METHODS
IN
M O L E C U L A R B I O L O G Y TM
Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK
For other titles published in this series, go to www.springer.com/series/7651
Bioluminescence Methods and Protocols Second Edition
Edited by
Preston B. Rich and
Christelle Douillet University of North Carolina at Chapel Hill, Chapel Hill, NC, USA
Editors Preston B. Rich Department of Surgery University of North Carolina Division of Trauma & Critical Care 4008 Burnett-Womack Bldg. Chapel Hill, NC 27599-7228 USA
[email protected]
Christelle Douillet Department of Surgery University of North Carolina Division of Trauma & Critical Care 90 Manning Drive 6119A Thurston-Bowles Bldg. CB# 7161 Chapel Hill, NC 27599-7161 USA
[email protected]
Series Editor John M. Walker University of Hertfordshire Hatfield, Herts UK
ISSN 1064-3745 e-ISSN 1940-6029 ISBN 978-1-60327-320-6 e-ISBN 978-1-60327-321-3 DOI 10.1007/978-1-60327-321-3 Springer Dordrecht Heidelberg London New York Library of Congress Control Number: 2009931798 # Humana Press, a part of Springer ScienceþBusiness Media, LLC 2009 All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Humana Press, c/o Springer ScienceþBusiness Media, LLC, 233 Spring Street, New York, NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed is forbidden. The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights. Printed on acid-free paper Springer is part of Springer ScienceþBusiness Media (www.springer.com)
Preface Part I I was raised in a redbrick Baltimore row house where summer was marked by the timehonored ritual of firefly-chasing – a backyard tradition that has endured the generations. Amid the excitement, my father often told the story of how, when he was a child, researchers at the Johns Hopkins University had appealed for the systematic capture of live fireflies en masse. Science had engaged the Baltimore youth in an entrepreneurial quest to jar as many lightning bugs as the dwindling light of dusk would permit. The very next morning, each 100-count glass jar of glowing crawling insects could be exchanged at the University for exactly one crisp dollar bill. Unrecognized at the time by my father, his joyous endeavors had contributed in a profound way to the advanced molecular biological techniques that serve as the basis for this textbook. In 1947, William McElroy used extracts from those very fireflies to define the fundamental reaction underlying the mystical phenomenon of luminescence, and published ‘‘The energy source for bioluminescence in an isolated system’’ in the Proceedings of the National Academy of Sciences. In the decades since that summer, the study and application of bioluminescence have allowed us to leverage the enduring power of nature’s elegance. We have painstakingly harnessed a powerful tool that enables us to seek a deeper understanding of the complex mechanisms underpinning so many vital biologic systems. This second edition of Methods in Molecular Biology’s Bioluminescence: Methods and Protocols serves as a readable and utilitarian compilation of the newest and most innovative techniques that have emerged in this rapidly expanding and progressively diverse field. We are indebted to the authors for their thoughtful contributions, inspired by their rigorous dedication to the science of bioluminescence, humbled by the unyielding support of our colleagues, and grateful for the opportunity provided us by John and Jan Walker. Chapel Hill, North Carolina
Preston B. Rich
Part II My first encounter with bioluminescence happened while I was a child, during a family vacation at an Atlantic beach. One evening, we stayed near the water until night time, seeking some relief from the unusual heat. The magic happened when each walking and kicking step agitated the sand and water, lighting a soft blue glow. It evoked both poetic wonder and the foreign feeling suggested by a sci-fi movie. Later, I speculated which species was present that day. It is difficult to know, since so many marine organisms are bioluminescent. v
vi
Preface
Our personal anecdotes and countless others illustrate the widespread occurrence of bioluminescence in nature (bacteria, fungi, worms, fireflies, coral, jellyfish, fishes, etc.). Indeed, it appeared many times independently throughout evolution. Its purposes are also varied: it can be used for communication, predation (e.g., attraction to a lure in fish or aggressive flashing mimicry in fireflies), reproduction (attracting a mate), camouflage, repulsion, or other defensive strategies (e.g., dinoflagellates when endangered by a predator may use bioluminescence to attract a bigger predator who may prey on the smaller predator), and sometimes for illumination (night vision). The extensive use of bioluminescence in nature is mirrored by its very wide use in scientific laboratories. Since the classical experiment by Raphael Dubois in 1885 describing for the first time the luciferin–luciferase reaction, the applications of bioengineered bioluminescence have continuously increased in number. In popular culture, the development of glowing pets, self-illuminating Christmas trees, and other wild endeavors appear amusing (light indeed). However, the applications in biotechnology and medicine are cutting-edge and far-reaching. Bioluminescence is used to study cellular and subcellular phenomenon, and we present in this second edition of Methods in Molecular Biology’s Bioluminescence: Methods and Protocols some methods to assess cell trafficking, protein–protein interactions, intracellular signaling, and apoptosis. One key feature of bioluminescence is the possibility to visualize and quantify biological mechanisms in real-time and in in vivo settings. This opens new avenues of knowledge, and we have included here some chapters that describe the in vivo study of bacterial or viral infections, transplanted cells, stem cells proliferation, vascular flow, and tumors. The commercialization of reporter genes, assay kits, and imaging systems provide easy access to the materials needed for such studies. This book provides protocols that are detailed enough to be followed and adapted by scientific teams who have no previous expertise in bioluminescence. Hence, we believe that numerous breakthrough and new applications from basic to applied science and medicine will continue to be developed. We thank the chapters’ authors for sharing their rich expertise, and Jan and John Walker for helping us throughout the editorial process. Chapel Hill, North Carolina
Christelle Douillet
Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
v ix
1.
Luminescent Probes and Visualization of Bioluminescence . . . . . . . . . . . . . . . . . . Elisa Michelini, Luca Cevenini, Laura Mezzanotte, and Aldo Roda
1
2.
Validation of Bioluminescent Imaging Techniques. . . . . . . . . . . . . . . . . . . . . . . . . John Virostko and E. Duco Jansen
15
3.
Assessment of Extracellular ATP Concentrations . . . . . . . . . . . . . . . . . . . . . . . . . . Lucia Seminario-Vidal, Eduardo R. Lazarowski, and Seiko F. Okada
25
4.
High-Throughput Quantitative Bioluminescence Imaging for Assessing Tumor Burden . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Angelina Contero, Edmond Richer, Ana Gondim, and Ralph P. Mason
5.
6.
Fluorescence Imaging of Tumors with ‘‘Smart’’ pH-Activatable Targeted Probes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Daisuke Asanuma, Hisataka Kobayashi, Tetsuo Nagano, and Yasuteru Urano Imaging Vasculature and Lymphatic Flow in Mice Using Quantum Dots . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Byron Ballou, Lauren A. Ernst, Susan Andreko, James A. J. Fitzpatrick, B. Christoffer Lagerholm, Alan S. Waggoner, and Marcel P. Bruchez
7.
Bioluminescent Imaging of Transplanted Islets . . . . . . . . . . . . . . . . . . . . . . . . . . . Xiaojuan Chen and Dixon B. Kaufman
8.
Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cell Survival, Proliferation, and Fate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kitchener D. Wilson, Mei Huang, and Joseph C. Wu
9.
37
47
63
75
87
Detection of Apoptosis Using Cyclic Luciferase in Living Mammals . . . . . . . . . . . 105 Akira Kanno, Yoshio Umezawa, and Takeaki Ozawa
10. Noninvasive Bioluminescent Imaging of Infections . . . . . . . . . . . . . . . . . . . . . . . . 115 Javier S. Burgos 11. Real-Time Bioluminescence Imaging of Viral Pathogenesis . . . . . . . . . . . . . . . . . . 125 Kathryn E. Luker and Gary D. Luker 12. Bioluminescent Monitoring of In Vivo Colonization and Clearance Dynamics by Light-Emitting Bacteria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137 Siouxsie Wiles, Brian D. Robertson, Gad Frankel, and Angela Kerton 13. Quantitative In Vivo Imaging of Non-viral-Mediated Gene Expression and RNAi-Mediated Knockdown . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 155 Garrett R. Rettig and Kevin G. Rice
vii
viii
Contents
14. Analysis of Protein–Protein Interactions Using Bioluminescence Resonance Energy Transfer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173 Kevin D.G. Pfleger 15. Bioluminescent Imaging of MAPK Function with Intein-Mediated Reporter Gene Assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185 Akira Kanno, Takeaki Ozawa, and Yoshio Umezawa 16. Bioluminescence Analysis of Smad-Dependent TGF-b Signaling in Live Mice . . . . 193 Jian Luo and Tony Wyss-Coray 17. Bioluminescence Imaging of Calcium Oscillations Inside Intracellular Organelles. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203 Carlos Villalobos, Marı´a Teresa Alonso, and Javier Garcı´a-Sancho 18. Novel Tools for Use in Bioluminescence Resonance Energy Transfer (BRET) Assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 215 Me´lanie Robitaille, Isabelle He´roux, Alessandra Baragli, and Terence E. He´bert 19. PIN-G Reporter for Imaging and Defining Trafficking Signals in Membrane Proteins. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 235 Lynn Mckeown, Vicky C. Jones, and Owen T. Jones 20. Imaging b-Galactosidase Activity In Vivo Using Sequential Reporter-Enzyme Luminescence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 249 Georges von Degenfeld, Tom S. Wehrman, and Helen M. Blau Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 261
Contributors MARI´A TERESA ALONSO • Instituto de Biologı´a y Gene´tica Molecular (IBGM), Universidad de Valladolid and Consejo Superior de Investigaciones Cientı´ficas (CSIC), Valladolid, Spain SUSAN ANDREKO • Molecular Biosensor and Imaging Center, Carnegie Mellon University, Pittsburgh, PA, USA DAISUKE ASANUMA • Graduate School of Pharmaceutical Sciences, The University of Tokyo, Tokyo, Japan BYRON BALLOU • Molecular Biosensor and Imaging Center, Carnegie Mellon University, Pittsburgh, PA, USA ALESSANDRA BARAGLI • Department of Pharmacology and Therapeutics, McGill University, Montre´al, QC, Canada HELEN M. BLAU • Baxter Laboratory in Genetic Pharmacology, Department of Microbiology and Immunology, Stanford University School of Medicine, Stanford, CA, USA MARCEL P. BRUCHEZ • Molecular Biosensor and Imaging Center and Department of Chemistry, Carnegie Mellon University, Pittsburgh, PA, USA JAVIER S. BURGOS • Drug Discovery Unit, Neuron BPh, Granada, Spain LUCA CEVENINI • Department of Pharmaceutical Sciences, University of Bologna, Bologna, Italy ANGELINA CONTERO • Cancer Imaging Program, UT Southwestern, Dallas, TX, USA XIAOJUAN CHEN • Division of Organ Transplantation, Department of Surgery, Feinberg School of Medicine, Northwestern University, Chicago, IL, USA E. DUCO • Jansen Department of Biomedical Engineering, Vanderbilt University, Nashville, TN, USA LAUREN A. ERNST • Molecular Biosensor and Imaging Center, Carnegie Mellon University, Pittsburgh, PA, USA JAMES A.J. FITZPATRICK • Molecular Biosensor and Imaging Center, Carnegie Mellon University, Pittsburgh, PA, USA GAD FRANKEL • Division of Cell and Molecular Biology, Imperial College, London, UK JAVIER GARCI´A-SANCHO • Instituto de Biologı´a y Gene´tica Molecular (IBGM), Universidad de Valladolid and Consejo Superior de Investigaciones Cientı´ficas (CSIC), Valladolid, Spain ANA GONDIM • Cancer Imaging Program, UT Southwestern, Dallas, TX, USA TERENCE E. HE´BERT • Department of Pharmacology and Therapeutics, McGill University, Montre´al, QC, Canada ISABELLE HE´ROUX • De´partement de Biochimie, Universite´ de Montre´al; Department of Pharmacology and Therapeutics, McGill University, Montre´al, QC, Canada MEI HUANG • Molecular Imaging Program at Stanford (MIPS), Stanford University, Stanford, CA, USA OWEN T. JONES • Faculty of Life Sciences, The University of Manchester, Manchester, UK VICKY C. JONES • Faculty of Life Sciences, The University of Manchester, Manchester, UK ix
x
Contributors
AKIRA KANNO • Department of Chemistry, School of Science, The University of Tokyo; Japan Science and Technology Agency, Tokyo, Japan DIXON B. KAUFMAN • Division of Organ Transplantation, Department of Surgery, Feinberg School of Medicine, Northwestern University, Chicago, IL, USA ANGELA KERTON • Central Biomedical Services, Imperial College, London, UK HISATAKA KOBAYASHI • Molecular Imaging Program, National Cancer Institute, National Institute of Health, Center for Cancer Research, Bethesda, MD, USA B. CHRISTOFFER LAGERHOLM • MEMPHYS, University of Southern Denmark, Odense, Denmark EDUARDO R. LAZAROWSKI • Cystic Fibrosis/Pulmonary Research and Treatment Center, The University of North Carolina at Chapel Hill, Chapel Hill, NC, USA GARY D. LUKER • Departments of Radiology and Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, MI, USA KATHRYN E. LUKER • Departments of Radiology and Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, MI, USA JIAN LUO • Department of Neurology and Neurological Sciences, Stanford University School of Medicine, Stanford, CA, USA RALPH P. MASON • Cancer Imaging Program, UT Southwestern, Dallas, TX, USA LYNN MCKEOWN • Faculty of Life Sciences, The University of Manchester, Manchester, UK LAURA MEZZANOTTE • Department of Pharmaceutical Sciences, University of Bologna, Bologna, Italy ELISA MICHELINI • Department of Pharmaceutical Sciences, University of Bologna, Bologna, Italy TETSUO NAGANO • Graduate School of Pharmaceutical Sciences, The University of Tokyo, Tokyo, Japan SEIKO F. OKADA • Cystic Fibrosis/Pulmonary Research and Treatment Center, The University of North Carolina at Chapel Hill, Chapel Hill, NC, USA TAKEAKI OZAWA • Department of Chemistry, School of Science, The University of Tokyo; Japan Science and Technology Agency, Tokyo, Japan KEVIN D.G. PFLEGER • Western Australian Institute for Medical Research (WAIMR) and Centre for Medical Research, University of Western Australia, Perth, Australia GARRETT R. RETTIG • Division of Medicinal and Natural Products Chemistry, College of Pharmacy, University of Iowa, Iowa City, IA, USA KEVIN G. RICE • Division of Medicinal and Natural Products Chemistry, College of Pharmacy, University of Iowa, Iowa City, IA, USA EDMOND RICHER • Cancer Imaging Program, UT Southwestern, Dallas, TX, USA BRIAN D. ROBERTSON • Department of Microbiology, Imperial College, London, UK ME´LANIE ROBITAILLE • De´partement de Biochimie, Universite´ de Montre´al; Department of Pharmacology and Therapeutics, McGill University, Montre´al, QC, Canada ALDO RODA • Department of Pharmaceutical Sciences, University of Bologna, Bologna, Italy LUCIA SEMINARIO-VIDAL • Cystic Fibrosis/Pulmonary Research and Treatment Center, The University of North Carolina at Chapel Hill, Chapel Hill, NC, USA YOSHIO UMEZAWA • Department of Chemistry, School of Science, The University of Tokyo; Research Institute of Pharmaceutical Sciences, Tokyo, Japan
Contributors
xi
YASUTERU URANO • Graduate School of Pharmaceutical Sciences, The University of Tokyo, Tokyo, Japan CARLOS VILLALOBOS • Instituto de Biologı´a y Gene´tica Molecular (IBGM), Universidad de Valladolid and Consejo Superior de Investigaciones Cientı´ficas (CSIC), Valladolid, Spain JOHN VIROSTKO • Vanderbilt University Institute of Imaging Science, Vanderbilt University, Nashville, TN, USA GEORGES VON DEGENFELD • Cardiovascular Research, Bayer Healthcare AG, Wuppertal, Germany ALAN S. WAGGONER • Molecular Biosensor and Imaging Center, Carnegie Mellon University; Department of Biology, Carnegie Mellon University, Pittsburgh, PA, USA TOM S. WEHRMAN • Discoverx Corp, Fremont, CA, USA SIOUXSIE WILES • Department of Infectious Diseases and Immunity, Imperial College London, London, UK KITCHENER D. WILSON • Department of Bioengineering, Stanford University; Molecular Imaging Program at Stanford (MIPS), Stanford University, Stanford, CA, USA JOSEPH C. WU • Molecular Imaging Program at Stanford (MIPS), Stanford University and Department of Medicine, Division of Cardiology, Stanford University School of Medicine, and Department of Radiology, Stanford University School of Medicine, Stanford, CA, USA TONY WYSS-CORAY • Department of Neurology and Neurological Sciences, Stanford University School of Medicine, Stanford; GRECC, VA Palo Alto Health Care System, Palo Alto, CA, USA
Chapter 1 Luminescent Probes and Visualization of Bioluminescence Elisa Michelini, Luca Cevenini, Laura Mezzanotte, and Aldo Roda Abstract Bioluminescence (BL) has revealed an extremely useful analytical tool enabling ultrasensitive detection in biotechnological applications. Following the discovery of luciferin and luciferases, molecular biology techniques allowed the cloning of several luciferases and photoproteins. Among most used BL reporters, we find firefly and click-beetle luciferases, bacterial luciferase, Renilla, Gaussia, and Cypridina luciferases, and calcium-activated photoproteins. According to the specific bioluminescent protein, different substrates and protocols must be applied in the experimental procedure for BL measurement. By conjugating (either chemically or by molecular biology techniques) bioluminescent probes to specific targets, it is in fact possible to track a wide range of events and analytes. To aid investigators in the choice and applications of reporter genes, the materials and methods required for BL measurements and experimental protocols are described. Key words: Bioluminescent proteins, Photinus pyralis luciferase, bacterial luciferase, Gaussia luciferase aequorin, reporter gene.
1. Introduction The typical bioanalytical applications of bioluminescent (BL) proteins include the investigation of protein–protein interactions, protein conformational changes, protein phosphorylation, second-messengers expression and, in general, the study of gene expression and gene regulation (1, 2). The expression of a BL protein can be put under the control of tissue-specific regulatory elements allowing non-invasive imaging of physiological and pathological processes like differentiation, apoptosis, tumor progression, and inflammation, even in a 3D fashion by means of BL tomography, which allows 3D BL source reconstruction (3).
P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_1, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
1
2
Michelini et al.
Since BL proteins can be detected down to very low levels, they allow ultrasensitive detection of the target analytes and monitoring of the physiological phenomena under investigation. These BL features, associated to instrumental and technical advancements in miniaturization, enable the analysis of small-volume samples, which leads to the development of miniaturized and high-throughput assays. The principal advantages of BL reporter gene-based assays are their high sensitivity, reliability, convenience, dynamic range, and adaptability to high-throughput screening. The choice of reporter gene, however, depends on the cell line used, the nature of the experiment, and the adaptability of the assay to the appropriate detection method (e.g., single-cell imaging versus well- or plate-based detection). A broad variety of BL proteins with different properties is today available for the most demanding applications. Genetically engineered cells (bacteria, yeasts, or mammalian cells) able to produce a BL signal in response to a target analyte represent powerful analytical tools for environmental, medical, and food analysis, and are characterized by low cost and high rapidity and sensitivity. The cells are modified by introducing a reporter gene fused to a regulatory DNA sequence that is activated only in the presence of the analyte of interest, which thus regulates the reporter gene expression. According to intracellular or secreted expression of the BL protein, different protocols have to be used (Fig. 1.1).
Fig. 1.1. Schematic view of heterologous expression of one or more bioluminescent proteins in a cell system. A cell line is transfected with one or more reporter plasmids expressing a BL protein (e.g., firefly or Gaussia luciferases) under the regulation of a specific promoter; cells are lysed and BL emission is measured in cell extracts after substrate addition to assay intracellular activity (e.g., for firefly or click-beetle luciferases). If the BL protein is secreted into the culture medium (e.g., Gaussia and Cypridina luciferases), BL emission is assayed directly in aliquots of culture medium simply by addition of the substrate.
Luminescent Probes
3
2. Firefly Luciferase Among BL reporter proteins, luciferase from the North American firefly Photinus pyralis is by far the most employed. Luciferase does not require any post-translational modification for enzyme activity, and it is not toxic even at high concentrations, being thus suitable for in vivo applications in prokaryotic and eukaryotic cells. Several commercially available luciferase assay formulations have been developed, permitting single-step reporter activity measurements, also including cell lysis. Luciferase BL measurements and experimental setup is described in detail depending on the cellular system used (mammalian, bacterial, or yeast cells). 2.1. Mammalian Expression 2.1.1. Materials
1. Mammalian cell line, e.g., HepG2 cells in MEM (minimum essential medium with Earle’s salts), supplemented with 10% (v/v) fetal calf serum, 2 mM L-glutamine, 0.1 mM non-essential amino acids, MEM vitamins, and antibiotic/antimycotic solution (all materials for cell culture from Invitrogen) 2. Triton1 X-100: 1% solution 3. Solution of Trypsin-EDTA (0.25% Trypsin; 1 mM EDTA 4Na) l
4. Luciferase reporter plasmids (Several vectors are available from Promega and Clontech) 5. Exgen500 (MBI Fermentas, Vilnius, Lituania) 6. 96-well flat-bottom microtiter plate 7. Bright-GloTM luciferase assay system (Promega) to be stored in aliquots at –80C 8. Varioskan Flash spectral scanning multimode reader (Thermo Scientific), Veritas microplate luminometer (Turner Biosystems), Centro LB 960 luminometer (Berthold technologies), or Victor multilabel counter (Perkin-Elmer Wallac, Turku, Finland). 2.1.2. Methods
According to the vector used for luciferase expression different protocols may be used, and a careful optimization of experimental procedure is always required depending on the level of luciferase expression, cell type, and instrumentation features. 1. Cell transfection. Cells are passaged when approaching confluence with trypsin/EDTA and plated in 24-well plates approximately at a density of 2–6 104 the day before transfection. About 50–70% confluent cells in 24-well plates are transfected using 1 mg of DNA in physiological solution and 3.3 mL (6 equivalents) of ExGen 500 per well of 24-well plate according to the manufacturer’s instructions (see Note 1). Although the presence of serum does not affect ExGen500-mediated
4
Michelini et al.
transfection efficiency, a phosphate-buffered saline (PBS) wash is preferable before transfection. Transfected cells are incubated at 37C for 48–72 h. For stable transfection, the appropriate selective agent has to be added and transgene expression monitored 10–15 days after transfection. 2. Preparation of cell extracts. Approximately 48–72 h after transfection, cells are washed twice in PBS and lysed with 200 mL of 1% Triton1 X-100 for 5 min at 25C. Cells are scraped from the culture dish, transferred to a microcentrifuge tube, and centrifuged for 2 min at 12,800g to pellet the cell debris. After centrifugation, 100 mL of supernatant (cell extract) is transferred to a white 96-well plate (or luminometer tubes). 3. Measurement for luciferase activity. Each cell lysate is analyzed by the addition of 100 mL (or an equal volume of cell extract) room temperature Bright-GloTM luciferase assay system (see Note 2). Light acquisition from 5 to 30 s, depending on the luminometer used and the sensitivity required (see Note 3). A number of controls are always necessary for quantification of luciferase activity. Positive and negative controls must always be introduced in the experimental setup. The light units values must be corrected for cell number and/or total amount of protein. 2.2. Firefly Luciferase Assay in Bacterial and Yeast Cells
1. Saccharomyces cerevisiae cells expressing firefly luciferase (without the peroxisomal targeting codons, otherwise a cell lysis step is required for the assay) or alternatively bacterial cells expressing firefly luciferase.
2.2.1. Materials
2.
D-luciferin (Synchem). Working solution: 1 mM in 0.1 M Na citrate buffer (pH 5.0) prepared by mixing 35.0 mL of 0.1 M citric acid and 65.0 mL of 0.1 M trisodium citrate.
3. LB broth medium or yeast synthetic complete (SC) medium. 4. Victor multilabel counter (Perkin-Elmer Wallac, Turku, Finland). 2.2.2. Methods
1. Yeast culture. A 5-mL preculture expressing firefly luciferase is grown overnight at 30C in an orbital shaker in synthetic complete medium. The culture is diluted to OD600 nm ¼ 0.6. The diluted culture is grown at 30C until it reaches midlogarithmic phase (OD600 nm ¼ 1.4). Then 100-mL aliquots of cell culture are pipetted into a 96-well plate. 2. Bacterial cultures. A 5-mL preculture expressing firefly luciferase is grown overnight in LB broth medium at 37C. The culture is diluted to OD600 nm ¼ 0.6. Then 100-mL aliquots of cell culture are pipetted into a 96-well plate for luminescence measurements.
Luminescent Probes
5
3. Luminescence measurements. D-Luciferin (1 mM, 100 mL) in 0.1 M Na citrate buffer (pH 3.0 or 5.0) is pipetted into the wells containing 100 mL-aliquots of yeast or bacterial cultures. The plate is briefly shaken and then immediately measured using a luminometer (1–5 s integration time). The light-emission levels are expressed as RLU (relative light units ¼ luminescence value given by the luminometer) (see Note 4).
3. Bacterial Luciferases (lux) Bacterial luciferase catalyzes the oxidation of reduced flavin mononucleotide (FMNH2) and a long-chain aldehyde by molecular oxygen to yield FMN, the corresponding acid, H2O, and light (490 nm)(4). In luminous bacteria the formation of bioluminescent system is controlled by an ‘‘autoinducer’’ (e.g., N-acyl homoserine lactone, AHL) that is produced and secreted by the cells; the inducer levels in the culture medium increase with the growth of the bacterial cells until they reach a threshold and the biosynthesis of bioluminescent system begins (5). 3.1. Materials
Light-producing bacteria (Xenogen)
3.2. Methods
Bacterial luciferase operon contains the genes encoding both for luciferase and for the enzymes able to synthesize its bioluminescent substrate, thus eliminating the need for exogenous substrate addition. Luminous bacteria are suitable for direct determination of sample general toxicity, measuring the decrease of bioluminescent emission as the concentration of toxic compound increase. Due to the low expression levels of bacterial luciferase in mammalian cells, it is mostly used in bacterial BL bioassays. Luciferase assay can be performed in a 96-well microtiter plate: 1. Grow cell culture until OD600 nm ¼ 0.6–0.8. 2. Transfer the cell suspension (200 mL) into each well. 3. Add 100 mL of the sample to be tested to each well in duplicate. 4. Incubate for 30–60 min at 37C. 5. Read with luminometer, 10-s integration time (see Note 5).
4. Gaussia Luciferase Gaussia luciferase (Gluc) is a novel secreted luciferase, cloned from the copepod Gaussia princeps, which catalyzes the oxidation of the small molecule coelenterazine (CTZ) to produce light. Unlike the
6
Michelini et al.
firefly luciferase systems, these CTZ-utilizing luciferases do not require accessory high-energy molecules such as ATP, simplifying their use in a number of reporter applications (6, 7). This luciferase catalyzes the oxidation of the substrate CTZ in a reaction that emits light (lmax ¼ 470 nm), and has considerable advantages over other reporter genes. Since Gluc, when expressed into mammalian cells, is secreted into the culture medium, the BL measurements are performed simply by addition of CTZ in culture medium, without the need for cell lysis. 4.1. Materials
1. Native coelenterazine (Nanolight Technology, Prolume Ltd., Pinetop, AZ). CTZ stock solution is prepared at 1 mg/mL concentration in methanol acidified by HCl (to 10 mL of 100% anhydrous methanol, 50 mL concentrated HCl are added). CTZ is dissolved in an amber microcentrifuge tube to protect from light. CTZ stock solution can be stored at 70C (2–4 week shelf life). Dry CTZ may be stored at 70C for longest storage life. CTZ working solution: CTZ stock solution is diluted to a final concentration of 5 mM in PBS (see Note 6). 2. Vectors expressing the humanized version of Gluc for cloning promoter sequences to assess their transcriptional regulatory functions in mammalian cells (e.g., pGluc-Basic-1 vector from New England BioLabs; pCMV-Gluc-1 from Nanolight Technology) or the native form (pUC19 GLuc from Nanolight Technology) for bacterial expression.
4.2. Methods
Luminescence measurements. CTZ working solution is pipetted into the wells containing yeast, bacterial, or mammalian cells expressing Gaussia luciferase. In order to perform repetitive measurements and real-time monitoring of Gluc expression in the same cellular population, aliquots of culture medium (usually up to 10 mL) are transferred into a 96-well plate and assayed for Gluc emission. The plate is briefly shaken and then immediately measured after CTZ addition using a luminometer with an automated injection system.
5. Cypridina Luciferase Cypridina luciferase is a secreted bioluminescent protein (62 kDa) cloned from the ostracod Cypridina noctiluca, which catalyzes the oxidation of its luciferin to produce light, with a maximum wavelength emission at 465 nm (8).
Luminescent Probes
5.1. Materials
7
1. Vector containing Cypridina luciferase cDNA sequence (pCL). 2. Native Cypridina luciferin (also known as Vargulin, NanoLight Technology): 0.5 mM in 10 mM Tris-HCl, pH 7.4.
5.2. Methods
This luciferase has been used as bioluminescent reporter enzyme in yeast, bacterial, and mammalian cell-based assays, with the methods and the same advantages of Gaussia luciferase. Luminescence measurements. Cypridina luciferase activity is measured by mixing 20 mL of culture medium with 80 mL of native or synthetic luciferin. BL measurements are performed by automatic injection of Cypridina luciferin (see Note 7).
6. Aequorin Aequorin is a photoprotein, isolated from the luminescent jellyfish Aequorea victoria, composed of two distinct units, the apoprotein apoaequorin (22 kDa) and the prosthetic group CTZ that reconstitute spontaneously in the presence of molecular oxygen, forming the functional protein (9, 10). Aequorin has become a useful tool in molecular biology for the measurement of intracellular Ca2+ levels, since it has several binding sites for Ca2+ ions responsible for protein conformational changes that convert through oxidation its prosthetic group, CTZ, into excited coelenteramide and CO2. As the excited coelenteramide relaxes to the ground state, blue light (lmax ¼ 469 nm) is emitted and can be easily detected with a luminometer (Fig. 1.2). 6.1. Materials
1. Native coelentarazine (NanoLight Technology, Prolume Ltd., Pinetop, AZ) or Coelenterazine h, a derivative of native coelenterazine that is more sensitive to calcium, making it the ideal choice for luminescent calcium HTS. CTZ working solution: 5 mM CTZ in 100 mM Tris, 90 mM NaCl, 5 mM EDTA, pH 8. 2. Vector expressing mature Aequorin apoprotein sequence in pUC19 vector (e.g., pAPHO from NanoLight Technology). 3. Triggering solution: 0.75% Triton X-100, 15 mM CaCl2.
6.2. Methods
CTZ freely permeates cell membranes, facilitating the reconstitution of the aequorin complex in vivo. Luminescence measurements. 100-mL aliquots of cell suspension (yeast, bacterial, or mammalian cell cultures expressing apoaequorin) in exponential growth phase are pipetted into the wells of
8
Michelini et al.
Fig. 1.2. Schematic view of aequorin BL emission. Aequorin is composed of an apoprotein (molecular mass 21 kDa) and a hydrophobic prosthetic group, CTZ (molecular mass 400 Da). Its polypeptide sequence includes three high-affinity Ca2+ binding sites. Ca2+ binding causes the rupture of the covalent link between the apoprotein and the prosthetic group; this reaction is associated with the emission of one photon.
a 96-well microtiter plate. The cells are incubated overnight with 50 mL of CTZ working solution at 4C in the dark to reconstitute aequorin. Then the plate is warmed at room temperature for 10 –min, and BL emission is measured using a luminometer with an automated injection system. To trigger the reaction, 100 mL of Triggering X-100 solution are added to each well and measured with 1-s integration time.
7. Multiplexed Bioluminescence The recent availability of new reporter genes with improved BL properties, together with technical improvements, prompted the development of multiplexed cell-based assays and multicolor in vivo imaging. We reported dual and triple-color mammalian assays, which combine spectral unmixing of green- and red-emitting luciferases with a secreted luciferase requiring a different substrate, thus allowing to measure three separate targets with high sensitivity and rapidity (11).
Luminescent Probes
7.1. Materials
9
1. Elution buffer: 50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 7. 2. Purified BL proteins requiring the same substrate and emitting at different wavelength like green CBG99luc and red CBRluc genes from Promega in elution buffer. 3.
D-Luciferin
(Biosynth, A.G., Switzerland).
4. Adenosine 50 -triphosphate magnesium salt from bacterial source. 5. 25 mM Glycylglycine buffer (pH 7.8). 6. Eclipse spectrofluorometer (Varian). When two proteins that require different substrates for BL emission are used (e.g., firefly and Renilla luciferase from Promega) in the dual assay: 1. Dual-GloTM Luciferase Assay System (Promega) designed to allow high-throughput analysis of mammalian cells containing genes for firefly and Renilla luciferases, grown in 96- or 384-well plates. 2. ModulusTM Microplate Luminometer (Turner Biosystems) with dual injectors or VeritasTM Microplate Luminometer. 7.2. Methods
Ideally, in a dual-color system the emission spectra of the two reporters would not overlap. Unfortunately, two BL proteins requiring the same substrate whose emissions do not overlap at all have not been identified yet. To minimize spectral overlap, the two emitters should have the narrowest bandwidths possible and wellseparated emission maxima (see Note 8). When two luciferases that emit at different wavelength (e.g., green- and red-emitting firefly luciferases) are used in the same cell-based assay and filters are used to resolve the two signals, a preliminary measurement of the filter correction factors has to be performed by assaying each purified luciferase separately with no filters, and with the green and red filters. These values provide the calibrations constants for the Promega Chroma-Luc calculator, an Excel spreadsheet designed to calculate corrected luminescence values from samples containing red- and green-emitting proteins (12). As previously reported, the concept of detection limit in a dual-color assay is not easy to define (13). In fact, the luminescent signal from one emitter (e.g., green) transmitted through the filter used to monitor the other emitter (e.g., red), i.e. the interference, must be taken into consideration together with the background noise when calculating the detection limit. This interference is concentration-dependent, meaning that the detection limits and the working range of an emitter are dependent on the concentration of the other. 1. Measurement of bioluminescence emission spectra. Emission spectra are obtained using an Eclipse spectrofluorometer (Varian) in ‘‘Bio/Chemiluminescence’’ mode (excitation
10
Michelini et al.
source turned off). Reaction mixtures containing purified green- and red-emitting luciferases (5–100 mg) in elution buffer, 70 mM D-luciferin, and 2 mM Mg-ATP are brought to a final volume of 1 mL with 25 mM glycylglycine buffer (pH 7.8) (see Note 9). Approximately 1 min after initiation of bioluminescence, spectra are recorded in a 1.0-mL fluorescence cuvette and emission slit of 10 nm. Bandwidths of emission spectra are measured at 50% and 20% of the intensity at the maximum wavelength. 2. Bacterial expression and model reporter systems. Dual-reporter model systems were developed to investigate the best luciferase pair for dual reporter assays. The BL proteins are first expressed in 5 mL LB medium cultures of Escherichia coli strain JM109 grown at 37C overnight and diluted in 20 mL LB medium to midlog phase (A600 nm ¼ 0.6). Different proportions of cell cultures expressing the luciferases are transferred in a total volume of 100 mL in a 96-well microtiter plate. All combinations have to be tested in triplicate. 3. Spectral resolution. Luminescence measurements are performed with a Luminoskan Ascent equipped with an injector for substrate addition. An amount of 100 mL of D-luciferin 1 mM in 0.1 M Na citrate buffer solution at pH 5.0 is injected with an automatic dispenser, and after a brief shaking luminescence measurements are performed with 5-s integration. Luciferase activities are measured in the absence or presence of two emission filters. The Promega Chroma-Luc ‘‘Calculator’’ is used to determine the contributions of red- and greenemitting luciferases. Figure 1.3 shows BL emissions obtained
Fig. 1.3. BL emissions of a red-emitting luciferase (&) and a green-emitting luciferase (~) expressed in Escherichia coli JM109 cells grown at 37C. The assay is performed in 96-well microtiter plates using different proportions of two bacterial populations expressing the red- or the green-emitting luciferase. The total cell culture volume is held constant (100 mL). Mean values are plotted, with standard deviations indicated by error bars. RLU, relative light units.
Luminescent Probes
11
mixing populations of E. coli JM109 cells expressing a red- and a green-emitting luciferase grown at 37C. Different proportions of cell cultures expressing the luciferases are transferred in a total volume of 100 mL in a 96-well microtiter plate. All combinations are tested in triplicate. Simultaneous measurements of green- and red-emitters are performed in intact E. coli cells in a high-throughput 96-well microplate format. The same assay can be performed using purified BL proteins instead of bacterial cells expressing the two proteins (13).
8. Notes 1. High-quality DNA is critical for successful transfection; an OD260/OD280 ratio of 1.8 or greater is recommended; DNA should be sterile and free of any contaminant such as endotoxins. 2. Since luciferase activity is temperature-dependent, the temperature of the luciferase assay buffers should be held constant at room temperature while quantifying luminescence. Reagent stored frozen after reconstitution must be thawed below 25C to ensure reagent performance. Mix well after thawing. The simplest method for thawing is placing the reagent in a water bath at room temperature. For maximum reproducibility, cell cultures should be equilibrated to room temperature before adding reagent. 3. Using a Luminoskan Ascent luminometer (ThermoLabsystem), a 10-s signal acquisition should be enough when measuring P. pyralis luciferase BL emission in mammalian cells. When higher sensitivies are required (e.g., in case of low levels of luciferase expression), the Bright-GloTM Reagent provides at least fourfold more light output than other extended half-life luciferase reagents. The SteadyGlo1 Luciferase Assay System (Promega) is designed to provide long-lived luminescence (over 5 h) when added to cultured cells and is thus suitable for high-throughput analysis with good reproducibility. 4. When analyzing analytes or liquid samples, it is preferable to add 5 mL of the analyte in solution to 95 mL-cell culture aliquots and add 100 mL of D-luciferin for the light measurement. In the latter case, a blank well should be prepared containing 5 mL of the analyte solvent and 95-mL cell culture aliquots to assess aspecific matrix or solvent effect on the BL signal.
12
Michelini et al.
5. Note that intracellular redox state and growth phase play an important role in the overall response of whole-cell biosensors based on the bacterial luciferase operon; thus studies of the kinetics of induction, as opposed to end-point measurements, are needed to obtain more reliable determinations, especially when high-throughput screening applications are envisioned (14). 6. CTZ spontaneously decays and is unstable for prolonged periods in aqueous solutions. For best results and highest sensitivity, CTZ working solution should be prepared fresh. It is recommended to let the CTZ working solution sit for 15–20 min at room temperature before use. 7. Note that Cypridina luciferin is hundred times more unstable than native coelenterazine, so for best results dissolve immediately before use. 8. Since firefly luciferases are pH-sensitive and may change emission wavelength at different pH, the pH should be measured to investigate if an eventual red-shifting or spectrum broadening caused by pH lowering could interfere with the signal separation. 9. Protein purification may be easily performed by expressing the BL proteins as his-fusion proteins. Briefly, 6his-fusion proteins are first grown in E. coli strain BL-21 in 5-mL LB medium with 100 mg/ml ampicillin at 37C overnight. These cultures are used to inoculate 250 ml cultures at a 1:100 dilution (LB broth supplemented with 100 mg/ml ampicillin), and grown at 37C with shaking until an OD600 nm of 0.6 is reached. Cultures are transferred to a 22C incubator, allowed to equilibrate, and induced with 0.1 mM isopropylbeta-D-thiogalactopyranoside (Sigma) overnight. Qiagen Ni-NTA resins (Qiagen) are used for protein purification according to manufacturer’s instructions, with slight modifications. Cells are harvested by centrifugation, resuspended in 2 ml of lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, 1 mM PMSF, pH 7), and sonicated using ten 10-s bursts with a 15-s cooling period on ice between each burst. The lysate is then centrifuged at 2,200g for 1 h at 4C to pellet cellular debris, and the supernatant is saved to proceed with protocol for purification under native condition. The cleared lysate is mixed with 1 mL of the 50% Ni-NTA slurry, loaded into a polypropylene columns (Qiagen), and washed twice with 4 mL wash buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, 1 mM PMSF, pH 7). Then 500-mL aliquots are eluted in Elution Buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 7). Protein concentration is determined by Bio-Rad Microassay procedure using bovine serum albumin (BSA) as
Luminescent Probes
13
standard. The activity of the purified proteins is evaluated with a luminometer (Luminoskan Ascent, Labsystem) using 4 mL of eluted protein, 100 mL PBS, and 100 mL of BrightGloTM Luciferase Assay System (Promega). References 1. Roda, A., Pasini, P., Mirasoli, M., Michelini, E., and Guardagli, M. (2004) Biotechnological applications of bioluminescence and chemiluminescence. Trends Biotechnol 22, 295–303. 2. Roda, A., Guardagli, M., Pasini, P., and Mirasoli, M. (2003) Bioluminescence and chemiluminescence in drug screening. Anal Bioanal Chem 377, 826–833. 3. Sato, A., Klaunberg, B., and Tolwani, R. (2004) In vivo bioluminescence imaging. Comp Med 54, 631–634. 4. Nealson, K. H., and Hastings, J. W. (1979) Bacterial bioluminescence: its control and ecological significance. Microbiol Rev 43, 496–518. 5. Dunlap, P. V. (1999) Quorum regulation of luminescence in Vibrio fischeri. J Mol Microbiol Biotechnol 1, 5–12. 6. Tannous, B. A., Kim, D. E., Fernandez, J. L., Weissleder, R., and Breakefield, X. O. (2005) Codon-optimized Gaussia luciferase cDNA for mammalian gene expression in culture and in vivo. Mol Ther 11, 435–443. 7. Verhaegent, M., and Christopoulos, T. K. (2002) Recombinant Gaussia luciferase. Overexpression, purification, and analytical application of a bioluminescent reporter for DNA hybridization. Anal Chem 74, 4378–4385. 8. Nakajima, Y., Kobayashi, K., Yamagishi, K., Enomoto, T., and Ohmiya, Y. (2004)
9.
10.
11.
12.
13.
14.
cDNA cloning and characterization of a secreted luciferase from the luminous Japanese ostracod, Cypridina noctiluca. Biosci Biotechnol Biochem 68, 565–570. Shimomura, O. (2005) The discovery of aequorin and green fluorescent protein. J Microsc 217, 1–15. Shimomura, O. (1995) Luminescence of aequorin is triggered by the binding of two calcium ions. Biochem Biophys Res Commun 211, 359–363. Michelini, E., Cevenini, L., Mezzanotte, L., Ablamsky, D., Southworth, T., Branchini, B., and Roda, A. (2008) Spectral-resolved gene technology for multiplexed bioluminescence and highcontent screening. Anal Chem 80, 260–267. Promega Corporation. (2003) Chroma-Glo Luciferase Assay System Technical Manual No. TM062, 7–9. Branchini, B. R., Southworth, T. L., Khattak, N. F., Michelini, E., and Roda, A. (2005) Red- and green-emitting firefly luciferase mutants for bioluminescent reporter applications. Anal Biochem 345, 140–148. Galluzzi, L., and Karp, M. (2007) Intracellular redox equilibrium and growth phase affect the performance of luciferase-based biosensors. J Biotechnol 127, 188–198.
Chapter 2 Validation of Bioluminescent Imaging Techniques John Virostko and E. Duco Jansen Abstract Bioluminescence imaging (BLI) is frequently cited for its ease of quantification. This fundamental strength of BLI has led to applications in cancer research, cell transplantation, and monitoring of infectious disease in which bioluminescence intensity is correlated with other metrics. However, bioluminescence measurements can be influenced by a number of factors, among them source location, tissue optical properties, and substrate availability and pharmacokinetics. Accounting for these many factors is crucial for accurate BLI quantification. A number of methods can be employed to ensure correct interpretation of BLI results and validate BLI techniques. This chapter summarizes the use of calibrated light-emitting standards, bioluminescence tomography, and post-mortem validation of luciferase expression for validating quantitative BLI measurements. Key words: Bioluminescence imaging, BLI, luciferase, optical imaging, quantification, validation, optical attenuation, light propagation, bioluminescence tomography.
1. Introduction Bioluminescence imaging (BLI) has been applied to a variety of small animal models to provide a quantifiable assessment of bioluminescent cells. Bioluminescence has been used extensively in cancer research; BLI intensity has been used to assess tumor growth (1) and regression in response to treatment (2, 3). BLI quantification has been correlated with caliper measurements (4), excised tumor weight (5), MRI volume (6), and PET measurements of tumor burden (7). Bioluminescence has also been used to visualize transplanted cells (8). BLI has been employed to track engraftment and survival of a variety of cell types, including bone marrow cells, pancreatic islets, and cardiac allografts (9). BLI measures of transplanted cell survival have been correlated with P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_2, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
15
16
Virostko and Jansen
other metrics of cellular engraftment. For example, BLI measurements of cardiac allograft survival correlates with graft beating scores (10). Similarly, BLI measurements after transplantation of pancreatic islets correlate with the number of islets transplanted (11–13). Bioluminescence has been employed to assess the extent of bacterial and viral infection (14–16). In these studies, bioluminescence measurements have been correlated with viral load (17). Imaging gene expression is another quantifiable application of BLI (18). For example, BLI has been used to quantify VEGF gene expression and correlated with ex vivo measures of protein expression (19).
2. Factors Affecting BLI Measurements 2.1. Optical Attenuation Influences BLI Measurements
While bioluminescence measurements have been correlated with other metrics in numerous studies, BLI quantification can be affected by several factors other than the quantity of bioluminescent cells. Biological tissue attenuates light propagation, influencing the detected bioluminescence intensity. Upon entering a biological medium, photons of light can be absorbed by the tissue components and converted to heat, catalyze a chemical reaction, or be released as fluorescence emission. Molecules that absorb light are known as chromophores; for visible light, hemoglobin and melanin are the principle chromophores. Photons are also scattered in media with spatial fluctuations in density and refractive index, resulting in changes in photon path direction. In biological tissue, discrete particles, such as cell membranes, nuclei, collagen, or other cellular microstructures, can cause photon scattering. The attenuation of light by tissue between a bioluminescent source and the detector will decrease the BLI signal. A practical implication of this light attenuation is that bioluminescence measurements are influenced by source depth: sources at increasing depth pass through more biological tissue, suffer greater optical attenuation, and thus exhibit decreased BLI signal (20–22). For instance, a dim superficial source may appear as strong as a bright but deep source, leading to erroneous interpretation that both sources have equal levels of luciferase. Optical attenuation also determines the minimum detectable number of cells, as the minimum signal necessary for detection increases with source depth (20). The optical attenuation of a biological tissue is determined by the propensity of the tissue to absorb and scatter photons of light, known as the optical properties of the tissue. The optical properties of different biological tissues can vary by several orders of magnitude, depending on the molecular components and structure of
Validation of Bioluminescent Imaging Techniques
17
the tissue (23). The attenuation of a bioluminescent signal depends not only on the source depth but also on the tissue or organ through which the light passes. Thus the anatomical location of the source can influence measurements of BLI intensity: bioluminescent sources underneath highly attenuating organs appear less intense. Bioluminescence attenuation is further complicated by the fact that optical properties of biological tissue are not static; dynamic processes can influence optical attenuation. Hemoglobin has been shown to reduce BLI signal due to the strong absorption of light by hemoglobin (24). Increased blood flow, such as present during tumor angiogenesis or hemorrhaging, can influence BLI quantification (25). Surgical artifacts can also affect optical attenuation. For example, after transplantation of bioluminescent cells, inflammation and scarring in tissue overlying the source can lower the detected bioluminescent signal (22). 2.2. BLI Pharmacokinetics Affect BLI Quantification
The chemoluminescent reaction that produces bioluminescence can be influenced by several mechanisms. The luciferase enzyme found in the firefly, Photinus pyralis, catalyzes bioluminescence through the following reaction (26). Luciferase þ Luciferin þ ATP þ O2Mg2þ ! LuciferaseLuciferin þ AMP þ PPi LuciferaseLuciferin þ AMP þ O2 !Oxyluciferin þ CO2 þ AMP Oxyluciferin ! Oxyluciferin þ hv In the presence of oxygen, magnesium, and ATP, the reaction of the luciferase enzyme with the substrate luciferin yields an electronically excited oxyluciferin. The return of oxyluciferin to its ground state is accompanied by the release of a single photon (27). Thus, in the presence of excess oxygen, ATP, and luciferin, the number of photons emitted is proportional to the number of molecules of luciferase present (28). However, the bioavailability of oxygen, ATP, and luciferin can be limiting factors in the bioluminescence reaction, especially in diseased states. In a study of hepatic tumors BLI was found to correlate with tumor burden in small tumors, but for progressively larger tumor sizes this correlation weakened due to tumor hypoxia (25). Similarly, another study found that BLI measurements tend to underestimate tumor volume for fibrotic and necrotic tumors (29). ATP can be a ratelimiting factor in BLI, a fact that has long been used to assay ATP content in cells (30) and map ATP distribution in tumors (31). Bioavailability of the luciferin substrate can also affect the luciferase reaction. The amount of luciferin substrate reaching bioluminescent sources following systemic administration (4) and cellular
18
Virostko and Jansen
uptake of luciferin (32) have both been implicated in affecting bioluminescence measurements. The pharmacokinetics of luciferin delivery influences bioluminescence measurements. The luciferase reaction is dynamic, with peak intensity reached 5–20 min after administration of luciferin followed by a gradual decline over an hour (1, 6). The decline in bioluminescence intensity results from the clearance of luciferin, while the firefly luciferase enzyme has a half-life of 3 h (33, 34). There is evidence that the time to peak bioluminescence intensity can be affected by source location, presumably due to differences in substrate delivery (35).
3. Accounting for Optical Attenuation Several techniques can be employed to validate accurate quantification of bioluminescence measurements. As previously discussed, optical attenuation can affect the detected bioluminescent source intensity. In order to accurately quantify BLI measurements, the extent of optical attenuation must be determined. Two methods for determining this attenuation and accounting for it in BLI quantification are outlined below. 3.1. Constant LightEmitting Standards
If the location of a bioluminescent source is known, constant lightemitting standards can be implanted at that site to provide a surrogate marker for bioluminescence (22). Luminescent beads (Mb-Microtec, Bern, Switzerland) consist of glass capillary tubes filled with tritium, which excites a phosphor and isotropically emits constant intensity light. The spectral emission from these sources closely mimics the spectral emission of firefly luciferase. When these beads are placed at the site of a bioluminescent source, they can be used to model light attenuation from that site. As light emission from these beads is affected only by tissue optics and not by any biological factors, the proportion of emitted light that is detected can be calculated to quantify optical attenuation. Luminescence imaging of these beads can be performed dynamically after implantation to capture the effect of surgery on luminescence measurements, as observed after transplantation of bioluminescent cells (22).
3.2. Bioluminescence Tomography
If the precise location of bioluminescent sources is not known, mathematical models of light propagation can be employed to reconstruct bioluminescent source location and intensity. Algorithms that tomographically reconstruct bioluminescent sources are under development, which account for optical attenuation when quantifying bioluminescent source intensity (36–47). A
Validation of Bioluminescent Imaging Techniques
19
number of these techniques take advantage of the fact that light attenuation is a function of wavelength, with optical attenuation by biological tissue inversely related to wavelength. These approaches perform BLI at multiple wavelengths and incorporate this multispectral information to determine source depth (36, 37, 41, 44, 46). A simplified example of this multispectral approach is that a light source with equal levels of short- and long-wavelength light would emit greater levels of long-wavelength light relative to short wavelength at a deeper location. Several models of photon propagation have been employed to model bioluminescence, including the diffusion approximation (37, 39, 41, 44) and Monte Carlo modeling (43). A common attribute of these algorithms is that the optical properties of the biological tissue must be included to model the absorption and scatter of photons from a bioluminescent source. One approach is to model the mouse as optically homogeneous. However, as previously noted, the optical properties of different tissues varies, leading to erroneous reconstruction of bioluminescent sources in heterogeneous mouse tissue when optical homogeneity is assumed (36, 48). Several approaches to model optical heterogeneity are under development. One approach is to use an atlas of mouse organs and assign optical properties based on that atlas (36, 46). However, deformation of the actual mouse volume from that of the atlas may impair accuracy using this method. Another approach is to determine the anatomy from another modality, such as MRI (49). However, this method sacrifices both the speed and inexpensiveness of BLI, and has thus far only been shown to marginally improve reconstruction accuracy (49). The choice of optical properties to assign to each organ also influences reconstruction accuracy, as published values can vary significantly (23). In situ measurements of optical properties have been shown to improve BLI reconstruction accuracy (38).
4. Substrate Availability and Pharmacokinetics
As previously discussed, substrate availability and pharmacokinetics can also influence bioluminescence measurements. Consistent substrate availability requires precise injection of luciferin, with total dosage normalized by the animal weight. The pharmacokinetics of luciferin are dynamic and must be controlled. One study found that the tumor bioluminescence measured 10–20 min after intraperitoneal luciferin administration correlated well with peak luminescence, the intensity integrated for an hour postluciferin administration, and tumor size (4). This imaging window
20
Virostko and Jansen
10–20 min after luciferin injection seems to provide the most consistent bioavailability of luciferin, but should be validated in each animal model with repeatability studies.
5. Post-mortem Validation of Luciferase Expression
Even after controlling for tissue optical attenuation and substrate availability and pharmacokinetics, BLI measurements can be affected by other factors, such as co-factor availability. Availability of oxygen and ATP can be difficult to non-invasively determine in vivo. However, assays of luciferase content (50, 51) and luciferase immunohistochemistry (52) can be performed post-mortem to ensure that co-factor availability is not influencing bioluminescence measurements.
5.1. Luciferase Staining
Immunohistochemical staining can be used to validate luciferase expression. Rabbit anti-luciferase antibodies, such as that from Cortex Biochem, Inc. (San Leandro, CA), can be employed to detect luciferase on tissue slides. To systematically examine luciferase expression in the tissue sections, sections throughout the tissue block can be stained for luciferase expression. This immunohistochemical validation can then be correlated with in vivo BLI measurements.
5.2. Luciferase Activity
Post-mortem measures of luciferase activity in tissue lysates can be determined by luminometer. These luminometer assays provide luciferin, oxygen, and ATP in excess to prevent any of these components from being rate-limiting in the luciferase reaction. Furthermore, as tissues are homogenized prior to the assay, optical attenuation is negligible. Several studies have correlated in vivo BLI measurements with luminometer measurements of luciferase activity in vitro (50, 51). In applications where protein content can vary from sample to sample, luciferase activity can be normalized to total protein.
References 1. Edinger, M., Sweeney, T. J., Tucker, A. A., Olomu, A. B., Negrin, R. S., and Contag, C. H. (1999) Noninvasive assessment of tumor cell proliferation in animal models. Neoplasia (New York, N.Y.) 1, 303–310. 2. Edinger, M., Cao, Y. A., Verneris, M. R., Bachmann, M. H., Contag, C. H., and Negrin, R. S. (2003) Revealing lymphoma growth and the efficacy of immune cell
therapies using in vivo bioluminescence imaging. Blood 101, 640–648. 3. Sweeney, T. J., Mailander, V., Tucker, A. A., Olomu, A. B., Zhang, W., Cao, Y., Negrin, R. S., and Contag, C. H. (1999) Visualizing the kinetics of tumor-cell clearance in living animals. Proc Natl Acad Sci USA 96, 12044–12049. 4. Paroo, Z., Bollinger, R. A., Braasch, D. A., Richer, E., Corey, D. R., Antich, P. P., and
Validation of Bioluminescent Imaging Techniques
5.
6.
7.
8.
9.
10.
11.
12.
13.
Mason, R. P. (2004) Validating bioluminescence imaging as a high-throughput, quantitative modality for assessing tumor burden. Mol Imaging 3, 117–124. Vooijs, M., Jonkers, J., Lyons, S., and Berns, A. (2002) Noninvasive imaging of spontaneous retinoblastoma pathway-dependent tumors in mice. Cancer Res 62, 1862–1867. Rehemtulla, A., Stegman, L. D., Cardozo, S. J., Gupta, S., Hall, D. E., Contag, C. H., and Ross, B. D. (2000) Rapid and quantitative assessment of cancer treatment response using in vivo bioluminescence imaging. Neoplasia (New York, N.Y.) 2, 491–495. Ray, P., Wu, A. M., and Gambhir, S. S. (2003) Optical bioluminescence and positron emission tomography imaging of a novel fusion reporter gene in tumor xenografts of living mice. Cancer Res 63, 1160–1165. Cao, Y. A., Wagers, A. J., Beilhack, A., Dusich, J., Bachmann, M. H., Negrin, R. S., Weissman, I. L., and Contag, C. H. (2004) Shifting foci of hematopoiesis during reconstitution from single stem cells. Proc Natl Acad Sci USA. 101, 221–226. Cao, Y. A., Bachmann, M. H., Beilhack, A., Yang, Y., Tanaka, M., Swijnenburg, R. J., Reeves, R., Taylor-Edwards, C., Schulz, S., Doyle, T. C., Fathman, C. G., Robbins, R. C., Herzenberg, L. A., Negrin, R. S., and Contag, C. H. (2005) Molecular imaging using labeled donor tissues reveals patterns of engraftment, rejection, and survival in transplantation. Transplantation 80, 134–139. Tanaka, M., Swijnenburg, R. J., Gunawan, F., Cao, Y. A., Yang, Y., Caffarelli, A. D., de Bruin, J. L., Contag, C. H., and Robbins, R. C. (2005) In vivo visualization of cardiac allograft rejection and trafficking passenger leukocytes using bioluminescence imaging. Circulation 112, I105–I110. Chen, X., Zhang, X., Larson, C. S., Baker, M. S., and Kaufman, D. B. (2006) In vivo bioluminescence imaging of transplanted islets and early detection of graft rejection. Transplantation 81, 1421–1427. Fowler, M., Virostko, J., Chen, Z., Poffenberger, G., Radhika, A., Brissova, M., Shiota, M., Nicholson, W. E., Shi, Y., Hirshberg, B., Harlan, D. M., Jansen, E. D., and Powers, A. C. (2005) Assessment of pancreatic islet mass after islet transplantation using in vivo bioluminescence imaging. Transplantation 79, 768–776. Lu, Y., Dang, H., Middleton, B., Zhang, Z., Washburn, L., Campbell-Thompson, M.,
14.
15.
16.
17.
18.
19.
20.
21.
22.
21
Atkinson, M. A., Gambhir, S. S., Tian, J., and Kaufman, D. L. (2004) Bioluminescent monitoring of islet graft survival after transplantation. Mol Ther 9, 428–435. Contag, C. H., Contag, P. R., Mullins, J. I., Spilman, S. D., Stevenson, D. K., and Benaron, D. A. (1995) Photonic detection of bacterial pathogens in living hosts. Mol Microbiol 18, 593–603. Francis, K. P., Yu, J., Bellinger-Kawahara, C., Joh, D., Hawkinson, M. J., Xiao, G., Purchio, T. F., Caparon, M. G., Lipsitch, M., and Contag, P. R. (2001) Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon. Infect Immun 69, 3350–3358. Rocchetta, H. L., Boylan, C. J., Foley, J. W., Iversen, P. W., LeTourneau, D. L., McMillian, C. L., Contag, P. R., Jenkins, D. E., and Parr, T. R., Jr. (2001) Validation of a noninvasive, real-time imaging technology using bioluminescent Escherichia coli in the neutropenic mouse thigh model of infection. Antimicrob Agents Chemother 45, 129–137. Luker, G. D., Bardill, J. P., Prior, J. L., Pica, C. M., Piwnica-Worms, D., and Leib, D. A. (2002) Noninvasive bioluminescence imaging of herpes simplex virus type 1 infection and therapy in living mice. J Virol 76, 12149–12161. Contag, C. H., Spilman, S. D., Contag, P. R., Oshiro, M., Eames, B., Dennery, P., Stevenson, D. K., and Benaron, D. A. (1997) Visualizing gene expression in living mammals using a bioluminescent reporter. Photochem Photobiol 66, 523–531. Wang, Y., Iyer, M., Annala, A., Wu, L., Carey, M., and Gambhir, S. S. (2006) Noninvasive indirect imaging of vascular endothelial growth factor gene expression using bioluminescence imaging in living transgenic mice. Physiol Genomics 24, 173–180. Rice, B. W., Cable, M. D., and Nelson, M. B. (2001) In vivo imaging of light-emitting probes. J Biomed Opt 6, 432–440. Zhao, H., Doyle, T. C., Coquoz, O., Kalish, F., Rice, B. W., and Contag, C. H. (2005) Emission spectra of bioluminescent reporters and interaction with mammalian tissue determine the sensitivity of detection in vivo. J Biomed Opt 10, 41210. Virostko, J., Chen, Z., Fowler, M., Poffenberger, G., Powers, A. C., and Jansen, E. D. (2004) Factors influencing quantification
22
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
Virostko and Jansen of in vivo bioluminescence imaging: application to assessment of pancreatic islet transplants. Mol Imaging 3, 333–342. Cheong, W. F., Prahl, S. A., and Welch, A. J. (1990) A review of the optical-properties of biological tissues. Ieee J Quantum Elect 26, 2166–2185. Colin, M., Moritz, S., Schneider, H., Capeau, J., Coutelle, C., and Brahimi-Horn, M. C. (2000) Haemoglobin interferes with the ex vivo luciferase luminescence assay: consequence for detection of luciferase reporter gene expression in vivo. Gene Ther 7, 1333–1336. Sarraf-Yazdi, S., Mi, J., Dewhirst, M. W., and Clary, B. M. (2004) Use of in vivo bioluminescence imaging to predict hepatic tumor burden in mice. J Surg Res 120, 249–255. Gould, S. J., and Subramani, S. (1988) Firefly luciferase as a tool in molecular and cell biology. Anal Biochem 175, 5–13. Nguyen, V. T., Morange, M., and Bensaude, O. (1988) Firefly luciferase luminescence assays using scintillation counters for quantitation in transfected mammalian cells. Anal Biochem 171, 404–408. Brasier, A. R., Tate, J. E., and Habener, J. F. (1989) Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines. BioTechniques 7, 1116–1122. Nyati, M. K., Symon, Z., Kievit, E., Dornfeld, K. J., Rynkiewicz, S. D., Ross, B. D., Rehemtulla, A., and Lawrence, T. S. (2002) The potential of 5-fluorocytosine/ cytosine deaminase enzyme prodrug gene therapy in an intrahepatic colon cancer model. Gene Ther 9, 844–849. Addanki, S., Sotos, J. F., and Rearick, P. D. (1966) Rapid determination of picomole quantities of ATP with a liquid scintillation counter. Anal Biochem 14, 261–264. Tamulevicius, P., and Streffer, C. (1995) Metabolic imaging in tumours by means of bioluminescence. Br J Cancer 72, 1102–1112. Zhang, Y., Bressler, J. P., Neal, J., Lal, B., Bhang, H. E., Laterra, J., and Pomper, M. G. (2007) ABCG2/BCRP expression modulates D-Luciferin based bioluminescence imaging. Cancer Res 67, 9389–9397. Rettig, G. R., McAnuff, M., Liu, D., Kim, J. S., and Rice, K. G. (2006) Quantitative bioluminescence imaging of transgene expression in vivo. Anal Biochem 355, 90–94. Thompson, J. F., Hayes, L. S., and Lloyd, D. B. (1991) Modulation of firefly luciferase
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
stability and impact on studies of gene regulation. Gene 103, 171–177. Burgos, J. S., Rosol, M., Moats, R. A., Khankaldyyan, V., Kohn, D. B., Nelson, M. D., Jr., and Laug, W. E. (2003) Time course of bioluminescent signal in orthotopic and heterotopic brain tumors in nude mice. BioTechniques 34, 1184–1188. Alexandrakis, G., Rannou, F. R., and Chatziioannou, A. F. (2005) Tomographic bioluminescence imaging by use of a combined optical-PET (OPET) system: a computer simulation feasibility study. Phys Med Biol 50, 4225–4241. Chaudhari, A. J., Darvas, F., Bading, J. R., Moats, R. A., Conti, P. S., Smith, D. J., Cherry, S. R., and Leahy, R. M. (2005) Hyperspectral and multispectral bioluminescence optical tomography for small animal imaging. Phys Med Biol 50, 5421–5441. Comsa, D. C., Farrell, T. J., and Patterson, M. S. (2007) Bioluminescence imaging of point sources implanted in small animals post mortem: evaluation of a method for estimating source strength and depth. Phys Med Biol 52, 5415–5428. Cong, W., Durairaj, K., Wang, L. V., and Wang, G. (2006) A born-type approximation method for bioluminescence tomography. Med Phys 33, 679–686. Cong, W., and Wang, G. (2006) Boundary integral method for bioluminescence tomography. J Biomed Opt 11, 020503. Dehghani, H., Davis, S. C., Jiang, S., Pogue, B. W., Paulsen, K. D., and Patterson, M. S. (2006) Spectrally resolved bioluminescence optical tomography. Opt Lett 31, 365–367. Klose, A. D., and Hielscher, A. H. (1999) Iterative reconstruction scheme for optical tomography based on the equation of radiative transfer. Med Phys 26, 1698–1707. Kumar, D., Cong, W. X., and Wang, G. (2007) Monte Carlo method for bioluminescence tomography. Indian J Exp Biol 45, 58–63. Kuo, C., Coquoz, O., Troy, T. L., Xu, H., and Rice, B. W. (2007) Three-dimensional reconstruction of in vivo bioluminescent sources based on multispectral imaging. J Biomed Opt 12, 024007. Li, S., Zhang, Q., and Jiang, H. (2006) Two-dimensional bioluminescence tomography: numerical simulations and phantom experiments. Appl Opt 45, 3390–3394. Lv, Y., Tian, J., Cong, W., Wang, G., Yang, W., Qin, C., and Xu, M. (2007) Spectrally resolved bioluminescence tomography with adaptive finite element analysis:
Validation of Bioluminescent Imaging Techniques
47.
48.
49.
50.
methodology and simulation. Phys Med Biol 52, 4497–4512. Soloviev, V. Y. (2007) Tomographic bioluminescence imaging with varying boundary conditions. Appl Opt 46, 2778–2784. Virostko, J., Powers, A. C., and Jansen, E. D. (2007) Validation of luminescent source reconstruction using single-view spectrally resolved bioluminescence images. Appl Opt 46, 2540–2547. Allard, M., Cote, D., Davidson, L., Dazai, J., and Henkelman, R. M. (2007) Combined magnetic resonance and bioluminescence imaging of live mice. J Biomed Opt 12, 034018. Sadikot, R. T., Jansen, E. D., Blackwell, T. R., Zoia, O., Yull, F., Christman, J. W., and Blackwell, T. S. (2001) High-dose
23
dexamethasone accentuates nuclear factorkappa b activation in endotoxin-treated mice. Am J Respir Crit Care Med 164, 873–878. 51. Wu, J. C., Sundaresan, G., Iyer, M., and Gambhir, S. S. (2001) Noninvasive optical imaging of firefly luciferase reporter gene expression in skeletal muscles of living mice. Mol Ther 4, 297–306. 52. Mocanu, J. D., Yip, K. W., Alajez, N. M., Shi, W., Li, J. H., Lunt, S. J., Moriyama, E. H., Wilson, B. C., Milosevic, M., Lo, K. W., van Rooijen, N., Busson, P., Bastianutto, C., and Liu, F. F. (2007) Imaging the modulation of adenoviral kinetics and biodistribution for cancer gene therapy. Mol Ther 15, 921–929.
Chapter 3 Assessment of Extracellular ATP Concentrations Lucia Seminario-Vidal, Eduardo R. Lazarowski, and Seiko F. Okada Abstract Most cells release ATP to the extracellular milieu. Extracellular ATP plays important signaling roles by activating a score of broadly distributed cell surface purinergic receptors (purinoceptors). Biological responses regulated by purinergic receptors include neurotransmission, smooth muscle relaxation and contraction, epithelial cell ion transport, inflammation, platelet activation, immune responses, cardiac function, endocrine and exocrine secretion, glucose transport, and cell proliferation. ATP concentrations at the cell surface, and consequently the magnitude of purinergic receptor stimulation, reflect a wellcontrolled balance between rates of ATP release and extracellular metabolism. Given the broad spectrum of responses triggered by extracellular ATP, there is a growing interest in accurately assessing the concentrations of this nucleotide at the cell surface. In this chapter, we discuss the use of the luciferin/ luciferase-based reaction to measure extracellular ATP concentrations with high sensitivity. Protocols are adapted to assess ATP levels either in sampled extracellular fluids or in situ at the cell surface. Although our focus is on studies of ATP release from epithelial cells, protocols described here are applicable to practically all cell types. Key words: ATP release, extracellular ATP, ecto-ATPase, luciferase, protein A-luciferase, luciferin. Abbreviations: 6 His: hexa-histidine, ALU: arbitrary light unit, ARL-67156: 6-N-N-diethylb,g-dibromomethylene-D-ATP, b,g-metATP: b,g-methyleneadenosine 50 -triphosphate, BSA: bovine serum albumin, DMEM: Dulbecco’s modified eagle’s medium, ebselen: 2-phenyl-1,2benzisoselenazol-3(2H)-one, FBS: fetal bovine serum, HBSS: Hank’s balanced salt solution, HEPES: 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid, MEM: minimum essential medium, PBS: phosphate-buffered saline, RT: room temperature, SPA-luc: Staphylococcus protein A-fused luciferase.
1. Introduction ATP is an essential component of living cells. ATP is the major source of energy in most biosynthetic processes, participates as cofactor or activator of numerous enzymatic reactions, and is a P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_3, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
25
26
Seminario-Vidal, Lazarowski, and Okada
building block of nucleic acid chains. In addition, ATP is released from cells in a regulated manner to accomplish autocrine and paracrine functions via the activation of cell surface purinergic receptors (purinoceptors) (1). Purinoceptors consist of three widely distributed families: P2X, P2Y, and P1 receptors. Purinoceptor-mediated responses include cell proliferation, migration, differentiation, embryonic development, wound healing, restenosis, atherosclerosis, ischemia, turnover of epithelial cells in skin and visceral organs, inflammation, neuroprotection, and cancer (1). P2X receptors are ligand-gated cation channels. They include seven molecularly defined species (P2X1–P2X7), all of which are selectively activated by ATP, but not by other nucleotides (2). The P2Y receptor family includes eight G protein-coupled receptors: the P2Y1, P2Y2, P2Y4, P2Y6, P2Y11, P2Y12, P2Y13, and P2Y14 receptors. The P2Y2 receptor is potently activated by ATP (and UTP). The P2Y11 receptor is selectively activated by ATP, whereas the P2Y12 and P2Y13 receptors are most potently and selectively activated by ADP. P2Y4, P2Y6, and P2Y14 receptors are activated selectively by uridine nucleotides and UDP-sugars (1). The P1 receptor family (A1, A2a, A2b, and A3 adenosine receptors) is activated by the nucleoside adenosine, the final product of ATP dephosphorylation. Cellular ATP is released both in the absence of external stimuli and in response to physiological stimuli. Levels of extracellular ATP are controlled by a complex array of nucleotide-metabolizing cell surface enzymes, which include ecto-nucleotidases of the ectonucleotide triphosphate diphosphohydrolase (eNTPDase) and ecto-nucleotide pyrophosphatase (eNPP) families, 50 -nucleotidase (50 -NT), non-specific phosphatases, and transphosphorylating enzymes, such as nucleoside diphosphokinase and adenylyl kinase (3). Thus, extracellular ATP concentrations and, consequently, ATP, ADP, and adenosine actions on purinergic receptors, are dynamically regulated via cellular release and extracellular metabolism of ATP (4). Given the physiological importance of purinergic signaling, there is an increased interest in assessing nucleotide concentrations on the surface of cells and tissues and in understanding the mechanisms of cellular ATP release. Numerous approaches have been developed in recent years to assess extracellular levels of ATP and other nucleotides (reviewed in (5)). Several factors complicate the accurate measurement of extracellular ATP concentrations. For example, it is difficult to assess ATP concentrations in the physiologically relevant unstirred film covering the cell surface. Moreover, robust ATP release occurs in response to mechanical stress; thus, experimental maneuvers (cell wash, sampling, transporting the cell dishes) often result in artifacts. Finally, rapid hydrolysis of released ATP may compromise the relevance of ATP measurements.
Assessment of Extracellular ATP Concentrations
27
In this chapter, we will describe approaches to measure ATP concentrations in sampled, diluted extracellular fluids, as well as in cell surface thin films (Fig. 3.1). We will focus on epithelial cells as examples; however, these methods are applicable to all cell types. A
B
C
Luminometer
hv
hv
luciferin luciferase
Luminometer
Fig. 3.1. Off-line and real-time approaches to measure extracellular ATP concentrations. Extracellular ATP concentrations can be measured by off-line luminometry of sampled extracellular fluids (A), or on-line luminometry using either soluble luciferase dissolved in medium covering the cells (B) or cell –surface-attached luciferase (C). ATP concentrations detected by each method in different volumes are illustrated in Figs. 3.2 and 3.3.
1.1. Measuring ATP Concentrations in Sampled Fluids: OffLine Bioluminescence Detection
This section describes a protocol that uses the luciferin/luciferasebased reaction (see Note 1) to quantify ATP concentrations in samples obtained from cell culture-conditioned media. In epithelial and endothelial cells, robust ATP release can be triggered by mechanical stimuli such as shear stress, stretch, compression, and hypotonicity-induced cell swelling (4, 6–9). Here, we will use hypotonicity-induced ATP release as an example. ATP release can also be measured after inhibition of ATP metabolism. Commonly used inhibitors of ecto-nucleotidase activities are b,g-methyleneadenosine 5-triphosphate (b,g-metATP), 6-N-N-diethyl-b,gdibromomethylene-D-ATP (ARL-67156), and 2-phenyl-1,2benzisoselenazol-3(2H)-one (ebselen) (4, 8–11). Levamizole has been used to inhibit alkaline phosphatase activity present on epithelial cells (4). In this example, we obtained maximal inhibition of ATP metabolism in A549 cell cultures by using a cocktail of b,g-metATP and ebselen. After stimulation of the cells and/or inhibition of ATP metabolism, the conditioned media are analyzed for ATP concentration. Briefly, samples are collected gently to minimize unwanted mechanical release of ATP, boiled to abolish ATPase activities potentially present in the extracellular solution, and transferred to the dark chamber of a luminometer. The luciferase/luciferin cocktail is added by an automatic injector, and the resulting luminescence is recorded (Fig. 3.1A). The methodology described here is applicable to ATP measurements in tissue extracts, biological fluids, bacterial cultures, in vitro enzymatic reactions, etc.
28
Seminario-Vidal, Lazarowski, and Okada
1.2. Real-Time, Cell Surface Measurement of Extracellular ATP
In this section, we describe methods for real-time measurement of ATP by using cell surface-bound luciferase (Fig. 3.1C), and will compare this method with measurements obtained with soluble luciferase (Fig. 3.1B). The protocols below are designed for measuring luminal ATP concentrations on polarized epithelial cells; however, they are also applicable to measuring extracellular ATP concentrations of non-polarized cells grown on culture plates. Cell surface-binding luciferase can be engineered by fusing luciferase to cell surface-binding constructs, e.g., Staphylococcus protein A (4, 10, 12), biotin, or lectins, and allows the assessment of ATP concentrations near the cell surface. Soluble luciferase assesses the average ATP concentrations in the medium (from the cell surface to the surface of the bathing solution) and, when used in a small volume, reflects near-cell surface ATP concentrations (Figs. 3.2 and 3.3). For real-time assessment of ATP concentrations, cultures (either non-polarized or polarized) are placed directly in the luminometer. Sampling Real-time (Soluble luciferase) Real-time (Cell-attached luciferase)
ATP (nM)
15
10
5
0 0
100
200 300 Volume (µl)
400
500
Fig. 3.2. Basal ATP concentrations on the cell surface. ATP concentrations in varied luminal volumes on resting human bronchial cells were measured by off-line luminometry (as in Fig. 3.1A, grey triangle), or by real-time measurement with luciferase dissolved in bulk (as in Fig. 3.1B, open circle), and attached to the cell surface (as in Fig. 3.1C, solid diamond). Values are mean – SEM of four Transwells/subject established from three different subjects. No major differences in basal ATP concentrations were observed with these approaches. Reprinted with permission from JBC, vol. 281, no. 32, pp. 22992– 23002 (2006).
2. Materials All reagents should be of the highest purity available and maintained free of bacterial contamination to avoid ATP degradation. Use of aerosol-protected tips is strongly recommended to avoid reagent cross-contamination.
Assessment of Extracellular ATP Concentrations
Sampling
50 µl 100 µl 300 µl
Peak ATP (nM)
1500
B
1500
Real-time (Soluble luciferase) 25 µl 50 µl 100 µl 300 µl 500 µl
C
1500
1000
1000
1000
500
500
500
0
0 –1
0 1 2 Time (min)
3 –1
D
Real-time (Cell-attached luciferase) 50 µl 100 µl 300 µl
0 0 1 2 Time (min)
3 –1 0 1 2 Time (min)
Soluble luciferase Cell-attached luciferase
1500 Peak ATP (nM)
A
29
1000
500
0 3
0
100
200 300 400 Volume (µl)
500
Fig. 3.3. Hypotonicity-induced ATP release. Primary human bronchial epithelial cultures were exposed to luminal 33% hypotonic challenge at t = 0. ATP concentrations were measured by off-line luminometry (A), real-time luminometry with soluble luciferase (B), and real-time luminometry with cell surface-attached luciferase (C). Varied luminal volumes were applied on 12-mm Transwells, as indicated. D: Summary data illustrating peak ATP concentrations as measured by soluble luciferase (open circle) and cell-attached luciferase (solid diamond) in varied luminal volumes. In (A)–(C), values are mean – SEM of 3–4 Transwells/subject established from three different subjects. In diluted solutions (100–500 ml), ATP concentrations measured at the cell surface (C) are higher than those measured in bulk (B) or by sampling (A). However, ATP concentrations in small volumes (25–50 ml) were similar between cell-attached luciferase detection and soluble luciferase detection (D). Reprinted with permission from JBC, vol. 281, no. 32, pp. 22992–23002 (2006).
2.1. Measuring ATP Concentrations in Sampled Fluids: Offline Bioluminescence Detection 2.1.1. Cell Culture 2.1.2. Stimulation of ATP Release by Hypotonic Swelling
Experiments illustrated in this section are performed with A549 cells (ATCC # CCL-185) seeded on 24-well multiwell plastic plates (BD Falcon). Cells are grown on Dulbecco’s modified eagle’s medium (DMEM) with high glucose (D-Glucose: 4.5 g/L), supplemented with 10% fetal bovine serum (FBS), 60 mg/ml (100 IU/mL) penicillin, and 100 mg/mL streptomycin. 1. Hypotonic solution: 1.2 mM CaCl2, 1.8 mM MgCl2, and 25 mM 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES), pH 7.4. Store at 4C. 2. Control (isotonic) solution: 154 mM NaCl (0.9% NaCl solution), 1.2 mM CaCl2, 1.8 mM MgCl2, and 25 mM HEPES, pH 7.4. Store at 4C.
2.1.3. Inhibition of ATP Metabolism
1. Ebselen: 10 mM in dimethyl sulfoxide (DMSO), aliquoted, and stored at –20C. 2. b,g-metATP: 100 mM in water, aliquoted, and stored at –20C.
30
Seminario-Vidal, Lazarowski, and Okada
In A549 cell cultures, we obtain maximal inhibition of ATP metabolism by using a cocktail containing 300 mM b,g-metATP and 30 mM ebselen (see Fig. 3.4). A
B HBSS+ βγ-MetATP Ebselen
80
103 100
102 101 10–1
40 20
20
80 60 40 20
0 0.1
100
Control βγ-Met-ATP/ ebselen
40
//
0
60
0 100 nM ATP
//
0
80 60
Control PPADS RB2 Suramin
120
ATP (nM)
104
vehicle βγ-Met-ATP Ebselen Cocktail
100
ATP (nM)
105
% of Maximal Luminescence
Luminescence (RLU)
106
C
1 10 100 1000 ATP (nM)
0 0
10
20 30 Time (min)
40
Isotonicity 33% Hypotonicity
Fig. 3.4. Effect of pharmacological reagents on ATP detection. (A) Luciferase activity is not affected by ATPase inhibitors, but decreases in the presence of some purinoceptor antagonists. Calibration curves of ATP were performed in HBSS+ alone, or supplemented with 300 mM b,g-metATP, or 30 mM ebselen. Inset: 100 nM ATP was prepared in HBSS+ alone, or containing 100 mM pyridoxal-phosphate-6-azophenyl-2’,4’-disulfonic acid (PPADS), 100 mM reactive blue 2 (RB2), or 100 mM suramin. Values are the mean – SEM of three separate experiments, n = 3. (B) Effect of ecto-ATPase inhibitors on ATP hydrolysis in A549 cells. Lung alveolar A549 cells were incubated for the indicated times at 37C with 300 ml HBSS+ containing 100 nM ATP (vehicle), or 100 nM ATP and 300 mM b,g-metATP, or 100 nM ATP and 30 mM ebselen, or 100 nM ATP and b,g-metATP and ebselen combined. Samples were collected and luminescence recorded as described in the Methods section. Values are the mean – SEM of two separate experiments, n = 4. (C) Measurements of extracellular ATP concentrations are underestimated in the absence of ecto-ATPase inhibitors. Confluent A549 cells grown on 24-well plates were incubated at 37C for 5 min with 300 ml HBSS+ in the absence (control) or in the presence of 300 mM b,g-metATP and 30 mM ebselen. Cultures were subsequently treated for 5 min with isotonic solution or 33% hypotonic challenge. Samples were collected and luminescence recorded as described in the Methods section. Values are the mean – SEM of 2 separate experiments, n = 6. 2.1.4. Luminometry Reagents
Several commercial brands of luminometers are available. The protocol described below was adapted for a Berthold AutoLumat luminometer, which is configured to process 180 test tubes at a time (see Note 2). 1. 4X LUMI solution: 6.25 mM MgCl2, 0.63 mM ethylenedinitrilotetraacetic acid (EDTA), 75 mM dithiothreitol (DTT), 1 mg/mL bovine serum albumin (BSA), and 25 mM HEPES, pH 7.8. Filter and store sterile at 4C. 2. Luciferase from Photinus pyralis (Sigma) is dissolved at 0.5 mg/ mL in 4X LUMI solution and stored in 30 ml aliquots at –20C. 3. Luciferin (BD PharMingen) is dissolved at 10 mg/mL in water and stored in 100 mL aliquots, protected from light at –20C. 4. Hank’s balanced salt solution (HBSS) supplemented with 1.2 mM CaCl2 and 1.8 mM MgCl2 (HBSS+). HBSS+ is filtered sterile and stored at 4C. 25 mM HEPES, pH 7.4, is added freshly prior to experiments (see Note 3).
Assessment of Extracellular ATP Concentrations
31
5. 5 mL clear polystyrene or glass test tubes (e.g., Sarstedt). 6. ATP stock solution (e.g., 100 mM, GE Healthcare) stored at –20C. 2.2. Real-Time, Cell Surface Measurement of Extracellular ATP
1. Cells can be grown on plastic dishes (for non-polarized cells) or Transwells (for polarized cells) 3.5 cm or less in diameter. 2. Luciferase (Sigma) 3. Luciferin (BD PharMingen) 4. Staphylococcus protein A-fused luciferase (SPA-luc; modified from the original construct provided by Dr. George Dubyak, Case Western Reserve University; see Note 4 and (4) for purification protocols) 5. Blocking solution: PBS containing 1% BSA (PBS/BSA) 6. Anti-keratan sulfate antibody (mouse IgG2b, Chemicon, Temecula, CA) 7. Buffer: HBSS+ buffered with 10 mM HEPES (HBSS/ HEPES). HBSS+ can be replaced with other nutrient-containing solutions (e.g., DMEM, MEM, F12). 8. Luminometer with a real-time measurement function, e.g., TD-20/20 (Turner Biosystems, Sunnyvale, CA).
3. Methods 3.1. Measuring ATP Concentrations in Sampled Fluids: OffLine Bioluminescence Detection 3.1.1. Preparation of Samples
1. Grow lung epithelial A549 cells in 24-well plastic plates (surface area of 2 cm2) until confluence (see Note 5). 2. Rinse confluent cultures gently twice with HBSS+ to remove cell debris and serum components present in the medium. 3. Pre-incubate cells in HBSS+ for 1 h at 37C and 5% CO2 in a tissue culture incubator. To minimize unwanted mechanically induced ATP release during sampling, cell cultures should be covered sufficiently with media (e.g., 250 mL for each well of a 24-well plate). 4. Expose cell cultures to reagents and/or stimuli, as described in Fig. 3.4. 5. Collect up to 100 mL of the cell bathing medium into 1.5-mL microcentrifuge tubes placed on ice. 6. Heat samples for 2 min at 98C to inactivate potential nucleotidase activities. 7. Store samples at –20C until bioluminescence measurements.
32
Seminario-Vidal, Lazarowski, and Okada
3.1.2. Quantification of ATP
This protocol assumes the use of a LB953 AutoLumat luminometer (Berthold, Wildbad, Germany), but can be modified to other luminometers by following the manufacturer’s instructions (Figs. 3.4 and 3.5).
A
B 106
105
105
Luminescence (RLU)
106
104 103 102
0 // 0 0.1
100 80
104 103 10
2
1
10 ATP (nM)
100
1000
60 40 20
10 //
//
10
Non-heated Heated
MEM + 10% FBS
ATP (nM)
10 Luminescence (RLU)
C MEM
Water HBSS+
0 mM NaCl 154 mM NaCl
7
0 // 0 0.1
0 1
10 ATP (nM)
100
1000
MEM
MEM + MEM + 10% FBS Albumin
Fig. 3.5. Quantification of ATP using luciferin/luciferase. (A) Anions greatly interfere with the luciferase reaction. Calibration curves of ATP were performed by adding 30 ml of the indicated ATP concentrations to 300 ml H2O or 154 mM NaCl. Values are the mean – SEM of two separate experiments, n = 3. (B) Serum components decrease ATP detection. ATP was diluted at the indicated concentrations in H2O, HBSS+, MEM, or MEM supplemented with 10% FBS. A 30-mL aliquot was collected and added to a 5-mL test tube containing 300 mL of water. Values are the mean – SEM of two separate experiments, n = 4. (C) Albumin and other serum components affect ATP detection. 100 nM ATP was prepared in MEM, MEM supplemented with 10% FBS, or MEM supplemented with 4 g/dL human albumin, and incubated at RT for 10 min. Samples were heated at 98C for 2 min (except non-heated controls) prior to ATP measurements.
1. Prepare the luciferin/luciferase cocktail freshly by adding one aliquot of luciferase and luciferin stock solutions (described in Materials) to 12.5 ml 4X LUMI solutions at room temperature (RT), protected from light. Final luciferin and luciferase concentrations in 4X LUMI are 265 mM and 1.2 mg/ml, respectively. 2. Place the luciferin/luciferase solution in the injector port of the luminometer. Prime the injector line following the manufacturer’s instructions. 3. Prepare an ATP calibration curve (e.g., up to 1,000 nM ATP, see Note 6) in the same solution/media used for incubations with cells. 4. Add 30 mL of each sample to a 5 mL test tube containing 300 mL H2O (see Note 7). 5. Transfer the test tubes to the dark chamber of the luminometer and proceed with the luciferin/luciferase injection and bioluminescence recording, i.e., arbitrary light units (ALUs), as instructed by the manufacturer. 6. Determine ATP concentration in the sample by intersecting sample ALU values with the calibration curve ALU values (see Notes 8 and 9).
Assessment of Extracellular ATP Concentrations
3.2. Real-Time, Cell Surface Measurement of Extracellular ATP 3.2.1. Attachment of Staphylococcus Protein A-Fused Luciferase (SPA-Luc) to Cell Surface (see Note 10)
33
1. Wash the surface (apical, if polarized cells are used) of cell cultures with phosphate-buffered saline (PBS), 3 . 2. Incubate the (apical) surface with 50 mL (for cultures of 12 mm diameter) of blocking solution for 30 min on ice. If polarized cells are used, keep the basolateral surface immersed in medium. 3. Replace the blocking solution with a solution containing the designated primary antibody (see Note 11). For primary airway epithelial cells, use 50 mL of 10 mg/mL (i.e., 1:300) antikeratan sulfate antibody in PBS/BSA. Incubate for 1 h on ice. 4. Wash 3 with PBS. 5. Incubate with 0.5 mg/mL purified SPA-luc (see Note 4) for 1 h at 4C in the dark. SPA-luc will bind to the Fc domain of the antibody attached to the cells, as indicated in Step 3. 6. Wash carefully 3 with PBS. Replenish the apical surface with ATP assay solution (e.g., HBSS/HEPES). Keep cultures in the dark at RT for 30 min to equilibrate the extracellular ATP concentrations.
3.2.2. Measurement of Cell Surface ATP Concentrations Using SPA-luc
1. Place a SPA-luc-bound cell culture in the Turner TD-20/20, add soluble luciferin (150 mM final, to the apical solution for polarized cultures) and close the lid. When a Transwell is used, place it in a chamber (or a dish) containing HBSS/ HEPES to cover the basolateral side (Fig. 3.1B, C). Assays are typically performed at RT (see Note 12). 2. Record baseline luminescence (arbitrary light unit, ALU) every minute with 5–10 s integration time, according to manufacturer’s instructions. Monitor ALU until baseline luminescence is achieved (see Note 13). Baseline luminescence is usually achieved within 5–30 min and represents basal ATP concentrations (see Fig. 3.3). 3. To assess stimulated ATP release, add stimuli (e.g., pharmacological reagents, hypotonic challenge, etc.) and record the ALU. ALU integration time needs to be optimized, as well as the frequency of recording, for each experiment. For example, when airway epithelial cells are challenged with 33% hypotonicity, H2O (a half volume of the initial luminal volume) is added to the luminal solution at t = 0. The ALU is recorded for 5 min; every 0.2 s for the first minute, then every 10 s (with 4-s integration time) for the next 4 min. A typical time-course of ATP concentrations is shown in Fig. 3.3. 4. At the end of each assay, an ATP–luminescence relationship (calibration curve) is generated to calculate ATP concentrations. Known concentrations of ATP are added to the luminal liquid in a stepwise manner (e.g., 1 nM added twice, 10 nM added twice, then 100 nM added twice – for the accuracy of
34
Seminario-Vidal, Lazarowski, and Okada
the calibration curve, adding each concentration twice is recommended), and increases in ALUs recorded each time (see Note 14) 3.2.3. Measurement of Cell Surface ATP Concentrations Using Soluble Luciferase
1. Wash the surface of cultures with PBS,3 . 2. Add HBSS/HEPES (0.5–1 ml for non-polarized 3.5 cm cultures. Bilaterally for polarized cultures – 1 cc and 25–500 ml to luminal and serosal side, respectively, when 12-mm Transwell is used). Equilibrate the cultures in an incubator (37C and 5% CO2) for 1 h. 3. Add luciferase (0.8 mg/cm2 culture surface) and luciferin (150 mM) to the luminal buffer, and start the measurement as described in Methods 3.2.2.
4. Notes 1. Firefly luciferase catalyzes the following reaction: D-luciferin þ ATP þ luciferase (L) ! L(luciferyl-adenylate)
þ pyrophosphate L(luciferyl-adenylate) þ O2 ! L(oxyluciferin*; AMP) + CO2 L(oxyluciferin*; AMP) ! L(oxyluciferin; AMP) þ photon L(oxyluciferin; AMP) ! L þ oxyluciferin þ AMP 2. Many luminometers are configured as microplate readers. Sample volume and luciferase-luciferin cocktail should be modified to fit the volume of an individual well, following the manufacturer’s instructions. 3. Minimum essential medium (MEM), DMEM, or several other culture media (without serum) are equally effective as HBSS+, and could be used as an alternative in the sample preparation assay. Avoid using media supplemented with ATP, such as Medium 199. 4. SPA-luc fused to a hexa-histidine (6 His) tag (4) is purified over a Ni2+-chelating column. The 6 His tag is cleaved by Tobacco-Etch virus (TEV) protease after purification. For detailed purification protocols, see (4). 5. Seeding density of 1 105 A549 cells/well will provide confluent cultures at 24 h. 6. Under the conditions described, a linear ATP concentration:luminescence relationship is observed in the range of 0.1– 1000 nM ATP. This ATP concentration range covers ATP concentrations detected in the bulk extracellular medium of most cell cultures.
Assessment of Extracellular ATP Concentrations
35
7. Media or other saline-based solutions (e.g., 0.9% NaCl or PBS) contain anions that interfere with the luciferase reaction [Fig. 3.5A and (13, 14)], decreasing the sensitivity of the assay. Therefore, we recommend using water as the diluting agent to achieve the highest sensitivity in the assay. 8. The luciferase reaction is inhibited by components present in cell culture media, e.g., anions [Fig. 3.5B and (14)]. Moreover, phosphatases and other components present in FBS-supplemented and hormone-supplemented media (e.g., BEGM or SAGM, Lonza Walkersville, MD) affect ATP availability for the luciferase reaction. Albumin-bound ATP can be dissociated by heating the sample at 95C for 2 min (Fig. 3.5C). 9. All test drugs added to the cells should be tested for potential interference with luciferase activity [Fig. 3.4 and (14)]. 10. The principle of SPA-luc attachment to cell surface is as follows. First, bind an antibody to cell surface molecules; next, attach protein A (of SPA-luc) to the Fc domain of the antibody. It is important to choose an antibody that protein A is capable of binding; for example, protein A strongly binds to total IgG, IgG2a, IgG2b, and IgG3, but exhibit weak or no binding to IgG1, which is the most common class of monoclonal antibodies. 11. For primary human airway cells, lectins and monoclonal antibodies against keratan sulfate or MUC1 served as SPA-luc attachment molecules (4). For mouse Bac-1.2F5 macrophages, monoclonal antibodies against CD45.2 or H-2 Kd major histocompatibility complex (MHC) class I; for human platelets, monoclonal antibodies against CD41 or anti-HLAABC served as SPA-luc attachment molecules (12). For cell types in which finding an endogenous antigen on the cell surface for sufficient antibody attachment is difficult, antigens can be overexpressed [e.g., CD14 (10)]. However, the effect of antigen overexpression on ATP release and metabolism needs to be addressed. 12. Though it is ideal to perform ATP release assays at a physiological temperature (37C), luciferase activity is dramatically decreased above 30C (15). Being aware that some ATP release pathways (e.g., exocytosis) might be suppressed at low temperatures, assays can be carried out at RT. It is critical to maintain pH of the assay solution on cells (which contains luciferin and luciferase) at 7.0–7.4 (15) by including 25 mM HEPES (pH 7.4). 13. Experimental maneuvers, such as changing and adding luminal solutions and transferring Transwells, cause robust ATP release from cells. Baseline ATP concentrations are achieved after such artifactually released ATP is hydrolyzed by endogenous ecto-ATPases, usually within 5–30 min of incubation.
36
Seminario-Vidal, Lazarowski, and Okada
14. The sensitivity of luciferin-luciferase reactions may vary among assays; thus, an ATP–ALU relationship should be generated for each assay. The end products of luciferin-luciferase reaction (e.g., pyrophosphate, oxyluciferin) inhibit the luciferase reaction. However, when sufficient amounts of luciferin and luciferase are included at the beginning of the assay, the assay sensitivity is typically maintained for at least 30 min on cells. References 1. Burnstock, G. (2006) Purinergic signalling. Br J Pharmacol 147 (Supple 1), S172–S181. 2. North, R. A. (2002) Molecular physiology of P2X receptors. Physiol Rev 82, 1013–1067. 3. Zimmermann, H. (2000) Extracellular metabolism of ATP and other nucleotides. Naunyn Schmiedebergs Arch Pharmacol 362, 299–309. 4. Okada, S. F., Nicholas, R. A., Kreda, S. M., Lazarowski, E. R., and Boucher, R. C. (2006) Physiological regulation of ATP release at the apical surface of human airway epithelia. J Biol Chem 281, 22992–23002. 5. Lazarowski, E. R., Shea, D. A., Boucher, R. C., and Harden, T. K. (2003) Release of cellular UDP-glucose as a potential extracellular signaling molecule. Mol Pharmacol 63, 1190–1197. 6. Gatof, D., Kilic, G., and Fitz, J. G. (2004) Vesicular exocytosis contributes to volumesensitive ATP release in biliary cells. Am J Physiol Gastrointest Liver Physiol 286, G538–G546. 7. Boudreault, F., and Grygorczyk, R. (2004) Cell swelling-induced ATP release is tightly dependent on intracellular calcium elevations. J Physiol 561, 499–513. 8. Button, B., Picher, M., and Boucher, R. C. (2007) Differential effects of cyclic and constant stress on ATP release and mucociliary transport by human airway epithelia. J Physiol 580, 577–592.
9. Kreda, S. M., Seminario-Vidal, L., Heusden, C. V., and Lazarowski, E. R. (2008) Thrombin-promoted release of UDP-glucose from human astrocytoma cells. Br J Pharmacol 153, 1528–1537 10. Joseph, S. M., Buchakjian, M. R., and Dubyak, G. R. (2003) Colocalization of ATP release sites and ecto-ATPase activity at the extracellular surface of human astrocytes. J Biol Chem 278, 23331–23342. 11. Kreda, S. M., Okada, S. F., van Heusden, C. A., O’Neal, W., Gabriel, S., Abdullah, L., Davis, C. W., Boucher, R. C., and Lazarowski, E. R. (2007) Coordinated release of nucleotides and mucin from human airway epithelial Calu-3 cells. J Physiol 584, 245–259. 12. Beigi, R., Kobatake, E., Aizawa, M., and Dubyak, G. R. (1999) Detection of local ATP release from activated platelets using cell surface-attached firefly luciferase. Am J Physiol 276, C267–C278. 13. Lundin, A. (2000) Use of firefly luciferase in ATP-related assays of biomass, enzymes, and metabolites. Methods Enzymol 305, 346–370. 14. Taylor, A. L., Kudlow, B. A., Marrs, K. L., Gruenert, D. C., Guggino, W. B., and Schwiebert, E. M. (1998) Bioluminescence detection of ATP release mechanisms in epithelia. Am J Physiol 275, C1391–C1406. 15. DeLuca, M., and McElroy, W. D. (1978) Purification and properties of firefly luciferase. In Methods Enzymol 57, 3–15.
Chapter 4 High-Throughput Quantitative Bioluminescence Imaging for Assessing Tumor Burden Angelina Contero, Edmond Richer, Ana Gondim, and Ralph P. Mason Abstract Bioluminescence imaging (BLI) has emerged during the past 5 years as the preeminent method for rapid, cheap, facile screening of tumor growth and spread in mice. Both subcutaneous and orthotopic tumor models are readily observed with high sensitivity and reproducibility. User-friendly commercial instruments exist and, increasingly, luciferase-expressing tumor cells are available in academic institutions or commercially. There is an increasing literature on routine use of BLI for assessing chemotherapeutic efficacy, drug combinations, dosing, and timing. In addition, BLI may be applied to more sophisticated questions of molecular biology by including specific promoter sequences. This chapter will describe routine methods used to support multiple investigators in our small animal imaging resource. Key words: Luciferase, luciferin, charged-coupled device cameras (CCD), IGOR Pro, bioluminescence.
1. Introduction The concept of bioluminescence to study biochemistry has been around for many years, for example, as the basis for quantifying ATP in snap-frozen histological specimens or tissue extracts (1, 2). However, in vivo application has been spearheaded by Contag et al. (3) and promoted by Xenogen (now Caliper Lifesciences). In less than a decade, BLI has become a routine modality for use in cancer biology, particularly suited for assessing tumor burden and metastatic spread. In vivo BLI has been reviewed many times (3–6), and readers are directed to these papers and other chapters of this book for further insight.
P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_4, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
37
38
Contero et al.
In its most popular format, the bioluminescent reaction requires luciferase enzyme derived from the American firefly (Photinus pyralis) and D-luciferin substrate. Luciferase is generated by cells following transfection. It is important to select clones with high-stable expression, usually based on lentiviral transfection, which tends to be more stable than plasmid transfection. It is important to recognize that clones isolated for high expression may not behave identically to parallel lines or the parental system (e.g., differential growth rates). Thus, tumor models can be highly effective in terms of assessing tumor development and response to therapy, but they may not perfectly replicate parental cell lines. Pharmacokinetics of the luciferin substrate is important. Remarkably, luciferin appears to readily permeate every tissue, including crossing the blood–brain and blood–placental barriers (4). However, the kinetics of light emission can differ with tumor location, and thus it is critical to establish reproducibility of lightemission curves prior to embarking on large-scale studies. The most popular route of administration of luciferin is intra peritoneal (IP) (7); but while this is apparently facile, we find a significant failure rate (8) where no light emission is observed following substrate administration, yet if repeated 1 h later gives expected bioluminescence. We attribute this to poor injection, possibly into the intestines. Intravenous (IV) administration can give much higher light emission (9), but more transiently so that any variation in the timing of image capture and/or integration time can generate poorer reproducibility (8). Intravenous injection is also technically more challenging. Direct intratumor (IT) injection generates the most intense bioluminescence, but is obviously invasive and feasible only for easily accessible tumors (7, 10). We favor subcutaneous (SC) administration of luciferin in the back neck region. The technique is facile with overwhelming success in observing expected signal, and the kinetics provide intense light over several minutes (8, 11). Light detection is strongest from subcutaneous tumor sites, although in this case caliper measurements may be just as effective and cheaper for simple tumor volume assessment. However, BLI is particularly effective for low tumor burdens, and indeed, subpalpable volumes can be detected and quantified (Fig. 4.1). For large tumors, self-absorption and scatter of light can bias apparent relative tumor volume. Planar BLI appears to accurately reflect the volume of small tumors, but becomes less linear for larger tumors although continuing to increase monotonically (12, 13). Light is subject to significant absorption and scattering from deep tumors, and thus equivalent tumors located at depth are expected to provide much less detectable light. Thus, for longitudinal studies, it is crucial to view an animal from the same direction on successive occasions to ensure a reproducible, solid viewing angle and consistent absorption by any intervening tissues. Nude mice are
High-Throughput Quantitative BLI for Assessing Tumor Burden
39
Day 7
200
Day 13
300 300
Day 17
500
Day 20
1400 1400
Day 7
20
Day 13
20
Day 17
14
Day 20
100
Control No cisplastin 106 cells day 0
60
Day 3
Cisplatin 3mg/kg Day 3, 7, 10
Fig. 4.1. Assessing chemotherapy by bioluminescence imaging (BLI). Series of images of two nude mice imaged at various times after injecting HeLa-luc cells into the peritoneum. On each occasion, mice were anesthetized and 150 mg/kg luciferin was administered, followed by a 10-min image. The upper mouse served as control, while the lower series of images show a mouse which received cis-platinum chemotherapy at 3 mg/kg on days 3, 7, and 10, following introduction of tumor cells. Note images have been scaled differently to accommodate the massive changes in dynamic range.
preferred, though light may also be detected from white or black mice with hair: some investigators prefer to shave the animals or apply depilating agents. BLI systems can be constructed quite easily and cheaply based on several recipes in the literature, primarily from the amateur astronomy field, where there is a similar need to detect weak signals against a low background based on longterm signal integration (14). To date, our BLI service uses a home-built system, which has been described elsewhere (7, 8, 15). The primary protocol below describes the procedures with this system (Cyclops). However, the instrument is technically complex, requiring a BLI technician and engineering support. Sophisticated commercial systems are available, which are user-friendly (Caliper Xenogen and Berthtold, see Notes 1 and 2, respectively), and we have recently acquired both IVIS1 Lumina and Spectrum systems for use by multiple research teams. These provide both bioluminescence and fluorescence imaging, including depth-resolved capabilities for the spectrum. D-Luciferin can cost $100 per 100 mg, but bulk purchases should allow better than $400 per gram, which is important for high-throughput screening. Although BLI is simple, several properties require consideration. The light emission can by characterized by parameters including area under the curve (AUC), maximum signal intensity, time to maximum intensity, or light integration over a specified period. We routinely use a dose of 450 mg/kg administered subcutaneously into an anesthetized nude
40
Contero et al.
mouse, with imaging for a period of 5 min starting 10 min after luciferin administration. Weak signals may require longer integration to achieve useful signal to noise, but many investigators prefer a constant acquisition method even though small tumors then provide essentially zero signal.
2. Materials 2.1. Preparation of Luciferin
1.
D-Luciferin
Firefly, sodium salt monohydrate (synthetic) (Biosynth, Staad, Switzerland, See Note 3) stored in dark at –20C.
2. Sorensen’s phosphate buffer, 0.2 M, pH 7.2 (phosphate mixed solution salts) stored at 2–8C (Electron Microscopy Sciences, Hatfield, PA). 2.2. Administration of Luciferin
1. 1/2 cc 28G1/2, U-100 insulin syringes, latex-free syringe, micro-fine IV 2. Veterinary isoflurane, USP 3. USP medical-grade oxygen compressed USP, 99% pure.
2.3. Imaging Equipment
1. A CCD (SITe SI-032AB) non-color, back-illuminated, fullframe image sensor with 512 512 pixels (Scientific Imaging Technologies Inc., Tigard, OR), see Note 4. 2. 1400 Duo-Seal vacuum pump (Welch, Niles, IL). 3. FP88-HL ultra-low refrigerated circulator (Julabo, Allentown, PA). 4. Dark box to accommodate imaging system. 5. Dehumidifier. 6. NIST-traceable research radiometer (IL 1700, International Light, Inc., Newburyport, MA) for camera calibration. 7. Deltaphase isothermal warming pad. 8. Anesthesia system Matrix Medical Inc. (VMC model 100 F, Orchard Park, NY). 9. Data acquisition and processing computer running IGOR Pro (Wavemetrics, Seattle, WA, USA), and custom image analysis routines or Caliper Xenogen IVIS1 Lumina with the LivingImage software (Hopkinton, MA).
High-Throughput Quantitative BLI for Assessing Tumor Burden
41
3. Methods 3.1. Preparation of Luciferin
1. Luciferin is used at 40 mg/ml of D-Luciferin sodium salt monohydrate for both mouse and rat studies. 2. Mix the substrate with 2 M Sorensen’s phosphate buffer solution. 3. After making the solution, cover the vial (i.e., foil), since the luciferin is light-sensitive and stored in a laboratory refrigerator.
3.2. Injection of Luciferin
1. Anesthetize the mouse with an induction dose of isoflurane 2.5% in oxygen (see Note 5). 2. Inject a dose of 450 mg/kg luciferin (280 ml for 25 g mouse) subcutaneously in the back neck region using a single-use insulin syringe 10 min prior to imaging (see Note 6). It is important that the time to start imaging is kept constant between individuals and for repeat measurements, since the light emitted is strongly time-dependent. 3. Depending on the region of interest, place the animal on a secure netted bed and place the snout in an anesthesia nose cone, maintained with 1.5% isoflurane and 1 l/min oxygen in the imaging box.
3.3. Imaging with Cyclops (Advanced Radiological Sciences Imaging System)
1. The vacuum pump must be turned on followed by the coolant pump of the refrigerated circulation system. 2. After the refrigerant has cooled to –1.0C, turn on the charge-coupled cameras (CCD) and cool to 230 K (–43C) using internal thermoelectric device. 3. The door of the light box is closed. Prior to imaging the animal, a dark image is acquired to allow subtraction of dark current signal and interference noise from auxiliary equipment. The dark image integration time should be the same as the BLI time, which depends on how intense is the BLI signal. During dark image acquisition, a mechanical shutter shields the camera sensor and therefore an image is taken without any light. 4. Apply diffuse light sources and acquire a 700-ms light image for image overlay to show the body of the animal for orientation and anatomical co-registration. 5. A 5-min BLI image is taken immediately after the light image (see Note 7). In some cases, multiple sequential images are acquired to reveal light-emission dynamics. In high-throughput mode, usually a single image is captured for each animal.
42
Contero et al.
6. At the end of the imaging series a second dark image is acquired. 7. Return mice to cage and monitor until fully recovered from anesthesia, usually within 5 min. 8. Between groups of mice, spray the animal bed and support structure with Quatricide disinfectant (Pharmacal Research Laboratories Inc., Waterbury, CT) to reduce risk of pathogen spread (Fig. 4.2).
a
b
c
d
Fig. 4.2. Images associated with bioluminescence imaging (BLI). Images acquired with home-built Cyclops BLI system. (a) Dark image to allow subtraction of background noise; (b) light image based on surface external illumination for anatomical registration; (c) bioluminescent image; (d) overlay of bioluminescent signal intensity on anatomical image.
3.3.1. Processing Images
1. Save the images on a personal computer and process using IGOR Pro software with a set of custom image analysis routines (see Note 8). 2. Upload the Dark Image 1, then the Dark Image 2, and average them to allow subtraction of background/instrument noise.
High-Throughput Quantitative BLI for Assessing Tumor Burden
43
3. Upload the BLI image and subtract averaged dark image. 4. Create a region of interest (ROI) to measure and integrate the signal. Signals are either measured in relative light units (RLUs) per second, radiance units photons/s/cm2/sr, or total light-emission photons/s. 5. Upload the light image and overlay the bioluminescence image after the background is rendered transparent. 6. Save images as JPG or TIFF files. 3.3.2. Measuring the Signal
1. Using IGOR Pro access ROI under the Image Tools. 2. Draw an ROI around the signal. The signal is measured by creating a box around the signal and integrating the region of interest. 3. Save the data in an Excel file and the picture in your computer drive as JPEG or TIFF files.
3.4. Xenogen Lumina IVIS System ( See Note 9)
The lumina system includes anesthesia unit and heated platform and can image up to three mice at a time. 1. To begin, the user must initiate IVIS system to begin the cooling down process. The optimal time between injection and imaging depends on the route of luciferin injection and tumor site. 2. When ready to image, place the mouse in the anesthesia induction chamber. After turning on the oxygen, the gas valve on the anesthesia is opened. 3. Turn on the evacuation pump before opening the induction chamber. 4. To image the mouse, place the mouse on the platform and open the anesthesia flow for the IVIS box. The door must be closed in order to begin imaging. For multiple mice, a black shield is placed between animals to reduce cross-illumination. 5. There are four fields of view ranging from A (the closest in length to the cameras) to D (the farthest). 6. The user must select bioluminescence since the lumina has both fluorescent and bioluminescent capabilities. Exposure time is set in minutes, and the pixel binning is usually set at medium. 7. After acquiring the image, the mouse must be taken out of the box, and the oxygen tank, anesthesia unit, and gas valve must be turned off. 8. The system remains on overnight to allow the dark images to be taken and saved. This is done automatically.
44
Contero et al.
9. Save the images on a personal computer and analyze them using the Living Image Data Software provided by Caliper. 10. The lumina system automatically corrects light intensity for camera–subject distance and calibrates for dark images daily.
4. Notes 1. http://www.caliperls.com/products/ivis-lumina.htm 2. http://www.berthold.com/bio/ww/en/pub/bioanalytik/ produkte/lb981.cfm 3.
D-Luciferin may be obtained from many sources as either synthetic or natural material. Sodium or potassium salts may be used. We have no evidence for differential quality. Other sources include D-luciferin sodium salt (Catalog #10102; Biotium, Hayward, CA, USA); D-luciferin potassium salt (P/N 122769) isolated from firefly (Caliper Life Sciences: http://www.caliperls.com/products/dluciferin-potassiumsalt.htm).
4. In earlier work we had used a TC245 CCD camera (Texas Instruments, Dallas TX) (7) and a system based on the French Audine astronomical camera with a high-performance Kodak KAF-0402ME CCD (7). 5. Other forms of anesthesia, such as ketamine, can also be used. 6. Other doses of luciferin may be used. Caliper recommends a dose of 150 mg/kg for mice with its lumina imaging system. Our experience favors the higher dose. Caliper Lifesciences recommends 10–15 min between injection and imaging. 7. The exposure time may be altered to avoid overexposing intense signals or to detect weak signals. In practice, we may use anywhere from 1 to 30 min. Many investigators like to maintain a constant imaging time, where 5 min is typical. 8. The macros are really outside the scope of this chapter and interested readers are referred to (8). 9. Instructions derived from the instrument user manual.
Acknowledgments Supported in part by grants from the DOD Breast Cancer Initiative (IDEA award DAMD17-03-1-0343), the NIH Cancer Imaging Program (P20 CA86354 and U24 CA126608), and the
High-Throughput Quantitative BLI for Assessing Tumor Burden
45
Simmons Cancer Center. We are grateful to Drs. Li Liu, Robert Bollinger, Jerry Shay, and Peter Antich for bringing the vision of BLI to UT Southwestern. References 1. Schaefer, C., Mayer, W. K., Kru ¨ ger, W., and Vaupel, P. (1993) Microregional distributions of glucose, lactate, ATP and tissue pH in experimental tumours upon local hyperthermia and/or hyperglycaemia. J Cancer Res Clin Oncol 119, 599–608. 2. Lundin, A. (2000) In Bioluminescence and Chemiluminescence, Pt C 305 346–370. 3. Contag, C. H., and Ross, B. D. (2002) It’s not just about anatomy: in vivo bioluminescence imaging as an eyepiece into biology. JMRI 16, 378–387. 4. Thorne, S. H., and Contag, C. H. (2005) Using in vivo bioluminescence imaging to shed light on cancer biology. Proc IEEE 93, 750–762. 5. Massoud, T. F., and Gambhir, S. S. (2003) Molecular imaging in living subjects: seeing fundamental biological processes in a new light. Genes Dev 17, 545–580. 6. Bhaumik, S., and Gambhir, S. S. (2002) Optical imaging of Renilla luciferase reporter gene expression in living mice. Proc Natl Acad Sci USA 99, 377–382. 7. Paroo, Z., Bollinger, R. A., Braasch, D. A., Richer, E., Corey, D. R., Antich, P. P., and Mason, R. P. (2004) Validating bioluminescence imaging as a high-throughput, quantitative modality for assessing tumor burden. Mol Imaging 3, 117–124. 8. Bollinger, R. A. (2006), Ph.D., UT Southwestern, Dallas. 9. Wang, W., and El-Deiry, W. S. (2003) Bioluminescent molecular imaging of endogenous and exogenous p53-mediated transcription in vitro and in vivo using an HCT116 human
10.
11.
12.
13.
14.
15.
colon carcinoma xenograft model. Cancer Biol Ther 2, 196–202. Cecic, I., Chan, D. A., Sutphin, P., Ray, P., Gambhir, S. S., Giaccia, A. J., and Graves, E. E. (2007) Oxygen sensitivity of reporter genes: implications for preclinical imaging of tumor hypoxia. Mol Imaging Biol 6, 219–228. Karam, J. A., Fan, J., Stanfield, J., Richer, E., Benaim, E. A., Frenkel, E., Antich, P., Sagalowsky, A. I., Mason, R. P., and Hsieh, J. -T. (2007) The use of histone deacetylase inhibitor FK228 and DNA hypomethylation agent 5-Azacytidine in human bladder cancer therapy. Int J Cancer 120, 1795–1802. Klerk, C. P., Overmeer, R. M., Niers, T. M., Versteeg, H. H., Richel, D. J., Buckle, T., Van Noorden, C. J., and van Tellingen, O. (2007) Validity of bioluminescence measurements for noninvasive in vivo imaging of tumor load in small animals. Biotechniques 43, 7–13 Sarraf-Yazdi, S., Mi, J., Dewhirst, M. W., and Clary, B. M. (2004) Use of in vivo bioluminescence imaging to predict hepatic tumor burden in mice. J Surg Res 120, 249–255. Kanto, V., Munger, J., and Berry, R. (1994) The CCD Camera Cookbook, Willman-Bell, Inc, Richmond, VA. Dikmen, Z. G., Gellert, G., Dogan, P., Mason, R., Antich, P., Richer, E., Wright, W. E., and Shay, J. E. (2005) A new diagnostic system in cancer research: bioluminescent imaging (BLI). Turk J Med Sci 35, 65–70.
Chapter 5 Fluorescence Imaging of Tumors with ‘‘Smart’’ pH-Activatable Targeted Probes Daisuke Asanuma, Hisataka Kobayashi, Tetsuo Nagano, and Yasuteru Urano Abstract One goal of molecular imaging is to establish a widely applicable technique for specific detection of tumors with minimal background originated from non-target tissues. In this study, a ‘‘smart’’ activatable strategy for specific tumor imaging is proposed in which pH-activatable targeted probes specifically detect tumors after binding to the target cell surface proteins, internalization, and eventual acidic pH activation within the acidic organelles. We successfully visualized submillimeter-sized tumors using this strategy in two different tumor mouse models. Since the design of pH-activatable targeted probes can be applied to any target molecules on the cell surface that are to be internalized after ligand binding, this imaging strategy can afford a general and powerful method to diagnose and monitor the target tumors. Keywords: Optical tumor imaging, fluorescence, molecular probes, pH, receptor-mediated endocytosis.
1. Introduction Molecular imaging has been efficaciously employed to detect and guide treatment of tumors (1, 2). Accurate diagnosis of lesions is crucial for the success of cancer therapy, including cytoreduction and surgical metastasectomy. Recently, fluorescence imaging techniques have attracted interest in clinical oncology because of its high sensitivity and specificity, excellent temporal and spatial resolution, and low-cost imaging systems without ionizing radiation, relative to other imaging modalities such as PET/SPECT, MRI, and CT. The feasibility of tumor imaging depends on how to distinguish between lesions and normal sites in pathophysiological aspects and to specifically target tumors with some distinctive features. Overexpressingcellsurfaceproteinsontumors,suchassomatostatinreceptor(3)or folate receptor (4), are excellent candidates for targeted tumor imaging. P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_5, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
47
48
Asanuma et al.
In conventional approaches of tumor imaging with fluorophore-conjugated peptides or antibodies targeted to these cell surface markers, however, one of the problems is a limited tumor-to-background ratio because of the ‘‘always on’’ nature of the imaging probes regardless of their distribution in tumors, normal tissues, or blood (Fig. 5.1A). For specific tumor imaging, ‘‘smart’’ activatable probes have been developed, which increase their fluorescence intensity after target reaction (5–8) (Fig. 5.1B). Because of their low initial fluorescence and targeted activation,highertumor-to-backgroundratioscanbeachievedthanthe above-mentioned approaches.
Fig. 5.1. Mechanism of a cancer imaging strategy using target-specific activatable probes. (A) Conventional strategies for tumor imaging with MRI, PET, or nonactivatable ‘‘always on’’ fluorescence detection. (B) New strategy for selective tumor imaging with activatable fluorescence probes. (C) A schematic representation of highly selective tumor imaging with pH-activatable targeted probes. The probe is nonfluorescent when outside the tumor cells. After internalization by endocytosis, the probe is accumulated in late endosomes or lysosomes, where the acidic pH activates the probe, making it highly fluorescent. S/N: Signal/Noise ratio.
Fluorescence Imaging of Tumors
49
Our strategy for specific tumor imaging exploits ligandinduced internalization and subsequent delivery of cell surface protein–ligand complexes to the acidic organelles such as late endosome and lysosome, leading to acidic pH activation of fluorescence probes tethered to the ligands (Fig. 5.1C). Several tumorassociated cell surface markers have been reported demonstrating such properties: b-D-galactose receptor (lectin) (9), human epidermal growth factor receptor type 2 (HER2) (10), transferrin receptor (11), LDL receptor (12), membrane type 1-matrix metalloprotease (MT1-MMP) (13), and so on. Labeling of ligands targeted to these markers with our developed, acidic pH-activatable fluorescence probes (Fig. 5.2) can afford pH-activatable targeted probes, which remain ‘‘silent’’ in the extracellular environment in vivo at physiological pH, but turn ‘‘on’’ only after specific internalization into the target tumor cells (Fig. 5.1C).
A R2
R1
Switch moiety
R2
N
R1
e–
H
NH
+
–H+ O HO
N F
B
N F
O OH
O
Almost non-fluorescent
B
Switch moiety NH 2
pH Activatable probes
H2NBDP N
DiMeNBDP N
EtMeNBDP N
Control
DiEtNBDP
PhBDP
N
HO
F
B
O
N F
OH
Highly fluorescent (Ex/Em = 520/537 nm)
C Fluorescence quantum yield
Fluorophore
0.7 0.6 0.5 0.4 0.3 0.2 0.1 0
0
2
4
6
8
10
pH
H2NBDP (pKa = 3.8) DiMeNBDP (pKa = 4.3) EtMeNBDP (pKa = 5.2) DiEtNBDP (pKa = 6.0) PhBDP (always on)
Fig. 5.2. Development of a series of fluorescence probes for various acidic environments. (A) A scheme for the reversible and acidic pH-induced fluorescence activation of probes. (B) pH profiles of fluorescence of H2NBDP, DiMeNBDP, EtMeNBDP, and DiEtNBDP as acidic pH-sensitive fluorescence probes and PhBDP as a control ‘‘always on’’ probe. The pH ranges from 2 to 9 in one pH unit increments. (C) pH-dependent changes in emission intensity of acidic pH-activatable probes. Curve fitting was based on Henderson–Hasselbach equation. Fluorescence quantum yield (fl) of the probes versus pH, measured in 200 mM sodium phosphate buffer and determined with fluorescein (fl ¼ 0.85 in 0.1 N NaOH aq.) as a standard.
50
Asanuma et al.
We demonstrate that, after laparotomy or thoracotomy, it is possible to detect submillimeter-sized tumors using this strategy in two different tumor mouse models. One is a lectin-overexpressing model, which can be targeted with galactosamine-conjugated serum albumin (GSA), while the other is a HER2-overexpressing one with Herceptin, a monoclonal antibody against HER2. For comparison, ‘‘always on’’ PhBDP (Fig. 5.1B, C) was also employed for tumor imaging as a control, indicating importance of the activatable strategy for specific tumor imaging.
2. Materials 2.1. Synthesis of pH-Activatable and Non-activatable Fluorescence Probes
Materials for the synthesis of the probes: 1,3,5,7-Tetramethyl-2,6bis-(2-carboxyethyl)-8-[4-(N,N-diethylamino)phenyl]-4,4-difluoro4-bora-3a, 4a-diaza-s-indacene (DiEtNBDP) and 1,3,5,7-tetramethyl-2,6-bis-(2-carboxyethyl)-8-phenyl-4,4-difluoro-4-bora3a,4a-diaza-s-indacene (PhBDP), and their mono-succinimidyl esters (DiEtNBDP, SE&PhBDP, SE) 1. Methyl 5-(benzyloxycarbonyl)-2,4-dimethyl-3-pyrrolepropionate 2. 4-(N,N-Diethylamino)benzaldehyde (for DiEtNBDP) 3. Benzaldehyde (for PhBDP) 4. Trifluoroacetic acid (TFA) 5. 10% Palladium-carbon 6. 2,3,5,6-Tetrachloro-1,4-benzoquinone (p-chloranil) 7. N,N-Diisopropylethylamine 8. Boron trifluoride etherate 9. Sodium hydroxide 10. Acetone 11. Dichloromethane 12. Methanol 13. Toluene
2.2. Preparation of pH-Activatable and Non-activatable Targeted Probes
1. Albumin, bovine-galactosamide (23 mol galactosamine/mol albumin) (galactosamine-conjugated serum albumin: GSA) 2. Herceptin1 (Genentech Inc., South San Francisco, CA) 3. Dimethyl sulfoxide (DMSO) 4. PD-10 columns (SephadexTM G-25 M) (GE Healthcare, Poole, UK) 5. PBS pH 7.4
2.3. Cell Culture
1. RPMI 1640 medium 2. Fetal bovine serum (FBS)
Fluorescence Imaging of Tumors
3. Penicillin/streptomycin: 10,000 10,000 mg/mL streptomycin
units/mL
51
penicillin,
4. Trypsin–EDTA: 0.05% trypsin, 0.53 mM EDTA-4Na 2.4. Injection of Tumor Cells and Targeted Probes into Mouse Models
1. Tuberculin syringes (1 cc)
2.5. Imaging System
1. MaestroTM In-Vivo Imaging System (CRi Inc., Woburn, MA)
2. 26G 1/200 needles (0.45 13 mm)
3. Methods 3.1. Imaging of Tumors with GSA-DiEtNBDP in Tumor Mouse Models 3.1.1. Synthesis of pH-Activatable and Non-activatable Fluorescence Probes O
O O
O H2 /10%Pd-C
O
acetone, rt
N H
O
TFA N H
1 y. 94% (2 steps) R 1) 1 (2 equiv.) DIEA cat. TFA BF3 .OEt2 CH 2Cl2, rt
R
2) p-chloranil toluene, rt rt O
O
H
O
R = NEt2 R= H
N
B
F
O
N F
O
2a R = NEt2 y. 16% y. 32% 2b R = H R
R
NaOH CH 2Cl2 /MeOH/H2 O rt
NHS, WSCD DMF, 0oC to rt
O HO
N F
B
N F
O OH
DiEtNBDP (3a) R = NEt2 y. 91% y. 75% PhBDP (3b) R = H
O HO
N F
B
N F
O
O
O N
DiEtNBDP, SE (4a) R = NEt2 y. 44% O PhBDP, SE (4b) R = H y. 27%
52
Asanuma et al.
3.1.1.1. Methyl 2,4dimethyl-3pyrrolepropionate
Methyl 5-(benzyloxycarbonyl)-2,4-dimethyl-3-pyrrolepropionate (1.55 g, 4.91 mmol) is dissolved in 150 mL of acetone containing 10% palladium-carbon. The resulting solution is stirred under H2 at ambient temperature (rt: room temperature) for 12 h. The reaction solution is then filtered and evaporated. The residue is immediately dissolved in 10 mL of TFA and stirred under an argon atmosphere at ambient temperature for 10 min. Then, 30 mL of dichloromethane is added and the resulting solution is washed with H2O and 1 M NaHCO3 aq., dried over anhydrous sodium sulfate, filtered, and evaporated, resulting in 1 (0.835 g, 94%) as a slightly brown oil. 1H NMR (300 MHz, CDCl3) d 2.02 (s, 3H, NHCHCCH3), 2.16 (s, 3H, NHCCH3), 2.42–2.48 (m, 2H, COCH2), 2.69–2.74 (m, 2H, COCH2CH2), 3.66 (s, 3H, OCH3), 6.36 (s, 1H, NHCH), 7.64 (br s, 1H, NH); 13C NMR (75 MHz, CDCl3) d 10.22, 11.09, 19.85, 35.26, 51.37, 113.0, 116.5, 117.7, 124.1, 173.9. MS (ESI+) m/z 182 [M+H]+.
3.1.1.2. 1,3,5,7Tetramethyl-2,6-bis(2-methoxycarbonylethyl)8-[4-(N,Ndiethylamino)phenyl]4,4-difluoro-4-bora3a,4a-diaza-s-indacene (2a)
1 (0.542 g, 2.99 mmol) and 4-(N,N-diethylamino)benzaldehyde (0.265 g, 1.49 mmol) are dissolved in 300 mL of dichloromethane containing a catalytic amount of TFA. The resulting mixture is stirred overnight at ambient temperature under an argon atmosphere. p-Chloranil (0.370 g, 1.51 mmol) is added, and stirring is continued for 10 min. The reaction mixture is washed with H2O, dried over anhydrous sodium sulfate, filtered, and evaporated. Repeated column chromatography over aluminum oxide using dichloromethane/methanol (95:5, 98:2, and 100:0) containing 1% triethylamine as the eluent yields a greenish amorphous compound. The compound thus obtained is dissolved in 100 mL of toluene containing DIEA (5 mL), and the resulting solution is stirred at ambient temperature. BF3OEt2 (5 mL) is then slowly added, and stirring is continued for 10 min. The reaction mixture is washed with H2O, dried over anhydrous sodium sulfate, filtered, and evaporated. The crude compound is purified by repeated column chromatography over silica gel using dichloromethane/ methanol (95:5, 98:2, and 100:0) as the eluent, resulting in 2a (136 mg, 16%) as an orange powder. 1H NMR (300 MHz, CDCl3) d 1.22 (t, 6H, J ¼ 7.0 Hz, NCH2CH3), 1.44 (s, 6H, NCCCH3), 2.36 (t, 4H, J ¼ 7.3, 8.4 Hz, COCH2), 2.53 (s, 6H, NCCH3), 2.65 (t, 4H, J ¼ 7.3, 8.4 Hz, COCH2CH2), 3.41 (q, 4H, J ¼ 7.0 Hz, NCH2), 3.65 (s, 6H, OCH3), 6.74 (d, 2H, J ¼ 8.6 Hz, NCCHCH), 6.99 (d, 2H, J ¼ 8.6 Hz, NCCH); 13C NMR (75 MHz, CDCl3) d 12.11, 12.30, 12.45, 19.34, 34.25, 44.31, 51.56, 112.0, 121.6, 128.6, 129.0, 131.7, 139.6, 142.6, 148.2, 153.1, 173.1; HRMS (ESI+) calculated value for [M+H]+ m/z 568.31582, found 568.31626 (D 0.44 mmu).
Fluorescence Imaging of Tumors
53
3.1.1.3. 1,3,5,7Tetramethyl-2,6-bis-(2carboxyethyl)-8-[4-(N,Ndiethylamino)phenyl]-4,4difluoro-4-bora-3a,4adiaza-s-indacene (3a)
2a (136 mg, 239 mmol) is dissolved in 3 mL of dichloromethane. To the resulting solution are added 20 mL of methanol and 5 mL of 1 N NaOH aq., successively. The reaction solution is stirred for 4 h at ambient temperature. Then 30 mL of H2O is added, and the reaction solution is washed with dichloromethane three times. The aqueous phase is then acidified with 1 N HCl aq. (1 mL) until the solution emits green fluorescence on UV excitation of 365 nm, followed by extraction with dichloromethane three times. The dichloromethane extract is dried over anhydrous sodium sulfate, filtered, and evaporated. The crude compound is then purified by PLC using dichloromethane/acetone (1:1) as the eluent, affording 3a (118 mg, 91%) as an orange powder. 1H NMR (300 MHz, CD3OD) d 1.10 (t, 6H, J¼7.0 Hz, NCH2CH3), 1.39 (t, 6H, NCCCH3), 2.25 (t, 4H, J¼7.5, 7.9 Hz, COCH2), 2.39 (s, 6H, NCCH3), 2.56 (t, 4H, J ¼ 7.5, 7.9 Hz, COCH2CH2), 3.33 (q, 4H, J¼7.0 Hz, NCH2), 6.75 (d, 2H, J ¼ 8.8 Hz, NCCHCH), 6.93 (d, 2H, J ¼ 8.8 Hz, NCCH); 13C NMR (75 MHz, CD3OD) d 12.47, 12.66, 20.38, 35.31, 45.40, 113.3, 122.8, 130.3 (representing two different carbons), 132.8, 140.8, 144.2, 149.7, 154.4, 176.5; HRMS (ESI–) calculated value for [M–H]– m/z 538.26887, found 538.26446 (D–4.40 mmu).
3.1.1.4. 1,3,5,7Tetramethyl-2-(2carboxyethyl)-6(succinimidyl oxycarbonylethyl)-8-[4(N,N-diethylamino)phenyl]-4,4-difluoro-4bora-3a,4a-diaza-sindacene (4a)
3a (25.7 mg, 47.6 mmol) is dissolved in 2 mL of N,N-dimethylformamide (DMF) and the resulting solution is cooled to 0C. To the reaction solution are added 100 mM NHS in DMF and 100 mM WSCD in DMF (each 47.6 mmol). The reaction mixture is stirred at 0C and then allowed to warm gradually to ambient temperature. After 14 h, the reaction mixture is concentrated in vacuo. The crude compound is purified by PLC using dichloromethane/acetone (1:1) as the eluent, resulting in 4a (13.4 mg, 44%) as a red powder. HRMS (ESI+) calculated value for [M+H]+ m/z 637.30090, found 637.30278 (D 1.89 mmu).
3.1.1.5. 1,3,5,7Tetramethyl-2,6-bis-(2methoxycarbonylethyl)-8phenyl-4,4-difluoro-4bora-3a,4a-diaza-sindacene (2b)
1 (0.634 g, 3.50 mmol) and benzaldehyde (0.185 g, 1.74 mmol) are dissolved in 300 mL of dichloromethane containing a catalytic amount of TFA. The resulting mixture is stirred overnight at ambient temperature under an argon atmosphere. p-Chloranil (0.428 g, 1.74 mmol) is added, and stirring is continued for 10 min. The reaction mixture is washed with H2O, dried over anhydrous sodium sulfate, filtered, and evaporated. Repeated column chromatography over aluminum oxide using dichloromethane containing 1% triethylamine as the eluent yields a brown oil. The compound thus obtained is dissolved in 100 mL of toluene containing DIEA (5 mL), and the resulting solution is stirred at ambient temperature. BF3OEt2 (5 mL) is then slowly added, and stirring is continued for 10 min. The reaction mixture is washed with H2O, dried over anhydrous sodium sulfate, filtered,
54
Asanuma et al.
and evaporated. The crude compound is purified by column chromatography over silica gel using dichloromethane as the eluent, affording 2b (273 mg, 32%) as a green compound. 1H NMR (300 MHz, CDCl3) d 1.29 (s, 6H, NCCCH3), 2.32–2.38 (m, 4H, COCH2), 2.54 (s, 6H, NCCH3), 2.61–2.66 (m, 4H, COCH2CH2), 3.65 (s, 6H, OCH3), 7.25–7.28 (m, 2H, benzene), 7.46–7.49 (m, 3H, benzene); 13C NMR (75 MHz, CDCl3) d 11.77, 12.59, 19.29, 34.18, 51.63, 128.0, 128.9, 129.1, 130.9, 135.4, 139.4, 140.9, 154.0, 173.0; HRMS (ESI+) calculated value for [M+Na]+ m/z 519.22426, found 519.22433 (D 0.07 mmu). 3.1.1.6. 1,3,5,7Tetramethyl-2,6-bis-(2carboxyethyl)-8-phenyl4,4-difluoro-4-bora-3a,4adiaza-s-indacene (3b)
2b (40.1 mg, 78.4 mmol) is dissolved in 1 mL of dichloromethane. To the resulting solution are added 20 mL of methanol and 5 mL of 1 N NaOH aq., successively. The reaction solution is stirred overnight at ambient temperature. Then 30 mL of H2O is added, and the reaction solution is washed with dichloromethane three times. The aqueous phase is then acidified with 1 N HCl aq. (1 mL) until the solution emits green fluorescence on UV excitation of 365 nm, followed by extraction with dichloromethane five times. The dichloromethane extract is dried over anhydrous sodium sulfate, filtered, and evaporated. The crude compound is then purified twice by semi-preparative HPLC under the following conditions: A/B = 50/50 (0 min)–0/100 (20 min), then A/B ¼ 70/ 30 (0 min)–0/100 (30 min) (solvent A: H2O, 0.1% TFA; solvent B: acetonitrile/H2O = 80/20, 0.1% TFA). The aqueous fractions containing the desired product are extracted with dichloromethane three times. The dichloromethane extract is dried over anhydrous sodium sulfate, filtered, and evaporated, affording 3b (32.0 mg, 84%) as an orange powder. 1H NMR (300 MHz, CD3OD) d 1.19 (s, 6H, NCCCH3), 2.23 (t, 4H, J ¼ 8.1 Hz, COCH2), 2.40 (s, 6H, NCCH3), 2.55 (t, 4H, J ¼ 8.1 Hz, COCH2CH2), 7.21–7.46 (m, 5H, benzene); 13C NMR (75 MHz, CD3OD/NaOD) d 12.19 (representing two different carbons), 22.01, 39.34, 129.5, 130.2, 130.4, 132.0, 132.2, 136.9, 140.4, 142.1, 155.2, 181.8; HRMS (ESI+) calculated value for [M+Na]+ m/z 491.19296, found 491.18910 (D –3.87 mmu).
3.1.1.7. 1,3,5,7Tetramethyl-2-(2carboxyethyl)-6(succinimidyl oxycarbonylethyl)-8phenyl-4,4-difluoro-4bora-3a,4a-diaza-sindacene (4b)
3b (12.4 mg, 26.5 mmol) is dissolved in 1 mL of N,N-dimethylformamide (DMF) and the resulting solution is cooled to 0C. To the reaction solution are added 100 mM NHS in DMF and 100 mM WSCD in DMF (each 39.7 mmol). The reaction mixture is stirred at 0C and then allowed to warm gradually to ambient temperature. After 24 h, the reaction mixture is concentrated in vacuo. The crude compound is then purified by semi-preparative HPLC under the following conditions: A/B = 50/50 (0 min)– 0/100 (20 min) (solvent A: H2O, 0.1% TFA; solvent B:
Fluorescence Imaging of Tumors
55
acetonitrile/H2O = 80/20, 0.1% TFA). The aqueous fractions containing the desired product are extracted with dichloromethane three times. The dichloromethane extract is dried over anhydrous sodium sulfate, filtered, and evaporated, affording 4b (4.0 mg, 27%) as a red powder. Recovery is 24%. HRMS (ESI–) calculated value for [M–H]– m/z 564.21175, found 564.21392 (D 2.18 mmu). 3.1.2. Labeling of GSA with DiEtNBDP or PhBDP
Synthetic schemes of pH-activatable fluorescence probes are also referred in (14). Succinimidyl esters (SEs) are excellent reagents for protein labeling because of their high reactivity with primary amines, such as lysine residues, to form stable amide bonds. A carboxylic group of DiEtNBDP or PhBDP is readily converted to a succinimidyl ester by condensation reaction with N-hydroxysuccinimide, providing DiEtNBDP, SE and PhBDP, SE, respectively. 1. Dissolve each DiEtNBDP, SE and PhBDP, SE in DMSO to afford 10 mM stock solutions (see Note 1). 2. Dissolve GSA in 200 mM sodium phosphate buffer (pH 8.5) (see Note 2) to obtain 1.0 mg/mL GSA stock solution (14.2 nmol/mL). 3. Add 22.7 mL of 10 mM DiEtNBDP, SE stock solution (227 nmol; 16 eq.) or 14.2 mL of 10 mM PhBDP, SE stock solution (142 nmol; 10 eq.) to 1.0 mL of 1.0 mg/mL GSA stock solution (14.2 nmol), immediately followed by gentle mixing. 4. Incubate the reaction solutions for 60 min at ambient temperature in the dark. 5. Separate the GSA-DiEtNBDP and GSA-PhBDP conjugates from free DiEtNBDP and PhBDP, respectively, by PD-10 columns using PBS pH 7.4 as the eluent according to the manufacturer’s instruction, yielding 3.0 mL of stock solution of GSA-DiEtNBDP and GSA-PhBDP. Preserve the stock solution in the dark at 4C (see Note 3).
3.1.3. Determination of the Degree of Labeling (DOL) for GSA-DiEtNBDP and GSAPhBDP
DOL is defined as labeled fluorophore [mol]/protein [mol], which serves as one of the most important indicators of conjugates determining their functions and stability. Less DOL of the conjugates, better their stability and less their functions (e.g., pKa values for pH-activatable probes and Kd values for ligands) affected relative to those of individual molecule before labeling, but less their fluorescence signals a conjugate molecule, resulting in reduced sensitivity in imaging experiments or vice versa. The DOL of conjugates should be optimized in each combination of fluorescence probes and proteins.
56
Asanuma et al.
1. Dilute the GSA-DiEtNBDP stock solution (50 mL) with PBS pH 7.4 (2450 mL) in a cuvette (light path length (l) = 1 cm). The absorbance (Abs) of GSA-DiEtNBDP at 520 nm was determined to be 0.03137 with an absorption spectrometer. 2. Calculate the DOL for GSA-DiEtNBDP (DiEtNBDP/GSA [mol/mol]) by using the following equation: DOL ¼
Abs Dilution 1 ; l c
[1]
where Dilution is a dilution factor used for absorbance measurement, e is molar extinction coefficient (L/mol/ cm) of the labeled probe, and c is protein concentration (mol/L). Assuming that (i) there is no change for e of DiEtNBDP before and after GSA conjugation and (ii) there is no loss of macromolecular GSA at the separation step (1,3,5,7-tetramethyl-2,6-bis-(2-methoxycarbonylethyl) -8-phenyl-4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (2b)), e and c were determined to be 64,000 (L/mol/cm) and 4.73 10–6 (mol/L), respectively. The DOL is determined as follows:
DOL ¼
0:0137:50 1 ¼ 5:2: 64; 000:1 4:73 106
[2]
3. Similarly, the DOL was determined to be 4.5 for GSAPhBDP. 3.1.4. Preparation of Mouse Models of Intraperitoneally Disseminated Tumor
1. Culture the human ovarian cancer cell line SHIN3 in RPMI 1640 containing 10% fetal bovine serum, 100 U/mL penicillin, and 100 mg/mL streptomycin at 37˚C in humidified air containing 5% CO2. 2. When SHIN3 cells reach sub-confluence, treat the cells with trypsin–EDTA to separate culture into single cells (see Note 4). Just after centrifugation (100 g, 3 min, 4C) of a solution of the trypsinized SHIN3 cells, remove the supernatant and suspend the cells with ice-cold PBS pH 7.4 to a cell density of 1 106 cells/300 mL PBS. 3. Immediately, inject 1 106 cells of SHIN3 suspended in 300 mL of PBS in athymic nude mice (see Note 4). 4. Breed treated mice for 10–14 days when a centimeter-sized tumor is intraperitoneally formed adjacent to the pancreas, and millimeter-sized tumors are disseminated on the mesentery (see Note 5).
Fluorescence Imaging of Tumors
1. Inject 100 mg of GSA-DiEtNBDP (DOL = 5.2) as a pH-activatable targeted probe or 100 mg of GSA-PhBDP (DOL = 4.5) as a control in 300 mL of PBS into the peritoneal cavity of the mouse models of intraperitoneally disseminated tumor. 2. At 2–3 h post-injection, kill the mice by CO2 treatment, followed by whole blood collection. 3. Expose surgically the abdominal cavity of the treated mouse models with scissors and tweezers for small-animal use. 4. Capture the white light and fluorescence spectral images of the whole abdominal cavity and the mesentery with a MaestroTM In-Vivo Imaging System (CRi Inc., Woburn, MA) (Figs. 5.3 and 5.4). The fluorescence emission spectra are obtained from 520 to 800 nm in 10-nm step with excitation at 445–490 nm. 5. Create the unmixed images with the use of authentic spectral patterns of DiEtNBDP, PhBDP, and the background. Figure 5.3C, D show unmixed images of the peritoneal cavity of the treated mouse models, where probe fluorescence was visualized as green, while autofluorescence originated from the skin and the internal duct white and orange, respectively. Moreover, in Fig. 5.4, autofluorescence from the adipose tissue was additionally separated and assigned yellow.
White light image
GSA-PhBDP (always ON)
Unmixed image
3.1.5. Fluorescence Spectral Imaging in the Mouse Models of Intraperitoneally Disseminated Tumor
57
GSA-DiEtNBDP (pH-activatable)
A
B
C
D
Fig. 5.3. The activatable GSA–DiEtNBDP can specifically detect intraperitoneal tumors. White light (A and B) and fluorescence unmixed images (C and D) of the peritoneal cavity in the mouse models of intraperitoneally disseminated tumor with ‘‘always on’’ GSA– PhBDP (A and C) or ‘‘pH-activatable’’ GSA–DiEtNBDP (B and D). Unmixed images indicate probe fluorescence (green) and autofluorescence originated from the skin (white) and the internal duct (orange). White arrowheads indicate disseminated tumors.
58
Asanuma et al.
White light image
A
Unmixed image
GSA-PhBDP (always ON)
C
GSA-DiEtNBDP (pH-activatable)
B
5 mm
D
Fig. 5.4. The activatable GSA–DiEtNBDP can specifically detect intraperitoneally disseminated tumors as small as submillimeter in size. White light (A and B) and fluorescence unmixed images (C and D) of the mesentery of the mouse models of intraperitoneally disseminated tumor with ‘‘always on’’ GSA–PhBDP (A and C) or ‘‘pHactivatable’’ GSA–DiEtNBDP (B and D). Unmixed images indicate probe fluorescence (green) and autofluorescence originated from the internal duct (orange) and the adipose tissue (yellow). Scale bar is 5 mm.
3.2. Imaging of Tumors with Herceptin– DiEtNBDP in Tumor Mouse Models 3.2.1. Labeling of Herceptin with DiEtNBDP or PhBDP
1. Dissolve Herceptin in 200 mM sodium phosphate buffer (pH 8.5) (see Note 2) to obtain 1.0 mg/mL Herceptin stock solution (3.42 nmol/mL). 2. Add 3.42 mL of 10 mM DiEtNBDP, SE stock solution (34.2 nmol; 10 eq.) or 2.05 mL of 10 mM PhBDP, SE stock solution (20.5 nmol; 6 eq.) to 1.0 mL of 1.0 mg/mL Herceptin stock solution (3.42 nmol), immediately followed by gentle mixing. 3. Incubate the reaction solutions for 60 min at ambient temperature in the dark. 4. Separate the Herceptin–DiEtNBDP and Herceptin–PhBDP conjugates from free DiEtNBDP and PhBDP, respectively, by PD-10 columns using PBS pH 7.4 as the eluent according to the manufacturer’s instruction, yielding 3.0 mL of stock solution of Herceptin–DiEtNBDP and Herceptin–PhBDP. The stock solution is preserved in the dark at 4C.
3.2.2. Determination of DOL for Herceptin–DiEtNBDP and Herceptin–PhBDP
1. Measure the absorbance of Herceptin–DiEtNBDP and Herceptin–PhBDP at 520 nm with an absorption spectrometer.
Fluorescence Imaging of Tumors
59
2. Calculate the DOL with equation. In our case, DOL was 2.8 and 3.0 for Herceptin–DiEtNBDP and Herceptin–PhBDP, respectively. 3.2.3. Preparation of Mouse Models of Lung Metastatic Tumor
1. Culture the HER2-transfected NIH3T3/HER2 cells in RPMI 1640 containing 10% fetal bovine serum, 100 U/mL penicillin, and 100 mg/mL streptomycin at 37˚C in humidified air containing 5% CO2. 2. When NIH3T3/HER2 cells reach sub-confluence, treat the cells with trypsin–EDTA to separate each cell (see Notes 4 and 6). Just after centrifugation (100 g, 3 min, 4C) of a solution of the trypsinized NIH3T3/HER2 cells, remove the supernatant and suspend the cells to a cell density of 1 106 cells/100 mL with ice-cold PBS pH 7.4. 3. Immediately, inject 2 106 cells of NIH3T3/HER2 suspended in 200 mL of PBS via the tail vein in athymic nude mice (see Note 4). 4. Breed the treated mice for 18–21 days, when millimetersized tumors are formed on the lung surfaces (see Note 5).
3.2.4. Fluorescence Spectral Imaging in the Mouse Models of Lung Metastatic Tumor
1. Inject 300 mg of Herceptin–DiEtNBDP (DOL = 2.8) as a pH-activatable targeted probe, or 100 mg of Herceptin– PhBDP (DOL = 3.0) plus 200 mg of Herceptin as a control via the tail vein into the mouse models of lung metastatic tumor. 2. One day post-injection, kill the mice by CO2 treatment, followed by whole blood collection. 3. Expose surgically the thoracic cavity of the treated mouse models with scissors and tweezers for small-animal use. 4. Capture the white light and fluorescence spectral images of the thorax with a MaestroTM In-Vivo Imaging System (Fig. 5.5). The fluorescence emission spectra are obtained from 520 to 800 nm in 10-nm step with excitation at 445–490 nm. 5. Create the unmixed images with the use of authentic spectral patterns of DiEtNBDP, PhBDP, and the background.
3.3. Conclusion
We successfully visualized tumors as small as submillimeter in size, with minimal background by GSA–DiEtNBDP and Herceptin–DiEtNBDP in the intraperitoneally disseminated tumor and lung metastatic tumor mouse models, respectively. Since the design of pH-activatable targeted probes can be applied to any target molecules on the cell surface that are to be internalized
Asanuma et al.
Thoracic cavity
Unmixed image
White light image
IgG-PhBDP (always ON)
Composite image
60
Lung & heart
IgG-DiEtNBDP IgG-PhBDP (pH-activatable) (always ON)
A
D
B
E
C
F
IgG-DiEtNBDP (pH-activatable)
Fig. 5.5. The activatable Herceptin–DiEtNBDP can specifically detect submillimetersized tumors on the lung surfaces. (A and D) White light images, (B and E) unmixed images, and (C and F) composite images of (A) and (B), or (D) and (E). The images show simultaneously two operated mice that were arranged side by side with their lungs centered at their position. Left mouse was treated with ‘‘always-ON’’ Herceptin–PhBDP and right mouse with ‘‘pH-activatable’’ Herceptin–DiEtNBDP. The tumor-to-heart ratio of the pH-activatable probe was 22-fold higher than that of the control probe (193.0 versus 8.7 arbitrary units) (14).
after ligand binding, this imaging strategy can afford a general and powerful method to diagnose and monitor the target tumors. Main potential application of the probes will be used as a clinical tool for the real-time detection of tumors during surgical resection. Such an agent also provides sufficient contrast for sensitive and reliable detection of tumors with a fluorescence endoscope (14). Finally, the strategy could be used in photodynamic therapy to salvage normal tissues and specifically enhance the cytotoxic effect on tumors.
Fluorescence Imaging of Tumors
61
4. Notes 1. All SE stock solutions should be stored at –20C in the dark. Avoid moisture exposure as much as possible to keep SEs reactive. 2. Buffers (pH 8–9) containing no free amine, such as sodium phosphate buffer, are recommended. Tris and glycine that have free amines must be avoided because those molecules can react with SE. For efficient labeling, moderately basic conditions are required for aliphatic amines to become sufficiently nucleophilic by deprotonation and react with SE. Under such conditions, SE is hydrolyzed in competition with labeling; but this side reaction is usually slow below pH 9. Buffers can be prepared at any concentration as long as pH of reaction solutions is retained. 3. Do not freeze the solutions to avoid denaturation of the conjugates. The prepared conjugates are recommended to be used in imaging experiments within several days as immediately as possible. 4. Unify the condition for tumor cell preparation as possible, because the activity of tumor cells can severely influence the growth rate and pattern of tumors formed in mouse models. It is noteworthy that sub-confluent cells empirically have high viability, providing stable, satisfactory tumor models. 5. Tumor mouse models should be carefully monitored every day to establish a stable procedure for efficient models. Described number of days for breeding after tumor cell injection is just a reference, because the degree of tumor dissemination depends on the growth environment of mice, etc. Avoid overprogression of tumor model that induces suffering and eventually kills treated mice. 6. Unless trypsinized tumor cells are separated to single cells, injected mouse models will die owing to infarction of aggregated cells in capillary vessels. References 1. Hengerer, A., Wunder, A., Wagenaar, D. J., Vija, A. H., Shah, M., and Grimm, J. (2005) From genomics to clinical molecular imaging. Proceedings of the IEEE 93, 819–828. 2. Krohn, K. A., O’Sullivan, F., Crowley, J., Eary, J. F., Linden, H. M., Link, J. M., Mankoff, D. A., Muzi, M., Rajendran, J. G., Spence, A. M., and Swanson, K. R. (2007) Challenges in clinical studies with
multiple imaging probes. Nucl Med Biol 34, 879–885. 3. Becker, A., Hessenius, C., Licha, K., Ebert, B., Sukowski, U., Semmler, W., Wiedenmann, B., and Grotzinger, C. (2001) Receptor-targeted optical imaging of tumors with near-infrared fluorescent ligands. Nat Biotechnol 19, 327–331.
62
Asanuma et al. 4. Moon, W. K., Lin, Y., O’Loughlin, T., Tang, Y., Kim, D. -E., Weissleder, R., and Tung, C. -H. (2003) Enhanced tumor detection using a folate receptor-targeted near-infrared fluorochrome conjugate. Bioconjug Chem 14, 539–545. 5. Weissleder, R., Tung, C. -H., Mahmood, U., and Bogdanov, A. (1999) In vivo imaging of tumors with protease-activated nearinfrared fluorescent probes. Nat Biotechnol 17, 375–378. 6. Bremer, C., Tung, C. -H., and Weissleder, R. (2001) In vivo molecular target assessment of matrix metalloproteinase inhibition. Nat Med 7, 743–748. 7. Hama, Y., Urano, Y., Koyama, Y., Kamiya, M., Bernardo, M., Paik, R. S., Shin, I. S., Paik, C. H., Choyke, P. L., and Kobayashi, H. (2007) A target cell-specific activatable fluorescence probe for in vivo molecular imaging of cancer based on a self-quenched avidin-rhodamine conjugate. Cancer Res 67, 2791–2799. 8. Kamiya, M., Kobayashi, H., Hama, Y., Koyama, Y., Bernardo, M., Nagano, T., Choyke, P. L., and Urano, Y. (2007) An enzymatically activated fluorescence probe for targeted tumor imaging. J Am Chem Soc 129, 3918–3929. 9. Hama, Y., Urano, Y., Koyama, Y., Choyke, P. L., and Kobayashi, H. (2006) Targeted optical imaging of cancer cells using lectin-
10.
11.
12.
13.
14.
binding BODIPY conjugated avidin. Biochem Biophys Res Commun 348, 807–813. Austin, C. D., De Maziere, A. M., Pisacane, P. I., van Dijk, S. M., Eigenbrot, C., Sliwkowski, M. X., Klumperman, J., and Scheller, R. H. (2004) Endocytosis and sorting of ErbB2 and the site of action of cancer therapeutics trastuzumab and geldanamycin. Mol Biol Cell 15, 5268–5282. Hongyan Li, Z. M. Q. (2002) Transferrin/ transferrin receptor-mediated drug delivery. Med Res Rev 22, 225–250. Konan, Y. N., Gurny, R., and Allemann, E. (2002) State of the art in the delivery of photosensitizers for photodynamic therapy. J Photochem Photobiol 66, 89–106. Atobe, K., Ishida, T., Ishida, E., Hashimoto, K., Kobayashi, H., Yasuda, J., Aoki, T., Obata, K. -I., Kikuchi, H., Akita, H., Asai, T., Harashima, H., Oku, N., and Kiwada, H. (2007) In vitro efficacy of a sterically stabilized immunoliposomes targeted to membrane type 1 matrix metalloproteinase (MT1-MMP). Biol Pharm Bull 30, 972–978. Urano, Y., Asanuma, D., Hama, Y., Koyama, Y., Barrett, T., Kamiya, M., Nagano, T., Watanabe, T., Hasegawa, A., Choyke, P. L., and Kobayashi, H. (2009). Selective molecular imaging of viable cancer cells with pH-activatable fluorescence probes. Nat Med 15(1): 104–109.
Chapter 6 Imaging Vasculature and Lymphatic Flow in Mice Using Quantum Dots Byron Ballou, Lauren A. Ernst, Susan Andreko, James A. J. Fitzpatrick, B. Christoffer Lagerholm, Alan S. Waggoner, and Marcel P. Bruchez Abstract Quantum dots are ideal probes for fluorescent imaging of vascular and lymphatic tissues. On injection into appropriate sites, red- and near-infrared-emitting quantum dots provide excellent definition of vasculature, lymphoid organs, and lymph nodes draining both normal tissues and tumors. We detail methods for use with commercially available quantum dots and discuss common difficulties. Key words: Quantum dots, in vivo, animals, vasculature, circulation, lymph nodes, sentinel lymph nodes, lymphatic vessels.
1. Introduction Quantum dots were first used for labeling biological specimens in 1998 (1, 2), and have been used extensively since, because of the significant advantages they hold over other types of fluorophores. They combine exceptionally high brightness, due to high extinction coefficients (>6 106 M–1cm–1 at 450 nm) and large quantum yields (routinely as high as 60% for 655 nm emitting quantum dots), narrow emission bandwidths (<35 nm), and an unprecedented resistance to photobleaching. Several recent reviews have summarized progress in biological applications of quantum dots (3–10). The availability of far-red- and near-infrared-emitting quantum dots allows simple imaging of the general circulation and targetable organs or lesions in small animals. The potential drawbacks to the use of quantum dots, large size and high molecular weights, are not significant limitations for many in vivo imaging purposes. Large quantum dots, having P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_6, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
63
64
Ballou et al.
thick coatings, do not extravasate, are taken up by the reticuloendothelial system, and are trapped in primary sentinel nodes (11, 12); however, smaller quantum dots with thinner coats may not be trapped in primary nodes and can be used for other applications (13, 14). It is likely that such materials will be made commercially available. Since the current generation of quantum dots is composed of toxic heavy metals (cadmium selenide (CdSe) and cadmium telluride (CdTe) cores, with zinc sulfide (ZnS) or zinc sulfide–cadmium selenide (ZnS-CdSe) shells), toxicity might be anticipated if the quantum dots degrade over time. The consensus of the many tests for toxicity in vitro and in vivo is that core-shell quantum dots having a ZnS shell and suitably coated pose no significant short-term chemical toxicity risks (15–29). Phototoxicity induced by the high absorbency of quantum dots is a potential problem, and has led to the suggestion that suitably coated quantum dots may be useful for photodynamic therapy (30–33). Quantum dots used in our experiments were provided by Quantum Dot Corporation, now part of Invitrogen. They are coated with an amphiphilic polymer ‘‘amp’’ (34), which yields highly fluorescent aqueous-stable quantum dots with a high density of carboxyl groups on the surface (Qdot1 ITKTM carboxyl quantum dots). These quantum dots are available further coated by the manufacturer with polyethylene glycols (PEG) terminated with methoxy (mPEG) or amino groups (amino-PEG) (Qtracker1 non-targeted and Qdot1 ITKTM amino-PEG quantum dots, respectively). PEG substitution is extremely useful in minimizing non-specific binding and increasing the circulating lifetime of both molecules and nanoparticles. We have shown that mPEG-5000 substituted quantum dots have a much longer circulating lifetime than the original carboxyl quantum dots, quantum dots surfaced with mPEG-700, or quantum dots substituted with carboxy-terminal PEG-3400. Thus to obtain comprehensive labeling of the circulating blood pool, quantum dots conjugated to mPEG5000 are the preferred tools (35). We found that there is very little difference between carboxy-, amino-PEG, and mPEG in transport from tumors to sentinel lymph nodes (36). 1.1. Labeling Sentinel Lymph Nodes of Tumors
For following quantum dots from tumors to lymph nodes, human melanomas (37, 38) or mouse teratocarcinomas (39) were grown in the thighs of mice, which drain to the inguinal lymph nodes (36). As the inguinal node is large and superficial, it is easy to assess quantum dot migration using noninvasive imaging.
1.2. Labeling Draining Lymph Nodes of Normal Tissues
Extensive descriptions of methods for labeling sentinel lymph nodes and drainage basins are given in the works of Frangioni and collaborators (11, 40–45); his methods for using small Type II quantum dots are given in Frangioni et al. (12); Kobayashi and
Imaging Vasculature and Lymphatic Flow in Mice Using Quantum Dots
65
co-workers have defined different lymphatic drainage basins using two or more emission wavelengths of quantum dots or fluorochrome-labeled nanoparticles (46, 47). We have used injection into the tail flesh of mice to follow the time course of quantum dot migration through lymphatic channels (48). The pulsatile nature of lymphatic flow is clearly demonstrated in a video (http://www.mbic.cmu.edu/movies/movie2.mov).
2. Materials 1. Mice, either Balb/c or athymic nude, 20–25 g were obtained from Harlan (Indianapolis, IN). Other strains or suppliers may be used as convenient. The athymic nude mice are especially convenient for imaging, as there is minimal fluorescence background or attenuation from hair. 2. Mouse tumor lines: Tumor cell lines were kind gifts: mouse MH-15 teratocarcinoma from Drs. Barbara Knowles and Davor Solter, now at Jackson Laboratories, Bar Harbor, ME (www.jax.com), and human M21 melanoma from Dr. R. A. Reisfeld, Scripps Research Institute, LaJolla, CA (www.scripps.edu/research). These lines were used because our laboratory has considerable experience with them. We would expect most other tumor lines to behave similarly. Cell growth reagents were obtained from Invitrogen (Invitrogen, Carlsbad, CA). 3. Anesthetics: Sodium pentobarbital, 50 mg/mL in ethanol, isofluorane, and nitrous oxide. Gaseous anesthesia is provided using a SurgiVet veterinary anesthesia vaporizer (Smiths Medical, Waukesha, WI). Coaxial anesthesia units with face masks for rodents and other small animals, with vapor scavenging units, are available from Harvard Apparatus, Holliston, MA. Many other manufacturers of small animal anesthesia devices supply similar equipment, and local utility gas suppliers can usually provide oxygen and nitrous oxide. 4. Quantum dots were obtained from Invitrogen. We used 655 nm-emitting ZnS-CdSe, 705 nm ZnS-CdSe-CdTe and 800 nm-emitting ZnS-CdSe-CdTe core-shell quantum dots. All are available as Qtracker1 non-targeted mPEG-coated nanoparticles. They were supplied in 0.01 M sodium borate buffer at pH 8.5. 5. Millex syringe filters and Centricon centrifugal ultrafilters, 30 k molecular weight cut-off (Millipore, Billerica, MA).
66
Ballou et al.
6. Solutions: 1.4 M NaCl. PBS: Phosphate-buffered saline (from any supplier). ECM gel from Sigma-Aldrich (www.sigmaaldrich.com). This product is similar to MatrigelTM from BD (www.bd.com). 7. Light-emitting diodes (LED): we use Luxeon Royal Blue LXHL-MRRC, equipped with 460 50 interference filters or Luxeon LXHL-MD1D, equipped with 635 20 filters. Both were from Lumileds Lighting (www.philipslumileds. com). These devices were originally placed in custom units assembled by us, but preassembled LED lighting units having several wavelength outputs are now available from many manufacturers, for example, LED Area Lights from Edmund Optics Barrington, NJ (www.edmundoptics.com). Any positioning device that will hold the illuminators firmly in place for the duration of an experiment is satisfactory. Illuminators should be positioned so as to give uniform illumination over the field of view. For many purposes, a ring illuminator is acceptable. The uniformity of illumination must be checked before use (easily done by imaging a flat surface at the illuminating wavelength). 8. Bandpass interference filters optically blocked outside their transmitted wavelength ranges are widely available. Our interference filters were from Chroma Technologies, Rockingham, VT (www.chroma.com). 9. Cooled charge-coupled device (CCD) cameras having good sensitivity in the near-infrared are available from manufacturers such as Andor, Hamamatsu, and Qimaging. For most purposes, we have used an Andor DU 434-BRDD cooled CCD camera (Andor Technology, South Windsor, CT; www.andor.com) equipped with a 50-mm AF Nikkor lens and any of several interference filters fitted between the lens and the CCD and held in place using Orings. More recent versions of this camera having a higher frame rate and better sensitivity in the near-infrared are now available (see Note 1).
3. Methods 3.1. Labeling the General Circulation and the Reticuloendothelial System
1. Anesthesia: For imaging, anesthetize mice using pentobarbital (typically 80 mg/kg, intraperitoneally, the dose may be adjusted to give the desired level of anesthesia). For inhalation anesthesia, we use a mixture of oxygen and nitrous oxide (typically at a 2:1 ratio) passed through isofluorane in a
Imaging Vasculature and Lymphatic Flow in Mice Using Quantum Dots
67
SurgiVet veterinary anesthesia vaporizer; a coaxial facemask is used, and exhaled vapors pass through a vapor-scavenging canister to remove isofluorane. Inhalation anesthesia is much preferred where observation periods of 30 min or more are needed. 2. Quantum dots: Qtracker1 non-targeted quantum dots are supplied at 2 mM. Filter 180 ml (360 pmol) through a Millex 0.2-m syringe-tip filter, or equivalent, mix with 20-ml sterile 1.4 M NaCl, yielding a sterile solution of quantum dots in normal saline (the sodium borate makes a negligible contribution to ionic strength of the quantum dot solutions). About 200 ml is an appropriate volume for administration to adult mice (see Note 2). 3. Injection: Gently heat mice, place in a restraining device, and inject quantum dots into the tail veins. Where following rapid distribution of a bolus is required, mice are first anesthetized, then placed under the camera and imaged prior to and during injection, and for appropriate periods subsequent to the injection. 4. Illumination: Illuminate animals using four 450-nm-emitting 5-watt LEDs or four 625-nm-emitting 1-watt LEDs (Luxeon Royal Blue LXHL-MRRC, Luxeon LXHL-MD1D, respectively). The red-emitting LEDs allow better penetration of excitation light; however, we find that there is sufficient emission outside the nominal emission maxima that the illuminators should be equipped with secondary interference bandpass filters (460 50 for the blue LEDs; 630 20 for the red LEDs) to minimize background in the detected emission channels. 5. For imaging, we use an Andor DU cooled CCD camera equipped with a 50-mm AF Nikkor lens and any of several interference filters fitted between the lens and the CCD. The 655-nm-emitting quantum dots are imaged using a 654 24 nm interference filter, 705-nm-emitting quantum dots are imaged using a 700 75 nm interference filter, and 800-nm-emitting quantum dots are normally imaged using an 800 20 interference filter. Immediately after injection, the animal’s subsurface vasculature becomes fluorescent, and the circulating lifetime of quantum dots may be estimated by measuring the fluorescence of blood vessels at successive time intervals (35); a video comparison of quantum dots having three different surfaces is available (http://www.mbic. cmu.edu/movies/movie1.mov). With time, accumulation in the liver, spleen, and lymph nodes becomes apparent (see Note 3).
68
Ballou et al.
3.2. Labeling Sentinel Lymph Nodes of Tumors
1. Inoculate tumors into the right thighs of mice by subcutaneous injection of 106 cells in PBS (for MH-15 cells) or in 50 ml ECM gel (for M21 cells), then allow to grow to a diameter of 2–3 mm and a thickness of 1–2 mm. 2. Anesthetize mice as described above. 3. Prepare quantum dots in saline as above, but at 5-mM final concentration for injection into the tumors (see Note 4). 4. Inject only a small volume into the tumors (typically 5–20 ml; 25–100 pmol of quantum dots). Under these conditions, migration from the tumors can be followed through the skin and the draining lymphatic vessels may be seen. 5. Image as described above. Because of the by-pass feature of mouse lymph nodes (49), not only the inguinal nodes but also the brachial node and connecting lymphatics typically can be followed. We caution that, although the initial movement of quantum dot fluorescence from tumors is rapid, minutes to hours may be required before migration to distant lymph nodes is detectable. A particularly clear demonstration that the migration from tumors is only to a limited set of lymph nodes may be had by labeling the reticuloendothelial system by tail vein injection (thus labeling all the lymph nodes), then labeling sentinel nodes only by injecting a quantum dot having a different emission wavelength into the tumor (36) (Fig. 6.1) (see Note 5).
Fig. 6.1. (A) Lymph nodes labeled generally by tail-vein injection of 655-nm-emitting mPEG-5000; (B) Sentinel lymph nodes labeled by tumor injection of 800-nm-emitting mPEG-5000 quantum dots. Mouse necropsied after euthanasia, and internal organs removed to display the lymph nodes more clearly. Imaging was as described in the text, without correction for the (negligible) spillover. The overwhelmingly bright tumor (‘‘T’’) is masked to allow imaging of the nodes. Figure from (36).
Imaging Vasculature and Lymphatic Flow in Mice Using Quantum Dots
3.3. Labeling Draining Lymph Nodes of Normal Tissues: Mouse Tail
69
1. Prepare quantum dots as above in saline solution at 5-mM concentration. 2. Anesthetize mice as above. 3. Inject into the ventral or lateral tail interstitium of an anesthetized mouse. Typically, 10–50 ml containing 50–250 pmol of quantum dots are injected into the base of the tail over 5 s. 4. Place the anesthetized mouse on its back, and image over a time period of 30 min to 1 h. Flow to the inguinal lymph nodes and beyond is visible (Fig. 6.2). If the mouse is injected more distally in the tail, most of the quantum dots will be found in the lumbar, sacral, and sciatic nodes (see Note 6).
Fig. 6.2. The 800-nm-emitting quantum dots injected into the base of a mouse tail. Migration to the inguinal and brachial lymph nodes may be followed over a time series. Note that there is no leakage into the general circulation. From (48).
70
Ballou et al.
4. Notes 1. When we began our work, it was necessary to assemble our own equipment. Now small animal imaging devices are available from several manufacturers; each has specific advantages, and all allow standardization for repeated imaging under identical conditions of illumination, animal position, and exposure. Examples include the Caliper IVIS (www.caliperls. com/products/optical-imaging/), the Kodak F and FX (www.carestreamhealth.com/in-vivo-imaging-system-f.html), the Visen FMT (www.visenmedical.com/products/quantitative_tomography_systems/FMT_2500_system), and the CRI Nuance (www.cri-inc.com/applications/in-vivo.asp). 2. Normally, fresh quantum dots may be used as obtained from the manufacturer, and are simply adjusted to a desired volume and salt concentration for cell labeling or injection. Material may leak from surface coatings on long-term storage; we have found it useful to pass aged quantum dots through a gel filtration column (Sephacryl-300 or Superose 6, from GE Healthcare, or equivalent columns from other manufacturers) to remove both high- and low-molecular weight contaminants. 3. In unpublished experiments, we found that substituting quantum dots with longer PEG chains (10, 20 k) did not lead to a longer circulating lifetime, nor did a subsequent ‘‘fill-in’’ reaction using shorter PEG chains in an attempt to increase the surface density on the quantum dots. We caution that there may be significant batch-to-batch variation in circulating lifetime among commercial as well as ‘‘home-brew’’ quantum dots. Quantum dots injected into the general circulation are rapidly taken up by the different components of the reticuloendothelial system. Liver, lymph nodes, spleen, and bone marrow are the principal sites of deposition. Carboxyl- or amino-PEG quantum dots are taken up much more rapidly than PEGsurfaced quantum dots (35, 48, 50). Varying the surfaces of quantum dots influences, to a limited extent, the sites of deposition; long-chain PEG-surfaced quantum dots are localized less to lymph nodes and more to the liver and spleen than the carboxyl quantum dots, (35) as would be expected (12). Toms and colleagues found that tumor macrophages in rat C6 gliomas can be labeled using systemically administered amino-PEG quantum dots, provided that enough quantum dots are used to saturate the reticuloendothelial system (51, 52). This represents a promising approach to delineating tumor margins in intracranial and other tumors, where background from the reticuloendothelial system is not a significant factor.
Imaging Vasculature and Lymphatic Flow in Mice Using Quantum Dots
71
4. Depending on the manufacturer, it may be necessary to concentrate the quantum dots. We prefer to use Centricon centrifugal ultrafilters, 30 k molecular weight cut-off. As always, quantum dots should be held in low salt concentration (e.g., 0.01 M sodium borate, pH 8.5) until just before use, when they are made up to 0.14 M NaCl. 5. Where two or more different emitters are used together, narrowband emission filters (with subtraction of spillover) or spectral segmentation may be used to resolve the emission. Alternatively, illumination of the higher-wavelength emitter at a wavelength longer than the emission wavelength of the shorter wavelength emitter will eliminate spillover from the shorter wavelength emitter, thus allowing one-way subtraction to resolve distinct emissions. We find that 655 and 800 nm emitters provide optimal signal-separation for these experiments: combinations of 705- and 800-nm-emitting quantum dots are too heavily overlapped, and 605 nm quantum dots do not provide adequate tissue penetration for most noninvasive in vivo experimentation. 6. We have found these methods to be relatively reliable using commercially available materials from Quantum Dot Corporation and Invitrogen Corporation, although we have noted considerable variability in actual circulation lifetime using ‘‘equivalent’’ commercial products. As is the case with all in vivo experimentation, it is important to ensure that the specific materials and animals that you use provide appropriate imaging windows (time and signal) for the measurements that you are performing.
Acknowledgments The authors wish to acknowledge financial support from the NIH BRP program under grant number EB00364. MB also wishes to acknowledge Carnegie Mellon University for faculty start-up funds. References 1. Bruchez, M., Jr., Moronne, M., Gin, P., Weiss, S., and Alivisatos, A. P. (1998) Semiconductor nanocrystals as fluorescent biological labels. Science 281, 2013–2016. 2. Chan, W. C., and Nie, S. (1998) Quantum dot bioconjugates for ultrasensitive nonisotopic detection. Science 281, 2016–2018.
3. Zhou, M., and Ghosh, I. (2007) Quantum dots and peptides: a bright future together. Biopolymers 88, 325–339. 4. Jaiswal, J. K., and Simon, S. M. (2007) Imaging single events at the cell membrane. Nat Chem Biol 3, 92–98. 5. Smith, A. M., Ruan, G., Rhyner, M. N., and Nie, S. (2006) Engineering luminescent
72
Ballou et al.
6.
7. 8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
quantum dots for in vivo molecular and cellular imaging. Ann Biomed Eng 34, 3–14. Pinaud, F., Michalet, X., Bentolila, L. A., Tsay, J. M., Doose, S., Li, J. J., Iyer, G., and Weiss, S. (2006) Advances in fluorescence imaging with quantum dot bioprobes. Biomaterials 27, 1679–1687. Sargent, E. H. (2005) Infrared quantum dots. Adv Mater 17, 515–522. Michalet, X., Pinaud, F. F., Bentolila, L. A., Tsay, J. M., Doose, S., Li, J. J., Sundaresan, G., Wu, A. M., Gambhir, S. S., and Weiss, S. (2005) Quantum dots for live cells, in vivo imaging, and diagnostics. Science 307, 538–544. Medintz, I. L., Uyeda, H. T., Goldman, E. R., and Mattoussi, H. (2005) Quantum dot bioconjugates for imaging, labelling and sensing. Nat Mater 4, 435–446. Alivisatos, A. P., Gu, W., and Larabell, C. (2005) Quantum dots as cellular probes. Annu Rev Biomed Eng 7, 55–76. Kim, S., Lim, Y. T., Soltesz, E. G., De Grand, A. M., Lee, J., Nakayama, A., Parker, J. A., Mihaljevic, T., Laurence, R. G., Dor, D. M., Cohn, L. H., Bawendi, M. G., and Frangioni, J. V. (2004) Near-infrared fluorescent type II quantum dots for sentinel lymph node mapping. Nat Biotechnol 22, 93–97. Frangioni, J. V., Kim, S. -W., Ohnishi, S., Kim, S., and Bawendi, M. G. (2007) Sentinel lymph node mapping with type-II quantum dots. Methods Mol Biol 374, 147–159. Zimmer, J. P., Kim, S. W., Ohnishi, S., Tanaka, E., Frangioni, J. V., and Bawendi, M. G. (2006) Size series of small indium arsenide-zinc selenide core-shell nanocrystals and their application to in vivo imaging. J Am Chem Soc 128, 2526–2527. Choi, H. S., Liu, W., Misra, P., Tanaka, E., Zimmer, J. P., Ipe, B. I., Bawendi, M. G., and Frangioni, J. V. (2007) Renal clearance of quantum dots. Nat Biotechnol 25, 1165–1170. Lewinski, N., Colvin, V., and Drezek, R. (2008) Cytotoxicity of nanoparticles. Small 4, 26–49. Fischer, H. C., and Chan, W. C. (2007) Nanotoxicity: the growing need for in vivo study. Curr Opin Biotechnol 18, 565–571. Choi, A. O., Cho, S. J., Desbarats, J., Lovric, J., and Maysinger, D. (2007) Quantum dot-induced cell death involves Fas upregulation and lipid peroxidation in human neuroblastoma cells. J Nanobiotechnology 5, 1.
18. Chithrani, B. D., and Chan, W. C. (2007) Elucidating the mechanism of cellular uptake and removal of protein-coated gold nanoparticles of different sizes and shapes. Nano Lett 7, 1542–1550. 19. Zhang, T. T., Stilwell, J. L., Gerion, D., Ding, L. H., Elboudwarej, O., Cooke, P. A., Gray, J. W., Alivisatos, A. P., and Chen, F. F. (2006) Cellular effect of high doses of silica-coated quantum dot profiled with high throughput gene expression analysis and high content cellomics measurements. Nano Lett 6, 800–808. 20. Hardman, R. (2006) A toxicologic review of quantum dots: toxicity depends on physicochemical and environmental factors. Environ Health Perspect 114, 165–172. 21. Fischer, H. C., Liu, L. C., Pang, K. S., and Chan, W. C. W. (2006) Pharmacokinetics of nanoscale quantum dots: in vivo distribution, sequestration, and clearance in the rat. Adv Funct Mater 16, 1299–1305. 22. Delehanty, J. B., Medintz, I. L., Pons, T., Brunel, F. M., Dawson, P. E., and Mattoussi, H. (2006) Self-assembled quantum dotpeptide bioconjugates for selective intracellular delivery. Bioconj Chem 17, 920–927. 23. Chang, E., Thekkek, N., Yu, W. W., Colvin, V. L., and Drezek, R. (2006) Evaluation of quantum dot cytotoxicity based on intracellular uptake. Small 2, 1412–1417. 24. Lovric, J., Bazzi, H. S., Cuie, Y., Fortin, G. R., Winnik, F. M., and Maysinger, D. (2005) Differences in subcellular distribution and toxicity of green and red emitting CdTe quantum dots. J Mol Med 83, 377–385. 25. Kirchner, C., Liedl, T., Kudera, S., Pellegrino, T., Munoz Javier, A., Gaub, H. E., Stolzle, S., Fertig, N., and Parak, W. J. (2005) Cytotoxicity of colloidal CdSe and CdSe/ZnS nanoparticles. Nano Lett 5, 331–338. 26. Shiohara, A., Hoshino, A., Hanaki, K., Suzuki, K., and Yamamoto, K. (2004) On the cyto-toxicity caused by quantum dots. Microbiol Immunol 48, 669–675. 27. Derfus, A. M., Chan, W. C. W., and Bhatia, S. N. (2004) Probing the cytotoxicity of semiconductor quantum dots. Nano Lett 4, 11–18. 28. Hoshino, A., Fujioka, K., Oku, T., Suga, M., Sasaki, Y. F., Ohta, T., Yasuhara, M., Suzuki, K., and Yamamoto, K. (2004) Physicochemical properties and cellular toxicity of nanocrystal quantum dots depend on their surface modification. Nano Lett 4, 2163–2169. 29. Lovric, J., Cho, S. J., Winnik, F. M., and Maysinger, D. (2005) Unmodified
Imaging Vasculature and Lymphatic Flow in Mice Using Quantum Dots
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
cadmium telluride quantum dots induce reactive oxygen species formation leading to multiple organelle damage and cell death. Chem Biol 12, 1227–1234. Samia, A. C., Chen, X., and Burda, C. (2003) Semiconductor quantum dots for photodynamic therapy. J Am Chem Soc 125, 15736–15737. Bakalova, R., Ohba, H., Zhelev, Z., Ishikawa, M., and Baba, Y. (2004) Quantum dot anti-CD conjugates: are they potential photosensitizers or potentiators of classical photosensitizing agents in photodynamic therapy of cancer? Nano Lett 4, 1567–1573. Dayal, S., Oleinick, N. L., Kenney, M. E., and Burda, C. (2007) Quantum dot-based energy transfer to photodynamic therapy agents. Abstracts of Papers, 233rd ACS National Meeting, Chicago, IL, United States, March 25–29, 2007, PHYS-325. Tsay, J. M., Trzoss, M., Shi, L., Kong, X., Selke, M., Jung, M. E., and Weiss, S. (2007) Singlet oxygen production by peptidecoated quantum dot-photosensitizer conjugates. J Am Chem Soc 129, 6865–6871. Wu, X., Liu, H., Liu, J., Haley, K. N., Treadway, J. A., Larson, J. P., Ge, N., Peale, F., and Bruchez, M. P. (2003) Immunofluorescent labeling of cancer marker Her2 and other cellular targets with semiconductor quantum dots. Nat Biotechnol 21, 41–46. Ballou, B., Lagerholm, B. C., Ernst, L. A., Bruchez, M. P., and Waggoner, A. S. (2004) Noninvasive imaging of quantum dots in mice. Bioconj Chem 15, 79–86. Ballou, B., Ernst, L. A., Andreko, S., Harper, T., Fitzpatrick, J. A. J., Waggoner, A. S., and Bruchez, M. P. (2007) Sentinel lymph node imaging using quantum dots in mouse tumor models. Bioconj Chem 18, 389–396. Bumol, T. F., and Reisfeld, R. A. (1982) Unique glycoprotein-proteoglycan complex defined by monoclonal antibody on human melanoma cells. Proc Natl Acad Sci USA 79, 1245–1249. Giuliano, A. E., Irie, R. F., Morton, D. L., and Ramming, K. P. (1978) Quantitative variations in expression of oncofetal antigens on human melanomas in culture. Proc Am Assoc Cancer Res 19, 133. Ballou, B., Levine, G., Hakala, T. R., and Solter, D. (1979) Tumor location detected with radioactively labeled monoclonal antibody and external scintigraphy. Science 206, 844–847.
73
40. Parungo, Cherie P., Soybel, David I., Colson, Yolonda L., Kim S.-W., Ohnishi, S., DeGrand, Alec M., Laurence, Rita G., Soltesz, Edward G., Chen, Fredrick Y., Cohn, Lawrence H., Bawendi, Moungi G., and Frangioni, John V. (2007) Lymphatic drainage of the peritoneal space: a pattern dependent on bowel lymphatics. Ann Surg Oncol 14, 286–298. 41. Parungo, C. P., Colson, Y. L., Kim, S. W., Kim, S., Cohn, L. H., Bawendi, M. G., and Frangioni, J. V. (2005) Sentinel lymph node mapping of the pleural space. Chest 127, 1799–1804. 42. Parungo, C. P., Ohnishi, S., De Grand, A. M., Laurence, R. G., Soltesz, E. G., Colson, Y. L., Kang, P. M., Mihaljevic, T., Cohn, L. H., and Frangioni, J. V. (2004) In vivo optical imaging of pleural space drainage to lymph nodes of prognostic significance. Ann Surg Oncol 11, 1085–1092. 43. Parungo, C. P., Ohnishi, S., Kim, S. W., Kim, S., Laurence, R. G., Soltesz, E. G., Chen, F. Y., Colson, Y. L., Cohn, L. H., Bawendi, M. G., and Frangioni, J. V. (2005) Intraoperative identification of esophageal sentinel lymph nodes with nearinfrared fluorescence imaging. J Thorac Cardiovasc Surg 129, 844–850. 44. Soltesz, E. G., Kim, S., Kim, S. W., Laurence, R. G., De Grand, A. M., Parungo, C. P., Cohn, L. H., Bawendi, M. G., and Frangioni, J. V. (2006) Sentinel lymph node mapping of the gastrointestinal tract by using invisible light. Ann Surg Oncol 13, 386–396. 45. Soltesz, E. G., Kim, S., Laurence, R. G., DeGrand, A. M., Parungo, C. P., Dor, D. M., Cohn, L. H., Bawendi, M. G., Frangioni, J. V., and Mihaljevic, T. (2005) Intraoperative sentinel lymph node mapping of the lung using near-infrared fluorescent quantum dots. Ann Thor Surg 79, 269–277; discussion 69–77. 46. Hama, Y., Koyama, Y., Urano, Y., Choyke, Peter L., and Kobayashi, H. (2007) Simultaneous two-color spectral fluorescence lymphangiography with near infrared quantum dots to map two lymphatic flows from the breast and the upper extremity. Breast Cancer Res Treat 103, 23–28. 47. Kobayashi, H., Hama, Y., Koyama, Y., Barrett, T., Regino, C. A. S., Urano, Y., and Choyke, P. L. (2007) Simultaneous multicolor imaging of five different lymphatic basins using quantum dots. Nano Lett 7, 1711–1716. 48. Ballou, B., Ernst, L. A., Andreko, S., Lagerholm, B. C., Bruchez, M. P., and Waggoner, A. S. (2008) Long-term retention of
74
Ballou et al.
fluorescent quantum dots in vivo, in ‘‘Nanomaterials for Application in Medicine and Biology’’ (Giersig, M., and Khomutov, G. B., Eds.), Vol. XVI, pp. 127–137, SpringerVerlag, Dordrecht. 49. Kowala, M. C., and Schoefl, G. I. (1986) The popliteal lymph node of the mouse: internal architecture, vascular distribution and lymphatic supply. J Anat 148, 25–46. 50. Ballou, B. (2005) Quantum dot surfaces for use in vivo and in vitro. Curr Top Dev Biol 70, 103–120.
51. Jackson, H., Muhammad, O., Daneshvar, H., Nelms, J., Popescu, A., Vogelbaum Michael, A., Bruchez, M., and Toms Steven, A. (2007) Quantum dots are phagocytized by macrophages and colocalize with experimental gliomas. Neurosurgery 60, 524–529; discussion 29–30. 52. Muhammad, O., Popescu, A., and Toms Steven, A. (2007) Macrophage-mediated colocalization of quantum dots in experimental glioma. Methods Mol Biol 374, 161–172.
Chapter 7 Bioluminescent Imaging of Transplanted Islets Xiaojuan Chen and Dixon B. Kaufman Abstract Bioluminescence imaging (BLI) modalities have been developed, refined, and used broadly in the study of small animal models of human biology and disease, including monitoring the fate of transplanted islets in vivo in real time. In order to advance our understanding of the pathophysiology and immunobiology of islet transplantation as they occur in living animals, islet grafts tagged with light-emitting luciferase can be implanted in a mouse islet transplantation model and assessed using in vivo BLI. We have utilized transgenic islets expressing the firefly luciferase as donor islets in syngeneic and allogeneic islet transplant mouse models for monitoring islets in vivo by BLI after they have been transplanted at different sites of the mice, including the intrahepatic site via portal vein injection. The sensitive and non-invasive BLI system allows better understanding of the dynamic fate of transplanted islets and the relationships among the islet mass that ultimately engrafts, the quality of graft function, and overall glucose homeostasis. It permits detection of early changes in islet graft function or mass due to rejection to prompt timely therapeutic intervention and change the fate of the graft. This chapter details some of the procedures for islet isolation, transplantation, and imaging as well as considerations of using the BLI system in the field of islet transplantation research. Key words: Islet isolation, islet portal transplantation in mice, bioluminescence imaging.
1. Introduction Islet transplantation can successfully ameliorate long-term glycemic instability and severe hypoglycemic complications in select subjects with type 1 diabetes mellitus (1). The success of islet transplantation depends on engraftment of an adequate mass of viable islets that produce sufficient amounts of insulin. Islets, however, are exquisitely sensitive to mechanical and chemical stresses generated during the isolation, purification, and transplantation processes. Islets are also vulnerable to injuries imposed by
P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_7, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
75
76
Chen and Kaufman
immediate nonspecific host inflammatory responses, later allospecific rejection, and potential auto-immune reactions posttransplant. To better understand the dynamic fate of transplanted islets and the relationships among the islet mass that ultimately engrafts, the quality of graft function, and overall glucose homeostasis, it is important to develop sensitive and noninvasive methods of real-time imaging to fate-map the functional mass of islets in vivo. We have applied bioluminescence imaging (BLI) in mouse models of islet transplantation by transplanting transgenic islets expressing the firefly luciferase to recipient mouse liver via portal vein infusion (2, 3). There is a linear relationship between the amount of islets transplanted and the intensity of the luminescent signals detected. BLI is a sensitive method for tracking the fate of islets after transplant, and permits detection of early changes in islet graft function or mass due to rejection to prompt timely therapeutic intervention and change the fate of the graft (3).
2. Materials 2.1. Sources of Luciferase-Tagged Islets and Choices of Recipient Mice ( See Note 1)
1. Transgenic FVB-Tg(RIP-luc) mice are used as islet donors in each transplant procedure. These mice have the FVB/NJ background (H-2q) and contain the firefly luciferase gene under the regulation of a rat insulin promoter II (RIP, 760 bp) that specifically and constitutively expresses firefly luciferase in the pancreatic islet beta cells (Xenogen Corp., Alameda, CA). 2. Wild-type male FVB/NJ (H-2q) and Balb/C (H-2d) mice (Jackson Laboratories, Bar Harbor, ME) are used as islet recipients for isogenic and allogeneic islet transplants, respectively.
2.2. Mouse Diabetes Induction by Streptozotocin Treatment ( See Note 2)
1. Streptozotocin (STZ, minimum 98% HPLC). 2. Citric acid anhydrous. 3. Sodium citrate dihydrate. 4. 0.1 M Citric acid solution: dissolve 1.9241 g of citric acid in 50 mL distill water. Store at room temperature. 5. 0.1 M Sodium citrate solution: Dissolve 1.4705 g of sodium citrate in 50 mL distillated water. Store at room temperature. 6. Citric acid buffer: Mix 25.5 mL 0.1 M sodium citrate solution and 22.0 mL 0.1 M citric acid solution and make up volume to 100 mL with distill water.
Bioluminescent Imaging of Transplanted Islets
2.3. Mouse Islet Isolation 2.3.1. Equipment and Instruments
77
1. 15 and 50 mL conical tubes 2. 20-mL capacity glass screw top vial (1 per 5 pancreata) 3. 1 glass funnel 4. 3 and 10 cc syringes; 19 and 30 gauge needles 5. 5, 10, 25, 50 mL pipettes and electric pipettor 6. Stainless steel type 304 mesh 400 mm (Small Parts, Inc., Miramar, FL) 7. A sterile drawn Pasteur pipette connected to a 3 cc syringe via a rubber tubing (self prepared) 8. Sterile individually wrapped transfer pipettes 9. 60 15 mm and 100 15 mm polystyrene Petri dishes 10. Gauze pads 11. Cotton tip swab 12. A centrifuge (we use Allegra X-12R, Beckman Coulter, Inc, Fullerton, CA) 12. Sterile surgical instruments: two pairs of scissors, one toothed tissue forceps, one anatomical forceps, one mosquito clamp, one abdominal retractor (Roboz Surgical Instrument Co., Rockville, MD)
2.3.2. Reagents
1. Hank’s balanced salt solution (HBSS 1 with calcium and magnesium without phenol red). 2. Hank’s balanced salt solution (HBSS 1 with calcium, magnesium, and phenol red) 3. Penicillin-streptomycin (P/S) 10,000 units/mL and 10,000 mg/mL, store aliquots of 5 mL in 15-mL conical tubes at –20C 4. Fetal bovine serum (FBS). If not pretreated, heat at 60C for 30 min, then store aliquots of 50 mL in 50-mL conical tubes at –20C until use. 5. Collagenase, Clostridiopeptidase A from Clostridium Histolyticum Type XI (Sigma-Aldrich). 6. HEPES buffer 7. Ketamine HCL and Xylazine 8. Dextran (MW 60,000–90,000, Sigma Industrial Grade, Sigma-Aldrich)
2.3.3. Working Solutions of Reagents
1. HBSS/P/S: Add 5 mL of thawed P/S to one bottle of 500 mL HBSS 1 with calcium and magnesium without phenol red. Keep on ice. Add 0.5 mL to sterile glass screw top vial (digestion of pancreas) and 40 mL to 50-mL conical tube (rinsing of pancreas) and keep on ice.
78
Chen and Kaufman
2. Collagenase: Remove collagenase from freezer. Place in a desiccator and let it warm up before weighing. Measure 0.0103 g of collagenase and mix with 20 mL of HBSS with Calcium, Magnesium without phenol red plus P/S in a 50-mL conical tube and filter it with 10 cc syringe and 0.22 mm filter for injection of 2.5 mL per mouse, sufficient for six mice. Keep on ice. 3. HBSS/P/S/FBS: Add 50 mL thawed FBS and 5 mL of P/S to HBSS 1 with calcium, magnesiumandphenol red. Keep onice. 4. 31% Dextran Gradient Stock Solution (density 1.111 g/mL): Add 12.5 mL HEPES to 500 mL HBSS. Weight 169 g of dextran and add to the 512.5 mL HBSS plus HEPES solution. Dissolve dextran with magnetic stir for 60–90 min at room temperature. Check the density to confirm it is 1.111. Check the pH to confirm it is 7.4. Autoclave the solution at 100C for 15 min. Store at 4C. Dextran working solution with different densities: Gradient T-3: density 1.111 g/mL (Dextran gradient stock solution). Gradient T-2: density 1.092 g/mL. Prepared by adding 3.9 mL HBSS/HEPES to 33.75 mL Dextran gradient stock solution. Gradient T-1: density 1.083 g/mL. Prepared by adding 10 mL HBSS/HEPES to 24.6 mL Dextran gradient stock solution. Gradient T-0: density 1.039 g/mL. Prepared by adding 20 mL HBSS/HEPES to 8 mL Dextran gradient stock solution. The gradient is prepared under Step 8 in the islet isolation protocol (see below). 2.4. Intra-portal Islet Transplantation
1. Dissection microscope. 2. 25GA butterfly (winged 0.38 3 tubing needle) and a 3 cc syringe. 3. A rubber or plastic surgical board. 4. 60 15 mm Petri dish filled with sterile saline. 5. Sterile phosphate-buffered saline (1 ). 6. Ketamine HCl and Xylazine. 7. Avitene microfibrillar collagen hemostat flour (Davol, In., Cranston, RI). 8. 5-0 Ethicon silk sutures. 9. Sterile surgical instruments pack with: small straight-edged scissors, small smooth forceps, toothed forceps, needle holder, skin stapler, gauze pads, and cotton-tipped applicators.
Bioluminescent Imaging of Transplanted Islets
79
2.5. Substrate Administration and Bioluminescence Imaging
1. In vivo bioluminescence imaging system (IVIS1 200, Xenogen Corp., Alemeda, CA).
2.5.1. Instruments
4. 1 cc syringes.
2.5.2. Reagents
1. Isofluorane
2. Gas anesthesia system (Xenogen). 3. Computer equipped with the Living Image software (Xenogen).
2.
D-Luciferin,
potassium salt (Molecular Therapeutics Inc., Ann Arbor, MI).
3. Methods 3.1. Mouse Diabetes Induction
1. Weight and record body weight of each mouse to be rendered diabetic. Prepare fresh STZ solution by dissolving 0.065 g of STZ in 5 mL of citric acid buffer for 20 min at room temperature. Then keep on ice while using. 2. To render mice diabetic, inject 220 mg/kg of STZ solution dissolved in citric acid buffer intraperitoneally.
3.2. Islet Isolation Procedure
1. For pancreas procurement, anesthetize mice (20–35 g body weight) by an intraperitoneal injection of a weight-adjusted dose of Ketamine (80–100 mg/kg), combined with Xylazine (5–10 mg/kg). Shave abdomen and chest and disinfect with 70% ethanol. Enter the abdominal cavity via a midline incision from the sternum to the symphysis pubis, and insert an abdominal retractor. After pulling the intestines to the left, fold the duodenum to the left. This exposes the bile duct, which is clamped with a mosquito clamp at its junction with the duodenum. Excise the sternum and exsanguinate the mouse by cutting the intrathoracic aorta and vena cava. Retract the liver to the chest with wet gauze and then cannulate the common bile duct at its junction with the cystic duct with a 30-gauge needle attached to a 3-cc syringe. Advance the tip of the cannula downward in the bile duct beyond any segmental branches to the liver. By injecting the collagenase over approximately a 3-min period, the duodenal and splenic portion of the pancreas should both become distended. After removal of the cannula, cut the proximal end of the bile duct, and excise the pancreas from the duodenum and other attachments. Rinse the pancreas in HBSS/P/S and place in the precooled screw top vial containing 0.5 mL HBSS/P/S. Up to five pancreases are collected in one vial, which is kept on ice.
80
Chen and Kaufman
2. For digestion of the pancreata, transfer the vial from ice to a 37C water bath and shake at 5-min intervals. The digestion time depends on the collagenase brand, type, and lot, and is normally between 11 and 15 min. 3. To stop the digestion, transfer the digest to a 50-mL conical tube, which has been pre-filled with 20 mL cold HBSS/P/S/ FBS. After shaking the tube fairly hard to break up the pancreas and get a cell suspension, add cold HBSS/P/S/FBS to adjust the volume up to 50 mL. 4. Centrifuge at 524g for 2 min at a temperature of 5C. 5. Pour off the supernatant into the waste container. Then add 10 mL HBSS/P/S/FBS and shake the tissue up and down. 6. Set up the glass funnel with a 400-mm mesh screen and 50-mL conical collection tube. Pour the tissue on the mesh and wash it with another 40 mL of cold HBSS/P/S/FBS through the mesh screen by using a 10-mL syringe with a 19-gauge needle. 7. Centrifuge at 524g for 2 min and pour off the supernatant into the waste container. 8. Now prepare the dextran gradient tube: Add 16 mL gradient (T-3) with a density of 1.111 g/mL into the cell pellet, mix well. Gently add 6 mL of gradient (T-2) with a density of 1.092 g/mL on top. Next, add 6 mL of gradient (T-1) with a density of 1.083 g/mL on top, and finally add 6 mL of gradient (T-0) with a density of 1.039 on top. 9. Centrifuge for 20 min at a speed of 1,455g with an acceleration set at 4 and deceleration set at off. 10. The islets should be settled between the interface of gradient (T-0) and (T-1), and the interface of gradient (T-1) and (T-2). Collect all cells which shine bright under maximum illumination from the interfaces and transfer into another 50-ml conical tube containing 10 mL cold HBSS/P/S/FBS. Add the volume up to 50 mL with cold HBSS/P/S/FBS. 11. Wash off the gradient solution by washing the islets three times in cold HBSS/P/S/FBS. Centrifuge at 930g for 1 min with brake high (first wash). 12. Remove 30 mL of the supernatant with a transfer pipette. Then mix well and add cold HBSS/P/S/FBS up to 50 mL. Centrifuge at 930g for 1 min (second and third wash). Remove the supernatant completely using the Pasteur pipette. 13. When a second gradient purification is necessary, repeat Steps 8–12 with a modification of Step 9 in which samples are centrifuged for only 10 min.
Bioluminescent Imaging of Transplanted Islets
81
14. Resuspend the pellet in 10 mL HBSS/P/S/FBS and pour the islet suspension in one 100 15 mm Petri dish pre-filled with 5 mL of HBSS/P/S/FBS. Wash the conical tube three times with 10 mL HBSS/P/S/FBS, pouring each wash into the Petri dish. Pick up the islets with a sterile drawn Pasteur pipette connected with a syringe and count the islet number. Transfer the islets into 60 15 mm Petri dishes, which contain already 5 mL HBSS/P/S/FBS, and keep the Petri dishes on ice. For culture, use either RPMI 1640 supplemented with 10% FBS and 1% P/S and 1% L-glutamin, or CMRL 1066 supplemented with 10% FBS, 1% P/S and 1% L-glutamine and incubate in the CO2 incubator (5% CO2, 37C). Change culture medium every day. 3.3. Intra-portal Islet Transplantation
1. Thoroughly wipe down the surgical area and the surgical board with 70% ethanol. 2. Place the syringe and all sterile instruments within reach.
3.3.1. Setup
3.3.2. Procedure
3. Cut Avitene microfibrillar hemostat flour into small pieces (about 5 5 mm) and place them within reach. 1. Carefully swirl islets to the center of a Petri dish. 2. Draw up 0.5 mL sterile saline in 3-mL syringe, attach 25GA butterfly needle to syringe, fill saline in needle tubing. Expel air from syringe and butterfly. 3. Carefully and slowly aspirate all the islets into butterfly avoiding air bubbles, set aside within easy reach. 4. Inject Ketamine (80–100 mg/kg) and Xylazine (5–10 mg/ kg) to induce and maintain anesthesia for approximately 20 min. 5. Shave the abdomen and wipe with a 70% ethanol-soaked gauze pad. Position the mouse abdomen up and keep it in the position with its four limbs taped on the surgical board under the dissection microscope. 6. Open skin via long midline incision. 7. With the toothed forceps lift the muscle layer away from the vital organs and cut the muscle along the midline. Be careful not to cut through the rib cage or the diaphragm. 8. Retract the muscle and skin on each side by suture and tape the end to the surgical board. 9. Cover the intestine with wet gauze, carefully move the intestine to the left side to expose the Portal vein. 10. Hold the tissue adjacent to the portal vein with smooth forceps. This will stabilize the vein during injection. With other hand, insert butterfly needle into portal vein.
82
Chen and Kaufman
11. While holding butterfly in the portal vein, lay smooth forceps down, and using the hand, pick up the syringe. Very slowly inject the islets to portal vein. 12. After all the islets and about 500 mL saline (to make sure all the islets are injected) have been injected into portal vein, put the syringe down. Use the same hand to pick up the Avitene pieces with forceps and place them on top of the needle entrance site. Lay down the forceps and use a dry cottontipped applicator to press Avitene on the needle entrance site. At the same time, gently withdraw the needle and press the Avitene to stop bleeding. 13. Using moist cotton-tipped applicator, gently move intestine back to normal position. 14. Suture the muscle with 5-0 silk. Moisten the muscle layer and approximate the skin. Suture the skin with 5-0 silk. 3.4. Substrate Administration and Bioluminescence Imaging
1. In preparation for BLI, place mice in the gas anesthesia chamber that is designed to work with IVISTM, and anesthetize with 2.0% isofluorane in air that is delivered by an isoflurane vaporizer. 2. After the mice are anesthetized, injected i.p. the substrate luciferin potassium salt (see Note 3) and then place mice dorsal side up in the camera chamber where a controlled flow of 1.0–2.0% isofluorane in air is administered through a nosecone via the gas anesthesia system. 3. Minutes (see Note 4) after the injection of luciferin, image mice for a 1-minute duration on dorsal side at medium resolution with a field of view (FOV) of 20 cm. A gray-scale body 100000
80000 60000
40000
20000 Color Bar Min = 10000 Max = 1e+05
Fig. 7.1. Bioluminescent image of luciferase-positive islets post-intrahepatic transplant. Islets (150) isolated from Tg(RIP-luc) mice were transplanted to a syngeneic mouse via portal vein infusion. Bioluminescence image was obtained on day 14 posttransplantation.
Bioluminescent Imaging of Transplanted Islets
83
image is collected and overlaid by a pseudo-color image representing the spatial distribution of detected photons (Fig. 7.1). Photons per second of light from the liver from dorsal images can be quantified using selected sizes of regions of interest (ROI) (See Note 5). 4. Collect background images daily; background subtractions are automatically calculated by the Living Image software. The BLI signal intensities emitted from the liver region of the recipient mice are analyzed by IGOR IMAGE software (WaveMetrics, CA) and expressed in terms of photons per second.
4. Notes 1. Sources of luciferase-tagged islets and choices of recipient mice: besides the Tg(RIP-luc) mice, transgenic mice with islets expressing luciferase under the actin promoter or the GAPDH promoter can also be obtained from Xenogen and used as islet donors for transplantation and imaging. Since black animals reduce the sensitivity of BLI significantly as melanin in the skin and fur absorbs light, white or hairless mice are better suited for imaging. Younger mice with lower body weight are preferred islet recipients, as photons emitted by the transplanted islets can penetrate more efficiently from their internal organs. 2. Safety and precautions for handling of streptozotocin: wear a laboratory coat and protective gloves for handing streptozotocin, and a facemask for weighing the powder or weigh inside a fume hood. Waste generated from use of streptozotocin must be stored in suitable containers appropriately labeled as chemical hazard, so they can be properly disposed. The streptozotocin-injected mice must be kept in a study area for at least 6 h after the injection so that the waste bedding, which is contaminated with urinary excretions of streptozotocin, can be properly disposed. The animals must then be placed in newly bedded cages before being returned to the animal facility. 3. The luminescent signal intensities increase with increased amount of substrate luciferin administered. In general, at least 100 mg/g body weight of luciferin is needed to generate significant amount of emission of luminescence from the liver region where luciferase-expressing islets are transplanted. Luciferin administration at 100–400 mg/g body weight results in a dose-dependent increase in luminescence emitted (Fig. 7.2).
Chen and Kaufman
Luminescence intensity (fold increase)
84
3 2.5 2 1.5 1 0.5 0 0
100
200 300 Luciferin (g/kg BWT)
400
500
Fig. 7.2. Luciferin dose curve. A same mouse transplanted with 200 transgenic luciferase-positive islets in the liver was injected i.p. with 100, 200, 300, or 400 mg/mL of luciferin and subjected to BLI scanning. The BLI images were taken on the same day with time interval between each luciferin injection of 4 h so that the previously injected luciferin would be completely metabolized before the next injection. Luminescent signal intensities were measured and presented as photons per second in relationship to luciferin dose.
4. The magnitude of bioluminescence measured varied with time after the injection of luciferin. Luminescence can be detected in the liver region from the dorsal side of the mouse as early as 2 min after the administration of luciferin. The luminescence intensity peaks around 10 min, diminishes rapidly within the first hour and completely disappeared by 3–4 h. 5. BLI measurements are subject to some inherent limitations: Correlation of light emission to islet mass and function must take into consideration the factors that influence light transmission from the bioluminescent source to the CCD camera aperture. Factors influencing BLI measurements include surgical artifacts, motion (mouse positioning at the time of imaging) artifacts, and subject body weight artifacts. It is therefore important to include in the imaging system an internal control such as luminescent beads (4, 5). In vivo BLI measurements may also be influenced by graft site oxygen and ATP levels, revascularization, and by the amount of luciferin that actually reached the graft site (injection artifacts). Careful and consistent luciferin injection in terms of the amount and the location of injection is required in BLI analysis of islet transplantation.
Acknowledgment This work was supported by National Institutes of Health Grant DK063565(D.B.K.)andtheJuvenileDiabetesResearchFoundation.
Bioluminescent Imaging of Transplanted Islets
85
References 1. Shapiro, A. M., Ricordi, C., Hering, B. J., Auchincloss, H., Lindblad, R., Robertson, R. P., Secchi, A., Brendel, M. D., Berney, T., Brennan, D. C., Cagliero, E., Alejandro, R., Ryan, E. A., DiMercurio, B., Morel, P., Polonsky, K. S., Reems, J. A., Bretzel, R. G., Bertuzzi, F., Froud, T., Kandaswamy, R., Sutherland, D. E., Eisenbarth, G., Segal, M., Preiksaitis, J., Korbutt, G. S., Barton, F. B., Viviano, L., Seyfert-Margolis, V., Bluestone, J., and Lakey, J. R. (2006) International trial of the Edmonton protocol for islet transplantation.[see comment]. N Engl J Med 355, 1318–1330. 2. Chen, X., and Kaufman, D. B. (2004) Bioluminescence imaging of pancreatic islet transplants. Curr Med Chem 4, 301–308.
3. Chen, X., Zhang, X., Larson, C. S., Baker, M. S., and Kaufman, D. B. (2006) In vivo bioluminescence imaging of transplanted islets and early detection of graft rejection. Transplantation 81, 1421–1427. 4. Virostko, J. M. (2003) Assessment of Pancreatic Islet Transplantation Using In Vivo Bioluminescence Imaging. Thesis Submitted to the Faculty of the Graduate School of Vanderbilt University. 5. Virostko, J., Chen, Z., Fowler, M., Poffenberger, G., Powers, A. C., and Jansen, E. D. (2004) Factors influencing quantification of in vivo bioluminescence imaging: application to assessment of pancreatic islet transplants. Mol Imaging: Official J Soc Mol Imaging 3, 333–342.
Chapter 8 Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cell Survival, Proliferation, and Fate Kitchener D. Wilson, Mei Huang, and Joseph C. Wu Abstract The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging, and specifically bioluminescent reporter gene imaging, has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatiotemporal kinetics of hESC engraftment and proliferation in living subjects. In this chapter, the specific materials and methods needed for tracking stem cell proliferation with bioluminescence imaging will be described. Key words: Human embryonic stem cells, molecular imaging, reporter gene, bioluminescence, luciferase.
1. Introduction Controlled differentiation of human embryonic stem cells (hESCs) has given medical science the tantalizing prospect of creating virtually any cell type in the body. The ability to differentiate hESCs has already been demonstrated in cardiac (1, 2), neuronal (3, 4), and pancreatic islet (5) cells, among others. Though still in its infancy, clinicians and scientists envision a future in which diseased or lost tissue is ‘‘regenerated’’ using differentiated hESCs, thus offering revolutionary treatments for such intractable diseases as heart failure, neurological injury, and P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_8, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
87
88
Wilson, Huang, and Wu
diabetes. Tissue regeneration using hESCs has understandably generated significant excitement in the scientific community and general public. Before hESC-derived cell regeneration becomes clinically relevant, however, several basic biologic hurdles must be overcome – namely cell death or apoptosis following transplantation of differentiated cells, teratoma formation from undifferentiated cells, and immune rejection by the host organism. These and other challenges highlight the need for tracking hESC engraftment, survival, and proliferation within the recipient organism. The development of molecular imaging techniques such as the bioluminescent firefly luciferase (fluc) reporter gene and ultrasensitive charged-coupled device (CCD) cameras has enabled noninvasive, repetitive assessment of cell location, migration, proliferation, and differentiation in vivo (6). In this chapter we will give a brief background on bioluminescence reporter genes, as well as a detailed protocol for effectively tracking transplanted hESC proliferation in living organisms. 1.1. Concept of Reporter Gene Imaging
In general, molecular imaging is noninvasive, quantitative, and repetitive imaging of targeted macromolecules and biological processes in living organisms (7). To do this, a variety of molecular probes are used whose concentration and/or spectral properties are altered by specific biological processes. These probes may be photon-emitting, as in the case of bioluminescence, or directly labeled with radioisotopes for positron emission tomography (PET) and single-photon emission computed tomography (SPECT) imaging. A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multimodality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell’s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins are detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin, as will be described below.
1.2. Limitations of Fluorescent Proteins for In Vivo Cell Tracking
Fluorescent reporter genes include enhanced green fluorescent protein (EGFP), monomeric red fluorescent protein (mRFP), yellow fluorescent protein (YFP), and cyan fluorescent protein (CYP), among others (8). While commonly used for identifying and sorting cell populations with fluorescence-activated cell sorting (FACS), fluorescence imaging is unable to reliably track transplanted cells in vivo for several reasons. Fluorophores require
Human Embryonic Stem Cell Survival, Proliferation, and Fate
89
excitatory light in order to emit light (at a different wavelength). But excitatory light itself is limited by photon scatter and absorption in tissues, and so cannot penetrate tissues more than a few millimeters at sufficient intensity. Furthermore, excitatory light produces an unacceptable level of background signal. To avoid these issues, investigators typically identify fluorescent proteinexpressing cells in post-mortem tissues samples using histologic techniques rather than in vivo imaging. This requires the sacrifice of a large number of animals to overcome sampling error, and does not allow for longitudinal monitoring of cell survival and proliferation. 1.3. Luciferase
To avoid the need for excitatory light to track stem cells in vivo, bioluminescence reporter gene imaging systems have been developed, which require only an exogenously administered probe to induce light emission (9). Firefly luciferase (fluc), derived from the firefly Photinus pyralis, encodes an enzyme that, in the presence of ATP and O2, catalyzes D-luciferin to the optically active metabolite, oxyluciferin (Fig. 8.1). Optical activity can then be monitored longitudinally with an ultrasensitive cooled CCD camera (Fig. 8.2). Although other luciferases exist, such as renilla luciferase (rluc) (10), our laboratory has significant experience and success with fluc, the best studied of the luciferases. Compared to other modalities such as PET and MRI, bioluminescence has limited spatial resolution and reduced tissue penetration due to the relatively weak energy of emitted photons
Fig. 8.1. Overview of optical reporter gene imaging. Cells expressing the humanized fusion reporter gene will generate fusion proteins that can emit both fluorescence and bioluminescence signal after appropriate stimulation with excitatory light or exogenously administered probe such as D-luciferin.
90
Wilson, Huang, and Wu
Fig. 8.2. IVIS 200 Imaging System (Caliper Life Sciences, Hopkinton, MA, left) at Stanford’s Center for In Vivo Imaging (SCI3 ).
(2–3 eV); for these reasons, it has thus far not been applicable in large animals. However, bioluminescence has the advantage of being low-cost, high-throughput, and non-invasive, making it highly desirable for in vivo stem cell tracking in small animals. Furthermore, to increase its activity a number of improvements have been made to fluc. Tisi et al. developed a thermostable mutant luciferase with a longer half-life at 37C compared to wild-type luciferase (11). Additionally, deletion of the peroxisome localization signal of the mutated gene has resulted in increased cytoplasmic enzyme concentrations and increased bioluminescence signal (12). These improvements enable effective in vivo cell proliferation studies for many months after transplantation. 1.4. Fusion Constructs
Non-bioluminescence reporter genes, such as PET and fluorescence constructs, may be used in conjunction with luciferase to create a ‘‘fusion’’ reporter gene that is composed of different domains containing the individual reporter genes. For example, our group uses a fusion construct containing fluc, monomeric red fluorescent protein (mrfp), and Herpes simplex virus truncated thymidine kinase (ttk, a PET reporter gene) for multimodality tracking of stem cell behavior in small animals (13–15). This fusion construct causes no significant adverse effects on mouse ESC viability, proliferation, differentiation, or protein expression (16). We have also constructed a ‘‘humanized’’ double-fusion reporter gene, hfluc-hrgfp (Fig. 8.3a), which contains modified versions of
Human Embryonic Stem Cell Survival, Proliferation, and Fate
91
Fig. 8.3. (a) The double-fusion construct cassette containing humanized firefly luciferase (hfluc) and green fluorescent protein (hrgfp) as part of a lentiviral vector used for stable transduction of hESCs. (b) Bright field of hESCs. (c) Expression of GFP from hESCs-hFluc-hrGFP (nuclei stained with DAPI). (d) Firefly signal of hESCs-hFluc-hrGFP cells at different cell numbers. (e) Calibration curve from in vitro imaging analysis of stably transduced hESCs (r2 = 0.99). This positive correlation between cell number and bioluminescent signal confirms the quantitative ability of bioluminescence imaging for tracking cell proliferation. (f) Bioluminescence imaging of 1 million undifferentiated hESCs injected into rat myocardium. After the initial injection, most cells die during the following week, as indicated by a decrease in bioluminescence over the heart region (black arrow). The hESCs that survive transplantation ultimately form a teratoma in the heart, which can be visualized as a rapidly increasing bioluminescence signal starting at around day 14. Of note, at day 7 there is a second region of bioluminescence (red arrow), which shows extra-cardiac leakage of hESCs into abdominal organs such as the liver.
fluc (Promega, Madison, WI) and gfp (Stratagene, La Jolla, CA) that have codons and other regulatory regions optimized for mammalian systems. Several caveats to fusion reporter genes should be noted (12, 15). In addition to using reporter gene mutations optimized for stability, cytoplasmic localization, and high enzymatic activity, one must ensure that the linker sequences joining each individual domain are stable and resistant to cleavage in vivo. Additionally, we advise against the use of multimeric fluorescent proteins such as tetrameric RFP (DsRed2) in fusion constructs, which may impose structural and functional limitations on the enzymatic activity of the Fluc component of the fusion protein.
92
Wilson, Huang, and Wu
1.5. Stable Transfection and Transduction of Reporter Genes
Reporter gene constructs can be incorporated into hESCs using either viral or non-viral vectors. Among non-viral methods, lipofection (17) and electroporation (18) have resulted in relatively low transfection efficiency, although nucleofection (19, 20) has recently been shown to transfect hESCs well. Viral vectors such as lentivirus and retrovirus tend to yield significantly higher transduction efficiency (21, 22). However, both lentiviral- and retroviral-mediated transduction cause random integration in the chromosome and so increase the risk of insertional mutagenesis. Thus, in the future, site-specific integration of reporter genes into loci distanced from proto-oncogenes will be necessary to avoid these drawbacks (23). Over time, stably integrated reporter genes may be subject to gene silencing by the endogenous chromosomal machinery. A reporter gene’s susceptibility to gene silencing is closely related to the choice of promoter driving its expression. For instance, the cytomegalovirus promoter (pCMV) is quickly silenced in hESCs (24). Our laboratory has had good success with the human ubiquitin-C promoter (pUbiC) to drive expression of a double-fusion construct in multiple hESC cell lines, and have observed minimal signal loss over time (13, 25).
1.6. In Vivo Bioluminescence Imaging of Cell Proliferation
hESCs and other cell lines stably transduced with the double fusion (hfluc-hrgfp) reporter gene can be isolated based on fluorescent protein expression with FACS. These stably transduced cells carry the reporter constructs within their chromosomal DNA and can therefore pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal, apoptotic or dead cells will not. Figure 8.3b, c, d, e shows the quantitative ability of bioluminescence signal for tracking cell proliferation and number in vitro. Figure 8.3f demonstrates longitudinal in vivo tracking of hESC proliferation using bioluminescence reporter gene imaging.
1.7. Comparison of Bioluminescence Reporter Gene Imaging with Iron Particle Labeling for In Vivo Proliferation Studies
To compare bioluminescence and magnetic resonance (MR) imaging for tracking cell proliferation in vivo, our laboratory colabeled hESCs and hESC-derived endothelial cells (hESC-ECs) with the double-fusion reporter gene and superparamagnetic iron oxide particles before transplantation to murine hindlimbs (26). As expected, longitudinal MR imaging showed persistent signal in both cell populations that lasted up to 4 weeks, demonstrating the limitations of iron particles for following cell proliferation. By contrast, bioluminescence imaging showed divergent signal patterns for hESCs and hESC-ECs. In particular, bioluminescence signal from hESC-ECs decreased progressively over 4 weeks,
Human Embryonic Stem Cell Survival, Proliferation, and Fate
93
whereas bioluminescence signals from undifferentiated hESCs increased dramatically during the same period. Post-mortem histology and immnohistochemistry confirmed teratoma formation after injection of undifferentiated hESCs, but not hESC-ECs. Taken together, we concluded that luciferase reporter genes are a better method for monitoring cell proliferation in vivo.
2. Materials 2.1. Viral Particle Development
1. 293FT (human embryonic kidney fibroblast) cell growth medium: Dulbecco’s Modified Eagle’s Medium (DMEM) minimal essential media (MEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin (100 mg/mL)/ streptomycin (292 mg/mL). 2. 2.5 M CaCl2 stock solution (sterilize through a 0.45-mm filter and store at –20C). 3. 2 HBS buffer saline: 100 ml 2 HBS containing 1 g Hepes acid, 1.6 g NaCl, 0.72 mL Na2HPO4 (0.25 M), 1 mL KCl (1 M). Mixed together, pH to 7.12 with NaOH, then bring volume to 100 mL with ddH2O. Filter sterilize (using 0.2-mm syringe filter), aliquot 10 ml each, and freeze (–20C). 4. 2 BES-buffered saline: 50 mM BES (pH 6.95), 280 mM NaCl, and 1.5 mM Na2HPO4. Sterilize filter and store at –20C. The pH can be adjusted with HCl at room temperature. 5. 10 mM chloroquine, keep in dark and freeze. 6. 1 citric saline, diluted from 10 stock. 10 stock: 1.35 M KCl 0.015 M sodium citrate, autoclave and store at 4C. 7. HIV-1 packaging vector (pAX2)(pCMVR8.2) and Vesicular stomatitis virus G glycoprotein-pseudotyped envelop vector (pMD2G)(pMD.G) (gift from Dr. Sanjiv Gambhir, Stanford University, CA, see Note 1). 8. 8 mg/mL Polybrene (Store at –20C). 9. Ultracentrifuge.
2.2. hESC Maintenance and Culture
1. 0.1% Gelatin solution: Add 0.5 g gelatin to 500 mL endotoxin-free water and autoclave before using. Do not use glass bottles that have received detergent. Glass bottles should be cleaned with NaOH when first obtained and dedicated to sterile gelatin solution storage. 2. B-FGF solution: Add 10 mg human recombinant bFGF (Invitrogen) to 5 mL of 0.1% BSA in PBS.
94
Wilson, Huang, and Wu
3. 200 mM L-glutamine þ 2 mercaptoethanol solution: Add 7 mL of 2-mercaptoethanol to 5 mL of 200 mM L-glutamine in fume hood. L-Glutamine aliquots should be kept frozen and thawed immediately before use. 4. Frozen mouse embryonic fibroblasts. 5. Mouse embryonic fibroblast (MEF) culture medium: Mix 450 mL of high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM), 50 mL of fetal bovine serum (FBS) that has been heat inactivated for 30 min at 56C, and 5 mL of 100 nonessential amino acids solution. Sterilize filter and store at 4C. 6. hESC culture medium: Mix 200 mL DMEM-F12 medium with 50 mL of Knockout Serum Replacer, 1.25 mL of 200 mM L-glutamine þ 2-mercaptoethanol solution, 2.5 mL of 100 non-essential amino acids solution, and 1 mL of bFGF solution (2 mg/mL). 7. 0.05% Trypsin-EDTA solution. 8. Collagenase IV solution: Dissolve 30 mg Collagenase Type IV in 30 mL DMEM-F12 media. Sterilize filter and store at 4C. 9. BD MatrigelTM basement membrane matrix, growth factor reduced (BD Biosciences). 10. Phosphate buffered saline (PBS). 11. Swinging bucket centrifuge (able to hold 15 mL conical tubes). 12. Sterile tissue culture hood. 13. Humidified incubator set at 37C and 5% CO2. 14. Aspirator. 15. Baked Pasteur pipettes. 16. 150 20 mm tissue culture dish (TPP1 ca. no. 93150). 17. Frozen stock of MEF (can be derived from CF-1 strain timely pregnant mice or bought commercially). 18. Microscope. 19. Radiation source to provide 6,000 rads of exposure (such as the Mark I 137-Cesium irradiator).
3. Methods 3.1. Construction of Double-Fusion Reporter Gene
Construction of the double-fusion reporter gene has been published. The focus of this chapter is on its application, so detailed procedures are not provided here. However, the general strategy pursued in creating the construct is provided below to assist anyone wishing to generate similar materials.
Human Embryonic Stem Cell Survival, Proliferation, and Fate
95
Mutations to enhance thermostability (11) and remove the peroxisome localization sequence (12) can be performed on commercially available luciferases, such as pCDNA 3.1-CMV-hrl or CMV-fluc (Promega, Madison, WI). Our laboratory’s doublefusion construct vector contains hfluc and hrgfp (Stratagene, La Jolla, CA), separated by a 15-bp spacer within pCDNA 3.1þ. Plasmid CMV-fluc (without stop code) is digested with BamHI and NotI and ligated in frame to the PCR-amplified, BamHI/ NotI-digested hrgfp gene fragment (with stop codon) from the pEGFP-N1 vector to generate the double-fusion hfluc-hrgfp construct. 3.2. Production of Virus Carrying the DoubleFusion Reporter Gene 3.2.1. Construction of Lentiviral Vector
3.2.2. 293FT Cell Culture
The double-fusion gene was originally located downstream of the cytomegalovirus promoter in pCDNA 3.1(+). This 3.3-kbp fragment was excised using NdeI and NotI digestion, and subsequently blunt-end ligated into the multiple cloning site of the lentiviral transfer vector FUG. FUG is a self-inactivating (SIN) lentiviral vector lacking viral promoter and enhancer sequences, thus preventing mobilization of replication-competent virus. A schema of the lentiviral vector is depicted in Fig. 8.3a. 1. Culture 293FT cells in growth medium. 2. Trypsinize and seed 293FT cells at 5 105 cells per 10-cm plate. 3. Incubate overnight in 10 mL of growth medium.
3.2.3. 293FT Cell Transfection
293FT cells are transiently transfected using the standard calcium phosphate method (27). 1. Mix 15 mg pFUG-DF (containing the double fusion construct), 10 mg HIV-1 packaging vector (pAX2)(pCMVR8.2), and 5 mg vesicular stomatitis virus G glycoprotein-pseudotyped envelop vector (pMD2G) (pMD.G) (28, 29), with 0.5 mL of 0.25 M CaCl2. 2. Add 0.5 mL 2 HBS. 3. Incubate at room temperature for 20–30 min. 4. Add the calcium phosphate–DNA solution to a plate of 293FT cells dropwise and swirl gently to mix. 5. Incubate the cells for 15–24 h in tissue culture incubator before aspirating media and refeeding cells with fresh medium. 6. About 48–72 h after transfecting the cells, harvest the lentivirus-containing supernatant. 7. Centrifuge the supernatant at low speed (800g for 10 min at 4C) (1340g for 5 min), and purify by passing it through a 0.45-mm filter.
96
Wilson, Huang, and Wu
8. Concentrate the lentivirus by sediment centrifugation of the medium with an SW28 rotor at 50,000g for 2 h at 4C. 9. After centrifugation, dissolve the viral pellets in 1/100th volume 100 mL of serum-free medium and store at –70C. 3.3. Human ESC Maintenance In Vitro (see Note 2) 3.3.1. MEF Feeder Layer 3.3.1.1. Culture of Mouse Embryonic Fibroblasts (MEF)
1. Remove a vial of frozen stock MEF (passage 1–3) from –80C freezer and roll between hands. 2. Immerse the vial in a 37C water bath to thaw the cells. 3. Spray with 95% ethanol to disinfect and allow vial to air dry in sterile tissue culture hood. 4. Transfer the cells to a 15-mL conical tube. 5. Add 4 mL of MEF culture media to the 15-mL conical tube and pipette up and down gently to mix. 6. Transfer the cell suspension to a 150 20-mm Petri dish that is not coated with gelatin. 7. Place the dish in an incubator and monitor the cell density daily.
3.3.1.2. Split MEF Cells
1. Aspirate the MEF culture media. The cell monolayer should remain attached to the plastic surface. 2. Wash the dish with 5 mL of PBS. Aspirate the PBS. 3. Add 3 mL 0.05% Trypsin-EDTA solution. Let it sit at room temperature for 3–5 min. 4. Dislodge the cells from the bottom of the dish by quickly moving the dish back and forth and washing the dish bottom by pipetting. Continue until you can see that the cell layer is dislodged. 5. Add 5 mL of MEF culture media. The media contains serum and will inhibit further trypsin action. 6. Mix well to form a cell suspension. Pool all the cells into one 50-mL conical tube. 7. Add MEF media as needed (40-mL for one plate) for a total of approximately 50 mL and mix thoroughly. 8. Add 10 mL of the resulting cell suspension to each of five new 150 20-mm cell culture dishes.
3.3.1.3. Gelatin-Coated Plates
1. Autoclave a 0.1% gelatin solution for 30 min. The gelatin will solubilize. Store this solution at room temperature. 2. Place 1 mL of the gelatin solution into each well of a 6-well plate, or use 6 mL gelatin solution for each 100 20-mm cell culture dish. 3. Place the plates in 37C incubator at least 2 h or overnight until needed. 4. Aspirate the remaining gelatin solution from each plate prior to plating MEF.
Human Embryonic Stem Cell Survival, Proliferation, and Fate 3.3.1.4. Trypsinize, Count, and Irradiate MEF Cells (see Note 3)
97
1. Aspirate the MEF media from the cell culture dishes (150 20 mm). 2. Wash the cells with 5 mL of PBS. 3. Add 3 mL 0.05% Trypsin-EDTA solution for 3–5 min. 4. Dislodge cells from cell culture dish by shaking as before. 5. Add 5 mL of MEF culture media to the dish. 6. Mix to form cell suspension. Pool all cells into one cell culture dish. 7. Remove 0.5–1 mL of the suspension and transfer it to a 15-mL conical tube. 8. Pipette cell suspension vigorously to break up cell aggregates. 9. Remove 20 mL cell suspension and count cells with a hemocytometer to determine the concentration of cells per milliliter in your sample. 10. Determine how many cells you will need to make new feeder plates. Normally, feeder plate density is 2 105 MEF cells/mL. 11. Remove the appropriate volume of cell suspension containing the above-calculated number of cells and transfer to it into a 15-mL conical tube. Add PBS as necessary to obtain desired concentration of cells. If the MEFs are under passage 4, MEFs that are not to be irradiated can be plated into sterile tissue culture dishes. 12. Irradiate the cells. The rads of exposure needed to inactivate MEF cell batches may vary, but is usually between 5,000 and 8,000 rads. We typically irradiate MEF cells at 6,000 rads. 13. Centrifuge the irradiated cells for 5 min at 200g. 14. Remove the supernatant. 15. Resuspend the cells at 106 cells/mL in MEF culture media. Use the cell count calculations made prior to irradiation.
3.3.1.5. Plate MEF Feeder Layer onto Gelatin-Coated Plates
1. Further dilute the cell suspension of irradiated MEF to the required cell concentration. 2. Remove the gelatin-coated plates prepared in Section 3.3.1.3 from the incubator and aspirate any excess gelatin. 3. Add the cell suspension dropwise to each well of the plate. 4. Place the plates into an incubator and allow cells to attach overnight.
3.3.2. hESCs
1. Remove a vial of hESCs from liquid nitrogen storage. Roll the vial between fingers to remove frost (see Note 4).
3.3.2.1. hESC Culture
2. Immerse the vial in a 37C water bath to thaw cells. 3. Spray the vial with 95% ethanol to disinfect the surface.
98
Wilson, Huang, and Wu
4. Gently pipette the cells into a 15-mL conical tube. 5. Slowly add 4 mL of hESC culture media dropwise to the hESCs to avoid osmotic shock (The suspension is diluted to reduce the DMSO concentration.). Gently shake the tube to mix cells. 6. Centrifuge the cells at 200g for 5 min. 7. Remove and discard the DMSO-containing supernatant. 8. Gently resuspend the cell pellet in 2.5 mL of hESC culture media. 9. Add 2.5 mL cell suspension drop-wise into one well of a 6-well tissue culture plate containing a MEF feeder layer (prepared in Section 3.3.1.5, see Note 5) 10. Place the plate in a 37C incubator. 11. Refresh hESC culture media daily. 3.3.2.2. Split hESCs
1. Cells should be split when either the MEF feeder layer is 2-weeks-old, or hESC colonies become too large or too dense. 2. Aspirate the spent media from well. 3. Add 1 mL freshly made collagenase IV solution (1 mg/mL) to each well of the 6-well plate and incubate at 37C for at least 5 min. Confirm that colonies have partly separated from the plate by observing that the colony edges appear folded back under the microscope. 4. Remove the collagenase solution and replace with 1 mL fresh hESC culture medium. 5. Use a cell scraper to scrape cells off the surface of the plate. Pipette the cell suspension up and down to wash the cells off of the surface of the plate. 6. Pool the suspension in a 15-mL conical tube. 7. Wash each well with 1 mL hESC media and transfer wash to a 15-mL conical tube. Gently pipette to mix. Discard the used plate. Wait at room temperature for 15 min and allow hESC clumps to settle to bottom of tube before gently aspirating supernatant. Old MEF cell contamination is contained in the supernatant. 8. Add 2 mL of fresh medium and centrifuge broken-up cell colonies at 200g for 5 min. 9. Aspirate the supernatant. 10. Wash the cell pellet with 2–3 mL hESC media and gently reconstitute pellet. 11. Centrifuge again at 200g for 5 min. 12. While hESCs are centrifuging, aspirate MEF media from fresh feeder plates.
Human Embryonic Stem Cell Survival, Proliferation, and Fate
99
13. Add about 1 mL of PBS to each well of the fresh 6-well feeder plate to wash away serum. Do not keep PBS on MEF for more than 5–10 min. 14. Aspirate the supernatant from the pelleted hESCs and again gently resuspend the pellet in 2–3 mL hESC media (see Note 6). 15. Dilute the cell suspension with a sufficient volume of hESC media in order to ensure 2.5 mL cell suspension per well (15 mL cell suspension per 6-well plate). Mix well with a pipette. 16. Aspirate the PBS from wells of MEF feeder plate. 17. Add the cell suspension dropwise to each well of the plate. 18. Place the 6-well plate into the incubator. Move the plate in several quick, short, back-and-forth, and side-to-side motions to ensure an even distribution of cell colonies across each well. 19. Incubate the cells overnight to allow colonies to attach. Refresh hESC media daily. 3.4. Lentiviral Transduction
hESCs can be transduced 3–5 days after passage at a multiplicity of infection (MOI) of 10 (viral titer of approximately 107 incubated with 106 cells). 1. The thawed viral stock, mixed with 8 mg/mL polybrene, is added directly to fresh hESC media and incubated for 6–12 h. Then replace with fresh hESC medium. 2. After 48 h, transduction efficiency can be qualitatively assessed using fluorescence microscopy. Subsequently, FACS can be used to isolate infected cells (see Note 7).
3.5. In Vitro Bioluminescence Imaging of fluc+hESCs
For in vitro cell imaging, it is important to maintain sterile conditions. Therefore, the imaging system should be sterile, preferably in a cell culture room (see Note 8). 1. Before imaging, remove the cell media and add just enough PBS to cover the cells. For example, add 1 mL PBS to each well of a 6-well plate containing the hESC cultures, followed by 10 mL of the reporter probe D-luciferin (45 mg/mL). Note that the ratio of D -Luciferin to PBS should be 1:100. 2. Wait 1 min, then acquire an image using an exposure time of 1 s. If signal is weak, increase the exposure interval and try again. 3. The bioluminescent signal reflects cell number, so quantitation assays can be performed, which correlate signal with different cell numbers.
3.6. Preparation of Mouse and Injecting fluc+ hESCs for In Vivo Imaging
1. When cells are ready for transplantation, use collagenase IV to loosen the cells, wash several times with PBS, and suspend them in a 1:1 mixture of growth factor reduced Matrigel and DMEM (see Note 9).
100
Wilson, Huang, and Wu
2. Anesthetize the mouse with isoflurane. After 1–5 min, the mouse should be asleep and can be placed on the operating table with continuous isoflurane. 3. Because fur naturally auto-fluoresces and may obscure the bioluminescent image, remove hair from the site of cell injection either with an electric shaver or with the commercially available hair-removal gels. Wipe with alcohol to sterilize the skin afterward. 4. Draw up fluc+hESC suspension in a syringe. The 23–27 gauge needles work best since they will not clog up with cells. If the needle is too large (<23 gauge), the needle tract may leave a large hole through which cells can leak back out. 5. Inject cells into desired location of mouse. For subcutaneous injections, use thumb and forefinger to pinch and stretch out the skin prior to injection. Inject cells just under the skin, taking care not to puncture too deeply. Also, avoid sliding the needle out of the injection site while depressing the plunger – this will prevent creating a hole in the skin through which the cells can leak. 6. After injection, wait several hours to allow the mouse to recover before re-anesthetizing for bioluminescence imaging. Doing so avoids isoflurane toxicity.
3.7. In Vivo Bioluminescence Imaging of Transplanted fluc+ hESCs
1. For whole-animal bioluminescence imaging of transplanted fluc+hESCs, first perform an intraperitoneal injection of the reporter probe D-luciferin (375 mg/kg body weight). Inject the D-luciferin in the peritoneum, just off the midline. Avoid injecting too deep and damaging internal organs. 2. Image animals for 20–40 min using 1–5 min acquisition intervals (see Note 10). 3. When satisfied with images, remove the mouse from isoflurane and allow it to recover. Usually, the mouse should wake up within 15 min. 4. Bioluminescence is quantified in units of photons per second per centimeter square per steridian (p/s/cm2/sr). The reporter probe can be administered before each imaging session, allowing for multiple imaging acquisitions of the same animal over time (Fig. 8.3f, ref (13)). 5. After the desired time course of bioluminescence images is acquired, the animal may be sacrificed and tissue sections used for histology (see Note 11).
Human Embryonic Stem Cell Survival, Proliferation, and Fate
101
4. Notes 1. Plasmids containing genes that produce the lentiviral packaging proteins (gag/pol and rev) and the VSV-G envelope protein are also commercially available as a ViraPowerTM Packaging Mix (Invitrogen). 2. In our group, hESCs are mainly cultured on a mouse embryonic fibroblast (MEF) feeder layer according to protocols obtained from the WiCell Research Institute. To eliminate MEFs, hESCs can be cultured in a feeder-free in vitro system with the use of Matrigel1 and MEF-conditioned medium (30). 3. Here, we describe the inactivation of the MEF cells by irradiation. Alternatively, one may use mitomycin-C to inactivate MEFs (31), although we find irradiation to be more reliable. 4. Be sure to wear eye protection as vials may explode after being kept in liquid nitrogen. 5. Confirm under the microscope that the MEF feeder layer has been plated at the appropriate confluency prior to plating hESCs. If by visual inspection it is apparent that MEF cells are still proliferating, MEF cells may be re-irradiated while in the tissue culture dish (before hESCs have been plated), although this is not generally advised. 6. Do not attempt to break up cell clumps to a single-cell suspension at this time. Ideally, hESCs should remain as clumps of approximately 100 cells that are easily visualized by the unaided eye by holding the 15-mL conical tube against a light source. 7. To determine the infectivity after 48 h, we detect GFP expression as analyzed on FACScan (BD Bioscience, San Jose, CA). After dissociating hESCs into a single-cell suspension, the RFP-positive cell populations can be isolated by FACS (Becton Dickinson Immunocytometry Systems, San Jose, CA), and subsequently plated on feeder layer cells for long-term culturing (to select stably transduced cells, for example). Flow cytometry data can be analyzed with FlowJo analysis software (Treestar, San Carlos, CA). 8. For cell and animal bioluminescence imaging, we use the Xenogen In Vivo Imaging System (IVIS) (Fig. 8.2) as described (32). 9. The simplest method is to inject hESCs that express the firefly luciferase reporter gene subcutaneously into the dorsal sides of SCID mice. For each injection, inject 200,000 to 1 million
102
Wilson, Huang, and Wu
cells suspended in a 25–100 ml volume of Matrigel/DMEM mixture. The cell number and volume can be adjusted depending on application. Keep cell suspensions on ice prior to injection. 10. During the 30-min acquisition of bioluminescence signal, the peak in fluc activity is used as the final intensity value. Maximum activity is usually observed within 15–25 min after luciferin injection. 11. A variety of tissue preparation techniques may be used. Excised organs may be immersion fixed in 4% paraformaldehyde (Sigma) in PBS at pH 7.4 for 1–2 h and then immersed in 30% sucrose overnight, embedded in OCT, frozen, and prepared into 10-m thick frozen sections with a 5,030 series Microtome (Bright Instruments, Huntingdon, England). Endogenous GFP signals may be amplified for immunohistochemical analysis with Alexa Fluor 488-conjugated antiGFP polyclonal antibody (Molecular Probes). References 1. Passier, R., Oostwaard, D. W., Snapper, J., Kloots, J., Hassink, R. J., Kuijk, E., Roelen, B., de la Riviere, A. B., and Mummery, C. (2005) Increased cardiomyocyte differentiation from human embryonic stem cells in serum-free cultures. Stem Cells 23, 772–780. 2. Laflamme, M. A., Chen, K. Y., Naumova, A. V., Muskheli, V., Fugate, J. A., Dupras, S. K., Reinecke, H., Xu, C., Hassanipour, M., Police, S., O’Sullivan, C., Collins, L., Chen, Y., Minami, E., Gill, E. A., Ueno, S., Yuan, C., Gold, J., and Murry, C. E. (2007) Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nat Biotechnol 25, 1015–1024. 3. Baharvand, H., Mehrjardi, N. Z., Hatami, M., Kiani, S., Rao, M., and Haghighi, M. M. (2007) Neural differentiation from human embryonic stem cells in a defined adherent culture condition. Int J Dev Biol 51, 371–378. 4. Schulz, T. C., Palmarini, G. M., Noggle, S. A., Weiler, D. A., Mitalipova, M. M., and Condie, B. G. (2003) Directed neuronal differentiation of human embryonic stem cells. BMC Neurosci 4, 27. 5. Jiang, J., Au, M., Lu, K., Eshpeter, A., Korbutt, G., Fisk, G., and Majumdar, A. S. (2007) Generation of insulin-producing islet-like clusters from human embryonic stem cells. Stem Cells 17, 17.
6. Swijnenburg, R. J., van der Bogt, K. E. A., Sheikh, A. Y., Cao, F., and Wu, J. C. (2007) Clinical hurdles for the transplantation of cardiomyocytes derived from human embryonic stem cells: role of molecular imaging. Curr Opin Biotechnol 18, 38–45. 7. Herschman, H. R. (2003) Molecular imaging: looking at problems, seeing solutions. Science 302, 605–608. 8. Lippincott-Schwartz, J., and Patterson, G. H. (2003) Development and use of fluorescent protein markers in living cells. Science 300, 87–91. 9. Contag, P. R., Olomu, I. N., Stevenson, D. K., and Contag, C. H. (1998) Bioluminescent indicators in living mammals. Nat Med 4, 245–247. 10. Bhaumik, S., and Gambhir, S. S. (2002) Optical imaging of Renilla luciferase reporter gene expression in living mice. Proc Natl Acad Sci USA 99, 377–382. 11. Tisi, L. C., White, P. J., Squirrell, D. J., Murphy, M. J., Lowe, C. R., and Murray, J. A. H. (2002) Development of a thermostable firefly luciferase. Anal Chim Acta 457, 115–123. 12. Ray, P., Tsien, R., and Gambhir, S. S. (2007) Construction and validation of improved triple fusion reporter gene vectors for molecular imaging of living subjects. Cancer Res 67, 3085–3093. 13. Cao, F., Lin, S., Xie, X., Ray, P., Patel, M., Zhang, X., Drukker, M., Dylla, S. J.,
Human Embryonic Stem Cell Survival, Proliferation, and Fate
14.
15.
16.
17.
18.
19.
20.
21.
22.
Connolly, A. J., Chen, X., Weissman, I. L., Gambhir, S. S., and Wu, J. C. (2006) In vivo visualization of embryonic stem cell survival, proliferation, and migration after cardiac delivery. Circulation 113, 1005–1014. Cao, F., Drukker, M., Lin, S., Sheikh, A. Y., Xie, X., Li, Z., Connolly, A., Weissman, I., and Wu, J. C. (2007) Molecular imaging of embryonic stem cell misbehavior and suicide gene ablation. Cloning Stem Cells 9, 107–117. Ray, P., De, A., Min, J. J., Tsien, R. Y., and Gambhir, S. S. (2004) Imaging tri-fusion multimodality reporter gene expression in living subjects. Cancer Res 64, 1323–1330. Wu, J. C., Cao, F., Dutta, S., Xie, X., Kim, E., Chungfat, N., Gambhir, S., Mathewson, S., Connolly, A. J., Brown, M., and Wang, E. W. (2006) Proteomic analysis of reporter genes for molecular imaging of transplanted embryonic stem cells. Proteomics 6, 6234–6249. Eiges, R., Schuldiner, M., Drukker, M., Yanuka, O., Itskovitz-Eldor, J., and Benvenisty, N. (2001) Establishment of human embryonic stem cell-transfected clones carrying a marker for undifferentiated cells. Curr Biol 11, 514–518. Mohr, J. C., de Pablo, J. J., and Palecek, S. P. (2006) Electroporation of human embryonic stem cells: small and macromolecule loading and DNA transfection. Biotechnol Prog 22, 825–834. Siemen, H., Nix, M., Endl, E., Koch, P., Itskovitz-Eldor, J., and Brustle, O. (2005) Nucleofection of human embryonic stem cells. Stem Cells Dev 14, 378–383. Lakshmipathy, U., Pelacho, B., Sudo, K., Linehan, J. L., Coucouvanis, E., Kaufman, D. S., and Verfaillie, C. M. (2004) Efficient transfection of embryonic and adult stem cells. Stem Cells 22, 531–543. Ma, Y., Ramezani, A., Lewis, R., Hawley, R. G., and Thomson, J. A. (2003) High-level sustained transgene expression in human embryonic stem cells using lentiviral vectors. Stem Cells 21, 111–117. Menendez, P., Wang, L., Chadwick, K., Li, L., and Bhatia, M. (2004) Retroviral transduction of hematopoietic cells differentiated from human embryonic stem cell-derived CD45(neg)PFV hemogenic precursors. Mol Ther 10, 1109–1120.
103
23. Thyagarajan, B., Liu, Y., Shin, S., Lakshmipathy, U., Scheyhing, K., Xue, H., Ellerstr¨om, C., Strehl, R., Hyllner, J., Rao, M. S., and Chesnut, J. D. (2008) Creation of engineered human embryonic stem cell lines using phiC31 integrase. Stem Cells 26, 119–126. 24. Liew, C. -G., Draper, J. S., Walsh, J., Moore, H., and Andrews, P. W. (2007) Transient and stable transgene expression in human embryonic stem cells. Stem Cells 25, 1521–1528. 25. Krishnan, M., Park, J. M., Cao, F., Wang, D., Paulmurugan, R., Tseng, J. R., Gonzalgo, M. L., Gambhir, S. S., and Wu, J. C. (2006) Effects of epigenetic modulation on reporter gene expression: implications for stem cell imaging. FASEB J 20, 106–108. 26. Li, Z., Suzuki, Y., Huang, M., Cao, F., Xie, X., Connolly, A.J., Yang, P.C., and Wu, J. C. (2008) Comparison of reporter gene and iron particle labeling for tracking fate of human embryonic stem cells and differentiated endothelial cells in living subjects. Stem Cells 4, 864–873. 27. Chen, C., and Okayama, H. (1987) Highefficiency transformation of mammalian cells by plasmid DNA. Mol Cell Biol 7, 2745–2752. 28. De, A., Lewis, X. Z., and Gambhir, S. S. (2003) Noninvasive imaging of lentiviralmediated reporter gene expression in living mice. Mol Ther 7, 681–691. 29. Naldini, L., Blomer, U., Gage, F. H., Trono, D., and Verma, I. M. (1996) Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc Natl Acad Sci USA 93, 11382–11388. 30. Xu, C., Inokuma, M. S., Denham, J., Golds, K., Kundu, P., Gold, J. D., and Carpenter, M. K. (2001) Feeder-free growth of undifferentiated human embryonic stem cells. Nat Biotechnol 19, 971–974. 31. Eiges, R. (2006) Genetic manipulation of human embryonic stem cells by transfection. Methods Mol Biol 331, 221–239. 32. Wu, J. C., Inubushi, M., Sundaresan, G., Schelbert, H. R., and Gambhir, S. S. (2002) Optical imaging of cardiac reporter gene expression in living rats. Circulation 105, 1631–1634.
Chapter 9 Detection of Apoptosis Using Cyclic Luciferase in Living Mammals Akira Kanno, Yoshio Umezawa, and Takeaki Ozawa Abstract Programmed cell death, apoptosis, is a crucial process involved in pathogenesis and progression of diseases, which is executed by cysteine aspartyl proteases (caspases). The caspase activities in living subjects and their regulation with small chemical compounds are of great interest for screening drug candidates or pathological agents. We describe a novel genetically encoded bioluminescent indicator for real-time imaging of caspase-3 activities in living cells and animals. The indicator is composed of an engineered firefly luciferase, of which the N- and C-terminal ends are linked with a substrate sequence of caspase-3 (Asp-Glu-Val-Asp). When activated caspase-3 digests the substrate sequence, the cyclized luciferase recovers its activity. The indicator provides a general means of evaluating effects of cytotoxic compounds or novel pharmacological chemicals and apoptosis. Key words: Apoptosis, caspases, imaging, luciferases, luminescence.
1. Introduction A programmed cell death, apoptosis, is an important chemical process in living systems (1–4). Improper apoptosis triggers many diseases such as Alzheimer’s disease, Huntington’s disease, ischemia, autoimmune disorders, and immortality of cancer cells (5, 6). The programmed cell death is executed by cysteine aspartyl proteases (caspases). Of many caspases that have been identified, caspase-3 is a crucial component of the apoptotic machinery (7–9). The spatiotemporal activity of caspase-3 and chemical compounds that inhibit or accelerate caspase-3 activity are of great concern. In this chapter, we describe a method for quantitative sensing of caspase-3 activity in living cells upon extracellular stimuli and for noninvasive imaging of caspase-3 activity in living mice (10). The P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_9, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
105
106
Kanno, Umezawa, and Ozawa
schematic structure of the indicator for monitoring caspase-3 is shown in Fig. 9.1. Two fragments of DnaE intein (11) are fused to flanking ends of Photinus pyralis luciferase (firefly luciferase; Fluc) connected with a substrate sequence of caspase-3, Asp-Glu-ValAsp (DEVD). After translation into a single polypeptide in living cells, the C- and N-terminals of the luciferase (Fluc-C and Fluc-N, respectively) are ligated by protein splicing, which results in a closed circular polypeptide chain (Fig. 9.2). Since the structure of the cyclic luciferase is distorted, the luciferase lacks in its bioluminescence activity. Meanwhile, unspliced indicator is digested due to the effect of the flanking PEST sequence. The PEST sequence is known to accelerate degradation of a fused protein (12). As a result, only the cyclic Fluc accumulates inside the cells. If caspase-3 digests the substrate sequence, the luciferase changes into an active form. The extent of caspase-3 activity is evaluated by measuring the bioluminescence of the reconstituted Fluc.
Fig. 9.1. A schematic structure of the cDNA construct. For an efficient protein splicing reaction, Cys-Phe-Asn-Ile-Ser (CFNIS) and Lys-Phe-Ala-Glu-Tyr-Cys (KFAEYC) sequences are inserted between DnaEc and Fluc-C and between Fluc-N and DnaEn, respectively. ‘‘Pro’’ means a promoter, other abbreviations are defined in the text. Italics refer to the genes of the corresponding proteins.
Fig. 9.2. Strategy for the detection of caspase-3 activity.
Detection of Apoptosis
107
2. Materials 2.1. Construction of DNA Plasmids
1. pcDNA3.1(þ) (Invitrogen, Groningen, The Netherlands). 2. The cDNA of Fluc (e.g., pGL3-Control or pGL4.13 available from Promega Co., Madison, WI) (see Note 1). 3. The cDNA of the N- and C-terminal DnaE intein (DnaEn and DnaEc, respectively). 4. The cDNA of amino acid residues 422–461 of mouse ornithine decarboxylase (MODC). MODC (422–461) is known as a PEST sequence available from pHcRed1-DR (d2PEST; Clontech Laboratories Inc., Palo Alto, CA), which accelerates degradation of a fused protein with a half-life time of 2 h (12). The cDNA of d2PEST is mutated for construction of a PEST sequence with a half-life time of 4 h (d4PEST) (see Note 2). 5. Oligonucleotide primers shown in Table 9.1.
Table 9.1 Oligonucleotide sequences of PCR primers including linkers used for constructing the cDNA of cyclic firefly luciferasea
a
Primer name
Primer sequence (50 –30 )
DnaEc forward primer
AAAGGATCCGCCACCATGGTTAAAGTTATCGGTCGT
DnaEc reverse primer
TTTAAGCTTCAATTGGCGGCGATCGCCCC
Fluc-C forward primer
AAAGGATCCAATTGTTTTAATATCTCATCCGGTTATGTAAACAAT
Fluc-C reverse primer
AAACTCGAGTCGACTTCATCCACGGCGATCTTTCCGCC
Fluc-N forward primer
AAACTCGAGTCGACACAGGGGCAGAAGACGCCAAAAACATA
Fluc-N reverse primer
TTTAAGCTTAGGCAATATTCCGCAAACTTTCCATCCTTGTCAATCAA
DnaEn forward primer
TTTAAGCTTCGGCACCGAAATTTTAACC
DnaEn reverse primer
TTTGGATCCATGGCTAAGTTTAATTGTCCCAGCGTCAAG
PEST forward primer
TTTAAGCTTAGCCATGGCTTCCCGCCG
PEST reverse primer
AAACTCGAGCTACACATTGATCCTAGC
Italics represent restriction sites for cloning the PCR-amplified DNA into cloning vectors. Bold letters mean restriction sites for ligation of cDNA fragments.
108
Kanno, Umezawa, and Ozawa
2.2. Cell Culture and Transfection
1. HeLa cells. 2. Dulbecco’s modified Eagle’s medium (D-MEM; SIGMA) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS; Gibco BRL), 100 units/mL penicillin, and 100 mg/mL streptomycin. 3. A transfection reagent, TransIT-LT1 reagent (Mirus Bio Co., Madison, WI). 4. Opti-MEM I (Gibco BRL). 5. Phosphate-buffered saline (PBS): Prepare 10 stock solution with 1.37 M sodium chloride, 27 mM potassium chloride, 100 mM disodium hydrogenphosphate, and 18 mM potassium dihydrogenphosphate (adjust to pH 7.4 with hydrochloric acid). Autoclave the stock solution before storage at room temperature. Prepare working solution by ten times dilution with water, and autoclave the diluted solution.
2.3. In Vitro Measurement of Caspase-3 Activities
1. Plasmids: a) The plasmid pcFluc–DEVD for expression of circular Fluc in mammalian cells. The detailed structure of pcFluc– DEVD is shown in Fig. 9.1. b) phRL-TK (Promega Co.) expressing Renilla reniformis luciferase (Rluc) in mammalian cells. 2. HeLa cells. 3. Apoptosis-inducing reagents, such as staurosporine (STS) and actinomycin D (ActD), are dissolved in dimethylsulfoxide (DMSO) (see Note 3). Working solutions are prepared by dilution with D-MEM supplemented with 10% (v/v) heatinactivated FBS. 4. An inhibitor of caspases, Z-VAD-FMK (Sigma), is dissolved in DMSO. The solution is stocked in a single-use aliquot at – 80C or –30C. Avoid repeated freezing and thawing of the solution of the inhibitor. Working solutions are prepared by dilution in D-MEM supplemented with 10% (v/v) heat-inactivated FBS. 5. A kit of Dual-Luciferase Reporter Assay System 100 assays (Promega Co.) for measurement of firefly luciferase activities. The kit consists of 10 mL of Luciferase Assay Buffer II, one vial of Luciferase Assay Substrate, 10 mL Stop & Glo Buffer, 200 mL Stop & Glo Substrate (50X), and 30 mL Passive Lysis Buffer (5 ).
2.4. Time-Course Measurement of Caspase-3 Activities
1. pcFluc–DEVD. 2. HeLa cells. 3. Hank’s balanced salt solution (HBSS; Gibco BRL) supplemented with 5% (v/v) heat-inactivated FBS.
Detection of Apoptosis
109
4. Apoptosis-inducing reagents, STS and ActD, are dissolved in DMSO (see Note 3). Working solutions are prepared by dilution with HBSS supplemented with 5% (v/v) heat-inactivated FBS. 5.
2.5. In Vivo Imaging of Caspase-3 Activities in Living Mice
D-Luciferin potassium salt (Promega Co.) dissolved in PBS at the concentration of 500 mM (see Note 4).
1. Plasmids: a) pcFluc–DEVD b) A vector for expression of Fluc in mammalian cells (e.g., pGL3-control or pGL4.13 from Promega Co.) (see Note 5). 2. HeLa cells. 3. BALB/c-nude mice (female, 5-week old, 17–20 g of body weight). 4. Isoflurane for anesthesia of mice. 5. PBS. 6.
D-Luciferin potassium salt dissolved in PBS at the concentration of 120 mg/mL.
7. STS dissolved in DMSO.
3. Methods The present indicator for monitoring caspase-3 activity consists of naturally split DnaE intein derived from Synechocystis sp. PCC6803 (11), an engineered Fluc, and a mutated murine PEST sequence, d4PEST (12) (Fig. 9.2). The indicator is cyclized by protein splicing of the intein DnaE in living cells, and changed into a cyclic Fluc. The activity of the cyclized Fluc is markedly decreased. The fused d4PEST accelerates degradation of unspliced Fluc. As a result, only cyclic Fluc accumulates inside the cells. After the digestion of DEVD sequence by activated caspase-3, the cyclic Fluc recovers its activity. Caspase-3 activity is thus observed as its bioluminescence. 3.1. Construction of DNA Plasmids
An Escherichia coli strain, DH5, is used as a bacterial host for construction of all the plasmids. For protein expressions in mammalian cells, pcDNA3.1(þ) carrying a human cytomegalovirus immediate-early (CMV) promoter is used. 1. The cDNA of d4PEST is made by mutating the DNA sequence of Thr-436 to Ala in the cDNA of d2PEST. 2. The cDNAs of DnaEc, DnaEn, Fluc (2–416) (Fluc-N), Fluc (399–550) (Fluc-C), and d4PEST are amplified by PCR using respective pairs of oligonucleotide primers shown in Table 9.1 (see Note 6).
110
Kanno, Umezawa, and Ozawa
3. Fuse the cDNA of DnaEc to the cDNA of Fluc-C. 4. Ligate the cDNA of DnaEn to the cDNA of d4PEST. 5. Connect the fusion cDNA of DnaEc–Fluc-C with the cDNA of Fluc-N. 6. The chimeric cDNAs (DnaEc–Fluc-C–Fluc-N and DnaEn– d4PEST) are ligated and cloned into the multiple cloning site of pcDNA3.1(+) vector as shown in Fig. 9.1. The resultant vector is named pcFluc–DEVD. 3.2. Cell Culture and Transfection
1. HeLa cells are cultured in D-MEM supplemented with 10% (v/v) FBS, 100 units/mL penicillin, and 100 mg/mL streptomycin at 37C in an atmosphere of 5% CO2. 2. The HeLa cells are seeded in culture dishes or 12-well plates with the D-MEM and grown up to 80–90% confluence before transient transfection using TransIT-LT1. 3. Cells on 3-cm dishes and 12-well plates are transfected with 1.0 mg of expression vectors, while cells on 10-cm dishes are transfected with 12 mg of expression vectors. 4. The transfected cells are incubated at 37C for 48 h in an atmosphere of 5% CO2.
3.3. In Vitro Measurement of Caspase-3 Activities
It is important to confirm whether reagents used to trigger apoptosis induce the activation of caspase-3. Before in vivo analysis of caspase-3 activities, in vitro assay with a single tube is performed. Measurement of bioluminescence is performed according to the manufacture’s protocol of dual-luciferase reporter Assay. Dualluciferase reporter assay measures activities of Fluc and Rluc from a single sample, sequentially. Fluc activities are monitored after addition of D-luciferin. After quantification of the luminescence from Fluc (LF), the reaction is stopped by a Stop & Glo reagent, and the luminescence from Rluc (LR) is measured with the substrate molecule for Rluc, coelenterazine. LF normalized to LR is termed as relative light unit (RLU; RLU = LF/ LR). The calculated RLUs are used for evaluation of caspase-3 activities. 1. HeLa cells on 12-well culture plates are cotransfected with 1.0 mg of pcFluc–DEVD and 10 ng of phRL-TK vector, and incubated at 37C for 48 h in an atmosphere of 5% CO2. 2. Prepare an adequate volume of the 1 lysis buffer (250 mL/ well of a 12-well culture plate) by adding 1 volume of 5 Passive Lysis Buffer to 4 volumes of distilled water and mixing well (see Note 7). Mix the provided lyophilized luciferase assay substrate in 10 mL of the supplied luciferase assay buffer II (see Note 8). Prepare a sufficient volume of substrates for Renilla luciferase by mixing 1 volume of Stop & Glo Substrate (50 ) in 50 volumes of Stop & Glo Buffer (see Note 9).
Detection of Apoptosis
111
3. The transfected HeLa cells are treated with Z-VAD-FMK or vehicle and incubated at 37C for 1 h in an atmosphere of 5% CO2. 4. Remove the media covering the HeLa cells, and wash the cells with PBS twice. 5. Stimulate the vehicle- or Z-VAD-FMK-treated cells with STS at 37C for 2 h in an atmosphere of 5% CO2. 6. Remove the media from the cultured cells, and gently rinse the cells twice with PBS. Remove the PBS completely before applying the diluted lysis buffer. 7. Dispense 250 mL of the lysis buffer into each well of 12-well culture plates. 8. Rock the culture plates on an orbital shaker gently for 15 min at room temperature. 9. Harvest the lysate with a rubber scraper and suspend the lysate gently. Transfer the lysates to tubes and centrifuge the tubes for 30 s at 15000g. Transfer 20 mL of the supernatants to vials for measurements of bioluminescence. 10. Add 100 mL of the prepared substrates for firefly luciferase to the vial and gently suspend the mixture five times. Bioluminescence from the sample is measured for 10 s with a luminometer (e.g., MinilumatLB9507 luminometer; Berthold GmbH & Co. KG, Wildbad, Germany). 11. Add 100 mL of the substrates for Renilla luciferase to the same vial and gently suspend the mixture. Bioluminescence from the sample is evaluated for 20 s with the luminometer (see Note 10). 3.4. Time-Course Measurement of Caspase-3 Activities
The time required for maximal caspase-3 activation in response to extracellular stimuli varies with chemical compounds and their concentration. Before the in vivo assay of caspase-3 activities, it is important to confirm when caspase-3 is activated after stimulation with apoptotic reagents. In this set of experiments, in vitro real-time analysis of caspase-3 activity in living cells is performed. 1. Growth medium covering HeLa cells transfected with pcFluc–DEVD on 3-cm culture dishes is replaced with HBSS containing 500 mM D-luciferin and 5% (v/v) FBS (see Note 11). 2. After setting the five 3-cm dishes on a photon counter for real-time analysis of bioluminescence such as Kronos (ATTO, Tokyo, Japan), the cells are stimulated with STS or ActD. 3. The luminescence intensities are measured every 5 min with the accumulation time of 45 s per dish.
112
Kanno, Umezawa, and Ozawa
3.5. In Vivo Imaging of Caspase-3 Activities in Living Mice
HeLa cells expressing cyclic Fluc are implanted in the right side on the back of a mouse. HeLa cells expressing full-length Fluc, which are used for normalization of the bioluminescence from the cells expressing cyclic Fluc, are implanted in the left side on the back of the same mouse. The observed luminescence intensity from the right side (LR) is divided by the intensity from the left side (LL); the extent of activated caspase-3 is evaluated as RLUs (RLU = LR/LL). This method of calculation eliminates variations in some experimental conditions such as transfection efficiency, the numbers of the implanted cells, and the amount of injected D-luciferin circulating in the body of the mouse. 1. HeLa cells are transfected with pcFluc–DEVD or a plasmid for expression of full-length Fluc on 10-cm culture dishes, and incubated for 48 h. 2. The cells are harvested with rubber scrapers, and centrifuged at 700g for 5 min. The harvested cells are suspended in PBS (see Note 12). An aliquot of 1.0 106 cells is subcutaneously implanted on the back of a mouse. 3. After anesthesia of the mouse with isoflurane, STS dissolved in DMSO is intraperitoneally (i.p.) injected. Immediately, 100 mL of the PBS containing 120 mg/mL of D-luciferin is i.p. injected. 4. The mouse is imaged with a CCD camera such as IVIS200 system (Xenogen, Alameda, CA). Photons emitted from the implanted cells are collected and integrated for 1 min. Image processing is performed by a LIVING IMAGE software (Xenogen). Hereafter, 100 mL of the PBS containing 120 mg/mL of D-luciferin is injected i.p. before each imaging at intervals of 1 h. 5. To quantify the measured luminescence, regions of interest are drawn over the cell-implanted areas, and the luminescence intensities (photons/s/cm2) are evaluated (see Note 13).
4. Notes 1. pGL3-Control and pGL4.13 carry Fluc cDNAs named ‘‘lucþ’’ and ‘‘luc2’’, respectively. The codon of ‘‘lucþ’’ is different from that of ‘‘luc2’’. In the study (10), the gene of ‘‘lucþ’’ to construct the cDNA of cyclic Fluc was used. 2. d4PEST is made by mutating an amino acid residue 436-Thr of d2PEST to Ala.
Detection of Apoptosis
113
3. The solutions are stored in a single-use aliquot at –80C or –30C. Repeated freezing and thawing of the stock solutions are not recommended. 4. The solutions are stored in a single-use aliquot at –80C or –30C. Repeated freezing and thawing of the stock solutions is not recommended. 5. pGL3-Control and pGL4.13 express Fluc in mammalian cells under control of the simian virus 40 (SV40) early enhancer/ promoter (see also Note 1). 6. The template we used for amplification of Fluc by PCR is the cDNA provided as ‘‘luc+’’ from Promega Co. 7. Prepare the 1 lysis buffer just before use. 8. The prepared substrate solutions for Fluc are stored in a single-use aliquot at –80C or –30C. 9. Prepare the reagents just before use. 10. Two examples of the result are shown in Fig. 9.3a, b, which demonstrate the quantitative analysis of caspase-3 activities.
Fig. 9.3. In vitro analysis of caspase-3 activity. (a) Quantitative analysis of the Fluc activity with STS. HeLa cells transfected with pcFluc–DEVD were treated with various concentrations of STS for 2 h. (b) Quantitative analysis of the inhibitory effect of Z-VADFMK on caspase-3 activities. pcFluc–DEVD-transfected HeLa cells were treated with different concentrations of Z-VAD-FMK or vehicle (0.1% DMSO) for 1 h and stimulated with 100 nM of STS for 2 h.
11. Wash the cells with HBSS supplemented with 5% (v/v) of FBS twice before loading the substrate solution. 12. Do not keep the cell suspension at room temperature. Incubate the suspension on ice just before use. 13. An example of the result is shown in Fig. 9.4.
114
Kanno, Umezawa, and Ozawa
Fig. 9.4. In vivo imaging of time-dependent caspase-3 activity in living mice with optical CCD camera. The mice were subcutaneously implanted with HeLa cells expressing cyclic Fluc (right side of its rear) and full-length Fluc (left side). Images of the mice were taken at the indicated times after intraperitoneal injection of STS. A representative of three mice is shown.
Acknowledgment This work was supported by grants from the Japan Science and Technology Agency (JST), and Japan Society for the Promotion of Science (JSPS). References 1. Arends, M. J., and Wyllie, A. H. (1991) Apoptosis – Mechanisms and roles in pathology. Int Rev Exp Pathol 32, 223–254. 2. Ellis, R. E., Yuan, J. Y., and Horvitz, H. R. (1991) Mechanisms and functions of celldeath. Annu Rev Cell Biol 7, 663–698. 3. Cohen, J. J., Duke, R. C., Fadok, V. A., and Sellins, K. S. (1992) Apoptosis and programmed cell-death in immunity. Annu Rev Immunol 10, 267–293. 4. Cohen, G. M. (1997) Caspases: the executioners of apoptosis. Biochem J 326, 1–16. 5. Nijhawan, D., Honarpour, N., and Wang, X. D. (2000) Apoptosis in neural development and disease. Annu Rev Neurosci 23, 73–87. 6. Riedout, H. J., and Stefanis, L. (2001) Caspase inhibition: a potential therapeutic strategy in neurological diseases. Histol Histopathol 16, 895–908. 7. Thornberry, N. A., and Lazebnik, Y. (1998) Caspases: enemies within. Science 281, 1312–1316.
8. Budihardjo, I., Oliver, H., Lutter, M., Luo, X., and Wang, X. D. (1999) Biochemical pathways of caspase activation during apoptosis. Annu Rev Cell Dev Biol 15, 269–290. 9. Wolf, B. B., and Green, D. R. (1999) Suicidal tendencies: apoptotic cell death by caspase family proteinases. J Biol Chem 274, 20049–20052. 10. Kanno, A., Yamanaka, Y., Hirano, H., Umezawa, Y., and Ozawa, T. (2007) Cyclic luciferase for real-time sensing of caspase-3 activities in living mammals. Angew Chem Int Ed. 46, 7595–7599. 11. Wu, H., Hu, Z. M., and Liu, X. Q. (1998) Protein trans-splicing by a split intein encoded in a split DnaE gene of Synechocystis sp. PCC6803. Proc Natl Acad Sci USA 95, 9226–9231. 12. Li, X. Q., Zhao, X. N., Fang, Y., Jiang, X., Duong, T., Fan, C., Huang, C. C., and Kain, S. R. (1998) Generation of destabilized green fluorescent protein transcription reporter. J Biol Chem 273, 34970–34975.
Chapter 10 Noninvasive Bioluminescent Imaging of Infections Javier S. Burgos Abstract Traditional studies of viral and bacterial infection and pathogenesis have generally relied on animal models that require the sacrifice of infected animals to determine viral or bacterial distributions and titers. The recent application of the in vivo bioluminescence imaging (BLI) to monitor the replication and tropism of pathogens expressing the luciferase (from firefly or Renilla) reporter proteins has been recently developed. This technology do not requires the sacrifice of the experimental animals, where the in vivo bioluminescence emissions in living animals permit the tracking of the infection. It has been demonstrated that the in vivo BLI is comparable to the classical approaches as measurements of in vitro light emission in organs of sacrificed animals. Moreover, molecular techniques such as PCR determinations show parallel results in pathogen quantification, where the concentrations of microbial DNA measured correlated with the magnitude of bioluminescence in vivo, and with the photon flux determined by the in vitro luciferase enzyme assay. These results show that BLI can be used for noninvasive, real-time monitoring of several infections of pathogens in living animals, supplying a new methodology in the study of pathogens in addition to conventional techniques for the characterization of infections. Key words: Bioluminescence, firefly luciferase, Renilla luciferase, infection, pathogen, region-ofinterest, imaging.
1. Introduction In vivo bioluminescence imaging (BLI) is a highly sensitive imaging method potentially ideal for evaluating many biological phenomena. Advances in biotechnology have enabled in vivo imaging of luciferase expression in living mice via the use of cooled chargecoupled device (CCD) cameras (1, 2). Firefly (Photinus pyralis) luciferase (FL), the substrate of which is D-luciferin, has been used in several imaging studies of this type (3, 4). This enzyme has minimal background activity, can cross the cell membrane, and can even penetrate the blood–brain barrier after intraperitoneal P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_10, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
115
116
Burgos
(i.p.) or intravenous (i.v.) injection into mice. BLI of Renilla luciferase has been also reported after systemic delivery of coelenterazine (5). Establishing the optimal conditions and potential limitations of this novel technique may allow its use in the evaluation of therapeutic responses in preclinical studies in the field of infections. Studies of pathogens in small animal models (generally mice) usually depend on the observation of clinical symptoms, the sacrifice of the experimental animals, and the harvesting of organs and tissues for histopathological examination or their use in molecular assays. The major drawback is that sequential sacrifice precludes any subsequent observation of the microbiological, clinical, behavioral, or other outcomes in the mice thus used. Animal-to-animal variations in host–pathogen interactions and therapeutic response are therefore commonly missed. In this sense, the bioluminescence is a powerful technique capable to monitor several kinds of infection (6), and has in fact already been used to study viral pathogenesis by introducing firefly and Renilla luciferase genes into the viral genome (7). Interest in the infections has increased in recent years, but it remains poorly studied with these new imaging technologies. BLI might be extremely useful when studying infection, since it potentially allows the noninvasive examination of intact organs and the recording of changes over short periods of time (8). The observation and quantification of in vivo light production relies on the spatial and temporal distribution of photons emitted by the reporter in cells expressing luciferase in the living animal. BLI could also be used to detect the spread of viruses and bacteria to unexpected anatomical sites; standard molecular techniques for detecting the virus require that organs be isolated whereas noninvasive imaging technology allows whole-animal screening. Several recombinant pathogens (viruses and bacteria) have been used to monitor microbial infections by bioluminescence (9). A successful example to track virus infection was the use of a herpes simplex virus type 1 (HSV-1) expressing luciferase (called KOS/Dlux/oriL) (7). This virus was employed in BLI studies to monitor HSV-1 infection in vivo in both wild-type and knock-out mice (6, 7, 10, 11). As an example of the use of bioluminescent bacterial pathogens, the progression of Salmonella enterica serovar typhimurium (S. typhimurium) expressing luciferase has been monitored after oral infection in mice (12). Although this type of imaging method has a few disadvantages, e.g., the attenuation of light by hair and organ pigmentation, overlapping signals, the attenuation of signals due to organ depth from the surface, it potentially offers significant advantages over standard classical techniques, increasing the capacities of analysis for the infection studies.
Noninvasive Bioluminescent Imaging of Infections
117
2. Materials 2.1. Infection of the Recombinant Pathogens
1. Recombinant specific pathogens carrying luciferase/s. To carry out this technique, the modified pathogen under study (with genetic insertions of the described luciferases) is needed to infect the experimental animals (see Note 1 and 2). 2. Animals (preferably mice) (see Note 3–10).
2.2. In Vivo Bioluminescence Imaging
1
1. Cooled IVIS animal imaging system (Xenogen Corp., Alameda, CA, US) linked to a PC running Living ImageTM (Xenogen Corp.) and IGOR software (Wavemetrics, Seattle, WA, USA) under Windows XP (see Note 11). 2.
(see Note 12). Prior to imaging, D-luciferin is prepared in normal saline as a stock solution in phosphatebuffered saline (PBS) (e.g., 10 mM). The solution of D-luciferin should be sterile-filtered and stored in aliquots at –80C (see Note 13). D-Luciferin
3. Anesthesia (see Note 14).
3. Methods 3.1. Infection of the Recombinant Pathogens 3.2. Administration of D-Luciferin
3.3. Imaging
1. The animals will be infected with or without anesthesia depending on the selected route of infection. Anesthesia is not necessary when the administration of the pathogen is i.p. D-Luciferin (potassium salt) is usually injected i.v. or i.p. at a dose between 15 and 150 mg/kg body weight. Anesthesia is not necessary to administer the D-luciferin.
1. Previous to imaging in the CCD camera setup, mice should be anesthetized by i.p. injection (with avertin solution) or in air (with 2% isofluorane). Anesthesia by i.p. injection takes effect after some 5 min and last for 25–30 min. Anesthesia with isofluorane typically requires 2–3 min and it is maintained via nose cone. 2. Transfer the mice to the stage of the CCD camera individually or in groups (depending on the device). 3. Acquire in the system a gray-scale photograph of the mouse/ mice, and determine the right position of the animal under the camera. The distance of the mice from the CCD camera should always be the same.
118
Burgos
4. Imaging should begin some minutes after the administration of D-luciferin (13) (see Note 15). 5. Determine experimentally the integration time to obtain the image. The integration time depends on the photon flux efficiency (some minutes) with large binning (high resolution); an f/stop of 1 and an open filter should be used for luminescent image acquisition. 3.4. Quantification of Bioluminescence Data
1. A gray-scale surface image of each mouse should be initially acquired using field-of-view position C, a 0.2-s exposure time, a medium binning (resolution), an f/stop of 8 (aperture), and an open filter. 2. The gray-scale photograph of the mice obtained in the specimen chamber under dim LED illumination will be overlain with a pseudocolor luminescent image showing colors from violet (least intense) to red (most intense). The color variation represents the spatial distribution of the photon emissions emerging from luciferase activity within the animal. Each result is a pseudocolor illustration overlain on a gray-scale reference image of the whole mouse (Fig. 10.1).
Fig. 10.1. Bioluminescence images of a representative infected animal with a recombinant herpes simplex virus type 1 (KOS/Dlux/oriL) containing firefly luciferase over time (top) and the signal variability between mice at one selected time point (bottom). In this example, the highest levels of luciferase activity were detected on the dorsum at day 0.8. Signals decreased gradually thereafter, remaining localized to the abdomen of the animals up to day 4 post-infection. No luciferase activity was detected in mice on day 5.7, consistent with viral clearance, its entry into the central nervous system, and the establishment of latency. This figure was published in Microbes and Infection Vol. 8, Authors: Burgos JS, Guzman-Sanchez F, Sastre I, Fillat C and Valdivieso F, Title: Non-invasive bioluminescence imaging for monitoring herpes simplex virus type 1 hematogenous infection, Page numbers: 1330–1338, Copyright Elsevier (2006). Used by permission.
Noninvasive Bioluminescent Imaging of Infections
119
3. Photon flux data must be normalized for differences in image acquisition time. Signal intensities from manually derived regions-of-interests (ROIs) must be obtained over the selected area of each animal, and the processing software used to quantify light emission from the pixels. 4. Data should be expressed as photon flux (photons/s/cm2/ steradian), where steradian (sr) refers to the photons emitted from a solid angle of a sphere. The background photon flux must be defined from an ROI of the same size and placed in the same position prior to the injection of D-luciferin (see Note 16). 5. Data are normalized to the peak signal intensity of each timecourse and reported as mean values – standard deviations (SD) (see Notes 17 and 18). 3.5. Conclusions
To date, an increasing number of infections can be followed by BLI in living animals. For that, the construction of recombinant pathogens is a need, and in this sense an increasing number of modified pathogens containing luciferase genes have been obtained. Bioluminescence detects transcriptional activity in living cells by means of photon-emission fluxes. The progression of infections can be monitored until the disappearance of the signal, using the distribution and relative intensity of transmitted light to determine sites of infection and relative amounts of replicating reporter pathogens. Serial images are obtained from all animals and the mean photon flux relative to the peak signal determined. No bioluminescence is detected above background levels in mock-infected mice or before the administration of D-luciferin. Noninvasive imaging with D-luciferin (which is of low immunogenicity and negligible toxicity) provides advantages such as the ability to detect infection at any site in the living mouse (4, 13, 14), the possibility of repeat imaging of the same mouse, and the easy quantification of bioluminescence (2, 15), although this method also has a number of limitations (e.g., light transmission is attenuated by hair and organ pigmentation). Moreover, image acquisition time is empirically determined based on anticipated amounts of luciferase activity (13); thus, for low amounts of bioluminescence, long imaging times may be needed to detect luciferase activity and to optimize the signal-to-noise ratio (8). Another disadvantage in the analysis of infection is that luciferase requires ATP to produce bioluminescence from luciferin (16), so extracellular pathogens cannot be detected (17). However, BLI appears to be a valid technique for the real-time, noninvasive monitoring of pathogen colonization during the course of infections. The results validate the BLI for monitoring microbial infections in animal models.
120
Burgos
4. Notes 1. The titers of the pathogens must be determined by plaque assays previously to the infection of experimental animals. 2. The pathogen strain should be selected among the most prototypic laboratory or pathogenic strains. 3. All animals should undergo a period of quarantine, and strict precautions should be taken to prevent contamination during inoculation and dissection. 4. At least three animals per point should be addressed in order to obtain statistically significant differences. 5. All mice should be marked, examined, and analyzed individually. 6. Mock-infected animals should be employed as controls (used in parallel in all experiments). 7. The mouse strain should be selected in order to obtain the most appropriate images. In this sense, mouse strains with dark pigmentation are worse than albino or nude mice, because hair pigmentation attenuates the photonic emission. 8. The choice of gender is an important point in the tracking of infections, since several infections are gender-dependent, where a sex shows greater viral infectivity than the other. 9. The administration route is relevant in the efficiency of the infection and in the access of the pathogen to the target organs. 10. The age of the animals will depend on the experimental approach. 11. The IVIS system consists of a cooled CCD camera mounted in a light-tight specimen chamber, a cryogenic refrigeration unit, a camera controller, and a computer system for data analysis. This system provides high signal-to-noise images of luciferase signals emitted from within living animals. 12. The luciferase enzyme produces light in the presence of the substrate luciferin, oxygen, and ATP (18); the light produced penetrates mammalian tissues and can be externally detected and quantified using sensitive light-imaging systems (19). 13.
D-Luciferin is light-sensitive, so the reagent and solution must be adequately protected at all times.
14. Anesthesia can be injected (e.g., 1.2% avertin solution [2,2,2tribromoethanol and tert-amylalcohol]) or applied in air via a nose cone system (e.g., 2% isofluorane). For long acquisition times, anesthesia in air is preferred.
Noninvasive Bioluminescent Imaging of Infections
121
15. It is convenient to analyze previously the time-course of bioluminescent signal at several times after D-luciferin administration (5 min to 1 h post-luciferin) to determine the differences in the kinetics of the bioluminescence in different models. (Fig. 10.2).
Fig. 10.2. (Top) Representative animal at different time points following D-luciferin administration. The signal gradually increased in the brain and in the flank up to a peak at approximately 20 min, after which time the signal slowly decayed. (Bottom) Time-course of luciferase signal following the intraperitoneal injection of D-luciferin. Data are plotted as the mean percentage with standard deviations of photon counts over time from three animals per group. This figure is adapted from material published in BioTechniques Vol. 34 (6), Authors: Burgos JS, Rosol M, Moats RA, Khankaldyyan V, Kohn DB, Nelson MD Jr., and Laug WE,, Title: Time course of bioluminescent signal in orthotopic and heterotopic brain tumors in nude mice, Page numbers: 1184–1188, (2003). Used by permission.
16. Although animals do not have autoluminescence, it is convenient to subtract the photon flux data from the photon flux backgrounds in each region to quantify relative luciferase activity as a measure of the amount of signal. In general, a threshold value not over 10% light emission is set to distinguish true results from the background. 17. When the bioluminescent signal is undetectable, animals can be sacrificed and bioluminescence measured in isolated organs previously soaked in a D-luciferin bath for 10 min. The image acquisition parameters are then identical to those used for living animals (Fig. 10.3).
122
Burgos
Fig. 10.3. Determination of bioluminescent signals after sacrifice. When the bioluminescence had disappeared in the living animals, the latter can be sacrificed and their organs immediately removed. Isolated organs are then placed in a D-luciferin bath and bioluminescence imaging undertaken. In this example, signals were restricted to the spinal cord although the photon flux levels were low, confirming the data obtained in intact animals. This figure was published in Microbes and Infection Vol. 8, Authors: Burgos JS, Guzman-Sanchez F, Sastre I, Fillat C and Valdivieso F, Title: Non-invasive bioluminescence imaging for monitoring herpes simplex virus type 1 hematogenous infection, Page numbers: 1330–1338, Copyright Elsevier (2006). Used by permission.
18. After sacrifice, the organs of the mice used to quantify in vivo bioluminescence can also be used to quantify in vitro light emission. For that, these tissues are homogenized in PBS and CCLR lysis buffer (Promega, Madison, WI, US) added. After freeze-thawing at –80C for 15 min three times, the homogenate is centrifuged at 1,870g for 15 min. Luciferase activity is assessed using 20 mL of supernatant with 100 mL luciferase assay reagent (Promega, Madison, WI, US). A luminometer (Monolight 2010, Analytical Luminescence, San Diego, CA, US) is used to measure total light emission according to the manufacturer’s protocol. The results are normalized to relative light units (RLU) per gram of protein as measured by the BCA Protein Assay System (Pierce, Rockford, US). Results from these in vitro assays are comparable with the bioluminescence signals obtained for all mice (11) (Fig. 10.4).
Noninvasive Bioluminescent Imaging of Infections
123
Fig. 10.4. (Top) Bioluminescence imaging of the ventral area at 3 days postinfection of a representative animal infected with HSV-1 KOS/Dlux/oriL virus. Asterisks show foci of infection compatible with the ovaries, white arrows indicate signals compatible with the adrenal glands. (Bottom) Time courses of firefly activity during KOS/Dlux/oriL infection in the ovaries and adrenal glands. The results show that in vivo bioluminescence quantification strongly correlates with photon flux in vitro values. This figure is adapted from material published in Microbes and Infection Vol. 8, Authors: Burgos JS, Guzman-Sanchez F, Sastre I, Fillat C and Valdivieso F, Title: Non-invasive bioluminescence imaging for monitoring herpes simplex virus type 1 hematogenous infection, Page numbers: 1330–1338, Copyright Elsevier (2006). Used by permission.
124
Burgos
Acknowledgments I thank Dr. David A. Leib for providing the KOS/Dlux/oriL HSV-1 and for his help. References 1. Contag, C. H., Spilman, S. D., Contag, P. R., Oshiro, M., Eames, B., Dennery, P., Stevenson, D. K., and Benaron, D. A. (1997) Visualizing gene expression in living mammals using a bioluminescent reporter. Photochem Photobiol 66, 523–531. 2. Wu, J. C., Sundaresan, G., Iyer, M., and Gambhir, S. S. (2001) Noninvasive optical imaging of firefly luciferase reporter gene expression in skeletal muscles of living mice. Mol Ther 4, 297–306. 3. Contag, C. H., and Bachmann, M. H. (2002) Advances in vivo bioluminescence imaging of gene expression. Annu Rev Biomed Eng 4, 235–260. 4. Contag, C. H., and Ross, B. D. (2002) It’s not just about anatomy: in vivo bioluminescence imaging as an eyepiece into biology. J Magn Reson Imaging 16, 378–387. 5. Bhaumik, S., and Gambhir, S. S. (2002) Optical imaging of Renilla luciferase reporter gene expression in living mice. Proc Natl Acad Sci USA 99, 377–382. 6. Summers, B. C., and Leib, D. A. (2002) Herpes simplex virus type 1 origins of DNA replication play no role in the regulation of flanking promoters. J Virol 76, 7020–7029. 7. Luker, G. D., Bardill, J. P., Prior, J. L., Pica, C. M., Piwnica-Worms, D., and Leib, D. A. (2002) Noninvasive bioluminescence imaging of herpes simplex virus type 1 infection and therapy in living mice. J Virol 76, 12149–12161. 8. Luker, G. D., and Leib, D. A. (2005) Luciferase real-time bioluminescence imaging for the study of viral pathogenesis. Methods Mol Biol 292, 285–296. 9. Hutchens, M., and Luker, G. D. (2007) Applications of bioluminescence imaging to the study of infectious diseases. Cell Microbiol 9, 2315–2322. 10. Luker, G. D., Prior, J. L., Song, J., Pica, C. M., and Leib, D. A. (2003) Bioluminescence imaging reveals systemic dissemination of herpes simplex virus type 1 in the
11.
12.
13.
14.
15.
16.
17.
18.
19.
absence of interferon receptors. J Virol 77, 11082–11093. Burgos, J. S., Guzman-Sanchez, F., Sastre, I., Fillat, C., and Valdivieso, F. (2006) Non-invasive bioluminescence imaging for monitoring herpes simplex virus type 1 hematogenous infection. Microbes Infect 8, 1330–1338. Burns-Guydish, S. M., Olomu, I. N., Zhao, H., Wong, R. J., Stevenson, D. K., and Contag, C. H. (2005) Monitoring agerelated susceptibility of young mice to oral Salmonella enterica serovar Typhimurium infection using an in vivo murine model. Pediatr Res 58, 153–158. Burgos, J. S., Rosol, M., Moats, R. A., Khankaldyyan, V., Kohn, D. B., Nelson, M. D., Jr., and Laug, W. E. (2003) Time course of bioluminescent signal in orthotopic and heterotopic brain tumors in nude mice. Biotechniques 34, 1184–1188. Benaron, D. A., Contag, P. R., and Contag, C. H. (1997) Imaging brain structure and function, infection and gene expression in the body using light. Philos Trans R Soc Lond B Biol Sci 352, 755–761. Sadikot, R. T., Jansen, E. D., Blackwell, T. R., Zoia, O., Yull, F., Christman, J. W., and Blackwell, T. S. (2001) High-dose dexamethasone accentuates nuclear factor-kappa b activation in endotoxin-treated mice. Am J Respir Crit Care Med 164, 873–878. Wilson, T., and Hastings, J. W. (1998) Bioluminescence. Annu Rev Cell Dev Biol 14, 197–230. Cook, S. H., and Griffin, D. E. (2003) Luciferase imaging of a neurotropic viral infection in intact animals. J Virol 77, 5333–5338. Hastings, J. W. (1996) Chemistries and colors of bioluminescent reactions: a review. Gene 173, 5–11. Contag, P. R., Olomu, I. N., Stevenson, D. K., and Contag, C. H. (1998) Bioluminescent indicators in living mammals. Nat Med 4, 245–247.
Chapter 11 Real-Time Bioluminescence Imaging of Viral Pathogenesis Kathryn E. Luker and Gary D. Luker Abstract Mouse models are used commonly to study viral infection and define viral and host determinants of infection and disease morbidity. Conventional studies of viral infection in mice rely upon euthanizing cohorts of animals at multiple time points to identify sites of infection, quantify viral titers, and determine host immune responses. This experimental paradigm precludes longitudinal studies of infection and response to treatment in the same animal and assumes that progression of infection and pharmacodynamics of therapeutic agents are identical in all mice. To enable repetitive, quantitative studies of viral infection in mouse models, we and others are using noninvasive bioluminescence imaging to track viral infection, dissemination, and effects of host immune mediators on disease. In this chapter, we detail experimental protocols for bioluminescence imaging of viral infections in living mice. Key words: Luciferase, optical imaging, vaccinia, herpes simplex virus, mouse model.
1. Introduction Studies of viral–host interactions in mouse or other small animal models of disease conventionally rely upon euthanizing groups of animals at multiple time points to localize sites of infection, establish systemic dissemination, and quantify viral titers in these sites. This approach precludes longitudinal studies of viral replication and disease progression in the same mouse and instead assumes that infection proceeds identically in all animals. As a result, animal-to-animal variations in extent of viral replication locally and systemically will be missed. These differences may reveal new aspects of pathogenesis, including new routes and kinetics of dissemination, and control for technical variables in an experiment, such as inoculation of virus in an unintended anatomic site. Viral spread to unexpected anatomic sites will be missed if only a P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_11, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
125
126
Luker and Luker
standard subset of organs are assayed, thereby limiting knowledge about the full extent of disease. In addition, conventional studies of viral pathogenesis are expensive and time-consuming because of the need to have sufficient animals at each time point to generate statistically significant data. These limitations of conventional experimental approaches to study viral infection highlight the need for new, alternative strategies to investigate pathogenesis in vivo. To overcome limitations of conventional techniques, we and others have developed bioluminescence imaging as a powerful new method to study viral infection in small animal models. In this chapter, we describe protocols to image and quantify viral infection in living mice.
2. Materials 2.1. Luciferase Enzymes and Substrates
1. Firefly (Photinus pyralis), Renilla (Renilla reniformis), and/ or Gaussia (Gaussia princeps) luciferases with codons optimized for expression in mammalian cells (Promega, New England Biolabs). 2.
D-Luciferin substrate for firefly luciferase (Promega) prepared as 15 mg/mL stock in phosphate-buffered saline (PBS) and then sterile filtered through a 0.22 mm filter. Store aliquots of D-luciferin at –20C.
3. Native coelenterazine substrate (Fluka) for Renilla and Gaussia luciferases prepared as a 1 mg/mL stock in methanol. Store aliquots of D-luciferin at –20C. 2.2. Recombinant Viruses
1. Viruses and viral nucleic acid templates for regulating expression of a luciferase enzyme from a promoter of interest and inserting this reporter cassette into the viral genome. Specific reagents necessary for preparing recombinant reporter viruses differ for various pathogens and are beyond the scope of this protocol.
2.3. Bioluminescence Imaging Equipment
1. CCD camera with light-tight imaging box, on-line isoflurane anesthesia, and computer software for data acquisition and analysis (IVIS systems, Caliper). 2. 30 g, 300 ml syringes for injecting luciferin or coelenterazine into mice (insulin-type syringe). 3. Electric clippers to remove fur from mice.
Real-Time Bioluminescence Imaging of Viral Pathogenesis
127
3. Methods Preparation and validation of recombinant viruses expressing firefly luciferase are key components of the protocol. To establish reporter viruses for bioluminescence imaging, it is necessary to integrate a luciferase enzyme into the viral genome under control of a defined promoter. Stronger promoters that drive higher levels of expression of luciferase are preferable to increase sensitivity for detecting viruses in vivo. The relatively large genome of DNA viruses typically can accommodate insertion of a luciferase enzyme without affecting the expression of neighboring genes or significantly attenuating the resultant virus (1, 2). It is more challenging to insert optical imaging reporters into the smaller genomes of RNA viruses. Recombinant Sindbis viruses expressing firefly luciferase have been used successfully for bioluminescence imaging in mice, although reporter viruses were attenuated significantly in vivo as measured by lethality in two different strains of mice (3). Pierson et al. used a DNA-based transfection approach to generate West Nile viruses expressing a green fluorescent protein (GFP) reporter (4). These viruses had reduced growth in cultured cells and frequently lost expression of the reporter, emphasizing the challenges in developing recombinant RNA viruses for imaging. 3.1. Considerations for Luciferase Reporter Enzyme
1. Luciferase enzymes. Several different luciferase enzymes, including firefly (Photinus pyralis), Renilla, and Gaussia, have been used for imaging studies in small animals (Table 11.1). Firefly luciferase has several advantages for imaging relative to Renilla and Gaussia. First, bioluminescence from firefly luciferase has an emission peak of 612 nm at 37C (5), which is in the red and far-red part of the visible spectrum. By comparison, native forms of Renilla and Gaussia luciferases emit blue light with peak emission at 480 nm (6, 7), and light from the most red-shifted mutant of Renilla luciferase peaks at 535 nm (8). Longer wavelengths of visible light (red and far-red) transmit preferentially through tissues, so bioluminescence from Renilla and Gaussia luciferases is attenuated to a substantially greater extent than firefly luciferase. 2. Substrates. D-Luciferin, the substrate for firefly luciferase, has favorable pharmacologic properties for in vivo imaging. After intraperitoneal injection, D-luciferin distributes widely throughout the animal and penetrates blood–tissue barriers such as the brain and placenta. As a result, it is possible to image firefly luciferase reporters in the brain and in fetal tissues (9, 10). Coelenterazine, the substrate for Renilla and Gaussia luciferases, must be injected intravenously, which is a potential limitation for repetitive imaging studies.
128
Luker and Luker
Table 11.1 Luciferase enzymes Luciferase
Peak emission at 37C (nm)
Substrate
Size (amino acids)
Firefly (Photinus Pyralis)
612
D-Luciferin
550
Renilla reniformis
480
Coelenterazine
310
Mutant Renilla reniformis (RLuc8.6-535)
535
Coelenterazine
310
Gaussia princeps
480
Coelenterazine
185
Coelenterazine has higher background signals because of oxidation in serum (11), and this substrate is excluded from some tissues by drug transport proteins (12). Firefly luciferase produces sustained, relatively constant bioluminescence, peaking approximately 10 min after intraperitoneal injection of D-luciferin (13). The steady level of bioluminescence facilitates longer periods of image acquisition and reduces experimental errors from timing of imaging studies (see below). Renilla and Gaussia luciferases have flash kinetics, resulting in a rapid burst of bioluminescence that decays rapidly (6, 7). Therefore, even small differences in the amount of time between injecting substrate and imaging among animals can produce relatively large experimental errors. Collectively, these properties of enzyme and substrate have made firefly luciferase the enzyme used most commonly for imaging studies of viral infection and other biologic processes. 3.2. Validation of Viral Replication and Bioluminescence in Cell Culture
1. Replication in cell culture. As a first step toward determining to what extent the luciferase reporter attenuates viral replication, perform growth experiments with wild-type and reporter viruses in a cell line known to be susceptible to the pathogen of interest. Experiments may be performed with low ( 0.01) or high ( 5–10) multiplicities of infection (MOI) to assess multi- and single-step viral growth. Replication of wild-type and reporter viruses may be quantified by standard methods for the pathogen of interest, such as an assay to determine plaque-forming units. 2. Correlation of bioluminescence with viral titers. To establish that increases in bioluminescence correlate with greater amounts of reporter virus, quantify changes in luciferase activity and viral titers over time. Plate susceptible cells in a format appropriate for standard viral replication assays, such as 6-well plates, and infect with low or high MOI for each reporter virus to be tested. At defined time points (such as 4, 8, 12, 24,
Real-Time Bioluminescence Imaging of Viral Pathogenesis
129
and 48 h post-infection), measure luciferase activity in intact cells (see below) and then harvest cells for viral plaque assays or other appropriate measures of viral titers. Include a mockinfected well as a control for background bioluminescence, which is particularly important for Renilla and Gaussia luciferases. 3. Bioluminescence imaging in intact cells. For viruses expressing firefly luciferase, add D-luciferin directly to culture medium at a final concentration of 150 mg/mL and rock plate to disperse the substrate. Incubate cells with D-luciferin for 5 min at 37C in a CO2 incubator before imaging. For Renilla and Gaussia luciferases, it is preferable to remove medium with serum from cells before adding coelenterazine because this substrate oxidizes in serum, increasing background bioluminescence. Add coelenterazine to a final concentration of 1 mg/mL and then image the plate immediately. Place the plate on the stage of the bioluminescence imaging instrument and set the field-of-view (FOV) to position B for a single tissue culture plate. Acquire a bioluminescence image with no emission filter. Image acquisition times and resolution are semi-empiric with lower resolution and longer imaging times needed for lower levels of bioluminescence. As a starting point, we suggest a 1-min acquisition on medium resolution. For low levels of bioluminescence, longer imaging times and high-sensitivity settings are needed. If the initial image exceeds the counting capacity of the detector (saturated image), a shorter exposure and/or high-resolution settings are required for accurate data. 4. Quantification of bioluminescence imaging data for cultured cells. Data are quantified by region of interest analysis using software with the imaging instrument. For cell culture plates, standard grids are available with matrices consistent with multi-well tissue culture plates, such as 3 2 grids for a 6-well plate. Position the region of interest over the appropriate wells and quantify bioluminescence as photons, which corrects for differences in imaging times and resolution. Subtract photons present in mock-infected wells to determine amounts of bioluminescence from reporter virus at various time points. For viruses that express luciferase constitutively, amounts of bioluminescence are expected to increase with increasing titers of virus. 3.3. Bioluminescence Imaging in Living Mice
1. Infect mice with desired amounts of reporter virus at anatomic sites or routes appropriate for the pathogen of interest. For initial validation experiments, we suggest infecting a parallel set of mice with wild-type virus. This approach allows direct comparisons of disease progression, as determined by
130
Luker and Luker
parameters such as weight loss, temperature, and/or mortality, in mice infected with wild-type and luciferase reporter viruses (Note 1). 2. For strains of mice with dark fur (SV129, C57Bl/6), we shave animals with electric clippers at the start of an imaging experiment. We anesthetize mice with 2% isoflurane gas delivered via nose cone for shaving. Dark fur attenuates and scatters light, substantially reducing sensitivity for detecting bioluminescence from reporter viruses (Note 2). 3. We typically image mice daily over the course of infection, beginning on the first day after viral inoculation. Within this time period, bioluminescence has decreased to background levels for all luciferase enzymes. It is possible to image more frequently, although 6 h are required for bioluminescence from firefly luciferase to return to background. Persistent bioluminescence indicates that substrate (D-luciferin or coelenterazine) is still present in the animal. Amounts of injected substrate do not saturate luciferase enzymes in vivo, so bioluminescence per luciferase molecule increases with higher amounts of substrate (13) and reduces reproducibility of quantitative imaging data obtained by injecting a standard amount of substrate per mouse. 4. Imaging procedure for firefly luciferase. Inject mice intraperitoneally (IP) with 150 mg/kg of D-luciferin stock solution in PBS using a 30-gauge needle (Note 3). Using a standard amount of D-luciferin per animal is essential for generating reproducible imaging data. Five minutes after injection, anesthetize mice with 2% isoflurane gas. Place mice in instrument to begin imaging 10 min after injection (Note 4). 5. Imaging procedure for Renilla and Gaussia luciferases. Dilute coelenterazine stock to 4 mg/kg in PBS and inject intravenously via tail vein (Note 5). Anesthetize mice with isoflurane immediately after injection, and begin imaging at the earliest reproducible time point, typically 3 min after injection. 6. Mouse positioning. We typically image groups of three mice at a time using FOV C on the IVIS system. More or fewer mice may be imaged at a time using larger or smaller fields of view, respectively. Position mice under the CCD camera port in the bioluminescence imaging instrument. We place animals on a piece of disposable black construction paper to reduce the potential for contaminating the equipment with viruses. It is important to determine that the paper (or other padding materials) does not produce detectable light, which will confound imaging experiments. Mice are positioned with the probable anatomic sites of infection positioned closer to the CCD camera. For example, to focus on viral infection in the
Real-Time Bioluminescence Imaging of Viral Pathogenesis
131
brain, mice are placed prone on the imaging platform to orient this organ closer to the camera. Depending on the route of infection and sites of viral spread, it may be necessary to acquire images from multiple projections. Multiple imaging projections can improve the ability to assign sites of bioluminescence to specific organs and tissues, based on distribution of light and relative brightness when an organ is positioned closer or farther from the camera. 7. Image acquisition. Parameters of image acquisition are the final variables for bioluminescence imaging studies. Imaging times may range from 1 s to 10 min or more, depending on the amount of bioluminescence produced. In general, we use the longest image acquisition time possible without saturating the detection limits of the CCD camera, because these data give the best counting statistics for data analysis. The imaging field of view affects the resolution of the image and overall sensitivity for detecting bioluminescence. Smaller FOV settings improve resolution and sensitivity with the trade-off of imaging fewer animals at once. A smaller FOV also may place animals near the edge of the camera field, which may decrease detection of light. We use a 13-cm FOV (FOV C on an IVIS instrument) for most animal imaging experiments because this allows three mice to be centered under the camera and imaged at the same time. This same FOV is maintained throughout an experiment. BLI instruments also allow investigators to select image resolution based on the matrix for picture elements (pixels) in a given FOV. For example, a 256 256 matrix increases sensitivity for detecting bioluminescence while diminishing spatial resolution because individual pixels are larger. The opposite is true for a 1024 1024 matrix. This parameter must be optimized based on the relative amounts of bioluminescence produced in various sites of infection versus the desired spatial resolution (Note 6). 8. Data quantification. As described for cell culture studies, bioluminescence imaging data are quantified using the region of interest (ROI) analysis software programs provided with these instruments (Fig. 11.1). Such programs allow investigators to manually define ROI for defined anatomic sites in each animal and quantify bioluminescence output. For example, we define standard ROIs for head, chest, and abdomen regions in our vaccinia model of infection. These ROIs correspond with sites of intranasal inoculation, viral replication in the lung, and systemic dissemination to abdominal organs including liver. We also define a specific ROI for bioluminescence in the spleen on images obtained with the left side of the animal facing the CCD camera to measure trafficking on
132
Luker and Luker ROI 1=2.3074e+09
ROI 4=9.3278e+08
ROI 2=9.4022e+08
ROI 5=2.3013e+08
Image Min = –5.3014e+08 Max = 1.5329e+09 p/sec/cm^2/sr
40
30 x106 20
ROI 3=8.1045e+08
ROI 6=1.9942e+08
10
Color Bar Min = 4.8e+06 Max = 4.8e+07
Fig. 11.1. Region of interest analysis for bioluminescence imaging data. Bioluminescence image of C57BL/6 mice infected intranasally with 1 105 pfu recombinant vaccinia virus that expresses firefly luciferase from a hybrid early/late gene promoter. Bioluminescence image parameters were 1-s acquisition time, 13-cm FOV, and 1024 1024 matrix. Relative amounts of bioluminescence are depicted on a pseudocolor scale, with red representing the highest and blue the lowest intensity. The bioluminescence image is superimposed on a gray-scale photograph of the infected mouse. ROI boxes are shown around the head, chest, and abdomen. Photons in each ROI are listed.
infected immune cells to this organ. Bioluminescence imaging data are quantified as numbers of photons emitted per unit time from a defined area (photon flux). This quantification scheme corrects for differences in image acquisition time which may be necessary throughout the experiment. We and others have shown a direct correlation between bioluminescence in a defined organ and viral titers as measured by plaque assay (9, 1). It is important to note that BLI provides relative quantification of bioluminescence in an anatomic site rather than absolute determinations of the concentration of luciferase enzyme. This difference is due to variable attenuation of light by pigmentation in different organs and depth within an animal. For a defined anatomic site, an investigator may conclude that greater amounts of bioluminescence correspond to increased viral replication, and it is possible to generate a standard curve for bioluminescence versus viral titers. However, the same amount of light emitted from a different region will not necessarily correlate with the same amount of virus. For example, light emitted from 1 104 pfu of our recombinant HSV-1 reporter virus will be substantially higher in the
Real-Time Bioluminescence Imaging of Viral Pathogenesis
133
eye than the liver. BLI data for viral replication are most reliable over time when standard ROIs are used to compare amounts of bioluminescence in a specific anatomic site. 9. Validation of imaging data. To correlate photons with viral titers in a defined organ or other anatomic site, we quantify bioluminescence in an organ of interest and then directly measure viral titers in the excised organ. For example, we have used this method to establish a direct correlation between lung bioluminescence and viral titers following intranasal inoculation of a recombinant vaccinia virus expressing firefly luciferase (Fig. 11.2) (1).
Lung pfu/ml and photons
photons
1.E+09 1.E+08 1.E+07 1.E+04
1.E+05 1.E+06 pfu / ml
1.E+07
Fig. 11.2. Direct correlation between bioluminescence and viral titers. C57BL/6 mice were infected with 1 105 pfu vaccinia reporter virus intranasally. Bioluminescence in the chest, which corresponds predominantly to infection in lungs, was measured on day 6 post-infection. Viral titers in excised organs then were quantified by standard plaque assay. The graph may be used as a standard curve to determine viral titers in the lung based on bioluminescence imaging data.
3.4. Biosafety
1. Isoflurane gas that leaks into the environment is a waste product that poses potential health hazards. Waste gases must be scavenged with charcoal canisters or other traps as directed by local OSEH guidelines. 2. In most institutions, bioluminescence imaging instrumentation is part of a core facility used by multiple investigators, some of whom may be using immunocompromised mice for in vivo imaging studies. Therefore, it is imperative that BLI equipment and adjacent work areas not be contaminated with viruses, which typically are BSL-2 pathogens. While imaging infected animals, we wear protective clothing, including gown, mask, hair cover, gloves, and shoe covers. When feasible, we recommend that two researchers work together during BLI studies of viral infection. One person is responsible for handling infected
134
Luker and Luker
animals, while the other person operates the computer system. This strategy greatly reduces the potential for contamination of difficult to clean surfaces, such as computer keyboards and monitors. After imaging is completed, all work areas and surfaces in the instrument are disinfected with an appropriate antiseptic spray (Note 7). In all cases, investigators using viral pathogens should work with local biosafety and animal approval committees to establish standard protocols for bioluminescence imaging of infectious agents.
4. Notes 1. Attenuation of the recombinant imaging virus does not necessarily diminish its utility for studies of pathogenesis, particularly if the attenuation is mild and can be overcome with larger infectious doses. 2. For studies involving very weak bioluminescence imaging signals in darkly pigmented mice, removing all hair with a depiliatory agent, such as Nair, can further enhance sensitivity for luciferase activity. This procedure is more time consuming, and the animal must be rinsed thoroughly with water to remove the agent after hair removal to avoid chemical burns. We do not typically treat mice with a depiliatory agent prior to bioluminescence imaging studies. 3. Standard dosing of D-luciferin is 150 mg/kg. Larger amounts will increase amounts of light with the trade-off of greater costs for experiments. 4. Maintain a constant time period (typically 10 min) between injecting D-luciferin and beginning imaging to reduce variations caused by pharmacology of luciferin biodistribution and excretion. 5. Coelenterazine substrate for Renilla and Gaussia luciferases is injected intravascularly via tail vein or direct intracardiac routes. Injected amounts are 0.7–7.7 mg/kg. Imaging begins at 3 min after injection because of flash kinetics of these luciferases. 6. Optimize image acquisition time, FOV, and resolution as needed for optimal sensitivity and resolution. 7. Decontaminate imaging and anesthesia equipment with antiseptic solution approved by the local animal studies committee. Do not use this solution on the camera itself.
Real-Time Bioluminescence Imaging of Viral Pathogenesis
135
Acknowledgments Infectious disease imaging research in the authors’ laboratory is supported by R21AI066192 and NIH R24CA083099 for the University of Michigan Small Animal Imaging Resource. References 1. Luker, K., Hutchens, M., Schultz, T., Pekosz, A., and Luker, G. (2005) Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread. Virology 341, 284–300. 2. Hutchens, M., Luker, K., Sottile, P., Sonstein, J., Lukacs, N., Nunez, G., Curtis, J., and Luker, G. (2008) TLR3 increases disease morbidity and mortality from vaccinia infection. J Immunol 180, 483–491. 3. Cook, S., and Griffin, D. (2003) Luciferase imaging of a neurotropic viral infection in intact animals. J Virol 77, 5333–5338. 4. Pierson, T., Diamond, M., Ahmed, A., Valentine, L., Davis, C., Samuel, M., Hanna, S., Puffer, B., and Doms, R. (2005) An infectious West Nile virus that expresses a GFP reporter gene. Virology 334, 28–40. 5. Zhao, H., Doyle, T., Coquoz, O., Kalish, F., Rice, B., and Contag, C. (2005) Emission spectra of bioluminescent reporters and interaction with mammalian tissue determine the sensitivity of detection in vivo. J Biomed Optics 10, 41210. 6. Bhaumik, S., and Gambhir, S. (2002) Optical imaging of Renilla luciferase reporter gene expression in living mice. Proc Natl Acad Sci USA 99, 377–382. 7. Tannous, B., Kim, D., Fernandez, J., Weissleder, R., and Breakefield, X. (2005) Codon-optimized Gaussia luciferase cDNA for mammalian gene expression in culture and in vivo. Mol Ther 11, 435–443.
8. Loening, A., Wu, A., and Gambhir, S. (2007) Red-shifted Renilla reniformis luciferase variants for imaging in living subjects. Nat Methods 4, 641–643. 9. Luker, G., Bardill, J., Prior, J., Pica, C., Piwnica-Worms, D., and Leib, D. (2002) Noninvasive bioluminescence imaging of herpes simplex virus type 1 infection and therapy in living mice. J Virol 76, 12149–12161. 10. Saxena, M., Aton, F., Hildebolt, C., Prior, J., Abraham, U., Piwnica-Worms, D., and Herzog, E. (2007) Bioluminescence imaging of period1 gene expression in utero. Mol Imaging 6, 68–72. 11. Zhao, H., Doyle, T., Wong, R., Cao, Y., Stevenson, D., Piwnica-Worms, D., and Contag, C. (2004) Characterization of coelenterazine analogs for measurements of Renilla luciferase activity in live cells and living animals. Mol Imaging 3, 43–54. 12. Pichler, A., Prior, J., and Piwnica-Worms, D. (2004) Imaging reversal of multidrug resistance in living mice with bioluminescence: MDR1 P-glycoprotein transports coelenterazine. Proc Natl Acad Sci USA 101, 1702–1707. 13. Paroo, Z., Bollinger, R., Braasch, D., Richer, E., Corey, D., Antich, P., and Mason, R. (2004) Validating bioluminescence imaging as a high-throughput, quantitative modality for assessing tumor burden. Mol imaging 3, 117–124.
Chapter 12 Bioluminescent Monitoring of In Vivo Colonization and Clearance Dynamics by Light-Emitting Bacteria Siouxsie Wiles, Brian D. Robertson, Gad Frankel, and Angela Kerton Abstract Bioluminescence is an excellent reporter system for analysing bacterial colonization and clearance dynamics in vivo. Many bacterial species have been rendered bioluminescent, allowing the sensitive detection of bacterial burden and metabolic activity in real-time and in situ in living animals. In this chapter we describe the protocols for characterizing in vivo infection models using bioluminescent bacteria: from real-time imaging in living animals by bioluminescence imaging (BLI) to ex vivo BLI of harvested organs and tissues and, finally, to quantification of bacterial numbers in organ and tissue homogenates by luminometry and viable counts. While the lux operon from Photorhabdus luminescens is ideally suited for use in such models, there may be times when alternative luciferases, such as those from the firefly (luc) or marine copepods (Gluc), may be more appropriate. Here we describe the protocols required to monitor colonization and clearance dynamics using bioluminescent bacteria that are lux-, luc-, or Gluc-positive. Key words: Bioluminescence imaging, bacteria, in vivo, infection model, colonization dynamics, luminometry, luciferase, luciferin, coelenterazine.
1. Introduction Bioluminescent reporter genes have been used to investigate microbial associations in a myriad of biological systems (1, 2). In essence, bioluminescent reporters offer a method of labelling microorganisms that is innocuous and allows the sensitive detection of live, metabolically active cells. There are three main approaches by which colonization and infection processes can be monitored using bioluminescent microorganisms: (1) monitoring bacterial numbers and location, (2) monitoring bacterial viability
P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_12, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
137
138
Wiles et al.
(for example, in response to antibiotic treatment) and (3) monitoring bacterial gene expression (for example, those genes involved in colonization and/or virulence). Bioluminescence arises from the oxidation of a substrate (a luciferin) by an enzyme (a luciferase), which usually requires energy and oxygen. Luciferin and luciferase are generic terms as none of the major classes share sequence homology. Luciferase systems include, among others, the bacterial luxAB genes of terrestrial Photorhabdus luminescens and marine Vibrio sp., as well as eukaryotic luciferase genes such as luc from the firefly (Photinus sp) and Gluc from the marine copepod Gaussia princeps (3–6). The firefly luminescence reaction involves the oxidation of a benzothiazoyl-thiazole ‘‘luciferin’’ (commonly referred to as luciferin) and ATP resulting in the production of oxyluciferin, AMP, CO2 and light at 560 nm (7), while the copepod reaction involves the oxidation of an imidazolopyrazine derivative called coelenterazine (the ‘‘luciferin’’) to produce CO2, coelenteramide and light at 470 nm (8). The genes required for substrate production and recycling in these systems are not available; hence exogenous substrate must be added. In contrast, the bacterial luminescence reaction involves the oxidation of a long-chain aldehyde (the ‘‘luciferin’’) and reduced flavin mononucleotide (FMNH2), resulting in the production of oxidised flavin (FMN), a long-chain fatty acid and light at 490 nm (9). A multi-enzyme complex (encoded by the genes luxC, D and E) is responsible for regeneration of the aldehyde substrate from the fatty acid produced by the reaction (10, 11). To date, an abundance of bacterial species have been rendered either lux-, luc- or Gluc-positive (2, 12–19). The choice of reporter gene depends on a number of factors, including the bacterial species under investigation and whether the organism itself or gene expression is being monitored. A significant advantage of the bacterial luciferase system is the ability to express the biosynthetic enzymes for substrate synthesis without the exogenous addition of substrate. However, in many bacterial species harbouring the lux operon, bioluminescence declines when cells enter stationary phase during in vitro growth (13, 20) and is most likely due to a decrease in metabolic activity. In contrast, the bioluminescence of Gluc-expressing cells (which is dependent on the exogenous addition of substrate) appears to be independent of cofactors that become limited during stationary phase (19). In addition, eukaryotic luciferases catalyse the most efficient bioluminescent reaction known (that is, the amount of light generated in relation to the energy expended), with the firefly luciferase reaction found to be approximately 10-fold more efficient than the reaction catalysed by the bacterial luciferases (21). The luciferase encoded by Gluc has been found to exhibit enhanced stability during exposure to low pH, hydrogen peroxide and high
Bioluminescent Monitoring of In Vivo Colonization and Clearance Dynamics
139
temperature (19). This luciferase may therefore be more appropriate if gene expression is being monitored in response to environmental conditions which would have a detrimental effect on the luciferases encoded by luxAB and luc. Using specialized equipment it is possible to visualize bioluminescence directly through the viscera, skin and fur of intact animals (a technique known as bioluminescence imaging [BLI]) (22, 23). BLI is a very powerful tool for implementation of the 3Rs (Replacement, Refinement and Reduction), one of the guiding principles surrounding the use of animals in scientific research. Using BLI, bioluminescent bacteria can be followed throughout the infection cycle as the bacteria expand and migrate to different tissues in the animal, simply by imaging the bioluminescent signal detected from infection sites within the animal. Repetitive study of the same animal over the course of an experiment reveals a dynamic and more meaningful picture of the progressive changes in microbial burden, yielding better-quality results from far fewer experimental animals. Importantly, luminescence is quantifiable and related to bacterial burden. In a number of infection models, death of the animal results from the rapid and uncontrolled expansion of the infecting bacteria. Using BLI the bioluminescent signal can be used to estimate whether an animal will survive or die and hence allows for humane euthanasia, perhaps even before the onset of clinical symptoms. Characterization of an infection model involving bioluminescent bacteria is a three-stage process: (1) detection of bioluminescent bacteria in vivo in anaesthetized animals using BLI; (2) determination of the anatomical location of the bacteria by BLI using harvested tissue; and (3) quantification of bioluminescence (by luminometry) and viable bacterial counts (by plating onto selective media) from homogenized tissue and, where appropriate, organ contents (or stool, in the case of gastrointestinal pathogens). This chapter describes the protocols involved in this process. Importantly, the detection limits for a given bacterial strain will depend on numerous factors, including the level of light production and bacterial numbers present, the availability of cofactors for the bioluminescence reaction, the tissue tropism of the bacteria (and hence, the distance the photons must travel through tissue) and potential signal impedance (such as the absorption of light by oxyhaemoglobin and deoxyhaemoglobin, or by melanin within pigmented skin and fur). It is recommended that prior to embarking on the characterization process, serial dilutions of the bioluminescent bacterial strain grown in laboratory media are assessed by BLI and luminometry, and the relationship between bioluminescence and viable counts established. These results, coupled with an understanding of the in vivo model using the non-luminescent wild-type bacterial
140
Wiles et al.
strain, will allow an estimation of whether the bioluminescence of the engineered microorganism is bright enough to be detected in vivo. Here we describe the in vivo and in vitro protocols required to monitor colonization and clearance dynamics using bioluminescent bacteria that are lux-, luc- or Gluc-positive.
2. Materials 1. In vivo optical imaging equipment (with or without gaseous anaesthesia induction equipment) such as the IVIS range from Xenogen (Alameda, CA, USA) [now part of Caliper Life Sciences], the NightOWL II from Berthold Technologies (Germany) or the Photon Imager from Biospace Lab (Paris, France) (see Note 1). 2. Software programs: such as Living Image (Xenogen) and Igor (Wavemetrics, Seattle, USA) 3. Luminometer, such as the LB953 from Berthold Technologies (Germany), and appropriate vials/plates (see Note 2). 4. Hair-removal methods such as clippers or beard-trimmer (see Note 3). 5. Anaesthetic agents (see Note 4) such as ketamine hydrochloride (100 mg/ mL) combined with xylazine hydrochloride (2% 20 mg/mL) administered via intraperitoneal injection or inhalational isofluorane. A working solution of ketamine/xylazine comprises, for example, 0.5 mL (50 mg) ketamine and 0.25 mL (5 mg) xylazine in 4.25 mL of water. While the ketamine/xylazine mix can be stored at 4C for up to 1 week, deterioration (lack of sedation) occurs after 48 h, so ideally it should be made up fresh and used immediately. 6. Sterile phosphate-buffered saline (PBS) without Mg2+ and Ca2+: 50 mM Potassium phosphate, 150 mM NaCl pH7.2 sterilised by autoclaving. PBS may also be purchased from companies such as Invitrogen. 7.
D-Luciferin,
sodium salt (Gold BioTechnology, St. Louis, MO, USA) if the luciferase used is encoded by luc. For in vivo assays, make up a 50 mM working concentration in PBS without Mg2+ and Ca2+ (15 mg/mL) and filter sterilise through a 0.2-mm syringe filter. For in vitro assays a 100 mM (200x) stock solution is made in distilled water (30 mg/mL to give 150 mg/mL working solution). Alternatively, a number of luciferase assay systems are commercially available (see Note 5). Stock concentrations can be prepared in advance and aliquots stored at –20C. Ideally, working concentrations should be
Bioluminescent Monitoring of In Vivo Colonization and Clearance Dynamics
141
made up fresh and used immediately, but aliquots can be prepared and stored at –20C for future use. Do not subject luciferin to repeated freeze-thaw cycles. Once in use, keep cool and protected from light. 8. Coelenterazine (Prolume Ltd., Pinetop, AZ, USA) if the luciferase used is encoded by Gluc. Make up a 12 mM (5 [5 mg/mL]) stock solution in acidified methanol (100% methanol with 20 mL/mL 3 N or 6 N HCl). For working concentration, dilute stock in PBS without Mg2+ and Ca2+. Keep cool and protected from light. For in vitro use incubate at room temperature for 15–20 min before use. As coelenterazine spontaneously decays and is unstable for prolonged periods in aqueous solutions, it is best made up fresh. The 5 stock solution can be stored at –20C or colder for 1–3 weeks although there will be some loss of activity. Therefore, for accurate, reproducible and comparative data, freshly prepared coelenterazine is recommended (see Note 6). 9. 70% Ethanol 10. Dissection kit 11. Petri dish 12. 25–27 gauge needles (see Note 7). 13. Stomacher 80 Biomaster bags, Seward (Worthing, UK). 14. Appropriate media for determination of bacterial colonyforming units.
3. Methods 3.1. In vivo Bioluminescence Imaging
1. Anaesthetise mice (see Note 8). For inhalational agents, mice are placed into a clear plastic anaesthesia box that allows unimpeded visual monitoring of the animals. The commercially available imaging systems also have a gaseous anaesthesia manifold located inside the imaging chamber so that once sufficiently anaesthetised, animals can be transferred to the imaging chamber and anaesthesia maintained. Anaesthesia is induced within the box using a flow rate of 1 L/min 100% oxygen combined with 5% isoflurane. When the animals have lost their righting reflex, they are removed from the box and placed within the imaging chamber. Anaesthesia is maintained on 1.5–2% isoflurane with an oxygen flow rate of 0.4–0.5 L/min. If no gas anaesthesia equipment is available, mice can be injected via the intraperitoneal route (see Note 9) with a working concentration of ketamine/xylazine at 100 mL per 10 g bodyweight (24) (see Note 10).
142
Wiles et al.
2. If necessary, remove the fur from dark animals (see Note 3). 3. Administer substrate if required (if bacteria are expressing the whole lux operon, for example, from Photorhabdus luminescens, no substrate is required for light production and animals can be imaged as soon as they are anaesthetised). a) If bacteria are expressing the firefly luciferase (luc), administer luciferin to the mice 5–10 min prior to imaging. Common quantities and delivery routes are given in Table 12.1 (see Note 11). The most common route of luciferin delivery is via the intraperitoneal route (see Note 9).
Table 12.1 Common routes and quantities for administration of luciferin Route
Dose
Intravenousa Intraperitoneal
10 uL/g body weight of 15 mg/mL luciferin solution a
10 uL/g body weight of 15 mg/mL luciferin solution
Intramuscularb Intranasal
50 mL of 1–2 mg/mL luciferin solution
c
50 mL of 3 mg/mL luciferin solution
a
Using a 25–27 gauge needle. Using a 27-gauge needle. c Using a pipette. b
b) If bacteria are expressing the copepod luciferase (Gluc), inject 100 mL of 1 stock (1 mg/mL) coelenterazine intravenously into the tail vein using a 26-gauge needle (see Note 12) and image the mice immediately. 4. Place mice into the BLI equipment. Placement will be determined by the anatomical region the light signal is expected from, for example, for colonisation/infection of the visceral organs/lungs, mice are placed on their backs. 5. Image following manufacturer’s instructions for the particular machine. The level of luciferase expression (bacterial numbers) will determine the amount of bioluminescence to be detected. This is turn will determine the period of time required to detect the signal, but usually ranges from 1 to 10 min. 6. After imaging, remove mice from the BLI equipment for recovery from anaesthetic (see Note 13). 7. Using this protocol, mice may be imaged repeatedly, especially if gaseous anaesthetic is used. Animals highly infected/colonised with lux-expressing bacteria (imaged in a
Bioluminescent Monitoring of In Vivo Colonization and Clearance Dynamics
143
couple of minutes) can be monitored three to four times a day using isoflurane, although ideally this intensive monitoring regime should not be followed for more than 3 days. The limiting factor with monitoring Gluc- and luc-expressing bacteria is the clearance of substrate and the number of times animals can be subjected to substrate delivery (see Table 12.2). While coelenterazine rapidly disappears, mice
Table 12.2 Suggested maximum volumes and frequencies of administration of substances (in accordance with (34)) Intraperitoneal
Intramuscular
Subcutaneous
Oral gavage
Intravenous
Maximum number of doses
24
6
24
20
14
Maximum daily volume
20 mL/kg
500 mL
20 mL/kg
20 mL/ kg
10 mL/kg
Number of daily doses <7 days
2–3
2
3
2
1–2a
Number of daily doses >7 days
1
1
2
1
<1a
a
For intravenous administration, 1 dose per day should be administered for no more than 6 days, while 2 doses per day should be administered for no more than 2 days.
should only be dosed intravenously twice on a given day. In contrast, mice can safely be dosed with luciferin by the intraperitoneal route up to three times per day. However, luciferin is cleared much more slowly than coelenterazine, requiring intervals of approximately 4 h between administrations. 3.2. Ex Vivo Bioluminescence Imaging of Harvested Tissue
1. Cull mice by an appropriate humane method. Mice may be imaged intact at this point, but the availability of oxygen and cofactors may be a limiting factor (see Fig. 12.2 and Note 14). 2. Spray mice with 70% ethanol before dissecting and remove any organs/tissues of interest. Wash in sterile PBS if appropriate, and place into Petri dish. Organs such as the stomach and gastrointestinal tract can be washed in PBS to determine numbers of organisms intracellularly, extracellularly but adhering or extracellular and non-adherent (see Note 15). 3. Bathe organs/tissue in substrate (luciferin/coelenterazine) as appropriate (see Subheading 3.1. Step 3 and Notes 5 and 6). 4. Image following manufacturers instructions.
144
Wiles et al.
1. Cull mice by an appropriate humane method.
3.3. Tissue Homogenate Bioluminescence Assay
2. Dissect to remove organs/tissues of interest. 3. Wash in sterile PBS if appropriate. Do not discard the wash to determine numbers of organisms intracellularly, extracellularly but adhering or extracellular and non-adherent if appropriate (see Note 15). 4. Place organs in a plastic stomacher bag and determine weight of organ/tissue. 5. Mash organs to make a homogenate, being careful not to pierce the bag. Add an appropriate amount of PBS (usually 1–5 mL) to bag and resuspend organ/tissue (see Note 16). 6. Remove three replicate samples from each sample (see Note 17). Prepare serial dilutions of organ/tissue homogenate (see Note 18) in PBS or another appropriate buffer (see Note 19). The volumes required will depend on the luminometer used. 7. Place samples into luminometer, add or inject luciferin/coelenterazine if required (see Notes 5 and 6) and record the photon emission for an appropriate time, usually 1–10 s (see Note 20). 8. Plate serial dilutions of samples onto the appropriate selective agar for measurement of bacterial numbers (colony forming units).
3.4. Expected Results
The three-stage process of model characterization is illustrated in Figs. 12.1–12.3 with the extracellular gastrointestinal pathogen Citrobacter rodentium (25). Laboratory-grown C. rodentium
7 × 106
4
5 × 106
20 × 104 10 × 10
15 × 104 6 × 104
Day 3**
1 × 10
6
10 × 104
2 × 104
Day 1*
3 × 10
6
Photons sec–1cm–2 sr–1
14 × 104
5 × 104
Day 6
Day 8
Day 10
Day 14
Time post-infection
Fig. 12.1. In vivo colonisation and clearance dynamics of Citrobacter rodentium ICC180. BLI was performed at regular intervals over a 14-day period (representative images from the same animal are shown) using an IVIS50 system (Xenogen) after gaseous anaesthesia with isoflurane. Images are displayed as pseudocolour images of peak bioluminescence, with variations in colour representing light intensity at a given location. Red represents the most intense light emission, while blue corresponds to the weakest signal. The colour bar indicates relative signal intensity (as photons s–1 cm–2 sr–1 [where sr = steradian]). Mice were imaged with an integration time of 1 min at a binning of 4. If no luminescence was detected, a 5-min (indicated by **) or 10-min exposure (indicated by *) was used. The abdomen of each mouse was shaved with a beard-trimmer prior to imaging.
Bioluminescent Monitoring of In Vivo Colonization and Clearance Dynamics
145
administered by oral gavage first become established within a specialized patch of lymphoid tissue in the caecum known as the caecal patch. A few days later, the bacteria migrate to colonize the colon. Mice were orally given 109 colony-forming units (cfu) of a constitutively bioluminescent C. rodentium derivative (strain ICC180 which expresses the luxCDABE operon from P. luminescens). In vivo BLI was performed at regular intervals over a 14-day period (representative images from the same animal are shown in Fig. 12.1) using an IVIS50 system after gaseous anaesthesia of mice with isoflurane. The sample shelf was set to position D (field of view 15 cm), and animals were imaged for 1–10 min at a binning of 4 (see Note 21) using the software program Living Image as an overlay on Igor. For anatomical localization, a pseudocolour image representing light intensity (blue, least intense to red, most intense) was generated using the Living Image software and superimposed over the grey-scale reference image. At various time points, animals were humanely culled and organs were harvested and imaged ex vivo using the IVIS50 system, with the sample shelf in position D and an imaging time of 1 min at a binning of 4. Figure 12.2 shows the detection of light from an anaesthetised mouse (A), moments after death (B), after opening of the abdomen (with peritoneum still intact) (C), after introduction of air to gastrointestinal organs (D) and after harvesting and washing
8 × 106
6 × 106
4 × 106
Anaesthetised
Moments after death
Prior to opening of peritoneum
After exposure to air
Photons sec–1 cm–2 sr –1
10 × 106
Harvested organs
Fig. 12.2. Determining the organ/tissue localization of the signal during colonization/infection of mice with bioluminescent bacteria. At particular intervals post-infection, BLI was performed using an IVIS50 system (Xenogen) (the results for a representative animal 10 days post-infection is shown) while anaesthetised (A), moments after death (B), after opening of the abdomen (with peritoneum still intact) (C), after introduction of air to the gastrointestinal organs (D) and after harvesting and washing of colon and caecum (arrow indicates caecal patch) with PBS (E). Images are displayed as pseudocolour images of peak bioluminescence, with variations in colour representing light intensity at a given location. Red represents the most intense light emission, while blue corresponds to the weakest signal. The colour bar indicates relative signal intensity (as photons s–1 cm–2 sr–1). Mice were imaged with an integration time of 1 min at a binning of 4.
146
Wiles et al.
Viable counts (log CFU g-1 tissue) Bioluminescence (log RLU g–1 tissue)
with PBS (E). Harvested organs were then homogenized and samples assessed for bioluminescence by luminometry and viable counts by plating onto selective agar (Fig. 12.3).
1 × 109 1 × 108 1 × 107 1 × 106 1 × 105 CFU
Colon
RLU
CFU
RLU
Caecum
CFU
RLU
Caecal patch
Fig. 12.3. Quantification of bioluminescence and viable counts in harvested organs. Organs were harvested from mice 10 days post-infection, homogenized in PBS and assessed for bioluminescence (by luminometry, expressed as relative light units [RLU]/g tissue) and viable counts (by plating onto selective agar, expressed as colony-forming units [CFU]/g tissue). Luminometry was performed over a 10-s period with a 1-s integration time using a Berthold Autolumat LB953. Error bars are standard deviations.
4. Notes 1. In vivo optical imaging machines comprise a charge-coupled device (CCD) camera mounted within a light-tight specimen chamber. The shelf of the imaging chamber is heated to enhance the well-being of the anaesthetised animals. Typically, a photographic reference image is acquired under weak illumination and then the bioluminescent signal is captured in complete darkness, which may take from seconds to minutes depending on the strength and location of the signal. The CCD camera spatially encodes the intensity of incident photons which are then displayed as a pseudocolour image superimposed on the grey-scale photographic image. Variations in colour within the pseudocolour image represent variations in light intensity at a given location, with red representing the most intense light emission and blue corresponding to the weakest. 2. Luminometers measure light emission using photomultiplier tubes, which convert photons into electrical pulses. Luminometers come in many different formats, from a simple manual one-tube luminometer to a computer-controlled micro-titre plate instrument. Some models also include an
Bioluminescent Monitoring of In Vivo Colonization and Clearance Dynamics
147
injection system which allows the rapid and precise addition of reagents, and are highly recommended if using luc- and Gluc-encoded luciferases require the addition of exogenous substrate and typically cause a flash reaction (see Note 5). Detected photons are displayed as relative light units (RLU). However, this value is not the actual number of photons emitted but a correlate thereof. As a result, absolute values of light emission vary greatly from luminometer to luminometer for a given amount of luciferase protein. For this reason, samples from an experiment should be run on the same machine using the same protocol. 3. In our experience there is at least a 10-fold quenching of the bioluminescent signal from mice with black fur, such as C57Bl/6, in comparison with white mice, such as Balb/C. Depending on the region the bioluminescent signal comes from, it may be advisable to remove the fur from dark animals. We routinely do this using a cordless rechargeable beard trimmer, which is lighter than a pair of hair clippers and possesses a smaller blade. Alternatively, we used commercially available moisturising hair-removal cream applied according to the manufacturer’s instructions. 4. Mice are anaesthetised for restraint purposes. The level of bioluminescence signal emitted by the bacteria will determine the period of time required for the animals to remain under anaesthesia, but will usually be in the range of 5–30 min in total, with imaging times of 1–10 min. It is preferable to anaesthetise mice using inhalational agents such as isoflurane. The advantage of maintaining animals on gas is the greater control of the level of anaesthesia. Inhaled agents are mainly eliminated by the lungs, whereas injectable agents need to be metabolised by the liver and excreted by the kidneys, a process which can be prolonged. Recovery is therefore more rapid from inhaled agents, which is important in regaining normal physiology, to control post-procedural hypothermia and fluid or electrolyte imbalance. Inhalational agents are also suitable for high-frequency anaesthesia studies, where animals are repeatedly imaged. Ketamine can cause muscle rigidity, so in certain situations the mice may appear to twitch. This is less than ideal, especially if the bioluminescent signal is located in the limbs. Where injectable agents are used, to ensure proper dosing each animal should be weighed and dosed according to its bodyweight. 5. The kinetics of the bioluminescence reaction catalysed by firefly luciferase can vary between a flash reaction and a glow reaction, depending on the buffer components. In a flash reaction, the bioluminescence signal rapidly decays to background levels, requiring measurements to be taken in the
148
Wiles et al.
region of seconds after substrate addition. In a glow reaction, the bioluminescence signal decays to background levels much more slowly, allowing measurements to be taken several minutes after substrate addition. A glow reaction is much more desirable if the luminometer available does not have an injection system, as the substrate can be added to all samples prior to measuring the luminescence. Alternatively, samples would have to be read immediately after the addition of substrate to each tube. Riska et al. (1999) described the use of 0.33 mM luciferin in 50 mM Sodium Citrate (pH 4.5) produced a flash reaction, while 0.2 mM luciferin in a buffer comprising 50 mM Sodium Citrate (pH 5.3), 8 mM dithiothreitol and 12 mM MgSO4 produced a glow reaction when assaying luciferase expression in Mycobacterium tuberculosis (26). A number of luciferase assay systems are commercially available in which samples are resuspended in particular substrate/buffer combinations, such as Bright-Glo (E2610), which results in an approximate 30-min luciferase half-life, and Steady-Glo (E2510), which results in a 5-h luciferase half-life, from Promega Corporation. 6. Once mixed, coelenterazine solutions oxidize and gradually decay to their coelenteramide oxidation product. Dry coelenterazine compounds are only sparingly soluble in aqueous solutions, and must be dissolved in alcohols or propylene glycol prior to making aqueous buffer solutions. Alternatively, New England Biolabs Inc. (Ipswich, MA, USA) sell a Gaussia luciferase assay system (product number E3300) for use in vitro. Preparations of coelenterazine for use in vivo are also commercially available (Prolume Ltd., Pinetop, AZ, USA). Provided in sterile vials, the coelenterazine is made up in a 50/50 mixture of ethanol and propylene glycol, designed to rapidly solvate the coelenterazine, prolong its storage life and be far less inflammatory to small vessels. This preparation is recommended in the case of repeated in vivo studies. Furthermore, coelenterazine itself is chemiluminescent and so it is important to have appropriate controls in both in vivo (for example, an animal without the Glucexpressing bacteria injected with coelenterazine) and in vitro experiments (for example, homogenized tissue with bacteria not expressing Gluc). 7. Ensure a sharp needle is always used. It is preferable to change needles between animals to avoid potential transfer of infection. 8. Anaesthetised animals must be monitored to ensure that they stay in the proper anaesthetic plane. The animals should not be too lightly anaesthetised that they regain consciousness, or
Bioluminescent Monitoring of In Vivo Colonization and Clearance Dynamics
149
too deep that vital functions are compromised. Parameters that should be monitored include mucous membrane colour (should be pink not blue or grey) and respiratory rate and pattern (can be assessed by movement of the chest wall and observation of abdominal movements). The respiratory rate of a normal undisturbed mouse is approximately 180 breathes per minute. A slow rate drop of 50% is acceptable during anaesthesia. Breathing should be steady. If the animals’ breathing becomes ‘‘jerky’’, too much anaesthetic is being applied and this will be fatal if maintained for long periods of time. If an animal appears too deeply anaesthetised, administer supplemental oxygen or alternatively administer reversal agents if available (see Note 13). For prolonged periods of anaesthesia (>30 min), an ophthalmic artificial tear ointment (e.g. Lacrilube, Allergan, Buckinghamshire, UK) should be applied to the eyes to prevent corneal drying and trauma. 9. Intraperitoneal administration involves injection through the abdominal wall and into the peritoneal cavity. It is important to note that intraperitoneal delivery is difficult to perform correctly as it is easy to misplace the dose into the intestine, gut, urinary bladder, muscle or other organs rather than into the peritoneal cavity. To avoid puncturing the abdominal viscera, introduce the needle rapidly at an angle of 30, slightly left of the midline umbilicus, about halfway between the pubic symphysis and the xiphisternum (27). For mice, the technique may best be performed by holding the animals with the head tilted downwards. Note that with this technique withdrawal of the plunger will not usually be helpful as gut contents are too viscous to be drawn into the needle. 10. Ketamine/xylazine can also be administered by the intramuscular route. To ensure proper dosing when using injectable anaesthetics, each animal should be weighed and dosed according to its bodyweight. 11. Researchers have recently suggested direct injection of luciferin in situ when widespread distribution is not needed and utilised this delivery method for imaging of luciferase expression in muscle and the knee joint (28). Furthermore, intranasal administration is recommended if the signal is derived from the lungs (29). It is therefore recommended that the route of administration reflect the location of the bioluminescent signal. Alternative methods of luciferin delivery have been described in the literature and include the use of an osmotic pump for continuous delivery (30) or within food and water (31).
150
Wiles et al.
12. For easier intravenous injection into the tail vein, warm the animals up in a ‘‘hot box’’ at 37C for 5 min maximum, to dilate the veins. It is important not to overheat the mice. It is also important not to inject the substrate too rapidly as this can result in a bolus going straight to the central nervous system or other organs and can be fatal. In occasional circumstances (<1 in 100), an animal may suffer heat exhaustion. In mild cases, where the animal immediately revives on removal from the heat source, it will be possible to continue. In severe cases, where the animal does not immediately recover, the animal should be humanely culled. The site of injection may bleed after intravenous dosing. Apply gentle but firm pressure with a swab until the bleeding stops. Wipe traces of blood away to prevent excessive licking or gnawing at the injection site. 13. If an inhalation agent is used, this will take seconds to minutes. However, if a ketamine/xylazine mix is used, then animals should be injected with an appropriate reversal agent such as atipamezole (Antisedan, 5 mg/mL, Pfizer, Kent, UK), which can be administered at 1 mg/kg intraperitoneally or subcutaneously to speed recovery. Atipamezole should not be administered until at least 30 min after administration of the ketamine/xylazine mixture. If it is administered any earlier, the ketamine component of the mix will not have worn off and the animal will experience violent muscle tremors during the recovery phase. Complete recovery may still take 3–4 h. It is very important that animals are kept warm during this period, preferably by placing within a hotbox (28–30C). Failure to do so will almost certainly be fatal. Animals may be returned to their holding area once they are awake, able to move about the recovery cage and appear to be making normal behavioural adjustments. An animal should not be placed in a group cage unless it is capable of protecting itself from cage mates. 14. Signals originating in the gastrointestinal tract and peritoneal cavity are lost almost immediately after cervical dislocation, while those in the lungs and nose remain for a period (32). 15. In mice infected with the extracellular gastrointestinal pathogen Citrobacter rodentium, despite the presence of both intimately attached organisms and those being shed from the caecum and colon, the bioluminescent signal detected in vivo was found to be slightly less than for the harvested organs containing only attached bacteria (2.20 108 compared to 2.75 108 photons/s) (33). This is likely due to the distance photons must travel through tissue and signal impedance by the melanin within pigmented skin and fur.
Bioluminescent Monitoring of In Vivo Colonization and Clearance Dynamics
151
16. Tissue homogenates can be made using a ‘‘stomacher’’ machine such as the Stomacher 80 Biomaster from Seward (Worthing, UK) (120 s on medium power setting). Alternatively, tissue/organs can be pummelled using the lid of a 50-mL plastic tube or pushed through a sterile sieve. 17. Multiple samples are required to allow calculation of mean values and standard deviations. Within any set of three samples, readings should not be significantly different. 18. Light emission measurements can be quenched by high cell/tissue densities as well as dark/red tissue and organs (such as the liver and spleen). Measure the luminescence of several serial dilutions to determine if the values are linear. If the relationship between luminescence and dilution is not linear, the light is being quenched at low dilutions. In this case, use the readings taken from samples at higher dilutions where the effect of quenching is minimised. 19. Coelenterazine is itself chemiluminescent and can exhibit high background luminescence values depending on the buffer used. As a result, it is very important to determine the most appropriate buffer for performing in vitro assays. In our experience, different bacterial growth media result in very different effects on coelenterazine chemiluminescence, and even small traces carried over into the diluent can have an effect (19). An important control is samples containing the wild-type non-bioluminescent parent strain to determine the absolute levels of background chemiluminescence. 20. Very bright samples may result in spurious light readings from neighbouring wells/tubes in luminometers which process multiple samples. Separate samples using blank tubes/wells and consider potential cross-talk before assuming low values are significant if they came from wells neighbouring strongly bioluminescent ones. 21. When using in vivo optical imaging equipment, one way of increasing the sensitivity of photon detection is to increase the exposure time of the camera to the sample. In addition, some machines have a second method for increasing sensitivity known as ‘‘binning’’. With this technique, pixels are summed together to form super-pixels, that is, for binning a, a a pixels are combined. The higher the value of a, the more sensitive the detection level. However, the trade-off of binning is the loss of spatial resolution, so conversely the higher the value of a, the lower the resolution.
152
Wiles et al.
Acknowledgments The authors would like to thank the Wellcome Trust for supporting this work. References 1. Prosser, J. I., Killham, K., Glover, L. A., and Rattray, E. A. (1996) Luminescence-based systems for detection of bacteria in the environment. Crit Rev Biotechnol 16, 157–183. 2. Francis, K. P., Joh, D., Bellinger-Kawahara, C., Hawkinson, M. J., Purchio, T. F., and Contag, P. R. (2000) Monitoring bioluminescent Staphylococcus aureus infections in living mice using a novel luxABCDE construct. Infect Immun 68, 3594–3600. 3. Engebrecht, J., Nealson, K., and Silverman, M. (1983) Bacterial bioluminescence: isolation and genetic analysis of functions from Vibrio fischeri. Cell 32, 773–781. 4. de Wet, J. R., Wood, K. V., Helinski, D. R., and DeLuca, M. (1985) Cloning of firefly luciferase cDNA and the expression of active luciferase in Escherichia coli. Proc Natl Acad Sci USA 82, 7870–7873. 5. Frackman, S., Anhalt, M., and Nealson, K. H. (1990) Cloning, organization, and expression of the bioluminescence genes of Xenorhabdus luminescens. J Bacteriol 172, 5767–5773. 6. Tannous, B. A., Kim, D. E., Fernandez, J. L., Weissleder, R., and Breakefield, X. O. (2005) Codon-optimized Gaussia luciferase cDNA for mammalian gene expression in culture and in vivo. Mol Ther 11, 435–443. 7. McElroy, W. D. (1951) Properties of the reaction utilizing adenosinetriphosphate for bioluminescence. J Biol Chem 191, 547–557. 8. Verhaegent, M., and Christopoulos, T. K. (2002) Recombinant Gaussia luciferase. Overexpression, purification, and analytical application of a bioluminescent reporter for DNA hybridization. Anal Chem 74, 4378–4385. 9. Campbell, A. K. (1989) Living light: biochemistry, applications. Essays Biochem 24, 41–81. 10. Riendeau, D., and Meighen, E. (1981) Fatty acid reductase in bioluminescent
11.
12.
13.
14.
15.
16.
17.
bacteria. Resolution from aldehyde reductases and characterization of the aldehyde product. Can J Biochem 59, 440–446. Riendeau, D., and Meighen, E. (1985) Enzymatic reduction of fatty acids and acyl-CoAs to long chain aldehydes and alcohols. Experientia 41, 707–713. Riedel, C. U., Monk, I. R., Casey, P. G., Morrissey, D., O’Sullivan, G. C., Tangney, M., Hill, C., and Gahan, C. G. (2007) Improved luciferase tagging system for Listeria monocytogenes allows real-time monitoring in vivo and in vitro. Appl Environ Microbiol 73, 3091–3094. Wiles, S., Clare, S., Harker, J., Huett, A., Young, D., Dougan, G., and Frankel, G. (2004) Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium. Cell Microbiol 6, 963–972. Beard, S. J., Salisbury, V., Lewis, R. J., Sharpe, J. A., and MacGowan, A. P. (2002) Expression of lux genes in a clinical isolate of Streptococcus pneumoniae: using bioluminescence to monitor gemifloxacin activity. Antimicrob Agents Chemother 46, 538–542. Kadurugamuwa, J. L., Modi, K., Yu, J., Francis, K. P., Orihuela, C., Tuomanen, E., Purchio, A. F., and Contag, P. R. (2005) Noninvasive monitoring of pneumococcal meningitis and evaluation of treatment efficacy in an experimental mouse model. Mol Imaging 4, 137–142. Xiong, Y. Q., Willard, J., Kadurugamuwa, J. L., Yu, J., Francis, K. P., and Bayer, A. S. (2005) Real-time in vivo bioluminescent imaging for evaluating the efficacy of antibiotics in a rat Staphylococcus aureus endocarditis model. Antimicrob Agents Chemother 49, 380–387. Basaglia, M., Povolo, S., and Casella, S. (2007) Resuscitation of viable but not culturable Sinorhizobium meliloti 41 pRP4luc: effects of oxygen and host plant. Curr Microbiol 54, 167–174.
Bioluminescent Monitoring of In Vivo Colonization and Clearance Dynamics 18. Sasahara, K. C., Gray, M. J., Shin, S. J., and Boor, K. J. (2004) Detection of viable Mycobacterium avium subsp. paratuberculosis using luciferase reporter systems. Foodborne Pathog Dis 1, 258–266. 19. Wiles, S., Ferguson, K., Stefanidou, M., Young, D. B., and Robertson, B. D. (2005) Alternative luciferase for monitoring bacterial cells under adverse conditions. Appl Environ Microbiol 71, 3427–3432. 20. Francis, K. P., Yu, J., Bellinger-Kawahara, C., Joh, D., Hawkinson, M. J., Xiao, G., Purchio, T. F., Caparon, M. G., Lipsitch, M., and Contag, P. R. (2001) Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon. Infect Immun 69, 3350–3358. 21. Seliger, H. H., and Mc, E. W. (1960) Spectral emission and quantum yield of firefly bioluminescence. Arch Biochem Biophys 88, 136–141. 22. Hutchens, M., and Luker, G. D. (2007) Applications of bioluminescence imaging to the study of infectious diseases. Cell Microbiol 9, 2315–2322 23. Zhao, H., Doyle, T. C., Wong, R. J., Cao, Y., Stevenson, D. K., Piwnica-Worms, D., and Contag, C. H. (2004) Characterization of coelenterazine analogs for measurements of Renilla luciferase activity in live cells and living animals. Mol Imaging 3, 43–54. 24. Flecknell, P. (1992) Laboratory animals anaesthesia, Second edition, Academic Press, London. 25. Mundy, R., MacDonald, T. T., Dougan, G., Frankel, G., and Wiles, S. (2005) Citrobacter rodentium of mice and man. Cell Microbiol 7, 1697–1706. 26. Riska, P. F., Su, Y., Bardarov, S., Freundlich, L., Sarkis, G., Hatfull, G., Carriere, C., Kumar, V., Chan, J., and Jacobs, W. R., Jr. (1999) Rapid film-based determination of antibiotic susceptibilities of Mycobacterium tuberculosis strains by using a luciferase reporter phage and the Bronx Box. J Clin Microbiol 37, 1144–1149.
153
27. Waynforth, H. B., and Flecknell, P.A. (1992) Experimental and surgical techniques in the rat, Second edition, Academic Press, London. 28. Bloquel, C., Trollet, C., Pradines, E., Seguin, J., Scherman, D., and Bureau, M. F. (2006) Optical imaging of luminescence for in vivo quantification of gene electrotransfer in mouse muscle and knee. BMC Biotechnol 6, 16. 29. Buckley, S. M. K., Howe, S.J., Rahim, A. A., Buning, H., McIntosh, J., Wong, S-P., Baker, A. H., Nathwani, A., Thrasher, A. J., Coutelle, C., McKay, T. R., and Waddington, S. N. (2008) Luciferin Detection After Intranasal Vector Delivery Is Improved by Intranasal Rather Than Intraperitoneal Luciferin Administraton. Human Gene Theraphy 19, 1050–1056. 30. Gross, S., Abraham, U., Prior, J. L., Herzog, E. D., and Piwnica-Worms, D. (2007) Continuous delivery of D-luciferin by implanted micro-osmotic pumps enables true real-time bioluminescence imaging of luciferase activity in vivo. Mol Imaging 6, 121–130. 31. Hiler, D. J., Greenwald, M. L., and Geusz, M. E. (2006) Imaging gene expression in live transgenic mice after providing luciferin in drinking water. Photochem Photobiol Sci 5, 1082–1085. 32. Wiles, S., Crepin, V. F., Childs, G., Frankel, G., and Kerton, A. (2007) Use of biophotonic imaging as a training aid for administration of substances in laboratory rodents. Lab Anim 41, 321–328. 33. Wiles, S., Pickard, K. M., Peng, K., MacDonald, T. T., and Frankel, G. (2006) In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium. Infect Immun 74, 5391–5396. 34. Diehl, K. H., Hull, R., Morton, D., Pfister, R., Rabemampianina, Y., Smith, D., Vidal, J. M., and van de Vorstenbosch, C. (2001) A good practice guide to the administration of substances and removal of blood, including routes and volumes. J Appl Toxicol 21, 15–23.
Chapter 13 Quantitative In Vivo Imaging of Non-viral-Mediated Gene Expression and RNAi-Mediated Knockdown Garrett R. Rettig and Kevin G. Rice Abstract Bioluminescent imaging (BLI) coupled with hydrodynamic (HD) dosing of luciferase-expressing plasmid DNA (pDNA) has proven to be a powerful method for quantitatively benchmarking non-viral gene expression in the liver. The expression of luciferase or knockdown of luciferase by RNA interference (RNAi) in the liver is quantifiable over five-orders of magnitude in living mice. The photon emission data derived from BLI can be converted to the absolute amount of luciferase expression by comparison with a standard curve developed using luciferase as a primary standard. Quantitative BLI is also applicable to luciferase expression in other tissues, such as skeletal muscle, following intramuscular (IM) dosing and electroporation (EP) of pDNA. The primary advantages of using quantitative BLI in mouse liver and muscle are the sensitivity of the assay, the speed and ease of making measurements, the precision and linearity of the dose–response curves, and the ability to conduct serial sampling of gene expression over many days or months while eliminating the need to euthanize animals. Key words: Bioluminescent imaging, hydrodynamic dosing, non-viral gene delivery, intramuscular dosing.
1. Introduction The primary goal of non-viral gene therapy is the expression of a therapeutic protein following the delivery of DNA. This goal has been difficult to achieve in animals because plasmid DNA (pDNA) is rapidly metabolized (1), does not easily cross membranes (2), and is too large to passively diffuse into the nucleus (3, 4). A variety of non-viral gene delivery systems are under development that attempt to improve the tissue-specific delivery of pDNA to nuclei in whole animals in an attempt to achieve therapeutically relevant levels of gene expression. P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_13, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
155
156
Rettig and Rice
The first test of a gene delivery system in animals most often uses a reporter gene to measure efficiency. Although many different reporter genes have been used, luciferase expression both in cell culture and in whole animals has proven to be reliable and sensitive (5). The expression of luciferase is not only quantifiable over many orders of magnitude but allows reliable comparisons between laboratories since the expression is determined without concern over false positives. As with all reporter gene expression, it is difficult to ascertain whether or not the magnitude of protein expression is therapeutically relevant. This is a particular difficulty with exquisitely sensitive reporter genes such as luciferase, where a 10–1,000-fold increase in detectable expression may still fall many orders-of-magnitude below the minimal threshold of therapeutic protein expression. Still, for the purposes of improving a systemic gene delivery system, it is essential that the reporter provide a measurable signal even at low levels of expression versus using a less-sensitive reporter that provides no signal. Although luciferase expression has been used as a reporter gene in animals for over a decade, two major advances, hydrodynamic (HD) dosing and bioluminescence imaging (BLI), have significantly improved its application as a gene expression benchmark by which to quantitatively compare investigational non-viral gene delivery systems. HD dosing of pDNA in mice via the tail vein was discovered as an efficient means to express transgenes in the liver (6, 7) and is now widely used as a tool to achieve maximal gene expression (8). The hydrodynamics-based approach involves a rapid, high-volume dose of pDNA in normal saline via the tail vein. Reporter gene expression on the order of 1 mg/g of liver can be achieved following a dose of 5 mg of pDNA in mice (6, 7, 9). This level of protein expression is considered therapeutic for secreted proteins such as Factor VIII in the treatment of hemophilia (10). BLI is an increasingly popular imaging modality that enables detection of photons via a cooled, charge-coupled device (CCD) camera. The CCD camera can detect photon emission from the chemiluminescent reaction of luciferase-mediated oxidation of luciferin in the presence of ATP. Photon products of this reaction can be observed from luciferase expressed in mammalian tissue. Live animal imaging by this method is dependent on luciferase expression, cellular ATP, and delivery of exogenous luciferin. BLI in whole animals can be used to define the anatomical location of luciferase expression as well as the relative intensity of expression as a correlation of photon intensity. This method is amenable to serial sampling over a time course that can range from hours to months, depending on the mode of enzyme expression. Frequent applications include monitoring tumor metastases with luciferaseexpressing cancer cells (11–14), evaluating gene transfer efficiency of gene therapeutics (15–20), and observing the effects of RNAi in
Quantitative Bioluminescence Imaging of Gene Expression
157
knockdown experiments (21–23). BLI can also be used in bioluminescence-resonance energy transfer experiments to determine protein–protein interactions or used to probe tissue-specificity of various promoters (24). In many cases, the photon detection by BLI may be qualitatively compared; however, the conditions of linearity of response and limit of detection must be independently determined for a given tissue in a specific animal to conduct quantitative measurements. Living Image1 software provided with the IVIS1 system normalizes photon emission based on unit time and unit area to read out in units of photon/s/cm2/steradian (sr). The tissue depth of luciferase expression, the degree of tissue vascularization, the amount of photon-absorbing hemoglobin, cellular pigmentation, and substrate bioavailability all influence the observed photon emission at the surface of the skin (25, 26). Because BLI readouts rely on photons detected from the surface of the animal, a method of calibration is needed to convert photon emission to the actual amount of moles of luciferase expressed. A quantitative BLI method was developed for luciferase expression in mouse liver following HD dosing of a plasmidexpressing luciferase (pGL3). Mice were dosed with pGL3 quantities ranging from 100 pg to 5 mg. After 24 h, an intraperitoneal (IP) dose of luciferin resulted in a BLI readout that provided a linear dose–response curve which spanned five orders (105–1010 photons/s/cm2/sr) of magnitude. The amount of luciferase in mouse liver was determined relative to calibrated luciferase standards following extraction of the enzyme from liver. The calibration curve was constructed by adding known amounts of luciferase to naı¨ve liver homogenate and determining the relative light units (RLUs) produced on a bench-top bioluminometer, following the addition of luciferin. The RLUs derived following extraction of luciferase from the livers of HD-dosed mice were compared with the calibration curve in order to convert RLUs to the amount of luciferase. The limit of detection for both BLI in whole animals and the analysis of homogenate in a bench-top bioluminometer was 20 pg of luciferase. The linear range of dosing and detection spans five orders-of-magnitude for both assay methods (9). Quantitative HD-BLI was used to compare the potency of small-interfering RNA (siRNA) versus short-hairpin RNA (shRNA) following co-administration with pGL3. On a weight basis, siRNA and shRNA were shown to be equipotent. In each case, a maximal effect of 80% knockdown was observed by dosing 1 mg pGL3 with 10 mg of siRNA or plasmid encoding an shRNA. These results suggest that shRNA-mediated knockdown from a plasmid-based system is much more potent when considered on a mole basis. HD-BLI proved to be a rapid and reliable method to quantitatively compare RNAi in liver (22).
Rettig and Rice
In addition to HD-BLI, luciferase expression in other tissues may be quantitatively measured by BLI. Skeletal muscle will express luciferase and other gene products following an intramuscular bolus dose of pDNA (27). Electroporation (EP) following an IM dose of pDNA can further enhance expression by several orders of magnitude (28). A quantitative BLI method was developed to measure luciferase expression in skeletal muscle by determining the optimal route and dose of luciferin delivery, the timing of acquisition following DNA and luciferin dose, the linearity of the dose–response curve, the limit of detection, and the amount of luciferase expressed in muscle relative to a calibration curve. Unlike the HD-BLI expression in liver, muscle expression is optimally detected when luciferin is dosed within the skeletal muscle and the linearity of bioluminescent response only extends across two orders of magnitude of pGL3 dosed (Fig. 13.3). The differences in luciferase expression in liver versus skeletal muscle are most clearly observed by quantitative BLI (Figs. 13.1, 13.3, and 13.4). The studies described below discuss the steps involved in generating a quantitative BLI calibration curve. The general approach used should be adaptable to nearly any tissue that is capable of generating appreciable levels of luciferase expression.
1011
106
1010
105
109
104
108
103
107
102
106
101
105 10–5
10–4 10–3 10–2 10–1 100 Hydrodymanic Dose (µg pGL3)
Mass Luciferase (pg/liver)
Bioluminescence (photons/sec/cm2/sr)
158
101
Fig. 13.1. Dose–Response Calibration Curve for pGL3 by HD-BLI. The dynamic range of BLI is illustrated following a HD dose of pGL3 in triplicate mice ranging from 0.0001 to 5 mg. At 24 h following HD dosing, mice were dosed IP, with 2.4 mg of luciferin and imaged on an IVIS Imaging System 200 Series from Xenogen. The images represent the color intensity from a single mouse at each dosing range. The pg luciferase was determined by a Lumat bioluminometer measurement following homogenation of excised livers. Within the linear range of detection, the correlation value is 8.88 104 photons/pg luciferase.
Quantitative Bioluminescence Imaging of Gene Expression
159
2. Materials 2.1. Hydrodynamic Dosing
1. A luciferase-expressing plasmid is biosynthesized and amplified using DH5- competent Escherichia coli in LB media containing ampicillin. The pGL3 Control vector (Promega, Madison, WI) contains the gene encoding firefly (Photinus pyralis) luciferase along with SV40 promoter and enhancer elements. 2. Plasmid is purified using ion exchange chromatography. The anion exchange resin is diethylamionethanol (Qiagen, Valencia, CA). 3. A UV spectrophotometer is used to quantify the plasmid concentration by UV absorbance at 260 nm. 4. Mice used in these experiments are ICR males (Harlan Laboratories, Indianapolis, IN) that range from 15 to 20 g (upon delivery) (see Note 1). 5. A 3-mL syringe with a Luer-Lok tip and a 27 G ½ inch needle is used to deliver pGL3 dilution in normal saline. 6. A cylindrical mouse-restraint device is used to restrict movement of the mouse during HD dosing.
2.2. Intramuscular Dosing and Electroporation
1. The pGL3 Control vector, as described in Section 2.1., is used in IM dosing applications, as well. 2. Mice used in these experiments are ICR males (Harlan Laboratories, Indianapolis, IN) that range from 20 to 25 g (upon delivery). 3. Plasmid is delivered via a 1-mL insulin syringe with a permanently attached needle (28 G ½ in). The needle is sheathed by silicon tubing (inner diameter = 0.31 mm/outer diameter = 0.64 mm). 4. Surgical scissors with curved blades are used to shear mouse fur from the dosing areas while minimizing inadvertent tissue lacerations. 5. Electrical stimuli are delivered via a 2-needle array electrode (BTX Products, Harvard Apparatus, Holliston, MA) with a width of 10 mm. 6. An ECM 830, Square Wave Electroporation System (BTX Products, Harvard Apparatus, Holliston, MA) is used to generate the electrical pulses.
2.3. Bioluminescent Imaging
1.
D-Luciferin
(sodium salt) (Gold Biotechnology, St. Louis, MO) is diluted to a concentration of 30 mg/mL in Dulbecco’s PBS (Invitrogen, Madison, WI).
160
Rettig and Rice
2. Imaging is carried out using the IVIS Imaging System 200 Series (Xenogen, Allameda, CA). 3. Data are processed using the Xenogen-licensed software, LivingImage 3.0. 2.4. Tissue Harvesting and Ex Vivo Luciferase Assay
1. A 200-mL dose of a ketamine and xylazine dilution (20 and 2 mg/mL, respectively) is given intraperitoneally to anesthetize mice. A large forceps is used to euthanize animals by cervical dislocation. 2. Standard surgical equipment is used to resect the tissue of interest. The tissue is immediately frozen upon removal in liquid nitrogen. 3. A porcelain mortar and pestle is used to grind the frozen tissue into a fine powder in the presence of dry ice. 4. Lysis buffer: 25 mM Tris-HCl, 8 mM MgCl2, 1 mM EDTA, 1 w/v % Triton-X 100, pH 7.8. This is used to release cytoplasmic luciferase. 5. Expression of luciferase, in the form of relative light units (RLU), is observed on a bench-top Lumat LB50 bioluminometer from Berthold (Oak Ridge, TN). 6. Luciferase and ATP (Roche Applied Science, Indianapolis, IN). The stock concentration of ATP is 165 mM, 0.15 M NaOH. Luciferase aliquots (30 mL, 1 mg/mL in 0.5 M Trisacetate, pH 7.5) are most stable when stored at –70C in glass vials.
2.5. Hydrodynamic Coadministration of pGL3 and siRNA/pshRNA
1. The pGL3 Control vector, as described in Section 2.1., is used in this co-administration application. Additionally, equipment and materials that apply to HD dosing are also used. 2. pShagLuc expresses a shRNA that is complimentary to firefly luciferase mRNA (Mark Kay Laboratory, Stanford University, Palo Alto, CA). The plasmid contains a U6 promoter, which is transcribed by RNA Pol III. siRNA sequences were purchased from Dharmacon (Lafayette, CO). See detailed sequences of shRNA, siLuc1, siLuc2, and siControl in McAnuff et al. (22).
3. Methods 3.1. Hydrodynamic Dosing
As discussed previously, HD dosing is an established, non-viral method for delivering pDNA to the liver. The physiological response that allows for effective gene transfer has been well
Quantitative Bioluminescence Imaging of Gene Expression
161
detailed (29, 30). HD dosing is used in this experiment to deliver varying amounts of pGL3 and generate a corresponding bioluminescent response. 1. Determine the concentration of pGL3 by a UV absorbance spectrum. Generate serial dilutions with concentrations of pGL3 that range from mg/mL to ng/mL. 2. In triplicate, mice are hydrodynamically dosed with 0.1, 1.0, 10, 100, 1,000, or 5,000 ng of pGL3. The volume of the dose (in mL of normal saline) is determined by 9% of the body weight (g). Mice will be dosed with identical amounts of pGL3 in a given group; however, dosing volumes will vary based on small differences in body weight. 3. Secure a mouse in a cylindrical restraint. Minimize its movement in the restraint while avoiding suffocation. Submerge the tail in water that is approximately 40C, and massage the skin above the tail veins until the bilateral vessels are noticeably dilated. Deliver the dose to the vein that appears to be the most dilated. 4. Place the point of the needle adjacent to the skin and gently pierce through the vein. Move the needle proximally into the vein with the tail and syringe in a near-parallel orientation. 5. Hold the needle firmly in the tail vein with one hand, and depress the plunger of the syringe with the other hand. Deliver the entire contents of the syringe in less than 5 s (see Notes 2 and 3). 6. Remove the needle from the tail vein while holding a cotton swab firmly over the wound. Firm pressure for 15–20 s will halt bleeding. 7. Remove the mouse from the restraint, make identifying markings, and return the mouse to its designated cage. 3.2. Intramuscular Dosing and Electroporation (IM-EP)
A quantitative BLI method to measure expression levels of luciferase in skeletal muscle is discussed. Intramuscular dosing of naked pDNA proved sufficient for transgene expression in vivo (27). Skeletal muscle has continued to be a popular target for gene therapeutics (31). When compared on a weight basis, an IM dose of pDNA generates less transgene expression than HD dosing. At the same time, transgene expression persists for an extended time course and has advantages over HD dosing in that regard. There are specific experimental considerations that have lead to skeletal muscle as a target tissue, and expression levels have been significantly increased by including EP (32). 1. Mice are anesthetized with a 150 mL dose of ketamine/xylazine that is given intraperitoneally via a 1-mL syringe with a 27 G ½ in needle (see Note 4).
162
Rettig and Rice
2. Monitor the effectiveness of the anesthetic by looking for a lack of a pedal response. The effects of the anesthetic should be sufficient for IM dosing approximately 10 min following the ketamine/xylazine dose. 3. Using surgical scissors with curved blades, completely shear the fur covering the hamstrings muscles on either leg (i.e., the ventral aspect of the upper hind leg). 4. Swab the area that has been sheared with a cotton swab saturated with 70% ethanol. Allow 3–5 min for the ethanol to evaporate. 5. Mice are IM dosed with 0.1 mg up to 20 mg of pGL3. The volume of each dose is 50 mL of normal saline. Mice are dosed with identical amounts and volumes of pGL3 in a given group. 6. Draw up the entire volume for the dosing group into an insulin syringe with the tip of the needle sheathed in silicon tubing so there is 2–3 mm of the needle’s point exposed. The tubing allows for more precise control of the depth of the bolus dose of pGL3. 7. Pierce the flesh of the sheared leg with the needle and embed the needle into the hamstring, while avoiding contact with the femur. Ensure that the tip of the needle remains embedded in the muscle. When the needle is implanted into the flesh, pause 10 s, slowly deliver 50 mL over the course of 10 s, pause 10 additional seconds, and slowly remove the needle (see Note 5). 8. Position the 2-needle electrode array so that the pGL3 bolus injection site is centered, and slightly embed the needle electrodes into the tissue. 9. Begin EP stimuli 1 min following the bolus dose of pGL3. Conditions for EP are 6, 20 ms stimuli of 100 V with interceding latent periods of 100 ms. 10. Allow mice to recover in a cage that lacks loose bedding (to avoid inhalation and suffocation). Mice should awake in approximately 1 h. 3.3. Bioluminescent Imaging
The experiments described use the IVIS Imaging System 200 Series from Xenogen. The following discussion of methods in BLI should apply to using other CCD cameras and their associated software from other manufacturers (see Note 6). 1. Liver-based luciferase expression is assayed by delivering the substrate IP. a. Dose mice IP with 80 mL (30 mg/mL) of D-luciferin in phosphate-buffered saline (see Note 7).
Quantitative Bioluminescence Imaging of Gene Expression
163
b. Place mice directly in the anesthetization chamber with the isofluorane flow set to 3%. c. Remove mice from anesthetization chamber and transfer to the imaging chamber where mice remain anesthetized by isofluorane flowing at 2% via nose cones in a gas manifold. Position mice so ventral images are captured from the camera above. d. Begin the image acquisition of photon emission when mice are aligned in the nose cone manifold. Based on the anticipated expression levels (or previously observed expression levels), the duration of acquisition time will need to be varied in order to capture photon emission that is in the dynamic range of detection. 2. Skeletal muscle expression via an intramuscular dose of Dluciferin. a. Anesthetize mice via isofluorane (3%) in the anesthetization chamber prior to dosing D-luciferin. b. Relocate mice to the imaging chamber and deliver a 40 mL (30 mg/mL) dose of D-luciferin via an insulin needle. Deliver substrate IM at the site of pGL3 bolus dose while maintaining mice under 2% isofluorane. c. Collect image beginning 10 min following the delivery of D-luciferin. At this time, expression is maximal for this route of substrate delivery. 3. BLI Data Processing. a. Each image acquisition results in a gray-scale photograph of mice, taken in advance of photon detection. The relative intensity of photon emission is represented in the form of a color-map overlay on the gray-scale image (see Note 8). b. In the case of HD dosing and liver-specific expression, all photon emission will be localized anatomically over the liver. Drawing tools allow the user to encircle zones of luciferase expression or regions of interest (ROIs). Drawing an ROI will enable the measurement of photon emission from that specified location. Photon emission will be expressed in the following normalized units – photons/s/cm2/steradian (see Note 9). c. Values measured for these ROIs represent the photons emitted due to luciferase expression.
3.4. Tissue Harvesting and Ex Vivo Luciferase Assay
The BLI readout can be calibrated to absolute amounts of luciferase. This requires tissue resection which is a time-consuming procedure. After this calibration is completed for a given tissue,
164
Rettig and Rice
the need for tissue harvesting is eliminated in future experiments. By using only BLI to assay for luciferase expression, the total number of euthanized mice is drastically reduced. 1. Anesthetize mice with 200–250 ml of ketamine/xylazine. Ensure anesthetization by the absence of the pedal response. 2. Euthanize mice by cervical dislocation, and quickly resect the luciferase-expressing tissue of interest. 3. Weigh each tissue section and snap-freeze the tissue in liquid nitrogen for preservation until the time at which it can be assayed. 4. Grind the tissue with a porcelain mortar and pestle in the presence of dry ice to maintain the tissue in a powder-like form. 5. Combine the powder with 500 ml of lysis buffer per gram of tissue, vortex for 5 min, freeze-thaw three times (–70C freezer and 37C water bath) and centrifuge for 3 min at 10,000g. 6. The supernatant is recovered and stored at –70C. The tissue pellet is resuspended in 500 ml lysis buffer per gram of tissue and centrifuged as described above. Lysis buffer supernatants from a given sample are combined and stored at –70C. The volume of lysis buffer should be equal to 1 mL/g of tissue. 7. Using a bench-top luminometer, aliquot 100 mL of supernatant, combine with 300 mL lysis buffer and 4.3 mL of ATP (165 mM) and auto-inject 100 mL of D-luciferin (0.14 mg/mL in lysis buffer) prior to measuring bioluminescence. Values are expressed in RLUs and can be converted to express RLUs per gram or RLUs per tissue section. 8. A standard curve is generated to define the absolute amount of luciferase that corresponds to a given RLU reading. This is done by adding a known amount of luciferase to naive tissue homogenate. Luciferase is added to the lysis buffer and frozen tissue powder, and carried through the extraction process as described above. A regression line can be generated from the plot of pg of luciferase versus RLU. 9. Figure 13.1 shows a correlation of the data generated from BLI and bench-top luminometer assays for luciferase expression. 3.5. Hydrodynamic Coadministration of pGL3 and siRNA/shRNA
Methods for HD dosing have been described in detail in Section 2.1. The same methods apply to this co-administration of pGL3 with siRNA or pShagLuc.
Quantitative Bioluminescence Imaging of Gene Expression
165
1. As discussed previously, the concentration of pGL3 is determined indirectly by measuring the UV absorbance at 260 nm. In the same way, the concentrations of siRNAs and pShagLuc are calculated prior to dosing. 2. Following the protocol for HD dosing that is described above, siRNA or pShagLuc is ad-mixed with pGL3 at a given weight ratio, and the dilution of nucleotides is administered in a rapid, high-volume dose. A constant dose (1 mg) of pGL3 is given with varying amounts of siRNA or pShagLuc, resulting in weight ratios of 0.1, 1, and 10 mg pGL3 per mg siRNA/pShagLuc. 3. The degree of knockdown is determined by BLI analysis of RNAi as compared to control experiments, which include a non-targeting sequence of siRNA and a dose of 1 mg pGL3 alone. The data in Fig. 13.1 illustrate the photons detected by BLI and the amount of luciferase expressed on the respective y-axes as a function of HD dose of pGL3. The results illustrate linear
0 µg 0.1 µg 1 µg 10 µg
109
104
88%
84%
108
103 * *
*
107
pShagLuc
Mass Luciferase (pg/liver)
Bioluminescence (photons/sec/cm2/sr)
3.6. Results
*
siLuc 1
sicontrol
Fig. 13.2. RNAi-Mediated Knockdown of pGL3 Expression by HD-BLI. In vivo dose– response comparison of siRNA and shRNA at a constant dose of pGL3. Triplicate mice were hydrodynamically dosed with 1 mg of pGL3 and either 0.1, 1, or 10 mg of pShagLuc, siLuc1, or sicontrol. The luciferase expression was measured by BLI at 24 h after injection. The results establish statistically significant knockdown for pShagLuc and siLuc1 at a dose of 1 and 10 mg, *p < 0.05 relative to pGL3.
Rettig and Rice
dose–response over five orders of magnitude, with a limit of detection of 105 photons/s/cm2/sr at 100 pg of pGL3 and maximal detection of 1010 photons/s/cm2/sr at a 5 mg dose. The results presented in Fig. 13.1 allow for the quantitative comparison of knockdown efficiency of pGL3 when it is co-administered with siLuc 1, pShagLuc, or a combination of both (Fig. 13.2). These data demonstrate the application of HD-BLI to determine a >80% knockdown mediated by siRNAi and shRNA. A BLI dose–response curve following IM dosing and EP in skeletal muscle is illustrated in Fig. 13.3. In contrast to the results presented in Fig. 13.1, the linear range spans two orders of magnitude from doses of 0.1–10 mg of pGL3.
109 103 108 102 107 101 106 100 105 10–1
Mass Luciferase (pg/g hamstring)
Bioluminescence (photons/sec/cm2 /sr)
166
104
0 5 10 15 20 Intramuscular Dose/Electroporation (µg pGL3)
Fig. 13.3. Dose–Response Calibration Curve for pGL3 by IM-EP-BLI. The dose– response curve for pGL3 administered intramuscularly followed by electroporation and BLI is illustrated. Two mice were dosed on each hamstring (n = 4), with a pGL3 dose varying from 0.1 to 20 mg. After 3 days, mice were imaged following an IM dose of 1.2 mg of luciferin. The results establish a linear dose–response range from 0.1 to 10 mg.
The relative time course of gene expression following HD dosing and IM-EP of pGL3 is illustrated in Fig. 13.4. These results demonstrate the utility in serially sampling mice by BLI.
Quantitative Bioluminescence Imaging of Gene Expression
1010
105
A
109
104
108
103
107
102
106
101
105
100
(pg/liver) Mass Luciferase
Limit of Detection
104 0
2
4
6
8
10
108 102
B 107 101 106 100
(pg/g hamstring)
Bioluminescence (photons/sec/cm2/sr)
167
105 10–1 Limit of Detection
104
0
10 20 30 Time (days following 1 µg pGL3)
40
Fig. 13.4. Time Course of Gene Expression by HD-BLI and IM-EP-BLI. pGL3 (1 mg) was dosed hydrodynamically (A) and intramuscularly followed by electroporation (B). Luciferase expression was monitored by BLI over an extended time course in each case. The results establish the duration of observable expression for each route of pGL3 delivery.
4. Notes 4.1. Hydrodynamic Dosing
1. ICR mice are used to minimize expense. This strain of white mice readily displays luciferase expression in the target tissue of choice. Mice weighing 15–20 g are preferred for HD dosing. The relatively low weight translates to a more manageable volume to dose. A larger volume HD dose takes longer to administer. This allows more time for the mouse to move and leads to a greater chance to compromise the HD dose (as discussed above).
168
Rettig and Rice
2. If the needle is not sufficiently in the tail vein prior to dosing, a HD dose cannot be delivered. Very firm pressure applied to the syringe of a misplaced needle will not move the plunger or deliver a dose. The handler should remove the needle entirely and re-insert at a more proximal location to avoid forcing the HD dose out of the wound. In addition, a mouse that moves or flinches during HD delivery can cause the needle to pierce the wall of the tail vein. Excessive pressure applied to the plunger at this point can force the fluid out of pores in the integument of the tail resulting in a missed dose. To reliably confirm that the needle is in the tail vein: a. Gently move the syringe back and forth (pivoting at the point in which the needle goes into the skin). The resultant movement of the tip of the needle in the vein should be visible. b. Gently depress the plunger of the syringe. If it moves easily and there is noticeable release of normal saline into the vessel (visualized by a clearing of the blood at the tip of the needle), then the needle is properly in the tail vein. 3. Further points to consider for HD dosing: a. Monitor the temperature of the warm water to avoid scalding the skin on the tail of the restrained mouse. The water should be tolerable to the touch. b. Palpate the tail on both sides for 15–20 s to facilitate dilation of the tail veins. Dry the tail immediately upon removal from the water to avoid evaporative cooling and vasoconstriction. c. The most difficult part of the HD dosing is inserting the needle into the tail vein. This technique should be practiced several times without the intention of delivering a HD dose prior to carrying out the actual experiment. 4.2. Intramuscular Dosing and Electroporation
4. For IM-EP, mice that weigh 20–25 g are used. Mice that are larger than those used in HD dosing makes the hamstring muscle a more manageable target. 5. The consistency of delivering an IM dose can have an impact on precision of expression levels. As discussed in the methods, the 50-mL dose should be delivered over the course of 10 s, followed by a 10 s pause and slow removal of the needle. Faster, more careless methods will lead to some volume of the dose being released from the injection site either during or after bolus delivery.
Quantitative Bioluminescence Imaging of Gene Expression
4.3. BLI
169
6. It is critical to understand the role that autoluminescence or background signal plays in using BLI for in vivo analysis of luciferase expression. This can be best demonstrated in a naı¨ve mouse. Dose the mouse with D-luciferin according to the protocol for BLI of luciferase expression in either the liver or the skeletal muscle. Image the mouse in the same way that luciferase-expressing mice would be imaged. The size and anatomical location of ROIs are important factors to control throughout an experiment. The value of the background signal can be confidently subtracted if size and anatomical location of ROIs are consistent from mouse to mouse and from group to group within an experiment. 7. Use a luciferin dilution of 30 mg/mL as this is the limit of solubility for the solute in PBS. Although this dose of substrate is not saturating (in the event of an IP dose of 80 mL when measuring luciferase expression in the liver) (9), the use of more luciferin becomes cost prohibitive. Typically, 1 g of D-luciferin can be purchased for $600. Each 80 mL dose is an injection of 2.4 mg valued at $1.44. 8. The dynamic range of luciferase detection by BLI can be maximized by increasing the sensitivity. If the assay can be manipulated to detect minimal amounts of luciferase, then the limit-ofdetection is effectively reduced. With this in mind, the kinetic parameters of luciferin biodistribution are important to consider. The route of luciferin delivery and the time that acquisition is commenced following the luciferin dose can be manipulated to maximize photon emission from a given tissue. 9. In cases where expression levels are close to the limit-of-detection, diffuse pixels of color may appear in seemingly inexplicable regions on the mice. These areas should not be confused as actual luciferase expression. Rather, this effect is attributable to an inherent autoluminescence associated with the skin of the mice. As such, these areas are most commonly observed around the mouth and nose or other regions lacking continuous fur covering. Any amount of significant luciferase expression will be greater than the autoluminescence; however, there may be cases of low expression levels where the autoluminescent signal is observed along with the luciferase-mediated signal.
Acknowledgments The authors gratefully acknowledge support for this work from NIH DK063196, DK066211, and Pharmacological Sciences Training Grant (GM 067795).
170
Rettig and Rice
References 1. Kawabata, K., Takakura, Y., and Hashida, M. (1995) The Fate of plasmid DNA after intravenous injection in mice: involvement of scavenger receptors in its hepatic uptake. Pharm Res 12, 825–830. 2. Boado, R. (2007) Blood-brain barrier transport of non-viral gene and RNAi therapeutics. Pharm Res 24, 1772–1787. 3. Nigg, E. A. (1997) Nucleocytoplasmic transport: signals, mechanisms and regulation. Nature 386, 779–787. 4. Wolff, J. A., and Budker, V. (2005) The mechanism of naked DNA uptake and expression. Adv Genet 54, 3–20. 5. Greer, R. F. 3rd., and Szalay, A. A. (2002) Imaging of light emission from the expression of luciferases in living cells and organisms: a review. Luminescence 17, 43–74. 6. Liu, F., Song, Y., and Liu, D. (1999) Hydrodynamics-based transfection in animals by systemic administration of plasmid DNA. Gene Ther 6, 1258–1266. 7. Zhang, G., Budker, V., and Wolff, J. A. (1999) High levels of foreign gene expression in hepatocytes after tail vein injections of naked plasmid DNA. Hum Gene Ther 10, 1735–1737. 8. Suda, T., and Liu, D. (2007) Hydrodynamic gene delivery: its principles and applications. Mol Ther 15, 2063–2069. 9. Rettig, G., McAnuff, M., Kim, J., Liu, D., and Rice, K. G. (2006) Quantitative bioluminscence imaging of transgene expression in vivo. Anal Biochem 335, 90–94. 10. Pierce, G. F., Lillicrap, D., Pipe, S. W., and Vandendriessche, T. (2007) Gene therapy, bioengineered clotting factors and novel technologies for hemophilia treatment. J Thromb Haemost 5, 901–906. 11. Craft, N., Bruhn, K. W., Nguyen, B. D., Prins, R., Liau, L. M., Collisson, E. A., De, A., Kolodney, M. S., Gambhir, S. S., and Miller, J. F. (2005) Bioluminescent imaging of melanoma in live mice. J Invest Dermatol 125, 159–165. 12. Jenkins, D., Oei, Y., Hornig, Y., Yu, S., Dusich, J., Purchio, T., and Contag, P. (2003) Bioluminescent imaging (BLI) to improve and refine traditional murine models of tumor growth and metastasis. Clin Exp Metastasis 20, 733–744. 13. van der Pluijm, G., Que, I., Sijmons, B., Buijs, J. T., Lowik, C. W., Wetterwald, A., Thalmann, G. N., Papapoulos, S. E., and Cecchini, M. G. (2005) Interference with
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
the microenvironmental support impairs the de novo formation of bone metastases in vivo. Cancer Res 65, 7682–7690. Drake, J. M., Gabriel, C. L., and Henry, M. D. (2005) Assessing tumor growth and distribution in a model of prostate cancer metastasis using bioluminescence imaging. Clin Exp Metastasis 22, 674–684. Banerjee, P., Reichardt, W., Weissleder, R., and Bogdanov, A., Jr. (2004) Novel hyperbranched dendron for gene transfer in vitro and in vivo. Bioconjugate Chem 15, 960–968. Iyer, M., Berenji, M., Templeton, N. S., and Gambhir, S. S. (2002) Noninvasive imaging of cationic lipid-mediated delivery of optical and PET reporter genes in living mice. Mol Ther 6, 555–562. Yoshimitsu, M., Sato, T., Tao, K., Walia, J. S., Rasaiah, V. I., Sleep, G. T., Murray, G. J., Poeppl, A. G., Underwood, J., West, L., Brady, R. O., and Medin, J. A. (2004) Bioluminescent imaging of a marking transgene and correction of Fabry mice by neonatal injection of recombinant lentiviral vectors. Proc Natl Acad Sci USA 101, 16909–16914. Bartlett, D. W., and Davis, M. E. (2006) Insights into the kinetics of siRNAmediated gene silencing from live-cell and live-animal bioluminescent imaging. Nucleic Acids Res 34, 322–333. Wu, J. C., Sundaresan, G., Iyer, M., and Gambhir, S. S. (2001) Noninvasive optical imaging of firefly luciferase reporter gene expression in skeletal muscles of living mice. Mol Ther J Amer Soc Gene Ther 4, 297–306. McCaffrey, A., Kay, M. A., and Contag, C. H. (2003) Advancing molecular therapies through in vivo bioluminescent imaging. Mol Imaging 2, 75–86. McCaffrey, A. P., Meuse, L., Pham, T. T., Conklin, D. S., Hannon, G. J., and Kay, M. A. (2002) RNA interference in adult mice. Nature 418, 38–39. McAnuff, M. A., Rettig, G. R., and Rice, K. G. (2007) Potency of siRNA versus shRNA mediated knockdown in vivo. J Pharm Sci 96, 2922–2930. Bartlett, D. W., Su, H., Hildebrandt, I. G., Weer, W. A., and Davis, M. E. (2007) Impact of tumor-specific targeting on the biodistribution and efficacy of siRAN nanoparticles measured by multimodality in vivo imaging. Proc Natl Acad Sci 104, 15549–15554.
Quantitative Bioluminescence Imaging of Gene Expression 24. Contag, C. H., and Ross, B. D. (2002) It’s not just about anatomy: in vivo bioluminescence imaging as an eyepiece into biology. J Magn Reson Imaging 16, 378–387. 25. Lee, K. H., Byun, S. S., Paik, J. Y., Lee, S. Y., Song, S. H., Choe, Y. S., and Kim, B. T. (2003) Cell uptake and tissue distribution of radioiodine labelled D-luciferin: implications for luciferase based gene imaging. Nucl Med Commun 24, 1003–1009. 26. Zhao, H., Doyle, T. C., Coquoz, O., Kalish, F., Rice, B. W., and Contag, C. H. (2005) Emission spectra of bioluminescent reporters and interaction with mammalian tissue determine the sensitivity of detection in vivo. J Biomed Opt 10, 41210. 27. Wolff, J. A., Malone, R. W., Williams, P., Chong, W., Acsadi, G., Jani, A., and Felgner, P. L. (1990) Direct gene transfer into mouse muscle in vivo. Science (New York, N.Y.) 247, 1465–1468. 28. Prud’homme, G. J., Glinka, Y., Khan, A. S., and Draghia-Akli, R. (2006) Electroporation-
29.
30.
31.
32.
171
enhanced nonviral gene transfer for the prevention or treatment of immunological, endocrine and neoplastic diseases. Curr Gene Ther 6, 243–273. Zhang, G., Gao, X., Song, Y. K., Vollmer, R., Stolz, D.B., Gaskowski, J. Z., Dean, D. A., and Liu, D. (2004) Hydroporation as the mechanism of hydrodynamic delivery. Gene Ther 11, 675–682. Crespo, A., Peydro, A., Dasi, F., Benet, M., Calvete, J. J., Revert, F., and Alin ˜ o, S. F. (2005) Hydrodynamic liver gene transfer mechanism involves transient sinusoidal blood stasis and massive hepatocyte endocytic vesicles. Gene Ther 12, 927–935. Trollet, C., Bloquel, C., Scherman, D., and Bigey, P. (2006) Electrotransfer into skeletal muscle for protein expression. Curr Gene Ther 6, 561–578. Liu, F., and Huang, L. (2002) A syringe electrode device for simultaneous injection of DNA and electrotransfer. Mol Ther 5, 323–328.
Chapter 14 Analysis of Protein–Protein Interactions Using Bioluminescence Resonance Energy Transfer Kevin D.G. Pfleger Abstract Knowledge of how and when proteins interact in living cells is fundamental to our understanding of cellular biology, and bioluminescence resonance energy transfer (BRET) provides an increasingly popular mechanism for studying these interactions in real time. The technique utilises heterologously expressed fusion proteins linking a bioluminescent donor or complementary acceptor fluorophore to proteins of interest. Resonance energy transfer between these fusion proteins is then detected when they are in close proximity, indicative of association either directly or as part of a complex. BRET is particularly useful for real-time monitoring of ligand-modulated interactions as dynamic changes in protein complex assembly can be observed in a live cell environment. Key words: Bioluminescence resonance energy transfer, BRET, protein–protein interaction, eBRET, Renilla luciferase, Rluc8, fluorophore, Venus.
1. Introduction Bioluminescence resonance energy transfer (BRET) is a non-radiative transfer of energy between a bioluminescent donor enzyme and a complementary acceptor fluorophore upon oxidation of a coelenterazine substrate (1–3). The range of this energy transfer is particularly small as it is inversely proportional to distance to the sixth power (4). A consequence of efficient energy transfer is a detectable light emission from the acceptor fluorophore that can be distinguished from light emission from the donor as it occurs at longer wavelengths (1). This phenomenon can be utilised in the laboratory to study protein–protein interactions by genetically linking proteins of interest to the donor or acceptor (5). Inferences regarding the interaction of these proteins can then be made when P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_14, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
173
174
Pfleger
resonance energy transfer occurs and is detected by observing acceptor fluorescence relative to donor luminescence, particularly as efficient energy transfer generally implies a maximum donor– acceptor separation of less than 10 nm which is the order of size of many cellular proteins. It is worth stressing that the oxidation of the coelenterazine substrate by the donor enzyme results in energy emission that takes the form of light (electromagnetic radiation) in the absence of a suitable acceptor. In contrast, if a suitable acceptor is within close proximity, less energy is emitted as light (electromagnetic radiation) and some energy is transferred to the acceptor via a non-radiative dipole–dipole energy transfer mechanism that does not involve the emission or absorption of photons (known as resonance energy transfer (4)). BRET has been used to study interactions between various proteins, although it has proved most popular for studying G protein-coupled receptor interactions with either themselves or other proteins (3, 6).
2. Materials 2.1. Generation and Validation of Fusion Constructs
1. cDNA for proteins of interest. 2. cDNA for complementary BRET donor (such as Rluc8 from S. S. Gambhir, Stanford University, CA (7)) and acceptor (such as Venus from A. Miyawaki, RIKEN, Japan (8)) in appropriate expression vectors (such as pcDNA3.1 from Invitrogen). 3. Assay reagents and instruments required for fusion protein validation, such as a confocal microscope.
2.2. Cell Culture
1. 6-well clear cell culture plates. 2. 96-well white cell culture plates. 3. Appropriate cell line for transfection, such as COS-7 or HEK293FT. 4. Media appropriate for the cell line, such as Dulbecco’s modified Eagle’s medium (DMEM) containing 0.3 mg/mL glutamine, 100 IU/mL penicillin, 100 mg/mL streptomycin and 10% fetal calf serum. 5. DMEM without phenol red containing 0.3 mg/mL glutamine, 100 IU/mL penicillin, 100 mg/mL streptomycin, 10% fetal calf serum and 25 mM HEPES. 6. Transfection reagent, such as Genejuice (Novagen-Merck). 7. 0.05% trypsin-0.53 mM ethylenediamine tetraacetic acid (EDTA).
BRET Analysis of Protein–Protein Interactions
2.3. Detection of BRET
175
1. Coelenterazine substrate, such as 60 mM EnduRen (Promega), dissolved in dimethylsulfoxide (DMSO). 2. Microplate luminometer capable of measuring light through two filters. Examples include the VICTOR Light (PerkinElmer), Mithras LB 940 (Berthold Technologies) and FLUO star Optima or POLARstar Optima (BMG Labtech). 3. A scanning spectrometer for visualization of the spectral shift observed with BRET is optional. Examples include the Spex fluorolog or fluoromax (Jobin Yvon), the Cary Eclipse (Varian) and the FlexStation II (Molecular Devices).
3. Methods There are now a number of variations to the BRET assay methodology. Consequently, the technique will be illustrated primarily using extended BRET (eBRET) (9) to monitor a ligand-induced interaction between proteins over time in adherent live cells. eBRET is similar to the other derivations (BRET1 and BRET2), but has the advantage of being able to monitor interactions for longer periods in real time (2, 9). Variations to this protocol, including the use of BRET1 and BRET2 and different approaches to calculating the BRET ratio, will then be described in the ‘Notes’ with cross-referencing from the relevant section. The BRET assay procedure is summarized in Fig. 14.1.
Fig. 14.1. An illustration of the BRET protocol using a microplate luminometer. Donor- and acceptor-linked fusion proteins are expressed in live cells and, following substrate addition, light emission is detected through two filters. Reprinted with permission from Ref. (1).
176
Pfleger
3.1. Generation and Validation of Fusion Constructs
1. Fusion constructs are generated by inserting the cDNA for the protein of interest in-frame into a suitable expression vector such as pcDNA3.1 (Invitrogen), containing the cDNA for the donor (a variant of Renilla luciferase; Rluc) or acceptor (a variant of green fluorescent protein; GFP) (5). Currently, Rluc8 (7) and Venus (8) are arguably the best combination of donor and acceptor for live cell detection of protein–protein interactions using BRET (10). The choice of donor–acceptor combination is also dependent upon the form of coelenterazine substrate used (see Note 1). 2. Using mutagenesis, the stop codon between the cDNA sequences is removed and replaced with a linker region if necessary (see Note 2). 3. The fusion proteins are tested for detectable luminescence (using a luminometer following addition of coelenterazine substrate) or fluorescence (using a fluorometer following direct laser excitation) (see Note 3). 4. The fusion proteins are validated with respect to function of the protein of interest. For example, if they are receptors, ligand binding and/or secondary signalling assays can be utilized to ensure addition of the donor or acceptor molecule has not altered ligand affinity/efficacy/potency. The use of confocal microscopy is also recommended to ensure correct protein localization (see Note 4).
3.2. Cell Culture
1. Cells are distributed in appropriate media into 6-well clear cell culture plates such that they are 50–80% confluent after 24 h (or as appropriate for the selected transfection reagent). 2. Cells are maintained at 37C, 5% CO2 in a humidified incubator. 3. After 24 h, cells are transfected with an appropriate concentration and ratio of donor to acceptor cDNA (see Note 5). 4. For subsequent detection of BRET in an adherent layer, the cells are detached using trysin-EDTA after a further 24 h. The cells are resuspended in HEPES-buffered DMEM without phenol red, and 40–100 mL distributed per well into a 96well white cell culture plate (see Note 6). 5. The cells are maintained at 37C, 5% CO2 in a humidified incubator for a further 24 h to allow attachment. 6. As an option, relative expression of fluorescent and luminescent fusion proteins is assessed prior to detection of BRET. A separate aliquot of each sample is excited directly by a laser followed by measurement of fluorescence. A coelenterazine substrate is then added to the same sample followed by measurement of luminescence (see Note 7).
BRET Analysis of Protein–Protein Interactions
3.3. Detection of BRET
177
1. EnduRen coelenterazine substrate (Promega) is reconstituted in tissue culture grade dimethylsulfoxide (DMSO). Care is taken to ensure the substrate is entirely resuspended, which is likely to require extensive vortexing for up to 10 min and warming to 37C. Aliquots are stored at –20C protected from light (see Note 8). 2. Immediately prior to adding to cells, the EnduRen substrate is diluted in HEPES-buffered DMEM without phenol red at 37C to produce a working concentration of 600 mM (10 final concentration). The substrate continues to be protected from light (see Note 9). 3. The diluted EnduRen is added to the media on the cells, which is then incubated at 37C, 5% CO2 in a humidified incubator for at least 1.5 h prior to detection of BRET (see Note 10). 4. BRET is detected using a luminometer capable of measuring light through two filter windows, namely 440–500 nm and 510–590 nm when using EnduRen as substrate, Rluc8 as donor and Venus as acceptor. Light from each well is measured through each filter (either simultaneously or sequentially) for 1–5 s before moving to the next well (see Note 11). 5. Measurements are repeated as required, which can be automated if using an instrument with appropriate kinetics software. 6. When investigating ligand- (or reagent-) modulated interactions over time, measurements are taken for a period prior to treatment. Ligand (or reagent) is then added (by injection if time points are required immediately after treatment) and repeated measurements are taken over time to evaluate the effect. In parallel, duplicate samples are treated with vehicle only (see Note 12). 7. A further option is to visualize the spectral shift characteristic of BRET using scanning spectrometry, whereby a secondary peak or shoulder appears at a wavelength characteristic of the acceptor emission (10) (see Note 13).
3.4. Calculation and Interpretation of the BRET Signal
1. For each sample, the light emission detected through the long-wavelength emission filter (e.g. 510–590 nm for eBRET) is divided by the light emission detected through the short-wavelength emission filter (e.g. 440–500 nm for eBRET). This in itself is not the ‘BRET signal’ as the background signal needs to be taken into account. 2. When calculating a ligand- (or reagent-) induced BRET signal, the above ratio for the vehicle only-treated sample is subtracted from the same ratio for the ligand- (or reagent-) treated sample (2, 9). If treatment with the ligand (or
178
Pfleger
reagent) results in a negative ligand-induced BRET ratio, this implies that there are fewer interactions and/or those occurring are weaker and/or more transient than those observed prior to ligand (or reagent) addition. For example, this may be the case with inverse agonism of an interaction dependent upon active receptor conformation. Alternatively, a conformational change may have occurred resulting in greater distance or less favourable relative orientation between donor and acceptor (see Note 14). 3. The data obtained by scanning spectrometry can also be used to quantify the BRET signal. The area under the curve within wavelength windows corresponding to the filters in the luminometer can be ascertained so that BRET is calculated in a similar manner to that described above for dual-filter luminometry (see Note 15). 4. The BRET signal can be plotted against time to produce kinetic profiles, examples of which are shown in Fig. 14.2. Apparent association (or dissociation) rate constants can potentially be calculated from such data (11).
Fig. 14.2. Modulation of protein–protein interactions monitored by eBRET in real-time. The dose-dependency of eBRET kinetic data illustrated using the angiotensin II-induced interaction between angiotensin II receptor type 1A (AT1AR)/Rluc and EGFP/b-arrestin 1. Data shown are mean – SE of four independent experiments. Transiently co-transfected COS-7 cells were pre-incubated for 2 h with EnduRen, then assayed for 20 min pretreatment and 180 min post-treatment with vehicle or agonist. Measurements were taken in real time at 37C. Reprinted from Ref. (9) with permission from Elsevier.
5. BRET concentration-response curves are produced by replotting BRET data, such as that illustrated in Fig. 14.2, as BRET signal against the logarithm of ligand concentration. The concentration eliciting a half-maximal response (EC50 value) can be calculated from such data following curve-fitting by non-linear regression (11).
BRET Analysis of Protein–Protein Interactions
179
6. Data can be plotted as BRET signal against the relative fluorescent/luminescent protein expression ratio. Bouvier and coworkers have proposed that specific interactions result in a saturation curve and non-specific interactions result in a ‘quasilinear curve’ (12–14). Such assays may include correlation of fluorescence or luminescence with protein expression using radioligand-binding assays (12, 14). These assays have also been used to compare apparent affinity by generating BRET50 values that represent the relative amount of acceptor-linked fusion protein over donor-linked fusion protein required to produce 50% of the maximal BRET signal (12–14) (see Note 16). 7. The assessment of competition between interacting proteins has also been used to provide evidence for interaction specificity (15, 16). Donor- and acceptor-linked (‘labelled’) fusion proteins are expressed in the presence and absence of unlabelled protein that competes for association with the labelled proteins if the interactions are specific. A decrease in BRET signal results, although it is important to ensure that this is not simply a reflection of reduced expression of the labelled proteins. A negative control sample co-expresses a similar unlabelled protein that does not interact with the proteins of interest and should therefore not affect the BRET signal between the labelled proteins. 8. The Z0 -factor for calculating the suitability of a high-throughput screening assay is calculated with respect to the mean and standard deviation (SD) of control data using the equation Z0 = 1 – ((3SD of positive control + 3SD of negative control)/ |mean of positive control – mean of negative control|) (17). For assessment of a ligand-induced BRET high-throughput screening assay, the ‘positive control’ data should be the mean and SD of the (long-wavelength emission)/(short-wavelength emission) ratio for the ligand-treated samples. The ‘negative control’ data should be the mean and SD of the same ratio for the vehicle-only treated samples. The mean BRET signal is effectively the difference between these means; however, calculation of the Z0 -factor in this manner allows the variance in both the ratios to be considered (see Note 17).
4. Notes 1. There are a number of donor and acceptor combinations available for BRET. Renilla luciferase tends to be used almost exclusively; however, this may be codon-humanized and/or
180
Pfleger
mutated (an example being Rluc8 (7)). When using coelenterazine h (BRET1) or EnduRen (eBRET), a yellow fluorescent protein (YFP; an example being Venus (8)) is generally preferred (11), although enhanced green fluorescent protein (EGFP) has also been used successfully (9). When using DeepBlueC (BRET2), GFP2 or GFP10 are preferred acceptors (1, 2). 2. One of the determinants of efficient resonance energy transfer is relative orientation of the donor and acceptor dipoles. Consequently, incorporating a linker region between the proteins of interest and the donor or acceptor can enable greater freedom of movement, thereby potentially increasing the probability of optimal relative orientation being achieved (4). 3. If low relative luminescence or fluorescence counts are observed, assessment of various parameters needs to be considered including: substrate viability; presence of a reducing agent such as ascorbic acid; cDNA sequence of fusion proteins; transfection optimization with respect to amount and ratio of cDNAs; cell number; and instrument calibration. 4. If a protein of interest is not functioning correctly, and the cDNA has been sequenced to ensure there are no errors, the donor or acceptor ‘‘label’’ may be interfering with protein function. Repositioning the label to the other end of the protein or possibly an internal peripheral region may reduce such interference. Alternatively, increasing the length of linker between label and protein of interest may help. 5. A titration should be carried out to establish the optimal ratio of donor to acceptor cDNA. Typically, a protein concentration of 1:3 or 1:4 (donor:acceptor) is adopted; however, the relationship between cDNA quantity and final concentration of functional protein expressed is not always consistent. There may also be occasions when a 1:1 protein ratio is desirable even if the BRET efficiency is suboptimal. If non-ligand- (or non-reagent-) mediated interactions are to be assessed, a second population of cells expressing only the donor-linked fusion protein is also required. The expression level of the donor-linked fusion protein should be similar in samples with and without co-expression of the acceptor-linked fusion protein. 6. Cells can also be assessed in suspension by detaching, resuspending and aliquoting into a 96-well white isoplate immediately prior to detection of BRET. 7. Measurement of relative expression of fluorescent and luminescent fusion proteins is particularly important if constitutive interactions are to be assessed using BRET saturation assays as described by Bouvier and co-workers (12–14).
BRET Analysis of Protein–Protein Interactions
181
8. Alternative substrates are coelenterazine h (dissolved in methanol or ethanol; from Molecular Probes) and DeepBlueC (dissolved in anhydrous or absolute ethanol; from Perkin Elmer). These are agitated gently until resuspended and again stored at –20C, protected from light. 9. Coelenterazine h and DeepBlueC are diluted in Dulbecco’s phosphate-buffered saline (D-PBS; from Gibco) with CaCl2, MgCl2 and D-glucose to produce a working concentration of 50 mM (10 final concentration). 10. When using coelenterazine h and DeepBlueC, the media on the cells is removed and replaced with D-PBS (plus CaCl2, MgCl2 and D-glucose), taking extreme care not to detach cells. The substrate is then added immediately prior to detection of BRET without the incubation period required for EnduRen. 11. The 440–500 nm and 510–590 nm filter combination is also typically used for BRET1 with coelenterazine h as substrate, any Rluc variant as donor and any YFP as acceptor (18). A filter combination of 400–475 nm and 500–550 nm is typically used for BRET1 (coelenterazine h) or eBRET (EnduRen) when EGFP is used as the acceptor (9). Finally, a filter combination of 370–450 nm and 500–530 nm is typically used for BRET2 with DeepBlueC as substrate, any Rluc variant as donor and GFP2 or GFP10 as acceptor (12). 12. A second population of cells expressing only the donor-linked fusion protein may be assayed in parallel with those containing both donor- and acceptor-linked proteins, particularly when investigating non-ligand- (or non-reagent-) mediated interactions. 13. Scanning spectrometry can be used to visualize eBRET, BRET1 and BRET2. Rluc8 is far more amenable than native or codon-humanized Rluc to BRET2 detection by this method (10). 14. An alternative method of accounting for the background signal is to subtract the ratio of emissions for a sample containing only the donor-linked fusion protein from the ratio of emissions for a sample containing both donor- and acceptorlinked proteins. This method can be used for both constitutive and ligand- (or reagent-) mediated interactions. It is assumed that the ratiometric nature of the BRET calculation accounts for differences in protein expression between samples with and without acceptor-linked fusion protein. Nevertheless, efforts should be made to express similar amounts of this protein in both cell populations. It is difficult to interpret a ‘‘negative’’ BRET signal using this calculation method. It should certainly not be interpreted as protein dissociation as
182
Pfleger
there is no acceptor-linked fusion protein present in the background sample. Again, ensuring consistent protein expression levels may help to alleviate such results if they are observed. The lack of a BRET signal, regardless of calculation method, does not provide conclusive evidence of a lack of protein– protein interaction as the high proximity- and orientationdependence of resonance energy transfer means that it is possible for donor- and acceptor-linked proteins to interact without a signal being detected. 15. An alternative method of calculating the BRET signal from scanning spectrometry data is to normalize the emission spectra to the peak from Rluc, denoting this as an intensity of 1. The BRET signal is then calculated using the area under the curve between 500 and 550 nm. The background is taken as the area under the curve in this wavelength region when a sample containing only the donor-linked fusion protein is assessed (19), or indeed when a vehicle-only treated sample is used to calculate a ligand- (or reagent-) induced BRET signal. 16. The use of BRET saturation assays to assess constitutive interactions has been questioned recently (20), although the criticisms have been strongly disputed by the proponents of the concept (21, 22). 17. Statistical analysis of BRET assays can also be carried out using ANOVA with suitable post-tests, or Student’s t-tests. Again, this can be done by comparing the variance in the ratios from ligand-treated and vehicle-treated samples (2).
Acknowledgements The author would like to thank Professor Sanjiv Sam Gambhir and Dr. Atsushi Miyawaki for generously providing Rluc8 and Venus cDNA, respectively. The author and his work using the BRET methodology have been funded by the National Health and Medical Research Council of Australia in the form of a Peter Doherty Research Fellowship (#353709), Project Grants (#404087 and #566736) and a Development Grant (#513780). References 1. Pfleger, K. D. G., and Eidne, K. A. (2006) Illuminating insights into protein-protein interactions using bioluminescence resonance energy transfer (BRET). Nat Methods 3, 165–174.
2. Pfleger, K. D. G., Seeber, R. M., and Eidne, K. A. (2006) Bioluminescence resonance energy transfer (BRET) for the real-time detection of protein–protein interactions. Nat Protoc 1, 337–345.
BRET Analysis of Protein–Protein Interactions 3. Milligan, G., and Bouvier, M. (2005) Methods to monitor the quaternary structure of G-protein-coupled receptors. FEBS J 272, 2914–2925. 4. Wu, P., and Brand, L. (1994) Resonance energy transfer: methods and applications. Anal Biochem 218, 1–13. 5. Pfleger, K. D. G., and Eidne, K. A. (2003) New technologies: bioluminescence resonance energy transfer (BRET) for the detection of real time interactions involving G-protein coupled receptors. Pituitary 6, 141–151. 6. Pfleger, K. D. G., and Eidne, K. A. (2005) Monitoring the formation of dynamic G protein-coupled receptor–protein complexes in living cells. Biochem J 385, 625–637. 7. De, A., Loening, A. M., and Gambhir, S. S. (2007) An improved bioluminescence resonance energy transfer strategy for imaging intracellular events in single cells and living subjects. Cancer Res 67, 7175–7183. 8. Nagai, T., Ibata, K., Park, E. S., Kubota, M., Mikoshiba, K., and Miyawaki, A. (2002) A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat Biotechnol 20, 87–90. 9. Pfleger, K. D. G., Dromey, J. R., Dalrymple, M. B., Lim, E. M. L., Thomas, W. G., and Eidne, K. A. (2006) Extended bioluminescence resonance energy transfer (eBRET) for monitoring prolonged protein–protein interactions in livecells. Cell Signal 18, 1664–1670. 10. Kocan, M., See, H.B., Seeber, R. M., Eidne, K. A., and Pfleger, K. D. G. (2008) Demonstration of improvements to the bioluminescence resonance energy transfer (BRET) technology for the mointoring of G proteincoupled receptors in live cells. J Biomol Screen 13, 888–898. 11. Hamdan, F. F., Audet, M., Garneau, P., Pelletier, J., and Bouvier, M. (2005) Highthroughput screening of G protein-coupled receptor antagonists using a bioluminescence resonance energy transfer 1-based beta-arrestin2 recruitment assay. J Biomol Screen 10, 463–475. 12. Mercier, J. F., Salahpour, A., Angers, S., Breit, A., and Bouvier, M. (2002) Quantitative assessment of b1- and b2-adrenergic receptor homo- and heterodimerization by bioluminescence resonance energy transfer. J Biol Chem 277, 44925–44931. 13. Germain-Desprez, D., Bazinet, M., Bouvier, M., and Aubry, M. (2003) Oligomerization of transcriptional intermediary factor 1 regulators and interaction with
14.
15.
16.
17.
18.
19.
20.
21.
22.
183
ZNF74 nuclear matrix protein revealed by bioluminescence resonance energy transfer in living cells. J Biol Chem 278, 22367–22373. Breit, A., Lagace, M., and Bouvier, M. (2004) Hetero-oligomerization between b2- and b3adrenergic receptors generates a b-adrenergic signalling unit with distinct functional properties. J Biol Chem 279, 28756–28765. Kroeger, K. M., Hanyaloglu, A. C., Seeber, R. M., Miles, L. E., and Eidne, K. A. (2001) Constitutive and agonist-dependent homooligomerization of the thyrotropin-releasing hormone receptor. Detection in living cells using bioluminescence resonance energy transfer. J Biol Chem 276, 12736–12743. Ayoub, M. A., Couturier, C., Lucas-Meunier, E., Angers, S., Fossier, P., Bouvier, M., and Jockers, R. (2002) Monitoring of ligand-independent dimerization and ligand-induced conformational changes of melatonin receptors in living cells by bioluminescence resonance energy transfer. J Biol Chem 277, 21522–21528. Zhang, J. -H., Chung, T. D. Y., and Oldenburg, K. R. (1999) A simple statistical parameter for use in evaluation and validation of high throughput screening assays. J Bio Mol Screen 4, 67–73. Angers, S., Salahpour, A., Joly, E., Hilairet, S., Chelsky, D., Dennis, M., and Bouvier, M. (2000) Detection of b2-adrenergic receptor dimerization in living cells using bioluminescence resonance energy transfer (BRET). Proc Natl Acad Sci USA 97, 3684–3689. McVey, M., Ramsay, D., Kellett, E., Rees, S., Wilson, S., Pope, A. J., and Milligan, G. (2001) Monitoring receptor oligomerization using time-resolved fluorescence resonance energy transfer and bioluminescence resonance energy transfer. J Biol Chem 276, 14092–14099. James, J. R., Oliveira, M. I., Carmo, A. M., Iaboni, A., and Davis, S. J. (2006) A rigorous experimental framework for detecting protein oligomerization using bioluminescence resonance energy transfer. Nat Methods 3, 1001–1006. Bouvier, M., Heveker, N., Jockers, R., Marullo, S., and Milligan, G. (2007) BRET analysis of GPCR oligomerization: newer does not mean better. Nat Methods 4, 3–4. Salahpour, A., and Masri, B. (2007) Experimental challenge to a ‘rigorous’ BRET analysis of GPCR oligomerization. Nat Methods 4, 599–600.
Chapter 15 Bioluminescent Imaging of MAPK Function with InteinMediated Reporter Gene Assay Akira Kanno, Takeaki Ozawa, and Yoshio Umezawa Abstract For nondestructive analysis of chemical processes in living mammalian cells, here we show a new reporter gene assay for detecting Ras–Raf-1 interactions based on protein splicing of transcription factors with DnaE inteins. The protein splicing induces connection of a DNA-binding protein (modified LexA; mLexA) with a transcription activation domain of a herpes simplex virus protein (VP16AD). Ras is connected with N-terminal DnaE and mLexA, while Raf-1 is connected with C-terminal DnaE and VP16AD. Upon stimulation with EGF, the interaction between Ras and Raf-1 triggers folding of the DnaEs, thereby inducing protein splicing to form mLexA–VP16AD fusion protein and transcription of a reporter gene, firefly luciferase. The extent of Ras–Raf-1 interaction is quantified by measuring the luciferase activity. By using the protein-splicing elements and the reporter gene, the Ras–Raf-1 interaction close to cell membranes can be evaluated. Key words: Luciferase, intein, reporter gene, transcription factor.
1. Introduction The mitogen-activated protein kinase (MAPK) cascade is a pathway that transduces extracellular stimuli to a broad range of biological outputs including cell-cycle progression and proliferation (1). The MAPK signaling has been observed on not only the plasma membrane but also the endoplasmic reticulum, the Golgi apparatus, and mitochondria (2). In the MAPK cascade, the extracellular signals are conveyed via Ras–Raf-1 interaction in living cells. Ras is a well-known oncogenic product, whose gene is frequently mutated in human cancers. It is therefore important to monitor interaction of Ras with Raf-1 in living cells from the pharmaceutical and therapeutical points of view. P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_15, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
185
186
Kanno, Ozawa, and Umezawa
Here we describe a protein-splicing-based reporter gene assay to monitor Ras–Raf-1 interaction in mammalian cells. Protein splicing is a post-translational autocatalytic processing in which an intein is excised out with the concomitant ligation of the flanking exteins (3–6). An important property of the protein splicing is that the substitution of exteins for different peptides does not interfere with the splicing process (7, 8). We use N- and C-terminal halves of an Ssp. DnaE intein as the protein-splicing elements. Modified LexA (mLexA) and a transcription activation domain of a herpes simplex virus protein (VP16AD) were used as the couple of transcription factors. LexA is localized in the nucleus when expressed in mammalian cells. In contrast to LexA, mLexA, which carries two amino acids substitutions R157G and K159E, stays in the cytosol (9). The present reporter gene assay allows us to detect epidermal growth factor (EGF)-induced membraneproximal Ras–Raf-1 interactions in living mammalian cells. The principle of the present method is shown in Fig. 15.1. Interactions between Ras with Raf-1 bring the DnaEs in proximity and undergo correct folding, which induces protein splicing. Consequently, mLexA and VP16AD directly link to each other by a peptide bond. Until mLexA is ligated with VP16AD, the firefly luciferase reporter gene is not transcribed into mRNA. Because the molecular weight of mLexA–VP16AD is 30 kDa, the ligated mLexA–VP16AD can be subjected to passive diffusion toward
Fig. 15.1. Principle for the intein-mediated reporter gene assay. DnaEn (amino acids 1–123) and DnaEc (amino acids 1–36) are connected with mLexA (amino acids 1–229) and VP16AD (amino acids 411–456), respectively. Interested Ras and Raf-1 are linked to the ends of DnaEs. Interaction between Ras and Raf-1 accelerates the folding of DnaEn and DnaEc, and protein splicing results. mLexA and VP16AD are linked together by a peptide bond to obtain a transcriptional activity.
Bioluminescent Imaging of MAPK Function
187
the nucleus. As a result, the extent of the Ras–Raf-1 interaction is evaluated by measuring the magnitude of the luminescence intensity originating from firefly luciferase translated from the mRNA.
2. Materials 2.1. Construction of DNA Plasmids
1. A pcDNA3.1(+) vector (Invitrogen, Groningen, Netherlands) containing the cDNAs of mLexA, the N-terminus of DnaE intein (DnaEn), and Ras. 2. A pcDNA3.1(+) vector (Invitrogen) carrying the cDNA of Raf-1, the C-terminus of DnaE (DnaEc), and VP16AD. 3. pX8luc constructed by substitution of five GAL4-binding sites in pG5luc (Promega Co., Madison, WI) with eight LexA-binding sites. 4. phRL-RK encoding Renilla reniformis luciferase (Promega Co.). The detailed structures of the plasmids are shown in Fig. 15.2. The cDNAs of Ha-Ras and Raf-1 are available from Clontech Laboratories Inc. (Palo Alto, CA). The chimeric cDNAs of mLex–DnaEn and DnaEc–VP16AD in pcDNA3.1(+) (pmLDn and pDcV, respectively) are available from our laboratory on request.
Fig. 15.2. The schematic structures of the constructs. The sequence of the GS linker is (GGGGS)6. MCSs are multiple cloning sites. Ras conveys an extracellular signal to its target of effector proteins, Raf-1. cDNAs encoding each fusion protein are inserted into pcDNA3.1(+). For the construction of pX8luc, five GAL4 binding sites in a pG5luc vector are replaced with eight-repeated LexA operators. ‘‘Promoter’’ indicates a major late promoter of adenovirus.
188
Kanno, Ozawa, and Umezawa
2.2. Cell Culture and Transfection
1. CHO cells stably expressing epidermal growth factor receptor (CHO-EGFR). 2. Dulbecco’s modified Eagle’s medium (D-MEM; SIGMA) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS; Gibco). 3. Ham’s F-12 medium supplemented with 10% (v/v) heatinactivated FBS, 100 units/mL penicillin, and 100 mg/mL streptomycin (Gibco). 4. A transfection reagent, Lipofectamine2000 (Invitrogen). 5. Opti-MEM I (Gibco). 6. Phosphate-buffered saline (PBS) 10 stock: 1.37 M sodium chloride, 27 mM potassium chloride, 100 mM disodium hydrogen phosphate, and 18 mM potassium dihydrogen phosphate (adjust to pH 7.4 with hydrochloric acid). Autoclave the stock solution before storage at room temperature. Prepare working solution by ten times dilution with water, and autoclave the diluted solution.
2.3. Evaluation of Ras–Raf-1 Interaction
1. Epidermal growth factor (EGF) is reconstituted to the concentration of 200 mg/mL in 0.2 mm-filtered 10 mM acetic acid containing 0.1% (w/v) bovine serum albumin (BSA). The EGF solution is stored in a single-use aliquot at –80C or –30C. Avoid repeated freezing and thawing of the EGF stock solution. Working solutions are prepared by dilution with the following Ham’s F-12 medium. 2. Ham’s F-12 medium supplemented with 0.2% (w/v) BSA, 100 units/mL penicillin, and 100 mg/mL streptomycin. 3. PBS 4. Dual-Luciferase Reporter Assay System 100 assays (Promega Co.): This is a kit for measurement of firefly luciferase activities. The kit consists of 10 mL of Luciferase Assay Buffer II, one vial of Luciferase Assay Substrate, 10 mL Stop & Glo Buffer, 200 mL Stop & Glo Substrate (50 ), and 30 mL Passive Lysis Buffer (5 ). 5. Luminometer such as MinilumatLB9507 luminometer; Berthold GmbH & Co. KG, Wildbad, Germany.
3. Methods 3.1. Construction of Plasmids for Mammalian Cell Expression
The Escherichia coli strain DH5 was used as the bacterial host for all plasmid construction. For protein expressions in mammalian cells, we used pcDNA3.1(+), which has a human cytomegalovirus immediate-early (CMV) promoter. Detailed structures of constructs are shown in Fig. 15.2.
Bioluminescent Imaging of MAPK Function
189
1. Construction of pX8luc 1.1 The upstream polyadenylation signal and transcriptional pause site of pG5luc is amplified by PCR to introduce Mlu I and BamH I sites. The LexA-binding site of pSH18-34 is modified by PCR to introduce BamH I and Nhe I sites. These two PCR-amplified fragments are ligated and inserted into the Mlu I and Nhe I sites of pcDNA3.1(+) (see Note 1). 1.2 The fragment of 1,760 bp is released from pG5luc by restriction enzymes Nhe I and Xba I. The fragment contains the major late promoter of adenovirus and the firefly luciferase gene. This fragment is cloned into the abovementioned modified pcDNA3.1(+) (see Notes 2 and 3). 2. Construction of pmLDn–Ras and pDcV–Raf-1 The gene of Ras is amplified by PCR to introduce restriction enzyme sites of EcoR I and Xho I, and cloned into the EcoR I and Xho I sites of pmLDn. The gene of Raf-1 is modified by PCR to introduce restriction enzyme sites of Bam HI and Xba I, and inserted into the Bam HI and Xba I sites of pDcV. 3.2. Cell Culture and Transfection
1. Cultivate CHO-EGFR cells in Ham’s F-12 medium supplemented with FBS, penicillin, and streptomycin at 37C. 2. Seed the CHO-EGFR cells in 12-well culture plates with penicillin- and streptomycin-free D-MEM and grow to 80–90% confluence before transient transfection using Lipofectamine2000 reagent (see Note 4). 3. Cotransfect all cells to be assessed by Dual-Luciferase Reporter Assay (10) (see the next section) with 0.5 mg of pmLDn– Ras, pDcV–Raf-1, and pX8luc and 5 ng of phRL-TK vector. 4. Eight hours after the transfection, replace the medium covering the cells with Ham’s F-12 medium supplemented with FBS, penicillin, and streptomycin, and then incubate the cells at 37C for 24 h in an atmosphere of 5% CO2 (see Note 5).
3.3. Evaluation of Firefly Luciferase Activities
CHO-EGFR cells are transfected under the same experimental conditions in different wells on culture plates; however, variation such as the number of cells and transfection efficiency is not negligible in each replicate. To eliminate these errors, Dual-Luciferase Reporter Assay is performed according to the manufacture’s protocol, in which firefly (Photinus pyralis) and Renilla (Renilla reniformis) luciferases are measured sequentially from a single sample. Firefly luciferase activities are monitored after adding the substrate molecule for firefly luciferase, beetle luciferin. After quantification of the luminescence from firefly luciferase (LF), this reaction is quenched, and the luminescence from Renilla luciferase (LR) is measured with the substrate molecule for Renilla
190
Kanno, Ozawa, and Umezawa
luciferase, coelenterazine. The firefly luminescence normalized against the Renilla luminescence is termed as relative light unit (RLU; RLU = LF/ LR). The calculated RLUs are used for evaluation of Ras–Raf-1 interactions. 1. Prepare an adequate volume of the 1 lysis buffer (250 mL/ well of a 12-well culture plate) by adding 1 volume of 5 passive lysis buffer to 4 volumes of distilled water and mixing well (see Note 6). Mix the provided lyophilized luciferase assay substrate in 10 mL of the supplied luciferase assay buffer II (see Note 7). Prepare a sufficient volume of substrates for Renilla luciferase by mixing 1 volume of Stop & Glo Substrate (50 ) in 50 volumes of Stop & Glo Buffer in a siliconized polypropylene tube (see Note 8). 2. Remove the growth medium from the cultured cells, and gently rinse the cells twice with PBS. Remove the rinse PBS completely before applying the diluted lysis buffer. 3. Dispense 250 mL of the lysis buffer into each well of 12-well culture plates. 4. Rock the culture plates on an orbital shaker gently for 15 min at room temperature. 5. Harvest the lysate with a rubber scraper and suspend the lysate gently. Transfer the lysates to tubes and centrifuge the tubes for 30 s at 15,000g. Transfer 20 mL of the supernatants to vials for measurements of bioluminescence. 6. Add 100 mL of the prepared substrates for firefly luciferase to the vial and gently suspend the mixture five times. Bioluminescence from the sample is measured for 10 s with a luminometer. 7. Add 100 mL of the substrates for Renilla luciferase to the same vial and gently suspend the mixture five times. Bioluminescence from the sample is evaluated for 10 s with the instrument (see Note 9).
4. Notes 1. The CMV promoter in pcDNA3.1(+) is removed by digestion with restriction enzymes Mlu I and Nhe I. 2. Although the fragment carries two Xba I sites, one of the two is not digested by Xba I. It is because that the uncleavable site is methylated by dam methylase of the E. coli strain DH5.
Bioluminescent Imaging of MAPK Function
191
3. Note that the ends of the fragment digested by Nhe I and Xba I are compatible. Treat the host vector with alkaline phosphatase before ligation of DNA fragments. 4. Rinse CHO-EGFR cells with PBS twice after removing the growth media. This washing reduces the number of dead cells after transfection. 5. Wash the cells with PBS after removing before changing penicillin- and streptomycin-free DMEM. This reduces dead cells. 6. Prepare the 1 lysis buffer just before use. 7. The prepared substrate solutions for firefly luciferase are stored in single-use aliquots at –80C. 8. Prepare the reagents just before use. 9. Resuspend the prepared Stop & Glo substrate solution before use. Note: An example of the result is shown in Fig. 15.3, which shows RLUs in an EGF concentration-dependent manner.
Fig. 15.3. Concentration dependence of EGF on RLU. CHO-EGFR cells were cultured in 12-well plates and transfected with 0.5 mg of the pmLDn–Ras and pDcV–Raf-1 (solid squares). All cells to be assayed were transfected with 0.5 mg of pX8luc. To normalize the observed luminescence from firefly luciferase to that from Renilla luciferase, CHOEGFR cells in each well were cotransfected with 5 ng of the phRL-TK. The cells were subject to stimulation with EGF for 24 h, and the luminescence was measured. The concentrations of EGF ranged from 1.0 10–13 to 2.0 10–7 M.
192
Kanno, Ozawa, and Umezawa
Acknowledgments This work was supported by grants from the Japan Science and Technology Agency (JST), and Japan Society for the Promotion of Science (JSPS). References 1. Seger, R., and Krebs, E. G. (1995) The MAPK signaling cascade. FASEB J 9, 726–735. 2. Mor, A., and Philips, M. R. (2006) Compartmentalized Ras/MAPK signaling. Annu Rev Immunol 24, 771–800. 3. Hirata, R., Ohsumi, Y., and Anraku, Y. (1989) Functional molecular masses of vacuolar membrane H+-ATPase from Saccharomyces cerevisiae as studied by radiation inactivation analysis. FEBS Lett 244, 397–401. 4. Kane, P. M., Yamashiro, C. T., Wolczyk, D. F., Neff, N., Goebl, M., and Stevens, T. H. (1990) Protein splicing converts the yeast TFP1 gene product to the 69-kD subunit of the vacuolar H(+)-adenosine triphosphatase. Science 250, 651–657. 5. Noren, C. J., Wang, J. M., and Perler, F. B. (2000) Dissecting the chemistry of protein splicing and its applications. Angew Chem Int Ed 39, 451–466.
6. Paulus, H. (2000) Protein splicing and related forms of protein autoprocessing. Annu Rev Biochem 69, 447–496. 7. Cooper, A. A., Chen, Y. J., Lindorfer, M. A., and Stevens, T. H. (1993) Protein splicing of the yeast TFP1 intervening protein sequence: a model for self-excision. EMBO J 12, 2575–2583. 8. Chong, S. R., and Xu, M. Q. (1997) Protein splicing of the Saccharomyces cerevisiae VMA intein without the endonuclease motifs. J Biol Chem 272, 15587–15590. 9. Rhee, Y., Gurel, F., Gafni, Y., Dingwall, C., and Citovsky, V. (2000) A genetic system for detection of protein nuclear import and export. Nat Biotechnol 18, 433–437. 10. Lorenz, W. W., McCann, R. O., Longiaru, M., and Cormier, M. J. (1991) Isolation and expression of a cDNA encoding Renilla reniformis luciferase. Proc Natl Acad Sci USA 88, 4438–4442.
Chapter 16 Bioluminescence Analysis of Smad-Dependent TGF-b Signaling in Live Mice Jian Luo and Tony Wyss-Coray Abstract TGF-b signaling via the Smad2/3 pathway has key roles in development and tissue homeostasis. Perturbations of the TGF-b signaling are involved in the pathogenesis of many human diseases, including cancer, fibrotic disorders, developmental defects, and neurodegeneration. To study the temporal and spatial patterns of Smad2/3-dependent signaling in living animals, we engineered transgenic mice with a Smad-responsive luciferase reporter (SBE-luc mice). Smad2/3-dependent signaling can be assessed non-invasively in living mice by bioluminescence imaging. To identify the cellular source of the bioluminescence signal, we generated new reporter mice expressing a trifusion protein containing luciferase, red fluorescent protein (RFP), and thymidine kinase under the control of the same SBE promoter (SBE-lucRT mice). SBE-luc and SBE-lucRT mice can be used to study temporal, tissue-specific activation of Smad2/3dependent signaling in living mice as well as for the identification of endogenous or synthetic modulators of this pathway. Key words: TGF-b, Smad, bioluminescence imaging, in vivo, luciferase, immunofluorescence.
1. Introduction The TGF-b superfamily of proteins, including TGF-b 1, 2, 3, activins, and bone morphogenic proteins (BMPs), controls cellular processes ranging from patterning and differentiation to proliferation and apoptosis and has been implicated in tumorigenesis, fibrosis, inflammation, and neurodegeneration (1, 2). TGF-b 1, 2, and 3 activate the TGF-b signaling pathway through a highaffinity transmembrane receptor complex consisting of the TGF-b type I (ALK5) and type II serine/threonine kinase receptor subunits (1, 3). TGF-b binding leads to phosphorylation of ALK5 and recruitment and phosphorylation of receptor-regulated Smad2 or P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_16, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
193
194
Luo and Wyss-Coray
Smad3. Once phosphorylated, these Smads associate with Smad4 and translocate into the nucleus where they can bind to Smad-binding elements (SBE) in the DNA to regulate gene transcription (3). Activins, nodal, growth and differentiation factor (GDF)-8/myostatin, GDF-9, and GDF-11 also signal via Smad2/3 and Smad4 proteins by engaging activin receptors or ALK5 (3–7). In contrast, BMPs recruit Smad1, Smad5, and Smad8 in combination with Smad4 after binding to BMP type I and type II receptors (1, 3). Three TGF-b isoforms (TGF-b1, -b2, and -b3) have been described in the nervous system. Under normal conditions, TGF-b1 expression appears restricted to meningeal cells, choroid plexus epithelial cells, and glial cells, while TGF-b2 and -b3 are expressed in both glia and neurons (8). TGF-b1 helps orchestrate the response to brain injury and has been implicated in a number of disorders of the central nervous system including stroke (9), Parkinson’s disease (10), Alzheimer’s disease (AD) (11), and brain tumors (12). To follow Smad2/3-dependent signaling within a single mouse over time, we engineered transgenic reporter mice that express luciferase in response to activation of Smad2/3 (SBE-luc mice) (13, 14). After injecting a luciferase substrate, we can use bioluminescence imaging to obtain and follow optical signatures in a spatial and temporal manner in living mice. To identify the cellular source of the bioluminescence signal and because no specific antibodies are available to detect luciferase expression in brain tissue (13, 14), we generated new reporter mice for the TGF-b signaling pathway (15). These SBE-lucRT mice express a trifusion protein containing luciferase, red fluorescent protein (RFP), and thymidine kinase (16) under the control of the same SBE promoter as the original SBE-luc reporter mice (13, 14) (see Note 1). We describe here how these mice are used to detect TGF-b signaling: (1) biochemical assay of TGF-b signaling by tissue luciferase; (2) bioluminescence imaging of TGF-b signaling in dissected individual organs; (3) bioluminescence imaging of TGF-b signaling in live animals; (4) confocal immunofluorescence microscopy to detect which cell type displays activated TGF-b signaling.
2. Materials 2.1. Reporter Mice for Smad-Dependent TGFb Signaling
1. SBE-luc mice (13, 14), now available at The Jackson Laboratory (stock no. 005999; Bar Harbor, ME). 2. SBE-lucRT mice (15)
Bioluminescence Analysis of Smad-Dependent TGF-b Signaling in Live Mice
2.2. Animal Preparation
195
1. Surgical dissection tools. 2. 12-well plates. 3. 28-Gauge 1.0-ml syringes. 4. Balance.
2.3. Biochemical Assay of Tissue Luciferase Activity
1. Tail or organ tissue samples from SBE-luc or SBE-lucRT mice. 2. Luciferase assay system kit (Promega, Madison, WI), includes 5 cell culture lysis reagent and luciferase assay reagent. 3. Pellet Pestle1 Disp with tube (Kontes Biotechnology) (see Note 2). 4. Polystyrene, round-bottom centrifuge tubes, or white, flat-bottom microplates, such as Costar 96-well assay plates. 5. Luminometer: tube luminometer (Turner Instruments) or plate-reading luminometer (Molecular Devices) (see Note 3).
2.4. Bioluminescence Imaging
1. CCD camera and computer analysis software (IVIS, Xenogen, Alameda, CA). 2.
2.5. Confocal Immunofluorescence Microscopy
D-Luciferin
(Xenogen) (see Note 4).
1. Microtome sections from SBE-lucRT mice, 40 mm (see Note 5). 2. 24-well plates. 3. TBST (Tris-buffered saline with Tween 20): 10 mM TrisHCL, 150 mM NaCl, 0.05 % v/v Tween 20 (pH 7.35–7.45). 4. 30% H2O2. 5. Pretreatment buffer: 0.6% H2O2, 0.1% Triton-X in TBST. 6. Primary antibodies: rabbit anti-RFP (MAB3216, Chemicon, Temecula, CA), mouse anti-GFAP (Dako, Carpinteria, CA), rat anti-mouse CD68 (MCA1957S, Serotec, Raleigh, NC), mouse anti-NeuN (MAB377, Chemicon, Temecula, CA) (see Note 6). 7. Secondary antibodies: Alexa fluor1 488 donkey anti-rabbit IgG, Cy31-conjugated donkey anti-mouse IgG, Cy31-conjugated donkey anti-rat IgG. 8. Normal donkey serum. 9. Vectashield1 hard setTM mounting medium for fluorescence (Vector Laboratories, Burlingame, CA). 10. Microscope slides and cover slip. 11. Shaker.
196
Luo and Wyss-Coray
3. Methods 3.1. Biochemical Assay of TGF-b Signaling by Tissue Luciferase ( see Note 7 )
1. Make 1 cell culture lysis reagent and add 100 mL to each freshly clipped tail sample (adjust volume for tissue samples) (see Note 8) in pellet pestle disposable tubes. The tip of the tail is cut at 3 weeks of age (about 4 mm long). 2. Using angled scissors, cut tail samples into small pieces. Clean scissors with 70% ethanol solution after each sample, rinse with water, and dry with paper towel. 3. Mechanically grind each tail with disposable pestle, change pestle after each tube. 4. Freeze tubes for 5 min in dry ice, then thaw at room temperature for 10 min. Repeat two more times. 5. After thawing for the last time, put tubes back on normal ice and centrifuge at 4C for 10 min, at 18,000g. 6. Prepare luciferase assay reagent and load into substrate probe of the luminometer. 7. Start and prime the luminometer three times. 8. Load 20 mL supernatant from the sample tubes into assay tubes used for luminometer. Make sure the bottom of the tube is dry. 9. Program the luminometer to perform a 2-s measurement delay followed by a 6-s measurement read for luciferase activity. The read time should be optimized depending on the light signal. 10. Place the tube in the luminometer and initiate reading by injecting 100 mL of luciferase assay reagent into the tube. 11. After all the tubes are analyzed, rinse the injector twice with water, exit and turn off the machine. 12. If a plate-reading luminometer is used, program the luminometer for the appropriate delay and measurement times. Load 20 mL of cell lysate per well and place the plate into the luminometer. Add 100 mL of luciferase assay reagent per well (automatically by the injector).
3.2. Animal Preparation for Bioluminescence Imaging
1. Weigh each mouse. 2. Inject D-luciferin i.p. at a dose of 150 mg/kg from a 40 mg/ mL stock solution, using a 28-gauge, 1.0-mL syringe. 3. Return animals to cages to allow distribution of luciferin throughout tissues (5 min). 4. Anesthetize mice with 2% isofluorane, which typically requires 2–3 min.
Bioluminescence Analysis of Smad-Dependent TGF-b Signaling in Live Mice
197
5. To image individual organs, sacrifice mice by cervical dislocation. Quickly dissect organs and put each organ in separate wells of a 12-well plate. 3.3. Bioluminescence Imaging
1. Start the software and initialize the system. 2. Setup CCD camera. (1) Select appropriate field of view (FOV) that will accommodate the desired number of mice to be imaged at one time. For most of our studies, we use the FOV of 15 cm that allows four normal-sized adult mice to be imaged simultaneously. (2) Select binning to optimize sensitivity vs. spatial resolution. (3) Define exposure time. We begin with 5-min of exposure with a medium binning and adjust the imaging parameters based on intensity of bioluminescence signal (see Note 9). 3. Transfer mice to the stage of the imaging chamber. Position mice so that the anatomic sites of interest are exposed to the camera. Anesthesia for mice is maintained with 1% isoflurane delivered via nose cones. 8. Begin imaging 10 min after injection of luciferin (see Note 10). Obtain a live image to determine whether animals are positioned properly under the camera. Reposition the mice if necessary. 9. Acquire the bioluminescence photograph, using the selected imaging parameters. Obtain images from as many positions as desired. Bioluminescence is automatically presented as a pseudo-color representation superimposed on the gray-scale photograph of each mouse (Fig. 16.1A). 10. Remove mice from the CCD camera and return to cages. Animals typically recover within 5 min. 11. Define manually region of interest (ROI) for each mouse (Fig. 16.1A) (see Note 11). Measure bioluminescence units of photon flux (photons/s) in each ROI. 12. Determine background bioluminescence from an ROI of the same size. This may be obtained from the average of a group of non-transgenic mice (n ¼ 3–5) that were injected with luciferin and were imaged with identical imaging parameters. 13. Subtract background bioluminescence from photon flux in each ROI. 14. For longitudinal studies, the bioluminescence is expressed as fold induction over a baseline obtained before injury or treatment (see Note 12). 15. To image individual organs, transfer the organs in the plate to the stage of the CCD camera. Begin imaging 10 min after injection of luciferin. To compare the bioluminescence signal between different organs from the same animal or between
198
Luo and Wyss-Coray
Fig. 16.1. Detecting Smad-dependent TGF signaling in SBE-lucRT mice. (A) Bioluminescence imaging of TGF-signaling in ‘‘responder’’ SBE-lucRT mice. The mice received 150 mg/kg of luciferin by i.p. injection and were imaged by IVIS 10 min later. Bioluminescence emission from an unmanipulated mouse (left panel) and a mouse with autoimmune inflammation in the CNS (right panel) shows basal TGF-signaling in the brain (ROI 1, left panel) and its increase in the brain (ROI 1, right panel) and spinal cord (ROI 2, right panel) after inflammatory lesion. FOV: 15 cm; exposure time: 5 min; binning: medium (5). B–D. The unmanipulated mouse was sacrificed after imaging and brain sections were stained for RFP, revealed by DAB (B–C) or double immunofluorescence staining (D).
the same organs from different animals, weight each organ immediately after imaging and normalize the bioluminescence signal to weight. 3.4. Confocal Immunofluorescence Microscopy 3.4.1. Day 1
1. Pick sections in 24-well plate and wash in 1 mL 1 TBST three times for 5 min on shaker at 100 rpm (about 0.8g). 2. Pre-treat in pre-treatment buffer for 20 min at room temperature to quench endogenous peroxidases and permeablize tissue, 500 mL/well.
Bioluminescence Analysis of Smad-Dependent TGF-b Signaling in Live Mice
199
3. Wash with 1 mL TBST for each well on the shaker, three times, 5 min each. 4. Block with 10% donkey serum for 1 h, 290 mL/well. Serum is from the animal in which the secondary antibody was raised. All of our secondary antibodies were from donkey in this experiment. 5. Apply primary antibodies (290 mL per well). Dilute the primary antibodies in TBST with 1% serum used for blocking. The anti-RFP (1:200) is paired with each of the following antibodies: anti-GFAP (1:1000), anti-CD68 (1:50), antiNeuN (1:100). 6. Incubate overnight at 4C (see Note 13). 3.4.2. Day 2
1. Wash with 1 ml TBST four times, 5 min each on shaker. 2. Apply secondary antibodies (diluted 1:500 in TBST), 290 mL/well, for 1 h at room temperature, on shaker. Protect the sections from light from this step since the secondary antibodies are fluorescent. 3. Wash with 1 mL TBST four times, 5 min each on shaker. 4. Transfer sections to distilled water in a flat container (e.g., Petri dish) and pick up sections onto superfrost slides. Let dry briefly and coverslip with Vectashield1 hard setTM mounting medium (see Note 14). Place slides with coverslips in the dark at room temperature to allow mounting medium to harden. 5. Results (see Note 15): RFP Staining cells- - - - - - - - - - - green Cell type marker staining cells- - - red Double Staining cell- - - - - - - - - -yellow
4. Notes 1. In approximately 30–45% of SBE-luc (13, 14) and 10% of SBE-lucRT (15), the transgene-positive mice do not show an induction of the transgene in response to injury, although primary astrocytes from all transgene positive mice responded similarly to stimulation by TGF-b1. Such ‘‘non-responder’’ mice had no basal reporter gene activity in their tissues (luciferase activity was similar to nontransgenic mice) and could be identified by a lack of luciferase activity in tail biopsies. The reason for this is not clear, but may be due to chromatin
200
Luo and Wyss-Coray
modification. To screen ‘‘responder’’ mice, two 2-mm tail biopsies are obtained from each mouse, one for genotyping by PCR and the other for tissue luciferase assay. 2. For quantitative analysis of tough tissues such as skin and intestine, use a glass tissue grinder instead. 3. Any high-quality luminometer can be used for these assays. For best results, the reactions should be initiated within the measuring chamber of the luminometer. 4.
D-Luciferin can be prepared as a 40 mg/mL stock solution in sterile distilled water. The solution is stored in aliquots at – 20C (–80C for long-term storage). The compound is light sensitive, so the reagent and solution should be protected from light as much as possible.
5. Any section method (cryostat and paraffin) can be used. This protocol uses microtome sections from the brain tissue. The mice were anesthetized with 400 mg/kg chloral hydrate and transcardially perfused with 0.9% saline. Brains and spinal cords were removed and were fixed for 24 h in 4% paraformaldehyde and cryoprotected in 30% sucrose. Brains were sectioned at 40 mm using a freezing microtome (Leica, Allendale, NJ) and stored in cryoprotective medium. 6. Prior to double labeling, it is important to test each primary antibody individually and select the best pre-treatment. It will be ideal if the two primary antibodies require the same pretreatment. Otherwise, it is recommended to perform a test by treating sections with both pre-treatments and then stain for each antibody individually. Another alternative is to do immunostaining sequentially for each antibody, so pre-treatments are done separately. 7. For quantitative analysis, obtain weight of each organ before homogenization, and normalize the bioluminescence signal to weight (express as RLU/mg tissue). 8. For organs, we usually use 100–400 mL lysis reagent depending on how much tissue is being analyzed. 9. The key is to obtain a bioluminescence photograph that the signal of interest is above the noise level (100 counts) and below CCD saturation (65,535 counts). Adjust exposure time and/or binning and repeat the image acquisition if the signal level is unacceptable. If the number of photons emitted exceeds the capacity of the CCD camera leading to overexposure, the measurement will be inaccurate and the actual luciferase activity may be higher. 10. After luciferase injection (ip), the bioluminescence signal gradually increases and reaches a plateau at 10 min, which lasts for 15–20 min, so the best time window of imaging is
Bioluminescence Analysis of Smad-Dependent TGF-b Signaling in Live Mice
201
10–25 min after luciferin administration. However, for longitudinal studies, it is recommended to image the animals at the same time after luciferin administration throughout an experiment. If a different imaging system is used, the precise timing of the plateau in signal should be measured. 11. Depending on the anatomic sites of interest, we use customized circles/squares. Some examples of ROIs that we commonly used: for brain, a 1.6-cm diameter circle; for intestine, a 2.5-cm diameter circle; for spinal cord, a 1.6 cm (width) 4.0 cm (height) ellipse (Fig. 16.1A). 12. For longitudinal studies, repeated imaging within short period of time can lead to animal death. Also, the possible effects of anesthesia should be taken into consideration. It is therefore important to keep the percentage of anesthetic and duration of anesthesia constant for all mice throughout an experiment. For repeated imaging, it is critical to determine the time interval between two imagings. This can be done by recording the ‘‘baseline’’ signal without injecting luciferin, then taking consecutive images after luciferin administration and noting the time from luciferin injection to signal returning to the ‘‘baseline’’ level. The interval time is 2 h in SBE-luc mice, i.e., wait for at least 2 h for a second imaging. 13. For many primary antibodies, protocols call for 1-hour incubation at room temperature, but with brain sections overnight at 4C is usually better. 14. If counterstain with DAPI is desired, use Vectashield1 hard setTM mounting medium for fluorescence with DAPI. 15. In normal SBE-luc mice, the brain shows the highest basal luciferase activity among all the organs (13). In the brain, the hippocampus has the highest basal luciferase activity compared with other brain regions (the cortex, thalamus, cerebellum, and brain stem) (14). Consistent with pSmad2 staining (14), baseline TGF-b signaling in SBE-lucRT mice was detected in large pyramidal neurons in the hippocampus (15) (Fig. 16.1B, D) and cortex and Purkinje cells of the cerebellum.
Acknowledgments We thank B. Debsi, W. Wang, H. Yang, and E. Hashemi for animal husbandry and genotyping. This work was supported by grants from NIH (AG23708, AG20603) and the John Douglas French Alzheimer’s Foundation (T.W-C).
202
Luo and Wyss-Coray
References 1. Dennler, S., Goumans, M. J., and ten Dijke, P. (2002) Transforming growth factor beta signal transduction. J Leukoc Biol 71, 731–740. 2. Massague, J., Blain, S. W., and Lo, R. S. (2000) TGFbeta signaling in growth control, cancer, and heritable disorders. Cell 103, 295–309. 3. Shi, Y., and Massague, J. (2003) Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 113, 685–700. 4. Mazerbourg, S., Klein, C., Roh, J., KaivoOja, N., Mottershead, D. G., Korchynskyi, O., Ritvos, O., and Hsueh, A. J. (2004) Growth differentiation factor-9 signaling is mediated by the type I receptor, activin receptor-like kinase 5. Mol Endocrinol 18, 653–665. 5. Oh, S. P., Yeo, C. Y., Lee, Y., Schrewe, H., Whitman, M., and Li, E. (2002) Activin type IIA and IIB receptors mediate Gdf11 signaling in axial vertebral patterning. Genes Dev 16, 2749–2754. 6. Rebbapragada, A., Benchabane, H., Wrana, J. L., Celeste, A. J., and Attisano, L. (2003) Myostatin signals through a transforming growth factor beta-like signaling pathway to block adipogenesis. Mol Cell Biol 23, 7230–7242. 7. Reissmann, E., Jornvall, H., Blokzijl, A., Andersson, O., Chang, C., Minchiotti, G., Persico, M. G., Ibanez, C. F., and Brivanlou, A. H. (2001) The orphan receptor ALK7 and the Activin receptor ALK4 mediate signaling by Nodal proteins during vertebrate development. Genes Dev 15, 2010–2022. 8. Unsicker, K., Flanders, K. C., Cissel, D. S., Lafyatis, R., and Sporn, M. B. (1991) Transforming growth factor beta isoforms in the adult rat central and peripheral nervous system. Neuroscience 44, 613–625. 9. Kim, J. S., Yoon, S. S., Kim, Y. H., and Ryu, J. S. (1996) Serial measurement of interleukin-6, transforming growth factor-beta, and
10.
11.
12.
13.
14.
15.
16.
S-100 protein in patients with acute stroke. Stroke 27, 1553–1557. Mogi, M., Harada, M., Kondo, T., Narabayashi, H., Riederer, P., and Nagatsu, T. (1995) Transforming growth factor-beta 1 levels are elevated in the striatum and in ventricular cerebrospinal fluid in Parkinson’s disease. Neurosci Lett 193, 129–132. van der Wal, E. A., Gomez-Pinilla, F., and Cotman, C. W. (1993) Transforming growth factor-beta 1 is in plaques in Alzheimer and Down pathologies. Neuroreport 4, 69–72. Platten, M., Wick, W., and Weller, M. (2001) Malignant glioma biology: role for TGF-beta in growth, motility, angiogenesis, and immune escape. Microsc Res Tech 52, 401–410. Lin, A. H., Luo, J., Mondshein, L. H., ten Dijke, P., Vivien, D., Contag, C. H., and Wyss-Coray, T. (2005) Global analysis of Smad2/3-dependent TGF-beta signaling in living mice reveals prominent tissue-specific responses to injury. J Immunol 175, 547–554. Luo, J., Lin, A. H., Masliah, E., and WyssCoray, T. (2006) Bioluminescence imaging of Smad signaling in living mice shows correlation with excitotoxic neurodegeneration. Proc Natl Acad Sci USA 103, 18326–18331. Luo, J., Ho, P. P., Buckwalter, M. S., Hsu, T., Lee, L. Y., Zhang, H., Kim, D. K., Kim, S. J., Gambhir, S. S., Steinman, L., and Wyss-Coray, T. (2007) Glia-dependent TGF-beta signaling, acting independently of the TH17 pathway, is critical for initiation of murine autoimmune encephalomyelitis. J Clin Invest 117, 3306–3315. Ray, P., De, A., Min, J. J., Tsien, R. Y., and Gambhir, S. S. (2004) Imaging tri-fusion multimodality reporter gene expression in living subjects. Cancer Res 64, 1323–1330.
Chapter 17 Bioluminescence Imaging of Calcium Oscillations Inside Intracellular Organelles Carlos Villalobos, Marı´a Teresa Alonso, and Javier Garcı´a-Sancho Abstract Ca2+ oscillations inside intracellular organelles are important for regulation of functions such as gene expression at the nucleus, respiration at mitochondria or protein processing at the endoplasmic reticulum. Targeted aequorins are excellent calcium probes for subcellular analysis, but single-cell imaging has proven difficult because of low light yield. Here we describe a procedure that combines virus-based expression of targeted aequorins with photon-counting imaging. This methodology allows real-time resolution of changes of cytosolic, mitochondrial or nuclear Ca2+ signals at the single-cell level. Key words: Bioluminescence imaging, aequorin, herpes simplex virus, calcium oscillations, mitochondria, nucleus, endoplasmic reticulum, anterior pituitary, pancreatic islets of Langerhans, b cells.
1. Introduction Genetically encoded probes, such as aequorins (1), can be targeted to specific subcellular location (2–4). In the presence of Ca2þ, aequorin (AEQ) catalyzes oxidation of the cofactor coelenterazine with emission of blue light. AEQ offers several advantages for measurements of subcellular Ca2+ signals in living cells. Unlike fluorescent probes, aequorin does not require cell radiation for exciting light emission. In addition, it has a larger gain and a wider dynamic range (5). Manipulation of the Ca2+-binding sites together with the use of different synthetic coelenterazines permits to cover a Ca2+ concentration range from 10–8 to 5 10–3 M (1, 6, 7). However, the low amount of light emitted has made difficult the use of this methodology for studies at the single-cell level, which are often required for adequate analysis of subcellular P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_17, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
203
204
Villalobos, Alonso, and Garcı´a-Sancho
Ca2+ oscillations. Here we combine the superb selectivity of targeted aequorin, the high expression induced by a viral vector and the high sensitivity provided by a photon-counting camera to resolve subcellular changes in [Ca2+] at the single-cell level. The herpes simplex virus (HSV) based gene transfer system has unique features that make it suitable for use in mammalian cells (8). It promotes high expression of the transduced gene and is suitable for post-mitotic expression ‘‘in vivo’’ or in primary cultures, two conditions that are closer to the physiological condition than the cell lines models. On the other hand, photon-counting imaging of bioluminescence extends sensitivity to the single-cell level. Calibration of the photoluminescent signal into [Ca2+] requires computation of the fraction of the total luminescence that is emitted at each instant. For this reason, every experiment must be finished by cell lysis in the presence of excess Ca2+ to release the residual luminescence. We describe here protocols that can be applied to studies with cell lines (GH3 pituitary cells), primary cultures (mouse anterior pituitary cells) or ‘‘ex vivo’’ tissues (pancreatic islets of Langerhans), but the procedures should work efficiently with other cells and tissues.
2. Materials 2.1. Cell Preparation, Culture and Expression of Aequorins
1. Solutions for cell dissociation: Trypsin, type III; Collagenase, type 4 (Worthington, LS004186); Hank’s Balanced Salt Solution. Collagenase working solution: 0.2% collagenase in HBSS. 2. Culture media and additives: Dulbecco’s Modified Eagle’s Medium (DMEM); foetal bovine serum (FBS); penicillin/ streptomycin; L-glutamine. Supplemented RPMI medium: RPMI 1640 with 2.5% FBS, 15% horse serum, 2 mM L-glutamine, 100 U/mL penicillin and 100 mg/mL streptomycin. 3. Solution containing 0.25% trypsin and 1 mM ethylendiaminetetraacetic acid (Trypsin/EDTA) 4. Poly-L-lysine-coated coverslips can be obtained commercially. Alternatively, they can be easily prepared by introducing 12-mm diameter glass sterilized coverslips into a 0.01 mg/mL solution of poly-L-lysine. Treat for 15 min and then wash the coverslips twice with water and air-dry for 30–60 min under sterile conditions. 5. Multi-dish 4 wells for 12-mm glass coverslips 6. Coelenterazine and coelenterazine n (Molecular Probes, Invitrogen) are dissolved in methanol at a concentration of 200 mM, aliquoted in 30 mL portions in microcentrifuge
Bioluminescence Imaging of Calcium Oscillations
205
tubes in ice and gassed briefly with nitrogen before closing the tubes. Wrap with aluminium foil and store at –80C for up to 6 months. 2.2. Bioluminescence Imaging
1. HEPES-buffered saline (HBS): 145 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 10 mM glucose, 10 mM sodiumHEPES, pH 7.4. 2. Krebs-Ringer bicarbonate-(KRB): 120 mM NaCl, 5 mM KCl, 2.5 mM CaCl2, 1.2 mM MgCl2, 25 mM NaHCO3, 3 or 10 mM glucose; gassed with 95% O2–5% CO2 to maintain pH at 7.4. 3. Permeabilizing solution: Digitonin dissolved at 100 mM in 10 mM CaCl2. The stock solution of digitonin can be prepared at 10 mM in DMSO. 4. Home-made wood lightproof box to cover the microscope (about 100 100 100 cm). They are also available from commercial sources (see for example, Hamamatsu Photonics). 5. Zeiss Axiovert S100 TV inverted microscope equipped with a Zeiss Fluar 40 , 1.3 NA oil objective equipped with a Xenon XBO75 fluorescence excitation lamp and filters for FITC (Excitation, 490 nm; Emission, >520 nm). 6. Hamamatsu VIM photon counting ICCD camera (C240035) mounted in the bottom port of the microscope. Argus Image Processor and M4314 image intensifier controller. All the above hardware is handled by the Hamamatsu Aquacosmos 2.0 software. 7. Cell perfusion system for living cells mounted in a PH-3 thermostated platform for open 12-mm glass coverslips (Warner Instruments) using a 8-lines gravity-driven perfusion system equipped with pinch valves (VC-8 valve controller). Solutions are heated using a SH-27B inline heating system. All these components may be obtained from Warner Instruments.
3. Methods 3.1. Cell Preparation, Culture and Expression of Aequorins 3.1.1. Cell Preparation and Culture
1. Rat pituitary GH3 cells (ATCC, CCL-82.1) are cultured in supplemented RPMI medium. The cells are grown in 75 cm2 flasks at 37C under atmosphere of 95% air/5% CO2. Cells are trypsinized once a week with 0.25% trypsin-EDTA and subcultured at 1:5 dilution. Duplication
206
Villalobos, Alonso, and Garcı´a-Sancho
time is about 48 h. For the experiments, the cells are seeded on the 12-mm diameter poly-L-lysine-coated coverslips at 3–10104 cells/coverslip. 2. Anterior pituitary (AP) cells are obtained from 12-week-old Wistar rats. The animals are killed by cervical dislocation and pituitaries are quickly removed. The neurointermediate lobe is removed and the AP gland is chopped into little pieces with small dissecting scissors. Cell disaggregation is induced by incubation with 1 mg/mL trypsin in HBSS for 30 min at 37C with gentle shaking. Every 5 min, the cell suspension is passed five times through the tip of a silanized fire-polished Pasteur pipette to help cell dissociation. The cells are then sedimented by centrifugation (5 min at 200g) and washed twice with HBSS. Monodispersed cells are finally plated on poly-L-lysine-coated coverslips (5–15104 cells/coverslip) and cultured in DMEM supplemented with 10% FBS, antibiotics and glutamine. 3. Islets of Langerhans are obtained from 12-week-old Balb/c mice. The mice are killed by cervical dislocation, the pancreatic duct is cannulated with a 27–30 G needle and 1–2 ml of collagenase solution is introduced checking the size increase of the pancreas. The organ is then removed and placed inside a tube containing 1 mL of collagenase solution. After a 5–15 min incubation at 37C with strong shaking (this time may change considerably with different collagenase lots), the tissue is passed repeatedly through the tip of a plastic Pasteur pipette to complete dissociation. At this time 10 mL of ice cold HBBS containing 1% FBS is added. The tissue is allowed to sediment and washed again with cold HBBS/FBS. The tissue is then transferred to a Petri dish under a stereoscopic microscope and the islets (about 100/mouse) are fished with the tip of an automatic pipette. Once isolated, islets are plated at the centre of 12-mm poly-L-lysine-treated coverslips (4–8 islets), allowed to attach undisturbed for 30–60 min and cultured for 24 h in DMEM medium containing 5.6 mM glucose and supplemented with 10% FBS and antibiotics. 3.1.2. Expression of Aequorin by Infection with HSV-1-Derived Amplicon Vectors
Amplicon vectors derived from herpes simplex virus type 1 (HSV1) produce high protein expression in a very wide range of host cells, both dividing and non-dividing (see Note 1). The schematic diagram of a prototype aequorin amplicon is depicted in Fig. 17.1. The detailed protocol of how to prepare and titer HSV amplicon vectors can be found in another issue of this series (9). 1. To facilitate cell adhesion, seed about 3105 GH3 or AP cells on 12-mm diameter poly-L-lysine-coated glass coverslips and place the coverslips in four-well plates containing 0.5 mL of
Bioluminescence Imaging of Calcium Oscillations
207
GFP-aequorin
Multicloning site IE 4/5 promoter
oriS
pHSVgfp-aeq SV40 polyA procaryotic sequences
HSV packaging site
Fig. 17.1. Schematic diagram of a prototype aequorin amplicon. The transcriptional unit contains the immediately early (IE) 4/5 promoter, the corresponding targeted GFP– aequorin chimeric gene and a polyadenylation signal. The two genetic elements from HSV –1, the oris and the HSV packaging sequences, allow replication and packaging of the amplicon. The prokaryotic sequences contain a bacterial origin of replication and an ampicilin selection marker that allow propagation and amplification in Escherichia coli. The detailed protocol of how to prepare and titrate HSV amplicon vectors can be found in another issue of this series (9). Details on targeting sequences and alternative red fluorescent proteins can be searched in Refs. (4 and 14). This figure was reproduced with permission from Ref. (14). Copyright Elsevier (1998).
the culture medium per well. A good attachment is essential, as cells must be perfused with different solutions along the experiment. 2. After an hour to ensure attachment to the glass surface, the cells are infected with an amplicon vector expressing an aequorin targeted to a given subcellular compartment. For this purpose, 5–20 mL of virus stock are added directly into the cell culture medium (see Note 2). The multiplicity of infection (MOI) is 0.1–0.6. In the present protocol we use amplicon vectors expressing the fusion protein GFP– aequorin targeted to the cytosol, nucleus or mitochondria (see Note 3). 3. The islets of Langerhans are allowed to attach to the coverslip for 30–60 min and then 1–3103 infectious virus particles per islet are added. 4. In all the cases, expression time is usually 12–24 h. A 48-h expression period, tested in a few experiments, was found satisfactory as well.
Villalobos, Alonso, and Garcı´a-Sancho
1. Check the expression of the aequorin at 12–24 h postinfection by monitoring the GFP fluorescence under the microscope. The range of positive (green) cells should be 20–40%. 2. Aequorin has to be reconstituted with coelenterazine in order to allow Ca2+-dependent light emission. Different aequorin– coelenterazine combinations may be used to achieve different Ca2+ affinities, depending on the range of the [Ca2+] changes expected (Fig. 17.2). The combination of native aequorin and coelenterazine (AEQ1) is suitable for the 107–3106 range. Using coelenterazine n with native aequorin (AEQ2) extends the upper range to 2105. Finally, the combination of mutated aequorin and coelenterazine n (AEQ3) is suitable for the range between 3106 and 103 M (see Note 4).
100 10–1
AE Q AE Q2 1
10–2
3
10–3
AE Q
3.1.3. Reconstitution of Apoaequorin
Light emission (L/LTOTAL)
208
10–4 10–5
10–7
10–6
10–5
10–4
10–3
[Ca2+] (M)
Fig. 17.2. Calibration curves of different aequorin systems. The three aequorin (AEQ) systems shown, correspond to: wild-type aequorin with either native coelenterazine (AEQ1) or coelenterazine n (AEQ2) or mutated low Ca2+ affinity aequorin and coelentarazine n (AEQ3) (6). The function used to relate Ca2+ and photoluminescence (expressed as fraction of the total counts emitted at every instant, L/LTOTAL) was: [Ca2+] (in M) = [R + (R KTR)1]/[KR(R KR)], where R = [L/(Lmax )]1/n, using the values shown in Table 17.1 for the constants. This figure was redrawn with permission from ref. 5. Copyright Elsevier (2006).
3. For reconstitution, the coverslips containing the cells expressing the apoaequorins (targeted to different organelles and either native or mutated) are transferred to a 4-well plate containing 0.20 ml of HBS. Then, 1 mL of coelenterazine (either native or n, from a 200 mM stock) is added and gently mixed. Finally, the plate is incubated for 1–2 h at room temperature in the dark.
Bioluminescence Imaging of Calcium Oscillations
209
4. Islets of Langerhans are reconstituted in a similar fashion except that they are initially not attached to coverslips. Instead, they are handled with the tip of an automatic pipette and placed in the coelenterazine suspension by hand. The incubation medium for the islets is KRB containing 3 mM glucose and gassed with 95% O2/5% CO2. 3.2. Bioluminiscence Measurements 3.2.1. Bioluminescence Imaging of Subcellular Ca2+
1. Coverslips containing infected cells or islets (see Note 5) are reconstituted with coelenterazine. Then, they are placed in the stage of the microscope into a perfusion chamber thermostated to 37C and perfused continuously with pre-warmed HBS (for GH3 or AP cells) or KRB medium gassed with 5% CO2 (for pancreatic islets) at a rate of 5 mL/mL. 2. The cells are examined for GFP fluorescence using the FITC filters and an adequate microscopic field is chosen. A GFP fluorescence image is captured with the help of the Hamamatsu C2400-35 ICCD camera with the sensitivity set to a minimum (0). 3. After turning off the excitation lamp, a bright field image of the same cells is captured using the same camera. 4. Microscope light is turned off and the dark box doors closed for complete darkness (see Note 6). 5. Sensitivity of the intensifier is set to maximum (10) and photonic emission images are captured with the Hamamatsu VIM photon-counting camera handled with an Argus-20 image processor and integrated every 10-s periods. Total counts per region of interest may range between 2.103 and 2.105 for different cells. Background photonic emissions in regions of interest of similar size in non-expressing cells is typically about (mean–S.D.) 1–1 count per second (cps) per typical cell area (about 2000 pixels). 6. Cells are subjected to the different test treatments using the perfusion system. Three examples of the outcome are shown in Fig. 17.3. 7. Before ending the experiment, it is necessary to perfuse the cells with permeabilizing solution. Digitonin releases all the remaining aequorin counts, which must be added up in order to estimate the total photonic emissions, a value required for calibration in Ca2+ concentrations. Emission of all residual counts may take 2–5 min from the time of lysis. The experiment is finished once aequorin photonic emissions cease. 8. The entire sequence of bioluminescence images is stored in the computer together with the bright field and fluorescence images captured before photon counting.
210
Villalobos, Alonso, and Garcı´a-Sancho
A.
[Ca2+]M (µM) 1.22
0.004
–1
L/LTOTAL(s )
2 min 0.003 0.002
0.88
0.001
0.63 0.46
0.000
B.
4 µM [Ca2+]M
5 min
11 mM G
C.
Fig. 17.3. Examples of Ca2+ oscillations inside organelles measured with aequorin. (A) The trace represents the spontaneous oscillations of mitochondrial Ca2+ in a single anterior pituitary cell expressing mitochondria-targeted aequorin. The images corresponding to one single oscillation are shown on top. Photonic emissions, coded in pseudocolor, have been
Bioluminescence Imaging of Calcium Oscillations
3.3. Image Analysis and Quantification
211
1. Regions of interest (ROIs) are selected with the help of the Aquacosmos software by drawing circles around infected cells according to the fluorescence and bright field images captured at the beginning of the experiment (see Note 7). 2. The same ROIs are pasted on every image of the of bioluminesce sequence. Total photonic emissions in every ROI are computed with the Aquacosmos software to obtain the luminescence emission value (L) for each cell at each point in time. A few ROIs are drawn in regions devoid of cells to compute background luminescence. 3. All the photonic emissions in the bioluminescence images, including those obtained after digitonin permeabilization, are added up using the Aquacosmos software to obtain a bioluminescence image containing all the photonic emissions. The size of the ROI is adjusted to the area in which photons are emitted from each individual cells, which is usually somewhat larger than the size of the cell. Cells with overlapping of photonic emissions are excluded from the analysis. 4. The luminescence values for every ROI at each time value (L) are computed and exported to a worksheet. Background luminescence is subtracted from each L value. For every ROI, the total luminescence, Total(L), is computed by adding up the values of all the images. Then, the following values are computed for every time point (t): l
L: Luminescence emission at time t
l
Sum(L) ¼ L values from t ¼ 0 to t
l
LTOTAL: Total luminescence remaining at time t ¼ Total(L) – Sum(L)
l
% Remaining luminescence: 100 LTOTAL/Total(L)
l
L/LTOTAL
l
[Ca2+] using the algorithms described in Table 17.1.
Fig 17.3. (continued) superimposed to the bright field image. Time sequence goes from left to right and from top to bottom. Interval between images, 10 s. The size of each image box is 10 10 mm. Unpublished results by C. Villalobos, L. Nun˜ez, P. Chamero, M.T. Alonso and J. Garcı´a-Sancho. (B) Glucose-induced mitochondrial Ca2+ oscillations in nine single pancreatic b cells within a Langerhans’ islet expressing mitochondria-targeted aequorin. The upper panels show, from left to right, brightfield, GFP fluorescence and pseudocolor-coded aequorin bioluminescence images (integration of the luminescence emission during the whole experiment; scale at right). The size of each image box is 200 200 mm. This figure was reproduced with permission from Ref. (13). Copyright Elsevier (2008). C. Nuclear Ca2+ oscillations in four individual cells of a pancreatic islet expressing with nucleus-targeted aequorin and stimulated with high (11 mM) glucose. The stimulation period (bar) was 5 min. Left: pseudocolor-coded aequorin bioluminescence image (integration of the luminescence emission during the whole experiment). This figure was reproduced with permission from ref. 5. Copyright Elsevier (2006).
212
Villalobos, Alonso, and Garcı´a-Sancho
Table 17.1 Values of the constants for calibration of several aequorin–coelenterazine combinations KTR
n
l
4.81 107
601
2.3
1
2.23 10
7
348
2.0
0.129
8.47 10
7
1.204
0.138
Condition
KR
AEQ1: AEQwt + COEL AEQ2: AEQwt + COEL n AEQ3: AEQmut + COEL n
156.6 10
3
All the values were obtained at 37C. Calculations were performed using the following formula: [Ca2+] (in M)=[R+(RKTR)1]/(KR(RKR) where R=[L/(LTOTAL )](1/n), where L is the luminescence emitted at the time of measurement and LTOTAL is the addition of the counts present in the tissue at that time, estimated by integrating all the counts from the time of measurement until the release of all the residual luminescence by lysis at the end of the experiment. For more details, see Refs. (5 and 7).
4. Notes 1. Apart from GH3 and AP cells (10–13) and pancreatic islets, this methodology has been successfully applied to express AEQ in HeLa, HEK293 and NIH3T3 cell lines, and in primary cultures of adrenal chromaffin cells, cerebellar granule, sympathetic and dorsal root ganglion neurons, and rat cardiomyocytes and chicken embryonic heart cells (6, 11, 14–16). 2. The virus stocks have titers of 0.2–1 107 ml-1 and are stored at –80C in 50–100 mL aliquots. Virus particles are thermolabile and should be thawed immediately before adding them to the cells, and kept on ice during manipulations. GH3 and AP cells are spherical and adhere to the glass very rapidly; other cells such as HeLa or HEK293 cells need longer times to become properly attached so that it may be better to wait till next day for infection. 3. The use of the fusion protein GFP–aequorin has many advantages over the native aequorin. It allows direct visualization of the expressed protein under the fluorescence microscope, the protein is more stable, and it gives a higher light yield (17). The original GFP–aequorin fusion gene was obtained from Dr. Bruˆlet (17) and modified by PCR to fuse it in frame to the corresponding targeted sequences. The nuclear GFP–aequorin was obtained by fusing the Xenopus nuclear nucleoplasmin gene; the cytosolic GFP–aequorin, by fusing the luciferase gene; and the mitochondrial aequorin by fusing the first 31 amino acids
Bioluminescence Imaging of Calcium Oscillations
213
of the human COX VIII subunit. The low Ca2+-affinity mitochondrial GFP–aequorin was generated by swapping the EcoRV–EcoRI fragment of the aequorin moiety by the mutated region of the low Ca2+ affinity endoplasmic reticulum aequorin, as previously described (14). All of these fusions were cloned in the multicloning site of the pHSVpuc plasmid. Recently, similar fusion proteins with mRFP have been described (4). 4. Ca2+ reaches very different concentrations in different cellular compartments. In cytosol and in nucleus [Ca2+] is about 10–7 M at rest and can increase 10 times or more during cell activation. In the endoplasmic reticulum [Ca2+] is high at rest (near 10–3 M) and decreases during cell activation. In mitochondria [Ca2+] is low at rest (about 107 M) but can increase to mM and even near mM levels during cell activation (6). 5. The islets are placed over the glass bottom (coated with 0.1 mg/mL poly-L-lysine) of the perfusion chamber. Small islets are a better choice because they can be accommodated inside the microscopic field and they usually stick better to the coverslip. The flow is stopped at this stage in order to avoid dragging away the islets. After 2–3 min, the islets stick to the glass bottom and perfusion can be started, first at low rate and then increased progressively to reach about 5 mL/min. 6. Photon counting cameras are extremely sensitive to any contaminating light. Accordingly, any light source inside the dark box must be turned off during photon counting. Putative light sources, such as leads of different operators, even if they are outside the dark box, must be turned off. Some motorized microscopes have internal leads that produce a light leak to the camera. This is the case of Zeiss Axiovert 200, for example. Check this disturbance by turning off the microscope during measurements. 7. Calibration of the recorded signals is dependent on the total amount of photonic emissions, including those released after cell permeabilization. If cell density is excessive or the amount of light emitted by some individual cells is too high, overlap between photonic emissions from different cells may happen, and this could influence the calculations of Ca2+ concentrations. This can be avoided by optimizing expression efficiency and/or by plating the cells at a proper density.
Acknowledgements ´ y Financial support from the Spanish Ministerio de Educacion Ciencia (grant BFU-2006-60157) is gratefully acknowledged.
214
Villalobos, Alonso, and Garcı´a-Sancho
References 1. Shimomura, O., Musicki, B., Kishi, Y., and Inouye, S. (1993) Light-emitting properties of recombinant semi-synthetic aequorins and recombinant fluorescein-conjugated aequorin for measuring cellular calcium. Cell Calcium 14, 373–378. 2. Rizzuto, R., Simpson, A. W., Brini, M., and Pozzan, T. (1992) Rapid changes of mitochondrial Ca2+ revealed by specifically targeted recombinant aequorin. Nature 358, 325–327. 3. Badminton, M. N., Campbell, A. K., and Rembold, C. M. (1996) Differential regulation of nuclear and cytosolic Ca2+ in HeLa cells. J Biol Chem 271, 31210–31214. 4. Manjarres, I. M., Chamero, P., Domingo, B., Molina, F., Llopis, J., Alonso, M. T., and Garcia-Sancho, J. (2008) Red and green aequorins for simultaneous monitoring of Ca2+ signals from two different organelles. Pflugers Arch 455, 961–970. 5. Alonso, M. T., Villalobos, C., Chamero, P., Alvarez, J., and Garcia-Sancho, J. (2006) Calcium microdomains in mitochondria and nucleus. Cell Calcium 40, 513–525. 6. Montero, M., Alonso, M. T., Carnicero, E., Cuchillo-Ibanez, I., Albillos, A., Garcia, A. G., Garcia-Sancho, J., and Alvarez, J. (2000) Chromaffin-cell stimulation triggers fast millimolar mitochondrial Ca2+ transients that modulate secretion. Nat Cell Biol 2, 57–61. 7. Alvarez, J., and Montero, M. (2002) Measuring [Ca2+] in the endoplasmic reticulum with aequorin. Cell Calcium 32, 251–260. 8. Geller, A. I., and Breakefield, X. O. (1988) A defective HSV-1 vector expresses Escherichia coli beta-galactosidase in cultured peripheral neurons. Science 241, 1667–1669. 9. Lim, F., Hartley, D., Starr, P., Song, S., Lang, P., Yu, L., Wang, Y., and Geller, A. I. (1997) Use of defective herpes-derived plasmid vectors. Methods Mol Biol 62, 223–232. 10. Villalobos, C., Nunez, L., Chamero, P., Alonso, M. T., and Garcia-Sancho, J.
11.
12.
13.
14.
15.
16.
17.
(2001) Mitochondrial [Ca2+] oscillations driven by local high [Ca2+] domains generated by spontaneous electric activity. J Biol Chem 276, 40293–40297. Chamero, P., Villalobos, C., Alonso, M. T., and Garcia-Sancho, J. (2002) Dampening of cytosolic Ca2+ oscillations on propagation to nucleus. J Biol Chem 277, 50226–50229. Villalobos, C., Nadal, A., Nunez, L., Quesada, I., Chamero, P., Alonso, M. T., and Garcia-Sancho, J. (2005) Bioluminescence imaging of nuclear calcium oscillations in intact pancreatic islets of Langerhans from the mouse. Cell Calcium 38, 131–139. Quesada, I., Villalobos, C., Nunez, L., Chamero, P., Alonso, M. T., Nadal, A., and Garcia-Sancho, J. (2008) Glucose induces synchronous mitochondrial calcium oscillations in intact pancreatic islets. Cell Calcium 43, 39–47. Alonso, M. T., Barrero, M. J., Carnicero, E., Montero, M., Garcia-Sancho, J., and Alvarez, J. (1998) Functional measurements of [Ca2+] in the endoplasmic reticulum using a herpes virus to deliver targeted aequorin. Cell Calcium 24, 87–96. Villalobos, C., Nunez, L., Montero, M., Garcia, A. G., Alonso, M. T., Chamero, P., Alvarez, J., and Garcia-Sancho, J. (2002) Redistribution of Ca2+ among cytosol and organella during stimulation of bovine chromaffin cells. FASEB J 16, 343–353. Nunez, L., Senovilla, L., Sanz-Blasco, S., Chamero, P., Alonso, M. T., Villalobos, C., and Garcia-Sancho, J. (2007) Bioluminescence imaging of mitochondrial Ca2+ dynamics in soma and neurites of individual adult mouse sympathetic neurons. J Physiol 580, 385–395. Baubet, V., Le Mouellic, H., Campbell, A. K., Lucas-Meunier, E., Fossier, P., and Brulet, P. (2000) Chimeric green fluorescent protein-aequorin as bioluminescent Ca2+ reporters at the single-cell level. Proc Natl Acad Sci USA 97, 7260–7265.
Chapter 18 Novel Tools for Use in Bioluminescence Resonance Energy Transfer (BRET) Assays Me´lanie Robitaille, Isabelle He´roux, Alessandra Baragli, and Terence E. He´bert Abstract Recent advances in imaging assays based on bioluminescence resonance energy transfer (BRET) have made it possible to study protein/protein interactions in living cells under physiological conditions. Here we describe protocols for these assays including relevant positive and negative controls, and we also show how they can be combined with protein complementation assays such as bimolecular fluorescence complementation (BiFC) to study three- and four-partner interactions. We also describe a BRET assay that uses SNAP-tagged proteins as a fluorescence acceptor molecule for the bioluminescent donor. Key words: BRET, GPCRs, SNAP tagging, bioluminescence, biomolecular fluorescence complementation.
1. Introduction Seven transmembrane receptors, also known as G proteincoupled receptors (GPCRs), represent the largest family of cell surface receptors. Approximately 2% of the human genome encodes these receptors (1). Their principal function is to transduce extracellular signals into intracellular events in order to respond to an ever-changing environment (2). They control numerous biological processes including cardiac function, olfaction, vision, pain perception, metabolism, and inflammation (3). GPCRs are also the largest group of pharmacological targets, and 50% of currently marketed drugs target these receptors (4). Precise characterization of receptor-mediated signaling pathways is crucial for developing the next generation of therapeutic targets. It now seems that in addition to targeting the ligand-binding site of GPCRs at the P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_18, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
215
216
Robitaille et al.
plasma membrane, we should now be thinking about targeting these receptors at other membrane compartments and also consider interactions that lead to the formation of specific signaling complexes as novel approaches to generating therapies with fewer side effects (4). Recent studies have demonstrated that stable GPCR signaling complexes consisting of the receptor itself as a homo- or heterodimer, the heterotrimeric G protein, and associated effector molecules are formed before individual components are trafficked to their sites of action. Complex formation seems to take place during biosynthesis, and recent evidence suggests that they are formed in internal membrane compartments such as ER (5). In addition, other sets of trafficking, disassembly and assembly events occur in response to agonist stimulation. These events provide a number of opportunities for future therapeutic intervention. To take advantage of these interaction sites beyond the ligandbinding domain, we first require a more complete understanding of the trafficking and assembly of particular signaling complexes in living cells. Many tools have been developed for this purpose based on epitope and affinity tags for protein identification and purification (6) and on even larger tags useful for imaging strategies such as fluorescence and bioluminescence resonance energy transfer (FRET and BRET). Imaging-based assays have become increasingly useful tools to study interactions between proteins in living cells (7–10). Recently, a number of laboratories have also begun to develop protein interaction assays using bimolecular fluorescence complementation (BiFC). BiFC uses fusion proteins tagged respectively with the N- and C-terminal portions of YFP, neither of which fluoresce when expressed alone (11). If the non-YFP portions of the fusion proteins directly interact, a functional YFP is reconstituted and can be detected by fluorescence measurements in a microscope, by FACS analysis or a microplate reader. In this sense, it is technically simpler than FRET or even BRET. Recently, multiple variants of BiFC constructs for different GFP variants have been used to produce BiFC pairs with distinct spectral patterns (12). This greatly expands the utility of the technique to look at multiple or competing interactions (13–15). In fact, it is possible to even combine BiFC with either FRET or BRET to theoretically study interactions between three or more different interacting partners as well and we have pioneered this approach (5, 16, 17). It is also possible to imagine FRET pairs created by two distinct BiFC events for use in individual cells. In the long term, these experiments can also be envisaged to study trafficking and assembly of multi-partner signaling complexes in living cells. For example, this will allow us to eventually determine if different signaling complexes or subcomplexes (i.e., partially assembled or disassembled units that may be shared between different signaling complexes) compete for components.
Novel Tools for Use in BRET Assays
217
As with any technique, valid controls must be designed for meaningful conclusions to be drawn from experiments using BRET, FRET, or BiFC. General considerations for the use of imaging-tagged proteins have been summarized in a number of recent articles and reviews (see (7–10) for review or (5, 16–19) for detailed examples). Briefly, the functionality of the GFP- and luciferase-tagged partners must be assured for meaningful conclusions about the interactions to be drawn. Also, all positive and negative control constructs must be expressed at similar levels as the experimental constructs and in the same subcellular compartments. BRET saturation experiments must always be performed (1) to assess the specificity of the interaction and (2) to measure changes in relative affinities for the different tagged pair combinations in the absence and presence of other signaling molecules. Finally, BRET, FRET, or BiFC interactions should be able to be competed by ‘‘cold,’’ untagged versions of either partner. The possibility of combining these approaches in a multipurpose strategy using a single tag would greatly expedite many of these studies. The SNAP tag is a candidate for such a multipurpose tag because it is versatile and can be used in a variety of experimental designs including pulse-chase experiments, FRET and BRET assays, as well as for protein purification (20–25). Here, we discuss some technical considerations for the use of BRET combined with BiFC and the use of SNAP-tagged proteins as BRET acceptors.
2. Materials 2.1. Cell Culture, Transfection, and Preparation of the Cells
1. Dulbecco’s Modified Eagle’s Medium High Glucose 1 (DMEM) supplemented or not with either 5% or 10% fetal bovine serum (FBS) and 100 U/mL and 100 mg/mL of penicillin/streptomycin, respectively, or 2.5% fetal bovine serum. 2. Human embryonic kidney cells (HEK293-F, Invitrogen). 3. Polyethylenimine (PEI, Polysciences, Inc.) dissolved in water (see Note 1) at a concentration of 1 mg/mL (see Note 2). 4. PBS (1 ), from a 10 stock solution: 1.37 M NaCl, 0.1 M Na2HPO4, 26.8 mM KCl, 17.6 mM KH2PO4, pH 7.4, and autoclaved. These solutions can be kept at room temperature. 5. Appropriate cDNA constructs. See Sections 2.2.1, 2.3.1, 2.4.1, and 2.5.1. 6. PBS+: PBS (1 ), 1 g/L glucose, 1 protease inhibitor cocktail. This solution is used for BRET, BiFC, and BiFC/ BRET. It must be prepared fresh for each experiment.
218
Robitaille et al.
2.2. BRET
1. Renilla luciferase- (Rluc; see Note 3), GFP10-tagged (BRET2; Perkin-Elmer Life Analytical and Sciences), or eGFP- (BRET1) cDNA constructs (5, 16, 17). 2. Protease inhibitor cocktail (PI, 1000 ) stock solution: 10 mg/mL benzamidine, 5 mg/mL, leupeptin, 5 mg/mL soybean trypsin inhibitor. The stock solution should be aliquoted in small volumes and stored at –20C. Freeze/thaw cycles should be avoided. 3. Fusion Instrument (Perkin-Elmer Life and Analytical Sciences, see Note 4) using a 410/80 nm (RLuc) and 515/35 nm (GFP10) emission filter for BRET2 and a 450/58 nm (RLuc) and a 480/LP nm (eGFP) emission filter for BRET1. For a control of the fluorescence, the excitation filters 425/20 nm (BRET2) or 475/20 nm (BRET1) and the emission filter 515/35 nm (BRET2 and BRET1) should be used. 4. 96-well microplates (white optiplate; Perkin-Elmer Life and Analytical Sciences). 5. 1 mM Coelenterazine 400 A (Biotium) for BRET2 and 1 mg/mL Coelenterazine H (Molecular Probe) for BRET1 reconstituted in absolute ethanol and stored in aliquots, away from light at –20C (see Note 5 for more detail).
2.3. BiFC
1. YFP (1–158) and YFP(159–238) cDNA construct (11). 2. Bio-Rad Protein Assay Reagent (Bio-Rad). 3. Bovine serum albumin: 1 mg/mL in water, kept at –20C in aliquots. 4. Protease inhibitor cocktail (PI, 1000 ) stock solution: 10 mg/mL benzamidine, 5 mg/mL leupeptin, 5 mg/mL soybean trypsin inhibitor. The stock solution should be aliquoted in small volumes and stored at –20C. Freeze/thaw cycles should be avoided. 5. Packard Fusion Instrument (Perkin-Elmer Life and Analytical Sciences, see Note 4) using a 485/10 nm excitation filter and a 535/25 nm emission filter. 6. 96-well microplates (white optiplate; Perkin-Elmer Life and Analytical Sciences).
2.4. BiFC/BRET
1. Rluc-, YFP (1–158)-, and YFP(159–238)-tagged cDNA constructs. 2. Bio-Rad Protein Assay Reagent (Bio-Rad). 3. Bovine serum albumin: 1 mg/mL in water, kept at –20C in aliquots.
Novel Tools for Use in BRET Assays
219
4. Protease inhibitor cocktail (PI, 1000 ) stock solution: 10 mg/mL benzamidine, 5 mg/mL leupeptin, 5 mg/mL soybean trypsin inhibitor. The stock solution should be aliquoted in small volumes and stored at –20C. Freeze/thaw cycles should be avoided. 5. Packard Fusion Instrument (Perkin-Elmer Life and Analytical Sciences, see Note 4) using a 485/10 nm and a 450/58 nm excitation filter and the 535/25 and 480/LP nm emission filters. 6. 96-well microplates (White optiplates; Perkin-Elmer Life and Analytical Sciences). 7. Coelenterazine H (Molecular Probes): 1 mg/mL in ethanol, kept at –20C in aliquots, away from light (see Note 5 for details).
2.5. SNAP/BRET
1. SNAP-tagged (cloned into pSEMS1–25 m (Covalys)) and Rluc-tagged (Perkin-Elmer Life and Analytical Sciences) cDNA constructs. 2. BG-430 substrate (Covalys) dissolved in DMSO at a concentration of 1 mM (see Note 6). 3. PBS (1 ) is made from a 10 stock solution: 1.37 M NaCl, 0.1 M Na2HPO4, 26.8 mM KCl, 17.6 mM KH2PO4, pH 7.4, and autoclaved. These solutions can be kept at room temperature. 4. DMEM supplemented with 10% FBS + antibiotics. 5. Packard Fusion Instrument (Perkin-Elmer Life and Analytical Sciences, see Note 4) using a 425/30 nm filter for excitation and the 480/LP nm filter for excitation when reading SNAP fluorescence. For BRET, we used the 410/ 80 nm for excitation and the 480/LP nm filter for emission for BG-430. For BG-505, we used 485/10 for excitation and 535/25 for emission in the labeling assay, and the 450/58 excitation filter and the 535/25 emission filter for the BRET assay. 6. 96-well microplates (white optiplate; Perkin-Elmer Life and Analytical Sciences). 7. 1 mM Coelenterazine 400 A (Biotium) was used for BG430 BRET assays, and 1 mg/mL Coelenterazine H (Molecular Probes) was used for BG-505 BRET assay. These were reconstituted in absolute ethanol and stored in aliquots, away from light at –20C (see Note 5 for more detail).
220
Robitaille et al.
3. Methods Resonance energy transfer-based approaches have been use to study protein–protein interactions in living cells for a number of years. They are very useful in obtaining a dynamic characterization of signal transduction under physiological conditions. The original resonance energy transfer method is FRET, which is based on the energy transfer between two fluorophores, an energy donor and an acceptor. The emission spectra of the donor must overlap with the excitation spectra of the acceptor. If the two fluorophores are within 100 A˚ of each other, excitation of the donor will lead to the non-radiative transfer of energy through dipole–dipole coupling to the acceptor. This energy transfer will excite the acceptor who will then be able to emit at its characteristic emission wavelength. Bioluminescence resonance energy transfer or BRET is based on the same principle, but instead of a fluorophore the donor is a bioluminescent protein such as luciferase. The energy transferred to the acceptor is produced by the luciferase-catalyzed oxidation of a membrane permeable substrate. There exist two different luciferase substrates currently in common usage for BRET: coelenterazine H used in BRET1 experiments and Deep Blue C used in BRET2 experiments (see (7–10) for review or (5, 16–19, 26) for detailed examples). BiFC is one of a number of protein complementation assays which involve expressing two potential interacting proteins as fusions constructs with two halves of an enzyme (b-galactosidase, luciferase, etc.) or fluorescent molecules (different GFP variants). Only if the two partners interact, will the split proteins associate and reconstitute the enzymatic activity or fluorescent tag (see (27, 28) for review).
3.1. Cell Culture, Transfection, and Preparation of Cells
1. The day prior to transfection, HEK 293 cells should be plated onto 6-well plates so that they reach a density of 50% the day of the transfection (see Note 7). For this step, DMEM with 5% or 10% FBS with antibiotic is used (see Note 8). Incubate cells at 37C with 5% CO2. 2. cDNAs for each condition should be prepared for transfection using sterile, deionized water (see Sections 3.2.1, 3.3.1, 3.4.1, and 3.5.1 and Note 9). 3. Under a biological hood, cDNAs should be mixed with 100 mL of DMEM (no FBS or antibiotic). A stock solution of PEI is prepared calculating 3 mL of PEI for each mg of DNA and 100 mL of DMEM for each condition. 100 mL of the PEI/DMEM stock solution is added to each DNA tube, mixed by inversion, and incubated at room temperature for 15–20 min.
Novel Tools for Use in BRET Assays
221
4. During the cDNA/PEI incubation, cell media should be changed for 2 mL of DMEM supplemented with 2.5% FBS (see Note 10). 5. After the incubation time, cDNAs should be added delicately to each well (see Note 11) and the plates placed back in the incubator as soon as possible. 6. At 24 h after transfection (see Note 12), the media is changed for DMEM supplemented with 5% or 10% FBS + antibiotic and the cells incubated for another 24 h. 7. The Packard Fusion Instrument should be warmed up 1 h prior to utilization (see Note 13). 8. From this point, experiments can be performed in a nonsterile environment. For the SNAP/BRET experiment, the treatment of the cells should be done as described in Section 3.5. Just prior to BiFC, BRET, or BiFC/BRET experiments, the PBS+ should be made as described in Section 2.1.6 . 9. For the BRET, BiFC, and BiFC/BRET, the cells are washed twice with 1 mL of PBS 1 (see Note 14). The PBS should be added carefully to the plates to avoid cell detachment. 10. Cells are resuspended in 500 mL of PBS+ using a pipette and placed into an appropriately labeled microcentrifuge tube.
3.2. BRET
1. cDNAs prepared for the transfection should be a mixture of protein A tagged with RLuc and protein B tagged with eGFP (BRET1) or GFP10 (BRET2). Initially, 0.5 mg of each should be used for transfection and the quantity optimized according to fluorescence and luminescence intensities obtained. Negative and positive controls for BRET experiments should also be transfected (see Note 15). Follow Steps 3.1.1–3.1.10 for transfection and preparation of cells. 2. For BRET1, coelenterazine H stocks should be diluted 1:500 in PBS+ and kept away from light, at room temperature. This solution should be discarded at the end of the experiment. 3. Ninety microliters of the cell suspension for each sample should be added to a 96-well plate and the fluorescence read on the Packard Fusion Instrument, with a time read of 1 s, a PMT voltage of 500, a gain of 1, using a halogen light source with an excitation filter of 425/20 nm (BRET2) or 475/ 20 nm (BRET1) and the emission filter of 515/35 nm (see Note 16 for more details). This is a measure of total GFP expression and is used to quantitate the amount of acceptor protein expressed. 4. For BRET2, coelenterazine 400 A should be diluted 1:20 in PBS+ just prior adding it to the 96-well plate.
222
Robitaille et al.
5. Ten microliters of the diluted coelenterazine 400 A (BRET2) or coelenterazine h (BRET1) is added into each well and mixed by gently shaking the plate. 6. BRET is rapidly measured using the Packard Fusion Instrument, reading each well for 1 s. For BRET2, the parameters used are a PMT voltage of 1100, a gain of 100, with the emission filter 410/80 nm (RLuc) and 515/35 nm (GFP10). For BRET1, the parameters used are a PMT voltage of 1000, a gain of 1, with the emission filter 450/58 nm (RLuc) and 480/LP nm (eGFP) (see Note 16 for more details about RLuc expression and Note 17 regarding the detection range of this particular machine). 7. Data should be analyzed by calculating the BRET ratio, given by the light emitted through the 515/35 filter over that passed by the 410/80 nm (BRET2) or 480/LP nm (BRET1) filters. It is also possible to express the BRET ratio as net BRET, subtracting appropriate negative controls from the experimental readings. Typical experiments with relevant controls are shown in Figs. 18.1 and 18.2. 3.3. BiFC
1. cDNAs prepared for the transfection should be a mix of the protein A tagged with the N-terminal portion of YFP, YFP (1–158) and the protein B tagged with YFP(159–238), the C-terminal portion of YFP. Initially, 1 mg of each plasmid should be used for transfection and the quantity optimized according to fluorescence intensity obtained. Negative and positive controls for the BiFC experiment should also be transfected (see Note 15). Follow Steps 3.1.1–3.1.10 for transfection and the preparation of the cells. 2. Quantification of the protein should be determined (see Note 18). Add 800 mL of water to a 1-mL cuvette, 2 mL of the cell suspension, and 200 mL of Bio-Rad Protein Assay Reagent. Mix well and take the absorbance at 595 nm. A standard curve using BSA should be generated at the same time using concentrations of 0, 2, 4, 6, 8, and 10 mg/mL. 3. Take 25–100 mg of protein (the same quantity for each sample) or the quantity that would yield a reasonable fluorescence signal over background. The conditions should be optimized depending on the individual interactors and the plate reader used. Complete the volume to 100 mL with PBS+ and load the cells into a 96-well plate. If the volume is over 100 mL, centrifuge the cells 3 min at 1000g, take off the supernatant, and resuspend in 100 mL of PBS+. 4. Read the fluorescence on the Packard Fusion Instrument, with a time read of 1 s, a PMT voltage of 500, a gain of 1, using a halogen light source with an excitation filter of 485/ 10 nm and an emission filter of 535/25 nm.
Novel Tools for Use in BRET Assays
A
223
B 0.4
1.75 1.70
BRET 2
BRET 1
0.3 1.65 1.60 1.55
0.2 0.1
1.50
R -G FP 10
β1
ag -
2A
Fl R
ir3 .1 -
-R
R
Lu
Lu
c
c
+
+
β
+ 10 FP
K
2A
β
c K
ir3
C
.1
D
-R
4-
R
Lu
β
Lu
+
c
2A
+
R
G
-R
eG
Lu
FP
c
-G
+
-G
γ2
β1
β
+
2A
H A -G
G
γ2
R -e G FP
γ2
H A -G + β1
-G FP eG + c Lu -R .1 ir3 K
C D 4G FP 10
0.0
1.45
C Kir3.1-RLuc + eGFP-Gβ1 + HA-Gγ 2 75000
0.2 RFU
50000
Net BRET 1
25000
0
0.1
0 2 4 DNA ratio Kir3.1-HA/Kir3.1-RLuc
0.0 0
2
4
DNA ratio Kir3.1-HA/Kir3.1-RLuc
Fig. 18.1. BRET experiments and controls. BRET was measured in HEK293 cells transfected with 0.5 mg of each cDNA. BRET assays show an interaction between the Kir3.1 potassium channel and the Gbg dimer of the heterotrimeric G protein. In this case, the dimerization of the b2AR was used as a positive control, and cells transfected with this eGFP-Gb1 or Kir3.1-RLuc and the CD4 receptor tagged with either GFP10 or RLuc as the negative control. These interactions were detected using BRET1 (A) as well as in BRET2 (B). In (C), a competition of the Kir3.1-RLuc and the eGFP-Gb1 interaction was performed by co-expressing increasing amounts of ‘‘cold’’ Kir3.1 subunit (untagged for BRET). This experiment shows the specificity of the Kir3.1/Gb1g2 interaction. These results are presented as net BRET, meaning that the negative control ratio was subtracted from all experimental ratios. Inset: eGFP-Gb1 expression was monitored to demonstrate that the decrease in BRET in the competition experiment was not caused by a decrease in eGFP-Gb1 expression.
224
Robitaille et al. 1.60 1.58
BRET
1.56 1.54 1.52 1.50 1.48 0.0
0.5
1.0
1.5
2.0
2.5
GFP/RLuc Ratio
Fig. 18.2. BRET saturation curves. In this experiment, HEK-293 cells were co-transfected with a constant amount of AC2-RLuc (1 mg cDNA, squares) or hKvLQT1-Luc (0.05 mg, triangles) and increasing amounts of AC5-EGFP (0.05–> 6 mg). The BRET, total luminescence, and total fluorescence were measured 60–72 h after transfection. BRET levels are plotted as a function of the total fluorescence signal (fold over background)/total luminescence signal (fold over background). The results were expressed as the mean – S.E. of seven independent experiments performed in duplicate. The curves were fit using non-linear regression or linear regression (GraphPad Prism).
5. Data should be analyzed by relative fluorescence unit (RFU) or by net BiFC, where the RFU of the negative control can be subtracted from the RFU of the samples. As can be seen in the inset to Fig. 18.3, fluorescence is only reconstituted when two proteins tagged with the complementary halves of YFP were co-expressed. 3.4. BiFC/BRET
1. cDNAs prepared for the transfection should be a mix of the protein A tagged with Renilla luciferase and protein B and C tagged with YFP (1–158) and the YFP(159–238). Initially, 0.5 mg of the RLuc construct and 1 mg of each split YFP construct should be used for transfection and the quantity optimized according to fluorescence and luminescence intensities obtained. Negative and positive controls for the BiFC/BRET experiment should also be transfected (see Note 15). Follow Steps 3.1.1–3.1.10 for transfection and preparation of cells. 2. Coelenterazine H should be diluted 1:500 in PBS+ and kept away from light, at room temperature. This solution should be discarded at the end of the experiment. 3. See Steps 3.3.2–3.3.5 for the preparation the samples and BiFC measurement. 4. Ten microliters of diluted coelenterazine H is added into each well and mixed by shaking gently the plates.
Novel Tools for Use in BRET Assays
225
15000
10000 BiFC
0.32
5000
γ2
G
23
8)
)–
9–
P
–2 38
(1 5
9– (1 5
58 )
YF P
+
(1 59
YF
YF P
+
(1 –1
YF P
(1 –1
58 )–
G
β1
YF P
(1 –
15
23
8)
lls
0.24
YF P
ce
0.26
8)
0
0.28
no ntr an sf ec te d
BiFC/BRET
0.30
0.22
γ 2
G )– 38 –2
R YF P
(1
59
2A
β +
β1
+
Lu c
–G
-R R
C
D
4R
Lu c
Lu c
+
+
YF
YF P
P
(1
(1
–1
–1
β
58
)
2A
) 58
-e G FP
γ 2
G )– 38 –2 59
(1
YF P + β1
–G
(1
YF P +
Lu c K
ir3 .1 -R
K
K
ir3 .1 -R
ir3 .1 -R
Lu c
–1
+
58
)
YF P
–G
(1
β1
–1
+
58
)–
G
YF P
β1
(1
+
59
G
–2 3
γ2
8)
0.20
Fig. 18.3. BiFC and BiFC/BRET assays. BiFC/BRET was measured in HEK293 cells transfected with Kir3.1-Rluc, and the split YFP(1–138)-Gb1 and Gg2 or YFP(139–258) or YFP(139–258)-Gg2. A positive BiFC/BRET could only be detected when both YFP(1–138)-Gb1 and YFP(139–258)-Gg2 were expressed. The CD4-RLuc/YFP(1–138)-Gb1/YFP(139–258)-Gg2 served as the negative control, and dimerization of the b2AR was used as the positive control. In this case, the emission filter used to collect fluorescence in the BiFC/BRET experiment was the 535/25 nm filter. Inset : BiFC controls for the YFP(1–158) and YFP(158–238) constructs. No fluorescence over background was detected if either or both split YFP constructs were expressed unless they were fused to Gb1 and Gg2. This shows that the vectors alone are not able to associate together to reconstitute YFP.
5. Monitor BRET using the Packard Fusion Instrument, reading each well for 1 s at a PMT voltage of 100, a gain of 1, with the emission filter 450/58 nm (RLuc) and 480/LP nm (BiFC) (see Notes 16 and 17 for more details). 6. Data should be analyzed by calculating the BRET ratio, given by the light emitted at 535/25 filter relative to that passed by the 450/58 nm filter. It is also possible to express the BiFC/BRET ratio as net BiFC/BRET, subtracting the ratio of the negative BiFC/BRET control from the experimental ratio. A typical experiment is shown in Fig. 18.3. BRET was only detected when the three relevant proteins, two tagged with complementary halves, were co-expressed with a third interacting protein tagged with Rluc.
226
Robitaille et al.
3.5. SNAP/BRET
Although SNAP-tagged proteins have been used for FRET, this is the first report that the SNAP tag can also be used in BRET applications. Coelenterazine H oxidation leads to an emission maximum at 475 nm, thus the BG-505 substrate should be compatible for use as a BRET1 acceptor. DeepBlue C (or coelenterazine 400a) has an emission maximum of 400 nm, thus the BG-430 substrate should be compatible with BRET2 experiments. We found that BG-505 was not an efficient BRET acceptor (Fig. 18.4) while BG-430 worked in this application (Fig. 18.5). 1. Prepare cDNA mixture composed of the appropriate SNAPand Rluc-tagged constructs (normally 2 mg of each DNA is sufficient) (see Note 19). Negative and positive controls for the SNAP/BRET experiment should also be transfected (see Note 15 and Note 20). Follow Steps 3.1.1–3.1.8 for transfection. 2. Prepare BG-430 or BG-505 labeling solutions (see Note 21) at a concentration of 5 mM as follows: dilute BG stock solution (1 mM) 1:200 into a DMEM supplemented with 10% FBS (600 mL of labeling solution is required per well of a 6well plate). 3. Incubate cells with 600 ml SNAP substrate solution at 37C in 5% CO2 30 min (see Note 22). 4. Wash the cells twice with DMEM with 10% FBS (see Note 23). 5. Replace the media once more and incubate cells for another 30 min at 37C in 5% CO2 (see Note 24). 6. Replace the media one last time and incubate cells for a final 30 min incubation at 37C in 5% CO2 7. Wash cells once with DMEM with 10% FBS (see Note 25) and then wash cells twice with PBS 1 (see Note 14) 8. Resuspend cells in 90 mL of PBS 1 and load them into a 96 white optiplate. 9. Read the fluorescence of the samples using the appropriate filter set on the Fusion microplate reader (see Note 17). The BG-430 chromophore is excited at 425/20 nm (peak excitation of BG-430: 421 nm) and emission is read at 480/LP nm (peak emission of BG-430: 444 and 484 nm). The BG-505 chromophore is excited at 485/10 nm (peak excitation of BG-505:504 nm) and emission is read at 535/25 nm (peak emission of BG-505:532 nm). 10. Experiments with the BG-430 were conducted using BRET2. Coelenterazine 400 A substrate was used at a final concentration of 5 mM. Dilute the stock solution (1 mM) 1:20 into PBS 1 . Do not prepare more diluted substrate needed for more
Novel Tools for Use in BRET Assays
227
75000 5000
–
2 AR-eGFP
2 AR-SNAP
+
His-
untransfected cells
+
HA-
HA- 2 AR
+
HA-
2 AR-SNAP
0
2AR
2500
HA-
Fluorescence counts
125000
–
–
BG-505
1.6
His- 2 AR-eGFP + CD4-RLuc
2 AR-RLuc
–
+
–
2 AR-eGFP
2 AR-RLuc
+
+
His-
–
2AR
2 AR-SNAP
HA-
+
HA-
2AR-SNAP
BG-505
HA-
+
2 AR-RLuc
1.4
2 AR-RLuc
1.5
+
BRET ratio
1.7
Fig. 18.4. BRET assays using BG-505 substrate for SNAP tag. These assays were performed in HEK 293 cells 48 h post-transfection. Cells were transfected with 2 mg of HA-b2AR-SNAP cDNA and 2 mg of b2AR-RLuc cDNA and were incubated with 2 mM BG505 substrate for 15 min. Labeling experiments were performed based on SNAP-cell 505 protocol from Covalys. Cells were resuspended in PBS and the BRET1 substrate coelenterazine H at 0.2 ng/ml was added to each sample before reading. Readings were performed using the Fusion microplate reader (PerkinElmer) at 450 nm for luciferase emission and at 480 nm for the BG-505 (peak emission of BG-505:532 nm). BRET ratio represents the BG-505 emission counts over the luciferase emission counts. Inset: Labeling of the HA-b2AR-SNAP protein with 2 mM BG-505. Cells were resuspended in PBS and were read in a Fusion microplate reader (PerkinElmer). BG-505 chromophore was excited at 485 nm and emission was read at 535 nm (peak emission of BG505:532 nm).
Robitaille et al.
Fluorescence count
40000 30000 20000 10000
HA- 2 AR-SNAP
BG-430
HA- 2 AR
0.30
HA- 2AR-SNAP
0
+
+
–
2AR-RLuc
2 AR-RLuc
+
HA- 2 AR-SNAP +
–
2 AR
+
HA-
2 AR-SNAP
+
0.20
HA-
0.25
2 AR-RLuc
BRET ratio
228
BG-430
+
Fig. 18.5. BRET assays using 5 mM of BG-430 substrate. These assays were performed in HEK 293 cells 48 h post-transfection. Cells were transfected with 2 mg of HA-b2AR-SNAP and 2 mg of b2AR-RLuc cDNA and were incubated with 5 mM BG-430 substrate at for 30 min. Labeling experiments were performed based on SNAP-cell 430 protocol from Covalys, but an additional 15–30 min of washing was performed after the 30 min indicated therein. Cells were resuspended in PBS, and 5 mM BRET2 substrate coelenterazine 400 A was added to each sample before reading. Readings were performed using the Fusion microplate reader (PerkinElmer) at 410 nm for the luciferase emission and at 480 nm for the BG-430 (peak emission of BG-430: 444 and 484 nm). The BRET ratio represents the BG-430 emission counts over the luciferase emission counts. Inset: Labeling of the HA-b2AR-SNAP protein with 5 mM BG-430 substrate. Cells were resuspended in PBS and were read in a Fusion microplate reader (PerkinElmer). BG-430 chromophore was excited at 425 nm and emission was read at 480 nm (peak emission of BG-430:444 and 484 nm).
Novel Tools for Use in BRET Assays
229
than 2 samples at a time (see Note 26). Experiments with BG505 were conducted using BRET1. Coelenterazine H substrate was used at a final concentration of 0.2 ng/mL. The stock solution (1 mg/mL) was diluted 1:500 in 1 PBS. 11. Add 10 mL of your diluted substrate to a maximum of two samples for coelenterazine 400 A (with BG-505) and read the plate immediately. 12. For BG-430, collect signals using a 410/80 nm band pass filter for the luciferase emission and a 480/LP nm band pass filter for the BG-430 emission (peak emission of BG-505: 444 and 484 nm). For BG-505, collect signals using 450/ 58 band pass filter for luciferase emission and a 535/25 band pass filter the BG-505 emission (peak emission of the BG505: 532 nm). 13. BRET2 signals are determined by the ratio of the light emitted by the 410/80 (luciferase) over the 480/LP (BG430) band pass filters or the ratio of the light emitted by the 450/58 (luciferase) over the 535/25 (BG-505) band pass filters (see Note 27).
4. Notes 1. Except if otherwise specified, solutions should be prepared in water that has a resistance of 18.2 M -cm. 2. Ten microliters of water should be heated to 80C and 20 mg of PEI dissolved in it. The solution is cooled on ice to room temperature and the pH adjusted to pH 7 with 0.5 M HCl. The volume is adjusted to 20 mL, filtered under a biological hood, aliquoted and stored at –80C. Cell toxicity of the solution is proportional to the time that the solution is kept at room temperature, so the preparation of PEI should be as rapid as possible. 3. For best results, the humanized version of the Renilla luciferase vector should be used. This vector can be purchased from Perkin-Elmer Life and Analytical Sciences. 4. You can also use any machine that is able to read both luminescence and fluorescence emissions simultaneously. 5. Coelenterazine compounds are provided by suppliers as a yellow-orange powder that needs to be reconstituted in pure ethanol. Surprisingly, we obtain better results if the compounds are dissolved at least 1 day prior making aliquots. We recommend dissolving these compounds in ethanol by vortexing, keeping them at –20C in the original tubes for at least one day, vortexing again, and then aliquoting them.
230
Robitaille et al.
These products are light-sensitive so they should be kept away from light. Coelenterazine 400 A supplied by Biotium is the generic version of Deep Blue C supplied by Perkin-Elmer Life and Analytical Sciences. Both can be used for the BRET2 and give similar results. 6. Dissolve a 50-nmol vial of BG-430 in 50 mL of DMSO. Mix 10 min until BG-430 is completely dissolved (remembering to protect it from light). Store this stock solution at –20C protected from light, and it should be stable for at least 6 months under these conditions. Prepare a working solution at 5 mM in DMEM supplemented with 10% FBS. Do not prepare more working solution than will be consumed within 1 h and protect it from light. 7. Cells can be transfected when they are between 40% and 60% confluent. Below this percentage, not enough cells will survive transfection. 8. DMEM can be complemented by either 5% or 10% FBS at your discretion. The cells will grow faster in 10% FBS than in 5% FBS. 9. The total amount of DNA transfected should be the same in each sample, so empty vector can be used to maintain the DNA/well quantity constant. Do not transfect more than 10 mg of DNA per well, above that the concentration of PEI will be toxic. 10. FBS interferes with the efficiency of transfection. For this reason, cDNAs should be diluted in serum-free DMEM. Tests performed in our laboratory have shown that, over 2.5% FBS, the transfection efficiency decreased significantly, and below 2.5% FBS, cells survival is dramatically reduced. 11. Do not add the PEI/DNA solution directly to cells, as this will kill the cells. Place pipette on the side of the well and push out the solution slowly into the media surrounding the cells. Shake wells gently to be sure that the PEI/DNA solution is well mixed with the media. 12. If using a large amount of DNA, and hence a large amount of PEI, we recommend only 6-h incubations to increase survival rate. 13. We have found that warming up the plate reader by turning it on an hour prior to utilization yields more stable BRET ratios during repetitive reading of the same plate. 14. Wash cells with PBS to remove all the indicator, which quenches BRET signals. 15. As a negative control, one of the proteins of interest should be changed for another protein that is known to not interact with the other putative partner. However, this protein should be
Novel Tools for Use in BRET Assays
231
localized to the same subcellular compartment and expressed at the same level as the protein it replaces. For BiFC/BRET, it is useful to perform negative controls for both the BiFC and the BiFC/BRET. The positive control can be any two proteins known to interact together and it is used to confirm that the experimental system is functional. In our case, we like to use homodimerization of b2-adrenergic receptors as this interaction has been well described in the literature using BRET technology (29, 30). 16. Since BRET is a ratio of the fluorescence over luminescence, protein quantification is usually not required, because small changes in cell quantity will not affect the BRET ratios. However, the first step of the experiment is to monitor the total fluorescence and luminescence of the cells to be sure that each sample expresses approximately similar amounts of Rluc- and GFP-tagged constructs. If this is not the case, you should refer to Step 3.3.2 and quantify the proteins in each sample or change the transfection conditions if different GFP-tagged proteins are expressed. Three readings of the same plate (with the samples in duplicate) should usually be taken to determine consistency. 17. To stay within the detection range of the Packard Fusion Instrument, the RLuc counts obtained for BRET2 should be between 50,000 and 130,000 and between 20,000 and 100,000 for BRET1. If the counts are too low, it is possible to concentrate the cells in PBS+ and add more cells/volume of 90 ml. If the counts are too high, it is possible to wait several seconds before reading the plate again or to decrease the number of cells by dilution with PBS+ (always using 90 ml of PBS+/well). However, in both cases, these conditions are relevant for the Packard Fusion Instrument. If another plate reader is used, the correct conditions should be determined empirically. The maximal counts should be the highest relative luminescence units (RLU) that do not saturate the machine and the minimal counts should be the lowest RLU at which the BRET ratio remains stable. At a certain value, the ratio will increase as the RLU will decrease. In BRET2, the RLuc counts decrease rapidly; therefore, it is better to read only three or four samples at one time. 18. For BiFC experiments, the fluorescence signal is highly related to the quantity of cells. To avoid artifacts caused by differences in material quantity, the same amount of proteins or cells should be added to each well. Instead of protein quantification, it is also possible to count the cells and add the same amount for each sample.
232
Robitaille et al.
19. To avoid possible variation in the BRET signals resulting from fluctuations in the relative expression levels of the energy donor and acceptor, we designed transfection conditions to maintain constant BG-430 SNAP/RLuc expression ratios in each experimental set. 20. Negative controls for the SNAP/BRET assay are also essential. For an interpretable SNAP/BRET assay, untagged (SNAP) versions of proteins of interest should be labeled with substrate when co-expressed with the Rluctagged partner to confirm that BRET signals are not a result of nonspecific labeling with BG substrate or expression of the untagged protein control. Another negative control should be the SNAP-tagged partner transfected with the appropriate Rluc-tagged partner but not labeled with BG substrate to confirm that the SNAP tag itself does not influence luciferase emissions. 21. BG substrates are light sensitive. Do not prepare more diluted substrate than will be used within 1 h. The BG430 substrate concentration can vary between 2 and 20 mM. Often an increase in the substrate concentration will lead to an increase in the background and does not necessarily increase the signal to noise ratio. FBS reduces the non-specific binding of the substrate to surfaces. Labeling untransfected cells could be performed as a negative control. 22. The incubation time can vary between 15 and 60 min depending on experimental conditions, expression levels of the SNAP-tag fusion protein, and substrate concentration. Covalys recommends a 30-min incubation time. 23. If cells detach, washing steps can be performed in 1.5-mL microtubes. Detach cells and wash them up and down (gently) with DMEM with 10% FBS. Spin 3 min at 800g to remove media between each washing step and incubate microtubes at 37C when necessary. 24. Incubation times can be varied from 30 to 60 min. Longer incubation times in the same DMEM solution will not decrease the background as much as replacement of the washing solution. 25. Wash cells one last time to completely remove non-reacted SNAP substrate that has leaked out of the cells. 26. Once the substrate is added to the samples, it is oxidized rapidly. Too many samples should not be read at once, as luminescence counts will decrease rapidly.
Novel Tools for Use in BRET Assays
233
27. BRET ratios may vary slightly between experiments but should be comparable. At least three independent experiments should be performed before pursuing BRET saturation and competition assays to confirm the specificity of each interaction.
Acknowledgments This work was supported by grants from the Canadian Institutes of Health Research (MOP-99567) and Heart and Stroke Foundation of Quebec to T.E.H. T.E.H. is a Chercheur National of the Fonds de Recherche en Sante´ du Que´bec (FRSQ). M.R. holds a doctoral scholarship from the FRSQ. We thank Vic Rebois (NIH) for helpful discussions and we also thank Covalys for providing constructs and reagents for the SNAP tag.
References 1. Vassilatis, D. K., Hohmann, J. G., Zeng, H., Li, F., Ranchalis, J. E., Mortrud, M. T., Brown, A., Rodriguez, S. S., Weller, J. R., Wright, A. C., Bergmann, J. E., and Gaitanaris, G. A. (2003) The G protein-coupled receptor repertoires of human and mouse. Proc Natl Acad Sci USA 100, 4903–4908. 2. Cabrera-Vera, T. M., Vanhauwe, J., Thomas, T. O., Medkova, M., Preininger, A., Mazzoni, M. R., and Hamm, H. E. (2003) Insights into G protein structure, function, and regulation. Endocr Rev 24, 765–781. 3. Marinissen, M. J., and Gutkind, J. S. (2001) G-protein-coupled receptors and signaling networks: emerging paradigms. Trends Pharmacol Sci 22, 368–376. 4. Rebois, R. V., Allen, B. G., and Hebert, T. E. (2003) The targetable G protein proteome: where is the next generation of drug targets? Drug Discovery Today: Targets 3, 104–111. 5. Dupre, D. J., and Hebert, T. E. (2006) Biosynthesis and trafficking of seven transmembrane receptor signalling complexes. Cell Signal 18, 1549–1559. 6. Gingras, A. C., Gstaiger, M., Raught, B., and Aebersold, R. (2007) Analysis of protein complexes using mass spectrometry. Nat Rev Mol Cell Biol 8, 645–654. 7. Hebert, T. E., Gales, C., and Rebois, R. V. (2006) Detecting and imaging protein-protein interactions during G protein-mediated signal transduction in vivo and in situ by
8.
9.
10.
11.
12.
13.
using fluorescence-based techniques. Cell Biochem Biophys 45, 85–109. Marullo, S., and Bouvier, M. (2007) Resonance energy transfer approaches in molecular pharmacology and beyond. Trends Pharmacol Sci 28, 362–365. Milligan, G., and Bouvier, M. (2005) Methods to monitor the quaternary structure of G protein-coupled receptors. Febs J 272, 2914–2925. Pfleger, K. D., and Eidne, K. A. (2006) Illuminating insights into protein-protein interactions using bioluminescence resonance energy transfer (BRET). Nat Methods 3, 165–174. Hu, C. D., Chinenov, Y., and Kerppola, T. K. (2002) Visualization of interactions among bZIP and Rel family proteins in living cells using bimolecular fluorescence complementation. Mol Cell 9, 789–798. Hu, C. D., and Kerppola, T. K. (2003) Simultaneous visualization of multiple protein interactions in living cells using multicolor fluorescence complementation analysis. Nat Biotechnol 21, 539–545. Hynes, T. R., Tang, L., Mervine, S. M., Sabo, J. L., Yost, E. A., Devreotes, P. N., and Berlot, C. H. (2004) Visualization of G protein betagamma dimers using bimolecular fluorescence complementation demonstrates roles for both beta and gamma in subcellular targeting. J Biol Chem 279, 30279–30286.
234
Robitaille et al.
14. MacDonald, M. L., Lamerdin, J., Owens, S., Keon, B. H., Bilter, G. K., Shang, Z., Huang, Z., Yu, H., Dias, J., Minami, T., Michnick, S. W., and Westwick, J. K. (2006) Identifying off-target effects and hidden phenotypes of drugs in human cells. Nat Chem Biol 2, 329–337. 15. Mervine, S. M., Yost, E. A., Sabo, J. L., Hynes, T. R., and Berlot, C. H. (2006) Analysis of G protein betagamma dimer formation in live cells using multicolor bimolecular fluorescence complementation demonstrates preferences of beta1 for particular gamma subunits. Mol Pharmacol 70, 194–205. 16. Dupre, D. J., Robitaille, M., Richer, M., Ethier, N., Mamarbachi, A. M., and Hebert, T. E. (2007) Dopamine receptor-interacting protein 78 acts as a molecular chaperone for Ggamma subunits before assembly with Gbeta. J Biol Chem 282, 13703–13715. 17. Rebois, R. V., Robitaille, M., Gales, C., Dupre, D. J., Baragli, A., Trieu, P., Ethier, N., Bouvier, M., and Hebert, T. E. (2006) Heterotrimeric G proteins form stable complexes with adenylyl cyclase and Kir3.1 channels in living cells. J Cell Sci 119, 2807–2818. 18. Gales, C., Van Durm, J. J., Schaak, S., Pontier, S., Percherancier, Y., Audet, M., Paris, H., and Bouvier, M. (2006) Probing the activation-promoted structural rearrangements in preassembled receptor-G protein complexes. Nat Struct Mol Biol 13, 778–786. 19. Heroux, M., Breton, B., Hogue, M., and Bouvier, M. (2007) Assembly and signaling of CRLR and RAMP1 complexes assessed by BRET. Biochemistry 46, 7022–7033. 20. Gronemeyer, T., Godin, G., and Johnsson, K. (2005) Adding value to fusion proteins through covalent labelling. Curr Opin Biotechnol 16, 453–458. 21. Keppler, A., Gendreizig, S., Gronemeyer, T., Pick, H., Vogel, H., and Johnsson, K. (2003) A general method for the covalent labeling of fusion proteins with small molecules in vivo. Nat Biotechnol 21, 86–89.
22. Krayl, M., Guiard, B., Paal, K., and Voos, W. (2006) Fluorescence-mediated analysis of mitochondrial preprotein import in vitro. Anal Biochem 355, 81–89. 23. Mottram, L. F., Maddox, E., Schwab, M., Beaufils, F., and Peterson, B. R. (2007) A concise synthesis of the Pennsylvania Green fluorophore and labeling of intracellular targets with O6-benzylguanine derivatives. Org Lett 9, 3741–3744. 24. Pick, H., Jankevics, H., and Vogel, H. (2007) Distribution plasticity of the human estrogen receptor alpha in live cells: distinct imaging of consecutively expressed receptors. J Mol Biol 374, 1213–1223. 25. Tirat, A., Freuler, F., Stettler, T., Mayr, L. M., and Leder, L. (2006) Evaluation of two novel tag-based labelling technologies for site-specific modification of proteins. Int J Biol Macromol 39, 66–76. 26. Gales, C., Rebois, R. V., Hogue, M., Trieu, P., Breit, A., Hebert, T. E., and Bouvier, M. (2005) Real-time monitoring of receptor and G-protein interactions in living cells. Nat Methods 2, 177–184. 27. Michnick, S. W., Ear, P. H., Manderson, E. N., Remy, I., and Stefan, E. (2007) Universal strategies in research and drug discovery based on protein-fragment complementation assays. Nat Rev Drug Discov 6, 569–582. 28. Remy, I., and Michnick, S. W. (2007) Application of protein-fragment complementation assays in cell biology. Biotechniques 42, 137, 139, 141 passim. 29. Angers, S., Salahpour, A., Joly, E., Hilairet, S., Chelsky, D., Dennis, M., and Bouvier, M. (2000) Detection of beta 2-adrenergic receptor dimerization in living cells using bioluminescence resonance energy transfer (BRET). Proc Natl Acad Sci USA 97, 3684–3689. 30. Salahpour, A., Angers, S., Mercier, J. F., Lagace, M., Marullo, S., and Bouvier, M. (2004) Homodimerization of the beta2adrenergic receptor as a prerequisite for cell surface targeting. J Biol Chem 279, 33390–33397.
Chapter 19 PIN-G Reporter for Imaging and Defining Trafficking Signals in Membrane Proteins Lynn Mckeown, Vicky C. Jones, and Owen T. Jones Abstract The identification of motifs that control the intracellular trafficking of proteins is a fundamental objective of cell biology. Once identified, such regions should, in principle, be both necessary and sufficient to direct any randomly distributed protein, acting as a reporter, to the subcellular compartment in question. However, most reporter proteins have limited versatility owing to their endogenous expression and limited modes of detection – especially in live cells. To surmount such limitations, we engineered a plasmid – pING – encoding an entirely artificial, type I transmembrane reporter protein (PIN-G), containing HA, cMyc and GFP epitope, and fluorescence tags. Although originally designed for trafficking studies, pIN technology is a powerful tool applicable to almost every area of biology. Here we describe the methodologies used routinely in analyzing pIN constructs and some of their derivatives. Key words: Green fluorescent protein (GFP), live imaging, trafficking, epitope tags, reporter constructs, photoactivation, lentivirus.
1. Introduction 1.1. pIN Technology
A fundamental problem in cell biology is how best to test the contribution of putative protein interaction domains in phenomena such as trafficking, docking, and regulation, especially when they are housed within highly complex, often oligomeric, membrane or cytoplasmic parent protein structures (1). Do such domains act only in the context of the parent protein? Do they operate independently or hierarchically? Is their function regulated and if so how? Conventionally, a powerful way to address these questions has been to test whether the domain’s putative function can be transplanted onto an unrelated ‘‘reporter’’ protein (2, 3). However, available reporter proteins have serious limitations,
P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_19, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
235
236
Mckeown, Jones, and Jones
including their endogenous expression, limited modes of detection, and poor experimental versatility (1–3). To circumvent such problems, we introduced a strategy – termed pIN technology – based upon pIN-G (Genbank: AY841887), a highly engineered expression plasmid, encoding an entirely artificial modular type I membrane protein (PIN-G) designed to maximize functionality in imaging and biochemical experiments (1). The design and construction of PIN-G and its encoding plasmid – pIN-G – have already been described (1), and its salient features are shown in Fig. 19.1A, B. Briefly, the pIN-G vector encodes for a fusion protein containing in order: an efficient leader sequence for membrane insertion, an external hemagglutinin (HA) epitope tag, enhanced green fluorescent protein (eGFP), a second, cMyc, epitope tag, a transmembrane spanning domain from platelet-derived growth factor receptor (PDGFR), and a short carboxy terminus. Together, these elements afford a 30-kDa integral protein with a type I transmembrane topology. In addition, the pIN-G vector contains two, non-overlapping, multiple cloning sites (MCS-1 and MCS-2) located in sequences encoding non-functional regions of the extracellular and intracellular protein domains. Consequently, MCS-1 allows the facile introduction of sequences encoding motifs which can interact with components that are extracellular or in the lumen of the secretory pathway (4). Conversely, MCS-2 permits the introduction of sequences encoding motifs that have a cytoplasmic disposition (1).
A.
B.
N HA
PIN-G: CMV KZ
SP HA
N
EGFP
cMyc
TM
M1
pA
M2 C
pA
EGFP
C.
cMyc
PIN-ANT: N
MDEL C
N
KDEL C
TM
PIN-KDEL: cytoplasm
C
Fig. 19.1. Features of PIN-G, and some of its derivatives. (A) Cartoon showing type I transmembrane (extracellular amino terminus, single pass) topology and modular features of PIN-G following signal peptide cleavage. Salient features include the HA and cMyc epitope tags, green fluorescent protein (GFP) fluorophore, and the transmembrane domain from the platelet-derived growth factor receptor (PDGFR). (B) Schematic showing main features of the pIN-G expression plasmid, including (small boxes) the CMV promoter (CMV), kozak (KZ) consensus sequence, multiple cloning sites (M1 and M2), and polyadenylation sequences. Protein-encoding regions are shown in large boxes (notation as in A plus the Ig chain signal peptide (SP)). (C) Protein-encoding elements of two PIN-G derivatives – PIN-ANT – which is targeted to the anterograde secretory pathway and PIN-KDEL – a derivative retained in the lumen of the endoplasmic reticulum by virtue of a C-terminal KDEL sequence (4). All notation as in B.
PIN-G Reporter for Imaging and Defining Trafficking Signals in Membrane Proteins
1.2. pIN Derivatives
237
Owing to its modular design and unique cloning sites, one may introduce, substitute, or remove select protein encoding regions into the extracellular, transmembrane, or intracellular domains and test their function. Daughter pIN-G derivatives can be generated with new properties permitting their application as parents for further derivatives. Both approaches are exemplified in the twostage construction of pIN-KDEL, a reporter designed to image endoplasmic reticulum dynamics (4) (Fig. 19.1C). Here, a premature stop codon was first engineered into the parent pIN-G vector to yield a truncated protein lacking the cMyc tag and the entire transmembrane and N-terminal sequences of pIN-G. Owing to retention of the amino terminal signal peptide, the resulting protein – termed PIN-ANT – translocates into the ER and, following signal peptide cleavage, is released as a soluble HA and GFP-tagged protein capable of progressing through and
A.
B.
C.
D.
Fig. 19.2. Fluorescence imaging of PIN-G, and PIN-R-Ant – a red (RFP) fluorescent derivative of PIN-G targeted to the anterograde secretory pathway in HEK293 cells. (A) Expression of total PIN-G fluorescence determined using its intrinsic GFP fluorophore. Note strong cell surface fluorescence (arrowheads) as well as some puncta within intracellular compartments. In this sample, the nuclei were counterstained using DAPI (see Note 7). (B) Example of the use of anti-HA labelling against the extracellular HA epitope tag in pIN-G to resolve just surface rather than total (surface+intracellular) PIN-G distribution (see 3.2). (C) and (D) Co-expression of pIN-G (panel C) and anterograde secretory pathway-targeted pIN-R-Ant (panel D, same cell as in C). Note fluorescence for PIN-G (panel C) as in panel A, but without nuclear (DAPI) counterstaining.
238
Mckeown, Jones, and Jones
demarcating the lumen of the anterograde secretory pathway (Fig. 19.2). Conversion of the functionally inert C-terminal residues of PIN-ANT to a KDEL (Lys-Asp-Glu-Leu-COOH) ER retention motif yields an HA and GFP-tagged protein – termed PIN-KDEL – which selectively resides and demarcates the ER lumen. Using lentiviral gene transduction technology, PINKDEL serves as a useful marker of ER dynamics and continuity in neurons (4). It is also possible to generate pIN constructs with altered intrinsic reporter properties. While obvious modifications include substitutions of the existing HA and cMyc epitope tags, the most important involve those that use sequences encoding monomeric fluorescent proteins with select spectral properties for multicolor imaging applications (5). One additional arena that holds much promise is the development of pIN constructs tailored for fluorescence photoactivation (FPA) studies of protein dynamics in cells (6). Using a photoactivatable GFP (PA-GFP) analog that differs from GFP in just four amino acids (L64F, T65S, V163A, T203H) (7), it has been possible to prepare a construct encoding a photoactivatable analog of the ER-targeted pIN-KDEL termed PA-PIN-KDEL which, following brief excitation at 413 nm, shows a 100-fold increase in fluorescence intensity when imaged with 488 nm light (Fig. 19.3). By tracking the dispersion of activated PA-PINKDEL, it has been possible to confirm the continuity of the ER in diverse cells suggested by photobleaching studies.
A.
B.
Fig. 19.3. Photoactivation of ER-targeted PIN-construct containing photoactivatable GFP (PA-GFP) (A) Fluorescence pre-activation. (B) Fluorescence post-activation. In these experiments, HEK293 cells were transduced with PA-PIN-KDEL (See Fig. 19.1C) using the lentiviral gene delivery system. After 48 h, the cells were imaged at (excitation 488 nm; emission 505 nm), then irradiated for 10 s by a laser (413 nm excitation) in the region approximated by the ellipse in panel A, and then re-imaged. To preclude rapid fluorescence dissipation due to PIN-KDEL diffusion, the sample shown here was fixed prior to irradiation. For dynamic live imaging studies, the fixation step would be omitted and the sample imaged intermittently.
PIN-G Reporter for Imaging and Defining Trafficking Signals in Membrane Proteins
239
In this chapter we now describe the methods we use, routinely, for analyzing the distribution and surface expressions (e.g. Fig. 19.4) of pIN constructs in mammalian cells.
A.
Po So
G
G G
G
Cy3
G G
Cy3 fluorescence
G G
pIN
104
Cy3
G
G
B.
103
102
101
G
Cy3
100 100
101
102
103
104
GFP fluorescence
Fig. 19.4. Determination of surface versus intracellular PIN construct distribution. (A) Assay principle: Any pIN construct (pIN) expressed at the cell surface is detected by labeling live cells with primary antibodies (Po) to the extracellular HA epitope tag followed by Cy3-conjugated secondary (So) antibody. Total PIN construct expression (surface+intracellular) is determined from the GFP (G) fluorescence. (B) Fluorescence cytometry of cells showing red (Cy3) and green (GFP) fluorescence corresponding to surface and total construct expression. Surface expression is determined from the number of cells showing surface (Cy3) to total (GFP) fluorescence (quadrant R4/R4+R6). Note: Cy3 and GFP fluorescence intensities are expressed on log scales. Quadrants R3 and R5 denote background red and green fluorescence, respectively.
2. Materials 2.1. Cell Culture and Transfection
1. HEK293 cells (ECACC) propagated in T75 vented cell culture flasks. 2. Culture medium: Dulbecco’s minimum essential medium (DMEM) supplemented with 10% fetal calf serum (v/v), 2 mM L-glutamine (w/v), and 1% (w/v) penicillin and streptomycin. 3. Phosphate-buffered-saline without calcium and magnesium (PBS–). 4. 6-well culture plates. 5. Transfection medium: unsupplemented DMEM. 6. Fugene 6 transfection agent (Roche Applied Sciences, UK).
240
Mckeown, Jones, and Jones
2.2. Immunofluorescence for Imaging and FACS
1. Round 10 mm, no. 1.5 glass coverslips. 2. Collagen solution: Type I rat-tail collagen (Sigma, Gillingham, UK) 1:400 in PBS–. 3. Phosphate-buffered saline with calcium and magnesium (PBS+). 4. Paraformaldehyde fixative: 4% solution (w/v) in PBS– fresh or stored at –20C. 5. Quench solution: 0.1 M glycine in PBS–. 6. Saponin solution: 0.5% (w/v) saponin (Sigma, UK) in PBS–. 7. Primary antibodies: mouse monoclonal anti-HA.11 (Covance, Cambridge Biosciences, UK), mouse monoclonal antimyc (Developmental Studies Hybridoma Laboratories, Iowa, USA). 8. Secondary antibodies: Cy3-conjugated anti-mouse and Cy5conjugated anti-mouse for FACS (Jackson Immunoresearch, Stratech, UK). 9. Antibody dilution buffer: non-permeabilized cells: PBS–; permeabilized cells: 0.01% (w/v) saponin in PBS–. 10. Nuclear stain: 0.05 mg/mL 40 -6-diamidino-2-phenylindole (DAPI) in PBS–. 11. Mountant: ProLong Gold Fade (Molecular Probes, Invitrogen, Gillingham, UK).
2.3. FACS Analysis
1. T25 vented cell culture flasks. 2. Wash buffer: PBS+ containing 1% (v/v) fetal calf serum.
2.4. Lentiviral Transduction of pIN Constructs
1. HEK293 FT cells (Invitrogen, UK). Culture medium – see Section 2.1. 2. Phenol red-free culture medium: DMEM, containing 25 mM glucose, without phenol red supplemented with 10% (v/v) FBS, 2 mM L-glutamine, 100 U/mL penicillin and 100 mg/mL streptomycin. 3. Lentiviral packaging plasmids (8): pMDLg/pRRE (core plasmid), pRSV.REV (core plasmid), and pMD2VSV-G (envelope plasmid). Self-inactivating lentiviral transfer vector plasmid (e.g., pLV-pIN-KDEL). All the above plasmids are available from the authors upon request. 4. Calcium phosphate mammalian transfection kit (Takara Bio Europe, San-Germain-en-Laye, France). 5. 0.22-mm syringe filter. 6. Vivaspin 20 100,000 molecular weight cut-off filter tubes (Sartorius Ltd., Epsom, UK).
PIN-G Reporter for Imaging and Defining Trafficking Signals in Membrane Proteins
241
3. Methods 3.1. Transfection of Cells with pIN Constructs
1. When approaching confluence (every 3–4 days), passage HEK293 cells by removing the culture medium and suspending the cell monolayer with PBS–. For maintenance cultures seed new T75 flasks at 1:20 in fresh culture medium. 2. For experimental cultures, seed at 1:50 into fresh culture medium using 6-well plates. Use 1 well/data point for pulse-chase and FACS experiments or 1 well. For imaging, assume 1 well/3 coverslips. 3. Incubate at 37C 5%CO2 until cells attain 50% confluence. 4. For each well of cells to be transfected, first mix 2 mg of pIN construct cDNA with 150 mL transfection medium in a 0.5-mL microcentrifuge tube. In a separate 0.5 mL microcentrifuge tube, add 6 mL of pre-warmed (22C) Fugene 6–150 mL transfection medium (see Note 1). 5. Combine the DNA and Fugene 6 mixtures, tap gently, and leave the transfection mixture 20 min for lipid–DNA complexes to form. 6. Apply the transfection mixture evenly and dropwise to the cell well (see Note 2). 7. Incubate cells at 37C for 24 h.
3.2. Immunostaining of Transfected Cells to Determine Total and Surface Expression of pIN Constructs
1. Using a microbiological safety cabinet, place sterile ethanolwashed coverslips in a 12-well plate and wash three times with PBS+ to remove all traces of ethanol. 2. To promote HEK293 cell adherence, add 0.5 mL collagen solution to each well/coverslip for >1 h (see Note 3). 3. Prior to use, aspirate the collagen solution and wash the coverslips twice with 0.5 mL PBS+, then add 1 mL of prewarmed (37C) cell culture medium to each well. 4. At 24-h post-transfection (see Section 3.1. Step 7), aspirate the transfection medium and detach cells in 1 mL PBS– by trituration (see Note 4). For imaging seed cells at 1:3 per coverslip, then incubate for a further 24 h at 37C. For FACS analysis use cells without splitting. 5. To detect total pIN-construct expression via its reporter (e.g., GFP in the case of pIN-G constructs) fluorescence without further staining, the cells from Step 4 can be fixed directly (Step 13). To visualize total pIN construct expression immunocytochemically rather than from the reporter fluorescence, go to Step 6. To distinguish surface from total PIN construct expression, go to Step 10.
242
Mckeown, Jones, and Jones
6. Permeabilize the cells from Step 4 by adding 1 mL/well 0.5% saponin solution for 10 min at 22C. (see Note 5). 7. Aspirate saponin solution, add 250 mL/well of anti-HA 1:500 in dilution buffer and incubate at 22C for 30 min. 8. Wash cells carefully three times with PBS+, then add 200 mL Cy3-conjugated anti-mouse secondary antibody, 1:200 in dilution buffer, for 20 min at 22C. 9. Wash three times with PBS+, then proceed to fixation Step 13. 10. To distinguish surface from total PIN construct expression (see Note 6), incubate each well of cells from Step 4 with 250 mL anti-HA (1:500 in dilution buffer) for 30 min at 22C. 11. Wash cells carefully three times with PBS+, then add 200 mL secondary Cy3-conjugated anti-mouse 1:200 in dilution buffer for 20 min at 22C. 12. Wash cells three times with PBS+, then proceed to fixation Step 13, below. 13. Aspirate the medium from the coverslips and fix cells with 0.5 mL of paraformaldehyde fixative for 20 min (see Note 7). 14. Remove fixative and wash cells three times with PBS+ (see Note 8). Inactivate any remaining fixative with 1 mL of quench solution for 10 min. Remove quench solution by washing coverslips twice with PBS+. 15. Pipette 6 mL of mountant (prewarmed to room temperature) onto a clean glass microscope slide. 16. Carefully remove the coverslip from the well with watchmaker’s forceps, using a clean tissue wipe off excess fluid from the edge of the coverslip and place it, cell side down, onto the mountant. 17. Cover and leave mounted slide, in dark, to ‘‘cure’’ for > 2 h, ideally overnight. 18. Seal the coverslip edges with clear nail varnish. 19. Image within 1 week, if possible, using any fluorescent microscope equipped with filter sets for GFP or Fluorescein isothiocyanate (FITC) (see Note 9).
3.3. Quantitation of Surface and Total pIN Construct Expression by Flow Cytometry
1. At 24-h post-transfection (see 3.1. Step 4), aspirate the transfection medium and detach cells in 1 ml PBS– by trituration (see Note 4). Seed cells into a T25 flask containing 6 mL culture medium and incubate for a further 24 h at 37C. Ensure there are enough cells for assay and control (see Step 10) samples.
PIN-G Reporter for Imaging and Defining Trafficking Signals in Membrane Proteins
243
2. Place cells on ice to prevent internalization and cool to 4C (see Note 10). Once cooled, carefully decant the medium. To each T25 flask add 2 mL of anti-HA diluted 1:500 in FACS wash buffer (chilled to 4C) and incubate on ice for 45 min. 3. Detach cells (see Note 4) using a plastic pipette and transfer cell suspension into glass tubes and pellet cells by low-speed centrifugation at 4C. 4. Decant the medium and wash cell pellets by resuspending in 0.5 mL wash buffer and centrifugation. Repeat centrifugation wash step two more times. 5. Dilute Cy5-conjugated anti-mouse secondary antibody (see Note 11) 1:1000 in a polypropylene tube with wash buffer (5 mL antibody and 995 mL wash buffer is enough for 10 samples), mix and place on ice. 6. Add 100 mL diluted antibody to each FACS sample tube (Step 4). Gently resuspend cells and incubate on ice for 30 min. 7. Pellet cells by centrifugation and decant off the antibody supernatant. 8. Wash cells, as in Step 4, twice with 0.5 mL ice-cold wash buffer and 1 with PBS–. 9. Resuspend the cell pellet in 100 mL PBS–, then fix cells by adding 100 mL 2% (w/v) paraformaldehyde followed by 200 mL PBS+. 10. Perform FACS analysis (see Note 12) taking mean fluorescent values of experimental samples and controls, which should minimally include transfected cells treated, as above, but omitting the primary antibody (in Step 2). 11. Surface expression is assessed from the ratio of the number of cells showing surface (e.g., Cy5) fluorescence to the number of total number of cells expressing PIN construct fluorescence (e.g., green for pIN-G constructs) (Fig. 19.4). 3.4. Pulse-Chase Assay for Imaging pIN Construct Internalization
Prior to fixation, cells can be subjected to a pulse-chase procedure in order to visualize pIN-construct internalization. 1. Follow 3.2. Steps 1–4. 2. Place cells on ice to prevent internalization and cool to 4C. Carefully aspirate off the medium and add 250 mL /well of anti-HA antibody diluted 1:500 in PBS+ (chilled to 4C). Incubate samples on ice for 45 min. 3. Aspirate antibody solution and wash twice with PBS+. Add 1 mL of culture medium (warmed to 22C) and transfer cells to a 37C incubator to initiate internalization.
244
Mckeown, Jones, and Jones
4. After the desired internalization time period, e.g., 1 h (see Note 13), immediately, place the cells on ice, aspirate the medium from the coverslips, and fix the cells with 0.5 mL paraformaldehyde fixative for 20 min. 5. Remove the fixative by gentle aspiration and wash the cells three times with PBS. 6. Inactivate any remaining fixative with 1 mL of quench solution for 10 min, then wash cells three times with PBS+. 7. Add 200 mL of Cy3-conjugated anti-mouse secondary antibody 1:200 in dilution buffer for 20 min at 22C. 8. Wash three times with PBS+, then mount coverslips as described in Steps 15–19, Section 3.2. 3.5. Pulse-Chase FACS Assay of pIN Construct Internalization
Through a combination of flow cytometry and pulse-chase protocols, it is possible to quantify pIN construct internalization from the cell surface, accurately and conveniently. 1. Follow 3.3. Steps 1 and 2. 2. Carefully decant anti-HA antibody and wash cells twice with PBS+. 3. Add 3 ml of culture medium (22C) and incubate at 37C for desired internalization time period (see Note 13). 4. Follow procedures in Section 3.3 Steps 3–11, ensuring cells maintained at 4C
3.6. Viral Transduction of pIN Constructs
3.6.1. Lentivirus Preparation
Owing to the moderately small size of pIN reporter constructs, pIN technology is especially suited for viral gene expression, where insert packaging can be an issue. Although the constructs can be packaged into almost any viral gene delivery system, we use a fourth-generation, replication-defective lentivirus system tailored for gene therapy and transduction of cells, such as neurones, which are notoriously difficult to transfect using conventional lipid-based methods. To enhance pleiotropy, the lentivirus is pseudotyped with VSV-G coat protein, although other coats can be used (see Note 13). 1. HEK293 FT cells (a cell line specialized for viral production) are grown to 40–60% confluency in T75 flasks, exactly as described for HEK293 cells in Section 3.1, Step 1. 2. At 1–2 h prior to transfection, replace the culture medium with 20 ml fresh pre-warmed phenol red-free culture medium. 3. To package VSV-G (Indiana serotype) pseudotyped lentiviral particles, the HEK293FT cultures are transfected using a calcium phosphate mammalian transfection kit as per the
PIN-G Reporter for Imaging and Defining Trafficking Signals in Membrane Proteins
245
manufacturer’s instructions. Good transfection can be achieved using the following ratios: 15 mg pMDLg/pRRE, 5.8 mg pRSV.REV, and 8.2 mg pMD2VSV-G, plus 23.4 mg of the appropriate self-inactivating lentiviral transfer vector plasmid (e.g., pLV-pIN-KDEL). 4. At 16 h post-transfection, remove the culture medium and add 12 ml fresh pre-warmed phenol red-free medium (see Note 14). 5. At 24–48 h post-transfection, collect the culture medium (1st batch). Add 8 ml of fresh, pre-warmed, phenol red-free medium to the T75 flask and return to the incubator. 6. Centrifuge the medium from Step 5 at 500g for 3 min to remove dead cells, then remove minor traces of cell debris by passing the centrifuged medium supernatant through a 0.22 mm Millex1 GP syringe filter. 7. Store the virus-containing medium supernatant from Step 6 in a sealed tube at 4C (or at –80C for longer-term storage). 8. After a further 24 h, i.e., at 48–72 h post-transfection, re-harvest the culture medium (2nd batch) from Step 5 and repeat Steps 6 and 7. 9. Pool first and second batches of spun/filtered culture medium and concentrate to a volume of 300 mL by centrifugation at 5000g, 4C, in a Vivaspin 20 100,000 molecular weight cut-off filter tube. 10. Store the concentrated virus in aliquots of 100 mL batches – 80C until required. The virus will stay active for at least 6 months. 3.6.2. Lentiviral Transduction
1. Prepare HEK293 cells for experimentation as described in Section 3.1, Step 1. Other cells may be used providing they are not >50% confluent. 2. At 24 h after plating, transduce HEK293 cells by adding 50–100 ml of thawed concentrated virus stock (3.6.1. Step 9) directly to the culture medium and swirl gently to mix. 3. Incubate cells at 37C for 24 h, then process for imaging, FACS (e.g., as in 3.2–3.5) or biochemistry.
3.7. Photoactivation Experiments with PA-pIN Constructs
1. HEK293 cells, transfected (See 3.1) or transduced (See 3.6.2) with the desired PA construct, should be prepared for live imaging by growing in glass-bottomed culture dishes coated with type I rat-tail collagen (see Notes 2 and 15). 2. Pre-activated PA-PIN-KDEL may be visualized by excitation using a low-power 413 nm laser line. Unlike WT GFP, PAGFP shows negligible fluorescence when excited at 488 nm (i.e., GFP imaging mode) (see Note 16).
246
Mckeown, Jones, and Jones
3. Photoactivate PA-GFP-tagged pIN construct using focal illumination with high-intensity 400–450 nm light for 5–30 s. Visualize activated PA-GFP by switching to 488 nm, imaging mode excitation with continuous or intermittent (e.g., every 15 s), image capture.
4. Notes 1. Undiluted Fugene 6 must not come into contact with plastic surfaces other than the pipette tip. A 3:1 Fugene 6:cDNA ratio is optimal for efficient transfection of HEK293 cells with pIN constructs. Follow the manufacturer’s instructions to optimize transfections for other cell types. 2. There is no need to change the incubation medium already present on the cells. 3. Depending on cell type, the coverslips may go uncoated or another extracellular matrix protein may be used. 4. HEK293 cells can be detached using PBS–; more adherent cells may require trypsin or EDTA (for FACS analysis) solutions. 5. Saponin is a mild permeabilization agent affording excellent preservation of lipid structures in cells. However, as its actions can be reversible, all post-permeabilization antibody and wash solutions should contain 0.01% (w/v) saponin. 6. Discrimination of surface versus total expression of PIN constructs exploits the presence of its extracellular HA (or cMyc) epitope tags and the failure of antibodies to penetrate nonpermeabilized cells. 7. To facilitate focusing, we recommend treating the cells with 0.5 mL nuclear stain solution prior to fixation. After 1 min, aspirate off the stain and add 0.5 mL PBS– to the well. 8. Carefully apply wash solutions down well sides rather than onto the cells directly. 9. We use a DeltaVision restoration workstation (Applied Precision Instruments, Seattle, USA) which utilizes a Unix-based computer system equipped with SoftWorx version 2.5. Using the high-precision nanochassis stage, optical sections of 0.2 mm are acquired through the z plane of the cells. Z stacks are generated and then deconvolved using a constrained iterative algorithm assigned by DeltaVision.
PIN-G Reporter for Imaging and Defining Trafficking Signals in Membrane Proteins
247
10. To isolate the fraction of pIN construct that is at the cell surface, the cells are labeled with antibodies to the extracellular HA-tag (see Note 6). Chilling at 4C during the labeling period suppresses internalization and, thus, overestimation of surface expression. 11. The antibody-conjugated fluorophore is chosen depending on the laser lines available on the FACS cytometer, with the only requirement being good separation of its fluorescence emission from that of the pIN construct. For pIN-G constructs (green, GFP fluorescence), we use Cy3 or Cy5-conjugated antibodies routinely. 12. We use a FACScaliber flow cytometer (Becton Dickinson, UK). 13. Since the rate of internalization will depend upon the specific pIN construct, pilot time course studies should be performed. Incubation times of 10–100 min are typical. 14. All steps involving live virus (4.6., Step 4 onward) must be conducted in accordance with local guidance for viral handling. In the United Kingdom, this is currently ACDP containment level 2, i.e., requiring procedures to be conducted in a level II microbiological safety cabinet in an ACDP level 2 classified room. Although lentiviral particles are killed on exposure to air and dessication, both the user and the environment are potentially at risk from viral particles in aerosols or liquids. Precautions include wearing two pairs of gloves, of which the outer pair is changed regularly (the inner pair forms a ‘‘second skin’’), and a Howie-style laboratory coat at all times. Any liquid waste should be treated with an antiviral agent, such as VirkonTM (DuPont, Stevenage, UK), prior to disposal in waste water systems. Solid waste should be autoclaved prior to incineration. Equipment and surfaces should be disinfected with a recognized antiviral agent (e.g., VirkonTM) followed by 70% ethanol. 15. When using viral transduction, replace culture medium entirely with phenol red-free culture medium as the indicator can be phototoxic to cells. 16. To circumvent difficulties in focusing (due to low pre-activation PA-GFP fluorescence), cells can be co-transfected with a second plasmid encoding an additional, but more discernible fluorophore such as mRFP.
Acknowledgments This work was supported by funds from the Biotechnology and Biological Sciences Research Council UK: BBSRC, BB/ D008891/1. We are indebted to Professor P.-L. Nicotera and
248
Mckeown, Jones, and Jones
Dr. D. Bano (University of Leicester, UK) for their gift of the lentiviral packaging system and advice on its use. We also thank Jane Kott and the University of Manchester Bioimaging Facility for imaging support. References 1. McKeown, L., Robinson, P., Greenwood, S. M., Hu, W., Jones, O.T, (2006) PIN-G - a novel reporter for imaging and defining the effects of trafficking signals in membrane proteins. BMC Biotechnol 6, 15. 2. Bonifacino, J. S., Cosson, P., and Klausner, R. D. (1990) Colocalized transmembrane determinants for ER degradation and subunit assembly explain the intracellular fate of TCR chains. Cell 63, 503–513. 3. Gu, C., Jan, Y. N., and Jan, L. Y. (2003) A conserved domain in axonal targeting of Kv1 (Shaker) voltage-gated potassium channels. Science 301, 646–649. 4. Jones, V. C., McKeown, L., Verkhratsky, A., Jones, O. T. (2008) LV-pIN-KDEL: a novel lentiviral vector demonstrates the morphology, dynamics and continuity of the
5.
6.
7.
8.
endoplasmic reticulum in live neurones. BMC Neurosci 9, 10. Prescott, M., Battad, J. M., Wilmann, P. G., Rossjohn, J., and Devenish, R. J. (2006) Recent advances in all-protein chromophore technology. Biotechnol Annu Rev 12, 31–66. Patterson, G. H. (2008) Photoactivation and imaging of photoactivatable fluorescent proteins. Curr Protoc Cell Biol Chapter 21: Unit 21.6. Patterson, G. H., and Lippincott-Schwartz, J. A. (2002) Photoactivatable GFP for selective photolabeling of proteins and cells. Science 297, 1873–1877. Follenzi, A., and Naldini, L. (2002) HIVbased vectors. Preparation and use. Methods Mol Med 69, 259–274.
Chapter 20 Imaging b-Galactosidase Activity In Vivo Using Sequential Reporter-Enzyme Luminescence Georges von Degenfeld, Tom S. Wehrman, and Helen M. Blau Abstract Bioluminescence using the reporter enzyme firefly luciferase (Fluc) and the substrate luciferin enables noninvasive optical imaging of living animals with extremely high sensitivity. This type of analysis enables studies of gene expression, tumor growth, and cell migration over time in live animals that were previously not possible. However, a major limitation of this system is that Fluc activity is restricted to the intracellular environment, which precludes important applications of in vivo imaging such as antibody labeling, or serum protein monitoring. In order to expand the application of bioluminescence imaging to other enzymes, we characterized a sequential reporter-enzyme luminescence (SRL) technology for the in vivo detection of b-galactosidase (b-gal) activity. The substrate is a ‘‘caged’’ D-luciferin conjugate that must first be cleaved by b-gal before it can be catalyzed by Fluc in the final, light-emitting step. Hence, luminescence is dependent on and correlates with b-gal activity. A variety of experiments were performed in order to validate the system and explore potential new applications. We were able to visualize non-invasively over time constitutive b-gal activity in engineered cells, as well as inducible tissue-specific b-gal expression in transgenic mice. Since b-gal, unlike Fluc, retains full activity outside of cells, we were able to show that antibodies conjugated to the recombinant b-gal enzyme could be used to detect and localize endogenous cells and extracellular antigens in vivo. In addition, we developed a low-affinity b-gal complementation system that enables inducible, reversible protein interactions to be monitored in real time in vivo, for example, sequential responses to agonists and antagonists of G-protein-coupled receptors (GPCRs). Thus, using SRL, the exquisite luminescent properties of Fluc can be combined with the advantages of another enzyme. Other substrates have been described that extend the scope to endogenous enzymes, such as cytochromes or caspases, potentially enabling additional unprecedented applications. Key words: b-galactosidase, luminescent imaging, in vivo pharmacology, G-protein-coupled receptor.
1. Introduction 1.1. Bioluminescence Imaging of Firefly Luciferase
Bioluminescent imaging based on firefly luciferase (Fluc) activity is now a well-established method that has proven to be a valuable tool for the investigation of biological and pharmacological
P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3_20, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
249
250
von Degenfeld, Wehrman, and Blau
questions (1–5). The characteristics, strengths, and limitations of the different luciferases and their respective luminescent substrates have been described and discussed in detail elsewhere (6). In principle, bioluminescence has the potential to provide unsurpassed sensitivity due to the absence of endogenous luciferase expression in mammalian cells and to the exceedingly low background luminescence emanating from animals. 1.2. Luminescence Imaging of Other Peptidases and Proteases by Sequential ReporterEnzyme Luminescence
We have developed a technology that increases the versatility of luminescence imaging by making it possible for the first time to non-invasively image the activity of enzymes other than luciferases, while capitalizing on the advantages of luciferase-based bioluminescence (7). The method is based on ‘‘caged’’ luciferin conjugates that cannot be cleaved by Fluc due to the presence of a bulky side group. Following cleavage of the side group at a cleavage site specific to the target enzyme, free D-luciferin is generated that, subsequently, is catalyzed by constitutively expressed firefly luciferase to produce light (7). Fluc no longer acts as a bona fide reporter enzyme, but rather as a secondary detection system that makes it possible to visualize the activity of the enzyme of interest. Hence, enzymes for which luminescent substrates are either not known or not applicable to live cells or animals become amenable to bioluminescent imaging. Such a technique has the potential to greatly expand the scope of bioluminescent imaging applications. The technique was first tested in a series of proof-of-principle experiments to image b-gal, a well-known reporter enzyme, using the luciferin conjugate 1-O-galactopyranosyl-luciferin (Lugal) as described below. This substrate was first described by Miska & Geiger, and applied to the highly sensitive detection of bacterial contamination of food stocks (8–10). We provided the first evidence that Lugal has the ability to penetrate living cells without causing overt toxicity (7). As a result, it can be used to image intraas well as extracellular b-gal in cell cultures as well as in living mice, as described below. Importantly, a wide variety of novel luciferin conjugates have been developed, which make it possible to detect and quantify other proteases and peptidases, including endogenous enzymes. The following list shows selected examples of such substrates: l cytochromes P450 (differentiating between specific isoforms CYP1A1, –1A2, –1B1, –2C8, –2C9, –2C19, –2D6, –2J2, –3A4, –3A7, –4A11, –4F3B, –4F12, and –19) (11) (available from Promega, Madison, WI) l
caspases 3/7, 8, and 9 (12)
l
alpha-chymotrypsin (13)
l
carboxylic esterase (10)
Imaging b-Galactosidase Activity In Vivo Using Sequential Reporter-Enzyme Luminescence l
arylsulfatase (10)
l
alkaline phosphatase (10)
251
kinases, e.g., carboxypeptidases A, B, and N (10, 14) Based on the principle exemplified by b-gal, it should be possible to generate substrates containing suitable peptide sequences that make it possible to detect the activity of a wide variety of peptidases or proteases via bioluminescence imaging, enabling novel applications in the fields of toxicology and pharmacology as well as to study of organ and tissue physiology and pathology. To date, however, only b-gal has been tested and shown to be amenable to bioluminescent imaging of living cells and live animals. Recently, caspase activity was imaged in living mice that, however, died later in the process of imaging, apparently due to substrate toxicity (12). Different substrate conjugates may differ from Lugal with respect to toxicity, plasma stability, ability to penetrate the membrane of intact cells, and with respect to their pharmacokinetics following intraperitoneal (or intravenous) injection. Consequently, each substrate will need to be rigorously characterized and optimized in order to assess its applicability to in vivo imaging. For b-gal, we have conducted a series of proofof-principle experiments that demonstrate the suitability of the Lugal substrate for in vivo imaging of intra- and extracellular b-gal activity repeatedly over time. l
1.3. Characterization and Applications of b-Galactosidase Bioluminescent Imaging
b-gal is one of the most widely used reporter enzymes in life sciences. The bacterial enzyme, encoded by the LacZ gene, possesses remarkable stability, retaining high activity through tissue fixation protocols and harsh chemical treatments, making it in many ways an ideal reporter system. It can be used as a reporter in cells and in transgenic animals or as a protein that can be linked to a wide variety of chemical and biological molecules. We have performed the following experiments to establish the feasibility and validity of using b-gal for in vivo bioluminescent imaging: Differentiation of LacZ expressing cells by luminescence in vitro – Lugal was applied to living cells expressing Fluc alone (Fluc cells) or LacZ and Fluc (LacZ-Fluc cells): LacZ cells incubated with Lugal were shown to produce a luminescent signal that was specific for LacZ-Fluc cells (i.e., not detectable in Fluc cells) which was linear with increasing cell number (7). Differentiation of LacZ expressing cells by luminescence in vivo – LacZ-Fluc and Fluc cells were implanted into the muscle or subcutaneously in nude mice and imaged by intraperitoneal injection of Lugal and bioluminescent imaging. LacZ-Fluc cells were shown to produce robust luminescence with a high signal-to-noise ratio compared to Fluc cells (Fig. 20.1).
252
von Degenfeld, Wehrman, and Blau
Fig. 20.1. Luminescent imaging of b-gal activity in living mice using Lugal. b-gal expressing cells can be imaged in a living subject using Lugal. One million cells expressing Fluc were injected into the left tibialis anterior (TA) leg muscle of a BALB/c nude mouse; the same number cells expressing Fluc and b-gal were injected into the right TA. Lugal was injected 6 h later, showing a clear luminescent signal over the right leg injected with cells expressing b-gal and FLuc, whereas the left leg implanted with cells expressing Fluc, but not b-gal, showed only minimal luminescence (left panel). Luciferin was injected 24 h later, showing that equivalent cell numbers expressing Fluc were present in both legs (right panel). The results are representative of five independent experiments. Bioluminescent images are quantified in photons/sec/cm2. Reproduced with permission from Nature Methods, vol. 3, no. 4, pp. 295–301 (2006).
Imaging of inducible LacZ expression in transgenic mice in vivo – Myf-5-LacZ mice were crossed with mice expressing Fluc in all cells, muscle damage was induced by notexin and imaging was performed repeatedly over a period of 9 days by intraperitoneal injection of Lugal. Inducible tissue-specific, gene expression was clearly detected. Detection of antibodies to extracellular or membrane proteins in living mice – Antibodies to a membrane protein, CD4, coupled to b-gal revealed the lymph nodes and spleen (Fig. 20.2). The activity of b-gal outside the cells cleaved the Lugal substrate releasing luciferin that entered neighboring cells, serving as a luminescent substrate for intracellular luciferase. Detection of protein-protein interactions in live animals through imaging of -gal complementation – Cells engineered to express a GPCR fused to a small fragment and b-arrestin2 fused to
Imaging b-Galactosidase Activity In Vivo Using Sequential Reporter-Enzyme Luminescence
253
Fig. 20.2. Luminescent imaging extracellularly labeled cells and of lymphocyte distribution in vivo using anti-CD4 antibodies labeled with b-gal. (A) Injected cells extracellularly labeled with the b-gal reporter enzyme can be imaged using SRL. Untransduced C2C12 myoblasts, not expressing FLuc, were labeled with biotin, followed by an avidin-b-gal conjugate, and injected into a transgenic mouse constitutively expressing Fluc. Lugal was injected 24 h later, resulting in a robust signal localized to the site of implantation. (B–E) Detection of endogenous CD4+ T-cells by injection of anti-CD4 antibodies conjugated to b-gal in wild-type mice transplanted with the bone marrow from transgenic mice constitutively expressing Fluc. (C) Firstly, the pattern of FLuc activity from the FLuc-bone marrow transplanted mice was determined by Luciferin injection. Luminescence intensity and distribution were similar in both mice and revealed only minimal enhancement over organs containing high densities of blood-derived cells, e.g., the liver (‘‘blood pool’’). (D) The following day the same mice were injected with an anti-CD4 antibody conjugated to b-gal or a control anti-rat antibody similarly labeled with b-gal. Four hours after antibody injection, Lugal was injected intraperitoneally, revealing markedly different antibody distributions in both mice. A clear luminescent signal emerged over the cervical lymph nodes and the spleen of the mouse injected with the CD4 antibody (arrows, right panel), whereas only weak regional luminescence was seen in the mouse having received the control antibody (left panel). Bioluminescent images are quantified in photons/sec/cm2. (E) Quantification of luminescence after Lugal injection in regions of CD4+ T-cell enrichment. No difference was observed between the animals over the right thorax, an area containing relatively few blood cells. However, the signal over the liver was slightly enhanced in the mouse injected with the anti-CD4 antibody. A three- to fivefold higher signal was seen over the spleen and both cervical lymph nodes of the mouse injected with the anti-CD4 antibody in comparison to the control, highlighting the organs known to contain high densities of CD4 lymphocytes. Reproduced with permission from Nature Methods, vol. 3, no. 4, pp. 295–301 (2006).
the weakly complementing b-gal fragment were injected into nude mice(15). Upon agonist binding, b-arrestin2 bound to the activated GPCR, resulting in complementation of b-gal and an increase in enzyme activity (Fig. 20.3). Intraperitoneal injection of agonist and subsequent imaging using Lugal resulted in a robust luminescence induction, showing that b-gal complementation can be imaged and used to monitor GPCR activation in live animals. The experiments performed using Lugal have shown that b-gal can be imaged using bioluminescence. However, this is still a very recent technique, the optimization of numerous parameters is still ongoing and the ultimate value of the method as a research tool in
254
von Degenfeld, Wehrman, and Blau
Fig. 20.3. In vivo imaging of b2-adrenergic receptor activation using b-gal complementation in conjunction with sequential reporter-enzyme luminescence. Cells expressing the b2AR construct were transduced to express Fluc and K-Ras and injected in subcutaneous location into the back of BALB/c nude mice (4 106 cells/injection). (A) Seven to fourteen days later, when cells had grown into small tumors, baseline luminescence was imaged by injection of Lugal. Isoproterenol (6 mg/kg ip) or vehicle was injected and luminescence imaged again after 1, 8, 24, and 36 h. (B) Robust increase in luminescence was seen 1 h after isoproterenol injection, which subsequently returned to baseline within 24 h. (C) Quantification shows that signal increase was approximately fourfold over baseline (red line: mice treated with isoproterenol; blue line: vehicle-treated controls) (mean – SEM; n = 9/group). Reproduced with permission from FASEB J vol. 21, no. 14, pp. 3819–3826 (2007).
life sciences remains to be shown. The following technical description focuses on the general aspects of in vivo methods of b-gal imaging using Lugal. If other enzymes are to be imaged, a different set of tests might be required to establish the method.
2. Materials 2.1. Mice
1. Nude mice are, in general, best suited for optical imaging experiments because fur leads to partial extinction and scattering of the emitted light, leading to loss of signal and spatial resolution. BALB/c nude mice are available from several vendors, e.g., Taconic (Germantwon, NY) and Jackson (Bar Harbor, ME) and are especially well suited to this application because they also are T cell-deficient. Hence, immune response to bacterial b-gal, triggering a slight, localized accumulation of immune cells in immune-competent mice, can be avoided (unpublished observation).
Imaging b-Galactosidase Activity In Vivo Using Sequential Reporter-Enzyme Luminescence
255
2. If nude mice cannot be used, mice with white or light fur are preferred. See Note 1. 3. Depending on the question addressed, the source of b-gal that is to be imaged is diverse, including engineered cells, gene transfer into adult animals, transgenic mice, and cells or antibodies labeled with recombinant b-gal protein. It would clearly go beyond the scope of this chapter to describe protocols for each experiment performed to date, which might be of interest to other researchers. 4. In the case of myoblasts retrovirally transduced with the LacZ and the Fluc genes, we refer the reader to the expert protocols published (16, 17). 2.2. Lugal
1. The substrate 1-O-galactopyranosyl-luciferin (Lugal) is commercially available from different sources. The authors have used the substrate obtained as a special order from Promega (Madison, WI), but it is also available from Marker Gene Technologies (Eugene, OR). 2. Lugal is the core ingredient of the BetaGlo1 Kit, an assay system for b-gal quantification. Because the kit is designed to be used as a terminal measurement in cell culture, it contains detergents and other unspecified agents that lead to cell lysis. Hence, the kit cannot be directly used as sold on living cells or for injection into living animals. An alternative approach is described in the Notes section (Note 2).
2.3. Imaging Device
Systems for bioluminescent in vivo imaging that include a cabinet, a CCD camera, as well as data processing and storage software are commercially available from at least three companies. The authors have used the IVIS1-100 and IVIS1-Spectrum systems (Xenogen-Caliper Life Sciences, Hopkinton, MA), but a similar system (NightOWL II LB 983) is available from Berthold Technologies (Bad Wildbad, Germany). As an example, the IVIS1-100 consists of the following components: l A light-tight imaging chamber. l
A heated stage (to avoid cooling off of the anaesthetized animals). The stage is sized to hold five mice or three rats, an important prerequisite for ‘‘relatively high throughput’’ imaging. Included are gas anesthesia connections and a full gas anesthesia system (e.g., isofluorane).
l
A charged-coupled-device (CCD) camera (2048 2048 pixels) cryogenically cooled to –90C by a closed-cycle refrigeration unit to minimize electronic background and maximize sensitivity.
256
von Degenfeld, Wehrman, and Blau l
The system is operated via a computer using the Living Image1 3.0 software. The software also serves to store the data, for image display and analysis.
3. Methods 1. Lugal can be easily dissolved in PBS, aliquoted and frozen for later use (Lugal stock). 2. Before use, an aliquot of the Lugal stock is thawed and diluted in PBS to a final volume of 100 mL per mouse. 3. The Lugal dose used in most of our experiments was between 0.1 and 0.2 mmol/kg body weight. 4. Mice are anesthetized. Injectable compounds (e.g., Ketamine/ Xylacine or Avertin) can be used. The authors, however, prefer inhalation anesthesia (e.g., isofluorane), because it allows prolonged imaging sessions if necessary without the need for reinjection (which would interrupt the imaging procedure and result in altered body position). 5. Anesthesia is induced in an induction chamber with 3–4% isofluorane. 6. Mice are weighed and placed into the imaging chamber, where anesthesia is maintained through isofluorane administered through a nose cone (typically 1.75%). The position of the animal is chosen according to the localization of the organ of interest. See Note 3. 7. Based on body weight, the total dose of Lugal is determined and diluted in PBS to a final volume of 100 mL per mouse, and filled into a 1 mL insulin-type syringe fitted with a 27–29-gauge needle. 8. For intraperitoneal injection of Lugal, mice are briefly removed from the nose cone. It is important to inject head down into the lower left quadrant of the abdomen to minimize the risk of injury of internal organs. See Note 4. 9. Optimal settings of sensitivity (‘‘binning’’) and duration of exposure need to be determined for each experiment. We have used exposures of up to 180 s in experiments with low luminescence. In other instances, e.g., if b-gal was imaged in transgenic mice ubiquitously overexpressing Fluc, luminescence generally was high and exposure, hence had to be short (few seconds). Note: Binning causes reduction in spatial resolution, but this does not limit the quantitative readout of the signal.
Imaging b-Galactosidase Activity In Vivo Using Sequential Reporter-Enzyme Luminescence
257
10. Collect serial images until the peak signal is achieved, typically after 20–30 min. See Note 5. 11. Images are stored by the software (e.g., Living Image1 3.0) for later analysis. Luminescence is represented by a color map over a gray-scale picture of the mouse and can be easily quantified by drawing regions of interest.
4. Notes 1. In some instances (e.g., specific transgenic or knockout mice), black mice have to be used instead of BALB/c nude or white mice. Luminescence and spatial resolution can be improved by shaving the mice over the region of interest if needed. 2. As an alternative to Lugal, the solid component (‘‘cake’’) of the BetaGlo1 Kit can be used, although its precise composition and, in particular, the concentration of Lugal contained are not disclosed by the manufacturer. In this case, the ‘‘cake’’ is not dissolved in the liquid buffer provided in the kit (which contains detergents), but rather in PBS. A variety of doses were used for in vivo experiments. In theory, the use of the solid component of the BetaGlo1 kit might provide an advantage because it also contains active firefly luciferase, ATP, and various inorganic salts, which may locally ‘‘burn off’’ any free Dluciferin contaminating the solution that would contribute to background luminescence. Whether this protocol reduces background, as expected, has not yet been established. 3. Anesthesia can be tricky in the setting of in vivo imaging, because the animals cannot be continuously surveyed while the images are acquired. It is recommended to regularly check on the animals every couple of minutes in between the acquisition of images. 4. Lugal, like the standard firefly luciferase substrate D-luciferin, is readily resorbed following intraperitoneal injection. This may sound like a detail but, in practice, dramatically reduces the requirements on time and technical skills. Indeed, it is not possible for a single operator to intravenously inject five mice simultaneously, because this technique typically takes up to several minutes per mouse. In contrast, five anesthetized mice can be easily injected intraperitoneally within a few seconds (‘‘simultaneously’’), placed in the imager and imaged. Thus, the option of intraperitoneal injection of the substrate is a prerequisite for ‘‘relatively high-throughput’’ imaging (if two imagers are available, up to 30 mice can be imaged per hour by a single operator). Similar to Lugal, the caspase-3-substrate
258
von Degenfeld, Wehrman, and Blau
(Caspase-Glo, Promega, Madison, WI) can be delivered intraperitoneally (12). If other conjugates are to be used, it will be necessary to determine first whether they are absorbed following intraperitoneal administration (as is the case for D-Luciferin and Lugal) or need to be injected intravenously. 5. Importantly, background luminescence was seen in all experiments, most likely due to ‘‘spillover’’ of free D-luciferin. Indeed, in the presence of active firefly luciferase (e.g., in the transplanted cells) that acts as the ‘‘helper enzyme,’’ any free luciferin will produce light. Lugal appears to have limited stability in mouse in plasma and, furthermore, to be partially degraded during freeze/thaw cycles, generating free luciferin. This problem can be circumvented in part by using exclusively images acquired within the first few minutes following Lugal injection, thus enabling reliable imaging of b-gal activity. In later images background luminescence was found to increase, apparently due to the generation of free luciferin, until, eventually, b-gal activity was no longer distinguishable at all. An additional reason for unspecific luminescent signal might be the presence of endogenous, mammalian b-gal, leading to cleavage of Lugal; such signal might be reduced or prevented if alternative models such as the b-gal knockout mice were used, or by using other reporter enzymes that are not unspecifically expressed in mammalians. Further studies are necessary to establish the stability of Lugal and to optimize the protocol. Chemical modification most likely could improve the stability in serum. If other substrates are to be used, this caveat needs to be cautiously monitored and characterized. References 1. Wu, J. C., Chen, I. Y., Wang, Y., Tseng, J R., Chhabra, A., Salek, M., Min, J. J., Fishbein, M. C., Crystal, R., and Gambhir, S. S. (2004) Molecular imaging of the kinetics of vascular endothelial growth factor gene expression in ischemic myocardium. Circulation 110, 685–691. 2. Contag, P. R., Olomu, I. N., Stevenson, D. K., and Contag, C. H. (1998) Bioluminescent indicators in living mammals. Nat Med 4, 245–247. 3. Contag, C. H., Contag, P. R., Mullins, J. I., Spilman, S. D., Stevenson, D. K., and Benaron, D. A. (1995) Photonic detection of bacterial pathogens in living hosts. Mol Microbiol 18, 593–603. 4. Edinger, M., Sweeney, T. J., Tucker, A. A., Olomu, A. B., Negrin, R. S., and Contag, C. H. (1999) Noninvasive assessment of
5.
6.
7.
8.
tumor cell proliferation in animal models. Neoplasia 1, 303–310. Gross, S., and Piwnica-Worms, D. (2005) Real-time imaging of ligand-induced IKK activation in intact cells and in living mice. Nat Methods 2, 607–614. Zhao, H., Doyle, T. C., Coquoz, O., Kalish, F., Rice, B. W., and Contag, C. H. (2005) Emission spectra of bioluminescent reporters and interaction with mammalian tissue determine the sensitivity of detection in vivo. J Biomed Opt 10, 41210. Wehrman, T. S., von Degenfeld, G., Krutzik, P. O., Nolan, G. P., and Blau, H. M. (2006) Luminescent imaging of beta-galactosidase activity in living subjects using sequential reporter-enzyme luminescence. Nat Methods 3, 295–301. Geiger, R., Schneider, E., Wallenfels, K., and Miska, W. (1992) A new ultrasensitive
Imaging b-Galactosidase Activity In Vivo Using Sequential Reporter-Enzyme Luminescence
9.
10.
11.
12.
bioluminogenic enzyme substrate for betagalactosidase. Biol Chem Hoppe Seyler 373, 1187–1191. Miska, W., and Geiger, R. (1987) Synthesis and characterization of luciferin derivatives for use in bioluminescence enhanced enzyme immunoassays. New ultrasensitive detection systems for enzyme immunoassays, I. J Clin Chem Clin Biochem 25, 23–30. Miska, W., and Geiger, R. (1988) A new type of ultrasensitive bioluminogenic enzyme substrates. I. Enzyme substrates with D-luciferin as leaving group. Biol Chem Hoppe Seyler 369, 407–11. Cali, J. J., Ma, D., Sobol, M., Simpson, D. J., Frackman, S., Good, T. D., Daily, W. J., and Liu, D. (2006) Luminogenic cytochrome P450 assays. Expert Opin Drug Metab Toxicol 2, 629–645. Shah, K., Tung, C. H., Breakefield, X. O., and Weissleder, R. (2005) In vivo imaging of S-TRAIL-mediated tumor regression and apoptosis. Mol Ther 11, 926–931.
259
13. Monsees, T., Miska, W., and Geiger, R. (1994) Synthesis and characterization of a bioluminogenic substrate for alpha-chymotrypsin. Anal Biochem 221, 329–334. 14. Geiger, R., and Miska, W. (1989) A new type of ultrasensitive bioluminescence enzyme substrates for kininases. Adv Exp Med Biol 247B, 383–388. 15. von Degenfeld, G., Wehrman, T. S., Hammer, M. M., and Blau, H. M. (2007) A universal technology for monitoring G-protein-coupled receptor activation in vitro and noninvasively in live animals. Faseb J 21, 3819–3826. 16. Banfi, A., Springer, M. L., and Blau, H. M. (2002) Myoblast-mediated gene transfer for therapeutic angiogenesis. Methods Enzymol 346, 145–157. 17. Springer, M. L., Rando, T. A., Blau, H. M., Banfi, A., Springer, M. L., and Blau, H. M. (2002) Gene delivery to muscle. Myoblastmediated gene transfer for therapeutic angiogenesis. Curr Protoc Hum Genet Chapter 13, Unit 13 4.
INDEX The letters ‘f ’, ‘t’ and ‘n’ following locators refer to figures, tables and note numbers respectively.
A Accuracy................................................................ 19, 33–34 Acquisition..........4, 11 n3, 40, 41, 100, 102, 118, 119, 120, 121, 126, 128, 129, 131, 132f, 134 n6, 158, 163, 169, 200, 257 n3 Activity................................... 2f, 3, 4, 7, 11 n2, 13, 20, 27, 30f, 35 n12, 61 n4, 89, 90, 91, 102 n10, 105–106, 109, 111, 113f, 114f, 115–116, 118f, 121 n16, 122 n18, 123f, 128–129, 134 n2, 138, 141, 186f, 195, 196, 199 n1, 200 n9, 201 n15, 220, 249–258 Adenosine tri-phosphate .................................................. 25 Aequorea victoria.................................................................. 7 Aequorin/Aequorins ... 7–8, 203, 204–209, 210f, 211f, 212t Aequorea victoria............................................................ 7 Apoaequorin ..................................................... 7–8, 208 Analysis environmental ............................................................... 2 food ........................................................................... 247 multiplex ................................................................. 9–11 Anesthesia.............40, 41, 42, 43, 44 n5, 65, 66–67, 79, 81, 82, 109, 112, 117, 120 n14, 126, 134 n7, 197, 201 n12, 255, 256, 257 n3 Animal model ....................................15, 20, 116, 119, 125, 126 tranplantation.............................................................. 76 Anterior pituitary, see Pituitary Antibody ......... 31, 33, 35, 50, 102, 199, 200 n6, 239f, 240, 242, 243, 244, 246 n5, 247 n11, 253f Apoaequorin ........................................................... 7–8, 208 Apoprotein.....................................................................7, 8f Apoptosis ...................................... 1, 88, 105–114, 193–194 Area under the curve (AUC) ...............39–40, 178, 182 n15 Assay ..... 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 17–18, 20, 33–34, 35 n7, 36 n14, 88, 99, 108, 110, 111, 116, 120 n1, 122 n18, 126, 128–129, 132–133, 140–141, 144, 148 n5, 151 n19, 157, 160, 162, 163–164, 169, 174, 175f, 176, 178f, 179, 180 n7, 181 n12, 182 n16, 185–191, 194, 195, 196, 200 n1, 215–233, 239f, 242, 243, 244, 255 Assay system ....... 3, 4, 9, 11 n3, 13 n9, 108, 122, 140–141, 147 n5, 148 n6, 188, 195, 255
ATP, see Adenosine tri-phosphate Attenuation............16–17, 18–19, 20, 65, 116, 132, 134 n1 AUC, see Area under the curve (AUC) Autoinducer ........................................................................ 5
B Background ..... 9, 39, 42f, 43, 48, 57, 59–60, 65, 67, 70 n3, 76, 83, 88, 89, 115, 119, 121 n16, 128, 129, 130, 147 n5, 151 n19, 169, 177, 181 n14, 182 n15, 197, 209, 211, 222, 224f, 225f, 232 n21, 239f, 250, 255, 257 n2, 258 n5 Bacteria/Bacterial...2, 3, 4–5, 6, 7, 9, 10, 11, 12, 16, 27, 28, 109, 116, 137–151, 188, 207f, 250, 251, 254 colonization....................................................... 137–151 light emitting .................................................... 137–151 Bandwidth............................................................... 9, 10, 63 Bimolecular fluorescence complementation .......... 216, 217, 218, 220, 221, 222, 224, 225, 231 n15 Bioanalytical........................................................................ 1 Bioluminescence Imaging (BLI), see Imaging Bioluminescence Resonance Energy Transfer............... 157, 173–182, 215–233 Biosafety.................................................................. 133, 134 Biotin .......................................................................28, 253f Blocking .............................................................. 31, 33, 199 BRET, see Bioluminescence Resonance Energy Transfer Bright-GloTM Assay System ............3, 4, 11 n3, 13 n9, 148 Burden......................................... 15–16, 17–18, 37–45, 139
C Caged Luciferin .............................................................. 250 Calcium.....................7, 77, 78, 95, 203–213, 239, 240, 244 calcium-activated .......................................................... 7 intracellular or subcellular............................. 7, 203, 209 oscillation .......................................................... 203–213 Calibration .......................... 9, 30f, 32, 33–34, 40, 91f, 157, 158, 163–164, 166f, 180 n3, 204, 208f, 209, 212, 213 n7 Cancer ......... 15–16, 26, 37, 47, 48f, 56, 105, 156–157, 185 Caspase............105–106, 108, 109, 110, 111, 112, 113 n10, 114f, 250, 251, 257 n4 CCD, see Charge-coupled device (CCD) camera
P.B. Rich, C. Douillet (eds.), Bioluminescence, Methods in Molecular Biology 574, DOI 10.1007/978-1-60327-321-3, ª Humana Press, a part of Springer Science+Business Media, LLC 2009
261
BIOLUMINESCENCE
262 Index
Cell culture ....................3, 4, 5, 7, 10, 11, 27, 31, 33, 50–51, 95, 96, 97, 99, 108, 110, 128, 129, 131, 156, 174, 176, 188, 189, 195, 196, 207, 217, 220, 239, 250, 255 death...................................... 88, 105 See also Apoptosis differentiation ....................................................... 26, 88 engraftment........................................................... 15–16 line...................2, 3, 38, 56, 92, 128, 174, 204, 212, 214 lysis........................................................3, 4, 6, 204, 255 proliferation .......................................26, 90, 91f, 92, 93 stem cell, see Embryonic stem cell surface ..... 26, 28, 29f, 31, 33, 34, 35, 48, 49, 215, 237f, 239f, 244, 247 survival .......................................................... 15, 87–102 tracking ........................................................... 88–89, 90 transfection.............................................................. 3, 95 transplantation ............................................................ 18 Centrifugation ...............4, 12 n9, 56, 59, 96, 206, 243, 245 Charge-coupled device (CCD) camera ..........40, 41, 44 n4, 66, 67, 84 n5, 88, 89, 112, 114f, 115–116, 117, 120 n11, 126, 130, 131, 146 n1, 156, 162, 195, 197–198, 200 n9, 205, 209, 255 Circulation .............................. 41, 63, 66, 69f, 70 n3, 71 n6 Click Beetle........................................................................2f CMV, see Cytomegalovirus Coelenterazine ........5–6, 7, 12 n7, 110, 116, 126, 127, 128, 129, 130, 134 n5, 138, 141, 142, 143, 144, 148 n6, 151 n19, 173–174, 175, 176, 177, 180 n1, 181 n8, 190, 203–205, 208, 209, 212t, 218, 219, 220, 221, 222, 224, 226, 227f, 228f, 229, 230 n5 Collagenase ...................77, 78, 79–80, 94, 98, 99, 204, 206 Colonization ................................................... 119, 137–152 Confocal microscopy....................................................... 176 Conformational....................................................... 1, 7, 178 Conjugation/Conjugated........48, 50, 55, 56, 58, 61 n3, 64, 102 n11, 195, 239f, 240, 242, 243, 244, 246 n11, 250, 251, 253f, 258 n4 Culture .........2f, 3, 4, 5, 6, 7, 10, 11, 12 n9, 27, 28, 29, 30f, 31, 33, 34, 35 n8, 50, 56, 59, 81, 93, 94, 95, 96, 97, 98, 99, 101 n2, 108, 110–111, 112, 127, 128, 129, 131, 156, 174, 176, 177, 188, 189–190, 191f, 195, 196, 204, 205–206, 207, 212 n1, 217, 220, 239, 240, 241, 242, 243, 244–245, 247 n15, 250, 255 Cypridina noctiluca............................................................... 6 Cytomegalovirus .................. 92, 95, 109, 188, 190 n1, 236f
D Data acquisition ........................................................ 40, 126 Death .........................................88, 105, 139, 145, 201 n12 Deep Blue C ......................................................220, 230 n5 Degree of labeling............................................................. 55
Detection dual-color ...................................................................... 9 high sensitivity ..........................................2, 8, 129, 204 high throughput..................................2, 11, 12, 90, 179 in vivo ....................................................................... 251 limit of detection......................157, 158, 166, 167f, 169 non-invasive ........................... 1, 20, 90, 118f, 122f, 250 off-line .................................................................. 27, 31 See also Imaging Diabetes .......................................................... 75–76, 79, 88 Differentiation ..............1, 26, 87–88, 90–91, 193–194, 251 DOL, see Degree of labeling Dosing............134 n3, 147 n4, 149 n9, 150 n12, 156, 158f, 159, 160–161, 162, 163, 164, 165, 166, 167, 168 Dots............................................................................. 63–71 Dual color ........................................................................... 9 Dual-GloTM assay system................................................... 9 Dynamic range................... 2, 39f, 158f, 163, 169, 203–204
E Ecto-ATPase ......................................................30f, 35 n13 Efficiency ..........4, 92, 99, 112, 118, 120 n9, 156–157, 166, 180 n5, 189–190, 213 n7, 230 n10 Electroporation .............. 92, 158, 159, 161, 166f, 167f, 168 Elution ...............................................................9, 10, 12 n9 Embryonic Stem Cell ............................................... 87–102 Emission ............ 2f, 5, 6, 8, 9–10, 11 n3, 12 n8, 16, 18, 38, 39–40, 41, 43, 49f, 57, 59, 63, 65, 67, 68, 71 n5, 83 n3, 84 n5, 88, 89, 118, 119, 120 n7, 121 n16, 122 n18, 127, 128t, 129, 144, 145f, 146 n1, 147 n2, 151 n18, 156–157, 163, 169, 173–174, 175f, 177, 179, 181 n14, 182 n15, 198f, 203–204, 205, 208, 209, 210f, 211, 213 n7, 218, 219, 220, 221, 222, 225, 226, 227f, 228f, 229, 232 n20, 238f, 247 n11 Emitter...............................................................9, 11, 71 n5 Engraftment.............................................. 15–16, 75–76, 88 Epitope............................ 216, 236, 237f, 238, 239f, 246 n6 ESC, see Embryonic Stem Cell Exposure ........... 43, 44, 61 n1, 70 n1, 94, 97, 99, 118, 129, 138–139, 144f, 145f, 151 n21, 197, 198f, 200 n9, 247 n14, 256 Expression..... 1, 2, 3, 4, 5, 6, 10, 11 n3, 16, 20, 35 n11, 38, 90–91, 92, 101 n7, 108, 109, 110, 112, 115–116, 126, 127, 138–139, 142, 148 n5, 149 n11, 155–169, 174, 176, 179, 180 n5, 181 n14, 188, 194, 204, 205, 206, 207, 208, 213 n7, 221, 222, 223, 232, 236, 237f, 239, 241, 242, 243, 244, 246 n6, 247 n10, 250, 252 Extracellular .................25–36, 49, 105–106, 111, 119, 143, 144–146, 150 n15, 185, 187f, 215–216, 236, 237–238, 239f, 246 n3, 247 n10, 250, 251, 252, 253f Ex Vivo......................................16, 143, 145, 160, 163, 204
BIOLUMINESCENCE
Index 263
F
H
FACS ........88–89, 92, 99, 101 n7, 216, 240, 241, 243, 244, 245, 246 n4, 247 n11 Field of view........ 66, 82, 118, 129, 130, 131, 132f, 134 n6, 145, 197, 198f Firefly ...186–187, 188, 189–191, 191 n7, 249–250, 257 n2, 258 n5 Flow ...... 17, 43, 63–71, 82, 101 n7, 141, 163, 213 n5, 242, 244, 247 n12 Fluc ....... 91, 106, 107, 108, 109, 110, 112, 113f, 114f, 249, 250, 251, 252, 253f, 254f, 255, 256 Fluorescence.................................. 47–61, 227f, 228f, 237f, 238f, 239f BiFC, see Bimolecular fluorescence complementation GFP, see Green Fluorescent Protein protein................................................................... 55, 56 Fluorescence resonance energy transfer ........... 216, 217, 220, 226 Fluorophore ...................................................................... 49 FOV, see Field of view FRET, see Fluorescence Resonance Energy Transfer Fusion ..........90, 94, 95, 174, 176, 218, 219, 221, 222, 225, 226, 227f, 228f, 231 instrument..........................218, 219, 222, 225, 231 n17 protein....... 91, 174, 179 n6, 180 n5, 181 n12, 182 n14, 187f, 207, 212, 232 n22, 236
Herpes Simplex Virus .................... 90, 116, 122f, 123f, 186, 204, 206 hESC, see Embryonic Stem Cell High-sensitivity .............................................................. 129 High-throughput........................................................ 37–45 HSV, see Herpes Simplex Virus Hydrodynamic dosing............................................. 159, 165 Hypoxia............................................................................. 17
G b-Galactosidase............................................... 220, 249–258 Gaussia princeps ..........................................5, 126, 128t, 138 Gene...............2, 50, 66, 88, 92, 94, 95, 155–169, 174, 176, 185–191, 203, 217, 255 expression...........1, 2, 16, 138, 139, 155–169, 203, 244, 249, 252 knockdown........................................................ 155–169 non viral gene delivery ...................................... 155, 156 non viral gene expression .......................................... 155 regulation ...................................................................... 1 transgene ............................................... 4, 156, 161, 199 GFP, see Green Fluorescent Protein Gluc..................5, 6, 25, 29, 75, 76, 94, 137, 138, 140, 141, 142, 143, 147 n2, 148 n6, 160, 164, 165, 166, 181 n10, 205, 206, 209, 217, 240 GPCRs, see G protein-coupled receptors G protein-coupled receptors........................... 216, 252, 253 Green Fluorescent Protein .......... 88, 91f, 101 n7, 102 n11, 127, 176, 180 n1, 181 n11, 207f, 208, 209, 212 n3, 213 n3, 216, 217, 220, 221, 231 n16, 236, 237, 238, 241, 242, 245, 247 n16 Growth.......... 5, 7, 12 n5, 15, 38, 49, 61 n4, 65, 93, 94, 95, 99, 111, 127, 128, 138, 151 n19, 186, 188, 190, 191, 194, 236
I Imaging ..........1, 2, 8, 15–20, 37–44, 47–61, 63–71, 75–84, 87–102, 115–123, 125–134, 139, 140, 141, 142, 143, 145, 146 n1, 147 n7, 149 n11, 151 n21, 155–169, 185–191, 194, 195, 196, 197, 198f, 199 n10, 201 n10, 203–213, 216, 217, 235–247, 249–258 bioluminescence imaging (BLI) ........ 15, 37–44, 76, 79, 82, 91f, 92, 99, 100, 101 n8, 112f, 117, 118f, 123f, 125–134, 139, 141, 143, 156, 194, 195, 196, 197, 198f, 203–213, 249, 251 dual-color ...................................................................... 9 high sensitivity .......................................................... 129 in vivo ............................................... 169, 204, 249–258 molecular............................................................... 47, 88 multiplexed.................................................................... 8 non-invasive .................................................................. 1 optical........................................................................ 254 overlay ......................................................................... 41 plate........................................................................... 128 processing images........................................................ 42 real-time...................................................................... 76 single cell....................................................................... 2 spectral ........................................................................ 57 system........ 41, 44, 51, 57, 59, 70, 84, 90f, 101 n8, 117, 120 n12, 141, 158f, 160 well ..................................................2, 99, 243, 250, 255 See also Detection Immunofluorescence............................... 194, 195, 198, 240 Immunostaining.................................................200 n6, 241 Infection/Infectious ........................................ 115–123, 206 bacterial ................................................................... 5, 10 viral.................................................................... 125, 128 Inflammation .........................................1, 17, 26, 198f, 215 Infra-red...................................................................... 63, 66 Injection .........6, 7, 8, 19, 32, 38, 41, 43, 44, 51, 57, 59, 61, 65, 67, 68, 70, 78, 79, 81, 82, 83, 84, 91f, 93, 100, 101, 114f, 116, 117, 119, 121f, 127, 128, 130, 134, 140, 147, 148, 149, 150, 162, 168, 169, 177, 197, 198f, 200, 201, 251, 252, 253f, 254f, 255, 256, 257 n4, 258 n5 In situ ................................................................ 19, 147, 149
BIOLUMINESCENCE
264 Index
Instrument ........... 2, 3, 39, 42, 44, 77, 78, 81, 88, 102 n11, 129, 130, 131, 133, 134, 146 n2, 174, 177, 180, 190, 195, 205, 218, 219, 221, 222, 225, 231 n17 Integration .............. 5, 8, 10, 33, 38, 39, 41, 92, 118, 144f, 145f, 146f Intein............................................... 106, 107, 109, 185–191 Interference ............................................9, 35, 41, 66, 67 n4 Intracellular.... 2, 7, 12, 143, 203–213, 236, 237f, 239f, 252 Intramuscular dosing ...................................... 159, 161, 168 Intraperitoneal ......... 19, 57f, 79, 100, 114f, 115, 121f, 127, 128, 140, 141, 142, 143t, 149, 157, 251, 252, 253, 256, 257, 258 Intra-portal ........................................................... 78, 81–82 Intravenous .... 38, 116, 127, 130, 142f, 143f, 150 n12, 251, 257 n4, 258 In vivo ..................3, 7, 8, 16, 20, 37, 49, 63, 64, 70, 71, 76, 79, 84, 88, 89, 90, 91, 92, 93, 110, 111, 116, 122, 126, 127, 130, 133, 139, 140, 145, 148, 150, 151, 161, 165f, 169 n6, 204, 251, 252, 253f, 255, 257 n2 Islet..................................76, 77, 78, 79, 81, 83, 84, 87, 207 isolation....................................................................... 77 transgenic .................................................................... 76 transplantation ......... 16, 17, 18, 75, 76, 78, 81, 82f, 83, 84, 88, 90, 91f, 92, 99 Isolation .......................................................... 75, 77, 78, 79
K Knockdown ............................................................. 155–169
L Labeling .........10, 49, 55, 58, 61, 63, 64, 66, 68, 69, 70, 92, 200 n6, 219, 226, 227f, 228f, 232 n20, 239f, 247 LacZ................................................................ 251, 252, 255 Langerhans.............................................................. 204, 206 See also Islet Lectin .......................................................28, 35 n11, 49, 50 Lentivirus ...................................................... 92, 95, 96, 244 Light ..... 4, 5, 6, 7, 10, 11 n4, 12 n9, 16, 17, 18, 19, 30, 32, 33, 38, 39, 40, 41, 42f, 43, 44, 52, 56, 57, 58f, 60f, 66, 67, 83, 84, 88, 89 n6, 110, 116, 119, 120 n11, 121 n16, 122 n18, 126, 127, 130, 131, 132, 134 n3, 137–151, 157, 160, 162, 173, 174, 175, 177, 181, 190, 196, 199, 200 n4, 203, 205, 208, 209, 212 n3, 213 n6, 218, 219, 221, 222, 224, 225, 229, 230 n6, 232 n21, 238, 246, 250, 253f, 254, 255, 258 n5 box............................................................................... 41 detection...................................................................... 38 emission ....... 5, 18, 38, 39, 41, 43, 84 n5, 89, 119, 121, 122, 144f, 146 n1, 147 n2, 151 n18, 173, 175f, 177, 203, 208 integration..................................................................... 5 propagation ................................................................. 18
quantification ............................................................ 110 source .............................................................. 16, 18, 19 Limit of detection..................................157, 158, 167f, 169 Line (cell)..................................................2, 3, 56, 128, 244 Luciferase....... 3–13, 16, 17, 18, 20, 27, 28, 29f, 30, 31, 32, 33, 34, 35, 36, 38, 76, 82, 83, 84f, 89, 90, 91f, 93, 101 n9, 106, 108, 110, 111, 115, 116, 117, 118, 119, 120 n11, 121f, 122 n18, 126, 127, 128t, 129, 130, 132f, 133, 138, 139, 140, 141, 142, 147 n2, 148 n5, 149 n11, 156, 157, 158, 158f, 159, 160, 161, 162, 163, 164, 165f, 166f, 167f, 169, 176, 179 n1, 186, 187, 188, 189, 190, 191, 194, 195, 196, 199 n1, 200 n10, 201 n15, 212 n3, 217, 218, 220, 224, 227f, 228f, 229, 232 n20, 249, 250, 252, 257 n2, 258 n8 activity........... 4, 7, 20, 30f, 35 n12, 118, 119, 122, 129, 196, 199 n1, 201 n15 bacterial (Lux)....................................................... 5, 138 Bright-GloTM assay system .....3, 4, 9, 11, 13, 108, 122, 148 n6, 188, 195, 255 cell-surface ...........................................................27f, 28 click-beetle ...........................................................2f, 189 Cypridina noctiluca.....................................2f, 6, 7, 12 n7 Dual-GloTM assay sytem .............................................. 9 firefly (Fluc) .......... 2, 4, 6, 9, 18, 34 n1, 76, 88, 89, 91f, 101 n9, 106, 107, 108, 111, 115, 118f, 126, 127, 128, 130, 132f, 133, 138, 142, 147 n5, 160, 186, 187, 188, 189, 190, 191, 249, 250, 257 n2, 258 n5 Gaussia princeps (Gluc).............................................. 126 green............................................................................ 10 Photinus Pyralis ......................................... 106, 115, 159 Photorhabdus luminescens ........................................... 138 red ....................................................................... 8, 9, 10 Renilla reniformis (LR) (Rluc) ........................... 185, 187 reporter plasmid ............................................................ 3 soluble ............................................................28, 29f, 34 Staphylococcus protein A (SPA)-luciferase............. 31, 33 Steady-GloTM assay system...................................11 n3 Luciferin........ 4, 5, 6, 7, 9, 10, 11 n4, 12 n7, 17, 19, 27, 30, 31, 32, 33, 34, 35 n14, 38, 39, 40, 41, 43 n6, 79, 82, 83 n3, 84f, 88, 89, 99, 100, 102 n10, 109, 110, 111, 112, 115, 117, 118, 119, 120 n12, 121 n17, 126, 127, 128, 129, 130, 134, 137, 138, 140, 141, 142, 143, 144, 148 n5, 149 n11, 156, 157, 158, 159, 162, 163, 164, 166f, 169 n6, 189, 195, 196, 197, 198f, 200, 201, 250, 253f, 257 n4 caged luciferin ........................................................... 250 oxyluciferin.........................................17, 34 n1, 89, 138 Lugal ......................... 250, 251, 252f, 253f, 254f, 255, 256, 257 n2, 258 n4 Luminescence .................. 5, 6, 7, 10, 18, 30f, 32f, 84f, 122, 211, 249–258 sequential reporter enzyme luminescence (SRL) .................................................... 249–258
BIOLUMINESCENCE
Index 265
Luminometer ......................... 9, 27f, 140, 146 n2, 188, 195 Lux .............................................................. 5, 138, 140, 142 Lymph/Lymphatic...................................................... 63–71 Lysis .....3, 4, 6, 12, 108, 110, 111, 113, 122, 160, 164, 188, 190, 191, 196, 200, 204, 209, 212t, 255
M Magnetic Resonance Imaging (MRI) .............................. 92 MAPK, see Mitogen Activated Protein Kinase Miniaturization................................................................... 2 Mitogen Activated Protein Kinase ......................... 185–191 Molecular ....... 5, 7, 8f, 16, 26, 56, 63, 65, 70 n2, 71 n4, 79, 88, 102 n11, 116, 175, 181 n8, 186, 195, 204, 216, 218, 219, 240, 245 biology............................................................... 7, 37, 88 imaging ....................................................................... 88 Monitoring........ 2, 6, 89, 92, 93, 106, 109, 118f, 119, 122f, 123f, 137–151, 156, 208 Mouse ......... 19, 31, 35 n11, 39f, 40, 41, 43, 50, 51, 56, 57, 58, 59, 60f, 61 n4, 64, 65, 68, 69, 76, 77, 79, 81, 82f, 84f, 90, 94, 96, 99, 100, 101 n2, 107, 112, 117, 118, 119, 120 n7, 125, 130, 132f, 157, 159, 167, 168 n2, 194, 195, 197, 204, 240, 244, 253f, 257 MRI, see Magnetic Resonance Imaging (MRI) Multiplex/Multiplexed ................................................. 8–11
N Non invasive................................. 1, 20, 90, 118f, 122f, 250
O Off line.................................................................27, 28f, 31 Optical ...............16–20, 66, 70, 89, 127, 140, 146 n1, 151, 194, 246 n9 Oscillation............................................................... 203–213 Overlay.......................................................41, 42f, 145, 163 Oxygen ........... 5, 7, 17, 20, 40, 41, 43, 65, 66, 84, 120 n12, 138, 141, 143, 149 Oxyluciferin .................................................. 17, 34, 89, 138
P Pancreas ........................................................56, 77, 79, 206 See also Islet Pathogen ....42, 116, 117, 119, 120, 128, 129, 144, 150 n15 PET, see Positron emission tomography pH ................. 4, 5, 7, 9, 10, 12, 29, 30, 35 n12, 40, 47–61, 63–71, 78, 93, 108, 138, 148, 160, 188, 195, 205, 217, 219, 229 n2 Pharmacokinetics ..............................17, 18, 19, 20, 38, 251 Phosphorylation .................................................... 1, 26, 193 Photinus Pyralis .............1, 3, 17, 30, 38, 89, 106, 115, 126, 127, 128t, 159, 189 Photoactivation ............................................... 235, 238, 245
Photobleaching ......................................................... 63, 238 Photon..........8, 16, 17, 19, 34, 43, 83, 84, 88, 89, 100, 111, 112, 116, 119, 120, 121f, 122f, 123f, 129, 132, 133, 139, 140, 144, 145f, 146, 147 n2, 150 n15, 151 n21, 156, 157, 158f, 163, 165, 166, 167f, 169, 174, 188, 197, 200, 204, 205, 209, 210, 211, 213, 252f, 253f Photoprotein ....................................................................... 7 calcium-activated .......................................................... 7 Photorhabdus luminescens ......................................... 138, 142 PIN-G reporter....................................................... 235–247 Pituitary .........................................................204, 205, 206f Plasmid..............38, 95, 112, 157, 159, 213, 222, 236, 240, 245, 247 Positron emission tomography ......................................... 88 Probe ................48f, 49f, 56, 57, 58f, 60f, 89, 99, 100, 157, 196, 218 Progression............................1, 61, 116, 119, 125, 129, 185 Proliferation ........................................ 26, 87–102, 185, 193 Promoter .......... 2f, 6, 76, 83 n1, 88, 92, 95, 106f, 109, 113, 126, 127, 132f, 157, 159, 160, 187f, 188, 189, 190, 194, 207f, 236f SBE promoter........................................................... 194 Propagation..................................................16, 18, 19, 207f Protein......1, 2, 4, 6, 7, 49, 55, 88, 147, 156, 173–182, 186, 188, 206, 212 n3, 217, 222, 231 n16, n18, 235, 236, 238, 252 A: Protein, see Staphylococcus protein A (SPA) apoprotein ................................................................7, 8f conformational changes ............................................ 1, 7 fluorescent..................... 88, 89, 91f, 92, 127, 176, 179, 207f, 236 fusion protein.......... 97, 174, 179, 180, 181, 182, 187f, 232, 236 intracellular ........................................................... 2, 236 membrane protein............................................. 236, 252 phosphorylation .................................................... 1, 193 photoprotein ................................................................. 7 post-translational modification................................. 186 protein-protein interactions..1, 157, 173–182, 220, 252 purification.......................................................... 12, 216 secreted...................................................................... 156 splicing .............................................................106f, 186 surface ......................................................................... 49 trafficking.................................................................. 235 Purification ...............................12, 13, 31, 34, 80, 216, 217 Purinoceptor ..............................................................26, 30f
Q Quantification............4, 15, 16, 17, 18, 110, 116, 118, 119, 123f, 129, 131, 132, 139, 146f, 189, 211, 222, 231, 253f, 254f, 255 Quantum dots ............................................................. 63–71
BIOLUMINESCENCE
266 Index R
Raf-1 ....................................................................... 185–191 Ras..................................................................185–191, 254f Real-time .............. 6, 27f, 28, 29f, 31, 33, 60, 76, 111, 119, 125–134, 178f Region of interest ........ 41, 43, 129, 131, 132f, 197, 209 n1 Regression......................................................... 15, 164, 224 Regulatory DNA sequence.............................................................. 2 element.......................................................................... 1 Relative light unit ................................................... 110, 190 Renilla reniformis..................................... 108, 126, 187, 189 Reporter .........2, 3, 6, 7, 8, 10, 87–102, 108, 110, 116, 119, 126, 127, 128, 129, 130, 132, 133, 138, 156, 186, 188, 189, 194, 199 n1, 235–247 construct...................................................................... 92 gene ............................................................................... 2 intein-mediated................................................. 185–191 PIN-G reporter................................................. 235–247 plasmid.....................................................................2f, 3 single step reporter activity assay .................................. 3 system........................................................................ 251 Resolution ......10, 47, 82, 89, 118, 129, 131, 134, 151, 197, 254, 256, 257 Resonance ................................. 92, 157, 173–182, 215–232 See also BRET; FRET; MRI Reticuloendothelial system (RES)........................ 64, 66, 70 Rluc ..................89, 108, 110, 176, 178, 181, 182, 218, 219, 221, 222, 223f, 224, 225f, 226, 227f, 228f, 231, 232 n19 RLU, see Relative Light Unit RNA................................................................ 127, 157, 160 RNA interference (RNAi)................................ 155–169 shRNA .....................................157, 160, 164, 165f, 166 siRNA ............................................... 157, 160, 164, 165 ROI, see Region of interest
S Saccharomyces cerevisia ......................................................... 4 SBE promoter................................................................. 194 Second messenger ............................................................... 1 Sensitivity.........2, 4, 8, 12, 35, 36, 47, 55, 66, 83, 127, 129, 130, 131, 134 n2, 151 n21, 169, 197, 204, 209, 250, 255, 256 Sequential reporter enzyme luminescence (SRL) .. 249–258 shRNA ...........................................157, 160, 164, 165f, 166 Signal/Signaling (pathway)............................. 193, 194, 215 Single step................................................................... 3, 128 siRNA ............................................. 157, 160, 164–165, 166 Smad ....................................................................... 193–201 Small-volume sample analysis ............................................ 2 SNAP...... 217, 219, 221, 226, 227, 228, 232 n20, 232 n22, 232 n25
SPA, see Staphylococcus protein A Spectral/Spectrum...............................12, 39, 127, 161, 255 imaging ................................................................. 57, 59 resolution .............................................................. 10–11 spectral emission ......................................................... 18 Splicing ........................................................... 106, 109, 186 Staphylococcus protein A.........28, 31, 33, 34, 35 n10, 35 n11 Steady-GloTM assay system...................................... 11, 148 Stem cell, see Embryonic Stem Cell Substrate administration ................................................. 38, 79, 82 injection .................................................................... 255 preparation ................................................................ 219 System assay.........3, 4, 9, 11, 108, 122, 140, 148, 188, 195, 255 detection.................................................................... 250 reporter................................................................ 10, 251 reticuloendothelial ....................................64, 66, 68, 70
T Target.......2, 4, 8, 47–61, 63, 64, 65, 67, 88, 120, 161, 165, 167, 168, 187f, 204, 207f, 208, 212, 215, 216, 236f, 237f, 238, 250 Temperature....... 4, 8, 11 n2, 12 n6, 32, 35 n12, 52, 53, 54, 55, 58, 76, 78, 79, 80, 93, 95, 96, 98, 111, 113, 130, 139, 141, 168, 188, 198, 199, 201 n13, 208, 217, 219, 220, 221, 224, 229 n2, 242 TGFb, see Transforming Growth Factor b Tomography.................................................1, 18, 70 n1, 88 See also Positron emission tomography Tracking............................. 76, 88, 90, 91f, 92, 120 n8, 238 Trafficking .............................................. 131, 216, 235–248 Transcription ........................6, 88, 119, 186, 189, 194, 207 Transfection efficiency .................................................4, 92, 112, 189 transgene ............................................... 4, 156, 161, 199 Transforming Growth Factor b, 193–201 Transgenic/Transgene ....76, 83, 84, 194, 197, 199 n1, 251, 252, 253f, 255, 256, 257 n1 Transplantation.... 16, 17, 18, 75, 76, 78, 81, 82, 83 n1, 84, 88, 90, 91f, 92, 99 Tumor burden ....................................................... 15, 17, 37–45 growth ......................................................................... 15 progression .................................................................... 1 regression .................................................................... 15
U Ultrasensitive detection....................................................... 2
V Vaccinia........................................................... 131, 132, 133 Validation............................15–20, 127, 129, 133, 174, 176
BIOLUMINESCENCE
Index 267
Vasculature.................................................................. 63–71 Vector.........3, 6, 7, 88, 91, 92, 93, 105, 109, 110, 159, 160, 174, 176, 187, 189, 191, 195, 204, 206, 207, 225, 229, 236, 237, 240, 245 Venus ..............................................174, 176, 177, 180, 182 Virus Cytomegalovirus (CMV)...................... 92, 95, 109, 188 Herpes simplex virus (HSV)........90, 116, 118, 122, 123, 186, 204, 206 Lentivirus ...................................................... 92, 95, 244
W Wavelength....6, 9, 10, 12, 19, 65, 66, 68, 71, 89, 127, 173, 177, 178, 179, 182, 220
Y Yeast................................................................2, 3, 4, 5, 6, 7 See also Saccharomyces cerevisia YFP ...........................88, 180, 181, 216, 218, 222, 224, 225