiguchi, J; Ferguson, DO; Chen, HT; Yang, EM; Earle, J; Frank, K; Whitlow, S; Gu, Y; Xu, Y; Nussenzweig, A; Alt, FW. (2001). Genetic interactions between ATM and the nonhomologous end-joining factors in genomic stability and development. Proc. Natl. Acad. Sci. U. S. A. 98,3243-3248. Shi, Y; Venkataraman, SL; Dodson, GE; Mabb, AM; LeBlanc, S; Tibbetts, RS. (2004). Direct regulation of CREB transcriptional activity by ATM in response to genotoxic stress. Proc. Natl. Acad. Sci. U. S. A. 101,5898-903. Shiloh, Y. (2006). The ATM-mediated DNA-damage response: taking shape. Trends Biochem. Sci. 31,402-410. Shiloh, Y. (2003). ATM and related protein kinases: safeguarding genome integrity. Nat. Rev. Cancer. 3,155-168. Slupphaug, G; Kavli, B; Krokan, HE (2003). The interacting pathways for prevention and repair of oxidative DNA damage. Mutat. Res. 531,231-251. Sobol, RW; Horton, JK; Kuhn, R; Gu, H; Singhal, RK; Prasad, R; Rajewsky, K, Wilson, SH. (1996). Requirement of mammalian DNA polymerase-beta in base-excision repair. Nature. 379, 183-186. Sonoda, E; Hochegger, H; Saberi, A; Taniguchi, Y; Takeda, S. (2006). Differential usage of non-homologous end-joining and homologous recombination in double strand break repair. DNA Repair (Amst). Jun 23; [Epub ahead of print] Souza-Pinto, NC; Croteau, DL; Hudson, EK; Hansford, RG; Bohr VA.(1999). Age-associated increase in 8-oxo-deoxyguanosine glycosylase/AP lyase activity in rat mitochondria. Nucleic Acids Res. 27,1935-1942. Stevaux, O and Dyson, NJ.(2002). A revised picture of the E2F transcriptional network and RB function. Curr. Opin. Cell Biol. 14,6846-6891. Stommel, JMn and Wahl, GM. (2004). Accelerated MDM2 auto-degradation induced by DNA-damage kinases is required for p53 activation. EMBO J. 23,1547-1556. Tibbetts, RS; Cortez, D; Brumbaugh, KM; Scully, R; Livingston, D; Elledge, SJ; Abraham, RT. (2000). Functional interactions between BRCA1 and the checkpoint kinase ATR during genotoxic stress. Genes Dev. 14,2989-3002.

DNA Damage Response and Apoptosis of Postmitotic Neurons

41

Tobita, M; Nagano, I; Nakamura, S; Itoyama, Y; Kogure, K. (1995). DNA single-strand breaks in postischemic gerbil brain detected by in situ nick translation procedure. Neurosci. Lett. 200,129-132. Veglia, F; Matullo, G; Vineis, P. (2003). Bulky DNA adducts and risk of cancer: a metaanalysis. Cancer Epidemiol. Biomarkers Prev. 12,157-160. Vemuri, MC; Schiller, E; Naegele, R. (2001). Elevated DNA double strand breaks and apoptosis in the CNS of scid mutant mice. Cell Death Differ. 8,245-255. Verdaguer, E; Jorda, EG; Stranges, A; Canudas, AM; Jimenez, A; Sureda, FX;, Pallas, M; Camins, A. Inhibition of CDKs: a strategy for preventing kainic acid-induced apoptosis in neurons. Ann. N. Y. Acad. Sci. 1010,671-674. Walsh, MJ; Shue, G; Spidoni, K; Kapoor, A. (1995). E2F-1 and a cyclin-like DNA repair enzyme, uracil-DNA glycosylase, provide evidence for an autoregulatory mechanism for transcription. J. Biol. Chem. 270,5289-5298. Wang, H; Perrault, AR; Takeda, Y; Qin, W; Wang, H; Iliakis, G. (2003). Biochemical evidence for Ku-independent backup pathways of NHEJ. Nucleic Acids Res. 3,53775388. Wartiovaara, K; Barnabe,-Heider, F; Miller, FD; Kaplan, DR. (2002). N-myc promotes survival and induces S-phase entry of postmitotic sympathetic neurons. J. Neurosci. 22,815-824. Watanabe, M; Osada, J; Aratani, Y; Kluckman, K; Reddick, R; Malinow, MR; Maeda, N.(1995). Mice deficient in cystathionine beta-synthase: animal models for mild and severe homocyst(e)inemia. Proc. Natl. Acad. Sci. U. S. A. 92,1585-1589. Williams, GM and Jeffrey, AM. (2000). Oxidative DNA damage: endogenous and chemically induced. Regul. Toxicol. Pharmacol. 32,283-292. Wilson, TM; Rivkees, SA; Deutsch, WA; Kelley, MR.(1996). Differential expression of the apurinic / apyrimidinic endonuclease (APE/ref-1) multifunctional DNA base excision repair gene during fetal development and in adult rat brain and testis. Mutat. Res. 362,237-248. Wyllie, AH; Kerr, JF; Currie, AR. (1980). Cell death: the significance of apoptosis. Int. Rev. Cytol. 68,251-306. Yang, Y; Geldmacher, DS; Herrup, K. (2001). DNA replication precedes neuronal cell death in Alzheimer's disease. J. Neurosci 21,2661-2668. Yang, J; Yu, Y; Hamrick, HE; Duerksen-Hughes, PJ. (2003). ATM, ATR and DNA-PK: initiators of the cellular genotoxic stress responses. Carcinogenesis. 24,1571-1580. Yuan, J and Yankner, BA. (2000). Apoptosis in the nervous system. Nature. 407,802-809.

In: Brain Mapping and Diseases Ed: Diane E. Spinelle

ISBN: 978-1-61122-065-0 © 2011 Nova Science Publishers, Inc.

Chapter 3

TISSUE-, PERIOD- AND SITE-SPECIFICITY OF SOMATIC DNA RECOMBINATION IN THE GENOMIC REGION, BC-1. Toyoki Maeda1, Ryuzo Mizuno2, Saburo Sakoda3, Tomokazu Suzuki4 and Naoki Makino1 1

Division of Molecular and Clinical Gerontology, Department of Molecular and Cell Biology, Medical Institute of Bioregulation, Kyushu University, 4546, Beppu, Oita 874-0838, Japan. 2 Nishinomiya Minocipal Central Hospital, 8-24, Hayashidacho, Nishinomiya, Hyogo 663-8014, Japan. 3 Department of Neurology, Osaka University, 2-2, Yamadaoka, Suita, Osaka, 565-0871, Japan. 4 Kinki Central Hospital, 3-1, Kurumazuka, Itami-cuty, Hyogo 664-8533, Japan.

ABSTRACT The nuclear circular DNA population has been analyzed in mouse brain cells. The brain is active in producing extrachromosomal nuclear circular DNA during the embryonic and newborn neonatal stage. One circular DNA, BC-1,1 was cloned from a mouse embryonic circular DNA library. The genomic region containing the BC-1 DNA sequence was shown to undergo somatic DNA recombination yielding a DNA deletion and circular DNA in mouse embryonic brain. The genomic BC-1 region is also active in DNA recombination in non-brain organ tissue such as the ocular lens and spleen. Although the BC-1 region contains an evolutionally conservative DNA sequence homologous to the DNA sequence on human chromosome 3, the BC-1 does not contain any conventional exon and intron structure. The physiological significance and the molecular mechanism of the BC-1 DNA recombination and the BC-1 RNA expression

44

Toyoki Maeda, Ryuzo Mizuno, Saburo Sakoda et al. are not clear. In this study, the DNA sequence surrounding the BC-1 region and BC-1 RNA expression are further analyzed as a first step in order to explain for the mechanism of the somatic BC-1 DNA recombinational events.

INTRODUCTION Extrachromosomal circular DNA molecules have been identified in various kinds types of eukaryotic cells [(1-8)]. Almost all the circular DNA molecules have been regarded physiologically meaningless products accidentally formed except other than the by-products of the antigen receptor gene rearrangement in lymphatic tissues, where the intervening unnecessary DNA sequence lying between exon segments is removed as a circular DNA molecule [(9-12)]. Many of the circular DNA molecules, other than those of the antigen receptor genes, can be produced by DNA recombination at repetitive DNA sequence such as L1 repetitive DNA, known as illegitimate somatic DNA recombination [(2, 5)]. Therefore, circular DNA production has been considered to be closely associated with somatic DNA recombination. Circular DNA molecules have been studied in embryonic brain tissue and a circular DNA, designated as BC-1 DNA, has been cloned [(13)]. The BC-1 circular DNA has beenis detected reproducibly in the 16-day-old mouse brain by external region-directed PCR, which amplifies a circularized sequence containing a recombination joint (Figure 1).

Figure 1. Schematic drawing demonstrating the detected joining sites of circular DNA production and DNA deletion using ED-PCR and the standard PCR. A horizontal line depicts a genomic region yielding the DNA deletion accompanying circular DNA production. Short vertical bars on the horizontal line depict restriction sites used to cut fragments out from circular DNA molecules. Open and closed arrows along the circular DNA and the genomic region depict the ED-PCR primers. Note that they face to each other after the corresponding circular DNA molecule is produced and become able to amplify a DNA fragment containing a recombinational joint. The recombinational joints are indicated by the closed arrowheads. Horizontal gray arrows depict the PCR-primers used to amplify a genomic fragment containing a recombinational joint.

Tissue-, Period- and Site-Specificity of Somatic DNA Recombination…

45

Figure 2. Genomic Southern blot of brain and non-brain tissue specimens with a BC-1 probe. The 2.1 kb fragment is a BC-1 fragment. Eco RI-digested genomic DNA (5 μg/each lane) are shown as ethidium bromide-stained smears visualized under ultra-violet light. The left end-lane contains Hin dIIIdigested λ phage DNA (0.25 μg) as a molecular weight marker. The relative signal intensity of the detected 2.1 kb-BC-1-band is standardized with the corresponding smear density, using the NIH image software program.

The genomic region containing the BC-1 DNA sequence yields circular DNA from a narrow range around the BC-1 sequence in the brain from 13- to 17-day-old mice and a wide range of deletion after the circular DNA production. During the late embryogenesis, a DNA recombination mechanism is thought to be activated in the brain, because an impairment of the enzymatic components for DNA recombination disrupts brain development with massive neuronal death during the late embryonic period [(14-18)]. The BC-1 region can be one of regions for somatic DNA recombination driven by these enzymatic components in the brain at this stage. The BC-1 region contains conserved DNA segments highly homologous to the DNA on human chromosome 3. The joining points of circular DNA production and DNA deletion are located near the conserved segments, and the gene structure around the recombination joints has been identified. No specific sequence resembling the recognition signal sequence for the antigen receptor genes at the joining point has been detected either. BC-1 circular DNA production and BC-1 DNA rearrangement has also been detected in nonbrain tissue including the ocular lens and spleen [(19)]. In addition, the BC-1 region does not contain any known gene segments or conventional gene structure containing exon and intron segments, nor has BC-1 RNA been detected in a northern Northern blot analysis of the brain, lens and spleen using a BC-1 probe [(19)]. However, an in situ hybridization analysis probed with the conserved sequence of the BC-1 region on the head partfrom the head region of the embryonic and newborn mouse has shown a signal in the ocular lens but not in the brain. It is unclear whether BC-1 RNA is truly expressed in the lens, because it is possible that the lens may contain a specific protein which can bind to the labeled BC-1 probe. BC-1 rearrangement may be related to ectodermal development, but no biological function of BC-1 rearrangement and expression has yet been demonstrated. This study shows the findings of a further analysis

46

Toyoki Maeda, Ryuzo Mizuno, Saburo Sakoda et al.

of the BC-1 sequence and the DNA sequence surrounding the recombinational joining points, while also investigating the BC-1 expression in a wider range of organs and period stages in an attempt to obtain hints for elucidation to characterize the BC-1 function.

MATERIALS AND METHODS Nuclear Circular DNA Preparation and Establishment of a Circular DNA Library Circular DNA molecules were extracted according to the method previously described [(13)]. Tissue specimens were homogenized in a nuclear isolation buffer (0.3 M sucrose, 20 mM Tris-HCl (pH 7.6), 10 mM KCl, 0.5 mM EDTA, 3 mM CaCl2) supplemented with 0.5% Nonidet-P40 and then the cell nuclei were collected. The collected cell nuclei were homogenized in alkaline buffer containing detergent (50 mM NaCl, 2 mM EDTA, 1% sodium duodecyldodecyl sulfate). The lysate was mixed by vortexing for 2 min and then it was incubated at 30°C for 30 min. The sample was neutralized with 0.1 volume of 1M Tris-HCl (pH 7.1) and 5 M NaCl and then was incubated with proteinase K (100 μg/mL). Crude circular DNA fraction was obtained by phenol-chloroform extraction. The circular DNA fraction was subjected to linear DNA-specific DNase (ATP-dependent DNase from Misrococcus luteus, Toyobo Biochemical Corp., Osaka, Japan) to eradicate non-circular DNA molecules. Circular DNA molecules were extracted from about 3g of tissue, finally dissolved in 100μl of TE buffer (10mM TrisHCl, pH8.0, and 1mM EDTA). Twenty microliters of the extracted circular DNA were digested with Eco RI and ligated into λZAPII phage arm DNA to establish a circular DNA library.

Polymerase Chain Reaction (PCR) Long PCR and ED-PCR (External region-Directed-PCR) methods were performed as described previously [(13)]. PCR was performed on a programmable thermal controller PC700 (Aztec, Tokyo, Japan) under the following conditions: 30 cycles of 98°C for 20 seconds and 68°C 2 min, using LA-Taq polymerase (Takara) and Perfect Match PCR Enhancer (Stratagene), followed by A-tailing for 10 min at 72°C according to the manufacturer’s protocols. Every PCR experiment was performed as nested PCR to detect very rare DNA recombination with two sets of PCR primers (nested primers). The primers for the first round PCR were set to encompass the DNA sequence expectedly amplified by the second round PCR (Figure 3). The DNA sequence of the PCR primer set to detect recombination joint of BC-1 circular DNA and BC-1 deletion are: The first round ED-PCR primer set for circular DNA: 5’-GATGGGGAGGTAACAAGACAGAGAGGAGATGATAA-3’ 5’-TTGATGATGTTCATATTCCAGCAGAATCCACCAAC-3’

Tissue-, Period- and Site-Specificity of Somatic DNA Recombination…

47

The second round ED-PCR primer set for circular DNA: 5’- CACAATGCATGTGAATAGTTATCCACAGATACAGC-3’ 5’- ATAAAGATGATAAAAGACAGCCCGAGGAGAAT-3’ The first round long genomic PCR for DNA deletion: 5’- GATCTCCAGTGAGTACTGACTCCCTTCTTTAAAAT-3’ 5’- AGAGAGGAATTTGATACTTCCAGAACATTTTCTT-3’ The second round long genomic PCR for DNA deletion: 5’- CGATGCTGGTGCTTTGGTGGTTGAGTCTAA-3’ 5’- GCTTTATAAATGCAAAACCCTGGCTGCTCTTTCGA-3’ The brain, ocular lens and spleen from postnatal 50 and 100 day old Balb/c mice (P50 and P100) were used to analyze BC-1-associated DNA recombination of the aged mouse.

DNA Sequencing DNA sequencing was accomplished by using fluorescence-labeled dideoxy terminator chemistry and Taq I DNA polymerase on an ABI377 automated DNA sequencer (Applied biosystems) according to the manufacturer’s protocols.

Figure 3A.

(1) 13E Brain TCCAAAAAATTTCTATAGTTCATCAAATATCACAACAGAATTTGCTAAAAATTTTTACATAAATTTTTTATTTGAAAAAATCTT TCTAAAATTGTGTAATAAACTATAAAGATGATAAAAGACAGCCCGAGGAGAATATATGTTTGATAGTGCACCAGAAACTGTGAGT (2) 15E Brain TCATATAATATCTAAATTCTAGCAACAAGAAAGATGAATACAATTAGAGCTCCAGTAGAGTTATTTAGACTGAGACTATGCCATGTGCAG TAGAATAAAACCTAGCATATACTTTAAACTCAAAGTTCCTTCTGTTCTTTCTTC (3) 17E Brain TACTTTTAATTCCAGTACTCTGTGTTTGGAGGATGCCATGAGAGAGTTCAAGG AGAATAAAACCTAGCATATACTTTAAACTCAAAGTTCCTTCTGTTCTTTCTTCTTTTCTTCTTTCCTTCTTTTCTTCTCTCCTTCT (4) 16E Brain GATCAATTTTAATTGGCCAACCAAGACATTGTGTAGTAAAAATAGGTTACAGATTTAAAAGGTGTTAGAATTCACTTTTGTGAATAA ATGTTATATACAAAATGTGTCACAAATCTATCTTAAACTTAGAAGATTCAACTCCAATATCTCTCCCTGGAGAGCAACAATGATTACATGCA GGTAAAAGCAAAGTAATGATAAAAATCC (5) 15E Brain CTTTCTCTCTTTCTTTTTTTTTCTTTCTTTCTCTCATCTATAGACTTGTGTGGTC TGAAATTTTTACCTCTGTTGTTTTTGTTATATAACTTTTGGAACATGAACCAATTTTAAATGTTGAAAAGTATTGACC

Figure 3B.

(6) P0 Brain, P0 Lens, P21 Spleen GTTTGTATTCTTAGATAAAATTGGTTTTGAATATATGATATGGTAGATTTCAAA CTCAAATAAAAGGCTGAGATGCAAACAGAATAATTAAAGAATAAAACTGAAAATTAGCCTGAATAACTGA (7) P0 Brain TTGAATATATGATATGGTAGATTTCAAATTGTATCACCTACAATACATCATACATTTTTTTAAACAAACTGAGTTTTATAAGAC CAGAATAATTAAAGAATAAAACTGAAAATTAGCCTGAATAACTGAATCTGCACAAAACTCATATATTGAACCACATTCCCATGA (8) P0 Brain GGGTTTTATTTCTGCAGAATTAAAACTATTTTTATAAAATAGGAAGTCATACTCTTGGGGAAATGTTACTTTTTTTTCCA ACTAAAATAGCAAGTCATATAGAAAGGAAGATATTTGTCCATGTCATTTAAATGTAATAAAGGCATTGG (9) P21 Spleen TGATTTTAAAAGATGCTGACACTACAGCTAAGCAGGACTTGTAGTATCAACAACAGTAAAAAAAAATTCTAGAA CCCCCGAGCCTTCCATCATACTTGAAATAAAACAAAGAAATGAGCTAAAAACTTGGG (10) 16E Brain AGAATATATGTTTGATAGTGCACCAGAAACTGTGAGTGTGATATTTTCCTCCA CAGAAGTGCAATAGCCCATTACTGGATGGCCATCCTTTGCCTTCTACTGTGTTGCTCATTCAGTCCCTGGGAAACAATTTGCACAATTAAG

Figure 3. Structure of the genomic region surrounding the 2.1 kb-BC-1 fragment. A. A schematic drawing of the genomic region surrounding the BC-1 fragment. Double horizontal lines depict a genomic DNA region containing BC-1-associated DNA recombinational joints on mouse chromosome 16. Black squares depict the human-orthologous conserved segmental sequence. The gray zone depicts the 2.1 kb BC-1 fragment. The 5’ and 3’ are indicated to show the direction and relative locations of the sequences lying in this region. Bracketed numbers depict the recombinational joint pairs of circular DNA production (from 1 to 5) and DNA deletion (from 6 to 10). These numbers correspond to those in B. Open triangles depict long nested PCR primers used to detect the deletion joints. Closed triangles depict ED-PCR primers to detect recombination sites on circular DNA. B. DNA sequence surrounding the recombinational joints. Boxed nucleotides indicate homology at the joints. The upper and lower lane shows the sequence around a joining point at the 5’ and 3’ side, respectively. Joining points without homology are indicated by vertical bars across the lanes. Six base pair or longer AT-stretches are dotted-underlined. The V(D)-J recombination-‘heptamer’-like sequence are broken-underlined. E; embryonic day-old. P; postnatal day-old.

50

Toyoki Maeda, Ryuzo Mizuno, Saburo Sakoda et al.

In Situ Hybridization In situ hybridization was performed as previously described [19]. For the BC-1 cRNA probe preparation, the 470 bp Eco RI-Bam HI fragment containing a human-orthologous sequence was subcloned into pBluescript II plasmid. The plus and minus strand probe were transcribed from the inserted cloned DNA by two promoters with opposite directions respectively at the cloning site. Sections were postfixed by exposure to formaldehyde vapors for 30 min. Prehybridization and hybridization were done as described previously. In the case an erasing RNA signal was observed, RNase A-pretreatment was performed just before prehybridization as follows; The section was overlaid with 100 μl of 50 μg/mL RNase A solution, incubated at 37ºC for 30 min and washed twice with 0.15 M NaCl solution and further washed twice with 0.15 M NaCl supplemented with RNasin (RNase inhibitor; 1 u/μl; Promega Co Ltd). Sections were postfixed by exposure to formaldehyde vapors for 30 min. Prehybridization and hybridization were done as described previously. Thereafter, the sections were dehydrated through graded ethanols, containing 0.3M ammonium acetate; vacuum dried; and exposed to X-ray film for 1-10 days and it was developed.

Other Methods for DNA Analysis DNA clones were analyzed by standard procedures [20].

DNA Sequencing DNA sequencing was accomplished by using fluorescence-labeled dideoxy terminator chemistry and Taq I DNA polymerase on an ABI377 automated DNA sequencer (Applied biosystems) according to the manufacturer’s protocols.

In Situ Hybridization In situ hybridization was performed as previously described (19). For the BC-1 cRNA probe preparation, the 470 bp Eco RI-Bam HI fragment containing a human-ortholopgous sequence,sequence was subcloned into pBluescript II plasmid. Plus The plus strand and minus strand probe were transcribed from the inserted cloned DNA by two promoters with opposite directions respectively at the cloning site. Sections were postfixed by exposure to formaldehyde vapors for 30 min. Prehybridization and hybridization were done as described previously. In the case of an erasing RNA signal was observed, RNase A-pretreatment was performed just before prehybridization as follows;. The section was overlaid with 100 μl of 50 μg/mL RNase A solution, incubated at 37°C for 30 min and washed twice with 0.15 M NaCl solution and further washed twice with 0.15 M NaCl supplemented with RNasin (RNase inhibitor) (; 1 u/μl) (; Promega Co Ltd). Sections were postfixed by exposure to formaldehyde vapors for 30 min. Prehybridization and hybridization were done as described previously. Thereafter,Then the sections were dehydrated through graded ethanols, containing

Tissue-, Period- and Site-Specificity of Somatic DNA Recombination…

51

0.3M ammonium acetate; vacuum dried; and exposed to X-ray film for 1-10 days and it was developed.

RESULTS Southern Blot Analysis of BC-1 DNA of Brain and Non-Brain Organs in Pre- and Postnatal Stage Prenatal (embryonic 16-day-old) brain and liver, and postnatal (21-day-old) brain and liver and thymus were subject toDNA studied by a genomic Southern blot analysis probed by a 2.1 kb Eco RI-BC-1 fragment. No rearranged band and apparent deletion of BC-1 was detected in the brain (Figure 2). The BC-1 deletion seemed to be restricted to a very small cell population in the brain.

DNA Sequence Analysis Surrounding the Recombination Joints We identified 10 pairs of the recombination joint around the BC-1 region. Five of them are coded for circular DNA production and the rest for genomic deletions (Figure 3). No specific signal-like sequence was identified at or near the joints. However, some tendencies were observed. The DNA deletion joints tended to show short homology at the joints and were located in regions rich in A and T nucleotides. Hexamer or longer AT stretches were observed near the joints. In case of the joints for the BC-1 circular DNA production, adding in addition to the AT stretch, there was a heptamer similar to the signal heptamer sequence (CACAGTG/CTCTGTG) of the antigen-receptor gene rearrangement located near the circular DNA joints. Furthermore, no homology at the joints was observed. The AT-stretch and signal-heptamer like sequence may play a part in the BC-1-associated DNA recombinational events.

Variety in the Population Size of Extrachromosomal Circular DNA of Brain and Non-Brain Organs According to our previous report, BC-1-associated DNA recombination takes place in a limited period, from a late embryonic period to an early postnatal period [(13, 19)]. Then, we analyzed, the circular DNA population size in the brain and liver to compare the BC-1 recombination activity and total circular DNA producing activity between in brain and in non-brain organ tissues (Figure 4). In addition, the size of L1-containing circular DNA population was also evaluated, since L1 DNA is one of major genomic sequence involved in circular DNA production [(2, 6)].

52

Toyoki Maeda, Ryuzo Mizuno, Saburo Sakoda et al.

Figure 4. Quantitative estimation of the circular DNA clones in pre- and postnatal brain tissue and liver tissue specimens. Counts of total phage plaques of λ ZAPII circular DNA library from 108 cells of tissue (brain or liver) are shown as open columns. L1 sequence-containing plaques (L1-plaques) were shown as gray columns. L1-plaques were detected as positive plaques hybridizing to the L1 sequencecontaining DNA probe mixture (LINE-1 probe), which contains clones originating from a 16E-brain circular DNA library ( ). E; embryonic day-old. P; postnatal day-old.

The results showed that brain and liver contained nuclear circular DNA and the contents population of circular DNA sequences were different in the brain and liver. The postnatal brain contained much less of the circular DNA and much less of the L1 DNA than the liver and embryonic brain. The content level of L1-circular DNA was almost parallel to the total size of circular DNA, but the brain revealed less content of the L1-circles (0.3575/1.3 at 16E, 0.00036/0.072 at P21) in comparison to the total size the liver (1.672/3.8 at 16E, 20.175/25 at P21). The postnatal brain seemed to contain almost no circular DNA-producing activity. These observations suggested that the brain showed reduced circular DNA-producing activity in during the embryonic stage and low L1-mediated circular DNA-producing activity.

Chronological Alteration of Population Size of Brain Circular DNA We also studied the circular DNA population size which was also analyzed in brain during its development (Figure 5). The P0 brain contains the most circular DNA and the amount of circular DNA decreased later. Circular DNA-production in the brain seemed not to

Tissue-, Period- and Site-Specificity of Somatic DNA Recombination…

53

appear to be preferentially mediated by L1 DNA circle formation. A BC-1 genomic deletion has been observed mainly at in the P0 brain. A non-L1 circle producing mechanism in the brain may be associated with BC-1 circular DNA production. Ocular lens and spleen from P50 and P100 mice were analyzed by ED-PCR and long PCR for the BC-1 region to determine whether BC-1-associated DNA recombination has limited activity during the early stage of brain development or is still active in later stages. A non-L1 circle producing mechanism in the brain may be associated with BC-1 circular DNA production. To see whether BC-1-associated DNA recombination is active limitedly in developmental early stage or still active in aged period, brain O, ocular lens and spleen of from P50 and P100 mice were subjected to analyzed by ED-PCR and long PCR for the BC-1 region to determine whether BC-1-associated DNA recombination has limited activity during the early stage of brain development or is still active in later stages. No signal was identified in tissue from either period of organs in the PCR experiments. From the present and previous results, the BC-1associated DNA recombination activity demonstrated by these and the previous resultsis are summarized in Table 1. BC-1-associated-DNA recombinational events were not detected in aged the later stage mouse. The BC-1-recombinations seemed to be restricted in a developmental stage to the late embryonic to the postnatal young stage

Figure 5. Quantitative estimation of circular DNA clones in pre- and postnatal brain tissue. Counts of total phage plaques of λ ZAPII circular DNA library from 108 cells of tissue (brain or liver) are shown as blank columns. L1 sequence-containing plaques (L1-plaques) were shown as gray columns. E; embryonic day-old. P; postnatal day-old.

No signal was identified in tissue from either period in the PCR experiments. The BC-1associated DNA recombination activity demonstrated by these and the previous results are summarized in Table 1. BC-1-associated-DNA recombinational events were not detected in

54

Toyoki Maeda, Ryuzo Mizuno, Saburo Sakoda et al.

the later stage mouse. The BC-1-recombination seemed to be restricted to the late embryonic to the postnatal young stage. Table 1. BC-1-associated DNA recombinational events in the brain, lens, and spleen with aging Age Brain Lens Spleen

Circular DNA DNA deletion

16E (+) (-)

P0 (-) (+)

P21 (-) (-)

P50 (-) (-)

P100 (-) (-)

Circular DNA DNA deletion Circular DNA DNA deletion

n.d. n.d. n.d. n.d.

(+) (+) n.d. n.d.

(-) (+) (-) (+)

(-) (-) (-) (-)

(-) (-) (-) (-)

(+): The BC-1-associated DNA recombinational events were detected. (-): The BC-1-associated DNA recombinational events were not detected. n.d.; not done.

Chronological Alteration of BC-1 RNA Expression in Organs We analyzed the spleen (21-day-old postnatepostnatal), liver (21-day-old postnatepostnatal) and whole body embryo (17-day-old embryo) by in situ hybridization probed by the BC-1 probe. No significant signal was detected in these tissue specimens. Only the ocular lens revealed the BC-1 signal in specimens from the late an embryonic period to the newborn period, and the signal was erased by the RNase-pretreatment (Figure. 6). This observation confirmed that the detected signal was brought by BC-1 RNA expression in the lens.

Chronological Alteration of BC-1 RNA Expression in Organs The spleen (21-day-old postnatal), liver (21-day-old postnatal) and whole body embryo (17-day-old embryo) were analyzed by in situ hybridization probed by the BC-1 probe. No significant signal was detected in these tissue specimens. Only the ocular lens revealed the BC-1 signal in specimens from the late embryonic period to the newborn period, and the signal was erased by the RNase-pretreatment (Figure 6). This observation confirmed that the detected signal indicated BC-1 RNA expression in the lens.

Evolutional Conservation of the BC-1 Region among Vertebrates The BC-1-homologous region is well conserved only among the placental mammals but not in the monotreme, marsupial, bird, or fish (Table 2).

Tissue-, Period- and Site-Specificity of Somatic DNA Recombination…

55

From evolutional aspect of BC-1 appearance in the placental mammals, this indicates that the BC-1 expression or the BC-1 deletion possibly contributes to a physiological function specific for placental mammals except monotremes and marsupials.

Figure 6. In situ hybridization for whole embryo, brain, lens, spleen and liver with the BC-1 probe. (+) and (-) depict the plus strand probe and the minus strand probe, respectively. The (+) probe is defined as that yielding a positive signal in the ocular lens. RNase (+) depicts that RNase-pretreatment was performed just before prehybridization. RNase (-) depicts no RNase pretreatment. Arrows indicate the lens. Note that the BC-1 signal in lens almost disappears following RNase pretreatment. The BC-1 signal in lens is detected weakly at 18E and intensely at P0 and P4, but no signal is seen in the P8 lens. Organ and tissue specimens other than ocular lens did not reveal any apparent positive signal. E; embryonic day-old. P; postnatal day-old.

Table 2. Evolutional conservation of BC-1 among vertebrates Animal species Homo sapiens (human) Bos taurus (bovine) Equus caballus (horse) Canis lupus familiaris (dog) Mus musculus (mouse) Rattus norvegicus (rat) Tupaia belangeri (tree shrew) Monodelphis domestica (opposum) Ornithorhynchus anatinus (duck-billed platypus) Gallus gallus (chicken) Danio rerio (zebrafish)

Homology to mouse BC-1(%) 87 84 84 86 100 92 87 (-) (-) (-) (-)

56

Toyoki Maeda, Ryuzo Mizuno, Saburo Sakoda et al.

Five hundred and nine base pair-long human-orthologous sequence in the 2.1kb BC-1 fragment is compared to other species’ orthologue. (-): No significant orthologous sequence was found in an NCBI BLAST search.

DISCUSSION We have reported a genomic region, BC-1, which yields circular DNA production and undergoes DNA deletion in brain tissue from embryonic and newborn period mice but not in aged tissue from later stages (Table 1). The brain turned out to bear a low circular DNA producing activity mainly in embryonic stage (Figure 5). BC-1 circular DNA may be produced by a non-L1-mediated circular DNA production mechanism whose activity is highest during the neonatal period and reduced later. A genomic Southern blot analysis with BC-1 did not reveal any significant change indicating a BC-1 DNA deletion (Figure 2). A Southern blot may not be sufficiently sensitive to detect BC-1 deletion in a very small population of brain cells. The detection of BC-1 recombinational events required a high sensitivity brought by the use of highly sensitive PCR-based methods. BC-1 circular DNA and the BC-1 deletion are not detectable by a single PCR amplification but require two rounds of PCR amplification with nested primers [(13, 19)]. This difficulty in detecting BC-1 recombinational events is considered to indicate that BC-1 recombinational events are very rare and that they occur in a very small number of cells. In order to elucidate the mechanism for the rare BC-1 rearrangement, the site-specificity and possible signal sequence for the BC-1 DNA recombinational events were studied. Sitespecific circular DNA production is thought to occur exclusively in the antigen receptor gene rearrangements. The V-(D)-J recombination contributes to diversification of the antigenbinding capacity of immunoglobulin and T-cell receptors. This recombination occurs precisely at a site of the recognition signal sequence consisting of a CACAGTG/CACTGTG heptamer and an ACAAAAACC/GGTTTTTGT nonamermonomer. It is possible that a transgene containing this heptamer/nonamermonomer recognition signal sequence (RSStransgene) can possibly undergo DNA recombination in the brain in addition to the immune organs tissue specimens [(21)]. No specific DNA sequence has been identified at the joining sites of the BC-1 recombination for circular DNA production and the DNA deletion [(13)]. In this study, we investigated the sequence surrounding the BC-1 recombination sites for a DNA sequence characteristic of the BC-1 recombination (Figure 3B). An AT stretch was identified in the sequence surrounding the recombination joints for circular DNA formation and DNA deletion. HA heptamer (CACAGTG/CACTGTG) like sequence segments were identified only in the BC-1 circular DNA-producing region, within 50 bp from the joining sites, but not at the sites of recombination. The RSS-transgene rearrangement in the brain has been reported to occur not at but near the heptamer sequence [(21)]. The accuracy association of the recombination joint location with the heptamer seems to be decreased in the brain. This suggests that ‘heptamerthe ‘heptamer’-like sequence might be associated with BC-1 circular DNA production and DNA deletion in this region (Figure 3). On the other hand, the recombination sites for deletion were detected in the AT-stretch but not near the ‘heptamer’like sequence except a for a small deletion in the BC-1 circular DNA-producing region. The sequence homology at the joining points was observed more for the deletion than for the circular DNA production. Moreover, BC-1 circular DNA production preceded large BC-1

Tissue-, Period- and Site-Specificity of Somatic DNA Recombination…

57

deletions. These observations imply that the DNA deletion encompassing the BC-1-circular DNA-producing region and the BC-1 circular DNA production are controlled by different mechanisms for DNA recombination. BC-1-associated-DNA recombinational events including BC-1 circular DNA production and narrow-ranged deletions may be an initial step for larger BC-1 deletions and may predispose the cells for the following wide-ranged DNA deletions. The wide-ranged BC-1 rearrangement results in the deletion of segmental conservative DNA sequences including the BC-1 region in the cell. Although the physiological significance of the BC-1-associated DNA recombinational events is unclear so far, the evolutional conservation of the BC-1 DNA sequence implies the biological importance of the region. Even though the deleted region did not seem to contain conventional gene structure and any reasonable open reading frames, the conserved DNA sequence may be transcribed and the BC-1 expression may be associated with the BC-1 deletion. In fact, the BC-1 transcript was detected in the ocular lens by an in situ hybridization experiment. No evidence of BC-1 being transcribed in brain has yet been obtained (Figure 6). The BC-1 transcript, however, was not detected in the Northern blot of lens RNA, and several attempts to clone BC-1 cDNA have not been unsuccessful [(19)]. Such sequential failures to detect BC-1 RNA except by in situ hybridization experiment made us suspicious about BC-1 RNA expression in lens, because the BC-1 signal in lens could result from lens protein binding to the BC-1 cRNA probe without a BC-1 transcript. In the present study, in situ hybridization with RNase-pretreatment erased the BC-1 signal, thus suggesting that the detected signal was derived from BC-1 RNA expressed in the lens (Figure 6). The inability to detect the BC-1 transcript as a band in a Northern blot analysis implies that that various sizes of BC-1 transcripts does not converge in a single band. The BC-1 genomic region around the BC-1 fragment does not have a conventional gene structure,structure; nevertheless, RNA transcripts are expressed from the BC-1 region in limited specific organs and during a specific stage of development. The observed BC-1 expression implies the existence of a new unknown RNA function. The BC-1 transcription may be partly regulated by BC-1 deletions. For example, BC-1 deletions may be expected to result in loss of BC-1 transcript in the cells. However, BC-1 RNA expression did not seem to coincide to with BC-1 circular DNA production and BC-1 deletion was detected in the lens, as an intense hybridization signal of BC-1 transcripts was detected in P0 lens and it disappeared completely in the P8 lens. However, the BC-1 deletion was detectable in both the P0 and P21 lens. The observed BC-1 deletion seemed to be restricted to a very small number of lens cells, because not a single round of genomic PCR, but a nested two-round course of genomic PCR was required to detect the BC-1 rearrangements. It seems that most lens cells express the BC-1 transcript and a few cells show a rearranged BC-1 region during the newborn period. Biological The biological function of the BC-1 transcript in the lens is unclear so far. The brain and lens have been reported to show somatic DNA recombination with LINE3 repetitive DNA [(22)]. Since the BC-1associated recombination sites were not surrounded by LINE3 sequence, LINE3rearrangement and BC-1 rearrangement seemed to be mediated by different mechanisms. However, both reports support the hypothesis that the brain and lens show a somatic DNA recombination activity. The brain and lens have common biological aspects. For example, both are ectodermal organs. Moreover, the parietal eye of submammalian species has evolved to the pineal gland of placental mammals. The pineal gland is an organ in the brain, which shares several

58

Toyoki Maeda, Ryuzo Mizuno, Saburo Sakoda et al.

common features with the ocular lens. This suggests that the pineal gland may be a candidate organ that can demonstrate the BC-1-associated DNA recombination commonly observed in the lens. The BC-1 sequence is conserved among the placental mammals. And the function of the pineal gland has changed with evolution. The pineal gland has a biological clock locates in the pineal gland in birds which is located in the suprachiasmatic nucleus of the hypothalamus in mammals [(23)]. The evolutionally altered function of the pineal gland may be attributed to mammals gaining the conserved BC-1 genomic region. However, it is unclear as to how BC-1-associated DNA recombination is associated with the pineal gland development during the late embryonic and newborn stages. On the other hand, the spleen also reveals the BC-1 deletion [(19), )]. The BC-1 associated biological function should work commonly in the lens cells, splenocytes, and brain cells. The spleen contains B-cells undergoing immunoglobulin class-switch recombination, which occurs preferentially at a ‘switch region’ comprising repetitive DNA adjacent to the immunoglobulin constant regions and accompanies circular DNA production by DNA deletion [(11)]. Some aspects of this of switch DNA recombination mechanism may also play a part in the BC-1-associated DNA recombination mechanism, but their relationship is still unclear. Further investigation is necessary to elucidate the BC-1-associated genetic events and cell functions in the brain, lens and spleen.

ACKNOWLEDGMENT We are grateful to Mr. Brian Quinn for linguistic advice.

REFERENCES [1]

[2]

[3]

[4]

[5]

Stanfield, S.W., &and Lengyel, J. A. (1979) Small circular DNA of Drosophila melanogaster: chromosomal homology and kinetic complexity, Proc. Natl. Acad. Sci. USA 76 6142-6146. Jones, R.S. &and Potter, S.S. (1985) L1 sequences in HeLa extrachrosomal circular DNA: evidence for circularization by homologous recombination. Proc. Natl. Acad. Sci. USA 82,1989-1993. Stanfield, S.W. &and Helinski, D.R. (1986) Multiple mechanisms generate extrachromosomal circular DNA in chinese hamster ovary cell. Nucleic Acids Res. 14, 3527-3538. Sunnerhagan, P. Sjoberg, R. M. Karlsson, A. L. Lundh. L. &and Bjursell G. (1986) Molecular cloning and characterization of small polydisperse circular DNA from mouse 3T6 cells, Nucleic Acids Res. 14, 7823-7838. Pont, G. Degroote, F. &and Picard, G. (1988) Illegitimate recombination in the histone multigenic family generates circular DNAs in Drosophila embryos, Nucl. Acids Res. 16 8817-8833.

Tissue-, Period- and Site-Specificity of Somatic DNA Recombination… [6]

[7]

[8]

[9]

[10] [11]

[12] [13]

[14]

[15]

[16]

[17]

[18]

[19]

59

Gaubatz, J. W. &and Flores, S. C. (1990) Tissue-specific and age-related variations in repetitive sequences of mouse extrachromosomal circular DNAs, Mutat. Res. 237, 2936. van Loon, N., Miller, D., &and Murnane, J.P. (1994) Formation of extrachromosomal circular DNA in HeLa cell by nonhomologous recombination. Nucl. Acids Res. 22, 2447-2452. Cohen, S., Menut, S., &and Mechali, M. (1999) Regulated formation of extrachromosomal circular DNA molecules during development in Xenopus laevis, Mol. Cell. Biol. 19, 6682-6689. Okazaki, K., Davis, D. D., &and Sakano, H. (1987) T cell receptor β gene sequences in the circular DNA of thymocyte nuclei: Direct evidence for intramolecular DNA deletion in V(D)J joining, Cell 49477-485. von Schwedler, U., Jack, H. M., &and Wabl, M. (1990) Circular DNA is a product of the immunoglobulin class switch rearrangemen., Nature 345, 452-456. Matsuoka, M. Yoshida, K. Maeda, T. Usuda, S., &and Sakano, H. (1990) Switch circular DNA formed in cytokine-treated mouse splenocytes: Evidence for intramolecular DNA deletion in immunoglobulin class switching, Cell 62, 135-142. Iwasato, T. Shimizu, A. Honjo, T. Yamagishi, H. (1990) Circular DNA is excised by immunoglobulin class switch recombination, Cell 62, 143-149. Maeda, T., Chijiiwa, Y., Tsuji, H., Sakoda, S., Tani, K., &and Suzuki, T. (2004). Somatic DNA recombination yielding circular DNA and deletion of a genomic region in embryonic brain. Biochem. Biophys. Res. Commun. 319,1117-1123. Barnes, D. E., Stamp, G., Rosewell, I., Denzel, A., &and Lindahl, T. (1998) Targeted disruption of the gene encoding DNA ligase IV leads to lethality in embryonic mice. Curr. Biol. 8,1395-1398. Gao, Y., Sun, Y., Frank, K. M., Dikkes, P., Fujiwara, Y., Seidl, K. J., Sekiguchi, J. M., Rathbun, G. A., Swat, W., Wang, J., Bronson, R. T., Malynn, B. A., Bryans, M., Zhu, C., Chaudhuri, J., Davidson, L., Ferrini, R., Stamato, T., Orkin, S. H., Greenberg, M. E., &and Alt, F. W. (1998) A critical role for DNA end-joining proteins in both lymphogenesis and neurogenesis. Cell. 95, 891-902. Gu, Y., Sekiguchi, J., Gao, Y., Dikkes, P., Frank, K., Ferguson, D., Hasty, P., Chun, J. J., &and Alt, F W. (2000) Defective embryonic neurogenesis in Ku-deficient but not DNA-dependent protein kinase catalytic subunit-deficient mice. Proc. Natl. Acad.. Sci. USA. 97, 2668-2673. Murai, M., Enokido, Y., Inamura, N., Yoshino, M., Nakatsu, Y., van der Horst, G. T, Hoeijmakers JH, Tanaka K, Hatanaka H. (2001) Early postnatal ataxia and abnormal cerebellar development in mice lacking Xeroderma pigmentosum Group A and Cockayne Syndrome Group B DNA repair genes. Proc. Natl. Acad. Sci. USA. 98, 13379–13384. Sugo, N., Aratani, Y., Nagashima, Y., Kubota, Y., &and Koyama, H. (2000) Neonatal lethality with abnormal neurogenesis in mice deficient in DNA polymerase beta. EMBO J. 191, 397-404. Maeda, T., Mizuno, R., Sugano, M., Satoh, S., Oyama, J., Sakoda, S., Suzuki, T., &and Makino, N. (2006) Somatic DNA recombination in a mouse genomic region, BC-1, in brain and non-brain tissue. Can. J. Physiol Pharmacol. 84, 443-449.

60

Toyoki Maeda, Ryuzo Mizuno, Saburo Sakoda et al.

[20] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989). A Laboratory Manual. 2nd ed. 3vol. Cold Spring Harbor Laboratory Express, Cold Spring Harbor, NY. [21] Matsuoka, M., Nagawa, F., Okazaki, K., Kingsbury, L., Yoshida, K., Müller, U., Larue, D. T., Winer, J. A., &and Sakano, H. (1991) Detection of somatic DNA recombination in the transgenic mouse brain. Science. 254: 81-86. [22] Yokota, H., Iwasakii, T., Takahashi, M., &and Oishi, M. (1989) A tissue-specific change in repetitive DNA in rats. Proc. Nati. Acad. Sci. USA. 86, 9233-9237. [23] Csernus, V., and Mess, B. (2003) Biorhythms and pineal gland. Neuroendocrinology Letters, 24, 404-11.

In: Brain Mapping and Diseases Ed: Diane E. Spinelle

ISBN: 978-1-61122-065-0 © 2011 Nova Science Publishers, Inc.

Chapter 4

HIGHLIGHTS IN UNDERSTANDING WHITE MATTER ISCHEMIA James J.P. Alix1 and Michael G. Salter2 1 2

University of Leicester Medical School, Leicester, UK

Institute of Membrane and Systems Biology, University of Leeds, Leeds, UK

ABSTRACT The pathophysiology underlying the ischemic injury of white matter has, in recent times, been under intense investigation. As a result, significant inroads have been made in elucidating the mechanisms of injury that lead to pathology observed throughout life, from periventricular leukomalacia (PVL) in the neonate, to stroke in adulthood. To the surprise of many working in the field there are both remarkable similarities and important differences between the ischemic injury of the more classically studied grey matter and its white matter counterpart. In the mature CNS early studies using isolated white matter tracts first demonstrated the importance of the Na+-Ca2+ exchange protein in mediating a toxic Ca2+ influx. Ca2+ channels have also been implicated, by both providing the conduit for Ca2+ entry and mobilising Ca2+ from internal stores. More recently, NMDA and AMPA receptors have been shown to play important roles in the development of irreversible white matter injury, both in mature white matter and during an important developmental window. With regard to development, injury to white matter in the form of PVL is the primary pathology associated with the most common human birth disorder, cerebral palsy. Oligodendrocytes, the myelin forming cells of the central nervous system, have been a primary focus of research in this field and their progenitors have been shown to be especially susceptible to ischemic injury. A sound understanding of such pathways will be essential if successful therapeutic strategies are to be developed. Here, we review the remarkable progress made in what may still be viewed as a developing field, as researchers work towards unravelling the physiology behind the pathology.

62

James J. P. Alix and Michael G. Salter

INTRODUCTION The white matter (WM) of the central nervous system (CNS) is responsible for the transmission of signals between neurones in grey matter (GM) portions of the nervous system. It is composed primarily of axons, oligodendrocytes, astrocytes, NG2 glia (or “synantocytes”) and microglia. The functional unit of WM is the axon and, in general terms, after emerging from the neuronal perikaryon at the axon hillock it courses towards its synaptic target maintaining a constant diameter and not branching until its termination, if at all. At diameters less than 0.2 μm nearly all central axons are unmyelinated, that is to say, they are a bare extension of the cell body [1]. Above this diameter axons tend to be myelinated, that is, wrapped in membrane by oligodendrocytes which, because of the high lipid content of the myelin sheath, gives the tissue a white appearance, hence its name. The importance of the functional integrity of WM tracts is illustrated by the clinical deficits observed in conditions such as multiple sclerosis, stroke and cerebral palsy. As for other areas within the CNS the WM is a complex mix of cell types that work together to ensure efficient functioning of the tissue. Within such an environment there is a need for communication between the different cellular elements and this is achieved using a combination of signalling molecules, including excitatory neurotransmitters. It is becoming increasingly clear, however, that these mechanisms of communication are also responsible for many of the injury processes that occur, particularly as a result of ischemia.

ISCHEMIC INJURY TO WHITE MATTER Interruption of the blood supply to the CNS causes a complex pathophysiology that frequently results in either death or severe handicap to those affected. While hypoxiaischemia research has traditionally focused on the neuronal population it is becoming increasingly clear that injury to the WM compartment has significant consequences. WM can be the focus for pathology in several conditions with an ischemic aetiology, including stroke, vascular dementia and cerebral palsy; indeed, it has been suggested that human ischemic stroke is never limited to GM regions, can involve WM in isolation and that WM injury accentuates neurological deficits [2-5]. To help place this in context it has been estimated that during a large vessel ischemic stroke 1.9 million neurons, 14 billion synapses, and 12 kilometres of myelinated fibres are destroyed each minute [6]. During an ischaemic episode normally aerobic cells are subject to oxygen and glucose depravation (OGD) and quickly suffer energy deficit. When this control over ionic homeostasis is lost, leading to an accumulation of K+ in the extracellular space and hence membrane depolarization. This, in turn, may cause voltage gated channels to open and electrogenic transporters to reverse, and so injurious pathways are set in motion. This leads to cell death and necrosis of the most severely affected regions, while a surrounding area, the penumbra, remains electrically silent and in need of “resuscitation” before irreversible injury occurs [7]. Injury to these areas may persist for several days beyond the restoration of oxygenated blood to the affected region [8]. Interestingly, data from magnetic resonance imaging suggest that WM may exist in a penumbral state for a longer period of time than GM, offering a longer therapeutic target [9].

Highlights in Understanding White Matter Ischemia

63

LAYING THE FOUNDATIONS OF WHITE MATTER ISCHEMIA Early indications were that an important causal mechanism of injury to WM axons during an ischemic insult was related to Ca2+ overload. Stys et al. (1990) used ex vivo mature WM in the form of the rat optic nerve (RON), an extension of the CNS, to investigate the response of WM axons to anoxia [10]. By using extracellular compound action potentials (CAPs) as a measure of functional integrity the authors were able to elucidate that functional recovery following anoxia was inversely proportional to extracellular Ca2+ concentration ([Ca2+]e), with solutions free of Ca2+ demonstrating 100% recovery. The conclusion of this report was that irreversible injury was caused by an accumulation of Ca2+ within the axoplasm and this information drove the direction of subsequent research. A significant source of this Ca2+ influx from the extracellular space was shown to be mediated by a failure of the regulation of Na+ influx through tetrodotoxin (TTX) sensitive Na+ channels [11]. Using the same anoxic RON model Stys et al. demonstrated that following ATP depletion and subsequent membrane depolarisation axons appear to accumulate Na+ via non-inactivating Na+ channels. This rise in intra-axonal Na+, in combination with membrane depolarisation, then drives reverse operation of the Na+-Ca2+ exchange protein, leading to a toxic Ca2+ accumulation in the cytoplasm [11]. Later studies also found a protective role for specific voltage gated Ca2+ channel (VGCC) antagonists [12, 13]. Fern et al. found block of either N-type or L-type VGCCs to have a beneficial effect upon the recovery of the post-anoxic CAP. It was argued that these effects were missed in the prior investigations of Stys et al. (1990) due to the non-specific actions of some VGGC blockers, which may include inhibition of the release of neuroprotective substances such as γ-amino-butyric acid (GABA) and adenosine [14-16]. Using several VGCC blockers, with differing non-specific actions, Fern et al. concluded that VGCCs are involved in the development of anoxic WM injury. Similarly, Brown et al. used a combination of electrophysiological and immunohistochemical approaches to demonstrate a role for L- but not N-type VGCCs in anoxic injury [12].

INTRA-AXONAL CA2+ RELEASE: THE TROJAN HORSE VGCCs may also play an indirect role in axonal accumulation of Ca2+ by mediating release of Ca2+ from intra-axonal stores, the so-called Trojan horse of ischemic injury [17]. This was first demonstrated by Ouardouz et al. (2003) who observed that in rat dorsal columns, removal of bath Ca2+ did not improve post-ischemic CAP recovery [18]. Subsequent Ca2+ imaging experiments in which axons were loaded with Ca2+-sensitive dyes revealed that a rise in intracellular Ca2+ concentration ([Ca2+]i) still persisted under such conditions. Ryanodine or blockers of the L-type Ca2+ channel voltage sensor (such as diltiazem and nimodipine) were protective during zero Ca2+ experiments and subsequent immunoprecipitation and immunohistochemical studies revealed an association between L-type Ca2+ channels and ryanodine receptors (RyRs) on axons. These data led the authors to describe a mechanism similar to the excitation-contraction coupling seen in skeletal muscle where ischemic depolarisation sensed by L-type VGCCs activates RyRs on the endoplasmic reticulum (ER), leading to the release of damaging amounts of Ca2+. Ouardouz et al. (2006) followed this work by examining the interplay between glutamate receptors and glutamate

64

James J. P. Alix and Michael G. Salter

signalling in dorsal column WM [19]. Using a combination of electrophysiological and confocal imaging techniques they reported that while removal of Ca2+ or Na+ from the perfusate was protective against injury in an experimental paradigm employing 30 minutes of (OGD), such treatment conferred no protection when OGD was extended beyond this time. αamino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor antagonists, however, were protective even after 60 minutes of OGD, as was blocking RyR mediated Ca2+ mobilisation from intracellular stores [19]. Remarkably, application of AMPA resulted in a rise in intra-axonal Ca2+ concentrations under normoxic conditions. The authors speculate AMPA receptors present on axons not only permit Ca2+ entry directly, but also influence the release of Ca2+ from intracellular stores. Other work on the effects of in vitro chemical ischemia on the mature RON has demonstrated a significant amount of intra-axonal Ca2+ release [20]. In contrast to the studies by Ouardouz et al. (2003 and 2006) the majority of Ca2+ release in this model was dependent upon Na+ loading, which stimulates three separate Ca2+ release pathways: reverse operation of Na+-dependent neurotransmitter transporters leading to activation of metabotropic glutamate receptors (mGluRs) and consequent activation of the inositol triphosphate (IP3) signalling cascade, positive modulation of RyRs and reversal of the mitochondrial Na+- Ca2+ exchange. Importantly, prevention of intracellular Ca2+ release significantly improved the functional recovery of the RONs, despite the presence of extracellular Ca2+. The differences between these two models may reflect differences between the way in which ischemia was simulated, OGD vs. chemical, but may also reflect differences in the tissue, dorsal column vs. optic nerve.

ACUTE OLIGODENDROCYTE INJURY Much of the initial work in the area examined the mechanisms of injury operating against the functional unit of white matter, the axon. However, axonal function is largely dependent upon surrounding glial cells and so it appears logical that, for example, damage to oligodendrocytes and/or the myelin they produce will compromise axon function. Tekkök and Goldberg (2001) provided confirmation of this by demonstrating that hypoxic-ischemic injury to oligodendrocytes mediated by AMPA/kainite receptors in acute corpus callosum slices subsequently compromises axon function [21]. Importantly, this study moved to a potentially more clinically relevant model – OGD. Whilst Ca2+ removal preserved axon function following an insult, Na+ removal provided only partial protection. Far more effective in preserving both CAP conduction and axonal structure was oligodendrocyte protection through AMPA/kainate blockade with NBQX (2,3-dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f] quinoxaline-7- sulphonamide), a result not attributable to the protection of neuronal somata. The authors speculated that the underlying reasons for this might include the prevention of myelin damage, increased tissue energy use or the loss of trophic support [21]. The work of Tekkök and Goldberg (2001) demonstrated the interdependence of the constituent WM cell types during an ischemic insult and hence the importance of understanding the response of all cell types to energy deprivation. In keeping with this further work has focused on the effects of modelled ischemia on cellular elements with surprising results. For example, it appears that over activation of iGluRs (excitotoxicity), as demonstrated in WM by Tekkök and Goldberg (2001), plays an important role in ischemic

Highlights in Understanding White Matter Ischemia

65

injury of oligodendrocytes. Indeed, it has long been recognised that cells of the oligodendrocyte lineage express iGluRs [22-27] and it has been shown subsequently that AMPA/kainate receptors mediate injury to these cells [21,28-32]. Excitotoxicity occurs as a result of glutamate release into the extracellular space following reversal of glutamate transporters on astrocytes, oligodendrocytes and axons [28,31,33]. This excess of glutamate then mediates a toxic influx of Ca2+ into the cells via activated glutamate receptors. The occurrence of excitotoxicity and its profound effect on the survival of oligodendrocytes has led to a number of investigations to determine how this injury effects all compartments of the cell. Dogma had it that N-methyl-D-aspartate (NMDA) receptors were not expressed on oligodendrocyte cells and as a result AMPA/kainite receptors were assumed to be the sole mediators of injury, certainly in immature oligodendrocytes [28,30]. The availability of animals that expressed green fluorescent protein (GFP) in oligodendrocytes made it possible to study the effects of ischemia on cellular compartments rather than just cell bodies. Using optic nerves where GFP was expressed under control of the oligodendrocyte specific 2’, 3’-cyclic nucleotide 3’-phospodiesterase (CNP) promoter Salter and Fern (2005) showed that NMDA receptors were expressed on oligodendrocyte processes [34]. Although much of this work was completed using more susceptible immature oligodendrocytes Salter and Fern (2005) also looked at postnatal day 25 optic nerves (by which time all precursor cells have progressed to the mature phenotype), and found that NMDA receptor block was again protective against process injury.

Figure 1. Summary diagram for the ischemic injury of myelinated CNS axons. Following failure of the Na+K+ pump Na+ accumulates in the axoplasm via a non-inactivating Na+ conductance (1a). Influx of Na+ through AMPA/kainate receptors may also contribute to the Na+ load (1b). This increase in [Na+]i results in reversal of the axolemmal and mitochondrial Na+-Ca2+ exchangers (2 & 3 respectively) and the release of a neurotransmitter(s) capable of acting on mGluRs, leading to activation of the IP3 signalling cascade (4). Ca2+ influx mediated by VGCCs may activate ER RyRs, through either Ca2+-induced or depolarisation coupled means (5a & b). MY= Myelin.

66

James J. P. Alix and Michael G. Salter

Further evidence for the role of NMDA receptors in the ischemic injury of mature oligodendrocytes was provided by Micu et al. (2006). By loading the Ca2+ indicator X-rhod-1 into oligodendrocytes and the cytoplasmic compartment of the myelin sheath in adult RONs they were able to demonstrate an influx of Ca2+ into the myelin compartment during simulated ischemia [35]. The increase in Ca2+ fluorescence was largely ablated in somata by AMPA/kainate receptor block, a treatment that had little effect upon the increase in signal seen in myelin. By contrast NMDA receptor antagonism prevented the Ca2+ rise in myelin and reduced damage to myelin. Micu et al. also probed the expression of NMDA receptor subunits and presented data which raise the possibility of myelinic receptors being composed of NR2C and/or NR2D subunits, which the authors point out would be more sensitive to glutamate and glycine [35]. Further description of the technical advance that permitted visualisation of the myelin compartment during ischemia demonstrated that inhibiting glutamate and glycine transporters during chemical ischemia reduced the Ca2+ load in the myelin of RONs and dorsal columns [36]. Finally, it would appear that these studies dispel the theory that clinical trials of iGluR antagonists failed due to a lack of protection against WM injury.

ASTROCYTES AND WHITE MATTER ISCHEMIA Astrocytes are multifunctional cells whose principle purpose is the regulation of the extracellular space of the central nervous system and storage of glycogen to supply glucose to neurons [37]. Despite their numerical prominence in the CNS the relevance of much of the information on the mechanism(s) of injury of astrocytes during ischaemia is difficult to assess due to their relatively high resistance to energy deprivation [38,39] and the difficulty of studying cell viability in vivo. In the acute setting damage to astrocytes during ischemia will have a profound effect on the functioning of the brain, leading to an excess of neurotransmitter in the extracellular space and loss of regulation of key ions such as Na+, K+ and Ca2+ and evidence is accumulating to suggest that astrocytes may be the source of the extracellular glutamate that initiates oligodendrocyte cell death. The loss of astrocytic glutamate homeostasis is, in part, due to the movement of Na+ into the cell, probably via failure of the Na+-K+-Cl- co-transporter and Na+-Ca2+ exchange regulation during ischemia [40-42]. The effect of this Na+ accumulation is that there is a forced reversal of glutamate transporters that depend on Na+ and K+ to drive glutamate uptake [43-45]. In pathological circumstances the excess Na+ leaves the cell alongside glutamate via glutamate transporters such as excitatory amino acid transporter type 1 (EAAT1) and 2 (EAAT2) [46-48]. The importance of proper functioning of glutamate transport has been shown by Domerque et al. (2005) who demonstrated that, in the RON, block of EAAT2 (also known as glutamate transporter 1 (GLT-1)) glutamate transporters results in a loss of oligodendrocytes, probably due to an over stimulation of glutamate receptors on these cells [49]. The protective effect of blocking glutamate transporters, and thereby preventing reversal, during ischemia has also been shown to prevent ischemia induced [Ca2+]i rises in myelin [36]. Astrocytes that suffer prolonged energy deprivation will be subject to necrotic death, with the majority of the cells disintegrating within an hour of the commencement of the insult, which will also liberate glutamate into the extracellular space and disrupt ionic homeostasis

Highlights in Understanding White Matter Ischemia

67

[38,40,41,50,51]. Those cells that survive beyond the ischemic insult can become “reactive”, with up-regulation of GFAP, cellular hypertrophy, astrocyte proliferation and process extension [52-54]. The consequences of astrocytic activation are not well understood and may be both beneficial and detrimental. For example, free radicals and inflammatory mediators such as transforming growth factor-δ may be released with the potential to cause injury, while trophic factors such as brain derived neurotrophic factor are also released and, remarkably, free radical scavenging is possible [53,55-59]. A potentially interesting response to ischemia as part of the development of reactive astrocytosis was identified by Beschorner et al. (2007) following their analysis of human brains of individuals who had suffered a stroke [60]. Their work showed that there was an increase in EAAT1, though not EAAT2, in both reactive astrocytes and microglia. These levels rose within 24 hours and remained elevated for several months, demonstrating a dynamic response to the need to clear excess glutamate during ischemia [60].

ISCHEMIC INJURY TO DEVELOPING WHITE MATTER The ischemic injury of developing WM has received much attention in recent years. While the immature CNS is generally regarded to be more resistant than the adult CNS to such insults, it is now known that an ischemic affront between 23 and 32 weeks gestation can result in a remarkably selective pattern of injury to periventricular WM (PVWM) [61-64]. In the United States approximately 57,000 low birth-weight infants (<1500 g) are born each year and while recent advances in neonatal medicine mean that around 90% of these patients survive, sadly 10% show signs of cerebral palsy [65]. An additional 25–50% display cognitive or behavioural deficits and PVWM injury is the most common neuropathological correlate of both of these presentations [65]. In addition, recent estimates suggest that a cerebrovascular event occurs in around 1/4000 term births [66,67]. Whether this is an accurate estimate is unclear as perinatal stroke, unlike that in the adult, does not present with characteristic clinical signs and thus relies on neuroimaging for diagnosis [68]. It therefore appears likely that this may be an even bigger problem than current evidence suggests. WM pathology of the developing brain was first termed periventricular leukomalacia (PVL) by Banker and Larroche who described “necrosis of the white matter dorsal and lateral to the external angles of the lateral ventricles” [69]. Further work has identified two patterns of injury in PVL: a necrotic focus and a diffuse component. The necrotic area affects all cell types and subsequently becomes cystic in nature, while the diffuse pathology typically only involves oligodendroglial cells, leading to marked hypomyelination and advances in imaging have demonstrated that areas of hypomyelination can exist without a “cystic sister” [65,70, 71]. Indeed, it has been shown that over the past decade or so the most common pathology observed has shifted from the cystic, necrotic type to the diffuse type of injury [72]. Sadly, this change has not been mirrored by a decrease in adverse neurodevelopmental outcomes.

68

James J. P. Alix and Michael G. Salter

WHY IS PERIVENTRICULAR WHITE MATTER VULNERABLE TO INJURY? Both the vascular anatomy of the tissue and the underlying physiology of the constituent cell types appear to contribute to this injury. Firstly, a poorly developed vascular tree means that arterial end zones may be quite some distance from the PVWM [73]. WM in this area receives its blood supply from long and short penetrating arteries and Volpe has suggested that the focal component of PVL develops at the end zones of the immature long penetrating arteries [65]. The diffuse component, which occurs at the end zones of the shorter penetrating arteries, is thought to arise following less severe ischemic episodes. In addition, it has been noted that a “pressure passive” circulation, unable to adapt to fluctuations in cerebral blood flow, exits in premature infants [74-76]. A relatively low flow of blood to the region further increases the likelihood of energy deprivation. Recent work in fetal sheep elegantly highlighted the disparity in flow between the vulnerable WM and its more resistant cortical counterpart [77]. This study demonstrated, using global cerebral ischemia induced by bilateral carotid occlusion in fetal sheep, that although cerebral blood flow fell by proportionally the same extent in white and grey matter, in absolute units PVWM received far less blood than the cortex. The authors argued that this may explain the greater susceptibility of PVWM to ischemic injury relative to the cortex [77]. Interestingly, PVWM was not injured in a uniform manner in this study, with the medial and parietal WM injured to a greater degree. The probable reason for this was the difference in development of the oligodendroglial cells present in the different anatomical locations [77]. The authors found that both the medial and parietal WM contained oligodendrocyte precursor cells (OPCs), while the lateral PVWM contained more mature cells of the oligodendroglial lineage that were more resistant to injury. This phenomenon will be discussed further below.

OLIGODENDROGLIAL INJURY IN PVL The response of oligodendroglia in immature WM to ischemia has received much attention. Oligodendrocytes undergo a complex process of differentiation as they mature into myelin forming cells and it is the late oligodendrocyte precursor (OPC) that is thought to be the major target for pathology in the lineage [78]. Many studies have demonstrated a remarkable vulnerability of these actively differentiating cells to ischemic and oxidative stresses, resulting in the description of maturation-dependent characteristics, which may be of crucial importance in the pathogenesis of PVL [28,32,61,79].

EXCITOTOXIC OLIGODENDROGLIAL INJURY Glutamate has been shown to play an important role in the pathophysiology of OPC death through both receptor mediated and non-receptor mediated mechanisms [28,30-32,34,80-82]. In line with these observations elevated extracellular glutamate levels have been observed both in animal models and clinically [83-86]. There are many potential sources for glutamate release during ischemia. Release from axons is one possibility and glutamate

Highlights in Understanding White Matter Ischemia

69

release/depletion during ischemia has been reported in the optic nerve and spinal cord [30,87,88]. Ischemic conditions that lead to a loss of ionic homeostasis and thus the reversal of Na+-dependent glutamate transporters is one mechanism by which glutamate may be liberated into the extracellular space, as mentioned previously [87,89]. Axonal disruption is another possibility, while the release of glutamate from astrocytes, following cell death and clasmatodendrosis (loss of cell processes), has also been suggested [40]. An in vitro study also suggested the possibility of OPCs releasing glutamate which might then, by means of an autologous feedback loop, damage the same cell [28]. However, it was suggested by Wilke et al. that this may be an artefact of the in vitro conditions as, in their in situ preparation, oligodendrocytes accumulated glutamate, as assessed by electron microscopy immuno-gold labelling [30]. The complex nature of glutamate movement during energy deprivation, and of interpreting data from slightly different models, was noted by Back et al. who, in contrast to Wilke et al., observed depletion of oligodendroglial glutamate post-ischemia [88]. Differences in the maturational stage of oligodendroglia in the postnatal day 10 RON [30], versus the postnatal day 7 rat PVWM [88], were suggested to account for such a difference [88]. Elevation of extracellular glutamate in an uncontrolled fashion and over activation of iGluRs leads on to a toxic Ca2+ flux into the cells expressing Ca2+-permeable iGluRs. The result is cell damage and death with both NMDA and non-NMDA glutamate receptors shown to contribute to excitotoxic OPC damage [28,31,32,34,81,82,90]. AMPA/kainate receptors were the first iGluRs to be identified in cells of the oligodendroglial lineage [23,91] and their role in ischemia induced OPC damage during development is well appreciated. Follet et al. (2000) demonstrated that unilateral carotid ligation plus hypoxia for one hour in postnatal day 7 rats resulted in a selective pattern of injury involving subcortical WM [31]. Treatment with the AMPA/kainate receptor blocker NBQX at the end of the hypoxic period significantly reduced this injury, while it was also reported that intracerebral AMPA injections produced WM injury in an age-specific manner with cortical injury dominating at more mature developmental stages. AMPA/kainate receptors are multimeric stuctures composed of varying combinations of GluR1-4 (AMPA) and GluR5-7 and KA1-2 (kainate) subunits whose permeability to Ca2+ is determined by the expression of the GluR2 subunit [92,93]. Expression of the subunit renders the receptor impermeable to Ca2+, while the opposite is true of receptors devoid of GluR2 [94,95]. Studies have subsequently shown that developing oligodendroglia show reduced expression of the GluR2 subunit and so exhibit an increased permeability to Ca2+ [94, 96-98]. Further to this, evidence is now emerging that OPCs express both GluR2-containing and GluR2-devoid AMPA/kainate receptors, with the latter apparently mediating excitotoxic damage through down regulation of the transcription factor cAMP-response element-binding protein (CREB) [99]. CREB may be involved in the expression of cell survival genes and, interestingly, expression of a constitutively active form of CREB, VP16-CREB, was found to up-regulate expression of the Ca2+-impermeable GluR2 subunit both in vitro and in vivo, conferring protection against excitotoxicity. The authors suggest that targeting CREB may therefore provide a novel therapeutic approach against excitotoxic OPC injury [99]. Efforts to translate this work to humans have already begun and, promisingly, studies on human PVWM have confirmed laboratory studies, demonstrating a high level of GluR4 expression and low GluR2 expression during the acknowledged window of vulnerability to hypoxic-ischemic injury [100]

70

James J. P. Alix and Michael G. Salter

NMDA receptors have recently been demonstrated in both neonatal and mature oligodendrocytes [34,35,81]. Working independently Káradóttir et al. (2005) and Salter and Fern (2005) reported the presence and activation of NMDA receptors on OPCs during OGD. Káradóttir et al. demonstrated their presence by whole cell clamping oligodendrocytes at different stages of development and subsequently recording currents that could be elcited by application of glutamate, NMDA or an OGD paradigm. Characterisation of these currents with specific blockers suggested the presence of NMDA receptors that may contain NR1, NR2C and NR3 subunits, an unusual combination when compared to the classic synaptic recptors which may have therpaeutic potential [81]. Immuno-labelling at light and electron microscopic level revealed these receptors to be on myelinating processes and the authors point out that the small intracellular volume of this compartment will lead to high intracellular concentrations of Ca2+ which will potentiate NMDA recepor signalling, in both physiological and pathophysiological circumstances. This effect is further enhanced by the unusually small degree of Mg2+ block at the resting membrane potential of the cells [81]. Salter and Fern (2005) reported the presence and activation of oligodendroglial NMDA receptors by using live confocal imaging of oligodendroglial cells in mouse optic nerve expressing GFP, as described previously [34]. Experiments utilising mice at postnatal day 10, when myelination is just getting under way, demonstrated that under ischemic conditions pixel intensity fell dramatically during a 60 minute period. This loss, which likely represents a loss in membrane integity and subsequent leakage of GFP, could be attenuated in somata through block of AMPA/kainate receptors and in myelinating processes through block of NMDA receptors. Immuno-labelling revealed the presence of NMDA receptor subunits NR1, NR2A, -B, -C, -D and NR3A in oligodendroglia and reverse-transcriptase polymerase chain reaction (RT-PCR) analysis corroborated these results. Importantly, preliminary studies using autopsy specimens have shown that pre-term human WM contains NR1, NR2A and NR2B subunits expressed at a significantly high density [101].

OXIDATIVE OLIGODENDROGLIAL INJURY The inherent susceptibility of developing oligodendrocytes to oxidative injury has also been a focus for study and studies of human autopsy specimens have demonstrated significant oxidative damage [102,103]. The generation of free radical species upon reperfusion is a well established phenomenon and glutamate likely contributes to this injury. Oka et al. (1993) demonstrated this phenomenon by exposing oligodendroglial cultures to glutamate, with the observed toxicity in these circumstances mediated via activation of a glutamate-cystine exchanger [80]. Activation of this protein led to a reduction in cellular levels of cystine and hence decreased synthesis of the important anti-oxidant glutathione. In this study prevention of glutamate uptake, or exposure to cystine, for example, was effective in preventing glutamate toxicity [80]. Similarly, cystine deprivation has been used to demonstrate an intrinsic dependence on anti-oxidants during oligodendroglial development in vitro [104]. The downstream effect of this (glutathione depletion) has also been shown to be a developmental phenomenon, with such treatment apparently having little effect upon the viability of mature oligodendrocytes [79]. It has been suggested that the vulnerability of immature oligodendroglia to oxidative stress is due to a developmental delay in the maturity of anti-oxidant defences [65]. In

Highlights in Understanding White Matter Ischemia

71

agreement with this it has been shown that the anti-oxidant enzyme manganese-containing superoxide dismutase (MnSOD) has significantly less activity in OPCs when compared with mature oligodendrocytes [105]. MnSOD catalyses the conversion of superoxide to hydrogen peroxide and water in mitochondria, and decreased activity will therefore be detrimental to mitochondrial function and cell survival. It is worth noting that the expression and activity of the cytosolic enzyme copper-zinc-containing superoxide dismutase did not vary across the oligodendrocyte lineage [105]. The subsequent breakdown of hydrogen peroxide (which, it should be noted, can be formed by additional pathways) is mainly achieved by glutathione peroxidase and catalase and evidence suggests that these defences are not as potent in developing oligodendrocytes when compared to mature oligodendrocytes [106]. The reason for this appears to be that while catalase expression is similar throughout development and into maturity, glutathione peroxidase expression is low during development. Baud et al. (2004) measured enzyme activity following hydrogen peroxide exposure and found that in OPCs this treatment reduced catalase activity. Treatment of OPCs with a glutathione peroxidase mimic prevented this, while inhibition of glutathione peroxidase in mature oligodendrocytes reduced catalase activity in cells not normally displaying such a reduction [106]. It therefore appears that the presence of both enzymes is required for effective degradation of hydrogen peroxide, with glutathione peroxidase apparently required to prevent hydrogen peroxide concentrations reaching the level at which catalase is inactivated [106]. The sequential operation of superoxide dismutases and glutathione peroxidase and catalase is considered essential if oxidative stress is to be avoided, and it appears likely that the immaturity of these pathways plays an important role in the maturation dependent vulnerability of oligodendroglia [107,108].

MYELINATING AXONS ARE DAMAGED BY ISCHEMIC INSULTS The function of WM is, of course, the transmission of action potentials along axons. In order to propagate these signals rapidly and efficiently many axons are myelinated. Banker and Larroche’s original description of PVL noted the presence of “retraction balls and clubs”, that is, the presence of swollen axon cylinders, and such injury will contribute to the phenotype of the ensuing disorder. More recently amyloid precursor protein, a marker of the integrity of fast axonal transport (and therefore axon injury) has been detected in the brains of infants with PVL [109-112]. Importantly this injury has been noted to occur at the earliest stages in the evolution of pathology and in areas away from necrotic margins, indicating the sensitivity of the axon to metabolic insults [109-111]. Despite such observations relatively little information exists on the mechanism of injury to the developing axon. This injury was first modelled in vitro by Fern et al. (1998) in a developmental study on axon conduction during energy deprivation [113]. Using extracellular CAP recordings, a rapid decrease in the ability of RONs to recover electrical activity following OGD was noted around the onset of myelination [113]. In contrast to the mature RON, removal of oxygen only (i.e hypoxia) did not affect neonatal RON function, while glucose deprivation (i.e. aglycaemia) resulted in modest irreversible injury; data which appear to fit well with earlier hypotheses regarding the differential sensitivity of developing WM to energy deprivation [63, 64]. That combined anoxia and aglycaemia (i.e. “ischemia” or OGD) resulted in an almost identical attenuation in CAP amplitude, in both the actively myelinating

72

James J. P. Alix and Michael G. Salter

and mature RON, reinforces the importance in understanding the pathophysiology behind this loss of function. McCarran and Goldberg have begun to elucidate the mechanisms responsible for immature axon injury, using acute corpus callosum brain slices from thy1–yellow fluorescent protein (YFP) mice [114]. In this model axon morphology can be visualised using confocal microscopy over a number of hours and beading and fragmentation of staining were taken as markers of axon injury. The authors were thus able to examine the effects of OGD overseveral developmental stages which they described as pre-myelinated, early myelinating and late-myelinating [114]. In experiments employing one hour of OGD followed by nine hours of reperfusion axons at all stages of development displayed pathological changes, although myelinating axons were more significantly damaged. Interestingly, changes in axon fluorescence were not observed during the period of OGD at any age and even at the more mature, metabolically sensitive ages it took six hours of reperfusion for pathology to develop, observations which, at first glance, do not appear to complement the study of Fern et al. One possible explanation might be that axon conduction is lost prior to the loss of membrane integrity, which is presumably required for the loss of YFP staining. The injury observed by McCarran and Goldberg was significantly reduced in actively myelinating axons by AMPA/kainate receptor block, but not in pre-myelinated axons, leading the authors to hypothesise that axon-oligodendrocyte interactions mediate excitotoxic axon damage. That AMPA/kainate receptor block still resulted in some axon injury, and was not protective of pre-myelinated axons indicates that other pathways must be acting in parallel to damage these axons.

Figure 2. Summary diagram of injury pathways affecting OPCs and axons. During ischemia the extracellular glutamate concentration rises and this may activate AMPA/kainate receptors on oligodendroglial somata (1). Evidence suggests that their activation may alter gene expression [99]. Glutamate may also activate NMDA receptors present on myelinating processes (2), the damage of which might then contribute to the hypomyelination observed in diffuse PVL. Activation of iGluRs would also appear to compromise the structural integrity of developing axons (3), although the mechanism through which this occurs remains uncertain. Developing oligodendroglia are also sensitive to oxidative stress through several mechanisms (4). These include low expression of the mitochondrial superoxide scavenger MnSOD, and low activity of glutathione peroxidase which, along with catalase, breaks down hydrogen peroxide (H2O2) into water and oxygen. The ability of the cells to degrade hydrogen peroxide may be further compromised through loss of cystine via a glutamate cystine exchange protein. MY = Myelin.

Highlights in Understanding White Matter Ischemia

73

CONCLUSION Research into the pathophysiology underlying brain hypoxia-ischemia began with the neuronal population and largely ignored injury to WM. Slowly this has changed and much progress has been made understanding the biochemical mechanisms of injury operating in WM, both during development and in the mature CNS. Indeed, to the surprise of many it appears that GM matter shares its vulnerability to excitotoxicity with WM and that this mechanism of injury is important throughout development. However, important differences are apparent between the injury mechanisms operating in immature and mature WM. The failure of attempted interventions thus far should not dishearten those working in the field, for the pathophysiology described in various models appears to translate well to the human brain. It therefore follows that in the study of the ischemic injury of both mature and immature WM important progress has been made, but there is still much to do if labour at the bench is to bear fruit at the bedside.

REFERENCES [1]

Hirano A, Llena JF. Morphology of central nervous system axons. In: Waxman SG, Kocsis, J.D. and Stys, P.K., editor. The Axon: Structure, Function and Pathophysiology: Oxford University Press; 1995. p. 49-67. [2] Goldberg MP, Ransom BR. New light on white matter. Stroke 2003;34(2):330-2. [3] Stoeckel MC, Wittsack HJ, Meisel S, Seitz RJ. Pattern of cortex and white matter involvement in severe middle cerebral artery ischemia. J. Neuroimaging. 2007;17(2):131-40. [4] Bogousslavsky J, Regli F. Centrum ovale infarcts: subcortical infarction in the superficial territory of the middle cerebral artery. Neurology. 1992;42(10):1992-8. [5] Pantoni L, Garcia JH, Gutierrez JA. Cerebral white matter is highly vulnerable to ischemia. Stroke. 1996;27(9):1641-6; discussion 1647. [6] Saver JL. Time is brain--quantified. Stroke. 2006;37(1):263-6. [7] Fisher M. The ischemic penumbra: identification, evolution and treatment concepts. Cerebrovasc. Dis. 2004;17 Suppl 1:1-6. [8] Lipton SA. Neuronal protection and destruction by NO. Cell Death Differ. .1999;6(10):943-51. [9] Koga M, Reutens DC, Wright P, Phan T, Markus R, Pedreira B, et al. The existence and evolution of diffusion-perfusion mismatched tissue in white and gray matter after acute stroke. Stroke. 2005;36(10):2132-7. [10] Stys PK, Ransom BR, Waxman SG, Davis PK. Role of extracellular calcium in anoxic injury of mammalian central white matter. Proc. Natl. Acad. Sci. U.S.A. 1990;87(11):4212-6. [11] Stys PK, Waxman SG, Ransom BR. Ionic mechanisms of anoxic injury in mammalian CNS white matter: role of Na+ channels and Na(+)-Ca2+ exchanger. J. Neurosci. 1992;12(2):430-9. [12] Brown AM, Westenbroek RE, Catterall WA, Ransom BR. Axonal L-type Ca2+ channels and anoxic injury in rat CNS white matter. J. Neurophysiol. 2001;85(2):90011.

74

James J. P. Alix and Michael G. Salter

[13] Fern R, Ransom BR, Waxman SG. Voltage-gated calcium channels in CNS white matter: role in anoxic injury. J. Neurophysiol. 1995;74(1):369-77. [14] Fern R, Waxman SG, Ransom BR. Modulation of anoxic injury in CNS white matter by adenosine and interaction between adenosine and GABA. J. Neurophysiol. 1994;72(6):2609-16. [15] Fern R, Waxman SG, Ransom BR. Endogenous GABA attenuates CNS white matter dysfunction following anoxia. J. Neurosci. 1995;15(1 Pt 2):699-708. [16] Phillis JW, O'Regan MH, Walter GA. Effects of nifedipine and felodipine on adenosine and inosine release from the hypoxemic rat cerebral cortex. J. Cereb. Blood Flow Metab. 1988;8(2):179-85. [17] Ransom BR, Brown AM. Intracellular Ca2+ release and ischemic axon injury: the Trojan horse is back. Neuron. 2003;40(1):2-4. [18] Ouardouz M, Nikolaeva MA, Coderre E, Zamponi GW, McRory JE, Trapp BD, et al. Depolarization-induced Ca2+ release in ischemic spinal cord white matter involves Ltype Ca2+ channel activation of ryanodine receptors. Neuron. 2003;40(1):53-63. [19] Ouardouz M, Malek S, Coderre E, Stys PK. Complex interplay between glutamate receptors and intracellular Ca2+ stores during ischaemia in rat spinal cord white matter. J. Physiol. 2006;577(Pt 1):191-204. [20] Nikolaeva MA, Mukherjee B, Stys PK. Na+-dependent sources of intra-axonal Ca2+ release in rat optic nerve during in vitro chemical ischemia. J. Neurosci. 2005;25(43):9960-7. [21] Tekkök SB, Goldberg MP. Ampa/kainate receptor activation mediates hypoxic oligodendrocyte death and axonal injury in cerebral white matter. J. Neurosci. 2001;21(12):4237-48. [22] Berger T, Walz W, Schnitzer J, Kettenmann H. GABA- and glutamate-activated currents in glial cells of the mouse corpus callosum slice. J. Neurosci. Res. 1992;31(1):21-7. [23] Patneau DK, Wright PW, Winters C, Mayer ML, Gallo V. Glial cells of the oligodendrocyte lineage express both kainate- and AMPA-preferring subtypes of glutamate receptor. Neuron. 1994;12(2):357-71. [24] Barres BA, Koroshetz WJ, Swartz KJ, Chun LL, Corey DP. Ion channel expression by white matter glia: the O-2A glial progenitor cell. Neuron. 1990;4(4):507-24. [25] Borges K, Ohlemeyer C, Trotter J, Kettenmann H. AMPA/kainate receptor activation in murine oligodendrocyte precursor cells leads to activation of a cation conductance, calcium influx and blockade of delayed rectifying K+ channels. Neuroscience. 1994;63(1):135-49. [26] Gallo V, Zhou JM, McBain CJ, Wright P, Knutson PL, Armstrong RC. Oligodendrocyte progenitor cell proliferation and lineage progression are regulated by glutamate receptor-mediated K+ channel block. J. Neurosci. 1996;16(8):2659-70. [27] Yuan X, Eisen AM, McBain CJ, Gallo V. A role for glutamate and its receptors in the regulation of oligodendrocyte development in cerebellar tissue slices. Development. 1998;125(15):2901-14. [28] Fern R, Moller T. Rapid ischemic cell death in immature oligodendrocytes: a fatal glutamate release feedback loop. J. Neurosci. 2000;20(1):34-42.

Highlights in Understanding White Matter Ischemia

75

[29] McDonald JW, Althomsons SP, Hyrc KL, Choi DW, Goldberg MP. Oligodendrocytes from forebrain are highly vulnerable to AMPA/kainate receptor-mediated excitotoxicity. Nat. Med. 1998;4(3):291-7. [30] Wilke S, Thomas R, Allcock N, Fern R. Mechanism of acute ischemic injury of oligodendroglia in early myelinating white matter: the importance of astrocyte injury and glutamate release. J. Neuropathol. Exp. Neurol. 2004;63(8):872-81. [31] Follett PL, Rosenberg PA, Volpe JJ, Jensen FE. NBQX attenuates excitotoxic injury in developing white matter. J. Neurosci. 2000;20(24):9235-41. [32] Deng W, Rosenberg PA, Volpe JJ, Jensen FE. Calcium-permeable AMPA/kainate receptors mediate toxicity and preconditioning by oxygen-glucose deprivation in oligodendrocyte precursors. Proc. Natl. Acad. Sci. U. S. A. 2003;100(11):6801-6. [33] Li S, Mealing GA, Morley P, Stys PK. Novel injury mechanism in anoxia and trauma of spinal cord white matter: glutamate release via reverse Na+-dependent glutamate transport. J. Neurosci. 1999;19(14):RC16. [34] Salter MG, Fern R. NMDA receptors are expressed in developing oligodendrocyte processes and mediate injury. Nature 2005;438(7071):1167-71. [35] Micu I, Jiang Q, Coderre E, Ridsdale A, Zhang L, Woulfe J, et al. NMDA receptors mediate calcium accumulation in myelin during chemical ischaemia. Nature. 2006;439(7079):988-92. [36] Micu I, Ridsdale A, Zhang L, Woulfe J, McClintock J, Brantner CA, et al. Real-time measurement of free Ca(2+) changes in CNS myelin by two-photon microscopy. Nat. Med. 2007;13(7):874-9. [37] Swanson RA. Astrocyte glutamate uptake during chemical hypoxia in vitro. Neurosci. Lett. 1992;147(2):143-6. [38] Fern R. Intracellular calcium and cell death during ischemia in neonatal rat white matter astrocytes in situ. J. Neurosci. 1998;18(18):7232-43. [39] Goldberg MP, Choi DW. Combined oxygen and glucose deprivation in cortical cell culture: calcium-dependent and calcium-independent mechanisms of neuronal injury. J. Neurosci. 1993;13(8):3510-24. [40] Thomas R, Salter MG, Wilke S, Husen A, Allcock N, Nivison M, et al. Acute ischemic injury of astrocytes is mediated by Na-K-Cl cotransport and not Ca2+ influx at a key point in white matter development. J. Neuropathol. Exp. Neurol. 2004;63(8):856-71. [41] Salter MG, Fern R. The mechanisms of acute ischemic injury in the cell processes of developing white matter astrocytes. J. Cereb. Blood Flow Metab. In press. [42] Kintner DB, Luo J, Gerdts J, Ballard AJ, Shull GE, Sun D. Role of Na+-K+-Clcotransport and Na+/Ca2+ exchange in mitochondrial dysfunction in astrocytes following in vitro ischemia. Am. J. Physiol. Cell Physiol. 2007;292(3):C1113-22. [43] Phillis JW, Smith-Barbour M, Perkins LM, O'Regan MH. Characterization of glutamate, aspartate, and GABA release from ischemic rat cerebral cortex. Brain Res. Bull. 1994;34(5):457-66. [44] Levy LM, Warr O, Attwell D. Stoichiometry of the glial glutamate transporter GLT-1 expressed inducibly in a Chinese hamster ovary cell line selected for low endogenous Na+-dependent glutamate uptake. J. Neurosci. 1998;18(23):9620-8. [45] Anderson CM, Swanson RA. Astrocyte glutamate transport: review of properties, regulation, and physiological functions. Glia. 2000;32(1):1-14.

76

James J. P. Alix and Michael G. Salter

[46] Rothstein JD, Martin L, Levey AI, Dykes-Hoberg M, Jin L, Wu D, et al. Localization of neuronal and glial glutamate transporters. Neuron. 1994;13(3):713-25. [47] Longuemare MC, Swanson RA. Excitatory amino acid release from astrocytes during energy failure by reversal of sodium-dependent uptake. J. Neurosci. Res. 1995;40(3):379-86. [48] Dronne MA, Grenier E, Dumont T, Hommel M, Boissel JP. Role of astrocytes in grey matter during stroke: a modelling approach. Brain Res. 2007;1138:231-42. [49] Domercq M, Etxebarria E, Perez-Samartin A, Matute C. Excitotoxic oligodendrocyte death and axonal damage induced by glutamate transporter inhibition. Glia. 2005;52(1):36-46. [50] Fern R. Ischemia: astrocytes show their sensitive side. Prog. Brain Res. 2001;132:40511. [51] Bondarenko A, Chesler M. Rapid astrocyte death induced by transient hypoxia, acidosis, and extracellular ion shifts. Glia. 2001;34(2):134-42. [52] Norton WT, Aquino DA, Hozumi I, Chiu FC, Brosnan CF. Quantitative aspects of reactive gliosis: a review. Neurochem. Res. 1992;17(9):877-85. [53] Ridet JL, Malhotra SK, Privat A, Gage FH. Reactive astrocytes: cellular and molecular cues to biological function. Trends Neurosci. 1997;20(12):570-7. [54] Davies CA, Loddick SA, Stroemer RP, Hunt J, Rothwell NJ. An integrated analysis of the progression of cell responses induced by permanent focal middle cerebral artery occlusion in the rat. Exp. Neurol. 1998;154(1):199-212. [55] Iwata-Ichikawa E, Kondo Y, Miyazaki I, Asanuma M, Ogawa N. Glial cells protect neurons against oxidative stress via transcriptional up-regulation of the glutathione synthesis. J. Neurochem. 1999;72(6):2334-44. [56] Dhandapani KM, Hadman M, De Sevilla L, Wade MF, Mahesh VB, Brann DW. Astrocyte protection of neurons: role of transforming growth factor-beta signaling via a c-Jun-AP-1 protective pathway. J. Biol. Chem. 2003;278(44):43329-39. [57] Trendelenburg G, Dirnagl U. Neuroprotective role of astrocytes in cerebral ischemia: focus on ischemic preconditioning. Glia. 2005;50(4):307-20. [58] Bruno V, Battaglia G, Casabona G, Copani A, Caciagli F, Nicoletti F. Neuroprotection by glial metabotropic glutamate receptors is mediated by transforming growth factorbeta. J. Neurosci. 1998;18(23):9594-600. [59] Hoshi A, Nakahara T, Kayama H, Yamamoto T. Ischemic tolerance in chemical preconditioning: possible role of astrocytic glutamine synthetase buffering glutamatemediated neurotoxicity. J. Neurosci. Res. 2006;84(1):130-41. [60] Beschorner R, Simon P, Schauer N, Mittelbronn M, Schluesener HJ, Trautmann K, et al. Reactive astrocytes and activated microglial cells express EAAT1, but not EAAT2, reflecting a neuroprotective potential following ischaemia. Histopathology. 2007;50(7):897-910. [61] Back SA, Han BH, Luo NL, Chricton CA, Xanthoudakis S, Tam J, et al. Selective vulnerability of late oligodendrocyte progenitors to hypoxia-ischemia. J. Neurosci. 2002;22(2):455-63. [62] Volpe JJ. Cerebral white matter injury of the premature infant-more common than you think. Pediatrics. 2003;112(1 Pt 1):176-80. [63] Duffy TE, Kohle, S.J., and Vannucci, R.C. Carbohydrate and energy metabolism in perinatal rat brain: relation to survival in anoxia. J. Neurochem. 1975;24(2):271-276.

Highlights in Understanding White Matter Ischemia

77

[64] Kabat H. The greater resistance of very young animals to arrest of the brain circulation. Am. J. Physiol. 1940(130):588-599. [65] Volpe JJ. Neurobiology of periventricular leukomalacia in the premature infant. Pediatr. Res. 2001;50(5):553-62. [66] Lynch JK, Hirtz DG, DeVeber G, Nelson KB. Report of the National Institute of Neurological Disorders and Stroke workshop on perinatal and childhood stroke. Pediatrics. 2002;109(1):116-23. [67] Lynch JK, Nelson KB. Epidemiology of perinatal stroke. Curr. Opin. Pediatr. 2001;13(6):499-505. [68] Nelson KB. Perinatal ischemic stroke. Stroke. 2007;38(2 Suppl):742-5. [69] Banker BQ, Larroche JC. Periventricular leukomalacia of infancy. A form of neonatal anoxic encephalopathy. Arch. Neurol. 1962;7:386-410. [70] Back SA, Rivkees SA. Emerging concepts in periventricular white matter injury. Semin. Perinatol. 2004;28(6):405-14. [71] Folkerth RD. Periventricular leukomalacia: overview and recent findings. Pediatr. Dev. Pathol. 2006;9(1):3-13. [72] Hamrick SE, Miller SP, Leonard C, Glidden DV, Goldstein R, Ramaswamy V, et al. Trends in severe brain injury and neurodevelopmental outcome in premature newborn infants: the role of cystic periventricular leukomalacia. J. Pediatr. 2004;145(5):593-9. [73] Rorke LB. Anatomical features of the developing brain implicated in pathogenesis of hypoxic-ischemic injury. Brain Pathol. 1992;2(3):211-21. [74] Tsuji M, Saul JP, du Plessis A, Eichenwald E, Sobh J, Crocker R, et al. Cerebral intravascular oxygenation correlates with mean arterial pressure in critically ill premature infants. Pediatrics. 2000;106(4):625-32. [75] Greisen G, Borch K. White matter injury in the preterm neonate: the role of perfusion. Dev. Neurosci. 2001;23(3):209-12. [76] Pryds O, Greisen G, Lou H, Friis-Hansen B. Heterogeneity of cerebral vasoreactivity in preterm infants supported by mechanical ventilation. J. Pediatr. 1989;115(4):638-45. [77] Riddle A, Luo NL, Manese M, Beardsley DJ, Green L, Rorvik DA, et al. Spatial heterogeneity in oligodendrocyte lineage maturation and not cerebral blood flow predicts fetal ovine periventricular white matter injury. J. Neurosci. 2006;26(11):304555. [78] Back SA, Luo NL, Borenstein NS, Levine JM, Volpe JJ, Kinney HC. Late oligodendrocyte progenitors coincide with the developmental window of vulnerability for human perinatal white matter injury. J. Neurosci. 2001;21(4):1302-12. [79] Back SA, Gan X, Li Y, Rosenberg PA, Volpe JJ. Maturation-dependent vulnerability of oligodendrocytes to oxidative stress-induced death caused by glutathione depletion. J. Neurosci. 1998;18(16):6241-53. [80] Oka A, Belliveau MJ, Rosenberg PA, Volpe JJ. Vulnerability of oligodendroglia to glutamate: pharmacology, mechanisms, and prevention. J. Neurosci. 1993;13(4):144153. [81] Káradóttir R, Cavelier P, Bergersen LH, Attwell D. NMDA receptors are expressed in oligodendrocytes and activated in ischaemia. Nature. 2005;438(7071):1162-6. [82] Matute C, Sanchez-Gomez MV, Martinez-Millan L, Miledi R. Glutamate receptormediated toxicity in optic nerve oligodendrocytes. Proc. Natl. Acad. Sci. U. S. A. 1997;94(16):8830-5.

78

James J. P. Alix and Michael G. Salter

[83] Hagberg H. Hypoxic-ischemic damage in the neonatal brain: excitatory amino acids. Dev. Pharmacol. Ther. 1992;18(3-4):139-44. [84] Silverstein FS, Naik B, Simpson J. Hypoxia-ischemia stimulates hippocampal glutamate efflux in perinatal rat brain: an in vivo microdialysis study. Pediatr. Res. 1991;30(6):587-90. [85] Benveniste H, Drejer J, Schousboe A, Diemer NH. Elevation of the extracellular concentrations of glutamate and aspartate in rat hippocampus during transient cerebral ischemia monitored by intracerebral microdialysis. J. Neurochem. 1984;43(5):1369-74. [86] Groenendaal F, Roelants-Van Rijn AM, van Der Grond J, Toet MC, de Vries LS. Glutamate in cerebral tissue of asphyxiated neonates during the first week of life demonstrated in vivo using proton magnetic resonance spectroscopy. Biol. Neonate. 2001;79(3-4):254-7. [87] Li S, Stys PK. Na(+)-K(+)-ATPase inhibition and depolarization induce glutamate release via reverse Na(+)-dependent transport in spinal cord white matter. Neuroscience. 2001;107(4):675-83. [88] Back SA, Craig A, Kayton RJ, Luo NL, Meshul CK, Allcock N, et al. Hypoxiaischemia preferentially triggers glutamate depletion from oligodendroglia and axons in perinatal cerebral white matter. J. Cereb. Blood Flow Metab. 2007;27(2):334-47. [89] Kriegler S, Chiu SY. Calcium signaling of glial cells along mammalian axons. J. Neurosci. 1993;13(10):4229-45. [90] Follett PL, Deng W, Dai W, Talos DM, Massillon LJ, Rosenberg PA, et al. Glutamate receptor-mediated oligodendrocyte toxicity in periventricular leukomalacia: a protective role for topiramate. J. Neurosci. 2004;24(18):4412-20. [91] Gallo V, Patneau DK, Mayer ML, Vaccarino FM. Excitatory amino acid receptors in glial progenitor cells: molecular and functional properties. Glia. 1994;11(2):94-101. [92] Lerma J. Kainate receptor physiology. Curr. Opin. Pharmacol. 2006;6(1):89-97. [93] Liu SJ, Zukin RS. Ca2+-permeable AMPA receptors in synaptic plasticity and neuronal death. Trends Neurosci. 2007;30(3):126-34. [94] Burnashev N, Monyer H, Seeburg PH, Sakmann B. Divalent ion permeability of AMPA receptor channels is dominated by the edited form of a single subunit. Neuron. 1992;8(1):189-98. [95] Jonas P, Racca C, Sakmann B, Seeburg PH, Monyer H. Differences in Ca2+ permeability of AMPA-type glutamate receptor channels in neocortical neurons caused by differential GluR-B subunit expression. Neuron. 1994;12(6):1281-9. [96] Durand GM, Zukin RS. Developmental regulation of mRNAs encoding rat brain kainate/AMPA receptors: a northern analysis study. J. Neurochem. 1993;61(6):223946. [97] Monyer H, Burnashev N, Laurie DJ, Sakmann B, Seeburg PH. Developmental and regional expression in the rat brain and functional properties of four NMDA receptors. Neuron. 1994;12(3):529-40. [98] Pellegrini-Giampietro DE, Bennett MV, Zukin RS. Are Ca(2+)-permeable kainate/AMPA receptors more abundant in immature brain? Neurosci. Lett. 1992;144(1-2):65-9. [99] Deng W, Neve RL, Rosenberg PA, Volpe JJ, Jensen FE. Alpha-amino-3-hydroxy-5methyl-4-isoxazole propionate receptor subunit composition and cAMP-response

Highlights in Understanding White Matter Ischemia

79

element-binding protein regulate oligodendrocyte excitotoxicity. J. Biol. Chem. 2006;281(47):36004-11. [100] Talos DM, Follett PL, Folkerth RD, Fishman RE, Trachtenberg FL, Volpe JJ, et al. Developmental regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid receptor subunit expression in forebrain and relationship to regional susceptibility to hypoxic/ischemic injury. II. Human cerebral white matter and cortex. J. Comp. Neurol. 2006;497(1):61-77. [101] Talos DM, Numis A, Sucher NJ, Folkerth RD, Volpe JJ, Jensen FE. Maturational profile of NR1, NR2, and NR3 subunit expression in human parietal white matter. In: Program No. 623.12. Neuroscience Meeting Planner. Atlanta, GA: Society for Neuroscience, 2006. [102] Back SA, Luo NL, Mallinson RA, O'Malley JP, Wallen LD, Frei B, et al. Selective vulnerability of preterm white matter to oxidative damage defined by F2-isoprostanes. Ann. Neurol. 2005;58(1):108-20. [103] Haynes RL, Folkerth RD, Keefe RJ, Sung I, Swzeda LI, Rosenberg PA, et al. Nitrosative and oxidative injury to premyelinating oligodendrocytes in periventricular leukomalacia. J. Neuropathol. Exp. Neurol. 2003;62(5):441-50. [104] Yonezawa M, Back SA, Gan X, Rosenberg PA, Volpe JJ. Cystine deprivation induces oligodendroglial death: rescue by free radical scavengers and by a diffusible glial factor. J. Neurochem. 1996;67(2):566-73. [105] Baud O, Haynes RF, Wang H, Folkerth RD, Li J, Volpe JJ, et al. Developmental upregulation of MnSOD in rat oligodendrocytes confers protection against oxidative injury. Eur. J. Neurosci. 2004;20(1):29-40. [106] Baud O, Greene AE, Li J, Wang H, Volpe JJ, Rosenberg PA. Glutathione peroxidasecatalase cooperativity is required for resistance to hydrogen peroxide by mature rat oligodendrocytes. J. Neurosci. 2004;24(7):1531-40. [107] Khan JY, Black SM. Developmental changes in murine brain antioxidant enzymes. Pediatr. Res. 2003;54(1):77-82. [108] Folkerth RD, Haynes RL, Borenstein NS, Belliveau RA, Trachtenberg F, Rosenberg PA, et al. Developmental lag in superoxide dismutases relative to other antioxidant enzymes in premyelinated human telencephalic white matter. J. Neuropathol. Exp. Neurol. 2004;63(9):990-9. [109] Arai Y, Deguchi K, Mizuguchi M, Takashima S. Expression of beta-amyloid precursor protein in axons of periventricular leukomalacia brains. Pediatr. Neurol. 1995;13(2):161-3. [110] Deguchi K, Oguchi K, Takashima S. Characteristic neuropathology of leukomalacia in extremely low birth weight infants. Pediatr. Neurol. 1997;16(4):296-300. [111] Meng SZ, Arai Y, Deguchi K, Takashima S. Early detection of axonal and neuronal lesions in prenatal-onset periventricular leukomalacia. Brain Dev. 1997;19(7):480-4. [112] Ohyu J, Marumo G, Ozawa H, Takashima S, Nakajima K, Kohsaka S, et al. Early axonal and glial pathology in fetal sheep brains with leukomalacia induced by repeated umbilical cord occlusion. Brain Dev. 1999;21(4):248-52. [113] Fern R, Davis P, Waxman SG, Ransom BR. Axon conduction and survival in CNS white matter during energy deprivation: a developmental study. J. Neurophysiol. 1998;79(1):95-105.

80

James J. P. Alix and Michael G. Salter

[114] McCarran WJ, Goldberg MP. White matter axon vulnerability to AMPA/kainate receptor-mediated ischemic injury is developmentally regulated. J. Neurosci. 2007;27(15):4220-9.

In: Brain Mapping and Diseases Ed: Diane E. Spinelle

ISBN: 978-1-61122-065-0 © 2011 Nova Science Publishers, Inc.

Chapter 5

APPLICATIONS OF DIFFUSION TRACTOGRAPHY TO THE STUDY OF HUMAN COGNITIVE FUNCTIONS Emi Takahashi* Department of Radiology; Harvard Medical School, Massachusetts General Hospital; A. A. Martinos Center for Biomedical Imaging. Charlestown, MA 02129, USA

ABSTRACT Functional neuroimaging studies have significantly advanced our understanding of human cognitive functions. However, much less is known about the anatomical connections underlying higher cognitive processes in humans. One of the reasons why anatomical studies have lagged behind functional studies is that there are methodological limitations on studying anatomical connections of the human brain in vivo. There are numerous detailed anatomical studies of non-human primates that serve as the basis of our understandings of connections in the brain. However, those techniques are not feasible in humans. Diffusion imaging is a new technique based on detecting the diffusion of water molecules from magnetic resonance images. Diffusion imaging allows non-invasive mapping of anatomical connections and gives a comprehensive picture of connectivity throughout the brain, but there are still numerous technical issues to be addressed. Here, I introduce our recent studies on large-scale anatomical connections underlying episodic memory in humans. We studied an entire network based on some episodic memory tasks, and applied several new approaches to assess our tractography results. Our main finding was that encoding-related areas in the left dorsolateral prefrontal cortex and the left ventrolateral prefrontal cortex connect with another encoding-related area in the left temporal cortex. This suggests that there are two pathways between prefrontal cortex and temporal cortex related to encoding processes in episodic memory. Further, I discuss future applications of diffusion imaging in the study of the human memory system.

*

Emi Takahashi: Email: [email protected]

82

Emi Takahashi

INTRODUCTION Diffusion Imaging and Tractography Diffusion tensor imaging (DTI) is a technique that measures the diffusion properties of water molecules from diffusion-weighted magnetic resonance images (Basser et al., 1994). One promising application of diffusion images in brain research is reconstructing white matter fiber structures. Tractography algorithms are applied to DTI data to reconstruct connections between various brain regions (Mori et al., 1999; Jones et al., 1999; Conturo et al., 1999). Many studies have used DTI to show anatomical connections in the human brain (e.g. Conturo et al., 1999; Basser et al., 2000; Stieltjes et al., 2001; Xu et al., 2002; Behrens et al., 2003; Lehericy et al., 2004; Powell et al., 2004), and recent studies have used DTI to assess connectivity between functionally defined region of interest (e.g. Guye et al., 2003; Toosy et al., 2004; Dougherty et al., 2005; Kim et al., 2006; Takahashi et al., 2007a, 2007b). White matter occupies most of the brain, and it has been shown that disruptions of the white matter properties could cause various cognitive deficits and other kinds of variability (e.g. Catani, 2006; Sullivan and Pfefferbaum, 2003; Tuch et al., 2005). Thus, I believe that knowing white matter pathways underlying specific cognitive functions has great possibilities to contribute to our understandings of functional organization of the human brain. In this chapter, I review our recent study of anatomical connections underlying episodic memory encoding and retrieval in the human brain, along with the research trends in this field, and introduce possible future diffusion studies on the human memory system.

Selection of Cognitive Models The human memory system is supported and constituted by a number of different processes (Squire and Zola-Morgan, 1991; Cabeza and Nyberg, 2000; Tulving, 2002; Habib et al., 2003). Recent functional neuroimaging studies have shown that areas in the prefrontal, parietal and temporal cortices are involved in memory encoding and retrieval (Tulving et al., 1994; Demb et al., 1995; Buckner et al., 1998; Buckner and Koutstaal, 1998; Wagner et al., 1998; Buckner et al., 1999; Lepage et al., 2000). Among these memory-related areas, prefrontal cortex (PFC) is thought to subserve cognitive control processes (Goldman-Rakic, 1987; Schacter, 1987; Shimamura, 1995; Fuster, 1997; Takahashi and Miyashita, 2002), and send top-down signals to posterior cortices (Incisa della Rocchetta, 1993; Gazzaniga, 1995; Tomita et al., 1999; Takahashi and Miyashita, 2002). Recently, a two-stage model of PFC was proposed (Petrides, 1994a, 1994b, 1996; Owen, Evans and Petrides, 1996). In this model, ventro-lateral prefrontal cortex (VLPFC) interacts with posterior cortices such as temporal cortex for active (or controlled) encoding and retrieval of information, whereas dorso-lateral prefrontal cortex (DLPFC) monitors and manipulates information maintained in VLPFC. Anatomical studies in nonhuman primates have shown direct corticocortical connections from VLPFC to temporal cortex (Petrides and Pandya, 2002), but direct connections from DLPFC to temporal cortex are still controversial (Seltzer and Pandya, 1989; Petrides and Pandya, 1994, 1999; Petrides, 2005). Based on these studies, we hypothesized two possibile models of

Applications of Diffusion Tractography to the Study of Human Cognitive Functions

83

the anatomical connections between PFC and temporal cortex in humans (figure 1A); (i) Serial Pathway Model: DLPFC connects with VLPFC, and VLPFC connects with temporal cortex, but DLPFC does not connect with temporal cortex, (ii) Parallel Pathway Model: DLPFC and VLPFC both connect with temporal cortex. In this study, we performed DTI tractography from functionally defined memory areas to test these two connectivity models.

Figure 1. (A) Two possible models of connections between the prefrontal and temporal cortices. (i) Serial Pathway Model: DLPFC connects with VLPFC, but not with the temporal cortex, and VLPFC connects with the temporal cortex, (ii) Parallel Pathway Model: DLPFC and VLPFC both connect with the temporal cortex. (B) Experimental design for functional imaging in encoding (left) and retrieval (right). In encoding, there are four conditions: living/nonliving, detection, visuo-motor control, and fixation. In retrieval, there are retrieval trials and visuo-motor control trials.

Functional Task To define functional anatomy to constrain the analysis of anatomical connectivity, we used tasks that engage episodic memory. The experiment consisted of two parts, an encoding phase and a retrieval phase (figure 1B). In the encoding phase, subjects were asked to perform 4 different “encoding” tasks: 1) make a living/nonliving judgment (deep encoding), 2) detect a given letter within a non-word letter sequence (shallow encoding), 3) press a random button, and 4) fixate on a central target. Each word was presented only once throughout the encoding phase. In the retrieval phase, subjects performed randomly intermixed retrieval trials, visuomotor control trials, and fixation trials. In the retrieval trials, subjects made yes/no recognition memory judgments for previously studied and new stimuli. Half of the words from the encoding phase were presented again, along with new words. Activated brain areas are shown in figure 2A, B (found in the encoding phase) and figure 3A, B (found in the retrieval phase).

84

Emi Takahashi

Figure 2. (A-C) Activation and fiber tracking from the activated areas in the encoding phase in the comparison “deep encoding versus visuo-motor control”. (A) Activated clusters (20 subjects, random effect analysis, p<0.001, uncorrected; p<0.05 corrected for whole-brain multiple comparisons at cluster level, only cortical activation clusters are displayed) are superimposed on T1-weighted normalized brain slices. The left hemisphere of the brain corresponds to the left side of the image. A color bar for T values of activated areas is shown at the bottom of the left. Z coordinates of Talairach space are shown on the top of each slice. (a) Left DLPFC (BA9/46/45), (b) left VLPFC (BA45/47/insula), (c) medial frontal gyrus (BA6), (d) right VLPFC (BA45/46), (e) left superior frontal gyrus (BA6), (f) left intraparietal sulcus (BA7) and (g) left STS and FG (BA21/22/37). BA:Brodmann’s Area. (B) Activated clusters using the same threshold as (A) are shown as red superimposed on a saggital view (top) and an axial view (bottom) of a brain. (a)-(g) represent the same areas as shown in (A). (C) All the reconstructed fibers from the left DLPFC (left) and left VLPFC (right) in single subject are shown as green in a saggital view (top) and an axial view (bottom). The activated areas are shown as yellow.

Detection of Connections We used tractography algorithms based on the method described in Basser et al. (Basser et al., 2000) and Lazar et al. (Lazar et al., 2003). At every position along the fiber trajectory, a diffusion tensor is interpolated and eigenvectors are computed. The eigenvector associated with the greatest eigenvalue indicates the principal direction of water diffusion. The fiber tract is propagated along this direction over a small distance to the next point where a new diffusion tensor is interpolated. Fiber tracking terminates when the angle between two consecutive eigenvectors is greater than a given threshold (60o), or when the FA value is smaller than a given threshold (0.14). The criteria of FA < 0.14-0.15 is reported to provide the best tradeoff between fewer erroneous tracts and penetration into the white matter (Thottakara et al. 2006). This streamline approach is based on the assumption that diffusion is locally uniform and can be accurately described by a single eigenvector. Unfortunately, this approach fails to describe crossing fibers (e.g. Alexander et al., 2001). To overcome this problem, tensorline approaches (e.g. tensor deflection) have been developed that use the entire tensor information instead of reducing it to a single eigenvector (Lazar et al., 2003). In our study, both algorithms, i.e. streamline (Basser et al., 2000) and tensor deflection (Lazar et al., 2003), were used to reconstruct 3D tractography fibers (Takahashi et al, 2007a).

Applications of Diffusion Tractography to the Study of Human Cognitive Functions

85

Figure 3. Activation and DTI tractography from activated areas in the retrieval phase in the comparison “all retrieval versus visuo-motor control”. (A) Activated clusters (20 subjects, random effect analysis, p<0.001, uncorrected; p<0.05 corrected for whole-brain multiple comparisons at cluster level, only cortical activation clusters are displayed) are superimposed on T1-weighted normalized brain slices. The left hemisphere of the brain corresponds to the left side of the image. A color bar for T values of activated areas is shown at the bottom of the left. Z values of Talairach space are shown on the top of each slice. (a, d) bilateral VLPFC (BA47/45/insula), (b) left VLPFC (BA10/47), (c) medial frontal gyrus (BA6/8), (e) left DLPFC (BA9/8), (f) anterior cingulate cortex (BA24), (g) left intraparietal sulcus (BA7), (h, j) bilateral fusiform gyrus (BA37), and (i, k) bilateral inferior and middle occipital gyrus and cuneus (BA17/18/19). (B) Activated clusters using the same threshold as (A) are shown as red superimposed on a saggital view (top) and an axial view (bottom) of a brain. (a)-(k) represent the same areas as shown in (A). (C) All the reconstructed fibers from the left DLPFC (left) and left VLPFC (right) in single subject are shown as green in a saggital view (top) and an axial view (bottom). The activated areas are shown as yellow. (A: anterior, P: posterior, D: dorsal, V: ventral, L: left, R: right).

Tractography was performed from all of the activated cortical regions (but not from cerebellum and brain stem) in 20 healthy subjects. Figure 2C and 3C show the reconstructed fibers from the left DLPFC (left) and left VLPFC (right) active in a single subject in encoding (figure 2C) and retrieval (figure 3C). The fibers from left DLPFC and VLPFC extended to other left prefrontal regions, as well as the left parietal and temporal cortices. The fibers from the region that was active in the left temporal cortex were found to be connected to the left frontal, parietal and occipital cortices.

DESIGN OF TRACTOGRAPHY ANALYSES FOR COGNITIVE FUNCTIONS Network of Connections By studying the pathways among all activated regions, we can see an entire network that is involved in a specific cognitive task. We examined connections between pairs of activation clusters in each subject. Fibers were obtained using any voxel in the starting cluster (as a seed) to any voxel within the end cluster, going in either direction. Examples of connections are shown in figure 4A (encoding) and 4B (retrieval). Figure 5A shows the connections found between the activated areas in the left DLPFC and the left temporal cortex for the encoding phase. Figure 5B shows the connections between the left VLPFC and the region that was active in the left temporal cortex for the encoding phase. We performed this analysis on the data obtained from all 20 subjects. The most dorsal part (BA 9) of the left DLPFC cluster

86

Emi Takahashi

connected with the dorsal part (BA21, 22) of the left temporal cortex cluster. In some subjects, there were also connections between the ventral part of the DLPFC cluster and the temporal cortex cluster. Fibers between VLPFC and STS also exhibited different pathways passing through more ventral parts. These fiber pathways were consistent across subjects.

Figure 4. Examples of tractography between each pair of activated areas in single subject. (A-D) “deep encoding versus control” (A) left DLPFC (BA9/8/46/45) and left middle temporal to fusiform gyrus (BA22/37), (B) left and right operculum, (C) left inferior frontal gyrus (BA47) and left intraparietal sulcus, and (D) left intraparietal gyrus (BA7/40) and left middle temporal and fusiform gyri (BA37). (E-H) “all retrieval versus control” (E) left BA9/8 and medial BA6 (SMA and pre-SMA), (F) right frontal operculum (BA47/45) and right inferior occipital gyrus (BA19), (G) left frontal operculum (BA47) and left inferior occipital gyrus (BA19), and (H) left and right inferior occipital gyrus (BA19). (A: anterior, P: posterior, D: dorsal, V: ventral, L: left, R: right).

Figure 6 summarizes the connectivity data between each pair of clusters for the entire group of subjects. The connections between the left DLPFC and the left temporal cortex, and between the left VLPFC and the left temporal cortex were found in more than 10 out of 20 subjects with both the streamline (from the left DLPFC to the left temporal cortex: 18 subjects; from the left VLPFC to the left temporal cortex: 14 subjects) and tensor deflection algorithms (from the left DLPFC to the left temporal cortex: 20 subjects; from the left VLPFC to the left temporal cortex: 18 subjects) in encoding. Fibers found in more than half of all 20 subjects with both the streamline and tensor deflection algorithms were shown as arrows in solid lines. The dotted arrow indicates the pathways found in more than 10 subjects only by tensor deflection (Some arrows are omitted).

Applications of Diffusion Tractography to the Study of Human Cognitive Functions

87

Figure 5. Fibers between two activation clusters in five different subjects. (A) Reconstructed fibers between the left DLPFC (BA9/8/46/45) and left STS to FG (BA21/22/37) in the encoding phase. (B) Reconstructed fibers between the left VLPFC and the left STS to FG (BA21/22/37) in the encoding phase. (A: Anterior, P: posterior, D: dorsal, V: ventral, L: left, R: right). Fibers were tracked in both directions.

Figure 6. Summary of the tractography results between the activation clusters. (A) Encoding, (B) Retrieval. The pathways found in more than 10 subjects both by streamline and tensor deflection algorithms are shown as solid arrows, while a dotted arrow indicates the pathways found in more than 10 subjects only by tensor deflection. DLPFC: dorso-lateral prefrontal cortex, VLPFC: ventro-lateral prefrontal cortex, SFG: superior frontal gyrus, STS: superior temporal sulcus, FG: fusiform gyrus, AC: anterior cingulated cortex: SMA: supplementary motor area, OTC: occipito-temporal cortex.

88

Emi Takahashi

Specificity of Connections If reconstructed fibers represented random connections between brain regions, then showing the existence of such fibers would be meaningless. Even though the connections are not entirely random, diffusely connected tracts to broad areas near the targets, are still less meaningful than they could otherwise be. To address this issue, we estimated the specificity in the connections between two activated clusters in the left DLPFC and the left temporal cortex in encoding. For this purpose, we examined the degree of connectivity between the DLPFC activation and arbitrarily defined non-activating regions. If the connection was specific, the degree of connectivity between DLPFC and arbitrary regions should be significantly lower than the connectivity between DLPFC and temporal cortex activation. However, the degree of connectivity could be affected by many factors, such as distances between regions, and shapes of regions. Thus, we restricted the arbitrary regions to those satisfying the following conditions: (1) all voxels were inside the brain, (2) there was no overlap with the activated regions, (3) the volume and shape of the region were exactly the same as the temporal cortex activation, (4) the distance from the DLPFC was exactly the same as the distance between the DLPFC and the temporal cortex activation. Following these conditions, the arbitrary regions were selected 100 times for each subject, allowing their overlap. Then, the number of the fibers between the DLPFC and these arbitrarily defined regions were obtained. The fibers between the left DLPFC and the newly placed cluster were tracked from any voxel in one cluster to any voxel in the other cluster in both directions. Arbitrary regions satisfying the selection criteria were used 100 times for each subject. Then, the number of fibers between the DLPFC and those arbitrarily defined regions were obtained. There was no connection between the DLPFC cluster and 55% of the random clusters. The median of the number of fibers between the DLPFC cluster and the random clusters was found to be 0, which is significantly different from the observed number of fibers (57 fibers). The random clusters that had more fibers than the actual number of fibers (57 fibers) were only 5%, and all of them were found in the precuneus in this particular subject. We performed the same type of analysis on all 18 subjects who had fibers between DLPFC and temporal cortex clusters. Eleven out of 18 subjects showed a significantly larger number of actual fibers relative to fibers generated from random clusters. At the population level, the number of actual fibers and the median number of fibers from random clusters for 18 subjects were significantly different. These analyses confirmed that the connections between DLPFC and temporal cortex activation were specific. Only some restricted areas (14.0 %) located in the right PFC (BA9/46) and precuneus (BA7) showed more connections with the left DLPFC cluster. Strength of connection is a different concept from specificity, and could be defined as the quantity of reconstructed fibers. However, one needs to be very cautious about direct comparisons of quantities because they are very sensitive to and dependent on the sampling conditions of the fibers.

Applications of Diffusion Tractography to the Study of Human Cognitive Functions

89

Segregation of Multiple Connections Segregation is also a different concept from specificity, and could be contribute to our broader understanding of cognitive functions. For example, there is an unsolved relationship between the parietal cortex and temporal lobe in terms of episodic memory retrieval. The parietal cortex has traditionally been implicated in spatial attention and eye-movement processes (Hyvarinen, 1982; Corbetta, 1998; Colby and Goldberg, 1999; Mesulam, 1999). In addition, recent functional neuroimaging studies have found activation in the parietal cortex during various memory tasks, especially those related to successful recognition memory (Henson et al. 1999; Konishi et al., 2000; Donaldson et al., 2001; Cansino et al., 2002; Dobbins et al., 2003; Rugg et al., 2003; Wheeler and Buckner, 2003; Herron et al, 2004). Most studies have identified several regions in the parietal cortex that respond to “Hits” (when subjects correctly recognize previously studied old items) more than to “Correct Rejections” (when they correctly identify new items). The regions in which this effect was identified consistently include the intraparietal sulcus (IPS or Brodmann Areas (BA) 7), medial parietal cortex (the precuneus (PCu) or medial BA7, and posterior cingulate cortex or BA23/31), and several prefrontal regions. Although the roles of the prefrontal cortex in successful memory retrieval have been relatively well studied (Buckner et al., 1998a, b; Henson et al. 1999, followed by many other studies), those of the parietal cortex are still poorly understood (Shannon and Buckner, 2004; Naghavi and Nyberg, 2005; Wagner et al., 2005; Cavanna and Trimble, 2006). Since it is well known that declarative memory relies on the medial temporal lobe (MTL) and lateral temporal cortex, a key strategy for studying successful memory retrieval in the parietal cortex is to study its relationship with the temporal lobe. Given the accumulating knowledge on the functionally dissociated roles of the temporal lobe in terms of memory, studying connectivity between IPS/PCu and the temporal lobe should be fundamental to understand the roles of the parietal regions in memory. Neuropsychological studies suggest that different types of memory depend on separated cortical structures (e.g. Squire, 1994, Takahashi and Miyashita, 2002). For example, patients with left lateral temporal lobe damage have impaired memory for semantic knowledge (De Renzi et al., 1987; Hart and Gordon, 1990; Snowden et al., 1989), but relatively preserved memory for episodic information (De Renzi et al., 1987; Snowden et al., 1994). Recent functional imaging studies also showed that lateral temporal cortex is activated by semantic memory retrieval or item-based memory, while the MTL is activated by episodic memory retrieval or relational memory (Wiggs et al., 1999; Lee et al., 2002; Konishi et al., 2006). Based on these functional dissociations between the MTL and lateral temporal cortex studies of the specific connections between these areas should provide insight into the process of memory retrieval in parietal cortex. Another example is the dorsal and ventral information streams. When we perceive our external world, the information is divided into multiple functional streams in our brains. Especially, when we briefly hold information in working memory, “where” and “what” aspects of the percept are largely divided into dorsal and ventral pathways in the brains. However, both the functional reasons for this segregation and the underlying mechanism for recombining the information remain unsolved. Why does the brain need to separate visual information in this way to generate a percept of the world? How does the brain combine those functional streams into a perceived event or percept with distinct features? This dissociation

90

Emi Takahashi

could be based on the specific segregated anatomical connections, and our perception of complex events could be derived from the resulting specific connections from the two pathways.

Group Analyses Group analysis in the tractography study has been relatively less developed compared to that in the functional study. In our study (Takahashi et al., 2007a, 2007b), the coordinates of the activated clusters in Talairach coordinates were reverse normalized into each subject’s coordinates, and used as the basis for fiber tracking and determining the coordinates of the end points of the fibers. We then normalized the coordinates of the end points and averaged the data across all the subjects. This approach is better than normalizing diffusion weighted images (DWIs) directly because the resolution of DWIs was reduced when we resampled DWIs during normalization.

Figure 7. The average results of 20 subjects’ terminal points of DTI tractography. The left hemisphere of the brain corresponds to the left side of the image. The terminals of the tracked fibers are shown as yellow to green. The colors indicate the number of subjects whose fiber tracking from any seed points terminated in the voxel (see color bar). Terminal points of fibers from encoding activation in the left DLPFC (top row), left VLPFC (middle row) and the left STS (bottom row). The end points of fiber tracking converged in (a) left inferior frontal gyrus (BA47), (b) left anterior to posterior insula, (c) left hippocampus/parahippocampal formation, (d) bilateral brain stem, (e) left inferior occipital gyrus (BA18), (f) left STS and FG (BA21/22/37), (g) left inferior frontal gyrus (BA44/45), (h) left frontal operculum (BA47), (i) left striatum, (j) left thalamus, (k) right inferior frontal gyrus (BA46), (l) left superior to middle frontal gyri (BA9/10), (m) left occipital gyrus (BA19), (n) left medial frontal gyrus (BA9), (o) left supplementary motor area (BA8), (p) left precuneus (BA7), (q) left middle frontal gyrus (BA6), (r) left inferior parietal gyrus (BA40), (s) left supplementary motor area (BA6), (t) left superior frontal gyrus (BA6), and (u) left postcentral gyrus.

Figure 7 shows the distribution of terminal points for reconstructed fibers in 20 subjects. The fibers were tracked from areas in the left DLPFC (top row), VLPFC (middle row) and temporal cortex (bottom row) that were activated during the encoding phase. The terminal points converged on a large number of memory-related areas also activated during the encoding phase. These areas include: left VLPFC (h), right VLPFC (k), left medial frontal (o,

Applications of Diffusion Tractography to the Study of Human Cognitive Functions

91

s), left superior frontal (t) and left temporal cortex (f). In addition, some fibers terminated in areas activated during the retrieval phase (e.g. i and p). We also found connections to the left hippocampus/parahippocampal region (c). We performed this group analysis for all the other activated areas. The results in figure 8 suggest that, consistent with our results on each subject, activated areas in the left DLPFC and VLPFC both have connections with the left temporal cortex activation.

Estimation of Tractography Error In our study, the dispersion errors in white matter tractography were estimated by a statistical nonparametric bootstrap method (Lazar and Alexander, 2005). In each iteration, two samples were randomly selected with replacement from the pool of four independent DTI acquisitions, and were averaged. The procedure was repeated for each diffusion-encoding of the brain volume (15 directions) and for one non-diffusion weighted volume, resulting in one bootstrap DTI volume sample. The dispersion errors for the tractography were obtained by running the tractography algorithm over 100 iterations of the bootstrap DTI data set. Thirty-three continuous seed points in the temporal cortex showed greater than 50 % probability of a connection to DLPFC. The seed cluster volume was 33 mm3 (1mm sampling of seed points), corresponding to 0.7 % of the entire temporal cortex activation (4848 mm3). It is clear that these seed points did not distribute diffusively across the whole activated cluster, but were rather confined in a specific region. The Talairach coordinates of these 33 voxels were located in STS (x, y, z = -54 ± 5, -40 ± 2, -1 ± 2). These results indicate that the locations in temporal cortex that had connections with DLPFC were very specific. We showed the results of boot-trac from a single seed point (Talairach: x, y, z = -49, -41, 0) in two ways. First, all the fibers for 100 bootstraps are shown in figure 8A. Most of the fibers (78 %) went to the DLPFC, gradually diverging by the distance from the seed point in the temporal cortex activation. To assess uncertainty of this probability, we performed boottrac analysis 1000 times. By shuffling the orders of the 1000 boot-trac samples 1000 times, an error for each iteration was obtained. At 100 iterations of boot-trac, the error was less than 5%. Second, the boot-trac from the same seed is shown as a probabilistic map (figure 8B). This figure shows how many times, out of 100, the boot-trac fibers passed through each voxel. The probabilities were almost 100 % around the seed point in the temporal cortex activation, but soon went down less than 50 %. This is because of the divergence of the tracked fibers, which depends on the distance from the seed point, as displayed in figure 8A. We obtained a probabilistic map of connections from all 33 seed points with a connection probability greater than 50% (figure 8C). These seed points are located in restricted locations, so they could compensate for the low probability of one seed point. The results indicate that the fiber tracking from those 33 seed points reached the DLPFC activation with a probability of more than 80 %. The terminal location was the posterior end of the DLPFC cluster (around x, y, z = -49, 3, 36 in the Talairach coordinate), around the precentral sulcus to the middle frontal gyrus. This result indicates that not only the seed points, but also the terminal points were in very restricted locations within the activation. Figure 8C shows the probabilities of fibers from 33 voxels in the temporal cortex to anywhere in the whole brain. Although we did not selectively show the fibers that reached the DLPFC activation, high probabilities were

92

Emi Takahashi

found only along the pathway from the temporal cortex to DLPFC. Thus, the specificity of this pathway was remarkable. We also obtained probabilistic maps (figure 9, upper row) from all the voxels in the temporal cortex activation, similar to figure 8C. All subjects’ results (n=20) were averaged after normalization (figure 9, lower row).

Figure 8. (A) All the fibers for 100 bootstraps from a single seed point at (-49, -41, 0). A: anterior, P: posterior, D: dorsal, V: ventral. (B) A probabilitistic map of the connection from a single seed point (Talairach: x, y, z = -49, -41, 0). The voxels with more than 10 % probabilities were color-coded. (C) A probabilitistic map of the connection from the 33 seed points of high probabilities in the temporal cortex (green). Voxels that showed more than 50 % were color-coded.

The boot-tracked fibers were diverging by the distance from the seed points, but in many cases, as shown in figure 8A, most of the fibers reached the DLPFC activation. To see this observation quantitatively, we examined the probability of connections between any voxel in the temporal cortex and any voxel in the DLPFC. We found the connection with a probability of 100% in this subject. We performed this latter analysis for 18 subjects who showed connections between these regions. The existence of this pathway was crucial to distinguishing between the two models (the Serial and Parallel Pathway Models) mentioned above. Ten subjects out of the 18 subjects showed more than 50% probabilities for the connections between the left DLPFC and the left temporal cortex. The probability for the

Applications of Diffusion Tractography to the Study of Human Cognitive Functions

93

existence of this connection was very high in these 10 subjects (86.3 ± 18.0%, n=10). This result validates our major finding on the direct pathway between DLPFC and the temporal cortex activation.

Figure 9. Probabilistic maps of the connections from all the seed points in the temporal cortex activation in a single subject (upper row) and all the 20 subjects (lower row).

INTERPRETATIONS OF TRACTOGRAPHY RESULTS IN COGNITIVE FUNCTIONS Although tractography provides information about anatomical pathways in vivo, it does not offer any functional interpretations of the reconstructed fibers. One solution to that problem is using functionally activated areas to constrain the analysis of anatomical connectivity, which I have introduced in this chapter. With knowledge of the functional roles of activated areas, outcomes of tractography (i.e. connectivity/disconnectivity of a network, probability, specificity, segregation, numbers of fibers, diffusion properties on the fibers etc.) can help us understand anatomical networks underlying specific cognitive processes. Correlations between the results of tractography, and the strength of functional activation or performance measures of subjects are an additional help. Another possible approach is to see functional correlations among areas that have anatomical connections (Takahashi et al., 2007b). There have been an increasing number of studies on functional connectivity. Parallel findings of anatomical connections and functional connectivity provide another source of convergent functional evidence to explain the reconstructed fiber tracts.

FUTURE DIRECTIONS FOR TRACTOGRAPHY STUDIES Technical Improvements One major challenge facing tractography is the crossing-fiber problem. Algorithms for tractography fail or produce errors when they encounter a voxel where neural fibers cross each other. Basically, at that point, a reconstructed fiber stops or goes in the wrong direction. There have been two approaches to solving this problem thus far: one is to assess

94

Emi Takahashi

tractography errors using a probabilistic approach, and the other is to pursue higher-resolution imaging to improve the accuracy of tractography results. A number of studies have assessed tractography results using the probabilistic approach (e.g. Upadhyay et al., 2006; Takahashi et al., 2007a, 2007b). Although anatomical connections are conceptually incompatible with probability, this is one emerging trend in the study of connections in vivo. There are numbers of suggested methods to obtain probabilities of tracts (Behrens et al., 2003; Chung et al., 2006; Jbabdi et al., 2007). However, we currently do not have a way to directly compare the results of different implementations of the probabilistic approach. For example, the probabilities using repetition and wild bootstrap have different meanings, and it is not appropriate to compare them directly. This means that the same anatomical pathway can have different probabilities depending on the method used, even in the same brain. I believe that this problem needs to be addressed in the course of future tractography studies, in order to form a solid basis for comparative studies on large samples, similar to what has been done in tracer studies of connectivity of non-human primates. Another issue is that probability reflects both connections between the areas we are interested in, and the quality of the dataset (more precisely, various artifacts/noise on the pathway). The degree of artifact/noise could vary across different brain areas, so not addressing this problem may impair our ability to see the actual course of the pathway. These issues present challenging problems to be solved as the technology progresses. On a different front, efforts to improve accuracy of tractography will also be very important. New techniques were proposed recently that apply multiple diffusion encoding directions (Tuch et al., 2002; Wedeen et al., 2005) together with different gradient strengths (Wedeen et al., 2005). In theory, these techniques provide us with more precise ways to uncover white matter fiber structures, by reconciling the different directions of reconstructed fibers in a single voxel. These techniques are remarkably powerful especially on post-mortem brains (Schmahmann et al., 2007). Applying them to human in vivo imaging is a promising future direction.

Applications: Connectivity Studies in Human Memory Research As I discussed earlier in this chapter, there are several unanswered questions in memory research that tractography studies could help answer. One example is studying the pathways between the medial/lateral parietal cortices and medial/lateral temporal lobes involved in successful memory retrieval, and another is dissociating dorsal and ventral streams in maintaining and encoding visual information. Both anatomical pathways are unknown in humans, so directly studying the actual pathways predicted by those models will be significant for us to understand the mechanisms of long-range networks in memory systems. Certain other pathways are known to be important in memory processes. There are two signal pathways through which the mnemonic representation in the inferior temporal cortex can be activated in memory retrieval: the frontotemporal pathway and the limbic-temporal pathway (Takahashi and Miyashita, 2002). How do these pathways cooperate during memory retrieval? Many functional neuroimaging studies have suggested that the frontotemporal pathway is involved in retrieval. For example, Lepage and colleagues (2000) refer to the ‘retrieval mode’ as a neurocognitive state, in which one mentally holds in the background of

Applications of Diffusion Tractography to the Study of Human Cognitive Functions

95

focal attention an episode from one’s past experience. The neural substrate of such a neurocognitive set has been identified by imaging experiments in the bilateral frontal pole (Brodmann’s Area 10), the bilateral frontal operculum (BA45/47), the left dorsal prefrontal cortex (BA8/9), and the left anterior cingulate (BA 32). Our study, based on functional anatomy, showed direct anatomical pathways between the two prefrontal areas and the temporal cortex. However, so far, it is unknown how these prefrontal areas process the memory encoding/retrieval signal and which part sends the final signal to the temporal cortex. How do the two pathways play roles for the temporal cortex? It is likely that the connection between the dorsal prefrontal and temporal cortices plays a more encoding-related role (e.g. detecting novel features in an event and consolidating it into the brain) while the connection between the ventral prefrontal and temporal cortices plays a more retrieval-related role, as we showed in our study. Another signal pathway for memory retrieval originates from the medial temporal lobe. This pathway may play a crucial role for memory storage and retrieval for a while until memory is stored and retrieved by the hippocampus-independent system, perhaps until neocortical areas per se establish connectivity with each other (Takahashi and Miyashita, 2000). However, the nature of this indexing system is still unknown. Obtaining direct evidence for this hypothesis in animal experimentations remains as a challenge for future work to address.

From Connection to Cognition The results of tractography on humans have been compared to the results of tracer studies on non-human primates. The functional roles of connections in human brains have often been inferred based on those observed in the non-human primates. However, we should of course expect to see certain differences between humans and non-human primates that constitute the basis of uniquely human cognitive abilities. I believe that studying these differences in connectivity will provide us with a better understanding of human brains and higher-level cognitive functions. Future comparisons of connectivity could also reveal subtle differences between individuals. This could potentially enable us to causally predict and explain the cognitive variability we see in individuals, allowing us to move beyond what is possible with today’s correlation-based methods.

CONCLUSION Diffusion imaging enables us to study the white matter structure of the brain in vivo. Our experimental data demonstrates large-scale anatomical networks that serve as a basis of episodic memory in humans, especially two anatomical pathways between frontal and temporal lobes. Because of the limitations of current techniques, we should proceed with great care in the design of tractography studies. Future applications of tractography will be promising with development of more universally agreed-upon methods of estimating error, and more accurate detection of the trajectories of the fiber pathways.

96

Emi Takahashi

ACKNOWLEDGMENTS I gratefully thank Robert Levy for his very helpful editorial comments.

REFERENCES Alexander A.L., Hasan K.M., Lazar M., Tsuruda J.S. and Parker D.L. (2001). Analysis of partial volume effects in diffusion-tensor MRI. Mgn. Reson, Med. 45, 770-780. Basser, P.J., Mattiello, J. and LeBihan, D. (1994). MR diffusion tensor spectroscopy and imaging. Biophs. J. 66, 259-267. Basser P.J., Pajevic S., Pierpaoli C., Duda J. and Aldroubi A. (2000). In vivo fiber tractography using DT-MRI data. Magn. Reson. Med. 44, 625-632. Behrens T.E., Johansen-Berg H., Woolrich M.W., Smith S.M., Wheeler-Kingshott C.A., Boulby P.A., Barker G.J., Sillery E.L., Sheehan K., Ciccarelli O., Thompson A.J., Brady J.M. and Matthews P.M. (2003). Non-invasive mapping of connections between human thalamus and cortex using diffusion imaging. Nat. Neurosci. 6, 750-757. Buckner, R.L. and Koutstaal, W. (1998). Functional neuroimaging studies of encoding, priming, and explicit memory retrieval. Proc. Natl. Acad. Sci. U.S.A. 95, 891-898. Buckner R.L., Koutstaal W., Schacter D.L., Wagner A.D. and Rosen B.R. (1998). Functionalanatomic study of episodic retrieval using fMRI. I. Retrieval effort versus retrieval success. Neuroimage. 7, 151-162. Buckner, R.L., Koutstaal, W., Schacter, D.L., Dale, A.M., Rotte, M., Rosen, B.R. 1998b. Functional-anatomic study of episodic retrieval II. Selective averaging of event-related fMRI trials to test the retrieval success hypothesis. NeuroImage. 7: 163-175. Buckner, R.L., Kelley, W.M. and Petersen, S.E. (1999). Frontal cortex contributes to human memory formation. Nat. Neurosci. 2, 311-314. Cabeza, R. and Nyberg, L. (2000). Imaging cognition II: An empirical review of 275 PET and fMRI studies. J. Cogn. Neurosci. 12, 1-47. Cansino, S., Maquet, P., Dolan, R.J., Rugg, M.D. 2002. Brain activity underlying encoding and retrieval of source memory. Cereb. Cortex. 12: 1048-1056. Chung, S., Lu, Y., and Henry, R.G. (2006) Comparison of bootstrap approaches for estimation of uncertainties of DTI parameters. Neuroimage ee, 531-41. Colby, C.L., Goldberg, M.E. 1999. Space and attention in parietal cortex. Ann. Rev. Neurosci. 22: 319-349. Conturo T.E., Lori N.F., Cull T.S., Akbudak E., Snyder A.Z., Shimony J.S., McKinstry R.C., Burton H. and Raichle M.E. (1999). Tracking neuronal fiber pathways in the living human brain. Proc. Natl. Acad. Sci. U.S.A. 96, 10422-10427. Corbetta, M. 1998. Frontoparietal cortical networks for directing attention and the eye to visual locations: identical, independent, or overlapping neural systems? Proc. Natl. Acad. Sci. U.S.A. 95: 831-838. Catani, M. (2006). Diffusion tensor magnetic resonance imaging tractography in cognitive disorders. Curr. Opin. Neurol. 19, 599-606. Cavanna, A.E., Trimble, M.R. 2006 The precuneus: a review of its functional anatomy and behavioural correlates. Brain. 129: 564-583.

Applications of Diffusion Tractography to the Study of Human Cognitive Functions

97

De Renzi, E., Liotti, M., Nichelli, P. 1987. Semantic amnesia with preservation of autobiographical memory: A case report. Cortex. 23: 575-597. Demb J.B., Desmond J.E., Wagner A.D., Vaidya C.J., Glover G.H. and Gabrieli J.D. (1995). Semantic encoding and retrieval in the left inferior prefrontal cortex: a functional MRI study of task difficulty and process specificity. J. Neurosci. 15, 5870-5878. Dobbins, I.G., Rice, H.J., Wagner, A.D., Schacter, D.L. 2003. Memory orientation and success: separable neurocognitive components underlying episodic recognition. Neuropsychologia. 41: 318-333. Donaldson, D.I., Petersen, S.E., Ollinger, J.M., Buckner, R.L. 2001. Dissociating state and item components of recognition memory using fMRI. Neuroimage. 13: 129-142. Dougherty, R.F., Ben-Shachar, M., Bammer, R., Brewer, A.A. and Wandell, B.A. (2005). Functional organization of human occipito-callosal fiber tracts. Proc. Natl. Acad. Sci. U.S.A. 102, 7350-7355. Fuster, J.M. (1997). The prefrontal cortex: Anatomy, physiology, and neuropsychology of the frontal lobe. (Philadelphia: Lippincott-Raven). Gazzaniga, M.S. (1995). Principles of human brain organization derived from split-brain studies. Neuron. 14, 217-228. Goldman-Rakic, P.S. (1987). Circuitry of primate prefrontal cortex and regulation of behavior by representational memory. In Plum, F. and Mountcastle, V. eds. Handbook of physiology: Section 1. The nervous system. Vol. 5. Higher functions of the brain. Part 1, pp. 373-417. (Bethesda, MD: American Physiological Society). Guye M. et al. 2003. Combined functional MRI and tractography to demonstrate the connectivity of the human primary motor cortex in vivo. NeuroImage. 19: 1349-1360. Habib, R., Nyberg, L. and Tulving, E. (2003). Hemispheric asymmetries of memory: the HERA model revisited. TRENDS in Cogn. Sci. 7, 241-245. Hart, J. Jr, Gordon, B. 1990. Delineation of single-word semantic comprehension deficits in aphasia, with anatomical correlation. Ann. Neurol. 27: 226-231. Henson, R.N.A., Rugg, M.D., Shallice, T., Josephs, O., Dolan, R.J. 1999. Recollection and familiarity in recognition memory: an event-related functional magnetic resonance imaging study. J. Neurosci. 19: 3962-3972. Herron, J.E., Henson, R.N.A., Rugg, M.D. 2004. Probability effects on the neural correlates of retrieval success: an fMRI study. NeuroImage. 21: 302-310. Hyvarinen, J. 1982. Posterior parietal lobe of the primate brain. Physiol. Rev. 62: 1060-1129. Incisa della Rocchetta, A. and Milner, B. (1993). Strategic search and retrieval inhibition: The role of the frontal lobes. Neuropsychologia. 31, 503-524. Jbabdi, S, Woolrich, M.W., Andersson, J.L., Behrens, T.E. (2007) A bayesian framework for global tractography. In press Jones, D.K., Horsfield, M.A. and Simmons, A. (1999). Optimal strategies for measuring diffusion in anisotropic systems by magnetic resonance imaging. Magn. Reson. Med. 42, 515-525. Kim, M., Ducros, M., Carlson, T., Ronen, I., He, S., Ugurbil, K., Kim, D-S. 2006. Anatomical correlates of the functional organization in the human occipitotemporal cortex. Magn. Reson. Imaging. Konishi, S., Wheeler, M.E., Donaldson, D.I., Buckner, R.L. 2001. Neural correlates of episodic retrieval success. NeuroImage. 12: 276-286.

98

Emi Takahashi

Konishi, S., Asari, T., Jimura, K., Chikazoe, J., Miyashita, Y. 2006. Activation shift from medial to lateral temporal cortex associated with recency judgements following impoverished encoding. Cereb. Cortex. 16: 469-474. Lazar M., Weinstein D.M., Tsuruda J.S., Hasan K.M., Arfanakis K., Meyerand M.E., Badie B., Rowley H.A., Haughton V., Field A. and Alexander A.L. (2003). White matter tractography using diffusion tensor deflection. Hum. Brain Mapp. 18, 306-321. Lazar, M. and Alexander, A.L. (2005). Bootstrap white matter tractography. (BOOT-TRAC) Neuroimage. 24, 524-532. Lehericy S., Ducros M., Krainik A., Francois C., Van de Moortele P.F., Ugurbil K. and Kim D.S. (2004). 3-D diffusion tensor axonal tracking shows distinct SMA and pre-SMA projections to the human striatum. Cereb. Cortex. 14, 1303-1309. Lee, A.C., Robbins, T.W., Graham, K.S., Owen, A.M. 2002. “Pray or Prey?” dissociation of semantic memory retrieval from episodic memory processes using positronemission tomography and a nocel homophone task. NeuroImage. 16: 724-735. Lepage, M., Ghaffar, O., Nyberg, L. and Tulving, E. (2000). Prefrontal cortex and episodic memory retrieval mode. Poc. Natl. Acad. Sci. U.S.A. 97, 506-511. Mesulam, M.M. 1999. Spatial attention and neglct: parietal, frontal and cingulated contributions to the mental representation and attentional targeting of salient extrapersonal events. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 354: 1325-1346. Mori, S., Crain, B.J., Chacko V.P. and van Zijl, P.C.M. (1999). Three-dimensional tracking of axonal projections in the brain by magnetic resonance imaging. Annal. Neurol. 45, 265269. Naghavi H.R. and Nyberg L. 2005. Common fronto-parietal activity in attention, memory, and consciousness: Shared demands on integration? Consci. Cogn. 14: 390-425. Owen, A.M., Evans, A.C. and Petrides, M. (1996). Evidence for a two-stage model of spatial working memory processing within the lateral frontal cortex: A positron emission tomography study. Cerebral Cortex. 6, 31-38. Petrides, M. (1994a). Frontal lobes and behaviour. Current Opinion in Neurobiology. 4, 207211. Petrides, M. (1994b). Frontal lobes and working memory: Evidence from investigations of the effects of cortical excisions in nonhuman primates. In Boller, F. and Grafman, J. eds. Handbook of neuropsychology. Vol. 9 (Amsterdam: Elsevier), pp. 59-82. Petrides, M. (1996). Specialized systems for the processing of mnemonic information within the primate frontal cortex. Phil. Trans. R. Soc. B., 351, 1455-1462. Petrides, M. (2005). Lateral prefrontal cortex: architectonic and functional organization. Phil. Trans. R. Soc. B., 360, 781-795. Petrides, M. and Pandya, D.N. (1994). Comparative architectonic analysis of the human and the macaque frontal cortex. In Boller, F. and Grafman, J. eds. Handbook of neuropsychology. Vol. 9 (Amsterdam: Elsevier), pp. 17-58. Petrides, M. and Pandya, D.N. (1999). Dorsolateral prefrontal cortex: comparative cytoarchitectonic analysis in the human and the macaque brain and corticocortical connection patterns. Eur. J. Neurosci. 11, 1011-1036. Petrides, M. and Pandya, D.N. (2002). Comparative cytoarchitectonic analysis of the human and the macaque ventrolateral prefrontal cortex and corticocortical connection patterns in the monkey. Eur. J. Neurosci. 16, 291-310.

Applications of Diffusion Tractography to the Study of Human Cognitive Functions

99

Powell H.W., Guye M., Parker G.J., Symms M.R., Boulby P., Koepp M.J., Barker G.J. and Duncan J.S. (2004). Noninvasive in vivo demonstration of the connections of the human parahippocampal gyrus. Neuroimage. 22, 740-747. Rajah, M.N., McIntosh, A.R. and Grady, C.L. (1999). Frontotemporal interactions in face encoding and recognition. Cogn. Brain Res. 8, 259-269. Rugg, M.D., Henson, R.N.A., Robb, W.G. 2003. Neural correlates of retrieval processing in the prefrontal cortex during recognition and exclusion tasks. Neuropsychologia. 41: 4052. Schacter, D.L. (1987). Memory, amnesia, and frontal lobe dysfunction. Psychophysiology. 17, 568-576. Schmahmann, J.D., Pandya, D.N., Wang, R., Dai, G., D’Arceuil, H.E., de Crespigny, A.J., and Wedeen, V.J. (2007). Association fibre pathways of the brain: parallel observations from diffusion spectrum imaging and autoradiography. Brain. 130, 630-53. Seltzer, B. and Pandya, D.N. (1980). Converging visual and somatic sensory cortical input to the intraparietal sulcus of the rhesus monkey. Brain Res. 192, 339-351. Seltzer, B. and Pandya, D.N. (1989). Frontal lobe connections of the superior temporal sulcus in the rhesus monkey. J. Comp. Neurol. 281, 97-113. Shannon, B.J., Buckner, R.L. 2004. Functional-anatomic correlations of memory retriecal that suggest nontraditional processing roles for multiple distinct regions within posterior parietal cortex. J. Neurosci. 24: 10084-10092. Shimamura, A.P. (1995). Memory and frontal lobe function. In Gazzaniga, M.S. ed. The cognitive neurosciences. (Cambridge, MA: MIT press), pp. 803-813. Snowden, J.S., Goulding, P.J., Neary, D. 1989. Semantic dementia: A form of circumscribed cerebral atrophy. Behav. Neurol. 2: 167-182. Snowden, J.S., Griffiths, H., Neary, D. 1994. Semantic dementia: Autobiographical contribution to preservation of meaning. Cogn. Neuropsycol. 11: 265-288. Squire, L. (1994). Declarative and nondeclarative memory: multiple brain systems supporting learning and memory. In: Mmoeyr systems. (Schacter, D.L., and Tulving, E. eds), pp. 203-232. Cambridge, MA: MIT Press. Squire, L.R. and Zola-Morgan, S. (1991). The medial temporal lobe memory system. Science. 253, 1380-1386. Stieltjes B., Kaufmann W.E., van Zijl P.C., Fredericksen K., Pearlson G.D., Solaiyappan M. and Mori S. (2001). Diffusion tensor imaging and axonal tracking in the human brainstem. Neuroimage. 14, 723-735. Sullivan, E.V. and Pfefferbaum, A. (2003). Diffusion tensor imaging in normal aging and neuropsychiatric disorders. Eur. J. Radiol. 45, 244-255. Takahashi, E. and Miyashita, Y. in Neuropsychology of Memory. (eds. Squire, L.R. and Schacter, D.L.) 301-310 (The Guilford Press, New York, 2002). Takahashi, E., Ohki, K., Kim, D-S. (2007a). Diffusion tensor studies dissociated two frontotemporal pathways in the human memory system. NeuroImage. 34: 827-838. Takahashi, E., Ohki, K., Kim, D-S. (2007b). Dissociated pathways for successful memroy retrieval from the human parietal cortex. Cereb. Cortex. December 28, 2007, doi:10.1093/cercor/bhm204 Thottakara, P., Lazar, M., Johnson, C. and Alexander, L. (2006) Application of Brodmann’s area templates for ROI selection in white matter tractography studies. Neuroimage. 29, 868-878.

100

Emi Takahashi

Tomita, H., Ohbayashi, M., Nakahara, K., Hasegawa, I. and Miyashita, Y. (1999). Top-down signal from prefrontal cortex in executive control of memory retrieval. Nature. 401, 699703. Toosy A.T. et al. 2004. Characterizing function-structure relationships in the human visual system with functional MRI and diffusion tensor imaging. NeuroImage. 21: 1452-1463. Tuch, D.S., Rees, T.G., Wiegell, M.R., Makris, N., Belliveau, J.W., and Wedeen, V.J. (2002). High angular resolution diffusion imaging reveals intravoxel white matter fiber heterogeneity. Magn. Reson Med. 4, 577-82. Tuch, D.S., Salat, D.H., Wisco, J.J., Zaleta, A.K., Hevelone, N.D., Rosas, H.D. (2005). Choice reaction time performance correlates with diffusion anisotropy in white matter pathways supporting visuospatial attention. Proc. Natl. Acad. Sci. U. S. A. 102, 12212-7. Tulving E., Kapur S., Craik F.I., Moscovitch M. and Houle S. (1994). Hemispheric encoding/retrieval asymmetry in episodic memory: positron emission tomography findings. Poc. Natl. Acad. Sci. U.S.A. 91, 2016-2020. Tulving, E (2002). Episodic memory: From mind to brain. Annu. Rev. Psycol. 53, 1-25. Upadhyay, J., Ducros, M., Knaus, T.A., Lindgren, K.A., Silver, A., Tager-Flusberg, H., Kim, D-S. (2007). Function and Connectivity in Human Primary Auditory Cortex: A Combined fMRI and DTI Study at 3 tesla. Cereb. Cortex. 17, 2420-32. Wagner A.D., Schacter D.L., Rotte M., Koutstaal W., Maril A., Dale A.M., Rosen B.R. and Buckner R.L. (1998). Building memories: remembering and forgetting of verbal experiences as predicted by brain activity. Science. 281, 1188-1191. Wagner, A.D., Shannon, B.J., Kahn, I., Buckner, R.L. (2005). Parietal lobe contributions to episodic memory retrieval. Trends in Cogn. Sci. 9: 445-453. Wedeen, V.J., Hagmann, P., Tseng, W.Y., Rees, T.G., and Weisskoff, R.M. (2005) Mapping complex tissue architecture with diffusion spectrum magnetic resonance imaging. Magn. Reson. Med. 6, 1377-86. Wheeler, M.E., Buckner, R.L. (2003). Functional dissociation among components of remembering: control, perceived oldness, and content. J. Neurosci. 23: 3869-3880. Wiggs, C.L., Weisberg, J., Martin, A. (1999). Neural correlates of semantic and episodic memory retrieval. Neuropsycologia. 37: 103-118. Xu D., Mori S., Solaiyappan M., van Zijl P.C. and Davatzikos C. (2002). A framework for callosal fiber distributon analysis. Neuroimage. 17, 1131-1143.

In: Brain Mapping and Diseases Ed: Diane E. Spinelle

ISBN: 978-1-61122-065-0 © 2011 Nova Science Publishers, Inc.

Chapter 6

EFFECTS OF COX-2 INHIBITORS ON BRAIN DISEASES Takako Takemiya1,2 and Kanato Yamagata1 1

Department of Neuropharmacology, Tokyo Metropolitan Institute for Neuroscience, Tokyo, Japan, 2 Department of Physiology, Tokyo Women’s Medical University, Tokyo, Japan

ABSTRACT Cyclooxygenase-2 (COX-2) expression is induced in the brain in various pathological conditions, such as fever, pain, and neurological disorders related to neuroinflammation. Therefore, it is important to elucidate the roles of COX-2 and the effects of COX-2 inhibitors in the central nervous system. Here, we review the modulatory roles of COX-2 and its product, prostaglandinE2 (PGE2), in fever and pain, and discuss the effects of COX-2 inhibitors. In addition, we will review the latest findings regarding the neuroprotective effects of COX-2 inhibitors on neuronal loss regarding neuroinflammation associated with brain diseases, including epilepsy, ischemia, amyotrophic lateral sclerosis, Parkinson’s disease, multiple sclerosis, and Alzheimer’s disease. We also discuss the roles of non-steroidal anti-inflammatory drugs (NSAIDs), such as COX inhibitors and peroxisome proliferator-activated receptorγ (PPAR-γ) agonists. Brain diseases have neuroinflammatory aspects involving the activation of microglia related to neuronal loss, and PPAR-γ agonists have been shown to inhibit the activation of microglia. Furthermore, we address two common points concerning various diseases. We discuss the clinical application of selective COX-2 inhibitors to neuronal death induced by epilepsy and ischemia. The short-term and sub-acute cure achieved using selective COX-2 inhibitors matching the elevation of PGE2 is expected for treatment after onset of neuronal excitatory diseases to prevent neuronal loss. We also discuss the responses in vascular endothelial cells related to fever and epilepsy. In the endothelial cells, mPGES-1 is colocalized with COX-2, suggesting that the two enzymes are functionally linked and that brain endothelial cells play an essential role in PGE2 production during fever and epilepsy.

102

Takako Takemiya and Kanato Yamagata Further analysis of COX-2 inhibitors may provide a better understanding of the process of neuropathological disorders, as well as facilitate the development of new treatment regimens.

INTRODUCTION Cyclooxygenase (COX) is a key enzyme in the biotransformation of arachidonic acid to prostaglandins (PGs). COX exhibits two catalytic activities: a bis-oxygenase activity (cyclooxygenase), which catalyzes PGG2 formation from arachidonic acid (AA), and a peroxidase activity, which converts PGG2 to PGH2. Specific synthases convert PGH2 to other PGs, such as PGE2, PGD2, or PGF2α. COXs are classified into two isoforms, COX-1 and COX-2, which show distinct expression patterns and distinct biological activities. COX-1 is expressed constitutively in various cell types, and is responsible for physiological production of PGs. In contrast, the inducible isoform, COX-2, is induced rapidly in several cell types in response to various stimuli, such as neuronal activity, cytokines, and pro-inflammatory molecules.

Figure 1. Relative selectivity of agents as inhibitors of human COX-1 and COX-2 displayed as the ratio of IC80 concentrations (reprinted with permission and seen in [4]).

Effects of COX-2 Inhibitors on Brain Diseases

103

The COX-2 gene is characterized by the presence of a TATA box and a multitude of binding sites for transcription factors in its promoter region, which account for the complex regulation of COX-2 expression. Its long 3’-untranslated region, which has been found in many immediate-early genes, acts as a determinant of mRNA instability or as a translation inhibitory element. These observations indicate post-transcriptional control of COX-2 expression. In contrast, the COX-1 gene represents a classical “housekeeping” gene, and lacks a TATA box in its promoter. The two isoforms of COX proteins show >60% homology in humans and rodents, although there is an insertion of 18 amino acids near the C-terminus of COX-2, which is not present in COX-1. COX-2, but not COX-1, is characterized by an accessible side pocket that is an extension to the hydrophobic channel. COX-1 appears only as a constitutively expressed isoform in various organs, while both COX-1 and COX-2 are expressed under physiological conditions in some organs, such as the brain, kidney, heart, liver, spleen, and small intestine [1]. COX-2 plays an important role not only in the periphery but also in the central nervous system. In the brain, COX-1 and COX-2 immunoreactivities are present in discrete neuronal populations distributed in distinct areas [2, 3]. PG biosynthesis is inhibited by nonsteroidal anti-inflammatory drugs (NSAIDs), which are widely used as anti-inflammatory agents and analgesics. The mechanism of action of NSAIDs includes inhibition of both the COX-1 and COX-2 isoenzymes, and the effect of each NSAID varies in relative selectivity of agent as inhibitor of COX-1 and COX-2 (figure 1) [4]. Moreover, unwanted side effects, particularly in the gastrointestinal tract, are due to the inhibition of COX-1. As COX-1 is the major COX isoform expressed in platelets and gastric mucosa under normal conditions, the inhibition of COX-1 activity in platelets leads to an increase in the risk of bleeding, and that in the gastric mucosa leads to erosion, ulceration, and perforation. Therefore, selective COX-2 inhibitors have been developed and shown to be efficacious in the treatment of inflammation and pain. Brain COX-2 expression is highly regulated by different factors, such as the occurrence of fever and pain responses, which are related to peripheral inflammation. Here, we discuss the relationship between brain COX-2 and fever or pain, and the effects of COX-2 inhibitors on these conditions. In addition, PGE2 is thought to be the COX-2 product involved in the genesis of fever and pain. Therefore, we discuss microsomal prostaglandin E synthase-1 (mPGES-1), which is a key terminal enzyme in the COX-2-mediated PGE2 biosynthetic pathway. Brain COX-2 is also associated with not only acute neurotoxicity but also proinflammatory activities, which are thought to exacerbate the neuronal damage in epilepsy, ischemia, and neurodegenerative disorders, such as amyotrophic lateral sclerosis (ALS), Parkinson’s disease (PD), multiple sclerosis (MS), and Alzheimer’s disease (AD). The functions of COX-2 in these diseases have been reviewed, particularly in “Prostaglandins: New Research” published by Nova Science Publishers, Inc. Here, we review the effects of COX-2 inhibitors on these neuronal diseases, based on the most recent studies, including our newest data (figure 2). In addition, we introduce the role of NSAIDs as COX inhibitors or peroxisome proliferator-activated receptor-γ (PPAR-γ) agonists on neurological disorders.

104

Takako Takemiya and Kanato Yamagata

Figure 2. Hypothetical schema of the targets of COX-2 inhibitors and NSAIDs in the brain.

Fever Fever is thought to be caused by endogenous pyrogenic cytokines, and exogenous pyrogens, such as lipopolysaccharide (LPS). LPS is known to act through mononuclear phagocytes in the circulation and peripheral tissues to trigger the production of pyrogenic cytokines, such as tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL6), and interferon-γ (IFN-γ) [5]. PGE2 is induced by these cytokines in the periphery and acts as a proximal mediator in the preoptic-anterior hypothalamic area (POA). It was unclear how peripheral pyrogenic signals reach the central nerve, although it has been suggested to access the brain via the circulation or neural routes [6,7]. In 1995, Matsumura et al. discovered that brain COX-2 mRNA expression was induced by intraperitoneal injection of LPS not only in neurons or glial cells, but also in nonparenchymal cells of the blood vessels and leptomeninges [8]. The authors had previously proposed a possible role of blood vessels and leptomeninges as a source of PGE2 in the genesis of fever. A pyrogenic dose of IL-1β injected intraperitoneally was shown to act on the type-1 interleukin-1 receptor and induce COX-2 mRNA expression in brain endothelial cells [9,10]. These observations suggest that pyrogenic cytokines produced by mononuclear phagocytes in the circulation or peripheral tissues may directly affect their receptors on brain endothelial cells and advance the production of PGE2 in the endothelium. In addition, LPS increases the PGE2 level in the entire brain via induction of COX-2, suggesting that fever may be mediated by PGE2 produced in the blood vessels near the POA or in other parts of the brain and transported to the POA through the ventricular system [11]. In a study to elucidate the causal link between LPS-induced fever and LPS-induced COX-2 mRNA, various degrees

Effects of COX-2 Inhibitors on Brain Diseases

105

of fever were shown to be closely correlated with the level of COX-2 mRNA in the blood vessels, and fever was suppressed by pretreatment with a selective COX-2 inhibitor [12], suggesting that COX-2 induced in the brain blood vessels/leptomeninges is involved in the molecular mechanism of LPS-induced fever. Moreover, COX-2 is also involved in fever induced by TNF- α. COX-2-like immunoreactive cells were colocalized with von Willebrand factor, which is a marker of endothelial cells, suggesting that the brain blood vessels are the major sites of PGE2 biosynthesis enhanced by TNF-α, similar to IL-1 β [13]. Furthermore, endothelial COX-2 is involved in the fever evoked by brain inflammation, which is induced by intracerebroventricular administration of LPS or pyrogenic cytokines [14,15]. The effects of COX-2 inhibition on fever were further investigated. Selective COX-2 inhibitors reverse the temperature elevation evoked by intravenous injection of LPS in monkeys, and naturally occurring fever in humans comparable to dual COX-1/COX-2 inhibitors [16]. To determine which component is critical in COX inhibition, highly selective inhibitors of COX-1 or COX-2 were tested. Selective COX-2 inhibitors not only blocked LPS-induced fever, but also prevented the expression of Fos, a marker for neuronal activity, in the areas of the hypothalamus critical for production of fever, including the ventromedial preoptic nucleus (VMPO) and hypothalamic paraventricular nucleus (PVH). In contrast, selective COX-1 inhibitors revealed hypothermia in the initial phase after LPS injection, but showed no effect on fever. Interestingly, the selective COX-1 inhibitor prevented Fos expression in the PVH as well as in the nucleus of the solitary tract (NTS), ventrolateral medulla (VLM), and parabrachial nucleus (PB), but not in the VMPO. These observations suggest that COX-2 plays the dominant role in mediating the fever response to LPS, and at least some components of the response, including avoiding hypothermia and induction of neuronal activity in NTS, VLM, PB, and PVH, may be dependent on COX-1. COX-2 knockout mice (COX-2(-/-)) show no rise in core temperature (Tc) after injection of LPS, whereas COX-1 knockout mice responded to LPS with an increase in Tc. Thus, it also appears that COX-2 is necessary for LPS-induced fever production. On the other hand, the effect of COX-2 inhibition is dependent on suppression of COX-2 products involved in induction of fever, mostly PGE2. PGE2 acts by interacting with four subtypes of PGE receptor: EP1, EP2, EP3, and EP4 receptors. In reports about EP receptors related to fever, only mice lacking the EP3 receptor failed to show a febrile response to PGE2 and to either IL-1β or LPS, indicating that PGE2 mediates fever generation in response to both exogenous and endogenous pyrogens by acting at EP3 receptors [17]. In addition, EP1 and EP3 agonists increase Tc, while EP2 receptor agonists have no effect on Tc. In contrast, EP4 receptor agonists decrease the Tc. These findings suggest that each EP receptor may have a different role in thermoregulatory responses [18]. It is generally accepted that PGE2 acts on POA [19], which triggers stimulation of the sympathetic system, resulting in the production of fever. POA shows a high level of expression of EP3 receptor especially within cell bodies and dendrites of POA neurons [20]. These observations suggest that EP3 receptors on POA neurons are targets of PGE2 to exert its febrile action. The action of PGE2 in the POA is thought to trigger the efferent mechanisms that control peripheral sympathetic effectors, including brown adipose tissue (BAT), which is known to be the major organ involved in thermogenesis during fever in rodents [21]. Moreover, Nakamura et al. demonstrated that microinjection of PGE2 into the medial POA induces pyrogenic signals that are transmitted directly toward the raphe pallidus nucleus[22],

106

Takako Takemiya and Kanato Yamagata

a brainstem structure known to contain premotor neurons controlling sympathetic drive of BAT functions [23]. As the EP3 receptor has been shown to be coupled to a Gi protein, which inhibits adenylate cyclase activity and reduces cAMP levels [24], reductions in cAMP levels may be responsible for the genesis of fever. Intra-POA administration of cAMP agonist reduces Tc, and cGMP augments the drop in Tc evoked by cAMP. In addition, reduction of cAMP and cGMP production induces a fever-like response. These observations support the suggestion that decreases in the levels of cAMP and cGMP in the POA are associated with the genesis of fever [25]. In response to the endogenous pyrogen, PGE2, the majority of temperature-insensitive neurons in the VMPO show an increase in firing rate, while warm-sensitive neurons are inhibited. These neurons in the VMPO may play critical and contrasting roles in the production of fever [26]. In a study investigating the role of the major noradrenergic nucleus, the locus ceruleus (LC), in LPS-induced fever, LC neurons are part of a neuronal network that is activated specifically by PGE2 to increase thermogenesis and produce fever [27]. Finally, we will shift the emphasis to PGE2-synthesizing enzymes in brain endothelial cells as the major source of PGE2. We cloned the rat glutathione-dependent mPGES-1, and examined its induction in the rat brain after intraperitoneal injection of LPS [28]. Northern blot analysis showed mPGES-1 mRNA to be expressed weakly in the brain under normal conditions but to be induced markedly between 2 and 4 hours after LPS injection. In situ hybridization analysis revealed that LPS-induced mPGES-1 mRNA signals were mainly associated with brain blood vessels, especially veins or venular-type vessels, throughout the whole brain. Immunohistochemical analysis demonstrated that mPGES-1-like immunoreactivity was expressed in endothelial cells in the perinuclear region of the brain. Furthermore, in the endothelial cells, mPGES-1 was colocalized with COX-2, suggesting that the two enzymes are functionally linked and that this link is essential for fever. These results demonstrate that brain endothelial cells play an essential role in PGE2 production during fever by expressing COX-2 and mPGES-1. mPGES-1 is also produced by IL-1β in the endothelium. In addition, intraperitoneal injection of LPS induces COX-2 and mPGES-1 only in brain endothelial cells, but not in those of peripheral organs, including the neck, heart, lung, liver, and kidney [29]. These results demonstrate the significance of brain endothelial cells in PGE2 production during fever. mPGES-1 knockout mice (mPGES-1(-/-)) showed no increase in PGE2 or body temperature after injection of LPS, indicating that mPGES-1 is a key enzyme in the production of PGE2, which induces fever [30]. A recent study demonstrated a role of another PG, 15-depxy-△12, 14-prostaglandin J2 (15d-PGJ2). 15d-PGJ2, an endogenous ligand for PPARγ, can attenuate the febrile response to LPS. PPARγ is expressed in the hypothalamus, a brain locus crucial for fever generation. 15dPGJ2 and the enzyme responsible for its synthesis, PGD2 synthase, are present in rat cerebrospinal fluid, and their levels are enhanced in response to systemic injection of LPS [31]. All of these studies demonstrated the importance of PGE2 in the production of fever.

Effects of COX-2 Inhibitors on Brain Diseases

107

Pain The COX product, PGE2, is a common pain modulatory factor. Although PGE2 itself does not cause pain when applied to the human forearm, PGE2 greatly potentiates the pain induced by pain-producing mediators, such as bradykinin or histamine. Behavioral models indicate that persistent small afferent input, as generated by tissue injury, results in hyperalgesia at the site of injury and tactile allodynia in areas adjacent to the injury site. Hyperalgesia reflects sensitization of the peripheral terminal and central facilitation evoked by the persistent small afferent input. The allodynia reflects central sensitization. Pain is a complex state characterized by peripheral and central mechanisms. COX inhibitors have been used as analgesics and anti-inflammatory agents. When we can show the COX-2 induction and PGE2 production in pain pathways, we will be able to understand the effects of COX-inhibitors on pain. First, we discuss the modulatory role of PGE2 in pain responses in the spinal cord. Intrathecal administration of PGE2 to conscious mice induced allodynia, a state of discomfort and pain evoked by innocuous tactile stimuli, and hyperalgesia as assessed by the hotplate test [32]. After tissue injury, excitatory transmitters (e.g., glutamate and substance P) acting though N-methyl-D-aspartate (NMDA) and neurokinin 1 receptors initiate a cascade that evokes release of nitric oxide (NO) or PGE2 in the spinal cord, respectively. COX-2 and NO synthase inhibitors act to diminish only hyperalgesia. Spinal PGs may facilitate release of spinal amino acids and peptides, and enhance hyperalgesia [33]. It is generally believed that primary afferent C-fibers become hypersensitive and induce hyperalgesia, and that lowthreshold Aβ -fibers are responsible for induction of allodynia. However, selective elimination of C-fibers by neonatal capsaicin treatment results in the disappearance of allodynia induced by PGE2. These observations suggest that capsaicin-sensitive C-fibers may participate in PGE2-induced allodynia [34]. Second, we introduce studies of the hypothalamic mechanisms of pain modulatory action of cytokines and PGE2. Proinflammatory cytokines, such as IL-1β, IL-6, and TNF-α, are known to enhance nociception at the sites of peripheral inflammation. Systemic administration of LPS or IL-1β, an experimental model of acute infection, may mimic the biphasic changes in nociception, hyperalgesia at small doses of LPS and IL-1β, and analgesia at larger doses. Behavioral and electrophysiological studies revealed that IL-1β in the brain induces hyperalgesia through the actions of PGE2 on EP3 receptors in POA and the neighboring basal forebrain, whereas the IL-1β-induced analgesia is produced by the actions of PGE2 on EP1 receptors in the ventromedial hypothalamus (VMH) [35-38]. An intravenous injection of LPS produces hyperalgesia, which is abolished by microinjection of selective COX-2 inhibitor or inhibitors of both COX-1 and COX-2 into the POA and the horizontal limb of the diagonal band of Broca (DBB), but not into the other areas in the hypothalamus [39]. These findings suggest that LPS-induced hyperalgesia is mediated predominantly through COX-2 induced PGs in POA and DBB. In addition, PGE2 in the midbrain periaqueductal gray area also produces hyperalgesia [40], and PGE2 activates pain-modulating circuitry in the rostral ventromedial medulla (RVM) [40,41]. Furthermore, IL-1β induces COX-2 expression in the central nervous system, and COX-2 may regulate central PGE2 production [42]. Thus, COX-2 inhibitor decreases inflammation-induced central PGE2 levels and mechanical hyperalgesia [42]. These observations suggest that prevention of

108

Takako Takemiya and Kanato Yamagata

central PGE2 production by inhibiting induction of COX-2 or inhibiting central COX-2 activity reduces centrally generated inflammatory pain hypersensitivity. During inflammation in a carrageenan-induced inflammation model, endothelial cells are the major source of PGs in the CNS, and this endothelial expression of COX-2 is involved in the inflammation-induced hyperalgesia [43]. In a recent study, mPGES-1(-/-) mice were shown to display a marked reduction in inflammatory responses in comparison with wild-type controls [44]. These observations demonstrated that mPGES-1 is responsible for the production of PGE2 that mediates pain during an inflammatory response, and provides a target for the treatment of inflammatory disease and pain. In a neuropathic pain model prepared by L5 spinal nerve transaction, mPGES-1-deficient mice did not exhibit mechanical allodynia or thermal hyperalgesia [45]. These observations demonstrated that PGE2 produced by mPGES1 is involved in neuropathic pain. Thus, selective mPGES-1 inhibitors are expected to become useful for the treatment of pain.

Epilepsy Epilepsy is the most common primary disease of the brain, and consists of a complex of disorders characterized by a tendency for the development of hyperexcitability in one or more regions of the central nervous system (CNS). Epilepsy has traditionally been classified into syndromes based on clinical presentations and electroencephalogram (EEG) findings, whereas there are likely to be multiple underlying cellular and molecular mechanisms responsible for various epileptiform phenomena. Here, we review the effects of COX-2 inhibitors on hyperexcitability and neurodegeneration, which result in serious neuronal loss and probably initiate or contribute to the generation of most temporal lobe seizures. Many studies have demonstrated the elevation of PGs until a few hours after seizure, although little is known about their roles in the induction of seizures. We first demonstrated that brain COX-2 was markedly induced in neurons by seizure in 1993, and COX-2 has become an interesting target in subsequent studies [46]. Particularly, COX-2 was shown to be induced in neurons in the hippocampus, cerebral cortex, or amygdala, suggesting its importance in epilepsy [46-51]. COX-2 induction showed a diphasic increase, peaking at 2 and 24 hours after seizure [52-55]. These observations suggest that COX-2 is induced in the early and more delayed phases after the occurrence of a seizure. Hyperexcitability immediately after seizure, and neurodegeneration that begins late, are the most serious problems in epilepsy. Taken together with these findings, COX-2 and its products may have critical functions in both early and delayed phases after seizure. Therefore, we investigated the effects of COX-2 inhibition on the hyperexcitotoxicity induced after seizure. In the rapid kindling of the perforant path, COX-2 mRNA was markedly induced in granular neurons of the hippocampal dentate gyrus and pyramidal neurons of the CA3 region, and brain PGE2 production was also increased in wild-type mice. We found that COX-2(-/-) mice or mice treated with selective COX-2 inhibitor showed decreased incidence of hippocampal seizures on EEG and lowered PGE2 levels [56]. These results suggest that COX-2 inhibition decreases the recurrence of hippocampal seizures. Moreover, the COX inhibitor, indomethacin, suppressed COX-2 function and the elevation of brain PGE2 content, and prevented electrocorticographic seizures induced by lithium chloride

Effects of COX-2 Inhibitors on Brain Diseases

109

[57]. These reports indicated that inducible COX-2 stimulates neuronal excitability immediately after seizure via PGE2 production. Meanwhile, endotoxin LPS, which induces the production of PGE2, decreases the seizure threshold, and COX inhibitors reverse the proconvulsant effect of LPS [58]. These findings suggest that PGE2 induced by LPS acts as a proconvulsant mediator. Thus, neuronal COX-2 induced by seizure may accelerate the hyperexcitotoxicity immediately after seizure, mediating PGE2 production, and COX-2 inhibition blocks a change for the worse in seizure hyperexcitotoxicity. We next investigated the neurodegenerative changes after seizure using an analogue of the excitatory amino acid KA, because administration of KA induces not only a characteristic behavioral seizure but also a reproducible pattern of neurodegeneration in several brain areas, closely resembling human temporal lobe epilepsy. We found that the concentration of PGE2 showed a delayed continuous elevation, peaking at 24 hours, and observed that a selective COX-2 inhibitor completely blocked the elevation of PGE2 and significantly decreased neuron loss. Similarly, the PGE2 elevation observed in wild-type mice was completely blocked in COX-2(-/-), and neuronal loss was also attenuated significantly in COX-2(-/-) compared with wild-type controls (unpublished). Other studies also showed a protective effect of COX-2 inhibitors against hippocampal neuron death induced by KA [59,60], NMDA [61], or LPS [62] in vivo. In addition, selective COX-2 inhibitor or COX-1/COX-2 nonselective inhibitors blocked NMDA-stimulated PG production and attenuated neuronal death in primary cortical cultures [63]. COX-2 overexpression accelerated glutamate-mediated apoptotic damage, and selective COX-2 inhibitor significantly attenuated this effect [64]. These findings demonstrated that neuronal death is mediated by PGE2 production derived from COX-2, and COX-2 inhibitors block the elevation of PGE2 and neuronal cell death after seizure. We finally addressed whether mPGES-1 had an impact on the neuronal death after seizure using mPGES-1(-/-) mice [65]. Our observations indicated that mPGES-1(-/-) mice were resistant to neuronal damage after seizure, and the elevation of PGE2 observed in wildtype controls was significantly attenuated in mPGES-1(-/-) mice (unpublished). These results suggest that mPGES-1 in endothelial cells is the key enzyme for production of PGE2, which stimulates neuronal cell death. In addition, COX-2 was detected in endothelial cells or perivascular microglia in an animal model of neurodegeneration using quisqualic acid [66], indicating that COX-2 may couple with mPGES-1 in endothelial cells. Although it is widely thought that PGE2 may be synthesized and derived from astrocytes [67-71], microglia [72], or neurons [73], we found that most brain PGE2, which affects neuronal death, is supplied by vascular endothelial cells mediated via mPGES-1. mPGES-1 selective inhibitors are expected to become useful for treatment of excitotoxic disorders, such as epileptic seizure, ischemia, and brain injury.

Ischemia Ischemic stroke is characterized by a transient or permanent disruption of cerebral blood flow (CBF) that is limited to the area of the major brain arteries. The reduction of flow is caused by occlusion of the cerebral artery by either an embolus or by local thrombosis. Brain injury following focal cerebral ischemia includes some pathophysiological events that occur

110

Takako Takemiya and Kanato Yamagata

after an ischemic accident. The major pathogenic mechanisms are excitotoxicity and periinfarct depolarization, inflammation, and programmed cell death (apoptosis). Post-ischemic inflammation is a dynamic process involving a complicated set of interactions among various inflammatory cells and molecules. The inflammatory brain cells, the microglia, are especially activated in response to ischemic insults, many of which are regulated by NF-κB. There is an intimate relationship between NF-κB and microglial activation in the brain inflammatory mechanisms. COX-2 and inducible nitric oxide synthase (iNOS) gene transcription are activated following induction of nuclear factor-κB (NF-κB). Several studies have provided evidence that expression of iNOS and COX-2 have critical effects on the progression of cerebral ischemic damage. In models of inflammation, COX-2 is up-regulated and contributes to tissue damage through the production of reactive oxygen species and toxic prostanoids. The catalytic activity of COX-2 is associated with production of reactive oxygen species, and superoxide produced by COX-2 activity may react with NO to form the powerful oxidant, peroxynitrite [74], suggesting that COX-2 participates in the mechanisms of cerebral ischemia. COX-2 expression is up-regulated 12–24 hours after cerebral ischemia in rodents [75-77]. In addition, intermittent hypoxia induces COX-2 expression, but not COX-1 expression, and COX-2 up-regulation is associated with increased PGE2 level and neuronal apoptosis [78]. In patients who died 1–2 days after suffering an ischemic stroke, COX-2 protein was detected in neurons, endothelial cells, and neutrophils in the ischemic lesion [75]. Moreover, the upregulation of COX-2 immunoreactivity was confined to the area of damage [79]. A recent study showed that the time course of COX-2 expression in the peri-infarct area is different from that in the focal ischemic core, and suggested that COX-2 expressed in the peri-infarct area plays an important role in the progression of ischemia [80]. PGE2 is also increased after ischemia [80,81]. Candelario-Jalil et al. [79] reported a biphasic and significant increase in PGE2 level after 2 and 24–48 hours of reperfusion, and the late increase in PGE2 was reduced more potently by the selective COX-2 inhibitor, rofecoxib, than a COX-1 inhibitor [81]. In addition, inhibition of COX-2 conferred significant protection against neuronal damage, indicating that PGE2 produced by COX-2 may be a stimulator of neuronal damage. This was supported by a study in which PGE2 exacerbated the neuronal damage induced by global hemispheric hypoxic-ischemia [82]. Moreover, a selective COX-2 inhibitor increased the survival of hippocampal neurons after ischemic injury by reducing PGE2 concentration [83]. COX-2-deficient mice also showed a significant reduction in brain injury produced by occlusion of the middle cerebral artery [84]. A recent study investigated the effects of the selective COX-2 inhibitor, nimesulide, in different doses or at different start times of administration [85]. The results showed that nimesulide dose-dependently reduced infarct volume and functional recovery, and significantly reduced infarct volume when treatment was started in 12 hours after onset of ischemia. However, it was more effective when treatment was started within several hours after onset. Furthermore, a COX-1 inhibitor also showed a neuroprotective effect [81], and the NSAID, meclofenamate, reduced the PGE2 concentration in the early phase after ischemia [86]. In a subpopulation of AD, one mechanism by which NSAIDs cause neuronal damage is the suppression of COX activity, but it is possible that NSAIDs act as agonists for PPAR-γ. PPAR-γ agonists inhibit microglial activation, which suppresses inflammatory responses elicited after ischemia. However, NSAIDs have been reported to be of no clinical therapeutic

Effects of COX-2 Inhibitors on Brain Diseases

111

value in stroke treatment [87], and COX-1 knockout mice showed no difference in infarct size compared to wild-type controls in a middle cerebral artery occlusion model [88]. One potential problem with the global inhibition of COX is that COX-1 is responsible for the production of PGI2, which is both antithrombotic and vasodilatory [89]. Both of these properties are desirable after an occlusive stroke, and a decrease in PGI2 level leads to an increased response to pro-thrombotic stimuli, thus increasing the risk of clot formation. This was supported by another report that increasing the levels of both COX-1 and PGI2 synthase reduced cerebral infarct volume without increasing production of other PGs [90]. Thus, the role of COX-1 in ischemia is still controversial. To develop a new therapeutic regimen for ischemia, it is necessary to have a better understanding of the involvement of COX in ischemia.

Amyotrophic Lateral Sclerosis Amyotrophic lateral sclerosis (ALS) is a progressive motor neuron disorder characterized mainly by painless progressive muscle wasting and weakness in bulbar and extremity muscles. The disease usually shows focal onset in adults and seems to progress randomly. The pathology of ALS has not been determined because it involves many different cell types. Its occurrence is mostly sporadic, but familial ALS (FALS) accounts for about 5–15% of cases. There are a number of common theories regarding the mechanism of idiopathic ALS, including excitotoxic damage, oxidative damage, altered neurofilament function, and abnormalities in protein folding. Recently, the spinal cord in ALS was shown to be characterized by neuroinflammation consistent with other neurodegenerative diseases, such as AD [91]. COX-2 is up-regulated in the postmortem spinal cords of sporadic ALS patients [92]. In addition, COX-2 protein is found in motor neurons, interneurons, and glial cells, including astrocytes and microglia. In contrast, COX-1 protein is confined predominantly to microglia [93]. COX-2 expression in activated microglia in ALS pathology is similar to that in AD, suggesting that neuroinflammation promotes the progression of ALS, as in AD. The expression of neuronal COX-2 in the frontal cortex was shown to be up-regulated in ALS patients with dementia, but not in those without dementia, suggesting a relationship between expression of COX-2 in frontal cortex neurons and dementia [80]. Mice transgenic for human superoxide dismutase 1 (mSOD1) also show increased expression of COX-2 in neurons of the anterior horn of the spinal cord in both early symptomatic and end-stage disease, and to a lesser extent in astrocytes [94]. In addition, the spinal cords of ALS mice treated with a selective COX-2 inhibitor, showed significant preservation of spinal neurons, without astrogliosis or microglial activation [95], indicating that COX-2 does not cause microglial activation and astrogliosis, whereas may have other role in microglia and astrocyte. An inflammatory process has been suggested to play an important role in the pathogenesis of ALS in association with reactive microglia and astrocytes, and thus it is necessary to investigate the mechanism of COX-2 induction and its role in reactive glia. Several lines of evidence suggest some effects of COX-2 inhibitors using the G93A SOD1 mouse model of ALS. The COX-2 inhibitor, nimesulide, showed significant delay in the onset of motor impairment and reduced COX-2-mediated induction of PGE2 in

112

Takako Takemiya and Kanato Yamagata

the cervical spinal cord [96]. Other COX-2 inhibitors, celecoxib or rofecoxib, significantly improved motor performance, attenuated weight loss and extended survival [97]. In addition, celecoxib or rofecoxib also significantly reduced PGE2 levels. In a study using an organotypic spinal cord culture model of ALS, the COX-2 inhibitor, SC236, conferred significant protection against loss of spinal motor neurons, suggesting that it may be useful in treatment of ALS [98]. However, when the COX-2 inhibitor, rofecoxib, was not administered at sufficient levels, no protective effect was observed on the neurons [99], suggesting the importance of complete inhibition of COX-2 activity.

Parkinson’s Disease Parkinson’s disease (PD) is a common neurodegenerative disorder, in which patients typically present resting tremor, slowness of movement, rigidity, and postural instability associated with marked loss of dopamine-containing neurons in the substantia nigra pars compacta (SNpc). The most effective treatment for PD remains administration of a precursor of dopamine, L-dopa, for supplementation of dopamine to the brain, although L-dopa often causes motor and psychiatric side effects. Therefore, new treatments for PD are required. With severe loss of dopamine neurons, the SNpc is also the site of glial reaction in PD and experimental models of PD. Gliosis is a prominent neuropathological feature of many neurological diseases of the brain, and is considered to occur as a consequence of neuron loss over long periods. Recently, glia have been shown to play a role in pathological conditions that contribute to neuron death. The density of microglia is markedly higher in the SNpc in comparison to other brain areas, and neurons in SNpc are much more susceptible to activated microglia-mediated injury [100]. In PD patients, large numbers of HLA-DR-positive microglia exist along with Lewy bodies and free melanin in the SN [101]. Thus, gliosis may play a critical role in PD. In fact, the loss of dopaminergic neurons in the post-mortem PD brain is associated with glial reaction [102,103]. Animal models treated with 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) show marked microglial reaction in the SNpc the magnitude of which seems to parallel that of dopaminergic neuron loss [104-108]. In addition, blockade of 1-methyl-4phenylperydinium (MPP+, the active metabolite of MPTP) uptake into dopaminergic neurons was shown to completely prevent SNpc dopaminergic neuronal death [109]. Following microglial activation, NF-κB is activated and inflammatory cytokines are induced [110]. Then, transcription of iNOS and COX-2 genes is facilitated, resulting in the production of NO and PGs, respectively [111]. As the COX-2 promoter shares many features with the iNOS promoter [112], these two enzymes are often co-expressed under pathological conditions with gliosis. COX-2 is expressed in SNpc microglial cells in the post-mortem PD brain [111]. Therefore, the concentration of PGE2 is elevated in SNpc from PD patients [113]. These reports indicate the possibility that the inhibition of inflammatory changes or microglial activation may block the progressive disorder in dopaminergic neurons. The NSAIDs, sodium salicylate and aspirin, decrease striatal dopamine levels and completely prevent the neurotoxic effects in the MPTP mouse model of PD [114-117]. However, dexamethasone or other non-selective NSAIDs, such as paracetamol, diclofenac, ibuprofen, and indomethacin, were ineffective [114]. As NSAIDs have an effect as PPAR-γ

Effects of COX-2 Inhibitors on Brain Diseases

113

agonists, the neuroprotective effect of NSAIDs may be as a PPAR-γ agonist. However, attenuation of the MPTP-induced microglial activation and inhibition of the dopaminergic cell loss by the PPAR-γ agonist, pioglitazone, were limited in the SNpc, but not in the striatum [118]. These observations suggest that pioglitazone may affect the SNpc via some other direct mechanism. Furthermore, PGH synthase is prominent in the brain and possesses cyclooxygenase and peroxidase activities. The peroxidase activity cooxidizes dopamine to reactive dopamine quinines [119]. Aspirin and indomethacin inhibit the oxidation of dopamine [113]. These findings suggest that dopamine quinines may be involved in the development of PD. On the other hand, inhibition of COX-2 has been shown to attenuate MPTP toxicity in mice [117,120-122]. In COX-2-deficient mice, the lesion caused by MPTP is reduced and dopaminergic neurons in the substantia nigra are also protected [122]. In addition, COX-2 has been identified as a molecular target of c-Jun N-terminal kinase (JNK) activation. Thus, COX-2 inhibition in microglia will provide a new strategy to treat PD.

Multiple Sclerosis Multiple sclerosis (MS) is an inflammatory demyelinating disease of the CNS that results in motor and sensory deficits. Experimental autoimmune encephalomyelitis (EAE) is an inflammatory, demyelinating disease that can be induced by immunizing animals against myelin antigens, i.e., myelin basic protein (MBP), proteolipid protein (PLP), or myelin oligodendrocyte glycoprotein, all of which are constituents of CNS myelin, or passive transfer of CD4+ encephalitogenic T cells. EAE has been widely used as an animal model of MS due to its similarities in both histopathology and clinical course. EAE and MS are characterized clinically by neurological deficits and paralysis, and pathologically by perivascular lymphocytic and monocytic inflammation, demyelination, edema, increased vascular permeability, and limited remyelination within the CNS. The inflammatory mediator, PGE2, is released from peripheral leukocytes or monocytes in MS patients [123-125]. In addition, PGE2 level is increased in CNS tissues of EAEaffected rodents and EAE is prevented by inhibition of COX activity [126]. Moreover, conditioned medium (CM) of activated EAE-inducer cells accelerates PGE2 production in the murine macrophage cell line, RAW264.7, and COX-2 induction may be inhibited by an antibody to the T cell cytokine, IFN-γ [126]. These observations suggest that encephalitogenic lymphoid cells are capable of inducing the expression of COX-2 in macrophages. In a study of the mechanism underlying PLP139-151 peptide-induced EAE, COX-2 was shown to be expressed only in the acute phase in the spinal cord, mainly in CD11b+ cells, whereas COX-2 expression was reduced after the acute phase [127]. These observations demonstrated that brain COX-2 expression during the course of EAE may be associated with the presence of leukocyte infiltrate in the acute phase. Selective COX-2 inhibitors are expected to be used in future clinical trials to treat the acute phase of MS. On the other hand, PPAR-γ is detected in macrophages, T cells, and endothelial cells [128-131], and PPAR-γ agonist suppresses the activities of these cells. The PPAR-γ agonist,

114

Takako Takemiya and Kanato Yamagata

15d-PGJ2, also suppresses IFN-γ, IL-10, and IL-4 production by activated lymphocytes, and further inhibits the proliferation of T cells from MBP transgenic mice that develop EAE spontaneously [132]. In addition, administration of 15d-PGJ2 significantly reduces the severity of MS or EAE [132]. 15d-PGJ2 can reduce the severity of both active and passive EAE [133], and acts cooperatively to inhibit the development of EAE [134]. Moreover, a clinical study supported the suggestion that PPAR-γ agonists may be effective for treatment of MS [135]. These results imply that some PGs, such as 15d-PGJ2 or PGA2, have anti-inflammatory roles. However, other PGs, such as PGE2, may be pro-inflammatory mediators in MS. COX inhibitors block all PGs, including PGE2 and 15d-PGJ2, and it might be difficult to use for MS. In future, it will be necessary to choose a selective PG agonist or a selective PG synthase inhibitor for the treatment of MS.

Alzheimer’s Disease Alzheimer’s disease (AD) is the most common neurodegenerative disease, and the majority of patients with dementia suffer from AD. This disease is characterized pathologically by neurofibrillary tangles (NFTs) and senile plaques. NFTs are comprised of a hyperphosphorylated form of the axonal protein, tau, whereas the major constituent of senile plaques is beta-amyloid protein (Aβ), which is derived from the neuronally produced amyloid precursor protein (APP). In addition, neuronal cell death is most closely correlated to AD. Despite extensive molecular characterization of intracellular NFTs and extracellular amyloid plaques, the pathological relationship between these lesions—NFTs, amyloid plaques, and neuronal cell death—are not well understood. One widely accepted hypothesis is that the accumulation of Aβ is the true cause of AD, with NFTs and dystrophic neuritis developing as a consequence of Aβ accumulation. The neuroinflammatory response in AD has attracted a great deal of attention as the antiinflammatory drugs, NSAIDs, have been used for treatment of AD and have been shown to decrease the risk of developing AD [136-138]. AD patients treated for 6 months with indomethacin showed slight improvements in cognitive function test scores, whereas patients administered placebo showed a decline in cognition [139], and AD patients taking NSAIDs performed better on cognitive tests than those not taking NSAIDs [140]. In addition, other reports showed a decrease of relative risk for AD with increasing duration of NSAID use [138,141-146]. The efficacy of NSAIDs in AD suggests a relationship between inflammation and the pathology of this disease. McGeer et al. suggested that there is an inflammatory response in AD. Several components of neuroinflammatory reaction are activated in the brain [101,147]. Activation of glial cells, and especially of microglia, is observed consistently in AD pathology [148,149], and the activated astrocytes or microglia are localized around amyloid plaques. This is because Aβ peptides, the major constituents of plaques, facilitate microglial activation and induce the complement cascade [150-152]. Following microglial activation, NF-κB is activated and inflammatory cytokines, such as IL-1β, IL-6, IFN-γ, and TNF-α, are induced.

Effects of COX-2 Inhibitors on Brain Diseases

115

There have been many reports that NSAIDs inhibit microglial activation. Indomethacin inhibits IL-1 and NO production from microglia, and Aβ-stimulated gelatinase activity in microglia [153,154]. In addition, indomethacin inhibits Aβ-protein-induced microglial infiltration [155,156], and ibuprofen blocked Aβ production induced by TNF-α and IFNγ [157]. Moreover, activation of NF-kB by amyloid-derived peptides was shown to be markedly inhibited by acetaminophen [158]. NO-flurbiprofen (NFP), a novel NSAID, was reported to attenuate microglial activation, and reduce the inflammation-induced memory disorder [159]. NFP also markedly reduces Aβ load [160]. Thus, NSAIDs are associated with reduced microglial activation, whereas they do not affect senile plaque formation. Taken together, these findings indicate that NSAIDs may be able to delay the progression of AD, including microglial infiltration or amyloid deposition. In addition, aspirin was shown to prevent Aβ aggregation, and NSAIDs conferred protection against the toxic effects of Aβ [161, 162]. COX-2 mRNA and protein levels in the post-mortem brains of AD patients are higher than those in normal controls [1,54,163-166]. COX-2 is observed not only in neurons but also in astrocytes and in the cerebrovasculature [167] or microglial cells, which are co-localized with Aβ plaques [168]. These observations suggest that COX-2 in various cells in the brain may be related to the neuropathological alterations in AD. Ho et al. suggested that neuronal COX-2 may be an indicator of the progression of dementia in early AD [169], whereas neuronal COX-2 expression is down-regulated in end-stage AD [167].In addition, transgenic mice overexpressing COX-2 develop an age-dependent deficit in spatial memory at 12 to 20 months [170]. In AD pathology, Aβ42 peptide up-regulates COX-2 expression in human neural cells in primary culture. COX-2 gene transcription is also up-regulated by IL-1, which is correlates with microglial activation in human neural cells or neuroblastoma cells [168,171]. In contrast, brain COX-2 influences APP processing and promotes amyloidosis in the brain [172]. Moreover, COX-2 promotes amyloid plaque deposition, and accelerates Aβmediated apoptotic damage in a transgenic mouse model of AD [172,173]. These observations indicate that COX-2 stimulates the development of AD. A selective COX-2 inhibitor was shown to attenuate Aβ-induced cell death and PGE2 production [174]. In rat brain slices, freshly solubilized Aβ1-40 also produces PGE2, and this effect is prevented by a selective COX-2 inhibitor [175]. These results indicate that induction of COX-2 may be up-regulated by Aβ or microglial activation, and PGE2 produced by inducible COX-2 may be correlated with the pathology of AD. Two clinical studies were designed to investigate whether the selective COX-2 inhibitors, rofecoxib and naproxen, could slow cognitive decline in patients with AD [51,176]. However, there were no significant differences between the inhibitor-treated group and the placebo control group. The results of these studies indicated that rofecoxib or naproxen do not slow cognitive decline in AD. However, AD includes a number of stages from very mild to moderate, and the results were not discussed separately for each stage. As Ho et al. suggested that neuronal COX-2 may be an indicator of the progression of dementia in early AD, selective COX-2 inhibitors may be effective in very mild AD. In addition, PGE2 stimulates expression of APP in rat astrocytes [177]. Shie et al. showed that mice lacking one specific receptor for PGE2, EP2 (EP2(-/-)), were protected against Aβinduced neuronal damage, and EP2(-/-) microglia showed enhanced phagocytosis of Aβ peptides [178]. These observations indicated that PGE2 inhibits the phagocytosis of Aβ

116

Takako Takemiya and Kanato Yamagata

peptides, leading to an increase in Aβ peptide level. PG potentiates γ-secretase activity, which promotes the generation of Aβ peptide [179]. Moreover, Aβ was reported to be involved in vasoconstriction [175,180-182]. Future studies may yield a selective inhibitor of PGE2 synthase for use in the treatment of AD. Another COX isoform, COX-1, exists at very low levels in the normal brain [46], but both COX-1 and COX-2 mRNA seem to be elevated in the frontal cortex in AD, suggesting that COX-1 may also act as a prostaglandin synthase in AD [1,54]. Especially, there is an increase in COX-1 immunoreactivity in microglial cells in the AD cortex and COX-1immunoreactive microglia are associated with amyloid plaques [150,168,183]. Therefore, one mechanism by which NSAIDs affect AD may be through inhibition of COX-1 activity. Furthermore, it is possible that NSAIDs act as agonists for PPAR-γ, which inhibits microglial activation [184,185,186], or reduces amyloidogenic Aβ42 levels independently of COX activity [187]. These findings may be linked to the observation that activated microglia, localized around amyloid plaques, are important for activation of NF-κB or cytokines. Inhibition of microglial activity involves blocking the inflammatory response in AD [156,187]. PPAR-γ agonists inhibit the activity of NF-κB and attenuate induction of COX and iNOS [188,189]. In the process of inflammation, COX-2 stimulates PGD2 production, which affects PPAR-γ and inactivates NF-κB. Then, induction of COX-2 mRNA is regulated by a negative feedback loop mediated through PPAR-γ [190]. Thus, PPAR-γ agonist NSAIDs may prevent the neurotoxicity induced by the COX product, PG, and iNOS product, NO. In addition, 15d-PGJ2, which also acts as an endogenous ligand for PPAR-γ, may suppress microglial activity [191]. Furthermore, 15d-PGJ2 was shown to inhibit IκB kinase, which is responsible for the activation of NF-κB [192]. PPAR-γ levels are increased in the temporal cortex of the AD brain, suggesting that PPAR-γ has effects in AD [54]. Future studies of selective COX-2 inhibitors or PPAR-γ agonists are expected to yield methods capable of suppressing the inflammatory response in AD patients.

Clinical Application of Selective COX-2 Inhibitors to Brain Diseases Next, we discuss the clinical application of selective COX-2 inhibitors to neurological disorders followed by neuronal death in experiments using animal models of diseases. As described above in the paragraphs on epilepsy and ischemia, the concentration of PGE2 revealed a biphasic and significant increase after 2 and 24–48 hours of severe seizure or postischemic reperfusion. Consistent with these observations, COX-2 expression is up-regulated 12–24 hours after cerebral ischemia [75-77]. The up-regulation of COX-2 immunoreactivity is confined to the area of damage [79]. These findings indicate that PGE2 produced by COX-2 may be a stimulator of neuronal damage, which was supported by the results of studies in which PGE2 exacerbated neuronal damage or neuronal apoptosis [82,193,194]. Selective COX-2 inhibitors were shown to block the delayed continuous elevation of PGE2 completely when administered at appropriate levels. In addition, COX-2 inhibition was reported to significantly reduce the extent of neuronal loss [56,81,83,84]. Indeed, selective COX-2 inhibitors dose-dependently reduced infarct volume and accelerated functional

Effects of COX-2 Inhibitors on Brain Diseases

117

recovery, and the effect was significant when treatment was started by 12 hours after onset of ischemia [85]. Thus, treatment with selective COX-2 inhibitors after, and not before, onset of the brain accident is effective, because they can prevent increased activity of delayed induced COX-2, which facilitates neuronal death. However, the treatment is more effective when started within several hours after the onset of seizure or ischemia. In addition, selective COX-2 inhibitors must be administered fully and periodically to block the elevation of PGE2 completely over a period of at least several days. In animal models, unsatisfactory use of inhibitors does not show the protective effect against neuronal loss. Treatment with selective COX-2 inhibitors after onset of neuronal excitatory diseases, such as seizure or ischemia, is expected to provide short-term and sub-acute cure by preventing neuronal loss. Some COX-2 inhibitors are suspected to result in ischemic heart disease as a side effect when their use is extended over a long period of time. Taken together, short-term and sub-acute cure by selective COX-2 inhibitors is quite safe for treatment of neuronal loss after seizure or ischemia. On the other hand, the relationship between the time course of PGE2 elevation and the pathophysiology of ALS and AD is not yet clear, and we could not assess effective treatment regimens for these disorders using selective COX-2 inhibitors. Further studies are required to determine the roles of PGE2 in these diseases.

Endothelial Cells Here, we discuss the responses of vascular endothelial cells related to fever and epilepsy. In the endothelial cells, mPGES-1 is colocalized with COX-2, suggesting that the two enzymes are functionally linked and brain endothelial cells play an essential role in the PGE2 production during fever and epilepsy by expressing COX-2 and mPGES-1. In fever, it is generally accepted that PGE2 is produced by endothelial cells in response to endogenous pyrogenic cytokines and exogenous pyrogens, such as LPS. Moreover, it is also accepted that endothelial PGE2 acts on POA [19], and the majority of temperature-insensitive neurons in VMPO [26]. A recent study demonstrated that neurons of the LC are part of a neuronal network that is activated specifically by PGE2 to increase thermogenesis and produce fever [27]. In epilepsy, we found that mPGES-1 was induced after seizure in endothelial cells, whereas it is unclear by what mechanism endothelial mPGES-1 is induced, and by what process endothelial mPGES-1 acts on neuronal loss. We propose two hypotheses for the mechanism of induction of endothelial mPGES-1. First, in response to robust neuronal activity, such as seizure, synaptic glutamate activates both neuronal and astrocytic glutamate receptors. Activation of the latter receptors induces an increase in astrocytic glutamate release. The expression of COX-2 and mPGES-1 in endothelial cells after seizure may be mediated by glutamate release from astrocytes, which activates metabotropic glutamate receptors on endothelial cells [195]. The neuron-to-astrocyte signaling pathway mediated via glutamate is facilitated after seizure, so that endothelial cells may have been stimulated for a long time, i.e., endothelial mPGES-1 is induced in an activity-dependent manner similarly to

118

Takako Takemiya and Kanato Yamagata

COX-2. This is supported by reports indicating that mPGES-1 is induced by neuronal activity in the brain [72,73]. The second hypothesis is that KA causes microglial activation, which results in the propagation of inflammatory responses, including NF-κB, IL-1β, and TNF. Such proinflammatory mediators may stimulate endothelial cells to induce COX-2 or mPGES-1. Indeed, microglial activation may be involved in neuronal death [196-198]. The peak time course of the inflammatory response corresponds to those of mPGES-1 induction and PGE2 production, indicating an intimate relationship between microglial activation and mPGES-1 induction. It is likely that these two mechanisms act together after seizure in the brain, and a large amount of PGE2 is produced in the endothelium. The results described here also indicate that brain endothelial cells do not act merely as a physiological barrier between the blood and brain but may also act as a signal transducer or amplifier. In particular, endothelial cells may be active under pathological conditions, such as epileptic seizure. In response to these conditions, endothelial cells would supply large amounts of PGE2 continuously to astrocytes, which in turn affect neurons. Further analysis of the interactions among neurons, astrocytes, and endothelial cells may provide a better understanding of the processes of neuropathological disorders, as well as facilitating the development of new treatments. Further, we propose a mechanism for the role of endothelial PGE2 in neuronal death. Endothelial PGE2 may promote Ca2+-dependent glutamate release from astrocytes, leading to an increase in neuronal Ca2+ level and neuronal death. Endothelial cells are surrounded by astrocytic end-feet [199] suggesting that PGE2 produced in endothelial cells may affect astrocytes directly. Several lines of evidence indicate that EP receptors are present on cultured astrocytes [200]. Taken together, our results indicate that endothelial cells can modulate neuronal death by releasing PGE2. Thus, COX-2 or mPGES-1-selective inhibitors are expected to be useful for treatment of neurological disorders, such as epileptic seizure, ischemia, ALS, PD, MS, and AD.

CONCLUSIONS COX-2 expression in the brain is induced by various stimuli, and the area of appearance, type of cells, and induction period are dependent on the pathology of each disease. It is possible that COX-2 produces PGs except PGE2 and they do not exacerbate these diseases. However, inducible PGE2 aggravates these diseases. Thus, it is necessary to inhibit the production of PGE2 completely by COX-2 inhibitors during the period in which PGE2 acts as an exacerbation factor. COX-2 has been shown to be closely associated with neuroinflammatory aspects of brain diseases, and these diseases also have other points in common related to neuroinflammation. One is the production of PGE2 mediated via endothelial mPGES-1 in fever and epilepsy, and another is microglial activation regarding neuronal loss in epilepsy, ischemia, and other neurodegenerative diseases. Microglial activation propagates inflammatory responses, including NF-κB, IL-1β, and TNF. Such proinflammatory mediators may stimulate COX-2 induction in various cells in the brain. Activation of microglia may be involved in neuronal death. COX-2 inhibitors can suppress the COX-2 activity stimulated by activated microglia. Moreover, not only COX-2 inhibitors but also NSAIDs reduce the degree of neuronal death because of the action of NSAIDs as PPAR-γ agonists, preventing the activation of microglia.

Effects of COX-2 Inhibitors on Brain Diseases

119

Further studies are required to determine the roles and mechanisms of action of COX-2 and PGs in brain diseases, specifically related to stage or pathophysiological alteration of disease.

REFERENCES [1] [2] [3] [4]

[5] [6] [7] [8] [9]

[10] [11] [12] [13]

[14]

[15]

[16] [17]

Yasojima, K., et al., Distribution of cyclooxygenase-1 and cyclooxygenase-2 mRNAs and proteins in human brain and peripheral organs. Brain Res, 1999. 830(2): p. 226-36. Breder, C.D., et al., Distribution and characterization of cyclooxygenase immunoreactivity in the ovine brain. J. Comp. Neurol, 1992. 322(3): p. 409-38. Breder, C.D., D. Dewitt, and R.P. Kraig, Characterization of inducible cyclooxygenase in rat brain. J. Comp. Neurol, 1995. 355(2): p. 296-315. Warner, T.D., et al., Nonsteroid drug selectivities for cyclo-oxygenase-1 rather than cyclo-oxygenase-2 are associated with human gastrointestinal toxicity: a full in vitro analysis. Proc. Natl. Acad. Sci. U. S. A, 1999. 96(13): p. 7563-8. Kluger, M.J., Fever: role of pyrogens and cryogens. Physiol. Rev, 1991. 71(1): p. 93127. Watkins, L.R., S.F. Maier, and L.E. Goehler, Cytokine-to-brain communication: a review and analysis of alternative mechanisms. Life Sci, 1995. 57(11): p. 1011-26. Maier, S.F., et al., The role of the vagus nerve in cytokine-to-brain communication. Ann. N. Y. Acad. Sci, 1998. 840: p. 289-300. Cao, C., et al., Induction by lipopolysaccharide of cyclooxygenase-2 mRNA in rat brain; its possible role in the febrile response. Brain Res, 1995. 697(1-2): p. 187-96. Cao, C., et al., Endothelial cells of the rat brain vasculature express cyclooxygenase-2 mRNA in response to systemic interleukin-1 beta: a possible site of prostaglandin synthesis responsible for fever. Brain Res, 1996. 733(2): p. 263-72. Cao, C., K. Matsumura, and Y. Watanabe, Induction of cyclooxygenase-2 in the brain by cytokines. Ann. N. Y. Acad. Sci, 1997. 813: p. 307-9. Matsumura, K., C. Cao, and Y. Watanabe, Possible role of cyclooxygenase-2 in the brain vasculature in febrile response. Ann. N. Y. Acad. Sci, 1997. 813: p. 302-6. Cao, C., et al., Involvement of cyclooxygenase-2 in LPS-induced fever and regulation of its mRNA by LPS in the rat brain. Am. J. Physiol, 1997. 272(6 Pt 2): p. R1712-25. Cao, C., et al., Cyclooxygenase-2 is induced in brain blood vessels during fever evoked by peripheral or central administration of tumor necrosis factor. Brain Res. Mol. Brain Res, 1998. 56(1-2): p. 45-56. Cao, C., et al., Lipopolysaccharide injected into the cerebral ventricle evokes fever through induction of cyclooxygenase-2 in brain endothelial cells. J. Neurosci, 1999. 19(2): p. 716-25. Cao, C., et al., Pyrogenic cytokines injected into the rat cerebral ventricle induce cyclooxygenase-2 in brain endothelial cells and also upregulate their receptors. Eur. J. Neurosci, 2001. 13(9): p. 1781-90. Schwartz, J.I., et al., Cyclooxygenase-2 inhibition by rofecoxib reverses naturally occurring fever in humans. Clin. Pharmacol. Ther, 1999. 65(6): p. 653-60. Ushikubi, F., et al., Impaired febrile response in mice lacking the prostaglandin E receptor subtype EP3. Nature, 1998. 395(6699): p. 281-4.

120

Takako Takemiya and Kanato Yamagata

[18] Oka, T., K. Oka, and C.B. Saper, Contrasting effects of E type prostaglandin (EP) receptor agonists on core body temperature in rats. Brain Res, 2003. 968(2): p. 256-62. [19] Scammell, T.E., et al., Ventromedial preoptic prostaglandin E2 activates feverproducing autonomic pathways. J. Neurosci, 1996. 16(19): p. 6246-54. [20] Nakamura, K., et al., Immunohistochemical localization of prostaglandin EP3 receptor in the rat nervous system. J. Comp. Neurol, 2000. 421(4): p. 543-69. [21] Rothwell, N.J., Eicosanoids, thermogenesis and thermoregulation. Prostaglandins Leukot. Essent Fatty Acids, 1992. 46(1): p. 1-7. [22] Nakamura, K., et al., The rostral raphe pallidus nucleus mediates pyrogenic transmission from the preoptic area. J. Neurosci, 2002. 22(11): p. 4600-10. [23] Morrison, S.F., A.F. Sved, and A.M. Passerin, GABA-mediated inhibition of raphe pallidus neurons regulates sympathetic outflow to brown adipose tissue. Am. J. Physiol, 1999. 276(2 Pt 2): p. R290-7. [24] Toh, H., A. Ichikawa, and S. Narumiya, Molecular evolution of receptors for eicosanoids. FEBS Lett, 1995. 361(1): p. 17-21. [25] Steiner, A.A., J. Antunes-Rodrigues, and L.G. Branco, Role of preoptic second messenger systems (cAMP and cGMP) in the febrile response. Brain Res, 2002. 944(12): p. 135-45. [26] Ranels, H.J. and J.D. Griffin, Effects of prostaglandin E2 on the electrical properties of thermally classified neurons in the ventromedial preoptic area of the rat hypothalamus. BMC Neurosci, 2005. 6(1): p. 14. [27] Almeida, M.C., et al., Thermoeffector neuronal pathways in fever: a study in rats showing a new role of the locus coeruleus. J. Physiol, 2004. 558(Pt 1): p. 283-94. [28] Yamagata, K., et al., Coexpression of microsomal-type prostaglandin E synthase with cyclooxygenase-2 in brain endothelial cells of rats during endotoxin-induced fever. J. Neurosci, 2001. 21(8): p. 2669-77. [29] Inoue, W., et al., Brain-specific endothelial induction of prostaglandin E(2) synthesis enzymes and its temporal relation to fever. Neurosci. Res, 2002. 44(1): p. 51-61. [30] Engblom, D., et al., Microsomal prostaglandin E synthase-1 is the central switch during immune-induced pyresis. Nat. Neurosci, 2003. 6(11): p. 1137-8. [31] Mouihate, A., L. Boisse, and Q.J. Pittman, A novel antipyretic action of 15-deoxyDelta12,14-prostaglandin J2 in the rat brain. J. Neurosci, 2004. 24(6): p. 1312-8. [32] Minami, T., et al., Characterization of EP-receptor subtypes involved in allodynia and hyperalgesia induced by intrathecal administration of prostaglandin E2 to mice. Br. J. Pharmacol, 1994. 112(3): p. 735-40. [33] Yaksh, T.L., et al., The spinal biology in humans and animals of pain states generated by persistent small afferent input. Proc. Natl. Acad. Sci. U. S. A. 1999. 96(14): p. 76806. [34] Minami, T., et al., Involvement of primary afferent C-fibres in touch-evoked pain (allodynia) induced by prostaglandin E2. Eur. J. Neurosci. 1999. 11(6): p. 1849-56. [35] Hori, T., et al., Pain modulatory actions of cytokines and prostaglandin E2 in the brain. Ann. N. Y. Acad. Sci. 1998. 840: p. 269-81. [36] Hori, T., et al., Hypothalamic mechanisms of pain modulatory actions of cytokines and prostaglandin E2. Ann. N. Y. Acad. Sci. 2000. 917: p. 106-20.

Effects of COX-2 Inhibitors on Brain Diseases

121

[37] Hosoi, M., T. Oka, and T. Hori, Prostaglandin E receptor EP3 subtype is involved in thermal hyperalgesia through its actions in the preoptic hypothalamus and the diagonal band of Broca in rats. Pain, 1997. 71(3): p. 303-11. [38] Hosoi, M., et al., Prostaglandin E(2) has antinociceptive effect through EP(1) receptor in the ventromedial hypothalamus in rats. Pain, 1999. 83(2): p. 221-7. [39] Abe, M., et al., Prostanoids in the preoptic hypothalamus mediate systemic lipopolysaccharide-induced hyperalgesia in rats. Brain Res, 2001. 916(1-2): p. 41-9. [40] Heinricher, M.M., M.E. Martenson, and M.J. Neubert, Prostaglandin E2 in the midbrain periaqueductal gray produces hyperalgesia and activates pain-modulating circuitry in the rostral ventromedial medulla. Pain, 2004. 110(1-2): p. 419-26. [41] Heinricher, M.M., et al., Prostaglandin E2 in the medial preoptic area produces hyperalgesia and activates pain-modulating circuitry in the rostral ventromedial medulla. Neuroscience, 2004. 128(2): p. 389-98. [42] Samad, T.A., et al., Interleukin-1beta-mediated induction of Cox-2 in the CNS contributes to inflammatory pain hypersensitivity. Nature, 2001. 410(6827): p. 471-5. [43] Ibuki, T., et al., Cyclooxygenase-2 is induced in the endothelial cells throughout the central nervous system during carrageenan-induced hind paw inflammation; its possible role in hyperalgesia. J. Neurochem. 2003. 86(2): p. 318-28. [44] Trebino, C.E., et al., Impaired inflammatory and pain responses in mice lacking an inducible prostaglandin E synthase. Proc. Natl. Acad. Sci. U. S. A. 2003. 100(15): p. 9044-9. [45] Mabuchi, T., et al., Membrane-associated prostaglandin E synthase-1 is required for neuropathic pain. Neuroreport. 2004. 15(9): p. 1395-8. [46] Yamagata, K., et al., Expression of a mitogen-inducible cyclooxygenase in brain neurons: regulation by synaptic activity and glucocorticoids. Neuron. 1993. 11(2): p. 371-86. [47] Marcheselli, V.L. and N.G. Bazan, Sustained induction of prostaglandin endoperoxide synthase-2 by seizures in hippocampus. Inhibition by a platelet-activating factor antagonist. J. Biol. Chem. 1996. 271(40): p. 24794-9. [48] Adams, J., Y. Collaco-Moraes, and J. de Belleroche, Cyclooxygenase-2 induction in cerebral cortex: an intracellular response to synaptic excitation. J. Neurochem. 1996. 66(1): p. 6-13. [49] McCown, T.J., D.J. Knapp, and F.T. Crews, Inferior collicular seizure generalization produces site-selective cortical induction of cyclooxygenase 2 (COX-2). Brain Res. 1997. 767(2): p. 370-4. [50] Okada, K., et al., Cyclooxygenase-2 expression in the hippocampus of genetically epilepsy susceptible El mice was increased after seizure. Brain Res. 2001. 894(2): p. 332-5. [51] Aisen, P.S., et al., Effects of rofecoxib or naproxen vs placebo on Alzheimer disease progression: a randomized controlled trial. Jama. 2003. 289(21): p. 2819-26. [52] Chen, J., et al., Expression of cyclo-oxygenase 2 in rat brain following kainate treatment. Neuroreport. 1995. 6(2): p. 245-8. [53] Domoki, F., et al., Kainic acid rapidly induces cyclooxygenase (COX)-2 in piglet cerebral cortex. Neuroreport. 2000. 11(16): p. 3435-8.

122

Takako Takemiya and Kanato Yamagata

[54] Kitamura, Y., et al., Increased expression of cyclooxygenases and peroxisome proliferator-activated receptor-gamma in Alzheimer's disease brains. Biochem. Biophys. Res. Commun. 1999. 254(3): p. 582-6. [55] Sanz, O., et al., Differential cellular distribution and dynamics of HSP70, cyclooxygenase-2, and c-Fos in the rat brain after transient focal ischemia or kainic acid. Neuroscience. 1997. 80(1): p. 221-32. [56] Takemiya, T., et al., Inducible brain COX-2 facilitates the recurrence of hippocampal seizures in mouse rapid kindling. Prostaglandins Other Lipid Mediat. 2003. 71(3-4): p. 205-16. [57] Paoletti, A.M., et al., Systemic administration of N omega-nitro-L-arginine methyl ester and indomethacin reduces the elevation of brain PGE2 content and prevents seizures and hippocampal damage evoked by LiCl and tacrine in rat. Exp. Neurol. 1998. 149(2): p. 349-55. [58] Sayyah, M., M. Javad-Pour, and M. Ghazi-Khansari, The bacterial endotoxin lipopolysaccharide enhances seizure susceptibility in mice: involvement of proinflammatory factors: nitric oxide and prostaglandins. Neuroscience. 2003. 122(4): p. 1073-80. [59] Kunz, T. and E.H. Oliw, The selective cyclooxygenase-2 inhibitor rofecoxib reduces kainate-induced cell death in the rat hippocampus. Eur. J. Neurosci. 2001. 13(3): p. 569-75. [60] Kim, E.J., et al., Differential roles of cyclooxygenase isoforms after kainic acid-induced prostaglandin E(2) production and neurodegeneration in cortical and hippocampal cell cultures. Brain Res. 2001. 908(1): p. 1-9. [61] Manabe, Y., et al., Prostanoids, not reactive oxygen species, mediate COX-2-dependent neurotoxicity. Ann. Neurol. 2004. 55(5): p. 668-75. [62] Araki, E., et al., Cyclooxygenase-2 inhibitor ns-398 protects neuronal cultures from lipopolysaccharide-induced neurotoxicity. Stroke. 2001. 32(10): p. 2370-5. [63] Hewett, S.J., et al., Cyclooxygenase-2 contributes to N-methyl-D-aspartate-mediated neuronal cell death in primary cortical cell culture. J. Pharmacol. Exp. Ther. 2000. 293(2): p. 417-25. [64] Mirjany, M., L. Ho, and G.M. Pasinetti, Role of cyclooxygenase-2 in neuronal cell cycle activity and glutamate-mediated excitotoxicity. J Pharmacol Exp Ther, 2002. 301(2): p. 494-500. [65] Uematsu, S., et al., Lipopolysaccharide-dependent prostaglandin E(2) production is regulated by the glutathione-dependent prostaglandin E(2) synthase gene induced by the Toll-like receptor 4/MyD88/NF-IL6 pathway. J. Immunol. 2002. 168(11): p. 58116. [66] Scali, C., et al., Brain inflammatory reaction in an animal model of neuronal degeneration and its modulation by an anti-inflammatory drug: implication in Alzheimer's disease. Eur. J. Neurosci. 2000. 12(6): p. 1900-12. [67] Zonta, M., et al., Neuron-to-astrocyte signaling is central to the dynamic control of brain microcirculation. Nat. Neurosci. 2003. 6(1): p. 43-50. [68] Parri, R. and V. Crunelli, An astrocyte bridge from synapse to blood flow. Nat. Neurosci. 2003. 6(1): p. 5-6.

Effects of COX-2 Inhibitors on Brain Diseases

123

[69] Zonta, M., et al., Glutamate-mediated cytosolic calcium oscillations regulate a pulsatile prostaglandin release from cultured rat astrocytes. J. Physiol. 2003. 553(Pt 2): p. 40714. [70] Mulligan, S.J. and B.A. MacVicar, Calcium transients in astrocyte endfeet cause cerebrovascular constrictions. Nature. 2004. 431(7005): p. 195-9. [71] Hirase, H., A multi-photon window onto neuronal-glial-vascular communication. Trends Neurosci. 2005. 28(5): p. 217-9. [72] Turrin, N.P. and S. Rivest, Innate immune reaction in response to seizures: implications for the neuropathology associated with epilepsy. Neurobiol. Dis. 2004. 16(2): p. 32134. [73] Ciceri, P., et al., Pharmacology of celecoxib in rat brain after kainate administration. J. Pharmacol. Exp. Ther. 2002. 302(3): p. 846-52. [74] O'Banion, M.K., Cyclooxygenase-2: molecular biology, pharmacology, and neurobiology. Crit. Rev. Neurobiol. 1999. 13(1): p. 45-82. [75] Nogawa, S., et al., Cyclo-oxygenase-2 gene expression in neurons contributes to ischemic brain damage. J. Neurosci. 1997. 17(8): p. 2746-55. [76] Nogawa, S., et al., Interaction between inducible nitric oxide synthase and cyclooxygenase-2 after cerebral ischemia. Proc. Natl. Acad. Sci. U. S. A. 1998. 95(18): p. 10966-71. [77] 7Miettinen, S., et al., Spreading depression and focal brain ischemia induce cyclooxygenase-2 in cortical neurons through N-methyl-D-aspartic acid-receptors and phospholipase A2. Proc. Natl. Acad. Sci. U. S. A. 1997. 94(12): p. 6500-5. [78] Li, R.C., et al., Cyclooxygenase 2 and intermittent hypoxia-induced spatial deficits in the rat. Am. J. Respir. Crit. Care Med. 2003. 168(4): p. 469-75. [79] Iadecola, C., et al., Cyclooxygenase-2 immunoreactivity in the human brain following cerebral ischemia. Acta Neuropathol. (Berl), 1999. 98(1): p. 9-14. [80] Yokota, C., et al., Temporal and topographic profiles of cyclooxygenase-2 expression during 24 h of focal brain ishemia in rats. Neurosci. Lett. 2004. 357(3): p. 219-22. [81] Candelario-Jalil, E., et al., Assessment of the relative contribution of COX-1 and COX2 isoforms to ischemia-induced oxidative damage and neurodegeneration following transient global cerebral ischemia. J. Neurochem. 2003. 86(3): p. 545-55. [82] Thornhill, J. and M. Smith, Intracerebroventricular prostaglandin administration increases the neural damage evoked by global hemispheric hypoxic ischemia. Brain. Res, 1998. 784(1-2): p. 48-56. [83] Nakayama, M., et al., Cyclooxygenase-2 inhibition prevents delayed death of CA1 hippocampal neurons following global ischemia. Proc. Natl. Acad. Sci. U. S. A. 1998. 95(18): p. 10954-9. [84] Iadecola, C., et al., Reduced susceptibility to ischemic brain injury and N-methyl-Daspartate-mediated neurotoxicity in cyclooxygenase-2-deficient mice. Proc. Natl. Acad. Sci. U. S. A. 2001. 98(3): p. 1294-9. [85] Candelario-Jalil, E., et al., Wide therapeutic time window for nimesulide neuroprotection in a model of transient focal cerebral ischemia in the rat. Brain Res. 2004. 1007(1-2): p. 98-108. [86] Bucci, M.N., K.L. Black, and J.T. Hoff, Arachidonic acid metabolite production following focal cerebral ischemia: time course and effect of meclofenamate. Surg. Neurol. 1990. 33(1): p. 12-4.

124

Takako Takemiya and Kanato Yamagata

[87] Feuerstein, G.Z. and X. Wang, Inflammation and stroke: benefits without harm? Arch. Neurol. 2001. 58(4): p. 672-4. [88] Cheung, R.T., et al., Cyclooxygenase-1 gene knockout does not alter middle cerebral artery occlusion in a mouse stroke model. Neurosci. Lett. 2002. 330(1): p. 57-60. [89] FitzGerald, G.A., Cardiovascular pharmacology of nonselective nonsteroidal antiinflammatory drugs and coxibs: clinical considerations. Am. J. Cardiol. 2002. 89(6A): p. 26D-32D. [90] Lin, H., et al., Cyclooxygenase-1 and bicistronic cyclooxygenase-1/prostacyclin synthase gene transfer protect against ischemic cerebral infarction. Circulation. 2002. 105(16): p. 1962-9. [91] McGeer, P.L., COX-2 and ALS. Amyotroph. Lateral Scler. Other Motor Neuron Disord. 2001. 2(3): p. 121-2. [92] Yasojima, K., et al., Marked increase in cyclooxygenase-2 in ALS spinal cord: implications for therapy. Neurology. 2001. 57(6): p. 952-6. [93] Maihofner, C., et al., Expression and localization of cyclooxygenase-1 and -2 in human sporadic amyotrophic lateral sclerosis. Eur. J. Neurosci. 2003. 18(6): p. 1527-34. [94] Almer, G., et al., Increased expression of the pro-inflammatory enzyme cyclooxygenase-2 in amyotrophic lateral sclerosis. Ann. Neurol. 2001. 49(2): p. 176-85. [95] Drachman, D.B., et al., Cyclooxygenase 2 inhibition protects motor neurons and prolongs survival in a transgenic mouse model of ALS. Ann. Neurol. 2002. 52(6): p. 771-8. [96] Pompl, P.N., et al., A therapeutic role for cyclooxygenase-2 inhibitors in a transgenic mouse model of amyotrophic lateral sclerosis. Faseb J. 2003. 17(6): p. 725-7. [97] Klivenyi, P., et al., Additive neuroprotective effects of creatine and cyclooxygenase 2 inhibitors in a transgenic mouse model of amyotrophic lateral sclerosis. J. Neurochem. 2004. 88(3): p. 576-82. [98] Drachman, D.B. and J.D. Rothstein, Inhibition of cyclooxygenase-2 protects motor neurons in an organotypic model of amyotrophic lateral sclerosis. Ann. Neurol. 2000. 48(5): p. 792-5. [99] Azari, M.F., et al., Effects of intraperitoneal injection of Rofecoxib in a mouse model of ALS. Eur. J. Neurol. 2005. 12(5): p. 357-64. [100] Kim, W.G., et al., Regional difference in susceptibility to lipopolysaccharide-induced neurotoxicity in the rat brain: role of microglia. J. Neurosci. 2000. 20(16): p. 6309-16. [101] McGeer, P.L., et al., Reactive microglia are positive for HLA-DR in the substantia nigra of Parkinson's and Alzheimer's disease brains. Neurology. 1988. 38(8): p. 128591. [102] Banati, R.B., S.E. Daniel, and S.B. Blunt, Glial pathology but absence of apoptotic nigral neurons in long-standing Parkinson's disease. Mov. Disord. 1998. 13(2): p. 2217. [103] Mirza, B., et al., The absence of reactive astrocytosis is indicative of a unique inflammatory process in Parkinson's disease. Neuroscience. 2000. 95(2): p. 425-32. [104] Langston, J.W., et al., Evidence of active nerve cell degeneration in the substantia nigra of humans years after 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine exposure. Ann. Neurol. 1999. 46(4): p. 598-605.

Effects of COX-2 Inhibitors on Brain Diseases

125

[105] Kohutnicka, M., et al., Microglial and astrocytic involvement in a murine model of Parkinson's disease induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). Immunopharmacology. 1998. 39(3): p. 167-80. [106] Czlonkowska, A., et al., Microglial reaction in MPTP (1-methyl-4-phenyl-1,2,3,6tetrahydropyridine) induced Parkinson's disease mice model. Neurodegeneration. 1996. 5(2): p. 137-43. [107] Liberatore, G.T., et al., Inducible nitric oxide synthase stimulates dopaminergic neurodegeneration in the MPTP model of Parkinson disease. Nat. Med. 1999. 5(12): p. 1403-9. [108] Dehmer, T., et al., Deficiency of inducible nitric oxide synthase protects against MPTP toxicity in vivo. J. Neurochem. 2000. 74(5): p. 2213-6. [109] O'Callaghan, J.P., D.B. Miller, and J.F. Reinhard, Jr., Characterization of the origins of astrocyte response to injury using the dopaminergic neurotoxicant, 1-methyl-4-phenyl1,2,3,6-tetrahydropyridine. Brain Res. 1990. 521(1-2): p. 73-80. [110] Nagatsu, T., et al., Changes in cytokines and neurotrophins in Parkinson's disease. J. Neural Transm. Suppl. 2000(60): p. 277-90. [111] Knott, C., G. Stern, and G.P. Wilkin, Inflammatory regulators in Parkinson's disease: iNOS, lipocortin-1, and cyclooxygenases-1 and -2. Mol. Cell Neurosci. 2000. 16(6): p. 724-39. [112] Nathan, C. and Q.W. Xie, Regulation of biosynthesis of nitric oxide. J. Biol. Chem. 1994. 269(19): p. 13725-8. [113] Mattammal, M.B., et al., Prostaglandin H synthetase-mediated metabolism of dopamine: implication for Parkinson's disease. J. Neurochem. 1995. 64(4): p. 1645-54. [114] Aubin, N., et al., Aspirin and salicylate protect against MPTP-induced dopamine depletion in mice. J. Neurochem. 1998. 71(4): p. 1635-42. [115] Ferger, B., et al., Salicylate protects against MPTP-induced impairments in dopaminergic neurotransmission at the striatal and nigral level in mice. Naunyn. Schmiedebergs Arch. Pharmacol. 1999. 360(3): p. 256-61. [116] Mohanakumar, K.P., D. Muralikrishnan, and B. Thomas, Neuroprotection by sodium salicylate against 1-methyl-4-phenyl-1,2,3, 6-tetrahydropyridine-induced neurotoxicity. Brain Res. 2000. 864(2): p. 281-90. [117] Teismann, P. and B. Ferger, Inhibition of the cyclooxygenase isoenzymes COX-1 and COX-2 provide neuroprotection in the MPTP-mouse model of Parkinson's disease. Synapse. 2001. 39(2): p. 167-74. [118] Breidert, T., et al., Protective action of the peroxisome proliferator-activated receptorgamma agonist pioglitazone in a mouse model of Parkinson's disease. J. Neurochem. 2002. 82(3): p. 615-24. [119] Hastings, T.G., Enzymatic oxidation of dopamine: the role of prostaglandin H synthase. J. Neurochem. 1995. 64(2): p. 919-24. [120] Przybylkowski, A., et al., Cyclooxygenases mRNA and protein expression in striata in the experimental mouse model of Parkinson's disease induced by 1-methyl-4-phenyl1,2,3,6-tetrahydropyridine administration to mouse. Brain Res. 2004. 1019(1-2): p. 14451. [121] Teismann, P., et al., COX-2 and neurodegeneration in Parkinson's disease. Ann. N. Y. Acad. Sci. 2003. 991: p. 272-7.

126

Takako Takemiya and Kanato Yamagata

[122] Feng, Z., et al., COX-2-deficient mice are less prone to MPTP-neurotoxicity than wildtype mice. Neuroreport. 2003. 14(15): p. 1927-9. [123] Dore-Duffy, P., et al., Prostaglandin release in multiple sclerosis: correlation with disease activity. Neurology. 1986. 36(12): p. 1587-90. [124] Aberg, J.A., et al., Prostaglandin production in chronic progressive multiple sclerosis. J. Clin. Lab. Anal. 1990. 4(4): p. 246-50. [125] Kirk, P.F., et al., The effect of methylprednisolone on monocyte eicosanoid production in patients with multiple sclerosis. J. Neurol. 1994. 241(7): p. 427-31. [126] Misko, T.P., J.L. Trotter, and A.H. Cross, Mediation of inflammation by encephalitogenic cells: interferon gamma induction of nitric oxide synthase and cyclooxygenase 2. J. Neuroimmunol. 1995. 61(2): p. 195-204. [127] Di Rosa, F., et al., Short-lived immunization site inflammation in self-limited active experimental allergic encephalomyelitis. Int. Immunol. 2000. 12(5): p. 711-9. [128] Jiang, C., A.T. Ting, and B. Seed, PPAR-gamma agonists inhibit production of monocyte inflammatory cytokines. Nature. 1998. 391(6662): p. 82-6. [129] Ricote, M., et al., The peroxisome proliferator-activated receptor-gamma is a negative regulator of macrophage activation. Nature. 1998. 391(6662): p. 79-82. [130] Clark, R.B., et al., The nuclear receptor PPAR gamma and immunoregulation: PPAR gamma mediates inhibition of helper T cell responses. J. Immunol. 2000. 164(3): p. 1364-71. [131] Marx, N., et al., PPARgamma activation in human endothelial cells increases plasminogen activator inhibitor type-1 expression: PPARgamma as a potential mediator in vascular disease. Arterioscler. Thromb. Vasc. Biol. 1999. 19(3): p. 546-51. [132] Diab, A., et al., Peroxisome proliferator-activated receptor-gamma agonist 15-deoxyDelta(12,14)-prostaglandin J(2) ameliorates experimental autoimmune encephalomyelitis. J. Immunol. 2002. 168(5): p. 2508-15. [133] Natarajan, C. and J.J. Bright, Peroxisome proliferator-activated receptor-gamma agonists inhibit experimental allergic encephalomyelitis by blocking IL-12 production, IL-12 signaling and Th1 differentiation. Genes Immun. 2002. 3(2): p. 59-70. [134] Diab, A., et al., Ligands for the peroxisome proliferator-activated receptor-gamma and the retinoid X receptor exert additive anti-inflammatory effects on experimental autoimmune encephalomyelitis. J. Neuroimmunol. 2004. 148(1-2): p. 116-26. [135] Pershadsingh, H.A., et al., Effect of pioglitazone treatment in a patient with secondary multiple sclerosis. J. Neuroinflammation. 2004. 1(1): p. 3. [136] Breitner, J.C., The role of anti-inflammatory drugs in the prevention and treatment of Alzheimer's disease. Annu. Rev. Med. 1996. 47: p. 401-11. [137] Breitner, J.C., Inflammatory processes and antiinflammatory drugs in Alzheimer's disease: a current appraisal. Neurobiol. Aging. 1996. 17(5): p. 789-94. [138] McGeer, P.L., M. Schulzer, and E.G. McGeer, Arthritis and anti-inflammatory agents as possible protective factors for Alzheimer's disease: a review of 17 epidemiologic studies. Neurology. 1996. 47(2): p. 425-32. [139] Rogers, J., et al., Clinical trial of indomethacin in Alzheimer's disease. Neurology. 1993. 43(8): p. 1609-11. [140] Rich, J.B., et al., Nonsteroidal anti-inflammatory drugs in Alzheimer's disease. Neurology. 1995. 45(1): p. 51-5.

Effects of COX-2 Inhibitors on Brain Diseases

127

[141] Stewart, W.F., et al., Risk of Alzheimer's disease and duration of NSAID use. Neurology. 1997. 48(3): p. 626-32. [142] McGeer, P.L. and E.G. McGeer, The inflammatory response system of brain: implications for therapy of Alzheimer and other neurodegenerative diseases. Brain Res. Brain Res. Rev. 1995. 21(2): p. 195-218. [143] Breitner, J.C., et al., Delayed onset of Alzheimer's disease with nonsteroidal antiinflammatory and histamine H2 blocking drugs. Neurobiol. Aging. 1995. 16(4): p. 52330. [144] Anthony, J.C., et al., Reduced prevalence of AD in users of NSAIDs and H2 receptor antagonists: the Cache County study. Neurology. 2000. 54(11): p. 2066-71. [145] In t' Veld, B.A., et al., Nonsteroidal antiinflammatory drugs and the risk of Alzheimer's disease. N. Engl. J. Med. 2001. 345(21): p. 1515-21. [146] In 't Veld, B.A., et al., NSAIDs and incident Alzheimer's disease. The Rotterdam Study. Neurobiol. Aging. 1998. 19(6): p. 607-11. [147] Rogers, J., et al., Complement activation by beta-amyloid in Alzheimer disease. Proc. Natl. Acad. Sci. U. S. A. 1992. 89(21): p. 10016-20. [148] Lue, L.F., et al., Characterization of glial cultures from rapid autopsies of Alzheimer's and control patients. Neurobiol. Aging. 1996. 17(3): p. 421-9. [149] McGeer, P.L. and E.G. McGeer, Inflammation of the brain in Alzheimer's disease: implications for therapy. J. Leukoc. Biol. 1999. 65(4): p. 409-15. [150] Meda, L., et al., Activation of microglial cells by beta-amyloid protein and interferongamma. Nature. 1995. 374(6523): p. 647-50. [151] Webster, S.D., et al., Complement component C1q modulates the phagocytosis of Abeta by microglia. Exp. Neurol. 2000. 161(1): p. 127-38. [152] Hu, L., et al., The impact of Abeta-plaques on cortical cholinergic and non-cholinergic presynaptic boutons in alzheimer's disease-like transgenic mice. Neuroscience. 2003. 121(2): p. 421-32. [153] Du, Z.Y. and X.Y. Li, Inhibitory effects of indomethacin on interleukin-1 and nitric oxide production in rat microglia in vitro. Int. J. Immunopharmacol. 1999. 21(3): p. 219-25. [154] Gottschall, P.E., beta-Amyloid induction of gelatinase B secretion in cultured microglia: inhibition by dexamethasone and indomethacin. Neuroreport. 1996. 7(18): p. 3077-80. [155] Netland, E.E., et al., Indomethacin reverses the microglial response to amyloid betaprotein. Neurobiol. Aging. 1998. 19(3): p. 201-4. [156] Lim, G.P., et al., Ibuprofen suppresses plaque pathology and inflammation in a mouse model for Alzheimer's disease. J. Neurosci. 2000. 20(15): p. 5709-14. [157] Blasko, I., et al., Ibuprofen decreases cytokine-induced amyloid beta production in neuronal cells. Neurobiol. Dis. 2001. 8(6): p. 1094-101. [158] Bisaglia, M., et al., Acetaminophen protects hippocampal neurons and PC12 cultures from amyloid beta-peptides induced oxidative stress and reduces NF-kappaB activation. Neurochem. Int. 2002. 41(1): p. 43-54. [159] Hauss-Wegrzyniak, B., P. Vraniak, and G.L. Wenk, The effects of a novel NSAID on chronic neuroinflammation are age dependent. Neurobiol. Aging. 1999. 20(3): p. 30513.

128

Takako Takemiya and Kanato Yamagata

[160] Jantzen, P.T., et al., Microglial activation and beta -amyloid deposit reduction caused by a nitric oxide-releasing nonsteroidal anti-inflammatory drug in amyloid precursor protein plus presenilin-1 transgenic mice. J. Neurosci. 2002. 22(6): p. 2246-54. [161] Thomas, T., T.G. Nadackal, and K. Thomas, Aspirin and non-steroidal antiinflammatory drugs inhibit amyloid-beta aggregation. Neuroreport. 2001. 12(15): p. 3263-7. [162] Bate, C., et al., Neurones treated with cyclo-oxygenase-1 inhibitors are resistant to amyloid-beta1-42. Neuroreport. 2003. 14(16): p. 2099-103. [163] Lukiw, W.J. and N.G. Bazan, Cyclooxygenase 2 RNA message abundance, stability, and hypervariability in sporadic Alzheimer neocortex. J. Neurosci. Res. 1997. 50(6): p. 937-45. [164] Pasinetti, G.M. and P.S. Aisen, Cyclooxygenase-2 expression is increased in frontal cortex of Alzheimer's disease brain. Neuroscience. 1998. 87(2): p. 319-24. [165] Ho, L., et al., Regional distribution of cyclooxygenase-2 in the hippocampal formation in Alzheimer's disease. J. Neurosci. Res. 1999. 57(3): p. 295-303. [166] Oka, A. and S. Takashima, Induction of cyclo-oxygenase 2 in brains of patients with Down's syndrome and dementia of Alzheimer type: specific localization in affected neurones and axons. Neuroreport. 1997. 8(5): p. 1161-4. [167] Yermakova, A.V. and M.K. O'Banion, Downregulation of neuronal cyclooxygenase-2 expression in end stage Alzheimer's disease. Neurobiol. Aging. 2001. 22(6): p. 823-36. [168] Hoozemans, J.J., et al., Cyclooxygenase expression in microglia and neurons in Alzheimer's disease and control brain. Acta Neuropathol. (Berl), 2001. 101(1): p. 2-8. [169] Ho, L., et al., Neuronal cyclooxygenase 2 expression in the hippocampal formation as a function of the clinical progression of Alzheimer disease. Arch. Neurol. 2001. 58(3): p. 487-92. [170] Andreasson, K.I., et al., Age-dependent cognitive deficits and neuronal apoptosis in cyclooxygenase-2 transgenic mice. J. Neurosci. 2001. 21(20): p. 8198-209. [171] Bazan, N.G. and W.J. Lukiw, Cyclooxygenase-2 and presenilin-1 gene expression induced by interleukin-1beta and amyloid beta 42 peptide is potentiated by hypoxia in primary human neural cells. J. Biol. Chem. 2002. 277(33): p. 30359-67. [172] Xiang, Z., et al., Cyclooxygenase-2 promotes amyloid plaque deposition in a mouse model of Alzheimer's disease neuropathology. Gene Expr. 2002. 10(5-6): p. 271-8. [173] Xiang, Z., et al., Cyclooxygenase (COX)-2 and cell cycle activity in a transgenic mouse model of Alzheimer's disease neuropathology. Neurobiol. Aging. 2002. 23(3): p. 32734. [174] Jang, J.H. and Y.J. Surh, beta-Amyloid-induced apoptosis is associated with cyclooxygenase-2 up-regulation via the mitogen-activated protein kinase-NF-kappaB signaling pathway. Free Radic. Biol. Med. 2005. 38(12): p. 1604-13. [175] Paris, D., et al., Statins inhibit A beta-neurotoxicity in vitro and A beta-induced vasoconstriction and inflammation in rat aortae. Atherosclerosis. 2002. 161(2): p. 2939. [176] Reines, S.A., et al., Rofecoxib: no effect on Alzheimer's disease in a 1-year, randomized, blinded, controlled study. Neurology. 2004. 62(1): p. 66-71. [177] Landolfi, C., et al., Inflammatory molecule release by beta-amyloid-treated T98G astrocytoma cells: role of prostaglandins and modulation by paracetamol. Eur. J. Pharmacol. 1998. 360(1): p. 55-64.

Effects of COX-2 Inhibitors on Brain Diseases

129

[178] Shie, F.S., et al., Microglial EP2 as a new target to increase amyloid beta phagocytosis and decrease amyloid beta-induced damage to neurons. Brain Pathol. 2005. 15(2): p. 134-8. [179] Qin, W., et al., Cyclooxygenase (COX)-2 and COX-1 potentiate beta-amyloid peptide generation through mechanisms that involve gamma-secretase activity. J. Biol. Chem. 2003. 278(51): p. 50970-7. [180] Niwa, K., et al., A beta-peptides enhance vasoconstriction in cerebral circulation. Am. J. Physiol. Heart Circ. Physiol. 2001. 281(6): p. H2417-24. [181] Paris, D., et al., Vasoactive effects of A beta in isolated human cerebrovessels and in a transgenic mouse model of Alzheimer's disease: role of inflammation. Neurol. Res. 2003. 25(6): p. 642-51. [182] Townsend, K.P., et al., Proinflammatory and vasoactive effects of Abeta in the cerebrovasculature. Ann. N. Y. Acad. Sci. 2002. 977: p. 65-76. [183] Yermakova, A.V., et al., Cyclooxygenase-1 in human Alzheimer and control brain: quantitative analysis of expression by microglia and CA3 hippocampal neurons. J. Neuropathol. Exp. Neurol. 1999. 58(11): p. 1135-46. [184] Lehmann, J.M., et al., Peroxisome proliferator-activated receptors alpha and gamma are activated by indomethacin and other non-steroidal anti-inflammatory drugs. J. Biol. Chem. 1997. 272(6): p. 3406-10. [185] Petrova, T.V., K.T. Akama, and L.J. Van Eldik, Cyclopentenone prostaglandins suppress activation of microglia: down-regulation of inducible nitric-oxide synthase by 15-deoxy-Delta12,14-prostaglandin J2. Proc. Natl. Acad. Sci. U. S. A. 1999. 96(8): p. 4668-73. [186] Combs, C.K., et al., Inflammatory mechanisms in Alzheimer's disease: inhibition of beta-amyloid-stimulated proinflammatory responses and neurotoxicity by PPARgamma agonists. J. Neurosci. 2000. 20(2): p. 558-67. [187] Weggen, S., et al., A subset of NSAIDs lower amyloidogenic Abeta42 independently of cyclooxygenase activity. Nature. 2001. 414(6860): p. 212-6. [188] Landreth, G.E. and M.T. Heneka, Anti-inflammatory actions of peroxisome proliferator-activated receptor gamma agonists in Alzheimer's disease. Neurobiol. Aging. 2001. 22(6): p. 937-44. [189] Kielian, T. and P.D. Drew, Effects of peroxisome proliferator-activated receptorgamma agonists on central nervous system inflammation. J. Neurosci. Res. 2003. 71(3): p. 315-25. [190] Inoue, H., T. Tanabe, and K. Umesono, Feedback control of cyclooxygenase-2 expression through PPARgamma. J. Biol. Chem. 2000. 275(36): p. 28028-32. [191] Takata, K., et al., Possible involvement of small oligomers of amyloid-beta peptides in 15-deoxy-delta 12,14 prostaglandin J2-sensitive microglial activation. J. Pharmacol. Sci. 2003. 91(4): p. 330-3. [192] Rossi, A., et al., Anti-inflammatory cyclopentenone prostaglandins are direct inhibitors of IkappaB kinase. Nature. 2000. 403(6765): p. 103-8. [193] Takadera, T., et al., Prostaglandin E(2) induces caspase-dependent apoptosis in rat cortical cells. Neurosci. Lett. 2002. 317(2): p. 61-4. [194] Takadera, T., Y. Shiraishi, and T. Ohyashiki, Prostaglandin E2 induced caspasedependent apoptosis possibly through activation of EP2 receptors in cultured hippocampal neurons. Neurochem. Int. 2004. 45(5): p. 713-9.

130

Takako Takemiya and Kanato Yamagata

[195] Gillard, S.E., et al., Expression of metabotropic glutamate receptors in rat meningeal and brain microvasculature and choroid plexus. J. Comp. Neurol. 2003. 461(3): p. 31732. [196] Shaw, J.A., V.H. Perry, and J. Mellanby, Tetanus toxin-induced seizures cause microglial activation in rat hippocampus. Neurosci. Lett. 1990. 120(1): p. 66-9. [197] Beach, T.G., et al., Reactive microglia in hippocampal sclerosis associated with human temporal lobe epilepsy. Neurosci. Lett. 1995. 191(1-2): p. 27-30. [198] Taniwaki, Y., et al., Microglial activation by epileptic activities through the propagation pathway of kainic acid-induced hippocampal seizures in the rat. Neurosci. Lett. 1996. 217(1): p. 29-32. [199] Janzer, R.C. and M.C. Raff, Astrocytes induce blood-brain barrier properties in endothelial cells. Nature. 1987. 325(6101): p. 253-7. [200] Fiebich, B.L., et al., Mechanisms of prostaglandin E2-induced interleukin-6 release in astrocytes: possible involvement of EP4-like receptors, p38 mitogen-activated protein kinase and protein kinase C. J. Neurochem. 2001. 79(5): p. 950-8.

In: Brain Mapping and Diseases Ed: Diane E. Spinelle

ISBN: 978-1-61122-065-0 © 2011 Nova Science Publishers, Inc.

Chapter 7

NEURO-PHYSIOLOGICAL STUDIES IN CREUTZFELDT-JAKOB’S DISEASE J.J. Ortega-Albás1,2 and A.L. Serrano-García1 1

2

Clinical Neuro-physiological Service Sleep Unit, Hospital General de Castellón; Castellón de la Plana, Spain

INTRODUCTION Neurophysiological studies in Creutzfeldt-Jakob Disease (CJD) are mostly centred on the appearance, during development of the disease, of an electroencephalogram (EEG) called “typical”, which converts the clinical suspicion into a likely diagnosis. Early diagnosis avoids another series of unnecessary procedures, prevents iatrogenic transmission and recognises the invariably fatal prognosis. The EEG as a diagnostic tool is based on interpreting a series of graphical elements that express the brain’s bio-electrical activity as a particular form of language. Its conventional meaning, mainly based on practical aspects, has allowed a series of basic electroencephalogram patterns to be defined. Performing an EEG comprises three major stages: the first is the detailed analysis of the graphical elements of which it is composed; the second, matching it with one of the defined patterns and, lastly, the identification of EEG patterns with a sociological value, i.e., trying to establish the appropriate electro-clinical correlation. Within the basic EEG pattern catalogue, the typical findings seen in the course of CJD are included in a large group of periodic activities. Nevertheless, two important aspects must be considered: on the one hand the fact that the EEG is a dynamic test that presents wide variations in the evolution of the disease and, on the other hand, the lack of typicality in the new variant of the disease (vCJD) and in the genetic subtypes that lead us to seek new ways of trying to establish a neurophysiological characterisation of the disease.

132

J. J. Ortega-Albás and A. L. Serrano-García

In this chapter, in the first place, we will discuss the EEG findings in the course of the evolution of sporadic CJD and the aspects differentiating them from other phenotypes before explaining the current status and future prospects for neurophysiological studies.

1. ELECTROENCEPHALOGRAM (EEG) Definition of Periodic Activity Generally, periodic activity is a succession of stereotyped paroxistic graphical elements (at least three) separated by nearly identical intervals. The graphical elements always have greater amplitude than the background elements, varying between 100 and 300 microvolts or even higher. They may be simple, complex (frequently of three-phase morphology) or even very complex and polymorphic. Their duration is between 100 and 300 milliseconds. The successive graphical elements and the intervals between them comprise compound elements with a total duration of between half a second and 20 seconds. (figure 1)

Figure 1. the stereotyped graphical element A is separated from the following one by an interval B. The duration of A (t1) and B (t2) is stable. The repetition interval, characteristic of the periodicity, is the time T, the sum of t1 and t2.

As an EEG sign, it should be noted that periodic activities are only registered in pathological conditions. The duration of the time T and the distribution of periodic activities in the scalp enabled Gaches, [1] in 1971, to produce a classification that is widely used at present: a) Periodic activities of short duration (less than 4 seconds) and of symmetrical and synchronous distribution

Neuro-Physsiological Studdies in Creutzffeldt-Jakob’s Disease D

133

This group basically inclludes: •

• •

s two or thhree-phase grraphical elemeents lasting Creutzzfeldt-Jakob diisease, with steep approx ximately 100-3300 milliseconnds and repeaating at intervaals of 0.7 – 1.5 seconds. (figuree 2). Hepatiic encephalopaathy. Three phhase waves with w a greater frequency of occurrence (2/seco ond) and a disttribution that shows clear prredominance in i the anteriorr areas. Post-an noxic encephaalopathy: its presentation p coonstitutes a raarity and adoppts GPEDS (generaalised periodiic epileptiform m discharges)) morphology or BIPLEDS S (bilateral indepeendent periodicc lateralised eppileptiform diischarges).

Fiigure 2. Characteeristic pattern off Creutzfeldt-Jakkob disease.

b) Periodicc activities of short s duration (less than 4 seeconds) and focal fo or local distribution d •

• •

s herpes: simple graphhic elements, frequently Necrottising encephaalitis due to simple single phase but alsso more compplex of long duration d (1-1..5 seconds) annd with an discharge interrval of 2-4 seconds. (figure 3) 3 inter-d The ph henomenon usually u appearrs in a tempooral area; it may m remain liimited (or) spread secondarily thhroughout thee scalp. milar pattern iss seen for som me days or monnths in cases of o ischemic Excepttionally, a sim acciden nts in the tempporal-parietal--occipital juncction.

d (overr 4 seconds) periodic acttivity with diiffuse and syynchronous c) Long duration diistribution.

1334

J. J.. Ortega-Albáss and A. L. Seerrano-García

The classiccal types of thhis group are inndividualised Radermeckerr complexes inn sub-acute scclerosing paneencephalitis. They T have a veery complex morphology, m duuration of 1 too 3 seconds annd an intervall of 4 to 20 seeconds. The sttereotype founnd in the sam me patient throoughout the reecording is chaaracteristic.

Fiigure 3. Enceph halitis due to siimple herpes. Note N the imagee opposing the phase in the teemporal

reegion of the lefft hemisphere.

C Sub-Ty CJD ypes dic form is mannifested in 84% of cases off the disease. The sporad Genetic sub-types s (G Gerstmann-Strääussler-Scheinnker syndrom me and fataal familial innsomnia) coveer about 10% of o cases and thhose of iatrogenic cause, 3--4% [2]. The new n variety duue to the transsmission of thhe agent causinng bovine spongiform encepphalitis to mann occurs in 3% %. pter we shall make a detailled descriptionn of the findinngs and evoluution of the In this chap EEG in the deevelopment off the sporadicc form of the disease and finish f by com mparing the diifferential aspects of the othher sub-types.

E EEG Evolutiion in Sporaadic CJD and, Gathereforee, subject to vaariations in Cerebral biio-electric activity is a dynaamic process E tim ppearance of passing p patternns that make itt more difficullt to correlate an isolated me and the ap

Neuro-Physsiological Studdies in Creutzffeldt-Jakob’s Disease D

135

reecording with clinical evoluution in certainn processes. This T implies thhe need in succh cases of prractising EEG G recordings inn series, thus making it posssible to comppare the results obtained w the evolutiion of clinicall data. with Adopting the t clinical classification prroposed by May M [3], the most m frequentlyy observed findings in CJD D are: A)

Prodroomic phase

p are accoompanied in the t EEG by The behaviioural and coggnitive disturbbances of this phase n of backgrouund activity inn the theta or delta frequency range, althhough focal a slowing down A them [5], disinterestt and social withdrawal, w sllowing down may also be found [4]. Among afffective and personality chaanges, aggresssive conduct, dysphoria, d anxxiety, insomniia, changes inn the sleep-waaking rhythm, paranoid ideeas and halluccinations have all been deescribed. In geeneral, the dissturbance is diagnosed d and the patients treated t for a depressive d synndrome and thhe EEG’s are altered a in a noon-specific maanner. At the end of this phasee, or at the begginning of thee disease stagee, there may be b periodic diischarges of acute a waves like l those connstituting the typical patterrn, although this t occurs inntermittently or o sporadicallyy. At this timee, the periodicc discharges have h the charaacteristic of beeing triggered d selectively byy afferent stim muli [6], and thhis means thatt repeated stim mulations of a different sign must be usedd when CJD is suspected. The polyso omnographic studies show w early alterattions in the sleep s macro and a microsttructure, such as the absencce of spindles and K compleexes [7,8], deccreased REM sleep until it is almost non n-existent [7,8,9,10] and goood representattion of NREM M sleep phasess III and IV [110]. B)

Dissease phase

Fiigure 4. FIRDA A observed in a caase of moderate uremic encephaalopathy due to acute a renal insuffficiency.

The most characteristic c findings in thhe initial period consist off high voltage sinusoidal deelta activity (100-150 microvolts) m in the form of o rhythmic intermittent outbreaks, prredominantly frontal, and known k as FIR RDA (“frontal intermittent rhythmic r deltaa activity”)

1336

J. J.. Ortega-Albáss and A. L. Seerrano-García

[44,12]. FIRDA A is a non-speecific EEG paattern, the objject of a widde range of pathological prrocesses, whicch range from m their frequeently being obbserved in sysstematic toxicc-metabolic allterations (figu ure 4) to their exceptional apppearance in intracranial i focal lesions [6]]. However, Gloor [11], retrospectively r y analysing the EEG of 36 3 patients with w diffuse enncephalopathy y and post-m mortem histoppathological studies, s showeed a close relationship r beetween the preedominant afffectation of grrey matter andd the preservattion of white matter m with tw wo fundamental EEG patternns: • •

o delta waves,, intermittentlyy presented annd predominanntly frontal Regulaar outbreaks of (FIRDA As); Periodic activity.

onship betweeen cerebral spongiosis, s a characteristicc finding of CJD, and The relatio geeneralised perriodic activityy is interestinng. In 1982, Kuroiwa [122] observed generalised g peeriodic short interval i EEG discharges sim milar to those occurring in CJD in a casee of anoxic enncephalopathy y. The necropssy showed spoongiosis of thee cerebral cortex. In 1994, th he Berlin Neuuropathologicaal Institute in Germany [13] linked the presence p of sppongiosis in cerebral c grey and white matter m in 3 casses of ketoticc hyperglycaemia of the neewborn. As an n example of spongiform encephalopath e y, we show thhe register of a newborn off 19 days of o age with severe secoondary cerebbral affectatioon due to non-ketotic n hyyperglycaemiaa confirmed by an enzymatiic study after a liver biopsyy which was reegistered as eaarly neonatall myoclonic encephalopatthy. During its evolutionn the newborrn showed geeneralised perriodic short innterval activity (figure 5) as a well as tracces of burst-ssuppression chharacteristic of o this disease. He died at 32 3 days of lifee and in the post-mortem p s study, there w signs of diffuse were d cerebraal spongiosis.

Fiigure 5. Trace co orresponding to a 19-day-old new wborn with non--ketotic hyperglyycaemia. Note thhe diffuse peeriodic acute com mplexes of shortt inter-discharge interval.

In the evo olution of the disease (variiable in time), it just becomes possible to discern peeriodic acute wave compleexes, with a two t or three-pphase morphoology, an EEG G pattern a

Neuro-Physsiological Studdies in Creutzffeldt-Jakob’s Disease D

137

feeature of CJD.. The complexxes, comprisinng intermixed points, polypoints and slow w graphical ellements, must be included as a typical findiings. At this point p of evoluttion, the compplexes have thhe characteristtic of being bllocked by the acoustic or noociceptive stim mulations thatt we apply, ass shown in fig gure 6. This behaviour b is wholly w contraryy to what will happen laterr, when the peeriodic activitty will form part p of phase A of the cycclic alternating pattern (CA AP) and be trriggered by thee stimulations.

Fiigure 6. The periiodic acute wavees start to emergge from the backgground activity, being blocked by b the stiimuli, in this casse acoustic (arrow).

Recording number (77.1) Fiigure 7 (Contiinued)

1338

J. J.. Ortega-Albáss and A. L. Seerrano-García

Recording number (77.2)

Recording number (77.3) Fiigure 7.

In full disease stage, thhe periodic coomplexes of acute waves become perm manent and diiffuse. The baackground acttivity, which the periodic activity a interrrupts, also undergoes an evvolutionary prrocess throughhout CJD, as can c be seen inn the followinng EEG sequence (figure 7)), correspondiing to the sam me patient at different d mom ments of the disease d stage. In the first reecording (7.1), the complexxes appear to arise a from a deegraded, delayyed backgrounnd activity. Inn 7.2, the com mplexes are established e altthough it is sttill possible too see some slow waves innterrupting theem. In 7.3, thee complexes are a somewhat more spaced and there is a flattening off the voltage between b them,, with no reacttion to an acouustic stimulus (shout).

Neuro-Physsiological Studdies in Creutzffeldt-Jakob’s Disease D

139

Recordingss (7.2) and (7.3) have identical make up and a calibrationn as (7.1) Topograph hically, the com mplexes show w a voltage graadient with antteroposterior distribution d [114], just like what w occurs inn the majorityy of recordinggs corresponding to encephhalopathies, irrrespective off their aetiology. The expllanation lies in i the greaterr representativvity of the frrontal lobes in scalp EEG reegisters. The Heind denhain variannt progresses clinically wiith cortical bllindness and includes a deescription of the t inversion of the EEG voltage v gradieent with posteerior predominnance [15], allthough this finding f is rarre among othher authors [114]. This highher voltage inn posterior reegions may rem main stable orr become moree diffuse. The EEG below b is of a 68-year-old patient p with Heindenhain H vaariant and shoows a clear prredominance of o the complexxes in posterioor cerebral reggions (Figure 8). 8 During moonitoring of thhe evolution, th he discharge became b generaalised and sym mmetrical. The characcteristic myocllonics of the disease d appearr in this periodd. They are geenerally not reelated in timee with the coomplexes, althhough such a relationship may be estaablished on occcasions. Trau ub and Pedleey [16] indicaated that fusioon of the denndritic membrrane of the afffected neuro ones could result r in incrreased electriical couplingg and a pathhologically syynchronised neuronal dischaarge. p prevennts the sleep phases p being classified in accordance a Destructuriing of sleep patterns w commonly with y accepted parrameters [17].

Fiigure 8. EEG patttern of the Heinndenhain variantt of the disease with w a predominaantly distal distriibution grradient.

1440

J. J.. Ortega-Albáss and A. L. Seerrano-García

At the starrt of the disease stage, it is still possible to see a remiiniscence of REM R sleep: thhe patient is reelaxed with thhe eyes closed and EEG actiivity includes frequencies between b 0.5 annd 4 Hz [18].

Fiigure 9. Theta rh hythmical activitty constituting thhe CAP phase B.

Cyclic Alterna Cy ating Pattern (CAP) The progreessive decreasee in the level of o consciousnness is accomppanied by irrupption of the cyyclic alternatiing pattern (C CAP), which includes a first f phase knnown as phaase A with peermanent disccharge of peeriodic compllexes, a phasse B with sllow theta acttivity (less frrequently in th he delta range)) of noticeablee rhythmicalitty and mid-higgh voltage, duuring which thhe myoclonicss disappear (ffigure 9). Thiis activity is accompanied on the polyggraph by a leessening of th he heart and breathing b rate.. It is then followed by phhase C (not CAP) where thhere is no posssibility of incluusion in the tw wo previous phhases. The evolution of cyclicaal variations beetween two phhases can be observed o here:: a phase A chharacterised by b sustained discharge d of periodic p complexes, and a phase p B wherre the theta annd delta activiity is rhythmiccal (figure 10). In phase A the patient experiences e a behavioural situation s of arrousal, keepinng the eyes oppen with ocular movemeents, musculaar hypertoniaa and the presence of myoclonics m chharacteristic of o CJD. At thiss moment of evolution, e the periodic compplexes includeed in phase A are selectivelly triggered byy the stimuli we w apply. The second shows a transitory decrease d in thhe degree of arrousal: eyes cllosed, hypotonnia and occasional apnoeas and hypopnoeeas. Figure 11 a CAP cycle where w phase B gives way to phase A. In phase B, B the patient, a 70-year-old male with CJJD, showed a behavioural situation s of akkinesis, with closed c eyes, brradycardia and progressive bradypnea, which w gave waay to a long laasting apnea th hat caused a faall in arterial saturation s of oxygen o (measuured by pulsoxximetry) to vaalues of 30-40 0%. This gavee way immediaately to a phase A in whichh the patient had his eyes oppen, there waas tachycardiaa, tachypnoea,, muscular hyypertonia (visiible on channnels 20 and 21), profuse sw weating and boody movementts. Myoclonicss were not obsserved.

Neuro-Physsiological Studdies in Creutzffeldt-Jakob’s Disease D

PHASE EA

P PHASE B

141

PHASE EA

Fiigure 10. The co ombination of a phase p A and a phhase B comprisees a CAP cycle. The T analysis tim me is one m minute so as to bee able to observee the CAP graphiically.

The CAP is an ultradiann rhythm whichh, under physiological condditions, forms part of the noon-REM sleep p micro-structuure. It is charaacterised by trransitory electrrical sequencees of events (sspindles, K complexes, deltaa waves) that are different from f the backgground EEG activity a and arre repeated at intervals of upp to 1 minute [19]. ht that the CA AP is formed as a result off the interaction between thhe cerebral It is though coortex and various brainstem m structures [220]. In CJD, ass well as in cooma, the CAP is directed toowards controlling autonom mic functions such as breathhing, heart ratte and blood pressure p to avvoid an anarch hical and chaootic deregulatioon of vital connstants [ 21]. The ratio of o CAP and non-CAP sequences increasees in proportion to worseniing clinical coonditions and d dysfunction of physiologgical sleep which, w as of that time, beecomes the m modulator of th he states of aleertness and aroousal. (figure 12) 1 CAP has allso been descrribed in macaccus rhesus inooculated with Kuru K [22].

C) Terminal Phase P When arou usal modulatioon becomes im mpossible, thee CAP drops suddenly s and heralds the diisappearance of o periodic disscharges and myoclonias. m H However, the typical t compleex periodic paattern reappeaars spontaneously or is indduced by senssorial stimuli and is accom mpanied by inncreased musccle tone, a reaappearance off the myoclonnias and acceleration of thee pulse and brreathing rate.

1442

J. J.. Ortega-Albáss and A. L. Seerrano-García

Fiigure 11. Analyssis time: 1 minutte. Phase B, com mprising harmoniic theta frequenccies, gives way to t phase A, w periodic com with mplex dischargess. Note that the beginning b of the phase A is indiccated by an increease in the m muscular tone in channels c 20 (EM MG of the deltoidd muscles) and 21 2 (EMG of the anterior a tibial muscle). m

Fiigure 12. With an analysis time of o 5 minutes, thee recurrent CAP sequences can be b seen in a patieent with CJD inn the disease stag ge.

Neuro-Physiological Studies in Creutzfeldt-Jakob’s Disease

143

The EEG finally evolves towards the disappearance of periodic complexes and levelling off of electro-cortical activity, with which the loss of coordination between arousal and somatic-vegetative activities leads to the onset of uncontrolled cardio-respiratory hyperactivity that warns of impending death [23]. Other EEG signs described in this stage are non-reactive slow waves and the alpha coma pattern [24].

Unusual EEG Findings in Sporadic CJD The description of cases of sporadic CJD that, in their initial stage, are expressed as periodic lateralised epileptiform discharges (PLEDs) is significant. It has been suggested that the occurrence of PLEDs may reflect an early stage of the disease, when the progress through the commissural fibres has not yet led to a diffuse cortical disease [25, 26, 27]. Wieser [14] prefers to call this pattern PLED-like or periodic activity of acute lateralised waves, given its morphological similarity. He, however, defends that these are not genuine PLEDs for the following reasons: •

• •

PLEDs are a transitory EEG phenomenon that typically decrease their amplitude and repetition frequency in the course of the disease and which normally disappear 2 weeks after the injury [28]. They are often associated with epileptic crises, which does not normally occur in sporadic CJD. They are not influenced by sleep or external manipulations such as administering sedative medication. In our experience, they do not even disappear after the provocation of an isoelectric EEG by the intravenous administration of propofol. On the other hand, the periodic discharges of CJD can be attenuated by benzodiazepines [29]. The origin and physiopathology of PLEDs is not known, although an acute structural injury lesion or a subjacent metabolic process seems to lead to a dysafferentation of the cerebral cortex. Gloor’s neuropathological study [11] and Raroque and Purdy’s functional study [30] had already shown the importance of the affectation of subcortical grey matter in correlation with PLEDs, and this probably explains their inalterability when propofol, midazolam or diazepam are administered.

In recent years, several works have been published presenting epileptic crises in the prodromic phase of CJD; an infrequent occurrence in this phase and less so in later phases, where it reaches 21% for some authors [31], who describe complex partial epileptic status [32], non-convulsive epileptic status [33, 34], convulsive generalised epileptic status [35] and continuous partial epilepsy [36, 37, 38]. For Wieser [14], some cases may be periodic complex discharges rather than an authentic epileptiform activity, because the EEG response to anti-epileptic drugs is not sufficient to conclude that the periodic discharges represent correlation of the crisis, especially if it is not accompanied by a change in the mental status of the patient. Moreover, epileptiform activity is temporarily related to clinical motor signs, whereas in CJD, the myoclonia may be present before, during and after the periodic complexes.

1444

J. J.. Ortega-Albáss and A. L. Seerrano-García

On the otheer hand, lateraalised or focall abnormalities of the perioddic activity maay reflect a suubjacent neuro ological deficcit, without thhis inducing an erroneous diagnosis. d Cam mbier et al [339] demonstraated that, in 8 cases of spooradic CJD, thhe focal or latteralised findiings on the EEG were corrrelated with neeurological deeficit signs andd with alteratioons in the FLA AIR NMR. w in an evoolved diseasee stage and This is shown in figure 13.. In this casee the patient was o brachial preedominance. prresented right hemiparesis of

Fiigure 13. The peeriodic acute wavves are better reppresented in the left hemisphere.. A 69-year old patient p with rigght hemiparesis.. Analysis time: 15 seconds.

E EEG in the Other O CJD Sub-Types Iaatrogenic Creeutzfeldt-Jakoob Disease EEG findin ngs in the iattrogenic form m, due to the inoculation of the transmisssible CJD aggent (PrPSc), either by caddaveric dura mater m grafts or o contaminatted deep elecctrodes, are siimilar to those observed inn the sporadicc form [14]. However, H it has h been repoorted that a paatient develop ped the diseasse 14 years affter he was giiven a dura mater m transplannt [40] and thhat, in the earlliest stages off the disease, he presented more restrictiive EEGs in thhe infected arrea even thou ugh, in time, it i developed the t typical patttern. Bernoullli [41] and Wieser W [29] prresent the evo olution of 2 paatients contam minated with deeep electrodess, from progreessive focal sllowing down at the point of infection, to generaliseed periodic diischarges and, finally, a deecrease in the amplitude andd dispersion of o the dischargge.

Neuro-Physiological Studies in Creutzfeldt-Jakob’s Disease

145

Genetic Creutzfeldt-Jakob Disease The typical periodic acute complexes only occur in 10% of cases [42], being more frequent in the familial form than in Gerstmann-Sträussler-Scheinker syndrome or in fatal familial insomnia. New Variant of Creutzfeldt-Jakob Disease (vCJD) The absence of the classic EEG trace is considered a diagnostic criterion of the new variant (class III-A criterion in the revision of the World Health Organisation for defining cases of the new variant) [43]. Two reports have recently been published of cases of vCJD which showed a typical periodic EEG pattern in the terminal stage. The authors mention the possibility of the classic pattern in advanced stages of the disease in cases with a long survival period [44, 45].

2. ELECTRORETINOGRAM (ERG) It is of interest to evaluate the ERG in CJD as degeneration of the retina has been observed in scrapie-infected sheep [46] and there is also evidence of the replication of the infective agent in the retina of inoculated laboratory animals [47]. De Seze et al [48] obtained an ERG with photopic and scotopic flash in 19 patients with iatrogenic and sporadic CJD and made special mention of an early decrease in the amplitude of the b1 wave, with an abnormal b/a ratio of less than 2. There are records of an anatamopathological study having been carried out on three of these 19 patients, with very important findings. Spongiform changes were observed in the external plexiform layer and there was also an increase of the cytoplasm volume of the Müller cells. This could justify both the affectation of the b wave of the ERG (generated in the Müller cells) and the decrease in the b/a ratio, suggesting postsynaptic topography of the retinal involvement. There is also an earlier work [49], presenting similar results. In this case, apart from the reduction in the b1 wave, the a and b waves of the ERG underwent a progressive delay with eventual extinction of the b wave. In contrast, other studies have been published with normal ERGs [50], even in the case of a patient in an advanced phase of the disease [51].

3. EVOKED VISUAL POTENTIALS (FLASH-EVP) Visual anomalies in CJD are unspecific, especially in cases associated with a slight neurological deterioration where an ophthalmologic clinical examination is usual. Nevertheless, inter or supra-nuclear oculomotor paresis, visual agnosis, palinopsia, hemianopsia, Heidenhain-type cortical blindness and defective ocular convergence have been detected. De Seze et al [48] showed a statistically significant increase in the amplitude of flash-EVP in 15 of 20 patients with definitive or probable CJD where the 15 patients presented myoclonias. This fact, which could also be observed previously [52,53], is comparable to the giant somatosensory evoked potentials in the cortical myoclonus. In a recent work carried out on a long series of patients, Visani et al [54] obtained large or gigantic visual responses (amplitude N1-P2>60 microvolts) in 8 of 20 cases of CJD studied. Of these, seven presented a prominent and almost continuous pattern or periodic EEG.

146

J. J. Ortega-Albás and A. L. Serrano-García

However, Richard et al [49] obtained the opposite results. They monitored two children with iatrogenic CJD with flash-EVP after treatment with growth hormone. The amplitudes of the EVP remained normal but the morphology progressively degraded and the latencies presented a gradual delay. We had the opportunity to carry out flash-ERG (white and red light in scotopic conditions) and flash-EVP on a patient with the Heindenhain variant of CJD in the disease stage. In our case, the morphology, amplitude and latency of the fundamental components did not differ from those obtained in the control group (figures 14 and 15).

Figure 14. Normal ERG: maximum scotopic response and cone response.

Figure 15. Normal evoked visual potentials after flash stimulus. Nomenclature in accordance with Ciganek [55].

Neuro-Physiological Studies in Creutzfeldt-Jakob’s Disease

147

There has likewise been a series of studies claiming that the periodic discharges of CJD are either due to an excessively long refractory period of the cortical neurones, or to an abnormal sub-cortical pacemaker with loss of the inhibition mechanisms of the cortex [56,57]. Fukui et al [53] developed a special technique with a register of EVP whose flash stimulus was triggered by each periodic complex. This enabled them to demonstrate the nonexistence of any interaction between the periodic complexes, thus implying an absence of any refractoriness associated with the discharges. On the other hand, repeated stimulation with the flash produced a decrease in the amplitude of the discharges; a fact undoubtedly related to the decrease of the alertness, rather than to interference between the mechanisms for generating the flash-EVP and those of the periodic complexes. This fact is also conflictive, as Visani et al [54] have related prominent spontaneous periodic paroxysms with giant flash-EVP, suggesting that both are due to a common hyperexcitabilty that favours neuronal synchronisation.

4. BRAINSTEM AUDITORY EVOKED POTENTIALS (BAEPS) In this section we also find few references to the practice of BAEP in CJD patients. There are some cases in which no response alteration occurs, as they remain within absolute normality [50]. However, in evolutive monitoring of three cases of CJD, there was progressive deterioration in the responses. This implied a lengthening of the inter-peak intervals and an abnormal morphology in the BAEP waves in the disease stage period, which the authors related to late brainstem affectation in the course of the disease [58].

5. MOTOR EVOKED POTENTIALS (MEP) A study using MEP allows an evaluation to be made of the pyramidal pathways of CJD. The different studies published reflect an increase in the cortical excitability threshold and low amplitude MEPs [59]. Regarding the high excitability threshold, doubt still remains about whether these results were modified by administering benzodiazepines, as, because of the psychomotor hyperactivity that CJD patients usually present in the disease stage, it has been impossible to obtain the same results in the absence of prior medication.The low amplitude MEP suggests either degeneration or functional alteration of the upper and lower motor neurones, or the affect of both. The intensity of the main symptoms of CJD would appear to be related to the degree of affectation of the potentials. However, the Central Conduction Time (CCT) is normal, a fact that is in agreement with the scant representation that demyelination has in the pathogenics of CJD. In a recent study carried out on 4 patients with the sporadic form of the disease, Sakuishi et al [60] seemed to establish a relationship between excitability changes in the motor cortex and periodic complex discharges in the EEG, on observing that the MEP have a greater amplitude as the next periodic complex discharge approaches. It is, however, difficult to exclude the contribution of spinal cord excitability to the amplitude of MEP. However, these findings could be related to the previously mentioned cases of periodic unilateral discharges

148

J. J. Ortega-Albás and A. L. Serrano-García

that accompany the motor deficit. Similarly, they would be fit in with the concept of cortical excitability being significantly increased in CJD. The persistence of the F wave may be low, possibly because it appears together with a functional increase of the excitability threshold, although anatamopathological studies have observed gliosis and spongiosis of the motor neurones of the anterior medullary horn [61].

6. SOMATOSENSORY EVOKED POTENTIALS (SEP) Cases of CJD have also been published with short normal latency SEP [52]. From some patients, giant cortical SEPs were obtained with normal latencies, [61] suggesting a functional alteration in the inhibitory mechanisms of the synapse that is established in the somatosensory route. In a recent study carried out on 8 patients with CJD [62], the authors established correlation between the EEG and SEPs. The latter were preserved until the advanced phases of the disease in spite of severe abnormalities being found in the EEG. Giant cortical components were observed in intermediate phases and it was concluded that the inhibitory system is the first to be altered. In later phases, there is a reduction in the amplitude of the cortical N20 and, finally, a delay in its latency as a manifestation of the late affectation of the white matter.The technique of SEP recovery following paired stimulus, which may be useful in measuring the excitability of the CNS [63], provides undefined results, with increased [64] or reduced [61] excitability of the somesthetic cortex.

7. BLINK REFLEX In regard to the blink reflex, it is interesting to note a selective alteration of the R1 component described in two patients with iatrogenic CJD [49], which could be related to an affectation of the nucleus of the fifth cranial pair and its connection with the eighth pair. This would imply damage to the upper pontine nucleus, although the mid pontine structures remain undamaged.

CONCLUSION The EEG is an element of major importance in CJD even though its evolutionary changes, linked to each of the different clinical phases of the disease, make it necessary to consider the appearance of other basic EEG patterns. An isolated EEG or performing several EEGs over a long period of time should not be considered definitive or exclusive, and for this reason we have to insist on carrying out recordings in series and on paying special attention to the polygraphic changes related to variations in the degree of consciousness and also to the extreme care taken when applying stimuli. Polysomnographic studies, especially those carried out in the early stages of clinical suspicion, may also be of great help.

Neuro-Physiological Studies in Creutzfeldt-Jakob’s Disease

149

Lastly, the findings described with the use of other neurophysiological techniques, although not yet free from controversy, provide added interest to the study of this enigmatic disease.

REFERENCES [1] [2]

[3] [4]

[5]

[6] [7] [8]

[9]

[10]

[11]

[12]

[13] [14] [15]

Gaches J. Les activités périodiques en EEG. Rev. EEG Neurophysiol. 1971, 1: 9-33. Ladogana A, Puopolo M, Croes EA, Budka H, Jarius C et al. Mortality from Creutzfeldt-Jakob disease and related disorders in Europe, Australia and Canada. Neurology. 2005; 64:1586-91 May WW. Creutzfeldt-Jakob disease . I. Survey of the literature and clinical diagnosis. Acta Neurol. Scand. 1968, 44: 1-32. Hansen HC, Zschocke S, Stürenburg HJ, Kunze K. Clinical changes and EEG patterns preceding the onset of periodic sharp wave complexes in Creutzfeldt-Jakob disease. Acta Neurol. Scand. 1998: 99-106. Boesenberg C, Scultz-Schaffer WJ, Meissner B, Kallemberg K, Barti M, Heinemann U, Krasniaski A, Stoeck K, Varges D, Windl O, Ketrzschmar HA, Path FR and Zerr I. Clinical course in young patients with sporadic Creutzfeldt-Jakob disease. Ann. Neurol. 2005; 58: 533-43. Niedermeyer E, Lopes Da Silva F. Electroencephalography. Basic principles, clinical applications and related fields, 3nd edn. Baltimore: Williams and Wilkins 1993. Bassetti C, Mathis J, Achermann P, Roth C, Tobler I, Hess CW. Sleep abnormalities in two patients with Creutzfeldt-Jakob disease. J. Sleep. Res. 1998; (Suppl 2): 17. Carpizo MR, Fernández J, Polo J, Calleja J, Fernández R. Creutzfeldt- Jakob disease in Cantabria (Spain). A serial polygraphic study in twelve patients. J. Sleep Res. 1998; (Suppl 2): 39. Donnet A, Farnarier G, Gambarelli D, Aguglia U, Regis H. Sleep elec troencephalogram at the early state of Creutzfeldt-Jakob disease. Clin. Electroencephalogram. 1992; 23: 118-25. Bortone E, Bettoni L, Giorgi C, Terzano MG, Trabattoni GR, Mancia D. Reliability of EEG in the diagnosis of Creutzfeldt-Jakob disease. Electroencephalogr. Clin. Neurophysiol. 1994; 90: 323-30. Gloor P, Kalabay O, Giard N. The electroencephalogram in difusse Encephalopathies: electroencephalographic correlates of grey and white matter lesions. Brain. 1968, vol 91, 779-802. Kuroiwa Y, Celesia CG, Chung HD. Periodic EEG discharges and status spongiosus of the cerebral cortex in anoxic encephalopathy: a necropsy case report. J. Neurol. Neurosurg. Psychiatry. 1982; 45: 740-2 Prosenc N, Stoltenburg-Didinger G. Spongy encephalopathy in ketotic hyperglicinemia. Brain Dev. 1994; 16 (6): 445-9. Wieser HG, Schindler K, Zumsteg D. EEG in Creutzfeldt-Jakob disease. Clin. Neurophysiol. 2006; 24: 1-17. Furlan AJ, Henry CE, Sweeney PJ, Mitsumoto H. Focal EEG abnormalities in Heindenheim variant of Creutzfeldt-Jakob disease. Arch. Neurol. 1981; 38: 312-4.

150

J. J. Ortega-Albás and A. L. Serrano-García

[16] Traub RD, Pedley TA. Virus induced electrotonic coupling: hypothesis on the mechanism of periodic EEG discharges in Creutzfeld- Jakob disease. Ann. Neurol. 1981; 10: 405-10. [17] Rechtschaffen A, Kales A, eds. A manual for standardized terminology, technique and scoring for sleep stages of human subjects. Los Angeles: Brain Information Service/Brain Research Institute; 1968. [18] Terzano MG, Parrino L, Pietrini V, Mancia D, Spaggiari MC, Rossi G et al. Precocious loss of physiological sleep in a case of Creutzfeldt- Jakob disease: a serial polygraphic study. Sleep. 1995; 18: 849-58. [19] Terzano MG, Parrrino L, Sherieri A, Chervin R, Chokroverty S et al. Atlas, rules, and recording techniques for the scoring of cyclic alternanting pattern (CAP) in human sleep. Sleep med. 2001; 2: 537-553. [20] Terzano MG, Mancia D, Salati MR, Costani G, Decembrino A, Padrino L. The cyclic alternating pattern as a physiologic component of normal NREM sleep. Sleep. 1985; 8: 137-45. [21] Terzano MG, Mancia D, Manzoni GC. Periodic activities in Creutzfeldt- Jakob disease and epilepsy. In Alan RL, ed. Epilepsy: an update on research and therapy. New York; 1983. p. 199-226. [22] Bert J, Vuillon-Cacciuttolo G, Balzamo E, de Micco P, Gambarelli D, Tamalet J., et al. Experimental Kuru in the rhesus monkey: a study of EEG modifications in the waking state and during sleep. Electroenceph. Clin. Neurophysiol. 1978, 42: 611-620 [23] Terzano MG, Parrino L, Pietrini V, Mancia D, Spaggiari MC, Rossi G et al. Precocious loss of physiological sleep in a case of Creutzfeld Jakob disease: a serial polygraphic study. Sleep. 1995, 18 (10): 849-858. [24] Asai Y, Shimoda M, Sasaki K, Nakayasu H, Takeshima T et al. Alpha-like activity in terminal stage of Creutzfeldt-Jakob disease. Acta Neurol. Scand. 2001; 104: 118-22 [25] Heye N Cervos-Navarro J; Focal involvement and lateralization in Creutzfeldt-Jakob disease: correlation of clinical, electroencephalographic and neuropathologic findings. Eur. Neurol. 1992; 32: 289-292. [26] Primavera A, Tabaton M, Leonardi A; Periodic lateralized discharges in CreutzfeldtJakob disease: serial electroencephalographic studies. Rev. Electroencephalogr. Neurophysiol. Clin. 1984. 13: 379-82. [27] Steinhoff BJ, Racker S, Herrendorf G, Poser S, Grosche S et al. Accuracy and reliability of periodic sharp wave complexes (PSWC) in Creutzfeldt-Jakob disease. Arch. Neurol. 1996; 53: 162-66. [28] Westmoreland BF, Klass DW, Sharbrough FW. Chronic periodic lateralized epileptiform discharges. Arch. Neurol. 1986; 43: 494-6. [29] Wieser HG, Schwarz U, Blättler T, Bernoulli C, Sitzler M, Stoeck K, Glatzel M. Serial EEG findings in sporadic and iatrogenic Creutzfeldt-Jakob disease. Clin. Neurophysiol. 2004; 115: 2467-78. [30] Raroque HG, Purdy P. Lesion localization in periodic lateralized epileptiform discharges: gray or white matter. Epilepsia. 1995; 36 (1): 58-62. [31] Cokgor I, Rozear M, Morgenlander JC. Seizures and Creutzfeldt-Jakob disease. A case report and series review. N. C. Med. J. 1999; 2: 108-9.

Neuro-Physiological Studies in Creutzfeldt-Jakob’s Disease

151

[32] Rees JH, Smith SJ, Kullmann DM, Hirsch NP, Howard RS. Creutzfeldt-Jakob disease presenting as complex partial status epilepticus: a report of two cases. J. Neurol. Neurosurg. 1999; 66: 406-407. [33] Cohen D, Kutluay E, Edwards J, Peltier A, Beydoun A. Sporadic Creutzfeldt-Jakob disease presenting with nonconvulsive status epilepticus. Epilepsy Behav. 2004; 5 (5): 792-6. [34] Fernandez-Torre JL, Solar DM, Astudillo A, Cereceda R, Acebes A, Calatayud MT. Creutzfeldt-Jakob disease and non-convulsive status epilepticus: a clinical and followup study. Clin. Neurophysiol. 2004; 115: 316-319. [35] Neufeld MY, Talianski-Aronov A, Soffer D, Koreczyn AD. Generalized convulsive status epilepticus in Creutzfeldt-Jakob disease. Seizure. 2003; 12 (6): 403-5. [36] Donmez D, Cakmur R, Men S, Oztura I, Kitis A. Coexistence of movement disorders and epilepsia partialis continua as the initial signs in probable Creutzfeldt-Jakob disease. Mov. Disord. 2005; 20 (9): 1220-3. [37] Parry J, Tuch P, Knezevic W, Fabian V. Creutzfeldt-Jakob syndrome presenting as epilepsia partialis continua. J. Clin. Neurosci. 2001; 8 (3): 266-8. [38] Lee K, Haight E, Olejniczak O. Epilepsia partialis continua in Creutzfeldt-Jakob disease. Act. Neurol. Scand. 2000; 102 (6): 398-402. [39] Cambier DM, Kantarci K, Worrel GA, Westmoreland BF, Aksamit AJ. Lateralized and focal clinical, EEG, and FLAIR MRI abnormalities in Creutzfeldt-Jakob disease. Clin. Neurophysiol. 2003; 114: 1724-8. [40] Fushimi M, Sato K, Shimizu T, Hadeishi H. PLEDs in Creutzfeldt-Jakob disease following a cadaveric dural graft. Clin. Neurophysiol. 2002; 113: 1030-5. [41] Bernouilli C, Siegfried J, Baumgarter G, Regli F, Rabinowicz T et al. Danger of accidental person-to-person transmission of Creutzfeldt-Jakob disease by surgery. Lancet 1977; 26: 478-9. [42] Kovacs GG, Puopolo M, Ladogana A, Pochiari M, Budka H. Genetic prion disease: the EUROCJD experience. Hum. Genet. 2005; 118 (2): 166-74. [43] Wordl Health Organization. The revision of the surveillance case definition for variant Creutzfeldt-Jakob disease (vCJD). Report of a WHO consultation Edinburg, United Kingdom; 17 May 2001. http://www.who.int/csr/resources [44] Binelli S, Agazzi P, Giaccone G, Will RG, Bugiani O Franceschetti S, Tagliavini F. Periodic electroencephalogram complexes in a patient with variant Creutzfeldt-Jakob disease. Ann. Neurol. 2006; 59 (2): 423-7. [45] Yamada M. Variant CDJ group Creutzfeldt Jakob disease Surveillance Committee, Japan. The first Japonese case of variant CDJ showing periodic EEG. Lancet. 2006; 367 (9513): 874. [46] Barnett KC, Palmer AC. Retinopathy in sheep affected with natural scrapie. Res. Vet. Sci. 1971; 12: 383-5. [47] Hogan RN, Kingsbury DT, Baringer JR, Prusiner SB. Retinal degeneration in experimental Creutzfeldt-Jakob disease. Lab. Invest. 1983; 49: 708-15. [48] De Seze J, Hache JC, Vermersch P, Arndt CF, Maurage CA, Pasquier F et al. Creutzfeldt-Jakob disease: neurophysiologic visual impairments. Neurology. 1998; 51: 962-7.

152

J. J. Ortega-Albás and A. L. Serrano-García

[49] Richard P, Renault F, Ostré C, Auzoux-Chevé M. Neurophysiological follow-up in two children with Creutzfeldt-Jakob disease after human growth hormone treatment. Electroenceph. Clin. Neurophysiol. 1994; 91: 100-7. [50] Tsutsui J, Kawashima S, Kajikawa I, Shirabe T, Terao A. Electrophysiological and pathological studies on Creutzfeldt-Jakob disease. Doc. Ophthalmol. 1986; 63: 13-21. [51] Aguglia U, Gambarelli D, Farnarier G, Quattrone A. Different susceptibilities of the geniculate and extrageniculatevisual pathways to human Creutzfeldt-Jakob disease (a combined neurophysiological-neuropathological study). Electroenceph. Clin. Neurophysiol. 1991; 78: 413-23. [52] Aguglia U, Farnarier G, Regis H, Oliveri RL, Quattrone A. Sensory evoked potentials in Creutzfeldt-Jakob disease. Eur. Neurol. 1990; 30: 157-61. [53] Fukui R, Tobimatsu S, Kato M. Periodic synchronus discharges and visual evoked potentials in Creutzfeldt-Jakob disease: PSD-triggered flash PEV. Electroenceph. Clin. Neurophysiol. 1994; 90: 433-7. [54] Visani E, Agazzi P, Scaioli V, Giaccone G, Binelli S et al. FVEPs in Creutzfeldt-Jakob disease: waveforms and interaction with the periodic EEG pattern assessed by single sweep analysis. Clin. Neurophysiol. 2005, 116 (4): 895-904. [55] Ciganek L, The EEG response (evoked potential) to light stimulus in man. Electroenceph. Clin. Neurophysiol. 1961; 13: 163-72. [56] Lee RG, Blair RDG. Evolution of EEG and visual evoked response changes in Creutzfeldt-Jakob disease. Electroenceph. Clin. Neurophysiol. 1973; 35: 133-42. [57] Rossini PM, Caltagirone C, David P, Machi G. Jakob-Creutzfeldt disease: analisis of EEG and evoked potentials under basal condition and neuroactive drugs. Eur. Neurol. 1979; 18: 269-79. [58] Pollak L, Giladi R, Kertesz J, Arlazoroff A. Progressive deterioration of brainstem auditory evoked potentials in Creutzfeldt-Jakob disease: clinical and electroencephalographic correlation. Clin. Electroencephalogr. 1996; 27: 95-9. [59] Wochnik-Dyjas D, Niewiadomska M, Kulczycki J, Lojkowska W, Niedzielsa K, Glazowski C et al. Motor evoked potential studies in Creutzfeldt-Jakob disease. Clin. Neurophysiol. 2000; 111: 1687-94. [60] Sakuishi K, Hanajima R, Kanazawa I, Ugawa Y. Periodic motor cortical excitability changes associated with PSDs of EEG in Creutzfeldt-Jakob disease. (CJD). Clin. Neurophysiol. 2005; 116 (5): 1222-26 [61] Matsunaga K, Uozomi T, Akamatsu N, Nagashio Y, Qingrui L, Hashimoto T et al. Negative myoclonus in Creutzfeldt-Jakob disease. Clin. Neurophysiol. 2000; 111: 4716. [62] Shiga Y, Seki H, Onuma A, Shimizu H, Itoyama Y. Decrement of N20 amplitude of the median nerve somatosensory evoked potential in Creutzfeldt-Jakob disease patients. J. Clin. Neurophysiol. 2001; 18: 576-82. [63] Ugawa Y, Genba K, Shimpo T, Mannen T. Somatosensory evoked potential recovery (SEP-R) in myoclonic patients. Electroencephalogr. Clin. Neurophysiol. 1991; 80: 215. [64] Yokota T, Yoshino A, Hirashima F, Komori T, Miyatake T. Increased central motor tract excitability in Creutzfeldt-Jakob disease. J. Neurol. Sci. 1994; 123: 33-7.

In: Brain Mapping and Diseases Ed: Diane E. Spinelle

ISBN: 978-1-61122-065-0 © 2011 Nova Science Publishers, Inc.

Chapter 8

NEUROFILAMENT PROTEINS IN BRAIN DISEASES Olivier Braissant∗ Clinical Chemistry Laboratory, University Hospital of Lausanne, Switzerland

ABSTRACT Neurofilaments are the main components of intermediate filaments in neurons, and are expressed under three different subunit proteins, NFL, NFM and NFH. Neurofilaments act with microtubules and microfilaments to form and maintain the neuronal structure and cell shape. Phosphorylation is the main post-translational modification of neurofilaments, which influences their polymerization and depolymerization, and is responsible for their correct assembly, transport, organization and function in the neuronal process. In particular, phosphorylation is essential for the repulsion of the neurofilament polymers in axons, which determines the axonal diameter and the velocity of electrical conduction. The phosphorylation state of neurofilaments is regulated in a complex manner, including interactions with the neighbouring glial cells. Abnormal expression, accumulation or post-translational modifications of neurofilament proteins are found in an increasing number of described neurological diseases, such as amyotrophic lateral sclerosis, Parkinson’s, Alzheimer’s and CharcotMarie-Tooth diseases, or giant axonal neuropathy. Some of these diseases are associated with mutations discovered in the neurofilament genes. Recently, altered expression and phosphorylation states of neurofilament proteins have also been shown in metabolic diseases affecting the central nervous system either during development or in adulthood, such as hepatic encephalopathy due to hyperammonemia, methylmalonic and propionic acidemias, and diabetic neuropathy. Finally, accumulation of neurofilament proteins in the cerebrospinal fluid has been described as discriminating marker for patients with multiple sclerosis, and as predictor of long-term outcome after cardiac arrest. This review will focus on the most recent investigations on neurofilament proteins in

∗

Correspondence to: Olivier Braissant. Clinical Chemistry Laboratory, University Hospital of Lausanne, CH-1011 Lausanne, Switzerland; Tél: (+41.21) 314.41.52; Fax: (+41.21) 314.35.46; e-mail: [email protected]

154

Olivier Braissant neurodegenerative, neurodevelopmental and metabolic diseases, as well as on the use of neurofilaments as markers of diseases.

Keywords: Neurofilaments, phosphorylation, neurodegenerative diseases, metabolic diseases, neurodevelopmental diseases, axon.

INTRODUCTION Three types of filament proteins compose the cellular cytoskeleton: microtubules (Ø: ~25 nm), microfilaments (Ø: ~7 nm) and intermediate filaments (IFs; Ø: ~10 nm). Microtubules are essentially made of tubulin, and are involved in maintaining cell shape, in mitosis (formation of spindle fibers) and in the mouvement of organelles or vesicles. Actin is the main component of microfilaments, which are responsible for cell movements, muscular contraction, cytokinesis, mechanical strength, and, more specifically in CNS, axonal outgrowth and synaptic plasticity. Depending of the cell identity, a greater variety of proteins are found in IFs, which are prominent in cells that must withstand important mechanical stress, and are classified in five different types. The most important IFs in neurons are neurofilaments (NFs), which belong to type IV IFs and are exclusively neuronal. NFs establish an extremely stable tubular system of the neuronal cytoskeleton, having a 10 nm diameter. While NFs have been identified as structures since more than 100 years with the discovery of the silver staining technique, their precise roles in neuronal cytoskeleton have remained elusive until recently. NFs are heteropolymers made of 3 different subunits: light (NFL), medium (NFM) and heavy (NFH) chain neurofilaments (Figure 1). These subunits assemble in a filamentous structure composing the main part of the axonal cytoskeleton. NFs interact with neighbouring cellular structures or other elements of the cytoskeleton through side arms protruding ouside of their filamentous structure. Their assembly in heteropolymers, as well as their interactions with neighbouring cellular structures, are regulated by post-translational modifications, from which the most important is phosphorylation, occuring in their head and side arms domains (Figure 1). Part of these post-translational modifications of NFs are regulated by glial cells in axonal vicinity. NFs participate to the rigidity of the axon, to its tensile strength, and to the regulation of axonal calibre. In that sense, NFs are essential to the formation and maintenance of the neuronal cell shape, and particularly of the axon, a structure with a diameter of 1 to 25 µm extending sometimes 100'000 times farther (1 m or more) than the neuronal cell body (10 to 50 µm in diameter). NFs also participate to the transport guidance of organelles and particles along the axon. These last years, an increasing list of human brain diseases have been associated with NFs proteins. NFs proteins per se can be altered, either by mutations in their genes, or by alteration of their post-translational modifications, and particularly their phosphorylation state. The abnormal accumulation of neurofilaments have been observed in many neurodegenerative diseases, including Parkinson’s disease (PD), amyotrophic lateral sclerosis (ALS), Alzheimer’s disease (AD) or Charcot-Marie-Tooth (CMT) disease. More recently, altered expression and phosphorylation states of NFs have also been shown in metabolic diseases affecting the central nervous system either during development or in adulthood, such as hepatic encephalopathy due to hyperammonemia, methylmalonic and propionic acidemias, and diabetic neuropathy. Finally, the extracellular release of NFs proteins, due to axonal

Neurofilament Proteins in Brain Diseases

155

mechanical break-down or damage, and their accumulation in the cerebrospinal fluid can be followed as discriminating markers for patients with multiple sclerosis, and as predictor of long-term outcome after cardiac arrest. This review will discuss NFs proteins expression and assembly in filamentous tubular structures, as well as their post-translational modifications. Focus will be made on the most recent NFs investigations in neurodegenerative, neurodevelopmental and metabolic diseases, and on the use of NFs as markers of diseases.

Figure 1. Schematic representation of human NFL, NFM and NFH proteins. Head, rod (α-helical coils) and side arms domains are indicated, as well as phosphorylation (including on KSP repeats) and glycosylation sites.

NEUROFILAMENT PROTEINS NFs, as peripherin, α-internexin and nestin, belong to type IV IFs, with which they share common sequence structures. Three NF subunits contribute to the assembly of neurofilaments: Light (NFL), medium (NFM) and heavy (NFH) chain NFs (Figure 1). Human NFL is encoded by the NEFL gene located on chromosome 8 (8p21) and consists of 544 amino acids. Human NFM is encoded by the NEFM gene also located on chromosome 8 (8p21) and consists of 916 amino acids. Human NFH is encoded by the NEFH gene located on chromosome 22 (22q12.2) and consists of 1020 amino acids. NFL, NFM and NFH have a molecular weight of 60, 100 and 110 kDa respectively, calculated on their amino acid sequence; however, due to important posttranslational modifications (i.e. phophorylation and glycosylation), NFL, NFM and NFH exhibit higher molecular weight on SDS-PAGE: 68 kDA, 160 kDa and 205 kDa respectively (for reviews, see: Lee and Cleveland, 1996; Parry and Steinert, 1999b; Al-Chalabi and Miller, 2003; Liu et al., 2004; Lariviere and Julien, 2004).

156

Olivier Braissant

NFs are exclusively expressed by neurons. IFs, including NFs, are expressed differentially during CNS development and maturation. Undifferentiated brain cells express the type III IF protein vimentin (Bignami et al., 1982; Cochard and Paulin, 1984), while later neuroblasts express nestin, α-internexin, and peripherin (Portier et al., 1983; Lendahl et al., 1990; Kaplan et al., 1990). The neuronal differentiation induces the expression of NFs (Shaw and Weber, 1982; Carden et al., 1987; Nixon and Shea, 1992). NFL appears first at the start of neuronal differentiation, overlapping with α-internexin and peripherin expression (Willard and Simon, 1983; Carden et al., 1987). NFM follows NFL shortly after, when neurite elongation starts, NEFL and NEFM genes being located on the same chromosome and regulated in coordination. NFH appears later during axonal maturation (Willard and Simon, 1983; Carden et al., 1987). NFs, as all IF proteins, share a common structure. In the centre of the protein, a rod domain of approximately 310 amino acids forms highly conserved α-helical motifs (regions 1a, 1b, 2a and 2b, Figure 1). Every seventh residue in this central rod domain is hydrophobic, facilitating the formation of α-helical coiled-coil parallel homo- or heterodimers (see below). The central rod domain is flanked by less conserved aminoterminal globular head and carboxyterminal side-arm tail. Head and tail confer their functional specificities to the different IF proteins: whilst the central rod domain is mainly responsible for NF assembly, head and tail interact with the environment of NFs (e.g. protein-protein interactions or axonal diameter) (Heins et al., 1993). The head domain also contributes to NF assembly (Gill et al., 1990). NFs are obligate heteropolymers in vivo, with NFL being required to form proper heteropolymers with either NFM or NFH (Lee et al., 1993; Ching and Liem, 1993). The dimer is formed by the head to tail coiled apposition of two NF proteins (NFL and either NFM or NFH) by their central rod domain. Two NF dimers assemble then in an halfstaggered antiparallel NF tetramer (Cohlberg et al., 1995). The final 10 nm filament of NFs is formed by the lateral and longitudinal helical association of eight NF tetramers (Heins and Aebi, 1994; Fuchs and Weber, 1994; Fuchs and Cleveland, 1998; Parry and Steinert, 1999a; Herrmann and Aebi, 2000). The other IF proteins α-internexin and peripherin may also coassemble, as homodimers however, with the NF heterodimers, especially during development (α-internexin, peripherin) and in restricted sets of mature neurons (peripherin) (Kaplan et al., 1990; Fliegner et al., 1994; Beaulieu et al., 1999). During neuronal differentiation (i.e.: neurite formation, axonal growth and maturation), the nature of the NF fibers changes, starting with heterodimers NFL-NFM only, followed, once NFH starts its expression, by NF fibers constituted of NFL-NFM and NFL-NFH heterodimers (Carden et al., 1987). Along time, a specific NF tetrameric unit can be replaced by another, explaining the differential stoichiometry observed in the NF fibers from development to mature CNS, influencing also axonal structure and functions. NFL is essential for the precise NF assembly and for the maintenance of axonal calibre (Zhu et al., 1997). NFM participates in cross-bridges between NF fibers, stabilizes the NF filament network, participates in neurite longitudinal extension, and influences the axonal radial growth (Elder et al., 1998a; Jacomy et al., 1999; Elder et al., 1999a; Elder et al., 1999b). NFH also contributes to cross-bridges between NF fibers and may interact with microtubules, microfilaments and other cytoskeletal elements (Elder et al., 1998b; Jacomy et al., 1999; Elder et al., 1999b). In contrast to NFM, NFH does not seem to influence the axonal radial growth (Rao et al., 2002b).

Neurofilament Proteins in Brain Diseases

157

NFs, after synthesis in the neuronal cell body, are then rapidly transported into the axons. Until recently, it was not clear whether NFs were transported into the axon as polymeric structures (« polymer hypothesis »), or as individual subunits (« subunit hypothesis ») (Baas, 1997; Hirokawa, 1997; Nixon, 1998). Radioisotopic pulse labeling studies argued for the polymeric hypothesis with NFs moving slowly in axons at an average rate of 0.2 to 1 mm/day, a much slower speed than any known axonal transport (Xu and Tung, 2000). On the other side, photobleaching experiments with fluorescence-tagged NFs argued for the subunit hypothesis, with the bleached axonal segment remaining stationary and slowly recovering its fluorescence (Okabe et al., 1993). The solution to this controversy came from recent works using live cell imaging and GFP-tagged NFs, that showed a fast transport of NF polymers (bursts of average speed of 1 to 2 mm/s) interrupted by prolonged pauses (Roy et al., 2000; Wang et al., 2000). As these fast bursts of NFs transport can be bidirectional, and due to the high proportion of paused NF fibers (> 90%), the resulting overall NF transport appears slow. NFs seem to use the conventional kinesin and dynein motor system (Shah et al., 2000; Yabe et al., 2000), and appear to dissociate from these motor systems after phosphorylation (Yabe et al., 1999). NFs are also translocated in dendrites of specific types of neurons, and seem required for the proper dendritic arborization of large motor neurons (Kong et al., 1998; Zhang et al., 2002). Two major modifications are added post-translationally on NFs: phosphorylation and glycosylation. These modifications are dynamic and thought to regulate assembly, transport, structure and functions of NFs. Various phosphorylation sites have been identified in the head (N-terminal) and tail (Cterminal) regions of NFs. The head region of NFL and NFM can be phosphorylated at different positions (Figure 1) by protein kinases A, C and N (Sihag and Nixon, 1989; Sihag and Nixon, 1991; Hisanaga et al., 1994; Mukai et al., 1996; Cleverley et al., 1998; Nakamura et al., 2000). The phosphorylation of the NFL and NFM head region occurs rapidly after protein synthesis in the neuronal cell body, and inhibits the NF filament assembly in perikaria (Gibb et al., 1996; Gibb et al., 1998; Ching and Liem, 1999). This phosphorylation is transient, and the dephosphorylation of the NFL and NFM head region is a prerequisite for the axonal NF assembly in filaments (Gibb et al., 1998). Moreover, the transient phosphorylation of the head region of NFM also inhibits the phosphorylation of its C-terminal tail region (Zheng et al., 2003). Thus, before NF translocation in the axons, the phosphorylation of the head region of NFL and NFM protects neurons from a pathological accumulation of NF aggregates in their cell bodies . Upon entry of NFs into the axon, the C-terminal side-arm domain of NFM and NFH, as well as the short C-terminal region of NFL, become phosphorylated. In particular, NFM and NFH are phosphorylated on Lys-Ser-Pro (KSP) repeat domains (Figure 1). In humans, NFM has 13 KSP repeats, while NFH exists with two polymorphic forms of either 44 or 45 KSP repeats (Figlewicz et al., 1993). Most of the serine residues of the KSP repeats can be phosphorylated, meaning that each mole of NFM and NFH can contain about 10 and 50 moles of phosphate, respectively (Julien and Mushynski, 1982; Grant and Pant, 2000). In axons, more than 99% of assembled NFM and NFH proteins are phosphorylated on their KSP repeats, in particular in myelinated internodal regions, while this proportion is much weaker in cell bodies, dendrites and nodes of Ranvier (de Waegh et al., 1992; Hsieh et al., 1994). Unphosphorylated NFs represent only ~1% of total NFs in the neurons. In the axon, NFs are

158

Olivier Braissant

phosphorylated in a proximal to distal gradient (Sternberger and Sternberger, 1983; Pant and Veeranna, 1995). The C-terminal region of NFL is phosphorylated by caseine kinase II (Nakamura et al., 1999), while the kinases that phosphorylate NFM and NFH KSP repeats in their C-terminal tail domains include GSK-3α/β, cdk5/p35, ERK1/2 and JNK1/3 (Guan et al., 1991; Giasson and Mushynski, 1996; Sun et al., 1996; Li et al., 2001). In axons, the phosphorylation of multiple KSP repeats increases the negative charge of NFM and NFH, resulting in side-arm formation of their C-terminal tail and increased interneurofilament spacing (Nixon et al., 1994). This allows the radial axonal growth (i.e. regulation of axonal caliber), which increases axonal conduction velocity (de Waegh et al., 1992; Yin et al., 1998). The C-terminal phosphorylation of NFs also slows down their transport rate in axons, and mediate interactions with other cytoskeleton proteins, in particular microtubules (Hisanaga et al., 1991; Yabe et al., 2001; Shea et al., 2003). The phosphorylation of NFM seems preferentially responsible for the radial axonal growth, while the phosphorylation of NFH acts on the NF transport rate and their interactions with other proteins (Lewis and Nixon, 1988; Rao et al., 1998; Rao et al., 2003). The myelination of axons, both by Schwann cells in peripheral nerves and by oligodendrocytes in CNS, promotes the phosphorylation of NFM and NFH C-terminal tail, thus promoting the radial growth of myelinated axons and increasing their conduction velocity (de Waegh et al., 1992; Sanchez et al., 1996; Yin et al., 1998; Sanchez et al., 2000). NFL, NFM and NFH are also post-translationally glycosylated by addtion of O-linked Nacetylglucosamine moieties on serine and threonine residues located in their head regions (NFL, NFM and NFH) as well as in their KSP repeat carboxyterminal region (NFM and NFH) (Figure 1) (Dong et al., 1993; Dong et al., 1996). The proximity of the OGlcNAcylation and phosphorylation sites in the NF head domain suggest that competition between the two modes of post-translational modifications regulates NF assembly (Gill et al., 1990; Wong and Cleveland, 1990; Chin et al., 1991; Dong et al., 1993). On the other hand, in the nodes of Ranvier where NFs are more closely packed than in the internode axonal segments, O-GlcNAcylation probably replaces phosphorylation in the carboxyterminal KSP repeat region of NFM and NFH, rendering interactions between NFs more attractive than repulsive. Therefore, phosphorylation / dephosphorylation and glycosylation / deglycosylation of NFs (by kinase / phosphatase and O-GlcNAc transferase / N-acetyl-β-D-glucosaminidase respectively) contributes to the assembly, structure and functions of NFs (Dong et al., 1993; Nixon, 1993; Xu et al., 1994; Dong et al., 1996). Many neurons extend very long axons, up to 1 m in humans. To maintain the integrity and functions of these axons, some of their structural proteins, including those of the axonal cytoskeleton, have long lifetimes. For NFs in the human sciatic nerve, this average lifetime was estimated to 1 to 2 years (Lee and Cleveland, 1996). This very high stability of NFs is thought to be due, at least in part, to their phosphorylation which protects them from protease degradation (Goldstein et al., 1987; Pant, 1988). In physiological conditions, NF degradation only occurs in the axon terminus (presynaptic compartment), where NFs are dephosphorylated by protein phosphatase 2A (PP2A) (Gong et al., 2003), and then digested by calmodulin, a Ca++-dependent protease (Maxwell et al., 1997).

Neurofilament Proteins in Brain Diseases

159

Apart from their major role in regulating axonal caliber in function of their state of phosphorylation, NFs have been demonstrated or are postulated to have other functions in the axon. While gene knockout experiments demonstrated that NFs are not essential for axonal elongation, they nervertheless might facilitate it by stabilization of cytoskeletal elements and inhibition of axonal retraction (Zhu et al., 1997; Elder et al., 1998a; Elder et al., 1998b; Elder et al., 1999a). NFs participate, together with microtubules and microfilaments, to the axonal structural integrity, to the neuronal shape as well as to the axonal mechanisms of transport. They do so by direct or indirect interactions with microtubules (Hisanaga et al., 1991) or motor proteins like dynein, kinesin and myosin Va (Yabe et al., 1999; Shah et al., 2000; Yabe et al., 2000; Rao et al., 2002a), or with other crosslinking proteins like dystonin (Yang et al., 1999; Chen et al., 2000). NFM has been shown to interact with the D(1) dopamine receptor in subsets of neurons (Kim et al., 2002). Finally, of peculiar importance for the neuronal and axonal long term stability, NFs seem to protect axons from toxic components, by sequestrating for example Cdk5/p25 complexes which induce apoptosis (Nguyen et al., 2001), or by coupling of carbonyl groups issued of the oxidative stress on the lysine residues of KSP repeats (Wataya et al., 2002).

NEUROFILAMENT PROTEINS IN BRAIN DISEASES As discussed above, the tight regulation of NF subunits expression, post-translational modifications, stoichiometry between NFL, NFM and NFH, and NF axonal transport, allows the correct assembly of NF filaments. This in turn contributes to the normal axonal growth, maturation, and stability along time. Any dysregulation of these precise mechanisms of NF regulations is susceptible to induce severe pathological consequences on neurons. In particular, the hallmark of numerous human neurological diseases is the abnormal accumulation of NFs in neuronal perikarya (for recent reviews, see Al-Chalabi and Miller, 2003; Liu et al., 2004; Lariviere and Julien, 2004; Petzold, 2005), which alters axonal growth, mechanisms of particles and organelles transportation, stability, and dynamic of interactions between NFs and other axonal proteins (Herrmann and Griffin, 2002). For a long time, it was admitted that NF abnormalities in human neurological disorders were secondary to neuronal dysfunctions. Recent studies demonstrate however that dysregulations of NFs themselves can be the cause of these pathologies. The second part of this review will focus on NF dysregulations in neurodegenerative, neurodevelopmental and metabolic diseases of central and peripheral nervous systems, as well as on the use of NFs as markers of specific diseases.

NFS IN NEURODEGENERATIVE DISEASES Amyotrophic Lateral Sclerosis (ALS) ALS is a progressive neurodegenerative disease affecting motor neurons in the brain and spinal cord, with a typical onset between 40 and 60 years of age. ALS patients usually die wihin 5 years after ALS diagnosis, due to motor neurons death and loss of function of the

160

Olivier Braissant

relative innervated muscles, and progressive partial or total paralysis. Most of the cognitive functions in ALS patients remain preserved. ALS is a heterogeneous syndrom, in which the neuropathological hallmark is an abnormal aggregation of NFs in the degenerating motor neurons (Manetto et al., 1988; Munoz et al., 1988). 5-10% of ALS cases are familial (autosomal dominant), while all the remaining cases are sporadic. 1-2% of all ALS cases (2025% of familial ALS cases) are due to mutations in the Cu/Zn superoxide dismutase (SOD1) gene (Andersen, 2006), while the basis of the remaining ALS cases is still not known with precision. Mutations in SOD1 are thought to be linked to abnormal accumulation of NFs in ALS (Rouleau et al., 1996). Due to the abnormal accumulation and aggregation of hyperphosphorylated NFs in the ALS degenerating neurons, mutations in the NF genes have also been sought for a long time as good causative candidates for ALS. Indeed, different mutations have been found in NFs, in association with ALS (Figures 2,3,4). Codon deletions and insertions have been identified in the KSP regions of NFH in association with few sporadic cases of ALS (Figure 4) (Figlewicz et al., 1994; Tomkins et al., 1998; Al-Chalabi et al., 1999). More recently, missense mutations have also been found in the head and rod domains of NFH in other ALS cases (Garcia et al., 2006) (Figure 4). In association with ALS, the same group also identified recently a deletion in the tail domain of NFL (Figure 2), as well as missense mutations in the head, rod and tail domains of NFM (Figure 3) (Garcia et al., 2006). However, none of the mutations found in NF genes have been clearly identified as causative agent of ALS, nor linked to the familial dominantly inherited ALS (Al-Chalabi and Miller, 2003; Garcia et al., 2006), and it is thought now that these mutations in NF genes have to be considered as risk factors for sporadic ALS. However, the alteration of NF homeostasis seems to be an important part of the pathogenesis of ALS (Figures 2,3,4). As shown with mutant SOD1 transgenic models of ALS (Nguyen et al., 2001), the deregulation of specific NF kinase pathways (e.g: cdk5/p35) might cause the aberrant hyperphosphorylation of NFH and NFM side arms. This in turn might slow the axonal transport of NFs, which accumulate in neuronal perikarya (Williamson and Cleveland, 1999). The abnormal accumulation of NFs in the ALS degenerating neurons has also been associated with a significative decrease of NFL mRNA, which could increase the imbalance between NF subunits and precipitate further the neuronal degeneration (Bergeron et al., 1994; Wong et al., 2000). This decrease in NFL mRNA seems due to the direct binding of mutant SOD1 to NFL mRNA, which destabilizes it (Ge et al., 2005). Interestingly, the two main posttranslational modifications of NFs, i.e. phosphorylation and glycosylation, might be conversely deregulated in ALS, as Oglycosylation of the C-terminal tail domain of NFM is decreased, while its phosphorylation is increased, in a transgenic rat model of ALS (Ludemann et al., 2005).

Charcot-Marie-Tooth Disease (CMT) CMT is the most common inherited neurological disorder of the peripheral nervous system, affecting 1-4:10’000 individuals. CMT clinical phenotype is characterized by the progressive degeneration of motor and sensory neurons in the distal part of the limbs, leading to the slow loss of normal use of feet, legs, arms and hands (Skre, 1974; Reilly, 2000). CMT neuropathies are heterogeneous in the genes involved and, based on electrophysiological criteria, are classified in CMT1, a primary demyelinating form with reduced nerve conduction

Neurofilament Proteins in Brain Diseases

161

velocities, and CMT2, a primary axonal loss form. Some forms of CMT with overlapping characteristics between CMT1 and CMT2 have been classified as intermediate CMT. CMT is generally inherited with an autosomal dominant pattern. Recently, different missense mutations and one amino acid deletion have been identified in the NEFL gene (coding NFL) in several families in association with CMT (Figure 2) (Mersiyanova et al., 2000; De et al., 2001; Georgiou et al., 2002; Yoshihara et al., 2002; Jordanova et al., 2003; Choi et al., 2004; Zuchner et al., 2004). All these mutations are associated with the primary axonal loss form CMT2, with the exception of Glu397Lys being associated with the demyelinating form CMT1. These mutations in NFL are thought to disrupt NF assembly and axonal transport, as well as to alter NFL post-translational modifications. Other forms of CMT (CMT1) are caused by mutations in genes primarily expressed in Schwann cells and involved in myelin formation. These mutations lead to alterations in myelination, which in turn alter NFL, NFM and NFH phosphorylation states (Watson et al., 1994). The disruption of NF assembly and the alteration of NF phosphorylation states are thought to contribute, at least in part, to the CMT disease mechanisms leading to axonal degeneration.

Figure 2. Schematic representation of NFL alterations in various brain diseases. Mutations identified in association with diseases are indicated above the NFL scheme, while the disease effects on NFL are indicated below the NFL scheme. AD: Alzheimer’s disease; ALS: amyotrophic lateral sclerosis; CMT1, CMT2: Charcot-Marie-Tooth disease; PD: Parkinson’s disease; Δ: deletion.

162

Olivier Braissant

Figure 3. Schematic representation of NFM alterations in various brain diseases. Mutations identified in association with diseases are indicated above the NFM scheme, while the disease effects on NFM are indicated below the NFM scheme. AD: Alzheimer’s disease; ALS: amyotrophic lateral sclerosis; CMT1, CMT2: Charcot-Marie-Tooth disease; MMA: methylmalonic aciduria; NH4: hyperammonemia; PA: propionic aciduria; PD: Parkinson’s disease.

Figure 4: Schematic representation of NFH alterations in various brain diseases. Mutations identified in association with diseases are indicated above the NFH scheme, while the disease effects on NFH are indicated below the NFH scheme. AD: Alzheimer’s disease; ALS: amyotrophic lateral sclerosis; CMT1, CMT2: Charcot-Marie-Tooth disease; i: insertion; MMA: methylmalonic aciduria; PA: propionic aciduria; PD: Parkinson’s disease; Δ: deletion.

Neurofilament Proteins in Brain Diseases

163

Parkinson Disease (PD) PD is a progressive neurodegenerative CNS disorder affecting dopaminergic neurons of substantia nigra and leading to decreased dopamine availability. The principal pathological modifications in PD affected neurons are the so-called Lewy bodies, which are inclusions of accumulated proteins in neuronal perikariya and are made of numerous proteins, including NFL, NFM and NFH, α-synuclein, ubiquitin and subunits of the proteasome (Galloway et al., 1992; Trimmer et al., 2004). In particular, abnormally phosphorylated NFs have been identified in PD associated Lewy bodies (Hill et al., 1991; Trojanowski et al., 1993), but the reasons for this alteration of NF phosphorylation have not been precisely identified so far (Figures 2, 3, 4). Familial forms of PD have also been identified, in which the principal mutations found are located in the parkin, α-synuclein and ubiquitin C-terminal hydrolase L1, all three related to cellular ubiquitin proteasomal system (Lim et al., 2003). A significative decrease of NF mRNAs and proteins has also been observed in the PD affected neurons of substantia nigra (Hill et al., 1993; Basso et al., 2004) (Figures 2, 3, 4). Recently, a point mutation in the NEFM gene, located in the rod domain 2b of NFM and changing Gly to Ser (Gly336Ser) (Figure 3), has been identified in a patient that developed PD very early, at the age of 16 (Lavedan et al., 2002). Due to the position of this mutation in the very highly conserved region of IFs (rod, α-helical coils) involved in their assembly mechanism, it was speculated that this mutation could alter NFM assembly into NF filaments (Lavedan et al., 2002). As this mutation has been found in only one PD patient which moreover had three unaffected siblings (Lavedan et al., 2002; Han et al., 2005), it is not sure so far that this mutation is really causative of PD. If yes however, the NFM G336S mutation does not seem to interfere with either assembly nor cellular distribution of NFs (Perez-Olle et al., 2004), but could rather alter interactions of NFM with other PD susceptibility proteins (Al-Chalabi and Miller, 2003).

Alzheimer’s Disease (AD) Among neurodegenerative diseases, AD is the leading cause of dementia, with risks over 65 years of age varying from 6-10% for men to 12-19% for women (Seshadri et al., 1997). CNS regions involved in memory and thinking skills are the first affected, followed by neuronal death in other brain regions as disease progresses, which eventually causes the death of the patient. Despite intensive work on AD, its precise cause is still unknown. One of the important secondary features of AD is the neuronal cytoskeleton disruption, due to the inappropriate hyperphosphorylation of cytoskeletal proteins such as tau or NFs (Sternberger et al., 1985; Gong et al., 2000) (Figures 3, 4). In particular, hyperphosphorylated NFH accumulates in neuronal perikaryon and proximal axon (Sternberger et al., 1985), due most probably to an imbalance between kinase and phosphatase activities (Trojanowski et al., 1993; Maccioni et al., 2001; Veeranna et al., 2004). After accumulation in neuronal perikarya, these cytoskeletal proteins aggregate in abnormally modified filaments, and progressively form the neurofibrillary tangles and AD senile plaques, which are the hallmarks of AD. Recently, hyperphosphorylated NFM has also been identified in AD amyloid plaques (Liao et

164

Olivier Braissant

al., 2004). NFL mRNA is also significatively decreased in AD degenerating neurons (McLachlan et al., 1988) (Figure 2).

NFs in Other Neurodegenerative Diseases The expression and post-translational modifications of NFs have been found altered in a number of other neurodegenerative conditions (summarized in figures 2, 3). Giant axonal neuropathy (GAN) is a rare autosomal recessive neurodegenerative disorder progressively affecting both peripheral and central nervous system. GAN is due to mutations of the gene encoding gigaxonin, a protein suggested to be associated to IFs (Bomont et al., 2000; Herrmann and Griffin, 2002). GAN, due to the gigaxonin disruption, is thus characterized by the presence of giant axons filled with massive segmental accumulations of disorganized NFs (Asbury et al., 1972; Herguner et al., 2005). A recent work has shown that leprous nerve atrophy, characterized by a diminution of axonal calibre and paranodal demyelination, might be due to dephosphorylation of NFM and NFH (Save et al., 2004). NFH have been shown to be dephosphorylated in an experimental model of glaucoma, a neurodegenerative condition affecting the optic nerve in association with high intraoccular pressure (Kashiwagi et al., 2003). Glutamate excitotoxicity induces a rapid degradation of the neuronal cytoskeleton. It was shown recently that glutamate toxicity, primarily mediated by NMDA receptor, initiates a rapid loss of NFs in the affected axons, while other axonal markers remain intact for a longer period (Chung et al., 2005). Distal hereditary motor neuronopathies (dHMNs) are a heterogeneous group of disorders in which motor neurons selectively undergo age-dependent degeneration. Mutations in the small heat-shock protein HSPB1 (also called HSP27) are responsible for one form of dHMN. The mutant forms of HSPB1 seem to disrupt NF assembly, to alter axonal transport system, and lead to the accumulation and aggregation, in neuronal perikarya, of cellular components, including NFM (Ackerley et al., 2006). Huntington's disease (HD) is caused by a polyglutamine repeat expansion in the Nterminal domain of the huntingtin protein. Huntingtin is localized in the cytoplasm where it may interact with cytoskeletal and synaptic proteins. The mechanism of HD pathogenesis remains unknown but recent investigations suggest that the mutant huntingtin found in HD might interact aberrantly with cytoskeletal proteins, including NFs, and thus affect the axonal cytoskeletal integrity (DiProspero et al., 2004). Neuronal intermediate filament inclusion disease (NIFID) is a recently described novel neurological disease of early onset, presenting considerable variability in clinical phenotypes, including frontotemporal dementia, as well as pyramidal and extrapyramidal signs. The pathological hallmark of NIFID is the presence of abnormal aggregates of α-internexin, NFL, NFM and NFH in the affected neurons (Cairns et al., 2004). α-internexin, a class IV IF protein, has not been identified in any pathological protein aggregates of any other neurodegenerative disease.

Neurofilament Proteins in Brain Diseases

165

NFS IN NEURODEVELOPMENTAL AND METABOLIC DISEASES Diabetes Neuropathy Diabetes is associated with a symmetrical distal axonal neuropathy predominantly affecting sensory nerves and neurons of dorsal root ganglia. Diabetic neuropathy is characterized by a reduced conduction velocity, and axonal atrophy. Both in human diabetic patients and in streptozotocin-induced diabetic rats, abnormal aggregations of NFs and other cytoskeletal proteins have been observed in the affected neurons, together with an abnormal increase of NFM and NFH phosphorylation (Figures 3, 4) (Schmidt et al., 1997; Fernyhough et al., 1999). These alterations of NF phosphorylation seem to occur through the activation of the NF kinase c-Jun N-terminal kinase (JNK) (Fernyhough et al., 1999; Middlemas et al., 2006). NFs mRNAs are reduced. The affected neurons present defects of axonal transport mechanisms, a reduction in axon calibre, and a diminished capacity of nerve regeneration, all characteristics relying on the integrity of axonal cytoskeleton. It appears thus that NF abnormalities seem to be a primary cause of diabetic neuropathy, and not only a marker of the pathology (McLean, 1997). A recent work has shown that diabetic neuropathy in an experimental model, the insulin KO mouse, does not alter only peripheral axons, but also affects central neurons, where hyperphosphorylation of NFs together with alteration of different NF kinases activities have been demonstrated (Schechter et al., 2005).

Hyperammonemia during CNS Development Poorly understood irreversible damages to CNS development occur in neonates and infants with hepatic deficiency or inherited defects of ammonium (NH4+) metabolism, manifesting on the long term as mental retardation (Bachmann, 2002; Bachmann, 2003). We have shown, in brain cell 3D primary cultures exposed to NH4+ as experimental model of hyperammonemia during CNS development, that NH4+ impairs axonal growth (Braissant et al., 1999; Braissant et al., 2002). NFs appear to be affected in this process, as both NFM expression and phosphorylation are decrease by NH4+ exposure (Figure 2) (Braissant et al., 2002). The correct expression and phosphorylation of NFM seem to depend on levels of creatine (Braissant et al., 2002), which can be synthesized by brain cells including during development (Braissant et al., 2001; Braissant et al., 2005). Axonal growth, as well as NFM expression and phosphorylation, are protected under NH4+ exposure by co-treatment with creatine in a glial cell dependent manner (Braissant et al., 2002). Our results are consistent with clinical findings in hyperammonemic neonates or infants presenting irreversible brain lesions compatible with neuronal fiber loss or defects of neurite outgrowth. The alteration of NF phosphorylation under NH4+ exposure might occur through the dysregulation of MAPK, which are NF kinases and present altered levels of phosphorylation and activity in brain cells exposed to NH4+ (Schliess et al., 2002; Jayakumar et al., 2006; Cagnon et al., 2006).

166

Olivier Braissant

Methylmalonic (MMA) and Propionic (PA) Acidemias Among the most frequent organic acidemias, PA and MMA are due to deficiencies in propionyl-CoA carboxylase and L-methylmalonyl-CoA mutase, respectively, and lead to the increase of free propionic acid in blood and its accumulation in tissues (PA), and to the tissular accumulation of L-methylmalonic acid and secondarily of propionic acid (MMA). The levels of these metabolites in blood and cerebrospinal fluid can rise as high as 5 mM and may be even higher in neuronal cells. PA and MMA lead to chronic neurologic disabilities, seizures and developmental delay. Damages to basal ganglia, a general hypomyelination, cerebral atrophy and white matter edema are frequently encountered. So far, the exact underlying mechanisms of brain damage in PA and MMA remain to be elucidated. However, NFs might be implicated in the neuropathological aspects of MMA and PA (Figures 2, 3 4). Indeed, MMA and PA experimental models have provided evidence that neuronal NFL and NFM expression and phosphorylation are reduced under L-methylmalonic acid and propionic acid exposures (de Mattos-Dutra et al., 1997a; de Mattos-Dutra et al., 1997b; de Mattos-Dutra et al., 1998), while they are increased for NFH (Vivian et al., 2002).

NFs in other Neurodevelopomental and Metabolic Diseases Phenylketonuria (PKU) is one of the most frequent inborn errors of metabolism, is due to the deficiency of the hepatic enzyme phenylalanine hydroxylase and results in hyperphenylalaninemia. Among other pathological characteristics, untreated PKU leads to mental retardation. Untreated PKU patients show a severe hypomyelination of their CNS. Experimental evidence has been shown that hyperphenylalaninemia delays axonal maturation and myelination during critical period of CNS development, probably through a deficit of NFH as well as myelin basic protein expression (Reynolds et al., 1993). Progressive encephalopathy syndrome with edema, hypsarrhythmia and optic atrophy (PEHO syndrome) is a form of infantile progressive encephalopathy showing severe hypotonia, convulsions, profound mental retardation, hyperreflexia, optic atrophy and brain atrophy, in particular in cerebellum and brainstem. PEHO seems to occur in the postnatal period, without exclusion of potential prenatal onset. Interestingly, PEHO patients presented an aberrant expression of NFH in the perikarya of their cerebellar Purkinje cells, demonstrating an important disorganization of their cytoskeleton (Haltia and Somer, 1993).

NFS AS MARKERS OF DISEASES NFs, as the principal components of the axonal cytoskeleton, are released in the interstitial fluid after axonal injury or degeneration, and diffuse into cerebrospinal fluid (CSF), where they can be quantified to monitor axonal degeneration, as well as disease activity and progression. Increasing studies are published making use of NFs as markers of neuronal injury. A lot of work has been done on the measure of NFL and NFH released in CSF, as markers of axonal degeneration, to help the prediction and monitoring of the

Neurofilament Proteins in Brain Diseases

167

neurological decline in people with multiple sclerosis (MS). Different studies have shown that NFL CSF concentration is higher in patients with MS than in controls, making of NFL a promising marker to discriminate MS patients from patients with other neurological diseases. On the other hand, CSF NFH seems interesting for the follow up of the progression of the disease in MS patients, as it is increased during the progressive phase of MS. For more specific informations on the use of NFs as markers of MS, the reader is invited to read two detailed and recent reviews (Petzold, 2005; Teunissen et al., 2005). As new but non-exhaustive examples, the use of NFs as markers of three other neuropathological conditions will be briefly discussed here: ALS, subarachnoid hemorrhage (SAH), and brain damages as consequence of cardiac arrest. As discussed in a previous chapter, ALS is the most common form of motor neuron disease, presenting as neuropathological hallmark an abnormal aggregation of NFs in the degenerating motor neurons. A recent work proposes that phosphorylated NFH might be a valuable marker of axonal damage in ALS, discriminate between different categories of ALS, and be used as marker for therapeutic trials (Brettschneider et al., 2006). Axonal degeneration is thought to be an underestimated complication of SAH, which can continue for days after the primary injury, and extend into the period of delayed cerebral ischemia. A recent study shows that phosphorylated NFH, measured daily in CSF during 14 days after the SAH episode, is significatively increased in SAH patients with bad outcome (measured at 3 months) (Petzold et al., 2005). This work demonstrates the secondary axonal degeneration following SAH, and show that the levels of phosphorylated NFH in CSF are highly predictive of a bad outcome for SAH patients. The majority of patients surviving resuscitation after an out of hospital cardiac arrest present neurological complications due to global anoxia. Outcome prediction for these patients mainly rely on clinical observations, and on the recent measure of biochemical markers of brain damage in serum, such as brain specific proteins S-100 or NSE (Rosen et al., 2001). A recent study has shown that the levels of NFL in CSF give a reliable measure of brain damage, and are highly predictive of poor outcome for these patients (Rosen et al., 2004).

CONCLUSION NFs are essential cytoskeletal proteins of the neuron, which participate in axonal rigidity, tensile strength, stability along time, regulation of calibre, and transport guidance of organelles and particles. NFs alterations have been identified in many different brain pathologies, ranging from neurodegenerative, neurodevelopmental to metabolic diseases. This list of diseases showing abnormalities in NFs will certainly increase in the near future. The identified NFs alterations range from genetic mutations, to abnormal expression, posttranslational modifications and aberrant localization or accumulation in neuronal perikaryion. From this diversity of NF dysregulation in so many brain diseases, the future experimental work on NFs may unravel common mechanisms of IF accumulation and aggregation, and hopefully allow the design of better treatments for the patients suffering of these neurodegenerative diseases.

168

Olivier Braissant

ACKNOWLEDGMENTS Our work is supported by the Swiss National Science Foundation, grants n° 31-63892.00 and 3100A0-100778.

REFERENCES Ackerley S, James PA, Kalli A, French S, Davies KE, and Talbot K (2006). A mutation in the small heat-shock protein HSPB1 leading to distal hereditary motor neuronopathy disrupts neurofilament assembly and the axonal transport of specific cellular cargoes. Hum. Mol. Genet. 15, 347-354. Al-Chalabi A, Andersen PM, Nilsson P, Chioza B, Andersson JL, Russ C, Shaw CE, Powell JF, and Leigh PN (1999). Deletions of the heavy neurofilament subunit tail in amyotrophic lateral sclerosis. Hum. Mol. Genet. 8, 157-164. Al-Chalabi A and Miller CC (2003). Neurofilaments and neurological disease. Bioessays 25, 346-355. Andersen PM (2006). Amyotrophic lateral sclerosis associated with mutations in the CuZn superoxide dismutase gene. Curr. Neurol. Neurosci. Rep. 6, 37-46. Asbury AK, Gale MK, Cox SC, Baringer JR, and Berg BO (1972). Giant axonal neuropathy a unique case with segmental neurofilamentous masses. Acta Neuropathol. 20, 237-247. Baas PW (1997). Microtubules and axonal growth. Curr. Opin. Cell Biol. 9, 29-36. Bachmann C (2002). Mechanisms of hyperammonemia. Clin. Chem. Lab. Med. 40, 653-662. Bachmann C (2003). Outcome and survival of 88 patients with urea cycle disorders: a retrospective evaluation. Eur. J Pediatr. 162, 410-416. Basso M, Giraudo S, Corpillo D, Bergamasco B, Lopiano L, and Fasano M (2004). Proteome analysis of human substantia nigra in Parkinson's disease. Proteomics. 4, 3943-3952. Beaulieu JM, Robertson J, and Julien JP (1999). Interactions between peripherin and neurofilaments in cultured cells: disruption of peripherin assembly by the NF-M and NFH subunits. Biochem. Cell Biol. 77, 41-45. Bergeron C, Beric-Maskarel K, Muntasser S, Weyer L, Somerville MJ, and Percy ME (1994). Neurofilament light and polyadenylated mRNA levels are decreased in amyotrophic lateral sclerosis motor neurons. J. Neuropathol. Exp. Neurol. 53, 221-230. Bignami A, Raju T, and Dahl D (1982). Localization of vimentin, the nonspecific intermediate filament protein, in embryonal glia and in early differentiating neurons. In vivo and in vitro immunofluorescence study of the rat embryo with vimentin and neurofilament antisera. Dev. Biol. 91, 286-295. Bomont P, Cavalier L, Blondeau F, Ben HC, Belal S, Tazir M, Demir E, Topaloglu H, Korinthenberg R, Tuysuz B, Landrieu P, Hentati F, and Koenig M (2000). The gene encoding gigaxonin, a new member of the cytoskeletal BTB/kelch repeat family, is mutated in giant axonal neuropathy. Nat. Genet. 26, 370-374. Braissant O, Henry H, Loup M, Eilers B, and Bachmann C (2001). Endogenous synthesis and transport of creatine in the rat brain: an in situ hybridization study. Brain Res. Mol. Brain Res. 86, 193-201.

Neurofilament Proteins in Brain Diseases

169

Braissant O, Henry H, Villard AM, Speer O, Wallimann T, and Bachmann C (2005). Creatine synthesis and transport during rat embryogenesis: spatiotemporal expression of AGAT, GAMT and CT1. BMC. Dev. Biol. 5, 9. Braissant O, Henry H, Villard AM, Zurich MG, Loup M, Eilers B, Parlascino G, Matter E, Boulat O, Honegger P, and Bachmann C (2002). Ammonium-induced impairment of axonal growth is prevented through glial creatine. J. Neurosci. 22, 9810-9820. Braissant O, Honegger P, Loup M, Iwase K, Takiguchi M, and Bachmann C (1999). Hyperammonemia: regulation of argininosuccinate synthetase and argininosuccinate lyase genes in aggregating cell cultures of fetal rat brain. Neurosci. Lett. 266, 89-92. Brettschneider J, Petzold A, Süssmuth SD, Ludolph AC, and Tumani H (2006). Axonal damage markers in cerebrospinal fluid are increased in ALS. Neurology 66, 852-856. Cagnon L, Honegger P, Bachmann C, and Braissant O (2006). Signal transduction mechanisms implicated in ammonium neurotoxicity and protection through glial creatine. FENS Forum Abstracts 2006. A228-4. Cairns NJ, Zhukareva V, Uryu K, Zhang B, Bigio E, Mackenzie IR, Gearing M, Duyckaerts C, Yokoo H, Nakazato Y, Jaros E, Perry RH, Lee VM, and Trojanowski JQ (2004). alpha-internexin is present in the pathological inclusions of neuronal intermediate filament inclusion disease. Am. J. Pathol. 164, 2153-2161. Carden MJ, Trojanowski JQ, Schlaepfer WW, and Lee VM (1987). Two-stage expression of neurofilament polypeptides during rat neurogenesis with early establishment of adult phosphorylation patterns. J. Neurosci. 7, 3489-3504. Chen J, Nakata T, Zhang Z, and Hirokawa N (2000). The C-terminal tail domain of neurofilament protein-H (NF-H) forms the crossbridges and regulates neurofilament bundle formation. J. Cell Sci. 113, 3861-3869. Chin SS, Macioce P, and Liem RK (1991). Effects of truncated neurofilament proteins on the endogenous intermediate filaments in transfected fibroblasts. J. Cell Sci. 99, 335-350. Ching GY and Liem RK (1999). Analysis of the roles of the head domains of type IV rat neuronal intermediate filament proteins in filament assembly using domain-swapped chimeric proteins. J. Cell Sci. 112, 2233-2240. Ching GY and Liem RK (1993). Assembly of type IV neuronal intermediate filaments in nonneuronal cells in the absence of preexisting cytoplasmic intermediate filaments. J. Cell Biol. 122, 1323-1335. Choi BO, Lee MS, Shin SH, Hwang JH, Choi KG, Kim WK, Sunwoo IN, Kim NK, and Chung KW (2004). Mutational analysis of PMP22, MPZ, GJB1, EGR2 and NEFL in Korean Charcot-Marie-Tooth neuropathy patients. Hum. Mutat. 24, 185-186. Chung RS, McCormack GH, King AE, West AK, and Vickers JC (2005). Glutamate induces rapid loss of axonal neurofilament proteins from cortical neurons in vitro. Exp. Neurol. 193, 481-488. Cleverley KE, Betts JC, Blackstock WP, Gallo JM, and Anderton BH (1998). Identification of novel in vitro PKA phosphorylation sites on the low and middle molecular mass neurofilament subunits by mass spectrometry. Biochemistry 37, 3917-3930. Cochard P and Paulin D (1984). Initial expression of neurofilaments and vimentin in the central and peripheral nervous system of the mouse embryo in vivo. J. Neurosci. 4, 20802094. Cohlberg JA, Hajarian H, Tran T, Alipourjeddi P, and Noveen A (1995). Neurofilament protein heterotetramers as assembly intermediates. J. Biol. Chem. 270, 9334-9339.

170

Olivier Braissant

De Mattos-Dutra A, Sampaio de Freitas M, Lisboa CS, Pessoa-Pureur R, and Wajner M (1998). Effects of acute and chronic administration of methylmalonic and propionic acids on the in vitro incorporation of 32P into cytoskeletal proteins from cerebral cortex of young rats. Neurochem. Int. 33, 75-82. De Mattos-Dutra A, Sampaio de Freitas M, Schröder N, Zilles AC, Wajner M, and PessoaPureur R (1997a). Methylmalonic acid reduces the in vitro phosphorylation of cytoskeletal proteins in the cerebral cortex of rats. Brain Res. 763, 221-231. De Mattos-Dutra A, Sampaio de Freitas M, Schröder N, Fogaca Lisboa CS, Pessoa-Pureur R, and Wajner M (1997b). In vitro phosphorylation of cytoskeletal proteins in the rat cerebral cortex is decreased by propionic acid. Exp. Neurol. 147, 238-247. De Waegh SM, Lee VM, and Brady ST (1992). Local modulation of neurofilament phosphorylation, axonal caliber, and slow axonal transport by myelinating Schwann cells. Cell 68, 451-463. De Jonghe P, Mersivanova I, Nelis E, Del Favero J, Martin JJ, Van Broeckhoven C, Evgrafov O, and Timmerman V (2001). Further evidence that neurofilament light chain gene mutations can cause Charcot-Marie-Tooth disease type 2E. Ann. Neurol. 49, 245-249. DiProspero NA, Chen EY, Charles V, Plomann M, Kordower JH, and Tagle DA (2004). Early changes in Huntington's disease patient brains involve alterations in cytoskeletal and synaptic elements. J. Neurocytol. 33, 517-533. Dong DL, Xu ZS, Chevrier MR, Cotter RJ, Cleveland DW, and Hart GW (1993). Glycosylation of mammalian neurofilaments. Localization of multiple O-linked Nacetylglucosamine moieties on neurofilament polypeptides L and M. J. Biol. Chem. 268, 16679-16687. Dong DL, Xu ZS, Hart GW, and Cleveland DW (1996). Cytoplasmic O-GlcNAc modification of the head domain and the KSP repeat motif of the neurofilament protein neurofilament-H. J. Biol. Chem. 271, 20845-20852. Elder GA, Friedrich VL Jr, Bosco P, Kang C, Gourov A, Tu PH, Lee VM, and Lazzarini RA (1998a). Absence of the mid-sized neurofilament subunit decreases axonal calibers, levels of light neurofilament (NF-L), and neurofilament content. J. Cell Biol. 141, 727739. Elder GA, Friedrich VL Jr, Kang C, Bosco P, Gourov A, Tu PH, Zhang B, Lee VM, and Lazzarini RA (1998b). Requirement of heavy neurofilament subunit in the development of axons with large calibers. J. Cell Biol. 143, 195-205. Elder GA, Friedrich VL Jr, Margita A, and Lazzarini RA (1999a). Age-related atrophy of motor axons in mice deficient in the mid-sized neurofilament subunit. J. Cell Biol. 146, 181-192. Elder GA, Friedrich VL Jr, Pereira D, Tu PH, Zhang B, Lee VM, and Lazzarini RA (1999b). Mice with disrupted midsized and heavy neurofilament genes lack axonal neurofilaments but have unaltered numbers of axonal microtubules. J. Neurosci. Res. 57, 23-32. Fernyhough P, Gallagher A, Averill SA, Priestley JV, Hounsom L, Patel J, and Tomlinson DR (1999). Aberrant neurofilament phosphorylation in sensory neurons of rats with diabetic neuropathy. Diabetes 48, 881-889. Figlewicz DA, Krizus A, Martinoli MG, Meininger V, Dib M, Rouleau GA, and Julien JP (1994). Variants of the heavy neurofilament subunit are associated with the development of amyotrophic lateral sclerosis. Hum. Mol. Genet. 3, 1757-1761.

Neurofilament Proteins in Brain Diseases

171

Figlewicz DA, Rouleau GA, Krizus A, and Julien JP (1993). Polymorphism in the multiphosphorylation domain of the human neurofilament heavy-subunit-encoding gene. Gene 132, 297-300. Fliegner KH, Kaplan MP, Wood TL, Pintar JE, and Liem RK (1994). Expression of the gene for the neuronal intermediate filament protein alpha-internexin coincides with the onset of neuronal differentiation in the developing rat nervous system. J. Comp Neurol. 342, 161-173. Fuchs E and Cleveland DW (1998). A structural scaffolding of intermediate filaments in health and disease. Science 279, 514-519. Fuchs E and Weber K (1994). Intermediate filaments: structure, dynamics, function, and disease. Annu. Rev. Biochem. 63, 345-382. Galloway PG, Mulvihill P, and Perry G (1992). Filaments of Lewy bodies contain insoluble cytoskeletal elements. Am. J. Pathol. 140, 809-822. Garcia ML, Singleton AB, Hernandez D, Ward CM, Evey C, Sapp PA, Hardy J, Brown RH Jr, and Cleveland DW (2006). Mutations in neurofilament genes are not a significant primary cause of non-SOD1-mediated amyotrophic lateral sclerosis. Neurobiol. Dis. 21, 102-109. Ge WW, Wen W, Strong W, Leystra-Lantz C, and Strong MJ (2005). Mutant copper-zinc superoxide dismutase binds to and destabilizes human low molecular weight neurofilament mRNA. J. Biol. Chem. 280, 118-124. Georgiou DM, Zidar J, Korosec M, Middleton LT, Kyriakides T, and Christodoulou K (2002). A novel NF-L mutation Pro22Ser is associated with CMT2 in a large Slovenian family. Neurogenetics. 4, 93-96. Giasson BI and Mushynski WE (1996). Aberrant stress-induced phosphorylation of perikaryal neurofilaments. J. Biol. Chem. 271, 30404-30409. Gibb BJ, Brion JP, Brownlees J, Anderton BH, and Miller CC (1998). Neuropathological abnormalities in transgenic mice harbouring a phosphorylation mutant neurofilament transgene. J. Neurochem. 70, 492-500. Gibb BJ, Robertson J, and Miller CC (1996). Assembly properties of neurofilament light chain Ser55 mutants in transfected mammalian cells. J. Neurochem. 66, 1306-1311. Gill SR, Wong PC, Monteiro MJ, and Cleveland DW (1990). Assembly properties of dominant and recessive mutations in the small mouse neurofilament (NF-L) subunit. J. Cell Biol. 111, 2005-2019. Goldstein ME, Sternberger NH, and Sternberger LA (1987). Phosphorylation protects neurofilaments against proteolysis. J. Neuroimmunol. 14, 149-160. Gong CX, Lidsky T, Wegiel J, Zuck L, Grundke-Iqbal I, and Iqbal K (2000). Phosphorylation of microtubule-associated protein tau is regulated by protein phosphatase 2A in mammalian brain. Implications for neurofibrillary degeneration in Alzheimer's disease. J. Biol. Chem. 275, 5535-5544. Gong CX, Wang JZ, Iqbal K, and Grundke-Iqbal I (2003). Inhibition of protein phosphatase 2A induces phosphorylation and accumulation of neurofilaments in metabolically active rat brain slices. Neurosci. Lett. 340, 107-110. Grant P and Pant HC (2000). Neurofilament protein synthesis and phosphorylation. J. Neurocytol. 29, 843-872.

172

Olivier Braissant

Guan RJ, Khatra BS, and Cohlberg JA (1991). Phosphorylation of bovine neurofilament proteins by protein kinase FA (glycogen synthase kinase 3). J. Biol. Chem. 266, 82628267. Haltia M and Somer M (1993). Infantile cerebello-optic atrophy. Neuropathology of the progressive encephalopathy syndrome with edema, hypsarrhythmia and optic atrophy (the PEHO syndrome). Acta Neuropathol. 85, 241-247. Han F, Bulman DE, Panisset M, and Grimes DA (2005). Neurofilament M gene in a FrenchCanadian population with Parkinson's disease. Can. J. Neurol. Sci. 32, 68-70. Heins S and Aebi U (1994). Making heads and tails of intermediate filament assembly, dynamics and networks. Curr. Opin. Cell Biol. 6, 25-33. Heins S, Wong PC, Müller S, Goldie K, Cleveland DW, and Aebi U (1993). The rod domain of NF-L determines neurofilament architecture, whereas the end domains specify filament assembly and network formation. J. Cell Biol. 123, 1517-1533. Herguner MO, Zorludemir S, and Altunbasak S (2005). Giant axonal neuropathy in two siblings: clinical histopathological findings. Clin. Neuropathol. 24, 48-50. Herrmann DN and Griffin JW (2002). Intermediate filaments: a common thread in neuromuscular disorders. Neurology 58, 1141-1143. Herrmann H and Aebi U (2000). Intermediate filaments and their associates: multi-talented structural elements specifying cytoarchitecture and cytodynamics. Curr. Opin. Cell Biol. 12, 79-90. Hill WD, Arai M, Cohen JA, and Trojanowski JQ (1993). Neurofilament mRNA is reduced in Parkinson's disease substantia nigra pars compacta neurons. J. Comp Neurol. 329, 328336. Hill WD, Lee VM, Hurtig HI, Murray JM, and Trojanowski JQ (1991). Epitopes located in spatially separate domains of each neurofilament subunit are present in Parkinson's disease Lewy bodies. J. Comp Neurol. 309, 150-160. Hirokawa N (1997). The mechanisms of fast and slow transport in neurons: identification and characterization of the new kinesin superfamily motors. Curr. Opin. Neurobiol. 7, 605614. Hisanaga S, Kusubata M, Okumura E, and Kishimoto T (1991). Phosphorylation of neurofilament H subunit at the tail domain by CDC2 kinase dissociates the association to microtubules. J. Biol. Chem. 266, 21798-21803. Hisanaga S, Matsuoka Y, Nishizawa K, Saito T, Inagaki M, and Hirokawa N (1994). Phosphorylation of native and reassembled neurofilaments composed of NF-L, NF-M, and NF-H by the catalytic subunit of cAMP-dependent protein kinase. Mol. Biol. Cell 5, 161-172. Hsieh ST, Kidd GJ, Crawford TO, Xu Z, Lin WM, Trapp BD, Cleveland DW, and Griffin JW (1994). Regional modulation of neurofilament organization by myelination in normal axons. J. Neurosci. 14, 6392-6401. Jacomy H, Zhu Q, Couillard-Després S, Beaulieu JM, and Julien JP (1999). Disruption of type IV intermediate filament network in mice lacking the neurofilament medium and heavy subunits. J. Neurochem. 73, 972-984. Jayakumar AR, Panickar KS, Murthy C, and Norenberg MD (2006). Oxidative stress and mitogen-activated protein kinase phosphorylation mediate ammonia-induced cell swelling and glutamate uptake inhibition in cultured astrocytes. J. Neurosci. 26, 47744784.

Neurofilament Proteins in Brain Diseases

173

Jordanova A, De Jonghe P, Boerkoel CF, Takashima H, De Vriendt E, Ceuterick C, Martin JJ, Butler IJ, Mancias P, Papasozomenos SC, Terespolsky D, Potocki L, Brown CW, Shy M, Rita DA, Tournev I, Kremensky I, Lupski JR, and Timmerman V (2003). Mutations in the neurofilament light chain gene (NEFL) cause early onset severe Charcot-MarieTooth disease. Brain 126, 590-597. Julien JP and Mushynski WE (1982). Multiple phosphorylation sites in mammalian neurofilament polypeptides. J. Biol. Chem. 257, 10467-10470. Kaplan MP, Chin SS, Fliegner KH, and Liem RK (1990). Alpha-internexin, a novel neuronal intermediate filament protein, precedes the low molecular weight neurofilament protein (NF-L) in the developing rat brain. J. Neurosci. 10, 2735-2748. Kashiwagi K, Ou B, Nakamura S, Tanaka Y, Suzuki M, and Tsukahara S (2003). Increase in dephosphorylation of the heavy neurofilament subunit in the monkey chronic glaucoma model. Invest Ophthalmol. Vis. Sci. 44, 154-159. Kim OJ, Ariano MA, Lazzarini RA, Levine MS, and Sibley DR (2002). Neurofilament-M interacts with the D1 dopamine receptor to regulate cell surface expression and desensitization. J. Neurosci. 22, 5920-5930. Kong J, Tung VW, Aghajanian J, and Xu Z (1998). Antagonistic roles of neurofilament subunits NF-H and NF-M against NF-L in shaping dendritic arborization in spinal motor neurons. J. Cell Biol. 140, 1167-1176. Larivière RC and Julien JP (2004). Functions of intermediate filaments in neuronal development and disease. J. Neurobiol. 58, 131-148. Lavedan C, Buchholtz S, Nussbaum RL, Albin RL, and Polymeropoulos MH (2002). A mutation in the human neurofilament M gene in Parkinson's disease that suggests a role for the cytoskeleton in neuronal degeneration. Neurosci. Lett. 322, 57-61. Lee MK and Cleveland DW (1996). Neuronal intermediate filaments. Annu. Rev. Neurosci. 19, 187-217. Lee MK, Xu Z, Wong PC, and Cleveland DW (1993). Neurofilaments are obligate heteropolymers in vivo. J. Cell Biol. 122, 1337-1350. Lendahl U, Zimmerman LB, and McKay RD (1990). CNS stem cells express a new class of intermediate filament protein. Cell 60, 585-595. Lewis SE and Nixon RA (1988). Multiple phosphorylated variants of the high molecular mass subunit of neurofilaments in axons of retinal cell neurons: characterization and evidence for their differential association with stationary and moving neurofilaments. J. Cell Biol. 107, 2689-2701. Li BS, Daniels MP, and Pant HC (2001). Integrins stimulate phosphorylation of neurofilament NF-M subunit KSP repeats through activation of extracellular regulatedkinases (Erk1/Erk2) in cultured motoneurons and transfected NIH 3T3 cells. J. Neurochem. 76, 703-710. Liao L, Cheng D, Wang J, Duong DM, Losik TG, Gearing M, Rees HD, Lah JJ, Levey AI, and Peng J (2004). Proteomic characterization of postmortem amyloid plaques isolated by laser capture microdissection. J. Biol. Chem. 279, 37061-37068. Lim KL, Dawson VL, and Dawson TM (2003). The cast of molecular characters in Parkinson's disease: felons, conspirators, and suspects. Ann. N. Y. Acad. Sci. 991, 80-92. Liu Q, Xie F, Siedlak SL, Nunomura A, Honda K, Moreira PI, Zhua X, Smith MA, and Perry G (2004). Neurofilament proteins in neurodegenerative diseases. Cell Mol. Life Sci. 61, 3057-3075.

174

Olivier Braissant

Lüdemann N, Clement A, Hans VH, Leschik J, Behl C, and Brandt R (2005). O-glycosylation of the tail domain of neurofilament protein M in human neurons and in spinal cord tissue of a rat model of amyotrophic lateral sclerosis (ALS). J. Biol. Chem. 280, 31648-31658. Maccioni RB, Otth C, Concha II, and Munoz JP (2001). The protein kinase Cdk5. Structural aspects, roles in neurogenesis and involvement in Alzheimer's pathology. Eur. J. Biochem. 268, 1518-1527. Manetto V, Sternberger NH, Perry G, Sternberger LA, and Gambetti P (1988). Phosphorylation of neurofilaments is altered in amyotrophic lateral sclerosis. J. Neuropathol. Exp. Neurol. 47, 642-653. Maxwell WL, Povlishock JT, and Graham DL (1997). A mechanistic analysis of nondisruptive axonal injury: a review. J. Neurotrauma 14, 419-440. McLachlan DR, Lukiw WJ, Wong L, Bergeron C, and Bech-Hansen NT (1988). Selective messenger RNA reduction in Alzheimer's disease. Brain Res. 427, 255-261. McLean WG (1997). The role of axonal cytoskeleton in diabetic neuropathy. Neurochem. Res. 22, 951-956. Mersiyanova IV, Perepelov AV, Polyakov AV, Sitnikov VF, Dadali EL, Oparin RB, Petrin AN, and Evgrafov OV (2000). A new variant of Charcot-Marie-Tooth disease type 2 is probably the result of a mutation in the neurofilament-light gene. Am. J. Hum. Genet. 67, 37-46. Middlemas AB, Agthong S, and Tomlinson DR (2006). Phosphorylation of c-Jun N-terminal kinase (JNK) in sensory neurones of diabetic rats, with possible effects on nerve conduction and neuropathic pain: prevention with an aldose reductase inhibitor. Diabetologia 49, 580-587. Mukai H, Toshimori M, Shibata H, Kitagawa M, Shimakawa M, Miyahara M, Sunakawa H, and Ono Y (1996). PKN associates and phosphorylates the head-rod domain of neurofilament protein. J. Biol. Chem. 271, 9816-9822. Munoz DG, Greene C, Perl DP, and Selkoe DJ (1988). Accumulation of phosphorylated neurofilaments in anterior horn motoneurons of amyotrophic lateral sclerosis patients. J. Neuropathol. Exp. Neurol. 47, 9-18. Nakamura Y, Hashimoto R, Kashiwagi Y, Aimoto S, Fukusho E, Matsumoto N, Kudo T, and Takeda M (2000). Major phosphorylation site (Ser55) of neurofilament L by cyclic AMP-dependent protein kinase in rat primary neuronal culture. J. Neurochem. 74, 949959. Nakamura Y, Hashimoto R, Kashiwagi Y, Wada Y, Sakoda S, Miyamae Y, Kudo T, and Takeda M (1999). Casein kinase II is responsible for phosphorylation of NF-L at Ser473. FEBS Lett. 455, 83-86. Nguyen MD, Larivière RC, and Julien JP (2001). Deregulation of Cdk5 in a mouse model of ALS: toxicity alleviated by perikaryal neurofilament inclusions. Neuron 30, 135-147. Nixon RA (1998). The slow axonal transport debate. Trends Cell Biol. 8, 100. Nixon RA (1993). The regulation of neurofilament protein dynamics by phosphorylation: clues to neurofibrillary pathobiology. Brain Pathol. 3, 29-38. Nixon RA, Paskevich PA, Sihag RK, and Thayer CY (1994). Phosphorylation on carboxyl terminus domains of neurofilament proteins in retinal ganglion cell neurons in vivo: influences on regional neurofilament accumulation, interneurofilament spacing, and axon caliber. J. Cell Biol. 126, 1031-1046.

Neurofilament Proteins in Brain Diseases

175

Nixon RA and Shea TB (1992). Dynamics of neuronal intermediate filaments: a developmental perspective. Cell Motil. Cytoskeleton 22, 81-91. Okabe S, Miyasaka H, and Hirokawa N (1993). Dynamics of the neuronal intermediate filaments. J. Cell Biol. 121, 375-386. Pant HC (1988). Dephosphorylation of neurofilament proteins enhances their susceptibility to degradation by calpain. Biochem. J. 256, 665-668. Pant HC and Veeranna (1995). Neurofilament phosphorylation. Biochem. Cell Biol. 73, 575592. Parry DA and Steinert PM (1999b). Intermediate filaments: molecular architecture, assembly, dynamics and polymorphism. Q. Rev. Biophys. 32, 99-187. Parry DA and Steinert PM (1999a). Intermediate filaments: molecular architecture, assembly, dynamics and polymorphism. Q. Rev. Biophys. 32, 99-187. Perez-Olle R, Lopez-Toledano MA, and Liem RK (2004). The G336S variant in the human neurofilament-M gene does not affect its assembly or distribution: importance of the functional analysis of neurofilament variants. J. Neuropathol. Exp. Neurol. 63, 759-774. Petzold A (2005). Neurofilament phosphoforms: surrogate markers for axonal injury, degeneration and loss. J. Neurol. Sci. 233, 183-198. Petzold A, Rejdak K, Belli A, Sen J, Keir G, Kitchen N, Smith M, and Thompson EJ (2005). Axonal pathology in subarachnoid and intracerebral hemorrhage. J. Neurotrauma 22, 407-414. Portier MM, de Néchaud B, and Gros F (1983). Peripherin, a new member of the intermediate filament protein family. Dev. Neurosci. 6, 335-344. Rao MV, Campbell J, Yuan A, Kumar A, Gotow T, Uchiyama Y, and Nixon RA (2003). The neurofilament middle molecular mass subunit carboxyl-terminal tail domains is essential for the radial growth and cytoskeletal architecture of axons but not for regulating neurofilament transport rate. J. Cell Biol. 163, 1021-1031. Rao MV, Engle LJ, Mohan PS, Yuan A, Qiu D, Cataldo A, Hassinger L, Jacobsen S, Lee VM, Andreadis A, Julien JP, Bridgman PC, and Nixon RA (2002a). Myosin Va binding to neurofilaments is essential for correct myosin Va distribution and transport and neurofilament density. J. Cell Biol. 159, 279-290. Rao MV, Garcia ML, Miyazaki Y, Gotow T, Yuan A, Mattina S, Ward CM, Calcutt NA, Uchiyama Y, Nixon RA, and Cleveland DW (2002b). Gene replacement in mice reveals that the heavily phosphorylated tail of neurofilament heavy subunit does not affect axonal caliber or the transit of cargoes in slow axonal transport. J. Cell Biol. 158, 681-693. Rao MV, Houseweart MK, Williamson TL, Crawford TO, Folmer J, and Cleveland DW (1998). Neurofilament-dependent radial growth of motor axons and axonal organization of neurofilaments does not require the neurofilament heavy subunit (NF-H) or its phosphorylation. J. Cell Biol. 143, 171-181. Reilly MM (2000). Classification of the hereditary motor and sensory neuropathies 7. Curr. Opin. Neurol. 13, 561-564. Reynolds R, Burri R, and Herschkowitz N (1993). Retarded development of neurons and oligodendroglia in rat forebrain produced by hyperphenylalaninemia results in permanent deficits in myelin despite long recovery periods. Exp. Neurol. 124, 357-367. Rosen H, Karlsson JE, and Rosengren L (2004). CSF levels of neurofilament is a valuable predictor of long-term outcome after cardiac arrest. J. Neurol. Sci. 221, 19-24.

176

Olivier Braissant

Rosen H, Sunnerhagen KS, Herlitz J, Blomstrand C, and Rosengren L (2001). Serum levels of the brain-derived proteins S-100 and NSE predict long-term outcome after cardiac arrest. Resuscitation 49, 183-191. Rouleau GA, Clark AW, Rooke K, Pramatarova A, Krizus A, Suchowersky O, Julien JP, and Figlewicz D (1996). SOD1 mutation is associated with accumulation of neurofilaments in amyotrophic lateral sclerosis. Ann. Neurol. 39, 128-131. Roy S, Coffee P, Smith G, Liem RK, Brady ST, and Black MM (2000). Neurofilaments are transported rapidly but intermittently in axons: implications for slow axonal transport. J. Neurosci. 20, 6849-6861. Sanchez I, Hassinger L, Paskevich PA, Shine HD, and Nixon RA (1996). Oligodendroglia regulate the regional expansion of axon caliber and local accumulation of neurofilaments during development independently of myelin formation. J. Neurosci. 16, 5095-5105. Sanchez I, Hassinger L, Sihag RK, Cleveland DW, Mohan P, and Nixon RA (2000). Local control of neurofilament accumulation during radial growth of myelinating axons in vivo. Selective role of site-specific phosphorylation. J. Cell Biol. 151, 1013-1024. Save MP, Shetty VP, Shetty KT, and Antia NH (2004). Alterations in neurofilament protein(s) in human leprous nerves: morphology, immunohistochemistry and Western immunoblot correlative study. Neuropathol. Appl. Neurobiol. 30, 635-650. Schechter R, Beju D, and Miller KE (2005). The effect of insulin deficiency on tau and neurofilament in the insulin knockout mouse. Biochem. Biophys. Res. Commun. 334, 979-986. Schliess F, Gorg B, Fischer R, Desjardins P, Bidmon HJ, Herrmann A, Butterworth RF, Zilles K, and Häussinger D (2002). Ammonia induces MK-801-sensitive nitration and phosphorylation of protein tyrosine residues in rat astrocytes. FASEB J. 16, 739-741. Schmidt RE, Beaudet LN, Plurad SB, and Dorsey DA (1997). Axonal cytoskeletal pathology in aged and diabetic human sympathetic autonomic ganglia. Brain Res. 769, 375-383. Seshadri S, Wolf PA, Beiser A, Au R, McNulty K, White R, and D'Agostino RB (1997). Lifetime risk of dementia and Alzheimer's disease. The impact of mortality on risk estimates in the Framingham Study. Neurology 49, 1498-1504. Shah JV, Flanagan LA, Janmey PA, and Leterrier JF (2000). Bidirectional translocation of neurofilaments along microtubules mediated in part by dynein/dynactin. Mol. Biol. Cell 11, 3495-3508. Shaw G and Weber K (1982). Differential expression of neurofilament triplet proteins in brain development. Nature 298, 277-279. Shea TB, Jung C, and Pant HC (2003). Does neurofilament phosphorylation regulate axonal transport? Trends Neurosci. 26, 397-400. Sihag RK and Nixon RA (1989). In vivo phosphorylation of distinct domains of the 70kilodalton neurofilament subunit involves different protein kinases. J. Biol. Chem. 264, 457-464. Sihag RK and Nixon RA (1991). Identification of Ser-55 as a major protein kinase A phosphorylation site on the 70-kDa subunit of neurofilaments. Early turnover during axonal transport. J. Biol. Chem. 266, 18861-18867. Skre H (1974). Genetic and clinical aspects of Charcot-Marie-Tooth's disease 1. Clin. Genet. 6, 98-118.

Neurofilament Proteins in Brain Diseases

177

Sternberger LA and Sternberger NH (1983). Monoclonal antibodies distinguish phosphorylated and nonphosphorylated forms of neurofilaments in situ. Proc. Natl. Acad. Sci. U. S. A 80, 6126-6130. Sternberger NH, Sternberger LA, and Ulrich J (1985). Aberrant neurofilament phosphorylation in Alzheimer disease. Proc. Natl. Acad. Sci. U. S. A 82, 4274-4276. Sun D, Leung CL, and Liem RK (1996). Phosphorylation of the high molecular weight neurofilament protein (NF-H) by Cdk5 and p35. J. Biol. Chem. 271, 14245-14251. Teunissen CE, Dijkstra C, and Polman C (2005). Biological markers in CSF and blood for axonal degeneration in multiple sclerosis. Lancet Neurol. 4, 32-41. Tomkins J, Usher P, Slade JY, Ince PG, Curtis A, Bushby K, and Shaw PJ (1998). Novel insertion in the KSP region of the neurofilament heavy gene in amyotrophic lateral sclerosis (ALS). Neuroreport 9, 3967-3970. Trimmer PA, Borland MK, Keeney PM, Bennett JP Jr, and Parker WD Jr (2004). Parkinson's disease transgenic mitochondrial cybrids generate Lewy inclusion bodies. J. Neurochem. 88, 800-812. Trojanowski JQ, Schmidt ML, Shin RW, Bramblett GT, Rao D, and Lee VM (1993). Altered tau and neurofilament proteins in neuro-degenerative diseases: diagnostic implications for Alzheimer's disease and Lewy body dementias. Brain Pathol. 3, 45-54. Veeranna, Kaji T, Boland B, Odrljin T, Mohan P, Basavarajappa BS, Peterhoff C, Cataldo A, Rudnicki A, Amin N, Li BS, Pant HC, Hungund BL, Arancio O, and Nixon RA (2004). Calpain mediates calcium-induced activation of the erk1,2 MAPK pathway and cytoskeletal phosphorylation in neurons: relevance to Alzheimer's disease. Am. J. Pathol. 165, 795-805. Vivian L, Pessutto FD, de Almeida LM, Loureiro SO, Pelaez PL, Funchal C, Wajner M, and Pessoa-Pureur R (2002). Effect of propionic and methylmalonic acids on the high molecular weight neurofilament subunit (NF-H) in rat cerebral cortex. Neurochem. Res. 27, 1691-1697. Wang L, Ho CL, Sun D, Liem RK, and Brown A (2000). Rapid movement of axonal neurofilaments interrupted by prolonged pauses. Nat. Cell Biol. 2, 137-141. Wataya T, Nunomura A, Smith MA, Siedlak SL, Harris PL, Shimohama S, Szweda LI, Kaminski MA, Avila J, Price DL, Cleveland DW, Sayre LM, and Perry G (2002). High molecular weight neurofilament proteins are physiological substrates of adduction by the lipid peroxidation product hydroxynonenal. J. Biol. Chem. 277, 4644-4648. Watson DF, Nachtman FN, Kuncl RW, and Griffin JW (1994). Altered neurofilament phosphorylation and beta tubulin isotypes in Charcot-Marie-Tooth disease type 1. Neurology 44, 2383-2387. Willard M and Simon C (1983). Modulations of neurofilament axonal transport during the development of rabbit retinal ganglion cells. Cell 35, 551-559. Williamson TL and Cleveland DW (1999). Slowing of axonal transport is a very early event in the toxicity of ALS-linked SOD1 mutants to motor neurons. Nat. Neurosci. 2, 50-56. Wong NK, He BP, and Strong MJ (2000). Characterization of neuronal intermediate filament protein expression in cervical spinal motor neurons in sporadic amyotrophic lateral sclerosis (ALS). J. Neuropathol. Exp. Neurol. 59, 972-982. Wong PC and Cleveland DW (1990). Characterization of dominant and recessive assemblydefective mutations in mouse neurofilament NF-M. J. Cell Biol. 111, 1987-2003.

178

Olivier Braissant

Xu Z, Dong DL, and Cleveland DW (1994). Neuronal intermediate filaments: new progress on an old subject. Curr. Opin. Neurobiol. 4, 655-661. Xu Z and Tung VW (2000). Overexpression of neurofilament subunit M accelerates axonal transport of neurofilaments. Brain Res. 866, 326-332. Yabe JT, Chylinski T, Wang FS, Pimenta A, Kattar SD, Linsley MD, Chan WK, and Shea TB (2001). Neurofilaments consist of distinct populations that can be distinguished by Cterminal phosphorylation, bundling, and axonal transport rate in growing axonal neurites. J. Neurosci. 21, 2195-2205. Yabe JT, Jung C, Chan WK, and Shea TB (2000). Phospho-dependent association of neurofilament proteins with kinesin in situ. Cell Motil. Cytoskeleton 45, 249-262. Yabe JT, Pimenta A, and Shea TB (1999). Kinesin-mediated transport of neurofilament protein oligomers in growing axons. J. Cell Sci. 112 ( Pt 21), 3799-3814. Yang Y, Bauer C, Strasser G, Wollman R, Julien JP, and Fuchs E (1999). Integrators of the cytoskeleton that stabilize microtubules. Cell 98, 229-238. Yin X, Crawford TO, Griffin JW, Tu P, Lee VM, Li C, Roder J, and Trapp BD (1998). Myelin-associated glycoprotein is a myelin signal that modulates the caliber of myelinated axons. J. Neurosci. 18, 1953-1962. Yoshihara T, Yamamoto M, Hattori N, Misu K, Mori K, Koike H, and Sobue G (2002). Identification of novel sequence variants in the neurofilament-light gene in a Japanese population: analysis of Charcot-Marie-Tooth disease patients and normal individuals. J. Peripher. Nerv. Syst. 7, 221-224. Zhang Z, Casey DM, Julien JP, and Xu Z (2002). Normal dendritic arborization in spinal motoneurons requires neurofilament subunit L. J. Comp Neurol. 450, 144-152. Zheng YL, Li BS, Veeranna, and Pant HC (2003). Phosphorylation of the head domain of neurofilament protein (NF-M): a factor regulating topographic phosphorylation of NF-M tail domain KSP sites in neurons. J. Biol. Chem. 278, 24026-24032. Zhu Q, Couillard-Després S, and Julien JP (1997). Delayed maturation of regenerating myelinated axons in mice lacking neurofilaments. Exp. Neurol. 148, 299-316. Zuchner S, Vorgerd M, Sindern E, and Schroder JM (2004). The novel neurofilament light (NEFL) mutation Glu397Lys is associated with a clinically and morphologically heterogeneous type of Charcot-Marie-Tooth neuropathy. Neuromuscul. Disord. 14, 147157.

In: Brain Mapping and Diseases Ed: Diane E. Spinelle

ISBN: 978-1-61122-065-0 © 2011 Nova Science Publishers, Inc.

Chapter 9

SEGMENTATION PROPAGATION FROM DEFORMABLE ATLASES FOR BRAIN MAPPING AND ANALYSIS Marius George Linguraru∗1, Tom Vercauteren2,3, Mauricio Reyes-Aguirre4, Miguel Ángel González Ballester4 and Nicholas Ayache2 1

Diagnostic Radiology Department, Clinical Center, National Institutes of Health, Bethesda MD, USA 2 Epidaure/Asclepios Research Group, INRIA, Sophia Antipolis, France 3 Mauna Kea Technologies, Paris, France 4 MEM Research Center, Institute for Surgical Technology and Biomechanics, University of Bern, Switzerland

ABSTRACT Magnetic resonance imaging (MRI) is commonly employed for the depiction of soft tissues, most notably the human brain. Computer-aided image analysis techniques lead to image enhancement and automatic detection of anatomical structures. However, the intensity information contained in images does not often offer enough contrast to robustly obtain a good detection of all internal brain structures, not least the deep gray matter nuclei. We propose digital atlases that deform to fit the image data to be analyzed. In this application, deformable atlases are employed for the detection and segmentation of brain nuclei, to allow analysis of brain structures. Our fully automatic technique is based on a combination of rigid, affine and non-linear registration, a priori information on key anatomical landmarks and propagation of the information of the atlas. The Internet Brain Segmentation Repository (IBSR) data provide manually segmented brain data. Using prior anatomical knowledge in local brain areas from a randomly chosen brain scan (atlas), a first estimation of the deformation fields is calculated by affine registration. The image alignment is refined through a non-linear transformation to correct the segmentation of nuclei. The local segmentation results are greatly improved. They are ∗

E-mail: [email protected]

180

Marius George Linguraru, Tom Vercauteren, Mauricio Reyes-Aguirre et al. robust over the patient data and in accordance with the clinical ground truth. Validation of results is assessed by comparing the automatic segmentation of deep gray nuclei by the proposed method with manual segmentation. The technique offers the accurate segmentation of difficultly identifiable brain structures in conjuncture with deformable atlases. Such automated processes allow the study of large image databases and provide consistent measurements over the data. The method has a wide range of clinical applications of high impact that span from size and intensity quantification to comprehensive (anatomical, functional, dynamic) analysis of internal brain structures.

Keywords: MRI, brain, gray matter nuclei, atlas, registration, deformation, segmentation.

1. INTRODUCTION The advent of medical imaging modalities such as X-ray, ultrasound, computed tomography (CT) and magnetic resonance imaging (MRI) has greatly improved the diagnosis of human diseases. Until recently, the most common procedure to analyze imaging data was visual inspection on printed support. In the last decade, computer-aided medical image analysis techniques have been employed to provide a better insight into the acquired image data [Duncan and Ayache 2000]. Such techniques allow for quantitative, reproducible observation of the patient condition. Furthermore, the computing power of modern machines can be used to combine information from several images of the same patient (i.e. image fusion) or add prior information from a database of images. In this chapter, we present a fully automated medical image analysis technique aimed at the detection of internal brain structures from MRI data. Such automated processes allow the study of large image databases and provide consistent measurements over the data. In our case, we employ a priori anatomical knowledge in the form of digital brain atlases. Relevant background information about MRI and brain anatomy is provided next. In Methods we describe the different components of our image processing framework, which segments and quantifies internal brain structures by propagating deformable models of internal nuclei. Finally, results are presented and the algorithm is assessed.

1.1. Magnetic Resonance Imaging MRI has become a leading technique widely used for imaging soft human tissue. Its applications are extended over all parts of the human body and it represents the most common visualization method of human brain. Images are generated by measuring the behavior of soft tissue under a magnetic field. Under such conditions, water protons enter a higher energy state when a radio-frequency pulse is applied and this energy is re-emitted when the pulse stops (a property known as resonance) [Hornak]. A coil is used to measure this energy, which is proportional to the quantity of water protons and local biochemical conditions. Thus, different tissues give different intensities in the final MR image. From the brain MRI perspective, this quality makes possible the segmentation of the three main tissue classes within the human skull: gray matter (GM), white matter (WM) and cerebrospinal fluid (CSF).

Segmentation Propagation from Deformable Atlases for Brain Mapping and Analysis 181 Their accurate segmentation and sub-classification remains a challenging task in the clinical environment. The relative contrast between brain tissues is not a constant in MR imaging. In most medical imaging applications, little can be done about the appearance of anatomically distinct areas relative to their surroundings. In MRI, the choice of the strength and timing of the radiofrequency pulses, known as the MRI sequence [Stark et al.1999], can be employed to highlight some type of tissue or image out another, according to the clinical application. However, the presence of artifacts due to magnetic field inhomogeneity (bias fields) and movement artifacts may hamper the delineation of GM versus WM and CSF and make their depiction difficult [Fennema-Notestine et al. 2006; Guillemaud et al.1997; Han et al. 2006; Sled et al.1998; Van Leemput et al. 1999]. Several MRI sequences are used in common clinical practice. T1-weighted MRI offers the highest contrast between the brain soft tissues and is arguably the most popular MR acquisition technique used for brain diagnosis. On the contrary, T2-weighted and Proton Density (PD) images exhibit very low contrast between GM and WM, but high contrast between CSF and brain parenchyma. In other MRI sequences, like the Fluid Attenuated Inversion Recovery (FLAIR) sequence, the CSF is eliminated from the image in an adapted T1 or T2 sequence. More about these specific MRI sequences and their variations can be found in [Brown and Semelka 1999]. MR images depict a 3D volume where the organ or part of the body of interest is embedded. This information can be used to build a 3D representation of the structure of interest. This applies both to 2D sequences, where images are acquired in slices, and to the recently developed 3D sequences, where the data are captured in the 3D Fourier space, rather than each slice being captured separately in the 2D Fourier space [Brown and Semelka 1999; Stark et al. 1999].

1.2. Deep Gray Matter Nuclei The neurons that build up the human brain are composed of a cellular body and an axon. The latter projects its dendritic connections to other neurons in remote cerebral regions. In essence, gray matter corresponds to the cellular bodies, whereas the axons constitute the white matter. Cerebral gray matter is mainly concentrated in the outer surface of the brain (cortex), but several internal GM structures exist, as seen in Figure 1. These are known as deep gray matter nuclei and they play a central role in the intellectual capabilities of the human brain. Additionally, deep brain gray matter nuclei are relevant to a set of clinical conditions, such as Parkinson’s and Creutzfeldt-Jakob diseases [Summerfield et al. 2005; Linguraru et al. 2006]. The size and appearance of gray nuclei can be indicators of abnormality. However, their detection in MRI data sets remains a challenging task, due to their small size, partial volume effects [González Ballester et al.2002], anatomical variability, lack of white matter-gray matter contrast in some sequences and movement artifacts. A methodology for the robust detection of deep brain gray matter nuclei in multi-sequence MRI is presented in this chapter.

182

Marius George Linguraru, Tom Vercauteren, Mauricio Reyes-Aguirre et al.

1.3. Segmentation Based on Deformable Atlases Brain atlases are images that have been segmented and thus contain information about the position and shape of each structure. Such atlases can be binary (1 for the location of a structure and 0 for “outside”) or probabilistic, in which case the values correspond to the probability of a voxel containing the structure of interest. In order to locate such structures in a given patient image, the atlas image is deformed to match the shape of the patient brain through registration. Depending on the number of degrees of freedom and the type of geometric deformation allowed, registration can be rigid, affine, or non-linear (a deformation field specifying the displacement applied to each point).

Figure 1. The map of gray matter nuclei in axial view. To the left, an annotated map of deep gray matter internal nuclei reproduced from the Talairach and Tournoux atlas [Talairach and Tournoux 1988]: the caudate (C), putamen (P), globus pallidus (G) and thalamus (T). To the right, deep gray matter internal nuclei as seen in a normal T1 weighted axial MR image with good contrast between WM, GM and CSF.

Registration to a digital atlas has become a common technique with the introduction of popular statistical algorithms for image processing, such as Statistical Parametric Mapping (SPM) [Ashburner and Friston 2000] or Expectation Maximization Segmentation (EMS) [Van Leemput et al. 2001]. A widely-used probabilistic atlas is the MNI Atlas from the Montreal Neurological Institute at McGill University [Collins et al. 1998]. It was built using over 300 MRI scans of healthy individuals to compute an average brain MR image, the MNI template, which is now the standard template of SPM and the International Consortium for Brain Mapping [Mazziotta et al. 2001]. However the averaging is performed on the entire brain and the three main tissue classes: GM, WM and CSF. More anatomical details can be found in manually segmented brain scans, and popular or new options are the Zubal Atlas from Yale University [Zubal et al. 1994], the SPL Atlas from Harvard Medical School [Kikinis et al. 1996], the basal ganglia atlas build from histological data from Pitié-Salpêtrière Hospital in Paris [Yelnik et al. 2007] and IBSR from Massachusetts General Hospital, Harvard Medical School, which is employed in this work.

Segmentation Propagation from Deformable Atlases for Brain Mapping and Analysis 183

1.4. Gray Nuclei Segmentation The challenging nature of the problem of segmenting gray matter nuclei from MRI images stems from the lack of contrast, limitations of image resolution, and possible imaging artifacts. Few works have attempted to provide a fully automated algorithm for their identification and accurate delineation. [Dawant et al. 1999] propose a method for the segmentation of internal brain structures based on similarity and free-form deformations to register one segmented image. No statistical atlas information is employed for spatial normalization. [Joshi et al. 2004] propose a method for unbiased diffeomorphic atlas construction, and they show results on the segmentation of the caudate nucleus within the context of a study on autism. [Pohl et al. 2006] propose a method for joint segmentation and registration based on the Expectation-Maximization (EM) algorithm, and apply their method to the segmentation of the thalamus. We propose digital atlases that deform to fit the image data to be analyzed. Our fully automatic technique is based on a combination of rigid, affine and non-linear registration. A priori information on key anatomical landmarks is used to propagate the information from the atlas employing the computed deformation field. The technique offers the robust segmentation and quantification of difficultly identifiable brain structures in conjuncture with deformable atlases.

2. METHODS 2.1. Data For the analysis of deep gray nuclei in this chapter, we used the Internet Brain Segmentation Repository1 (IBSR) from the Center for Morphometric Analysis, Massachusetts General Hospital, Harvard Medical School. Boston, MA. The database consists of 18 highresolution T1 MR scans of normal subjects. For each scan, 43 individual brain structures, including the deep gray nuclei, are manually segmented. The MR image data are T1-weighted 3D coronal acquisitions. The image resolution is between 0.93x0.93x1.5 mm3 and 1x1x1.5 mm3. There are 4 female and 14 male datasets with ages between juvenile and 71 years, covering a large variability of brain anatomies.

Figure 2. The IBSR database. We present a case from the ISBR database: from left to right, the coronal MR T1 scan; the segmentation of WM (white), GM (yellow) and CSF (red); the map of the manually segmented 43 brain structures. 1

http://www.cma.mgh.harvard.edu/ibsr/

184

Marius George Linguraru, Tom Vercauteren, Mauricio Reyes-Aguirre et al.

A subject image from the IBSR database is shown in Figure 2. T1-weighted volumetric images from IBSR have been positionally normalized into the Talairach orientation (rotation only). This rigid transformation provides a first level of inter-subject alignment.

2.2. Spatial Normalization The large variability inherent to human anatomy and the differences in patient positioning across scans leads us to consider further spatial normalization for the identification of deep gray nuclei. This will allow localizing the areas of interest with the help of an atlas of the brain. Furthermore, it will make automatic inter-patient comparisons possible. For the construction of the statistical atlas, we chose using the data from IBSR, as it contains 18 manually segmented scans; they can provide the level of necessary information to guide the segmentation of brain structures, but also be used for the quantitative validation of the segmentation method. Given that the IBSR images are already aligned rigidly to the Talairach space, we perform a first refinement of the rigid registration using an affine transform. One random image from the database is selected as atlas. The atlas selection may introduce a bias, as the chosen atlas is not an average morphology and the segmentation does not account for intra-observer variability. The atlas T1-weigthed scan is registered to each of the other 17 T1 scans. We employ a robust block-matching algorithm to estimate the affine deformation between subjects’ scans. [Ourselin 2000, Ourselin 2001]. The block matching strategy is a two-step iterative method. The standard assumption behind the algorithm is that there is a global intensity relationship between the template or reference image, I, and the one being registered to it or floating image, J. The result is reflected by the registered image J’ = J ◦ T, with T being the registration transformation. In the first step, each block of I, BI, is locally translated over J and a correlation coefficient CC is maximized to blocks of J, BJ. We use a correlation coefficient, as the registration is performed between monomodal T1-weighted MR images. CC (B I , B J ) =

1 N2

i, j

(

)(

)

⎡ x i − μ BI y i − μ B J ⎤ ⎥ σ BI σ B J ⎢⎣ ⎥⎦ ,

∑⎢

where xi are elements of BI, yj are elements of BJ, and by μ and σ we denote the mean values and standard deviations. Thus, the transformation between the two images is computed block by block and a displacement field is generated after removing outliers. In the second step, a parametric transformation, in this case affine, is estimated by regularizing the deformation field to explain most of the block correlations. A least trimmed squared regression approximates the affine transformation by minimizing the residual error

min ∑ ri:n T

i

ri:n

2

,

2

where are the squared ordered Euclidean residual norms number of displacement vectors.

( )

ri = B I i − T B J i

and n is the

Segmentation Propagation from Deformable Atlases for Brain Mapping and Analysis 185 To improve robustness, this procedure is repeated iteratively at multiple scales. Resulting registered data are interpolated using a linear function. More details can be found in [Ourselin 2001]. The alignment of the atlas to all individual scans allows a more robust inter-subject analysis and statistical algorithms can be applied.

2.3. Refined Segmentation To be able to segment GM and WM in MRI data, a good contrast between these types of tissue in T1-weighted images is desired. Although image acquisition has radically improved over the last years, the variation in parameters and patient motion brings artifacts and variations in image appearance. Bias field inhomogeneities further contribute to the degradation of image quality. Hence, the segmentation of GM cannot be done reliably only from the patient images. An affine transformation provides a better level of inter-subject GM alignment than a rigid transformation. However, to segment small GM sub-structures a more precise registration is necessary. For the examples in this chapter, we will focus on the basal ganglia. Hence, we create a mask with the caudate, globus pallidus, thalamus and putamen, which will be referred as internal nuclei for the rest of this paper, from the atlas (Figure 3). We aim to use this mask for the segmentation of internal nuclei in the other subject images. Non-linear (free-form) registration is used to align the T1 scans of the affinely registered atlas and the corresponding T1 images of the 17 subjects. We employ a diffeomorphic nonlinear registration algorithm based on Thirion’s demons algorithm [Thirion 1998; Vercauteren et al. 2007a; Vercauteren et al. 2007b]. This algorithm has an open-source implementation [Vercauteren et al. 2007c] and is used in the free MedINRIA v 1.6.0 package2 from the Asclepios Research Group, INRIA [Toussaint et al. 2007].

Figure 3. The mask of internal nuclei. We show an axial view of the T1 image chosen as atlas and the corresponding mask of manually segmented basal ganglia, including the caudate (orange), globus pallidus (yellow), putamen (white) and thalamus (red).

It has been shown in [Pennec et al. 99] that the demons algorithm could be seen as an optimization of a global energy. The main idea is to introduce a hidden variable in the registration process: correspondences. We then consider the regularization criterion as a prior 2

http://www-sop.inria.fr/asclepios/software/MedINRIA/

186

Marius George Linguraru, Tom Vercauteren, Mauricio Reyes-Aguirre et al.

on the smoothness of the transformation T. Instead of requiring that point correspondences between image pixels (a vector field C) be exact realizations of the transformation, one allows some error at each image point. Given the template image I and the floating image J, we end up with the global energy

E (C , T ) = σ i−2 Sim( I , J o C ) + σ x−2 dist(T , C ) 2 + σ T−2 Reg(T ) ,

Sim( I , J o C ) =

1 2 I − J oC , 2

where σi accounts for the noise on the image intensity, σx for a spatial uncertainty on the correspondences, and σT controls the amount of regularization we need. We classically have dist(T,C) = ||C-T|| and Reg(T) = ||∇T||2, but the regularization can also be modified to handle fluid-like constraints [Cachier et al. 2003]. Within this framework, the demons registration can be explained as an alternate optimization over T and C. The optimization is performed within the complete space of dense non-linear transformations by taking a series of additive steps, T←T+u. The most straightforward way to adapt the demons algorithm to make it diffeomorphic is to optimize E(C,T) over a space of diffeomorphisms. This can be done as in [Malis 2004; Mahony et al. 2002] by using an intrinsic update step

T ← T o exp(u) , on the Lie group of diffeomorphisms. This approach requires an algorithm to compute the exponential for the Lie group of interest. Thanks to the scaling and squaring approach in [Arsigny et al. 2006], this exponential can efficiently be computed for diffeomorphisms with just a few compositions: Algorithm (Fast Computation of Vector Field Exponentials). · · ·

Choose N such that 2-N u is close enough to 0, e.g. maxp ||2-N u(p)|| ≤ 0.5; Perform an explicit first order integration: v(p) ← 2-N u(p) for all pixels; Do N (not 2N!) recursive squarings of v: v ← v ◦ v.

By plugging the Newton method tools for Lie groups within the alternate optimization framework of the demons, we proposed in [Vercauteren et al. 2007a] the following nonparametric diffeomorphic image registration algorithm: Algorithm (Diffeomorphic Demons Iteration). · · · ·

Compute the correspondence update field u using a regular demons step; If a fluid-like regularization is used, let u ← Kfluid * u; Let C ← T◦exp(u), where exp(u) is computed using the above fast algorithm; If a diffusion-like regularization is used, let T ← Id + Kdiff * (C-Id) (else let T ← C).

Segmentation Propagation from Deformable Atlases for Brain Mapping and Analysis 187 Having the deformation fields computed, we apply them to the mask of internal nuclei of the atlas, deforming the mask according to the position and size of the internal nuclei in each subject image. A diagram of the algorithm is shown in Figure 4. The deformed mask is used to segment the internal nuclei of the patient, namely the caudate, globus pallidus putamen, putamen and thalamus.

Figure 4. Diagram of the algorithm for segmentation and quantification of the brain deep gray matter nuclei.

In order to preserve the correct values of the segmentation labels posterior to the application of the transformation, nearest-neighbor interpolation is performed, as opposed to the case of patient image registration, which employed linear interpolation.

2.4. Quantification For each internal nucleus, we compute a segmentation overlap between the automatic and the manual segmentations as a quantifiable measure of the success of the algorithm. The metric for validation is based on the Dice Coefficient (DC)

DC =

2 S A ∩ SM S A + SM

,

where SA is the segmented region of the automatic method, and SM is the manually segmented region by an expert. The volume estimation between manual and automatic volume measurement is computed for each type of internal nucleus. To correlate the manual and automatic estimates, we use the R-squared (R2) value of the best linear fit of data correlation

R 2 (V A , VM ) =

cov(V A , VM )

σV σV A

,

B

where cov represents the covariance between the manual (VM) and automatic (VA) estimates of nucleus volume and σ the standard deviation.

188

Marius George Linguraru, Tom Vercauteren, Mauricio Reyes-Aguirre et al.

3. RESULTS You will note that we present our results alternating between coronal and axial views. Images in the IBSR database are acquired in a coronal view, but for visualization we show them in radiological convention view as well. We compared registration results at three levels of deformation: rigid, affine and nonlinear. Figure 5 presents one subject scan and the atlas being deformed to best match the subject. The rigid registration on the Thalairach space provides a good alignment, but does not handle any anatomical differences. The affine transformation is better suited for the registration, but still insufficient to align small structures, such as the internal nuclei. Finally, the non-linear refinement provides the best fit between the two 3D images. Note the adaptation of size and shape of the ventricles and thalamus. Checkerboard comparative images for the three levels of registration are presented in Figure 6 for a better visual assessment. Note the better correspondence between brain structures after non-linear registration. Hence, we save the non-linear transformation field presented in Figure 7 and apply it to the mask of internal nuclei (Figure 3).

Figure 5. Inter-patient registration: (a) the target image; (b) the source image after rigid registration; (c) the source image after affine registration; (d) the deformed source using non-linear registration.

Figure 6. Comparative registration results using checkerboards: (a) after rigid registration (b) after affine registration; and (c) using non-linear transformations;

Segmentation results for the group of deep gray matte nuclei (caudate, globus pallidus, putamen and thalamus) are illustrated in Figure 8. For visual assessment of the impact of the registration on segmentation, the results are shown after rigid, affine and non-linear registration and compared to the manual segmentation of nuclei. Segmented nuclei mask are overlaid on the T1 scans of the subject. Once more, we observe the superior segmentation

Segmentation Propagation from Deformable Atlases for Brain Mapping and Analysis 189 provided after non-linear registration. In Figure 9 we present difference images between nuclei mask using automatic and manual segmentations. The error in volume estimation using non-linear registration is significantly smaller than using transformations with fewer degrees of freedom.

Figure 7. Deformation fields. We present the source image (atlas) used in the registration and the deformation filed resulting from the non-linear registration to the target image.

Figure 8. Segmentation of gray nuclei: (a) the manual segmentation; (b) after rigid registration; (c) using affine registration; and (d) using the non-linear transformation fields.

Figure 9. Segmentation overlap with the manual segmentation: (a) the difference image after rigid registration; (b) after affine registration; and (c) using non-linear registration.

190

Marius George Linguraru, Tom Vercauteren, Mauricio Reyes-Aguirre et al. More segmentation results using non-linear registration are shown in Figure 10 and 11.

Figure 10. Segmentation of gray nuclei in radiological convention. We present segmentation results in axial (a), sagittal (b) and coronal (c) views. The bottom row shows the MR image for the visual evaluation of the automatic segmentation results.

Figure 10 shows typical segmentation results in a subject scan. We separate the nuclei using a color code: orange for caudate, yellow for globus pallidus, white for putamen and red for thalamus. Axial, sagittal and coronal views are presented for 3D assessment. In Figure 11 we browse through the 3D coronal space of the subject and compare the manual and automatic segmentation of the four internal nuclei. Finally, a 3D map of the segmented nuclei is illustrated in Figure 12 using 3D rendering. To quantify the quality of the segmentation for the 17 subject data, the overlap ratios and errors in volume estimation between the manual and automatic segmentations were computed. Values were calculated for each type of nuclei (caudate, globus pallidus, putamen and thalamus) and for all nuclei together, as denominated by gray nuclei. Numerical figures are presented in Table 1. As expected, numbers look better for the larger nuclei, as they are correlated with the structure size. The charts of the overlap ratio and error of volume estimation are seen in Figure 13 and Figure 14 respectively. The correlations between manual and automatic segmentation is presented in Figures 15 and 16. Figure 15 shows the best linear fit of the correlated data and the R-squared (R2) value for each category of nuclei (caudate, globus pallidus, putamen and thalamus). In Figure 16 we present the correlation for all internal nuclei together.

Segmentation Propagation from Deformable Atlases for Brain Mapping and Analysis 191

Figure 11. 3D segmentation of nuclei. We present comparative results between the manual and automatic segmentations of deep gray nuclei at six coronal locations along the 3D volume of the brain.

Figure 12. A 3D map of the segmented gray nuclei.

Table 1. Segmentation error. The rows present the overlap ratio and volume estimation error for four categories of gray nuclei (caudate, globus pallidus, putamen and thalamus) and the total volume of the nuclei (gray nuclei)

Overlap ratio Volume error (%)

Caudate 0.824±0.038 9.59±4.268

Globus Pallidus 0.788±0.045 11.112±7.02

Putamen 0.855±0.023 4.387±2.348

Thalamus 0.883±0.033 3.299±2.078

Gray Nuclei 0.855±0.018 2.613±2.058

192

Marius George Linguraru, Tom Vercauteren, Mauricio Reyes-Aguirre et al.

Figure 13. The computed overlap between manual and automatic segmentation of deep nuclei of the brain. The bar corresponding to “gray nuclei” refers to the combined volume of caudate, globus pallidus, putamen and thalamus.

Figure 14. The computed error in volume estimation between manual and automatic segmentation of deep nuclei of the brain.

It has been shown that the error induced by MRI partial volume effects in small structures can be in the range 20-60 % of the volume [González Ballester et al. 2000]. Taking into account the size of grey matter nuclei and the good correlation with manual segmentations, our results show the suitability of our approach for neuroanatomical studies.

Segmentation Propagation from Deformable Atlases for Brain Mapping and Analysis 193

Figure 15. The best linear fits and R-squared values for correlated volume estimations of the four categories of gray nuclei. The horizontal axes correspond to the manual segmentation, and the automatic segmentation estimates are shown on the vertical axes.

Figure 16. The best linear fit and R-squared value for correlated volume estimations of the total volume of the segmented gray nuclei: caudate, globus pallidus, putamen and thalamus.

194

Marius George Linguraru, Tom Vercauteren, Mauricio Reyes-Aguirre et al.

Given the high resolution and good contrast in the IBSR images, the inter-subject registration of T1-weighted MR images is sufficiently robust to govern the segmentation of small internal nuclei. However, in clinical practice data quality is variable and the intensity information from MRI may be inadequate to find an accurate alignment between scans. In these situations, it is desirable to use anatomical landmarks for the definition of more precise transformations. We proposed to employ easily identifiable anatomical structures in the brain, such as the lateral ventricles and cortex boundary. For more detail please refer to [Linguraru et al. 2006; Linguraru et al. 2007].

CONCLUSION We proposed digital atlases that deform to fit the image data to be analyzed. Our fully automatic technique is based on a combination of rigid, affine and non-linear registration. A priori information on anatomical landmarks was used to propagate the information from the atlas employing the computed deformation field. The technique offers the robust segmentation and quantification of difficultly identifiable brain structures in conjuncture with deformable atlases. In this chapter, we focused on the segmentation of the basal ganglia to present our algorithm for the segmentation of deep gray matter nuclei. An identical approach can be used for other inner brain structures to accurately segment them in patient images.

REFERENCES Ashburner J, Friston KJ. Voxel-based morphometry--the methods. Neuroimage. 2000 Jun;11(6 Pt 1):805-21. Brown MA, Semelka RC. MR imaging abbreviations, definitions, and descriptions: a review. Radiology. 1999 Dec;213(3):647-62. Cachier P, Bardinet E, Dormont D, Pennec P, Ayache N. Iconic feature based nonrigid registration: The PASHA algorithm. Computer vision and image understanding. 2003 Feb; 89(2-3):272-298. Collins DL, Zijdenbos AP, Kollokian V, Sled JG, Kabani NJ, Holmes CJ, Evans AC. Design and construction of a realistic digital brain phantom. IEEE Trans Med Imaging. 1998 Jun;17(3):463-8. Dawant BM, Hartmann SL, Thirion JP, Maes F, Vandermeulen D, Demaerel P. Automatic 3D segmentation of internal structures of the head in MR images using a combination of similarity and free-form transformations: Part I, Methodology and validation on normal subjects. IEEE Trans Med Imaging. 1999 Oct;18(10):909-16. Duncan J, Ayache N. Medical Image Analysis: Progress over Two Decades and the Challenges Ahead. IEEE Transactions on Pattern Analysis and Machine Intelligence 2000; 22(1):85-106. Fennema-Notestine C, Ozyurt IB, Clark CP, Morris S, Bischoff-Grethe A, Bondi MW, Jernigan TL, Fischl B, Segonne F, Shattuck DW, Leahy RM, Rex DE, Toga AW, Zou KH, Brown GG. Quantitative evaluation of automated skull-stripping methods applied to

Segmentation Propagation from Deformable Atlases for Brain Mapping and Analysis 195 contemporary and legacy images: effects of diagnosis, bias correction, and slice location. Hum Brain Mapp. 2006 Feb; 27(2):99-113. González Ballester MA, Zisserman AP, Brady M. Segmentation and measurement of brain structures in MRI including confidence bounds. Med. Image Anal. 2000; 4(3):189-200. González Ballester MA, Zisserman AP, Brady M. Estimation of the partial volume effect in MRI. Med. Image Anal. 2002 Dec;6(4):389-405. Guillemaud R, Brady M. Estimating the bias field of MR images. IEEE Trans Med. Imaging. 1997 Jun;16(3):238-51. Han X, Jovicich J, Salat D, van der Kouwe A, Quinn B, Czanner S, Busa E, Pacheco J, Albert M, Killiany R, Maguire P, Rosas D, Makris N, Dale A, Dickerson B, Fischl B. Reliability of MRI-derived measurements of human cerebral cortical thickness: the effects of field strength, scanner upgrade and manufacturer. Neuroimage. 2006 Aug 1;32(1):180-94. Hornak JP. The Basics of MRI, http://www.cis.rit.edu/htbooks/mri/ Joshi S, Davis B, Jomier M, Gerig G. Unbiased diffeomorphic atlas construction for computational anatomy. Neuroimage. 2004;23 Suppl 1:S151-60. Kikinis R, Shenton ME, Iosifescu DV, McCarley RW, Saiviroonporn P, Hokama HH, Robatino A, Metcalf D, Wible CG, Portas CM, Donnino RM, Jolesz FA. A digital brain atlas for surgical planning, model-drivensegmentation, and teaching. IEEE Transactions on Visualization and Computer Graphics 1996; 2(3):232-41. Linguraru MG, Ayache N, Bardinet E, Ballester MA, Galanaud D, Haïk S, Faucheux B, Hauw JJ, Cozzone P, Dormont D, Brandel JP. Differentiation of sCJD and vCJD forms by automated analysis of basal ganglia intensity distribution in multisequence MRI of the brain--definition and evaluation of new MRI-based ratios. IEEE Trans Med Imaging. 2006 Aug;25(8):1052-67. Linguraru MG, Gonzalez Ballester MA, Ayache N. Deformable Atlases for the Segmentation of Internal Brain Nuclei in Magnetic Resonance Imaging. International Journal of Computers, Communication and Control 2007;2(1):26-36. Mahony R, Manton J.H.. The geometry of the Newton method on non-compact Lie-groups. Journal of Global Optimization. 2002 Aug; 23(3):309-27. Malis E. Improving vision-based control using efficient second-order minimization techniques. IEEE Int. Conf. Robot Automat. 2004. Mazziotta J, Toga A, Evans A, Fox P, Lancaster J, Zilles K, Woods R, Paus T, Simpson G, Pike B, Holmes C, Collins L, Thompson P, MacDonald D, Iacoboni M, Schormann T, Amunts K, Palomero-Gallagher N, Geyer S, Parsons L, Narr K, Kabani N, Le Goualher G, Boomsma D, Cannon T, Kawashima R, Mazoyer B. A probabilistic atlas and reference system for the human brain: International Consortium for Brain Mapping (ICBM). Philos. Trans R Soc. Lond B Biol. Sci. 2001 Aug 29;356(1412):1293-322. Ourselin S, Roche A, Prima S, Ayache N. Block matching: a general framework to improve robustness of rigid registration of medical images. In: DiGioia AM, Delp S editors. Medical Robotics, Imaging and Computer Assisted Surgery (MICCAI 2000). Lectures Notes in Computer Science 1935, Berlin Heidelberg: Springer 2000; 557-566. Ourselin S, Roche A, Subsol G, Pennec X, Ayache N. Reconstructing a 3D structure from serial histological sections. Image and Vision Computing 2001;19(1-2):25-31. Pennec X, Cachier P, Ayache N. Understanding the demon’s algorithm: 3D non-rigid registration by gradient descent. . Med Image Comput Comput Assist Interv Int Conf Med Image Comput Comput Assist Interv. 1999; 597-605.

196

Marius George Linguraru, Tom Vercauteren, Mauricio Reyes-Aguirre et al.

Pohl KM, Fisher J, Grimson WE, Kikinis R, Wells WM. A Bayesian model for joint segmentation and registration. Neuroimage. 2006 May 15;31(1):228-39. Sled JG, Zijdenbos AP, Evans AC. A nonparametric method for automatic correction of intensity nonuniformity in MRI data. IEEE Trans Med Imaging. 1998 Feb;17(1):87-97. Summerfield C, Junqué C, Tolosa E, Salgado-Pineda P, Gómez-Ansón B, Martí MJ, Pastor P, Ramírez-Ruíz B, Mercader J. Structural brain changes in Parkinson disease with dementia: a voxel-based morphometry study. Arch. Neurol. 2005 Feb;62(2):281-5. Stark DD, Bradley WG, Bradley JR. WG. Magnetic Resonance Imaging. St Louis, Mosby 1999. Talairach J, Tournoux P. Co-Planar Stereotaxic Atlas of the Human Brain. New York, Thieme Medical Publishers 1988. Thirion JP. Image matching as a diffusion process: an analogy with Maxwell's demons. Med Image Anal. 1998 Sep;2(3):243-60. Toussaint N, Souplet J-C, Fillard P. MedINRIA : Medical image navigation and research tool by INRIA. MICCAI’07 Workshop on Interaction in Medical Image Analysis and Visualization. 2007. Van Leemput K, Maes F, Vandermeulen D, Colchester A, Suetens P. Automated segmentation of multiple sclerosis lesions by model outlier detection. IEEE Trans Med. Imaging. 2001 Aug;20(8):677-88. Van Leemput K, Maes F, Vandermeulen D, Suetens P. Automated model-based bias field correction of MR images of the brain. IEEE Trans Med Imaging. 1999 Oct;18(10):88596. Vercauteren T, Pennec X, Malis E, Perchant A, Ayache N. Insight into efficient image registration techniques and the demons algorithm. Inf. Process Med. Imaging. 2007a;20:495-506. Vercauteren T, Pennec X, Perchant A, Ayache N. Non-parametric diffeomorphic image registration with the demons algorithm. Med. Image Comput Comput Assist Interv Int. Conf Med. Image Comput. Comput Assist Interv. 2007b;10(Pt 2):319-26 Vercauteren T, Pennec X, Perchant A, Ayache N. Diffeomorphic Demons Using ITK's Finite Difference Solver Hierarchy. Insight Journal, ISC/NA-MIC Workshop on Open Science at MICCAI 2007. 2007c. Yelnik J, Bardinet E, Dormont D, Malandain G, Ourselin S, Tandé D, Karachi C, Ayache N, Cornu P, Agid Y. A three-dimensional, histological and deformable atlas of the human basal ganglia. I. Atlas construction based on immunohistochemical and MRI data. Neuroimage. 2007 Jan 15;34(2):618-38. Zubal IG, Harrell CR, Smith EO, Rattner Z, Gindi G, Hoffer PB. Computerized threedimensional segmented human anatomy. Med. Phys. 1994 Feb;21(2):299-302.

In: Brain Mapping and Diseases Ed: Diane E. Spinelle

ISBN: 978-1-61122-065-0 © 2011 Nova Science Publishers, Inc.

Chapter 10

BRAIN MAPPING ALTERATIONS IN STRABISMUS Martín Gallegos-Duarte1, Héctor F. Rubio-Chevannier2 and Jorge Mendiola-Santibañez3 1

Instituto de Enfermedades Congénitas. Querétaro, México 2 Unidad Neurológica Satélite, México, D.F. 3 Universidad Autónoma de Querétaro, México

ABSTRACT Congenital strabismus affects 3% of world population. Millions of persons suffer this condition, but still its origin or the reasons why not all patients respond to the traditional treatment are unknown. Until very recently, it was believed that congenital strabismus had no relation to cortical alterations; therefore, neuroimaging studies were only required when strabismus was present in premature infants or when brain damage was suspected. A preliminary study on strabismal patients in 1968 provided some insight into the incidence of the different presentations of strabismus in our institution, as well as the correlation among the various clinical signs. Based on this experience we decided to enlarge our sample. Using conventional EEG and digitized brain mapping (DBM) methods, we analyzed 195 young patients with clinical diagnosis of congenital strabismus –111 females (56.92%) and 84 males (43.08%); the age range was from 2 to 14 years. The DBM approach was done in real time. Given its low cost, security and availability, DBM turned to be a useful tool to evince some alterations in cerebral cortex related to congenital strabismus, especially dissociated strabismus. We also employed complementary neuroimaging methods for research purposes. From 195 DBM images, 56.4% exhibited various neuroelectric alterations, whereas 43.6% were considered normal. Abnormal DBM were more frequent in the dissociated strabismus group (64.95%) than in non-dissociated strabismus patients (42.6%); the rate of altered DBM images was higher in horizontal dissociated deviation cases (73.3%). Based on these findings, we recommend the use of DBM in patients with dissociated strabismus, and in some cases the treatment must go beyond surgery and glasses. Some of our patients were subjected to different neuroimaging methods, such as single Photon emission tomography (SPECT), magnetic resonance imaging (MRI),

198

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al. granulometry, and proton nuclear magnetic resonance spectroscopy (1H NMRS) with the aim of correlating this data and gain further understanding on the origin of congenital strabismus, particularly dissociated strabismus cases. This chapter addresses aspects of congenital strabismus, as well as some of its cortical implications –neuroelectric, neurometabolic and morphometric. The illustrations are meant to make this interesting and scarcely-explored topic more accessible.

1. STRABISMUS Congenital strabismus affects 3% of world population [1]. This condition refers to the pathological ocular deviation [Photo 1], [1], that is, while the dominant eye controls the visual sense and direction, the deviant eye exhibits a different alignment to the purpose and direction of the dominant eye [2]. Since no neurological damage is evident in this condition, the question that prompts is: What is congenital strabismus and where is its origin? [3] [Hoyt and Good]. To gain more insight into this problem, we employed clinical neurological studies and neuroimaging to get some answers. There are always small differences in visual perception and in the movement of both eyes. In normal conditions, these variations are harmonized and integrated in the cerebral cortex, so that perceived images from each eye are fused into one. In strabismus these differences are large and anomalous relations are established between both eyes originating a functional competence between both visual fields. This in turn produces neurosensory variations such as amblyopia and suppression [4]. Congenital strabismus appears before infants are one year old and its clinical manifestations are varied [1,2,3,5]. From these manifestations the distinct sensory-motor descriptions of this condition have been integrated. However, more important than the time of appearance of this condition, is the fact that congenital strabismus is accompanied or not of dissociated movements [4]. Primary dissociated movements by nature are always congenital [4]; they can be detected when one of the eyes is fixed on a determined object, then the other manifests smooth and intermittent movements with variable angles that are regulated independently of the supranuclear control and Hering’s law [Photo 2a, 2b] [6,7,8]. Dissociated movements are identified through their clinical manifestations as: dissociated vertical deviation (DVD) when the predominant dissociated movement is upward [Photos 2a,2b] and dissociated horizontal deviation (DHD) when the movement is variable, asymmetric and directed outward [Photos 3a, 3b, 3c, 3d, 4a, 4b, 4c] [6,7].

A in Strabismus Brrain Mapping Alterations

199

Phhotograph 1. In nfant with congeenital esotropia,, variety Ciancia. The left eye fixes f the gaze while w the rigght eye deviates inward.

In addition n, when the disssociated preddominant movvement is variaable and inwaard and it is acccompanied by DBM allterations, laatent nystagm mus, DVD, suppression, horizontal unncommittancee, hyperopia astigmatysmus a s, amblyopia and lack of toorticollis encoompasses a syyndrome know wn in Mexico as strabismic syndrome of angular variabbility (SSAV)) [8] [Photo 5aa, 5b, 5c, 5d].. DHD and SS SAV will be discussed d in more m detail in this chapter, since these foorms exhibit more m cortical alterations thhan the rest annd therefore have h been stuudied more thhoroughly.

Phhotographs 2a and a 2 b. In the left Photograph the left eye preesents a slight uppward deviationn due to a diissociated verticcal deviation in low degree thaat can be enhancced by diminishhing the entrancce of light to thhe eye or the quality of the imaage with a transllucent occlusor. These movem ments are independent or not asssociated with Hering’s H Law.

2000

Martín Gallegos-Duarte, Héctor F. Rubbio-Chevannieer et al.

Phhotographs 3a, 3b, 3c and 3d. Photographic P seequence taken in partial darkneess using the nigght shoot m mode. 6-year old d boy with DHD D, exhibits an inntermittent and variable v exodevviation when the right eye is fixed (the pupiil shows a light background refflection or Brokker's reflex withh a luminous spot at the e is deviated outward o and upward; the samee thing happens when the left eye is fixed, ceenter), the left eye thhe right eye then n gets deviated. Notice that devviation measurees are different for each eye. Thhis assymmetry and variability v in thee presentation angle a accompannied by other altterations such as a suuppression and amblyopia are not n a good signn in accordance with the normaativity of deviatiions reeported in neuro ophysiological studies s carried out o in our patiennts.

Phhotographs 4a, 4b and 4c. Patieent with DHD. Top: Exodeviattion of the rightt eye can be apppreciated beehind the translu ucent occlusor, while the left eye e is fixed. Bottom: The samee patient looking upward (ssupraduction). Notice N the asym mmetry betweenn the deviations of either eye; thhis clinically obbserved assymmetry is chaaracteristic of dissociated d strabbismus. Studies using digitizedd brain mappingg and SP PECT have sho own irregularitiees in the power,, symmetries annd coherences of o the different band b frrequencies that suggest s alteratioons in the neuroonal tracts –intrra-hemispheric and inter-hemisspheric.

Brain Mapping Alterations in Strabismus

201

Photographs 5a, 5b, 5c and 5d. Six-year old, female patient with a variety of dissociated strabismus called “strabismic syndrome of angular variability” (SSAV). Upper Photos: Patient turns to her right, to the front and to her left during a stable phase (non-variable). Lower Photos: Patient tries to turn to her left during the variable phase. The left eye can not shift itself possibly due to the isometric contraction of the medial straight muscle that is not able to relax while the right eye gradually increases its deviation angle. This condition might be propitiated by the active cortical inhibition following Hering’s law possibly hindered by cortical disturbances evinced in Digitized Brain Mapping.

In cases of congenital strabismus, in which dissociated movements are rather evident, ophthalmologists usually call it “dissociated strabismus”. This condition entails a

202

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

combination of movements in the horizontal, vertical and torsional directions, but the direction of the predominant movement is the one that gives name to the particular type. These dissociated movements can manifest themselves spontaneously, especially when the child in under physical or emotional stress: angry, tired, irritated, dehydrated or ill. There are some clinical manipulations that can induce this type of movements such as the cover test and cover-uncover test [9, 10] [Photos 2a, 2b]. Dissociated strabismus is usually related to neuroelectric, granulometric, sensory and perceptual alterations that will be addressed in this chapter. With regard to the origin of congenital strabismus, its multifactor character with certain family predisposition is generally accepted [5]. Electro-occulography studies (EOG) in first degree relatives considered healthy show 63% alterations in eye pursuit movements when they have a strabismic relative [11]. Although congenital strabismus does not follow a Mendelian inheritance pattern, in some occasions it behaves as a dominant autosomic disease of incomplete penetration and in other occasions as a multifactor disease [12]. In our sample, 27% of our patients [10] admit having at least other relative with strabismus. Among the many factors originating this disease, prematurity in newborns is an important risk factor to presenting strabismus, retinal alterations, refractive errors and neuronal immaturity [12]. In addition, newborns with low weight and respiratory distress [13,14,15] are especially susceptible to presenting periventricular, intraventricular or parenchymal hemorrhages. In premature newborns periventricular circulatory self-regulation is believed to be passive and dependent on perfusion pressure; meaning that fluctuations in arterial or central venous pressure, such as those occurring in traumatic births, due to respiratory alterations, the use of positive pressure and other maneuvers, can produce lesions in the vessels of the stem matrix [16,17]. Biochemical changes at this level [14] can also induce damage to neuronal interconnection pathways. This in turn produces various clinical manifestations, including strabismus. When early onset of strabismus is accompanied by evident neuronal damage, for example, infant cerebral palsy or psychomotor retardation, neuroimaging exams such as intracranial ultrasound, EEG and magnetic resonance imaging (MRI) are carried out as soon as possible to determine the type and extension of the brain damage. It is infrequent that a physician requests a BDM study to gain further insight beyond that attained with an EEG, though the former method is useful in congenital strabismus for providing information on cortical activity. Thus, patients with congenital strabismus are regularly prescribed lenses, visual therapy, orthoptic eye patches and surgery, but they could be presenting cortical malfunctioning, not clinically detectable. [8] Predisposition of patients to DBM alterations are those that are less than 7 years old and simultaneously present suppression, amblyopia, latent nystagmus and dissociated vertical deviation [Table 1].

Brain Mapping Alterations in Strabismus

203

Table 1. In a group of 68 patients with congenital strabismus the clinical signs (Pearson’s correlations) were analyzed to establish correlations. Four signs with high correlations –latent nystagmus, dissociated vertical deviation, amblyopia and suppression-- were identified in dissociated strabismus. These four elements were also correlated with altered brain mappings. Pearson´s Correlations

Suppression

Amblyopia

Latent Nystagmus

Dissociated Vertical Deviation

Latent Nystagmus

Dissociated Vertical Deviation

Suppression 1

Amblyopia

.

.001

.000

.000

68

68

68

68

.396**

.396**

.442**

.432**

1

.194

.217

.001

.

.112

.075

68

68

68

68

.803**

.194

1

.000

.112

.

.000

68

68

68

68

.803**

1

.442**

.432**

.217

.000

.075

.000

.

68

68

68

68

**

Correlation is significant at the 0.01 level (2-tailed). Analysis.

2. PERCEPTUAL ASSESSMENT AND STRABISMUS Although CS does not affect what Piaget and Vygotski [18,19] called “superior functions”, there is evidence indicating that various association areas such as Broca’s, Wernicke’s, angular gyrus, and parieto-occipital regions, as well as motor areas might be involved; the results of perceptual assessments [20] and neuroelectric alterations in DBM [21] support this hypothesis. The former can be understood when the cerebral cortex is visualized as a vast interconnection network. The visual cortex not only has feedback circuitry but also conveys information to other extra-striatum cortical zones. For example, the visual system is involved in the process of turning ideas into semantic and reading-writing messages [22], but impairments such as strabismus and amblyopia can deteriorate these abilities. It has been suggested that letter and word perception and reading comprehension are affected by visual, semantic, and environmental aspects where such reading occurs [22,23]. Moreover, lexicological and semantic levels affect the perceptual process in the phonological and logographical aspects, respectively. It is also known that patients with CS exhibit difficulty in second and third degree stereopsis; this deficit indicates impairment in cortical integration. A subjective manner to assess the performance of the visual system is through perceptual evaluations. These tests are designed to assess the capacity of the individual to give meaning

204

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

to the information provided by the visual system, cerebral cortex and association areas [23]. Through these tests it is possible to establish whether the responses are adequate for certain visual stimuli. Patients with strabismus present low spatial coordination, impairment in locomotor activity and a low profile in the results of perceptual tests. In a prospective study in which a screening perceptual assessment was carried out in a homogeneous group of 7-year old children with dissociated strabismus( n= 10), we found that all presented a low profile in visual perception, especially stereopsis, forms, sizes and spatial localization [21]. The mean values of these findings are given in Table 2. Table 2. Perceptual assessment. An average of visual abilities was evaluated in 10 children (7 year-old) with dissociated strabismus. The outcome of each test was always deficient (less than 100%) especially in stereopsis, velocity of perception, perceptions of forms and sizes, and peripheral vision. Strabismus Dissociated and Perceptual Alterations n = 10 Perception of depth (estereopsia) Visual memory Speed of perception Space perception Saccadic movements Peripheral vision Perception of fundamental elements Perception of forms and sizes Movements of pursuit

0% 77.50% 64.25% 56.25% 71.25% 41.75% 87.75% 41.75% 81.25%

All patients had average school performance and adequate socialization within parameters considered as normal by parents, pediatricians and teachers. However, when some parents were interviewed they recognize that their sons tended to mix–up letters when reading or writing, were slow at reading and doing their homework, got easily distracted, placed their faces at a very short distance from their notebook or had a bad quality in handwriting. Although these children presented oculomotor alterations without overt neurologic manifestations, they revealed visual perceptual deficits, possibly related to impairment in neuronal interconnection pathways between striatum cortex and cortico-cortical and interhemispheric areas participating in image processing –recognition, meaning, spatial localization, depth and visual memory, among others.

3. NEUROFUNCTIONAL STUDIES AND STRABISMUS In the study of strabismus and amblyopia different neurofunctional and morphometric methods have been utilized. Thouvenin [25] in France uses brain electrical activity mapping (BEAM) as a screening method to verify visual reactivity at cortical level in small children with strabismic amblyopia. Horton [26, 27] in the USA analyzes brain cortex in primates with cytochemical techniques; he has concluded that amblyopia is a cortical malfunction with

Brain Mapping Alterations in Strabismus

205

ophthalmologic manifestations. In the same country, Mendola [28] using Voxel analysis, reports diminution in gray matter in areas including the calcarine sulcus, parieto-temporal regions, and ventral temporal areas. Suk et al [29] in Hong Kong have used this same technique to analyze the redistribution of gray matter, which they think is due to brain plasticity, in adult Chinese patients with exotropia employing Voxel-based morphometry (VBM). Morphometric findings reported by Mendola [28] and Chan [29] are in agreement with the neurofunctional results by Gallegos et al. [8,9,21,30] [Photo 6] showing that areas of the extra-striate cortex are affected in dissociated strabismus. Gallegos-Duarte et al. [31] and Moguel-Ancheita et al. [32] using SPECT [Photo 7, 8] and DBM [9a, 9b]demonstrate the existence of improved cortical metabolic changes after strabismus treatment [30,31,32]. Gastaut [30] in 1982 and Panayiotopoulos [33, 34] in 1989, using EEG, described the paroxysmal symptomatology in occipital lobes as a different form of idiopathic partial epilepsy. This condition refers to occipital lobe epilepsy in children with its vast symptomatology, but in which ocular deviation is exceptional [35]. On the other hand, Gallegos [36] reports two DHD patients with a paradoxical cortical response to light, to whom intermittent Photo stimulation induces regularization in paroxysmal brain activity. [Photos 10a, 10b and 10c] Gallegos and Moguel [30,31,32] using SPECT, DBM and EOG demonstrate neuroadaptive changes taking place after the application of the botulism toxin to a girl with SSAV, which is attributable to an epileptogenic focus in ictal phase in the temporal lobe [Photo 7]. In addition, Gallegos et al. [21], using DBM [Photo 9a and 9b] and 1H-NMRS show the existence of active neuronal distress in cerebral cortex in patients with DHD [Photo 11a ] and SSAV [Photo 11b] manifested as the diminution in aspartate levels, lactate enhancement and loss of the relationship between creatine and choline in cases of dissociated strabismus.

Photograph 6. Photograph of an eight year-old boy with dissociated strabismus (DHD), attention deficit disorder, and low school performance. He exhibits irritative discharges during sleep in left frontotemporal regions (electrical activity was interpolated to brain mapping). EEG traces during wakefulness (not represented here) are anomalous, consisting of the slowing-down of the left temporal region and parieto-temporal asymmetry.

206

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

Photograph 7. Scintillography from tomographic images taken with SPECT scan analyzed 45 minutes after the iv administration of tecnecium 99 ethyl cysteinate dimer to be detected under spectrometric observation in the red-violet scale performed in a 5 year-old girl with SSAV. In zones 3 and 4 corresponding to right temporal area (left side of the image) an epileptogenic area can be appreciated. Zones 7, 8, and 9 –corresponding to left fronto-temporal area (right side of the image)—exhibit low expenditure of a glucose analog; these areas presented the lowest voltages. EEG showed slow and paroxysmal activity with hyperactivity in right fronto-temporal regions and higher power in right temporal region.

Photograph 8. A second brain SPECT was taken three months later, pharmacological treatment. The right temporal region has no signs of hyperactivity; a low to moderate hypoperfusion zone can be appreciated in the left fronto-parietal region, patent in transaxial and coronal sections. An increase in metabolic activity in occipital lobes is encountered when compared to the previous study.

Brrain Mapping Alterations A in Strabismus

207

Phhotograph 9a. Digitized D Brain Mapping of thee same case of Photo P 7. The stuudy shows increeased delta acctivity in both frontal fr lobes, spreading in lesseer degree to botth paracentral heead regions, andd diiminished anterro-posterior alphha gradient.

Phhotograph 9b. Digitized D Brain Mapping (DBM M) of the same case of Photo 8. 8 A second braiin mapping w taken three months was m later pharmacological treatment. t The study s revealed a discreet improovement in thhe distribution of o the power, a diminution d of dysynchrony d andd a discreet delaay in the cerebrral ellectrogénesis. A year later anotther DBM was taken t that was reported r like noormal.

2008

Martín Gallegos-Duarte, Héctor F. Rubbio-Chevannieer et al.

Phhotograph 10a. EEG Six-year old, o female withh DHD diagnossis. The EEG shhows unusually increased slow activity locaalized mostly both posterior heead regions shortly after the hyyperventilation began. b M Mixed with musccle and movemeent artifacts.

Phhotograph 10b. EEG of seem patient, p awake and a with good driving d responsee with the interm mittent Phhoto stimulation n with stroboscopic light (flashhing of 8 Hz/s).

Brrain Mapping Alterations A in Strabismus

209

Phhotograph 10c. The EEG of thee same patient shows s a focal sppike and show wave w dischargee emerging onn the right temp poral and parietaal region with secondary s spreaad to left homologous head reggions, event innterpolated a braain mapping.

These auth hors suggest thhat the dissociated movemeents are the oculomotor maanifestation off the epileptog genic disease [21, 30]. Bessides, Gallegoos et al [37] fiind, using graanulometry, thhat DHD and SSAV S have diifferent degreees of neuronall maturity that were determiined by this teechnique. mpleting the piccture of corticcal alterations underlying The above mentioned stuudies are com sttrabismus, and d it has becom me clear thatt the striate cortex and thee extra-striate cortex are innvolved in con ngenital dissocciated strabism mus. Moreoveer, neuroelectric studies of thhe cerebral coortex have sheed a considerab able amount off light on manyy aspects of thhis disease.

4.. DIAGNOSSTIC NEURO OPHYSIOLOGICAL METHODS APPPLIED IN STRABISMIC C STUDIES S S made the first reeport showingg that 30% off strabismic In 1950 Leevinson and Stillerman paatients presen nted electroenncephalographhic malfunctiooning. Stillerm man thought that t ocular allterations inclluding strabismus induced irritation in the occipital cortex, that is, for this auuthor strabism mus caused coortical changees, whereas Smith S and Keellaway propoounded that occcipital alterattions found inn electrical reccordings of some strabismicc patients were projected frrom thalamic nuclei and thhat the physioopathology off strabismus should be diffferent from eppileptogenic leesions [38]. Given the difficulties reesearchers in strabismus s hadd to confront at that time in i trying to unnderstand thiss condition byy means of EE EG studies, Sooto de la Vegaa and Romeroo-Apis [38] puublish in 197 70 the first series of 116 cases in straabismus (including some neurogenic n

210

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

associated diseases) showing that 92% of patients presented electroencephalographic anomalies, especially the presence of slow waves. In this study there is a diagnosed case of “intermittent exotropia” along with an electroencephalographic recording exhibiting “clear spike paroxysmal activity from temporo-occipital (right and left) and occipito-occipital derivations”. In retrospect, this case highly probably corresponded to a patient with dissociated strabismus, similar to intermittent exotropia, now known as DHD. Three fundamental facts originated from those early studies: a) a high incidence of cortical anomalies in the strabismic population, b) slow brain waves, and c) the presence of paroxysms. However, a long time had to elapse before many factors associated with dissociated strabismus could be correlated, namely clinical findings, neuroelectric recordings, neuroimaging studies and physiopathogeny. Based on those studies, Gallegos and Moguel [8] prospectively study DBM information from 11 patients presenting congenital esotropia with variability and uncoordinated manifestations, but now related to anomalies in the brain cortex (Fisher test, p< 0.001). These authors conclude that this syndrome has own characteristics. It is characterized by the presence of congenital esotropia, variability, limited abduction, latent nystagmus, lateral nystagmus, dissociated vertical deviation (DVD) amblyopia, suppression, asymmetric horizontal movements and hyperopic astigmatism. [8,9,10]. Preliminary studies of the 11 patients mentioned previously showed lateralized corticosubcortical dysfunction in 4 cases, diffuse dysfunction in 2 cases, asymmetry in frequency and power, electrooculogenesis delay in 2 cases, and non-lateralized irregular bursts of probable sub-cortical or centro-encephalic origin in 3 cases [8]. The combination of neuroimaging methods with electrophysiological studies allows a better localization of the origin of some alterations such as epilepsy, since the time-spatial resolution is enhanced [39]. A given example is the analysis of both, the neuroelectric behavior with DBM and the neurometabolic performance with SPECT, to study strabismus. [30, 31]. Using this combination of techniques, in one of our series of patients [30] the presence of low activity and high-voltage paroxysmal bursts and higher power in the right temporal region were evinced with EEG-DBM. Also, the presence of an epileptogenic focus in ictal phase was identified with SPECT imaging in the right temporal region originating a small symptomatogenic area (=194) with relative metabolic hyperactivity (64.7 U) [Photo 7]. This patient showed no neurological manifestations other than strabismus; this condition was characterized by: slow, variable and intermittent movements in the right eye, sometimes vertical and upward. These movements were present several times a week, particularly when she was tired or sleepy [Photo 4a]. The correlation between neurometabolic [Photos 7, 8] and neuroelectric alterations [Photos 6, 9a and 9b] could be related to the dissociated eye movements in a similar manner to some interictal EEG abnormalities observed in epileptic disorders. After treatment with botulism toxin, visual therapy and neurological handling, the symptomatology improved remarkably. The motor aspect was stabilized; cortical, electric and metabolic responses also improved. A subsequent control study revealed a redistribution of glucose expenditure where higher quantities were present in posterior brain regions [Photo 8]. As DBM measures minute electrical pulses in brain activity, SPECT can quantify minor differences in the consumption of glucose analogs, by generating spectrometric images in two and three dimensions that can be computer analyzed in vivo [40, 41]. Given its spatial

Brain Mapping Alterations in Strabismus

211

resolution, SPECT analysis is used to detect areas with functional deficits. [Photo 7] [31, 32, 40, 42] The positive findings encountered in the above-mentioned studies have stimulated the use of neuroimaging methods such as SPECT (Photos 7 and 8) EEG [Photos 10a,10b], DBM [Photo 10c], 1H-NMRS and MRI [Photos 11a, 11b and 11c], granulometry [Photos 12a, 12b, 12c, 12d], EOG [Photos 13, 14a, 14b, 14c], and neurometry [Figure 1, Table 3 ], in studies on cerebral cortex behavior in strabismus. For example, with the aid of neuroimaging techniques it has been possible to differentiate in an ontogenic and functional manner that congenital esotropia has two varieties: the most common was described by Dr. Alberto Ciancia and known as “Ciancia syndrome” [Photo 1], the second dissociated condition has been recently dubbed in Mexico as SSAV [Photos 5a, 5b, 5c, and 5c]. Each form has its own distinctive features [10]. Combined neuroimaging studies such as DBM and 1H-NMRS have recently contributed to the better understanding of SSAV (of recent nosologic description) and DHD (thought to be a type of intermittent exotropia until a few years ago); these ailments might be considered the oculomotor expression of a cortical malfunction [21,30]. By means of DBM it is known that DHD exhibits various malfunctions in brain electrogenesis different from those found in intermittent exotropia. [36] From 1H-NMRS information [21] it is also known that there is neuronal distress in DHD, whereas granulometry [37] has shown that this type of patients presents less granulometric density than healthy children do. [Photos 12a, 12b, 12c, 12c]

Photo 11a. Spectroscopy (1H-NMRS) of the occipital lobes of the brain of a boy of 7 years of age, with DHD diagnosis. A loss of the choline - creatine relation is observed.

212

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

Photo 11b. Spectroscopy (1H-NMRS) performed in a 4 year-old girl with SSAV showing high lactate levels (4 units) and decreased N-acetyl-aspartate concentration (12 units). The white square in the axial and sagittal projections shows the exact location where the 1H-NMRS sample was taken from.

Photograph 11c. Normal RMI of a girl of 7 years of age with SEVA. The macroestructural morphometrics reports always are normal in these cases; nevertheless, the determined microstructural reports by means of the granulometric analysis are altered.

Photographs 12a and 12b. White substance of the occipital lobes in a healthy 7 year-old boy. 12a Abundant granulometric small forms are appraised that penetrate deeply in the gray substance and in addition are ordered in coraliform aspect. (12a).The healthy brains are gradually losing the elements of small size of the white substance during the granulometric technique (12b).

Brain Mapping Alterations in Strabismus

213

Photographs 12c and 12d. 12c. White substance of the occipital cortex in a 7 year-old boy with DHD. Notice the heavy absence of small granulometric sized elements (12c) as well as lobulated aspect (12d) that emerge from two great pieces. During the procedure of elimination of granulometric sized elements, first the small elements disappear, later the elements of greater size are disappearing progressively. In the brain with DHD it is possible to be observed that the small elements do not exist and this is a important morphologic difference.

Figure 1. The graph shows higher left to right inter-hemispheric asymmetry values in all frequency bands from O1-O2 occipital regions. Long interconnection neurons might be responsible for this electric malfunctioning.

214

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

Table 3. The shows the numerical values of figure 1. Positive values in bold numbers lie above established parameters. It is worth noticing that the highest inter-hemispheric asymmetry in all frequency bands is located in the occipital lobes. Monopolar Interhemispheric Symmetry in a case of DHD

Total Delta Theta Alpha Beta Comb.

Fpl-Fp2

F3-F4

C3-C4

P3-P4

O1-O2

F7-F8

T3-T4

T5- T6

-0.5 -0.58 -0.19 0.45 -0.69 -0.07

-0.18 0.19 -0.2 -0.6 -0.26 -1.5

-0.73 0 0.2 -1.98 -0.68 0.97

-1.31 -0.68 -0.67 -1.6 -1.87 0.54

3.11 2.7 3.4 2.36 2.66 1.69

0.36 0.61 0.12 0.26 0.07 -1.45

0.58 0.35 0.42 0.96 0.03 -0.25

0.27 -0.17 0.19 0.58 0.36 -1.14

5. SPECTROSCOPY (1H-NMRS) In a study on children with dissociated strabismus [21] the biochemical composition of cerebral cortex was analyzed with 1H-NMRS to determine whether biochemical alterations could be found in occipital lobes in cases of SSAV and DHD. 10 children participated in this research in which metabolic alterations were reported, such as enhanced lactate levels [Figure 2], decrease in N-acetyl-aspartate levels Figure 3] and lack of correlation between choline and creatine. [Figure 4].

Figure 2. Increase in lactate concentrations in 6 out of 10 patients with DHD. Presence of lactate reflects hypoxia and neuronal distress. Blue bars correspond with low lactate levels, whereas green bars indicate high concentrations of this metabolite.

Brain Mapping Alterations in Strabismus

215

Figure 3. Diminution in N-Acetil Aspartate concentrations in 7 out of 10 patients with DHD. 1

H-NMRS gives information on the biochemical constitution of brain structures by measuring some metabolite concentrations. To achieve this electrons are excited in these substances by the incoming energy from magnetic resonance, this causes particles to change from a certain state α to a state β, when the electrons return to their initial state they release energy in the radiofrequency range that can be put into graphs. [43, 44] [Photo 11 a, 11 b] Among the quantifiable elements in the brain by 1H-NMRS is creatine (Cr), a metabolite associated with energy production; N-acetyl-aspartate (NAA), found in axonal projections in white matter and whose diminution indicates neuronal damage, and lactate (Lac) whose enhancement implies neuronal distress, since it is a metabolite of anaerobic glycolisis [44,45]. There is evidence showing that epileptogenic activity induces neurolectric and neurometabolic changes. Studies in rats [46] show that epileptic activity increases oxygen consumption in the affected area.

Figure 4. Creatine/ Choline relation. In normal conditions this relation must be 1:1, some patients presented changes in this proportion.

During the ictal phase [Photo 7] neurons receive an excitatory impulse that enhance oxygen consumption, which in turn reflects a subsequent depletion of energy in the affected

216

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

area; this induces, on the one hand, electroencephalographic changes [Photo 9a] and, on the other hand, metabolic changes in the area surrounding the lesion, consisting basically in a raise in oxygen, lactate and pyruvate levels [Photo 11b, Figure 2]. It has been suggested that dissociated movements may be a form of expression of the epileptogenic condition and that the cerebral cortex actively participates in their origin [30]. In a study carried out in 7 year-old children (n=10) with dissociated strabismus and EEG paroxysms, 6 exhibited lactate enhancement [Figure 2]] and 7 showed a small diminution in N-acetyl-aspartate [18] [Figure 3]. N-acetyl-aspartate is present in high concentrations almost exclusively in brain neurons; therefore, it can be used to measure neuronal loss or diminution of gray matter [43]. A decrement in this neuronal marker has been reported in occipital cerebral cortex in children with dissociated strabismus [18]. This agrees with the findings reported by Suk [29] in the sense that a diminution in gray matter might exist in the occipital lobes of strabismic patients. The presence of lactate in occipital lobes (site where samples were taken) point to the existence of acute neuronal distress that can be related to epileptogenic activity detected with EEG and DBM methods in distant areas of visual brain cortex, connected by intrahemispheric or transcortical tracts, while N-acetyl-aspartate diminution may indicate a decrease in neuronal volume. In perspective, these findings suggest that the symptomatogenic zone is far from the visual brain cortex [21].

6. EOG AND STRABISMUS Since Dewar introduced the electrooculographic (EOG) study in humans in 1877, this technique is the most widely used to understand vestibular functioning; currently this methodology has been enriched with the use of video-oculography [47]. Initially this test was carried out by using a galvanometer and electrodes immersed in saline solution. This method has been improved not only in the technical aspects but also in its accuracy since nowadays it has incorporated EOG and video-recording to the electroencephalographic recording of children with strabismus. To obtain precise EOG records two electrodes placed in the temporal lobes and at least one nasal electrode must be employed [44]. However, we add a modification by taking the recordings from frontopolar and/or anterior temporal lobes having as reference the interorbital-supranasal electrode [Photo 13]. This renders a rather simple morphology in EOG traces [Photos 14a, 14b, 14c] appropriate for practical observations.

Photograph 13. Position of the electrodes by strabismus study.

Brrain Mapping Alterations A in Strabismus

217

Phhotograph 14a. Normal electroooculographic trrace of a healthyy 7 year-old girrl. Upper trace corresponds c too left eye, lowerr trace to the rigght eye. A peak means electronnegative activityy and a valley ellectropositive acctivity. Dotted vertical v lines reepresent one-seccond intervals. The T procedure consists c in thhe patient follow wing with his/heer glance (withoout moving the head) glance a slow-moving object o diisplaced horizon ntally from left to right in a 100-s interval (slow w speed from leeft to right, VLIID, initials inn Spanish). In no ormal conditionns both eyes traces are simultanneous and keepp a 1:1 relation between b eye poositions and thee moving objectt (this relation iss called gain).

Phhotograph 14b. Electrooculogrraphic trace of a 7 year-old girll with SSAV. Inn this case the patient p must foollow with her glance g a slow moving m object frrom right to leftt (VLDI, initialss in Spanish). A decrease inn the electric potential is vieweed as a flatteningg of trace, simuultaneous to a significant delay in the puursuit movemen nt when comparred to the normal trace. Gain iss 25% higher (11:1.25), that is, the t reesponse is 200 ms m delayed withh respect to the normal one forr an object moviing horizontallyy in space.

Phhotograph 14c. The same patieent as in previouus 3 weeks afterr the applicationn of the botulinnic toxin into thhe medial straigh ht muscles. Thee procedure is too follow a slow w-moving objectt from right to left. l A Attenuation in th he trace can be appreciated a alonng with a largerr gain indicatingg a decrease in the t eclectic poower; this is clin nically called paresis, p caused in i this case by thhe chemical ageent. This sequennce carried ouut in different epochs shows ellectrooculographic variations inn the VLDI (sloow movement from f right to leeft) sequence originated by the pharmacologiccal handling of strabismus. s

218

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

Although this technique is simple, it enables the recognition, on the one hand, of oculopalpebral potentials during the EEG recording to identify some differences in amplitude and synchrony, as well as the polarity of slow pursuit and saccadic movements in treated and untreated patients with dissociated strabismus. To obtain DBM images, the recordings are not made in the EOG recording area, since eye movements produce artifacts that can be misleading. EEG studies in primates in which strabismus has been provoked [48] indicate a difference in the velocity of each eye movement when they go from an out toward an inside position (temporal nasal direction). This movement is quicker when eyes go from the inside out; this difference in velocities can be appreciated during pursuit movements as a delay with respect to the object displaced through space. This difference is known as gain [Photo 15]. The EOG analysis in patients with CS indicates alterations in pursuit movements [49]. In addition, permanence of opto-kinetic nystagmus (OKN) has been described in this type of patients at older ages.

Photograph 15. An object (white shade) uniformly moves of left to right at a constant speed of 10º /s and a distance of 50 cm in scotopic conditions (in the dark). The patient follows the object with this left eye while we observed the position of the eye with respect to the object. A lag in the position of the eye with respect to the object is observed. This misalignment is the "gain". The presence of "gain" means that there is motor instability and angular variability, which increases the risk of which the patients show a dissociated strabismus and greater incidence of alterations in the Digitized Brain Mapping registries.

Brain Mapping Alterations in Strabismus

219

7. NEUROPHYSIOLOGICAL STUDIES ON STRABISMUS: ELECTROENCEPHALOGRAM AND DIGITIZED BRAIN MAPPING In the study of strabismus, neurophysiological studies are ahead of other neurodiagnostic methods since they are endowed with a high temporal resolution (quasi-real). Besides, the obtained values are completely objective; hindrances being lower spatial resolution and its limitation to a bi-axial plane [50]. For these reasons data must be analyzed under strict neurofunctional parameters. The percentage of anomalous neurophysiological studies [Photo 16 and 17] in this series was considerably high [Figure 5]; therefore, we suggest that DBM must be performed in all patients with congenital and neurogenic strabismus, where there is evidence of dissociated movements, suspected hypoxia, low weight, neonatal trauma or some other gestational event. One must bear in mind that a single DBM considered as “normal” does not preclude previous or future abnormal mappings.

Photograph 16. EEG and Digitized Brain Mapping of a six year-old boy with SSAV (a form of dissociated strabismus). The study reveals bilateral irregularity; there is no antero-posterior gradient as should correspond to a patient of this age. Asymmetry due to lower voltage on right temporal lobe and bilateral slowing with irritative discharge in left frontal region interpolated to brain mapping.

2220

Martín Gallegos-Duarte, Héctor F. Rubbio-Chevannieer et al.

Phhotograph 17. Digitized D Brain Mapping bi-dim mensional imagge of the electricc activity of a 6 year-old giirl with DHD (o other form of diissociated strabiismus). There iss an asymmetryy in posterior regions due too the decreased beta activity in both right parieeto-occipital annd temporal regiions; this contraasts with the allpha- and theta- wave predominnance in the sam me regions ipsillateral to the noon-dominant eyee. Conventional EE EG exhibited asyynchrony in thee alpha rhythm.

Fiigure 5. We anaalyzed 195 filess with essential strabismus (nott neurogenic strrabismus). Mostt of the paatients showed neurologic n alterrations: 85 casees (56, 41%) weere reported likee normal whereas 110 paatients (63, 59% %) showed neuroelectrics alteraations.

DBM studiies are obtaineed of EEG datta, which in tuurn represent the power and the spatioteemporal relatio on of the diffferent frequenncy bands andd the electricaal conductivityy of neural grroups, especiaally of the apiccal dendrites of o the pyramiddal cells in cerrebral cortex. These T cells arre influenced by b the electriccal activity of subcortical neeurons [50]. DBM reveaals the dynam mic and functioonal character of the corticaal function in real r time. It caan be readily applied to all strabismic children. c It is employed reggularly to dettermine the im mplications an nd the possibble origin of some clinicaal manifestations of the disease. d An

Brain Mapping Alterations in Strabismus

221

example of the practicality of this technique is the verification of positive neuroadaptive changes posterior to medical treatment or surgery [30, 31, 32, and 51]. DBM data are useful to demonstrate an improvement in the gain parameter during horizontal version movements posterior to medical treatment or surgery [30]. This confirms the hypothesis of neuroelectric [30, 31] and neurometabolic [30,32] improvements in comparison to the values of these parameters previous to pharmacological handling with botulism toxin and/or surgery [Photos 7, 8, 9a and 9b]. The neuroadaptive capacity encountered in patients having undergone surgery for strabismus is certainly due to the plasticity of the human brain; this characteristic is defined as the capacity “to minimize the effects of lesions through structural and functional changes [51] [Pascual-Castroviejo]. The best way to assess this plasticity is by analyzing “the clinical situation with respect to the congenital anomaly or to the pre- and post-treatment stages in the acquired “processes” [51], in other words, to determine a “before” and “after” with the utmost objectivity [30, 31, 32] [Photos 7, 8 9a and 9b]. Among the benefits obtained from neurophysiological and neuroimaging studies one can mention the possibility of obtaining positive changes by medical and surgical handling of strabismus [30,31,32], such as improvement in electric [30,31] and metabolic [30,31] interhemispheric coherence, power redistribution [9,21,30], input improvement to occipital cortical regions [21], and a diminution of paroxysms [9,21]. It is important to emphasize that strabismus is not only a cosmetic matter; rather it has become a neurological question, which is the true issue. In order to verify whether the medical and surgical handling of strabismus modifies in a positive manner the neuroelectric signal (using DBM technique), a comparison was made between the incidence of pathological reports of volunteers who were subjected to this technique before and 3 months after surgery; their electroencephalographic recordings were compared, the preliminary study included 68 patients. The DBM previous to surgery revealed anomalies in 37 (54.4%) of 68 subjects [Table 4]. Table 4. Sixty-eight patients with diverse types of strabismus were analyzed. A Digitized Brain Mapping was carried out prior and after medical and surgical handling. Data show 54.4% of abnormal maps previous to treatment. First Brain Mapping n = 68 Frequency Percent Valid Percent

Cumulative Percent

indeterminate

1

1.5

1.9

1.9

normal

15

22.1

28.3

30.2

abnormal

37

54.4%

69.8

100.0

Subtotal

53

77.9

100.0

Missing System

15

22.1

Total

68

100.0

In 29 volunteers whit DBM abnormal already treated, a second DBM was performed 3 months after the surgery; from these 18 (26.5%) presented abnormalities in the DBM [Table 5]. Since participants in this study were volunteers, many refused to have a second DBM;

222

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

therefore, only a decreasing trend in anomalous DBM obtained 3 months after treatment could be shown. Table 5. After 3 months of medical and surgical handling, the incidence of abnormal Digitized Brain Mappings in a voluntary group (n = 29 patients) showed decreased to 26.5% of abnormal DBM. Second Brain Mapping n = 29 Frequency Percent Valid Percent

Cumulative Percent

normal

11

16.2

37.9

37.9

abnormal

18

26.5%

62.1

100.0

Subtotal

29

42.6

100.0

Missing System

39

57.4

Total

68

100.0

In other preliminary study the rates among the various kinds of congenital strabismus were analyzed, as well as the rates of neuroelectric alterations in DBM. A high incidence (38.24%) of dissociated strabismus (DHD, SSAV, variable esotropia) was found [Figure 6]; the more frequent neuroelectric alterations were hyperactivity and slowing-down of the activity [Figure 7].

Figure 6. Graph showing the incidence of various kinds of strabismus found in a 68-patient case study. A high incidence (38.24%) of dissociated strabismus was detected (14.71% with DHD and 23.53% with SSAV); the remaining subjects (61.76%) presented non-dissociated strabismus.

Brain Mapping Alterations in Strabismus

223

Figure 7. General trend of neuroelectric behavior in 68 patients with strabismus exhibiting positive alterations in the Digitized Brain Mapping previous to surgery.

In 49 patients (54.4%) of this preliminary series some alterations (slowing-down of the activity and paroxystic activity) were identified in the different areas of the cerebral cortex, though the majority of these alterations were predominant in occipital and frontal areas. [Table 6]. Table 6. In 49 out of 68 Digitized Brain Mappings it was possible to identify the predominant location of electrical disturbances. The majority of alterations consisted of slowing of the activity in occipital and anterior regions of the brain. Predominant location of the electrical alterations N = 49 Anterior

Temporal

Parietal

Occipital

Central

Mixto

Hemispheric

Slowing

4

2

1

9

2

9

4

Paroxystic

4

2

1

4

2

3

2

Total

8

4

2

13

4

12

6

Based on these findings, we decided to analyze 195 cases to determine whether alterations found in DBM rendered a significant difference between dissociated and nondissociated strabismus. From the sample, 111 (56.92%) were females and 84 (43.08%) males, ages ranging from 1 to 12 years old. [Figure 8]

224

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

60

50

Percent

40

30

20

56.92 43.08

10

0 Male

Female Sex

Figure 8. Digitized Brain Mapping analysis of 195 clinical cases; 111 (56.92%) were females and 84 (43.08%) males.

The majority of strabismic patients present neuroelectric alterations. From 195 patients, only 85 exhibited normal brain behavior, whereas 110 (56.4%) exhibited anomalies [Figure 9] Fourteen cases presented paroxysms, in 13 patients irritable zones were identified, slow waves were patent in 40 cases, a combination of slow waves and paroxysms was observed in 16 patients, and 27 patients exhibited other alterations as asynchrony, focalization, irritability, etc. [Table 7].

Figure 9. Trends in electrical behavior of 110 patients with altered Digitized Brain Mapping classified into groups: exotropia, 7 cases; esotropia, 39 cases; DHD, 22 cases; and other types of strabismus, 12. Notice the preeminence of esodeviations formed by esotropy and SSAV groups. These two add up to 69 cases or 62.7% of the whole sample (195 patients).

Brain Mapping Alterations in Strabismus

225

Table 7. Trend in the electric behavior of cerebral cortex in 195 cases with dissociated strabismus. From these, 110 cases exhibited alterations in brain mapping divided into: paroxysms, 14 cases (7.2%); slowing-down of brain waves (this was the most significant finding), 40 cases (20.5%); irritative area, 13 cases (6.7%); combined alterations, 16 cases (8.2%), and other types of malfunctions such as asynchrony and asymmetries, among others. Trend in the electrical behavior in Strabismus. n = 195

Valid

Total

Normal Paroxism Slowness Irritative zone Combination Others

Frecuency 85 14 40 13 16 27 195

Valid Percent 43.6 7.2 20.5 6.7 8.2 13.8 100

In altered DBM, dissociated strabismus was more frequent than non-dissociated ones. The rate of altered DBM was still higher in dissociated horizontal deviations, which is the variety with more neuroelectrics alterations followed by the SSAV group. In conclusion this study shows that some neuroelectrics alterations in the cerebral cortex are related to strabismus, especially dissociated strabismus [Table 7]. A clear systematization of strabismus can be established by studying the clinical behavior of congenital strabismus. However, neuroelectrics findings in DBM do not reveal a characteristic pattern for identifying each type of this condition. In addition, a clear cause/effect correlation has not been established. Certainly, strabismus in most cases leaves its mark in the electroencephalographic recording, though it is not always revealed in the first attempt, given the existence of “false negatives”. The former could be due to the multifactor origin of the disease [3,4,5,10,11] or to the ontogenic nature of the brain [52]. There are always irregularities in the neuroelectric oscillations, a changing background that can be modified by internal and external factors [50,53]. But this situation must not hinder the research of strabismus using DBM. The finding of electric alterations in DBM not only has drawn some light into the origin of congenital strabismus and the participation of the cerebral cortex, but also this knowledge can guide us to find the best therapeutic alternatives for these patients. For example, in the case of dissociated cases with altered DBM, it is necessary to give the patient additional visual therapy, together with a visual perceptual assessment and, if necessary, refer them to visual therapy, language therapy, child psychology or neurology, as the case requires. Though we can not assume a pathognomonic electric behavior in strabismus, we can correlate with caution every neurofunctional alteration with the clinical implications of the disease. For example, when strabismus is accompanied of dissociated movements, suppression, latent nystagmus and amblyopia, then cortical alterations are more evident [5,8,21]. The proportion of neuroelectric alterations that each of these eventualities

226

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

contributes in itself is not known, because they are intricately intermingled. A correlation of these clinical signs is shown in Table 1. Besides, it is known that these signs underlie dissociated strabismus, and this condition in turn presents more than 70% of the alterations found in DBM. The use of digitized brain mapping (DBM) as the chosen instrument to measure neurofunction in strabismus does not demerit the benefit that other methods with higher spatial resolution can offer and that may complement or be combined with the first technique, as the case requires, in a specific research problem within this field. In this sense, we have employed diverse complementary neuroimaging methods in vivo such as DBM, conventional EEG, neurometry, SPECT, 1H-NMRS, EOG, MRI, and granulometry. These techniques enable the analysis of brain electric behavior, energetic metabolism, biochemical composition, or morphometry. The information drawn from these approaches has provided insights into brain structure and function of children with strabismus. The use of one or more of these tools has provided information on the cause-effect relationship [21,30], structural maturity concept [37], evinced neuro-adaptive changes [30,31,32] posterior to medical and surgical treatments, as well as shed some understanding into the origin of the disease [21]. The combination of DBM, SPECT and 1H-NMRS has rendered solid evidence supporting the correlation between dissociated movements and epileptogenic disease [21,30]. Indeed, it is possible that when intermittent and variable involuntary oculomotor movements appearing several times a week are accompanied by positive paraclinic studies such as altered DBM are, in reality, and in agreement with the International League Against Epilepsy (ILAE) [54,55,56], a manifestation of epilepsy that has been evidently sub-diagnosed [21,30]. In other words, the presence of different irregularities of brain waves determined with EEG and DBM can be present in diverse neurological malfunctions such as it occurs in children with attention deficit disorder. In the specific case of children with dissociated strabismus, additional biochemical unbalances in cerebral cortex are detected with 1H-NMRS, as well as intermittent involuntary eye movements. By correlating these findings, there is evidence in dissociated CS not only for active neuronal distress, but also for the fact that these alterations in the cerebral cortex are more the cause than the effect of strabismus [21]. An example of the above is the marked presence of slow activity in brain electric activity. It is known that continuous slow activity may be associated with a diminution in cholinergic cortical afferences in anterior brain structures and that paroxysmal activity is linked to neurotransmission unbalances [50]. Both situations have been found in many of our patients [Figure 7 and Table 6], especially those with dissociated strabismus such as SSAV and DHD. We analyzed 27 clinical files of patients with DHD to determine the ratio between “slowing-down” and activity enhancement (paroxysms and irritative discharges. Thirteen cases (48.1%) showed positive slowing-down, whereas 6 of the 27 patients exhibited irritative discharges and 10 paroxysms. [Table 8] Age range of these patients was from 2 to 14 years old; mean age= 6.7 years and mode = 6 years. We found that brain alterations were scattered in the following manner: 25.9% temporal, 25.9% frontal, 22.2% occipital and 22% parietal as such or in combination with other regions. These findings bring to our minds those obtained with DBM approach in children suffering from attention deficit disorder (ADD). Similar to them, some patients with dissociated strabismus present a profile known as “maturity delay”, that is, enhancement of slow activity and deficit in fast activity.

Brain Mapping Alterations in Strabismus

227

Other point in common with ADD children is a higher epileptiform activity with respect to normal population of this age, as well as a decrease in inter-hemispheric coherence and an increase in the power of theta activity; this is interpreted by some authors as signs of immaturity and by others as developmental deviation [57]. Coherence alterations have been identified with the genesis of epilepsy; coherence studies are used to assess interconnections among different brain regions. [39, 57] In this sense, we have found that some cases of congenital strabismus, hipo-coherence of the wave delta in T5-T6. [Figure 10 and Table 10]. Table 8. Brain electric activity in 27 patients with DHD. The main finding is that 48.1% showed slowing-down of brain waves. Trends in the electrical behavior in Dissociated Horizontal Deviation (DHD) n = 27 Irritative discharge Paroxistic Activity Lentification Count Count Count Indeterminate

21

17

14

Positive

6

10

13

Epilepsy is more evident than strabismus in the neuroelectric recording. This is explained by the fact that paroxysms and power changes are readily identified by the visual inspection of the electroencephalographic recording [54,55,56]. The electric behavior of the cerebral cortex comprised in the EEG recording not only shows power alterations and evident signs of focalized malfunctions, but also relevant information can be gained by analyzing intra- and inter-hemispheric functional relations. For example, in the 70’s research on the behavior of the electric coherence of frequency bands was initiated [39]. Among the reported findings were the differences between young brains and old ones [55], and between healthy ones and those suffering from Alzheimer’s [58]. Schizophrenia, Alzheimer’s, and ADD were among the diseases studied with new recording methods such as QEEG [58, 59]. The initial aim of improving the recording techniques was made by Adrian and Matthews, who in 1934, replicate the studies carried out by Berger and state that even though the EEG technique can be employed as a biological marker, it is not possible with this sole methodology to understand the functioning of the central control regulating eye movements and their complex cerebral interconnections to comprehend strabismus [60].

8. NEUROMETRY The advent of digital systems to enable the conversion of an analog signal into a digital one --with more accuracy and minimization of sign deformation as time goes on--, as well as the extraordinary development of computational technology --that allows the instantaneous numerical analysis of the signal (QEEG) using algorithms-- are two breakthroughs that in combination with statistical procedures –univariate and multivariate— have provided more precise and sensitive recordings. This reliable information has enabled further insight into

228

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

various diseases, since it is now possible the detection of discreet changes with respect to normal “Z” values [Table 9]. Once the signal is improved, a computerized analysis of significant elements in the bioelectric activity --absolute and relative power, inter- and intra-hemispheric symmetries and coherences in different frequency ranges— is performed and compared with normal “Z” values to determine whether in congenital strabismus the identified changes occurring in the cerebral cortex are significant and thus might implicate the participation of the cerebral cortex in the physiopathogeny of this disease. In this sense, neurometry or the neurometric method is a highly valuable instrument [Table 9]. As digital computer technology developed in the 60’s and 70’s, it became feasible to assess and quantify with precision more parameters than was possible through human visual inspection of raw EEG waveforms. With these developments the field of quantitative computerized analysis (QEEG) came into existence. Bickford and his colleagues were among the earliest to introduced the compressed spectral array (Bickford, Fleming and Billinger, 1971) [61], which increased visualization. However, they did not provide a quantified evaluation regarding deviation from normal. Duffy and his associates [62] were among the first to exact meaningful information the volumes of data generated by the quantitative EEG (QEEG) techniques, by breaking continuous background activity into its spectral components, numerical values for the various components were thus obtained. By referencing these values to normal ones, a probability of normalcy can be established. Once a scaled value is established for a spectral component at each electrode site, a method for interpolating these values spatially between these sites is used to display a digitized brain map (DBM). These values are assigned hues of gray or colors within a scale which reflect changes over the scalp to illustrate the EEG findings. It is important to note that different QEEG techniques do not all share the same algorithms for determining normal deviations. John et al. [63] developed the neurometric Z score maps using transformation functions such as the log transform. These authors adjusted values for the subtle effects of aging by fitting these values to age-dependent parameters, as well as mathematical correct regression equations to reflect the influence of the electrical activity in one area of the brain over another area. Neurometric values calculated with Mahalanobis distance multivariate equations can correct the deviation activity in one hemisphere from deviations in the other hemisphere. Similarly, activity in the anterior regions can be calculated from activity in the posterior regions [62]. These calculations are conducted for both monopolar and bipolar derivations. In addition, since age correction regression methods can be used, the ability to fit an individual’s data can be tested to fit the regression curves at earlier ages, thereby assessing maturational lag of cortical development. In 1998, the Neurometric Analysis System was released for used by qualified medical professionals to perform post-hoc statistical analysis of EEG recordings [61]. This technique was certified to be Year 2000 Compliant in accordance with the guidelines for use by the FDA. Moreover, the American Academy of Neurology approved the neurometric method as a research tool over other QEEG methods.

Brain Mapping Alterations in Strabismus

229

Table 9. Intra- and inter-hemispheric values, fronto-temporal and fronto-occipital, surpass normal “Z” values. There is evidence of a diminution in both inter-hemispheric coherence in frontal lobes and intra-hemispheric gradient, as well as a decrease in centro-parietal synchrony in this Dissociated Strabismus case. Altered neurometric parameters in dissociated strabismus 1. Monopolar interhemispheric coherence (Z) Fp1-Fp2

F3-F4

C3-C4

P3-P4

O1-O2

F7-F8

T3-T4

T5-T6

Total

-2.68

-2.14

-1.3

-1.17

0.26

-1

-0.34

-0.01

Delta

-2.24

-2.11

-0.96

-2.02

-0.7

0.07

-0.51

-3.81

Theta

-3.04

-2.44

-1.55

-1.35

0.09

-1.34

0.51

0.57

Alpha

-1.88

-1.26

-1.41

-0.33

0.95

-1.81

0.62

1.35

Beta

-1.17

-1.18

-1.11

-0.16

-0.44

-0.17

0.16

0.73

Comb.

1.29

1.08

0.15

0.94

-0.01

0.57

-1.33

2.6

F8- T6

F3-Ol

F4-O2

Ol-F7

O2-F8

2. Monopolar intrahemispheric gradient (Z) F3-T5

F4-T6

F7- T5

Total

4.34

3.12

3.34

2.53

2.39

2.53

-1.83

-2.08

Delta

4.15

2.8

2.6

2.05

1.84

1.64

-1

-1.16

Theta

4.2

2.97

3.41

2.67

2.03

1.87

-1.59

-1.61

Alpha

4.09

3.9

3.42

3

2.84

3.46

-2.39

-2.7

Beta

2.78

0.51

2.6

0.8

-0.25

0.66

-0.1

-0.88

Comb.

2.51

2.36

1.88

1.64

1.77

1.76

1.19

1.2

3. Monopolar intrahemispheric synchrony (Z)

Total

Fp1-F3

F2-F4

T3-T5

T4-T6

C3-P3

C4-P4

F3-01

F4-02

0.38

-0.21

-0.38

-0.68

-2.37

-1.2

-0.25

-0.69

Delta

0.65

-0.12

-0.55

-0.61

-3.19

-1.03

-0.08

-0.95

Theta

0.28

-0.47

0

-0.02

-2.41

-1.21

-1.21

-1.09

Alpha

0.59

-0.17

-0.43

-0.84

-2.37

-1.61

0.71

-0.72

Beta

0.47

0.36

0

-2.88

-1.39

-1.76

-0.55

-2.13

Comb.

-1.16

-0.9

-0.91

1.78

1.71

0.44

-0.42

0.95

Prior to addressing the topic of neurometry it is important to remember that congenital strabismus is especially studied in children and that these patients exhibit some normal variations in brain electric behavior. It must also be considered that strabismus entails very subtle changes. Its specificity increases after the age of 6 given that the results can be compared with normal populations (normal “Z” values). Neuroelectric integration in 6-year olds is still unstable and has a larger variability range than in adults. These changes, together with the scarcity of parameters in healthy children to establish normal values, hinder the possibility of elaborating fine neurometric analyses in children younger than this age. For this reason, our neurometric analyses always refer to children older than 6 years [60, 63].

230

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

Normal values in our neurometric study have been validated in the asymptomatic population starting from 6 years of age. In the meantime, spectrographic analyses and their interpolation to brain mapping can be performed by means of various programs such as Persyst version 4.0. To carry out this type of studies, the American Clinical Neurophysiology Society (ACNS) has issued guidelines that recommend a minimum of 2-min conventional EEG recordings of representative epochs, free or artifacts, to produce a validated and certified neurophysiological interpretation. Neurometry or neurometric analysis is derived from quantitative electroencephalogram (QEEG) studies. Since its certification in 2000 by the FDA, its acceptance has been progressive. The major benefit of using computerized discriminatory mathematical equations means that obtained values can almost be simultaneously compared with normal “Z” values obtained from the healthy population of the same age [Figures 10, 11, 12, Photos 18, 19]. The neurometric analysis is, given its nature, eminently objective and descriptive. These properties allow the assessment of the topographic behavior without compromising the high temporal resolution of the EGG technique. Neurometry allows the correlation of the various EEG components and the delineation of its different characteristics along the various frequency ranges for each derivation. As a result very accurate information coming from multiple brain regions can be simultaneously obtained through the spectral analysis; thus our knowledge between structure and function is widened. A close relationship between electric activity and structure is established, as forming a unit. For example, coherence is thought to be mediated by the association of long and short cortico-cortical fibers, as well as by the association of cortico-subcortical fibers [58]. Thus, by coherence studies it is possible to classify different types of pathologies, such as in brain dementias, and differentiate them from healthy subjects, given that dementia patients present, among other deficiencies, a difficulty for processing and associating information [58, 64]. The incorporation of discriminatory mathematical analysis enables the acquisition of accurate information regarding various QEEG parameters and compares them with data bases to quantify deviations from normal values. Neurometry is not useful for identifying pathologies; rather it allows the perception of subtle changes that together with EEG data enable the statistical possibility of determining whether a certain value is out of the range of normal values and how this value is related to the rest of the electric activity in the brain at a certain moment [50]. This methodology makes quantitative analysis possible as well as allows the correlation of values that can be describing absolute and relative power (expressed in picowatts) from monopolar or bipolar electrodes. These results are defined, compared and combined in each frequency band. The same procedure is valid for assessing inter- and intra-hemispheric symmetry [Figure 1, Photo 18] and coherence [Photo 19, Figures 10 and 11, Tables 10 and 11].

Brain Mapping Alterations in Strabismus

231

Photograph 18. Digitized Brain Mapping of a six year-old boy with DHD. Schematic representation of the neurometric study shows to intrahemispheric asymmetry for the bands delta and beta, with predominance in right parietals regions. The conventional EEG showed paroxystic activity in right parietal region in addition to diffuse lentification.

Photograph 19. Schematic representation showing coherence of EEG spectral bands. Color scale on the right side of the image marks the level of inter-hemispheric coherence (in percentage) from low (blue color) to high (red color) values. A diminution in coherence can be appreciated in temporal and parietooccipital regions in a 6 year-old female patient with SSAV.

232

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

Figure 10. Distribution of inter-hemispheric coherence in a 6 year-old boy with SSAV. A decrease in delta waves (pink line) with value = -3.94 and an increment in alpha waves (green line) with value = 2.23 are present in left and right temporal regions.

Table 10. The Table 10 shows the numerical values of figure 10. Observe the great hipocoherence that is in the wave delta at level T5 and T6 (emphasized in yellow color). Alterations in the coherence of the wave delta at temporal level are as a relatively frequent finding in cases of congenital strabismus. These alterations suggest it extraestriated cortex participates in the origin of the congenital strabismus.

Total Delta Theta Alpha Beta

Monopolar interhemispheric coherence in a case of SSAV Fpl-Fp2 F3-F4 C3-C4 P3-P4 O1-O2 F7-F8 T3-T4 -1.22 -0.58 0.37 0.38 0.44 -0.5 2.14 -1.28 -0.64 0.4 0.27 -0.5 -1.34 -0.72 -1.7 -0.3 0.94 1.1 -0.52 -1.74 0.8 0.13 -0.32 0.72 0.73 0.99 0.55 2.23 -2.06 -0.41 0.19 0.47 -0.03 -2.11 1.54

T5- T6 -0.59 -3.94 0.27 0.2 0.39

Comb.

1.27

2.53

-1.78

-0.53

-0.39

-0.38

1.6

0.98

Brain Mapping Alterations in Strabismus

233

Figure 11. Neurometry study in a 6-year old boy with DHD. Alterations in coherence are evident especially occipital hypercoherence in theta and beta bands, as well as marked hypocoherence in the alpha rhythm in frontal brain regions.

Neurometric analysis of dissociated strabismus has shown, among other things, a negative increment in the intra-hemispheric monopolar gradient in the hemisphere corresponding to the non-dominant eye. As an example a case of a 6 year-old boy with SSAV is presented; his dominant eye is the right one and the left is suppressed [Photo 10, Table 10]. Table 11. The table sows the neurometric parameters of same case of figure 11. The clinical signs of the patients showed right visual preference, isovision, alternated suppression, and asymmetric exotropy with higher horizontal and vertical deviations in the left eye. Monopolar Interhemispheric coherence in DHD Fpl-Fp2 F3-F4 C3-C4 P3-P4 O1-O2 F7-F8

T3-T4

T5- T6

Total

-1.22

-1.09

-0.74

-1.05

2.15

-1.24

1.6

-2.59

Delta

-1.0 1

-1.26

-0.73

-0.79

1.35

-0.98

0.11

-1.19

Theta

-1.68

-0.91

0.15

0.03

2.16

-0.75

1.3

-0.63

Alpha

-1.58

-1.25

-0 .25

-1.71

1.87

-2.96

1.57

0.97

Beta

-0.3

-0.08

-0.03

-0.64

2.07

-0.38

1.59

0.5

Comb.

0.38

0.17

0.49

0.88

0.97

1.54

0.44

0

2334

Martín Gallegos-Duarte, Héctor F. Rubbio-Chevannieer et al.

Phhotograph 20. Digitized D Brain Mapping of a 6 year-old boy with w DHD. Thiss patient displayyed a grreater vertical deviation d in the left eye and left ft eye suppressioon. He underweent surgery on thhree occcasions for "in ntermittent exotrropy" (a diagnoosis mistaken) with w a relapse inn motor symptom matology. D DBM reveals disscreet inverse assymmetry in poosterior regions,, with enhancedd slow-wave acttivity of deelta and theta baands in the left hemisphere; higgher alpha activvity is present inn right hemisphhere, as well ass fronto-polar sllowing-down duue to higher dellta activity.

One year prior to surggery, the DBM M showed geeneralized parroxysms of intermittent i cllustered spikees of slow wavves during sleeep phase II recordings. r [P Photo 16] Onee year after suurgery the co omputerized trraditional studdy showed no n paroxysmal activity, thoough some vaariations weree evident in innter-hemispherric synchrony in posterior parieto-tempor p ral regions, ass well as in occcipital areas; data showed no persistent lateralizationn. In addition, changes in innter-hemispherric coherence were detectedd in parieto-occcipital regionss. As followss an example of o a DHD casee in which cohherence alteraation is manifeest, but this tim me on anterior brain regions [Figure 11, Table T 11, Photo 6]

Brain Mapping Alterations in Strabismus

235

Figure 12. A 6 year-old patient with DHD. The graphic show an increase in intra-hemispheric monopolar intrahemispheric gradient.

Table 12. The Table shows the numerical values of figure 12. The neurometric study exhibits an increase (in grey color) in intra-hemispheric statistical values in frontal regions of a 6 year-old patient with DHD. The yellow color indicates a decreed of the values in occipital-frontal regions. Monopolar Intrahemispheric Gradient in a case of DHD

Total Delta Theta Alpha Beta Combo

F3-T5

F4-T6

F7- T5

F8- T6

F3-Ol

F4-O2

Ol-F7

O2-F8

4.34 4.15 4.2 4.09 2.78 2.51

3.12 2.8 2.97 3.9 0.51 2.36

3.34 2.6 3.41 3.42 2.6 1.88

2.53 2.05 2.67 3 0.8 1.64

2.39 1.84 2.03 2.84 -0.25 1.77

2.53 1.64 1.87 3.46 0.66 1.76

-1.83 -1 -1.59 -2.39 -0.1 1.19

-2.08 -1.16 -1.61 -2.7 -0.88 1.2

Most of patient with dissociated strabismus present cortical alterations. We have studied a group of 10 patients with DHD and have found a great amount of alterations in the DBM [Photo 10c and 20], the neurometry [Figure 11] the spectroscopy [Photo 11b ] and the granulometry [Photos 12c and 12d] in all of them. From all image studies, neurofunctional ones are the most employed in the study of strabismus with regard to the cerebral cortex. However, in order to correlate structure with function, we have undertaken morphometric analyses in some patients, using magnetic resonance imaging to establish the absence of macro-structural alterations. However, when

236

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

analyzing topographical sections obtained by resonance in a granulometry study, we found relevant differences between the brains of healthy children and those with dissociated strabismus.

9. GRANULOMETRY Since the discovery of X-rays by Roentgen in 1895, a great advancement has been made to visualize the structures of the human body. Morphometric image studies, such as Computerized Axial Tomography scan or MRI, provide highly precise information of relatively large structures of the human body. However, given the complexity of the brain, there are structural aspects that are not liable to evaluation with conventional methods, for they can not be perceived at plain sight [64]. Granulometry is a concept used in image processing. This concept, originally introduced by Matheron [65-68] is useful and versatile for the morphological analysis of images. Its application includes a wide range of tasks, such as size estimation of the components in an image and image segmentation, just to mention a few. Granulometry is the study of the distribution by sizes of the particles comprising an aggregate. This method is employed in diverse areas to describe the qualities of size and shape of the granules in a product. For example, in a soil study, granulometry provides information on whether the soil is sandy, clayey, etc.; when dealing with cement, granulometric studies may define its application and final performance. Granulometric studies are based on a sieving process which is carried out with the help of a sieve, a measuring instrument that enables the classification of a material according to size. The main element in the sieve is the mesh. This technique entails the possibility of analyzing images in a numerical language, whereas MCD and neurometry provide objective neurofuctional information on the brain anatomical substrate. Both techniques are rather precise and a correlation is expected to give some insight into the origin of strabismus. By using granulometry, a micro-structural study of the brain and cerebral cortex may be carried out in vivo using mathematical and granulometric analyses of Pixel (picture elements) and Voxel (volume elements) acquired from positive three dimensional magnetic resonance images (3-D RMI T1). By means of Voxel based analysis, Mendola [28] analyzed three major brain areas and found a diminution in total volume distribution of gray matter in visual cortex -–parieto-occipital and temporal-ventral regions—of patients with amblyopia. In other study, a redistribution of gray matter was reported by Suk-tak et al. [64], using Voxel morphometric analysis from MRI in adults with exotropia. These patients showed a redistribution of gray matter on the brain surface attributed to neuroadaptive changes [29]. Through Voxel and Pixel analyses, Gallegos-Duarte [37] reported that the granulometric profile shows differences between two forms of congenital dissociated strabismus (strabismus syndrome of angular variation, SSAV, and dissociated horizontal deviation, DHD) attributable to the presence of varying degrees of maturity in the brain [37, 69]. From the above mentioned evidence we decided to carry out a granulometric analysis to study the cortical brain structure from MRI to correlate structure and function in subjects with dissociated strabismus. This method was not intended to obtain the cartography of the brain cortex, but rather the volume, order and distribution of cellular elements obtained from Voxel and Pixel analyses. In addition, the role that the brain cortex plays in congenital strabismus is

Brain Mapping Alterations in Strabismus

237

to be studied, as well as the relation of neuroelectric manifestations and the underlying brain structures. In the present communication a morphometric study is carried out. It consists in the determination of the characteristic structures of white and gray matter found in the occipital lobes of children with dissociated strabismus, and the correlation of these findings with brain tissue of normal children and that of children showing leukomalacia (a radiological sign of cerebral immaturity). Two healthy children are the control group (CG); the experimental group consists of four children with dissociated strabismus --two with DHD and two with SSAV; granulometric averages are carried out. A brain exhibiting leukomalacia is analyzed and compared with the other two groups as a reference of structural immaturity. In summary, two groups of patients are analyzed: one consisting of four patients with strabismus (two exhibiting SSAV and two DHD) and a control group. Granulometric curves are compared among strabismic and control subjects. Figure 13 shows the granulometric standard of white and gray matter in control subjects.

Figure 13. Granulometric patterns obtained from two control subjects.

These graphs were obtained by averaging the analyzed sections of healthy subjects. These patterns are useful when compared with patterns of subjects with SSAV and DHD. Patterns of subjects with strabismus are presented in Figure 14. In two control parameters (mature brains and immature brains), a comparison is made between granulometric values per group. The results are shown in Figure 15.

238

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

Figure 14. Granulometric patterns from four subjects with strabismus.

Brain Mapping Alterations in Strabismus

239

Figure 15. The control group (CG) shows a larger differential in the white matter (white columns) to gray matter (gray columns) ratio; the opposite occurs with the immature brain. Strabismus cases occupy an intermediate situation, in which the difference between these brain regions is smaller than in CG. Ratios of white to gray matter are the following: CG, 1.74; DHD (1) 2.15, DHD (2) 1.6, SSAV (1) 1.31, SSAV (2) 1.21, Leukomalacia 1.29.

In particular, three main groups of clear and dark structures are considered. These groups take into account the size of a square window, whose origin is in its center. The size of the window µ is computed as [2 µ+1] [2 µ+1], that is, the size µ=1 means a window [2(1)+1] [2(1)+1]=9 pixels, whereas µ=4, for example, means a square with [2(4)+1] [2(4)+1] =81 pixels. The groups are the following: Group 1. All the small structures within the sizes 3 to 5 are comprised. Notice that structures with sizes 1 to 2 are not considered, since noisy components are detected at these small sizes of the structuring element. Group 2. This group contains medium-sized structures located in the interval 6 to 9. Group 3. Finally, this group comprises large-sized structures, in the interval 10 to 15. In our case, MRI sections of occipital lobes of controls and patients with SSAV, DHD, and leukomalacia are analyzed [Figure 15]. The granulometric analysis consists in sieving the brain image prior to the calculation of a graph similar to that of granulometric density. This process is illustrated in Figure 16.

Figure 16. Image illustrating the sieving process.

240

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

The granulometric profile of the four analyzed groups showed important differences. Specifically, differences in this profile were encountered between SSAV and DHD groups [Figure 15]. [69] This study allowed the correlation between structure and function in some cases of dissociated strabismus. In the occipital lobes, changes in granulometric density of brain cortex were found. These changes could be differentiated and compared to determine the maturity of certain structures. This in turn could be related to the presence of slow waves in MCD of dissociated strabismus. Our results suggest that dissociated strabismus shows immaturity signs in neuronal granulometry: the immaturity level is more evident in children with DHD rather than in those with SSAV. The classification of strabismus is currently controversial. Therefore, our interest is to determine, based upon physiopathogeny, whether clinical manifestations correspond to different conditions, or whether they are different expressions of the same disease with a common origin. These structural differences [Photos 12a,12b, 12c and 12d] might be related to neuroelectrical behavior, for example. Patterns in neuronal distribution are capable of modifying the electric signal in EEG; in consequence, they are potentially quantifiable. This circumstance has been presumed in attention deficit subjects. In this respect, prevalence of atopic cellular groups is present in patients with Zinder dyslexia. Although the size of the sample was not enough to establish a correlation between electroencephalographic findings and structure, our findings open a field in which the correlation of these parameters can be made with great accuracy. Granulometric studies provided information concerning structural volumetric quantities detected in white and gray matter. In both cases, DHA and SSAV, changes were evident in white and gray matter when compared to volumetric quantities detected in control subjects. Furthermore, strabismic subjects with DHD exhibited less variation in GM than strabismic subjects with SSAV. With respect to WM, changes were encountered in large structures for both DHD and SSAV subjects, when compared to controls. These findings indicate that dissociated strabismus, specifically DHD and SSAV, may be originated mainly by alterations in gray matter and in large components of white matter.

10. METHODOLOGY a) Clinical Study All patients had their strabological clinical record made; this included: cycloplegic refraction with cyclopentolate, motoricity (ductions and versions, horizontal version trajectories, pursuit movements, monitored with night shoot video-recording in ectopic and mesopic conditions), sensory perception (visual acuteness, stereopsis tests, suppression diagnosis and amblyopia).

Brain Mapping Alterations in Strabismus

241

b) Electrooculography Ocular movements during the EOG recording were obtained with night shoot videorecording. The patient was seated facing forward. Subsequently, a stimulus to assess slow movements followed a horizontal trajectory at 10º/s. To check saccadic movements, patient was asked to look at a dim light located to his right or left, and he was indicated in which direction he had to look at. Studies were carried out in a room with neutral background, free of noises and distractions. The same parameters were used each time and were taken by the same health professional as required by the International Convention of Geneva to perform anthropometric measures in living subjects. For the simultaneous EOG and EEG recordings an additional nasal electrode was employed.

c) Perceptual Test A computerized perceptual screening was performed in an awake and cooperative patient, with optical correction, in a neutral environment free of external stimuli. A high resolution flat LCD monitor was ergonomically placed at a 60-cm distance from the patient at eye level to determine the perception of speed, space, shapes, sizes and primordial elements. Visual memory was evaluated, as well as reading and writing speed, slow pursuit and saccadic movements, peripheral vision, visual preference and manual preference. These assessments were all performed by the same personnel und following the same exploratory routine.

d) Brain Mapping A DBM was performed to all patients using the 10-20 International System with 21 channels and a 32-channel recording option with established parameters for each epoch, in printed form as well as pulse monitored. The cortical response to various stimuli was recorded and evaluated, using digital electroencephalography. Stimuli were light, hyperventilation, opening and closing of eyelids, sleep, and wakefulness. Simultaneous electrooculography (EOG) using specific electrodes and channels were employed to assess horizontal version movements both slow and saccadic.

e) Neurometry Is a method of quantitative electroencephalographic analysis (QEEG) that uses objective computer algorithms to extract a large number of quantitative from an EEG recording for comparison against a reference database. Each extracted feature is subjected to a statistical evaluation, and compared to the distribution of values of same features observed in a normative reference ("Z") database using multivariate statistical procedures

242

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

f) Magnetic Resonance Analysis of brain sections, 1 mm thick, was made using 3–D RMI T1 approach, without contrast and medication free. Multiplanar brain images were acquired in simple phase, spine eco routine power sequences employing the FLAIR technique.

g) Spectroscopy (1H-NMRS) Proton nuclear magnetic resonance spectroscopy, 1H-NMRS, was performed in both occipital lobes. A piece, 8 cm3, of brain cortex from each occipital lobe was selected and analyzed. The equipment and protocol were the following: Intera Pilips 1.0T, version 10.6, Fast Fell Echo sequence (FFE), T1 weighted in 3-D, field of vision (FOV) 230 mm, RFOV 80%, slice thickness 1 mm, without space between slices, eco time (ET) 6.9 ms, repetition time (RT) 25 ms, deviation angle (DA) 30 degrees, number of excitations (NAS) 1, number of slices 120.

h) Brain SPECT Brain SPECT was carried out using scintillography and analyzed every 45 minutes after the intravenous administration of tecnecium 99 ethyl-cysteinate dimer to enable the spectrometric observation in the red-violet scale.

CONCLUSIONS The human brain cortex is unique. It consists of an ontogenic design with a wide integration network at all levels. The visual system consumes a large part of these neurointegrative resources, so a motor sensory dysfunction such as strabismus not only leaves a frequent mark in DBM, but also the neurological findings available with neuroimaging techniques suggest cerebral cortex participation as the origin of dissociated movements underlying congenital strabismus. It is difficult to establish whether strabismus is the cause of DBM alterations or, conversely, brain alterations in the cerebral cortex originate ocular deviations. There is evidence showing that observed neuroelectric alterations in extra-striate cortex could be directly related to the presence of dissociated movements. It remains to be elucidated whether motor alterations or, more accurately, sensory alterations are the cause of the changes in the inter- and intra-hemispheric coherences encountered in neurometric reports. One of the clinical characteristics of dissociated strabismus is the sensory-motor asymmetry. In addition to this finding, in this study, we have encountered alterations in coherence, frequency and power asymmetries possibly related to alterations in long-axon neurons of inter-hemispheric interconnection.

Brain Mapping Alterations in Strabismus

243

When going from a major degree of ontogenic complexity to a minor one in a descending direction --from cortex to nuclei, from nuclei to effector organ-- it can be appreciated that the cerebral cortex plays a preponderant role that must not be ignored. Likewise, we can not disregard the evidence that the human being is especially prone to suffer from strabismus, an extremely rare disease in other species. Given that the human cerebral cortex is distinctively complex with respect to other species, we believe that in this structure lies the answer to some of our questions with regards to the cause of congenital strabismus and its origin. Evidence from current studies suggests that some cortical alterations related to dissociated congenital strabismus may induce motor dysfunctions as it occurs in epilepsy. In fact, there is no evidence pointing to motor alterations as the cause of paroxysms, slowing down of brain activity, cortical hyperexcitability, nor something indicating a possibility in the inverse direction; hence, our interest in trying to understand the participation of electric disturbances in association with the manifestations in the oculomotor system. The mechanisms underlying cortical disturbances in extra-striate areas apparently distant form each other may induce changes in ocular motility; though these mechanisms have not yet been elucidated. The presence of paroxysms possibly generates symptomatogenic zones capable of modifying the supranuclear control, as well as inhibiting Hering’s law. Once the latter happens, movements may become incoherent. Invariably, the eye pertaining to the hemisphere where the main cortical alterations are present corresponds to the eye presenting higher variability with regard to movement, suppression, amblyopia, dissociated deviation, and a more evident latent nystagmus. In summary, the eye with more sensory and motor alterations corresponds in general to the hemisphere exhibiting major alterations. We are aware that one study is not enough to establish accurately a cause-effect relationship between the activity of the cerebral cortex and strabismus, but by correlating various studies in this field we have been able to infer a physiopathologic basis for the origin of some alterations underlying congenital strabismus. In gaining a better understanding into the origin of congenital strabismus and into the neurological differences among the various types of this disease, better medical and surgical treatments will be available. Moreover, the opportunity of having a multi-disciplinary handling of the strabismic patient –neurodiagnostics, neurology, therapy and psychology, among others-- will be possible. Some of the bad outcomes frequently found after the surgical handling of strabismus can be associated with a bad pre-operative diagnosis [70], for example, to underestimate the cortical participation in the sensory and motor behaviors in this disease. It is currently within our reach in reference to dissociated strabismus the possibility of more precise surgeries, the emphasis on visual pre-and post-operative rehabilitation, as well as a better counseling to the family with regard to the neurological implications. In summary, a better knowledge on the origin of the problem and its implications enables a better treatment for the patient.

244

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

ACKNOWLEDGMENTS The authors wish to thank to the foundation Mario Moreno Reyes for the financial support and M. Sanchez Alvarez for proof-reading this manuscript.

REFERENCES [1]

[2] [3] [4] [5] [6]

[7]

[8] [9] [10]

[11] [12] [13]

[14] [15] [16]

Ciancia, AO.; La esotropia del lactante, En: Actualidades del estrabismo latinoamericano, Consejo Latinoamericano de estrabismo. Centro mexicano de estrabismo, México, D.F. 1998, 47-52. Ciancia, AO.; On Infantile Esotropia with Nystagmus in Abduction. J. Pediatr. Ophthalmol. Strabismus 32: 280-288. 1995. Hoyt CS, Good WV.: Infantile strabismus: What is it? Where is it? Br. J. Ophthalmol. 1994; 78:325-6. Gallegos-Duarte, M.; Estigma y origen de la endotropia congénita. Rev. Mex. Oftalmol. 79 (1): 10-16. 2005 Helveston EM. The origins of congenital esotropia. J. Pediatr. Ophthalmol. Strabismus 1993; 30: 215-232. Romero-Apis, D. Castellanos-Bracamontes, A. Acosta-Silva, M.: Estrabismos disociados, En: Temas selectos de estrabismo segunda Edición. Centro Mexicano de Estrabismo 2005: 49-59 México, D.F. Shokida F.: “Desviación Horizontal Disociada: Diagnóstico y tratamiento” En: Curso Básico. Acta Estrabológica. 2001; en línea: http://www.oftalmo.com/estrabologia/rev01/01-13.htm. Gallegos, M; Moguel, S.; Rubin de Celis, B.; Alteraciones en el mapeo cerebral en la endotropia congénita variable. Rev. Mex. Oftalmol; 2004; 78 (3): 122-126. Gallegos-Duarte, M.: Respuesta cortical paradójica durante la fotoestimulación intermitente. Cir. y Cir. 2005; 73 (3): 161-165. Gallegos-Duarte M: Maniobras exploratorias en la endotropia congénita En: Temas Selectos de Estrabismo. Centro Mexicano de Estrabismo SC. México, Composición Editorial Láser. México, D.F. 2005, 1-18. Sarubbi M.C., Letiz, M.A. Infantil esotropia: an inevitable legacy? Am. Orthopt. J. (55): 112-121. 2005. Maumenee IH, Alston A, Mets MB, Flynn JT, Mitchell TN, Beaty TH: Inheritance of congenital esotropia. Trans Am. Ophthalmol. Soc. (84): 85-93. 1986. Philippa M Pennefather Ph M, Clarke MP, Strong NP, David G Cottrell DG, Dutton J, Tin W Risk factors for strabismus in children born before 32 weeks gestation. Br. J. Ophthalmol. 83: 514-518. 1999. Stanley, F.J. survival and Cerebral Palsy in low birthweight infants: Implications for perinatal care. Pediatric Perinatal Epidemiology 1992, 6, 298-310. Tersidou V, Bennett P; Maternal risk factors for fetal and neonatal brain damage. Biol. Neonate 2001;79(3-4):157-62. Pulido-Rivas P., Martínez-Sarries J.F., Sola R.G. Tratamiento de la hidrocefalia secundaria a hemorragia intraventricular en el prematuro. Revisión bibliográfica. Rev. neurol. 44 (10): 616-624.

Brain Mapping Alterations in Strabismus

245

[17] Greisen G, Vannucci RC. Is periventricular leukomalacia of hipoxic-ischaemic inyury ? Hypocapnia and the patern brian. Biosl. Neonate. 2001; 79(3-4): 194:200. [18] Hernández, R J. Entre Piaget y la pared del tubo neural. Gaceta Médica de Querétaro, 2003; 12 (3): 62-69. [19] Vygotski, L. S., El desarrollo de los procesos psicológicos superiores, Grijalbo, Barcelona, 1988. [20] Bravo-Cóppola, L. Las destrezas perceptuales y los retos en el aprendizaje de la lectura y la escritura. Una guía para la exploración y comprensión de dificultades específicas. En: Revista electrónica “Actualidades Investigativas en Educación”. Universidad de Costa Rica, Ed IMEC 2004; 4 (1): 1-24. [21] Gallegos-Duarte M, Mendiola-Santibañez J, Ortiz-Retana JJ. Dissociated deviation. A strabismus of cortical origin. Cir y Cir 2007 (75); 4: 243-249. [22] McClelland, J. L. Mirman, D., and Holt, L. L. (2006). Are there interactive processes in speech perception? Trends in Cognitive Sciences, 10(8), pp. 363-369. [23] McClelland, J. L., McNaughton, B. L., and O'Reilly, R. C. Why there are complementary learning systems in the hippocampus and neocortex: Insights from the successes and failures of connectionist models of learning and memory. Psychological. Review, 102, 419-457. 1995. [24] Thouvenin D, Tiberge M, Arne JL, Arbus L.Brain electrical activity mapping in the study of visual development and amblyopia in young children. J. Pediatr. Ophthalmol. Strabismus; 32(1):10-6. 1995. [25] Horton, J.C. and Hocking, D.R: “Timing of the critical period for plasticity of ocular dominance columns in macaque striate cortex”. J. Neuroscience, 17:3684-3709,1997. [26] Horton, J.C., Hocking, D.R., An adult-like pattern of ocular dominance columns in striate cortex of newborn monkeys prior to visual experience. J. Neuroscience 1996, 16:1789-1805. [27] Mendola JD, Conner IP, Anjali R, Chan ST, Schwartz TL, Odom JV, Kwong KK. “Voxel-based analysis of MRI detects abnormal visual cortex in children and adults with amblyopia”. Human Brain Mapping 2005; 25(2) 222-236. [28] Chan ST, Tang KW, Lam KC, Chan LK, Mendola JD; Kwong KK. Neuroanatomy and adult strabismus: a voxel-based morphometric analisys of magnetic resonance structural scans. Neuroimage (22) 986-994, 2004. [29] Gallegos-Duarte M, Moguel-Anchita S. Participación y neuromodulación de la corteza extraestriada en el estrabismo. Arch. Chil. Oftal. Vol 63, (2): 199-209. 2006. [30] Gallegos-Duarte, M, Moguel-Ancheita S: “Modifications neurologiques adaptatives après traitement médical et chirurgical du syndrome strabique avec variations des repères angulaires” Réunion de printemps, Association française de strabologie. 110 Congres de la société Française d´Ophtalmologie. Paris. mai, 2004. http://perso.wanadoo.fr/hoc.lods/demo150.html. [31] Moguel-Ancheita S, Orozco-Gómez L, Gallegos-Duarte M, Alvarado I, Montes C. Cambios metabólicos en la corteza cerebral relacionados con el tratamiento de estrabismo. Resultados preliminares con SPECT”. Cir Ciruj 2004; 72:165-170. [32] Caraballo RH, Cersósimo RO, Medina CS, Tenembaum S, Fejerman N. Idiopathic partial epilepsy with occipital paroxysms. Rev. Neurol. 25(143):1052-8. 1997. [33] Panayiotpoulos CP, Inhibitory effect of central vision on occipital lobe seizures. Neurology 1981; 31:1330-3.

246

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

[34] Caraballo RH, Cersosimo RO, Medina CS, Tenembaum S, Fejerman N. Idiopathic partial epilepsy with occipital paroxysms. Rev. Neurol. 1997; 25: 1052-8. [35] Gallego-Duarte, M.; “Respuesta cortical paradójica durante la fotoestimulación intermitente en el estrabismo disociado”. Cir Ciruj 2005; 73 (3): 163-167. [36] Gallegos-Duarte M, Mendiola-Santivañez JD, Ortiz-Retama JJ.: Estrabismo disociado y maduración. Boletin del Consejo Latinoamericano de Estrabismo (CLADE) 2007, 21; 2. (In press). [37] Soto-de la Vega M, Romero-Apis D. Alteraciones electroencefalográficas en el estrabismo. An. Soc. Mex. Oftal. 1970 (1): 9-18. [38] Céspedes-Gacía Y, González-Hernández J.A.García-Fidalgo J., Beguería-Santos R.A., Figueredo-Rodríguez P. Coherencia cerebral interictal en pacientes con epilepsia del lóbulo temporal. Rev. Neurol. 27 (12): 1107-1111. 2003. [39] Morales-Chacon L, Sánchez-Catasus C, Águila A, Bender J, García I, García ME, Lorigados. Contribución del SPECT cerebral en la evaluación de la epilepsia del lóbulo temporal farmacoresistente. Experiencia del CIREN. Rev. Mex. Neuroci. 2005; 6 (3) 250-256. [40] Riikonen et al.: SPECT and MRI in foetal alcohol syndrome. Developmental medicine and child neurology 1999, 41: 652-659. [41] Piovensan EJ, Cristiano Lange M, Kowacs PE, FemelliH,Werneck LC, Yamana A, et Al. Structural and functional analyses of the occipital cortex in visual impaired patients with visual loss before 14 years old. Arq Neuropsiquitr 2002; 60 (4): 949-953. [42] Onofre-Castillo JJ, Martínez HR, Arteaga M, Gómez A, Olivas-Mauregui S.; Espectroscopia por resonancia magnética en enfermedades neurológicas. Rev. Mex. Neurol. 2002; 3 (4) 213-217. [43] Warren K E.; NMR Spectroscopy and pediatric brain tumors. The oncologist 2004; (9): 312-318. [44] Poca MA, Sauquillo J, Mena MP, Vilalta A, Rivero M.; Actualizaciones en los métodos de monitorización cerebral regional en los pacientes neurocríticos: presión tisular de oxigeno, microdiálisis y técnicas de espectroscopia por infrarrojos. Neurocirgía 2005; (16): 385-410. [45] Darbina O, Rissob JJ, Carreb, Lonjonc EM, Naritoku DK. Metabolic changes in rat striatum following convulsive seizures. Brain Research 1050 (1): 124-129. 2005. [46] Doménech-Campos E, Armengol-Caroeller M, Barona de Guzmán R. Electroculografía: aportación al diagnóstico del paciente con alteraciones del equilibrio. Act Otorrino Esp (56):12-16. 2005. [47] Tychsen L; Wong AM; Burkhalter A.: Paucity of horizontal connections for binocular vision in V1 of naturally strabismic macaques: Cytochrome oxidase compartment specificity. J. Com. Neurol. 2004, 474 (2): 261-75. [48] Melek NB, Garcìa H, Ciancia AO. La elecroculografía (EOG) de seguimiento de persecución en las esotropias con limitación bilateral de la abducción (LBA). Arch. Oftalmol B Aires (54): 271-276. [49] Cabanyes-Truffino J, Cartografía cerebral: metodología y aplicaciones en la clínica neurológica. Rev. Neurol. 28 (11): 1090-1098. 1999. [50] Pascual-Castroviejo. Plasticidad cerebral. Rev. Neurol. (Barc) 1996; 24 (135): 13611366.

Brain Mapping Alterations in Strabismus

247

[51] Hans-Rudolf Shc. Some findings concerning the relationship between ontogesesis and cytoarchitecture of the primate brain. J. Comp. Neurol. 2004; 133 (4): 411-427. [52] Herrmann CS, Demiralp T. Human EEG gamma oscillations in neuropsychiatric disorders. Clinical Neurophysiolology 116: 2719-2733. 2005. [53] Rubio D F. Epidemiología de la epilepsia, En: Manual clínico de la epilepsia, JGH Editores, México 1997: 15-20. [54] Pozo-Lauzan D, Pozo-Alonso AJ.: Nuevo enfoque conceptual de la epilepsia. Rev. Cubana Pediatr. 2001; 73 (4): 224-9. [55] Engel J Jr. ILAE commission report. A proposed diagnostic scheme for people with epileptic seizures and with epilepsy: report of the ILAE task force on classification and terminology. Epilepsia 2001; 42: 1-8. [56] Mauritis N M, Scheeringa R, Van der Hoeven J H, de Jong R. EEG coherence obtained from an auditory oddball task increases with age. Journal of Clinical Neurophysiology. (23): 395-403. 2006. [57] Calderón-González P.L, Parra-Rodriguez M.A., Libre-Rodríguez J.J., Gutiérrez J.V. Análisis espectral de la coherencia cerebral en la enfermedad de Alzheimer. Rev. Neurol. 2004; 38 (5): 422-427. [58] Snyder S M., Hall J R. A Meta-analysis of Quantitative EEG power associated with attention-Deficit hyperactivity disorder. Journal of Clinical Neurophysiology 23 (5): 440-452. (2006). [59] Adrian E.D., Matthews B.H.C. The interpretation of potential waves in the cortex. J. Physiol. (81): 440-471. 1934. on line http://jp.physoc.org/cgi/reprint/81/4/440. [60] Fleming, N.L.and Ballinger, T.W. (1971).Compression of EEG data by isometric power spectral plots. EEG Clin.Neurophysiol., 1971 (31): 632. [61] Duffy F.H. Bartels, P.H., Burtfiel, J.L. Significance probability mapping. An aid in the topographic analysis of brain electrical activity. EEG Cil. Neurophysiol. 1981 (51): 455-462. [62] John, E.R., Prichep, L., Fridman, J., Easton, P. Neurometrics: computer-assisted differential diagnosis of brain dysfunctions. Science 1988; 293 (4836): 162-169. [63] Snyder S M., Hall J R. A Meta-analysis of Quantitative EEG power associated with attention-Deficit hyperactivity disorder. Journal of Clinical Neurophysiology 23 (5): 440-452. (2006). [64] Suk-tak Ch; Kwok-win T; Kwok-cheung L; Lap-kong Ch; Mendola JD; Kwong KK. Neuroanatomy and adult strabismus: a voxel-based morphometric analisys of magnetic resonance structural scans. Neuroimage (22) 986-994, 2004. [65] Matheron G.: El´ements pour une th´eorie des milieux poreoux. Mason,Paris , 1967. [66] Vincent L.: Granulometries and Opening Trees. Fundamenta Informaticae, 41(12), 57– 90, 2000. [67] Vincent L., Dougherty E. R.:Morphological segmentation for textures and particles. In Digital Image Processing Methods E.R. Dougherty, editor,. Marcel Dekker, New York, (1994) 43–102. L. [68] Dougherty E. R.: Granulometric Size Density for Segmented Random-Disk Models. Mathematical Imaging and Vision, 17(3) (2002) 267–276.

248

Martín Gallegos-Duarte, Héctor F. Rubio-Chevannier et al.

[69] Gallegos-Duarte M, Mendiola-Santivañez JD, Granulometría de la corteza cerebral en el estrabismo. Free paper, Event ID: PP1106; 27 Congreso Panamericano de Oftalmología. Cancún México mayo 2007. [70] Gallegos-Duarte M., Vidal-Pineda R, Enfermedad iatrogénica en estrabismo. Rev. Mex. Oftalmol.; 81 (2): 61-64. 2007.

In: Brain Mapping and Diseases Ed: Diane E. Spinelle

ISBN: 978-1-61122-065-0 © 2011 Nova Science Publishers, Inc.

Chapter 11

ENDOVASCULAR BRAIN MAPPING: A STRATEGY FOR INTRAOPERATIVE VISUALIZATION OF BRAIN PARENCHYMA FUNCTIONALITY H. Charles Manning1,2,3 , Sheila D. Shay1, Erich O. Richter4, Swadeshmukul Santra5 and Robert A. Mericle1,3 1

Vanderbilt University Department of Neurological Surgery 2 The Vanderbilt University Institute of Imaging Science 3 Vanderbilt University Department of Radiology and Radiological Sciences 4 Louisiana State University HSC, Department of Neurological Surgery 5 University of Central Florida, Nanoscience Technology Center, Department of Chemistry and Biomedical Science Center

ABSTRACT Within the field of cognitive neuroscience, brain mapping strategies aim to localize neurological function within specific regions of the human brain. The burgeoning fields of functional magnetic resonance imaging (fMRI) and functional electrophysiology seek to map the human brain with ever-improving resolution. However, these functional strategies do not enable real-time, intraoperative discrimination of functional and nonfunctional brain parenchyma with precise, well-defined margins, as are necessary for surgical guidance and resection. To address the need for an intraoperative brain mapping strategy aimed specifically at neurosurgical guidance at resection, we have developed a novel brain mapping technique that we term preoperative endovascular brain mapping (PEBM). PEBM combines a super-selective, intraarterial approach with the delivery of visually detectable contrast agents to identify specific regions of functional and nonfunctional brain before and during craniotomy for brain resections. Our novel approach aims to avoid additional postoperative neurological deficits which would occur if functional brain parenchyma is inadvertently injured during an aggressive resection. Endovascular brain mapping aims to preserve brain function by providing a means of direct volumetric surgical guidance in real-time, whereby non-functional tissues are delineated by sharp, visible margins and can therefore be safely resected. The successful

250

H. Charles Manning, Sheila D. Shay, Erich O. Richter et al. implementation of PEBM is highly dependent upon the proper selection and use of imaging probes, and we have developed a number of novel multimodal chemistries specifically aimed at PEBM. In this chapter, we will describe the PEBM technique in detail by highlighting its use in various small animal models, as well as our ongoing development of novel imaging probes suitable for PEBM.

Brain mapping is the attempt to specify the localization of function in the human brain in as much detail as possible [56]. Many brain mapping techniques exist, which have various strengths and weaknesses, and are therefore useful for specific aspects of research in cognitive neuroscience. The determination of the presence or absence of function in a potential neurosurgical resection site has critical importance in clinical neurosurgery and therefore this is the focus of the neurosurgical brain mapping techniques. Standard brain mapping techniques do not allow direct, real-time surgical visualization of nonfunctional brain parenchyma with sharp, precise, visualized margins that can be safely resected [12,14,15,33,39-41,46,56-58,61]. However, PEBM has the potential to achieve these goals, through further research efforts.

REVIEW OF EXISTING SURGICAL GUIDANCE BRAIN MAPPING TECHNIQUES The origins of brain mapping developed after physicians observed functional deficits in patients with a known lesion in a specific brain location [8, 56]. These early observations advanced our initial knowledge of brain functional localization. Lesion studies, however, can cause inaccurate functional data because gray matter subserving one function often overlies white matter carrying fibers subserving an unrelated function. Brain mapping for neurosurgical resections started to develop in the 1950’s with Penfield and Jasper [42]. They acquired functional data with intraoperative brain stimulation during craniotomy in awake patients. This technique is most useful for mapping the motor or language cortex during brain surgery. Some of the disadvantages of this approach include: 1) the increased operative time and associated risk of infection, 2) the increased cortical exposure required, 3) the pain and inconvenience of an awake patient during open craniotomy, and 4) the surgeon’s limited ability to perform detailed neurological and cognitive testing with the patient on the operating room table and in a state of conscious sedation. An adaptation of this technique is implantation of subdural cortical electrodes and depth electrodes, which can be stimulated postoperatively, to collect functional data in specialized epilepsy monitoring unit (EMU) beds. This technique is used today in patients who need epilepsy surgery. After a period of monitoring during stimulation of the various implanted electrodes, functional brain tissues are identified and mapped. A subsequent second craniotomy is then performed for removal of the electrodes and possible definitive resection, after the functional mapping is completed. Similarly, many neurosurgeons use microelectrode recording and stimulation to precisely localize deep nuclei [19]. The obvious disadvantages of these approaches are the necessity of performing two separate craniotomies and the associated increased risks and expense. The precise localization of function is also limited by the size of

Endovascular Brain Mapping

251

the electrodes, the distance between the electrodes, and the inability after removal of the electrodes to resect the exact tested neuron cells/tissue that were tested. Less invasive cortical brain mapping can be achieved to some extent with transcranial electrical stimulation (TES), and transcranial magnetic stimulation (TMS) [12,20,3941,61,70]. These brain mapping techniques use electrical or electromagnetic fields to induce changes within the cortex to stimulate the tissue or that behave as a temporary lesion. However, TES and TMS are of limited use in clinical neurosurgery because of patient discomfort, unacceptably poor spatial resolution leading to imprecise localization, and the possibility of inducing seizures with repetitive stimulation [12,56,70]. Passive transcranial modalities, such as electroencephalography (EEG), [13,31,63] and its magnetic counterpart, magnetoencephalography (MEG), [32] also have limitations in clinical intraoperative brain mapping because of their unacceptably poor spatial resolution. Furthermore, these techniques are very sensitive to external magnetic fields, thereby making their setup in typical operating room environments challenging. Functional MRI (fMRI), [14,15,46,57,58] positron emission tomography (PET) scanning, [3,26,44,56,59] or optical imaging [19,44,59] have limited usefulness in clinical intraoperative neurosurgical mapping because the modest spatial resolution of these maps prevent correlation of the imaging signal to the exact cells/tissue to be potentially resected during subsequent craniotomy. fMRI can accurately identify the tissue that is active during any given task, but it is difficult to determine if surrounding tissues are involved in important functional activities that were not included in the task-set at the time of imaging.

COMBINED BRAIN MAPPING AND VOLUMETRIC IMAGE GUIDANCE Some of these brain mapping techniques, especially fMRI, have been supplemented with stereotactic volumetric image-guidance, [59] but spatial resolution is a concern, and the correlation can degrade as the operation continues, because they are not real-time images. Once brain shifting occurs, brain tissue is resected, or cerebrospinal fluid (CSF) is lost, these stereotactically guided images become less useful.

The Endovascular Approach Advances in microcatheters and microwires have made preoperative embolization of AVMs and certain brain tumors safer and more effective [2,6,10,17,18,2325,37,38,47,48,50,51,60,63,67-69,71]. It is now routine to catheterize distal branches of the ACA, MCA, and PCA super-selectively during transcatheter embolization. A super-selective Wada test with microcatheter infusion of methohexital or amobarbital is sometimes performed at this distal arterial position before injection of the embolic agent to be sure that functional brain tissue is not in the pathway of the embolization [36,43,50,51]. These same techniques can be applied to a candidate for brain mapping. After the methohexital is injected into a specific location in the brain, if any functional tissue exists in that location, the patient will exhibit a temporary corresponding deficit for about 5 minutes. If the area is “nonfunctional” the patient will remain neurologically intact. When nonfunctional vascular

252

H. Charles Manning, Sheila D. Shay, Erich O. Richter et al.

territory is identified, then endovascular mapping (staining) of this nonfunctional brain tissue could be helpful during a subsequent elective craniotomy for brain resection.

Preoperative Endovascular Brain Mapping (PEBM) Approach Preoperative endovascular brain mapping (PEBM), which uses a super-selective, intraarterial endovascular approach to elucidate nonfunctional brain prior to and during craniotomy for brain resections, was recently described as a novel strategy [35]. The technique can help avoid new postoperative neurological deficits because it provides direct, real-time intraoperative volumetric image guidance of nonfunctional tissue with sharp margins that remain true throughout the resection, even with CSF loss or brain shifting. The conceptual steps of endovascular brain mapping for volumetric image guidance require, first, super-selective intraarterial catheterization of a distal target artery for delivery of testing materials to the corresponding target brain tissue. A super-selective Wada test is then performed to determine if functional activity is present at the target brain parenchyma [1,4,5,7,9,22,29,30,36,43,50,51,64-66]. If it is determined that no functional activity is present in the targeted brain, then a “mapping agent” is infused into the same microcatheter in the exact same distal arterial location where the super-selective Wada test was performed, staining corresponding target brain. The infusion is monitored with fluoroscopy and digital road-map angiography to avoid any reflux and therefore assure that the mapping agent travels to the same vascular distribution where the Wada test was performed. The mapped nonfunctional brain, with its sharp margins, can be clearly visualized at the time of subsequent elective craniotomy for resection. During the resection, no neurological deficits will occur if the resection is completely contained within the “mapped” nonfunctional (silent) tissue. At the current stage of development, we believe that this brain mapping technique is likely to be most useful for radical resection of malignant gliomas; specifically, diffuse infiltrating glioblastoma multiforme (GBM). When treating GBMs, the surgical plan could include resection of all possible nonfunctional brain tissue surrounding the infiltrating tumor, if this can be accomplished without causing new neurological deficits. In this situation, the surgical plan could match the super-selectively catheterized and stained vascular territories because only these territories would be known to be nonfunctional. The ideal endovascular brain mapping agent should possess all of the following characteristics: 1) systemically nontoxic; 2) clearly visualized in the brain at the time of subsequent craniotomy; 3) radiographically opaque for fluoroscopic and angiographic monitoring during the infusion; and 4) capable of adhering to the target tissues, either by crossing the blood-brain barrier (BBB) or by adhering to the target brain capillaries. Several dyes that are widely used in medical applications are classified as nontoxic. For example, fluorescein is a dye with minimal toxicity widely used in clinical practice, particularly in ophthalmologic applications, [11] where fluorescein angiography is an established method of retinal evaluation. Strategies to allow fluorescein passage across the BBB may involve invasive techniques (disruption of BBB) and noninvasive techniques (maintain intact BBB) [45]. Previous studies have shown that an invasive approach, such as using an osmotic agent to disrupt the BBB, can be used which allows many dyes to cross the

Endovascular Brain Mapping

253

BBB and stain the parenchyma [52,62]. Non-invasive methods are preferable, however, to reduce complications associated with BBB manipulation [44,62]. Most dyes used in food and medications are water-soluble and, thus, cannot penetrate the intact BBB by diffusion (passive transport). Some promising noninvasive strategies for brain mapping include: 1) the bioreversible covalent modification of a dye to improve its physicochemical properties that result in an enhancement of BBB transport ("pro-drug" approach); 2) conjugation of a mapping agent with nutrients (amino acids, glucose, etc.) actively transported into the brain; 3) linking a mapping agent to biomolecules undergoing adsorptive-mediated uptake (penetratin, pegellin, etc.); 4) receptor-mediated transcytosis (transferrin- or insulin-receptor antibodies, immunoliposomes) across the BBB; 5) linking a mapping agent to a cell-penetrating peptide (F-ANT, TAT, etc.); [53] 6) emulsification of a mapping agent (such as β carotene, organic dye, etc.) to stain brain capillary endothelial cells; or (7) grafted nanoparticle systems for brain delivery of mapping agents [27,53,54]. These noninvasive strategies require extensive development which is currently underway and planned for future studies. For the preliminary description of endovascular brain mapping for volumetric image guidance, we carried out our "proof-of-concept" study in animal models by using simple alternative techniques. These included the technically easier, but less desirable, invasive osmotic disruption of the BBB and dense staining of brain capillaries by capillary-level embolization. More recently, we have explored methods that enable PEBM without modification of the BBB as described below.

ANIMAL PREPARATION FOR PEBM STUDIES Approval for all animal studies was obtained from the University of Florida and Vanderbilt University Institutional Animal Care and Use Committees. A Blood Flow to MCA in Brain

Occipital Artery Ligation

B External Carotid Artery (ECA)

Internal Carotid Artery (ICA) Bifurcation Arterectomy

Common Carotid Artery (CCA) Ligation PE-50 tubing catheter Blood Flow to Brain

Figure 1. A. Schematic of the carotid artery in the animals illustrating point of catheterization and areas of arterial ligation. B. Cerebral angiogram in the anteroposterior view of a rabbit after occluding the ECA and occipital arteries to enhance flow through the ICA.

254

H. Charles Manning, Sheila D. Shay, Erich O. Richter et al.

Sprague-Dawley rats (Harlan, Indianapolis, IN) and New Zealand White rabbits were used for these studies. Rats were sedated with 87 mg/ml ketamine and 13 mg/ml of Xylazine (J.A. Webster, Inc., Sterling MA or Henry Schein, Denver, PA). The FDandC Green No. 3 was performed on a New Zealand White rabbit (Myrtle’s Rabbitry, Thompson Station, TN). The rabbit was sedated with 3 mg intravenously administered acepromazine before endotracheal induction of general anesthesia with 1 to 5% inhalational isoflurane (both agents from J.A. Webster, Inc.) In every animal, we used a carotid cutdown method to expose the common carotid artery. After dissecting the carotid past the bifurcation of the ICA and the ECA, the ECA was tied off along with the occipital artery, then a catheter was introduced into the lumen proximal to the ICA and a suture was used to secure the catheter within the vessel. Occluding the ECA and occipital arteries enhanced the flow through the ICA (Figure 1 above). In each of the animals, 0.2- 0.6 ml of mapping agent was infused through the right ICA directly into the right brain hemisphere with the aid of a standard infusion pump at 0.05 ml/min to 0.2 ml/minute. In each experiment, the animal was euthanized, its brain harvested, and the quality of the stain accessed on the same day by the appropriate method for each technique.

PEBM TECHNIQUES UTILIZED Administration of Fluorescein with BBB Manipulation Six minutes after the BBB disruption by arabinose using a previously described method, [49,52,62] a 10% solution of fluorescein (Sigma-Aldrich corp., St. Louis, MO) was mixed with an equal amount of iohexol contrast agent (Omnipaque; Amersham Health, Princeton, NJ). A total of 0.6 ml fluorescein was infused at 0.2 ml/minute using a standard infusion pump under fluoroscopic guidance. Modifications to the Zeiss operating microscope (Carl Zeiss Surgical, Inc., Thornwood, NY) to allow a clear visualization of fluorescence-stained brain territories have been described [28] this technique could be used intraoperatively to maximize visualization during a craniotomy for brain resection. However, for simplicity during our initial proof-of-concept studies in animals, a 365-nm hand-held ultraviolet light (UV-4B Spectroline; Spectonics Corp., Westbuty, NY) was used to visualize the fluorescein. With this method, staining was evident on the cortical surface and into the deep white matter. The fluorescence was well visualized, and the margin between the stained and the non-stained brain was relatively distinct (Figure 2). The normal brain tissue autofluoresces slightly at this wavelength, and therefore, improved visualization could be achieved with appropriate microscope filters [28]. This fluorescein approach is promising; however, it is limited by the need for fluorescent excitation and filtration; and it cannot be used routinely in humans because of the need for invasive BBB disruption.

Administration of FD and C Green No. 3 with BBB Manipulation In an attempt to avoid the extra step of fluorescent excitation, visible spectrum dyes were used to test the feasibility of endovascular brain mapping. An aqueous suspension of FD and

Endovascular Brain Mapping

255

C Green No. 3 (Sigma-Aldrich, St. Louis, MO) was selected because of its reported low toxicity and good visibility [21,34]. First, 0.3 ml of FDandC Green No. 3 was mixed with 0.3 ml of iohexol to add radio-opacity for visualization under fluoroscopy and DSA during infusion into the ICA. Selective BBB disruption was performed as previously described [49,52,62]. Then, 0.6 ml of the green dye and iohexol mixture was injected at 0.2 ml/min with a standard infusion pump in the right brain hemisphere. A New Zealand white rabbit was used for this experiment to determine if better angiographic images could be obtained for monitoring during the infusion, and if a more distal selective position could be attained with the microcatheter, which could possibly allow an improved delineation of the margin between mapped brain and normal brain.When FD and C Green No. 3 was infused after invasive BBB manipulation, the anterior and middle cerebral artery (MCA) distributions were clearly stained both on the cortical surface and into the deep white matter. There was a small area that remained unstained on the inferior and medial portion of the temporal lobe; this area likely corresponded to the PCA distribution that was not infused (Figure 3).

A B

Figure 2. Fluorescein mapped rat brain; (a) dorsal view and (b) coronal section after osmotic disruption of the blood brain barrier (BBB) using a hypertonic solution of arabinose.

A B

Figure 3. FDandC Green No. 3 mapped rabbit brain; (a) ventral view and (b) coronal section after osmotic disruption of the blood brain barrier (BBB) using a hypertonic solution of arabinose.

256

H. Charles Manning, Sheila D. Shay, Erich O. Richter et al.

Experiments are currently underway to confirm this. There was a relatively sharp visual margin between the stained brain and the unstained brain. The advantage of the rabbit model over the rat was the ability to visualize with fluoroscopy and digital subtraction angiography (DSA) exactly where the mapping agent was infiltrating into the brain. Unfortunately, we were not able to advance the microcatheter distally into the intracranial MCA branches. Therefore, the rat model was used for the remaining experiments. The FDandC Green No. 3 as a mapping agent is limited by the need for invasive BBB disruption. Because this successfully proved the concept, all future PEBM agents will be performed without BBB disruption.

Tantalum Particle Embolization, PEBM Contrast without BBB Manipulation Capillary-level embolization is another strategy of endovascular brain mapping that has the potential advantage of eliminating the invasive BBB manipulations. Tantalum embolization also has the potential to eliminate bleeding during the brain resection following craniotomy. To test the strategy of capillary-level embolization, we injected 0.6 ml of visible embolic agents mixed with iohexol into the right brain hemisphere through the right ICA of the rats. Tantalum was the initial agent used to test the feasibility of this approach. We obtained tantalum powder from the TruFill® n-BCA embolization kit (Cordis Neurovascular, Miami Lakes, FL); this material has FDA approval for intraarterial embolization of intracranial AVMs. We also obtained tantalum dust (Biodyne, Inc., La Mesa, CA), which consisted of much smaller particles sizes, to assess the differences in brain map quality that might result from differences in the tantalum. Because the particle size would likely be a primary determinate of the quality of the brain map, we performed electron microscopy on each sample and measured this property. Each of the two tantalum samples was then infused into the right brain hemisphere of 2 different rats. We demonstrated that the TruFill® tantalum powder became wedged in the brain arterioles, producing an inadequate result because of poor visualization and poor margins of the target brain parenchyma (Figure 4).

Figure 4. Tantalum particle mapped rat brain dorsal view. Notice the particles are too large to travel to the capillary level, therefore this produces a poor brain map.

Endovascular Brain Mapping

257

Results of electron microscopy studies revealed the particle sizes of the tantalum powder were too large (20-80 μm), which likely explains why they lodged in the arterioles. The smaller tantalum dust also produced an inadequate result, because the particles traveled through the capillaries and were washed out into the venous system. Electron microscopy studies revealed that all of these particles were less than 5 μm, with an average size of 3 μm, which was determined to be too small for adequate brain mapping. We concluded that in order to achieve an appropriate brain map, the tantalum particles have to be an ideal size to lodge in the capillaries, probably 5- to 10-μm particles.

Sudan Black Cocktail Embolization without BBB Disruption To overcome several difficulties encountered with tantalum, a novel mixture of agents was then tested to perform capillary-level embolization and subsequent brain mapping. To achieve the ideal penetration to the capillary level while preventing transit into the venous system, we used a mixture of 1mg Sudan Black (Sigma Aldrich, St. Louis, MO), 1 ml of NBCA (TruFill®, Cordis Neurovascular, Miami Lakes, FL), 10 ml Ethiodol™ (Savage Laboratories, Melville, NY), and 40 μl glacial acetic acid (Sigma Aldrich, St. Louis, MO) as a potential brain mapping agent. We then used a standard infusion pump to deliver 0.6 ml of the cocktail over 3 minutes at 0.2 ml/min. The use of NBCA and Ethiodol has been approved by FDA for injection into the intracranial arterial supply of AVMs for preoperative embolization. The practice of adding glacial acetic acid is sometimes used to slow the NBCA polymerization time [6,16]. The addition of Sudan Black, a fat soluble dye, allows visualization of the material at the time of subsequent craniotomy and resection. This novel combination of materials allows the mapping agent to remain liquid until reaching the capillary bed, and then it polymerizes to solid form before excessive transit to the venous system occurs. Once a target distribution of tissue has been mapped as nonfunctional and chosen for resection, the preoperative capillarylevel embolization of that territory should eliminate intraoperative bleeding. A symptomatic stroke is not likely in humans because the target vascular territory will have been identified previously as nonfunctional with a super-selective Wada test [5,9,36,43,50,51,65]. When the mixture of Sudan Black, NBCA, Ethiodol, and glacial acetic acid was used, there was excellent penetration of the mapping agent into the brain capillaries of the target brain distribution (Figure 5). This provided a dense, highly contrasted, black brain map. We were again able to achieve a relatively sharp margin between the stained brain in the MCA and ACA distribution and the unstained brain in the inferior medial temporal lobe, which was likely within the PCA distribution. This approach required manipulation of the ratios of each cocktail constituent to optimize imaging agent distribution through the capillaries into the venous structures. This injection can be further optimized by altering the injection speed, volume, and force of the infusion. Despite the gross appearance of black brain parenchyma, histological examination revealed only the capillaries were stained and the brain parenchyma cells were unaffected. The gross appearance of Sudan black-stained brain parenchyma is due to the fact that the capillaries are so numerous and dense.

258

H. Charles Manning, Sheila D. Shay, Erich O. Richter et al.

Figure 5. Sudan black cocktail mapped rat brain, ventral-lateral view. Notice the mapping agent is small enough to travel to the capillary level, therefore this produces a more useful brain map.

Administration of TAT-Conjugated Silica Nanoparticles and TATConjugated Cds: Mn/Zns Quantum Dots without BBB Manipulation More sophisticated techniques for PEBM have been recently described, such as the use of nanoparticles, including silica nanoparticles and quantum dots, as potential brain mapping agents, without the need for BBB manipulation or vascular occlusion [50,51]. It has been shown that is possible to deliver various nanoparticle-based imaging agents into cells using a TAT peptide-mediated delivery system [53-55]. TAT-conjugated silica nanoparticles and Cds:Mn/ZnS Qdots (TAT-Qdots) were prepared as described by Santra et al. [55]. The silica nanoparticles labeled brain endothelial cells, but the Qdots were small enough to also label the brain parenchyma cells, in addition to the endothelial cells. The Qdots are highly sensitive and photostable. Qdots without TAT did not label brain tissue confirming that the TAT peptide is necessary to penetrate through the BBB to the cells in the parenchyma. About 0.75 ml (10 mg/ml) of TAT-Qdot suspension in phosphate buffered saline (PBS) was loaded in a syringe and attached to a standard infusion pump and injected into a rat. The Qdots were injected over a period of 5 minutes and then PBS (pH 7.4) was injected for 15 minutes at the same rate of injection to remove residual TAT-Qdots. The ECA was then opened and collateral blood flow allowed for 3 minutes. The rat was then euthanized and the brain harvested. The whole brain was immediately placed under a hand held 366 nm multi-band UV source (Spectroline, model UV-4B) and photographed using a standard digital camera. The TAT-Qdot fluorescence is pink and the background autofluorescence in the absence of

Endovascular Brain Mapping

259

Qdots is blue at this 366 nm UV wavelength. With this method, the time needed to stain brain tissue is dependent on cerebral blood flow. Histological analysis was performed to show whether the TAT-Qdots penetrated the endothelial cells. It showed TAT-Qdots reached the nucleus of brain cells, supporting the fact that TAT-Qdots cross the BBB and migrated into the parenchyma of the brain to reach the cell nuclei. Endothelial cells in the blood capillaries were loaded with TAT-Qdots as expected. These grafted nanoparticle systems are limited by potential toxicity from the silica in the nanoparticles and the Cd:ZnS in the Qdots. It would therefore be difficult to receive FDA regulatory approval for either of these potential mapping agents.

Administration of Onyx®- Fluorescein Cocktail We have recently advanced our embolic approach to PEBM through the development and use of fluorescent cocktails of the commercially available embolic agent Onyx®. Onyx® is a non-adhesive liquid embolic agent that is comprised of ethylene vinyl alcohol copolymer (EVOH) dissolved in a sterile vehicle of dimethyl sulfoxide (DMSO). Since these agents are already approved by the FDA for other applications, their regulatory approval would be more likely. To provide visualization under fluoroscopy, micronized tantalum powder is also suspended in the solution matrix. Typically, the agent is delivered slowly by controlled injection through a microcatheter into the brain under fluoroscopic guidance. Chemically, upon entry into the blood stream, the DMSO vehicle dissipates rapidly into the blood and the EVOH copolymer and suspended tantalum particles precipitate in situ into a spongiform, coherent material. Onyx® is currently available in two formulations marketed as Onyx® 18 (6% EVOH) and Onyx® 34 (8% EVOH), with Onyx® 18 being considerably less viscous allowing increased penetration deeper into distant capillaries and vascular features. Capitalizing upon our ability to precisely deliver PEBM imaging agents via superselective arterial catheterization, we have explored the use of Onyx®-based PEBM emulsions that could be visualized by optical imaging. To do this, we added a small quantity of fluorescein to the standard Onyx® 18 preparation. Upon addition, we found that fluorescein was highly soluble in the DMSO/EVOH mixture and would co-precipitate with EVOH in aqueous solution forming a highly fluorescent spongiform solid that appeared suitable for imaging. We hypothesized that the improved sensitivity of fluorescence imaging (compared to gross visualization or x-ray angiography) would enable enhanced visualization of the embolic material following precipitation and possibly improve the sensitivity of our PEBM approach. An added benefit of using fluorescein as the optical probe was that fluorescence visualization could be achieved in the visible portion of the electromagnetic spectrum, and excitation of the agent could be achieved using a simple hand-held ‘black light’ or Wood’s lamp, which is operating room compatible. In Figure 6, we illustrate a typical brain map in a rat using the Onyx®-based optical imaging approach. Immediately following catheterization as described above and agent preparation, the Onyx®-fluorescein emulsion was slowly injected using an infusion pump (5mg/mL agent @ 1mL/min). After approximately 10 minutes, the animal was sacrificed and a craniotomy was performed. Gross whitelight visualization of the intact brain illustrated

260

H. Charles Manning, Sheila D. Shay, Erich O. Richter et al.

enhanced probe accumulation and staining primarily on the left hemisphere, as shown by the slight yellow tinting of the brain tissue from the dye (Figure 6 A and C). Additionally, some of the larger tantalum particles can be seen in the middle cerebral artery.

A

C

B

D

Figure 6. Endovascular brain mapping using the Onyx®-Fluorescein embolic approach in rat. (A) Gross whitelight visualization of rat brain following agent infusion and craniotomy. Under whitelight illumination, left hemisphere of brain appears slightly yellow-tinted from agent accumulation. Larger tantalum particles can be seen in the arterials because of their large size. (B) Fluorescence visualization illustrates enhanced visualization of mapping agent accumulation. Good differentiation between left and right brain hemispheres is observed, with some accumulation of fluorescence in the deep veins. (C/D) Whitelight and fluorescence images, respectively, of resected brain.

Agent localization primarily to the left hemisphere can be further appreciated by fluorescence visualization following illumination with a hand-held Wood’s lamp. In addition to agent localization to the left hemisphere, we also observed some accumulation in the posterior fossa, possibly indicating some agent passage from the arterial system to the venous system and settling in the dural sinus veins in the posterior fossa (Figure 6 B and D). In summary, it appears feasible to prepare fluorescent embolic materials using an Onyx®-based medium, and these materials appear to be promising agents for PEBM. As with any embolic material, a considerable limitation of these agents is the fact that they occlude the vasculature and are therefore unsuitable for imaging normal tissues. However, these materials and similar

Endovascular Brain Mapping

261

agents hold considerable promise for resection guidance of diseased tissue that will subsequently be removed or in applications where it is appropriate to leave embolics in place, such as treatment of AVMs. We are currently developing improved mapping agents that do not require BBB manipulation or vascular occlusion, as well as having the safest possible profile, to minimize potential toxicity. BBB disruption is not desirable in the ideal PEBM agent, because of its associated potential neurotoxicity and possible increased cerebral edema. Vascular occlusion is also not ideal, because nearby adjacent brain tissue could be affected by the ischemic edema arising from the non-functional mapped territory.

CONCLUSIONS In this chapter, we have described the concept for preoperative endovascular brain mapping (PEBM), and demonstrated the feasibility and utility of the technique with several potential mapping agents in animal models. In each case, using the techniques illustrated we have achieved good visual clarity and relatively sharp margins between the mapped brain and the non-mapped brain. Furthermore, we have illustrated simple PEBM techniques that require BBB manipulation to be effective, as well as alternative techniques that do not require BBB manipulation. Our concept of preoperative endovascular brain mapping for volumetric image guidance has the potential to produce clearly visible, safe margins of nonfunctional brain tissue for resection with excellent spatial resolution that remains true throughout the procedure, regardless of brain-shifting. If this approach is successful, it could significantly reduce or eliminate postoperative neurologic deficits. Although safety and toxicology studies must be performed on any potential mapping agent, there is a greater potential for toxicity, when considering nanoparticle systems as many of their characteristics remain unknown. Studies to determine the durability of each mapping agent to allow for a possible delay between brain mapping and surgical resection must also be performed. Even though further study is required to demonstrate safety, minimize toxicity, and improve the characteristics of potential mapping agents, PEBM is an emerging imaging technique that may prove complementary to other brain mapping strategies, as well as serving as a surgical guidance tool during the resection of diseased tissue.

REFERENCES [1]

[2] [3]

Akanuma N, Koutroumanidis M, Adachi N, Alarcon G, Binnie CD: Presurgical assessment of memory-related brain structures: the Wada test and functional neuroimaging. Seizure 12:346-358, 2003. Andrews BT, Wilson CB: Staged treatment of arteriovenous malformations of the brain. Neurosurgery 21:314-323, 1987. Baete K, Nuyts J, Van Laere K, Van Paesschen W, Ceyssens S, De Ceuninck L, et al: Evaluation of anatomy based reconstruction for partial volume correction in brain FDGPET. Neuroimage 23:305-317, 2004.

262 [4] [5]

[6]

[7] [8]

[9]

[10]

[11]

[12] [13] [14]

[15] [16]

[17]

[18] [19] [20]

H. Charles Manning, Sheila D. Shay, Erich O. Richter et al. Bazin JE, Picard P, Gabrillargues J, Dordain M: Propofol administered via the carotid artery to achieve a Wada test. Can. J. Anaesth. 45:707-708, 1998. Brassel F, Weissenborn K, Ruckert N, Hussein S, Becker H: Superselective intraarterial amytal (Wada test) in temporal lobe epilepsy: basics for neuroradiological investigations. Neuroradiology 38:417-421, 1996. Brothers MF, Kaufmann JC, Fox AJ, Deveikis JP: n-Butyl 2-cyanoacrylate--substitute for IBCA in interventional neuroradiology: histopathologic and polymerization time studies. AJNR Am. J. Neuroradiol. 10:777-786, 1989. Buchtel HA, Passaro EA, Selwa LM, Deveikis J, Gomez-Hassan D: Sodium methohexital (brevital) as an anesthetic in the Wada test. Epilepsia 43:1056-1061, 2002 Corkin S, Amaral DG, Gonzalez RG, Johnson KA, Hyman BT: H. M.'s medial temporal lobe lesion: findings from magnetic resonance imaging. J. Neurosci. 17:39643979, 1997. Fitzsimmons BF, Marshall RS, Pile-Spellman J, Lazar RM: Neurobehavioral differences in superselective Wada testing with amobarbital versus lidocaine. AJNR Am. J. Neuroradiol. 24:1456-1460, 2003. Fournier D, TerBrugge KG, Willinsky R, Lasjaunias P, Montanera W: Endovascular treatment of intracerebral arteriovenous malformations: experience in 49 cases. J. Neurosurg. 75:228-233, 1991. Friberg TR: Examination of the retina: Principles of fluorescein angiography, in Albert DM, Jakobiec FA (eds): Principles and Practice of Ophthalmology: Clinical Practice. Philadelphia: WB Saunders, 1994, Vol 2, pp 697-718. George MS, Lisanby SH, Sackeim HA: Transcranial magnetic stimulation: applications in neuropsychiatry. Arch. Gen. Psychiatry 56:300-311, 1999. Gevins A: Electrophysiological imaging of brain function, in Toga AW, Mazziotta JC (eds): Brain Mapping: The Methods. San Diego: Academic Press, 1996, pp 259-276. Gore JC: Functional MRI is fundamentally limited by an inadequate understanding of the origin of fMRI signals in tissue. For the proposition. Med. Phys. 30:2859-2860, 2003. Gore JC: Principles and practice of functional MRI of the human brain. J. Clin. Invest. 112:4-9, 2003. Gounis MJ, Lieber BB, Wakhloo AK, Siekmann R, Hopkins LN: Effect of glacial acetic acid and ethiodized oil concentration on embolization with N-butyl 2cyanoacrylate: an in vivo investigation. AJNR Am. J. Neuroradiol. 23:938-944, 2002. Guglielmi G: Use of the GDC crescent for embolization of tumors fed by cavernous and petrous branches of the internal carotid artery. Technical note. J. Neurosurg. 89:857-860, 1998. Guterman LR, Standard SC, Ahuja A, Hopkins LN: Vascular and endovascular neurosurgery. Curr. Opin. Neurol. 6:854-859, 1993. Haglund MM, Hochman DW: Optical imaging of epileptiform activity in human neocortex. Epilepsia 45 Suppl 4:43-47, 2004. Halgren E, Walter RD, Cherlow DG, Crandall PH: Mental phenomena evoked by electrical stimulation of the human hippocampal formation and amygdala. Brain 101:83-117, 1978.

Endovascular Brain Mapping

263

[21] Hansen WH, Long EL, Davis KJ, Nelson AA, Fitzhugh OG: Chronic toxicity of three food colourings: Guinea Green B, Light Green SF Yellowish and Fast Green FCF in rats, dogs and mice. Food Cosmet. Toxicol. 4:389-410, 1966. [22] Helmstaedter C, Kurthen M: Validity of the WADA test. Epilepsy Behav. 3:562-563, 2002. [23] Hoh BL, Ogilvy CS, Butler WE, Loeffler JS, Putman CM, Chapman PH: Multimodality treatment of nongalenic arteriovenous malformations in pediatric patients. Neurosurgery 47:346-357; discussion 357-348, 2000. [24] Hurst RW, Berenstein A, Kupersmith MJ, Madrid M, Flamm ES: Deep central arteriovenous malformations of the brain: the role of endovascular treatment. J. Neurosurg. 82:190-195, 1995. [25] Jafar JJ, Davis AJ, Berenstein A, Choi IS, Kupersmith MJ: The effect of embolization with N-butyl cyanoacrylate prior to surgical resection of cerebral arteriovenous malformations. J. Neurosurg. 78:60-69, 1993. [26] Kim DW, Lee SK, Yun CH, Kim KK, Lee DS, Chung CK, et al: Parietal lobe epilepsy: the semiology, yield of diagnostic workup, and surgical outcome. Epilepsia 45:641649, 2004. [27] Kreuter J: Nanoparticulate systems for brain delivery of drugs. Adv. Drug Deliv. Rev. 47:65-81, 2001. [28] Kuroiwa T, Kajimoto Y, Ohta T: Development of a fluorescein operative microscope for use during malignant glioma surgery: a technical note and preliminary report. Surg. Neurol. 50:41-48; discussion 48-49, 1998. [29] Kurthen M: [The intra-carotid amobarbital test--indications--procedure--results]. Nervenarzt 63:713-724, 1992. [30] Lee GP, Park YD, Westerveld M, Hempel A, Loring DW: Effect of Wada methodology in predicting lateralized memory impairment in pediatric epilepsy surgery candidates. Epilepsy Behav. 3:439-447, 2002. [31] Lewine JD, Orrison WWJ: Clinical electroencephalography and event-related potentials, in Orrison WWJ, Lewine JD, et al. (eds): Functional Brain Imaging. Boston: Mosby-Year Book, 1995, pp 369-418. [32] Lewine JD, Orrison WWJ: Magnetoencephalography and magnetic source imaging, in Orrison WWJ, Lewine JD, et al. (eds): Functional Brain Imaging. Boston: Mosby-Year Book, 1995, pp 369-418. [33] Llinas RR: Mapping brain terrain. Neurobiol. Dis. 7:499-500, 2000. [34] Marmion DM: Handbook of U.S. Colorants: Foods, Drugs, Cosmetics, and Medical Devices, ed 3. New York: John Wiley and Sons, 1991. [35] Mericle RA, Richter EO, Eskioglu E, Watkins C, Prokai L, Batich C, et al: Preoperative endovascular brain mapping for intraoperative volumetric image guidance: preliminary concept and feasibility in animal models. J. Neurosurg. 104:566-573, 2006. [36] Moo LR, Murphy KJ, Gailloud P, Tesoro M, Hart J: Tailored cognitive testing with provocative amobarbital injection preceding AVM embolization. AJNR Am. J. Neuroradiol. 23:416-421, 2002. [37] Nelson PK, Setton A, Choi IS, Ransohoff J, Berenstein A: Current status of interventional neuroradiology in the management of meningiomas. Neurosurg. Clin. N. Am. 5:235-259, 1994.

264

H. Charles Manning, Sheila D. Shay, Erich O. Richter et al.

[38] Origitano TC, al-Mefty O, Leonetti JP, DeMonte F, Reichman OH: Vascular considerations and complications in cranial base surgery. Neurosurgery 35:351-362; discussion 362-353, 1994. [39] Pascual-Leone A, Bartres-Faz D, Keenan JP: Transcranial magnetic stimulation: studying the brain-behaviour relationship by induction of 'virtual lesions'. Philos. Trans R Soc. Lond B Biol. Sci. 354:1229-1238, 1999. [40] Pascual-Leone A, Meador KJ: Is transcranial magnetic stimulation coming of age? J. Clin. Neurophysiol. 15:285-287, 1998. [41] Pascual-Leone A, Walsh V, Rothwell J: Transcranial magnetic stimulation in cognitive neuroscience--virtual lesion, chronometry, and functional connectivity. Curr. Opin. Neurobiol. 10:232-237, 2000. [42] Penfield W, Jasper J: in Epilepsy and the Functional Anatomy of the Human Brain. Boston: Little, Brown and Company, 1954, pp 239-280 and 739-817. [43] Peters KR, Quisling RG, Gilmore R, Mickle P, Kuperus JH: Intraarterial use of sodium methohexital for provocative testing during brain embolotherapy. AJNR Am. J. Neuroradiol. 14:171-174, 1993. [44] Pouratian N, Sheth S, Bookheimer SY, Martin NA, Toga AW: Applications and limitations of perfusion-dependent functional brain mapping for neurosurgical guidance. Neurosurg. Focus 15:E2, 2003. [45] Prokai L: Targeting drugs into the central nervous system, in Muzykantov V, Torchilin V (eds): Niomedical Aspects of Drug Targeting. Boston: Kluwer Academic, 2002, pp 359-380. [46] Puce A, Constable RT, Luby ML, McCarthy G, Nobre AC, Spencer DD, et al: Functional magnetic resonance imaging of sensory and motor cortex: comparison with electrophysiological localization. J. Neurosurg. 83:262-270, 1995. [47] Purdy PD, Batjer HH, Samson D: Management of hemorrhagic complications from preoperative embolization of arteriovenous malformations. J. Neurosurg. 74:205-211, 1991. [48] Qureshi AI: Endovascular treatment of cerebrovascular diseases and intracranial neoplasms. Lancet 363:804-813, 2004. [49] Rapoport SI: Osmotic opening of the blood-brain barrier: principles, mechanism, and therapeutic applications. Cell Mol. Neurobiol. 20:217-230, 2000. [50] Rauch RA, Vinuela F, Dion J, Duckwiler G, Amos EC, Jordan SE, et al: Preembolization functional evaluation in brain arteriovenous malformations: the ability of superselective Amytal test to predict neurologic dysfunction before embolization. AJNR Am. J. Neuroradiol. 13:309-314, 1992. [51] Rauch RA, Vinuela F, Dion J, Duckwiler G, Amos EC, Jordan SE, et al: Preembolization functional evaluation in brain arteriovenous malformations: the superselective Amytal test. AJNR Am. J. Neuroradiol. 13:303-308, 1992. [52] Robinson PJ, Rapoport SI: Size selectivity of blood-brain barrier permeability at various times after osmotic opening. Am. J. Physiol. 253:R459-466, 1987. [53] Santra S, Yang H, Dutta D, Stanley JT, Holloway PH, Tan W, et al: TAT conjugated, FITC doped silica nanoparticles for bioimaging applications. Chem. Commun. (Camb):2810-2811, 2004.

Endovascular Brain Mapping

265

[54] Santra S, Yang H, Holloway PH, Stanley JT, Mericle RA: Synthesis of waterdispersible fluorescent, radio-opaque, and paramagnetic CdS:Mn/ZnS quantum dots: a multifunctional probe for bioimaging. J. Am. Chem. Soc. 127:1656-1657, 2005. [55] Santra S, Yang H, Stanley JT, Holloway PH, Moudgil BM, Walter G, et al: Rapid and effective labeling of brain tissue using TAT-conjugated CdS:Mn/ZnS quantum dots. Chem. Commun. (Camb):3144-3146, 2005. [56] Savoy RL: History and future directions of human brain mapping and functional neuroimaging. Acta Psychol. (Amst) 107:9-42, 2001. [57] Schlosser MJ, Aoyagi N, Fulbright RK, Gore JC, McCarthy G: Functional MRI studies of auditory comprehension. Hum. Brain Mapp. 6:1-13, 1998. [58] Schlosser MJ, McCarthy G, Fulbright RK, Gore JC, Awad IA: Cerebral vascular malformations adjacent to sensorimotor and visual cortex. Functional magnetic resonance imaging studies before and after therapeutic intervention. Stroke 28:11301137, 1997. [59] Sobottka SB, Bredow J, Beuthien-Baumann B, Reiss G, Schackert G, Steinmeier R: Comparison of functional brain PET images and intraoperative brain-mapping data using image-guided surgery. Comput. Aided Surg. 7:317-325, 2002. [60] Standard SC, Ahuja A, Livingston K, Guterman LR, Hopkins LN: Endovascular embolization and surgical excision for the treatment of cerebellar and brain stem hemangioblastomas. Surg. Neurol. 41:405-410, 1994. [61] Stewart L, Ellison A, Walsh V, Cowey A: The role of transcranial magnetic stimulation (TMS) in studies of vision, attention and cognition. Acta Psychol. (Amst) 107:275-291, 2001. [62] Suzuki M, Iwasaki Y, Yamamoto T, Konno H, Kudo H: Sequelae of the osmotic bloodbrain barrier opening in rats. J. Neurosurg. 69:421-428, 1988. [63] Taylor CL, Dutton K, Rappard G, Pride GL, Replogle R, Purdy PD, et al: Complications of preoperative embolization of cerebral arteriovenous malformations. J. Neurosurg. 100:810-812, 2004. [64] Trenerry MR, Loring DW: Intracarotid amobarbital procedure. The Wada test. Neuroimaging Clin. N Am. 5:721-728, 1995. [65] Urbach H, Klemm E, Linke DB, Behrends K, Biersack HJ, Schramm J, et al: Posterior cerebral artery Wada test: sodium amytal distribution and functional deficits. Neuroradiology 43:290-294, 2001. [66] van Emde Boas W: Juhn A. Wada and the sodium amytal test in the first (and last?) 50 years. J. Hist. Neurosci. 8:286-292, 1999. [67] Vinuela F, Dion JE, Duckwiler G, Martin NA, Lylyk P, Fox A, et al: Combined endovascular embolization and surgery in the management of cerebral arteriovenous malformations: experience with 101 cases. J. Neurosurg. 75:856-864, 1991. [68] Wakhloo AK, Juengling FD, Van Velthoven V, Schumacher M, Hennig J, Schwechheimer K: Extended preoperative polyvinyl alcohol microembolization of intracranial meningiomas: assessment of two embolization techniques. AJNR Am. J. Neuroradiol. 14:571-582, 1993. [69] Wakhloo AK, Lieber BB, Rudin S, Fronckowiak MD, Mericle RA, Hopkins LN: A novel approach to flow quantification in brain arteriovenous malformations prior to enbucrilate embolization: use of insoluble contrast (Ethiodol droplet) angiography. J. Neurosurg. 89:395-404, 1998.

266

H. Charles Manning, Sheila D. Shay, Erich O. Richter et al.

[70] Walsh V, Cowey A: Transcranial magnetic stimulation and cognitive neuroscience. Nat. Rev. Neurosci. 1:73-79, 2000. [71] Yakes WF, Krauth L, Ecklund J, Swengle R, Dreisbach JN, Seibert CE, et al: Ethanol endovascular management of brain arteriovenous malformations: initial results. Neurosurgery 40:1145-1152; discussion 1152-1144, 1997.

In: Brain Mapping and Diseases Ed: Diane E. Spinelle

ISBN: 978-1-61122-065-0 © 2011 Nova Science Publishers, Inc.

Chapter 12

THE BRAIN’S NEUROPROTECTIVE AND PROAPOPTOTIC EFFECTS OF ASPIRIN - A REVIEW Yair Lampl∗ Departments of Neurology, Edith Wolfson Medical Center, Holon and Sackler Faculty of Medicine, Tel Aviv University, Israel.

ABSTRACT The investigation of techniques for neuroprotection plays a key role in brain research which involves finding a protective method for acute or chronic destruction of brain tissue. These methods are aimed either toward the necrotic pathway or the apoptotic one. The ability of acetylsalicylic acid (aspirin) to alleviate both destructive pathways is increasingly being recognized, as well as there being indirect evidence for its effective use in the attenuation of severity of neurologic diseases. The relation between the neuroprotective effects and the dosage of aspirin are not yet in agreement. The rationale of action appears to be aspirin’s direct and indirect specific effect on the nuclear factor Kappa β (NF Kappa-). Other targets of aspirin activity are the mitogen activated protein kinase (MAPK), the nitro oxide synthase (NOS) and the adenosine triphosphate (ATP). The protective effect of aspirin was studied in hypoxic damage, cerebral infarction, degenerative brain disease and epilepsy. An aspirin-induced apoptotic phenomenon was documented in gastric colon, lung and cervical cancer. Evidence of the same mechanism was shown also in brain malignant glioblastoma cells. The antiapoptotic and antitumoral effects are mediated by the Bcl-2 and caspase-3 pathways, as well as the mitochondrial permeability transfer mechanism. The pro- and anti-apoptotic mechanisms studied in regards to brain ischemic events are still unresolved issues. However, data from direct and indirect in vitro and in vivo studies, as well as epidemiological studies, lead to the assumption that aspirin probably does have an in vivo protective effect in humans. The ∗

Correspondence concerning this article should be addressed to Dr. Yair Lampl, MD Department of Neurology , Edith Wolfson Medical Center Holon 58100, Israel. Tel: 972 – 3 – 502-8512; Fax: 972 – 3 – 502-8681; Email: [email protected].

268

Yair Lampl promising data from these experimental studies bode well for an optimistic view for the possibility of aspirin’s therapeutic use as a neuroprotective agent in human diseases of the central nervous system.

INTRODUCTION Management of acute and chronic pathological progressive destruction of brain neural cells is one of the most fascinating and important focal issues in cutting edge neuroscience. The interpretation of degenerative devastating processes is the first step for research in the activation of neuromodulatory systems and neurogenesis. The relative new concept that death of neuronal cells is not only initiated by one single process, but can be activated in addition to passive necrosis also by the active system or apoptotic pathway, changed forever our understanding and opinions. The knowledge of the existence of programmed cell death (PCD) forced us to explore therapeutic agents which simultaneously affect both mechanisms. However, there is a wide discrepancy between real scientific knowledge of these current theories and the translation into therapeutical properties in order to find a clinically effective method to inhibit these pathological processes. Most of the studies that examined new neuroprotective agents failed or were found to have only limited effect. The investigation for agents with inhibitory effects on only one at a time of the pathways can be assumed to be the reason for this failure. Aspirin (acetylsalicylic acid – ASA), which is well known for a long time as a non selective COX inhibitor, seems to show the promising data. The research into its initial analgesic and anti-inflammatory effects were enlarged into additional study indicators, especially the antiaggregation, and lately neuroprotective, pro- and anti-apoptotic properties. The multi variant target effects of aspirin seem to be specific to this agent in comparison to other selective COX-1 or COX-2 inhibitors. Experimental data produced diverse effects of the necrotic and apoptotic pathways in neural cell death. Although a lot of this data is also limited, these new findings can let us be optimistic toward the eventual additional use of aspirin in the arsenal of neuroprotective agents under current research.

DISCUSSION Neuroprotection 1. Neuroprotection The concept of neuroprotection is based on the assumption that different pathways leading to acute or chronic progressive damage of neuronal tissue can be interrupted by external stimuli. It can be a pharmacological or non pharmacological method (example – hypothermia). The interruption of the propagation of the damaging cascade can be achieved by inhibition of excessive glutamate receptor activity, countering the accumulation of intracellular calcium ions, massive production of free radicals and the activation of the apoptotic cell death pathway. Target conditions for neuroprotective research are the degenerative diseases, such as Parkinson’s disease, Alzheimer’s disease and amyotrophic lateral sclerosis, and the acute,

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

269

hypoxic, traumatic and ischemic brain conditions. Brain ischemia is one of the most studied with research showing a post ischemic cascade of irreversible electrophysiological changes thru release of excitatory neurotransmitters, permanent breakdown of the ionic hemostatic balance and depletion of energy donators [1-10].

1a. Neuroprotection and Aspirin There is a lot of evidence for a beneficial neuroprotective effect induced by aspirin. The protective mechanisms included various targets of brain neurochemistry. The type of mechanisms is dependent upon the specific form of action induced by the aspirin. Aspirin inhibits the excessive activation of the N methyl D aspartate (NMDA) ionotropic glutamate receptor [11,12], NFKB activity which regulates protein [13-15] and Kinase activity which down-regulates the proinflammatory enzymes of the nitric oxide synthase (NOS) family group [16-18]. It reduces the oxidative stress [19-24], inhibits the uncoupling of oxidative phosphorylation [25-27], regulates the amount of adenosine triphosphate (ATP) and increases the extracellular adenosine [28-29]. 2. Glutamate and N Methyl D Aspartate (NMDA) Glutamate is the most common excitatory neurotransmitter in the central nervous system. It is composed of four different types of receptors: 3 inotropic receptors – (a) N methyl D aspartate (NMDA), (b) α amino 3 hydroxy 5 methyl 4 isoxazolepropionic acid (AMPA), and (c) Kainate, and one metabotrophic receptor. The NMDA is subclassified into two types of receptors - NR1 (NR1AG) and NR2 (NR2AG). The NR1 receptor is diffusely represented in the brain and is a product of a single gene. The NR2 receptor is localized in various areas of the brain and is composed of four different genes. The AMPA receptor has the sub units GluR1and GluR4, and is more prevalent in the telencephalon, whereas Kainate has GluR5 and GluR7 subunits, as well as K1 and K2, and is more diffusely widespread in the brain. The metabotrophic receptor has three main subgroups – subgroup 1 (m GluR1 and m GluR5), 2 (m GluR2 and m GluR3) and 3 (m GluR4, 6, 7, and 8). The ionotropic glutamic receptors, along with the NMDA receptor, are permeable to Ca+2 and monovalent cations [30,31]. Its overactivation leads to cascade and progressive neuronal damage. Any permanent metabolic dysfunction and deficit in energy substance are responsible for ongoing depolarization and release of Mg+2. The resulting increase of Ca+2 influx and accumulation of intracellular Na+ and Ca+2 ions induce the neural cell death [32]. The neurotoxicity of NMDA also activates the phospholipase A2 pathway [33], neuronal nitro oxide synthase [34-36], and calpain [37]. Acute glutamate neurotoxicity is studied especially in stroke, hypoxia, trauma and epilepsy [38,39]. It has been hypothesized to occur in slow progressive neurodegenerative processes. 2a. Glutamate, NMDA Receptor and Aspirin Induction of cyclooxygenase 2 (COX2) is seen after seizures [40,41], spreading depression [40] and after focal and diffuse ischemia [42,43]. Amelioration of ischemic brain damage, associated with changes of NMDA activity, was shown after administration of indomethacin in gerbil hippocampus CA1 neurons [44] and after treatment with Ibuprofen leading to reduced volume of focal brain ischemia in spontaneous hypertensive rats [45]. Hewett et al [46] examined various COX-1 and COX-2 agents. They found an antineural death effect with administration of COX-1/COX-2 inhibitors and selective COX-2 enzymes, but not in selective COX-1. Aspirin had no effect when using it alone as a preventative

270

Yair Lampl

treatment, but worked well in a combination of aspirin as a pretreatment and the COX-2 inhibitor as post treatment. In this combined administration, the positive COX-2 inhibitory effect was markedly increased. The neurotoxicity of NMDA is mostly induced through a pathway of activation of the NFKB. Grilli et al [15] showed in hippocampal and cerebellar neurons that blockade of the NFKB pathway is the main target of aspirin and sodium salicylate anttiglutamate activities. In mouse cortical cells after treatment with 3 mM of aspirin, Ko et al [47] found blocking of NMDA induced activation of C Jun terminal kinase (JNK) and NFKB. The effect was assumed to induce nuclear translocation of NFKB’s p50 and p65. On rat cerebellar cells, glutamate also induces p38, a subfamily of MAPK, another target of aspirin activity [48]. Crisanti et al [12] demonstrated the key role of protein kinase C zeta (PKC zeta) in the relationship of NMDA and NFKB in neural death. They showed that aspirin, but not salicylic acid, has a direct effect on PKC zeta, leading to decrease of NMDA activity and its nuclear translocation. The decrease of NMDA activity reduces neuronal cell death. The prevention of PKC zeta cleavage and its nuclear translocation by aspirin is hypothesized to have a role in the anti-acute neuronal damage, as well as antiapoptotic, mechanisms.

2b. Aspirin in Non Central Nervous System NMDA Receptors Cochlear system Some studies showed that the association between aspirin and aspirin-induced tinnitus is based on the activation of the cochlear NMDA receptors [49]. Platelets The NMDA receptor of platelets has some characteristics which have differentiated them from the NMDA receptor of the central nervous system [50], including having antiaggregating activity. This effect is potentiated in association with various COX inhibitors, including aspirin and indomethacin [51].

3. NFKB NFKB was first described by Sen and Baltimore in 1986 [52]. This eukaryotic transcription factor enzyme consists of various proteins and exists in most cells where it reacts on specific NFKB binding sites [12,53]. The NFKB DNA are induced and activated by various exogenic and endogenic stimuli. NFKB exists in the cytoplasm as homomer and heteromers of the structurally related protein – Rel/NFKB [54]. According to structure, function and properties, this family group is divided into two main subgroups [55]. The inactive form of NFKB has multiple contacts with IKB, an inhibitor protein related to the Rel/NFKB family group. The activation of the NFKB pathway is induced by splitting of it from the NFKB-IKB complex, activation of the enzyme IKB kinase, phosphorylation of IKB, ubiquitination of the protease, and finally, its degradation. The destruction of the IKB leads to nuclear translocation of the NFKB and activation of the target gene promoter [56,57]. For activation of NFKB transcription activity, the induction of other groups of NFKB proteins (Rel-A, Rel-B, c-Rel) is necessary [58-60]. Sizeable amounts of stimuli varieties – cytokine and chemokine (TNFα, TNFβ, ILα and ILβ) receptors on cell surfaces and adhesion molecules [61]; bacterial products, including lipopolysacharrides; various viruses, such as the herpes group, HTLV, Epstein-Barr virus and the influenza virus; and exposure to hypoxia and

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

271

H2O2, irradiation and toxins – can lead to activation of NFKB. NFKB has a crucial role in protection of the cell, including cell survival [62,63], protection against signal induced cell death [64,65], cancer [66] and oxidative stress [67,68]. NFKB is activated in the early stages of brain damage, as well as in the apoptotic pathway.

3a. Aspirin and NFKB Aspirin has a proven inhibitory effect on NFKB. It is based on prevention of the activity of IKB kinase β. IKB kinase is responsible for the phosphorylation and degradation of IKB. IKB is the main factor in the stabilization of NFKB. Breakdown of the IKB kinase evades the IKB degradation leading to persistence of NFKB in the cytosol and preventing its nuclear translocation [69,70]. The supposition that aspirin may also have a direct effect on NFKB dependent gene is controversial [70,71]. The effect of aspirin on NFKB is related to the inhibition of the vascular cell adhesion molecule 1 (VCAM 1) [72,73] and E selectin [72], reduction of the intracellular adhesion molecule 1 (ICAM 1) expression [74] and changing the mobilization of TNFα and suppression of TNFα mRA [75,76]. The inhibitory effect of aspirin on NFKB is apparent in its blockage of viral activity. 1-2 mM of aspirin inhibits Chlamydia pneumonia by inducing NFKB activation [78]. This inhibitory effect is also shown with the cytomegalovirus [79], HIV in a dosage of 10 mM and in herpes 8 [80]. Aspirin’s NFKB blockage effects also tumor proliferation in the pancreas [81] and lung [82], colorectal cancer [83], as well as reduces angiotensin II in organ damage [84] and carotid artery plaques in humans [85]. According to the various studies, the aspirin’s effective dosage is unclear and ranges from 1mM - 20 mM. 3b. NFKB, Aspirin and the Central Nervous System Brain Hypoxia A decrease of NFKB DNA binding in brain activity was found to be characteristic of COX2 knockout mice [86]. Grilli et al [15] demonstrated and discussed aspirin’s role in neuroprotection through blockage of NFKB activity. On the oxygen and glucose deprivation rat model, Moro et al [87] showed prevention of neural damage after administration of low dose (0.1-0.5 mM) aspirin. This effect was correlated to NFKB translocation, iNOS expression and inhibition of glutamate release. Opposite to these findings, Vartiainen et al [88] in hypoxia/reoxygenation spine rat model pointed to a clear neuroprotective effect of aspirin. However, this effect was found to be secondary to inhibition of the activation of extracellular signal regulate protein (ERK), ERK-1 and ERK-2, but unrelated to NFKB. Parkinson’s Disease Aubin et al [89] demonstrated that the neurotoxic effect of MPTP in mice, an animal model used for Parkinson’s research, can be inhibited by aspirin. They hypothesized that NFKB may play a main role. On Chinese hamster ovary cells, Weingarten et al [90] found that the dopamine intracellularily activated NFKB rapidly and was resistant to aspirin, whereas dopamine extracellularily induced NFKB activity slowly and in small amounts. Only this last type of dopamine activity was inhibited by aspirin.

272

Yair Lampl

Alzheimer’s Disease In human glial cell cultures, activation of NFKB by IL1β leads to release of α2 macroglobulin. This proinflammatory mechanism was assumed to be inhibited by aspirin and to act as a blocker of Aβ peptide, a key molecular chain in the development of Alzheimer’s disease [91]. On the examination of 3-30 mM of sodium salicylate in astroglial cells exposed to the Aβ peptide, the reduction of Aβ activation was up to 60% [92]. APO E Apo E and Apo J are expressed in glial cells, Apo E in microglia cells and Apo J in astrocytes. On exposure to aspirin (10 mM), this expression was blocked. It was assumed that the inhibition occurred via blocking of NFKB [93]. CNS Inflammation While exploring the actions of hepatic metabolism after infection of the central nervous system, Abdulla et al [94] found, following injection of lipopolysacharrides, down regulation of the hepatic enzyme and CYP genes and increase of NFKB activity parallel to other transcription factors. Although there was no direct investigation of the effect of aspirin, it can be hypothesized to be present through the NFKB inhibition effect. 4. Mitogen Activated Protein Kinase (MAPK) MAPK is a family of serinekinase proteins, acting as nuclear transcription factors. The MAPK protein family activity is initiated on the cell surface and acts by transferring γ phosphate of the ATP to the dual serine-threonine sites in the cell’s protein. The MAPK pathways lead to cell death through necrotic or apoptosis mechanisms, as well as to cell proliferation. Three families of MAPKs have been identified: (1) extracellular signal regulate protein (ERK); (2) C-Jun NH2 terminal kinase (JNK); and (3) p38. The ERKs play a role in the mitosis and cell definition and is activated in response to growth factors [95-99]. Of its various know enzymes, the most studied are the ERK-1 and ERK-2. The route of activity is through stimulation of cell surface receptors and activation of the Ras protein. The transcriptional activation of the C-fas is induced by way of phosphorylated ERK-translocation to the nucleus and phosphorylation of the transcription factor ELK-1 [100,101]. The JNK proteins are also known as a group of stress activated MAPK. They consist of two main enzymes – JNK-1 and JNK-2 – and some other less known types. JNK-3 is characterized by its specificity for brain and testicles [102]. All theses are activated by stress, cytokines or endotoxins [103-105]. The JNK signal pathway regulates the C-Jun transcription factor, the ELK-1 and AIF2 [105]. p38 is activated by stress and cytokines and is responsible for regulation of AIF2 and ELK-1 transcription factors. 4a. MAPK and Aspirin ERK In human neutrophils, aspirin inhibits ERK activity. This characteristic is specific for aspirin and was not found with indomethacin [106]. The effect was induced also by MEK – an activator of ERK. A relationship was found between the ERK activation and the integrin

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

273

dependent neutrophil adhesion. An interaction between ERK, NFKB and TNFα was evident with exposure to sodium salicylate [107-110].

JNK and p38 Although activity of JNK seems to be reduced by aspirin [111], Schwenger et al [112] found that p38 and JNK were induced after treatment of cells with sodium salicylate. With the use of sodium salicylate, interaction was seen between p38 and NFKB [113], but not between p38 and JNK [114]. 4b. MAPK, Aspirin and the Central Nervous System Hypoxia The pathway mechanism of NMDA receptor inhibition by aspirin has been shown to be also partially dependent upon the activation of JNK. This activation, which leads to Ca+2 dependent manner of neuroprotection, was tested at an aspirin dosage of 3mM [115]. In hypoxic injured rat spinal cord cell cultures, Vartiainen et al [88] showed that aspirin inhibits neural death. They found an inhibition of both ERK-1 and ERK-2, which were elevated after the trauma. p38 was not altered by the hypoxia and was not affected by aspirin. The therapeutic dosage of aspirin was 1-3 mM/L. Alzheimer’s Disease In the examination of APP 751 transgenic mice (the usual rodent model for Alzheimer’s disease) after exposure to focal brain ischemia, high p38 MAPK was observed in microglia [116]. Aspirin, as well as other p38 inhibitor agents, neutralized the neural vulnerability of the mice. 5. Nitric Oxide (NO), and Nitro Oxide Synthase (NOS) NO is and essential labeled messenger molecule, having the properties of neurotransmitters. The formation of NO occurs by the transmission of L arginine into L citrulline. This process includes the reaction of the quanidino nitrogen area of the L arginine with molecular oxygen in the presence of NOS enzymes. The low concentration of NO produced by NOS inhibit the expression of adhesion molecules and block the synthesis of cytokine and the adhesion of leukocytes. High concentrations of NO produced by NOS react toxic and in a proinflammatory manner [116]. There are three know NOS isomers – two of them (NOS I and NOS III) are constitutional, and one (NOS II), inducible. NOS I (neurogenic NOS-nNOS), which is located in the neuron’s cytosole, induces rapid Ca+2 influx, binding to the calmodulin and generation of NO [117,118]. It also has a crucial effect on the NMDA receptor, acting on the post synaptic calmodulin, the calcium calmodulin complex and the guanylate cyclase in the presynaptic neuron [119]. This process is necessary for inducing the phenomenon of long-time potentiation (LTP) in the creation of memory [120,121]. NOS II (inducible NOS-iNOS) is an inducible cytoplastic enzyme. It can be expressed by overestimation of the astrocytes [123]. Under normal physiological conditions, the concentrations of NOS II are very low [124]. In the presence of lipopolysacharrides, it activates the release of proinflammatory cytokines [125,126]. The main mechanism of NOS II is at least partially dependent upon the nuclear transcription of NFKB, which is inhibited by aspirin [127]. NOS III (endothelial NOS-eNOS) has similar properties to NOS I. It regulates

274

Yair Lampl

the calcium-calmodulin complex system [128] and plays a key role in the vasodilatation of cerebral vessels [129-131] and in controlling the cerebral blood flow [132]. The damaging effect of NO on the brain was investigated in Alzheimer’s disease [133-134], multiple sclerosis [135], Parkinson’s disease [136], and especially, in ischemic brain damage [137139]. The rationale for these effects can be explained by the activation of reactive nitro oxide radicals, damage to the nucleic acids and activation of the poly ADP ribose synthase (PARS).

5a. NOS and Aspirin A specific characteristic of aspirin is having a least a partial inhibitory effect on iNOS expression [140-142]. Kepka-Lenhart et al [143] found that aspirin in a concentration of 3-10 mg inhibited iNOS mRNA induction in lipopolysaccharide stimulated murine macrophage cells, but enhanced iNOS mRNA in interferon gamma stimulated cells. They assumed that different pathways are involved in the aspirin effect on NO and iNOS. Amin et al [140] showed on the same cell culture type that the inhibition of iNOS expression by aspirin is based on the modification and direct action on the mechanism of translation-post translation of the iNOS catalytic activity. The specificity of this effect by aspirin was demonstrated when compared with indomethacin. Inhibition of induction of iNOS was shown on rat cardiac fibroblast selectivity after the administration of aspirin, but not with indomethacin or acetaminophen [144], and it was also shown in rabbit infracted heart in situ after exposure to 150mg-500 mg/day of aspirin [145]. The effect of aspirin on iNOS and NO synthesis in vascular smooth muscle cells was shown to be independent [146] or partially dependent [147] from the mechanism which activated the NFKB system. 5b. NOS, Aspirin and the Central Nervous System Glial Cells In rat glial cell culture, iNOS expression is suppressed by high aspirin dosage resulting in decreased NO production. The effect was hypothesized to be caused either by aspirin’s direct effect on iNOS or through an effect of the prostaglandins [148]. Brain Degenerative Diseases In the comparison of indomethacin, ibuprofen and aspirin on NOS mRNA expression, the properties of beta amyloid protein and interferon gamma to induce NO production in murine macrophage cell lines were tested. Aspirin, contrary to the other agents, had no effect [149]. However, Asanuma et al [150] showed that using the electron spin resonance spectrometry, aspirin has a direct effect on scavenger generated nitric oxide radicals. This dosage dependent phenomenon was assumed to also have neuroprotective properties in neurodegenerative diseases, especially in Alzheimer’s disease. Brain Ischemia and Anoxia Aspirin was found to reduce various types of NOS activities in nitrogen hypoxic induced brain slices. The effect is dose dependent and is expressed only at higher dosages. Aspirin’s activity rate is lower than those of salicylate acid [151]. Contrary to these findings, Vartiainen et al [88] found no involvement of the iNOS in the reactive mechanisms of early post anoxia in rat spinal cord culture. In the comparison of aspirin to triflusal (a fluorinated derivate of

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

275

aspirin), a reduction of nitric oxide activity, calculated as a summation of nitrates, nitration and all NOS activity levels, was demonstrated. The study, which was performed on the rat brain, was conducted under anoxic reoxygenation (180 min) conditions. The reduction was up to 25% dependent upon dosage of the study medication [152].

6. ATP, Aspirin and the Central Nervous System The total volume of adenosine 5’-triphosphat (ATP) varies according to the amount of aspirin present. On cultured cortical neurons exposed to oxygen-glucose deprivation, aspirin blocked the ATP decrease after stress or ischemia in about 40% of the cultures. These characteristics are specific for aspirin and salicylate acid, not for indomethacin. In rats during hypoxia [153], aspirin induced ATP increase and inhibits the negative effect of iNOS induction [154]. The rate of ATP was also increased in a focal cerebral ischemic-reperfusion model [155] varying up to 120%. The mechanism was assumed to be due to the inhibition glutamate recovery by restoration of the ATP level [154]. However, in the examination of the rat glioma growth characteristics in vitro studies, the synthesis of ATP was reduced up to 34% in the presence of aspirin and salicylic acid, while being associated with inhibition of malignant cell growths [156]. 7. Heat Shock Proteins (HSP) Heat shock proteins (HSP) are members of a family of proteins located in intracellular structures – cytoplasm, nucleus, mitochondria, or endoplasmic reticulum. Under normal physiological conditions, they act as protease of chaperons. Their concentrations increase three fold under ischemic and hypoxic conditions, in chemical and toxic injuries, with thermic stress and viral infections [157-159]. The HSP family is divided into six main groups according to their molecular weight – small HSP, HSP 40, HSP 60, HSP 70, HSP 90, and HSP 100. In brain ischemia and the presence of protein synthesis reduction, the HSP 70 is upregulated and the HSP 70 mRNA and protein transcription is induced. The location of increased HSP 70 is in the surrounding area of the post ischemic necrotic core (penumbra). It is hypothesized that the HSP 70 increase has a protective influence on ischemic tissue and facilitates the renaturation of protein after the onset of reperfusion [160-162]. Administration of HSP inducer demonstrated reduced infarct volume in the permanent MCA occlusion model [163]. 7a. Heat Shock Protein (HSP), Aspirin and the Central Nervous System Studies in cultured cells have shown that aspirin can induce HSP70 expression and increase its amounts. After injection of 100 mg/Kg of aspirin combined with heat treatment, Fawcett et al [164] showed on rats a three- to four-fold HSP 70 level in lungs, liver and kidney. Without the associated heat treatment, no alteration of HSP 70 was seen. However, in the examination of rat brain after induced focal cerebral ischemia, HSP 70 was found not to be different after treatment with aspirin than the vehicle control group in the cortex and striate regions. In this study, also found, was no difference in infarct volume among groups. The dosage of aspirin was 100 mg/Kg administered intraperitoneally, and the rats were sacrificed 24 hours after treatment [165].

276

Yair Lampl

8. Metalloproteinases (MMP’s) The matrix metalloproteinases (MMP’s) are a group of enzymes which are responsible for the allostasis of the cell matrix composition and for the cleavage of various extracellular matrix components and extramatrix properties. The origin of these enzymes has already been detected in invertebrates. All MMP’s share a common structure. They contain a single peptide, a propeptide and a catalytic domain. They consist of two zinc ions needed for the catalytic process and at least one of calcium ion. The enzymes, which are active in a neutral milieu, are mostly synthesized as an intact latent enzyme and are activated by plasminogen activators and furin. There are more than 20 members in this enzyme group divided into subfamilies – the classical MMP’s, membrane-bound MMP’s, the ADMS (adamlysins) and the ADMATS (adamlysins and metalloproteinase with a thrombospandin motif). The MMP’s include collagenase, stromelysines, elastases and aggrecanases. A relationship has been found between some of the MMP’s and MAPK [166-168], as well as with pro TNF α [169]. MMP’s have a crucial role in the embryogenesis and normal healing [170], but also in pathological processes, such as arthritis, inflammatory and pulmonary diseases and cancer [171,172]. The effects are partially dependent upon the MMP’s role in angiogenesis. In the central nervous system, the role of MMP’s includes regulation of the blood brain barrier, neoplastic processes cerebrovascular diseases [173-177] and malignant brain tissues [178]. 8a. Metalloproteinase and Aspirin Evidence has indicated that there is an inhibitory effect of aspirin on metalloproteinase. However, the studies were performed only on a part of this protein family group and only on selective cell tissues. It was hypothesized that the effect is at least partially dependent upon the involvement of the NFKB, C JUN and ERK pathways. MMP 1 Aspirin inhibits human endothelial cells. The decrease of expression is selectively specific for aspirin and salicylate, not for other COX inhibitors and is dose dependent (1-5 mM). The effect is correlated to down regulation of oxidized low density lipoproteins and suppression of lectin-like receptors [179]. The dissociative effect between aspirin and selective COX-2 inhibitors was shown also in fibroblast-like synoviocytes [180]. MMP 2 An inhibitory effect was shown to be similar to aspirin in COX-2 inhibition of MMP 2 by its acting on fibronectin [181]. This inhibitory effect was found in lung cancer tissue [182], breast cancer [183] and other neoplastic tissues [184]. MMP 9 The inhibition of MMP 9 expression caused by aspirin was demonstrated in mice tumors [185] and in human breast tumors [183]. No studies have been performed to analyze the efficacy of aspirin on MMP in the central nervous system.

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

277

9. Aspirin and Diseases of the Central Nervous System 9a. Stroke, Brain and Aspirin in Vivo Various studies have identified significantly better outcome of stroke after aspirin administration. Aspirin was acknowledged to be the protective agent in hypoxia as seen in vitro and in vivo studies. Riepe et al [153] showed post anoxic recovery of population spike amplitude and the ATP content after administration of 20 mg/Kg aspirin before pretreatment of white Wistar rats. The recovery rate was about 65%-87% in the population spike recovery and dependent upon time of treatment. Khayyam et al [186] found clear infarct volume reduction by administration of 15 mg/Kg aspirin 30 minutes and 2 hours prior to both common carotid and middle cerebral artery occlusion, but not in the earlier phase (8-24 hours) or after inducing stroke. In a study by De Cristobal et al [187], a reduction of volume was demonstrated in the rat after permanent focal cerebral ischemia with the administration of 30 mg/Kg, 2 hours prior to ligation. Berger et al [188] induced focal ischemia in male Wistar rats by intraperitoneal injection of aspirin. They found a decrease of more than 50% reduction after repeated injections of 40 mg/Kg, not by another lower dosage or single bolus treatment. 9b. Alzheimer’s Disease and Aspirin Studies, which analyzed the efficacy of COX-1 and COX-2 inhibitors to prevent Alzheimer’s disease, reported controversial conclusions. The Alzheimer’s Disease Corporation Study, a multi-center, randomized, placebo-controlled study with a duration of one year, found no effect in treatment with naproxen or fecoxib. Aspirin was not studied [189]. In a Swedish population based sample study, a cross sectional and longitudinal study, which included 702 participants, found an association between low prevalence of Alzheimer’s disease and high dosage use of aspirin [190]. A reduced occurrence of Alzheimer’s disease was found among aspirin users in The Cache Country Study of 201 patients [191] and in the Baltimore longitudinal study of aging with 1,686 participants. The effect was dependent upon duration of aspirin treatment (overall RR 0.4 more than two year duration and RR 0.74 less than two year duration)[192]. Contrary to this finding, in a twin cohort controlled study of 50 pairs and in a case-controlled study of 302 participants [193], only weak correlation toward efficacy was found [194]. In a cross-sectional retrospective study which analyzed the data of 2,708 patients, no effect of aspirin was found contrary to non aspirin NSAIDS [195]. A cohort Kungsholmen Project study of 1,301 patients, with a follow-up period of six years, found a relative risk (RR) of 1.8 in Alzheimer’s disease patients of the APO E α negative group using aspirin [196]. The positive results in some of these studies may be explained by the association between Alzheimer’s disease and aspirin’s neuroprotective effect which involves the amyloid beta, the most important morphological component of Alzheimer’s disease. Aspirin was shown to affect the inhibition of the amyloid beta aggregation [197], the complete inhibition of the fibrillogenesis of amyloid beta (1-42 peptide)[198] and the inhibition of the glial expression of apolipoprotein E, which plays a role in the Alzheimer’s disease metabolism [199]. 10. Parkinson’s Disease and Aspirin In an epidemiological prospective study from a cohort of 45,000 persons, the association between aspirin and parkinsonism was analyzed. Among 415 patients, there was a non significant low risk of parkinsonism with the aspirin users (RR 0.56) [200].

278

Yair Lampl

Contrary to the epidemiological studies, data of in vitro and in vivo experimental studies are promising. The ability of aspirin to protect mesencephalic culture cells against 6 hydroxy dopamine and 1 methyl 4 phenylpyridium (MPP+) was shown to be selective for dopaminergic neurons [201]. The neuroprotective effect of aspirin and salycilate was shown in in vivo studies in the MPTP mice model. The dopamine depletion increased up to 38.6%, dependent upon the dosage of administered aspirin (50 to 100 mg/K)[202].

11. Amyotrophic Lateral Sclerosis (ALS) and Aspirin Barneoud et al [203] in one study examined the effect of soluble aspirin (lysine acetylsalicylate) on the animal model familial ALS mice with SOD (superoxide dismutase) mutation. A better functional outcome was demonstrated with early onset of aspirin treatment. This effect was not present with a later onset of treatment. There was no difference in the life expectancy of these groups.

Apoptosis 1. Overview of Apoptosis Apoptosis is an energy-dependent process of the active cell death, induced by the cell itself. It is characterized by specific morphological parameters which distinguish this cell pathway process from the more commonly known one of necrosis. As first described by Kerr et al [204], the parameters in apoptosis are shrinkage of the cell volume, chromatin margination of the nucleus and irregimentation of cells by persistence of the membrane integrity up to the last stage of cell disruption [205]. The apoptotic cell death pathway was first interpreted as being only a normal component of cell and tissue homeostasis [206]. However, an increase of apoptosis was observed in various pathological disorders. In the central nervous system, it was found to be present in neoplasm [207-208], epilepsy [209,210], ischemic brain damage [211,212], trauma [213] and neurodegenerative diseases [214]. Its role in neoplastic disease was described as being due to its activation after processes which are associated with tissue damage due to DNA mutation or chemotherapy [208]. The genetic regulation of apoptosis was first identified in the nomads of the genes Ced-3 and Ced-4 as a proapoptotic gene, and in Ced-9, as an inhibitor gene [215]. In the mammalian form, overexpression of Bcl-2 was found to have a significant anti-apoptotic effect by acting on the ICE and c-Myc proteins [216], both members of a proapoptotic gene group. Other family members of the Bcl gene group have properties involved in the apoptotic process, including Bax, Bad, Bak and Bcl-x5 as proapoptotic, and Bcl-x4, as inhibitor factors [217]. The hemostasis between the effects of the various members of this group is probably the reason for a stable hemostasis in healthy individuals. p53, a DNA transcription factor, is another protein involved by activation of the proapoptotic Bax gene, in the steady state of apoptosis. Apoptosis is activated in two parallel pathways – the intrinsic and the extrinsic pathway. The extrinsic pathway is advanced by the ligand of the TNF family. These components, along with TNF α1 receptor, lead to trimerization of the receptor and activation of the TNF- and Fas-associated death domains, and finally, targeting caspase-8 to recruit the apoptotic pathway. The intrinsic pathway is a mitochondrial target one which leads to release of cytochrome C and apoptosis induced factor (AIF). The AIF acts on the Apat-1, caspase-9, and finally, caspase-3, in order to enhance the apoptosis. The Bcl protein family has a mean role

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

279

in the regulation of this pathway, including the Bcl-2 and Bcl-xl proteins which also have antiapoptotic properties that act by modulation of the VDAC channel, inhibition of the cytochrome release and translocation to the mitochondria during apoptosis. This mechanism is a caspase-dependent process. The intramembranous space’s acting Smac/Diablo protein functions as a regulator to the caspase activator. The proapoptotic Bcl family members, in the form of Bax, Bak and Bid, act by changing the configuration of the channels on the outer membrane of the mitochondria leading to release of cytochrome C and Smac proteins [218]. Apoptosis seems to have a key role in ischemic brain damage. In animal models, activation of the apoptotic process was identified 30 minutes after onset of stroke, increasing to its maximal point after 24-48 hours, with a persistence of the activity for up to four weeks [219]. In parts of the traumatic brain, apoptosis has appeared after eight hours, peaking in activity 24-48 hours, as well [220]. The increase in activity was associated with elevation of the Bax gene [220]. Evidence of the existence of apoptosis was found also in epilepsy [209-210], as well as in various neurodegenerative diseases of the central nervous system, including amyotrophic lateral sclerosis [221], Parkinson’s disease [222] and Alzheimer’s disease [214]. However, the meaning of the increase in apoptosis versus decrease of the process is not well understood in the central nervous system, and it seems that at least part of the process has a favorable effect, whereas other effects lead to transient or permanent undesirable outcomes.

2. Apoptosis and Glutamate Receptors Glutamate receptors are frequently involved in toxic mechanisms, leading to necrotic damage in the central nervous system, especially in brain ischemia, brain traumatic lesions and epilepsy. The excitatory neurotransmitter substrates are responsible for mediation of glutamate receptors which results in this irreversible damage. It is also known that, apart from the excitatory necrotic pathway, a second, late stage and non-necrotic neural cell death pathway is activated by glutamate. This traumatic process is based on activation of the calcium influx process by opening calcium channels, which are regulated by the glutamate receptors [213,223,224]. This type of neural cell death can be identified for an extended period of time (up to hours) after the induction of ischemic or anoxic brain damage. This late phase of injury induces changes compatible with apoptosis. The association between the glutamate receptor, glutamate excitatory cell toxicity and apoptosis was shown in cortical, hippocampal and cerebral neural cells. Glutamate was shown to trigger the internucleosomal DNA cleavage in cortical and hippocampal neural cells [225]. The morphological changes were characterized by internucleosomal DNA fragmentation, compatible with apoptotic changes. DNA fragmentation and chromatin margination was found also in cerebellar cells in a second phase of injury and after reactivation of damaged mitochondrial functions [226]. The type of damage (necrotic or apoptotic) was dependent upon the intensity of NMDA receptor stimulation. The less intense activation was responsible for the delayed apoptotic injury, whereas the high intense was responsible for the early necrotic damage. An association between apoptosis and other inducing factors was found also in oxidative stress-induced mediators. Adcock et al [227] identified morphological changes characteristic for apoptosis after activation of NFKB followed oxidative stress.

280

Yair Lampl

3. The Proapoptotic Effect of Aspirin The proapoptotic effect of aspirin was identified in malignant colorectal, gastric and breast cancer and leukemia. Retrospective studies showed a decrease of colorectal cancer up to 50% in patients who were under permanent aspirin treatment. However, other studies, especially post hoc analysis of larger vascular studies, did not share this optimistic finding [228-231]. The specific role of aspirin in comparison to other Cox inhibitor substrates was hypothesized to be caused either by a covalent modifying action alternating the biological role of Cox-2 or the special effect of the more potent metabolite of salicylic acid, both acting through the enhanced effect of the metabolite 15 R hydroxyeicosatetraenoic acid, a tumor inhibitor [232]. These studies analyzed the mechanisms of the anti-tumoral effect of aspirin and demonstrated a proapoptotic effect on the early stage of carcinogenesis [233,234]. The exact location where aspirin affects the apoptotic pathway seems to be on its intrinsic and extrinsic pathway areas. Mitochondria play a critical role in the aspirin-induced apoptosis [235], lowering the mitochondrial permeability [236], for example. A direct effect by aspirin was shown on the actions of NFKB [237,238], interleukins [239,240], TNFα [204,241] and the caspase family members [242]. Aspirin also acts by modification of various antiapoptotic and proapoptotic protein members of the Bcl2 family group. In an analysis of the deubiquitinating enzymes, Brummelkamp, et al [243] found that the inhibition of the enzymes activates the transcription factor NFKB and leads to the antiapoptotic mechanism. An inhibition of NFKB reverses this effect by acting on the TNFα receptor and TNF receptor associated protein factor (TNF/RAF), as well as working downstream on the IKB/NFKB complex which seems to be the initiating factor. Although the aspirin-induced proapoptotic effect was mostly studied on cell culture specimens, the assumption is that this phenomenon has a very important role in controlling the growth of premalignant or malignant cells. 3a. Gastric Cancer Various reports have indicated that aspirin induced gastric mucosa cancer cell death. In an epidemiological study, Thun et al [231] showed a 40% reduction of death from gastric cancer among aspirin users. Studies performed on gastric epithelial cells showed that the antitumoral effect of aspirin is based on activation of the apoptotic pathway. Zhou et al [244] noted that the antiapoptotic induced by aspirin is brought about by the upregulation of Bax and Bak. Zhu et al [245] showed that the apoptosis is blocked by protein C activation through inhibition of c-Myc. In a study performed on the AGS line of gastric mucosa cells, Power et al [246] demonstrated early activation of caspase-8 and caspase-9, associated with activation of caspase-3, caspase-6 and caspase-7 and cleavage of the PARP protein. These findings stress the main role of the mitochondrial pathway in the aspirin induced apoptosis in gastric cells. On the same gastric cell line, this research group also demonstrated down regulation of cytosolic Bcl-2, translocation of Bax from cytosol into the mitochondria and Bid processing. The apoptosis induced by enhanced aspirin concentration was more dependent upon the caspase-9 activating pathway. This finding underscores not only the main role of the Bcl-2 protein family, but also the more important role it plays in the activation of the mitochondrial pathway. These results were also confirmed in other studies on other malignant gastric cell lines [247,248].

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

281

3b. Colorectal Cancers The clinical role of aspirin in colorectal cancers was demonstrated by prospective and retrospective epidemiological studies and showed reduction of risk of fatal colon cancer with its use. Its preventative effect was shown to be enhanced when the subject was included in the case-controlled study of the Nottingham Faecal Occult Blood Screening Programme [249]. A randomized trial of aspirin to prevent colorectal adenoma found that 81 mg of aspirin has a preventative effect in subjects at risk for developing colorectal cancer [250]. In animal models, aspirin’s protective effect was shown in colon cancer of the rat [251], and also in the mouse min/+ model [252]. In cell culture studies, Din et al [253,254] found various specific effects on colorectal cancer cell lines compared with breast and gynecologic cancers. They found concentrator dependent IKBα degradation, NFKB nuclear translocation and inducing of apoptosis in all colorectal cell lines compared with no effect in the non-colorectal ones. These effects are dependent upon the p53 protein and DNA repair status. This finding was not in agreement with previous studies assuming that the DNA mismatched repair protein is responsible for the aspirin induced proapoptotic effect in human colorectal cancer. The protective effect of aspirin against apoptosis through activation of the phosphatidylinostal 3 Kinase/AKT/p21 pathway [255] leads to the conclusion that aspirin may have a proapoptotic, but also a preventative effect, so that, therefore, aspirin may really have a regulatory effect on apoptosis. 3c. Endometrial and Human Cervical Cancers In one study performed on three different endometrial cancers, the antiapoptotic properties of aspirin, as well as other selective Cox-2 inhibitors, were analyzed. Aspirin was shown to trigger apoptosis by release of cytochrome C, activation of caspase-9, caspase-3 and cleavage of PARP. The Bcl-2 and Bcl-x1 were downregulated and Bax and Bcl-x5 upregulated. These findings were confirmed on three different endometrial cancer cell lines. In other studies, human cervical adenocarcinoma and aspirin was analyzed mostly on the HeLa cell line, and as has been proven elsewhere, its role in the inhibition of TNFα and IL-1induced NFKB was shown. This effect was found to be dose-dependent and based upon phosphorylation and degradation of IKBα, a protein belonging to the inhibitory protein group, acting upon the NFKB transcription factor [256]. Other studies have examined aspirin in combination therapy, and its subsequent effect on apoptosis. In this type of cell line, Kim et al [257] showed there was an enhanced aspirin antitumoral effect, which was mediated by Bcl-2 and caspase-3, when combined with radiation. 3d. Leukemia Analysis of the behavior of human leukemic T cells was mostly performed on the Jurkat cell line [258]. The phenomenon of aspirin-induced apoptosis was shown, at least partially, upon inhibition of the Mcl-1 protein activity. This is an early induction gene, identified in human myeloid leukemia. Other hypotheses tested on the same cell line, which caused the apoptosis, were not confirmed. 3e. Hepatoma In cultured hepatocytes, Bradham et al showed the mediation of the mitochondrial permeability transition (MPT) event in TNFα- and Fas-mediated apoptosis [259]. In cultured heptocyte cell line testing, aspirin was shown to activate the process of MPT leading to cell

282

Yair Lampl

death [260]. The intensity of death was dependent upon aspirin concentration. It was hypothesized that this mechanism is responsible for Reye’s syndrome. Oh et al [236] had determined that aspirin induced MPT pathways promoted apoptotic, as well as necrotic cell death. The apoptosis was mediated by acceleration of caspase-3 activation.

3f. Breast Cancer Whereas, Cox inhibitors were shown to prevent breast cancer progression in an animal model [261-263], cell culture examination could find similar characteristic apoptosismediating factors also for aspirin [240,264]. However, evidence for the efficacy of aspirin as an antiapoptotic agent was found also in breast cancer. In MCF7 breast cancer cell culture, aspirin prevents the upregulation of survivin. Survivin is a family member of the IAP (inhibitor of apoptosis protein) and prevents apoptosis. This effect is nonspecific for aspirin, but more effective in comparison to selective Cox-2 inhibitors [265]. 4. Aspirin-Inducing Proapoptotic or Antiapoptotic of the Central Nervous System Analysis of the behavior of cerebellar granular cells to exposure of glutamate showed that, in addition to the induction of the necrotic mechanism, there was also a prominent activation of the apoptotic pathway. These results involving aspirin on brain NFKB play a crucial role in helping to understand the association between aspirin and brain neuroprotection. Pretreatment of the cell culture with aspirin induced inhibition of P50, a member of the NFK family group, with induction of apoptosis. The relation between glutamate and apoptosis was shown also for p53, p21 and MSH2, proteins which are not related to aspirin [266]. 4a. Malignant Brain Tumor Studies which analyzed the effect of aspirin on glioma cell lines demonstrated inhibition of cell growth. Aas et al [156] showed that aspirin inhibited the proliferation of cells in vitro and in vivo in rat glial cells. The antitumoral drug effect on glioma cells was demonstrated also in other studies [267]. The correlation between aspirin, reduction of cell proliferation and apoptosis was shown by Amin et al [268]. They analyzed the antiproliferation on gliobastoma cell lines T98G. Aspirin exhibited clear proapoptotic and antiproliferative effects. This was dependent upon dosage and time, reading the maximal intensity of inhibition after 24 hours. The dosage dependency was shown also on rats, impregnated with C6 glioma cells. With the administration of low dosage (12.5-25 mg/Kg per day), the tumor size decreased; whereas, high dosage (200-400 mg/Kg per day) initiated a paradoxical effect with increase of the tumor volume, cell proliferation and mitotic index [269]. 4b. Brain Ischemia The mechanism of activation of brain apoptosis after ischemia is not clear. Lee et al [270] studied the antiapoptotic effect of antiaggregation and antitoxic drugs in induced focal ischemia in rats. After administration of aspirin, no suppression of the DNA fragmentation phenomenon was seen in the surrounding cortical penumbra tissue. A similar observation was noticed after clopidogrel and other antioxidant agents. We examined the role of Annexin V in acute stroke [unpublished data]. Annexin V, an endogenous human protein, is attached to the membrane-bound phosphatidylserine. In apoptosis, there is a translocation of the phosphatidylserine from the inner to the outer leaflet of the cell membrane [271,272].

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

283

Annexin V radiolabeled to Tc99m can be used in vitro and in vivo to detect apoptosis. We determined that radiolabeled Annexin V had the ability to concentrate in apoptotic cell death in humans with acute cerebral stroke. From a total of 12 patients, eight had a positive finding, and in five of these, there was a high concentration of Annexin V found not only in the infarct area, but in a distant one which included the contralateral hemisphere. There was a correlation between this finding and the usage of aspirin prior to the stroke. Although preliminary, these results may raise the hypothesis that aspirin may play a proapoptotic role in stroke. Also, as verification of this assumption, a new compound – nitric oxide aspirin (NCX 4016) (a nitric oxide releasing aspirin agent) – was shown to prevent apoptosis in the mouse model [273] and reduce brain damage in focal cerebral ischemia in the rat [165].

CONCLUSION 1. Promising Data The data concerning the neuroprotective effect of aspirin on the brain is very promising. It seems to be activated by the use of various pathways and target locations. The majority of emphasized the specificity of aspirin’s proneuroprotective effect in comparison to the other COX inhibitors. Additionally, the exact dose needed for good efficacy is not yet clear. According to various studies, efficacy was achieved by low up to high concentrations. The conclusion that aspirin has a neuroprotective effect is based upon epidemiological, in vitro and in vivo animal models, but not on human in vivo studies. For confirmation of this promising conclusion and to determine its implication on therapeutic management, human clinical studies must be performed.

2. Aspirin in Apoptosis of the Central Nervous System The overall effect of aspirin in the brain proapoptotic and antiapoptotic mechanisms is not yet clear. Nevertheless, studies have demonstrated pathways of action connecting aspirin and apoptotic cell death. Furthermore, it would seem that the proapoptotic characteristics of aspirin demonstrated in other tissues are relevant also for the brain. Therefore, this may result in the assumption that aspirin plays a role in protection against brain tumors. It may be hypothesized that Aspirin may have an additional neuroprotective effect against other diseases of the central nervous system. However, as the exact behavior of aspirin in inducing proapoptotic or antiapoptotic mechanisms is not yet entirely clear, more data is necessary in order to establish more definitive conclusions.

REFERENCES [1]

Palmer GC. Neuroprotection by NMDA receptor antagonists in a variety of neuropathologies. Curr Drug Targets. 2001;2(3):241-71.

284 [2] [3] [4]

[5] [6] [7] [8] [9] [10] [11]

[12] [13] [14]

[15] [16]

[17]

[18]

[19]

[20]

Yair Lampl Fahn S, Sulzer D. Neurodegeneration and neuroprotection in Parkinson disease. Neuro Rx. 2004;1(1):139-54. Yakovlev AG, Faden AI. Mechanisms of neural cell death: implications for development of neuroprotective treatment strategies. Neuro Rx. 2004;1(1):5-16. Rohargi T, Sedehizade F, Reymann KG, Reiser G. Protease-activated receptors in neuronal development, neurodegeneration, and neuroprotection: thrombin as signaling molecule in the brain. Neuroscientist. 2004;10(6):501-12. Clarke CF. Neuroprotection and pharmacotherapy for motor symptoms in Parkinson’s disease. Lancet Neurol. 2004;3(8):466-74. Gagliardi RJ. Neuroprotection, excitotoxicity and NMDA antagonists. Arq Neuropsiquiatr. 2000;58(2B):583-8. Cheng YD, Al-Khoury L, Zivin JA. Neuroprotection for ischemic stroke: two decades of success and failure. Neuro Rx. 2004;1(1):36-45. Wu D. Neuroprotection in experimental stroke with targeted neurotrophins. Neuro Rx. 2005;2(1):120-8. Martinez-Vila E, Irimia P. Challenges of neuroprotection and neurorestoration in ischemic stroke treatment. Cerebrovasc Dis. 2005;20 Suppl 2:148-58. Tasi EC, Tator CH. Neuroprotection and regeneration strategies for spinal cord repair. Curr Pharm Des. 2005;11(10):1211-22. Peng BG, Chen S, Lin X. Aspirin selectively augmented N-methyl-D-aspartate types of glutamate responses in cultured spiral ganglion neurons of mice. Neurosci Lett. 2003;343(1):21-4. Crisanti P, Leon A, Lim DM, Omri B. Aspirin prevention of NMDA-induced neuronal death by direct protein kinase Czeta inhibition. J Neurochem. 2005;93(6):1587-93. Kopp E, Gosh S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 1994;265(5174):956-9. Pierce JW, Read MA, Ding H, Luseinskas FW, Collins T. Salicylates inhibit I kappa Balpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 1996;156(10):3961-9. Grilli M, Pizzi M, Memo M, Spano P. Neuroprotection by aspirin and sodium salicylate through blockade of NF-kappa B activation. Science. 1996;274(5291):1383-5. Aeberhard EE, Henderson SA, Arabolos NS, Griscavage JM, Castro FE, Barrett CT, et al. Non-steroidal anti-inflammatory drugs inhibit expression of the inducible nitric oxide synthase gene. Biochem Biophys Res Commun. 1995;208:1053-9. Sakitani K, Kitade H, Inoue K, Kamiyama Y, Nishizawa M, Okumura T, et al. The anti-inflammatory drug sodium salicylate inhibits nitric oxide formation induced by interleukin-1 beta at a translational step, but not at a transcriptional step, in hepatocytes. Hepatology. 1997;25:416-20. Kwon G, Hill JR, Corbett JA, McDaniel ML. Effects of aspirin on nitric oxide formation and de novo protein synthesis by RINm5F cells and rat islets. Mol Pharmacol. 1997;52:398-405. Saini T, Bagchi M, Bagchi D, Jaeger S, Hosoyama S, Stohs SJ. Protective ability of acetylsalicylic acid (aspirin) to scavenge radiation induced free radicals in J774A.1 macrophage cells. Res Commun Mol Pathol Pharmacol. 1998;101(3):259-68. Guerrero A, Gonzalez-Correa JA, Arrebola MM, Munoz-Marin J, Sanchez de la Cuesta F, de la Cruz JP. Antioxidant effects of a single dose of acetylsalicylic acid and salicylic

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

[21]

[22]

[23]

[24]

[25]

[26] [27]

[28]

[29]

[30]

[31] [32]

[33]

[34]

285

acid in rat brain slices subjected to oxygen-glucose deprivation in relation with its antiplatelet effect. Neurosci Lett. 2004;358(3):153-6. Prasad K, Lee P. Suppression of oxidative stress as a mechanism of reduction of hypercholesterolemic atherosclerosis by aspirin. J Cardiovasc Pharmacol Ther. 2003;8(1):61-9. Wu R, Lamontagne D, de Champlain J. Antioxidative properties of acetylsalicylic acid on vascular tissues from normotensive and spontaneously hypertensive rats. Circulation. 2002;105(3):387-92. Colantoni A, de Maria N, Caraceni P, Bernardi M, Floyd RA, Van Thiel DH. Prevention of reoxygenation injury by sodium salicylate in isolated-perfused rat liver. Free Radic Biol Med. 1998;25:87-94. van Jaarsveld H, Kuyl JM, van Zyl GF, Barnard HC. Salicylate in the perfusate during ischemia/reperfusion prevented mitochondrial injury. Res Commun Mol Pathol Pharmacol. 1994;86:287-95. Gutknecht J. Salicylates and proton transport through lipid bilayer membranes: a model for salicylate-induced uncoupling and swelling in mitochondria. J Membr Biol. 1990;115(3):253-60. Petreseu I, Tarba C. Uncoupling effects of diclofenac and aspirin in the perfused liver and isolated hepatic mitochondria of rat. Biochem Biophys Acta. 1997;1318(3):385-94. Somasundaram S, Sigthorsson C, Simpson RJ, Watts J, Jacob M, Tavares IA, et al. Uncoupling of intestinal mitochondrial oxidative phosphorylation and inhibition of cyclooxygenase are required for the development of NSAID-enteropathy in the rat. Aliment Pharmacol Ther. 2000;14(5):639-50. Cronstein BN, Van De Stouwe M, Druska L, Levin RI, Weissmann G. Nonsteroidal antiinflammatory agents inhibit stimulated neutrophil adhesion to endothelium: adenosine dependent and independent mechanisms. Inflammation. 1994;18:323-35. Crostein BN, Montesinos MC, Weismann G. Salicylates and sulfasalazine, but not glucocorticoids, inhibit leukocyte accumulation by an adenosine-dependent mechanism that is independent of inhibition of prostaglandin synthesis and p105 of NF kappa B. Proc Natl Acad Sci USA. 1999;96:6377-81. Mayer ML, Westbrook GL. Permeation and block of N-methyl-D-aspartic acid receptor channels by divalent cations in mouse cultured central neurons. J Physiol. 1987;394:501-27. Westbrook GL, Mayer ML. Micromolar concentrations of Zn2+ antagonize NMDA and GABA responses of hippocampal neurons. Nature. 1987;328(6131):640-3. Dykens JA. Isolated cerebral and cerebellar mitochondria produce free radicals when exposed to elevated CA2+ and Na+: implications for neurodegeneration. J Neurochem. 1994;63(2):584-91. Lazarewicz JW, Wroblewski JT, Costa E. N-methyl-D-aspartate-sensitive glutamate receptors induce calcium-mediated arachidonic acid release in primary cultures of cerebellar granule cells. J Neurochem. 1990;55(6):1875-81. Ayata C, Ayata G, Hara H, Matthews RT, Beal MF, Ferrante RJ, et al. Mechanisms of reduced striatal NMDA excitotoxicity in type I nitric oxide synthase knock-out mice. J Neurosci. 1997;17(18):6908-17.

286

Yair Lampl

[35] Hajimohammadreza J, Raser KJ, Nath R, Nadmipalli R, Scott M, Wang KK. Neuronal nitric oxide synthase and calmodulin-dependent protein kinase II alpha undergo neurotoxin-induced proteolysis. J Neurochem. 1997;69(3):1006-13. [36] Kara P, Friedlander MJ. Dynamic modulation of cerebral cortex synaptic function by nitric oxide. Prog Brain Res. 1998;118:183-98. [37] Siman R, Noszek JC. Excitatory amino acids activate calpain I and induce structural protein breakdown in vivo. Neuron. 1988;1(4):279-87. [38] Sloviter RS. “Epileptic” brain damage in rats induced by sustained electrical stimulation of the perforant path. I. Acute electrophysiological and light microscopic studies. Brain Res Bull. 1983;10(5):675-97. [39] Choi DW. Calcium-mediated neurotoxicity: relationship to specific channel types and role in ischemic damage. Trends Neurosci. 1988;11(10):465-9. [40] Miettinen S, Fusco FR, Yrjanheikki J, Keinanen R, Hirvonen T, Roivainen R, et al. Spreading depression and focal brain ischemia induce cyclooxygenase-2 in cortical neurons through N-methyl-D-aspartic acid-receptors and phospholipase A2. Proc Natl Acad Sci USA. 1997;94(12):6500-5. [41] Adams J, Collaco-Moraes Y, de Belleroche J. Cyclooxygenase-2 induction in cerebral cortex: an intracellar response to synaptic excitation. J Neurochem. 1996;66(1):6-13. [42] Collaco-Moraes Y, Aspey B, Harrison M, de Belleroche J. Cyclo-oxygenase-2 messenger RNA induction in focal cerebral ischemia. J Cereb Blood Flow Metab. 1996;16(6):1366-72. [43] Nakayama M, Uchimura K, Zhu RL Nagayama T, Rose ME, Stetler RA. Cyclooxygenase-2 inhibition prevents delayed death of CA1 hippocampal neurons following global ischemia. Proc Natl Acad Sci USA. 1998;95(18):10954-9. [44] Sasaki T, Nakagomi T, Kirino T, Tamura A, Noguchi M, Saito I, et al. Indomethacin ameliorates ischemic neuronal damage in the gerbil hippocampal CA1 sector. Stroke. 1988;19(11):1399-403. [45] Cole DJ, Patel PM, Reynolds L, Drummond JC, Marcantonio S. Temporary focal cerebral ischemia in spontaneously hypertensive rats: the effect of ibuprofen on infarct volume. J Pharmacol Exp. Ther. 1993;266(3):1713-17. [46] Hewett SJ, Uliasz TF, Vidwans AS, Hewett JA. Cyclooxygenase-2 contributes to Nmethyl-D-aspartate-mediated neuronal cell death in primary cortical cell culture. J Pharmacol Exp Ther. 2000;293(2):417-25. [47] Ko HW, Park KY, Kim H, Han PL, Kim YU, Gwag BJ, et al. Ca2+-mediated activation of c-Jun N-terminal kinase and nuclear factor kappa B by NMDA in cortical cell cultures. J Neurochem. 1998;71(4):1390-5. [48] Kawasaki H, Morooka T, Shimohama S, Kimura J, Hirano T, Gotoh Y, et al. Activation and involvement of p38 mitogen-activated protein kinase in glutamate-induced apoptosis in rat cerebellar granule cells. J Biol Chem. 1997;272(30):18518-21. [49] Guitton MJ, Caston J, Ruel J, Johnson RM, Pujol R, Peul JL. Salicylate induces tinnitus through activation of cochlear NMDA receptors. J Neurosci. 2003;23(9):3944-52. [50] Franconi F, Miceli M, De Montis MG, Crisafi EL, Bennardini F, Tagliamonte A. NMDA receptors play an anti-aggregating role in human platelets. Thromb Haemost. 1996;76(1):84-7.

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

287

[51] Franconi F, Miceli M, Alberti L, Seghieri G, De Montis MG, Tagliamonte A. Further insights into the anti-aggregating activity of NMDA in human platelets. Br J Pharmacol. 1998;124(1):35-40. [52] Sen R, Baltimore D. Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell. 1986;46(5):705-16. [53] Li X, Stark GR. NFkappa B-dependent signaling pathways. Exp Hematol. 2002;30(4):285-96. [54] May MJ, Ghosh S. Rel/NF-kappa B and I kappa B proteins: an overview. Semin Cancer Biol. 1997;8(2):63-73. [55] Siebenlist U, Franzoso G, Brown K. Structure, regulation and function of NF-KB. Annu Rev Cell Biol. 1994;10:405. [56] Karin M, Ben Neriah Y. Phosphorylation meets ubiquitination: the control of NF-KB activity. Annu Rev Immunol. 2000;18:621-63. [57] Wang T, Zhang X, Li JJ. The role of NF-kappaB in the regulation of cell-stress responses. Int Immunopharmacol. 202;2(11):1509-20. [58] Read MA, Brownell JE, Gladysheva TB, et al. Nedd8 modification of cul-1 activates SCF(β(TrCP))-dependent ubiquitination of IKBβ. Mol Cell Biol. 2000;20:2326-33. [59] Silverman N, Maniatis T. NF-KB signaling pathways in mammalian and insect innate immunity. Genes Dev. 2001;15:2321. [60] Zhong H, SuYang H, Erdjument-Bromage H, Tempst P, Ghosh S. The transcriptional activity of NF-KB is regulated by the IKB-associated PKAc subunit through a cyclic AMP-independent mechanism. Cell. 1997;89:413-24. [61] Pahl HL. Activators and target genes of Rel/NF-KB transcription factors. Oncogene. 1999;18:6853-66. [62] Sonenshein GE. Rel/NF-K B transcription factors and the control of apoptosis. Semin Cancer Biol. 1997;8:113-9. [63] Wu M, Arsura M, Bellas RE, et al. Inhibition of c-myc expression induces apoptosis of WEHI 231 murine B cells. Mol Cell Biol. 1996;16:5015-25. [64] Boldin MP, Goncharov TM, Goltsev YV, Wallach D. Involvement of MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1- and TNF receptor-induced cell death. Cell. 1996;85:803-15. [65] Wang CY, Mayo MW, Baldwin AS Jr. TNF- and cancer therapy-induced apoptosis: potentiation by inhibition of NF-KB. Science. 1996;274:784-7. [66] Rayet B, Gelinas C. Aberrant rel nfkb genes and activity in human cancer. Oncogene 1999;18:6938-47. [67] Manna SK, Zhang HJ, Yan T, Oberley LW, Aggarwal BB. Overexpression of manganese superoxide dismutase suppresses tumor necrosis factor-induced apoptosis and activation of nuclear transcription factor-KB and activated protein-I. J Biol Chem. 1998;273:13245-54. [68] Meyer M, Schreck R, Baeuerle PA. H2O2 and antioxidants have opposite effects on activation of NF-K B and AP-1 in intact cells: AP-1 as secondary antioxidant-responsive factor. EMBO J. 1993;12:2005-15. [69] Yin MJ, Yamamoto Y, Gaynor RB. The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 1998;396(6706):77-80.

288

Yair Lampl

[70] Mortaz E, Redegeld FA, Nijkamp FP, Engels F. Dual effects of acetylsalicylic acid on mast cell degranulation, expression of cyclooxygenase-2 and release of proinflammatory cytokines. Biochem Pharmacol. 2005;69(7):1049-57. [71] Mitchell JA, Saunders M, Barnes PJ, Newton R, Belvisi MG. Sodium salicylate inhibits cyclo-oxygenase-2 activity independently of transcription factor (nuclear factor kappaB) activation: role of arachidonic acid. Mol Pharmacol. 1997;51(6):907-12. [72] Weber C, Erl W, Pietsch A, Weber PC. Aspirin inhibits nuclear factor-kappa B mobilization and monocyte adhesion in stimulated human endothelial cells. Circulation. 1995;91(7):1914-7. [73] Sakurada S, Kato T, Okamoto T. Induction of cytokines and ICAM-1 by proinflammatory cytokines in primary rheumatoid synovial fibroblasts and inhibition by N-acetyl-L-cysteine and aspirin. Int Immunol. 1996;8(10):1483-93. [74] Cercek B, Yamashita M, Dimayuga P, Zhu J, Fishbein MC, Kaul S, et al. Nuclear factor-kappaB activity and arterial response to balloon injury. Atherosclerosis. 1997;131(1):59-66. [75] Shackelford RE, Alford PB, Xue Y, Thai SF, Adams DO, Pizzo S. Aspirin inhibits tumor necrosis factor alpha gene expression in murine tissue macrophages. Mol Pharmacol 1997;52(3):421-9. [76] Osnes LT, Foss KB, Joo GB, Okkenhaug C, Westvik AB, Ovstebo R, et al. Acetylsalicylic acid and sodium salicylate inhibit LPS-induced NF-kappa B/c-Rel nuclear translocation and synthesis of tissue factor (TF) and tumor necrosis factor alfa (TNF-alpha) in human monocytes. Thromb Haemost. 1996;76(6):970-6. [77] Kopp E, Ghosh S. Inhibition of NF-kappa B by sodium salicylate and aspirin. Science. 1994;265(5174):956-9. [78] Yoneda H, Miura K, Matsushima H, Sugi K, Murakami T, Ouchi K, et al. Aspirin inhibits Chlamydia pneumoniae-induced NF-kappa B activation, cyclo-oxygenase-2 expression and prostaglandin E2 synthesis and attenuates chlamydial growth. J Med Microbiol. 2003;52(Pt 5):409-15. [79] DeMeritt IB, Milford LE, Yurochoko AD. Activation of the NF-kappaB pathway in human cytomegalovirus-infected cells is necessary for efficient transactivation of the major immediate-early promoter. J Virol. 2004;78(9):4498-507. [80] Samaniego F, Pati S, Karp JE, Prakash O, Bose D. Human herpes virus 8K1-associated nuclear factor-kappa B-dependent promoter activity: role in Kaposi’s sarcoma inflammation? J Natl Cancer Inst Monogr. 2001;28:15-23. [81] Sclabas GM, Uwagawa T, Schmidt C, Hess KR, Evans DB, Abbruzzese JL, et al. Nuclear factor kappa B activation is a potential target for preventing pancreatic carcinoma by aspirin. Cancer. 2005;103(12):2485-90. [82] Futakuchi M, Ogawa K, Tamano S, Takahashi S, Shirai T. Suppression of metastasis by nuclear factor kappaB inhibitors in an in vivo lung metastasis model of chemically induced hepatocellular carcinoma. Cancer Sci. 2004;95(1):18-24. [83] Din FV, Stark LA, Dunlop MG. Aspirin-induced nuclear translocation of NFkappaB and apoptosis in colorectal cancer is independent of p53 status and DNA mismatch repair proficiency. Br J Cancer. 2005;92(6):1137-43. [84] Muller DN, Heissmeyer V, Dechend R, Hampich F, Park JK, Fiebeler A, et al. Aspirin inhibits NF-kappaB and protects from angiotensin II-induced organ damage. FASEB J. 2001;15(10):1822-4.

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

289

[85] Sattler KJ, Woodrum JE, Galili O, Olson M, Samee S, Meyer FB, et al. Concurrent treatment with rennin-angiotensin system blockers and acetylsalicylic acid reduces nuclear factor kappaB activation and C-reactive protein expression in human carotid artery plagues. Stroke. 2005;36(1):14-20. [86] Rao JS, Langenbach R, Bosetti F. Down-regulation of brain nuclear factor-kappa B pathway in the cyclooxygenase-2 knockout mouse. Brain Res Mol Brain Res. 2005;139(2):217-24. [87] Moro MA, De Alba J, Cardenas A, De Cristobal J, Leza JC, Lizasoain I, et al. Mechanisms of the neuroprotective effect of aspirin after oxygen and glucose deprivation in rat forebrain slices. Neuropharmacology. 2000;39(7):1309-18. [88] Vartianen N, Goldsteins G, Keksa-Goldsteine V, Chan PH, Koistinaho J. Aspirin inhibits p44/42 mitogen-activated protein kinase and is protective against hypoxia/reoxygenation neuronal damage. Stroke. 2003;34(3):752-7. [89] Aubin N, Curet O, Deffois A, Carter C. Aspirin and salicylate protect against MPTPinduced dopamine depletion in mice. J Neurochem. 1998;71(4):1635-42. [90] Weingarten P, Bermak J, Zhou QY. Evidence for non-oxidative dopamine cytotoxicity: potent activation of NF-kappa B and lack of protection by anti-oxidants. J Neurochem. 2001;76(6);1794-804. [91] Gao F, Bales KR, Dodel RC, Liu J, Chen X, Hample H. NF-kappaB mediates IL-1 beta-induced synthesis/release of alpha2-macroglobulin in a human glial cell line. Brain Res Mol Brain Res. 2002;105(1-2):108-14. [92] Dodel RC, Du Y, Bales KR, Gao F, Paul SM. Sodium salicylate and 17beta-estradiol attenuate nuclear transcription factor NF-kappaB translocation in cultured rat astroglial cultures following exposure to amyloid A beta (1-40) and lipopolysaccharides. J Neurochem. 1999;73(4):1453-60. [93] Saura J, Petegnief V, Wu X, Liang Y, Paul SM. Microglial apolipoprotein E and astroglial apolipoprotein J expression in vitro: opposite effects of lipopolysaccharide. J Neurochem. 2003;85(6):1455-67. [94] Abdulla D, Goralski KB, Del Busto Cano EG, Renton KW. The signal transduction pathways involved in hepatic cytochrome P450 regulation in the rat during a lipopolysaccharide-induced model of central nervous system inflammation. Drug Metab Dispos. 2005;33(10):1521-31. [95] Zanella CL, Timblin CR. Cummins A, Jung M, Goldberg J, Raabe R, et al. Asbestosinduced phosphorylation of epidermal growth factor is linked to c-fos and apoptosis. Am J Physiol. 1999;277(4 Pt. 1):L684-93. [96] Sebolt-Leopold JS, Dudley DT, Herrera R, Van Becelaere K, Wiland A, Gowan RC, et al. Blockade of the MAP kinase pathway suppresses growth of colon tumors in vivo. Nat Med. 1999;5(7):736-7. [97] Bennett AM, Tonka NK. Regulation of distinct stages of skeletal muscle differentiation by mitogen-activated protein kinase. Science. 1997;278(5341):1288-91. [98] Whalen AM, Galasinski SC, Shapiro PS, Nahreini TS, Ahn NG. Megakaryocytic differentiation induced by constitutive activation of mitogen-activated protein kinase kinase. Mol Cell Biol. 1997;17(4):1947-58. [99] Chin BY, Choi ME, Burdick MD, Strieter RM, Risby TH, Choi AM. Induction of apoptosis by particulate matter: role of TNF-alph and MAPK. Am J Physiol. 1998;275(5 Pt 1):L942-9.

290

Yair Lampl

[100] Gille H, Sharrocks A, Shaw P. Phosphorylation of transcription factor p62TCF by MAP kinase stimulates ternary complex formation at c-fos promoter. Nature. 1992;358:41417. [101] Marais R, Wynne J, Treisman R. The SRF accessory protein Elk-1 contains a growth factor-regulated transcriptional activation domain. Cell. 1993;73:381-93. [102] Jurewicz A, Matysiak M, Tybor K, Selmaj K. TNF-induced death of adult human oligodendrocytes is mediated by c-jun NH2-terminal kinase-3. Brain. 2003;126(Pt 6):1358-70. [103] Ramos-Nino ME, Haegens A, Shukla A, Mossman BT. Role of mitogen-activated protein kinases (MAPK) in cell injury and proliferation by environmental particulates. Mol Cell Biochem. 2002;234-235(1-2):111-8. [104] Kyriakis J, Banerjee P, Nikolakaki E, Dai T, Rubie E, Ahmad M, et al. The stressactivated protein kinase subfamily of c-Jun kinases. Nature. 1994;396:156-60. [105] Derijard B, Hibi M, Wu I, Barrett T, Su B, Deng T, et al. JNK1: A protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell. 1994;76:1025-37. [106] Pillinger MH, Capodici C, Rosenthal P, Kheterpal N, Hanft S, Philips MR, et al. Modes of action of aspirin-like drugs: salicylates inhibit erk activation and integrin-dependent neutrophils adhesion. Proc Natl Acad Sci USA. 1998;95(24):14540-5. [107] Kwon KS, Chae HJ. Sodium salicylate inhibits expression of COX-2 through suppression of ERK and subsequent NF-kappaB activation in rat ventricular cardiomyocytes. Arch Pharm Res. 2003;26(7):545-53. [108] Wang Z, Jiang B, Brecher P. Selective inhibition of STAT3 phosphorylation by sodium salicylate in cardiac fibroblasts. Biochem Pharmacol. 2002;63(7):1197-207. [109] Chae HJ, Chae SW, Reed JC, Kim HR. Salicylate regulates COX-2 expression through ERK and subsequent NF-kappaB activation in osteoblasts. Immunopharmacol Immunotoxicol. 2004;26(1):75-91. [110] Kwon KS, Chae HJ. Sodium salicylate inhibits expression of COX-2 through suppression of ERK and subsequent NF-kappaB activation in rat ventricular cardiomyocytes. Arch Pharm Res. 2003;26(7):545-53. [111] Prattali RR, Barreiro GC, Caliseo CT, Fugiwara FY, Ueno M, Prada PO, et al. Aspirin inhibits serine phosphorylation of insulin receptor substrate 1 in growth hormone treated animals. FEBS Lett. 2005;579(14):3152-8. [112] Schwenger P, Alpert D, Skolnik EY, Vilcek J. Cell-type-specific activation of c-Jun Nterminal kinase by salicylates. J Cell Physiol. 1999;179(1):109-14. [113] Alpert D, Schwenger P, Han J, Vilcek J. Cell stress and MKK6b-mediated p38 MAP kinase activation inhibit tumor necrosis factor-induced lkappaB phosphorylation and NF-kappaB activation. J Biol Chem. 1999;274(32):22176-83. [114] Wong CK, Zhang JP, Lam CW, Ho CY, Hjelm NM. Sodium salicylate-induced apoptosis of human peripheral blood eosinophils is independent of the activation of cJun N-terminal kinase and p38 mitogen-activated protein kinase. Int Arch Allergy Immunol. 2000;121(1):44-52. [115] Koistinaho M, Kettunen ML, Goldsteins G, Keinanen R, Salminen A, Ort M, et al. Beta-amyloid precursor protein transgenic mice that harbor diffuse A beta deposits but do not form plaques show increased vulnerability: role of inflammation. Proc Natl Acad Sci USA. 2002;99(3):1610-5.

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

291

[116] Duncan AJ, Heales SJ. Nitric oxide and neurological disorders. Mol Aspects Med. 2005;26(1-2):67-96. [117] Sheng H, Schmidt HH, Nakane M, Mitchell JA, Pollock JS, Fostermann U. Characterization and localization of nitric oxide synthase in non-adrenergic noncholinergic nerves from bovine retractor penis muscles. Br J Pharmacol. 1992;106:76873. [118] Su Z, Blazing MA, Fan D, George SE. The calmodulin-nitric oxide synthase interaction. Critical role of the calmodulin latch domain in enzyme activation. J Biol Chem. 1995;270(49):29117-22. [119] Arancio O, Kander ER, Hawkins RD. Activity-dependent long-term enhancement of transmitter release by presynaptic 3’, 5’-cylic GMP in cultured hippocampal neurons. Nat Lond. 1995;376:74-80. [120] Kantor DB, Lanzrein M, Stary SJ, Sandoval GM, Smith WB, Sullivan BM, et al. A role for endothelial NO synthase in LTP revealed by adenovirus-mediated inhibition and rescue. Science. 1996;274:1744-8. [121] Zorumski CF, Izumi Y. Modulation of LTP induction by NMDA receptor activation and nitric oxide release. Prog Brain Res. 1998;118:173-82. [122] Bredt DS. Endogenous nitric oxide synthesis: biological functions and pathophysiology. Free Radical Res. 1999;31:577-96. [123] Mine-Golomb D, Yadid G, Tsarfaty I, Resau JH, Schwartz JP. In vivo expression of inducible nitric oxide synthase in cerebellar neurons. J Neurochem. 1996;66:1504-9. [124] Moro MA, De Alba J, Leza JC, Lorenzo P, Fernandez AP, Bentura ML, et al. Neuronal expression of inducible nitric oxide synthase after oxygen and glucose deprivation in rat forebrain slices. Eur J Neurosci. 1998;10:445-56. [125] Murphy S, Simmons ML, Aguillo L, Garcia A, Feinstein DL, Galea E, et al. Synthesis of nitric oxide in CNS glial cells. Trends Neurosci. 1993;16:323-8. [126] Mac Micking J, Xie QW, Nathan C. Nitric oxide and macrophage function. Annu Rev Immunol 1997;15:323-50. [127] Qu XW, Wang H, De Plaen IG, Rozenfeld RA, Hsueh W. Neuronal nitric oxide synthase (NOS) regulates the expression of inducible NOS in rat small intestine via modulation of nuclear factor kappa B. FASEB J. 2001;15(2):439-46. [128] Venema RC, Sayegh HS, Kent JD, Harrison DG. Identification, characterization, and comparison of the calmodulin-binding domains of the endothelial and inducible nitric oxide synthases. J Biol Chem. 1996;271(11):6435-40. [129] Giraldez RR, Panda A, Xia Y, Sanders SP, Zweier JL. Decreased nitric-oxide synthase activity causes impaired endothelium-dependent relaxation in the post ischemic heart. J Biol Chem. 1997;272(34):21420-6. [130] Onoue H, Tsutsui M, Smith L, Stelter A, O’Brien T, Katusic ZS. Expression and function of recombinant endothelial nitric oxide synthase gene in canine basilar artery after experimental subarachnoid hemorrhage. 1998;29(9):1959-65; discussion 1965-6. [131] Kimura C, Oike M, Ohnaka K, Nose Y, Ito Y. Constitutive nitric oxide production in bovine aortic and brain microvascular endothelial cells: a comparative study. J Physiol. 2004;554(Pt 3):721-30. [132] Wang Q, Pelligrino DA, Baughman VL, Koenig HM, Albrecht RF. The role of neuronal nitric oxide synthase in regulation of cerebral blood flow in normocapnia and hypercapnia in rats. J Cereb Blood Flow Metab. 1995;15(5):774-8.

292

Yair Lampl

[133] Dorheim MA, Tracey WR, Pollock JS, Grammas P. Nitric oxide synthase activation is elevated in brain microvessels in Alzheimer’s disease. Biochem Biophys Res Commun. 1994;205:659-65. [134] Hara H, Huang PL, Panahian N, Fishman MC, Moskowitz MA. Reduced brain edema and infarction volume in mice lacking the neuronal isoform of nitric oxide synthase after transient MCA occlusion. J Cerebr Blood Flow Metab. 1996;16:605-11. [135] Smith KJ, Lassmann H. The role of nitric oxide in multiple sclerosis. Lancet Neurol. 2002;1:323-41. [136] Hunot S, Boissiere F, Faucheux B, Brugg B, Mouattprigent A, Agid Y, et al. Nitric oxide synthase and neuronal vulnerability in Parkinson’s disease. Neuroscience. 1996;72:355-63. [137] Samdani AF, Dawson TM, Dawson VL. Nitric oxide synthase in models of focal ischemia. Stroke. 1997;28:1283-8. [138] del Zoppo G, Ginis I, Hallenbeck JM, Iadecola C, Wang X, Feuerstein GZ. Inflammation and stroke: putative role for cytokines, adhesion molecules and iNOS in brain response to ischemia. Brain Pathol 2000;10:95-112. [139] Smith MA, Harris PLR, Sayre LM, Beckman JS, Perry G. Widespread peroxynitrite mediated damage in Alzheimer’s disease. J Neurosci. 1997;17:2653-7. [140] Amin AR, Vyas P, Attur M, Leszcynska-Piziak J, Patel JR, Weissmann G. The mode of action of aspirin-like drugs: effect on inducible nitric oxide synthase. Proc Natl Acad Sci USA. 1995;92(17):7926-30. [141] Gonzalez-Correa JA, Arrebola MM, Urena IM, Guerrero A, Munoz-Marin J, RuizVillairanca D, et al. Effects of triflusal on oxidative stress, prostaglandin production and nitric oxide pathway in a model of anoxia-reoxygenation in rat brain slices. Brain Res. 2004;1011(2):148-55. [142] Sanchez de Miguel L, de Frutos T, Gonzalez-Fernandez F, del Pozo V, Lahoz C, Jimenez A, et al. Aspirin inhibits inducible nitric oxide synthase expression and tumour necrosis factor-alpha release by cultured smooth muscle cells. Eur J Clin Invest. 1999;29(2):93-9. [143] Kepka-Lenhart D, Chen LC, Morris SM Jr. Novel actions of aspirin and sodium salicylate: discordant effects on nitric oxide synthesis and induction of nitric oxide synthase mRNA in a murine macrophage cell line. J Leukoc Biol. 1996;59(6):840-6. [144] Farivar RS, Chobanian AV, Brecher P. Salicylate or aspirin inhibits the induction of the inducible nitric oxide synthase in rat cardiac fibroblasts. Circ Res. 1996;78(5):759-68. [145] Kimura A, Roseto J, Suh KY, Cohen AM, Bing RJ. Effect of acetylsalicylic acid on nitric oxide production in infracted heart in situ. Biochem Biophys Res Commun. 1998;251(3):847-8. [146] Shimpo M, Ikeda U, Maeda Y, Ohya K, Murakami Y, Shimada K. Effects of aspirinlike drugs on nitric oxide synthesis in rat vascular smooth muscle cells. Hypertension. 2000;35(5):1085-91. [147] Katsuyama K, Shichiri M, Kato H, Imai T, Marumo F, Hirata Y. Differential inhibitory actions by glucocorticoid and aspirin on cytokine-induced nitric oxide production in vascular smooth muscle cells. Endocrinology. 1999;140(5):2183-90. [148] Marchini C, Angeletti M, Eleuteri AM, Fedeli A, Fioretti E. Aspirin modulates LPSinduced nitric oxide release in rat glial cells. Neurosci Lett. 2005;381(1-2):86-91.

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

293

[149] Ogawa O, Umegakki H, Sumi D, Hayashi T, Nakamura A, Thakur NK, et al. Inhibition of inducible nitric oxide synthase gene expression by indomethacin or ibuprofen in beta-amyloid protein-stimulated J774 cells. Eur J Pharmacol. 2000;408(2):137-41. [150] Asanuma M, Nishibayashi-Asanuma S, Miyazaki I, Kohno M, Ogawa N. Neuroprotective effects of non-steroidal anti-inflammatory drugs by direct scavenging of nitric oxide radicals. J Neurochem. 2001;76(6):1895-904. [151] Hirohata M, Ono K, Naiki H, Yamada M. Non-steroidal anti-inflammatory drugs have anti-amyloidogenic effects for Alzheimer’s beta-amyloid fibrils in vitro. Neuropharmacology. 2005;49(7):1088-99. [152] De La Cruz JP, Guerrero A, Gonzalez-Correa JA, Arrebola MM, de la Cuesta SF. Antioxidant effect of acetylsalicylic and salicylic acid in rat brain slices subjected to hypoxia. J Neurosci Res. 2004;75(2):280-90. [153] Riepe MW, Kasischke K, Raupach A. Acetylsalicylic acid increases tolerance against hypoxic and chemical hypoxia. Stroke. 1997;28(10):2006-11. [154] De Cristobal J, Cardenas A, Lizasoain I, Leza JC, Fernandez-Tome P, Lorenzo P. Inhibition of glutamate release via recovery of ATP levels accounts for a neuroprotective effect of aspirin in rat cortical neurons exposed to oxygen-glucose deprivation. Stroke. 2002;33(1):261-7. [155] Qiu LY, Yu J, Zhou Y, Chen CH. Protective effects and mechanism of action of aspirin on focal cerebral ischemia-reperfusion in rats. Yao Xue Xue Bao. 2003;38(8):561-4. [Chinese]. [156] Aas AT, Tonnessen TI, Brun A, Salford LG. Growth inhibition of rat glioma cells in vitro and in vivo by aspirin. J Neurooncol. 1995;24(2):171-80. [157] Nover L, Munsche D, Neumann D, Ohme K, Scharf KD. Control of ribosome biosynthesis in plant cell cultures under heat-shock conditions. Ribosomal RNA. Eur J Biochem. 1986;160(2):297-304. [158] Gehrmann M, Brunner M, Pfister K, Reichle A, Kremmer E, Multhoff G. Differential up-regulation of cytosolic and membrane-bound heat shock protein 70 in tumor cells by anti-inflammatory drugs. Clin Cancer Res. 2004;10(10):3354-64. [159] Beckmann RP, Mizzen LE, Welch WJ. Interaction of Hsp 70 with newly synthesized proteins: implications for protein folding and assembly. Science. 1990;248(4657):8504. [160] DeGracia DJ, O’Neil BJ, Frisch C, Krause GS, Skjaerlund JM, White BC, et al. Studies of the protein synthesis system in the brain cortex during global ischemia and reperfusion. Resuscitation. 1993;25(2):161-70. [161] Aoki M, Abe K, Kawagoe J, Sato S, Nakamura S, Kogure K. Temporal profile of the induction of heat shock protein 70 and heat shock cognate protein 70 mRNAs after transient ischemia in gerbil brain. Brain Res. 1993;601(1-2):185-92. [162] Kokubo Y, Matson GB, Liu J, Mancuso A, Kayama T, Sharp FR, et al. Correlation between changes in apparent diffusion coefficient and induction of heat shock protein, cell-specific injury marker expression, and protein synthesis reduction on diffusionweighted magnetic resonance images after temporary focal cerebral ischemia in rats. J Neurosurg. 2002;96(6):1084-93. [163] Yasuda H, Shichinohe H, Kuroda S, Ishikawa T, Iwasaki Y. Neuroprotective effect of heat shock protein inducer, geranylgeranylacetone in permanent focal cerebral ischemia. Brain Res. 2005;1032(1-2):176-82.

294

Yair Lampl

[164] Fawcett JW, Xu Q, Holbrook NJ. Potentiation of heat stress-induced hsp70 expression in vivo by aspirin. Cell Stress Chaperones. 1997;2(2):104-9. [165] Fredduzzi S, Mariucci G, Tantucci M, Del Soldato P, Ambrosini MV. Nitro-aspirin (NCX4016) reduces brain damage induced by focal cerebral ischemia in the rat. Neurosci Lett. 2001;302(2-3):121-4. [166] McCawley LJ, Li S, Wattenberg EV, Hudson LG. Sustained activation of the mitogenactivated protein kinase pathway. A mechanism underlying tyrosine kinase specificity for matrix metalloproteinase-9 induction and cell migration. J Biol Chem. 1999;274(7):4347-53. [167] Brogley MA, Cruz M, Cheung HS. Basic calcium phosphate crystal induction of collagenase 1 and stromelysin expression is dependent on a p42/44 mitogen-activated protein kinase signal transduction pathway. J Cell Physiol. 1999;180(2):215-24. [168] Kurata H, Thant AA, Matsuo S, Senga T, Okazaki K, Hotta N. Consitiutive activation of MAP kinase kinase (MEK1) is critical and sufficient for the activation of MMP-2. Exp Cell Res. 2000;254(1):180-8. [169] Gearing AJ, Beckett P, Christodoulou M, Churchill M, Clements JM, Crimmin M, et al. Matrix metalloproteinases and processing of pro-TNF-alpha. J Leukoc Biol. 1995;57(5):774-7. [170] Werb Z, Chin JR. Extracellular matrix remodeling during morphogenesis. Ann NY Acad Sci. 1998;857;110-8. [171] Curran S, Murray GI. Matrix metalloproteinases: molecular aspects of their roles in tumour invasion and metastasis. 2000;36(13 Spec No):1621-30. [172] John A, Tuszynski G. The role of matrix metalloproteinases in tumor angiogenesis and tumor metastasis. Pathol Oncol Res. 2001;7(1):14-23. [173] Horstmann S, Kalf P, Koziol J, Gardner H, Wagner S. Profiles of matrix metalloproteinases, their inhibitors, and laminin in stroke patients: influence of different therapies. Stroke. 2000;34(9):2165-70. [174] Harris AK, Ergul A, Kozak A, Machado LS, Johnson MH, Fagan SC. Effect of neutrophil depletion on gelatinase expression, edema formation and hemorrhagic transformation after focal ischemic stroke. BMC Neurosci. 2005;6:49. [175] Serena J, Blanco M, Castellanos M, Silva Y, Vivancos J, Moro MA. The prediction of malignant cerebral infarction by molecular brain barrier disruption markers. Stroke. 2005;36(9):1921-6. [176] Gasche Y, Fujimura M, Morita-Fujimura Y, Copin JC, Kawase M, Massengale J, et al. Early appearance of activated matrix metalloproteinase-9 after focal cerebral ischemia in mice: a possible role in blood-brain barrier dysfunction. J Cereb Blood Flow Metab. 1999;19(9):1020-8. [177] Cunningham LA, Wetzel M, Rosenberg GA. Multiple roles for MMPs and TIMPs in cerebral ischemia. Glia. 2005;50(4):329-39. [178] Lakka SS, Gondi CS, Rao JS. Proteases and glioma angiogenesis. Brain Pathol. 2005;15(4):327-41. [179] Mehta JL, Chen J, Yu F, Li DY. Aspirin inhibits ox-LDL-mediated LOX-1 expression and metalloproteinase-1 in human coronary endothelial cells. Cardiovasc Res. 2004;64(2):243-9. [180] Pillinger MH, Rosenthal PB, Tolani SN, Aspel B, Dinsell V, Greenberg J. Cyclooxygenase-2-derived E prostaglandins down-regulate matrix metalloproteinase -1

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

295

expression in fibroblast-like synoviocytes via inhibition of extracellular signalregulated kinase activation. J Immunol. 2003;171(11):6080-9. [181] Ito H, Duxbury M, Benoit E, Farivar RS, Gardner-Thrope J, Zinner MJ. Fibronectininduced COX-2 mediates MMP-2 expression and invasiveness of rhabdomyosarcoma. Biochem Biophys Res Commun. 2004;318(2):594-600. [182] Karna E, Palka JA. Inhibitory effect of acetylsalicylic acid on metalloproteinase activity in human lung adenocarcinoma at different stages of differentiation. Eur J Pharmacol. 2002;443(1-3):1-6. [183] Morgan MP, Cooke MM, Christopherson PA, Westfall PR, McCarthy GM. Calcium hydroxyapatite promotes mitogenesis and matrix metalloproteinase expression in human breast cancer cell lines. Mol Carcinog. 2001;32(3):111-7. [184] Jiang MC, Liao CF, Lee PH. Aspirin inhibits matrix metalloproteinase-2 activity, increases E-cadherin production, and inhibits in vitro invasion of tumor cells. Biochem Biophys Res Commun. 2001;282(3):671-7. [185] Murono S, Yoshizaki T, Sato H, Takeshita H, Furukawa M, Pagano JS. Aspirin inhibits tumor cell invasiveness induced by Epstein-Barr virus latent membrane protein 1 through suppression of matrix metalloproteinase-9 expression. Cancer Res. 2000;60(9):2555-61. [186] Khayyam N, Thavendiranathan P, Carmichael FJ, Kus B, Jay V, Burnham WM. Neuroprotective effects of acetylsalicylic acid in an animal model of focal brain ischemia. Neuroreport. 1999;10(2):371-4 [187] De Cristobal J, Moro MA, Davalos A, Castillo J, Leza JC, Camarero J, et al. Neuroprotective effect of aspirin by inhibition of glutamate release after permanent focal cerebral ischaemia in rats. J Neurochem 2001;79(2):456-9. [188] Berger C, Xia F, Schabitz WR, Schwab S, Grau A. High-dose aspirin is neuroprotective in a rat focal ischemia model. 2004;998(2):237-42. [189] Aisen PS, Schafer KA, Garundman M, Pfeiffer E, Sano M, Davis KL, et al.: Alzheimer’s Disease Cooperative Study. Effects of rofecoxib or naproxen vs placebo on Alzheimer disease progression: a randomized controlled trial. JAMA 2003;289(21):2819-26. [190] Nilsson SE, Johansson B, Lakkmen S, Berg S, Zarit S, McClearn G, et al. Does aspirin protect against Alzheimer’s dementia? A study in a Swedish population-based sample aged > 80 or =80years. Eur J Clin Pharmacol. 2003;59(4):313-9. [191] Anthony JC, Breitner JC, Zandi PP, Meyer MR, Jurasova I, Norton MC, et al. Reduced prevalence of AD in users of NSAIDs and H2 receptor antagonists: the Cache County study. Neurology. 2000;54(11):2066-71. [192] Stewart WF, Kawas C, Corrada M, Metter EJ. Risk of Alzheimer’s disease and duration of NSAID use. Neurology. 1997;48(3):626-32. [193] Beard CM, Waring SC, O’Brien PC, Kurland LT, Kokmen E. Nonsteroidal antiinflammatory drug use and Alzheimer’s disease: a case-control study in Rochester, Minnesota, 1980 through 1984. Mayo Clin Proc. 1998;73(10):951-5. [194] Breitner JC, Gau BA, Welsh KA, Plassman BL, McDonald WM, Helms MJ, et al. Inverse association of anti-inflammatory treatments and Alzheimer’s disease: initial results of a co-twin control study. Neurology. 1994;44(2):227-32.

296

Yair Lampl

[195] Landi F, Cesari M, Onder G, Russo A, Torre S, Bernabei R. Non-steroidal antiinflammatory drug (NSAID) use and Alzheimer disease in community-dwelling elderly patients. Am J Geriatr Psychiatry. 2003;11(2):179-85. [196] Cornelius C, Fastbom J, Windblad B, Viitanen M. Aspirin, NSAIDs, risk of dementia, and influence of the apolipoprotein E epsion 4 allele in an elderly population. Neuroepidemiology. 2004;23(3):135-43. [197] Thomas T, Nadackal TG, Thomas K. Asprin and non-Steroidal anti-inflammatory drugs inhibit amyloid-beta aggregation. Neuroreport. 2001;12(15):3263-7. [198] Harris JR. In vitro fibrillogenesis of the amyloid beta 1-42 peptide: cholesterol potentiation and aspirin inhibition. Micron. 2002;33(7-8):609-26. [199] Petegnief V, Saura J, de Gregorio-Roscasolano N, Paul SM. Neuronal injury-induced expression and release of apolipoprotein E in mixed neuro/glia co-cultures: nuclear factor kappaB inhibitors reduce basal and lesion-induced secretion of apolipoprotein E. Neuroscience. 2001;104(1):223-34. [200] Chen H, Zhang SM, Hernan MA, Schwarzschild MA, Willett WC, Golditz GA, et al. Nonsteroidal anti-inflammatory drugs and the risk of Parkinson disease. Arch Neurol. 2003;60(8):1059-64. [201] Carrasco E, Werner P. Selective destruction of dopaminergic neurons by low concentrations of 6-OHDA and MPP+: protection by acetylsalicylic acid aspirin. Parkinsonism Relat Discord. 2002;8(6):407-11. [202] Teismann P, Ferger B. Inhibition of the cyclooxygenase isoenzymes COX-1 and COX2 provide neuroprotection in the MPTP-mouse model of Parkinson’s disease. Synapse. 2001;39(2):167-74. [203] Barneoud P, Curet O. Beneficial effects of lysine acetylsalicylate, a soluble salt of aspirin, on motor function performance in a transgenic model of amyotrophic lateral sclerosis. Exp Neurol. 1999;155(2):243-51. [204] Kerr JFR. Shrinkage necrosis: a distinct mode of cellular death. J Pathol. 1971;105:1320. [205] Wyllie A, Kerr J, Currie A. Cell death: the significance of apoptosis. Int Rev Cytol. 1980;68:251-307. [206] Kerr J, Wyllie A, Currie A. Apoptosis: a basic biological phenomenon with wide ranging implications in tissue kinetics. Br J Cancer. 1972;26:239-57. [207] Kerr J, Winterford C, Harmon B. Apoptosis: its significance in cancer and cancer therapy. Cancer. 1994;73:2013-26. [208] Donehower LA, Harvey M, Slagle BL, McAuthur MJ, Montgomery CA, Butel JS, et al. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumors. Nature 1992;356:215-21. [209] Pollard H, Cantagrel S, Charriaut-Marlangue C, Moreau J, Ben-Ari Y. Apoptosis associated DNA fragmentation in epileptic brain damage. Neuroreport. 1994;5:1053-5. [210] Pollard H, Charriaut-Marlangue C, Cantagrel S, Represa A, Robain O, Moreau J, et al. Kainate-induced apoptotic cell death in hippocampal neurons. Neuroscience. 1994;63:7-18. [211] Li Y, Sharov VG, Jiang N, Zalong C, Sabbah HN, Chopp M. Ultrastructural and light microscopic evidence of apoptosis after middle cerebral artery occlusion in the rat. Am J Pathol. 1995:146:1045-51.

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

297

[212] Charriaut-Marlangue C, Margaill I, Plotkine M, Ben-Ari Y. Early endonuclease activation following reversible focal ischemia in the rat brain. J Cereb Blood Flow Metab. 1995;15:385-8. [213] Rink Z, Fung KM, Trojanowski JQ, Lee VM, Neugebauer E, McIntosh TK. Evidence of apoptotic cell death after experimental traumatic brain injury in the rat. Am J Pathol. 1995;147:1575-83. [214] Clark RS, Kochanek P, Chen J, Chen M, Zhu R, Simon R, et al. Expression of cell death regulatory proteins Cpp32, Bax, and Bcl-xl, after traumatic brain injury in rats. J Cereb Blood Flow Metab. 1997;17(Suppl 1):S22. Abstract. [215] Yuan J, Horvitz R. The Caenorhabditis elegans cell death gene ced-4 encodes a novel protein and is expressed during the period of extensive programmed cell death. Development. 1992;116:309-20. [216] Bina-Stein M, Tritton T. Aurintricarboxylic acid is a nonspecific enzyme inhibitor. Mol Pharmacol. 1976;12:191-3. [217] Wang S, Yang D, Lippman ME. Targeting Bcl-2 and Bcl-XL with nonpeptidic smallmolecule antagonists. Semin Oncol. 2003;30(Suppl 16):133-42. [218] Liou AKF, Clark RS, Henshall DC, Yin XM, Chen J. To die or not to die for neurons in ischemia, traumatic brain injury and epilepsy: a review on the stress-activated signaling pathways and apoptotic pathways. Progress in Neurology. 2003;69:103-42. [219] Li Y, Chopp M, Jiang N, Yao F, Zaloga C. Temporal profile of in situ DNA fragmentation after transient middle cerebral artery occlusion in the rat. J Cereb Blood Flow Metab. 1995;15:389-97. [220] Loo D, Copani A, Pike C, Whittemore E, Walencewicz A, Cotman C. Apoptosis is induced by β-amyloid in cultured central nervous system neurons. Proc Natl Acad Sci USA. 1993;90:7951-5. [221] Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, Hentati A, et al. Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 1993;362:59-62. [222] Hartley A, Stone J, Heron C, Cooper J, Schapira A. Complex I inhibitors induce dosedependent apoptosis in PC12 cells: Relevance to Parkinson’s disease. J Neurochem. 1994;63:1987-90. [223] Bonde C, Noraberg J, Noer H, Zimmer J. Ionotropic glutamate receptors and glutamate transporters are involved in necrotic neuronal cell death induced by oxygen-glucose deprivation of hippocampal slice cultures. Neuroscience. 2005;136(3):749-94. [224] Choi DW. Ionic dependence of glutamate neurotoxicity in cortical cell culture. J Neurosci. 1987;7:369-79. [225] Kure S, Tominaga T, Yoshimoto T, Tada K, Narisawa K. Glutamate triggers internucleosomal DNA cleavage in neuronal cells. Biochem Biophys Res Commun. 1991;179:39-45. [226] Ankarerona M, Dypbukt JM, Bonfoco E, Zhivotovsky B, Orrenius S, Lipton SA, et al. Glutamate-induced neuronal death: a succession of necrosis or apoptosis depending on mitochondrial function. Neuron. 1995;15:961-73. [227] Adcock I, Brown C, Kwon O, Barnes P. Oxidative stress induces NFKB DNA binding and inducible NOS mRNA in human epithelial cells. Biochem Biophys Res Commun. 1994;199:1518-24.

298

Yair Lampl

[228] La Vecchia C, Negri E, Franceschi S, Conti E, Motella M, Giacossa A. Aspirin an colorectal cancer. Br J Cancer. 1997;76:675-7. [229] Collet JP, Sharpe C, Belzile E, Boirin JF, Hanley J, Abenhaim L. Colorectal cancer prevention by non-steroidal anti-inflammatory drugs: effects of dosage and timing. Br J Cancer. 1999;81:62-8. [230] Chan TA, Morin PJ, Vogelstein B, Kinzler KW. Mechanisms underlying non-steroidal anti-inflammatory drug-mediated apoptosis. Proc Natl Acad Sci USA. 1998;95(2):6816. [231] Thun MJ, Nanboodiri MM, Calle EE, Flanders WD, Heath CW Jr. Aspirin use and risk of fatal cancer. Cancer Res. 1993;53(6):1322-7. [232] Gardiner PS, Gilmer JF. The medicinal chemistry implications of the anticancer effects of aspirin and other NSAIDs. Mini Rev Med Chem. 2003;3(5):461-70. [233] Escribano M, Molero L, Lopez-Farre A, Abarrategui C, Carrasco C, Garcia-Mendez A, et al. Aspirin inhibits endothelial nitric oxide synthase (eNOS) and Flk-1 (vascular endothelial growth factor receptor-2) prior to rat colon tumour development. Clin Sci (Long). 2004;106(1):83-91. [234] Barnes CJ, Cameron IL, Hardman WE, Lee M. Non-steroidal anti-inflammatory drug effect on crypt cell proliferation and apoptosis during initiation of rat colon carcinogenesis. Br J Cancer. 1998;77(4):573-80. [235] Redlak MJ, Power JJ, Miller TA. Role of mitochondria in aspirin-induced apoptosis in human gastric epithelial cells. Am J Physiol Gastrointest Liver Physiol. 2005;289(4):G731-8. [236] Oh KW, Qian T, Brenner DA, Lemasters JJ. Salicylate enhances necrosis and apoptosis mediated by the mitochondrial permeability transition. Toxicol Sci. 2003;73(1):44-52. [237] Stark LA, Din FV, Zwacka RM, Dunlop MG. Aspirin-induced activation of the NFkappaB signaling pathway: a novel mechanism for aspirin-mediated apoptosis in colon cancer cells. FASED J. 2001;15(7):1273-5. [238] Shao J, Fujiwara T, Kadowaki Y, Fukazawa T, Waku T, Itoshima T, et al. Overexpression of the wild-type p53 gene inhibits NF KappaB activity and synergizes with aspirin to induce apoptosis in human colon cancer cells. Oncogene. 2000;19(6):726-36. [239] Jen JH, Wang YJ, Chiang BL, Lee PH, Chan CP, Ho YS, et al. Roles of keratinocyte inflammation in oral cancer: regulating the prostaglandin E2, interleukin-6 and TNFalpha production of oral epithelial cells by areca nut extract and arecoline. Carcinogenesis. 2003;24(8):1301-15. [240] Sotiriou C, Lacroix M, Lagneaux L, Berchem G, Body JJ. The aspirin metabolite salicylate inhibits breast cancer cells growth and their synthesis of the osteolytic cytokines interleukins-6 and -11. Anticancer Res. 1999;19(4B):2997-3006. [241] Kim KM, Song JJ, An JY, Kwon YT, Lee YJ. Pretreatment of acetylsalicylic acid promotes tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis by down-regulating BCL-2 gene expression. J Biol Chem. 2005;280(49):41047-56. [242] ChenYC, Shen SC, Tsai SH. Prostaglandin D(2) and J(2) induce apoptosis in human leukemia cells via activation of the caspase 3 cascade and production of reactive oxygen species. Biochim biophys acta. 2005;1743(3):291-304.

The Brain’s Neuroprotective and Proapoptotic Effects of Aspirin - a Review

299

[243] Brummelkamp TR, Njman SM, Dirac AM, Bernards R. Loss of the cylindromatosis tumour suppressor inhibits apoptosis by activating NF-kappaB. Nature. 2003;424(6950):797-801. [244] Zhou XM, Wong BC, Fan XM, Zhang HB, Lin MC, Kung HF, et al. Non-steroidal antiinflammatory drugs induce apoptosis in gastric cancer cells through up-regulation of bax and bak. Carcinogenesis. 2001;22(9):1393-7. [245] Zhu GH, Wong BC, Eggo MC, Ching CK, Yuen ST, Chan EY, et al. Non-steroidal anti-inflammatory drug-induced apoptosis in gastric cancer cells is blocked by protein kinase C activation through inhibition of c-myc. Br J Cancer. 1999;79(3-4):393-400. [246] Power JJ, Dennis MS, Redlak MJ, Miller TA. Aspirin-induced mucosal cell death in human gastric cells: evidence supporting an apoptotic mechanism. Dig Dis Sci. 2004;49(9):1518-25. [247] Gu Q, Wang JD, Xia HH, Lin MC, He H, Zou B, et al. Activation of the caspase-8/Bid and Bax pathways in aspirin-induced apoptosis in gastric cancer. Carcinogenesis. 2005;26(3):541-6. [248] Tomisato W, Tsutsumi S, Rukutan K, Tsuchiya T, Mizushima T. NSAIDs induce both necrosis and apoptosis in guinea pig gastric mucosal cells in primary culture. Am J Physiol Gastrointest Liver Physiol. 2001;281(4):G1092-100. [249] Baron JA, Cole BF, Sandler RS, Haile RW, Ahnen D, Bresalier R, et al. A randomized trial of aspirin to prevent colorectal adenomas. N Engl J Med. 2003;348(10):891-9. [250] Little J, Logan RF, Hawtin PG, Hardcastle JD, Turner ID. Colorectal adenomas and diet: a case-control study of subjects participating in the Nottingham faecal occult blood screening programme. Br J Cancer. 1993;67(1):177-84. [251] Barnes CJ, Cameron IL, Hardman WE, Lee M. Non-steroidal anti-inflammatory drug effect on crypt cell proliferation and apoptosis during initiation of rat colon carcinogenesis. Br J Cancer. 1998;77(4):573-80. [252] Mahmoud NN, Dannenberg AJ, Mestre J, Bilinski RT, Churchill MR, Martucci C, et al. Aspirin prevents tumors in a murine model of familial adenomatous polyposis. Surgery. 1998;124(2):225-31. [253] Din FV, Dunlop MG, Stark LA. Evidence for colorectal cancer cell specificity of aspirin effects on NF kappa B signaling and apoptosis. Br J Cancer. 2004;91(2):381-8. [254] Din FV, Stark LA, Dunlop MG. Aspirin-induced nuclear translocation of NFkappaB and apoptosis in colorectal cancer is independent of p53 status and DNA mismatch repair proficiency. Br J Cancer. 2005;92(6):1137-43. [255] Ricchi P, Palma AD, Matola TD, Apicella A, Fortunato R, Zarrilli R, et al. Aspirin protects Caco-2 cells from apoptosis after serum deprivation through the activation of phosphatidylinositol 3-kinase/AKT/p21Cip/WAF1 pathway. Mol Pharmacol. 2003;64(2):407-14. [256] Kutuk O, Basaga H. Aspirin inhibits TNFalpha- and IL-1-induced NF-kappaB activation and sensitizes HeLa cells to apoptosis. Cytokine. 2004;25(5):229-37. [257] Kim KY, Soel JY, Jeon GA, Nam MJ. The combined treatment of aspirin and radiation induces apoptosis by the regulation of bcl-2 and caspase-3 in human cervical cancer cells. Cancer Lett. 2003;189(2):157-66. [258] Iglesias-Serret D, Pique M, Gil J, Pons G, Lopez JM. Transcriptional and translational control of Mcl-1 during apoptosis. Arch Biochem Biophys. 2003;417(2):141-52.

300

Yair Lampl

[259] Hatano E, Bradham CA, Stark A, Iimuro Y, Lemasters JJ, Brenner DA. The mitochondrial permeability transition augments Fas-induced apoptosis in mouse hepatocytes. J Biol Chem. 2000;275(16):11814-23. [260] Bradham CA, Qian T, Streetz K, Trautwein C, Brenner DA, Lemasters JJ. The mitochondrial permeability transition is required for tumor necrosis factor alphamediated apoptosis and cytochrome c release. Mol Cell Biol. 1998;18(11):6353-64. [261] Han EK, Arber N, Yamamoto H, Lim JT, Delohery T, Pamukcu R, et al. Effects of sulindac and its metabolites on growth and apoptosis in human mammary epithelial and breast carcinoma cell lines. Breast Cancer Res Treat. 1998;48(3):195-203. [262] Kundu N, Smyth MJ, Samsel L, Fulton AM. Cyclooxygenase inhibitors block cell growth, increase ceramide and inhibit cell cycle. Breast Cancer Res Treat. 2002;76(1):57-64. [263] Liu W, Chen Y, Wang W, Keng P, Finkelstein J, Hu D, Liang L, et al. Combination of radiation and celebrex (celecoxib) reduce mammary and lung tumor growth. Am J Clin Oncol. 2003;26(4):S103-9. [264] Ott I, Schmidt K, Kircher B, Schumacher P, Wiglenda T, Gust R. Antitumoractive cobalt-alkyne complexes derived from acetylsalicylic acid: studies on the mode of drug action. J Med Chem. 2005;48(2):622-9. [265] Teh SH, Hill AK, Foley DA, McDermott EW, O’Higgins NJ. COX inhibitors modulate bFGF-induced cell survival in MCF-7 breast cancer cells. J Cell Biochem. 2004;91(4):796-807. [266] Uberti D, Grilli M, Memo M. Contribution of NF-kappaB and p53 in the glutamateinduced apoptosis. Int J Dev Neurosci. 2000;18(4-5):447-54. [267] Hwang SL, Lee KS, Lin CL, Lieu AS, Cheng CY, Loh JK, et al. Effect of aspirin and indomethacin on prostaglandin E2 synthesis in C6 glioma cells. Kaohsiung J Med Sci. 2004;20(1):1-5. [268] Amin R, Kamitani H, Sultana H, Taniura S, Islam A, Sho A, et al. Aspirin and indomethacin exhibit antiproliferative effects and induce apoptosis in T98G human gliobastoma cells. Neurol Res. 2003;25(4):370-6. [269] Arrieta O, Guevara P, Reyes S, Palencia G, Rivera E, Sotelo J. Paradoxical effect of aspirin on the growth of C6 rat glioma and on time of development of ENU-induced tumors of the nervous system. J Cancer Res Clin Oncol. 2001;127(11):681-6. [270] Lee JH, Park SY, Lee WS, Hong KW. Lack of antiapoptotic effects of antiplatelet drug, aspirin and clopidogrel, and antioxidant, MCI-186, against focal ischemic brain damage in rats. Neurol Res. 2005;27(5):483-92. [271] Swairjo MA, Roberts MF, Campos MB, Dedman JR, Seaton BA. Annexin V binding to the outer leaflet of small unilamellar vesicles leads to altered inner-leaflet properties: 31P- and 1H-NMR studies. Biochemistry. 1994;33(36):10944-50. [272] Shiratsuchi A, Umeda M, Ohba Y, Nakanishi Y. Recognition of phosphatidylserine on the surface of apoptotic spermatogenic cells and subsequent phagocytosis by Sertoli cells of the rat. J Biol Chem. 1997;272(4):2354-8. [273] Emanueli C, Van Linthout S, Salis MB, Monopoli A, Del Soldato P, Ongini E, et al. Nitric oxide-releasing aspirin derivative, NCX 4016, promotes reparative angiogenesis and prevents apoptosis and oxidative stress in a mouse model of peripheral ischemia. Arterioscler Thromb Vasc Biol. 2004;24(11):2082-7.

In: Brain Mapping and Diseases Ed: Diane E. Spinelle

ISBN: 978-1-61122-065-0 © 2011 Nova Science Publishers, Inc.

Chapter 13

REGIONAL DIFFERENCES IN NEONATAL SLEEP ELECTROENCEPHALOGRAM Karel Paul1,*, Vladimír Krajča2, Zdeněk Roth3, Jan Melichar1 and Svojmil Petránek2 1

2

Institute for the Care of Mother and Child, Prague, Czech Republic Faculty Hospital Bulovka, Department of Neurology, Prague, Czech Republic 3 National Institute of Public Health, Prague, Czech Republic

ABSTRACT Background and purpose: While EEG features of the maturation level and behavioral states are visually well distinguishable in fullterm newborns, the topographic differentiation of the EEG activity is mostly unclear in this age. The aim of the study was to find out wether the applied method of automatic analysis is capable of descerning topographic particulaities of the neonatal EEG. A quantitative description of the EEG signal can contribute to objective assessment of the functional condition of a neonatal brain and to rafinement of diagnostics of cerebral dysfunctions manifesting itself as “dysrhytmia”, “dysmaturity” or “disorganization”. Subjects and methods: We examined polygraphically 21 healthy, full-term newborns during sleep. From each EEG record, two five-minute samples were subject to off-line analysis and were described by 13 variables: spectral measures and features describing shape and variability of the signal. The data from individual infants were averaged and the number of variables was reduced by factor analysis. Results: All factors identified by factor analysis were statistically significantly influenced by the location of derivation. A large number of statistically significant differences was also found when comparing the data describing the activities from different regions of the same hemisphere. The data from the posterior-medial regions differed significantly from the other studied regions: They exhibited higher values of spectral features and notably higher variability. When comparing data from homotopic regions of the opposite hemispheres, we only established significant differences between *

Karel Paul; Institute for the Care of Mother and Child; 14 710 Prague 4; Czech Republic; Tel. : +420 296511498 Fax. : +420 241432572 e-mail: [email protected]

302

Karel Paul, Vladimír Krajča, Zdeněk Roth et al.

the activities of the anterior-medial regions: The values of spectral features were higher on the right than on the left side. The activities from other homotopic regions did not differ significantly. Conclusion: The applied method of automatic analysis is capable of discerning differences in the sleep EEG activities from the individual regions of the neonatal brain. Significance: The capability of the used method to discriminate regional differences of the neonatal EEG represents a promise for their application in clinical practice. Keywords: Full-term newborn; EEG; Regional differences; Automatic analysis.

INTRODUCTION When analyzed visually, the EEG activity of sleeping full-term newborns at the first glance appears topographically non-differentiated for the most part. The EEG atlases dealing with the earliest age either do not mention the regional differences in the EEG signal in fullterm sleeping newborns at all [1,2], or the EEG activity of these infants is being described as ‘uniformly distributed’ [3]. The reason for this is probably the fact that the human eye will not discern differences in the activities from the individual cranial regions. However, the application of computing technology has proven that the electroencephalogram of a full-term newborn is in fact topographically differentiated. The regional differences in the values of spectral energies were described [4-8]. Intrahemispheric and interhemispheric coherence of the EEG activity had been studied [8-14]. Automatic brain mapping was applied to the neonatal EEG [15,16]. Topographic interdependencies of the neonatal EEG have been examined by the means of non-linear methods [17-20]. In the present study, we have applied a multi-channel automatic method based on adaptive segmentation [21] in order to describe the EEG activity from the specific regions of the neonatal brain. This method evaluates not only spectral measures but also additional features as amplitude level, shape and variance of the signal, in which it comes close to visual analysis. The objective of the study is to verify whether the applied method is capable of discerning the differences in the EEG activities of the specific brain regions. It is possible to suppose that if the used method is able to discerne physiological regional EEG differences it will be possible to use the method in a detection and objective description of topographic deviations in patients with a cerebral pathology.

SUBJECTS We included 21 healthy full-term newborns in the study. They were born in the 39th to the 40 week of gestation, the Apgar score was >7 in the first minute and >8 in the fifth minute, and their birthweights ranged from 3010 to 3950g. The infants were examined in the 4th and 10th day of their life. Parents of the infants were informed of the methods and purposes of the examination and gave their consent. The project was approved by the institute’s ethical commission. th

Regional Differences in Neonatal Sleep Electroencephalogram

303

METHODS The examinations were carried out in an EEG laboratory in standardized conditions after morning feeding and lasted 90-120 minutes. The examination room was noise-protected and background noise level did not exceed 45dB. The illumination level was reduced to a degree that would enable the observer to just perceive changes in infant’s behavior. Room temperature was in the 23-25°C range. Disturbing environmental stimuli were excluded. Infants were examined in a crib, placed in supine position. The EEG activity was recorded polygraphically from eight bipolar derivations, positioned under the system 10-20 (Fp1-C3, C3-O1, Fp1-T3, T3-O1, Fp2-C4, C4-O2, Fp2-T4, T4-O2); the reference derivation, linked ear electrodes; filter setting, 0,2 and 60Hz; sensitivity, 100μV per 10mm. The respiration (PNG), ECG, EOG, and EMG of chin muscles were also recorded. Electrode impedances were not higher than 5kOhm. The recording was performed using the Brain-Quick (Micromed) digital system with sampling frequency of 128Hz and the data were stored on CDs. An observer continuously recorded any change in infant’s behavior on the polygram. Two five-minute-samples free of artifacts (segments contaminated by artifacts were eliminated by visual inspection) were selected from the EEG record of each infant. One sample was chosen from the middle part of quiet sleep, the other from the middle of the subsequent active sleep. In this study, we have defined mentioned sleep states according to the following criteria: Quiet sleep was defined as sleep with closed eyes, absence of eye movements, regular breathing, absence of body movements except for startles, and the typical EEG pattern ‘tracé alternant’. Active sleep was defined as a behavioral state in which the infant’s eyes were closed or nearly closed, eye movements were apparent, breathing was irregular, and mimic muscle movements, small movements of extremities and even large generalized movements occurred intermittently. The EEG showed the ‘activité moyenne‘ pattern [3]. Quantitative processing of EEG was performed off-line. Subject to analysis were data from the above-mentioned bipolar montage. A method based on multi-channel adaptive segmentation [21] was used. The method was selected for the following reasons: (a) The algorithm of the adaptive segmentation divides the EEG signal into quasi-stationary segments of variable length. The idea was that the feature extraction from such relatively homogeneous epochs would be substantially more effective than the feature extraction from fixed epochs. This holds especially true when analyzing the highly variable pattern as tracé alternant. (b) The division of the signal into quasi-stationary segments made it possible to evaluate length, number and proportional occurrence of these segments and thus to quantify the stability and variability of the signal. The method of applied automatic analysis was explained in detail in our previous paper [22]. Therefore it is described only briefly in this study. Using adaptive segmentation, the EEG signal from each derivation was divided into relatively homogeneous segments of variable length. The limits of the segments were in fact defined by the change in stationary character of the signal. The segments were distributed into three classes according to their maximum voltage. The segments whose amplitude didn’t exceed 50μV were placed into the 1st class, the 2nd class contained segments with voltage higher than 50μV and lower than 90μV, and the 3rd class was occupied by segments with the amplitude of 90μV and more. Examples of the application of adaptive segmentation and the distribution of segments into

304

Karel Paul, Vladimír Krajča, Zdeněk Roth et al.

voltage classes are presented in figure 1. The activity of each segment was then described by ten features. The AV feature described the variance of the segment’s amplitude; Mm defined the value of the maximum amplitude ‘peak-to-peak’; the following five features provided information about the value of spectral amplitude in five frequency bands, δ1 in the 0.2-1.5Hz band, δ2 in the 1.6-3Hz band, θ1 in the 3.1-5Hz band, θ2 in the 5.1-8Hz band, α in the 8.115Hz band; feature D1 described the steepness of the curve; D2 described its sharpness; ØF informed about the average frequency of an activity in the segment. The data of the features describing each segment were then averaged in each class, and for each class three additional features were extracted: t% defines the time percentage of the specific class occurence; No gives the number of segments of a specific class; L provides the information about the average duration of the segments of a specific class in sec. In this manner the automatic analysis provided 312 values (8 derivations x 3 classes x 13 features) from the five-minutesample of the analyzed EEG signal. An example of the numeric output of the automatic analysis is presented in table 1.

Figure 1. An example of adaptive segmentation and distribution of segments into voltage classes. Polygraphic records of quiet sleep (QS) and active sleep (AS). Fp1-C3, C3-O1, Fp1-T3, T3-O1, Fp2-C4, C4-O2, Fp2-T4, T4-O2, eight EEG channels; PNG, respiration (movements of abdomen); ECG, electrocardiogram; EOG, electrooculogram; EMG, electromyogram of chin muscles; vertical lines, segments’ boundary; 1, 2, 3 , voltage classes.

STATISTICAL ANALYSIS The data collected from individual infants were averaged and the number of variables taken into account was reduced by means of factor analysis. Using the principal component analysis, three factors – Fc1, Fc2, Fc3 – were extracted, transformed by Varimax rotation with the Kaiser normalization and the respective factor scores were computed.

Table 1. An example of the automatic analysis output Fp1-C3 3: 2: 1:

AV 29.5 17.6 11.1

Mm 119.0 73.3 44.7

δ1 134.1 80.9 50.0

δ2 94.4 50.2 28.0

θ1 54.0 33.9 18.1

θ2 32.5 22.1 11.9

α 15.7 11.6 6.7

D1 25.3 19.7 12.4

D2 26.3 21.5 14.8

ØF 2.4 2.5 3.0

t% 21 31 48

No 27 33 37

L 2.4 2.8 3.9

Numerical data obtained by the analysis of a 5–minute-period of the EEG activity from the channel Fp1-C3 in quiet sleep. 1,2,3, voltage classes; AV,…,L, features.

Table 2. Features' representation, eigenvalues and percentage of variance of factors identified by factor analysis Factors Fc1 Fc2 Fc3

Representation of features AV,Mm,δ1,δ2,θ1,θ2,α,D1,D2, ØF No,t% L

Eigenvalues 7.38 1.49 1.31

% of variance 56.76 11.47 10.08

306

Karel Paul, Vladimír Krajča, Zdeněk Roth et al.

Table 2 shows the list of factors identified by the factor analysis and the list of features represented by the specific factors; furthermore the table shows data about the eigenvalues of factors and the percentage of variance explained by these factors. In the first phase of the statistical analysis we tested (a) the effect of brain region, (the activity from each brain region is represented by a symbol of the individual bipolar derivation: Fp1-C3, …, T4-O2), (b) the effect of voltage class (low-, mid-, and high-voltage class), (c) the effect of sleep state (quiet and active sleep), and (d) the mutual statistical dependences of these effects on all three factors using the method of General Linear Model; the Wilks’ multivariate test (λ) evaluated by means of F-test served as criterion. Subsequently using the F-test, the effect of brain region upon each factor was tested separately, as well as the effect of voltage class, the effect of sleep state and mutual dependences of these effects. In the next phase of the statistical analysis, in order to determine the differences between the individual brain regions, we evaluated the vector of the 13 EEG features in each voltage class separately both in quiet and in active sleep. Using the General Lineal Model method, we employed the multidimensional analysis of variance, which further modifies the calculations of comparative tests with regard of mutual correlations between the 13 features, so that the final tests are not affected by these correlations. Following the initial parallel analysis of the 13 features, we compared in detail the effects of individual brain regions for each of the 13 features using the test according to Šidák. These tests for the individual features serve as an explanatory supplement to the basic multidimensional tests and they illustrate which brain areas and which features participate in the topographic differences, and the direction of these differences.

RESULTS The Effect of Brain Region By evaluating the effect of brain region we were testing the presence of topographic differentiation of EEG activity. The influence upon the factors identified by factor analysis are shown in table 3. It is apparent that both the entire set of factors – Fc1, Fc2, Fc3 – and even each individual factor are highly significantly influenced by the brain region. This means that both the factor Fc1 representing above all spectral features, and the Fc2 and Fc3 factors, which represent non-spectral features, are influenced. Table 3. The effects of brain area, voltage class and sleep stat upon the factors identified by factor analysis and the effects' interactions Effects Factors Fc1,Fc2, Fc3 Fc1 Fc2 Fc3

Brain area F p

Volt. class F p

Sleep state F p

Area x Class F p

Area x Sleep F p

4.76

< .001

317.00

< .001

298.66

< .001

6.86

< .001

2.27 = .001

3.60 5.19 6.33

< .001 < .001 < .001

610.09 258.64 412.28

< .001 < .001 < .001

46.21 436.92 452.85

< .001 < .001 < .001

2.51 13.16 4.72

= .002 = .037 < .001

3.06 = .003 1.24 = .274 2.50 = .015

Regional Differences in Neonatal Sleep Electroencephalogram

307

The Effect of Voltage Class and Dependence between the Effects of Brain Region and Voltage Class (Table 3) When analyzing the effect of voltage class we were testing whether the studied features of EEG signal differ significantly in individual voltage classes. We established that the effect of voltage class significantly influenced the entire set of factors as well as each factor in particular. We have also found a statistically significant dependence between the effect of brain region and the effect of voltage class for all three factors together and for each factor in particular, which points to the fact that the effect of brain region is different in each voltage class. The Effect of Sleep State and Dependence between the Effects of Brain Region and Sleep State (Table 3) The sleep state also significantly influenced all the analyzed factors together as well as each factor separately. We have also proven the presence of a significant dependence between the effect of brain region and the effect of sleep state, documenting that the brain region effect is influenced by the sleep state, for all the three studied factors as a whole and for factors Fc1 and Fc3. The Effect of Brain Region on the EEG Features The results of the comparison of measured values of the EEG features between the individual brain areas with respect to the voltage class and to the sleep state are depicted synoptically in figure 2. First we compared the data from the specific regions of the given hemisphere to one another, so that each region was compared to the other regions of the hemisphere (Fp1-C3 vs. C3-O1, …, C4-O2 vs. T4-O2; the activities from the studied regions are in this case represented by the symbols of the specific derivations). Then we compared the data from the homotopic regions of the two hemispheres to one another (Fp1-C3 vs. Fp2-C4, …, T3-O1 vs. T4-O2). In this way we have mutually compared the activity from the total of 12 pairs of regions altogether. In each pair of regions we were comparing 39 pairs of items (13 features x 3 voltage classes). In the end we have acquired 468 items (12 pairs of areas x 39 pairs of items) for each sleep state, which provide the information on the occurrence of statistically significant differences between the compared data, or lack thereof. While comparing data describing the activities from the individual regions of the same hemisphere, we have found a large number of significantly different values. (a) We have found most differences between the activities of the anterior and posterior medial regions (Fp1,2-C3,4 vs. C3,4-O1,2). It became evident that spectral features (AV, …, D2) and the feature No have significantly higher values in posterior regions. On the other hand the low voltage class values of the L and t% features were significantly higher in anterior regions. (b) The differences in activities of the anterior and posterior temporal regions (Fp1,2-T3,4 vs. T3,4 – O1,2) were distinguished by the following fact: While the majority of spectral features (AV, …θ2) of the high-voltage and mid-voltage class reached significantly higher values in the anterior regions, the values of the α, D1 and D2 features in the mid-voltage and lowvoltage classes were higher in the rear. The values of non-spectral features from both regions mostly did not differ. (c) We established sleep state dependent differences while comparing the values from the anterior-medial and anterior-temporal regions (Fp1,2-C3,4 vs. Fp1,2T3,4). In quiet sleep, the values of spectral features (δ2, …, α) were higher in the medial regions, on the contrary in active sleep spectral features presented higher values in lateral

308

Karel Paul, Vladimír Krajča, Zdeněk Roth et al.

regions. (d) The differences between activities from the posterior-medial and posterior-lateral regions (C3,4-O1,2 vs. T3,4-O1,2) were noted for medially localized higher values of spectral features (AV, …, α). However in active sleep the α, D1, D2 features exhibited higher values laterally. The non-spectral features L and t% had in the low-voltage class significantly higher values temporally, while the values of the t% and No features in the high-voltage class were higher medially.

Figure 2. Differences of EEG features between compared brain areas. Results of Šidák’s test. QS, quiet sleep; AS, active sleep; AV, …, L, features; Fp1-C3 x C3-O1, …, T3-O1 x T4-O2, pairs of bipolar derivations representing the EEG activity of compared brain areas; 1, 2, 3, voltage classes; A, measured value is significantly higher (p<.05) in the anterior region; P, measured value is significantly higher (p<.05) in the posterior region; M, measured value is significantly higher (p<.05) in the medial region; L, measured value is significantly higher (p<.05) in the lateral region; D, measured value is significantly higher (p<.05) in the dexter homotopic region; S, measured value is significantly higher (p<.05) in the sinister homotopic region. The table shows for example the fact that when comparing feature AV from the left anterior-medial region and from the left posterior-medial region (Fp1-C3 x C3-O1) the measured value of the feature is during quiet sleep (QS) significantly higher in the posterior region (P) both in the 1st and 2nd voltage class; in the 3rd voltage class significant difference between regions has not been found. The values of the same feature in active sleep (AS) are probably very similar in both regions in all voltage classes, because no significant differences have been found.

The comparison of data from the homotopic regions of the opposite hemispheres exhibited only small number of statistically significant differences. Only activities from the right and left anterior-medial regions (Fp1-C3 vs. Fp2-C4) differed significantly from each other: Most spectral features showed higher values on the right side. Lateral differences between the other regions were rare. Each feature contributed to the topographic differentiation to a different degree. Features θ1, θ2, α, and δ2 exhibited the highest occurence of significantly different entries in quiet

Regional Differences in Neonatal Sleep Electroencephalogram

309

sleep; in turn in active sleep, these were the features δ2, t%, D1 and α. In feature ØF, we have encountered fewest significant differences.

CONCLUSION The main objective of the study was to establish whether the applied method is capable of discerning topographic particularities of the neonatal EEG. The statistical analysis proved that the effect of the brain region influences all the factors, representing the original measured EEG variables, in a highly significant manner. In this way it demonstrated that the applied method is adequately sensitive and that it is capable to distinguish regional specifities of the neonatal EEG. Beside that the statistical analysis proved that all factors are significantly influenced by both voltage class and sleep state. Mutual statistical dependences between the effects of the brain region and voltage class and between the effects brain region and sleep state have been found. Paired comparison of the data acquired from each region of the individual hemisphere exhibited substantial number of significantly different values. Our findings are thus in accord with the outcomes of the preceding studies, which suggest topographical differences in the values of spectral energies [6-8,10] and in the EEG complexity [17-20]. Topographic differences in EEG activity are no doubt connected to the described morphological differences of the individual regions of the neonatal brain [23,24], to the established regional variances in the brain metabolism [25,26], as well as to the identified local differences in the maturation of brain structures [27,28]. We found that spectral features exhibited higher values in medial derivations than in lateral ones, and at the same time higher values in posterior than in anterior regions. The above mentioned findings apparently testify to a more advanced functional organization in the posterior-medial regions of the brain cortex. The analysis of non-spectral features has shown that the low-voltage and mid-voltage segments of greater length (L) occupy greater time percentage (t%) in the activity of the anterior-medial and posterior-lateral regions. The activity of these regions is therefore less changeable, more rigid, and apparently contributes decisively to the low-voltage and mid-voltage part of the tracé alternant pattern. While comparing the data measured in the homotopic regions of the two hemispheres, we found greater number of significantly different values only between the activities from the anterior-central regions. Right spectral features exhibited mostly higher values than the same features on the left. When comparing the activities from the remaining homotopic regions of the two hemispheres, we have not found any other marked differences. Consequently it became evident, that when using our method, the neonatal EEG activity appears predominantly symmetrical. Other authors have come to a similar conclusion [8, 29, 30]. One of the probable causes of the bilateral EEG symmetry are the connections running through the corpus callosum. The described symmetry of the EEG activity can, however, also support the idea that the functional organization of the majority of homotopic cortical regions is not yet laterally distinguished in the neonatal period. In the present study, we have shown that the applied automatic method is capable of discerning the differences in the EEG signals from the different regions of the neonatal brain. We have also proven that the topographic differences in the neonatal EEG pertain not only spectral measures, as it is evident from the preceding computer-aided studies, but that the

310

Karel Paul, Vladimír Krajča, Zdeněk Roth et al.

topographic differences also pertain the shape and variance of the EEG signal – a fact that has so far solicited no attention. We believe that the discriminatory capabilities of the used method represent a promise for its application in clinical practice.

ACKNOWLEDGMENTS This work was supported by the research program “Information Society” under Grant No. 1ET101210512 “Intelligent methods for evaluation of long-term EEG recordings” , and by Grant IGA MZ ČR 1A8600.

REFERENCES [1] De Weerd AW. Atlas of EEG in the first months of life. Amsterdam: Elsevier; 1995. [2] Mizrahi EM, Hrachovy RA, Kellaway P. Atlas of neonatal electro-encephalography. 3rd ed. Philadelphia: Lippinncot, Williams and Wilkins; 2004. [3] Stockard-Pope JE, Werner SS, Bickford R. G. Atlas of neonatal electroencephalography. 2nd ed. New York: Raven Press; 1992. [4] Eiselt M, Schendel M, Witte H, Dorschel J, Cruzi-Dascalova L, D`Allest AM et al. Quantitative analysis of discontinuous EEG in premature and full-term newborns during quiet sleep. Electroencephalogr. Clin. Neurophysiol, 1997;103:528-534. [5] Paul K, Krajča V, Roth Z, Melichar J, Petránek S. Quantitative topographic differentiation of the neonatal EEG. Clin. Neurophysiol, 2006;117:2050-2058. [6] Scher MS, Steppe DA, Sclabassi RJ, Banks DL. Regional differences in spectral EEG measures between healthy term and preterm infants. Pediatr. Neurol, 1997;17:218-223. [7] Thordstein M, Flisberg A, Lofgren N, Bagenholm R, Lindecrantz K, Wallin BG et al. Spectral analysis of burst periods in EEG from healthy and post-asphyctic neonates. Clin. Neurophysiol, 2004;115:2461-2466. [8] Willekens H, Dumermuth G, Duc G, Meith D. EEG spectral power and coherence analysis in healthy full-term neonates. Neuropediatrics, 1984;15:180-190. [9] Duffy FH, Als H, Mc Anulty GB. Infant EEG spectral coherence data during quiet sleep; unrestricted principal components analysis-relation of factors to gestational age, medical risk and neurobehavioral status. Clin. Electroencephalogr, 2003;34:54-69. [10] Eiselt M, Schindler J, Arnold M, Witte H, Zwiener U, Frenzl J. Functional interactions within the newborn brain investigated by adaptive coherence analysis of EEG. Neurophysiol. Clin, 2001;31:104-114. [11] Kuks JBM, Vos JB, O`Brien MJ. EEG coherence function for normal newborns in relation to their sleep state. Electroencephalogr. Clin. Neurophysiol, 1988;69:295-302. [12] Parmelee AH, Akyiama Y, Schulz M, Wenner WH, Schulte JF. Analysis of the EEG of sleeping infants. Activ. Nerv. Super, 1969;11:111-115. [13] Prechtl HFR, Vos JE, Akyiama Y, Casaer P. Neonatal EEG: Neonatal EEG coherence function in relation to intrauterine growth and oestrogen levels.In: Jílek L, Trojan S, editors. Ontogenesis of the brain, vol.2. Praha: Universita Karlova; 1974;201-210.

Regional Differences in Neonatal Sleep Electroencephalogram

311

[14] Scher MS, Jones BL, Steppe DA, Cork DL, Seltman HJ, Banks D. Functional brain maturation in neonates as measured by EEG-sleep analysis. Clin. Neurophysiol, 2003;114: 875-882. [15] Hughes JR, Kohram MH. Topographic mapping of the EEG in premature infants and neonates. Clin. Electroencephalogr, 1989;20:228-234. [16] Mandelbaum DE, Krawciw N, Assing E, Ostfeld B, Washburn D, Rosenfeld D et al. Topographic mapping of brain potentials in the newborn infant: the estabilishment of normal values and utility in assessing infants with neurological injury. Acta Pediatr, 2000; 89:1104-1110. [17] de la Cruz MD, Manas S, Pereda E, Garrido JM, Lopez S, De Vera R et al. Maturational changes in the interdependecies between cortical brain areas of neonates during sleep. Cerebr. Cortex, 2007;17:583-590. [18] Meyer-Lindenberg A. The evolution of comlexity in human brain development: an EEG study. Electroencephalogr. clin. Neurophysiol, 1996;99:405-411. [19] Pereda E, de la Cruz DM, Maňas S, Garrido JM, Lopez S, De Vera R et al. Topography of EEG complexity in human neonates: Effect of postmenstrual age and sleep state. Neurosci. Lett, 2006;394:152-157. [20] Pereda E, Maňas S, De Vera L, Garido JM, López S, Gonzáles JJ. Non-linear asymetric interdependencies in the electroencephalogram of healthy term neonates during sleep. Neurosci. Lett, 2003;337:101-105. [21] Krajča V, Petránek S, Patáková J,Varri A. Automatic identification of significant graphoelements in multichannel EEG recordings by adaptive segmentation and fuzzy clustering . Int. Biomed. Comput, 1991;28:71-89. [22] Paul K, Krajča V, Roth Z, Melichar J, Petránek S. Comparison of quantitative EEG characteristics of quiet and active sleep in newborns. Sleep Med, 2003;4:543-552. [23] Conel J. The postnatal development of the human cerebral cortex. Vol.6. Cambridge: Harvard University Press; 1939-1963. [24] Salamon G. Magnetic resonance imaging of the human brain: an anatomic atlas. New York: Raven Press; 1990. [25] Chugani HT, Phelps ME. Maturational changes in cerebral function in infants determined by 18FDG positron emission tomography. Science, 1986; 231: 840-843. [26] Chugani HT, Phelps ME. Imaging human brain development with positron emission tomography. J. Nucl. Med, 1990;32:23-25. [27] Barchovich AJ. Normal development of the neonatal and infant brain. In: Barchovich AJ, editor. Pediatric neuroimaging. New York: Raven press; 1990. [28] Huttenlocher PR, Dabholkar AS. Regional differences in synaptogenesis in human cerebral cortex. J. Comprar. Neurol, 1997;387:167-178. [29] Varner JL, Ellingson RJ, Danahy T, Nelson B. Interhemispheric amplitude symmetry of the EEGs of normal full-term newborns. Electroencephalogr. Clin. Neurophysiol, 1976; 40:215-216. [30] Sterman MB, Harper RM, Havens B, Hoppenbrowers T, Mc Ginty DJ, Hodgman JE.Quantitative analysis of infant EEG development during sleep. Electrencephalogr. clin neurophysiol, 1977;43:371-385.

In: Brain Mapping and Diseases Ed: Diane E. Spinelle

ISBN: 978-1-61122-065-0 © 2011 Nova Science Publishers, Inc.

Chapter 14

HANDEDNESS OF CHILDREN DETERMINES PREFERENTIAL FACIAL AND EYE MOVEMENTS RELATED TO HEMISPHERIC SPECIALIZATION Carmina Arteaga1,* and Adrián Poblanoa 1

Laboratorio de Neurofisiología Cognoscitiva Instituto Nacional de Rehabilitación, Ciudad de México, México

ABSTRACT Background: Despite repeated demonstrations of asymmetries in several brain functions, the biological bases of such asymmetries have remained obscure The objective of study was to investigate development of lateralized facial and eye movements evoked by hemispheric stimulation in right-handed and left-handed children. Methods: Fifty children were tested according to handedness by four tests: I. Monosyllabic non-sense words, II. Tri-syllabic sense words, III. Visual field occlusion by black wall, and presentation of geometric objects to both hands separatelly, IV. Left eye and the temporal half visual field of the right eye occlusion with special goggles, afterwards asking children to assemble a three-piece puzzle; same tasks were performed contralaterally. Results: Right-handed children showed higher percentage of eye movements to right side when stimulated by tri-syllabic words, while left-handed children shown higher percentages of eyes movements to left side when stimulated by tri-syllabic words. Lefthanded children spent more time in recognizing mono-syllabic words. Hand laterality correlated with tri-syllabic word recognition performance. Age contributed to laterality development in nearly all cases, except in second test. Conclusions: Eye and facial movements were found to be related to left- and righthand preference and specialization for language development, as well as visual, haptic perception and recognition in an age-dependent fashion in a very complex process. *

Address reprints request: Carmina Arteaga, M.D., M.Sc. Calzada Mexico Xochimilco 289, Col. Arenal Guadalupe, Deleg. Tlalpan, C.P. 14389, Mexico, D.F., Mexico. Pone: (+52) (+55) 59-99-10-00; Fax: (52) (55) 56-03-91-48; E-mail: [email protected]

314

Carmina Arteaga and Adrián Poblano

Keywords: Handedness, Language, Haptic perception, Visual perception, Left and right hemispheres, Brain specialization.

INTRODUCTION Asymmetry in human cerebral hemisphere function, as reflected in a special relationship of the left hemisphere to language, has been recognized for more than a century (Searleman and Porac, 2001). Subsequent observations have identified other aspects of lateralization in brain tasks, such as the superiority of the right hemisphere for spatial manipulations. Despite repeated demonstrations of asymmetries in several functions, the biological bases of such asymmetries have remained obscure (Bear, et al., 1986). This aspect of brain organization, referred to as functional hemispheric asymmetry or functional specialization, is principally noticeable in the human brain (Aboitiz et al., 1995). Most individuals (98 %) show right-hand preference for writing and other manual activities, which are related to cerebral dominance for language in the left hemisphere in 70 % of the cases (Loring et al., 2000). On the other hand, it has been noticed that left-handed subjects have differences in cognitive activities and significant asymmetries when compared with right-handed subjects (Portellano et al., 2006). In the present work, we decided to study lateralization evoked by preferential hemispheric stimuli. Vision of the human face is an important stimulus for recognizing characteristics of every individual, as well as his/her gender, age and race, and identifying categorical human expressions like: annoyance, happiness, sadness or surprise (Webster et al., 2004). Additionally, it is highly sensitive to identification of several external stimuli, and is related to highly-specialized neural reflexes. Biological motion, especially facial motion, provides a rich and subtle source of information on many tasks, including subject and object recognition, facial speech, and the perception of emotion (Reis and Zaidel, 2001; Hill et al., 2005); however, facial movements have been scarcely studied in relation to specific hemispheric stimulation. Visual perception depends among other variables, on the form of the object seen. It has been showed that control and visual actions are analyzed in 17 and 18 sensory cortical areas, respectively, when presentation of one object is unidimensional, thus preventing activation of all other areas in the visual cortex (Granel and Goodale, 2003); on the contrary, vision of one object in movement operates 18 and 19 Brodmann areas, respectively. The nasal segment of the visual field of every eye registers the temporal half of the corresponding retina, whereas the temporal region of the visual field registers the nasal half of the retina. In the central nervous system visual pathway, the fibers of the optical nerve that come from the temporal segment of the retina carry information to the same hemisphere, whereas the proceeding ones from the nasal segment of the retina interweave in the optical chiasma and cross to the other hemisphere (Despopoulos and Silbernagl, 1994). On the other hand, some evidences suggest that eye movements and covert attention may be mediated by complex cognitive mechanisms; for example, cognitive activity produced in one hemisphere can trigger eye movements in the contralateral side (Struthers et al. 1992); nonetheless, this evidence requires additional supporting research. A study performed by Holloway et al. (2000) related the sensoriomotor response to hand dominance. Patients were tested by means of sensory-motor hand preference and

Handedness of Children Determines Preferential Facial and Eye Movements…

315

simultaneous functional Magnetic Resonance Imaging (fMRI), and the authors observed that in the majority of the studied subjects, cortical activation was contralateral to the prefered hand. Body laterality has distinguished human beings for centuries as a rather exclusive feature of man, in difference with many other species. The causes of this are under research and explanations vary from fetal position during pregnancy to faster maturation of one cerebral hemisphere (Golby et al., 2001). Thus, in this paper, we chose to investigate development in a short life-time period of facial and eye movements evoked by preferential hemispheric stimulation in a sample of right-handed and left-handed healthy school children. Our working hypothesis was: left-handed children have preference for eye and facial movements towards the left side of the face, whereas right-handed children more frequently show eye and facial movements towards the right side, and this effect will depend on age.

METHODS Subjects The sample was selected from healthy 8 to 10 year-old school-age children. We tested 50 school children from a public school with the following characteristics: age within the range quoted above, each participant demonstrating a normal neurologic examination (Touwen, 1986), with better than 20/20 Snellen visual acuity, normal screening pure-tone audiometry, adequate familial environment (we included only children from integrated families, where both parents lived with the child), middle socio-economic status, and Wechsler Intelligence Scale for Children-Revised in Mexico (WISC-RM Full Scale) over 90 (Wechsler, 1981). Participant did not demonstrate attention deficit-hyperactivity disorder (ADHD), epilepsy, mental retardation, cerebral palsy, or other neurological disorders, psychiatric disorders, congenital malformations (such as those seen in children with Fragile X syndrome) or stuttering. Children were divided in two groups according to handedness (Oldfield, 1971) with the following equation: 100 x ([R-L] / [R+L]) for right- or left-hand use preference. Each group comprised 25 individuals. The Institutional Review Board of the National Institute of Rehabilitation in Mexico City approved the protocol and informed consent and signed forms were obtained from parents and children.

Procedures We used the experimental design by Zaidel (1984). Children sat comfortably on a chair in front of a desk and were stimulated by means of a word list after Castañeda and Pérez-Ruiz (1991) 20 dB above hearing threshold, and given to the left hemisphere. The list contained the phonetically-balanced most common words used in the Mexico City area. This test is customarily used to obtain word-recognition percentages in Mexico City. Stimuli were delivered biaurally in free-field via loudspeaker using an Amplaid A-171 audiometer (Portland, OR, USA). Children were asked to respond aloud with the correct word, and word

316

Carmina Arteaga and Adrián Poblano

types utilized were as follows: Mono-syllabic non-sense, and tri-syllabic sense words (Appendix 1). Afterwards, the children’s vision was occluded by a black wall that covered the fullvisual field, and geometric objects were presented separately to each the right or the left hand for haptic hemispheric-prefered recognition. Children were asked to answer in recognition of each object, and correct answers as well as misspellings were recorded (see figure 1). Next, the left eye and the temporal half visual field of the right eye were occluded with special goggles, and children were requested to assemble a three piece puzzle with the left hand. Afterward, the right eye was occluded as well as the temporal half visual field of the left eye, and the children were asked to perform the same assembly task with the right hand (see figure 2). All tests were performed begining with the ipsilateral side of the dominant hand in the Edinburg’s test. Simultaneous videotape recordings of facial and eye movements while the subject performed each task were employed. Eye and facial movements were visually recorded only by the principal investigator blinded to group pertinance. Videotape recordings were conducted with the video camera located in front of the face at level of the nose, with the face uncovered and clean, without hair or glasses and with adequate brightness. Facial and eye movements in each test were evaluated using frame-by-frame slow motion of film recordings of 333-msec periods (Video Camera Recorder CCD-TR350, Sony Corporation, Tokio, Japan), in a VHS-HQ DA4 videocassette player (Goldstar, Seoul, Korea) in a JVC TV monitor (JVC, New Jersey, USA). Variables studied included the following: stretching of the mouth, (depressor labii inferioris movements, and elevation of labii superioris, orbicularis oris, and the zygomatic muscles) and lateral eye movements (rectus internus oculi, rectus externus oculi, obliquus superior muscle and obliquus inferior muscle) as binomial variables. No movements of the frontal region were observed during performance of four tests; therefore, none were included in the analysis. Subsequently, the latencies of each movement were calculated employing frame-by-frame analysis as continuous variables.

Figure 1. Design of the Haptic Recognition Test. Subject’s visual field was occluded by the black wall. The subject was asked to recognized figures with each hand.

Handedness of Children Determines Preferential Facial and Eye Movements…

317

Figure 2. Selective Hemi-field Visual Recognition Test. Contralateral eye and temporal visual field was occluded while the subject used only the nasal hemi-field for puzzle assembly. A. Design of special goggles. B. Visual pathway between stimuli and occipital visual cortex.

Statistical Analysis The mean and standard deviation (SD) of quantitative variables and the percentages of binomial variables were calculated. Kruskal-Wallis test was used to compare binomial variables frequency (percentages of eye movements to right and left side; and percentages of labial right and left movements). In addition, we compared quantitative variable averages were compared using Student’s t test (eye and facial movements latencies in each condition). Logistic regression was used to investigate the influence of hand laterality on each test performance. ANOVA for repeated measurements was used, utilizing the test type as a levelfour factor for each year of age of children and employing Huynh-Feldt corrections for homosedasticity assessment. The p value accepted a priori for detecting differences was p ≤ 0.05.

RESULTS Twelve male and 13 female right-handed children were analyzed, while the left-handed group consisted of 11 male and 14 female children. Mean (± standard deviation, SD) of age of right-handed children was 100.96 ± 10.83 months and of left-handed children, 109.76 ± 11.50 months. Average of Edinburgh test quotients of right-handed children was 84.4, while of lefthanded children was 22. Percentages in each sub-test of preferent hemispheric stimulation yielded significant differences between both groups of children in discrimination of the tri-syllabic word test when comparing right and left eye movements, right-handed children demonstrated higher discrimination percentages (see Table I). Latencies of facial and eye movements in each

318

Carmina Arteaga and Adrián Poblano

preferent hemispheric stimulation sub-test are shown in Table II. Left-handed children spent significantly more time in recognizing mono-syllabic words (t = -2.03, p = 0.048). Using logistic regression, hand laterality correlated only with recognition of tri-syllabic words (r = .489, p = 0.027). In ANOVA tests, we found evidenced for significant contribution of age to laterality within subjects in the mono-syllabic recognition test (F = 4.52, df = 1, 4.62, p = 0.041), geometrical figure recognition in the contralateral hand test (F = 6.16, df = 1, 6.22, p = 0.018), and puzzle assembly in the contralateral vision field test (F = 5.30, df = 1, 5.60, p = 0.027).

DISCUSSION As can be seen in Table I, right-handed children exhibited higher percentages of eye movements to the right side when stimulated by tri-syllabic words, while left-handed children demonstrated higher percentages of eye movements to the left side when stimulated by trisyllabic words. Left-handed children spent more time in recognizing mono-syllabic non-sense words (Table II). Hand laterality correlated with tri-syllabic word recognition performance. Age contributed significantly to laterality development in nearly all tests with the exception of the tri-syllabic word recognition test. Right-handed children showed higher percentages of eye movements to the right side, with specialization of left hemisphere in language decoding. Many research articles support left hemisphere dominance for language recognition, including Steinmetz et al., (1991), who showed that planum temporale asymmetry correlated with hand dominance. On the other hand, left-handed individuals had a lesser degree of leftward asymmetry than right-handed individuals, as measured by magnetic resonance imaging (MRI). Recently Mäkelä et al. (2005) studied N-100 magnetoencephalographic (MEG) responses to constant-formant vowels and diphthongs with formant transitions: all the stimuli elicited prominent auditory N100 responses, but the formant transitions resulted in latency modulations specific to the left hemisphere. As expected from a review of the literature and the investigations quoted above, left dominance for language in right-handed children induced more right-side eye movements when sense words were used as stimuli; contrariwise, left-handed children showed greater frequency of left-side eye movements for language stimuli as a result of their incomplete lefthemisphere dominance for speech processing (Struthers et al. 1992). The longer time used in mono-syllabic non-sense words recognition by left-handed children may be attributed to incomplete left-hemisphere specialization and difficulties for mastering language, verbal fluency, or linguistic-processing speed, as has been proposed for children with language delay and developmental learning disorders (Poblano et al. 2000; Herbert et al. 2005). Although the left-handed children studied are asymptomatic and exhibit good school performance, which suggest that this group of children is at high risk for language-reading difficulties. On the other hand, Knetch et al. (2001) suggested that atypical hemispheric specialization for language is not associated with major impairments of linguistic faculties in healthy subjects; thus, additional research is need to lend support to this finding. Hand laterality correlated with word recognition. This fact confirms previous data from the literature supporting the role of left-hemisphere specialization for language dominance, as shown by Wyllie et al. (1990) utilizing intracarotid amobarbital administration in the language-dominance test and its correlation with cortical stimulation, and by Schwartz, et al,

Handedness of Children Determines Preferential Facial and Eye Movements…

319

(1996) during recordings of electroencephalographic activity after craniotomy of right-handed patients with epilepsy. Hand-preference development has been shown to be age-dependent, especially in the earlier stages of childhood. For example, Curt et al. (1992), found in 765 pre-school children that hand-asymmetry distribution for one moving task and for a graphic test was mainly agedependent. Development of handedness and lateralization, and the relationships of these abilities to additional bodily functions, is a complex and not well-known process. For example, auditory perception and its relationship to other lateralized functions is not well known, but deserves more attention in future research. This study presents some limitations, including the low number of subjects studied, and the cross-sectional study design employed, which could have been improved by the use of a prospective follow-up. These points merit additional attention in future works. Notwithstanding this, we learned that interactions between lateralization of eye and facial movements is a complex, age-influenced process, a process wich will be studied in greater detail in future works.

ACKNOWLEDGMENTS The authors’ thanks go to Lucia Vega B.Sc., Principal of the Republic of Swaziland School, for her help in this research and to Maggie Brunner, M.A., and Eduardo Castro-Sierra Ph.D. for their comments and help in the preparation of the English version of the paper.

REFERENCES Aboitiz, F., Ide, A., Navarrete, A., Peña, M., Rodríguez, E., Wolf, V., and Zaidel, E. (1995) The anatomical substrate for language and hemispheric specialization. Biological Reviews. 28: 45-50 Bear, D., Schiff, D., Saver, J., Greenberg, M., and Freeman, R. (1986) Quantitative analysis of cerebral asymmetries. Fronto-occipital correlation, sexual dimorphism, and association with handedness. Archives of Neurology. 43: 598-603 Castañeda, G.R., and Pérez-Ruiz, S.J. (1991) Phonetic analysis of common use-word lists in speech audiometry (in Spanish). Otorrinolaringologia Mexicana. 36: 23-30 Curt, F., Maccario, J., and Dellatolas, G. (1992) Distribution of hand preference and hand skill asymmetry in preschool children: theoretical implications. Neuropsychologia. 30: 27-34 Despopoulos, A., and Silbernagl, S. (1994) Text and atlas of physiology. (in Spanish). Barcelona. Mosby/Doyma. pp. 300 – 310 Golby, J.A., Poldrack, R.A., Brewer, J.B., Spencer, D., Desmond, J.E., Aron, A.P., and Gabrieli, J.D.E. (2001) Material-specific lateralization in the medial temporal lobe and prefrontal cortex during memory ecoding . Brain. 123: 1841-1854 Granel, T., Goodale, M.A. (2003) Visual control of action but not perception requires analytical processing of object shape. Nature. 426: 664 - 667

320

Carmina Arteaga and Adrián Poblano

Herbert, M.R., Ziegler, D.A., Deutsch, C.K., O'Brien, L.M., Kennedy, D.N., Filipek, P.A., Bakardjiev, A.I., Hodgson, J., Takeoka, M., Makris, N., and Caviness, V.S.Jr. (2005) Brain asymmetries in autism and developmental language disorder: a nest whole-brain analysis. Brain. 128: 213-226 Hill, H.C.H., Troje, N.F., and Johnston, A. (2005) Range- and domain- specific exaggeration of facial speech. Journal of Vision. 5: 793-807 Holloway, V., Gadian, D.G., Vargha-Khadem, F., Porter, D.A., Boyd, S.G., and Connelly, A. (2000) The reorganization of sensorimotor function in children after hemispherectomy. Brain. 123:2432-2444 Knecht, S., Dräger, B., Flöel, A., Lohman, H., Breittenstein, C., Deppe, M., Henningsen, H., and Ringelstein E.-B. (2001) Behavioral relevance of atypical language lateralization in healthy subjects. Brain. 124: 1657-1665 Loring, D.W., Meador, K.J., Allison, J.D., and Wright, J.C. (2000) Relationship between motor and language activation using fMRI. Neurology. 54: 981-983 Mäkelä, A.M., Alku, P., May, P. J. C., Mäkinen, V., and Tiitinen, H. (2005) left-hemispheric brain activity reflects format transitions in speech sounds. Neuroreport. 16: 549-553 Oldfield, R.C. (1971) The assessment and analysis of handedness: The Edinburgh inventory. Neuropsychologia. 9: 97-113 Poblano, A., Valadez-Tepec, T., Arias, M.L., García-Pedroza, F. (2000) Phonological and visuo-spatial working memory alterations in dyslexic children. Arch. Med. Res. 31: 493496 Portellano, J.A., Torrijos, S., Martínez-Arias, R., and Vale, P. (2006) Cognitive performance of right handed and left-handed persons on the Wechsler adult intelligence scale (WAISIII). Rev. Neurol. 42: 73-76 Reis, V.A., and Zaidel, D.W. (2001) Brain and face: communicating signals of health in the left and right sides of the face. Brain and Cognition. 46: 240-244 Schwartz, T.H., Ojeman, G.A., Haglund, M.M., and Lettich, E. (1996) Cerebral lateralization of neuronal activity during naming, reading and line-matching. Cognitive Brain Research. 4: 263-273 Searleman, A., and Porac, C. (2001) Lateral preference patterns as posible correlates of successfully switched left hand writing: data and a theory. Laterality. 6: 303-314 Steinmetz, H., Volkman, J., Jänke, L., and Freund, H-J. (1991) Anatomical left-right asymmetry of language-related temporal cortex is different in left- and right-handers. Annals of Neurology. 29: 315-319 Struthers, G., Charlton, S., and Bakan, P. (1992) Lateral orientation, eye movements and dichotic listening. International Journal of Neurosciences. 66: 189-195 Touwen, B.C.L. (1986). The neurological examination of the child with minor nervous dysfunction. (in Spanish). Buenos Aires Panamericana Webster, M.A., Kaping, D., Mizokami, Y., and Duhamel, P. (2004) Adaptation to natural facial categories. Nature. 428: 557-561 Weschler, D. (1981) WISC-R Scale of intelligence revised for school level. (in Spanish) Mexico City, Manual Moderno

Handedness of Children Determines Preferential Facial and Eye Movements…

321

Wyllie, E., Lüders, H., Murphy, D., Morris, H., Dinner, D., Lesser, R., Godoy, J., Kotagal, P., and Kanner, A. (1990) Intracarotid amobarbital (Wada) test for language dominance: correlation with results of cortical stimulation. Epilepsia. 3: 156-161 Zaidel, D.W. (1984) The functions of the right hemisphere (in Spanish). La Recherche. 4: 504-513

In: Brain Mapping and Diseases Ed: Diane E. Spinelle

ISBN: 978-1-61122-065-0 © 2011 Nova Science Publishers, Inc.

Chapter 15

INTACT ENVIRONMENTAL HABITUATION AND EPINEPHRINE-INDUCED ENHANCEMENT OF MEMORY CONSOLIDATION FOR A NOVEL OBJECT RECOGNITION TASK IN PRE-WEANLING SPRAGUE-DAWLEY RATS Robert W. Flint, Shelby Hickey and Maryann Dobrowolski The College of Saint Rose, Albany, NY 12203-1490

Reviewed by Matthew Anderson Saint Joseph’s University, USA

ABSTRACT Within- and between-session environmental habituation were examined in infant rats on postnatal days 14 and 15 in an open field. Using a computerized animal tracking system, rats showed decreases in the total distance traveled (m) and overall average speed (m/s) across 6 30-sec time blocks each day and from day 1 to day 2 of testing. Although the literature is inconclusive regarding the ontogeny of environmental habituation, these results provide clear evidence of both within-session and between-session habituation. On postnatal day 16, animals were returned to the open field with 2 identical objects for novel object recognition training. Animals were either tested immediately after training or were given a subcutaneous injection of saline or .01 mg/kg of epinephrine, followed by testing 2-hrs later. For testing animals were placed into the open field with one familiar and one novel object and the number of object explorations and the time spent exploring each object were recorded by the animal tracking system. From these measures the absolute mean preference for novelty and relative percent preference for novelty were computed. Only the relative percent preference for novelty based on the time spent exploring each object revealed significant differences among the groups. Post-hoc pairwise comparisons indicated that saline animals tested 2-hrs after training performed significantly worse than epinephrine animals and worse than those tested immediately

324

Robert W. Flint, Shelby Hickey and Maryann Dobrowolski after training. This indicates a rapid rate of forgetting for object recognition memory which is effectively attenuated with post-training epinephrine.

INTRODUCTION Age-related memory impairments are stereotypically thought of as afflicting the elderly, and are infrequently a concern for children, young adults, or even those of middle-age. However, we have all suffered and continue to suffer from a very significant form of memory loss described by Freud (1914/1938) as infantile amnesia. Research examining the ontogeny of memory encompasses some very important endeavors in behavioral and developmental neuroscience. The goal of the present study was to examine environmental habituation and object recognition memory in preweanling rats and to determine the effect of epinephrine on novel object recognition memory. Immature mammals commonly exhibit a rapid rate of forgetting (Arnold and Spear, 1997; Campbell and Campbell, 1962; Campbell, Jaynes, and Misanin, 1968; Campbell and Spear, 1972; Hartshorn et al., 1998; Kirby, 1963; Spear and Riccio, 1994; Spear and Rudy, 1991) and an inability to accurately recall events from infancy after reaching adulthood (Freud, 1914/1938; Sheingold and Tenney, 1982; Usher and Neisser, 1993; see Pillemer and White, 1989 for review). While both of these phenomena may be described as infantile amnesia, the present study was interested in the characteristics of the former mnemonic deficit, namely that immature organisms rapidly forget recently learned information. For example, Hill, Borovsky, and Rovee-Collier (1988) used 6-7-month-old human infants and demonstrated that they could acquire and maintain a memory for an operant conditioning procedure for 14 days, but that complete forgetting of the procedure would occur by 21 days post-training. It is paradoxical that this critical period of development is associated with such poor memory. The cause of infantile amnesia is not known, but Campbell and Spear (1972) and Howe and Courage (1993) reviewed a variety of potential mechanisms for this phenomenon. In humans it was suggested that the development of a cognitive sense of self, along with the personalization of event memory are particularly important. Other proposed mechanisms that are not limited to humans included maturational changes in interference and informationprocessing and neuroanatomical and/or biochemical changes in the central nervous system. While the cause of infantile amnesia continues to be debated, increased knowledge of biological ontogentic changes makes this a plausible consideration. For example, it is wellknown that both the limbic system, a group of interconnected neuroanatomical structures heavily involved in learning and memory, and the hypothalamic-pituitary-adrenal axis are developmentally immature (Bayer and Altman, 1975; Levine, 1994; Schapiro, Geller, and Eiduson, 1962; Schlessinger, Cowan, and Gottlieb, 1975; Schmidt et al., 2003; Vazquez, 1998). Regardless of the cause of this rapid rate of forgetting, research has clearly indicated that this deficit is the result of a retrieval failure at the time of testing, and not a failure to learn the material during training. This is evidenced by the success of treatments to enhance the retrieval of memories formed during infancy (Anderson, Karash, and Riccio, 2004; Campbell and Jaynes, 1966; Flint, Bunsey, and Riccio, 1999; Flint and Riccio, 1997; Greco, RoveeCollier, Hayne, Griesler, and Earley, 1986; Hamberg, and Spear, 1978; Rovee-Collier and

Intact Environmental Habituation and Epinephrine….

325

Hayne, 1987; Rovee-Collier, Sullivan, Enright, Lucas, and Fagan, 1980; Richardson, Wang, and Campbell, 1993). Spear and Parsons (1976) trained rats at postnatal day 16, postnatal day 23, or as adults and tested them 28 days later. They demonstrated that an unconditioned stimulus (UCS; footshock) reactivation treatment 24-hours prior to testing had differential effects on retention performance based on the age at which training occurred. The reactivation treatment was effective for all groups with the exception of the 16-day-old animals. However, Spear and Parsons did find that the reactivation treatment was effective for subjects at this age if the retention interval was shortened to 7 days instead of 28 days. These results indicate that the training memory was stored, but the effectiveness of the reactivation treatment likely decreases as the retention interval increases. Furthermore, a single exposure to the conditioning reinforcer was sufficient to reactivate the training memory. The creation and use of new memories involves a complex series of processes including information acquisition, consolidation, storage, and retrieval, with distinct biochemical processes and neuroanatomical substrates which may differ depending upon the nature of the to-be-remembered information. Research indicates that memory consolidation is a timelimited event occurring immediately following acquisition. During this time the memory is in a labile state where manipulations may either enhance or impair the consolidation process, resulting in either enhanced or impaired performance on subsequent tests. For example, some memory enhancing treatments in rats include adrenocorticotropic hormone (Gold and van Buskirk, 1976), glucose (Flint and Riccio, 1996; 1999; Gold, 1986), vasopressin (Koob et al., 1991), oxytocin (Bohus, Conti, Kovacs, and Versteeg, 1982), gastrointestinal peptides (Morley and Flood, 1991), and epinephrine (Costa-Miserachs, Portell-Cortes, Aldavert-Vera, Torras-Garcia, and Morgado-Bernal, 1994; Gold and van Buskirk, 1975, 1978; Nordby, Torras-Garcia, Portel-Cortes, and Costa-Miserachs, 2006). Of paramount importance to the present study are those experiments demonstrating the memory enhancing effects of epinephrine when administered immediately following training. Post-training epinephrine has been shown to enhance memory consolidation for a variety of tasks including inhibitory avoidance conditioning (Gold and van Buskirk, 1975, 1978), taste conditioning (Guaza, Borrell, and Borrell, 1986), appetitive conditioning (Sternberg, Isaacs, Gold, and McGaugh, 1985), and novel object recognition memory (Dornelles et al., 2007). Gold, Murphy, and Cooley (1982) trained 16-day-old rats on an inhibitory avoidance conditioning task. They found that these animals demonstrated good retention of the training shortly afterwards (1-hr) but not 24-hrs later, evidence of infantile amnesia. A subcutaneous injection of epinephrine immediately after training enhanced subsequent performance on the retention test 24-hrs later. In a more recent study, Flint, Bunsey, and Riccio (2007) examined the effects of epinephrine on memory retrieval of inhibitory avoidance conditioning in 17day-old rats. Animals that had received a subcutaneous injection of .01 mg/kg or .1 mg/kg of epinephrine 25 (+5-min) prior to the retention test exhibited significantly better retention scores. Importantly, control groups suggest that these results were not likely due to the effects of epinephrine on vigilance or as an internal contextual reminder cue of training. In novel object recognition memory, animals are commonly presented with two identical objects in an open field type apparatus. Animals are given a specific amount of time to freely explore these objects. On a subsequent retention test, animals are presented with two objects, one familiar (from training) and one novel, and are similarly free to explore these objects. Animals with intact object recognition memory will spend more time exploring the novel object, indicating intact retention of the familiar object (Anderson et al., 2004; Ennaceur and

326

Robert W. Flint, Shelby Hickey and Maryann Dobrowolski

Delacour, 1988; Steckler, Drinkenburg, Sahgal, and Aggleton, 1998). Dornelles et al. (2007) utilized the object recognition paradigm with adult rats. Animals exposed to the training objects for 2-min showed intact memory during the recognition test 1.5 or 24 hours later, but not 96 hours following training. Immediate post-training administration of epinephrine attenuated this recognition memory deficit when tested 96 hours after training. Unlike environmental habituation, object recognition memory requires the animal to establish a memory for a specific environmental stimulus. Since it is common to provide animals with a chance to acclimate to the apparatus prior to training in tasks like novel object recognition (Besheer and Bevins, 2000), the present study took advantage of this opportunity to examine environmental habituation on postnatal days 14 and 15. Prior reports examining the ontogeny of environmental habituation have provided in inconsistent results. Ba and Seri (1995) examined head-dip responses on a hole-board test in animals between postnatal day 10 and 45. They did not find any evidence of within-session habituation at postnatal days 10 or 15, but environmental habituation was evident at 20-days-of-age. Similar results have also been reported by Feigley, Parsons, Hamilton, and Spear (1972). In contrast, File (1978) used the head-dip response to examine the ontogeny of habituation and found that 16-day-old animals demonstrated both within- and between-session environmental habituation. Using an open field apparatus, Bronstein, Neiman, Wolkoff, and Levine (1974) recorded the number of grid crossings and the duration of horizontal movement in 15-, 21-, and 100-day-old rats. They found that 21- and 100-day-old animals habituated to the open field, but there was no evidence of within-session habituation in 15-day-old animals. In the present study we examined the locomotor activity of 14- and 15-day-old animals in an open field for evidence of within- and between-session environmental habituation. On postnatal day 16, animals were returned to the open field for novel object recognition training. Animals were either tested for novel object recognition memory immediately after training, or were given a subcutaneous injection of saline or epinephrine followed by testing 2 hours later. No hypotheses were formulated regarding environmental habituation, given the lack of consensus in the literature. Based upon evidence indicating that epinephrine effectively attenuates infantile amnesia for avoidance conditioning and enhances object recognition memory in adult rats, we hypothesized that immediate posttraining injection of epinephrine would enhance subsequent retention performance.

METHODS Subjects Fifty-nine (37 male, 22 female) Sprague-Dawley rat pups from 5 litters were used for this study. Animals were bred from Harlan Lab breeding stock at The College of Saint Rose. Litters were culled at 5-6 days-of-age to 11-12 pups per litter and were maintained in large Plexiglas cages with dam, food, and water for the duration of the study. The colony room was kept at approximately 70° F on a reversed 9:15 hr light:dark cycle. All testing took place during the dark phase of the cycle. The date of birth was counted as day 0 when determining the age of the animals. Animals were handled for 3-min each on postnatal days 12 and 13 and all animals had their eyes open on day 14. Animals were weighed at postnatal day 16 (M=30.90 g, SE=.45 g) shortly prior to injection to ensure that injection volumes were

Intact Environmental Habituation and Epinephrine….

327

accurate. All experimental procedures were approved by the Institutional Animal Care and Use Committee prior to the onset of the study.

Materials and Apparatus The open field apparatus consisted of a round aluminum tub, within which a 54.0 cm diameter 2.0 cm thick board was inserted. Both the board and the aluminum tub were painted with multiple coats of black paint to seal the surfaces as well as provide a background on which animals would be easily visible. The walls of the apparatus were 25.4 cm high and the room was illuminated with overhead fluorescent lighting. A 68 dB white noise was present during all exposures to the apparatus to mask background noises. A total of four objects were used for training and testing on the novel object recognition task (2 identical green plastic bolts and 2 identical purple plastic Mega BloksTM). The green plastic bolt (circular base diameter = 3.5 cm, height = 6.4 cm) and a purple plastic Mega BlokTM (square base width = 3.2, height = 3.5) were selected from a set of objects based on pilot data that indicated equivalent preferences for the two objects. Objects were mounted onto small pieces of black Plexiglas (5.1 x 7.6 cm) with bolts extending from the bottom, that allowed them to be fitted into small pre-drilled holes on the base of the open field. Objects were positioned in the middle of the apparatus 20.3 cm apart on center. The apparatus and objects were thoroughly cleaned with disinfectant after each animal in order to eliminate the potential effect of scent marks left by prior animals. Pre-training habituation sessions, training, and testing were recorded using the AnyMaze animal tracking system (Stoelting, Inc., Wood Dale, IL). The AnyMaze software was loaded onto a standard IBM office computer to which a digital camera was attached and suspended directly above the open field apparatus. Using the AnyMaze system, the open field was divided into 3 zones, the first zone contained the entire visible area of the open field (2289 cm2), the second zone measured 10.2 cm by 12.7 cm and encompassed the first object, and the third zone with the same dimensions encompassed the second object. The total distance traveled (m), overall average speed (m/s), number of entries into the object zones, and the time spent in the object zones (s) were recorded as dependent measures. Silvers, Harrod, Ferris, Mactutus, and Booze (2006) have demonstrated that the use of automated animal tracking systems produces the same pattern of results for object novelty tasks as coding dependent upon experimenter observation. Sterile saline (.85% NaCl) or epinephrine (.01 mg/kg; Sigma Chemical Co., St. Louis, MO) were administered subcutaneously in the nape of the neck at a volume of 1 ml/kg. The dose of epinephrine was selected based on extensive literature indicating that this concentration is optimal for enhancing memory consolidation (Costa-Miserachs, PortellCortes, Aldavert-Vera, Torras-Garcia, and Morgado-Bernal, 1994; Flint, Bunsey, and Riccio, 2007; Nordby, Torras-Garcia, Portell-Cortes, and Costa-Miserachs, 2006; Williams, Men, Clayton, and Gold, 1998). \

328

Robert W. Flint, Shelby Hickey and Maryann Dobrowolski

Procedure Animals were handled for 3-min each on postnatal days 12 and 13 in order to acclimate them to being picked up by the researcher. On postnatal days 14 and 15, animals were placed individually into the open field apparatus without any objects present. Animals remained in the apparatus for 3-min during which AnyMaze tracked their behavior. This 2-day pretraining phase was used to acclimate the animals to the apparatus and to specifically examine these animals for within- and between-session environmental habituation. For all pre-training, training, and testing sessions animals were placed onto the center of the open field at the beginning of the session. On postnatal day 16, animals were pseudorandomly assigned to one of 3 groups, so that 3-4 animals from each litter were represented in each group. Animals in the immediate test group (n=16) were tested immediately after training. Animals in the saline group (n=12) and the epinephrine group (n=17) were administered their respective subcutaneous injection immediately after training, followed by a 2-hr delay before testing was conducted. Training for all animals involved being placed into the center of the open field for 3-min in the presence of 2 identical objects. Designation of the training objects (green bolts or purple Mega BloksTM) was randomly counterbalanced across subjects. Testing for all animals involved being returned to the apparatus with one familiar object (from training) and one novel object (never seen before) for 3-min. The placement of the familiar and novel objects (left/right) was counterbalanced across animals. AnyMaze recorded the behavior of the animals during all phases of the study.

RESULTS Results were analyzed using parametric tests and were considered significant when p was less than or equal to .05. Partial eta squared (ηp2) has been reported as an effect-size statistic for all omnibus analysis of variance (ANOVA) tests and Cohen’s d (d; Faul, Erdfelder, Lang, and Buchner, 2007) has been reported for pairwise analyses. Post-hoc power analyses have also been tabulated for all results that failed to reach statistical significance.

Pretraining Locomotor Activity All animals were given 3-min sessions to explore the apparatus once at 14-days-old and again at 15-days-old during which the distance traveled and overall average speed were determined (see Figures 1 and 2). Each session was divided into 6 30-sec time blocks (epochs). A 2x2x6 (sex x day x epoch) mixed ANOVA for total distance traveled (m) revealed a significant effect of day [F(1,57)=38.26, p<.001, ηp2=.40], a significant effect of epoch [Huynh-Feldt Correction F(4.44,252.91)=45.27, p<.001, ηp2=.44], and a significant day by epoch interaction [Huynh-Feldt Correction F(4.76,271.10)=3.84, p<.01, ηp2=.06]. There was no main effect of sex [F(1,57)=1.25, p>.05, ηp2=.02, power = .20]. Analyses of the overall average speed (m/s) revealed the same pattern of results. A 2x2x6 (sex x day x epoch) mixed ANOVA for total distance traveled indicated a main effect of day [F(1,57)=38.90,

Intact Environmental Habituation and Epinephrine….

329

p<.001, ηp2=.41], a main effect of epoch [Huynh-Feldt Correction F(4.42,251.70)=45.38, p<.001, ηp2=.44], and a significant day by epoch interaction [Huynh-Feldt Correction F(4.74,270.13)=4.12, p=.002, ηp2=.07]. There was no main effect of sex [F(1,57)=1.26, p>.05, ηp2=.02, power=.20]. 1.4 1.2

Distance (m)

1 0.8 0.6 0.4 0.2 0 1

2

3

4

5

6

1

2

3

4

5

6

Figure 1. Lines represent the mean total distance traveled (m) during each of the 6 30-sec epochs at 14and 15-days-of-age. Bars represent the mean total distance traveled on each day. Error bars represent the standard error of the mean.

0.045 0.04

Speed (m/s)

0.035 0.03 0.025 0.02 0.015 0.01 0.005 0 1

2

3 Day 1

4

5

6

1

2

3

4

5

6

Day 2

Figure 2. Lines represent the mean overall average speed (m/s) during each of the 6 30-sec epochs at 14- and 15-days-of-age. Bars represent the mean overall average speed on each day. Error bars represent the standard error of the mean.

330

Robert W. Flint, Shelby Hickey and Maryann Dobrowolski

Object Recognition The absolute mean preference for novelty (novel minus familiar) and the relative percent preference for novelty [(novel/total) x 100] for the immediate test, saline control, and epinephrine groups were calculated for both the number of object zone entries and the time spent exploring each object. A 2 x 3 (sex x group) ANOVA on the absolute mean preference for novelty did not reveal any significant effects using the number of explorations [Sex F(1,39)=1.40, p>.05, power=.21; Group F(2,39)=1.31, p>.05, power=.27] or the time spent exploring [Sex F(1,39)=.01, p>.05, power=.05; Group F(2,39)=1.51, p>.05, power=.30]. ANOVAs for the relative percent preference for novelty, similarly, did not reveal any significant effects using the number of explorations [Sex F(1,39)=.24, p>.05, power=.08; Group F(2,39)=1.44, p>.05, power=.29]. However, a significant effect of group for the relative percent preference for novelty on time spent object exploring was revealed [F(2,39)=5.00, p<.05, ηp2=.20] (see Figure 3). Post-hoc Fischer’s LSD tests for pairwise comparisons revealed that the saline control tested 2-hrs after training had a significantly lower percent preference score in comparison to both the immediate test group and the epinephrine group tested 2-hrs after training. There was no significant effect of sex for the relative percent preference score [F(1,39)=.52, p>.05, power=.11]. 100

Relative Percent Preference

90 80 70 60 50 40 30 20 10 0 IMM

SAL

EPI

Group Figure 3. Mean relative percent preference for object exploration time for the immediate test, saline, and epinephrine groups. Error bars represent the standard error of the mean.

Locomotor Activity during Testing Since testing was conducted two hours following training in the saline and epinephrine groups, it is possible that residual effects of epinephrine might have elevated activity levels

Intact Environmental Habituation and Epinephrine….

331

confounding the results. In order to examine this potential confound, the test data for male and female animals were combined, as prior analyses did not reveal any sex differences. Independent samples t-tests for the total distance traveled [t(38)=.25, p>.05, d=.45, power=.28] and overall average speed [t(38)=.23, p>.05, d=.00001, power=.05] did not reveal any differences between the saline and the epinephrine groups. 4 3.5

Distance (m)

3 2.5 2 1.5 1 0.5 0 SAL

EPI

Figure 4. Mean total distance traveled (m) for the saline and epinephrine groups during the novel object recognition test on postnatal day 16. Error bars represent the standard error of the mean.

Overall Average Speed (m/s)

0.025

0.02

0.015

0.01

0.005

0 SAL

EPI

Figure 5. Mean overall average speed (m/s) for the saline and epinephrine groups during the novel object recognition test on postnatal day 16. Error bars represent the standard error of the mean.

332

Robert W. Flint, Shelby Hickey and Maryann Dobrowolski

CONCLUSIONS Early studies of environmental habituation depended upon manual coding, frequently involving counting the number of times animals crossed lines on the grid floor of an apparatus. With the advent of computerized animal tracking systems we are now able to obtain detailed measurements such as the exact distance traveled and the average speed providing a more accurate measure of exploratory behavior and activity level. In the present study, open field activity measures in animals at postnatal days 14 and 15 showed significant within- and between-session environmental habituation. The total distance traveled and the overall average speed declined across the 6 30-sec epochs within the test sessions on each day, and there was a significant reduction in these measures from day 1 to day 2. These changes in behavior indicate that at postnatal day 14, animals are capable of forming a memory of their environment and maintaining it for at least 24-hrs. Similar within- and between-session habituation results have been reported using head-dipping as a dependent measure in 16-day-old rats (File, 1978) and Goodwin and Barr (1997) have reported envorinmental habituation of locmotor activity at postnatal day 10. However, our results are in contrast to those reported by Bronstein, Neiman, Wolkoff, and Levine (1974) in a study of the ontogeny of environmental habituation (see also Feigley, Parsons, Hamilton, and Spear, 1972). The reason for this difference is not clear, but our study differs on many levels including the method of data collection, the size of the groups, and behavioral protocol. Based, in part, upon earlier studies failing to show sufficient environmental habituation in immature animals, some researchers have suggested that this apparent behavioral deficit may be a result of an immature hippocampal system (Bronstein et al., 1974) or underdeveloped cholinergic inhibitory mechanism (Feigley et al., 1972). Carman and Mactutus (2001) used the water maze to investigate the ontogeny of spatial navigation in rats. A critical manipulation they made was to adjust the size of the apparatus to that of the developmental size of the animal. Using this technique, they were able to demonstrate that 17-day-old preweanling animals show evidence of learning in a water maze 1/3 the size of that used for adults. Based upon these data, Carman and Mactutus suggested that the developmentally immature state of the hippocampus in 17-day-old preweanling rats did not preclude its ability to integrate visual-spatial information. This hypothesis is important to the present study, as environmental habituation and novel object recognition memory are hippocampal-dependent tasks. If Carman and Mactutus are correct, it is logical to expect that the developmental state of the hippocampus between 14 and 16 days may similarly be sufficient to allow for visualspatial learning. More importantly, it appears as though environmental habituation may be retained for at least 24-hours, similar to those reported by Carman and Mactutus using the water maze. Results of the object recognition memory task indicate that epinephrine administered immediately following training attenuated the memory deficit seen in these infant animals according to relative percent preference scores for the time spent exploring the objects. It is important to note that overall average speed and distance traveled during the object recognition memory test did not differ between groups, suggesting that there were no residual effects of epinephrine present. Additional support for this comes from the finding that absolute novelty preference scores, known to be sensitive to differences in activity levels, did not reflect any group differences. Epinephrine has a very short half-life and reaches peak

Intact Environmental Habituation and Epinephrine….

333

plasma levels following stress in less than 1 minute (Berne and Levy, 1993; Dimsdale and Moss, 1980; Steptoe, 1987) in humans, so if plasma levels are similar in rats it is unlikely that epinephrine would have influenced locomotor activity 2-hrs following administration. Although considerable evidence indicates that epinephrine enhances memory consolidation (Introini-Collison and McGaugh, 1991; McGaugh, 1983; McGaugh and Roozendaal, 2002), two studies by Izquierdo and colleagues have suggested that epinephrine may sometimes prevent the disruptive effects of retroactive interference (Izquierdo, Barcik, and Brioni, 1989; Izquierdo and Pereira, 1989). In their studies, the disruptive effects of posttraining (conditioned emotional responding or inhibitory avoidance conditioning) exposure to an open field or extinction session were prevented with epinephrine administration. However, Izquierdo and Pereira did report that the retroactive interference produced by a series of tones presented following inhibitory avoidance conditioning was not attenuated by post-training epinephrine administration. It is therefore possible that post-training epinephrine effects on subsequent memory performance may, in part, be due to increased resistance to retroactive interference. One potential mechanism of epinephrine-induced memory modulation involves the subsequent elevation in blood glucose level. Epinephrine does not easily cross the blood brain barrier (Axelrod, Weil-Malherbe, and Tomchick, 1959), but glucose does. Epinephrine affects the liver which in turn may then affect the pancreas, both leading to an elevation in blood glucose level (Flint, 2002). It is not clear whether or not this potential mechanism is intact and functional in 16-day-old rats. The development of the pancreas is ongoing following birth (Bourassa et al, 1999; Hill, Hogg, Petrik, Arany, and Han, 1999; Lu, Lebenthal, and Lee, 1987) and these immature animals are primarily utilizing ketones for energy at this age as opposed to glucose (Vannucci and Simpson, 2003). The later developmental switch from ketones to glucose is accompanied by elevations in glucose transporters in the brain (Vannucci, 1994; Vannucci et al., 1998; Vannucci, Seaman, Brucklacher, and Vannucci, 1994; Vannucci, Willing, and Vannucci, 1993) which recent evidence suggests may be important for memory (Choeiri, Staines, Miki, Seino, and Messier, 2005). Other mechanisms of epinephrine-induced memory modulation may include indirect effects on the nucleus tractus solitarius, basolateral nucleus of the amygdala, locus coeruleus, and the hippocampus (Clayton and Williams, 2000ab; Ferry, Roozendaal, and McGaugh, 1993; Liang, McGaugh, and Yao, 1990; Miyashita and Williams, 2004; Williams and McGaugh, 1993; Williams, Men, and Clayton, 2000). Future research may help to elucidate the mechanisms of epinephrine-induced memory modulation.

REFERENCES Anderson, M. J., Barnes, G. W., Briggs, J. F., Ashton, K. M., Moody, E. W., Joynes, R. L., and Riccio, D. C. (2004). The effects of ontogeny on the performance of rats in a novel object recognition task. Psychological Reports, 94, 437-443. Anderson, M. J., Karash, D. L., and Riccio, D. C. (2004). The alleviation of ontogenetic forgetting in a novel object recognition task. Journal of Behavioral and Neuroscience Research, 2(1), 1-5. Arnold, H. M., and Spear, N. E. (1997). Infantile amnesia: using animal models to understand forgetting. In P. J. B. Slater, J. S. Rosenblatt, C. T. Snowden, and M. Milinski (Eds.),

334

Robert W. Flint, Shelby Hickey and Maryann Dobrowolski

Advances in the study of behavior, vol. 26 (pp. 251-284). New York, NY: Academic Press. Axelrod, J., Weil-Malherbe, H., and Tomchick, R. (1959). The physiological disposition of 3H-epinephrine and its metabolite metanephrine. Journal of Pharmacology and Experimental Therapeutics, 127, 251-256. Ba, A., and Seri, B. V. (1995). Psychomotor functions in developing rats: ontogenetic approach to structure-function relationships. Neuroscience and Biobehavioral Reviews, 19(3), 413-425. Bayer, S. A., and Altman, J. (1975). The effects of X-irradiation on the postnatally-forming granule cell populations in the olfactory bulb, hippocampus, and cerebellum of the rat. Experimental Neurology, 48, 167-174. Berne, R. M., and Levy, M. N. (1993). Physiology (3rd ed.). St. Louis, MO: Mosby-Year Book, Inc. Besheer, J., and Bevins, R. A. (2000). The role of environmental familiarization in novelobject preference. Behavioural Processes, 50, 19-29. Bourassa, J., Laine, J., Marie-Luise, K., Gagnon, M. C., Calvo, E., and Morisset, J. (1999). Ontogeny and species differences in the pancreatic expression and localization of the CCKA receptors. Biochemistry, Biophysics, and Research Communication, 260, 820-828. Bronstein, P. M., Neiman, H., Wolkoff, F. D., and Levine, M. J. (1974). The development of habituation in the rat. Animal Learning and Behavior, 2(2), 92-96. Bohus, B., Conti, L., Kovacs, G. L., and Versteeg, D. H. G. (1982). Modulation of memory processes by neuropeptides: Interaction with neurotransmitter systems. In C. Ajmone Marsan and H. Matthies (Eds.), Neuronal plasticity and memory formation. New York, NY: Raven Press. Campbell, B. A., and Campbell, E. H. (1962). Retention and extinction of learned fear in infant and adult rats. Journal of Comparative and Physiological Psychology, 55, 1-8. Campbell, B. A., and Jaynes, J. (1966). Reinstatement. Psychological Review, 73, 478-480. Campbell, B. A., Jaynes, J. R., and Misanin, J. (1968). Retention of a light-dark discrimination in rats of different ages. Journal of Comparative and Physiological Psychology, 66, 467-472. Campbell, B. A., and Spear, N. E. (1972). Ontogeny of memory. Psychological Review, 79, 215-236. Choeiri, C., Staines, W., Miki, T., Seino, S., and Messier, C. (2005). Glucose transporter plasticity during memory processing. Neuroscience, 130, 591-600. Clayton, E. C., and Williams, C. L. (2000a). Adrenergic activation of the nucleus tractus solitarius potentiates amygdala norepinephrine release and enhances retention performance in emotionally arousing and spatial memory tasks. Behavioural Brain Research, 112, 151-158. Clayton, E. C., and Williams, C. L. (2000b). Noradrenergic receptor blockade of the NTS attenuates the mnemonic effects of epinephrine in an appetitive light-dark discrimination learning task. Neurobiology of Learning and Memory, 74, 135-145. Costa-Miserachs, D., Portell-Cortex, I., Aldavert-Vera, L., Torras-Garcia, M., and MorgadoBernal, I. (1994). Long-term memory facilitation in rats by posttraining epinephrine. Behavioral Neuroscience, 108(3), 469-474. Dimsdale, J. E., and Moss, J. (1980). Short-term catecholamine response to psychological stress. Psychosomatic Medicine, 42(5), 493-497.

Intact Environmental Habituation and Epinephrine….

335

Dornelles, A., Martins de Lima, M. N., Grazziotin, M., Presti-Torres, J., Garcia, V. A., Scalco, F. S., Roesler, R., and Schroder, N. (2007). Adrenergic enhancement of consolidation of object recognition memory. Neurobiology of Learning and Memory, 88, 137-142. Ennaceur, A., and Delacour, J. (1988). A new one-trial test for neurobiological studies of memory in rats 1: Behavioral data. Behavioural Brain Research, 31(1), 47-59. Faul, F., Erdfelder, E., Lang, A.-G. and Buchner, A. (2007). G*Power 3: A flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behavior Research Methods, 39, 175-191. Feigley, D. A., Parsons, P. J., Hamilton, L. W., and Spear, N. E. (1972). Development of habituation to novel environments in the rat. Journal of Comparative and Physiological Psychology, 79(3), 443-452. Ferry, B., Roozendaal, B., and McGaugh, J. L. (1999). Role of norepinephrine in mediating stress hormone regulation of long-term memory storage: A critical involvement of the amygdala. Biological Psychiatry, 46, 1140-1152. File, S. E. (1978). The ontogeny of exploration in the rat: Habituation and effects of handling. Developmental Psychobiology, 11(4), 321-328. Flint, R. W., Jr. (2002). Glucose-induced memory modulation. In R. W. Flint, Jr. (Ed.), Forget it? Sources, theories, and mechanisms of alterations in mnemonic function (pp. 197-216). North Chelmsford, MA: Courier Custom Publishing, Inc., Erudition Books. Flint, R. W., Jr., Bunsey, M. D., and Riccio, D. C. (1999). UCS intensity-dependent attenuation of infantile amnesia. Psychobiology, 27(4), 530-540. Flint, R. W., Jr., Bunsey, M. D., and Riccio, D. C. (2007). Epinephrine-induced enhancement of memory retrieval for inhibitory avoidance conditioning in preweanling SpragueDawley rats. Developmental Psychobiology, 49, 303-311. Flint, R. W., Jr., and Riccio, D. C. (1996). Glucose administration attenuates hypothermiainduced retrograde amnesia in rats in a time- and dose-dependent manner. Psychobiology, 24, 62-66. Flint, R. W., Jr., and Riccio, D. C. (1997). Pretest administration of glucose attenuates infantile amnesia for passive avoidance conditioning in rats. Developmental Psychobiology, 31, 207-216. Flint, R. W., Jr., and Riccio, D. C. (1999). Post-training glucose administration attenuates forgetting of passive-avoidance conditioning in 18-day-old rats. Neurobiology of Learning and Memory, 72, 62-67. Freud, S. (1938). The writings of Sigmund Freud (A. A. Brill, Trans.), New York, NY: Random House. (Original work published 1914). Gold, P. E. (1986). Glucose modulation of memory storage. Behavioral and Neural Biology, 45, 342-349. Gold, P. E., and van Buskirk, R. B. (1975). Facilitation of time-dependent memory processes with posttrial epinephrine injections. Behavioral Biology, 13, 145-153. Gold, P. E., and van Buskirk, R. B. (1976). Enhancement and impairment of memory processes with post-trial injections of adrenocorticotropic hormone. Behavioral Biology, 16, 387-400. Gold, P. E., and van Buskirk, R. B. (1978). Effects of alpha- and beta-adrenergic receptor antagonists on posttrial epinephrine modulation of memory: Relationship to posttraining brain norepinephrine concentrations. Behavioral Biology, 24, 1168-1184.

336

Robert W. Flint, Shelby Hickey and Maryann Dobrowolski

Goodwin, G. A., and Barr, G. A. (1997). Evidence for opioid and nonopioid processes mediating adaptive responses of infant rats that are repeatedly isolated. Developmental Psychobiology, 31, 217-227. Greco, C., Rovee-Collier, C., Hayne, H., Griesler, P., and Earley, L. (1986). Ontogeny of early event memory: I. Forgetting and retrieval by 2- and 3-month-olds. Infant Behavior Development, 9, 441-460. Guaza, C., Borrell, S., and Borrell, J. (1986). Effects of adrenaline on the acquisition and maintenance of ethanol preference in a taste conditioning paradigm. Psychopharmacology, 90(3), 336-340. Hamberg, J. M., and Spear, N. E. (1978). Alleviation of forgetting of discrimination learning. Learning and Motivation, 9, 466-476. Hartshorn, K., Rovee-Collier, C., Gerhardstein, P., Bhatt, R. S., Wondoloski, T. L., Klein, P., Gilch, J., Wurtzel, N., and Campos-de-Carvalho, M. (1998). The ontogeny of long-term memory over the first year-and-a-half of life. Developmental Psychobiology, 32, 69-89. Hill, D. J., Hogg, J., Petrik, J., Arany, E., and Han, V. K. (1999). Cellular distribution and ontogeny of insulin-like growth factors (IGFs) and IGF binding protein messenger RNAs and peptides in developing rat pancreas. Journal of Endocrinology, 160, 305-317. Hill, W. L., Borovsky, D., and Rovee-Collier, C. (1988). Continuities in infant memory development. Developmental Psychobiology, 21, 43-62. Howe, M. L., and Courage, M. L. (1993). On resolving the enigma of infantile amnesia. Psychological Bulletin, 113(2), 305-326. Introini-Collison, I. B., and McGaugh, J. L. (1991). Interaction of hormones and neurotransmitter systems in the modulation of memory storage. In R. C. A. Frederickson, J. L. McGaugh, and D. L. Felten (Eds.). Peripheral signaling of the brain: Role in neural-immune interactions and learning and memory (pp. 275-301). Ashland, OH: Hogrefe and Huber Publishers. Izquierdo, I., Barcik, N. R., and Brioni, J. D. (1989). Pretest β-endorphin and epinephrine, but not oxotremorine, reverse retrograde interference of a conditioned emotional response in mice. Pharmacology, Biochemistry, and Behavior, 33(3), 545-548. Izquierdo, I., and Pereira, M. E. (1989). Post-training memory facilitation blocks extinction but not retroactive interference. Behavioral and Neural Biology, 51(1), 108-113. Kirby, R. H. (1963). Acquisition, extinction, and retention of an avoidance response in rats as a function of age. Journal of Comparative and Physiological Psychology, 56, 158-162. Koob, G. F., Lebrun, C., Bluthe, R. M., Dantzer, R., Dorsa, D. M., and Le Moal, M. (1991). Vasopressin and learning: Peripheral and central mechanisms. In R. C. A. Frederickson, J. L. McGaugh, and D. L. Felten (Eds.), Peripheral signaling and the brain: Role in neural-immune interactions and learning and memory (pp. 351-363). Lewiston, NY: Hogrefe and Huber. Levine, S. (1994). The ontogeny of the hypothalamic-pituitary-adrenal axis. The influence of maternal factors. Annals of the New York Academy of Science, 746, 275-293. Liang, K. C., McGaugh, J. L., and Yao, H. Y. (1990). Involvement of amygdala pathways in the influence of post-training intra-amygdala norepinephrine and peripheral epinephrine on memory storage. Brain Research, 508(2), 225-233. Lu, R. B., Lebenthal, E., and Lee, P. C. (1987). Developmental changes of glucocorticoid receptors in the rat pancreas. Journal of Steroid Biochemistry, 26, 213-218.

Intact Environmental Habituation and Epinephrine….

337

McGaugh, J. L. (1983). Hormonal influences on memory. Annual Review of Psychology, 34, 297-323. Mcgaugh, J. L., and Roozendaal, B. (2002). Role of adrenal stress hormones in forming lasting memories in the brain. Current Opinion in Neurobiology, 12(2), 205-210. Miyashita, T., and Williams, C. L. (2004). Peripheral arousal-related hormones modulate norepinephrine release in the hippocampus via influences on brainstem nuclei. Behavioural Brain Research, 153, 87-95. Morley, J. E. and Flood, J. F. (1991). Gut peptides as modulators of memory. In R. C. A. Frederickson, J. L. McGaugh, and D. L. Felten (Eds.), Peripheral signaling of the brain: Role in neural-immune interactions and learning and memory (pp. 379-387). Lewiston, NY: Hogrefe and Huber. Nordby, T., Torras-Garcia, M., Portell-Cortes, I., and Costa-Miserachs, D. (2006). Posttraining epinephrine treatment reduces the need for extensive training. Physiology and Behavior, 89, 718-723. Pillemer, D. B., and White, S. H. (1989). Childhood events recalled by children and adults. In H. W. Reese (Ed.), Advances in child development and behavior, Vol. 21 (pp. 297-340). Orlando, FL: Academic Press. Richardson, R., Wang, P., and Campbell, B. A. (1993). Reactivation of nonassociative memory. Developmental Psychobiology, 26, 1-23. Rovee-Collier, C. K., and Hayne, H. (1987). Reactivation of infant memory: Implications for cognitive development. In H. W. Reese (Ed.), Advances in child development and behavior (Vol. 20, pp. 185-238). San Diego, CA: Academic Press. Rovee-Collier, C. K., Sullivan, M. W., Enright, M., Lucas, D., and Fagan, J. W. (1980). Reactivation of infant memory. Science, 208, 1159-1161. Schapiro, S., Geller, E., and Eiduson, S. (1962). Neonatal adrenal cortical response to stress and vasopressin. Proceedings of Social, Experimental, and Biological Medicine, 109, 937-941. Schlessinger, A. R., Cowan, W. M., and gottlieb, D. I. (1975). An autoradiographic study of the time of origin and the pattern of granule cell migration in the dentate gyrus of the rat. Journal of Comparative Neurology, 159, 149-176. Schmidt, M., Enthoven, L., van der Mark, M., Levine, S., de Kloet, E. R., and Oitzl, M. S. (2003). The postnatal development of the hypothalamic-pituitary-adrenal axis in the mouse. International Journal of Developmental Neuroscience, 21, 125-132. Sheingold, K., and Tenney, Y. (1982). Memory for a salient childhood event. In U. Neisser (Ed.), Memory observed: Remembering in natural contexts. San Francisco, CA: Freeman. Silvers, J. M., Harrod, S. B., Ferris, M. J., Mactutus, C. F., and Booze, R. M. (2006). Automation of the novel object recognition task [Abstract]. Society for Neuroscience, 751.6. Spear, N. E., and Parsons, P. J. (1976). Analysis of a reactivation treatment: Ontogenetic determinants of alleviated forgetting. In D. L. Medin, W. A. Roberts, and R. T. Davis (Eds.), Processes of animal memory (pp. 135-165). Hillsdale, NJ: Lawrence Erlbaum. Spear, N. E., and Riccio, D. C. (1994). Memory, phenomena, and principles. Boston, MA: Allyn and Bacon. Spear, N. E., and Rudy, J. W. (1991). Test of ontogeny of learning and memory: Issues, methods, and results. In H. N. Shair, G. A. Barr, and M. A. Hofer (Eds.), Developmental

338

Robert W. Flint, Shelby Hickey and Maryann Dobrowolski

psychobiology: New methods and changing concepts. New York, NY: Oxford University Press. Steckler, T., Drinkenburg, W. H., Sahgal, A., and Aggleton, J. P. (1998). Recognition memory in rats – I. Concepts and classification. Progress in Neurobiology, 54(3), 289311. Steptoe, A. (1987). The assessment of sympathetic nervous function in human stress research. Journal of Psychosomatic Research, 31(2), 141-152. Sternberg, D. B., Isaacs, K. R., Gold, P. E., and McGaugh, J. L. (1985). Epinephrine facilitation of appetitive learning: Attenuation with adrenergic receptor antagonists. Behvioral and Neural Biology, 44(3), 447-453. Usher, J. A., and Neisser, U. (1993). Childhood amnesia and the beginnings of memory for four early life events. Journal of Experimental Psychology: General, 122, 155-165. Vannucci, S. J. (1994). Developmental expression of GLUT1 and GLUT3 glucose transporters in rat brain. Journal of Neurochemistry, 62, 240-246. Vannucci, S. J., Clark, R. R., Koehler-Stec, E., Li, K., Smith, C. B., Davies, P., Maher, F., and Simpson, I. A. (1998). Glucose transporter expression in brain: Relationship to cerebral glucose utilization. Developmental Neuroscience, 20, 369-379. Vannucci, S. J., Seaman, L. B., Brucklacher, R. M., and Vannucci, R. C. (1994). Glucose transport in developing rat brain glucose transporter proteins, rate constants, and cerebral glucose utilization. Molecular and Cellular Biochemistry, 140, 177-184. Vannucci, S. J., and Simpson, I. A. (2003). Developmental switch in brain nutrient transporter expression in the rat. American Journal of Physiology, 48, E1127-E1134. Vannucci, S. J., Willing, L. B., and Vannucci, R. C. (1993). Developmental expression of glucose transporters, GLUT1 and GLUT3, in postnatal rat brain. Advances in Experimental and Medical Biology, 331, 3-7. Vazquez, D. M. (1998). Stress and the developing limbic-hypothalamic-pituitary-adrenal axis. Psychoneuroendocrinology, 23(7), 663-700. Williams, C. L., and McGaugh, J. L. (1993). Reversible lesions of the nucleus of the solitary tract attenuate the memory-modulating effects of posttraining epinephrine. Behavioral Neuroscience, 107(6), 955-962. Williams, C. L., Men, D., and Clayton, E. C. (2000). The effects of noradrenergic activation of the nucleus tractus solitarius on memory and in potentiating norepinephrine release in the amygdala. Behavioral Neuroscience, 114(6), 1131-1144. Williams, C. L., Men, D., Clayton, E. C., and Gold, P. E. (1998). Norepinephrine release in the amygdala after systemic injection of epinephrine or escapable footshock: Contribution of the nucleus of the solitary tract. Behavioral Neuroscience, 112(6), 14141422.

INDEX A  accumulation, x, 28, 132, 171, 172, 175, 177, 178, 181, 182, 184, 185, 189, 192, 194, 286, 287, 303 accuracy, 56, 112, 234, 245, 258 acetaminophen, 133, 292 acetic acid, 4, 6, 275, 280 acid, xii, 4, 6, 14, 20, 41, 81, 82, 84, 94, 96, 97, 120, 127, 139, 140, 141, 148, 173, 179, 184, 188, 275, 280, 285, 286, 287, 288, 292, 293, 298, 302, 303, 304, 306, 307, 310, 311, 313, 314, 315, 316, 318 acidosis, 94 acquisitions, 109, 201 action potential, 81, 89 activity level, 293, 348, 350 activity rate, 292 acute infection, 125 adaptation, 206, 268 adenocarcinoma, 299, 313 adenoma, 299 adenosine, xii, 81, 92, 285, 287, 293, 303 adenosine triphosphate, xii, 285, 287 adenovirus, 309 ADHD, 333 adhesion, 288, 289, 291, 302, 303, 306, 308, 310 adipose, 123, 138 adipose tissue, 123, 138 ADP, 26, 27, 34, 292 adrenaline, 354 adrenocorticotropic hormone, 343, 353 adulthood, viii, x, 79, 171, 172, 342 aetiology, 80, 157 affect, 122, 131, 133, 134, 136, 182, 193, 286, 295 age, 10, 13, 14, 30, 133, 145, 177, 181, 182 agent, xiii, 121, 178, 286, 295, 300, 301 aggregates, 175, 182 aggregation, 133, 146, 178, 182, 185, 295, 314 aging, 295

agonist, 124, 131, 132, 134, 143, 144 alertness, 159, 165 algorithm, 109, 198, 201, 202, 203, 204, 205, 212, 213, 214, 321 alkylation, 24 allele, 314 alpha activity, 252 alpha wave, 250 ALS, 20, 34, 121, 129, 135, 136, 142, 172, 177, 179, 180, 185, 187, 192, 195, 296 alternative, 39, 137 alters, 177 Alzheimer's disease, vii, 19, 20, 34, 36, 38, 41, 140, 142, 144, 145, 146, 147, 189, 192, 194, 195 amblyopia, 216, 217, 218, 220, 221, 222, 228, 243, 254, 258, 261, 263 amino acids, 96, 121, 125, 173, 174, 271, 304 ammonia, 190 ammonium, 50, 51, 183, 187 amnesia, 115, 117, 342, 343, 344, 351, 353, 354, 356 amplitude, 89, 150, 161, 162, 163, 164, 165, 166, 170, 236, 295, 320, 321, 329 amygdala, 126, 280, 351, 352, 353, 354, 356 amyloid beta, 145, 146, 147, 295, 314 amyloidosis, 133 amyotrophic lateral sclerosis, ix, x, 20, 119, 121, 142, 171, 172, 179, 180, 186, 188, 189, 192, 194, 195, 286, 297, 314, 315 analgesic, 286 anatomy, 86, 101, 113, 114, 198, 202, 213, 214, 279 aneuploidy, 29 angiogenesis, 294, 312, 318 angiogram, 271 angiography, 270, 274, 277, 280, 283 angiotensin II, 289, 306 animals, 3, 4, 9, 10, 13, 14, 29, 131, 138, 308 anisotropic systems, 115 anisotropy, 118 ANOVA, 335, 336, 346, 348

340

Index

anoxia, 81, 89, 92, 93, 94, 185, 292, 310 antagonism, 84 anterior cingulate cortex, 103 antibody, 6, 40, 131 antigen, 31, 44, 45, 51, 56 anti-inflammatory agents, 121, 125, 144, 305 anti-inflammatory drugs, ix, 119, 121, 132, 142, 144, 146, 147, 302, 311, 314, 316, 317 antioxidant, 21, 39, 97, 300, 305, 318 antipyretic, 138 anxiety, 153 aphasia, 115 apnea, 158 apoptosis, v, vii, 1, 2, 5, 6, 7, 9, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 26, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 128, 134, 146, 147, 177, 290, 296, 297, 298, 299, 300, 304, 305, 306, 307, 308, 314, 315, 316, 317, 318 apoptotic mechanisms, xiii, 285 aqueous suspension, 272 architecture, 118, 190, 193 arginine, 140, 291 arousal, 158, 159, 161, 355 arrest, xi, 22, 30, 32, 36, 38, 95, 171, 173, 185, 193, 194 arrests, 23 arteries, 86, 127, 271, 272 arterioles, 274, 275 arteriovenous malformation, 279, 280, 281, 282, 283, 284 artery, 4, 91, 94, 127, 128, 129, 142, 270, 271, 272, 273, 278, 280, 283, 289, 295, 307, 309, 314, 315 arthritis, 294 ascorbic acid, 20 aspartate, 15, 83, 93, 96, 125, 140, 141, 223, 230, 232, 233, 234, 287, 302, 303, 304 aspartic acid, 303 asphyxia, 2, 14 assessment, xiii, 206, 208, 222, 243, 248, 279, 283, 319, 335, 338, 356 association, 22, 32, 35, 129, 174, 178, 179, 180, 182, 190, 191, 196, 288, 295, 297, 300, 313 astigmatism, 228 astrocytes, viii, 19, 80, 83, 84, 85, 87, 93, 94, 127, 129, 132, 133, 135, 136, 141, 148, 190, 194, 290, 291 astrocytoma, 146 astrogliosis, 129 asymmetry, 118, 218, 223, 228, 231, 232, 238, 249, 252, 260, 332, 336, 337, 338 asymptomatic, 248, 336 ataxia, 22, 27, 28, 30, 32, 34, 36, 38, 59 atherosclerosis, 38, 303

ATP, xii, 17, 20, 46, 81, 285, 287, 290, 293, 295, 311 atrophy, 117, 182, 183, 184, 188, 190 attention, 132 auditory evoked potentials, 170 autism, 201, 338 autobiographical memory, 115 autopsy, 88 autosomal dominant, 178, 179 autosomal recessive, 27, 182 availability, 13, 181 avoidance, 343, 344, 351, 353, 354 axonal degeneration, 179, 184, 185, 195 axons, x, 80, 81, 83, 86, 89, 90, 91, 96, 97, 146, 171, 175, 176, 177, 182, 183, 188, 190, 191, 193, 194, 196, 199

B  background information, 198 background noise, 321, 345 basal forebrain, 125 basal ganglia, 184, 200, 203, 212, 213, 214 base pair, 49, 56 basilar artery, 309 BBB, 270, 271, 272, 273, 274, 275, 276, 277, 279 Bcl-2 proteins, 13 beams, 38 behavior, 299, 300, 301 behaviors, 261 beneficial effect, 7, 13, 81 bias, 199, 202, 213, 214 binding, 6, 17, 22, 26, 121, 178, 193, 288, 289, 291, 309, 315, 318 biochemistry, 37 biopsy, 154 biosynthesis, 121, 123, 143, 311 birth, 2, 3, 5, 8, 9, 10, 13, 14 birth weight, 97 births, 85, 220 birthweight, 262 bleeding, 121, 274, 275 blindness, 157, 163 blocks, 127 blood, 4, 122, 124, 136, 137, 140, 148, 184, 195, 294, 312 blood flow, 4, 86, 95, 127, 140, 276, 292, 309 blood pressure, 159 blood stream, 277 blood supply, 80, 86 blood vessels, 122, 124, 137 blood-brain barrier, 148, 270, 282, 283, 312 body, vii, 4, 11, 19, 124, 138, 195 bonds, 24

Index bone, 4 botulism, 223, 228, 239 botulism toxin, 223, 228, 239 bounds, 213 boutons, 145 bradycardia, 158 bradykinin, 125 bradypnea, 158 brain activity, 118, 223, 228, 261, 289, 338 brain damage, xi, 15, 141, 184, 185, 215, 220, 262, 287, 289, 292, 296, 297, 301, 304, 312, 314, 318 brain functions, xiii, 331 brain stem, 103, 108, 283 brain structure, xi, 8, 197, 198, 201, 202, 206, 212, 213, 233, 244, 254, 279, 327 brain tumor, 29, 264, 269, 301 brainstem, 117, 124, 159, 165, 170, 184, 355 brainstem auditory evoked potentials, 170 branching, 80 breakdown, vii, 1, 2, 89, 287, 304 breast cancer, 294, 298, 300, 313, 316, 318 breast carcinoma, 318 breathing, 158, 159, 321 breathing rate, 158, 159 breeding, 344 bridges, 174 buffer, 5, 6 Burma, 27, 34 by-products, 44

C  Ca2+, viii, 14, 16, 27, 79, 81, 82, 83, 84, 87, 88, 91, 92, 93, 96, 136, 304 calcium, 91, 92, 93, 141, 195, 286, 291, 294, 297, 303, 312 caliber, 176, 177, 188, 192, 193, 194, 196 calibration, 157 California, 17 cancer, viii, xii, 19, 22, 25, 27, 32, 33, 36, 38, 41, 285, 289, 294, 298, 299, 300, 305, 306, 313, 314, 316, 317, 318 cancer cells, 316, 317, 318 cancer progression, 300 candidates, 178, 281 CAP, 81, 82, 89, 155, 158, 159, 160, 168 capillary, 271, 274, 275, 276 carbon, 30, 38 carbonyl groups, 177 carcinogenesis, 21, 33, 298, 316, 317 carcinoma, 306, 318 cardiac arrest, xi, 171, 173, 185, 193, 194 carotene, 271 case study, 240

341

caspases, 13, 22, 35 cast, 191 castration, 16 catalytic activity, 128, 292 catheter, 272 cation, 92 CBS, 30 cDNA, 57 cell body, 80, 172, 175 cell culture, 3, 7, 15, 16, 93, 140, 187, 290, 291, 292, 298, 299, 300, 304, 311, 315 cell cycle, viii, 15, 17, 20, 22, 23, 27, 29, 30, 31, 32, 33, 35, 36, 37, 38, 140, 146, 318 cell death, vii, 1, 2, 7, 13, 14, 15, 16, 17, 19, 20, 27, 28, 29, 34, 36, 37, 41, 80, 84, 87, 92, 93, 127, 128, 132, 133, 140, 286, 287, 288, 289, 290, 296, 297, 298, 300, 301, 302, 304, 305, 314, 315, 317 cell fate, viii, 20 cell line, 38, 93, 131, 292, 298, 299, 300, 307, 310, 313, 318 cell lines, 38, 292, 298, 299, 300, 313, 318 cell signaling, 20 cell surface, 191, 288, 290 cement, 254 central nervous system, viii, ix, x, xiii, 15, 17, 34, 36, 79, 80, 84, 91, 119, 121, 125, 126, 139, 147, 171, 172, 182, 282, 286, 287, 288, 290, 294, 296, 297, 301, 307, 315, 332, 342 cerebellar development, 59 cerebellum, 30, 103, 184, 352 cerebral blood flow, 86, 95, 127, 277, 292, 309 cerebral cortex, xi, 4, 8, 9, 10, 11, 12, 13, 15, 27, 38, 92, 93, 126, 139, 154, 159, 161, 167, 188, 195, 215, 216, 221, 222, 223, 227, 229, 232, 234, 238, 241, 243, 244, 245, 246, 253, 254, 260, 261, 304, 329 cerebral function, 329 cerebral hemisphere, 332, 333 cerebral hypoxia, 17 cerebral palsy, viii, 79, 80, 85, 220, 333 cerebrospinal fluid, x, 37, 124, 171, 173, 184, 187, 198, 269 cerebrovascular disease, 282, 294 certification, 248 cervical cancer, xii, 285, 317 channels, 297, 303 chemical bonds, 24 chemotherapy, 296 child development, 355 childhood, 95, 337, 355 chloral, 4 chromosome, viii, 43, 45, 49, 173, 174 chronic glaucoma, 191

342

Index

circulation, 86, 95, 122, 147 City, 19, 333, 338 class, 58, 59, 163, 182, 191, 321, 324, 325, 326, 327 class switching, 59 classification, 18, 25 cleavage, 16, 17, 288, 294, 297, 298, 299, 315 clinical diagnosis, xi, 167, 215 clinical examination, 163 clinical presentation, 126 clinical trials, 84, 131 clone, 57 cloning, 50, 58 clopidogrel, 300, 318 clustering, 329 clusters, 102, 103, 104, 105, 106, 108 CNS, viii, 19, 20, 37, 41, 79, 80, 81, 83, 84, 85, 91, 92, 93, 98, 126, 131, 139, 166, 172, 174, 176, 181, 183, 184, 191, 290, 309 CO2, 2, 3 cobalt, 318 coding, 179, 337, 345, 350 cognition, 114, 132, 283 cognitive abilities, 113 cognitive activity, 332 cognitive deficit, 100, 146 cognitive deficits, 100, 146 cognitive development, 355 cognitive function, ix, 99, 100, 107, 113, 132, 178 cognitive impairment, viii, 19 cognitive process, ix, 99, 111 cognitive testing, 268, 281 coherence, 239, 245, 247, 248, 249, 250, 251, 252, 260, 265, 320, 328 cohort, 36, 295 collateral, 276 colon, xii, 285, 299, 307, 316, 317 colon cancer, 299, 316 colon carcinogenesis, 316, 317 color, 102, 103, 108, 110, 208, 249, 250, 253 colorectal cancer, 289, 298, 299, 306, 316, 317 coma, 159, 161 combination therapy, 299 communication, 137, 141 complement, 34, 90, 132, 244 complexity, 58, 254, 261, 327, 329 complications, 185, 271, 282 components, x, 29, 31, 123, 132, 171, 177, 182, 184, 294, 296 composition, 96, 232, 244, 294 compounds, 26 comprehension, 115, 221, 283 computed tomography, 198 computer technology, 246

computing, 198, 320 concentration, 31, 127, 128, 130, 134, 185, 291, 292, 298, 300, 301 condensation, 2, 5, 11, 12, 13, 17, 20, 32 conditioning, 342, 343, 344, 351, 353, 354 conductance, 83, 92 conduction, x, 82, 89, 90, 98, 171, 176, 178, 183, 192 conductivity, 238 configuration, 23, 297 congenital malformations, 333 conjugation, 271 connectionist models, 263 connectivity, ix, 99, 100, 101, 104, 106, 107, 111, 112, 113, 115, 282 consciousness, 116, 158, 166 conservation, 55, 57 consolidation, 343, 345, 351, 353 consumption, 228, 233 contralateral hemisphere, 301 control, vii, 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 22, 27, 36, 121, 123, 133, 145, 146, 147, 194, 293, 305, 313, 317 control group, 133, 164, 255, 257, 293, 343 convention, 206, 208 convergence, 163 coordination, 161, 174, 222 corpus callosum, 82, 90, 92, 327 correlation, x, xi, 113, 115, 144, 149, 161, 166, 168, 170, 202, 205, 208, 210, 215, 228, 232, 243, 244, 248, 254, 255, 258, 269, 295, 300, 301, 336, 337, 339 correlation coefficient, 202 correlations, 111, 117, 202, 208, 221, 324 cortical neurons, 16, 30, 31, 39, 40, 141, 187, 293, 304, 311 cost, xi, 215 Costa Rica, 263 COX-2 enzyme, 287 craniotomy, xii, 267, 268, 269, 270, 272, 274, 275, 277, 278, 337 creatine, 142, 183, 186, 187, 223, 229, 232, 233 Creutzfeldt-Jakob disease, 151, 167, 168, 169, 170, 199 critical period, 184, 263, 342 cross-sectional study, 337 CSF, 184, 185, 193, 195, 198, 199, 200, 201, 269, 270 culture, 3, 13, 16, 31, 93, 130, 133, 140, 192, 292, 296, 298, 299, 300, 304, 315, 317 cycles, 46 cycling, viii, 20, 30, 32, 33 cyclins, 22

Index cyclooxygenase, 120, 131, 137, 138, 139, 140, 141, 142, 143, 144, 146, 147, 287, 303, 304, 306, 307, 314 cyclopentenone prostaglandins, 147 cystathionine, 30, 41 cystine, 88, 90 cytoarchitecture, 190, 265 cytochrome, 296, 299, 307, 318 cytokines, 20, 120, 122, 125, 130, 132, 134, 135, 137, 138, 143, 144, 290, 291, 306, 310, 316 cytokinesis, 172 cytomegalovirus, 289, 306 cytometry, 32 cytoplasm, 81, 163, 182, 288, 293 cytosine, 25 cytoskeleton, 172, 176, 181, 182, 183, 184, 191, 192, 196

D  damage, vii, xii, 2, 4, 16, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 33, 38, 40, 121, 127, 128, 129, 133, 134, 140, 141, 147, 173, 185, 187, 285, 286, 287, 288, 289, 292, 296, 297, 304, 306, 307, 310 database, 198, 201, 202, 206, 259 death, vii, ix, 1, 2, 7, 11, 12, 13, 14, 16, 17, 18, 19, 20, 34, 35, 36, 37, 39, 40, 41, 119, 127, 130, 132, 134, 135, 136, 141, 177, 181, 286, 287, 291, 296, 297, 298, 300, 302, 304, 308, 314, 315 declarative memory, 107 defects, 26, 28, 183 defense, vii, 19, 21 defense mechanisms, 21 deficiencies, 184, 248 deficiency, 26, 29, 33, 183, 184, 194 deficit, 80, 133, 162, 166, 184, 221, 223, 244, 258, 269, 287, 333, 342, 344, 350 definition, 290 deformation, xi, 197, 198, 200, 201, 202, 205, 206, 207, 212, 245 degradation, 2, 7, 14, 23, 24, 27, 40, 89, 176, 182, 193, 203, 288, 289, 299 delivery, 3 delta wave, 154, 159, 250 deltoid, 160 demand, 22 dementia, 80, 117, 129, 132, 133, 146, 181, 182, 194, 214, 248, 313, 314 demonstrations, xiii, 331, 332 demyelinating disease, 131 demyelination, 131, 165, 182 dendrites, 123, 175, 238 dendritic arborization, 175, 191, 196 density, 3, 4, 5, 11, 130, 193, 294

343

dephosphorylation, 27, 175, 176, 182, 191 depolarization, 80, 96, 128, 287 depolymerization, x, 171 depression, 141, 287, 304 deprivation, vii, 1, 2, 14, 82, 84, 86, 87, 88, 89, 93, 97, 98, 289, 293, 303, 307, 309, 311, 315, 317 deregulation, 159, 178 desensitization, 191 destruction, xii, 2, 21, 91, 285, 286, 288, 314 detection, xi, 5, 14, 24, 26, 32, 34, 35, 38, 40, 56, 97, 101, 113, 197, 198, 199, 214, 246, 320 developing brain, vii, 1, 2, 13, 15, 16, 85, 95 developmental process, 20 deviation, xi, 205, 215, 216, 217, 218, 219, 220, 221, 223, 228, 245, 246, 252, 254, 260, 261, 263, 335 diabetic neuropathy, x, 171, 172, 183, 188, 192 diabetic patients, 183 diagnosis, x, xi, 85, 149, 162, 167, 177, 198, 199, 213, 215, 226, 229, 252, 258, 261, 265 diet, 317 differential diagnosis, 265 differentiation, 28, 144, 174, 189, 307, 313 diffusion, ix, 91, 99, 100, 102, 108, 109, 111, 112, 114, 115, 116, 117, 118, 204, 214, 271, 311 diffusion process, 214 discharges, 151, 153, 154, 159, 160, 161, 162, 165, 167, 168, 170, 223, 244 discomfort, 125, 269 discrimination, xii, 267, 335, 352, 354 discrimination learning, 352, 354 disease activity, 144, 184 disease progression, 139, 313 disorder, viii, 27, 79, 89, 129, 130, 133, 178, 181, 182, 223, 244, 265, 333, 338 dispersion, 109, 162 displacement, 200, 202 disposition, 352 dissociation, 33, 107, 116, 118 distilled water, 4 distractions, 259 distress, 220, 223, 229, 232, 233, 234, 244 distribution, 140, 146, 181, 193 disturbances, 153, 219, 241, 261 divergence, 109 diversification, 37, 56 diversity, 185 DNA, v, vii, viii, 1, 2, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 43, 44, 45, 46, 47, 49, 50, 51, 52, 53, 54, 56, 57, 58, 59, 60, 288, 289, 296, 297, 299, 300, 306, 314, 315, 317

344

Index

DNA damage, v, vii, 16, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 DNA lesions, vii, 16, 19, 21, 23, 24, 27 DNA ligase, 26, 33, 35, 36, 59 DNA polymerase, 26, 32, 34, 35, 40, 47, 50, 59 DNA repair, vii, 19, 22, 23, 24, 25, 28, 29, 30, 31, 32, 33, 34, 36, 37, 38, 39, 40, 41, 59, 299 DNA sequencing, 47, 50 domain, 174, 175, 176, 178, 181, 182, 187, 188, 189, 190, 192, 196, 294, 308, 309 dominance, 263, 332, 336, 339 dopamine, 130, 143, 177, 181, 191, 289, 296, 307 dopaminergic, 38, 130, 131, 143, 181, 296, 314 dorsolateral prefrontal cortex, ix, 99 dosage, xii, 285, 289, 291, 292, 293, 295, 296, 300, 316 double helix, 24, 26 down-regulation, 147 drawing, 44, 49 Drosophila, 58 drugs, ix, 17, 119, 121, 132, 142, 144, 145, 146, 147, 161, 170, 281, 282, 300, 302, 308, 310, 311, 314, 316, 317 dura mater, 162 durability, 279 duration, 132, 145, 295, 313 dyes, 81, 270, 271, 272 dynamic control, 140 dyslexia, 258 dysphoria, 153

E  EAE, 131, 132 economic status, 333 edema, 131, 184, 190, 279, 310, 312 EEG activity, xiii, 158, 159, 319, 320, 321, 323, 324, 326, 327 EEG patterns, x, 149, 154, 166, 167 eigenvalues, 323, 324 elderly, 314 elderly population, 314 electrical conductivity, 238 electrical properties, 138 electrocardiogram, 322 electrodes, 162, 234, 248, 259, 268, 321 electroencephalogram, x, 126, 149, 167, 169, 248, 320, 329 electroencephalography, 259, 269, 281, 328 electromagnetic, 269, 277 electromagnetic field, 269 electromagnetic fields, 269 electron, 87, 88, 274, 275, 292

electron microscopy, 87, 274, 275 electrons, 233 electrophoresis, vii, 1, 13 elongation, 174, 177 elucidation, 46 emboli, 269, 271, 274, 275, 280, 281, 282, 283 embolization, 269, 271, 274, 275, 280, 281, 282, 283 embolus, 127 embryo, 186, 187 embryogenesis, 12, 45, 187, 294 EMG, 160, 321, 322 emission, xii, 6, 116, 118, 215, 269, 329 emotion, 332 EMU, 268 emulsions, 277 encephalitis, 151, 152 encephalomyelitis, 131, 144 encephalopathy, x, 95, 151, 153, 154, 167, 171, 172, 184, 190 encoding, ix, 32, 33, 59, 96, 99, 100, 101, 102, 103, 104, 105, 106, 108, 109, 112, 113, 114, 115, 116, 117, 118, 182, 186, 189 endonuclease, 14, 15, 16, 18, 25, 26, 30, 41, 315 endothelial cells, ix, 119, 122, 124, 126, 127, 128, 131, 135, 136, 137, 138, 139, 144, 148, 271, 276, 277, 294, 306, 309, 312 endothelium, 122, 124, 136, 303, 309 endotoxins, 290 energy, 2, 13, 287, 296 environment, 24, 174 environmental factors, 38 environmental stimuli, 321 enzymes, ix, 21, 22, 24, 30, 89, 97, 119, 124, 130, 135, 138, 287, 290, 291, 294, 298 EOG, 220, 223, 229, 234, 236, 244, 259, 264, 321, 322 epidemiologic studies, 144 epilepsy, ix, xii, 16, 119, 121, 126, 127, 134, 135, 136, 139, 141, 148, 161, 168, 223, 228, 244, 245, 261, 263, 264, 265, 268, 280, 281, 285, 287, 296, 297, 315, 333, 337 epinephrine, xiv, 341, 342, 343, 344, 345, 346, 348, 349, 350, 351, 352, 353, 354, 355, 356 episodic memory, ix, 99, 100, 101, 107, 113, 116, 118 episodic memory tasks, ix, 99 epithelial cells, 17, 298, 315, 316 Epstein-Barr virus, 288, 313 equipment, 260 erosion, 121 esotropia, 217, 228, 229, 240, 242, 262 ester, 140 ethanol, 4, 6, 354

Index ethylene, 277 eukaryotic cell, 44 European Community, 3 event-related potential, 281 evidence, vii, xii, 2, 14, 15, 19, 23, 31, 32, 38, 41, 128, 129, 136, 184, 188, 191, 285, 287, 300, 314, 317 evoked potential, 163, 170 evolution, 9, 11, 138 exaggeration, 338 examinations, 321 excision, 4, 24, 25, 28, 36, 37, 39, 40, 41, 283 excitability, 127, 165, 166, 170 excitation, 5, 81, 139, 272, 277, 304 excitotoxicity, 20, 35, 82, 83, 87, 91, 93, 97, 128, 140, 182, 302, 303 exclusion, 117, 184 execution, 30, 32 exonuclease, 14 exotropia, 223, 228, 229, 242, 254 experiences, 118, 158 experimental autoimmune encephalomyelitis, 144 experimental design, 333 explicit memory, 114 exploration, 348, 353 exposure, 2, 4, 7, 9, 20, 22, 26, 28, 31, 38, 50, 88, 89, 142, 183, 268, 288, 290, 291, 292, 300, 307, 343, 351 external magnetic fields, 269 extinction, 163, 351, 352, 354 extracellular matrix, 294 extraction, 46, 321 eye movement, xiii, 228, 236, 244, 245, 321, 331, 332, 333, 334, 335, 336, 338

F  factor analysis, xiii, 319, 322, 323, 324 failure, 286, 302 false negative, 243 family, 13, 22, 34, 35, 39, 186, 189, 287, 288, 290, 293, 296, 298, 300 family members, 296, 297, 298 family predisposition, 220 fat, 275 fat soluble, 275 FDA, 246, 248, 274, 275, 277 FDA approval, 274 feedback, 87, 92, 134, 221 feet, 136, 178 fetal development, 41 fever, ix, 119, 121, 122, 123, 124, 135, 136, 137, 138 fiber, 100, 102, 104, 108, 109, 111, 112, 113, 114, 115, 118, 183

345

fibers, 102, 103, 105, 106, 108, 109, 110, 111, 112, 125, 172, 174, 175, 248, 268, 332 fibroblast growth factor, 3 fibroblasts, 37, 187, 306, 308, 310 fidelity, 37 filament, 172, 174, 175, 182, 186, 187, 189, 190, 191, 193, 195 filters, 272 filtration, 272 financial support, 262 first degree relative, 220 fluid, x, 37, 124, 171, 173, 184, 187, 198, 204, 269 fluorescence, 5, 6, 47, 50, 84, 90, 175, 272, 276, 277, 278 forebrain, 2, 7, 8, 13, 15, 37, 93, 97, 125, 193, 307, 309 fragments, vii, 1, 9, 13, 14, 16, 17, 44 France, 1, 3, 4, 5, 6, 8, 197, 222 free radicals, 26, 85, 286, 302, 303 freedom, 200, 207 frequencies, 158, 160, 218 frontal cortex, 116, 129, 134, 146 frontal lobe, 115, 117, 157, 225, 247 functional activation, 111 functional analysis, 193 functional changes, 239 functional imaging, 101, 107 functional MRI, 115, 118, 280

G  gamma rays, 21 ganglion, 192, 195, 302 gastric mucosa, 121, 298, 317 gastrointestinal tract, 121 gel, 5, 7, 8, 9, 10, 11, 12, 13 gene expression, 23, 90, 141, 146, 306, 311, 316 gene promoter, 288 gene transfer, 142 general anesthesia, 272 generalization, 139 generation, 20, 24, 123, 124, 126, 134, 147, 291 genes, x, 22, 24, 28, 39, 44, 45, 59, 87, 121, 130, 171, 172, 174, 178, 179, 187, 188, 189, 287, 290, 296, 305 genetic mutations, 185 genetics, 35 genome, vii, 19, 22, 24, 26, 28, 40 genomic instability, vii, 19, 22 Germany, 154 gestation, 3, 85, 262, 320 gestational age, 328 gland, 57, 60 glasses, xii, 215, 334

346

Index

glaucoma, 182, 191 glia, 80, 92, 129, 130, 186, 314 glial cells, x, 82, 92, 96, 122, 129, 132, 171, 172, 290, 300, 309, 310 glioblastoma, xii, 270, 285 glioblastoma multiforme, 270 glioma, 281, 293, 300, 311, 312, 318 globus, 200, 203, 205, 206, 208, 209, 210, 211 glucocorticoid receptor, 354 glucose, 80, 84, 89, 93, 224, 228, 271, 289, 293, 303, 307, 309, 311, 315, 343, 351, 353, 356 glutamate, 81, 82, 83, 84, 86, 87, 88, 90, 92, 93, 94, 95, 96, 125, 127, 135, 136, 140, 148, 182, 190, 286, 287, 288, 289, 293, 297, 300, 302, 303, 304, 311, 313, 315, 318 glutathione, 20, 88, 89, 90, 94, 95, 124, 140 glycerol, 5 glycine, 84 glycogen, 84, 190 glycosylation, 173, 175, 176, 178, 192 grants, 186 granules, 254 graph, 231, 257 gray matter, xi, 91, 197, 198, 199, 200, 201, 205, 212, 223, 234, 254, 255, 257, 258, 268 groups, 288, 293, 296 growth, 3, 16, 20, 26, 31, 32, 39, 174, 176, 177, 183, 186, 187, 193, 194, 290, 293, 298, 300, 306, 307, 308, 316, 318 growth factor, 3, 20, 85, 94, 290, 307, 308, 316, 354 growth hormone, 164, 170, 308 guanine, 35 guidance, xii, 172, 185, 267, 269, 270, 271, 272, 277, 279, 281, 282 guidelines, 3, 246, 248 Guinea, 281

H  habituation, xiv, 341, 342, 344, 345, 346, 350, 352, 353 hallucinations, 153 handedness, xiii, 331, 333, 337, 338 harm, 142 HE, 38, 39, 40, 41 health, 189 heart disease, 135 heart rate, 159 heat, 182, 186, 293, 311, 312 heat shock protein, 311 heat treatment, 293 height, 345 hemianopsia, 163 hemiparesis, 162

hemisphere, xiii, 102, 103, 108, 152, 162, 246, 251, 252, 261, 272, 273, 274, 278, 301, 319, 325, 327, 332, 333, 336, 339 hemispheric asymmetry, 231, 232, 332 hemorrhage, 185, 193, 309 hemostasis, 296 hepatic encephalopathy, x, 171, 172 hepatocellular carcinoma, 306 hepatocytes, 299, 302, 318 HERA, 115 herpes, 151, 152, 288, 289, 306 herpes virus, 306 heterogeneity, 95, 118 hippocampus, 4, 16, 30, 38, 96, 108, 109, 113, 126, 139, 140, 148, 263, 287, 350, 351, 352, 355 histamine, 125, 145 histone, 27, 38, 58 HIV, 289 HLA, 130, 142 homeostasis, 12, 22, 80, 84, 87, 178, 296 homework, 222 homogeneity, 3 Honda, 191 Hong Kong, 223 HTLV, 288 hub, 35 human brain, ix, xi, xii, 85, 91, 99, 100, 113, 114, 115, 117, 137, 141, 172, 197, 198, 199, 213, 239, 260, 267, 268, 280, 283, 329, 332 human cerebral cortex, 261, 329 human leukemia cells, 316 human neutrophils, 290 human subjects, 35, 168 Huntington's disease, 182, 188 hybridization, 45, 50, 54, 55, 57, 124, 186 hydrogen, 6, 20, 89, 90, 97 hydrogen peroxide, 6, 20, 89, 90, 97 hydrolysis, 21, 24 hydroxyapatite, 313 hydroxyl, 20 hyperactivity, 161, 165, 224, 228, 240, 265, 333 hyperglycaemia, 154 hyperopia, 217 hypersensitivity, 126, 139 hypertrophy, 85 hyperventilation, 226, 259 hypothalamus, 58, 123, 124, 125, 138, 139 hypothermia, 123, 286, 353 hypothesis, 57, 113, 114, 132, 136, 168, 175, 221, 239, 301, 333, 350 hypoxia, vii, 1, 2, 3, 4, 5, 7, 8, 9, 10, 13, 14, 15, 16, 17, 80, 87, 89, 91, 93, 94, 128, 141, 146, 232, 237, 287, 288, 289, 291, 293, 295, 307, 311

Index

I  iatrogenic, x, 149, 152, 162, 163, 164, 166, 168 ibuprofen, 130, 133, 292, 304, 311 ICAM, 289, 306 ice, 4, 30 ideal, 270, 275, 279 identification, 190 identity, 172 idiopathic, 129, 223 IFN, 122, 131, 132, 133 IGFs, 354 IL-6, 122, 125, 132 illumination, 5, 278, 321 image, xi, 45, 102, 103, 108, 152, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 212, 214, 217, 222, 224, 238, 249, 253, 254, 257, 269, 270, 271, 279, 281, 283 image analysis, xi, 197, 198 images, ix, xi, 99, 100, 108, 197, 198, 199, 200, 201, 202, 203, 206, 207, 212, 213, 214, 215, 216, 224, 228, 236, 254, 260, 269, 273, 278, 283, 311 imaging modalities, 198 immune reaction, 141 immunity, 305 immunization, 144 immunodeficiency, 26 immunoglobulin, 37, 39, 56, 58, 59, 305 immunohistochemistry, vii, 1, 6, 194 immunoreactivity, 6, 11, 124, 128, 134, 137, 141 impairments, vii, 1, 143, 169, 221, 336, 342 in situ hybridization, 45, 54, 57, 186 in vitro, viii, xiii, 3, 14, 17, 19, 29, 32, 137, 145, 146, 186, 187, 188, 285, 293, 295, 296, 300, 301, 307, 311, 313 in vivo, ix, xiii, 5, 17, 29, 32, 84, 87, 96, 99, 111, 112, 113, 115, 117, 127, 143, 174, 187, 191, 192, 194, 228, 244, 254, 280, 285, 295, 296, 300, 301, 304, 306, 307, 311, 312 incidence, xi, 27, 29, 32, 126, 215, 228, 236, 239, 240 inclusion, 40, 182, 187, 195 inducer, 131, 293, 311 inducible protein, 16 induction, 15, 22, 25, 27, 32, 122, 123, 124, 125, 126, 128, 129, 131, 133, 134, 135, 136, 137, 138, 139, 144, 145, 272, 282, 288, 292, 293, 297, 299, 300, 304, 309, 310, 311, 312 induction period, 136 infancy, 95, 342 infants, xi, xiii, 85, 86, 89, 95, 97, 183, 215, 216, 262, 319, 320, 322, 328, 329, 342 infarction, xii, 15, 91, 142, 285, 310, 312

347

infection, 290 inflammation, 20, 121, 123, 125, 126, 128, 131, 132, 133, 134, 139, 144, 145, 146, 147, 306, 307, 308, 316 inflammatory cells, 128 inflammatory disease, 126 inflammatory mediators, 85, 132 inflammatory responses, 126, 128, 136 influence, 174, 293, 312, 314 informed consent, 333 inheritance, 220 inhibition, 38, 40, 81, 89, 94, 96, 115, 121, 123, 126, 128, 129, 130, 131, 134, 137, 138, 141, 142, 144, 145, 147, 165, 177, 190, 219, 286, 289, 290, 291, 292, 293, 294, 295, 297, 298, 299, 300, 302, 303, 304, 305, 306, 308, 309, 311, 313, 314, 317 inhibitor, 7, 14, 38, 50, 121, 123, 125, 126, 127, 128, 129, 132, 133, 134, 140, 144, 192, 286, 288, 291, 296, 298, 300, 315 inhomogeneity, 199 initial state, 233 initiation, 22, 316, 317 injections, 87, 295, 353 injury, vii, 1, 2, 12, 13, 14, 15, 17, 30, 37, 125, 127, 128, 130, 141, 143, 184, 185, 192, 193, 297, 303, 306, 308, 311, 314 innate immunity, 305 inoculation, 162 inositol, 82 input, 125, 138 insertion, 121, 180, 195 insomnia, 152, 153, 163 instability, vii, 19, 22, 121, 130 insulin, 3, 183, 194, 271, 308, 354 integration, 32, 116, 204, 221, 247, 260 integrin, 290, 308 integrity, vii, 19, 21, 22, 28, 30, 40, 176, 177, 182, 183, 296 intelligence, 338 intensity, 6, 297, 300 interaction, 20, 29, 291, 309 interactions, x, 40, 128, 136, 171, 172, 174, 176, 177, 181 interdependence, 82 interference, 165, 342, 351, 354 interferon, 122, 144, 145, 292 interferon gamma, 144, 292 interleukins, 298, 316 Internet, xi, 197, 201 interneurons, 129 internode, 176 interpretation, 34, 286 interruptions, 24

348

Index

intervention, viii, 20, 283 intestine, 121, 309 intracerebral hemorrhage, 193 intravenously, 272 inversion, 157 invertebrates, 294 ionizing radiation, viii, 19, 26, 34, 36 ions, 84, 286, 287, 294 ipsilateral, 11, 12, 238, 334 irradiation, viii, 19, 30, 35, 38, 289, 352 irritability, 242 ISC, 214, 333 Islam, 318 isolation, 5, 16, 46, 80 isomers, 291

J  Jakob-Creutzfeldt disease, 170 Japan, 43, 46, 119, 169, 334 joints, 44, 45, 49, 51, 56 Jordan, 282

K  K+, 80, 83, 84, 92, 93 keratinocyte, 316 ketones, 351 kidney, 121, 124, 293 kinase activity, 40 kinetics, 314 knowledge, 286 Korea, 334

L  labeling, vii, 1, 5, 6, 9, 175, 283 lactate level, 230, 232 language development, xiv, 331 language lateralization, 338 latency, 164, 166, 336 lateral eye movements, 334 lateral sclerosis, ix, x, 21, 119, 121, 129, 142, 171, 172, 179, 180, 186, 188, 189, 192, 194, 195, 286, 297, 314, 315 laterality, xiii, 331, 333, 335, 336 LD, 35, 97 LDL, 312 lead, xiii, 5, 15, 21, 22, 25, 28, 29, 30, 179, 182, 184, 285, 289, 290, 296, 297 leakage, 2, 88 learning, 117, 263, 336, 342, 350, 352, 354, 355, 356 learning task, 352 left hemisphere, 102, 103, 108, 152, 162, 252, 278, 332, 333, 336

left-hemisphere, 336 legend, 10 lens, viii, 43, 45, 47, 53, 54, 55, 57, 58 lesions, vii, 16, 19, 21, 23, 24, 26, 27, 28, 37, 97, 132, 154, 167, 183, 214, 220, 227, 239, 282, 297, 356 leukemia, 298, 299, 316 lice, 92 Lie group, 204 life expectancy, 296 ligand, 124, 134, 296, 316 limbic system, 342 linear function, 203 links, 37 lipid peroxidation, 195 lipid peroxides, 20 lipids, 21 lipoproteins, 294 lithium, 126 liver, 33, 51, 52, 53, 54, 55, 121, 124, 154, 293, 303, 351 localization, 138, 142, 146, 168, 185, 222, 228, 268, 269, 278, 282, 309, 352 location, 293, 298 locomotor, 222, 344, 351 locus, 124, 138, 351 longitudinal study, 295 long-term memory, 353, 354 low birthweight, 262 low risk, 295 LSD, 348 lumen, 272 lung cancer, 294 Luo, 93, 94, 95, 96, 97 lupus, 55 lying, 44, 49 lymphocytes, 17, 38, 132 lymphoid, 131 lysine, 3, 177, 296, 314

M  machinery, viii, 20, 22, 24, 29, 32, 33, 36, 37 macrophages, 131, 306 magnetic field, 198, 199, 269 magnetic resonance, ix, xii, 80, 96, 99, 100, 114, 115, 116, 118, 198, 215, 220, 233, 253, 254, 260, 263, 265, 267, 280, 282, 283, 311, 336 magnetic resonance imaging, xii, 80, 114, 115, 116, 118, 198, 215, 220, 253, 267, 280, 282, 283, 336 magnetic resonance spectroscopy, xii, 96, 216, 260 magnetoencephalography, 269 majority, vii, 19, 24, 82, 84, 124, 132, 135, 157, 185, 241, 242, 301, 325, 327, 333

Index males, 3 mammalian brain, 15, 189 management, 281, 283, 284, 301 manganese, 89, 305 manipulation, 271, 273, 275, 276, 279, 350 mapping, iv, ix, xi, xii, 99, 114, 215, 218, 222, 223, 225, 227, 237, 243, 244, 248, 263, 265, 267, 268, 269, 270, 271, 272, 274, 275, 276, 277, 278, 279, 281, 282, 283, 320, 329 markers, xi, 31, 32, 38, 90, 172, 173, 177, 182, 184, 185, 187, 193, 195, 312 Marx, 144 mass, 187 mass spectrometry, 187 matrix, 220, 277, 294, 312, 313 matrix metalloproteinase, 294, 312, 313 maturation, 34, 174, 177, 184, 196 MBP, 131, 132 mean arterial pressure, 95 mechanical stress, 172 mechanical ventilation, 95 median, 4, 106, 170 mediation, 297, 299 medication, 161, 165, 260, 293 medulla, 123, 125, 139 MEG, 269, 336 MEK, 290 memory, ix, xiv, 99, 100, 101, 107, 108, 112, 113, 114, 115, 116, 117, 118, 133, 181, 222, 259, 263, 279, 281, 291, 337, 338, 342, 343, 344, 345, 350, 351, 352, 353, 354, 355, 356 memory formation, 114, 352 memory loss, 342 memory performance, 351 memory processes, 112, 116, 352, 353 memory retrieval, 107, 112, 114, 116, 118, 343, 353 men, 181 meninges, 3 mental representation, 116 mental retardation, 183, 184, 333 messages, 221 messenger RNA, 192, 304, 354 messengers, 20 meta-analysis, 41 metabolic dysfunction, 287 metabolism, vii, 19, 20, 21, 27, 28, 30, 94, 143, 183, 184, 244, 290, 295, 327 metabolites, 184, 318 metalloproteinase, 294, 312, 313 metastasis, 306, 312 methanol, 6 methodology, 199, 234, 245, 248, 281 methylation, 24

349

methylprednisolone, 144 Mexico, 217, 229, 331, 333, 338 Mg2+, 14, 16, 88 Miami, 274, 275 microcirculation, 140 microdialysis, 96 microinjection, 123, 125 microphotographs, 6 microscope, 6, 272, 281 microscopy, 5, 87, 90, 93, 274, 275 midbrain, 125, 139 migration, 312, 355 mitochondria, 24, 36, 40, 89, 293, 297, 298, 303, 316 mitochondrial DNA, 28, 37 mitogen, xii, 139, 146, 148, 190, 285, 304, 307, 308, 312 mitosis, 29, 39, 172, 290 mitotic index, 300 MMA, 180, 184 MMP, 294, 312, 313 MMP-2, 312, 313 MMPs, 312 mode, 310, 314, 318 modelling, 94 models, vii, 1, 2, 13, 14, 41, 125, 128, 130, 134, 135, 178, 184, 297, 299, 301, 310 modification, x, 171, 188, 234, 271, 292, 298, 305 mole, 175 molecular biology, 141 molecular mass, 187, 191, 193 molecular oxygen, 291 molecular weight, 14, 45, 173, 189, 191, 195, 293 molecules, ix, 24, 34, 35, 44, 46, 59, 80, 99, 100, 120, 128, 288, 291, 310 monitoring, 157, 165, 184, 268, 270, 273 morbidity, 2 morphogenesis, 312 morphology, 7, 9, 11, 16, 90, 150, 151, 152, 154, 164, 165, 194, 202, 234 morphometric, xii, 216, 222, 253, 254, 255, 263, 265 mortality, 2, 4, 194 motif, 188, 294 motor behavior, 261 motor control, 101, 102, 103 motor neuron disease, 185 motor neurons, 129, 130, 142, 175, 177, 182, 185, 186, 191, 195 motor system, 175 movement, 130, 195 movement disorders, 169 MRI, xi, xii, 114, 115, 118, 169, 197, 198, 199, 200, 201, 203, 210, 212, 213, 214, 215, 220, 229, 244, 254, 257, 263, 264, 267, 269, 280, 283, 336

350

Index

mRNA, 30, 121, 122, 124, 126, 133, 134, 137, 143, 178, 182, 186, 189, 190, 292, 293, 310, 315 mtDNA, 24 mucosa, 121, 298 multidimensional, 324 multiple sclerosis, ix, x, 80, 119, 121, 144, 171, 173, 185, 195, 214, 292, 310 muscles, 129, 160, 178, 235, 309, 321, 322, 334 mutagenesis, 21, 35 mutant, 28, 41, 178, 182, 189 mutation, 32, 37, 181, 186, 189, 191, 192, 194, 196, 296 myelin, viii, 79, 80, 82, 84, 86, 93, 131, 179, 184, 193, 194, 196 myelin basic protein, 131, 184 myelin oligodendrocyte glycoprotein, 131 myoblasts, 36 myoclonus, 163, 170 myosin, 177, 193

N  Na+, viii, 79, 81, 82, 83, 84, 87, 91, 92, 93, 287, 303 NaCl, 5, 46, 50, 345 naming, 338 nanoparticles, 276, 277, 282 National Institutes of Health, 197 National Science Foundation, 186 necrosis, 2, 5, 6, 7, 9, 11, 13, 14, 15, 18, 20, 80, 85, 122, 137, 286, 296, 305, 306, 308, 310, 314, 315, 316, 317, 318 necrotic core, 293 negative feedback, 134 neocortex, 146, 263, 280 neonates, 3, 96, 183, 328, 329 neoplasm, 296 neoplastic tissue, 294 nerve, 36, 81, 82, 87, 88, 92, 95, 122, 126, 137, 142, 170, 176, 178, 182, 183, 192, 332 nervous system, vii, viii, ix, x, xiii, 15, 17, 19, 20, 28, 29, 34, 36, 39, 41, 79, 80, 84, 91, 115, 119, 121, 125, 126, 138, 139, 147, 171, 172, 177, 178, 182, 187, 189, 282, 286, 287, 288, 290, 294, 296, 297, 301, 307, 315, 318, 332, 342 nested PCR, 46, 49 network, 40, 124, 135, 174, 190 neural development, 28 neural systems, 114 neuritis, 132 neurobiology, 141 neuroblastoma, 38, 133 neuroblasts, 174 neurodegeneration, vii, 19, 20, 22, 28, 32, 33, 34, 35, 37, 40, 126, 127, 140, 141, 143, 302, 303

neurodegenerative diseases, viii, 20, 27, 29, 35, 38, 129, 136, 145, 172, 181, 185, 191, 292, 296, 297 neurodegenerative disorders, 21, 28, 29, 32, 121 neurofibrillary tangles, 36, 132, 181 neurofilaments, x, xi, 171, 172, 173, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196 neurogenesis, 15, 16, 59, 187, 192, 286 neuroimaging, ix, xi, xii, 85, 99, 100, 107, 112, 114, 215, 216, 220, 228, 229, 239, 244, 260, 279, 283, 329 neuroinflammation, ix, 119, 129, 136, 145 neurokinin, 125 neurological disease, x, 20, 130, 171, 177, 182, 185, 186 neuromotor, 27 neuronal apoptosis, viii, 17, 19, 20, 29, 31, 33, 35, 37, 38, 128, 134, 146 neuronal cells, 3, 6, 145, 184, 286, 315 neuropathic pain, 126, 139, 192 neuropathologies, 301 neuropathy, x, 171, 172, 182, 183, 186, 187, 188, 190, 192, 196 neuropeptides, 352 neuroprotection, xii, 141, 143, 285, 286, 289, 291, 300, 302, 314 neuroprotective agents, 34, 286 neuropsychiatry, 280 neuropsychology, 115, 116 neuroscience, xii, 267, 268, 282, 284, 286, 342 neurosurgery, 268, 269, 280 neurotoxicity, 34, 94, 121, 134, 140, 141, 142, 143, 144, 146, 147, 187, 279, 287, 288, 304, 315 neurotransmission, 143, 244 neurotransmitter, 82, 83, 84, 287, 297, 352, 354 neutrophils, 128, 290, 308 New Zealand, 272, 273 nitrates, 293 nitric oxide, 15, 125, 128, 140, 141, 143, 144, 145, 146, 287, 292, 293, 301, 302, 303, 304, 309, 310, 311, 316 nitric oxide synthase, 128, 141, 143, 144, 287, 302, 303, 304, 309, 310, 311, 316 nitrogen, 291, 292 NMDA receptors, 16, 83, 84, 88, 90, 93, 95, 96, 288, 304 N-methyl-D-aspartic acid, 141, 303, 304 NMR, 162, 264, 318 nodes, 175, 176 noise, 112, 204, 321, 345 non-adrenergic non-cholinergic, 309 non-steroidal anti-inflammatory drugs, ix, 119, 146, 147, 311, 316 norepinephrine, 352, 353, 354, 355, 356

Index normal aging, 117 normal children, 255 normal development, 20 NSAIDs, ix, 119, 121, 122, 128, 130, 132, 133, 134, 136, 145, 147, 313, 314, 316, 317 nuclear magnetic resonance, xii, 216, 260 nuclei, vii, xi, 1, 5, 7, 9, 11, 13, 14, 30, 36, 46, 59, 197, 198, 199, 200, 201, 202, 203, 205, 206, 207, 208, 209, 210, 211, 212, 227, 261, 268, 277, 355 nucleic acid, 21, 292 nucleotides, 49, 51 nucleus, 2, 58, 123, 124, 138, 166, 201, 205, 277, 290, 293, 296, 351, 352, 356 nucleus tractus solitarius, 351, 352, 356 numerical analysis, 245 nutrients, 271 nystagmus, 217, 220, 221, 228, 236, 243, 261

O  observations, 13, 14, 27, 28, 30, 32, 121, 122, 123, 124, 125, 126, 127, 131, 133, 134, 185 occipital cortex, 227, 231, 264 occipital lobe, 223, 224, 229, 230, 232, 234, 255, 257, 258, 260, 263 occipital regions, 221, 231, 249, 252 occlusion, xiii, 86, 94, 97, 127, 128, 129, 142, 276, 279, 293, 295, 310, 314, 315, 331 occult blood, 317 ocular movements, 158 oculomotor, 163, 222, 227, 229, 244, 261 oil, 280 oligodendrocytes, 80, 82, 83, 84, 87, 88, 89, 92, 95, 97, 176, 308 oligodendroglia, 86, 87, 88, 90, 93, 95, 96, 193 oligomers, 147, 196 opacity, 273 operant conditioning, 342 optic nerve, 81, 82, 83, 87, 88, 92, 95, 182 optimization, 203, 204 organ, viii, 43, 51, 57, 123, 199, 261, 289, 306 organelles, 172, 177, 185 organization, x, 37, 171, 190, 193 oscillations, 141, 243, 265 overlap, 106, 205, 207, 208, 209, 210 ox, 80, 312 oxidation, 24, 35, 131, 143 oxidative damage, 20, 34, 39, 88, 97, 129, 141 oxidative stress, 20, 27, 30, 32, 34, 35, 86, 88, 90, 94, 95, 145, 177, 287, 289, 297, 303, 310, 318 oxygen, vii, 1, 2, 14, 20, 24, 80, 89, 90, 93, 128, 140, 158, 233, 289, 291, 293, 303, 307, 309, 311, 315, 316 oxygen consumption, 233

351

P  p53, 27, 32, 33, 34, 37, 38, 39, 40, 296, 299, 300, 306, 314, 316, 317, 318 pain, ix, 119, 121, 125, 126, 138, 139, 192, 268 pancreas, 289, 351, 354 parallel, 6, 13, 52, 90, 117, 130, 174, 290, 296, 324 paralysis, 131, 178 parenchyma, xii, 199, 267, 268, 270, 271, 274, 275, 276, 277 parenchymal cell, 122 paresis, 163, 235 parietal cortex, 5, 107, 114, 117 parietal lobe, 115 Parietal lobe, 118, 281 Parkinson’s disease, ix, 36, 119, 121, 130, 172, 179, 180, 286, 292, 297, 302, 310, 314, 315 parkinsonism, 295 particles, 172, 177, 185 passive, 131, 132, 286 pathogenesis, 20, 32, 39, 86, 95, 129, 178, 182 pathology, vii, viii, 19, 79, 80, 85, 86, 89, 90, 97, 129, 132, 133, 136, 142, 145, 183, 192, 193, 194, 320 pathophysiology, viii, 79, 80, 86, 90, 91, 135, 309 PCA, 269, 273, 275 PCR, 44, 46, 47, 49, 53, 56, 57, 88 penis, 309 peptides, 125, 132, 133, 145, 147, 343, 354, 355 perforation, 121 performance, xiv, 111, 118, 130, 221, 222, 223, 228, 254, 314, 331, 334, 335, 336, 338, 343, 344, 351, 352 perfusion, 91, 95, 220, 282 perinatal, vii, 1, 2, 15, 85, 94, 95, 96, 262 periodicity, 150 peripheral blood, 308 peripheral nervous system, 177, 178, 187 permeability, xiii, 87, 96, 131, 282, 285, 298, 299, 316, 318 peroxidation, 195 peroxide, 6, 20, 89, 90, 97 peroxynitrite, 20, 128, 310 perspective, 193 PET, 114, 269, 279, 283 PGE, 123 pH, 5, 46, 276 phage, 45, 46, 52, 53 phagocytosis, 13, 20, 133, 145, 147, 318 pharmacological treatment, 224, 225 pharmacology, 95, 141, 142 pharmacotherapy, 302 phenol, 46

352

Index

phenotype, 26, 35, 83, 89, 178 phenylalanine, 184 phosphatidylserine, 300, 318 phosphorylation, x, 27, 34, 35, 37, 171, 172, 173, 175, 176, 177, 178, 179, 181, 183, 184, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 287, 288, 289, 290, 299, 302, 303, 307, 308 photobleaching, 175 physicochemical properties, 271 physiology, vii, ix, 19, 79, 86, 96, 115, 337 physiopathology, 161, 227 pineal gland, 57, 60 pioglitazone, 131, 143, 144 placebo, 132, 133, 139, 295, 313 planum temporale, 336 plaque, 133, 145, 146 plaques, 181, 191, 289, 308 plasma levels, 351 plasma membrane, 20 plasminogen, 144, 294 plasticity, 14, 96, 172, 223, 239, 263, 352 platelets, 121, 288, 304, 305 PM, 38, 170, 186, 193, 195, 304 pneumonia, 289 Poincaré, 1 point mutation, 181 polarity, 236 polymer, 175 polymerase, 26, 27, 32, 34, 35, 40, 46, 47, 50, 59, 88 polymerase chain reaction, 88 polymerization, x, 171, 275, 280 polymerization time, 275, 280 polymers, x, 171, 175 polymorphism, 193 polyvinyl alcohol, 283 poor, 185 population, 190, 196, 295, 313, 314 population size, 51, 52 positron, 116, 118, 269, 329 positron emission tomography, 116, 118, 269, 329 posterior region, 326 precipitation, 81, 277 precursor cells, 83, 86, 92 prediction, 184, 185, 312 prefrontal cortex, ix, 99, 100, 105, 107, 113, 115, 116, 117, 118, 337 pregnancy, 333 premature infant, xi, 86, 94, 95, 215, 329 prematurity, 220 preschool, 337 preschool children, 337 pressure, 182 preterm infants, 95, 328

prevention, 40, 82, 88, 95, 125, 144, 192, 288, 289, 302, 316 principal component analysis, 322 probability, 109, 110, 111, 112, 200, 246, 265 probe, 45, 50, 52, 54, 55, 57, 277, 278, 283 production, ix, 119, 120, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 140, 141, 144, 145, 286, 292, 309, 310, 313, 316 progesterone, 3 prognosis, x, 149 program, vii, 2, 12, 19, 29, 30 pro-inflammatory, 120, 121, 132, 142, 306 project, 320 proliferation, 15, 29, 85, 92, 132, 289, 290, 300, 308, 316, 317 promoter, 83, 121, 130, 288, 306, 308 propagation, xi, 136, 148, 197, 286 proposition, 280 prostaglandins, 120, 140, 146, 147, 292, 312 proteases, 15 protective factors, 144 protective mechanisms, 287 protective role, 81, 96 protein family, 193, 290, 294, 296, 298 protein folding, 129, 311 protein kinase C, 39, 148, 192, 288, 302, 317 protein kinases, 16, 40, 175, 194, 308 protein synthesis, 7, 15, 23, 175, 189, 293, 302, 311 proteinase, 5, 46 protein-protein interactions, 174 proteolipid protein, 131 proteolysis, 189, 304 pro-thrombotic, 129 protons, 198 psychiatric disorders, 333 psychiatric side effects, 130 psychobiology, 356 psychological stress, 352 psychology, 243, 261 pulse, 14, 175 pyramidal cells, 238 pyrimidine, 24

Q  quantum dot, 276, 283 quantum dots, 276, 283

R  radiation, viii, 19, 21, 26, 34, 36, 299, 302, 317, 318 radicals, 26, 85, 286, 292, 302, 303, 311 radio, 198, 199, 273, 283 radiotherapy, viii, 19

Index reaction time, 118 reactive oxygen, 20, 24, 128, 140, 316 reactivity, 222 reading, 57, 221, 222, 259, 262, 300, 336, 338 reading comprehension, 221 reading difficulties, 336 real time, xi, 215, 238 reality, 244 recall, 342 receptors, viii, 16, 56, 79, 81, 82, 83, 84, 87, 88, 90, 92, 93, 94, 95, 96, 122, 123, 125, 135, 136, 137, 138, 141, 147, 148, 287, 288, 290, 294, 297, 302, 303, 304, 315, 352, 354 recognition, xiv, 45, 56, 101, 107, 115, 117, 222, 236, 331, 332, 333, 334, 336, 341, 342, 343, 344, 345, 349, 350, 351, 353, 355 recognition test, 336, 344, 349 recovery, 11, 14, 24, 128, 135, 193, 293, 295, 311 recurrence, 126, 140 redistribution, 223, 228, 239, 254 reduction, 29, 31, 124, 126, 127, 128, 146, 183, 192, 289, 290, 293, 295, 298, 299, 300, 303, 311 reference system, 213 reflexes, 332 regeneration, 183, 302 regression, 202, 246, 335, 336 regression equation, 246 regression method, 246 regulation, 16, 23, 27, 30, 33, 37, 40, 121, 128, 134, 137, 139, 146, 172, 176, 177, 185, 187, 192, 290, 294, 296, 297, 298, 305, 307, 309, 311, 317 regulations, 177 regulators, 143 rehabilitation, 261 relationship, 30, 35, 121, 128, 129, 132, 135, 136, 288, 290, 294, 304 relatives, 220 relaxation, 309 relevance, 39, 84, 195, 338 reliability, 168 REM, 153, 158, 159 repair, vii, 14, 19, 22, 23, 24, 25, 26, 28, 29, 30, 31, 32, 33, 34, 36, 37, 38, 39, 40, 41, 59, 299, 302, 306, 317 reparation, 50 replacement, 109, 193 replication, 21, 22, 24, 29, 31, 32, 37, 38, 39, 41, 163 repression, 37 resection, xii, 267, 268, 270, 272, 274, 275, 279, 281 residual error, 202 residues, 175, 176, 177, 194 resistance, 14, 29, 84, 95, 97, 351

353

resolution, xii, 108, 112, 118, 201, 212, 228, 229, 237, 244, 248, 259, 267, 269, 279 resources, 169, 260 respiration, 25, 26, 321, 322 respiratory, 17 retardation, 35, 183, 184, 220, 333 retention interval, 343 reticulum, 81, 293 retina, 37, 163, 280, 332 retinoblastoma, 22, 31 retroactive interference, 351, 354 retrograde amnesia, 353 rhythm, 153, 159, 238, 251 ribose, 26, 27, 34, 292 ribosome, 311 right hemisphere, 252, 332, 339 risk, 41, 121, 129, 132, 145, 178, 194, 295, 299, 314, 316 risk factors, 178, 262 RNA, viii, 43, 45, 50, 54, 57, 146, 192, 304, 311 rodents, 13, 121, 123, 128, 131 room temperature, 5, 6 Rouleau, 178, 188, 189, 194

S  sadness, 332 salicylates, 308 sample, 295, 313 saturation, 158 school performance, 222, 223, 336 scientific knowledge, 286 sclerosis, ix, x, 20, 80, 119, 121, 129, 131, 142, 144, 148, 171, 173, 179, 180, 185, 186, 188, 189, 192, 194, 195, 214, 286, 292, 297, 310, 314, 315 screening, 222, 259, 317, 333 secretion, 145, 314 sedative medication, 161 seed, 103, 108, 109, 110, 111 segregation, 107, 111 seizure, 126, 127, 134, 135, 136, 139, 140 selectivity, 120, 121, 282, 292 self, 144 self-regulation, 220 semantic memory, 107, 116 sensitivity, 2, 16, 26, 56, 89, 277, 321 sensitization, 125 sensor proteins, 23 serine, 22, 27, 175, 176, 290, 308 Sertoli cells, 318 serum, 3, 6, 14, 185, 317 severity, xii, 132, 285 sex, 346, 348, 349 sex differences, 349

354

Index

sexual dimorphism, 337 shape, x, xiii, 40, 106, 171, 172, 177, 200, 206, 254, 319, 320, 328, 337 shaping, 191 shares, 130 sheep, 86, 97, 163, 169 shock, 182, 186, 293, 311 shoot, 218, 258, 259 shrinkage, 2, 20, 296 siblings, 181, 190 side effects, 121, 130 signal transduction, 23, 24, 307, 312 signaling pathway, 20, 22, 27, 135, 146, 305, 315, 316 signalling, 34, 37, 80, 82, 83, 88 signals, 22, 39, 80, 89, 100, 122, 123, 124, 280, 327, 338 signs, xi, 85, 154, 161, 162, 169, 182, 215, 221, 224, 244, 245, 251, 258 silica, 276, 277, 282 silver, 172 sites, 6, 23, 24, 27, 121, 123, 125, 173, 175, 176, 187, 191, 196, 288, 290 skeletal muscle, 81, 307 small intestine, 121, 309 smooth muscle, 292, 310 smooth muscle cells, 292, 310 smoothness, 204 social withdrawal, 153 socialization, 222 sodium, 5, 46, 94, 130, 143, 282, 283, 288, 290, 291, 302, 303, 306, 308, 310 sodium dodecyl sulfate (SDS), 5 software, 6, 8, 45, 203, 345 somata, 82, 84, 88, 90 Southern blot, 45, 51, 56 Spain, 149, 167 spatial information, 350 spatial learning, 350 spatial memory, 133, 352 specialization, xiv, 331, 332, 336, 337 species, 20, 24, 55, 56, 57, 88, 128, 140, 261, 316, 333, 352 specificity, vii, 1, 290, 292, 301, 312, 317 spectral component, 246 spectrophotometric method, 4 spectroscopy, xii, 96, 114, 216, 253, 260 speech, 263, 332, 336, 337, 338 speech perception, 263 speech processing, 336 speech sounds, 338 speed, 175 spin, 292

spinal cord, 87, 92, 93, 96, 125, 129, 131, 142, 165, 177, 192, 291, 292, 302 spindle, 172 spine, 260, 289 spleen, viii, 43, 45, 47, 53, 54, 55, 58, 121 Sprague-Dawley rats, 272, 353 Spring, 60 stability, 26, 36, 40, 146, 176, 177, 185 stabilization, 34, 177, 289 stages, 14, 15, 133, 289, 307, 313 standard deviation, 202, 205, 335 standard error, 347, 348, 349 status epilepticus, 169 stimulus, 156, 164, 165, 166, 170, 259, 332, 343, 344 stoichiometry, 174, 177 storage, 84, 113, 343, 353, 354 strabismus, xi, xii, 215, 216, 218, 219, 220, 221, 222, 223, 227, 228, 229, 232, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 250, 251, 253, 254, 255, 256, 258, 260, 261, 262, 263, 265 strategies, 302 streams, 107, 112 stress, 20, 28, 30, 36, 37, 39, 40, 41, 189, 190, 290, 293, 297, 298, 305, 308, 312, 315 stretching, 334 striatum, 108, 116, 131, 221, 222, 264 stroke, viii, 20, 34, 39, 79, 80, 85, 91, 94, 95, 127, 128, 129, 142, 275, 287, 295, 297, 300, 302, 310, 312 structural protein, 176, 304 structuring, 257 subarachnoid hemorrhage, 185, 309 subcutaneous injection, xiv, 341, 343, 344, 346 subgroups, 287, 288 substrates, 27, 195, 297, 298, 343 subtraction, 274 succession, 150, 315 Sun, 16, 19, 35, 59, 93, 176, 195 supply, 2, 136 suppression, 29, 33, 123, 128, 154, 216, 217, 218, 220, 221, 228, 243, 251, 252, 258, 261, 289, 294, 300, 308, 313 suprachiasmatic nucleus, 58 surgical resection, 279, 281 surveillance, 169 survival, viii, 2, 4, 7, 20, 37, 39, 41, 83, 87, 89, 94, 98, 128, 130, 142, 163, 186, 262, 289, 318 susceptibility, 86, 88, 97, 140, 141, 142, 181, 193 suspects, 191 suture, 4, 272 swelling, 2, 190, 303 Switzerland, 171, 197

Index symmetry, 248, 327, 329 symptoms, 165, 302 synapse, 16, 140, 166 synaptic plasticity, 96, 172 syndrome, 28, 146, 152, 153, 163, 169, 184, 190, 217, 219, 228, 229, 254, 263, 264, 300, 333 synthesis, 7, 15, 23, 24, 25, 88, 94, 124, 137, 138, 175, 186, 187, 189, 291, 292, 293, 302, 303, 306, 307, 309, 310, 311, 316, 318 systems, 22, 25, 28, 138, 175, 286

T  T cell, 59, 131, 144, 299 T lymphocytes, 17 tachycardia, 158 tactile stimuli, 125 tangles, 36, 132, 181 tantalum, 274, 275, 277, 278 targets, xii, 28, 39, 122, 123, 285, 287 task difficulty, 115 tau, 132, 181, 189, 194, 195 T-cell receptor, 56 TCR, 24, 28 telangiectasia, 22, 27, 28, 30, 34, 36, 38 telencephalon, 287 temperature, 4, 5, 6, 123, 124, 135, 138, 321 temporal lobe, 107, 112, 113, 117, 126, 127, 148, 223, 234, 237, 273, 275, 280, 337 temporal lobe epilepsy, 127, 148, 280 tensile strength, 172, 185 terminals, 108 territory, 91, 270, 275, 279 test data, 349 test scores, 132 testing, xiv, 268, 270, 280, 281, 282, 299, 324, 325, 341, 342, 344, 345, 346, 348 Tetanus, 148 TF, 304, 306 TGF, 34 thalamus, 108, 114, 200, 201, 203, 205, 206, 208, 209, 210, 211 therapeutic agents, 286 therapeutic intervention, viii, 20, 283 therapy, 142, 145, 168, 220, 228, 243, 261, 299, 305, 314 thermoregulation, 138 thinking, 181 threonine, 22, 176, 290 threshold, 125, 127 thrombin, 302 thrombosis, 127 thymus, 51

355

time, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 30, 31, 37, 39, 128, 135, 136, 141, 174, 177, 178, 185, 286, 291, 295, 297, 300, 318 time use, 336 timing, 316 tinnitus, 288, 304 tissue, viii, xii, 4, 5, 11, 27, 30, 36, 43, 44, 45, 46, 52, 53, 54, 55, 56, 59, 60, 80, 82, 86, 91, 92, 96, 118, 123, 125, 128, 138, 192, 198, 199, 200, 203, 255, 269, 270, 272, 275, 276, 278, 279, 280, 283, 285, 286, 293, 294, 296, 300, 306, 314 tissue homeostasis, 296 TNF, 122, 123, 125, 132, 133, 136, 288, 289, 291, 294, 296, 298, 305, 306, 307, 308, 312, 316 TNF-alpha, 306, 312, 316 TNF-α, 132 tones, 351 torticollis, 217 toxic effect, 133 toxicity, viii, 16, 19, 38, 88, 93, 95, 96, 131, 137, 143, 182, 192, 195, 270, 273, 277, 279, 281, 297 toxicology, 279 toxicology studies, 279 toxin, 148, 223, 228, 235, 239 training, xiv, 341, 342, 343, 344, 345, 346, 348, 350, 351, 353, 354, 355 trajectory, 102, 259 transcription, 2, 16, 21, 22, 24, 27, 28, 35, 39, 41, 57, 87, 121, 128, 130, 133, 288, 290, 291, 293, 296, 298, 299, 305, 306, 307, 308 transcription factors, 16, 22, 35, 121, 290, 305 transduction, 23, 24, 187, 307, 312 transformation, xi, 22, 29, 35, 197, 202, 203, 204, 205, 206, 207, 246, 312 transformations, 204, 206, 207, 212 transforming growth factor, 85, 94 transition, 22, 31, 299, 316, 318 translation, 2, 41, 121, 286, 292 translocation, 175, 194, 288, 289, 290, 297, 298, 299, 300, 306, 307, 317 transmission, x, 22, 80, 89, 138, 149, 152, 169, 291 transport, x, 84, 89, 93, 96, 171, 172, 175, 176, 177, 178, 179, 182, 183, 185, 186, 187, 188, 190, 192, 193, 194, 195, 196, 271, 303, 356 trauma, 2, 20, 93, 237, 287, 291, 296 traumatic brain injury, 315 tremor, 130 trial, 139, 144, 299, 313, 317, 353 triggers, 7, 16, 36, 96, 123, 315 tumor, 27, 31, 122, 137, 270, 289, 298, 300, 305, 306, 308, 311, 312, 313, 316, 318 tumor cells, 311, 313 tumor growth, 318

356

Index

tumor metastasis, 312 tumor necrosis factor, 122, 137, 305, 306, 308, 316, 318 tumors, 29, 264, 269, 280, 294, 301, 307, 314, 317, 318 tyrosine, 194, 312

U  UK, 79 ultrasound, 198, 220 umbilical cord, 97 underlying mechanisms, 184 United Kingdom, 169 UV, 5, 21, 22, 272, 276, 308 UV light, 22, 308

V  vagus nerve, 137 validation, 202, 205, 212 values, 7, 8, 10, 12, 31 variations, x, 36, 59, 149, 152, 158, 166, 199, 203, 216, 235, 247, 252, 263 vascular cell adhesion molecule, 289 vascular dementia, 80 vascular occlusion, 276, 279 vasculature, 137, 278 vasoconstriction, 134, 146, 147 vasopressin, 343, 355 VCAM, 289 velocity, x, 171, 176, 183, 222, 236 verbal fluency, 336 vessels, 122, 124, 137, 220, 292 video, 234, 258, 259, 334 video-recording, 234, 258, 259 vision, 212, 213, 222, 259, 260, 263, 264, 283, 332, 334, 336

visual acuity, 333 visual field, xiii, 216, 331, 332, 334, 335 visual stimuli, 222 visual system, 118, 221, 260 visualization, 7, 198, 206, 246, 268, 272, 273, 274, 275, 277, 278 vulnerability, 35, 86, 87, 88, 91, 94, 95, 97, 98, 291, 308, 310

W  waking, 153, 168 water, 3, 4, 5 water diffusion, 102 Wechsler Intelligence Scale, 333 white matter, viii, 79, 80, 82, 85, 91, 92, 93, 94, 95, 96, 97, 98, 100, 102, 109, 112, 113, 116, 117, 118, 154, 166, 167, 168, 184, 198, 199, 233, 257, 258, 268, 272, 273 word recognition, xiv, 331, 336 work, 27, 30, 181, 182, 183, 184, 185, 186 working memory, 107, 116, 338 World Health Organisation, 163

X  X-irradiation, 35, 352 X-ray, 38, 50, 51, 198, 254

Y  yes/no, 101 yield, 134 young adults, 342

Z  zinc, 89, 189, 294 zygomatic arch, 4