Biotechnology in the 21st Century
Biotechnology and Your Health Pharmaceutical Applications
Biotechnology in the 21st Century
Biotechnology on the Farm and in the Factory Agricultural and Industrial Applications
Biotechnology and Your Health Pharmaceutical Applications
Bioinformatics, Genomics, and Proteomics Getting the Big Picture
The Ethics of Biotechnology
Biotechnology in the 21st Century
Biotechnology and Your Health Pharmaceutical Applications
Bernice Schacter
BIOTECHNOLOGY AND YOUR HEALTH Copyright © 2006 by Infobase Publishing All rights reserved. No part of this book may be reproduced or utilized in any form or by any means, electronic or mechanical, including photocopying, recording, or by any information storage or retrieval systems, without permission in writing from the publisher. For information contact: Chelsea House An imprint of Infobase Publishing 132 West 31st Street New York NY 10001 ISBN-10: 0-7910-8519-8 ISBN-13: 978-0-7910-8519-6 Library of Congress Cataloging-in-Publication Data Schacter, Bernice Zeldin, 1943– Biotechnology and your health: pharmaceutical applications/Bernice Schacter. p. cm.—(Biotechnology in the 21st century) Includes bibliographical references and index. ISBN 0-7910-8519-8 1. Pharmaceutical biotechnology. 2. Medical technology. I. Title. II. Series. RS380.S33 2005 615'.19—dc22 2005010397 Chelsea House books are available at special discounts when purchased in bulk quantities for businesses, associations, institutions, or sales promotions. Please call our Special Sales Department in New York at (212) 967-8800 or (800) 322-8755. You can find Chelsea House on the World Wide Web at http://www.chelseahouse.com Text and cover design by Keith Trego Printed in the United States of America Bang 21C 10 9 8 7 6 5 4 3 2 This book is printed on acid-free paper. All links and web addresses were checked and verified to be correct at the time of publication. Because of the dynamic nature of the web, some addresses and links may have changed since publication and may no longer be valid.
Table of Contents Foreword by Dr. Kary B. Mullis Introduction
1 What Is Biotechnology?
ix xxiii 1
2 Natural Products as Drugs
22
3 Large Molecules
34
4 Types of Recombinant Drugs
45
5 Uses for Recombinant Protein Drugs
61
6 Gene Therapy to Treat Disease
83
7 Gene Therapy for Cancer Treatment
96
8 Replacing Cells
106
9 Organ Transplantation
121
10 Lab Tests Using Recombinant Components
130
A History of Biotechnology
145
Glossary
149
Bibliography
163
Further Reading
168
Websites
169
Index
170
Detailed Table of Contents FOREWORD BY KARY MULLIS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . INTRODUCTION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . CHAPTER 1
Mendelian Genetics Stop and Consider
What Is a Gene?
2 2 3 4
Unlocking the Secret of DNA
4
Stop and Consider
7 7
From Gene to Protein
The Biotechnologist’s Toolbox How to Engineer a Gene
8
Connections Reproductive Cloning
10 10 11 12 14 15 16
20 20
8
22 23
Stop and Consider
23
Finding Medicines in Nature
25
FDA Approval of New Drugs Protection of Human Test Subjects
26 27
The Discovery of Antibiotics Who Owns Nature’s Medicine Cabinet? Alexander Fleming and the Discovery of Penicillin Stop and Consider
Connections
28 29 32 33
33
LARGE MOLECULES . . . . . . . . . . . . . . . . . . . . . 34
Innoculation: Medical Breakthrough and Social Fad 34 Vaccination: Less Risky and More Effective 35
The Use of Insulin: Replacing What Is Not Working The Use of Human Growth Hormone The Discovery of Insulin: A Lifesaver Stop and Consider
The Immune System— Our Best Defense
37
Stop and Consider
38
CHAPTER 4
The Polymerase Chain Reaction Delivering the Gene to Its New Home How Does PCR Work? Living Factories Choosing Which Cell to Engineer Cloning Using Whole Animals and Plants
NATURAL PRODUCTS AS DRUGS . . . . . . . . . . . . 22
Natural Cures for Ancient Diseases From Dyes to Drugs
CHAPTER 3
xxiii
WHAT IS BIOTECHNOLOGY? . . . . . . . . . . . . . . . . 1
Developing the Tools and Methods of Modern Biotechnology
CHAPTER 2
ix
Connections Prion Diseases
39 39 40 42
43 43
TYPES OF RECOMBINANT DRUGS . . . . . . . . . . . 45
Protein Factories
45
Bacteria at Work
47
Changing the Bacterium’s DNA
48
Changing the Protein
48
The Shape of Proteins
50
Another Kind of Factory: Producing Sugars
Using Antifreeze to Keep Proteins in the Blood Choosing a Production System The Production of Antibodies Stop and Consider
Different Animals and Different Antibodies Stop and Consider
52
Connections
53 54 55 56 56 58
60
CHAPTER 5
USES FOR RECOMBINANT PROTEIN DRUGS . . . . 61
Pioneers and Medical Advances Replacing Missing Proteins
61 62
for Biotechnology Fair? Treating Hemophilia The Production of New Blood Cells Red Blood Cells and Erythropoietin Helping the Body Fight Infection
CHAPTER 6
64
65 65
Working With Blood Cells
The Human Genome Project
67
Monoclonal Treatments for Cancer
70 72 73
Stop and Consider
83 86 86
Problems with Gene Therapy
89
Stop and Consider
90
Unintended Consequences of Gene Therapy
Connections
74 74 78
78 79 80 81
82
Immune Deficient Children Stop and Consider
Death of a Gene Therapy Volunteer PRO OR CON? Children in Clinical Trials
Stop and Consider
Connections
91 91 92 94 95
95
91
GENE THERAPY FOR CANCER TREATMENT. . . . . 96
Immune-based Cancer Gene Therapy Strategies Stop and Consider
The Use of Antisense
CHAPTER 8
Stop and Consider
Treating Heart Disease Cancer Treatment
74
GENE THERAPY TO TREAT DISEASE . . . . . . . . . . 83
The Ashanti de Silva Case Vectors: Getting Genes Inside Cells
CHAPTER 7
Stop and Consider
Suppressing the Immune Response
PRO OR CON? Are the Prices
The Need to Make Treatments Safe
Immune System Drugs
Cancer: Done in by Genes
98 98 101
Stop and Consider
Connections
102 105
105
REPLACING CELLS . . . . . . . . . . . . . . . . . . . . . 106
Blood Transfusions Stem Cells U.S. Policy on Stem Cell Research
106 110 111
Possibilities of Stem Cell Therapy Challenges That Face Stem Cell Research Stop and Consider
Blood-forming Stem Cells
113
Ethical Arguments
Multitalented Stem Cells
113
Stop and Consider
Stop and Consider
114
Connections
116 117 118 118 119
119
CHAPTER 9
ORGAN TRANSPLANTATION . . . . . . . . . . . . . . 121
Organ Transplant Successes and Failures Taking Organs from Other Animals Organs from Primates Stop and Consider
PRO OR CON? Ethical Issues of
121
Animal-to-Human Transplants Stop and Consider
124
Organs from Non-primates
124 125
Stop and Consider
Connections
126 127 127 129
129
CHAPTER 10 LAB TESTS USING RECOMBINANT COMPONENTS . . . . . . . . . . . . . . . . . . . . . . . 130 Monoclonal Antibody Tests Diagnosing Infections Other Diagnostic Uses Home-based Tests
DNA Sequencing Tests Testing for HIV Tests for Genetic Conditions What Is PCR? Stop and Consider
130 131 131 131
132 132 134 134 136
DNA Provides Clues About Common Illnesses DNA Marker Tests Could the Results of a Genetic Test Be Used to Harm You? How Are Forensic DNA Tests Done? Stop and Consider
The Use of DNA Microarray
Connections
A HISTORY OF BIOTECHNOLOGY. . . . . . . . . . . . . . . . . . 145 GLOSSARY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 149 BIBLIOGRAPHY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 163 FURTHER READING. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 168 WEBSITES. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169 INDEX . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170
137 138 138 139 140 141
144
Foreword The processes that eventually led to life began inside the first
generation of stars that resulted after what astrophysicists refer to as the Big Bang. The events associated with the Big Bang mark the beginning of our universe—a time during which such simple elements as hydrogen and helium were turned by gravitational pressure and heat into carbon, oxygen, nitrogen, magnesium, chlorine, calcium, sodium, sulfur, phosphorous, iron, and other elements that would make the formation of the second generation of stars and their planets possible. The most familiar of these planets, our own planet Earth, would give rise to life as we know it—from cells and giant squids to our own human race. At every step in the processes that led to the rich variety of life on Earth, the thing that was forming in any particular environment was capable of transforming, and did, transform that environment. Especially effective at transformation was that class of things that
x
FOREWORD
we now refer to as replicators. We know of two examples of replicators: genes and memes. (The latter rhymes with “creams.”) Genes and memes exist in cells, tissues, and organs. But memes mostly are in brains, and human religions and civilizations. Near the bottom of the hierarchy it’s all genes and near the top it’s more memes. Genes appeared independently of cells, and are responsible for most of what we call biological life, which can be thought of as a soft and comfortable vehicle made mostly of cells, and created and maintained by the genes, for their efficient replication and evolution. Amazingly, the existence of replicators is all it takes to explain life on Earth; no grand creation, no intelligent design, no constant maintenance; at first just genetic replicators and natural selection, and as far as we know, just one more thing, which appeared after there were human brains big enough to support them: memes. Genes you’ve already heard of; but memes may be a completely new term to you. Memes follow the same rules as genes and their natural selection and evolution account for everything that the natural selection of genes doesn’t. For instance, our brains are almost too large for our upright stance and therefore must somehow answer to a calling other than the mere replication of our genes, which were doing okay without the extra pint of white matter we gained in the last 50,000 years. The striking increase in brain size means something powerful is strongly benefiting from our increased brain capacity. The best explanation for this, according to Richard Dawkins, in his best selling and robustly influential book, The Selfish Gene, is that our brains are particularly well adapted for imitation, and therefore for the replication of memes. Memes are things like words, ideas, songs, religious or political viewpoints, and nursery rhymes. Like genes, they exist for themselves—that is, they are not here to promote us or anything else, and their continued existence does not necessarily depend on their usefulness to anything: only to their fecundity, their ability to copy themselves in a very precise, but inexact way, and their relative
FOREWORD
stability over time. It is these features of genes and of memes that allow them to take part in natural selection, as described by Darwin in 1859, in spite of the fact that he was unaware of the nature of the two replicators. After 150 years, we have started to understand the details. Looking back on it from only a century and a half, Darwin’s conception was probably the most brilliant that mankind has chanced upon in our relatively short time here on Earth. What else could possibly explain dandelions? Dawkins realized that the genes were evolving here, not us. We are just the vessel, and Dawkins realized the significance of replicators in general. After that, the field opened up rather widely, and must include Stan Cohen and Herbert Boyer, whose notion, compounded in 1973 in a late-night deli in Oahu, of artificially replicating specific genes underlies most of the subject matter in this rather important series of books. SO WHAT’S SO IMPORTANT ABOUT GENES AND MEMES?
I’m sure that most of you might want to know a little bit about the stuff from which you are made. Reading the books in this series will teach you about the exciting field of biotechnology and, perhaps most importantly, will help you understand what you are (now pay attention, the following clause sounds trivial but it isn’t), and give you something very catchy to talk about with others, who will likely pass along the information to others, and so on. What you say to them may outlive you. Reading the books in this series will expose you to some highly contagious memes (recall that memes are words, ideas, etc.) about genes. And you will likely spread these memes, sometimes without even being aware that you are doing so. THE BIRTH OF BIOTECHNOLOGY—OAHU 1973
So what happened in Oahu in 1973? Taking the long view, nothing really happened. But we rarely take the long view, so let’s take the view from the 70s.
xi
xii
FOREWORD
At the time, it was widely held that genes belonged to a particular organism from whose progenitors the gene had been passed to an organism and that the organism in question would pass the gene to its offspring, and that’s the only way that genes got around. It made sense. Genes were known by then to carry the instructions for building new organisms out of the germinal parts of old organisms, including constructing a wide array of devices for collecting the necessary raw materials needed for the process from the environment; genes were the hereditary mechanism whereby like begat like, and you looked like your parents because of similar genes, rather than looking like your neighbors. The “horizontal transfer” of genes from one species to another was not widely contemplated as being possible or desirable, in spite of the fact that such transfer was already evident in the animal and plant worlds—think of mules and nectarines. And “undesirable” is putting it rather mildly. A lot of people thought it was a horrible idea. I was a research scientist in the recombinant laboratories of Cetus Corporation in 1980, during which time Cetus management prudently did not advertise the location of the lab for fear that the good people of Berkeley, California (a town known for its extreme tolerance of most things) might take offense and torch our little converted warehouse of a lab. Why this problem in regard to hybrid life forms? Maybe it had something to do with the fact that mules were sterile and nectarines were fruit. Apples have been cultivated in China for at least 4,000 years. The genetic divergence from the parental strains has all been accomplished by intentional cultivation, including selection of certain individuals for properties that appealed to our farming ancestors; and farmers did so without much fanfare. The Chinese farmers were not aware that genes were being altered permanently and that was the reason that the scions from favored apple trees, when grafted onto a good set of roots, bred true. But they understood the result. Better apple genes have thus been
FOREWORD
continually selected by this process, although the process throughout most of history was not monitored at the genetic level. The farmers didn’t have any scary words to describe what they were doing, and so nobody complained. Mules and nectarines and Granny Smith apples were tolerated without anyone giving a hoot. Not so when some educated biologists took a stab at the same thing and felt the need to talk about it in unfamiliar terms to each other, but not the least to the press and the businessmen who were thinking about buying in. There was, perhaps, a bit too much hyperbole in the air. Whatever it was, nobody was afraid of apples, but when scientists announced that they could move a human gene into a bacterium, and the bacterium would go on living and copying the gene, all hell broke loose in the world of biology and the sleepy little discipline of bioethics became a respectable profession. Out of the settling dust came the biotechnology industry, with recombinant insulin, human growth hormone, erythropoietin, and tissue plasminogen activator, to name a few. CETUS IN 1980
The genie was out of the bottle. Genes from humans had been put into terrified bacteria and the latter had survived. No remarkable new bacteremias—that is, diseases characterized by unwanted bacteria growing in your blood—had emerged, and the initial hesitancy to do recombinant DNA work calmed down. Cetus built a P-3, which was something like an indoor submarine, with labs inside of it. The P-3 was a royal pain to get in and out of; but it had windows through which potential investors could breeze by and be impressed by the bio-suited scientists and so, just for the investment it encouraged, it was worth it. Famous people like Paul Berg at Stanford had warned the biotech community that we were playing with fire. It stimulated investment. When nobody died bleeding from the eyeballs, we started thinking maybe it wasn’t all that scary. But there was something in the air. Even the janitors
xiii
xiv
FOREWORD
pushing their brooms through the labs at night and occasional scientists working until dawn, felt that something new and promising was stirring. My lab made oligonucleotides, which are little, short, singlestranded pieces of DNA, constructed from the monomers A, C, T, and G that we bought in kilogram quantities from the Japanese, who made them from harvested salmon sperm (don’t ask me how). We broke these DNA pieces down into little nucleoside constituents, which we chemically rebuilt into 15- to 30-base long sequences that the biologists at Cetus could use to find the big pieces, the genes, that coded for things like interferons, interleukins, and human proteins. We were also talking about turning sawdust into petroleum products. The price of petroleum in the world was over $35 a barrel, if my memory serves me at all, which was high for the decade. A prominent oil company became intrigued with the sawdust to petroleum idea and gave us somewhere between $30 or $40 million to get us started on our long-shot idea. The oil company funding enabled us to buy some very expensive, sensitive instruments, like a mass spectrometer mounted on the backside of a gas chromatograph, now called GCMS. It was possible under very special conditions, using GCMS, to prove that it could be done—glucose could be converted biologically into long chain hydrocarbons. And that’s what gasoline was, and sawdust was mainly cellulose, which was a polymer of glucose, so there you have it. Wood chips into gasoline by next year. There were a few details that have never been worked out, and now it has been a quarter of a very interesting century in which the incentive, the price of oil, is still very painful. My older brother Brent had gone to Georgia Tech as had I. He finished in chemical engineering and I in chemistry. Brent worked for a chemical company that took nitrogen out of the air and methane out of a pipe and converted them into just
FOREWORD
about anything from fertilizer to the monomers needed to make things like nylon and polyethylene. Brent and I both knew about chemical plants, with their miles of pipes and reactors and about a century of good technical improvements, and that the quantities of petroleum products necessary to slake the global appetite for dark, greasy things would not fit easily into indoor submarines. We had our doubts about the cellulose to oil program, but proteins were a different thing altogether. Convincing bacteria, then later yeasts and insect cells in culture, to make human proteins by inserting the proper genes not only seemed reasonable to us but it was reasonable. WE DID IT!
I remember the Saturday morning when David Mark first found an E. coli clone that was expressing the DNA for human beta-interferon using a P32 labeled 15-base long oligonucleotide probe that my lab had made. Sometimes science is really fun. I also remember the Friday night driving up to my cabin in Mendocino County when I suddenly realized you could make an unlimited amount of any DNA sequence you had, even if what you had was just a tiny part of a complex mixture of many DNAs, by using two oligos and a polymerase. I called it Polymerase Chain Reaction. The name stuck, but was shortened to PCR. We were down in a really bad part of town, Emeryville being the industrial side of Berkeley; but we were young and brave, and sometimes it was like an extended camping trip. There were train tracks behind our converted warehouse. You could walk down them during the daytime to an Indian restaurant for lunch, or if you could manage to not be run over by a train late at night while a gel was running or an X-ray plate was exposing, you could creep over across the tracks to the adjacent steel mill and watch white hot steel pouring out of great caldrons. In the evenings, you could go up on the roof and have a beer with the president of the company.
xv
xvi
FOREWORD
Like the Berkeley of the late Sixties which had preceded it, it was a time that would never happen again. Today, nobody would be particularly concerned about the repercussions of transferring a gene out of bacteria, say a gene out of Bacillus thuringiensis inserted into a commercial strain of corn, for instance. Genes now have found a new way to be moved around, and although the concept is not revolutionary, the rate at which it is happening is much faster than our own genes can react. The driver, which is the case for all social behaviors in humans today, is the meme. Memes can appear, replicate, and direct our actions as fast as thought. It isn’t surprising, but it does come as a shock to many people when they are confronted with the undisputed fact that the evolving elements in what we have referred to as biological evolution, which moves us from Homo habilus to Homo sapiens, are genes; not organisms, packs, species, or kinship groups. The things that evolve are genes, selfishly. What comes as an even more shocking surprise, and which in fact is even less a part of the awareness of most of us, is that our behavior is directed by a new replicator in the world, the meme. YOU MAY WANT TO SKIP THIS PART (Unless You’re Up for Some Challenging Reading)
Let’s digress a little, because this is a lot of new stuff for some people and may take a few hours to soak in. For starters, what exactly is a gene? . . . Atgaagtgtgccgtgaaagctgctacgctcgacgctcgatcacctggaaaaccctggtag . . . could be the symbol for a gene, a rather short gene for our editorial convenience here (most of them have thousands of letters). This rather short gene would code for the peptide met-lys-cys-ala-val-lys-gly-gly-thr-leu-aspala-arg-ser-pro-gly-lys-pro-trp, meaning that in a cell, it would direct the synthesis of that string of amino acids, (which may or may not do something very important).
FOREWORD
Getting back to the gene, it may share the organism as an environment favoring its replication with a whole gang of other replicators (genes), and they may cooperate in providing a comfy little protected enclave in which all of the genes develop a means to replicate and cast their sequences into the future all using the same mechanism. That last fact is important as it separates a cellular gene from a viral gene, but I won’t belabor it here. Reviewing just a little of what I’ve infected you with, that sequence of AGCT-type letters above would be a replicator, a gene, if it did the following: (1) exhibited a certain level of fecundity—in other words it could replicate itself faster than something almost like it that couldn’t keep up; (2) its replication was almost error-free, meaning that one generation of it would be the same as the next generation with perhaps a minor random change that would be passed on to what now would be a branch of its gene family, just often enough to provide some variation on which natural selection could act; and (3) it would have to be stable enough relative to the generation time of the organism in which it found itself, to leave, usually unchanged, with its companion genes when the organism reproduced. If the gene goes through the sieve of natural selection successfully, it has to have some specific identity that will be preserved long enough so that any advantage it confers to the rate of its own replication will, at least for some number of generations, be associated with its special identity. In the case of an organic replicator, this specialness will normally be conferred by the linear sequence of letters, which describe according to the genetic code, a linear
xvii
xviii
FOREWORD
sequence of amino acids in a peptide. The process is self-catalytic and almost irreversible, so once a sequence exhibits some advantage in either (1), (2), or (3) above, all other things being nearly equal, it is selected. Its less fortunate brethren are relatively unselected and the new kid on the block takes over the whole neighborhood. See how that works? This should not be shocking to you, because it is a tautology, meaning it implies nothing new. Some people, however, are accustomed to the notion that genes and individual organisms serve the greater good of something they call a species, because in the species resides an inviolate, private gene pool, which is forever a part of that species. This concept, whether you like it or not, is about as meaningful—and now I guess I will date myself—as the notion that Roger Waters is forever and always going to be playing with Pink Floyd. It isn’t so. Waters can play by himself or more likely with another group. So can genes. And don’t forget that not only genes, but also an entirely different kind of replicator is currently using our bodies as a base of operations. Genes have a reaction time that is slow relative to the lifetime of an individual. It takes a long time for genes to respond to a new environment. Memes can undergo variation and selection at the speed of thought. Let’s leave the subject of memes for awhile. They are an immense part of every human now, but biotechnology as practiced in the world and described in this book does not pay them much mind. Biotechnologists are of the impression that their world is of genes, and that’s alright. A whole lot happened on Earth before anybody even expected that the place was spinning and moving through space, so memes can wait. I thought I ought to warn you. It is worth noting that new gene sequences arise from preexisting gene sequences but gene molecules are not made out of old genes. Gene molecules are made out of small parts that may have been in genes before, but the atoms making up the nucleotides that
FOREWORD
are strung together and constitute today’s incarnation of a gene, may have two weeks ago been floating around in a swamp as urea or flying out of a volcano as hot lava. A gene sequence (notice that molecule is not equal to sequence) that makes itself very useful may last millions of years with hardly a single change. You may find precisely the same gene sequence in a lot of very different species with few significant changes because that sequence codes for some protein like cytochrome C that holds an iron atom in a particularly useful way, and everybody finds that they need it. It’s a more classic design than a Jaguar XK and it just keeps on being useful through all kinds of climatic eras and in lots of different species. The sequence is almost eternal. On the very different other hand, the specific molecular incarnations of a gene sequence, like the DNA molecule that encodes the cytochrome C sequence in an individual cell of the yeast strain that is used, for example, to make my favorite bread, Oroweat Health Nut, is ephemeral. The actual molecules strung together so accurately by the DNA polymerase to make the cytochrome C are quickly unstrung in my small intestine as soon as I have my morning toast. I just need the carbon, nitrogen, and phosphorous. I don’t eat it for the sequence. All DNA sequences taste the same, a little salty if you separate them from the bread. That’s what happens to most chemical DNA molecules. Somebody eats them and they are broken down into general purpose biological building blocks, and find their way into a new and different molecule. Or, as is often the case in a big organism like Arnold Schwarzenegger, body cells kill themselves while Governor Schwarzenegger is still intact because of constantly undergoing perfectly normal tissue restructuring. Old apartments come down, new condos go up, and beautiful, long, perfectly replicated DNA sequences are taken apart brick by brick. It’s dangerous stuff to leave around on a construction site. New ones can be made. The energy just keeps coming: the sun, the hamburgers, the energy bars.
xix
xx
FOREWORD
But the master sequences of replicators are not destroyed. Few germ cells in a woman’s ova and an embarrassingly large number of germ cells in a male’s sperm are very carefully left more or less unaltered, and I say more or less, because one of the most important processes affecting our genes, called recombination, does alter the sequences in important ways; but I’m not going to talk about it here, because it’s pretty complicated and this is getting to be too long. Now we are ready to go back to the big question. It’s a simple answer, but I don’t think you are going to get it this year. If . . . atgaagtgtgccgtgaaagctgctacgctcgacgctcgatcacctggaaaaccctggtag . . . is a gene, then what particular format of it is a gene? For this purpose, let’s call it a replicator instead of a gene, because all genes are after all replicators. They happen to encode protein sequences under certain conditions, which is one of our main uses for them. As I’ve mentioned, the one above would code for the protein met-lys-cys-ala-val-lys-gly-gly-thr-leu-asp-ala-arg-serpro-gly-lys-pro-trp with the final “tag” being a punctuation mark for the synthesis mechanism to stop. We make other uses of them. There are DNA aptamers, which are single-stranded DNA polymers useful for their three-dimensional structures and ability to specifically cling to particular molecular structures, and then there is CSI, where DNA is used purely for its ability to distinguish between individuals. But replication for the genes is their reason for being here. By “reason for being here,” I don’t mean to imply that they are here because they had some role to fulfill in some overall scheme; I just mean simply that they are here because they replicate—it’s as simple or impossible to understand as that. Their normal way of replication is by being in their molecular form as a double stranded helical organic polymer of adenosine, guanosine, thymidine, and cytosine connected with phosphate linkages in a cell. Or they could be in a PCR tube with the right mixture of nucleoside triphosphates, simple inorganic salts, DNA polymerase, and short strands of singlestranded DNA called primers (we’re getting technical here, that’s
FOREWORD
why you have to read these books). Looking ahead, DNA polymerase is a molecular machine that hooks the triphosphate form of four molecular pop beads called A, C, T, and G together into long meaningful strings. Okay, getting back to the question, is the gene, . . . atgaagtgtgccgtgaaagctgctacgctcgacgctcgatcacctggaaaaccctggtag . . . always the organic polymer form of the sequence, which has a definite mass, molecular weight, chemical structure, or is the Arabic letter form of it in your book still a gene, or is the hexadecimal representation of it, or the binary representation of it in your CPU a gene, or is an equivalent series of magnetic domains aligned in a certain way on your hard disk just another form of a gene? It may sound like a dumb question, but it isn’t. If you are insistent that a gene is just the organic polymer of A, C, T, and G that can be operated on by DNA polymerase to make replicas in a cell, then you may take a minute to think about the fact that those little triphosphate derivatives of A, C, T, and G may not have been little nucleotides last month when they were instead disembodied nucleotide pieces or even simple atoms. The atoms may have been residing in things called sugars or amino acids in some hapless organism that happened to become food for a bigger organism that contained the machinery that assembled the atoms into nucleotides, and strung them into the sequence of the gene we are talking about. The thing that is the same from generation to generation is the sequence, not the molecule. Does that speak to you? Does it say something like maybe the symbol of the gene is more the gene than the polymer that right now contains it, and the comprehensive symbolic representation of it in any form at all is a replicator? This starts to sound pretty academic, but in any biotechnology lab (and you will read about some of them in this series) making human proteins to sell for drugs, the genes for the proteins take all the above mentioned forms at one time or another depending on what is appropriate, and each of them can
xxi
xxii
FOREWORD
be reasonably called a replicator, the gene. Genetic engineering is not just the manipulation of chemicals. SKIP DOWN TO HERE
These books are not written to be the behind the scenes story of genes and memes any more than a description of an integrated circuit for someone who wants to use it in a device for detecting skin conductivity or radio waves is about quantum mechanics. Quantum mechanics is how we understand what’s happening inside of a transistor embedded in an integrated circuit in your iPod or described in the Intel catalogue. By mentioning what’s going on inside biotechnology, I hope to spark some interest in you about what’s happening on the outside, where biotechnology is, so you can get on about the important business of spreading these memes to your friends. There’s nothing really thrilling about growing bacteria that make human hormones, unless your cousin needs a daily injection of recombinant insulin to stay alive, but the whole process that you become involved in when you start manipulating living things for money or life is like nothing I’ve found on the planet for giving you the willies. And remember what I said earlier: you need something to talk about if you are to fulfill your role as a meme machine, and things that give you the willies make great and easily infectious memes. Lowering myself to the vernacular for the sake of the occasional student who has made it this far, “Biotech is far out man.” If you find something more interesting, let me know. I’m at
[email protected], usually. Dr. Kary B. Mullis Nobel Prize Winner in Chemistry, 1993 President/Altermune, LLC
Introduction BIOTECHNOLOGY: AN INTRODUCTION
Biotechnology, the use of biological organisms and processes to
provide useful products in industry and medicine, is as old as cheese making and as modern as creating a plant-based energy cell or the newest treatment for diabetes. Everyday, newspaper articles proclaim a new application for biotechnology. Often, the media raises alarms about the potential for new kinds of biotechnology to harm the environment or challenges our ethical values. As a result of conflicting information, sorting through the headlines can be a daunting task. These books are designed to allow you to do just that—by providing the right tools to help you to make better educated judgments. The new biotechnologies share with the old a focus on helping people lead better, safer, and healthier lives. Older biotechnologies, such as making wine, brewing beer, and even making bread, were
xxiv
INTRODUCTION
based on generations of people perfecting accidental discoveries. The new biotechnologies are built on the explosion of discoveries made over the last 75 years about how living things work. In particular, how cells use genetic material to direct the production of proteins that compose them, and provide the engines used to produce energy needed to keep them alive. These discoveries have allowed scientists to become genetic engineers, enabling them to move genes from one living organism to another and change the proteins made by the new organism, whether it is a bacterium, plant, mouse, or even a human. Biotechnologists first engineered bacterial cells, producing new proteins useful in medicine and industry. The type of cell that biotechnologists engineer today may be a simple bacterium or a complicated animal or human cell. The protein product might be a simple string of amino acids or a complicated antibody of four chains, with critical genetic instructions from both mice and humans. Plant biotechnologists engineer plants to resist predatory insects or harmful chemicals to help farmers produce more, with less risk and expense. Plants have also been engineered to make products useful for industry and manufacturing. Animals have been engineered for both research and practical uses. Research is also underway to develop methods of treating human diseases by changing the genetic information in the cells and tissues in a patient’s body. Some of these efforts have been more successful than others and some raise profound ethical concerns. Changing the genetic information of a human may one day prevent the development of disease, but the effort to do so pushes the envelope of both ethics and technology. These and other issues raised by advances in biotechnology demand that we as citizens understand this technology, its promise, and its challenge so that we can provide appropriate limits on what biotechnologists create. Who are the biotechnologists, the genetic engineers? Generally, they have university or advanced training in biology or chemistry.
INTRODUCTION
They may work in a university, a research institute, a company, or the government. Some are laboratory scientists trained in the tools of genetic engineering–the laboratory methods that allow a gene for a particular protein to be isolated from one living creature’s DNA and inserted into another’s DNA in a way that instructs the new cell to manufacture the protein. Some are computer scientists who assemble databases of the DNA and protein sequences of whole organisms. They may write the computer code that allows other scientists to explore the databases and use the information to gain understanding of evolutionary relationships or make new discoveries. Others work in companies that engineer biological factories to produce medicines or industrial plastics. They may engineer plants to promote faster growth and offer better nutrition. A few have legal training that allows them to draft or review patents that are critical to the business of biotechnology. Some even work in forensic laboratories, processing the DNA fingerprinting you see on TV. The exact number of working biotechnologists is hard to determine, since the job description doesn’t neatly fit into a conventional slot. The U.S. Department of Labor indicates that there are over 75,000 Master’s and Ph.D.-level biologists in the U.S. and Bio.org, the Website for the Biotechnologies Industry Organization, reports nearly 200,000 biotechnologists are currently employed. Biotechnology is not just the stuff of the future. The work of modern biotechnology and genetic engineering is in our daily lives, from the food we eat and clothing we wear to some of the medicines we take. The ketchup you put on your fries at lunch today may have been sweetened with corn syrup made from corn that was engineered to resist a deadly insect. The cotton in your T-shirt, even if the shirt were made in China or Bangladesh, probably came from a U.S. cotton plant genetically engineered to resist another insect. If someone in your family is a diabetic, the insulin he or she injects and the glucose test monitor used to determine the amount of
xxv
xxvi
INTRODUCTION
insulin to inject rely on biotechnology. If you go to the doctor and she arranges for blood tests, the laboratory uses biotechnology products to run those tests. This series, BIOTECHNOLOGY IN THE 21ST CENTURY, was developed to allow you to understand the tools and methods of biotechnology, and to appreciate the current impact and future applications of biotechnology in agriculture, industry, and your health. This series also provides an exploration of how computers are used to manage the enormous amount of information produced by genetic researchers. The ethical and moral questions raised by the technology, whether they involve changing the genetic information of living things or using cells from human embryos to develop new ways to treat disease, are posed with a foundation in how moral philosophers think about ethical issues. With these tools, you will be better able to understand the headlines about the latest advances in biotechnology and the alarms raised by those concerned with the impact that these applications have on the environment and our society. You may even be inspired to learn more and join the community of scientists who work on finding new and better ways to produce food, products, and medical treatments. Bernice Zeldin Schacter, Ph.D. Series Editor
1 What Is Biotechnology? Biotechnology, in its most general meaning, is the use of biologic
processes to create a product for human use and benefit. Today, when people use the term biotechnology, we usually think they mean the application of modern methods of manipulation of DNA (deoxyribonucleic acid), the genetic information of an organism, to make a product. In fact, biotechnology is ancient, providing the basis for making a wide range of products, including bread, cheese, beer, and wine. These early forms of biotechnology relied on fermentation, the breakdown by microorganisms of organic molecules, particularly sugars, into simpler compounds, often CO2 (carbon dioxide). In practice, fermentation involves holding the material under conditions that allow the microorganisms to increase in number, and to change the original material through chemical reactions inside the cells. The starting material in fermentation can be bread dough, made of flour, water, and yeast, or grape juice plus yeast.
1
2
BIOTECHNOLOGY AND YOUR HEALTH
To make bread, after the dough is kneaded to make the gluten (flour protein) stringy, the dough is kept at a warm temperature to allow the yeast cells to multiply in number. The yeast cells need energy to grow, so they break down sugars in the flour to CO2, creating pockets of gas. This gas makes the dough rise. When the bread is baked, the gluten dries out and the bread is filled with many small holes. Wine makers grow yeast submerged in liquid grape pressings. This deprives the yeast of oxygen so that it produces ethanol as a waste product when it metabolizes sugar. A slightly more complicated process is used to make beer, but the principle also involves growing yeast cells without oxygen so that they produce ethanol as they make energy. Cheese is also made through biotechnology. Rennin, a protein found in the stomachs of young cows, is added to milk to make cheese. (Today, rennin is usually made with modern biotechnology methods.) The rennin breaks down casein, the major protein of milk, into small pieces. Then, cheese makers add bacteria to milk to convert (ferment) the lactose sugar in the milk to acid, which causes the casein fragments to curdle, making them form semi-solid lumps. The flavor of cheese becomes more intense as it ages, and the flavors concentrate. Adding certain molds during the aging process turns cheese blue in color. DEVELOPING THE TOOLS AND METHODS OF MODERN BIOTECHNOLOGY Mendelian Genetics
Modern biotechnology, defined as the movement and modification of genes at will, was built on discoveries in genetics and biochemistry originally made in the first half of the 20th century. Scientists learned that inherited characteristics or traits, such as hair or eye color, are passed from parents to offspring in units of inheritance called genes. You may have learned how an Austrian monk named
What Is Biotechnology?
Gregor Mendel figured this out in the late 19th century by carefully conducting breeding experiments with peas. However, his work was not noticed until 34 years later, when several scientists came upon his papers and realized the importance of his discoveries. Building on Mendel’s findings, scientists studied plants, animals, and humans, and determined several things: 1) genes are carried on chromosomes, structures in the cell’s nucleus; 2) genetic information resides in the chemicals that make up the chromosomes; and 3) traits are generally based directly or indirectly on the proteins produced in cells. Stop and Consider It took 34 years for biologists to appreciate Gregor Mendel’s work on the genetics of peas. Does it surprise you that something that now seems like a profound discovery was not immediately recognized? What do you think keeps people, even scientists, from understanding the importance of a discovery when it is first made?
Proteins (also called polypeptides) are composed of one or more linear chains of amino acids. There are 20 different amino acids that share a common structure, with side chain groups that vary in size, shape, charge, chemical reactivity, and solubility in water. Proteins can be small (made up of just a few amino acids) or very large (composed of thousands of amino acids). The biochemical properties, three-dimensional shape, and function of each protein primarily result from the sequence of the amino acids that make up the particular protein. Proteins do many things: they provide structure, allow cells and whole organisms to move, and permit cells to produce and break down all kinds of chemicals to gain nutrition and energy. In complex organisms such as animals, plants, and insects, many proteins travel around the body to carry gases for respiration (breathing) and to carry signals between and among cells
3
4
BIOTECHNOLOGY AND YOUR HEALTH
in different parts of the body. The production of different proteins by cells is what gives each cell its properties and the organism as a whole its traits. The human body produces more than 70,000 different proteins; a single liver cell has approximately 10,000 different proteins. Within every cell of every organism, the integrated, finely orchestrated functioning of these proteins, both separate and together, is central to life. What Is a Gene?
To figure out how genes work and how they direct the production of specific proteins that allow organisms to inherit traits, scientists started with the fact that chromosomes were known to be made up of protein and DNA. A series of experiments using bacteria and viruses that infect bacteria established that DNA, not protein, was the basic genetic material. Scientists figured out how DNA “worked” as the genetic material, how it was copied when a cell divided into two identical cells, and how DNA determined traits—that is, determined the sequence of amino acids in each protein that allow different traits to be expressed. DNA molecules are chains of four bases: adenosine (A), cytosine (C), guanine (G), and thymine (T). Each of these bases is slightly different from the others in its chemical makeup. Figuring out the structure of DNA provided the clues to how DNA worked to transmit genetic information (Figure 1.1). UNLOCKING THE SECRET OF DNA
In 1962, James Watson, Francis Crick, and Maurice Wilkins won the Nobel Prize in Physiology or Medicine for their discovery that the structure of DNA is a double helix. This double helix is made up of two chains of DNA bound to each other by the ability of each A base to form a weak chemical bond to a T base and each C to a G. The bases only paired with their base partners, so that where one strand had a T, the other had an A, and where one had a C, the other had
What Is Biotechnology?
Figure 1.1 The structure of DNA is illustrated here. DNA is the genetic
material of the cell. Through the processes of transcription and translation, the DNA sequence is used to produce first an RNA copy of the gene and then a protein based on the gene sequence.
5
6
BIOTECHNOLOGY AND YOUR HEALTH
a G. This rule of base pairing means that when the strands separate before a cell divides into two, the DNA is copied precisely, because a T in one strand lines up with an A for the new strand, an A lines up with a T, and so on. The bases A and T, as well as C and G, are called complementary bases because they form pairs easily. In the 1960s, scientists developed methods that allowed them to figure out the order, or sequence, of bases in a DNA molecule. The methods have been modified over the years so that machines can now do much of the work, but the principle remains the same. The sequencing method requires:
• The piece of DNA to be sequenced; • DNA polymerase, a protein that can make a copy of a strand of DNA in a test tube;
• the four different bases; • chemically modified versions of bases that, when added to the strand, stop more bases from being added; and
• a short piece of DNA with a base sequence that complements the sequence at the beginning of the piece of DNA to be sequenced. (This bit of DNA is called a primer, and it tells the DNA polymerase where to start adding bases.) The DNA, the primer, and the four bases are placed in four test tubes. The primer is chemically tagged with dye. Then, a chemically modified version of one base—A, T, C, or G—is added to each test tube. The reaction is started with the addition of DNA polymerase. In each tube, sets of DNA strands, complementary to the DNA to be sequenced, are made. Synthesis of a strand stops when, at random, the modified form of the base is added. There are millions of copies of the DNA to be sequenced in each tube, and at the end of an hour or so, there are millions of copies of strands, each stopped
What Is Biotechnology?
when a modified base is added. At the end of the process, each tube (the A, T, C, and G tubes) will contain a mixture of many copies of different-sized products, the length of each determined by the location of that base. Each reaction mixture is injected into a tube filled with a plastic-like material that separates the DNA pieces by size. The size of the fragments flowing out of the four tubes is “read” by a machine that picks up the dye molecule of the primer. Computer programs interpret the results and generate the sequence by analyzing which base is added, as the products of the four tubes get longer, base by base. Stop and Consider Moving genes from one species to another is distasteful to some people because it allows genetic changes to occur outside the natural mating processes. What are your opinions on this issue? Would they be influenced by the planned use of a particular biotechnology product?
From Gene to Protein
Genes are composed of the sequence of As, Ts, Cs, and Gs that the cell decodes to make up a protein. The code for each of the 20 amino acids is a particular triplet of bases. When a cell manufactures a protein, intermediate copies of the gene sequence are made, in the form of messenger ribonucleic acid (mRNA), and these copies move to the ribosomes, the protein-manufacturing structures of the cell. In the ribosome, the code is read from the triplets of RNA bases that specify the amino acids. RNA is composed of four bases that are slightly different chemically from the bases of DNA. The sugar portions of the DNA bases have one less oxygen atom than the RNA bases do. Amino acids are shuttled to the ribosome and lined up by another type of RNA called transfer RNA (tRNA). For each amino acid, a specific tRNA, carrying the base sequence that complements
7
8
BIOTECHNOLOGY AND YOUR HEALTH
the triplet code for that amino acid, lines up the amino acid by base pair formation with the mRNA on the ribosome. A cell protein then connects the amino acids lined up by the mRNA. In this way, the sequence of bases, taken in threes, determines the sequence of a protein. A gene is thus the sequence of DNA bases that codes for a protein. The sequence of bases (the order of As, Ts, Cs, and Gs) in a gene or a whole organism can provide useful information, including details that are needed to move a gene from one organism to another, and insight into how the cell decides to make the protein encoded in the DNA and how the cells in an organism work together. The sequence even provides clues about how different organisms are related in evolution. Modern biotechnology is only one way that scientists are using this information, and the healthcare applications described in this book are only one part of modern biotechnology. Before we dive into the ways biotechnology can be applied to your health, we have to become familiar with the “biotechnologist’s toolbox.” THE BIOTECHNOLOGIST’S TOOLBOX How to Engineer a Gene
The essential task of modern biotechnology is to change an organism’s genetic material (DNA) to allow for the production of a useful protein. The gene for the protein must first be isolated and engineered so that it will drive production of the protein. The product may be the protein, or it may be a modified organism, such as a bacterium that cleans up oil spills, a tree that removes mercury from contaminated soil, or a virus that treats cancer. To isolate a gene, scientists use surgical DNA “scissors” called restriction endonucleases (RE), proteins made by bacteria that cut DNA, based on specific rules. Each kind of RE—there are hundreds— recognizes specific sequences of 4–8 base pairs and cuts the DNA molecule at a specific spot (Figure 1.2). The biotechnologist selects
What Is Biotechnology?
9
Figure 1.2 The restriction enzyme ECOR1, illustrated here, is one of hundreds isolated from bacteria and used by biotechnologists to cut DNA molecules so that they can be joined with other DNA molecules. This allows scientists to insert a desired genetic sequence into a strand of DNA.
the RE based on the sequence of the DNA at each end of the gene. Many REs make staggered cuts that leave a single-stranded tail of DNA at each end of the cut piece, which can bind, through the rules of base pairing, to DNA fragments of other sequences cut by the same RE.
10
BIOTECHNOLOGY AND YOUR HEALTH
The Polymerase Chain Reaction
To prepare a gene for engineering, the scientist generally needs many millions of identical copies of the gene. Originally, the only way to get these copies was to start with a large number of cells or a large piece of tissue, to use chemicals to extract and purify the DNA, and then to treat the DNA with an RE to clip the desired gene. Today, there is a much faster way to copy the same piece of DNA. In the mid-1980s, American chemist Kary Mullis developed a method that could make many copies of a stretch of DNA, even when the scientist knew only the sequence of bases at either end of the strand. This technique, called the polymerase chain reaction (PCR), which won Mullis the Nobel Prize in Chemistry in 1993, has become a routine tool used in just about every research, hospital, and criminal evidence laboratory that works with DNA. It allows usable amounts of identical DNA molecules to be produced from a small sample, about the amount found in just a few cells. Once the gene has been isolated, the next step is to join it to a molecular “on-switch,” a sequence of DNA that will allow the cell to use the gene to make the desired protein. The on-switch, called a promoter, is matched to the type of cell that will be used for production. Delivering the Gene to Its New Home
The next challenge is to get the desired gene into the new cell. The target cell may be a bacterium, a yeast cell, or a cell from an insect, plant, or mammal. Scientists use delivery systems, called vectors, suited for the cell type, to get the combination of gene and promoter (sometimes called a “cassette”) into the target cell, so that DNA will be copied each time the cell divides. The most commonly used vector to get a gene into bacteria is a plasmid, a small circular piece of DNA that is copied every time the bacterium divides into two, though it does not become part of the bacterial DNA. Plasmids have been developed that work as vectors for yeast, plant, and mammal cells.
What Is Biotechnology?
How Does PCR Work? The DNA isolated from cells, or from another source, is combined with primers and with DNA polymerase, a protein that copies the DNA between the primers. The trick is to use
a DNA polymerase that can withstand high temperatures. Taq polymerase, widely used in PCR, was isolated from a bacterium, Thermos aquaticus, discovered growing in a hot spring. With 20 to 30 repeated cycles of heating to separate the strands of DNA, and then cooling to allow the primers to bind and the DNA polymerase to copy the region between the primers again, enough DNA for analysis is made from the sample. Twenty-three cycles will generate 2,097,152 copies of the original sequence (Figure 1.3). This ground-breaking technique for making multiple copies of DNA in a test tube was invented in the 1980s by Kary Mullis, a biochemist. Mullis’ revolutionary technique earned him a Nobel Prize in Chemistry in 1993.
Figure 1.3 Polymerase chain reaction, or PCR, allows scientists to produce many exact copies of a piece of DNA. The process is illustrated here.
11
12
BIOTECHNOLOGY AND YOUR HEALTH
Viruses are natural vectors that take over cells and make them into
virus-producing factories, a process that often kills the cell. Some viruses have been used as vectors for biotechnology after their genetic information has been changed to remove the instructions that permit the production of full-fledged new viruses. There are bacterial viruses called bacteriophage that can be used as genetic engineering vectors— that is, after they have been modified to make them useful but not harmful to the bacteria. To insert the gene cassette into the vector, the vector DNA is cut with a matching RE that creates sticky ends so that it will accept the gene and promoter. Another protein called DNA ligase is used to rejoin, or stitch up, the pieces of DNA, joining the cut ends. All that is left to be done is to add the engineered vector to a group of the bacteria, yeast, or other cells that have been treated to make their outside membrane porous enough to allow the plasmid or other vector DNA to enter. At this point, the cell has been engineered to make the desired product (Figure 1.4). How can scientists tell that the cell has been successfully engineered? It is possible for mistakes to occur. Some of the RE-clipped pieces may not have lined up at the correct spot, or may have lined up with each other, but the scientists are prepared for this. In addition to the product gene and its on-switch, the scientists include a gene for a protein that would make the engineered cell stand out. This may be a gene for a protein that breaks down an antibiotic, or a gene for a protein that makes the cells give off fluorescent light. Whatever type of gene is used, the protein produced by the extra gene lets scientists distinguish cells that were successfully changed from those that were not. Now scientists have cultures of engineered cells that can be grown to large numbers and make the desired protein. Living Factories
Every cell—whether bacterium, yeast, plant, insect, or human—is a protein factory, among other things. Cells produce the proteins for
What Is Biotechnology?
Figure 1.4 Engineering of a bacterium with a plasmid vector is a useful
technique in biotechnology. Restriction enzymes are used to cut both foreign DNA and plasmid DNA, which are then joined together using DNA ligase and inserted into bacteria. The bacteria can then reproduce, expressing the modified DNA.
13
14
BIOTECHNOLOGY AND YOUR HEALTH
their membranes, the proteins wrapped around their DNA to protect and control which proteins are made from its instructions, the enzyme proteins that transform raw food materials into energy to keep the cell alive, and the proteins needed to build a new cell when one cell divides into two. Eukaryotic cells, cells that have a nucleus, must also make the proteins for the membrane of their nucleus, the sack containing their genetic material, with its proteins split into the bits called chromosomes. Eukaryotic cells of all sorts—yeast, plant, animal, and human—make the proteins for their little energy factories called mitochondria, and plant cells make the proteins for the chloroplasts, the energy factories that capture light and transform it into chemical energy so the plant cell can make proteins and carbohydrates. In complex creatures like animals, plants, insects, and even some worms with many different kinds of cells, the cells are unique because they make different proteins. To make a simple comparison, liver cells make proteins to help break down food, but liver cells do not grow hair. The cells that grow hair make different proteins. Choosing Which Cell to Engineer
Genetic engineers must decide into which cell they will insert their gene—a choice that depends on the protein product, its intended use, and costs. Bacterial cells are less expensive to grow in large numbers for production of a protein, but as we shall see, human and other eukaryotic cells, unlike bacterial cells, attach sugar molecules to the proteins they make, and this difference may be important for how the body handles a protein or for how well the protein works. It is expensive to grow large numbers of human or animal cells to manufacture a protein, and it may be tricky. Small changes in growing conditions—such as temperature, acidity of the broth, and vitamins or hormones in the broth—may change the size, shape, or amount of the protein made by the cells. Researchers are exploring the use of insect cells to produce protein drugs and the use of viruses that infect insect cells as vectors.
What Is Biotechnology?
Cloning Genes
Cloning a gene means making copies of the same DNA sequence. As described above, this can be done with PCR. Another way scientists clone DNA is to insert it into a plasmid with RE, use the plasmid to transform a bacterial culture, grow a large number of modified bacteria, extract the DNA, and then clip it back out with the appropriate RE. Cells
For most uses, and particularly for use as a drug, a protein must be consistent, so that every molecule in the bottle is just like every other molecule. An important method used to increase the odds that every protein in the bottle is identical is to make sure that the cells producing the protein—whether bacteria, animal, or human—are identical with the gene cassette in the same place in the cell’s genetic material. The process of producing a culture of identical cells descended from a single common ancestor is also called cloning. Whether the cells are bacterial, yeast, plant, animal, or human, the principle of creating a culture of genetically identical cells is the same: First, scientists need the mixture of the cells with a known concentration and a little plastic tray with a set of small wells, each able to hold about 1/100th of a liter. Then, the scientists will:
• dilute the mixture of cells so that when he or she delivers a 1/100th of liter to each well in a plastic culture plate, by chance each well will receive no more than one cell; and
• provide the needed temperature and nutrients in the culture wells so that each cell divides repeatedly. Every cell in each resulting individual culture will be genetically identical, though the cultures may be different from each other. Then the scientists test a sample from each well to see which ones
15
16
BIOTECHNOLOGY AND YOUR HEALTH
are producing the desired protein. Now they have sets of cloned cells that can be increased in number to create large amounts of the desired protein product. Using Whole Animals and Plants
Since the 1950s, scientists have been able to clone plants. You may have cloned a carrot or onion plant in school, meaning that you isolated a single cell from the root of an onion or carrot and grew it, first in liquid in a dish to which you added nutrients to allow the cells to increase in number, and then in plant hormones that made the clump of cells develop into an entire plant with roots, stem, and all. Because you started with a single cell, you cloned the plant, and your cloned plant was genetically identical to the plant that provided the starting cell. If you had transformed it by engineering for a new protein in the gene before you put that cell in the culture dish, you could have created a set of genetically engineered plants able to produce the new protein. The vectors used for plants have to suit the plant. One vector used for many plants is a plasmid from a bacterium that causes a large growth, called a crown gall, in plants (Figure 1.5). You may see these large masses on trees. To insert a gene into a plant susceptible to the bacteria, scientists first remove the genetic information from the plasmid that causes the large growths, and replace it with the genetic information for the desired protein. The plasmid is then put back into the bacteria, and the plant cells are infected. Some plants cannot be infected with the crown gall bacteria, so the genetic information has to be delivered another way. One common method is to a use a gene-gun, a device that “shoots” tiny metal spheres that are covered with the genetic information into plant cells. Animals
Researchers have also inserted foreign genetic information into mice, rats, chickens, pigs, and sheep. An animal whose genetic information
What Is Biotechnology?
Figure 1.5 The tree in this picture has Crown Gall disease, which is
caused by a bacterium that carries a plasmid used for genetic engineering of some plants.
17
18
BIOTECHNOLOGY AND YOUR HEALTH
has been modified to carry a new, foreign gene is called a transgenic animal. There are two ways to make transgenic mice. Both use a cassette of the desired gene in an appropriate vector. One method, first successfully attempted in mice in the 1970s, uses newly fertilized eggs. The researchers use a very fine needle to inject the desired DNA into the area containing the DNA from the sperm, before the sperm and egg have fused. The injected DNA may become part of the sperm DNA. After fusion has occurred, the fertilized egg is allowed to develop into a two-cell embryo, which is then implanted into a female mouse. If the embryo attaches to the uterus, the pregnancy will go forward and healthy pups, or baby mice, will develop. Successful development of transgenic mice is not certain, because only one-third of the embryos placed into a mouse uterus develop into live animals, and only a few may carry the transgene and produce the desired protein. A second method provides a more certain outcome. Before the manipulated embryo is put into the mouse’s uterus, that genetic information is present and in a form that will drive production of a protein. This method uses embryonic stem (ES) cells. Early in its development, before it settles in the uterus, the embryo becomes a hollow ball of cells called the blastocyst, and inside that ball are embryonic stem (ES) cells (Figure 1.6). A single mouse ES cell can develop into a whole animal. Several research groups have reported that an entire mouse was produced from an ES cell that was allowed to grow and develop into an embryo in the lab and was then placed in the uterus of a female mouse to complete its development. To make a transgenic animal using ES cells, the researcher first constructs the DNA cassette containing the desired gene, the gene that will signal whether the transformation succeeds, and the appropriate stretches of DNA that tell the cell to read the genes and make the proteins. All of this material is incorporated into a vector. The researcher mixes the vector with the ES cells. Some ES cells will take the new DNA into their genetic material. Then the ES cells are
What Is Biotechnology?
19
Figure 1.6 Early development of an embryo is illustrated here. The human blastocyst
develops by about 4 1/2 days. Embryonic stem cells are formed from inner cell mass.
treated to separate those that have successfully taken up the new genetic material from those that have not. The successfully transformed ES cells are injected into the hollow center of a blastocyst, so that the genetically modified ES cells mix with the small number of ES cells present. The embryo is allowed to develop in the laboratory for a short time, and is then placed into the uterus of a female. Success is still not certain: About 10% of the live mouse pups will have the new gene, the transgene. Only one of two chromosomes of the transgenic mice will carry the transgene, so the mice will have to be bred to produce animals with two copies of the new gene. ES cells can also be used to generate an animal genetically identical to a living animal, a process termed reproductive cloning. Reproductive cloning has been used in some species, and has been hotly debated, particularly regarding its potential use in humans.
20
BIOTECHNOLOGY AND YOUR HEALTH
CONNECTIONS
The ability to move a gene from one organism to another at will was built on basic discoveries about the biology and genetics of cells and whole organisms. The biotechnologist’s toolbox includes methods to precisely clip DNA and insert it into a new cell, along with other Reproductive Cloning Laboratory methods have been used to produce animals that are genetically identical to one another. These procedures are also called cloning, specifically reproductive cloning, because the goal is to produce a live animal. Animal and human clones are not unknown. Identical twins, because they derive from the same fertilized egg that splits into two, are genetically identical, and each is therefore a clone of the other. But the form of cloning that concerns and sometimes alarms people is the process by which the nucleus of an adult individual’s cell is substituted for the nucleus of a fertilized egg, with the goal of generating a genetic copy of the donor of the nucleus. Dolly the sheep, the first cloned mammal, was produced in 1996 by substituting the nucleus from a skin cell of a sheep for the nucleus of an unfertilized egg. Many such transfers were done, and each egg was cultured in the laboratory until it developed into an embryo and was then placed into the uterus of an ewe treated with hormones to mimic pregnancy. Hundreds of embryos were produced, but only one resulted in a live birth. Others died early in development or were born with fatal birth defects. A similar method has been used to produce cloned sheep, goats, cows, mice, pigs, cats, rabbits, and a gaur, which is an endangered ox. The method is called somatic nuclear transfer ( SNT). The cells in animal and human bodies destined to develop into sperm or eggs are called germ cells, and the rest of the cells are called somatic cells. The process is not a sure thing. In every species in which SNT has been tried, experience has shown that many embryos die early in development or, if born alive, have significant birth defects. The morality and ethics of human reproductive cloning have been hotly debated since Dolly’s birth, and the issues are of great concern to many religious faiths. The debate centers on respect for the earliest form of human life, and different ideas about the stage of development at which a human embryo should be granted protection as a “person.” This debate will not be easily cooled. Ethical and moral issues aside, after thorough review of results with different animal species, the scientific and medical consensus is that reproductive cloning of humans is too dangerous and should not be attempted.
What Is Biotechnology?
genetic material that allows selection of successfully changed cells and instructs the cells to make the desired protein. Methods to make many copies of stretches of DNA and to determine the sequence of bases in the DNA allow the researcher to understand the relationship between DNA sequence and protein product, and to modify the genetic information of a cell in new and useful ways. The methods have also been applied to genetically modified whole plants and animals. Biotechnologists apply these methods to make useful products for medicine, agriculture, and industry. This book will explore some approaches that have proven useful in health care and some that are still experimental. The possibility of using this method to create a genetic copy of humans, though generally viewed as medically too risky, has spurred ethical and moral debates. FOR MORE INFORMATION
For more information about the concepts discussed in this chapter, search the Web using the keywords: genetic engineering, animal cloning, polymerase chain reaction
21
2 Natural Products as Drugs NATURAL CURES FOR ANCIENT DISEASES
In China in 500 B.C., moldy soybeans—the first antibiotic—were
considered one prescription to cure a rash. Diseases were treated with products from living organisms hundreds of years before the development of biotechnology methods that allowed scientists to move genetic information from one organism to another. A document from 1550 B.C. in Egypt, perhaps the earliest medical book ever found, describes more than 700 drugs, many of them made from herbs. Many medicines that we now use and often take for granted were based on the healing properties of plants and other natural sources known to traditional healers. Aspirin, or acetylsalicylic acid, is a chemically modified form of salicylic acid, a chemical extracted in the early 19th century from willow tree bark, which had been known for centuries to reduce fevers. Today, aspirin is chemically
22
Natural Products as Drugs
synthesized from simple starting chemicals, a process that costs less than growing willow trees. We can thank both the willow plant and advances in chemistry for the availability and low cost of aspirin. FROM DYES TO DRUGS
The modern pharmaceutical industry began in Europe when researchers developed methods to isolate and determine the structure of complex chemicals from natural sources, and to build these compounds from inexpensive and readily available starting materials. Soon, industrial chemists were isolating many useful chemicals from coal tar, a by-product of the industrial use of coal for fuel, and developing methods to make many new products, including textile dyes, from scratch. Stop and Consider Does describing a drug as “natural” mean it is safe to use? Provide some examples.
Traditionally, textile dyes were extracted from plants, requiring access to scarce, often exotic, raw materials. The development of methods to make chemicals inexpensively from cheap raw materials spawned several entirely new industries, including the pharmaceutical industry. Advances in chemical dye methods were quickly applied to medicine, beginning in the early 19th century, when chemists isolated the drugs morphine, quinine, and digitalis from their plant sources: poppies, cinchona tree bark, and the foxglove plant, respectively (Figure 2.1). Today, chemists use sophisticated and powerful tools, but the basic principle is often the same. Working from knowledge of the medicinal properties of a particular plant or microorganism (a living thing too small to be seen without a microscope), chemists isolate an active drug,
23
24
BIOTECHNOLOGY AND YOUR HEALTH
Figure 2.1 The foxglove plant, a member of the snapdragon family,
grows in Europe and was the original source for the heart drug digitalis. Digitalis is now manufactured synthetically.
Natural Products as Drugs
determine its structure, and develop reliable and economical ways to produce it from inexpensive materials. In some cases, the medical use of a plant extract was discovered long after it had been used for other purposes. Morphine, now used to treat severe pain, was isolated in the 19th century from opium, a drug that has been used and abused for centuries. Several plant extracts now known to have effects on the heart were used as arrow poisons by tribal peoples around the world. In A.D. 1250, a Welsh physician wrote about the use of the foxglove plant to treat accumulation of fluid in the tissues, which can be caused by the weakening of the heart muscle. Digitalis, a heart medication used today, was isolated from the foxglove plant. Chemists isolated quinine, now used to prevent and treat malaria, from the bark of the cinchona tree, used for centuries by South American tribes to treat malaria and to bring down fevers. Today, these drugs are produced by chemical methods, without relying on harvesting wild or cultivated plants. FINDING MEDICINES IN NATURE
Plants have traditionally played a major role in medicine, with herbs and other plants providing teas, balms, and salves. Although we might like to think that modern science has led us away from these seemingly simplistic sources for healing, one of the most effective modern cancer drugs came out of a massive government search for new cancer medicines from plants, a search that ranged around the globe. Paclitaxel (Taxol®), a drug used to treat cancer of the ovary, breast, and certain forms of lung cancer, was produced through a joint effort of the National Cancer Institute (NCI) and the Department of Agriculture (USDA). From the early 1960s to 1981, plant experts at the USDA traveled the world searching for new plants, and NCI scientists tested extracts of those new plants for the ability to kill tumor cells. The chemical responsible for killing tumor cells was then isolated from the extract. Although hundreds of thousands
25
26
BIOTECHNOLOGY AND YOUR HEALTH
FDA Approval of New Drugs In many countries, including the United States, drugs are only available if a government agency has determined that they are safe and effective. In the United States, the Food and Drug Administration (FDA) is responsible for approving drugs for sale. The FDA decides whether to approve a drug based on a large amount of information from laboratory, animal, and human studies. Laboratory studies with cells, as well as animal studies, provide clues as to the drug’s potential usefulness and possible toxic effects. Human studies, sometimes called clinical trials, may begin only after the FDA has reviewed all the laboratory and animal studies. Clinical trials are done in three phases. Studies in Phase 1, generally performed on a small number of healthy volunteers, are designed to show how the body takes up and eliminates the drug, and to find out what toxic effects the drug might have in humans. In Phase 1, the drug is given in increasing doses, starting with a very low dose identified to be very unlikely to be toxic in humans from the results of the animal safety studies. Phase 2 studies, performed with a small number of people who have the condition the drug is intended to treat, compare the new drug to a standard drug for the condition or, if there is no approved drug for this condition, to a placebo—an inert substance such as a sugar pill. Phase 2 trials, which are the first human tests of whether the drug will benefit patients, are often double-blind tests, meaning that neither the subjects nor the physician researchers measuring the drug’s effects know who is getting the new drug and who is getting the control drug, whether approved drug or placebo. Phase 3 trials, also blind and controlled, are generally larger and performed at several different medical centers. The results of all the clinical trials are analyzed using mathematical methods to see if the studies support the usefulness of the drug. During the entire clinical testing period, data are collected on any harmful effects and these results must be reported to the FDA. The pharmaceutical company must also demonstrate that it can manufacture the drug at a consistently high level of purity and that the drug can be stored without breaking down. FDA scientists, sometimes with advice from outside medical experts, review all the information and, based upon these reviews, the FDA decides whether the results support the safety and efficacy of the new drug. Only if the results are positive may a company offer the drug for sale. Information on any harmful effects of the drug will continue to be collected by the company and reported to the FDA. If necessary, this information will be provided to physicians to help them prescribe the drug safely. Severely harmful effects that outweigh the potential benefit of the drug may eventually cause the drug to be withdrawn from the market.
Natural Products as Drugs
of plant extracts were tested, only a few provided useful drugs; one of these was Taxol. The NCI scientists discovered that extracts of the bark and needles of a yew tree, Taxus brevifolia of the Pacific Northwest, killed tumor cells. Fresh samples were obtained from the forests in the state of Washington in August 1962. Paclitaxel was first isolated from yew tree extract in 1967, and retested on cells in the laboratory. After it was found to be effective in tests on animals with tumors, paclitaxel was studied in a large number of human cancer patients and finally approved by the Food and Drug Administration (FDA) in 1992 for use in treating cancer in people. Paclitaxel was first manufactured by extracting the active drug from the bark of the Pacific yew tree, but that approach was unacceptable, both for the manufacturer, Bristol-Myers Squibb, and for Protection of Human Test Subjects Drugs may be approved for sale only after they have been shown through experiments to be safe and effective in humans. Since the end of World War II (1945), human experimentation of any kind has been regulated by strict rules protecting the subjects. Participation must be voluntary. Subjects must be informed of the potential risks and benefits of their participation, must give written consent, and must be able to withdraw from the study at any time without penalty. An independent committee of physicians, other healthcare professionals, and nonmedical community representatives must review and approve the detailed plan for the study, including the written description of the risks that is used to obtain written consent from subjects. The consent material must be written in a language and at an educational level suitable for potential participants. Subjects must be treated fairly, with compassion, and with respect for their autonomy—their ability to make their own decisions. Individuals who are unable to give informed consent because of age, illness, or mental disease may only participate in clinical trials if an appointed legal guardian consents. Bioethicists—professionals trained in medical science, moral philosophy, and legal and psychological aspects of human experimentation—work with physicians and researchers to ensure that experiments involving humans are conducted with compassion, fairness, and respect for the test subjects.
27
28
BIOTECHNOLOGY AND YOUR HEALTH
environmentalists, because this process killed the slow-growing and scarce yew tree. Researchers eventually succeeded in synthesizing paclitaxel from a chemical precursor found in the needles of another yew tree, Taxus baccata, which grows abundantly in Asia and Europe. The needles could be harvested and the drug made in a factory without sacrificing trees. Scientists have not yet succeeded in producing paclitaxel from scratch in the lab or in producing the drug or a precursor from plant cells grown in large vats. THE DISCOVERY OF ANTIBIOTICS
have a long history, and represent another highly successful application of conventional biotechnology. In China, Egypt, and among some native South American tribes, molds were used to treat rashes and severe skin infections, such as boils. The modern antibiotic era began with British bacteriologist Alexander Fleming’s serendipitous discovery of penicillin in 1928, the first successful result of a 50-year search for chemicals produced by one microorganism that were able to kill another organism, or at least stop its growth (Figure 2.2). In the struggle to survive in competitive conditions with limited food sources, molds, fungi, and bacteria discharge antibiotic substances into the local environment. Many antibiotics currently in use, including penicillin, were discovered by observing the ability of a colony of mold or fungus to prevent the growth of bacteria (Figure 2.3). Cephalosporin, the first of a series of related and widely used antibiotics, was isolated in 1948 from a fungus discovered from the sea near Sardinia, an island off the west coast of Italy. The story is that the sample was taken from the sea near the outlet from a sewage treatment plant! Many medically useful antibiotics are first discovered by putting bacteria in a culture dish with molds or fungi to see whether the mold or fungus kills the bacteria or slows its growth. But finding dead bacteria on a lab dish may not necessarily mean that a useful drug is being produced. Today, most of the clinically useful antibiotics Antibiotics
Natural Products as Drugs
are manufactured semi-synthetically, meaning that the producing organism is grown in huge industrial vats under very controlled conditions. The antibiotic is purified from the liquid in which the bacteria grow, and is then chemically modified to make it more useful as a drug. These changes may make the antibiotic less expensive Who Owns Nature’s Medicine Cabinet? Many of the medicines used in the United States come from plants or microorganisms found in the environment. This includes medicines ranging from aspirin to antibiotics and even Taxol, one of the most widely used cancer drugs. Plants and animals were widely used in traditional medicine, and nature’s “medicine cabinet” was the source for many early drugs as chemists learned how to isolate the specific compounds that made medicinal plants useful in treating human illness. Not surprisingly, pharmaceutical and biotechnology companies still search all over the world today for new and better drugs. These searches are based both on folk medicines and on systematic tests of extracts from previously unknown plants and microorganisms. The search for a new drug from these extracts involves many thousands of laboratory tests that use robots to run the tests and computers to analyze the results. Because the diversity of plant and animal species is greatest in the tropical rain forests in relatively underdeveloped parts of the world, the ethics of exploiting that diversity, and of wealthy companies using folk medicine traditions, has been challenged. Several international agreements, such as the General Agreement on Tariffs and Trade (GATT) and the Convention on Biological Diversity (CBD), have supported sustainable commercialization of biological resources and patenting of discoveries to encourage sharing the benefits with the country of origin and the indigenous people whose traditional knowledge may have formed the basis for the product. The CBD, not signed by the United States, encourages large companies to recognize the right of each country to control access to the biological resources within its borders. The CBD also created expectations that bioprospecting companies would share with each country the benefits of the discoveries, in the form of compensation and transfer of useful technologies, but these expectations have not always been met. Several large pharmaceutical companies have provided funds, equipment, and training to a private nonprofit association in Costa Rica in exchange for access to its forests. It is not yet clear whether populations of the underdeveloped or developing countries with the sought-after native biological resources and indigenous medical traditions will benefit from these activities.
29
30
BIOTECHNOLOGY AND YOUR HEALTH
Figure 2.2 Alexander Fleming, the discoverer of penicillin, with a bacterial dish containing
a ring used to test antibiotics. The ring would be soaked with a solution of the test compound and placed on a plate with the bacteria to see if, after a day or so, the bacteria growth was stopped near the ring.
to form into a pill, more stable in the acidic conditions of the stomach, and more likely to be absorbed from the stomach into the bloodstream. They also may make the antibiotic less susceptible to being broken down by the bacteria being targeted, make it effective against more types of bacteria, and make it less likely to harm the patient. All these changes help a health-care provider match the appropriate antibiotic to the patient’s infection. The discovery of antibiotics has had a major medical impact. Between 1900 and 1996, U.S. death rates due to infection dropped
Natural Products as Drugs
Figure 2.3 An illustration of a bacterial plate contaminated with an antibiotic
producing mold (top) and Fleming’s actual plate (bottom). Notice the absence of bacterial colonies surrounding the mold.
31
32
BIOTECHNOLOGY AND YOUR HEALTH
from 800 per 100,000 to less than 60 per 100,000. The antibiotic streptomycin was introduced in 1944 to treat tuberculosis (TB), caused by infection with Mycobacterium tuberculosis. Between 1945 Alexander Fleming and the Discovery of Penicillin The story of Alexander Fleming’s discovery of penicillin in 1928 is well known. Going on vacation, he left his laboratory, where he was studying Staphylococci bacteria, but failed to put a Petri dish containing a sample of the bacteria in the incubator. When he returned, a mold colony, which perhaps had been blown in through an open window, was growing on the culture plate, but the area around the mold colony was clear, indicating that the bacteria had dissolved. The possibility that one microorganism might produce compounds that could destroy other microorganisms was not a new idea. In 1877, French scientist Louis Pasteur, originator of the idea that many diseases were caused by germs (infectious agents too small to be seen with the naked eye), noticed that anthrax bacteria would grow easily in sterile urine, but would not grow if he added what he called a common bacterium. Other scientists had found that a sterile filtrate of the broth in which bacteria had been grown would dissolve bacteria taken from patients with dysentery (an intestinal infection). When Alexander Fleming tested extracts from cultures of the Penicillium notatum mold in his Petri dish, he found that they were effective in killing a number of different bacteria. However, he and his colleagues were unable to purify the active compound he named penicillin (after the mold it came from), perhaps because they did not have sufficient resources to purify the very small amount of the active compound in the culture. No one seemed to think this discovery was important enough to spend money researching until just before World War II began in 1939. Then Ernst Chain, a German-born chemist who had emigrated to England after the Nazis came to power, and Howard Florey, an Australian-born biologist working at Oxford University, purified a small amount of penicillin and showed that it could treat an infection in mice that was lethal without treatment. The amounts Chain and Florey purified were too small to be useful for humans, but as impending war became a reality, pharmaceutical companies began to mass-produce penicillin, first in the United States, and then in Great Britain. By D-day in June 1944, when the United States and its Allies invaded France, enough penicillin was being produced in the United States and Britain to treat all of the Allied servicemen who needed it. In 1945, Fleming, Florey, and Chain were awarded the Nobel Prize in Physiology or Medicine for their efforts.
Natural Products as Drugs
and 1955, the death rate from TB in the United States fell from 39.9 deaths per 100,000 to 9.1 per 100,000. Stop and Consider What role does an antibiotic play for the organism producing it? Why is this important?
CONNECTIONS
Historically, plants and other living creatures have been used as medical treatments, and early chemically produced drugs were based on or identical to compounds extracted from natural sources. Nature continues to provide modern drugs, and searches still begin with systematic laboratory testing or by following clues from traditional folk healers. Modern chemical methods are used to improve upon what is found in nature. Some of these drugs, such as paclitaxel, provide major improvements in medical care. FOR MORE INFORMATION
For more information about the concepts discussed in this chapter, search the Web using the keywords: Food and Drug Administration (FDA), antibiotics, Taxol
33
3 Large Molecules INOCULATION: MEDICAL BREAKTHROUGH AND SOCIAL FAD
Several hundred years ago, inoculation parties were all the rage in the
Turkish countryside. Families gathered around an old woman with nutshells full of scrapings from the skin of people who had smallpox. The most likely participants were young women, since catching smallpox and being left with a pockmarked face could drastically reduce a young woman’s chance of marrying well. Each person to be inoculated would hold out an arm, allow a vein to be sliced open, and then a small bit of the scrapings from the nutshell would be placed in the open vein. Tradition held that the scrapings would protect the person from smallpox, a disease that scarred and killed large numbers of people who caught it naturally. Everyone knew that those who survived smallpox were protected the next time the disease appeared. The inoculation party was an acceptable and effective, though somewhat risky, way to be protected against
34
Large Molecules
the disease. (It could be risky because people who were inoculated sometimes developed full-blown smallpox.) The wife of the British consul in Constantinople (now Istanbul) reported this practice of inoculation in her letters home and, soon, after some initial testing on royal children and convicted felons, the practice became widespread in England, France, Russia, and North America. In 1798, Edward Jenner, an English country physician, reported success in providing protection from smallpox by scratching the skin with a pin that held scrapings from the skin of dairymaids who had cowpox, a mild disease the women contracted by handling the udders of infected cows. Farmers knew that dairymaids who developed cowpox could not catch smallpox. Jenner did his first experiment on a young boy, scratching the boy’s skin with a pin that held cowpox material from an infected dairymaid. Six weeks later, Jenner repeated the process, scratching the boy with smallpox, rather than cowpox, material on the pin. The child did not get the small sore that the smallpox scratch usually caused, which suggested that the boy was protected against smallpox. More studies followed, and smallpox vaccination with cowpox became routine (Figure 3.1). VACCINATION: LESS RISKY AND MORE EFFECTIVE
The word vaccination comes from vaccinia, the name of the virus now known to cause cowpox (vaca is the Latin word for “cow”). The term vaccination is now broadly used to describe the process of causing a mild disease in order to protect a person from a more dangerous disease. Vaccination is one form of immunization, exposing the body to a material to stimulate a protective response from the immune system. Vaccination is routinely used to prevent many illnesses, including measles, mumps, German measles (rubella), chicken pox, and polio. Many of these illnesses have disappeared or become very rare in developed countries that provide widespread vaccinations. Smallpox has been eradicated worldwide, thanks to
35
36
BIOTECHNOLOGY AND YOUR HEALTH
Figure 3.1 This painting depicts the first cow pox vaccination by Edward
Jenner. The child being vaccinated is held down, while his arm is scratched with a needle containing cow pox. On the right is a milk maid who is rewrapping her hand, presumably covering the cow pox pustules from which the vaccination was taken.
Large Molecules
whole population vaccination programs organized by the World Health Organization (WHO). Other immunizations use substances taken from the microorganism that causes the disease, and some even use whole killed disease-causing bacteria. The DPT shots that children receive before entering school are made up of proteins isolated from the bacteria that cause diphtheria and whooping cough (pertussis), plus killed tetanus bacteria. The pertussis and diphtheria proteins used in the The Immune System—Our Best Defense The immune system of humans and other animals consists of a series of specialized cells and proteins that provide powerful defenses against infectious diseases. Immune system cells develop in the marrow, the soft tissue inside the bones, and in the thymus, a small organ just in front of the heart. When immune system cells mature, they move to the spleen, a large organ in the abdomen; to lymph nodes, small organs located throughout the body; to the appendix; and to the blood. When you have a sore throat or cough and the doctor pokes and prods your neck, he or she is trying to see if the lymph nodes in your neck are swollen, which would indicate that they are fighting an infection. You have probably also heard of tonsils and adenoids, immune system tissues in the throat and nose that are rich in infection-fighting cells. The purpose of that look into your throat is to see if your tonsils are swollen and red, another sign that the body is fighting an infection. Immune system cells provide both general responses to infections and responses precisely targeted to the specific infecting virus or bacteria. The infection-specific cells, called lymphocytes, work to attack and remove infecting pathogens. Another important defense tool of the immune system consists of specialized proteins called antibodies, or immunoglobulins, that are produced by lymphocytes and can recognize and bind to proteins on the surfaces of microorganisms, resulting in their destruction and removal from the body. The disease-fighting lymphocytes that produce antibodies are able to “remember” previous exposure to a protein or other substance and respond quickly if it reappears in the body. Vaccination and other immunizations that prevent disease cause the immune system to develop the appropriate set of specific lymphocytes and antibodies that can quickly attack an infection.
37
38
BIOTECHNOLOGY AND YOUR HEALTH
injections are the toxins—proteins that make us sick if the diphtheria bacteria grow in our bodies. In response to the series of small injections of these proteins, our bodies develop antibodies, protective proteins produced by our immune system in response to an infection by a microbe. Once a person has been vaccinated (or has recovered from a particular disease), the antibodies remain in the body, on the lookout for the same microbe to invade again. If it reenters the body, the antibodies react and help remove it. Stop and Consider How do childhood vaccinations help prevent serious diseases? Can you provide some examples?
In addition to preventing disease, antibodies can also be injected to treat a disease. People who develop diphtheria infection may receive antibiotics and serum, the fluid part of blood, containing antibodies from animals that have been repeatedly injected with small amounts of the poisonous protein from diphtheria bacteria. The antibodies in the animal serum bind to the toxin protein in the patient, making it harmless. These animal sera (plural of serum) are prepared very carefully to make sure they are safe. That was not always the case. In St. Louis in 1901, during a diphtheria epidemic, the serum of a retired milk wagon horse named Jim, which was infected with tetanus, was used to manufacture the diphtheria antitoxin. After receiving the contaminated vaccine, 13 children died of tetanus. The scandal led to the passage of the 1902 Biologics Control Act, which gave the federal government control over the production of biologic products, including serums, vaccines, and antitoxins. Antivenoms—serum preparations from horses or sheep that have been repeatedly injected with small amounts of venom proteins—are used around the world to treat snake and scorpion bites.
Large Molecules
THE USE OF INSULIN: REPLACING WHAT IS NOT WORKING
Biologic sources have long provided replacement proteins for medical conditions caused by absent or defective proteins. One such condition is the type of diabetes that occurs in young people, which is caused by destruction of the pancreas cells that produce insulin. The pancreas, a gland in the abdomen, secretes insulin, a protein hormone that allows the body to break down the sugar molecule glucose. If it cannot create insulin when needed, the body wastes away because sugar from food cannot be processed to provide energy and to build and maintain muscle. In addition, without insulin, the glucose produced by the digestion of food may rise to such high levels in the blood that the patient may become unconscious and die very quickly. Before insulin injections became available, people with this form of diabetes could only be treated by a very restrictive diet that only postponed death for a short while. Then, in the 1920s, a team of Canadian researchers produced insulin from calf pancreas and, soon after, pharmaceutical companies were able to supply cow and pig insulin to diabetics. Animal insulins can be used for humans because the amino acid sequence of insulin from cows and pigs is very similar to that of human insulin. Animal insulin did cause problems for some diabetic patients, particularly in the early years when the insulin preparations were not entirely free from other proteins. Some diabetic patients who received animal insulin, even highly purified preparations, developed antibodies to the insulin, which blunted its effectiveness. A few developed serious allergic reactions. Sometimes this occurred only in the skin where the insulin was injected, but in some cases, people had severe allergic reactions that tightened the throat and became life-threatening. THE USE OF HUMAN GROWTH HORMONE
Some children do not grow at the normal rate, and are the size of children who are several years younger. This may occur because
39
40
BIOTECHNOLOGY AND YOUR HEALTH
they have too little growth hormone. Growth hormone is a protein produced by the pituitary gland, located at the base of the brain (Figure 3.2). Growth hormone influences the development of The Discovery of Insulin: A Lifesaver Imagine your doctor tasting your urine to find out what was making you constantly thirsty and hungry and wasting away to skin and bones! For hundreds of years, this was a fairly common practice. Diabetes had been known for centuries, and one advance came when physicians realized that patients with diabetic symptoms often had high levels of sugar in their urine. In the 11th century, someone took a sip of the urine and the condition was named diabetes mellitus (from the Latin word for “honey” or “sweet”). Until the 1920s, other than ordering a very restricted diet with little carbohydrates or sugar and lots of fat and protein, the physician could do little or nothing to prevent the death of a diabetic patient within a few months or years. In 1920, Frederick Banting, a young physician on the staff of Western University in London, Ontario, Canada, read about a recent study that had shown that diabetes develops only when distinctive cells in the pancreas, called the islets of Langerhans, were damaged. Banting became determined to isolate or purify the substance found in the islets of Langerhans and test it to see whether diabetes could be reversed. In the spring of 1921, he was given some laboratory space and hired an assistant named Charles Best. Working over a hot summer and without salaries, Banting and Best removed the pancreas of dogs to cause diabetes, then reversed the condition by giving the newly diabetic dogs fluid from the islets of Langerhans of healthy dogs. With this initial success, they won the support of J.J.R. MacLeod of the University of Toronto and a biochemist named J. B. Collip. They switched to using islets of Langerhans from slaughterhouse calves, and had further success in dog experiments with the extracts and subsequently with concentrated material they called iseltin, because it was obtained from islet cells. Other researchers had worked to purify the active material from calf pancreas, and the name “insulin” had been proposed as early as 1906. In 1922, a teenager in a diabetic coma became the first human to receive an injection of insulin. His condition improved with the injections. When reports of his treatment spread, the challenge became to produce enough insulin to treat all the diabetics who wanted it. By 1923, insulin was widely available. In February of that year, Banting and MacLeod were awarded the Nobel Prize in Physiology or Medicine.
Large Molecules
Figure 3.2 The pituitary gland is a pea size gland located at the base of
the human brain. The pituitary gland has two rounded projections or lobes. Cells of the anterior lobe produce growth hormone and five other protein hormones involved in regulating various body functions, when stimulated by specific signals from the hypothalamus. The optic chiasma is where the optic nerves from each eye cross before entering the brain.
41
42
BIOTECHNOLOGY AND YOUR HEALTH
nearly every organ and tissue in the body except for the brain and eyes. Unlike insulin, growth hormone from animals does not work in humans. From 1963 to 1985, the U.S. Public Health Services (PHS), part of the U.S. Department of Health and Human Services, provided American physicians with human growth hormone (HGH) purified from the pituitary glands of human cadavers (dead bodies). A total of 7,700 children who were too small for their age and had low blood levels of growth hormone levels were treated with this material. Many of them grew significantly. Stop and Consider Should all short children be treated with growth hormone? Why or why not? What are some of the advantages and disadvantages?
However, in 1985, scientists learned that at least three men who had been treated as children with the cadaver-derived human growth hormone had developed a very rare and fatal degenerative brain disease called variant Creutzfeldt-Jakob disease (vCJD). Similar discoveries were made in France, Great Britain, New Zealand, Brazil, and several other countries that had used the procedure. Although some individuals who developed vCJD in other countries had received human growth hormone from the same laboratory that provided the PHS material, others had received human growth hormone produced in their own country. When told of the development of vCJD in the three men, the PHS stopped providing the HGH and notified all physicians who had received it to stop using it on patients. By 2004, the National Institutes of Health (NIH) had tracked down 6,272 of the 7,700 people treated with U.S. cadaver growth hormone and found that 32 of them had developed vCJD. When the PHS began distributing growth hormone from human cadavers, no one suspected that preparations from the
Large Molecules
brains of some people might cause vCJD, because the possibility that there might be an unknown infection in the brain tissue was not understood. CONNECTIONS
The real and potential risks of serious health problems from the use of protein-based medicines isolated from animal or human tissue,
Prion Diseases Transmissible spongiform encephalopathies (TSEs) are brain diseases that can be
transmitted from one animal to another. In these diseases, many of the nerve cells in the brain are destroyed. When viewed under a microscope, the brain tissue of animals and people with TSE resembles a sponge. Human TSEs include the variant Creutzfeldt-Jacob disease (vCJD) that occurred in a small number of children treated with growth hormone or brain tissue from human cadavers, and kuru, a disease found among the Fore tribe in Papua New Guinea, who practiced ritualized cannibalism in which they ate the brains of deceased relatives. Sheep and goats can develop a TSE called scrapie, and cows develop bovine spongiform encephalopathy, or BSE, sometimes called “mad cow disease.”
Human and animal TSEs are spread by exposure to the brain tissue of an infected individual, though scrapie spreads from mother to offspring through the placenta and placenta fluids, and to other animals through consumption of infected brain tissue. The nature of the agent that actually causes the TSEs is a matter of debate. Viruses, bacteria, and fungi—all of which contain nucleic acids, the material that makes up genes—cause most infectious diseases. After 30 years of searching, no one has yet been able to find nucleic acid in the infectious material that causes TSEs. Beginning in the 1960s, scientists began to propose that a protein material alone caused these diseases. In 1981, Dr. Stanley Prusiner coined the name “prion” to describe the proteinonly infectious material believed to be responsible for TSE. According to Prusiner’s hypothesis, the infectious prion protein enters nerve cells and changes the way that related normal proteins fold, a change that causes the cells to die. All mammals have genes for normal prion proteins; the genes are similar but not identical among different species, and the differences seem related to the ability of prions from one species to infect another species.
43
44
BIOTECHNOLOGY AND YOUR HEALTH
and the limitations of the use of animal proteins, were strong spurs to the establishment of the biotechnology industry in the 1980s. At first, there were not many ways to change the proteins isolated from these sources to make them more useful as drugs. Engineering— specifically genetic engineering—held the promise of helping scientists design protein drugs that would be extremely effective. FOR MORE INFORMATION
For more information about the concepts discussed in this chapter, search the Web using the keywords: proteins, amino acids, prions, immune system, insulin, diabetes, pancreas, infectious disease
4 Types of Recombinant Drugs PROTEIN FACTORIES
On television, you have probably seen factories that are vast computer-
controlled, super-clean spaces with equipment tended by technicians in space suits, booties, and hoods. This is an accurate image of manufacturing plants that work in the modern biotechnology industry. Picture an enormous room full of shiny stainless steel vats, each two stories tall and containing 5,000 to 10,000 gallons of a broth—composed of water, salt, and sugar—in which bacteria are dividing again and again. Pretty soon there are millions, billions, and trillions of bacteria, all the same and all busily producing human insulin (Figure 4.1). The vats are connected to a network of tubes and devices to withdraw the insulin from the broth, remove almost everything else, and emit a concentrated solution of insulin. This solution is then sent to another set of machines to be mixed with preservatives and a few other chemicals to make it suitable for
45
46
BIOTECHNOLOGY AND YOUR HEALTH
Figure 4.1 Shown here are industrial biotechnology reactors used to
grow cells for production of biotechnology products. Temperature, pH, and other conditions are carefully monitored and controlled. Industrial biotechnology reactors can hold thousands of liters and stand two stories high.
Types of Recombinant Drugs
injection into diabetic patients who need it. After samples are tested to make sure everything is in order, the vials are ready to be shipped to a drug distribution warehouse. Bacteria at Work
Many types of recombinant biotechnology products are available today, but at the outset, the major spur to adopt the technology came from the search for safe, efficient, and economical ways to produce protein drugs. Small chemical drugs could be synthesized in the laboratory and factory from inexpensive materials, but such methods were ineffective for proteins. Over the years, biological researchers had identified hundreds of proteins that were potentially useful for treating disease, but producing them in the large amounts needed for testing and use was difficult, and often the animal protein would not work in humans. In the first years of the industry’s existence, the 1980s and early 1990s, most biotechnologyderived protein drugs were produced in bacteria, particularly in a strain of the bacterium Escherichia coli (E. coli) that had been changed so it could not cause disease. We all carry large numbers of E. coli bacteria in our intestines, where they help digest our food. The strains of E. coli in our intestines do not cause disease unless the bacteria somehow escape to other tissues or organs. A serious infection can develop if a wound in the intestine allows E. coli and other bacteria to leak into the abdomen. Some strains of E. coli do cause disease even if they do not leave the intestines. You may have heard of a type of E. coli that can cause severe food poisoning if someone eats undercooked, contaminated meat (most bacteria can be killed if meat is cooked thoroughly). This strain of E. coli produces a poisonous protein, called a toxin. When someone eats food contaminated with this strain of E. coli, the bacteria grow rapidly and the toxin they emit can cause severe diarrhea, kidney damage, and even death. The strain of E. coli used to manufacture proteins is very different from the type that causes food poisoning
47
48
BIOTECHNOLOGY AND YOUR HEALTH
as well as the type that grows naturally in our intestines. Industrial E. coli have been genetically changed so they cannot grow outside of a carefully controlled laboratory setting and cannot cause disease. Changing the Bacterium’s DNA
Biotechnology uses a series of techniques to harness a bacterium’s ability to increase quickly to very large numbers in a solution of inexpensive chemicals, and to produce large amounts of protein. With the toolbox of recombinant DNA technology, the genetic material of the bacterium is changed through the addition of a segment of DNA that carries instructions for the protein that will become a drug; in this case, human insulin. Each bacterium becomes a very small production “factory” for the protein that is then purified, or freed from all the other chemicals. Changing the Protein
Other steps may be needed to actually make the protein useful. For example, the protein may need to be treated to make it on take the correct shape, or to make it fold the right way (Figure 4.2). In the case of insulin, something else is needed, something that is not required to make pig or cow insulin useful for humans. When the islet of Langerhans cells in the pancreas of cows, pigs, or humans “read” the gene for insulin to create a protein, the first product is a large protein. The starting protein is trimmed of a precise section of amino acids while it travels in the islet cell to the spot where it will be packaged for transport into the bloodstream. In that package, the protein is again clipped at two spots with great precision to produce insulin. Insulin consists of two short peptides, one of which is 21 amino acids long and the other 30 amino acids long. The peptides are held together by weak chemical bonds. To produce insulin in E. coli, scientists knew that the bacteria could not process the starting protein into insulin on their own, so they came up with a solution. They inserted two different plasmids into E. coli, one carrying the
Types of Recombinant Drugs
49
Figure 4.2 This three-dimensional image of a protein shows the many twists and
folds in its structure. The coils, called alpha helices, and the ribbons, called beta pleated sheets, are generally determined by the amino acid sequence of the protein and how the amino acids in different parts form weak bonds with each other. The shape of a protein is often critical for its function.
DNA coding for the 21-amino-acid chain and the other carrying the DNA sequence coding for the 30-amino-acid chain. In both plasmids, the DNA sequence was linked to instructions for another protein, an enzyme protein. The bacteria produced two fused proteins of enzyme and one of the two insulin chains.
50
BIOTECHNOLOGY AND YOUR HEALTH
One more trick allowed scientists to control when the insulin pieces would be produced. Both enzyme-insulin chain DNA cassettes included a promoter that would trigger the production of the fused proteins when a simple chemical was added to the bacteria. When the bacteria had grown to a high concentration in the vat, the chemical was added to trigger the production of both enzymeinsulin chain fusion proteins. The mixtures of the two proteins are purified and treated to clip off the enzyme protein from both insulin chains. The liberated chains join together through the weak chemical bonds and take the shape of insulin. Yeast have also been genetically engineered to produce human insulin. The Shape of Proteins
In this business, size and shape are critical. Most proteins, like insulin, will only have the right effect on cells if they have the correct sequence of amino acids and the appropriate three-dimensional shape. This is because, in order to work, the protein must fit neatly and precisely into the pocket of another protein, called its receptor. Insulin has effects on various cells because those cells have a docking protein for insulin—the insulin receptor—on their outer membranes. The receptor is connected inside the cell with biochemical “toggle switches” that signal that insulin has arrived. Insulin must fit into the receptor like a key in a lock in order to cause very specific biochemical changes in the receptor and trigger its effect. The wrong key works poorly, if at all (Figure 4.3). There are thousands of sets of signal proteins, like insulin and its receptor. These systems of paired protein-control molecules and their receptors have evolved over millions of years and provide the very precise orchestration of thousands of different chemical reactions that are required to keep our bodies alive and working. Although illness that develops because of a failure in these systems may seem like a terrible betrayal of how things should work, the fact that so many complex systems in so many
Types of Recombinant Drugs
Figure 4.3 A prototype signal protein and its receptor is illustrated here. The human body relies on hundreds of different signal proteins docking into very specific and selective cell membrane receptor proteins to control which cell proteins are made or broken down and how the cell functions by sending specific chemical signals to other parts of the cell. The signal proteins may be produced by a nearby cell or reach its target from a distant cell through the blood stream.
cells work correctly just about each and every day can seem even more remarkable. Over many decades, scientists have worked to understand how each of these systems in each cell and in the whole organism
51
52
BIOTECHNOLOGY AND YOUR HEALTH
works—what component does what and how. With a growing understanding of how proteins work, physicians and scientists such as Banting sought to replace a missing or malfunctioning protein. An animal protein could not correct every missing or defective protein in a human patient, however, because, in some cases, the animal version of the protein is too different in shape to fit correctly into the human cell receptor. Pig insulin differs from human insulin by only 1 of its 51 amino acids, so it works well on human cells. Not every animal protein is as similar to its human counterpart, though, so deliberately producing the human protein itself seemed like a good idea. The recombinant DNA methods that were developed beginning in the 1970s made that possible. Another Kind of Factory: Producing Sugars
Some human proteins produced in a bacterium will not work even if the amino acid sequence is identical to the human protein. This is because our cells, and the cells of plants, animals, and yeast, add sugars to most of the proteins they produce. There are many different kinds of sugar molecules, and the type of sugar added and the place in the cell and on the protein where the sugars are added vary among cells for different species. If the correct sugars are not on the correct spot on the protein, the protein may not fit into the receptor pocket correctly, and thus not have the desired effect. Also, without the added sugars, the enzymes in our blood may destroy the protein before it can get to the appropriate spot to bind to the correct receptor. One way to overcome this problem is to make the protein in cells from organisms that do add sugars to their proteins, as our cells do. To accomplish this, scientists have developed ways to put the genetic information for the drug protein into an animal, plant, insect, or yeast cell so that the protein will be made with sugar added. But because different types of cells and even the same cells under different conditions may attach different sugars in different
Types of Recombinant Drugs
spots, there is no guarantee that the sugars will be in the right place to make the protein useful. Producing a protein drug from a genetically changed cell (animal, insect, plant, or yeast) has required scientists to invent new ways to deliver the genetic information for the protein product to the factory cell so that it becomes a stable part of the cell’s genetic material, copied every time the cell divides and read consistently by the cells’ protein-making machinery. Technologists also had to develop methods and equipment to allow cells to increase in number and produce the desired protein in large amounts in the laboratory. The genetically changed plant, insect, animal, or human cells must emit the protein into the broth in which they are growing or accumulate the protein in a part of the cell without doing too much damage. Making a protein in a eukaryotic cell is not the biotechnologist’s first choice for a number of reasons. The broths, or culture media, for animal, insect, and human cells are more complex and expensive than the broth in which bacteria or yeast will grow, but if the protein is not manufactured, embellished with sugar, and folded correctly, then the less expensive ways will not do. USING ANTIFREEZE TO KEEP PROTEINS IN THE BLOOD
In some cases, recombinant proteins created in E. coli or other cell systems can be changed after production to increase the amount of time they remain in the blood by adding units of ethylene glycol— more commonly known as antifreeze. When strung together and then attached to a protein with some careful chemistry, one or more strands of polyethylene glycol may increase the length of time the protein remains in the circulating blood by 5 to 10 times. These addition of polyethylene glycol appears to protect the protein from being digested by enzymes in the blood, so that a protein drug may require less frequent injections. There is another potential benefit from adding polyethylene glycol to a protein drug. The immune
53
54
BIOTECHNOLOGY AND YOUR HEALTH
system reacts to foreign proteins and protein drugs that are not native human proteins. If linked to polyethylene glycol, foreign proteins are less likely to be taken up by the cells of the immune system and therefore are less likely to trigger an immune response. CHOOSING A PRODUCTION SYSTEM
The biotechnologist who wants to produce a recombinant protein has to make a series of choices based on what is known about the potential protein drug, how it works, how “fussy” its receptor is, whether the protein will be chewed up by enzymes in the blood, how long the protein must stay in the blood or in other places in the body to have an effect, and much more. Practical questions have to be asked, including: How expensive would it be to manufacture the protein in one cell system or another? Does the protein need to be sweetened with sugars to work? Should polyethylene glycol be added to increase the time the protein stays in the body? Would the production of large amounts of the protein damage the bacteria or cell system used for production so much that the cells would die before enough protein was made? Should the protein be produced all the time or should production just be “switched on” after the number of bacteria or other cells has increased greatly? What signal will be used to “turn on” production of the protein? Although there may be no one perfect set of answers to these questions for any particular protein drug, pharmaceutical biotechnologists must make some educated guesses and test them by creating the genetic constructs, delivering them to the candidate cell system, and running an experiment to see whether the amount of protein created is enough to be economically feasible and whether the protein product can be purified. Most importantly, experiments must be conducted to see if the test material works. Development of a suitable production system for a recombinant protein drug can take many tries over a period of many, many months.
Types of Recombinant Drugs
THE PRODUCTION OF ANTIBODIES
Although the serum of animals immunized with small amounts of toxins has been used for many years to help people recover from diphtheria or to provide protection against snake or scorpion venom, there have been other situations where a specific antibody was needed in a concentrated form. Unfortunately, there were limits to what animal antibodies could do. First, the animal serum preparations, even with repeated injections, were mixtures of antibodies—not collections of many of the same antibody. That is just the way the immune system works in animals, including humans. In addition, there was always the danger of taking the serum from a diseased animal; remember the case of Jim, the horse with tetanus! As with penicillin and insulin, serendipity rewarded prepared minds. Georges Kohler, a Swiss postdoctoral fellow working at Cambridge University in England, with Argentine-born Professor Cesar Milstein, wanted to understand how the production of antibody proteins was controlled within immune system cells. In the late 1950s, scientists had discovered that any single antibodyproducing cell made only one form of an antibody protein, and that some blood cancers produced large amounts of a single type of antibody protein. In fact, physicians could diagnose this type of blood-cell cancer by showing that the serum of the patients was not filled with the usual mixture of antibody proteins, but instead had one predominant antibody protein. The science of growing blood-cell cancers had advanced to the point that cultures of such cancers from mice or humans could be easily grown in the lab. Normal antibody-producing cells from mice that had been immunized to produce antibodies to a specific protein did not survive in the laboratory, but antibody-producing cancer cells grew just fine, emitting lots of antibody protein. Kohler and Milstein wanted to know what changes allowed the antibodyproducing cancer cell to survive and grow in the laboratory and
55
56
BIOTECHNOLOGY AND YOUR HEALTH
produce antibodies, and whether these abilities could be shared with normal antibody-producing cells from an immunized mouse. To find out, they used two technologies: cell fusion and cell cloning. They found that if they immunized a normal mouse with a particular substance and then took the mouse’s antibody-producing cells and fused them with mouse blood-cancer cells, some of the fused cells would survive and produce antibody protein—not the antibody protein of the tumor cell, but one of the antibody proteins that the immunized mouse produced. The scientists could clone the antibody-producing fusions, creating cultures of millions of identical cells from a single fused pair. The culture medium of the clones contained many millions of molecules of identical antibody protein. The antibody-producing cells were called hybridomas and the antibodies they produced were called monoclonal antibodies, because they were the result of genetic instructions from a single antibody-producing cell (Figure 4.4). The potential uses of monoclonal antibodies were not lost on the scientific, medical, or business communities. Soon, the method was being used to produce monoclonal antibodies for laboratory tests and treatments for a wide variety of diseases. In 1984, Milstein and Kohler were awarded the Nobel Prize in Physiology or Medicine. Stop and Consider Why was the invention of monoclonal antibodies important? What does the story of how the process of making monoclonal antibodies was developed tell you about basic scientific research?
Different Animals and Different Antibodies
There was a problem with using mouse monoclonal antibody proteins to treat some human diseases, however. The human immune system recognizes the mouse antibody as the foreign protein it is,
Types of Recombinant Drugs
57
Figure 4.4 The process of developing a mouse monoclonal antibody is illustrated
here. Antibody -producing cells from a mouse immunized with material containing the intended antibody target are fused with tumor cells to produce hybridomas. The hybridomas are cloned and the culture fluids are tested to find the clone producing the desired antibody. Large amounts of the monoclonal antibody can then be isolated from the culture medium.
58
BIOTECHNOLOGY AND YOUR HEALTH
and, useful or not, produces antibodies against it. These antibodies capture the useful antibody, rendering it useless and sending it on its way to destruction. So mouse monoclonal antibodies could not be effectively injected over and over again. Scientists have invented several ways to get past this problem. The portions of the antibody protein that allow it to bind to a specific chemical structure are very small bits located at one end. The rest of the antibody molecule allows the antibody to work, directing cells to remove the foreign molecule or cell or triggering the death of an infecting bacterium or virus (Figure 4.5). Methods were devised to isolate the genetic instructions for the targeting end of the mouse monoclonal antibody and insert it into the genetic instructions for a human antibody protein. This meant that only a very small bit of the engineered, now “humanized,” antibody was not human, and the monoclonal antibody would be much less likely to trigger an immune response that would prevent it from being used repeatedly. The genetic information to produce an antibody that was mostly human could be inserted into an animal cell for manufacture. Another solution was the development of methods to fuse human antibody-forming cells with blood-cancer cells so that the monoclonal antibodies were not just humanized, but actually human. Stop and Consider What concerns do you have about humans creating new microorganisms through genetic engineering?
Researchers are also testing minibodies—small pieces of antibodies engineered to be produced in bacteria or animal cells. Because of their small size, minibodies may be able do things to cells that larger, bulky antibodies cannot do. Such a minibody has recently been produced and tested in animals, and in the future may help patients with certain kinds of bleeding disorders.
Types of Recombinant Drugs
Figure 4.5 The most common antibody molecule is a complex combination
of two identical light and two identical heavy chains, held together by weak bonds formed by sulfur-containing amino acids. The four variable regions form the antigen binding site; the constant regions allow the antibodies to trigger the cell-damaging complement cascade and signal phagocytic cells to engulf and break down invading microbes.
59
60
BIOTECHNOLOGY AND YOUR HEALTH
CONNECTIONS
In 1982, the FDA approved human insulin made in E. coli, the first recombinant protein drug to gain approval. Since then, biotechnology has provided more than 90 new medications and many diagnostic laboratory tests using these basic building blocks, tools, and tricks. But producing a protein drug is far from a sure thing. When scientists propose that a recombinant protein may be useful for preventing, treating, or diagnosing a disease, the challenge is to find a way (through both established and new molecular biology methods) to produce a protein economically and to show that the drug has the desired effect on cells in laboratory and animal tests. Many months of experiments are required to develop a costeffective, reliable, and safe production method. Sometimes new factories must be built just to perform these experiments. The FDA also requires drug manufacturers to show that any drug produced is free of potentially harmful contaminants. Only then may human trials begin to test whether the drug is safe and effective. Because biotechnology drugs are produced from living organisms, special steps must be taken to show that the FDA’s standards for purity and safety have been met. Biotechnology drugs can be more expensive to make than conventional drugs synthesized in the laboratory from simple chemicals because of the time, effort, and costs of developing the production process, creating large amounts of a protein drug and meeting FDA requirements. Biotechnology drugs, however, may provide treatments that would not otherwise be available and in some cases may provide life-saving options. FOR MORE INFORMATION
For more information about the concepts discussed in this chapter, search the Web using the keywords: monoclonal antibodies, bacterial transformation, transfection of cells
5 Uses for Recombinant Protein Drugs PIONEERS AND MEDICAL ADVANCES
The first modern biotechnology drugs, human insulin and human
growth hormone, were replacement proteins for conditions that had been treated with proteins extracted from animal or human tissues. In 1982, recombinant human insulin was approved to control blood glucose levels, and in 1985, recombinant human growth hormone was approved to treat children who were growing too slowly because of a lack of growth hormone. Previously, insulin was extracted from animal tissues and human growth hormone was extracted from the brains of human cadavers. Physicians and patients were familiar with the older versions of these drugs, and the recombinant products, though pioneering, were not considered dramatic medical breakthroughs. Animal insulin was widely available and worked quite well for the vast majority of insulin-dependent diabetics, and although the lack of growth hormone might have presented social
61
62
BIOTECHNOLOGY AND YOUR HEALTH
and emotional problems for some people of short stature, the consequences were not life-threatening. The older treatment for growth hormone deficiency was dangerous. Human growth hormone from cadavers could be contaminated with a mysterious infectious protein that led to dementia and death. The development and approval of the recombinant versions of these drugs was the culmination of years of work by scientists. It also presented a problem for the FDA. How would the agency review applications for approval of drugs produced using recombinant DNA methods? The FDA recognized that, though the method of production of the new recombinant drugs might be different, the agency’s focus needed to stay on the product, rather than on the way it was produced. The key questions for the reviewers were 1) whether the product was safe and effective, 2) whether it could be manufactured so that it would be consistently pure, and 3) whether the manufacturer had provided satisfactory written evidence for these facts. The FDA’s decision to focus on product rather than source allowed the field of recombinant medicines to move forward more rapidly than other applications of biotechnology. REPLACING MISSING PROTEINS
Several recombinant drugs treat inherited conditions by replacing missing or malfunctioning proteins. Several of these are enzymes, proteins that drive biochemical reactions. The body has many different enzyme proteins, each of which performs a specific job in the construction or breakdown of chemicals. Some inherited conditions are caused by a destructive buildup of substances, a buildup that occurs because of an error in the gene for a particular enzyme that breaks down that chemical. One example is an enzyme replacement drug used to treat a form of Gaucher disease, which is caused by an inherited error in the gene coding for the enzyme that breaks down the fatty substance cerebroside. In Gaucher disease, certain immune system cells
Uses for Recombinant Protein Drugs
called macrophages fill up with cerebroside, and large numbers of these fat-loaded cells settle in the liver, bone marrow, and spleen (the large blood-forming organ located above the liver). In Gaucher disease, patients’ bones may not develop normally and may break without trauma, because macrophage-related cells are involved in bone formation and destruction. The Gaucher cells may also cause severe pain, because macrophages carry proteins that cause pain, which they can emit where they accumulate. The new treatment for this inherited disease is an example of a modern biotechnology drug replacing a conventionally derived drug, much like insulin and growth hormone. In 1991, researchers produced large amounts of the normal form of the enzyme from human placentas (the organ that delivers nutrients to the fetus while it is inside the womb) but the enzyme as isolated did not work as a treatment because the accumulated cerebroside is inside the Gaucher cells and the isolated enzyme could not enter the cells. To solve this problem, scientists attached sugar molecules to one end of the enzyme protein—not just any sugars but those that would specifically trigger the Gaucher cells to suck in the enzyme. The scientists knew which sugars instructed macrophages to consume things. The particular sugar they attached fit neatly into a receptor on the surface membrane of the macrophage/Gaucher cells and when the sugar-linked enzyme landed on the receptor, the cell membrane folded into a little balloon and engulfed the sugar/protein package. The placenta-derived enzyme was treated to make any associated risk of viral infections low, but a small risk of infection from human tissue remained, so scientists developed a recombinant replacement enzyme, with the right sugar embellishment, produced from a laboratory source. Unfortunately, about 15% of patients treated with the replacement enzyme develop antibodies to the protein that can reduce the usefulness of the injections and pose a risk of mild to severe allergic reactions. At the moment, however,
63
64
BIOTECHNOLOGY AND YOUR HEALTH
enzyme replacement seems to be the most promising treatment for this rare and potentially lethal inherited disease. Like many recombinant treatments for chronic diseases, the recombinant replacement enzyme for Gaucher disease is very expensive: A year’s treatment can cost over $150,000, though most private insurance companies will reimburse patients for its use. PRO
OR
CON ?
Are the Prices for Biotechnology Fair? Biotechnology drugs can cost a lot. Should they? This is not a simple question. Biopharmaceuticals—usually large and complex protein drugs—can cost patients, or their insurance companies, tens or even hundreds of thousands of dollars for a year’s treatment, or in some cases, for just a few weeks’ course of treatment. These drugs may also be the only option to save a life, or at least to extend, a patient’s life for a few weeks, months, or years. Whether the patient is old or young, a felon or an upstanding citizen, how does society put a price on those weeks, months, or years? The biotechnology drug may provide the most effective way to treat the pain and stop the crippling effects of a chronic disease such as multiple sclerosis or arthritis. The costs of discovering, manufacturing, and testing a biotechnology drug are high, possibly even higher than the $200 to $800 million estimated cost of bringing any new drug, biotechnology product, or small chemical to the market. Often, a company spends a quarter to half a billion dollars to build a special factory to meet federal regulations and to safely produce required amounts of needed proteins. Biotechnology is a financially risky business; a drug can fail at any stage of testing. Biotechnology companies may not make a profit for many years, even after one or more biopharmaceuticals is approved for sale. On the positive side, from a business point of view, a single successful biotechnology drug can bring in hundreds of millions, even billions, of dollars in sales.
Uses for Recombinant Protein Drugs
THE NEED TO MAKE TREATMENTS SAFE Treating Hemophilia
In the early 1980s, the development of HIV/AIDS in young blood transfusion patients was a powerful incentive to find other sources for the blood-derived proteins used to treat hemophilia, a group of inherited disorders affecting the clotting of blood. Hemophilia has TREATING HEMOPHILIA The FDA does not set the price for a drug; the manufacturer sets the price after considering the costs of developing the drug, the relative benefit of the drug compared with alternatives, and the amount insurance companies reimburse for alternative drugs. Because of patents and FDA rules, for several years after a drug is approved for sale, the pharmaceutical company usually has an exclusive right to sell the drug before exact copies of the drug, called generics, may be sold. When generics enter the market, competition usually drives down a drug’s price. To gain FDA approval to market a generic small molecule drug, a manufacturer only has to show that it can consistently manufacture the drug to high standards of purity, and that the generic version of the drug is taken up and eliminated from the body in the same way as the original drug—tasks that may be more difficult to do for biotechnology drugs. Currently, the FDA is considering what the rules should be for a generic biotechnology drug. But rules allowing the sale of generic biotechnology drugs will not necessarily drive down the price. Some biotechnology drugs treat rare diseases, and manufacturers may not invest in producing generic biotechnology drugs unless a large number of people need the drug. The National Organization of Rare Disorders (NORD) works with a number of pharmaceutical and biotechnology companies to provide financial assistance for people who need particular medications.
65
66
BIOTECHNOLOGY AND YOUR HEALTH
been recognized from ancient times as an inherited tendency (mainly in males) to bleed excessively even after a minor wound. This life-threatening condition affected the last Russian royal family (the Romanovs, who died in 1918) and many of their relatives among other European royalty. There are about 20,000 people, mostly men, living with hemophilia in the United States. Worldwide, the prevalence of the disease varies from country to country, but there are probably 200,000 to 400,000 people around the world with hemophilia. Many proteins and cells are involved in the complicated process that causes blood to change from a liquid to a solid, which is what happens in blood clotting. Errors in the genes that code for any of these proteins may put a person at risk of severe bleeding—even bleeding to death—from a minor cut. Hemophilia A and B, the most common forms, result from errors in two different clotting protein genes carried on the X chromosome. Because the genes are on the X chromosome, males (who have an XY chromosome arrangement) only have to receive one defective gene to suffer from bleeding problems. Carrier females (women have two X chromosomes) with one normal and one defective copy of the gene generally do not experience bleeding problems, but their sons have a 50% chance of inheriting the defective gene and suffering from the disease. Women can have hemophilia, but because they must have inherited a copy of the defective gene from both parents, it is very rare. Hemophilia A and B are the result of inherited defects in two different proteins, called factors, both part of the cascade of steps that allows blood to clot. Males with hemophilia A have inherited a defective version of the gene for the Clotting Factor 8; those with a defective copy of the gene for Clotting Factor 9 have hemophilia B. Hemophiliacs are treated with clotting factors when they have severe bleeding episodes, and are also treated to prevent bleeding if surgery or any other activity that might lead to bleeding is planned. Before recombinant technology, the fluid part of normal human
Uses for Recombinant Protein Drugs
blood was the only source for the replacement clotting factors. The first version was fresh frozen plasma from donated blood. Plasma is the fluid part of blood that has not clotted, which would use up the clotting proteins. Fresh frozen plasma has to be kept cold to remain active and useful, and the low concentration of proteins in the plasma meant that a large volume—a quart or so—had to be injected slowly into the patient’s vein. Storage and treatment at home were impractical. In the 1960s and 1970s, concentrated clotting factors were developed, and storage and treatment at home became possible— a welcome advance because it meant fewer trips to hospital emergency rooms for people with hemophilia. However, in the early 1980s, it became clear that commercial sources for the concentrated factors were infecting hemophiliacs with HIV because some of the blood used to prepare the concentrates had been donated by people unknowingly infected with HIV. Back then, the virus had not yet been identified and there was no way to detect it. Because of the danger of using commercial concentrates, hemophiliacs were once again forced to make frequent visits to the emergency room. Something had to be done to protect hemophiliacs from serious bleeding problems without infecting them with a deadly virus. Better methods for preparing clotting factors from blood and the development of recombinant clotting factors provided the solutions. Methods of detecting, inactivating, and removing viruses were improved, and none of the hemophilia replacement products— conventional or recombinant—has transmitted either HIV or hepatitis since 1987. As an alternative, recombinant clotting factors 8 and 9, produced in animal cells, were approved in 1992 and 1997, without the risk associated with human blood products. WORKING WITH BLOOD CELLS
Our blood cells do many different types of work: They carry oxygen, fight infections, and help repair leaks in blood vessels. The cells also
67
68
BIOTECHNOLOGY AND YOUR HEALTH
share another quality—they don’t stay around for a very long time. Sometimes they die in the work they do, but they have a short life expectancy in any case. This may be good from a biological point of view, but it can also cause trouble. Red blood cells live for about 120 days, and white blood cells, the first responders to an infection, only live for 1 to 1 1/2 days. This means that we must constantly be able to replace blood cells, and we can. The bone marrow, the soft tissue inside the larger bones in our body, manufactures these cells and is normally very good at it. For example, every day, the bone marrow produces about 200 billion red blood cells to replace those that are dying. Having too few blood cells creates problems and so does having too many, so our bodies have a system of growth factor proteins that instruct the bone marrow to produce more of a particular type of blood cell when and only when its numbers drop. Many different bone marrow growth factors have been found. Each works by docking at a specific receptor protein on an immature bone marrow cell and triggering it to divide and develop into the next stage, resulting in the production of the type of cell the body needs. This system of matched signal proteins and receptors is finely controlled, and the supply of cells normally keeps up with the body’s demand. If something happens to cause a dramatic drop in the number of blood cells—a drop too large to wait for normal production to kick in—then a dose of the appropriate blood cell growth factor might help. This is where biotechnology steps in. These proteins, which trigger the cell division and the specialization of cells (Figure 5.1), are present at very low levels in the blood. We have seen in the discussion of hemophilia how trying to replace a blood protein can lead to different kinds of problems. Blood cell growth factors are present in very small amounts in the blood, so purifying them from blood is impractical. Instead, scientists have isolated the genes that direct the production of a number of these blood-cell growth proteins, engineered them into an appropriate (continued on page 72)
Uses for Recombinant Protein Drugs
69
Figure 5.1 Growth factor receptors are illustrated here. Docking proteins—receptors
for protein growth factors—are embedded in the outer membranes of cells. Binding of the specific growth factor triggers a cascade of biochemical signals that cause the cell to divide and express the proteins that give the cell specialized properties.
70
BIOTECHNOLOGY AND YOUR HEALTH
The Production of New Blood Cells Millions of our blood cells die and are replaced every day. The production system for these critical cells is an orchestrated process of growth and development of specialized cells from immature precursors, driven by protein factors. This only happens once we are adults. The general process is named for the differentiation—the change from an unspecialized cell to a specialized cell able to do a job because of the presence of particular proteins. A single type of precursor cell, the hematopoietic stem cell, gives rise to red blood cells, white blood cells to fight infections and populate our immune system, and platelets to help heal wounds and plug up leaks in blood vessels. Except for lymphocytes, each specialized blood cell is a workhorse at the end of its road; each remains in the circulatory system or in a tissue and then dies, perhaps as a result of doing its job. Red cells (erythrocytes) have lost their nucleus, and platelets are fragments of precursor cells. Because they have no nuclei, human red cells and platelets cannot divide. The drivers of the cell division and differentiation of each cell are signal proteins that dock onto the membrane of a less specialized cell and trigger that cell to go to the next step to make the particular required proteins; for example, erythropoietin triggers the developing red cell to manufacture hemoglobin. The cells in the intermediate stage, those moving from hematopoietic stem cells to more committed cells, have on their membranes the docking proteins needed to allow the cell to respond to the protein trigger for the next transition. Neutrophils, eosinophils, and basophils are infection-fighting cells that develop from a common precursor cell. Each has distinctive granules in its cytoplasm and is named for the way those granules take up certain dyes. A protein called granulocyte-stimulating factor (G-CSF) causes the final step (Figure 5.2). The process can be traced further back to the production of the shared granulocyte precursor cell, which is triggered by granulocyte-monocyte stimulating factor (GM-CSF). These factors were named “colony stimulating factors” because the scientists who discovered them relied on the ability of these factors to cause colonies, or groups, of the particular cells to grow in laboratory cultures. Erythropoietin drives development of a process through which precursor cells eventually give rise to red cells through several steps. The same precursor cell, if triggered by different protein factors—interleukin11 and thrombopoietin—develops into a cell that clips off bits of itself to make platelets. The names may seem complicated, but they make sense if you know their sources. Interleukin is the general name for proteins produced by one white cell that influences another; 11 indicates that it was the 11th such white cell signal protein to be discovered; poietin at the end of the names comes from a Greek word that means “make more;” erythro means “red;” thrombo means “clot;” and “leuko” comes for the Latin word for white.
Uses for Recombinant Protein Drugs
Figure 5.2 All types of blood cells are formed from uncommitted blood (hematopoietic) stem cells in a process called differentiation. Specific protein factors drive the development of erythrocytes (red blood cells), platelets, and the white blood cells including neutrophils and eosinophils, basophils, all with multi-lobed nuclei, and the mononuclear monocytes and lymphocytes that provide specific protein and cellular defenses to the body.
71
72
BIOTECHNOLOGY AND YOUR HEALTH
(continued from page 68)
cell production system, and produced the specific recombinant proteins to stimulate production of red cells and several kinds of white blood cells. Red Blood Cells and Erythropoietin
The kidney normally manufactures erythropoietin, the growth factor for the production of red blood cells. In fact, erythropoietin was first isolated from the urine of patients with anemia, a condition characterized by too few red blood cells. Red cells carry oxygen to the body’s tissues, and if too little oxygen is delivered to them, certain kidney cells produce erythropoietin. Most of this substance goes into the blood, where it circulates to the bone marrow and other tissues and triggers increased production of red cells from immature cells. Some erythropoietin spills into the urine. The concentration of erythropoietin in the blood is very low. The concentration is even lower in urine, but urine is easy, safe, and cheap to collect, and it does not contain a large number of other proteins. The first successful scheme to purify erythropoietin from urine started with 2,550 liters of urine, and through a series of steps to remove other proteins based on what was known about erythropoietin, scientists produced only enough of the substance to conduct some laboratory tests. This was not a practical way to get the growth factor, so scientists engineered animal cells to produce recombinant human erythropoietin (Procrit®/Epogen® and Aranesp®) to treat people who have anemia. Anemic patients often feel very weak and tired because their muscles do not receive enough oxygen. Red blood cells are filled with hemoglobin, a protein that shuttles oxygen from the lungs to the tissues and moves waste CO2 from the tissues to the lungs. Anemia occurs in patients whose kidneys have failed (and thus do not produce erythropoietin), and in patients receiving certain cancer drugs that slow the bone marrow’s production of red cells. The same form of erythropoietin is marketed to treat cancer
Uses for Recombinant Protein Drugs
patients (Procrit) and patients with kidney failure (Epogen). To produce darbepoietin (Aranesp), a sweetened form of erythropoietin, scientists changed the gene sequence so that the protein has two more places to which the producing animal cell would automatically attach chains of sugars. The added sugars make Aranesp stay in the blood two to three times longer than Epogen or Procrit so that it can be injected once a week rather than two or three times a week. Helping the Body Fight Infection
Three recombinant protein drugs—Leukine®, Neupogen®, and Neulasta®—are used to stimulate the formation of infectionfighting white blood cells in patients undergoing chemotherapy for cancer treatment. The goal is to make sure patients have enough white blood cells to attack infecting bacteria. Several different types of infection-fighting white blood cells come from one precursor cell, and sargramostim (Leukine) stimulates the production of the shared precursor. Produced in yeast cells, sargramostim differs from the native form of the protein by one amino acid. Filgrastim (Neupogen) and pegfilgrastim (Neulasta) are two forms of a natural protein that stimulates production of infection-fighting white cells at the last step. Both are produced in E. coli, but pegfilgrastim is tagged with polyethylene glycol, making it stay in the blood five times longer or even more, thus allowing a more convenient schedule of injections. Platelets, small cell fragments produced from bone marrow cells, work with the cascade of proteins in the formation of blood clots. If platelet counts are low, leaks in blood vessels that would normally be small can lead to the loss of large amounts of blood. Certain chemotherapy drugs knock out the production of the cells that produce platelets. Oprelvekin (Neumega®), produced in E. coli, stimulates bone marrow to produce that very important type of cell.
73
74
BIOTECHNOLOGY AND YOUR HEALTH
IMMUNE SYSTEM DRUGS
The immune system has been a prime area of research for recombinant biotechnology drugs, particularly as scientists found clues to the identity and workings of the cells and proteins of this very complex system. Like many complicated biological systems, the immune system has complementary features—systems to speed it up and others to slow it down. Modern biotechnology exploits both sides for different purposes. If there is a threat from an infection or a tumor cell, the goal is to strengthen the immune system. If the immune system itself is going haywire and mistakenly targeting the body’s own tissues for destruction, as in autoimmune diseases like rheumatoid arthritis or multiple sclerosis, the goal is to dampen the system. When a kidney, liver, heart, lung, or other organ is transplanted from one person to another, the immune system of the patient receiving the transplant must be controlled so that the genetically different tissue will not be rejected, its cells attacked and killed by immune system’s cells and proteins because the body recognizes the transplanted tissue as foreign. Biotechnology methods have provided several treatments to suppress the immune response to let the body accept a transplanted organ or to reduce tissue damage caused by autoimmune diseases. Stop and Consider How has the immune system provided the opportunity for so many biotechnology drugs?
Suppressing the Immune Response Preventing the Action of T Cells
Muromonab (Orthoclone OKT3®) is a mouse monoclonal antibody that kills T lymphocytes, cells that are a part of the immune response. Muromonab, the first monoclonal antibody approved for use as a drug, is used to treat rejection of a donated kidney, liver, or
Uses for Recombinant Protein Drugs
heart graft. Daclizumab (Zenepax®) and basiliximab (Simulect®) are monoclonal antibodies that bind to the docking protein for interleukin-2 (IL-2), the key growth signaling protein for T lymphocytes, also called T cells. If T cells do not receive the IL-2 trigger, they do not increase in number and an effective immune response does not occur. These monoclonal antibodies, each made more like human antibodies in slightly different ways, prevent the effective docking of IL-2 and are used to prevent rejection of organ grafts. Stopping Immune Attacks Against the Body
are a family of immune system signal proteins that play many different roles in our bodies. Interferons were originally named because they interfered with the ability of viruses to infect cells. They also have been genetically engineered to provide treatments to weaken or strengthen the immune response. One form of interferon, interferon-beta, slows the immune response and restores balance to an immune system directing a destructive attack against the body’s own tissues. Such an attack plays an important role in multiple sclerosis (MS), a disease in which the immune system attacks myelin, the fatty insulation around nerve fibers in the brain and spinal cord. As a result of the loss of myelin, people with MS can experience attacks of weakness, eye problems, difficulty walking, and even paralysis. Several forms of interferon-beta (Betaseron®, Avonex®, and Rebif®) are used to reduce the frequency of attacks in multiple sclerosis and slow the development of handicapping disabilities.
Interferons
Controlling Hepatitis
A type of interferon produced by white blood cells, alpha interferon, has been engineered and produced to keep the progression of hepatitis C virus, a serious liver infection, under control. The first alpha interferons were slightly modified forms of natural interferon alpha produced in E. coli. More recent versions, peginterferon and
75
76
BIOTECHNOLOGY AND YOUR HEALTH
peginterferon alfa-2b (Pegasys® and Peg-INTRON®), also produced in E. coli, are alpha interferons linked to polyethylene glycol chains to lengthen the time the protein stays in the blood 20-fold, so that injections need be given only once a week rather than every other day. A chemical drug to inhibit hepatitis virus production is usually given along with the interferon to help keep the number of viruses down and to slow liver damage. Suppressing Inflammation
Cells and proteins of the immune system can trigger a set of responses that together are called inflammation. Inflamed tissue is warm, red, swollen, and painful because an injury or a wound calls in cells that make small blood vessels swell and leak blood fluids. Inflammation is what creates the redness, warmth, swelling, and pain. How does inflammation happen? The white blood cells that gather at the site of the threat produce several proteins that not only signal to other white blood cells but can also damage surrounding cells and tissues. Rheumatoid arthritis (RA) is an autoimmune disease in which immune system cells attack tissues in the joints. This attack triggers inflammation, causing pain, swelling, and, if left unchecked, crippling damage to the joints of the hands, arms, and legs. The nonprescription anti-inflammatory drugs aspirin and ibuprofen, along with several prescription anti-inflammatory drugs, are sometimes enough to treat rheumatoid arthritis, but in severe cases, these drugs may be unable to control the damage. Several recombinant proteins that target inflammation are used to treat RA. All are directed at proteins that play a part in inflammation. Etanercept (Enbrel®) is an engineered protein that combines the tail of an antibody with a part of the receptor for tumor necrosis factor (TNF). TNF is one of the cell-damaging proteins involved in inflammation. It got its name because the first thing scientists discovered that it did was kill cancer cells. Killing cancer cells is only one of its skills, however, and that may be something that happens
Uses for Recombinant Protein Drugs
only in the laboratory. Regardless,TNF is one of the major players in inflammation. Two other biologic drugs that target TNF are used to treat RA. Both are monoclonal antibodies that bind to TNF itself and take it out of action and eventually out of the body. Infliximab (Remicade®) is a monoclonal antibody to TNF, engineered so that only the TNF binding ends of the antibody contain the mouse sequence; the rest of the antibody looks like a human antibody protein. This reduces the chance that patients treated with infliximab will develop an immune response to it. Infliximab is also used to treat Crohn’s disease, an inflammatory condition that affects the intestines. Another TNF-targeting antibody used in RA, adalimumab (Humira®), was designed so that it is essentially entirely a human antibody. Scientists have also developed the ability to engineer monoclonal antibody molecules into plants. Although no plant-produced antibody has been tested in humans, a plant-produced human monoclonal antibody to the rabies virus was able to protect hamsters from rabies after they were exposed to the virus. Development in this area has been slowed by technical issues of efficiency, economics of production of monoclonal antibodies in plants, as well as environmental and safety concerns about growing genetically engineered antibody-producing plants in open fields. Biotechnologists must first overcome the technical problems that to date have prevented plant production from being economically competitive with production in cell culture. Vaccines
Vaccines made with recombinant proteins marshal an immune response to specific viruses to treat or prevent disease. Vaccines to prevent infection with the liver-damaging hepatitis viruses (Twinrix®, Recombivax HB®, and Engerix-B®) include a recombinant version of a hepatitis virus B protein. Recombinant hepatitis B protein is also included in some combination vaccines given to children. Comvax® also includes a recombinant flu virus protein,
77
78
BIOTECHNOLOGY AND YOUR HEALTH
and Pediatrix™ adds recombinant hepatitis B protein to the isolated bacterial proteins and killed bacteria of the DPT shot and inactivated poliovirus. Stop and Consider What are the advantages and disadvantages of a recombinant vaccine produced with plants?
Researchers are working to produce recombinant proteins from viruses in plants so that the leaves, fruit, or root (such as potatoes) would be edible forms of vaccine. A vaccine that is eaten may be more appealing and suitable than injections, particularly in poor parts of world with limited access to skilled health-care professionals. But there are barriers to the development of plant vaccines. First, there are technical issues. For example, would conditions within the stomach allow the immune system to respond to the protein to provide protection? Additionally, some people are concerned about the environmental and health risks of growing vaccineproducing plants in fields. Could the food be safely processed and shipped? While the development of plant-based vaccines has been a research success since first reported in 1992, it remains uncertain whether this form of biotechnology will eventually have a major impact on public health. TREATING HEART DISEASE
Heart disease, particularly clogged blood vessels, is also treated with recombinant products. Alteplase (Activase®), a human recombinant protein that breaks down fibrin, is used immediately after a stroke or heart attack to break down platelet-trapping clots in small blood vessels of the heart or brain and thus improve the patient’s chances for recovery. Purified enzymes from bacteria are used for the same purposes. Abciximab (ReoPro®), a monoclonal antibody to
Uses for Recombinant Protein Drugs
platelets, is used to keep the blood vessels of the heart open after they have been unblocked by the insertion of a small balloon, a procedure called balloon angioplasty (angio means “blood vessel” in Greek). CANCER TREATMENT
Few diagnoses trigger as much fear or have inspired as much literature and so many rousing military metaphors as cancer. Named for the Greek word for “crab,” the assorted diseases known as cancer share the problem of cells growing without normal controls but differ from each other in many ways, based on the type and origin of the cells that are growing abnormally. Our understanding of the basis for the loss of ordered cell growth has expanded as both industry and government have pumped money into cancer research. Still, cancer remains a wily adversary. The problem is that cancer is not a single disease with a single cause and single biology, and so no single cure or treatment is likely to work. Nonetheless, research has led to new treatments, some of which advance patient care and improve the chances of survival. Some of these new cancer drugs are based on recombinant biotechnology. One form of interferon, interferon-alpha (Roferon-A® and Intron-A®), produced in E. coli, is used to treat some leukemias— cancers that develop from white cells in the bone marrow. Interleukin2 (Proleukin®), the growth-triggering signal protein for T cells, engineered into E. coli, is used to treat melanoma, an aggressive skin cancer, as well as some types of kidney cancer. Conventional cancer chemotherapy drugs are cell poisons, slightly more deadly against cancer cells than normal cells. But anyone who has known someone undergoing cancer treatment will know that slightly is an important word. The loss of hair, severe nausea and vomiting, and insufficient white blood cells to fight infections that often occur with chemotherapy are dramatic evidence that normal body cells also fall victim to these therapeutic poisons.
79
80
BIOTECHNOLOGY AND YOUR HEALTH
Scientists have long hoped that biologic-based cancer treatments would provide a deadly blow to the cancer cells while leaving normal cells unaffected, thus sparing patients these devastating and sometimes lethal side effects. That ideal has proven difficult to achieve, in part because some of these biologic-based cancer treatments rely on signal proteins that have multiple functions. Interleukin-2 (Proleukin) is a good example of the narrow window between benefit and harm that new cancer therapies share with the old. Developed because it was believed to trigger an immune system attack on tumor cells, interleukin-2 treatment produces a range of side effects: fevers, aches and pains, diarrhea, nausea and vomiting, very low blood pressure, difficulty breathing, and many more. The symptoms can be nearly unbearable and even life-threatening because interleukin makes the small blood vessels in the lungs leak fluids. Depending on the kind of cancer, 2–4% of patients treated with interleukin-2 die as a result of the treatment. Interleukin-2 is also used in denileukin diftitox (Ontak®), a recombinant protein drug that combines interleukin-2 with the cell-killing part of the diphtheria toxin protein. Denileukin diftitox is used to treat a rare form of skin cancer called cutaneous T cell lymphoma that comes from T lymphocytes. Because these cancer cells may display receptors for interleukin-2 on their membranes, interleukin-2 becomes the missile that delivers the toxin warhead, killing the cancer cells. Denileukin diftitox shares many side effects with interleukin-2. Monoclonal Treatments for Cancer
Monoclonal antibodies are used in a number of cancer treatments. They can target particular molecules that are found only or most often on certain cancer cells. Gemtuzimab ozogamicin (Mylotarg®), used to treat a form of leukemia, consists of a cell-killing cancer drug purified from bacteria chemically linked to a monoclonal antibody that reacts with a protein present on the leukemia cells
Uses for Recombinant Protein Drugs
and on some white blood cells. The antibody delivers the drug to the cells and shuttles the whole thing inside, where the drug is clipped off and then binds to and damages the cell’s DNA, thus killing the cell. Antibodies can also be effective without a linked “warhead.” In some situations, the tail end of the antibody that has attached to the tumor cell starts a process that utlimately kills the cell. Rituximab (Rituxan®), a monoclonal antibody that binds to CD20, present on antibody-producing white blood cells—B lymphocytes, or B cells—and on the surface of solid tumor cells derived from B lymphocytes, is used to treat B cell solid tumors. Other antibodies used to treat cancer work by binding to a docking protein for a growth factor receptor, thus preventing the growth factor from binding. Trasuzumab (Herceptin®) is used to treat breast cancer that has spread throughout the body, and cetuximab (Erbitux®) isused for tumors of the digestive tract. Both are monoclonal antibodies that bind to two different receptors for epidermal growth factor, a protein hormone that triggers cell division. By occupying the receptors and denying access to the growth factor, the antibodies cause tumor cells to die. When used with chemotherapy drugs, these antibodies administer a double blow to these advanced tumors. Both normal cells and tumor cells require blood circulation to provide the oxygen and the nourishment they need to survive. Bevacizumab (Avastin™) is used to treat advanced forms of cancer of the digestive system; it is a reengineered mouse monoclonal antibody that binds to a growth factor receptor required for the development of blood circulation around a tumor. Stop and Consider What advantages might factory-produced biotechnology drugs have over proteins purified from humans?
81
82
BIOTECHNOLOGY AND YOUR HEALTH
CONNECTIONS
Recombinant DNA technology has provided many drugs to treat serious medical conditions. Although early biotechnology drugs were replacements for protein drugs produced from animal or human tissues, other recombinant proteins and monoclonal antibodies are novel and, through precise targeting of cell structures uncovered by modern biologic research, provide powerful and safe treatments for a wide range of conditions.
FOR MORE INFORMATION
For more information about the concepts discussed in this chapter, search the Web using the keywords: genetic disorders, HIV, AIDS, autoimmune diseases, monoclonal antibodies, cancer treatment
6 Gene Therapy to Treat Disease THE ASHANTI DE SILVA CASE
It is a warm September day in 1990. Inside a hospital room in
Bethesda, Maryland, Ashanti de Silva, a 4-year-old girl who is small for her age, lies wide-eyed as doctors, nurses, and her parents stand around her hospital bed, watching a nurse hook up something to the needle in her arm. She has experienced only a few healthy days throughout much of her short life and has frequently been subjected to poking, prodding, and injections. We can imagine their thoughts. She doesn’t understand what is going on, but her parents do. Ashanti knows the look on her father’s face, but he says over and over that this will not hurt; it is just another needle in her arm and she is getting used to that. The worried look on Ashanti’s dad’s face comes from knowing that what the doctors are doing to his daughter has never been done before. The doctors are injecting Ashanti’s own blood cells into her arm. The blood cells have been treated in a lab with a virus related
83
84
BIOTECHNOLOGY AND YOUR HEALTH
to HIV. Ashanti has an inherited defect in the production of mature immune system cells, so she is dangerously vulnerable to viruses that would be nothing more than a nuisance to a healthy child. Children with severe combined immunodeficiency, the condition that affects Ashanti, can die, and have died, from a chicken pox vaccination. Ashanti’s father has read about HIV, but the doctors have told him that this virus will not hurt Ashanti. The treated cells are supposed to be little factories to produce the protein that Ashanti needs to make her immune system work. All those blood transfusions and other injections she had in the past did not help her for very long. Despite the treatments, she could not go to nursery school or even play with her cousins when they came to visit because she might get a cold or a case of chicken pox that could kill her. This new treatment is called gene therapy, and the doctors think it might cure Ashanti. Proteins are the workhorses of the body. Genes carry information in their DNA sequence about the structure of the protein, as well as instructions for when and where to make it. Errors in the DNA sequence coding for a particular protein can make the protein fail to do its job or be missing entirely, as in people with hemophilia. The first uses of recombinant technology in medicine replaced a missing protein or a protein that did not work correctly, but scientists soon got the idea that they could replace a miscoded gene with a correct one. In fact, the possibility was first discussed in 1966, just 13 years after James Watson and Francis Crick reported that they had determined the structure of DNA, and nearly a decade before anyone learned how to move a gene from one organism to another. It took a long time to work out how gene therapy might safely be tried in human patients; the first government-approved clinical trial of gene therapy began in 1990, with 4-year-old Ashanti. More than 15 years and hundreds of clinical trials later, the FDA has not yet approved any gene therapy product. It has not been for lack of trying. By 2004, there were more than 600 human
Gene Therapy to Treat Disease
gene therapy trials worldwide, either completed, enrolling patients, or waiting for permission to proceed from the National Institutes of Health Human Gene Therapy Subcommittee. Although most gene therapy trials now focus on treating cancer, the earliest studies of gene therapy were designed to treat inherited diseases such as cystic fibrosis and immune deficiency disorders. As scientists pinpointed the specific miscoded genes for inherited diseases and learned to change the genetic coding of cells in the laboratory, they thought it would be both possible and useful to insert a correct gene into the genome of the cells affected by the disorder. If the process worked with cells in the laboratory, then getting it to work in the body would not be so difficult, but only if the cells affected by the inherited defect were easily reached. For example, in the most common form of dwarfism, the inherited defect occurs in a gene that provides a docking protein for a growth factor that is responsible for the development of bones in fetuses and children. It would be very difficult to replace the docking protein everywhere in the body. In contrast, Ashanti’s immunodeficiency is the result of something missing in the formation of her immune system cells. Researchers knew that the condition could be treated with a transplant of bone marrow cells from a suitable donor, so they needed to target only the bone marrow, and they had learned how to do that from over 30 years of using bone marrow transplants to treat leukemia and other blood disorders. The sequencing of the human genome, completed in late 2003, may still open up many more targets for gene therapy. The challenge is to get the genetic construct into the appropriate cell, and have it settle down in the cell to be copied faithfully every time the cell divides. Most importantly, it must be placed where it would direct the production of the correct protein so that the protein would be produced in the right amount and in the proper location within the cell. So far, gene therapy has not had much success.
85
86
BIOTECHNOLOGY AND YOUR HEALTH
VECTORS: GETTING GENES INSIDE CELLS
The system used to deliver the desired gene into the cells, called the gene therapy vector, may be a virus, a plasmid, or even just the “naked” DNA. The choice of vector is based on the difficulty of getting the gene into the cell, the amount of DNA the vector can carry, the size of the gene sequence needed to provide the correct protein, and the effects the vector may have on the body. Each type of vector has advantages and disadvantages. Viruses are very important as gene therapy vectors. Over the millennia of their existence, they have evolved to be very good at The Human Genome Project The Human Genome Project is a decades-long international effort by hundreds of laboratories and thousands of scientists to determine the sequence of human DNA, at least the part that codes for functional genes, working with robots and computers. The human genome is 3 billion base-pairs long, but surprisingly, contains only about 25,000 genes to direct the production of the 100,000 or so proteins in our bodies. Many genes can code for different proteins by cutting and pasting different parts together. The genome of any individual human differs from that of another by less than 0.1%, and the human genome differs from that of chimpanzees by only 2%, which suggests that even very small differences may have very big impacts. The completion of the Human Genome Project has set the stage for the discovery of new ways to diagnose and treat diseases, and new ways to predict who will develop a particular disease. But this will require not only a file with the bases all in a row, but an understanding of how the genes are organized within that sequence and how the genes that make proteins are read. Just as the entire genetic makeup of an organism is called the genome, the entire set of proteins that an organism makes is called the proteome. Scientists are working to understand how and where each protein works, and how different proteins interact with each other. To produce a complicated working body of 3 billion cells—a body that can see, hear, walk, talk, feel, and eat—means that the cells, genes, and proteins must interact well together from the time of conception to our last breath. Researchers seek to understand how these processes are orchestrated and what goes wrong when we get ill.
Gene Therapy to Treat Disease
inserting their genetic information, normally instructions to make more virus particles, into the cells that they infect. The gene therapy viral vectors retain the ability to insert their own genetic information into the cell’s genetic information, but the instructions to make more viruses have been removed and replaced with the therapeutic gene, called the payload. Most gene therapy trials have used RNA viruses as vectors. RNA viruses, also called retroviruses, use RNA rather than DNA as their genetic material. The RNA viral genome must be copied into a DNA sequence before it is inserted into the cell’s genetic material. Although well suited for introducing genes into dividing cells, such as blood-forming cells from the bone marrow, the retroviral vectors are too fragile to be injected directly into the body. Retroviral vectors are mixed with blood-forming cells removed from the patient’s bone marrow or blood. After the vector payload has been delivered to the cells, the cells are reintroduced into the patient’s body through a vein in the same way that a blood transfusion is given. Retroviral vectors are prepared to receive the payload by removal of the genes the viruses use to instruct an infected cell to produce more virus particles. Retroviral vectors are efficient at getting genes into the blood-forming cells and result in the stable insertion of the payload genetic material into the cells’ genetic material. Every time the bloodforming cell divides, the inserted gene is copied, and the gene directs the formation of the desired protein. However, the insertion of the new genetic material may change the cell’s genetic information in harmful ways (Figure 6.1). Two types of DNA viruses have also been used in human gene therapy trials. Adenoviruses, double-stranded DNA viruses, can efficiently carry a larger gene into cells even if they are not dividing, but the genetic information does not become inserted into the cell’s genetic material and the information may rapidly be lost. Adeno-associated virus vectors, made from small single-stranded
87
88
BIOTECHNOLOGY AND YOUR HEALTH
Figure 6.1 An RNA viral gene therapy vector, engineered to carry the
genetic information for a protein product, is incubated with blood or bone marrow cells removed from a patient. The foreign DNA sequence integrates into the cell’s genetic material and when the cells are returned to the patient, they direct the production of the protein product. RNA gene therapy vectors are engineered to be unable to direct the production of new virus particles.
Gene Therapy to Treat Disease
DNA viruses, can be engineered to insert small DNA sequences into a cell’s genome. Both adenovirus and adeno-associated viral vectors can withstand injection into the body. These vectors do have drawbacks, though. Adenovirus vectors can cause dangerous reactions of tissue swelling and damage. Adeno-associated vectors may cause damaging rearrangements of chromosomes. DNA alone, or trapped inside a small fatty balloon that will melt into the cell’s outer membrane, is also a possible vector. These vectors can carry large payloads, but because they do not include the viral genetic information, they are not very good at actually delivering the genetic material. PROBLEMS WITH GENE THERAPY
The idea of gene therapy has fostered great hope and not a little hype because it seems to promise precise, effective, and longlasting treatments for devastating diseases in children and adults. Unfortunately, as with many new technologies, the idea and the reality are sometimes very far apart. Just because a vector “works” in a test tube—meaning that the gene gets into the cells and the new protein is produced—does not mean that it will successfully cure a patient of a genetic disease. First, the engineered vector has to get to the right part of the body. It is not simple to get a large, complicated gene therapy vector to the exact spot that needs help, so the earliest human trials of gene therapy were targeted at diseases in which affected cells were accessible or, even better, could be removed from the body, engineered, and then returned to the patient. In 1990, Ashanti de Silva, the 4-year-old girl with inherited immunodeficiency resulting from the absence of a functional adenosine deaminase (ADA) enzyme, was given back her own T cells that had been engineered with a retroviral vector containing a gene for ADA, an enzyme required to break down chemicals that are lethal to certain immune system cells. Over
89
90
BIOTECHNOLOGY AND YOUR HEALTH
the next 23 months, Ashanti received 10 more treatments, plus the weekly injections of cow ADA linked to polyethylene glycol (PEG-ADA) she had already been getting. Did the gene therapy succeed? It is hard to tell. Twelve years after her first gene treatment and ten years after her last, she appeared to be doing well, and about 20% of her T cells carried the ADA gene. However, based on lab tests, her immune cells are not working well. She still receives PEG-ADA every week. Stop and Consider Why do you think there was so much initial excitement about gene therapy?
Cystic fibrosis (CF), an inherited condition affecting the lungs and other organs, is another genetic disease targeted by early gene therapy efforts. In 1989, researchers identified the defective protein that leads to CF, a protein that normally moves chloride into and out of cells, and controls the movement of other molecules across the cell’s outer membrane. In CF patients, the cells lining the passageway that carries air into the lungs produce mucus so thick that the lungs become clogged, making breathing difficult and infections frequent. Pancreas cells also do not work correctly in people with CF, failing to deliver enzymes that break down food. The air passage cells were a reasonable first place to test gene therapy in CF patients, because nose drops and sprays could deliver the vector, and the cells could be checked by a simple biopsy to see if the vector got into the cells and produced the correct CF protein. Unfortunately, despite great efforts to design a CF gene therapy vector, and after at least 19 clinical trials, no satisfactory vector has been found that can provide safe and reasonably stable production of the normal protein in airway cells. Research continues; at least scientists now know many approaches that do not work.
Gene Therapy to Treat Disease
UNINTENDED CONSEQUENCES OF GENE THERAPY Immune Deficient Children
In 2000, French researchers announced the first gene therapy cure in nine children with X-linked severe combined immune deficiency (X-SCID). This rare condition is caused by the inherited loss of a protein that is part of the docking site for critical immune system signal proteins. Because of this defect, children with X-SCID have no mature, working lymphocytes—critical immune system cells. As a result, they are so susceptible to viral and bacterial infections that they rarely survive infancy. In the French scientists’ research, blood stem cells were removed from an affected child, treated with a retroviral vector carrying a normal docking protein gene, and returned to the child. Nine out of ten children treated in this way developed functional, mature immune system cells, which provided them with protection against infections. News articles proclaimed that a cure had been found. Stop and Consider What would you want to know before you took part in a gene therapy trial?
However, within a few months, two of the nine children developed a form of leukemia that had been triggered by the insertion of the payload gene too close to a gene that controlled the division of those cells. Uncontrolled increases in the number of white blood cells cause leukemia. The two children were treated with chemotherapy for the leukemia. One patient’s leukemia returned and the child was then treated with a bone marrow transplant, but subsequently died. The same study reported that a third child showed evidence of uncontrolled growth of white blood cells. In addition, a U.S. researcher reported that a monkey treated with cells changed by a similar vector died of a white blood cell tumor. The FDA called a halt to human
91
92
BIOTECHNOLOGY AND YOUR HEALTH
trials using a retroviral vector to treat X-SCID and convened an expert committee to review the data and give advice as to whether to make the hold permanent. The committee suggested that the FDA permit the use of such vectors only for X-SCID patients with no other treatment option, such as a bone marrow transplant from a relative. This failure was another blow for gene therapy. The unexpected problem has made researchers focus on better understanding and controlling where a payload gene is inserted in the target cells’ genome. Death of a Gene Therapy Volunteer
In 1999, Jesse Gelsinger, an 18-year-old from Arizona with a mild form of an inherited deficiency of the liver enzyme ornithine transcarbamylase (OTC ), died during a gene clinical trial at the University of Pennsylvania, triggering a tightening of the review process and oversight of such research. He was enrolled in an early stage trial to determine the safety of treating OTC deficiency by delivering an adenovirus vector that carried the gene for OTC to the liver. Severe forms of OTC deficiency can result in brain swelling, coma, and death soon after birth, but mild forms can be controlled with changes in diet and with drug treatment. Although Gelsinger had the mild form of OTC deficiency, he volunteered for a University of Pennsylvania trial to test the safety and efficacy of increasing doses of an OTC vector because he wanted to help severely affected newborns. He died four days after the vector was injected into a blood vessel in his liver. An autopsy showed that he died of a severe inflammatory response to the adenoviral vector, which led to a blood reaction that caused most of his organs to shut down. The media coverage of Gelsinger’s death was extensive, and investigations by federal agencies discovered several serious lapses in following the rules for conducting human trials. The University of Pennsylvania clinical gene therapy unit had failed to disclose to university safety monitors, to federal regulators, and to Gelsinger
Gene Therapy to Treat Disease
and his family, signs of toxicity its researchers had seen with lower doses of the vector. Additionally, the trial’s principal investigator had treated Gelsinger with the vector despite lab test results that should have disqualified Gelsinger for the trial. These findings led to changes in how applications to perform gene therapy clinical trials are reviewed, how local and federal agencies monitor trials, and how adverse events among subjects in trials are reported. The study protocols for all proposed clinical trials, including those involving gene therapy, are reviewed for soundness of the science as well as risks and benefits to the subjects, the study staff, and society as a whole. Clinical study protocols must include background justification for the trial and criteria for enrolling or excluding subjects, as well as information about exactly what the subjects will be given, what tests will be done, and how the safety of the subjects will be monitored and protected. Subjects in clinical trials must give informed written consent after they have received all the available information about the treatment plan, communicated in a language they can understand. Since Jesse Gelsinger’s death and the ensuing investigations, human gene therapy trials have been watched much more closely. Groups reviewing proposals for gene therapy clinical trials include the Recombinant Advisory Committee of the NIH; the Center for Biologics Evaluation and Research of the FDA; the hospital’s Institutional Review Board, which is responsible for assuring that human subjects will be protected; and the Institutional Biosafety Committee, which assesses the safety of the patient, the research staff, and the public. During the clinical trial, an independent safety board of experts, established by the hospital, monitors patient data for evidence of serious adverse events and for evidence that the agreed-upon study protocol is being followed. Currently, the FDA requires several months of follow-up for each subject before a new subject may begin treatment in a gene therapy trial, a situation that will slow the rate at which the field advances.
93
94
BIOTECHNOLOGY AND YOUR HEALTH
PRO
OR
CON ?
Children in Clinical Trials Should new medical treatments be tested on children? This is not a simple question. Adults, protected by all the federal rules about how clinical trials should be handled, are generally considered capable of giving or withholding consent to participate in a trial, after being informed of the potential risks and benefits. Children under the age of 18 are thought to be too immature to understand what they are being told and to judge the risks. Therefore, their parents or guardians must give consent for them, but some people question whether the parents of a sick child can make an objective decision about such an issue. Parents may want to believe that the doctor knows best and would not suggest that a child take part in a trial if it were not in the child’s best interest. Children are also seen as too fragile to withstand the risks of experimental treatments, so for many years, children were not included in studies of new drugs. However, because drugs were not tested on young people, no one really knew if a particular drug was safe and effective for children. Children are not just small adults. They may have distinct ways of absorbing and removing drugs from their bodies. The amount of the drug given and the timing of its administration may be inappropriate, even if a child’s size is taken into account. In addition, some diseases appear more often or have a different pattern in children. In 1998, the FDA and the NIH began to require that children be included in clinical trials if the treatment was intended to be used in children. The inclusion of children has to be scientifically and ethically justified and parental consent must be sought and obtained. In addition, unless a child’s participation in a trial is essential to his or her welfare, the American Academy of Pediatrics recommends that a child’s refusal to participate be respected.
Gene Therapy to Treat Disease
Stop and Consider Do you think the current slow pace of gene therapy is a good thing, or will the caution slow the availability of treatments for devastating disease?
CONNECTIONS
The potential for gene delivery to actually become gene therapy seemed very clear decades ago when biotechnology was a young science, at least in the modern sense. But reality has clouded the promise. The challenges of delivering the correct gene to the appropriate cells and tissue, leading to production of enough protein for a long period of time, and doing so without causing more harm than good, have proven to be significant. Laboratory studies, animal tests, and human trials continue, though the latter are moving more slowly than in the past because of unforeseen problems. The next few years will show whether these approaches will prove to be safe and effective. The increased review, oversight, and caution that were triggered by Jesse Gelsinger’s death and by the leukemia in the French children may be necessary in order for regulators and the public to regain confidence in procedures used to protect subjects. FOR MORE INFORMATION
For more information about the concepts discussed in this chapter, search the Web using the keywords: gene therapy, cystic fibrosis, severe combined immunodeficiency disorder (SCID)
95
7 Gene Therapy for Cancer Treatment Trials of gene therapy for inherited conditions have captured the most
media headlines, good and bad, but they account for less than 10% of the 987 gene therapy trials done worldwide between 1989 and 2004. While some of the other 90% of gene therapy trials are directed at chronic diseases such as arthritis, multiple sclerosis, and heart disease, over two-thirds of such trials are directed toward the treatment of cancer. Cancer gene therapy trials fall into two major categories: those aimed at creating or strengthening an immune response to cancer, and those targeted to a genetic alteration or susceptibility of cancer cells (Figure 7.1). Such trials build on our growing understanding of the immune system and/or insights into genetic changes that take place within cancer cells. Though both have been exciting areas of research, a great deal about the biology of cancer cells and their interactions within the human body is not yet fully understood.
96
Gene Therapy for Cancer Treatment
Figure 7.1 Some of the approaches to cancer treatment using gene
therapy are illustrated here. Gene therapy research for cancer treatment has focused on boosting the immune response to tumors by delivering immuneactivating signal proteins or by delivering a gene based vaccine. Another focus has been the direct delivery of genes to convert inactive drugs, block the growth promoting effects of oncogenes, or replace a mutant tumor suppr essor gene.
97
98
BIOTECHNOLOGY AND YOUR HEALTH
IMMUNE-BASED CANCER GENE THERAPY STRATEGIES
Many cancer cells are sufficiently different from related normal cells that our immune system can recognize the differences and should be able to attack the tumor as the unwanted interloper that it is. But sometimes the differences may not be great enough, or the tumor cells—wily creatures that they are—may have developed the ability to ward off an immune system attack. Cancer is not one disease, but many, and in most cases, specific changes in the genetic makeup of cancer cells are responsible for the uncontrolled growth of that form of cancer. Strategies to unleash an immune response to a particular kind of cancer must take into account the type of cancer and its genetic changes. One strategy for immune-based gene therapy for cancer is delivery to tumor cells of a gene for an immune system signal protein that will kill the tumor cells or call up an immune attack. Because immune system signal proteins such as interleukin-2 have so many different kinds of effects, they are generally too toxic to be administered to the whole body. Delivering the gene construct to tumor cells so that they produce the protein themselves makes more sense. Several immune system signal protein genes, including interleukin-2, are being tested in this way, either alone or in combination with conventional chemotherapy drugs or radiation. Stop and Consider Why do you think there are so many gene therapy trials for cancer?
A specific immune response requires the delivery of a small bit of the target protein, the antigen, to immune system cells. Another immune-based gene therapy approach being studied for cancer is to engineer a patient’s antigen-presenting cells outside of the body with the tumor antigen gene, and then return the altered cells to the patient to efficiently deliver the “call to arms” to the immune system
Gene Therapy for Cancer Treatment
cells. These approaches seem logical and have worked in one or more animal tests, but still remain unproven in humans, despite some small human studies. The specific genetic changes responsible for the uncontrolled growth of cancer cells are found in oncogenes, genes everyone has that promote the growth of tumors if the sequence changes, and tumor suppressor genes that normally suppress the growth of tumors. Some of the tumor suppressed genes that are changed in cancer cells are those that normally prevent the death of cells by suicide or trigger cell death if the cell DNA is damaged. This programmed cell suicide is called apoptosis (Figure 7.2). Several human tumors have mutations in the tumor suppressor genes that prevent those genes from functioning. Delivery of normal, unchanged tumor suppressor genes to trigger apoptosis has been promising as a cancer treatment both in animal tests and in limited human trials. For example, an adenovirus vector carrying the p53 tumor suppressor gene reduced the size of the tumors when injected directly into human tumors. Three months after treatment with the p53-carrying adenovirus, combined with radiation, 63% of patients with a form of lung cancer had no detectable tumors. Another gene therapy approach being explored for cancer is delivery to tumor cells of a gene for an enzyme protein that changes an inactive form of a drug to the active drug that kills the tumor cell. The tumor cell is thus made into the engine of its own death, which is why this type of trial is sometimes called a “suicide gene” trial. The enzyme genes are derived from viruses or non-mammals, such as a gene for an enzyme that converts a drug used to fight virus infections into a drug that is toxic to cells. Tumors are masses of cancer cells and can only survive if nutrients and oxygen are provided by blood. Researchers are developing promising drugs, including recombinant proteins, that deprive tumors of this sustenance by preventing the development of blood vessels at the tumor site. The growth of blood vessels is called angiogenesis. Gene therapy strategies and vectors are being developed
99
100
BIOTECHNOLOGY AND YOUR HEALTH
Figure 7.2 Programmed cell death (PCD) is also called apoptosis. The
process is shown here. In programmed cell death, a cell dies through structural changes and the breakdown of the nucleus is followed by ingestion of the cell by scavenging white blood cells. PCD is a normal process in development and in response to DNA damage that cannot be repaired.
Gene Therapy for Cancer Treatment
to block angiogenesis by delivering to a tumor a vector with a gene that would prevent angiogenesis as the tumor increases in size, thus starving the tumor. This method has been effective in animal tests but has not yet been tested on humans. The large number and types of gene therapy trials for cancers reflect both the potential opportunities to develop treatments and the fact that a single strategy will not likely work for all forms of cancer. The Use of Antisense
Another promising molecular approach to treating cancer, studied for decades, uses specific RNA molecules to target oncogenes and other genes that permit a cancer cell to thrive and grow. The goal is to prevent the production of the protein that causes the uncontrolled division of tumor cells. The idea behind this approach is that a short piece of DNA or RNA would bind specifically to a messenger RNA, founded on its sequence of bases, and prevent the message from being used to make the protein. This would stop the cell division of cancer cells and possibly cause cancer cells to die. Synthetic RNA and DNA drugs have been named antisense because they were crafted to bind to the single strand of the RNA message, the “sense” sequence that would normally be translated into protein. As more and more oncogenes were implicated in the ability of specific cancer cells to divide and increase in number without normal controls, efforts were made to produce an RNA antisense drug that stopped that growth. Although test-tube studies in the lab have often been successful, antisense drugs face formidable challenges. They must resist being broken down by enzymes in the blood. They must also be able to get to and into the cells. They also need to be able to clamp onto the targeted message once they get inside the cell. A number of different chemical modifications of the basic RNA antisense have shown promise in the lab and in animal test systems, (continued on page 104)
101
102
BIOTECHNOLOGY AND YOUR HEALTH
Cancer: Done in by Genes Cancer cells of all kinds share the capacity to increase in number, free of the normal controls on cell division. They also have the ability to survive for very long periods of time. Normal cells generally divide and increase in number only when the body tells them to do so through chemical signals. Cancer cells have acquired the ability to divide without outside signals, as long as they have proper nutrition. The cancer cells get this capacity for growth from genetic changes. Two different types of genes are changed in cancer: oncogenes and tumor suppressor genes. Oncogenes are mutated forms of protooncogenes—normal genes that stimulate cell division. Studies of how certain animal RNA viruses caused cancers in animals led to the discovery of oncogenes and protooncogenes. Scientists suspect that the viruses picked up the oncogene sequences during their evolution. There are many different protooncogenes. They either code for proteins that are part of the cell’s internal machinery for cell division (Figure 7.3), code for proteins that are part of the machinery that a cell uses to respond to an outside growth signal, or code for proteins that normally prevent the cell from dying. The mutated forms may allow the cell to survive and divide repeatedly, even in the absence of the growth protein. A single copy of a mutated oncogene is enough to give rise to cancer. Tumor suppressor genes normally function as gatekeepers to prevent cell division when the cell’s DNA is damaged or when conditions are not right—for example, when there is a shortage of nutrients or when a protein signal required for cell division is missing. Mutated tumor suppressor genes allow cells with damaged DNA to survive and go through many cycles of cell division, thus increasing the chances that a mutated cell that cannot properly control cell division will survive and increase in number. The changes found in the genetic material of cancer cells may be very extensive. Both copies of a tumor suppressor gene must be mutated in order to allow cells with such changes to survive. Because they are mutations that add properties to a cell, oncogenes may be seen as more difficult to correct, or turn off, through gene therapy approaches. Because they represent a loss of function, mutations in tumor suppressor genes would appear to be easier to correct through gene therapy techniques that put the normal gene back where it belongs.
Gene Therapy for Cancer Treatment
Figure 7.3 The cell cycle is illustrated in this figure. Cell division proceeds through discrete phases: G1 during which the cell grows and prepares for division; the S phase where the DNA content and chromosomes double; G2 where the cell develops the structures needed for cell division; and the M phase where the nucleus splits into two and the cell divides into two daughter cells.
103
104
BIOTECHNOLOGY AND YOUR HEALTH
(continued from page 101)
and some antisense molecules are now being studied in human cancer patients. However, the only FDA-approved antisense drug is fomiversin (Vitravene®), which is used to treat cytomegalovirus infection of the eye. (Cytomegalovirus [CMV] is a common DNA virus related to the viruses that cause chicken pox, mononucleosis, and fever blisters. CMV does not usually make people sick, but it can hide out in the body, and if the immune system is weakened, it can cause illness and damage to the retina.) Fomiversin is injected directly into the eye. Discovered in the 1980s, ribozymes are RNA molecules with a very distinct hammerhead structure. They function as enzymes and directly cut RNA. Synthetic ribozymes targeted to specific messenger RNAs have been used in many laboratory studies with cells. Efforts to develop ribozyme treatments targeted to specific cancer genes and for other uses have not succeeded in clinical trials, partly because the structure of the ribozyme that is needed to allow it to work as an enzyme was destroyed when it was injected. Over the last few years, research has suggested that antisense doesn’t work simply by interfering with the ability of the proteinmaking machinery to read the messenger RNA. Instead, it must actually set up the message to be destroyed. Laboratory experiments with cells indicated that in some cases, the single-stranded antisense was less effective in preventing the production of the targeted protein than a double-stranded RNA made up of the antisense and sense sequences. Double-stranded interfering RNA has become a very useful laboratory tool for studying the function of a protein. This is because the message for the protein targeted by the interfering RNA is destroyed and the protein production is stopped, or at least severely curtailed. If you knock out the protein and see what goes wrong, you can understand more about what the protein does. However, as with vector-based gene therapy, fooling Mother Nature is not so easy. First, if double-stranded RNA is delivered to cells at too high a concentration, it is not specific and may damage other
Gene Therapy for Cancer Treatment
cells. In addition, if large double-stranded RNA is delivered to a whole animal, it will activate some immune system responses. Researchers are trying to learn how to use appropriate doses of small interfering RNA (siRNA) in animal experiments to treat certain cancers, liver damage caused by virus infections, shock caused by potentially lethal bacterial infections, and possibly HIV. The potential of siRNA seems very great, but only careful tests in whole animal model systems and human trials will eventually prove whether this seemingly surgically precise molecular clipper can work. Stop and Consider Why are cancer cells attractive candidates for gene-specific therapies?
CONNECTIONS
Over the last few decades, several types of gene-directed strategies have been proposed as cancer treatments, based on scientists’ understanding of the genetic changes in tumor cells that allow them to grow out of control. Despite many years and many trials, gene therapy, antisense, and ribozymes have so far failed to provide a useful anticancer drug. Newer approaches, particularly siRNA, are currently poised for critical testing. Experience with older approaches may provide lessons for researchers that increase the chances for success against cancer—one of our most formidable medical adversaries. FOR MORE INFORMATION
For more information about the concepts discussed in this chapter, search the Web using the keywords: cancer genes, oncogenes, tumor suppressor genes, angiogenesis, small interfering RNA
105
8 Replacing Cells BLOOD TRANSFUSIONS
A little sheep’s blood may be just the thing to calm a distracted
student. At least that was the idea proposed at the English Royal Society in 1667, the same venue where, in 1628, Dr. William Harvey described the circulation of blood for the first time. A transfusion of 12 ounces of sheep’s blood was administered to a divinity student who was said to be “crack-brained;” apparently that meant he was inattentive and disruptive. The volunteer seemed to be no worse after the procedure, but he did refuse any further transfusions. By 1678, the transfusion of blood from animals to humans had sickened and killed several people, and was outlawed in England and France. Since that time, transfusion of human blood has become safe and widely available. Advances that made this possible include the development of antiseptics to reduce infections from person
106
Replacing Cells
Figure 8.1 When a person receives blood, it is essential that the ABO blood
groups are compatible. ABO Blood Group testing for blood transfusions is illustrated here. Antibodies in the serum (the clear part of blood) form clumps of red blood cells when they come in contact with red blood cells of an incompatible blood group. For example, the sera of O and B transfusion recipients would cause clumping of red cells from donors whose blood is type A or AB.
to person during blood transfusions, the discovery of the ABO blood the recognition of the importance of ABO matching to prevent deadly transfusion reactions, and the discovery of simple ways to keep blood from clotting (Figure 8.1). Today, human blood is routinely used to replace blood lost in accidents, surgery, or childbirth, or to supplement lack of certain blood components. groups,
107
108
BIOTECHNOLOGY AND YOUR HEALTH
Blood is also regularly tested, not just for blood group compatibility, but also for infections carried in the blood such as human immunodeficiency virus (HIV) and hepatitis B and C viruses. Early in the AIDS epidemic, before the AIDS virus was identified and a test developed to detect whether a person has been exposed to the virus, patients did contract HIV through blood transfusions. Today, every unit of donated blood is tested for the presence of HIV, as well as for hepatitis B and C viruses. But why transfuse blood? If your body is not able to deliver enough blood to vital organs, you can become unconscious and die. Whole blood is rarely used for transfusions today. Immediate replacement of the fluid volume for substantial blood loss is critical, but a sterile salt solution can be used for this purpose. Blood is composed of both a fluid part and cells. The fluid part of blood, the plasma, contains many different proteins, including disease-fighting antibodies and proteins that help the blood to clot (Figure 8.2). The red cells are the most numerous, but various kinds of white cells are important for fighting infections. The red cells carry oxygen from the lungs to the tissues and take waste carbon dioxide from the tissues to lungs. A substantial loss of red blood cells in an accident or during surgery may require a transfusion of red blood cells suspended in a small volume of salt solution. The proteins in the fluid portion of the blood, which can take the form of fresh frozen plasma or concentrate, may be used to help the blood of hemophilia patients to clot. Platelets—the small bits of cells critical for blood clot formation—are removed from donated blood, stored in a preserving salt solution, and transfused into patients who have trouble producing their own platelets because they have blood cancer or are undergoing cancer treatment. Additionally, infection-fighting white blood cells may be obtained from a donor and transfused into a patient who is unable to produce white blood cells. Recombinant drugs to stimulate the body’s ability to form red or white blood cells may also be used in patients.
Replacing Cells
Figure 8.2 A developing blood clot is shown in this picture. A blood clot is
made of platelets, membrane fragments of a bone marrow cell, and a network of insoluble proteins, particularly fibrin generated from a precursor protein, fibrinogen, through the work of a cascade of protein clotting factors. Several bleeding disorders result from inherited deficiencies in clotting proteins.
Despite all the advances in storing or distributing blood, providing life-saving red blood cell transfusions in disasters and on the battlefield remains a challenge because facilities are not readily available for cold storage of large quantities of red cells. Researchers have worked for decades to come up with a red blood cell substitute,
109
110
BIOTECHNOLOGY AND YOUR HEALTH
both before and after the introduction of biotechnology techniques that let scientists design protein at will. Scientists focused first on hemoglobin purified from human blood, and then on forms of hemoglobin engineered in the laboratory. Their goal was to come up with a protein that could be dehydrated for storage at room temperature and dissolved in a salt solution to provide the life-saving capacity to transport oxygen similar to that of intact red blood cells. Researchers have even packaged the hemoglobin in a fat and protein sack to mimic the structure of a red blood cell. Despite all the elegant and laborious efforts, no red cell substitute has yet proven safe and effective. Now researchers are analyzing how hemoglobin is tethered inside red cells so that it is efficient at picking up and delivering the oxygen and carbon dioxide as needed. STEM CELLS
Blood cells are not the only type of cell therapy on the horizon. Scientists are now working on another type of cell therapy, called stem cell therapy, which would take immature cells and coax them into becoming specialized cells in the laboratory to repair damaged or poorly functioning organs. Stem cells are potentially the raw material that could make medical repairs that are currently impossible with drugs. To use these cells, scientists must understand how stem cells have the ability to divide repeatedly without specializing, yet under the right conditions, turn into all kinds of cells: liver cells, heart muscle cells, bone-producing cells, and so forth. The human body’s entire system of a billion or more cells develops from a single cell—the egg fertilized by the sperm. As this cell divides to form all the different tissues and structures of the growing fetus, the daughter cells become specialized in the kinds of proteins they produce. Think of the entire set of genes as inherited instructions to form more than 100,000 proteins when and where they are needed. Going from the single-cell embryo to the enormous collection of specialized cells that make up our body is an
Replacing Cells
111
orchestrated process of calling up particular sets of those instructions and manufacturing the proteins as instructed so that the resulting specialized cells can perform particular functions. In very simple terms, the control of the process is what makes a liver cell perform liver functions instead of growing hair. This specialization does not occur in a single step. Instead, it happens as a series of discrete steps that the cells take as they commit to becoming a particular kind of cell. This process of commitment to specialization is called differentiation. The embryo cell, and the cells produced during the first few rounds of cell division, retain the ability to become any type of cell in the body. As the cells of the embryo go through more rounds of cell division, the cells become more specialized and the kind of tissue or organ they can build appears to become more limited (Figure 8.3). U.S. Policy on Stem Cell Research Few things have stirred more debate than the prospect of human cloning—producing an exact genetic copy of a person from his or her cells. There is little or no support for cloning to produce a child, because of both safety and ethical concerns. However, the potential of embryonic stem cells and therapeutic human cloning to provide treatments for a number of devastating and untreatable conditions, such as Parkinson’s disease, has received substantial support and media attention. Animal experiments suggest that embryonic stem cells may be able to provide cells to treat Parkinson’s disease, multiple sclerosis, brain and spinal cord injury, diabetes, hearts damaged by heart attacks, and many other conditions. Scientists have suggested that somatic nuclear transfer (SNT) be used to generate embryonic stem cells to avoid the risk that the patient’s immune system will attack and destroy the transplanted cells. In 2001, President George W. Bush developed a U.S. policy regarding work with human ES cells. He proclaimed a ban on the use of federal funds for work on human ES cell lines that were not generated before August 9, 2001. Federally funded researchers may work on human ES cell lines created before that date. Research on human ES cells is going on without these conditions in several other countries. Several states, including California, have passed laws providing funding for work on human ES cells within the state.
112
BIOTECHNOLOGY AND YOUR HEALTH
Figure 8.3 Specialized cells and tissues in our body develop in stages. The embryo
inner cell mass develops into three layers: the outer layer, or ectoderm, that will become skin, eyes, and nerves; the inner cell layer, the endoderm, that develops into the lungs, liver, and the lining of our digestive system; and the middle layer, the mesoderm, that develops into bones, muscle, and blood.
Replacing Cells
Blood-forming Stem Cells
Scientists have known for a long time that stem cells taken from the bone marrow, the soft tissue inside the hollow part of most bones, can develop into all the different types of blood cells. These blood-forming, or hematopoietic, stem cells are now the most widely used stem cells in medicine. Most types of blood cells survive for only a short time and the hematopoietic stem cells are constantly replacing both themselves and the dying blood cells. Blood-forming stem cells are normally present in very small numbers in the blood, but will increase if a person is treated with recombinant forms of protein growth factors (described in Chapter 5) that dock onto a protein on the surface of the cells and trigger the cells to divide and become mature blood cells. Another source of blood-forming stem cells is the blood in a newborn’s umbilical cord. Hematopoietic stem cells are used to treat people whose own blood-forming cells fail because of a rare condition called aplastic anemia, or to help people who have been accidentally exposed to very high doses of irradiation. Hematopoietic stem cells are most often used as part of the treatment for certain forms of cancer. Sometimes cancer patients are given very high doses of irradiation and/or chemotherapy drugs that destroy the blood-forming stem cells in the bone marrow. Transplants with the patient’s own blood stem cells that were removed before the treatment, or stem cells from a healthy donor, allow the patient to recover. The transplant process is very simple: The cells in a salt solution are slowly injected into a vein just like a blood transfusion. If the blood stem cells come from a donor, then the donor and the patient must share certain inherited proteins to make sure that the donor’s immune system cells will not attack the treated patient. This condition, called graft versus host disease, can severely damage the intestines, liver, and other organs, and may be fatal. Multitalented Stem Cells
Recently, scientists have also become very interested in other, more versatile, kinds of stem cells—stem cells that may be able to develop
113
114
BIOTECHNOLOGY AND YOUR HEALTH
into many different types of specialized cells. Two different types of cells are the focus of interest, embryonic stem (ES) cells and adult stem cells. The ES cells are found in the very early-stage embryo. Adult stem cells refer to cells found in one tissue that may be able to develop into specialized cells of another tissue or organ. Think of a cell found in liver that, under the right circumstances, might be persuaded to develop into a nerve cell. In the laboratory, ES cells can divide over and over again, under the right conditions, producing many more ES cells that, with the addition of certain chemicals, can change into one of many different kinds of specialized cells. Animal experiments have shown that a single embryonic stem cell can become any cell in the body. Because, as the source of the entire adult body, ES cells can become every kind of cell, they are called totipotent. Stop and Consider What are the possible uses of ES cells in healthcare? What are some of the scientific barriers to the potential of ES cells? What approaches are being explored to overcome these barriers?
Adult stem cells are tucked away in specialized tissues and organs, such as bone marrow, skin, liver, fat, kidney, and even the brain. The accepted and established role of adult stem cells appears to be to help maintain the organ in which they are found and to allow that organ to repair itself if damaged. But is the potential of adult stem cells limited to just a few options? Some scientists believe that stem cells in some adult tissues may have the ability, under the right conditions, to become many different kinds of specialized cells and not just the cells of the tissue in which they are found. That would mean that some adult stem cells, though not totipotent like embryonic stem cells, are pluripotent, meaning that they could change into a number of different types of specialized cells, given the right circumstances.
Replacing Cells
The ability of adult stem cells to become something other than what they were destined to be is controversial. One team of scientists has reported that a particularly promising adult stem cell, isolated from bone marrow and called a multipotent adult progenitor cell (MAPC), appears able to develop into many different kinds of specialized cells in the laboratory. Other scientists have not been able to reproduce these results. Additionally, scientists have reported that stem cells found in fat can become muscle cells, nerve cells, or even pancreas cells able to make insulin, under the right laboratory conditions. Researchers in Germany treated a girl who had a massive skull injury from a fall with bone-repair cells grown from her own fat plus a graft of her own bone. The story is an example of both the heroic efforts made on behalf of a patient when standard treatment fails and also of the uncertainty of whether these uses of the stem cell make a difference. Immediately after the fall, the child had developed increasing pressure in her skull and the surgeons had to remove pieces of her skull bone. They stored the pieces in a freezer for three weeks and tried to use them with plates of titanium to provide a protective covering for her brain. But the repair became infected and the bone graft failed. Next, a team of surgeons and technicians worked in the operating room to build an ingenious and novel graft. They spread a paste made from a piece of the girl’s hip bone onto a mold made of sheets of dressing that would eventually be broken down. They put the paste-covered mold in place, and covered it with more protective dressing. None of this was new technology—but then they added stem cells. During the surgery, they had taken a little bit of fat from the girl’s hip and had isolated stem cells from it. When the molded graft was in place, the doctors injected the stem cells into holes in the protective sheet and then sprayed the whole thing with a sticky spray made from the girl’s own fibrin, a blood protein involved in blood clotting and wound healing. After six weeks, the patched area was strong that the
115
116
BIOTECHNOLOGY AND YOUR HEALTH
child no longer had to wear the helmet she had worn for the previous year since her fall. At three months, scans of her skull showed bone formation where the defect had been. This was quite an amazing procedure, but there is no way to be sure that the addition of stem cells made a difference in the result. New methods will have to be developed to track the stem cells to see if they became part of the final graft. Early efforts like these provide hope that it may be possible to incorporate the use of stem cells into complex medical procedures, but like bone marrow transplants in their early days, it will take many years and controlled clinical trials to have full confidence in the role of adult stem cells. In a general way, the question about the versatility of adult stem cells comes down to whether the library of genetic instructions is irreversibly changed as cells specialize, and whether some parts then become unusable. This is a fundamental question that scientists have been studying for many years, and the answers are not yet certain. It is also a practical question, since if stem cells from one or more adult tissue are pluripotent, then such cells might be taken from an individual and used to repair and replace any, or at least many, of his or her tissues that are not working correctly. POSSIBILITIES OF STEM CELL THERAPY
Excitement about ES-derived cells has been fueled by several reports of laboratory and animal studies. In Parkinson’s disease, symptoms result from a loss of cells that produce a critical signal molecule. Cells that produce the signal were created in the lab from mouse ES cells. When injected into the brain, they reduced symptoms in mice with a form of Parkinson’s disease. Strains of rats and mice have been developed or discovered that are unable to produce myelin, the fatty insulation that normally covers the nerve fibers of the brain and spinal cord. Injection of insulationproducing cells generated from mouse ES cells produced myelin on the nerve fibers of these animals.
Replacing Cells
These results raise the possibility that stem cells might provide treatment for spinal cord injury and multiple sclerosis. Several groups of researchers have been able to produce working heart muscle cells from mouse and human ES cells. One study with mouse ES-derived heart cells found that the cells did not substitute for damaged heart cells but did trigger repair of the damaged muscle when injected into a mouse with a damaged heart. Mouse ESderived insulin-secreting pancreas cells have worked when injected into mice whose own insulin-producing cells had been destroyed, though the experimental diabetes was not entirely reversed. These are just a few of the possibilities currently being studied. Challenges That Face Stem Cell Research
There are many scientific challenges to the use of either adult or embryonic stem cells, including establishing conditions that will allow scientists to produce large numbers of stem cells in the lab. Scientists must learn what needs to be done to allow stem cells to increase in number without dying off or changing, and what conditions are required to cause the stem cells to turn into one of the different types of specialized cells. Finally, researchers need to learn how to get the specialized cells to go to the part of the body where they are needed and to function correctly. The safety of laboratoryderived specialized cells for treating human disease is also unknown. The long-term safety of these cells has not been tested in animals. Will it be possible to produce specialized cells free of other kinds of unwanted or unnecessary cells? Will the specialized cells—whether liver, heart muscle, or pancreas cells—remain just that, or will they revert to a more primitive cell? That is, will they acquire genetic changes that lead them to go through rounds of cell division, free of the normal signals that restrain and regulate cell division? The concern is that such a cell might act like a tumor. Finding the answers to these questions will take a lot more work and time.
117
118
BIOTECHNOLOGY AND YOUR HEALTH
Stop and Consider Why do some scientists view adult stem cells as more promising than embryonic stem cells?
Immune System Problems
The use of specialized cells produced from embryonic stem cells faces another challenge: The patient’s immune system may destroy them. Because of inherited transplant proteins, specialized cells developed from embryonic stem cells may be attacked and destroyed by the immune system of the person who receives such cells. Some scientists believe that this kind of an attack would not happen, because they have found that embryonic stem cells and the specialized cells produced from them in the laboratory do not make enough of the transplant proteins to trigger such an attack. If this is not the case, however, there may be a possible solution: a process called therapeutic cloning. In therapeutic cloning, the nucleus of a donated egg cell is replaced with a nucleus from a patient’s cell. The resulting cell would be grown in the lab through several rounds of cell division to produce a very early embryo from which embryonic stem cells would be taken and treated further to generate the specialized cells for treatment, whether insulin-producing cells, heart muscle cells to replace cells damaged in a heart attack, or something else. Because the nucleus used for the technique is taken from a somatic cell, a cell not destined to produce eggs or sperm, the process is also called somatic nuclear transfer (SNT). The embryo created in the lab would be, in genetic characteristics, a clone of the donor of the nucleus, the patient him- or herself. The transplant proteins made by the specialized cells would perfectly match the patient’s because the genes directing their production would be the patient’s own. Ethical Arguments
Research on human embryonic stem cells and therapeutic cloning
Replacing Cells
is controversial. Gaining access to embryonic stems cells to develop cells for treatment requires the destruction of an embryo. Therapeutic cloning involves creating a very early embryo in the laboratory that would be destroyed to obtain the embryonic stem cells. The idea of destroying an embryo, or creating an embryo for the sole purpose of harvesting cells, is profoundly troubling to many people. Many people, for religious or other reasons, believe that human life begins at fertilization and that it is morally wrong to create an embryo only to destroy it to obtain the ES cells. To overcome these problems, adult stem cells may provide useful cell treatments without the destruction of an embryo, if they can be reprogrammed in the lab to unlock the genetic instructions that were thought to be unavailable. Stop and Consider Think about your beliefs on the issue of human embryonic stem cells. Do you support their use? What kind of laws should we have in place to regulate the work? Where would the possibility of cures for devastating illness like Parkinson’s disease fit into your consideration?
CONNECTIONS
Cell treatments are as simple and routine as a blood transfusion and as uncertain as the use of specialized cells produced in the laboratory from adult or embryonic stem cells. The history of blood transfusion suggests that it will take a lot of research and perhaps a long time to solve the mysteries of these stem cells. From the first sheep blood transfusion, it took several hundred years for physicians to learn how to transfuse blood safely. Even today, it takes constant vigilance and research to make sure a blood transfusion is safe, a lesson learned tragically in the early years of the AIDS epidemic. Blood stem cell transplants, though life-saving in some situations, can pose the risk of potentially deadly graft versus
119
120
BIOTECHNOLOGY AND YOUR HEALTH
host disease. How to work with other types of stem cells presents many challenges, both scientific and social. Stem cell technology is cutting-edge science and, with some luck and the work of a lot of smart people, we may someday be able to learn how to use the technology wisely. FOR MORE INFORMATION
For more information about the concepts discussed in this chapter, search the Web using the keywords: embryonic stem cells, adult stem cells, blood stem cells, cloning, therapeutic cloning, blood transfusion
9 Organ Transplantation ORGAN TRANSPLANT SUCCESSES AND FAILURES
It has been over 50 years since the first successful human organ
transplant was done—a kidney transplanted from one identical twin to another—and the procedure has become almost routine. The list of organs transplanted includes not just kidneys, but hearts, livers, lungs, and the pancreas (Figure 9.1). The number of transplants performed is impressive, considering both how complicated the surgery is and how strong a fight the immune system launches against the new organ. More than 325,000 transplants were performed in the United States from 1988 through August 2004. The average number per year is now about 25,000. Kidney transplants account for more than half of all transplants; liver transplants make up about 20%, hearts 10%, and lungs 5%. The number of transplants may seem large, but an even bigger number includes those people who are on a waiting list for an organ—more than 86,000
121
122
BIOTECHNOLOGY AND YOUR HEALTH
Figure 9.1 In this heart transplant, a surgeon holds the donor heart as a colleague
prepares to connect its blood vessels to the blood vessels of the recipient.
people right now. Because human beings have two kidneys and can function just fine with only one, kidney transplants can come from living donors. In recent years, methods to transplant just a part of a liver have succeeded because the liver can repair and regenerate itself. A few hundred people each year, often children, receive a lobe of a liver from a family member. All the other organs, however,
Organ Transplantation
must come from people who signed a donor card before they died or whose family agrees to the organ donation. The gift of an organ at the sad time of the sudden loss of a family member in an accident is an act of great generosity. Despite these gifts, every year a shortage of healthy organs causes many more sad results—the death of people on the waiting list. In 2003, more than 6,000 people died while waiting for an organ. Human-to-human organ transplantation has risks. The human immune system is finely tuned to recognize and destroy invaders, and because it carries different forms of transplantation markers from those of the recipient, the transplanted organ is seen as an invader, unless the donor and recipient share exactly the same genes, as in that first successful kidney transplant between identical twins. A major risk exists if antibodies to the donor cells are present in the recipient’s blood at the time of transplant. If donor-reactive antibodies are present when the blood connection to the organ is made during surgery, the reaction against the new organ may be so rapid that the blood vessels are blocked and the organ cells die. This rapid antibody reaction to the cells lining the organ blood vessels is called hyperacute rejection. Tests for antibodies lurking in the recipient’s blood that could cause hyperacute rejection are performed before the transplant to determine who receives a donated organ. The ABO blood group system, critical in blood transfusion, is also important for some, but not all, transplanted organs. An organ donor must be a suitable ABO type for the patient or ABO antibodies in the recipient’s blood will cause hyperacute rejection. After the surgery, new antibodies and killer lymphocytes that cause rejection may develop within days. To prevent this from happening, or at least reduce the chances of it, scientists have discovered and developed a number of immunosuppressive drugs that help extend the life of the transplanted organ and, thus, the life of its recipient. Corticosteroids and the cancer chemotherapy drug azathioprine were the first drugs used to suppress the immune system for organ
123
124
BIOTECHNOLOGY AND YOUR HEALTH
transplants. Although their long-term use can have serious side effects, steroids such as prednisone are still widely used. In the 1970s, the introduction of cyclosporine, the product of a soil fungus, dramatically improved one-year graft and transplant patient survival. Other widely used chemical immunosuppressive drugs include tacrolimus, mycophenolate mofetil, and sirolimus. Several monoclonal antibodies that remove or shut down T lymphocytes (such as muromonab, daclizumab, and basiliximab) are used to prevent or treat rejection (Chapter 5). A preparation of animal antibodies raised against human lymphocytes is still used for the same purpose. Despite all these tools, slow or chronic rejection of the organ remains an ongoing problem. The success of organ transplantation is measured by organ and patient survival. Over 80% of kidney patients and 65% of their grafts survive for five years. Patient survival is higher than kidney graft survival, because kidney graft failure means that patients must go back onto chronic dialysis and usually back onto the waiting list for another transplant. Five-year graft and patient survival rates are lower for other organs. Because there is no counterpart to dialysis that provides long-term support for those with a failing liver, lungs, or heart, patients who need these organs often die without a successful transplant. TAKING ORGANS FROM OTHER ANIMALS
Because the transplant waiting list continues to grow, scientists have explored nonhuman animals as a possible source of organs. Despite the shock and repulsion it sometimes causes, the idea of xenotransplantation, or transplantation of an organ from one species to another, deserves some serious consideration. Organs from Primates
At first, it seemed reasonable to look toward nonhuman primates, such as chimpanzees and baboons, as organ donors. With experience,
Organ Transplantation
however, it became clear that nonhuman primates pose significant medical, economic, and ethical problems as alternate sources for organs. Transplants of organs from nonhuman primates would still require the use of immunosuppressive drugs, perhaps at even higher doses than are used for human-to-human transplants. Also, because of our genetic similarity to other primates and because the immune system has been turned off, any unknown virus or microorganism that the organ harbored might jump to humans and cause serious disease. There is strong evidence that HIV, the virus that causes AIDS, originally moved from chimps to humans, so this concern cannot be easily dismissed. Human-to-human transplants do carry the risk of viral infections, but the viruses in question are known (hepatitis viruses, HIV, and cytomegalovirus, among others) and donors can be tested to rule out infections. An unknown virus that does not cause illness in a nonhuman primate might infect a human organ recipient and then go on to infect other people and cause serious human disease. Economic and social factors have also discouraged the idea of using nonhuman primates as organ donors. Nonhuman primates are expensive to breed and care for, and some species are endangered. Many people find the idea of sacrificing these close animal “relatives” as organ sources morally unacceptable because they are so similar to humans. Stop and Consider What factors have led researchers to explore xenotransplantation?
Successes and Failures of Primate Organ Transplants
There have been attempts to use nonhuman primates as tissue and organ donors. In the 1960s, several surgeons transplanted kidneys from baboons or chimps into humans, and the patients survived only a few months. Born with a malformed heart, Baby Fae received a baboon heart transplant in 1984. The procedure, her
125
126
BIOTECHNOLOGY AND YOUR HEALTH
PRO
OR
CON ?
Ethical Issues of Animal-to-Human Transplants The debate over the animal rights ethics of xenotransplantation is an extension of the general debate about the use of animals in biomedical research. Most people believe it is alright to use animals for the benefit of humans, with a minimum amount of pain and suffering. They accept the breeding and sacrifice of animals to replace failed kidneys, hearts, lungs, or livers, or to provide cells to treat diabetes and Parkinson’s disease. However, some animal rights advocates believe that the shortage of human organs can be met in other ways, such as campaigns to encourage people to sign donor cards or the possibility of using organs from people whose hearts have stopped beating before the organs can be harvested. Those who oppose animal transplantation believe it is unethical to treat animals as a commodity to be killed for human benefit. They hold the belief that animals have moral value like that of humans and, just as it is unethical to sacrifice one human being to provide organs for another, so it is wrong to kill an animal for the same purpose. Because they are so similar to humans, the use of nonhuman primates for this purpose is particularly abhorrent to many people, but even the use of pigs or other barnyard animals as organ and cell donors for humans is unacceptable to some. As scientific progress appears to promise improved ways to prevent and treat disease to avoid the need for replacement of organs or cells, and as animal rights advocacy grows, it may become more and more difficult to overcome arguments against the wholesale breeding and sacrifice of animals to benefit ailing humans. But the bonds of kinship that make our loyalty highest to other humans will continue to temper this trend. Neither the science nor the ethics of xenotransplantation is yet mature.
Organ Transplantation
three-week survival, and her ultimate death were watched by the whole world. After her death, it was learned that a simple ABO incompatibility, rather than the fact that the donor was a baboon, had doomed the procedure. Two baboon-to-human liver transplants were performed by transplant pioneer Dr. Thomas Starzl in 1992. When both patients died of overwhelming infections within two months, Starzl decided that further organ xenotransplantation should be stopped and more research done. In 1995, Jeff Getty, a 38-year-old AIDS activist from San Francisco, received a baboon bone marrow transplant from a team from the University of Pittsburgh and the University of California to try to replace his immune system, which had been destroyed by HIV. The baboon cells survived for just a few weeks, but Getty lived for several more years. Stop and Consider Why are nonhuman primates no longer considered as possible organ donors for humans?
Organs from Non-primates
Researchers began to look elsewhere for possible nonhuman donors. The animal that seemed most promising for xenotransplantation was the pig. Pigs are easy and relatively inexpensive to breed, and they produce large litters of offspring. Although the usual breeds of pigs grow to a very large size, tipping the scales at 1,000 pounds (454 kg) or more, breeds of miniature swine grow to about 300 pounds (136 kg) as adults. Their organs are just the right size for humans. The anatomy and physiology of the pig kidney, in particular, makes it especially suitable for transplantation into humans. Whether pig livers would work in humans is unknown. Pigs can be bred and raised in sterile facilities to reduce
127
128
BIOTECHNOLOGY AND YOUR HEALTH
the risk of infection. However, researchers have recently discovered that pigs harbor in their genome the sequence for several RNA viruses, which, when activated, may infect humans and cause disease. Another problem with using pigs as organ donors is the very vigorous immune attack that would have to be blunted. Human blood normally contains antibodies to sugar molecules present on the surfaces of pigs’ cells. If the antibodies latched onto the cells that line the blood vessels of the pig organ, hyperacute rejection would occur. In addition, several types of destructive lymphocytes are poised to attack organs and tissues from species that are as different from us as pigs are. Some researchers have tried to genetically engineer pigs to reduce the antibody problem. Techniques have included putting human proteins on the surface of the pig cells that prevent activation of complement proteins or disabling the pig gene for the enzyme that puts the antibody-targeted sugar on the cell surface. To blunt the cell-based attack, several researchers have developed methods to replace some of the immune system cells in the potential organ recipient with pig immune-system cells in an effort to make the recipient better tolerate the pig tissue. This approach has succeeded in experiments with pig-to-monkey transplants. Whether these maneuvers will prevent hyperacute or quick cellbased rejection in humans is unknown, though experiments with pig cells have been encouraging. A number of small biotechnology companies and academic research teams are working on these problems. However, worries about the pig RNA viruses have cooled enthusiasm for xenotransplantation. Although some laboratory work continues, there appear to be no immediate human xenotransplant studies on the horizon. Some researchers have, however, proposed using pig liver cells in a device kept outside the body to help remove toxins from the blood of patients whose liver has failed, to help the patients survive while they wait for a human liver transplant.
Organ Transplantation
Stop and Consider What makes pigs possible sources for organs? What problems might there be with pig-to-human transplants?
CONNECTIONS
The shortage of suitable organs for transplantation has led to efforts to see if animals might provide an acceptable alternate source. Despite several attempts—some of them infamous—to use nonhuman primates as organ donors for human patients, medical, economic, and social issues have led researchers to look to other animals. Recently, the pig has become the most promising species for xenotransplantation, although there are serious barriers to using pig organs in people, including the risk of a severe rejection response and the possibility of human infections with potentially dangerous viruses. Research to solve these problems continues, but at a greatly reduced level because of concerns about the potential for a serious viral infection coming from the transplanted pig organ. Meanwhile, the waiting list for organs continues to grow. FOR MORE INFORMATION
For more information about the concepts discussed in this chapter, search the Web using the keywords: xenotransplantation, transplant rejection, immunosuppressive drugs
129
10 Lab Tests Using Recombinant Components Modern biotechnology has had a profound impact on the tests used in
healthcare, whether the test is done at home, in a doctor’s office, or in a commercial or hospital laboratory. Doctors rely on many different tests to find out what is causing a patient’s symptoms. In the past, many of these tests were time-consuming and required both expensive equipment and trained technicians to get a reliable answer. The application of modern biotechnology methods, however, has provided relatively inexpensive tests that save money, time, and, in many cases, have reduced the amount of blood needed. MONOCLONAL ANTIBODY TESTS
Monoclonal antibodies have allowed for the development of hundreds of new tests that are accurate, fast, and inexpensive.
130
Lab Tests Using Recombinant Components
Diagnosing Infections
Fast diagnosis of some infections is important to allow timely treatment. Accurate and easy-to-use test kits allow clinic and emergency room staff to identify or rule out an infection suspected because of the patient’s symptoms. For these tests, a small sample of blood or other body fluid is put into cellulose-bottomed wells on the side of a cigar-shaped plastic device, and tandem pairs of monoclonal antibodies lock onto different parts of the infecting bacterium, fungus, virus, or other infection, signaling the presence of the pathogen. In a typical kit, one monoclonal antibody linked to a gold-colored particle that traps the intended target, and the mixture is wicked by the cellulose to a band or spot where the other antibody is stuck. If the target of the two antibodies is present in the sample, the spot or band will change color because the colored complex is concentrated in a small area. Kits using this technology allow for a quick diagnosis of influenza and malaria. Other Diagnostic Uses
Hospital and commercial diagnostic testing laboratories rely on monoclonal antibody tests to measure the amounts of specific proteins, hormones, or drugs in blood. Monoclonal antibodies tagged to fluorescent dyes are also used with lasers to determine the kind of tumor a patient has, to track the number of tumor cells, and to monitor the level of immune system cells. The CD4 count test, important to patients with HIV infection, uses monoclonal antibodies and a laser-driven device that checks cell by cell for the CD4 protein, the marker for the critical immune system cell. The same technology and a set of antibodies to immune system cell proteins are used to diagnose children suspected of having inherited an immune system deficiency. Home-based Tests
Test kits based on paired monoclonal antibodies are so reliable and
131
132
BIOTECHNOLOGY AND YOUR HEALTH
simple to use that they are approved to be sold for home use. The over-the-counter pregnancy test kits sold in drug stores use paired monoclonal antibody reactive with human chorionic gonadotropin, a protein hormone that appears in the serum and urine of a pregnant woman 6 to 15 days after conception (Figure 10.1). A similar technology is the basis of some home glucose-monitoring devices for diabetics who must match their insulin dose to their blood-glucose level. DNA SEQUENCING TESTS
New, powerful methods of analyzing DNA and RNA have added to the doctor’s tools for detecting and predicting illness. These methods also have presented profound challenges. Testing for HIV
The routine test for infection with the human immunodeficiency virus (HIV) measures whether a person’s blood contains antibodies that react with HIV proteins. Newer tests allow the detection of the HIV antibody in saliva. Antibody tests are not useful for tracking how well treatment for HIV infection is working, particularly with the development of effective drugs that control the ability of the virus to increase in number. Physicians needed sensitive methods to detect small numbers of HIV virus in the blood. Three different FDA-approved tests provide a precise count of the number of HIV particles by measuring how many copies of the viral RNA genome are present in the blood plasma, the clear fluid part of the blood from which the cells have been removed. All of the tests use probes targeted to sequences of the bases in the viral RNA genome, and each uses different powerful molecular methods to detect a viral count as low as 50 copies per milliliter of plasma. In some tests, a technique called PCR (polymerase chain reaction) makes many copies of the virus genetic material so that an accurate virus count can be made with a small sample of blood. These methods can also detect which type of HIV is present in the sample.
Lab Tests Using Recombinant Components
Figure 10.1 Home pregnancy testing devices, like the one seen here,
utilize biotechnology techniques. This test uses paired monoclonal antibodies and colored beads to indicate increased human gonadotropin in urine. The second round well is a control, indicating the device is working properly by trapping a common urine protein.
133
134
BIOTECHNOLOGY AND YOUR HEALTH
Tests for Genetic Conditions
Tests for inherited conditions that are apparent at birth have been used for many years to help physicians and families choose appropriate treatments. Other inherited conditions do not show up early in life, but DNA-sequence differences allow detection before symptoms appear. The question of using the tests usually comes up when a family member is diagnosed with one of these conditions. The genetic tests may allow family members, particularly the children of those diagnosed, to know if they are at high risk. Genetic tests are available for some families that have a history of breast and ovarian cancer, for a neurologic condition called Huntington disease; and for a disease of the colon called familial adenomatous polyposis, in which many small growths that can turn into cancer develop in the colon. The use of these tests is complicated, both medically and psychologically. What Is PCR? DNA tests rely on two basics facts, 1) the distance a molecule of DNA moves in a thin slap or small column of gelatin-like material when an electric current is passed through it depends on the length of the piece of DNA, a process called electrophoresis and 2) single strands of DNA will bind to each other if they have complementary base sequences: An A will pair with a T, a T with an A, a G with a C, and a C with a G. PCR, or polymerase chain reaction, is used to make many copies of one or more important stretches of the DNA extracted from the sample. To see if the PCR product contains a specific, inherited sequence for medical or forensic purposes, the PCR product is heated to separate the two strands of DNA and treated with a probe, a short piece of DNA complementary to the target sequence and tagged with a dye. If the spot changes color, then the targeted sequence is present. The target may be a mutant form of a breast cancer susceptibility gene, a tissue transplant compatibility gene, or a gene for a blood enzyme known to be different in different people. PCR is also used with specific probes to detect the presence of a virus or other infection in the blood or tissue and to determine how many virus particles are present. Many of these tests are automated so that a technician need only place the extracted DNA in a small tube, instruct the machine which tests to run, push a button, and wait for the printout.
Lab Tests Using Recombinant Components
Breast and Ovarian Cancer
Genetic changes linked to an increased risk of breast and ovarian cancers are found in only about one in ten of women with these cancers. Everyone inherits two copies of the BRCA1 and BRCA2 genes (the breast cancer genes), but mutations in one copy mean that a woman has 3–7 times greater a risk of developing breast or ovarian cancer. In family members of a woman diagnosed with breast or ovarian cancer due to one of the mutated forms of BRCA1 or BRCA2, genetic testing may allow relatives to find out if they have inherited an increased risk for breast or ovarian cancer. The options for those with a positive test are not simple or entirely effective, however. More frequent and thorough physical exams will possibly detect a cancer at an earlier, more treatable stage. Some women choose to have surgery to remove ovaries and both breasts before cancer has a chance to set in. These are drastic steps that do not even guarantee that a tumor will not develop, because it is surgically impossible to remove all of the tissue that might become cancerous. Treatment with drugs to reduce the risk is not consistently effective in those with the BRCA1 and BRCA2 mutations. Given that these treatment options are not completely effective, the psychological disturbance caused by a positive test may be greater than the peace of mind obtained from a negative test result. Before the test is done, physicians and families need to consider the consequences for the whole family if the woman diagnosed with breast cancer is tested. Huntington Disease
Huntington disease presents an enormous family challenge because the symptoms do not develop until later in life. The mutated gene is dominant (as opposed to recessive), which means that the risk of developing the disease is 100% for people who inherit just one copy of the mutated form of the gene. Children of a person with Huntington disease have a 50% chance of inheriting the mutated
135
136
BIOTECHNOLOGY AND YOUR HEALTH
gene. Beyond supportive medical care and counseling, there is no treatment for this progressive neurologic disease in which mental and physical disturbances limit and shorten life. Deciding who should be tested and when the testing should be done is not simple. A positive test imposes a burden on family relationships and threatens educational and other life choices. Testing a young child is not recommended because it may rob the child of the right to accept or reject knowledge of the future he or she faces. Stop and Consider What questions would you ask before agreeing to a genetic test to evaluate your risk of a disease?
FAP
Familial adenomatous polyposis (FAP) is a disease for which genetic testing can provide useful information. Ninety-five percent of those diagnosed with FAP have a dominant mutation in a gene, called the APC gene. Most will develop colon cancer between the ages of 35 and 45, if not properly treated, usually with removal of the colon. Children of an affected individual have a 50% chance of inheriting the mutation. Routine examinations of the colon for polyps after the age of 12, and surgical removal of the colon when polyps appear, can greatly reduce the risk of developing colon cancer. People can survive without the colon. The remaining end of their digestive tract is attached to an opening created on their abdomen, and feces empty into a bag attached there. The procedure, called an ostomy, allows people to live long and essentially normal lives. There are some drugs that may reduce the development of polyps in people with FAP. These are difficult choices to put before a child, choices that may forever change the way that child has bowel movements, rigged with a plastic bag that holds feces. However, knowledge in this case may be life-saving.
Lab Tests Using Recombinant Components
DNA PROVIDES CLUES ABOUT COMMON ILLNESSES
Over the last decades, as the human genome was sequenced, scientists have assembled a vast library of small DNA-sequence differences that are precisely located within the genome. The marker sequences were used for the reassembly of the sequenced pieces of the 3 billion base pairs. Some of these markers are found within a gene that has changed in people with an inherited condition. Other markers are just that—small sequence differences that may not by themselves contribute to an inherited condition. Depending on their location, they may or may not be inherited by family members with a known inherited condition. These small sequence differences are sometimes just the substitution of one nucleotide for another; for example, a G instead of a C. In each person’s DNA, there are millions of these single nucleotide polymorphisms , inherited differences among individuals (called SNPs), in about 1 out of every 1,200 bases. Scientists are very interested in knowing whether single SNPs or sets of them could provide clues to common illnesses. Many common human diseases are thought to be the result of the interaction of one or more genes with environmental factors such as infections, pollution, or smoking. Scientists are interested in testing people with conditions such as heart disease, high blood pressure, cancer, and autoimmune diseases to see if any set of SNPs is found more often in those who have one of these conditions than in those who do not. In the future, using such information and powerful methods of detecting small differences in the DNA sequence, physicians may be able to determine if a person has an increased risk of a condition such as heart disease, based on the pattern of markers. These markers may also provide clues as to who will or will not benefit from or be harmed by a particular drug. Some people see the testing for SNPs and other markers and the collection of inherited differences in databases as potentially valuable, but others are concerned about the collection and possible abuse of such information,
137
138
BIOTECHNOLOGY AND YOUR HEALTH
which could lead to people being stigmatized by employers, health insurance companies, or others. DNA Marker Tests
In the future, DNA markers may help predict who is likely to have a heart attack or develop arthritis, or even whose arthritis pain might be eased with a specific pill. Today, DNA markers are very powerful tools to identify with a great degree of certainty whether Could the Results of a Genetic Test Be Used to Harm You? Many experts, including Dr. Francis Collins, director of the National Human Genome Institute, have raised concerns that genetic tests could lead to genetic discrimination. They worry that insurance companies may deny insurance or that an employer may deny employment to an individual found to have inherited a gene that gives him or her an increased risk of developing a disease. Current laws prevent discrimination against people with medical conditions when it comes to health insurance, under the 1996 Health Insurance Portability Act (HIPPA), and in employment, under the Americans with Disabilities Act (ADA). What about someone who is not currently ill but is identified as having inherited an elevated risk of disease? Most Americans obtain health insurance through their employers. HIPPA does protect against denial of group health insurance based on an employee’s genetic information, without defining whether the risk is based on family history or the result of a genetic test. HIPPA does not address individual health insurance. The ADA deals with workplace discrimination for individuals with existing disabilities, not potential ones. Even though genetic testing is not yet widespread, a few anecdotal cases of genetic discrimination have been reported. The Senate passed a bill in 2003 prohibiting discrimination based on the results of a genetic test, but the House of Representatives has not yet considered the issue. Although HIPPA strengthened the requirement to protect the privacy of personal medical information, including family history and results of genetic tests, an insurance company would know that the genetic test had been performed if it was asked to pay for it. The results of genetic tests can have an emotional and medical impact on a whole family. Physicians and genetic counselors work with the patient and the entire family to make sure the medical and social significance of the results is understood. As more genetic tests are developed and methods are established to reduce the inherited risk, the issue will have to be addressed, or people will avoid tests that might allow treatments to lengthen or improve their lives.
Lab Tests Using Recombinant Components
139
a particular person committed a crime or is the father of a child. Conventional fingerprints have been used for more than 100 years by law enforcement officials to identify a person who touched something. The whorls and swirls of fingerprints, created when we are still in the womb, distinguish us from one another, but they provide little more than a “yes or no” answer—providing a match or not for the fingerprint taken from a crime scene. DNA marker tests used for legal purposes distinguish between all people except identical twins. With databases of the markers found in large numbers of people, a DNA marker match can provide a mathematical estimate of the chance that the blood, semen, or even a dandruff sample at the scene of a crime could have come from someone other than the suspect. Similar tests are also used to determine if a particular man is a child’s biological father. DNA markers are inherited and when the child’s DNA marker pattern is compared with the mother’s and the alleged father’s, it is easy to see whether the child inherited a marker that is not present in either the mother’s or the man’s pattern. If so, the man cannot have fathered the child. If the man is not excluded, using the same mathematical methods used for crime scene investigations, the scientist can provide an estimate of the chance that another man could be the child’s father and could have provided the DNA marker pattern the child inherited from his father. How Are Forensic DNA Tests Done? The target sequence for DNA profiling that is most widely used for forensic purposes has no known function. Our genome contains many regions in which short base sequences are repeated several times. The number of repeats is inherited. Several different short tandem repeats (STRs) provide powerful forensic tests. To obtain STR profiles, the PCR products generated using primers specific for each STR are clipped by restriction enzymes that cut the DNA on either side of the run of repeats. The resulting pieces are separated by size by exposing them to an electric field, and the size of the piece that binds to a probe of the repeating sequence is compared with standards to indicate the number of repeats.
140
BIOTECHNOLOGY AND YOUR HEALTH
For both crime scene investigation and paternity testing, laboratories use a panel of DNA markers that are very likely to be different from one person to another. If the alleged father or suspect is not excluded by the discovery in the child of a marker the man does not have, or in the sample from the crime scene, then the scientist can calculate the odds against someone else having the same pattern of markers. The chances of someone else having the set of markers may be one in millions or even billions. There can be problems with these calculations because the frequencies of markers vary among different ethnic groups. If the database used for the calculations does not include enough representatives of the suspect’s or alleged father’s ethnic group, then the calculations may seriously underestimate the possibility that someone could have had the same marker results. Stop and Consider Some states have passed laws that require that everyone arrested for certain serious crimes provide a DNA sample for analysis and inclusion in CODIS (see below). What rules should there be for saving and sharing DNA profiles in law enforcement databases for a person arrested but acquitted of a crime?
To help in law enforcement, a federal law was enacted in 1994 that established a Federal Bureau of Investigation (FBI) national DNA database called CODIS (Combined DNA Index System). By 1998, all 50 states had passed laws that require all persons convicted of serious sex offenses and other crimes to provide a sample of blood for DNA analysis. The marker results are entered into the CODIS database, along with the results of crime scene samples. The methods and panel of markers used are standardized for all states so that results from a sample tested in one state can be compared with all the files in the database. Some groups argue that requiring a blood sample is a
Lab Tests Using Recombinant Components
unwarranted invasion of privacy. Another practice that disturbs some people is when law enforcement agencies keep convicts’ DNA samples for later analysis. The situation is further clouded by laws passed in Louisiana and Texas that require DNA samples from people arrested for certain offenses, even if DNA analysis is not required for the prosecution of the offense. As with the introduction of any new technology in law enforcement, these issues will likely wind their way through the state and federal courts over the coming years. The Use of DNA Microarray
The way a cell or tissue looks under a microscope can provide useful information in diagnosing disease or in choosing an appropriate treatment for an illness. New methods that provide a detailed accounting of what genes are being read to produce proteins in a tissue sample also may provide important information to a doctor. These tests, using devices called DNA microarray or gene chips, have become important laboratory research tools and are beginning to be applied to medical care (Figure 10.2). The tests are based on information gained from the human genome project and computer chip manufacturing technology. The messenger RNA copy of a gene used to make a protein in a cell is complementary to and will bind to the DNA gene. To find out which genes are being used, the cell’s RNA is copied into fluorescent dye-tagged DNA using PCR with a collection of fluorescent-dyelinked primers for a large number of genes. A robotic machine deposits a defined array of small amounts of all the different genes to be tested onto a piece of glass or nylon. If the PCR products bind to a spot on the chip, that spot—the particular gene—will become fluorescent. The chip is then analyzed to provide a list of the genes that the cell is using to make proteins. Scientists have developed a DNA microarray test that predicts whether a woman with a certain type of breast cancer will have the cancer recur after the tumor is removed. This helps physicians and
141
142
BIOTECHNOLOGY AND YOUR HEALTH
Figure 10.2 This scientist is examining a microarray slide. The pattern
of binding of the test samples, to the array of DNA on the slide, is displayed on the computer screen. Libraries of small chemicals can also be analyzed for their ability to bind to DNA or protein microarrays in a search for potential new drugs.
patients decide if further drug treatment is necessary. DNA microarray technology is also used to tell drug researchers what form of several genes a subject has inherited—information important in how the body breaks down drugs. This may predict whether the drug will build up in the body, leading to toxic effects. Drug companies are working to see if these methods will allow drugs to be tested and even used more safely (Figure 10.3).
Lab Tests Using Recombinant Components
Figure 10.3 Microarrays can be used to determine which genes are
being “read” to make messenger RNA by a cancer cell. This process is illustrated here.
143
144
BIOTECHNOLOGY AND YOUR HEALTH
CONNECTIONS
Biotechnology tools and methods have provided many new and improved laboratory tests. Diagnoses can be made more rapidly and with greater precision, so that appropriate treatment can be started and potentially useless treatment avoided. Family members can find out if they are at high risk of contracting a devastating disease discovered in a relative. Law enforcement has new tools to identify the perpetrators of violent crimes. A child’s biological father can be identified with confidence. Some of these tests, because they probe the details of our personal genome, raise questions and concerns about the consequences of knowing, especially when there is little that can be done to change the outcome. They also raise questions about the potential misuse of genetic information in employment decisions as well as access and cost of health and life insurance. Debates will continue about the proper use and limits of this technology. The potential of these tests to uncover our genetic makeup and our risk of developing a serious disease—and thus, in a sense, to uncover who we are and to predict our future— can be disquieting. FOR MORE INFORMATION
For more information about the concepts discussed in this chapter, search the Web using the keywords: genetic tests, breast cancer genes, Huntington disease, familial adenomatous polyposis, polymerase chain reaction (PCR), forensic DNA tests
A HISTORY OF BIOTECHNOLOGY C.
145
4000-2000 B.C. Yeast used to leaven bread and make beer and wine C. C.
500 B.C. Moldy soybean curds used to treat boils (first antibiotic)
8000 B.C. Crops and livestock domesticated
C.
100 A.D. Powdered chrysanthemums used as first insecticide 1590 Microscope invented 1600 Beginning of the Industrial Revolution in Europe 1663 Cells discovered 1675 Anton van Leeuwenhoek discovers bacteria 1797 Edward Jenner inoculates child to protect him from
smallpox 1857 Louis Pasteur proposes microbe theory for fermentation 1859 Charles Darwin published the theory of evolution
through natural selection 1865 Gregor Mendel published the results of his studies on
heredity in peas 1890 Walther Fleming discovers chromosomes 1914 First use of bacteria to treat sewage 1919 Term biotechnology was coined by Karl Ereky, a
Hungarian engineer 1922 First person injected with insulin, obtained from a cow 1928 Alexander Fleming discovers penicillin 1933 Hybrid corn commercialized 1944 Oswald Avery, Colin MacLeod, and Maclyn McCarty
prove that DNA carries genetic information 1953 James Watson and Francis Crick publish paper
describing the structure of DNA
146
A HISTORY OF BIOTECHNOLOGY
1961 Bacillus thuringiensis registered as first biopesticide 1966 Marshall Warren Nirenberg, Har Gobind Korhana, and
Robert Holley, figure out the genetic code 1973 Herbert Boyer and Stanley Cohen construct first
recombinant DNA molecule and reproduce 1975 First monoclonal antibodies produced 1975 Asilomar Conference held; participants urge U.S.
government to develop guidelines for work with recombinant DNA 1977 Human gene expressed in bacteria 1977 Method developed for rapid sequencing of long stretches
of DNA 1978 Recombinant human insulin produced 1980 U.S. Supreme Court allows the Chakrabarty patent for a
bacterium able to break down oil because it contains two different plamsids 1980 Stanley Cohen and Herbert Boyer awarded first patent
for cloning a gene; Paul Berg, Walter Gilbert, and Frederick Sanger awarded Nobel Prize in chemistry for the creation of the first recombinant molecule 1981 First transgenic animals (mice) produced 1982 Human insulin, first recombinant biotech drug,
approved by the FDA 1983 Human immunodeficiency virus, the cause of AIDS, is
identified by U.S. and French scientists 1983 Idea for PCR conceived by Kary Mullis, an American
molecular biologist 1984 First DNA based method for genetic fingerprinting
developed by Alec Jeffreys
A HISTORY OF BIOTECHNOLOGY
147
1985 First field testing of transgenic plants resistant to insects,
bacteria and viruses 1985 Recombinant human growth hormone approved by the
FDA 1985 Scientists discovered that some patients who had
received human growth disorder hormone from cadavers had died of a rare brain disorder 1986 First recombinant cancer drug approved, interferon 1987 The first field test of a recombinant bacterium, Frostban,
engineered to inhibit ice formation 1988 Human Genome Project funded by Congress 1990 Recombinant enzyme for making cheese introduced,
becoming the first recombinant product in the U.S. food supply 1990 First human gene therapy performed, in an effort to
treat a child with an immune disorder 1990 Insect resistant Bt corn approved 1994 First gene for susceptibility to breast cancer discovered 1994 First recombinant food (FlavrSavr tomatoes) approved
by FDA 1994 Recombinant bovine growth hormone (bovine
somatotropin, BST) 1997 Weed killer resistant soybeans and insect resistant cotton
commercialized 1997 Dolly the sheep, the first animal cloned from an adult
cell, is born 1998 Rough draft of human gene map produced, placing
30,000 genes
148
A HISTORY OF BIOTECHNOLOGY
1999 Jesse Gelsinger, a participant in a gene therapy trial for
an inherited enzyme defect, dies as a result of the treatment 2000 First report of gene therapy “cures” for an inherited
immune system defect. A few months later, several of the treated children developed a blood cancer 2002 Draft of human genome sequence completed 2003 First endangered species cloned (the banteng, a wild ox
of Southeast Asia) 2003 Dolly, the cloned sheep, develops a serious chronic lung
disease and is euthanized 2003 Japanese scientists develop a genetically engineered
coffee plant the produces low caffeine beans 2004 Korean scientists report human embryonic stem cell
produced using a nucleus from an adult cell 2005 Korean scientists improve success rate of human adult
nuclear transfer to embryonic cells by 10 fold
GLOSSARY
149
ABO blood groups—Blood types important in transfusions and transplants; blood types of donor and recipient must match to prevent deadly transfusion reactions. Adenosine deaminase (ADA)—Protein absent in a type of inherited defect in the body’s defense system. The absence of this protein results in death of key cells in the defense system. Adenoviruses—Double-stranded DNA viruses that can efficiently carry larger genes into cells even if they are not dividing, but the genetic information does not become inserted into the cell’s genetic material and the information may rapidly be lost. Adult stem cells—Unspecialized cells in adult tissues that can turn into different kinds of specialized cells. Adverse events—Illnesses or deaths resulting from a medical procedure or drug. AIDS—See Human immunodeficiency virus. Allergic reaction—An abnormal response by the body’s immune system. Amino acid—One of the 20 building blocks of proteins. Angiogenesis—Formation of blood vessels. Antibiotic—Substance that destroys or slows the growth of organisms that are visible only with a microscope. Antibodies—Proteins produced by the body’s immune system that bind to a specific foreign material or invading organism. Antigen—Material that the body’s immune system sees as foreign. Antisense—Method other than altering abnormal genes, by which the abnormal genes are simply switched off. Antitoxin—Protein produced by the body’s immune system that binds to a poisonous molecule and prevents it from harming the body. Antivenom—Protein produced by the body’s immune system that binds to a poisonous substance from a snake or insect. Apoptosis—Programmed cell death. Autoimmune disease—One of a number of illnesses caused by the immune system targeting the patient’s own tissues for destruction, such as rheumatoid arthritis or multiple sclerosis.
150
GLOSSARY
Bacteria (Singlular is bacterium)—Single-celled organism visible only that has a microscope and with no membrane surrounding its genetic material. Bacteriophage—Virus that infects single-celled organisms with no membrane surrounding their genetic material. Base—One of the four substances that form the building blocks of DNA and code genetic information. DNA molecules are chains of four bases: adenosine (A), cytosine (C), guanine (G), and thymine (T), each slightly different chemically from the others. Basophil—Type of white blood cell involved in the defense at a site of injury; plays a role in inflammation. Biotechnology—Use of a living organism to make a useful product. Blastocyst—Early stage animal or human embryo made of a hollow ball of cells. Blood clotting—Process that changes blood from a liquid to a semisolid. Blood stem cells—Stem cells that can become any type of blood cell. See Hematopoietic stem cells. Blood transfusion—Transfer of blood, or blood components, into the body to replace blood lost in an accident, surgery, or childbirth, or to supplement a lack of blood components. Used routinely and safely due to ABO blood type matching and testing for infections in the blood, such as HIV. Bone marrow—Soft tissue inside the hollow part of most bones, in which stem cells can be found; important in the production of blood cells. Bovine spongiform encephalopathy—See Mad cow disease. BRCA—See breast cancer gene. Breast cancer gene—BRCA1 and BRCA2 genes, which, if mutated, are associated with greater risk of breast or ovarian cancer, but only one in ten women with breast and ovarian cancer has these genetic changes. Some women in whom the mutations are identified choose surgical removal of breasts and ovaries before cancer is detected. Treatment with drugs to reduce cancer risk is not consistently effective in those with BRCA1 and BRCA2 mutations.
GLOSSARY
151
Cancer—Loss of normal control of the increase in the number of cells, which may result in the invasion into and destruction of surrounding tissue. Cancer gene—See Oncogene. Cell cloning—Production of a group of cells that are replicas of the original cell. Cell fusion—Merging of two cells so that they are contained with a single membrane envelope. Cerebroside—Fatty substance that fills up blood cells in Gaucher disease. Chemotherapy—Cancer treatment using drugs that are cell poisons, somewhat more lethal to cancer cells than to normal cells. Because some normal cells are also damaged, such as those in hair follicles, digestive system lining, and bone marrow, side effects of chemotherapy include nausea, hair loss, and a weakened immune system. Chloroplast—Structure in green plant cells that captures light energy and converts it into chemical energy. Chromosomes—Thread-like structure in cells made of protein and DNA that carries genetic information. Clinical trials—Tests of drugs on human subjects. Cloning—Production of exact replicas of a gene, cell, plant, or animal. CODIS (Combined DNA Index System)—A Federal Bureau of Investigation (FBI) national DNA database established in 1994. By 1998, all 50 states required persons convicted of serious sex offenses and other crimes to provide a blood sample for DNA analysis. Results are entered in CODIS so that a sample from one state can be compared with the entire database. CODIS is controversial. Complementary bases—Subsets of the four building blocks of DNA that easily form pairs. The bases A and T, as well as C and G, are complementary bases. Corticosteroids—Chemicals produced in small amounts by a group of cells that sits above the kidneys. The chemicals regulate how the body makes and breaks down sugar, fat, and protein, as well as how the body maintains its water and salt balance. Can be used as drugs. Cowpox—Virus related to the smallpox virus, it causes a mild disease in cows and humans and is used to protect people against smallpox.
152
GLOSSARY
Creutzfeldt-Jacob disease—Human form of transmissible spongiform encephalopathy (TSE), a brain disease in which nerve cells of the brain are destroyed. Seen under a microscope, the brain tissue of people with TSE resembles a sponge. Crohn’s disease—Inflammatory disease that affects the intestines. Cyclosporine—Drug, produced by a soil fungus, that is very effective in blocking the body’s immune system. Cystic fibrosis (CF)—A genetic disease affecting the lungs and pancreas caused by a mutation of a gene for chloride transport protein. It was targeted by early efforts at gene therapy, but without success. Cytoplasm—The semi-fluid material inside a cell. Deoxyribonucleic acid—See DNA. Diabetes—Condition in which the body does not respond correctly to changes in the sugar content of the blood. Dialysis—Method of separating large and small molecules using a membrane that only lets some molecules pass through it. This process is used to remove waste products from the blood in people whose kidneys are not working properly. Differentiation—The change by an unspecialized cell to a more complex, specialized cell. Digitalis—Drug obtained from the foxglove plant and used to stimulate the heart. DNA (deoxyribonucleic acid)—Carrier of genetic material that determines inheritance of traits. DNA is in chromosomes in every cell of the body except red blood cells and is copied when cells divide. DNA molecules are shaped like a double helix, and are composed of sequences of four bases: adenosine (A), cytosine (C), guanine (G), and thymine (T). The sequence of the bases directs production of particular proteins by determining the sequence of amino acids in proteins. The double-helix structure of DNA helps it transmit genetic information. DNA ligase—Protein that facilitates the joining of DNA molecules. DNA microarray—Arrangement on a glass or plastic slide of small amounts of DNA with different sequences.
GLOSSARY
153
DNA polymerase—Protein that copies DNA by linking together bases that are lined up and paired with complementary bases in a piece of DNA. Dominant—Refers to a gene with two or more forms that has an effect on the organism even if only one copy is present. Double-blind test—Test in which neither the subjects nor the researchers know who is getting the new drug and who is getting the placebo or control drug. Double helix—The shape of DNA molecules, discovered by James Watson and Francis Crick. The double helix is made up of two chains of DNA bound to each other by weak chemical bonds between pairs of complementary bases. This base pairing allows the DNA to be copied precisely when the strands separate as cells divide. Embryonic stem cells—Unspecialized cells in the early embryo, each of which can give rise to every type of cell in the adult. Enzymes—Proteins that facilitate chemical reactions. Eosinophil—Type of white blood cell involved in defense against invading organisms; also play a role in allergies. Erythrocytes—Red blood cells; the color comes from the oxygen-carrying protein hemoglobin inside the cell. Escherichia coli (E. coli )—Bacteria in human intestine that aids in digestion; it does not cause disease unless the bacteria escape to other organs or tissues. However, some strains of E. coli produce toxins and can cause food poisoning. Strains of E. coli are used in biotechnology, modified so the bacteria cannot cause disease. Eukaryotic cells—Cells with the genetic material surrounded by a membrane made of protein and fat. Familial adenomatous polyposis—An inherited disease of the colon in which many small growths develop in the colon and can turn into cancer. Genetic tests are available for this disease. Fermentation—A biochemical reaction involving enzymes that breaks down complex carbohydrates and simple sugar (glucose), usually producing carbon dioxide and ethanol or an acid. Fibrin—Blood protein involved in blood clotting and wound healing.
154
GLOSSARY
Food and Drug Administration (FDA)—U.S. government agency responsible for approving drugs for sale based on information from laboratory, animal, and human studies. Human studies, called clinical trials, can begin only after the FDA reviews the laboratory and animal studies. Forensic—Related to law and courts of law. Fungi—Group of organisms that have cell walls like plants, but no green pigment. May grow as single cells or joined together. Usually grow in damp conditions; some fungi can infect humans and cause disease. Gaucher disease—Hereditary condition caused by an error in the gene for the enzyme that breaks down a fatty substance called cerebroside; blood cells called macrophages fill with cerebroside, and settle in several organs. People with Gaucher disease experience pain, and their bones break easily. Gaucher disease has been treated by a biotechnology drug. Gene—Part of the genetic material that directs production of a particular protein, and thus determines the presence or absence of a particular trait. Genes may be dominant or recessive. Gene chip—Arrangement of small amounts of different genes on a small glass, plastic slide, or silicon chip used in genetic tests. Gene therapy—Inserting genes into cells in an effort to treat inherited diseases or cancer. Genetic engineering—Changing an organism by inserting a gene from another organism into its genetic information. Genetic tests—Examinations for inherited conditions detected through identification of difference in DNA sequences, so that conditions can be identified before symptoms appear. Genome—All the genes of a cell or organism. Germ cells—Cells that develop into the reproductive sperm and egg cells. Gland—Group of cells that produces specific substances and delivers them to the blood. Glucose—Sugar molecule found widely in nature. Graft versus host disease—Condition caused in a transplant blood cell, when a donor’s immune system cells attack the new organ. The condition can severely damage the intestines, liver, and other organs, and may be fatal.
GLOSSARY
155
Growth hormone—Protein produced by a small collection of cells in the brain that influences the growth of bones, the production of proteins, and the use of fat for energy. Hematopoietic stem cells—Immature cells that produce all the types of cells found in the blood. Hemoglobin—Protein that shuttles oxygen from the lungs to the tissues and moves waste CO2 from the tissues to the lungs. Hemophilia—Inherited absence of one or more of the proteins required for the blood to change from liquid to semisolid. HIV/AIDS—See Human immunodeficiency virus. Human Genome Project—Decades-long international effort by hundreds of laboratories and thousands of scientists to determine the sequence of human DNA. Human immunodeficiency virus (HIV)—Virus that causes AIDS (acquired immunodeficiency syndrome) by destroying a critical cell of the body’s immune system. Huntington disease—Progressive neurological disease that shortens life span and causes mental and physical problems. This hereditary disease is passed down through a dominant mutated gene, so those who inherit one copy of the mutated gene will develop Huntington. There is no treatment for the disease. Genetic testing is possible, but symptoms do not appear until later in life, often after the childbearing years. Hybridomas—Fusion of a tumor cell and a specialized cell of the immune system, able to produce a large amount of the same immune system binding protein. Hyperacute rejection—Very rapid attack of foreign cells or organs caused by binding protein of the body’s immune system. Immune system—Series of specialized cells and proteins that provide powerful defenses against infectious diseases. Immunization—Production by artificial means of the capacity of the immune system to protect the body. Immunosuppressive drugs—Medications that block the body’s immune system. Infectious disease—Illness caused by the invasion of bacteria, mold, viruses, or other microorganisms.
156
GLOSSARY
Inflammation—Set of responses triggered by the immune system when white blood cells congregate around a wound or other threat of infection. Inflamed tissue is warm, red, swollen, and painful. Informed consent—Permission to proceed with a medical procedure, test, or experiment, based on full understanding of the process, its risks, and benefits. There are strict rules requiring informed consent to protect the subjects of experiments, including clinical trials. Inoculated—Have a small amount of a microorganism introduced into the body. Inoculation—Introduction into a culture dish or the body of a small amount of a microorganism. Insulin—Signal protein that controls the cells’ ability to use sugar to make energy and new proteins. Interferons—Family of immune system signal proteins that interfere with the ability of viruses to infect cells. Interferons have been genetically engineered to provide treatments by weakening immune response in autoimmune disease such as multiple sclerosis, or by strengthening immune response in diseases like hepatitis C. Irradiation—Exposure to high energy electromagnetic waves (X rays). Islets of Langerhans—Distinctive cells in the pancreas that produce insulin. Lymphocytes—Infection-specific white blood cells that are part of the immune system response. Macrophage—Type of blood cell that ingests bacteria or cell debris. Mad cow disease—Bovine spongiform encephalopathy, or BSE, the form of transmissible spongiform encephalopathy (TSE) found in cattle. It is thought to be spread by consumption of brain tissue and caused by proteins called prions. Malaria—Disease caused by a single-celled parasite that infects a human through a mosquito bite. Medicinal properties—Ability to cure disease or relieve symptoms. Messenger ribonucleic acid (mRNA)—Messenger RNA copy of a gene used to make a protein in a cell; it is complementary to and will bind to the DNA gene.
GLOSSARY
157
Microbe—Living organism only visible with a microscope. Microorganism—Living organism only visible with a microscope. Milliliter—1/1,000 of a liter. Minibodies—Small pieces of antibodies engineered to be produced in bacteria or animal cells. Because of their small size, minibodies may be able do things to cells that large bulky antibodies cannot do. Mitochondria—The structures within all eukaryotic cells that break down nutrients to produce energy for the cell. Mold—Growth of a microorganism that has a hard outer wall like a plant but no green pigment, found in damp surroundings. Monoclonal antibodies—Defense system proteins that are identical, produced by a culture of identical cells. Morphine—Drug that makes a person sleepy and relieves pain, but can lead to dependence. Multiple sclerosis—Nervous system disorder in which the body’s immune system mistakenly attacks the fatty insulation of cells of the brain and spinal cord. Multipotent adult progenitor cell (MAPC)—Unspecialized cell found in adult tissue that can turn into several different types of specialized cells. Mutation—Change in the genetic material of a cell or organism that is inherited. Myelin—Fat and protein insulation on the nerve fibers of the brain and spinal cord. Neutrophil—Type of white blood cell involved in defense against bacteria; also plays a role in inflammation. Nucleus—Membrane-bound body containing the genetic material in eukaryotic cells (yeast, insects, plants, and animals). Oncogene—Gene that can change a normal cell into a cell that fails to respond to the body’s normal control of growth and cell division. Ornithine transcarbamylase—Protein that facilitates the breakdown one of the body’s waste products.
158
GLOSSARY
Ovary—Egg-producing organ of female animals. Pancreas—Organ in the abdomen that produces digestive proteins and insulin, a signal protein that controls cells’ ability to use sugar to make energy and new proteins. Parkinson’s disease—Disease of the nervous system caused by failure to make a particular signal molecule; patients have muscle weakness and shaking of arms and legs. Penicillin—Antibiotic produced by mold, discovered by Alexander Fleming in 1928. Peptides—Short chains of amino acids; small proteins. Pituitary gland—Collection of cells at the base of the brain that produces a number of signal molecules that circulate in the blood to regulate a large number of the body’s processes. Placebo—Inactive dummy pill or injection. Placenta—Layer of tissue that attaches to the inside wall of the uterus and nurtures the growing fetus. Plasma—The clear fluid part of blood. Plasmid—Piece of DNA inside a bacterium that is separate from the bacterium’s genetic material, but is copied each time the bacterium divides. It is used in biotechnology to introduce new genetic information into a bacterial cell. Platelets—Small cell fragments produced from bone marrow cells that help blood to clot. If platelet counts are low, leaks in blood vessels that would normally be small can result in the loss of large amounts of blood. Certain chemotherapy drugs diminish production of platelets. Pluripotent—Able to develop into several different kinds of specialized cells. Polymerase chain reaction (PCR)—Process of making many copies of a stretch of DNA using short pieces able to bind to each end of the DNA, a heat-resistant protein able to drive the production of the new DNA between the short pieces, and multiple rounds of heating and cooling to separate the strands of DNA and allow the new DNA to be made. Polypeptides—Synonym for proteins. Primer—Stretch of nucleotides complementary to one end of a stretch of DNA.
GLOSSARY
159
Prion—Abnormal form of a brain protein thought to be responsible for several different diseases in which brain tissue comes to look like a sponge. Prions may be passed from one individual to another by consumption or injection of infected brain tissue. Promoter—Beginning of a gene where the DNA code is read to make a protein; may function as an on-off switch for protein production. Proteins—Large molecules produced by living organisms, composed of one or more chains of amino acids. These may be modified by the addition of sugars or other chemical substances. Proteome—Entire collection of proteins made by any organism. Protocol—Detailed directions for an experiment and for a study of a medicine in animals or humans. Quinine—Chemical taken from the bark of the cinchona tree and used to treat fevers and to prevent malaria, an infection of a single-celled organism through a mosquito bite. Receptor—Docking protein for a signal molecule; may sit on the outside membrane of a cell or inside the cell. Recessive—Refers to a form of a gene that is only apparent in the characteristics of the organism if two copies are present. Recombinant DNA—DNA molecule made of genes from different sources. Red blood cells—Type of blood cell filled with the red protein hemoglobin that carries oxygen to tissues. Reproductive cloning—Production of a genetically exact copy of an individual. Restriction endonucleases (RE)—Proteins that create breaks within DNA molecules based upon the sequence. Retrovirus—Virus whose genetic material is composed of ribonucleic acid (RNA). Rheumatoid arthritis—Disease in which immune system cells attack tissues in the joints, triggering inflammation, pain, swelling, and, if left unchecked, crippling damage to the joints of the hands, arms, and legs. RA is treated with nonprescription anti-inflammatory drugs, but some recombinant proteins that target inflammation are used to treat RA.
160
GLOSSARY
Ribosomes—Structures inside a cell where proteins are manufactured. Ribozyme—RNA molecule that is able to cut itself. Serum—Clear fluid part of the blood after the blood has clotted. Severe combined immunodeficiency—Inherited absence of a functional immune system against infections with bacteria and viruses. Single nucleotide polymorphisms—Inherited differences in a single base of DNA. Small interfering RNA (siRNA)—Short double-stranded RNA molecules able to interfere with the reading of a gene to make a protein. Smallpox—Virus infection that causes fever and skin eruptions, frequently fatal. Smallpox has been eradicated by worldwide campaigns to vaccinate, making the body’s immune system able to resist infection by the introduction beneath the skin of a small amount of a harmless form of the virus. Somatic cells—All cells in the body, except the germ (reproductive) cells, that can divide to produce more cells like itself. Somatic nuclear transfer (SNT)—Mechanical transfer of the nucleus of a body cell to replace the nucleus of an animal or human egg. Stem cells—Unspecialized cells able to develop into specialized cells; may have limited capacity (multipotent or pluripotent) or may be able to turn into any cell of the body (totipotent). Taxol—One of the most effective modern cancer drugs, came out of a massive government search for new cancer medicines from plants. Taxol is used to treat cancer of the ovary, breast, and certain forms of lung cancer. Taxol comes from the bark and needles of a yew tree. T cell—Type of white blood cell important in the immune system. Therapeutic cloning—Creation, through the transfer of a nucleus of an individual’s mature cell to an egg, of a source of stem cells able to provide cells to repair or replace damaged cells. Totipotent—Able to turn into any cell in the body, under the appropriate conditions. Toxins—Poisonous molecules produced by a living organism. Transfer RNA (tRNA)—RNA that shuttles an amino acid to the site of protein production, the ribosome.
GLOSSARY
161
Transgene—A gene transplanted from one organism into another. A gene taken from one organism and inserted into the genetic material of another organism. Transgenic animal—Animal into which a gene from another organism has been introduced by recombinant DNA methods. Transmissible spongiform encephalopathies (TSEs)—Brain diseases transmitted from one animal to another. Under a microscope, the brain tissue of animals and people with TSEs resembles a sponge. TSEs include variant Creutzfeldt-Jacob disease (vCJD) in humans, scrapie in sheep and goats, and bovine spongiform encephalopathy (BSE) in cows (mad cow disease). These diseases are spread by consumption of brain tissue and are thought to be caused by prions, a kind of protein. Transplant rejection—Immune system attack on genetically different tissue that occurs when an organ is transplanted from one person to another. The immune system of the recipient recognizes the transplanted tissue as foreign. Tumor—Masses of cells, often cancer cells, characterized by uncontrolled and usually rapid cell division. Tumor necrosis factor (TNF)—One of the cell-damaging proteins involved in inflammation, named because it appeared to kill cancer cells in the laboratory. Drugs for some autoimmune diseases like rheumatoid arthritis and Crohn’s disease are designed to target TNF. Tumor suppressor gene—Gene that blocks the survival and growth of cancer cells. Uterus—Organ in female mammals where the young develop before birth. Vaccination—Use of a material to cause the immune system to develop resistance to infection by disease-causing organisms. Vaccines—Killed or weakened disease-causing organisms or materials from them that can be used to stimulate the immune system to develop resistance. Vectors—Structures used to deliver genetic material into a cell. Viruses—Very small particles able to infect cells and reproduce inside the cell. Viruses are inert outside of a cell. White blood cells—Blood cells that fight infection; they do not have hemoglobin. There are several types of white blood cells: the lymphocytes. monocytes, neutrophils, eosinophils, and basophils.
162
GLOSSARY
Xenotransplantation—Replacement of an organ (kidney, liver, heart, etc.) with one from another species. Used to describe the use of animal organs in humans. X-linked severe combined immune deficiency (X-SCID)—Absence of a functioning immune system inherited with the X chromosome. X-linked refers to inheritance with the X chromosome, one of the chromosomes involved in determining gender. In humans, women have two X chromosomes, and men have an X and a Y chromosome. X-linked genes can only be inherited by a boy from his mother, since his father would have given him his Y chromosome.
BIBLIOGRAPHY
163
Aguilar, G. “Access to Genetic Resources and Protection of Traditional Knowledge in the Territories of Indigenous Peoples.” Environmental Science & Policy Vol. 4 (2001): 241-256. Alberts, B., A. Johnson; Julian Lewis, Martin Raff, et al. Molecular Biology of the Cell 4th ed. New York, NY: Garland Publishing, 2002. Anonymous. “DNA’s Detective Story; Case History.” The Economist (March 2004). Artuso, A. “Bioprospecting, Benefit Sharing, and Biotechnological Capacity Building.” World Development 30 no. 8 (2002): 1355-1368. Baneyx, F. “Recombinant protein expression in Escherichia coli.” Current Opinion in Biotechnology 10 no. 5 (1999): 411-421. Bastian, L.A., K. Nanda, V. Hasselblad, and D. L. Simel. “Diagnostic Efficiency of Home Pregnancy Test Kits: A Meta-analysis.” Archives of Family Medicine 7 no. 5 (1998): 465-469. Begley, S., T. Hayden, W. Underhill, and G. Beals. “Decoding the Human Body.” Newsweek (April 10, 2000): 50. Braham, S., J. Gandhi, S. Beard, and B. Cohen. “Evaluation of the Roche LightCycler Parvovirus B19 Quantification Kit for the Diagnosis of Parvovirus B19 Infections.” Journal of Clinical Virology 31 no. 1 (2004): 5-10. Bruu, A., R. Hjetland, E. Holter, L. Mortensen, et al. “Evaluation of 12 Commercial Tests for Detection of Epstein-Barr Virus-Specific and Heterophile Antibodies.” Clinical and Diagnostic Laboratory Immunology 7 no. 3 (2000): 451-456. Buenz, E., D. J. Schnepple, B. A. Bauer, P. L. Elkin, et al. “Techniques: Bioprospecting Historical Herbal Texts by Hunting for New Leads in Old Tomes.” Trends in Pharmacological Sciences 25 no. 9 (2004): 494-498. Castelain, S., V. Descamps, V. Thibault, C. Francois, et al. “TaqMan Amplification System with an Internal Positive Control for HCV RNA Quantitation.” Journal of Clinical Virology 31 no. 3 (2004): 227-234. Chapin, K., and M. Musgnug. “Evaluation of Three Rapid Methods for the Direct Identification of Staphylococcus aureus from Positive Blood Cultures.” Journal of Clinical Microbiology 41 no. 9 (2003): 4324-4327.
164
BIBLIOGRAPHY
Chu, Lily, and D. K. Robinson. “Industrial Choices for Protein Production by Large-scale Cell Culture.” Current Opinion in Biotechnology 12 no. 2 (2001): 180-187. Coleman, B. “Some Observations on the New Method Of Receiving the Small Pox by Ingrafting or Inoculating.” Harvard College 1721 [cited December 10, 2004]. http://www.ncbi.nlm.nih.gov/books/ bookres.fcgi/history/pdf_colman.pdf. Dwyer, K., P. J. Cowan, and A. J. F. d’Apice. “Xenotransplantation: Past Achievements and Future Promise.” Heart, Lung and Circulation 11 no. 1 (2002): 32-41. Egger, G., G. Liang, A. Aparicio, and P. A Jones. “Epigenetics in Human Disease and Prospects for Epigenetic Therapy.” Nature 429 no. 6990 (2004): 457-463. Emery, D. W. 2004. “Gene Therapy for Genetic Diseases: On the horizon.” Clinical and Applied Immunology Reviews, In Press. Evans, W., and M. V. Relling. “Moving Towards Individualized Medicine with Pharmacogenomics.” Nature 429 no. 6990 (2004): 464-468. Fenwick, S. “Bioprospecting or Biopiracy?” Drug Discovery Today 3 no. 9 (1998): 399-402. Ferrer, M., H. Thorsteinsdottir, U. Quach, P. A. Singer, et al. “The Scientific Muscle of Brazil’s Health Biotechnology.” Nature Biotechnology 22 (Supplement December 2004): DC8-DC12. Fire, A., S. Xu, M. K. Montgomery, S. A. Kostas, et al. “Potent and Specific Genetic Interference by Double-stranded RNA in Caenorhabditis elegans.” Nature 391 no. 6669 (1998): 806-811. Fitzpatrick, A. “Ethics and Animal Research.” Journal of Laboratory and Clinical Medicine 141 no. 2 (2003): 89-90. Fortina, P., S. Surrey, and L. J. Kricka. “Molecular Diagnostics: Hurdles for Clinical Implementation.” Trends in Molecular Medicine 8 no. 6 (2002): 264-266. Gavin, P., and R. B. Thomson, Jr. “Review of Rapid Diagnostic Tests for Influenza.” Clinical and Applied Immunology Reviews 4 no. 3 (2004): 151-172.
BIBLIOGRAPHY
165
Geisse, S., H. Gram, B. Kleuser, and H. P. Kocher. “Eukaryotic Expression Systems: A Comparison.” Protein Expression and Purification 8 no. 3 (1996): 271-282. Gerecht-Nir, S., and J. Itskovitz-Eldor. “The Promise of Human Embryonic Stem Cells.” Best Practice & Research Clinical Obstetrics & Gynaecology 18 no. 6 (2004): 843-852. Greenwald, R., Y. H. Choe, J. McGuire, and C. D. Conover. “Effective Drug Delivery by PEGylated Drug Conjugates.” Advanced Drug Delivery Reviews 55 no. 2 (2003): 217-250. Groopman, J. 1998. “Decoding Destiny: Genetic Testing.” The New Yorker (February 9, 1998): 42. Herzog, E.L., L. Chai, and D. S. Krause. “Plasticity of Marrow-derived Stem Cells.” Blood 102 no. 10 (2003): 3483-3493. Hulse, J.H. “Biotechnologies: Past History, Present State and Future Prospects.” Trends in Food Science & Technology 15 no. 1 (2004): 3-18. Janeway, C.A., P. Travers, M. Walport, and M. Shlomchik. Immunobiology. 6th ed. New York, NY: Garland Press, 2004. Katsoulidou, A., E. Papachristou, M. Petrodaskalaki, V. Sypsa, et al. “Comparison of Three Current Viral Load Assays for the Quantitation of Human Immunodeficiency Virus Type 1 RNA in Plasma.” Journal of Virological Methods 121 no. 1 (2004): 93-99. Keku, T. O., T. Rakhra-Burris, and R. Millikan. “Gene Testing: What the Health Professional Needs to Know.” Journal of Nutrition 133 no. 11 (2003): 3754S-3757. Kurreck, J. “Antisense Technologies: Improvement through Novel Chemical Modifications.” European Journal of Biochemistry 270 no. 8 (2003): 1628-1644. Lewin, A. S., and W. W. Hauswirth. “Ribozyme Gene Therapy: Applications for Molecular Medicine.” Trends in Molecular Medicine 7 no. 5 (2001): 221-228. Lloyd-Evans, M. “Regulating Tissue Engineering.” Materials Today 7 no. 5 (2004): 48-55. Mayhall, E. A., N. Paffett-Lugassy, and L. I. Zon. “The Clinical Potential of Stem Cells.” Current Opinion in Cell Biology 16 no. 6 (2004): 713-720.
166
BIBLIOGRAPHY
Muul, L. M., L. M. Tuschong, S. L. Soenen, G. J. Jagadeesh, et al. “Persistence and Expression of the Adenosine Deaminase Gene for 12 years and Immune Reaction to Gene Transfer Components: Long-term Results of the First Clinical Gene Therapy Trial.” Blood 101 no. 7 (2003): 2563-2569. Ogata, K., and J. L. Platt. “Potential Applications and Prospects for Cardiac Xenotransplantation.” The Journal of Heart and Lung Transplantation 23 no. 5 (2004): 515-526. Perkins, J. 2001. “Genetic Discrimination and Taking Sides Over Privacy.” San Diego Union-Tribune (June 29, 2001): B-7. Peterson, R. K. D., and C. J. Arntzen. “On Risk and Plant-based Miopharmaceuticals.” Trends in Biotechnology 22 no. 2 (2004): 64-66. Ray, Arghya, and B. Norden. “Peptide Nucleic Acid (PNA): Its Medical and Biotechnical Applications and Promise for the Future.” FASEB Journal 14 no. 9 (2000): 1041-1060. Robinson, R. “RNAi Therapeutics: How Likely, How Soon?” PLoS Biology 2 no. 1 (2004): e28. Sachs, L. “The Control of Hematopoiesis and Leukemia: From Basic Biology to the Clinic.” Proceedings of the National Academy of Sciences 93 no. 10 (1996): 4742-4749. Shufaro, Y., and B. E. Reubinoff. “Therapeutic Applications of Embryonic Stem Cells.” Best Practice & Research Clinical Obstetrics & Gynaecology 18 no. 6 (2004): 909-927. Sioud, M. “Therapeutic siRNAs.” Trends in Pharmacological Sciences 25 no. 1 (2004): 22-28. Stender, H., M. Fiandaca, J. J. Hyldig-Nielsen, and J. Coull. 2002. “PNA for Rapid Microbiology.” Journal of Microbiological Methods 48 no. 1 (2002): 1-17. Swartz, J. R. “Advances in Escherichia Coli Production of Therapeutic Proteins.” Current Opinion in Biotechnology Vol. 12 no. 2 (2001): 195-201. Szilvassy, S. J. “The Biology of Hematopoietic Stem Cells.” Archives of Medical Research 34 no. 6 (2003): 446-460. Tamm, I., B. Dorken, and G. Hartmann. 2001. “Antisense Therapy in Oncology: New Hope for an Old Idea?” The Lancet 358 no. 9280 (2001): 489-497.
BIBLIOGRAPHY
167
Verma, I.M. 2002. “Biopiracy: Distrust Widens the Rich-Poor Divide.” Molecular Therapy 5 no. 2 (2002): 95. Wagers, A.J., R.I. Sherwood, J. L. Christensen, and I. L. Weissman. “Little Evidence for Developmental Plasticity of Adult Hematopoietic Stem Cells.” Science 297 no. 5590 (2002): 2256-2259. Walsh, G. “Second-generation Biopharmaceuticals.” European Journal of Pharmaceutics and Biopharmaceutics 58 no. 2 (2004): 185-196. Weissig, V., S-M. Cheng, and G. G. M. D’Souza. “Mitochondrial Pharmaceutics.” Mitochondrion 3 no. 4 (2004): 229-244.
168
FURTHER READING
Alberts, B. J. Alexander, J. Lewis, M. Raff, et al. Molecular Biology of the Cell 4th Edition. New York, NY: Garland Publishing, 2002. Anonymous “DNA’s Detective Story: Case History.” The Economist (March 2004). Drlica, K. Double-Edged Sword: The Promises and Risks of the Genetics Revolution. Reading, MA: Addison-Wesley Publishing Company, 1994. Drlica, K. Understanding DNA and Gene Cloning. New York, NY: John Wiley & Sons, 1997. Gonick, L. M. W. The Cartoon Guide to Genetics. New York, NY: Harper Perennial, 1991. Grace, E. S. Biotechnology Unzipped. Washington, DC: Joseph Henry Press, 1997. Janeway, C. A., P. Travers, Mark Walport, and M. Shlomchik. Immunobiology. New York, NY: Garland Press, 2004. Kolata, G. Clone, The Road to Dolly, and the Path Ahead. New York, NY: William Morrow and Company, 1998. Pollack, R. Signs of Life: The Language and Meanings of DNA. Boston, MA: Houghton Mifflin, 1994. Reichhardt, T., D. Cyranoski, et al. “Religion and Science: Studies of Faith.” Nature 432 no. 7018 (2004): 666-669. Schacter, Bernice. Issues and Dilemmas of Biotechnology: A Reference Guide. Westport, CT: Greenwood Press, 1998.
WEBSITES
American Society of Gene Therapy http://www.asgt.org/ BioTeach http://www.bioteach.ubc.ca/index.htm Biotechnology Industry Organization http://www.bio.org/ CancerQuest http://www.cancerquest.org/ Clinical Trials http://clinicaltrials.gov/ct Food and Drug Administration http://www.fda.gov/ Lab Tests online http://www.labtestsonline.org/index.html National Institutes of Health http://www.nih.gov U.S. Department of Justice on DNA evidence http://www.ojp.usdoj.gov/ovc/publications/bulletins/dna_4_2001/
169
170
INDEX
ABO blood groups, 107–8, 123, 149–50 incompatibility, 127 ADA. See Adenosine deaminase Adenosine deaminase (ADA), 89–90, 149 Adenoviruses, 87, 89, 99, 149 Adverse events, 93, 149 Allergic reactions, 39, 149 Amino acids, 59, 149 sequence, 3–4, 8, 49–50, 52, 158 Anemia aplastic, 113 treatment, 72 Angiogenesis, 99–101, 149 Antibiotics, 149, 158 discovery, 22, 28–33, 145 Antibodies monoclonal, 56–57, 74–75, 77–78, 80–82, 124, 130–33, 145, 157 production, 37–38, 55–60, 63, 81, 107, 123, 128, 149, 157 Antigen, 98, 149 Antisense, 149 use of, 101, 104–5 Antitoxins, 38, 149 Antivenoms, 38, 149 Apoptosis, 99, 149 Arthritis, 64, 96, 138 Aspirin discovery, 22–23, 29 Autoimmune diseases, 149 diseases, 74, 76, 137, 156 Bacillus thuringiensis, 146 Bacteria, 37 Bacteriophage, 12, 150 Bacterium, 28, 150 discovery, 145 and disease, 43, 47–48, 78, 80, 91, 105, 153, 155 DNA, 48 engineering, 8, 12–14, 16–17
and fermentation, 2 functions, 47–48, 157–58 human gene in, 146 prevention of growth, 28–31 recombinant, 45, 47–48, 52, 54, 147 research, 4, 8, 15 treatment of sewage, 145 Banting, Frederick, 40, 52 Bases, 21, 101, 150 complementary, 6, 151 modified, 6–7 pair formation, 8–10, 132, 137, 152–53 triplet of, 7 Basophils, 70, 150 Best, Charles, 40 Biologics Control Act, 38 Biopesticide, 145 Biotechnology, 46, 150 defined, 1–21, 145 development, 22–33 ethical issues, 64–65 history of, 145–48 prices, 64–65 testing, 45–46, 48, 52, 54, 61–63, 68, 74, 77, 79, 82, 110, 128, 130, 133, 144, 154 Blastocyst, 18–19, 150 Blood cell production, 67–72, 83–85, 108, 110, 113, 154 clotting, 66–67, 73, 109, 150 disorders, 109 transfusions, 84, 106–10, 119, 123, 149–50 Bone marrow, 68, 150–51 transplant, 91–92, 109, 116, 127 Bovine somatotropin (BST), 147 Bovine spongiform encephalopathy, 43, 150, 156 BRCA. See Breast cancer genes Breast cancer genes (BRCA), 135, 150 Bush, George W., 111
INDEX
Cancer, 151 cells, 55–56, 74, 80–81, 96–98, 101–2, 105, 131, 141, 143 research, 79 treatment, 8, 27, 72–73, 76, 79–82, 85, 91, 96–105, 113, 135, 147, 150–51, 154, 158 types, 55, 79–80, 99, 101, 134–36, 141, 150 Cell fusion, 56, 151 Cephalosporin, 28 Cerebroside, 62, 151 Chain, Ernst, 32 Chemotherapy and cancer treatment, 73, 79, 91, 98, 123, 113, 151, 158 Chicken pox, 35, 104 vaccination, 84 Chloroplasts, 14, 151 Chromosomes, 151–52 discovery of, 3, 19, 145 disorders of, 66, 89, 103 structures, 3–4 Clinical trials, 27, 151 and children, 94 and gene therapy, 84–85, 87, 89–90, 92–93, 96, 99, 101, 105, 116, 154 protocols, 26, 93, 159 Cloning animals and plants, 16–20, 147–48 cells, 15–16, 56, 151 genes, 15, 146 human, 111 reproductive, 19–20, 159 therapeutic, 160 CODIS. See Combined DNA Index System Collins, Francis, 138 Collip, J.B., 40 Combined DNA Index System (CODIS), 140, 151
171
Corticosteroids, 123, 151 Cowpox, 35–36, 151 Creutzfeldt-Jakob disease (vCJD), 42–43, 152 Crick, Francis research of, 4, 84, 145, 153 Crohn’s disease, 77, 151 Crown Gall disease, 16–17 Cyclosporine, 124, 152 Cystic fibrosis, 85 causes, 90, 152 Cytomegalovirus, 125 Darwin, Charles, 145 Deoxyribonucleic acid (DNA), 158 and common illnesses, 137–38 discovery, 4–8 forensic testing, 139–40, 146 genetic information, 1, 4, 8, 14, 18–21, 81, 145, 149–52, 156 ligase, 12–13, 152 marker tests, 138–41 microarray, 141–44, 152 plasmid, 13 polymerase, 6, 11, 153 recombinant, 48, 52, 45, 159 research, 11–12, 18, 20, 84, 100–4 sequence, 5–6, 9–10, 15, 20, 49–50, 84, 86–89, 132–34, 137, 139, 145, 152, 154–55, 159 structure, 4–8, 84, 145, 152 Diabetes, 39, 111, 152 treatment, 39–40, 47, 61, 117, 132 Dialysis, 124, 152 Differentiation, 71, 111, 152 Digitalis discovery, 23–25, 152 Diphtheria, 37–38, 55, 80 Dominant, 135, 153–54 Double-blind test, 26, 153 Double helix, 4, 152–53
172
INDEX
DNA. See Deoxyribonucleic acid Dwarfism, 85 Embryonic stem cell (ES), 153 production, 111, 114, 148 research, 18–19, 116–19 Enzyme, 14, 99, 101, 147, 153 defects, 147 proteins, 49–50, 52, 54, 62, 78 replacement, 62–64 restrictions, 13 Eosinophil, 70, 153 Ereky, Karl, 145 Erythrocytes. See Red blood cells Erythropoietin production, 70, 72–73 ES. See Embryonic stem Escherichia coli, 47, 53, 153 and human insulin, 48, 60 and infection fighting drugs, 73, 75–76, 79 Eukaryotic cells, 14, 53, 153, 157 Familial adenomatous polyposis, 134, 136, 153 FDA. See Food and Drug Administration Fermentation defined, 1–2, 145, 153 Fibrin, 78, 109, 115, 153 FlavrSavr, 147 Fleming, Alexander discovery of penicillin, 28, 30–32, 145 Fleming, Walther discovery of chromosomes, 145 Florey, Howard, 32 Food and Drug Administration (FDA), 154 and drug approval, 26–27, 60, 62, 65, 84, 91–94, 104, 146–47 and lab test approval, 132 Forensic, 154 testing, 138, 140, 146
Frostban, 147 Fungi, 28 and disease, 43, 154 Gaucher disease, 62–64, 151, 154 Gelsinger, Jesse, 92–93, 95, 147 Gene, 2, 98, 102, 135 chip, 154 cloning, 15 code, 145 defined, 4–5 and DNA, 1, 8–10, 18–21, 145, 149–51, 156 engineering, 2–3, 8–21, 44, 50, 52–54, 56–57, 62, 68, 75, 99, 148, 150, 152, 154, 156, 158–59 gun, 16 map, 147 mutation, 135–36, 157 sequence, 5, 7–9, 73, 128, 137, 144, 148 tests, 138–39, 146, 154–55 Gene therapy, 83–105, 134, 147–48, 152, 154 case study, 83–85 problems with, 89–90 unintended consequences of, 91–95 vectors, 86–89 German measles (rubella), 35 Germ cells, 20, 154 Getty, Jeff, 127 Graft versus host disease, 113, 154 Growth hormone, 85, 102, 155 older treatments for, 62 use of human, 39–43, 61–63, 147 Harvey, William, 106 Heart disease, 117, 138 treatment, 78–79, 111 Hematopoietic stem cell, 70–71, 113, 150, 155 Hemoglobin, 110, 153, 155, 159
INDEX
Hemophilia, 155 treatment, 65–67, 108 Hepatitis, 125 treatment, 75–78 types, 108, 156 HIV/AIDS, 65, 84, 125, 149, 155 and blood transfusions, 67, 105, 108, 119 identification, 146 testing, 131–32, 150 Hormones, 14, 16, 39, 41–42, 131 Human genome project, 86, 138, 147, 155 sequence, 148 Huntington disease, 134–36, 155 Hybridomas, 56–57, 155 Hyperacute rejection, 123, 155 Immune deficient children, 84–85, 89–92 Immune system, 35, 155 defects, 84–85, 89–92, 118, 148, 151, 155, 157 drugs, 74–78 functions, 37–38, 54–56, 62, 70, 73–77, 80, 98, 104–5, 118, 131, 149, 154, 156, 159 and gene therapy, 84–85, 91, 96, 98–101 research, 74 response to transplants, 121, 123–25, 128 Immunization, 35, 37, 56, 155 Immunosuppressive drugs, 123–25, 152, 155 Infectious disease, 155 types, 43 Inflammation, 92, 150, 156–57, 159 suppression, 76–77 Influenza, 131 Informed consent, 27, 156 Inoculation, 156 for small pox, 34–35, 145
173
Insulin, 118, 156 animal, 39, 42, 48, 52, 61 human, 45, 50, 52, 60–61, 63, 146 use of, 39–40, 48–50, 55, 61, 132, 145–46, 158 Interferons, 75–76, 79, 147, 156 Irradiation, 113, 156 Islets of Langerhans, 40, 48, 156 Jeffreys, Alec, 146 Jenner, Edward and cowpox, 35–36, 145 Kohler, Georges research of, 55–56 Leukemia, 80, 85, 91, 95 Lymphocytes, 37, 71, 81, 91, 156 killer, 123–24, 128 MacLeod, J.J.R., 40, 145 Macrophages, 63, 154, 156 Mad cow disease. See Bovine spongiform encephalopathy Malaria, 25, 131, 156 MAPC. See Multipotent adult progenitor cell Medicinal properties, 23, 156 Mendel, Gregor research of, 3, 145 Microbe, 38, 59, 157 Microorganisms, 155–57 breakdown of, 1 research, 23, 29, 32, 37 Milliliter, 132, 157 Milstein, Cesar, 55–56 Minbodies, 58, 157 Mitochondria, 14, 157 Molds, 28, 155, 157 Monocytes, 71 Mononucleosis, 104
174
INDEX
Morphine, 23, 157 Mullis, Kary research of, 10–11, 146 Multiple sclerosis, 64, 74, 96, 111, 117, 149, 157 Multipotent adult progenitor cell (MAPC), 115, 157 Muromonab, 74 Myelin, 75, 157 National Institutes of Health (NIH), 42, 94 Natural products cures for ancient diseases, 22–23, 145 as drugs, 22–33, 145 Neutrophils, 70, 157 NIH. See National Institutes of Health Nucleus, 3, 14, 20, 70, 148, 157 Oncogenes, 96–97, 99, 151, 157 Organ transplantation ethical issues, 126 from non-primates, 127–29 from primates, 124–25 rejection, 124, 161 risks, 123 successes and failures, 121–25 Ornithine transcarbamylase (OTC), 92, 157 OTC. See Ornithine transcarbamylase Ovary, 25, 158 Pancreas cells, 39–40, 48, 90, 117, 152, 156, 158 Parkinson’s disease, 111, 116, 158 Pasteur, Louis and microbe theory, 32, 145 PCR. See Polymerase chain reaction Penicillin, 158 discovery, 28, 30, 32, 55, 145 Peptides, 48, 158
Pertussis. See Whooping cough Pituitary gland, 40–41, 158 Placebo, 26, 158 Placentas, 63, 158 Plasma, 67, 132, 158 Plasmid, 10, 17, 146, 158 DNA, 12–13, 15–16, 49, 86 Platelets, 158 production, 70–71, 73, 108–9 Pluriopotent, 114, 116, 158 Poliovirus, 35 Polymerase chain reaction (PCR), 134, 158 discovery, 146 process, 10–11, 15, 132, 141 Polypeptides. See Proteins Precursor cells 70, 73 Primer, 6–7, 11, 158 Prion, 43, 156, 159 Promoter, 10, 50, 159 Proteins, 141, 149, 152, 158–59 in the blood, 37, 53–54, 86, 113 changing, 48–50 and disease, 47, 62, 90, 118 factories, 45–47, 84, 111, 131 factors, 71 functions, 3, 38–39, 43–44, 49 replacement, 62–64, 66, 68 shape, 50–52, 84 and sugar production, 52–53, 158–59 synthesis, 3–6, 7–8, 12, 14–16, 18, 48–54, 55–61, 69–70, 72–73, 75, 77–80, 91, 109, 153, 155–56, 159 Proteome, 159 Prusiner, Stanley, 43 Quinine, 23, 159 RE. See Restriction endonucleases Receptor, 50–52, 54, 159 growth-factor, 68–69
INDEX
Recessive, 135, 154, 159 Recombinant components DNA, 52, 145, 159 and lab testing, 47, 130–44 Recombinant drugs, x, 159 complications, 62, 147 and infection, 73 production systems, 54–60, 72–73, 76–82, 84 types, 45–60, 84, 146–47 uses, 61–82 Recombinant food discovery, 147 Red blood cells, 153, 159 production, 68, 70–73, 108–10 Reproductive cloning, 19–20, 159 Restriction endonucleases (RE), 8–10, 15, 159 Retroviruses, 87, 159 Rheumatoid arthritis, 159 treatment, 74, 76–77, 149 Ribosomes, 7, 160 Ribozymes, 104–5, 160 RNA, 5, 101–2, 104–5 messenger, 7–8, 141, 143, 156 testing, 132 transfer, 7, 160 viruses, 128 Rubella. See German measles Serum, 38, 160 Severe combined immunodeficiency, 84, 160 Silva, Ashanti de, 83–85, 89–90 Single nucleotide polymorphisms, 137, 160 siRNA. See Small interfering RNA Small interfering RNA (siRNA), 105, 160 Smallpox, 34–35, 151, 160 SNT. See Somatic nuclear transfer Somatic cells, 20, 118, 160
175
Somatic nuclear transfer (SNT), 20, 118, 160 Spinal cord injuries, 117 Starzl, Thomas, 127 Stem cells, 110, 160 adult, 114–17, 119, 148–49 blood-forming, 113 multitalented, 113–16 research, 18–19, 111, 113, 120, 149 research challenge, 113, 117 therapy, 116–17, 150 Taxol®, 25, 160 T cells, 160 and disease, 89–90 killer, 123–24 preventing action of, 74–75, 79 Therapeutic cloning, 118, 160 TNF. See Tumor necrosis factor Tools and methods, Biotechnology development, 2–4 medelian genetics, 2–4 Totipotent, 114, 160 Toxins, 38, 160 Traits, 3 Transcription, 5 Transgene, 18–19, 161 Transgenic animal, 161 first, 18–19, 146 Transgenic plants testing of, 146 Translation, 5 Transmissible spongiform encephalopathies (TSE), 43, 152, 156, 161 TSE. See Transmissible spongiform encephalopathies Tuberculosis, 32–33 Tumor cells, 25, 56–57, 74, 80–81, 97–99, 101–2, 105, 131, 141, 155, 161
176
INDEX
Tumor necrosis factor (TNF), 76–77, 161 Tumor suppressor genes, 97–99, 102, 161 Vaccination, 161 forms, 77–78, 84, 97 process of, 35–38 vCJD. See Creutzfeldt-Jakob disease Vectors, 10, 161 functions, 86–90, 92–93, 99, 101 types, 12, 14, 16, 18 Viruses, 12, 146, 161 and disease, 43, 91, 99, 104, 125, 128–29, 151, 155–56, 159 genetic information, 12, 75–76, 132 and treatment of diseases, 8, 14, 83–84, 86–89, 150
Watson, James research of, 4, 84, 145, 153 White blood cells, 68, 161 production, 72–73, 75, 81, 91, 108, 150, 153, 156–57 Whooping cough (pertussis), 37 WHO. See World Health Organization Wilkins, Maurice, 4 World Health Organization (WHO), 37 Xenotransplantation, 124, 126–28, 162 X-linked severe combined immune deficiency (X-SCID), 91, 162 X-SCID. See X-linked severe combined immune deficiency
PICTURE CREDITS
177
page: 5: 9: 11: 13: 17: 19: 24: 30: 31: 31: 36: 41: 46: 49: 51:
© Peter Lamb © Peter Lamb © Peter Lamb © Peter Lamb © Bill Beatty/Visuals Unlimited © Peter Lamb © Sandi and Bill Langley/ Index Stock Imagery, Inc. Library of Congress (top) © Peter Lamb (bottom) © Mediscan/ Visuals Unlimited © Bettmann/CORBIS © Peter Lamb Associated Press, AP/Paul Sakuma © CORBIS © Peter Lamb
57: 59: 69: 71: 88: 97: 100: 103: 107: 109: 112: 122: 142: 143:
© Peter Lamb © Peter Lamb © Peter Lamb © Peter Lamb © Peter Lamb © 21st Century Publishing © Peter Lamb © Peter Lamb © Peter Lamb © Dr. Robert Caughey/ VisualsUnlimited © Peter Lamb © Bettmann/CORBIS © Science VU/NCI/ Visuals Unlimited Associated Press Graphics
Activase is a registered trademark of Genentech, Inc.; Aranesp is a registered trademark of Amgen, Inc.; Avastin is a registered trademark of Genentech, Inc.; Avonex is a registered trademark of Biogen Idec; Betaseron is a registered trademark of Berlex Laboratories, Inc.; Comvax is a registered trademark of Merck & Co., Inc.; Embrel is a registered trademark of Wyeth Pharmaceutical Products; Enerix-B is a registered trademark of GlaxoSmithKline; Epogen is a registered trademark of Amgen, Inc.; Erbitux is a registered trademark of ImClone Systems Incorporated; Herceptin is a registered trademark of Genentech, Inc.; Humira is a registered trademark of Abbott Laboratories; Intron-A is a registered trademark of Schering Corporation; Leukine is a registered trademark of Berlex Laboratories, Inc.; Mylotarg is a registered trademark of Wyeth Pharmaceutical Products; Neulasta is a registered trademark of Amgen, Inc.; Neumega is a registered trademark of Wyeth Pharmaceutical Products; Neupogen is a registered trademark of Amgen, Inc.; Ontak is a registered trademark of Ligand Pharmaceuticals; Orthoclone OKT3 is a registered trademark of Ortho Biotech Products, L.P.; Pediatrix is a registered trademark of GlaxoSmithKline; Pegasys is a registered trademark of Hoffman-La Roche, Inc.; Peg-INTRON is a registered trademark of Schering Corporation; Procrit is a registered trademark of Ortho Biotech Products, L.P.; Proleukin is a registered trademark of Chiron Corporation; Rebit is a registered trademark of Serono, Inc., and Pfizer, Inc.; Recombivax HB is a registered trademark of Merck & Co., Inc.; Remicade is a registered trademark of Centocor, Inc.; ReoPro is a registered trademark of Centocor, Inc.; Rituxin is a registered trademark of Genentech, Inc.; Roferon-A is a registered trademark of Hoffman-La Roche, Inc.; Simulect is a registered trademark of Novartis Pharmaceutical Corporation; Taxol is a registered trademark of Bristol-Myers Squibb Company; Twinrix is a registered trademark of GlaxoSmithKline; VIOXX is a registered trademark of Merck & Co., Inc.; Vitravene is a registered trademark of ISIS Pharmaceuticals; Zenepax is a registered trademark of Roche Pharmaceuticals.
178
ABOUT THE AUTHOR
BERNICE ZELDIN SCHACTER,
Ph.D., has over 25 years of biomedical research experience in both academia and industry. She was awarded a Ph.D. from Brandeis University and completed postdoctoral training at the Lawrence Radiation Laboratory at the University of California at Berkeley and the University of Miami. She served on the faculty of the School of Medicine at Case Western Reserve University and conducted immunology research at Bristol-Myers Squibb Company. She also served as vice president of research at BioTransplant, Inc., a biotechnology startup company in Boston, Massachusetts. She has published more than 50 papers in peer-reviewed journals and is a coinventor on 4 issued patents. Since 1994, she has been a biomedical consultant and writer, authoring Issues and Dilemmas in Biotechnology (Greenwood Press, 1999). She is currently working on a general audience book on the development of new medicines to be published in 2005. She has taught immunology to undergraduate, graduate, and medical students. She also has developed and offered biotechnology courses for liberal studies students at Wesleyan University in Connecticut and at the University of Delaware.
