Animal Models of Human Inflammatory Skin Diseases
1391_C00.fm Page 2 Wednesday, November 19, 2003 10:32 AM
Animal M...
67 downloads
1708 Views
13MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
Animal Models of Human Inflammatory Skin Diseases
1391_C00.fm Page 2 Wednesday, November 19, 2003 10:32 AM
Animal Models of Human Inflammatory Skin Diseases Edited by
Lawrence S. Chan
CRC PR E S S Boca Raton London New York Washington, D.C.
1391_C00.fm Page 4 Wednesday, November 19, 2003 10:32 AM
Library of Congress Cataloging-in-Publication Data Animal models of human inflammatory skin diseases / edited by Lawrence S. Chan. p. cm. Includes bibliographical references and index. ISBN 0-8493-1391-0 (alk. paper) 1. Skin—Inflammation—Animal models. 2. Alopecia areata—Animal models. I. Title. RL231.C48 2003 616.5—dc22 2003060292 This book contains information obtained from authentic and highly regarded sources. Reprinted material is quoted with permission, and sources are indicated. A wide variety of references are listed. Reasonable efforts have been made to publish reliable data and information, but the author and the publisher cannot assume responsibility for the validity of all materials or for the consequences of their use. Neither this book nor any part may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, microfilming, and recording, or by any information storage or retrieval system, without prior permission in writing from the publisher. All rights reserved. Authorization to photocopy items for internal or personal use, or the personal or internal use of specific clients, may be granted by CRC Press LLC, provided that $1.50 per page photocopied is paid directly to Copyright clearance Center, 222 Rosewood Drive, Danvers, MA 01923 USA. The fee code for users of the Transactional Reporting Service is ISBN 0-8493-1391-0/04/$0.00+$1.50. The fee is subject to change without notice. For organizations that have been granted a photocopy license by the CCC, a separate system of payment has been arranged. The consent of CRC Press LLC does not extend to copying for general distribution, for promotion, for creating new works, or for resale. Specific permission must be obtained in writing from CRC Press LLC for such copying. Direct all inquiries to CRC Press LLC, 2000 N.W. Corporate Blvd., Boca Raton, Florida 33431. Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation, without intent to infringe.
Visit the CRC Press Web site at www.crcpress.com © 2004 by CRC Press LLC No claim to original U.S. Government works International Standard Book Number 0-8493-1391-0 Library of Congress Card Number 2003060292 Printed in the United States of America 1 2 3 4 5 6 7 8 9 0 Printed on acid-free paper
1391_C00.fm Page 5 Wednesday, November 19, 2003 10:32 AM
Dedication This book is dedicated to my former mentors who have participated in building the foundation of my academic career: John H. Rockey, who kindly introduced me to the exciting world of laboratory research; John J. Voorhees, who inspired me with his unwavering dedication to cutaneous biology; Kevin D. Cooper, who gently guided me through the paths of learning through investigation and scientific writing; and David T. Woodley, who enlightened me with his unceasing curiosity in clinical and experimental dermatology. This book is also dedicated to my parents who have instilled in me the characteristics of humility and perseverance; to my wife, who has unselfishly supported my academic career, each step of the way; and to James Bostwick, who has always encouraged me throughout the years.
1391_C00.fm Page 6 Wednesday, November 19, 2003 10:32 AM
1391_C00.fm Page 7 Wednesday, November 19, 2003 10:32 AM
Preface What is an animal model of human inflammatory skin disease? According to the American Heritage Dictionary, a model is a small object, usually built to scale, that represents some existing object. Likewise, an animal model of inflammatory skin disease is an animal representation of a human inflammatory skin disease. An animal model of human inflammatory disease does not need to be completely identical to that of its human counterpart, nor can it always be. The degree of dissimilarity between the human immune system and that of an animal or between the human skin structure and that of an animal, however small, makes it almost impossible for perfect identity. Nevertheless, sufficient similarity allows investigators who study the animal model to gain insight into the general pathological pathways of a disease process that likely occurs in human patients. In this book, both spontaneously arising and experimentally induced animal models are presented. Why should we study an animal model of human inflammatory skin disease? Indeed there are many outstanding in vitro model systems from which we can gain much insight into the molecular mechanisms of skin inflammation. However, only an animal model can bring our understanding of the disease mechanism to a real-life level. An animal model makes it possible for investigators to study how the immune system relates to the actual tissues of the biggest organ of the body, the skin. Moreover, the actual pathological process of an inflammatory skin disease can only be accurately observed and analyzed in a living animal model, and not in any in vitro model system, however brilliant it may be. By using an animal model, investigators can learn about the step-bystep immunological sequence of events for inflammation induction and progression and the factors contributing to these events. The complexity of the disease process in a living organism simply cannot be adequately understood by any in vitro model system, however sophisticated it may be. Furthermore, the in vivo studies conducted in animal models certainly cannot be carried out in human patients, for practical reasons and for obvious ethical concerns. Finally, an animal model provides an excellent avenue for pharmaceutical companies to test the effectiveness and safety of new anti-inflammatory medications before testing these medications in human patients. How then shall we study the animal model of human inflammatory skin disease? This is indeed the major focus of this book. This book provides both the principles and practices of how we go about studying inflammatory skin diseases using living animal models. On the theoretical side, this book establishes foundations by providing the comparative structure and function of the skin and the comparative immunology system in animal species commonly used as models. This comparative information is provided to help readers analyze the relevance of findings obtained in an animal model with that obtained in human patients. Additionally, the unique immune privileges occurring in the eye and hair follicles are discussed with respect to their possible breakdown that leads to inflammation at these “privilege sites.” On the practical side, this book provides general discussion on methods of experimental animal modeling, as well as specific expert experience from investigators who themselves have successfully generated and studied these models. I have attempted to include the most useful models in this book and have requested that contributors follow a standard format for the sake of uniformity and benefit to readers. In a fast-moving field of biomedical research, I am sure that new information regarding these animal models will surface soon after this book is published. These future new discoveries, along with suggestions from readers, will be used to develop better subsequent editions based on the foundation provided in this first edition.
1391_C00.fm Page 8 Wednesday, November 19, 2003 10:32 AM
1391_C00.fm Page 9 Wednesday, November 19, 2003 10:32 AM
Editor Lawrence S. Chan, M.D., was born in Hong Kong, the then-British colony. He immigrated to the United States in 1975. After graduating from the Massachusetts Institute of Technology with double bachelor degrees in chemical engineering and life sciences in 1981, he entered medical school at the University of Pennsylvania, where he obtained his M.D. degree in 1985. Dr. Chan then performed his internship at the Cooper Hospital/University Medical Center. Both his dermatology residency and immunodermatology fellowship took place at the University of Michigan Medical Center. After a brief stint on the Wayne State University School of Medicine faculty, he served as assistant professor of dermatology and director of immunodermatology at Northwestern University Medical School from 1993 to 2002. Currently, he is associate professor of dermatology and microbiology/immunology and the director of skin immunology research at the University of Illinois at Chicago, and is supported by three research grants from the National Institutes of Health. Dr. Chan has authored and co-authored 75 peer-reviewed biomedical journal articles and 25 book chapters.
1391_C00.fm Page 10 Wednesday, November 19, 2003 10:32 AM
1391_C00.fm Page 11 Wednesday, November 19, 2003 10:32 AM
Contributors Grant J. Anhalt, M.D. Professor of Dermatology Johns Hopkins University School of Medicine Baltimore, Maryland
Kenneth B. Gordon, M.D. Associate Professor of Dermatology Loyola University Maywood, Illinois
Joseph M. Carroll, Ph.D. Senior Scientist Millennium Pharmaceuticals Cambridge, Massachusetts
Bruce Hammerberg, Ph.D. Professor of Immunoparasitology North Carolina State University College of Veterinary Medicine Raleigh, North Carolina
Lawrence S. Chan, M.D. Associate Professor of Dermatology and Microbiology/Immunology University of Illinois at Chicago College of Medicine Chicago, Illinois Paul J. Christner, Ph.D. Associate Professor of Medicine Division of Rheumatology Thomas Jefferson University Philadelphia, Pennsylvania Jonathan L. Curry, M.D. Postdoctoral Fellow in Pathology Loyola University School of Medicine Maywood, Illinois Luis A. Diaz, M.D. Professor of Dermatology University of North Carolina Chapel Hill, North Carolina Amos Gilhar, M.D. Associate Professor of Dermatology Laboratory for Skin Research The Bruce Rappaport Faculty of Medicine Technion-Israel Institute of Technology Haifa, Israel Anita C. Gilliam, M.D., Ph.D. Associate Professor of Dermatology, Pathology, and Hematology-Oncology Case Western Reserve University Cleveland, Ohio
Andrew Hillier, MVSc, MACVSc Associate Professor of Dermatology College of Veterinary Medicine The Ohio State University Columbus, Ohio Natsuho Ito, M.D. Research Fellow in Dermatology Department of Dermatology Hautklink Universitaet Hamburg Universitaets-Krankenhaus Eppendorf Hamburg, Germany Taisuke Ito, M.D. Research Fellow in Dermatology Department of Dermatology Hautklink Universitaet Hamburg Universitaets-Krankenhaus Eppendorf Hamburg, Germany Toshiroh Iwasaki, D.V.M., Ph.D. Professor of Veterinary Internal Medicine Department of Veterinary Internal Medicine Tokyo University of Agriculture and Technology Fuchu, Tokyo, Japan Sergio A. Jimenez, M.D. Professor of Medicine and Biochemistry/Molecular Biology Division of Rheumatology Thomas Jefferson University Philadelphia, Pennsylvania
1391_C00.fm Page 12 Wednesday, November 19, 2003 10:32 AM
Richard S. Kalish, M.D., Ph.D. Associate Professor of Dermatology Health Science Center State University of New York at Stony Brook Stony Brook, New York
Kevin J. McElwee, Ph.D. Senior Scientist Department of Dermatology Philipp University at Marburg Marburg, Germany
Keiko Kawamoto, D.V.M., Ph.D. Associate Professor Research Center for Animal Hygiene & Food Safety Obihiro University of Agriculture and Veterinary Medicine Obihiro, Japan
Vu Thuong Nguyen, M.D. Assistant Professor of Dermatology University of California at Davis Davis, California
Lloyd E. King, Jr., M.D., Ph.D. Professor of Dermatology Vanderbilt University Nashville, Tennessee Zelmira Lazarova, M.D. Assistant Professor of Dermatology Medical College of Wisconsin Milwaukee, Wisconsin Ning Li, Ph.D. Associate Professor of Dermatology Department of Dermatology University of North Carolina Chapel Hill, North Carolina Xiu-Min Li, M.D. Assistant Professor of Pediatrics Division of Pediatric Allergy and Immunology Mount Sinai School of Medicine New York, New York Zhi Liu, Ph.D. Associate Professor of Dermatology and Microbiology/Immunology University of North Carolina Chapel Hill, North Carolina Hiroshi Matsuda, D.V.M., Ph.D. Professor Laboratory of Clinical Immunology Faculty of Agriculture Tokyo University of Agriculture and Technology Fuchu, Tokyo, Japan
Brian J. Nickoloff, M.D., Ph.D. Professor of Pathology and Microbiology/Immunology Loyola University School of Medicine Maywood, Illinois Jerry Y. Niederkorn, Ph.D. Professor of Ophthalmology University of Texas Southwestern Dallas, Texas Thierry Olivry, Dr. Vet., Ph.D. Associate Professor of Dermatology North Carolina State University College of Veterinary Medicine Raleigh, North Carolina Ralf Paus, M.D. Professor of Dermatology Department of Dermatology Hautklink Universitaet Hamburg Universitaets-Krankenhaus Eppendorf Hamburg, Germany Kalyanasundaram Ramaswamy, Ph.D. Associate Professor of Microbiology/Immunology College of Medicine University of Illinois at Rockford Biomedical Science Rockford, Illinois David S. Rubenstein, M.D., Ph.D. Assistant Professor of Dermatology University of North Carolina Chapel Hill, North Carolina
1391_C00.fm Page 13 Wednesday, November 19, 2003 10:32 AM
Hugh A. Sampson, M.D. Professor of Pediatrics Division of Pediatric Allergy and Immunology Mount Sinai School of Medicine New York, New York Jonathan M. Spergel, M.D., Ph.D. Assistant Professor of Pediatrics The Children’s Hospital of Philadelphia University of Pennsylvania School of Medicine Philadelphia, Pennsylvania Birte Steiniger, Ph.D. Professor of Anatomy and Immunobiology Institute of Anatomy and Cell Biology Marburg, Germany John P. Sundberg, D.V.M., Ph.D., Dipl. A.C.V.P. Senior Staff Scientist The Jackson Laboratory Bar Harbor, Maine
Desmond J. Tobin, Ph.D. Associate Professor of Cell Biology University of Bradford West Workshire, England Simon J. Warren, M.D. Assistant Professor of Dermatology and Pathology University of North Carolina Chapel Hill, North Carolina Toshiyuki Yamamoto, M.D. Professor of Dermatology Tokyo Medical and Dental University School of Medicine Bunkyo-ku, Tokyo, Japan Minglang Zhao, M.D. Assistant Professor of Dermatology University of North Carolina Chapel Hill, North Carolina
1391_C00.fm Page 14 Wednesday, November 19, 2003 10:32 AM
1391_C00.fm Page 15 Wednesday, November 19, 2003 10:32 AM
Table of Contents Part I Comparative Structure and Function of the Skin.........................................................................1 Chapter 1 Comparative Structure and Function of the Skin: Overview of Structures and Components .........3 Lawrence S. Chan Chapter 2 Comparative Structure and Function of the Skin: Epithelial Basement Membrane Zone.............19 Lawrence S. Chan
Part II Comparative Immunology.............................................................................................................31 Chapter 3 Human Immune System...................................................................................................................33 Kalyanasundaram Ramaswamy Chapter 4 Canine Immune System ...................................................................................................................79 Bruce Hammerberg Chapter 5 Rat Immune System.........................................................................................................................91 Kevin J. McElwee and Birte Steiniger Chapter 6 Mouse Immune System .................................................................................................................119 Lawrence S. Chan and Kenneth B. Gordon
Part III Immune Privilege and Skin Inflammation.................................................................................141 Chapter 7 Immune Privilege of the Eye.........................................................................................................143 Jerry Y. Niederkorn Chapter 8 The Theory of Immune Privilege of the Hair Follicle..................................................................155 Ralf Paus, Natsuho Ito and Taisuke Ito
1391_C00.fm Page 16 Wednesday, November 19, 2003 10:32 AM
Part IV Methods of Experimental Animal Modeling .............................................................................167 Chapter 9 Passive Transfer and Active Induction of Autoimmune Diseases ................................................169 Zhi Liu, Minglang Zhao and Luis A. Diaz Chapter 10 Adoptive Transfer of Cellular Immunity.......................................................................................179 Lawrence S. Chan Chapter 11 Molecular Biological Manipulation of the Immune System by Transgenic Techniques .............187 Lawrence S. Chan
Part V Inflammatory Skin Disease Models ............................................................................................197
Section A Bullous Pemphigoid......................................................................................................................199 Chapter 12 Natural Bullous Pemphigoid in Companion Animals...................................................................201 Thierry Olivry Chapter 13 Experimental Mouse Model of Bullous Pemphigoid: Passive Transfer of Anti-BP180 Type XVII Collagen, Antibodies ...................................................................................................213 Zhi Liu and Luis A. Diaz
Section B Epidermolysis Bullosa Acquisita.................................................................................................225 Chapter 14 Spontaneous Canine Model of Epidermolysis Bullosa Acquisita ................................................227 Thierry Olivry
Section C Mucous Membrane Pemphigoid .................................................................................................239 Chapter 15 Spontaneous Canine Model of Mucous Membrane Pemphigoid .................................................241 Thierry Olivry
1391_C00.fm Page 17 Wednesday, November 19, 2003 10:32 AM
Chapter 16 Experimental Mouse Model of Mucous Membrane Pemphigoid: Passive Transfer of Anti-Laminin 5 Antibodies ............................................................................................................251 Zelmira Lazarova
Section D Pemphigus Vulgaris .....................................................................................................................261 Chapter 17 Spontaneous Canine Model of Pemphigus Vulgaris .....................................................................263 Thierry Olivry Chapter 18 Experimental Mouse Model of Pemphigus Vulgaris: Passive Transfer of Desmoglein-Targeting Antibodies..................................................................................................275 Zelmira Lazarova and Grant J. Anhalt Chapter 19 Experimental Mouse Model of Pemphigus Vulgaris: Passive Transfer of Nondesmoglein 1 and 3 Antibodies ............................................................................................................................285 Vu Thuong Nguyen
Section E Pemphigus Foliaceus ....................................................................................................................307 Chapter 20 Spontaneous Canine Model of Pemphigus Foliaceus ...................................................................309 Toshiroh Iwasaki and Thierry Olivry Chapter 21 Experimental Mouse Model of Pemphigus Foliaceus: Passive Transfer of Desmoglein-Targeting Antibodies..................................................................................................321 David S. Rubenstein, Simon J. Warren, Ning Li, Zhi Liu and Luis A. Diaz
Section F Psoriasis.........................................................................................................................................329 Chapter 22 Experimental Chimeric SCID Mouse/Human Skin Model of Psoriasis: Induction by Transfer of Cellular Immunity..................................................................................................331 Jonathan L. Curry and Brian J. Nickoloff Chapter 23 Experimental Mouse Model of Psoriasis by Transgenic Expression of Integrin .........................341 Joseph M. Carroll
1391_C00.fm Page 18 Wednesday, November 19, 2003 10:32 AM
Section G Atopic Dermatitis .........................................................................................................................351 Chapter 24 Spontaneous Canine Model of Atopic Dermatitis.........................................................................353 Andrew Hillier and Thierry Olivry Chapter 25 Spontaneous Mouse Model of Atopic Dermatitis in NC/Nga Mice.............................................371 Keiko Kawamoto and Hiroshi Matsuda Chapter 26 Experimental Mouse Model of Atopic Dermatitis by Transgenic Induction ...............................387 Lawrence S. Chan Chapter 27 Experimental Mouse Model of Atopic Dermatitis: Induction by Oral Allergen..........................399 Xiu-Min Li and Hugh A. Sampson Chapter 28 Experimental Mouse Model of Atopic Dermatitis: Induction by Epicutaneous Application of Allergen......................................................................................................................................417 Jonathan M. Spergel
Section H Alopecia Areata ............................................................................................................................427 Chapter 29 Spontaneous and Experimental Skin-Graft-Transfer Mouse Models of Alopecia Areata ...........429 John P. Sundberg, Kevin J. McElwee and Lloyd E. King, Jr. Chapter 30 Spontaneous Rat Model of Alopecia Areata in the Dundee Experimental Bald Rat (DEBR)..........451 Kevin J. McElwee Chapter 31 Spontaneous Canine Model of Alopecia Areata ...........................................................................469 Desmond J. Tobin and Thierry Olivry Chapter 32 Experimental Chimeric SCID Mouse/Human Skin Model of Alopecia Areata: Induction by Transfer of Cellular Immunity..................................................................................................483 Richard S. Kalish and Amos Gilhar
1391_C00.fm Page 19 Wednesday, November 19, 2003 10:32 AM
Section I Scleroderma ..................................................................................................................................493 Chapter 33 Spontaneous Mouse Models of Systemic Scleroderma ................................................................495 Paul J. Christner and Sergio A. Jimenez Chapter 34 Experimental Mouse Model of Scleroderma/Graft versus Host Disease: Induction by Transfer of Cellular Immmunity....................................................................................................517 Anita C. Gilliam Chapter 35 Experimental Mouse Model of Scleroderma: Induction by Bleomycin.......................................535 Toshiyuki Yamamoto Index ..............................................................................................................................................549
1391_C00.fm Page 20 Wednesday, November 19, 2003 10:32 AM
1391_C01.fm Page 1 Tuesday, November 18, 2003 4:50 PM
PART I Comparative Structure and Function of the Skin
1391_C01.fm Page 2 Tuesday, November 18, 2003 4:50 PM
1391_C01.fm Page 3 Tuesday, November 18, 2003 4:50 PM
CHAPTER
1
Comparative Structure and Function of the Skin: Overview of Structures and Components Lawrence S. Chan
CONTENTS I. Introduction ............................................................................................................................3 II. The Epidermis ........................................................................................................................4 A. Langerhans Cells ...........................................................................................................5 B. Melanocytes ...................................................................................................................5 C. Keratinocytes .................................................................................................................7 III. The Dermal–Epidermal Junction (Skin Basement Membrane Zone)...................................9 IV. The Dermis.............................................................................................................................9 V. The Hypodermis...................................................................................................................10 VI. Summary ..............................................................................................................................10 Acknowledgment..............................................................................................................................11 References ........................................................................................................................................11
I. INTRODUCTION The skin is the largest organ of the human body and accounts for about 15% of total body weight [1]. Skin is well known for its functional role as a protective physical barrier: water and electrolytes are kept inside of the body and toxins and pathogens are kept out [1–7]. It is now clear that skin is far more than just a protective physical barrier, but rather a dynamic organ that has three other recognized functions: endogenous homeostasis (e.g., body temperature and fluid regulation); metabolism (e.g., Vitamin D synthesis); and sensory input [8]. More recently, skin has been recognized as actively participating in various immunological regulation processes and responses [8–12]. However, not all immunological reactions occurring in the skin are beneficial to the host. Some harmful reactions result from overreacting to trivial “invaders” such as allergens, and lead to intolerable skin inflammation (contact dermatitis) that requires medication [13–16]. Other reactions probably result from exposing autoreactive lymphocytes to immunologically hidden skin antigens, such as epidermal cell surface component desmoglein 1 (Dsg1) or epithelial basement membrane component type VII collagen, through an “epitope spreading” mechanism or other
0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
3
1391_C01.fm Page 4 Tuesday, November 18, 2003 4:50 PM
4
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
autoimmune mechanisms, which in turn lead to autoimmunity and inflammatory damage to skin structure and functions [17–25]. In this book, the principles and practices of animal models of human inflammatory skin diseases are discussed. Before confident interpretation of clinical and experimental data obtained from animal models is possible, comparative analyses of the structure and function and the immune systems of skin are in order. Demonstrating structural and functional similarities between the human skin and that of mammals used in animal modeling goes a long way in providing a sound scientific basis to interpret these data. Thus, in this chapter, we provide an overview of skin structure and components. In Chapter 2, the detailed structures and functions of the skin basement membrane zone are discussed. In these two chapters, we discuss the comparative structure and function between human skin and that of other mammals, particularly small mammals commonly used in biomedical research laboratories. Part I is not meant to be a comprehensive review of all skin structures and functions; rather, its purpose is to highlight salient features essential for understanding inflammatory skin diseases. Part II is devoted to comparison of the immune systems between humans and small mammals commonly used in animal modeling. These comparative studies help in determining the scientific relevance of findings obtained from animal models in relationship to human inflammatory skin diseases.
II. THE EPIDERMIS There are two types of epithelia in a mammal’s body: the epithelium of the skin (epidermis) provides an external covering for the whole body, and the epithelium of the mucous membrane provides a lubricating lining of an internal surface or an organ, such as oral cavity, conjunctiva, and intestine. The epidermis of the skin differs slightly from the epithelium of the mucous membrane in that stratum cornea (outer keratinized layer) is present only in the former. Besides this difference, it is now clear that the composition of certain epidermal components is also varied. For example, one of the intercellular adhesion molecules that bind epithelial cells together, termed desmoglein 3 (Dsg3), is present primarily in the suprabasal layers of the skin epidermis, but it is present throughout all layers of the mucous membrane epithelium [26]. Furthermore, it has also been reported that the degree of expression of Dsg1, an intercellular adhesion molecule located in the upper epidermis, is lower in the mucous membrane epithelium than that of skin [27]. These distinct tissue distribution patterns of Dsg between skin and mucous membrane are identified in both human and mouse epithelia [26,27]. Correspondingly, these distinct distributions of Dsg seem to explain the clinical phenomenon that patients with the autoimmune skin blistering disease, pemphigus foliaceus, with autoantibodies targeting Dsg1, manifesting with intraepidermal blister primarily on the skin, and not on mucous membranes, is due to the combined effect of compensatory abilities of Dsg3 to maintain upper epidermal adherence in mucous membrane and the low level of Dsg1 expression in mucous membrane, despite Dsg1 being targeted by the autoantibodies. Similarly, this distinct tissue distribution of Dsg3 also seems to explain the clinical observation that patients with another autoimmune skin blistering disease, pemphigus vulgaris, with autoantibodies targeting Dsg3, manifests as intraepidermal blister initially on mucous membranes followed by blister on skin at a later stage [28], as this process is likely due to greater amounts of target antigen (Dsg3) of the autoantibodies present in mucous membranes. In addition, the types of keratins present in the skin epidermis vary somewhat from those in the mucous membrane epithelium [29]. These small variations notwithstanding, the epithelia have similar structures and functions throughout the body. The epidermal cells are primarily composed of keratinocytes, Langerhans cells, and melanocytes, with more than 80% of epidermal cells being keratinocytes [29]. As a continually renewing squamous epithelium, the epidermis is organized into four layers named after their position or structural properties: stratum germinativum (basal layer); stratum spinosum (squamous cell layer); stratum granulosum (granular
1391_C01.fm Page 5 Tuesday, November 18, 2003 4:50 PM
COMPARATIVE STRUCTURE AND FUNCTION OF THE SKIN
5
layer); and stratum corneum (horny layer). The thickness of epidermis of a given species varies according to body part. In addition, the thickness of epidermis among different species of the same body part varies. In Figure 1.1, skin and mucous membrane samples obtained from human, porcine, canine, rat, and mouse are illustrated for direct comparison. Due to the small numbers of epidermal layers in rat and mouse, the four organized layers are sometimes not easily discerned. Whereas the human epidermis usually contains seven more layers of epithelial cells, the porcine epidermis contains about five layers (Figure 1.1A and B). The epidermis in canine, rat, and mouse skin is relatively thin, containing only two to three layers (Figure 1.1C, D, and E). The epithelia of the mucous membranes, on the contrary, are substantially thicker (Figure 1.1F, G, and H). Among the porcine, canine, rat, and mouse skin, porcine skin is the closest match to that of humans (Figure 1.1). A. Langerhans Cells Langerhans cells are not original epidermal cells, but are bone marrow–derived cells that migrate into the epidermis during embryonic development [30–32]. Localized in suprabasal layers of the epithelia of skin and mucous membrane, Langerhans cells are dendritic cells with important immune functions. Accounting for about 5% of epidermal cells, they are professional antigen-presenting cells that come into contact with foreign antigens passing through the epidermis [30–32]. Upon internalizing the antigen, the Langerhans cells migrate out from the skin to regional lymph nodes with the help of integrin molecules, where they present the processed antigen to T cells by way of their surface MHC class II molecule and co-stimulatory molecules [30–32]. A unique Langerhanscell cytoplasmic structure known as the Birbeck granule (evocative of a tennis racket), is observable under transmission electron microscope (Figure 1.2) [32]. A Langerhans cell–specific protein termed Langerin/CD207, a type II transmembrane protein essential for Birbeck granule formation, has recently been isolated in human [33,34]. Subsequently, the equivalent of Langerin was identified in mouse [35–37], suggesting a similar functional role between the human Langerhans cells and that of small mammals. The human Langerin shares 66% of overall amino-acid sequence identity with its mouse counterpart, with a 75% amino acid homology at the important carbohydrate recognition domain of Langerin [34,35]. Furthermore, using this specific antibody, the Langerhans cells in both human and mouse have been shown to migrate to draining lymph nodes upon inflammatory stimulation, confirming a similar function between human and mouse Langerhans cells [37,38]. Other support for a similar function between human Langerhans cells and that of mouse is in findings that many important functional cell surface markers are present in both species: MHC class II molecules, and co-stimulatory molecules including B7-1 (CD80), B7-2 (CD86), and other cell surface markers such as CD54 (ICAM-1) and E-cadherin [39–47]. It has recently been demonstrated that human epidermal Langerhans cells are differentiated from dermal resident CD14+ cells [43]. B. Melanocytes Melanocytes are not original epidermal cells, but migrate into the epidermis during embryonic development. Originating in the neural crest, melanocytes are important pigment-producing cells in the skin [48]. Primarily located in the basal layer, melanocytes synthesize pigments in the form of melanosomes, which are then transferred by way of their dendrites to the neighboring suprabasal epidermal layer-located keratinocytes. Melanocytes are present in the epithelia of skin and mucous membrane, as well as in the hair follicle bulb [48]. Similarities of structure and function between human melanocytes and that of mouse are supported by a similar resident location of melanocyte in the epidermis for both species, the presence of essential melanin-synthesis enzymes such as tyrosinase in both species, and the occurrence of genetic pigmentary diseases in both species via the same defect [49–58]. For example, a recessive mutation at the pale ear (ep) locus, a homologue of human HPS gene, on mouse chromosome 19, exhibits abnormalities in melanosmes and platelet-
1391_C01.fm Page 6 Tuesday, November 18, 2003 4:50 PM
6
Figure 1.1
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Comparative histology of the skin. Normal skin and mucous membrane samples obtained from human newborn foreskin (A), pig chest (B), dog chest (C), rat chest (D), mouse chest (E), pig lip (F), dog lip (G), and rat lip (H) were stained with hematoxylin and eosin, and were photographed. These samples illustrate the relative thickness of epithelium and relative concentration of hair follicles. Bar = 130 mm (A to E), 260 mm (F to H).
1391_C01.fm Page 7 Tuesday, November 18, 2003 4:50 PM
COMPARATIVE STRUCTURE AND FUNCTION OF THE SKIN
Figure 1.2
7
Ultrastructure of Langerhans cell. Transmission electron micrograph of cytoplasm in a human epidermal Langerhans cell, demonstrating the unique cytoplasmic structure termed “Birbeck granules” (white arrows). Bar = 0.4 mm.
dense granules similar to that occurring in human patients with Hermansky-Pudlak syndrome (HPS), an autosomal recessive disease characterized by albinism, bleeding, and lysosomal storage that results from defects of diverse cytoplasmic organelles [49–51]. Similarly, an ocular albinism type 1 (Oa1) gene-deficient mouse line generated by gene targeting has resulted in ocular fundus hypopigmentation, reduction in the size of uncrossed pathway, misrouting of optic fibers at the chiasm, and presence of giant melanosomes in retinal pigment epithelium, findings observed in human patients with ocular albinism type 1 (OA1), an X-linked disorder characterized by severe impairment of visual acuity, retinal hypopigmentation, and macromelanosomes in retinal pigment epithelium [52,53]. Another example is the oculocutaneous albinism type 2 (OCA 2), an autosomal recessive disorder characterized by hypopigmentation in skin, hair, and iris in human patients as a result of mutation in the p gene. Mutations of the homologous p-locus (pink-eyed dilution gene) in mice, has also resulted in a homologous disorder manifested with hypopigmented eye, fur, and skin [54,55]. Another example of structural and functional similarities between human and mouse melanocytes is a newly recognized form of albinism termed Griscelli syndrome, a rare autosomal recessive disease characterized by partial albinism, along with immunological and/or neurological impairments. Mutations in a peripheral melanosome distribution regulatory gene RAB27A and the mouse homologue (ash, Rab27a) have resulted in Criscelli syndrome in human patients and lightened coat color and defects of pigment granule transport in ashen mutant mice [56–58]. C. Keratinocytes Being the predominant cell type in the epidermis, keratinocytes are intuitively considered to be the most important cell type for maintaining epidermal structure integrity. The keratinocyte stem cells are known to locate at the basal layer of the epidermis, from which they continuously divide in order to provide a sufficient number of cells for the purpose of differentiating into the upper layers of suprabasal keratinocytes, granular keratinocytes, and then simply keratins (at the stratum corneum) [59]. As the most important structural cell of the epidermis, keratinocytes form a coherent structural frame by way of desmosome, an intercellular adhesion network [60]. Currently, well-characterized transmembrane desmosomal components include two members of the cadherin
1391_C01.fm Page 8 Tuesday, November 18, 2003 4:50 PM
8
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
supergene family, each having four isoforms: Dsg1, 2, 3, and 4, and desmocollin (Dsc) 1, 2, 3, and 4 [60–69]. On the molecular structure level, human Dsg1 shares 76% identity of amino acid sequence with mouse Dsg1 [61,62], human Dsg2 shares 75% identity of amino acid sequence with mouse Dsg2 [61,63], whereas human Dsg3 shares 85.6% homology of amino acid sequence with its mouse counterpart [64,65]. The newly isolated human Dsg4 shares 79% amino acid identity with that of murine [66]. The genes encoding human Dsc1, mouse Dsc2, and human Dsc3 have also been isolated [67–69]. At the functional level, anti-Dsg1 and anti-Dsg3 autoantibodies that cause acantholysis and intraepidermal blisters in human patients can induce the same pathological effects in newborn mice [70,71]. Furthermore, genetic mutations in Dsg4 have been identified in human patients with inherited hypotrichosis, manifested with sparse scalp hair and eyebrows and bumpy scalp skin, and in the lanceolate hair mouse, manifested with baldness and thickened and fold skin [66]. In addition, targeted disruption of mouse Dsc1 has resulted in acantholysis and separation of epidermis below stratum granulosum, similar to the pathology occurred in the superficial form IgA pemphigus, where IgA autoantibodies targeted the human Dsc1 [72,73]. However, it should also be pointed out that there are dissimilarities in the skin components between different species. For example, there is only one form of Dsg1 in human, whereas there are three isoforms of Dsg1 (a, b, g) in mouse [66]. Being the major structural component of the epidermis, keratinocytes also synthesize keratins, intermediate 10-nm filaments that form network and provide mechanical strength, cellular structure, and assistance in adhesion molecule attachment [74]. In the basal epidermal level, keratinocytes of the keratinized stratified squamous epithelia synthesize a pair of keratins, namely keratins 5 and 14. However, when they differentiate to the suprabasal layers, keratinocytes no longer synthesize keratins 5 and 14, but rather they primarily synthesize another pair of keratins (1 and 10) [75]. The resemblance between keratins and other intermediate filaments in humans and mouse can be stated based on their functional similarities. Functionally, mutant expression of the keratin 14 gene in transgenic mice has resulted in a clinical phenotype of blisters similar to that of human heritable noninflammatory superficial blistering disease, epidermolysis bullosa simplex, due to genetic mutation of keratin 14 [76–80]. Similarly, targeted disruption of the keratin 5 gene in mice has resulted in a neonatal lethality and severe skin fragility resembling human epidermolysis bullosa simplex due to genetic mutation of keratin 5 [81–84]. Furthermore, mutant expression of the keratin 10 gene in transgenic mice has resulted in a clinical phenotype blisters like that of human heritable noninflammatory superficial blistering disease, epidermolytic hyperkeratosis, due to genetic mutation of keratins 10 [85,86]. Another keratinocyte-originated structurally important protein is plectin, which functions to linked components within the desmosomes and hemidesmosomes of skin and muscle [87]. At the molecular structure level, human plectin shares 93% amino-acid sequence identity with that of murine (rat) [88,89]. Functionally, targeted inactivation of the plectin gene in murine (mice) has resulted in a clinical phenotype of blisters similar to the human heritable noninflammatory superficial blistering disease known as epidermolysis bullosa simplex–muscular dystrophy due to genetic mutation of plectin [90–93]. As mentioned above, the skin is now recognized as an important immune organ [8–12]. Being the major cell type in the epidermis, keratinocytes share a substantial part in these immune functions. Keratinocytes are now known to express many different kinds of immune function-related molecules, such as cytokines, chemokines, co-stimulatory molecules, and MHC class II molecules [94–148]. As of this writing, expressions of many of these immune function molecules have been identified, either constitutively or upon activation, in the following human keratinocytes: complement component 3 [94], factor B [94], interleukin (IL)-1a/IL-1b [97,98], IL-3 [101], IL-6 [103], IL-7 [105], IL-8 [107,108], IL-10 [110], IL-12 [111], IL-15 [112], IL-18 [114], IL-20 [115], IL-1 receptor antagonist (IL-1ra) [99], tumor necrosis factor-alpha (TNF-a) [132–134], interferon-alpha (IFN-a) [135], IFN-b [135], CC chemokine receptor 3 (CCR3) [142,143], RANTES [128], eotaxin [144], monocyte chemoattractant protein-1 (MCP-1) [145], macrophage inflammatory protein-3 (MIP-3) [141], macrophage colony stimulating factor (M-CSF) [136], granulocyte macrophage
1391_C01.fm Page 9 Tuesday, November 18, 2003 4:50 PM
COMPARATIVE STRUCTURE AND FUNCTION OF THE SKIN
9
colony stimulating factor (GM-CSF) [139], intercellular adhesion molecule-1 (ICAM-1) [132,146,147], transforming growth factor-alpha (TGF-a) [130], TGF-b [130], vascular endothelia growth factor (VEGF) [116–119], platelet derived growth factor (PDGF) [123], CD14 [127], CD40 [125], toll-like receptor 4 [127], interferon inducible protein 10 (IP-10) [121,122], and MHC class II molecules [137]. Among these immune function molecules identified in human keratinocytes, mouse keratinocytes are confirmed thus far to share expressions of the following molecules with the human counterpart: IL-1a/IL-1b [95,96], IL-3 [102], IL-6 [104], IL-7 [105,106], IL-10 [109], IL-18 [113], IL-1ra [100], TNF-a [133], RANTES [129], M-CSF [136], GM-CSF [140], ICAM-1 [148], TGF-b [131], VEGF [120], PDGF [124], CD40 [126], and MHC class II molecules [138]. Significant similarities have been shown between human and mouse keratinocytes in structure and function. These similarities in intercellular adhesions, structural integrity, and immune function–related molecules strongly indicate that this major cell type of the epidermis in human and small mammals share very similar, if not identical, structural and functional properties.
III. THE DERMAL–EPIDERMAL JUNCTION (SKIN BASEMENT MEMBRANE ZONE) The skin basement membrane zone situated at the dermal–epidermal junction is an interface between the upper skin layer of the epidermis and the lower skin layer of the dermis [29]. The current understanding of the skin basement membrane zone is that it primarily functions to attach epidermis and dermis to one another, support the growth and organization of epidermis, and serve as a semipermeable barrier [29]. Due to the structural and functional complexity of this skin basement membrane zone, Chapter 2 is devoted to the discussion of details.
IV. THE DERMIS The dermis comprises the bulk of the skin and provides its elasticity, tensile strength, and pliability [29]. The major components of the dermis are collagen and elastic connective tissues, with collagen accounting for about 75% of the skin’s dry weight [29]. In fetal human skin, the predominantly expressed collagen is type III collagen [149]. In adult human skin, however, the predominant collagen in the dermis is type I collagen [29]. In adult human skin, the three interstitial collagens — type I collagen (80% to 90%), type III collagen (8 to 12%), and type V collagen (about 5%) — assemble into interwoven fibrous networks and provide strength and elasticity for the skin [29]. The dermal collagens are synthesized by fibroblasts, mesenchymally derived cells and the predominant cell type in the dermis [29]. The similarities between human and mouse dermal fibroblasts are illustrated by the facts that both human and mouse fibroblasts synthesize the major constituents of dermis, type I and type III collagens [150–152]. In addition, human dermal fibroblasts are capable of synthesis and deposit the two essential skin basement membrane-specific collagens, type IV and type VII collagens [153–156]. A mouse fibroblast-derived tumor cell line (EHS fibrosarcoma) is also known to synthesize the basement membrane type IV collagen [157]. Besides the major cell type of fibroblasts, the dermis also houses other cells, such as mast cells, macrophages, and T cells, with the greatest density around papillary dermis and vasculature [29]. The dermis also contains many important structures for the functions of the skin. Among them is the all-important blood vessel, which provides essential nutrients to the skin, temperature and blood pressure regulation, and wound repair, as well as immunological defense for the body. The microvasculatures of the skin include arterioles/terminal arterioles, precapillary sphincters, arterial and venous capillaries, postcapillary venules, and collecting venules [29]. All cutaneous microvasculatures are covered by a special type of cell called veil cells, which define a domain for the dermal microvasculature although they are not part of vessel wall [29]. Microscopic examination of dermal blood vessels of both human and mouse skin, as identified by immunolabeling of factor
1391_C01.fm Page 10 Tuesday, November 18, 2003 4:50 PM
10
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
B
A
Figure 1.3
Microvascular networks in the skin dermis. Immunofluorescence microscopy of normal human newborn foreskin (A) and mouse ear skin (B) using anti-factor VIII–related antigen (A) and antiCD31 (B) illustrates the presence of microvascular networks in the dermis. Bar = 72 mm (A), 50 mm (B).
VIII-related antigen and CD31 (a blood vessel endothelial antigen), respectively, shows similarities of microvasculature in numbers and shape (Figure 1.3). Endothelial cells lining the lumen of dermal vasculature are well known to participate in cutaneous inflammation by their expressions of adhesion molecules that facilitate the migration of inflammatory leukocytes from peripheral blood to the skin sites. It is now clear that both human and mouse dermal vascular endothelial cells are capable of expressing these inflammation-related adhesion molecules: ICAM-1, VCAM-1, E-selectin, and P-selectin [158–161]. In addition, the dermis also houses nerves and receptors of the skin and the epidermis-derived appendages, including hair follicles, sebaceous glands, eccrine (sweat) glands, and apocrine glands, and lymphatic vessels [29].
V. THE HYPODERMIS The tissue below the dermis is called hypodermis, which is abruptly distinct from the upper layer dermis histologically [29]. The hypodermis is an adipose tissue-predominant region, but is functionally integrated with the upper layer dermis through nerve, microvascular, and lymphatic networks and the continuity of hair follicles into the hypodermis [29]. Mesenchymally derived, the adipocyte is the predominant cell type in the hypodermis. Adipocytes are organized into lobular structures outlined by fibrous connective tissues [29]. The tissues in the hypodermis serve as an energy supplier, insulator, cushion, and protector of the skin, and also provide mobility over the underlying structures [29]. Scleroderma in human patients as well as a spontaneous mouse model of scleroderma (tight-skin mouse) are characterized by the presence of autoantibodies to extracellular matrix, major microfibrillar-component protein fibrillin 1, increased biosynthesis of type I collagen, and clinical improvement by intravenous immunoglobulin treatment. In both cases, hypodermal adipose tissues are infiltrated by mononuclear cells in early lesions, and are replaced by dense fibrous connective tissue in late lesions, resulting in taut skin [162–168].
VI. SUMMARY Comparative analyses of skin structure and function allow us to determine that there are substantial similarities in both structural and functional properties of human skin and that of small
1391_C01.fm Page 11 Tuesday, November 18, 2003 4:50 PM
COMPARATIVE STRUCTURE AND FUNCTION OF THE SKIN
11
mammals. These similarities are particularly well characterized for human skin and mouse skin, in part due to the greater availability of research reagents for studies of mouse skin components. Thus, these similarities allow readers to interpret the observations in animal models of inflammatory skin diseases with greater confidence, knowing that the extrapolations have a strong scientific basis.
ACKNOWLEDGMENT This work is supported by NIH grants R01 AR47667, R03 AR47634, and R21 AR48438 (Lawrence S. Chan).
REFERENCES 1. Kanitakis, J., Anatomy, histology, and immunohistochemistry of normal human skin, Eur. J. Dermatol., 12, 390, 2002. 2. Nemes, Z. and Steinert, P.M., Bricks and mortar of the epidermal barrier, Exp. Mol. Med., 31, 5, 1999. 3. Wertz, P.M., Lipids and barrier function of the skin, Acta Derm. Venereol., 208, 7, 2000. 4. Forslind, B., The skin barrier: analysis of physiologically important elements and trace elements, Acta Derm. Venereol., 208, 46, 2000. 5. Bouwstra, J. et al. New aspects of the skin barrier organization, Skin Pharmacol. Appl. Skin Physiol., 14 (Suppl. 1), 52, 2001. 6. Bouwstra, J. et al., Structure of skin barrier and its modulation by vesicular formulations, Prog. Lipid Res., 42, 1, 2003. 7. Tsuruta, D. et al., The barrier function of skin: how to keep a tight lid on water loss, Trends Cell Biol., 12, 355, 2002. 8. Spellberg, B., The cutaneous citadel. A holistic view of skin and immunity, Life Sci., 67, 477, 2000. 9. Bos, J.D., The skin as an organ of immunity, Clin. Exp. Immunol., 107 (Suppl. 1), 3, 1997. 10. Robert, C. and Kupper, T.S., Inflammatory skin diseases, T cells, and immune surveillance, N. Engl. J. Med., 341, 1817, 1999. 11. Chuong, C.M. et al., What is the “true” function of skin? Exp. Dermatol., 11, 159, 2002. 12. Hayday, A. and Viney, J.L., The ins and outs of body surface immunology, Science, 290, 97, 2000. 13. Beltrani, V.S. and Beltrani, V.P., Contact dermatitis, Ann. Allergy Asthma Immunol., 78, 160, 1997. 14. Bernstein, D.I., Allergic reactions to workplace allergens, JAMA, 278, 1907, 1997. 15. Sussman, G.L., Beezhold, D.H., and Kurup, V.P., Allergens and natural rubber proteins, J. Allergy Clin. Immunol., 110 (Suppl. 2), 33, 2002. 16. Kimbe, I. et al., Allergic contact dermatitis, Int. Immunopharmacol., 2, 201, 2002. 17. Chan, L.S. et al., Eptiope spreading: lessons from autoimmune skin diseases, J. Invest. Dermatol., 110, 103, 1998. 18. Koulu, L. et al., Human autoantibodies against a desmosomal core protein in pemphigus foliaceus, J. Exp. Med., 160, 1509, 1984. 19. Eyre, R.W. and Stanley, J.R., Identification of pemphigus vulgaris antigen extracted from normal human epidermis and comparison with pemphigus foliaceus antigen, J. Clin. Invest., 81, 807, 1988. 20. Anhalt, G.J. et al., Paraneoplastic pemphigus: an autoimmune mucocutaneous disease associated with neoplasia, N. Engl. J. Med., 323, 1729, 1990. 21. Woodley, D.T. et al., Identification of the skin basement membrane autoantigen in epidermolysis bullosa acquisita, N. Engl. J. Med., 310, 107, 1984. 22. Labib, R.S. et al., Molecular heterogeneity of the bullous pemphigoid antigens as detected by immunoblotting, J. Immunol., 136, 1231, 1986. 23. Zone, J.J. et al., Identification of the cutaneous basement membrane zone antigen and isolation of antibody in linear immunoglobulin A bullous dermatosis, J. Clin. Invest., 85, 812, 1990. 24. Domloge-Hultsch, N. et al., Epiligrin, the major human keratinocyte integrin ligand, is a target in both an acquired autoimmune and an inherited subepidermal blistering skin disease, J. Clin. Invest., 90, 1628, 1992.
1391_C01.fm Page 12 Tuesday, November 18, 2003 4:50 PM
12
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
25. Chan, L.S. et al., Identification and partial characterization of a novel 105-kDalton lower lamina lucida autoantigen associated with a novel immune-mediated subepidermal blistering disease, J. Invest. Dermatol., 101, 262, 1993. 26. Mahoney, M.G. et al., Explanations for the clinical and microscopic localization of lesions in pemphigus foliaceus and vulgaris, J. Clin. Invest., 103, 461, 1999. 27. Shirakata, Y. et al., Lack of mucosal involvement in pemphigus foliaceus may be due to low expression of desmoglein 1, J. Invest. Dermatol., 110, 76, 1998. 28. Sirois, D., Leigh, J.E., and Sollecito, T.P., Oral pemphigus vulgaris preceding cutaneous lesions: recognition and diagnosis, J. Am. Dent. Assoc., 131, 1156, 2000. 29. Haake, A.R. and Holbrook, K., The structure and development of skin, in Fitzpatrick’s Dermatology in General Medicine, Freedberg, I.M. et al., Eds., McGraw-Hill, New York, 1999, chap. 7. 30. Katz, S.I. et al., Epidermal Langerhans cells are derived from cells originating in the bone marrow, Nature, 282, 324, 1979. 31. Castellino, F. et al., Antigen presentation by MHC class II molecules: invariant chain function, protein trafficking, and the molecular basis of diverse determinant capture, Hum. Immunol., 54, 159, 1997. 32. Stingl, G. et al., The epidermis: an immunologic microenvironment, in Fitzpatrick’s Dermatology in General Medicine, Freedberg, I.M., et al., Eds., McGraw-Hill, New York, 1999, chap. 28. 33. Valladeau J. et al., The monoclonal antibody DCGM4 recognizes Langerin, a protein specific of Langerhans cells, and is rapidly internalized from the cell surface, Eur. J. Immunol., 29, 2695, 1999. 34. Valladeau, J. et al., Langerin, a novel C-type lectin specific to Langerhans cells, is an enodocytic receptor that induces the formation of Birbeck granules, Immunity, 12, 71, 2000. 35. Valladeau, J. et al., Identification of mouse langerin/CD207 in Langerhans cells and some dendritic cells of lymphoid tissues, J. Immunol., 168, 782, 2002. 36. Takahara, K. et al., Identification and expression of mouse langerin (CD207) in dendritic cells, Int. J. Immunol., 14, 433, 2002. 37. Stoitzner, P. et al., Visualization and characterization of migratory Langerhans cells in murine skin and lymph nodes by antibodies against langerin/CD207, J. Invest. Dermatol., 120, 266, 2003. 38. Geissmann, F. et al., Accumulation of immature Langerhans cells in human lymph nodes draining chronically inflamed skin, J. Exp. Med., 196, 417, 2002. 39. Borkowski, T.A. et al., Expression of E-cadherin by murine dendritic cells: E-cadherin as a dendritic cell differentiation antigen characteristic of epidermal Langerhans cells and related cells, Eur. J. Immunol., 24, 2767, 1994. 40. Blauvelt, A., Katz, S.I., and Udey, M.C., Human Langerhans cells express E-cadherin, J. Invest. Dermatol., 104, 293, 1995. 41. Salgado, C.G. et al., Functional CD40 ligand is expressed on epidermal Langerhans cells, J. Leukoc. Biol., 66, 281, 1999. 42. Salgado, C.G. et al., Differential effects of cytokines and immunosuppressive drugs on CD40, B7-1, and B7-2 expression on purified epidermal Langerhans cells1, J. Invest. Dermatol., 113, 1021, 1999. 43. Adriana, T. et al., Dermal-resident CD14+ cells differentiate into Langerhans cells, Nat. Immunol., 2, 1151, 2001. 44. Teunissen, M.B. et al., Human epidermal Langerhans cells undergo profound morphologic and phenotypical changes during in vitro culture, J. Invest. Dermatol., 94, 166, 1990. 45. Tang, A. and Udey, M.C., Inhibition of epidermal Langerhans cell function by low dose ultraviolet B radiation. Ultraviolet B radiation selectively modulates ICAM-1 (CD54) expression by murine Langerhans cells, J. Immunol., 146, 3347, 1991. 46. Epstein, S.P., Baer, R.L., and Belsito, D.V., Effect of triggering epidermal Fc gamma receptors on the interleukin-2- and interleukin-6-induced upregulation of Ia antigen expression by murine epidermal Langerhans cells: the role of prostaglandins and cAMP, J. Invest. Dermatol., 97, 461, 1991. 47. Chang, C.H., Furue, M., and Tamaki, K., B7-1 expression of Langerhans cells is up-regulated by proinflammatory cytokines, and is down-regulated by interferon-gamma or by interleukin-10, Eur. J. Immunol., 25, 394, 1995. 48. Jimbow, K. et al., Biology of melanocytes, in Fitzpatrick’s Dermatology in General Medicine, Freedberg, I.M., et al., Eds., McGraw-Hill, New York, 1999, chap. 15. 49. Gahl, W.A. et al., Genetic defects and clinical characteristics of patients with a form of oculocutaneous albinism (Hermansky-Pudlak syndrome), N. Engl. J. Med., 338, 1258, 1998.
1391_C01.fm Page 13 Tuesday, November 18, 2003 4:50 PM
COMPARATIVE STRUCTURE AND FUNCTION OF THE SKIN
13
50. Gardner, J.M. et al., The mouse pale ear (ep) mutation is the homologue of human Hermansky-Pudlak syndrome, Proc. Natl. Acad. Sci. U. S. A., 94, 9238, 1997. 51. Oh, J. et al., Positional cloning of a gene for Hermansky-Pudlak syndrome, a disorder of cytoplasmic organelles, Nat. Genet., 14, 242, 1996. 52. Bassi, M.T. et al., Cloning of the gene for ocular albinism type 1 from the distal short arm of the x chromosome, Nat. Genet., 10, 13, 1995. 53. Incerti, B. et al., Oa1 knock-out: new insights on the pathogenesis of ocular albinism type 1, Hum. Mol. Genet., 9, 2781, 2000. 54. Rosemblat, S. et al., Identification of a melanosomal membrane protein encoded by the pink-eyed dilution (type II oculocutaneous albinism) gene, Proc. Natl. Acad. Sci. U. S. A., 91, 12071, 1994. 55. Spritz, R.A. et al., Frequent intragenic deletion of the P gene in Tanzanian patients with type II oculocutaneous albinism (OCA2), Am. J. Hum. Genet., 56, 1320, 1995. 56. Wilson, S.M. et al., A mutation in Rab27a causes the vesicle transport defects observed in ashen mice, Proc. Natl. Acad. Sci. U. S. A., 97, 7933, 2000. 57. Hume, A.N. et al., Rab27a regulates the peripheral distribution of melanosomes in melanocytes, J. Cell Biol., 152, F21, 2001. 58. Anikster, Y. et al., Evidence that Criscelli syndrome with neurological involvement is caused by mutations in RAB27A, not MYO5A, Am. J. Hum. Genet., 71, 407, 2002. 59. Lavker, R.M. and Sun, T.T., Epidermal stem cells, J. Invest. Dermatol., 81, 121s, 1983. 60. Green, K.J. and Jones, J.C., Desmosomes and hemidesmosomes: structure and function of molecular components, F.A.S.E.B. J., 10, 871, 1996. 61. Mahoney, M.G. et al., Interspecies conservation and differential expression of mouse desmoglein gene family, Exp. Dermatol., 11, 115, 2002. 62. Liu, Z. et al., cDNA cloning of a novel human ubiquitin carrier protein. An antigenic domain specifically recognized by endemic pemphigus foliaceus autoantibodies is encoded in a secondary reading frame of this human epidermal transcript, J. Biol. Chem., 267, 15829, 1992. 63. Schafter, S., Koch, P.J., and Franke, W.W., Identification of the ubiquitous human desmoglein, Dsg2, and the expression catalogue of the desmoglein subfamily of desmosomal cadherins, Exp. Cell Res., 211, 391, 1994. 64. Ishikawa, H. et al., Cloning of the mouse desmoglein 3 gene (Dsg3): interspecies conservation within the cadherin superfamily, Exp. Dermatol., 9, 229, 2000. 65. Amagai, M., Klaus-Kovtun, V., and Stanley, J.R., Autoantibodies against a novel epithelial cadherin in pemphigus vulgaris, a disease of cell adhesion, Cell, 67, 869, 1991. 66. Kijuic, A. et al., Desmoglein 4 in hair follicle differentiation and epidermal adhesion: Evidence from inherited hypotrichosis and acquired pemphigus vulgaris, Cell, 113, 246, 2003. 67. King, I.A. et al., Cloning of the cDNA (DSC1) coding for human type 1 desmocollin and its assignment to chromosome 18, Genomics, 18, 185, 1993. 68. Lorimer, J.E. et al., Cloning, sequence analysis and expression pattern of mouse desmocollin 2 (DSC2), a cadherin-like adhesion molecule, Mol. Membr. Biol., 11, 229, 1994. 69. King, I.A. et al. The desmocollins of human foreskin epidermis: identification and chromosomal assignment of a third gene and expression patterns of the three isoforms, J. Invest. Dermatol., 105, 314, 1995. 70. Anhalt, G.J. et al., Induction of pemphigus in neonatal mice by passive transfer of IgG from patients with the disease, N. Engl. J. Med., 306, 1189, 1982. 71. Roscoe, J.T. et al., Brazilian pemphigus foliaceus autoantibodies are pathogenic to BALB/c mice by passive transfer, J. Invest. Dermatol., 85, 538, 1985. 72. Chidgey, M. et al., Mice lacking desmocollin 1 show epidermal fragility accompanied by barrier defects and abnormal differentiation, J. Cell Biol., 155, 821, 2001. 73. Hashimoto, T. et al., Human desmocollin 1 (Dsc1) is an autoantigen for the subcorneal pustular dermatosis type of IgA pemphigus, J. Invest. Dermatol., 109, 127, 1997. 74. Goldman, R.D. et al., The function of intermediate filaments in cell shape and cytoskeletal integrity, J. Cell Biol., 134, 971, 1996. 75. Latkowski, J-A.M. and Freedberg, I.M. Epidermal cell kinetics, epidermal differentiation, and keratinization, in Fitzpatrick’s Dermatology in General Medicine, Freedberg, I.M. et al., Eds., McGrawHill, New York, 1999, chap. 9.
1391_C01.fm Page 14 Tuesday, November 18, 2003 4:50 PM
14
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
76. Vassar, R. et al., Mutant keratin expression in transgenic mice causes marked abnormalities resembling a human genetic skin disease, Cell, 64, 365, 1991. 77. Coulombe, P.A. et al., Point mutation in human keratin 14 genes of epidermolysis bullosa simplex patients: genetic and functional analyses, Cell, 66, 1301, 1991. 78. Bonifas, J.M., Rothman, A.L., and Epstein, E.H., Epidermolysis bullosa simplex: evidence in two families for keratin gene abnormalities, Science, 254, 1202, 1991. 79. Hovanian, A. et al., A missense mutation in the rod domain of keratin 14 associated with recessive epidermolysis bullosa simplex, Nat. Genet., 3, 327, 1993. 80. Rugg, E.L. et al., A functional “knockout” of human keratin 14, Genes Dev., 8, 2563, 1994. 81. Peters, B. et al., Complete cytolysis and neonatal lethality in keratin 5 knockout mice reveal its fundamental role in skin integrity and in epidermolysis bullosa simplex, Mol. Biol. Cell, 12, 1775, 2001. 82. Lane, E.B. et al., A mutation in the conserved helix termination peptide of keratin 5 in hereditary skin blistering, Nature, 356, 244, 1992. 83. Dong, W., Ryynanen, M., and Uitto, J., Identification of a leucine-to-proline mutation in the keratin 5 gene in a family with the generalized Kobner type of epidermolysis bullosa simplex, Hum. Mutation, 2, 94, 1993. 84. Chan, Y.M. et al., Mutations in the non-helical linker segment L1-2 of keratin 5 in patients with Weber-Cockayne epidermolysis bullosa simplex, J. Cell Sci., 107, 765, 1994. 85. Fuchs, E., Esteves, R.A., and Coulombe, P.A., Transgenic mice expressing a mutant keratin 10 gene reveal the likely genetic basis for epidermolytic hyperkeratosis, Proc. Natl. Acad. Sci. U. S. A., 89, 6906, 1992. 86. Chen, J. et al., The genetic basis of epidermolytic hyperkeratosis: a disorder of differentiation-specific epidermal keratin genes, Cell, 70, 811, 1992. 87. Wiche, G., Role of plectin in cytoskeleton organization and dynamics, J. Cell Sci., 111, 2477, 1998. 88. Liu, C.G. et al. Human plectin: organization of the gene, sequence analysis, and chromosome localization (8q24), Proc. Natl. Acad. Sci. U. S. A., 93, 42278, 1996. 89. Wiche, G. et al. Cloning and sequencing of rat plectin indicates a 466-kD polypeptide chain with a three-domain structure based on a central alpha-helical coiled coil, J. Cell Biol., 114, 83, 1991. 90. Andra, K. et al., Targeted inactivation of plectin reveals essential function in maintaining the integrity of skin, muscle and heart cytoarchitecture, Genes Dev., 11, 3143, 1997. 91. Smith, F.J.D. et al., Plectin deficiency results in muscular dystrophy with epidermolysis bullosa, Nat. Genet., 13, 450, 1996. 92. McLean, W.H.I. et al., Loss of plectin causes epidermolysis bullosa with muscular dystrophy: cDNA cloning and genomic organization, Genes Dev., 10, 1724, 1996. 93. Gache, Y. et al., Defective expression of plectin in epidermolysis bullosa simplex with muscular dystrophy, J. Clin. Invest., 87, 2289, 1996. 94. Pasch, M.C. et al., Synthesis of complement component C3 and factor B in human keratinocytes is differentially regulated by cytokines, J. Invest. Dermatol., 114, 78, 2000. 95. Luger, T.A. et al., Murine epidermal cell-derived thymocyte-activating factor resembles murine interleukin-1, J. Immunol., 128, 2147, 1982. 96. Ansel, J.C. et al. The expression and modulation of IL-1 alpha in murine keratinocytes, J. Immunol., 140, 2274, 1988. 97. Kupper, T.S. et al., Human keratinocytes contain mRNA indistinguishable from monocyte interleukin1 alpha and beta mRNA. Keratinocyte epidermal cell-derived thymocyte-activating factor is identical to interleukin-1, J. Exp. Med., 164, 2095, 1986. 98. Bell, T.V. et al., Expression of mRNA homologous to interleukin 1 in human epidermal cells, J. Invest. Dermatol., 88, 375, 1987. 99. Hammerberg, C. et al., Interleukin-1 receptor antagonist in normal and psoriatic epidermis, J. Clin. Invest., 90, 571, 1992. 100. La, E. and Fischer, S.M., Transcriptional regulation of intracellular IL-1 receptor antagonist gene by IL-1 alpha in primary mouse keratinocytes, J. Immunol., 166, 6149, 2001. 101. Danner, M. and Luger, T.A., Human keratinocytes and epidermoid carcinoma cell lines produce a cytokine with interleukin 3-like activity, J. Invest. Dermatol., 88, 353, 1987. 102. Luger, T.A. et al., Keratinocyte-derived interleukin 3, Ann. N. Y. Acad. Sci., 548, 253, 1988.
1391_C01.fm Page 15 Tuesday, November 18, 2003 4:50 PM
COMPARATIVE STRUCTURE AND FUNCTION OF THE SKIN
15
103. Yoshizaki, K. et al., Interleukin 6 and expression of its receptor on epidermal keratinocytes, Cytokine, 2, 381, 1990. 104. Sprecher, E. and Becker, Y., Detection of IL-1 beta, TNF-alpha, and IL-6 gene transcription by the polymerase chain reaction in keratinocytes, Langerhans cells and peritoneal exudate cells during infection with herpes simplex virus-1, Arch. Virol., 126, 253, 1992. 105. Heufler, C. et al., Interleukin 7 is produced by murine and hman keratinocytes, J. Exp. Med., 178, 1109, 1993. 106. Ariizumi, K. et al., IFN-gamma-dependent IL-7 gene regulation in keratinocytes, J. Immunol., 154, 6031, 1995. 107. Barker, J.N. et al., Modulation of keratinocyte-derived interleukin-8 which is chemotactic for neutrophils and T lymphocytes, Am. J. Pathol., 139, 869, 1991. 108. Kristensen, M.S. et al., Quantitative determination of IL-1 alpha-induced IL-8 mRNA levels in cultured human keratinocytes, dermal fibroblasts, endothelial cells, and monocytes, J. Invest. Dermatol., 97, 506, 1991. 109. Enk, A.H. and Katz, S.I. Identification and induction of keratinocyte-derived IL-10, J. Immunol., 149, 92, 1992. 110. Enk, A.H. et al., Induction of IL-10 gene expression in human keratinocytes by UVB exposure in vivo and in vitro, J. Immunol., 154, 4851, 1995. 111. Muller, G. et al., Identification and induction of human keratinocyte-derived IL-12, J. Clin. Invest., 94, 1799, 1994. 112. Blauvelt, A. et al., Interleukin-15 mRNA is expressed by human keratinocytes, Langerhans cells, and blood-derived dendritic cells and is downregulated by ultraviolet B radiation, J. Invest. Dermatol., 106, 1047, 1996. 113. Stoll, S. et al., Production of IL-18 (IFN-gamma-inducing factor) messenger RNA and functional protein by murine keratinocytes, J. Immunol., 159, 298, 1997. 114. Koizumi, H.,et al., Distribution of IL-18 and IL-18 receptor in human skin: various forms of IL-18 are produced in keratinocytes, Arch. Dermatol. Res., 293, 325, 2001. 115. Grone A., Keratinocytes and cytokines, Vet. Immunol. Immunopathol., 88, 1, 2002. 116. Ballaum, C. et al., Human keratinocyte express the three major splice forms of vascular endothelial growth factor, J. Invest. Dermatol., 104, 7, 1995. 117. Frank, S. et al., Nitric oxide triggers enhanced induction of vascular endothelial growth factor expression in cultured keratinocytes (HaCaT) and during cutaneous wound repair, F.A.S.E.B. J., 13, 2002, 1999. 118. Diaz, B.V. et al., Regulation of vascular endothelial growth factor expression in human keratinocytes by retinoids, J. Biol. Chem., 275, 642, 2000. 119. Sen, C.K. et al., Oxidant-induced vascular endothelial growth factor expression in human keratinocytes and cutaneous wound healing, J. Biol. Chem., 277, 33284, 2002. 120. Larcher, F. et al., Up-regulation of vascular endothelial growth factor/vascular permeability factor in mouse skin carcinogenesis correlates with malignant progression state and activated H-ras expression levels, Cancer Res., 56, 5391, 1996. 121. Sarris, A.H. et al., Human interferon-inducible protein 10: expression and purification of recombinant protein demonstrate inhibition of early human hematopoietic progenitors, J. Exp. Med., 178, 1127, 1993. 122. Boorsma DM et al., Chemokine IP-10 expression in cultured human keratinocytes, Arch. Dermatol. Res., 290, 335, 1998. 123. Ansel, J.C. et al., Human keratinocytes are a major source of cutaneous platelet-derived growth factor, J. Clin. Invest., 92, 671, 1993. 124. Beer, H.D., Longaker, M.T., and Werner, S., Reduced expression of PDGF and PDGF receptors during impaired wound healing, J. Invest. Dermatol., 109, 132, 1997. 125. Denfeld, R.W. et al., CD40 is functionally expressed on human keratinocytes, Eur. J. Immunol., 26, 2329, 1996. 126. Coutant, K.D. et al., Early changes in murine epidermal cell phenotype by contact sensitizers, Toxicol. Sci., 48, 74, 1999. 127. Song, P.I. et al., Human keratinocytes express functional CD14 and toll-like receptor 4, J. Invest. Dermatol., 119, 424, 2002.
1391_C01.fm Page 16 Tuesday, November 18, 2003 4:50 PM
16
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
128. Li, J. et al., Epidermal and oral keratinocytes are induced to produce RANTES and IL-8 by cytokine stimulation, J. Invest. Dermatol., 106, 661, 1996. 129. Frank, S. et al., Large induction of the chemotactic cytokine RANTES during cutaneous wound repair: a regulatory role for nitric oxide in keratinocyte-derived RANTES expression, Biochem. J., 347, 265, 2000. 130. Gaido, K.W. et al., 2,3,4,8-Tetrachlorodibenzo-p-dioxin-dependent regulation of transforming growth factors-alpha and -beta2 expression in a human keratinocyte cell line involves both transcriptional and post-transcriptional control, J. Biol. Chem., 267, 24591, 1992. 131. Bascom, C.C. et al., Complex regulation of transforming growth factor beta 1, beta 2, and beta 3 mRNA expression in mouse fibroblasts and keratinocytes by transforming growth factor beta 1 and beta 2, Mol. Cell Biol., 9, 5508, 1989. 132. Pastore, S. et al., Interferon-gamma promotes exaggerated cytokine production in keratinocytes cultured from patients with atopic dermatitis, J. Allergy Clin. Immunol., 101, 538, 1998. 133. Kolde, G. et al., Immunohistological and immunoelectron microscopic identification of TNF alpha in normal human and murine epidermis, Arch. Dermatol. Res., 284, 154, 1992. 134. Matsuura, K., Otsuka, F., and Fujisawa, H., Effects of interferons on tumor necrosis factor alpha production from human keratinocytes, Cytokine, 10, 500, 1998. 135. Fujisawa, H. et al., The expression and modulation of IFN-alpha and IFN-beta in human keratinocytes, J. Interferon Cytokine Res., 17, 721, 1997. 136. Chodakewitz, J.A. et al., Macrophage colony-stimulating factor production by murine and human keratinocytes. Enhancement by bacterial lipopolysaccharide, J. Immunol., 144, 2190, 1990. 137. Basham, T.Y. et al., Recombinant gamma interferon differentially regulates class II antigen expression and biosynthesis on cultured normal human keratinocytes, J. Interferon Res., 5, 23, 1985. 138. Jun, B.D., Krueger, G.G., and Roberts, L.K., Differential expression of Ia by murine keratinocytes and gut epithelium in response to recombinant gamma-interferon, J. Invest. Dermatol., 93, 33, 1989. 139. Kupper, T.S. et al., Interleukin 1 binds to specific receptors on human keratinocytes and induces granulocyte macrophage colony-stimulating factor mRNA and protein. A potential autocrine role for interleukin 1 in epidermis, J. Clin. Invest., 82, 1787, 1988. 140. Chodakewitz, J.A., Kupper, T.S., and Coleman, D.L., Keratinocyte-derived granulocte/macrophage colony-stimulating factor induces DNA synthesis by peritoneal macrophages, J. Immunol., 140, 832, 1988. 141. Tohyama, M. et al., Differentiated keratinocytes are responsible for TNF-alpha regulated production of macrophage inflammatory protein 3alpha/CCL20, a potent chemokine for Langerhans cells, J. Dermatol. Sci., 27, 130, 2001. 142. Wakugawa, M. et al., Expression of CC chemokine receptor 3 on human keratinocytes in vivo and in vitro-upregulation by RANTES, J. Dermatol. Sci., 25, 229, 2001. 143. Petering, H. et al., Characterization of the CC chemokine receptor 3 on human keratinocytes, J. Invest. Dermatol., 116, 549, 2001. 144. Jean-Baptiste, S. et al., Expression of eotaxin, an eosinophil-selective chemokine, paralleles eosinophil accumulation in the vesiculobullous stage of incontinentia pigmenti, Clin. Exp. Immunol., 127, 470, 2002. 145. Li, J., Farthing, P.M., and Thornhill, M.H., Oral and skin keratinocytes are stimulated to secrete monocyte chemoattractant protein-1 by tumor necrosis factor-alpha and interferon gamma, J. Oral Pathol. Med., 29, 438, 2000. 146. Griffiths, C.E., Voorhees, J.J., and Nickoloff, B.J., Gamma interferon induces different keratinocyte cellular patterns of expression of HLA-DR and DQ and intercellular adhesion molecule-1 (ICAM-1) antigens, Br. J. Dermatol., 120, 1, 1989. 147. Albanesi, C., Cavani, A., and Girolomoni, G., IL-17 is produced by nickel-specific T lymphocytes and regulates ICAM-1 expression and chemokine production in human keratinocytes: synergistic or antagonist effects with IFN-gamma and TNF-alpha, J. Immunol., 162, 494, 1999. 148. Carroll JM et al., Transgenic mice expressing IFN-gamma in the epidermis have eczema, hair hypopigmentation, and hair loss, J. Invest. Dermatol., 108, 412, 1997. 149. Sandberg, M. et al., Construction of a human pro alpha 1(III) collagen cDNA clone and localization of type III collagen expression in human fetal tissues, Matrix, 9, 82, 1989.
1391_C01.fm Page 17 Tuesday, November 18, 2003 4:50 PM
COMPARATIVE STRUCTURE AND FUNCTION OF THE SKIN
17
150. Liau, G., Yamada, Y., and de Crombrugghe, B., Coordinate regulation of the levels of type III and type I collagen mRNA in most but not all mouse fibroblasts, J. Biol. Chem., 260, 531, 1985. 151. Lambert, C.A. et al., Coordinated regulation of procollagens I and III and their post-translational enzymes by dissipation of mechanical tension in human dermal fibroblasts, Eur. J. Cell Biol., 80, 479, 2001. 152. Dumas, M. et al., In vitro biosynthesis of type I and type III collagens by human dermal fibroblasts from donors of increasing age, Mech. Ageing Dev., 73, 179, 1994. 153. Olsen, D.R., Chu, M.L., and Uitto, J., Expression of basement membrane zone gene coding for type IV procollagen and laminin by human skin fibroblasts in vitro: elevated alpha 1 (IV) collagen mRNA levels in lipoid proteinosis, J. Invest. Dermatol., 90, 734, 1988. 154. Markinkovich, M.P. et al., Cellular origin of the dermal-epidermal basement membrane, Dev. Dyn., 197, 255, 1993. 155. Woodley, D.T. et al., Epidermolysis bullosa acquisita antigen, a major cutaneous basement membrane component, is synthesized by human dermal fibroblasts and other cutaneous tissues, J. Invest. Dermatol., 87, 227, 1986. 156. Chen, M. et al., Restoration of type VII collagen expression and function in dystrophic epidermolysis bullosa, Nat. Genet., 32, 670, 2002. 157. Schwarz, U. et al., Structure of mouse type IV collagen. Amino-acid sequence of the C-terminal 511residue-long triple-helical segment of the alpha 2(IV) chain and its comparison with the alpha 1(IV) chain, Eur. J. Biochem., 157, 49, 1986. 158. Sigurdsson, V. et al., Expression of VCAM-1, ICAM-1, E-selectin, and P-selectin on endothelium in situ in patients with erythroderma, mycosis fungoides and atopic dermatitis, J. Cutan. Pathol., 27, 436, 2000. 159. Harari, O.A. et al., Endothelial cell E- and P-selectin up-regulation in murine contact sensitivity is prolonged by distinct mechanisms occurring in sequence, J. Immunol., 163, 6860, 1999. 160. Saloga, J. et al., Cutaneous exposure to the superantigen staphylococcal enterotoxin B elicits a T-celldependent inflammatory response, J. Invest. Dermatol., 106, 982, 1996. 161. Zhou, L. et al., Tepoxalin blocks neutrophil migration into cutaneous inflammatory sites by inhibiting Mac-1 and E-selectin expression, Eur. J. Immunol., 26, 120, 1996. 162. Tu, J.H. and Eisen, A.Z., Scleroderma, in Fitzpatrick’s Dermatology in General Medicine, Freedberg, I.M. et al., Eds., McGraw-Hill, New York, 1999, chap. 174. 163. Christner, P.J. et al., The tight skin 2 mouse: an animal model of scleroderma displaying cutaneous fibrosis and mononuclear cell infiltration, Arthritis Rheum., 38, 1791, 1995. 164. Arnett, F.C. et al., Autoantibodies to the extracellular matrix microfibrillar protein, fibrillin 1, in patients with localized scleroderma, Arthritis Rheum., 42, 2656, 1999. 165. Tan, F.K. et al., Autoantibodies to the extracellular matrix microfibrillar protein, fibrillin 1, in patients with scleroderma and other connective tissue diseases, J. Immunol., 163, 1066, 1999. 166. Murai, C. et al., Spontaneous occurrence of anti-fibrillin-1 autoantibodies in tight-skin mice, Autoimmunity, 28, 151, 1998. 167. Blank, M. et al., The role of intravenous immunoglobulin therapy in mediating skin fibrosis in tight skin mice, Arthritis Rheum., 46, 1689, 2002. 168. Levy, Y. et al., Skin score decrease in systemic sclerosis patients treated with intravenous immunoglobulin: a preliminary report, Clin. Rheumatol., 18, 207, 2000.
1391_C01.fm Page 18 Tuesday, November 18, 2003 4:50 PM
1391_C02.fm Page 19 Wednesday, November 19, 2003 10:35 AM
CHAPTER
2
Comparative Structure and Function of the Skin: Epithelial Basement Membrane Zone Lawrence S. Chan
CONTENTS I. Overview of Skin Basement Membrane Zone ....................................................................19 II. Structures of Skin Basement Membrane Zone ...................................................................20 III. Skin Basement Membrane Components .............................................................................20 A. Type VII Collagen .......................................................................................................20 B. Laminins ......................................................................................................................24 C. Integrin Subunits..........................................................................................................24 D. Type XVII Collagen (BP180) .....................................................................................25 E. Other Skin BMZ Components ....................................................................................25 IV. Summary ..............................................................................................................................26 Acknowledgment..............................................................................................................................26 References ........................................................................................................................................26 I. OVERVIEW OF SKIN BASEMENT MEMBRANE ZONE Situated between the epidermis (the upper layer of the skin) and the dermis (the middle layer of the skin), the specific location of the skin basement membrane zone (BMZ) conveys an intuitive view of its functional role as a connecting network that anchors the epidermis to the dermis. This view has been supported by cumulative scientific evidence, both direct and indirect. For example, when one or more of the components of the skin BMZ is defective due to genetic mutation, skin fragility and associated blisters were observed [1–3]. Conversely, restoration of expression of these defected BMZ components by molecular biology techniques results in restoration of skin BMZ structure and function [4–6]. Similarly, when autoantibodies target one or more of the components of the skin BMZ, inflammation and the accompanied blistering diseases are detected [7–12]. In addition, in vitro studies demonstrate that individual components of the skin BMZ have the capacity to form strong binding to one another or to other structures, thus providing evidence to support their roles in forming a connecting network for the purpose of anchoring the epidermis to the dermis [13–19]. In the following sections, the detailed skin BMZ ultrastructures and the individual skin BMZ components that are relevant to the inflammatory skin diseases described in this book will be discussed. 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
19
1391_C02.fm Page 20 Wednesday, November 19, 2003 10:35 AM
20
Figure 2.1
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Transmission electron microscopy of a normal human skin basement membrane zone. The epidermis is located above the basement membrane zone, while the dermis is located below it. Short white arrows point to lamina densa, long white arrows to hemidesmosomes, and black arrowheads to anchoring fibrils. Asterisks indicate the areas of lamina lucida. Bar = 0.1 mm.
II. STRUCTURES OF SKIN BASEMENT MEMBRANE ZONE The structure of skin BMZ is best visualized under transmission electron microscopy (TEM). An ultra-thin section of the skin viewed under TEM delineates a linear electron translucent zone, which has been termed lamina lucida (LL) (asterisks, Figures 2.1 and 2.2). Below the LL on the dermis side lies a gray electron-dense (nontranslucent) linear zone, which has been termed lamina densa (LD) (short white arrows, Figures 2.1 and 2.2). Connecting beneath the LD, strings of gray structures known as anchoring fibrils are observed (black arrowheads, Figures 2.1 and 2.2). On the upper LL, dark gray electron-dense bodies that lie parallel to the skin BMZ are named hemidesmosomes, onto which the tonofilaments of the basal keratinocytes are attached (long white arrows, Figures 2.1 and 2.2). Careful examination within the LL space reveals fine string-like gray structures termed anchoring filaments that span the entire width of LL (Figures 2.1 and 2.2). It is now recognized that type VII collagen is the major component of anchoring fibril [8,19–21], which is also linked to LD. type IV collagen appears to be the major component of LD [22]. The compositions of anchoring filaments within the LL appear to include type XVII collagen and laminin-5 [23–25]. On the ultrastructural level, human skin BMZ (Figure 2.1) seems to be identical to canine (Figure 2.2). A schematic representation of skin BMZ is illustrated in Figure 2.3.
III. SKIN BASEMENT MEMBRANE COMPONENTS A. Type VII Collagen Located in the lamina densa and sub–lamina densa areas of the skin BMZ, type VII collagen is a homotrimer of alpha-1 (COL7A1) chains [20]. Each of the alpha-1 chain monomers is composed of a 145-kDa centrally located collagenous triple-helical domain flanked by a 145-kDa N-terminallocated noncollagenous domain 1 (NC1) and a 34-kDa C-terminal-located noncollagenous domain
1391_C02.fm Page 21 Wednesday, November 19, 2003 10:35 AM
EPITHELIAL BASEMENT MEMBRANE ZONE
Figure 2.2
21
Transmission electron microscopy of a normal canine skin basement membrane zone. The epidermis is located above the basement membrane zone, while the dermis is located below it. Short white arrows point to lamina densa, long white arrows to hemidesmosomes, and black arrowheads to anchoring fibrils. Asterisks indicate the areas of lamina lucida. Bar = 0.12 mm.
Epidermis α6β4 integrin Collagen 17 Hemidesmosome Anchoring Filaments
LL
LD (Collagen 4)
Dermis
Figure 2.3
Laminin-1 Laminin-5 Laminin-6
Anchoring Fibrils (Collagen 7)
Schematic representation of skin BMZ. LL, lamina lucida; LD, lamina densa.
2 (NC2) [19,20]. The gene encoding human type VII collagen was the first to be delineated, followed by the genes encoding mouse homologue and the partial gene encoding canine homologue [26–29]. It is now known that the NC1 domain is the major target region of the autoantibodies in human patients with an inflammatory blistering skin disease termed epidermolysis bullosa acquisita [30]. Homology analyses of the NC1 domain revealed 87% and 83% amino acid identity between humans and canine and between humans and murine, respectively [29]. In certain well-characterized regions of antigenic epitope within the NC1 domain, as defined by autoantibodies of human patients with epidermolysis bullosa acquisita, the amino acid identities between humans and those of canine and murine are greater than 90% [29]. This high degree of amino acid identity in these antigenic epitope regions is correlated with the positive labeling to the skin BMZ of human, pig, dog, rat, and mouse by an antibody raised against a full-length recombinant human type VII collagen NC1 domain (Figure 2.4). Indirect immunofluorescence microscopy illustrating the binding to the skin basement membranes from different species by the same human autoantibodies against type VII collagen
Indirect immunofluorescence microscopy illustrates the binding to the skin basement membranes of various species by an antibody raised against the human type VII collagen NC1 domain. This antihuman type VII collagen antibody positively labels the skin BMZ of human (A), pig (B), dog (C), rat (D), and mouse (E), as well as the BMZ of mucous membrane (lip) in pig (F), dog (G), and rat (H). Bar = 80 mm (A through H).
H
G
F
E
Figure 2.4
D
C
B
22
A
1391_C02.fm Page 22 Wednesday, November 19, 2003 10:35 AM
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Figure 2.5
A C
D
Indirect immunofluorescence microscopy illustrating the binding to the skin basement membranes from different species by the same autoantibodies (A and B) and the binding to the same skin basement membrane by autoantibodies from patients of different species (C and D). The antitype VII collagen IgG autoantibodies from a human patient affected with epidermolysis bullosa acquisita positively label the floor of salt-split skin BMZ of human (A) and dog specimens (B). Similarly, the antitype XVII collagen (BPAG2) IgG autoantibodies from a pig patient (C) and a human patient (D) suffering from bullous pemphigoid label the roof of salt-split human skin samples. Stars indicate the lamina lucida space split by 1.0-M NaCl salt solution. The arrows point to the binding sites of IgG autoantibodies. Bar = 100 mm (A through D).
B
1391_C02.fm Page 23 Wednesday, November 19, 2003 10:35 AM
EPITHELIAL BASEMENT MEMBRANE ZONE 23
1391_C02.fm Page 24 Wednesday, November 19, 2003 10:35 AM
24
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
NC1 domain further supports the amino acid homology between different species (Figure 2.5, A and B). Functionally, scientific data seems to support a similar and essential role of type VII collagen in connecting the epidermis from the underlying dermis in both humans and small animals [31–36]. In human patients suffering from a noninflammatory heritable blistering skin disease termed dystrophic epidermolysis bullosa, mutations at various areas of type VII collagen gene have been identified [31–33]. Similarly, targeted disruption of type VII collagen gene in mice has resulted in an identical skin blistering phenotype [34]. In addition, a sheep patient suffered from a similar blistering disease also exhibited type VII collagen defect [35]. Further support for this functional similarity between human type VII collagen and that of mammals is the report of a canine equivalent of human epidermolysis bullosa acquisita characterized by autoantibodies targeting the NC1 domain of type VII collagen [36]. B. Laminins Located in the lamina lucida region, well-characterized laminin isoforms that are present in the skin BMZ include laminin-1, laminin-5, and laminin-6 [37–40]. Laminin molecules are heterotrimers each is composed of an alpha, a beta, and a gamma chain, linked together by disulfide bonds [37–40]. Different compositions of monomers constitute different isoforms of laminin. Whereas laminin-1 is composed of alpha-1, beta-1, and gamma-1 chains, laminin-5, also known as nicein/kalinin/epiligrin, is composed of alpha-3, beta-3, and gamma-2 chains. Similar to laminin1 and laminin-5, laminin-6 (originally termed k-laminin), is composed of alpha-3, beta-1, and gamma-1 chains [37–40]. The genes encoding laminin-5 chains have been isolated for human and mouse [41–43]. Homology analyses of the alpha-3 chain revealed 77% amino acid homology between human and mouse [42]. Laminin-5 and laminin-6 have been identified as the target antigens of the autoantibodies from a subgroup of human patients suffered from an inflammatory blistering skin disease named mucous membrane pemphigoid, whereas laminin-1 has not been implicated as target antigen in any human skin disease [10,44–48]. Specifically, the antigenic epitopes of these patients’ autoantibodies recognize alpha-3, beta-3, and gamma-2 chains of laminin-5 and laminin6 [10,44–48]. The functional similarity between the human laminin-5 and that of the mammals lies in the findings that genetic mutation of laminin-5 could result in a spontaneously arising noninflammatory blistering skin disease called “junctional epidermolysis bullosa” in both human patients [49–52] and in large and small mammals [53,54]. Moreover, targeted disruption of the laminin 5 gene in mice has resulted in a similar clinical phenotype as in human patients [55]. Additional support for this functional similarity between human laminin-5 and that of mammals comes from findings that the presence of autoantibodies to laminin-5 could lead to similar inflammatory blistering skin disease in both human patients [10,44–48] and small mammal [56]. Furthermore, passive transfer of antibodies to laminin-5 could induce inflammatory blistering skin disease similar to human mucous membrane pemphigoid in newborn mice [57]. C. Integrin Subunits Integrin molecules, the principal receptors for extracellular matrix, are heterodimers consisting of noncovalently linked one alpha and one beta subunits [13]. Located in the upper lamina lucida and basal epithelial cell area, major integrin subunits alpha-6 and beta-4 are essential elements for the assembly of hemidesmosome of the skin BMZ [13]. They are functionally associated with the laminin molecules and with type XVII collagen [16,17,58]. The genes encoding these skin BMZlocated integrin subunits for human, mouse, and rat have been isolated [59–64]. Sequence analyses of beta-4 subunit determined 95.1% and 87.5% identity in amino acids between mouse and rat, and between human and rat, respectively [64]. Similarly, the identity of alpha-6 subunit amino acid sequence between human and mouse was determined to be 93% [63]. In addition to the structural
1391_C02.fm Page 25 Wednesday, November 19, 2003 10:35 AM
EPITHELIAL BASEMENT MEMBRANE ZONE
25
similarity between the human alpha-6 beta-4 integrin subunits and that of small mammals [59–64], there is evidence indicating their functional similarity [65–70]. In human patients suffering from a severe heritable noninflammatory blistering skin disease known as junctional epidermolysis bullosa with pyloric atresia, beta-4 subunit gene mutation has been identified [65–67]. Likewise, the absence of alpha-6 beta-4 subunits in knockout mice results in the phenotype of a severe epidermis detachment from the underlying BMZ, which closely resembles that observed in human patients [68–70]. Furthermore, mucous membrane pemphigoid, a human inflammatory blistering skin disease, has been observed as a result of autoantibodies targeting these BMZ-located integrin subunits, although animal models of this inflammatory blistering skin disease due to anti-integrin autoantibodies have not yet been reported [71–74]. D. Type XVII Collagen (BP180) Located in the upper lamina lucida and basal epidermal cell areas, type XVII collagen is a hemidesmosomal component of the skin BMZ [75–77]. As a transmembranous protein, type XVII collagen is composed of a C-terminal–located intracellular domain, a transmembrane domain, and an N-terminal–located domain composed of many collagenous and 16 noncollagenous domains [75–77]. NC16A, the largest of all the noncollagenous domains, located just outside the basal epidermal cell membrane, is now known to be the major target antigenic site of the autoantibodies from patients with an inflammatory blistering skin disease named bullous pemphigoid [78]. The genes encoding type XVII collagen have been identified in human, mouse, and partially in canine [75–77,79]. Homology analyses of the NC16A domain revealed 58% and 57% amino acid identity between human and canine, and between human and mouse, respectively [79]. Interestingly, the amino acid identity of the transmembrane domain reaches 100% between human and canine and between human and mouse [79]. These high homology data correlate positively with binding to the same skin basement membrane by anti-BP180 IgG autoantibodies from patients of different species (Figure 2.5C and D). Functionally, scientific data seem to support a similar and essential role of type XVII collagen in connecting the epidermis from the underlying dermis in both humans and other mammals [80–88]. In human patients suffering from generalized atrophic benign epidermolysis bullosa, a noninflammatory junctional form of heritable blistering skin disease, mutations at various areas of type XVII collagen gene have been identified [80–82]. The cellular defects of this mutation are reported to be restorable by in vitro gene delivery [4]. In addition, spontaneous inflammatory blistering skin disease like that of human bullous pemphigoid has been observed in horses, pigs, dogs, and cats, showing similar clinical phenotype, histopathological findings, IgG autoantibody binding to the skin BMZ, and IgG autoantibodies targeting type XVII collagen [83–86]. Furthermore, passive transfer experiments using rabbit antibodies against mouse recombinant type XVII collagen reproduce a similar skin blistering disease phenotype as observed in humans [87,88]. E. Other Skin BMZ Components Besides type VII collagen, laminin-5, laminin-6, alpha-6 and beta-4 integrin subunits, and type XVII collagen, there are other well-characterized skin BMZ components, such as type IV collagen, laminin-1, nidogen, and heparan sulfate proteoglycan [1]. Although these components are essential elements for the skin BMZ, they have not been targeted in any inflammatory skin diseases, with the noticeable exception of two patients suffering from inflammatory skin blistering disease, renal insufficiency, and autoantibodies targeting the alpha-5 chain of type IV collagen (COL4A5) in skin BMZ and renal glomerular BMZ [89]. These BMZ components are beyond the scope of this book, and are not discussed here.
1391_C02.fm Page 26 Wednesday, November 19, 2003 10:35 AM
26
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
IV. SUMMARY Cumulative scientific data from comparative studies on the structure and function of skin BMZ supports a close resemblance between human skin and that of other mammals, particularly the small mammals commonly used in the laboratories of biomedical researchers. This close resemblance of skin BMZ structures and functions thus provides investigators who study the animal models of inflammatory skin diseases with a useful tool in interpreting research results concerning the relevance to human diseases.
ACKNOWLEDGMENT This work is supported by NIH grants R01 AR47667, R03 AR47634, and R21 AR48438 (Lawrence S. Chan).
REFERENCES 1. Marinkovich, M.P., The molecular genetics of basement membrane diseases, Arch. Dermatol., 129, 1557, 1993. 2. Christiano, A.M. and Uitto, J., Molecular complexity of the cutaneous basement membrane zone. Revelation from the paradigms of epidermolysis bullosa, Exp. Dermatol., 5, 1, 1996. 3. Korge, B.P. and Krieg, T., The molecular basis for inherited bullous diseases, J. Mol. Med., 74, 59, 1996. 4. Seitz, C.S. et al., BP180 gene delivery in junctional epidermolysis bullosa, Gene. Ther., 6, 42, 1999. 5. Dellambra, E. et al., Gene correction of integrin beta4-dependent pyloric atresia-junctional epidermolysis bullosa keratinocytes establishes a role for beta4 tyrosines 1422 and 1440 in hemidesmosome assembly, J. Biol. Chem., 276, 41336, 2001. 6. Chen, M. et al., Restoration of type VII collagen expression and function in dystrophic epidermolysis bullosa, Nat. Genet., 32, 670, 2002. 7. Labib, R.S. et al., Molecular heterogeneity of the bullous pemphigoid antigens as detected by immunoblotting, J. Immunol., 136, 1231, 1986. 8. Woodley, D.T. et al., Identification of the skin basement membrane autoantigen in epidermolysis bullosa acquisita, N. Engl. J. Med., 310, 107, 1984. 9. Zone, J.J. et al., Identification of the cutaneous basement membrane zone antigen and isolation of antibody in linear immunoglobulin A bullous dermatosis, J. Clin. Invest., 85, 812, 1990. 10. Domloge-Hultsch, N. et al., Epiligrin, the major human keratinocyte integrin ligand, is a target in both an acquired autoimmune and an inherited subepidermal blistering skin disease, J. Clin. Invest., 90, 1628, 1992. 11. Chan, L.S. et al., Identification and partial characterization of a novel 105-kDalton lower lamina lucida autoantigen associated with a novel immune-mediated subepidermal blistering disease, J. Invest. Dermatol., 101, 262, 1993. 12. Chan, L.S. et al., The first international consensus on mucous membrane pemphigoid: definition, diagnostic criteria, pathogenic factors, medical treatment, and prognostic indicators, Arch. Dermatol., 138, 370, 2002. 13. Jones, J.C., Hopkinson, S.B., and Goldfinger, L.E., Structure and assembly of hemidesmosomes, Bioessays, 20, 488, 1998. 14. Maldonado, B.A. and Furcht, L.T., Involvement of integrins with adhesion-promoting, heparin-binding peptides of type IV collagen in culture human corneal epithelial cells. Invest. Ophthalmol. Vis. Sci., 36, 364, 1995. 15. Thie, M. et al., Cell adhesion to the apical pole of epithelium: a function of cell polarity, Eur. J. Cell Biol., 66, 180, 1995. 16. Tozeren, A. et al., Integrin alpha 6 beta 4 mediates dynamic interactions with laminin, J. Cell Sci., 107, 3153, 1994.
1391_C02.fm Page 27 Wednesday, November 19, 2003 10:35 AM
EPITHELIAL BASEMENT MEMBRANE ZONE
27
17. Niessen, C.M. et al., The alpha 6 beta 4 integrin is a receptor for both laminin and kalinin, Exp. Cell Res., 211, 360, 1994. 18. Chen, M. et al., a2b1 integrin mediates dermal fibroblast attachment to type VII collagen via a 158amino-acid segment of the NC1 domain, Exp. Cell Res., 249, 231, 1999. 19. Chen, M. et al., The recombinant expression of full-length type VII collagen and characterization of molecular mechanisms underlying dystrophic epidermolysis bullosa, J. Biol. Chem., 277, 2118, 2002. 20. Burgeson, R.E. et al., The structure of type VII collagen, Ann. N. Y. Acad. Sci., 460, 47, 1985. 21. Chen, M. et al., The carboxyl terminus of type VII collagen mediates antiparallel dimmer formation and constitutes a new antigenic epitope for epidermolysis bullosa acquisita autoantibodies, J. Biol. Chem., 276, 21649, 2001. 22. Kühn, K., Basement membrane (Type IV) collage, Matrix Biol., 14, 439, 1994. 23. Marinkovich, M.P. et al., LAD-1, the linear IgA bullous dermatosis autoantigen, is a novel 120-kDa anchoring filament protein synthesized by epidermal cells, J. Invest. Dermatol., 106, 734, 1996. 24. Schäcke, H. et al., Two forms of collagen XVII in keratinocytes: a full-length transmembrane protein and a soluble ectodomain, J. Biol. Chem., 273, 25937, 1998. 25. Rousselle, P. et al., Kalinin: an epithelium-specific basement membrane adhesion molecule that is a component of anchoring filaments, J. Cell Biol., 114, 567, 1991. 26. Parente, M.G. et al., Human type VII collagen: cDNA cloning and chromosomal mapping of the gene, Proc. Natl. Acad. Sci. U.S.A., 88, 6931, 1991. 27. Christiano, A.M. et al., Cloning of human type VII collagen: complete primary sequence of the alpha 1 (VII) chain and identification of the intragenic polymorphisms. J. Biol. Chem., 269, 20256, 1994. 28. Kivirikko, S. et al., Cloning of mouse type VII collagen reveals evolutionary conservation of functional protein domains and genomic organization, J. Invest. Dermatol., 106, 1300, 1996. 29. Xu, L. et al., Molecular cloning and characterization of a cDNA encoding canine type VII collagen non-collagenous (NC1) domain, the target antigen of autoimmune disease epidermolysis bullosa acquisita (EBA), Biochim. Biophys. Acta, 1408, 25, 1998. 30. Lapiere, J-C. et al., Epitope mapping of type VII collagen. Identification of discrete peptide sequences recognized by sera from patients with acquired epidermolysis bullosa, J. Clin. Invest., 92, 1831, 1993. 31. Christiano, A.M. et al., A missense mutation in type VII collagen in two affected siblings with recessive dystrophic epidermolysis bullosa, Nat. Genet., 4, 62, 1993. 32. Hovnanian, A. et al., Characterization of 18 new mutations in COL7A1 in recessive dystrophic epidermolysis bullosa provides evidence for distinct molecular mechanisms underlying defective anchoring fibril formation, Am. J. Hum. Genet., 61, 599, 1997. 33. Jarvikallio, A., Pulkkinen, L., and Uitto, J., Molecular basis of dystrophic epidermolysis bullosa: mutations in the type VII collagen gene (COL7A1), Hum. Mutation, 10, 338, 1997. 34. Heinonen, S. et al., Targeted inactivation of the type VII collagen gene (Col7a1) in mice results in severe blistering phenotype: a model for recessive dystrophic epidermolysis bullosa, J. Cell Sci., 112, 3641, 1999. 35. Bruckner-Tuderman, L., Guscetti, F., and Ehrensperger, F., Animal model for dermolytic mechanobullous disease: sheep with recessive dystrophic epidermolysis bullosa lack collagen VII, J. Invest. Dermatol., 96, 452, 1991. 36. Olivry, T. et al., Canine epidermolysis bullosa acquisita: circulating autoantibodies target the aminoterminal non-collagenous (NC1) domain of collagen VII in anchoring fibrils, Vet. Dermatol., 9, 19, 1998. 37. Burgeson, R.E. et al., A new nomenclature for the laminins, Matrix Biol., 14, 209, 1994. 38. Timpl, R. and Brown, J.C., The laminins. Matrix Biol., 14, 275, 1994. 39. Aumailley, M. and Krieg, T., Laminins: a family of diverse multifunctional molecules of basement membranes, J. Invest. Dermatol., 106, 209, 1996. 40. Marinkovich, M.P. et al., The dermal-epidermal junction of human skin contains a novel laminin variant, J. Cell Biol., 119, 695, 1992. 41. Ryan, M.C. et al., Cloning of the LamA3 gene encoding the a3 chain of the adhesive ligand epiligrin, J. Biol. Chem., 269, 22779, 1994. 42. Galliano, M.F. et al., Cloning and complete primary structure of the mouse laminin alpha 3 chain. Distinct expression pattern of the laminin alpha 3A and alpha 3B chain isoforms, J. Biol. Chem., 270, 21820, 1995.
1391_C02.fm Page 28 Wednesday, November 19, 2003 10:35 AM
28
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
43. Utani, A. et al., Mouse kalinin B1 (laminin beta 3 chain): cloning and tissue distribution, Lab. Invest., 72, 300, 1995. 44. Chan, L.S. et al., Laminin-6 and laminin-5 are recognized by autoantibodies in a subset of cicatricial pemphigoid, J. Invest. Dermatol., 108, 848, 1997. 45. Kirtschig, G. et al., Anti-basement membrane antibodies in patients with anti-epiligrin cicatricial pemphigoid bind the a subunit of laminin 5, J. Invest. Dermatol., 105, 543, 1995. 46. Lazarova, Z. et al., Anti-epiligrin cicatricial pemphigoid represents an autoimmune response to subunits present in laminin 5 (a3b3g2), Br. J. Dermatol., 139, 791, 1998. 47. Nousari, H.C. et al., Anti-epiligrin cicatricial pemphigoid with antibodies against the g2 subunit of laminin 5, Arch. Dermatol., 135, 173, 1999. 48. Leverkus, M. et al., Anti-epiligrin cicatricial pemphigoid: an underdiagnosed entity within the spectrum of scarring autoimmune subepidermal bullous dermatoses, Arch. Dermatol., 135, 1091, 1999. 49. Baudoin, C. et al., Herlitz junctional epidermolysis bullosa keratinocytes display heterogeneous defects of nicein/kalinin gene expression, J. Clin. Invest., 93, 862, 1994. 50. Pulkkinen, L. et al., Mutations in the gamma 2 chain gene (LAMC2) of kalinin/laminin 5 in the junctional forms of epidermolysis bullosa, Nat. Genet., 6, 293, 1994. 51. Takizawa, Y. et al., Compound heterozygosity for a point mutation and a deletion located at splice acceptor sites in the LAMB3 gene leads to generalized atrophic benign epidermolysis bullosa, J. Invest. Dermatol., 115, 312, 2000. 52. Nakano, A. et al., Laminin 5 mutations in junctional epidermolysis bullosa: molecular basis of Herlitz vs. non-Herlitz phenotypes, Hum. Genet., 110, 41, 2002. 53. Spirito, F. et al., Animal models for skin blistering conditions: absence of laminin 5 causes hereditary junctional mechanobullous disease in the Belgian horse, J. Invest. Dermatol., 119, 684, 2002. 54. Kuster, J.E. et al., IAP insertion in the murine LamB3 gene results in junctional epidermolysis bullosa, Mamm. Genome, 8, 673, 1997. 55. Ryan, M.C. et al., Targeted disruption of the LAMA3 gene in mice reveals abnormalities in survival and late stage differentiation of epithelial cells, J. Cell Biol., 145, 1309, 1999. 56. Olivry, T. et al., Laminin-5 is targeted by autoantibodies in feline mucous membrane (cicatricial pemphigoid), Vet. Immunol. Immunopathol., 88, 123, 2002. 57. Lazarova, Z. et al., Passive transfer of anti-laminin 5 antibodies induces subepidermal blisters in neonatal mice, J. Clin. Invest., 98, 1509, 1996. 58. Schaapveld, R.Q. et al., Hemidesmosome formation is initiated by the beta 4 integrin subunit, requires complex formation of beta4 and HD1/plectin, and involves a direct interaction between beta4 and the bullous pemphigoid antigen 180, J. Cell Biol., 142, 271, 1998. 59. Hogervorst, F. et al., Cloning and sequence analysis of beta-4 cDNA: an integrin subunit that contains a unique 118 kd cytoplasmic domain, EMBO J., 9, 765, 1990. 60. Suzuki, S. and Naitoh, Y., Amino acid sequence of a novel integrin beta 4 subunit and primary expression of the mRNA in epithelial cells, EMBO J., 9, 757, 1990. 61. Hogervorst, F. et al., Molecular cloning of the human alpha 6 integrin subunit. Alternative splicing of alpha 6 mRNA and chromosomal localization of the alpha 6 and beta 4 genes, Eur. J. Biochem., 199, 425, 1991. 62. Kennel, S.J. et al., Sequence of a cDNA encoding the beta4 subunit of murine integrin, Gene, 130, 209, 1993. 63. Hierck, B.P. et al., Variants of the alpha 6 beta 1 laminin receptor in early murine development: distribution, molecular cloning and chromosomal localization of the mouse integrin alpha 6 subunit, Cell Adhes. Commun., 1, 33, 1993. 64. Feltri, M.L. et al., Cloning and sequence of the cDNA encoding the beta 4 integrin subunit in rat peripheral nerve, Gene, 186, 299, 1997. 65. Vidal, F. et al., Integrin b4 mutations associated with junctional epidermolysis bullosa with pyloric atresia, Nat. Genet., 10, 229, 1995. 66. Pulkkinen, L. et al., Genomic organization of the integrin beta 4 gene (ITGB4): a homozygous splicesite mutation in a patient with junctional epidermolysis bullosa associated with pyloric atresia, Lab. Invest., 76, 823, 1997.
1391_C02.fm Page 29 Wednesday, November 19, 2003 10:35 AM
EPITHELIAL BASEMENT MEMBRANE ZONE
29
67. Takizawa, Y. et al., Novel ITGB4 mutations in a patient with junctional epidermolysis bullosa-pyloric atresia syndrome and altered basement membrane zone immunofluorescence for the alpha6beta4 integrin, J. Invest. Dermatol., 108, 943, 1997. 68. van der Neut, R. et al., Epithelial detachment due to absence of hemidesmosomes in integrin beta 4 null mice, Nat. Genet., 13, 366, 1996. 69. Dowling, J., Yu, Q.C., and Fuchs, E., Beta4 integrin is required for hemidesmosome formation, cell adhesion and cell survival, J. Cell Biol., 134, 559, 1996. 70. Georges-Labouesse, E. et al., Absence of integrin alpha 6 leads to epidermolysis bullosa and neonatal death in mice, Nat. Genet., 13, 370, 1996. 71. Tyagi, S. et al., Ocular cicatricial pemphigoid antigen: partial sequence and biochemical characterization, Proc. Natl. Acad. Sci. U. S. A., 93, 14714, 1996. 72. Chan, R.Y. et al., The role of antibody to human beta4 integrin in conjunctival basement membrane separation: possible in vitro model for ocular cicatricial pemphigoid, Invest. Ophthalmol. Vis. Sci., 40, 2283, 1999. 73. Bhol, K.C. et al., The autoantibodies to alpha 6 beta 4 integrin of patients affected by ocular cicatricial pemphigoid recognize predominantly epitopes within the large cytoplasmic domain of human beta 4, J. Immunol., 165, 2824, 2000. 74. Bhol, K.C. et al., Autoantibodies to human alpha 6 integrin in patients with oral pemphigoid, J. Dent. Res., 80, 1711, 2001. 75. Hopkinson, S.B. et al., Cytoplasmic domain of the 180-kD bullous pemphigoid antigen, a hemidesmosomal component: molecular and cell biological characterization, J. Invest. Dermatol., 99, 264, 1992. 76. Giudice, G.J., Emery, D.J., and Diaz, L.A., Cloning and primary structural analysis of the bullous pemphigoid autoantigen, BP-180, J. Invest. Dermatol., 99, 243, 1992. 77. Li, K. et al., Cloning of type XVII collagen. Complementary and genomic DNA sequences of mouse 180-Kilodalton bullous pemphigoid antigen (BPAG2) predict an interrupted collagenous domain, a transmembrane segment, and unusual features in the 5'-end of the gene and 3'-untranslated region of the mRNA, J. Biol. Chem., 268, 8825, 1993. 78. Giudice, G.J. et al., Bullous pemphigoid and herpes gestationis autoantibodies recognize a common non-collagenous site on the BP180 ectodomain, J. Immunol., 151, 5742, 1993. 79. Xu, L. et al., Molecular cloning of canine bullous pemphigoid antigen 2 cDNA and immunomapping of NC16A domain by canine bullous pemphigoid autoantibodies, Biochim. Biophys. Acta, 1500, 97, 2000. 80. McGrath, J.A. et al., Mutations in the 180-kD bullous pemphigoid antigen (BPAG2), a hemidesmosomal transmembrane collagen (COL17A1), in generalized atrophic benign epidermolysis bullosa, Nat. Genet., 11, 83, 1995. 81. Chavanas, S. et al., A homozygous in-frame deletion in the collagenous domain of bullous pemphigoid antigen BP180 (type XVII collagen) causes generalized atrophic benign epidermolysis bullosa, J. Invest. Dermatol., 109, 74, 1997. 82. Pulkkinen, L. et al., Compound heterozygosity for novel splice site mutations in the BPAG2/COL17A1 gene underlies generalized atrophic benign epidermolysis bullosa, J. Invest. Dermatol., 113, 1114, 1999. 83. Iwasaki, T. et al., Canine bullous pemphigoid (BP) — Identification of the 180 kd canine BP antigen by circulating autoantibodies, Vet. Pathol., 32, 387, 1995. 84. Olivry, T. et al., Novel feline autoimmune blistering diseases resembling bullous pemphigoid in humans: IgG autoantibodies target the NC16A ectodomain of type XVII collagen (BP180/BPAG2), Vet. Pathol., 36, 328, 1999. 85. Olivry T. et al., A spontaneously arising porcine model of bullous pemphigoid, Arch. Dermatol. Res., 292, 37, 2000. 86. Olivry, T. et al., Equine bullous pemphigoid IgG autoantibodies target linear epitopes in the NC16A ectodomain of collagen XVII (BP180, BPAG2), Vet. Immunol. Immunopathol., 73, 45, 2000. 87. Liu, Z. et al., A passive transfer model of the organ-specific autoimmune disease, bullous pemphigoid, using antibodies generated against the hemidesmosomal antigen, BP180, J. Clin. Invest., 92, 2480, 1993.
1391_C02.fm Page 30 Wednesday, November 19, 2003 10:35 AM
30
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
88. Liu, Z. et al., The role of complement in experimental bullous pemphigoid, J. Clin. Invest., 95, 1539, 1995. 89. Ghohestanti, R.F. et al., The alpha 5 chain of type IV collagen is the target of IgG autoantibodies in a novel autoimmune disease with subepidermal blisters and renal insufficiency, J. Biol. Chem., 275, 16002, 2000.
1391_C03.fm Page 31 Tuesday, November 18, 2003 4:54 PM
PART II Comparative Immunology
1391_C03.fm Page 32 Tuesday, November 18, 2003 4:54 PM
1391_C03.fm Page 33 Tuesday, November 18, 2003 4:54 PM
CHAPTER
3
Human Immune System Kalyanasundaram Ramaswamy
CONTENTS I. Overview of Immune System ..............................................................................................34 II. Innate Immunity...................................................................................................................35 A. Phagocytes ...................................................................................................................36 1. Mannose and CR3 Receptors in Phagocytosis .....................................................36 2. Scavenger Receptors and Phagocytosis ................................................................36 3. Toll-Like Receptors in Phagocytosis.....................................................................36 4. CD14 Receptors and Phagocytosis .......................................................................37 5. Fc Receptors and Phagocytosis .............................................................................37 B. Neutrophils...................................................................................................................37 C. Natural Killer Cells .....................................................................................................38 D. Eosinophils...................................................................................................................39 E. Mast Cells and Basophils ............................................................................................40 F. Complement.................................................................................................................41 III. Adaptive Immunity ..............................................................................................................44 A. B Lymphocytes ............................................................................................................44 B. B1 Cells .......................................................................................................................44 C. Immunoglobulins .........................................................................................................45 1. IgM.........................................................................................................................46 2. IgD .........................................................................................................................46 3. IgG .........................................................................................................................46 4. IgA .........................................................................................................................47 5. IgE..........................................................................................................................47 6. Immunoglobulin Gene Regulation and Class Switch ...........................................48 D. Major Histocompatibility Complex.............................................................................48 1. Structure of Class I MHC Molecules ...................................................................49 2. Structure of Class II MHC Molecules ..................................................................49 3. Peptide Binding to MHC Molecules.....................................................................49 E. Minor Histocompatibility (H) Antigens ......................................................................50 F. Antigen Processing and Presentation ..........................................................................50 1. Antigen Processing and Presentation on Class I MHC Molecules ......................50
0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
33
1391_C03.fm Page 34 Tuesday, November 18, 2003 4:54 PM
34
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
2. Antigen Processing and Presentation on Class II MHC Molecules.....................51 3. MHC Tetramers .....................................................................................................51 G. Langerhans Cells and Other Dendritic Cells ..............................................................52 H. T Cells..........................................................................................................................53 I. Cytokines .....................................................................................................................53 1. Interferons ..............................................................................................................54 2. Tumor Necrosis Factor ..........................................................................................54 3. Interleukins ............................................................................................................55 a. IL-1 Family of Cytokines................................................................................55 b. IL-2 Family of Cytokines and Common Cytokine Receptor Gamma Chain ..................................................................................................57 c. IL-3 and IL-5 Family of Cytokines ................................................................59 d. IL-6 and gp130 Family of Cytokines..............................................................59 e. IL-8 ..................................................................................................................61 f. IL-10 Family of Cytokines..............................................................................61 g. IL-12 Family of Cytokines..............................................................................62 h. IL-13 ................................................................................................................63 i. IL-14 ................................................................................................................63 j. IL-16 ................................................................................................................64 k. IL-17 Family of Cytokines..............................................................................64 l. IL-28 and IL-29 Family of Cytokines ............................................................64 4. Growth Factors ......................................................................................................65 a. Transforming Growth Factor...........................................................................65 b. Stem Cell Factor ..............................................................................................65 c. Leukemia Inhibitory Factor.............................................................................65 d. Platelet-Derived Growth Factor.......................................................................65 J. Chemokines..................................................................................................................66 IV. Summary ..............................................................................................................................68 References ........................................................................................................................................68
I. OVERVIEW OF IMMUNE SYSTEM The primary role of the immune system is surveillance and destruction of molecules or substances that are foreign to the body. To accomplish these functions the immune system has developed a sophisticated network of cells and soluble molecules that are distributed strategically throughout the body. These effector mechanisms of the immune system are highly capable of destroying a wide variety of cells including microorganisms such as bacteria, viruses, parasites, and fungi that invade the body. A critical aspect of the effector function of the immune system is to avoid harming self, or the body’s own cells. The immune effector cells achieve this function elegantly by discriminating self from non-self. However, occasional failure to discriminate self can lead to tolerance (of harmful non-self), self-destruction, or autoimmune diseases. Based on the type of effector interaction, the cells and molecules within the immune network can be grouped into two major classes: one responds specifically (adaptive immunity) and another that responds nonspecifically (innate immunity) toward the invading organisms or molecules. Both of these arms of immunity consist of several cells and molecules that often have overlapping functions (Figure 3.1). For purposes of simplicity, each is described separately in this chapter.
1391_C03.fm Page 35 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
35
Immune system
Innate Figure 3.1
Adaptive
Schematic representations of the two major arms of the immune system. Effector cells and molecules that function in a nonspecific fashion are grouped under innate immunity and those functions specifically are grouped as adaptive immunity, with significant functional overlaps between them.
II. INNATE IMMUNITY Innate immunity refers to the first line of natural defense offered by the body. A variety of factors contribute to innate immunity, including anatomical barrier, molecules, and cells. Resistance offered by the anatomical barrier includes the body surfaces at the skin, gastrointestinal tract, urogenital tract, mammary gland, and respiratory tract. The skin is the largest organ of the human body. In addition to providing a mechanical barrier, the skin also houses a variety of cells such as keratinocytes, mast cells, tissue macrophages, sebaceous glandular cells, natural killer (NK) cells, and endothelial cells that actively participate in innate immunity [1]. Some of these cells, such as tissue macrophages, can engulf foreign material and destroy or eliminate it from the body by producing proteolytic enzymes and reactive oxygen radicals [2,3]. However, certain antimicrobial peptides (AMPs) and proteins produced by the cells of the innate immune system in the skin have a major role to play in the initial defense against invading gram-positive or gram-negative bacteria, fungi, and certain viruses [4–6]. The AMPs have a cationic charge and can interact with bacterial membranes through hydrophobic amino acids. Some of the AMPs identified in the skin include cathelicidins, defensins, dermcidin, granulysin, adrenomedullin, cystatin, and secretory leukocyte protease inhibitor [7,8]. The cathelicidins and defensins probably play the major role in host defense [9]. Cathelicidins are proteins approximately 37 amino acids long, and are highly expressed by human keratinocytes under certain inflammatory conditions such as psoriasis. Defensins, on the other hand, are cationic peptides 28 to 44 amino acids long. Defensins contain six to eight cysteine residues that form three characteristic intramolecular disulfide bonds [6,10]. Three forms of defensins — a-defensin, bdefensin and q-defensin — have been described to date and each consists of several molecules. There are at least six different a-defensins. Four of these, designated as human neutrophil peptides (HNP1 through 4), are produced by neutrophils, and the other two a-defensins are highly expressed in the Paneth’s cells of the small intestinal crypts and the epithelial cells of the female urogenital tract. These are called human defensins 5 (HD-5) and HD-6. Similarly, at least four human bdefensins (HBD1 through 4) have been described to date. These AMPs participate in innate immunity by directly killing microorganisms or by indirectly activating cells that are involved in innate immunity or adaptive immunity. For example, HBD2 may participate in cutaneous allergic reactions by inducing the release of histamine and prostaglandin D2 from mast cells. Similarly, HBD can bind to the chemokine receptor CCR6 and attract immature dendritic cells and memory T cells to the site. HNP1-3 can increase the expression of tumor necrosis factor (TNF)-a and interleukin (IL)-1 from human macrophages.
1391_C03.fm Page 36 Tuesday, November 18, 2003 4:54 PM
36
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
A. Phagocytes Phagocytes are specialized professional cells that can engulf large particles including microorganisms. These engulfed particles are then destroyed or degraded by powerful enzymes within the cytoplasm of these cells. This specialized function originally described by Metchnikoff a century ago is referred to as phagocytosis [11]. In humans, several cell types including macrophages, monocytes, neutrophils, eosinophils, basophils, mast cells, platelets, and B lymphocytes possess the abilities for phagocytosis. The process of phagocytosis begins when the foreign particle or certain regions of the particle (called ligands) bind to specific receptors on the surface of phagocytes. Medzhitov and Janeway [12] proposed the term “pattern-recognition receptors” (PRRs) for these molecules on the surface of the phagocytes and “pathogen-associated molecular patterns” (PAMPs) for the ligands on the surface of microbes that bind to these receptors. Binding of PAMP to PRR triggers rearrangement of actin in the cytoskeleton leading to pseudopodial formations that engulf and internalize the particle. The PRRs involved in phagocytosis can be classified into two groups based on whether they induce opsonic phagocytosis (type I phagocytosis) or nonopsonic phagocytosis (type II phagocytosis). Receptors that mediate type I phagocytosis bind to the integral surface components of the particles. Some of the PRRs in this category include macrophage mannose receptor (MR); complement receptor 3 (CR3, Mac-1, or integrin CD11b/CD18); scavenger family of receptors (class A through class F); toll-like receptors (TLR 2 and TLR 4); and the GPIanchored receptor, CD14. Type II phagocytosis is mediated by Fc receptors. 1. Mannose and CR3 Receptors in Phagocytosis The mannose receptor (MR) family of proteins consists of four multifunctional multidomain glycoproteins that are type I transmembrane receptors with an N-terminal cysteine-rich domain. MR is involved in both phagocytosis and endocytosis [13,14]. The CR3 is a versatile multipurpose adhesion and recognition receptor. Common ligands for CR3 consist of complement component C3bi (see below) and several molecules of microbial organisms. In addition, CR3 is an integrin that can mediate migration of phagocytes, activate them through a variety of signaling pathways, and induce cytoskeleton rearrangement. Several studies show that CR3 can mediate both type I and type II phagocytosis [15–18]. 2. Scavenger Receptors and Phagocytosis The scavenger receptors (SR) are multidomain transmembrane glycoproteins that can bind with high affinity to a broad range of ligands including lipopolysaccharide (LPS) of bacteria, phosphatidylserine of apoptotic cells, and the cell surface of certain tumors. Therefore, SR are often described as “molecular flypaper” [19]. One of the unique properties of SR is that they can bind to chemically modified low-density lipoproteins and promote their uptake by phagocytes [11]. The SR family of proteins includes the following receptors: class A (type I and II macrophage scavenger receptors, and MARCO); class B (CD36, scavenger receptor class B1); class C (scavenger receptor class C1); class D (CD68/macrosialin); class E (the endothelial lectin-like oxidized LDL receptor 1/LOX-1); and class F (scavenger receptor from endothelial cells/SREC). 3. Toll-Like Receptors in Phagocytosis The Toll-like receptors (TLR) are key molecules involved in the recognition of pathogens by the innate immune system [3,20,21]. TLR consist of a family of proteins first identified on the basis of sequence similarity with the Drosophila protein Toll. Ten members of the TLR family (TLR1 through TLR10) have been identified in the human. TLR have an extracellular domain with leucine-rich repeats, and an intracytoplasmic region with significant sequence similarity to the IL-1
1391_C03.fm Page 37 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
37
and IL-18 receptors. This suggests that binding of ligand to the TLR triggers a common pathway of intracellular signal-transduction cascade. Some of the major ligands of TLR include LPS, bacterial lipoproteins, peptidoglycan, and bacterial DNA [22]. Engagement of TLR by pathogenassociated ligands results in the activation of the phagocytes leading to phagocytosis, production of reactive oxygen and nitrogen intermediates (ROI and RNI), proinflammatory cytokines, and upregulation of co-stimulatory molecules [21,23]. Thus, TLR signaling represents a key component of the innate immune response to microbial infection [22]. 4. CD14 Receptors and Phagocytosis The CD14 is a multiligand PRR that recognizes apoptotic cells and certain surface components of bacteria such as LPS [24,25]. Although CD14 binds to LPS and apoptotic cells, it cannot initiate a transmembrane activation signal because it is a glycosylphosphatidyl-inositol (GPI)-anchored protein [26]. Therefore, CD14 must interact with other receptor proteins such as TLR2 or TLR4 to mediate cell signaling in the phagocytes [27–29]. 5. Fc Receptors and Phagocytosis Fc receptors (FcRs) mediate type II phagocytosis of IgG-coated particles [27]. FcRs that participate in this type of phagocytosis include FcgR1, FcgRIIA, and FcgRIIIA. FcgRIIA is a singlechain protein with an extracellular Fc-binding domain, a transmembranous domain, and a cytoplasmic tail containing two tyrosine activation motifs. The tyrosine activation motif is important for the phagocytic function. When two FcgRIIA are cross-linked by the IgG-coated particles, phosphorylation of the tyrosine motif occurs resulting in the activation of the phagocyte. A member of the src family of tyrosine kinase, this protein is believed to initiate the phosphorylation followed by Syk kinases that causes transcriptional activation and cytoskeletal rearrangement leading to phagocytosis of the IgG-coated particle. FcgRI and FcgRIIIA have extracellular Fc-binding domains similar to FcgRIIA. However, they lack the tyrosine motifs on their cytoplasmic tail. Therefore, these receptors must form dimers with another receptor that has the tyrosine motif for their phagocytic function. Phagocytes can also internalize IgA-coated particles [30]. B. Neutrophils Neutrophils are one of the major phagocytic cells in peripheral circulation besides monocytes and mononuclear phagocytes that act as frontline defenders against invading bacteria [31]. Neutrophils are generated in the bone marrow and are released into the peripheral circulation from where they migrate to the tissues and mucosal surfaces. Neutrophils comprise approximately 70% of total circulating leukocytes, and about 100 billion neutrophils enter and leave the circulation daily in a normal adult. Neutrophils are the initial cells that arrive at sites of inflammation and thus play a central role in innate immunity [32,33]. The exit of neutrophils from the peripheral circulation into the tissue is facilitated by chemokines and expression of adhesion molecules on the surface of endothelial cells. Neutrophils bind to these molecules via the CD11/CD18 complex expressed on their surface. A defect in the expression of the CD11/CD18 complex leads to a condition called “leukocyte adhesion deficiency” (LAD) type I syndrome, where neutrophils fail to adhere to endothelium and are thus unable to enter the tissue. After adhering to the endothelium, the neutrophils emigrate to the tissue via the intercellular tight junctions of the endothelium. This process, called transendothelial migration, is facilitated by several cytokines and chemokines. Once in the tissue, the neutrophils get activated at the site of inflammation and release toxic oxygen radicals and their azurophilic granular content. The release of toxic oxygen radicals, called respiratory bursts, are characterized by increased production of superoxide (O2-) and hydrogen peroxide. In addition, the granules contain several degradative enzymes (such as acid hydrolases,
1391_C03.fm Page 38 Tuesday, November 18, 2003 4:54 PM
38
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
myeloperoxidases), lactoferrin, and a number of cationic proteins including defensins and other antibacterial agents that destroy the invading pathogen or molecule [34]. Neutrophils thus play an important role in innate immunity. C. Natural Killer Cells NK cells are large lymphocytes containing azurophilic granules, and account for nearly 10 to 20% of peripheral blood lymphocytes. NK cells do not express receptors for antigens but carry typical surface markers CD3-, CD56+, and CD16+ [35]. As the name suggests, NK cells are killer cells and are one of the most important effector cells of innate immunity [36]. The targets of NK cells include a variety of cells that carry intracellular pathogens (infected cells) and tumor cells. The effector function of NK cells is spontaneous and requires only a weak stimulation or activation. However, the pathways leading to NK cell activation are poorly characterized. Nevertheless, recognition of the absence of class I human leukocyte antigens (HLA) on the surface of target cells is a critical event in the activation of NK cells. All human nucleated cells carry class I HLA molecules on cell surfaces. A single cell such as a lymphocyte can express several thousands of these molecules. However, certain viral infections or tumor transformations of cells can cause a decrease in the number of class I HLA expressions on the surface of affected cells. NK cells can discriminate and recognize these cells with no or low levels of class I HLA. Certain molecules expressed on the surface of NK cells such as CD94/NKG2 (natural killer group 2) and the killer immunoglobulin (Ig)-like family of receptors (KIR or CD158) can detect the density of class I HLA molecules on normal cells. Transient engagement of these receptors to the class I HLA molecule delivers inhibitory signals to the NK cells, thereby preventing them from killing normal cells. However, the lack of or insufficient amounts of class I molecules on the surface of potentially dangerous cells, such as tumor cells or cells that are infected with viruses, leads to activation of NK cells, which then produce molecules that kill the tumor cells or infected cells. This target recognition is referred to as the “missing-self” hypothesis. In addition to CD94/NKG2 and KIR, NK cells also carry several target recognition receptors such as NK cell-receptor protein (NKRP)1A, killer cell lectin-like receptor (KLR)F1, leukocyte-associated Ig-like receptors (LAIR), lectin-like transcript (LLT)1, activation-induced C-type lectin (AICL), C-type lectin-like receptor (CLEC), and natural cytotoxicity receptors (NKp46, NKp30, and NKp44) that participate in the effector function [37–39]. NK cells are rapidly recruited from the peripheral blood to the site of tissue injury or infection by chemokines (CXCR1, CX3CR1, fractalkine) [40] and are then activated by cytokines such as IL-12, type 1 interferon (IFN), IL-15 [41], IL-18, and IL-2 [36]. Dendritic cells (DC), which can interact with NK cells, are another cell type drawn to the initial site of injury [39]. This interaction involves certain cytokines and chemokines released by activated NK cells, which in turn promotes maturation of immature DC. Mature DC can then elicit cognate adaptive immune responses. However, when the ratio of DC to NK cells in the microenvironment decreases, NK cells gain the upper hand and lyse the DC, which turns off the immune responses [42]. Thus, NK cells play a major role in the control switch of innate immunity. Chronic NK-cell lymphocytosis (CNKL) is an abnormal chronic proliferation of NK cells in humans characterized by neutropenia, anemia, fever, cutaneous vasculitis, and autoimmune disorders. NK cells are activated when the activation receptors (such as CD16) are cross-linked [43]. Upon activation, there is an increase in Ca2+ flux and inositol phosphate turnover leading to granule exocytosis, cytokine secretion, and transcription of effector proteins. The key molecular players in the effector function of NK cells are the pore-forming protein perforin and a family of granulebound serine proteases called granzymes [44,45]. These granules are preformed and are stored within the cytoplasm of NK cells. Thus, NK cells are armed and can kill target cells within minutes (Figure 3.2). Exocytosis of these granules results in the release of perforin, granzymes, and granulysin into the tight intracellular junction formed between the NK cell and target cell. Phosphocholine present on the target cell membrane acts as a specific calcium-dependent receptor for
1391_C03.fm Page 39 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
39
Granzyme
CI-MPR
Target cell Death
Cleave Procaspase 3
Perforin
Figure 3.2
Activated granzyme
Molecular mechanism of NK cell-mediated killing of target cells. Upon activation, NK cells release the pore-forming protein perforin to bind on target cell surface, lyse the membrane and open the pore, allowing the entry of granzyme. The perforin-activated granzyme then cleaves procaspase 3, leading to target cell death.
perforin. Receptor-bound perforin polymerizes and damages the target cell membrane. Certain tumor cells that lack these receptors resist the perforin-mediated membrane damage and are thus resistant to immune killing by NK cells. Similarly, a defect in the perforin gene in humans is associated with familial hemophagocytic lymphohistiocytosis (FHL), a disease characterized by uncontrolled activation of T cells and macrophages and overproduction of inflammatory cytokines. Through studies using synthetic peptides and recombinant perforins, it has been suggested that the N-terminal region of the perforin molecule is an important domain responsible for the lytic activity. To complete NK-cell–mediated killing, the perforin has to combine with granzymes (A and B). As perforin traverses the cell membrane and enters the cell, granzymes also enter the target cell by endocytosis after binding to its cation-independent mannose-6-phosphate receptor (CI-MPR) on the surface of target cells. Binding of perforin to granzyme B in the cytoplasm activates the granzyme, which then cleave procaspase 3 leading to DNA fragmentation and programmed cell death or apoptosis of the target cell. Cathepsin C (DPPI) is a critical molecule required for the activation of granzyme. A deficiency in DPPI leads to Papillion–Lefevre syndome in humans, also known as keratosis palmoplanterus with periodontopathia, a disease characterized by premature loss of teeth and thickening of the skin [46]. D. Eosinophils Eosinophils are granulocytes that exhibit typical bilobar nucleus and carry electron-dense granules in their cytoplasm [47,48]. These granules contain cationic proteins that easily stain with the acid aniline dye, eosin, and hence the name. Eosinophils are generated in the bone marrow from CD34+ hematopoietic stem cells and mature eosinophils leave the bone marrow and enter peripheral circulation. In healthy individuals, only a few eosinophils (less than 4% of total leukocytes) are present in circulation. However, in helminth infection, allergy, and asthma very high numbers of eosinophils (up to 40% of total leukocytes) appear in peripheral circulation and tissues [49]. These allergic conditions and parasitic infections are associated with high levels of the cytokine IL-5 that promotes differentiation, proliferation, and release of eosinophils from the bone marrow. Circulating eosinophils are then recruited to the site of allergy. The mechanism of eosinophil trafficking into the tissue from peripheral circulation is well characterized [47]. The adhesion molecule very late antigen (VLA)-4 expressed on the surface of eosinophils interacts first with
1391_C03.fm Page 40 Tuesday, November 18, 2003 4:54 PM
40
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
certain receptors (called selectins) expressed on the surface of endothelial cells causing rolling motion of the eosinophils. This rolling is arrested by a firm adhesion of VLA-4 to the vascular cell-adhesion molecule (VCAM)-1 on the surface of endothelial cells. Subsequently, a concentration gradient formed by specific CC chemokines such as eotaxins (CCL11, CCL24, and CCL26), and mediators such as leukotriene B4 (LTB4) and platelet-activating factor (PAF) at the site of allergy promotes focused chemotaxis of eosinophils through the blood vessel wall into the tissue. Several cytokines such as IL-4, IL-13, and TNF-a play a central role in this eosinophil chemotaxis by up-regulating VCAM-1 on endothelial cells. Eosinophils migrated into the tissue can then be primed or activated to induce its effector function. Mediators such as IL-3, IL-5, GM-CSF, CC chemokines, and PAF prime eosinophils by promoting their survival in the tissue. Primed or activated eosinophils exhibit lower density than resting eosinophils and are thus called hypodense eosinophils. Cross-linking of receptors (for IgG or IgA) on the surface of the hypodense eosinophils causes the release of eosinophil granular contents, including an array of proinflammatory cytokines into the microenvironment. One of the major components of the eosinophil granules is the major basic protein (MBP) that has a potent toxic function against several helminth parasites and respiratory epithelial cells [50]. A significant increase in the levels of MBP occurs during asthma, which is responsible for the pathological changes during bronchial hyperresponsiveness and bronchoconstriction. Another important constituent of the granular content of eosinophils is the eosinophil-derived neurotoxin (EDT) that is highly toxic to myelinated neurons and has RNAse activity. Eosinophil granules also contain eosinophil cationic proteins (ECPs) that are toxic to bacteria, helminths, and epithelial cells of the body. ECPs also possess RNAse activity such as EDT. These molecules can thus kill singlestranded RNA-pneumoviruses, such as respiratory syncytial viruses. Another constituent of eosinophil granules is eosinophil peroxidase, which is capable of generating hypohalous (such as hypochlorous and hypobromous) acids from hydrogen peroxide and halides. Eosinophil peroxide is toxic to helminths, protozoan parasites, bacteria, tumor cells, and several other cells of the body. Since eosinophil granules also contain histaminase that can degrade histamine, it was proposed that eosinophils are recruited into the tissue to mop up the histamine released by mast cells and basophils. Eosinophils can also produce and release a variety of mediators such as LTC4, IL-1, transforming growth factor (TGF)-b, IL-3, IL-4, IL-5, IL-8, and TNF that can participate in allergic inflammatory reactions [51]. Human eosinophils also contain a 17-kDa hydrophobic protein that forms Charcot–Leydon crystals often found in the sputum, feces, and tissue of patients with allergic asthma and other eosinophil-related diseases. E. Mast Cells and Basophils Mast cells and basophils play an important role in innate and adaptive immune responses by virtue of their ability to secrete a plethora of mediators, including histamine, that are stored in their cytoplasmic granules [52–54]. An important effector role for these two cell types in allergic reactions and parasitic infections is well established; however, their contribution to innate immunity is becoming more apparent as their biology and functions are better understood [55–57]. Both mast cells and basophils originate from CD34+ hematopoietic stem cells in the bone marrow and express the high-affinity receptor for IgE (FceRI) on their surface. Cross-linking of the FceRIs by antigenbound IgEs activates these cells to release their granules, which contain preformed mediators such as histamine, proteoglycans, and neutral proteases. Human mast cells contain approximately 2 to 5 pg of histamine per cell. In addition, activated mast cells and basophils also synthesize de novo certain mediators, such as LT C4, PAF, IL-4, and IL-13. Activated mast cells, but not basophils, produce heparin, prostaglandin D2, serotonin, and a variety of cytokines such as IL-1, IL-3, IL-5, IL-6, IL-8, IL-10, IL-16, RANTES, IFN-g, TGF-b, TNF, and granulocyte-macrophage-colonystimulating factor (GM-CSF), as well as chemokines such as C-C chemokines, macrophage inflammatory protein (MIP)-1a, and monocyte chemoattractant protein (MCP)-1. Mast cell–derived
1391_C03.fm Page 41 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
41
serotonin is associated with contact dermatitis. Similarly, TNF and LT produced by mast cells play a major role in the development of septic peritonitis and graft-versus-host disease (GVHD) reaction [52,58–60]. Mast cells can be triggered to release TNF through a variety of receptors expressed on their surface [61]. The released TNF then activates endothelial cells resulting in neutrophil and macrophage recruitment into the microenvironment. Vasoactive amines released from these activated mast cells cause vasodilatation, increased mucus secretion, and massive flux of chloride secretion resulting in serum exudation and edema. Thus, mast cells may play an essential role in the initiation of an immune response. To perform this unique function, mast cells are placed strategically throughout the mucous membrane and different organs that are highly vascularized. There are two different phenotypes of human mast cells described based on the type of neutral protease they carry and their location. Mast cells found in the mucosa of intestinal tissue and lungs (MCT) carry mostly tryptase, whereas mast cells found in the skin and submucosa of the small intestine (MCTC) carry both tryptase and chymase as well as carboxypeptidase A and cathepsin G. Mast cell precursors generated in the bone marrow are recruited to various tissues where they mature into MCT or MCTC types. On the other hand, basophils mature in the bone marrow and are released into the circulation from where they are recruited into the tissue. Although activation of mast cells and basophils via the IgE-mediated pathway is well characterized, both mast cells and basophils can be activated through an IgE-independent pathway. This activation may occur through a variety of receptors on the surface of these cells including CD48; CD88 (complement component C3a and C5a receptors); TrkA (nerve growth factor receptor); FcgRI (IgG receptor); cytokine receptors (IL-4R, IL-5R, IL-9R, IL-10R, GM-CSFR, IFN-gR); chemokine receptors (CCR3, CCR5, CXCR2, CXC4); and CD8-like molecules on mast cells. Mast cells carry a receptor (Kit) for stem cell factor (SCF). In the presence of SCF mediator, the release from mast cells is enhanced several fold [62]. Receptors on basophils include cytokine receptors (IL-3R, IL-5R, GM-CSFR); chemokines receptors (CCR2, CCR3); complement receptors (CD11b, CD11c, CD35, CD88); prostaglandin receptors (CRTH2); and FcgR1I. Certain molecules secreted by bacteria, viruses, and parasites can activate mast cells and basophils directly through these non-FceRI pathways that lead to release of mediators including histamine and TNF [63–65]. Mast cell activation and release of mediators together initiates a cascade of events resulting in an immediate hypersensitivity reaction as well as a late-phase reaction [66,67]. The immediate hypersensitivity reaction in the skin appears as erythema, edema, and itch; in the upper airways as sneezing, rhinorrhea, and mucus secretion; in the gastrointestinal tract as nausea, vomiting, diarrhea, and cramping. These symptoms coincide with release of histamine, PGD2, and LTC4. This immediate reaction is then followed 6 to 24 hours later by persistent edema and leukocytic infiltration. Additional mediators released by mast cells and inflammatory mediators released by accumulating leukocytes initiate the late-phase reaction, which is believed to be a major contributor of persistent skin inflammation and asthma. Mast cells can also down-regulate an inflammatory reaction in the skin and lungs by releasing IL-1 receptor antagonist, IL-10, and heparin. In addition, both mast cells and basophils can phagocytose bacteria and destroy them. Subjects with a mutation in the Kit gene have increased numbers of mast cells in their body, a pathological condition called mastocytosis. Patients with mastocytosis exhibit a typical skin lesion called “urticaria pigmentosa,” along with elevated serum levels of tryptase, episodes of unexplained flushing, and anaphylaxis [68]. F.
Complement
The term “complement” was coined by Paul Ehrlich in 1899 to describe a group of factors in the serum that can lyse bacteria. After more than a decade of research we now know that the complement system consists of over 30 different proteins, some present as soluble proteins in the plasma and the others as bound in the cell membrane [6,69]. The soluble components in plasma consist of complement proteins numbered from C1 through C9. C3 is present in the highest concentration in plasma. The membrane-bound complement proteins are named based on their
1391_C03.fm Page 42 Tuesday, November 18, 2003 4:54 PM
42
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Alternate Pathway
C5 C3a
C3
C3b
C3b,Bb (C3 convertase)
Classic Pathway By way of activating C3 to become C5 Convertase
C1s C1r
C4 C4a Fc
C4b Immunoglobulin
C4b,C2a (C3 Convertase)
Antigen
C2
C2b C5b
Mannose-binding pathway
MBL (Mannose-binding Lectin)
C6, C7, C8, C9
MAC (Membrane attack complex)
Figure 3.3
Schematic representations of the three major pathways of complement activation: classic, alternate and mannose-binding.
function (e.g., decay accelerating factor), or biochemical structure, such as those belonging to the cluster of differentiation (CD) system or as complement receptor proteins (CR1, CR2, CR3, and CR4). Approximately 90% of the plasma-complement proteins are synthesized in the liver. Other sources of complement include monocytes, macrophages, endothelial cells, lymphocytes, glial cells, astrocytes, renal epithelium, and reproductive organs. Acute-phase mediators (such as IL-1, IL-6, TNF, IL-11) and IFN-g stimulate the synthesis of complement following tissue injury. The released complement proteins are then activated through a systematic cascade of sequential proteolytic cleavage of components (the sequence being C1-C4-C2-C3-C5-C6-C7-C8-C9) [70]. The proteolytic cleavage leaves a smaller and a bigger fragment designated as “a” for smaller and “b” for bigger fragment, respectively, except for C2a, which is a larger fragment. This proteolytic cleavage and subsequent activation sequence are collectively called the “complement activation pathway.” There are three different pathways of complement activation: alternative, mannose-binding lectin, and classical (Figure 3.3). Activation of C3 by cleavage to C3b is an important and common reaction in all three activation cascades. The enzyme that catalyzes C3 fragmentation to C3b is the C3 convertase (also called C3b,Bb). C3b contains an intramolecular thioester bond that is activated upon cleavage and removal of the C3a fragment. The reactive thioester acts as an acceptor site that can form covalent bonds with several targets, including OH, NH2, and H2 molecules. The alternative pathway of complement activation is phylogenetically the oldest C3-activating pathway, and is one of the first lines of defense against invading microorganisms. This pathway is activated instantaneously when the acceptor site of activated C3b fragment comes into contact with a foreign molecule that is not self (activator surface). Factors B, D, and P present in the plasma then associate with the C3b and convert it into C3b,Bb (C3 convertase), which in turn activates fresh C3 resulting in the amplification of complement activation. However, binding of the C3
1391_C03.fm Page 43 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
43
acceptor site to a host cell membrane (self) triggers the factors H and I that disassociate from the C3b,Bb, thus down-regulating the alternative pathway of complement activation. The classical pathway of complement activation consists of C1, C4, C2, and C3 proteins. C1 is a complex 750-kDa protein consisting of two C1r and two C1s molecules noncovalently associated with a C1q molecule [71]. The C1q molecule consists of six identical subunits, each with three homologous chains that form a globular domain at the C-terminal that can bind to the Fc portion of Ig [72]. The C1r and C1s molecules are placed inside the cone shaped region of the C1q molecule [73]. Both C1r and C1s contain a serine protease domain and a contact domain. Antigenbound IgG and IgM are the primary triggers for C1 complex activation, although bacterial LPS, acute-phase mediators, myelin, polyanionic compounds, and some viruses can activate C1 complex. C1q binds to Fc portions of IgG (IgG3> IgG1> IgG2>IgG4, affinity) and IgM that has undergone conformational changes as a result of antigen binding. At least two of the six globular domains have to be occupied by the Ig to trigger the activation of C1. Engagement of C1q to Fc portion of Ig activates C1r, which in turn activates C1s. The activated C1s will then cleave the C4 complement protein into C4a and C4b fragments. The C4b fragment then refolds to expose the thiol ester region, which can form covalent ester and amide bonds with several proteins, carbohydrates, and water. C1 activation to C4b binding occurs in microseconds. Complement protein C2 then form complexes with C4b, allowing cleavage of C2 into C2a and C2b by C1s. The C2b is then released with a kinin-like activity. The C2a bound to C4b, results in an enzymatically active fragment, C4b,C2a, which acts as the C3 convertase for the classical pathway [74,75]. The mannose-binding lectin (MBL) pathway consists of a C-type lectin (MBL) that can bind to mannose and a variety of carbohydrate molecules in a Ca+-dependent fashion [76]. The structure of MBL is very similar to C1q molecule with six globular domains that bind to carbohydrates. Two MBL-associated serine proteases, MASP-1 and MASP-2, are noncovalently associated with MBL in analogy with the C1r and C1s proteins. Active MASP-2 can cleave C4 similar to C1s, leading to the formation of the C3 convertase C4b,C2a as described above. Thus, there are two C3 convertases (C3b,Bb and C4b,C2a) formed as a result of the three different pathways. The C3 convertases then initiate cleavage of the C5 component of the complement resulting in the formation of a small C5a peptide, a powerful chemoattractant for inflammatory cells and a bigger fragment C5b, which is important in the formation of the membrane attack complex (MAC). C5b in turn activates C6, C7, C8, and C9 nonenzymatically. C9 molecules are cylinders that get inserted into the membrane of the target cell. Depending on the availability of C9 molecules in the microenvironment, several C9 can bind to the MAC, thus increasing the strength of the deathblow. Several cells in the body, including erythrocytes, lymphocytes, macrophages, monocytes, dendritic cells, eosinophils, and neutrophils, can express receptors for complement and their active fragments. Binding of the fragments to these receptors can also activate the complement cascade. The major receptors of complement are CR1, CR2, CR3, and CR4. The CR1 serves as a receptor for C3b-bound toxin–antitoxin or antigen–antibody immune complexes. Cells expressing the CR1bound complexes are then phagocytosed by macrophages or if the complex is bound to the CR1 of a phagocyte, it acts as a phagocytic stimulus. Human CR2 can bind fragments of C3, envelop protein (gp350/220) of Epstein–Barr virus, and the low-affinity receptor for IgE (CD23) on B cells. CR3 (also called Mac-1, CD11b/CD18) is expressed on dendritic cells, phagocytes, neutrophils, NK cells, and mast cells. The most important function of CR3 is phagocytosis. Some bacteria and yeast can bind directly to the lectin domain of the receptor without the need for complement. Triggering of CR3 via its lectin domain can cause oxidative burst in neutrophils and phagocytes. Other ligands for CR3 include intercellular adhesion molecule (ICAM)-1, fibrinogen, and clotting factor X. CR4 (also known as p150/95 and CD11c/CD18) has similar function as CR3 on phagocytes. In addition, several cells express receptors for C5a, C3a, C1q, and factor H. Among these, the receptor for C5a (C5aR) is probably the most important because binding of C5a to C5aR triggers severe inflammatory reaction including smooth muscle contraction and vascular permeability. C5a
1391_C03.fm Page 44 Tuesday, November 18, 2003 4:54 PM
44
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
can also trigger mast cell degranulation and cause chemotaxis of neutrophils. Thus, complement plays a central role in linking innate immunity with adaptive immunity [77].
III. ADAPTIVE IMMUNITY Adaptive immunity refers to the specific immune response to a microbe, an antigen or foreign particle through an acquired pathway. The adaptive immune response is expressed by two different mechanisms; one involves the B cells and immunoglobulin, known as humoral immunity, and the other involves T cells and various mediators produced by the T cells, which primarily functions via a cell-mediated mechanism. An important feature of the adaptive immune response is memory. This allows the body to respond to a given antigen in a specific way at a later time (also known as recall responses) when the body re-encounters the antigen. Adaptive immunity is the underlying principle for vaccine development [78]. A. B Lymphocytes B lymphocytes are cells derived from the bone marrow; hence the name. The progenitors of B cells in the bone marrow have a typical set of surface markers of CD19+, CD10+, and CD34+. These cells develop into precursor cells or pre-B cells with a phenotype of CD19+, CD10+, and CD34-. The number of these progenitor and precursor cells decline with age. Nevertheless, B cells are generated throughout the life cycle, mainly from bone marrow [79,80]. Pre-B cells can be found in fetal liver by 8 weeks of gestation. This suggests that the B-cell compartment is formed well before birth. B cells produce immunoglobulins that participate in the humoral arm of adaptive immunity. After generation in bone marrow, B cells exit into peripheral circulation as immature B cells. These immature B cells are highly susceptible to inactivation upon antigen contact [81]. This is probably one of the mechanisms by which immune tolerance to an antigen is developed. About 1 week after entering the periphery, B cells mature and become competent cells that can make antibodies when they encounter antigens. Binding of T-cell–independent antigens triggers signaling through B-cell receptors (BCRs), resulting in B-cell activation that is characterized by an upregulation of class II MHC molecule expression and cell proliferation. BCRs consist of a complex formed by membrane immunoglobulin (mIg) that is associated with at least two transmembranous polypeptide chains called Ig-a and Ig-b [82]. Binding of antigen to the BRC and subsequent crosslinking trigger a cascade of intracellular events, leading to internalization of antigens. The internalized antigens are then degraded into small peptides inside the cytoplasm and are expressed in the class II MHC groove for presenting the antigen to helper T cells in lymphoid organs. Interacting helper T cells express CD40 ligand (CD40L) molecules and secrete cytokines that in turn activate the B cells to proliferate and terminally differentiate into antibody-secreting plasma cells. These plasma cells then migrate from the T-cell areas to follicular areas and initiate formation of germinal centers. Immature B cells that are not recruited into the long-lived follicular region will die within a week. Inside these germinal centers, the B cells activate the somatic hypermutation of their immunoglobulin genes (see below) to create an antibody with high affinity to the antigen. The germinal center is thus the major site where plasma cells that produce high-affinity antibodies are generated. These cells subsequently develop into memory B cells. B. B1 Cells B1 cells are a separate lineage of B cells that are present predominantly in the peritoneal and pleural cavities. B1 cells express high levels of IgM, and low levels of IgD and Mac1, but do not express CD23. A subset of B1 cells expresses low levels of CD5 [83]. Thus, based on the expression of CD5, B1 cells are classified into B1a (that express a low level of CD5) and B1b (that do not
1391_C03.fm Page 45 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
45
express CD5). B1 cells are generated during fetal life and are characterized by restricted IgH gene rearrangements that primarily use only the VH repertoire. Thus, they have limited ability to rearrange their antibody. A unique property of B1 cells is that they have the potential to self-replicate indefinitely. Although the functions of B1 cells are not fully understood, these cells can remarkably produce IgM antibodies against common bacterial proteins within 48 hours of exposure. C. Immunoglobulins Humoral immune responses in humans are essentially mediated by immunoglobulins (Igs), which are specialized globular glycoproteins produced by B cells, more specifically plasma cells. There are five major classes or isotypes of Igs: IgM, IgD, IgG, IgA, and IgE. An Ig generated against a specific antigen is called an antibody. Classic studies by Edelman and Porter in the 1950s and subsequent crystal structure analysis of Igs show that the different classes of Igs share a basic structure. Thus, an Ig molecule consists of two heavy chains and two light chains that are held together by interchain disulfide bonds and hydrophobic interactions (Figure 3.4). The heavy chain of Ig has a molecular mass of approximately 55 kDa, and the light chain has a molecular mass of 25 kDa. One light chain pairs with one heavy chain. Disulfide interaction between the two heavy chains results in the formation of a heterodimeric structure that contains the two light chains and two heavy chains. Studies by Edelman and Porter in the 1950s using IgG molecule showed that papain digestion yields two monovalent antigen-binding fragments called Fab and an easily crystalizable fragment called Fc. Digestion of IgG molecule with the enzyme pepsin yields a divalent antigen-binding fragment F(ab)'2. Subsequent treatment of the F(ab)'2 with mercaptoethenol yielded the monmeric form. These findings were subsequently confirmed by the crystal structure analysis of IgG, suggesting the significance of the interchain disulfide bonds in holding the heterodimer together. The amino terminal of light and heavy chains express two to five unique domains called Ig domains consisting of approximately 110 amino acids. These Ig domains are the antigen-binding sites of an Ig, and are thus the fundamental units of an antibody. The Ig domains of all Ig classes of proteins exhibit a common structural motif called the Ig fold, which is formed by two b-pleated sheets oriented in a sandwich-like structure enclosing a hydrophobic core. The amino acid sequences within each of these Ig domains show considerable variation between diverse Ig molecules and between light and heavy chains. This region is therefore collectively called as the variable (V) region of the Ig, and is responsible for antigenic specificity and for diversity of the antibodies. For a given Ig, more than 100 genes code the V regions, thus amplifying the permutation combination
VH VL C1 Hinge region
C2 C3 Figure 3.4
Structure of a typical immunoglobulin (Ig) molecule consists of two heavy chains (H) and two light chains (L) held together by interchain disulfide bonds and hydrophobic interactions. The variable regions of heavy chain (VH) and light chain (VL) are responsible for antigen specificity and antibody diversity; whereas the constant regions (C) show little sequence variation. Hinge region is a flexible part of Ig.
1391_C03.fm Page 46 Tuesday, November 18, 2003 4:54 PM
46
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
of the antigen-binding sites. Variable regions of light chain are designated as VL and the variable regions of heavy chain are designated as VH. The carboxyl termini of light and heavy chains show very little sequence variation within a given class of Ig. Therefore, this region is referred to as the constant (C) region. The light chain has one constant region (CL), whereas the heavy chain has more than one constant region designated as CH1, CH2, CH3, and so on, with CH1 being close to the V region. The C region of an Ig is responsible for binding of the Ig to its receptor (Fc), serves as a binding site (fixation) for complement, confers ability to form Ig multimers, and allows certain classes of Igs to be secreted into the mucosal site. Between the CH1 and CH2 regions is a hinge region that permits considerable flexibility to the V regions. The CH3 domain of the heavy chain shows significant variation that gives the unique characteristics to each class of Ig. Thus, there are five different CH3 domains: mu (m), delta (d), gamma (g), alpha (a), and epsilon (e), which are associated with the IgM, IgD, IgG, IgA, or IgE isotype, respectively. There are two classes of light chain constant regions, Ck and Cl, whose functions are poorly understood at the present time. 1. IgM Developmentally, the heavy chain of IgM (m chain) is the first Ig isotype to be synthesized by B cells, and IgM antibodies are the first to be produced during a primary immune response [84]. Approximately 10% of circulating Igs are of IgM isotype, which have a short half-life of 5 days. IgM exists in two forms: membrane bound monomeric and secreted pentameric. The membrane bound form of IgM is expressed on the surface of immature B cells and serves as an important molecule for B-cell activation upon antigen binding [85]. IgM has four constant regions in its heavy chains, and binding to its Fc receptor occurs through the CH4 (Cm4) region. The secreted pentameric form of IgM consists of five monomeric IgM molecules held together by a J chain. The J chain can interact with a molecule called secretory component (SC), which is expressed on the basal surface of epithelial cells [86]. Pentameric IgM bound to the SC are then transported across the epithelial cells into the mucosal surface, including breast milk. Because of multiple antigen-binding sites, the pentameric IgM has higher avidity for antigens than the monomeric form. Similarly, the pentameric secretory IgM can efficiently bind complement fragments of the classical pathway. Thus, pentameric IgM are the first line of defense against invading organisms at the mucosal surfaces. Memory B cells are poor sources of secretory IgM; therefore, an elevation in the levels of IgM is an indication of recent antigen activation. 2. IgD Less than 0.5% of IgD is present in the circulation in any given time. In part, this may be because of its short half-life and susceptibility to proteolytic degradation. Interestingly, the C region genes of both m and d are transcribed together in B cells. Thus, the mature B cells that migrate out of bone marrow are IgD+/IgM+ and constitute nearly 90% of circulating B cells [87]. Although a specific immunological function is not ascribed to IgD, activation of the cells through the membrane bound IgD can up-regulate certain molecules such as B7-1 and B7-2 on the surface of B cells and thus promote antigen presentation. Activation through IgD can also increase the secretion of IgE from B cells. Another important function of IgD is that it can fix complement, and thus participate in innate immunity [88]. 3. IgG Nearly 75% of serum Igs are of the IgG isotype, and are distributed equally between intravascular and extravascular serum pools [89]. IgG is also present in the lymph, peritoneal, and cerebrospinal fluid. IgG has a molecular mass of approximately 150 kDa and exists in four different
1391_C03.fm Page 47 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
47
forms or subclasses: IgG1, IgG2, IgG3, and IgG4. An important functional characteristic of IgG (especially IgG1, IgG3, and IgG4) is its ability to cross the placenta with the ability of conferring protection to the fetus and newborn. The half-life of circulating IgG is about 7 to 24 days depending on the subclass of IgG. IgG3 has an extended hinge region that makes it more amenable to proteolytic degradation resulting in a shorter half-life (7 days) compared to the other subclasses. Increases in the levels of high-affinity antigen-specific IgG occur during a secondary immune response [90]. These antigen-coupled IgGs can then bind to FcgR expressed on a variety of cells such as B cells, macrophages, granulocytes, and cytotoxic lymphocytes, resulting in cell activation, cytokine production, expression of receptors, phagocytosis, and antibody-dependent cell-mediated cytotoxicity (ADCC). Among the various subclasses, IgG1 has the highest efficiency in inducing ADCC than the other Igs (IgG3, IgG2, or IgG4) [91]. This difference is reflected in their differential binding to FcgR, which is attributable to a sequence difference in their Cg2 region [92]. Another important function of IgG is its ability to activate complement via the classical pathway. Again, the ability of each subclass to activate complement varies, with IgG3 having the highest capacity, followed by IgG1 and IgG2. These differences appear to be due to a structural variation at the hinge and Cg2 regions. IgG4 has a compact structure and appears to activate complement via the alternate pathway better than the classical pathway. Another interesting fact is that because of its compact nature, IgG4 antibodies are functionally monovalent and are believed to possess the ability of scavenging allergenic antigens. Binding of these IgG4 antibodies to mast cells and basophil surfaces are believed to down-regulate IgE-mediated hypersensitivity reactions. Thus, IgG4 antibodies can serve as blocking antibodies [93–95]. 4. IgA IgA is the major immunoglobulin present in mucosal surfaces, and is especially abundant in the saliva, tears, intestinal mucus secretion, bronchial secretion, nasal mucosa, colostrum, prostatic fluid, and vaginal secretions [96]. In the circulatory system, IgA constitutes approximately 15% of total serum immunoglobulins. IgA exists as a monomeric or polymeric form. Over 90% of IgAs present in circulation are in monomeric form, whereas IgAs present in the mucous surface are primarily polymeric [97,98]. These polymeric secretory IgAs are formed from two monomeric IgA molecules linked together by a J chain that is attached to an SC. Polymorphic IgA is secreted into the mucosal surface, similar to IgM. The molecular mass of a monomeric IgA is 160 kDa, whereas the molecular mass of a polymeric IgA is 400 kDa. The two subclasses of IgAs present in humans are IgA1 and IgA2. The two subclasses differ in their amino acid sequences in the hinge and Ca regions. IgA1 is susceptible to proteolytic degradation, whereas IgA2 lacks the 13 amino acid proteolytic-sensitive domains in its hinge region, and is resistant to this degradation. This unique feature makes IgA2 more resistant to enzymatic cleavage by a variety of bacteria (Clostridium sp. Haemophysalis influenzae, Neisseria gonorrhoeae, Streptococcus pneumoniae, Streptococcus sanguis, Neisseria meningitides, and so on). IgA2 is present in two allotypic forms: IgA2m(1) and IgA2m(2). One of the major functions of IgA appears to block uptake of bacterial and viral antigens by inflammatory cells, thereby limiting the inflammatory responses [99–101]. However, by binding to certain bacteria and parasites, IgA can trigger the ADCC mechanism via FcaR in some effector lymphocytes. In general, IgA is a poor activator of complement via the classical pathway. However, IgA can activate complement via the alternate pathway [102,103]. 5. IgE IgE is present in very small amounts in the circulation of healthy individuals and comprises less than 0.004% of total serum immunoglobulins. IgE has a major function in allergic reactions and parasitic infections [104–106]. Helminth infections can trigger production of large quantities of polyclonal IgE antibodies. Cross-linking of two IgE molecules bound to its high-affinity receptor
1391_C03.fm Page 48 Tuesday, November 18, 2003 4:54 PM
48
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
(FceRI) on mast cells or basophils can trigger the release of a variety of vasoactive mediators by these cells leading to allergy and hypersensitivity reaction. However, binding of monomeric IgE to FceRI on mast cells can render these cells resistant to apoptosis [107]. IgE lacks the J segment, yet in some parasitic infections IgE is present as a secretory antibody in the bronchial and intestinal mucous secretions [108,109]. In addition to mast cells and basophils, the high-affinity receptor for IgE (FceRI) is also present on skin Langerhans cells (LCs). A low-affinity receptor for IgE (CD23, or FceRII) is present on a variety of cells including B cells, monocytes, and macrophages. CD23 has been shown to be involved in the regulation of IgE synthesis in B cells [110]. 6. Immunoglobulin Gene Regulation and Class Switch The regulation and rearrangement of Ig gene are highly complex events. In immature B cells, the various regions of the Ig genes are not assembled. As the B cells mature in the follicle, a unique somatic hypermutation event occurs within the B cells that can rearrange various units of the Ig genes to produce an antibody with high specificity to the antigen [111]. Such a rearrangement can create antibodies with more than 108 different types of specificities. As mentioned above there are two families of Ig light chains (k and l) and one family of heavy chain (H), each consisting of its own set of V genes and C genes. Each family resides in different chromosomes. The process of assembling various chains within the activated B cells is called the recombination event leading to rearrangement of various chains by allelic exclusion [112]. First, recombination occurs on the V(D)J segment of the heavy chain, which then pairs with the VL CL units of k or l light chain to generate antibody diversity. Finally, the type of CH gene recombination will define the isotype of antibody. A single B cell can produce only one isotype of antibody at any given time. However, depending on the environmental stimuli and differentiation, B cells can switch from one isotype to another antibody isotype. This process is called class switching or isotype switching [113–116]. Class switching occurs only in the CH gene. Thus, during class switching a single VH gene may combine with more than one CH gene, which allows generation of antibodies with different isotype but same specificity. Initially, B cells generate Cm. During class switching, the Cm region is deleted allowing combination with other CH genes such as Cg,Ce, and Ca. D. Major Histocompatibility Complex Major histocompatibility complex (MHC) is a collection of closely linked genes located in the human chromosome 6. MHC proteins encoded by these genes are vital for the induction and regulation of specific immune responses. On chromosome 6, these MHC genes are organized into three major regions that are broadly designated as class I, class II, and class III (Figure 3.5). The class III region is located between class I and class II regions, and contains genes that code for some of the complement proteins, soluble serum proteins, and TNF [117]. Within the class I and class II MHC regions are the loci for the human leukocyte antigens (HLA). Class I region encodes
Genes
Class II
Locus
DP DQ DR
Gene products Figure 3.5
αβ
αβ
αβ
Class III
Class I
C4 C2 BF
B C
A
B
A
Complement
TNF
Organization of human MHC genes on chromosome 6.
C
1391_C03.fm Page 49 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
49
for the a or heavy chain of three major subclasses of HLA (HLA-A, HLA-B, and HLA-C). In addition, the class I region also contains several nonclassical MHC class 1b genes such as HLAG and MHC class I chain–related (MIC) genes that are believed to be important in immune evasion [118,119]. Class I region also contains several pseudogenes that are essentially nonfunctional. On the other hand, class II genes code for both a and b chains of three HLA subclasses (HLA-DP, HLA-DQ, and HLA-DR). The class II genes are further subdivided into A or B depending on whether they code for a or b chains. Thus, there are four DP genes (A1, B1, A2, B2), five DQ genes (A1, B1, A2, B2, B3), and several DR genes (A, B1 to B9), depending on the haplotype. 1. Structure of Class I MHC Molecules Class I MHC molecule is expressed on all human nucleated cells although their number may vary from cell to cell. Lymphocytes express the highest number (> 5 ¥ 105 molecules per cell) of class I MHC molecules, whereas liver cells and neuronal cells express the least number. A typical structure of a human class I MHC molecule consists of a polymorphic transmembranous glycoprotein heavy chain (~44 kDa) bound noncovalently to a nonpolymorphic 12-kDa light-chain protein called b2 microglobulin or b2m. The a chain of the class I molecule has three external domains (a1, a2, and a3), each with approximately 90 amino acids, a transmembranous domain that is 40 amino acids long, and a cytoplasmic tail of 30 amino acids. There is significant sequence homology among the a3 domain, b2m, and the C region domain of Ig. Therefore, the class I molecule belongs to the Ig superfamily of proteins. The a1 and a2 domains of class I MHC interact with each other to form a cleft or groove that holds a short peptide of eight to ten residues. These peptides are usually derived from endogenous proteins, infectious agents, or tumors. The sides of the groove are formed by two a-helical regions, and the base of the groove where peptide attaches is formed by a b sheet with eight antiparallel b strands. The a3 domain is highly conserved among all three classes of MHC class I molecules and contains the binding site for the CD8 membrane receptor on T cells. 2. Structure of Class II MHC Molecules Class II MHC molecules are typically expressed by antigen-presenting cells, including dendritic cells, macrophages, thymic epithelial cells, and mature B cells. The human class II MHC molecule is a heterodimeric glycoprotein comprised of a a chain (33 kDa) and a b chain (28 kDa) that are noncovalently associated with each other [120]. Both a and b chains have an external domain, a transmembranous domain, and a cytoplasmic tail similar to the class I molecule. The external domain of the a and b chain has significant sequence homology to the Ig-fold domain. Thus, the class II MHC molecule also belongs to the Ig superfamily of proteins. The external domain of each chain is comprised of two distinct regions: a1 and a2 domains and b1 and b2 domains. The a1 and b1 domains interact with each other to form a groove that is similar to the class I groove but is much shallower with one end relatively open. This allows binding of slightly bigger (13 to 25 residues) peptides to the class II MHC molecule. The external domain of the class II MHC molecule contains the binding site for the CD4 membrane receptor on T cells. 3. Peptide Binding to MHC Molecules Both class I and class II MHC molecules are promiscuous as far as peptide binding is concerned. A single MHC molecule can bind several different types of peptides; similarly, a single peptide can bind to several different MHC molecules. This unique function is due to significant structural similarity between the class I and class II peptide–binding grooves. Nearly all the peptides that bind to the class I MHC molecule share similar amino acid residues (also called anchor residues) at their amino and carboxyl termini with which they bind to the class I MHC molecule. Since the
1391_C03.fm Page 50 Tuesday, November 18, 2003 4:54 PM
50
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
peptide-binding sites on the class I MHC molecule clusters to the two ends of the groove, the peptide that binds to the class I molecule arches away from the groove exposing the middle region of the peptide for T-cell presentation. On the other hand, the class II MHC groove has several peptide-binding sites and uses hydrophobic interaction to bind peptides. Because of the diversity in the MHC molecule, a normal individual can express up to six different class I molecules and 12 different class II molecules. Peptides binding to the grooves of these few numbers of class I or class II molecules are responsible for almost all T-cell activation in the body and subsequent initiation of cell-mediated and humoral immune responses against a variety of antigens. E. Minor Histocompatibility (H) Antigens Minor histocompatibility antigens or minor H antigens play a major role in graft rejection [121,122]. Minor H antigens are short MHC-bound peptides derived from an allelic variation (usually a single amino acid change) of endogenous self-peptides. Genes of minor H antigen have been traced to the mitochondrial genome, the Y chromosome, and the autosome [123]. The first minor H peptide to be sequenced was HA-2, which was found to be associated with HLA-A2.1 and graft-versus-host disease (GVHD) [124]. HA-2 sequence was found to be homologous to myosin heavy-chain proteins. The existence of minor H antigens was first described in inbred mice by Snell [125], who demonstrated the ability of inbred mice to reject skin grafts and tumor cells from H2 (MHC) matched donors. Subsequently, the presence of minor H antigens in humans was established when skin grafts or stem cells from HLA-identical siblings was rejected [126]. It is now well established that mismatched H antigens can cause GVHD, graft-versus-leukemia (GVL) effect and host-versusgraft (HVG) reaction in humans [127,128]. An increased frequency of skin allograft rejection may be due to a higher level of H antigens being presented to T cells by LCs in the skin. Both CD4 and CD8 T cells can respond to peptides presented by H antigens. In some cases, recognition of minor H peptides by CD8+ T cells can lead to tolerance. An important feature of T-cell responses to H antigen is the requirement of prior exposure of T cells to the antigenic peptide, unlike those that naïve T cells can respond to when presented by MHC. Thus, prior exposure to minor H antigen creates a memory pool of T cells that are involved in subsequent graft rejection or tolerance. Substantial clinical data are accumulating on the role of minor H antigen on the rejection of various allografts including cornea grafts [122]. This exciting field is fast evolving, especially with respect to transplantation immunology. F.
Antigen Processing and Presentation
T-cell activation of antigen requires that small peptides derived from the antigen be displayed within the groove of a MHC molecule expressed on the surface of antigen-presenting cells (APCs). The sequence of events involved in the formation of the peptide–MHC complex is called antigen processing [129]. The antigen processing occurs within the cytoplasm of APCs via a cytosolic pathway for class I molecules and via an endocytic pathway for class II molecules. The processed peptide–MHC complex is then transported to the exterior and presented on the surface of the APC. This process is designated as antigen presentation [130]. 1. Antigen Processing and Presentation on Class I MHC Molecules Cytosolic pathway of antigen presentation on class I MHC molecule occurs when intracellular soluble proteins or endogenous antigens are degraded, and the peptides of such degraded proteins are expressed on the class I MHC molecule [131–133]. Examples of endogenous antigens include proteins released by viruses, bacteria, or intracellular protozoans invading an infected cell. In some cases, the endogenous antigens can be normal cellular proteins. The mechanism of antigen
1391_C03.fm Page 51 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
51
processing begins when a small group of proteins within the cytoplasm called ubiquitin binds to the intracellular antigen. Several ubiquitin molecules can bind to a single protein. This process is called ubiquitylation or multiubiquitin tagging of a protein. When an antigen or protein is ubiquitinated, it becomes a target for degradation by a specialized ATP-dependent, multisubunit complex of proteases called the proteasome. Proteasomes are a large group of proteolytic enzymes enclosed inside a cylindrical enzymatic chamber with a central channel of 10 to 20 Å. Proteasomes are found in several compartments of a cell and are responsible for degrading proteins that are no longer necessary for the cells, including damaged proteins or proteins that are folded incorrectly. The multiubiquitin tagged proteins to be degraded are selectively guided into the enzymatic chamber by a 19S ATPases-containing subunit of proteasome, and the proteins are degraded inside the chamber. Thus, other proteins within the cell are prevented from proteolysis. Peptides generated by a typical proteasomes are not always antigenic. However, the cytokine interferon-g induces transcription of specialized subunits of proteasome, which creates an immunoproteasome that can now generate antigenic peptides. These antigenic peptides are then transported into the rough endoplasmic reticulum (ER) by a transporter protein called TAP (transporters associated with antigen processing) that has a high affinity for peptides with 8 to 13 amino acid residues. TAP is a membrane-spanning heterodimer consisting of proteins TAP1 and TAP2. The life of a class I MHC molecule begins with the co-translational translocation of a and b2-microglobulin across the ER. Several chaperone proteins such as calnexin, calreticulin, tapasin, and the ERp57 are involved in this assembly initially. Tapasin binds the class I molecule to the ER and mediates physical association of TAP to the class I molecule. The TAP then loads the peptide onto the class I MHC groove. Tapasin releases the peptide-loaded class I molecule into the ER lumen, initiating the transportation process [134]. Several viral proteins are known to block the release of class I MHC molecule from ER by modulating the tapasin functions. The mature peptide containing class I MHC molecule is then transported to the surface of the cell where it presents the antigenic peptide to CD8+ T cells. 2. Antigen Processing and Presentation on Class II MHC Molecules Endocytic pathway or exogenous antigen presentation occurs when a foreign antigen is internalized by APCs through endocytosis (receptor mediated or pinocytosis) or phagocytosis. The internalized antigen is then degraded into short peptides (of 13 to 25 residues) within the endosomes or phagocytic vesicle by several hydrolytic enzymes functioning at three different pH ranges (6.0 to 6.5, 5.0 to 6.0, and 4.5 to 5.0). These antigenic peptides are now ready for loading on to new class II MHC molecules. Similar to the class I molecule, the assembly of class II molecules also occurs in the ER. During the assembly of class II molecules, they associate with another protein called invariant chain (Ii), which stabilizes the class II molecule and prevents the binding of any peptide to the class II groove. In addition, the Ii chain also directs the movement of class II molecules from ER to golgi apparatus and from there to the endosomes, where the antigenic peptide fragments are made. Once inside the endosome, the hydrolytic enzymes will cleave the Ii chain, leaving a small region of the invariant chain called CLIP (class II–associated invariant chain peptide) bound to the class II groove. CLIP remains associated to the class II molecule until it is actively removed by HLA-DM, a class II MHC-like molecule present only within the endosomal vesicles. Once the CLIP is removed, peptide can bind to the class II groove, and the class II MHC molecule is then transported to the surface where antigen is presented to CD4+ T cells. 3. MHC Tetramers The development of class I and class II tetramers has provided invaluable insight into the identification and characterization of MHC-restricted CD8 and CD4 cells in the immune responses against complex antigens [135]. Class I tetramers are generated by expressing the respective a and
1391_C03.fm Page 52 Tuesday, November 18, 2003 4:54 PM
52
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
b2-microglobulin (for class I) and a and b chains (for class II) in Escherichia coli. The recombinant proteins are then refolded in the presence of an antigenic peptide of interest [136]. The MHC–peptide complex is then biotinylated (a process that adds biotin molecule to the protein using the enzyme Bir A) and aggregated into tetramers by the addition of phycoerythrin-labeled streptavidin that binds to the biotin molecule. Tetramers generated in this fashion are stable for at least 1 year. These tetramers can be then used to estimate the precursor frequency of antigen-specific T cells in the peripheral blood, to map the T-cell epitopes of complex antigens, and study T-cell response against a wide variety of antigens including infectious agents, tumors, or autoimmune diseases [137,138]. Application of this MHC tetramer technology to vaccine development will bring this powerful tool to the forefront of human immunology in the next decade. G. Langerhans Cells and Other Dendritic Cells Langerhans cells (LCs) are bone marrow–derived dendritic cells that reside in the skin epidermal layer and play a central role in both innate and adaptive immunity [139,140]. LC was originally discovered by Paul Langerhans; hence the name. LCs are potent APCs that express high levels of class II MHC molecules and CD1a molecules; thus, LCs play an important role in the skin immune system [141–143]. Activated LCs can express other surface markers, such as CD4, CD40, CD14, CD15, CD23, CD33, FcgR, complement receptors, ICAM-1, B7-1, B7-2, E-cadherin, E-selectin, and very late antigen (VLA) molecules. LCs also express the high-affinity FceRI, and may thus participate in IgE-mediated allergic diseases. LCs carry a unique organelle in their cytoplasm called Birbeck granules that can be identified under the electron microscope. The function of these granules is not fully understood. LCs have the ability to process antigens in the periphery and transport it to the draining lymph nodes where they are able to cluster with and activate antigen specific naïve T cells. Thus, the ability of LCs to migrate from the epidermis to regional lymph nodes is of pivotal importance to the induction of primary immune responses [144–146]. In the skin, LCs are normally found in an inactive state. However, upon interaction with a foreign antigen or stimuli, they get activated and differentiate to express various molecules on their cell surface typical of an APC [147]. These activated cells then disassociate themselves from the epidermis and migrate to the regional lymph nodes to initiate the immune response [148]. During migration, LCs undergo further phenotypic and functional changes, which enable them to perform their immune function [149,150]. The journey that the LC has to make from the skin has a number of requirements. Several cytokines, chemokines, and their interaction with appropriate receptors orchestrate this mobilization. Initially, it is necessary that the LCs disassociate from surrounding keratinocytes. This requires downregulation of E-cadherins. This response is mediated by TNF binding to TNF-R2 on the surface of LCs. There is also a second requirement involving IL-1b produced by LC binding to IL-1R1 in an autocrine fashion. For this reason, both TNF and IL-1b are essential for the migratory function of LCs and they in turn up-regulate other molecules such as ICAM-1 and CD44 (including exonsplice isoforms of CD44) on the surface of LCs. Absence of any one of these molecules may interfere with LC migration. Once dislodged from keratinocytes, migrating LCs must successfully traverse the basement membrane of the dermal–epidermal junction. This is facilitated by expression of very late antigen 6 (VLA-6, a6 integrin) that confers laminin-binding activity. Passage across the basement membrane will also require proteolysis. TNF induces matrix metalloprotienase-9 (MMP-9) and MMP-3 expression on the surface of LC that help in this function. CD40–CD40 ligand interaction is also critical for the migration of antigen-bearing LCs from the skin to the draining lymph nodes. Once in the dermis, the LCs make their way via afferent lymphatics into the draining lymph nodes. This migration is facilitated by expression of CCR7 chemokine receptors. Chemokines such as MIP-3a, MCP-1, MRP-1, and secondary lymphoid organ chemokine (SLC) can enhance migration of LCs. The only known cytokine that can block LC migration from the skin is IL-10. There are other less well-characterized dendritic cells including dendritic epidermal
1391_C03.fm Page 53 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
53
T cells, dermal dendrocytes, and dermal Langerhans-like cells in the skin [151,152]. Although there is no evidence that dendritic epidermal T cells can present antigen or migrate to lymph nodes, they do influence the intensity of cutaneous immune responses to chemical haptens. Thus, LCs are probably the most important immune cells in the skin that can activate naïve T cells and initiate a primary immune response. Because of this unique property, LCs are a major target for vaccine and immune modulation [153–156]. H. T Cells T lymphocytes undergo development, differentiation, and maturation in the thymus; hence the name. Similar to B cells, T cells are also generated in the bone marrow from where they migrate to the thymus for phenotypic development and maturation [157]. Like B cells, T cells also possess a membrane-bound antigen receptor, which is structurally different from Ig, but share some common features with the Ig molecule. Called T-cell receptor (TCR) [158], the receptor can only recognize antigens presented by membrane-bound MHC displayed by several APCs. The APCs phagocytose antigens, degrade them in their cytoplasmic compartment, and express fragments of these antigens on the MHC groove. When naïve T cells recognize the presence of these antigenic peptides within the MHC molecules, the T cells get activated, which results in proliferation and differentiation of T cells leading to the formation of memory cells for that particular antigen. These T cells can then differentiate into various effector cells. Thus, the fundamental difference between humoral and cellmediated response is that the B cells can bind to soluble antigens using the Ig on their surface, whereas T cells require that the antigen be processed and presented to them by the APCs [159]. Based on the expression of the TCR molecules, there are at least two well-defined groups of T cells: ab T cells (these include CD4+ and CD8+ cells) and gd T cells. The ab T cells are responsible for most of the cell-mediated immune responses. Based on the cytokine they produce, the ab T cells can be further divided into T helper cells Th1 and Th2. Th1 cells secrete proinflammatory cytokines such as interferon-g and TNF, whereas Th2 cells secrete cytokines such as IL-4, IL-5, IL-6, IL-9, and IL-10 that provide help for the synthesis of antibodies [160,161]. During an immune response, cytokines generated by these two subsets of Th cells orchestrate the outcome of the immune reaction. I.
Cytokines
Cytokines are short-acting, low-molecular-weight protein messengers that orchestrate an immune response, and are analogous to hormones in the endocrine system. Cytokines are produced and released by a variety of cells that participate in immune defense. For its function, a cytokine has to bind to a specific receptor on the surface of target cells. In this way, cytokines can have an autocrine (on the same cell that produced it) or paracrine action (on other cells in the microenvironment), thus regulating the immune and inflammatory responses associated with innate and adaptive immunity. Pleiotropism, redundancy, and synergy are typical characteristics of cytokines. A single cell can produce several different types of cytokines depending on the stimuli, and can express receptors for more than one cytokine simultaneously, often with opposing actions. Thus, a single cell can be regulated differently by different cytokines. Similarly, some cytokines have functions on various cells bringing about diverse biological effects. In the skin, keratinocytes are a major source of cytokines, although other cells such as LCs, lymphocytes, fibroblasts, and endothelial cells can also release a wide array of cytokines and chemokines that participate in the cutaneous inflammatory and immune responses [162]. A typical inflammatory/immune response is characterized by participation of several cytokines with redundant and synergistic functions. The balance between the functions of these various cytokines largely dictates the outcome of an inflammatory/immune response. Broadly, the cytokines that participate in the inflammatory/immune reactions can be grouped into four major groups: interferons, tumor necrosis factors, interleukins, and growth factors.
1391_C03.fm Page 54 Tuesday, November 18, 2003 4:54 PM
54
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
1. Interferons Interferons (IFNs) are glycoproteins with potent antitumor and antiviral properties, and are produced by a variety of cells. Type I IFNs include IFN-a, IFN-b, IFN-W, IFN-k, and IFN-tau. Type II IFNs consists of IFN-g only [163]. Among these, IFN-a, IFN-b, and IFN-g play a major role in host defense and immune homeostasis. In general, IFNs are immunoregulators that can alter cell growth, differentiation, gene transcription, and translation. Binding IFNs to their receptors triggers transmembrane signaling and transcription of certain proteins, collectively known as IFNinduced proteins (IPs). More than 25 IPs have been identified to date. IPs mediate most of IFN functions [164,165]. Generally, IFNs are growth inhibitors for a variety of cells including tumor cells. IFN-a is produced by B cells, T cells, macrophages, NK cells, and large granular lymphocytes in response to viruses such as Newcastle disease virus and Sendai virus, and bacteriophages, bacterial products, polynucleotides, tumor cells, and allogeneic cells [166–168]. Glucocorticoid hormones and viral RNA can up-regulate synthesis of IFN-a. The binding of IFN-a to its receptor on fibroblasts, tumor cells, B cells, monocytes, or hematopoietic progenitor cells causes selective growth inhibition and stimulation of class I MHC molecules. In response to IFN-a, tumor cells express increased amounts of tumor antigen on the surface for targeted cytotoxicity, B cells stop antibody production, and the bone resorption function of osteoclasts is inhibited. Because of its antitumor effect, IFN-a has been approved for therapy against hairy cell leukemia and Kaposi’s sarcoma. IFN-a is also effective against Mycobacterium leprae and Plasmodium falciparum. Interestingly, levels of IFN-a are increased in certain autoimmune diseases such as lupus erythematosus, rheumatoid arthritis, and acquired immune deficiency syndrome (AIDS). IFN-b is secreted by fibroblasts and some epithelial cells. Infections with viruses or doublestranded RNA up-regulate synthesis of IFN-b. The IFN-b binds to the same receptor as IFN-a and has essentially the same function as IFN-a. IFN-b has potent antiviral activity against both RNA and DNA viruses and against the protozoan parasite Toxoplasma gondii. IFN-b also inhibits growth of tumor cells, up-regulates class I MHC molecules and increases NK cell and cytotoxic cell activity similar to IFN-a. IFN-b therapy is indicated in a variety of tumor conditions (bladder carcinoma, bronchiogenic carcinoma, renal carcinoma, malignant glioma, hairy cell leukemia, T-cell leukemia, lymphomas); for viral infections (hepatitis B and C, herpes zoster, herpes simplex, cytomegalovirus, HIV); and multiple sclerosis. IFN-g is mainly produced by Th1-type lymphocytes and NK cells, although several other cells can also secrete IFN-g. The secretion of IFN-g is induced by antigens, endotoxin, and other cytokines such as IL-2. IFN-g receptors are present in almost all nucleated cells. Binding of IFN-g to its receptor induces inhibition of cell growth in a variety of cells including tumor cells. IFN-g upregulates class I and class II MHC molecules, and enhances NK and cytotoxic cell activity. In addition, IFN-g also has potent antiviral function similar to other IFNs. Clinical application of IFN-g includes chronic granulomatous diseases, as an antiviral agent, against tumors and in autoimmune diseases. 2. Tumor Necrosis Factor Tumor necrosis factor (TNF) is a 26-kDa transmembrane protein belonging to a large TNF ligand family of proteins that are characterized by a unique b structure formed by two b-pleated sheets and two anti-parallel b strands [169–171]. The human TNF gene is located within the class III MHC region on chromosome 6. The TNF ligand family of cytokines has potent proinflammatory and antitumor activity. They exert their biological effects by binding to a family of receptors, collectively called the TNF-R [172]. Two such receptors — TNF-R1 and TNF-R2 — can bind TNF that is either membrane-bound or free in a soluble form [173]. TNF-R1 is constitutively expressed in nearly all tissues, whereas TNF-R2 is highly regulated and found only on cells of the immune
1391_C03.fm Page 55 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
55
system [174,175]. Cross-linking and activation of TNF-R occur when three molecules of TNF bind to the receptors to form a homotrimer. TNF is mainly produced by macrophages, although a variety of cells such as neutrophils, mast cells, fibroblasts, NK cells, astrocytes, endothelial cells, and smooth muscle cells can also produce TNF. Although TNF has potent antitumor properties, it is best known for its ability to induce a variety of inflammatory cytokines and acute phase proteins, resulting in fever, release of prostaglandin E2, synthesis of collagen, resorption of bone and cartilages, inhibition of lipoprotein lipases, production of complement fragments, tissue necrosis, neurodegeneration, cachexia, and septic shock. Another important function of TNF is its ability to induce programmed cell death (apoptosis) through its TNF-R1. The molecular mechanism of TNF-induced apoptosis is now well characterized. Binding of TNF to TNF-R1 recruits the adaptormolecule TNF receptor-associated death domain (TRADD), which in turn recruits another adaptormolecule Fas-associated death domain (FADD). These receptor-bound death domains interact with the proteases caspase-8 and caspase-10, initiating the cascade of caspase activation leading to DNA fragmentation and cell death. There is also a TNF-related apoptosis-inducing ligand (TRAIL) that can bind to receptors DR4 and DR5 and induce apoptosis [176]. Binding of TRAIL to two TNF family decoy receptors DcR1 and DcR2 prevents apoptosis, as these receptors lack the death domains. A third decoy TNF receptor, DcR3, which binds to Fas ligand (FasL), is constitutively expressed at high levels in keratinocytes. Interestingly, soluble forms of DcR3 can profoundly modulate dendritic cell maturation and differentiation in the skin. The homotrimeric cytokines, lymphotoxin (LT)-a and LT-b, are structurally and functionally homologous to TNF. LT-a and LT-b are produced by activated T cells, B cells, and NK cells. LT-a homotrimer can bind to TNF-R1 and TNF-R2 and transduce signals similar to TNF. LT-b has a different receptor, LT-bR, and hence has a different biological function. 3. Interleukins Interleukins (ILs) are cytokines with a plethora of functions in the immune system, and are the major mediators of cell-mediated immunity. To date there are 29 different interleukins described in the literature. They are designated as IL-1 through IL-29. Several of these interleukins have overlapping functions, mainly because they use common receptor complexes to transduce intracellular signals in the effector cells. Based on receptor use, the interleukins can be grouped into the IL-1 family of cytokines, IL-2 family of cytokines that use receptors containing a g chain (gc), IL-3 and IL-5 family, IL-6 and gp130 family, IL-8, IL-10 family, IL-12 family, IL-13, IL-14, IL-16, IL-17 family, and IL-28 and IL-29 family of cytokines. a. IL-1 Family of Cytokines The IL-1 family of cytokines consists of four distinct but structurally related molecules: IL-1a, IL-1b, IL-1 receptor antagonist (IL-1ra), and IL-18 [177]. Since IL-1ra can bind to IL-1 receptors without activating them, IL-1ra is a natural blocking agent of IL-1–induced function on target cells [178]. Activated mononuclear phagocytes are the major cellular source of IL-1, although several activated cells other than the mononuclear phagocytes can also secrete IL-1 in response to infection, products of infectious agents (bacterial LPS, superantigens, viruses, antigens of parasites), tissue injury, inflammatory process, or specific endogenous mediators (LTs, complement fragment C5a, TNF, GM-CSF). The nature of the stimulus will determine whether IL-1 accumulates intracellularly or is secreted. Despite the fact that IL-1 is secreted, it lacks the typical signal sequence required for secretion, suggesting that IL-1 utilizes a pathway different from the classical secretory pathway used by other secreted proteins. Both IL-1a and IL-1b are synthesized as a 31-kDa–precursor protein (pro–IL-1a and pro–IL-1b), which is then proteolytically cleaved to generate the 17-kDa mature form. Most of IL-1a is stored in the cytoplasm as pro–IL-1a. Calpain and other extracellular proteolytic enzymes cleave the pro–IL-1a to the mature form. The pro–IL-1b on the other hand is
1391_C03.fm Page 56 Tuesday, November 18, 2003 4:54 PM
56
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
cleaved by an enzyme called IL-1b converting enzyme (ICE), which is not effective for converting pro–IL-1a [179]. LPS and IFN-g up-regulate the expression of ICE. Both pro–IL-1a and membranebound mature IL-1a are biologically active, whereas pro–IL-1b has no biological function. Therefore, pro–IL-1b has to be cleaved by ICE to be functional. The third member of the IL-1 family, IL-1ra, is produced mainly by tissue macrophages and keratinocytes. Two forms of IL-1ra are synthesized by these cells: an intracellular form that lacks the signal sequence (icIL-1ra) and a secreted form that shows varying levels of glycosylation and possesses a signal sequence. Keratinocytes express mainly IL-1a and icIL-1ra. IL-1 induces its effect by binding to its receptor (IL-1R), which is expressed on a number of cell types [180]. There are two distinct types of IL-1R (IL-1RI and IL-1RII) and they belong to the Ig superfamily [181]. IL-1RI is an 80-kDa transmembrane protein with a long cytoplasmic tail that participates in signal transduction. The extracellular IL-1 binding site consists of three Ig-like domains. The IL-1RII is a 60-kDa transmembrane protein that possesses similar extracellular domains but lacks the long cytoplasmic tail and is incapable of signal transduction. Therefore, IL1RII acts as a decoy receptor for IL-1 and thus down-regulates IL-1–induced functions. There is also a transmembrane IL-1 receptor accessory protein (IL-1R-AcP) that can complex with IL-1RI and can bind IL-1 and IL-1ra. Since fewer IL-1RI receptors are expressed by cells, a majority of the IL-1–induced effects are mediated through the IL-1RI/IL-1R-AcP complex. IL-1RI is expressed on T cells, endothelial cells, fibroblasts, keratinocytes, and hepatocytes, whereas IL-1RII is expressed on neutrophils, B cells, and monocytes. IL-1a binds to IL-1RI with high affinity but has low affinity to IL-1RII. IL-1b binds to IL-1RII with high affinity. IL-1ra binds to both receptors with 10- to 50-fold higher affinity than IL-1 and does not transduce any signals. Thus, IL-1ra is a potent inhibitor of IL-1 function. However, under physiological conditions, an excess of 10- to 500-fold of IL-1ra is required in the microenvironment to completely block the IL-1–mediated responses. Activated neutrophils and monocytes can shed the extracellular domain of IL-1RI and IL-1RII. The soluble IL-1R can then bind to IL-1 and block their function. Certain viruses such as vaccinia and cowpox can secrete proteins with structures similar to soluble IL-1R, and are thus capable of modulating the IL-1 function. Similarly, certain viruses can inhibit the function of ICE, thereby affecting the cleaving of pro–IL-1b. Signals transduced through IL-1R activate the nuclear transcription factors NF-kB and AP-1 that translocate to the nucleus and activate several IL-1–inducible cytokine genes for IL-6, IL-8, TNF, granulocyte-colony–stimulating factor (G-CSF), plateletderived growth factor (PDGF), IL-11, IL-2 receptor, IFN-g receptor, IL-3 receptor, ICAM-1, and other adhesion molecules on endothelial cells. IL-1 also acts as an autocrine or paracrine costimulant of early inflammatory immune responses. When released in large quantities, IL-1 can activate the fever center in the brain, induce production of leptins, stimulate the hypothalamuspituitary-adrenal axis to release several hormones, and induce production of acute-phase proteins. IL-1 acts a comitogen by up-regulating IL-2 production and IL-2 receptor expression on T cells. Increased IL-1 secretion in the thymus helps maturation and differentiation of CD4+CD8+ cells. Similarly, IL-1 can also induce maturation of B cells, resulting in augmented B-cell proliferation, surface IgM expression, and antibody production [182]. IL-1 on antigen-presenting cells is also a co-stimulator for Th2-type cells that are being activated through the T-cell receptor. IL-1 stimulates fibroblast proliferation and secretion of collagenases. In addition, IL-1 also induces cycloxygenase synthesis and prostaglandin release from fibroblasts. Intracellular IL-1b can inhibit Fas-mediated apoptosis. Thus, IL-1 plays a central role in regulating immune responses, essentially by inducing release of other mediators and cytokines. IL-18 was originally identified as an IFN-g–inducing factor [183,184]. IL-18 is expressed in a wide range of cells including Kupffer cells, macrophages, T cells, B cells, osteoblasts, keratinocytes, dendritic cells, astrocytes, and microglia [185]. IL-18 shares biological property with IL-12, including stimulation of IFN-g production, NK cell activation, and stimulation of Th1 cell differentiation. Despite their functional similarity, IL-18 is not related to IL-12. In terms of structure, IL-18 and
1391_C03.fm Page 57 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
57
IL-1b share primary amino acid sequences of the so-called “signature sequence” motif and are similarly folded as all-beta–pleated sheet molecules. Also similar to IL-1b, IL-18 is synthesized as a pro–IL-18 in the cells and is then converted to mature IL-18 by the intracellular cysteine proteinase ICE [181]. The activity of mature IL-18 is closely related to that of IL-1. Several cells including macrophages produce pro–IL-18. LPS activates ICE; therefore, LPS activation of these cells may contribute to IL-18 secretion. IL-18 induces gene expression and synthesis of TNF, IL-1, FasL on NK cells, and several chemokines. IL-18 is also involved in endotoxin-induced liver injury and inhibits osteoclast formation. IL-18 induces these biological effects by binding to its receptor, IL18R complex. This IL-18R complex is made up of a binding chain termed IL-18Ralpha, a member of the IL-1 receptor family previously identified as the IL-1 receptor–related protein (IL-1Rrp), and a signaling chain, also a member of the IL-1R family. The IL-18R complex recruits the IL1R–activating kinase (IRAK) and TNFR-associated factor-6 (TRAF-6), which phosphorylates NFkB-inducing kinase (NIK) with subsequent activation of NFkB. Although IL-18 is a potent inducer of the Th1 cytokine IFN-g, recent studies show that IL-18 can also induce IL-13 from NK and T cells in the absence of IFN-g. Thus, IL-18 can promote both Th1 and Th2 cytokines depending on the microenvironment milieu. b.
IL-2 Family of Cytokines and Common Cytokine Receptor Gamma Chain
The IL-2 family of cytokines plays a major role in immune system development and modulation of lymphocyte activities during immune responses [186,187]. The IL-2 family of cytokines includes IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21, which share the common cytokine receptor gamma chain (gc) [188–190]. The gene for gc is localized to human chromosome 13 in the region previously determined to be a locus for X-linked severe combined immunodeficiency (XSCID). Subsequently, a mutation in the gc gene was determined in human XSCID [191]. XSCID is a disease characterized by significant decrease in the numbers of T cells and NK cells, but normal numbers of nonfunctional B cells. In addition to gc, the IL-2 family of cytokines also requires a specific receptor (such as IL-2Rb, IL-4a, IL-7a, and IL-9a) for their intracellular signal transduction [192]. IL-15 shares IL-2Rb and hence both IL-2 and IL-15 have overlapping biological functions [193]. In addition, both IL-2 and IL-15 require a a chain (IL-2Ra and IL-15Ra) for higher binding affinity to respective receptors, but these a chains do not participate in signal transduction [194]. A mutation in the IL-2Ra chain can lead to increased susceptibility to bacterial, fungal, and viral infections in humans. Signals that are dependent on gc have been shown to be important for the development of the T-cell compartment, playing an important role not only in inducing expansion and preventing apoptosis of peripheral T cells, but also in supporting various stages of thymocyte development. The IL-2 family of cytokines can also act on other lineage of cells in addition to the cells of T-cell lineages [195]. IL-2 induces proliferation of T cells and augmentation of NK cell activity [196,197]. IL-2 also plays an important role in eliminating autoreactive T cells from circulation and can promote Ig synthesis by B cells. Interaction of IL-2 with its receptor complex (IL-2a/IL-2Rb/gc) signals activation of the receptor-associated tyrosine kinases, Jak1 and Jak3. These kinases in turn activate other signaling molecules such as Shc, signal transducer and activators of transcription (STAT)5a and STAT5b, which then dock to the cytoplasmic tail of IL-2Rb, triggering the Ras-Raf-Map kinasesignaling pathway [186]. Ubiquitin/proteasome-mediated degradation of STAT proteins attenuates IL-2–induced responses. IL-4 is a critical mediator that promotes differentiation of T-cell precursor cells into the Th2 type phenotype. The IL-4 gene is located on chromosome 5 (q23-31). Like IL-2, IL-4 is produced by activated CD4+cells and uses the common gc chain in its receptor complex [198]. IL-4 can also be secreted by mast cells, basophils, and keratinocytes [199,200]. IL-4 is the major B-cell growth factor and a vital cytokine for Ig class switching leading to IgE production [94]. In addition, IL4 can up-regulate class II MHC and CD23 expressions on B cells. IL-4 also has effects on
1391_C03.fm Page 58 Tuesday, November 18, 2003 4:54 PM
58
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
macrophages, fibroblasts, stromal cells, and hematopoietic precursor cells. Furthermore, IL-4 can potentiate T-cell apoptosis via IL-2–dependent mechanisms [201]. A novel cytokine-like molecule designated FISP (IL-4–induced secreted protein) is secreted by Th2 cells and requires signaling through both TCR and STAT6-dependent IL-4R [202]. IL-7 is a tissue-derived cytokine produced primarily by MHC class II+ cortical epithelial cells in the thymus and bone marrow [203]. The bone marrow–derived dendritic cells are a minor source of IL-7. Additional sources of IL-7 include keratinocytes, intestinal epithelial cells, fetal liver, dendritic cells, and follicular dendritic cells [204]. The gene for IL-7 is located on chromosome 8 (q12-13). IL-7 can bind extensively to extracellular matrix–associated glycosaminoglycan (GAG), heparin sulfate, and fibronectin. This binding allows an increase of IL-7 concentration in the microenvironment. IL-7 and transforming growth factor (TGF)-b maintain a reciprocal relationship, wherein one down-regulates the expression of the other. Like other members of the family, IL-7 transduces its intracellular signal through a receptor complex formed by its alpha chain (IL-7Ra) and the gc. IL-7 can signal through a number of nonreceptor tyrosine kinase pathways that bind to the cytoplasmic tail of IL-7Ra. These pathways include the Jak/STAT pathway, phosphatidylinositol 3-kinase pathway, and Src family tyrosine kinases. IL-7 was originally isolated as a growth factor for B-cell precursors [205]. Subsequently, IL-7 was shown to be an important cytokine for T-cell development in the thymus, for development and maturation of dendritic cells in various tissues, for modulating T-cell function and homeostasis, and as an antitumor agent by virtue of its ability to down-regulate TGF-b [206]. IL-9 is a multifunctional cytokine produced by activated memory (CD45 RO+) Th2 type T cells, eosinophils, and mast cells [207]. IL-1, IL-4, and IL-10 augment IL-9 production. The IL-9 gene is located on chromosome 5 (q31-35). IL-9 inhibits cytokine production by IFN-g–producing CD4+ cells and promotes proliferation of CD8+ T cells. IL-9 is also an eosinophil and mast cell growth factor that can promote IgE production by B cells and induce chemokine and mucus secretion by bronchial epithelial cells [208]. An important role for IL-9 in the pathology of asthma has been established due to its action on mast cells, eosinophils, neutrophils, and airway epithelium. The existence of an IL-9-mediated autocrine loop has been suggested for some malignancies such as Hodgkin’s disease. The IL-9 receptor is a member of the hematopoietin receptor superfamily and consists of a ligand-specific a subunit (IL-9Ra) and the gc [195]. Signal transduction through this receptor is dependent on Jak/STAT-1, STAT-3, and STAT-5 pathways. IL-15 is a 15-kDa cytokine expressed in a broad range of tissues and cells such as activated monocytes, dendritic cells, osteoblasts, and fibroblasts [41]. The receptor for IL-15 consists of a trimeric IL-15 receptor (IL-15R) formed by IL-2Rb, gc, and the IL-15Ra chain, which is alternatively spliced to generate three active forms that can bind IL-15 with high-affinity transducing signals through Jak1/3 and STAT3/5 [194,195,209]. Since IL-15 uses IL-2Rb, some of the functions of IL-15 overlap with that of IL-2. IL-15Ra is expressed in various tissues and cells including activated T cells [210]. Some functional activities of IL-15 overlap with those of IL-2. IL-15 is a potent initiator of the innate immune system by activating NK cells and CD8 cells [41]. In addition, IL-15 also plays a major role in the development and survival of NK cells, development of TCRgd intestinal intraepithelial lymphocytes, and functional maturation of macrophages and dendritic cells [211]. IL-15 is also important for the maintenance and proliferation of the memory phenotype of CD8+ T cells that express IL-2Rb, CD44, and Ly6C. Thus, IL-15Ra signaling is an important event in contributing to CD8+ T-cell memory responses and proliferation of NK cells [212]. IL-21 is a recently discovered cytokine that uses the common gc in the formation of its active heterodimeric receptor complex [213]. Like other cytokines in this family, IL-21 influences the proliferation of T cells and B cells, augments the cytolytic activity of NK cells, and up-regulates genes associated with innate immunity [214,215]. IL-21 may also play a role in regulating B-cell homeostasis and Ig production [216,217].
1391_C03.fm Page 59 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
c.
59
IL-3 and IL-5 Family of Cytokines
IL-3 and IL-5 belong to a family of hemopoietic cytokines that includes the growth factor granulocyte-macrophage colony-stimulating factor (GM-CSF) and are involved in the differentiation and activation of cells in the myeloid compartment [218]. All three cytokines are comprised of four a helices packed as a bundle, which is dimerized in the case of IL-5. These cytokines utilize a receptor complex consisting of respective a subunits and a b common chain (designated bc). The a chains of these cytokines have a unique N-terminal Ig-like domain that is not seen in other types of cytokine receptors. The a subunit binds to its cognate ligand with low affinity and is insufficient for full receptor activation by itself. The bc subunit is a member of the type 1 cytokine receptor superfamily that contains conserved extracellular domains called cytokine receptor modules (CRMs). Each CRM consists of two repeats of a fibronectin type III–like domain. Each domain is made up of approximately 100 amino acids and 7 b strands with intervening loops arranged into a b barrel structure. These repeats carry two sets of conserved motifs typical of this family of receptors. The first repeat contains four cysteines with conserved spacing, while the second repeat contains a WSXWS motif. Binding of IL-3, IL-5, and GM-CSF to their respective receptors results in the activation of Jak2 and phosphorylation of tyrosine and serine residues of the bc cytoplasmic tail [219]. Disulfide-mediated dimerization of the signaling units is unique to this family of cytokines. Eosinophils express receptors for all three cytokines, whereas monocytes express only receptors for GM-CSF and IL-3. Thus, all three cytokines can activate eosinophils, but IL-5 cannot activate monocytes. These cytokines thus contribute to inflammatory diseases such as atopic dermatitis, allergic rhinitis, and asthma. Subjects with low levels of bc expression on peripheral blood cells exhibit a condition called “pulmonary alveolar proteinosis” characterized by reduced numbers of eosinophils in the lungs. IL-3, IL-5, and GM-CSF are produced by activated T cells. IL-3 is a multilineage hemopoietic regulator that promotes the survival, proliferation, and development of a wide variety of myeloid progenitors such as hematopoietic stem cells and committed progenitor cells of the granulocyte-macrophage, erythrocyte, eosinophil, basophil, megakaryocyte, mast, and lymphocyte lineage cells [220]. Because of these functions, IL-3 is therapeutically useful in primary marrow disorders, including myelodysplastic syndromes and aplastic anemia [221]. IL-3 also enhances phagocytosis and cytotoxic function of myeloid cells and promotes activation of basophils and eosinophils. In addition, IL-3 potentiates IL-2–dependent growth of normal T cells and IL-2–dependent secretion of IgG by activated B cells [222]. IL-5 is the predominant cytokine that acts on eosinophils [223]. The pro–eosinophilic effects of IL-5 include enhanced replication and differentiation of eosinophilic myelocytes, enhanced degranulation of eosinophils, prolonged survival time of eosinophils, and enhanced adhesion of eosinophils [224]. Thus, blocking of IL-5 can have significant advantages therapeutically to block atopic conditions mediated by eosinophils [225]. GM-CSF is an 85-kDa glycoprotein that interacts with stem cells to differentiate and promote clonal development of granulocyte and dendritic cell progenitors [226]. Activated T cells, B cells, macrophages, mast cells, endothelial cells, and fibroblasts produce GM-CSF in response to a variety of stimuli. Receptors of GM-CSF are expressed on the surface of monocytes, neutrophils, eosinophils, granulocyte progenitors, and fibroblasts, and on endothelial cells. GM-CSF thus essentially functions as a survival factor for hematopoietic progenitor cells. Binding of GM-CSF to its receptor on phagocytes activates these cells to enhance their phagocytosis. In addition, GM-CSF mediates ADCC reaction and stimulates secretion of IL-1 and TNF. Clinically, GM-CSF is administered to ameliorate neutropenia following cancer chemotherapy and bone marrow transplantation. d. IL-6 and gp130 Family of Cytokines The IL-6 family of cytokines consists of IL-6, IL-11, leukemia inhibitory factor (LIF), oncostatin M (OSM), ciliary neurotrophic factor (CNTF), cardiotrophin-1 (CT-1), and a novel
1391_C03.fm Page 60 Tuesday, November 18, 2003 4:54 PM
60
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
neurotropin-1/B-cell stimulatory factor 3 (NNT-1/BSF-3). These cytokines are structurally and functionally related and share gp130 as a critical component in their receptor complexes for signal transduction [227,228]. The gp130 molecule has no IL-6 binding capability by itself but plays an important role in the formation of high-affinity IL-6 binding sites by associating with the IL-6/IL-6R complex in the transduction of IL-6 signals [229]. The gp130 also forms a similar receptor complex with the other IL-6 family of cytokines [230]. Cytoplasmic signaling through gp130 is mediated by tyrosine phosphorylation of STAT by Jak kinases [231,232]. IL-6 was originally identified as a factor that stimulates and differentiates B cells to produce Ig. Now we know that IL-6 is a pleiotropic cytokine with a wide range of biological functions. These include inducing proliferation of megakaryocyte progenitors, differentiation of macrophages and cytotoxic cells, stimulation of hepatocytes, induction of expression of various acute-phase proteins, differentiation of neuronal cells, and stimulation of secretion of anterior pituitary hormones [231]. Because of its effect on acute-phase proteins, IL-6 also increases body temperature. Other cytokines in the IL-6 family have biological functions that overlap those of IL-6. This functional redundancy is due to gp130, which is an essential component of the receptor complex of all members of the IL-6 family of cytokines [233]. A secretory form of IL-6 receptor (sIL-6R) is present in healthy human sera at a concentration of approximately 80 ng/ml. Since sIL-6R can promote formation of osteoclast-like cells, an increase in circulating sIL-6R is associated with increased bone absorption as seen in osteolytic diseases such as multiple myeloma and juvenile rheumatoid arthritis [234,235]. Similarly, clinical studies have shown that the circulating levels of IL-6 and other cytokines in the IL-6 family are increased in patients with congestive heart failure [236]. IL-11 is a multifunctional cytokine that uses gp130 and has activities on a broad range of hematopoietic cells including primitive stem cells and mature progenitor cells [237,238]. IL-11 supports the growth of colony-forming units in megakaryocytes. Administration of IL-11 increases two- to three-fold circulating platelets, stimulates bone marrow and spleen megakaryocyte progenitor numbers, and enhances megakaryocyte maturation [239]. Thus, IL-11 is therapeutically highly effective for myelosuppression and thrombocytopenia associated with cancer chemotherapy and bone marrow transplantation. IL-11 has potent anti-inflammatory activity and can suppress TNF and IL-12 expression in activated macrophages [238]. IL-11 down-regulates glucocorticoid receptors in a dose-dependent fashion, whereas IL-6 up-regulates the expression of glucocoticoid receptors. Similarly, IL-1b up-regulates IL-11 secretion. LIF and OSM are closely related cytokines in both function and structure [240,241]. LIF was first identified as a factor that inhibits the growth of leukemia cell lines, and OSM was identified as a factor that inhibits growth of human melanoma cells [242]. Several cells, including lymphocytes, monocytes, and bone marrow stromal and osteoblastic cells can produce LIF in addition to certain malignant cells. Osteoblasts appear to be the major target of LIF and OSM. Both LIF and OSM induce an anti-apoptotic effect on these cells and promote proliferation and differentiation [243]. Their effects on osteoclasts are not fully understood but both can activate osteoclasts and cause hypercalcemia. LIF is important for embryo implantation [244]. Lack of the LIF gene can lead to female infertility [245]. LIF and OSM induce their effect by binding to gp130-associated receptors [246]. In addition, LIF and OSM also bind to a low-affinity receptor, LIFR, whose structure is closely related to that of gp130. LIFR then becomes heterodimerized with gp130 to form the high-affinity and signaling-competent complex. OSM can also bind to OSM-specific receptor component (OSMR) to form a heterodimer complex with gp130 [247]. The LIFR/gp130 complex is also utilized by CNTF, CT-1, and NNT-1/BSF-3 to transduce their signals. However, these cytokines have to bind to the a chain of their respective receptors such as CNFR and CT-1R. Although gp130 and LIFR are expressed in nearly all organs, expression of the a chain of IL-6R, IL-11R, CNTFR, and CT-1R is limited, suggesting that the cellular responsiveness to these cytokines is largely determined by the regulated expression of their specific receptor chains. Inflammatory responses can up-regulate the expression of the respective receptor a chains.
1391_C03.fm Page 61 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
61
CNTF enhances the survival of neuronal cells and has been investigated as a therapeutic agent for motor neuronal diseases [248]. CNTF is also shown to have a promising role in the treatment of obesity and diabetes, and is recognized as a major protective factor in demyelinating central nervous system diseases [249]. To exert its biological effect, CNTF has to bind to its nonsignaling specific receptor, CNTFR, which then associates with the gp130/LIFR complex to induce the Jak/STAT signaling pathway [250]. CT-1 is a cytokine that induces cardiac myocyte hypertrophy [251]. Serum levels of CT-1 are increased in patients with chronic heart failure. Cardiac myocytes and fibroblasts are a major source of CT-1. The CT-1 can also induce angiotensinogen expression in cardiac myocytes [252]. These functions of CT-1 are regulated by its binding to the gp130 receptor complex [253]. Thus, gp130 appears to play an important role in cardiomyocyte regulation, including survival and proliferation during development and induction of hypertrophy after birth [254]. NNT-1/BSF-3 is a new addition to the IL-6 family of proteins that uses the LIFR/gp130 complex to transduce its signal [244]. NNT-1/BSF-3 was identified first in the activated human Jurkat T-cell lymphoma cells. Similar to other IL-6 members, the NNT-1/BSF-3 also has a neurotropic effect in addition to being a potent B-cell stimulator to produce IgG and IgM. e. IL-8 IL-8 was originally discovered as a neutrophil chemotactic factor in the supernatants of activated human monocytes [255]. IL-8 is the founding member of the CXC chemokine superfamily [256]. One of the major biological functions of IL-8 is that it is an activator and chemoattractant for neutrophils. Expression of IL-8 considerably varies. In healthy tissues, IL-8 is barely detectable, but it is rapidly induced by a factor of 10 to 100 in response to cellular stress, proinflammatory cytokines such as TNF or IL-1, and microbial agents such as bacteria and viruses [257,258]. IL-8 is also frequently expressed by tumor cells. In fact, IL-8 expression was first demonstrated at high levels in human melanomas [259]. Subsequently, increased IL-8 expression has been found in several tumors such as acute myelogenous leukemia, B-cell chronic lymphocytic leukemia, brain tumors, breast cancer, colon cancer, cervical cancer, gastric cancer, Hodgkin’s disease, lung cancer, mesothelioma, ovarian cancer, pituitary adenomas, prostrate cancer, renal cell carcinoma, pancreatic tumors, and thyroid tumors. IL-8 has been shown to be motogenic (chemotactic effect), mitogenic, and angiogenic, and thus plays an important role in human tumor progression by an autocrine loop. IL-8 expression can be induced by numerous stress factors present in the tumor environment, such as hypoxia, acidosis, hyperglycemia, hyperosmotic pressure, high cell density, hyperthermia, radiation, and chemotherapeutic agents. Because of its critical role in tumor metastasis, IL-8 is one of the major targets for cancer treatment [260]. IL-8 also plays an important role in the pathophysiology of pulmonary diseases [261,262]. The receptor for IL-8 is CXCR2, which is expressed on various cells including macrophages [258]. f.
IL-10 Family of Cytokines
The IL-10 family of cytokines consists of IL-10, IL-19, IL-20, IL-22, IL-24, and IL-26 [263]. The genes for IL-19, IL-20, and IL-24 are clustered together with IL-10 on chromosome 1, whereas the genes for IL-22 and IL-26 are located close to the IFN-g genes on chromosome 12. Originally discovered as an inhibitory factor for the production of Th1 type cytokines, IL-10 is a pleiotropic inhibitor of several cell types. Subsequent studies showed that IL-10 can also act as a survival and differentiation factor for B cells. Thus, IL-10 can function both as an immunosuppressive and immunostimulatory cytokine. IL-10 is produced by a variety of cells including activated monocytes, T cells, and keratinocytes. The existence of a family of IL-10 cytokines came from studies analyzing the genome of several viruses such as human g1-herpesvirus, Epstein–Barr virus (EBV), monkey yatapoxvirus, and human and simian cytomegaloviruses. The genome of these viruses contains
1391_C03.fm Page 62 Tuesday, November 18, 2003 4:54 PM
62
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
proteins that show functional sequence homology to human IL-10. Furthermore, these viral IL-10 homologues were shown to bind to IL-10 receptors and mediate IL-10 functions. Using subtractive cDNA hybridization with these sequences, five human paralogues of IL-10 have been discovered that show 20% to 83% sequence homology to human IL-10. The IL-10 family of cytokine consists of the melanoma differentiation-associated antigen (designated as IL-24); IL-10 related T-cell–derived inducible factor (IL-22); AK155 (IL-26); IL-19; and IL-20. IL-19 is expressed by activated monocytes [264]. Although the cellular source of IL-20 is not established yet, IL-20 appears to have a significant role in the development of psoriatic lesions. IL-22 is produced by CD4+ cells, and this cytokine mediates acute-phase response signals in hepatocytes [264]. IL-24 is expressed by differentiated melanoma cells and Th2 type lymphocytes [265]. IL-24 has antitumor activity. IL-26 is highly expressed by T cells transformed with herpes virus. IL-10 and IL-24 have significant therapeutic potential as immunosuppressive agents for organ transplantation and tumor therapy [264]. The three-dimensional structure of IL-10 shows that the molecule forms V-shaped dimers and each arm of the dimer consists of six a helices, four originating from one subunit and two from the other subunit [263]. Four of the a helices form a bundle similar to other helical cytokines such as IL-4 and GM-CSF. The overall topology of IL-10 closely resembles that of IFN-g, suggesting a close relationship between these two cytokines. The IL-10 family of cytokines exerts effects by forming a complex with the IL-10 receptors (IL-10R). The IL-10R consists of a longer chain, IL-10R1, which is the major signaling component of the receptor, and a shorter membrane-spanning receptor chain, IL-10R2 (also called cytokine receptor family 2, CRF2) with a short intracellular segment. Dimeric IL-10 molecules first bind to the IL-10R1 with high affinity and subsequently, IL-10R2 binds to the IL-10/IL-10R1 complex with low affinity to form the IL-10/IL-10R1/IL10R2 complex. Other members of the family also form similar complexes by binding to CRF2. Thus, IL-20 binds to IL-20R1 and IL-20R2 on the surface of keratinocytes, IL-22 binds to the long chain of IL-10R (IL-10R1) and IL-22 binding protein (also called IL-22RA2), and IL-19 and IL-24 use IL-20R1/IL-20R2 heterodimers. Similarly, IL-20 and IL-24 can bind to the IL-10R1/IL22RA2 and IL-10R1/IL-20R2 complexes. Thus, CRF2 receptors show certain degree of promiscuity for binding of the IL-10 family of cytokines. Signaling through this receptor complex activates Jak kinases and STAT-dependent transcription of genes that encode suppression of cytokine signaling. g. IL-12 Family of Cytokines The IL-12 family of cytokines consists of the two subunits of IL-12 (p35 and p40), IL-23 and IL-27 [266]. IL-12 is a heterodimeric cytokine composed of two subunits, p35 and p40. P35 is constitutively expressed by a number of cells. The p40 chain exists as a soluble monomer, a homodimer (with another p40), or as a heterodimer (with p35 or other proteins). For expression of IL-12 (IL-12p70 or IL-12p75), both p35 and p40 subunits have to express in the same cell. Activated macrophages and dendritic cells secrete significant amounts of monomeric and homodimeric p40. The heterodimer formed by p40 and a p35-related protein p19 is designated as IL-23. The heterodimer formed by a p40-related protein plus a p28 protein is designated as IL-27. All these proteins critically influence the induction and maintenance Th1 type responses. IL-12 is an immunoregulatory cytokine that promotes cell-mediated immunity, specifically by promoting secretion of IFN-g from NK cells [267]. The p35 subunit of IL-12 has significant homology to the IL-6 family of cytokines, and the p40 subunit has homology to the extracellular domain of IL-6R1a and CNTFR. The biological function of IL-12 is mediated by the high-affinity receptor IL-12R, which is formed of two subunits b1 and b2. The IL-12R is a member of the class I cytokine receptor family and is closely related to the glycoproteins gp130 and LIFR. NK cells and T cells can express both the subunits of IL-12R and are required for IL-12 bioactivity. The homodimeric p40 subunit acts as an antagonist for IL-12 bioactivity by binding to the b1 subunit
1391_C03.fm Page 63 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
63
of the IL-12R. Homodimeric p40 is also an efficient chemoattractant for macrophages and can promote inducible nitric oxide synthetase (iNOS) expression in these cells. The proinflammatory function of IL-12 as well as its ability to stimulate the Th1 type response play an essential role in the defense against many intracellular protozoa, and fungal and bacterial pathogens. Antigens from microbial agents induce primarily IL-12p40. Subsequent cross-linking of CD40 on antigen-activated dendritic cells by CD40L-expressing T cells amplifies IL-12 production by increasing the synthesis of IL-12p35. As mentioned above, IL-23 consists of the p40 subunit and a p19 protein [268]. The p19 protein has considerable sequence homology to p35 and is functionally inactive by itself. IL-23 binds to IL-12Rb1 and a b2-like receptor subunit designated as IL-23R for its biologic function. The p19 component is produced in large amounts by activated macrophages, dendritic cells, T cells, and endothelial cells. Th1 cells express larger amounts of p19 than Th2 cells. However, only activated macrophages and dendritic cells concomitantly express IL-12 p40, the other molecule required for IL-23 signal transduction. The p19 expression is up-regulated by bacterial products that signal through toll-like receptors 2 and 4. IL-23 induces proliferation of memory T cells, and production of IFN-g from memory and naïve T cells. IL-23 may play a significant role in eczematous skin diseases. IL-27 is a heterodimeric protein that consists of EBV-induced gene 3 (EBI3), a p40-related protein, and p28, a polypeptide related to IL-12p35 [269]. Monocytes, macrophages, fetal cells, and placental trophoblasts express EBI3. IL-27 appears to be produced early by APCs. IL-27 can thus induce clonal proliferation of naïve but not memory CD4+ T cells, and can augment IL-12-induced IFN-g production by naïve CD4+ T cells. The receptor for IL-27 appears to be a recently identified orphan receptor TCCR that is shown to play an important role in the early initiation of Th1 type responses, but is not required for the maintenance of Th1 responses. Therefore, it is possible that IL-27 and IL-12 act sequentially in generating and maintaining the Th1 responses. h. IL-13 IL-13 is a key mediator in the pathogenesis of allergic inflammation, and is produced by activated Th2 cells [270]. The IL-13 gene is located on chromosome 5 (q31). Subsequently, IL-13 was shown to up-regulate MHC class II expression on B cells and monocytes, promote IgE class switching in B cells, and inhibit inflammatory cytokine production. Thus, IL-13 was originally thought to be functionally redundant with IL-4. However, several recent studies suggest that IL-13 is a pleotropic cytokine with several unique biological functions. IL-13 plays a significant role in resistance against bacteria, intracellular protozoa, and helminth parasites. In addition, IL-13 is an anti-apoptotic cytokine that promotes tumor growth. IL-13 has a central role in the pathogenesis of asthma by virtue of its ability to activate eosinophils, induce mucus secretion, and cause airway hyperreactivity. IL-13 can up-regulate extracellular matrix, thereby promoting tissue fibrosis. Thus, IL-13 is a potent inducer of tissue fibrosis in schistosomiasis and asthma. To transduce signals, IL-13 first binds to its high-affinity receptor formed by IL-4Ra and IL13Ra1 [271]. This heterodimer then binds to the decoy receptor IL-13Ra2 to form the receptor–ligand complex. IL-13Ra1 is expressed on a wide variety of cells such as B cells, basophils, eosinophils, mast cells, epithelial cells, endothelial cells, fibroblasts, monocytes, smooth muscle cells, and macrophages. However, functional IL-13R has not been demonstrated on T cells. Thus, unlike IL-4, IL-13 does not activate CD4+ T cells. IL-13Ra1 and a2 expression are up-regulated by IL-3, IL-4, and IL-10, whereas IFN-g down-regulates the expression of IL-13R. i.
IL-14
IL-14 is a high-molecular-weight B-cell growth factor produced by malignant B cells and T cells [272]. IL-14 can induce proliferation of activated B cells, stimulate resting B cells, and induce
1391_C03.fm Page 64 Tuesday, November 18, 2003 4:54 PM
64
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
synthesis or inhibition of antibodies by B cells [273]. IL-14 shares various functional activities with IL-4 such as long-term growth of B cells and increasing cAMP in B cells. IL-14 induces this effect by binding to its receptor IL-14R. Peripheral blood B cells and T cells from patients with systemic lupus erythematosus (SLE) and B-cell type non-Hodgkin’s lymphoma spontaneously produce significant amounts of IL-14 that may contribute to disease pathology. j.
IL-16
IL-16 is a 14-kDa cytokine initially described as a T-cell chemoattractant [274,275]. Subsequent studies show that IL-16 is a chemoattractant for a variety of CD4+ immune cells [276]. IL-16 acts as an immunoregulator for selective trafficking of CD4+ cells into the inflammatory immune site. IL-16 expression is up-regulated during asthma and autoimmune diseases [277,278]. k.
IL-17 Family of Cytokines
IL-17 is a 17-kDa proinflammatory cytokine produced and released by CD45RO+ memory CD4+ T cells and, under certain conditions, from CD8+ T cells [279,280]. In the lungs, eosinophils are the major source of IL-17 during asthma. IL-17 expression is elevated in rheumatoid arthritis, asthma, multiple sclerosis, psoriasis, and transplantation rejection [281,282]. IL-17 is characterized by the presence of four cysteines in its protein structure. Cytokines with similar structures are grouped under the IL-17 family of cytokines [283]. There are four such cytokines in the IL-17 family of cytokines: IL-17B, IL-17C, IL-17F, and IL-25. IL-17 induces its biological functions by binding to IL-17R, which is expressed in nearly all cells. IL-17 shares transcriptional pathways similar to IL-1 and TNF. P38 and NF-kB are the key transcriptional factors for IL-17 function and require toll-like receptor 4 signaling. IL-17 can promote the production of TNF, IL-1b, IL-6, IL-8, and G-CSF. IL-17B and C, however, do not bind to IL-17R, and only promote TNF and IL-1b production. IL-17F is produced by memory T cells in patients with asthma and contributes to the pathology of asthma. IL-17F can also activate bronchial epithelial cells to release the neutrophil chemoattractant IL-8 and neutrophil-activating factor IL-6. In addition, IL-17F can induce IFN-g in the lung. Local production of IL-17 is a critical event in the host defense against gram-negative bacteria. IL-25 is a cytokine with significant sequence homology to IL-17 [284]. However, in the lungs, IL-25 promotes production of Th2 cytokines, IL-4, IL-15, IL-13, and eotaxins. The source of these IL-25–induced cytokines in the lungs appears to be mast cells [285]. By promoting Th2 cytokine secretion, IL-25 is contributing to the pathology of asthma by inducing eosinophil infiltration, mucus production, and airway hyperreactivity reactions [286]. IL-25 expression is also significantly increased in the gut and lungs during gastrointestinal parasitic infections. l.
IL-28 and IL-29 Family of Cytokines
This family consists of three cytokines: IL-28A, IL-28B, and IL-29 [287]. These cytokines represent an evolutionary link between IL-10 and the type 1 IFN family of cytokines. At the amino acid level, IL-28 and IL-29 are related to type I IFN, whereas at the genomic structure level, IL-28 and IL-29 are more similar to members of the IL-10 gene family. Like type 1 IFN, IL-28 and IL29 are induced by viral infection and show antiviral activity. However, for signal transduction, both IL-28 and IL-29 use the heterodimeric class II cytokine receptor that consists of IL-10Rb and an orphan class II receptor chain designated IL-28Ra. Therefore, IL-28 and IL-29 serve as an alternative to type 1 IFNs in providing immunity to viral infections.
1391_C03.fm Page 65 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
65
4. Growth Factors a. Transforming Growth Factor Transforming growth factor (TGF)-b is a 25-kDa multifunctional cytokine with proinflammatory and immunosuppressive activities [288]. TGF-b is a potent stimulator of cell growth and is produced by a variety of cells including tumor cells. Many cells, including platelets, macrophages, B cells, T cells, fibroblasts, epithelial cells, endothelial cells, astrocytes, microglial cells, osteoblasts, and osteoclasts express TGF-b constitutively. The three major isomeric forms of TGF-b in humans — TGF-b1, b2 and b3 — are induced by a variety of agents, including steroids, oncogenes, epidermal growth factor, nerve growth factor, and IL-1. TGF-b2 and b3 are involved in embryogenesis, whereas TGF-b1 has several immunological functions. The secreted form of TGF-b is biologically inactive. Enzymes such as plasmin, cathepsin D, thrombospondin, or heat activation and low pH can activate TGF-b. Activated TGF-b then binds to specific receptors expressed universally on the surface of cells except on some neoplastic cells. Three classes of TGF-b receptors have been identified and they are designated as type I, type II, and type III TGF-bR. Circulating TGF-b has a plasma half-life of 2 to 3 seconds. Despite the short half-life, the effects of TGF-b on various tissues are remarkable, the most important of which is its effect on extracellular matrix. TGF-b increases synthesis and secretion of matrix proteins that are important in cell migration, wound healing on soft and hard tissues, embryogenesis, carcinogenesis, and fibrotic diseases in various organs. Despite its potent stimulatory activity, TGF-b suppresses the growth of all lymphocyte lineage cells and thus mediates immunosuppression. b.
Stem Cell Factor
Stem cell factor is a growth factor that promotes growth and differentiation of hematopoietic cells, melanocytes, and mast cells. Stem cell factor is produced by cells in the bone marrow, liver, lung, kidney, brain, placenta, testis, and fibroblasts. The receptor for stem cell factor is a c-kit protooncogene that has tyrosine kinase activity. IL-3, GM-CSF, and erythropoietin modulate expression of c-kit. c.
Leukemia Inhibitory Factor
Leukemia inhibitory factor (LIF) is a cytokine that promotes differentiation of embryonic stem cells, hepatocytes, adipocytes, neurons, and some hematopoietic cells [246]. Alloreactive T cells, and certain tumor cells can produce LIF. Clinically, LIF is useful in differentiation of cells, stimulation of platelet formation, and enhanced local bone healing. d. Platelet-Derived Growth Factor Platelet-derived growth factor (PDGF) is a cytokine released from platelets that stimulates proliferation and viability of a variety of cells. PDGF is synthesized as a heterodimeric protein in megakaryocytes that is stored in platelet a granules and released from platelets at the site of blood vessel injury [289]. Serum levels of PDGF range from 15 to 60 ng/ml in normal individuals. Gastric epithelial cells can secrete PDGF-like peptides that promote stromal cell growth through paracrine mechanisms [290]. PDGF receptors are expressed on fibroblasts, and binding of PDGF to its receptor induces tyrosine kinase activity leading to several PDGF-inducible genes such as JE, KC.
1391_C03.fm Page 66 Tuesday, November 18, 2003 4:54 PM
66
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
J. Chemokines In order to participate in an acute or chronic inflammatory immune process, a great majority of the cells in the immune system must emigrate out of the circulation. Initial events that promote these processes include various integrins and their ligands that cause tethering (rolling), which leads to firm adhesion of the immune cells to the endothelial cells in areas where inflammatory immune responses are occurring in tissue. The immune cells are then drawn to the site of action from the endothelial surface via several factors, of which the chemokines are an important component. Thus, chemokines are chemical agents that attract cells (or chemoattractants) to a specific site. Unlike other chemoattractants that have a broad spectrum of activity, the chemotactic activity of chemokines is cell type specific. In addition to targeted trafficking, chemokines also promote angiogenesis, lymphopoiesis, and hematopoiesis. Chemokines are produced by a wide variety of cells including leukocytes in response to irritants, mitogens, endogenous cytokines, and antigens. Chemokines belong to a large supergene family of low-molecular-weight (8 to 10 kDa), heparinbinding proteins [162,291]. More than 50 chemokines have been reported to date and the list is growing (Table 3.1). Based on unique sequence homology and position of cysteine residues, chemokines have been divided into four subfamilies CXC (a), CC (b), C (g), and CX3C. The CXC subfamily comprises of nearly 15 chemokines designated CXCL1 through 15. Except for CXCL12, all CXC genes are located on chromosome 4 (q12-21). CXC chemokines have four conserved cysteine residues in their sequences; of these the first two cysteine residues are separated by a single amino acid (X); hence the name. The CC chemokine subfamily consists of a large number of chemokines; 11 are located on chromosome 7 (q11-21), and others are located on chromosomes 2, 9, and 16. The CC chemokines have their first two cysteine residues close together without any amino acid residues between them. Disufide bonds formed between cysteine residue 1 and 3 and between 2 and 4 provide a stable tertiary structure to the chemokine molecules. The C chemokine subfamily consists of a 16-kDa protein XCL1 whose gene is located on chromosome 11. XCL1 has only two cysteine residues (1 and 3) located near the amino terminus. The CX3C chemokine subfamily has a single 38-kDa protein, CX3CL1, whose gene is located on chromosome 16. CX3CL1 has three amino acids between the first two cysteine residues. CC and CXC chemokines are produced by a wide array of cell types. The CC chemokines attract monocytes, dendritic cells, eosinophils, lymphocytes, and NK cells, whereas CXC chemo ines preferentially attract neutrophils besides lymphocytes and NK cells. XCL1 chemokine is produced by NK cells and is chemoattractive for NK cells and T cells. The CXCL1 has a hydrophobic membrane-anchoring motif at its carboxyl terminal, with which the molecule attaches to endothelial cells. Enzymatic cleaving of the amino termini produces a soluble form of CXCL1 that is 80 amino acids long. The soluble form has potent chemotactic activity for T cells, monocytes, and activated NK cells. The membrane bound form helps in the adhesion of these leukocytes to the endothelium. The carboxyl terminus of chemokines possesses a low-affinity heparin-binding property that allows the chemokines to bind to GAG and other negatively charged sugar molecules on the surface of cells and to tissue matrix glycoproteins. This property allows the chemokines to be adsorbed to endothelial surface, connective tissue, and extracellular matrices, where it acts as a focus for attracting cells that roll along the GAG-coated surfaces. Chemokines bind with high affinity to a subfamily of homologous seven-transmembrane G-protein–coupled receptors that constitute the chemokine receptors. As the list of chemokines is expanding, newer receptors are being identified. However, a great majority of chemokines share receptors. Thus, there are six receptors (designated CXCR1 through 6) identified for the CXC subfamily of chemokines, 11 receptors (designated CCR1 through 11) for CC subfamily of receptors, and one receptor each for C chemokines (designated as XCR1) and for CX3C chemokines (designated as CX3CR1). Chemokine receptors are expressed on the surface of leukocytes and are regulated by exogenous and endogenous stimuli. Generally, activated cells express greater number of these receptors than resting cells. Similarly, one cell can express more than one type of receptor, thus
1391_C03.fm Page 67 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
67
Table 3.1 Chemokines and Their Receptors Chemokines
Receptors C — Chemokines
XCL1 (Lymphotactin a) XCL2 (Lymphotactin b)
XCR1 XCR1
CC — Chemokines CCL1 (TCA-3) CCL2 (MCP-1) CCL3 (M1P-1a) CCL4 (MIP-1b) CCL5 (RANTES) CCL6 (C10) CCL7 (MCP-3) CCL8 (MCP-2) CCL9/10 (MIP-1g) CCL11 (Eotaxin) CCL12 (MCP-5) CCL13 (MCP-4) CCL14 (HCC-1) CCL15 (HCC-2) CCL16 (HCC-4) CCL17 (TARC) CCL18 (MIP-4) CCL19 (MIP-3b) CCL20 (MIP-3a) CCL21 (ECkine) CCL22 (MDC) CCL23 (MPIF-1) CCL24 (Eotaxin-2) CCL25 (TECK) CCL26 (Eotaxin-3) CCL27 (CTACK)
CCR8 CCR2, 10, 11 CCR1, 5 CCR5, 8 CCR1, 3, 5, 11 Not identified CCR1, 2, 3, 10, 11 CCR2, 3, 11 CCR1 CCR3 CCR2 CCR2, 3, 11 CCR1 CCR1 Not identified CCR4, 8 Not identified CCR7 CCR6 CCR7 CCR4 CCR1 CCR3 CCR9 CCR3 CCR10 CXC — Chemokines
CXCL1 (GROa) CXCL2 (GROb) CXCL3 (GROg) CXCL4 (PF-4) CXCL5 (ENA-78) CXCL6 (GCP-2) CXCL7 (NAP-2) CXCL8 (IL-8/NAP-1) CXCL9 (MIG) CXCL10 (IP-10) CXCL11 (H174/IP-9) CXCL12 (SDF-1/PBSF) CXCL13 (BLC/BCA-1) CXCL14 (BRAK) CXCL15 (Lungkine)
CXCR1, 2 CXCR2 CXCR2 Not known CXCR2 CXCR1, 2 CXCR2 CXCR1, 2 CXCR3 CXCR3 CXCR3 CXCR4 CXCR4, 5 Not known Not known
CX3C — Chemokine CX3CL1 (Fractalkaine)
CX3CR1
Note: Old names for respective chemokines are in parentheses.
1391_C03.fm Page 68 Tuesday, November 18, 2003 4:54 PM
68
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
having the ability to respond to different chemokines. Signal transduction through chemokine receptors requires an initial coupling with G proteins, a large gene family coding for at least 16 a subunits, four b subunits and multiple g subunits. Uncoupling of G protein inhibits chemokine receptor-mediated responses. Binding of a chemokine to its G-protein coupled receptor initiates the cascade of cell signaling, resulting in an increase in intracellular calcium, actin polymerization, reconfiguration of adhesion proteins, and other cellular responses contributing to cell migration. Many pathogens use the chemokine receptors to their advantage, such as the malaria parasite (Plasmodium vivax), and certain viruses (HIV-1, CMV) use chemokine receptors for entering the cell. Similarly, the human herpes virus up-regulates CXCR2 and binding of CXC to this receptor, which promotes angiogenesis. CXC chemokines can be divided into two groups based on the presence or absence of the amino acid residues Glu-Leu-Arg (ELR) at positions 4, 5, and 6 near the amino termini. This ELR sequence binds to CXCR2 receptors expressed on neutrophils, thus preferentially attracting them to the inflammatory loci. At higher concentrations, these ELR+ chemokines can activate the neutrophils to release oxygen radicals and their granular contents, thus amplifying the inflammatory responses. ELR- chemokines are not chemotactic for neutrophils, but are chemotactic for monocytes and T lymphocytes. Thus, chemokines and their receptors play an important role in both innate and adaptive immune responses.
IV. SUMMARY The immune system is the sentinel that constantly maintains vigilance over the various portals of the body and destroys microbes and foreign molecules or substances that gain access. To perform these functions, the immune system has developed a sophisticated network of cells and complex molecules that interact with the foreign substance or with each other to elicit their functions. There are two principal pathways of defense orchestrated by the immune system. The defense mechanism that functions nonspecifically toward the foreign substance is called the innate immunity, and the defense mechanism reacting very specifically toward the foreign substance is called the adaptive immunity. Participants of innate immunity include phagocytes, neutrophils, NK cells, eosinophils, mast cells, basophils, and complement. These participants are called for action early in the process of an inflammatory/immune response and are thus vital for maintaining health. Molecules and cells that participate in the adaptive immunity are highly adapted for variability. This adaptive property allows them to modify their artillery to suit the need. Participants in the adaptive immune system include B lymphocytes and their specific immunoglobulins and antibodies, T lymphocytes (especially CD4 and CD8 cells), and an extensive network of mediators that includes the cytokines, chemokines, and growth factors. These cells and mediators of adaptive immunity destroy and eliminate foreign molecules and substances. A remarkable feature of adaptive immunity is memory. Both innate and adaptive immunity rely on their ability to recognize and differentiate self from non-self. Dysfunction in this recognition can lead to tolerance, self-destruction, or autoimmunity.
REFERENCES 1. Bos, J.D., The skin as an organ of immunity, Clin. Exp. Immunol., 107, 3, 1997. 2. Bogdan, C. et al. The role of nitric oxide in innate immunity, Immunol. Rev., 173, 17, 2000. 3. Curry, J.L. et al., Innate immune-related receptors in normal and psoriatic skin, Arch. Pathol. Lab. Med., 127, 178, 2003. 4. Gallo, R.L. et al., Biology and clinical relevance of naturally occurring antimicrobial peptides, J. Allergy Clin. Immunol., 110, 823, 2002. 5. Sallenave, J.M., Antimicrobial activity of antiproteinases, Biochem. Soc. Trans., 30, 111, 2002.
1391_C03.fm Page 69 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
69
6. Bos, J.D. et al., Defensins and complement systems from the perspective of skin immunity and autoimmunity, Clin. Dermatol., 19, 563, 2001. 7. Schroder, J.M. and Harder, J., Human beta-defensin-2, Int. J. Biochem. Cell Biol., 31, 645, 1999. 8. Dorschner, R.A. et al., Neonatal skin in mice and humans expresses increased levels of antimicrobial peptides: innate immunity during development of the adaptive response, Pediatr. Res., 53, 566, 2003. 9. Di Nardo, A. et al., Cutting edge: mast cell antimicrobial activity is mediated by expression of cathelicidin antimicrobial peptide, J. Immunol., 170, 2274, 2003. 10. Fellermann, K. et al., Antimicrobial peptides in the skin, N. Engl. J. Med., 348, 361, 2003. 11. Underhill, D.M. and Ozinsky, A., Phagocytosis of microbes: complexity in action, Annu. Rev. Immunol., 20, 825, 2002. 12. Medzhitov, R. and Janeway, C., Jr., Innate immune recognition: mechanisms and pathways, Immunol. Rev., 173, 89, 2000. 13. East, L. and Isacke, C.M., The mannose receptor family, Biochim. Biophys. Acta., 1572, 364, 2002. 14. Apostolopoulos, V. and McKenzie, I.F., Role of the mannose receptor in the immune response, Curr. Mol. Med., 1, 469, 2001. 15. Ehlers, M.R., CR3: a general purpose adhesion-recognition receptor essential for innate immunity, Microb. Infect., 2, 289, 2000. 16. Reichert, F. and Rotshenker, S., Complement-receptor-3 and scavenger-receptor-AI/II mediated myelin phagocytosis in microglia and macrophages, Neurobiol. Dis., 12, 65, 2003. 17. Taborda, C.P. and Casadevall, A., CR3 (CD11b/CD18) and CR4 (CD11c/CD18) are involved in complement-independent antibody-mediated phagocytosis of Cryptococcus neoformans, Immunity, 16, 791, 2002. 18. Le Cabec, V. et al., Complement receptor 3 (CD11b/CD18) mediates type I and type II phagocytosis during nonopsonic and opsonic phagocytosis, respectively, J. Immunol., 169, 2003, 2002. 19. Gough, P.J. and Gordon, S., The role of scavenger receptors in the innate immune system, Microbes Infect., 2, 305, 2000. 20. Heine, H. and Lien, E., Toll-like receptors and their function in innate and adaptive immunity, Int. Arch. Allergy Immunol., 130, 180, 2003. 21. Werling, D. and Jungi, T.W., TOLL-like receptors linking innate and adaptive immune response, Vet. Immunol. Immunopathol., 91, 1, 2003. 22. Barton, G.M. and Medzhitov, R., Toll-like receptors and their ligands, Curr. Top. Microbiol. Immunol., 270, 81, 2002. 23. Takeda, K. and Akira, S., Toll receptors and pathogen resistance, Cell Microbiol., 5, 143, 2003. 24. Dobrovolskaia, M.A. and Vogel, S.N., Toll receptors, CD14, and macrophage activation and deactivation by LPS, Microbes Infect., 4, 903, 2002. 25. Gregory, C.D., CD14-dependent clearance of apoptotic cells: relevance to the immune system, Curr. Opin. Immunol., 12, 27, 2000. 26. Triantafilou, M. and Triantafilou, K., Lipopolysaccharide recognition: CD14, TLRs and the LPSactivation cluster, Trends Immunol., 23, 301, 2002. 27. Aderem, A. and Underhill, D.M., Mechanisms of phagocytosis in macrophages, Annu. Rev. Immunol., 17, 593, 1999. 28. Baldini, M. et al., CD14: an example of gene by environment interaction in allergic disease, Allergy, 57, 188, 2002. 29. Schmitz, G. and Orso, E., CD14 signalling in lipid rafts: new ligands and co-receptors, Curr. Opin. Lipidol., 13, 513, 2002. 30. Geissmann, F. et al., A subset of human dendritic cells expresses IgA Fc receptor (CD89), which mediates internalization and activation upon cross-linking by IgA complexes, J. Immunol., 166, 346, 2001. 31. Allen, L.A., The role of the neutrophil and phagocytosis in infection caused by Helicobacter pylori, Curr. Opin. Infect. Dis., 14, 273, 2001. 32. Burg, N.D. and Pillinger, M.H., The neutrophil: function and regulation in innate and humoral immunity, Clin. Immunol., 99, 7, 2001. 33. Fierer, J., Polymorphonuclear leukocytes and innate immunity to Salmonella infections in mice, Microb. Infect., 3, 1233, 2001.
1391_C03.fm Page 70 Tuesday, November 18, 2003 4:54 PM
70
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
34. Levy, O., A neutrophil-derived anti-infective molecule: bactericidal/permeability-increasing protein, Antimicrob. Agents Chemother., 44, 2925, 2000. 35. Moretta, L. et al., Natural killer cells: a mystery no more, Scand. J. Immunol., 55, 229, 2002. 36. Lieberman, N. and Mandelboim, O., The role of NK cells in innate immunity, Adv. Exp. Med. Biol., 479, 137, 2000. 37. Yokoyama, W.M. and Plougastel, B.F., Immune functions encoded by the natural killer gene complex, Nat. Rev. Immunol., 3, 304, 2003. 38. Boyington, J.C. and Sun, P.D., A structural perspective on MHC class I recognition by killer cell immunoglobulin-like receptors, Mol. Immunol., 38, 1007, 2002. 39. Moretta, A., Natural killer cells and dendritic cells: rendezvous in abused tissues, Nat. Rev. Immunol., 2, 957, 2002. 40. Robertson, M.J., Role of chemokines in the biology of natural killer cells, J. Leukoc. Biol., 71, 173, 2002. 41. Ohteki, T., Critical role for IL-15 in innate immunity, Curr. Mol. Med., 2, 371, 2002. 42. Zitvogel, L., Dendritic and natural killer cells cooperate in the control/switch of innate immunity, J. Exp. Med., 195, F9, 2002. 43. Yokoyama, W.M. and Scalzo, A.A., Natural killer cell activation receptors in innate immunity to infection, Microb. Infect., 4, 1513, 2002. 44. Griffiths, G.M., Endocytosing the death sentence, J. Cell Biol., 160, 155, 2003. 45. Trapani, J.A., Granzymes: a family of lymphocyte granule serine proteases, Genome Biol., 2, 3014, 2001. 46. Van Steensel, M.A. et al., New syndrome of hypotrichosis, striate palmoplantar keratoderma, acroosteolysis and periodontitis not due to mutations in cathepsin C, Br. J. Dermatol., 147, 575, 2002. 47. Robinson, D.S. et al., Eosinophils, Clin. Allergy Immunol., 16, 43, 2002. 48. Gleich, G.J. et al., The biology of the eosinophilic leukocyte, Annu. Rev. Med., 44, 85, 1993. 49. Capron, M. and Goldman, M., The eosinophil, a cell with multiple facets, Therapie, 56, 371, 2001. 50. Plager, D.A. et al., Human eosinophil granule major basic protein and its novel homolog, Allergy, 53, 33, 1998. 51. Wardlaw, A.J., Eosinophils in the 1990s: new perspectives on their role in health and disease, Postgrad. Med. J., 70, 536, 1994. 52. Prussin, C. and Metcalfe, D.D., IgE, mast cells, basophils, and eosinophils, J. Allergy Clin. Immunol., 111, S486, 2003. 53. Abraham, S.N. and Malaviya, R., Mast cells in infection and immunity, Infect. Immun., 65, 3501, 1997. 54. Gurish, M.F. and Boyce, J.A., Mast cell growth, differentiation, and death, Clin. Rev. Allergy Immunol., 22, 107, 2002. 55. Taylor, M.L. and Metcalfe, D.D., Mast cells in allergy and host defense, Allergy Asthma Proc., 22, 115, 2001. 56. Abraham, S.N. and Arock, M., Mast cells and basophils in innate immunity, Semin. Immunol., 10, 373, 1998. 57. Henz, B.M. et al., Mast cells as initiators of immunity and host defense, Exp. Dermatol., 10, 1, 2001. 58. Malaviya, R. and Abraham, S.N., Mast cell modulation of immune responses to bacteria, Immunol. Rev., 179, 16, 2001. 59. Hirji, N.S. et al., Novel CD8 molecule on macrophages and mast cells: expression, function and signaling, Int. Arch. Allergy Immunol., 118, 180, 1999. 60. Arock, M. et al., Phagocytic and tumor necrosis factor alpha response of human mast cells following exposure to gram-negative and gram-positive bacteria, Infect. Immun., 66, 6030, 1998. 61. Varadaradjalou, S. et al., Toll-like receptor 2 (TLR2) and TLR4 differentially activate human mast cells, Eur. J. Immunol., 33, 899, 2003. 62. Kassel, O. et al., The stem cell factor, its properties and potential role in the airways, Pulm. Pharmacol. Ther., 14, 277, 2001. 63. Gnanasekar, M. et al., Molecular characterization of a calcium binding translationally controlled tumor protein homologue from the filarial parasites Brugia malayi and Wuchereria bancrofti, Mol. Biochem. Parasitol., 121, 107, 2002. 64. Rao, K.V. et al., Cloning and characterization of a calcium-binding, histamine-releasing protein from Schistosoma mansoni, J. Biol. Chem., 277, 31207, 2002.
1391_C03.fm Page 71 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
71
65. MacDonald, S.M. et al., Immune mimicry in malaria: Plasmodium falciparum secretes a functional histamine-releasing factor homolog in vitro and in vivo, Proc. Natl. Acad. Sci. U. S. A., 98, 10829, 2001. 66. Charlesworth, E.N., The role of basophils and mast cells in acute and late reactions in the skin, Allergy, 52, 31, 1997. 67. Krishnaswamy, G. et al., The human mast cell: functions in physiology and disease, Front. Biosci., 6, D1109, 2001. 68. Escribano, L. et al., Mastocytosis: current concepts in diagnosis and treatment, Ann. Hematol., 81, 677, 2002. 69. Mastellos, D. and Lambris, J.D., Complement: more than a “guard” against invading pathogens? Trends Immunol., 23, 485, 2002. 70. Gal, P. and Ambrus, G., Structure and function of complement activating enzyme complexes: C1 and MBL-MASPs, Curr. Protein Peptide Sci., 2, 43, 2001. 71. Kishore, U. and Reid, K.B., C1q: structure, function, and receptors, Immunopharmacology, 49, 159, 2000. 72. Kishore, U. et al., Recent progress in the understanding of the structure-function relationships of the globular head regions of C1q, Immunobiology, 205, 355, 2002. 73. Crawford, K. and Alper, C.A., Genetics of the complement system, Rev. Immunogenet., 2, 323, 2000. 74. Dodds, A.W., Which came first, the lectin/classical pathway or the alternative pathway of complement? Immunobiology, 205, 340, 2002. 75. Arlaud, G.J. et al., Structural biology of the C1 complex of complement unveils the mechanisms of its activation and proteolytic activity, Mol. Immunol., 39, 383, 2002. 76. Hajela, K. et al., The biological functions of MBL-associated serine proteases (MASPs), Immunobiology, 205, 467, 2002. 77. Carroll, M.C. and Prodeus, A.P., Linkages of innate and adaptive immunity, Curr. Opin. Immunol., 10, 36, 1998. 78. Esser, M.T. et al., Memory T cells and vaccines, Vaccine, 21, 419, 2003. 79. Galloway, T.S. et al., Regulation of B lymphocytes in health and disease. Meeting review, Mol. Immunol., 39, 649, 2003. 80. Defrance, T. et al., The life and death of a B cell, Adv. Cancer Res., 86, 195, 2002. 81. Cyster, J.G. et al., Traffic patterns of B cells and plasma cells, Adv. Exp. Med. Biol., 512, 35, 2002. 82. Turner, M., B-cell development and antigen receptor signaling, Biochem. Soc. Trans., 30, 812, 2002. 83. Raman, C., CD5, an important regulator of lymphocyte selection and immune tolerance, Immunol. Res., 26, 255, 2002. 84. Boes, M., Role of natural and immune IgM antibodies in immune responses, Mol. Immunol., 37, 1141, 2000. 85. Pike, K.A. and Ratcliffe, M.J., Cell surface immunoglobulin receptors in B cell development, Semin. Immunol., 14, 351, 2002. 86. Brandtzaeg, P., The secretory immunoglobulin system: regulation and biological significance. Focusing on human mammary glands, Adv. Exp. Med. Biol., 503, 1, 2002. 87. Preud'homme, J.L. et al., Structural and functional properties of membrane and secreted IgD, Mol. Immunol., 37, 871, 2000. 88. Vladutiu, A.O., Immunoglobulin D: properties, measurement, and clinical relevance, Clin. Diagn. Lab. Immunol., 7, 131, 2000. 89. Papadea, C. and Check, I.J., Human immunoglobulin G and immunoglobulin G subclasses: biochemical, genetic, and clinical aspects, Crit. Rev. Clin. Lab. Sci., 27, 27, 1989. 90. Ferrante, A. et al., IgG subclass distribution of antibodies to bacterial and viral antigens, Pediatr. Infect. Dis. J., 9, S16, 1990. 91. Clark, M.R., IgG effector mechanisms, Chem. Immunol., 65, 88, 1997. 92. Jefferis, R. and Lund, J., Interaction sites on human IgG-Fc for FcgammaR: current models, Immunol. Lett., 82, 57, 2002. 93. Leynadier, F. et al., Blocking antibodies to inhalant allergens and asthma, Allergy Immunol. (Paris)., 23, 341, 1991. 94. Vercelli, D. et al., To E or not to E? Can an IL-4-induced B cell choose between IgE and IgG4? Int. Arch. Allergy Immunol., 116, 1, 1998.
1391_C03.fm Page 72 Tuesday, November 18, 2003 4:54 PM
72
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
95. Scott, J.R., A review of in-vitro assays for IgG and IgG4 antibodies: concept and potential applications, N. Engl. Reg. Allergy Proc., 8, 385, 1987. 96. van Egmond, M. et al., IgA and the IgA Fc receptor, Trends Immunol., 22, 205, 2001. 97. Rojas, R. and Apodaca, G., Immunoglobulin transport across polarized epithelial cells, Nat. Rev. Mol. Cell Biol., 3, 944, 2002. 98. Phalipon, A. and Corthesy, B., Novel functions of the polymeric Ig receptor: well beyond transport of immunoglobulins, Trends Immunol., 24, 55, 2003. 99. Noguera-Obenza, M. and Cleary, T.G., The role of human milk secretory IgA in protecting infants from bacterial enteritis, Adv. Nutr. Res., 10, 213, 2001. 100. Fagarasan, S. and Honjo, T., Intestinal IgA synthesis: regulation of front-line body defences, Nat. Rev. Immunol., 3, 63, 2003. 101. Pilette, C. et al., Lung mucosal immunity: immunoglobulin-A revisited, Eur. Respir. J., 18, 571, 2001. 102. Zhang, W. et al., Complement in IgA immune-complex-induced neutrophil activation, Biochem. Soc. Trans., 25, 462, 1997. 103. Russell, M.W. et al., IgA antibody as a non-inflammatory regulator of immunity, Biochem. Soc. Trans., 25, 466, 1997. 104. Vercelli, D., Immunoglobulin E and its regulators, Curr. Opin. Allergy Clin. Immunol., 1, 61, 2001. 105. Ebo, D.G. and Stevens, W.J., IgE-mediated food allergy — extensive review of the literature, Acta Clin. Belg., 56, 234, 2001. 106. Heyman, B., IgE-mediated enhancement of antibody responses: the beneficial function of IgE? Allergy, 57, 577, 2002. 107. Novak, N. et al., IgE receptors, Curr. Opin. Immunol., 13, 721, 2001. 108. Ramaswamy, K. et al., Evidence for an interleukin 4-inducible immunoglobulin E uptake and transport mechanism in the intestine, J. Exp. Med., 180, 1793, 1994. 109. Ramaswamy, K. and Befus, D., IgE antibody responses in bronchoalveolar spaces of rats infected with Nippostrongylus brasiliensis, Exp. Parasitol., 76, 23, 1993. 110. Vercelli, D., The regulation of IgE synthesis, Clin. Allergy Immunol., 16, 179, 2002. 111. Papavasiliou, F.N. and Schatz, D.G., Somatic hypermutation of immunoglobulin genes: merging mechanisms for genetic diversity, Cell, 109, S35, 2002. 112. Kinoshita, K. and Honjo, T., Linking class-switch recombination with somatic hypermutation, Nat. Rev. Mol. Cell. Biol., 2, 493, 2001. 113. Stavnezer, J., Immunoglobulin class switching, Curr. Opin. Immunol., 8, 199, 1996. 114. Manis, J.P. et al., Mechanism and control of class-switch recombination, Trends Immunol., 23, 31, 2002. 115. Vercelli, D., Novel insights into class switch recombination, Curr. Opin. Allergy Clin. Immunol., 2, 147, 2002. 116. Zhang, K., Immunoglobulin class switch recombination machinery: progress and challenges, Clin. Immunol., 95, 1, 2000. 117. Kumánovics, A. et al., Genomic organization of the mammalian MHC, Annu. Rev. Immunol., 21, 629, 2003. 118. Seliger, B. et al., HLA-G and MIC expression in tumors and their role in anti-tumor immunity, Trends Immunol., 24, 82, 2003. 119. Rouas-Freiss, N. et al., HLA-G in transplantation: a relevant molecule for inhibition of graft rejection? Am. J. Transplant., 3, 11, 2003. 120. Mach, B. et al., Regulation of MHC class II genes: lessons from a disease, Annu. Rev. Immunol., 14, 301, 1996. 121. Simpson, E. and Roopenian, D., Minor histocompatibility antigens, Curr. Opin. Immunol., 9, 655, 1997. 122. Streilein, J.W. et al., The role of minor histocompatibility alloantigens in penetrating keratoplasty, Dev. Ophthalmol., 36, 74, 2003. 123. Roopenian, D. et al., The immunogenomics of minor histocompatibility antigens, Immunol. Rev., 190, 86, 2002. 124. Falkenburg, J.H. et al., Minor histocompatibility antigens as targets of graft-versus-leukemia reactions, Curr. Opin. Hematol., 9, 497, 2002. 125. Snell, G.D., Recent advances in histocompatibility immunogenetics, Adv. Genet., 20, 291, 1979.
1391_C03.fm Page 73 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
73
126. Ceppellini, R. et al., Experimental allotransplantation in man. I. The role of the HL-A system in different genetic combinations, Transplant. Proc., 1, 385, 1969. 127. Otten, H.G. et al., Prevention of acute graft-versus-host-disease by selective depletion of T cells reactive with minor histocompatibility antigens on epithelial cells, Leuk. Lymphoma, 40, 385, 2001. 128. Simpson, E. et al., Minor H antigens: genes and peptides, Transpl. Immunol., 10, 115, 2002. 129. McDevitt, H.O., Discovering the role of the major histocompatibility complex in the immune response, Annu. Rev. Immunol., 18, 1, 2000. 130. Watts, C., Capture and processing of exogenous antigens for presentation on MHC molecules, Annu. Rev. Immunol., 15, 821, 1997. 131. Rock, K.L. and Goldberg, A.L., Degradation of cell proteins and the generation of MHC class Ipresented peptides, Annu. Rev. Immunol., 17, 739, 1999. 132. Solheim, J.C., Class I MHC molecules: assembly and antigen presentation, Immunol. Rev., 172, 11, 1999. 133. Engelhard, V.H. et al., Insights into antigen processing gained by direct analysis of the naturally processed class I MHC associated peptide repertoire, Mol. Immunol., 39, 127, 2002. 134. Gruhler, A. and Fruh, K., Control of MHC class I traffic from the endoplasmic reticulum by cellular chaperones and viral anti-chaperones, Traffic, 1, 306, 2000. 135. Nepom, G.T., MHC multimers: expanding the clinical toolkit, Clin. Immunol., 106, 1, 2003. 136. Sun, M.Y. and Bowness, P., MHC class I multimers, Arthritis Res., 3, 265, 2001. 137. Kwok, W.W. et al., Use of class II tetramers for identification of CD4+ T cells, J. Immunol. Methods, 268, 71, 2002. 138. Buckner, J.H. et al., Defining antigen-specific responses with human MHC class II tetramers, J. Allergy Clin. Immunol., 110, 199, 2002. 139. Kanitakis, J., Anatomy, histology and immunohistochemistry of normal human skin, Eur. J. Dermatol., 12, 390, 2002. 140. Katz, S.I., The role of Langerhans’ cells in immunity, Arch. Dermatol., 116, 1361, 1980. 141. Carr, M.M. et al., MHC class II antigen expression in normal human epidermis, Immunology, 59, 223, 1986. 142. Cruz, P.D., Jr. and Bergstresser, P.R., Antigen processing and presentation by epidermal Langerhans cells. Induction of immunity or unresponsiveness, Dermatol. Clin., 8, 633, 1990. 143. Gielen, V. et al., HLA class I antigen (heavy and light chain) expression by Langerhans cells and keratinocytes of the normal human epidermis: ultrastructural quantitation using immunogold labelling procedure, Arch. Dermatol. Res., 280, 131, 1988. 144. Cumberbatch, M. et al., Langerhans cell migration, Clin. Exp. Dermatol., 25, 413, 2000. 145. Sallusto, F., Origin and migratory properties of dendritic cells in the skin, Curr. Opin. Allergy Clin. Immunol., 1, 441, 2001. 146. Romani, N. et al., Migration of dendritic cells into lymphatics: the Langerhans cell example: routes, regulation, and relevance, Int. Rev. Cytol., 207, 237, 2001. 147. Pieri, L. et al., Langerhans cells differentiation: a three-act play, Ital. J. Anat. Embryol., 106, 47, 2001. 148. Udey, M.C., Cadherins and Langerhans cell immunobiology, Clin. Exp. Immunol., 107, 6, 1997. 149. Lanzavecchia, A. and Sallusto, F., Regulation of T cell immunity by dendritic cells, Cell, 106, 263, 2001. 150. Lanzavecchia, A., Dendritic cell maturation and generation of immune responses, Haematologica, 84, 23, 1999. 151. Bergstresser, P.R. et al., Dendritic epidermal T cells: lessons from mice for humans, J. Invest. Dermatol., 100, 80S, 1993. 152. Boismenu, R. et al., Molecular and cellular biology of dendritic epidermal T cells, Semin. Immunol., 8, 323, 1996. 153. Kumamoto, T. et al., Recent advances in dendritic cell vaccines for cancer treatment, J. Dermatol., 28, 658, 2001. 154. Chen, D. and Payne, L.G., Targeting epidermal Langerhans cells by epidermal powder immunization, Cell Res., 12, 97, 2002. 155. Hammond, S.A. et al., Transcutaneous immunization: an emerging route of immunization and potent immunostimulation strategy, Crit. Rev. Ther. Drug Carrier Syst., 18, 503, 2001.
1391_C03.fm Page 74 Tuesday, November 18, 2003 4:54 PM
74
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
156. Luger, T.A. et al., Cutaneous immunomodulation and coordination of skin stress responses by alphamelanocyte-stimulating hormone, Ann. N. Y. Acad. Sci., 840, 381, 1998. 157. Starr, T.K. et al., Positive and negative selection of T cells, Annu. Rev. Immunol., 21, 139, 2003. 158. Anton van der Merwe, P. and Davis, S.J., Molecular interaction mediating T cell antigen recognition, Annu. Rev. Immunol., 21, 659, 2003. 159. Guermonprez, P. et al., Antigen presentation and T cell stimulation by dendritic cells, Annu. Rev. Immunol., 20, 621, 2002. 160. Mosmann, T.R. and Coffman, R.L., TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties, Annu. Rev. Immunol., 7, 145, 1989. 161. Romagnani, S., Biology of human TH1 and TH2 cells, J. Clin. Immunol., 15, 121, 1995. 162. Uchi, H. et al., Cytokines and chemokines in the epidermis, J. Dermatol. Sci., 24, S29, 2000. 163. Brierley, M.M. and Fish, E.N., Review: IFN-alpha/beta receptor interactions to biologic outcomes: understanding the circuitry, J. Interferon Cytokine Res., 22, 835, 2002. 164. Deonarain, R. et al., Interferon-alpha/beta-receptor interactions: a complex story unfolding, Curr. Pharm. Design, 8, 2131, 2002. 165. Grossberg, S.E. et al., Interferon receptors and their role in interferon action, Experientia, 45, 508, 1989. 166. Brassard, D.L. et al., Interferon-alpha as an immunotherapeutic protein, J. Leukoc. Biol., 71, 565, 2002. 167. Fitzgerald-Bocarsly, P., Natural interferon-alpha producing cells: the plasmacytoid dendritic cells, Biotechniques, 22 (Suppl. 16–22), 24, 2002. 168. Pestka, S., The human interferon alpha species and receptors, Biopolymers, 55, 254, 2000. 169. Locksley, R.M. et al., The TNF and TNF receptor superfamilies: integrating mammalian biology, Cell, 104, 487, 2001. 170. Zhou, T. et al., Immunobiology of tumor necrosis factor receptor superfamily, Immunol. Res., 26, 323, 2002. 171. Tracey, K.J. and Cerami, A., Tumor necrosis factor: an updated review of its biology, Crit. Care Med., 21, S415, 1993. 172. Wajant, H. et al., Tumor necrosis factor signaling, Cell. Death Differ., 10, 45, 2003. 173. Olsson, I. et al., Tumour necrosis factor (TNF) binding proteins (soluble TNF receptor forms) with possible roles in inflammation and malignancy, Eur. Cytokine Network, 4, 169, 1993. 174. Ryffel, B. and Mihatsch, M.J., TNF receptor distribution in human tissues, Int. Rev. Exp. Pathol., 34, 149, 1993. 175. Cosman, D., A family of ligands for the TNF receptor superfamily, Stem Cells, 12, 440, 1994. 176. Baetu, T.M. and Hiscott, J., On the TRAIL to apoptosis, Cytokine Growth Factor Rev., 13, 199, 2002. 177. Roux-Lombard, P., The interleukin-1 family, Eur. Cytokine Network, 9, 565, 1998. 178. Arend, W.P., The balance between IL-1 and IL-1Ra in disease, Cytokine Growth Factor Rev., 13, 323, 2002. 179. Dinarello, C.A., Interleukin-1 beta, interleukin-18, and the interleukin-1 beta converting enzyme, Ann. N. Y. Acad. Sci., 856, 1, 1998. 180. Daun, J.M. and Fenton, M.J., Interleukin-1/Toll receptor family members: receptor structure and signal transduction pathways, J. Interferon Cytokine Res., 20, 843, 2000. 181. Sims, J.E., IL-1 and IL-18 receptors, and their extended family, Curr. Opin. Immunol., 14, 117, 2002. 182. Fitzgerald, K.A. and O’Neill, L.A., The role of the interleukin-1/toll-like receptor superfamily in inflammation and host defense, Microb. Infect., 2, 933, 2000. 183. Akira, S., The role of IL-18 in innate immunity, Curr. Opin. Immunol., 12, 59, 2000. 184. Dinarello, C.A., Interleukin-18, Methods, 19, 121, 1999. 185. Lebel-Binay, S. et al., Interleukin-18: biological properties and clinical implications, Eur. Cytokine Network, 11, 15, 2000. 186. Lin, J.X. and Leonard, W.J., The role of Stat5a and Stat5b in signaling by IL-2 family cytokines, Oncogene, 19, 2566, 2000. 187. Kuziel, W.A. and Greene, W.C., Interleukin-2 and the IL-2 receptor: new insights into structure and function, J. Invest. Dermatol., 94, 27S, 1990. 188. Nelson, B.H. and Willerford, D.M., Biology of the interleukin-2 receptor, Adv. Immunol., 70, 1, 1998. 189. Semenzato, G. et al., The interleukin-2/interleukin-2 receptor system: structural, immunological, and clinical features, Int. J. Clin. Lab. Res., 22, 133, 1992.
1391_C03.fm Page 75 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
75
190. Sugamura, K. et al., The interleukin-2 receptor gamma chain: its role in the multiple cytokine receptor complex and T cell development in XSCID, Annu. Rev. Immunol., 14, 179, 1996. 191. Schmalstieg, F.C. and Goldman, A.S., Immune consequences of mutations in the human common gamma-chain gene, Mol. Genet. Metab., 76, 163, 2002. 192. Kono, T. et al., The interleukin-2 receptor complex and signal transduction: role of the beta-chain, Semin. Immunol., 5, 299, 1993. 193. Minami, Y. et al., The IL-2 receptor complex: its structure, function, and target genes, Annu. Rev. Immunol., 11, 245, 1993. 194. Di Santo, J.P. et al., Common cytokine receptor gamma chain (gamma c)-dependent cytokines: understanding in vivo functions by gene targeting, Immunol. Rev., 148, 19, 1995. 195. Demoulin, J.B. and Renauld, J.C., Signalling by cytokines interacting with the interleukin-2 receptor gamma chain, Cytokines Cell Mol. Ther., 4, 243, 1998. 196. Gillis, S., Interleukin 2: biology and biochemistry, J. Clin. Immunol., 3, 1, 1983. 197. Smith, K.A., Interleukin-2: Inception, impact, and implications, Science, 240, 1169, 1988. 198. Nelms, K. et al., The IL-4 receptor: Signaling mechanisms and biologic functions, Annu. Rev. Immunol., 17, 701, 1999. 199. Ackermann, L. et al., Staphylococcal enterotoxin B inhibits the production of interleukin-4 in a human mast-cell line HMC-1, Immunology, 94, 247, 1998. 200. Viac, J. et al., Interleukin-4 and interferon-gamma interactions in the induction of intercellular adhesion molecule-1 and major histocompatibility complex class II antigen expression of normal human keratinocytes, Exp. Dermatol., 3, 72, 1994. 201. Zhang, J. et al., IL-4 potentiates activated T Cell apoptosis via an IL-2-dependent mechanism, J. Immunol., 170, 3495, 2003. 202. Schaefer, G. et al., FISP (IL-4-Induced Secreted Protein), a novel cytokine-like molecule secreted by Th2 cells, J. Immunol., 166, 5859, 2001. 203. Appasamy, P.M., Biological and clinical implications of interleukin-7 and lymphopoiesis, Cytokines Cell Mol. Ther., 5, 25, 1999. 204. Moller, P. et al., Interleukin-7. Biology and implications for dermatology, Exp. Dermatol., 5, 129, 1996. 205. Mertsching, E. et al., Interleukin-7, a non-redundant potent cytokine whose over-expression massively perturbs B-lymphopoiesis, Int. Rev. Immunol., 16, 285, 1998. 206. Appasamy, P.M., Interleukin-7: biology and potential clinical applications, Cancer Invest., 11, 487, 1993. 207. Demoulin, J.B. and Renauld, J.C., Interleukin 9 and its receptor: an overview of structure and function, Int. Rev. Immunol., 16, 345, 1998. 208. Soussi-Gounni, A. et al., Role of IL-9 in the pathophysiology of allergic diseases, J. Allergy Clin. Immunol., 107, 575, 2001. 209. Waldmann, T.A., The IL-2/IL-15 receptor systems: targets for immunotherapy, J. Clin. Immunol., 22, 51, 2002. 210. Lodolce, J. et al., Interleukin-15 and the regulation of lymphoid homeostasis, Mol. Immunol., 39, 537, 2002. 211. Waldmann, T.A. and Tagaya, Y., The multifaceted regulation of interleukin-15 expression and the role of the cytokine in NK cell differentiation and host response to intracellular pathogens, Annu. Rev. Immunol., 17, 19, 1999. 212. Weng, N.P. et al., IL-15 is a growth factor and an activator of CD8 memory T cells, Ann. N. Y. Acad. Sci., 975, 46, 2002. 213. Habib, T. et al., The common gamma chain (gamma c) is a required signaling component of the IL-21 receptor and supports IL-21-induced cell proliferation via JAK3, Biochemistry, 41, 8725, 2002. 214. Parrish-Novak, J. et al., Interleukin-21 and the IL-21 receptor: novel effectors of NK and T cell responses, J. Leukoc. Biol., 72, 856, 2002. 215. Strengell, M. et al., IL-21 up-regulates the expression of genes associated with innate immunity and Th1 response, J. Immunol., 169, 3600, 2002. 216. Mehta, D.S. et al., IL-21 Induces the apoptosis of resting and activated primary B cells, J. Immunol., 170, 4111, 2003. 217. Ozaki, K. et al., A critical role for IL-21 in regulating immunoglobulin production, Science, 298, 1630, 2002.
1391_C03.fm Page 76 Tuesday, November 18, 2003 4:54 PM
76
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
218. Guthridge, M.A. et al., Mechanism of activation of the GM-CSF, IL-3, and IL-5 family of receptors, Stem Cells, 16, 301, 1998. 219. Woodcock, J.M. et al., The functional basis of granulocyte-macrophage colony stimulating factor, interleukin-3 and interleukin-5 receptor activation, basic and clinical implications, Int. J. Biochem. Cell Biol., 31, 1017, 1999. 220. Morris, C.F. et al., Molecular and cellular biology of interleukin-3, Immunol. Ser., 49, 177, 1990. 221. Sunderland, M.C. and Roodman, G.D., Interleukin-3. Its biology and potential uses in pediatric hematology/oncology, Am. J. Pediatr. Hematol. Oncol., 13, 414, 1991. 222. Yang, Y.C. and Clark, S.C., Interleukin-3: molecular biology and biologic activities, Hematol. Oncol. Clin. North Am., 3, 441, 1989. 223. Weltman, J.K. and Karim, A.S., IL-5: biology and potential therapeutic applications, Expert Opin. Invest. Drugs, 9, 491, 2000. 224. Lalani, T. et al., Biology of IL-5 in health and disease, Ann. Allergy Asthma Immunol., 82, 317, 1999. 225. Mordvinov, V.A. and Sanderson, C.J., Regulation of IL-5 expression, Arch. Immunol. Ther. Exp (Warsz), 49, 345, 2001. 226. Herbst, B. et al., GM-CSF promotes differentiation of a precursor cell of monocytes and Langerhanstype dendritic cells from CD34+ haemopoietic progenitor cells, Br. J. Haematol., 101, 231, 1998. 227. Nakashima, K. and Taga, T., gp130 and the IL-6 family of cytokines: signaling mechanisms and thrombopoietic activities, Semin. Hematol., 35, 210, 1998. 228. Hirano, T., Interleukin 6 and its receptor: ten years later, Int. Rev. Immunol., 16, 249, 1998. 229. Bravo, J. and Heath, J.K., Receptor recognition by gp130 cytokines, E.M.B.O. J., 19, 2399, 2000. 230. Grotzinger, J. et al., IL-6 type cytokine receptor complexes: hexamer, tetramer or both? Biol. Chem., 380, 803, 1999. 231. Chow, D.C. et al., A structural template for gp130-cytokine signaling assemblies, Biochim. Biophys. Acta., 1592, 225, 2002. 232. Heinrich, P.C. et al., Interleukin-6-type cytokine signalling through the gp130/Jak/STAT pathway, Biochem. J., 334, 297, 1998. 233. Taga, T. and Kishimoto, T., Gp130 and the interleukin-6 family of cytokines, Annu. Rev. Immunol., 15, 797, 1997. 234. Montero-Julian, F.A., The soluble IL-6 receptors: serum levels and biological function, Cell Mol. Biol., 47, 583, 2001. 235. Heymann, D. and Rousselle, A.V., gp130 Cytokine family and bone cells, Cytokine, 12, 1455, 2000. 236. Wollert, K.C. and Drexler, H., The role of interleukin-6 in the failing heart, Heart Fail. Rev., 6, 95, 2001. 237. Leng, S.X. and Elias, J.A., Interleukin-11, Int. J. Biochem. Cell Biol., 29, 1059, 1997. 238. Trepicchio, W.L. and Dorner, A.J., Interleukin-11. A gp130 cytokine, Ann. N. Y. Acad. Sci., 856, 12, 1998. 239. Turner, K.J. et al., The role of recombinant interleukin 11 in megakaryocytopoiesis, Stem Cells, 14, 53, 1996. 240. Knight, D., Leukaemia inhibitory factor (LIF): a cytokine of emerging importance in chronic airway inflammation, Pulm. Pharmacol. Ther., 14, 169, 2001. 241. Bruce, A.G. et al., Oncostatin M, Prog. Growth Factor Res., 4, 157, 1992. 242. Grant, S.L. and Begley, C.G., The oncostatin M signalling pathway: reversing the neoplastic phenotype? Mol. Med. Today, 5, 406, 1999. 243. Miyajima, A. et al., Role of Oncostatin M in hematopoiesis and liver development, Cytokine Growth Factor Rev., 11, 177, 2000. 244. Robb, L. et al., Leukemia inhibitory factor and interleukin-11: cytokines with key roles in implantation, J. Reprod. Immunol., 57, 129, 2002. 245. Lass, A. et al., Leukemia inhibitory factor in human reproduction, Fertil. Steril., 76, 1091, 2001. 246. Gadient, R.A. and Patterson, P.H., Leukemia inhibitory factor, Interleukin 6, and other cytokines using the GP130 transducing receptor: roles in inflammation and injury, Stem Cells, 17, 127, 1999. 247. Gomez-Lechon, M.J., Oncostatin M: signal transduction and biological activity, Life Sci., 65, 2019, 1999. 248. Ip, N.Y., The neurotrophins and neuropoietic cytokines: two families of growth factors acting on neural and hematopoietic cells, Ann. N. Y. Acad. Sci., 840, 97, 1998.
1391_C03.fm Page 77 Tuesday, November 18, 2003 4:54 PM
HUMAN IMMUNE SYSTEM
77
249. Lesser, S.S. and Lo, D.C., CNTF II, I presume? Nat. Neurosci., 3, 851, 2000. 250. Inoue, M. et al., Activating mechanism of CNTF and related cytokines, Mol. Neurobiol., 12, 195, 1996. 251. Latchman, D.S., Cardiotrophin-1: a novel cytokine and its effects in the heart and other tissues, Pharmacol. Ther., 85, 29, 2000. 252. Latchman, D.S., Cardiotrophin-1 (CT-1): a novel hypertrophic and cardioprotective agent, Int. J. Exp. Pathol., 80, 189, 1999. 253. Wollert, K.C. and Chien, K.R., Cardiotrophin-1 and the role of gp130-dependent signaling pathways in cardiac growth and development, J. Mol. Med., 75, 492, 1997. 254. Pennica, D. et al., Cardiotrophin-1: a multifunctional cytokine that signals via LIF receptor-gp 130 dependent pathways, Cytokine Growth Factor Rev., 7, 81, 1996. 255. Baggiolini, M. et al., Neutrophil activation and the effects of interleukin-8/neutrophil-activating peptide 1 (IL-8/NAP-1), Cytokines, 4, 1, 1992. 256. Baggiolini, M. and Clark-Lewis, I., Interleukin-8, a chemotactic and inflammatory cytokine, F.E.B.S. Lett., 307, 97, 1992. 257. Hoffmann, E. et al., Multiple control of interleukin-8 gene expression, J. Leukoc. Biol., 72, 847, 2002. 258. Mukaida, N. and Matsushima, K., Regulation of IL-8 production and the characteristics of the receptors for IL-8, Cytokines, 4, 41, 1992. 259. Shi, Q. et al., Regulation of interleukin-8 expression by tumor-associated stress factors, J. Interferon Cytokine Res., 21, 553, 2001. 260. Xie, K., Interleukin-8 and human cancer biology, Cytokine Growth Factor Rev., 12, 375, 2001. 261. Hay, D.W. and Sarau, H.M., Interleukin-8 receptor antagonists in pulmonary diseases, Curr. Opin. Pharmacol., 1, 242, 2001. 262. Strieter, R.M., Interleukin-8: a very important chemokine of the human airway epithelium, Am. J. Physiol. Lung Cell Mol. Physiol., 283, L688, 2002. 263. Fickenscher, H. et al., The interleukin-10 family of cytokines, Trends Immunol., 23, 89, 2002. 264. Kotenko, S.V., The family of IL-10-related cytokines and their receptors: related, but to what extent? Cytokine Growth Factor Rev., 13, 223, 2002. 265. Sarkar, D. et al., mda-7 (IL-24): signaling and functional roles, Biotechniques, 30 (Suppl. 1), 30, 2002. 266. Brombacher, F. et al., Novel IL-12 family members shed light on the orchestration of Th1 responses, Trends Immunol., 24, 207, 2003. 267. Trinchieri, G., Interleukin-12 and the regulation of innate resistance and adaptive immunity, Nat. Rev. Immunol., 3, 133, 2003. 268. Frucht, D.M., IL-23: a cytokine that acts on memory T cells, Sci. S.T.K.E., 2002, 114, 2002. 269. Pflanz, S. et al., IL-27, a heterodimeric cytokine composed of EBI3 and p28 protein, induces proliferation of naive CD4(+) T cells, Immunity, 16, 779, 2002. 270. Hershey, G.K., IL-13 receptors and signaling pathways: an evolving web, J. Allergy Clin. Immunol., 111, 677, 2003. 271. Zheng, T. et al., Cytokine regulation of IL-13Ralpha2 and IL-13Ralpha1 in vivo and in vitro, J. Allergy Clin. Immunol., 111, 720, 2003. 272. Ford, R. et al., Identification of B-cell growth factors (interleukin-14; high molecular weight-B-cell growth factors) in effusion fluids from patients with aggressive B-cell lymphomas, Blood, 86, 283, 1995. 273. Ambrus, J.L., Jr. et al., A Potential Role for PGE and IL-14 (HMW-BCGF) in B-Cell Hyperactivity of Patients with Systemic Lupus Erythematosus, Am. J. Ther., 2, 933, 1995. 274. Center, D.M. et al., Interleukin-16, Int. J. Biochem. Cell Biol., 29, 1231, 1997. 275. Cruikshank, W.W. et al., Interleukin-16, J. Leukoc. Biol., 67, 757, 2000. 276. Center, D.M. et al., Interleukin 16: implications for CD4 functions and HIV-1 progression, Immunol. Today, 21, 273, 2000. 277. Kornfeld, H. and Cruikshank, W.W., Prospects for IL-16 in the treatment of AIDS, Expert Opin. Biol. Ther., 1, 425, 2001. 278. Little, F.F. et al., Immunomodulatory effect of interleukin-16 on allergic airway inflammation, Chest, 123, 431S, 2003. 279. Albanesi, C. et al., IL-17 is produced by nickel-specific T lymphocytes and regulates ICAM-1 expression and chemokine production in human keratinocytes: synergistic or antagonist effects with IFN-gamma and TNF-alpha, J. Immunol., 162, 494, 1999.
1391_C03.fm Page 78 Tuesday, November 18, 2003 4:54 PM
78
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
280. Fossiez, F. et al., Interleukin-17, Int. Rev. Immunol., 16, 541, 1998. 281. Miossec, P., Interleukin-17 in rheumatoid arthritis: if T cells were to contribute to inflammation and destruction through synergy, Arthritis Rheum., 48, 594, 2003. 282. Laan, M. and Linden. A., IL-17 as a potential target for modulating airway neutrophilia, Curr. Pharmacol. Design, 8, 1855, 2002. 283. Aggarwal, S. and Gurney, A.L., IL-17: prototype member of an emerging cytokine family, J. Leukoc. Biol., 71, 1, 2002. 284. Hurst, S.D. et al., New IL-17 family members promote Th1 or Th2 responses in the lung: in vivo function of the novel cytokine IL-25, J. Immunol., 169, 443, 2002. 285. Ikeda, K. et al., Mast cells produce interleukin-25 upon Fcepsilon RI-mediated activation, Blood, 101, 3594, 2003. 286. Fort, M.M. et al., IL-25 induces IL-4, IL-5, and IL-13 and Th2-associated pathologies in vivo, Immunity, 15, 985, 2001. 287. Sheppard, P. et al., IL-28, IL-29 and their class II cytokine receptor IL-28R, Nat. Immunol., 4, 63, 2003. 288. Dhainaut, J.F. et al., Transforming growth factor-beta: A mediator of cell regulation in acute respiratory distress syndrome, Crit. Care Med., 31, S258, 2003. 289. Heldin, C.H. and Westermark, B., Mechanism of action and in vivo role of platelet-derived growth factor, Physiol. Rev., 79, 1283, 1999. 290. Wada, K. et al., Gastric epithelial cells secrete a PDGF-like peptide, a potent mitogen for human gastric fibroblasts, Proc. Soc. Exp. Biol. Med., 217, 109, 1998. 291. Matsukawa, A. et al., Chemokines and innate immunity, Rev. Immunogenet., 2, 339, 2000.
1391_C04.fm Page 79 Tuesday, November 18, 2003 4:58 PM
CHAPTER
4
Canine Immune System Bruce Hammerberg
CONTENTS I. II. III. IV. V.
Introduction ..........................................................................................................................79 Major Histocompatibility Complex (MHC) ........................................................................80 Complement System ............................................................................................................80 Antibodies ............................................................................................................................81 Immune Cells .......................................................................................................................82 A. Mast Cells ....................................................................................................................82 B. Neutrophils...................................................................................................................82 C. Lymphocytes ................................................................................................................83 D. Dendritic Cells .............................................................................................................84 VI. Cytokines and Chemokines .................................................................................................84 References ........................................................................................................................................85
I. INTRODUCTION Distinct from conventional laboratory animal models, the characterization of the canine immune system has been driven in large part by a need to understand the pathogenesis and develop effective therapies for naturally occurring diseases in the dog, in addition to the need to find research models for the human immune system. This is true for antibody production, the complement system, immune cells, cytokines and chemokines. Consequently, where functionality of the canine and human immune systems is coincidental, this has been discovered because of identical or very similar pathogenic mechanisms in naturally occurring diseases. The power of this type of discovery is in its ability to allow manipulation of a complex natural process to instruct rather than depending upon the preconceptions of how the researcher may think a pathogenic mechanism may be functioning to create a complex disease model. This is particularly important for the complex disease processes considered in this review.
0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
79
1391_C04.fm Page 80 Tuesday, November 18, 2003 4:58 PM
80
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
II. MAJOR HISTOCOMPATIBILITY COMPLEX (MHC) Characterization of the dog MHC, or dog leukocyte antigen (DLA) as it is officially referred to by the International Society for Animal Genetics (ISAG) [1], was begun more than 25 years ago [2] and has been vigorously pursued primarily by researchers using the dog as a model for transplantation studies. In the last 15 years much progress has been made and earlier serological study results have been recently correlated, where possible, with sequence data [1]. Four complete canine class II genes have been characterized: DLA-DRA1 [3], DLA-DQA1 [4], DLA-DRB1 [5], and DLA-DQB1 [6]. More recently, four complete class I genes have been sequenced and characterized with regard to polymorphism: DLA-12, DLA-79, DLA-88, and DLA-64 [7,8]. Even though the DLA has been characterized primarily for transplantation research, just as in humans and mice the functions of MHC class I and II are associated with the immune system, including the recognition of self- and non-self antigens. This function makes MHC important to autoimmune and infectious diseases. The organization of the canine major histocompatibility complex and a comparison to human MHC has been reviewed by Wagner et al. [9]. As with human class I molecules, HLA-A, HLA-B, and HLA-C, the dog DLA-A molecules are typical of class I in their noncovalent association with b2 microglobulin. Although the tissue distribution and function of DLA class I genes are not yet known, it can be inferred from other species that DLA class I surface proteins could be the targets of cytotoxic T lymphocytes [9]. In contrast to class I genes in families that have independently come about in various mammalian orders, the class II genes are highly conserved and analogies exist between human and canine [9]. Thus, names are shared between canine and human analogous genes of class II. Even though class II molecules are presented on antigen-presenting cells as part of their well known function in antigen processing, one very interesting difference between human and canine class II gene expression is that almost all canine T lymphocytes in peripheral circulation express class II antigens, whereas human T lymphocytes display this molecule only after activation [10]. Similarly, many other mammals, such as the horse [11], pig [12], and dolphin [13] also express class II molecules on nonactivated lymphocytes. The role of MHC genes in human familial systemic lupus erythematosus (SLE) has yet to be defined because of suspected multiple gene contribution and environmental stimuli [14]. Naturally occurring canine SLE has an association with DLA-A7 [15], and dogs share many of the same habitat stimuli as their human owners. Manipulation of these stimuli in dogs with high risk of SLE may reveal important clues to identifying environmental stimuli in susceptible populations. Naturally occurring immunopathological diseases in dogs are potentially important models for the identification of MHC ancestral haplotypes (AHs) recently suggested to be associated with these diseases in humans. Ancestral haplotypes are defined by their high degree of conservation and combinations of alleles at multiple loci that are strongly associated with immunopathological diseases [16]. One of these haplotypes, designated as 8.1, includes the genes HLA-A1, CW7, B8, BfS, C4AQ0, C4B1, DR3, and DQ2. AH 8.1 is associated with several immunopathological diseases including SLE [17] and dermatitis herpetiformis [18]. Do AHs exist in dogs that are associated with immunopathological diseases as in humans?
III. COMPLEMENT SYSTEM Early-stage second and fourth components of the complement cascade, C2 and C4, have loci within the MHC and are associated with human familial autoimmune diseases [19] and may be similarly associated in canine familial autoimmunity [15,20], including SLE. No genetic deficiency of C2 or C4 has been described in dogs to date; however, there is one report of statistically lower levels of C2 in collie breed dogs compared to noncollie breeds [21]. Canine C4 is polymorphic with eight electrophoretically detectable variants and an additional three allotypes due in part to
1391_C04.fm Page 81 Tuesday, November 18, 2003 4:58 PM
CANINE IMMUNE SYSTEM
81
neutral sugar variations in the a chain and microheterogeneity in the g chain [22]. Although no disease manifestation has been associated with C2 variation in dogs, there is a reported association of C4 phenotype 4 with idiopathic cardiomyopathy where 30% of the affected dogs had antimitochondrial antibody and 47% had serum antinuclear antibody [23]. The roles of C2 and C4 deficiencies or abnormal function in human autoimmune disease pathogenesis are not known, but it is suggested that C4 binding to immune complexes inhibits formation of insoluble forms of these complexes [24]. Complement protein C3 has been described in all vertebrate animals and as early in the phylogenetic tree as deuterostomes such as sea urchins [25]. Its function is innate resistance and greatly predates the appearance of adaptive immunity in evolutionary development. C3 is converted to opsonic and chemotactic forms by serine protease activity, which can be generated by the classical pathway cascade through C1, C2, and C4, by the alternative pathway using the C3 convertase activity of factor B or by the mannose-binding lectin (MBL) pathway–associated proteases [26]. C3-activated forms can be detected where immune complexes, certain foreign elements, or MBL binding are present in tissues, and this is used as an indicator of pathological changes. Although C3 localization in tissues is widely used as an indicator of pathological change, the role of C3 in pathogenesis is the result of a balance between its role in clearance and processing of immune complexes and its inflammatory activities [27]. The only naturally occurring nonhuman, complete C3 deficiency reported to date is in a colony of Brittany spaniel dogs [28]. This deficiency is the consequence of a deletion of a cytosine at position 2136 resulting in a stop codon 11 amino acids downstream from codon 712 [29]. These dogs demonstrated increased frequency of bacterial infections [30] and type I membranoproliferative glomerulonephritis [31]. The complexity of C3 involvement in pathogenesis is illustrated by the observation that the renal disease associated with C3 deficiency was made worse when C3deficient dogs were given normal plasma to replace C3 [31]. Canine C3-cDNA sequence alignment with human sequences demonstrated that the regions most critical for C3 function and post-translational changes are highly conserved between dog and human [29]. Deficiencies and polymorphisms of individual complement proteins in the dog are well characterized and provide avenues to discovering insights about the complex balance between complement roles of homeostasis and inflammatory response.
IV. ANTIBODIES Characterization of canine immunoglobulins was initiated by Patterson et al. [32–37] in the early 1960s partly because of interest in the dog as a model for allergic disease due to its naturally occurring pollen sensitivity [33,34,37]. A systematic approach to characterize dog immunoglobulins with rabbit antisera and physicochemical separation by molecular weight and charge and electrophoretic mobility demonstrated three major and one minor gamma-migrating subclasses of IgG, as well as subclasses that were analogous to human IgM and IgA [38,39]. Initial evidence for canine reagenic antibody, obtained from clinically seasonal allergic dogs, being analogous to human IgE was presented by Patterson et al. [36] and this subclass was further characterized as analogous to human IgE by Halliwell et al. [40,41]. Serum, colostral, and fecal levels of canine IgGa and IgGb, which could be recognized as immunologically distinct proteins but not separable, IgGc, IgGd (IgG1g), IgA, and IgM were done by Reynolds and Johnson [42] using radial immunodiffusion. Subsequent publications used corresponding designations as follows: IgGa = IgG2a, IgGb = IgG2b, IgGc = IgG2c, IgGd (7Sg1) = IgG1. More recently, monoclonal antibodies have been developed against four subclasses of canine IgG separated on the basis of binding to protein A and protein G [43,44]. These reagents were used to rename the IgG subclasses and relate them to human IgG subclasses based on serum levels and electrophoretic migration. Thus, as with humans, canine IgG2 and IgG4 migrate anodally, canine
1391_C04.fm Page 82 Tuesday, November 18, 2003 4:58 PM
82
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
IgG1 and IgG3 migrate cathodally; and, canine IgG1 and IgG2 occur at higher levels in normal dog serum than IgG3 and IgG4 [44,45]. Further characterization of these canine IgG subclasses has not been reported with regard to complement fixing and opsonic activity, nor has there been any association of these subclasses with polar T-helper cytokine profiles that currently link production of human IgG1 and IgG3 with IL-10 and IgG4 with IL-4 and IL-13 [46]. Major progress toward affirming the presence of four different canine immunoglobulin g chains was made by sequence analysis of cDNA from spleen cells and lymphoma cells that demonstrated much similarity in CH1, CH2 and CH3 domains but great distinction in hinge region sequences [47]. Three of four primers specific to canine IgG hinge region sequences demonstrated detection of IgG g chain mRNA expression by peripheral blood mononuclear cells. Because there was a higher degree of sequence homology within species than between species comparing dog with human and mouse the designation of IgG A–D was used instead of IgG 1–4. The relationship of the hinge region differences to monoclonal antibody–defined subclasses may be possible if those monoclonal antibodies made against Fab fragments happen to be specific for hinge region epitopes. Derived amino-acid sequence analysis of canine IgG subclasses and studies of canine myeloma IgG proteins should shed light on the functional requirements for opsonic, complement fixing and FcgRII-binding activities across species and identify tertiary structures essential for these functions. One recent application of knowing the derived amino-acid sequence of canine IgE and having canine IgE available from a heterohybridoma was the development of a peptide vaccine that induced nonanaphylactoic, autoantibodies against IgE that greatly reduced serum IgE levels in immunized dogs [48]. Heterohybridomas resulting from the fusion of mouse myeloma cells with canine B cells specific for filarial nematode antigens have been produced that yield monoclonal canine IgG from stable cell lines [49]. These monoclonal canine IgGs have yet to be characterized regarding function, nor has the IgG cDNA from the cell lines been sequenced.
V. IMMUNE CELLS A. Mast Cells The field of immune cell function in pathogenesis has benefited much from studies using canine in vitro and in vivo approaches. The most valuable and often pathbreaking work has involved canine mast cells and neutrophils. Some of the earliest mast cell lines of mammals to be studied were developed from canine mastocytomas [50–52]. These cell lines are valuable for having fully functional high-affinity receptors for IgE [51], 2 decades of work have characterized a vast array of canine mast cell line cell-derived inflammatory mediators [53–56]. The availability of canine mast cells lines and a heteromyeloma-derived canine IgE of known allergen specificity [49] greatly facilitate the study of spontaneous allergic diseases in dogs that closely parallel like diseases in humans [57–59]. In addition, the complexity of the mast cell heterogeneity and its relationship to tissue location is well documented for the dog by the comprehensive histochemical study of Kube et al. [60]. B. Neutrophils Similarly, although not to the same degree, the function of canine neutrophils have been studied for their role in acute inflammatory disease, and most importantly in the canine cardiac reperfusion injury model [61]. From this work, much is known about canine neutrophil responses to chemokine factors and integrins [62–69], and the canine model has demonstrated the role that neutrophilderived inflammatory mediators play in cardiac transplantation medicine. Transfer of what has been
1391_C04.fm Page 83 Tuesday, November 18, 2003 4:58 PM
CANINE IMMUNE SYSTEM
83
learned about canine neutrophil activity in heart, lung, and liver pathogenesis to dermal pathogenesis may suggest new roles for neutrophils in the pathogenesis of dermatitis. Many studies have focused on the role of the surface complement CR3 receptor CD11b/CD18 (Mac-1) in activation and adhesion of canine neutrophils, but most recently the respiratory burst response of neutrophils interacting with the intercellular adhesion molecule-1 (ICAM-1 or CD54) was found to involve both CD11b/CD18 and the lymphocyte function–associated antigen-1 (LFA-1 or CD11a/CD18); the former requires chemotactic stimulation and the latter not [70]. Canine neutrophil priming and function has been demonstrated to be enhanced by pituitary growth hormone, as in humans, and this connection between immune and neuroendocrine systems [71] should not be overlooked in experimental design. Finally, canine leukocyte adhesion deficiency (CLAD) has been described in Irish setters and shown to be the result of a single missense mutation of a crucial cysteine residue in the beta-2 integrin gene encoding the CD18 subunit [72,73]. C. Lymphocytes Regarding lymphocytes, the classic subsets of B cells, CD3+ T helper cells (distinguished by CD4 and CD8, and cytokine production profiles) and NK cells are well characterized in the dog. Several studies have been conducted to find cross-reactive antihuman leukocyte monoclonal antibodies that react with canine cells [74–76]. Brodersen et al. [77] surveyed 213 monoclonal antibodies and reviewed previously published findings on cross-reactive antibodies. Important to the function of T cells in responding to antigen-specific stimulatory signals from antigen-presenting cells are the co-stimulatory molecules CD28 and CTL-4. The balance of signals from CD28 and CTL-4 following binding with B7 (CD80) and B7-2 (CD86) determine whether the T-cell response is anergic (absence of CD28 signal), or potentiates autoimmunity (absence of CTL-4) or an appropriate protective immune response (early CD28 signaling followed by CTL-4 signals) [78]. The cDNA that encodes the full length of the canine CD28 molecule has been cloned and sequenced [79]. Both nucleic acid and derived amino acid sequences show about 80% homology with human CD28, and the hexapeptide motif, MYPPPY, inside the “V”-like domain is identical with human CD28 and a similar site in the published sequence of canine CTL-4 (GenBank accession number AF143204). Although canine CD80 and CD86 have been sequenced, and m-RNA expression for membrane-bound and secreted forms have been demonstrated to occur in peripheral blood mononuclear cells (PBMC) [80], the corresponding proteins have yet to be identified on cells or in serum. In a survey of commercially available anti-human leukocyte monoclonal antibodies by Lilliehook et al. [81], it was found that surface glycoproteins of canine granulocytes, including neutrophils and eosinophils, are recognized by monoclonal antibodies specific for human CD11b, CD18, and CD49d. Neutrophils, but not eosinophils, are recognized by antibodies specific for CD16 and CD32. Anti-CD9 demonstrated no binding to neutrophils but bound to a subset of eosinophils from four of seven dogs. These cross-reactive monoclonal antibodies identify cell adhesion and Fcg-receptors as follows: CD11b and CD18 are adhesion molecules, CD49d and CD29 make up the very late activation antigen 4 (VLA-4), and CD16 and CD32 are Fcg-receptors. Thus, it appears that surface molecules delineating granulocytes are more highly conserved than those of lymphocytes among mammals [81]. Early life age-related changes in canine PBMC neutrophil:lymphocyte ratios and in subsets of lymphocytes identified by CD3, CD4, CD8, CD21, and gd-TCR were recently reported [82,83]. Total lymphocyte counts were markedly higher in dogs under 2 months of age compared to adults and this was reflected in neutrophil/lymphocyte ratios of 1:1.5 compared to 2.4 for adults. The percentage of CD8 positive cells increased from very low levels at birth of about 3% to 10% to 14% at 1 to 3 months of age before obtaining near 20% as adults in beagles. In this same group of dogs, B cells identified by CD21 decreased from levels between 30% and 40% at 2 months. In breeds comparing beagles, dachshunds, German shepherds, and dalmatians; for example, dalmatians
1391_C04.fm Page 84 Tuesday, November 18, 2003 4:58 PM
84
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
showed the lowest percentage of CD3 positive cells with the lowest CD4/CD8 ratio and the highest percentage of CD21 positive cells, and these values were significantly different from beagles. D. Dendritic Cells Dendritic cells (DCs), as described in humans and mice, exist as several distinguishable types based on phenotype, function, and location in tissues [84]. This heterogeneity is thought to be due to both lineage differences and maturational stages, such that lymphoid [85] and myeloid lineages [86,87] have been described that produce cells found to be phenotypically different based on tissue location [88]. These differences are also reflected in cell function where the CD11c- lymphoid lineage, or plasmocytoid DCs, produce alpha interferon (IFN-a) and limited amounts of IL-12, in contrast to myeloid lineage cells that can be subdivided into dermal or interstitial DCs and Langerhans cell (LC)–derived DCs and that do produce IL-12 but no IFN-a [88]. Within the human myeloid lineage, dermal DCs produce IL-10 whereas LC-derived DCs do not [89]. Canine dendritic cells from peripheral blood were distinguished as a subset of immune stimulatory cells distinct from monocytes as early as 1985 [90,91]. Cells of similar morphology, called veiled cells, were found in lymph drainage from skin [92] and these cells were further characterized as being antigen-presenting cells [93]. As with human DCs, and unlike rodent DCs, canine cells can express the high-affinity receptor for IgE and the group I CD1 surface glycoproteins, CD1a and CD1c, as shown in the dermis and epidermis [94] and in peripheral blood [95]. The lack of group I CD1 in mice makes extrapolations of DC function from mice to human difficult given the demonstrated importance of this group of surface molecules in immune responses [96]. Thus, the dog would appear not to suffer from this potential defect as a model for human immune-mediated diseases. In addition, the importance of the canine model for studies of DC function has been enhanced by the demonstration that DC populations can be expanded ex vivo from bone marrow cells by treatments with Fms-like tyrosine-kinase receptor 3 ligand (Flt3L), granulocyte/macrophage colonystimulating factor (GM-CSF), and tumor necrosis factor-alpha (TNF-a) [97]. More recently, DCs have been generated from canine PBMC by culture with Flt-3L, GM-CSF, and interleukin-4 (IL-4) [98].
VI. CYTOKINES AND CHEMOKINES As noted above in the review of canine neutrophils, much of the data regarding canine chemokines derive from studies of cardiac reprefusion done in dogs. Thus, the m-RNA expression of the CC chemokine CCL2 (MCP)-1 [99], and more recently CXCL 10 or IP-10 [100], have been measured in endothelial cells of various tissues where infiltrates of mononuclear leukocytes have been observed in response to various inflammatory stimuli. CCL2 expression in reperfused canine heart-venule endothelium has been found to be closely associated with concentrations of reactive oxygen intermediates and inhibitable with antioxidants [101]. An indication of the shifting application of canine chemokine reagents from modeling of transplantation and cardiac research to that of spontaneous allergic disease research in the dog is the recent report of thymus and activationregulated, chemokine (TARC) m-RNA expression in lesional skin during atopic dermatitis manifestation [102]. The lack of reagents for detecting and measuring canine cytokines has been a major barrier to the fulfillment of the potential for learning from naturally occurring canine analogues to human diseases. This barrier is being removed rapidly by the application of molecular biology to the development of canine-specific reagents, and the systematic discovery of many human-specific reagents that cross-react with canine cytokines having a high degree of homology with human counterparts.
1391_C04.fm Page 85 Tuesday, November 18, 2003 4:58 PM
CANINE IMMUNE SYSTEM
85
Thus, a recent survey of commercially available monoclonal antibodies (mAb) made against a variety of human and animal cytokines reported cross-reactivity for canine IL-8, IL-4, and IFN-g determined by flow cytometric staining of canine PBMC intracellular cytokines [103]. Even where cross-reactive mAb reagents may be lacking, it is likely that bioassay systems will be functional in cross-reactive assays, as indicated from a survey of 47 cytokines known to cross-react with cells from another species. In this survey, species biological cross-reactivity occurred when cytokine amino-acid sequence identity between two species was above 60% [104]. Because of the often highly conserved nature of many cytokines between dog and human, it has been possible to use consensus sequences, sometimes degenerate, in polymerase chain reaction (PCR) detection of mRNA expression. Thus, commercially available services for the detection of canine IL-1b, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12 p35, IL-12 p40, GM-CSF, TNF-a, TNF-b, IFNg and IFN-a can be found at the University of California, Davis TaqMan‚ Service (www.vetmed.ucdavis.edu/vme/taqmanservice). Additionally, the measurement of expression of canine IL-5 mRNA has been reported in comparison of AD lesional and nonlesional skin from dogs [105] and recently canine IL-5 has been expressed as a biologically active recombinant protein [106]. Other canine cytokines that have been expressed as biologically active recombinant proteins include IL13 [107], and IL-4, IL-10, and IFN-g (available from R&D Systems, Inc. at www.RnDSystems.com). As the sequences of canine cytokines become available there are likely to be important observations to be made in how amino acid sequence relates to function in the parallel pathogenesis of disease between dog and human. One example of this may be in the sequence polymorphism of IL-13 in humans where it has been reported that a substitution of the amide amino acid, glutamine, for the base amino acid, arginine, at position 130 is associated with elevated serum total IgE and allergen-specific IgE [108]. An analysis of the amino acid sequence of canine IL-13, having 61.8% identity with human IL-13, that was derived from a cDNA library of canine PBMC [109] showed that at position 130 this canine IL-13 contained the amide amino acid, asparagine. It is not known to what degree there is polymorphism in canine IL-13 or at what frequency asparagine is present at this position. However, it would be interesting to know if the relatively high level of serum IgE often reported for dogs [110,111] could be associated with an amino acid polymorphism at IL-13 position 130 similar to that in humans.
REFERENCES 1. Kennedy, L.J. et al., Nomenclature for factors of the dog major histocompatibility system (DLA), 1998: First report of the ISAG DLA Nomenclature Committee, Anim. Genet., 31, 52, 2000. 2. Vriesendorp, H.M. et al., Joint report of 1st International Workshop on Canine Immunogenetics, Tissue Antigens, 3, 145, 1973. 3. Wagner, J.L. et al., Nucleotide sequence and polymorphism analysis of canine DRA cDNA clones, Tissue Antigens, 45, 284, 1995. 4. Wagner, J.L. et al., Molecular analysis and polymorphism of the DLA-DQA gene, Tissue Antigens, 48, 199, 1996. 5. Wagner, J.L., Burnett, R.C., and Storb, R., Molecular analysis of the DLA DR region, Tissue Antigens, 48, 549, 1996. 6. Wagner, J.L. et al., Molecular analysis and polymorphism of the DLA-DQB genes, Tissue Antigens, 52, 242, 1998. 7. Burnett, R.C. et al., Molecular analysis of six dog leukocyte antigen class I sequences including three complete genes, two truncated genes and one full-length processed gene, Tissue Antigens, 49, 484, 1997. 8. Graumann, M.B. et al., Polymorphism analysis of four canine MHC class I genes, Tissue Antigens, 51 (4 Pt 1), 374, 1998.
1391_C04.fm Page 86 Tuesday, November 18, 2003 4:58 PM
86
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
9. Wagner, J.L., Burnett, R.C., and Storb, R., Organization of the canine major histocompatibility complex: current perspectives, J. Hered., 90, 35, 1999. 10. Doxiadis, I. et al., Biochemical evidence that the DLA-B locus codes for a class II determinant expressed on all canine peripheral blood lymphocytes, Exp. Clin. Immunogenet., 6, 219, 1989. 11. Crepaldi, T. et al., Equine T lymphocytes express MHC class II antigens, J. Immunogenet., 13, 349, 1986. 12. Saalmuller, A., Weiland, F., and Reddehase, M.J., Resting porcine T lymphocytes expressing class II major histocompatibility antigen, Immunobiology, 183, 102, 1991. 13. Romano, T.A., Ridgway, S.H., and Quaranta, V., MHC class II molecules and immunoglobulins on peripheral blood lymphocytes of the bottlenosed dolphin, Tursiops truncatus, J. Exp. Zool., 263, 96, 1992. 14. Eroglu, G.E. and Kohler, P.F., Familial systemic lupus erythematosus: the role of genetic and environmental factors, Ann. Rheum. Dis., 61, 29, 2002. 15. Teichner, M. et al., Systemic lupus erythematosus in dogs: association to the major histocompatibility complex class I antigen DLA-A7, Clin. Immunol. Immunopathol., 55, 255, 1990. 16. Price, P. et al., The genetic basis for the association of the 8.1 ancestral haplotype (A1, B8, DR3) with multiple immunopathological diseases, Immunol. Rev., 167, 257, 1999. 17. Christiansen, F.T. et al., Major histocompatibility complex (MHC) complement deficiency, ancestral haplotypes and systemic lupus erythematosus (SLE): C4 deficiency explains some but not all of the influence of the MHC, J. Rheumatol., 18, 1350, 1991. 18. Wilson, A.G. et al., Comparative genetic association of human leukocyte antigen class II and tumor necrosis factor-alpha with dermatitis herpetiformis, J. Invest. Dermatol., 104, 856, 1995. 19. Dawkins, R.L. et al., Disease associations with complotypes, supratypes and haplotypes, Immunol. Rev., 70, 1, 1983. 20. Day, M.J. and Penhale, W.J., A review of major histocompatibility complex-disease associations in man and dog, Vet. Res. Commun., 11, 119, 1987. 21. Hargis, A.M. et al., Complement levels in dogs with familial canine dermatomyositis, Vet. Immunol. Immunopathol., 20, 95, 1988. 22. Doxiadis, G. et al., Statement on the nomenclature of dog C4 allotypes, Immunogenetics, 25, 167, 1987. 23. Day, M.J., Inheritance of serum autoantibody, reduced serum IgA and autoimmune disease in a canine breeding colony, Vet. Immunol. Immunopathol., 53, 207, 1996. 24. Schifferli, J.A., Ng, Y.C., and Peters, D.K., The role of complement and its receptor in the elimination of immune complexes, N. Engl. J. Med., 315, 488, 1986. 25. Nonaka, M., Evolution of the complement system, Curr. Opin. Immunol., 13, 69, 2001. 26. Sato, T. et al., Molecular characterization of a novel serine protease involved in activation of the complement system by mannose-binding protein, Int. Immunol., 6, 665, 1994. 27. Winkelstein, J.A., Sullivan, K.E., and Colten, H.R., Genetically determined disorders of the complement system., in The Metabolic and Molecular Basis of Inherited Disease, Scriver, C.R. et al., Eds., McGraw-Hill, New York, 1995, p. 3911. 28. Winkelstein, J.A. et al., Genetically determined deficiency of the third component of complement in the dog, Science, 212, 1169, 1981. 29. Ameratunga, R. et al., Molecular analysis of the third component of canine complement (C3) and identification of the mutation responsible for hereditary canine C3 deficiency, J. Immunol., 160, 2824, 1998. 30. Blum, J.R. et al., The clinical manifestations of a genetically determined deficiency of the third component of complement in the dog, Clin. Immunol. Immunopathol., 34, 304, 1985. 31. Cork, L.L.C. et al., Membranoproliferative glomerulonephritis in dogs with a genetically determined deficiency of the third component of complement, Clin. Immunol. Immunopathol., 60, 455, 1991. 32. Patterson, R., Chang, W.W.Y., and Pruzansky, J.J., Some characteristics of canine precipitating and non-precipitating antibody, Immunology, 7, 150, 1964. 33. Patterson, R. et al., The immunologic resonse of dogs to soluble protein antigens., J. Immunol., 91, 129, 1963. 34. Patterson, R., Pruzansky, J.J., and Chang, W.W.Y., Spontaneous canine hypersensitivity to ragweed. Characterization of the serum factor transferring skin, bronchial and anaphylactic sensitivity., J. Immunol., 90, 35, 1963.
1391_C04.fm Page 87 Tuesday, November 18, 2003 4:58 PM
CANINE IMMUNE SYSTEM
87
35. Patterson, R., Pruzansky, J.J., and Janis, B., Biologic activity of canine nonprecipitating and precipitating antibody, J. Immunol., 93, 51, 1964. 36. Patterson, R., Roberts, M., and Pruzansky, J.J., Types of canine serum immunoglobulins, J. Immunol., 101, 684, 1968. 37. Patterson, R. and Sparks, D.B., The passive transfer to normal dogs of skin reactivity, asthma and anaphylaxis from a dog with spontaneous ragweed pollen hypersensitivity., J. Immunol., 88, 262, 1962. 38. Johnson, J.S. and Vaughan, J.H., Canine immunoglobulins. I. Evidence for six immunoglobulin classes, J. Immunol., 98, 923, 1967. 39. Johnson, J.S., Vaughan, J.H., and Swisher, S.N., Canine immunoglobulins. II. Antibody activities in six immunoglobulin classes, J. Immunol., 98, 935, 1967. 40. Halliwell, R.E. et al., Physicochemical properties of canine IgE, Transplant. Proc., 7, 537, 1975. 41. Halliwell, R.E., Schwartzman, R.M., and Rockey, J.H., Antigenic relationship between human IgE and canine IgE, Clin. Exp. Immunol., 10, 399, 1972. 42. Reynolds, H.Y. and Johnson, J.S., Quantitation of canine immunoglobulins, J. Immunol., 105, 698, 1970. 43. Mazza, G. et al., The separation and identification by monoclonal antibodies of dog IgG fractions, J. Immunol. Methods, 161, 193, 1993. 44. Mazza, G. et al., Preparation of monoclonal antibodies specific for the subclasses of canine IgG, Res. Vet. Sci., 57, 140, 1994. 45. Mazza, G. et al., Development of an enzyme-linked immunosorbent assay for the detection of IgG subclasses in the serum of normal and diseased dogs, Res. Vet. Sci., 57, 133, 1994. 46. Briere, F. et al., Human interleukin 10 induces naive surface immunoglobulin D+ (sIgD+) B cells to secrete IgG1 and IgG3, J. Exp. Med., 179, 757, 1994. 47. Tang, L. et al., Cloning and characterization of cDNAs encoding four different canine immunoglobulin gamma chains, Vet. Immunol. Immunopathol., 80, 259, 2001. 48. Wang, C.Y. et al., Synthetic IgE peptide vaccine for immunotherapy of allergy, Vaccine, 21, 1580, 2003. 49. Gebhard, D. et al., Canine IgE monoclonal antibody specific for a filarial antigen: production by a canine x murine heterohybridoma using B cells from a clinically affected lymph node, Immunology, 85, 429, 1995. 50. Lazarus, S.C., Mast cell-derived mediators and their role in cell-to-cell interactions in the lung, Respiration, 50 (Suppl. 2), 17, 1986. 51. DeVinney, R. and Gold, W.M., Establishment of two dog mastocytoma cell lines in continuous culture, Am. J. Respir. Cell Mol. Biol., 3, 413, 1990. 52. Lazarus, S.C. et al., Isolated canine mastocytoma cells: propagation and characterization of two cell lines, Am. J. Physiol., 251 (6 Pt 1), C935, 1986. 53. Caughey, G.H., Raymond, W.W., and Wolters, P.J., Angiotensin II generation by mast cell alpha- and beta-chymases, Biochim. Biophys. Acta., 1480, 245, 2000. 54. Vanderslice, P. et al., Molecular cloning of dog mast cell tryptase and a related protease: structural evidence of a unique mode of serine protease activation, Biochemistry, 28, 4148, 1989. 55. Wolters, P.J. et al., Dipeptidyl peptidase I cleaves matrix-associated proteins and is expressed mainly by mast cells in normal dog airways, Am. J. Respir. Cell Mol. Biol., 22, 183, 2000. 56. Fang, K.C. et al., Mast cell expression of gelatinases A and B is regulated by kit ligand and TGFbeta, J. Immunol., 162, 5528, 1999. 57. Hammerberg, B., Olivry, T., and Orton, S.M., Skin mast cell histamine release following stem cell factor and high-affinity immunoglobulin E receptor cross-linking in dogs with atopic dermatitis, Vet. Dermatol., 12, 339, 2001. 58. Jackson, H.A. and Hammerberg, B., Evaluation of a spontaneous canine model of immunoglobulin E-mediated food hypersensitivity: dynamic changes in serum and fecal allergen-specific immunoglobulin E values relative to dietary change, Comp. Med., 52, 316, 2002. 59. Brazis, P. et al., IgE enhances Fc epsilon RI expression and IgE-dependent TNF-alpha release from canine skin mast cells, Vet. Immunol. Immunopathol., 85, 205, 2002. 60. Kube, P. et al., Distribution, density and heterogeneity of canine mast cells and influence of fixation techniques, Histochem. Cell Biol., 110, 129, 1998. 61. Dreyer, W.J. et al., Neutrophil activation and adhesion molecule expression in a canine model of open heart surgery with cardiopulmonary bypass, Cardiovasc. Res., 29, 775, 1995.
1391_C04.fm Page 88 Tuesday, November 18, 2003 4:58 PM
88
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
62. Burns, A.R. et al., Chemotactic factors stimulate CD18-dependent canine neutrophil adherence and motility on lung fibroblasts, J. Immunol., 156, 3389, 1996. 63. Manning, A.M. et al., Cloning and comparative sequence analysis of the gene encoding canine intercellular adhesion molecule-1 (ICAM-1), Gene, 156, 291, 1995. 64. Dore, M. et al., P-selectin mediates spontaneous leukocyte rolling in vivo, Blood, 82, 1308, 1993. 65. Entman, M.L. et al., Neutrophil adherence to isolated adult canine myocytes. Evidence for a CD18dependent mechanism, J. Clin. Invest., 85, 1497, 1990. 66. Hawkins, H.K. et al., Acute inflammatory reaction after myocardial ischemic injury and reperfusion. Development and use of a neutrophil-specific antibody, Am. J. Pathol., 148, 1957, 1996. 67. Shappell, S.B. et al., Mac-1 (CD11b/CD18) mediates adherence-dependent hydrogen peroxide production by human and canine neutrophils, J. Immunol., 144, 2702, 1990. 68. Abbassi, O. et al., Canine neutrophil margination mediated by lectin adhesion molecule-1 in vitro, J. Immunol., 147, 2107, 1991. 69. Kukielka, G.L. et al., Role of early reperfusion in the induction of adhesion molecules and cytokines in previously ischemic myocardium, Mol. Cell. Biochem., 147, 5, 1995. 70. Lu, H., Ballantyne, C., and Smith, C.W., LFA-1 (CD11a/CD18) triggers hydrogen peroxide production by canine neutrophils, J. Leukoc. Biol., 68, 73, 2000. 71. Petersen, T.K., Smith, C.W., and Jensen, A.L., Characterization of the priming effect by pituitary canine growth hormone on canine polymorphonuclear neutrophil granulocyte function, Clin. Diagn. Lab. Immunol., 7, 226, 2000. 72. Kijas, J.M. et al., A missense mutation in the beta-2 integrin gene (ITGB2) causes canine leukocyte adhesion deficiency, Genomics, 61, 101, 1999. 73. Giger, U. et al., Deficiency of leukocyte surface glycoproteins Mo1, LFA-1, and Leu M5 in a dog with recurrent bacterial infections: an animal model, Blood, 69, 1622, 1987. 74. Chabanne, L. et al., Screening of 78 monoclonal antibodies directed against human leukocyte antigens for cross-reactivity with surface markers on canine lymphocytes, Tissue Antigens, 43, 202, 1994. 75. Cobbold, S. and Metcalfe, S., Monoclonal antibodies that define canine homologues of human CD antigens: summary of the First International Canine Leukocyte Antigen Workshop (CLAW), Tissue Antigens, 43, 137, 1994. 76. Williams, D.L., Studies of canine leukocyte antigens: a significant advance in canine immunology, Vet. J., 153, 31, 1997. 77. Brodersen, R. et al., Analysis of the immunological cross reactivities of 213 well characterized monoclonal antibodies with specificities against various leucocyte surface antigens of human and 11 animal species, Vet. Immunol. Immunopathol., 64, 1, 1998. 78. Chambers, C.A. and Allison, J.P., Costimulatory regulation of T cell function, Curr. Opin. Cell. Biol., 11, 203, 1999. 79. Khatlani, T.S. et al., Molecular cloning and sequencing of canine T-cell costimulatory molecule (CD28), Vet. Immunol. Immunopathol., 78, 341, 2001. 80. Yang, S. and Sim, G.K., New forms of dog CD80 and CD86 transcripts that encode secreted B7 molecules, Immunogenetics, 50, 349, 1999. 81. Lilliehook, I., Johannisson, A., and Hakansson, L., Expression of adhesion and Fcgamma-receptors on canine blood eosinophils and neutrophils studied by anti-human monoclonal antibodies, Vet. Immunol. Immunopathol., 61, 181, 1998. 82. Faldyna, M. et al., Lymphocyte subsets in peripheral blood of dogs — a flow cytometric study, Vet. Immunol. Immunopathol., 82, 23, 2001. 83. Toman, M. et al., Postnatal development of leukocyte subset composition and activity in dogs, Vet. Immunol. Immunopathol., 87, 321, 2002. 84. Banchereau, J. and Steinman, R.M., Dendritic cells and the control of immunity, Nature, 392, 245, 1998. 85. Banchereau, J. et al., Immunobiology of dendritic cells, Annu. Rev. Immunol., 18, 767, 2000. 86. Caux, C. et al., GM-CSF and TNF-alpha cooperate in the generation of dendritic Langerhans cells, Nature, 360, 258, 1992. 87. Romani, N. et al., Proliferating dendritic cell progenitors in human blood, J. Exp. Med., 180, 83, 1994. 88. Pulendran, B. et al., Modulating the immune response with dendritic cells and their growth factors, Trends Immunol., 22, 41, 2001.
1391_C04.fm Page 89 Tuesday, November 18, 2003 4:58 PM
CANINE IMMUNE SYSTEM
89
89. de Saint-Vis, B. et al., The cytokine profile expressed by human dendritic cells is dependent on cell subtype and mode of activation, J. Immunol., 160, 1666, 1998. 90. Goodell, E.M., Blumenstock, D.A., and Bowers, W.E., Canine dendritic cells from peripheral blood and lymph nodes, Vet. Immunol. Immunopathol., 8, 301, 1985. 91. Aprile, J. and Deeg, H.J., Ultraviolet irradiation of canine dendritic cells prevents mitogen-induced cluster formation and lymphocyte proliferation, Transplantation, 42, 653, 1986. 92. Galkowska, H. and Olszewski, W.L., Cellular composition of lymph in experimental lymphedema, Lymphology, 19, 139, 1986. 93. Dabrowski, M.I., Galkowska, H., and Olszewski, W.L., Functional characteristics of veiled cells from canine prenodal lymph, Immunobiology, 178, 316, 1989. 94. Olivry, T. et al., Langerhans cell hyperplasia and IgE expression in canine atopic dermatitis, Arch. Dermatol. Res., 288, 579, 1996. 95. Jackson, H.A., Orton, S.M., and Hammerberg, B., IgE is present on peripheral blood monocytes and B cells in normal dogs and dogs with atopic dermatitis but there is no correlation with serum IgE concentrations, Vet. Immunol. Immunopathol., 85, 225, 2002. 96. Porcelli, S.A. and Modlin, R.L., The CD1 system: antigen-presenting molecules for T cell recognition of lipids and glycolipids, Annu. Rev. Immunol., 17, 297, 1999. 97. Hagglund, H.G. et al., Ex vivo expansion of canine dendritic cells from CD34+ bone marrow progenitor cells, Transplantation, 70, 1437, 2000. 98. Catchpole, B., Stell, A.J., and Dobson, J.M., Generation of blood-derived dendritic cells in dogs with oral malignant melanoma, J. Comp. Pathol., 126, 238, 2002. 99. Birdsall, H.H. et al., Complement C5a, TGF-beta 1, and MCP-1, in sequence, induce migration of monocytes into ischemic canine myocardium within the first one to five hours after reperfusion, Circulation, 95, 684, 1997. 100. Frangogiannis, N.G. et al., Induction of the synthesis of the C-X-C chemokine interferon-gammainducible protein-10 in experimental canine endotoxemia, Cell Tissue Res., 302, 365, 2000. 101. Lakshminarayanan, V. et al., Reactive oxygen intermediates induce monocyte chemotactic protein-1 in vascular endothelium after brief ischemia, Am. J. Pathol., 159, 1301, 2001. 102. Maeda, S. et al., Lesional expression of thymus and activation-regulated chemokine in canine atopic dermatitis, Vet. Immunol. Immunopathol., 88, 79, 2002. 103. Pedersen, L.L.G. et al., Identification of monoclonal antibodies that cross-react with cytokines from different animal species, Vet. Immunol. Immunopathol., 88, 111, 2002. 104. Scheerlinck, J.P., Functional and structural comparison of cytokines in different species, Vet. Immunol. Immunopathol., 72, 39, 1999. 105. Olivry, T. et al., Toward a canine model of atopic dermatitis: amplification of cytokine-gene transcripts in the skin of atopic dogs, Exp. Dermatol., 8, 204, 1999. 106. Yang, S. et al., Canine interleukin-5: molecular characterization of the gene and expression of biologically active recombinant protein, J. Interferon Cytokine Res., 21, 361, 2001. 107. Tang, L. et al., Recombinant canine IL-13 receptor alpha2-Fc fusion protein inhibits canine allergenspecific-IgE production in vitro by peripheral blood mononuclear cells from allergic dogs, Vet. Immunol. Immunopathol., 83, 115, 2001. 108. Leung, T.F. et al., A polymorphism in the coding region of interleukin-13 gene is associated with atopy but not asthma in Chinese children, Clin. Exp. Allergy, 31, 1515, 2001. 109. Yang, S., Boroughs, K.L., and McDermott, M.J., Canine interleukin-13: molecular cloning of fulllength cDNA and expression of biologically active recombinant protein, J. Interferon Cytokine Res., 20, 779, 2000. 110. Hammerberg, B. et al., Auto IgG anti-IgE and IgG x IgE immune complex presence and effects on ELISA-based quantitation of IgE in canine atopic dermatitis, demodectic acariasis and helminthiasis, Vet. Immunol. Immunopathol., 60, 33, 1997. 111. DeBoer, D.J., Ewing, K.M., and Schultz, K.T., Production and characterization of mouse monoclonal antibodies directed against canine IgE and IgG, Vet. Immunol. Immunopathol., 37, 183, 1993.
1391_C04.fm Page 90 Tuesday, November 18, 2003 4:58 PM
1391_C05.fm Page 91 Tuesday, November 18, 2003 4:59 PM
CHAPTER
5
Rat Immune System Kevin J. McElwee and Birte Steiniger
CONTENTS I. II. III. IV.
Introduction ..........................................................................................................................91 The Laboratory Rat..............................................................................................................92 Major Histocompatibility Complex .....................................................................................94 Immune Organs....................................................................................................................95 A. Thymus ........................................................................................................................95 B. Spleen...........................................................................................................................96 V. Antibodies ............................................................................................................................98 VI. Complement System ............................................................................................................99 VII. Immune Cells .......................................................................................................................99 A. Mast Cells ..................................................................................................................100 B. Natural Killer Cells (NK Cells) ................................................................................100 C. Lymphocytes ..............................................................................................................101 D. Monocytes/Macrophages ...........................................................................................101 E. Dendritic Cells ...........................................................................................................102 VIII. Cytokines and Chemokines ...............................................................................................103 IX. Conclusions ........................................................................................................................105 References ......................................................................................................................................105
I. INTRODUCTION Rats belong to the family Muridae with the brown, or Norway, rat classified as Rattus norvegicus and the black, or house, rat as Rattus rattus. The Norway rat is thought to have originated in temperate Asia and is noted for being extremely aggressive. The two species cannot interbreed, and ultimately the Norway rat replaced the smaller and less aggressive black rat in Europe. Norway rats made their way to the United States by ship around 1775, again replacing the already established black rat. Soon after the introduction of the Norway rat into Western Europe, albino mutants made their appearance in wild populations. This spontaneous coat color mutation is a fairly common occurrence in wild mammals and particularly in rats. Rats initially entered captivity in the early 1800s as large numbers were collected for the blood sport of rat baiting. The hobby of rat breeding developed later with albino and mutant coat color 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
91
1391_C05.fm Page 92 Tuesday, November 18, 2003 4:59 PM
92
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
rats likely derived from these wild mutants collected for baiting. Rats were the first mammalian species domesticated for use in scientific research [1]. The studies of adrenalectomized rats by Philipeaux [2] in France in 1856 and the neuroanatomical studies by Hatai at the University of Chicago in the early 1890s represent the first known biomedical experiments using rats. The albino rats used in these early studies probably originated from European stocks at the University of Geneva brought to America by the neuropathologist Adolf Meyer [3]. It is speculated that these albino rats of European origin eventually comprised the foundation colony for the Wistar Institute in Philadelphia. However, it has also been indicated that the origins of the Wistar Institute rat colony may have been mutants selected from wild rats captured in the United States [4]. In 1906, the Wistar Institute initiated the standardization of albino and coat color variants that produced the first inbred laboratory rat strains. The first inbred rat strain is generally regarded as the “King albino,” now called the PA strain, produced at the Wistar Institute. Although rat research was initiated in Europe some time before the development of the Wistar Institute rat colonies, the Wistar bloodline is the basis of most laboratory rat strains used today (Table 5.1). II. THE LABORATORY RAT Until relatively recently, rats were the primary laboratory animals employed in experimental research and there is an extensive repertoire of rat reagents available for studies [5], but with the advent of molecular genetics, mice have recently become the species of choice for laboratory research. After the mouse, the laboratory rat is still the most extensively used experimental animal, particularly in the research fields of pharmacology, physiology, neuroscience, aging, transplantation, and immunology. There are many outbred and inbred strains of laboratory rats with over 200 listed [6–8] and likely many more that are currently unlisted. The most frequently used inbred strains include the Fisher 344 (F344), Brown Norway (BN), Lewis (LEW), and Wistar-Furth (WF). A few of the more common outbred strains include the Sprague–Dawley (SD), Wistar (WI) and Long–Evans (LE); the latter is often called the hooded (or piebald) rat. However, most strains are comprised of small, isolated colonies used only by a small number of investigators. In contrast to mouse strains, rat strain distribution is geographically limited with just a handful of strains distributed globally, primarily by commercial entities, and used regularly by investigators. This presents the problem that many strains with unique characteristics of importance to particular fields of research are not readily available to scientists. To remedy this situation, the National Institutes of Health in collaboration with academic and commercial interests, launched the Rat Resource and Research Center (RRRC). While only established in 2001 and still in an embryonic phase, the RRRC should eventually serve as a centralized repository for the distribution of characterized inbred, hybrid, and mutant rats to investigators (www.radil.missouri.edu/rrrc/). The RRRC and other online initiatives for developing and distributing laboratory rat information, such as the rat genome sequencing project (www.hgsc.bcm.tmc.edu/projects/rat/), rat genome database (rgd.mcw.edu/), “RatMap” (ratmap.gen.gu.se/), and others [9,10] may lead to an expansion in rat strains and more rat-focused research in the future. The rat’s larger body size enables microsurgical manipulation that is difficult or impossible in mice. For this reason, rat models dominated in organ transplantation and rejection studies until quite recently [11]. Mouse models generally dominate in fields of tumor research, as most rat strains are relatively less susceptible to spontaneous tumorigenesis and have a longer latent period for tumor induction, particularly skin cancers, compared to rabbits and mice [12]. There are, however, a few notable exceptions. F344 rats are relatively susceptible to spontaneous leukemia, pituitary, and testicular tumors [13,14]. The BDII rat strain is susceptible to the development of endometrial carcinomas [15]. BN rats have a high bladder tumor incidence along with a variety of other tumors [16]. The Tsc2 knockout (Eker) rat is an important renal cell carcinoma model [17]. In addition,
1391_C05.fm Page 93 Tuesday, November 18, 2003 4:59 PM
RAT IMMUNE SYSTEM
93
Table 5.1 Rat Strain Derivation ABH AO AS B BB BRUFO BuF GH GK JC K KYN LEW AGUS APR BDE BD I – BD X BDE BS A28807 A7322 A990 A35322 ACH BN ALB CAS CAR DA FH NEDH OM PVG TO
Rat Strains Directly Descended from Wistar Institute Stocks LOU SR MNE W MNR WA MR WAB MHS WAG MNS WBN MW WE ODU WF OKA WKA PA WKY RA WM SHR WN Rat Strains Descended from Crosses between Wistar and Other Stocks DEBR MAXX GHA OLTEF IS SS LE McCollum (outbred) LGE Sprague-Dawley (outbred) LN Rat Strains Descended from Columbia University Stocks ACI COP ACP F344 AUG M520 Avon 34986 Z61 Other Non–Wistar Derived Stocks Descended from Philadelphia (?), USA Descended from Albany Medical College, USA Descended from Michigan State University, USA Descended from Michigan State University, USA Descended from Oak Ridge National Laboratory, USA Descended from University of Michigan, USA Descended from University of Chicago, USA Descended from Connecticut Agricultural Experiment Station, USA Descended from King’s College of Household Science, UK Descended from Hokkaido University, Japan
Sources: From Lindsey, J.R., in The Laboratory Rat, Vol. 1, Biology and Diseases, Academic Press, New York, 1979 [3], and Greenhouse D.D. et al., in Genetic Monitoring of Inbred Strains of Rats, Gustav Fischer, Stuttgart, 1990 [8], with permission.
WF rats and outbred SD rats have a relatively high incidence of mammary and pituitary tumors [18–23]. The rat is widely used to study mechanisms involved in human disease pathogenesis. While laboratory rats have disadvantages as compared to mice, particularly limited transgenic rat development and availability, there are a significant number of rat models for inflammatory and autoimmune diseases for which there is no direct mouse equivalent. Lewis rats (LEW) are susceptible to several autoimmune conditions including experimental autoimmune encephalomyelitis (EAE) [24], autoimmune complex nephritis (AIC), experimental allergic neuritis (EAN) [25,26], and experimental autoimmune uveitis (EAU) [27]. Rat models dominate over mouse models in chronic relapsing EAE (CREAE) [28] and myasthenia gravis (EAMG) [29]. Several rat models for induced arthritis are available [30,31], and the BioBreeding (BB) rat is a popular model for spontaneous type 1 diabetes [32].
1391_C05.fm Page 94 Tuesday, November 18, 2003 4:59 PM
94
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
III. MAJOR HISTOCOMPATIBILITY COMPLEX The locus of the alloantigenic system in the rat is designated by RT followed by a number. The numbers are generally assigned in the order of the loci discovery. The rat major histocompatibility complex (MHC) is officially designated RT1. In early literature, RT1 was also designated as Ag-B or H-1. Haplotypes of inbred strains of rats are designated by superscripted lower-case letters from a to u omitting r (e.g., RT1a). In early literature the same haplotype designations followed H-1 (e.g., H-1a), but with Ag-B numbers were given such that the new designation of RT1a equates to the original designation of Ag-B4 (RT to Ag-B equivalents: 1=1, a=4, b=6, c=5, d=9, f=10, g=7, u=2). Used alone, m indicates the haplotype of the MNR strain (RT1m). When used with another haplotype symbol, m indicates a mutant form of that haplotype (e.g., RT1lm1). A recombinant is designated by the superscript haplotype symbol r followed by a series number (e.g., RT1r1) and a variant haplotype is designated by adding the letter v, and a series number to the haplotype (e.g., F344 = RT1lv1). A haplotype of a wild rat is designated by a superscript w, followed by a series number (e.g., RT1w1). Individual loci are designated by a capital letter and the allele is designated by a superscript denoting the haplotype from which the locus originated. The order in which the letters are written indicates the sequence of loci on the chromosome, as determined by mapping studies (e.g., RT1.AaBaDaEaCa). While RT1 refers to the MHC, RT2 and RT3 are expressed on erythrocytes and are primarily used for monitoring inbred strain purity. RT8 is also an erythrocyteexpressed antigen used to differentiate SHR substrains. RT6 and RT7 are lymphocyte-expressed antigens. These and other details on nomenclature conventions in the laboratory rat can be found in several publications [33,34]. The MHC loci designation for some of the most popular rat strains are provided in Table 5.2. The MHC plays a central role in the regulation of immune activity [35–37]. As with the MHC of mice and humans, rat MHC genes function by presenting antigenic peptides to the immune system by MHC class I or MHC class II cell-surface molecules [38]. In rats, MHC class I and II expressions become evident in the 2nd to 3rd month postpartum [39]. The MHC region is located on rat chromosome 20 on the telomeric part of the short arm and is 3.7 Mb in size [40–42]. Although the overall genetic diversity between inbred rat strains is higher than that of mouse strains [43], the polymorphism for the MHC across rat strains is lower than that observed in mice and humans [44,45]. Analysis of the rat MHC was based on inbred strains, RT1 congenic strains, and recombinants in the same way as for the mouse MHC (H-2) complex. As with other species, the rat MHC contains equivalent class I, II, and III regions and shows a large degree of genomic conservation with both mice and humans [38]. Similar to mice, but in contrast to humans, the rat MHC contains two class I regions. The rat’s telomeric class I region is equivalent to the human class I HLA while the second Table 5.2 Rat MHC Specificities Strain Designation A28807 ALB BDIX1 BN BUF DA F344
RT1
Strain Designation
RT1c RT1b RT1d RT1n RT1b RT1av1 RT1lv1
LE LEW LOU PVG SHR WF WKY2
RT1 RT1uv2 RT1l RT1u RT1c RT1k RT1u RT1k or RT1l
Notes: BDIX does not express RT1.B [289]. Some substrains of WKY are RT1k while others are RT1l, suggesting that contamination of some inbred substrains has occurred in their history. Sources: Kren, V., Transplantation, 17, 148, 1974 [290]; Kunz, H.W., I.L.A.R. News, 33, 1, 1991 [291]; and Arenas, O. et al., J. Immunogenet., 8, 307, 1981 [292], with permission.
1391_C05.fm Page 95 Tuesday, November 18, 2003 4:59 PM
RAT IMMUNE SYSTEM
Figure 5.1
95
Schematic structure of the MHC in rats compared to humans.
class I region is located centromerically from the classical class II region [46] (Figure 5.1). The detailed structure of the rat MHC and comparison to mice and humans is comprehensively described elsewhere [38,42,46–51].
IV. IMMUNE ORGANS In terms of cell volume, rat lymph nodes contain on average 1.8 ¥ 109 cells per organ, the spleen 1.0 ¥ 109, Peyer’s patches 0.3 ¥ 09 per organ, and the thymus 1.1 ¥ 109 [52–57]. By weight, 3% of the adult rat is bone marrow [58]. B and T lymphocytes proliferate locally, both in central lymphoid organs such as the thymus and the bone marrow, and in peripheral lymphoid organs such as the spleen, lymph nodes, and Peyer’s patches. Studies on immune cell migration are predominantly derived from rat studies with the first understanding of lymphocyte recirculation published in 1959 [59]. The time required for most lymphocytes to cross lymph nodes from blood to lymph ranges from 4 to 18 hours. On average, lymphocytes take 5 to 10 minutes to cross high endothelial venules when entering lymph nodes from the blood [60–62]. T lymphocytes quickly take up residence in the paracortex, while migrating B cells may shuttle between the paracortex and cortex [63,64]. Migration from these organs to the periphery usually takes less than 24 hours [65]. A. Thymus Since the first suggestion that the thymus could be involved in the maturation of immune cells, this organ has been identified as a key organ in immune system function. The thymus shapes the nature of the immune system through T-cell production, “education,” and programmed cell death [66–68]. The immature stages of T-cell differentiation occur in the thymic cortex while final maturation into T-cell receptors (TCR) expressing CD4+ or CD8+ cells occurs in the medulla [69]. Recent studies have explored the changes that occur within the rat thymus with age [70,71]. The changes involve a complex remodeling over time that activates a series of interactions between various cell populations that ultimately results in progressive thymic involution. The expression pattern of cell surface receptors can be used to define the development of T cells in the thymus. In all mammals, the development of thymocytes follows the same general course employing similar cell surface receptors and differentiation programs as demonstrated when rat T cells successfully complete full differentiation in the thymus of SCID mice [72]. T cells in their most immature form are characteristically TCR-/CD4-/CD8- triple negative. These cells
1391_C05.fm Page 96 Tuesday, November 18, 2003 4:59 PM
96
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
become positive for a single marker, either CD4-/CD8+ or CD4+/CD8-, and then progress to doublepositive CD4+/CD8+ cells. Mature CD4+/CD8- or CD4-/CD8+ cells develop from these doublepositive cells and are released to the periphery [73,74]. In rats, CD4-/CD8+ cells can differentiate into CD4+/CD8+ cells in vitro in the absence of stimulation, and CD4+/CD8+ cells can be induced to develop into mature CD4-/CD8+ cells through IL-2 [75]. This is distinct from mouse thymocyte development, where IL-2 is suggested to play no significant role in cell maturation [76]. Ligation of TCR can induce mouse CD4+/CD8+ cells to develop into mature CD4+/CD8- lymphocytes [77]. These and other studies are suggestive that while mouse CD4+/CD8+ thymocytes are committed to becoming CD4+ cells, rat CD4+/CD8+ thymocytes are committed to becoming mature CD8+ cells in the absence of external education [78]. It is likely that rat and mouse thymocytes interpret the same external stimuli in different ways. Stimulation of mouse or rat thymocytes with PMA and ionomycin to bypass TCR signaling results in downregulation of CD8 marker in mice, but CD4 in rats. B. Spleen The spleen of rats and other mammals is a secondary lymphatic organ that harbors more or less motile leukocytes and erythrocytes in a reticular connective tissue stroma composed of fibroblasts and reticular fibers. The spleen consists of two large microanatomic compartments, the white pulp and red pulp. The white pulp is formed by dense accumulations of different lymphocyte populations, while the red pulp is composed of connective tissue cords and sinuses. The rat spleen has a unique circulatory system that differs from all other organs. There are two parallel pathways of blood flow: closed and open circulation. In the closed system, the finer branches of the arterial vessels are supposed to supply the splenic sinuses, a specialized form of capillaries without continuous basement membrane and with slits between the endothelial cells [79]. These sinuses then continue into the venous part of the splenic vasculature. The open circulation on the other hand terminates in arterioles that pour blood into the open spaces of the splenic red pulp cords. In this compartment, the blood percolates through the labyrinth of the reticular connective tissue without an endothelial barrier and thus comes into direct contact with a large population of macrophages inhabiting the cords. The splenic cords either drain through the slits into the splenic sinuses or their blood may even pass directly into the open beginnings of red pulp venules and veins [80]. In rats, the white pulp consists of three different lymphocyte compartments arranged around the finer branches of the splenic artery, the so-called central arterioles [80]. These vessels are covered by a concentric sheath composed primarily of T lymphocytes, called the periarteriolar lymphatic sheath (PALS). At regular intervals, hemispherical accumulations of migratory B lymphocytes are attached to this T-cell sheath, called the follicles. Finally, both the periarteriolar lymphatic sheath and the follicles are delimited from the red pulp by a broad sheath of specialized B lymphocytes, the marginal zone. Thus, the white pulp consists of a central T-cell region and two more peripherally situated B-cell regions of a different shape. In comparison to mice and humans, the marginal zone is especially prominent in rats [81]. In rats and mice, but not in humans, this compartment is clearly delimited from the T-cell region and the follicles by a tortuous, capillarylike blood vessel, the marginal sinus. The outer border of the marginal zone to the open spaces of the red pulp is, however, indistinct. Thus, the rat marginal zone always contains a number of evenly distributed erythrocytes and platelets. Some authors tend to regard it as a separate compartment somehow related to the open splenic circulation. There are three essential cell types that can be distinguished within the PALS: T lymphocytes, sessile stromal cells or fibroblasts (formerly designated as fibroblastic reticulum cells), and interdigitating dendritic cells (IDCs) derived from the bone marrow. In addition, the outer PALS is also a migration compartment for B lymphocytes in rats [82–84] and it may contain substantial numbers of B cells among the always predominating T cells. The evenly distributed branched IDCs are the
1391_C05.fm Page 97 Tuesday, November 18, 2003 4:59 PM
RAT IMMUNE SYSTEM
97
main cell population positive for MHC class II antigens in the inner PALS. They are regarded as the antigen-presenting cells of the T-cell area, although their function may also comprise the downmodulation of T-cell functions [85]. The fibroblasts of the PALS are poorly defined. In mice and humans, they have been shown to express certain adhesion molecules involved in lymphocyte homing and to secrete a number of chemokines attracting T cells and dendritic cells from the blood [86,87]. The follicles are occupied by migratory B cells. It is believed that the decisive stromal cells of this compartment are the follicular dendritic cells (FDCs), which secrete chemokines attracting recirculating B cells and certain T cells [88]. However, the derivation of the FDCs is not entirely clear. FDCs express complement and Fc receptors and are able to retain immune complexes on their surfaces for astonishingly prolonged periods [89]. Follicles may either appear as primary follicles without any special internal structure or as secondary follicles with pale-staining germinal centers. In secondary follicles the germinal center displaces the remainder of the primary follicle (the small recirculating B lymphocytes) to the follicular periphery. This shell of small B cells is then called the mantle zone or corona. Germinal centers arise when B lymphocytes have met their cognate antigen somewhere in the body. Fragments of this antigen may also have been presented to antigen-specific T cells in the PALS by MHC class II–positive IDCs. This leads to T-cell activation and movement of T cells to the outer PALS. Antigenprimed B cells expressing MHC class II molecules may then also enter the outer PALS from the marginal zone, where they arrive from the blood (see below). The antigen-specific interaction of activated T cells and antigen-presenting B cells in the outer PALS provokes B-cell differentiation. These B cells then develop into low affinity plasma cells at the outer border of the PALS and secrete imunoglobulin for a short period [90,91]. The immunoglobulin forms antigen-antibody complexes that are deposited on the surface of FDCs. If primed recirculating B cells enter follicles containing their cognate antigen in immune complexes, they are arrested in the follicle and start cell division, giving rise to a germinal center. Full-blown germinal centers consist of a dark zone with centroblasts and a light zone containing centrocytes. During division, centroblasts hypermutate the variable antigen-binding regions of their immunoglobulin genes [92]. They may then develop into centrocytes if — by chance — the hypermutation process has led to the expression of surface immunoglobulin with an increased affinity for antigen. Cells with reduced or unchanged affinity of immunoglobulin undergo apoptosis and are phagocytosed by the so-called tingible body macrophages of the germinal center. With the help of germinal center T cells and FDCs, centrocytes further develop into B-memory cells or into plasma cell precursors and then leave the germinal center to distribute in the body. B-memory cells may colonize the splenic marginal zone and several other locations [91], while the majority of plasma cells reside in the bone marrow. Thus, the germinal centers are compartments for immunoglobulin affinity maturation in the spleen and in other secondary lymphatic organs after initial low-affinity immunoglobulin has been produced and distributed systemically [90,93,94]. In rats and mice the marginal zone is a dual-purpose compartment. First, the marginal zone serves as an entry site for antigens and for migratory T and B lymphocytes arriving from the blood stream via the marginal sinus. Second, it harbors a specialized type of more sessile B cells, the marginal zone B lymphocytes, which are recruited from recirculating precursors [91,95–99]. Recirculating B and T lymphocytes are assumed to cross the leaky outer wall of the marginal sinus to first enter the marginal zone. From there T cells move into the PALS to rest for a shorter or longer period, while B cells migrate along the outer PALS to enter the primary follicles or the mantle zone of secondary follicles [91]. The typical marginal zone B cells have a phenotype different from that of small recirculating B cells [91,98]. In rats, marginal zone B cells may function as Bmemory cells for T-cell–dependent antibody reactions, but they are also decisive as precursors of plasma cells for immediate antibody formation against so-called T-independent type 2 antigens [96,100]. These antigens are distinguished by repetitive polysaccharide epitopes such as those present in the capsules of certain gram-negative bacteria that may cause a fulminant septic syndrome
1391_C05.fm Page 98 Tuesday, November 18, 2003 4:59 PM
98
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
in splenectomized humans [101,102]. In addition, the marginal zone may also contain polyreactive, autoreactive and xenoreactive B cells recognizing sugar and lipid determinants [99,103–105]. On confrontation with specific antigen or after polyclonal activation, marginal zone B cells quickly leave their compartment, enter the outer PALS, and differentiate into plasmablasts [106–108]. From the outer PALS the plasmablasts enter the splenic red pulp or other locations and give rise to IgMproducing plasma cells. Thus, marginal zone B cells play a decisive role in the immediate production of large amounts of IgM antibodies to particulate antigens or certain bacteria and viruses present in the blood. The marginal zone consists of ill-defined stromal cells, various slightly activated types of B cells such as polysaccharide-specific, polyreactive, and memory-B cells, recirculating naïve T and B cells, and immature dendritic cells arriving from the blood. In addition, there are two phenotypically defined populations of macrophages, the marginal metallophilic macrophages and the marginal zone macrophages. The marginal metallophilic macrophages line the marginal sinus, while the marginal zone macrophages are evenly scattered throughout the marginal zone. In mice, both populations can be differentially stained with monoclonal antibodies, while in rats [109,110] they both react with antibodies directed against sialoadhesin (CD169). These macrophages phagocytose fluorescent polysaccharides injected intravenously in rats, but whether and how they interact with the special marginal zone B cells remains unknown [111,112]. A minimum of four or five monoclonal antibodies permits visualization of the compartments mentioned above and are recommended for a first overview of rat spleens. Monoclonal antibody R73, which is directed against a constant epitope on the T-cell antigen-receptor beta chain [113] may be used for demonstration of the PALS. Follicles and marginal zone react with antibody Ox33 specific for the B-cell restricted form of the leukocyte common antigen CD45R [114]. Finally, red pulp macrophages and an ill-defined macrophage population at the outer border of the PALS are revealed by antibody ED2 detecting a member of the scavenger receptor family CD163 [109,115,116]. Marginal metallophilic macrophages and marginal zone macrophages stain with antibody ED3 against sialoadhesin [109,110] or, alternatively, with antibody KiM9R of unknown specificity [117]. In rats, mice, and humans, the spleen is the decisive organ for immunologic control of the blood. The marginal zone, which is most easily studied in rats because of its prominence in tissue sections, is regarded as a spleen-specific compartment involved in this function. Marginal zone B lymphocytes are capable of almost immediate plasma cell differentiation and antibody secretion against certain T-cell independent antigens and thus enable the spleen to start a unique emergency reaction before the more slowly progressing reactions against T-cell–dependent protein antigens take over. In addition, the red pulp of the spleen provides a large phagocytic compartment directly in contact with blood flowing slowly in the open circulation. This compartment may contribute decisively to remove opsonized bacteria and other pathogens as well as blood cells with altered surface composition.
V. ANTIBODIES Rat immunoglobulins (Igs) are similar to those identified in other mammals. Rats produce IgA, IgM, IgE, IgD, and IgG, which can be separated into four subcategories: IgG1 and IgG2a are similar to mouse IgG1, and rat IgG2b and IgG2c are the equivalents of mouse IgG2a/IgG2b and IgG3, respectively [118,119]. The concentrations of Ig types in normal rat serum are in the range of 0.15 to 0.9 mg/ml for IgM, 0.13 to 0.18 mg/ml for IgA, 0.0005 to 0.02 mg/ml for IgE, 0.5 to 7.0 mg/ml for IgG1, and 7.0 to 8.0 mg/ml for IgG2a [118,120–123]. In comparison, normal human serum may contain 0.5 to 3.3 mg/ml IgM, 0.6 to 3.1 mg/ml IgA, 24 to 430 mg/ml IgE, and 6.1 to 13.0 mg/ml of total IgG or around 9 mg/ml of IgG1, 3 mg/ml of IgG2, 1 mg/ml of IgG3, and 0.5 mg/ml of IgG4 [124,125].
1391_C05.fm Page 99 Tuesday, November 18, 2003 4:59 PM
RAT IMMUNE SYSTEM
99
The repertoire of the Ig light chain variable region in rats is quite extensive. Although rats express Igs at levels no higher than mice, rat variable light chain loci are considerably more complex than those of laboratory mice. Their diversity reflects the products of gene duplications that predate the time of primate/rodent divergence [126]. Significant variations in allotypes can be observed within and between different strains of rat [127–132]. In terms of eliciting phagocytic action by macrophages, rat IgM and IgG1 are efficient, while IgG2a is less so [133–135]. Human antibody isotypes IgG1, IgG3, and to a lesser extent, IgG2 and IgA, elicit phagocytic action [125]. Experimentally, rat IgG2b has a particularly high affinity for human Fc g receptors [136], including receptors on NK cells [137,138]. IgG1 type rat antibody complexes display a low complement-activating capacity compared with IgM, IgG2b, IgG2c, or IgG2a, of which IgG2a is most efficient in complement activation [139,140]. IgA and IgE are much less capable of activating complement [141,142]. Similarly, human IgG1, IgG3, and IgM are most efficient at complement activation while IgG2 and IgG4 have much less effect, and IgA, IgD, and IgE have no significant complement-binding activation ability [125].
VI. COMPLEMENT SYSTEM The complement system is highly conserved across mammalian species, and simpler complement systems may also be found in many invertebrates [143]. The mammalian complement system has three pathways; classical, alternative and lectin, which together jointly function to amplify an initiating signal through feedback systems of serine protease activities. The immediate outcomes of these pathways are similar with each generating a proteolytic enzyme complex, called C3 convertase, which cleaves the C3 protein to C3a and C3b. One of the central functions of complement activation is to “tag” foreign particles for destruction through augmented targeting and phagocytosis of the foreign particle. While C3b tags the target membrane, C3a acts as a potent proinflammatory mediator. In addition, the C3-based tags activate the terminal or lytic pathway that results in the formation of the membrane attack complex [144,145]. Only subtle differences in rat versus human complement systems are apparent and the primary focus is on system regulatory proteins and their distribution [146]. In humans, decay-accelerating factor (DAF) and membrane cofactor protein (MCP) are the most important proteins for controlling complement activation and amplification of the cascade through blockade of C3 cleavage and deposition. Another inhibitor of complement activation termed Crry has been identified on rat, but not human, cell membranes [147]. Crry is broadly distributed and is a functional and structural analogue of human DAF and MCP. Rodent cells also express DAF and MCP homologues, although the tissue distribution of MCP is more restricted [148].
VII. IMMUNE CELLS Fixed values for parameters that can be universally applied to all rodent strains under all environmental conditions are rare, and immune system parameters are no exception. However, some basic data provide a general framework. Rat blood volume is on average 6.4 ml per 100 g of body weight [149,150] with a pH of 7.4 [151]. Erythrocyte counts for adult rats are typically 6 to 10 ¥ 106/ml [152] and change in size dependant on age [153] while platelets are 4 to 10 ¥ 105/ml in frequency [152]. Rat blood total leukocyte counts have a wide range of 3 to 17 ¥ 103/ml, of which neutrophils constitute 14 to 27%, lymphocytes 65 to 83%, monocytes 0 to 4.0%, eosinophils 0 to 4.0%, and basophils 0 to 1.0% [152,154–158]. In comparison, human blood samples have a typical erythrocyte count range of 4.2 to 5.4 ¥ 106/ml, platelet count of 1.4 to 4.4 ¥ 105/ml and a leukocyte count range of 4.8 to 10.8 ¥ 103/ml. Neutrophils constitute 40 to 74%, lymphocytes 19 to 48%, monocytes 3.4 to 9.0%, eosinophils 0 to 7.0%, and basophils 0 to 1.5% [124,158].
1391_C05.fm Page 100 Tuesday, November 18, 2003 4:59 PM
100
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
A. Mast Cells Mast cells, basophils, and eosinophils are all bone marrow–derived cells that contribute allergic responses and other immune mechanisms [159–161]. An initial allergic reaction involves the interaction of allergen with specific IgE antibodies attached to high-affinity receptors (FceRI) on tissue mast cells [162]. This typically takes place on mucosal surfaces and in connective tissue. The subsequent recruitment of other cells, such as eosinophils and basophils, to the affected tissue sites expands the spectrum of triggering cells beyond mast cells in the mediation of chronic inflammatory processes [163]. Rat eosinophils have collagenase activity and are associated with areas of morphologically altered collagen fibers in incisional skin wounds suggesting that rat eosinophils may contribute to the remodeling of connective tissue [164,165]. Basophils are derived from different progenitor cells than mast cells and for the most part it is agreed that basophils more closely resemble eosinophils than mast cells, but the two cell types share several properties such as the expression of FceRI and histamine-containing granules [166]. From studies with human cells, it is now apparent that mast cells, basophils, and eosinophils share several recruitment pathways and inflammatory responses with one another, but each cell type possesses unique adhesion and migration responses that can contribute to their preferential accumulation in an immune response [163]. Rat mast cells can be divided into two basic types based on their histochemical and biochemical characteristics and are called connective tissue type mast cells (atypical) or mucosal mast cells (typical). The two mast cell types were initially defined by their toluidine or alcain blue dye–binding properties. Rat mast cells have two types of proteases designated as rat mast cell protease I and II, the differential expression of which also defines connective tissue derived or mucosal derived mast cells, respectively [167]. Rat mast cells are relatively abundant, and their activation and release of mediators such as prostaglandin D2 [168], leukotrienes [169], platelet-activating factor [170], histamine [171,172], heparin [173], and chondroitin sulfate [174] are considered central to the pathophysiology of allergic diseases in rodents. However, there are several differences between human and rodent mast cells that may make information derived from rodent studies difficult to extrapolate to human disease [175]. For example, rodent mast cell subsets store multiple chymase isoforms and rarely contain tryptase, while in contrast, only one chymase isoform has been identified in a subset of human mast cells and tryptase may comprise up to 25% of a human mast cells’ protein content [176]. Thus, while the fundamental functions of rat mast cells are similar to that of humans, subtle differences may complicate the comparison of rat research to humans. B. Natural Killer Cells (NK Cells) NK cells are bone marrow–derived lymphocytes that share a common progenitor with T cells [177]. As a component of the innate immune response, the primary function of NK cells is to monitor cells for the presence of crucial self markers [178]. In the absence of these markers, and in the absence of inhibitory factors, NK cells target the offending cell. As such, the most important role of NK cells in host defence may be in anti-viral immunity as well as bacterial and parasitic infections [179]. The potency of the NK cell response towards cells with an altered target phenotype means their involvement in autoimmune disease is also likely [180]. Certain T-cell responses in rats can be inhibited by NK cells suggesting an immunoregulatory role [181,182], while in disease models NK cells can be highly reactive to the target cell type. For example, as with human diabetes, BB rats have a significant deficiency in NK cells that may lead to reduced immune system regulation [183], but other studies demonstrate NK cells in BB rats are highly responsive to islet cells [184]. Rat NK cells are morphologically defined as large granular lymphocytes (LGL). These cells express asialo-GM1, laminin, and CD8 but do not express CD5, OX19, CD4, or surface Igs [185–187]. From the LGL population, lymphokine activated killer cells can be produced whereas T-cell populations devoid of LGL activity cannot produce lymphokine-activated killer cells
1391_C05.fm Page 101 Tuesday, November 18, 2003 4:59 PM
RAT IMMUNE SYSTEM
101
[187–189]. These properties of rat NK cells are in line with observations for mouse and human NK cells [190–192]. While NK cells are stimulated by cytokines such as IL-15, IL-12, IL-10, IL2 and IFN [193], NK cells themselves produce cytokines such as IL-12 and IFN-a capable of promoting Th1 type lymphocytes. Recognition of, and response to, allogeneic and xenogeneic cells by NK cells is mediated by the opposing effects of various activation and inhibitory receptors that are less well defined in the rat than in humans and mice [194,195]. Rat NK cells recognize MHC class I molecules encoded by both the classical (RT1-A) and non-classical (RT1-C/E/M) MHC class I (MHC-I) regions [196,197]. Responsiveness is accentuated by the presence of complement. C. Lymphocytes Mature rat lymphocytes range in size from 6 to 15 mm much as is observed in humans. However, rat lymphocyte size is biased more towards the lower end of the scale while in humans larger lymphocytes are more common. The majority of peripheral T cells are of two main phenotypes; CD4+ and CD8+ cells. CD4+ and CD8+ T cells identified in rats carry out essentially the same functions as equivalent cells in mice and humans [198,199]. The ratio of CD4 to CD8 cells varies considerably between rat strains [200]. The peripheral CD4/CD8 ratio variability is genetically determined much as is observed in humans [201]. In contrast to mice, the MHC haplotype of rats plays a dominant role in determining the peripheral CD4/CD8 ratio probably through positive and negative selection [200,202]. In rats and humans the CD4 antigen is expressed on both T helper cells and macrophages. In contrast, CD4 is apparently absent from mouse macrophages [203–205]. CD4+ T cells are classified into two subpopulations depending on the expression of CD45R. CD45RC- cells (CD45RC in rats equates to CD45RB in mice) are viewed as memory, or regulatory, T cells with a capacity to produce IL-4 [206]. CD45RC+ cells are naïve T cells with a propensity for IL-2 and IFNg production. Both memory and naïve rat CD4 cells migrate into lymph nodes via high endothelial venules but their rate of passage through the lymph node differs, with memory cells migrating faster than naïve cells [207]. With the discovery of CD25 as a potential marker for regulatory cells in mice [208], rat CD4 cells have also been examined for expression of CD25 and a regulatory phenotype. Rat CD4 cells expressing CD25 with a regulatory phenotype were also identified as low expressors of CD45RC. However, other cell subpopulations negative for CD25 expression have also been identified in rats with a regulatory cell phenotype [209]. Nevertheless, overall there is compelling evidence that essentially the same regulatory cells exist in rats, mice and humans. In rats, humans, and mice T cells can be divided into two main populations based on their TCR properties, specifically a/b TCR and g/d TCR. Most peripheral rat T cells express a/b TCR, but g/d TCR expressing cells are present at low levels with widespread distribution, including the skin [210,211]. Analysis of TCR transcripts demonstrates a high degree of similarity in both number and sequence between rat and mouse TCR genes [212,213]. However, in contrast to mouse and human a/b TCR cells that are typically CD4+, rat g/d TCR cells are CD8+ [214]. D. Monocytes/Macrophages Classically the definition of monocytes and macrophages has been defined by their relative physical location with monocytes restricted to the blood and macrophages resident in peripheral tissues. However, this distinction is not clear cut as, in contrast to humans, mature intravascular macrophages can be identified in some species [215] and in response to liver damage, intravascular macrophages may develop in some rat models [216]. A strict functional segregation of monocytes from macrophages is also difficult as any in vivo stimulation will affect both monocytes and macrophages, while in vitro monocytes quickly differentiate into macrophages upon adherence to the culture vessel. In non antigen challenged rats, monocytes represent 0–4% of white blood cells in the blood while in humans and mice the level can be somewhat higher at 5–10%. Monocytes,
1391_C05.fm Page 102 Tuesday, November 18, 2003 4:59 PM
102
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
derived from hematopoietic bone marrow stem cells, are continuously released into the blood where they reside for 24 hours before migrating, differentiating, and taking up residence in peripheral rat organs [217,218]. The most widely used reagents for visualizing tissue macrophages in rats are monoclonal antibodies ED1, ED2 and ED3 [109]. The target structure of ED1 has not been entirely characterized up to now. It is a primarily intracellular lysosomal antigen which may be similar to CD68 [219]. ED2 obviously binds to a member of the family of scavenger receptor molecules, potentially to rat CD163 [116]. ED3 is supposed to detect sialoadhesin (CD169) in rats [110,220]. While the ED1 target is present in the majority of tissue macrophages and monocytes [116], ED2 and ED3 antibodies only react with certain macrophage populations, but not with normal monocytes. The molecule identified by ED2 is present in interstitial macrophages in many, but not all, organs such as Kupffer cells, splenic red pulp macrophages, interstitial macrophages in the heart and perivascular macrophages in the brain. Strong reactivity for ED3 is found in marginal metallophilic macrophages and marginal zone macrophages of the spleen and in subsinusoidal and medullary macrophages of the lymph nodes. In addition, reactivity with ED2 and ED3 may be induced in macrophages under conditions of inflammation in vivo and experimentally in vitro [116]. Interestingly, none of the three antibodies label normal microglia cells in the brain. Up to now the antigens detected by antibodies ED1, ED2 and ED3 have not been detected outside the monocyte/macrophage and dendritic cell system to any larger extent. There is, however, a substantial number of further antibodies reacting with monocytes/macrophages and additional cells in rats [221]. The vast majority of blood monocytes can be detected by antibodies ED9 or Ox41, which are directed against different epitopes on a molecule of the signal-regulatory protein (SIRP) family [222]. If these reagents are used in flow cytometry, granulocytes have to be removed before due to potential crossreactivity. Two other antigens, the ED1 target structure and CD11b, detected by mAb Ox42 [223], are also present in all normal blood monocytes. The latter two reagents are, however, not well-suited to detect monocytes by flow cytometry, because staining for ED1 needs permeabilization of cell membranes and CD11b is also present in certain lymphocytes. Several other antigens of immunologic interest are expressed by subpopulations of normal ED9-positive rat monocytes including CD4, CD8, CD43, CD62L and CD161 [224]. These antigens may be either upregulated (CD161, CD62L, and CD8) or down-modulated (CD43 and CD4) by monocytes during immune reactions in vivo [224]. Interestingly, in LEW rats kept under specified pathogen-free conditions, MHC class II antigens are only present in a very low number of blood monocytes. This number does, however, increase during immune reactions. E. Dendritic Cells Since their first identification [225], dendritic cells have been characterized as key players in the adaptive immune system. Their ability to sample antigens [226] and present them to activate naïve lymphocytes, both CD4 and CD8, [227,228] dictates the nature of the immune response to an antigenic challenge [229]. In humans and mice the dendritic cell populations have a heterogeneous presentation of cell surface markers and rat dendritic cells exhibit similar heterogeneity. No one marker identifies all rat dendritic cells and it is likely that expression of dendritic cells changes depending on the degree of maturity, activation, and the surrounding environment of the cell [230,231]. A variety of antigens are used to identify rat dendritic cells, often employing several simultaneously, such as CD11c, MHC class II, ae-integrin and signal inhibitory regulatory proteins [232–236]. Rat dendritic cells can also variably express other antigens that are used to identify their source and lymphocyte stimulatory capacity including; CD4, Thy-1, CD2, CD25, MHC class I, and CD11b [236–238]. Of particular note, while CD4 is expressed on dendritic cell subpopulations from intestine and respiratory tract epithelia [239], CD4 is virtually absent from rat skin Langerhans cells [233].
1391_C05.fm Page 103 Tuesday, November 18, 2003 4:59 PM
RAT IMMUNE SYSTEM
103
Studies on dendritic cells are most advanced in humans and mice [240,241] while rat dendritic cell research is far less developed. However in one particular research area, namely the understanding of dendritic cell migration in vivo, rat models excel. Much detailed research with mice and humans involves ex vivo and in vitro models. The larger size of rats enables the development of in vivo models using, for example, cannulation of lymphatic vessels [242], a procedure for which mice are too small. Thus, rat research provides one of the primary sources for understanding in vivo cell migration dynamics. While some suggest dendritic cells only migrate from the periphery after acquiring foreign antigen and receiving appropriate stimuli [243], research from rat models indicate continuous migration of dendritic cells from the periphery regardless of stimuli, although stimuli enhance migration [236,238,244,245]. Most other cells migrating through peripheral tissues in adult animals either have an activated or memory phenotype [246]. Once the lymph node is reached, dendritic cells enter the paracortex and reside as interdigitating cells [247]. This continuous dendritic cell migration from the periphery to lymph nodes, and residency in the paracortex in close association with T lymphocytes [248], is suggested as one mechanism for the maintenance of self tolerance, and the immunostimulatory role of dendritic cells is only initiated in direct response to antigenic challenge. Rat dendritic cells are capable of inducing Th1 or Th2 type responses after antigenic challenge depending on the cytokine environment [249]. For a continuous migration of dendritic cells from the periphery to lymph nodes to be maintained, the departing cells must be continuously replaced. Dendritic cells are ultimately replaced with cells derived from bone marrow hematopoietic stem cells [250,251], but the nature of the transformation from stem cells to differentiated, mature peripheral tissue dendritic cell is poorly understood in all species. The immediate precursor cells of tissue dendritic cells are likely derived from the spleen and lymph nodes [252]. The rate of dendritic cell turnover in the periphery varies with tissue type. Rat dendritic cells reside for an average of 3 days in the intestines and respiratory tract before migrating to lymph nodes [244,253] while dendritic cells in the skin, kidneys, and heart remain resident for between 2 and 4 weeks [232]. These differences suggest that the rate of dendritic cell turnover may reflect the degree of antigenic load to which the cells are exposed in different tissues.
VIII. CYTOKINES AND CHEMOKINES Interleukin-1 (IL-1) is produced during infection, injury, or immunological challenge. IL-1 promotes a variety of systemic effects such as fever, sleep, ACTH release, and increased sodium excretion. IL-1 activates both T and B lymphocytes and induces production of various lymphokines, interferons, and other cytokines, particularly tumor necrosis factor [254]. IL-1 is a general name for at least two distinct proteins, IL-1a and IL-1b, considered to be the first of a small (but growing) family of regulatory and inflammatory cytokines [255]. There is a 78% amino acid identity between mouse and human mature IL-1b [256]. Full length IL-1a shows 54% amino acid identity and mature IL-1a shows 58% amino acid identity between mouse and human. Both human and rat IL-1 are active on mouse cells [257,258]. See Table 5.3 for human/rat cytokine homology. Interleukin-2 (IL-2) is a potent immunoregulatory cytokine that plays a central role in a number of T-cell functions. Although IL-2 has traditionally been grouped with the Th1 cytokines, it is now thought that IL-2 is not a true Th1 cytokine since naïve CD4+ T cells are known to produce it [259]. Mouse IL-2 is approximately 63% identical to human IL-2, but contains a unique stretch of repeated glutamine residues [260]. Rat IL-2 is similar to mouse and human IL-2 in its biochemical properties [261–264]. There at least 2 forms of rat IL-2, while at least 5 forms have been identified in different mouse strains [265,266]. Interleukin-4 (IL-4) was originally described as a growth factor for B cells stimulated with antiIgM antibodies. Subsequent investigation has revealed an abundance of other functions including
1391_C05.fm Page 104 Tuesday, November 18, 2003 4:59 PM
104
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Table 5.3 Human/Rat Cytokine Homology Cytokine or Receptor
Human Chromosome Location
IL-1a IL-1b IL-1r IL-2 Il2ra Il2rb IL-4 IL-4r IL-6 Il6r Il10 Il10ra IL10rb IL12a IL12b IFNg IFNgr TNFa
2q14 2q14 2q12 4q26-q27 10p15-p14 10p15-p14 5q31.1 16p11.2-12.1 7p21 1q21 1q31-q32 11q23 21q22.11 3p12-q13.2 5q31.1-q33.1 12q14 6q23-q24 6p21.3
Rat Chromosome Location
Human/Rat Protein Homology
3q36 3q36 2q24 17q12.3 7 10 1q33 4 2q34 13q11 8q22 11q11-q22 2q31 10q21 7q21 1q11 20p12
64% 66% 67% 64% 60% 60% 43% 49% 40% 54% 73% 61% 58% 66% 39% 48% 76%
Cross-Species Reactivity Yes Yes — Yes — — No — Partial — Partial — — No No No — Partial
References 293
261,294,295 296 296–298 267,299 269,270,300–302 302–305 274,275 279 280 306,307 284,308,309
Note: Italics indicate predicted position not yet confirmed. General Sources: Makalowski and Boguski, Proc. Natl. Acad. Sci. U.S.A., 95, 9407, 1998 [310], and Locuslink, available at www.ncbi.nlm.nih.gov/LocusLink/, accessed April 2003.
the ability to induce or enhance the expression of MHC class II molecules and CD23 on B cells, its own receptor on lymphocytes and VCAM-1 on endothelial cells. In addition, IL-4 can induce the secretion of IgG1and IgE while restricting the secretion of other Ig isotypes as well as acting as a growth factor for T cells and mast cells. The predicted amino acid sequence of the rat IL 4 gene shows low homology (57%) with the mouse homologue [267]. IL4 receptor (IL4r) comprises an overall identity of 52% and 78% to its human and mouse homologues, respectively [268]. Mouse and rat IL-6 also have been cloned and are approximately 40% identical to human IL6 at the amino acid level [269,270]. Unlike human IL-6, mouse and rat IL-6 lack potential N-linked glycosylation sites, but may be O-glycosylated [269]. The presence or absence of glycosylation, however, has no effect on bioactivity. Human IL-6 is active on both mouse and rat cells [270,271] while the effects of rat IL-6 on human cells has apparently not been examined, mouse IL-6 has no activity on human cells [270,272]. Interleukin-10 (IL-10) is primarily an anti-inflammatory, immunoregulatory cytokine [273]. The active form of IL-10 is a noncovalent homodimer, exhibiting species-specificity both with respect to structure and biological activity. Human and rat IL-10 exhibit 81% sequence identity at the amino acid level, and share 73% identity at the cDNA level [274]. Most notably, in addition to the two disulphide bonds also present in human IL-10, rat IL-10 has a fifth unpaired cysteine that may increase its biological activity [275]. Rat IL-10 may play a role in resistance to autoimmune diseases in rats [276], may be used to aid allograft survival [277], and reduces rat NK cell sensitivity to tumor cells [278]. The nucleic acid coding sequence for rat IL-10r exhibits 88% and 68% homology with the mouse and human IL-10 receptor sequences respectively, and the translated protein exhibited 83% and 61% homology with the mouse and human IL-10 receptor proteins respectively [279]. Interleukin 12 (IL-12) is involved in the stimulation and maintenance of Th1 cellular immune responses, including the normal host defence against various intracellular pathogens. IL-12 also has an important role in Th1 disease pathogenesis, such as in inflammatory bowel disease and multiple sclerosis. Bioactive IL-12 was identified as a disulfide-linked heterodimer, composed of
1391_C05.fm Page 105 Tuesday, November 18, 2003 4:59 PM
RAT IMMUNE SYSTEM
105
a heavy chain of 40 kDa (p40) and a light chain of 35 kDa (p35) encoded by separate genes. Human and rat IL-12 share 65% and 58% amino acid sequence homology in their p40 [280] and p35 subunits, respectively. Human IL-12 shows minimal activity in rats. Tumor necrosis factor (TNF) is a pleiotropic mediator contributing to cellular signaling pathways and cell growth, immune responses, angiogenesis, as well as modulating viral replication, growth of bacteria and other parasites [281]. TNFb and TNFa share 30% amino acid homology and have similar biological activities [282]. Unlike human TNFa, mouse TNFa is glycosylated [283]. The propeptide of rat TNFa as well as the biologically active TNFa possess a homology of 92% and 76% to mouse and human TNFa, respectively [284].
IX. CONCLUSIONS The evolutionary divergence between rats and mice is proposed to be about 20 to 40 million years [285–287], while the evolutionary distance from rats to humans may be around 100 million years [288]. Despite this long time period for evolutionary divergence, the genetic difference between rodents and humans is limited. Rats, mice and other rodents exhibit the same basic immunologic system as humans. Minor modifications are apparent, but fundamentally the innate and adaptive arms of the rat immune system operate much the same way as is observed in humans. The advantages of rodent research, their small size, their rapid breeding speed, the availability of genetically identical inbred stains, the abundance of immune reagents, and the absence of the ethical limitations as in human experimentation, naturally favor the development that much of our understating of immune system function in health and dysfunction in immunologic diseases is derived from rodent research. Mice now far exceed rats in their frequency of use in research and correspondingly much more is now known about mouse immunology. However, rats still retain a significant role and with the further development of production and distribution facilities, rat strains may regain their previous popularity as a prominent laboratory research model.
REFERENCES 1. Richter, C.P., The effects of domestication and selection on the behavior of the Norway rat. J. Natl. Cancer Inst., 15, 727, 1954. 2. Philipeaux, J.M., Note sur l’extirpation des capsules survenales chez les rats albinos (Mus rattus), C. R. Habd. Séances Acad. Sci., 43, 904, 1856. 3. Lindsey, J.R., Historical foundations, in The Laboratory Rat, Vol. 1, Biology and Diseases, Baker, H.J., Lindsey, J.R., and Weisbroth S.H., Eds., Academic Press, New York, 1979, p. 1. 4. Donaldson, H.H., The history and zoological position of the albino rat, J. Acad. Natl. Sci., 15, 365, 1912. 5. van den Berg, T.K. et al., Monoclonal antibodies against rat leukocyte surface antigens, Immunol. Rev., 184, 109, 2001. 6. Festing, M.F.W., Inbred strains, in The Laboratory Rat, Vol. 1, Biology and Diseases, Baker, H.J., Lindsey, J.R., and Weisbroth S.H., Eds., Academic Press, New York, 1979, p. 55. 7. Festing, M.F.W., Inbred Strains in Biomedical Research, Macmillan, London, 1979. 8. Greenhouse, D.D. et al., Catalogue of inbred strains of rats, in Genetic Monitoring of Inbred Strains of Rats, Hedrich, H.J., Ed., Gustav Fischer, Stuttgart, 1990, p. 410. 9. Jacob, H.J. and Kwitek, A.E., Rat genetics: attaching physiology and pharmacology to the genome, Nat. Rev. Genet., 3, 33, 2002. 10. Twigger, S. et al., Rat Genome Database (RGD): mapping disease onto the genome, Nucleic Acids Res., 30, 125, 2002. 11. Steiniger, B. et al., Monocytes in the rat: phenotype and function during acute allograft rejection, Immunol. Rev., 184, 38, 2001.
1391_C05.fm Page 106 Tuesday, November 18, 2003 4:59 PM
106
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
12. Bickerton, R.K., Spontaneous tumors and related pathologic changes, in Carcinogenesis Testing of Chemicals, Goldberg, L., Ed., CRC Press, Cleveland, 1974, p. 55. 13. Sher, S.P., Jensen, R.D., and Bokelman, D.L., Spontaneous tumors in control F344 and charles riverCD rats and Charles River CD-1 and B6C3HF1 mice, Toxicol. Lett., 11, 103, 1982. 14. Maekawa, A. et al., Spontaneous tumors in F-344/DuCrj rats, Gann, 74, 365, 1983. 15. Deerberg, F. and Kaspareit, J., Endometrial carcinoma in BD II/Han rats: model of a spontaneous hormone-dependent tumor, J. Natl. Cancer Inst., 78, 1245, 1987. 16. Burek, J.D. and Hollander, C.F., Incidence patterns of spontaneous tumors in BN/Bi rats, J. Natl. Cancer Inst., 58, 99, 1977. 17. McDorman, K.S. and Wolf, D.C., Use of the spontaneous Tsc2 knockout (Eker) rat model of hereditary renal cell carcinoma for the study of renal carcinogens, Toxicol. Pathol., 30, 675, 2002. 18. Kim, U.K, Clifton H., and Furth J., A highly inbred strain of Wistar rats yielding spontaneous mammosomatropic pituitary and other tumors, J. Natl. Cancer Inst., 24, 1031, 1960. 19. Schardein, J.L., Fitzgerald, J.E., and Kaump, D.H., Spontaneous tumors in Holtzman-source rats of various ages, Pathol. Vet., 5, 238, 1968. 20. Prejean, J.D. et al., Spontaneous tumors in Sprague-Dawley rats and Swiss mice, Cancer Res., 33, 2768, 1973. 21. Trouillas, J. et al. Spontaneous pituitary tumors in the Wistar/Furth/Ico rat strain. An animal model of human prolactin adenoma, Am. J. Pathol., 109, 57, 1982. 22. Trouillas, J. and Girod, C., Animal models of human pituitary tumors, Pathol. Res. Pract., 183, 638, 1988. 23. Nakazawa, M. et al., Spontaneous neoplastic lesions in aged Sprague-Dawley rats. Exp. Anim., 50, 99, 2001. 24. Swanborg, R.H., Experimental autoimmune encephalomyelitis in the rat: lessons in T-cell immunology and autoreactivity, Immunol. Rev., 184, 129, 2001. 25. Brosnan. J.V. et al., Disease patterns in experimental allergic neuritis (EAN) in the Lewis rat. Is EAN a good model for the Guillain-Barre syndrome? J. Neurol. Sci., 88, 261, 1988. 26. Maurer, M. and Gold, R., Animal models of immune-mediated neuropathies, Curr. Opin. Neurol., 15, 617, 2002. 27. Sasamoto, Y. et al., Interphotoreceptor retinoid-binding protein derived peptide can induce experimental autoimmune uveoretinitis in various rat strains, Curr. Eye Res., 13, 845, 1994. 28. Lorentzen, J.C. et al., Protracted, relapsing and demyelinating experimental autoimmune encephalomyelitis in DA rats immunized with syngeneic spinal cord and incomplete Freund’s adjuvant, J. Neuroimmunol., 63, 193, 1995. 29. Link, H. and Xiao, B.-G., Rat models as tool to develop new immunotherapies, Immunol. Rev., 184, 117, 2001. 30. Holmdahl, R. et al., Arthritis induced in rats with nonimmunogenic adjuvants as models for rheumatoid arthritis, Immunol. Rev., 184, 184, 2001. 31. Waksman, B.H., Immune regulation in adjuvant disease and other arthritis models: relevance to pathogenesis of chronic arthritis, Scand. J. Immunol., 56, 12, 2002. 32. Ramanathan, S. and Poussier, P., BB rat lyp mutation and type 1 diabetes, Immunol. Rev., 184, 161, 2001. 33. Festing M.F.W. and Staats J., Standardized nomenclature for inbred strains of rats: Fourth listing, Transplantation, 16, 221, 1973. 34. Committee on Rat Nomenclature, Definition, nomenclature, and conservation of rat strains, I.L.A.R. News, 34, s1, 1992. 35. Bogden, A.E. and Aptekman, P.M., The “R-1” factor is a histocompatibility antigen in the rat, Cancer Res., 20, 1272, 1960. 36. Würzburg, U., Correlation between the immune response to an enzyme and histocompatibility in rats, Eur. J. Immunol., 1, 496, 1971. 37. Gill, T.J., 3rd et al., The rat as an experimental animal, Science, 245, 269, 1989. 38. Günther, E. and Walter, L., The major histocompatibility complex of the rat (Rattus norvegicus), Immunogenetics, 53, 520, 2001. 39. Metzger, R. et al., Organ-specific maturation of the major histocompatibility antigens in rats, Pediatr. Surg. Int., 18, 640, 2002.
1391_C05.fm Page 107 Tuesday, November 18, 2003 4:59 PM
RAT IMMUNE SYSTEM
107
40. Locker, J. et al., The rat MHC and cystathionine beta-synthase gene are syntenic on chromosome 20, Immunogenetics, 31, 271, 1990. 41. Helou, K. et al., Cytogenetic orientation of the rat major histocompatibility complex (MHC) on chromosome 20, Immunogenetics, 47, 166, 1998. 42. Walter, L. et al., Physical mapping of the major histocompatibility complex class II and class III regions of the rat, Immunogenetics, 54, 268, 2002. 43. Canzian, F., Phylogenetics of the laboratory rat Rattus norvegicus, Genome Res., 7, 262, 1997. 44. Hedrich, H.J., Catalogue of mutant genes and polymorphic loci. RT1, in Genetic Monitoring of Inbred Strains of Rats, Hedrich, H.J., Ed., Gustav Fischer, Stuttgart, 1990, p. 381. 45. Vestberg, M. et al., Limited polymorphism in the first domain of the rat MHC class II RT1-D molecule, Immunogenetics, 48, 344, 1998. 46. Walter, L. and Günther, E., Physical mapping and evolution of the centromeric class I gene-containing region of the rat MHC, Immunogenetics, 51, 829, 2000. 47. Gill, T.J., 3rd et al., Current status of the genetic and physical maps of the major histocompatibility complex in the rat, Transpl. Proc., 29, 1657, 1997. 48. Helou, K. et al., Cytogenetic orientation of the rat major histocompatibility complex (MHC) on chromosome 20, Immunogenetics, 47, 166, 1998. 49. Günther, E. and Walter, L., Comparative genomic aspects of rat, mouse and human MHC class I gene regions, Cytogenet. Cell Genet., 91, 107, 2000. 50. Dressel, R., Walter, L., and Gunther, E., Genomic and funtional aspects of the rat MHC, the RT1 complex, Immunol. Rev., 184, 82, 2001. 51. Ioannidu, S. et al., Physical map and expression profile of genes of the telomeric class I gene region of the rat MHC, J. Immunol., 166, 3957, 2001. 52. Monden, Y., Quantitative evaluation of total cell number and cellular density of the thymolymphatic organs of young albino rats by means of DNA determinations, Okajimas Folia Anat., 32, 193, 1959. 53. Lundin, P.M. and Angervall, L., Effect of insulin on rat lymphoid tissue, Pathol. Eur. 5, 273, 1970. 54. McLean, J.M., Mosley, J.G., and Gibbs, A.C., Changes in the thymus, spleen and lymph nodes during pregnancy and lactation in the rat, J. Anat., 118, 223, 1974. 55. Trepel. F., Number and distribution of lymphocytes in man. A critical analysis, Klin. Wochenschr., 52, 511, 1974. 56. Forster, P.M., McLean, J.M., and Gibbs, A.C., Lymphoid response to pregnancy and pseudopregnancy in the rat, J. Anat., 128, 837, 1979. 57. Klausen, B. and Hougen, H.P., Quantitative studies of lymphoid organs, blood and lymph in inbred athymic and euthymic LEW rats under germfree and specified-pathogen-free conditions, Lab. Anim., 21, 342, 1987. 58. Schermer, S., The Blood Morphology of Laboratory Animals, 3rd ed., F.A. Davis Co., Philadelphia, 1967. 59. Gowans, J.L., The recirculation of lymphocytes from blood to lymph in the rat, J. Physiol., 146, 54, 1959. 60. Fossum, S., Smith, M.E., and Ford, W.L., The recirculation of T and B lymphocytes in the athymic, nude rat, Scand. J. Immunol., 17, 551, 1983. 61. Fossum, S., Smith, M.E., and Ford, W.L., The migration of lymphocytes across specialized vascular endothelium VII. The migration of T and B lymphocytes from the blood of the athymic, nude rat, Scand. J. Immunol., 17, 539, 1983. 62. Smith, M.E. and Ford, W.L., The recirculating lymphocyte pool of the rat: a systematic description of the migratory behaviour of recirculating lymphocytes, Immunology, 49, 83, 1983. 63. Westermann, J. et al., Random entry of circulating lymphocyte subsets into peripheral lymph nodes and Peyer’s patches: no evidence in vivo of a tissue-specific migration of B and T lymphocytes at the level of high endothelial venules, Eur. J. Immunol., 22, 2219, 1992. 64. Blaschke, V. et al., Lymphocyte traffic through lymph nodes and Peyer’s patches of the rat: B- and T-cell-specific migration patterns within the tissue, and their dependence on splenic tissue, Cell Tissue Res., 282, 377, 1995. 65. Westermann, J. et al., Proliferation of lymphocyte subsets in the adult rat: a comparison of different lymphoid organs, Eur. J. Immunol., 19, 1087, 1989. 66. Quaglino, D. and Ronchetti, I. P., Cell death in the rat thymus: a minireview, Apoptosis, 6, 389, 2001.
1391_C05.fm Page 108 Tuesday, November 18, 2003 4:59 PM
108
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
67. Miller, J.F., The discovery of thymus function and of thymus-derived lymphocytes, Immunol. Rev., 185, 7, 2002. 68. Sprent, J. and Kishimoto, H., The thymus and negative selection, Immunol. Rev., 185, 126, 2002. 69. Hünig, T. et al., A monoclonal antibody to a constant determinant of the rat T cell antigen receptor that induces T cell activation. Differential reactivity with subsets of immature and mature T lymphocytes, J. Exp. Med., 169, 73, 1989. 70. Quaglino, D. et al., Age-dependent remodeling of rat thymus. Morphological and cytofluorimetric analysis from birth up to one year of age, Eur. J. Cell Biol., 76, 156, 1998. 71. Capri, M. et al., A cytofluorimetric study of T lymphocyte subsets in rat lymphoid tissues (thymus, lymph nodes) and peripheral blood: a continuous remodelling during the first year of life, Exp. Gerontol., 35, 613, 2000. 72. Surh, C.D. and Sprent, J., Long-term xenogeneic chimeras. Full differentiation of rat T and B cells in SCID mice, J. Immunol., 147, 2148, 1991. 73. Paterson, D.J. and Williams, A.F., An intermediate cell in thymocyte differentiation that expresses CD8 but not CD4 antigen, J. Exp. Med., 166, 1603, 1987. 74. Lawetzky, A., Kubbies, M., and Hünig, T., Rat “first-wave” mature thymocytes: cycling lymphoblasts that are sensitive to activation-induced cell death but rescued by interleukin 2, Eur. J. Immunol., 21, 2599, 1991. 75. Park, J.H. et al., T cell receptor ligation induces interleukin (IL) 2R beta chain expression in rat CD4,8 double positive thymocytes, initiating an IL-2-dependent differentiation pathway of CD8 alpha+/betaT cells, J. Exp. Med., 177, 541, 1993. 76. Schorle, H. et al., Development and function of T cells in mice rendered interleukin-2 deficient by gene targeting, Nature, 352, 621, 1991. 77. Bommhardt, U. et al., Signals through CD8 or CD4 can induce commitment to the CD4 lineage in the thymus, Eur. J. Immunol., 27, 1152, 1997. 78. Mitnacht, R. et al., Opposite CD4/CD8 lineage decisions of CD4+8+ mouse and rat thymocytes to equivalent triggering signals: correlation with thymic expression of a truncated CD8 alpha chain in mice but not rats, J. Immunol., 160, 700, 1998. 79. Drenckhahn, D. and Wagner, J., Stress fibres in the splenic sinus endothelium in situ: molecular structure, relationship to the extracellular matrix, and contractility, J. Cell Biol., 102, 1738, 1986. 80. Steiniger, B. and Barth, P., Microanatomy and function of the spleen, Adv. Anat. Embryol. Cell Biol., 151, 1, 2000. 81. Kumararatne, D.S., Bazin, H., and MacLennan, I.C.M., Marginal zones: the major B cell compartment of rat spleens, Eur. J. Immunol., 11, 858, 1981. 82. Brelinska, R. and Pilgrim, C., Macrophages and interdigitating cells: their relationship to migrating lymphocytes in the white pulp of rat spleen, Cell Tissue Res., 233, 671, 1983. 83. Nieuwenhuis, P. and Ford, W.L., Comparative migration of B- and T-lymphocytes in the rat spleen and lymph nodes, Cell Immunol., 23, 254, 1976. 84. van Ewijk, W. and Nieuwenhuis, P., Compartments, domains and migration pathways of lymphoid cells in the splenic pulp, Experimentia, 4, 199, 1985. 85. Probst, H.C. et al., Inducible transgenic mice reveal resting dendritic cells as potent inducers of CD8+ T cell tolerance, Immunity, 18, 713, 2003. 86. Steiniger, B., Barth, P., and Hellinger, H., The perifollicular and marginal zones of the human splenic white pulp. Do fibroblasts guide lymphocyte immigration? Am. J. Pathol., 159, 501, 2001. 87. Förster, R. et al., CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs, Cell, 99, 23, 1999. 88. Ansel, K.M. et al. A chemokine-driven positive feedback loop organizes lymphoid follicles, Nature, 406, 309, 2000. 89. Tew, J.G. et al., Follicular dendritic cells and presentation of antigen and costimulatory signals to B cells, Immunol. Rev., 156, 39, 1997. 90. Jacob, J. and Kelsoe, G., In situ studies of the primary immune response to (4-hydroxy-3-nitophenyl)acetyl. II. A common clonal origin for periarteriolar lymphoid sheath-associated foci and germinal centers, J. Exp. Med., 176, 679, 1992. 91. MacLennan, I.C.M. et al., The changing preference of T and B cells for partners as T-dependent antibody responses develop, Immunol. Rev., 156, 53, 1997.
1391_C05.fm Page 109 Tuesday, November 18, 2003 4:59 PM
RAT IMMUNE SYSTEM
109
92. Küppers, R. et al., Tracing B cell development in human germinal centres by molcular analysis of single cells picked from histological sections, EMBO J., 12, 4955, 1993. 93. Smith, K.G.C. et al., The phenotype and fate of the antibody-forming cells of the splenic foci, Eur. J. Immunol., 26, 444, 1996. 94. Toellner, K-M. et al., Immunoglobulin switch transcript production in vivo related to the site and time of antigen-specific B cell activation, J. Exp. Med., 183, 2303, 1996. 95. Kraal, G., Cells in the marginal zone of the spleen, Int. Rev. Cytol., 132, 31, 1992. 96. Liu, Y-J., Oldfield, S., and MacLennan, I.C.M., Memory B cells in T cell-dependent antibody responses colonize the splenic marginal zones, Eur. J. Immunol., 18, 355, 1988. 97. Liu, Y-J., Sites of B lymphocyte selection, activation, and tolerance in spleen, J. Exp. Med., 186, 625, 1997. 98. Gray, D. et al., Migrant m+d+ and static m+ d- B lymphocyte subsets, Eur. J. Immunol., 12, 564, 1982. 99. Dammers, P.M. et al., The origin of marginal zone B cells in the rat, Eur. J. Immunol., 29, 1522, 1999. 100. Liu, Y-J. et al., Sites of specific B cell activation in primary and secondary responses to T celldependent and T cell-independent antigens, Eur. J. Immunol., 21, 2951, 1991. 101. Hosea, S.W. et al., Impaired immune response of splenectomised patients to polyvalent pneumococcal vaccine, Lancet, 1, 804, 1981. 102. Timens, W., The human spleen and the immune system: not just another lymphoid organ. Res. Immunol., 142, 316, 1991. 103. Dammers, P.M. et al., Most marginal zone B cells in rat express germline encoded Ig VH genes and are ligand selected, J. Immunol., 165, 6156, 2000. 104. Chen, X. et al., Evidence for selection of a population of multi-reactive B cells into the splenic marginal zone, Int. Immunol., 9, 27, 1997. 105. Candinas, D. et al., T cell independence of macrophage and natural killer cell infiltration, cytokine production, and endothelial activation during delayed xenograft rejection, Transplantation, 62, 1920, 1996. 106. Gray, D. et al., Relation of intra-splenic migration of marginal zone B cells to antigen localization on follicular dendritic cells, Immunology, 52, 659, 1984. 107. Pettersen, J.C., Borgen, D.F., and Graupner, K.C., A morphological and histochemical study of the primary and secondary immune responses in the rat spleen, Am. J. Anat., 121, 305, 1967. 108. Steiniger, B. and van der Meide, P.H., High-dose interferon-gamma alters the distribution of B lymphocytes and macrophages in rat spleen and lymph nodes, Immunology, 78, 461, 1993. 109. Dijkstra, C.D. et al., The heterogeneity of mononuclear phagocytes in lymphoid organs: distinct macrophage subpopulations in the rat recognized by monoclonal antibodies ED1, ED2 and ED3, Immunology, 54, 589, 1985. 110. van den Berg, T.K. et al., Sialoadhesin on macrophages: its identification as a lymphocyte adhesion molecule. J. Exp. Med., 176, 647, 1992. 111. Humphrey, J.H., Splenic macrophages: antigen presenting cells for TI-2 antigens. Immunol. Lett., 11, 149, 1985. 112. Humphrey, J.H. and Grennan, D., Different macrophage populations distinguished by means of fluorescent polysaccharides. Recognition and properties of marginal-zone macrophages, Eur. J. Immunol., 11, 221, 1981. 113. Hünig, T. et al., A monoclonal antibody to a constant determinant of the rat T cell antigen receptor that induces T cell activation, J. Exp. Med., 169, 73, 1989. 114. Woollett, G.R. et al., Molecular and antigenic heterogeneity of the rat leukocyte-common antigen from thymocytes and T and B lymphocytes, Eur. J. Immunol., 15, 168, 1985. 115. Matsuno, K., Ezaki, T., and Kotani, M., Splenic outer periarterial lymphoid sheath (PALS): an immunoproliferative microenvironment constituted by antigen-laden marginal metallophils and ED2positive macrophages in the rat, Cell Tissue Res., 257, 459, 1989. 116. van den Berg, T.K., Döpp, E.A., and Dijkstra, C.D., Rat macrophages: membrane glycoproteins in differentiation and function. Immunol. Rev., 184, 45, 2001. 117. Wacker, H.H., Sinuswandzellen. Immunakzessorische Zellen des Lymphknotensinus, Prog. Pathol., 143, 1, 1994. 118. Bazin, H., Beckers, A., and Querinjean, P., Three classes and four (sub)classes of rat immunoglobulins: IgM, IgA, IgE and IgG1, IgG2a, IgG2b, IgG2c, Eur. J. Immunol., 4, 44, 1974.
1391_C05.fm Page 110 Tuesday, November 18, 2003 4:59 PM
110
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
119. Bruggemann, M., Evolution of the rat immunoglobulin gamma heavy-chain gene family, Gene, 74, 473, 1988. 120. McGhee, J.R., Michalek, S.M., and Ghanta, V.K., Rat immunoglobulins in serum and secretions: purification of rat IgM, IgA and IgG and their quantitation in serum, colostrum, milk and saliva, Immunochemistry, 12, 817, 1975. 121. Pauwels, R. et al., The measurement of total serum IgE levels in rats, J. Immunol. Methods, 18, 133, 1977. 122. Rieh, B. and Dietzel-Rohl, L., Immunoglobulin G2a levels in SPF rats. 3. Selection of samples for quality control with special reference to the neonatal group, Z. Versuchstierkd., 24, 318, 1982. 123. Bazin, H. et al., Genetic regulation of immunoglobulin synthesis: selection of two rats' lines with respectively a high or low IgM serum level, J. Immunogenet. 10, 293, 1983. 124. Kratz, A. and Lewandrowski, K.B., Case records of the Massachusetts General Hospital. Weekly clinicopathological exercises. Normal reference laboratory values, N. Engl. J. Med., 339, 1063, 1998. 125. van Dijk, M.A. and van de Winkel, J.G., Human antibodies as next generation therapeutics, Curr. Opin. Chem. Biol., 5, 368, 2001. 126. Aguilar, B.A. and Gutman, G.A., Transcription and diversity of immunoglobulin lambda chain variable genes in the rat, Immunogenetics, 37, 39, 1992. 127. Bazin, H. et al., Allotypes of rat immunoglobulins. I. An allotype at the alpha-chain locus, J. Immunol., 112, 1035, 1974. 128. Beckers, A., Querinjean, P., and Bazin, H., Allotypes of rat immunoglobulins. II. Distribution of the allotypes of kappa and alpha chain loci in different inbred strains of rats, Immunochemistry, 11, 605, 1974. 129. Rokhlin, O, V. and Nezlin, R.S., RL allotypes of light chains of rat immunoglobulins: ratio in heterozygous rats and distribution among inbred and random-bred rats, Scand. J. Immunol., 3, 209, 1974. 130. Gutman, G.A., Loh, E., and Hood, L., Structure and regulation of immunoglobulins: kappa allotypes in the rat have multiple amino-acid differences in the constant region, Proc. Natl. Acad. Sci., 72, 5046, 1975. 131. Nezlin, R. and Rokhlin, O., Allotypes of light chains of rat immunoglobulins and their application to the study of antibody biosynthesis, Contemp. Top. Mol. Immunol., 5, 161, 1976. 132. Gutman, G.A., Genetic and structural studies on rat kappa chain allotypes, Transpl. Proc., 13, 1483, 1981. 133. Medgyesi, G.A. et al., Fc receptors of rat peritoneal macrophages: immunoglobulin class specificity and sensitivity to drugs affecting the microfilament or microtubule system, Immunology, 40, 317, 1980. 134. Tolnay, M. et al., Interaction between rat peritoneal macrophages and sensitised erythrocytes: dependence on IgG subclass, antibody density and the degree of hapten conjugation, Mol. Immunol., 29, 385, 1992. 135. Miklos, K. et al., Rat IgG subclasses mediating binding and phagocytosis of target cells by homologous macrophages, Mol. Immunol., 30, 1273, 1993. 136. van de Winkel, J.G., and Capel, P.J., General characteristics of human IgG Fc receptors, in Human IgG Fc Receptors (Molecular Biology Intelligence Unit), van de Winkel, J.G. and Capel, P.J., Eds., Chapman & Hall, London, 1996, p. 7. 137. Hale, G., Clark, M., and Waldmann, H., Therapeutic potential of rat monoclonal antibodies: isotype specificity of antibody-dependent cell-mediated cytotoxicity with human lymphocytes, J. Immunol., 34, 3056, 1985. 138. Chassoux, D.M. et al., K-cell-mediated cytotoxicity induced with rat monoclonal antibodies. I. Antibodies of various isotypes differ in their ability to induce cytotoxicity mediated by rat and human effectors, Immunology, 65, 623, 1988. 139. Medgyesi, G.A. et al., Classes and subclasses of rat antibodies: reaction with the antigen and interaction of the complex with the complement system, Immunology, 43, 171, 1981. 140. Farkas, A.I. et al., Immunogenicity of antigen complexed with antibody. I. Role of different isotypes, Immunology, 45, 483, 1982. 141. Rits, M. et al., Complement-mediated solubilization of rat IgA immune precipitates, Mol. Immunol., 24, 1047, 1987.
1391_C05.fm Page 111 Tuesday, November 18, 2003 4:59 PM
RAT IMMUNE SYSTEM
111
142. Pluschke, G. et al., Isolation of rat IgM to IgG hybridoma isotype switch variants and analysis of the efficiency of rat Ig in complement activation, Eur. J. Immunol., 19, 131, 1989. 143. Smith, L.C., Azumi, K., and Nonaka, M., Complement systems in invertebrates. The ancient alternative and lectin pathways, Immunopharmacology, 42, 107, 1999. 144. Tomlinson, S., Complement defense mechanisms, Curr. Opin. Immunol., 5, 83, 1993. 145. Volanakis, J.E., The role of complement in innate and adaptive immunity, Curr. Top. Microbiol. Immunol., 266, 41, 2002. 146. Miwa, T., Song, W.C., Membrane complement regulatory proteins: insight from animal studies and relevance to human diseases, Int. Immunopharmacol., 1, 445, 2001. 147. Caragine, T.A. et al., Expression of rat complement control protein Crry on tumor cells inhibits rat natural killer cell-mediated cytotoxicity, Blood, 100, 3304, 2002. 148. Mead, R., Hinchliffe, S.J., and Morgan, B.P., Molecular cloning, expression and characterization of the rat analogue of human membrane cofactor protein (MCP/CD46), Immunology, 98, 137, 1999. 149. Brooks, S., A method for measuring the normal blood volume of the rat using (125-I)labelled albumin, Aust. J. Exp. Biol. Med. Sci., 49, 241, 1971. 150. Yale, C.E. and Torhorst, J.B., Critical bleeding and plasma volumes of the adult germfree rat, Lab. Anim. Sci., 22, 497, 1972. 151. Libermann, I.M. et al., Blood acid-base status in normal albino rats, Lab. Anim. Sci., 23, 862, 1973. 152. Ringler, D.H. and Dabich, L., Hematology and clinical biochemistry, in The Laboratory Rat, Vol. 1, Biology and Diseases, Baker, H.J., Lindsey, J.R., and Weisbroth S.H., Eds., Academic Press, New York, 1979, p. 105. 153. Valet, G. et al., Der nachweis verscheidener erythrozyten populationen bei der ratte, Blut, 24, 42, 1972. 154. Schermer S., The Blood Morphology of Laboratory Animals, 3rd ed., F.A. Davis Co., Philadelphia, 1967. 155. Wolford, S.T. et al., Reference range data base for serum chemistry and hematology values in laboratory animals, J. Toxicol. Environ. Health, 18, 161, 1986. 156. Wolford, S.T. et al., Age-related changes in serum chemistry and hematology values in normal Sprague-Dawley rats, Fundam. Appl. Toxicol., 8, 80, 1987. 157. Matsuzawa, T., Nomura, M., and Unno, T., Clinical pathology reference ranges of laboratory animals. Working Group II, Nonclinical Safety Evaluation Subcommittee of the Japan Pharmaceutical Manufacturers Association, J. Vet. Med. Sci., 55, 351, 1993. 158. Geaghan, S.M., Hematologic values and appearances in the healthy fetus, neonate, and child, Clin. Lab. Med., 19, 1, 1999. 159. Marone, G. et al., Molecular and cellular biology of mast cells and basophils, Int. Arch. Allergy Immunol., 114, 207, 1997. 160. Metcalfe, D.D., Baram, D., and Mekori, Y.A., Mast cells, Physiol. Rev., 77, 1033, 1997. 161. Woolley, D.E., The mast cell in inflammatory arthritis, N. Engl. J. Med., 348, 1709, 2003. 162. Ishizaka, T. et al., A new concept of triggering mechanisms of IgE-mediated histamine release, J. Allergy Clin. Immunol., 61, 320, 1978. 163. Bochner, B.S. and Schleimer, R.P., Mast cells, basophils, and eosinophils: distinct but overlapping pathways for recruitment, Immunol. Rev., 179, 5, 2001. 164. Bassett, E.G. et al., Comparison of collagenase activity in eosinophil and neutrophil fractions from rat peritoneal exudates, Aust. J. Exp. Biol. Med. Sci., 54, 459, 1976. 165. Bassett, E.G., Baker, J.R., and de Souza, P., A light microscopical study of healing incised dermal wounds in rats, with special reference to eosinophil leucocytes and to the collagenous fibres of the periwound areas, Br. J. Exp. Pathol., 58, 581, 1977. 166. Kitamura, Y. et al., Development of mast cells and basophils: processes and regulation mechanisms, Am. J. Med. Sci. 306, 185, 1993. 167. Gibson, S. et al., Phenotypic expression of mast cell granule proteinases. Distribution of mast cell proteinases I and II in the rat digestive system, Immunology, 62, 621, 1987. 168. Urade, Y. et al., Mast cells contain spleen-type prostaglandin D synthetase, J. Biol. Chem., 265, 371, 1990. 169. Heavey, D.J. et al., Generation of leukotriene C4, leukotriene B4, and prostaglandin D2 by immunologically activated rat intestinal mucosa mast cells, J. Immunol., 140, 1953, 1988.
1391_C05.fm Page 112 Tuesday, November 18, 2003 4:59 PM
112
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
170. Hogaboam, C.M. et al., Platelet-activating factor synthesis by peritoneal mast cells and its inhibition by two quinoline-based compounds, Br. J. Pharmacol., 105, 87, 1992. 171. Moretti, G. et al., The quantitative behavior of cutaneous histamine and mast cells in the hair cycles of rats, J. Invest. Dermatol., 46, 231, 1966. 172. Fredholm, B. and Hagermark, O., Studies on histamine release from skin and from peritoneal mast cells of the rat induced by heat, Acta Derm. Venereol., 50, 273, 1970. 173. Yurt, R.W., Leid R.W., and Austen K.F., Native heparin from rat peritoneal mast cells, J. Biol. Chem., 252, 518, 1977. 174. Seldin, D.C., Austen, K.F., and Stevens, R.L., Purification and characterization of protease-resistant secretory granule proteoglycans containing chondroitin sulfate di-B and heparin-like glycosaminoglycans from rat basophilic leukemia cells, J. Biol. Chem., 260, 11131, 1985. 175. Kirshenbaum, A., Regulation of mast cell number and function, Hematol. Oncol. Clin. North Am., 14, 497, 2000. 176. Beil, W.J., Schulz, M., and Wefelmeyer, U., Mast cell granule composition and tissue location-a close correlation, Histol. Histopathol., 15, 937, 2000. 177. Spits, H., Lanier, L.L., and Phillips, J.H., Development of human T and natural killer cells, Blood, 85, 2654, 1995. 178. Kärre, K. et al., Selective rejection of H-2-deficient lymphoma variants suggests alternative immune defence strategy, Nature, 319, 675, 1986. 179. Biron, C.A., Activation and function of natural killer cell responses during viral infections, Curr. Opin. Immunol., 9, 24, 1997. 180. Baxter, A.G. and Smyth, M.J., The role of NK cells in autoimmune disease, Autoimmunity, 35, 1, 2002. 181. Matsumoto, Y. et al., Role of natural killer cells and TCR gamma delta T cells in acute autoimmune encephalomyelitis, Eur. J. Immunol., 28, 1681, 1998. 182. Smeltz, R.B., Wolf, N.A., and Swanborg, R.H., Inhibition of autoimmune T cell responses in the DA rat by bone marrow-derived NK cells in vitro: implications for autoimmunity, J. Immunol., 163, 1390. 1999. 183. Iwakoshi, N.N. et al., Diabetes prone BB rats are severely deficient in natural killer T cells, Autoimmunity, 31, 1, 1999. 184. Nakamura, N. et al., Intrinsic cytotoxicity of natural killer cells to pancreatic islets in vitro, Diabetes, 39, 836, 1990. 185. Reynolds, C.W. et al., Natural killer activity in the rat. II. Analysis of surface antigens on LGL by flow cytometry, J. Immunol., 127, 2204, 1981. 186. Woda, B.A. et al., Separation and isolation of rat natural killer (NK) cells from T cells with monoclonal antibodies, J. Immunol., 132, 2183, 1984. 187. Vujanovic, N.L. et al., Lymphokine-activated killer cells in rats: analysis of progenitor and effector cell phenotype and relationship to natural killer cells, Cancer Res., 48, 884, 1988. 188. Maghazachi, A.A. et al. Lymphokine-activated killer cells in rats. IV. Developmental relationships among large agranular lymphocytes, large granular lymphocytes, and lymphokine-activated killer cells, J. Immunol., 140, 2846, 1988. 189. Sarneva, M. et al., Lymphokine-activated killer cells in rats: generation of natural killer cells and lymphokine-activated killer cells from bone marrow progenitor cells, Cell. Immunol., 118, 448, 1989. 190. Lanier, L.L. et al., Antigenic, functional, and molecular genetic studies of human natural killer cells and cytotoxic T lymphocytes not restricted by the major histocompatibility complex, Fed. Proc., 45, 2823, 1986. 191. Salup, R.R., Mathieson, B.J., and Wiltrout, R.H., Precursor phenotype of lymphokine-activated killer cells in the mouse, J. Immunol., 138, 3635, 1987. 192. Mason, L.H., Mathieson, B.J., and Ortaldo, J.R., Natural killer (NK) cell subsets in the mouse. NK1.1+/LGL-1+ cells restricted to lysing NK targets, whereas NK-1.1+/LGL-1- cells generate lymphokine-activated killer cells, J. Immunol., 145, 751, 1990. 193. Kuribayashi, K. et al., Murine NK cell cultures: effects of interleukin-2 and interferon on cell growth and cytotoxic reactivity, J. Immunol., 126, 2321, 1981. 194. Lanier, L.L., NK cell receptors, Ann. Rev. Immunol., 16, 359, 1998. 195. Lanier, L.L., Activating and inhibitory NK cell receptors, Adv. Exp. Med. Biol., 452, 13, 1998.
1391_C05.fm Page 113 Tuesday, November 18, 2003 4:59 PM
RAT IMMUNE SYSTEM
113
196. Rolstad, B. et al., Positive and negative MHC class I recognition by rat NK cells, Immunol. Rev., 155, 91, 1997. 197. Rolstad, B. et al., Rat natural killer cell receptor systems and recognition of MHC class I molecules, Immunol. Rev., 181, 149, 2001. 198. Mason, D.W. et al., Functions of rat T-lymphocyte subsets isolated by means of monoclonal antibodies, Immunol. Rev., 74, 57, 1983. 199. Powrie, F. et al., Lineage relationships and functions of CD4+ T-cell subsets in the rat, Res. Immunol., 142, 54, 1991. 200. Damoiseaux, J.G. et al., A dominant role for the thymus and MHC genes in determining the peripheral CD4/CD8 T cell ratio in the rat, J. Immunol., 163, 2983, 1999. 201. Amadori, A. et al., Genetic control of the CD4/CD8 T-cell ratio in humans, Nat. Med., 1, 1279, 1995. 202. van Meerwijk, J.P. et al., Thymic lineage commitment rather than selection causes genetic variations in size of CD4 and CD8 compartments, J. Immunol., 160, 3649, 1998. 203. Barclay, A.N., The localization of populations of lymphocytes defined by monoclonal antibodies in rat lymphoid tissues, Immunology, 42, 593, 1981. 204. Jefferies, W.A., Green, J.R., and Williams, A.F., Authentic T helper CD4 (W3/25) antigen on rat peritoneal macrophages, J. Exp. Med., 162, 117, 1985. 205. Crocker, P.R. et al., Species heterogeneity in macrophage expression of the CD4 antigen, J. Exp. Med., 166, 613, 1987. 206. Powrie, F. and Mason, D., Subsets of rat CD4+ T cells defined by their differential expression of variants of the CD45 antigen: developmental relationships and in vitro and in vivo functions, Curr. Top. Microbiol. Immunol. 159, 79, 1990. 207. Westermann, J. et al., CD4+ T cells of both the naive and the memory phenotype enter rat lymph nodes and Peyer’s patches via high endothelial venules: within the tissue their migratory behavior differs, Eur. J. Immunol., 27, 3174, 1997. 208. Sakaguchi, S. et al., Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases, J. Immunol., 155, 1151, 1995. 209. Stephens, L.A. and Mason, D., Characterisation of thymus-derived regulatory T cells that protect against organ-specific autoimmune disease, Microbes Infect., 3, 905, 2001. 210. Kuhnlein, P. et al., Identification and characterization of rat gamma/delta T lymphocytes in peripheral lymphoid organs, small intestine, and skin with a monoclonal antibody to a constant determinant of the gamma/delta T cell receptor, J. Immunol., 153, 979, 1994. 211. Kuhnlein, P. et al., Gamma/delta T cells in fetal, neonatal, and adult rat lymphoid organs, Dev. Immunol., 4, 181, 1995. 212. Kuhnlein, P. et al., The canonical T cell receptor of dendritic epidermal gamma delta T cells is highly conserved between rats and mice, Eur. J. Immunol., 26, 3092, 1996. 213. Watson, D., Ando, T., and Knight, J.F., Sequence and diversity of the rat delta T-cell receptor, Immunogenetics, 51, 714, 2000. 214. Lawetzky, A. et al., Identification and characterization of rat T cell subpopulations expressing T cell receptors alpha/beta and gamma/delta, Eur. J. Immunol., 20, 343, 1990. 215. Winkler, G.C., Pulmonary intravascular macrophages in domestic animal species: review of structural and functional properties, Am. J. Anat., 181, 217, 1988. 216. Miot-Noirault, E. et al., Scintigraphic in vivo assessment of the development of pulmonary intravascular macrophages in liver disease: experimental study in rats with biliary cirrhosis, Chest, 120, 941, 2001. 217. van Furth, R. and Cohn, Z.A., The origin and kinetics of mononuclear phagocytes, J. Exp. Med., 128, 415, 1968. 218. Volkman, A., The origin and fate of the monocyte, Ser. Haematol., 3, 62, 1970. 219. Damoiseaux, J.G.M.C. et al., Rat macrophage lysosmal membrane antigen recognized by monoclonal antibody ED1, Immunology, 83, 140, 1994. 220. van den Berg, T.K., Döpp, E.A., and Dijkstra, C.D., Cellular binding mechanism on rat macrophages for sialylated glycoconjugates, inhibited by the monoclonal antibody ED3, J. Leukoc. Biol., 49, 434, 1991.
1391_C05.fm Page 114 Tuesday, November 18, 2003 4:59 PM
114
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
221. van den Berg, T.K. et al., Monoclonal antibodies against rat leukocyte surface antigens, Immunol. Rev., 184, 109, 2001. 222. Adams, S. et al., Signal-regulatory protein is selectively expressed by myeloid and neuronal cells, J. Immunol., 161, 1853, 1998. 223. Robinson, A.P., White, T.M., and Mason, D.W., Macrophage heterogeneity in the rat as delineated by two monoclonal antibodies MRC OX-41 and MRC OX-42, the latter recognizing complement receptor type 3, Immunology, 57, 239, 1986. 224. Steiniger, B. et al., Monocytes in the rat: phenotype and function during acute allograft rejection, Immunol. Rev., 184, 38, 2001. 225. Steinman, R.M. and Cohn, Z.A., Identification of a novel cell type in peripheral lymphoid organs of mice. I. Morphology, quantitation, tissue distribution, J. Exp. Med., 137, 1142, 1973. 226. Lanzavecchia, A., Mechanisms of antigen uptake for presentation, Curr. Opin. Immunol., 8, 348, 1996. 227. Inaba, K. et al., Efficient presentation of phagocytosed cellular fragments on the major histocompatibility complex class II products of dendritic cells, J. Exp. Med., 188, 2163, 1998. 228. Albert, M.L. et al., Immature dendritic cells phagocytose apoptotic cells via alphaVbeta5 and CD36, and cross-present antigens to cytotoxic T lymphocytes, J. Exp. Med., 188, 1359, 1998. 229. Banchereau, J. and Steinman, R.M., Dendritic cells and the control of immunity, Nature, 392, 245, 1998. 230. MacPherson, G.G. and Pugh, C.W., Heterogeneity amongst lymph-borne “dendritic” cells, Immunobiology, 168, 338, 1984. 231. Nelson, D.J. et al., Development of the airway intraepithelial dendritic cell network in the rat from class II major histocompatibility (Ia)-negative precursors: differential regulation of Ia expression at different levels of the respiratory tract, J. Exp. Med., 179, 203, 1994. 232. Hart, D.N. and Fabre, J.W., Demonstration and characterization of Ia-positive dendritic cells in the interstitial connective tissues of rat heart and other tissues, but not brain, J. Exp. Med., 154, 347, 1981. 233. Robinson, A.P., White, T.M., and Mason, D.W., Macrophage heterogeneity in the rat as delineated by two monoclonal antibodies MRC OX-41 and MRC OX-42, the latter recognizing complement receptor type 3, Immunology, 57, 239, 1986. 234. Brenan, M. and Puklavec, M., The MRC OX-62 antigen: a useful marker in the purification of rat veiled cells with the biochemical properties of an integrin, J. Exp. Med., 175, 1457, 1992. 235. Brenan, M. and Rees, D.J., Sequence analysis or rat integrin alphaE1 and alphaE2 subunits: tissue expression reveals phenotypic similarities between intraepithelial lymphocytes and dendritic cells in lymph, Eur. J. Immunol., 30, 1527, 2000. 236. Huang, F.P. et al., A discrete subpopulation of dendritic cells transports apoptotic intestinal epithelial cells to T cell areas of mesenteric lymph nodes, J Exp Med., 191, 435, 2000. 237. Liu, L.M. and MacPherson, G.G., Rat intestinal dendritic cells: immunostimulatory potency and phenotypic characterization, Immunology, 85, 88, 1995. 238. Liu, L. et al., Dendritic cell heterogeneity in vivo: two functionally different dendritic cell populations in rat intestinal lymph can be distinguished by CD4 expression, J. Immunol., 161, 1146, 1998. 239. Schon-Hegrad, M.A. et al., Studies on the density, distribution, and surface phenotype of intraepithelial class II major histocompatibility complex antigen (Ia)-bearing dendritic cells (DC) in the conducting airways, J. Exp. Med., 173, 1345, 1991. 240. Banchereau, J. et al., Immunobiology of dendritic cells, Ann. Rev. Immunol., 18, 767, 2000. 241. Banchereau, J., The long arm of the immune system, Sci. Am., 287, 52, 2002. 242. Pugh, C.W. and MacPherson, G.G., Non-lymphoid cells from rat intestinal lymph, Adv. Exp. Med. Biol., 149, 781, 1982. 243. Janeway, C.A., Jr., The immune system evolved to discriminate infectious nonself from noninfectious self, Immunol. Today, 13, 11, 1992. 244. Pugh, C.W., MacPherson, G.G., and Steer, H.W., Characterization of nonlymphoid cells derived from rat peripheral lymph, J. Exp. Med., 157, 1758, 1983. 245. MacPherson, G.G. et al., Endotoxin-mediated dendritic cell release from the intestine. Characterization of released dendritic cells and TNF dependence, J. Immunol., 154, 1317, 1995. 246. Mackay, C.R. et al., Lymphocyte subsets show marked differences in their distribution between blood and the afferent and efferent lymph of peripheral lymph nodes, J. Exp. Med., 167, 1755, 1988.
1391_C05.fm Page 115 Tuesday, November 18, 2003 4:59 PM
RAT IMMUNE SYSTEM
115
247. Fossum, S., Lymph-borne dendritic leucocytes do not recirculate, but enter the lymph node paracortex to become interdigitating cells, Scand. J. Immunol., 27, 97, 1988. 248. Blaschke, V. et al., Lymphocyte traffic through lymph nodes and Peyer’s patches of the rat: B- and T-cell-specific migration patterns within the tissue, and their dependence on splenic tissue, Cell Tissue Res., 282, 377, 1995. 249. Stumbles, P.A. et al., Resting respiratory tract dendritic cells preferentially stimulate T helper cell type 2 (Th2) responses and require obligatory cytokine signals for induction of Th1 immunity, J. Exp. Med., 188, 2019, 1998. 250. Klinkert, W.E., LaBadie, J.H., and Bowers, W.E., Accessory and stimulating properties of dendritic cells and macrophages isolated from various rat tissues, J. Exp. Med., 156, 1, 1982. 251. Bowers, W.E. and Berkowitz, M.R., Differentiation of dendritic cells in cultures of rat bone marrow cells, J. Exp. Med., 163, 872, 1986. 252. O’Keeffe, M. et al., Mouse plasmacytoid cells: long-lived cells, heterogeneous in surface phenotype and function, that differentiate into CD8(+) dendritic cells only after microbial stimulus, J. Exp. Med., 196, 1307, 2002. 253. McWilliam, A.S., Nelson, D.J., and Holt, P.G., The biology of airway dendritic cells, Immunol. Cell Biol., 73, 405, 1995. 254. Dinarello, C.A. and Savage, N., Interleukin-1 and its receptor, Crit. Rev. Immunol., 9, 1, 1989. 255. Bazan, J.F., Timans, J.C., and Kastelein, R.A., A newly defined interleukin-1? Nature, 379, 591, 1996. 256. Gray, P.W. et al., Two interleukin 1 genes in the mouse: cloning and expression of the cDNA for murine interleukin 1 beta, J. Immunol., 137, 3644, 1986. 257. March, C.J. et al., Cloning, sequence and expression of two distinct human interleukin-1 complementary DNAs, Nature, 315, 641, 1985. 258. Bergsteinsdottir, K. et al., Rat Schwann cells produce interleukin-1, J. Neuroimmunol., 34, 15, 1991. 259. O’Garra, A., Cytokines induce the development of functionally heterogeneous T helper cell subsets, Immunity, 8, 275, 1998. 260. Kashima, N. et al., Unique structure of murine interleukin-2 as deduced from cloned cDNAs, Nature, 313, 402, 1985. 261. Gillis, S., Smith, K.A., and Watson, J., Biochemical characterization of lymphocyte regulatory molecules. II. Purification of a class of rat and human lymphokines, J. Immunol., 124, 1954, 1980. 262. Mochizuki, D.Y., Watson, J., and Gillis, S., Biochemical separation of interleukin 2, J. Immunol. Methods, 39, 185, 1980. 263. Di Sabato, G., Purification and initial characterization of rat interleukin 2, Proc. Natl. Acad. Sci. 79, 3020, 1982. 264. McKnight, A.J. and Classon, B.J., Biochemical and immunological properties of rat recombinant interleukin-2 and interleukin-4, Immunology, 75, 286, 1992. 265. Thompson, L.P. and Di Sabato, G., Purification and characterization of two forms of rat interleukin2, Cell Immunol., 114, 12, 1988. 266. Matesanz, F., Alcina, A., and Pellicer, A., Existence of at least five interleukin-2 molecules in different mouse strains, Immunogenetics, 38, 300, 1993. 267. Richter, G., Blankenstein, T., and Diamantstein, T., Evolutionary aspects, structure, and expression of the rat interleukin 4 gene, Cytokine, 2, 221, 1990. 268. Richter, G. et al., The rat interleukin 4 receptor: coevolution of ligand and receptor, Cytokine, 7, 237, 1995. 269. van Snick, J. et al., cDNA cloning of murine interleukin-HP1: homology with human interleukin 6, Eur. J. Immunol., 18, 193, 1988. 270. Chiu, C.P. et al., Multiple biological activities are expressed by a mouse interleukin 6 cDNA clone isolated from bone marrow stromal cells, Proc. Natl. Acad. Sci., 85, 7099, 1988. 271. Northemann, W. et al., Structure of the rat interleukin 6 gene and its expression in macrophage-derived cells, J. Biol. Chem., 264, 16072, 1989. 272. Coulie, P.G., Stevens, M., and Van Snick, J., High- and low-affinity receptors for murine interleukin 6.Distinct distribution on B and T cells, Eur. J. Immunol., 19, 2107, 1989. 273. Lalani, I., Bhol, K., and Ahmed, A.R., Interleukin-10: biology, role in inflammation and autoimmunity, Ann. Allergy Asthma Immunol., 79, 469, 1997.
1391_C05.fm Page 116 Tuesday, November 18, 2003 4:59 PM
116
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
274. Feng, L. et al., Molecular cloning of rat cytokine synthesis inhibitory factor (IL-10) cDNA and expression in spleen and macrophages, Biochem. Biophys. Res. Commun., 192, 452, 1993. 275. Ball, C. et al., Rat interleukin-10: production and characterisation of biologically active protein in a recombinant bacterial expression system, Eur. Cytokine Netw., 12, 187, 2001. 276. Sun, B. et al., Evaluation of in vivo cytokine expression in EAU-susceptible and resistant rats: a role for IL-10 in resistance? Exp. Eye Res., 70, 493, 2000. 277. David, A. et al., Interleukin-10 produced by recombinant adenovirus prolongs survival of cardiac allografts in rats, Gene Ther., 7, 505, 2000. 278. Tsuruma, T. et al., Interleukin-10 reduces natural killer sensitivity and downregulates MHC class I expression on H-ras-transformed cells, Cell Immunol., 184, 121, 1998. 279. Ward, H. et al., The rat interleukin 10 receptor: cloning and sequencing of cDNA coding for the alphachain protein sequence, and demonstration by western blotting of expression in the rat brain, Cytokine, 15, 237, 2001. 280. Khalife, J. et al., Molecular cloning and sequencing of the rat interleukin-12 p40 gene, Eur. Cytokine Netw., 9, 69, 1998. 281. Aggarwal, B.B. and Natarajan, K., Tumor necrosis factors: developments during the last decade, Eur. Cytokine Netw., 7, 93, 1996. 282. Nedwin, G.E. et al., Human lymphotoxin and tumor necrosis factor genes: structure, homology and chromosomal localization, Nucleic Acids Res., 13, 6361, 1985. 283. Pennica, D. et al., Cloning and expression in Escherichia coli of the cDNA for murine tumor necrosis factor, Proc. Natl. Acad. Sci. U. S. A., 82, 6060, 1985. 284. Estler, H.C. et al., Rat tumor necrosis factor-alpha. Transcription in rat Kupffer cells and in vitro posttranslational processing based on a PCR-derived cDNA, Biol. Chem. Hoppe Seyler, 373, 271, 1992. 285. Kumar, S. and Hedges, S.B., A molecular timescale for vertebrate evolution, Nature, 392, 917, 1998. 286. Catzeflis, F.M. et al., DNA-DNA hybridization evidence of the rapid rate of muroid rodent DNA evolution, Mol. Biol. Evol., 4, 242, 1987. 287. O’hUigin, C. and Li, W.H., The molecular clock ticks regularly in muroid rodents and hamsters, J. Mol. Evol., 35, 377, 1992. 288. Li, W.H. et al., Molecular phylogeny of Rodentia, Lagomorpha, Primates, Artiodactyla, and Carnivora and molecular clocks, Proc. Natl. Acad. Sci. U. S. A., 87, 6703, 1990. 289. Male, D.K., Pryce, G., and Butcher, G.W., Serological evidence for a defect in RT1.B (I-A) expression by the BDIX rat strain, J. Immunogenet., 14, 301, 1987. 290. Kren, V., The major histocompatibility system (H-1) alleles of some British rat strains, Transplantation, 17, 148, 1974. 291. Kunz, H.W., RT1A (MHC), RT2, and RT3 (blood group) specificities of 44 inbred and congenic rat strains, I.L.A.R. News, 33, 1, 1991. 292. Arenas, O. et al., Comparison of the haplotypes of the major histocompatibility complex in the rat. V. A serological, genetic and numerical study of the RT1.A region antigens, J. Immunogenet., 8, 307, 1981. 293. Kato, H. et al., Molecular cloning of equine interleukin-1 alpha and -beta cDNAs, Vet. Immunol. Immunopathol., 48, 221, 1995. 294. McKnight, A.J., Mason, D.W., and Barclay, A.N., Sequence of rat interleukin 2 and anomalous binding of a mouse interleukin 2 cDNA probe to rat MHC class II-associated invariant chain mRNA, Immunogenetics, 30, 145, 1989. 295. Matesanz, F., Alcina, A., and Pellicer, A., Existence of at least five interleukin-2 molecules in different mouse strains, Immunogenetics, 38, 300, 1993. 296. Page, T.H. and Dallman, M.J., Molecular cloning of cDNAs for the rat interleukin 2 receptor alpha and beta chain genes: differentially regulated gene activity in response to mitogenic stimulation, Eur. J. Immunol., 21, 2133, 1991. 297. Bucan, M. et al., Comparative mapping of 9 human chromosome 22q loci in the laboratory mouse, Hum. Mol. Genet., 2, 1245, 1993. 298. Watanabe, T.K. et al., A radiation hybrid map of the rat genome containing 5,255 markers, Nat. Genet., 22, 27, 1999. 299. McKnight, A.J., Barclay, A.N., and Mason, D.W., Molecular cloning of rat interleukin 4 cDNA and analysis of the cytokine repertoire of subsets of CD4+ T cells, Eur. J. Immunol., 21, 1187, 1991.
1391_C05.fm Page 117 Tuesday, November 18, 2003 4:59 PM
RAT IMMUNE SYSTEM
117
300. Sehgal, P.B. et al., Human chromosome 7 carries the beta 2 interferon gene, Proc. Natl. Acad. Sci. U. S. A., 83, 5219, 1986. 301. Levan, G. et al., The gene map of the Norway rat (Rattus norvegicus) and comparative mapping with mouse and man, Genomics, 10, 699, 1991. 302. Szpirer, J. et al., The interleukin-6-dependent DNA-binding protein gene (transcription factor 5: TCF5) maps to human chromosome 20 and rat chromosome 3, the IL6 receptor locus (IL6R) to human chromosome 1 and rat chromosome 2, and the rat IL6 gene to rat chromosome 4, Genomics, 10, 539, 1991. 303. Baumann, M., Baumann, H., and Fey, G.H., Molecular cloning, characterization and functional expression of the rat liver interleukin 6 receptor, J. Biol. Chem., 265, 19853, 1990. 304. Sugita, T. et al., Functional murine interleukin 6 receptor with the intracisternal A particle gene product at its cytoplasmic domain. Its possible role in plasmacytomagenesis, J. Exp. Med., 171, 2001, 1990. 305. Kluck, P.M.C. et al., The human interleukin-6 receptor alpha-chain gene is localized on chromosome 1 band q21, Hum. Genet., 90, 542, 1993. 306. Dijkema, R. et al., Cloning and expression of the chromosomal immune interferon gene of the rat, EMBO J., 4, 761, 1985. 307. Dijkema, R. et al., Cloning, expression, and purification of rat IFN-gamma, Methods Enzymol., 119, 453, 1986. 308. Kirisits, M.J. et al., Mapping of the TNFA locus in the rat, Immunogenetics, 39, 59, 1994. 309. Masuyama, T. et al., An improved genetic linkage map of rat chromosome 20, Comp. Med., 50, 369, 2000. 310. Makalowski, W. and Boguski, M.S., Evolutionary parameters of the transcribed mammalian genome: an analysis of 2,820 orthologous rodent and human sequences, Proc. Natl. Acad. Sci. U. S. A., 95, 9407, 1998.
1391_C05.fm Page 118 Tuesday, November 18, 2003 4:59 PM
1391_C06.fm Page 119 Tuesday, November 18, 2003 5:03 PM
CHAPTER
6
Mouse Immune System Lawrence S. Chan and Kenneth B. Gordon
CONTENTS I. Introduction ........................................................................................................................120 II. Innate Immune System ......................................................................................................120 A. Membrane Receptors, Transcriptional Factors, and Soluble Factors .......................120 1. Toll-Like Receptors .............................................................................................120 a. TLR4 ..............................................................................................................121 b. TLR2 (TLR1 and TLR6)...............................................................................121 c. TLR5 ..............................................................................................................121 d. TLR9 ..............................................................................................................121 e. TLR3 ..............................................................................................................121 f. TLR7 ..............................................................................................................121 2. NF-kB Family of Transcriptional Factors...........................................................122 a. NF-kB ............................................................................................................122 b. IkB Proteins ...................................................................................................122 c. NF-kB Activation ..........................................................................................122 3. Defensins..............................................................................................................122 4. Cytokines .............................................................................................................123 a. Th1 vs. Th2....................................................................................................123 b. Cytokine Receptor Superfamilies..................................................................123 c. Cytokines in Mouse Immune System ...........................................................124 5. Chemokines..........................................................................................................124 6. Adhesion Molecules ............................................................................................125 7. Complement.........................................................................................................126 B. Immune Cells.............................................................................................................126 1. Natural Killer Cells .............................................................................................127 2. Mast Cells ............................................................................................................127 3. B-1 Cells and Natural Antibodies .......................................................................128 4. Interferon-Producing Cells ..................................................................................128 5. Gamma/Delta T Cells (gd T Cells) .....................................................................128 6. Intraepithelial Lymphocytes ................................................................................129 III. Adaptive Immune System..................................................................................................129 A. T Lymphocytes ..........................................................................................................129 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
119
1391_C06.fm Page 120 Tuesday, November 18, 2003 5:03 PM
120
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
B. B Lymphocytes (B-2 Cells).......................................................................................129 C. Antigen-Presenting Cells ...........................................................................................130 D. Major Histocompatibility Complex (MHC)..............................................................130 IV. Mice as an Essential Tool for Animal Modeling of Human Immune-Mediated Diseases ..............................................................................................................................130 A. Development and Nomenclature of Inbred Mouse Strains ......................................131 B. The Use of Inbred Mouse Strains .............................................................................131 C. Inbred Mouse Strains and Disease Susceptibility.....................................................132 D. Naturally Occurring Mutations of Mouse Immune System .....................................133 1. Severe Combined Immunodeficiency (SCID) Mice ...........................................133 2. Nude Mice ...........................................................................................................134 E. Experimentally Induced Alteration of Mouse Immune System ...............................134 1. RAG KO Mice.....................................................................................................134 2. Cytokine KO Mice ..............................................................................................134 3. Adhesion Molecule KO Mice .............................................................................134 4. Immune Cell KO Mice........................................................................................135 V. Conclusion..........................................................................................................................135 Acknowledgments ..........................................................................................................................135 References ......................................................................................................................................135
I. INTRODUCTION The mouse immune system is remarkably similar to that of humans, despite the existence of some variations [1–45]. In many ways, the mouse immune system is understood to a greater extent than the human system, due to the ability of researchers to use transgenic and knockout methods in mice to investigate the in vivo functions of immune components, one at a time. The organization and function of the human immune system have been described in substantial detail in Chapter 3. To avoid unnecessary repetition, the goal of this chapter is to highlight the essential facts about the mouse immune system in fulfilling the purpose of a comparative analysis between the mouse and human immune systems, without significant elaboration. However, features of mouse immune system distinct from the human counterpart, will be discussed in greater detail.
II. INNATE IMMUNE SYSTEM The innate (natural) immune system is traditionally considered to be the front line of immune defense that is instantly available without the need of prior encounter, as required in the adaptive (acquired) immune system. This division, however, is somewhat artificial. The current understanding of the innate immune system has led us to conclude that the innate and adaptive immune systems are not mutually exclusive, whether in components or in functions, but rather that they are strongly linked to provide an optimal immune defense for the entire body [34,46,47]. Many of the components described in the innate system actually actively participate in development and regulation of the adaptive system [3,7,8,10,11,13–15,17,26,33–36,38]. A. Membrane Receptors, Transcriptional Factors, and Soluble Factors 1. Toll-Like Receptors Toll-like receptors (TLRs) are considered to the primary sensors of the innate immune system and are important in the host defense against pathogenic microorganisms, as they are capable of
1391_C06.fm Page 121 Tuesday, November 18, 2003 5:03 PM
MOUSE IMMUNE SYSTEM
121
recognizing conserved motifs in pathogens known as pathogen-associated molecular patterns (PAMPs) in bacteria, fungi, and viruses [4,6,7]. The first human homologue of the Drosophila protein Toll was identified in 1997 — hence the term, “Toll-like receptor.” Since then, a total of ten mammalian TLRs have been identified, TLR1 through TLR10 [4,7]. As a family of conserved innate immune recognition receptors, TLRs share similarity in a cytoplasmic Toll/IL-1 receptor domain with that of the IL-1 receptor family, and are characterized by a distinct extracellular domain containing leucine-rich repeats [7]. Thus, TLRs and the IL-1 receptor family exert their functions by the same signaling pathways, including MyD88, IL-1 receptor–associated kinase (IRAK), TNF receptor-associated factor 6 (TRAF 6), mitogen-activated protein (MAP) kinases, and nuclear factor kappa B (NF-kB) [7]. a. TLR4 Experimental data from knockout mice have shown that TLR4 is essential for Gram- bacterial, outer-membrane component lipopolysaccharide (LPS) signaling. In addition, interaction of LPS with TLR4 requires another molecule, MD-2, which is unique for TLR4 [7,48,49]. Mouse TLR4 differs from human TLR4 in that the ligands lipid A analog, lipid IVa, and plant-derived reagent taxol act as LPS mimetics in the mouse system, whereas they act either as an antagonist or a nonfunctional entity in the human system [7]. b.
TLR2 (TLR1 and TLR6)
TLR2 recognizes Gram+ bacterial peptidoglycan, bacterial lipoproteins and lipopeptides, Trypanosoma glycophosphatidylinositol anchors, Mycobacterium lipoarabinomannan, Neisseria porins, and yeast cell-wall component zymosan [7]. Analyses of knockout mice confirmed that TLR2 ligand recognition is formed by way of heterodimers between TLR2 and other TLRs [7,50]. c.
TLR5
Expressed on the basolateral, but not apical, surface of intestinal epithelia, TLR5 recognizes a 55-kDa flagellin monomer, a rod-like propelling appendage of Gram- bacteria [7,51]. d. TLR9 The important role of TLR9 lies in its recognition of bacterial DNA, viral DNA, and synthetic oligodeoxynucleotides containing unmethylated CpG (CpG DNA). Due to amino acid sequence differences between the extracellular domains of the human and mouse TLR9, the optimal immunostimulatory CpG DNA motifs are distinct between humans and mice [7,52]. e. TLR3 Data from TLR3 knockout mice showed a reduced response to double-stranded RNA, suggesting the role of TLR3 in recognition of double-stranded RNA, which is a common result of viral replication within infected cells [7,53]. f.
TLR7
Rather than being known for its recognition of pathogen motifs, TLR7 is known for its ability to recognize imidazoquinolines. One of these molecules termed imiquimod, a topical antihuman papilloma virus medication, has the ability to induce Th1-type cytokines IL-12 and IFN-a via the TLR7/MyD88 pathway [7,54].
1391_C06.fm Page 122 Tuesday, November 18, 2003 5:03 PM
122
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
2. NF-kB Family of Transcriptional Factors a. NF-kB When LPS or other pathogen components induce signaling to the nucleus of macrophages of the innate immune system, these signaling pathways are mediated by NF-kB and other stressresponsive transcriptional factors (SRTFs), which in turn lead to expressions of multiple inflammatory genes. The NF-kB is normally present in the cytoplasm during inactivated state and is associated with inhibitors of NF-kB (IkBs). When activated by inducers, IkBs are phosphorylated, ubiquitylated, and degraded by proteasome, allowing the translocation and entrance of NF-kB to the nucleus. The binding of NF-kB to cognate DNA-binding sites in the nucleus allows transcriptional activation of more than 100 genes encoding mediators of inflammatory and immune responses [10,11]. In the mouse immune system, five members of the NF-kB family have been identified, including NF-kB1, NF-kB2, c-REL, RELB, and RELA [11]. All five members have a structurally conserved amino-terminal Rel-homology domain, which contains three subdomains: dimerization, nuclear-localization, and DNA-binding subdomains. In addition, the c-REL, RELB, and RELA proteins also have a carboxy-terminal nonhomologous transactivation domain. RELB protein has an additional leucine-zipper motif [11]. Target disruption of the genes encoding these five members in mouse models has led to understanding of the define roles of these NF-kB proteins in both innate and adaptive immune systems [11]. While mice deficient in RELA resulted in embryonic death, due to liver degeneration, mice lacking one of the other four members are immunodeficient, but without developmental defects. Interestingly, mice deficient in more than one member have more severe clinical phenotypes than those deficient in single protein, indicating the existence of functional redundancy among these five members [11,55,56]. b.
IkB Proteins
Three common forms of IkB proteins are identified, including IkBa, IkBb, and IkBe [11,55]. Results obtained from knockout mice experiments indicate distinct and redundant functions of these proteins [11]. Whereas IkBa is responsible for regulating transient activation of NF-kB, IkBb involves persistent activation of NF-kB [11]. c.
NF-kB Activation
NF-kB is activated by many pathways, including bacterial LPS, TNF/IL-1, and T-cell receptor (TCR) signaling [11]. Regardless which of the pathways is initiated, they all converge through the IkB kinase (IKK) complex, including IKKa, IKKb, and IKKg; the latter is also known as NF-kB essential modulator (NEMO) [11]. Activation of the IKK complex leads to phosphorylation and degradation of IkB proteins, resulting in exportation of NF-kB to the nucleus with the subsequent induction of expressions of multiple inflammatory genes [11]. 3. Defensins Mammalian defensins are small, cationic, cysteine-rich peptides with important antimicrobial functions [13,14]. They are an important member of the innate immunity, but also argument-adaptive immune responses [13,14]. Three major groups of defensins are known: a-defensins, b-defensins, and circular defensins. Existing data indicate a structural diversity of defensins between human and mouse immune systems. While a-defensins are noticeably absent in mouse neutrophils, they are prominently present in human neutrophils, with four of the six a-defensins are primarily expressed in human granulocytes and certain lymphocytes and are also termed human neutrophil peptides [13]. The only known mouse a-defensins are expressed in the intestinal Paneth cells [13].
1391_C06.fm Page 123 Tuesday, November 18, 2003 5:03 PM
MOUSE IMMUNE SYSTEM
123
On the other hand, at least five members of b-defensins are known in mouse, with partially overlapping tissue distributions between them [13,57–61]. While several forms of b-defensins are identified in human, circular defensins have only been identified in primates thus far [13]. Being a positively charaged cationic molecule, defensin attaches and attacks microbial negatively charged surface components by way of electrostatic interactions. The attacking sites of defensins include anionic membrane phospholipids such as phosphotidyl glycerol and cardiolipin, lipoteichoic acids, and lipid A moiety of LPS [13]. By interacting with chemokine receptors on dendritic cells and T cells, defensins may also participate in the regulation of host adaptive immunity in protecting against microbial invasion [13,14]. 4. Cytokines Cytokines are defined as soluble proteins or glycoproteins produced by leukocytes and other cells and function as chemical communicators between cells or as self-communicator (autocrine function). Although they carry many different functions, a unifying characteristic of most cytokines is that they regulate host defense against pathogens and inflammatory responses. It is now clear that cytokines are involved in both innate and adaptive immune functions; some cytokines, however, are more restricted to the adaptive immune system. While most cytokines are secreted, some are expressed on cell surface and others are stored in extracellular matrix reservoirs. Whereas some cytokines are constitutively expressed, most cytokines are expressed only under stimulation by infectious microorganisms such as bacteria, fungi, viruses, and parasites, toxin, and tissue damage. Cytokines exert their functions by binding to specific target cell-surface receptors that coupled with intracellular signal transduction and second messenger pathway. Most cytokines exhibit four essential features: (1) pleiotropy, having more than one action; (2) redundancy, having biological effects observed in other cytokine; (3) potency, having functional activity in nanomolar to femtomolar concentration; and (4) teamwork, participating, often synergistically, as a part of cascade of cytokines released in succession, and counter-balanced by antagonist inhibition [15–17]. a. Th1 vs. Th2 One well-characterized cytokine network pattern is the polarization of cytokine production by helper T-cell subset 1 (Th1) and subset 2 (Th2), which was defined in the mouse system by Fitzgerald et al. [16] and Mossman et al. [62]. This clear-cut polarization is not as obvious in the human system. Experimental data indicate that the cytokines in Th1 and Th2 subsets carry distinct immunological roles and are functionally antagonistic to each other [16,62]. While the roles of Th2 cytokines (IL-4, IL-5, IL-6, IL-10, and IL-13) were assigned to predominantly humoral immunity and allergy, the roles of Th1 cytokines (IL-12, INF-g, and TNF-b) were skewed toward primarily cellular immunity, inflammation, and organ-specific autoimmunity [16,62]. Table 6.1 depicts the current understanding on cytokine molecules as well as other characteristics of Th1 and Th2 Cells. b.
Cytokine Receptor Superfamilies
The cloning of cytokine receptors and analysis of their primary structures allow them to be grouped into families based on common homology regions. The major cytokine receptor superfamilies recognized are the hematopoietic receptor (also known as type I cytokine receptor), the interferon receptor (also named type II cytokine receptor), the TNF receptor, the IL-1/Toll-like receptor, the tyrosinase kinase receptor, and the chemokine receptor superfamilies [16]. The signal transductions by the hematopoietic receptor and the interferon receptor superfamilies are through the Janus kinases (Jaks) and signal transducers of activated transcription (STATs) [16,63,64]. The signal transductions by the TNF receptor and the IL-1/Toll-like receptor superfamilies that lead to inflammation take place in part through the NF-kB pathway [16].
1391_C06.fm Page 124 Tuesday, November 18, 2003 5:03 PM
124
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Table 6.1 Characteristics of Th1 and Th2 Cells Characteristics
Th1 Cells
Signals Transcriptional factors Cell surface molecules
JNK, p38 MAP kinase T-bet, STAT4, NF-kB LAG-3, IL-12R-b2, CCR5, CXCR3
Activators Inhibitors Cytokine produced
IL-12, IL-18, IL-23, CD28 IL-4, IL-10 IL-2, IL-18, IFN-g, TNF-b
Th2 Cells STAT6, GATA-3, c-Maf, JunB, NFATc ICOS, CD30, CD62, CCR3, CCR4, CCR8, CXCR4 IL-4, ICOS IFN-g IL-4, IL-5, IL-6, IL-9, IL-10, IL-13, IL-25
Sources: From Fitzgerald, K.A. et al., The Cytokine Facts Book, Academic Press, San Diego, 2001 [16]; Mosmann, T.R. et al., J. Immunol. 136, 2348, 1986 [62]; Oppmann, B. et al., Immunity, 13, 715, 2000 [70]; Fort, M.M. et al., Immunity, 15, 985, 2001 [74]; Hurst, S.D. et al., J. Immunol., 169, 443, 2002 [75]; Paul, W.E. and Seder, R.A., Cell, 76, 241, 1994 [84]; and Mosmann, T.R. and Coffman, R.L., Annu. Rev. Immunol., 7, 145, 1989 [94], with permission.
c.
Cytokines in Mouse Immune System
To illustrate the similarities in cytokines between human and mouse immune systems, the followings are a list of all known interleukins and some common cytokines and cytokine receptors that are confirmed to be present in both human and mouse systems [16]: Interleukin-1a (IL-1a), IL-b, IL-1 receptor antagonist (IL-1Ra), type I and II IL-1 receptors, IL-2, IL-2 receptor, IL-3, IL3 receptor, IL-4, IL-4 receptor, IL-5, IL-5 receptor, IL-6, IL-6 receptor, IL-7, IL-7 receptor, IL-8 receptor (CXCR2), IL-9, IL-9 receptor, IL-10, IL-10 receptor, IL-11, IL-11 receptor, IL-12 (p35 and p40 chains), IL-12 receptor, IL-13, IL-13 receptor, IL-15, IL-15 receptor, IL-16, IL-17, IL-17 receptor, IL-18, IL-18 receptor, angiostatin, epidermal growth factor (EGF), EGF receptor, Fas ligand (FasL), FasL receptor (Fas/Apol, CD95), acidic fibroblast growth factor (aFGF), basic fibroblast growth factor (bFGF), FGF receptors (types 1, 2, 3, and 4), granulocyte colony-stimulating factor (G-CSF), G-CSF receptor, granulocyte/macrophage colony-stimulating factor (GM-CSF), GM-CSF receptor, IFN-a, IFN-a receptor (IFNAR-1), IFN-b, IFN-g, IFN-g receptor, lymphotoxin (LT, TNF-b), macrophage colony-stimulating factor (M-CSF), M-CSF receptor, nerve growth factor (NGF), neurotrophin 3 (NT-3), NT-3 receptor, platelet-derived growth factor (PDGF), PDGF receptor, stem cell factor (SCF), SCF receptor, transforming growth factor b1, 2, 3 (TGFb1, 2, 3), TGFb receptor (type I), tumor necrosis factor a (TNFa), and TNFa receptors (type I and II). Worth noticing are the facts that there is no obvious mouse homologue of human IL-8 and IL-14 [16]. The direct comparison of the physiochemical properties of some major human cytokines with that of mice is depicted in Table 6.2. More recently, several novel cytokines have been identified in both human and mouse, with the respective percentage sequence identities at the amino acid levels: IL-19 (71%) [65]; IL-20 (76%) [66]; IL-21 (79%) [67,68]; IL-22 [69]; IL-23 [70–72]; IL-24 [73]; and IL-25 (80%) [74,75]. 5. Chemokines Chemokines are basically chemotactic cytokines and are members of the chemokine superfamily within the cytokine superfamilies [16,18]. They primarily act on immune cells such as neutrophils, eosinophils, monocytes/macrophages, and lymphocytes, thus exerting an essential role in host defense, both innate and adaptive [18,76]. Their fundamental roles are for the development, homeostasis, and function of the immune system [76]. Chemokines are characterized by their abilities to deliver cell-specific migratory signals. Chemokines are primarily divided into three families, a (CXC), b (CC), and g (C), based on the presence and position of the conserved cysteine amino acid residues [16,18]. A new classification has been proposed recently to include a new family termed CX3C [76]. Generally speaking, a chemokines are chemotactic to granulocytes, including neutrophils, eosinophils, and basophils, whereas b chemokines are chemotactic to mononuclear
1391_C06.fm Page 125 Tuesday, November 18, 2003 5:03 PM
MOUSE IMMUNE SYSTEM
125
Table 6.2 Comparative Physiochemical Properties of Human and Mouse Cytokines Cytokine
PI
AAa
Mrb
N-linked G Sitec
DS bondsd
h IL-1a m IL-1a h IL-1b m IL-1b h IL-2 m IL-2 h IL-3 m IL-3 h IL-4 m IL-4 h IL-5 m IL-5 h IL-6 m IL-6 h IL-7 m IL-7 h IL-10 m IL-10 h IL-12 p35 m IL-12 p35 h IL-12 p40 m IL-12 p40 h IL-13 m IL-13 h TNF-a m TNF-a h IFN-g m IFN-g
5 5 7 7 8.2 ? 4-8 4-8 10.5 6.5 7 7.8 6.2 6.5 9 8.7 8 8.1 6.5 8.2 5.4 6 8.69 8.34 5.6 5.6 7-9 5.5-6
159 156 153 159 133 149 133 140 129 120 115 113 183 187 152 129 160 160 196 193 306 313 112 113 157 156 143 133
18 18 17.4 17.4 15.4 17.2 15.1 15.7 15 13.6 13.1 13.1 20.8 21.7 17.4 14.9 18.6 18.8 22.5 21.7 34.7 35.8 12.3 12.4 17.4 17.3 17.1 15.9
2 3 1 2 0 0 2 4 2 3 2 3 2 0 3 2 1 2 3 1 4 5 4 3 0 1 2 2
0 0 0 0 1 1 1 2 3 3 2 2 2 2 3 3 2 2 3 3 5 6 2 ? 1 1 0 0
Note: h, human; m, mouse; PI, isoelectric point. a b c d
Amino acids after signal peptide removal. Predicted molecular ratio. Potential N-linked glycosylation site. Disulfide bonds.
cells, such as lymphocytes and monocytes/macrophages. However, there are some exceptions [18]. To demonstrate the similarities in chemokines between human and mouse immune systems, the followings are a list of chemokines confirmed to be present in both human and mouse systems [18,76]: melanoma growth stimulatory activity (MGSA), gamma interferon–inducible protein-10 (IP-10), macrophage inflammatory protein-2 (MIP-2), stromal cell derived factor-1 (SDF-1), monocyte chemoattractant protein-1 (MCP-1), MCP-2, MCP-3, macrophage inflammatory protein-1a (MIP-1a), MIP-1b, MIP-3a (LARC), MIP-3b (EBI-1 ligand chemokine, ELC), RANTES (regulated on activation, normal T cell expressed and secreted), I-309/TCA-3, lymphotactin (Lptn), eotaxin-1, eotaxin-2, eotaxin-3, B-cell–attracting chemokine-1 (BCA-1), 6Ckine, cutaneous T-cell–attracting chemokine (CTACK), granulocyte chemotactic protein-2 (GCP-2), migration inhibition factor (MIF), monokine induced by interferon g (MIG), thymus expressed chemokine (TECK), PF4, BRAK, HCC4/LCC-1, TARC, macrophage-derived chemokine (MDC)/ABCD-1, and the new CX3C chemokine fractalkine/neurotactin. 6. Adhesion Molecules Adhesion molecules are cell-surface components that mediate adhesive functions between cells or between cells and extracellular matrix. Adhesion molecules are very important in the inflammatory
1391_C06.fm Page 126 Tuesday, November 18, 2003 5:03 PM
126
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
process during which immune cells migrate out of the blood vessels and moved toward the inflammatory sites. The majority of adhesion molecules can be categorized into four families based on both the structural and functional similarities of the family members: cadherins, integrins, selectins, and syndecans [24]. An additional family is called the immunoglobulin superfamily. The adhesion molecules of the cadherins families that are components of epidermis and which are discussed in Chapters 1 and 2, will not be further described here. To illustrate the similarities in adhesion molecules between human and mouse immune systems, the following components have been confirmed to be present in both human and mouse systems [24]: E-cadherin, N-cadherin, P-cadherin, R-cadherin, VE-cadherin, K-cadherin, cadherin-8, OB-cadherin, Br-cadherin, H-cadherin, Ksp-cadherin, cadherin-14, LI-cadherin, ALCAM (CD166), CD22, CD31 (PECAM-1), CD33, CD147, CEACAM (CD66), contactin-1, ICAM-1 (CD54), ICAM-2 (CD102), ICAM-3 (CD50), junctional adhesion molecule (JAM), mucosal addressin cell-adhesion molecule 1 (MadCAM-1), neural cell adhesion molecule (NCAM, CD56), sialoadhesin (CD169), VCAM-1 (CD106), integrin aL (CD11a, LFA-1), integrin aM (CD11b), integrin a1 (CD49a), integrin a2 (CD49b), integrin a3 (CD49c), integrin a4 (CD49d), integrin a5 (CD49e), integrin a6 (CD49f), integrin a7, integrin a8, integrin a9, integrin aIIb (CD41), integrin av (CD51), integrin aE (CD103), integrin b1 (CD29), integrin b2 (CD18), integrin b3 (CD61), integrin b4 (CD104), integrin b5, integrin b6, integrin b7, integrin b8, E-selectin, L-selectin, P-selectin, syndecan-1 (CD138), syndecan-2 (HSPG), syndecan-3, syndecan-4, CD6, CD23, CD34, CD36, CD39, CD43, CD44, CD98, E-selectin ligand (ESL-1), and P-selectin ligand (PSGL-1, CD162). 7. Complement The complement system consists of a group of soluble molecules that function to defend against invading pathogens [25]. The complement system can be activated by three pathways: classical, mannose-binding lectin (MBL), and alternative pathways [25]. In the classical antibody-dependent pathway, the C1 complex (C1q, C1r, C1s) initiates the activation by the globular domain of C1q to the Fc region of immunoglobulin (IgG or IgM), followed by activation of C4, C2, and then C3 [25]. In the MBL antibody-independent pathway, the MBL/mannose-associated serine protease 1,2 (MASP-1, 2) initiates the activation by binding to mannose-containing proteins or carbohydrates on the surface of bacteria or viruses, in much the same way as the C1 complex, followed by activation of C4, C2, and then C3 [25]. The alternative antibody-independent pathway activation is based on a continuous low-grade hydrolysis of serum C3, with binding by factor B, and activation of factor D, can form a unstable C3 convertase, cleaving C3 to C3a and a labile C3b*, which degrades rapidly. If one of a variety of pathogen components is present, such as Gram- bacterial LPS, Gram+ bacterial cell wall teichoic acid, or zymosan, C3b* can bind to these components and activate factor B and properdin, leading to stable C3 convertase and C3 activation [25]. After the activation of C3, the common converging point for all three pathways, the activation of the other components — C5, C6, C7, C8, and C9 — follow, resulting in the formation of membrane attack complex (MAC). The immune defense functions of the complement system include opsonization (by C3b and C4b), release of anaphylatoxin (C3a and C5a), and lysis of bacterial membrane (by MAC) [25]. The genes encoding the following components of the complement system have been identified in both human and mouse [25]: C1q, MBL, MASP-1, factor B, factor D, factor H, factor I, properdin, C2, C3, C4, C5, C6, C7, C8, and C9 [25]. B. Immune Cells The immune cells in the mouse innate immune system include neutrophils, eosinophils, monocytes/macrophages, natural killer cells, mast cells, basophils, B-1 cells, interferon-producing cells, gamma/delta T cells, and intraepithelial lymphocytes. Obviously, some of these “innate immune
1391_C06.fm Page 127 Tuesday, November 18, 2003 5:03 PM
MOUSE IMMUNE SYSTEM
127
cells” do participate in the adaptive immune functions. The distinct features of mouse immune system of selected cell types are discussed below: 1. Natural Killer Cells Natural killer (NK) cells are large bone marrow–derived granular lymphocytes that are important for innate immune defense against a variety of “unwanted” cells, such as transformed cells, stressed cells, and infected cells, by their abilities to recognize and lyse them [28–30]. NK cells distinct from B and T lymphocytes in that they do not require gene rearrangement to assemble their receptor genes, yet they have definite abilities to discriminate between the “unwanted cells” and normal cells of the body [28–30]. These discriminatory abilities of NK cells are the current subject of intense investigations. The current data suggest that NK cells utilize both inhibitory recognition receptors as well as stimulatory receptors for their discriminatory actions. The inhibitory or negative recognition receptors function to prevent NK cells from lysing self-cells that express normal levels of each self-MHC class Ia molecule. This concept is supported by the fact that most self-cells that express normal levels of class Ia molecules are spared from NK cell killing. However, it is also apparent that some cells express normal levels of class Ia become targets of NK cells while some cells express low levels of class Ia are spared from the NK cell killing. It turns out that NK cells also utilize stimulatory receptor as a positive target-cell recognition mechanism. In the mouse system, three families of inhibitory MHC class I-recognizing receptors were expressed by NK cells: Ly49 (a C-type lectin-like protein), CD94/NKG2A, NKG2B heterodimers, and immunoreceptor tyrosine-based inhibitory motif (ITIM) [29]. In addition, two major groups of stimulatory receptors are recognized in mice: MHC class I recognizing and non-MHC class I recognizing. Several ligands have so far been identified for the mouse stimulatory receptors. H2-D has been identified as a ligand for Ly49D, a MHC class I-recognizing receptor. The retinoic acid early-1 protein (Rae 1) and H60 minor histocompatibility antigen have been identified as ligands for NKG2D, a non-MHC class I-recognizing receptor. Expression of Rae 1 or H60 on target cells has led to induction of strong NK cytotoxic killing activities [29,77,78]. Interestingly, human NK cells have no functional Ly49 receptor, but have an alternative receptor named killer cell immunoglobulin-like receptor (KIR) [29]. In addition to their cytotoxic effector functions, NK cells are capable of producing abundant cytokines such as IFN-g, TNF-a, GM-CSF, MIP-1, and RANTES [29]. 2. Mast Cells Mouse mast cells are bone marrow–derived cells originated from Thy-1lo c-kithi cells, which upon circulating in the blood and lymphatics migrate into tissues, where they mature with distinct morphological and functional features under the influence of local microenvironment [31–33]. Thus, mast cells are a heterogeneous population, exhibiting histochemical heterogeneity based on the cytoplasmic granule protein content [32]. The proliferation and maturation of rodent mast cells are primarily promoted by IL-3 and SCF, whereas IL-3 has a minimal direct effect on human mast cells [32]. Mast cells are well recognized as critical effector cells in the Th2-mediated, IgE-directed immediate hypersensitive responses [32]. Since they are strategically located at the interface between environmental and mucosal surfaces, mast cells are also thought to play roles in “immune surveillance” and effector roles in defense against bacterial and viral infection, based on some recent evidence [33]. For example, TLRs, such as TLR2, TLR4, and TLR6 have been identified in mouse mast cells [33]. Moreover, mast cells are capable of phagocytose and kill bacteria and participate in leukocyte recruitment by increasing vascular endothelial cell expressions of E-selectin, ICAM, and VCAM through the release of various cytokines during degranulation [32]. In addition, mast cells are capable of release TNF-a in response to Gram- bacteria [33]. Both human and rodent mast cells have been reported to express MHC class II molecules, and to process and present immunogenic antigens to CD4+ Th cells [32]. Mast cells are primarily activated by their surface
1391_C06.fm Page 128 Tuesday, November 18, 2003 5:03 PM
128
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
receptor FceRI, a high affinity receptor for IgE. Noticeably, the FceRI system in mouse cells is structurally different from that of humans [79]. In the mouse system, FceRI is primarily expressed in mast cells and basophils with a tetrameric structure consisting of one a chain, one b chain, and two identical g chains [79]. In human system, FceRI is expressed not only in mast cells, basophils, but also epithelial Langerhans cells, eosinophils, certain dendritic cells, and some monocytes [79]. However, the FceRI on human Langerhans cells, dendritic cells, and monocytes carries no b chain [79]. In addition, mouse mast cells are now known to express IgG receptors FcgRII and FcgRIII, and be activated by FcgRIII or by direct contact with microorganisms [32]. 3. B-1 Cells and Natural Antibodies Natural or spontaneous antibodies to toxins, bacteria, and red blood cells are present in sera of normal, nonimmunized humans and mice. Peritoneal CD5+ B1 cells are the major producers of natural IgM antibodies; however, natural antibodies can be synthesized by splenic CD5- B2 cells as well [35,80–82]. The production of natural antibodies is not dependent on internal or external antigenic stimulation, and the majority of natural antibodies are in the IgM class, with some in IgG and IgA classes [35,82]. Natural antibodies act as the first line of defense against infections by the following three major mechanisms. First of all, they can directly neutralize the incoming pathogen. Moreover, natural antibodies can eliminate the pathogens by three possible usage of activating the complement system: (1) complement-mediated lysis of pathogens; (2) T-cell–independent antibody response by targeting the antigen to splenic marginal zone; and (3) T-cell–depedent antibody response by stimulating B cells. Finally, they can also form antibody–antigen complex, thus preventing pathogen spread and enhancing immune responses in lymphoid organs [35]. 4. Interferon-Producing Cells Interferon-producing cells (IPC), found in the human system 2 decades ago, have been identified in the murine system only recently. IPC correspond to the previously named “plasmacytoid cells” identified in human lymph nodes during infections [36]. They are a small population of leukocytes that secrete high levels of type I IFN (IFN-a and IFN-b) in response to viral infection, thus playing a role in innate immunity and in shaping T-cell responses [36,37]. 5. Gamma/Delta T Cells (gd T Cells) These T cells are referred to T cells that express T-cell receptor gamma/delta chains (TCR gd) and participate in both innate and adaptive immune functions [38–41]. These gd T cells, together with B cells and ab T cells, are the three vertebrate cell types that use somatic DNA rearrangement to assemble the genes encoding their cell-surface receptors [83]. The gd T cells utilize variable (V), diversity (D), and joining (J) gene segments conferring on TCR gd in such a way that they are expected to contribute to adaptive immune response like that of B cells and ab T cells, but instead their role remains unclear [83]. TCR d knockout (KO) mice showed some degrees of immunodeficiency to infection by Listeria, vesicular stomatitis virus, and malaria parasites, usually confined to the early points of the infection, suggesting that the gd are designed to be a player in fast-acting innate response [83]. The gd T cells are shown to play an immunoregulatory role, as the gd T-cell–deficient mice have exaggerated and accelerated immunopathology due to an increase of CD4+ ab T cells [83]. The gd T cells are also known for their association with tissues [83], the most obvious example of which is their disproportionate enrichment in the epithelia [43–45,83] and will be described in the section below.
1391_C06.fm Page 129 Tuesday, November 18, 2003 5:03 PM
MOUSE IMMUNE SYSTEM
129
6. Intraepithelial Lymphocytes Intraepithelial lymphocytes (IEL) are locally resided, potently cytolytic, and immunoregulatory lymphocytes containing primarily T cells [42]. Unlike normal human skin, in which small numbers of T cells are residing predominantly in the dermis, normal mouse skin harbors an extensive network of IEL of dendritic morphology, known as dendritic epidermal T cells (DETCs) [42,83]. Essentially, all mouse DETCs express TCR gd, express CD8aa (a homodimer) or CD4-/CD8- (double negative), and respond to antigens not restricted by conventional MHC [42]. In all animals examined, DETCs are some of the earliest developed T-cell subsets, equipping them to respond to hostile environmental challenges faced by the newborns. Functionally, DETCs respond to heat-shocked autologous keratinocytes with cytokine secretion and kill the target cells. In addition, DETCs target Rae-1+ (a mouse MICA equivalent) transformed cells during the skin chemical carcinogenesis process. These findings suggest that one of the roles of DETCs may be to eradicate infected or transformed epidermal cells before they disseminate systemically [42]. In fact, DETCs are considered to be “revertants,” meaning immune cells that are functionally reversed from the adaptive to the innate response, using gene rearrangement, a marker of the adaptive response, to generate receptors for conserved autoantigens specifying infection, cell transformation, or other dysfunctions within local tissues [42].
III. ADAPTIVE IMMUNE SYSTEM A. T Lymphocytes Like human T cells, the mouse T cells are bone marrow–derived and thymus-matured mononuclear cells. All mouse T cells are CD3+. The majority of CD3+ T cells have either CD4+ or CD8+ surface markers, which they acquired during their maturation in the thymus. Whereas the mouse CD4+ helper T cells (Th) can be further divided into Th1 or Th2 based on the types of cytokines they secreted, this clear-cut division is not as obvious in the human system. Under the influence of IL-12, uncommitted Th cells (Th0) become committed Th1 cells, capable of secreting IL-2, IL-18, IFN-g, and TNF-b [16,62,84,85]. Similarly, under the influence of IL-4, Th0 cells become committed Th2 cells, with the ability to secret IL-4, IL-5, IL-6, IL-9, IL-10, IL-13, and IL-25 [16,62,74,75,84,85] (Table 6.1). It is now clear that the T-box transcription factor T-bet is central for Th1 cell development [86]. Similarly, Th2 cell development is primarily dependent on a zincfinger transcription factor GATA-3 [87–89]. Although many outstanding studies have shown the in vitro functional roles of human T cells, the in vivo functions of T cells in inducing inflammatory and autoimmune diseases have been demonstrated only in small mammals such as rats and mice, into which the adoptively transferred pathogenic T lymphocytes reproduce the clinical disease phenotype in the immunocompetent recipient mice [90–92]. B. B Lymphocytes (B-2 Cells) Since the term “B-1 cell” is now assigned to a subset of B cells that synthesize and secrete natural antibodies for the innate immune system, the conventional B lymphocyte is now termed “B-2 lymphocytes” or B-2 cells. The mouse B-2 lymphocytes, like those of humans, are derived from the liver during mid- to late fetal life and matured in bone marrow after birth [93]. However, the products of B-2 cells are classified distinctly from those of humans [94]. Unlike the human IgG antibodies, which are subclassed as IgG1, IgG2, IgG3, and IgG4, mouse IgG antibodies are subclassed as IgG1, IgG2a, IgG2b, and IgG3 [94]. For T-cell–dependent antibody production, it is driven by the interaction between the co-stimulatory molecules CD40 ligand (CD40L) on activated T cells and CD40 on B cells, plus the interaction of TCR of activated T cells and MHC-linked
1391_C06.fm Page 130 Tuesday, November 18, 2003 5:03 PM
130
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
antigenic peptide on B cells. Furthermore, the cytokine environment is of particular importance for class switching and has been established within the murine immune system. Mature, IgM-expressing B cells will alter their heavy-chain isotype when restimulated with antigen or a polyclonal activator like LPS. The class of heavy chain that they will switch to is dependent upon the cytokine environment. Cytokines from Th1-helper T cells, primarily IFN-g will induce the class to switch to IgG2a. The presence of IL-4 from Th2-type helper T cells will induce a class switch to IgG1 or IgE [16,62,84,94]. Both of the major phenotypes of T-helper cells can induce antibody responses in mice. However, it is possible to determine the predominant helper T-cell type by a close examination of the isotype of antibody being produced. While this identification has been postulated in humans, it is not as clearly demonstrated as with mice. C. Antigen-Presenting Cells In the skin, the most important antigen presenting cells are the Langerhans cells (LCs), which are present in both human and mouse epidermis [95–99]. Both human and mouse LCs are dendritic in form, and a LC-specific protein termed Langerin/CD207, a type II transmembrane protein essential for Birbeck granule formation, has recently been discovered in humans [95,96]. Subsequently, the equivalent of Langerin was identified in the mouse system [97–99], suggesting a similar functional role between the human LCs and that of mice. The human Langerin shares 66% overall sequence identity at the amino acid level with its mouse counterpart, with a 75% amino acid homology at the important carbohydrate recognition domain of Langerin [96,97]. Using this specific antibody, the LCs in both human and mouse have been shown to migrate to draining lymph nodes upon inflammatory stimulation, confirming a similar function between human and mouse LCs [99,100]. Both human and mouse LCs have the following surface markers: MHC class II molecule, E-cadherin, CD40L co-stimulatory molecules B71, B72, and ICAM-1 [101–109]. In the human system, LCs are recognized to have cell-surface FceRI, the high-affinity receptor for IgE, whereas such receptor has not yet been identified in the mouse system [110,111]. Mouse LCs, however, do possess a low-affinity receptor for IgE (FceRII/CD23) [112]. D. Major Histocompatibility Complex (MHC) The mouse MHC genes, located in chromosome 17, are organized slightly differently from those of humans, which are located in chromosome 6 [113]. Figure 6.1 illustrates the main genetic regions of the mouse MHC in comparison with the human counterpart.
IV. MICE AS AN ESSENTIAL TOOL FOR ANIMAL MODELING OF HUMAN IMMUNE-MEDIATED DISEASES Mice have been used as experimental animal models of human immune diseases for many decades and these models have provided us with significant insight into the function and dysfunction of the human immune system. While the mouse immune systems varies somewhat from that of humans, the mice play important roles in the animal modeling of human disease due to their small size (thus less expensive for keeping), their relatively short gestation period (thus less time required for data collection), and their ability to breed large numbers (thus more suitable for obtaining statistically significant results). However, the greatest advantage of mouse models of human inflammatory diseases, as opposed to humans or other mammals, stems from the development of immunologically identical strains of mice. These syngeneic mouse strains have consistent and reproducible immune responses that can be studied in detail to give us significant information that is applicable to mammalian immunity in general. Thus, it is central to understand the function of the immune
1391_C06.fm Page 131 Tuesday, November 18, 2003 5:03 PM
MOUSE IMMUNE SYSTEM
H:
DP
M:
K
131
DQ DR
A
E
C
C
HSP TNF etc
HSP TNF etc
B
C
D
A
L
Class I: Class II: Class III: Figure 6.1
Main genetic regions of human and mouse MHC. H, human; M, mouse; C, complement components; HSP, heat shock protein; TNF, tumor necrosis factor.
system in inbred mouse strains to decipher the importance of murine models of inflammatory disease. A. Development and Nomenclature of Inbred Mouse Strains The concept of mating between litter mates for establishing reproducible immunological identity or nonidentity between different groups of mice was developed in the mid-20th century. It was long known that grafting of skin from one mouse to another would induce rejection of the graft. However, the likelihood of rejection and the rate of rejection was less between littermates. After multiple rounds of inbreeding (about 20), multiple strains of mice were identified that would tolerate skin transplantation between members of the same strain. After some time, it was determined that theses strains were syngeneic, that is, they shared the same alleles in the genes that regulated graft rejection or acceptance. The genes associated with graft rejection were termed the histocompatibility locus and were localized to chromosome 17. Later, another genetic area locus associated with syngeneic immune responses was identified and referred to as immune-response genes. It was determined that immunologically identical, syngeneic strains would have identical alleles in both of these determinant areas. After the major histocompatibility genes in humans were identified, it became clear that the histocompatibility locus in mouse, or H-2, corresponded to the MHC class I determinant in humans, while the mouse immune response gene region, or Ir gene, corresponded to the human MHC class II. The nomenclature for histocompatibility in mice is based on these early experiments. The H-2 gene group in mice has two initially identified alleles, K and D. The specific gene allele is associated with the initial strain in which it was identified and is designated as a small letter. Thus, for the MHC I gene group, a mouse from the b strain for the K and D alleles would be identified as H2Kb and H-2Db, respectively. Similarly, the Ir groups have two specific loci, A and E, identified as I-A and I-E loci. Again, the specific allele that confers acceptance of grafts within the d strain is identified as a small letter superscript as in I-Ad, I-Ed. B. The Use of Inbred Mouse Strains When it was recognized that T-cell recognition and activation with appropriate peptide antigens required the peptides to be bound to these MHC sequences, it became clear that the inbred strains
1391_C06.fm Page 132 Tuesday, November 18, 2003 5:03 PM
132
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
of mice held many potential experimental advantages. In immune responses that are driven by specific antigens, the recognition of specific peptide antigens that may bind to a certain strain’s MHC locus would facilitate experiments to identify pathogenic proteins and peptide antigens as well as learning how to induce tolerance to these peptides. In experimental mouse models of human disease, like experimental autoimmune encephalomyelitis (EAE) or collagen-induced arthritis (CIA), immunization of specific strains of mice with adjuvant can lead to the phenotypic expression of the disease. Through the use of inbred strains of mouse with reproducible antigenic binding to the MHC locus, specific peptides that are the primary, secondary, or even tertiary in nature are recognized. These observations have led to significant insight into the nature of autoimmune disease. For example, the hierarchy of immunogenic peptides has resulted in the concept of “epitope spreading,” where waxing and waning autoimmune disease is related to newer responses to other peptides and proteins [114–116]. Moreover, antigen-specific tolerance to a disease can be conferred by inducing tolerance to a peptide in this hierarchy. In a virus-induced autoimmune disease, Theiler’s murine encephalomyelitis virus infection, the infection-inducing cell damage has been determined as an initiating factor that is responsible for a specific progression of antigenic peptide recognition, leading to an immune-mediated disease process [117–119]. This evidence strongly suggests that the nature of this virus-induced disease is not molecular mimicry between microorganism antigen and self-antigen as had previously been thought. Rather, the induction of an immune response in a genetically susceptible individual is brought on by a viral infection. These significant observations were only possible because of the existence of inbred strains of mouse. The second major advantage of using inbred strains of mice is the ability to transplant specific cells from one animal to another within the same strain. Specifically, it is possible to determine the specific cell type that may be inducing a specific immune-mediated disease through this process of adoptive transfer. For example, in mice with EAE, it is possible to prime an individual mouse with proteolipid protein and remove the draining lymph nodes prior to the onset of clinically apparent disease. Specific CD4+ T cells can then be isolated, restimulated in vitro with syngeneic antigen-presenting cells and the appropriate peptide, and then transferred to a naïve mouse of the same strain. The recipient mouse will, in turn, develop clinical signs of EAE. With this technique made possible by the use of syngeneic mice, it is now feasible to perform numerous experiments to determine pathological cell types, along with potential pathogenic cytokines, and so on. C. Inbred Mouse Strains and Disease Susceptibility While it was predictable that the development of mouse strains with consistent MHC I and II molecules would lead to new discoveries in antigen processing and presentation and information about autoimmunity, other experiments demonstrated that the differences among the strains were beyond the MHC locus. Many of these discoveries have led to important information about immunity and highlight differences among mouse strains that can be used for experimental models. One of the most significant discoveries with inbred strains of mice may be the finding that some specific strains are susceptible to specific infectious organisms while others are not. Almost all inbred strains of mice are resistant to infection with Leishmania major, a protozoum that can also be infectious in humans. The classic response is seen in the C57BL/6 mouse, which has an initial swelling response in the footpad after the injection of the parasite followed by resolution. However, the BALB/c strain seems to lack this resistance and will die within a few weeks after injection of the parasite. The resistance gene or genes for differences among these inbred strains was not determined until it became clear that the CD4+ T cells from resistant mice tended to produce primarily IFN-g upon injection of L. major while the BALB/c mice predominantly produced IL-4. Multiple experiments demonstrated that altering this IFN-g: IL-4 ratio, either by treatment with anti–IFN-g antibodies or with recombinant IL-4 in resistant mice, or by treating with IL-12 in susceptible mice, altered this pattern. Thus, it became clear that the immunological differences among inbred strains
1391_C06.fm Page 133 Tuesday, November 18, 2003 5:03 PM
MOUSE IMMUNE SYSTEM
133
Table 6.3 Immune Mutant Mouse Strains in C57BL/6Ja Background (Jackson Laboratory) Strain Name nu
B6.Cg-Foxn1 B6.CB17-Prkdcscid/SzJ B6.129S7-Rag1tm1Mom B6.129S2-Cd4tm1Mak B6.129S2-Cd8atm1Mak B6.129S4-Cd80tm1Shr B6.129S4-Cd86tm1Shr B6.129S6-Rac2tm1Mddw B6.129P2-Il4tm1Cgn B6.129S1-Il12atm1Jm B6.129S4-Icam1tm1Jcgr B6.129S7-Selptm1Bay
Stock No.
Deficiencyb
000819 001913 002096 002663 002665 003611 003609 004197 002253 002692 002867 002289
T cells, partial B cells T and B cells Matured T and B cells Helper T cells CD8+ T cells MLR, partial B cells Partial B cells Neutrophils, mast cells, phagocytosis IL-4, IgG1, IgE IL-12, DTH ICMA-1, neutrophil migration, DTH, MLR P-selectin, leukocyte rolling and migration
Refs. 127, 128 122 124 130 131 132 133 134 135 136 137 138
Note: MLR, mixed lymphocyte response; DTH, delayed-type hypersensitivity. a b
The control strain is C57BL/6J (stock no. 000664). In most cases, the identifiable deficiencies are not 100%.
of mice were more significant than simply the binding of antigen but included patterns of response. These findings were seminal in the development of the Th1/Th2 theory of T-cell responses in mice and were later applicable to human immunology with regard to mycobacterial infections [120,121]. These findings also give investigators important clues on which strains of mice to initially use when trying to develop models of human inflammatory diseases that may have a Th1 or Th2 tendency. D. Naturally Occurring Mutations of Mouse Immune System While there are many naturally occurring mouse strains that may be of importance in the development of new models of human autoimmunity and inflammation, there is one that merits special discussion. The severe combined immunodeficiency mouse can be used as a base to study many human immune processes. Table 6.3 lists some major spontaneously arising immune mutant mice available at Jackson Laboratory in Bar Harbor, ME (www.jax.org), in the C57BL/6J background. 1. Severe Combined Immunodeficiency (SCID) Mice The naturally occurring mouse strain with major implications for animal models of immune disease is the SCID. SCID mice have a genetic defect in a DNA repair gene that is central to recombination for both the T-cell receptor and immunoglobulin genes. This defect does not allow for normal production of these proteins, which causes elimination of cells within the T- and B-cell lineages. Thus, while these mice have intact neutrophils, monocytes, and other cells of the innate immune system, they have no adoptive immune system, such as T and B lymphocytes [122]. There are multiple possible uses of these mice in the study of human immune mediated diseases. The first area of study involves the transfer of human tissue to the SCIDs. As would be expected from animals that lack adaptive immunity, xenografts are not rejected [123]. Thus, it is possible to transfer skin from a susceptible human to the mouse to allow for the induction of inflammatory disease. Likewise, to study immune responses in human cancers, human tumor cells can be transferred to the SCID mice, followed by the transfer of human immunocytes. Manipulations of these models may lead to new insights in both the down-regulation of the immune system to treat autoimmune disease as well as up-regulation of the transferred immunity in the treatment of tumors. The second method of studying immune-mediated diseases in SCID mice is the partial constitution of the immune system with cells from patients suffering from autoimmune diseases. This method has been studied with a number of systems including multiple sclerosis and rheumatoid arthritis.
1391_C06.fm Page 134 Tuesday, November 18, 2003 5:03 PM
134
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
There are, however, a number of difficulties with using SCID mice for the development of models for human immune-mediated diseases. The first is that the SCID defect is in a DNA repair gene. This repair gene has implications for the normal homeostasis of the mouse’s genome. This complicates potential analyses of the meaning of experimental findings. Moreover, there is “leakiness” in the SCID system [122]. In other words, some mice will be able to produce some level of an adaptive immune system over time. These difficulties are overcome by using a strain of mouse that has a genetic knockout at recombination activating gene (RAG) locus [124–126]. It is becoming clear that RAG knockout (RAG NO) mice will likely replace SCID mice in future mouse models of immune disease. 2. Nude Mice Nude mice are T-cell–deficient, with partial defect in B-cell development [127–129]. Jackson Laboratory has several strains of nude mice available for investigators: stock no. 000819 (in C57BL/6J background); stock no. 000711 (in BALB/cByJ background); and stock no. 100402 (in CByB6F1/J background). E. Experimentally Induced Alteration of Mouse Immune System There are now many experimentally induced mouse lines that have been established for the purpose of experimental modeling for human inflammatory diseases. Most of these lines have a single immune component “knocked out,” so that immunological researchers can study the role of these “knocked out” components in certain inflammatory diseases. Table 6.3 lists some major knockout (KO) immune mutant mice available at Jackson Laboratory in the C57BL/6J background. 1. RAG KO Mice The establishment of a functional immune system with diverse antigen receptors such as that in adaptive systems depends on the V(D)J recombination–activating gene products Rag-1 and Rag-2, which compose the key components for the activation of antigen receptor rearrangement [124]. These gene products are essential for the catalysis of the initial stages of V(D)J recombination and functional disruption of them leads to lymphoid arrest before the recombination of the antigen receptor loci takes place [124]. As a result of the absence of antigen receptors, both B- and T-cell differentiation is terminated, leading to the absence of the major conventional populations of matured B and T cells [124–126]. Jackson Laboratory has several strains of RAG-1 Nmice available for investigators: RAG-1-/- (in BALB/cJ background, stock no. 003145); and RAG-1-/- (in C57BL/6J background, stock no. 002096). (See Table 6.3.) 2. Cytokine KO Mice Jackson Laboratory has a collection of many cytokines KO mouse lines developed in certain mouse strains. Important examples include IL-4-/- (in C57BL/6J background, stock no. 002253) and IL-12 a-chain-/- (in C57BL/6J background, stock no. 002692). (See Table 6.3.) 3. Adhesion Molecule KO Mice Jackson Laboratory has a collection of many adhesion molecules KO mouse lines developed in certain mouse strains. A few important examples include: ICAM-1-/- (in C57BL/6J background, stock no. 002867); P-selectin-/- (in C57BL/6J background, stock no. 002289); and ICAM-1/Pselectin-/- (in C57BL/6J background, stock no. 002285). (See Table 6.3.)
1391_C06.fm Page 135 Tuesday, November 18, 2003 5:03 PM
MOUSE IMMUNE SYSTEM
135
4. Immune Cell KO Mice Jackson Laboratory has a collection of many immune cell that Kline developed in certain mouse strains. These include neutrophil/mast cell-/- (in C57BL/6 background, stock no. 004197); CD4 T cell-/- (in C57BL/6J background, stock no. 002663); and CD8 T cell-/- (in C57BL/6J background, stock no. 002665). (See Table 6.3.)
V. CONCLUSION The use of mouse models to derive a better understanding of immune mediated diseases requires information on the genetic makeup of inbred strains of mice. Clearly, many models have been developed that take advantage of the unique circumstances of inbred mouse strains. It is important to remember, however, that while there are many stable breeding colonies of mice in the world, the specifics of mouse immunity are not static. Crossbreeding of different strains and manipulation of the immune system through the use of adjuvant has greatly enhanced the development of many models. Thus, the future development of models of inflammatory skin disease does not rest simply on the use of existing inbred strains of mice but in the development of new manipulations to best take advantages of their genetics.
ACKNOWLEDGMENTS This work is in part supported by National Institutes of Health grants (R01 AR47667, R03 AR47634, and R21 AR48438, L.S.C.).
REFERENCES 1. Janeway, C.A. Jr. and Medzhitov, R., Innate immune recognition, Annu. Rev. Immunol., 20, 197, 2000. 2. Aderen, A. and Ulevitch, R.J., Toll-like receptors in the induction of the innate immune response, Nature, 406, 782, 2000. 3. Akira, S., Takeda, K., and Kaisho, T., Toll-like receptors: critical proteins linking innate and acquired immnity, Nat. Immunol., 2, 675, 2001. 4. Means, T.K., Golenbock, D.T., and Fenton, M.J., Structure and function of Toll-like receptor proteins, Life Sci., 68, 241, 2000. 5. O’Neill, L.A., Toll-like receptor signal transduction and the tailoring of innate immunity: a role or Mal? Trends Immunol., 23, 296, 2002. 6. Beutler, B., Toll-like receptor: how they work and what they do, Curr. Opin. Hematol., 9, 2, 2002. 7. Akira, S., Mammalian Toll-like receptors, Curr. Opin. Immunol., 15, 5, 2003. 8. Caamano, J. and Hunter, C.A., NF-kappaB family of transcription factors: central regulators of innate and adaptive immune functions, Clin. Microbiol. Rev., 15, 414, 2002. 9. Karin, M. and Lin, A., NF-kappaB at the crossroads of life and death, Nat. Immunol., 3, 221, 2002. 10. Hawiger, J., Innate immunity and inflammation: a transcriptional paradigm, Immunol. Res., 23, 99, 2001. 11. Li, Q. and Verma, I.M., NF-kappa regulation in the immune system, Nat. Rev. Immunol., 2, 725, 2002. 12. Bell, S. et al., Involvement of NF-kappaB signaling in skin physiology and disease, Cell Signal, 15, 1, 2003. 13. Lehrer, R.I. and Ganz, T., Defensins of vertebrate animals, Curr. Opin. Immunol., 14, 96, 2002. 14. Yang, D. et al., Mammalian defensins in immunity: more than just microbicidal, Trends Immunol., 23, 291, 2002. 15. Trinchieri, G., Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific immunity, Annu. Rev. Immunol., 13, 251, 1995.
1391_C06.fm Page 136 Tuesday, November 18, 2003 5:03 PM
136
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
16. Fitzgerald, K.A. et al., The Cytokine Facts Book, Academic Press, San Diego, 2001. 17. Banyer, J.L. et al., Cytokines in innate and adaptive immunity, Rev. Immunogenet., 2, 359, 2000. 18. Vaddi, K., Keller, M., and Newton, R.C., The Chemokine Facts Book, Academic Press, San Diego, 1997. 19. Rossi, D. and Zlotnik, A., The biology of chemokines and their receptors, Annu. Rev. Immunol., 18, 217, 2000. 20. Power, C.A., Knock out models to dissect chemokine receptor function in vivo, J. Immunol. Methods, 273, 73, 2003. 21. McColl, S.R., Chemokines and dendritic cells: a crucial alliance, Immunol. Cell Biol., 80, 489, 2002. 22. Kruger-Krasagakes, S. et al., Chemokines and mast cells, in Chemokines and Skin, Kownatzki, E. and Norgauer, J., Eds., Birkhauser, Boston, 1998, p. 75. 23. Schroder, J.M., Chemokines and eosinophils, in Chemokines and Skin, Kownatzki, E. and Norgauer, J., Eds., Birkhauser, Boston, 1998, p. 89. 24. Isacke, C.M. and Horton, M.A., The Adhesion Molecule Facts Book, Academic Press, San Diego, 2000. 25. Morley, B.J. and Walport, M.J., The Complement Facts Book, Academic Press, San Diego, 2000. 26. Carroll, M.C., The role of complement in B cell activation and tolerance, Adv. Immunol., 74, 61, 2000. 27. Barclay, A.N. et al., The Leukocyte Antigen Facts Book, Academic Press, San Diego, 1997. 28. Smith, H.R., Idris, A.H., and Yokoyama, W.M., Murine natural killer cell activation receptors, Immunol. Rev., 181, 115, 2001. 29. Diefenbach, A. and Raulet, D.H., Strategies for target cell recognition by natural killer cells, Immunol. Rev., 181, 170, 2001. 30. Middleton, D., Curran, M., and Maxwell, L., Natural killer cells and their receptors, Transpl. Immunol., 10, 147, 2002. 31. Abraham, S.N. and Arock, M., Mast cells and basophils in innate immunity, Semin. Immunol., 10, 373, 1998. 32. Mekori, Y.A. and Metcalfe, D.D., Mast cells in innate immunity, Immunol. Rev., 173, 131, 2000. 33. Marone, G., Galli, S.J., and Kitamura, Y., Probing the roles of mast cells and basophils in natural and acquired immunity, physiology and disease, Trends Immunol., 23, 425, 2002. 34. Carroll, M.C. and Prodeus, A.P., Linkages of innate and adaptive immunity, Curr. Opin. Immunol., 10, 36, 1998. 35. Ochsenbein, A.F. and Zinkernagel, R.M., Natural antibodies and complement link innate and acquired immunity, Immunol. Today, 21, 624, 2000. 36. Colonna, M., Krug, A., and Cella, M., Interferon-producing cells: on the front line in immune responses against pathogens, Curr. Opin. Immunol., 14, 373, 2002. 37. Le Page, C. et al., Interferon activation and innate immunity, Rev. Immunogenet., 2, 374, 2000. 38. Ziegler, H.K., and Skeen, M.J., and Pearce, K.M., Role of alpha/beta T and gamma/delta T cells in innate and acquired immunity, Ann. N. Y. Acad. Sci., 730, 53, 1994. 39. Boismenu, R. and Havran, W.L., An innate view of gamma delta T cells, Curr. Opin. Immunol., 9, 57, 1997. 40. Welsh, R.M. et al., Alpha beta and gamma delta T-cell networks and their roles in natural resistance to viral infections, Immunol. Rev., 159, 79, 1997. 41. Carding, S.R., Role of gamma delta T cells in immunity to infectious diseases and the regulation of hematolymphoid cell development, Immunol. Rev., 17, 13, 1998. 42. Hayday, A. et al., Intraepithelial lymphocytes: exploring the third way in immunology, Nat. Immunol., 2, 997, 2001. 43. Holtmeier, W. et al., The TCRd repertoire in normal human skin is restricted and distinct from the TCRd repertoire in the peripheral blood, J. Invest. Dermatol., 116, 275, 2001. 44. Stingl, G. et al., Thy-1+ dendritic epidermal cells express T3 antigen and the T-cell receptor g chain, Proc. Natl. Acad. Sci. U. S. A., 84, 4586, 1987. 45. Asarnow, D. et al., Limited diversity of gd antigen receptor genes of Thy-1+ dendritic epidermal cells, Cell, 55, 837, 1988. 46. Lo, D. et al., Integrating innate and adaptive immunity in the whole animal, Immunol. Rev., 169, 225, 1999. 47. Jack, R.S., Schütt, C., and Bröker, B.M., The guardians at the gate, Trends Immunol., 23, 423, 2002.
1391_C06.fm Page 137 Tuesday, November 18, 2003 5:03 PM
MOUSE IMMUNE SYSTEM
137
48. Poltorak, A. et al., Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in TLr4 gene, Science, 282, 2085, 1998. 49. Nagai, Y. et al., Essential role of MD-2 in LPS responsiveness and TLR4 distribution, Nat. Immunol., 3, 667, 2002. 50. Alexopoulou, L. et al., Hyporesponsiveness to vaccination with Borrelia burgdorferi OspA in humans in in TLR1- and TLR2-deficient mice, Nat. Med., 8, 878, 2002. 51. Hayashi, F. et al., The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5, Nature, 410, 1099, 2001. 52. Bauer, S. et al., Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition, Proc. Natl. Acad. Sci. U. S. A., 98, 9237, 2001. 53. Alexopoulou, L. et al., Recognition of double-stranded RNA and activation of NF-kB by Toll-like receptor 3, Nature, 413, 732, 2001. 54. Hemmi, H. et al., Small anti-viral compounds activate immune cells via the TLR7 MyD88-dependent signaling pathway, Nat. Immunol., 3, 196, 2002. 55. Gerondakis, S. et al., Genetic approaches in mice to understand Rel/NF-kB and IkB function: transgenics and knock outs, Oncogene, 18, 6888, 1999. 56. Ghosh, S., May, M.J., and Kopp, E.B., NF-kB and Rel proteins: evolutionarily conserved mediators of immune responses, Annu. Rev. Immunol., 16, 225, 1998. 57. Morrison, G.M. et al., Mouse b defensin-1 is a functional homolog of human b defensin-1, Mamm. Genome, 9, 453, 1998. 58. Morrison, G.M., Davidson, D.J., and Dorin, J.R., A novel mouse b defensin, Defb2, which is upregulated in the airways by lipopolyasccharide, F. E. B. S. Lett., 442, 112, 1999. 59. Bals, R. et al., Mouse b-defensin 3 is an inducible antimicrobial peptide expressed in the epithelia of multiple organs, Infect. Immun., 67, 3542, 1999. 60. Jia, H.P. et al., A novel murine b-defensin expressed in tongue, esophagus, and trachea, J. Biol. Chem., 275, 33314, 2000. 61. Yamaguchi, Y. et al., A novel mouse b-defensin, mBD-6, predominantly expressed in skeletal muscle, J. Biol. Chem., 276, 31510, 2001. 62. Mosmann,T.R. et al., Two types of murine helper T cell clone. I. Definition according to profiles of lymphocyte activities and secreted proteins, J. Immunol., 136, 2348, 1986. 63. Ihle, J.N., The Janus protein tyrosine kinase family and its role in cytokine signaling, Adv. Immunol., 60, 1, 1995. 64. Leonard, W.J. and O’Shea, J.J., Jaks and STATs: biological implications, Annu. Rev. Immunol., 16, 293, 1998. 65. Liao, Y.C. et al., IL-19 induces production of IL-6 and TNF-alpha and results in cell apoptosis through TFN-alpha, J. Immunol., 169, 4288, 2002. 66. Blumberg, H. et al., Interleukin-20: discovery, receptor identification, and role in epidermal function, Cell, 104, 9, 2001. 67. Dumoutier, L. et al., Human interleukin-10-related T cell-derived inducible factor: molecular cloning and functional characterization as an hepatocyte-stimulating factor, Proc. Natl. Acad. Sci. U. S. A., 97, 10144, 2000. 68. Parrish-Novak, J. et al., Interleukin 21 and its receptor are involved in NK cells expansion and regulation of lymphocyte function, Nature, 408, 57, 2000. 69. Dumoutier, L. et al., IL-TIF/IL-22: genomic organization and mapping of the human and mouse genes, Genes Immun., 1, 488, 2000. 70. Oppmann, B. et al., Novel p19 protein engages IL12 p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12, Immunity, 13, 715, 2000. 71. Belladonna, M.L., IL-23 and IL-12 have overlapping, but distinct, effects on murine dendritic cells, J. Immunol., 168, 5448, 2002. 72. Cua, D.J. et al., Interelukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain, Nature, 421, 744, 2003. 73. Kotenko, S.V., The family of IL-10-related cytokines and their receptors: related, but to what extent? Cytokine Growth Factor Rev., 13, 223, 2002. 74. Fort, M.M. et al., IL-25 induces IL-4, IL-5, and IL-13 and Th2-associated pathogenesis in vivo, Immunity, 15, 985, 2001.
1391_C06.fm Page 138 Tuesday, November 18, 2003 5:03 PM
138
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
75. Hurst, S.D. et al., New IL-17 family members promote Th1 or Th2 responses in the lung: in vivo function of the novel cytokine IL-25, J. Immunol., 169, 443, 2002. 76. Zlotnick, A. and Yoshie, O., Chemokines: a new classification system and their role in immunity, Immunity, 12, 121, 2000. 77. Gerwenka, A. et al., Retinoic acid early inducible gene define a ligand family for the activating NKG2D receptor in mice, Immunity, 12, 721, 2000. 78. Malarkannan, S. et al., The molecular and functional characterization of a dominant minor H antigen, H60, J. Immunol., 161, 3501, 1998. 79. Kinet, J.P., The high-affinity IgE receptor (FceRI): from physiology to pathology, Annu. Rev. Immunol., 17, 931, 1999. 80. Baumgarth, N. et al., B-1 and B-2 cell-derived immunoglobulin M antibodies are nonredundant components of the protective response to influenza virus infection, J. Exp. Med., 192, 271, 2000. 81. Herzenberg, L.A. and Kantor, A.B., B-cell lineages exist in the mouse, Immunol. Today, 14, 79, 1993. 82. Avrameas, S., Natural autoantibodies: from “horror autotoxicus” to “gnothi seauton”, Immunol. Today, 12, 154, 1991. 83. Hayday, A. and Tigelaar, R., Immunoregulation in the tissues by gd T cells, Nat. Rev. Immunol., 3, 233, 2003. 84. Paul, W.E. and Seder, R.A., Lymphocyte responses and cytokines, Cell, 76, 241, 1994. 85. Murphy, K.M. and Reiner, S.L., The lineage decisions of helper T cells, Nat. Rev. Immunol., 2, 933, 2002. 86. Szabo, S.J. et al., A novel transcription factor, T-bet, directs TH1-lineage commitment, Cell, 100, 655, 2000. 87. Quyang, W. et al., Stat6-independent GATA-3 autoactivation directs IL-4-independent TH2 development and commitment, Immunity, 12, 27, 2000. 88. Zheng, W. and Flavell, R.A., The transcription factor GATA-3 is necessary and sufficient for TH2 cytokine gene expression in CD4 T cells, Cell, 89, 587, 1997. 89. Lee, G.R., Fields, P.E., and Flavell, R.A., Regulation of IL-4 gene expression by distal regulatory elements and GATA-3 at the chromatin level, Immunity, 14, 447, 2001. 90. Braley-Mullen, H. and Sharp, G.C., Adoptive transfer murine model of granulomatous experimental autoimmune thyroiditis, Int. Rev. Immunol., 19, 535, 2000. 91. Archelos, J.J. et al., Inhibition of experimental autoimmune encephalomyelitis by an antibody to the intercellular adhesion molecule ICAM-1, Ann. Neurol., 34, 145, 1993. 92. Zaccone, P. et al., The involvement of IL-12 in murine experimentally induced autoimmune thyroid disease, Eur. J. Immunol., 29, 1933, 1999. 93. Hardy, R.R. and Hayakawa, K., B-cell development pathways, Annu. Rev. Immunol., 19, 595, 2001. 94. Mosmann, T.R. and Coffman, R.L., TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties, Annu. Rev. Immunol., 7, 145, 1989. 95. Valladeau J. et al., The monoclonal antibody DCGM4 recognizes Langerin, a protein specific of Langerhans cells, and is rapidly internalized from the cell surface, Eur. J. Immunol., 29, 2695, 1999. 96. Valladeau, J. et al., Langerin, a novel C-type lectin specific to Langerhans cells, is an enodocytic receptor that induces the formation of Birbeck granules, Immunity, 12, 71, 2000. 97. Valladeau, J. et al., Identification of mouse langerin/CD207 in Langerhans cells and some dendritic cells of lymphoid tissues, J. Immunol., 168, 782, 2002. 98. Takahara, K. et al., Identification and expression of mouse langerin (CD207) in dendritic cells, Int. J. Immunol., 14, 433, 2002. 99. Stoitzner, P. et al., Visualization and characterization of migratory Langerhans cells in murine skin and lymph nodes by antibodies against langerin/CD207, J. Invest. Dermatol., 120, 266, 2003. 100. Geissmann, F. et al., Accumulation of immature Langerhans cells in human lymph nodes draining chronically inflamed skin, J. Exp. Med., 196, 417, 2002. 101. Borkowski, T.A. et al., Expression of E-cadherin by murine dendritic cells: E-cadherin as a dendritic cell differentiation antigen characteristic of epidermal Langerhans cells and related cells, Eur. J. Immunol., 24, 2767, 1994. 102. Blauvelt, A., Katz, S.I., and Udey, M.C., Human Langerhans cells express E-cadherin, J. Invest. Dermatol., 104, 293, 1995.
1391_C06.fm Page 139 Tuesday, November 18, 2003 5:03 PM
MOUSE IMMUNE SYSTEM
139
103. Salgado CG et al., Functional CD40 ligand is expressed on epidermal Langerhans cells, J. Leukoc. Biol., 66, 281, 1999. 104. Salgado CG et al., Differential effects of cytokines and immunosuppressive drugs on CD40, B7-1, and B7-2 expression on purified epidermal Langerhans cells1, J. Invest. Dermatol., 113, 1021, 1999. 105. Adriana, T. et al., Dermal-resident CD14+ cells differentiate into Langerhans cells, Nat. Immunol., 2, 1151, 2001. 106. Teunissen, M.B. et al., Human epidermal Langerhans cells undergo profound morphologic and phenotypical changes during in vitro culture, J. Invest. Dermatol., 94, 166, 1990. 107. Tang, A. and Udey, M.C., Inhibition of epidermal Langerhans cell function by low dose ultraviolet B radiation. Ultraviolet B radiation selectively modulates ICAM-1 (CD54) expression by murine Langerhans cells, J. Immunol., 146, 3347, 1991. 108. Epstein, S.P., Baer, R.L., and Belsito, D.V., Effect of triggering epidermal Fc gamma receptors on the interleukin-2- and interleukin-6-induced upregulation of Ia antigen expression by murine epidermal Langerhans cells: the role of prostaglandins and cAMP, J. Invest. Dermatol., 97, 461, 1991. 109. Chang, C.H., Furue, M., and Tamaki, K., B7-1 expression of Langerhans cells is up-regulated by proinflammatory cytokines, and is down-regulated by interferon-gamma or by interleukin-10, Eur. J. Immunol., 25, 394, 1995. 110. Wang, B. et al., Epidermal Langerhans cells from normal human skin bind monomeric IgE via Fc epsilon RI, J. Exp. Med., 175, 1353, 1992. 111. Hayashi, S. et al., Mouse Langerhans cells do not express the high-affinity receptor for IgE, Arch. Dermatol. Res., 291, 241, 1999. 112. Nagaoka, Y. et al., Identification and characterization of the low-affinity receptor for immunoglobulin E (FcepsilonRII/CD23) on murine Langerhans cells, J. Invest. Dermatol., 119, 130, 2002. 113. Roitt, I.M. and Delves, P.J., Roitt’s Essential Immunology, 10th ed., Blackwell Scientific, London, 2001. 114. McRae, B.L. et al., Functional evidence for epitope spreading in the relapsing pathology of experimental autoimmune encephalomyelitis, J. Exp. Med., 182, 75, 1995. 115. Miller, S.D. et al., Blockade of CD28/B7-1 interaction prevents epitope spreading and clinical relapses of murine EAE, Immunity, 3, 739, 1995. 116. Vanderlugt, C.L. and Miller, S.D., Epitope spreading in immune-mediated diseases: implications for immunotherapy, Nat. Rev. Immunol., 2, 85, 2002. 117. Miller, S.D. et al., Epitope spreading leads to myelin-specific autoimmune responses in SJL mice chronically infected with Theiler’s virus, J. Neurovirol., 3, S62, 1997. 118. Miller, S.D. et al., Persistent infection with Theiler’s virus leads to CNS autoimmunity via epitope spreading, Nat. Med., 3, 1133, 1997. 119. Tompkins, S.M., Fuller, K.G., and Miller, S.D., Theiler’s virus-mediated autoimmunity: local presentation of CNS antigens and epitope spreading, Ann. N. Y. Acad. Sci., 958, 26, 2002. 120. Yamamura, M. et al., Defining protective responses to pathogens: cytokine profiles in leprosy lesions, Science, 254, 277, 1991. 121. Salgame, P. et al., Differing lymphokine profiles of functional subsets of human CD4 and CD8 T cell clones, Science, 254, 279, 1991. 122. Bosma, M.J. and Carroll, A.M., The SCID mouse mutant: definition, characterization, and potential use, Annu. Rev. Immunol., 9, 323, 1991. 123. Mosier, D.E., Immunodeficient mice xenografted with human lymphoid cells: new models for in vivo studies of human immunobiology and infectious disease, J. Clin. Immunol., 10, 185, 1990. 124. Spanopoulou, E., Cellular and molecular analysis of lymphoid development using Rag-deficient mice, Int. Rev. Immunol., 13, 257, 1996. 125. Guidos, C.J. et al., Development of CD4+CD8+ thymocytes in RAG-deficient mice through a T cell receptor beta-chain-independent pathway, J. Exp. Med., 181, 1187, 1995. 126. Falk, I. et al., Immature T cells in peripheral lymphoid organs of recombinase-activating gene-1/-2deficient mice. Thymus dependence and responsiveness to anti-CD3 epsilon antibody, J. Immunol., 156, 1362, 1996. 127. Flanagan, S.P., “Nude,” a new hairless gene with pleiotropic defects in the mouse, Genet. Res., 8, 295, 1966.
1391_C06.fm Page 140 Tuesday, November 18, 2003 5:03 PM
140
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
128. Wortis, H.H., Nehlsen, S., and Owen, J.J., Abnormal development of the thymus in “nude” mice, J. Exp. Med., 134, 681, 1971. 129. Kaushik, A., Kelsoe, G., and Jaton, J.C., The nude mutation results in impaired primary antibody repertoire, Eur. J. Immunol., 24, 631, 1995. 130. Rahemtulla, A. et al., Mice lacking CD4 have normal development and function of CD8+ cells but have markedly decreased helper cell activity, Nature, 353, 180, 1991. 131. Fung-Leung, W.P. et al., CD8 is needed for development of cytotoxic T cells but not helper T cells, Cell, 65, 443, 1991. 132. Freeman, G.T. et al., Uncovering of functional alternative CTLA-4 counter-receptor in B7-deficient mice, Science, 262, 907, 1993. 133. Borriello, F. et al., B7-1 and B7-2 have overlapping, critical roles in immunoglobulin class switching and germinal center formation, Immunity, 6, 303, 1997. 134. Roberts, A.W. et al., Deficiency of the hematopoietic cell-specific Rho family GTPase Rac2 is characterized by abnormalities in neutrophil function and host defense, Immunity, 10, 183, 1993. 135. Kuhn, R., Rajewsky, K., and Muller, W., Generation and analysis of interleukin-4 deficient mice, Science, 254, 707, 1991. 136. Mattner, F. et al., Genetically resistant mice lacking interleukin-12 are susceptible to infection with Leishmania major and mount a polarized Th2 cell response, Eur. J. Immunol., 26, 1553, 1996. 137. Sligh, J.E. et al., Inflammatory and immune responses are impaired in mice deficient in intercellular adhesion molecule 1, Proc. Natl., Acad. Sci., U. S. A., 90, 8529, 1993. 138. Bullard, D.C. et al., P-selectin/ICAM-1 double mutant mice: acute migration of neutrophils into the peritoneum is completely absent but is normal into pulmonary alveoli, J. Clin. Invest., 95, 1782, 1995.
1391_C07.fm Page 141 Tuesday, November 18, 2003 5:05 PM
PART
III
Immune Privilege and Skin Inflammation
1391_C07.fm Page 142 Tuesday, November 18, 2003 5:05 PM
1391_C07.fm Page 143 Tuesday, November 18, 2003 5:05 PM
CHAPTER
7
Immune Privilege of the Eye Jerry Y. Niederkorn
CONTENTS I. Background ........................................................................................................................143 II. Anatomical and Structural Factors That Contribute to Ocular Immune Privilege...........144 III. Anti-Inflammatory and Immunosuppressive Factors Within the Intraocular Milieu ........................................................................................................145 A. Soluble Factors ..........................................................................................................145 B. Cell Membrane–Bound Factors.................................................................................145 IV. ACAID: A Dynamic Down Regulation of Systemic Immune Responses to Ocular Antigens .............................................................................................................146 V. Immune-Mediated Ocular Diseases: A Breakdown in Immune Privilege? ......................147 A. Intraocular Immune-Mediated Diseases....................................................................147 B. Immune-Mediated Diseases of the Cornea and Conjunctiva ...................................148 C. Ocular Cicatricial Pemphigoid ..................................................................................149 VI. Immune Privilege of the Hair Follicle...............................................................................149 Acknowledgments ..........................................................................................................................150 References ......................................................................................................................................150
I. BACKGROUND Although the human eye is only a few centimeters in diameter, it is composed of a diverse array of tissues, including some cellular and noncellular elements found nowhere else in the body [1]. There are approximately 1 million ganglion cells in the retina that transmit 500 electrical signals per second, which is roughly equivalent to 1.5 ¥ 109 bits of computer information [1]. The extraordinary complexity of the retina and its neurological communications with the brain are meaningless if the transparency of the cornea and the aqueous humor are compromised by trauma, infection, or inflammation. The eye is an extension of the brain and like other elements of the central nervous system; cells in the retina and the corneal endothelium cannot regenerate. Unlike other organs, the eye cannot tolerate even mild inflammation without jeopardizing its only known function, vision. Thus, tight regulation of ocular inflammation and immune responses in the eye is crucial for maintaining the integrity and function of the visual axis. Ocular immune privilege is believed to be an adaptation for restricting the expression of potentially damaging immune-mediated 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
143
1391_C07.fm Page 144 Tuesday, November 18, 2003 5:05 PM
144
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
responses that indiscriminately inflict injury to ocular cells that possess limited regenerative properties [2–5]. The phenomenon that we know as ocular immune privilege was recognized over a century ago by van Dooremaal, who demonstrated that tumors transplanted into the anterior chamber of the rabbit eye survived for prolonged periods of time [6]. However, the significance of graft survival in the anterior chamber (AC) was not fully appreciated until the seminal studies of Medawar and colleagues ushered in the age of transplantation immunology [7–9]. Medawar recognized that the prolonged survival of foreign tissue grafts in the AC of the eye was a departure from the expected fate of tissue grafts transplanted to other body sites [9]. Since the eye lacks patent lymphatic drainage, it was widely believed that foreign tumor and tissue grafts placed into the AC were sequestered from the peripheral immune apparatus. The notion that immune privilege in the AC was simply a case of immunological ignorance went unchallenged until the late 1970s when Kaplan and Streilein demonstrated that alloantigenic cells introduced into the AC of the rat were indeed perceived by the peripheral immune apparatus [10,11]. Not only did ocular antigens enter peripheral lymphoid tissues, but they also evoked an antigen-specific down regulation of cell-mediated immunity and a concomitant activation of humoral antibody production. This pattern of immune responses was a radical deviation from the normal responses evoked by antigens introduced by other routes. Subsequent studies in mice using allogeneic tumors and minor histocompatibility antigens demonstrated a similar spectrum of suppressed cell-mediated immunity and a preservation of humoral antibody responses [12,13]. Accordingly, the deviant immune response induced by antigens introduced into the AC was termed “anterior chamber-associated immune deviation” (ACAID) to connote the dynamic nature of this immune phenomenon and its relationship with the AC [14]. Since its initial description, ACAID has been demonstrated by numerous laboratories using a wide range of antigens including viral antigens [15], major and minor histocompatibility antigens [12,16–18], soluble proteinaceous antigens [19–21], haptenated cells [22], and tumor antigens [23]. To date, all of the soluble antigens tested have induced ACAID [4]. Although ACAID plays a central role in the maintenance of ocular immune privilege, other properties of the eye also limit the induction and expression of immune-mediated inflammation. These include: (a) anatomical barriers that limit the entry of inflammatory cells into the eye; (b) the low expression of major histocompatibility complex (MHC) antigens on various ocular tissues; (c) a potpourri of anti-inflammatory and immunosuppressive molecules in the aqueous humor; and (d) cell membrane-bound molecules that inactivate immune effector elements that may enter the eye. Thus, ocular immune privilege is a product of multiple anatomical, physiological, and immunoregulatory processes that conspire to limit the induction and expression of immune-mediate inflammation.
II. ANATOMICAL AND STRUCTURAL FACTORS THAT CONTRIBUTE TO OCULAR IMMUNE PRIVILEGE The simplest, and initially the most appealing, explanation for ocular immune privilege was based on the unique absence of major, patent lymphatics draining the interior of the eye, thus creating an afferent blockade of antigen egression to the immune apparatus. However, subsequent studies in mice demonstrated that antigens deposited into the anterior chamber could be detected in the submandibular lymph node as early as three days after intracameral injection [24]. It has been suggested that the tight junctional complexes in the endothelial cells of iris and retinal blood vessels limits the egression of macromolecules and cells from the blood into the eye. This would seemingly prevent the entry of systemically generated immune effector elements from entering the eye. However, passive transfer of immune serum, lymphocytes, or cytotoxic T-lymphocyte (CTL) clones results in the prompt rejection of some intraocular tumors in mice [25–27]. Thus, immune elements have the capacity to enter the eye and exert their effector functions.
1391_C07.fm Page 145 Tuesday, November 18, 2003 5:05 PM
IMMUNE PRIVILEGE OF THE EYE
145
Although MHC class I molecules are expressed on virtually all nucleated cells in the body, their expression is greatly reduced or frankly absent on many cells within the eye [28]. It is noteworthy that the corneal endothelium and the retina are incapable of regeneration and coincidentally express little or no MHC class I antigens. The absence of MHC class I antigens would protect these cells from cytolysis by MHC class I restricted CTL in the event of viral infection or when these tissues are used as allografts. The absence of MHC class II antigens on all three corneal cell layers allows MHC class II-mismatched corneal allografts to escape immune recognition and rejection in 80-90% of the hosts [29,30]. Even more impressive is the absence or dramatic reduction in the expression of both MHC class I and class II antigens on the corneal endothelium [5,31–33].
III. ANTI-INFLAMMATORY AND IMMUNOSUPPRESSIVE FACTORS WITHIN THE INTRAOCULAR MILIEU A. Soluble Factors The aqueous humor (AH) that fills the AC possesses remarkable anti-inflammatory and immunomodulatory properties. AH inhibits lymphoproliferative responses in vitro [34,35] and suppresses the expression of delayed type hypersensitivity (DTH) in vivo [36,37]. At least four different AHborne factors inhibit the expression of DTH within the eye: a) TFG-b, b) a-melanocyte-stimulating hormone (a-MSH), c) vasoactive intestinal peptide (VIP), and d) calcitonin gene-related peptide (CGRP) [38-44]. The AH also contains a <10-kDa peptide that induces apoptosis of natural killer (NK) cells, T cells, macrophages, and neutrophils [45]. The AH also suppresses elements of the innate immune system. The complement system, especially the alternative pathway of complement activation, is a component of the innate immune apparatus. Activation of the complement cascade culminates in the generation of potent chemoattractants that recruit and activate granulocytes. Complement products and the ensuing inflammatory cells can inflict significant injury to normal tissues following complement activation. However, many tissues in the body express complement regulatory proteins (CRP) that inactivate complement components, thereby preventing injury to innocent bystander cells. Complement regulatory proteins are also found in soluble forms in the AH and the vitreous components of the eye where they protect the eye from complement-mediated damage [46–48]. However, the capacity to limit complement-related injury in the eye is limited and an overwhelming activation of the complement cascade can culminate in immune-mediated destruction of ocular tissues [49]. It is believed that constant low level complement activation may have a beneficial effect in controlling minor infections within the eye without reaching levels that would damage normal, juxtaposed ocular cells. The AH contains several soluble factors that either suppress or eliminate cells of the innate immune system. Macrophage migration inhibitor factor (MIF) and TGF-b, are present in the AH at concentrations that strongly suppress the cytolytic activity of NK cells [50–53]. Moreover, studies in nude mice have shown that NK cell-mediated rejection of uveal melanomas is suppressed in the eye, yet is intact at extraocular sites [50]. In addition to suppressing NK cell function, the AH contains a small molecular weight protein that induces apoptosis of neutrophils and macrophages, two other cells of the innate immune system. B. Cell Membrane–Bound Factors Cells lining the interior of the eye are decorated with cell membrane-bound molecules that limit the expression of effector elements of the innate and adaptive immune systems. FasL (CD95L) is widely expressed on cells lining the interior of the eye and effectively eliminates inflammatory cells that enter the eye in response to viral infection [54]. FasL on corneal endothelial cells is
1391_C07.fm Page 146 Tuesday, November 18, 2003 5:05 PM
146
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
capable of inducing apoptosis of inflammatory cells and contributes to the immune privilege of corneal allografts [55,56]. Complement regulatory proteins are not only present in ocular fluids, but they are also expressed on the cell membranes of numerous ocular tissues [46,49,57]. The importance of complement regulatory proteins in the immunological homeostasis and immune privilege of the eye was demonstrated by Sohn et al. [49] who found that administration of neutralizing antibody to the cell membrane-bound complement regulatory protein, Crry, resulted in severe intraocular inflammation in rats. The current paradigm for NK cell regulation proposes that MHC class Ia molecules deliver inhibitory signals to NK cells. According to the “missing self” hypothesis, cells failing to display MHC class I antigens are vulnerable to NK cell-mediated cytolysis [58,59]. Thus, the absence or feeble expression of classical class Ia MHC molecules on cells that line the interior of the eye places many ocular tissues at risk for cytolysis by NK cells. However, nonclassical class Ib molecules, such as Qa-2 in the mouse, are expressed on ocular cells that fail to display detectable quantities of classical MHC class Ia molecules [60]. The expression of class Ib molecules has important implications in ocular immune privilege, as these molecules are associated with tolerance induction, inhibition of NK cell-mediated lysis, and suppression of inflammatory responses. The best-studied human class Ib molecule, HLA-G, is the human analog of Qa-2, and has been shown to inhibit the cytolytic activity of NK cells and CTL [61]. Qa-2 is widely expressed in the mouse eye, including cells that express little or no MHC class Ia molecules and which would otherwise be vulnerable to NK cell-mediated attack. Thus, instead of unwittingly inviting immune attack, cells that line the interior of the eye are endowed with molecules that inhibit elements in both the innate and adaptive immune system. The extensive redundancy of these adaptations bespeaks their importance in maintaining the homeostasis of the intraocular milieu.
IV. ACAID: A DYNAMIC DOWN REGULATION OF SYSTEMIC IMMUNE RESPONSES TO OCULAR ANTIGENS Structural, anatomical, and physiological features of the eye discourage the induction and expression of immune-mediated inflammation. Antigens that enter the AC elicit a unique deviation of the systemic immune response that culminates in the antigen-specific down-regulation of DTH responses, while preserving humoral antibody and CTL activities, which as previously mentioned, is the phenomenon termed ACAID [3–5]. The hallmark of ACAID is the selective down-regulation of DTH. This is consistent with the observation that DTH can inflict extensive injury to collateral tissues in an antigen-nonspecific manner. The preservation of systemic antibody and CTL responses in ACAID is teleologically appealing as the expression of these two effector mechanisms is tightly regulated in the eye by the buffering effects of the AH on antibody-related activation of complement and the low expression of MHC class I molecules, which are the requisite restriction elements for CTL. Thus, selectively suppressing DTH while preserving CTL and antibody responses to antigens introduced into the eye is an effective adaptation for maintaining immune defenses outside the eye while protecting ocular tissues from immune-mediated injury. The induction of ACAID is a complex process that involves at least two organs in addition to the eye: the thymus and the spleen. ACAID is initiated when antigens are introduced into the AC of the eye. The eye plays an active role in the induction of ACAID, as enucleation of the eye within three days of antigen injection will prevent the induction of ACAID [14,62,63]. During the ocular phase of ACAID, F4/80+ antigen presenting cells (APC) capture and process antigen under the influence of AH-borne factors. At least two factors present in the AH influence the behavior of ocular APC, TGF-b and the third component of complement [64,65]. Together these factors induce ocular APC to produce IL-10 and cease production of IL-12 [65,66]. Within 24 hours of antigen injection in the AC, the F4/80+ APC can be detected in the peripheral blood [67,68]. As few as 20
1391_C07.fm Page 147 Tuesday, November 18, 2003 5:05 PM
IMMUNE PRIVILEGE OF THE EYE
147
of the F4/80+ blood-borne ocular APCs can induce ACAID when transferred intravenously to naïve recipients [64]. The blood-borne ocular APC follow two pathways in the induction of ACAID. The first pathway leads to the thymus. The ocular APC must enter and reside in the thymus for at least 3 days where they induce the generation of NK1.1+, CD4-,8- thymocytes that subsequently emigrate to the spleen [69]. The second pathway for ocular APC migration is from the eye directly to the spleen where they are believed to induce the formation of CD8+ suppressor cells [64,68,70]. Both pathways of ocular APC migration culminate in the generation of splenic regulatory cells that suppress the expression of antigen-specific DTH. The spleen is required during the first 7 days after AC injection of antigen [14]. It is becoming increasingly clear that the cellular interactions that occur in the spleen during the course of suppressor cell development are extraordinarily complex. At least four separate spleen cell populations are required for the generation of ACAID suppressor cells: (1) B cells [71,72]; (2) gd T cells [73–75]; (3) NK T cells [76–78]; and (4) CD4+ T cells. Unraveling how these cell populations interact in the generation of ACAID is a daunting, but important task.
V. IMMUNE-MEDIATED OCULAR DISEASES: A BREAKDOWN IN IMMUNE PRIVILEGE? A. Intraocular Immune-Mediated Diseases Under normal circumstances the elegant immunoregulatory and anti-inflammatory properties of the AC shield the eye from immune-mediated injury. However, ocular immune privilege can break down, leaving the eye vulnerable to immune-mediated inflammation. The possibility that ocular antigens might provoke inflammatory responses was raised over 80 years ago when Verhoeff and Lemoine observed that penetrating injuries to the eye were often followed by persistent inflammation in the contralateral, uninjured eye [79]. This phenomenon has been confirmed countless times and is now recognized as a distinct entity termed sympathetic ophthalmia (SO). The pathogenesis of SO is believed to begin with the sudden release of sequestered ocular antigens following traumatic injury to the eye. The ocular antigens, for reasons that remain unknown, elicit a systemic autoimmune response that is directed against ocular epitopes that are expressed in both the traumatically injured eye and the contralateral “sympathizing eye.” This can result in persistent, potentially blinding, inflammation in both eyes. The anatomical sequestration of lens crystallins within the collagenous lens capsule early in organogenesis isolates lens proteins from the systemic immune apparatus and thus bypasses the normal induction of tolerance in the thymus. Not only are the lens antigens isolated from the systemic immune elements, but also the lens itself is in direct contact with the AC and most likely benefits from the privilege enjoyed by this site. Elements of the immune system do not come in contact with lens antigens unless penetrating, traumatic injury to the lens releases the lens crystallins into the peripheral circulation. Studies in mice have shown that rupturing the lens with an argon laser stimulates the production of antibodies to homologous lens crystallins [80]. Such traumatic injury to the lens in one eye is followed by spontaneous inflammation in the contralateral eye 3 to 4 weeks later. A significant body of circumstantial evidence suggests that antibodies to lens antigens may contribute to cataract development [81]. In some studies, up to 98% of cataract patients possess detectable serum antibodies specific for lens antigens [81]. Antibodies to lens proteins can produce complement-dependent lysis of human lens epithelial cells in vitro [82]. However, understanding the role of anti-lens antibodies in cataractogenesis is complicated by the fact that b crystallin antigens are cytoplasmic proteins that are not normally expressed on the lens epithelial cell membrane, and thus, are not directly accessible to anti-lens antibody [83]. Moreover, only 15% of the human lens epithelial cells react with anti-b crystallin monoclonal antibody in vitro [82]. In
1391_C07.fm Page 148 Tuesday, November 18, 2003 5:05 PM
148
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
spite of these caveats, there is sufficient circumstantial evidence to warrant further exploration of the hypothesis that cataractogenesis might have an immunological etiology. The chorid, ciliary body, and iris constitute the uveal tract of the eye and are vulnerable to immune-mediated attack, a condition termed “idiopathic uveitis.” Unlike the pathogenesis of cataract formation, an overwhelming body of compelling evidence has established the immunopathogenesis of uveitis. Almost 30 years of research in animal models has demonstrated that retinal antigens are capable of eliciting a T-cell–mediated inflammation of the retina and uveal tract that mimics human recurrent idiopathic uveitis [84]. Experimental autoimmune uveitis (EAU) can be induced in rodents through systemic immunization with the well-characterized retinal S antigen or interphotoreceptor retinoid-binding protein (IRBP). Both of these antigens are expressed in the retina and are targets for immune-mediated inflammation in EAU. The appearance of DTH responses to either retinal S-antigen correlates with the onset of EAU [85] and the adoptive transfer of S-antigen–specific CD4+ T cells produces EAU in naïve mice [86]. The weight of evidence indicates that EAU in rodents and possibly idiopathic uveitis in patients are Th1-mediated diseases. The relatively rare incidence of uveitis in humans and the observation that induction of uveitis in animals requires the use of adjuvants, suggests that the immune privilege of the eye is an effective barrier for preventing immune-mediated injury elicited by either endogenous ocular antigens. Prospective studies in animal models support this proposition. Intracameral injection of retinal Santigen induces down-regulation of Th1 immune responses (ACAID) and mitigates EAU [20,21,87]. Thus, it is plausible to propose that retinal antigens are routinely released inside the eye and elicit ACAID or an ACAID-like tolerance [88] that protects the retina and uveal tract from immunemediated inflammation. B. Immune-Mediated Diseases of the Cornea and Conjunctiva Infections of the cornea can overwhelm ocular immune privilege and instigate immune-mediated inflammation. In fact, the three leading causes of infectious corneal blindness, onchocerciasis, trachoma, and herpes simplex virus keratitis (HSV), are immune-mediated diseases [89–91]. Corneal infections with HSV can circumvent immune privilege and induce robust DTH responses that culminate in destruction of the corneal stroma and blindness [91]. The severity of HSV keratitis in mice correlates with the intensity of the systemic DTH responses to HSV antigens, and maneuvers that suppress HSV-specific DTH produce mitigation of keratitis that is commensurate with the degree of suppression of DTH [4]. Trachoma affects over 500 million people and is the leading cause of infectious blindness [92]. The pathogenesis of trachoma is characterized by chronic inflammation of the conjunctiva as a result of ocular infection with the bacterium, Chlamydia trachomatis. Repeated exposure to C. trachomatis results in chronic ocular inflammation, scarring, and blindness. The prevailing view is that the ocular lesions in trachoma are immune mediated. [93–95]. Studies in animals have implicated DTH responses to chronic stimulation with Chlamydia antigens as pivotal events in the pathogenesis of trachoma [96], although there is evidence that Th2 responses may also participate in the immunopathogenesis of trachoma [97]. In either case, the weight of evidence indicates that trachoma is an immune-mediated disease [93–98]. Onchocerciasis (river blindness) is the third leading cause of infectious blindness worldwide [89]. Infection with the nematode, Onchocerca volvulus, leads to the generation of microfilariae that eventually migrate through ocular tissues. The severity of the ocular lesions is directly correlated with the host’s immune response to the migrating microfilariae. Unlike the pathological sequelae of HSV and trachoma, which are Th1 mediated, the pathogenesis of onchocerciasis appears to be Th2 mediated. That is, the immune profile in onchocerciasis is characterized by elevated Th2 cytokines, IL-4 and IL-5, and a preponderance of eosinophils [89]. Antibody to onchocercal antigens leads to the activation of the complement cascade within the infected cornea and the recruitment of eosinophils and neutrophils. The presence of eosinophils is especially damaging to the infected
1391_C07.fm Page 149 Tuesday, November 18, 2003 5:05 PM
IMMUNE PRIVILEGE OF THE EYE
149
cornea as these cells release a variety of cytotoxic cationic proteins, which not only kill corneal cells, but also prevent corneal wound healing [99,100]. C. Ocular Cicatricial Pemphigoid Cicatricial pemphigoid (CP; recently renamed as mucous membrane pemphigoid) is an autoimmune disease that can affect virtually any mucosal surface, including the conjunctiva [101–103]. The ocular manifestations of CP include bilateral conjunctivitis, scarring, and in severe cases, blindness. The prevailing view is that CP is a defect in immune regulation that culminates in the generation of autoantibodies to epitopes expressed on the conjunctival basement membrane [101–103]. Anti-basement membrane antibodies of the IgA and IgG isotypes are implicated in the pathogenesis of ocular CP. It is believed that the anti-basement membrane antibodies activate the complement cascade culminating in the recruitment of multiple inflammatory cell populations including macrophages, T-helper lymphocytes, mast cells, and granulocytes. Antibody-dependent activation of the complement cascade appears to be a pivotal event in the pathogenesis of ocular CP. The cornea enjoys a degree of protection from complement-mediated injury through the expression of complement regulatory proteins on the corneal epithelial cells and the buffering properties of the aqueous humor-borne complement regulatory proteins that bathe the corneal endothelium. It is not presently known if the conjunctiva, unlike the cornea, lacks complement regulatory proteins, thereby making it vulnerable to complement-mediated autoimmune attack such at that which occurs in CP.
VI. IMMUNE PRIVILEGE OF THE HAIR FOLLICLE The notion that the hair follicle possessed unusual immunological properties was suggested over 30 years ago by Billingham and Silvers [104]. These investigators observed that pigmented skin allografts apparently underwent immune rejection in albino guinea pigs. However, melanocytes appeared in the graft beds in the ensuing weeks following putative skin allograft rejection. The appearance of melanocytes in albino hosts could only be explained by the donor cells escaping immune destruction. The authors proposed that the allogeneic donor cells had escaped immune destruction through the sanctuary provided by the host’s hair follicles. These extraordinary findings established the basis for immune privilege of the hair follicle. There are interesting parallels between the hair follicle and the AC of the eye that bear noting. Like many cells in the eye, the cells of the hair follicle display reduced expression of MHC class Ia molecules, especially during the growth stage of hair [105–107]. Moreover, immune cells are conspicuously absent or sparsely distributed in the hair follicle. The central corneal epithelium is devoid of class II positive Langerhans cells, which are necessary for the generation of DTH responses to ocular pathogens and alloantigens [31,32,108–110]. The absence of Langerhans cells in the entire lower two-thirds of the anagen hair follicle [107,111] is an intriguing similarity to the central corneal epithelium and begs the question of its role in the immune privilege of the hair follicle. There is evidence that immune responses in the skin are influenced by the hair cycle [112–114]. Contact hypersensitivity responses are impaired if hapten is administered to skin during telogen [113]. Like the aqueous humor, the hair follicle produces at least two factors, TGF-b [115,116] and adrenocorticotrophic hormone [117], which exert anti-inflammatory and immunoregulatory effects. The immune privilege of the eye has been recognized for over a century and thus, has experienced a long history of investigation. By contrast, the discovery of the immune privilege of the hair follicle is more recent and has not enjoyed the attention garnered by ocular immune privilege. As we learn more about the immunobiology of the hair follicle, it will be interesting to ascertain
1391_C07.fm Page 150 Tuesday, November 18, 2003 5:05 PM
150
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
if the multiple, redundant mechanisms that sustain ocular immune privilege have similar counterparts in the hair follicle.
ACKNOWLEDGMENTS This work supported by National Institutes of Health grants (EY07641 and EY05631) and an unrestricted grant from Research to Prevent Blindness, Inc., New York.
REFERENCES 1. Miller, D., Ophthalmology: The Essentials, Houghton Mifflin, Boston, 1979. 2. Niederkorn, J., Immunological barriers in the eye, in Immunopharmacology of Epithelial Barriers, Goldie, R., Ed., Academic Press, London, 19, 94, p. 241. 3. Niederkorn, J.Y., Anterior chamber-associated immune deviation, Chem. Immunol., 73, 59, 1999. 4. Niederkorn, J.Y., Immune privilege in the anterior chamber of the eye, Crit. Rev. Immunol., 22, 13, 2002. 5. Niederkorn, J.Y., Immune privilege and immune regulation in the eye, Adv. Immunol., 48, 191, 1990. 6. van Dooremaal, J.C., Die Entwicklung der in fremden Grund versetzten lebenden Geweba, Albrecht von Graefes Arch. Ophthalmol., 19, 358, 1873. 7. Billingham, R.E., Brent, L., and Medawar, P.B., Quantitative studies on tissue transplantation immunity. II. The origin, strength, and duration of actively and adoptively acquired immunity, Proc. R. Soc. Lond. B Biol. Sci., 143, 58, 1954. 8. Medawar, P.B., A second study of the behavior and fate of skin homografts in rabbits, J. Anat. (London), 79, 157, 1945. 9. Medawar, P.B., Immunity to homologous grafted skin. III. The fate of skin homografts transplanted to the brain, to subcutaneous tissue, and to the anterior chamber of the eye, Br. J. Exp. Pathol., 29, 58, 1848. 10. Kaplan, H.J., Streilein, J.W., and Stevens, T.R., Transplantation immunology of the anterior chamber of the eye. II. Immune response to allogeneic cells, J. Immunol., 115, 805, 1975. 11. Kaplan, H.J. and Streilein, J.W., Immune response to immunization via the anterior chamber of the eye. I. F.lymphocyte-induced immune deviation, J. Immunol., 118, 809, 1977. 12. Niederkorn, J., Streilein, J.W., and Shadduck, J.A., Deviant immune responses to allogeneic tumors injected intracamerally and subcutaneously in mice, Invest. Ophthalmol. Vis. Sci., 20, 355, 1981. 13. Streilein, J.W., Niederkorn, J.Y., and Shadduck, J.A., Systemic immune unresponsiveness induced in adult mice by anterior chamber presentation of minor histocompatibility antigens, J. Exp. Med., 152, 1121, 1980. 14. Streilein, J.W. and Niederkorn, J.Y., Induction of anterior chamber-associated immune deviation requires an intact, functional spleen, J. Exp. Med., 153, 1058, 1981. 15. Whittum, J.A. et al., Role of suppressor T cells in herpes simplex virus-induced immune deviation, J. Virol., 51, 556, 1984. 16. Benson, J.L. and Niederkorn, J.Y., Immune privilege in the anterior chamber of the eye: alloantigens and tumour-specific antigens presented into the anterior chamber simultaneously induce suppression and activation of delayed hypersensitivity to the respective antigens, Immunology, 77, 189, 1992. 17. Okamoto, S., Hara, Y., and Streilein, J.W., Induction of anterior chamber-associated immune deviation with lymphoreticular allogeneic cells, Transplantation, 59, 377, 1995. 18. Niederkorn, J.Y., Mayhew, E., and He, Y., Alloantigens introduced into the anterior chamber of the eye induce systemic suppression of delayed hypersensitivity to third-party alloantigens through “linked recognition,” Transplantation, 60, 348, 1995. 19. Niederkorn, J.Y., Brieland, J.K., and Mayhew, E., Enhanced natural killer cell activity in experimental murine encephalitozoonosis, Infect. Immun., 41, 302, 1983. 20. Mizuno, K., Clark, A.F., and Streilein, J.W., Anterior chamber-associated immune deviation induced by soluble antigens, Invest. Ophthalmol. Vis. Sci., 30, 1112, 1989.
1391_C07.fm Page 151 Tuesday, November 18, 2003 5:05 PM
IMMUNE PRIVILEGE OF THE EYE
151
21. Mizuno, K. et al., Histopathologic analysis of experimental autoimmune uveitis attenuated by intracameral injection of S-antigen, Curr. Eye Res., 8, 113, 1989. 22. Wang, R. et al., Definition of a novel binding site on CD8 cells for a conserved region of the MHC class Ib molecule Qa-1 that regulates IFN-gamma expression, Eur. J. Immunol., 31, 87, 2001. 23. Niederkorn, J.Y., Suppressed cellular immunity in mice harboring intraocular melanomas, Invest. Ophthalmol. Vis. Sci., 25, 447, 1984. 24. Egan, R.M. et al., Peptide-specific T cell clonal expansion in vivo following immunization in the eye, an immune-privileged site, J. Immunol., 157, 2262, 1996. 25. Niederkorn, J.Y. and Streilein, J.W., Adoptive transfer of immunity to intraocular tumors in mice, Invest. Ophthalmol. Vis. Sci., 25, 336, 1984. 26. Knisely, T.L. and Niederkorn, J.Y., Emergence of a dominant cytotoxic T lymphocyte antitumor effector from tumor-infiltrating cells in the anterior chamber of the eye, Cancer Immunol. Immunother., 30, 323, 1990. 27. Schurmans, L.R. et al., Successful immunotherapy of an intraocular tumor in mice, Cancer Res., 59, 5250, 1999. 28. LeBouteiller, P., HLA class I chromosomal region, genes, and products: facts and questions, Crit. Rev. Immunol., 14, 89, 1994. 29. Ross, J. et al., Evidence that the fate of class II-disparate corneal grafts is determined by the timing of class II expression, Transplantation, 51, 532, 1991. 30. Sonoda, Y. and Streilein, J.W., Orthotopic corneal transplantation in mice — evidence that the immunogenetic rules of rejection do not apply, Transplantation, 54, 694, 1992. 31. Niederkorn, J.Y., The immune privilege of corneal allografts, Transplantation, 67, 1503, 1999. 32. Niederkorn, J.Y., The immunology of corneal transplantation, Dev. Ophthalmol., 30, 129, 1999. 33. Niederkorn, J.Y., Immunology and immunomodulation of corneal transplantation, Int. Rev. Immunol., 21, 173, 2002. 34. Benezra, D. and Sachs, U., Growth factors in aqueous humor of normal and inflamed eyes of rabbits, Invest. Ophthalmol., 13, 868, 1974. 35. Kaiser, C., Ksander B., and Streilein J.W., Inhibition of lymphocyte proliferation by aqueous humor, Reg. Immunol., 2, 42, 1989. 36. Niederkorn, J.Y., Benson, J.L., and Mayhew, E., Efferent blockade of delayed-type hypersensitivity responses in the anterior chamber of the eye, Reg. Immunol., 3, 349, 1990. 37. Cousins, S.W., Trattler, W.B., and Streilein, J.W., Immune privilege and suppression of immunogenic inflammation in the anterior chamber of the eye, Curr. Eye Res., 10, 287, 1991. 38. Taylor, A.W., Ocular immunosuppressive microenvironment, Chem. Immunol., 73, 72, 1999. 39. Taylor, A.W., Streilein, J.W., and Cousins, S.W., Alpha-melanocyte-stimulating hormone suppresses antigen-stimulated T cell production of gamma-interferon. Neuroimmunomodulation, 1, 188, 1994. 40. Taylor, A.W., Streilein, J.W., and Cousins, S.W., Immunoreactive vasoactive intestinal peptide contributes to the immunosuppressive activity of normal aqueous humor, J. Immunol., 153, 1080, 1994. 41. Taylor, A.W., Yee, D.G., and Streilein, J.W., Suppression of nitric oxide generated by inflammatory macrophages by calcitonin gene-related peptide in aqueous humor, Invest. Ophthalmol. Vis. Sci., 39, 1372, 1998. 42. Taylor, A.W. et al., Aqueous humor induces transforming growth factor-beta (TGF-beta)-producing regulatory T-cells, Curr. Eye Res., 16, 900, 1997. 43. Cousins, S.W. et al., Identification of transforming growth factor-beta as an immunosuppressive factor in aqueous humor, Invest. Ophthalmol. Vis. Sci., 32, 2201, 1991. 44. Granstein, R.D. et al., Aqueous humor contains transforming growth factor-beta and a small (less than 3500 daltons) inhibitor of thymocyte proliferation, J. Immunol., 144, 3021, 1990. 45. D'Orazio, T.J. et al., Effect of aqueous humor on apoptosis of inflammatory cell types, Invest. Ophthalmol. Vis. Sci., 40, 1418, 1999. 46. Lass, J.H. et al., Expression of two molecular forms of the complement decay-accelerating factor in the eye and lacrimal gland, Invest. Ophthalmol. Vis. Sci., 31, 1136, 1990. 47. Sohn, J.H. et al., Complement regulatory activity of normal human intraocular fluid is mediated by MCP, DAF, and CD59, Invest. Ophthalmol. Vis. Sci., 41, 4195, 2000. 48. Goslings, W.R. et al., A small molecular weight factor in aqueous humor acts on C1q to prevent antibody-dependent complement activation, Invest. Ophthalmol. Vis. Sci., 39, 989, 1998.
1391_C07.fm Page 152 Tuesday, November 18, 2003 5:05 PM
152
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
49. Sohn, J.H. et al., Chronic low level complement activation within the eye is controlled by intraocular complement regulatory proteins, Invest. Ophthalmol. Vis. Sci., 41, 3492, 2000. 50. Apte, R.S., Mayhew, E., and Niederkorn, J.Y., Local inhibition of natural killer cell activity promotes the progressive growth of intraocular tumors, Invest. Ophthalmol. Vis. Sci., 38, 1277, 1997. 51. Apte, R.S. and Niederkorn, J.Y., Isolation and characterization of a unique natural killer cell inhibitory factor present in the anterior chamber of the eye, J. Immunol., 156, 2667, 1996. 52. Apte, R.S. et al., Cutting edge: role of macrophage migration inhibitory factor in inhibiting NK cell activity and preserving immune privilege, J. Immunol., 160, 5693, 1998. 53. Rook, A.H. et al., Effects of transforming growth factor beta on the functions of natural killer cells: depressed cytolytic activity and blunting of interferon responsiveness, J. Immunol., 136, 3916, 1986. 54. Griffith, T.S. et al., Fas ligand-induced apoptosis as a mechanism of immune privilege, Science, 270, 1189, 1995. 55. Yamagami, S. et al., Role of Fas-Fas ligand interactions in the immunorejection of allogeneic mouse corneal transplants, Transplantation, 64, 1107, 1997. 56. Stuart, P.M. et al., CD95 ligand (FasL)-induced apoptosis is necessary for corneal allograft survival, J. Clin. Invest., 99, 396, 1997. 57. Bora, N.S. et al., Differential expression of the complement regulatory proteins in the human eye, Invest. Ophthalmol. Vis. Sci., 34, 3579, 1993. 58. Ljunggren, H.G. et al., The RMA-S lymphoma mutant; consequences of a peptide loading defect on immunological recognition and graft rejection, Int. J. Cancer, 6, 38, 1991. 59. Ciccone, E. et al., Self class I molecules protect normal cells from lysis mediated by autologous natural killer cells, Eur. J. Immunol., 24, 1003, 1994. 60. Niederkorn, J.Y. et al., Expression of a nonclassical MHC class Ib molecule in the eye, Transplantation, 68, 1790, 1999. 61. Riteau, B. et al., HLA-G2, -G3, and -G4 isoforms expressed as nonmature cell surface glycoproteins inhibit NK and antigen-specific CTL cytolysis, J. Immunol., 166, 5018, 2001. 62. Niederkorn, J.Y. and Streilein, J.W., Induction of anterior chamber-associated immune deviation (ACAID) by allogeneic intraocular tumors does not require splenic metastases. J. Immunol., 128, 2470, 1982. 63. Wilbanks, G.A. and Streilein, J.W., The differing patterns of antigen release and local retention following anterior chamber and intravenous inoculation of soluble antigen. Evidence that the eye acts as an antigen depot, Reg. Immunol., 2, 390, 1989. 64. Wilbanks, G.A., Mammolenti, M., and Streilein, J.W., Studies on the induction of anterior chamberassociated immune deviation (ACAID). III. Induction of ACAID depends upon intraocular transforming growth factor-beta, Eur. J. Immunol., 22, 165, 1992. 65. Sohn, J.H. et al., Tolerance is dependent on complement C3 fragment iC3b binding to antigenpresenting cells, Nat. Med., 9, 206, 2003. 66. D'Orazio, T.J. and Niederkorn, J.Y., A novel role for TGF-beta and IL-10 in the induction of immune privilege, J. Immunol., 160, 2089, 1998. 67. Wang, Y. et al., Blood mononuclear cells induce regulatory NK T thymocytes in anterior chamberassociated immune deviation, J. Leukoc. Biol., 69, 741, 2001. 68. Wilbanks, G.A. and Streilein, J.W., Studies on the induction of anterior chamber-associated immune deviation (ACAID). 1.Evidence that an antigen-specific, ACAID- inducing, cell-associated signal exists in the peripheral blood, J. Immunol., 146, 2610, 1991. 69. Wang, Y. et al., Direct thymic involvement in anterior chamber-associated immune deviation: evidence for a nondeletional mechanism of centrally induced tolerance to extrathymic antigens in adult mice, J. Immunol., 158, 2150, 1997. 70. Wilbanks, G.A. and Streilein, J.W., Distinctive humoral immune responses following anterior chamber and intravenous administration of soluble antigen. Evidence for active suppression of IgG2-secreting B lymphocytes, Immunology, 71, 566, 1990. 71. Niederkorn, J.Y. and Mayhew, E., Role of splenic B cells in the immune privilege of the anterior chamber of the eye, Eur. J. Immunol., 25, 2783, 1995. 72. D'Orazio, T.J. and Niederkorn, J.Y., Splenic B cells are required for tolerogenic antigen presentation in the induction of anterior chamber-associated immune deviation (ACAID), Immunology, 95, 47, 1998.
1391_C07.fm Page 153 Tuesday, November 18, 2003 5:05 PM
IMMUNE PRIVILEGE OF THE EYE
153
73. Skelsey, M.E., Mellon, J., and Niederkorn, J.Y., Gamma delta T cells are needed for ocular immune privilege and corneal graft survival, J. Immunol., 166, 4327, 2001. 74. Xu, Y. and Kapp, J.A., Gammadelta T cells are critical for the induction of anterior chamber- associated immune deviation, Immunology, 104, 142, 2001. 75. Xu, Y. and Kapp, J.A., Gammadelta T cells in anterior chamber-induced tolerance in CD8(+) CTL responses, Invest. Ophthalmol. Vis. Sci., 43, 3473, 2002. 76. Faunce, D.E., Sonoda, K.H., and Stein-Streilein, J., MIP-2 recruits NKT cells to the spleen during tolerance induction, J. Immunol., 166, 313, 2001. 77. Sonoda, K.H. et al., CD1-reactive natural killer T cells are required for development of systemic tolerance through an immune-privileged site, J. Exp. Med., 190, 1215, 1999. 78. Sonoda, K.H. et al., NK T cell-derived IL-10 is essential for the differentiation of antigen-specific T regulatory cells in systemic tolerance, J. Immunol., 166, 42, 2001. 79. Verhoeff, F.H. and Lemoine, A.N., Hypersensitiveness to lens protein; patient desensitized and successfully operated on for immature cataract, Am. J. Ophthalmol., 5, 700, 1922. 80. Goldschmidt, L. et al., The immune response to homologous lens crystallin. II. A model of ocular inflammation involving eye injuries at separate times, J. Immunol., 129, 1658, 1982. 81. Angunawela, I.I., The role of autoimmune phenomena in the pathogenesis of cataract, Immunology, 61, 363, 1987. 82. Ibaraki, N. et al., Anti-beta-crystallin antibodies (mouse) or sera from humans with age- related cataract are cytotoxic for lens epithelial cells in culture, Exp. Eye Res., 64, 229, 1997. 83. Spector, A., The ocular lens, in Aspects of the Biochemistry of Cataract, Maisel, H., Ed. Marcel Dekker, New York, 1985, p. 405. 84. Wacker, W.B. and Lipton M.M., Experimental allergic uveitis: homologous retina as uveitogenic antigen, Nature, 206, 253, 1965. 85. Caspi, R.R. et al., Experimental autoimmune uveoretinitis induced in mice with two different retinal antigens, J. Immunol., 140, 1490, 1988. 86. Rozenszajn, L.A. et al., Induction of experimental autoimmune uveoretinitis by T-cell lines, Immunology, 57, 559, 1986. 87. Mizuno, K., Clark, A.F., and Streilein, J.W., Induction of anterior chamber associated immune deviation in rats receiving intracameral injections of retinal S antigen, Curr. Eye Res., 7, 627, 1988. 88. Gregerson, D.S. and Dou C., Spontaneous induction of immunoregulation by an endogenous retinal antigen, Invest. Ophthalmol. Vis. Sci., 43, 2984, 2002. 89. Pearlman, E., Immunopathology of onchocerciasis: a role for eosinophils in onchocercal dermatitis and keratitis, Chem. Immunol., 66, 26, 1997. 90. Niederkorn, J.Y., Animal models of corneal transplantation, in Immunology of Corneal Transplantation, Zierhut M., Pleyer, U., and Thiel, H.-J., Eds., Aeolus Press, Buren, The Netherlands, 1994, p. 177. 91. Streilein, J.W., Dana, M.R., and Ksander, B.R., Immunity causing blindness: five different paths to herpes stromal keratitis, Immunol. Today, 18, 443, 1997. 92. Taylor, H.R. and Bell, T.A., Chlamydial Infections, W.B. Saunders, Philadelphia, 1991. 93. Grayston, J.T. et al., Importance of reinfection in the pathogenesis of trachoma, Rev. Infect. Dis., 7, 717, 1985. 94. Bell, S.D. and Fraser, C.E., Experimental trachoma in owl monkeys, Am. J. Trop. Med. Hyg., 18, 568, 1969. 95. Schachter, J. et al., Nonculture methods for diagnosing chlamydial infection in patients with trachoma: a clue to the pathogenesis of the disease? J. Infect. Dis., 158, 1347, 1988. 96. Watkins, N.G. et al., Ocular delayed hypersensitivity: a pathogenetic mechanism of chlamydialconjunctivitis in guinea pigs, Proc. Natl. Acad. Sci. U. S. A., 83, 7480, 1986. 97. Holland, M.J. et al., T helper type-1 (Th1)/Th2 profiles of peripheral blood mononuclear cells (PBMC); responses to antigens of Chlamydia trachomatis in subjects with severe trachomatous scarring, Clin. Exp. Immunol., 105, 429, 1996. 98. Pal, S. et al., Chlamydia-specific lymphocytes in conjunctiva during ocular infection: limiting dilution analysis, Reg. Immunol., 3, 171, 1991. 99. Trocme, S.D. et al., Eosinophil granule major basic protein inhibition of corneal epithelial wound healing, Invest. Ophthalmol. Vis. Sci., 35, 3051, 1994.
1391_C07.fm Page 154 Tuesday, November 18, 2003 5:05 PM
154
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
100. Trocme, S.D. et al., Effects of eosinophil granule proteins on human corneal epithelial cell viability and morphology, Invest. Ophthalmol. Vis. Sci., 38, 593, 1997. 101. Holsclaw, D.S., Ocular cicatricial pemphigoid, Int. Ophthalmol. Clin., 38, 89, 1998. 102. Nguyen, Q. D. and Foster, C.S., Cicatricial pemphigoid: diagnosis and treatment, Int. Ophthalmol. Clin., 36, 41, 1996. 103. Smith, R.J., Manche, E.E., and Mondino, B.J., Ocular cicatricial pemphigoid and ocular manifestations of pemphigus vulgaris, Int. Ophthalmol. Clin., 37, 63, 1997. 104. Billingham, R.E. and Silvers, W.K., A biologist’s reflections on dermatology, J. Invest. Dermatol., 57, 227, 1971. 105. Westgate, G.E., Craggs, R.I., and Gibson, W. T., Immune privilege in hair growth, J. Invest. Dermatol., 97, 417, 1991. 106. Christoph, T. et al., The human hair follicle immune system: cellular composition and immune privilege, Br. J. Dermatol., 142, 862, 2000. 107. Paus, R., Christoph, T., and Muller-Rover, S., Immunology of the hair follicle: a short journey into terra incognita, J. Invest. Dermatol. Symp. Proc., 4, 226, 1999. 108. Jager, M.J., Corneal Langerhans cells and ocular immunology, Reg. Immunol., 4, 186, 1992. 109. Hendricks, R.L., Janowicz, M., and Tumpey, T.M., Critical role of corneal Langerhans cells in the CD4- but not CD8- mediated immunopathology in herpes simplex virus-1-infected mouse corneas, J. Immunol., 148, 2522, 1992. 110. He, Y.G. and Niederkorn, J.Y., Depletion of donor-derived Langerhans cells promotes corneal allograft survival, Cornea, 15, 82, 1996. 111. Moresi, J.M. and Horn, T.D., Distribution of Langerhans cells in human hair follicle, J. Cutan. Pathol., 24, 636, 1997. 112. Claesson, M.H. and Hardt, F., The influence of the hair follicle phase on the survival time of skin allografts in the mouse, Transplantation, 10, 349, 1970. 113. Hofmann, U. et al., The anagen hair cycle induces systemic immunosuppression of contact hypersensitivity in mice, Cell. Immunol., 184, 65, 1998. 114. Tokura, Y. et al., Spontaneous hair follicle cycling may influence the development of murine contact photosensitivity by modulating keratinocyte cytokine production, Cell. Immunol., 178, 172, 1997. 115. Gruschwitz, M. et al., Transcription and expression of transforming growth factor type beta in the skin of progressive systemic sclerosis: a mediator of fibrosis? J. Invest. Dermatol., 94, 197, 1990. 116. Schmid, P., Itin, P., and Rufli, T., In situ analysis of transforming growth factors-beta (TGF-beta 1, TGF- beta 2, TGF-beta 3) and TGF-beta type II receptor expression in basal cell carcinomas, Br. J. Dermatol., 134, 1044, 1996. 117. Slominski, A. et al., Detection of proopiomelanocortin-derived antigens in normal and pathologic human skin, J. Lab. Clin. Med., 122, 658, 1993.
1391_C08.fm Page 155 Tuesday, November 18, 2003 5:07 PM
CHAPTER
8
The Theory of Immune Privilege of the Hair Follicle Ralf Paus, Natsuho Ito and Taisuke Ito
CONTENTS I. Immune Privilege ...............................................................................................................156 A. Development of the Concept of Immune Privilege ..................................................156 B. Anagen Hair Follicle as an Immune Privilege Site ..................................................157 II. Murine Hair Cycle and Hair Follicle Immune Privilege ..................................................157 A. Classical and Nonclassical MHC Class I Expressions during the Murine Hair Cycles .............................................................................................157 B. MHC Class I Pathway Molecules and the Murine Hair Cycle ................................158 C. The Expression of Immunosuppressants and the Murine Hair Cycle......................159 III. Potential Functions of Hair Follicle Immune Privilege ....................................................160 IV. The “Immune Privilege Collapse Model” of Alopecia Areata .........................................161 V. Future Prospects.................................................................................................................162 References ......................................................................................................................................163
This chapter reviews the available evidence that the proximal hair follicle epithelium generates and maintains an area of relative immune privilege (IP) during a defined segment of the hair cycle (i.e., during anagen phase). This hair follicle IP is chiefly characterized by the absence or very low level of expression of MHC class Ia antigens, and the presence of local production of potent immunosuppressive agents, such as a-MSH and TGF-b1. In discussing the putative functions of the IP of the anagen hair bulb, we favor the view that it serves mainly to sequester anagen- and/or melanogenesis-associated autoantigens from immune recognition by autoreactive CD8+ T cells. It is on this background, that the concept of the “immune privilege collapse model” of alopecia areata (AA) pathogenesis was conceived. While discussing the clinical implications that this concept carries for AA management, we use the currently available evidence to support a hypothetical mechanism in explaining the initiation, progression, and termination of AA lesions. We review most recent evidence from our laboratory that a-MSH, IGF-1 and TGF-b1 can down-regulate IFNg–induced ectopic MHC class I expression in human anagen hair bulbs in vitro. We further suggest that hair follicle-derived a-MSH, IGF-1, and TGF-b1 form part of a constitutively active “IP restoration machinery” of the anagen hair bulb, to be activated whenever the hair follicle suffers immune-mediated injury. Finally we sketch some particularly promising research avenues for future investigation into the — far too long ignored — hair follicle IP. 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
155
1391_C08.fm Page 156 Tuesday, November 18, 2003 5:07 PM
156
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
I. IMMUNE PRIVILEGE A. Development of the Concept of Immune Privilege The immune system, if intact, usually mounts a strong response to allogeneic grafts, and the additional therapy for preventing the immunological rejection is still a major research subject for immunologists and transplant surgeons. However, certain tissues show an immunologically privileged response, meaning that allogeneic grafts placed inside these tissues are slowly rejected or even not rejected at all [1]. The concept of immune privilege (IP) was first coined by Sir Peter Medawar in 1948 [2]. He postulated that the eye was deficient in lymphatic drainage, creating an IP in the anterior eye chamber, such that the graft-derived antigens and immune effector cells cannot gain access to intraocular compartments. In the early 1970s, Billingham et al. [3,4] provided evidence to suggest that the epithelial hair bulb may be one of the few immunologically privileged tissue sites of the mammalian body. Subsequently, Billingham’s group [5] observed that foreign tumor cells placed in the anterior eye chamber of rabbits survived and grew, whereas similar cells placed subcutaneously were rejected. An immunoprivileged environment is now recognized to be present in the anterior eye chamber, nervous system behind the blood–brain barrier, brain, testis, hamster cheek pouch, placenta, and hair follicle [6–10]. From a functional point of view, the establishment of IP in the fetomaternal placentar unit is vital for avoiding fetal rejection [11,12], and ocular IP is indispensable for normal eye function [10] and for protecting the eye from inappropriate immune responses that may damage vision. The potential mechanisms underlying IP are (1) down-regulation or turn off of classical MHC class I expression, thereby sequestering (auto-)antigens in these sites and hindering their presentation to CD8+ T cells; (2) local production of potent immunosuppressants, such as TGF-b1, IL-10, and alpha-MSH, thereby creating an immunoinhibitor milieu; (3) functional impairment of antigenpresenting cells, thereby reducing adaptive immune responses; (4) absence of lymphatics; (5) establishment of extracellular matrix barriers, thereby hindering immune cell trafficking; (6) expression of nonclassical MHC class I molecules (such as the MHC class Ib molecules HLA-G in humans and Qa-2 in mice), thereby impairing cytotoxic T-lymphocyte (CTL) function and inhibiting NK cell lysis; and (7) expression of Fas ligand (FasL), thereby enabling the killing of autoreactive, Fas-expressing T and B cells [7,8,10]. Recently, additional mechanisms of IP that favor maternal immune tolerance of pregnancy have been proposed. For example, a local down-regulation of tryptophan below a threshold level required for the maternal T-cell response against fetal allograft is brought about by the tryptophan-catabolizing enzyme indeolamine 2,3-dioxygenase in the fetomaternal interface [11,13]. Inhibition of complement activation by a complement inhibitor (Crry) that negatively regulates the C3 and C4 components of the complement cascade [14], a placenta-specific, b2-microglobulin–dependent process linked to MHC class I antigen presentation [15], and uterine natural killer cells may also be involved in these new IP mechanisms [12]. Not all of these mechanisms may be present in each recognized site of IP, and their composition and relative importance vary among sites. In addition, IP may utilize additional yet-to-be-discovered pathways, some of which are probably related to the highly effective immune evasion strategies exploited by viruses and malignant cells in order to escape immune elimination by CD8+ T cells [9]. Viruses have evolved ways to decrease MHC class I expression and inhibit the presentation of viral antigens to CTLs [16,17]. Various tumors show decreased synthesis of MHC class I molecules and other related molecules (b2-microglobulin, TAP dimer, and proteasome) [18]. It is on this rapidly evolving research background — which is dominated by insights gained from ocular and placentar IP — that the theory of hair follicle IP enters the picture.
1391_C08.fm Page 157 Tuesday, November 18, 2003 5:07 PM
THE THEORY OF IMMUNE PRIVILEGE OF THE HAIR FOLLICLE
157
B. Anagen Hair Follicle as an Immune Privilege Site More than 3 decades ago, Billingham et al. [3,4] discovered that the anagen hair bulb provides a special milieu that allows transplanted allogeneic cells to immunologically escape from the host immune system. Billingham noted that, as expected, black color skin epidermis transplanted onto skin beds of genetically incompatible, white guinea pigs quickly lost its pigmentation as a sign that the foreign melanocytes from the donor epidermis had been rejected. Surprisingly, however, black hair shafts soon after began to resurface from the donor (now white) epidermis, indicating that at least some donor melanocytes had survived in the hair bulbs and had resumed their transfer of melanosomes to precortical hair matrix keratinocytes [3,4]. This invited the suggestion that the anagen hair bulb might rank among the immune-privileged tissue site. However, these intriguing findings were largely ignored, and the underlying mechanisms remained uncertain. A decade later, Harrist et al. [19] reported an unusual distribution of major histocompatibility (MHC) antigens in normal human skin, including human terminal hair follicles. In his study, dermal papilla, proximal outer root sheath (ORS) and inner root sheath (IRS) showed negative MHC class I expression. Ia-like antigen-positive dendritic cells are also rarely observed in deep portion (around the proximal hair follicles). On the other hand, distal ORS shows strong positive expression of MHC class I and many Ia-like antigen positive dendritic cells. However, the authors did not mention the term “immune privilege.” This striking down-regulation of MHC class I expression in the proximal epithelium of anagen hair bulbs was confirmed to exist in human [20], rat [21], and mouse hair follicles [22], and then re-analyzed in greater detail in stage VI human-anagen scalp hair follicles [23] (Figure 8.1). The concept of hair follicle IP has been further supported by the following additional features (also illustrated in Figure 8.2). • Anagen hair bulbs in mice locally express potent immunosuppressants such as TGF-b1 [24,25], ACTH [26,27], and a-MSH [27–29]. • In the proximal portion of the hair follicle, there is a sharply reduced number of apparently nonfunctional, MHC class II antigen-negative, Langerhans cells [23], compared with distal part of hair follicles (upper portion of hair follicles). • Contrary to the ORS distal from the infundibulum of the sebaceous gland, the anagen hair bulb is almost devoid of intraepithelial T cells; and in mice, gdTCR+ lymphocytes are not detected below the bulge region [30]. • In human, stage VI anagen scalp hair follicles, CD4+ T cells are observed only extremely rarely, and CD8+ T cells are almost always absent. If present, these cells are predominantly distributed in the distal hair follicle epithelium [23]. • Like the other well-defined IP tissues, the hair bulb is characterized by the absence of a lymphatic drainage pathway and the presence of a special extracellular matrix barrier around the hair follicle; both of these conditions may contribute to hinder immune cell trafficking [21,31].
II. MURINE HAIR CYCLE AND HAIR FOLLICLE IMMUNE PRIVILEGE A. Classical and Nonclassical MHC Class I Expressions during the Murine Hair Cycles Immunoreactivity (IR) for classical MHC class I antigen in the mouse hair follicle is strikingly dependent on the specific hair cycle phase and exhibits significant differences between various anatomical follicle compartments [22] (Figure 8.3). The cycle dependency of murine hair follicle MHC class I antigen can be illustrated in experiments in which anagen is induced in the back skin of the mouse (e.g., C57BL/6) in telogen phase of the cycle by depilation [32]. During the entire hair cycle, the distal part of the hair follicle shows strong MHC class I IR. In the telogen stage,
1391_C08.fm Page 158 Tuesday, November 18, 2003 5:07 PM
158
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Epidermis
Distal ORS
Dermis
SG
Subcutaneous CTS
IRS Proximal ORS DP
Figure 8.1
Schematic representation of a stage VI, anagen scalp hair follicle and the down-regulation of expression MHC class I IR (immunoreactivity) (black oval figures) in the proximal (lower) portion of the follicle. ORS, outer root sheath; SG, sebaceous gland; CTS, connective tissue substance; IRS, inner root sheath; DP, dermal papilla.
the entire hair follicle compartments have a strong classical MHC class I IR except for the dermal papilla. Shortly after anagen induction, this IR pattern changes. In anagen stages II and III, anagen hair matrix and dermal papilla show negative MHC class I IR. In anagen stage VI, IRS — in addition to hair matrix — has no classical MHC class I IR, but the MHC class I IR in dermal papilla reappears. In spontaneously developed catagen hair follicles, only the slowly receding IRS keratinocytes and dermal papilla remain classical MHC class I negative (Figure 8.3) [22]. In the human fetomaternal placentar unit, nonclassical MHC class I molecule HLA-G impairs specific cytolytic T-cell functions in addition to its well-established inhibition of NK cell lysis [33]. This leads to the hypothesis that nonclassical MHC class I may also play a similar inhibitory role on hair follicle IP. It turns out that the expression of the mouse nonclassical MHC class I equivalents (e.g., Qa-2) could be detected in the peri-infundibular region of the murine outer root sheath throughout the entire hair cycle [22] (Figure 8.3). The non-cycle–dependent expression of Qa-2 raises the possibility that these MHC class Ib molecules are not involved in the regulation of follicular IP, but rather in the intriguing, nonspecific anti-infection defenses of the hair follicle immune system (HIS) [22,34]. B. MHC Class I Pathway Molecules and the Murine Hair Cycle MHC Class I-dependent antigen presentation requires a complex of MHC class I molecule, b2-microglobulin, and antigens. Stable assembly and cell surface expression of functional MHC class I molecules require not only intracellular uptake and proteolytic digestion of an antigenic
1391_C08.fm Page 159 Tuesday, November 18, 2003 5:07 PM
THE THEORY OF IMMUNE PRIVILEGE OF THE HAIR FOLLICLE
159
hair shaft epidermis distal ORS SG
CTS
central ORS
d sc
proximal ORS
melanin IRS
Langerhans cell -TCR+
hair bulb DP Figure 8.2
Schematic representation of murine hair follicle and location of its resident Langerhans cells and gd TCR+ lymphocytes. ORS, outer root sheath; SG, sebaceous gland; CTS, connective tissue substance; d, dermis; sc, subcutaneous tissue; IRS, inner root sheath; DP, dermal papilla.
peptide derived from a variety of sources (e.g., autoantigen, viral proteins in virus infected cells, tumor-associated antigens in transformed cells), but also a complex, tightly regulated sequence of interactions with MHC class I pathway molecules, including b2-microglobulin, TAP1, and TAP2 [35–37]. Systematic studies of the depilation-induced murine hair cycle revealed that the relative MHC class I negativity correlates well with a down-regulation of MHC class I pathway molecules b2-microglobulin. This cycle-dependent down-regulation of MHC class I expression is seen only during the anagen phase, and is largely confined to those compartments of the hair follicle epithelium that are continuously generated de novo from the hair follicle stem cells (i.e., hair matrix and inner root sheath) during each anagen phase, and they are detected again in the following catagen phase [22,38]. Mouse anagen hair matrix has weak IR of TAP1 [38]. Although the relationship between TAP IR and the murine hair cycle is still uncertain, it appears that anagen hair follicles maintain their IP milieu by the reduction of expression of MHC class I, b2-microglobulin, and TAPs. C. The Expression of Immunosuppressants and the Murine Hair Cycle Anagen hair bulbs in mice express potent immunosuppressants such as TGF-b1 [24,25], ACTH [26,27], and a-MSH [27–29]. The IR of TGF-b1 during the hair cycle revealed that the strongest expression occurs during late anagen and the onset of catagen in cells of the ORS and epithelial strand [25]. TGF-bRII positive cells were also found in the proximal and central region of the ORS during the late anagen and catagen [25,39]. Both a-MSH and ACTH are detected in keratinocytes of ORS and hair matrix during the anagen stage IV [26,28,40]. POMC mRNA has been detected
1391_C08.fm Page 160 Tuesday, November 18, 2003 5:07 PM
160
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Epidermis
Arrector pili muscle SG Proximal ORS IRS
Anagen IV
H2b-IR
Anagen VI
Qa-2/1-IR no IR
Matrix DP
Catagen Telogen
Epithelial strand Dermal papilla
Figure 8.3
Schematic representation of expression of MHC class I antigen in relation to hair cycles. SG, sebaceous gland; ORS, outer root sheath; IRS, inner root sheath; DP, dermal papilla.
in earlier stages of murine anagen hair follicles, and the levels increase during progression to stage VI anagen [40,41]. These results suggest that the anagen hair follicle itself produces immunosuppressants, which may play an important role in maintaining the hair follicle IP milieu (Figure 8.4).
III. POTENTIAL FUNCTIONS OF HAIR FOLLICLE IMMUNE PRIVILEGE Why do anagen hair follicles require an IP milieu? Why do they have a distinct “hair follicle immune system” (HIS) [42] that differs from the surrounding skin immune system (SIS) [43]? The functional purpose for establishing an area of IP in the hair bulb should be reasoned through a sound hypothesis. With regard to ocular IP, Niederkorn [10] concludes IP is necessary for the normal function of the visual axis. In other words, the reason for the existence of ocular IP is to stringently regulate inflammation and to avoid immune attacks on innocent bystander cells that may result in a heavy damage to ocular tissues. Likewise, an IP milieu in the hair follicle may be needed for the purpose of securing a safe environment for hair follicle cycling and hair pigmentation requiring a constitutively active safeguarding system to protect it against immune injury. Apart from epidermal melanocytes (in vitiligo), thyroid epithelium (in autoimmune thyroiditis), and the synovium (in rheumatoid and psoriatic arthritis) [9,44], the hair follicle is one of the most frequent targets of immune-mediated disease, resulting in the development of AA or permanent alopecia associated with lichen planopilaris, lupus erythematodes, scleroderma, and folliculitis decalvans [45–47]. Thus, the effectiveness of this system of hair follicle IP would have to be continuously maintained among immunogenetically distinct individuals in order to sequester follicular autoantigens
1391_C08.fm Page 161 Tuesday, November 18, 2003 5:07 PM
THE THEORY OF IMMUNE PRIVILEGE OF THE HAIR FOLLICLE
161
from unwanted immune recognition and to protect the hair bulb from potentially deleterious autoaggressive immune responses. In the case of insufficient functioning or collapse of this system, this would result in a greatly enhanced risk of autoimmune attack on the follicle [22,48]. It is interesting to note that during neonatal hair follicle morphogenesis in mice, in contrast to the epidermis, distal follicular keratinocytes begin to express MHC class I only at the late stage of development when almost all skin cells already express MHC class I molecules, paralleling the sequential maturation of the skin immune system [34,38,48]. This observation raises the question regarding the timing in which IP is needed for the developing hair follicle epithelium: perhaps when the full range of immunocytes (intraepithelial T cells and Langerhans cells), immunoregulatory surface molecules, secreted immunomodulators, and hair follicle melanocytes have been assembled, situated, and expressed in their designated locations? The following three additional considerations regarding the physiological function of hair follicle IP should be taken into account [22,45]. • Melanocytes frequently are prone to be the target of immune-mediated injury (e.g., in vitiligo, halo nevi, regressing malignant melanoma, and during immunotherapy of metastasizing melanoma). • The characteristic inflammatory cell attack on lesional hair follicles in AA almost exclusively targets anagen hair bulbs that are in the process of active pigment production (i.e., anagen III and VI hair follicles). • Recovering hair follicles in AA patients often generate white hair shafts.
Together, these cumulative data suggest that the hair follicle IP is generated and maintained during each anagen phase (and then disassembled again during catagen and telogen phases) in order to sequester potentially deleterious, anagen- and/or melanogenesis-associated autoantigens from immune recognition by appropriately sensitized CD8+ T cells with cognate receptors, primarily via down-regulation of MHC class I and by the local production and secretion of potent immunosuppressants [48,49] (Figure 8.1).
IV. THE “IMMUNE PRIVILEGE COLLAPSE MODEL” OF ALOPECIA AREATA Alopecia areata (AA) is a putative autoimmune disease [47,49]. However, its etiology has remained obscure. We have hypothesized that one possible pathogenic mechanism of AA is through the collapse of IP in hair follicles mainly by up-regulation of MHC class I expression during anagen. This up-regulation of MHC class I predisposes the recognition of hair follicle autoantigens by CTLs, eventually leading to autoimmune response [49]. To elucidate the pathogenesis of AA, some animal models of AA have been established. Aging C3H/HeJ mice are prone to develop a nonscarring hair loss that closely resembles human AA [50]. These mice show aberrant MHC class I expression observed on keratinocytes of proximal ORS in lesional hair follicles associated with predominant CD8+ T cell infiltrate [51]. This observation implicates a collapse of hair follicle IP in the mouse AA model. The Dundee experimental bald rat (DEBR) has been established as an instructive model to investigate the pathogenesis of AA [52–56]. DEBRs undergo from progressive patchy hair loss on the head, shoulders, and flank, which can progress to complete body hair loss. The pathological features include a peri- and intra-follicular mononuclear cell infiltrate, consisting predominantly of CD4+ and CD8+ T cells as observed in human AA. McElwee et al. [54] revealed that CD8+ T cells play a principal role compared with a minor role for CD4+ T cells. The AA-suffered DEBRs started to regrow hair within 29 days after depletion of CD8+ T cells by intraperitoneal delivery of monoclonal antibodies against CD8+ T cells. These results further support our hypothesis that a
1391_C08.fm Page 162 Tuesday, November 18, 2003 5:07 PM
162
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
collapse of hair follicle IP that leads to CD8+ T cells activation may be essential for the pathogenesis of AA. Another study, which also supports our theory, was demonstrated by Gilhar et al. in 1999 [57,58] through transferring human AA patients’ autologous lesional T cells to their hair-bearing scalp skin grafted onto immunodeficient SCID mouse. The transferred T cells, reactivated with hair follicle homogenate prior to transfer, resulted in hair loss, and ectopic MHC class I expression along the proximal ORS and hair bulb of anagen follicles, along with infiltration of CD8+ T cells. To define potential up-regulators of MHC class I expression in the anagen hair bulb, three classical up-regulators of MHC class I expression, interferon (IFN)-g (10,000 IU), tumor necrosis factor (TNF)-a (10 mg), and interleukin (IL)-1b (500 ng), were examined for their abilities to upregulate MHC class I expression in anagen hair follicles of C57BL/6 mice in vivo [38]. In this study, only IFN-g significantly up-regulated MHC class I expression in the proximal ORS of mouse anagen hair follicles in vivo. This result suggests that IFN-g is a key determinant for controlling MHC class I expression in the hair follicle, and its overexpression may lead to breakdown of the hair follicle IP. Together with the previous reports, this “IP collapse model” proposes the following mechanism of AA pathogenesis (also illustrated in Figure 8.4) [59]. Triggered by infectious foci, bacterial superantigens, psychoemotional stressors, neurogenic inflammation skin microtrauma or other damage to the hair follicle, and possibly aided by as yet ill-defined, predisposing immunogenetic factors, a peri- and/or intra-follicular IFN-g production/secretion then up-regulates ectopic MHC class Ia expression in the proximal hair follicle epithelium, in the normally MHC class I-negative hair matrix of anagen hair bulbs. This up-regulation of MHC class I antigen disrupts the normal maintenance of the hair follicle IP. Ectopic MHC class I antigen expression will predispose the hair follicles to an autoimmune response if autoreactive CD8+ T cells are present. Once the hair cycle enters into the anagen phase, and at the latest when its pigmentary unit engages in active melanogenesis (i.e., during anagen III to VI [60]), the still obscure anagen- and/or melanogenesisassociated autoantigens are now exposed to the skin immune system. In the event that a given individual has pre-existing autoreactive CD8+ T cells, plus the appropriate local co-stimulatory signals and help from CD4+ T cells (as well as possibly additional signals, e.g., via CD44), a CTL attack is then launched on the hair matrix. This then activates a vicious circle of secondary, follicledamaging, autoimmune phenomena, the magnitude of which determines the degree of resulting hair follicle damage (dystrophy) and thus the actual clinical manifestation, progression, and course of AA (Figure 8.4) [49,59].
V. FUTURE PROSPECTS The underlying mechanisms that establish and maintain the follicular IP and the true functional significance of the hair follicle IP are still the subject of ongoing research, as this IP has been largely ignored for a long time relative to other sites of IP. Even the concept of IP collapse as an autoimmune response in AA is still controversial. We speculate that many additional and complex pathways operative during the generation and maintenance of the hair follicle IP are yet to be discovered. Important new leads in this respect arise from recent progress in ocular IP and fetomaternal IP, suggesting that local tryptophan catabolism is an important means of impairing T-cell function in the fetomaternal placental unit [11,13]. Also, a constitutive inhibition of complement activation may support the maintenance of IP in the placenta [14]. Furthermore, the transcriptional regulation of a placental b2–microglobulin–dependent process linked to MHC class I antigen presentation is controlled by a TATA binding protein that is also critical for maternal immune tolerance during pregnancy [15] may also be relevant for hair follicle IP. Following these leads in other sites of IP, we are now actively investigating whether any of the mechanisms recognized in the placental and ocular IP [7,10] is
1391_C08.fm Page 163 Tuesday, November 18, 2003 5:07 PM
THE THEORY OF IMMUNE PRIVILEGE OF THE HAIR FOLLICLE
163
IMMUNE PRIVILEGE COLLAPSE MODEL Alopecia-associated
a–MSH, IGF-1, TGF–b1
a–MSH, IGF-1, TGF–b1
follicular autoantigen
Secondary Autoimmune
IFNg
phenomena
MHC I
(incl. Autoantibodies, Activated macrophages, CD4, Fas/FasL)
-bacterial superantigens
Autoreactive
-infectious focus
CD8+T cells Costimulatory signals
-stress -microtrauma/follicular damage
CD4+T cell help, CD44
PROCESSION OF ALOPECIA AREATA
-(immuno-) genetics factors
INITIATION OF ALOPECIA AREATA Stimulation/up-regulation
Blockade/inhibition Figure 8.4
Hypothetical mechanism of alopecia areata pathogenesis as a result of collapse of the hair follicle immune privilege. (Modified from King, S.L. et al., J. Biol. Chem., 269, 13156, 1994.)
relevant to the hair follicle IP as well. Instructive new insights into the general characteristics and controls of IP may eventually be gained from these studies using the hair follicle as a far too long neglected, highly instructive IP.
REFERENCES 1. Streilein, W. and Pulido, J.S., HLA and eye disease, in HLA in Health and Disease, Lechler, R. and Warrens, A., Eds., Academic Press, London, 2000, chap. 19. 2. Medawar, P.B., Immunity to homologous grafted skin. III. The fate of the skin homografts transplanted to the brain, to subcutaneous tissue, and to the anterior chamber of the eye, Br. J. Exp. Pathol., 29, 58, 1948. 3. Billingham, R.E. and Silvers, W.K., A biologist’s reflections on dermatology, J. Invest. Dermatol., 57, 227, 1971. 4. Billingham, R.E., Transplantation immunity evoked by skin homografts and expressed in intact skin, in Immunology and the Skin, Montagna, W. and Billingham, R.E., Eds., Appleton-Century-Crofts, New York, 1971, p. 183. 5. Baker, C.F. and Billingham, R.E., Immunologically privileged site, Adv. Immunol., 25, 1, 1977. 6. Head, J.R. and Billingham, R.E., Immunologically privileged sites in transplantation immunology and oncology, Perspect. Biol. Med., 29, 115, 1985. 7. Streilein, J.W., Immune privilege as the result of local tissue barriers and immunosuppressive microenvironments, Curr. Opin. Immunol., 5, 428, 1993. 8. Brent, L., A History of Transplantation Immunology, Academic Press, San Diego, 1997, p. 1. 9. Janeway, C.A. et al., The immune system in health and disease, in Immunobiology, Garland, New York, 2001, p. 7. 10. Niederkorn, J.Y., Immune privilege in the anterior chamber of the eye, Crit. Rev. Immunol., 22, 13, 2002.
1391_C08.fm Page 164 Tuesday, November 18, 2003 5:07 PM
164
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
11. Mellor, A. L. and Munn, D.H., Immunology at the maternal-fetal interface: lessons for T cell tolerance and suppression, Annu. Rev. Immunol., 18, 367, 2000. 12. Erlebacher, A., Why isn’t the fetus rejected? Curr. Opin. Immunol., 13, 590, 2001. 13. Munn, D.H. et al., Prevention of allogeneic fetal rejection by tryptophan catabolism, Science, 281, 1191, 1998. 14. Xu, C. et al., A critical role for murine complement regular Crry in fetomaternal tolerance, Science, 287, 498, 2000. 15. Hobbs, N.K. et al., Removing the vertebrate-specific TBP N terminus disrupts placental b2m-dependent interactions with the maternal immune system, Cell, 110, 43, 2002. 16. Kerkau, T. et al., Mechanism of MHC class I downregulation in HIV infected cells, Immunobiology, 184, 402, 1992. 17. Howcroft, T.K. et al., Repression of MHC class I gene promorter activity by two-exon Tat of HIV, Science, 260, 1320, 1993. 18. Abbas, A.K., Immunity to tumors, in Cellular and molecular immunology, Abbas, A.K., Lichtman, A.H., and Pober, J.S., Eds., W.B. Saunders, Philadelphia, 2000, p. 14. 19. Harrist, T.J. et al., Distribution of major histocompatibility antigens in normal skin, Br. J. Dermatol., 109, 623, 1983. 20. Bröcker, E.B. et al., Abnormal expression of class I and class II major histocompatibility antigen in alopecia areata, J. Invest. Dermatol., 88, 564, 1987. 21. Westgate, G.E., Craggs, R.I., and Gibson, W.T., Immune privilege and hair growth, J. Invest. Dermatol., 97, 417, 1991. 22. Paus, R. et al., Expression of classical and non-classical MHC class I antigens in murine hair follicles, Br. J. Dermatol., 131, 177, 1994. 23. Christoph, T. et al., The human hair follicle immune system: cellular composition and immune privilege, Br. J. Dermatol., 142, 862, 2000. 24. Welker, P. et al., Hair cycle-dependent changes in the gene expression and protein content of transforming factor-b1 and b3 in murine skin, Arch. Dermatol. Res., 289, 554, 1997. 25. Foitzik, K. et al.. Control of murine hair follicle regression (catagen) by TGF-b1 in vivo, F. A. S. E. B. J., 14, 752, 2000. 26. Slominski, A. et al., Detection of proopiomelanocortin-derived antigens in normal and pathologic human skin, J. Lab. Clin. Med., 122, 658, 1993. 27. Slominski, A. et al., Corticotropin releasing hormone and proopiomelanocortin involvement in the cutaneous response to stress, Physiol. Rev., 80, 979, 2000. 28. Paus, R. et al., The skin POMC system (SPS): leads and lessons from the hair follicle, Ann. N. Y. Acad. Sci., 885, 350, 1999. 29. Botchkarev, V.A. et al., Developmentally regulated expression of alpha-MSH and MC-1 receptor in C57BL/6 mouse skin suggests functions beyond pigmentation, Ann. N. Y. Acad. Sci., 885, 433, 1999. 30. Paus, R. et al., Distribution and changing density of gamma-delta T cells in murine skin during the induced hair cycle, Br. J. Dermatol., 130, 281, 1994. 31. Stenn, K.S. and Paus, R., Control of hair follicle cycling, Physiol. Rev., 81, 449, 2001. 32. Paus, R., Stenn, K.S., and Link, R.E., Telogen skin contain as inhinitor of hair growth, Br. J. Dermatol., 122, 777, 1990. 33. Ann Le Gal, F. et al., HLA-G-mediated inhibition on antigen-specific cytotoxic T lymphocytes, Int. Immunol., 11, 1351, 1999. 34. Paus, R. et al., Generation and cycling remodeling of the hair follicle immune system in mice, J. Invest. Dermatol., 111, 7, 1998. 35. Pamer, E. and Cresswell, P., Mechanisms of MHC class I — restricted antigen processing, Annu. Rev. Immunol., 16, 323, 1998. 36. Momburg, F. and Tan, P., Tapasin-the keystone of the loading complex optimizing peptide binding by MHC class I molecules in the endoplasmic reticulum, Mol. Immunol., 39, 217, 2002. 37. Bouvier, M., Accessory proteins and the assembly of human class I MHC molecules: a molecular and structural perspective, Mol. Immunol., 39, 697, 2003. 38. Rückert, R. et al., MHC class I expression in murine skin: Developmentally controled and strikinglz restricted intraepithelial expression during hair follicle morphogenesis and cycling, and response to cytokine treatment in vivo, J. Invest. Dermatol., 111, 25, 1998.
1391_C08.fm Page 165 Tuesday, November 18, 2003 5:07 PM
THE THEORY OF IMMUNE PRIVILEGE OF THE HAIR FOLLICLE
165
39. Paus, R. et al., Transforming growth factor-beta receptor type I and type II expression during murine hair follicle development and cycling, J. Invest. Dermatol., 109, 518, 1997. 40. Mazurkiewicz, J.E. et al., Towards identification of cells expression POMC in the skin, J. Invest. Dermatol., 104, 636, 1995. 41. Mazurkiewicz, J.E., Corliss, D., and Slominski, A.T., Differential temporal and spatial expression of POMC peptides during the murine hair cycle, Ann. N. Y. Acad. Sci., 885, 427, 1999. 42. Paus, R., Immunology of the hair follicle, in The Skin Immune System, 2nd ed., Bos, J.D., Ed., CRC Press, Boca Raton, FL, 1997, p. 377. 43. Bos, J.D. and Kapsenberg, M.L., Skin immune system, in The Skin Immune System, 2nd ed., Bos, J.D., Ed., CRC Press, Boca Raton, FL, 1997, p. 9. 44. Paul, W., Fundamental Immunology, Lippincott-Raven, Philadelphia, 1999. 45. Dawber, R. and Fenton, D.A., Infections and infestations, in Disease of the Hair and Scalp, 3rd ed., Dawber, R., Ed., Blackwell Science, Oxford, 1997, chap. 13. 46. Hermes, B. and Paus, R., Scar forming alopecia. Comments in classification, differenciatial diagnosis and pathobiology, Hautarzt, 49, 462, 1998. 47. Cotsarelis, G. and Millar, S.E., Towards a molecular understanding of hair loss and its treatment, Trends Mol. Med., 7, 293, 2001. 48. Paus, R., Christoph, T., and Müller-Rover, S., Immunology of the hair follicle: a short journey into terra incognita, J. Invest. Dermatol. Symp. Proc., 4, 226, 1999. 49. Paus, R., Slominski, A., and Czarnetzki, B.M., Is alopecia areata an autoimmune-response against melanogenesis-related proteins, Exposed by abnormal MHC class I expression in the anagen hair bulb, Yale J. Biol. Med., 66, 541, 1994. 50. Sundberg, J.P., Cordy, W.R., and King Jr., L.E., Alopecia areata in aging C3H/HeJ mice, J. Invest. Dermatol., 104, 847, 1995. 51. Freyschmidt-Paul, P. et al., Treatment of alopecia areata in C3H/HeJ mice with the topical immunosuppressant FK506 (Tacrolimus), Eur. J. Dermatol., 11, 405, 2001. 52. Michie, H.J. et al., Immunobiological studies on the alopecic (DEBR) rat, Br. J. Dermatol., 123, 557, 1990. 53. Michie, H.J. et al., The DEBR rat: an animal model of human alopecia areata, Br. J. Dermatol., 125, 94, 1991. 54. Oliver R.F. et al., The DEBR rat model for alopecia areata, J. Invest. Dermatol., 96, 97S, 1991. 55. McElwee, K.J., Pickett, P., and Oliver, R.F., Autoantibodies to the hair follicle in sera from the DEBR rat model for alopecia areata, Br. J. Dermatol., 134, 55, 1996. 56. Sundberg, J.P. et al., Alopecia areata in humans and other mammalian species, J. Invest. Dermatol., 104 (Suppl.), 32, 1995. 57. Gilhar, A. et al., Alopecia areata is a T-lymphocyte mediated autoimmune disease: lesional human T-lymphocytes transfer alopecia areata to human skin grafts on SCID mice, J. Invest. Dermatol. Symp. Proc., 4, 207, 1999. 58. Gilhar, A. et al., Autoimmune hair loss (alopecia areata) transferred by T lymphocytes to human scalp explants on SCID mice, J. Clin. Invest., 101, 62, 1998. 59. Paus, R. et al., The hair follicle and immune privilege, J. Invest. Dermatol., Symp. Proc., 8, 188, 2003. 60. Slominski, A. and Paus, R., Melanogenesis is coupled to murine anagen: toward new concepts for the role of melanocytes and the regulation of melanogenesis in hair growth, J. Invest. Dermatol., 101, 90S, 1993.
1391_C08.fm Page 166 Tuesday, November 18, 2003 5:07 PM
1391_C09.fm Page 167 Tuesday, November 18, 2003 5:09 PM
PART
IV
Methods of Experimental Animal Modeling
1391_C09.fm Page 168 Tuesday, November 18, 2003 5:09 PM
1391_C09.fm Page 169 Tuesday, November 18, 2003 5:09 PM
CHAPTER
9
Passive Transfer and Active Induction of Autoimmune Diseases Zhi Liu, Minglang Zhao and Luis A. Diaz
CONTENTS I. Purpose of Methods ...........................................................................................................169 II. Strength and Limitation of Methods .................................................................................170 III. Illustration of Methods.......................................................................................................170 A. IgG Passive Transfer Model of Bullous Pemphigoid ...............................................170 1. Preparation and Isolation of Pathogenic Antimouse BP180 Antibodies ............171 2. Induction of Experimental Bullous Pemphigoid.................................................171 3. Clinical and Immunohistological Examination of Experimental Bullous Pemphigoid ..........................................................................................................171 4. Disease Scoring ...................................................................................................172 B. Active Model of Experimental Autoimmune Encephalomyelitis.............................172 1. Preparation of Encephalitogenic Antigens ..........................................................173 2. Induction of EAE Model.....................................................................................173 3. Mouse Strain and EAE Susceptibility.................................................................174 4. Clinical Evaluation of EAE.................................................................................174 5. Immune Intervention of EAE..............................................................................175 IV. Conclusion..........................................................................................................................175 Acknowledgment............................................................................................................................175 References ......................................................................................................................................175
I. PURPOSE OF METHODS Immune injury in autoimmune disease can be mediated by T cells, autoantibodies, or both. The immune injury could be systemic, referred to as systemic autoimmune disease. One such disease is systemic lupus erythematosis. As opposed to systemic autoimmune diseases, tissue- or organspecific autoimmune diseases affect a single organ and tissue, such as multiple sclerosis, rheumatoid arthritis, myasthenia gravis, bullous pemphigoid, and pemphigus. Local injury, inflammation, or dysfunction is produced by autoantibody- and/or cell-mediated reactions against a specific target antigen located in a specialized cell, tissue, or organ. 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
169
1391_C09.fm Page 170 Tuesday, November 18, 2003 5:09 PM
170
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
The complexity of human autoimmune disease requires a comparable model for our understanding of etiology and pathogenesis, and devising optimal therapy. Significant advances in understanding the pathogenesis of autoimmune diseases have been made mainly by studying animal models. These animal models are induced by passive transfer of pathogenic antibodies or T cells or by active immunization of self-antigen.
II. STRENGTH AND LIMITATION OF METHODS IgG passive transfer approach has been widely used to directly test pathogenic activity of autoantibodies of human autoimmune diseases such as pemphigus foliaceus, pemphigus vulgaris and myasthenia gravis [1–3]. The major strengths of this approach follow: • Simple and straightforward. Only a few simple techniques such as Ig purification and Ig injection are required. • Quick. It usually takes less than 24 hours to reproduce disease phenotypes. • Accurate and reproducible. The disease process is accurately controlled and duplicated in animals among experiments performed at different times and by different individuals with a given dose of pathogenic antibodies.
Therefore, the IgG passive transfer approach is ideal for dissection of antibody-mediated disease cascades. The limitation, however, is that it cannot be used to study cellular responses of human autoimmune diseases. Active immunization models, on the other hand, are developed to investigate cellular responses and immunogenetics of human autoimmunity. For example, experimental autoimmune encephalomyelitis (EAE) has been used to study the role of autoreactive T cells. Experimental myasthemia gravis (MG) is the animal model to study the role of autoreactive T and B cells and how these cells interact to produce pathogenic antibodies. Mice are the ideal species for studying the immunopathogenesis of human autoimmune diseases because the disease in mice is readily induced and the clinical score is relatively easy to assign. In addition, transgenic and knockout mice in immune response and cytokine genes are available. In this chapter, we focus on experimental bullous pemphigoid and EAE as models induced by the IgG passive transfer and active immunization approaches, respectively, and discuss their distinct usages to study autoimmune diseases.
III. ILLUSTRATION OF METHODS A. IgG Passive Transfer Model of Bullous Pemphigoid Bullous pemphigoid is an acquired autoimmune skin disease characterized by subepidermal blisters and autoantibodies against two hemidesmosomal antigens, BP230 (BPAG1) and BP180 (BPAG2) [4]. These antihemidesmosomal autoantibodies are found in the circulation of patients, and can be detected, along with complement components, bound to the dermal–epidermal junction (DEJ) of perilesional skin. The skin blisters of these patients show detachment of basal keratinocytes from the underlying dermis and a dermal inflammatory infiltrate [5]. A variety of cellular lineages have been identified in these inflammatory infiltrates, including eosinophils, neutrophils, lymphocytes, mast cells, and monocyte/macrophages [4,6–11]. Experimental BP, which involves the passive transfer of antimouse BP180 antibodies into neonatal BALB/c mice, reproduces the key immunopathological features of human BP, that is, IgG and complement deposition at the DEJ, inflammatory infiltration of the upper dermis, and subepidermal blistering [12]. Further characterization of this mouse model revealed that subepidermal blister formation is triggered by anti-mouse BP180 antibodies and is dependent on complement activation [13], mast cell degranulation [14] and neutrophil recruitment [15].
1391_C09.fm Page 171 Tuesday, November 18, 2003 5:09 PM
PASSIVE TRANSFER AND ACTIVE INDUCTION OF AUTOIMMUNE DISEASES
BP epitope
171
Collagen Domains
c
N
mBP180 mBP180ABC
Anti-mBP180 IgG
Figure 9.1
Generation of pathogenic antimouse BP180 antibodies. A schematic representation of the structural organization of the mouse BP180 protein is shown at the top [16]. The arch designates the transmembrane domain. The oval designates the NC14A antigenic site recognized by pathogenic anti-BP antibodies. The COOH-terminal extracellular region is made up of 13 interrupted collagenlike domains (black rectangles). A segment of mouse BP180 containing entire NC14A and part of collage domain 13 (referred to as mBP180ABC) is subcloned and expressed using the pGEX-2T system as a GST fusion protein. Affinity-purified GST-mBP180ABC fusion protein is used to immunize New Zealand white rabbits. Purified rabbit anti-mBP180ABC antibodies are passively transferred into neonatal mice.
1. Preparation and Isolation of Pathogenic Antimouse BP180 Antibodies A segment of mouse BP180 antigen corresponding to amino acid residues 494-642 (referred to as mBP180ABC) [16] is expressed using the pGEX-2T prokaryotic expression system as a GST fusion protein. The GST-mBP180ABC is purified by glutathione-agarose affinity chromatography [17]. The purified GST-mBP180ABC is used to immunize New Zealand white rabbits to generate rabbit anti-mBP180 antisera (Figure 9.1). IgG fractions are prepared from rabbit anti-mBP180 antisera by 50% ammonium sulfate precipitation followed by dialysis against phosphate-buffered saline (PBS). To obtain mBP180ABCspecific antibodies, IgG fractions are further purified by mBP180ABC-agarose–affinity chromatography. Rabbit anti-mBP180ABC antibodies are concentrated and filter sterilized before injection. 2. Induction of Experimental Bullous Pemphigoid Neonatal BALB/c mice (24 to 36 hours old) are injected either intraperitoneally or intradermally with pathogenic antimurine BP180 antibodies. Matched control group of mice are injected with the same dose of normal rabbit IgG. The injection volume is in the range of 50 to 100 ml with a 1-ml syringe. The injected animals are placed in a 30∞C incubator until examined [12]. 3. Clinical and Immunohistological Examination of Experimental Bullous Pemphigoid With an optimal dose of pathogenic antimouse BP180 antibodies, markedly erythematous sign is seen in the skin of pathogenic IgG-injected neonatal mice between 2 and 4 hours postinjection (Figure 9.2A). At 12 hours, the skin of the injected animals, upon gentle friction, develop persistent
1391_C09.fm Page 172 Tuesday, November 18, 2003 5:09 PM
172
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
A Figure 9.2
B
C
(A) Phenotype of experimental bullous pemphigoid. Neonatal BALB/c mice injected intradermally in the back with rabbit anti-mBP180 IgG develop extensive inflammatory reaction at 4 hours. (B) Typical “epidermal detachment” sign is generated by gentle friction. (C) A slit is made in the wrinkled epidermis and the epidermis sheet is easily lifted away from the underlying dermis.
wrinkling or the “epidermal detachment” sign (Figure 9.2B). The epidermis is easily lifted away from the underlying dermis (Figure 9.2C) [12]. To localize the skin lesional site and identify inflammatory cells in the skin, skin biopsies are taken at the lesional site and fixed in 10%-buffered formalin for at least 24 hours. Five-mm–thick sections are cut and stained with hematoxylin and eosin and examined under a light microscope [12]. Cell-specific immunostaining and histochemical staining can also be used to confirm the identity of different inflammatory cells. For example, the Toluidine-blue staining method is specific for mast cells [14]. Levels of pathogenic rabbit antimouse BP180 antibodies in circulation are measured by a rabbit IgG-specific ELISA [18]. Ninety-six–well microtiter plates are coated with goat antibodies specific for rabbit IgG Fc, incubated with dilutions of serum, and then developed with horseradish peroxidase-conjugated goat antibodies specific for rabbit IgG F(ab')2 and read at OD492nm against a standard curve. The titer of pathogenic antimouse BP180 IgG can be determined by indirect immunofluorescence using a FITC-conjugated–goat antirabbit IgG as the detection antibody and neonatal mouse skin as substrate. To detect in situ deposition of rabbit IgG and mouse C3 at the basement membrane zone of the skin of injected animals, skin biopsies are taken at the IgG-injection sites. Cryosections are first incubated with dilutions of serum and then incubated with either FITC-conjugated goat antirabbit IgG or FITC-conjugated goat antimouse C3 monoclonal antibodies [12]. 4. Disease Scoring The erythematous reaction and severe cutaneous signs are pathogenic IgG dose dependent. Clinically, the extent of cutaneous disease is scored as follows: (-), no detectable skin disease; 1+, mild erythematous reaction with no evidence of the “epidermal detachment” sign; 2+, intense erythema and epidermal detachment sign involving 10 to 50% of the epidermis in localized areas; and 3+, intense erythema with frank epidermal detachment sign involving more than 50% of the epidermis [12]. The disease severity of experimental BP can also be easily quantified by quantifying skin-site neutrophil accumulation. The number of infiltrating neutrophils in the skin can be counted directly with a hematoxylin and eosin-stained skin section under a light microscope or by measuring neutrophil myeloperoxidase (MPO) activity. To assay tissue MPO activity in skin sites of the injected animals, a standard reference curve is first established using known concentrations of purified MPO. The skin samples are homogenized and MPO activity in the supernatant fraction is measured by the change in optical density at 460 nm [15]. B. Active Model of Experimental Autoimmune Encephalomyelitis EAE is a demyelinating disease of the central nervous system (CNS) mediated by CD4+ T cells specific for myeline proteins. It serves as a useful animal model for studying inflammation, autoimmune phenomena, and novel T-cell–directed immunotherapies in human multiple sclerosis [19]. EAE has been induced in many mammalian species, including mouse, rats, guinea pigs, rabbit,
1391_C09.fm Page 173 Tuesday, November 18, 2003 5:09 PM
PASSIVE TRANSFER AND ACTIVE INDUCTION OF AUTOIMMUNE DISEASES
173
dog, pig, chicken, and monkeys. The clinical syndrome, typically manifested by ascending paralysis, is reproducible and can be scored by simple observation alone. Therefore, the mouse model of EAE allows us to evaluate the role of autoreactive T and B cells, and immunogenetic and cytokine regulation of EAE [20–23]. 1. Preparation of Encephalitogenic Antigens The EAE animal model was originally induced in monkeys using spinal cord homogenate (SCH) [24]. The first mouse EAE model was developed by Olitsky and Yager [25] in 1949 using the CNS. Subsequently, multiple CNS proteins including purified myelin basic protein (MBP) [26], proteolipid protein (PLP) [27], and myelin oligodendrocyte glycoprotein [28] have been shown to be encephalitogenic. Significantly, there is no single region of the molecule that serves as a general encephalitogen for all species [26]. Different sequences are encephalitogenic for different species. For example, the sequence of amino acids 70–90 of guinea pig MBP is highly encephalitogenic for the Lewis rat, but is not encephalitogenic for the mouse [29]. In mice different regions of molecular are encephalitogenic for different inbred strains. For example, residues 1–9 of MBP are encephalitogenic for PL/J mice, while at least two epitopes (residues 91–102 and 95–108) are encephalitogenic for SJL/J mice [30,31]. The finding of unique encephalitogenic determinants in different mice strains raises an important issue and suggests the study of different T-cell repertoires, antigen processing, exposure of epitopes in the CNS, or unique Ia-peptide interactions among various strains. 2. Induction of EAE Model The EAE model can be induced by active immunization of myelin proteins and immunodominant peptides from myelin proteins. Mice are injected subcutaneously in each flank (four sites) with total of 50 to 200 mg of myelin proteins or peptide dissolved in 0.1 ml PBS and emulsified in incomplete Freund’s adjuvant (IFA) supplemented with 1 to 5 mg/ml of Mycobacterium tuberculosis, strain H37RA. Immediately and 48 hours after antigen injection, 200 to 400 ng of Bordetella pertussis toxin is injected intraperitoneally [32]. Pertussis toxin is given as a co-adjuvant in promoting EAE in mice and is thought to affect blood–brain barrier permeability and enhance the cytokine production by T cells in EAE [33]. For successful immunization, besides the immunogenicity of antigen, the following parameters influence the result: administration route, doseage of antigen, and type of adjuvant. The location at which the antigen is deposited in part determines the lymphoid organs activated and the isotype of the antibody response. Active EAE consists of an inducting phase and an effecting phase [34]. The inducting phase involves the priming of myelin epitope-specific T cells in the peripheral lymphoid organ following immunization with myelin proteins or peptides in CFA and subsequent expansion and differentiation of the T cells into Th1 effectors. The effecting phase of disease consists of the following steps: (1) migration of activated myelin-specific T cells to the CNS, which involves binding of the activated T cells to the cerebrovascular endothelium, and extravasation of the T cells across the tight endothelia junctions comprising the BBB and the underlying basement membrane; (2) presentation of endogenous myelin epitopes to the immigrating T cells by CNS-resident antigen-presenting cells; (3) elaboration of cytokines and chemokines by the myelin-specific T cells and by activated CNS-resident cells, such as astrocytes and microglia, which combine to induce a large influx of peripheral mononuclear phagocytes into the CNS parenchyma; (4) activation of both peripheral monocytes/macrophages and CNS-resident microglia cells by T-cell–derived cytokins; and (5) demyelination of CNS axonal tract by the phagocytic activity of activated mononuclear cells and perhaps by indirect or direct cytotoxic effects of soluble effector molecules (e.g., INF-g, Lt-a,
1391_C09.fm Page 174 Tuesday, November 18, 2003 5:09 PM
174
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
TNF-a, NO, proteolytic enzymes, and O2 radicals released from activated CD4 T cells and activated macrophage/microglia). Two major clinical forms of EAE have been described: acute and chronic relapsing [26,35]. Acute EAE is a transient monophasic paralysis with complete recovery, in which histopathology reveals patchy perivascular mononuclear inflammation, a focal area of demyelination, and occasional intracerebral lymphocytes. Chronic relapsing EAE is manifested by multiple spontaneous episodes of transient exacerbations, and re-emission of paralysis is distinguished from true relapsing disease. The chronic relapsing EAE more closely resembles MS clinically and histologically than does acute EAE. 3. Mouse Strain and EAE Susceptibility The response to encephalitogenic challenge is strain dependent in mice. It has been shown that MHC controls the specificity of the encephalitogenic response in MHC-congenic mice. EAE susceptibility has been clearly linked to MHC background [36,37]. Mouse strains and myelin antigens influence EAE susceptibility and clinical course. For example, B10.RIII (H2r) mice are very susceptible to MBP-induced EAE, but are resistant to MOG-induced EAE; C57/BL6 (H2b) mice are very resistant to MBP and PLP-induced EAE, but are very susceptible to MOG-induced EAE when immunized under the same conditions. F1 hybrid mice were found to be more susceptible than either parental strain clinical EAE, and also developed chronic relapsing disease. In the SJL/J(H2s) mouse, the disease is characterized by a relapse–remission course of paralysis, which allows assessment of the efficacy of various immunoregulatory strategies in progressive autoimmune disease settings. In the PL/J (H2u) mouse, the disease is normally acute and self-limiting without the appearance of clinical relapse. 4. Clinical Evaluation of EAE Following induction of EAE, mice are monitored daily by an independent “blind” observer wherever possible until recovery. Disease is scored clinically [36,38] according to the scores in Table 9.1. On occasions when difficulty is experienced in differentiating between grade 1 and grade 2 disease, impairment of the righting reflex is taken as a definitive indicator of grade 2 disease. Diverse strains of mice are found to show slightly different patterns of disease [36,38]. In mice of the H2u haplotype, if disease progresses to grade 2, accompanying tail paralysis is usually complete. In contrast, Biozzi AB/H mice frequently retain some tail tone despite presence of hindlimb paresis. In such instance, impairment of the righting reflex is particularly useful in assigning a clinical score. In the actively induced EAE model, disease signs will normally start from day 10 to 14 onward. A significant drop of body weight usually precedes other clinical signs of EAE for about 1 to 2 days. Maximum severity is reached in 2 to 4 days and surviving mice recover slowly thereafter. Most mice recover completely in 10 to 20 days. Table 9.1 Clinical Scoring of Mouse EAE EAE Score
Clinical Disease
0 1 2 3 4 5
No clinical disease Flaccid paralysis of tail Hindlimb paresis Bilateral hindlimb paralysis Hindlimb and forelimb paralysis Moribund or dead
1391_C09.fm Page 175 Tuesday, November 18, 2003 5:09 PM
PASSIVE TRANSFER AND ACTIVE INDUCTION OF AUTOIMMUNE DISEASES
175
5. Immune Intervention of EAE EAE has proved to be a most applicable model disease for the analysis of immunotherapy for autoimmune disease [39,40]. Autoimmune disease therapies must focus on the elimination of pathogenic immune effector molecules or cells. Obviously, the therapeutic measures must be optimally efficient while keeping potential side effects at a minimum. Initially, inhibition or reversal of EAE depended on the use of nonspecific immunesuppressive and anti-inflammatory drugs. In recent years, great effort has been expended in seeking more specific mode of preventing or arresting injurious autoimmune response. Among the most promising approaches are the following: (1) reduction of CD4 T-cell population; (2) reduction of activated T cells (anti-Ia or anti IL-2 receptor); (3) antibody to particular MHC class II determinants; (4) antibody to particular TCR or V region of TCR; (5) surrogate peptide to block MHC class II binding; and (5) oral tolerization (induction tolerance to autoantigen). Current investigations have demonstrated efficacy in applying gene therapy strategies for the treatment of EAE [39]. Typically, these strategies involve the use of viral vectors to deliver therapeutic transgene cytockines or cytokine receptors to inflammatory site. There are three basic requirements for effective gene therapy: (1) targeted delivery of the therapeutic gene and/or its gene product in a reliable, efficient manner; (2) long-term expression of the therapeutic gene; and (3) regulated expression of the therapeutic gene so that it is activated only when needed. Using an EAE model, Tuohy and Mathisen [39] reported that the autoreactive T cell could serve as a useful endogenous vector for various antigen-inducible, site-specific therapeutic transgene factors capable of mediating both inhibition of autoimmune inflammation and regulation and/or protection of tissue damage.
IV. CONCLUSION Animal models by passive transfer and active immunization approaches have given us significant insights about the immunopathogenesis of various human inflammatory and autoimmune diseases. Much has been learned about cellular and humoral responses initiated by pathogenically relevant autoantibodies and lymphocytes since developments of these animal models. Future studies utilizing these animal models will lead to more exciting findings as details of disease processes unfold, which may provide important information for the development of novel therapeutic strategies.
ACKNOWLEDGMENT This work was supported by U.S. Public Health Service grants R01 AI40768 (Z.L.) and R01 AR32599 and R37 AR32081 (L.A.D.).
REFERENCES 1. Anhalt, G.J. et al., Induction of pemphigus in neonatal mice by passive transfer of IgG from patients with the disease, N. Engl. J. Med., 306, 1189, 1982. 2. Roscoe, J.T. et al., Brazilian pemphigus foliaceus autoantibodies are pathogenic to BALB/c mice by passive transfer, J. Invest. Dermatol., 85, 538, 1985. 3. Toyka, K.V. et al., Myasthenia gravis: passive transfer from man to mouse, Science, 190, 397, 1975. 4. Stanley, J.R., Bullous pemphigoid, in Fitzpatrick’s Dermatology in General Medicine, Freedberg, I.M. et al., Eds., McGraw-Hill, New York, 1999, p. 666. 5. Lever, W.F., Pemphigus. Medicine, 32, 1, 1953.
1391_C09.fm Page 176 Tuesday, November 18, 2003 5:09 PM
176
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
6. Emmerson, R.W. and Wilson-Jones, E., Eosinophilic spongiosis in pemphigus. A report of an unusual histological change in pemphigus, Arch. Dermatol., 97, 252, 1968. 7. Nishioka, K. et al., Eosinophilic spongiosis in bullous pemphigoid, Arch. Dermatol., 120, 1166, 1984. 8. Natio, K. et al., Experimental bullous pemphigoid in guinea pigs: The role of pemphigoid antibodies, complement, and migrating cells, J. Invest. Dermatol., 82, 227, 1984. 9. Nestor, M.S., Cochran, A.J., and Ahmed, A.R., Mononuclear cell infiltrates in bullous disease, J. Invest. Dermatol., 88, 172, 1987. 10. Wintroub, B.U. et al., Morphologic and functional evidence for release of mast-cell products in bullous pemphigoid, N. Engl. J. Med., 298, 417, 1978. 11. Iwatsuki, K., Tagami, H., and Yamada, M., Induction of leukocyte adherence at the basement membrane zone with subsequent activation of their metabolic pathway by pemphigoid antibodies and complement, Acta. Derm. Venereol., 63, 495, 1983. 12. Liu, Z. et al., A passive transfer model of the organ-specific autoimmune disease, bullous pemphigoid, using antibodies generated against the hemidesmosomal antigen, BP180, J. Clin. Invest., 92, 2480, 1993. 13. Liu, Z. et al., The role of complement in experimental bullous pemphigoid, J. Clin. Invest., 95, 1539, 1995. 14. Chen, R. et al., Mast cells play a key role on neutrophil recruitment in experimental bullous pemphigoid, J. Clin. Invest., 108, 1151, 2001. 15. Liu Z. et al., A major role for neutrophils in experimental bullous pemphigoid, J. Clin. Invest., 100, 1256, 1997. 16. Li, K. et al., Cloning of type XVII collagen. Complementary and genomic DNA sequences of mouse 180-kilodalton bullous pemphigoid antigen (BPAG2) predict an interrupted collagenous domain, a transmembrane segment, and unusual features in the 5’-end of the gene and the 3’-untranslated region of the mRNA, J. Biol. Chem., 268, 8825, 1993. 17. Liu, Z. et al., cDNA cloning of a novel human ubiquitin carrier protein. An antigenic domain specifically recognized by endemic pemphigus foliaceus autoantibodies is encoded in a secondary reading frame of this human epidermal transcript, J. Biol. Chem., 267, 15829, 1992. 18. Liu, Z. et al., b2 microglobulin-deficient mice are resistant to bullous pemphigoid, J. Exp. Med., 186, 777, 1997. 19. Xiao, B.G. and Link, H., Antigen-specific T cells in autoimmune diseases with a focus on multiple sclerosis and experimental allergic encephalomyelitis, Cell. Mol. Life Sci., 56, 5, 1999. 20. Iglesias, A. et al., T- and B-cell responses to myelin oligodendrocyte glycoprotein in experimental autoimmune encephalomyelitis and multiple sclerosis, Glia, 36, 220, 2001. 21. Cross, A.H., Trotter, J.L., and Lyons, J., B cells and antibodies in CNS demyelinating disease, J. Neuroimmunol., 112, 1, 2001. 22. Goodessart, N. and Kunkel, S.L., Chemokines in autoimmune disease, Cur. Opin. Immunol., 13, 670, 2001. 23. Kuchroo, V.K. et al., T cell response in experimental autoimmune encephalomyelitis (EAE): role of self and cross-reactive antigens in shaping, tuning, and regulating the autopathogenic T cell repertoire, Annu. Rev. Immunol., 20, 101, 2002. 24. Rivers, T., Sprunt, D., and Berry, G., Observation on attempts to produce acute disseseminated encephalomyelitis in monkeys, J. Exp. Med., 58, 39, 1933. 25. Olitsky, P.K. and Yager, R.H., Experimental disseminated encephalomyelitis in white mice, J. Exp. Med., 90, 213, 1949. 26. Fritz, R.B. and McFarlin, D.E., Encephalitogenic epitopes of myelin basic protein, Chem. Immunol., 46, 101, 1989. 27. Tuohy, V.K., Peptide determinants of myelin proteolipid protein (PLP) in autoimmune demyelinating disease, Neurochem. Res., 19, 935, 1994. 28. Johns, T, G. et al., Myelin oligodendrocyte glycoprotein induces a demyelinating encephalomyelitis resembling multiple sclerosis, J. Immunol., 154, 5536, 1995. 29. Fritz, R., Chou, C.-H.J., and McFarlin, D., Induction of experimental allergic encephalomyelitis in PL/J and (SJL/JxPL/J)F1 mice by myelin basic protein and its peptides: localization of a second encephalitogenic determinant, J. Immunol., 130, 190, 1983.
1391_C09.fm Page 177 Tuesday, November 18, 2003 5:09 PM
PASSIVE TRANSFER AND ACTIVE INDUCTION OF AUTOIMMUNE DISEASES
177
30. Zamivil, S. et al., T-cell epitope of the autoantigen myelin basic protein that induces encephalomyelitis, Nature, 324, 58, 1986. 31. Kono, D. et al., Two minor determinants of myelin basic protein induce experimental allergic encephalomyelitis in SJL/J mice, J. Exp. Med., 168, 213, 1988. 32. Zhao, M.L. and Fritz, R.B., Acute and relapsing experimental autoimmune encephalomyelitis in IL-4and alpha/beta T cell-deficient C57BL/6 mice, J. Neuroimmunol., 87, 171, 1998. 33. Hofstetter, H.H., Shive, C.L., and Forsthuber, T.G., Pertussis toxin modulates the immune response to neuroantigens injected in incomplete Freund’s adjuvant: induction of Th1 cells and experimental autoimmune encephalomyelitis in the presence of high frequencies of Th2 cells, J. Immunol., 169,117, 2002. 34. Miller, S.D. and Shevach, E.M., Immunoreguration of experimental autoimmune encephalomyelitis: editorial overview, Res. Immunol., 149, 753, 1998. 35. Fritz, R., Chou, C.-H.J., and McFarlin, D., Relapsing murine experimental allergic encephalomyelitis in PL/J and (SJL/JxPL/J)F1 mice by myelin basic protein, J. Immunol., 130, 1024, 1983. 36. Fritz, R.B. et al., Major histocompatibility complex-linked control of murine immune response to myelin basic protein, J. Immunol., 134, 2328, 1985. 37. Zhao M.L., Xia, J.Q., and Fritz, R.B., Epitope specificity and TCR Vb gene utilization in the encephalitogenic response of B10.RIII(71NS)/SnJ mice, J. Neuroimmunol., 42, 209, 1993. 38. Smith, R.M. and Wraith, D.C., Mouse models of experimental autoimmune encephalomyelitis, in Immunology Methods Manual, Lefkovits, I., Ed., Harcourt Brace, Orlando, FL, 1997, chapter 26.3. 39. Tuohy, V.K. and Mathisen, P.M., T cell design for therapy in autoimmune demyelinating disease, J. Neuroimmunol., 107, 226, 2000. 40. Bright, J.J. and Sriram, S., Immunotherapy of inflammatory demyelinating diseases of the central nervous system, Immunologic Res., 23, 245, 2001.
1391_C09.fm Page 178 Tuesday, November 18, 2003 5:09 PM
1391_C10.fm Page 179 Tuesday, November 18, 2003 5:10 PM
CHAPTER
10
Adoptive Transfer of Cellular Immunity Lawrence S. Chan
CONTENTS I. Purpose of Method.............................................................................................................179 II. Approach of Method..........................................................................................................180 A. Recipients of Adoptive Transfer................................................................................180 1. Immunoincompetent Recipients ..........................................................................180 2. Immunocompetent Recipients .............................................................................181 B. Routes of Adoptive Transfer .....................................................................................181 1. Intraperitoneal Transfer .......................................................................................181 2. Intravenous Transfer ............................................................................................181 3. Local Transfer......................................................................................................181 C. Preparation of Immune Cells for Transfer ................................................................181 1. Isolation of Immune Cells...................................................................................181 a. Isolation of T Lymphocytes...........................................................................182 b. Isolation of T-Cell Subsets ............................................................................182 c. Isolation of T-Helper Cell (Th) Subsets........................................................182 d. Isolation of Epitope-Specific T Lymphocytes...............................................182 2. Stimulation of Immune Cells ..............................................................................183 a. Cell-Specific Stimulation...............................................................................183 b. Antigen-Specific Stimulation ........................................................................183 III. Strength of Method ............................................................................................................183 IV. Limitation of Method.........................................................................................................184 A. Immunodeficient SCID Mice Model.........................................................................184 B. Immunocompetent Mice Model ................................................................................184 V. Illustration of Method ........................................................................................................184 Acknowledgment............................................................................................................................185 References ......................................................................................................................................185
I. PURPOSE OF METHOD Transferring cellular immunity from one animal to another has been widely used in experimental animal modeling of human immune-mediated diseases [1–21]. Among the immune cells, 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
179
1391_C10.fm Page 180 Tuesday, November 18, 2003 5:10 PM
180
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Mice with disease
Lymph nodes or spleens collected Cell suspension Density gradient centrifugation Interfaced cells collected Interfaced cells cultured in the presence of IL-2 +/- other cytokines & specific antigen Adoptive transfer: IV, IP, ID
Syngeneic mice Figure 10.1
SCID mice
RAG-1 KO mice
A generalized scheme for adoptive transfer of pathogenic T lymphocytes. IV, intravenous; IP, intraperitoneal; ID, intradermal; SCID, severe combined immunodeficiency; KO, knockout.
T lymphocytes have been the most successful cell type utilized for the adoptive transfer experiments, likely due to the central role of T lymphocytes in cellular immunity, with CD4+ helper T cells acting as commanders-in-chief [1]. These adoptive transfer experiments have been very useful in delineating the disease pathogenesis with regard to disease induction mechanism [3,4], adhesion molecules [5], cytokine requirement [2,6], epitope spreading [7–9], and disease maintenance and progression [7–9]. In addition, these experiments have been instrumental in determining the subset of pathogenic immune cells [1,10–19], MHC restriction [19,20], T-cell receptor (TCR) preference [15], and in vivo T-cell activation [21], as well as antigenic epitopes targeted by the pathogenic immune cells [8,9,20,22,23]. Besides being a useful method of investigating the roles of cellular immunity in immune-mediated diseases, successful adoptive transfer of cellular immunity from one animal to another with resulting disease development has been proposed as direct evidence for autoimmune disease [24,25]. Adoptive transfer of cellular immunity not only is used for animal models of human immune–mediated diseases, but also is being considered as a possible method of anticancer therapy, with T lymphocytes and dendritic cells being the principal tools [26–30] (Figure 10.1). Given the scope of this book, only the methods for animal modeling of immunemediated diseases are discussed in this chapter.
II. APPROACH OF METHOD A. Recipients of Adoptive Transfer 1. Immunoincompetent Recipients Severe combined immunodeficient (SCID) mice, which essentially do not possess T and B lymphocytes of their own, were first reported by Bosma et al. [31]. The SCID mice provide an excellent milieu for immune-cell adoptive transfer experiments [32–34]. The SCID mice, due to their state of severe immunodeficiency, accept allogeneic immune cells from mice of different
1391_C10.fm Page 181 Tuesday, November 18, 2003 5:10 PM
ADOPTIVE TRANSFER OF CELLULAR IMMUNITY
181
strains and xenogeneic immune cells from humans. Thus, the SCID mice are an excellent tool for adoptive transfer experiments. 2. Immunocompetent Recipients With the exception of generating an animal model of graft-versus-host disease, immunocompetent recipients used for adoptive transfer experiments usually are syngeneic (also termed isogeneic) in nature, that is, inbred mice of the same strain, so that they will have major histocompatibility complex identical to the donor’s, eliminating the possibility of the donor immune cells being rejected. B. Routes of Adoptive Transfer 1. Intraperitoneal Transfer Intraperitoneal transfer is a well-known and easy-to-use method. Mouse models of inflammatory bowel disease and relapsing experimental autoimmune encephalomyelitis have been successfully induced by intraperitoneal adoptive transfer of pathogenic T cells [8,20]. 2. Intravenous Transfer Intravenous transfer, in comparison to intraperitoneal transfer, is more challenging technically. The tail vein is commonly used for the transfer route. The advantage of intravenous transfer, however, is the assurance of the delivery of the transferring immune cells into the circulation of the animals. Once the transferred immune cells are within the blood circulation, the pathway to travel to the prospective inflammatory sites is guaranteed. Rat models of experimental autoimmune insulitis and mouse models of experimental autoimmune encephalomyelitis have been induced successfully by intravenous adoptive transfer of pathogenic T cells [18,23]. 3. Local Transfer In certain disease models, adoptive transfer of pathogenic immune cells was successful at a local level [35–37]. For example, in a SCID mouse–human skin model of psoriasis, Nickoloff and Wrone-Smith [35,36] reported the success of inducing psoriasis lesions by adoptively transferring skin antigen-stimulated autologous immune cells (2 to 3 ¥ 106 cells per mouse) directly into nonlesional human skin engrafted onto SCID mice [35,36]. Another example is a SCID mouse–human scalp skin model of alopecia areata. Gilhar et al. [37] demonstrated the cell-mediated hair loss induced by adoptively transferring hair follicle antigen-stimulated autologous immune cells (1.3 ¥ 106 T cells per mouse) directly into hair-bearing human scalp skin engrafted onto SCID mice. C. Preparation of Immune Cells for Transfer 1. Isolation of Immune Cells The isolation of immune cells for adoptive transfer is critical for successful experiments. In general, investigators aim at obtaining immune cells at about 95% purity for their experiments, since 100% purity will be very difficult to achieve unless a pure cell line is developed in a longterm culture. The purity of the immune cells is usually determined by flow cytometry.
1391_C10.fm Page 182 Tuesday, November 18, 2003 5:10 PM
182
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
a. Isolation of T Lymphocytes A mixed population of immune cells from peripheral blood, spleen, or lymph node is placed in a cell suspension. The cell suspension will be fractionated by Ficoll–Hypaque density-gradient centrifugation. The interface layer, which contains mononuclear cells (T cells, B cells, monocytes/macrophages, NK cells, and dendritic cells) will be cultured at 37∞C in the presence of IL-2, with or without a specific antigen. Generally speaking, the longer the culturing process, the purer the T-cell line will be obtained. Nickoloff and Wrone-Smith [36] were able to enrich a very pure T-cell population after culturing the mononuclear cells for 2 weeks. b.
Isolation of T-Cell Subsets
The major T-cell subsets are CD4+ and CD8+, identifiable by antibodies to their surface proteins CD4 and CD8, respectively. One way to enrich the CD4+ T-cell subset is by removing the CD8+ T cells using a magnetic bead method as demonstrated in a rat model by Griffin et al. [23] with the following negative selection method: a pathogenic T-cell line (1 ¥ 108 cells) was incubated with monoclonal mouse antirat CD8 antibodies for 30 minutes at 4∞C. After washing twice with PBS to remove unbound antibodies, the cells were then mixed with a 40:1 ratio of Dynabeads (M-450 sheep antimouse IgG, 4 ¥ 109; Dynal, Great Neck, NY) to T cells for 5 minutes, followed by placing the Dynabeads/T cells mixture in a tube on the magnet, yielding 8 ¥ 107 CD4+ T cells. After a purity of 95% CD4+ T cells is confirmed by flow cytometry, the enriched CD4+ T-cell subset can then be used for tail-vein intravenous adoptive transfer experiment using 2.5 ¥ 107 to 1.2 ¥ 108 cells per rat [23]. c.
Isolation of T-Helper Cell (Th) Subsets
Upon stimulation with antigen and antigen-presenting cells, CD4+ T cells become uncommitted T-helper cells (Th0), capable of secreting low levels of IL-2, IL-4, and IFN-g [1]. Upon further stimulation with Th-specific cytokines IL-12 or IL-4, Th0 cells become committed Th1 or Th2 cells, secreting IFN-g and TNF-b, or IL-4, IL-5, IL-6, IL-10, and IL-13, respectively [1]. Thus, the isolation of Th subsets will be based on the types of cytokines that the isolated cells secrete. Katz et al. [19] were the first to perform adoptive transfer of Th subsets by stimulating uncommitted T cells in the following manner: mouse spleen cell suspensions containing pathogenic T cells in a transgenic mouse line carrying an autoantigen-reactive T cell receptor were treated with 0.87% ammonium chloride to lyse red cells, followed by washing and resuspending the cells (at 5 ¥ 105 cells/ml) in high-glucose Dulbecco’s modified Eagle’s medium, supplemented with 10% heatinactivated fetal calf serum, 1 mM sodium pyruvate, 1X nonessential amino acids, 1 mM glutamine, penicillin and streptomycin, and 50 mM 2-mercaptoethanol. For Th1 stimulation, the following were added to the cell culture medium: concanavalin A (5 mg/ml); recombinant mouse IL-2 (100 U/ml); recombinant mouse IFN-g (1000 U/ml); and monoclonal antibodies to mouse IL-4 (15 mg/ml). Likewise, the following were added to the cell culture medium for Th2 stimulation: concanavalin A (5 mg/ml); recombinant mouse IL-4 (500 U/ml); and monoclonal anti-mouse IFN-g antibodies (15 mg/ml). After culturing at 37∞C and 10% CO2 for 4 days, their Th1 or Th2 cytokine profiles were confirmed by either ELISA (IL-4 and IFN-g) or bioassays (IL-2). The stimulated cells could then be used for adoptive transfer using 1 ¥ 107 to 2 ¥ 107 cells per mouse [19]. A simpler method of isolating Th subsets was demonstrated by Lafaille et al. [18]. d. Isolation of Epitope-Specific T Lymphocytes In order to show that a particular epitope of a given autoantigen is directly related to the pathogenesis of the disease, epitope-specific T lymphocytes can be selected for adoptive transfer
1391_C10.fm Page 183 Tuesday, November 18, 2003 5:10 PM
ADOPTIVE TRANSFER OF CELLULAR IMMUNITY
183
experiment as reported by Griffin et al. [23] in the following manner: peptides encoding the specific autoantigenic epitope (200 mg/rat) were emulsified with complete Freund’s adjuvant and immunized into the rat footpads. The immunized rats were sacrificed after 9 days and the lymph nodes were harvested to make cell suspension. The lymph-node cell suspension was incubated with 50 mg/ml peptide in initiation/proliferation medium cotaining RPMI 1640, 1% autologous rat serum, 5% NCTC-109 (Biowittaker, Walkersville, MD), 2 mmol/L glutamine, 100 U/ml penicillin, 100 mg/ml streptomycin, 100 mg/ml fungizone, and 5 ¥ 10-5 mole/L 2-mercaptoethanol. Three days later, the T lymphoblasts were collected by density centrifugation with Histopaque-1077 (Sigma, St. Louis, MO), washed, and resuspended in 10% fetal calf serum in the initiation/proliferation medium minus the autologous rat serum. In addition, 5% IL-2–rich supernatant from concanavalin A-stimulated rat spleen cells was also added. At 7 to 10 days of in vitro stimulation, the peptide-specific T cells were allowed to rest, and then restimulated with irradiated thymocytes (2000 rad) and 20 mg/ml peptide. Prior to intravenous adoptive transfer (2.5 ¥ 107 to 1.2 ¥ 108 cells/rat), the peptide/epitopespecific T cells were stimulated once more with either the peptide (20 mg/ml) or concanavalin A (5 mg/ml) with irradiated accessory cells for 72 hours. 2. Stimulation of Immune Cells The purpose of stimulating immune cells before the adoptive transfer is to increase the proliferative state of the immune cells, thus enhancing the disease-inducing capacities of the immune cells being transferred. a. Cell-Specific Stimulation In many reported experiments, the isolated immune cells are further stimulated with autocrinelike molecules before they are adoptively transferred to the recipient animals. For example, IL-2 is commonly used to stimulate T lymphocytes or T-cell subsets before the transfer takes place [19]. IL-12 and IL-4 are added to stimulate the Th1 and Th2 subsets, respectively, prior to adoptive transfer [18,19]. Other molecules, such as mitogen (like concanavalin A), are also widely used to stimulate immune cells prior to transfer [19]. b.
Antigen-Specific Stimulation
In autoimmune disease models, autoantigens are typically used to stimulate the isolated immune cells before they are adoptively transferred to the recipient animals [8,18,23].
III. STRENGTH OF METHOD The great usefulness of adoptive transfer in modeling inflammatory disease is the ability to demonstrate the in vivo effects of immune cells on the disease pathogenesis. These effects are both general and specific. With adoptive transfer, investigators can show in a general perspective that certain immune cell type can induce the same disease phenotype or confirm the autoimmune nature of an animal model. Specifically, investigators could also further delineate which subset of a given immune cell type is primarily responsible, the fine antigenic epitope of the pathogenic autoreactive T lymphocytes, the TCR that is preferentially used by the pathogenic T lymphocytes, and whether there is any MHC restriction of the disease induction. Furthermore, the effects of other inflammatory factors, such as cytokines and adhesion molecules, can also be delineated using the adoptive transfer models.
1391_C10.fm Page 184 Tuesday, November 18, 2003 5:10 PM
184
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
IV. LIMITATION OF METHOD A. Immunodeficient SCID Mice Model Since SCID mice do not have the differentiating factors needed to drive the donor immune cells transferred into their system, the adoptive transfer experiments performed in the SCID mouse system examine only an “instant picture” in the entire history of the disease [33]. Furthermore, the SCID mice usually die from Epstein–Barr virus-induced lymphomas within 16 weeks of receiving the donor immune cells that introduce the virus. Because they do not have immune system to fight off the tumors, SCID mice are unsuitable for animal modeling for the purpose of observing longterm effects of the disease process [33]. B. Immunocompetent Mice Model As illustrated in the next section, limitations are evident when certain immunological effects cannot be demonstrated in adoptive transfer models using immunocompetent recipients.
V. ILLUSTRATION OF METHOD To illustrate the method of adoptive transfer, the mouse model of experimental autoimmune encephalomyelitis (EAE) studied by Lafaille et al. [18,38] is discussed here. Th1 and Th2 T-cell subsets are known for their functional antagonism to each other and in some chronic inflammatory diseases such as multiple sclerosis, diabetes, and rheumatoid arthritis, Th1 and Th2 T cell subsets have been ascribed for their pathogenic and protective roles, respectively [1,18,39]. The central question to be answered in this EAE model is whether the Th2 subset of autoantigen-specific T cells are capable of inducing the same disease phenotype [18]. To achieve this goal, Lafaille et al. [38] utilized an adoptive transfer model. The authors first established a transgenic (Tg) mouse line, carrying a specific T cell receptor (TCR) reactive to the peptide Ac1-17 of myelin basic protein (MBP), the autoantigen in EAE [38]. The naïve MBP-specific T cells were obtained from the spleen of the Tg mice and 1 ¥ 106 cells were cultured in the presence of peptide Ac1-17, culture medium, and 100 U/ml IL-12 or 200 U/ml IL-4 to generate Th1 or Th2 subsets, respectively [18]. At cell culture days 4 and 8, these cultures were restimulated with peptide Ac1-17 and syngeneic antigen presenting cells. At culture day 11, these stimulated cells, judged to be blastic and positive for the Tg TCR and CD4 in over 90% of the population and secreting Th subset-specific cytokines, were washed with PBS and injected intravenously into recipient mice (5 ¥ 106 cells per mouse) [18]. As expected, the Th1 subset induced severe EAE in more than 90% of recipient mice (RAG-1 knockout, without mature T and B cells) [40]. However, surprisingly, the Th2 subset also induced severe EAE in more than 90% of the same recipient mice, although at a slower onset rate. Similar induction occurs in TCR-a KO mice [18,41]. To examine whether the inductive effects of the Th2 subset were due to the presence of small number of Th1 cells, kinetic studies were performed with a reduced number of transferred cells, revealing a decrease in the incidence of EAE induction in mice receiving reduced numbers of either Th1 or Th2 cells. Since the effect of a small number of Th1 cells present in the Th2 subset, if they existed, should mimic the kinetics and final incidence of EAE induction by a reduced number of Th1 cells, this study result indicates that such possibility is very unlikely [18]. To further examine whether the inductive effects of Th2 subset are due to conversion of Th2 cells to Th1 cells upon adoptive transfer, CD4+ T cells obtained from the spleen and brain of Th2-cell recipient mice that developed EAE were extracted for RNA and examined for their cytokine production, revealing their capacities to produce IL-4, but not IFN-g mRNA [18]. Therefore, this study confirms a disease induction role of the Th2 subset of antigen-specific T cells in EAE [18]. Interestingly, unlike the Th1 subset of T cells, the Th2 subset was incapable of
1391_C10.fm Page 185 Tuesday, November 18, 2003 5:10 PM
ADOPTIVE TRANSFER OF CELLULAR IMMUNITY
185
inducting EAE in TCR-d KO mice or immunocompetent mice, indicating that the protective effects against induction by Th2-subset T cells are TCR ab dependent [18,42]. ACKNOWLEDGMENT This work is supported by NIH grants R01 AR47667, R03 AR47634, and R21 AR48438 (Lawrence S. Chan).
REFERENCES 1. Lafaille, J.J., The roles of helper T cell subsets in autoimmune diseases, Cytokine Growth Factor Rev., 9, 139, 1998. 2. Bregenholt, S., Cells and cytokines in the pathogenesis of inflammatory bowel diseases: new insights from mouse T cell transfer models, Exp. Clin. Immunogenet., 17, 115, 2000. 3. Kojima, K. et al. Induction of experimental autoimmune encephalomyelitis by CD4+ T cells specific for an astrocyte protein, S100 beta, J. Neural Transm. Suppl., 49, 43, 1997. 4. Braley-Mullen, H. and Sharp, G.C., Adoptive transfer murine model of granulomatous experimental autoimmune thyroiditis, Int. Rev. Immunol., 19, 535, 2000. 5. Archelos, J.J. et al., Inhibition of experimental autoimmune encephalomyelitis by an antibody to the intercellular adhesion molecule ICAM-1, Ann. Neurol., 34, 145, 1993. 6. Zaccone, P. et al., The involvement of IL-12 in murine experimentally induced autoimmune thyroid disease, Eur. J. Immunol., 29, 1933, 1999. 7. Voskuhl, R.R. et al., Epitope spreading occurs in active but not passive EAE induced by myelin basic protein, J. Neuroimmunol., 70, 103, 1996. 8. Vanderlugt, C.L. et al., Pathologic role and temporal appearance of newly emerging autoepitopes in relapsing experimental autoimmune encephalomyelitis, J. Immunol., 164, 670, 2000. 9. Miller, S.D. et al., Persistent infection with Theiler's virus leads to CNS autoimmunity via epitope spreading, Nat. Med., 3, 1133, 1997. 10. Russell, P.J. et al., The role of suppressor T cells in the expression of autoimmune haemolytic anaemia in NZB mice, Clin. Exp. Immunol., 45, 496, 1981. 11. Kimura, H., Pickard, A., and Wilson, D.B., Analysis of T cell populations that induce and mediate specific resistance to graft-versus-host disease in rats, J. Exp. Med., 160, 652, 1984. 12. Sakaguchi, S. et al., Organ-specific autoimmune diseases induced in mice by elimination of T cell subset. I. Evidence for the active participation of T cells in natural self-tolerance; deficit of a T cell subset as a possible cause of autoimmune disease, J. Exp. Med., 161, 72, 1985. 13. Smith, S.C. and Allen, P.M., Myosin-induced acute myocarditis is a T cell-mediated disease, J. Immunol., 147, 2141, 1991. 14. Quinn, D.G. et al., Transfer of lymphocytic choriomeningitis disease in beta-2-microglobulin-deficient mice by CD4+ T cells, Int. Immunol., 5, 1193, 1993. 15. Wekerle, H. et al., Animal models, Ann. Neurol., 36, S47, 1994. 16. Hanninen, A. and Harrison, L.C., Gamma delta T cells as mediators of mucosal tolerance: the autoimmune diabetes model, Immunol. Rev., 173, 109, 2000. 17. Leithauser, F. et al., Early events in the pathogenesis of a murine transfer colitis, Pathobiology, 70, 156, 2002. 18. Lafaille, J.J. et al., Myelin basic protein-specific T helper 2 (Th2) cells cause experimental autoimmune encephalomyelitis in immunodeficient hosts rather than protect them from the disease, J. Exp. Med., 186, 307, 1997. 19. Katz, J.D., Benoist, C., and Mathis, D., T helper cell subsets in insulin-dependent diabetes, Science, 268, 1185, 1995. 20. Matsuda, J.L. et al., Systemic activation and antigen-driven oligoclonal expansion of T cells in a mouse model of colitis, J. Immunol., 164, 2797, 2000.
1391_C10.fm Page 186 Tuesday, November 18, 2003 5:10 PM
186
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
21. Pape, K.A. et al., Use of adoptive transfer of T-cell-antigen-receptor-transgenic T cell for the study of T-cell activation in vivo, Immunol. Rev., 156, 67, 1997. 22. Pope, L., Paterson, P.Y., and Miller, S.D., Antigen-specific inhibition of the adoptive transfer of experimental autoimmune encephalomyelitis in Lewis rats, J. Neuroimmunol., 37, 177, 1992. 23. Griffin, A.C. et al., Experimental autoimmune insulitis. Induction by T lymphocytes specific for a peptide of proinsulin, Am. J. Pathol., 147, 845, 1995. 24. Boitard, C., Current concepts in autoimmunity, Curr. Eye Res., 9, s69, 1990. 25. Rose, N.R. and Bona, C., Defining criteria for autoimmune diseases (Witebsky’s postulates revisited), Immunol. Today, 14, 426, 1993. 26. Gunzer, M. and Grabbe, S., Dendritic cells in cancer immunotherapy, Crit. Rev. Immunol., 21, 133, 2001. 27. Cohen, P.A. et al., T-cell adoptive therapy of tumors: mechanisms of improved therapeutic performance, Crit. Rev. Immunol., 21, 215, 2001. 28. Thomas, A.K. and June, C.H., The promise of T-lymphocyte immunotherapy for the treatment of malignant disease, Cancer J., 7, S67, 2001. 29. Perreault, C. and Brochu, S., Adoptive cancer immunotherapy: discovering the best targets, J. Mol. Med., 80, 212, 2002. 30. Kessels, H.W., Wolkers, M.C., and Schumacher, T.N., Adoptive transfer of T-cell immunity, Trends Immunol., 23, 264, 2002. 31. Bosma, G.C., Custer, R.P., and Bosma, M.J., A severe combined immunodeficiency mutation in the mouse, Nature, 301, 527, 1983. 32. Mosier, D.E. et al., Transfer of a functional human immune system to mice with severe combined immunodeficiency, Nature, 335, 256, 1988. 33. Hammarstrom, L. et al., The SCID mouse as a model for autoimmunity, J. Autoimmun., 6, 667, 1993. 34. Vladutiu, A.O., The severe combined immunodeficient (SCID) mouse as a model for the study of autoimmune diseases, Clin. Exp. Immunol., 93, 1, 1993. 35. Wrone-Smith, T. and Nickoloff, B.J., Dermal injection of immunocytes induces psoriasis, J. Clin. Invest., 98, 1878, 1996. 36. Nickoloff, B.J. and Wrone-Smith, T., Injection of pre-psoriatic skin with CD4+ T cells induces psoriasis, Am. J. Pathol., 155, 145, 1999. 37. Gilhar, A. et al., Autoimmune hair loss (alopecia areata) transferred by T lymphocytes to human scalp explants on SCID mice, J. Clin. Invest., 101, 62, 1998. 38. Lafaille, J.J. et al., High incidence of spontaneous autoimmune encephalomyelitis in immunodeficient anti-myelin basic protein T cell receptor transgenic mice, Cell, 78, 299, 1994. 39. Liblau, R.S., Singer, S.M., and McDevitt, H.O., Th1 and Th2 CD4+ cells in the pathogenesis of organspecific autoimmune diseases, Immunol. Today, 16, 34, 1995. 40. Mombaerts, P.J. et al., RAG-1 deficient mice have no mature B and T lymphocytes, Cell, 68, 869, 1992. 41. Mombaerts, P. et al., Mutations in T-cell antigen receptor genes a and b blocks thymocyte development at different stages, Nature, 360, 225, 1992. 42. Itohara, S. et al., T cell receptor d KO mice: independent generation of ab T cells and programmed rearrangements of dg TCR genes, Cell, 72, 337, 1993.
1391_C11.fm Page 187 Tuesday, November 18, 2003 5:12 PM
CHAPTER
11
Molecular Biological Manipulation of the Immune System by Transgenic Techniques Lawrence S. Chan
CONTENTS I. Purpose of Method.............................................................................................................187 II. Approach of Method..........................................................................................................188 A. Constitutively Expressed Transgene..........................................................................188 B. Inducibly Expressed Transgene.................................................................................189 1. Tet-Off System (tTA)...........................................................................................189 2. Tet-On System (rtTA)..........................................................................................189 3. Tet-On/Transcriptional Silencer System (rtTA/tTS) ...........................................190 III. Strength of Method ............................................................................................................190 A. Constitutive Expression .............................................................................................190 B. Inducible Expression .................................................................................................190 IV. Limitation of Method.........................................................................................................190 A. Constitutive Expression .............................................................................................190 B. Inducible Expression .................................................................................................192 1. Tet-Off System.....................................................................................................192 2. Tet-On System .....................................................................................................192 3. Modified Tet-On System with Gene Silencer .....................................................192 V. Illustration of Method ........................................................................................................192 Acknowledgment............................................................................................................................193 References ......................................................................................................................................193
I. PURPOSE OF METHOD The purpose of molecular biological manipulation of the immune system by transgenic method is to deliver an immune or nonimmune protein-coding gene (cDNA) into a tissue of a live animal (in vivo) or a living cell (in vitro), so that one can examine the effects of this inserted gene product on the immune responses of the animal (in vivo system) or that of a defined laboratory system (in vitro system) [1–42]. Gordon et al. [1] were the first to demonstrate that foreign DNA introduced into a fertilized egg by microinjection can be implanted into a pseudopregnant foster female animal 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
187
1391_C11.fm Page 188 Tuesday, November 18, 2003 5:12 PM
188
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
to generate progeny that carry a functional transgene [1]. The transgene to be delivered into the live animal or cell could be a gene native or foreign to the host animal or cell. As I discuss below, the transgene inserted into the tissue can be expressed in a constitutive [1–19] or inducible manner [20–42]. The purpose of expressing a transgene in a constitutive manner is to examine the effects of a constantly present gene, whereas expressing a transgene in an inducible (regulated) manner serves the purpose of examining the effects of the inserted gene at a defined timeframe by controlling the timing, and to a lesser extent, the quantity of the transgene expression.
II. APPROACH OF METHOD A. Constitutively Expressed Transgene Figure 11.1 illustrates a commonly used method of establishing a transgenic (Tg) construct. The Tg construct usually consists of a vector (for amplification purposes); a promoter/enhancer (for directing and activating the transgene to a specific tissue); an intron (for ensuring stable expression); the transgene cDNA (for the intended expression); and a poly-A tail (for concluding the expression), usually in a circular form. When sufficient amounts of construct are synthesized, the construct is cut at the restriction endonuclease sites (sites I and II in Figure 11.1) to release the vector and the remaining construct is further purified for the pronuclear microinjection into the fertilized eggs, followed by implantation into pseudopregnant animals. After the mice are born from the animals carrying the transgene-injected eggs, they are genotyped for positive transgene using the Southern blot hybridization or polymerase chain reaction (PCR) method. The most common technique for obtaining DNA samples is through tail clipping if mice or rats are used as Tg animals. I have successfully worked out a method of extracting chromosomal DNA from mice for PCR-based genotyping: at 25 days of age, 0.5- to 1.0-cm pieces of the tails are clipped from the mice and the skin is removed by scraping. The tail specimens are incubated with proteinase K at 56∞C overnight in a concentration of 10 mg/ml. After heating at 100∞C for 20 minutes, the DNAcontaining solution can then be used for PCR-based genotyping, using a 35-cycle PCR parameter with the primer pair specific for the transgene. The choice of promoter/enhancer is an important decision. You can choose a ubiquitous promoter/enhancer or a selective tissue-specific one. By choosing a ubiquitous promoter/enhancer, such as MHC class I promoter, expressions of the transgene will be observed in most cells of the Tg animal. In contrast, by choosing a tissue-specific promoter/enhancer, such as keratin 14 promoter, expressions of the transgene are present only in a highly selected cell type, in this case basal keratinocytes of the keratinized, stratified squamous epithelia. In some experimental conditions, the tissue specificity of the Tg expression actually determines whether an organ-specific disease Restriction Endonuclease Sites I II
Vector
Figure 11.1
Intron
Promoter/Enhancer
Transgene cDNA Poly-A Tail
Schematic representation of a constitutive-expression Tg construct.
1391_C11.fm Page 189 Tuesday, November 18, 2003 5:12 PM
MOLECULAR BIOLOGICAL MANIPULATION OF THE IMMUNE SYSTEM BY TRANSGENIC TECHNIQUES 189
process will be developed. For example, a constitutive expression of interleukin-4 cDNA through a tissue-specific keratin 14 promoter has resulted in an organ-specific inflammatory skin disease closely resembling atopic dermatitis in humans [17], whereas the same expression of interleukin4 under the control of ubiquitous promoters such as immunoglobulin promoter or MHC class I promoter has resulted in high levels of serum IgE with minimal periorbital inflammation or a systemic autoimmune disorder resembling systemic lupus erythematosus, respectively [18,19]. B. Inducibly Expressed Transgene To generate an inducible Tg animal, a regulatory unit, a responsive element linked to a target gene, and an induction agent are needed [22]. An ideal system includes the following features: • The transgene expression can be induced or terminated rapidly and reversibly by a simple external inducing agent. • Along with a specific promoter, the system should provide spatial and temporal control over the transgene expression. • The transgene should have no basal expression at the “off” state. • The transgene should be induced to a high level of expression at the “on” state. • The levels of transgene expression should be adjustable. • The inducing agent should be inexpensive, readily available, easily administered to the animals, long in half-life, high in bioavailability, and nontoxic. • The inducing agent should be able to reach the intended tissues easily and should carry no undesirable side effects that interfere with the parameters of the investigation [22].
Several inducible systems are available currently, including the tetracycline-controlled transcriptional regulator [20,21], the ecdysone-regulated gene switch [38,39], the lac operator-repressor system [25,40], and the GAL4/UAS system [24,41]. Among these systems, the most widely used, externally regulatable Tg system is the tetracycline-based inducible Tg expression system, which was first generated by Gossen and Bujard in 1992 [20]. As the scientific community celebrated the 11th year of the inducible Tg system in 2003, many modification and improvement have been made to the original system [20–22]. Figure 11.2 illustrates three forms of tetracycline-inducible Tg constructs. As discussed below, there are two basic forms (Tet-off and Tet-on systems) and one advanced form (modified Tet-on system combined with a gene silencer) [22,42]. 1. Tet-Off System (tTA) The general principle of this tetracycline-controlled transcriptional activator system is that the intended transgene expression is negatively suppressed by the inducing agent, usually doxycycline (Doc) [22] (Figure 11.2a). The tTA is composed of a tissue-specific promoter (Pro), the tetracycline repressor of Escherichia coli (tetR), and the transcriptional activator domain of herpes simplex viral protein 16 (VP16). In the absence of inducing agent Doc, tTA binds to the responsive element, the tetracycline-resistance operon of E. coli transposon Tn10 (tetO), and activates the human cytomegalovirus minimum promoter (Pcmv), leading to the transcription and expression of the transgenic (Tg) target protein. However, in the presence of Doc, tTA undergoes a conformational change and dissociates from tetO, and the transcription and protein production are terminated. 2. Tet-On System (rtTA) The general principle of this reverse tetracycline-controlled transcriptional activator system is that the intended transgene expression is positively induced by the inducing agent, Doc [22] (Figure 11.2b). Similar to that of tTA, the rtTA is composed of a Pro, the reverse tetracycline repressor of E. coli (rtetR), and the VP16. The working principle, however, is the reverse of that in the tTA
1391_C11.fm Page 190 Tuesday, November 18, 2003 5:12 PM
190
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
system. In the absence of Doc, rtTA does not bind to tetO and therefore no, or minimum, Tg target gene transcription is triggered. In the presence of Doc, rtTA binds to tetO, triggering transcription of the Tg target. 3. Tet-On/Transcriptional Silencer System (rtTA/tTS) The general principle of this modified Tet-on system combined with a silencer is the same as that of original Tet-on system, except the addition of a gene silencer [22] (Figure 11.2c). As a modified tTA, tTS is composed of a Pro, the tetR, and the DRAB-AB silencing domain of Kid-1 protein (Silenc Dom) and is inhibited by Doc. In the absence of Doc, tTS binds to tetO. But rather than induction, this binding between tTS and tetO actively suppresses transcription of the Tg target protein, preventing any basal (leaky) transcriptional activity. In the presence of Doc, the binding of tTS to tet is inhibited and tTS disssocaites from tetO, whereas rtTA binds to the tetO and activates transcription and expression of the Tg target. Zhu et al. were [42] the first to demonstrate the tTS suppression of leaky transgene expression in mice.
III. STRENGTH OF METHOD A. Constitutive Expression The strength of the Tg technique, in general, is its ability to delineate the specific function of a given gene in vitro and in vivo. As completion of the human genome sequencing project brought out some 40,000 genes that encode proteins, an enormous challenge for the scientific community is to delineate the function and regulation of these genes in healthy and diseased conditions. A powerful way to elucidate the functional and regulatory roles of these new genes will be to transgenically overexpress these genes in animal models and in cell cultures [22]. B. Inducible Expression The strength of the inducible Tg expression system lies in its abilities to “turn on” and “turn off” the transgene expression in a defined timeframe [22], so that one can detect the earliest pathogenic events of disease development, determine whether a continuous expression of the transgene is required for disease induction or progression, and to evaluate whether the transgene expressed in a defined timeframe leads to a reversible or irreversible disease process [23]. Each of the three tetracycline-based inducible systems has a distinct strength. • Tet-off system (tTA): Tight control of the “off” cycle • Tet-on system (rtTA): Tight control of the “on” cycle, suitable to study the acute effects of Tg target protein • Tet-on/transcriptional silencer system (rtTA/tTS): Tight control of both the “on” and “off” cycles
IV. LIMITATION OF METHOD A. Constitutive Expression The classical constitutive Tg animal models do not allow the determination of the earliest pathogenic events of the disease process. Moreover, the constitutively active promoter cannot answer the question of whether the progressive nature of the disease process requires a continuous expression of the transgene. Furthermore, the constitutively expressed, Tg animal models are not capable
1391_C11.fm Page 191 Tuesday, November 18, 2003 5:12 PM
MOLECULAR BIOLOGICAL MANIPULATION OF THE IMMUNE SYSTEM BY TRANSGENIC TECHNIQUES 191
(a)
tetR
Pro
VP16 tTA Doc
No Doc
tetO
Pcmv
tetO
Tg
Transgene product
(b)
Tg
Transgene product
rtetR
Pro
Pcmv
VP16 rtTA Doc
No Doc
tetO
Pcmv
Tg
Transgene product
(c)
Pro
tetR Silenc Dom
tetO
Pcmv
Transgene product Pro
rtetR
Doc
No Doc
Pcmv
Tg
Transgene product
Figure 11.2
VP16 rtTA
tTS
tetO
Tg
tetO
Pcmv
Tg
Transgene product
Schematic representation of three forms of tetracycline-controlled, inducible-expression transgenic (Tg) constructs. (a) Tetracycline-controlled transcriptional activator (tTA) system (Tet-off system). The tTA consists of the tissue-specific promoter (Pro), the tetracycline repressor of E. coli (tetR), and the transcriptional activator domain of herpes simplex viral protein 16 (VP16). In the absence of inducing agent Doc, tTA binds to the responsive element, the tetracycline-resistance operon of the E. coli transposon Tn10 (tetO), and activates the Pcmv, triggering the transcription and expression of the Tg target protein. In the presence of Doc, tTA undergoes a conformational change and dissociates from tetO and the transcription is turned off. (b) Reverse tetracycline-controlled transcriptional activator (rtTA) system (Tet-on system). Like that of tTA, the rtTA consists of Pro, reverse tetracycline repressor of E. coli (rtetR), and VP16. In the absence of Doc, rtTA does not bind to tetO, and therefore no Tg target protein transcription occurs. In the presence of Doc, rtTA binds to tetO, leading to transcription of the Tg target protein. (c) Modified Tet-on system with transcriptional silencer (tTS). As a modified tTA, tTS consists of Pro, tetR, and DRAB-AB silencing domain of Kid1 protein (Silenc Dom). In the absence of Doc, tTS binds to tetO and actively suppresses transcription of the Tg target protein, preventing any basal transcriptional activity. In the presence of Doc, tTS dissociates from tetO, whereas rtTA binds to the tetO and activates transcription and expression of the Tg target protein.
1391_C11.fm Page 192 Tuesday, November 18, 2003 5:12 PM
192
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
of determining whether the transgene leads to a reversible or irreversible disease process [23]. In addition, since the constitutive expression system has no control over the timing of the expression, which depends entirely on the properties of the promoter, the transgene can be activated as soon as the promoter is activated. If the transgene product is toxic to the developing embryo, this may lead to failure of generating live animals for studying the transgene functions past embryogenesis [22]. To address these questions, an inducible-expression Tg system, which can be turned on or off at defined times, would be ideal. B. Inducible Expression 1. Tet-Off System A major limitation of the Tet-off inducible Tg system lies in its burdensome application. In order to keep the system in the “off” cycle, Doc must be fed to the Tg animals on a continuous basis. Furthermore, this long-term administration of Doc may have undesired effects during embryogenesis. Moreover, the induced expression of the transgene is somewhat slow, depending on the speed of Doc clearance from the Tg animals. Therefore, the Tet-off system is not suitable for observing the acute effects of Tg target protein [22]. 2. Tet-On System The major limitation of the Tet-on inducible Tg system lies in the inability of the inducible system to tightly control the timing of turning off the expression. In some systems, basal protein expression continues to occur despite the switching from “on” to “off” that has taken place at the molecular level [22]. Without a tightly regulated expression system, one cannot properly investigate the time-dependent pathogenic events. Recently, many improvements have been reported in an attempt to achieve tighter control. For example, the tetracycline transcriptional silencer gene has been incorporated into the Tg construct [22]. 3. Modified Tet-On System with Gene Silencer With the latest round of modification and improvement, this system has tightly controlled “on” and “off” for the Tg target protein expression [22]. This system may be limited only in terms of the ability of the inducing agent, Doc, to reach the sites of the promoter that links to the transgene. Experimentally, it has recently been proved that Doc fed to Tg mice through drinking water is capable of inducing transgene expression under the control of basal epidermal cell-specific promoter keratin 5 [29]. As Doc fed by mouth can reach and exert its activating action at the skin epidermis, a site that is considered to be extremely peripheral from circulation, this system can certainly be used for Tg expression in most parts of the body; thus, the limitation of this modified Tet-on system is very minimal indeed.
V. ILLUSTRATION OF METHOD To illustrate the usefulness of the Tg technique in animal modeling of inflammation, an example using the tetracycline-controlled system by Zhu et al. [42] is described here. Zhu et al. [42] at Yale University were interested in studying the pathogenesis of asthma in animal models. Although constitutive expression of cytokines to the lung tissues by tissue-specific promoters has provided impressive insights on the roles of inflammatory cytokines and other mediators in asthma, its usefulness is limited by its inability to accurately model the waxing and waning nature of the asthma disease process and to determine the reversibility of the disease process [42]. Toward that
1391_C11.fm Page 193 Tuesday, November 18, 2003 5:12 PM
MOLECULAR BIOLOGICAL MANIPULATION OF THE IMMUNE SYSTEM BY TRANSGENIC TECHNIQUES 193
end, the Yale group generated a Tg mouse line with three molecular constructs. The first construct is composed of lung tissue-specific promoter Clara cell 10-kDa protein (CC10) and the reverse tetracycline transactivator (rtTA), a fusion protein of the herpesvirus VP-16 transactivator and a mutant tet repressor (rtetR) from E. coli. The second construct is composed of multimers of the tetracycline operator (tetO), a minimal Pcmv, and the gene of interest, IL-13 [42]. The double Tg mouse line generated with these two constructs is designated as CC10-rtTA-IL-13 Tg mice, a Teton system [42]. To circumvent the limitation of undesirable leakiness of rtTA in the absence of inducing agent Doc, the Yale group generated a second Tg mouse line with a third Tg construct that contained CC10 promoter and tTS, a fusion protein of a tet repressor (tetR) and a powerful transcriptional repressor, the KRAB-AB silencing domain of the Kid-1 protein [42], designated as CC10-tTS Tg mice. The mating of CC10-tTS Tg mice with the CC10-rtTA-IL-13 Tg mice resulted in a triple-Tg mouse line designated as CC10-rtTA/tTS-IL-13 Tg mice. Unlike the CC10-rtTA-IL13 double Tg mice, which were shown to have a quantifiable level of basal transgene leak (IL-13 induction) and phenotype induction (mucus metaplasia, inflammation, alveolar enlargement, and enhanced lung volumes) in the absence of Doc, the IL-13 and the disease phenotype were not detected in CC10-rtTA/tTS-IL-13 triple Tg mice without Doc. Nevertheless, the addition of Doc induced IL-13 and disease phenotype in the triple Tg mice without any alteration [42]. Thus, Zhu et al. [42] demonstrated an excellent method in which an optimal on/off regulation of Tg expression can be achieved by combining tTS and rtTA systems, which can certainly be considered in animal modeling of inflammatory skin diseases known to have the waxing and waning disease process, such as atopic dermatitis.
ACKNOWLEDGMENT This work is supported by NIH grants R01 AR47667, R03 AR47634, and R21 AR48438 (Lawrence S. Chan).
REFERENCES 1. Gordon, J.W. et al., Genetic transformation of mouse embryos by microinjection of purified DNA, Proc. Natl. Acad. Sci. U. S. A., 77, 7380, 1980. 2. Boyton, R.J. and Altmann, D.M., Transgenic models of autoimmune disease, Clin. Exp. Immunol., 127, 4, 2002. 3. Heinzmann, A. and Daser, A., Mouse models for the genetic dissection of atopy, Int. Arch. Allergy Immunol., 127, 170, 2002. 4. Ishihara, K. and Hirano, T., IL-6 in autoimmune disease and chronic inflammatory proliferative disease, Cytokine Growth Factor Rev., 13, 357, 2002. 5. Iwakura, Y., Roles of IL-1 in the development of rheumatoid arthritis: consideration from mouse models, Cytokine Growth Factor Rev., 13, 341, 2002. 6. Seery, J.P. et al., Antinuclear autoantibodies and lupus nephritis in transgenic mice expressing interferon g in the epidermis, J. Exp. Med., 186, 1451, 1997. 7. Michael, B.A. et al., Measles virus infection in a transgenic model: virus-induced immunosuppression and central nervous system disease, Cell, 98, 629, 1999. 8. Oldstone, M.B. et al., Measles virus infection in a transgenic model: virus-induced immunosuppression and central nervous system disease, Cell, 98, 629, 1999. 9. Tishon, A. et al., Transgenic mice expressing human HLA and CD8 molecules generate HLA-restricted measles virus cytotoxic T lymphocytes of the same specificity as humans with natural virus infection, Virology, 275, 286, 2000. 10. Keppler, O.T. et al., Progress toward a human CD4/CCR5 transgenic rat model for de novo infection by human immunodeficiency virus type 1, J. Exp. Med., 195, 719, 2002.
1391_C11.fm Page 194 Tuesday, November 18, 2003 5:12 PM
194
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
11. Stassen, M.H.W. et al., Experimental autoimmune myasthenia gravis in mice expressing human immunoglobulin loci, J. Neuroimmunol., 135, 56, 2003. 12. Chen, D. et al., Characterization of HLA DR3/DQ2 transgenic mice: a potential humanized animal model for autoimmune disease studies, Eur. J. Immunol., 33, 172, 2003. 13. Djilali-Saiah, I. et al., DNA vaccination breaks tolerance for a neo-self antigen in liver: a transgenic murine model for autoimmune hepatitis, J. Immunol., 169, 4889, 2002. 14. Laub, R. et al., Anti-human CD4 induces peripheral tolerance in a human CD4+, murine CD4-, HLADR+ advanced transgenic mouse model, J. Immunol., 169, 2947, 2002. 15. Kayaba, H. et al., Human eosinophils and human high affinity IgE receptor transgenic mouse eosinophils express low levels of high affinity IgE receptor, but release IL-10 upon receptor activation, J. Immunol., 167, 995, 2001. 16. Egwuagu, C.E. et al., IFN-gamma increases the severity and accelerates the onset of experimental autoimmune uveitis in transgenic rats, J. Immunol., 162, 510, 1999. 17. Chan, L.S., Robinson, N., and Xu, L., Expression of interleukin-4 in the epidermis of transgenic mice results in a pruritic inflammatory skin disease: an experimental animal model to study atopic dermatitis, J. Invest. Dermatol., 117, 977, 2001. 18. Tepper, R.I. et al., IL-4 induces allergic-like inflammatory disease and alters T cell development in transgenic mice, Cell, 63, 457, 1990. 19. Erb, K.J. et al., Constitutive expression of interleukin (IL)-4 in vivo causes autoimmune-type disorders in mice, J. Exp. Med., 185, 329, 1997. 20. Gossen, M. and Bujard, H., Tight control of gene expression in mammalian cells by tetracyclineresponsive promoters, Proc. Natl. Acad. Sci. U. S. A., 89, 5547, 1992. 21. Gossen, M. et al., Transcriptional activation by tetracyclines in mammalian cells, Science, 268, 1766, 1995. 22. Zhu, Z. et al., Tetracycline-controlled transcriptional regulation systems: advances and application in transgenic animal modeling, Semin. Cell Dev. Biol., 13, 121, 2002. 23. Yamamoto, A., Hen, R., and Dauer, W.T., The ons and offs of inducible transgenic technology: a review, Neurobiol. Dis., 8, 923, 2001. 24. Cao, T., Wang, X.J., and Roop, D.R., Regulated cutaneous gene delivery: the skin as a bioreactor, Hum. Gene Ther., 11, 2297, 2000. 25. Scrable, H., Say when: reversible control of gene expression in the mouse by lac, Cell Dev. Biol., 13, 109, 2002. 26. Emma, R. and Gerwins, P., How to make tetracycline-regulated transgene expression go on and off, Anal. Biochem., 309, 79, 2002. 27. Perez, N. et al., Tetracycline transcriptional silencer tightly controls transgene expression after in vitro intramuscular electrotransfer: application to interleukin 10 therapy in experimental arthritis, Hum. Gene Ther., 13, 2161, 2002. 28. Vigna, E. et al., Robust and efficient regulation of transgene expression in vivo by improved tetracycline-dependent lentiviral vectors, Mol. Ther., 5, 252, 2002. 29. Liu, X. et al., Conditional epidermal expression of TGFb1 blocks neonatal lethality but causes a reversible hyperplasia and alopecia, Proc. Natl. Acad. Sci. U. S. A., 98, 9139, 2001. 30. Chtarto, A. et al., Tetracycline-inducible transgene expression mediated by a single AAV vector, Gene Ther., 10, 84, 2003. 31. Lamartina, S. et al., Stringent control of gene expression in vivo by using novel doxycycline-dependent trans-activators, Hum. Gene Ther., 13, 199, 2002. 32. Teng, P.I. et al., Inducible and selective trangene expression in murine vascular endothelium, Physiol. Genomics, 11, 99, 2002. 33. Favre, D. et al., Lack of an immune response against the tetracycline-dependent transactivator correlates with long-term doxycycline-regulated transgene expression in nonhuman primates after intramuscular injection of recombinant adeno-associated virus, J. Virol., 76, 11605, 2002. 34. Giampaoli, S. et al., Adeno-cosmid cloning vectors for regulated gene expression, J. Gene Med., 4, 490, 2002. 35. Mizuguchi, H. and Hayakawa, T., The tet-off system is more effective than the tet-on system for regulating transgene expression in a single adenovirus vector, J. Gene Med., 4, 240, 2002.
1391_C11.fm Page 195 Tuesday, November 18, 2003 5:12 PM
MOLECULAR BIOLOGICAL MANIPULATION OF THE IMMUNE SYSTEM BY TRANSGENIC TECHNIQUES 195
36. Bockamp, E. et al., Of mice and models: improved animal models for biomedical research, Physiol. Genomics, 11, 115, 2002. 37. Corbel, S.Y. and Rossi, F.M., Latest development and in vivo use of the Tet system: ex vivo and in vivo delivery of tetracycline-regulated genes, Curr. Opin. Biotechnol., 13, 448, 2002. 38. Saez, E. et al., Inducible gene expression in mammalian cells and transgenic mice, Curr. Opin. Biotechnol., 8, 608, 1997. 39. Saez, E., Identification of ligands and coligands for the ecdysone-regulated gene switch, Proc. Natl. Acad. Sci. U. S. A., 97, 14512, 2000. 40. Cronin, C.A., Gluba, W., and Scrable, H., The lac operator-repressor system is functional in the mouse, Genes Dev., 15, 1506, 2001. 41. Wang, X.J. et al., Development of gene-switch transgenic mice that inducibly express transforming growth factor b1 in the epidermis, Proc. Natl. Acad. Sci. U. S. A., 96, 8483, 1999. 42. Zhu, Z. et al., Use of the tetracycline-controlled transcriptional silencer (tTS) to eliminate transgene leak in inducible overexpression transgenic mice, J. Biol. Chem., 276, 25222, 2001.
1391_C11.fm Page 196 Tuesday, November 18, 2003 5:12 PM
1391_C12.fm Page 197 Tuesday, November 18, 2003 5:13 PM
PART
V
Inflammatory Skin Disease Models
1391_C12.fm Page 198 Tuesday, November 18, 2003 5:13 PM
1391_C12.fm Page 199 Tuesday, November 18, 2003 5:13 PM
SECTION
A
Bullous Pemphigoid
1391_C12.fm Page 200 Tuesday, November 18, 2003 5:13 PM
1391_C12.fm Page 201 Tuesday, November 18, 2003 5:13 PM
CHAPTER
12
Natural Bullous Pemphigoid in Companion Animals Thierry Olivry
CONTENTS I. II. III. IV. V.
History ................................................................................................................................201 Animals ..............................................................................................................................202 Epidemiology .....................................................................................................................202 Course of Disease ..............................................................................................................202 Assessment of Disease.......................................................................................................203 A. Clinical Manifestation ...............................................................................................203 B. Histopathological Examination .................................................................................204 C. Immunopathological Data .........................................................................................204 1. Direct Immunofluorescence (IF) Microscopy .....................................................204 2. Indirect Immunofluorescence and Immunoelectron Microscopy .......................205 3. Immunoblotting and ELISA................................................................................207 D. Immunogenetics.........................................................................................................208 VI. Therapeutic Responses.......................................................................................................208 VII. Expert Experience ..............................................................................................................208 VIII. Lessons Learned.................................................................................................................209 IX. Conclusion..........................................................................................................................209 References ......................................................................................................................................210
I. HISTORY The spontaneous occurrence of autoimmune subepidermal blistering dermatoses in companion animals was first noticed 25 years ago with the description of a dog with vesiculation and antibasement membrane autoantibodies [1]. The first reports of a canine blistering disease cited as “bullous pemphigoid” (BP) are credited to Kunkle et al. [2] in 1978, and Griffin and MacDonald [3] in 1981. Single case descriptions [4-10] and one small study of eight subjects [11] were the only original reports of canine BP in the 20 years following its initial description. Of note is that in none of these cases was the nature of the autoantigen identified; thus it is not known whether these patients were affected with BP sensu stricto or with a resemblant vesicular disease. In fact, when the clinical signs of these subjects are reviewed using current knowledge on the clinicopathological phenotype of blistering skin diseases, other diagnoses would be given. Many of these 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
201
1391_C12.fm Page 202 Tuesday, November 18, 2003 5:13 PM
202
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
dogs probably suffered from epidermolysis bullosa acquisita (EBA) [3,4,7], mucous membrane pemphigoid (MMP) [2,8,9], or a vesicular form of cutaneous lupus erythematosus (VCLE) homologous to subacute cutaneous lupus of humans [5,6]. The same situation may characterize the small case study, with EBA and VCLE probably composing the majority of the diagnoses [11]. Therefore, the existence of a canine autoimmune blistering skin disease with autoantibodies directed against BP antigens was proven only in 1995 [12]. Within a few years, feline, equine, and porcine homologues of BP in humans were individualized as separate entities [13–15].
II. ANIMALS At the time of this writing, animal homologues of BP in humans have been identified in dogs [12,16], cats [13], horses [14] and pigs [15,17]. Our unpublished series of seven dogs with vesiculation and antibodies against BP antigens provides limited information on the characteristics of canine patients with this disease. Our seven dogs with BP belong to six different breeds; there are two dachshunds. The male to female ratio is 4 to 3 (1.33). The median age of onset of vesiculation is 5 years (range, 0.8 to 7 years), an age corresponding to middle age in this species. There are too few cases of feline and equine BP to provide meaningful information on the distinct features of affected patients. Remarkably, BP was discovered in a line of related Yucatan minipigs sold by a leading supplier [15,17]. In these animals, skin lesions developed around puberty (median age of onset, 5.5 months; range, 5 to 11 months). All affected patients were male, but this could reflect a selection bias, as only males were purchased by the institution in which the disease was noticed first.
III. EPIDEMIOLOGY In humans, BP is the diagnosis most often given to individuals with vesiculation associated with anti-basement membrane autoantibodies [18,19]. Canine BP is seen less frequently than MMP or EBA in the same species. Indeed, in a series of 59 dogs with autoimmune subepidermal blistering dermatoses, BP is the diagnosis given to only seven patients (12%), whereas MMP and EBA are the entities recognized in 31 (53%) and 12 (20%) dogs, respectively (T.O., unpublished data, 2002). At this time, there is no specific information on the prevalence and incidence of BP in the canine population. Too few cases of canine, feline, equine, and porcine BP have been diagnosed to allow meaningful epidemiological analysis of BP in animals. Nevertheless, the scarcity of reports of this disease in companion animals is indicative of the rarity of this disease outside humans.
IV. COURSE OF DISEASE In human patients, BP is a chronic inflammatory skin disease that can persist for months to years with intermittent blistering episodes. In our small series of seven dogs with BP, the duration of the disease prior to diagnosis was usually less than 1 month. In one dog, however, skin lesions had persisted for more than 2 years before BP was identified (T.O., unpublished data, 2002). In most dogs (see below), the disease responds to therapy, and remission can be prolonged. Too few cases of feline and equine BP have been recognized to provide clinically relevant information on the course of the disease. All horses diagnosed with BP have been euthanized because of the severity of their dermatosis. In pigs, lesions come very rapidly, abate with topical glucocorticoids, and then undergo longterm remission. Two pigs previously diagnosed with BP were kept for more than 1 year after initial blistering had occurred followed by treatment with topical glucocorticoids. In these two pigs,
1391_C12.fm Page 203 Tuesday, November 18, 2003 5:13 PM
NATURAL BULLOUS PEMPHIGOID IN COMPANION ANIMALS
203
analysis of serial samples demonstrated decreasing antibasement membrane IgG autoantibody serum titers during this period. After 1.5 years, spontaneous blistering had not recurred. Repeated intradermal injections with pig collagen XVII-NC16A peptides led to lymphocyte proliferation to this peptide, increases in autoantibody titers, and superficial dermal and basement membrane autoantibody deposition, yet neither macroscopic nor microscopic vesiculation could be provoked (T.O. et al., unpublished observations, 2001). Thus, BP in Yucatan minipigs appears to be associated with juvenile-onset blistering followed by long-lasting remission. V. ASSESSMENT OF DISEASE A. Clinical Manifestation Even though the diagnosis of BP has been confirmed immunologically only in seven canine patients, the review of this small case series permits useful clinical observations (T.O., unpublished data, 2002). In our series, skin lesions of canine BP consisted of erythematous macules, patches, or plaques (4 of 7, 57%); tense vesicles or bullae (3 of 7 dogs, 43%); erosions or ulcers (6 of 7, 86%); and (5 of 7, 71%). In these dogs, lesions of BP occurred first on the head, ears, or trunk. At the time of diagnosis, lesions could be seen on the back (4 of 7, 57%); axillae (2 of 7, 29%); and abdomen (2 of 7, 29%). Footpads were rarely affected in dogs with BP, unlike in subjects diagnosed with EBA. Lesions at mucosal or mucocutaneous junctional sites were detected in four dogs (57%), with a median number of one such site being affected. Lesions involved primarily the oral cavity (3 of 7, 43%); lip margins (4 of 7, 57%); and concave ear pinnae (4 of 7, 57%). In most patients, there were no systemic signs associated with blistering episodes, a marked contrast with canine EBA. In one dog, BP occurred in the context of alopecia areata-like hair loss. In cats, lesions of BP appear to be of minimal severity, with vesiculation and erosions occurring predominantly on the ears, trunk, and extremities. Mucosal involvement can be seen, but appears to be mild. In Yucatan minipigs with BP, single or coalescing, clear to hemorrhagic turgid vesicles develop on the dorsum [15]. In some pigs, erythema precedes vesicle formation. Blisters most commonly are short-lived and evolve rapidly into erosive or crusted lesions (Figure 12.1). Residual postinflammatory hyperpigmentation occasionally is observed at the periphery of the sites of previous vesicles. Mucosal lesions usually are not found.
Figure 12.1
Clinical phenotype of porcine BP. Acutely arising vesicles develop on the trunk (left), and develop rapidly into sharp-edged erosions and ulcers (right). (Courtesy of W. Singleton.)
1391_C12.fm Page 204 Tuesday, November 18, 2003 5:13 PM
204
Figure 12.2
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Clinical presentation of equine BP. Widespread erosions, ulcers, and crusts are present. Focal alopecia also can be seen on the head (left inset). Severe oral ulceration leads to anorexia and hypersalivation (right inset). (Courtesy of N. Slovis, case material, University of California, Davis.)
In contrast to other species, the phenotype of equine BP appears very severe due to the wide surface harboring skin lesions. Vesicles arise suddenly and progress rapidly into erosions and ulceration covered with crusts (Figure 12.2). Oral ulceration is especially prominent. Lethargy and anorexia also are present. Usually, horses with BP are euthanized for humane reasons due to the severity of their disease. B. Histopathological Examination In humans and animal species, the archetypal microscopic lesion of BP is a subepidermal vesicle. Variations in the severity of superficial dermal inflammation have been noticed between species, however. In canine and porcine BP, like in its human counterpart, there is usually prominent vesicular and subepidermal inflammation consisting of neutrophils and eosinophils (Figures 12.3 and 12.4). Indeed, intravesicular eosinophils and neutrophils were found in all pigs with BP [15] (Figure 12.5) and in two-thirds of dogs with this disease. In almost all dogs and pigs with BP, vesicles often contain a high number of red blood cells, leading to the clinical observation of hemorrhagic blisters. Lesional skin sections obtained from a few dogs with BP have been stained with toluidine blue, and microscopic examination revealed mast cell degranulation in the superficial dermis, as seen in humans with this disease. In cats and horses with BP, as opposed to the canine and porcine disease, there are few or no inflammatory cells in either vesicles or superficial dermis [13,14]. This is in marked contrast with the tissue eosinophilia commonly seen in most inflammatory skin diseases in these two species. C. Immunopathological Data 1. Direct Immunofluorescence (IF) Microscopy Deposition of basement membrane-bound immunoglobulins (especially IgG) or complement (C3 fraction) has been visualized by direct IF testing in most animal patients with BP (Figure 12.6). In dogs, the most commonly detected immunoglobulins are IgG and IgM (T.O., unpublished data, 2002).
1391_C12.fm Page 205 Tuesday, November 18, 2003 5:13 PM
NATURAL BULLOUS PEMPHIGOID IN COMPANION ANIMALS
205
Figure 12.3
Histopathological findings of canine BP: eosinophil and neutrophil granulocytes accumulate below the epidermis (arrowhead) in an early blistering skin lesion. Hematoxylin-eosin, bar = 25 mm.
Figure 12.4
Histopathological findings of porcine BP: subepidermal vesicles are rich in neutrophil and eosinophil granulocytes. Note the festooning aspect of the dermal floor of the vesicle covered by the lamina densa. Hematoxylin-eosin, bar = 100 mm.
2. Indirect Immunofluorescence and Immunoelectron Microscopy Using the indirect IF method performed on canine gingival substrate, IgG autoantibodies binding to the epithelial basement membrane zone have been detected in the serum of 6 of 7 (86%) dogs, 7 of 8 (88%) pigs [15], and all cats and horses with BP [13,14]. When salt-split gingival epithelia are used as substrates, however, the sensitivity of circulating autoantibody detection reaches 100%, and IgG autoantibodies binding to the epidermal (roof) side of induced clefts are uncovered [20] (Figure 12.7). Autoantibody titers vary greatly among individuals, and they range from 1:20 to greater than 1:2000. Remarkably, IgG antibodies often are found to not only bind to the basal side
1391_C12.fm Page 206 Tuesday, November 18, 2003 5:13 PM
206
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Figure 12.5
Histopathological findings of porcine BP: neutrophils and eosinophils (arrowheads) are present inside a vesicle. Luna stain for eosinophils, bar = 30 mm.
Figure 12.6
Direct immunofluorescence microscopy of canine BP: IgG autoantibodies are detected in a linear pattern at the dermo-epidermal junction (arrowheads) of a canine skin. Direct IF using fluoresceinlabeled anticanine IgG, bar = 40 mm.
of stratum basale keratinocytes (strong fluorescent detection), but they also bind to the lateral and apical aspects of these cells (weak fluorescent detection). A similar pattern of labeling has been noticed in human skin immunostained for human collagen XVII [21]. Recently, the isotype repertoire of antibasement membrane circulating autoantibodies was studied in five dogs with BP [22]. In these dogs, serum autoantibodies belonged predominantly to IgG1 (5 of 5, 100%), IgG4, IgM and IgE (3 of 5, 60%) or IgG3 (2 of 5, 40%) [22]. IgG2 autoantibodies were not detected. Indirect immunoelectron microscopy was performed with the serum of one dog and one pig with BP [12,15]. In these two animal subjects, IgG autoantibodies bound to hemidesmosomes of normal canine or human skin, respectively.
1391_C12.fm Page 207 Tuesday, November 18, 2003 5:13 PM
NATURAL BULLOUS PEMPHIGOID IN COMPANION ANIMALS
Figure 12.7
207
Indirect immuofluorescence microscoy of porcine BP: circulating IgG autoantibodies bind to antigens located at the epidermal side of induced clefts. Indirect IF using salt-split porcine skin, incubation of porcine serum followed by fluorescein-labeled antiporcine IgG, bar = 35 mm.
3. Immunoblotting and ELISA In 1995, the serum from one dog with BP was found to contain IgG autoantibodies that recognized a 180-kDa antigen that co-migrated with that targeted by IgG from a human patient with BP as well as antihuman collagen XVII antiserum [12]. In 2000, this 180-kDa antigen was found to represent the canine homologue of human collagen XVII (BP180, BPAG2) [16]. Furthermore, ELISA studies confirmed that canine BP IgG autoantibodies recognized the NC16A segment of human and canine collagen XVII [16] (T.O., unpublished observations, 2000). Recent experiments have provided preliminary evidence that IgG antibodies from dogs with BP also recognize antigenic epitopes at the carboxyl-terminus of the NC16A domain (T.O. and M.P. Marinkovich, unpublished observations, 2001). Similarly, serum IgG autoantibodies from two cats with BP bound to a protein of apparent molecular weight 180 kDa. This antigen migrated to the same position as that recognized by antihuman collagen XVII-NC16A polyclonal antiserum [13]. In ELISA studies using synthetic nonoverlapping peptide spanning the human NC16A segment of collagen XVII, these two cats with BP were found to have circulating IgG autoantibodies that targeted multiple epitopes within the human NC16A domain [13]. In two horses with BP, immunoblotting confirmed that serum IgG autoantibodies recognized a fusion protein of human collagen XVII segment NC16A [14]. Additionally, IgG autoantibodies from both horses were found to identify all synthetic peptides that spanned the human NC16A domain in ELISA studies [14]. In two pigs with BP, immunoblotting was performed using recombinant human collagen XVII ectodomain NC16A and the sera from both animals were found to contain IgG autoantibodies that recognized this molecule. Furthermore, ELISA tests confirmed that the IgG autoantibodies identified various epitopes within this segment of collagen XVII [15]. In summary, in all four animal species where BP has been identified with certainty, the sera from affected patients have been found to contain IgG autoantibodies that recognize a 180-kDa protein identified as collagen XVII. In all species, ELISA studies confirmed that multiple antigenic epitopes reside in the NC16A segment of this molecule.
1391_C12.fm Page 208 Tuesday, November 18, 2003 5:13 PM
208
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
D. Immunogenetics At this time, there is no relevant information on immunogenetic typing of animals with BP. Nonetheless, the porcine BP model provides evidence for genetic factors underlying the pathogenesis of this autoimmune blistering disease. Indeed, BP was recognized in inbred Yucatan minipigs obtained from one of the major suppliers of laboratory animals. In this line of pigs, BP lesions spontaneously developed in young animals, around the time of puberty, and then vesicles resolved following topical therapy [15].
VI. THERAPEUTIC RESPONSES The prognosis of BP appears to vary among animal species. In all dogs diagnosed for which information on outcome is available, complete remission was achieved with (five dogs) or without (one dog) treatment (T.O., unpublished data, 2002). Treatment was initiated with prednisone (1 mg/kg twice daily), prednisone combined with azathioprine (2 mg/kg once daily), or doxycycline (10 mg/kg once daily). In half of these dogs, treatment was discontinued after the lesions underwent complete remission, and blistering did not recur, even 1 year after treatment was stopped. Too few cases of feline BP have been identified to provide clinically relevant information on treatment and prognosis. Thus far, all three horses diagnosed with BP have been euthanized because of the extreme severity of their clinical signs. Such poor prognosis is in marked contrast with that of BP in other animal species and in humans. Finally, porcine BP appears to have a remarkably good prognosis. Indeed, the rapidly progressing cutaneous blistering resolves with mild-potency topical glucocorticoid cream, and lesions usually do not recur following initial treatment.
VII. EXPERT EXPERIENCE In cats, horses, and pigs with acquired tense skin vesiculation, the main differential diagnosis is that of an autoimmune subepidermal blistering dermatosis, with BP being the only entity recognized so far in this group of diseases. When dogs are presented with an acquired blistering skin disease that predominantly affects the skin, differential diagnoses should consist of BP, EBA, pemphigus vulgaris, vesicular cutaneous lupus erythematosus, and severe variants of the erythema multiforme/Stevens–Johnson syndrome spectrum. The final diagnosis is made from collation of clinical, histopathological, and immunological findings. We propose that the diagnosis of animal BP be made by satisfaction of all five criteria below: • Clinical examination: skin-predominant tense vesicular and erosive/ulcerative disease • Histopathology: microscopic subepidermal vesiculation, with variable inflammation • Direct immunofluorescence: basement membrane-binding autoantibodies or complement on lesional or perilesional skin • Indirect immunofluorescence: circulating autoantibodies targeting the epidermal side of salt-split epithelium • ELISA or immunoblotting: circulating autoantibodies targeting collagen XVII, especially the segment NC16A
1391_C12.fm Page 209 Tuesday, November 18, 2003 5:13 PM
NATURAL BULLOUS PEMPHIGOID IN COMPANION ANIMALS
209
VIII. LESSONS LEARNED The identification of spontaneously arising BP in various animal species provides relevant information on the comparative clinical, pathological, and immunological aspects of this most common autoimmune subepidermal blistering disease of human beings. Whereas human BP is a disease of the elderly [19], there is much variation in the age of onset of this dermatosis in animals. Indeed, BP affects pigs around the time of puberty [15], dogs during middle age (T.O., unpublished data, 2002), and horses during senescence [14]. In human individuals, HLA alleles have been shown to be overrepresented in patients with BP [23]. The recognition of this disease in inbred Yucatan minipigs [15] adds more credence to the importance of genetic factors in the development of this affection. The clinical phenotype of canine, feline, and porcine BP appears similar to that of the human counterpart [24]. In humans and these animals, vesicles arising from normal or erythematous skin will evolve into erosions, ulcers, and crusts, and scarring usually does not occur. In dogs and pigs, lesions appear to predominate on the trunk, as in humans [24]. In these three species, oral lesions are rarely found in subjects with BP. Without any treatment, or after short-term topical or systemic anti-inflammatory therapy, skin lesions can undergo spontaneous remission in humans, pigs, dogs, and cats with this disease [13,15,24,25]. In contrast, equine BP is markedly different from that seen in other species: the distribution of lesions is generalized, systemic signs are present, there is profound and severe oral involvement, and the prognosis is very poor with euthanasia being the final outcome. In humans, dogs, and pigs with BP, microscopic lesions are characterized by subepidermal vesiculation with granulocyte-rich inflammation [15,24,25]. Indeed, eosinophils — often degranulated — and neutrophils focally assemble in the superficial dermis of preblistered areas, and they infiltrate vesicles and the dermis beneath these lesions. Degranulated mast cells can be seen. The observation of activated (degranulated) eosinophils and mast cells in preblistered skin suggests that such cells could be involved in the mechanism of subepidermal vesiculation. In horses and cats with BP, however, dermal–epidermal separation occurs with minimal or no dermal inflammation [13,14]. This lack of visible inflammation implies a different mechanism of skin blistering in these two species. In spite of obvious interspecies clinical and histopathological differences in lesions of BP, there is remarkable homogeneity in the antigenic epitopes targeted by circulating autoantibodies. Indeed, in canine [12,16], feline [13], equine [14], and porcine [15] BP, serum IgG autoantibodies have been shown to target the same protein, collagen XVII, which is the second BP antigen of humans [26]. In animals with BP, limited epitope mapping studies have established the noncollagenous domain NC16A, a segment situated just outside of the basal keratinocyte membrane as containing major antigenic sites [13–16]. Of note is that this segment also harbors antigenic epitopes in human patients with BP [27–32]. Therefore, the NC16A domain, whose sequence is moderately conserved across animal species [16], must exhibit unique physicochemical properties to contain major antigenic epitopes in an autoimmune blistering disease affecting four different animal species as well as humans.
IX. CONCLUSION Current studies have confirmed the noticeable resemblance between canine and porcine BP with the human disease. This similarity can be found in both clinical and microscopic skin lesions as well as in immunological characteristics. Unfortunately, BP appears to represent a rare subset of autoimmune subepidermal blistering diseases in dogs, and the porcine variant has been identified
1391_C12.fm Page 210 Tuesday, November 18, 2003 5:13 PM
210
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
only in animals purchased from one supplier. In spite of the scarcity of this model, investigations of the porcine disease, with its unique juvenile onset and long-term remission, could provide extraordinary opportunity to study a genetically predisposed blistering autoimmune process. In cats and horses, the disease currently identified as BP is peculiar compared to that seen in other species. In cats, it is a disease with fairly mild phenotype in which vesicles occur with very few, if any, granulocytes. This observation alone is in marked contrast with the usual eosinophilrich feline inflammatory skin lesions. Equine BP is an unusually severe disease, with generalized skin lesions and profound mucosal involvement, as well as systemic signs. Subepidermal vesiculation typically occurs with minimal dermal inflammation. The prognosis is poor, with all cases diagnosed thus far having been euthanized for humane reasons. Further studies of the equine disease will be needed to search for explanations for such severe clinical signs and noninflammatory blister formation.
REFERENCES 1. Austin, V.H. and Maibach, H.I., Immunofluorescence testing in a bullous skin disease in a dog, J. Am. Vet. Med. Assn., 168, 322, 1976. 2. Kunkle, G., Goldschmidt, M.H., and Halliwell, R.E.W., Bullous pemphigoid in a dog: a case report with immunofluorescent findings, J. Am. Anim. Hosp. Assn., 14, 52, 1978. 3. Griffin, C.E. and McDonald, J.M., A case of bullous pemphigoid in a dog, J. Am. Anim. Hosp. Assn., 17, 105, 1981. 4. Turnwald, G.H., Ochoa, R., and Barta, O., Bullous pemphigoid refractory to recommended dosage of prednisolone in a dog, J. Am. Vet. Med. Assn., 179, 587, 1981. 5. White, S.D., Ihrke, P.J., and Stannard, A.A., Bullous pemphigoid in a dog: treatment with sixmercaptopurine, J. Am. Vet. Med. Assn., 185, 683, 1981. 6. Scott, D., Manning, T., and Lewis, R., Linear IgA dermatoses in the dog: bullous pemphigoid, discoid lupus erythematosus and a subcorneal pustular dermatitis., Cornell Vet., 72, 394, 1982. 7. Fadok, V.A. and Janney, E.H., Thrombocytopenia and hemorrhage associated with gold salt therapy for bullous pemphigoid in a dog, J. Am. Vet. Med. Assn., 181, 261, 1982. 8. Alhaidari, Z. and Ortonne, J.-P., La pemphigoide bulleuse canine: cas clinique, Point. Vet., 16, 41, 1984. 9. Fourrier, P., Cas dermatologique no. 15: pemphigoïde bulleuse chez un berger Allemand âgé de 5 ans. Essai de traitement par la dapsone, Prat. Med. Chir. Anim. Comp., 21, 381, 1986. 10. Dunn, K.A., What is your diagnosis? [bullous pemphigoid in a dog], J. Small Anim. Pract., 36, 146, 1995. 11. Scott, D.W. et al., Immune-mediated dermatoses in domestic animals: ten years after — Part I, Comp. Cont. Educ. Pract. Vet., 9, 424, 1987. 12. Iwasaki, T. et al., Canine bullous pemphigoid (BP) — identification of the 180 kD canine BP antigen by circulating autoantibodies, Vet. Pathol., 32, 387, 1995. 13. Olivry, T. et al., Novel feline autoimmune blistering disease resembling bullous pemphigoid in humans: IgG autoantibodies target the NC16A ectodomain of type XVII collagen (BP180 / BPAG2), Vet. Pathol., 136, 328, 1999. 14. Olivry, T. et al., Equine bullous pemphigoid IgG autoantibodies target linear epitopes in the NC16A ectodomain of collagen XVII (BP180, BPAG2), Vet. Immunol. Immunopathol., 73, 45, 2000. 15. Olivry, T. et al., A spontaneously arising porcine model of bullous pemphigoid, Arch. Dermatol. Res., 292, 37, 2000. 16. Xu, L. et al., Molecular cloning of canine bullous pemphigoid antigen 2 cDNA and immunomapping of NC16A domain by canine bullous pemphigoid autoantibodies, Biochim. Biophys. Acta, 1500, 97, 2000. 17. Mirsky, M.L., Singleton, W., and Olivry, T., ''Have you seen this?'' — Spontaneous cutaneous vesicular disease in Yucatan minipigs, Toxicol. Pathol., 28, 357, 2000. 18. Bernard, P. et al., Incidence and distribution of subepidermal autoimmune bullous skin diseases in three French regions, Arch. Dermatol., 131, 48, 1995.
1391_C12.fm Page 211 Tuesday, November 18, 2003 5:13 PM
NATURAL BULLOUS PEMPHIGOID IN COMPANION ANIMALS
211
19. Zillikens, D. et al., Incidence of autoimmune subepidermal blistering dermatoses in a region of central Germany, Arch. Dermatol., 131, 957, 1995. 20. Favrot, C. et al., Effect of substrates selection on indirect immunoflorescence testing of canine autoimmune subepidermal blistering diseases, Can. J. Vet. Res., 66, 26, 2002. 21. Kitajima, Y. et al., Internalization of the 180 kDa bullous pemphigoid antigen as immune complexes in basal keratinocytes: an important early event in blister formation in bullous pemphigoid, Br. J. Dermatol., 138, 71, 1998. 22. Favrot, C. et al., Immunofluorescent isotype determination of circulating autoantibodies in canine autoimmune subepidermal blistering dermatoses, Vet. Dermatol., 14, 23, 2003. 23. Delgado, J.C. et al., A common major histocompatibility complex class II allele HLA-DQB1 0301 is present in clinical variants of pemphigoid, Proc. Natl. Acad. Sci. U. S. A., 93, 8569, 1996. 24. Ghohestani, R.F. et al., Bullous pemphigoid: from the bedside to the research laboratory, Clin. Dermatol., 19, 690, 2001. 25. Olivry, T. and Chan, L.S., Spontaneous animal models of autoimmune blistering dermatoses, Clin. Dermatol., 19, 750, 2001. 26. Giudice, G.J., Emery, D.J., and Diaz, L.A., Cloning and primary structural analysis of the bullous pemphigoid autoantigen BP180, J. Invest. Dermatol., 99, 243, 1992. 27. Giudice, G.J. et al., Bullous pemphigoid and herpes gestationis autoantibodies recognize a common non-collagenous site on the BP180 ectodomain, J. Immunol., 154, 5742, 1993. 28. Matsumura, K. et al., The majority of bullous pemphigoid and herpes gestations serum samples react with the NC16a domain of the 180-kDa bullous pemphigoid antigen, Arch. Dermatol. Res., 288, 507, 1996. 29. Zillikens, D. et al., Tight clustering of extracellular BP180 epitopes recognized by bullous pemphigoid autoantibodies, J. Invest. Dermatol., 109, 573, 1997. 30. Zillikens, D. et al., A highly sensitive enzyme-linked immunosorbent assay for the detection of circulating anti-BP180 autoantibodies in patients with bullous pemphigoid, J. Invest. Dermatol., 109, 679, 1997. 31. Haase, C. et al., Detection of IgG autoantibodies in the sera of patients with bullous and gestational pemphigoid: ELISA studies utilizing a baculovirus-encoded form of bullous pemphigoid antigen 2, J. Invest. Dermatol., 110, 282, 1998. 32. Nakatani, C., Muramatsu, T., and Shirai, T., Immunoreactivity of bullous pemphigoid (BP) autoantibodies against the NC16A and C-terminal domains of the 180 kDa BP antigen (BP180): immunoblot analysis and enzyme-linked immunosorbent assay using BP180 recombinant proteins, Br. J. Dermatol., 139, 365, 1998.
1391_C12.fm Page 212 Tuesday, November 18, 2003 5:13 PM
1391_C13.fm Page 213 Tuesday, November 18, 2003 5:15 PM
CHAPTER
13
Experimental Mouse Model of Bullous Pemphigoid: Passive Transfer of Anti-BP180 Type XVII Collagen, Antibodies Zhi Liu and Luis A. Diaz
CONTENTS I. II. III. IV. V.
History ................................................................................................................................213 Animals ..............................................................................................................................214 Disease Induction...............................................................................................................214 Course of Disease ..............................................................................................................216 Assessment of Disease.......................................................................................................216 A. Clinical Manifestation ...............................................................................................216 B. Histopathological Examination .................................................................................216 C. Immunopathological Data .........................................................................................216 VI. Lessons Learned.................................................................................................................217 A. Role of Pathogenic Anti-BP180 Antibodies .............................................................217 B. Role of Complement .................................................................................................218 C. Role of Mast Cells.....................................................................................................218 D. Role of Neutrophils ...................................................................................................219 E. Role of Proteolytic Enzymes.....................................................................................220 F. Relevance of IgG Passive Transfer Model to Human BP ........................................220 G. Therapeutic Potential .................................................................................................220 VII. Conclusion..........................................................................................................................221 Acknowledgment............................................................................................................................221 References ......................................................................................................................................221
I. HISTORY In 1993, Liu et al. [1] at the Medical College of Wisconsin developed an animal model for bullous pemphigoid (BP) by passively transferring rabbit antimouse BP180 antibodies into neonatal BALB/c mice. This experimental BP model reproduces virtually all key immunopathological features of human BP [1]. Using the same approach, Yamamoto et al. [2] generated rabbit antibodies
0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
213
1391_C13.fm Page 214 Tuesday, November 18, 2003 5:15 PM
214
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
directed against the extracellular domain of hamster BP180 and these antibodies, when injected into neonatal hamsters, triggered BP-like subepidermal blisters in these animals.
II. ANIMALS The passive transfer model of BP was originally developed in neonatal BALB/c mice. Subsequently, several other strains, including C57BL/6J (B6), B10, CD1, and 129 have been tested and all of these strains tested thus far are susceptible to experimental BP. Mice at different ages (1 day old, 1 week old, and adult mice from 2 to 6 months old) show no difference in disease induction except that higher doses are needed for adult mice due to their greater body weight. For adult mice both males and females are equally sensitive to experimental BP.
III. DISEASE INDUCTION The antigen used to generate pathogenic rabbit antimouse BP180 is the largest noncollagen domain of extracellular portion of the molecule (referred to as NC14; Figure 13.1). In human BP, autoantibodies bind to the basement membrane zone (BMZ) and activate the complement [3]. These autoantibodies are directed against two major hemidesmosomal antigens of 230 kD (BP230 or BPAG1) and 180 kD (BP180, BPAG2, or type XVII collagen) [4–7]. BP230 is an intracellular protein that localizes to the hemidesmosomal plaque [8–10] and has significant homology with plectin and desmoplakins I and II [11–13]. In contrast, BP180 is a transmembrane protein with a type II orientation (Figure 13.1). Its amino-terminal region localizes to the intracellular hemidesmosomal plaque, while its carboxyl-terminal portion projects into the extracellular milieu of the BMZ [14–16]. The extracellular region consists of 15 collagen domains separated from one another by noncollagen sequences. The largest noncollagen domain of human BP180 is termed NC16A. Epitope mapping studies show that BP autoantibodies recognize multiple epitopes that cluster within NC16A of BP180 antigen [17,18]. The serum levels of autoantibodies to BP180 NC16A are correlated with the severity of BP [19,20]. BP EPITOPE
Collagen Domains
H 2N
COOH
BP EPITOPE
Figure 13.1
Human
KARVDELERIR RSILPYGDSMDRIE KDRLQGMAP
Mouse
K A R V E E L E KTK - - V L Y H D V Q M D K S N R D R L Q A E A P
: : : : . : : : .
.
.:
.
: : .
. .: : : : .
: :
Molecular structure of human and mouse BP180. A schematic representation of the structural organization of the human BP180 protein is shown at top. The arch designates the transmembrane domain. The gray oval designates the NC16A antigenic site recognized by BP autoantibodies. The COOH-terminal extracellular region is made up of 15 interrupted collagen-like domains (black rectangles). The box at the bottom shows the amino acid sequence alignment of the human and murine BP180 within the BP epitope. Identical residues are designated by double dots and conservative substitutions are marked by a single dot. An unusually high degree of sequence divergence is seen in the epitope region.
1391_C13.fm Page 215 Tuesday, November 18, 2003 5:15 PM
EXPERIMENTAL MOUSE MODEL OF BULLOUS PEMPHIGOID
215
Mouse BP180 has significant high homology with human BP180 with 80.6% identity and 86% similarity (Figure 13.1) [21]. The major difference between human and mouse BP180 is that mouse BP180 has 13 collagen and 14 noncollagen domains; hence mouse BP180 NC14A is equivalent to human BP180 NC16A. Another difference is that the well-defined BP immunodominant epitope on the human BP180 antigen is very poorly conserved in the mouse BP180. Only 3 of the 14 amino acid residues in this antigenic site are identical in these two species. This stark sequence difference in the BP epitope results in no immune cross-reactivity between human and murine BP180 antigens [1]. Antihuman BP180 antibodies react with human but not mouse BP180, whereas antimouse BP180 antibodies recognize mouse but not human BP180 (Figure 13.2).
A. Immunoblotting R306
R140
BP1
hBP180
mBP180
1 2
3 4
5
6
B. Indirect immunofluorescence
D
a
BP1
E
E
b Figure 13.2
R140
E
D
c
D
e
E
E
E
D
D
D
d
f
Mouse skin
Human skin
R306
Characterization of anti-BP180 antibody cross-species reactivity. (A) A rabbit antihuman BP180 NC16A (R306) antisera, rabbit antimouse BP180 NC14A (R140), and a human BP patient serum (BP1) were analyzed by immunoblotting against recombinant human BP180 (hBP180) (lanes 1, 3, and 5) and recombinant mouse BP180 (mBP180) (lanes 2, 4, and 6). Rabbit anti-hBP180 antibodies react with hBP180 (lane 1), but fail to cross-react with mBP180 (lane 2). Similarly, autoantibodies in BP1 react with hBP180 (lane 5), but not mBP180 (lane 6). Conversely, antimBP180 antibodies react with mBP180 (lane 4), but do not bind hBP180 (lane 3). (B) R306, R140, and BP1 were comparatively tested by indirect IF (IIF) using human (panels a, c, and e) or mouse (panels b, d, and f) skin sections. Rabbit anti-hBP180 IgG and human BP autoantibodies stain the basement membrane zone of the human (a and e) but not mouse skin (b and f). In contrast, rabbit anti-mBP180 IgG stain the basement membrane zone of mouse (d) but not human skin (c). E, epidermis; D, dermis; arrows point to skin BMZ.
1391_C13.fm Page 216 Tuesday, November 18, 2003 5:15 PM
216
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Anhalt et al. [22] and Roscoe et al. [23] are the first to use passive transfer animal models to demonstrate the pathogenic activity of antiepidermal autoantibodies associated with two autoimmune intraepidermal blistering diseases pemphigus vulgaris and pemphigus foliaceus (see Chapters 18 and 21). However, the very same approach failed to demonstrate the pathogenicity of BP autoantibodies due to the lack of cross-reactivity of BP autoantibodies with the mouse BP180 antigen [1,24,25]. As an alternative, we cloned the mouse BP180 NC14A region; recombinant mouse BP180 antigen was purified by affinity chromatograph. New Zealand white rabbits were immunized with the purified recombinant mouse BP180 antigen. The rabbit anti-mBP180 antibodies were isolated by 50% ammonium sulfate precipitation, protein G column, or antigen-specific affinity column, followed by extensive dialysis against phosphate-buffered saline (PBS). The rabbit antimouse BP180 antibodies were injected intradermally or intraperitoneally into neonatal BALB/c mice and induced experimental BP (see Chapter 9 for details). IV. COURSE OF DISEASE When neonatal mice (24 to 36 hours old) are injected with pathogenic antimouse BP180 antibodies, these animals develop extensive BP subepidermal blisters within 12 hours postinjection. The disease phenotype remains up to 68 hours without feeding the animals. Injected animals are routinely terminated for further examination. V. ASSESSMENT OF DISEASE A. Clinical Manifestation The skin of neonatal BALB/c mice given intraperitoneal or intradermal injections of pathogenic anti-mBP180 antibodies is markedly erythematous within 4 hours postinjection. Twenty-four hours after injection, the skin of the injected animals, upon gentle friction, develops persistent epidermal wrinkling, which produces the “epidermal detachment” sign (Figure 13.3). The extent of cutaneous disease is scored as follows: (-), no detectable skin disease; 1+, mild erythematous reaction with no evidence of the “epidermal detachment” sign; 2+, intense erythema and epidermal detachment sign involving 10 to 50% of the epidermis in localized areas; and 3+, intense erythema with frank epidermal detachment sign involving more than 50% of the epidermis [1]. B. Histopathological Examination Skin biopsies taken at the lesional site are fixed in 10% buffered formalin for at least 24 hours and histological sections are stained with hematoxylin and eosin. Histological examination of the lesional skin shows separation of the epidermis from the dermis producing a subepidermal vesicle (Figure 13.3) [1]. In most zones there are small numbers of inflammatory cells in the subepidermal clefts or underlying dermis. In focal zones, especially near the edges of the blisters, neutrophils are present in large numbers within the blister cavity and are scattered in smaller numbers in the nearby dermis. Inflammatory cell types include neutrophils, lymphocytes, and monocytes/macrophages [1,26]. Degranulating mast cells are present in the dermis [27]. Necrotic keratinocytes are only infrequently seen in the epidermis or roofs of vesicles and there is no evidence of vasculitis. C. Immunopathological Data Direct immunofluorescence analysis of the skin of neonatal BALB/c mice injected with pathogenic anti-mBP180 IgG usually shows in situ deposition of rabbit IgG and mouse C3 at the perilesional sites and much weaker or negative staining at the lesional sites (Figure 13.3) [1]. The
1391_C13.fm Page 217 Tuesday, November 18, 2003 5:15 PM
EXPERIMENTAL MOUSE MODEL OF BULLOUS PEMPHIGOID
217
Clinical exam
a IgG deposition
b C3 deposition
c H/E staining
d Figure 13.3
IgG passive transfer model of BP. Neonatal BALB/c mice are injected intradermally with rabbit antimouse BP180 IgG. After 24 hours, gentle friction elicits persistent epidermal wrinkling, producing the “epidermal detachment” sign (panel a). Direct immunofluorescence analysis shows deposition of rabbit anti-BP180 IgG (panel b), and murine C3 (panel c) at the basement membrane zone. Histological examination of lesional skin reveals dermal–epidermal junction separation with an inflammatory infiltrate (panel d). E, epidermis; D, dermis; V, vesicle; arrows, basal keratinocytes.
diseased mice have high circulating anti-BMZ titers when assayed by indirect immunofluorescence against normal neonatal mouse skin. Indirect immunofluorescence analysis with cell type-specific antibodies identify inflammatory cells in the lesional/perilesional skin sections. Flow cytometry analysis of the lesional skin of mice injected with pathogenic antibodies reveal that neutrophils are the predominant cell type, followed by macrophages, T cells, and B cells with minimal numbers of eosinophils (Figure 13.4) [26].
VI. LESSONS LEARNED Blister formation in BP was thought to be an IgG autoantibody-mediated inflammatory process. Using an in vitro organ culture system Gammon et al. [28] showed that dermal–epidermal separation depends on BP autoantibodies, complement, and leukocytes. In the IgG passive transfer model of BP, subepidermal blister formation is initiated by pathogenic anti-mBP180 antibodies, and requires complement activation and inflammatory cells, including neutrophils, macrophages, and mast cells (Figure 13.5) [26]. A. Role of Pathogenic Anti-BP180 Antibodies Subepidermal blistering in experimental BP is totally dependent on anti-mBP180 IgG. Rabbit anti-mBP180 IgG induces the BP disease phenotype and disease severity is directly corrected with the dose of pathogenic antibodies [1]. Pathogenic antibodies preabsorbed with mBP180 antigen
1391_C13.fm Page 218 Tuesday, November 18, 2003 5:15 PM
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Number of cells/skin section (x10-4)
218
Figure 13.4
60
Control Pathogenic IgG
**
50 15 ** 10 ** 5 0
*
PMN
Mφ
T
B
Eos
Role of inflammatory cells in IgG passive transfer model of BP. Neonatal C57BL/6J mice were injected intradermally with pathogenic anti-mBP180 IgG (black bars) or normal control IgG (gray bars). The skin sections at the IgG injection site were obtained 24 hours postinjection and processed to recover infiltrating cells. The various populations of inflammatory cells were identified by staining and flow cytometry. The data shown are the means and standard errors. *, p < 0.05 and **, p < 0.01, Student t-test for paired samples. PMN, neutrophils; Mf, macrophages; T, T lymphocytes; B, B lymphocytes; Eos, eosinophils.
are no longer able to trigger BP disease in mice [29]. Epitope mapping studies revealed that pathogenic anti-BP180 antibodies recognize a 9 to 12 amino acid stretch within the murine BP180 NC14A region of the antigen [29]. Significantly, this epitope overlaps the region of the human BP180 NC16A that contains the immunodominant epitopes recognized by human BP autoantibodies. B. Role of Complement Complement activation has been implicated in the pathogenesis of BP [30]. Autoantibodies from BP can fix complement in vitro and in vivo. C3 is often detected at the BMZ of the lesional/perilesional skin by direct IF [31,32]. Components of both the classical and alternative complement pathways have been detected at the BMZ of patients’ skin, including C1q, C3, C4, C5, C5-9 (membrane attack complex or MAC), factor B, factor H, and properdin [33–44]. In experimental BP, the critical role of complement activation in experimental BP is established by the following approaches: (1) C5-deficient mice are resistant to experimental BP; (2) BALB/c mice pretreated with cobra venom factor to deplete complement are resistant to experimental BP; (3) F(ab')2 fragments generated from the pathogenic anti-mBP180 IgG cannot induce subepidermal blisters in C5-sufficient mice; and (4) C5-deficient mice reconstituted with C5a become susceptible to experimental BP [45]. Further studies reveal that the major function of complement activation is to generate C5a, which in turn activates mast cells [27]. C. Role of Mast Cells Mast cells are present in the upper dermis of lesional areas in patients with BP. Mast cell degranulation is a feature of BP [46,47]. Chemoattractants from MCs, including eosinophilic/neutrophilic chemotactic factors and histamine, are present at high concentrations in BP blister fluids
1391_C13.fm Page 219 Tuesday, November 18, 2003 5:15 PM
EXPERIMENTAL MOUSE MODEL OF BULLOUS PEMPHIGOID
1
219
IgG binding
BK
α−BP180 IgG BP180 2
C’ activation
C3a, C5a
3
MC
4
PMN
5
BP Figure 13.5
MC activation
PMN infiltration and activation
Proteolysis of BMZ
Proposed mechanism of subepidermal blister formation in experimental BP/HG. Subepidermal blistering is an inflammatory process and includes the following steps: (1) anti-BP180 IgG binds to the pathogenic epitope of BP180 antigen in basal keratinocytes (BK); (2) the molecular interaction between BP180 antigen and anti-BP180 IgG activates complement system (C') to generate C3a and C5a; (3) C3a and/or C5a activate mast cell to degranulate leading to recruitment of neutrophils (PMN); (4) infiltrating PMN bind to BP180–anti-BP180 immune complex via the molecular interaction between Fc receptors on PMN and the Fc domain of anti-BP180 IgG and get activated; and (5) the activated PMN release proteolytic enzymes and reactive oxygen species that damage basement membrane leading to subepidermal blistering.
[48,49]. Extensive mast cell degranulation is also seen in the lesional skin of mice injected with pathogenic anti-mBP180 antibodies. Mast cell activation precedes neutrophil infiltration and inhibition of mast cell degranulation blocks neutrophil infiltration and subsequent blister formation. Furthermore, mast cell-deficient mice are resistant to experimental BP and mast cell-deficient mice reconstituted with mast cells restore the pathogenic activity of anti-mBP180 IgG. In addition, pathogenic anti-mBP180 antibodies also induce BP skin lesions in mast cell-deficient mice reconstituted with neutrophils, TNF-a, or IL-8. These results suggest that mast cells play a critical role in recruiting neutrophils [27]. D. Role of Neutrophils Neutrophil infiltration is a prerequisite for experimental BP, and disease severity is directly correlated to the number of infiltrating neutrophils [50]. Mice depleted of neutrophils are resistant to experimental BP. Blocking neutrophil infiltration abolishes subepidermal blistering [50]. Therefore, infiltrating neutrophils are the cells that directly cause tissue injury in the BMZ, leading to subepidermal blistering.
1391_C13.fm Page 220 Tuesday, November 18, 2003 5:15 PM
220
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
E. Role of Proteolytic Enzymes Infiltrating neutrophils, upon activation through molecular interaction between Fc of pathogenic anti-mBP180 IgG and Fc receptors on the cell surface of neutrophils, release several proteolytic enzymes including neutrophil elastase (NE) and gelatinase B (GB). Mice lacking neutrophil elastase or gelatinase B are resistant to experimental BP [51,52]. Although both gelatinase B and neutrophil elastase are capable of degrading the recombinant BP180 protein, only neutrophil elastase is directly involved in degradation of BP180 antigen, leading to dermal–epidermal separation in vivo and in the skin organ culture system [53,54]. Further dissection of this proteolytic event in experimental BP reveals a functional relationship between GB and NE; GB proteolytically inactivates a1proteinase inhibitor, the physiological inhibitor of NE. Unchecked NE then cleaves extracellular matrix proteins, including BP180 antigen, which results in dermal–epidermal junction (DEJ) separation [54]. F.
Relevance of IgG Passive Transfer Model to Human BP
Experimental BP reproduces key characteristics of human BP at the clinical, histological, and immunological levels [1]. Despite the similarities in the immunopathological features between the experimental model of BP and the human disease, there is one striking difference. The inflammatory infiltrate of early lesions in human BP shows large numbers of eosinophils. The histopathological findings in the lesional skin of majority of human BP patients are eosinophil-rich with some patients showing neutrophil-rich or pauci-inflammatory pemphigoid blisters. Therefore, BP blisters may be initiated and sustained by multiple immunopathological mechanisms, some of which require only pathogenic antibodies and others depend on both pathogenic antibodies and inflammatory cells (eosinophils and/or neutrophils). In the IgG passive transfer mouse model triggered by a welldefined IgG preparation, however, neutrophils are the predominant inflammatory cell type. Timecourse studies did not uncover signs of eosinophil recruitment into the injection site of the mice up to 48 hours after passive transfer of pathogenic anti-mBP180 IgG, despite extensive subepidermal blistering observed by 12 hours postinjection. Therefore, it is quite clear that in experimental mouse model of BP, eosinophils do not play an important role, at least in the initial stages of subepidermal blistering. Although whether eosinophils are pathogenically relevant or just innocent bystanders in human BP remains to be determined, recent studies suggest that neutrophils may be the disease-causing inflammatory cells in human BP. In vitro dermal–epidermal junction separation induced by human BP autoantibodies specific for BP180NC16A depends on neutrophils [55]. This study [55] confirms findings by Gammon et al. [28] 2 decades ago, who showed that BP autoantibodies induce DEJ separation in human skin sections only in the presence of both leukocytes (mostly neutrophils) and complement [28]. In addition, human BP blister fluid has high levels of both neutrophil elastase and gelatinase B, but BP180 degradation by blister fluid depends on neutrophil elastase activity [56]. These results confirm the findings from experimental BP and strongly suggest that neutrophil elastase plays a key role in direct cleavage of BP180 and subepidermal blister formation in human BP. G. Therapeutic Potential Systematic dissecting of experimental BP has revealed that subepidermal blister formation triggered by anti-BP180 antibodies is an inflammatory process that involves multiple steps. This disease cascade includes molecular interaction between anti-BP180 IgG and its target, complement activation, mast cell degranulation, neutrophil infiltration and activation, and proteolytic event. Therefore, blocking any one of these steps can block subepidermal blistering. We have demonstrated that BP disease in mice can be either completely abolished or markedly reduced by blocking C5a
1391_C13.fm Page 221 Tuesday, November 18, 2003 5:15 PM
EXPERIMENTAL MOUSE MODEL OF BULLOUS PEMPHIGOID
221
activity, blocking mast cell degranulation, or inhibiting activities of neutrophil elastase. This BP model should be very useful in testing new therapeutic strategies.
VII. CONCLUSION Recent experimental evidence strongly suggests that human BP and mouse BP share not only a common disease phenotype, but also a common underlying immunopathogenesis. This model has proved to be very useful in dissecting the anti-BP180, IgG-mediated inflammatory cascade in BP and could be used to test new therapeutic strategies for BP. Findings from the IgG passive transfer model of BP may also have significant implications for other autoimmune subepidermal blistering diseases which also have an anti-BP180 immune response. These diseases include cicatricial pemphigoid, herpes gestationis, linear IgA bullous dermatosis, and lichen planus pemphigoides [57–60].
ACKNOWLEDGMENT This work was supported by U.S. Public Health Service grants R01 AI40768 (Z.L.) and R01 AR32599 and R37 AR32081 (L.A.D.).
REFERENCES 1. Liu, Z. et al., A passive transfer model of the organ-specific autoimmune disease, bullous pemphigoid, using antibodies generated against the hemidesmosomal antigen, BP180, J. Clin. Invest., 92, 2480, 1993. 2. Yamamoto, K. et al., Cloning of hamster type XVII collagen cDNA, and pathogenesis of anti-type XVII collagen antibody and complement in hamster bullous pemphigoid, J. Invest. Dermatol., 118, 485, 2002. 3. Jordon, R.E. et al., Basement zone antibodies in bullous pemphigoid, J. A. M. A., 200, 751, 1967. 4. Stanley, J.R. et al., Characterization of bullous pemphigoid antigen: a unique basement membrane protein of stratified epithelia, Cell, 24, 897-903, 1981. 5. Stanley, J.R., Woodley, D.T., and Katz, S.I., Identification and partial characterization of pemphigoid antigen extracted from normal human skin, J. Invest. Dermatol., 82, 108, 1984. 6. Mutasim, D.F. et al., A pool of bullous pemphigoid antigen(s) is intracellular and associated with the basal cell cytoskeleton-hemidesmosome complex, J. Invest. Dermatol., 84, 47, 1985. 7. Labib, R.S. et al., Molecular heterogeneity of bullous pemphigoid antigens as detected by immunoblotting, J. Immunol., 136, 1231, 1986. 8. Klatte, D.H. et al., Immunochemical characterization of three components of the hemidesmosome and their expression in cultured epithelial cells, J. Cell. Biol., 109, 3377, 1989. 9. Tanaka, T. et al., Production of rabbit antibodies against carboxy-terminal epitopes encoded by bullous pemphigoid cDNA, J. Invest. Dermatol., 94, 617, 1990. 10. Ishiko, A. et al., Human autoantibodies against the 230-kD bullous pemphigoid antigen (BPAG1) bind only to the intracellular domain of the hemidesmosome, whereas those against the 180-kD bullous pemphigoid antigen (BPAG2) bind along the plasma membrane of the hemidesmosome in normal human and swine skin, J. Clin. Invest., 91, 1608, 1993. 11. Tanaka, T. et al., Comparison of molecularly cloned bullous pemphigoid antigen to desmoplakin I confirms that they define a new family of cell adhesion junction plaque proteins, J. Biol. Chem., 266, 12555, 1991. 12. Sawamura, D. et al., Human bullous pemphigoid antigen (BPAG1). Amino acid sequences deduced from cloned cDNAs predict biologically important peptide segments and protein domains, J. Biol. Chem., 266, 17784, 1991.
1391_C13.fm Page 222 Tuesday, November 18, 2003 5:15 PM
222
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
13. Green, K.J. et al., Comparative structural analysis of desmoplakin, bullous pemphigoid antigen and plectin: members of a new gene family involved in organization of intermediate filaments, Int. J. Macromol., 14, 145, 1992. 14. Giudice, G.J., Emery, D.J., and Diaz, L.A., Cloning and primary structural analysis of the bullous pemphigoid autoantigen, BP-180, J. Invest. Dermatol., 99, 243, 1992. 15. Hopkinson, S.B., Riddelle, K.S., and Jones, J.C.R., Cytoplasmic domain of the 180-kD bullous pemphigoid antigen, a hemidesmosomal component: molecular and cell biologic characterization, J. Invest. Dermatol., 99, 264, 1992. 16. Diaz, L.A. et al., Isolation of a human epidermal cNA corresponding to the 180-kD autoantigen recognized by bullous pemphigoid and herpes gestationis sera. Immunolocalization of this protein to the hemidesmosome, J. Clin. Invest., 86, 1088, 1990. 17. Giudice, G.J. et al., Bullous pemphigoid and herpes gestationis autoantibodies recognize a common non-collagenous site on the BP180 ectodomain, J. Immunol., 151, 5742, 1993. 18. Zillikens, D. et al., Tight clustering of extracellular BP180 epitopes recognized by bullous pemphigoid autoantibodies, J. Invest. Dermatol., 109, 573, 1997. 19. Haase, C. et al., Detection of IgG autoantibodies in the sera of patients with bullous and gestational pemphigoid: ELISA studies utilizing a baculovirus-encoded form of bullous pemphigoid antigen 2, J. Invest. Dermatol., 110, 282, 1998. 20. Dopp, R. et al., IgG4 and IgE are the major immunoglobulins targeting the NC16A domain of BP180 in bullous pemphigoid: serum levels of these immunoglobulins reflect disease activity, J. Am. Acad. Dermatol. 42, 577, 2000. 21. Li, K. et al., Cloning of type XVII collagen. Complementary and genomic DNA sequences of mouse 180-kilodalton bullous pemphigoid antigen (BPAG2) predict an interrupted collagenous domain, a transmembrane segment, and unusual features in the 5'-end of the gene and the 3'-untranslated region of the mRNA, J. Biol. Chem., 268, 8825, 1993. 22. Anhalt, G.J. et al., Induction of pemphigus in neonatal mice by passive transfer of IgG from patients with the disease, N. Engl. J. Med., 306, 1189, 1982. 23. Roscoe, J.T. et al., Brazilian pemphigus foliaceus autoantibodies are pathogenic to BALB/c mice by passive transfer, J. Invest. Dermatol. 85, 538, 1985. 24. Anhalt, G.J. and Diaz, L.A., Animal models for bullous pemphigoid, Clin. Dermatol., 5, 117, 1987. 25. Sams, W.M. Jr. and Gleich, G.J., Failure to transfer bullous pemphigoid with serum of patients, Proc. Soc. Exp. Biol. Med., 136, 1027, 1971. 26. Chen, R. et al., Macrophages, but not T and B lymphocytes are critical for subepidermal blister formation in experimental bullous pemphigoid: macrophage-mediated neutrophil infiltration depends on mast cell activation, J. Immunol., 169, 3987, 2002. 27. Chen, R. et al., Mast cells play a key role on neutrophil recruitment in experimental bullous pemphigoid, J. Clin. Invest., 108, 1151, 2001. 28. Gammon, W.R. et al., An in vitro model of immune complex-mediated basement membrane zone separation caused by pemphigoid antibodies, leukocytes, and complement, J. Invest. Dermatol., 78, 285, 1982. 29. Liu, Z. et al., Molecular mapping of a pathogenically relevant BP180 epitope associated with experimentally induced murine bullous pemphigoid, J. Immunol. 155, 5449, 1995. 30. Jordon, R.E., Kawana, S., and Fritz, K.A., Immunopathologic mechanisms in pemphigus and bullous pemphigoid, J. Invest. Dermatol., 85, 72s, 1985. 31. Chorzelski, T.P. and Cormane, R.H., The presence of complement bound in vivo in the skin of patients with pemphigoid, Dermatologica, 137, 134, 1968. 32. Provost, T.T. and Tomasi, T.B. Jr., Evidence for complement activation via the alternative pathway in skin diseases. I. Herpes gestationis, systemic lupus erythematosis, and bullous pemphigoid, J. Clin. Invest., 52:1779, 1973. 33. Jordon, R.E. et al., The complement system in bullous pemphigoid. I. Complement and component levels in sera and blister fluids, J. Clin. Invest., 52, 1207, 1973. 34. Provost, T.T. and Tomasi, T.B. Jr., Immunopathology of bullous pemphigoid: basement membrane deposition of IgE, alternate pathway components and fibrin, Clin. Exp. Immunol., 18, 193, 1974. 35. Jordon, R.E. et al., The complement system in bullous pemphigoid. II. Immunofluorescent evidence for both classical and alternate pathway activation, Clin. Immunol. Immunopathol., 3, 307, 1975.
1391_C13.fm Page 223 Tuesday, November 18, 2003 5:15 PM
EXPERIMENTAL MOUSE MODEL OF BULLOUS PEMPHIGOID
223
36. Jordon, R.E., Nordby, J.M., and Milstein, H., The complement system in bullous pemphigoid. III. Fixation of C1q and C4 by pemphigoid antibody, J. Lab. Clin. Med., 86, 733, 1975. 37. Jordon, R.E., Complement activation in bullous skin diseases, J. Invest. Dermatol., 65, 162, 1975. 38. Jordon, R.E. et al., The immunopathology of herpes gestationis. Immunofluorescence studies and characterization of the “HP factor,” J. Clin. Invest., 57, 1426, 1976. 39. Diaz-Perez, J.L. and Jordon, R.E., The complement system in bullous pemphigoid. IV. Chemotactic activity in blister fluid, Clin. Immunol. Immunopathol., 5, 360, 1976. 40. Carlo, J.R. et al., Demonstration of the complement regulating protein b1H in skin biopsies from patients with bullous pemphigoid, J. Invest. Dermatol., 73, 551, 1979. 41. Lee, C.W. and Jordon, R.E., The complement system in bullous pemphigoid: VII. Fixation of the regulatory protein 1H globulin by pemphigoid antibody, J. Invest. Dermatol., 75, 465, 1980. 42. Gammon, W.R., Ruddy, S., and Sams, W.M. Jr., Relationship of b1H globulin and cleavage fragments of the 3rd component of complement in the skin of patients with BP and DH, Clin. Immunol. Immunopathol., 20, 21, 1981. 43. Dahl, M.V. et al., Deposition of the membrane attack complex of complement in bullous pemphigoid, J. Invest. Dermatol., 82, 132, 1984. 44. Jordon, R.E., Xia, P., and Geoghegan, W.D., Bullous pemphigoid autoantibodies reactive with intracellular basal keratinocyte antigens: studies of subclass distribution and complement activation, J. Clin. Immunol., 12, 163, 1992. 45. Liu, Z. et al., The role of complement in experimental bullous pemphigoid, J. Clin. Invest., 95, 1539, 1995. 46. Wintroub, B.U. et al., Morphologic and functional evidence for release of mast-cell products in bullous pemphigoid, N. Engl. J. Med., 298, 417, 1978. 47. Dvorak, A.M. et al., Bullous pemphigoid, an ultrastructural study of the inflammatory response: eosinophil, basophil and mast granule changes in multiple biopsies from one patient, J. Invest. Dermatol., 78, 91, 1982. 48. Baba, T. et al., An eosinophil chemotactic factor present in blister fluids of bullous pemphigoid patients, J. Immunol., 116, 112, 1976. 49. Katayama, I., Doi, T., and Nishioka, K., High histamine level in the blister fluid of bullous pemphigoid, Arch. Dermatol. Res., 276, 126, 1984. 50. Liu, Z. et al., A major role for neutrophils in experimental bullous pemphigoid, J. Clin. Invest., 100, 1256, 1997. 51. Liu, Z. et al., Gelatinase B-deficient mice are resistant to experimental BP, J. Exp. Med., 188, 475, 1998. 52. Liu, Z. et al., Neutrophil elastase plays a direct role in dermal-epidermal junction separation in experimental bullous pemphigoid, J. Clin. Invest. 105, 113, 2000. 53. Ståhle-Bäckdahl, M. et al., 92-kD gelatinase is produced by eosinophils at the site of blister formation in bullous pemphigoid and cleaves the extracellular domain of recombinant 180-kD bullous pemphigoid autoantigen, J. Clin. Invest., 93, 2022, 1994. 54. Liu, Z. et al., The serpin alpha1-proteinase inhibitor is a critical substrate for gelatinase B/MMP-9 in vivo, Cell, 102, 647, 2000. 55. Sitaru, C. et al., Autoantibodies to bullous pemphigoid antigen 180 induce dermal-epidermal separation in cryosections of human skin, J. Invest. Dermatol., 118, 664, 2002. 56. Verraes, S. et al., Respective contribution of neutrophil elastase and matrix metalloproteinase 9 in the degradation of BP180 (type XVII collagen) in human bullous pemphigoid, J. Invest. Dermatol., 117, 1091, 2001. 57. Morrison, L.H. et al., Herpes gestationis autoantibodies recognize a 180-kD human epidermal antigen, J. Clin. Invest., 81, 2023, 1988. 58. Bernard, P. et al., The major cicatricial pemphigoid antigen is a 180-kD protein that shows immunologic cross-reactivities with the bullous pemphigoid antigen, J. Invest. Dermatol., 99, 174, 1992. 59. Tamada, Y. et al., Lichen planus pemphigoides: identification of 180 kD hemidesmosome antigen, J. Am. Acad. Dermatol., 32, 883, 1995. 60. Zone, J.J. et al., The 97 kDa linear IgA bullous disease antigen is identical to a portion of the extracellular domain of the 180 kDa bullous pemphigoid antigen, BPAg2, J. Invest. Dermatol., 110, 207, 1998.
1391_C13.fm Page 224 Tuesday, November 18, 2003 5:15 PM
1391_C14.fm Page 225 Tuesday, November 18, 2003 5:17 PM
SECTION
B
Epidermolysis Bullosa Acquisita
1391_C14.fm Page 226 Tuesday, November 18, 2003 5:17 PM
1391_C14.fm Page 227 Tuesday, November 18, 2003 5:17 PM
CHAPTER
14
Spontaneous Canine Model of Epidermolysis Bullosa Acquisita Thierry Olivry
CONTENTS I. II. III. IV. V.
History ................................................................................................................................227 Animals ..............................................................................................................................228 Epidemiology .....................................................................................................................228 Course of Disease ..............................................................................................................228 Assessment of Disease.......................................................................................................229 A. Clinical Manifestation ...............................................................................................229 1. Generalized Inflammatory Phenotype .................................................................229 2. Localized Phenotype............................................................................................230 B. Histopathological Examination .................................................................................230 C. Immunopathological Data .........................................................................................231 1. Direct Immunofluorescence (IF) Microscopy .....................................................231 2. Indirect Immunofluorescence and Immunoelectron Microscopy .......................232 3. Immunoblotting and ELISA................................................................................232 D. Immunogenetics.........................................................................................................233 VI. Therapeutic Responses.......................................................................................................234 VII. Expert Experience ..............................................................................................................234 VIII. Lessons Learned.................................................................................................................234 IX. Conclusion..........................................................................................................................236 References ......................................................................................................................................236
I. HISTORY Spontaneously arising autoimmune subepidermal blistering dermatoses have been recognized in dogs since 1976 [1]. Until 1995, immunological investigations on antigens targeted by autoantibodies were restricted to direct and indirect immunofluorescence (IF) methods, and all patients affected with such diseases were given the diagnosis of bullous pemphigoid (BP). After Iwasaki et al. [2] individualized canine BP based on immunoblotting methods [2], efforts were made to
0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
227
1391_C14.fm Page 228 Tuesday, November 18, 2003 5:17 PM
228
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
separate entities based on clinical, histopathological, and immunological characteristics. In 1998, canine epidermolysis bullosa acquisita (EBA) was recognized in a young Great Dane exhibiting a generalized inflammatory blistering skin disease [3]. Two years later, a localized variant of canine EBA was reported in a German shorthaired pointer [4]. In fact, accounts of dogs with clinical phenotypes very similar to that seen in the Great Dane with inflammatory EBA were published 20 years ago under the denomination of BP [5–7]. It is likely, however, that these three patients were affected with EBA instead of BP since the lesion distribution and histopathology were more consistent with the former than the latter. Presently, the inflammatory form of EBA is recognized as one of the most common autoimmune subepidermal blistering dermatoses identified in dogs [8]. A recent case study of 12 dogs with EBA has shed some light on the clinical characteristics and outcome of this canine autoimmune disease [9].
II. ANIMALS The recent case study of 12 dogs with EBA [9] provided limited information on the distinct features of patients that developed the disease. Dogs with EBA belonged to seven different breeds, but remarkably, 6 of the 12 dogs (50%) were Great Danes. Such high representation of a single breed indicates likely genetic predisposition. There were eight males and four females, including both intact or castrated/spayed animals, and this proportion yielded a male-to-female ratio of 2 to 1. The age of onset of skin lesions was surprisingly young (median: 1 year; range: 6 months to 8 years) with eight patients having developed the disease by 15 months of age, an age corresponding to young canine adulthood.
III. EPIDEMIOLOGY At the time of this writing (fall 2002), there have been only two published descriptions of dogs with immunologically proven EBA [3,4]. Our unpublished case study of 12 canine patients [9] was assembled from dogs seen by veterinarians across North America between 1994 and 2002. Unfortunately, because of the varied origin of the subjects, an estimation of prevalence and incidence could not be made. In spite of being a rare disease, EBA is the diagnosis given to 25% of dogs with blistering skin diseases associated with antibasement membrane autoantibodies [8]. Such proportion is ten times higher than that reported for humans [10,11].
IV. COURSE OF DISEASE As stated in a preceding section, canine EBA usually affects young adult dogs, with two-thirds of subjects developing lesions by 15 months of age. In most patients, skin lesions progress very rapidly, thus prompting examination by veterinarians within 2 weeks after the appearance of the first vesicles. In a recent case study [9], 11 of 12 dogs with EBA exhibited a moderate to severe form of the disease associated with systemic signs (generalized inflammatory EBA), while in one dog a mild localized phenotype was observed [4]. Dogs affected with generalized inflammatory EBA usually exhibit constitutional signs that consist of lethargy and fever. Lymphadenomegaly is common. Severe oral involvement will result in halitosis, hypersalivation, and anorexia. Canine generalized inflammatory EBA is a disease with variable prognosis. Approximately 50% of the patients will be euthanized at their owner’s request, because of quality-of-life concerns following inappropriate response to immunosuppressive treatment protocols.
1391_C14.fm Page 229 Tuesday, November 18, 2003 5:17 PM
SPONTANEOUS CANINE MODEL OF EPIDERMOLYSIS BULLOSA ACQUISITA
229
Figure 14.1
Clinical phenotype of canine generalized inflammatory EBA: vesicles arise from erythematous and urticarial patches.
Figure 14.2
Clinical presentation of canine generalized inflammatory EBA: severe oral ulceration results in anorexia and hypersalivation. (Courtesy of Al W. Sears.)
V. ASSESSMENT OF DISEASE A. Clinical Manifestation 1. Generalized Inflammatory Phenotype In this subset of canine EBA, erythematous and urticarial patches develop on the face, axillae, abdomen, and groin (Figure 14.1). These lesions progress rapidly into transient tense clear or hemorrhagic vesicles (Figure 14.1) or pustules that rupture rapidly and evolve into widespread, often confluent ulceration. Oral epithelium sloughing is found in all dogs (Figure 14.2). Other commonly affected glabrous skin sites include the nasal planum (nose pad) and ears. Skin ulceration is most prominent in areas of friction such as axillae and groin. Footpad involvement, characterized
1391_C14.fm Page 230 Tuesday, November 18, 2003 5:17 PM
230
Figure 14.3
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Clinical features of canine generalized inflammatory EBA: severe vesiculation of the footpads results in rapid sloughing of the epithelium. At left, early lesion; at right, lesion 1 week later.
by lifting of the epithelium followed by ulceration, is present in three fourths of patients (Figure 14.3). As stated above, in canine patients affected with this subset of EBA, there is usually accompanying hyperthermia, lethargy, and depression. Staphylococcal bacteremia can be seen as a result of extensive skin and mucosal ulceration. Anemia and thrombocytopenia have been observed in some subjects. 2. Localized Phenotype In one canine patient, skin lesions exhibited a localized pattern that resembled “Brunsting– Perry” EBA in humans [4]. In this dog, initial lesions reportedly were scattered on the head and trunk and had rapidly decreased in severity following a short course of anti-inflammatory doses of oral glucocorticoids. At the time of presentation to the specialist, vesicles, ulcers, and scars were restricted to the concave aspect of the ear pinnae. There were no systemic signs associated with this mild phenotype. B. Histopathological Examination The microscopic lesions of EBA in dogs appear similar in both generalized and localized forms of the disease [3,4]. Subepidermal blistering without intravesicular inflammatory cells, but often containing red blood cells, can be found in almost all patients (Figure 14.4). In all dogs, neutrophils are also detected at the dermoepidermal interface and result in subepithelial abscesses (Figure 14.5). Superficial dermal or intravesicular eosinophils are found in low numbers in one third of dogs with EBA — a marked difference with canine BP in which prominent vesicular eosinophilia usually is detected. In most dogs with EBA, mononuclear cells with dendritic cell characteristics assemble in the superficial dermis. In old lesions, the epidermis undergoes necrosis and ulceration ultimately occurs. Immunostaining of paraffin-embedded sections of blistered skin with collagen IV antibodies has proven very useful for diagnosis of EBA in dogs. Indeed, this entity is the only recognized canine autoimmune subepidermal blistering dermatosis in which cleft has been found to occur below collagen IV in the lamina densa of the epidermal basement membrane [3,4]. This technique could represent, therefore, a rapid diagnostic test for EBA in the canine species.
1391_C14.fm Page 231 Tuesday, November 18, 2003 5:17 PM
SPONTANEOUS CANINE MODEL OF EPIDERMOLYSIS BULLOSA ACQUISITA
231
Figure 14.4
Histopathological findings of canine generalized inflammatory EBA: tense vesicles without inflammation occur in most patients. Hematoxylin-Eosin, bar = 700 mm.
Figure 14.5
Histopathological findings in canine generalized inflammatory EBA: neutrophil accumulation in the superficial dermis often results in subepidermal abscess formation. Hematoxylin-Eosin, bar = 30 mm.
C. Immunopathological Data 1. Direct Immunofluorescence (IF) Microscopy Deposition of basement membrane-bound immunoglobulins or complement has been visualized by direct IF testing of lesional skin biopsy specimens in greater than 80% of dogs with EBA [9]. IgG represents the most common immunoglobulin isotype detected (Figure 14.6) [9]. IgA, IgM, and the activated complement C3 fraction are found in less than 30% of subjects. In dogs with EBA, the basement membrane deposit of IgG exhibits a distinct pattern, as the fluorescent band is usually intense, continuous, and thicker than that seen in other canine autoimmune blistering diseases (AIBD). In blistered skin, IgG usually segregates with the epidermis or dermis, and the deposit is often detected within basement membrane remnants on the floor or inside subepidermal vesicles.
1391_C14.fm Page 232 Tuesday, November 18, 2003 5:17 PM
232
Figure 14.6
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Direct immunofluorescence microscopy of canine generalized inflammatory EBA: IgG deposits can be visualized at the floor of microscopic vesicles around hair follicles (arrowhead). Direct IF, using fluorescein-labeled anticanine IgG, bar = 50 mm.
2. Indirect Immunofluorescence and Immunoelectron Microscopy Using the indirect IF method performed on canine gingival substrate, IgG autoantibodies can be detected in greater than 80% of dogs with EBA [9]. Furthermore, the sensitivity of autoantibody detection can be improved with the use of salt-split canine oral gingival sections [12]. With such substrate, anti-basement membrane IgG autoantibodies (median titer 1:250) have been detected at the dermal side of salt-split clefts in all dogs with EBA (Figure 14.7) [9,13]. In rare patients, epidermal-binding autoantibodies can be found as well. The predominant isotypes of circulating IgG autoantibodies are IgG1 (median titer: 1:250) and IgG4 (median titer: 1:25) [13]. Low titers of IgG2 and IgG3 autoantibodies also can be observed in some patients [13]. In contrast, basement membranespecific autoantibodies of IgA, IgM, and IgE classes are rarely found in dogs with EBA [13]. Indirect immunogold electron microscopy, performed with the serum of one dog, has revealed that IgG autoantibodies bind to the lower part of anchoring fibrils in the sublamina densa (Figure 14.8) [3]. 3. Immunoblotting and ELISA Using immunoblotting and proteins extracted from canine dermis, IgG and IgA autoantibodies were found to recognize two antigen doublets of 250/290 and 125/145 kDa in one dog with EBA [3]. These doublets were suspected to represent full-length and NC1 segments of canine collagen VII, respectively. Because the sequence of the NC1 domain of canine collagen VII is highly homologous to that of its human counterpart, immunoblotting and/or ELISA performed with recombinant human NC1 have been used to confirm the identity of the canine EBA autoantigen. Indeed, circulating IgG autoantibodies were detected that bound recombinant human collagen VII-NC1 in all dogs with EBA [9]. In 3 of these 12 dogs, IgG autoantibodies also recognized recombinant human NC2, a segment of collagen VII removed during the assembly of anchoring
1391_C14.fm Page 233 Tuesday, November 18, 2003 5:17 PM
SPONTANEOUS CANINE MODEL OF EPIDERMOLYSIS BULLOSA ACQUISITA
233
Figure 14.7
Indirect immunofluorescence microscopy of canine generalized inflammatory EBA: circulating IgG autoantibodies recognize antigens located at the floor of salt-split induced clefts (arrowhead). Indirect IF, incubating canine serum with salt-split canine gingiva, followed by fluorescein-labeled anticanine IgG, bar = 50 mm.
Figure 14.8
Canine generalized inflammatory EBA: circulating IgG autoantibodies recognize antigens at the lower portion of anchoring fibrils in the sublamina densa (arrowhead). Indirect immunogold electron microscopy using canine gingiva as substrate. AF, anchoring fibrils; CF, collagen fiber; HD, hemidesmosome; KF, keratin filament; LD, lamina densa.
fibrils. Whether autoantibodies also bind to the collagenous triple helix rod domain of collagen VII has not been tested at this time. D. Immunogenetics Presently, there is no information on immunogenetic typing of dogs with EBA. Nevertheless, it is suspected that genetic factors strongly underlie the pathogenesis of canine generalized inflammatory EBA. Indeed, more than half of the dogs affected with this common subset of EBA belong to a single breed (Great Danes), a breed that seems to be rarely affected with other autoimmune blistering skin diseases such as pemphigoid or pemphigus variants. Other factors suggesting a genetic predisposition for this breed are a very young age of blister development and the discovery of two dogs of the same line with blistering skin lesions, one of them diagnosed as EBA. Such genetic predisposition for immune-mediated skin diseases is commonly seen in the canine species,
1391_C14.fm Page 234 Tuesday, November 18, 2003 5:17 PM
234
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
as many individuals descend from a few dogs recognized as “breed champions.” Such a limited historical gene pool is likely to result in the sharing of restricted sets of major histocompatibility complex molecules, or it will lead to the vertical spread of EBA-predisposing gene mutations.
VI. THERAPEUTIC RESPONSES Our recent case study provided limited insight in the outcome of canine inflammatory EBA [9]. In five of ten dogs for which response to treatment was known, the severity of skin lesions and/or lack of response to immunosuppression resulted in euthanasia for humane reasons. In four other dogs, complete remission was achieved after induction of treatment with oral prednisone (1 to 2 mg/kg twice daily) with or without azathioprine (2 mg/kg once daily). In one patient, the addition of colchicine resulted in faster lesion remission. In some dogs, dapsone was added to immunosuppressive drugs, but it appeared to provide limited benefit. After complete remission was obtained with treatment induction, the dose of prednisone and/or its frequency of administration were decreased. All drugs were eventually discontinued in three dogs, and a relapse has not occurred at least 1 year after drug withdrawal.
VII. EXPERT EXPERIENCE When dogs are presented with an acquired blistering skin disease that affects predominantly the skin, differential diagnoses will consist principally of BP, EBA, pemphigus vulgaris, and paraneoplastic pemphigus, vesicular cutaneous lupus erythematosus, and severe variants of the erythema multiforme/Stevens–Johnson syndrome spectrum. The final diagnosis will be made from collation of clinical, histopathological, and immunological findings. We propose that the diagnosis of canine EBA be made by satisfaction of all four criteria below • Clinical examination: skin-predominant vesicular and ulcerative disease • Histopathology: microscopic subepidermal vesiculation on histopathological examination of lesional skin biopsy specimens • Immunofluorescence: basement membrane-bound autoantibodies (direct IF) AND/OR circulating autoantibodies targeting the dermal side of salt-split epithelium (indirect IF) • ELISA or immunoblotting: circulating autoantibodies targeting collagen VII
VIII. LESSONS LEARNED The recognition of canine EBA as an entity separate from BP was an important step that permitted veterinary dermatologists to differentiate these two diseases based on clinical signs and treatment outcome. Additionally, the canine species is the first and only species discovered with a spontaneous form of this disease. Thus, studies of dogs with EBA can provide clinical, pathological, or immunological information that can be relevant to the study of human EBA. The observation that a single canine breed accounts for more than 50% of dogs with generalized inflammatory EBA suggests that genetic factors predispose for development of this disease. Moreover, the diagnosis of EBA in two dogs of the same direct line (a young adult male dog and his dam’s littermate) is to be compared with the report of EBA in two young adult human females who were identical twins [14]. Examples of EBA-predisposing genes could be those encoding DLA major histocompatibility complex molecules, as the HLA-DR2 or DRB1 *13 alleles are often identified in human beings with this disease [15,16].
1391_C14.fm Page 235 Tuesday, November 18, 2003 5:17 PM
SPONTANEOUS CANINE MODEL OF EPIDERMOLYSIS BULLOSA ACQUISITA
235
The “classic” phenotype of human EBA is very distinctive with a slow progression of tense blisters and erosions on trauma-prone extensor surfaces of the hands, knuckles, elbows, knees, and ankles [17–19]. In this form of EBA, erosions heal with scarring and milia [17–19]. In the “generalized inflammatory” form of EBA, widespread tense vesicles and bullae, often hemorrhagic, develop from erythematous patches and wheals, thus mimicking the lesions seen during BP [17–19]. Finally, there are two localized subsets of human EBA, one involving primarily mucous membranes (“mucous membrane [cicatricial] pemphigoid phenotype”), and a chronic form that affects predominantly the head and neck (“Brunsting–Perry phenotype”) [18,19]. In 11 of 12 dogs diagnosed with EBA, the type and distribution of skin lesions were identical to those seen in the generalized inflammatory phenotype of the human disease [3,9]. In another dog, localized skin lesions were similar to those of the “Brunsting–Perry” variant of EBA [4]. In humans with EBA, histological examination of microscopic skin lesions reveals papillary edema with subsequent subepidermal vesiculation [19]. The nature and severity of dermal inflammation appears to vary depending on the clinical phenotype [19]. In the classic form of the disease, there is minimal subepidermal inflammation, while in the inflammatory variant, a neutrophil-rich infiltrate can be found [19]. In almost all dogs with EBA, there is coexistence of some vesicles without inflammatory cells and others that are rich in neutrophils. In many sections, there is subepidermal clustering of neutrophils, often with signs of degeneration. Blister eosinophilia is rarely seen, and when present, eosinophils account for less than 5% of granulocytes [3,4,9]. Such histopathological lesions are identical to those reported for the inflammatory phenotype of human EBA [19]. Investigations on the immunopathology of human and canine EBA reveal a remarkable similitude between the two species. In both human and canine subjects with EBA, direct IF performed in lesional or perilesional skin usually uncovers IgG deposited at the dermoepidermal junction [3,4,9,18,19]. Other immune proteins, such as IgA, IgM, and C3, can be detected as well [3,4,9,18,19]. The indirect IF method, especially when performed using salt-split skin substrates, is most helpful in permitting detection of IgG autoantibodies that most commonly bind the dermal side of induced clefts [3,4,9,18,19]. Of note is that such dermal fluorescence pattern is not pathognomonic for EBA, as this type also has been found in canine blistering skin diseases associated with autoantibodies targeting laminin-5 chains (T.O., unpublished observations, 2003). Similar to the autoantibody isotypes found in the serum of humans with EBA [20,21], IgG1 and IgG4 antibasement membrane autoantibodies are the predominant subclasses detected in the canine homologous disease [13]. By immunoelectron microscopy, serum IgG autoantibodies collected from human patients and one dog with EBA were found to bind to anchoring fibrils in the sublamina densa [3,18,19]. In both species, immunoblotting studies, performed with dermal extracts, have established that IgG autoantibodies recognize two antigens of 145 and 290 kDa molecular weight [3,4,9,18,19]. These antigens are presumed to represent the NC1 globular domain and the fulllength collagen VII, respectively [3,18,19]. Finally, an ELISA using eukaryotically expressed, recombinant, human NC1 coated plates was developed recently [22]. This test confirmed that the NC1 amino-terminal segment of collagen VII contains major antigenic epitopes recognized by human and canine EBA IgG autoantibodies [9,22]. In fewer human and canine patients, autoantibodies target also the NC2 carboxyl-terminal segment of collagen VII [9,23]. At this time, the hypothesis that the triple helix rod domain of collagen VII also contains antigenic epitopes has not been tested in dogs with EBA. In human beings, EBA is a chronic disease that can be refractory to therapy [19]. Lesions of the inflammatory variant of this disease appear to respond more favorably than those of the classical form of this disease [19]. Standard-of-care therapy for human EBA includes combinations of immunosuppression with oral glucocorticoids, azathioprine, methotrexate or cyclophosphamide, or immunomodulation with cyclosporine, colchicine, dapsone, intravenous immunoglobulins, plasmapheresis, or photochemotherapy [18,19]. Similarly to the prognosis of human EBA, the outcome
1391_C14.fm Page 236 Tuesday, November 18, 2003 5:17 PM
236
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
of the canine disease is unpredictable. In approximately half of the dogs with generalized inflammatory EBA, the severity of clinical signs or absence of remission with various immunosuppressive protocols led to euthanasia for humane reasons [3,9]. In contrast, skin lesions of other patients responded to therapy, and the treatment could be discontinued in a few cases [9]. At this time, variables that could predict the outcome of canine EBA have not been discovered, however.
IX. CONCLUSION Because of the exceptional likeness of canine EBA with its human counterpart at clinical, histopathological, and immunological levels, it is felt that the study of dogs with this disease could be of tremendous value for advancing knowledge of the pathogenesis or treatment of this rare human entity. Additionally, investigations using EBA-predisposed lines of Great Dane dogs could help uncover factors underlying the development of anticollagen VII naturally occurring autoimmunity.
REFERENCES 1. Austin, V.H. and Maibach, H.I., Immunofluorescence testing in a bullous skin disease in a dog, J. Am. Vet. Med. Assn., 168, 322, 1976. 2. Iwasaki, T. et al., Canine bullous pemphigoid (BP) — identification of the 180 kD canine BP antigen by circulating autoantibodies, Vet. Pathol., 32, 387, 1995. 3. Olivry, T. et al., Canine epidermolysis bullosa acquisita: circulating autoantibodies target the aminoterminal noncollagenous (NC1) domain of collagen VII in anchoring fibrils, Vet. Dermatol., 9, 19, 1998. 4. Olivry, T. et al., Novel localized variant of canine epidermolysis bullosa acquisita, Vet. Rec., 146, 193, 2000. 5. Griffin, C.E. and McDonald, J.M., A case of bullous pemphigoid in a dog, J. Am. Anim. Hosp. Assn., 17, 105, 1981. 6. Turnwald, G.H., Ochoa, R., and Barta, O., Bullous pemphigoid refractory to recommended dosage of prednisolone in a dog, J. Am. Vet. Med. Assn., 179, 587, 1981. 7. Fadok, V.A. and Janney, E.H., Thrombocytopenia and hemorrhage associated with gold salt therapy for bullous pemphigoid in a dog, J. Am. Vet. Med. Assn., 181, 261, 1982. 8. Olivry, T. and Chan, L.S., Spontaneous animal models of autoimmune blistering dermatoses, Clin. Dermatol., 19, 750, 2001. 9. Olivry, T. et al., Canine epidermolysis bullosa acquisita is an autoimmune blistering skin disease directed against collagen VII (12 cases), in Proceedings of the 18th Annual Congress of the ESVDECVD, Nice, France, 232, 2002. 10. Bernard, P. et al., Incidence and distribution of subepidermal autoimmune bullous skin diseases in three French regions, Arch. Dermatol., 131, 48, 1995. 11. Zillikens, D. et al., Incidence of autoimmune subepidermal blistering dermatoses in a region of central Germany, Arch. Dermatol., 131, 957, 1995. 12. Favrot, C. et al., Effect of substrates selection on indirect immunoflorescence testing of canine autoimmune subepidermal blistering diseases, Can. J. Vet. Res., 66, 26, 2002. 13. Favrot, C. et al., Immunofluorescent isotype determination of circulating autoantibodies in canine autoimmune subepidermal blistering dermatoses, Vet. Dermatol., 14, 23, 2003. 14. Murakami, S., Shiraishi, S., and Miki, Y., Epidermolysis bullosa acquisita in identical twins, J. Dermatol., 18, 230, 1991. 15. Gammon, W.R. et al., Increased frequency of HLA-DR2 in patients with autoantibodies to epidermolysis bullosa acquisita antigen: evidence that the expression of autoimmunity to type VII collagen is HLA class II allele associated, J. Invest. Dermatol., 91, 228, 1988. 16. Lee, C.W., Kim, S.C., and Han, H., Distribution of HLA class II alleles in Korean patients with epidermolysis bullosa acquisita, Dermatology, 193, 328, 1996.
1391_C14.fm Page 237 Tuesday, November 18, 2003 5:17 PM
SPONTANEOUS CANINE MODEL OF EPIDERMOLYSIS BULLOSA ACQUISITA
237
17. Gammon, W.R. and Briggaman, R.A., Epidermolysis bullosa acquisita and bullous systemic lupus erythematosus. Diseases of autoimmunity to type VII collagen, Dermatol. Clin., 11, 535, 1993. 18. Chan, L.S. and Woodley, D., Epidermolysis bullosa acquisita: update and review, Clin. Dermatol., 19, 712, 2001. 19. Hallel-Halevy, D. et al., Epidermolysis bullosa acquisita: update and review, Clin. Dermatol., 19, 712, 2001. 20. Mooney, E. and Gammon, W.R., Heavy and light chain isotypes of immunoglobulin in epidermolysis bullosa acquisita, J. Invest. Dermatol., 95, 317, 1990. 21. Cho, H.J., Lee, I.J., and Kim, S.C., Complement-fixing abilities and IgG subclasses of autoantibodies in epidermolysis bullosa acquisita, Yonsei Med. J., 39, 339, 1998. 22. Chen, M. et al., Development of an ELISA for rapid detection of anti-type VII collagen autoantibodies in epidermolysis bullosa acquisita, J. Invest. Dermatol., 108, 68, 1997. 23. Chen, M. et al., The carboxyl terminus of type VII collagen mediates antiparallel dimer formation and constitutes a new antigenic epitope for epidermolysis Bullosa acquisita autoantibodies, J. Biol. Chem., 276, 21649, 2001.
1391_C14.fm Page 238 Tuesday, November 18, 2003 5:17 PM
1391_C15.fm Page 239 Tuesday, November 18, 2003 5:18 PM
SECTION
C
Mucous Membrane Pemphigoid
1391_C15.fm Page 240 Tuesday, November 18, 2003 5:18 PM
1391_C15.fm Page 241 Tuesday, November 18, 2003 5:18 PM
CHAPTER
15
Spontaneous Canine Model of Mucous Membrane Pemphigoid Thierry Olivry
CONTENTS I. II. III. IV. V.
History ................................................................................................................................241 Animals ..............................................................................................................................242 Epidemiology .....................................................................................................................242 Course of Disease ..............................................................................................................242 Assessment of Disease.......................................................................................................243 A. Clinical Manifestation ...............................................................................................243 B. Histopathological Examination .................................................................................243 C. Immunopathological Data .........................................................................................244 1. Direct Immunofluorescence Microscopy ............................................................244 2. Indirect Immunofluorescence Microscopy ..........................................................245 3. Immunoblotting and ELISA................................................................................245 D. Immunogenetics.........................................................................................................246 VI. Therapeutic Responses.......................................................................................................246 VII. Expert Experience ..............................................................................................................247 VIII. Lessons Learned.................................................................................................................247 IX. Conclusion..........................................................................................................................248 References ......................................................................................................................................249
I. HISTORY In 1976, an article reported clinical and immunological characteristics of a single dog with multifocal mucocutaneous ulcerations with direct and indirect immunofluorescence evidence of basement membrane-binding autoantibodies [1]. From 1978 to 1995, multiple single-case reports [2–10] and one small study of eight subjects [11] described canine patients under the umbrella diagnosis of bullous pemphigoid (BP). Before the landmark description by Iwasaki et al. [12] of a “true” canine disease homologous to human BP, the identity of the antigen(s) targeted by autoantibodies in previously reported cases of canine “BP” remained unknown. When reviewing critically these early descriptions of canine BP, it is obvious that patients presented variable clinical 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
241
1391_C15.fm Page 242 Tuesday, November 18, 2003 5:18 PM
242
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
phenotypes, histopathology, and immunological features. In fact, using current knowledge on clinical aspects of canine autoimmune subepidermal blistering dermatoses, the diagnosis given to most of these dogs should be changed from BP to epidermolysis bullosa acquisita (EBA) [3,4,7,11] or vesicular cutaneous lupus erythematosus [5,6,11]. In three instances, the affected dogs exhibited mucosal-predominant ulceration, microscopic subepidermal vesiculation, and IgG deposition at the dermal–epidermal junction by direct immunofluorescence tests [2,8,9]. Moreover, in a dissertation reviewing data from 59 dogs with autoimmune skin diseases [13], the existence of a localized variant of BP characterized by ulcerations predominating in mucosae or at mucocutaneous junctions was proposed in 1986. If we apply recently accepted criteria for human mucous membrane pemphigoid (MMP) [14], it is likely that the three published cases [2,8,9] and 9 of 14 dogs with BP reported in the thesis [13] were affected with MMP instead of BP sensu stricto. In 2001, canine MMP was individualized formally as a separate entity after adaptation of the consensus criteria for the human disease [15].
II. ANIMALS Outside of human beings, spontaneously occurring MMP has been recognized only in dogs and cats [15,16]. Because only rare feline subjects have been diagnosed with MMP, this chapter will be restricted to the canine disease. To aid in identifying clinically relevant information on canine MMP, case material was pooled from the largest case series of 17 cases [16], three dogs with previously assigned diagnosis of “BP” but exhibiting mucosal predominant disease [2,8,9], eight dogs with “localized BP” described in a thesis [13], as well as 14 additional previously unreported canine patients (T.O., unpublished data, 2002). Therefore, 42 canine patients with MMP were available for meta-analysis. Dogs with MMP were of various pure and crossed breeds. Twelve of 42 dogs (29%) belonged to the German shepherd breed, three were Siberian husky crossbred dogs, and there were two each of the following breeds: border collies, dachshunds, poodles. and cockers. Unfortunately, this analysis regroups cases seen in France and North America between 1978 and 2002; thus a control population is unavailable for determination of a predisposition odds ratio. In this group of 42 dogs, the median age of onset of MMP was 5 years (range, 1.5 to 15 years), and there were 18 of 42 dogs (43%) older than 7 years, an age corresponding to advanced adulthood in humans. There were 33% more males than females.
III. EPIDEMIOLOGY At this time, there are no data permitting the calculation of reliable prevalence or incidence of MMP in the canine population. In spite of the lack of available epidemiological data, it is noteworthy to point out that MMP is the most common autoimmune subepidermal blistering disease of dogs. Indeed, the diagnosis of MMP was given to approximately 50% of 60 dogs exhibiting autoantibodies against basement membrane antigens (T.O., unpublished data, 2002).
IV. COURSE OF DISEASE In our own pool of 31 dogs with MMP, the median duration of skin lesions prior to diagnosis varied between 2 weeks and 5 years (median, 4.5 months). This lengthy duration of time highlights the slowly progressing nature of the disease in some canine patients. The evolution of canine MMP is much more insidious than the more rapidly evolving nature of canine EBA and BP. When lesions of MMP affect the oral cavity, pain, anorexia and listlessness are usually present. Dogs with MMP
1391_C15.fm Page 243 Tuesday, November 18, 2003 5:18 PM
SPONTANEOUS CANINE MODEL OF MUCOUS MEMBRANE PEMPHIGOID
243
are expected to maintain a normal life span, unless the severity of clinical signs and/or adverse drug effects motivate their owners to request euthanasia.
V. ASSESSMENT OF DISEASE A. Clinical Manifestation Detailed clinical information could be extracted from four papers describing 20 dogs with MMP [2,8,9,15], and this knowledge was added to data from 14 additional unpublished cases. Initial lesions of canine MMP occur in the oral cavity of 13 of the 34 patients (38%), on or around the nose in 13 (38%), inside the ears in seven (21%), in or around the genitalia in six (18%), on the lips in four (12%), and in or around the eyes in three subjects (9%). At the time of initial diagnosis, lesions were present inside the oral cavity in 20 of 34 dogs (59%), with the following affected location: gingiva or buccal mucosa, 18 of 34; palate, 14 of 34; tongue, 4 of 34; the nasal planum (nose pad) (Figure 15.1) or near it, 20 of 34 (59%); the lips 16 of 34 (47%); periorbital 14 of 34 (41%) (Figure 15.2); the genitalia 14 of 34 (41%); inside the ears 13 of 34 (38%); and the anal/perianal area 7 of 34 (21%). In our case series of 31 dogs with MMP, the median number of mucosal sites affected was three. Nonmucosal lesions have been reported also on the footpads in four dogs (12%) and around the claws in two patients (6%). In only four dogs with MMP (12%) were few lesions described on haired skin at sites distant from mucosae or mucocutaneous junctions. Of note is that laryngeal or esophageal involvement has not been assessed via endoscopy in any canine patients with MMP. Mucosal lesions of canine MMP consisted most commonly of tense vesicles (16 of 34; 47%) that evolved rapidly into erosions or ulcers (33 of 34; 97%) (Figures 15.1 and 15.2). When lesions were present outside the mucosae, crusting also was observed (20 of 34; 59%). Skin erythema or mucosal congestion (hyperhemia) was described in 20 dogs (59%). Hypopigmentation as an early lesion was seen on the nasal planum, lips, or eyelids of 15 of 34 dogs (44%). Visible scarring as the only clinical manifestation was reported for six dogs with MMP (18%) (Figure 15.1). Mucocutaneous lesions exhibited a remarkable bilateral symmetry in 27 of 28 subjects (97%) for which this feature was described. Outside of mucosal or skin lesions, there were few systemic clinical signs in dogs with MMP. Lymphadenomegaly was reported in 4 of 34 patients (12%), profound loss of nasal architecture was seen in three individuals (9%), and decreased appetite and complete anorexia were mentioned in rare subjects who exhibited severe oral involvement. B. Histopathological Examination Subepithelial vesiculation is the most characteristic histopathological finding in canine MMP, and it was reported in 34 of 40 dogs (85%) (Figure 15.3). In the other patients, either early (superficial dermal edema) or late (dermal ulceration) lesions were described. Out of 66 skin or mucosal biopsy sections that were reviewed (T.O., unpublished data, 2002), vesicles were found to contain eosinophils in 20% of sections, neutrophils or mononuclear cells in 12%, and no inflammatory cells were found in 52% of examined samples (Figure 15.3). Of note is that when biopsies were taken from mucosal or mucocutaneous areas, a superficial dermal band-like lymphoplasmacytic inflammation often was found [15]. Superficial dermal fibrosis was evident in a minority of biopsy specimens. When PAS or immunohistochemical staining for collagen IV, the primary component of lamina densa, was performed, it revealed that the blister cleft always arose above the lamina densa of the epidermal basement membrane zone (17 cases), as described previously [15].
1391_C15.fm Page 244 Tuesday, November 18, 2003 5:18 PM
244
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Figure 15.1
Clinical phenotype of canine MMP: alopecia, depigmentation, ulceration, scarring, and loss of normal architecture on the nasal planum of an Australian shepherd dog with chronic recurrent MMP. (Courtesy of Dr. Christine Rivierre.)
Figure 15.2
Ocular manifestation of canine MMP: ulceration, depigmentation, and erythema on the medial ocular canthus of a German shepherd dog with MMP. (Courtesy of Dr. Blaise Hubert.)
C. Immunopathological Data 1. Direct Immunofluorescence Microscopy Direct immunofluorescence (IF) was the ex vivo method used historically to detect the presence of skin or mucosal-fixed immunoglobulins or complement. Careful scrutiny of the literature, to which my unpublished observations were added, allowed retrieval of direct IF results from 39 dogs with MMP [2,8,9,13,15]. In 36 of 39 cases (92%), the direct IF method permitted the detection of IgG linearly distributed at the epidermal basement membrane zone. The deposit was described as
1391_C15.fm Page 245 Tuesday, November 18, 2003 5:18 PM
SPONTANEOUS CANINE MODEL OF MUCOUS MEMBRANE PEMPHIGOID
Figure 15.3
245
Histopathology of canine MMP: widespread subepidermal vesiculation with minimal inflammatory infiltrate within the blister cavity or around dermal blood vessels. Hematoxylin-eosin, bar = 145 mm.
linear, patchy to continuous, and fine or thick [15]. Basement membrane-fixed IgA were detected in 11 of 28 subjects (39%), IgM in 15 out 36 (42%), and activated complement (C3) in 28 of 39 dogs (72%) with MMP. In our laboratory, a positive direct IF (for either immunoglobulin or complement) has been observed in 27 of 28 cases (96%). In the case with a negative test, indirect IF revealed circulating basement membrane-specific autoantibodies. 2. Indirect Immunofluorescence Microscopy Indirect IF was the technique employed to screen for the presence of circulating IgG autoantibodies targeting basement membrane antigens. However, the frequency of detection of autoantibodies depended on the nature of the epithelial substrates used. When intact normal canine gingiva [8,13,15] or esophagus [2] were used, circulating basement membrane targeting IgG autoantibodies were detected in 12 of 37 dogs with MMP (32%). With this substrate, autoantibody titers varied between 1:20 to 1:5000 and they were lower than 1:100 in half of these subjects. If 1.0-M sodium chloride-split normal canine lip were used as substrate, however, the detection of circulating IgG autoantibodies was enhanced, as they were found in 24 of 31 dogs (77%) (Figure 15.4). In such instances, autoantibodies bound either the epidermal side (21 of 31; 68%), the dermal side (2 of 31; 6%), or both aspects (1 of 31; 3%) of salt-induced clefts [15] (T.O., unpublished data, 2002). Sera from 15 dogs with MMP was tested by indirect IF using salt-split canine gingiva to search for other isotypes of basement membrane-specific autoantibodies [17]. In this group of 15 patients, IgG autoantibodies were found in all dogs, and they belonged to IgG1 (14 dogs, 91%), IgG4 (6 dogs, 40%), IgG3 (3 dogs, 20%) or IgG2 (2 dogs, 13%) subclasses [17]. Similarly, anti–basement membrane IgA, and IgM and IgE autoantibodies were observed in 2 (13%), none (0%), and 8 subjects (53%), respectively [17]. Finally, serum antinuclear autoantibodies were searched in 11 dogs with MMP [2,9,13], and this test was positive only for one of them. 3. Immunoblotting and ELISA Our studies have permitted the identification of antigens targeted by circulating IgG autoantibodies in 25 dogs with MMP [15] (T.O. and M.P. Marinkovich, unpublished data, 2002). Immunoblotting was performed using extracts from cultured canine keratinocytes in seven dogs with MMP [15]. In these patients, serum IgG autoantibodies recognized antigens of 180 kDa (seven, 100%) and 230 kDa (four, 57%) presumed to represent the canine homologue of collagen XVII (BPAG2, BP180) and BPAG1 (BP230), respectively [15]. Immunoblotting was also conducted with recombinant, human processed collagen XVII extracellular segments (M.P. Marinkovich, unpub-
1391_C15.fm Page 246 Tuesday, November 18, 2003 5:18 PM
246
Figure 15.4
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Indirect immunofluorescence (IF) microscopy of canine MMP: indirect IF testing using salt-split canine gingiva is a sensitive method for detecting circulating autoantibodies in dogs with MMP. Whereas the IgG binding is invisible at far left, it is unmasked in salt-split areas (arrowhead). Indirect IF performed on salt-split gingival tissue with serum from dog MMP, followed by fluoresceinlabeled anticanine IgG, bar = 70 mm.
lished data, 2001). Of 21 canine sera tested, 17 (81%) contained IgG antibodies that recognized these recombinant peptides. ELISA and immunoblotting studies aided in further mapping of collagen XVII epitopes targeted by circulating IgG autoantibodies. ELISA using synthetic canine collagen XVII-NC16A overlapping peptides was positive or borderline positive in 13 of 16 dogs (81%) [15]. Of note is that all NC16A ELISA positive sera were collected from dogs in which indirect IF using salt-split canine gingiva had immunolocalized IgG autoantibodies to the epidermal side of the clefts [15]. In another dog with dermal fluorescence pattern in salt-split indirect IF (dog 1 in Olivry et al. [15]), antigenic epitopes were mapped to the C-terminus of collagen XVII by immunoblotting with recombinant human peptides. Finally, in one female dog with perioral and genital MMP lesions, subepidermal vesiculation and dermal salt-split indirect IF pattern, IgG autoantibodies were found to recognize all three chains of purified human laminin-5 (T. Olivry and M.P. Marinkovich, unpublished information, 2002). Until now, circulating autoantibodies targeting collagen VII have not been detected in dogs with MMP. D. Immunogenetics At this time, there is no information available on major histocompatibility complex haplotypes predisposing to canine MMP. As stated above, German shepherd dogs represent approximately 30% of canine patients with this disease, a proportion that appears higher than the prevalence of this breed. Unfortunately, the breed predisposition odds ratio cannot be calculated because of lack of reference population.
VI. THERAPEUTIC RESPONSES Presently, there is a limited information available on the treatment and prognosis of canine MMP. Outcome data on 11 dogs could be extracted from three publications [2,9,15]. In five dogs, partial to complete remission was achieved with a combination of niacinamide and tetracycline, 500 mg three times daily [15]. Prednisone or prednisolone monotherapy (1 to 4 mg/kg/day), or combined with azathioprine (1.5 to 2 mg/kg/day) or chlorambucil (0.1 to 0.2 mg/kg/day) led to
1391_C15.fm Page 247 Tuesday, November 18, 2003 5:18 PM
SPONTANEOUS CANINE MODEL OF MUCOUS MEMBRANE PEMPHIGOID
247
complete remission of clinical signs in four patients with MMP [2,15]. Finally, one dog was treated with oral dapsone (1 mg/kg three times daily), and skin lesions abated completely [9].
VII. EXPERT EXPERIENCE When dogs are presented with an acquired ulcerative and/or blistering skin disease that affects predominantly mucosae and mucocutaneous junctions, differential diagnoses should consist principally of MMP, pemphigus vulgaris or paraneoplastic pemphigus, erythema multiforme major, and the uveodermatological syndrome as well as various forms of cutaneous lupus. The final diagnosis will be made from collation of clinical, histopathological, and immunological findings. It is suggested that the diagnosis of canine MMP be given on satisfaction of the following three criteria: • Clinical examination: chronic mucosal or mucocutaneous predominant vesiculation and ulceration with or without scarring • Histopathology: subepidermal vesiculation with variable inflammation • Immunofluorescence: epithelium-fixed (direct method) immunoglobulins or complement, or circulating (indirect method) autoantibodies binding the basement membrane zone
Note that after circulating autoantibodies are detected by indirect IF using salt-split epithelia, in-depth immunological studies (immunoblotting or ELISA) are needed to identify the antigen(s) targeted.
VIII. LESSONS LEARNED This systematic review of publications reporting dogs with acquired mucosal predominant disease and basement-membrane targeting autoantibodies provides good evidence for the existence of a spontaneous canine model of MMP of humans [2,8,9,13,15]. Remarkably, this natural animal disease exhibits a strong analogy with its human counterpart. Of note is that canine MMP is now recognized as the most common basement membrane autoimmune blistering disease of dogs, in contrast to its relative rarity in human patients. Indeed, our recent investigations provided evidence that MMP is the most common canine autoimmune subepidermal blistering disease, a proportion (50%) markedly higher than that of human patients with similar afflictions (4% [18] to 10% [19]). The recently published consensus statement on human MMP describes the clinical aspect of this entity as “a chronic inflammatory blistering disease predominantly affecting any or all mucous membranes, with or without clinically observable scarring” [14]. Lesions of human MMP are observed principally on the oral and ocular mucosae followed by nasal, nasopharyngeal, anogenital, and laryngeal and esophageal mucosae [14,20]. There is usually more than one mucosa affected. Mucosal lesions will consist of erythema, vesicles, erosions, and ulcerations, with or without scar formation [14,20]. Clinically, canine MMP appears remarkably similar to the human disease with regard to sites being affected and nature of dermatological lesions. The existence of the canine nasal planum (nose pad), a unique mucosa-like skin structure, is a possible explanation for the high frequency of nasal or perinasal lesions seen in dogs with MMP. Another peculiarity of canine MMP is the lack of report of pharyngeal, laryngeal, or esophageal lesions, but it is likely that such lesions would have remained underrecognized in routine physical examinations. Microscopic lesions of human MMP consist of subepithelial vesiculation with variable leukocytic inflammation [14]. Histopathologically, canine MMP appears to be identical to its human counterpart, both in the nature of the lesions seen and the variability of dermal or vesicular inflammation.
1391_C15.fm Page 248 Tuesday, November 18, 2003 5:18 PM
248
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
The consensus statement on human MMP sets forth direct IF as a positive selection criterion: “Direct methods of IF or immunohistochemistry examination on peri-lesional mucosa and/or skin biopsies detects continuous deposits of any one or combination of the following in the epithelial basement membrane zone: IgG, IgA, C3” [14]. Our review highlights the striking homology of canine MMP with its human counterpart. Indeed, immunoglobulins and/or complement were identified in more than 95% of dogs diagnosed with this disease. Remarkably, when direct IF was negative in dogs with MMP, indirect IF revealed circulating autoantibodies; thus the combined direct IF and indirect IF could detect positive immunopathology in all canine patients with MMP. Although not included in the diagnostic criteria of human MMP, indirect IF using 1.0-M sodiumchloride split epithelium is a sensitive method enabling the detection of circulating autoantibodies in individuals with this disorder [14,20]. Two patterns of fluorescence will be visualized, thus reflecting the heterogeneity of targeted autoantigens. Indeed, in human MMP, autoantibodies are shown to bind to the epidermal or the dermal aspects or to both sides of salt-induced clefts [14,20]. In dogs with MMP, circulating autoantibodies are detected in 77% of patients using this method. In the great majority of individuals, autoantibodies will bind to the epidermal side of salt-induced splits, and in rare cases, they will target antigens on the dermal side. The individualization of human MMP as a separate entity relies primarily on clinical signs and not on the presence of a unique MMP basement membrane autoantigen. Indeed, in the last decade, studies have established almost a dozen separate MMP autoantigens that include collagen XVII, BPAG1e, laminin-5, laminin-6, collagen VII, integrin alpha-6/beta-4, and uncein, as well as other unrecognized proteins [14,20]. Despite the distinctive clinical phenotype of canine MMP, the multiplicity of targeted antigens mirrors the situation observed with the human disease. At this time, recognized autoantigens in the canine MMP include at least collagen XVII and laminin-5. Collagen XVII appears to be the most common antigen, and epitopes have been mapped to multiple segments of this protein, especially to the NC16A domain. In humans with MMP, the presence of ocular, nasopharyngeal, esophageal, laryngeal, or genital lesions is associated with worse prognosis [14]. Phenotypes involving these sites have a higher likelihood of scarring with associated loss of organ function, and they appear to be more difficult to treat [14]. A recent systematic review reported the outcome of interventions for treatment of human MMP [21]. Two randomized controlled trials and 30 studies involving more than five patients each were analyzed. There was evidence that severe ocular MMP responded best to cyclophosphamide therapy, and that mild to moderate phenotypes were effectively treated with dapsone [21]. Additionally, it was found that many patients had responded to sulfa drugs, minocyclin, or topical mitomycin for ocular forms [21]. Canine MMP appears to progress more slowly than BP or EBA, but this slow progression does not prevent lesions from negatively affecting organ function, especially when oral, ocular, or nasal involvement is severe. In dogs with this disease, mucosal lesions have been reported to improve with immune suppression with glucocorticoids alone or in combination with cytotoxic agents. Immunomodulation with either dapsone or a tetracycline-niacinamide combination also was found to be beneficial in some patients.
IX. CONCLUSION Canine MMP is relatively common among dogs with autoimmune subepidermal blistering dermatoses. Moreover, it is noticeably similar to the human disease with regard to clinical signs, prognosis, and histopathological characteristics, as well as immunological findings. Thus, canine MMP offers opportunity as a unique animal model to further the studies of comparative pathogenesis and/or treatment options for this rare illness affecting humans.
1391_C15.fm Page 249 Tuesday, November 18, 2003 5:18 PM
SPONTANEOUS CANINE MODEL OF MUCOUS MEMBRANE PEMPHIGOID
249
REFERENCES 1. Austin, V.H. and Maibach, H.I., Immunofluorescence testing in a bullous skin disease in a dog, J. Amer. Vet. Med. Assn., 168, 322, 1976. 2. Kunkle, G., Goldschmidt, M.H., and Halliwell, R.E.W., Bullous pemphigoid in a dog: a case report with immunofluorescent findings, J. Amer. Anim. Hosp. Assn., 14, 52, 1978. 3. Griffin, C.E. and McDonald, J.M., A case of bullous pemphigoid in a dog, J. Amer. Anim. Hosp. Assn., 17, 105, 1981. 4. Turnwald, G.H., Ochoa, R., and Barta, O., Bullous pemphigoid refractory to recommended dosage of prednisolone in a dog, J. Amer. Vet. Med. Assn., 179, 587, 1981. 5. White, S.D., Ihrke, P. J., and Stannard, A.A., Bullous pemphigoid in a dog: treatment with sixmercaptopurine, J. Amer. Vet. Med. Assn., 185, 683, 1981. 6. Scott, D., Manning, T., and Lewis, R., Linear IgA dermatoses in the dog: bullous pemphigoid, discoid lupus erythematosus and a subcorneal pustular dermatitis, Cornell Vet., 72, 394, 1982. 7. Fadok, V.A. and Janney, E.H., Thrombocytopenia and hemorrhage associated with gold salt therapy for bullous pemphigoid in a dog, J. Am. Vet. Med. Assn., 181, 261, 1982. 8. Alhaidari, Z. and Ortonne, J.-P., La pemphigoide bulleuse canine: cas clinique, Point. Vet., 16, 41, 1984. 9. Fourrier, P., Cas dermatologique n˚15: pemphigoïde bulleuse chez un berger Allemand âgé de 5 ans. Essai de traitement par la dapsone, Prat. Med. Chir. Anim. Comp., 21, 381, 1986. 10. Dunn, K.A., What is your diagnosis? [bullous pemphigoid in a dog], J. Small. Anim. Pract., 36, 156, 1995. 11. Scott, D.W. et al., Immune-mediated dermatoses in domestic animals: ten years after — Part I, Comp. Cont. Educ. Pract. Vet., 9, 424, 1987. 12. Iwasaki, T. et al., Canine bullous pemphigoid (BP) — identification of the 180 kD canine BP antigen by circulating autoantibodies, Vet. Pathol., 32, 387, 1995. 13. Olivry, T., Les dermatoses auto-immunes du chien et du chat, Dr. Vet. thesis, Université Paul-Sabatier, Toulouse, France, 1986. 14. Chan, L. S. et al., The first international consensus on mucous membrane pemphigoid: definition, diagnostic criteria, pathogenic factors, medical treatment and prognostic indicators, Arch. Dermatol., 138, 370, 2002. 15. Olivry, T. et al., A spontaneous canine model of mucous membrane (cicatricial) pemphigoid, an autoimmune blistering disease affecting mucosae and mucocutaneous junctions, J. Autoimmun., 16, 411, 2001. 16. Olivry, T. et al., Laminin-5 is targeted by autoantibodies in feline mucous membrane (cicatricial) pemphigoid, Vet. Immunol. Immunopathol., 88, 123, 2002. 17. Favrot, C. et al., Immunofluorescent isotype determination of circulating autoantibodies in canine autoimmune subepidermal blistering dermatoses, Vet. Dermatol., 14, 23, 2003. 18. Bernard, P. et al., Incidence and distribution of subepidermal autoimmune bullous skin diseases in three French regions, Arch. Dermatol., 131, 48, 1995. 19. Zillikens, D. et al., Incidence of autoimmune subepidermal blistering dermatoses in a region of central Germany, Arch. Dermatol., 131, 957, 1995. 20. Chan, L. S., Mucous membrane pemphigoid, Clin. Dermatol., 19, 703, 2001. 21. Kirtschig, G. et al., Interventions for mucous membrane pemphigoid/cicatricial pemphigoid and epidermolysis bullosa acquisita: a systematic literature review, Arch. Dermatol., 138, 380, 2002.
1391_C15.fm Page 250 Tuesday, November 18, 2003 5:18 PM
1391_C16.fm Page 251 Tuesday, November 18, 2003 5:20 PM
CHAPTER 16 Experimental Mouse Model of Mucous Membrane Pemphigoid: Passive Transfer of Anti-Laminin 5 Antibodies Zelmira Lazarova
CONTENTS I. History ................................................................................................................................252 II. Laboratory Animals............................................................................................................253 A. Neonatal Mice............................................................................................................253 B. Adult Mice .................................................................................................................253 C. Grafting of Human Skin onto SCID Mice................................................................253 D. Rabbits .......................................................................................................................253 III. Disease Induction...............................................................................................................253 A. Preparation of Laminin 5 ..........................................................................................253 B. Immunization of Rabbits ...........................................................................................254 C. Characterization of Rabbit Anti-Laminin 5 Antibodies............................................254 D. Characterization of Human Anti-Laminin 5 Antibodies...........................................254 E. Purification of IgG and Preparation of Fab Fragments ............................................254 F. Passive Transfer Studies ............................................................................................254 G. Mice Evaluation.........................................................................................................255 IV. Course and Assessment of Disease ...................................................................................255 A. Clinical Manifestation ...............................................................................................255 B. Histopathological Examination .................................................................................255 C. Immunopathological Data .........................................................................................256 V. Therapeutic Response ........................................................................................................257 VI. Lessons Learned.................................................................................................................257 Acknowledgment............................................................................................................................258 References ......................................................................................................................................258
0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
251
1391_C16.fm Page 252 Tuesday, November 18, 2003 5:20 PM
252
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
I. HISTORY Mucous membrane pemphigoid (MMP) or cicatricial pemphigoid (CP) describes a heterogeneous group of relatively rare, chronic autoimmune blistering disorders of mucous membranes and skin in which lesions often heal with scar formation [1–3]. Typical clinical features include oral mucosal erosions, desquamative gingivitis, and cicatrizing conjunctivitis. Scarring of ocular mucosa can result in symblepharon, entropion, and corneal opacities that may lead to blindness. Skin lesions usually consist of scattered erosions or tense blisters on an erythematous base. Light microscopy studies of lesional skin or mucosa from patients with CP characteristically demonstrate subepidermal blister formation. Ultrastructurally, blisters in these patients demonstrate separation within the lamina lucida of the epidermal basement membrane (BM). Many investigators have shown that patients with acquired autoimmune bullous diseases have autoantibodies that target specific antigens in normal human skin. Moreover, autoantibodies from these patients have been used to identify antigens in human skin on a molecular basis. Since the mid-1980s, ten different epithelial BM components have been recognized by the autoantibodies in patients with CP [4–15], and it has been shown that they represent important adhesion molecules in epidermal BM. The unifying immunopathological feature of patients with CP is the finding of IgG (and/or IgA) and complement components in perilesional epidermal BM [16–18], as well as the presence of low-titer circulating anti-BM autoantibodies. These observations led to the concept that cicatricial pemphigoid is not a single nosologic entity, but rather a disease phenotype consisting of a group of subepithelial blistering disorders that predominate on mucosal surfaces [19]. In 1992, Domloge-Hultsch et al. [6] identified a group of patients with clinical features of CP who had IgG anti-BM autoantibodies that immunoprecipitated a protein called epiligrin from human keratinocyte (HK) extracts and culture media. Because epiligrin was initially characterized as a glycoprotein in the human keratinocyte extracellular matrix (ECM) that serves as the major integrin ligand for human epidermal cells, this disorder was termed anti-epiligrin cicatricial pemphigoid (AECP) [20]. Subsequent cloning experiments have shown that epiligrin is a laminin isoform identical to laminin 5 (a3b3g2) [21]. Most of AECP patients have circulating antibodies against the a subunit of laminin 5, and these antibodies can serve as a disease-specific marker for this form of CP [22]. In vitro studies by Rousselle et al. [23] reported that monoclonal antibodies directed against laminin 5 have the ability to impair the adhesion of human keratinocytes to their extracellular matrix. This observation raised the possibility that anti-laminin 5 autoantibodies in patients with CP may be directly pathogenic in vivo. In 1995, Z. Lazarova and K.B. Yancey from the Dermatology Branch of the National Cancer Institute at the National Institutes of Health in Bethesda, Maryland found that human anti-laminin 5 antibodies do not bind murine skin and that several murine monoclonal anti-human laminin 5 antibodies do not bind the epidermal basement membrane of nonprimates. To investigate the hypothesis raised by previous in vitro experiments, rabbits were immunized with laminin 5 purified from ECM of human keratinocytes and the resulting rabbit anti-laminin 5 antibodies were injected into neonatal mice. Passive transfer of rabbit anti-laminin 5 antibodies to neonatal mice elicited noninflammatory subepithelial blisters, with clinical, histological, and immunopathological features like those seen in patients with AECP. This novel animal model provided evidence that anti-laminin 5 antibodies in AECP patients could be pathogenic in vivo [24,25] and that this process is independent of complement activation or mast cell degranulation. To directly assess the pathogenic activity of human anti-laminin 5 antibodies, a disease model in adult SCID mice bearing human skin grafts was developed. In this model, passive transfer of IgG from patients with AECP induced subepidermal blisters in skin grafts, clearly demonstrating that human anti-laminin 5 autoantibodies are pathogenic in vivo [26].
1391_C16.fm Page 253 Tuesday, November 18, 2003 5:20 PM
EXPERIMENTAL MOUSE MODEL OF MUCOUS MEMBRANE PEMPHIGOID
253
II. LABORATORY ANIMALS A. Neonatal Mice Neonatal BALB/c and DBA/2NCr mice were obtained from the National Institutes of Health (NIH) animal care facility (Frederick Cancer Research and Development Center, Frederick, MD). DBA/2NCr mice are C5 deficient since they are homozygous for the Hco allele. Female C57Bl/6J (Wv/+) and male WbReJ (W/+) mice were obtained from Jackson Laboratories (Bar Harbor, ME) and bred to produce W/Wv mast cell-deficient neonates. All experimental and control neonatal mice were between 24 to 48 hours old with a body weight of 1.3 to 1.8 g. B. Adult Mice Six- to 8-week-old BALB/c, DBA/2NCr (C5-deficient), athymic nude, and SCID mice were obtained from the NIH animal care facility. W/Wv (mast cell-deficient) mice were obtained as described above. C. Grafting of Human Skin onto SCID Mice Six- to 8-week-old SCID mice were anesthetized with intraperitoneal injection of Xylazine (50 mg) and Ketamine HCl (2.5 mg) in 250 ml of phosphate buffered saline (PBS). A 2 ¥ 3 cm area of skin was excised on the backs of the recipient mice down to the layer of panniculus carnosus with intact superficial vascular bed. Then human neonatal foreskins without subcutaneous fat layer were placed on the backs of recipient mice and secured with autoclips. Postoperatively, mice were evaluated daily and the autoclips were removed between postoperative days 10 and 14. Biopsies from representative animals were taken at the different time points and evaluated by light and immunofluorescence (IF) microscopy. These studies confirmed viability and normal morphology of grafted human skin, as well as the presence of epidermal basement membrane antigens such as bullous pemphigoid antigens 1 and 2, laminin 1 and 5, and collagen type IV and VII. D. Rabbits Sera from ten New Zealand white rabbits were screened for evidence of circulating IgG reactive with human skin by indirect IF microscopy. Preimmune sera from four rabbits with lowest background were collected and these rabbits were immunized with purified laminin 5.
III. DISEASE INDUCTION A. Preparation of Laminin 5 Laminin 5 was isolated from human keratinocytes ECM as follows: confluent cultures of human keratinocytes in 10-cm2 petri dishes were sequentially extracted with 1% Triton X-100 in PBS, 2 M urea in 1 M NaCl, and 8 M urea. For each extraction, we used 5 ml of extraction buffer per dish and each extraction time lasted 10 minutes. After the last extraction, the urea-insoluble proteins were detached from the surface of the culture dishes with a cell scraper and suspended in 1 ml of 0.5% sodium dodecyl sulfate (SDS). All extraction buffers contained 1 mM phenylmethylsulfonyl fluoride and 2 mM of N-ethylmaleimide (Sigma, St. Louis, MO). Purified laminin 5 was then dialyzed against 0.1% SDS in Tris-buffered saline, concentrated by solvent recovery (Sephadex G-75, Pharmacia, Uppsala, Sweden), and stored at -70∞C.
1391_C16.fm Page 254 Tuesday, November 18, 2003 5:20 PM
254
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
B. Immunization of Rabbits Four New Zealand white rabbits were immunized subcutaneously with purified laminin 5. Each rabbit received 100 mg of antigen suspended in 1 ml of Freund’s complete adjuvant. Two weeks later, each rabbit was boosted with the same dose of antigen suspended in incomplete Freund’s adjuvant. Immune sera were collected every 3 weeks, characterized, and used in the passive transfer studies. C. Characterization of Rabbit Anti-Laminin 5 Antibodies We evaluated rabbit anti-laminin 5 antibodies by indirect IF microscopy and found that they bound epidermal BM in intact human and neonatal murine skin at a titer of 10,240 and the dermal side of 1 M NaCl split skin at a titer of 20,480. Sera from immune rabbits activated the human complement in vitro and recognized all processed and unprocessed subunits of laminin 5 by immunoblotting and immunoprecipitation. Preimmune rabbit sera in all of these studies were negative. D. Characterization of Human Anti-Laminin 5 Antibodies Serum samples were obtained from two well-characterized patients with the clinical, histological, and immunopathological features of anti-epiligrin CP. The titer of circulating autoantibodies against the dermal side of 1 M NaCl split skin was 20 and 160, respectively. Both sera immunoblotted the unprocessed and processed a subunits of laminin 5 and immunoprecipitated laminin 5 from the media of radiolabeled human keratinocytes. E. Purification of IgG and Preparation of Fab Fragments Immune and normal rabbit IgG and human IgG were purified by chromatography on Affi-Gel Blue Gel (Bio-Rad Laboratories, Hercules, CA) and concentrated by ultrafiltration (Centricon 30, Amicon Corp, Danvers, MA). All samples were dialyzed against PBS and filtered through a 0.45mm filter before injection. Final IgG concentrations were determined by OD280 using extinction coefficients of 13.6 for rabbit IgG and 14.6 for human IgG. Purified rabbit IgG prepared as described above was dialyzed against 20-mM phosphate, 10-mM ethylenediaminetetraacetic acid, pH 7.0, and incubated with agarose-linked papain (ImmunoPure Fab Preparation Kit, Pierce, Rockford, IL) in a water bath at 37∞C for 5 hours. The digested IgG was applied to protein A column, and Fab fragments were collected, dialyzed against PBS, and concentrated by ultrafiltration (Centricon 30, Amicon, Danvers, MA). The final concentration of Fab fragments was determined by OD280 using an extinction coefficient of 15.3 for rabbit IgG Fab. F.
Passive Transfer Studies
Neonatal BALB/c, DBA/2NCr, W/Wv, and littermate control mice were injected with purified rabbit anti-laminin 5 IgG or normal rabbit IgG via subcutaneous injection. The IgG doses were between 0.01 to 10 mg/g of body weight and the maximal injection volume was 100 ml. Purified rabbit anti-laminin 5 (or normal, rabbit) Fab fragments were injected in a dose ranging from 1 to 3 mg/g of body weight, every 12 hours for 1 to 4 days. Adult BALB/c, DBA/2NCr, athymic nude, W/Wv, and SCID mice were injected subcutaneously into epilated areas on their back with 0.5 to 5.0 mg of purified rabbit anti-laminin 5 IgG, normal rabbit IgG (control), or bovine serum albumin (BSA) in a single 100-ml injection. SCID mice bearing human skin grafts were injected with 5 mg of rabbit anti-laminin 5 IgG, normal rabbit IgG, or BSA in a volume of 100 ml at 12-hour intervals for 1 to three days. Purified
1391_C16.fm Page 255 Tuesday, November 18, 2003 5:20 PM
EXPERIMENTAL MOUSE MODEL OF MUCOUS MEMBRANE PEMPHIGOID
255
human anti-laminin 5 IgG or normal human IgG was administered in the same fashion in a total dose ranging from 10 to 13 mg. G. Mice Evaluation Mice were evaluated daily for the clinical signs of disease (specifically, erythema, edema, blisters, erosions, or crusts). At selected time points after passive transfer of IgG, the animals were killed and samples of skin, oral mucosa, and serum were taken for direct and indirect IF studies, as well as for light and immunoelectron microscopy.
IV. COURSE AND ASSESSMENT OF DISEASE A. Clinical Manifestation Neonatal BALB/c mice injected with more than 5 mg/g of body weight of rabbit anti-laminin 5 IgG developed tense blisters on their abdomen, feet, and ears. Interestingly, mice continued to develop new blisters as late as 8 days after injection, and erosions and crusts replaced these blisters later on (Figure 16.1A). The number of blisters was dose dependent. In mice that received total doses of 1 to 2.5 mg/g of body weight, clinical findings were limited to peeling of epidermis after skin incision. There was no clinical evidence of disease in mice receiving less than 1 mg/g of body weight of anti-laminin 5 IgG, or in control mice, which received 1 to 20 mg/g of body weight of normal rabbit IgG. Passive transfer of 5 to 10 mg/g of body weight of anti-laminin 5 IgG also induced blisters, erosions, and peeling in neonatal DBA/2NCr (C5-deficient mice), as well as W/Wv (mast cell-deficient mice) and W/Wv littermate controls. Neonatal BALB/c mice injected with more than 8 mg/g of body weight of anti-laminin 5 Fab fragments developed faint erythema and blister formation within 24 hours after injection and the extent of lesions was dose dependent. Control animals were without clinical signs of disease. All adult mice injected with rabbit anti-laminin 5 IgG developed local eryhtema, focal erosions, and small crusts within 24 hours. The extent of lesions again directly correlated with the administered doses of IgG. No significant alterations were seen in mice challenged with normal rabbit IgG or BSA. Studies on adult mice clearly demonstrated that the effect of anti-laminin 5 antibodies is not confined to neonatal skin that is developmentally immature or fragile. Mature human skin grafts on SCID mice were injected with 5, 10, or 15 mg of rabbit antilaminin 5 IgG, normal rabbit IgG, or BSA. Twenty-four hours later, five of six grafts challenged with rabbit anti-laminin 5 IgG developed erythema, focal erosions, and small crusts. The character of the lesion was the same as that seen in adult mice injected with rabbit anti-laminin 5 IgG, but their overall extent was less. A substantially higher dose of rabbit anti-laminin 5 IgG (15 mg) was required to induce epidermal fragility and peeling in grafted mice. To test the hypothesis of the pathogenic ability of human anti-laminin 5 autoantibodies, we injected IgG from two patients with AECP into human skin grafts on SCID mice. The grafts challenged with 20 mg of patient IgG revealed no clinical alterations; in contrast, those receiving 90 or 120 mg of patient IgG developed erythema, focal erosions, and small crusts. The control grafts challenged with equivalent doses of normal human IgG showed no clinical alterations. B. Histopathological Examination Light microscopy studies of hematoxylin eosin–stained skin from neonatal mice injected with rabbit anti-laminin 5 IgG or Fab fragments revealed broad areas of subepidermal blister formation (Figure 16.1B). These subepidermal blisters were present as early as 6 hours after injection and were free of leukocytic infiltrates, dermal edema, or necrotic keratinocytes. Similar results of
1391_C16.fm Page 256 Tuesday, November 18, 2003 5:20 PM
256
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
A
C
B
D
Figure 16.1
(A) Passively transferred anti-laminin 5 IgG specifically induces large tense blisters (see arrow) on the abdomen of neonatal BALB/c mouse. (B) Hematoxylin- and eosin-stained section of flank skin from anti-laminin 5 IgG-recipient mouse shows separation (see arrow) of epidermis from epidermal basement membrane and the subepidermal blister, without leukocytic infiltrates, dermal edema, or necrotic keratinocytes. Direct immunofluorescence microscopy studies show in situ deposits of rabbit IgG (C) and murine C3 (D) at the skin basement membrane of the anti-laminin 5 IgG-recipient mouse and negative deposits on control mouse for immunoreactive rabbit IgG or murine C3 (data not shown).
noninflamatory subepidermal blisters were found in adult mice challenged with anti-laminin 5 IgG. The microscopic blisters consistently showed at 6 hours after injection. Twenty-four hours later they remained noninflammatory, but they had enlarged and were associated with focal sites of epidermal loss. At 48 hours, biopsies showed erosions and mild leukocytic infiltrate typical of a healing wound. Light microscopy of human skin grafts injected with rabbit anti-laminin 5 IgG or human antilaminin 5 IgG revealed noninflammatory, subepidermal blisters, whose extent correlated with the dose of antibodies administered. All mice challenged with normal rabbit IgG, normal human IgG, or BSA showed normal intact skin devoid of specific histological alterations. C. Immunopathological Data Direct IF microscopy of skin from neonatal and adult mice that received rabbit anti-laminin 5 IgG revealed continuous deposits of rabbit IgG in epidermal basement membranes (Figure 16.1C). In blistered skin, such deposits were localized to the dermal side of the sample. In addition to deposits of rabbit IgG, continuous deposits of murine C3 were also found in the epidermal basement membranes of all mice that received rabbit anti-laminin 5 antibodies (Figure 16.1D). There were no deposits of rabbit IgG or murine C3 in basement membranes of control animals. All grafted mice challenged with patient anti-laminin 5 IgG showed in situ deposits of human IgG in the epidermal BM of grafts and there was no evidence of human IgG in the adjacent murine epidermal BM. Moreover, the predominant subclass of IgG in graft epidermal BM was IgG4, as it is seen in patients with AECP.
1391_C16.fm Page 257 Tuesday, November 18, 2003 5:20 PM
EXPERIMENTAL MOUSE MODEL OF MUCOUS MEMBRANE PEMPHIGOID
257
Direct immunogold electron microscopy studies from a representative BALB/c mouse that received 5mg/g of body weight of anti-laminin 5 IgG showed deposits of rabbit IgG to the interface of the lamina lucida and the lamina densa. There were no deposits of gold beads in the skin of the control mouse. Indirect IF microscopy of sera obtained from mice after passive transfer of anti-laminin 5 IgG identified circulating rabbit or human IgG that bound to the dermal side of 1 M-NaCl split human skin. Titers of circulating IgG antibodies correlated with the dose of the passively transferred antibody and ranged from 5120 to 40,960 for rabbit anti-laminin 5 IgG and from 10 to 40 for human anti-laminin 5 IgG.
V. THERAPEUTIC RESPONSE We assessed the ability of systemic glucocorticosteroids to alter the pathogenic activity of antilaminin 5 IgG in an adult mouse model. In these studies adult BALB/c mice were pretreated with 2 or 20 mg per kg of dexamethasone intraperitoneally and 24 hours later, these mice were challenged with 5 mg of rabbit anti-laminin 5 IgG, normal rabbit IgG, or BSA subcutaneously. The experimental mice were killed 24 hours later and their skin was evaluated by light and IF microscopy. Interestingly, all mice pretreated with dexamethasone and injected with anti-laminin 5 antibodies developed focal erosions, crusts, and peeling of skin, and these findings were identical to those seen in untreated BALB/c mice (treated intraperitoneally with PBS).
VI. LESSONS LEARNED Laminin 5 is a heterotrimeric adhesion molecule that is associated with anchoring filaments in the lamina lucida of human epidermal BM [20,23,27]. These filaments represent an adhesion complex that anchors basal keratinocytes to epidermal BM. Laminin 5 is produced by human keratinocytes [28] and serves as a major integrin ligand for these cells. Studies of patients with CP showed that around 5% of these patients have IgG anti-BM autoantibodies directed against laminin 5. Our passive transfer animal model has provided a substantial perspective on the significance of anti-laminin 5 autoantibodies in patients with AECP. We were able to show that administration of rabbit anti-laminin 5 IgG or its Fab fragments to neonatal mice elicited subepidermal blisters of skin and mucous membranes within 6 hours, peeling of epidermis at 12 hours, and tense blisters by 24 hours. This process was independent of complement activation DBA/2NCr (C5-deficient mice), mast cell degranulation W/Wv (mast cell-deficient mice), as well as the presence of T cells (athymic nude and SCID mice). While the pathomechanisms of this effect have not been determined, it is supported by a number of experimental observations. It has been shown that monoclonal antibodies directed against the G domain of laminin 5 a subunit block human keratinocytes adhesion to extracellular matrix, split skin in vitro, and promote detachment and internalization of hemidesmosomes in 804G cells [29–32]. Interestingly, our studies have shown that the G domain of the laminin 5 a subunit is targeted by autoantibodies in most patients with AECP [33]. Given the complex interactions that laminin 5 has with other basement membrane proteins, it is possible that antibodies against this protein may physically or biochemically interfere with its function as an integrin ligand or may either activate or block signaling pathways that negatively affect the adhesiveness of overlying keratinocytes. The demonstration that IgG from patients with AECP elicited noninflammatory subepidermal blisters in human skin grafts on SCID mice extended our observations and showed that such autoantibodies play a direct role in the pathogenesis of this autoimmune blistering disease. These results provided proof that anti-laminin 5 IgG can be pathogenic in vivo and confirmed that laminin 5 plays
1391_C16.fm Page 258 Tuesday, November 18, 2003 5:20 PM
258
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
a critical role in epidermal adhesion. They also established an animal model that can be used to further define disease mechanisms and treatment modalities.
ACKNOWLEDGMENT I am grateful to Dr. Kim B. Yancey for his invaluable mentorship and support during my fellowship and for making this book chapter possible.
REFERENCES 1. Fine, J.D., Cicatricial pemphigoid, bullous pemphigoid, and epidermolysis bullosa acquisita antigens: differences in organ and species specificities and localization in chemically-separated human skin of three basement membrane antigens, Coll. Relat. Res., 5, 369, 1985. 2. Hardy, K.M. et al., Benign mucous membrane pemphigoid, Arch. Dermatol., 104, 467, 1971. 3. Katz, S.I., The epidermal basement membrane: structure, ontogeny and role in disease, Ciba Found. Symp., 108, 243, 1984. 4. Balding, S.D. et al., Cicatricial pemphigoid autoantibodies react with multiple sites on the BP180 extracellular domain, J. Invest. Dermatol., 106, 141, 1996. 5. Chan, L.S. et al., Laminin-6 and laminin-5 are recognized by autoantibodies in a subset of cicatricial pemphigoid, J. Invest. Dermatol., 108, 848, 1997. 6. Domloge-Hultsch, N. et al., Antiepiligrin cicatricial pemphigoid. A subepithelial bullous disorder, Arch. Dermatol., 130, 1521, 1994. 7. Domloge-Hultsch, N. et al., Epiligrin, the major human keratinocyte integrin ligand, is a target in both an acquired autoimmune and an inherited subepidermal blistering skin disease, J. Clin. Invest., 90, 1628, 1992. 8. Ghohestani, R.F. et al., Identification of a 168-kDa mucosal antigen in a subset of patients with cicatricial pemphigoid, J. Invest. Dermatol., 107, 136, 1996. 9. Horiguchi, Y. et al., An acquired bullous dermatosis due to an autoimmune reaction against uncein, Br. J. Dermatol., 134, 934, 1996. 10. Labib, R.S. et al., Molecular heterogeneity of the bullous pemphigoid antigens as detected by immunoblotting, J. Immunol., 136, 1231, 1986. 11. Lazarova, Z. et al., Antiepiligrin cicatricial pemphigoid represents an autoimmune response to subunits present in laminin 5 (alpha3beta3gamma2), Br. J. Dermatol., 139, 791, 1998. 12. Luke, M.C. et al., Mucosal morbidity in patients with epidermolysis bullosa acquisita, Arch. Dermatol., 135, 954, 1999. 13. Sarret, Y. et al., Bullous pemphigoid and cicatricial pemphigoid: immunoblotting detection of involved autoantigens, Autoimmunity, 2, 145, 1989. 14. Smith, E. P. et al., Identification of a basement membrane zone antigen reactive with circulating IgA antibody in ocular cicatricial pemphigoid, J. Invest. Dermatol., 101, 619, 1993. 15. Tyagi, S. et al., Ocular cicatricial pemphigoid antigen: partial sequence and biochemical characterization, Proc. Natl. Acad. Sci. U. S. A., 93, 14714, 1996. 16. Bean, S.F. et al., Cicatricial pemphigoid. Immunofluorescent studies, Arch. Dermatol., 106, 195, 1972. 17. Bedane, C. et al., Bullous pemphigoid and cicatricial pemphigoid autoantibodies react with ultrastructurally separable epitopes on the BP180 ectodomain: evidence that BP180 spans the lamina lucida, J. Invest. Dermatol., 108, 901, 1997. 18. Bernard, P. et al., The major cicatricial pemphigoid antigen is a 180-kD protein that shows immunologic cross-reactivities with the bullous pemphigoid antigen, J. Invest. Dermatol., 99, 174, 1992. 19. Chan, L.S. et al., The first international consensus on mucous membrane pemphigoid: definition, diagnostic criteria, pathogenic factors, medical treatment, and prognostic indicators, Arch. Dermatol., 138, 370, 2002. 20. Carter, W.G., Ryan, M.C., and Gahr, P.J., Epiligrin, a new cell adhesion ligand for integrin alpha 3 beta 1 in epithelial basement membranes, Cell, 65, 599, 1991.
1391_C16.fm Page 259 Tuesday, November 18, 2003 5:20 PM
EXPERIMENTAL MOUSE MODEL OF MUCOUS MEMBRANE PEMPHIGOID
259
21. Ryan, M.C. et al., Cloning of the LamA3 gene encoding the alpha 3 chain of the adhesive ligand epiligrin. Expression in wound repair, J. Biol. Chem., 269, 22779, 1994. 22. Kirtschig, G. et al., Anti-basement membrane autoantibodies in patients with anti-epiligrin cicatricial pemphigoid bind the alpha subunit of laminin 5, J. Invest. Dermatol., 105, 543, 1995. 23. Rousselle, P. et al., Kalinin: an epithelium-specific basement membrane adhesion molecule that is a component of anchoring filaments, J. Cell Biol., 114, 567, 1991. 24. Lazarova, Z. et al., Fab fragments directed against laminin 5 induce subepidermal blisters in neonatal mice, Clin. Immunol., 95, 26, 2000. 25. Lazarova, Z. et al., Passive transfer of anti-laminin 5 antibodies induces subepidermal blisters in neonatal mice, J. Clin. Invest., 98, 1509, 1996. 26. Lazarova, Z. et al., Human anti-laminin 5 autoantibodies induce subepidermal blisters in an experimental human skin graft model, J. Invest. Dermatol., 114, 178, 2000. 27. Yancey, K.B., Adhesion molecules. II: Interactions of keratinocytes with epidermal basement membrane, J. Invest. Dermatol., 104, 1008, 1995. 28. Marinkovich, M.P., Lunstrum, G.P., and Burgeson, R.E., The anchoring filament protein kalinin is synthesized and secreted as a high molecular weight precursor, J. Biol. Chem., 267, 17900, 1992. 29. Baker, S.E. et al., Laminin-5 and hemidesmosomes: role of the alpha 3 chain subunit in hemidesmosome stability and assembly, J. Cell Sci., 109, 2509, 1996. 30. Borradori, L. and Sonnenberg, A., Hemidesmosomes: roles in adhesion, signaling and human diseases, Curr. Opin. Cell Biol., 8, 647, 1996. 31. Christiano, A.M. and Uitto, J., Molecular complexity of the cutaneous basement membrane zone. Revelations from the paradigms of epidermolysis bullosa, Exp. Dermatol., 5, 1, 1996. 32. Shimizu, H., New insights into the immunoultrastructural organization of cutaneous basement membrane zone molecules, Exp. Dermatol., 7, 303, 1998. 33. Lazarova, Z. et al., IgG autoantibodies in patients with anti-epiligrin cicatricial pemphigoid recognize the G domain of the laminin 5 alpha-subunit, Clin. Immunol., 101, 100, 2001.
1391_C16.fm Page 260 Tuesday, November 18, 2003 5:20 PM
1391_C17.fm Page 261 Tuesday, November 18, 2003 5:21 PM
SECTION
D
Pemphigus Vulgaris
1391_C17.fm Page 262 Tuesday, November 18, 2003 5:21 PM
1391_C17.fm Page 263 Tuesday, November 18, 2003 5:21 PM
CHAPTER
17
Spontaneous Canine Model of Pemphigus Vulgaris Thierry Olivry
CONTENTS I. II. III. IV. V.
History ................................................................................................................................263 Animals ..............................................................................................................................264 Epidemiology .....................................................................................................................264 Course of Disease ..............................................................................................................264 Assessment of Disease.......................................................................................................265 A. Clinical Manifestation ...............................................................................................265 B. Histopathological Examination .................................................................................266 C. Immunopathological Data .........................................................................................268 1. Direct Immunofluorescence (IF) Microscopy .....................................................268 2. Indirect Immunofluorescence Microscopy ..........................................................268 3. Immunoblotting, Immunoprecipitation, and ELISA...........................................268 D. Immunogenetics.........................................................................................................269 VI. Therapeutic Responses.......................................................................................................269 VII. Expert Experience ..............................................................................................................269 VIII. Lessons Learned.................................................................................................................270 IX. Conclusion..........................................................................................................................271 References ......................................................................................................................................272
I. HISTORY Pemphigus vulgaris (PV) was the first subset of pemphigus identified in an animal species outside of human patients. In 1975, two small case series of canine PV were published consecutively in the same issue of the Journal of the American Veterinary Medical Association [1,2]. In the last 20 years, PV has been reported in animals of other species, such as cats [3], one pigtail macaque [4], and one llama [5]. In spite of PV being the first type of pemphigus identified in dogs, it appears to be very rare in this species. Indeed, original information on canine PV can be compiled from only nine single case reports [6–14] and eight series, encompassing few cases [1–3,15–19]. At least six patients published as single cases [12–15,18] were later included in one of the larger three case series [3,17,19]. At this time, and to my knowledge, detailed information on only 52 different dogs with PV can be found in the literature. 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
263
1391_C17.fm Page 264 Tuesday, November 18, 2003 5:21 PM
264
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
In 1998, a severe and fatal variant of PV was recognized in one dog with thymus lymphosarcoma [20]. Immunological investigations confirmed the homology of this canine disease [20,21] with paraneoplastic pemphigus (PNP) that affects human patients [22]. In fact, one of the first dogs reported as having PV (case 1 in Stannard et al. [1]) exhibited a severe clinical phenotype, microscopic lesions consisting of suprabasal acantholysis, keratinocyte apoptosis, and lymphocyte epitheliotropism, as well as a thymoma. It is conceivable, therefore, that this dog could have suffered from PNP instead of PV. Because only one single case of canine PNP has been reported as such, this disease will not be discussed further, and the reader is referred to the two papers describing clinical and immunological investigations on this patient [20,21].
II. ANIMALS By virtue of its rarity, few case series of canine PV have been reported [1–3,15–17,19]. Furthermore, these articles described patients seen in Switzerland [16], France [17], or the United States [1–3,15,19]. Because of a lack of reference population, a breed predisposition cannot be established with certainty. Nevertheless, it should be noted that German shepherd dogs and collies appear to be overrepresented among all dogs reported in the literature as having PV. Indeed, the former breed accounts for 8 of 52 dogs with PV (15%), while 6 of 52 (12%) dogs are collies. When the information on all 52 dogs with PV is pooled, the median age of onset is 6 years (range, 10 months to 14 years). Twenty-five of 52 dogs (48%) developed the disease after 7 years of age — in the canine species, this age corresponds to that of elderly human patients. In this meta-analysis of 52 dogs, males outnumber females (male:female ratio, 31:21 = 1.48).
III. EPIDEMIOLOGY Regrettably, very little epidemiological information is available on canine PV. In a veterinary teaching hospital (New York State College of Veterinary Medicine at Cornell University), PV was diagnosed in 12 of 9750 dogs between 1975 and 1984. This proportion results in an estimated prevalence of PV of approximately 12 per 10,000 canine patients presented to a university dermatology referral practice (incidence: 1 per 1000 canine patients referred for skin diseases per year). In another institution (Michigan State University College of Veterinary Medicine), PV was the diagnosis established in 4% of surgical skin biopsies read by veterinary pathologists (R.W. Dunstan, World Small Animal Veterinary Association Meeting, Birmingham, UK, 1997). Finally, in a retrospective study of 84 dogs with autoimmune skin diseases, PV was the diagnosis given to 12 subjects (14%) [23]. Therefore, in spite of PV being the first variant of pemphigus identified in the canine species, this disease appears to be among the rarest autoimmune dermatoses of dogs.
IV. COURSE OF DISEASE Despite the scarcity of reports, various observations can be made on the course of canine PV. In most patients, lesions of PV will occur first in the oral cavity (14 of 25 dogs for which this information could be extracted from reports, or 56%), or they will develop at mucocutaneous junctions before worsening progressively both in severity and extent. The diagnosis is usually made within weeks to months after the initial flare. Immunosuppressive therapy can result in partial or complete remission (see Section VI for more details), and a single case of spontaneous remission has been reported [3].
1391_C17.fm Page 265 Tuesday, November 18, 2003 5:21 PM
SPONTANEOUS CANINE MODEL OF PEMPHIGUS VULGARIS
Figure 17.1
265
Clinical phenotype of canine PV: primary skin lesion of canine PV manifested as a transient flaccid vesicle (left) that ruptures, easily leaving shreds of separated epithelium (right).
V. ASSESSMENT OF DISEASE A. Clinical Manifestation The pooling of all published descriptions of canine PV allows a meta-analysis of 52 cases, and this compilation provides clinically relevant information on the nature and distribution of skin lesions seen in this disease. In almost all dogs with PV, fragile and transient flaccid vesicles (Figure 17.1) (15 of 40 dogs for which this information was retrievable, or 38%) develop and they are rapidly broken leaving behind large erosions (48 of 52, 92%). Rubbing of the lesional edge usually causes wider epithelial sloughing (positive Nikolskiy’s sign). Trauma to eroded areas can result in deeper ulceration (37 of 52, 71%). When lesions affect nonmucosal skin, crusting can be seen. Nasal depigmentation was reported in few patients (3 of 39, 8%). Erythema can precede vesicle formation, especially in haired skin areas (8 of 39, 21%). Most lesions of “classical” canine PV will be seen first, usually in a bilaterally symmetrical pattern, on mucosal surfaces and mucocutaneous junctions. According to information available, affected areas include the oral cavity (Figure 17.2) (31 of 40 dogs, 78%); concave ear pinnae and auditory orifices (20 of 40, 50%); nasal planum (nose tip) (18 of 40 dogs, 45%); lip margins (14 of 40, 35%); genitalia (13 of 40, 33%); anus (10 of 40, 25%); or periocular skin (9 of 40, 23%). Of note is that erosive perionyxis/paronychia has been reported for 6 of 40 patients (15%) in whom it is usually associated with onychomadesis (shedding of claws) (5 of 40, 13%). The disease will evolve frequently from a mucosal predominant to a mucocutaneous phenotype. Haired skin lesions will be seen most commonly (18 of 35 dogs, 51%) on areas of friction and trauma such as axillae, groin (Figure 17.3), and lateral pressure points of the limbs (hocks, knees, and feet). Footpad sloughing has been described in some dogs (5 of 40, 13%). In approximately one half of dogs with PV (22 of 46, 48%), skin lesions are associated with systemic signs such as lethargy and depression. In several patients — all reported with oral involvement — hypersalivation, halitosis, anorexia, or weight loss was described. Several articles propose recognizing the existence of variants of canine PV. Two German shepherd dogs and a collie exhibited a “milder” form of PV with erosions and ulcers predominating on the dorsal muzzle and nasal planum. In these three dogs, oral or mucosal lesions were not
1391_C17.fm Page 266 Tuesday, November 18, 2003 5:21 PM
266
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Figure 17.2
Clinical presentation of oral lesion in canine PV: extensive blisters and erosions occur in oral cavity of a dog.
Figure 17.3
Characteristic advanced clinical findings in canine PV: erosions and ulcerations on friction areas and pressure points.
reported [10,15,17]. Similarly, erosive dermatitis of the nasal planum was the chief complaint in two dogs with PV [18], while PV restricted to the oral cavity was reported in four other subjects [1,2,17,19]. Notably, perionyxis and onychomadesis were the sole manifestations of PV in two canine patients [15,17]. Finally, a Boston terrier was shown to exhibit patches of spontaneous alopecia associated with suprabasal acantholysis of the mid-hair follicles [14]. B. Histopathological Examination Until now, the diagnosis of PV has been made on adult dogs that present compatible skin lesions with supportive histopathology. In more than 90% of canine PV cases published thus far, microscopic examination of lesional skin biopsies has revealed suprabasal acantholysis (Figure 17.4) leading to deep epidermal cleavage (Figure 17.5). Cell–cell separation usually leaves a single
1391_C17.fm Page 267 Tuesday, November 18, 2003 5:21 PM
SPONTANEOUS CANINE MODEL OF PEMPHIGUS VULGARIS
267
Figure 17.4
Histopathology of an early canine PV lesion: early lesions of canine PV consist of cell–cell separation (acantholysis) that occurs within and above the stratum basale.
Figure 17.5
Histopathology of a typical canine PV lesion: suprabasal acantholysis results in deep epidermal vesicles leaving keratinocytes appearing as a “row of tombstones” at the floor of the clefts (black arrowhead). Occasionally, clusters of acantholytic keratinocytes can be seen (gray arrowhead).
keratinocyte layer at the floor of the clefts (the so-called “row of tombstone cells”) [3,17]. Occasionally, free-floating acantholytic keratinocytes are observed within deep intraepidermal vesicles (Figure 17.5) [17]. In rare instances, suprabasal acantholysis is described primarily along the infundibulum of hair follicles [10,15]. In another case, this process was seen exclusively in the isthmus portion of primary follicles [14]. Because of the fragile nature of the intraepidermal vesicles, most skin biopsies exhibit severe epidermal erosion, ulceration, and granulation tissue. The mucosal origin of most lesions results in frequent bacterial colonization. In skin biopsies of dogs with PV, there is variable dermal inflammatory infiltrate, depending upon the location and age of the lesion sampled. Well-developed lesions exhibit more infiltrate than earlier ones. Ulcerated sections will be associated with marked neutrophilic extravasation. Finally, microscopic examination of samples from mucosal or mucocutaneous junctions usually reveals a superficial dermal lymphoplasmacytic band, a nonspecific inflammatory pattern characteristic of mucosal inflammation [14].
1391_C17.fm Page 268 Tuesday, November 18, 2003 5:21 PM
268
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
C. Immunopathological Data 1. Direct Immunofluorescence (IF) Microscopy Results of direct IF testing of lesional/perilesional skin biopsy specimens have been retrieved from reports of 31 dogs with PV [3,7,10,11,15,16,19]. In 22 of 28 subjects (79%), this method uncovered IgG deposited on the cell surface of keratinocytes in all layers of the epidermis, with a typical “honeycomb” or “fishnet” pattern characteristic for diseases of the pemphigus group. Intercellular epidermal IgA or IgM deposits were visualized only in 3 of 27 (11%) and 2 of 26 (8%) dogs, respectively. Remarkably, activated complement (C3) was not found in any of 21 dogs for which results of this test were reported. 2. Indirect Immunofluorescence Microscopy Indirect IF data could be compiled from six reports encompassing 30 dogs with PV [2,3,6,7,19,24]. In the first publications [2,6,7,24], indirect IF was described as positive for all seven tested sera. In the largest case series [3], however, specific details on the methodology used were not provided, and results were reported as universally negative for all 12 sera tested. In the most recent case series [19], circulating anti-keratinocyte, cell surface IgG autoantibodies were detected in 10 of 11 (91%) and 5 of 11 (45%) dogs with PV using normal canine lip and cultured canine oral squamous cell carcinoma cells, respectively. Furthermore, we established recently that circulating antikeratinocyte cell-surface autoantibodies belonged to various isotypes such as IgG4 (6 of 7 dogs, 86%); IgG1 (71%); IgG3 (71%); or IgG2 (29%) (T.O., unpublished data, 2000). Variation in methodology, choice of substrates or quality of reagents used for the indirect IF method are possible explanations for the discrepancy in reported frequencies of detection of circulating IgG autoantibodies. 3. Immunoblotting, Immunoprecipitation, and ELISA In 1993, the report of an immunoblotting study confirmed that IgG from a human patient with PV bound to a 130-kDa antigen extracted from dispase-separated canine lip epithelium [25]. This observation established the existence of a canine homologue of the human PV antigen, desmoglein3 (Dsg3), but proof that this antigen was targeted by autoantibodies from dogs with PV was lacking. In 1997, results of immunoblotting studies performed with the serum of one dog with PV tested on a canine cultured skin keratinocyte extract, revealed that circulating IgG autoantibodies targeted a 130/160-kDa antigen doublet suspected to represent canine Dsg3 and Dsg1, respectively [26]. Five years later, a canine oral keratinocyte antigen of 130 kDa molecular weight was found to be bound by IgG in seven of nine (78%) dogs with PV [19]. The identity of this 130-kDa antigen was finally determined to represent canine Dsg3 by immunoprecipitation immunoblotting [19]. Because 130-kDa canine Dsg3 is identified by serum IgG from more than half of dogs with PV, this antigen can be established as a major canine PV antigen. Whether additional epidermal antigens are targeted by circulating autoantibodies in this disease has not been proven with certainty. In one dog with mucocutaneous PV, circulating IgG autoantibodies were found to recognize not only Dsg3, but also antigens of 190 and 210 kDa suspected to represent periplakin and envoplakin, respectively [13]. Additionally, preliminary results from ELISA using recombinant extracellular human Dsg1 and Dsg3 [27] suggest that the autoantibody repertoire in canine PV is similar to that of the human disease [28]. Indeed, using sera from five dogs with PV, we observed that subjects with a mucocutaneous phenotype exhibited serum IgG
1391_C17.fm Page 269 Tuesday, November 18, 2003 5:21 PM
SPONTANEOUS CANINE MODEL OF PEMPHIGUS VULGARIS
269
that targeted both Dsg1 and Dsg3, whereas those animals with lesions restricted to mucosa solely exhibited autoantibodies against Dsg3 (T.O. and R. Ghohestani, unpublished data, 2000). D. Immunogenetics At this time, available reports on canine PV have not yielded sufficient information to provide meaningful data on a genetic predisposition for this disease. As stated above, the German shepherd and collie breeds appear overrepresented among dogs with this dermatosis, but a specific odds ratio cannot be calculated because of lack of a reference population.
VI. THERAPEUTIC RESPONSES The treatment of canine PV historically has relied on the administration of standard immunosuppressive protocols using high-dose oral corticosteroids with or without cytotoxic drugs (azathioprine, cyclophosphamide, or chlorambucil per os). In the article detailing the largest case series of dogs with this disease [3], the authors reported that PV was “rewarding to treat.” Careful review of all published cases, however, contradicts this optimistic viewpoint. Indeed, out of 45 dogs with PV for whom outcome information was retrievable, four individuals died spontaneously within months of diagnosis, and another 13 were euthanized (total deaths, 17 of 45 dogs or 38%). The leading causes for euthanasia requests were the severity of skin and mucosal lesions, lack of response to treatment, and the development of severe adverse effects due to prolonged high-dose corticosteroid therapy. Nevertheless, partial or complete remission could be achieved for most dogs with PV using standard-of-care immunosuppression. In an alternative to such treatment, chrysotherapy with injectable aurothioglucose was prescribed to five dogs, and the outcome was described as successful in four patients [3,8,16]. The prognosis of the “milder” or “localized” variants of canine PV appears to be better than that of dogs with the more classical mucosal/mucocutaneous phenotype. Indeed, none of such patients died or were euthanized. Moreover, in one dog with muzzle-predominant phenotype, skin lesions failed to respond to combination immune suppression [10]. This German shepherd was then treated with low-dose subcutaneous heparin therapy [10]. Similar to what was reported in an observational study of human PV [29], skin lesions from this canine patient abated following heparin monotherapy (100 IU/kg, twice daily). After a relapse, lesions were controlled temporarily with heparin and low-dose prednisone [10]. Of note is that spontaneous resolution of lesions has been reported for only one of 45 dogs with PV [3].
VII. EXPERT EXPERIENCE When dogs are presented with an acquired blistering and erosive skin disease affecting initially mucosa and mucocutaneous junctions and then progresses to involve skin areas of friction, few differential diagnoses must be investigated. As alternatives to canine PV, clinicians should consider principally paraneoplastic pemphigus, epidermolysis bullosa acquisita and type I bullous systemic lupus erythematosus, vesicular cutaneous lupus erythematosus (especially in the collie breed), and severe variants of the erythema multiforme/Stevens–Johnson syndrome spectrum. The final diagnosis will be made from assembling clinical, histopathological, and immunological findings. In light of data compiled from our meta-analysis of 52 cases of canine PV, we propose that the diagnosis of canine PV be made by satisfaction of three of four criteria below:
1391_C17.fm Page 270 Tuesday, November 18, 2003 5:21 PM
270
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
• Clinical examination: mucosal, mucocutaneous, or cutaneous flaccid vesicles progressing to erosions and ulcers • Histopathology: suprabasal epithelial acantholysis with cleft formation • Immunofluorescence: epithelium-fixed (direct method) or circulating (indirect method) IgG autoantibodies binding the cell membrane of gingival keratinocytes • ELISA or immunoblotting: circulating autoantibodies targeting desmoglein-3
Note that a rapidly progressing disease with prominent mucosal, nasal, and internal (esophageal) erosions should prompt the search for internal neoplasia. If such cancer is detected, the diagnosis of paraneoplastic pemphigus should be considered. Positive indirect immunofluorescence performed on mammalian bladder will support such a diagnosis.
VIII. LESSONS LEARNED Canine PV is remarkable in that it was the first autoimmune dermatosis recognized in this species [1,2], yet it is suspected to be among the rarest of such diseases. Limited epidemiological data suggest an incidence of one case per 1000 referred each year to a university veterinary dermatology practice [3]. Unfortunately, this report did not provide information on the canine population corresponding to the geographical area likely to be referred to this institution. Therefore, the “true” incidence of canine PV cannot be compared to that of the disease seen in human beings (one to five cases per million people per year [30]). In humans, several HLA haplotypes are associated with an increased risk to develop PV (reviewed in Hertl et al. [31] and Martel and Joly [32]), and such observation implies that genetic factors underlie this disease. Indeed, the association of selected alleles and PV is probably the result of the direct ability of major histocompatibility complex molecules to present Dsg-3 peptides to autoreactive T lymphocytes [31,32]. In the canine species, there are no data available on PVpredisposing DLA alleles, but the overrepresentation of two breeds (German shepherd and collie) accounting for one-fourth of patients reported with this entity suggests the existence of a genetic predilection for canine PV. Human individuals can suffer from PV at all ages, but lesions develop most commonly between the fourth and sixth decades (reviewed in Becker and Gaspari [30]). This illness reportedly affects patients of both genders equally [30]. In the dog, lesions of PV also are seen predominantly during adulthood (median age of onset, 6 years), and half of diseased subjects are old animals. Surprisingly, male dogs outnumber females by 50%. Clinical aspects of PV appear remarkably similar between canine and human patients. In both species, lesions commonly arise first in the oral cavity [33], in other mucosa or at mucocutaneous junctions. The disease usually will expand later to skin [30,34], especially in areas of friction or pressure [30]. In rare canine patients, PV without mucosal involvement has been reported [10,15]. In both humans and dogs, the primary lesion of PV is a flaccid vesicle with indistinct borders [30]. Such lesions are seen more commonly on skin than oral mucosa [30]. Pressure exerted on the edge (Nikolskiy sign) or the top (Asboe–Hansen sign) of vesicles results in peripheral extension of the blistering process [35,36]. Because of the fragile nature of vesicles and bullae, premature rupture results in painful erosions with shreds of detached epithelium at the edge [30]. Lesions extend peripherally and show little tendency to heal [30]; further trauma to denuded areas results in deeper ulcerations and serosanguineous crusting [30]. Perionyxis and onychomadesis can be early, and may be sole or concomitant lesions of human and canine PV [37]. Cutaneous lesions of canine PV exhibit a remarkable bilateral symmetry, especially on the face. In both humans and dogs with PV, pruritus is minimal, but cutaneous pain can be severe. Associated systemic signs frequently include halitosis, hypersalivation, anorexia, weight loss, lethargy, and depression, especially when oral or pharyngeal involvement is severe [30].
1391_C17.fm Page 271 Tuesday, November 18, 2003 5:21 PM
SPONTANEOUS CANINE MODEL OF PEMPHIGUS VULGARIS
271
Microscopic lesions of PV are identical in human beings and dogs. Early changes are characterized by widening of intercellular spaces within and above the stratum basale of malpighian epithelia [30]. The disease progresses to suprabasal acantholysis resulting in deep epidermal clefts; this process leaves cuboidal basal cells arranged on the floor of microscopic vesicles as “rows of tombstones” [30]. On haired skin samples, suprabasal acantholysis can be seen within superior segments of hair follicles. Such follicular involvement can be prominent in nonmucosal forms of canine PV [10,14,15]. When biopsies are obtained from mucosal epithelium, superficial dermal inflammatory infiltrate can be observed, consisting primarily of lymphocytes and plasma cells. Review of currently available information suggests that the immunopathology of human and canine PV is similar. Direct IF performed on perilesional or lesional specimens will reveal in situ deposition of IgG, and occasionally IgA or IgM [30]. Activated complement can be detected in up to 50% of human patients [30], but it was not visualized in any of 21 dogs with PV. The indirect IF method, performed on lip or esophageal epithelium, permits the detection of circulating IgG autoantibodies in up to 90% of human [30] and canine patients [19] with PV. In humans, the disease activity generally correlates with serum titers of anti-keratinocyte cell surface antibodies (reviewed in Olivry et al. [19]), but it is not known whether this is the case in the canine homologue. In both humans and dogs with PV, circulating autoantibodies belong predominantly to IgG4 and IgG1 isotypes [38,39] (T.O., unpublished data, 2000). Immunoblotting, immunoprecipitation, and ELISA have now firmly established the cadherin Dsg3 as the main autoantigen of human PV [40]. As a mucosal-predominant disease involves into a mucocutaneous phenotype, autoantibodies against Dsg1 (pemphigus foliaceus antigen) usually are detected [28,34]. Autoantibodies directed against keratinocyte cholinergic receptors also are suspected by some authors to be relevant to the pathogenesis of the human disease (reviewed in Grando [41]). In the dog, Dsg3 has been established recently as a major canine PV autoantigen [19]. The targeting of additional keratinocyte antigens by circulating autoantibodies has been rarely shown in dogs with PV, but the characterization of major canine PV antigens other than Dsg3 has not been undertaken. Recently, canine Dsg3 has been cloned and expressed in the baculovirus system [42]. This study also confirmed Dsg3 as a PV autoantigen in dogs [42]. Oral corticosteroids remain the cornerstone of treatment for PV in human beings, and their introduction into standard care led to a marked decrease in patient mortality [30]. Unfortunately, prolonged use of high-dose oral corticosteroids is associated with debilitating adverse drug effects. When PV lesions fail to abate with corticosteroids alone, cytotoxic agents such as methotrexate, azathioprine, cyclophosphamide, and mycophenolate mofetil are added to the treatment regimen [30]. Complete and durable remission of human PV can be induced in most individuals, and within 10 years, therapy can be discontinued without further flare-up of the disease in two-thirds of patients [43]. The systematic review of treatment outcome of published reports of canine PV allows three relevant observations. First, partial to complete remission can be induced with oral corticosteroids alone, or in combination with cytotoxic drugs, in more than half of dogs with PV. Second, disease prognosis appears to be better for mild variants of PV than for the classical mucocutaneous form. Finally, the severity of the disease, lack of response of lesions to treatment, and/or severity of adverse drug effects lead pet owners to request euthanasia for humane reasons in approximately 40% of affected dogs.
IX. CONCLUSION This meta-analysis of 52 dogs provides strong evidence that canine PV can be considered a natural model for the human disease, both at the epidemiological, clinical, histologic, and immunological levels. Therefore, the study of dogs with PV should provide valuable information for the human disease counterpart, specifically in areas where passive or active mouse models prove of limited benefit or relevance.
1391_C17.fm Page 272 Tuesday, November 18, 2003 5:21 PM
272
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
REFERENCES 1. Stannard, A.A., Gribble, D.H., and Baker, B.B., A mucocutaneous disease in the dog resembling pemphigus vulgaris in man, J. Am. Vet. Med. Assn., 166, 575, 1975. 2. Hurvitz, A.I. and Feldman, E., A disease in dogs resembling human pemphigus vulgaris: case reports, J. Am. Vet. Med. Assn., 166, 585, 1975. 3. Scott, D.W. et al., Immune-mediated dermatoses in domestic animals: ten years after — Part I, Comp. Cont. Educ. Pract. Vet., 9, 424, 1987. 4. Wolff, P.L. et al., Pemphigus vulgaris in a pigtail macaque, J. Am. Vet. Med. Assn., 189, 1220, 1986. 5. Miller, W.H. et al., Pemphigus vulgaris in a llama, Vet. Dermatol., 2, 97, 1991. 6. Hoskins, J.D. et al., Pemphigus vulgaris in the dog: a case report, J. Am. Anim. Hosp. Assn., 13, 164, 1977. 7. Parker, W.M., Pemphigus vulgaris in a border collie, Can. Vet. J., 19, 317, 1978. 8. Olynyk, G.P. and Guthrie, B.J., Canine pemphigus vulgaris treated with gold salt therapy, Can. Vet. J., 25, 168, 1984. 9. Brabenetz, J., [Pemphigus vulgaris in a dog — and your diagnosis], Wien Tierarztl. Monatsschr., 72, 217, 1985. 10. Olivry, T., Ihrke, P.J., and Atlee, B.A., Pemphigus vulgaris lacking mucosal involvement in a German Shepherd dog: possible response to heparin therapy, Vet. Dermatol., 3, 79, 1992. 11. Gonzalez, J.L. et al., [Pemphigus vulgaris in a dog], Clin. Vet. Peq. Anim., 16, 45, 1996. 12. Bensignor, E., Carlotti, D.N., and Terrier, S., [A case of pemphigus vulgaris in a German shorthaired pointer], Point. Vet., 29, 75, 1998. 13. Olivry, T., Alhaidari, Z., and Ghohestani, R.F., Anti-plakin and desmoglein autoantibodies in a dog with pemphigus vulgaris, Vet. Pathol., 37, 496, 2000. 14. Olivry, T. and Jackson, H.A., An alopecic phenotype of canine pemphigus vulgaris? Br. J. Dermatol., 145, 176, 2001. 15. Scott, D.W. et al., Pemphigus vulgaris without mucosal or mucocutaneous involvement in two dogs, J. Am. Anim. Hosp. Assn., 18, 401, 1982. 16. Suter, M. et al., [Pemphigus vulgaris and pemphigus foliaceus in the dog — report of 9 cases], Schweiz. Arch. Tierheilkd., 126, 249, 1984. 17. Carlotti, D.N. et al., [Pemphigus vulgaris in the dog: a report of 8 cases], Prat. Med. Chir. Anim. Cie., 35, 301, 2000. 18. Foster, A.P. and Olivry, T., Nasal dermatitis as a manifestation of canine pemphigus vulgaris, Vet. Rec., 148, 450, 2001. 19. Olivry, T. et al., Desmoglein-3 is a target autoantigen in spontaneous canine pemphigus vulgaris, Exp. Dermatol., 12, 198, 2003. 20. Lemmens, P. et al., Paraneoplastic pemphigus in a dog, Vet. Dermatol., 9, 127, 1998. 21. deBruin, A. et al., Periplakin and envoplakin are target antigens in canine and human paraneoplastic pemphigus, J. Am. Acad. Dermatol., 40, 682, 1999. 22. Anhalt, G.J. et al., Paraneoplastic pemphigus — an autoimmune mucocutaneous disease associated with neoplasia, N. Eng. J. Med., 323, 1729, 1990. 23. Werner, L.L., Brown, K.A., and Halliwell, R.E.W., Diagnosis of autoimmune skin disease in the dog: correlation between histopathologic, direct immunofluorescent and clinical findings, Vet. Immunol. Immunopathol., 5, 47, 1983. 24. Scott, D.W. et al., Observations on the immunopathology and therapy of canine pemphigus and pemphigoid, J. Am. Vet. Med. Assn., 180, 48, 1982. 25. Suter, M.M. et al., Identification of canine pemphigus antigens, in Advances in Veterinary Dermatology, Ihrke, P.J., Mason, I.S., and White, S.D., Eds., Pergamon Press, Oxford, 1993, p. 367. 26. Iwasaki, T. et al., Detection of canine pemphigus foliaceus autoantigen by immunoblotting, Vet. Immunol. Immunopathol., 59, 1, 1997. 27. Amagai, M. et al., Usefulness of enzyme-linked immunosorbent assay using recombinant desmogleins 1 and 3 for serodiagnosis of pemphigus, Br. J. Dermatol., 140, 351, 1999. 28. Amagai, M. et al., The clinical phenotype of pemphigus is defined by the anti-desmoglein autoantibody profile, J. Am. Acad. Dermatol., 40, 167, 1999.
1391_C17.fm Page 273 Tuesday, November 18, 2003 5:21 PM
SPONTANEOUS CANINE MODEL OF PEMPHIGUS VULGARIS
273
29. Mashkilleyson, N.A., Heparin action in pemphigus vulgaris: clinical and immunologic studies, Acta Derm. Venereol., 65, 545, 1985. 30. Becker, B.A. and Gaspari, A.A., Pemphigus vulgaris and vegetans, Dermatol. Clin., 11, 429, 1993. 31. Hertl, M. and Riechers, R., Autoreactive T cells as potential targets for immunotherapy of autoimmune bullous skin diseases, Clin. Dermatol., 19, 592, 2001. 32. Martel, P. and Joly, P., Pemphigus: autoimmune diseases of keratinocyte’s adhesion molecules, Clin. Dermatol., 19, 662, 2001. 33. Meurer, M. et al., Oral pemphigus vulgaris. A report of ten cases, Arch. Dermatol., 113, 1520, 1977. 34. Miyagawa, S. et al., Late development of antidesmoglein 1 antibodies in pemphigus vulgaris: correlation with disease progression, Br. J. Dermatol., 141, 1084, 1999. 35. Asboe-Hansen, G., Blister-spread induced by finger pressure, a diagnostic sign in pemphigus, J. Invest. Dermatol., 34, 5, 1966. 36. Salopek, T.G., Nikolskiy’s sign: is it “dry” or is it “wet”? Br. J. Dermatol., 136, 762, 1997. 37. Dhawan, S.S., Zaias, N., and Pena, J., The nail fold in pemphigus vulgaris, Arch. Dermatol., 126, 1374, 1990. 38. Futei, Y. et al., Predominant IgG4 subclass in autoantibodies of pemphigus vulgaris and foliaceus, J. Dermatol. Sci., 26, 55, 2001. 39. Spaeth, S. et al., IgG, IgA and IgE autoantibodies against the ectodomain of desmoglein 3 in active pemphigus vulgaris, Br. J. Dermatol., 144, 1183, 2001. 40. Amagai, M., Klaus-Kovtun, V., and Stanley, J.R., Autoantibodies against a novel epithelial cadherin in pemphigus vulgaris, a disease of cell adhesion, Cell, 67, 869, 1991. 41. Grando, S.A., Autoimmunity to keratinocyte acetylcholine receptors in pemphigus, Dermatology, 201, 290, 2000. 42. Nishifuji, K. et al., Cloning of canine desmoglein 3 and immunoreactivity of serum antibodies in human and canine pemphigus vulgaris with its extracellular domains, J. Dermatol. Sci., 32, 181, 2003. 43. Herbst, A. and Bystryn, J.C., Patterns of remission in pemphigus vulgaris, J. Am. Acad. Dermatol., 42, 422, 2000.
1391_C17.fm Page 274 Tuesday, November 18, 2003 5:21 PM
1391_C18.fm Page 275 Tuesday, November 18, 2003 5:23 PM
CHAPTER
18
Experimental Mouse Model of Pemphigus Vulgaris: Passive Transfer of Desmoglein-Targeting Antibodies Zelmira Lazarova and Grant J. Anhalt
CONTENTS I. History ................................................................................................................................275 II. Laboratory Animals............................................................................................................276 III. Disease Induction...............................................................................................................277 A. Preparation of IgG Fractions.....................................................................................277 B. Preparation of F(ab')2 Fragments..............................................................................277 C. Preparation of Fab' Fragments ..................................................................................277 D. Depletion of Complement by Cobra Venom Factor CoF .........................................277 E. Injection of Mice with PV IgG .................................................................................277 F. Injection of Mice with PV F(ab')2 and PV Fab' Fragments ....................................278 G. PV IgG Injection in C5-Deficient Mice....................................................................278 H. Injection of PV IgG in Mice Pretreated with CoF ...................................................278 I. Miscellaneous Techniques .........................................................................................278 IV. Course and Assessment of Disease ...................................................................................279 A. Clinical Manifestation ...............................................................................................279 B. Histopathological Findings and Ultrastructural Changes .........................................279 C. Immunopathological Data .........................................................................................280 V. Therapeutic Response ........................................................................................................280 VI. Lessons Learned.................................................................................................................281 References ......................................................................................................................................282
I. HISTORY Pemphigus vulgaris (PV) is a severe and often fatal blistering disease, affecting the skin and mucous membranes, in which intraepidermal vesicles form as a result of cell detachment called acantholysis. Our understanding of bullous skin disorders has increased enormously since the beginning of the century, when a patient with generalized blisters was diagnosed either as having pemphigus vulgaris or “pemphigus of the aged.” The unfortunate patients who did not survive had 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
275
1391_C18.fm Page 276 Tuesday, November 18, 2003 5:23 PM
276
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
pemphigus vulgaris while the other group had “pemphigus of the aged,” or dermatitis herpetiformis. The foundation studies that defined these diseases were histopathological studies by Lever [1] and immunopathological observations of Beutner et al. [2]. The latter investigators showed by immunofluorescence techniques that the majority of patients with pemphigus have IgG class autoantibodies in their serum that react with cell-surface antigens of stratified squamous epithelia. These autoantibodies are detected in situ bound to the diseased epithelium and circulating in the serum, but their relation to the disease has been unclear. Interestingly, there have been many facts pointing toward pathogenic effects of pemphigus autoantibodies. Some of these are reviewed below. In many patients with PV, the titer of antibodies in serum correlates with the disease severity, and plasmapheresis has been used to induce short-term remission [3–5]. There were reports of pemphigus disease in neonates born to mothers with active pemphigus, via transplacental transfer of maternal IgG. In surviving infants, the disease resolved as the maternal antibodies were catabolized [6,7]. In vitro studies also supported the pathogenic role of pemphigus antibodies in the induction of acantholysis. Many investigators have demonstrated that pemphigus serum, or IgG fractions from pemphigus serum, can induce acantholysis in human skin explants and the same antibodies can cause cell detachment if added to primary keratinocytes cultures from murine skin [8–11]. This effect was highly reproducible and specific, because it did not occur when cultures were treated with normal human IgG or IgG fractions from bullous pemphigoid or lupus erythematosus patients [12]. However, pemphigus vulgaris has not been reproduced in a laboratory animal. In earlier studies, Sams and Jordon [13] transfused plasma from PV patients into monkeys, although the animals showed serum elevations of pemphigus antibodies, they all failed to produce the disease. Wood et al. [14] showed that local injection of the patient’s serum into rabbit and monkey skin induced acantholysis in the injected site, and usually required application of the topical allergen 2,4-dinitrochlorbenzene to induce lesions. Holubar et al. [15] induced acantholysis in the oral mucosa of monkey lips by injection of PV antibodies. Another group of investigators injected athymic nude mice bearing grafted human oral mucosa with serum from PV patients [16]. None of the mice developed clinical features of pemphigus, and only a few grafts had a limited degree of epithelial-cell detachment. It is important to notice that pemphigus disease occurs spontaneously in dogs [17–21]. In early 1980, L.A. Diaz and G.J. Anhalt from the Department of Dermatology at Johns Hopkins University in Baltimore were working with cultured neonatal mouse keratinocytes and exposing them to sera from PV patients in order to study the pathomechanism of this disease. The cell detachment that they consistently observed led them to speculate that the antibodies were binding a molecule involved in cell adhesion. From there it was a logical step to confirm this hypothesis by injecting purified human immunoglobulins from the serum of patients with pemphigus vulgaris into neonatal mice. To their surprise, by the next day the animals were developing blisters. This was the basic experiment establishing the animal model for pemphigus vulgaris and emphasizing the fact that pemphigus autoantibodies bind the normal keratinocyte cell-surface structure and cause blisters via deterioration of cell adhesion [22].
II. LABORATORY ANIMALS The following strains of neonatal mice were used in the experiments: BALB/c, C5-deficient mice (B10-D2-OSN), and a control C5-sufficient strain (B10-D2-NSN). The newborns were between 24 to 28 hours of age, and their body weight was between 1.5 and 2.0 g. The volume of injected solution of IgG was no greater than 10% of the animal’s weight (using a weight/volume ratio of 1/1). All mice were obtained from Jackson Laboratory, Bar Harbor, ME, and maintained in breeding colonies at Johns Hopkins animal facility for use in various experimental studies.
1391_C18.fm Page 277 Tuesday, November 18, 2003 5:23 PM
PASSIVE TRANSFER OF DESMOGLEIN-TARGETING ANTIBODIES
277
III. DISEASE INDUCTION A. Preparation of IgG Fractions Serum was obtained from normal human donors and from patients with the typical clinical, histological, and immunological features of PV. The IgG fractions were prepared by 40% ammonium sulfate precipitation, followed by ion exchange chromatography, or affinity chromatography using staphylococcal protein A coupled to Sepharose 4B (Pharmacia, Uppsala, Sweden). Subsequent studies showed that the batches of IgG prepared by ion exchange chromatography had better biologic activity than those prepared by affinity chromatography. We suspect that the exposure to low pH required to release bound IgG from Staph protein A may be responsible for this reduction of activity. The IgG fractions were then dialyzed against phosphate-buffered saline (pH, 7.2), concentrated by ultrafiltration (Amicon, Lexington, MA), filter sterilized (Milex, Millipore, Bedford, MA), and stored at -20∞C. IgG concentration was measured by nephelometry using monospecific goat antihuman IgG (Beckman Instruments Kit, Clinical instruments Division, Brea, CA), and antibody titers were measured by indirect immunofluorescence, using rat-tongue epithelium as the tissue substrate. Affinity-purified IgG fractions were tested for IgA and IgM contaminants by double immunodiffusion and for other protein contaminants by sodium dodecylsulfate polyacrylamide-gel electrophoresis. B. Preparation of F(ab')2 Fragments Purified PV and normal IgG were digested overnight with pepsin, followed by gel filtration on Sephacryl S-200 (Pharmacia, Piscataway, NJ) and passage over a staphyloccoccal protein A-Sepharose 4B column (Pharmacia). F(ab')2 fragments at a concentration of 12.0 mg/ml retained the pemphigus antibody titer of 320 when tested by indirect immunofluorescence using rat tongue epithelium as a substrate. C. Preparation of Fab' Fragments A portion of F(ab')2 fragments was reserved and monovalent fragments from these portions were prepared by reduction with 0.01 M of dithiotreitol (Sigma Chemical Co., St. Louis, MO) at pH 8.6 for 1 hour at room temperature, followed by alkylation with excess iodoacetamide (Sigma), and dialysis against phosphate-buffered saline, pH 7.2. The Fab' solution was then processed by gel filtration on Sephacryl S-200 column to obtain single proteins. At a concentration of 12.0 mg/ml Fab', the solution also retained the pemphigus antibody titer of 320 when tested by indirect immunofluorescence. D. Depletion of Complement by Cobra Venom Factor CoF Purified CoF was prepared from lyophilized Naja Naja venom (Sigma) by ion exchange chromatography with DEAE cellulose (Whatman, Clifton, NJ), and gel filtration chromatography. The serum levels of C3 were determined by the immunofixation technique. Preliminary studies determined the optimal dose of CoF for complement depletion in neonatal mice. It was shown that C3 was reduced to almost undetectable levels by two injections of two units of CoF per mouse at 12-hour intervals and depletion persisted for more than 36 hours. E. Injection of Mice with PV IgG Neonatal BALB/c mice were injected with purified IgG fractions intraperitoneally through a 30-gauge needle. The doses of IgG were between 1.5 and 16 mg per gram of body weight per day,
1391_C18.fm Page 278 Tuesday, November 18, 2003 5:23 PM
278
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
and concentration of IgG was 33 to 80 mg per milliliter. The littermates were injected with either IgG from patients with PV, or with normal human IgG. Injections were given in divided doses in the morning and evening, and a maximum of four injections on 2 consecutive days was administered. F.
Injection of Mice with PV F(ab')2 and PV Fab' Fragments
The experimental mice in the first group received intraperitoneal injections of intact PV IgG in a dose of 15 mg/ml. Mice in the second group received injections of the F(ab')2 fragments in equimolar doses of 9.2 to 12.2 mg/g of body weight/day. Mice in the third group received intraperitoneal injections of PV Fab' fragments in doses of 9.1 to 13.4 mg/g of body weight/day. All control animals received equivalent amounts of normal human IgG, F(ab')2, or Fab' fragments. G. PV IgG Injection in C5-Deficient Mice C5-deficient (B10-D2-OSN) and normocomplementic (B10-D2-NSN) mice were injected with purified IgG in divided doses of 20mg/g of body weight/day in the morning and evening. Each group consisted of 20 mice. H. Injection of PV IgG in Mice Pretreated with CoF Neonatal BALB/c mice were divided into two groups. The first group received two injections of CoF (2 units in 0.15ml saline) at 12-hour intervals, while the control group received intraperitoneal saline. Twelve hours after the second injection, all mice received a single injection of purified PV IgG in identical doses (2.5 to 15.0 mg/g of body weight). Twelve hours after the injection of PV IgG, the mice were evaluated and sacrificed. All animals were weighed daily and evaluated for clinical signs of disease. Cutaneous lesions consisting of intact blisters or erosions were enumerated and recorded. The severity of disease was graded on a scale 0 to 3+: 0, no cutaneous lesions; 1+, 1 to 3 erosion(s) or blister(s); 2+, 3 to 10 erosions; and 3+, more than 10 lesions or positive Nikolskiy sign. Lesional and perilesional skin was studied by light and electron microscopy as well as by direct immunofluorescence. Serum was obtained from mice at the time of biopsy and evaluated for the total concentration of human immunoglobulins by nephelometry, and for human pemphigus antibody titer by indirect immunofluorescence. Control animals were studied in an identical fashion. I.
Miscellaneous Techniques
Skin and serum samples were obtained from experimental and control neonatal mice and were processed for light microscopy, direct and indirect IF microscopy, electron microscopy, and immunoelectron microscopy. Tissue specimens for light microscopy were fixed in 10% formalin and were stained with hematoxylin and eosin. Direct IF studies were performed as follows: cryosections of unfixed skin were prepared on glass slides, stained with monospecific fluorescein isothiocyanate (FITC)-conjugated anti-human IgG or FITC goat anti-human C3 (Cappel, Cochranville, PA) for 30 minutes at room temperature, and observed under a fluorescent light microscope. Speciments for electronmicroscopy were fixed immediately in 2.5% buffered glutaraldehyde, postfixed with 1% osmium tetraoxide, dehydrated with an ascending series of alcohol, stained en bloc with uranyl acetate, and embedded in an Epon/Araldite mixture. Thin sections were stained with Reynold’s lead citrate solution and examined with a JEM-100S transmission electron microscope (Joel Ltd., Tokyo).
1391_C18.fm Page 279 Tuesday, November 18, 2003 5:23 PM
PASSIVE TRANSFER OF DESMOGLEIN-TARGETING ANTIBODIES
Figure 18.1
279
Clinical appearance of lesions induced by PV IgG in neonatal mice. This animal shows extensive blistering and a positive Nikolskiy sign 24 hours after receiving PV IgG from a human patient with extensive mucocutaneous disease.
IV. COURSE AND ASSESSMENT OF DISEASE A. Clinical Manifestation Skin lesions and positive Nikolskiy sign occurred in 39 of 55 mice injected with IgG from the serum of patients with PV and in none of the 58 given normal human IgG. Early lesions consisted of discrete cutaneous vesicles, or extensive exfoliation of the epidermis (Figure 18.1). As the mice become older, the vesicles formed erosions and crusts, which persisted as long as the injections were continued but healed if the injections were stopped. This time course was highly reproducible in all mice that received injections of intact PV IgG, PV F(ab')2, or PV Fab' fragments. No changes were seen in the skin of control animals injected with IgG fractions from normal human serum [23]. All 20 C5-deficient mice and 20 mice in the control group injected with high doses of PV IgG (20 mg/gm/day) developed extensive erosions and positive Nikolskiy sign within 12 to 36 hours. Neonatal mice pretreated with CoF and injected with high doses of PV IgG (5.0 to 15.0 mg/g) developed similar lesions at the same time points as normal complementemic animals. Animals injected with lower doses of PV IgG developed limited disease and the onset of lesions was delayed. The ability of immunoglobulin fractions from various patients with the disease to induce lesions in the mice was directly related to the pemphigus antibody titers in their sera. The IgG from the acute phase of illness had very high titer of pemphigus antibodies, and was a very potent inducer of cutaneous disease in neonatal mice. In contrast, the IgG from the serum obtained during treatment was less effective in inducing disease, even at equivalent total doses, and the IgG from patients in remission was completely ineffective in inducing lesions. B. Histopathological Findings and Ultrastructural Changes Histologically, there were three patterns of epidermal injury in mice injected with PV IgG [24]. The first two patterns were either intraepidermal vesicles with epidermal basal cells adherent to the dermis and with suprabasilar acantholysis (Figure 18.2), or intraepidermal vesicles with few acantholytic cells but with many polymorphonuclear cells. These patterns were observed in mice that received lower doses of PV IgG. The third pattern was seen in mice given high doses of patients’ IgG (above 12.0 mg/g of body weight per day). These animals had acantholysis of epidermal cells below the granular-cell layer and necrosis of affected keratinocytes.
1391_C18.fm Page 280 Tuesday, November 18, 2003 5:23 PM
280
Figure 18.2
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Histopathological findings from a mouse that had received PV IgG 24 hours previously. The animal had clinical signs of blistering and positive Nikolskiy sign. The histology showed suprabasilar acantholysis without significant inflammatory infiltrates. Acantholytic cells are clearly demonstrated in the blister cavity (hematoxylin and eosin, original magnification, 400¥).
Transmission electron microscopy outlined the evolution of ultrastructural injury that occurs in vivo in the epidermis of neonatal BALB/c mice at specific time points after receiving passive transfer of human pemphigus IgG. Within the first hour after intraperitoneal injection of antibodies, widening of the epidermal ICS of the spinous and basal cell layers was observed. The greatly widened ICS often filed with serum and some desmosomal separation occurred from 6 to 12 hours. Most of the changes were observed after 18 to 24 hours when splitting of the desmosomes in two halves, perinuclear tonofilament retraction, and dissolution of attachment plaques led to complete cell separation. C. Immunopathological Data Direct immunofluorescence demonstrated human PV IgG in the intercellular spaces (ICS) of the mouse epidermis as early as 1 hour after injection. The intensity of the staining reached its maximum by 6 hours and was present at 24 hours after injection (Figure 18.3). In some areas of perilesional skin, mouse C3 was seen in ICS, but its distribution was patchy and its fluorescence was weak. Similar fluorescence was not detected in animals given control IgG. Indirect IF showed that PV antibodies were detected in murine serum as early as 1 hour after injection (titer 1:40); the titer reached its maximum at 12 hours (titer 1:160) and decreased by 24 hours (titer 1:20).
V. THERAPEUTIC RESPONSE The in vitro studies by Anhalt et al. [25] have shown that pemphigus IgG could stimulate the synthesis of plasminogen activator (PA) in human epidermal cells in culture. These studies suggested that an increase in PA activity that occurs after antibody binding to the cell surface may be an important mechanism in acantholysis. In order to test this theory, we measured PA in murine epidermis after intraperitoneal injection of PV IgG or normal human IgG with or without exposure to dexamethasone (DEX). BALB/c mice received intraperitoneal injections of saline or DEX (20 mg/g of body weight). Twenty-four hours later, they received a second injection of saline or DEX and a single dose of normal human IgG or PV IgG (20 mg/g of body weight). After 24 hours, epidermal PA was increased in animals injected with PV IgG, but not in the control group, which was injected with normal human IgG.
1391_C18.fm Page 281 Tuesday, November 18, 2003 5:23 PM
PASSIVE TRANSFER OF DESMOGLEIN-TARGETING ANTIBODIES
Figure 18.3
281
Direct immunofluorescence microscopy of a skin lesion from a mouse that had received PV IgG 24 hours previously. The specimen was probed with fluorescein-labeled anti-IgG that was specific for human IgG and showed no cross-reactivity with murine Ig. There was continuous linear deposition of IgG on the surface of keratinocytes in perilesional epidermis, identical to what one would observe in the human disease (original magnification, 400¥).
Treatment with DEX decreased PA levels in both groups of animals. Interestingly, despite the decreased PA activity, all animals in the PVIgG and the PVIgG and DEX groups had identical and extensive cutaneous disease, while the lesions developed at the same time points. These findings show that PV autoantibodies can stimulate increases in epidermal PA, but corticosteroid treatment does not inhibit acantholysis in vivo [25].
VI. LESSONS LEARNED The development of a reproducible animal model for any human disease is a major step in the understanding of the pathogenic mechanisms driving that disease. Our results demonstrate that the autoantibodies found in the skin and serum of patients with pemphigus vulgaris are responsible for the tissue injury characteristic of the disease. There can be no reasonable doubt that PVIgG can reproduce a cutaneous disease in neonatal BALB/c mice with all clinical, histologic, ultrastructural, and immunological features of the human disease. There are several significant aspects of this model for the study of pemphigus vulgaris. First, the extent of the disease directly correlates with the dose and titer of the pemphigus IgG fraction in the circulation of the recipient mice. Second, we found that the typical lesions of PV can be induced in vivo by the F(ab')2 or Fab' fragments and that intact PV IgG can induce lesions in C5defiecient mice and in mice depleted of complement by CoF. This would imply that complement activation could play a role in the propagation of the disease, but PV antibodies can induce acantholysis in the absence of complement activation in vivo. Third, PV antibodies can stimulate increases in epidermal PA, but reduction of PA by corticosteroids does not inhibit acantholysis in vivo. Since we developed the animal model of pemphigus vulgaris, major research advances occurred in the past decade. Today we know that the adhesion molecules which PV autoantibodies are targeting are desmosomal proteins from the cadherin superfamily called desmoglein 1 and desmoglein 3 [26–30]. Close association of PV with certain major histocompatibility complex II alleles has been reported [31,32]. The critical role of desmoglein 3 in cell-to-cell adhesion was demonstrated by the development of desmoglein 3 knockout mice by Koch et al. [33]. Another important milestone was achieved by Amagai et al. [34] and Tsunoda et al. [35], who developed the first
1391_C18.fm Page 282 Tuesday, November 18, 2003 5:23 PM
282
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
active animal model of the disease, created by immunization of the Dsg3 knockout mice with Dsg3, transfer of splenocytes to immunodeficient mice, and production of pathogenic antibodies by the transfused immune cells [34,35]. But the exact pathophysiologic mechanism by which IgG autoantibodies induce acantholysis in PV is still not completely clear. The work of several groups of researchers indicate that PV antibodies induce functional allosteric changes in the desmoglein molecule impairing its ability to participate in the homophilic binding to another desmoglein on the adjacent cell and resulting in acantholysis [35]. Aoyama et al. [36] support signal transduction theory, pointing out that addition of PV IgG to cultured keratinocytes induces phosphorylation of Dsg3 and the dissociation of Dsg3 from plakoglobin. Moreover, adding PV IgG to cultured murine keratinocytes leads to keratin retraction from cell–cell contact sites and it requires plakoglobinmediated signaling [37]. In conclusion, the development of an animal model for pemphigus vulgaris provides us with numerous opportunities to study the pathogenic mechanisms and various treatment modalities of this disease, and also has the potential to increase our understanding of autoimmunity in general.
REFERENCES 1. Lever, W.F., Pemphigus and pemphigoid, Charles C Thomas, Springfield, IL, 1965. 2. Beutner, E.H. et al., Immunofluorescent studies of autoantibodies to intercellular areas of epithelia in Brazilian pemphigus foliaceus, Proc. Soc. Exp. Biol. Med., 127, 81, 1968. 3. Auerbach, R. and Bystryn, J.C., Plasmapheresis and immunosuppressive therapy. Effect on levels of intercellular antibodies in pemphigus vulgaris, Arch. Dermatol., 115, 728, 1979. 4. Roujeau, J.C., Fabre, M., and Noel, L., Plasma exchanges in the treatment of skin disease, Int. J. Artif. Organs, 5, 257, 1982. 5. Swanson, D.L. and Dahl, M.V., Pemphigus vulgaris and plasma exchange: clinical and serologic studies, J. Am. Acad. Dermatol., 4, 325, 1981. 6. Moncada, B. et al., Neonatal pemphigus vulgaris: role of passively transferred pemphigus antibodies, Br. J. Dermatol., 106, 465, 1982. 7. Storer, J.S. et al., Neonatal pemphigus vulgaris, J. Am. Acad. Dermatol., 6, 929, 1982. 8. Diaz, L.A. and Marcelo, C.L., Pemphigoid and pemphigus antigens in cultured epidermal cells, Br. J. Dermatol., 98, 631, 1978. 9. Farb, R.M., Dykes, R., and Lazarus, G.S., Anti-epidermal-cell-surface pemphigus antibody detaches viable epidermal cells from culture plates by activation of proteinase, Proc. Natl. Acad. Sci. U. S. A., 75, 459, 1978. 10. Morioka, S., Naito, K., and Ogawa, H., The pathogenic role of pemphigus antibodies and proteinase in epidermal acantholysis, J. Invest. Dermatol., 76, 337, 1981. 11. Woo, T.Y., Specificity and inhibition of the epidermal cell detachment induced by pemphigus IgG in vitro, J. Invest. Dermatol., 81, 115s, 1983. 12. Diaz, L.A., Weiss, H.J., and Calvanico, N.J., Phylogenetic studies with pemphigus and pemphigoid antibodies, Acta Derm. Venereol., 58, 537, 1978. 13. Sams, W.M., Jr. and Jordon, R.E., Pemphigus antibodies: their role in disease, J. Invest. Dermatol., 56, 474, 1971. 14. Wood, G.W., Beutner, E.H., and Chorzelski, T.P., Studies in immunodermatology. II. Production of pemphigus-like lesions by intradermal injection of monkeys with Brazilian pemphigus foliaceus sera, Int. Arch. Allergy Appl. Immunol., 42, 556, 1972. 15. Holubar, K. et al., Studies in immunodermatology. 3. Induction of intraepithelial lesions in monkeys by intramucosal injections of pemphigus antibodies, Int. Arch. Allergy Appl. Immunol., 44, 631, 1973. 16. Buschard, K., Dabelsteen, E., and Bretlau, P., A model for the study of autoimmune diseases applied to pemphigus: transplants of human oral mucosa to athymic nude mice binds pemphigus antibodies in vivo, J. Invest. Dermatol., 76, 171, 1981. 17. Bennett, D. et al., Bullous autoimmune skin disease in the dog: (1) clinical and pathological assessment, Vet. Rec., 106, 497, 1980.
1391_C18.fm Page 283 Tuesday, November 18, 2003 5:23 PM
PASSIVE TRANSFER OF DESMOGLEIN-TARGETING ANTIBODIES
283
18. Bennett, D. et al., Bullous autoimmune skin disease in the dog: (2) immunopathological assessment, Vet. Rec., 106, 523, 1980. 19. Hurvitz, A.I., Animal model of human disease: pemphigus vulgaris, Am. J. Pathol., 98, 861, 1980. 20. Hurvitz, A.I. and Feldman, E., A disease in dogs resembling human pemphigus vulgaris: case reports, J. Am. Vet. Med. Assoc., 166, 585, 1975. 21. Stannard, A.A., Gribble, D.H., and Baker, B.B., A mucocutaneous disease in the dog, resembling pemphigus vulgaris in man, J. Am. Vet. Med. Assoc., 166, 575, 1975. 22. Anhalt, G.J. et al., Induction of pemphigus in neonatal mice by passive transfer of IgG from patients with the disease, N. Engl. J. Med., 306, 1189, 1982. 23. Anhalt, G.J. et al., Defining the role of complement in experimental pemphigus vulgaris in mice, J. Immunol., 137, 2835, 1986. 24. Takahashi, Y. et al., Experimentally induced pemphigus vulgaris in neonatal BALB/c mice: a timecourse study of clinical, immunologic, ultrastructural, and cytochemical changes, J. Invest. Dermatol., 84, 41, 1985. 25. Anhalt, G.J. et al., Dexamethasone inhibits plasminogen activator activity in experimental pemphigus in vivo but does not block acantholysis, J. Immunol., 136, 113, 1986. 26. Amagai, M., Klaus-Kovtun, V., and Stanley, J.R., Autoantibodies against a novel epithelial cadherin in pemphigus vulgaris, a disease of cell adhesion, Cell, 67, 869, 1991. 27. Boggon, T.J. et al., C-cadherin ectodomain structure and implications for cell adhesion mechanisms, Science, 296, 1308, 2002. 28. Buxton, R.S. et al., Nomenclature of the desmosomal cadherins, J. Cell Biol., 121, 481, 1993. 29. Eyre, R.W. and Stanley, J.R., Identification of pemphigus vulgaris antigen extracted from normal human epidermis and comparison with pemphigus foliaceus antigen, J. Clin. Invest., 81, 807, 1988. 30. Koch, P.J. et al., Identification of desmoglein, a constitutive desmosomal glycoprotein, as a member of the cadherin family of cell adhesion molecules, Eur. J. Cell Biol., 53, 1, 1990. 31. Ahmed, A.R. et al., Major histocompatibility complex haplotypes and class II genes in non-Jewish patients with pemphigus vulgaris, Proc. Natl. Acad. Sci. U. S. A., 88, 5056, 1991. 32. Sinha, A.A. et al., A newly characterized HLA DQ beta allele associated with pemphigus vulgaris, Science, 239, 1026, 1988. 33. Koch, P.J. et al., Targeted disruption of the pemphigus vulgaris antigen (desmoglein 3) gene in mice causes loss of keratinocyte cell adhesion with a phenotype similar to pemphigus vulgaris, J. Cell Biol., 137, 1091, 1997. 34. Amagai, M. et al., Use of autoantigen-knockout mice in developing an active autoimmune disease model for pemphigus, J. Clin. Invest., 105, 625, 2000. 35. Tsunoda, K. et al., Induction of pemphigus phenotype by a mouse monoclonal antibody against the amino-terminal adhesive interface of desmoglein 3, J. Immunol., 170, 2170, 2003. 36. Aoyama, Y., Owada, M.K., and Kitajima, Y., A pathogenic autoantibody, pemphigus vulgaris-IgG, induces phosphorylation of desmoglein 3, and its dissociation from plakoglobin in cultured keratinocytes, Eur. J. Immunol., 29, 2233, 1999. 37. Caldelari, R. et al., A central role for the armadillo protein plakoglobin in the autoimmune disease pemphigus vulgaris, J. Cell Biol., 153, 823, 2001.
1391_C18.fm Page 284 Tuesday, November 18, 2003 5:23 PM
1391_C19.fm Page 285 Tuesday, November 18, 2003 5:24 PM
CHAPTER
19
Experimental Mouse Model of Pemphigus Vulgaris: Passive Transfer of Nondesmoglein 1 and 3 Antibodies Vu Thuong Nguyen
CONTENTS I. History and Rationale ........................................................................................................286 A. Keratinocyte Antigens Targeted by Pemphigus Vulgaris Antibodies Are Not Limited to Desmoglein 1 and 3 ................................................................................286 B. Acantholysis Induced by Pathogenic PV Autoantibodies May Be Mediated Through Intracellular Signal Transduction ...............................................................288 1. Phosphorylation as a Result of Signal Transduction Induced by Binding of PVIgG to KC Antigens ...................................................................................289 2. Activation of KC Protease as a Result of Cell Signaling Induced by Binding of PVIgG to KC Antigens.....................................................................290 C. From Clinical Findings to the Concept and from the Concept to the Laboratory Data: The Question Remains .................................................................290 D. The “Multiple Hit” Hypothesis .................................................................................291 II. Laboratory Animals............................................................................................................292 A. The Original Dsg3-/- Mice ........................................................................................292 B. Nomenclature of Dsg3-/- Mice..................................................................................292 C. C57BL/6-bal/bal and 129xBL/6 Dsg3null Mice Generally Do Not Exhibit PV Phenotype ............................................................................................................292 III. Disease Induction: Experimental Mouse Model for Passive Transfer of Nondesmoglein 1 and 3 Antibodies ..................................................................................294 A. Development of PV Phenotype in Neonatal Mice....................................................294 1. Gross Pathology...................................................................................................295 2. Nikolskiy’s Sign...................................................................................................295 3. Histology..............................................................................................................295 B. Interpretation of Disease-Induction Mechanism.......................................................296 IV. Lessons Learned.................................................................................................................296 A. PVIgG TKC Antigens Other than Dsg1 and Dsg3 Can Induce PV-Like Lesion ....296 B. Identification of Variants of a Novel Cadherin Antigen, Dsg4, with a Critical Role in Mediating Acantholysis in PV .....................................................................296 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
285
1391_C19.fm Page 286 Tuesday, November 18, 2003 5:24 PM
286
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
C. D.
Limitations of Neonatal Mice Model for PV ...........................................................298 Products of Genome Projects Provide Solution for Pemphigus Controversy..........298 1. Identifying the Novel PV Antigen Desmoglein 4 (Dsg4) ..................................298 2. Identifying Novel Mouse Dsg1 Isoforms, Dsg1b and Dsg1g ............................300 V. Conclusion..........................................................................................................................300 Acknowledgment............................................................................................................................301 References ......................................................................................................................................301
I. HISTORY AND RATIONALE Development of the experimental mouse model for passive transfer nondesmoglein 1 and 3 antibodies was based on numerous laboratory experiments suggesting that other keratinocyte (KC) antigens in addition to desmoglein 1 and 3 (Dsg1 and Dsg3) are targeted by pemphigus vulgaris (PV) immunoglobulin G (IgG) and that these autoantibodies may participate to the disease process. This discussion begins with the review of some cornerstones of pemphigus research regarding the role of PV autoantibodies in the pathogenesis of disease. Acknowledgment of the role of autoantibodies in PV started when Beutner and Jordon [1] demonstrated the presence of autoantibodies in the skin and sera of PV patients in 1964. In 1973, Holubar et al. [2] demonstrated that injection of PV antibodies in monkey lips allowed the antibodies to bind to the epithelium at the site of injection and induced pemphigus-like lesions. The pathogenic role of PV autoantibodies was also demonstrated in human skin organ transplant experiments by Michel and Ko [3] and Schiltz and Michel [4] in 1976. In 1982, Anhalt et al. [5] introduced the first neonatal mice model for PV, which is by far the best in vivo model for PV. Using this model, in 1986 these authors [6] further demonstrated that the Fab fraction of pemphigus antibodies alone was sufficient to induce pemphigus-like lesion. These finding are very important because they suggest that a direct protein interaction of autoantibodies with keratinocyte antigens is sufficient to induce acantholysis. A. Keratinocyte Antigens Targeted by Pemphigus Vulgaris Antibodies Are Not Limited to Desmoglein 1 and 3 While Dsg1 and Dsg3 are components of desmosomes, KC cell-surface components bound by autoantibodies in patients with PV are not limited to desmosomes. Immunoelectron microscopic studies have revealed that PVIgG can bind to KC cell-surface in either desmosomal areas alone [7] or in both desmosomal structures and extradesmosomal areas [8,9]. Many research groups have been involved in identifying the antigens in KCs that are targeted by pathogenic PV antibodies. Many self-antigens of various molecular weights (MW) have been reported as targets for PV antibodies. In 1968, Ablin and Beutner [10] used protein fractionation and absorption assays with proteins extracted from bovine esophagus to describe a 12-kDa antigen for pemphigus antibodies. In 1973, Shu and Beutner [11] used the same technique with human esophagus extract to show a PV antigen with estimated MW of about 68 kDa. The authors showed that the protein fraction containing this PV antigen could adsorb all activity of PVIgG on monkey esophagus sections by indirect immunofluorescence (IIF) assay. In 1980, Diaz et al. [12] used gel filtration chromatography of normal human saliva to isolate a protein fraction that contained PV antigens that could completely adsorb PVIgG activity on rat tongue sections detected by IIF. This fraction was shown by unreduced and reduced SDS-PAGE analysis to contain a protein of 40 to 50 kDa that was composed of two subunits of 20 kDa and 25 kDa. In 1982, Stanley et al. [13] used double antibody-immunoprecipitation assay on proteins extracted from metabolic radiolabeled mouse or human KCs to describe a 130-kDa glycoprotein that was precipitated by five of seven unspecified pemphigus sera (i.e., PV vs. PF). Later, Eyre and Stanley used the same assay on 125I labeled epidermal extract to characterize both PV and PF sera [14]. They
1391_C19.fm Page 287 Tuesday, November 18, 2003 5:24 PM
PASSIVE TRANSFER OF NONDESMOGLEIN 1 AND 3 ANTIBODIES
287
found that in the presence of 2 mM of Ca2+, some PV sera precipitated both 130-kDa and 160kDa proteins that also present together with 85-kDa proteins forming complexes of 210 kDa and 260 kDa. In their study, large amounts of precipitated proteins with MW of less than 80 kDa, were visualized by very high radioactivity at the bottom of the gel, but were not analyzed due to the type of the gel (6% SDS-PAGE). In 1984, Peterson and Wuepper [15] used affinity chromatography assay employing concanavalin A to isolate a 66-kDa protein from extracted adult human epidermis. The protein was shown to be a complex of two 33-kDa subunits by SDS-PAGE and Western blotting (WB) techniques, the protein was recognized by IgG in five of six sera from PV patients, but none of ten normal control individuals. These authors further used this antigen to immunize rabbits and then demonstrated that passive transfer of immunized rabbit IgG could produce skin lesions in four of five neonatal mice. In 1985, Acosta and Ivanyi [16] used immunoblotting assay on protein extracted from SCaBER, a squamous cell carcinoma cell line, to show a 105-kDa PV antigen. The same technique on affinity-purified human saliva protein fraction was also used by these authors to show two other antigens for PVIgG with MW of 12 kDa and 30 kDa [17]. In 1990, Amagai et al. discovered Dsg3 by screening the human KC cDNA library with affinitypurified PVIgG to 130kDa proteins. The cDNA clone contained an open reading frame encoding an amino acid polypeptide of an estimated MW of 102 kDa for the nonglycosylated form of the polypeptide [18]. The protein was originally thought to be able to mediate cell signaling, in addition to its adhesive function. However, today we know that Dsg3, indeed, does not contain any putative cytoplasmic conserved signaling domain typical of the cadherin family. Recombinant Dsg3 ectodomain was later generated in the eukaryotic system (baculoprotein) to achieve better conformation and, via ELISA, shown to be the target for IgG from most PV sera [19]. Amagai et al. [20] also showed that the nonglycosylated forms of Dsg3 baculoproteins retained immunoadsorptive ability to PVIgG. Passive transfer of PVIgG immunoaffinity purified by baculoprotein of the extracellular portion of Dsg3 to neonatal mice produced skin blisters with microscopic PV features, proving that Dsg3 IgG in PV patients is pathogenic in neonatal mice [21]. Some PV patients contain autoantibodies to extracellular portion of Dsg1, an antigen of pemphigus foliaceus (PF) [22]. PVIgG against Dsg1 was also shown to be pathogenic in neonatal mice by producing skin lesions with microscopic features of PF in passive transfer experiments [21]. Until now, Dsg1 and Dsg3 are the two most extensively studied antigens for PV, and Dsg3 has been shown to be the common antigen for most patients with PV and to a lesser extent Dsg1; therefore, the two are the most widely accepted major PV antigens. The ability of pemphigus autoantibodies targeting Dsg3 or Dsg1 to cause skin blistering in neonatal mice suggests that these antibodies are pathogenic in neonatal mice. However, it is obvious that this conclusion cannot be made in humans, as we cannot yet exclude the possibility that PVIgG against other antigens, if treated in the same condition, would produce skin blistering in neonatal mice. Furthermore, the amount of monospecific antibody that was needed to inject in the animal to induce PV-like lesions should also be considered. Normal physiological amounts of total IgG in the animal can be calculated to be approximately about 1 mg/g of body weight. Since total IgG normally contains a large number of IgG species of different specificity, doses of more than 0.5 mg/g of body weight of a monospecific antibody, used in the passive transfer experiment, could be considered to be very high. This point was very well demonstrated by Ding et al. [23] because they demonstrated that while IgG from mucosal PV patients containing Dsg3 antibody did not produce skin blisters in neonatal mice, the affinity-purified Dsg3 IgG at the dose described did [21]. In 1997, Joly et al. [24] used WB of bovine tongue protein extract for WB analysis of 23 PV sera. They found that two-thirds of the sera contained IgG to 130-kDa proteins and one-third of the sera contained IgG to a 180- to 190-kDa doublet that may represent new PV antigens. Recently, in a blocking experiment [25], we found that nAChRa9, a receptor with both muscarinic and nicotinic characteristics, might be an antigen for PV. In a different approach, we found that PVIgG against adult human epidermis proteins with MW of 70 to 80 kDa on WB could
1391_C19.fm Page 288 Tuesday, November 18, 2003 5:24 PM
288
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
bind to the monkey esophagus epithelial cell surface in a PV-like fashion, and can also induce acantholysis in the normal human KC culture monolayer. Using these antibodies to screen the human KC cDNA library, we identified the pemphaxin (PX), a novel 38-kDa acetylcholine-binding protein that can form dimers. Using bacterial recombinant PX to remove the specific antibody from the pool of the three-PV sera, we were able to remove the acantholytic activity of that particular PVIgG pool in neonatal mice. The anti-PX antibody alone, however, could not induce skin lesion in this model. Returning anti-PX to the pool of PVIgG allowed restoring of acantholytic activity in the pool of PVIgG [26]. However, we have not been able to show that either nAChRa9 or PX can serve as common antigens for most patients rather than the fact that the sera used in these experiments came from PV patients with severe disease. Therefore, antibodies to these novel antigens may either represent a subgroup of pemphigus or additional targets for pathogenic antibodies in patients with severe disease. Thus, the thorough review for PV antigens allows us to pose these first two scientific questions. First, are there PV antigens other than Dsg1 and Dsg3 that are commonly targeted by autoantibodies in patients with PV? Second, are autoantibodies to these other antigens pathogenic in PV? B. Acantholysis Induced by Pathogenic PV Autoantibodies May Be Mediated Through Intracellular Signal Transduction The most striking evidence that supports the role of cell signaling in the pathogenesis of PV is obtained from laboratory studies using patients’ skin samples and clinical observations of patients’ response to treatment with corticosteroids. Original ultrastructural studies of the skin of patients with PV showed that the earliest change appears to be the aggregated appearance of the tonofilaments and the widening of intercellular spaces. The dissolution of intercellular spaces then extends to the desmosomal areas while desmosomes are still intact. Disruption of cell adhesion at the desmosome appears to be the last event for blister formation, although some dissolution of desmosomes as well as splitting of desmosomes to two halves known as half-desmosome could occasionally be seen at the lower lateral side of basal cells [27–30]. The fact that acantholysis induced by PVIgG starts at the extradesmosomal region is also supported by time-course study of acantholysis induced by the antibodies in animal models [31]. This observation is critically important because first, it implies that acantholysis in patients with acquired pemphigus is not initiated by the simple physical interference of the adhesive function of Dsg1 and Dsg3; otherwise, acantholysis would have started at the desmosomes. Second, PVIgG can bind to Dsg3 and cause acantholysis in animal models with the lesions characteristic for PV, yet initiate the process of acantholysis at the extradesmosomal regions, which highly suggests that there may be a signal transmitted from the desmosome to extradesmosomal regions through a molecule capable of signal tranduction with an ectodomain very similar to Dsg3. Clinical observation of patients with PV response to corticosteroid also indirectly provides a strong logic supporting the role of cell signaling in the pathogenesis of the disease. Before the corticosteroid era, PV was virtually a lethal disease [32]. Glucocorticosteroids are life-saving therapy for this disease, but their therapeutic mechanism is not fully understood. Several observations suggest that glucocorticosteroids exert direct antiacantholytic effects on KCs. Clinically, lesions in PV patients usually improve rapidly within 24 to 48 hours after treatment with high dosage of glucocorticosteroids such as methylprednisolone (pulse therapy) [33,34]. Intralesional injection of glucocorticosteroids such as triamcinolone acetonide also helps to heal the lesion in milder cases [33,34]. The rapid healing of the epidermis in “pulse therapy” suggests a reverse process of living cells rather than the formation of a new epidermis that is responsible for healing. At the time of clinical improvement, there are abundant circulating PVIgG available to bind to KCs and block the adhesive function of Dsg1 and Dsg3. Consequently, these clinical findings indirectly suggest that the rapid clinical improvement under corticosteroid treatment is probably not due to an unblocking of adhesion function of Dsg1 or Dsg3. Rather, the rapid healing of the
1391_C19.fm Page 289 Tuesday, November 18, 2003 5:24 PM
PASSIVE TRANSFER OF NONDESMOGLEIN 1 AND 3 ANTIBODIES
289
epidermis in these cases suggests that the direct therapeutic effect of corticosteroids on KCs is to block a downstream adverse signaling that is critical for the acantholysis process. The direct therapeutic effect of methylprednisolone on KCs was also demonstrated in laboratory experiments by Swanson and Dahl [35] using skin organ cultures. Similar results using hydrocortisone were demonstrated by Jeffes et al. [36]. In both cases there were no lymphocytes in the experimental system, thereby ruling out the involvement of a cell-mediated mechanism. In a recent study [37], we used a newly developed quantitative method that allows measurement of the extent of acantholysis induced by PVIgG in neonatal mice to show that methylprednisolone can significantly inhibit PVIgG-induced acantholysis. In summary, the direct therapeutic effect of methylprednisolone on KCs that reverses acantholysis of KCs in the presence of PVIgG indicates that a complicated mechanism — more than a simple blocking of adhesive function of Dsg3 in desmosomes by pathogenic antibodies — may be involved in the disease process of pemphigus vulgaris. 1. Phosphorylation as a Result of Signal Transduction Induced by Binding of PVIgG to KC Antigens In 1963, Decker [38] proposed that since the histological changes produced in skin by cantharidin closely resemble those in PV, it is possible to use this chemical as a model to study the biochemical mechanism of acantholysis. Cantharidin is an active component of skin blistering caused by the cantharides in the bites of some insects such as blister beetle and Spanish fly. Decker [38] provided evidence that endogenous ATP is required for induction of acantholysis and it may be used for phosphorylation of KC proteins that are associated with this process [39–41]. He then found that activation of a protein kinase in human epidermis treated with cantharidin might contribute to the increase of phosphorylation of proteins during acantholysis [42]. Twenty years after Decker’s work, cantharidin was found to be an inhibitor of serine/threonine protein phosphatases types 1 and 2A [43,44], which explains his observations. Decker’s findings are important, but this evidence did not lead to the conclusion that PVIgG could cause acantholysis in the epidermis by the same mechanism. Since 1987, Kitajima et al. [45,46] have studied the signal transduction induced by PVIgG on KC. They found that PVIgG acts on cultured KCs causing a transient increase in intracellular calcium and inositol 1,4,5-triphosphate [47], which is caused by activation of phosphatidylcholinespecific phospholipase C [48]. Comparing the level of protein kinase C (PKC) in the cytosolic and the particulate/cytoskeleton fractions of KC treated with PVIgG, Osada et al. [49] provided evidence suggesting that there is translocation of PKC from cytosolic to membrane-associated locations where activity of PKC also increases. Later, this group [50] also found that treatment of cultured KCs by PVIgG could induce phosphorylation of Dsg3 and dissociation of this cadherin from plakoglobin. Recently, we found that treated KC culture with PVIgG also increased phosphorylation of Ecadherin, b-catenin, and plakoglobin. Furthermore, in a preliminary experiment, our DNA microarray assay data revealed that PVIgG altered transcription of several molecules in KCs [37]. Interestingly, treatment of KC with PVIgG for 8 hours decreased transcription of some KC membrane receptors and also Dsg3. We speculated that the decrease of the transcription of these receptors, especially the Dsg3, might represent a cellular defense mechanism against negative insults to the cells via these proteins. Therefore, the change in these gene expressions may certainly guide us to identify the possible genes that may be involved in the pathogenesis mechanism of PV as well as the mechanism of cell adhesion regulation in KCs. These findings suggest that PVIgG may bind to KC receptors and subsequently induce outside–in signaling that may in turn direct disadhesion of a KC from others. Since total PVIgG was used in these studies, it was unknown if these cellular signaling were mediated by binding of PVIgG to Dsg3, especially given that we know the molecule does not have characteristics of a signaling molecule.
1391_C19.fm Page 290 Tuesday, November 18, 2003 5:24 PM
290
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
2. Activation of KC Protease as a Result of Cell Signaling Induced by Binding of PVIgG to KC Antigens In 1978, Farb et al. [51] showed that PVIgG-mediated keratinocyte detachment was blocked by the addition of proteinase inhibitors, including soybean trypsin inhibitor and a2-macroglobulin, to the culture media. These authors suggested that PVIgG disrupt adhesion between viable KCs by activation of proteases. Proteolytic activation in the pathogenesis of PV was later supported by evidence that PVIgG can activate the plasminogen activator or other proteolytic systems in KCs or skin [52–55]. More directly, there is evidence that protease inhibitors can inhibit acantholysis induced by PVIgG in cell culture, skin organ culture, or neonatal mice models for PV [56–59]. How does PVIgG activate KC protease? What are the antigens responsible for this activity? Do PVIgG target KC protease inhibitors or KC membrane receptors that subsequently activate proteases? Is it possible that activation and release of KC protease in the intercellular space of the epidermis represent a natural cellular process for removing unwanted extracellular-membrane protein fixation, which is the binding of PVIgG to KC surface proteins in this case? These questions are still open. C. From Clinical Findings to the Concept and from the Concept to the Laboratory Data: The Question Remains First, the histological finding of skin lesion in patients with PV is very specific. While there is overlapping of the expression of the known pathogenic antigens in a broad zone of the epidermis, the intraepidermal split occurs discretely right at the suprabasal site where KCs lose their proliferative activity and become differentiated. At this site, the type of intercellular adhesion structures also change from the more dynamic type at the basal layer to the subtler type at the prickle cell layers. This observation suggests that the mechanism of acantholysis caused by pathogenic antibodies in patients with PV may relate to the differentiation characteristic of KCs at this site. Second, there is a clear picture from evidence in patients with PV that cell signaling induced by binding of PVIgG to KC antigens may be a major mechanism for acantholysis to occur. These observations establish the concept for the pathogenesis of the disease in patients with PV. In laboratory research, numerous studies with autoantibodies against Dsg3 and Dsg1 have emphasized their critical role in pemphigus pathogenesis. The facts that most of PV patients with active disease have autoantibodies capable of binding to Dsg3 [60], that recombinant Dsg3 can specifically activate proliferation of T cells isolated from patients with PV [61,62], and that PVIgGs adsorbed by recombinant Dsg3 can alone induce PV-like lesion in the passive-transfer neonatal mouse model [63] provide extremely convincing evidence to support the concept that pathogenic PVIgGs that bind to Dsg3 are critical to the acantholysis process in PV. However, as mentioned above, Dsg3 does not have characteristics of the cadherin signaling molecule as shown in many classical cadherins. A recent study in a mouse model for PV, however, suggests that initiation of acantholysis in PV could be simply caused by blocking of the adhesive function of Dsg3 [64]. The discrepancy between observation from patients with PV and the mouse models for PV suggests that there is a major difference in the biology of mouse and human epidermis. Since our ultimate goal is to understand the disease in humans, a possible missing link that we should seek is what receptor(s) could mediate the signaling, which would lead to many observations described above. Therefore, the search for other possible pemphigus antigens should remain steadfast once it can be definitively proven that there are pemphigus antigens other than Dsg1 and Dsg3, and that autoantibodies to these novel antigens are pathogenic. Therefore, an in vivo model for PV that excludes all possible interaction between PV antibodies and Dsg1 and Dsg3 would be extremely helpful to achieve this goal.
1391_C19.fm Page 291 Tuesday, November 18, 2003 5:24 PM
PASSIVE TRANSFER OF NONDESMOGLEIN 1 AND 3 ANTIBODIES
291
D. The “Multiple Hit” Hypothesis A very thin epidermis isolating the whole animal body from the world outside is constructed by only about 10 to 20 layers of KC that adhere to each other. The vital adhesion function in KCs must be, through evolution, tightly controlled. Understandably, since the epidermis continuously receives insults directly from the external environment, it would develop an adaptive mechanism for survival. The concept of “adhesion molecule compensation” in KC could be considered as a natural defense mechanism for the skin in the event that one component of the skin is underdeveloped. Mice that naturally have the genetic defect Dsg3 such as the Bal/bal mice and human patients with striated palmoplantar keratoderma disease with genetic defects in Dsg1 or plakoglobin illustrate this concept [65–68]. These mice and human patients do not die because of missing a single important skin component. Rather, the skin in these cases adapts, although not perfectly, with the defect of an adhesion molecule by compensatory mechanisms such as an increase in the expression of other intact adhesion molecules or by an increase in the thickness of the epidermis at the areas where mechanical insult is normal. This fact of compensatory development does not negate the importance of each adhesion molecule; rather, it magnifies the essence of cellular teamwork of the skin organ as a whole. Patients with PV, on the other hand, would die if untreated. The skin somehow fails to deal with insults induced by PVIgG. This has led me to believe that there is a collapse of the infrastructure of the epidermis that is caused by the binding of pathogenic autoantibodies to KC antigens. For this to happen, it is possible that PVIgG attack both structural and regulatory elements of the epidermis, that is, a “multiple hit” by PVIgG. Attacks by PVIgG on structural elements of the epidermis such as Dsg3 and Dsg1 has been demonstrated in the neonatal mice model, but the regulatory element of KCs has not been revealed. In a plenary presentation at the Third International Investigative Dermatology Congress in Cologne, Germany in May 1998 [69], we postulated the “multiple hit” hypothesis for the pathogenesis of pemphigus. Acantholysis in PV may result from simultaneous and cumulative effects of autoantibodies directed toward different KC antigens including “structural” elements such as desmogleins, and regulatory elements such as receptors regulating function of the adhesion and cytoskeletal units [26]. A possible working model for studying the pathogenesis of PV that illustrates the “multiple hit” hypothesis was designed based on the specific epidermal acantholysis of PV in relation to the normal physiology of the epidermis. Pathologically, in PV patients, there is disadhesion between basal cells at their lateral sides and cells between the basal layer and the prickle cells. Adhesion between KCs in the strata spinosum and granulosum is intact. Physiologically, in normal epidermis, KCs proliferate at the basal layer, migrate upward and differentiate with increased number of desmosomes (hence, spinosum by appearance), which makes adhesion between KCs in this level become more subtle, strong, and rigid. In order for KCs to migrate upward, there is a continuous resolution of the existing adhesion junctions and formation of new ones. This dynamic process is necessary to secure a strong attachment between the upper epidermis and the basal layer while still allowing KC at the transition area to migrate upward. Therefore, logically, this dynamic process should always be at equilibrium and tightly regulated by regulatory receptors that allow perfect communication of the migrating cells and the cells at the upper and lower layers. Interference of this regulatory receptor system by antireceptor PV antibodies may hasten the resolution of the existing adhesion junctions. Simultaneously, PVIgG may interfere with adhesive function of desmogleins as well as the formation of new desmosomes. Therefore, these two independent mechanisms are postulated to work in concert to cause acantholysis in PV. This model also suggests that PVIgG, indeed, is a powerful tool to discover the novel receptors that have a central role in regulation of cell adhesion and differentiation in stratified epithelium.
1391_C19.fm Page 292 Tuesday, November 18, 2003 5:24 PM
292
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
II. LABORATORY ANIMALS Since Dsg3 IgG are present in most PV patients and Dsg1 IgG are present much less frequently, passive transfer of PVIgG lacking of Dsg1 antibodies to neonatal mice deficient in Dsg3 will be useful to determine whether keratinocyte antigens other than Dsg1 and Dsg3 exist and if these antibodies are pathogenic. To actualize this model, we used neonatal mice that lack Dsg3 (Strain 129xBL/6 Dsg3null) or mice that have defective Dsg3 (C57BL/6-bal/bal), both of which do not have spontaneously occurring PV phenotypes. A. The Original Dsg3-/- Mice In 1997, Koch et al. [70] developed transgenic mice that completely lacked the whole Dsg3 by targeted disruption of the Dsg3 gene. At the F2 generation, most of these mice at some time in their adult lives developed gross skin lesions around their eyes, nose, and other locations where their stratified epithelium were characteristically multilayered. Microscopically, these lesions were identical to typical lesions in patients with PV [68]. However, in subsequent generations, the probability of mice of this strain having gross or light microscopic PV-like lesions decreased. Lenox et al. [71] found that only 25% of Dsg3-/- homozygous mice generated from Dsg3+/- heterozygous parents had oral lesions observed by histological examination. When this Dsg3-/- mice strain was stabilized by backcrossing, the newly stabilized Dsg3-/- no longer developed PV-like lesion, except in very rare cases that occurred in aging mice. The reduction in the likelihood that the PV-like lesions occurred in mice through generations strongly suggested a segregate of an inadvertent double mutant that occurred in the first generation of the original mice. This is a real possibility because none of the experiments in the original publication excluded the possibility of incorporation of the targeting vector to other mouse genes other than Dsg3 gene. B. Nomenclature of Dsg3-/- Mice The original Dsg3-/- mice were designated as Dsg3tm1Stan , and these mice had black fur color [70]. This strain was originally developed at J.R. Stanley’s laboratory at the University of Pennsylvania. The second strain, designated B6; 129X1-Dsg3tm1Stan, is a result of crossing B6; 129X1 mice and the Dsg3tm1Stan mice and then backcrossing to select for homozygous Dsg3-/-. The third strain, the 129xBL/6 Dsg3null mice, which is the Dsg3-/- mice without PV-like lesions used in our studies, is the result of crossing the B6; 129X1-Dsg3tm1Stan mice with the white 129xBL/6 mice, and the inbred strain carrying pure Dsg3-/- was generated by sibling mating for many consecutive generations. These mice were white in color as they inherited fur color from the white 129xBL/6 strain. Natural mutant mice, C57BL/6-bal/bal, are the products of backcrossing of the Dsg3bal-2J (bal/bal) and C57BL/6 mice. Another natural Dsg3-/-mice strain that may be used for this purpose is Dsg3bal-Pas. In these mice there is a 14 bp deletion in exon 13 of the Dsg3 gene resulting in a frame-shift mutation, and premature termination codon 7 bp downstream from the site of the deletion that causes a truncation of the Dsg3 polypeptide by 199 amino acids, eliminating most of the intracellular domain. Although truncated Dsg3 mRNA transcript was detectable in Dsg3bal-Pas skin, the corresponding protein for Dsg3 was completely absent in the oral mucosal epithelium of homozygous Dsg3bal-Pas [70]. Therefore, this mouse could be an excellent model of mice lacking Dsg3. C. C57BL/6-bal/bal and 129xBL/6 Dsg3null Mice Generally Do Not Exhibit PV Phenotype Homozygous Dsg3-/- by PCR of the genomic DNA from the mice 129xBL/6 Dsg3null (Figure 19.1A) was confirmed. Similarly, homozygous Dsg3 mutants in C57BL/6-bal/bal mice were
1391_C19.fm Page 293 Tuesday, November 18, 2003 5:24 PM
PASSIVE TRANSFER OF NONDESMOGLEIN 1 AND 3 ANTIBODIES
A
293
B
C D
Figure 19.1
E
F
129xBL/6 Dsg3null mice. (A) Genotyping of Dsg3null mice: PCR with four primers, including a pair of primers for intact Dsg3 gene (sense: 5' TCTCTGGCCCTCCTGATGGT 3'; antisense: 5' CTCCCAACTCGTCTAGAGTC 3') that gives a 500 base-pair (bp) product and a pair for Neo gene (sense: 5' AGGTGAGATGACAGGAGATC 3'; antisense: 5' CTTGGGTGGAGAGGCTATTC 3') that gives a 280bp product. PCR of Dsg3+/+ genomic DNA produces only a 500bp product, while that of Dsg3-/- genomic DNA produces only a 280bp product. PCR of Dsg3+/- genomic DNA produces both 500bp and 280bp products. (B) Young adult 129xBL/6 Dsg3null mice that only have waves of hair loss and are otherwise normal without any PV phenotype. (C) A 1-day-old 129xBL/6 Dsg3null mouse after Nikolskiy’s sign was performed on its skin with a negative result. (D–G) Light microscopic examination of 129xBL/6 Dsg3null mice. (D) Light microscopic examination of a Dsg3null neonatal mice epidermis shows no acantholysis even after receiving mechanical shear force. (E) Skin from a 20-day-old mouse. (F) Oral tissue from a neonatal mouse. There is no difference in the microscopic features of skin of these Dsg3-/- mice and that of Dsg3+/+ mice at each particular age. Also note the natural development of mice epidermis from multiple nucleated layers at birth to the single nucleated layer at adulthood.
confirmed by PCR amplifying of genomic DNA and DNA sequencing (Figure 19.2B). Both mice strains at early to adult ages appeared to be normal without any evidence of PV phenotype. There were no gross skin lesions. Nikolskiy’s maneuver was performed on the skin of neonatal and adult mice and resulted in negative findings (Figure 19.1B through C and Figure 19.2A). Light microscopic examination of the skin (Figure 19.1D and E) and the oral tissue (Figure 19.1F) of these mice revealed no apparent acantholysis. The only interesting gross phenotype of these mice was the waves of hair loss occurring at a particular time in their lives. In some very rare cases, old mice of these strains developed skin lesions on their genitalia (Figure 19.3A) and face (Figure 19.3B). When these lesions were examined, there were numbers of abscesses underneath the skin, indicating infection underneath the skin (Figure 19.3C). It is likely that this infection might be secondary to the skin lesions rather than the original cause of the lesions because other mice housed in the same case did not get the lesions. Since the chance of these homozygous mice having spontaneous skin lesions after generation is much reduced, the rare occurrence of mice with gross skin lesions may suggest that these mice could inherit the homozygous double mutation from their original ancestors. Indeed, using PCR of the genomic DNA with specific primers revealed insertion of targeting vector DNA. Furthermore, WB using DG3.10 monoclonal antibody, the antibody that recognizes the 130kDa protein band of wild-type mouse epidermal proteins known to be Dsg3 and Dg4, does not recognize a protein band in epidermal proteins derived from these mice with gross skin lesions, suggesting that these mice with gross skin lesions lacked not only Dsg3 but also Dsg4. Interestingly, when the epidermal protein extract from these mutant mice was tested by WB using monoclonal antibody that was raised against the whole Dsg1 ectodomain, a very strong double band at 160
1391_C19.fm Page 294 Tuesday, November 18, 2003 5:24 PM
294
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
A
B
EXPECTED SEQUENCES WILD TYPE
TGAAGGACT
ATGCTGCGCCAGTC
HOMOZYGOUS T G A A G G A C TT A T G C T G C G C C A G T C HETEROZYGOUS T G A A G G A C T N N N N N N N N N C N N N N
CONFIRMATION RESULTS T
GT
A
A
G
G
A
C
G
A
C
T
T
A
T
G
C
T
G
C
G
C
C
A
G
C
C
A
G
T
C
Homozygous
T
G
A
A
G
T
A
T
G
C
T
G
C
G
T
C
A
Wild type
Figure 19.2
A Figure 19.3
C57BL/6-bal/bal strain consists of natural Dsg3 mutant mice. Congenitally, they have a null mutation in the Dsg3 gene. (A) Genotyping shows an insertion of a thymidine nucleotide at the position 2275 at exon 14 of Dsg3 gene that causes a frame shift resulting in a N-terminal truncated nonfunctional Dsg3. While sequencing of PCR products from homozygous Bal/Bal or normal mice give clean results, the PCR products generated from heterozygous mice give confusing signals after location of the mutation (i.e., NNNN) due to the frame shift. (B) Adult homozygous C57BL/6bal/bal mice typically do not have gross skin blisters nor histological epidermal acantholysis (data not shown), although they do have wave of hair loss.
B
C
In very rare cases, some old 129xBL/6 Dsg3null mice develop skin lesions. (A) Genitalia lesion leading to obstruction. (B) Lesion of facial skin around the eyes. (C) In severe cases, large abscesses underneath the skin can be seen. Genotyping of these mice showed that they have disruption of both Dsg3 and Dsg4 genes. Absence of Dsg3 and Dsg4 was also shown by Western blot of epidermal protein extract of these mice (data not shown).
kDa and below was detected, suggesting increased expression of Dsg1 isoforms to compensate for the lack of other Dsg [73]. Similar to the other two strains of Dsg3-/- mice, Dsg3bal-Pas mice normally do not have gross skin lesions. However, when mechanical shear force was applied on their paws for a period of time, these mice develop blisters on these areas [74]. This may indicate an underneath weakness of adhesion in the epidermis of these mice due to the lack of Dsg3 visible at the electron microscopic level.
III. DISEASE INDUCTION: EXPERIMENTAL MOUSE MODEL FOR PASSIVE TRANSFER OF NONDESMOGLEIN 1 AND 3 ANTIBODIES A. Development of PV Phenotype in Neonatal Mice The PV phenotype in neonatal mice is defined as having (1) gross skin lesions including skin blistering or skin wrinkling, (2) positive Nikolskiy’s sign, and (3) specific suprabasal epidermal acantholysis determined by histological study.
1391_C19.fm Page 295 Tuesday, November 18, 2003 5:24 PM
PASSIVE TRANSFER OF NONDESMOGLEIN 1 AND 3 ANTIBODIES
295
1. Gross Pathology Wrinkling of skin with or without large blister formation is a common gross pathological finding seen in neonatal mice that received PVIgG. Wrinkling epidermis is freely movable by a very slight touch of a finger on the mice skin. The best result for the experiment of passive transfer of pemphigus IgG is obtained when mice aged less than 1 day are used. The main reason for this may be that the mouse epidermis at this age has the highest number of nucleated KC layers (Figure 19.1D). These nucleated cells may represent the dynamic cells “moving” upward from the basal layer. When the mice grow older, their epidermis evolves to a single layer (Figure 19.1F), leaving behind no dynamically moving cells. At age 5 days or older, it is almost impossible to induce acantholysis by PVIgG in these mice. This characteristic makes mice skin very different from human skin; therefore, scientists should be very cautious in interpreting data obtained from mice experiments and then inferring to humans. 2. Nikolskiy’s Sign Since there is some confusion in the literature about Nikolskiy’s sign [75–78], it is important to know the correct definition of the sign and not confuse it with the blister-spread sign. The latter was described first by Lutz in 1957 [79,80] and then by Asboe-Hansen in 1960 [79,81]. The blisterspread sign, characteristic of pemphigus, is performed by gentle pressing upon a blister to make the blister readily enlarge within the epidermis in direction of the periphery. The spread-out of the blister due to mechanical pressure of the blister fluid represents the lost of cohesion within the epidermis at the perilesional area where the skin appears to be normal. The test is used to differentiate the blister of pemphigus from that of pemphigoid in which the separation of the skin occurs at the basement membrane. In pemphigoid, the basement membrane at the periphery of the blister is usually still strong enough to hold the epidermis; therefore, pressing pemphigoid blister tends to make it distend out above its edge rather than readily spread out. Nikolskiy’s sign, on the other hand, as described by Nikolskiy in his doctoral thesis in 1896 [79,82], is performed by applying lateral pressure with a finger on a visibly normal skin area. A positive Nikolskiy’s sign is present if the upper epidermis is dislodged from the freshly moist surface, but not bloody, of the underlying layer that reveals a loss of cohesion within the epidermis underneath normal-appearing skin. On neonatal mice, because of the small size of the animal, a pencil eraser can be used to apply lateral pressure. 3. Histology Unlike human skin, the epidermis in mice evolves rapidly within a few days after birth, from multiple nucleated cell layers on certain anatomic locations to only one or a few layers (Figure 19.1D-E). Mice aged less than 1 day have thicker epidermises at the extremities, paws, head, and neck areas. The dorsal epidermis has fewer layers and the abdominal epidermis usually has only about two nucleated cell layers. Within a few days, the epidermis evolves into a single nucleated layer while hairs fully grow. Epithelium at hair bulbs usually has more than one layer while the epidermis of the skin surrounding hair follicles virtually has only one nucleated layer, which is topped by the stratum corneum and bottomed by the basement membrane. The time in which mice epidermis evolves is different among strains, ranging about 3 days in Bal/c, bal/bal (strain C57BL/6-bal/bal), and Dsg3-/- mice (strain 129xBL/6 Dsg3null), to about 5 days in athymic nude mice. The age- and anatomical location-dependent morphology of the mouse epidermis is a very important consideration in experiments on pemphigus using the mouse model. To determine if acantholysis occurs, skin sections at any anatomical location can be used. We usually examine the cross section of neonatal mice at the umbilical level because in these mice the
1391_C19.fm Page 296 Tuesday, November 18, 2003 5:24 PM
296
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
umbilicus can be visualized so we can use it as a standard, and the cross section will provide skin sample of both abdominal and dorsal areas [26,37,69,83]. To differentiate the type of pemphigus lesion, that is, PV vs. PF, skin sections at the area where the epidermis consists of at least four layers should be used. The number of layers is necessary to determine whether an acantholysis is suprabasal or superficial. As a principle, the same anatomical location should be used for both control and experimental mice. Examining the skin at the head and neck areas of neonatal mice that were injected with PVIgG or PFIgG, we found that the suprabasal acantholysis and the superficial acantholysis, respectively. These findings are consistent in the neonatal mice model regardless of strains bal/c, C57BL/6-bal/bal, or 129xBL/6 Dsg3null [83]. B. Interpretation of Disease-Induction Mechanism Although there is a defect of adhesion at the ultrastructural level described in the epidermis of mice lacking Dsg3 later in life (i.e., 3 days to 5 months), this defect has never been described in the epidermis of neonatal mice lacking Dsg3 (i.e., within the first 2 days of life). The short period immediately after birth in mice appears to be a critical time for epidermis development. As mentioned, it is the time the epidermis evolves rapidly from multiple nucleated cell layers to a single nucleated layer except at the skin region adjunct to the mucosal area around the eyes, nose, mouth, and genitalia. The epidermis of 1- to 2-day-old neonatal mice lacking Dsg3, is, indeed, very strong; that is, one cannot produce positive Nikolskiy’s sign. Even with a strong shear force that can tear off the skin, the epidermis of these mice is still intact. Since the mouse model for passive transfer non-Dsg1 and 3 antibodies is done on neonatal mice aged less than 2 days, it is appropriate to conclude that the additional antibodies to KC antigens other than Dsg1 and Dsg3 are pathogenic. However, the pathogenic mechanism of induction of PV-like lesions in these mice by non-Dsg1 and 3 antibodies should be interpreted in the context of an epidermis lacking an important Dsg.
IV. LESSONS LEARNED A. PVIgG TKC Antigens Other than Dsg1 and Dsg3 Can Induce PV-Like Lesion We have previously demonstrated that when PVIgG that lacks of Dsg1 antibody was injected to the C57BL/6-bal/bal or 129xBL/6 Dsg3null neonatal mice, these mice developed PV-like lesions [83]. The gross and microscopic lesions in these Dsg3-deficient neonatal mice were typical for PV (Figure 19.4A to C). After many years of examining numerous PV sera by IIF, we found that almost all PV sera samples available in our laboratory would label the epidermal cell surface of mice lacking Dsg3 as long as they would label the epithelial cell surface of monkey esophagus. More than 40 PV sera were characterized by various sensitive methods including ELISA of recombinant Dsg1. We found that IgG from PV sera that did not contain Dsg1 antibodies could induce PV-like lesions in Dsg3-deficient neonatal mice of both strains. Therefore, the data were convincing enough to prove the existence of possible pathogenic antibodies to antigens other than Dsg1 and Dsg3. We used the standard technique for passive transfer of IgG to Dsg3-/- neonatal mice. B. Identification of Variants of a Novel Cadherin Antigen, Dsg4, with a Critical Role in Mediating Acantholysis in PV As mentioned previously, the data that show antibodies that can bind to Dsg3 can be pathogenic in PV are extremely convincing, but with a missing link. With regard to the understanding of PV pathogenesis in humans, this missing link is the involvement of a critical signaling receptor. Synthesizing the data from many researchers in the field, we speculated that the missing antigen
1391_C19.fm Page 297 Tuesday, November 18, 2003 5:24 PM
PASSIVE TRANSFER OF NONDESMOGLEIN 1 AND 3 ANTIBODIES
297
A
B
Figure 19.4
C
Passive transfer of PVIgG that do not contain Dsg1 antibody to homozygous 129xBL/6 Dsg3null neonatal mice. (A) Twenty milligrams of PVIgG per gram of mouse body weight were injected intraperitoneally to each mouse. Eighteen to 24 hours after injection all mice developed gross skin lesions ranging from skin wrinkling to large placid fluid-filled blisters. (B) A representative light microscopic examination of skin section of these mice reveals suprabasal acantholysis and epidermal separation. The row of “tombstone” basal cells is typical for PV. (C) A representative of direct IF examination of skin sections of these mice with FITC-conjugated antibody to human IgG reveals intercellular staining of the epidermis that is typical for PV.
could very likely be a cadherin-signaling receptor that has an ectodomain very similar to Dsg3 so that it can be recognized by the pathogenic PVIgG that bind to Dsg3. The pathogenic antigen must also have a cytoplasmic signaling domain so that it can mediate signaling. In a set of simple experiments, we used recombinant Dsg3 to affinity purify anti-Dsg3 PVIgG and used them to find the novel antigen by Western blot of epidermal proteins of mice lacking Dsg3 [83]. These pathogenic antibodies appeared to strongly recognize protein bands of 130 kDa, 190 kDa, and 40 kDa. The existence of a 190-kDa band beside a 130-kDa band highly suggested that it was a heavily glycosylated form of the 130-kDa protein as we learned from three known desmogleins. Indeed, in the same set of experiments, we proved that this was the case because PVIgG that bound to the 190-kDa band could not bind to the 130-kDa band. This indicated that there were two populations of PVIgG to Dsg4; one was glycosylation dependent (which binds to 190 kDa) and the other was conformational dependent but glycosylation independent (which binds to 130k Da). As mentioned below, we now have identified the molecular structure of two slicing variant isoforms of Dsg4. In addition, we have been able to produce the recombinant ectodomain of Dsg4 and showed that sera
1391_C19.fm Page 298 Tuesday, November 18, 2003 5:24 PM
298
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
of patients with PV contain IgG to Dsg4. Furthermore, we showed that PVIgG to Dsg3, indeed, could cross react with Dsg4 [73,84]. C. Limitations of Neonatal Mice Model for PV The major limitations of the mice model can be attributed to the concept that “mice are not human.” Because mice live in the bush and humans live in houses, their epidermis as the last barrier that protects the body from the external environment, evolved quite differently. This will be illustrated below. Because of this fact, experimental results from the mouse model sometimes lead to observations that may contradict reality in human patients with the disease. For example, we know that antibodies that can bind to Dsg1 commonly exist in patients with PF and these antibodies can cause the typical intragranular or subcorneal epidermal splitting in wild-type neonatal mice. However, when PFIgG was injected to Dsg3tm1Stan neonatal mice, these mice were extremely vulnerable to the antibodies and developed PV-like lesions [85]. On the other hand, when PFIgG was injected into more stabilized Dsg3-/- neonatal mice (129xBL/6 Dsg3null), these mice developed PF-like lesions [83]. As discussed below, we now know that unlike humans, mice have three isoforms of Dsg1 (a, b, and g) that are more than 90% identical to each other. The presence or absence of Dsg4 and Dsg3 in these neonatal mice may stimulate desmoglein compensation by increasing the expression of ectopic Dsg1b and Dsg1g at the lower epidermal layers that may be extremely important for early development of these animals. The existence of three targets for PFIgG may explain why different results were obtained from passive transfer of PFIgG to various strains of Dsg3-/- neonatal mice. Indeed, this experiment was the one used to suggest that interference in the adhesive function of Dsg1 and Dsg3 might be responsible for acantholysis in PV [83]. If interference of adhesive function of the two molecules causes acantholysis, we should see an “acantholysis zone” throughout the KC layers that contain both Dsg1 and Dsg3. However, in reality, in the skin lesion of patients with PV, the slit in the epidermis is very discrete and specific right above the basal cell layer, despite the fact that some contain both Dsg1- and Dsg3-targeting antibodies (Figure 19.5). The other limitation of the model is the development of the epidermis in mouse. Neonatal mouse epidermis has multiple nucleated layers. However, unlike humans, a few days after birth mouse epidermis evolves into a single nucleated layer except for the skin near the mucosal region, that is, eyes, nostrils, mouth, and so on. Since a multiple-nucleated cell-layered epidermis is necessary for acantholysis to occur under the effect of PVIgG, the younger the mouse, the greater the chance that a positive result can be obtained. However, this should be balanced with the purpose of the experiments. For example, young skin, which is substantially vulnerable to pathogenic antibodies, could render the determination of the effectiveness of antiacantholytic drugs extremely difficult. Because of the differences between human and mouse epidermis, any data from these neonatal mouse models that do not agree with the actual facts observed in human patients should be interpreted with great caution. D. Products of Genome Projects Provide Solution for Pemphigus Controversy 1. Identifying the Novel PV Antigen Desmoglein 4 (Dsg4) Thanks to the Genome Project, the amount of data on human and mouse genes has rapidly increased. The complete data sets of human and mouse genomes are now available. There is computational software that can predict potential genes and cDNA of novel molecules. The Annotation Project of the National Center for Biotechnology Information (NCBI) has deposited a huge number of computational, predicted novel molecules to the GenBank database. Although the computational predicted molecules may not be accurate, their physical existence can be tested simply by RT-PCR. This may be the dream tool for scientists who love to discover novel molecules.
1391_C19.fm Page 299 Tuesday, November 18, 2003 5:24 PM
PASSIVE TRANSFER OF NONDESMOGLEIN 1 AND 3 ANTIBODIES
299
Dsg1 Dsg3
Figure 19.5
Typical suprabasal epidermal split in PV acantholysis. It has been postulated that skin lesions of PV patients are caused by antibodies that interfere with the adhesive function of both Dsg3 and Dsg1. Since it was shown that Dsg3 dominates in the basal layer and Dsg1 dominates in the upper layers (left), logically there should be an acantholytic zone above the basal cells. However, a typical direct IF examination of skin sections of PV patients with FITC-conjugated antibody to human IgG reveals that this is not the case. This patient has antibodies to both Dsg1 and Dsg3. The typical PV intercellular staining appears throughout the epidermis of about ten KC layers with stronger intensity above the basal cells. There is a sharp split right at the basal-suprabasal junction rather than a deep zone of three to five cell layers with acantholysis.
One can search for potential novel molecules that have some homology with the known molecule from the GenBank with the use of the BLAST tool. Similarly, one can find and define whether an isoform of a molecule exists in the animal. Defining the intron–exon arrangement of a gene now can be done simply by a BLAST on the NCBI’s web server! Similarly, a simple BLAST search on the genome database will provide the arrangement of various genes in a gene cluster family. We used the BLAST to search for a potential sequence of the novel 130- and 190-kDa pemphigus antigen and found one computational predicted sequence that was very similar to Dsg3. We used the sequence of this computational predicted sequence to search for other existing EST sequences, and used these sequences to design specific primers to amplify a novel human epidermal cadherin that we now call desmoglein 4 (Dsg4, GenBank accession number AY168788, October 2002) [73]. Interestingly, the N-terminus region of the Dsg4 ectodomain is more than 90% similar to those of Dsg1 and Dsg3. More importantly, the cytoplasmic domain of Dsg4 contains a putative consensussignaling domain typical of classical cadherins. This domain can bind to a known catenin protein, Hakai [86], as well as p120ctn protein [87,88], which is very important for mediating cell signaling by a process called “direct cadherin-activated cell signaling” [89–91]. Interestingly, via genetic study of inherited hypotrichosis, a completely different approach from that of the PV study, we also discovered Dsg4 and provided evidence that the molecule has a central role in the control of keratinocyte adhesion and differentiation in the epidermis [84]. We further used the actual Dsg4 cDNA sequence for a BLAST search of the homology gene in mouse genome database. The mouse genomic DNA sequence that contained the homology sequence of Dsg4 was downloaded and used for computational analysis. This method allowed us to construct a computational predicted sequence for mouse Dsg4 mRNA. By RT-PCR, we were able to amplify a large portion of mouse Dsg4 mRNA with a sequence that proved to be 100%
1391_C19.fm Page 300 Tuesday, November 18, 2003 5:24 PM
300
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
identical to the sequence of the predicted one [73] (GenBank accession number, BK001041, April 2003). We also demonstrated that sera of patients with PV contained IgG to Dsg4 and that there is cross-activity between PVIgG to Dsg3 and Dsg4. The finding of this novel PV antigen may explain our previous finding that pathogenic IgG to KC antigens other than Dsg1 and Dsg3 can cause PV-like lesions in the neonatal mouse model. 2. Identifying Novel Mouse Dsg1 Isoforms, Dsg1b and Dsg1g We also used the human, mouse, and rat genome database to identify isoforms of Dsg1, Dsg2, Dsg3, and Dsg4. It appeared that no isoform for human Dsg existed, although the method did not exclude the possibility of the existence of splicing variants. Similarly, no isoform for rat Dsg was found. On the other hand, while mouse has no isoform for Dsg2, Dsg3, and Dsg4, the animal genome contains the genes for three independent isoforms for Dsg1 that locate on contiguous regions on chromosome 18 (Dsg1a, Dsg1b, and Dsg1g). Since their sequences shared more than 90% identity, the predicted sequences of Dsg1b and Dsg1g were constructed by simply joining the exons indicated by the BLAST results [73]. Interestingly, via different approaches, the two Dsg1 isoforms in mouse were also discovered by other laboratories [92,93]. The discovery of two novel Dsg1 isoforms, Dsg1b and Dsg1g, in addition to the known Dsg1a in mice provides a likely explanation for the discrepancy in the previous data from passive transfer of PFIgG to Dsg3-/neonatal mice.
V. CONCLUSION The pathogenesis of pemphigus has been very interesting to many scientists. Major progress in understanding the disease has occurred since Talbott et al. [94] published their paper about a disturbance of water and salt metabolism in pemphigus in 1940. Scientific and technological advances, together with the efforts of all scientists mentioned in this chapter and others, have allowed us to learn much about its pathomechanism. Recent results of the Genome Project have opened a whole new world of knowledge. As we enter into the vast unknown of nature, we must accept that our best efforts may not provide perfect answers, and that we should be open to the possibility of alternative or additional explanations. The experimental mouse model for passive transfer of non-Dsg1 and 3 antibodies has primed us for the discovery of novel Dsg4 in humans and mice as well as unique Dsg1 isoforms in mice, and proves that there is indeed another half of the pemphigus story [95]. This other half of the story can be put together with the previous knowledge of Dsg3 and Dsg1 to derive a revised “multiple hit” hypothesis for the pathogenesis of pemphigus. Accordingly, we have proposed a working model for the biological function of Dsg4 (Figure 19.6) [73]. This model is based on the concept of heterotypic interaction of ectodomains of cadherins from family desmoglein as well as the difference in distribution of Dsg1 and Dsg3 in various layers of the epidermis. Dsg1 expresses more in the upper layers of the epidermis, while Dsg3 expresses more in the basal layer of the epidermis. We propose that the “direct cadherin-activated cell signaling” induced by interaction of Dsg3 to Dsg4 may regulate early differentiation KC as well as formation of adhesion structures of the dynamic types, that is, adherens junctions and less-mature desmosomes. On the other hand, direct cadherin-activated cell signaling induced by interaction of Dsg1 to Dsg4 may stimulate KC differentiation as well as formation of adhesion structure of static types, that is, mature desmosomes. In PV, pathogenic antibodies may block the interaction of Dsg1 and Dsg3 to Dsg4 or may act directly on Dsg4, which subsequently produces the wrong signal to the cell, which in turn causes several adverse effects such as retraction of tonofilaments and dissolution of adherens junctions, among others that ultimately lead to acantholysis. Inhibition of Dsg3 assembly to desmosomes may explain some desmosome dissolution. Direct inhibition of Dsg3 adhesive function may provide
1391_C19.fm Page 301 Tuesday, November 18, 2003 5:24 PM
PASSIVE TRANSFER OF NONDESMOGLEIN 1 AND 3 ANTIBODIES
DSG1
DSG1
DSG3
DSG4
Figure 19.6
Interaction of DSG1 to DSG4--> Activation signaling --> clustering of desmosomal cadherins, increase mature desmosomes, increase keratin bundles. Regulate KC LATE DIFFERENTIATION and CORNIFICATION
DSG4
DSG4
DSG3
301
b-catenin Plakoglobin p120CAS Hakai
}
Signaling to other cell compartments and nucleus Communicate to other signaling pathways; i.e., Wnt/Wingless and AChR. Others ? Direct effector.
Interaction of DSG3 to DSG4 --> Activation signaling --> clustering of classical cadherins, increase adherens junctions and less mature desmosomes. Regulate KC EARLY DIFFERENTIATION
A working dynamic model for possible regulation mechanism of cell adhesion as well as proliferation and differentiation at the basal–spinous interface of the stratified squamous epithelium. KCs proliferate at the basal layer. For the cells to migrate from the more dynamic basal zone to reach the stratum spinosum where they become differentiated, the cells must resolve old adhesion below (arrow) and form new one above (arrow). To distinguish the above from below, Dsg4 plays a central role in regulating cell functions because its ectodomain can interact with both Dsg1 and Dsg3. Interaction of Dsg3 and Dsg4 may send a signal into the cell to regulate KC early differentiation and cell adhesion of the dynamic type. On the other hand, interaction of Dsg1 and Dsg4 may regulate KC late differentiation and cell adhesion of the static type.
an additional mechanism that explains the splitting of desmosomes at the lower lateral side of the basal cells that are occasionally seen in electron microscopic studies of patients’ lesion.
ACKNOWLEDGMENT This work is made possible because of information in the public domain provided by the National Center for Biotechnology Information of the National Institutes of Health and the published data of many scientists, especially the works of J.R. Stanley, M. Amagai, P.J. Koch, L.A. Diaz, and colleagues. I specially thank my former colleagues J.J. Zone and R.M. Horton who first mentored me in the science and art of immunology and molecular biology. I am also grateful to my wife, Anh Vo, who helped me to complete this manuscript while carrying our first child.
REFERENCES 1. Beutner, E. and Jordon, R., Demonstration of skin antibodies in sera of pemphigus vulgaris patients by indirect immunofluorescent staining, Proc. Soc. Exp. Biol. Med., 117, 505, 1964. 2. Holubar, K. et al., Studies in immunodermatology. 3. Induction of intraepithelial lesions in monkeys by intramucosal injections of pemphigus antibodies, Int. Arch. Allergy Appl. Immunol., 44, 631, 1973. 3. Michel, B. and Ko, C.S., An organ culture model for the study of pemphigus acantholysis, Br. J. Dermatol., 96, 295, 1977. 4. Schiltz, J.R. and Michel, B., Production of epidermal acantholysis in normal human skin in vitro by the IgG fraction from pemphigus serum, J. Invest. Dermatol., 67, 254, 1976. 5. Anhalt, G.J. et al., Induction of pemphigus in neonatal mice by passive transfer of IgG from patients with the disease, N. Engl. J. Med., 306, 1189, 1982. 6. Anhalt, G.J. et al., Defining the role of complement in experimental pemphigus vulgaris in mice, J. Immunol., 137, 2835, 1986. 7. Zhu, S. et al., The location of binding sites of pemphigus vulgaris and pemphigus foliaceus autoantibodies: a post-embedding immunoelectron microscopic study, Br. J. Dermatol., 136, 878, 1997.
1391_C19.fm Page 302 Tuesday, November 18, 2003 5:24 PM
302
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
8. Boulinguez, S. et al., Ultrastructural localisation of pemphigus vulgaris and pemphigus foliaceus antigens by indirect immunoelectron microscopy. Apropos of 7 cases, Ann. Dermatol. Venereol., 122, 417, 1995. 9. Takigawa, M. et al., Surface distribution of pemphigus antibody-binding substances(s) on isolated guinea pig epidermal cells: An immunoferritin electron microscopic study, J. Invest. Dermatol., 71, 182, 1978. 10. Ablin, J.R.J. and Beutner, E.H., Precipitation of epithelia antigen(s) with pemphigus-like autoantibodies of rabbit and human pemphigus autoantibodies, Experientia, 24, 1055, 1968. 11. Shu, S.Y. and Beutner, E.H., Isolation and characterization of antigens reactive with pemphigus antibodies, J. Invest. Dermatol., 61, 270, 1973. 12. Diaz, L.A., Patel, H., and Calvanico, N.J., Isolation of pemphigus antigen from human saliva, J. Immunol., 124, 760, 1980. 13. Stanley, J.R. et al, Pemphigus antibodies identify a cell surface glycoprotein synthesized by human and mouse keratinocytes, J. Clin. Invest., 70, 281, 1982. 14. Eyre, R.W. and Stanley, J.R., Identification of pemphigus vulgaris antigen extracted from normal human epidermis and comparison with pemphigus foliaceus antigen, J. Clin. Invest., 81, 807, 1988. 15. Peterson, L.L. and Wuepper, K.D., Isolation and purification of a pemphigus vulgaris antigen from human epidermis, J. Clin. Invest., 73, 1113, 1984. 16. Acosta, E. and Ivanyi, L., Identification of pemphigus-like antigens expressed by SCaBER cells, Br. J. Dermatol., 112, 157, 1985. 17. Acosta, E. and Ivanyi, L., Oral epithelial cells as the origin of pemphigus antigen in human saliva, Arch. Oral Biol., 30, 23, 1985. 18. Amagai, M., Klaus-Kovtun, V., and Stanley, J.R., Autoantibodies against a novel epithelial cadherin in pemphigus vulgaris, a disease of cell adhesion, Cell, 67, 869, 1991. 19. Ishii, K. et al., Characterization of autoantibodies in pemphigus using antigen-specific enzyme-linked immunosorbent assays with baculovirus-expressed recombinant desmogleins, J. Immunol., 159, 2010, 1997. 20. Amagai, M. et al., Conformational epitopes of pemphigus antigens (Dsg1 and Dsg3) are calcium dependent and glycosylation independent, J. Invest. Dermatol., 105, 243, 1995. 21. Ding, X. et al., The anti-desmoglein 1 autoantibodies in pemphigus vulgaris sera are pathogenic, J. Invest. Dermatol., 112, 739, 1999. 22. Kowalczyk, A.P. et al., Pemphigus sera recognize conformationally sensitive epitopes in the aminoterminal region of desmoglein-1, J. Invest. Dermatol., 105, 147, 1995. 23. Ding, X. et al., Mucosal and mucocutaneous (generalized) pemphigus vulgaris show distinct autoantibody profiles, J. Invest. Dermatol., 109, 592, 1997. 24. Joly, P. et al., Identification of a new antibody population directed against a desmosomal plaque antigen in pemphigus vulgaris and pemphigus foliaceus, J. Invest. Dermatol., 108, 469, 1997. 25. Nguyen, V.T., Ndoye, A., and Grando, S.A., Novel human alpha 9 acetylcholine receptor regulating keratinocyte adhesion is targeted by pemphigus vulgaris autoimmunity, Am. J. Pathol., 157, 1377, 2000. 26. Nguyen, V.T., Ndoye, A, and Grando, S.A., Pemphigus vulgaris antibody identifies pemphaxin: a novel keratinocyte annexin-like molecule binding acetylcholine, J. Biol. Chem., 275, 29466, 2000. 27. Wilgram, G.F., Caulfield, J.B., and Lever, W.F., An electron microscopic study of acantholysis in pemphigus vulgaris, J. Invest. Dermatol., 36, 373, 1961. 28. Hashimoto, K. and Lever, W.F., The cell surface coat of normal keratinocytes and of acantholytic keratinocytes in pemphigus: An electron microscopic study, Br. J. Dermatol., 83, 282, 1970. 29. Hashimoto, K. and Lever, W.F., The intercellular cement in pemphigus vulgaris, an electron microscopic study, Dermatologica, 135, 27, 1967. 30. Hashimoto, K. and Lever, W.F., An electron microscopic study on pemphigus vulgaris of the mouth and the skin with special reference to the intercellular cement, J. Invest. Dermatol., 48, 540, 1967. 31. Takahashi, Y. et al., Experimentally induced pemphigus vulgaris in neonatal BALB/c mice: a timecourse study of clinical, immunologic, ultrastructural, and cytochemical changes, J. Invest. Dermatol., 84, 41, 1985. 32. Lever, W.F., Pemphigus in Medicine, Talbott, J.H., Ed., Williams and Wilkins, Baltimore, 1953, p. 123.
1391_C19.fm Page 303 Tuesday, November 18, 2003 5:24 PM
PASSIVE TRANSFER OF NONDESMOGLEIN 1 AND 3 ANTIBODIES
303
33. Dumas, V. et al., The treatment of mild pemphigus vulgaris and pemphigus foliaceus with a topical corticosteroid, Br. J. Dermatol., 140, 1127, 1999. 34. Toth, G.G. and Jonkman, MF, Therapy of pemphigus, Clin. Dermatol. 19, 761, 2001. 35. Swanson, D.L. and Dahl, M.V., Methylprednisolone inhibits pemphigus acantholysis in skin cultures, J. Invest. Dermatol., 81, 258, 1983. 36. Jeffes, E.W., Kaplan, R.P., and Ahmed, A.R., Acantholysis produced in vitro with pemphigus serum: hydrocortisone inhibits acantholysis, while dapsone and 6-mercaptopurine do not inhibit acantholysis, J. Clin. Immunol., 4, 359, 1984. 37. Nguyen, V.T. et al., Pemphigus vulgaris IgG and a corticosteroid exhibit reciprocal effects on keratinocyte adhesion molecules, J. Invest. Dermatol., 119, 227, 2002. 38. Decker, R.H., Mechanism of acantholysis: the effect of cantharidin on oxidative phosphorylation, J. Invest. Dermatol., 42, 465, 1964. 39. Decker, R.H., The identification of a phosphoprotein in acantholytic epidermis, J. Invest. Dermatol., 51, 141, 1968. 40. Decker, R.H., Cantharidin-induced acantholysis, Arch. Dermatol., 94, 509, 1966. 41. Decker, R.H. and McMahon, N.J., Phosphoprotein synthesis in epidermis during acantholysis, Proc. Soc. Exp. Biol. Med., 132, 1178, 1969. 42. Decker, R.H., Activation of a protein kinase during acantholysis, J. Invest. Dermatol., 57, 125, 1971. 43. Li, Y.M. and Casida, J.E., Cantharidin-binding protein: identification as protein phosphatase 2A, A. Proc. Natl. Acad. Sci. U. S. A., 89, 11867, 1992. 44. Honkanen, R.E., Cantharidin, another natural toxin that inhibits the activity of serine/threonine protein phosphatases types 1 and 2A, FEBS Lett., 330, 283, 1993. 45. Kitajima, Y., Aoyama, Y., and Seishima, M., Transmembrane signaling for adhesive regulation of desmosomes and hemidesmosomes, and for cell-cell datachment induced by pemphigus IgG in cultured keratinocytes: involvement of protein kinase C, J. Invest. Dermatol. Symp. Proc., 4, 137, 1999. 46. Kitajima, Y., Inoue, S., and Yaoita, H., Effects of pemphigus antibody on the regeneration of cell-cell contact in keratinocyte cultures grown in low to normal Ca++ concentration, J. Invest. Dermatol., 89, 167, 1987. 47. Seishima, M. et al., Pemphigus IgG, but not bullous pemphigoid IgG, causes a transient increase in intracellular calcium and inositol 1,4,5-triphosphate in DJM-1 cells, a squamous cell carcinoma line, J. Invest. Dermatol., 104, 33, 1995. 48. Seishima, M. et al., Phosphatidylcholine-specific phospholipase C, but not phospholipase D, is involved in pemphigus IgG-induced signal transduction, Arch. Dermatol. Res., 291, 606, 1999. 49. Osada, K., Seishima, M., and Kitajima, Y., Pemphigus IgG activates and translocates protein kinase C from the cytosol to the particulate/cytoskeleton fractions in human keratinocytes, J. Invest. Dermatol., 108, 482, 1997. 50. Aoyama, Y., Owada, M.K., and Kitajima, Y., A pathogenic autoantibody, pemphigus vulgaris-IgG, induces phosphorylation of desmoglein 3, and its dissociation from plakoglobin in cultured keratinocytes, Eur. J. Immunol., 29, 2233, 1999. 51. Farb, R.M., Dykes, R., and Lazarus, G.S., Anti-epidermal-cell-surface pemphigus antibody detaches viable epidermal cells from culture plates by activation of proteinase, Proc. Natl. Acad. Sci. U. S. A., 75, 459, 1978. 52. Baird, J. et al., mRNA for tissue-type plasminogen activator is present in lesional epidermis from patients with psoriasis, pemphigus, or bullous pemphigoid, but is not detected in normal epidermis, J. Invest. Dermatol., 95, 548, 1990. 53. Hashimoto, K. et al., Anti-cell surface pemphigus autoantibody stimulates plasminogen activator activity of human epidermal cells: a mechanism for the loss of epidermal cohesion and blister formation, J. Exp. Med., 157, 259, 1983. 54. Seishima, M. et al., Pemphigus IgG induces expression of urokinase plasminogen activator receptor on the cell surface of cultured keratinocytes, J. Invest. Dermatol., 109, 650, 1997. 55. Xue, W., Hashimoto, K., and Toi, Y., Functional involvement of urokinase-type plasminogen activator receptor in pemphigus acantholysis, J. Cutan. Pathol., 25, 469, 1998. 56. Morioka, S., Naito, K., and Ogawa, H., The pathogenic role of pemphigus antibodies and proteinase in epidermal acantholysis, J. Invest. Dermatol., 76, 337, 1981.
1391_C19.fm Page 304 Tuesday, November 18, 2003 5:24 PM
304
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
57. Naito, K. et al., Proteinase inhibitors block formation of pemphigus acantholysis in experimental models of neonatal mice and skin explants: effects of synthetic and plasma proteinase inhibitors on pemphigus acantholysis, J. Invest. Dermatol., 93, 173, 1989. 58. Woo, T.Y. et al., Specificity and inhibition of the epidermal cell detachment induced by pemphigus IgG in vitro, J. Invest. Dermatol., 81, 115s, 1983. 59. Hashimoto, K. et al., Characterization of keratinocyte plasminogen activator inhibitors and demonstration of the prevention of pemphigus IgG-induced acantholysis by a purified plasminogen activator inhibitor, J. Invest. Dermatol., 92, 310, 1989. 60. Amagai, M. et al., Usefulness of enzyme-linked immunosorbent assay using recombinant desmogleins 1 and 3 for serodiagnosis of pemphigus, Br. J. Dermatol., 140, 351, 1999. 61. Veldman, C. et al., Dichotomy of autoreactive Th1 and Th2 cell responses to desmoglein 3 in patients with pemphigus vulgaris (PV) and healthy carriers of PV-associated HL.A. class II alleles, J. Immunol., 170, 635, 2003. 62. Lin, M.S. et al., Development and characterization of desmoglein-3 specific T cells from patients with pemphigus vulgaris, J. Clin. Invest., 99, 31, 1997. 63. Amagai, M. et al., Autoantibodies against the amino-terminal cadherin-like binding domain of pemphigus vulgaris antigen are pathogenic, J. Clin. Invest., 90, 919, 1992. 64. Tsunoda, K. et al., Induction of pemphigus phenotype by a mouse monoclonal antibody against the amino-terminal adhesive interface of desmoglein 3, J. Immunol., 170, 2170, 2003. 65. Allen, E., Yu, Q.C., and Fuchs, E., Mice expressing a mutant desmosomal cadherin exhibit abnormalities in desmosomes, proliferation, and epidermal differentiation, J. Cell Biol., 133, 1367, 1996. 66. Whittock, N.V. et al., Striate palmoplantar keratoderma resulting from desmoplakin haploinsufficiency, J. Invest. Dermatol., 113, 940, 1999. 67. Rickman, L. et al., N-terminal deletion in a desmosomal cadherin causes the autosomal dominant skin disease striate palmoplantar keratoderma, Hum. Mol. Genet., 8, 971, 1999. 68. Armstrong, D.K. et al., Haploinsufficiency of desmoplakin causes a striate subtype of palmoplantar keratoderma, Hum. Mol. Genet., 8, 143, 1999. 69. Nguyen, V.T. et al., Molecular cloning and partial characterization of novel keratinocyte annexin-like molecule identified by pemphigus vulgaris antibodies, J. Invest. Dermatol., 110, 486, 1998. 70. Koch, P.J. et al., Targeted disruption of the pemphigus vulgaris antigen (desmoglein 3) gene in mice causes loss of keratinocyte cell adhesion with a phenotype similar to pemphigus vulgaris, J. Cell Biol., 137, 1091, 1997. 71. Lenox, J.M. et al., Postnatal lethality of P-Cadherin/Desmoglein 3 double knockout mice: demonstration of a cooperative effect of these cell adhesion molecules in tissue homeostasis of stratified squamous epithelia, J. Invest. Dermatol., 114, 948, 2000. 72. Pulkkinen, L. et al., Loss of cell adhesion in Dsg3bal-Pas mice with homozygous deletion mutation (2079del14) in the desmoglein 3 gene, J. Invest. Dermatol., 119, 1237, 2002. 73. Nguyen, V.T. et al., A novel pemphigus vulgaris antigen desmoglein 4 has an central role in keratinocyte adhesion and differentation, in preparation. 74. Montagutelli, X. et al., Vesicle formation and follicular root sheath separation in mice homozygous for deleterious alleles at the balding (bal) locus, J. Invest. Dermatol., 109, 324, 1997. 75. Jordon, R.E., Pemphigus, McGraw-Hill, New York, 1979. 76. Fine, J.-D., Immunobullous Diseases, Churchill Livingstone, London; Edinburgh, 1996. 77. Fine, J.-D., Introduction to Vesicobullous Diseases, Harper and Row, Philadelphia, 1987. 78. Odom, R.B., James, W.D., and Berger, T.G., Andrews’ Diseases of the Skin: Clinical Dermatology, W.B. Saunders, Philadelphia, 2000. 79. Grando, S.A. et al., History and clinical significance of mechanical symptoms in blistering dermatoses: a reappraisal, J. Am. Acad. Dermatol., 48, 86, 2003. 80. Lutz, W., Pemphigus chronicus vulgaris, Lehrbuch Haut-Geschlehts-Krankheiten Basel Karger, 34, 198, 1957. 81. Asboe-Hansen, G., Blister-spread induced by finger pressure, a diagnostic sign in pemphigus, J. Invest. Dermatol., 34, 5, 1960. 82. Nikolskiy, P.V., The Materials on the Study of Pemphigus Foliaceus Cazenavi, Ph.D. diss., 1896, St. Vladimir Emperor University, Kiev, Ukraine (in Russian).
1391_C19.fm Page 305 Tuesday, November 18, 2003 5:24 PM
PASSIVE TRANSFER OF NONDESMOGLEIN 1 AND 3 ANTIBODIES
305
83. Nguyen, V.T. et al., Antibodies against keratinocyte antigens other than desmogleins 1 and 3 can induce pemphigus vulgaris-like lesions, J. Clin. Invest., 106, 1467, 2000. 84. Kljuic, A. et al., Desmoglein 4 in hair follicle differentiation and epidermal adhesion. Evidence from inherited hypotrichosis and acquired pemphigus vulgaris, Cell, 113, 249, 2003. 85. Mahoney, M.G. et al., Explanations for the clinical and microscopic localization of lesions in pemphigus foliaceus and vulgaris, J. Clin. Invest., 103, 461, 1999. 86. Fujita, Y. et al., Hakai, a c-Cbl-like protein, ubiquitinates and induces endocytosis of the E-cadherin complex, Nat. Cell Biol., 4, 222, 2002. 87. Ratcliffe, M.J., Rubin, L.L., and Staddon, J.M., Dephosphorylation of the cadherin-associated p100/p120 proteins in response to activation of protein kinase C in epithelial cells, J. Biol. Chem., 272, 31894, 1997. 88. Rosato, R. et al., Involvement of the tyrosine kinase fer in cell adhesion, Mol. Cell Biol., 18, 5762, 1998. 89. Yap, A.S. and Kovacs, E.M., Direct cadherin-activated cell signaling: a view from the plasma membrane, J. Cell Biol., 160, 11, 2003. 90. Gumbiner, B.M., Signal transduction of beta-catenin, Curr. Opin. Cell Biol., 7, 634, 1995. 91. Green, K.J. and Gaudry, C.A., Are desmosomes more than tethers for intermediate filaments? Nat. Rev. Mol. Cell Biol., 1, 208, 2000. 92. Kljuic, A. and Christiano, A.M., A novel mouse desmosomal cadherin family member, desmoglein 1gamma, Exp. Dermatol., 12, 20, 2003. 93. Pulkkinen, L. et al., Novel member of the mouse desmoglein gene family: Dsg1-beta, Exp. Dermatol., 12, 11, 2003. 94. Talbott, J.H. et al., Metabolic studies on patients with pemphigus, J. Invest. Dermatol., 43, 31, 1940. 95. Kalish, R.S., Possible role for non-desmoglein antigen in pemphigus, J. Invest. Dermatol., 117, 995, 2001.
1391_C19.fm Page 306 Tuesday, November 18, 2003 5:24 PM
1391_C20.fm Page 307 Tuesday, November 18, 2003 5:27 PM
SECTION
E
Pemphigus Foliaceus
1391_C20.fm Page 308 Tuesday, November 18, 2003 5:27 PM
1391_C20.fm Page 309 Tuesday, November 18, 2003 5:27 PM
CHAPTER
20
Spontaneous Canine Model of Pemphigus Foliaceus Toshiroh Iwasaki and Thierry Olivry
CONTENTS I. History ................................................................................................................................309 II. Animals ..............................................................................................................................310 A. Sex Predilection .........................................................................................................310 B. Age of Onset..............................................................................................................310 C. Breed Predilection .....................................................................................................310 III. Epidemiology .....................................................................................................................310 IV. Course of Disease ..............................................................................................................310 V. Assessment of Disease.......................................................................................................311 A. Clinical Manifestation ...............................................................................................311 B. Histopathological Examination .................................................................................311 C. Immunopathological Data .........................................................................................314 1. Direct Immunofluorescence/Immunohistochemistry Testing..............................314 2. Indirect Immunofluorescence (IIF) Microscopy .................................................314 3. Immunoblotting....................................................................................................316 4. Immunoreactivity of Canine PF Sera Against Recombinant Canine Dsg1 .......317 VI. Therapeutic Response ........................................................................................................317 VII. Expert Experience ..............................................................................................................317 VIII. Lessons Learned.................................................................................................................318 References ......................................................................................................................................318
I. HISTORY Pemphigus foliaceus (PF) in animals was first described in dogs by Halliwell in 1977 [1] as a scaling eruptive dermatitis with bulla formation. The first canine case revealed positive reaction with epidermal intercellular substances by direct and indirect immunofluorescence tests and required large doses of corticosteroids for control. PF was also reported in cats, the first case of which was described in 1987 [2] as a putative drug-induced pemphigus.
0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
309
1391_C20.fm Page 310 Tuesday, November 18, 2003 5:27 PM
310
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
II. ANIMALS A. Sex Predilection There are two articles on the sex predilection of canine PF; one described 61% of the affected animals as male [3], whereas another mentioned that sex difference in the occurrence of PF was not evident [4]. On the other hand, there are three articles on the sex predilection of feline PF: two described a high risk in females, 73% [5] and 65.2% [3], respectively, whereas one indicated no sex predilection in feline PF [4]. B. Age of Onset There seems to be no age predilection in canine PF. One article reported an average age of 6.1 years (range, 5 months to 12 years) [3], whereas another indicated no age predilection in an investigation of 26 dogs affected with PF, in which ages ranged from 1 to 12 years [6]. C. Breed Predilection Breed susceptibilities of canine PF are as follows: collie (17%), Doberman pinscher (13%), and cocker spaniel (9%) [3]. One textbook indicated that Akita, chow chows, dachshunds, bearded collies, Newfoundland, Doberman pinscher, Finnish spitz, and Schipperke are susceptible to canine PF [4]. Interestingly, in feline PF, domestic short-haired cats comprised 54% of those affected in one report [3]; however, in another investigators reported no breed at higher risk [3,5].
III. EPIDEMIOLOGY The prevalence of canine PF varies from 1 to 1.5% among dog patients in dermatology referral hospitals and 0.04% among those in primary care animal hospitals [4]. Even though it is a comparatively rare dermatosis, canine PF is the most common autoimmune skin disorder in dogs and it occurs much more frequently than canine pemphigus vulgaris (PV). Canine PF is thought to occur spontaneously, to be drug induced [7], or to be a secondary infection during dermatophyte infection such as Trichophyton mentagrophytes [8], or secondary to chronic dermatitis, especially allergic skin diseases.
IV. COURSE OF DISEASE The mean onset age of canine PF is calculated to be 4.2 years (range 2 to 7 years) with most dogs with PF being affected by age 5 years [9]. In our laboratory cases, the average onset age for all canine PF patients tested both IIF-positive (N=5) and IIF-negative (N=7) is 5.1 years. Separately, the average age of onset for the IIF-positive PF patients is 6.1 years, and that for the IIF-negative PF patients is 3.3 years (T.I.I., unpublished data, 2002). Iwasaki et al. [10] reported the onset age of 5 years (range 1.1 month to 9 years) in another study. The disease usually has a course of waxing and waning, and complete cure may not be expected. There may be hours to days when numerous new pustules form, followed by days to weeks of crusting during which few lesions surface [4]. The lesions usually appear on the muzzle, the periocular region, and the pinna, and could extend to the footpad, foot, trunk, skin and clawbed (Figure 20.1). The effects of seasonal and environmental factors were not found in canine PF patients in the state of California. In Japan, where most of the canine PF patients are kept outside the house, and symptoms worsen in summer and improve
1391_C20.fm Page 311 Tuesday, November 18, 2003 5:27 PM
SPONTANEOUS CANINE MODEL OF PEMPHIGUS FOLIACEUS
Figure 20.1
311
Clinical appearance of a canine patient affected with pemphigus foliaceus (PF). Muzzle, periocular region, and pinna are the most affected sites of canine PF.
in winter, probably due to the exacerbating effect of exposure to sunlight (T.I.I., unpublished data, 2002).
V. ASSESSMENT OF DISEASE A. Clinical Manifestation The lesions usually appear initially on the face and the pinna, and spread to the trunk, foot, and footpad (Figures 20.2 and 20.3), with crusting, erosion, erythema, and pustule formation. The perianal region and the mucocutaneous junction may be affected when the symptoms are severe. The lesions initially appear as erythemas, grow into pustules, and finally erosion and crust formation occur after rupture of the pustules. Pustules and erosions are rarely seen on the nose and the footpad. In the early phase of the course, transient fluid-filled blisters as the primary lesions occasionally occur, although this does not last long because of the thinness of canine and feline epidermis, which consists of only two to three layers of epidermal cells. Most of the lesions present as pustules. Both pustules and blisters rupture quickly to form erosions and crusted lesions. Crust formation on the footpad may be the only clinical sign in certain cases. Clinical signs tend to aggravate in summer and improve in winter, particularly in dogs bred outside the house, probably because of the continuous exposure to sunlight [11]. B. Histopathological Examination The characteristic histopathological feature of canine PF is the formation of pustules, in contrast to the lesion of human PF that presents as a vesicle without neutrophilic infiltration into pustules.
1391_C20.fm Page 312 Tuesday, November 18, 2003 5:27 PM
312
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Figure 20.2
Clinical appearance of canine pemphigus foliaceus (PF). Some PF shows hyperkeratosis on footpads.
Figure 20.3
Clinical appearance of feline pemphigus foliaceus. Erosion and crust formation are seen on nose, periocular region, and pinna.
Pustules of canine PF usually locate in the subcorneal, intraepidermal, or intrafollicular epithelium that contains abundant nondegenerated neutrophils, sometimes eosinophils, and numerous acantholytic keratinocytes (Figures 20.4, 20.5, and 20.6). The findings of acantholysis are often seen at the level of the granular layer, corresponding to the bottom of the pustules. In certain cases, pustules are located in the deeper layer within the stratum spinosum [8]. Pustules may be seen within the granular layer or the intrafollicular epithelium aside from the subcorneal region. The diagnosis of canine PF may sometimes be difficult to made, based solely on histopathology, since the microscopic morphology of a pustule of PF is very similar to that of bacterial pyoderma. In one study comparing the histopathology of superficial folliculitis (SF) with that of PF, PF was
1391_C20.fm Page 313 Tuesday, November 18, 2003 5:27 PM
SPONTANEOUS CANINE MODEL OF PEMPHIGUS FOLIACEUS
313
Figure 20.4
Microscopic examination of a smear obtained from a pustule in a canine pemphigus foliaceus patient. Keratinocytes appear to separate from each other and nondegenerated neutrophils are observed. (Original magnification ¥1000.)
Figure 20.5
Histopathology of canine pemphigus foliaceus. A large subcorneal pustule with acantholytic cells and numerous neutrophils are recognized. (Original magnification ¥40.)
found to have a 183-fold higher number of acantholytic cells than SF, more adhesion of keratinocytes to the roof of the pustule (rafts), and a longer extent of pustule involvement that bridges multiple hair follicles [12]. In drug-induced pemphigus, there may be some apoptotic cells in the epidermis in addition to histopathological findings similar to of PF [7].
1391_C20.fm Page 314 Tuesday, November 18, 2003 5:27 PM
314
Figure 20.6
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Histopathology of canine pemphigus foliaceus. Prominent acantholysis and neutrophils infiltration are observed. (Original magnification ¥200.)
A variant of canine PF, panepidermal pustular pemphigus (PPP), has been reported [13]. There is no counterpart of PPP in human pemphigus reported thus far. Histological findings of PPP revealed intraepidermal pustules with acantholysis at all levels of the stratified squamous epithelium, at the infundibular outer root sheath, and extend down to the suprabasal epidermis. Sera from dog patients with PPP reacted with a 150-kDa protein, probably desmoglein 1 (Dsg1). C. Immunopathological Data 1. Direct Immunofluorescence/Immunohistochemistry Testing The direct immunofluorescence (DIF) test revealed immune deposits at the epidermal cell surface in 70 to 90% of PF cases (Figures 20.7). The positive finding is observed as net-like fluorescence involving all epidermal layers. Moore et al. [14] reported positive deposition in six of seven patients (86% positive) using antibodies to IgG, IgM, C3, and IgA by the immunoperoxidase method. Scott et al. [6] showed 76% of positive results of DIF among 26 PF patients. Iwasaki et al. [10] investigated 13 canine PF cases and found 11 positive results (85% positive) by DIF. Day et al. [3] reported seven positive out of ten cases (70% positive) by immunoperoxidase staining. 2. Indirect Immunofluorescence (IIF) Microscopy In human PF cases, circulating IgG autoantibodies against epithelial cell surface using standard epithelial tissue substrate are detected in more than 90% of patients by the IIF test. In contrast, sera from canine PF patients do not show as many positive reactions as those from human PF patients, and this has led to controversy (Figure 20.8). Differences in the percentage of detectable antiepithelial cell-surface circulating autoantibodies in canine PF patients may be due to substrate selection. In addition, the sensitivity and specificity
1391_C20.fm Page 315 Tuesday, November 18, 2003 5:27 PM
SPONTANEOUS CANINE MODEL OF PEMPHIGUS FOLIACEUS
315
Figure 20.7
Direct immunofluorescence microsocpy of canine pemphigus foliaceus, showing IgG deposition on epidermal cell surface throughout epidermis. (Original magnification ¥100.)
Figure 20.8
Indirect immunofluorescence microscopy of canine pemphigus foliaceus, showing IgG autoantibodies binding to epithelial cell surface. (Original magnification ¥200.)
of the commercially available conjugated anticanine IgG antibodies, either fluorescein or peroxidase, may also be a factor. The sensitivity of the IIF test for human autoimmune blistering diseases is strongly influenced by the substrate used in the test [15]. In the case of canine PF, there is no exception. Halliwell and Goldschmidt [1] were first to report a case of canine PF that gave a positive reaction in the IIF test using normal dog buccal mucosa as substrate. Three years later, Manning et al. [16] found a positive result among three canine PF cases (33% positive) using normal dog tongue as substrate. In 1981, Scott and Lewis [17] described 16.6% of positive reaction in the IIF test. Thereafter, Scott et al.
1391_C20.fm Page 316 Tuesday, November 18, 2003 5:27 PM
316
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
206 160 120 117
89
85 M
Figure 20.9
HPF
8
16
17
NDS
Western blotting. Extracted proteins from cultured keratinized canine keratinocytes were separated by 6% SDS-PAGE and incubated with serum from human PF (HPF), dog PF sera (#8, #16, #17), and normal dog serum (NDS). Bands at 160, 120, and 90 kDa are recognized. M, molecular standard. Numbers on the left and right sides of the figure indicate molecular weights in KDs.
[6] reported 26 cases of canine PF, in which 20 were positive in the DIF test, but only one case was positive in the IIF test, a mere 4% positive result. Canine lip epithelium has often been used as a substrate for the IIF test, and Ihrke et al. [9] demonstrated a positive 66.7% in six of nine selected PF cases. By contrast, one report [18] using canine lip epithelium as substrate indicated that none of the 14 PF cases showed circulating autoantibodies. Because of these discouraging results, a common concern among veterinary dermatologists is that the IIF test is not useful for diagnosis of canine PF, because IIF is rarely positive in canine PF and may even be positive in nonpemphigus diseases. However, a recent study performed by Iwasaki et al. [19] demonstrated 9 out of 14 canine PF patients showing a positive reaction, which corresponded to 64.3% without a false-positive reaction by normal dog sera. However, the titer of sera is generally low, usually 1:20 to 1:40. When monkey esophagus was used as the substrate for the diagnosis of canine PF, however, the percentage of positive results was 44.4%, with 40% of normal dog sera also showed a falsepositive reaction. All of four canine PF sera tested revealed intercellular staining when they were reacted with cultured canine keratinocytes at confluence [19]. With regard to immunohistochemical testing, staining using peroxidase-conjugated anticanine IgG is thought to be a more sensitive procedure for the detection of intercellular immunoglobulin deposits by DIF than fluorescein-conjugated IgG. However, the use of formalin-fixed, paraffinembedded sections in the immunoperoxidase method may not be appropriate for detecting the autoantibodies in PF patients because of the low stability of the PF antigen (Dsg1) in formalin fixatives and the high temperature during paraffin embedding [20]. The same method, however, can be modified and used with freshly frozen nonfixed tissue substrate instead. IIF using living keratinocytes (MCA-B1) as substrate was reported to obtain good results with high specificities [21]. The titer of IIF, which represents the concentration of autoantibodies in the serum, may be correlated with the severity of clinical signs (T.I.I. and T.O., unpublished data, 2002). 3. Immunoblotting The molecular weight of autoantigens directed by canine PF sera was estimated to be 148 to 150 kDa [8] or 160 kDa [10] by immunoblotting using the extracted protein from canine mucous membrane or cultured keratinocytes as substrate (Figure 20.9). Iwasaki et al. [10] also found that 120-kDa and 85-kDa proteins reacted with sera from canine PF, which were regarded as desmocollin and plakoglobin, respectively. Nishifuji and colleagues (unpublished data, 2002) also detected a 160-kDa protein when extracted proteins from MCA-B1 cells were used as substrate in a sequential
1391_C20.fm Page 317 Tuesday, November 18, 2003 5:27 PM
SPONTANEOUS CANINE MODEL OF PEMPHIGUS FOLIACEUS
317
immunoprecipitation/immunoblotting technique. This method may be useful for the detection of the circulating antibodies in patients with canine PF. 4. Immunoreactivity of Canine PF Sera Against Recombinant Canine Dsg1 Cloning and sequencing of canine Dsg1 were performed by Muller et al. [22] and the sequence comparison revealed that the canine Dsg1 has 72% to 97% homology in extracellular domain to human Dsg1, and 69.5% to 97% homology to bovine Dsg1. Nishifuji et al. [21] generated a recombinant protein of canine Dsg1 by baculovirus expression, and the recombinant canine Dsg1 (rcDsg1) is recognized by human PF sera. However, thus far, no serum of canine PF has been found to recognize canine rcDsg1 (T.I.I. and T.O., unpublished data, 2002). However, Olivry et al. [23] demonstrated 100% positive reaction between human recombinant Dsg1 and canine PF sera using an ELISA system.
VI. THERAPEUTIC RESPONSE The therapeutic regimen for canine PF is basically dependent on the clinical signs of an individual patient, as well as the patients’ response to prescribed drug therapy. A high dosage of predonisolone (1~6 mg/kg) is usually required as the starting dosage, and is continued until the condition is improved. In cases where the symptoms are mild and confined to the face, a low dosage of predonisolone or topical corticoid may be sufficient to control the lesions. The dosage of predonisolone should be tapered to alternative day administration when the lesions have improved. When symptoms are not reduced by predonisolone administration alone, or administration of predonisolone is not acceptable to the owner or the dog, azathioprine or cyclosporine is added or used as a single drug, respectively. Azathioprine is contraindicated in cats because of its high toxicity. Aurothioglucose has also been used for canine PF as crysotherapy [16] when predonisolone, azathioprine, or their combination is ineffective. Environmental management of canine PF is also required: these include the avoidance of ultraviolet B irradiation, keeping dogs inside the house during the daytime in the summer, or topical application of sunscreen (SPF 15~20) on the muzzle and the pinna. Control of allergic skin diseases, particularly atopic dermatitis, and control of flea infestation are also needed. The muzzle usually has the most resistant lesion of canine PF even after clinical signs have improved, and approximately half of patients are not expected to be completely cured. However, drug-induced pemphigus [7] or chronic skin disease-related pemphigus [4] may be cured when the underlying cause is eliminated or controlled.
VII. EXPERT EXPERIENCE The characteristic clinical findings of canine PF are pustules, erosions, and crust formation on the muzzle, the pinna and the periocular region. Mucous membrane manifestation is not a common finding in canine PF. These findings are sufficient to suspect canine PF. Suspected patients are subjected to biopsy of the pustule lesion on the pinna or crusted muzzle skin. Typically, histopathological findings show subcorneal pustules filled with large amounts of nondegenerated neutrophils and acantholytic keratinocytes without severe inflammatory infiltration in the upper dermis. PAS staining may be needed for excluding dermatophyte infections. These histopathological findings may lead to the diagnosis of canine PF, and the epidermal cell surface deposition of IgG class immunoglobulin as observed by the DIF technique confirm the diagnosis of canine PF.
1391_C20.fm Page 318 Tuesday, November 18, 2003 5:27 PM
318
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
VIII. LESSONS LEARNED We should recognize the differences in clinical, histopathological, and immunopathological findings between human and canine PF, when we use canine PF cases as animal models of their human counterparts. The differences are summarized below. Differences in clinical findings are pustules in canine PF and vesicles in human PF. Differences in histopathological findings are neutrophilic or eosinophilic infiltration into pustules in canine PF and very little cellular infiltration in human PF. Interestingly, a clinical variant of human pemphigus is manifested histopathologically with subcorneal blister, acantholysis, and prominent inflammatory infiltrate containing neutrophils, eosinophils, or both [23]. Some of these human patients’ serum IgG antibodies were shown to be capable of inducing IL-8 expression and secretion from cultured keratinocytes, suggesting a novel mechanism of epidermal neutrophil recruitment [23]. Differences in immunopathological findings are that 10 to 60% of canine PF sera show a positive reaction by IIF and 90 to 100% of human patients’ sera show a positive reaction by IIF. This difference may change as the technique for detection improves. The most important issue is that canine PF sera do not show immunoreactvity to recombinant canine Dsg1. This means that we do not know whether canine and human PF have the same mechanism of action. Further studies should be conducted to more precisely characterize canine PF.
REFERENCES 1. Halliwell, R.E.W. and Goldschmidt, M.H., Pemphigus foliaceus in the canine: a case report and discussion, J. Am. Vet. Med. Assoc., 13, 431, 1977. 2. Mason, K.V. and Day, M.J., A pemphigus foliaceus-like eruption associated with the use of ampicillin in a cat, Aust. Vet. J., 64, 223, 1987. 3. Day, M.J., Hanlon, L., and Powell, L.M., Immune-mediated skin disease in the dog and cat, J. Comp. Pathol., 109, 395, 1993. 4. Scott, D.W., Miller, W.H., and Griffin, C.E., Small Animal Dermatology, 6th ed., Saunders, Philadelphia, 2001. 5. Greek, J.S., Feline pemphigus foliaceus: a retrospective of 23 cases. Proc. Annu. Memb. Meet. Am. Acad. Vet. Dermatol./Am. Coll. Vet. Dermatol. 9, 27, 1993. 6. Scott, D.W. et al., Immune-mediated dermatoses in domestic animals: ten years after. Part 1, Comp. Cont. Educ. Small Anim., 9, 424, 1987. 7. White, S.D. et al., Putative drug-related pemphigus foliaceus in four dogs, Vet. Dermatol., 13,195, 2002. 8. Suter, M.M. et al., Advances of Veterinary Dermatology, 3rd ed., Butterworth-Heinmann, Oxford, 1998. 9. Ihrke, P.J. et al., Pemphigus foliaceus in dogs: a review of 37 cases, J. Am. Vet. Med. Assoc., 186, 59, 1985. 10. Iwasaki, T. et al., Detection of canine pemphigus foliaceus autoantigen by immunoblotting, Vet. Immunol. Immunopathol., 59, 1, 1997. 11. Iwasaki, T. and Maeda, Y., The effect of ultraviolet (UV) on the severity of canine pemphigus erythematosus, Proc. Ann. Meet. Am. Acad. Vet. Dermatol./Am. Coll. Vet. Dermatol., 13, 86, 1997. 12. Kuhl, K.A., Shofer, F.S., and Goldschmidt, M.H., Comparative histopathology of pemphigus foliaceus and superficial folliculitis in the dog, Vet. Pathol., 31, 19, 1994. 13. Wurm, S., Mattise A.W., and Dunstan, R.W., Comparative pathology of pemphigus in dogs and human, Clin. Dermatol., 12, 515, 1994. 14. Moore, F.M. et al., Localization of immunoglobulins and complements by the peroxidase antiperoxidase method in autoimmune and non-autoimmune canine dermatopathies, Vet. Immunol. Immunopathol., 14, 1, 1987. 15. Bystryn, J.-C. and Sabolinski, M., Effect of substrate on indirect immunofluorescence tests for intercellular and basement membrane zone antibodies, J. Am. Assoc. Dermatol., 15, 197, 1986.
1391_C20.fm Page 319 Tuesday, November 18, 2003 5:27 PM
SPONTANEOUS CANINE MODEL OF PEMPHIGUS FOLIACEUS
319
16. Manning, T.O. et al., Three cases of canine pemphigus foliaceus and observations on chrysotherapy, J. Am. Anim. Hosp. Assoc., 16, 189, 1980. 17. Scott, D.W. and Lewis, R.M., Pemphigus and pemphigoid in dog and man: comparative aspects, J. Am. Acad. Dermatol., 5, 148, 1981. 18. Medleau, L., Dawe, D.L., and Scott, D.W., Complement immunofluorescence in sera of dogs with pemphigus foliaceus, Am. J. Vet. Res., 48, 486, 1987. 19. Iwasaki, T. et al., Effect of substrate on indirect immunofluorescence test for canine pemphigus foliaceus, Vet. Pathol., 33, 332, 1996. 20. Muller, G.H., Kirk, R.W., and Scott, D.W., Small Animal Dermatology, 4th ed., W.B. Saunders, Philadelphia, 1989. 21. Nishifuji, K. et al., Immunoadsorption of autoantibodies in human pemphigus foliaceus with baculovisrus-expressed recombinant canine desmoglein 1, Vet. Dermatol., 11, 25, 2000. 22. Muller E et al., Cloning of canine Dsg1 and evidence for alternative polyadenylation, J. Invest. Dermatol., 114, 1211, 2000. 23. O’Toole, E.A. et al. Induction of keratinocyte IL-8 expression and secretion by IgG autoantibodies as a novel mechanism of epidermal neutrophil recruitment in a pemphigus variant, Clin. Exp. Immunol., 119, 217, 2000.
1391_C20.fm Page 320 Tuesday, November 18, 2003 5:27 PM
1391_C21.fm Page 321 Tuesday, November 18, 2003 5:30 PM
CHAPTER
21
Experimental Mouse Model of Pemphigus Foliaceus: Passive Transfer of Desmoglein-Targeting Antibodies David S. Rubenstein, Simon J. Warren, Ning Li, Zhi Liu and Luis A. Diaz
CONTENTS I. II. III. IV. V. VI. VII.
History ................................................................................................................................321 Animals ..............................................................................................................................322 Disease Induction...............................................................................................................322 Course of Disease ..............................................................................................................323 Assessment of Disease.......................................................................................................323 Immunogenetics .................................................................................................................324 Lessons Learned.................................................................................................................324 A. Dsg1-Specific Antibodies Are Pathogenic ................................................................324 B. PF IgG-Induced Acantholysis Requires neither Complement Activation nor Extracellular Matrix Proteolytic Enzymes .........................................................324 C. Pathogenic Antibodies Bound to EC1/2 Epitopes of Dsg1 Are Primarily IgG4 Subclass......................................................................................................................325 VIII. Therapeutic Potentials........................................................................................................326 IX. Conclusion..........................................................................................................................326 Acknowledgments ..........................................................................................................................326 References ......................................................................................................................................326
I. HISTORY Pemphigus foliaceus (PF) is a human autoimmune blistering disease that clinically manifests as superficial vesicles on epidermal epithelia. The superficial nature of the epidermal cleavage plane, located just beneath the stratum corneum, results in transient vesicles so that the disease may more commonly present with crusted, scaling plaques rather than frank intact vesicles. In contrast to pemphigus vulgaris (PV), mucosal surfaces are not involved in PF. PF affects males and females equally, typically presenting in middle-aged adults. PF is sporadic in nature, although an endemic focus has been described among indigenous peoples of Brazil who inhabit the Terena reservation of Limao Verde [1]. Epidemiologic and immunopathogenic studies of endemic PF, also 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
321
1391_C21.fm Page 322 Tuesday, November 18, 2003 5:30 PM
322
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
known as Fogo selvagem (FS), suggest both hereditary and environmental factors that contribute to the development of this disease [1–6]. PF and endemic FS are characterized by the presence of pathogenic IgG that target a protein component of the desmosome, an epidermal cell–cell adhesion structure. Having been under intense investigation for the past 30 years, PF is known to be the result of pathogenic autoantibodies that target the desmosomal cadherin desmoglein-1 (Dsg1) [7–9]. In the passive-transfer model of autoimmune disease, autoantibodies from an exogenous source are administered to an experimental animal model in an attempt to reproduce the clinical disease. Exogenous sources of antibody may include sera, IgG, or epitope-specific antibodies purified from human patients or laboratory-generated antibodies raised in host animals using the suspected target epitopes. Passive transfer of PV sera to neonatal mice was first developed by Anhalt et al. [10] in 1982 to demonstrate the presence of pathogenic factors in the sera of PV patients; this was subsequently extended to the study of PF by the same investigators [11]. Murine and human Dsg1 are 76% identical [12] which may explain the ability of human IgG to bind to murine Dsg1 and to induce clinical and immunopathological changes in mice that mimic the features of human PF.
II. ANIMALS The behavior of PF autoantibodies has been most extensively studied in mouse strains such as the ubiquitous Balb/c and C57BL/6J mice. The age of the animal is critical for success of antibodies to induce blister formation at concentrations that can be readily delivered by intraperitoneal or subcutaneous injection. Although blister induction in adults occurs, neonatal mice are preferred because their small size allows for blister induction with less total antibody and because their lack of hair facilitates assessment by gross inspection of blister formation. A variety of engineered mice have been used to study disease pathogenesis. For example, blister formation by PF antibodies has been shown to not require complement nor the plasminogen/plasminogen activator system since mice deficient in C5, tissue-type plasminogen (tPA), and urokinase-type plasminogen activator (uPA) still form blisters when injected with PF IgG [13,14].
III. DISEASE INDUCTION The ability to induce disease in the passive-transfer model of PF is dependent on the ability to identify a source and to generate enriched fractions of pathogenic PF antibodies. The determination of protein concentrations and functional activity by serial dilution and indirect IF facilitates the ability to obtain consistent and reproducible results when using IgG preparations obtained from different patients or from the same patient at different times during the course of their disease. Serum samples obtained from PF patients are used as starting material to obtain purified fractions containing pathogenic IgG. Several strategies can be used to generate IgG fractions, including ammonium sulfate precipitation or affinity purification on protein A. Each of these techniques generates immunoglobulin fractions of varying purity as other proteins and/or immunoglobulin species are present with the pathogenic anti-Dsg1 IgG in the final preparation. Enrichment for specific anti-Dsg1 antibodies is accomplished by chromatography on an affinity matrix generated from recombinant human Dsg1 ectodomain. Large quantities of human Dsg1 ectodomain are generated using the baculovirus expression system [4,15]. In this approach, the ectodomain of human Dsg1 has been engineered to contain a polyhistidine tag that enables subsequent purification of the baculovirus expressed protein by nickel-nitrilotriacetic acid (Qiagen, Inc.) affinity chromatography [16]. The baculovirus expressed protein has also been used to develop sensitive and specific ELISAs for the detection of Dsg1 antibodies in patient sera [4,17].
1391_C21.fm Page 323 Tuesday, November 18, 2003 5:30 PM
EXPERIMENTAL MOUSE MODEL OF PEMPHIGUS FOLIACEUS
323
The purification is followed by SDS-PAGE, and Bradford analysis is used to determine protein concentration in purified IgG fractions. Antibody titers are checked by indirect immunofluorescence on human or mouse skin cryosections and by ELISA assay using recombinant baculovirus-expressed Dsg1 ectodomain. Once purified, antibody preparations are extensively dialyzed against phosphate-buffered saline, pH 7.2, concentrated to 50 to 100 mg/ml by ultrafiltration, and then sterile filtered through a 0.2micron Millipore filter. High concentrations of IgG fractions are desirable in order to limit the injection volume to less than 10% (v/w) of the test animal weight. In our laboratories, we typically limit the injection volume to 50 ml. Additionally, some degree of technical proficiency is required in order to prevent the injected material from leaking back out of the injection tract/site. Slow injections with a small-gauge (e.g., 30.5) needle are best. Two routes of injection are available, subcutaneous and intraperitoneal. In our laboratories, we typically inject subcutaneously to the skin overlying the right flank.
IV. COURSE OF DISEASE Epidermal acantholysis occurs within 24 hours of injection in a time- and dose-dependent fashion. Using IF and immunoelectron microscopy, Futamura et al. [18] performed a time-course analysis of acantholysis. They demonstrated binding of PF IgG to murine keratinocyte cell surfaces within 1 hour after injection; by immunoelectron microscopy, PF IgG staining of the cell membrane was initially diffuse. Edema was noted in the intracellular space at 1 hour, with subsequent splitting of the desmosomes, retraction of the tonofilaments, internalization of the desmosome remnants, and loss of cell–cell adhesion at 12 to 24 hours. IgG fractions containing higher concentrations of pathogenic anti-Dsg1 induce blister formation more rapidly and to a greater extent compared to low titer preparations.
V. ASSESSMENT OF DISEASE Typically, injected mice are examined 18 to 24 hours after a single subcutaneous injection. Gross blister formation may be apparent or can be readily induced by application of gentle mechanical traction (Nikolskiy’s sign) to the skin overlying the injection site (Figure 21.1). A fourpoint scale is used for grading the degree of blister formation as follows: 0, no blister formation; 1+, small blister with mechanical traction; 2+, large blister with mechanical traction; and 3+, gross blister formation in the absence of mechanical traction. After gross inspection, the mice are sacrificed and skin biopsies and blood are collected for histology, direct and indirect immunofluorescence, and ELISA analysis.
a Figure 21.1
b
c
IgG passive transfer model of PF. Neonatal BALB/c mice are injected intradermally with human sera–derived PF IgG. After 24 hours, gentle friction elicits persistent epidermal wrinkling, producing the “epidermal detachment” sign (panel a). Histological examination of lesional skin reveals a subcorneal blister (panel b). Direct immunofluorescence analysis reveals deposition of anti-Dsg1 IgG at the keratinocyte cell surface (panel c).
1391_C21.fm Page 324 Tuesday, November 18, 2003 5:30 PM
324
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Biopsies are obtained for histopathological examination as well as direct immunofluorescence. Routine staining of perilesional skin with hematoxylin and eosin demonstrates the histopathology of pemphigus foliaceus; namely, a subcorneal vesicle with scant inflammation. Direct immunofluorescence of perilesional skin reveals staining of the peripheral membrane of the epithelial keratinocytes (Figure 21.1). Serum is collected from the mice at the time of sacrifice to determine antiDsg1 antibody titers by indirect IF and/or ELISA. Similarly, indirect immunofluorescence on skin substrates shows staining of the keratinocyte cell surface. Serum samples are serially diluted until the skin staining is lost. Dilutions on indirect IF correlate with pathogenic activity of the specific sera used. Recombinant baculovirus-expressed human Dsg1 ectodomain is used as an antigen for ELISA detection of anti-Dsg1 IgG in collected sera. Plates are coated with the Dsg1 ectodomain protein [4]. Serial dilutions of sera are performed to determine the relative activity of anti-Dsg1 specific immunoglobulin in mouse sera; this activity correlates with the pathogenecity of the sera and with the ability of the sera to induce disease in the passive-transfer mouse model.
VI. IMMUNOGENETICS It has been suggested that genetic factors play a crucial role in the development and progression of PF. Studies in Japan showed that the HLA-DR4 haplotype is common to PF patients [19,20]. HLA typing on FS patients revealed that one or both of the HLA-DR1 and DR4 genes were present in 88% of these patients. Further, the HLA-DRB1*0102gene confers susceptibility to the development of FS, while other HLA alleles may confer resistance to FS [21]. Increased frequency of the HLA-DRB1*0404 and DRB1*1406 are also identified in the Terenas Amerindian population [22], where the prevalence of FS is 2.6%. These alleles may provide susceptibility to develop FS in individuals exposed to the initial environmental etiologic agent(s).
VII. LESSONS LEARNED Animal models of autoimmune blistering disease have been beneficial to elucidating the pathogenic mechanisms for these disorders. Several critical observations have been made by utilizing the passive-transfer mouse model of PF. A. Dsg1-Specific Antibodies Are Pathogenic The presence of pathogenic IgG species in PF patient sera was demonstrated by the ability of these IgG fractions to induce blister formation in mice [11]. Subsequent work demonstrated that pathogenic autoantibodies were directed against the nonclassical desmosomal cadherin Dsg1 [7,9]. Additional experiments were undertaken to demonstrate the ability to induce blisters of pathogenic autoantibody derived F(ab')2 and Fab fragments in neonatal mice [23]. The ability of F(ab')2 to induce blister formation revealed that the Fc portion of the antibody was not required for blister formation. Similarly, antigen crosslinking was not required as monovalent Fab also induced blister formation. Both circulating F(ab')2 and Fab could be identified in murine sera and direct immunofluorescence of injected mice detected the presence on keratinocyte cell surface of bound F(ab')2 and Fab. B. PF IgG-Induced Acantholysis Requires neither Complement Activation nor Extracellular Matrix Proteolytic Enzymes Although both PF and bullous pemphigoid (BP) are mediated by autoantibodies targeted to keratinocyte adhesion proteins, the mechanism of blister induction in PF differs from that of BP.
1391_C21.fm Page 325 Tuesday, November 18, 2003 5:30 PM
EXPERIMENTAL MOUSE MODEL OF PEMPHIGUS FOLIACEUS
325
In the passive-transfer mouse model of BP, bound antibody was demonstrated to fix complement, resulting in neutrophil infiltration and activation of neutrophil elastase with subsequent proteolytic digestion of the target antigen BP180 [24–30]. In contrast, neither complement activation nor activity of the serine proteinases tPA, uPA, plasmin, neutrophil elastase, or gelatinase B (MMP-9) are required for blister formation in PF [13,14,31]. PF IgG induced blister formation when passively transferred to C5-deficient mice and to mice depleted of C3 by cobra venom factor. C. Pathogenic Antibodies Bound to EC1/2 Epitopes of Dsg1 Are Primarily IgG4 Subclass Further characterization of PF IgG has demonstrated the presence of both IgG1 and IgG4 isoforms in PF patients and in Fogo selvagem patients [4]. As alluded to above, neither the mechanism leading to production of anti-Dsg1 antibodies nor the precise molecular events by which these antiDsg1 antibodies cause acantholysis has been elucidated. Current molecular and epidemiologic studies of Fogo selvagem are beginning to provide insight into the development of this autoimmune blistering disease. Both environmental factors as well as genetic susceptibility have been implicated in the development of pathogenic anti-Dsg1 autoantibodies [1,3,4]. Anti-Dsg1 specific antibodies can be detected in sera from inhabitants of the Terena reservation, a focus for endemic PF. The titers of these antibodies decrease with increasing physical distance from the reservation. Interestingly, nonpathogenic anti-Dsg1 antibodies have been detected in nonaffected inhabitants of the reservation as well as in family members of FS patients and patients prior to the development of active clinical disease [5]. Anti-Dsg1 antibodies from inhabitants without clinical disease do not induce blister formation in the passive-transfer mouse model; whereas, IgG from inhabitants with active disease does cause blistering in the mice. Further characterization of these antibodies has demonstrated that the nonpathogenic IgG species are predominantly IgG1 and bind to the Dsg1 EC5 domain, whereas pathogenic IgG are predominantly IgG4 and bind to the Dsg1 EC1/EC2 domains [5,32]. These data have been interpreted to suggest triggering of an anti-Dsg1 antibody response in inhabitants of the Terena reservation by a specific environmental exposure; however, only genetically susceptible individuals go on to develop pathogenic IgG4 responses by the phenomenon of epitope spreading. Identification of the specific environmental trigger may be valuable in the development of a truly active mouse model of PF. Exposure of test animals to the antigenic trigger might similarly yield a Dsg1-specific autoantibody response. Whether this response results in blister formation may depend on the genetic background of the injected mouse strain and/or pharmacological manipulation of the inflammatory response in the host animal. The ability to induce disease in such a manner would provide an invaluable resource to study early events in the development of autoimmune vesiculobullous disease and may provide a model of general autoimmunity. Such mice would prove extremely useful for testing therapeutic agents that target early steps in the cascade that leads to autoantibody production and to end-organ damage. The precise mechanism by which antibodies induce acantholysis has yet to be elucidated. Several mechanisms have been proposed including proteinase activation, steric hindrance, and activation of transmembrane signaling cascades that down-regulate cell–cell adhesion. Passive transfer experiments to complement and proteinase-deficient mice have demonstrated that blister formation occurs in the absence of these important inflammatory mediators and effector molecules. Activation of intracellular second messengers, including IP3 and calcium flux, and cellular phosphorylation events have been observed subsequent to PV autoantibody binding [33–36]; we have also observed rapid intracellular phosphorylation events after exposure of normal human keratinocytes to PF IgG, suggesting a possible role for activation of signaling mechanisms [37]. Confirmation of the role such signaling pathways play in acantholysis will require in vivo inhibition of these pathways in test animals and the subsequent demonstration that such mice are resistant to passive-transfer PF IgG-induced disease. Should such investigations prove fruitful, additional
1391_C21.fm Page 326 Tuesday, November 18, 2003 5:30 PM
326
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
therapies for PF can be designed that target specific components of the signaling cascades activated by pemphigus IgG.
VIII. THERAPEUTIC POTENTIALS The passive-transfer mouse model has been an effective experimental tool to demonstrate antibody pathogenicity and to look at events downstream of antibody binding to the keratinocyte cell surface. As such, the passive-transfer mouse model can be used to look at therapeutic strategies targeted toward these downstream events. Additionally, other molecular events in the extracellular environment that may occur consequent to autoantibody binding might contribute to the loss of cell–cell adhesion in PF. Such events can also serve as potential therapeutic targets, and the passivetransfer mouse model can additionally serve as a test system for efficacy of therapies aimed at these events. Therapeutic strategies that target events proximal to the binding of pathogenic antibody to the keratinocyte, namely those processes that result in the production of pathogenic autoantibodies, cannot be studied in the passive-transfer mouse model. Such studies necessitate the development of an active model in which a Dsg1-specific autoimmune response can be induced in the experimental organism. A number of strategies can be pursued to generate such a response. Amagai et al. [38] have generated an active mouse model of PV by active immunization of Dsg3 knockout mice and subsequent adoptive transfer of splenocytes from the immunized animals to Rag2-/immunodeficient mice [38]. An alternative approach would be to identify animals that spontaneously develop PF. Of note, dogs spontaneously develop a disorder that clinically, histologically, and immunologically resembles human PF [39]. Further characterization of these animals is currently underway. Such a model system may be useful for testing therapies aimed at interfering with the production of autoantibodies rather than the terminal effects of the autoantibodies on keratinocyte cell–cell adhesion.
IX. CONCLUSION The passive-transfer mouse model of PF has been an invaluable system for demonstrating the pathogenic role of Dsg1 autoantibodies and for studying the molecular pathogenesis of this disease. The development of an active mouse model will further our understanding of the events leading to the production of this Dsg1-specific autoimmune response.
ACKNOWLEDGMENTS This work was supported by U.S. Public Health Service grants R01 AI49427 (D.S.R.), R01 AI40768 (Z.L.), R01 AR32599 (L.A.D.), and R37 AR32081 (L.A.D.).
REFERENCES 1. Hans-Filho et al., An active focus of high prevalence of fogo selvagem on an Amerindian reservation in Brazil. Cooperative Group on Fogo Selvagem Research, J. Invest. Dermatol., 107, 68, 1996. 2. Diaz, L.A. et al., Endemic pemphigus foliaceus (fogo selvagem). I. Clinical features and immunopathology, J. Am. Acad. Dermatol., 20, 657, 1989. 3. Diaz, L.A. et al., Endemic pemphigus foliaceus (fogo selvagem): II. Current and historic epidemiologic studies, J. Invest. Dermatol., 92, 4, 1989.
1391_C21.fm Page 327 Tuesday, November 18, 2003 5:30 PM
EXPERIMENTAL MOUSE MODEL OF PEMPHIGUS FOLIACEUS
327
4. Warren, S.J. et al., The prevalence of antibodies against desmoglein 1 in endemic pemphigus foliaceus in Brazil. Cooperative Group on Fogo Selvagem Research [comment], N. Engl. J. Med., 343, 23, 2000. 5. Warren, S.J. et al., The role of subclass switching in the pathogenesis of endemic pemphigus foliaceus [Comment], J. Invest. Dermatol., 120, 104, 2003. 6. Lombardi, C. et al., Environmental risk factors in endemic pemphigus foliaceus (fogo selvagem). The Cooperative Group on Fogo Selvagem Research, J. Invest. Dermatol., 98, 847, 1992. 7. Koulu, L. et al., Human autoantibodies against a desmosomal core protein in pemphigus foliaceus, J. Exp. Med., 160, 1509, 1984. 8. Stanley, J.R. et al., A monoclonal antibody to the desmosomal glycoprotein desmoglein I binds the same polypeptide as human autoantibodies in pemphigus foliaceus, J. Immunol., 136, 1227, 1986. 9. Amagai, M. et al., Antigen-specific immunoadsorption of pathogenic autoantibodies in pemphigus foliaceus, J. Invest. Dermatol., 104, 895, 1995. 10. Anhalt, G.J. et al., Induction of pemphigus in neonatal mice by passive transfer of IgG from patients with the disease, N. Engl. J. Med.., 306, 1189, 1982. 11. Roscoe, J.T. et al., Brazilian pemphigus foliaceus autoantibodies are pathogenic to BALB/c mice by passive transfer, J. Invest. Dermatol., 85, 538, 1985. 12. Mahoney, M.G. et al., Interspecies conservation and differential expression of mouse desmoglein gene family, Exp. Dermatol., 11, 115, 2002. 13. Espana, A. et al., Mechanisms of acantholysis in pemphigus foliaceus, Clin. Immunol. Immunopathol., 85, 83, 1997. 14. Mahoney, M.G., Wang, Z.H., and Stanley, J.R., Pemphigus vulgaris and pemphigus foliaceus antibodies are pathogenic in plasminogen activator knockout mice, J. Invest. Dermatol., 113, 22, 1999. 15. Ding, X. et al., Mucosal and mucocutaneous (generalized) pemphigus vulgaris show distinct autoantibody profiles, J. Invest. Dermatol., 109, 592, 1997. 16. Ding, X. et al., The anti-desmoglein 1 autoantibodies in pemphigus vulgaris sera are pathogenic, J. Invest. Dermatol., 112, 739, 1999. 17. Ishii, K. et al., Characterization of autoantibodies in pemphigus using antigen-specific enzyme-linked immunosorbent assays with baculovirus-expressed recombinant desmogleins, J. Immunol., 159, 2010, 1997. 18. Futamura, S. et al., Ultrastructural studies of acantholysis induced in vivo by passive transfer of IgG from endemic pemphigus foliaceus (fogo selvagem), J. Invest. Dermatol., 93, 480, 1989. 19. Matsuyama, M. et al., HLA-DR antigens in pemphigus among Japanese, Tissue Antigens, 17, 238, 1981. 20. Miyagawa, S. et al., HLA-DRB1*04 and DRB1*14 alleles are associated with susceptibility to pemphigus among Japanese, J. Invest. Dermatol., 109, 615, 1997. 21. Moraes, J. et al., HLA antigens and risk for development of pemphigus foliaceus (fogo selvagem) in endemic areas of Brazil, Immunogenetics, 33, 388, 1991. 22. Moraes, M.E. et al., An epitope in the third hypervariable region of the DRB1 gene is involved in the susceptibility to endemic pemphigus foliaceus (fogo selvagem) in three different Brazilian populations, Tissue Antigens, 49, 35, 1997. 23. Mascaro, J.M. Jr. et al., Mechanisms of acantholysis in pemphigus vulgaris: role of IgG valence, Clin. Immunol. Immunopathol., 85, 90, 1997. 24. Liu, Z. et al., A passive transfer model of the organ-specific autoimmune disease, bullous pemphigoid, using antibodies generated against the hemidesmosomal antigen, BP180, J. Clin. Invest., 92, 2480, 1993. 25. Liu, Z. et al., The role of complement in experimental bullous pemphigoid, J. Clin. Invest., 95, 1539, 1995. 26. Liu, Z. et al., A major role for neutrophils in experimental bullous pemphigoid, J. Clin. Invest., 100, 1256, 1997. 27. Liu, Z. et al., Gelatinase B-deficient mice are resistant to experimental bullous pemphigoid, J. Exp. Med., 188, 475, 1998. 28. Liu, Z. et al., The serpin alpha1-proteinase inhibitor is a critical substrate for gelatinase B/MMP-9 in vivo, Cell, 102, 647, 2000. 29. Liu, Z. et al., A critical role for neutrophil elastase in experimental bullous pemphigoid, J. Clin. Invest., 105, 113, 2000.
1391_C21.fm Page 328 Tuesday, November 18, 2003 5:30 PM
328
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
30. Chen, R. et al., Mast cells play a key role in neutrophil recruitment in experimental bullous pemphigoid, J. Clin. Invest., 108, 1151, 2001. 31. Liu, Z. et al., The role of neutrophil elastase, gelatinase b, and plasmin/plasminogen activators in pemphigus foliaceus and pemphigus vulgaris in mice, J. Invest. Dermatol., 112, 616, 1999. 32. Li, N. et al., The role of intramolecular epitope spreading in the pathogenesis of endemic pemphigus foliaceus (Fogo Selvagem), J. Exp. Med., 197, 1501, 2003. 33. Seishima, M. et al., Pemphigus IgG, but not bullous pemphigoid IgG, causes a transient increase in intracellular calcium and inositol 1,4,5-triphosphate in DJM-1 cells, a squamous cell carcinoma line, J. Invest. Dermatol., 104, 337, 1995. 34. Esaki, C. et al., Pharmacologic evidence for involvement of phospholipase C in pemphigus IgGinduced inositol 1,4,5-trisphosphate generation, intracellular calcium increase, and plasminogen activator secretion in DJM-1 cells, a squamous cell carcinoma line, J. Invest. Dermatol., 105, 329, 1995. 35. Osada, K., Seishima, M., and Kitajima, Y., Pemphigus IgG activates and translocates protein kinase C from the cytosol to the particulate/cytoskeleton fractions in human keratinocytes, J. Invest. Dermatol., 108, 482, 1997. 36. Aoyama, Y., Owada, M.K., and Kitajima, Y., A pathogenic autoantibody, pemphigus vulgaris-IgG, induces phosphorylation of desmoglein 3, and its dissociation from plakoglobin in cultured keratinocytes, J. Immunol.,Eur. J. Immunol., 29, 2233, 1999. 37. Rubenstein, D.S. et al., Pemphigus foliaceus IgG activates transmembrane desmosomal signaling, J. Invest. Dermatol., 117, 473, 2001. 38. Amagai, M. et al., Use of autoantigen-knockout mice in developing an active autoimmune disease model for pemphigus, J. Clin. Invest., 105, 625, 2000. 39. Olivery, T. and Chan, L.S., Autoimmune blistering diseases in domestic animals, Clin. Dermatol., 19, 750, 2001.
1391_C22.fm Page 329 Wednesday, November 19, 2003 10:38 AM
SECTION
F
Psoriasis
1391_C22.fm Page 330 Wednesday, November 19, 2003 10:38 AM
1391_C22.fm Page 331 Wednesday, November 19, 2003 10:38 AM
CHAPTER
22
Experimental Chimeric SCID Mouse/Human Skin Model of Psoriasis: Induction by Transfer of Cellular Immunity Jonathan L. Curry and Brian J. Nickoloff
CONTENTS I. II. III. IV. V.
History ................................................................................................................................331 Laboratory Animals............................................................................................................334 Disease Induction...............................................................................................................334 Course of Disease ..............................................................................................................335 Assessment of Disease.......................................................................................................335 A. Clinical Manifestation ...............................................................................................335 B. Histopathological Examination .................................................................................335 C. Immunopathological Examination ............................................................................336 D. Immunogenetics.........................................................................................................336 VI. Therapeutic Response ........................................................................................................337 VII. Expert Experience ..............................................................................................................337 VIII. Lessons Learned.................................................................................................................337 IX. Conclusion..........................................................................................................................338 References ......................................................................................................................................338
I. HISTORY Psoriasis is an immune-based skin disease confined to humans. While some mice demonstrate spontaneous mutations (e.g., flaky skin, chronic proliferative dermatitis, or homozygous asebia) that mimic some pathological aspects of psoriasis (i.e., acanthosis and increased dermal vasculature), there is no natural animal correlate that demonstrates the consistent and full spectrum of clinical and histological features of psoriasis [1–3]. These features include (1) scale production and parakeratosis, (2) absence of the granular layer, (3) acanthosis, (4) uniform elongation of rete pegs, (5) thinning of suprapapillary plate, (6) angiogenic tissue reaction, and (7) infiltration of immunocytes as portrayed in Figure 22.1 [1,4–8]. In the absence of a natural animal model for psoriasis, researchers utilize and study a variety of immunodeficient mice. These include severe combined immunodeficiency (SCID), nude, beige, 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
331
1391_C22.fm Page 332 Wednesday, November 19, 2003 10:38 AM
332
Figure 22.1
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Histological appearance of active psoriatic plaque. Note the confluent parakeratotic scale, loss of the granular cell layer, extensive elongation of rete pegs, prominent dilated vessels, and intense inflammatory infiltrate including lymphocytes in the dermis and epidermis (hematoxylin and eosin, magnification ¥ 75).
and osteopetrosis strains of mice [2]. SCID mice lack both the humoral (B cells) and cellular (T cells) arms of the immune response [2,9–12]. Nude mice differ in that they are only deficient in T-cell–mediated immunity [2,13]. Beige mice are unique in their reduced NK cell activity. Osteopetrosis mice are deficient in growth factors for macrophage differentiation. Recognition that these immunodeficient mouse strains did not provide optimal model systems prompted researchers to selectively breed combinations of immunodeficient mice, such as SCID-beige, nude-beige, or nonobese diabetic (NOD)-SCID mice [2,14,15]. Yet, none of these mice provided sufficient animal models to study the pathogenesis of psoriasis. In the 1990s, researchers attempted to induce characteristics of psoriasis by establishing strains of mice in which gene(s) for keratin and or cytokines were expressed. Attempts to create transgenic animal models met with limited success because psoriasis is a complex polygenic disease process [2,6,16]. Transgenic models do not necessarily allow for the study of the impact of key cytokines involved in psoriasis. The most functional animal model to date in the study of psoriasis is the xeno-transplanted model in which human skin is grafted onto immunodeficient mice. The SCID mouse/human skin passive-transfer chimera displays many characteristic of psoriasis (Figure 22.2), including the induction of psoriatic plaques [1,2,12]. Krueger et al. [17] initially used athymic mice (i.e., nude mice) for human skin transplants to study psoriasis at the University of Utah College of Medicine in 1975. Other investigators subsequently used the nude mice xeno-transplantation model and grafted small biopsy samples of normal skin from individuals without psoriasis (NN skin), nonlesional skin from patients with psoriasis (PN skin), and psoriatic plaques (PP skin) onto these mice. The establishment of the nude mouse–human skin model to study psoriasis was hampered by the thin, fragile skin, and poor vasculature of nude mice. The postgraft phenotype of NN, PN, and PP skin were unstable [1,18–20]. The well-developed vasculature and thicker coat in SCID mice enabled these mice to better support human skin grafts [1]. Boehncke et al. [21] at the University of Ulm in 1993 transplanted full thickness (8 to 10 mm in diameter) psoriatic plaques (PP) and nonlesional psoriatic (PN) skin to the corresponding shaved full-thickness defect on the back of C.B-17 SCID mice (one transplant per mouse). The original morphology of PN and PP skin remained unchanged after 6 weeks of transplantation. Immunohistochemical staining of PP skin revealed that psoriasiform architecture
1391_C22.fm Page 333 Wednesday, November 19, 2003 10:38 AM
EXPERIMENTAL CHIMERIC SCID MOUSE/HUMAN SKIN MODEL OF PSORIASIS
Figure 22.2
333
Clinical appearance of engrafted psoriatic plaque on SCID mouse. Note the visible silvery scale and erythematous plaque on the SCID mouse.
persisted despite an absence of T-cell infiltrates. Murine derived keratinocytes replaced the PN and PP grafted epidermis [21]. The dermis remained human in origin. This model, using small human skin biopsies, did not produce a genuine psoriatic lesion because the epidermis was composed of murine-derived keratinocytes [1,21]. Nickoloff et al. [22] demonstrated improved maintenance of the psoriatic phenotype with lager keratome–derived skin samples in 1995 at the University of Michigan. PP, PN, and NN skin were biopsied (6 ¥ 2 ¥ 0.05 cm-keratome) from the lower back or buttocks of volunteers. Psoriatic patients without arthritis or other systemic disease had approximately 70% of total body skin affected by psoriasis. SCID mice transplanted with large keratome-derived NN, PN, and PP skin samples sustained human epidermis and dermis for months, with greater than 85% postoperative xenograft survival [22]. The histopathological architecture and cell phenotype of NN, PN, and PP skin were preserved, thereby validating the SCID mouse/human skin chimera animal model [22]. Gilhar et al. [23] in 1997 at the Skin Research Laboratory, Rabin Medical Center, demonstrated maintenance of the PP plaque in xeno-transplant SCID mice by injecting human skin–derived T cells into the graft. In this autoreactive T-cell model, the authors injected T cells derived from a psoriatic plaque intravenously or intradermally into xeno-transplanted SCID mice [23]. The animal model maintained full histological features of psoriasis for 10 weeks. In 1996, Wrone-Smith and Nickoloff [24] initially at the University of Michigan, and subsequently at Loyola University of Chicago Medical Center actually created psoriatic plaques by injecting autologous blood-derived immunocytes preactivated with bacterial-derived superantigens (SEB/SEC2) from psoriatic patients into full thickness PN skin orthotopically transferred onto SCID mice. Psoriatic plaques were created characterized by visible presence of silver scale, accompanied microscopically by acanthosis, agranulosis, prominent elongation of rete pegs, angiogenic tissue reaction, and infiltration of T cells into the epidermis [24]. This model demonstrated that psoriasis is primarily caused by pathogenic blood-derived immunocytes. Additionally, Boehncke et al. [25] in 1997 showed that intradermal injection of superantigens and simultaneous intraperitoneal injections with patients’ blood-derived mononuclear cells simulated with superantigen resulted in an psoriasiform inflammatory reaction. These experiments confirm the role of superantigen-stimulated pathogenic immunocytes in the immunopathogenesis of psoriasis [6,26].
1391_C22.fm Page 334 Wednesday, November 19, 2003 10:38 AM
334
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
II. LABORATORY ANIMALS SCID mice are an important research model in general, because they are the only mice that lack functional B and T lymphocytes making them amenable to xeno-transplantation. The lymphocytes are not functional because of impaired incisions of DNA hairpin-coding ends that result in defective V(D)J (V, variable; D, diversity; J, joining) gene products and subsequent immunodeficiency. Not all SCID mice are completely immunodeficient. Eight to 15% of SCID mice can produce immunoglobulins. Aged SCID mice are more prone to develop the “leaky” SCID phenotype that may result in graft rejection. SCID mice require special husbandry and health considerations to protect them from all pathogens. Feed and water must be sterilized. Mice must be housed in microisolator cages in rooms with HEPA-filtered air. They must be transferred weekly into sterile cages. Male or female SCID mice may be used for xeno-transplantation. SCID mice purchased from Taconic Farms, Germantown, NY, from 4 to 8 weeks old were used in the xeno-transplantation studies described in this chapter. Xeno-transplantation is accomplished by suturing a postage stamp sized sample (1.5 to 2.0 cm ¥ 1.5 to 2.0 cm ¥ 0.05 cm) of keratome-derived dermis and epidermis on the corresponding shaved, full-thickness defect on the flank of SCID mice [1,22]. Following xeno-transplantation, xeroform dressing (Kendall Co., Mansfield, MA) are used to cover the wound and must be periodically changed.
III. DISEASE INDUCTION The creation and validation of the xeno-transplanted SCID mouse model has allowed researchers to generate the clinical and histological features that define psoriasis [1,18,26]. As previously mentioned, Wrone-Smith and Nickoloff [24] injected autologous blood-derived immunocytes to investigate the pathogenicity of immunocytes infiltrating into skin. Multiple keratome-derived PN grafts were placed onto SCID mice from six different psoriatic patients. Two to 3 weeks following the transplant, autologous immunocytes at a concentration of 2 to 3 ¥ 106, prestimulated with bacterial-derived superantigens (SEB/SEC2), were resuspended in sterile phosphate-buffered saline (PBS; 300 ml volume) and injected intradermally into the xenograft [22,24,27]. Mice were examined 2 to 4 weeks later. Autologous immunocytes were isolated by Ficoll-Hypaque“ (Pharmacia LKB Biotechnology Inc., Piscataway, NJ) density centrifugation of heparinized peripheral blood [22,24,27]. One to 2 ¥ 106 peripheral blood mononuclear cells (PBMC) were cultured (Corning Glass Works, Corning, NY) in media containing 10% heat-inactivated autologous serum in RPMI1640 containing 25 mM Hepes (GIBCBRL, Gaithersburg, MD) supplemented with 2 mM of L-glutamine, 100 U/ml of penicillin, 100 mg/ml of streptomycin, and 50 mg/ml of gentamicin (GIBCBRL). Immunocytes were cultured with or without 1 mg/ml of staphylococcal enterotoxins (SEB and SEC2) (Toxin Technologies, Sarasota, FL) and 20 U/ml human IL-2 (Boehringer Mannheim Biochemicals, Indianapolis, IN) for 48 hours at 37∞C with 5% CO2. After incubation, cells were washed twice with RPMI-1640 and resuspended in sterile PBS [22,24,27]. A bona fide psoriatic plaque was produced following intradermal injection of activated autologous blood-derived immunocytes into keratome-derived PN skin grafts on SCID mice [22,24,27]. Several groups have subsequently created psoriatic plaques using these methods [14,28–31]. These experiments confirmed that immunocytes were critically important in the immunopathogenesis of psoriasis. To further explore the specific pathogenic subset of immunocytes responsible for the creation of a psoriatic plaque, selectively administered autologous CD4 and CD8 cells were intradermally injected into the PN SCID mice grafts [32]. These T-cell lines were produced by negative selection from heparinized blood of psoriatic patients using the Ficoll-Hypaque separation method.
1391_C22.fm Page 335 Wednesday, November 19, 2003 10:38 AM
EXPERIMENTAL CHIMERIC SCID MOUSE/HUMAN SKIN MODEL OF PSORIASIS
335
Immunocytes were cultured as described above. The injection of CD4+ T-cell lines (greater than 98% pure) intradermally into the grafts converted PN to PP skin, whereas the injection of CD8+ T cells did not cause this response [32]. Furthermore, intradermal injection of blood derived CD4+ T cells into PN skin triggered proliferation and activation of resident intraepidermal CD4+ and CD8+ T cells and induced expression of natural killer receptors (NKR) CD94, CD158a, and CD158b [27]. These NKRs recognize class I major histocompatability complex (MHC) as was recently confirmed by Gilhar et al. [31]. To explore the role of autoreactive T cells stimulated by bacterial superantigens, Boehncke et al. [25] repetitively injected superantigens into the xeno-transplanted SCID mouse. Specifically, intradermal injections consisted of 100 ml of PBS with 3 mg of staphylococcal superantigen exfoliative toxin. Intraperitoneal injections were with 2 ¥ 106 PBMC prestimulated with 100 ng/ml of bacterial superantigen. Repetitive intradermal injection of bacterial superantigen with simultaneous injection of patients’ superantigen-stimulated peripheral-blood mononuclear cells into the peritoneum resulted in a psoriasiform inflammatory reaction typified by acanthosis, papillomatosis, and T-lymphocytic infiltrate [30].
IV. COURSE OF DISEASE The description on the course of disease in this chimeric SCID mouse/human skin model of psoriasis was covered earlier in Sections II and III.
V. ASSESSMENT OF DISEASE A. Clinical Manifestation Nickoloff et al. [22] demonstrated greater than 85% postoperative xenograft survival. By 4 weeks posttransplantation, skin grafts had contracted 30 to 40%. NN skin transplant appeared pinktan/brown with no scale, demonstrating the texture and thickness of normal human skin. After engraftment onto SCID mice, PN skin clinically appears tan/brown with occasional thin scale [22,24]. Intradermal injection of soluble mediators and cytokines such as gamma interferon induced clinical change that included induction of slight erythema, hyperpigmentation, epidermal thickening, and scale formation; but creation of psoriatic plaques was not achieved using this protocol [12,32]. B. Histopathological Examination Murine skin is easily differentiated from human skin by routine microscopic examination. Montagna [33] stated that human skin demonstrates well-developed dermal papilla which can be readily differentiated from the flat epidermis of murine skin by microscopic examination [33]. A number of investigators have examined NN, PN, and PP skin grafts and confirmed that SCID mice maintained the transplanted skin phenotype [2,14,22,24,28,31,32]. Transplanted NN skin was microscopically unremarkable. Normal basket-weave stratum corneum, epidermis, and dermis were appreciated. Transplanted PN skin contained compact and intact stratum corneum, epidermal acanthosis, and occasionally mild superficial perivascular lymphocytic infiltrate. The epidermal thickness of PN skin increased after transplantation [22]. This observation was thought to be similar to the Koebner phenomenon seen clinically, in which after mild trauma, PN skin can develop into a psoriatic plaque. Transplanted PP skin demonstrated features of untreated psoriatic plaque characterized by hyperkeratosis, parakeratosis, acanthosis with elongation of rete pegs, mononuclear cell infiltrate,
1391_C22.fm Page 336 Wednesday, November 19, 2003 10:38 AM
336
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
and angiogenic tissue response. Investigators have also histologically examined xeno-transplanted PN skin following injection of autologous blood derived immunocytes. There was no significant change observed in either clinical or histological appearance of PN skin injected with phosphate buffered saline (PBS). Changes seen in PN skin grafts injected with activated immunocytes included marked induction of scale and thickening of the skin and prominent angiogenic tissue reaction [22]. Hematoxylin and eosin (H&E) stained sections revealed confluent and extensive parakeratotic scale, acanthosis and absence of the granular layer, elongation of rete pegs, infiltration of lymphocytes in the epidermis and dermis, and formation of spongiform pustule of Kogoj and Munro’s microabscesses [12,27,32]. C. Immunopathological Examination Nickoloff et al. [22,24,27,32] examined NN, PN, and PP skin following transplantation to SCID mice. Human mononuclear cells that stained positive for common leukocyte antigen (CD45) were viable in the dermis and epidermis of NN, PN, and PP xeno-transplants. Murine blood-derived monocytes (negative for CD45) were also detected in the skin transplants. Human T lymphocytes (CD3, CD4, and CD8) were retained in NN, PN, and PP skin. These cells were present at high levels in PP skin, in contrast to occasional and rare T cells in PN and NN skin, respectively. To characterize the type of autologous immunocytes present in PN skin converted to PP skin, additional staining for CD3, CD4, CD8, and CD45R was performed. Human T cells infiltrating the dermis and epidermis were memory T cells (CD3+ CD45RO+). Both epidermal and dermal compartments contained CD3l, CD4l, and CD8-positive T cells; however, there were more CD8-positive T cells in the epidermis compared to the CD4-positive T-cell population. After transplantation, human antigens CD54 (ICAM-1) were present on keratinocytes (KCs), dendritic cells (DCs), and endothelial cells (ECs). CD106 were present on DCs and ECs, and CD31 were seen only on ECs. Immunostains for CD34 demonstrated EC chimerism (a portion of a vessel positive and negative for CD34 immunostaining, indicating human and murine origin). KCs and ECs of PP skin prominently expressed HLA-DR. CD34 (human progenitor–cell antigen) was expressed by epidermal and dermal DCs. Factor XIIIa-positive DCs and rare scattered CD1a-positive epidermal Langerhans were apparent in PN and PP skin. S-100 immunostaining revealed no increase in number of epidermal melanocytes. The posttransplant hyperpigmentation was not due to a nevomelanocytic proliferation. Immunostaining with proliferating cell nuclear antigen (PCNA) revealed a higher proliferative index in basal keratinocytes of PN transplanted skin injected with activated immunocytes than PN skin injected with only PBS (1 of 3 PCNA-positive basal KCs compared to 1 of 10 PCNA-positive basal KCs). HLA-DR, B1 integrin, and keratin 16 expression measured indicators of keratinocyte activation. These markers were diffusely positive after injection with activated immunocytes, in contrast to no induction of expression after injection with PBS. D. Immunogenetics Psoriasis appears to be a genetically based immune-mediated skin disease. The search for a genetic determinant(s) of psoriasis is being actively pursued. Several candidate genes have been reported based on familial linkage studies [6,34–37]. The most promising region for psoriasis susceptibility is on chromosome 6p21.3, which includes the MHC region. Other regions are particularly interesting because of their association with other autoimmune diseases that may be linked to psoriasis (e.g., Crohn’s disease). A summary of the six most frequently identified disease susceptibility loci are presented in Table 22.1. However, it should be noted that despite identification
1391_C22.fm Page 337 Wednesday, November 19, 2003 10:38 AM
EXPERIMENTAL CHIMERIC SCID MOUSE/HUMAN SKIN MODEL OF PSORIASIS
337
Table 22.1 Psoriatic Susceptibility Loci Loci
Chromosomal Location
PSORS1 PSORS2 PSORS3 PSORS4 PSORS5 PSORS6
6p21.3 17q 4q 1cen-q21 3q21 19p13
of these loci by several groups, specific gene products that are unequivocally and causally related to the immunogenetics of psoriasis have yet to be clearly identified.
VI. THERAPEUTIC RESPONSE Some drugs have been shown to reverse the PP phenotype postengraftment. When engrafted PP skin was treated by intraepidermal injection with cyclosporin A (CsA), 1,25-dihydroxyvitamin D3 (1,25-Vit D3), but not IL-10 or all-transretinoic acid, the plaques on the SCID mice were converted back to PN skin as was observed in a previous clinical trial in human subjects [29]. Pretreatment of immunocytes impaired their ability to convert engrafted PN skin from becoming PP skin. When peripheral blood-derived immunocytes were pretreated with CsA or 1,25-Vit D3, they were rendered incapable of converting PN skin to PP skin. Boehncke et al. [38] determined that the SCID mouse/human xenogenic transplant model allows screening of antipsoriatic drugs. Dexamethasone was administered once daily at a dose of 0.2 mg/kg of body weight. Dexamethasone resulted in reduction of acanthosis and papillomatosis. Boehncke et al. [38] also tested BAY X 1005, an inhibitor of leukotriene synthesis, administered twice daily at a dose of 5 mg/kg of body weight. BAY X 1005 had similarly reduced acanthosis [38]. Further studies using new biological reagents are indicated [39].
VII. EXPERT EXPERIENCE Key considerations for both novice and experienced investigative cutaneous biologists are thoroughly discussed in a previous review [1].
VIII. LESSONS LEARNED The SCID mouse/human skin model maintains the native human epidermal and dermal configuration, and provides a valid system for the investigation of psoriasis [1–3]. Dermal injection of activated blood-derived immunocytes into the SCID mouse/human skin model demonstrated that psoriasis is a disease process triggered by pathogenic T cells that drive epidermal and dermal response. The SCID mouse model led to the discovery of a subset of immunocytes expressing natural killer receptors (NKRs) which may bridge the innate and adaptive immune response in the skin (reviewed in Nickoloff [5]). To further explore the role of these immunocytes, cells derived from engrafted human skin may be expanded in an ex vivo organ culture system. Combining the SCID mouse/human skin model with the ex vivo organ culture system allows for the investigation of cytokines, growth factors, adhesion molecules, and specific subsets of skinderived immunocytes responsible for the immunopathogenesis of psoriasis [40].
1391_C22.fm Page 338 Wednesday, November 19, 2003 10:38 AM
338
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
IX. CONCLUSION Psoriasis remains a unique disease confined to humans. There is no natural animal correlate for this common, enigmatic skin disease. The establishment of SCID mouse human skin xenotransplantation model will allow investigators to perform controlled experiments and explore disease-defining steps in psoriasis. This animal model can provide insights into keratinocyte proliferation, differentiation, and neovascularization. When combined with an ex vivo organ culture system [40], in-depth analysis of specific immunocytes and key cytokines in the immunopathogenesis of psoriasis can be explored. The most recent developments using new experimental approaches and animal models relevant to psoriasis have uncovered a potentially overlooked role of resident immunocytes that contribute to the development of psoriatic lesions [41–43].
REFERENCES 1. Nickoloff, B.J., Animal models of psoriasis, Exp. Opin. Invest. Drugs, 8, 393, 1999. 2. Schon, M.P., Animal models of psoriasis-what can we learn from them? J. Invest. Dermatol., 112, 405, 1999. 3. Nickoloff, B.J. and Wrone-Smith, T., Animal models of psoriasis, Nat. Med., 3, 475, 1997. 4. Farber, E.M., The natural history of psoriasis in 5,600 patients, Dermatologica, 148, 1, 1974. 5. Nickoloff, B.J., Skin innate immune system in psoriasis: friend or foe? J. Clin. Invest., 104, 1161, 1999. 6. Nickoloff, B.J., The immunologic and genetic basis of psoriasis, Arch. Dermatol., 135, 1104, 1999. 7. Sundberg, J.P. et al., Mouse mutations as animal models and biomedical tools for dermatological research, J. Invest. Dermatol., 106, 368, 1996. 8. Stern, R.S., Psoriasis, Lancet, 350, 349, 1997. 9. Hendrickson, E.A., The SCID mouse: relevance as an animal model system for studying human disease, Am. J. Pathol., 143, 1511, 1993. 10. Taylor, P.C., Current status review: the severe combined immunodeficeint (SCID) mouse: xenogeneicSCID chimeras in the investigation of human autoimmune disease, Int. J. Exp. Pathol., 73, 251, 1992. 11. Bosma, M.J. and Carroll, A.M., The SCID mouse mutant: definition, characterization and potential uses, Annu. Rev. Immunol., 9, 323, 1991. 12. Bosma, G.C., Custer, R.P., and Bosma, M.J., A severe combined immunodeficiency mutation in the mouse, Nature, 301, 527, 1983. 13. Fraki, J.E., Briggaman, R.A., and Lazarus, G.S., Transplantation of psoriatic skin onto nude mice, J. Invest. Dermatol., 80 (Suppl.), 31, 1983. 14. Raychaudhuri, S.P. et al., Severe combined immunodeficiency mouse-human skin chimeras: a unique animal model for the study of psoriasis and cutaneous inflammation, Br. J. Dermatol., 144, 931, 2001. 15. Renz, J.F. et al., SCID mouse as a model for transplantation studies, J. Surg. Res., 65, 34, 1996. 16. Nickoloff, B.J., The search for pathogenic T cells and the genetic basis of psoriasis using a severe combined immunodeficient mouse model, Cutis, 65, 110, 2002. 17. Krueger, G.G. et al., Involved and environmental skin from psoriatic subjects: are they equally diseased? Assessment by skin transplanted to congenitally athymic (nude) mice, J. Clin. Invest., 68, 1548, 1981. 18. Krueger, G.G. et al., Long term maintenance of psoriatic human skin on congenitally athymic (nude) mice, J. Invest. Dermatol., 64, 307, 1975. 19. Haftek, M. et al., Normal and psoriatic human skin grafts on nude mice: morphological and immunochemical studies, J. Invest. Dermatol., 76, 48, 1981. 20. Powles, A.V. et al., Transplantation of psoriatic skin onto nude athymic mice does not maintain features of psoriasis, J. Invest. Dermatol., 93, 306, 1989. 21. Boehncke, W. et al., Psoriasiform architecture of murine epidermis overlying human psoriatic dermis transplanted onto SCID mice, J. Cutan. Pathol., 286, 325, 1994. 22. Nickoloff, B.J. et al., Severe combined immunodeficiency mouse and human psoriatic skin chimeras. Validation of a new animal model, Am. J. Pathol., 146, 580, 1995.
1391_C22.fm Page 339 Wednesday, November 19, 2003 10:38 AM
EXPERIMENTAL CHIMERIC SCID MOUSE/HUMAN SKIN MODEL OF PSORIASIS
339
23. Gilhar, A. et al., T lymphocyte dependence of psoriatic pathology in human psoriatic skin grafted to SCID mice, J. Invest. Dermatol., 109, 283, 1997. 24. Wrone-Smith, T. and Nickoloff, B.J., Dermal injection of immunocytes induces psoriasis, J. Clin. Invest., 98, 1878, 1996. 25. Boehncke, W.H. et al., Induction of psoriasiform inflammation by a bacteria superantigen in the SCIDhu xenogeneic transplantation model, J. Cutan. Pathol., 24, 1, 1997. 26. Gottlieb, A.B., Immunopathogenesis of psoriasis, Arch. Dermatol., 33, 781, 1997. 27. Nickoloff, B.J. et al., Response of murine and normal human skin to injection of allogeneic blood derived psoriatic immunocytes: detection of T cells expressing receptors typically present on natural killer cells including CD94, CD158, and CD161, Arch. Dermatol., 1999. 28. Sugai, J. et al., Histological and immunohistochemical studies of human psoriatic lesions transplanted onto SCID mice, J. Dermatol. Sci., 17, 85, 1998. 29. Dam, T.S., Kang, S., and Nickoloff, B.J., Pharmacological modulation of induction and treatment of psoriasis using human skin grafted onto SCID mice, J. Invest. Dermatol., 108, 572, 1997. 30. Lovik, M., The SCID (severe combined immunodeficiency) mouse-its biology and use in immunotoxicological research, Arch. Toxicol. Suppl., 17, 455, 1995. 31. Gilhar, A. et al., Psoriasis is mediated by a cutaneous defect triggered by activated immunocytes: induction of psoriasis by cells with natural killer receptors, J. Invest. Dermatol., 119, 384, 2002. 32. Nickoloff, B.J. and Wrone-Smith, T., Injection of prepsoriatic skin with CD4+ T cells induces psoriasis, Am. J. Pathol., 155, 145, 1999. 33. Montagna, W., Cutaneous comparative biology, Arch. Dermatol., 104, 577, 1971. 34. Ozawa, A. et al., Specific restriction fragment length polymorphism on the HLA-C region and susceptibility to psoriasis, J. Invest. Dermatol., 90, 402, 1988. 35. Hohler, T. et al., Identification of major susceptibility locus on chromosome 6p and evidence for further disease loci revealed by two stage genome-wide search in psoriasis, Hum. Mol. Genet., 6, 562, 1997. 36. Oestreicher, J.L. et al., Molecular classification of psoriasis disease-associated genes through pharmacogenomics expression profiling, Pharmacogenomics J., 1, 272, 2001. 37. Bowcock, A.M. et al., Insights into psoriasis and other inflammatory diseases from large-scale gene expression studies, Hum. Mol. Genet., 10, 1793, 2001. 38. Boehncke, W.H. et al., The SCID-hu xenogeneic transplantation model allows screening of antipsoriatic drugs, Arch. Dermatol. Res., 291, 104, 1999. 39. Krueger, J.G., The immunological basis for the treatment of psoriasis with new biologic agents, J. Am. Acad. Dermatol., 46, 1, 2002. 40. Curry, J.L. et al., Reactivity of resident immunocytes in normal and pre-psoriatic skin using an exvivo skin explant model system, Arch. Pathol. Lab. Med., 127, 1, 2003. 41. Boyman, O. et al., Conversion of uninvolved to involved psoriatic skin transplanted onto AGR mice indicates intrinsic default pathway of psoriasis disease pathogenesis, J. Invest. Dermatol., 119, 302, 2002. 42. Pasparakis, M. et al., TNF-mediated inflammatory skin disease in mice with epidermis-specific deletion of IKK2, Nature, 417, 861, 2002. 43. Curry, J.L. et al., Innate immune-related receptors in normal and psoriatic skin, Arch. Pathol. Lab. Med., 127, 178, 2003.
1391_C22.fm Page 340 Wednesday, November 19, 2003 10:38 AM
1391_C23.fm Page 341 Tuesday, November 18, 2003 5:32 PM
CHAPTER
23
Experimental Mouse Model of Psoriasis by Transgenic Expression of Integrin Joseph M. Carroll
CONTENTS I. History ................................................................................................................................341 II. Rationale.............................................................................................................................342 A. Roles of Adhesion Molecules and Cytokines in Psoriasis-Like Skin Lesions ........342 B. Integrin Expression by Keratinocytes .......................................................................343 C. Aberrant Integrin Expressions in Inflammatory Diseases ........................................343 III. Laboratory Animals............................................................................................................343 IV. Disease Induction...............................................................................................................344 A. Transgenic Construct .................................................................................................344 B. Microinjection and Genotyping.................................................................................344 C. Transgene Expression ................................................................................................344 V. Assessment of Disease.......................................................................................................345 A. Clinical Manifestation ...............................................................................................345 B. Histopathological Examination .................................................................................345 C. Immunological Data ..................................................................................................345 VI. Lessons Learned.................................................................................................................345 A. Overexpression of Epidermal Integrin Results in Epidermal Hyperproliferation and Dermal Inflammation..........................................................................................345 B. Possible Mechanisms Underlying Altered Epidermis by Suprabasal Integrin Expression..................................................................................................................347 C. Effects of Epidermal Intergrin Overexpression on EGF-R Signaling......................347 D. Suprabasal Integrin as a “Marker” of Perturbed Epidermal Homeostasis ...............348 References ......................................................................................................................................348
I. HISTORY In all the complexity of the inflammatory skin disease psoriasis, one clear finding to date is that this disease involves contributions from both keratinocytes and immune-system cells. To more fully explore the underlying etiology of psoriasis, various mouse models have been used. Given 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
341
1391_C23.fm Page 342 Tuesday, November 18, 2003 5:32 PM
342
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
the vast differences in architecture and immunology of mouse and human skin, the use of mouse models in showing the potential “causes” of the psoriatic phenotype have been primarily mechanistic. Various transgenic mouse models have resulted in inflammatory skin disease, resembling psoriasis to varying degrees. Models involving epidermal expression of cytokines, growth factors, transcription factors, and adhesion molecules can all result in perturbed epidermal differentiation and proliferation checkpoints as well as spontaneous inflammation of the epidermis [1]. The role of this chapter is to provide a background in mechanisms by which keratinocyte integrin expression maintains epidermal homeostasis and influences the immunobiology of the epidermis.
II. RATIONALE A. Roles of Adhesion Molecules and Cytokines in Psoriasis-Like Skin Lesions The involvement of adhesion molecules and cytokines in the evolution of inflammatory skin disease is clear. Most inflammatory diseases of the skin, including psoriasis, result in the presence of large numbers of “activated” immune cells in the epidermis [2]. These activated immune cells, primarily T cells and and Langerhans cells, specifically home to particular areas of the dermis and epidermis and display altered patterns of cytokine and adhesion molecule expression. Animal model-based psoriatic research in the recent past has focused on determination of the role that specific molecules play in the inflammatory cascade resulting in a myriad of inflammatory disease phenotypes [3]. Much of this work has focused on using transgenic mouse models to over- or misexpress cytokines in the epidermis. Using keratinocyte-specific transgenic promoters, mice have been created expressing a large number of various cytokines and growth factors in the epidermis [1]. Although many of these models exhibit phenotypes and pathology that are similar, in some respects, to the observed human psoriatic phenotype, none is sufficient to give an overt psoriatic phenotype in the skin of transgenic mice. Results drawn from mice expressing individual cytokines are useful but must be put in perspective since a given T cell, Langerhans cell, or activated keratinocyte in an involved psoriatic lesion would likely be secreting a mixture of growth factors and undoubtedly be influenced by environmental factors. The fact that such a wide variety of cell types and signaling pathways can contribute to the evolution of psoriasis belies the complexity of this disease. Adhesion molecules are also known to play a key role in inflammatory diseases of the skin. Adhesion molecules such as E- and P-selectin as well as integrins, are usually considered with respect to their altered expression on T cells and homing to the epidermis [2,3]. The presence of these molecules on immune cells is exceedingly important and probably determines the specificity of the homing to evolving skin plaques. In inflammatory conditions, such as psoriatic skin, keratinocytes are generally “activated” in that they express new adhesion molecules and display new cell adhesion molecules on their surface. The recent discovery of chemokines such as TARC and TACK secreted by activated keratinocytes [4] implies a coordinated cascade of cell-surface changes in adhesion molecule expression on immune cells induced by activated keratinocytes. In addition to expressing a variety of secreted molecules that may play an important role in initiating inflammatory disease of the skin, keratinocytes can also express adhesion molecules, and the misexpression of these molecules by epidermal keratinocytes can also contribute to epidermal inflammation. Cadherins and integrins are the two major families of adhesion molecules expressed by epidermal keratinocytes, and although cadherin expression has been shown to be correlated with various skin diseases [5], the rest of this chapter is devoted to the role that integrins play in epidermal inflammation.
1391_C23.fm Page 343 Tuesday, November 18, 2003 5:32 PM
EXPERIMENTAL MOUSE MODEL OF PSORIASIS BY TRANSGENIC EXPRESSION OF INTEGRIN
343
B. Integrin Expression by Keratinocytes Integrins are cell-adhesion molecules that play crucial roles in maintaining epidermal homeostasis. By virtue of their heterodimeric composition, consisting of one a subunit and one b subunit, they are able to bind a variety of extracellular matrix proteins [6]. In the epidermis, the binding of keratinocyte integrins to matrix proteins in the basement membrane (i.e., collagen, fibronectin, vitronectin, and laminin) mediate keratinocyte differentiation as well as adhesion [7]. Experiments with knockout mice have shown that ablation of b4 or b1 subunits either in the entire mouse or conditionally in the epidermis [8,9] results in loss of hemidesmosome structure and epidermal polarity with clear blister formation as the epidermis separates from the basement membrane. These studies also demonstrate a clear role for keratinocyte integrins in maintaining epidermal homeostasis, adhesion, and basement membrane integrity. Apart from their clear role in regulating epidermal adhesion and polarity, integrins have also been implicated more broadly in keratinocyte growth, differentiation, and migration. Integrin expression levels, particularly of the b1 subunit (and its associated partners), have been shown to vary between epidermal “stem” cells and transient amplifying cells [7], suggesting a direct coupling integrin adhesion and keratinocyte proliferation. Deletion studies of the b1-integrin cytoplasmic tail have shown that the intracellular regions of the receptor that regulate integrin-mediated adhesion and differentiation are distinct [10]. In the most straightforward model of how integrins help to regulate cellular differentiation, as integrins lose adhesion for extracellular matrix proteins in the basement membrane, they leave the basal layer and undergo a progressive terminal differentiation as they move through the upper layers of the epidermis [7]. Integrins are also known to promote cell adhesion at the leading edge of migrating wound edge as the epidermis requires cell–matrix interaction at the leading edge of the wound [11]. C. Aberrant Integrin Expressions in Inflammatory Diseases For all of the functions described above, integrin expression is confined to the basal layer of the epidermis. However, there are situations in which integrin expression is observed in the suprabasal layers of the epidermis. During wound healing, aberrant integrin expression has been consistently observed [12,13]. Polarization of integrin exposure on the cell surface is lost after wound closure, and integrin expression in suprabasal layers is observed. During wound closure the epidermis is disorganized and hyperproliferative, and suprabasal integrin expression has been postulated to play a causative role in influencing the balance between epidermal proliferation, migration, and organization in this system during both adult and fetal wound healing [13,14]. These observations suggest that suprabasal integrin expression might play an important role in inflammatory skin disease, such as psoriasis. Indeed, psoriatic lesions have consistently been reported to exhibit suprabasal integrin expression. In keratinocytes derived from both involved and uninvolved psoriatic skin, suprabasal expression of axb1 subunits is observed, as is overexpression of the a5b1 subunit [12,15].
III. LABORATORY ANIMALS Our group has examined the effects of overexpression of integrin in the epidermis of transgenic mice on overall structure of the epidermis and we are looking for a possible development of psoriatic phenotype [16]. The CBA ¥ C57BL/10 mouse strain was used for the transgenic experiments.
1391_C23.fm Page 344 Tuesday, November 18, 2003 5:32 PM
344
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Restriction Endonuclease Sites SalI SalI
Intron
Vector Involucrin Promoter-2.5 kb
Transgene cDNA
Poly-A Tail
Human β 1 integrin-2.9 kb, or Human α 2 integrin-3.6 kb, or Human α 5 integrin-3.4 kb
Figure 23.1
Transgenic construct for epidermal overexpression of integrins.
IV. DISEASE INDUCTION A. Transgenic Construct The integrin cDNAs were cloned into the NotI site of an involucrin expression cassette consisting of 2.5 kb of the human involucrin upstream region, the involucrin intron, an SV40 intron, and an SV polyadenylation sequence (Figure 23.1) [16]. The cDNAs for human a2 integrin, a5 integrin, and b1 integrin subunits were excited from their original plasmids, blunt ended, and ligated to NotI linkers as described [16]. After amplification, all the transgenes were then excited from their parent plasmids as SalI fragments, prurified, resuspended in sterile phosphate-buffered saline at a concentration of 5 mg/ml. B. Microinjection and Genotyping The transgenes were then microinjected into fertilized oocytes from (CBA ¥ C57BL/10)F1 mice. Founders were backcrossed to establish lines of animals, and the F1 or later generation of progeny was analyzed. All transgenic mice were kept on an established 12 hour:12 hour (light:dark) cycle in a special pathogen-free facility [16]. Animals were screened for the presence of transgene using PCR of DAN obtained from the ear, with a primer pair specific for the transgene (one primer specific for the SV40 intron, and the other primer specific for the 5' end of the integrin cDNA). To determine the transgene copy number, isolated genomic DNA from mouse tail snips was digested with restriction enzymes excising a large piece of transgenic DNA. The digests were electrophoresed in 1% agarose gels, blotted onto nylon membrane, and probed with a human involucrin DNA probe consisting of a 1.4-kb SacI fragment of the involucrin upstream region. The copy numbers were determined as previously described [16]. To obtain double Tg mice, the single Tg mouse founders were mated after genotyping to establish double-Tg mouse lines, which were confirmed by genotyping [16]. C. Transgene Expression The determination of transgene expression was carried out by RT-PCR using total RNA extracted from tissues of Tg mice and by immunofluorescence microscopy using antibodies specific for the proteins encoded by the human integrin transgenes [16].
1391_C23.fm Page 345 Tuesday, November 18, 2003 5:32 PM
EXPERIMENTAL MOUSE MODEL OF PSORIASIS BY TRANSGENIC EXPRESSION OF INTEGRIN
345
V. ASSESSMENT OF DISEASE A. Clinical Manifestation On cross-inspection, several abnormalities were observed in the transgenic (Tg) mice and not observed in non-Tg mice. A significant proportion of the animals expressing a5, b1, a2b1, or a5b1 were born with open eyes, were runted, and had fewer whiskers than the non-Tg littermates [16]. Among the single Tg mice, a2-Tg, a5-Tg, and b1-Tg, the highest percentage of b1-Tg mice exhibited cross-abnormalities [16]. B. Histopathological Examination Histopathology revealed that epidermal hyperplasia and inflammatory cell infiltrate, features that resemble a psoriasic form lesion, are present in b1-Tg, a2b1-Tg, and a5b1-Tg mice, but not in a2-Tg and a5-Tg mice, which strongly suggested the prominent effects of b1 integrin over those of a2 and a5 integrins [16]. The strongest effects, however, are demonstrated in the a2b1-Tg mice, suggesting a role by the a2 integrin [16]. The hyperproliferative states of the Tg mouse epidermis were confirmed by antibodies specific for the proliferative cells (Ki-67) and differentiation-dependent keratins (K1 and K6). In contrast to non-Tg littermates, which showed only the basal layer being positive for Ki-67, the Tg mouse skin revealed several layers of positive staining [16]. The K1 protein staining revealed a suprabasal labeling in non-Tg mice skin, whereas it revealed a patchy multiple epidermal layers of labeling in Tg mice [16]. While K6 is only expressed in the non-Tg mouse hair follicles, it is highly expressed in several layers of the Tg hyperproliferative epidermis [16]. The only major histological feature of psoriasis not reproduced in the integrin Tg mice was the elongation of the rete ridges. The absence of rete ridges elongation may be explained by the fact that rete ridges are lacking in normal mouse skin dermal–epidermal junction. C. Immunological Data Immunostaining of skin sections in integrin Tg mice, in contrast to that of non-Tg littermates, showed numerous skin infiltrations of CD3+ T cells, CD4+ helper T cells, and CD8+ cytotoxic T cells [16]. In addition, epidermal ICAM-1 was highly expressed in Tg mice [16] (Figure 23.2).
VI. LESSONS LEARNED A. Overexpression of Epidermal Integrin Results in Epidermal Hyperproliferation and Dermal Inflammation Supporting the notion that the epidermally expressed integrin is in some way causative, is the finding that transgenic mice constituitively overexpressing axb1 integrin subunits exhibit a hyperproliferative skin disease with spontaneous epidermal hyperplasia and inflammation [16]. These mice show focal areas of epidermal inflammation characterized by epidermal thickening and hyperplasia as well as immune cell infiltrates. Immune cell infiltrates where characterized by both CD4+ and CD8+ T cells in the epidermis as well as large numbers of Langerhans cells in the epidermis. More extensive, but less severely affected regions of the epidermis were often seen in the skin of these mice, and these were characterized by hyperproliferative and acanthotic epidermis with very few infiltrating immune cells (similar to areas adjacent to involved psoriatic lesions in humans). More severely inflamed areas of the epidermis were characterized by large numbers of infiltrating CD8+ T cells and severely proliferative and hyperplastic epidermis. Transgenic
Figure 23.2
j k
h
e
b
l
i
f
c
severe
Immunofluorescence microscopy of skin samples demonstrating the immune responses of integrin transgenic mice. Skin sections obtained from the back of non-Tg mice (a, d, g, j), Tg mice (a5b1) with mild skin lesions (b, e, h, k), and Tg mice (a2b1) with severe skin lesions (c, f, i, l) were immunolabeled with antibodies against mouse CD3 (a–c), CD4 (d–f), CD8 (g–i), and ICAM-1 (j–l), followed by fluorescence-labeled second antibody. The weak epidermal fluorescence seen in d and j were the same when the sections were labeled with second antibody alone. Bar, 60 microns. (From Carroll, J.M., Romero, M.R., and Watt, F.M., Cell, 83, 957, 1995, with permission.)
ICAM-1
g
d
a
mild
346
CD8
CD4
CD3
control
1391_C23.fm Page 346 Tuesday, November 18, 2003 5:32 PM
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
1391_C23.fm Page 347 Tuesday, November 18, 2003 5:32 PM
EXPERIMENTAL MOUSE MODEL OF PSORIASIS BY TRANSGENIC EXPRESSION OF INTEGRIN
347
keratinocytes derived from these studies are not hyperproliferative in submerged cultures in vitro [17], suggesting that the phenotype in vivo is not solely determined by suprabasal integrin expression, but by a cascade of events initiated by aberrant integrin expression. The matrix protein substrates for integrins are not present in the suprabasal layers of the epidermis, and integrins on the surface of suprabasal kerartinocytes have been shown to be in an “inactive” (non–ligandbinding state) [18,19]. How, therefore, could the presence of suprabasal integrins on the cell surface affect epidermal homeostasis? B. Possible Mechanisms Underlying Altered Epidermis by Suprabasal Integrin Expression There are two main possibilities concerning the mechanism by which suprabasal integrin expression can perturb epidermal organization. One possibility is that a basal cell that recognizes integrin expression on a cell in the suprabasal layers is called on to hyperproliferate. There is currently no evidence supporting this view, and it seems unlikely given the lack of such a phenotype in all suprabasal-integrin–positive transgenic epidermis either in vitro or in vivo [16,17]. This hypothesis also does not explain the ensuing, sporadic inflammation that occurs in the epidermis of suprabasal-integrin transgenic mice. The second possibility is that the presence of suprabasal integrins on the cell surface conveys altered signaling pathways or the potential for altered signaling pathways on the suprabasal keratinocytes themselves. There are several lines of evidence supporting the second hypothesis. Transgenic mouse keratinocytes expressing suprabasal integrins secrete and have higher intracellular stores of IL-1a than control keratinocytes [20]. Inflamed areas of the skin of these mice also have elevated levels of activated MAPK present in the nucleus of skin sections in vivo [20]. Like the b1 integrins expressed on the surface of basal keratinocytes, suprabasal integrins ex vivo can activate MAPK through the binding of the respective extracellular matrix protein or activating antibody [20]. Although the full spectrum of extracellular matrix proteins is not present in suprabasal layers of the epidermis, they could potentially be activated under certain conditions by the minor collagens [21]. In addition to signaling through MAPK, integrins have also been shown to signal through the ILK pathway [22]. This kinase has been shown to have a restricted expression to the basal layers of the epidermis and hair follicles, in a pattern strikingly similar to the b1 integrin [23]. This kinase has been shown to be under the control of the erbB-2 receptor as well, and transgenic mice overexpressing the erbB2 receptor in the basal layers of the epidermis up-regulated ILK and exhibited epidermal hyperproliferation and hyperplasia [24]. Even though keratinocytes from suprabasal-integrin–positive transgenic mice do not exhibit increased proliferation when grown under Rheinwald–Green conditions [17], suprabasal integrin expression is correlated with hyperproliferation in a more complex and realistic in vitro culture system consisting of growing human keratinocytes on a dermal equivalent [25]. It is therefore possible that integrin-signaling pathways are perturbed in situations where integrins are present in suprabasal layers of the epidermis, and that these aberrant signaling pathways contribute to a signal cascade that initiates or exacerbates inflammatory skin disease. C. Effects of Epidermal Intergrin Overexpression on EGF-R Signaling Signaling through the EGF-R, and its ligands such as EGF, TGF-a, and amphiregulin have long been shown to play a pivotal role in keratinocyte proliferation and epidermal disease [26]. In fact, transgenic overexpression of the ligands TGF-a [27], amphiregulin [28], or perturbation of the EGF-R itself [29], all result in perturbed epidermal homeostasis including keratinocyte hyperproliferation and hyperplasia, and, in some cases, epidermal inflammation. Factors regulating the EGF-R pathway in human skin, particularly in disease states, are not as well understood. Both the receptor and its ligands have been shown to be overexpressed in psoriasis [26,30]. In addition, ex vivo studies of psoriatic explants show that the presence of the EGF-R in suprabasal layers was
1391_C23.fm Page 348 Tuesday, November 18, 2003 5:32 PM
348
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
functionally significant since it responded to exogenous EGF [31]. This is interesting because of the potent effects integrins are known to have on the EGF-R signaling pathway in other systems. In epithelial cells, the a5b1 integrin is known to enhance EGF-R signaling via the Akt/PI-3 kinase pathway [32]. Additionally, in a different system, expression of the a2b1 integrin at sites of cell–cell contact has been shown to stimulate EGF-R activation at these contacts [33]. Studies of integrin signaling pathways have also demonstrated that signaling interactions mediated via the integrin cytoplasmic tail are required for signal transduction through the EGF-R [34]. On the flip side of the coin, studies in breast epithelial cells have also showed that b1 integrin function can be mediated through EGF-R activation [35]. This evidence strongly suggests that integrins, particularly at sites of cell–cell contact (as would be present in suprabasal layers of the epidermis), may be crucial in regulating EGF-R signal transduction. D. Suprabasal Integrin as a “Marker” of Perturbed Epidermal Homeostasis Suprabasal integrin expression may also be a good “marker” for the inflamed state of the epidermis. In steady-state keratinocytes grown in standard submerged culture systems or on a dermal equivalent, cytokines are not sufficient to perturb integrin expression [12]. Yet, suprabasal integrin expression is observed in several mouse models where epidermal hyperproliferation and inflammation are present [36,37]. Overexpression of KGF in a skin equivalent model induced hyperproliferation and suprabasal integrin expression [38]. In the clinic, suprabasal integrin expression has been found to be present in a number of skin diseases. These include psoriasis [12,13], benign papillomas and malignant tumors [39], benign vulvar warts [40], pemphigoid nodularis [41], and atopic dermatitis [42]. Suprabasal integrins can also be good markers of normalization of disease phenotype with therapeutic agents. Agents that show normalization of suprabasal integrin expression include ultraviolet B light [43], etretinate [44], and calcipotriol [45]. Topical retinoic acid, when used to induce epidermal hyperplasia, can directly stimulate suprabasal integrin expression in vivo [46]. Taken together, these data suggest that suprabasal integrin expression plays an important role in the initiation of inflammatory skin disease as well as being a good marker of perturbed epidermal homeostasis. Whether by playing a key direct role in modulating keratinocyte homeostasis or indirectly by modulating IL-1a or EGF-R signaling pathways, aberrant integrin expression can cause epidermal hyperproliferation, and in some cases, spontaneous inflammation. Further studies will be needed to show the exact mechanisms whereby this regulation occurs.
REFERENCES 1. Schon, M.P., Animal models of psoriasis — what can we learn from them? J. Invest. Dermatol., 112, 405, 1999. 2. Robert, C. and Kupper, T.S., Inflammatory skin disease, T cells, and immune surveillance, N. Engl. J. Med., 341, 1817, 1999. 3. Nickoloff, B.J., The immunologic and genetic basis of psoriasis, Arch. Dermatol., 135, 1104, 1999. 4. Reiss, Y. et al., CC chemokine receptor CCR4 and the CCR10 ligand cutaneous T-cell attracting chemokine (CTACK) in lymphocyte trafficking to inflamed skin, J. Exp. Med., 194, 1541, 2001. 5. Furukawa, F. et al., Roles of E- and P- cadherin in the human skin, Micros. Res. Technol., 38, 343, 1997. 6. Hynes, R.O., Integrins: versatility, modulation and signaling in cell adhesion, Cell, 69, 11, 1992. 7. Watt, F.M., Role of integrins in regulating epidermal adhesion, growth and differentiation, EMBO J., 21, 3919, 2002. 8. Raghavan, S. et al., Conditional ablation of b1 integrin in skin: severe defects in epidermal proliferation, basement membrane formation, and hair follicle invagination, J. Cell Biol., 150, 1149, 2000. 9. Van der Neut, R. et al., Epithelial detachment due to the absence of hemidesmosomes in integrin b4 null mice, Nat. Genet., 13, 366, 1996.
1391_C23.fm Page 349 Tuesday, November 18, 2003 5:32 PM
EXPERIMENTAL MOUSE MODEL OF PSORIASIS BY TRANSGENIC EXPRESSION OF INTEGRIN
349
10. Levy, L et al., Beta1 integrins regulate keratinocyte adhesion and differentiation by distinct mechanisms, Mol. Biol. Cell., 11, 453, 2000. 11. De Luca, M. et al., Role of integrins in cell adhesion an polarity in normal keratinocytes and human skin pathologists, J. Dermatol., 21, 821, 1994. 12. Hertle, M.D. et al., Aberrant integrin expression during epidermal wound healing and in psoriatic epidermis, J. Clin. Invest., 89, 1892, 1992. 13. Marchisio, P.C., Trusolino, L., and De Luca, M., Topography and biological role of intergrins in human skin, Microsc. Res. Technol., 38, 353, 1997. 14. Cass, D.L. et al., Epidermal integrin expression is upregulated rapidly in human fetal wound repair, J. Pediatr. Surg., 33, 312, 1998. 15. Pelligrini, G. et al., Expression, topography, and function of integrin receptors are severely altered in keratinocytes from involved and uninvolved psoriatic skin, J. Clin. Invest., 89, 1783, 1992. 16. Carroll, J.M., Romero, M.R., and Watt, F.M., Suprabasal integrin expression in the skin of transgenic mice results in developmental defects and a phenotype resembling psoriasis, Cell, 83, 957, 1995. 17. Romero, M.R., Carroll, J.M., and Watt, F.M., Analysis of cultured keratinocytes from a transgenic mouse model of psoriasis: effects of suprabasal integrin expression on keratinocyte adhesion, proliferation and differentiation, Exp. Dermatol., 8, 53, 1999. 18. Kim, L.T. and Yamada, K.M., Evidence that beta1 integrins in keratinocyte cell-cell junctions are not in the liagnd-occupied conformation, J. Invest. Dermatol., 108, 876, 1997. 19. Penas, P.F. et al., Differential expression of activation epitopes of beta1 integrins in psoriasis and normal skin, J. Invest. Dermatol., 111, 19, 1998. 20. Haase, I. et al., A role for mitogen-activated protein kinase activation by integrins in the pathogenesis of psoriasis, J. Clin. Invest., 108, 527, 2001. 21. Peltonen, S., et al., A novel component of epidermal cell-matrix and cell-cell contacts: transmembrane protein type XIII collagen, J. Invest. Dermatol., 113, 635, 1999. 22. Dedhar, S., Cell-substrate interactions and signaling through ILK, Curr. Opin. Cell Biol., 12, 250, 2000. 23. Xie, W. et al., Expression of the integrin-linked kinase (ILK) in mouse skin: loss of expression in the suprabasal layers of the epidermis and up-regulation by erbB-2, Am. J. Pathol., 153, 367, 1998. 24. Xie, W. et al., Targeted expression of activated erbB-2 to the epidermis of transgenic mice elicits striking developmental abnormalities in the epidermis and hair follicles, Cell Growth Differ., 9, 313, 1998. 25. Rikimaru, K., Moles, J.-P., and Watt, F.M., Correlation between hypoproliferation and suprabasal integrin expression in human epidermis reconstituted in culture, Exp. Dermatol., 6, 214, 1997. 26. King, L.E. et al., The EGF/TGF alpha receptor in skin, J. Invest. Dermatol., 94, 164, 1990. 27. Vassar, R. and Fuchs, E., Transgenic mice provide new insights into the role of TGF-alpha during epidermal development and differentiation, Genes Dev., 5, 714, 1991. 28. Cook, P.W. et al., Transgenic expression of the human amphiregulin gene induces a psoriasis-like phenotype, J. Clin. Invest., 100, 2286, 1997. 29. Murillas, R. et al., Expression of a dominant negative mutant of epidermal growth factor receptor in the epidermis of transgenic mice elicits striking alterations in hair follicle development and skin structure, EMBO J., 14, 5216, 1995. 30. Elder, J.T. et al., Overexpression of transforming growth factor alpha in psoriatic epidermis, Science, 243, 811, 1989. 31. Nanney, L.B., Yates, R.A., and King, L.E., Modulation of epidermal growth factor receptors in psoriatic lesions during treatment with topical EGF, J. Invest. Dermatol., 98, 296, 1992. 32. Lee, J.W. and Juliano, R.L., The alpha5beta1 integrin selectively enhances epidermal growth factor signaling to the phosphatidylinositol-3-kinase/Akt pathway in intestinal epithelial cells, Biochim. Biophys. Acta, 1542, 23, 2002. 33. Yu, X., Miyamoto, S., and Mekada, E., Integrin alpha 2 beta 1-dependent EGF receptor activation at cell-cell contact sites, J. Cell Sci., 113, 2139, 2000. 34. Moro, L. et al., Integrin-induced epidermal growth factor (EGF) receptor activation requires c-Src and p130Cas and leads to phosphorylation of specific EGF receptor tyrosines, J. Biol. Chem., 277, 9405, 2002.
1391_C23.fm Page 350 Tuesday, November 18, 2003 5:32 PM
350
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
35. Adelsman, M.A., McCarthy, J.B., and Shimizu, Y., Stimulation of beta1-integrin function by epidermal growth factor and heregulin-beta has distinct requirements for erbB2 but a similar dependence on phosphoinositide 3-OH kinase, Mol. Biol. Cell, 10, 2861, 1999. 36. Carroll, J.M. et al., Transgenic mice expressing IFN-gamma in the epidermis have eczema, hair hypopigmentation, and hair loss, J. Invest. Dermatol., 108, 412, 1997. 37. Blessing, M., Schirmacher, P., and Kaiser, S., Overexpression of bone morphogenetic protein-6 (BMP6) in the epidermis of transgenic mice: inhibition or stimulation of proliferation depending on pattern of transgene expression and formation of psoriatic lesions, J. Cell. Biol., 135, 227, 1996. 38. Andreadis, S.T. et al., Keratinocyte growth factor induces hyperproliferation and delays differentiation in a skin equivalent model system, FASEB J., 15, 898, 2001. 39. Tennenbaum, T. et al., Extracellular matrix receptors and mouse skin carcinogenesis: altered expression linked to appearance of early markers of tumor progression, Cancer Res., 52, 2966, 1992. 40. Williams, A.T. et al., Upregulation of integrin expression in benign vulvar warts, J. Pathol., 175, 311, 1995. 41. Schachter, M. et al., Pemphigoid nodularis associated with autoantibodies to the NC16A domain of BP180 and a hyperproliferative integrin profile, J. Am. Acad. Dermatol., 45, 747, 2001. 42. Jung, K. et al., Adhesion molecules in atopic dermatitis: upregulation of alpha6 integrin expression in spontaneous lesional skin as well as in atopen and irritative induced patch test reactions, Int. Arch. Allergy Immunol., 113, 495, 1997. 43. Krueger, J.G. et al., Successful ultraviolet B treatment of psoriasis is accompanied by a reversal of keratinocyte pathology and selective depletion of intraepidermal T cells, J. Exp. Med., 182, 2057, 1995. 44. Gottlieb, S. et al., Cellular actions of etretinate in psoriasis: enhanced epidermal differentiation and reduced cell-mediated inflammation are unexpected outcomes, J. Cutan. Pathol., 23, 404, 1996. 45. Savoia, P. et al., Effects of topical calcipotriol on the expression of adhesion molecules in psoriasis, J. Cutan. Pathol., 25, 89, 1998. 46. Hakkinen, L. et al., Suprabasal expression of epidermal a2b1 and a3b1 integrins in skin treated with topical retinoic acid, Br. J. Dermatol., 138, 29, 1998.
1391_C24.fm Page 351 Wednesday, November 19, 2003 10:41 AM
SECTION
G
Atopic Dermatitis
1391_C24.fm Page 352 Wednesday, November 19, 2003 10:41 AM
1391_C24.fm Page 353 Wednesday, November 19, 2003 10:41 AM
CHAPTER
24
Spontaneous Canine Model of Atopic Dermatitis Andrew Hillier and Thierry Olivry
CONTENTS I. II. III. IV. V.
History ................................................................................................................................353 Animals ..............................................................................................................................354 Epidemiology .....................................................................................................................355 Course of Disease ..............................................................................................................355 Assessment of Disease.......................................................................................................356 A. Clinical Manifestation ...............................................................................................356 B. Histopathological Examination .................................................................................359 C. Biochemical and Immunopathological Data.............................................................360 1. Epidermal Cells ...................................................................................................360 2. Dermal Cells ........................................................................................................360 3. Cytokines and Chemokines .................................................................................360 D. Immunogenetics.........................................................................................................361 VI. Therapeutic Response ........................................................................................................361 A. Anti-Inflammatory Pharmacotherapy ........................................................................361 B. Allergen-Specific Immunotherapy.............................................................................362 C. Allergen Avoidance....................................................................................................363 VII. Expert Experience ..............................................................................................................363 VIII. Lessons Learned.................................................................................................................363 IX. Conclusion..........................................................................................................................364 References ......................................................................................................................................364
I. HISTORY Canine atopy was first reported more than 60 years ago in a dog with seasonal allergic rhinitis and pruritic urticaria [1], followed twenty years later by the description of a dog with allergic conjunctivitis and pruritus [2]. From the late 1960s through until the early 1980s numerous studies of multiple cases of canine atopic diseases appeared in the literature [3–10], which helped establish canine atopy as a skin-predominant affection. These studies were the first to characterize the clinical signs and skin lesions of canine atopic dermatitis (AD). Further, intradermal testing, serologic assays, provocative challenge with environmental allergens, and successful homologous passive 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
353
1391_C24.fm Page 354 Wednesday, November 19, 2003 10:41 AM
354
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
transfer of reaginic antibodies from affected dogs suggested an association with skin-sensitizing antibodies and allergy. Studies reported over the last 30 years have helped confirm the reaginic antibody as canine IgE. Initial studies of the physicochemical properties of canine IgE [11,12], its antigenic similarity with human IgE [13], and its presence on mast cells in the skin [14] were followed more recently by the development of monoclonal and polyclonal anticanine IgE antisera [15–17], the isolation of pure canine IgE from a heterohybridoma [18], the isolation and sequencing of the canine IgE constant region gene [19], the characterization of the heavy chain of canine IgE [18,20], and the development of an Fce-RI assay for canine IgE [21,22]. Despite these advances, it has not been until recent years that the pathogenesis of canine AD and the stimuli that trigger the inflammatory reaction have begun to be elucidated. The disease was initially termed “canine allergic inhalant dermatitis” based on clinical signs in early reports [1,2,5], and the initial focus of canine models of canine atopy that targeted the respiratory tract for sensitization and challenge with allergens [23–26]. However, the epidermal route of allergen challenge has more recently been proposed based on clinical observations [27], histological evidence [28], and the induction of allergen-specific IgE and dermatitis in genetically predisposed beagles following epicutaneous application of allergen [29–31]. In addition, experimental models of IgEmediated hypersensitivity to food and environmental allergens, some with the generation of cutaneous clinical signs, have further enhanced research and investigation into canine AD [32–35].
II. ANIMALS Canine AD has been reported to occur in many purebred dog (reviewed in Sousa and Marsella [36]) and in mixed-breed dogs. Only a few studies have evaluated the relative risk of specific breeds for development of AD based on appropriate population controls [5,9,37–40]. The following breeds have been reported to have higher risk for development of AD: Beauceron, Boston terrier, boxer, cairn terrier, Chinese shar-pei, cocker spaniel, Dalmatian, English bulldog, English setter, fox terrier, golden retriever, Irish setter, Labrador retriever, labrit, Lhasa apso, miniature schnauzer, pug, Scottish terrier, Sealyham terrier, West Highland white terrier, wire-haired fox terrier, and Yorkshire terrier. The following breeds have been reported to be at lower risk for developing AD: dachshund, Doberman pinscher, German shepherd, German shorthaired pointer, and poodle. The proportion of mixed breed dogs with AD was found to be significantly lower than expected from total hospital admissions in a recent study [40]. It is generally accepted that breed predispositions are present in canine AD; however these differ by geographic region and may change as the popularity of a breed rises or declines. A recent study of a colony of high IgE-responder beagle dogs suggested that the capacity to produce high levels of IgE was inherited in a genetically dominant manner [32]. However, further work within this colony suggests that the development of clinical disease is dependent on unspecified environmental factors as well as the genetic predisposition to development of high levels of IgE [41]. Perhaps this explains why the development of AD was unpredictable in a colony of 72 dogs established from the progeny of dogs with AD [42,43], and why no significant difference in total serum IgE levels and development of clinical disease was seen in 154 West Highland white terriers from 33 litters that were monitored for 3 years [44]. The typical age for the development of canine AD is from 6 months of age to 3 years, equivalent to young children of 3 to 4 years of age into early adulthood in humans (early 20s) [7,39,45,46]. Clinical signs of AD are rarely reported to surface for the first time in dogs aged less than 6 months (equivalent to infancy in humans) or in dogs older than 7 years (equivalent to middle age in humans). However, it should be noted that the early clinical signs, when affected dogs may have minimal pruritus or skin lesions, may not be perceived by some dog owners (and probably some veterinary practitioners as well) as being abnormal or suggestive of emerging allergic dermatitis.
1391_C24.fm Page 355 Wednesday, November 19, 2003 10:41 AM
SPONTANEOUS CANINE MODEL OF ATOPIC DERMATITIS
355
Sex predilection appears to be uncertain at this time as some studies report a higher incidence in male dogs [7], some report a higher incidence in females [5,9,47], and others do not report a predilection for development of AD in either sex [10,38,39].
III. EPIDEMIOLOGY There have been no studies reported to date that provide reliable epidemiologic data on the true prevalence and incidence of canine AD. Textbooks estimate that between 3% and 15% [48] or around 10% [46] of all dogs have AD. The disease is reported in textbooks to be the second most common cause of pruritus in dogs, after flea allergy dermatitis [46,48]. In a large survey of 31,484 dogs examined by veterinarians in 52 private general veterinary practices in the United States, a diagnosis of atopic/allergic dermatitis, allergy, or atopy was made in 8.7% of all dogs and 21.6% of dogs diagnosed with “skin or ear disease” [49]. It is likely that the incidence and prevalence of AD in the dog population will be difficult to establish as many patients with mild disease are managed with symptomatic treatment without a specific diagnosis being made. Furthermore, dogs with bacterial dermatitis, Malassezia dermatitis, or otitis as the major presenting problem may not be recognized by veterinary practitioners as having primary allergic disease. To complicate the matter more, the diagnostic criteria for definitive diagnosis of AD have not been clearly defined.
IV. COURSE OF DISEASE Most dogs with AD develop noticeable clinical signs and pruritus that prompt the owner to seek veterinary attention for their pet between 6 months and 3 years of age [7,39,45,46]. The progression of disease and the extent to which the individual canine patient is affected are highly variable. Some patients exhibit mild skin lesions with low-grade pruritus that are well controlled for many years with intermittent symptomatic treatment, while others could have a rapid progression with secondary skin lesions resulting from severe self-trauma within a few months. In addition, some patients have disease that remains localized while others have progressive disease that eventually affects large areas of the body. In 42 to 75% of dogs with AD, initial clinical signs were seasonal in nature [5,9,40], but they may eventually develop year-round manifestations of disease in the majority of cases [27]. This seasonal nature of canine AD also varies geographically. In a report from one tertiary referral practice at an academic institution in the midwestern United States, 81 of 90 (90%) consecutive cases of AD were presented with nonseasonal disease [50]. By contrast, only 52 of 136 (38%) dogs with AD from a tertiary referral practice at an academic institution in northern California had nonseasonal disease [40]. As pruritus is the hallmark feature of canine AD, it is likely that the variability of severity and progression of skin lesions is associated, at least in part, with the presence or absence of factors that may contribute to pruritus in atopic patients. Such stimuli could include weather factors (temperature, humidity); personal factors (stress, anxiety); allergen levels; the presence of coexistent allergies; secondary bacterial infection; Malassezia dermatitis; and otitis externa. The contribution of secondary infections to clinical signs and pruritus can be clinically significant. It is noted by some authors that some dogs with AD may have resolution of pruritus when secondary bacterial infections are controlled [37,45]. One study reported a 56 to 75% decrease in pruritus in 20 dogs with Malassezia dermatitis after resolution of the yeast infection alone (17 of these dogs had concomitant AD, confirmed or suspected) [51]. The association between AD and other common allergic skin disorders of dogs has yet to be clarified. Flea allergy dermatitis (FAD) is reportedly the most common allergy affecting dogs and was four times as prevalent as any other allergic disorder of dogs in one study involving 14 veterinary
1391_C24.fm Page 356 Wednesday, November 19, 2003 10:41 AM
356
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
teaching hospitals in North America [52]. However, one study from southwestern France (a fleaendemic area) reported that in 449 dogs evaluated, 57% had AD, 8.7% had FAD, and 31% had concomitant AD and FAD [38]. Also, in Florida (a flea-endemic area in the United States) the prevalence of positive intradermal test reactions to flea antigen in 120 dogs with AD was 79% [53], compared to a mere 39% positive reaction in 100 non-AD dogs [54]. These results suggest that dogs with AD are predisposed to developing hypersensitivity to flea salivary antigens. The relationship between AD and hypersensitivity to other arthropods, both biting (such as mosquito, Hymenoptera, black ant, and biting flies) and nonbiting (such as cockroach and moth), remains uncertain. There was no significant difference in the prevalence of intradermal test reactions to insect allergens between dogs with AD and non-AD dogs in one study [55], and the probability of cross-reactive epitopes between the various insect allergens for dogs has also been proposed [56]. Similarly, the relationship between AD and cutaneous adverse food reactions (CAFR) in the dog is also unclear [57–63]. Recent studies report that 3% to 13% of dogs with AD have concurrent CAFR [38–40,51,57]. Others report that 13 to 30% of dogs with CAFR have concurrent AD [59,60]. Such data suggest that a fraction of dogs with AD have concurrent food hypersensitivities that could contribute to the severity of clinical signs. It should be noted that CAFR is currently regarded as a separate disease syndrome in dogs, despite the fact that the clinical signs of canine AD and CAFR are almost identical [61]. The distinction is likely due to the fact that the immunopathogenesis of spontaneous CAFR remains to be clarified. Studies of intradermal test reactions to food allergens and food allergen-specific serum IgE quantitation have found both forms of allergy testing to lack specificity and accuracy [57,62,63], suggesting that spontaneous canine CAFR may not be an IgEmediated disease per se. However, canine models of IgE-mediated food hypersensitivity with the presence of pruritus and skin lesions following oral food allergen challenge have been reported [32–34,64], as well as recent unpublished reports of spontaneous IgE-mediated food allergy in dogs [65,66] The association between AD and the predisposition or presence of concurrent upper and/or lower respiratory allergic inflammation in dogs also has not been established. Although rhinitis and conjunctivitis in dogs with AD have been reported intermittently in dogs with spontaneous AD [5,6,9,10,67,68], two studies failed to identify exacerbation of skin lesions in dogs with AD after intranasal aerosol challenge [68,69]. Further, most canine models of allergic asthma [23–26,70] have also failed to describe the presence of skin lesions or pruritus following aerosol allergen challenge, although a pruritic nonseasonal pedal dermatitis was described in one of these models [71].
V. ASSESSMENT OF DISEASE A. Clinical Manifestation Pruritus is the major clinical sign of canine AD. Pruritus and skin lesions affecting poorly haired locations predominantly characterize the disease. The most frequently affected sites include the face (periocular, muzzle, and chin); ears (concave surface of the pinna and external ear canal); ventral aspects of the trunk (axilla, ventral abdomen, and groin); and distal limbs (including the digits and interdigital areas) (reviewed in Griffin and DeBoer [27]). Any one or more of these locations can be affected. Pruritus and lesions can become generalized in as many as 40% of patients [9,47], although this is more likely to occur when secondary bacterial and Malassezia dermatitis are present. Other body sites reported to be affected include the perineum, the flexural surface of the elbows and hocks, palmar carpal area, and plantar tarsal area [45,46]. The predominant skin lesions seen in these locations of pruritus are secondary and are a reflection of chronic self-trauma, chronic inflammation, and frequent secondary infection. Secondary lesions that have been commonly reported include alopecia; lichenification; hyperpigmentation;
1391_C24.fm Page 357 Wednesday, November 19, 2003 10:41 AM
SPONTANEOUS CANINE MODEL OF ATOPIC DERMATITIS
357
excoriations; red-brown “salivary” staining; dry, lusterless hair coat; and scaling [45,46] (Figures 24.1 to 24.7). The presence of primary lesions in uncomplicated (i.e., without secondary infection or other concurrent primary pruritic dermatoses) AD is unclear. The presence of erythema is generally accepted [27], but the presence of a primary eruption is controversial. Some studies report the presence of a macular to plaque-like eruption [3,45,67] or a papular dermatitis [6], whereas others suggest that there are no primary lesions [5,9,10]. Recent data from house dust-mite environmental challenge of sensitized high-IgE beagles suggest that erythematous macules, patches, and micropapules represent primary lesions of AD in these dogs [31]. Otitis externa is a common presenting problem affecting between 55% and 86% of patients [9,40,72]. Similarly, secondary infections are common in canine AD, with Staphylococcal dermatitis affecting an estimated 68% of dogs with AD [45] and Malassezia dermatitis affecting 38% of dogs with AD [40]. Other manifestations of AD seen infrequently may include acute moist dermatitis (“hotspots” or pyotraumatic dermatitis/folliculitis), acral pruritic nodules, marked seborrhea, and hyperhidrosis (reviewed in Griffin and DeBoer [27]).
Figure 24.1
Periocular alopecia with mild lichenification and hyperpigmentation in a Labrador retriever with atopic dermatitis.
Figure 24.2
Alopecia around the muzzle and on the chin resulting from facial pruritus in a Labrador retriever with atopic dermatitis (same dog presented in Figure 24.1).
1391_C24.fm Page 358 Wednesday, November 19, 2003 10:41 AM
358
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Figure 24.3
Alopecia and patchy hyperpigmentation of the right axillary region in a dog with atopic dermatitis.
Figure 24.4
Severe lichenification, hyperpigmentation, and associated greasy seborrhea of the ventral abdomen, groin, and medial thighs in a German shepherd dog with atopic dermatitis.
Figure 24.5
Mild alopecia resulting from pruritus on the cranial and medial antebrachial aspects of the foreleg of a dog with atopic dermatitis.
1391_C24.fm Page 359 Wednesday, November 19, 2003 10:41 AM
SPONTANEOUS CANINE MODEL OF ATOPIC DERMATITIS
359
Figure 24.6
Patchy alopecia and erythema on the dorsal aspect of the digits of a Dalmatian with atopic dermatitis.
Figure 24.7
Alopecia, lichenification, and hyperpigmentation on the cranial aspect of the carpi and digits of a Doberman pinscher with atopic dermatitis resulting from pruritus of the distal limbs.
B. Histopathological Examination The inflammatory pattern of lesional skin of dogs with AD is characterized by epidermal hyperplasia, spongiosis, and a mixed perivascular inflammatory infiltrate [9,73]. The dermal infiltrate consists mostly of T lymphocytes and dendritic antigen–presenting cells [73,74]. T lymphocytes and Langerhans cells may be observed in the epidermis, with the latter often grouped as microaggregates in the superficial epidermis [73,75]. Mild dermal mast cell hyperplasia has been reported in most studies [9,73,76], but was not present in one report [77]. Similarly, the presence of dermal eosinophils has been reported in low numbers in some studies [73,76], but has been characterized as scarce by others [9,78].
1391_C24.fm Page 360 Wednesday, November 19, 2003 10:41 AM
360
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
C. Biochemical and Immunopathological Data At present, there is limited information on the immunopathogenesis of canine AD compared to the wealth of data provided for its human counterpart. Nevertheless, review of the existing literature provides relevant information on the importance of epidermal and dermal cells. 1. Epidermal Cells A preliminary study [79], using the ruthenium tetroxide electron microscopy technique, documented that stratum corneum lipid lamellae appeared abnormal in lesional skin of several dogs with AD compared to those of normal dogs. Both continuity and thickness of lipid lamellae were decreased significantly compared to those of normal dogs. An abnormal extrusion of lamellar bodies was not found. In contrast, differences between normal and atopic dogs in skin abrasion fluids [80], subcutaneous fat [81], plasma [81], or serum [80,82] fatty acids, have not been observed. A recent abstract provided limited information on ceramide content in the epidermis of normal dogs and dogs with AD [83]. The total amounts of ceramides were not significantly different between normal and atopic canine skin. When the skin was “dry,” however, a lower amount of ceramides was detected in abdominal and caudal skin of dogs with AD. In summary, the presence or absence of a defective epidermal fatty acid-rich lipid barrier in dogs with AD therefore remains uncertain. In lesional skin of dogs with AD, keratinocytes express the adhesion molecule ICAM-1, allowing thus the binding of CD11a-expressing leukocytes to epidermal cells [73]. In lesional skin of dogs with AD, epidermal Langerhans cells (LCs) are hyperplastic and are commonly seen in clusters [75]. IgE-expressing epidermal LCs frequently are seen, especially when clustered [75]. In the epidermis of lesional canine AD skin, epitheliotropic lymphocytes express either ab or gd T-cell receptor (TCR), with CD8+ T cells outnumbering CD4+ T cells [73]. Low numbers of epidermal neutrophils are seen in approximately half of skin sections [73]. Intact and degranulated eosinophils occasionally are detected in subcorneal microabscesses [73]. 2. Dermal Cells Eosinophils are found more often in lesional than nonlesional canine AD skin [73]. Dermal eosinophils commonly exhibit features of activation and degranulation [73]. Neutrophils represent less than 5% of the dermal infiltrate seen in canine lesional AD skin [73]. Mast cell percentages are not significantly different between lesional or nonlesional skin in canine patients with AD [73]. Dermal mast cells express membrane-bound IgE [14,75], and mast cells isolated from canine AD skin exhibit enhanced releasability compared to those from normal canine skin [84]. Dermal mast cells from canine AD secrete chymase and tryptase variably [77]. There are more CD1-positive dendritic cells (DCs) in the dermis of lesional and nonlesional AD skin compared to normal canine skin. Approximately 10% of lesional dermal DCs express membrane IgE [75]. B lymphocytes and mature plasma cells compose less than 1% of dermal cells [73]. Lesional dermal CD3-positive T lymphocytes express the ab TCR ten times more often than the gd TCR [73], and express CD4 more often than CD8 [73,74]. 3. Cytokines and Chemokines There is considerable variation in the cytokine repertoire seen in samples of canine AD skin. Messenger RNA encoding the proinflammatory cytokine TNFa is found at high levels in half of canine AD specimens [85–87]. TNFa protein secretion appears to originate from both epidermal
1391_C24.fm Page 361 Wednesday, November 19, 2003 10:41 AM
SPONTANEOUS CANINE MODEL OF ATOPIC DERMATITIS
361
and dermal cells [85]. Messenger RNA specific for IL1a is detected at high levels in chronic AD skin [87]. The messenger RNAs (mRNAs) coding for T helper cell type-2 (Th2) cytokines (IL-4, IL-5) are more commonly detected in lesional AD skin specimens than in normal skin [85]. The levels of expression are higher in lesional skin than in normal skin [86]. In one study, mRNA for IL-4 was not detected in chronic AD skin [87]. The mRNAs for type-1 cytokines (IL-2, IL-12) are less commonly detected in lesional AD skin than in normal canine skin [85]. The levels of expressions are higher in lesional skin than in normal skin [86]. The mRNA encoding g-interferon is detected variably in canine lesional AD skin, and it is found more often in biopsies from chronic samples [85,87]. The levels of g-interferon can be three to six times higher in lesional AD skin compared to normal skin [86, 87]. The level of TGFb mRNA is higher in normal skin than in lesional AD skin [86]. Stem cell factor, a mast cell growth factor, is secreted in the dermis of lesional and nonlesional canine AD skin [88]. The mRNA encoding thymus and activation-regulated chemokine (TARC, CCL17), a CC chemokine involved in Th2 lymphocyte chemotaxis, is detected in lesional AD but not in nonlesional AD skin [87]. The mRNA coding for the TARC receptor CCR4, specifically expressed on Th2 lymphocytes, can also be detected in lesional canine AD skin [89]. Overall, the immunological changes observed in canine AD skin are remarkably similar to those seen in the skin of human patients with this disease. D. Immunogenetics Although some breed predilections and family histories of AD in dogs have been recognized, only one study to date has evaluated the genetic background of dogs with AD [90]. In this study, there was no significant difference in the gene frequency of various dog leukocyte antigen (DL-A) haplotypes between normal dogs and dogs with AD, although the combination of DL-A3 and R15 was found more frequently in dogs with AD and the haplotype 9,4 was found more frequently in normal dogs. Further, there were no significant differences between the two groups of dogs in serum IgE levels and no relationship between serum IgE levels and DL-A haplotypes was noted. Based on the studies of high–IgE-responder beagles, it has been proposed that the capacity to produce high levels of IgE in response to environmental allergens may be controlled by high–IgEresponse genes and that these genes are inherited in a dominant manner [32]. However, these studies actually define a phenotype characterized by IgE response to allergens without evaluating the genes that control this response.
VI. THERAPEUTIC RESPONSE The treatment of canine AD is multifaceted and involves a combination of anti-inflammatory pharmacotherapy, allergen-specific immunotherapy, allergen avoidance, and antimicrobial agents [91]. A. Anti-Inflammatory Pharmacotherapy An evidence-based review of studies reporting the efficacy of pharmacotherapeutic interventions in the treatment of canine AD has recently been published [92]. There is good evidence for high efficacy of oral glucocorticoids administered at anti-inflammatory doses for the treatment of canine AD [93–98]. Response is generally seen within days of initiation of treatment. Furthermore, there is good evidence for high efficacy of cyclosporine administered at 5.0 mg/kg once daily for the treatment of canine AD [97–99]. Significant reduction of lesions and pruritus is often only
1391_C24.fm Page 362 Wednesday, November 19, 2003 10:41 AM
362
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
appreciated after 2 weeks or more of treatment. In addition, there is fair evidence of high efficacy of topical 0.015% triamcinolone solution spray for the treatment of canine AD [100]. Significant reduction of pruritus was documented after 4 weeks of treatment. Moreover, there is fair evidence of medium efficacy of the first generation sedating type-1 histamine receptor antagonist clemastine [95,101–103] and the combination of chlorpheniramine and hydroxyzine [104]. However, there is insufficient evidence of efficacy of most agents in this group when given alone, including chlorpheniramine, pheniramine, diphenhydramine, hydroxyzine, promethazine, and trimeprazine [93,95,101–103,105]. The efficacy of the second-generation low-sedation type-1 histamine receptor antagonist oxatomide [106–108] seems to be medium; however, there is insufficient evidence of efficacy of terfenadine, astemizole, and loratidine [95,109]. In addition, there is fair evidence for medium efficacy of the prostaglandin analog misoprostol at 5mg/kg three times daily for the treatment of canine AD [110,111]. For phosphodiesterase inhibitors, there is limited evidence of lack of efficacy of papaverine [112], but fair evidence of efficacy of pentoxifylline at 10 mg/kg twice daily [113] and arofylline at 1 mg/kg twice daily [114], although the latter was associated with unacceptable vomiting in 70% of cases. The leukotriene inhibitors or receptor antagonists have been used in the treatment of canine AD with no or very low efficacy [115–118]. There is limited evidence of variable efficacy of the tricyclic antidepressants doxepin (at 10 to 30 mg three times daily) and amitriptyline (at 1 mg/kg twice daily) [95,119]. For nonsteroidal topical agents, there is limited evidence of medium efficacy of pramoxine [120] and capsaicin [121] in the treatment of canine AD. A recent review of studies that have evaluated the usefulness and efficacy of essential fatty acids in the treatment of canine AD concluded that it is unclear if, when, and how essential fatty acids should be recommended as part of the overall management of dogs with AD [122]. Only three randomized clinical trials with a crossover design have been reported [123–125]. Two of these studies assessed the efficacy of omega-6 fatty acid supplementation at 103–128 mg/kg once daily and reported a 17 to 40% improvement in clinical scores [123,124]. One study treated dogs with AD with 66 mg/kg of omega-3 fatty acids and reported 56% of dogs with more than 50% improvement [125]. Unfortunately, no studies have controlled the dietary essential fatty acid intake, a factor that could significantly alter the total intake of omega-6 and omega-3 fatty acids as well as the ratio between these essential fatty acids. Thus, the optimal dose and true potential of essential fatty acids for the treatment of canine AD remains to be clarified. B. Allergen-Specific Immunotherapy A recent review of allergen-specific immunotherapy (ASIT) for the treatment of canine AD [126] concluded that there was an absence of suitably controlled clinical studies of aqueous ASIT for the treatment of canine AD to evaluate its efficacy. However, it was also stated that the overwhelming clinical experience of veterinary dermatologists worldwide provides at least observational evidence of the benefits of ASIT for canine AD. This statement is supported by the recommendations from authors of major textbooks on veterinary dermatology and allergy [45,46,48]. Although ASIT regimens and allergens used in ASIT have not been standardized, an initial loading phase of increasing concentrations of allergens is administered over several weeks to months, followed by a maintenance phase where the maximum allergen concentration (or patientdetermined maximum) is administered on a regular basis with an injection interval of several days to 3 weeks. The results of the several open studies that have been reported suggest that 50 to 100% of dogs receiving ASIT 4 months or longer will experience at least a 50% improvement in their clinical signs (reviewed in Griffin and Hillier [126]).
1391_C24.fm Page 363 Wednesday, November 19, 2003 10:41 AM
SPONTANEOUS CANINE MODEL OF ATOPIC DERMATITIS
363
C. Allergen Avoidance There have been no published studies, open or controlled, to evaluate the potential benefits of allergen avoidance and elimination measures in the control of canine AD. A preliminary study evaluating the clinical effect of environmental control of house dust mites in mite-sensitive dogs found an excellent response (no other treatment needed) in 14 of 20 dogs, with significant decrease of pruritus in 4 of 20 dogs and no effect in 3 of 20 dogs [127].
VII. EXPERT EXPERIENCE AD is considered a differential diagnosis in any dog with pruritus, but it should also be considered in dogs with a primary complaint of recurrent staphylococcal dermatitis, recurrent Malassezia dermatitis, or recurrent otitis externa. As these clinical signs may be associated with numerous other primary diseases, the diagnosis is based on the fulfillment of a constellation of strongly associated clinical criteria along with elimination of other differential diagnoses [128]. The most important diseases that should be considered and ruled out prior to making a clinical diagnosis of AD include: flea allergy dermatitis, cutaneous adverse food reactions, Sarcoptic acariasis, other pruritic mite infestations, staphylococcal dermatitis, and Malassezia dermatitis. Checklists of criteria for the diagnosis of canine AD have been proposed [129,130]. Fulfillment of three of the five criteria suggested in one study [130] resulted in sensitivity and specificity of approximately 80% when used by seven veterinarians in 96 patients. At this time, we suggest that a diagnosis of canine AD should meet all of the following criteria. • Clinical features: pruritus and skin lesions affecting face, ears, ventral trunk (especially axillae and groin), or distal limbs. • Elimination of differential diagnoses: flea allergy dermatitis, cutaneous adverse food reactions, sarcoptic acariasis. • Role of allergy tests: reactions on either intradermal testing or with allergen-specific IgE serology should only be considered as supportive of a diagnosis of AD in dogs, and/or to select allergens for ASIT. Positive tests should not form the basis of the diagnosis.
VIII. LESSONS LEARNED A genetic predisposition for the development of the atopic state and manifesting as AD appears to be an important underlying feature in the dog, and thus provides the “soil” for the development of AD. Multiple flare factors may contribute to the development of clinical signs, with allergens being one of the most important “seeds” acting as a trigger factor for AD. The diagnosis of canine AD is predominantly clinical with a characteristic pattern of pruritus evident in the vast majority of patients. Recent immunopathological studies have highlighted the importance of IgE, and inflammatory cells such as Langerhans cells, T lymphocytes, mast cells, and eosinophils. Emerging evidence supports a very close similarity between the immunopathogenesis of canine and human AD. Although some differences in the clinical phenotype of each species are apparent, the similarities far outweigh these differences. In addition, treatment modalities for canine AD that are the most efficacious are similar to treatments that have been most successful in human AD. The most effective drugs are the inflammatory cell deactivators, including glucocorticoids, cyclosporinex, tacrolimus, PDE inhibitors, and PGE analogs.
1391_C24.fm Page 364 Wednesday, November 19, 2003 10:41 AM
364
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
IX. CONCLUSION Spontaneous AD in the dog has remarkable similarities to AD in humans. In both species, genetic predisposition and an association with IgE-mediated sensitization are key factors in the establishment of AD in most patients. Further, recent identification of the immunopathogenic factors of importance in canine AD are very similar to present knowledge of the immunopathogenesis of AD in humans. Coupled with the fact that the same environmental allergens induce in canine experimental models of AD the immunological and clinical changes consistent with the spontaneous canine AD, it is reasonable to conclude that canine AD provides one of the closest natural models from which to further study human AD.
REFERENCES 1. Wittich, F.W., Spontaneous allergy (atopy) in the lower animal — seasonal hay fever (fall type) in a dog, J. Allergy, 12, 247, 1941. 2. Patterson, R., Investigations of spontaneous hypersensitivity of the dog, J. Allergy, 31, 351, 1960. 3. Rockey, J.H. and Schwartzman, R.M., Skin sensitizing antibodies: a comparative study of canine and human PK and PCA antibodies and a canine myeloma protein, J. Immunol., 98, 1143, 1967. 4. Schwartzman, R.M., Clinical manifestations and treatment of atopy in the dog, Vet. Med./Small Anim. Clin., 63, 1131, 1968. 5. Halliwell, R.E.W. and Schwartzman, R.M., Atopic disease in the dog, Vet. Rec., 89, 209, 1971. 6. Chamberlain, K.W., Atopic (allergic) dermatitis, Vet. Clin. North Am., 4, 29, 1974. 7. Nesbitt, G.H., Canine allergic inhalant dermatitis: a review of 230 cases, J. Am. Vet. Med. Assoc., 172, 55, 1978. 8. Chamberlain, K.W., Clinical signs and diagnosis of atopic disease in the dog, J. Small Anim. Pract., 19, 493, 1978. 9. Scott, D.W., Observations on canine atopy, J. Am. Anim. Hosp. Assoc., 17, 91, 1981. 10. Willemse, A. and van den Brom, W.E., Investigations of the symptomology and the significance of immediate skin test reactivity in canine atopic dermatitis, Res. Vet. Sci., 34, 261, 1983. 11. Schwartzman, R.M., Halliwell, R.E.W., and Rockey, J.H., Canine reaginic antibody. Characterization of the spontaneous anti-ragweed and induced anti-dinitrophenyl reaginic antibodies of the atopic dog, Clin. Exp. Immunol., 9, 549, 1971. 12. Halliwell, R.E.W. et al., Physicochemical properties of canine IgE, Transplant. Proc., 7, 537, 1975. 13. Halliwell, R.E.W. and Schwartzman, R.M., Antigenic relationship between canine and human IgE, Clin. Exp. Immunol., 10, 399, 1972. 14. Halliwell, R.E.W., The localization of IgE in canine skin, J. Immunol., 110, 422, 1973. 15. DeBoer, D.J., Ewing, K.M., and Schultz, K.T., Production and characterization of mouse monoclonal antibodies directed against canine IgE and IgG, Vet. Immunol. Immunopathol., 37, 183, 1993. 16. Peng, Z., Simons, F.E., and Becker, A.B., Measurement of ragweed-specific IgE in canine serum by use of polyclonal and monoclonal antibodies, Am. J. Vet. Res., 54, 239, 1993. 17. Griot-Wenk, M.E. et al., Domain mapping and comparative binding features of eight dog IgE-specific reagents in ELISA, immunoblots, and immunochemistry, Vet. Immunol. Immunopathol., 70, 117, 1999. 18. Gebhard, D. et al., Canine IgE monoclonal antibody specific for a filarial antigen: production by a canine x murine heterohybridoma using B cells from a clinically affected lymph node, Immunology, 85, 429, 1995. 19. Patel, M. et al., Sequence of dog immunoglobulin alpha and epsilon constant region genes, Immunochemistry 41, 282, 1995. 20. Peng, Z. et al., Cross-reactivity and molecular mass of the epsilon chains of the IgE antibodies in dogs, humans, rates and mice, Int. Arch. Allergy Immunol., 110, 149, 1996. 21. Wassom, D.L. and Grieve, R.B., In vitro measurement of allergen-specific IgE for the detection of allergen-specific IgE, Vet. Dermatol., 9, 173, 1998. 22. Stedman, K. et al., Measurement of canine IgE using the alpha chain of the human high affinity IgE receptor, Vet. Immunol. Immunopathol., 78, 349, 2001.
1391_C24.fm Page 365 Wednesday, November 19, 2003 10:41 AM
SPONTANEOUS CANINE MODEL OF ATOPIC DERMATITIS
365
23. Gold, W.M. et al., Pulmonary physiologic abnormalities in experimental asthma in dogs, J. Appl. Physiol., 33, 496, 1972. 24. Patterson, R. et al., Airway response of dogs with ragweed and Ascaris hypersensitivity, Chest, 65, 488, 1974. 25. Hirschman, C.A., Malley, A., and Downes, H., Basenji-Greyhound dog model of asthma: reactivity to Ascaris suum, citric acid and metacholine, J. Appl. Physiol., 49, 953, 1980. 26. Peters, J.E., Hirschman, C.A., and Malley, A., The Basenji-Greyhound model of asthma: leukocyte histamine release, serum IgE and airway response to inhaled antigen, J. Immunol., 129, 1245, 1982. 27. Griffin, C.E. and DeBoer, D.J., The ACVD task force on canine atopic dermatitis (XIV): clinical manifestations of canine atopic dermatitis, Vet. Immunol. Immunopathol., 81, 255, 2001. 28. Olivry, T. and Hill, P.B., The ACVD task force on canine atopic dermatitis (IX): the controversy surrounding the route of allergen challenge in canine atopic dermatitis, Vet. Immunol. Immunopathol., 81, 219, 2001. 29. McCall, C., Geoly, F., and Clarke, K.B., Transdermal allergen exposure in genetically high IgE Beagle puppies elicits allergen-specific IgE and dermatitis at the site of exposure, Vet. Dermatol., 12 (Abstr.), 234, 2001. 30. Olivry, T. et al., Histologic and immunohistochemical characterization of “atopy patch tests” in IgE hyperresponsive Beagles: a pilot study, Vet. Dermatol., 12 (Abstr.), 235, 2001. 31. Marsella R. et al., A model for canine atopic dermatitis: induction of dermatitis in IgE hyperresponsive Beagle dogs after house dust mite challenge, in Proc. Am. Acad. Vet. Dermatol. Am. Coll. Vet. Dermatol., 19, 206, 2003. 32. de Weck, A.L. et al., Dog allergy, a model for allergy genetics, Int. Arch. Allergy Immunol., 113, 55, 1997. 33. Ermel, R.W. et al., The atopic dog: a model for food allergy, Lab. Anim. Sci., 47, 40, 1997. 34. Olson, M.E. et al., Hypersensitivity reactions to dietary antigens in atopic dogs, in Recent Advances in Canine and Feline Nutrition, Vol. 3, Reinhart, G.A. and Carey, D.P., Eds., Orange Frazer Press, Wilmington, OH, 2000, p. 69. 35. Zunic, M. et al., Studies of atopy in genetically high IgE responder Beagles, in Proc. Am. Acad. Vet. Dermatol. Am. Coll. Vet. Dermatol., 14, 53, 1998. 36. Sousa, C.A. and Marsella, R., The ACVD task force on canine atopic dermatitis (II): genetic factors, Vet. Immunol. Immunopathol., 81, 153, 2001. 37. Halliwell, R.E.W. and Gorman, N.T., Veterinary Clinical Immunology, W.B. Saunders, Philadelphia, 1989, p. 232. 38. Carlotti, D.N. and Costargent, F., Analysis of positive skin tests in 449 dogs with atopic dermatitis, Eur. J. Comp. Anim. Pract., 4, 42, 1994. 39. Saridomichelakis, M.N. and Koutinas, A.F., Observations on canine atopy in Greece: a study of 84 clinical cases, in Advances in Veterinary Dermatology, Vol. 4, Kwochka, K.W., Willemse, T., and von Tscharner, C., Eds., Butterworth-Heinemann, Oxford, 1998, p. 504. 40. Zur, G. et al., Canine atopic dermatitis: a retrospective study of 266 cases examined at the University of California, Davis, 1992-1998. Part I. Clinical features and allergy testing results, Vet. Dermatol., 13, 89, 2002. 41. Zunic, M et al., Studies of atopy in genetically high IgE responder Beagles, in Proc. Ann. Meet. Am. Acad. Vet. Dermatol./Am. Coll. Vet. Dermatol., 14, (Abstr.) 53, 1998. 42. Schwartzman, R.M. et al., The atopic dog model: report of an attempt to establish a dog model, Int. Arch. Allergy Appl. Immunol.,72, 97, 1983. 43. Schwartzman, R.M., Immunologic studies of progeny of atopic dogs, Am. J. Vet. Res., 45, 375, 1984. 44. DeBoer, D.J. and Hill, P.B., Serum immunoglobulin E concentrations in West Highland White Terrier puppies did not predict development of atopic dermatitis, Vet. Dermatol., 10, 275, 1999. 45. Griffin, C.E., Canine atopic dermatitis, in Current Veterinary Dermatology, The Science and Art of Therapy, Griffin, C.E., Kwochka, K.W., and MacDonald, J., Eds., Mosby Year Book, St. Louis, 1993, p. 99. 46. Scott, D.W., Miller, W.H., and Griffin, C.E., Muller and Kirk’s Small Animal Dermatology, 6th ed., W.B. Saunders, Philadelphia, 2001. 47. Nesbitt, G.H., Kedan, G.S., and Caciolo, P., Canine atopy. Part 1. Etiology and diagnosis, Comp. Cont. Educ. Pract. Vet., 6, 73, 1984.
1391_C24.fm Page 366 Wednesday, November 19, 2003 10:41 AM
366
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
48. Reedy, L.M., Miller, W.H., and Willemse, T, Allergic Skin Diseases of the Dog and Cat, 2nd ed., W.B. Saunders, London, 1997. 49. Lund, E.M. et al., Health status and population characteristics of dogs and cats examined at private veterinary practices in the United States, J. Am. Vet. Med. Assoc., 214, 1336, 1999. 50. Hillier, A., Kwochka, K.W., and Pinchbeck, L.R., Reactivity to intradermal injection of extracts of Dermatophagoides farinae, Dermatophagoides pteronyssinus, house dust mite mix, and house dust in dogs suspected to have atopic dermatitis: 115 cases (1996-1998), J. Am. Vet. Med. Assoc., 217, 536, 2000. 51. Pinchbeck, L.R. et al., Comparison of pulse administration versus once daily administration of itraconazole for the treatment of Malassezia pachydermatis dermatitis and otitis in dogs, J. Am. Vet. Med. Assoc., 220, 1807, 2002. 52. Sischo, W.M., Ihrke, P.J., and Franti, C.E., Regional distribution of 10 common skin diseases in dogs, J. Am. Vet. Med. Assoc., 195, 752, 1989. 53. Schick. R.O. and Fadok, V.A., Response of atopic dogs to regional allergens: 268 cases (1981-1984), J. Am. Vet. Med. Assoc., 189, 1493, 1986. 54. Halliwell, R.E.W., Preston, J.F., and Nesbitt, J.G., Aspects of the immunopathogenesis of flea allergy dermatitis in dogs, Vet. Immunol. Immunopathol., 17, 483, 1987. 55. Willis, E.L. et al., Intradermal reactivity to various insect and arachnid allergens among dogs from the southeastern United States, J. Am. Vet. Med. Assoc., 209, 1431, 1996. 56. Pucheu-Haston, C.M. et al., Allergenic cross-reactivities in flea-reactive canine serum samples, Am. J. Vet. Res., 57, 1000, 1996. 57. Kunkle, G.A. and Horner, S., Validity of skin testing in diagnosing food allergy in dogs, J. Am. Vet. Med. Assoc., 200, 677, 1992. 58. White, S.D., Food hypersensitivity in the dog: 30 cases, J. Am. Vet. Med. Assoc., 188, 695, 1986. 59. Carlotti, D.N., Remy, I, and Prost, C., Food allergy in dogs and cats: a review of 43 cases, Vet. Dermatol., 1, 51, 1990. 60. Rosser, E.J., Diagnosis of food allergy in dogs, J. Am. Vet. Med. Assoc., 203, 259, 1993. 61. Hillier, A. and Griffin, C.E., The ACVD task force on canine atopic dermatitis (X): is there a relationship between canine atopic dermatitis and cutaneous adverse food reactions? Vet. Immunol. Immunopathol., 81, 227, 2001. 62. Jeffers, J.G., Shanley, K.J., and Meyer, E.K., Diagnostic testing of dogs for food hypersensitivity, J. Am. Vet. Med. Assoc., 198, 245, 1991. 63. Mueller, R. and Tsohalis, J., Evaluation of serum allergen-specific IgE for the diagnosis of food adverse reactions in the dog, Vet. Dermatol., 9, 167, 1998. 64. Guildford, W.G., Experimental studies of gastrointestinal ischemia, reperfusion injury and food sensitivity in dogs, Ph.D. thesis, University of California-Davis, 1989. 65. Ishida, R. et al., In vivo and in vitro evidence of type I hypersensitivity to food allergens in atopic dogs, Vet. Dermatol., 11 (Abstr.), 32, 2000. 66. Jackson, H.A., Cates, C., and Hammerberg, B., Total and allergen specific serum and fecal IgE responses to dietary changes in dogs with suspected food hypersensitivity, Vet. Dermatol., 11 (Abstr.), 33, 2000. 67. Criep, L.H., Allergy in veterinary medicine, Vet. Med. Small Anim. Clin., 63, 855, 1968. 68. Willemse, A., Canine atopic disease: investigations of eosinophils and the nasal mucosa, Am. J. Vet. Res., 45, 1867, 1984. 69. Helton-Rhodes, K. et al., Investigation into the immunopathogenesis of canine atopy, Semin. Vet. Med. Surg. Small Anim., 2, 199, 1987. 70. Turner, N.C., Fuller, R.W., and Jackson, D.M., Eicosanoid release in allergen-induced bronchoconstriction in dogs: its relationship to airway hyperreactivity and pulmonary inflammation, J. Lipid Mediating Cell, 11, 93, 1995. 71. Butler, J.M. et al., Pruritic dermatitis in Basenji-Greyhound dogs: a model for human atopic dermatitis, J. Am. Acad. Dermatol., 8, 33, 1983. 72. Muse, R., Griffin, C.E., and Rosenkrantz, W.S., The prevalence of otic manifestations and otitis externa in allergic dogs, in Proc. Ann. Meet. Amer. Acad. Vet. Derm. Am. Coll. Vet. Derm., 12, (Abstr.) 33, 1996. 73. Olivry, T., Naydan, D.K., and Moore, P.F., Characterization of the cutaneous inflammatory infiltrate in canine atopic dermatitis, Am. J. Dermatopathol., 19, 477, 1997.
1391_C24.fm Page 367 Wednesday, November 19, 2003 10:41 AM
SPONTANEOUS CANINE MODEL OF ATOPIC DERMATITIS
367
74. Sinke, J.D. et al., Immunophenotyping of skin-infiltrating T-cell subsets in dogs with atopic dermatitis, Vet. Immunol. Immunopathol., 57, 13, 1997. 75. Olivry, T et al., Langerhans cell hyperplasia and IgE expression in canine atopic dermatitis, Arch. Dermatol. Res., 288, 579, 1996. 76. Nimmo Wilkie, J.S. et al., Morphometric analysis of the skin of dogs with atopic dermatitis and correlations with cutaneous and plasma histamine and total serum IgE, Vet. Pathol., 27, 179, 1990. 77. Welle, M.M. et al., Mast cell density and subtypes in the skin of dogs with atopic dermatitis, J. Comp. Pathol., 120, 187, 1999. 78. Gross, T.L., Ihrke, P.J., and Walder E.J., in Veterinary dermatopathology: a macroscopic and microscopic evaluation of canine and feline skin diseases, Mosby Year Book, St. Louis, 1992, p. 114. 79. Inman, A.O. et al., Electron microscopic observations of the stratum corneum intercellular lipids in normal and atopic dogs, Vet. Pathol., 38, 720, 2001. 80. White, P.D., Evaluation of serum and cutaneous essential fatty acid profiles in normal, atopic and seborrheic dogs, in Proc. Ann. Meet. Am. Acad. Vet. Dermatol./Am. Coll. Vet. Dermatol., 6, (Abstr.), 37, 1990. 81. Taugbol, O., Baddaky-Taugbol, B., and Saarem, K., The fatty acid profile of subcutaneous fat and blood plasma in pruritic dogs and dogs without skin problems, Can. J. Vet. Res., 62, 275, 1998. 82. Saevik, B.K., Thoresen, S.I., and Taugbol, O., Fatty acid composition of serum lipids in atopic and healthy dogs, Res. Vet. Sci., 73, 153, 2002. 83. Segiguchi, M., Ikeno, K., and Iwasaki, T., Ceramides in keratin layer of normal and atopic dogs, in Proc. Am. Acad. Vet. Dermatol. Am. Coll. Vet. Dermatol., 19, (Abstr.), 235, 2003. 84. DeMora, F. et al., Skin mast cell releasability in dogs with atopic dermatitis, Inflamm. Res., 45, 424, 1996. 85. Olivry, T. et al., Toward a canine model of atopic dermatitis: amplification of cytokine-gene transcripts in the skin of atopic dogs, Exp. Dermatol., 8, 204, 1999. 86. Nuttall, T. et al., Expression of Th1, Th2 and immunosuppressive cytokine gene transcripts in canine atopic dermatitis, Clin. Exp. Allergy, 32, 789, 2002. 87. Maeda, S. et al., Lesional expression of thymus and activation-regulated chemokine in canine atopic dermatitis, Vet. Immunol. Immunopathol., 88, 79, 2002. 88. Hammerberg, B., Olivry, T., and Orton, S.M., Skin mast cell histamine release following stem cell factor and high-affinity immunoglobulin E receptor cross-linking in dogs with atopic dermatitis, Vet. Dermatol., 12, 339, 2001. 89. Maeda, S. et al., Expression of CC chemokine receptor 4 (CCR4) mRNA in canine atopic skin lesion, Vet. Immunol. Immunopathol., 90, 145, 2002. 90. Vriesendorp, H.M. et al., Serological DL-A typing of normal and atopic dogs, Transplant. Proc., 7, 375, 1975. 91. Olivry, T. and Sousa, C.A., The ACVD task force on canine atopic dermatitis (XIX): general principles of therapy, Vet. Immunol. Immunopathol., 81, 311, 2001. 92. Olivry, T., Mueller, R.S., and the International Task Force on Canine Atopic Dermatitis. Evidencebased veterinary dermatology: a systemic review of the pharmacotherapy of canine atopic dermatitis, Vet. Dermatol., 14, 121, 2003. 93. Reddy, N.R.J. et al., Therapeutic evaluation of pheneramine maleate and prednisolone as antipruritic agents in dogs, Indian Vet. J., 69, 259, 1992. 94. Guaguère, E., Lasvergeres, F., and Arfi, L., Efficacy of oral methylprednisolone in the symptomatic treatment of allergic dermatitis, Pratique Médicale et Chirurgicale de L' Animal de Compagnie 31, 171, 1996 (in French). 95. Paradis, M., Scott, D.W., and Giroux, D., Further investigations on the use of nonsteroidal and steroidal anti-inflammatory agents in the management of canine pruritus, J. Am. An. Hosp. Assoc., 27, 44, 1991. 96. Ferrer, L. et al., Clinical anti-inflammatory efficacy of arofylline, a new selective phosphodiesterase4 inhibitor, in dogs with atopic dermatitis, Vet. Rec., 145, 191, 1999. 97. Olivry, T. et al., Cyclosporine decreases skin lesions and pruritus in dogs with atopic dermatitis: a blinded randomized prednisolone-controlled trial, Vet. Dermatol., 13, 77, 2002. 98. Steffan, J. et al., Comparison of cyclosporine A with methylprednisolone for treatment of canine atopic dermatitis: a parallel blinded randomized controlled trial, Vet. Dermatol., 14, 11, 2003.
1391_C24.fm Page 368 Wednesday, November 19, 2003 10:41 AM
368
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
99. Olivry, T. et al., Randomized controlled trial of the efficacy of cyclosporine in the treatment of atopic dermatitis in dogs, J. Am. Vet. Med. Assoc., 221, 370, 2002. 100. DeBoer, D. J. et al., Multiple-center study of reduced-concentration triamcinolone topical solution for the treatment of dogs with known or suspected allergic pruritus, Am. J. Vet. Res., 63, 408, 2002. 101. Paradis, M., Lemay, S., and Scott, D.W., The efficacy of clemastine (Tavist), a fatty acid-containing product (Derm Caps), and the combination of both products in the management of canine pruritus, Vet. Dermatol., 2, 17, 1991. 102. Miller, W.H., Scott, D.W., and Wellington, J.R., A clinical trial on the efficacy of clemastine in the management of allergic pruritus in dogs, Can. Vet. J., 34, 25, 1993. 103. Paterson, S., Additive benefits of EFAs in dogs with atopic dermatitis after partial response to antihistamine therapy, J. Small Anim. Pract., 36, 389, 1995. 104. Umesh, K.G., Rajeevalochan, S., and Ravindra, S.L., Evaluation of terfenadine and hydroxyzine as antipruritic agents in dogs, Indian Vet. J., 75, 345, 1998. 105. Scott, D.W. and Buerger, R.G., Nonsteroidal anti-inflammatory agents in the management of canine pruritus, J. Am. Anim. Hosp. Assoc., 24, 425, 1988. 106. Yoxall, A.T., A clinical trial of oxatomide in canine atopic dermatitis. Trends Vet.Pharm. Tox., 6, 348, 1980. 107. Hayasaki, M. et al., Evaluation of anti-allergic drugs for canine allergic dermatitis, J. Jap. Vet. Med. Assoc., 47, 29, 1994 (in Japanese). 108. Heripret, D., Oxatomide (Tinset ND), the value of this antihistamine in canine allergology field: results of an open study (136 cases), Pratique Medicale et Chirurgicale de L Animal de Compagnie 31, 51, 1996 (in French). 109. Paradis, M., Nonsteroidal antipruritic drugs in dogs and cats: an update. Bull. Can. Acad. Vet. Dermatol., 3, 1996. 110. Olivry, T., Guaguère, E., and Héripret, D., Treatment of canine atopic dermatitis with the prostaglandin E1 analog misoprostol: an open study, J. Dermatol. Treat., 8, 243, 1997. 111. Olivry, T. et al., A randomized controlled trial of misoprostol monotherapy for canine atopic dermatitis: effects on dermal cellularity and cutaneous tumor necrosis factor-alpha, Vet. Dermatol., 14, 37, 2003. 112. Scott, D.W. and Cayatte, S.M., Failure of papaverine hydrochloride and doxycycline hyclate as antipruritic agents in pruritic dogs: results of an open clinical trial, Can. Vet. J., 34, 164, 1993. 113. Marsella, R. and Nicklin, C.F., Double-blinded cross-over study on the efficacy of pentoxifylline for canine atopy, Vet. Dermatol., 11, 255, 2000. 114. Ferrer, L. et al., Clinical anti-inflammatory efficacy of arofylline, a new selective phosphodiesterase4 inhibitor, in dogs with atopic dermatitis, Vet. Rec., 145, 191, 1999. 115. DeBoer, D.J., Moriello, K.A., and Pollet, R.A., Inability of a short duration treatment with a lipoxygenase inhibitor to reduce clinical signs of canine atopy, Vet. Dermatol., 5, 13, 1994. 116. Crow, D.W., Marsella, R., and Nicklin, C.F., Double-blinded, placebo-controlled, cross-over pilot study on the efficacy of zileuton for canine atopic dermatitis, Vet. Dermatol., 12, 189, 2001. 117. Senter, D.A., Scott, D.W., and Miller, W.H., Jr., Treatment of canine atopic dermatitis with zafirlukast, a leukotriene-receptor antagonist: a single-blinded, placebo-controlled study, Can. Vet. J., 43, 203, 2002. 118. Thomsen, M.K., Kristensen, F., and Elling, F., Species specificity in the generation of eicosanoids: emphasis on leukocyte-activating factors in the skin of allergic dogs and humans, in Advances in Veterinary Dermatology, Vol. 2, Ihrke, P.J., Mason, I.S., White, S.D., Eds., Pergamon Press, Oxford, 1993, p. 63. 119. Miller, W.H., Scott, D.W., and Wellington, J.R., Nonsteroidal management of canine pruritus with amitriptyline, Cornell Vet., 82, 53, 1992. 120. Scott, D.W., Rothstein, E., and Miller, W.H., A clinical study on the efficacy of two commercial veterinary pramoxine cream rinses in the management of pruritus in atopic dogs, Can. Pract., 25,15, 2000. 121. Marsella, R., Nicklin, C.F., and Melloy, C., The effects of capsaicin topical therapy in dogs with atopic dermatitis: a randomized, double-blinded, placebo-controlled, cross-over clinical trial, Vet. Dermatol., 13, 131, 2002. 122. Olivry, T., Marsella, R., and Hillier, A., The ACVD task force on canine atopic dermatitis (XXIII): are essential fatty acids effective? Vet. Immunol. Immunopathol., 81, 347, 2001.
1391_C24.fm Page 369 Wednesday, November 19, 2003 10:41 AM
SPONTANEOUS CANINE MODEL OF ATOPIC DERMATITIS
369
123. Scarff, D.H. and Lloyd, D.H., Double-blind, placebo-controlled crossover study of evening primrose oil in the treatment of canine atopy, Vet. Rec., 134, 97, 1992. 124. Sture, G.H. and Lloyd, D.H., Canine atopic disease: therapeutic use of a an evening primrose oil and fish-oil combination, Vet. Rec., 137, 169, 1995 125. Logas, D. and Kunkle, G.A., Double-blinded crossover study with marine oil supplementation containing high-dose eicosapentaenoic acid for the treatment of canine pruritic skin disease, Vet. Dermatol., 5, 99, 1994. 126. Griffin, C.E. and Hillier, A., The ACVD task force on canine atopic dermatitis (XXIV): allergenspecific immunotherapy, Vet. Immunol. Immunopathol., 81, 363, 2001. 127. Swinnen, C. and Vroom, M., The clinical effect of environmental control of house dust mites in house dust mite sensitive dogs, in Proc. Ann. Meet. Am. Acad. Vet. Dermatol./Am. Coll. Vet. Dermatol., 18, (Abstr.), 27, 2002. 128. DeBoer, D.J. and Hillier, A., The ACVD task force on canine atopic dermatitis (XV): fundamental concepts in clinical diagnosis, Vet. Immunol. Immunopathol., 81, 271, 2001. 129. Willemse, T., Atopic skin disease: a review and reconsideration of diagnostic criteria, J. Small Anim. Pract., 27, 771, 1986. 130. Prélaud, P. et al., Reevaluation of diagnostic criteria of canine atopic dermatitis, Rev. Med. Vet., 149, 1057, 1998.
1391_C24.fm Page 370 Wednesday, November 19, 2003 10:41 AM
1391_C25.fm Page 371 Tuesday, November 18, 2003 5:36 PM
CHAPTER
25
Spontaneous Mouse Model of Atopic Dermatitis in NC/Nga Mice Keiko Kawamoto and Hiroshi Matsuda
CONTENTS I. History ................................................................................................................................372 II. Epidemiology .....................................................................................................................372 A. Sex and Age...............................................................................................................372 B. Environmental Factors ...............................................................................................372 C. Genetic Factors ..........................................................................................................373 III. Course of Disease ..............................................................................................................374 IV. Assessment of Disease.......................................................................................................374 A. Clinical Manifestation ...............................................................................................374 B. Histopathological Examination .................................................................................375 C. Immunopathological Features ...................................................................................376 D. Immunogenetics.........................................................................................................378 V. Therapeutic Responses.......................................................................................................378 A. Steroids ......................................................................................................................378 B. Tacrolimus..................................................................................................................379 C. Cytokines ...................................................................................................................379 D. Chymase Inhibitor .....................................................................................................380 E. Diet Manipulation......................................................................................................380 VI. Skin Barrier Abnormalities ................................................................................................381 VII. Expert Experience ..............................................................................................................381 VIII. Comparison with Human AD ............................................................................................382 IX. Conclusion..........................................................................................................................384 References ......................................................................................................................................384
Human atopic dermatitis (AD), one of most common skin diseases, shows a chronic inflammation with intense pruritus and typically distributed eczematous skin lesions. Although it is difficult to identify exactly how many people are affected by AD, an estimated 10 to 20% of infants and young children are affected in industrial countries and its prevalence has increased over the last 3 decades. The exact cause of AD is still unknown, but the disease seems to result from a combination 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
371
1391_C25.fm Page 372 Tuesday, November 18, 2003 5:36 PM
372
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
of genetic and environmental factors with immunological consequences. Recently, we have demonstrated that inbred NC/Nga mice provide a good animal model for human AD. When NC/Nga mice are raised in specific pathogen-free (SPF) circumstances, they exhibit no clinical signs and remain healthy. On the other hand, when raised in air-uncontrolled nonsterile circumstances, they spontaneously present pruritic dermatitis with marked elevation of plasma IgE. Since our first report introducing NC/Nga mice as an atopic animal model in 1997, the number of research studies using this strain has increased steadily. In this chapter, we focus on the clinical, histological, and immunological features of spontaneous skin lesions developed in NC/Nga mice, which closely resemble human AD. The goal of this chapter is to provide current information of this model from the published literature with regard to the etiology and pathogenesis of human AD, such as responsible genetic loci and immunological and biochemical abnormalities, as well as evaluation of new therapeutic targets.
I. HISTORY NC/Nga mice were established in 1957 as an inbred strain originated from Japanese fancy mice called Nishiki Nezumi (“nezumi” means mouse in Japanese) by K. Kondo at Nagoya University [1]. The strain name “NC” comes from Nishiki and its “cinnamon” coat color (genotype is C/C, s/s, A/A, b/b). At first, NC/Nga mice were considered to be a model for autoimmune diseases because of its spontaneous production of autoantibodies, high levels of C4, and a positive response to a Coombs’ test [2]. Some Japanese researchers found that skin inflammation frequently occurred in NC/Nga mice, but the pathogenesis remained unclear. Besides the development of dermatitis, NC/Nga mice show a high susceptibility to x-rays and to anaphylactic shock induced by a low dose of ovalbumin and glomerulonephritis in late life [3,4]. Thereafter, the number of reports on this strain declined, and reproduction was reduced. In 1995, we had a chance to obtain NC/Nga mice, and noticed their frequent scratching behavior due to severe itching and characteristic eczematous lesions of the neck and back skin. We discovered that the skin lesions were clinically and histologically very similar to those of human AD [5]. Substrains of NC/Nga mice include NC/NgaCrj, NC/NgaTnd, NC/jic, and NC/kuj, and some are commercially available.
II. EPIDEMIOLOGY A. Sex and Age AD-like skin lesions spontaneously occur in both male and female NC/Nga mice maintained under nonsterile conventional circumstances but not under SPF circumstances (Figure 25.1). The onset of the disease and the severity of clinical symptoms are substantially the same for male and female mice. Pregnant mice kept in the conventional conditions have been reported to show lesssevere skin inflammation [6]. When NC/Nga mice are raised in a nonsterile, air-uncontrolled room, AD-like dermatitis usually develops at 8 to 10 weeks old [5]. However, we have no precise evidence to show when the dermatitis is triggered pathogenically. Adult NC/Nga mice maintained in the SPF conditions exhibit delayed onset of the disease and mild dermatitis even when NC/Nga mice are moved to a conventional room. B. Environmental Factors Epidemiological studies suggest that genetic and environmental factors interact to determine disease susceptibility and expression of human AD. Unlike SPF NC/Nga mice, NC/Nga mice raised in conventional conditions present pruritic dermatitis. Age-matched BALB/c or C57BL/6 mice,
1391_C25.fm Page 373 Tuesday, November 18, 2003 5:36 PM
SPONTANEOUS MOUSE MODEL OF ATOPIC DERMATITIS IN NC/NGA MICE
Figure 25.1
373
AD-like skin lesions of NC/Nga mice raised in conventional circumstances. 17-week-old mice manifest eczematous dermatitis on face, ears, and back skin.
which are kept with affected NC/Nga mice in the same cage for several months under conventional conditions, exhibit no clinical signs and symptoms, suggesting that the dermatitis in NC/Nga mice is not due to infectious or contagious factors [5]. These findings indicate that certain genetic and environmental factors contribute to development of the dermatitis in NC/Nga mice. Although hypersensitivity to some environmental factors trigger dermatitis, the precise factors remain unclear. In human subjects, the onset and progression of AD may involve aeroallergens such as house dust mites and air pollutants. Mice maintained in conventional circumstances are often infected with Mycoptes musculinus, mouse fur mites, which provokes AD-like dermatitis in NC/Kuj mice but not in BALB/c mice or C57BL/6 mice [7,8]. The skin lesions of NC/Nga mice raised in a conventional room are improved when the mice are kept in a cage covered by a hood equipped with a high-efficiency particulate air filter (H.M. et al., unpublished data, 1998), suggesting that aeroallergens are the principal antigens involved in the pathogenesis of dermatitis in NC/Nga mice. The skin lesions of AD patients are frequently infected with Staphylococcus aureus [9], which are common in conventional circumstances, implying that bacterial factors may be involved in aggravation of dermatitis in NC/Nga mice. C. Genetic Factors In general, AD patients often have a family history of atopic diseases such as asthma and hay fever, and studies of identical twins demonstrate that the genetic contribution is substantial [10,11]. The dermatitis observed in NC/Nga mice seems to have some type of genetic predisposition. We attempted to identify major gene(s) responsible for dermatitis in NC/Nga mice, and studied the pattern of inheritance of dermatitis. We reciprocally paired NC/Nga mice with BALB/c mice to generate F1 progeny, and subsequently bred F2 and backcross (N2) generations. The offspring were classified according to clinical symptoms of dermatitis such as itching, erythema/hemorrhage, edema, and excoriation/erosion. As shown in Table 25.1, no F1 mice manifested AD-like skin lesions, and there was no difference in clinical skin severity between the reciprocal matings [12]. In addition, the segregation ratio of normal and affected mice in the F2 progeny was almost 3:1 because the number of mice with or without dermatitis was 232 and 89, respectively, which was the typical Mendelian segregation ratio [12]. Thus, it seems that the mode of inheritance of dermatitis is an autosomal recessive inheritance. We have proposed the genetic symbol derm for the responsible locus. Recently, Kohara et al. [13] carried out a linkage disequilibrium analysis and identified that a major determinant quantitative-trait loci contributing to AD-like dermatitis in NC/Nga mice was located on chromosome 9, which was designated derm1. The derm1 region on mouse chromosome 9 corresponds to chromosome 11q22.2-23.3 and 15q21-25 in humans. From the NCBI genome
1391_C25.fm Page 374 Tuesday, November 18, 2003 5:36 PM
374
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Table 25.1 Prevalence of Dermatitis in F1, F2, and N2 Offspring between BALB/c and NC/Nga Mice Mating Pairs Generation
Mating Pair (F ¥ M)
F1
BALB/c ¥ NC/Nga NC/Nga ¥ BALB/c
F2 N2
Prevalence of Dermatitis (No. of Affected Mice/No. of Offspring)
NC/Nga ¥ F1 F1 ¥ NC/Nga
0/89 0/98 89/321 79/162 13/35
database, seven functional candidate genes are located near the derm1 locus: Thy1, Cd3d, Cd3e, Cd3g, IL10ra, IL18, and Csk. Interestingly, those candidates are involved in regulating T-cell functions. Since Csk locates closest to the derm1 locus, it appears to be a prime candidate gene responsible for AD-like skin lesions in NC/Nga mice.
III. COURSE OF DISEASE SPF NC/Nga mice maintained in a laminar filter–air flow enclosure in a bioclean room do not show any clinical signs and symptoms. In contrast, NC/Nga mice raised in nonsterile conventional conditions manifest AD-like skin lesions from 8 weeks of age (Figure 25.2). The first clinical sign is scratching behavior beginning from 6 to 8 weeks of age, and coarse fur and eczema subsequently appear at the early stage of the course of the disease. Plasma levels of total IgE rapidly start to increase around this age (Figure 25.2). Within the next 2 to 3 weeks, the eczematous lesions rapidly develop on the face, ear, neck, and dorsal skin, which consist of erythema, hemorrhage, edema, superficial erosion and deep excoriation, and alopecia. Many affected mice show retarded growth. Although individual mice have slightly different patterns of dermatitis, these symptoms become severe with aging, and peak at around 17 weeks of age. In severe cases, deep erosion of auricles, blepharitis, and ophthalmitis are often observed, which may result from marked scratching due to persisting pruritus. During the course of the disease, remission and aggravation are repeated, and the skin lesions include thickening and lichenification. Remission of the dermatitis is occasionally observed in older mice aged more than six months.
IV. ASSESSMENT OF DISEASE A. Clinical Manifestation Since mice kept in air-regulated SPF conditions show no clinical signs of dermatitis, it is apparent that certain environmental factors are critical to induce dermatitis in NC/Nga mice. Dermatitis of NC/Nga mice is characterized by intense itching and chronic relapsing skin inflammation, which occurs spontaneously under conventional circumstances. To evaluate the skin lesions of NC/Nga mice, clinical severity of the dermatitis was scored by macroscopic diagnostic criteria for human AD as described previously with a slight modification [5,14]. Clinical skin conditions were macroscopically scored once a week with the following criteria. Clinical severity was expressed as the sum of the individual scores graded as 0 (none), 1 (mild), 2 (moderate), and 3 (severe) for each five symptoms (itching, erythema/hemorrhage, edema, excoriation/erosion, and scaling/dryness). As shown in Figure 25.2, the severity of dermatitis in NC/Nga mice maintained under conventional circumstances is increased with aging, and reaches the maximum level at 17 weeks old, whereas the mice maintained under SPF conditions showed no clinical manifestations [5].
1391_C25.fm Page 375 Tuesday, November 18, 2003 5:36 PM
15
80
12
60 lgE (µg/ml)
Clinical skin severity scores
SPONTANEOUS MOUSE MODEL OF ATOPIC DERMATITIS IN NC/NGA MICE
9 6
40
20
3 0
0 6
8
10 12
14 16
Weeks of age Figure 25.2
375
18
6
8
10 12
14 16
18
Weeks of age
Clinical severity scores of the dermatitis (left) and plasma levels of total IgE (right) in NC/Nga mice (closed circles) and BALB/c mice (open circles). Clinical scores were defined once a week as the sum of the individual score graded as 0 (none), 1 (mild), 2 (moderate), and 3 (severe) for each of five symptoms (itch, erythema/hemorrhage, edema, excoriation/erosion, and scaling/dryness) as described briefly with a slight modification [14]. Blood was collected from the retro-orbital plexus of mice once a week. Plasma levels of total IgE were determined by a sandwich ELISA.
The advantage of a NC/Nga mice model is that dermatitis is spontaneously induced in conventional circumstances without special or difficult manipulation. However, conditions of “conventional” animal rooms vary with each facility, which means that the prevalence and severity of spontaneous dermatitis of NC/Nga mice might depend on aspects of the circumstances where they are maintained. Since the development of AD involves a variety of antigens (Ag)/allergens, analyzing the pathogenesis of the disease is difficult. To experimentally induce AD-like skin lesions, SPF NC/Nga mice raised in air-regulated conditions are topically challenged with mite Ag, which is considered to be the major environmental factor in human AD. Intradermal injection of mite Ag extract into the ear of SPF NC/Nga mice successfully induces dermatitis clinically and immunologically similar to spontaneous dermatitis in conventional NC/Nga mice [15]. Recently, we have found that topically repeated application with hapten (picryl chloride) on the ears and back skin causes AD-like skin lesions in SPF NC/Nga mice but not in BALB/c mice (C. Fujisawa et al., unpublished data, 2003). As shown in Figure 25.3, quite different profiles of macroscopic appearance, clinical severity scores, and scratch frequency are noted in hapten-induced dermatitis in NC/Nga mice and BALB/c mice. During the course of the repeated Ag challenge at a weekly interval for 8 weeks, BALB/c mice expressed temporal dermatitis. In contrast, the severity of skin lesions of NC/Nga mice was gradually increased for every challenge. Serum levels of total IgE were markedly elevated 6 weeks after the Ag challenge. These results indicate that NC/Nga mice genetically predisposed to manifest the dermatitis resemble human patients with AD. B. Histopathological Examination Although conventional NC/Nga mice at 6 to 8 weeks old show no dermatitis superficially, the significant histopathological changes are already present including the increased number of mildlydegranulated mast cells and infiltration of eosinophils and mononuclear cells [5,6]. The skin lesions of 17-week-old NC/Nga mice include thickened epidermis by hyperplasia with elongation of the rete ridges and prominent hyperkeratosis with areas of parakeratosis (Figure 25.4). Slight intercellular edema (spongiosis) without vesicle formation is marked. The lesional skins are also characterized by the increased number of dermal mast cells and marked infiltration of inflammatory cells
1391_C25.fm Page 376 Tuesday, November 18, 2003 5:36 PM
376
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Figure 25.3
AD-like skin lesions in SPF NC/Nga mice induced by repeated application with hapten. After being sensitized with 5% PCl, mice were repeatedly challenged with 0.8% PCl at 1-week intervals for 8 weeks. Severe dermatitis characterized by erythema, hemorrhage, excoriation, and scaling are observed in the applied skin of NC/Nga mice (left) but not in that of BALB/c mice (right).
Figure 25.4
Histology of the skin lesion of NC/Nga mice kept under SPF (left) or conventional conditions (right). The skin biopsy samples were taken from 17-week-old NC/Nga mice, and stained with hematoxyllin-eosin. Hypertrophy of dermis and epidermis with massive infiltration of inflammatory cells is observed in the skin of conventionally housed NC/Nga mice.
such as eosinophils and lymphocytes. Mast cells and eosinophils with various grades of degranulation are observed in the affected site. In contrast, there are no pathological features described above in SPF NC/Nga mice raised in air-regulated conditions. Immunohistochemical studies on skin lesions of NC/Nga mice demonstrate infiltration of CD4+ T cells and macrophages [5,6]. In addition, the number of MHC-II positive cells in both epidermis and dermis of the lesional skins is also increased, which are likely to be Langerhans cells, dermal dendritic cells, and dermal macrophages [6]. C. Immunopathological Features More than 80% of human subjects with AD accompany by increased levels of total and/or specific IgE in the peripheral blood [16]. Plasma levels of total IgE are increased in association with development of dermatitis in NC/Nga mice as well [5]. As shown in Figure 25.2, plasma levels of IgE are rapidly increased within 8 to 10 weeks and plateau at 17 weeks, which correlate with the severity of the dermatitis [5]. In contrast, SPF NC/Nga mice have no hyperproduction of IgE. Therefore, the possible involvement of IgE in the pathogenesis of the disease has been speculated. Although there are no differences in the expression of CD40 and its ligand (CD40L) in T cells and B cells between NC/Nga and BALB/c mice, B cells of NC/Nga mice produce more than three to five times the amount of IgE in vitro than B cells of BALB/c mice (Figure 25.5). We have also demonstrated constitutive tyrosine phosphorylation of Janus kinase 3, a tyrosine kinase responsible for interleukin (IL)-4–receptor and CD40-mediated signaling, may contribute to enhanced activation of B cells in response to IL-4 and CD40, leading to the marked elevation of total IgE levels [16].
1391_C25.fm Page 377 Tuesday, November 18, 2003 5:36 PM
SPONTANEOUS MOUSE MODEL OF ATOPIC DERMATITIS IN NC/NGA MICE
300
3000
IgE (ng/ml)
250
2500
BALB/c NC/Nga
200
2000
150
1500
100
1000
50
500
0
0 0
Figure 25.5
377
25 50 100 IL-4 (U/ml)
200
0
1
10 100 CD40L (ng/ml)
1000
Increased IgE synthesis by B cells of NC/Nga mice. Splenic B cells (105 cells) isolated from BALB/c or NC/Nga mice were stimulated with various concentrations IL-4 (left) or soluble CD40L (right) for 9 days. The concentrations of IgE in culture supernatants were determined by an ELISA.
Several cytokines and chemokines that mediate allergic and nonallergic responses are recognized in skin lesions of conventional NC/Nga mice. Immunostaining with specific antibodies indicates that both mast cells and CD4+ T cells may produce IL-4 and IL-5 in the skin lesions of NC/Nga mice at 17 weeks old [5]. In spleens of conventional NC/Nga mice, there are few IL-4 positive cells, and most lymphocytes in the T-cell zone are positive for IL-5. Vestergaard et al. [6] reported that the expression of Th2-specific chemokines such as thymus- and activation-regulated chemokine (TARC) and macrophage-derived chemokine (MDC) in the skin biopsy samples of affected NC/Nga mice was markedly increased with aggravation of skin lesions. TARC and MDC are a pair of CC chemokines that selectively attract Th2-type memory T cells via chemokine receptor CCR4 [6]. Eotaxin, a chemokine for eosinophils, was also overexpressed in the lesional skin but not in normal skin [6]. An immunohistochemical analysis revealed that the cellular sources of TARC and MDC were keratinocytes at basal epidermis and dermal dendritic cells, respectively. In addition, the increased expression of CCR4, a chemokine receptor for TARC and MDC, is confirmed in lesional skins, but not in nonlesional skins. These findings suggest that a Th2-mediated immune response is predominant in the dermatitis of NC/Nga mice. In the presence of IL-12, differentiation of Th0 cells into Th1 memory cells occurs, whereas the presence of IL-10 and the absence of IL12 stimulate differentiation of Th2 cells that produce IL-4, IL-5, IL-9, and IL-13 [17]. IL-12 exerts its biological function via interferon (IFN)-g, which is capable of down-regulating IgE production in vivo and in vitro [18]. We have found a defective Th1 response in NC/Nga mice [19]. For example, spleen cells of NC/Nga mice produced IFN-g in response to concanavalin A or IL-12 stimulation, but its levels were less than half of those produced by control BALB/c spleen cells. Although addition of IFN-g to the culture with IL-4 and CD40L completely abrogated in vitro IgE production by B cells of BALB/c mice, a limited suppressive effect was observed in the culture of B cells of NC/Nga mice even when a high dose of IFN-g was added. Moreover, the facts that the expression of the IL-12 receptor b2 chain was impaired (Figure 25.6) and the phosphorylation of STAT4 was decreased in T cells of NC/Nga mice strongly support a possibility that a defective Th1 response of NC/Nga mice is involved in hyporesponsiveness to IL-12 due to impaired expression of the IL-12 receptor b2 chain, leading to the polarization of a Th2 immune response in NC/Nga mice.
1391_C25.fm Page 378 Tuesday, November 18, 2003 5:36 PM
378
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Figure 25.6
RT-PCR assay for mRNA expression of IL-12 receptors in spleen cells stimulated with Con A.
D. Immunogenetics At present, immunogenetic profiles such as MHC molecules, the T-cell receptor (TCR) repertoire, and VH gene usage of IgE associated with dermatitis in NC/Nga mice are not well known. As described above, a linkage disequilibrium analysis of NC/Nga mice has identified at least seven candidate genes encoding Thy1, d, g, and e subunits of CD3, the IL-10 receptor a chain, IL-18 and C-terminal Src kinase (Csk) [13]. All of them may act as modulators associated with the onset and the exacerbation of AD. For example, CD3 is a part of TCR complex, which activates T cells when Ag/allergens are presented through the MHC complex to TCR [20]. Proliferation of dermal T cells in response of anti-CD3 is enhanced in patients with AD as compared to that of healthy subjects [21]. Immunosuppressive cytokine IL-10 exerts its effects via the specific receptor of IL10, which is strongly down-regulated in acute-phase atopic lesions [22]. The concentrations of IL18 in sera and skin lesions in patients with AD are significantly higher than those in healthy controls [23–25]. NC/Nga mice with dermatitis also show increased serum levels of IL-18 [25]. Csk, a negative regulator of Src family kinases such as Lyn, Fyn, and Lck, plays a role in the signaling pathways to activate T cells and mast cells [26]. To clarify the genetic contribution of these candidates to AD, identification of polymorphisms and their functional relevance to the disease are required.
V. THERAPEUTIC RESPONSES Therapeutic trials are summarized in Table 25.2. A. Steroids Topical treatment with steroids is effective for dermatitis of NC/Nga mice as well as human AD. For example, topical application with steroid ointment (0.05% clobetasole propionate) for 7 days to the affected skin site of NC/Nga mice leads to significant regression of dermatitis with reduced itching [6]. Microscopically, the steroid treatment markedly reduces the infiltration of CD4+ T cells, whereas the number of mast cells and macrophages is slightly decreased. Hyperkeratosis and acanthosis are relieved. On the other hand, other steroid ointments such as betamethasone valerate (Rinderon“-V, 0.12%) or alclometasone dipropionate (Almeta“, 0.1%) have a marginal effect on skin lesions of NC/Nga mice with fully developed dermatitis [27]. However, such treatment causes adverse effects such as thinning of the skin and alopecia in NC/Nga mice [6,27]. Therapeutic effect of an adrenal steroid dehydroepiandrosterone (DHEA) has been reported by Sudo et al. [28]. Serum DHEA concentrations are decreased by exposure to stressful events, and it is significantly lower in patients with AD than those of age-matched healthy males [29]. Moreover,
1391_C25.fm Page 379 Tuesday, November 18, 2003 5:36 PM
SPONTANEOUS MOUSE MODEL OF ATOPIC DERMATITIS IN NC/NGA MICE
379
Table 25.2 Therapeutic Effect of Various Treatments for Dermatitis of NC/Nga Mice Treatment Steroid ointments Clobetasolepropionate Betamethasone valerate Alclometasone dipropionate Taclorimus (FK506) Dexamethasone DHEA Cytokines rhTGF-b1 rIL-12 rIFN-g anti-IFN-g Chymase inhibitor Diet restriction PUFA Persimmon leaf extract
Dosage and Route
Frequency
Length of Treatment
Effect
Reference
0.05% 0.12% 0.1% 0.1–1% 1 mg, IP 500 mg/kg, SC
1/day 2/week 2/week 2/week 1/week 3/week
7 days 9 weeks 9 weeks 9 weeks 4 weeks 28 weeks
+++ + + +++ +++ +++
6 27 27 27 36 28
1 mg, SC 1400 U, IP 1000 U, IP 500 mg, IP 150m/kg, PO 40% reduction, PO various, PO 0.125%, PO
1/week 1/day 2/week one shot daily daily
4 weeks 5 weeks 5 weeks 1 week 35 days 6 weeks
+++ — — + + +
36 19 19 36 35 42
ad libtum ad libtum
6 weeks 9 weeks
— +++
40 36
Note: IP, intraperitonally; SC, subcutaneously; PO, orally.
administration of DHEA during Ag sensitization attenuates the subsequent allergic reactions induced by challenge in an asthma mouse model [30]. Subcutaneous injection of DHEA (500 mg/kg of body weight, three times per week) to NC/Nga mice maintained in conventional conditions from 5 to 33 weeks of age suppresses a spontaneous increase in levels of IgE in the peripheral blood. The effect of DHEA appears at 8 weeks of age. There is no description about side effects after long-term use of DHEA in this report. B. Tacrolimus A newly generated immunosuppressive agent tacrolimus (FK506) is active in a topical formulation, and 0.03 to 0.3% tacrolimus ointment successfully improves clinical aspects of human AD [31–33]. Hiroi et al. [27] attempted to examine the possible therapeutic effect of topical application with tacrolimus (0.1 to 1%, twice a week) on dermatitis of conventional NC/Nga mice. The authors demonstrated that such treatment was effective in reducing the symptoms and severity of the dermatitis 2 weeks later. Unlike steroids, tacrolimus do not cause skin thinning. Interestingly, serum IgE levels of locally treated mice were dropped to one-tenth of those of untreated control mice by 9 weeks, which were comparable to those of SPF NC/Nga mice kept under air-regulated conditions. Histopathological analyses showed that the tacrolimus ointment also decreased the number of inflammatory cells such as CD4+ T cells, mast cells, eosinophils, and IL-4- or IL-5–producing cells in NC/Nga mice. C. Cytokines The imbalance between Th1 and Th2 is a fundamental underlying mechanism in allergic disorders. Human AD is regarded as a Th2-dominant immune disorder because of the increased expression of Th2 cytokines such as IL-4 and IL-5 in the lesional skins and the reduced Th1 response [34,35]. Therapeutic treatment of the dermatitis with Th1 or immunosuppressive cytokines has been tested to restore the imbalance of a Th1/Th2 immune response in NC/Nga mice. Since IL-12 drives a Th1 response and inhibits Th2 differentiation in mouse models for parasite infection and Ag-induced airway hypersensitivity, we administrated rIL-12 (1400 U/day) to NC/Nga mice in expectation of its therapeutic effect by redressing the imbalanced Th populations in AD-like
1391_C25.fm Page 380 Tuesday, November 18, 2003 5:36 PM
380
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
skin lesions. However, this attempt for 4 weeks not only ended in failure but also resulted in the exacerbation of the dermatitis in NC/Nga mice raised in conventional conditions [19]. Administration of IFN-g also increased the severity of the skin lesions, and the exacerbating effect of IL-12 was stronger than that of IFN-g [19]. In addition, IL-12–treated NC/Nga mice showed higher concentrations of plasma IgE than IFN-g–treated and untreated mice [19]. The other group reported that the injection of anti–IFN-g antibodies partially improved the dermatitis of NC/Nga mice kept under conventional conditions [36]. Thus, these results give rise to a possibility that a Th1-dependent mechanism contributes to the development of dermatitis in NC/Nga mice. The usage of such Th1 cytokines for therapeutic purposes has to be examined carefully. Sumiyoshi et al. [36] studied the effect of transforming growth factor (TGF)-b1, an immunosuppressive cytokine, on AD-like skin lesions in NC/Nga mice. Subcutaneous injection of TGF-b1 (1 mg once a week for 3 weeks) significantly improved the clinical symptoms; and serum IgE levels were also reduced after the TGF-b1 treatment. In the skin lesions, the number of inflammatory cells was decreased. The effect of TGF-b was comparable to that of dexamethasone served as a positive control. D. Chymase Inhibitor Chymase, a chymotrypsin-like serine protease, is mainly stored in mast cells and released in response to allergic and nonallergic stimuli. In fact, intradermal injection of chymase into humans and mice causes not only an increase of vascular permeability but also itching and eosinophil accumulation at the injected site of the skin [37–39]. Thus, mast cell chymase is considered to participate in allergic inflammation, but its precise role remains unclear. Fifteen-week-old NC/Nga mice that fully exhibited dermatitis were treated with a chymase inhibitor SUN-C8257 daily (150 mg/kg of body weight/day) in drinking water [40]. The oral administration of SUN-C8257 for 35 days significantly reduced the severity of clinical and histological aspects of dermatitis in NC/Nga mice, suggesting the involvement of chymase in tissue mast cells in the pathogenesis of AD. E. Diet Manipulation Except for the fact that there is insufficient evidence to clarify the mechanism in humans, manipulation of nutrition by either diet restriction or supplementation is believed to manifest antiinflammatory effects on skin disorders such as cutaneous tumor, psoriasis, and AD [41]. A lowenergy diet without malnutrition seems to reduce inflammatory symptoms of patients with AD [41]. In fact, Fan et al. [42] reported that a 40% dietary reduction of food quantity delayed the onset and progression of spontaneous dermatitis in NC/Nga mice. They speculated that diet restriction inhibited infiltration of inflammatory cells and production of Th2 cytokines such as IL-4 and IL-5, although the mechanism of how food intake influenced immune response was unknown. Feeding of persimmon leaf extract is effective to suppress development of dermatitis in NC/Nga mice [43,44]. At 9 weeks old, there is no significant difference in severity of skin lesions in NC/Nga mice between a persimmon leaf extract (250 mg/kg) diet group and a control diet group, but after that it is gradually reduced in mice treated with persimmon leaf extract. Oral administration of astragalin (1.5 mg/kg of body weight), an active ingredient of persimmon leaf extract, completely inhibits development of dermatitis and scratching behavior in NC/Nga mice. Serum IgE elevation, production of IL-4 and IL-13 by splenic T cells, and infiltrating cell numbers in skin lesions are also suppressed by persimmon leaf extract or astragalin. Astragalin, one of the major flavonoids in persimmon leaf extract, is capable of stabilizing mast cells and having antipruritic effect on dextranevoked scratching behavior in mice. Thus, the therapeutic effect of this substance might be attributable to its inhibitory effect on mast cells.
1391_C25.fm Page 381 Tuesday, November 18, 2003 5:36 PM
SPONTANEOUS MOUSE MODEL OF ATOPIC DERMATITIS IN NC/NGA MICE
381
The administration of n-3 polyunsaturated fatty acids (PUFAs) such as linoleic acid, which is abundant in fish oil, is effective for asthma by suppressing the production of eicosanoids such as prostaglandin E2, and leukotriene B4 and C4 [45,46]. The effect of PUFA is uncertain in patients with AD, but unfortunately oral administration of PUFA results in no therapeutic effect on the dermatitis of NC/Nga mice [47].
VI. SKIN BARRIER ABNORMALITIES Dry skin and cutaneous barrier abnormalities are pointed out as potential factors determining the disease susceptibility in human AD. Ceramide plays an important role in moisture retention and barrier function of the skin, and its level is significantly reduced in lesional and nonlesional skins of patients with AD due to the abnormality of ceramide-metabolizing enzymes: increased ceramidase activity and decreased sphigomyelinase activity [48,49]. Ceramidase converts ceramide into sphingosine and fatty acid. We measured transepidermal water loss and skin surface conductance to evaluate the skin properties for water retention and barrier function of NC/Nga mice kept under conventional or SPF conditions [50]. Abnormalities of these two parameters were detected, indicating the impairment of skin barrier function in conventional NC/Nga mice. The amount of ceramide was significantly lower as compared to healthy controls; and ceramidase activity of conventional NC/Nga mice with dermatitis was higher than that of SPF NC/Nga mice. In contrast, lower activity of sphigomyelinase was detected in the skin of both conventional and SPF NC/Nga mice as compared to that of control BALB/c mice. Thus, we speculate that NC/Nga mice may have a predisposition to impairment of the ceramide metabolism, which causes dryness and reduces skin barrier ability to protect against incoming Ag.
VII. EXPERT EXPERIENCE AD is characterized by persistent itch, and patients seek relief by scratching the pruritic lesions. Scratching induces rapid damage to the skin and causes subsequent serious irritation and inflammation leading to more intensive itching and exacerbation of the dermatitis. As well as avoiding contact to allergens, controlling scratching behavior is a major issue with regard to the preventive management of AD. However, little is known about the mediators or the neurological processes involved in the itch sensation. This lack of knowledge is due to the subjective nature of the sensation itself and related difficulties in quantifying pruritus, and the absence of a convincing animal model. Several scientific attempts have been made to develop and evaluate methods for the quantitative analysis of itching, such as visual counting by using an infrared video camera and video tape recorder system, a sensitive electromagnetic movement detector, and a vibration transducer [51]. However, defects of these methods are low validity and reliability. Recently, we have generated a new analysis system that is capable of precisely analyzing scratching behavior of mice [52]. A mouse is kept in an isolated cage, and its behavior is digitally videotaped. The dynamic image sequences are recorded digitally at 30 frames per second. The digital images are later analyzed with a custom-made personal computer-based image analysis system (SCLABA system, Noveltec Inc., Kobe, Japan), which is capable of detecting scratching movements of both hindlimbs, calculating the frequency and duration time based on the defined threshold, and providing qualitative and quantitative information. By using a SCLABA system, we have attempted to analyze the scratching behavior of NC/Nga mice, and found that the frequency of scratching behavior was positively correlated with the severity of the dermatitis (Figure 25.7). This is very useful as a valid quantitative and qualitative method for the assessment of itching, and is a potential instrument for studying the mechanisms of pruritus and for the evaluation of antipruritic therapies.
1391_C25.fm Page 382 Tuesday, November 18, 2003 5:36 PM
90 80 70 60 50
10
40 30 20 10 0
4
8 6
2 0 5
Figure 25.7
8
12 16 Weeks of age
Clinical skin severity scores ( )
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Scratching frequency ( )
382
20
Scratching frequency and clinical skin severity scores of conventional NC/Nga mice. Scratching frequency (20 minutes) was counted by a SCLABA system and skin severity was scored according to the criteria described in Figure 25.2.
VIII. COMPARISON WITH HUMAN AD Table 25.3 shows a summary of the similarities and differences in the dermatitis between NC/Nga mice and human patients. NC/Nga mice spontaneously suffer from pruritic dermatitis very similar to human AD with IgE hyperproduction clinically and histologically, which may be triggered by certain environmental factors. Profiles of cytokines and chemokines produced in skin lesions of NC/Nga mice also resemble those of human AD. Generally speaking, NC/Nga mice have many advantages as an animal model for human AD. However, there are some disparities. First, the close association between IgE levels and the onset and progression of the dermatitis is observed in NC/Nga mice; but approximately 20% of human subjects with severe dermatitis have normal or subnormal IgE levels in the peripheral blood, and the severity of the disease does not always correlate with IgE levels [53]. Human AD is considered as a Th2-driven disease, but Th1 cytokine IFN-g is also identified in the chronic skin lesions [54]. The number of IFN-g producing cells is significantly increased in the skin lesion although circulating lymphocytes produce less amount of IFN-g. Therefore, in human AD, Th2 cells are thought to play an important role in the initial phase of AD, and prolonged skin inflammation leads to the chronic lesions of AD with Th1 activation. The Role of IgE and Th1/Th2 cytokines in the elicitation and exacerbation of the disease is still controversial. To address the question, several studies were conducted using NC/Nga mice, Table 25.3 Comparative Chart of AD between NC/Nga Mice and Humans Similarities
Spontaneous development of eczematous skin lesions Involvement of genetic and environmental factors in the pathogenesis Severe pruritus Dry skin Elevated blood IgE levels Histological features (hypertrophy of dermis and epidermis, etc.) Massive infiltration of mast cells, eosinopshils, CD4+ T cells and macrophages Expression of Th2 cytokines and chemokines (IL-4, IL-5, and TARC, MDC) Constitutive phosphorylation of JAK3 in B cells Elevated blood IL-18 levels
Differences
Normal levels of serum IgE in 20% of human patients with AD AD-susceptible loci determined by genetic analyses
1391_C25.fm Page 383 Tuesday, November 18, 2003 5:36 PM
SPONTANEOUS MOUSE MODEL OF ATOPIC DERMATITIS IN NC/NGA MICE
383
and the results presented demonstrated that not only Th2/IgE-dependent but also IFN-g–dependent mechanisms might contribute to the pathogenesis of AD. Yagi et al. [55] recently generated STAT6deficient NC/Nga mice to clarify roles of IgE and an IL-4–mediated Th2 immune response in the pathogenesis of AD. STAT6 is a critical transcription factor that regulates IL-4–mediated immune responses such as Th2 differentiation and IgE class switching, all of which were completely abrogated in STAT6-deficient mice [55]. Surprisingly, STAT6-deficient NC/Nga mice spontaneously manifested AD-like skin lesions as normal NC/Nga littermates maintained under conventional conditions, which are characterized by an increase in numbers of mast cells and eosinophils, whereas these deficient mice lost productive abilities of IgE and Th2 cytokines such as IL-4 and IL-5. Instead of Th2 cytokines, IFN-g and its potent inducers such as IL-18, IL-12, and caspase-I are up-regulated in the skin lesion of STAT6-deficient NC/Nga mice [55]. In STAT6-deficient IL18–transgenic mice, AD-like skin lesions appeared despite undetectable levels of serum IgE [56]. These reports are not enough to rule out possible roles of IgE- and Th2-dependent immune responses in the pathogenesis of AD. In fact, AD-like dermatitis is improved in FceRI-g–chain knockout NC/Nga mice even in conventional circumstances (H.M. et al., unpublished data, 1999). The importance of IL-18 in AD has been indicated by other studies: increased IL-18 production by lymphocytes of AD patients upon stimulation [57], and elevated serum levels of IL-18 in human patients with AD as well as in NC/Nga mice [23–25]. Interestingly, serum IL-18 levels tend to correlate negatively with serum IgE levels in patients with AD and NC/Nga mice [26,27]. A genetic linkage analysis of NC/Nga mice shows that an IL-18 gene is located near the AD-susceptible locus [14], suggesting that IL-18 is a likely candidate gene for development of AD. Thus, IL-18 may play a substantial role in the manifestation of AD in humans and mice. Increased IFN-g production correlates with development of eczematous skin lesions in STAT6deficient NC/Nga mice [55]. IFN-g but not IL-4, which induce the expression of a Th2-type chemokine TARC in keratinocytes, is overexpressed in the skin lesions of NC/Nga mice [6]. The exacerbating effect of IL-12 or IFN-g in the dermatitis of NC/Nga mice supports these findings [19]. Taken together, from the study using NC/Nga mice, IgE/Th2-dependent and/or IFN-g-dependent mechanisms may contribute to the development of dermatitis in conventional NC/Nga mice. Clarifying an expression profile of Th1/Th2 cytokines in response to various Ag or irritants in NC/Nga mice may give us clues to understand the complicated pathogenesis of AD. A genetic linkage analysis to identify the locus responsible for AD shows some differences in mouse and human studies. In humans, several loci including 11q13 (FceRI b chain), 5q31-33 (cytokine cluster containing IL-4, IL-5, IL-9, IL-13), 13q12-14, 14q11.2 (mast cell cymase), 16p12 (IL-4R a chain), and psoriasis susceptibility loci (1q21, 3q21 4q, 6p, 17q25, and 20p) are related to AD [58–60]. A linkage disequilibrium analysis for the dermatitis in NC/Nga mice has identified two chromosome regions on murine chromosome 9 that correspond to chromosome 11q22.2-23.3 and 15q21-25 in humans [13]. Thus far, no loci or genes related to AD have been mapped to these regions. However, as described above, clinical and immunological findings in both patients with AD and NC/Nga mice suggest that an IL-18 gene on chromosome 11q22.2-22.3 is likely to be a candidate AD gene. The polymorphism study and the generation of IL-18–deficient NC/Nga mice will clarify the clinical prevalence of the gene to the disease. AD is a disease associated with multiple genes. A unique combination of symptoms is observed in each patient, and the symptoms and severity of the disease may vary over time, which makes the research of AD harder and more complicated. Using an inbred strain of mice is advantageous and simplifies the genetic analysis because of genetic uniformity as well as relatively short generation time and free choice of crosscombination. Identifying the responsible genes underlying AD offers a means of better understanding its pathogenesis. NC/Nga mice respond to topical treatment with steroid or tacrolimus as well as patients with AD [6,27]. Currently, experimental drugs for AD include biologic agents, fatty acid supplements, immunosuppressive agents, and anti-inflammatory drugs such as phosphodiesterase inhibitors. Although the predictability value of the data obtained from mice and the interpretation with regard
1391_C25.fm Page 384 Tuesday, November 18, 2003 5:36 PM
384
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
to human applications are not absolutely parallel, the pharmacological actions of drugs are, by and large, similar to those in humans. Thus, NC/Nga mice are very useful in evaluating new therapeutic agents for AD and to identify adverse effects via long-term follow-up studies. AD skins tend to be easily irritated, and dryness of the skin and ceramide deficiency in the stratum corneum are considered to lead to impairment of the skin barrier. These skin features of patients with AD are very similar to those of NC/Nga mice [50]. Even the uninvolved skin of patients with AD are characterized by distinct differences in a skin-surface lipid composition, especially in the ceramide fraction. Since unaffected SPF NC/Nga mice have ceramide deficiency, the impaired barrier function in AD may result from not only the presence of inflammation and environmental conditions but also some kind of genetic predisposition with the ceramide metabolism. It is believed that without emphasis on preventive care of AD, none of the prescribed antiinflammatory agents will offer more than temporal relief. NC/Nga mice are a preferred model for development of effective skin care.
IX. CONCLUSION In NC/Nga mice, AD-like skin lesions spontaneously appear that are associated with elevated serum levels of total IgE maintained under nonsterile conventional conditions but not under airregulated SPF conditions. Clinical, histological, immunological, and biochemical features observed in NC/Nga mice suffering from dermatitis closely resemble those of patients with AD. Despite the necessity of understanding the etiology and pathogenesis of AD, no well-accepted objective markers for the disease have been defined. NC/Nga mice are a useful model for human AD, and researching exact mechanisms of spontaneous dermatitis caused in NC/Nga mice provides important clues to the puzzle of the etiology and pathogenesis of human AD, resulting in improvement of preventive and therapeutic strategies and development of new diagnostic tools.
REFERENCES 1. Kondo, K., Improvement and establishment of inbred mouse strain in Japan, Jikken Dobutsu, 22 (Suppl.), 271, 1973. 2. Natsuume-Sakai, S., Kondo, K., and Migita, S., Quantitative estimation of serum Ss level: changes upon the development of autoantibodies, environment and acute inflammation in inbred mice, Jpn. J. Exp. Med., 47, 117, 1977. 3. Kondo, K., Nagami, T., and Tadokoro, S., Differences in haematopoietic death among inbred strains of mice, in Comparative Cellular and Species Radiosensitivity, V.P. Bond and T. Sugahara (Eds.), Igakushoin, Tokyo, 1966, p. 20. 4. Testing, M.F.W., Origins and characteristic of inbred strains of mice, in Genetic Variants and Strains of the Laboratory Mouse, M.F. Lyon (Ed.), Oxford University Press, Oxford, 1996, p. 1537. 5. Matsuda, H. et al., Development of atopic dermatitis-like skin lesion with IgE hyperproduction in NC/Nga mice, Int. Immunol., 9, 461, 1997. 6. Vestergaard. C. et al., Overproduction of Th2-specific chemokines in NC/Nga mice exhibiting atopic dermatitis-like lesions, J. Clin. Invest., 104, 1097, 1999. 7. Morita, E. et al., Fur mites induce dermatitis associated with IgE hyperproduction in an inbred strain of mice, NC/Kuj, J. Dermatol. Sci., 19, 37, 1999. 8. Iijima, O.T. et al., Atopic dermatitis in NC/Jic mice associated with Myobia musculi infestation, Comp. Med., 50, 225, 2000. 9. Taskapan, M.O. and Kumar, P., Role of staphylococcal superantigens in atopic dermatitis: from colonization to inflammation, Ann. Allergy Asthma. Immunol., 84, 3, 2000. 10. Cookson, W. Atopy: a complex genetic disease, Ann. Med., 26, 351, 1994. 11. Larsen, F.S., Holm, N.V., and Henningsen, K. Atopic dermatitis. A genetic-epidemiologic study in a population-based twin sample, J. Am. Acad. Dermatol., 15, 487, 1986.
1391_C25.fm Page 385 Tuesday, November 18, 2003 5:36 PM
SPONTANEOUS MOUSE MODEL OF ATOPIC DERMATITIS IN NC/NGA MICE
385
12. Tsudzuki, M. et al., Genetic analyses for dermatitis and IgE hyperproduction in the NC/Nga mouse, Immunogenetics, 47, 88, 1997. 13. Kohara, Y. et al., A major determinant quantitative-trait locus responsible for atopic dermatitis-like skin lesions in NC/Nga mice is located on Chromosome 9, Immunogenetics, 53, 15, 2001. 14. Leung, D.Y. et al., Thymopentin therapy reduces the clinical severity of atopic dermatitis, J. Allergy Clin. Immunol., 85, 927, 1990. 15. Sasakawa, T. et al., Atopic dermatitis-like skin lesions induced by topical application of mite antigens in NC/Nga mice, Int. Arch. Allergy Immunol., 126, 239, 2001. 16. Matsumoto, M. et al., IgE hyperproduction through enhanced tyrosine phosphorylation of Janus kinase 3 in NC/Nga mice, a model for human atopic dermatitis, J. Immunol., 162, 1056, 1999. 17. Morris, S.C. et al., Effects of IL-12 on in vivo cytokine gene expression and Ig isotype selection, J. Immunol., 152, 1047, 1994. 18. Gately, M.K., The interleukin-12/interleukin-12-receptor system: role in normal and pathologic immune responses, Annu. Rev. Immunol., 16, 495, 1998. 19. Matsumoto, M. et al., Inability of IL-12 to down-regulate IgE synthesis due to defective production of IFN-gamma in atopic NC/Nga mice, J. Immunol., 167, 5955, 2001. 20. Samelson, L.E., Harford, J.B., and Klausner, R.D., Identification of the components of the murine T cell antigen receptor complex, Cell, 43, 223, 1985. 21. Volke, A., Bang, K., and Thestrup-Pedersen, K., Proliferation of T lymphocytes from atopic dermatitis skin is enhanced upon anti-CD3, reduced upon mitogen and superantigen, and negligible upon tuberculin stimulation, Acta Derm. Venereol., 80, 407, 2000. 22. Muschen, A. et al., Differential IL-10 receptor gene expression in acute versus chronic atopic eczema. Modulation by immunosuppressive drugs and cytokines in normal cultured keratinocytes, Inflamm. Res., 48, 539, 1999. 23. Yoshizawa, Y. et al., Serum cytokine levels in atopic dermatitis, Clin. Exp. Dermatol., 27, 225, 2002. 24. Shida, K. et al., High serum levels of additional IL-18 forms may be reciprocally correlated with IgE levels in patients with atopic dermatitis, Immunol. Lett., 79, 169, 2001. 25. Tanaka, T. et al., Interleukin-18 is elevated in the sera from patients with atopic dermatitis and from atopic dermatitis model mice, NC/Nga, Int. Arch. Allergy Immunol., 125, 236, 2001. 26. Hermiston, M.L. et al., Reciprocal regulation of lymphocyte activation by tyrosine kinases and phosphatases, J. Clin. Invest., 109, 9, 2002. 27. Hiroi, J. et al., Effect of tacrolimus hydrate (FK506) ointment on spontaneous dermatitis in NC/Nga mice, Jpn. J. Pharmacol., 76, 175, 1998. 28. Sudo, N., Yu, X.N., and Kubo, C., Dehydroepiandrosterone attenuates the spontaneous elevation of serum IgE level in NC/Nga mice, Immunol. Lett., 79, 177, 2001. 29. Tabata, N., Tagami, H., and Terui, T., Dehydroepiandrosterone may be one of the regulators of cytokine production in atopic dermatitis, Arch. Dermatol. Res., 289, 410, 1997. 30. Yu, C.K. et al., Attenuation of house dust mite Dermatophagoides farinae-induced airway allergic responses in mice by dehydroepiandrosterone is correlated with down-regulation of TH2 response, Clin. Exp. Allergy, 29, 414, 1999. 31. Allen, B.R., Tacrolimus ointment: its place in the therapy of atopic dermatitis, J. Allergy Clin. Immunol., 109, 401, 2002. 32. Rico, M.J. and Lawrence, I., Tacrolimus ointment for the treatment of atopic dermatitis: clinical and pharmacologic effects, Allergy Asthma Proc., 23, 191, 2002. 33. Ruzicka, T. et al., A short-term trial of tacrolimus ointment for atopic dermatitis. European Tacrolimus Multicenter Atopic Dermatitis Study Group, N. Engl. J. Med., 337, 816, 1997. 34. Akdis, C.A. et al., Immune regulation in atopic dermatitis, Curr. Opin. Immunol., 12, 641, 2000. 35. Leung, D.Y., Atopic dermatitis: immunobiology and treatment with immune modulators, Clin. Exp. Immunol., 107, 25, 1997. 36. Sumiyoshi, K. et al., Transforming growth factor-beta1 suppresses atopic dermatitis-like skin lesions in NC/Nga mice, Clin. Exp. Allergy, 32, 309, 2002. 37. He, S. and Walls, A.F., The induction of a prolonged increase in microvascular permeability by human mast cell chymase, Eur. J. Pharmacol., 352, 91, 1998. 38. Hagermark, D., Rajika, G., and Berqvist, U., Experimental itch in human skin elicited by rat mast cell chymase, Acta Derm. Venereol., 52, 125, 1972.
1391_C25.fm Page 386 Tuesday, November 18, 2003 5:36 PM
386
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
39. He, S. and Walls, A.F., Human mast cell chymase induces the accumulation of neutrophils, eosinophils and other inflammatory cells in vivo, Br. J. Pharmacol., 35, 91, 1998. 40. Watanabe, N. et al., Chymase inhibitor improves dermatitis in NC/Nga mice, Int. Arch. Allergy Immunol., 128, 229, 2002. 41. Racket, S.C., Rothe, M.J., and Grant-Kels, J.M., Diet and dermatology. The role of dietary manipulation in the prevention and treatment of cutaneous disorders, J. Am. Acad. Dermatol., 29, 447, 1993. 42. Fan, W. et al., Effects of dietary restriction on spontaneous dermatitis in NC/Nga mice, Exp. Biol. Med., 226, 1045, 2001. 43. Kotani, M. et al., Persimmon leaf extract and astragalin inhibit development of dermatitis and IgE elevation in NC/Nga mice, J. Allergy Clin. Immunol.,106, 159, 2000. 44. Matsumoto, M. et al., Oral administration of persimmon leaf extract ameliorates skin symptoms and transepidermal water loss in atopic dermatitis model mice, NC/Nga, Br. J. Dermatol., 146, 221, 2002. 45. Bittiner, S.B. et al., A doubleblind, randomised, placebo-controlled trial of fish oil in psoriasis, Lancet, 20, 378, 1988. 46. Dry, J. and Vinccent, D., Effect of a fish oil diet on asthma: results of a 1-year double-blind study, Int. Arch. Allergy Appl. Immunol., 95, 156, 1991. 47. Suzuki, R. et al., Effects of n -3 polyunsaturated fatty acids on dermatitis in NC/Nga mice, Prostaglandins Leukot. Essent. Fatty Acids, 66, 435, 2002. 48. Ohnishi, Y. et al., Ceramidase activity in bacterial skin flora as a possible cause of ceramide deficiency in atopic dermatitis, Clin. Diagn. Lab. Immunol., 6, 101, 1999. 49. Hara, J. et al., High-expression of sphingomyelin deacylase is an important determinant of ceramide deficiency leading to barrier disruption in atopic dermatitis, J. Invest. Dermatol., 115, 406, 2000. 50. Aioi, A. et al., Impairment of skin barrier function in NC/Nga Tnd mice as a possible model for atopic dermatitis, Br. J. Dermatol., 144, 12, 2001. 51. Rees, J.L. and Laidlaw, A., Pruritus: more scratch than itch, Clin. Exp. Dermatol., 24, 490, 1999. 52. Orito, K. et al., A new analytical system for quantitating scratching behavior in mice, Br. J. Dermatol., in press. 53. Wolf, R., The role of IgE in atopic diseases, Med. Hypotheses, 14, 353, 1984. 54. Grewe, M. et al., Lesional expression of interferon-gamma in atopic eczema, Lancet, 343, 25, 1994. 55. Yagi, R. et al., Development of atopic dermatitis-like skin lesions in STAT6-deficient NC/Nga mice. J. Immunol., 68, 2020, 2002. 56. Konishi, H. et al., IL-18 contributes to the spontaneous development of atopic dermatitis-like inflammatory skin lesion independently of IgE/stat6 under specific pathogen-free conditions, Proc. Natl. Acad. Sci. U. S. A., 99,11340, 2002. 57. El-Mezzein, R.E. et al., Increased secretion of IL-18 in vitro by peripheral blood mononuclear cells of patients with bronchial asthma and atopic dermatitis, Clin. Exp. Immunol., 126, 193, 2001. 58. Lee, Y.A. et al., A major susceptibility locus for atopic dermatitis maps to chromosome 3q21, Nat. Genet., 26, 470, 2000. 59. Beyer, K. et al., Association and linkage of atopic dermatitis with chromosome 13q12-14 and 5q31-33 markers, J. Invest. Derm., 115,906, 2000. 60. Cookson, W.O. et al., Genetic linkage of childhood atopic dermatitis to psoriasis susceptibility loci, Nat. Genet., 27, 372, 2001.
1391_C26.fm Page 387 Tuesday, November 18, 2003 5:38 PM
CHAPTER
26
Experimental Mouse Model of Atopic Dermatitis by Transgenic Induction Lawrence S. Chan
CONTENTS I. II. III. IV. V.
History ................................................................................................................................387 Animals ..............................................................................................................................388 Disease Induction...............................................................................................................388 Course of Disease ..............................................................................................................389 Assessment of Disease.......................................................................................................390 A. Clinical Manifestation ...............................................................................................390 B. Histopathological Examination .................................................................................390 C. Immunopathological Data .........................................................................................391 D. Immunogenetics.........................................................................................................394 VI. Therapeutic Responses.......................................................................................................394 VII. Expert Experience ..............................................................................................................394 VIII. Lessons Learned.................................................................................................................395 IX. Conclusion..........................................................................................................................396 Acknowledgment............................................................................................................................397 References ......................................................................................................................................397
I. HISTORY Since atopic dermatitis is a common, chronic, inflammatory disease, the development of an animal model is naturally a sound investment for the biomedical community. Animal models of atopic dermatitis developed by transgenic techniques have the advantage that one can test the role of the overexpressed molecule (whichever that may be) in the induction and maintenance of the disease. The first publication of such model in which some evidence of skin inflammation is provided should be credited to Tepper et al. [1] in 1990. The overexpression of interleukin-4 was achieved by inserting mouse interleukin-4 cDNA through an immunoglobulin promoter [1]. These interleukin-4 transgenic mice have a marked increase in the serum level of IgE and the appearance of an inflammatory ocular lesion (blepharitis). Histopathologically, these ocular lesions have features consistent with allergic types of reactions. These two features are present in human patients 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
387
1391_C26.fm Page 388 Tuesday, November 18, 2003 5:38 PM
388
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
affected by atopic dermatitis, although by themselves are insufficient to fulfill the clinical diagnostic criteria for human atopic dermatitis [2]. Subsequently, Platzer et al. [3] analyzed cytokine mRNA levels in a different interleukin-4 transgenic mouse line by quantitative PCR, and demonstrated the increase of mRNA levels in interleukin-5, interleukin-6, interferon-gamma, and interleukin-4 receptor, as well as interleukin-4. More recently, Dvorak et al. [4] demonstrated by light and electron microscopy that the mast cells presented in the inflammatory eye lid lesions of the interleukin-4 trransgenic mice developed by Tepper et al. [1] were undergoing piecemeal degranulation, indicating the roles of mast cells and their granules in the pathogenesis of inflammatory skin lesions in these interleukin-4 transgenic mice.
II. ANIMALS The initial interleukin-4-transgenic (IL-4-Tg) mouse line developed in our laboratory was generated in the CByB6 strain of mice by Jackson Laboratory (Bar Harbor, ME), which is not a pure breed. The decision to generate the IL-4-Tg mouse line in this mixed bred strain of mouse was a practical one. Mixed-breed strains of mice such as CByB6 are hardy, and therefore offer a better chance for the transgenic process to succeed. The CByB6 IL-4-Tg mice were subsequently mated with the BALB/cBy strain of mouse, which is also a mixed breed. Two CByB6 IL-4-Tg founder mice (one male and one female) were identified by Southern blot analysis and mated with non-Tg BALB/cBy mice. Of the 38 offspring, 16 developed chronic, inflammatory, itchy skin lesions over a 12-month observation period. The female founder also developed these skin lesions. The earliest disease onset time in this group of mice was 4 months. Both male (N=11) and female (N=6) mice were affected, with a male to female ratio of 1.83:1. All of these mice were housed in conventional cages and fed with standard mouse chow and water. The second group of IL-4-Tg mice was also generated in a mixed-breed mouse strain. One male founder was generated in the B6SJL X BALB/c background, and another male founder was generated in the CB6 X BALB/c background by the Northwestern University Transgenic Core Facility (Chicago). These founders were then mated either with CB6 or BALB/c non-Tg female mice. In order to examine whether a pathogenic environment plays a key role in the development of these chronic, inflammatory, itchy skin lesions, all mice in this group were housed in special pathogen-free cages and fed with standard mouse chow and water. The investigation of this group of mice is currently underway. Preliminary studies suggest that pathogens do not play a role in the induction of skin lesions. Despite the fact that these mice were housed in specific pathogen-free conditions and tested free of pathogens, large numbers of IL-4-Tg mice developed these chronic, inflammatory, itchy skin lesions that are essentially identical to those of the initial group of IL-4Tg mice. Interestingly, this group of mice seems to develop skin lesions earlier than that of the initial group, with some mice developing skin lesions before they reach reproductive age.
III. DISEASE INDUCTION This particular model of atopic dermatitis is induced by a transgenically overexpressed cytokine IL-4. In order to express IL-4 to the skin in a tissue-specific manner, I generated a tissue-specific transgenic construct, utilizing the skin-specific keratin-14 promoter/enhancer (K14-Pro) obtained from E. Fuchs, University of Chicago [5]. As illustrated in Figure 26.1, the construct consists of a vector (pG3Z), K14-Pro, rabbit b-globulin intron, mouse IL-4 cDNA, and a polyA tail. The construct (K14-IL-4) was cut by two restriction endonucleases EcoRI and Hind III to release the pG3Z vector, and the purified and linearized fragment that contains the K14-Pro, rabbit b-globulin intron, mouse IL-4 cDNA, and polyA tail was microinjected into a mouse embryo by method of pronuclear injection. The mouse embryos were subsequently implanted into pseudopregnant mice.
1391_C26.fm Page 389 Tuesday, November 18, 2003 5:38 PM
EXPERIMENTAL MOUSE MODEL OF ATOPIC DERMATITIS BY TRANSGENIC INDUCTION
Figure 26.1
389
Upper panel: the IL-4-Tg construct is composed of a pG3Z vector, the keratin 14 promoter, an intron, the mouse IL-4 cDNA, and a poly A tail. Lower panel: demonstration of IL-4 mRNA expressions in IL-4-Tg mice. One mg of total RNA extracted from nonlesional skin from three Tg mice (lanes 2–4, 5–7, 10–12) and two non-Tg mice (lanes 8 and 9, lanes 13 and 14) were reversely transcribed with reverse transcriptase (lanes 2–4, 8, 9, 10–14) or without reverse transcriptase (lanes 5–7), followed by polymerase chain reactions (PCR) with primer pairs specific for IL-4 (lanes 2–9) and b-actin (lanes 10–14). PCR was similarly performed with a positive control of known IL4 cDNA template with the same IL-4 primer pair (lane 1). (From Chan, L.S., Robinson, N., and Xu, L., J. Invest. Dermatol., 117, 977, 2001 [6], with permission.)
The offspring of these pregnant mice were then genotyped for the IL-4 trangene by Southern blot analyses. In the initial group of IL-4-Tg mice, two founders (one male and one female) were identified and subsequently mated with nontransgenic (non-Tg) wild type mice to generate 38 offspring, as reported in 2001 [6]. In a 12-month observation period, 17 mice from the two founders and their 38 offspring housed in conventional cages developed chronic, inflammatory, pruritic skin lesions resembling clinical findings of human atopic dermatitis [2]. The skin lesions developed in these mice spontaneously without any additional manipulation. The identical methodology was used in a different facility for generating the second group of IL-4-Tg mice that were subsequently housed in special pathogen-free cages. These mice also developed a reproducible clinical phenotype as the first group of Tg mice without any additional manipulation, confirming the reproducibility of this Tg method.
IV. COURSE OF DISEASE The first group of IL-4-Tg mice were observed for 12 months. I recorded the earliest onset of disease by 4 months of age. The disease is chronic and progressive. The skin lesions appeared to
1391_C26.fm Page 390 Tuesday, November 18, 2003 5:38 PM
390
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
be pruritic as the affected mice constantly scratched their skin lesions. The acute lesions are usually moderately to severely inflammatory and scaly. Without treatment, the skin lesions thickened with evidence of lichenification and excoriation, leading to local destruction of affected skin in the forms of erosions and shallow ulcerations. Eight of the 17 (47%) affected mice developed progressive culture-proven Staphylococcal bacterial pyoderma over this 12-month observation period [6]. In all cases, skin lesions were observed first in the ears (100%). Subsequently, skin lesions extended to involve neck (65%), periocular (53%), face (29%), tail (12%), leg (12%), and torso (6%) [6]. When the periocular lesions developed, the affected mice had significant blepharitis.
V. ASSESSMENT OF DISEASE A. Clinical Manifestation As illustrated in Figure 26.2, the affected IL-4-Tg mice exhibited inflammatory scaly skin lesions, particularly in poorly haired skin such as ears, periocular, face, and neck. Secondary to continuous damage by scratching and by inflammation itself, chronic lesions usually revealed lichenification, excoriation, and areas of destruction. About 50% of the affected mice developed bacterial pyoderma. B. Histopathological Examination Figure 26.3 illustrates the histology of an inflammatory skin lesion. As compared to normal skin from a non-Tg mouse (Figure 26.3a), a chronic skin lesion from an IL-4-Tg mouse (Figure 26.3b) showed significant acanthosis, hyperkeratosis with focal parakeratosis, and a significant increase of mononuclear cell infiltration in the dermis. Few eosinophils are detected in the
Figure 26.2
Clinical phenotype of the IL-4-Tg mice. The affected IL-4-Tg mice exhibited inflammatory scaly skin lesions, particularly in poorly haired skin such as ears, periocular, face, and neck. Secondary to continuous damage by scratching and by inflammation itself, chronic lesions usually revealed lichenification, excoriation, and areas of destruction. A non-Tg mouse is compared with an IL-4-Tg mouse.
1391_C26.fm Page 391 Tuesday, November 18, 2003 5:38 PM
EXPERIMENTAL MOUSE MODEL OF ATOPIC DERMATITIS BY TRANSGENIC INDUCTION
391
dermis of chronic lesions (Figure 26.3d). The early lesions showed similar histology with the exception that the acanthosis is less prominent and there is no parakeratosis or eosinophil infiltration. By Giemsa stain, large numbers of degranulating and nondegranulating mast cells are observed in the lesional dermis (Figure 26.3c). C. Immunopathological Data Immunophenotyping of inflammatory cell types and inflammatory adhesion molecules in lesional and nonlesional skin of affected IL-4-Tg mice and in normal skin of non-Tg mice are currently underway. Although these studies are not yet completed, preliminary data revealed a prominent CD3+ T cells infiltration in the lesional skin, compared to minimal presence of these T cells in nonlesional skin of IL-4-Tg mice and in normal skin of non-Tg mice. The lesional dermal CD3+ T cells comprised nearly 30% of all CD11a+ bone marrow–derived leukocytes. Lesional dermal CD4+ Th cells outnumbered CD8+ Tc cells by about 2.5:1 (Figure 26.4). All known inflammatory adhesion molecules on the endothelial cells ICAM-1, VCAM-1, P-selectin, and E-selectin, are highly expressed in lesional skin, but essentially unexpressed in nonlesional skin of Tg mice (except ICAM-1) and in normal skin of non-Tg mice [7]. As illustrated in Figure 26.5, the serological studies of the IL-4-Tg mice revealed that most of the affected IL-4-Tg mice have elevated total serum IgE and IgG1 concentrations. On the other hand, their total serum IgG2a concentrations were depressed, in comparison to the normal non-Tg mice (Figure 26.5a). Furthermore, the onset of skin lesions coincided with higher total serum IgE and IgG1, but not IgG2a (Figure 26.5b). In addition, the increase in total serum IgE persisted during disease progression (Figure 26.5c).
Figure 26.3
The histopathology of inflammatory skin lesions occurred in IL-4-Tg mice. As compared to normal skin from a non-Tg mouse (a), a chronic skin lesion from an IL-4-Tg mouse (b) showed significant acanthosis, hyperkeratosis with focal parakeratosis, and significant increase of mononuclear cell infiltration in the dermis. Few eosinophils (arrows) are detected in the dermis of chronic lesion (d). The early lesions showed similar histology with the exception that the acanthosis is less prominent and there is no parakeratosis or eosinophil infiltration. Using Giemsa stain, a large number of degranulating and nondegranulating mast cells are observed in the lesional dermis (c). Bar = 45 mm (a and b), 18 mm (c and d).
Immunophenotyping of chronic lesional skin of IL-4-Tg mice. Monoclonal antibodies to mouse CD3, CD4, and CD8 demonstrate the infiltrations of these T cells. Bar = 70 mm.
392
Figure 26.4
1391_C26.fm Page 392 Tuesday, November 18, 2003 5:38 PM
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
1391_C26.fm Page 393 Tuesday, November 18, 2003 5:38 PM
EXPERIMENTAL MOUSE MODEL OF ATOPIC DERMATITIS BY TRANSGENIC INDUCTION
a.
IgG (mg/ml)
IgE (µg/ml)
393
12 11 10 9 8 7 6 5 4 3 2 1 0
IgG2a
IgG1 b.
IgG (mg/ml) IgE (µg/ml)
IgE
IgE-#3 IgG1-#3 IgG2a-#3 IgE-#3 IgG1-#6 IgG2a-#6
5
4 3
2
1
0 -80
-70
-20
Onset
20
40
14
c.
13 12 11 10 9 8 7 6 5
IgE (µg/ml)
4 3 2 1 0 4
Figure 26.5
6
8 10 12 Severity Scores
14
16
Serological studies of the IL-4-Tg mice revealed that most of the affected IL-4-Tg mice () have elevated total serum IgE and IgG1 concentrations as compared to non-Tg mice () (a). On the other hand, their total serum IgG2a concentrations were depressed, in comparison to the normal non-Tg mice (a). Furthermore, the onset of skin lesions co-incited with an elevation of total serum IgE and IgG1, but not with an elevation of IgG2a (b). In addition, the elevation of total serum IgE persisted during the disease progression (c). (From Chan, L.S., Robinson, N., and Xu, L., J. Invest. Dermatol., 117, 977, 2001 [6], with permission.)
1391_C26.fm Page 394 Tuesday, November 18, 2003 5:38 PM
394
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
D. Immunogenetics The data do not allow me to determine whether a particular strain of mouse is either more sensitive or more resistant to disease induction, since the strains of mice I used thus far are not purebred. Future studies using pure bredmice such as BALB/c (more Th2 prone) and SJL/j (more Th1 prone) strains may lead to data that can assist us in delineating the immunogenetic predisposition of atopic dermatitis development.
VI. THERAPEUTIC RESPONSES A large-scale therapeutic trial for chronic, inflammatory, itchy skin lesions occurring in the IL4-Tg mice has not been performed. Nevertheless, we have tried to apply middle-potency topical corticosteroid ointment on the lesional skin of several affected mice. After a few days of application (twice daily), the inflammation in the treated skin lesions was much improved, whereas the inflammation in the untreated skin lesions remained the same or had worsened. The responsiveness to corticosteroid treatment is consistent with that in human patients with atopic dermatitis [2].
VII. EXPERT EXPERIENCE In my experience of working with epithelia-specific IL-4-Tg mice, I learned that the K14 promoter/enhancer provided by E. Fuchs at the University of Chicago is an excellent one. The construct in which mouse IL-4 cDNA was linked to K14 promoter was successfully inserted into mice of three different genetic backgrounds by two different facilities, and the mice containing the epithelia-specific IL-4 transgene consistently developed chronic, inflammatory, pruritic skin lesions that closely resemble those of human disease atopic dermatitis. The mice developed skin lesions without any additional manipulation, that is, these IL-4-Tg mice developed skin lesions spontaneously. These IL-4-Tg mice developed skin lesions in both pathogen-containing and pathogen-free environment, suggesting that pathogens play no significant role in disease induction. Thus, if the goal is to maintain the mouse line for the purpose of understanding the pathogenesis of atopic dermatitis, it would be wise to house these IL-4-Tg mice in specific pathogen-free cages, so that bacterial infection would not complicate investigation of the immune mechanisms of disease induction and maintenance. While the development of skin lesions in this IL-4-Tg mouse line provides an excellent opportunity for the investigation of the atopic dermatitis pathomechanism, one of the unexpected difficulties for maintaining a viable IL-4-Tg mouse line is that some mice developed early skin lesions prior to reproductive age. The pruritic skin lesions have, in my experience, prohibited reproduction in some IL-4-Tg mice. Therefore, the IL-4-Tg mice, once confirmed by genotyping, should be mated as soon as feasible, so that the IL-4-Tg mouse line can be maintained. For genotyping the mouse line, I have consistently good results using DNA extracted from tail clippings. A small quantity of tail (about 0.5 cm long) is sufficient to extract enough DNA for polymerase chain reaction (PCR). I used a commercially available Taq DNA polymerase in Storage Buffer A (catalog no. M1861, Promega, Madison, WI) with the mouse IL-4 primer pair (reverse primer 5'-CAGTGATGTGGACTTGGACTCATTCATGGTGC-3’, forward primer 5'CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG-3') [6]. After preheating at 94∞C for 4 minutes, the 35-cycle PCR was performed in a GeneAmp 2700 Thermocycler (Applied Biosystems, Foster City, CA) using the following cycling parameter: 94∞C, 1 minute; 55∞C, 1 minute; 72∞C, 1 minute; and a single 10-minute extra extension at 72∞C. The 357-bp DNA bands corresponding to the IL-4
1391_C26.fm Page 395 Tuesday, November 18, 2003 5:38 PM
EXPERIMENTAL MOUSE MODEL OF ATOPIC DERMATITIS BY TRANSGENIC INDUCTION
395
nucleotide 70-427 [8] can be easily documented with a 1.5% agarose gel stained with ethidium bromide. For IL-4 transgene expression, I used the RT-PCR methodology. Nonlesional skin samples obtained from Tg mice were stored in RNAlater“ preservation solution (Sigma Chemical, St. Louis, MO) at -80∞C until RNA extraction is performed. One mg of total RNA is used to perform RTPCR using the above mouse IL-4 primer pair. To avoid the error of amplifying contaminated DNA, the duplicate sample should be amplified by PCR in the absence of RT to confirm the absence of the 357-bp DNA band in the preparation without RT. The PCR parameter used for the transgene expression is the same as that used for the genotyping method above, after the initial RT reaction.
VIII. LESSONS LEARNED The first lesson I learned was that the Th2 cytokine likely plays a critical role in disease induction of this atopic dermatitis mouse model. As reported previously [6], 43% of the first group of mice (Tg mouse founders and their offspring) developed inflammatory skin lesions over a 12-month observation period. All of the second group of IL-4-Tg mice, as documented by a positive IL-4 PCR result on tail-cut genotyping, developed inflammatory skin lesions. By contrast, none of the age-matched non-Tg mice, as documented by a negative IL-4 PCR result on tail-cut genotyping, developed these inflammatory skin lesions. Thus, the critical Th2 cytokine IL-4 appears to play a central role in the induction of these inflammatory skin lesions. The critical role of IL-4 is further supported by the facts that these inflammatory skin lesions developed in both female and male Tg mice, in mice of different genetic backgrounds, and in mice generated by different facilities. The findings that support an important role of IL-4, a critical Th2 cytokine, in the disease induction in this experimental atopic dermatitis mouse model are consistent with findings in the studies of human atopic dermatitis. To name a few examples, the cytokine profile in early atopic dermatitis skin lesions is predominantly the Th2 type, suggesting an initiating role of Th2 cytokine [9]. Furthermore, lymphocytes from human atopic dermatitis patients can spontaneously express IL-4 mRNA, the expression of which is only observed in activated normal human lymphocytes [10]. In addition, the frequency of IL-4–producing CD4+ and CD8+ lymphocytes in peripheral blood of human atopic dermatitis patients were significantly higher than that of normal individuals. By contrast, the frequency of IFN-g–producing CD4+ and CD8+ peripheral blood lymphocytes in human atopic dermatitis patients was significantly reduced [11]. Furthermore, the abnormal IL-4 gene expression by atopic dermatitis T lymphocytes is likely reflected in altered nuclear protein interactions with the IL-4 transcriptional regulatory element [12]. Moreover, genetic studies have linked atopic dermatitis to IL-4 in Japanese patients [13]. Pathogens probably play an insignificant role in the disease induction of this experimental atopic dermatitis mouse model. Despite the strong association of Staphylococcal infection with atopic dermatitis in human patients [2,14,15], the IL-4-Tg mice housed in our pathogen-free facilities spontaneously developed chronic, inflammatory, pruritic skin lesions identical to the lesions developed in IL-4-Tg mice housed in conventional cages. These findings strongly suggested that pathogens do not play a critical role in disease induction. Another finding that supports this view is that only mice (housed in conventional cages) that developed inflammatory skin lesions developed bacterial pyoderma, as reported previously [6]. Serum IgE may play a role in the pathogenesis of this experimental atopic dermatitis mouse model. In the first group of IL-4-Tg mice, disease onset coincided with a surge of total serum IgE. Further, as the disease worsened, total serum IgE remained high in the mice studied. However, like in human patients with atopic dermatitis, we found that not all IL-4-Tg mice affected with this disease in the first study group had documented increases of total serum IgE. The reason for this nonuniformity of total serum IgE in the affected animals is not clear. One possibility is that antigenspecific IgE, rather than total serum IgE, is a better parameter to reflect the atopic dermatitis disease
1391_C26.fm Page 396 Tuesday, November 18, 2003 5:38 PM
396
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
state, as determined in canine patients with atopic dermatitis [16]. I am in the process of analyzing antigen-specific IgE in sera obtained from IL-4-Tg mice affected with this inflammatory disease, and comparing the results in sera obtained from non-Tg mice. The increase in total serum IgE in our IL-4-Tg mice is consistent with one of the known function of IL-4 in enhancing IgE synthesis [17]. T cells, particularly CD4+ Th cells, may play a pathogenic role in this experimental atopic dermatitis mouse model. Although the cell type study on inflammatory cell infiltrates in this mouse model is not yet complete, preliminary results clearly indicate a predominant T-cell infiltration in the dermis, with a much greater number of CD4+ T cells than CD8+ T cells. These findings are consistent with the CD4+ T-cell predominance in human atopic dermatitis lesional skin [14,18]. Mast cells may play a pathogenic role in this experimental atopic dermatitis mouse model. A large number of degranulating and nondegranulating mast cells was present in both early and chronic lesional dermis. The abundance of dermal mast cells, together with the elevation of serum IgE, could provide a highly allergen-sensitive dermal environment in which the presence of trace allergen could easily cause mast cell degranulation, leading to release of a large amount of inflammatory mediators responsible for either the induction or maintenance of inflammation as visible clinically. These findings are consistent with the prominent presence of mast cells in human atopic dermatitis lesional skin, particularly in the chronic lesions [19]. Findings in the first group of IL-4-Tg mice were somewhat puzzling with regard to the age of disease onset. Most human patients with atopic dermatitis have early childhood onset [19]. However, the earliest age of disease onset in the first group IL-4-Tg mice was 4 months [6], which corresponds to middle age in mice. Subsequently, we observed an earlier disease onset in the second group. Although this investigation is not yet complete, preliminary results indicate that some mice developed inflammatory skin lesions before they reached sexual maturity. The reason for this difference in age of onset between these two groups of IL-4-Tg mice is not yet delineated. One possibility is that the number of transgene copies may be higher in the mice of the second group. We are in the process of determining the relative transgene copies between these groups by Southern blot analyses. Alternatively, the mouse strain may make a difference. However, a generation of purebred Tg mice may be needed to adequately address the latter question. One major question that remains to be answered before this experimental mouse model is finally authenticated as an unequivocal model of human atopic dermatitis is the cytokine profile. In human patients with atopic dermatitis, early skin lesions are dominated by Th2 cytokines, whereas chronic skin lesions are balanced by both Th1 and Th2 cytokines [9]. In addressing this important question, we are in the process of extracting RNA from both early and chronic skin lesions from our IL-4Tg mice. Total RNA will be used to perform quantitative real-time RT-PCR to document the presence and quantity of Th1 and Th2 cytokines in both early and chronic skin lesions, and compare them to that of nonlesional skin of the IL-4-Tg mice and the skin of non-Tg mice.
IX. CONCLUSION In conclusion, I have generated a mouse model of inflammatory skin disease closely resembling human atopic dermatitis by transgenically expressing the critical Th2 cytokine IL-4 in the basal epidermis of the skin [6,20]. The combined data of clinical phenotype, histopathology, immunopathology, bacteriology, and serology seem to support a disease model of atopic dermatitis. In fact, when using the clinical diagnostic critieria for human atopic dermatitis as a guide, this experimental mouse model fulfills three major criteria and four minor criteria, namely, pruritus, chronic dermatitis, family history of atopy, elevated serum IgE, Staphylococcal skin infection, xerosis, and conjunctivitis [2]. Furthermore, this experimental mouse model fulfills four major diagnostic criteria for canine atopic dermatitis, namely pruritus, facial involvement, chronic dermatitis, and positive
1391_C26.fm Page 397 Tuesday, November 18, 2003 5:38 PM
EXPERIMENTAL MOUSE MODEL OF ATOPIC DERMATITIS BY TRANSGENIC INDUCTION
397
family history of atopy and one minor criterion of Staphylococcal pyoderma [16]. The T-cell–predominated dermal infiltrate present in this IL-4-Tg mouse model further suggests a pathogenic role of T cells, as is suggested in human atopic dermatitis [21,22].
ACKNOWLEDGMENT This work is supported by NIH grants R01 AR47667, R03 AR47634, and R21 AR48438 (Lawrence S. Chan).
REFERENCES 1. Tepper, R.I. et al., IL-4 induces allergic-like inflammatory disease and alters cell development in transgenic mice, Cell, 62, 457, 1990. 2. Hanifin, J.M. and Rajka, G., Diagnostic features of atopic dermatitis, Acta Derm. Venereol., 92, 44, 1980. 3. Platzer, C. et al., Analysis of cytokine mRNA levels in interleukin-4-transgenic mice by quantitative polymerase chain reaction, Eur. J. Immunol., 22, 1179, 1992. 4. Dvorak, A.M. et al., Piecemeal degranulation of mast cells in the inflammatory eyelid lesions of interleukin-4 transgenic mice. Evidence of mast cell histamine release in vivo by diamine oxidaseold enzyme-affinity ultrastructural cytochemistry, Blood, 83, 3600, 1994. 5. Vassar, R. et al., Tissue-specific and differentiation-specific expression of a human k14 keratin gene in transgenic mice, Proc. Natl. Acad. Sci. U. S. A., 86, 1563, 1989. 6. Chan, L.S., Robinson, N., and Xu, L., Expression of interleukin-4 in the epidermis of transgenic mice results in a pruritic inflammatory skin disease: an experimental animal model to study atopic dermatitis, J. Invest. Dermatol., 117, 977, 2001. 7. Venkataramani, P. et al., An animal model of atopic dermatitis: lesional skin immunophenotyping delineates a CD4+ T cell-predominated inflammatory infiltrate associated with upregulation of adhesion molecules, J. Invest. Dermatol., (Abstr.), 44(121), 2003. 8. Lee, F. et al., Isolation and characterization of a mouse interleukin cDNA clone that expresses B-cell stimulating factor 1 activities and T-cell- and mast-cell-stimulating activities, Proc. Natl. Acad. Sci. U. S. A., 83, 2061, 1986. 9. Hamid, Q., Boguniewicz, M., and Leung, D.Y.M., Differential in situ cytokine gene expression in acute versus chronic aotpic dermatitis, J. Clin. Invest., 94, 870, 1994. 10. Tang, M.L.K. and Kemp, A.S., Spontaneous expression of IL-4 mRNA in lymphocytes from children with atopic dermatitis, Clin. Exp. Immunol., 97, 491, 1994. 11. Nakazawa, M. et al., Predominance of type 2 cytokine-producing CD4+ and CD8+ cells in patients with atopic dermatitis, J. Allergy Clin. Immunol., 99, 673, 1997. 12. Chan, S.C. et al., Abnormal IL-4 gene expression by atopic dermatitis T lymphocytes is reflected in altered nuclear protein interactions with IL-4 transcriptional regulatory element, J. Invest. Dermatol., 106, 1131, 1996. 13. Kawashima, T. et al., Linkage and association of an interleukin-4 gene polymorphism and atopic dermatitis in Japanese families, J. Med. Genet., 35, 502, 1998. 14. Cooper, K.D., Atopic dermatitis: Recent trends in pathogenesis and therapy, J. Invest. Dermatol., 102, 128, 1994. 15. Arikian, S.R., Einarson, T.R., and Doyle, J.J., Atopic dermatitis: Economic evaluation of treatments for eczema and atopic dermatitis, in Care Management of Skin Diseases: Life Quality and Economic Impact, Rajagopalan, B., Sheretz, E.F., and Anderson, R.T., Eds., Marcel Dekker, New York, 1998, chap. 23. 16. Willemse, T., Atopic skin disease: a review and a reconsideration of diagnostic criteria, J. Small Anim. Pract., 27, 771, 1986. 17. Pene, J. et al., IgE production by normal human lymphocytes is induced by interleukin 4 and suppressed by interferons g and a and prostaglandin E2, Proc. Natl., Acad., Sci. U.S.A., 85, 6880, 1988.
1391_C26.fm Page 398 Tuesday, November 18, 2003 5:38 PM
398
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
18. Lever, R. et al., Immunophenotyping of the cutaneous infiltrating and of the mononuclear cells in the peripheral blood in patients with atopic dermatitis, J. Invest. Dermatol., 89, 4, 1987. 19. Leung, D.Y.M., Tharp, M., and Boguniewicz, M., Atopic dermatitis (atopic eczema), in Fitzpatrick’s Dermatology in General Medicine, Freedberg, I.M. et al., Eds., McGraw-Hill, New York, 1999, chap. 124. 20. Paul, W.E. and Seder, R.A., Lymphocyte responses and cytokines, Cell, 76, 241, 1994. 21. Hanifin, J.M. and Chan, S., Biochemical and immunologic mechanisms in atopic dermatitis: new targets for emerging therapies, J. Am. Acad. Dermatol., 41, 72, 1999. 22. Agosti, J.M. et al., Transfer of allergen-specific IgE-mediated hypersensitivity with allogeneic bone marrow transplantation, N. Engl. J. Med., 319, 1623, 1988.
1391_C27.fm Page 399 Wednesday, November 19, 2003 10:45 AM
CHAPTER
27
Experimental Mouse Model of Atopic Dermatitis: Induction by Oral Allergen Xiu-Min Li and Hugh A. Sampson
CONTENTS I. II. III. IV. V.
History ................................................................................................................................400 Animals ..............................................................................................................................401 Disease Induction...............................................................................................................401 Course of Disease ..............................................................................................................401 Assessment of Disease.......................................................................................................401 A. Clinical Manifestation ...............................................................................................401 B. Histopathological Examination .................................................................................402 C. Immunopathological Data .........................................................................................403 1. Immunohistochemistry ........................................................................................403 a. Presence of IgE–Bearing Mast Cells ............................................................403 b. Presence of CD4+/CD8+ T cells ....................................................................404 2. Measurement of Ag-Specific IgE in Sera by ELISA .........................................404 3. Number of Peripheral Blood Eosinophils ...........................................................406 4. T-Cell Proliferation Assays..................................................................................407 5. RT-PCR ................................................................................................................407 VI. Therapeutic Responses.......................................................................................................407 VII. Expert Experience ..............................................................................................................408 A. Generation of Murine Model of Skin Inflammation Associated with Food Hypersensitivity .........................................................................................................408 VIII. Lessons Learned.................................................................................................................409 A. Immunological Sequence of Events and Critical Factors Delineated by the Model .........................................................................................................................409 B. What the Model Taught Us about the Human Disease ............................................411 C. Disparities Between Model and Human Disease in Clinical, Histopathological, and Immunological Findings and Possible Reasons Underlying Such Difference.....412 IX. Conclusion..........................................................................................................................412 Acknowledgments ..........................................................................................................................412 References ......................................................................................................................................412
0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
399
1391_C27.fm Page 400 Wednesday, November 19, 2003 10:45 AM
400
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Atopic dermatitis (AD) is a common, chronic, relapsing, and highly pruritic inflammatory skin disease that generally begins in early infancy [1]. Although the pathogenic role of allergy in AD has been debated for over a century, AD is frequently the first sign of atopic disease, and the majority of patients with AD have elevated serum IgE and increased numbers of dermal mast cells, eosinophils, and Th2 lymphocytes infiltrating the skin [2]. Clinical studies over the past 2 decades support a pathogenic role for food allergy in a subset of patients with AD, and hypersensitivity to foods has been implicated as an etiologic agent in up to 40% of children with moderate to severe AD [3]. A recent study found that 68% of 6- to 12-month-old infants with AD had positive skin-prick test reactions to cow milk, egg, or peanut [4]. However, the role of hypersensitivity to dietary antigens in the induction and maintenance of this chronic inflammatory response remains controversial. Animal models provide powerful tools for dissecting pathogenic mechanisms involved in human diseases, and appropriate animal models should be extremely useful to facilitate understanding of food hypersensitivity–associated AD in humans.
I. HISTORY Baker [5] first reported food allergy in cats and dogs in 1974. Immunological skin disorders in dogs and cats associated with food allergy was first reviewed by Scott [6] in 1978. Clinical syndromes vary and include atopic-like dermatitis, flea allergy-induced dermatitis, and pruritus without lesions. In a more definitive study, skin reactions, including pruritus (100%), alopecia (64%), and papules (21%), were found to be the most common clinical signs of food hypersensitivity in cats. Pruritus was localized principally to the head, neck, or ear regions in 42% of the cats. Diagnosis was based on resolution of clinical symptoms when cats were fed a restricted diet, and recurrence of signs when cats were fed their original diet or other food. The most common allergens were fish and dairy products [7]. Rosser [8] also confirmed food allergy in dogs. The primary clinical signs were persistent and nonseasonal pruritic skin disease. Although food allergy is rare in dogs and cats [9], these studies provide some evidence of an association between food allergy and skin reactions. Although a possible canine model of AD has been reported [10], few canine models have been used in experimental studies of AD associated with food allergy. Many investigators are focusing on murine models of allergic diseases such as asthma, because the immune system of the mouse mimics the human immune system more closely than other rodents and has been well studied in various inbred strains. In addition, a large number of immunological reagents are available to study murine immune responses. The development of knockout and transgenic mice (e.g., IL-4–deficient mice [11], IgE-deficient mice [12]) provides unique opportunities to isolate the role of various immunological responses. However, in contrast to murine models of asthma and murine models of intrinsic and epicutaneous-induced AD [13–15], it has been difficult to generate clinically relevant murine models of food allergy, and therefore murine models of AD associated with food hypersensitivity. It is estimated that the human gastrointestinal tract processes up to 2 tons of food during a lifetime [16]. While the majority of people enjoy food without adverse reactions (oral tolerance), a small percentage of the population develops food allergy (i.e., IgE-mediated food hypersensitivity). As in most humans, mice develop tolerance rather than sensitization to oral administration of food proteins. In humans, food allergy is determined by both genetic predisposition and environmental factors [17,18]. Genetic background also plays a determining role in mice [19]. Studies in our laboratory have shown that C3H/HeJ, but not BALB/c, CBA/J, or AKR/J mice, are susceptible to symptomatic food allergy [19]. Li et al. [20,21] employed C3H/HeJ mice and developed effective sensitization protocols by incorporating several factors including mucosal adjuvant (cholera toxin; CT), age at first sensitization, and doses and times of oral sensitization/challenge, and generated the first clinically relevant murine models of cow milk (CM) hypersensitivity and peanut (PN) allergy. In these models, antigen-specific IgE levels were induced by
1391_C27.fm Page 401 Wednesday, November 19, 2003 10:45 AM
EXPERIMENTAL MOUSE MODEL OF ATOPIC DERMATITIS: INDUCTION BY ORAL ALLERGEN
401
oral sensitization, and anaphylactic reactions were provoked following oral challenge. These symptoms involved multiple organs, including the skin, gastrointestinal tract, and respiratory systems. The most severe reactions were fatal [20,21]. Li et al. [22] modified the experimental protocols used to induce food hypersensitivity, and generated the first murine model of AD associated with milk and peanut hypersensitivity.
II. ANIMALS Female C3H/HeJ (H2K) mice were purchased from the Jackson Laboratory (Bar Harbor, ME) and maintained under specific pathogen-free conditions. Guidelines for the care and use of the animals were followed (Guide for the Care and Use of Laboratory Animals [23]).
III. DISEASE INDUCTION To induce cow milk (CM) and PN hypersensitivity-associated AD (AD), 2- to 3-week-old mice were sensitized intragastrically with homogenized cow milk or freshly ground whole peanut using cholera toxin as an adjuvant, boosted orally five times at weekly intervals. Mice were then maintained on a milk-containing mouse chow thereafter or fed peanut at 2- to 3-week intervals.
IV. COURSE OF DISEASE Thirty-five percent of CM-sensitized mice and 29% of PN-sensitized mice in three separate experiments developed eczematous skin lesions 9 to 14 weeks following initial sensitization (FA [food allergy]+ AD+, Table 27.1). Naïve mice showed no signs of AD-like skin reactions over an 8-month observation period. Skin lesions were most frequent on the forehead and/or neck (Figure 27.1A). In the most severe cases, the entire body was involved (Figure 27.1B). Episodic dermatitis characterized by spontaneous remissions and relapses persisted in all untreated AD-like mice throughout the 8-month observation period. No mice died during the observation period.
V. ASSESSMENT OF DISEASE A. Clinical Manifestation Clinical symptoms included pruritus as evidenced by scratching of the forehead, ears, legs, and inguinal regions, and lichenified plaques (Figure 27.1B). As previously reported in other murine Table 27.1 Food Allergen-Induced Atopic Dermatitis Sensitization CM+CT CM+CT PN+CT Naïve
Experiment 1 2 3 1–3
Incidence N/Total (%) 1/5 3/6 2/7 0/8
(20) (50) (29) (0)
Note: Mice were sensitized with CM or PN plus CT as described above in three separate experiments. Some of the mice developed eczematous skin lesions 9 to 14 weeks following the initial CM or PN sensitization. The incidence (%) of atopic dermatitis was calculated. CM, cow milk; CT, cholera toxin; PN, peanut.
1391_C27.fm Page 402 Wednesday, November 19, 2003 10:45 AM
402
Figure 27.1
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
(See Color Figure 27.1 following page 428.) Expression of AD-like skin lesions. (A) AD-like lesion about the head and neck with alopecia and excoriations. (B) Extensive AD-like skin lesion with raised erythematous rash, areas of hypopigmentation, and alopecia. (C) Normal C3H/HeJ mouse. (D) Close-up view of erythematous maculopapular rash with areas of hypopigmentation and alopecia. (E) Close-up view of normal skin from naïve mice.
models of AD [13,24], varying degrees of hair loss were a characteristic finding. Hairless regions exhibited erythema, scaling, and dryness, and hypopigmentation (Figure 27.1A, B, and D). B. Histopathological Examination Skin biopsies were obtained from face or inguinal lesions of FA+AD+ mice 3 to 6 weeks after symptoms developed. Skin biopsies from the same sites of naïve and normal-appearing skin of mice with CM or PN, but without AD-like lesion (FA+AD-), were also collected. Five-micrometer paraffin sections of formaldehyde-fixed biopsies were stained with hematoxylin and eosin (H and E) for identification of inflammatory cells and with toluidine blue or Giemsa for identification of mast cells. The total number of cells in the dermis, excluding the hair follicles, as well as the numbers of eosinophils and mast cells, was counted in ten high-power fields of three to five sections from each biopsy. Histological examination of H and E stained sections of lesional biopsies revealed mild spongiosis and numerous inflammatory cells including eosinophils, and lymphocyte-like cells in the dermis (Figure 27.2A and B). Cell counts showed that the total number of cells in the dermis of AD-like mice reached 1818 cells/mm2 with 177 cells/mm2 (10%) eosinophils. The dermis and epidermis appeared thicker in mice with AD-like lesions than those in normal mice (Figure 27.2A and C). In contrast, skin from naïve mice contained only 599 cells/mm2, none of which were eosinophils (Figure 27.2D). In addition, like naïve mouse skin, no eosinophils were observed in normal-appearing skin samples from FA+AD- mice (data not shown). Histological examination of toluidine blue-stained lesional biopsies showed that lesional skin of FA+AD+ mice contained numerous dermal mast cells (Figure 27.3A and B). Quantification showed 300 ±7 cells/mm2, 68% of which were degranulated. In contrast, the number of mast cells in naïve skin was only 87/mm2, 18% of which were degranulated (Figure 27.3C). Furthermore, mast cells in the skin of FA+AD- mice contained significantly fewer mast cells (137/mm2, 37% of which were degranulated) (Figure 27.3D) than in the skins of FA+AD+ mice, but higher than in the skin of naïve mice.
1391_C27.fm Page 403 Wednesday, November 19, 2003 10:45 AM
EXPERIMENTAL MOUSE MODEL OF ATOPIC DERMATITIS: INDUCTION BY ORAL ALLERGEN
Figure 27.2
403
(See Color Figure 27.2 following page 428.) Histological features of AD-like lesions (H and E staining). (A) Biopsy from inguinal area of AD-like lesion demonstrating mild spongiosis, epidermal thickening, and marked mononuclear round-cell infiltrate, especially about the hair follicles. (B) Same lesion showing marked eosinophil and lymphocyte-like cell infiltrate. Insert shows eosinophils. (C) Higher magnification of lesional skin showing spongiosis and epidermal thickening. (D) Normal inguinal skin from naïve mouse.
C. Immunopathological Data 1. Immunohistochemistry Frozen sections of biopsies (2 to 3 mm) of AD-like mouse lesional facial skin, naïve mouse facial skin, and facial skin from FA+AD- were stained with rat antimouse antibodies to detect CD4, CD8, and IgE-positive cells. Additional sections were counter-stained with toluidine blue for detection of IgE-bearing mast cells. Numbers of IgE+ cells and, IgE+ mast cells as well as CD4+ and CD8+ T cells were counted as described above. a. Presence of IgE-Bearing Mast Cells Numerous IgE-positive cells (124/mm2) were observed in lesional skin from AD-like mice (Figure 27.4A). Increased numbers of mast cells were also present in lesional biopsies, and IgEpositive mast cells made up 66.7% of the total IgE positive cells (Figure 27.4B). A small number of toluidine blue-negative, IgE-positive cells with dendritic morphology were also observed
1391_C27.fm Page 404 Wednesday, November 19, 2003 10:45 AM
404
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Figure 27.3
(See Color Figure 27.3 following page 428.) Mast cells in AD-like lesions (toluidine blue staining). (A) Frozen section of lesional facial skin showing markedly increased numbers of toluidine bluestained mast cells. (B) Degranulating mast cells in the dermis of lesional facial skin at higher magnification. (C) Frozen section of normal facial skin showing normal number of toluidine bluestained mast cells. (D) Frozen section of normal-appearing facial skin from FA+AD- mice showing moderately increased number of toluidine blue-stained mast cells.
(Figure 27.4C). In contrast, no IgE-positive cells were detected in skin from naïve mice (Figure 27.4D). Interestingly, IgE-positive cells were also present in normal-appearing skin of FA+AD- mice (Figure 27.4E), but the number (43/mm2) was only 35% of that in lesional skin of AD-like mice. IgE-bearing cells were also found the skin of previous murine models of AD as well as in human AD [25,26]. b.
Presence of CD4+/CD8+ T cells
Histological analysis of lesional skin from AD-like mice revealed many lymphocytes in the dermis (Figure 27.2A and B). Immunohistochemical staining showed numerous CD4+ T cells [281/mm2] (Figure 27.5A) and few CD8+ T cells [20/mm2] (Figure 27.5B). The ratio of CD4+ T cells to CD8+ T cells was 16:1. In contrast, no CD4+ T cells and rare CD8+ T cells were found in skin samples from naïve mice (Figure 27.5C and D). In addition, few if any CD4+ or CD8+ T cells were observed in the normal skins of FA+AD- mice (data not shown). These results show that prominent CD4+ T-cell inflammation in lesional skin is a characteristic feature of this model. CD4+ T cells are also prominent in lesional skin of humans and dogs with AD [27,28]. This finding differs from findings in a murine model of alopecia areata, in which the infiltrate was predominantly CD8+ cytotoxic T cells and only a few CD4+ T cells (CD4+ vs. CD8+ = 1:3) [29]. 2. Measurement of Ag-Specific IgE in Sera by ELISA Blood was obtained from tail veins at 3- to 4-week intervals from week 9 through week 18. Serum Ag–specific IgE was measured by ELISA as described previously [20]. CM-specific IgE levels in AD-like mice (CM+AD+) were significantly increased at week 9 and remained elevated through at least week 20 (Figure 27.6). As expected, serum IgE levels were also increased in CMsensitized mice with normal-appearing skin (CM+AD-) and were not significantly different from levels in CM+AD+ mice. Similarly elevated Ag-specific IgE levels were also present in mice sensitized with peanut with or without skin lesions.
1391_C27.fm Page 405 Wednesday, November 19, 2003 10:45 AM
EXPERIMENTAL MOUSE MODEL OF ATOPIC DERMATITIS: INDUCTION BY ORAL ALLERGEN
Figure 27.4
405
(See Color Figure 27.4 following page 428.) Increased numbers of IgE-positive cells in AD-like lesions. (A) Frozen section of facial lesion stained with anti-IgE mAb and counterstained with toluidine blue showing dark brown DAB-stained IgE positive cells in the upper dermis, and IgEpositive mast cells in the dermis and muscle. (B) IgE-positive mast cells with dark brown DABstained cell membranes and toluidine blue-stained mast cell granules in a facial lesion at higher magnification. (C) DAB-stained IgE-positive dendritic-shaped cells in the upper dermis. (D) Frozen section of normal facial skin of naïve mice showing no DAB-stained IgE positive cells. (E) Frozen section of normal-appearing facial skin of FA+AD- mouse showing a few DAB-stained IgE-positive cells.
1391_C27.fm Page 406 Wednesday, November 19, 2003 10:45 AM
406
Figure 27.5
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
(See Color Figure 27.5 following page 428.) Increased numbers of CD4+ T cells in AD-like lesions. (A) and (B) are frozen sections of the same lesion illustrated in Figure 27.4. (A) Numerous dark brown DAB-stained CD4+ cells, some of which have infiltrated the perifollicular area. (B) Few dark brown DAB-stained CD8+ cells, most of which are near hair follicles. (C, D) Normal facial skin of naïve mice stained in the same manner as in (A) and (B) showing the absence of CD4+ T and CD8+ T cells.
50
*** *** *
45
IgE (ng/ml)
40
*
CMH+AD+ CMH+ADNaive
35 30 25 20 15 10 5 0
Week 9 Figure 27.6
Week 20
(See Color Figure 27.6 following page 428.) Increases in serum Ag-specific IgE. Blood was obtained from AD-like mice and naïve mice (n = 4 - 6) at week 9 and week 20. CM-specific IgE levels were measured by ELISA. CM-specific IgE levels were highest at week 9 and remained relatively constant between week 9 and week 20. *, p < 0.05 vs. naïve mice, ***, p < 0.001.
3. Number of Peripheral Blood Eosinophils To determine the numbers of peripheral blood eosinophils, blood was obtained from mice with AD-like lesions and normal naïve control mice. Blood smears were stained with the Diff-Quik Stain Set (Dade Diagnostics of P.R. Inc., Aguada, Puerto Rico). Differential cell counts of blood leukocytes were determined by microscopic evaluation. Both mice with AD-like lesions and FA+AD- mice had higher peripheral-blood eosinophil counts than naïve mice (13.1 ± 0.9 to 14.0% ± 0.9 vs. 2.6 ± 0.2%, p < 0.001).
1391_C27.fm Page 407 Wednesday, November 19, 2003 10:45 AM
O.D. ratio (cytokine/β–actin)
EXPERIMENTAL MOUSE MODEL OF ATOPIC DERMATITIS: INDUCTION BY ORAL ALLERGEN
#
1.25
*
0.75 0.50 0.25 0.00
IL-4 Figure 27.7
FA+AD+ FA+ADNaive
***
1.00
407
IL-5
IL-13
IFN-γ
(See Color Figure 27.7 following page 428.) Increased IL-5 and IL-13 mRNA expression in AD lesions. Total RNA was extracted from biopsies of lesional skin of FA+AD+ mice, normal-appearing skin of FA+AD- mice and skin of naïve mice (n = 4). Semiquantitative RT-PCR was performed in triplicate. Results are expressed as mean ± SEM of OD ratios of cytokine IL-4, IL-5, IL-13, and IFN-g versus b-actin. *, p < 0.05 and ***, p < 0.001 versus naïve mice, #, p < 0.05 vs. FA+AD- mice. OD = optical density.
4. T-Cell Proliferation Assays To assess T-cell–specific proliferative responses to milk Ag, dermal cells were isolated from biopsies of lesional skin of CM-induced AD-like mice 48 hours after intradermal injection of cow milk extract (100 ml of 1:10 wt/volume; Center Labs, Port Washington, NY) and cultured in the presence or absence of cow milk antigen (50 mg/ml), as described previously [30]. Four days later, the cultures were pulsed with 3H-thymidine for 16 hours, harvested, and the incorporated radioactivity determined in a b-scintillation counter. The results were expressed as counts per minute (cpm). Dermal cells from AD-like lesions of mice with CM allergy showed significantly increased proliferative responses to CM proteins (3666 ± 143 cpm) compared to unstimulated cells (1375 ± 325 cpm; p < 0.05). We were unable to isolated T cells from naïve mice. These results demonstrate food allergen–specific T-cell activation of lymphocytes from lesional skin. 5. RT-PCR To characterize the cytokine profiles in skin of mice with AD-like lesions, lesional skin biopsy samples were collected 8 to 10 weeks after the first appearance of dermatitis in FA+AD+ mice. Biopsies of corresponding sites of normal skin from naïve mice and normal-appearing skin from FA+AD- mice were also collected, and IL-4, IL-5, IL-13, and IFN-g mRNA expression was determined by RT-PCR as described previously [31–33]. IL-4 expression did not differ between AD+ and AD- food-allergic mice or naïve mice. IL-5 expression on the other hand, was significantly increased in FA+AD+ mice compared to FA+AD- and naïve mice. Interestingly, IL-13 mRNA expression was only found in lesional skin of FA+AD+ mice (Figure 27.7). Th1 cytokine and IFN-g expression was increased in FA+AD+ mice compared to FA+AD- and naïve mice, but the increase did not reach statistical significance. These results together with the presence of CD4+ T cells in skin lesions suggest that CD4+ Th2-like cells are the predominant infiltrating lymphocytes and that IL-13 plays a critical role in the maintenance of chronic AD-like lesions in this model. These findings are similar to those in human AD in which there is increased numbers of T cells expressing IL-5 and IL-13 mRNA [34]. VI. THERAPEUTIC RESPONSES Since topical glucocorticoids are the cornerstone therapy for AD in humans, we examined the effect of topical glucocorticoids on skin lesions in this AD model. Two mice with cow milk-induced
1391_C27.fm Page 408 Wednesday, November 19, 2003 10:45 AM
408
Figure 27.8
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
(See Color Figure 27.8 following page 428.) AD-like skin lesions before and after therapy with topical corticosteroids. (A,B) Dermatitis and alopecia limited to the facial area. (C) Same mouse depicted in (A) following 1 week of topical corticosteroid therapy. No scratching behavior was noted at this time and facial hair is almost completely grown back. (D) Extensive AD-like involvement with patches of erythema and hypopigmentation, dry scaly patches, lichenification, and alopecia. (E) Same mouse depicted in (D) following 2 weeks of topical corticosteroid therapy. The mouse had partial hair regrowth and markedly reduced scratching behavior. Nevertheless, the skin retained patchy areas of dry, scaly skin and hypopigmentation.
AD-like lesions, one severe (100% surface area involvement) and one with moderate skin involvement (less than 20% of the surface area), were treated with a topical corticosteroid (DermaSmoothe‘, fluocinolone acotonide, 0.01% topical oil) once daily. After 7 days, the skin of the mouse with moderate AD (Figure 27.8A) was significantly improved, with new hair growth evident in almost all lesional areas (Figure 27.8C), whereas the skin lesion in the mouse without treatment was not improved (Figure 27.8B). The mouse with severe AD-like lesions (Figure 27.8D) was somewhat improved after the 14-day treatment, as evidenced by reduced scratching and new hair growth (Figure 27.8E). However, scaling and dryness did not appear to have improved significantly in this period. One week after discontinuing treatment, skin lesions had recurred in the severely affected mouse but not in the mouse with moderate symptoms (data not shown).
VII. EXPERT EXPERIENCE A. Generation of Murine Model of Skin Inflammation Associated with Food Hypersensitivity While developing our murine model of food allergy, we found that repetitive oral exposure of milk-sensitized mice to cow milk resulted in classic immediate allergic reactions, including marked pruritus of the skin, as manifested by scratching. Furthermore, some mice that were not challenged developed a dry, apparently pruritic rash resulting in scratching and hair loss. A review of potential causes for the pruritus revealed that a newly obtained mouse chow contained low levels of milk protein. In an attempt to generate a model of dermatitis, we fed milk-sensitized mice with mouse
1391_C27.fm Page 409 Wednesday, November 19, 2003 10:45 AM
EXPERIMENTAL MOUSE MODEL OF ATOPIC DERMATITIS: INDUCTION BY ORAL ALLERGEN
409
chow containing low levels of milk protein following our routine 6-week sensitization regimen. Since there is no commercially available mouse chow containing peanut, we fed low doses of peanut to peanut-sensitized mice every 2 to 3 weeks so as to avoid severe anaphylactic reactions. The first signs of skin lesions were observed 9 to 12 weeks after the initial sensitization. These findings suggest that repeated exposure of allergen-sensitized mice to low doses of relevant food allergens is necessary to induce chronic skin reactions similar to food-antigen AD. We also found that peanut is more allergenic than cow milk, regardless of dose, because sensitization of less than 3-week-old mice is required to generate cow milk hypersensitivity, whereas 5- to 8-week-old mice can be sensitized to peanut.
VIII. LESSONS LEARNED A. Immunological Sequence of Events and Critical Factors Delineated by the Model In this AD-like murine model, we found that total and Ag-specific serum IgE levels were significantly increased following oral food-allergen sensitization, and remained significantly higher throughout the period of observation (5 months). We also found that, compared to skin from naïve mice, the number of intact degranulated mast cells was significantly increased. This result is similar to the findings that patients with AD generally have elevated concentrations of serum IgE and increased numbers of mast cells in the lesional skin [2,35]. Numerous IgE-positive cells were also present in lesional skin of AD-like mice, and 60% IgE-positive cells were mast cells. Smaller numbers of IgE-positive dendritic-like cells were also observed in lesional skin. In contrast, no IgE-positive cells were observed in skin from naïve mice. Interestingly, as in human with AD where 25 to 44% of patients have food allergy–induced skin symptoms [36], 32% of the mice developed AD-like skin lesion (FA+AD+), while the remainder had normal-appearing skin (FA+AD-), despite being allergic to milk or peanut. To further delineate the mechanism of food allergy–associated AD, we compared the histological and immunological features of FA+AD+ mice with FA+AD- mice. We found that elevated serum IgE levels in FA+AD+ mice were not different from FA+AD- mice. Although there are no data regarding differences in IgE levels between food-allergic patients with or without AD, it has been suggested that the genetic predisposition to develop IgE-mediated responses may be similar in patients with AD and patients with asthma [2]. The numbers of mast cells and IgE-bearing cells in FA+AD- mice were significantly less than in FA+AD+ mice, although significantly higher than naïve mice. These results suggest that the presence of IgE and activation of mast cells in the skin by IgE antibodies are an important mechanisms in food allergy–associated AD. The histological analysis also demonstrated that lesional skin contained numerous inflammatory cells, including eosinophils, whereas no eosinophil was found in the skin of naïve mice. Normalappearing skin of FA+AD- mice did not contain eosinophils, even though the number of peripheralblood eosinophils was the same as in FA+AD+ mice. Eosinophils are thought to contribute to skin inflammation in AD by secreting cytokines and mediators that induce tissue injury through the production of reactive oxygen intermediates and the release of toxic granule proteins, particularly eosinophil MBP [37,38]. Eosinophils also release mediators such as platelet activating factor (PAF), leucotrienes, and histamine, which are important in the pathophysiology of pruritus in AD [39]. These findings suggest that eosinophils play an important role in inducing AD-like skin lesions in this model. Immunohistochemical analyses also revealed numerous CD4+ T cells in lesional skin of FA+AD+ mice, whereas no CD4+ T cells were found in skin of naïve mice or normal-appearing skin of FA+AD- mice. Dermal T cells isolated from lesional skin of FA+AD+ mice cultured in the presence of a specific food allergen exhibited significantly increased proliferative responses. We also characterized the cytokine profiles and found that IL-5 was significantly higher, and IFN-g was slightly
1391_C27.fm Page 410 Wednesday, November 19, 2003 10:45 AM
410
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
higher in lesional skin of FA+AD+ mice than in skin from naïve and FA+AD- mice. IL-13 expression was only detected in the lesional skin of FA+AD+ mice. Previous studies have shown that various Th2 cytokines were responsible for the different organ-related allergic responses. IL-4 was more closely associated with pulmonary allergic sensitization, whereas IL-13 was more related to skinrelated allergic sensitization [40]. Numerous IL-13–positive cells have also been found in lesional skin from patients with AD, whereas no IL-13–positive cells were found in skin from healthy controls. This study demonstrated that approximately 40% of T cells and 20% of mast cells in AD lesional skin produced IL-13 [41]. Taken together, this suggests that activation of CD4+ T cells, with secretions of IL-13 accompanied by IL-5, plays a fundamental role in induction of skin inflammation in this model as in human AD. IL-13 has been shown to be sufficient to promote B cell switching to IgE production, mast cell activation, and eosinophil accumulation. IL-5 has been shown to be the primary determinant of eosinophil priming, activation, recruitment, and survival [41–43]. Further work, perhaps utilizing in vivo deletion methods, is required to confirm a critical role for IL-13, IL-5, or other cytokines in food allergy–associated AD models. Although the immunopathological mechanisms of food hypersensitivity-associated AD are complex, our results from this model, together with findings in human and animal models of AD [1,13–15], suggest that a combination of IgE-dependent mast cell degranulation and dominant Th2mediated inflammation in the dermis is the likely immunopathogenic mechanism underlying food hypersensitivity–associated AD. The likely sequence of events appears to be as follows: oral sensitization induces antigen-specific IgE, which circulates to the skin and binds to mast cells and dendritic/Langerhans cells in the skin. Food allergens cross the gastrointestinal tract and traffic to the skin via the bloodstream where they cross-link IgE, thereby triggering mast cell degranulation and histamine release resulting in pruritus. It has been shown that children with AD who chronically ingest foods to which they are allergic exhibit increased spontaneous basophil histamine release compared to children without food allergy [44]. This sequence of events appears to be a general mechanism of food hypersensitivity associated with immediate skin reactions following ingestion of foods. Influx of eosinophils and CD4+ T cells, and the predominance of Th2 cytokine synthesis, particularly IL-13, are characteristics of AD-associated inflammation. However, how Th2 cells are recruited into the skin in this model is unknown. There are at least three potential mechanisms. First, activated mast cells production of cytokines and chemokines, which attract inflammatory cells into the skin [2]. However, because normal-appearing skin of FA+AD- mice also has an increased number of degranulated mast cells and IgE-positive cells (although significantly less than in lesional skin) mast cell–mediated inflammation may not be the only mechanism. Second, presentation of food allergens by IgE-bearing cells, such as dendritic cells/Langerhans, to local T cells could promote a Th2-skewed response [45]. IgE-bearing Langerhans cells have been shown to be 100- to 1000-fold more effective at presenting allergen to T cells (primarily Th2 cells) and activating T-cell proliferation than classical antigen-presenting cells [46,47]. However, because CD4+ cells T are rare in normal skin, residential T cells are unlikely to be the major source of the numerous CD4+ T cells in lesional skin in this model. The third possible mechanism involves T cells expressing cutaneous lymphocyte antigen (CLA). It has been found that most mature lymphocytes continuously recirculate from blood to organs and back to blood again as often as twice daily [48]. This pattern is highly regulated, selectively directing appropriate lymphocytes to particular microenviroments [48]. Lymphocyte progeny exit the tissue through the lymphatic system and enter the bloodstream. Such memory lymphocytes are more likely to return to the tissue in which they were first stimulated [48–50]. T cells expressing CLA, a unique skin-homing receptor, are known to play an important role in AD. It has been demonstrated that T cells migrating to the skin of allergen-induced reactions express significantly higher levels of CLA than do T cells isolated from the airway of an asthmatic [2]. It also has been suggested that the development of AD in relation to food allergy may relate to homing of allergen-specific T cells to the skin, since after in vitro stimulation of PBMCs with casein, but not Candida albicans, patients with milk allergy and AD had a significantly greater percentage of CLA+ T cells than controls [51]. Beyer et al. [52]
1391_C27.fm Page 411 Wednesday, November 19, 2003 10:45 AM
EXPERIMENTAL MOUSE MODEL OF ATOPIC DERMATITIS: INDUCTION BY ORAL ALLERGEN
411
found that after in vitro stimulation with casein, PBMCs from patients with milk-induced urticaria and AD had a significantly greater percentage of CD4+ T cells expressing CLA than PBMCs from patients with milk-induced gastrointestinal symptoms and atopic or nonatopic control subjects. Recent studies from our laboratory found increased numbers of milk-specific CLA+ and CD4+ T cells in the gastrointestinal tract of sensitized patients (K. Beyer, unpublished data). Human milkspecific mucosal lymphocytes in the gastrointestinal tract display an IL-13–dominant Th2 cytokine profile [53]. Thus CD4+ CLA+ T cells producing Th2 cytokines in the gastrointestinal tract may migrate to the skin and contribute to the inflammation process. Further research is required to test this hypothesis. B. What the Model Taught Us about the Human Disease The etiology of AD in humans remains enigmatic, but a recent study found that approximately 40% of children with moderate to severe AD attending a university dermatology clinic had food hypersensitivity [3]. Double-blind placebo-controlled food challenges in food-allergic children with AD typically elicit a pruritic, erythematous, morbilliform rash within 15 to 120 minutes following the challenge [54]. This rash is accompanied by a rise in plasma histamine [55], and generally clears within a few hours. In an earlier study it was demonstrated that elimination of specific foods from the diet of food-allergic AD patients resulted in significant improvement in their eczematous skin symptoms [56]. However, despite a substantial body of clinical and laboratory evidence, it has been difficult to establish the exact immunopathogenic role of food hypersensitivity in AD. Oral sensitization with milk protein and peanut protein followed by repeating feeding of low doses of the relevant food protein resulted in approximately one-third of mice sensitized with milk or peanut proteins developing a dry, erythematous, scaly, pruritic rash involving 15% to 100% of their body surface within 9 to 14 weeks of initial sensitization. As with human AD, treatment of skin lesions with topical corticosteroids led to decreased pruritus and erythema, and resumption of hair growth, as shown in Figure 27.1. In addition, episodic dermatitis was noted in untreated mice, with recurrences and remissions occurring throughout an 8-month observation period. Histological examination of skin lesions from sensitized mice revealed areas of mild thickening and spongiosis of the epidermis and a marked inflammatory infiltrate and thickening of the dermis compared to naïve mice. This infiltrate consisted of large numbers of lymphocytes, predominantly CD4+ T cells and few CD8+ cells, eosinophils, and mast cells. RT-PCR of lesional skin in mice with AD-like lesions and normal skin in naïve mice revealed similar expression of IL-4 and slight increase in IFN-g expression, and significantly elevated IL-5 expression in AD-like mice compared to naïve mice and FA+AD- mice. Interestingly, IL-13 expression was seen only in lesional skin of AD-like mice. These findings are similar to findings reported in humans with AD [43,57]. These findings differ from the histopathological findings in patients with chronic urticaria, where mast cell numbers (predominantly perivascular) are increased ten-fold, and the increased numbers of infiltrating lymphocytes show no predominance of CD4+ or CD8+ lymphocytes [58]. In human AD, eosinophils are sparse, although eosinophil products (major basic protein [MBP]) are prominent [59]. The presence of eosinophils in this model also suggests that eosinophils in the skin may be important in inducing skin lesions; however, deposition of eosinophil MBP in the dermis has not yet been demonstrated. This is the first murine model of AD-like lesions induced by oral sensitization with a food protein, and lends support to the hypothesis that food allergens can be an important immunopathogenic factor causing AD. Because of the immunological and histological similarities to human AD, this model should be a useful tool to delineate mechanisms such as T-cell migration and foodantigen trafficking from the gastrointestinal tract to the skin, and their role in the development and maintaining chronic skin inflammation.
1391_C27.fm Page 412 Wednesday, November 19, 2003 10:45 AM
412
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
C. Disparities Between Model and Human Disease in Clinical, Histopathological, and Immunological Findings and Possible Reasons Underlying Such Difference Murine models of AD-like disorders have some undesirable characteristics, including the covering of the skin with dense hair, high hair-follicle density, and very thin epidermis. Although pruritus is easily detected, other early skin symptoms such as rash may not be observed. As in other murine dermatitis models, hair loss was the first sign of dermatitis. In human chronic skin lesions, the epidermis exhibits marked hyperplasia with elongation of the rete ridges and prominent hyperkeratosis. In this model, we found only moderate epidermal thickening, and little hyperkeratosis. During infancy, AD is generally more acute and primarily involves the face, scalp, and extensor surface of the extremities. The diaper area is usually spared. In older children and in those with long-standing skin disease, patients develop the chronic form of AD with lichenification and localization of the rash to flexural folds of the extremities. In our model, facial skin appeared to be the most frequently affected area, as in other murine AD models [13,24], but no specific lesional skin distribution associated with age or disease activity was observed. Although an animal model cannot be identical to human AD, murine models of AD associated with food allergy mimic human AD in certain aspects including incidence, symptoms, and major histological characteristics, as well as systemic and local immunological responses. Interestingly, the incidence of skin disease is approximately the same in this highly inbred strain as it is in the genetically diverse human population. This finding suggests that phenotypic as well as genotypic variability is important. It is possible to use these models to conduct experiments, which are not possible in humans. This model may also serve as a useful tool for investigation of new interventions for the treatment of human AD.
IX. CONCLUSION In summary, we have been able to induce an eczematous rash in food-sensitized mice that resembles AD in humans. As seen in food-allergic children with AD, these mice developed foodspecific IgE antibodies, peripheral blood eosinophilia, and inflammatory lesions characterized by infiltration of CD4+, Th2 lymphocytes and eosinophils, and increased numbers of mast cells. Repeated ingestions of small amounts of food allergen appear to be responsible for the induction of the eczematous rash and hair loss, which respond to topical corticosteroid therapy. Further studies are necessary to determine why the dermatitis develops in only about one-third of food allergic mice and what immunopathogenic mechanisms are responsible for the lesions. With a better understanding of the relationship between food hypersensitivity and AD, more effective forms of therapy may be developed.
ACKNOWLEDGMENTS We are grateful to Brian Schofield, Gary Kleiner, Chin-Kang Huang, Soo-Yung Lee, and Nicholas A. Soter for their contributions to this work. This work was supported in part by the National Institute of Allergy and Infectious Diseases, National Institutes of Health grants AI24439, AI43668, and AI44236.
REFERENCES 1. Sampson, H.A., Atopic dermatitis: immunological mechanisms in relation to phenotype, Pediatr. Allergy Immunol. 12 (Suppl. 14), 62, 2001.
1391_C27.fm Page 413 Wednesday, November 19, 2003 10:45 AM
EXPERIMENTAL MOUSE MODEL OF ATOPIC DERMATITIS: INDUCTION BY ORAL ALLERGEN
413
2. Leung, D.Y., Atopic dermatitis: the skin as a window into the pathogenesis of chronic allergic diseases., J. Allergy Clin. Immunol. 96, 302, 1995. 3. Eigenmann, P.A. et al., Prevalence of IgE-mediated food allergy among children with atopic dermatitis, Pediatrics, 101, E8, 1998. 4. Sporik, R., Hill, D.J., and Hosking, C.S., Specificity of allergen skin testing in predicting positive open food challenges to milk, egg and peanut in children, Clin. Exp. Allergy, 30, 1540, 2000. 5. Baker, E., Food allergy, Vet. Clin. North Am., 4, 79, 1974. 6. Scott, D.W., Immunologic skin disorders in the dog and cat, Vet. Clin. North Am., 8, 641, 1978. 7. White, S.D. and Sequoia, D., Food hypersensitivity in cats: 14 cases (1982-1987), J. Am. Vet. Med. Assoc., 194, 692, 1989. 8. Rosser, E.J.J., Diagnosis of food allergy in dogs, J. Am. Vet. Med. Assoc., 203, 259, 1993. 9. Wills, J. and Harvey, R., Diagnosis and management of food allergy and intolerance in dogs and cats, Aust. Vet. J., 71, 322, 1994. 10. Butler, J.M. et al., Pruritic dermatitis in asthmatic basenji-greyhound dogs: a model for human atopic dermatitis, J. Am. Acad. Dermatol., 8, 33, 1983. 11. Li, X. et al., Strain-dependent induction of allergic sensitization caused by peanut allergen DNA immunization in mice, J. Immunol., 162, 3045, 1999. 12. Albani, S. et al., Diagnostic value of a lymphocyte stimulation test in cow milk protein intolerance, Ann. Allergy, 63, 489, 1989. 13. Matsuda, H., Development of atopic dermatitis-like skin lesion with IgE hyperproduction in NC/Nga mice, Int. Immunol., 9, 461, 1997. 14. Spergel, J.M. et al., Epicutaneous sensitization with protein antigen induces localized allergic dermatitis and hyperresponsiveness to methacholine after single exposure to aerosolized antigen in mice, J. Clin. Invest., 101, 1614, 1998. 15. Spergel, J.M. et al., Roles of TH1 and TH2 cytokines in a murine model of allergic dermatitis, J. Clin. Invest., 103, 1103, 1999. 16. Johansson, S.G., Dannaeus, A., and Lilja, G., The relevance of anti-food antibodies for the diagnosis of food allergy, Ann. Allergy, 53, 665, 1984. 17. Ono, S.J., Molecular genetics of allergic diseases, Annu. Rev. Immunol., 18, 347, 2000. 18. Sicherer, S.H., Clinical update on peanut allergy, Ann. Allergy Asthma Immunol., 88, 350, 2002. 19. Morafo, V. et al., Genetic susceptibility and other factors influencing the induction of cow's milk hypersensitivity, J. Allergy Clin. Immunol., 109 (Abstr.), 287, 2002. 20. Li, X.M. et al., A murine model of IgE mediated cow milk hypersensitivity, J. Allergy Clin. Immunol., 103, 206, 1999. 21. Li, X.M. et al., A murine model of peanut anaphylaxis: T- and B-cell responses to a major peanut allergen mimic human responses, J. Allergy Clin. Immunol., 106, 150, 2000. 22. Li, X.M. et al., Murine model of atopic dermatitis associated with food hypersensitivity, J. Allergy Clin. Immunol., 107, 693, 2001. 23. Institute of Laboratory Animal Resources Commission of Life Sciences NRC, Guide for the Care and Use of Laboratory Animals, National Academy Press, Washington, DC, 1996 (National Institutes of Health publication no. 86-23, revised). 24. Barton, D., HogenEsch, H., and Weih, F., Mice lacking the transcription factor RelB develop T celldependent skin lesions similar to human atopic dermatitis, Eur. J. Immunol., 30, 2323, 2000. 25. Hsu, C.H. et al., Glutathione-S-transferase induces murine dermatitis that resembles human atopic dermatitis, Clin. Exp. Allergy, 26, 1329, 1996. 26. Bieber, T. et al., New insights in the structure and biology of the high affinity receptor for IgE (Fc epsilon RI) on human epidermal Langerhans cells, J. Dermatol. Sci., 13, 71, 1996. 27. Leung, D.Y., Atopic dermatitis: new insights and opportunities for therapeutic intervention, J. Allergy Clin. Immunol., 105, 860, 2000. 28. Sinke, J.D. et al., Immunophenotyping of skin-infiltrating T-cell subsets in dogs with atopic dermatitis, Vet. Immunol. Immunopathol., 57, 13, 1997. 29. Sundberg, J.P., Cordy, W.R., and King, L.E.J., Alopecia areata in aging C3H/HeJ mice, J. Invest. Dermatol., 102, 847, 1994. 30. Sager, N. et al., House dust mite-specific T cells in the skin of subjects with atopic dermatitis: frequency and lymphokine profile in the allergen patch test, J. Allergy Clin. Immunol., 89, 801, 1992.
1391_C27.fm Page 414 Wednesday, November 19, 2003 10:45 AM
414
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
31. Simpson, A.E., Tomkins, P.T., and Cooper, K.L., An investigation of the temporal induction of cytokine mRNAs in LPS- challenged thioglycollate-elicited murine peritoneal macrophages using the reverse transcription polymerase chain reaction, Inflamm. Res., 46, 65, 1997. 32. Gavett, S.H. et al., Interleukin 12 inhibits antigen-induced airway hyperresponsiveness, inflammation, and Th2 cytokine expression in mice, J. Exp. Med., 182, 1527, 1995. 33. Hill, D.J. et al., Recovery from milk allergy in early childhood: antibody studies, J. Pediatr., 114, 761, 1989. 34. Sampson, H.A. and Sicherer, S.H., Eczema and food hypersensitivity, Immunol. Allergy Clin.North Am., 19, 495, 1999. 35. Mihm, M.C.J. et al., The structure of normal skin and the morphology of atopic eczema, J. Invest. Dermatol., 67, 305, 1976. 36. Wuthrich, B., Food-induced cutaneous adverse reactions, Allergy, 53, 131, 1998. 37. Gleich, G.J., Mechanisms of eosinophil-associated inflammation, J. Allergy Clin. Immunol., 105, 651, 2000. 38. Pucci, N. et al., Urinary eosinophil protein X and serum eosinophil cationic protein in infants and young children with atopic dermatitis: correlation with disease activity, J. Allergy Clin. Immunol., 105, 353, 2000. 39. Stander, S. and Steinhoff, M., Pathophysiology of pruritus in atopic dermatitis: an overview, Exp. Dermatol., 11, 12, 2002. 40. Herrick, C.A. et al., Th2 responses induced by epicutaneous or inhalational protein exposure are differentially dependent on IL-4, J. Clin. Invest., 105, 765, 2000. 41. Obara, W. et al., T cells and mast cells as a major source of interleukin-13 in atopic dermatitis, Dermatology, 205, 11, 2002. 42. Kumar, R.K. et al., Role of interleukin-13 in eosinophil accumulation and airway remodelling in a mouse model of chronic asthma, Clin. Exp. Allergy, 32, 1104, 2002. 43. Hamid, Q., Boguniewicz, M., and Leung, D.Y., Differential in situ cytokine gene expression in acute versus chronic atopic dermatitis, J. Clin. Invest., 94, 870, 1994. 44. Sampson, H.A., Broadbent, K.R., and Bernhisel-Broadbent, J., Spontaneous release of histamine from basophils and histamine-releasing factor in patients with atopic dermatitis and food hypersensitivity, N. Engl. J. Med., 321, 228, 1989. 45. Kekki, O.M., Turjanmaa, K., and Isolauri, E., Differences in skin-prick and patch-test reactivity are related to the heterogeneity of atopic eczema in infants, Allergy, 52, 755, 1997. 46. Mudde, G.C. et al., Allergen presentation by epidermal Langerhans' cells from patients with atopic dermatitis is mediated by IgE, Immunology, 69, 335, 1990. 47. Mudde, G.C., Bheekha, R., and Bruÿnzeel-Koomen, C.A., Consequences of IgE/CD23-mediated antigen presentation in allergy, Immunol. Today, 16, 380, 1995. 48. Picker, L.J., Control of lymphocyte homing, Curr. Opin. Immunol., 6, 394, 1994. 49. Salmi, M. and Jalkanen, S., Regulation of lymphocyte traffic to mucosa-associated lymphatic tissues, Gastroenterol. Clin. North Am., 20, 495, 1991. 50. Mackay, C.R., Homing of naive, memory and effector lymphocytes, Curr. Opin. Immunol., 5, 423, 1993. 51. Abernathy-Carver, K.J. et al., Milk-induced eczema is associated with the expansion of T cells expressing cutaneous lymphocyte antigen, J. Clin. Invest., 95, 913, 1995. 52. Beyer, K. et al., Milk-induced urticaria is associated with the expansion of T cells expressing cutaneous lymphocyte antigen, J. Allergy Clin. Immunol., 109, 688, 2002. 53. Beyer, K. et al., Human milk-specific mucosal lymphocytes of the gastrointestinal tract display a TH2 cytokine profile, J. Allergy Clin. Immunol., 109, 707, 2002. 54. Sampson, H.A., Food allergy. Part 1: immunopathogenesis and clinical disorders, J. Allergy Clin. Immunol., 103, 717, 1999. 55. Sampson, H.A. and Jolie, P.L., Increased plasma histamine concentrations after food challenges in children with atopic dermatitis, N. Engl. J. Med., 311, 372, 1984. 56. Sicherer, S.H. and Sampson, H.A., Food hypersensitivity and atopic dermatitis: pathophysiology, epidemiology, diagnosis, and management, J. Allergy Clin. Immunol., 104, 114, 1999. 57. Hamid, Q. et al., In vivo expression of IL-12 and IL-13 in atopic dermatitis, J. Allergy Clin. Immunol., 98, 225, 1996.
1391_C27.fm Page 415 Wednesday, November 19, 2003 10:45 AM
EXPERIMENTAL MOUSE MODEL OF ATOPIC DERMATITIS: INDUCTION BY ORAL ALLERGEN
415
58. Greaves, M., Chronic urticaria, J. Allergy Clin. Immunol., 105, 664, 2000. 59. Leiferman, K.M. et al., Dermal deposition of eosinophil-granule major basic protein in atopic dermatitis. Comparison with onchocerciasis, N. Engl. J. Med., 313, 282, 1985.
1391_C27.fm Page 416 Wednesday, November 19, 2003 10:45 AM
1391_C28.fm Page 417 Tuesday, November 18, 2003 5:42 PM
CHAPTER
28
Experimental Mouse Model of Atopic Dermatitis: Induction by Epicutaneous Application of Allergen Jonathan M. Spergel
CONTENTS I. II. III. IV. V.
History ................................................................................................................................417 Animals ..............................................................................................................................418 Disease Induction...............................................................................................................419 Course of Disease ..............................................................................................................421 Assessment of Disease.......................................................................................................421 A. Clinical Manifestation ...............................................................................................421 B. Histopathology and Immunophenotyping .................................................................422 C. Cytokine and Other Immunology Data.....................................................................422 VI. Therapeutic Response ........................................................................................................422 VII. Lessons Learned.................................................................................................................423 VIII. Relationship to Human Disease.........................................................................................425 IX. Conclusion..........................................................................................................................426 References ......................................................................................................................................426
I. HISTORY The model is based on the induction of atopic dermatitis-like lesions in mice by repeated epicutaneous sensitization. Epicutaneous sensitization is important for atopic dermatitis for several reasons. First, sensitization is occurring at the site of active disease. Second, atopic dermatitis (AD) lesions can be induced by the application of protein antigen in AD patients [1]. Finally, the skin represents a large surface area for possible sensitization with exposure to numerous antigens. It is known that patients with AD are at a high risk with up to 50% of the patients developing asthma. The skin may act as a sensitization site for patients with asthma or allergic rhinitis. The model has potential and has given insight for studying the role of different cell types in the development of AD and possible progression into asthma. The first reported use of epicutaneous sensitization in a murine model was in 1996 by Wang et al. [2], who found that epicutaneous sensitization with ovalbumin without adjuvant could lead to TH2-like response at a concentration of 10 mg and 10 mg/ml. Subsequent studies have shown 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
417
1391_C28.fm Page 418 Tuesday, November 18, 2003 5:42 PM
418
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
4000 3500 3000 2500 ng/ml
2000 Total IgE
1500 1000 500 0 IP
EC
(a) 1000 800 600 ng/ml
Total IgE 400 Specific IgE 200 0 IN
IP
(b) Figure 28.1
Total serum and antigen-specific IgE determination. IP, intraperitoneal sensitization; EC, epicutaneous sensitization; IN, intranasal sensitization. Data from [7] (a) and [3] (b).
that this method of sensitization leads to higher levels of total IgE and specific IgE compared to intraperitoneal (IP) or intranasal sensitization [3,4] (Figure 28.1). Epicutaneous sensitization causes a T cells and eosinophil skin infiltrate with elevated levels of TH2 cytokines. This model also demonstrated that mice develop asthma-like symptoms — hyperresponsiveness to methacholine — after a single exposure to antigen [4]. This indicated that mouse skin may act as a model for human skin sensitization and that the skin may be a site for primary sensitization in atopic patients and the start of the atopic march.
II. ANIMALS Multiple strains of mice have been used in this model (Table 28.1). All strains show a response to epicutaneous allergen induction. In all experiments, female mice aged 4 to 12 weeks are used with the majority of published data on mice based on mice aged 4 to 6 weeks in age. Variations in the intensity of skin inflammation are observed in varying strains. Mice with a greater propensity for TH2 reaction have a stronger reaction compared to mice with TH0 or TH1 phenotype. For example, C57/BL6 had a slightly decreased level of skin inflammation by eosinophils and total infiltrating cells per HPF compared to BALB/c and SV129 mice with BALB/c having the strongest
1391_C28.fm Page 419 Tuesday, November 18, 2003 5:42 PM
INDUCTION BY EPICUTANEOUS APPLICATION OF ALLERGEN
Table 28.1
419
Murine Strains Used
Wild-Type Strains
Skin Sensitizationa mRNA
BALB/c
≠IL-4, IL-5, IFN-g
C57/BL6 SV129 C57BL6xSV129 SV129xBALB/c
≠IL-4, IL-5, Ø≠ IFN-g ≠IL-4, IL-5, IFN-g ≠IL-4 ≠IL-4
WBB6F1
≠IL-4, Ø IFN-g
Airway Challenge PositiverResponse to OVA challenge ND ND ND Positive response to OVA challenge ND
Serum IgE (OVA Specific and Total) Elevated Elevated Elevated Elevated Elevated Elevated
Note: ND, no data. a
All strains had elevated T cells, eosinophils and mast cells in OVA sensitized sites.
Table 28.2
Gene-Deletion Models Used
Gene Deletion
Murine Strain
Skin Sensitization Ø Eos, Ø mast cell, ≠ T cell, NL skin thickness NL
IL-4-/-3,7
BALB/c
IFN-g-/-7
BALB/c
D011.10 IL-5-/-7
BALB/c C57BL/6
TCRa-/-11
C57BL/6
TCRd-/-11 IgH-/-11 Rag2-/-11 CD40-/-11 Stat6-/-9
C57BL/6 C57BL/6 C57BL6xSV129 C57BL6xSV129 C57BL6xSV129
IgE-/-7 CCR3-/-17
SV129 SV129xBALB/c
NL Ø Eos, NL mast cell, NL IL-4 levels
J-KitW/KitW-v16
WBB6F1
NL with absent mast cells, ≠IFN-g, IL-12
≠≠ inflammation No Eos, decreased skin thickness Ø Eos, Ø IL-4, absent skin inflammation NL NL Absent NL ND
Airway Sensitization
Serum and Allergen-Specific IgE
NL lung Eos, T cells
ØØ Total and specific IgE
ND ND ND
≠ Total and specific IgE ≠≠ Specific IgE NL total and specific
ND
ØØ Total and specific
ND ND ND ND Ø Lung Eos
NL total and specific Absent Absent Absent ØØ Total and specific IgG1 Absent NL Total
ND No response to AHR, Ø in lung Eos ND
≠ Total, NL Specific
Note: All results are compared to wild-type controls of the same strain. Eos, eosinophils; ND, no data; NL, normal. Airway hyperreactivity measured by methacholine.
inflammation. C57/BL6 and WBB6F1 had no significant increase in interferon gamma (IFN-g) expression in comparison to BALB/c and SV129 mice strains. Additionally, gene-deletion mice have been studied to examine the role of particular cells, interleukins, or chemokines in the development of allergic sensitization (Table 28.2).
III. DISEASE INDUCTION Female mice aged 4 to 6 weeks in a pathogen-free environment are initially anesthetized with Avertin (Sigma-Aldrich, Milwaukee, WI) or methoxyflurane (Mallinckrody Veterinary, Mundelein, IL) and then shaved with an electric razor. The loose hair was removed by tape stripping four times
1391_C28.fm Page 420 Tuesday, November 18, 2003 5:42 PM
420
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
at the site with Tegaderm (Owens & Minor, N.C., Franklin, MA). This tape stripping also introduces a standardized skin injury as a surrogate for the excoriation induced by scratching in patient with AD. One hundred microgram of OVA (grade V, Sigma Chemicals Co., St. Louis, MO) in 100 ml of normal saline was placed on a 1 ¥ 1–cm patch of sterile gauze, which is secured to the skin with Tegaderm. The antigen is sterile filtered prior to use and is used without adjuvant. The patch was placed for a 1-week period and then removed. Two weeks later, an identical patch was reapplied to the same skin site. Each mouse had a total of three 1-week exposures to the patch; the exposures were separated by 2-week intervals (Figure 28.2). Asthma has three cardinal features: airway inflammation, hyperreactive airways, and increased mucous, which were measured in this model. Prior to any measurement of airway function, mice are sensitized to one 50-ml dose of inhaled OVA in phosphate-buffered solution (PBS) (0.5 mg/ml). Bronchoalveolar lavage (BAL) and lung histology measured airway inflammation [3]. The determination of airway reactivity was measured by response to methacholine, a nonspecific bronchoconstrictor [4]. Mice are anesthetized and ventilated in a whole-body plethysmograph. Pulmonary conductance and dynamic compliance changes were measured in response to methacholine, administered via a jugular venous catheter [5]. Mucous production was measured by cells staining positive for periodic acid-Schiff stain [3]. Serological analysis of immunoglobulin levels was done by standard techniques. Mice were bled and sera were collected 1 day after the end of the series of three sensitizations. The standard PharMingen sandwich ELISA protocol was used to quantify the total amount of IgE in serum. Rat anti-mouse IgE mAb clone R35-72 was used for coating the plates, and rat antimouse IgE mAb clone R35-92 was used for detection. Total IgE was calculated based on absorption at 492 nm from an o-phenylenediamine substrate (Sigma Chemical Co.). IgG1, IgG2a, IgG2b, and IgG3 OVA-specific antibodies were measured as described by Renz et al [6]. Microtiter plates were coated with 50 mg/ml concentration of OVA in 0.1 M NaHCO3 and incubated at 4∞C overnight. The plates were washed with PBS-Tween 20 (0.05%), and then blocked with 3% PBS-BSA for 2 hours at 20∞C. A total of 100 ml of serial dilutions of sera in 1% BSA/PBS were incubated overnight at 4∞C. After washing with PBS-Tween 20, biotin-labeled antimouse 50 Day 1
7
21
Sensitization
28
42
49
Sensitization
51 Sensitization
Sera Level Skin Biopsy Inhalation of OVA
PFT Figure 28.2
Sensitization protocol.
1391_C28.fm Page 421 Tuesday, November 18, 2003 5:42 PM
INDUCTION BY EPICUTANEOUS APPLICATION OF ALLERGEN
421
isotype-specific antibody (1.5 mg/ml) was added for 2 hours. After washing with PBS-Tween, streptavidin-horseradish peroxidase (Amersham Life Sciences, Arlington Heights, IL), diluted 1:500 in 1% BSA/PBS, was incubated for 30 minutes at room temperature. The plates were then washed with PBS-Tween, o-phenylenediamine substrate (Sigma Chemical Co.) was added, and absorption at 492 nm was read. A different method was used to determine IgE OVA-specific antibody, since IgE may represent a small amount of the total antibody response to specific antigen. Plates were coated with rat antimouse IgE (clone R35-72, PharMingen) in 0.1 M NaHCO3 and incubated overnight at 4∞C. The plates were blocked and washed as above, and then the serial dilutions of sera were incubated overnight at 4∞C. After washing with PBS-Tween, biotin-labeled OVA was added and incubated for 2 hours. Streptavidin-horseradish peroxidase and o-phenylenediamine were added and absorption was read as above. The antibody titers of the sample were calculated by comparison with internal standards [2,6]. Anti-OVA IgG serum standards were obtained by pooling sera from five mice sensitized with OVA via the IP route as described above. The standard curve was constructed by a linear regression analysis of the absorbances versus serial dilutions of the positive reference sera. Results are expressed as ELISA titers relative to an internal isotype standard run in each assay [2,6]. The standard was assigned to IgG1-50, IgG2a-40, IgG2b-500, and IgG3-3 arbitrary units. IgE anti-OVA were expressed in nanograms per milliliter by comparison with a standard consisting of purified mouse IgE anti-OVA secreted by the hybridoma TOe. The dosing range of 1 mg to 10 mg in 100 ml has been examined [2]. Ten milligrams per milliliter caused the largest OVA-specific T-cell proliferation [2]. Three or four series of epicutaneous sensitization produced equivalent skin inflammation (J.M.S., unpublished data, 1998). Doses in the range of 0.1 to 1000 mg did not develop any differences in isotype pattern or changes in the number of eosinophils in the lung. Higher doses of OVA did develop an increase in OVA-specific titers [3].
IV. COURSE OF DISEASE In this model, mice are sensitized for 1 week with a 2-week rest followed by a second 1-week period of sensitization, followed by a second rest period of 2 weeks followed by a third sensitization (Figure 28.2). At the end of the third sensitization, mice are examined as detailed below. As the number of sensitization increases, inflammation noted by serological markers and histological changes correspondingly increase. Mice with two rounds of sensitization have minimal skin inflammation; mice with three or four rounds of sensitization give clinically similar histological and serological data. No data have been examined for mice sensitization longer than four rounds or after a single sensitization.
V. ASSESSMENT OF DISEASE A. Clinical Manifestation Mice develop a local inflammation at the site of sensitization. Gross examination of the allergensensitized site shows erythema and inflammation. Mice with increased inflammation also develop increased pruritus evidenced by increased scratching or biting at the site of sensitization. Mice with severe inflammation on occasion have developed oozing that is grossly similar to superinfection of AD lesions.
1391_C28.fm Page 422 Tuesday, November 18, 2003 5:42 PM
422
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
B. Histopathology and Immunophenotyping Mice lesions are biopsied at 24 hours after removal of the third allergen patch (Figure 28.2). The lesions are examined by hematoxylin and eosin staining [4] and immunohistochemistry for T cells, B cells, and mast cells [4]. The lesions have elevated number of eosinophils, mononuclear cells, neutrophils, and mast cells in OVA-sensitized lesions compared to saline-sensitized lesions [4]. Immunohistological analysis for T-cell and B-cell markers has identified an increased number of both ab and gd CD4+ T cells. The OVA-sensitized lesions have an increased thickness of dermal and epidermal layers compared to saline-sensitized lesions [7], creating a potential model for lichenification observed in chronic AD lesions. C. Cytokine and Other Immunology Data Individual cytokine mRNA levels are measured by reverse-transcriptase polymerase chain reaction (RT-PCR) and RNA protection assays [4,7]. The mRNA levels measured by RT-PCR are similar to observed levels in chronic AD lesions [8]. The lesions in BALB/c mice have elevated levels of interleukin-4 (IL-4), IL-5, and interferon (IFN)-gamma in OVA-sensitized lesions compared to saline-sensitized mice. However, there is variation in cytokine expression in different mouse strains; for example, C57/BL6 and WBBF6 had only elevated levels of IL-4 and IL-5 without significant changes in IFN-g. Serological measurements for total IgE and OVA-specific IgG1, IgG2a, IgG2b, Ig3, and IgE were done at the end of the third sensitization. Mice sensitized epicutaneously developed higher levels of total IgE than IP-injected mice with adjuvant. The epicutaneous-sensitized mice developed an elevated OVA-specific IgE, IgG1, and IgG2a titers consist with a TH2 response [4]. Similar to the total IgE, the OVA-specific IgE and IgG1 were higher in epicutaneous-sensitized mice versus the IP-sensitized mice. These serological results indicate a strong TH2 systemic response confirmed by analysis of murine airways. Airway response to the antigen was measured as follows: after mice were sensitized epicutaneously, they were then exposed to one dose of inhaled OVA via nebulizer. Clinical and pathological features of asthma were measured. Similar to humans, mice can develop the three cardinal features of asthma (airway inflammation, increase in mucous secretion, and airway hyperresponsiveness). Mice exposed to inhaled OVA and sensitized epicutaneously to OVA develop airway inflammation with increased eosinophils measured by BAL fluid or on histological analysis compared to mice sensitized with saline and exposed to inhaled OVA or mice epicutaneously sensitized to OVA and exposed to inhaled saline [3,4]. Additionally, increased mucus secretion was indicated by more positive periodic acid-Schiff cells in the dual OVA-sensitized mice [3]. Finally, mice can develop airway hyperresponsiveness similar to wheezing or coughing after being exposed to irritants. Dual OVA-sensitized mice developed increase response to methacholine and nonspecific bronchoconstrictor compared to unsensitized or monosensitized mice. Increased sensitivity to methacholine is diagnostic of asthma, as it is part of the official American Thoracic Society’s definition. Therefore, epicutaneous-sensitized mice can develop all three features of asthma. Extensive work has been done to examine this model in various gene-deletion mice (Table 28.2). Through these gene-deletion mice, the roles of cytokines, immunoglobulins, and co-stimulatory molecules in the skin inflammation process have been identified (see Section VI for details).
VI. THERAPEUTIC RESPONSE No medications have been tried to modify skin inflammation in the epicutaneous-sensitized mice. Studies have examined the role of IFN-gamma and antibodies against IL-13 in the development of lung inflammation. Intranasal IFN-gamma caused a decrease in BAL eosinophil but not
1391_C28.fm Page 423 Tuesday, November 18, 2003 5:42 PM
INDUCTION BY EPICUTANEOUS APPLICATION OF ALLERGEN
423
in the lung tissue eosinophil in IL-4 gene deletion mice indicating that IFN-gamma affects eosinophils differently depending of tissue location [9]. Also, intranasal anti–IL-13 to epicutaneously OVA-sensitized, IL-4 gene–deletion mice inhibited lung inflammation and TH2 response [3]. Therefore, either IL-4 or IL-13 can induce TH2 response in this model of skin sensitization.
VII. LESSONS LEARNED Epicutaneous sensitization has been shown to generate very high levels of total and specific IgE without adjuvants. This skewing with low levels of specific IgG1 indicates that the skin and its antigen-processing cells (APCs) are strong inducers of TH2 phenotype. Additionally, epicutaneous sensitization can cause a systemic sensitization as evidenced by a single inhalation of identical antigen causing airway inflammation observed on BAL and airway hypersensitivity. Gene-deletion mice have been used to examine what factors and cell types are responsible for the skin inflammation and airway sensitivity (Table 28.3), with the majority of studies focused on skin inflammation. The sensitized skin sites developed dermal and epidermal thickening, cellular infiltrate of T cells, eosinophils, and mast cells and elevated levels of IL-4, IL-5, and IFN-gamma mRNA, and increased expression of adhesion molecules for eosinophils and T cells, including the vascular cell-adhesion molecule (VCAM-1) [4]. The role of TH1 versus TH2 in the development of skin inflammation was examined by selective gene-deletion mice. The IL-4 gene-deletion mice (IL-4-/-) have marked reduction or absent TH2 response with an increased in TH1 response, while the IFN-gamma deletion mice have the opposite with an increased TH2 response and absent TH1 response. IL-4-/- mice developed skin inflammation with normal epidermal and dermal thickening compared to wild-type strains sensitized to the same antigen, OVA. But there were major differences in the composition of the cellular infiltrate with a decrease in eosinophil and mast cell numbers with an increase in the number of CD45+, CD3+, CD4+ and CD8+ cells [7]. The difference in skin eosinophilia was not due to eosinophil production or survival as the total peripheral blood eosinophil count, IL-5 protein levels, and VCAM-1 expression in the skin were similar in OVA-sensitized IL-4-/- mice and wild-type congenic mice. The increase in T cells and the decrease in eosinophil were postulated to be based on increased expression of chemokines. OVA-sensitized IL-4-/- mice had an increased expression of MIP-1b, MIP-2, and RANTES compared to the wild-type OVA–sensitized mice at the site of sensitization. These chemokines are known chemoattractants for TH1 cells leading to the increase in T-cell infiltrate. As predicted, the IL-4-/- mice had skewing of cytokine production at OVA-sensitized sites with decreased IgE and increased IgG2a production consistent with TH1 response. Therefore, a TH2 response is not essential for skin inflammation, but IL-4 plays a role in skin eosinophilia. IL-5 gene-deletion (IL-5-/-) mice have no epidermal or dermal thickening compared to wildtype mice with an identical genetic background. IL-5-/- mice had no skin eosinophilia compared to sensitized wild-type mice. Different from the IL-4-/- mice, the IL-5-/- mice had similar levels of CD45+, CD3+, CD4+, and CD8+ cells compared to wild-type controls [7]. The decrease in eosinophils was probably due to the direct effect of IL-5 on eosinophil survival [10]. IL-5 has a direct role in skin inflammation as IL-4-/- mice also had decreased eosinophils but normal skin inflammation. An alternative hypothesis is that the minimal eosinophils and increased lymphocytic infiltrate in the IL-4-/- mice can cause skin inflammation. No skewing of specific IgE and IgG2a was seen in the IL-5-/- mice. The role of TH1 was examined in the interferon gamma deletion mice (IFN-g-/-), which lack a TH1 response. The IFN-g-/- mice had thickening of the dermal layer of the skin but to a lesser degree than wild-type congenic mice [7]. The expression of all types of infiltrating cells (eosinophils, mast cells, and CD45+, CD3+, CD4+, and CD8+ cells) was identical in OVA-sensitized, wild-type, and IFN-g-/- mice. Not surprisingly, IFN-g-/- mice had skewing toward the TH2 profile based on
1391_C28.fm Page 424 Tuesday, November 18, 2003 5:42 PM
424
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
cytokine production at the site of sensitization and specific immunoglobulin production. Therefore, skin hypertrophy is dependent on both IL-5 and IFN-gamma in this model. Total immunoglobulin production or skewing of immunoglobulin production toward the TH1 (IL-4-/- mice) or TH2 (IFN-g-/- mice) phenotype as mice with no IgE production (IgE-deletion mice) or completely absent immunoglobulin production (IgH gene-deletion mice) develop similar cellular infiltrate inflammation compared to wild-type mice [11]. Therefore, immunoglobulins have no direct effect on skin inflammation. The role of B and T cells in the pathogenesis of skin inflammation was also defined by the use of gene deletion mice. Rag2-/- mice have no B or T cells due to a defect in recombination. In the absence of B and T cells, no inflammation occurred by any measure (dermal infiltration, increase in cytokine expression) in the OVA-sensitized Rag2-/- mice [11]. In comparison, IgH-/- mice lack mature B cells, but have a normal complement of T cells. These IgH-/- mice developed a dermal infiltrate of eosinophils and mononuclear cells including CD45+, CD3+, CD4+, and CD8+, equivalent to wild-type mice. Also, an increase in IL-4 mRNA was detected in OVA-sensitized IgH-/- mice. Taken together, these two gene-deletion mice indicate that T but not B cells are essential for the development of skin inflammation [11]. The roles of ab and gd T cells were also examined in this model. Both of these cell types reside in normal mice skin and can secrete a wide array of cytokines. Mice lacking the T-cell receptor alpha chain have a unique T beta-cell population that responds to superantigen but not to conventional antigen [12] gd T cells can produce TH1 and TH2 type cytokines, and are reported to be necessary for development of airway inflammation [13,14]. gd T cells have been implicated in the negative regulation of airway inflammation [15]. The d-/- mice had an increase in eosinophils, and mononuclear cells including CD45+, CD3+, CD4+, and CD8+ cells, similar to wild-type congenic mice. Furthermore, an increased expression of IL-4 mRNA and elevated total and OVA-specific IgE were seen in the d-/- mice equivalent to congenic wild-type mice. In contrast, the a-/- mice failed to show an increase in dermal infiltration of either eosinophils or mononuclear cells. Additionally, no detectable increase of IL-4 mRNA, total or OVA-specific IgE was seen in OVAsensitized a-/- mice compared to OVA-sensitized, wild-type mice. Therefore, ab T cells are essential for the development of skin inflammation, increased cutaneous IL-4 expression, and OVA-specific IgE. gd cells were found to be not essential for the development of skin inflammation [11]. Also, the interaction between CD40 and CD40L was found not to be essential for skin inflammation in this model [11]. CD40–CD40 ligand interaction is essential for immunoglobulin class switching and T- and B-cell interactions. OVA-sensitized CD40-/- mice developed skin inflammation of eosinophils and mononuclear cells comparable to OVA-sensitized wild-type mice. The role of mast cells was also examined in this model in J-KitW/KitW-v (WBB6F1) mice (W/Wv). These mice virtually lack tissue mast cells and possess less than 1.0% of the number of mast cells in the skin of congenic WBB6F1 mice. The cellular infiltrate of eosinophils or CD45+, CD3+, CD4+, and CD8+ cells were not significant different in mast cell–deficient mice compared to their congenic wildtype mice [16]. OVA-sensitization in W/Wv mice had increased in IL-4 expression at the sensitized site similar to wild type, but in contrast, W/Wv mice also had an increase in IFN-g mRNA levels not seen in wild-type mice. Interestingly, total and specific IgE levels were higher at baseline and after OVA sensitization in the W/Wv mice compared to the congenic wild-type mice. These results indicate that mast cells are not essential for dermal infiltrate of eosinophils and not important for development of TH2 response to epicutaneous sensitization. But, mast cells have a role in regulating IFN-g by regulating IL-12 p40 mRNA expression [16]. The role of chemokines in skin inflammation was also examined. CC chemokine receptor 3 (CCR3) is expressed by eosinophils, mast cells, and TH2 cells and is important for the chemotaxis of eosinophils. Mice deficient in CCR3 (CCR3-/-) had normal expression of mast cells, CD3+ T cells, IL-4 mRNA, and OVA-specific IgE after epicutaneous sensitization compared to wild-type
1391_C28.fm Page 425 Tuesday, November 18, 2003 5:42 PM
INDUCTION BY EPICUTANEOUS APPLICATION OF ALLERGEN
425
mice. However, CCR3-/- did not develop local dermal eosinophilia at the site of OVA sensitization. These mice had no evidence of eosinophil products including major basic protein (MBP), indicating that CCR3 is essential for skin infiltrate of eosinophils [17]. The role of epicutaneous sensitization in development of asthma was examined. Similar to humans, mice can develop features of asthma (lung eosinophilia by BAL, increase in mucous secretion, and airway hyperresponsiveness). Mice with sensitized skin develop asthma symptoms. Epicutaneous mice develop all three features of asthma, without any sensitization occurring directly in the airway. For development of airway hyperresponsiveness, mice deficient in IL-4, Stat-6, and CCR3 were examined. IL-4 is not essential for development of BAL eosinophilia and mucus hypersecretion if mice are sensitized epicutaneously in contrast to mice sensitized intranasally, where IL-4 is essential for BAL eosinophilia [3]. In contrast, IL-4 is important for eosinophilia at the primary site of sensitization if via the skin [7] or airway [3]. Stat-6, signal transducer and activator of transcription 6, is essential for the development of TH2 response, as it is part of the downstream signaling pathway for IL-4 and IL-13. Stat-6-/- mice did not develop TH2 response with decreased lung eosinophilia and mucus secretion but still developed a TH1 inflammatory response in the airway [3]. These two results indicate that TH2 response is not needed for developing murine asthma after skin sensitization. CCR3-/- mice had decreased airway eosinophilia by histology or BAL. In addition, these mice did not develop airway hyperresponsiveness after methacholine challenge [17]. This indicates that CCR3 is important for secondary airway response after epicutaneous sensitization. Therefore, immunoglobulins, B cells, mast cells, and CD40 skewing towards TH2 or TH1 phenotype are not essential for allergic skin inflammation. But, ab T cells are essential for development of sensitization in this model. Individual molecules are needed for various elements of the inflammation: CCR3, IL-4, and IL-5 are important for skin eosinophilia; IL-5 and IFN-g are important for skin hypertrophy; and IL-4 and Stat-6 are important for total and specific IgE production. Epicutaneous sensitization is different from intranasal or IP sensitization. In contrast to other methods, epicutaneous sensitization leads to a higher level of total and specific IgE, and does not require IL-4. Another interesting factor is that the tissue eosinophilia differs between primary and secondary sensitization sites seen in IL-4–deficient mice.
VIII. RELATIONSHIP TO HUMAN DISEASE Epicutaneous sensitization with antigen leads to skin inflammation with eosinophils, mast cells, T cells, elevated IgE, skin hypertrophy, a cytokine profile with increased IL-4, and IL-5 mRNA levels with a variable expression of IFN-g mRNA. There are numerous similarities to the human disease of AD. Both the murine model and human disease have elevated total and specific IgE, cellular infiltrate of T cells, and eosinophils. The cytokines profile of elevated IL-4, IL-5, and IFNg mRNA (BALB/c and SV129) is similar to observed cytokines detected in chronic AD lesions. The cytokines detected in C57/BL6 and WBB6F1 are similar to cytokines measured in acute lesions with only elevated IL-4 and IL-5 mRNA levels [18]. Another similarity is that epicutaneous sensitized mice can develop symptoms of asthma, as approximately 50% of patients with AD develop asthma. Gross observation in the mice with more severe inflammation can show excoriation and erythema similar to an acute superinfection. Mice can develop skin hypertrophy similar to lichenification noted in chronic AD lesions. There are differences in the gross histology due to the fact that mice are innately furry animals and humans are not. Another key difference is that human disease is a spontaneous, developing chronic relapsing lesion, while the murine model is induced with three rounds of epicutaneous sensitization mimicking the chronic course.
1391_C28.fm Page 426 Tuesday, November 18, 2003 5:42 PM
426
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
IX. CONCLUSION Epicutaneous sensitization with allergen without adjuvant can produce a strong IgE response. The site of sensitization developed a infiltrate similar to that observed in chronic lesions of AD. The method of sensitization mirrors the chronic relapsing pattern seen in AD with repeat exposure to the allergen. Analyses of the lesions are similar to the cytokines and histology observed in chronic AD lesions. The use of gene deletion mice strains has indicated that the T cells are essential for the development of dermatitis. Finally, the mice may mimic the atopic march, where patients with AD develop asthma and allergic rhinitis as adolescents and adults. In this model, sensitization through the skin can sensitize the airways and mimic signs of asthma.
REFERENCES 1. Mitchell, E.B. et al., Basophils in allergen-induced patch test sites in atopic dermatitis, Lancet, 1, 127, 1982. 2. Wang, L.-F. et al., Epicutaneous exposure of protein antigen induces a predominant TH2-like response with high IgE production in mice, J. Immunol., 156, 4079, 1996. 3. Herrick, C.A. et al., Th2 responses induced by epicutaneous or inhalational protein exposure are differentially dependent on IL-4, J. Clin. Invest., 105, 765, 2000. 4. Spergel, J.M. et al., Epicutaneous sensitization with protein antigen induces localized allergic dermatitis and hyperresponsiveness to methacholine after single exposure to aerosolized antigen in mice, J. Clin. Invest., 101, 1614, 1998. 5. Martin, T. et al., Pulmonary responses to bronchoconstrictor agonists in the mouse, J. Appl. Physiol., 64, 2318, 1988. 6. Renz, H. et al., Aerosolized antigen exposure without adjuvant causes increased IgE production and increased airway responsiveness in the mouse, J. Allergy Clin. Immunol., 89, 1127, 1992. 7. Spergel, J.M. et al., Roles of TH1 and TH2 cytokines in a murine model of allergic dermatitis, J. Clin. Invest., 103, 1103, 1999. 8. Hamid, Q., Boguniewicz, M., and Leung, D.Y.M., Differential in situ cytokine gene expression in acute versus chronic atopic dermatitis, J. Clin. Invest., 94, 870, 1994. 9. Cohn, L. et al., IL-4 promotes airway eosinophilia by suppressing IFN-gamma production: defining a novel role for IFN-gamma in the regulation of allergic airway inflammation, J. Immunol., 166, 2760, 2001. 10. Rothenberg, M., Review articles. Mechanisms of disease: eosinophilia, N. Engl. J. Med., 338, 1592, 1998. 11. Woodward, A.L. et al., An obligate role for T-cell receptor alphabeta+ T cells but not T-cell receptor gammadelta+ T cells, B cells, or CD40/CD40L interactions in a mouse model of atopic dermatitis, J. Allergy Clin. Immunol., 107, 359, 2001. 12. Mombaerts, P. et al., Peripheral lymphoid development and function in TCR mutant mice, Int. Immunol., 6, 1061, 1994. 13. Ferreira, A. et al., Fine-specificity of the immune response to oxazolone. I. Contact sensitivity and early antibodies, J. Immunol., 127, 2366, 1981. 14. Zuany-Amorim, C. et al., Requirement for gammadelta T cells in allergic airway inflammation, Science, 280, 1265, 1998. 15. Lahn, M. et al., gammadelta T cells as regulators of airway hyperresponsiveness., Int. Arch. Allergy Immunol., 125, 203, 2001. 16. Alenius, H. et al., Mast cells regulate IFN-gamma expression in the skin and circulating IgE levels in allergen-induced skin inflammation, J. Allergy Clin. Immunol., 109, 106, 2002. 17. Ma, W. et al., CCR3 is essential for skin eosinophilia and airway hyperresponsiveness in a murine model of allergic skin inflammation, J. Clin. Invest., 109, 621, 2002. 18. Leung, D.Y., Atopic dermatitis: the skin as a window into the pathogenesis of chronic allergic diseases, J. Allergy Clin. Immunol., 96, 302, 1995.
1391_C29.fm Page 427 Tuesday, November 18, 2003 5:44 PM
SECTION
H
Alopecia Areata
1391_C29.fm Page 428 Tuesday, November 18, 2003 5:44 PM
1391_C29.fm Page 429 Tuesday, November 18, 2003 5:44 PM
CHAPTER
29
Spontaneous and Experimental Skin-Graft-Transfer Mouse Models of Alopecia Areata John P. Sundberg, Kevin J. McElwee and Lloyd E. King, Jr.
CONTENTS I. History ................................................................................................................................429 A. Alopecia Areata in Human Is an Autoimmune Inflammatory Disease ....................430 1. Cell-Mediated Immunity in Alopecia Areata......................................................430 2. Humoral Immunity in Alopecia Areata...............................................................431 B. Genetics of Alopecia Areata......................................................................................433 II. Laboratory Animals............................................................................................................434 III. Rationale and Progress in Developing Mouse Models of Alopecia Areata .....................434 A. Humoral Immune System in Mouse Alopecia Areata ..............................................436 B. Cell-Mediated Immune System in Mouse Alopecia Areata .....................................437 1. Cell Transfer and Depletion Studies ...................................................................437 2. Skin Graft Induction Alopecia Areata Model .....................................................437 3. Longitudinal Graft Study.....................................................................................438 4. Mechanisms Involved in Mouse Graft–Induction Model of Alopecia Areata........439 C. Sexual Dichotomy in Mouse Alopecia Areata..........................................................441 D. The Questionable Role of Melanin in C3H/HeJ Mouse Alopecia Areata ...............441 E. Mouse Model to Test Efficacy of Pharmaceutical Products.....................................441 F. Genetics of Mouse Alopecia Areata..........................................................................441 G. New Mouse Model for AA........................................................................................442 IV. Conclusion..........................................................................................................................442 Acknowledgments ..........................................................................................................................442 References ......................................................................................................................................443
I. HISTORY In human patients, alopecia areata (AA) involves patchy hair loss from any hair-bearing region of the body but most frequently affects the scalp. Some individuals with AA progress to more extensive hair loss involving total scalp (alopecia totalis, AT), or the entire body (alopecia universalis, AU). This spontaneous patchy, potentially reversible, nonscarring hair loss has been the focus 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
429
1391_C29.fm Page 430 Tuesday, November 18, 2003 5:44 PM
430
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
of medical research for over 100 years but only recently have concerted attempts been made to understand the activation, pathogenesis, and treatment of AA. A range of hypotheses have been put forward to explain the pathogenesis of human AA. In the 19th century it was suggested that AA was due to infection [1,2], since the waxing and waning of alopecia at different sites resembled local infections and there were apparent epidemics of AA in orphanages and other institutions [3–5]. However, no infectious agent was identified in association with AA [6–8]. More recent research suggested that cytomegalovirus induced or activated AA [9,10], but these data have been refuted [11–15]. The trophoneurotic (neurotrophic, neuropathic) hypothesis of AA development was popular early in the 20th century. Circumstantial evidence stemmed from frequent clinical observations of emotional/physical stress or trauma associated with AA onset [16]. The apparent induction of circumscribed alopecia after sectioning of the cervical ganglion in cats and cases of human alopecia where affected areas corresponded to specific nerve distribution was used as evidence to further support the involvement of the nervous system in AA [2,17,18]. While the potential for nervous system involvement in AA remains [19,20], and stress is questioned as a potential trigger for onset of hair loss [21], the central trophoneurotic hypothesis has lost support. Other hypotheses to explain the pathogenesis of AA included toxic agents, particularly with reports of thallium acetate (rat poison) injection apparently inducing patchy hair loss and exclamation-mark hairs [7,22–24]. Endocrine dysfunction was also suggested as a cause when AA was recognized to be associated with thyroid disease and hormonal fluctuations during pregnancy or menopause [23,25–29]. Although leukocyte inflammation of dystrophic AA affected hair follicles was identified more than 100 years ago [30], the hypothesis that inflammation may be responsible for AA did not gain widespread support until relatively recently. The concept that AA is an autoimmune disease originated in the late 1950s [31]. Regardless of potential triggers and susceptibility factors involved in AA onset, variations on an autoimmune hypothesis for induction and progression of AA remain the most popular current explanation for hair loss [32–34]. A. Alopecia Areata in Human Is an Autoimmune Inflammatory Disease 1. Cell-Mediated Immunity in Alopecia Areata Support of AA as an autoimmune disease currently prevails over other potential hypotheses [35–38]. Observation of peri- and intrafollicular inflammation of the target anagen hair follicle primarily by T lymphocytes in both humans and animal models is compelling [31,39–42] (Figure 29.1 and Figure 29.2). In addition to a lymphocytic infiltrate, there is increased presence of antigen-presenting cells (APCs) such as macrophages and particularly Langerhans cells around, and sometimes within, dystrophic hair follicles [43]. Other evidence indicates that inflammation of hair follicles is present. For example, hair follicles may be transiently immune-privileged sites when in the active anagen-growing phase [44,45]. Part of this immune privilege may come from the near absence of major histocompatibility (MHC) class I or II expression in normal hair follicles [46]. Abnormal expression of class I and class II MHC antigens by AA-affected dystrophic anagen follicles has been observed [47–49], and this has been suggested as a key component of an inflammatory event in AA [50]. Furthermore, inflammatory markers include up-regulation of intercellular adhesion molecule (ICAM) and endothelial cell selectin (Sele, formerly ELAM) expression on the endothelium of blood vessels closely associated with affected hair follicles [41,51,52]. Changes in cytokine levels, particularly activating cytokines such as interleukin-2 (IL-2) and interferon gamma (IFN-g), have been noted during AA inflammation with corresponding alteration of cytokine concentrations after successful topical counterirritant therapy [53].
1391_C29.fm Page 431 Tuesday, November 18, 2003 5:44 PM
SKIN-GRAFT-TRANSFER MOUSE MODELS OF ALOPECIA AREATA
Figure 29.1
431
(A) The predominant feature of human alopecia areata is lymphocytes infiltrating in and around anagen-stage hair follicle bulbs. Higher magnification of the boxed area in (A) illustrates the socalled “busy bees” pattern of lymphocytes (B). (C,D) Inflammation may extend as far as the level of the sebaceous gland. (E) Horizontal sections demonstrate infiltration of lymphocytes around the hair follicles.
2. Humoral Immunity in Alopecia Areata Hair follicle–specific IgG autoantibodies have been found in increased concentrations in the peripheral blood of AA-affected individuals compared to “normal,” nonaffected humans [54,55]. This discovery has been mirrored by identifying hair follicle-specific autoantibodies with
1391_C29.fm Page 432 Tuesday, November 18, 2003 5:44 PM
432
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Figure 29.2
Immunohistochemistry of human biopsies reveals populations of (A) CD4+ and (B) CD8+ T cells (brown) in and around anagen-stage hair follicles in alopecia areata.
Figure 29.3
(A) Alopecia areata in C3H/HeJ laboratory mice can present as focal hair loss over the skull, (B) multiple patches over the body, or (C) essentially total body hair loss. Normal littermates are at left (A–C).
cross-species specificity to hair follicle antigens among humans, dogs, horses, mouse, and rat models of AA [56–62]. The recognition of apparent targeting of the hair follicle structure by humoral factors of the immune system appears to be persuasive circumstantial evidence of immune system involvement in AA-like hair loss. However, several findings do not implicate autoantibodies as a key pathogenic component in AA. Autoantibody-based autoimmune diseases are less prevalent than cell-mediated autoimmune diseases. No consistent target epitopes for hair follicle–specific autoantibodies have been identified in humans, rats, or mice with AA. Up to 30% of healthy humans produce low levels of hair follicle–specific autoantibodies compared to 75% of AA-affected humans [54,55]. In a follow-up study, at 1:100 serum dilution all human AA patients have detectable anti–hair follicle IgG while this occurs in only 40% of controls. Control sera only react with a single band while AA patients react with multiple bands with greater intensity in immunoblot analysis of sera against hair follicle extracts (D. Tobin, personal communication, 2002). The association of hypogammaglobulinemia
1391_C29.fm Page 433 Tuesday, November 18, 2003 5:44 PM
SKIN-GRAFT-TRANSFER MOUSE MODELS OF ALOPECIA AREATA
Table 29.1 Human Gene HLA DQ HLA DR IL-1rn IL-1b IL-1 Km1 MX1 TNFa
433
Purported Loci for Human Alopecia Areata Susceptibility Genes and Mouse Orthologs Human Chromosome
References
Mouse Gene
Mouse Chromosome
6 6 2 2 2 2 21 6
88, 89, 90, 97, 175, 176 88, 97, 175 177 178, 179 179, 180 178, 161, 181, 182 183 151
H2-Ab1 H2-Eb2 Il1rn IL1b IL1a Igk Mx1 Tnf
17, 18.64 cM 17, 18.67 cM 2, 10.0 cM 2, 73.0 cM 2, 73.0 cM 6, 30.0 cM 16, 71.2 cM 17, 19.06 cM
Note: Mouse loci from Mouse Genome Informatics (www.informatics.jax.org).
and AA in a single individual suggests that autoantibodies may not always be the key pathogenic factor [63]. We found that CBA/CaHN-Btkxid/J mice with X-linked immunodeficiency are deficient in IgM and IgG3, but still develop an AA-like disease [64]. Our gene array studies revealed upregulation of a wide assortment of immunoglobulin genes late in the disease, further suggesting that autoantibody production is a secondary, nonspecific event [65]. The direct or indirect involvement of autoantibodies in AA pathogenesis has not been ruled out. Low-level autoantibody production is a common phenomenon in AA [66]. IgG autoantibodies are produced more frequently and in much higher concentrations in AA-affected patients than healthy individuals. Different autoantibody clones may have different roles to play in disease [67]. Some autoantibodies may be disease severity–modifying factors. Other autoantibodies may be produced to help clear antigenic debris and may actually be beneficial to the AA patient [68]. A recent paper [69] suggested that melanocyte-associated T-cell epitopes can function as autoantigens for transfer of AA in a xenograft model. The authors concluded they used immunodominant epitopes but that no single melanocyte antigen is generally associated with AA. However, autoantibody production against melanocyte-associated antigens has not been identified thus far. These results are consistent with our gene array studies that indicated response to melanin-related proteins was a late, nonspecific action in AA [65]. B. Genetics of Alopecia Areata Some forms of AA appear to have a genetic basis [70–72]. Occurrence of AA in identical twins [73–78] or siblings [79], as well as identification of families with several generations of members with AA [71,80,81] suggest that AA may be an inherited disease. The research focus in human AA has been on HLA-D as the most likely region for genes that regulate susceptibility or resistance to AA, on the assumption that AA is an autoimmune disease (Table 29.1). Many other autoimmune diseases have been shown to be associated with a particular MHC class II haplotype [72,82]. Certain haplotypes seem to be associated with predisposal of the individual toward autoimmunity [83–90]. AA may have MHC class II restriction [91–97]. AA has been shown to be associated with several MHC class II alleles, HLA-DQ3, DR4, and DR11. Alleles DQB1 03 and DRB1 1104 are significantly associated with all forms of AA, while DRB1 1104, DRB1 0401, and DQB1 0301 are specifically associated with long-standing and/or extensive AT and AU [98,99]. The reason for autoimmune disease association with certain MHC genes has not been elucidated but may involve molecular and structural alteration of the HLA peptide–binding site and/or a general predisposition to overexpression of HLA antigens on target tissue and APCs [100]. We found significant linkage in our mouse AA model in the homologous region of the murine MHC complex [101]. The increased association of human AA with other autoimmune diseases within the same individual and/or within blood relatives of affected people also provides data suggesting inherited autoimmune susceptibility [102–104]. However, some question the belief that AA is found in
1391_C29.fm Page 434 Tuesday, November 18, 2003 5:44 PM
434
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
increased association with a particular disease such as thyroiditis and vitiligo [105,106]. The success in using immunosuppressive or immunomodulatory treatments in some cases of AA [21,107] also indicates that inflammation of the hair follicle is important in AA; hence the focus in human genetic studies on various immunoregulatory genes.
II. LABORATORY ANIMALS The primary strain of mice used in the development and continuous studies of our models of AA is the C3H/HeJ.
III. RATIONALE AND PROGRESS IN DEVELOPING MOUSE MODELS OF ALOPECIA AREATA Progress in understanding the pathogenesis and genetics of AA and developing new therapies has been severely hampered until relatively recently by the lack of an animal model for AA. Inbred laboratory mice are the best model system to study mammalian genetics. Several other species were proposed as models for AA, but most are poorly characterized or not readily available. They include hair-loss syndromes in dogs, cats, horses, cattle, nonhuman primates, and even a featherloss syndrome in chickens (Table 29.2) [108–114]. The Dundee experimental bald rat (DEBR) has many features of AA and this model is described in detail elsewhere [114–116], including in Chapter 30 in this book. The HLA-B27 transgenic rat develops AA-like and psoriasis-like skin diseases [118]. This transgenic rat model supports the findings that the HLA region of the human genome is a likely site for some genes involved in the pathogenesis of AA. However, the degree of similarity to human AA and severity of the peri- and interfollicular lymphocytic infiltrates have not been described in detail. We reviewed this HLA-B27 rat model in unrelated studies and found it to be unsatisfactory due to minimal perifollicular lymphocytic infiltrates (J. Carroll and J.P. Sundberg, Table 29.2
Spontaneous and Induced Animal Models in Various Species that Resemble Alopecia Areata in Humans
Species C3H/HeJ mouse C3H/HeJ mouse C3H/HeJBir mouse C3H/HeNJ mouse C3H/HeOuJ mouse BALB.2R-H2h2/Lil mouse A/J mouse CBA/CaHN-Btkxid/J mouse HRS/J +/+ mouse HRS/J hr/hr mouse C.B17 Prkdcscid/Prkdcscid mouse CD-18 null mouse Dundee experimental bald rat (DEBR) HLA-B27 rat Domestic dogs Horses Cattle Chicken
Type of Model
Human Disease
Refs.
Spontaneous Graft-induced Spontaneous Spontaneous Spontaneous Spontaneous Spontaneous Spontaneous Spontaneous Spontaneous Xenograft
Alopecia areata-like Alopecia areata-like Alopecia areata-like Alopecia areata-like Alopecia areata-like Alopecia areata-like Alopecia areata-like Alopecia areata-like Alopecia areata-like Papular atrichia Alopecia areata-like
42, 64, 112, 113 135 64 64 64 64 64 64 64 164, 172 134, 184
Targeted mutation Spontaneous
Some features of AA and psoriasis Alopecia areata-like
119 112, 113
Transgenic Spontaneous Spontaneous Spontaneous Spontaneous
Some features of AA and psoriasis Alopecia areata-like Alopecia areata-like Alopecia areata-like Autoimmune feather disease
118 112, 113 113 110, 111, 113 114
1391_C29.fm Page 435 Tuesday, November 18, 2003 5:44 PM
SKIN-GRAFT-TRANSFER MOUSE MODELS OF ALOPECIA AREATA
435
unpublished observations, 2000). The CD18 hypomorph-targeted mutation on the mouse PL/J congenic background, like the HLA-B27 rat, has features suggestive of both AA and psoriasis [119]. Like the DEBR rat and the C3H mouse models for spontaneous AA, these CD18 hypomorph mice will regrow hair after treatment with monoclonal antibodies (MoAbs) against CD4+ and CD8+ lymphocytes, suggesting a common mechanism in all three models. Mapping studies for modifier genes in the CD18 hypomorph congenic stock have progressed slowly (D.C. Bullard, personal communication, 2002). We identified a form of hair loss in aging C3H mice that closely mimics that seen in human AA [42,58,65,112,113,120]. Patchy areas of hair loss on the back, and larger, circumscribed areas on the abdomen, consistently develop in up to 20% of female C3H mice by age 12 months (Figure 29.3). Similar lesions develop at a later age in male mice [42,120]. In humans with AA, there is an equal or greater female to male ratio or a two-fold excess in cases in females [103,121,122]. Areas of alopecia on the dorsal skin wax and wane in severity as in human AA, and often become more generalized as occurs in AT or AU. Histologically, there is a mixed but predominantly mononuclear cell infiltrate in and around anagen hair follicles in mice, as is the case in human AA (Figure 29.4 and Figure 29.5). The infiltrate is localized and does not affect telogen follicles. Club hairs and “exclamation point” hair shafts are present, and both hair bulb melanocytes and keratinocytes are damaged as in human AA [123,124]. Compounds commonly used to treat human AA (i.e., steroids, squaric acid dibutylester, diphencyprone, and FK506) are also therapeutically effective in this AA mouse model [42,125–128]. Lastly, as described below,
Figure 29.4
(A) Histology of the normal mouse skin at the junction of a wave. Short telogen-stage follicles are on the left half of the field and long anagen-stage follicles are to the right. (B) Normal telogen follicles (left) compared to adjacent, inflammed anagen follicles (right) in a mouse with spontaneous alopecia areata. (C) Higher magnification of anagen follicles with the “busy bee” pattern.
1391_C29.fm Page 436 Tuesday, November 18, 2003 5:44 PM
436
Figure 29.5
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
(A) Spontaneous alopecia areata in a C3H/HeJ mouse with marked infiltration of lymphocytes in and around an anagen-stage hair follicle. (B) CD8+ and (C) CD3+ lymphocytes are located in and around the affected hair follicle.
mouse AA is associated with an abnormal antibody response to hair follicles as occurs in humans with AA [58]. A. Humoral Immune System in Mouse Alopecia Areata Our hypothesis was that hair keratins were the initiating target for antibody production that played a primary role in AA onset. Sera were collected on a monthly basis for over 12 months from 105 clinically normal female C3H mice in order to correlate onset of AA with development of specific antibodies directed against anagen hair follicle proteins, including the purported targets, hair keratins. Twenty three (22%) mice developed AA within the study period with onset ranging from 4 to 12 months. Hair follicle antigens were recognized by antibodies present in sera from these C3H/HeJ mice born to AA-affected mothers. The heterogenous nature of the anti–hair follicle antibody responses, even in mice that did not develop AA within the study period, suggests that the development of anti–hair follicle antibodies alone may not be sufficient for the induction of AA-like hair loss [129]. Our gene expression analysis on skin from graft-induced or spontaneous AA mice demonstrated late, nonspecific elevation of numerous immunoglobulin light-chain transcripts [65]. From these studies we concluded that the humoral response is secondary to hair-follicle root sheath disruption by infiltrating lymphocytes. Our second hypothesis, that C3H mice and human AA patients may have a fundamental abnormality in antibody production in general, was based on concurrent studies. A second disease that occurs with AA in both C3H mice and human patients is inflammatory bowel disease (IBD) [130–132]. Both diseases appear to have an underlying dysregulation of the humoral immune system associated with anagen hair follicles (AA) [58] or endogenous bacterial flora (IBD) [133]. Using intercrosses between C3H and C57BL/6J (B6) mice, serum IgG and fecal (secretory) IgA levels directed against E. coli cell-wall antigens and anagen follicles were determined and used as quantitative traits. We identified three loci for fecal IgA levels, one of which mapped near the locus identified initially for mouse AA on mouse Chromosome 6 (LOD score 4.9). Although intriguing,
1391_C29.fm Page 437 Tuesday, November 18, 2003 5:44 PM
SKIN-GRAFT-TRANSFER MOUSE MODELS OF ALOPECIA AREATA
437
no correlation with either IgG or IgA autoantibodies and anagen follicles was identified in the same sera by indirect immunofluorescence on frozen skin sections. No correlation with this locus and AA was found (see below). B. Cell-Mediated Immune System in Mouse Alopecia Areata The diagnostic histological feature of AA is a marked lymphocytic infiltrate in and around anagen-stage hair follicles. Therapeutic down-regulation of this response often resolves the disease, further supporting the cell-mediated immunity basis of AA. The laboratory mouse, with the wide assortment of immunological reagents and genetic tools available, is an ideal model to test hypotheses on the mechanisms of AA. 1. Cell Transfer and Depletion Studies A commonly held view is that AA is an autoimmune disease that is primarily cell mediated in nature. To evaluate the role of the purported effector cells, CD4+ and CD8+ T lymphocytes, these cells were depleted from affected C3H mice using MoAbs [65]. Alternatively, cells from bone marrow, spleen, or draining subcutaneous lymph nodes were removed from affected mice and transferred to unaffected littermates. Our hypothesis was that systemic removal of either CD4+ or CD8+ lymphocytes from bone marrow, spleen, and/or draining lymph nodes should cause resolution of AA in affected mice while cell transfer would induce AA. Partial hair regrowth was observed in MoAb-treated AA mice with a decrease in either CD4+ or CD8+ lymphocytes, but regrowth was not complete and AA returned as the cell populations rose after cessation of MoAb treatment. Reconsititution of the immune system in severe combined immunodeficiency mutant mice (PrkdcScid/PrkdcScid, hereafter referred to as scid/scid mice) yielded various degrees of efficiency of AA induction: bone marrow, 0%; spleen, 30%; and draining lymph nodes, 70% [65]. These studies indicate that lymphocytes and other undefined cell types can induce disease. Efficiency of AA induction reflects the activation state of the lymphocytes, as evidenced by lymph node cells inducing most cases of AA. In conclusion, although activated lymphocytes are clearly the initiators of rodent AA, this does not rule out the possibility that C3H wild-type and scid/scid mice have intrinsic factors (antigenic epitopes) localized in their hair follicles that make them more susceptible to AA as compared to other mouse strains. Our results are similar to those of Gilhar et al. [134] who, using a human skin xenograft model, indicated that primed lymphocytes can cause localized AA. Our mouse studies also show the ability of lymphocytes from affected individuals to cause localized AA. Conversely, an intact or reconstituted immune system can be activated to induce systemic AA. 2. Skin Graft Induction Alopecia Areata Model AA can be passaged by skin grafts to immunocompetent, normal-haired C3H mice (Figure 29.6) [135] and it has no infectious basis [11]. These studies yielded a tool to define the immunological mechanisms and make this AA mouse model more useful for therapeutic testing. Our initial studies defined the parameters needed for reproducibility of this AA model, namely full-thickness skin grafts from C3H mice with AA to normal-haired C3H mice aged 3 months or older. Immunodeficient scid/scid mice did not develop generalized AA and the alopecic graft regrew white hair. AA grafts to immunocompetent C3H wild-type mice resulted in ventral and dorsal patchy AA within 10 weeks that progressed to diffuse AA by 25 weeks after surgery [11]. Current studies are dissecting the changes with time after grafting, in surrounding skin, and skin at distant sites from the grafts as well as using this model to block specific cells or processes critical in the pathogenesis of AA [65,136].
1391_C29.fm Page 438 Tuesday, November 18, 2003 5:44 PM
438
Figure 29.6
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Full-thickness skin grafts from C3H/HeJ mice with alopecia areata to histocompatible C3H/HeJ unaffected mice consistently causes alopecia areata within 10 weeks of surgery. (A) Initial hair loss occurs immediately adjacent to the graft site (dorsal skin) and (B) then at many sites including the ventral skin.
3. Longitudinal Graft Study Mice received grafts and were necropsied at 2-week intervals after surgery. Histopathology, transmission electron microscopy, and indirect immunofluorescence studies were done on the graft site and at distant sites to follow progression of AA based on types of infiltrating cells. RNA was extracted from skin for gene chip“ and quantitative RT-PCR analyses [65]. Histologically, the surgical sites were completely healed by 2 weeks after surgery. There was scarring within the graft itself, enabling easy identification of the borders with normal host skin. These junctions had a narrow but consistent area of anagen-stage hair follicles in the host skin. Beyond this border on the host skin side, the follicles were predominantly in telogen. Those mice that received normal donor skin grafts had little to no inflammation in or around the anagen hair follicles in the graft itself, the normal host skin adjacent to the graft, or distant sites at any time after the graft surgery. In contrast, there was a mixed inflammatory cell infiltrate in and around anagen follicles of both donor and recipient skin from those receiving grafts from AA mice. This dichotomy continued in successive weeks after grafting. Those mice receiving skin grafts from mice with AA developed extensive peri- and interfollicular inflammation, primarily lymphocytic, in anagen follicles located in extensive areas around the graft and at distant sites by 8 weeks after engraftment. This feature persisted at 10 and 12 weeks after grafting. Hair follicles from the AA graft recipients in late anagen and early catagen had a prominent inflammatory component, but also exhibited marked follicular dystrophy in the region of the matrix above the bulb that resulted in disintegration of the hair fiber [137]. Grafts from AA mice onto normal recipients had CD8+ T cells (by IFA) within the graft on day 0. These cells localized immediately adjacent to the graft site by 4 weeks after surgery. By 8 weeks, intense CD8+ cell infiltrates were located in a perifollicular pattern in host anagen-stage hair follicles. CD8+ T-cell infiltration in the dermis was more diffuse and less focused on hair follicles in the graft recipient mice at this time point than typically observed in spontaneous, chronic AA-affected mice. By 10 weeks after surgery, intrafollicular penetration by individual CD8+ T cells was apparent, typical of the spontaneous form of this disease in mice. Similar features were observed at 12 weeks postsurgery. The hair follicle root sheaths expressed ICAM 4 weeks after graft surgery. The intensity of ICAM expression varied with individual hair follicles and persisted to overt hair loss [137]. Transmission electron microscopy of samples taken in the immediate AA graft site revealed isolated lymphocytes in a perifollicular location by 6 weeks after grafting. Disorganization of hair follicle root sheaths was evident by 8 weeks after grafting. Lymphocyte, macrophage, and polymorphonuclear cell infiltration was prominent in peri- and intrafollicular locations (within the outer and inner root sheaths) 8 weeks after grafting. Extensive hair follicle dystrophy was
1391_C29.fm Page 439 Tuesday, November 18, 2003 5:44 PM
SKIN-GRAFT-TRANSFER MOUSE MODELS OF ALOPECIA AREATA
439
apparent by 10 weeks after grafting. Controls (normal skin grafted onto normal, histocompatible recipients) exhibited no apparent hair follicle inflammation or disorganization at any time point after surgery [137]. 4. Mechanisms Involved in Mouse Graft–Induction Model of Alopecia Areata Our current hypothesis, as illustrated in Figure 29.6, is that AA is a complex polygenic trait influenced by epigenetic (primarily environmental) events. An antigenic epitope, either endogenous (our working hypothesis is a hair-specific keratin) or exogenous (infectious), is recognized by antigen-presenting cells (APCs). These APCs have B7.1 and B7.2 lymphocyte co-stimulatory molecules on their surface. APCs migrate to regional lymph nodes. A complex of B7.1 and B7.2 ligands and CD28 T-cell surface receptors in the presence of an antigen signal promotes T-cell proliferation, enhances cytokine production, and induces Bcl-x, which promotes T-cell survival. T cells with CD44var.10 surface receptors migrate to the skin, homing in on hair follicles in the anagen stage of the hair cycle, thus initiating the first stages of clinical AA [138]. Subsequent studies confirmed this and other CD44 variants are up-regulated early and then down-regulated. CD44 is not involved with maintenance of disease, and at early stages CD4+/CD25+ regulatory cells are at a low level [136,139]. Although the CD18 hypomorph-targeted mutant mouse develops a psoriasis/AA-like inflammatory skin disease [119], a true CD18 null mutant develops only spontaneous skin ulcers. The CD18-/- mice cannot mount a contact-sensitivity response, but CD18-/- cells can get primed to antigens, although the primed T cells cannot home to the skin associated with accumulation of CD3-CD44high in lymph nodes [140]. This model provides additional support for the CD44-blocking studies in the AA mouse model. Disruption of hair follicle integrity results in exposure of immunologically privileged sites inciting a secondary humoral response. These secondary responses may play a role in perpetuation of AA. There is strong up-regulation of tumor necrosis factor alpha (TNF-a) mRNA transcripts during the early phase of wound healing in normal mice, with TNF-a levels at 24 hours that were 30-fold greater than those observed in the days just prior to rejection of allografts [141]. TNF-a is a pleiotropic molecule important in promoting normal wound healing [142–144] in addition to its ability to induce necrosis likely to be involved in allograft rejection. Innate immune response functions attributed to TNF-a include (1) a stimulus for migration of APCs from the epidermis to draining lymph nodes [145,146]; (b) induction of the expression of vascular cell adhesion molecule-1 (VCAM-1), ICAM, and SELE [147–150]; and (c) induction of the expression of MHC I molecules [150]. This process is probably important in the initial events of this graft induction model, and possibly also its role in the genetic aspects of AA in humans [151]. Transcript analysis using Affymetrix gene chips“ and selected quantitative RT-PCR were done on RNA from skin of mice with and without AA as well as sequentially after grafting AA-affected skin or normal skin onto C3H/HeJ mice. Cluster analyses revealed various patterns of altered gene expression (Figure 29.7). Analyses focused on early up-regulation of genes involved in lymphocyte activation and late up-regulation of genes coding for variable chains of immunoglobulins were found [65]. Widescale up-regulation of transcripts coding for a large number of immunoglobulins as well as melanin-associated proteins was a late event in this model [65]. Support for the T-cell activation via co-stimulation mechanism comes from the C3H inducible–graft model for AA. We found that AA full-thickness grafts onto C3H/HeJ haired mice induced typical AA within 10 weeks after surgery at multiple sites distant from the graft [135]. Onset of AA is partially or completely blocked after administration of anti-CD44var.10137 or anti-B7.1/B7.2 MoAbs or CTLA4Ig65. While anti-CD44var.10 blocks migration of the activated T cells from the lymph nodes to the skin, blocking of T-cell activation in regional lymph nodes was done through inactivation of B7.1/B7.2 on APCs or down-regulating activation by competing for binding sites.
1391_C29.fm Page 440 Tuesday, November 18, 2003 5:44 PM
440
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
A
B 2
1
0
0
Normalized Frequency
2
1
1
0
-1
-1 2
4
6
10
C
E 2
1
1
0
0
-1
-1 2
4
6
10
C
4
6
10
4
6
10
C
C
2
4
6
10
C
2
4
6
10
C
2 1 0
-1
-1 C
10
I
2
0 10
6
0
0
6
4
1
1
4
2
2
1
2
2
4
6
10
Weeks Figure 29.7
C
F
2
H
2
-1 2
D2
G
C
2
C
AA Graft Sham Graft
Cluster analyses of gene expression patterns. Gray lines indicate response from the time of grafting in mice receiving alopecia areata skin grafts. Black lines indicate changes in gene expression patterns in mice that received normal skin (sham grafts).
Blocking of this pathway with the fusion protein CTLA4-Ig has potential therapeutic benefits in other diseases as well [152]. Similar gene expression studies were done on skin collected from human AT patients compared with normal age, sex, and biopsy site–matched people. Both similarities and differences between the two species were identified indicating a need to correlate stage of disease with gene expression data. The mouse AA-like disease appears to remain relatively active even when it has been ongoing for several months in contrast to human alopecia totalis patients [65]. Regardless, array technology has defined several inflammatory mechanisms involved in AA that could be targets for new treatment interventions. Alopecia areata is a T-cell–mediated autoimmune disease of hair follicles where Fas is expressed on hair follicles and Fas ligand (FasL) is expressed on perifollicular infiltrates. To elucidate whether the Fas-FasL pathway is of pathogenic significance in AA, we investigated whether AA can be induced in Fas (C3H/HeJ-Tnfsf6gld) and FasL (C3.MRL-Tnfrs6lpr) deficient mice and whether AA develops in skin from these mice. We induced AA by grafting AA-affected C3H/HeJ skin onto histocompatible normal (C3H/HeJ +/+), FasL-deficient, or Fas-deficient mice. All +/+ mice developed AA, while no Fas-deficient mice showed hair loss and two of seven FasL-deficient mice developed only transitory, limited AA. Moreover, skin from +/+, C3H/HeJ-Tnfsf6gld, and C3.MRLTnfrs6lpr mice was grafted onto C3H/HeJ mice with extensive AA. Skin grafts from +/+ mice developed hair loss, whereas Fas-deficient and FasL-deficient skin grafts were spared from AA. TUNEL and immunofluorescence studies revealed an increased number of apoptotic cells and expression of Fas on hair follicles as well as expression of FasL on cells of the perifollicular inflitrate in C3H/HeJ mice with AA, whereas in Fas-deficient and FasL-deficient mice apoptotic cells were virtually absent in hair follicles. These results suggest that the Fas-FasL pathway plays an important role in the pathogenesis of AA [153].
1391_C29.fm Page 441 Tuesday, November 18, 2003 5:44 PM
SKIN-GRAFT-TRANSFER MOUSE MODELS OF ALOPECIA AREATA
441
C. Sexual Dichotomy in Mouse Alopecia Areata We observed that female mice develop AA earlier in age and more severely than do males [42]. To investigate the roles of gonadal hormones, we neutered mice, both males and females, allowed them to heal, and then induced AA with skin grafts. This resulted in significant delay in onset of AA [154]. We interpreted these data to be due to a delay in onset of anagen-stage follicles, and dihydrotestosterone supplementation inhibited onset perhaps due to a reduction in immune system activity. These results initially appeared to contradict the work of Oh and Smart [155] as suggested by Stenn et al. [156]. However, a subsequent paper [157] indicated that topical pharmacological application of estradiol yielded opposite effects on hair follicle cycling than did systemic use, thus providing a rational basis for our results. D. The Questionable Role of Melanin in C3H/HeJ Mouse Alopecia Areata A persistent hypothesis is that melanocytes or melanogenesis-related proteins are the target(s) for the immune system in AA. This is mainly due to the clinical observation that white hair often regrows in human patients with AA and these hairs are resistant to future recurrences. We observed white hair regrowth of AA grafts onto immunodeficient mice and in some of the spontaneous cases in C3H and B6 hybrids. To address this hypothesis, we induced formation of white hair using freeze branding in the AA graft model. In 13 of 14 AA-grafted mice, white hairs were not protected from onset of AA. Our interpretation is that white hairs are a result of injury and a secondary effect on hair pigmentation [154]. This conclusion may be further supported by the observation of AAlike phenotypes in several albino strains [64]. Late up-regulation of many melanogenesis-related genes in our graft model also suggests that this may be a secondary event in the pathogenesis of AA [65]. The xenograft model by Gilhar et al. for relapsing AA also recently showed [69] that no single melanocyte antigen is generally associated with AA. E. Mouse Model to Test Efficacy of Pharmaceutical Products Another use of the AA graft model is the production of readily available, reproducible, and predictably induced forms of AA in mice for therapeutic screening studies. Our initial studies showed that spontaneous AA mice would regrow hair with intralesional injections of steroids, similar to human AA patients [42]. A number of other compounds have been used with various degrees of success in human AA including diphencyprone, anthralin, and squaric acid dibutyl ester. These compounds are effective in both the spontaneous, chronic AA mouse model, as well as in the graft induction model [125,128,158]. Experimental compounds are now being tested as well [126,159]. F.
Genetics of Mouse Alopecia Areata
Crosses were initially done using female and male C3H/HeJ mice with alopecia areata or pairs where only one mouse had the disease. Progeny were aged and evaluated for onset of disease. It was quickly obvious that this was not a simple, single, autosomal, recessive, mutation. Rather, some of the F1 generation developed disease suggesting that one or more loci had a dominant or semidominant effect. The low frequency of affected mice in litters suggested that up to four independent, unlinked loci might be invovled in the C3H/HeJ model. An intercross/backcross strategy was used between affected C3H/HeJ females and C57BL/6J mice that never developed AA. Their progeny were then backcrossed with C57BL6J mice with the goal of identifying dominant genes. One potential locus for AA susceptibility was found on mouse Chromosome 6. Within this interval are numerous immunological regulatory genes including Cd8 and Igk [160]. Early
1391_C29.fm Page 442 Tuesday, November 18, 2003 5:44 PM
442
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
unpublished trials with the Affymetrix cytokine profile gene chip“ revealed immunoglobulin kappachain complex (Igk) was up-regulated 50-fold (J. Carroll and J.P. Sundberg, unpublished data, 2000). Studies on human AA patients for Km (Igk polypeptide chain) and Gm (Igg heavy chain) allotypes found linkage disequilibrium for alleles of both genes in humans [161,162]. Based on the human studies and our mapping and gene expression studies, Igk appeared to be a severitymodulating gene in AA. Since many investigators consider autoantibodies to be a secondary event following disruption of the hair follicle root sheaths exposing their immunologically priviledged sites by the cell-mediated response [44,163], it seemed unlikely that mutations or polymorphisms within these genes were the primary cause of AA in either species. Because of the limited simple-sequence–length polymorphisms (SSLPs) available between C3H and B6 used in our initial backcross study, an intercross was set up between C3H/HeJ and CAST/EiJ. This strategy yields numerous polymorphisms in regions of interest and presumably many other potential loci. However, none of 295 F2 mice from this cross developed AA. These studies were terminated and we reverted to an intercross strategy (C3H/HeJ mice with AA crossed with normal C57BL/6J mice). Over 1000 F2 females were evaluated. Analyses revealed two regions of interest. The mouse Chrosome 17 interval (LOD score 10.9) centers around H2 (human HLA ortholog). The second interval, on mouse Chromosome 9, is only suggestive based on a LOD score of 2.0 [101]. G. New Mouse Model for AA We retrospectively and prospectively evaluated a variety of mutant mice at The Jackson Laboratory with various forms of alopecia. Some of these mutants, such as hairless (hr), originally touted as being AU (variant of AA) [164], have been investigated and found to be a totally different disease, papular atrichia [165–173]. We have identified eight different strains that have an AA-like disease (Table 29.2). One congenic strain, BALB.2R-H2h2/Lil, has nail defects and may prove to be a model for the human AA subtype in which patients have nail abnormalities [64]. Graft induction tests with the A/J mice worked but there was a significant delay in time of onset of disease to over 25 weeks compared to 10 weeks with the C3H/HeJ graft-induced model, suggesting that this is a distinct clinical disease or AA subtype. Another mutation arose spontaneously in our C3H production colony that appeared to have a juvenile onset AA-like clinical disease. This mutation (juvenile alopecia, jal) was characterized and the locus mapped to mouse Chromosome 13 [174]. Comparative studies with the spontaneous form of AA in C3H mice and with human AA cases revealed that [jal/jal] mice did not have a form of AA.
IV. CONCLUSION Animal models have been used effectively to understand the mechanisms and genetic basis of many diseases. They become particularly useful for efficacy testing of novel therapeutic approaches to disease. The C3H/HeJ mouse that develops a low background level of AA as they mature has provided a useful model to study this disease. Development of the full-thickness skin-graft model has yielded a highly reproducible model to study the mechanisms of disease and treatments. Availability of the mice coupled with vast resources of knowledge and reagents for inbred laboratory mice have made this a valuable model for studying human AA.
ACKNOWLEDGMENTS We are grateful to D. Boggess, K.A. Silva, J.H. Worcester, and B.A. Sundberg for their technical and graphics support. This work was supported by grants from the National Alopecia Areata Foundation (J.P.S., L.E.K.), the National Institutes of Health (AR43801, RR173, and CA34196,
1391_C29.fm Page 443 Tuesday, November 18, 2003 5:44 PM
SKIN-GRAFT-TRANSFER MOUSE MODELS OF ALOPECIA AREATA
443
J.P.S.), Council for Nail Disorders (J.P.S.), the Dermatology Foundation/Glaxo Dermatology Fellowship (K.J.M.), and the Veterans Administration (L.E.K.). REFERENCES 1. Sabouraud, R., Sur les origines de la pelade, Annals de Dermatologie et dermatologie et syphiligraphie, 3, 253, 1896. 2. Barber, H., Alopecia areata, Br. J. Dermatol., Syph., 33, 1, 1921. 3. Bowen, J., Two epidemics of alopecia areata in an asylum for girls, J. Cutan. Genito-Urinary Dis., 17, 399, 1899. 4. Fox, T.C., On a small epidemic of an areate alopecia, Br. J. Dermatol., 25, 51, 1913. 5. Davis, H., Epidemic alopecia areata, Br. J. Dermatol., 26, 207, 1914. 6. Roxburgh, A.C., The aetiology of alopecia areata and its relationship to vitiligo and scleroderma, Br. J. Dermatol. Syph., 41, 351, 1929. 7. Ormsby, O.S., Diseases of the Skin, 7th ed., Henry Kimpton, London, 1948. 8. Ikeda, T., Produced alopecia areata based on the focal infection theory and mental motion theory, Dermatologica, 134, 1, 1967. 9. Skinner, R.B. et al., Alopecia areata and presence of cytomegalovirus DNA [letter], JAMA, 273, 1419, 1995. 10. Skinner, R.B. et al., A molecular approach to alopecia areata, J. Invest. Dermatol., 104 (Suppl.), 3s, 1995. 11. McElwee, K.J. et al., Murine cytomegalovirus is not associated with alopecia areata in C3H/HeJ mice, J. Invest. Dermatol., 110, 986, 1998. 12. Hernandez, M.J.G. et al., No evidence of cytomegalovirus DNA in alopecia areata, J. Invest. Dermatol., 110, 185, 1998. 13. Tosti, A. et al., No correlation between cytomegalovirus and alopecia areata, J. Invest. Dermatol., 107, 443, 1996. 14. Jackow, C. et al., Alopecia areata and cytomegalovirus infection in twins: genes versus environment?, J. Am. Acad. Dermatol., 38, 418, 1998. 15. Offidani, A. et al., Role of cytomegalovirus replication in alopecia areata pathogenesis, J. Cutan. Med. Surg., 4, 63, 2000. 16. Kingsbury, J., Three cases of alopecia areata associated with ametropia, J. Cutan. Dis., 27, 211, 1909. 17. Freshwater, D., Alopecia areata, Practitioner., 95, 796, 1915. 18. Joseph, M., Experimentelle untersuchungen uber die Atiologie der alopecia areata, Monatshefte fur Praktische Dermatologie, 5, 483, 1886. 19. Hordinsky, M.K. et al., Structure and function of cutaneous nerves in alopecia areata, J. Invest. Dermatol., 104 (Suppl.), 28, 1995. 20. Hordinsky, M.K. and Ericson, M.E., Relationship between follicular nerve supply and alopecia, Dermatol. Clin., 14, 651, 1996. 21. Hordinsky, M.K., Alopecia areata, in Disorders of Hair Growth, Olson, E.A., Ed., McGraw-Hill, New York, 1994, p. 195. 22. Adamson, H.G., Modern Views upon the Significance of Skin Eruptions, John Bale & Sons, London, 1912. 23. Brown, W.H., The aetiology of alopecia areata and its relationship to vitiligo and possibly scleroderma, Br. J. Dermatol. Syph., 41, 299, 1929. 24. Dixon, W.E., Thallium, Proc. R. Soc. Med., 20, 1197, 1927. 25. Meachen, G.N. and Provis, F.L., Case of alopecia areata et totalis, Br. J. Dermatol., 24, 272, 1912. 26. Sabouraud, R., Nouvelles recherches sur l’etiologie de la pelade (pelade et menopause), Annals de Dermatologie et dermatologie et syphiligraphie, 5, 88, 1913. 27. Sabouraud, R., Pelade et goitre exohthalmique, Annales de Dermatologie et dermatologie et syphiligraphie, 5, 140, 1913. 28. Levy-Franckel, A. and Juster, E., La pelade, J. Med. Paris, 44, 631, 1925. 29. Sharma, V.K. et al., Evaluation of thyroid function in north Indians with alopecia areata: response to intravenous injection of 100 micrograms thyrotropin releasing hormone (TRH), J. Dermatol., 26, 339, 1999.
1391_C29.fm Page 444 Tuesday, November 18, 2003 5:44 PM
444
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
30. Giovannini, S., Recherches sur l’histologie pathologique de la pelade, Annales de Dermatologie et de syhiligraphie, 3, 921, 1891. 31. Van Scott, E.J., Morphologic changes in pilosebaceous units and anagen hairs in alopecia areata, J. Invest. Dermatol., 31, 35, 1958. 32. Paus, R., Slominski, A., and Czarnetzki, B.M., Is alopecia areata an autoimmune-response against melanogenesis-related proteins exposed by abnormal MHC class I expression in the anagen hair bulb?, Yale J. Biol. Med., 66, 541, 1993. 33. McDonagh, A.J. and Messenger, A.G., The aetiology and pathogenesis of alopecia areata, J. Dermatol. Sci., 7 (Suppl.), 125, 1994. 34. McDonagh, A.J. and Messenger, A.G., The pathogenesis of alopecia areata, Dermatol. Clin., 14, 661, 1996. 35. Bystryn, J.-C. and Tamesis, J., Immunologic aspects of hair loss, J. Invest. Dermatol., 96, 88, 1991. 36. McElwee, K.J. et al., Alopecia areata: an autoimmune disease? Exp. Dermatol., 8, 371, 1999. 37. Hordinsky, M.K., Alopecia areata: pathophysiology and latest developments, J. Cutan. Med. Surg., 3 (Suppl. 3), 28, 1999. 38. Randall, V.A., Is alopecia areata an autoimmune disease? Lancet, 358, 1922, 2001. 39. Perret, C., Wiesner-Menzel, L., and Happle, R., Immunohistochemical analysis of T-cell subsets in the peribulbar and intrabulbar infiltrates of alopecia areata, Acta Derm. Venereol., 64, 26, 1984. 40. Ranki, A. et al., Immunohistochemical and electron microscopic characterization of the cellular infiltrate in alopecia (areata, totalis, and universalis), J. Invest. Dermatol., 83, 7, 1984. 41. Zhang, J.G. and Oliver, R.F., Immunohistochemical study of the development of the cellular infiltrate in the pelage follicles of the DEBR model for alopecia areata, Br. J. Dermatol.,Br. J. Dermatol., 130, 405, 1994. 42. Sundberg, J.P., Cordy, W.R., and King, L.E., Alopecia areata in aging C3H/HeJ mice, J. Invest. Dermatol., 102, 847, 1994. 43. Wiesner-Menzel, L. and Happle, R., Intrabulbar and peribulbar accumulation of dendritic OKT 6-positive cells in alopecia areata, Arch. Dermatol. Res., 276, 333, 1984. 44. Paus, R., Immunology of the hair follicle, in Skin Immune System (SIS) Cutaneous Immunology and Clinical Immunodermatology, 2nd ed., Bos, J.D., CRC Press, Boca Raton, FL, 1997, p. 377. 45. Barker, C.F. and Billingham, R.E., Immunologically privileged sites, Adv. Immunol., 25, 1, 1977. 46. Westgate, G.E., Craggs, R.I., and Gibson, W.T., Immune privilege in hair growth, J. Invest. Dermatol., 97, 417, 1991. 47. Messenger, A.G. and Bleehen, S.S., Expression of HLA-DR by anagen hair follicles in alopecia areata, J. Invest. Dermatol., 85, 569, 1985. 48. Khoury, E.L., Price, V.H., and Greenspan, J.S., HLA-DR expression by hair follicle keratinocytes in alopecia areata: evidence that it is secondary to the lymphoid infiltration, J. Invest. Dermatol., 90, 193, 1988. 49. Brocker, E.-B. et al., Abnormal expression of class I and class II major histocompatibility antigens in alopecia areata: modulation by topical immunotherapy, J. Invest. Dermatol., 88, 564, 1987. 50. Paus, R., Slominski, A., and Czarnetzki, B.M., Is alopecia areata an autoimmune-response against melanogenesis-related proteins, exposed by abnormal MHC class I expression in the anagen hair bulb? Yale J. Biol. Med., 66, 541, 1993. 51. McDonagh, A.J.G. et al., HLA and ICAM-1 expression in alopecia areata in vivo and in vitro: the role of cytokines, Br. J. Dermatol., 129, 250, 1993. 52. Nickoloff, B.J. and Griffiths, C.E.M., Aberrant intercellular adhesion molecule-1 (ICAM-1) expression by hair-follicle epithelial cells and endothelial leukocyte adhesion molecule-1 (ELAM-1) by vascular cells are important adhesion-molecule alterations in alopecia areata, J. Invest. Dermatol., 96, 91, 1991. 53. Hoffmann, R. et al., Cytokine mRNA levels in alopecia areata before and after treatment with the contact allergen diphenylcyclopropenone, J. Invest. Dermatol., 103, 530, 1994. 54. Tobin, D.J. et al., Antibodies to hair follicles in alopecia areata, J. Invest. Dermatol.,. 102, 721, 1994. 55. Tobin, D.J., Orentreich, N., and Bystryn, J.-C., Autoantibodies to hair follicles in normal individuals, Arch. Dermatol., 130, 395, 1994. 56. Tobin, D.J., Alopecia areata is associated with antibodies to hair follicle-specific antigens located predominantly in the proliferative region of hair follicles, in Hair Research for the Next Millennium, Vanneste, D. and Randall, V., Eds., Excerpta Medica International Congress, Amsterdam, 1996, p. 237.
1391_C29.fm Page 445 Tuesday, November 18, 2003 5:44 PM
SKIN-GRAFT-TRANSFER MOUSE MODELS OF ALOPECIA AREATA
445
57. Tobin, D.J. et al., Hair follicle structures targeted by antibodies in alopecia areata, Arch. Dermatol., 133, 571, 1997. 58. Tobin, D.J. et al., Autoantibodies to hair follicles in C3H/HeJ mice with alopecia areata-like hair loss, J. Invest. Dermatol., 109, 329, 1997. 59. Tobin, D.J., Alhaidari, Z., and Olivry, T., Equine alopecia areata autoantibodies target multiple hair follicle antigens and may alter hair growth-a preliminary study, Exp. Dermatol., 7, 289, 1998. 60. McElwee, K.J., Pickett, P., and Oliver, R.F., Hair follicle autoantibodies in DEBR rat sera, J. Invest. Dermatol., 104 (Suppl.), 34, 1995. 61. McElwee, K.J., Pickett, P., and Oliver, R.F., The DEBR rat, alopecia areata and autoantibodies to the hair follicle, Br. J. Dermatol., 134, 55, 1996. 62. McElwee, K.J., Drummond, S., and Oliver, R.F., Hair follicle specific autoantibodies associated with alopecia areata in sera from the DEBR rat model and humans, in Hair Research for the Next Millennium, Vanneste, D. and Randall, V., Eds., Excerpta Medica International Congress, Amsterdam, 1996, p. 253. 63. Tan, R.S.H. and Samman, P.D., Thymoma, acquired hypogammaglobulinemia, lichen planus, alopecia areata, Proc. R. Soc. Med., 67, 196, 1974. 64. McElwee, K. et al., Spontaneous alopecia areata-like hair loss in one congenic and seven inbred laboratory mouse strains, J. Invest. Dermatol. Symp. Proc., 4, 202, 1999. 65. Carroll, J. et al., Gene array profiling and immunomodulation studies define a cell mediated immune response underlying the pathogenesis of alopecia areata in a mouse model and humans, J. Invest. Dermatol., 119, 392, 2002. 66. Grabar, P., Autoantibodies and the physiological role of immunoglobulins, Immunol. Today, 4, 337, 1983. 67. Maran, R. et al., IgG subclasses of human autoantibodies, Ann. Med. Interne, 148, 29, 1997. 68. El-Roiey, A. et al., Preferential secretion of a common anti-DNA idiotype (16/6 Id) and anti-polynucleotide antibodies by normal mononuclear cells following stimulation with Klebsiella pneumoniae, Immunol. Lett., 12, 313, 1986. 69. Gilhar, A. et al., Melanocyte-associated T cell epitopes can function as autoantigens for transfer of alopecia areata to human scalp explants on Prkdc<scid> mice, J. Invest. Dermatol., 117, 1357, 2001. 70. Colombe, B.W. et al., HLA class II antigen associations help to define two types of alopecia areata, J. Am. Acad. Dermatol., 33, 757, 1995. 71. Van der Steen, P. et al., The genetic risk for alopecia areata in first degree relatives of severely affected patients. An estimate, Acta Derm. Venereol., 72, 373-, 1992. 72. Green, J. and Sinclair, R.D., Genetics of alopecia areata, Australas. J. Dermatol., 41, 213, 2000. 73. Barsky, S. and Gigli, I., Alopecia areata in twins, Arch. Dermatol., 83, 224, 1961. 74. Bonjean, M., Prime, A., and Avon, P., Pelade chez deux jumeaux homozygotes (sic), Lyon Med., 219, 1852, 1968. 75. Cole, G.W. and Herzlinger, D., Alopecia universalis in identical twins, Int. J. Dermatol., 23, 283, 1984. 76. Hendren, S., Identical alopecia areata in identical twins, Arch. Dermatol., 60, 793, 1949. 77. Weidman, A.I., Zion, L.S., and Mamelok, A.E., Alopecia areata occurring simultaneously in identical twins, Arch. Dermatol., 74, 424, 1956. 78. Werth, V.P. et al., Incidence of alopecia areata and lupus erythematosus, Arch. Dermatol., 128, 368, 1992. 79. Insler, M.S. and Helm, C.J., Alopecia areata including the cilia and eyebrows of two sisters, Ann. Ophthalmol., 21, 451, 1989. 80. Hordinsky, M.K. et al., Familial alopecia areata. HLA antigens and autoimmunity formation in an American family, Arch. Dermatol., 120, 464, 1984. 81. Dawn, G. and Kumar, B., Profile of alopecia areata in northern India, Int. J. Dermatol., 35, 22, 1996. 82. Theofilopoulos, A.N., The basis of autoimmunity: Part II. Genetic predisposition, Immunol. Today, 16, 150, 1995. 83. Blum, A. and Miller, H., The major histocompatibility complex and inflammation, South. Med. J., 93, 169, 2000. 84. Campbell, R.D. and Milner, C.M., MHC genes in autoimmunity, Curr. Opin. Immunol., 5, 887, 1993. 85. Corzo, D. et al., Advances in HLA genetics, Exp. Clin. Immunogenet., 12, 156, 1995.
1391_C29.fm Page 446 Tuesday, November 18, 2003 5:44 PM
446
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
86. Tomlinson, I.P. and Bodmer, W.F., The HLA system and the analysis of multifactorial genetic disease, Trends Genet., 11, 493, 1995. 87. Thompson, G., HLA disease associations: models for the study of complex human genetic disorders, Crit. Rev. Clin. Lab. Sci., 32, 183, 1995. 88. Welsh, E.A. et al., Human leukocyte antigen-DQB01 03 alleles are significantly associated with alopecia areata, J. Invest. Dermatol., 103, 758, 1994. 89. Morling, N. et al., DNA polymorphism of HLA class II genes in alopecia areata, Dis. Markers, 9, 35, 1991. 90. Kavak, A. et al., HLA and alopecia areata, Int. J. Dermatol., 39, 589, 2000. 91. Kianto, U. et al., HLA-B12 in alopecia areata, Arch. Dermatol., 113, 1716, 1977. 92. Kuntz, B.M. et al., HLA antigens in alopecia areata, Arch. Dermatol., 113, 1717, 1997. 93. Hacham-Zadeh, S. et al., HLA and alopecia areata in Jerusalem, Tissue Antigens, 18, 71, 1981. 94. Averbakh, E.V. and Pospelo, L.E., HLA antigens in patients with alopecia areata, Vestn. Dermatol. Venereol., 1, 24, 1986. 95. Frentz, G. et al., HLA-DR4 in alopecia areata, J. Am. Acad. Dermatol., 14, 129, 1986. 96. Orecchia, G. et al., Human leukocyte antigen region involvement in the genetic predisposition to alopecia areata, Dermatologica, 175, 10, 1987. 97. Duvic, M. et al., HLA-D locus associations in alopecia areata: DRw52a may confer disease resistance, Arch. Dermatol., 127, 64, 1991. 98. Duvic, M. et al., Analysis of HLA-D locus alleles in alopecia areata patients and families, J. Invest. Dermatol., 104 (Suppl.), 5s, 1995. 99. Colombe, B.W. et al., HLA class II alleles in long-standing alopecia totalis/alopecia universalis and long-standing patchy alopecia areata differentiate these two clinical groups, J. Invest. Dermatol., 104 (Suppl.), 4, 1995. 100. Hang, L. and Nakamura, R.M., Current concepts and advances in clinical laboratory testing for autoimmune diseases, Crit. Rev. Clin. Lab. Sci., 34, 275, 1997. 101. Sundberg, J.P. et al., Major locus on mouse chromosome 17 and minor locus on chromosome 9 are linked with alopecia areata in C3H/HeJ mice, J. Invest. Dermatol., 120, 771, 2003. 102. Gollinck, H. and Orfanos, C.E., Alopecia areata: pathogenesis and clinical picture, in Hair and Hair Diseases, Orfanos, C.E. and Happle, R., Eds., Springer-Verlag, Berlin, 1990, p. 529. 103. Muller, S.A. and Winkelmann, R.K., Alopecia areata. An evaluation of 736 patients, Arch. Dermatol., 88, 290, 1963. 104. Shellow, W.V., Edwards, J.E., and Koo, J.Y., Profile of alopecia areata: a questionaire analysis of patient and family, Int. J. Dermatol., 31, 186, 1992. 105. Puavilai, S., Puavilai, G., and Charuwichitratana, S., Prevalence of thyroid diseases in patients with alopecia areata, Int. J. Dermatol., 33, 632, 1994. 106. Schallreuter, K.U. et al., Vitiligo and other diseases: coexistence or true association? Hamburg study of 321 patients, Dermatology, 188, 269, 1994. 107. Price, V.H. and Khoury, E.L., Alopecia areata, Prog. Dermatol., 25, 1, 1991. 108. Conroy, J.D., Alopecia areata, in Spontaneous Animal Models of Human Disease, Andrews, E.J., Ward, B.C. and Altman, N.H., Eds., Academic Press, New York, 1979, p. 30. 109. Muller, G.H., Kirk, R.W., and Scott, D.W., Small Animal Dermatology, 3rd ed., W.B. Saunders, Philadelphia, 1983. 110. Paradis, M., Fecteau, G., and Scott, D.W., Alopecia areata (pelade) in a cow, Can. Vet. J., 29, 727, 1988. 111. Scott, D.W. and Guard, C.L., Alopecia areata in a cow, Agri-practice, 9, 16, 1998. 112. Sundberg, J.P. et al., Alopecia areata in humans and other mammalian species, J. Invest. Dermatol., 104, 32, 1995. 113. McElwee, K.J. et al., Comparison of alopecia areata in human and nonhuman mammalian species, Pathobiology, 66, 90, 1998. 114. Smyth, J.R. and McNeil, M., Alopecia areata and universalis in the Smyth chicken model for spontaneous autoimmune vitiligo, J. Invest. Dermatol. Symp. Proc., 4, 211, 1999. 115. Michie, H.J. et al., Immunobiological studies on the alopecic (DEBR) rat, Br. J. Dermatol., 123, 557, 1990. 116. Michie, H.J. et al., The DEBR rat: an animal model of human alopecia areata, Br. J. Dermatol., 125, 94, 1991.
1391_C29.fm Page 447 Tuesday, November 18, 2003 5:44 PM
SKIN-GRAFT-TRANSFER MOUSE MODELS OF ALOPECIA AREATA
447
117. Oliver, R. et al., The DEBR rat model for alopecia areata, J. Invest. Dermatol., 96, 97, 1991. 118. Yanagisawa, H. et al., Characterization of psoriasiform and alopecic skin lesions in HLA-B27 transgenic rats, Am. J.Pathol., 147, 995, 1995. 119. Bullard, D.C. et al., A polygenic mouse model of psoriasiform skin disease in CD18-deficient mice, Proc. Natl. Acad. Sci. U. S. A., 93, 2116, 1996. 120. Sundberg, J.P., Vallee, C.M., and King, L.E., Alopecia areata in aging C3H/HeJ mice, in Handbook of Mouse Mutations with Skin and Hair Abnormalities: Animal Models and Biomedical Tools, Sundberg, J.P., Ed., CRC Press, Boca Raton, FL, 1994, p. 499. 121. Safavi, K.H. et al., Incidence of alopecia areata in Olmstead County, Minnesota 1975-1989, Mayo Clin. Proc., 70, 628, 1995. 122. Friedman, P.S., Clinical and immunological association of alopecia areata, Semin. Dermatol., 4, 9, 1985. 123. Tobin, D.J., Fenton, D.A., and Kendall, M.D., Ultrastructural observations on the hair bulb melanocytes and melanosomes in acute alopecia areata, J. Invest. Dermatol., 94, 803, 1990. 124. Tobin, D.J., Fenton, D.A., and Kendall, M.D., Cell degeneration in alopecia areata: an ultrastructural study, Am. J. Dermatopathol., 13, 248, 1991. 125. Shapiro, J. et al., Alopecia areata-like hair loss in C3H/HeJ mice and DEBR rats can be reversed using topical diphencyprone, J. Invest. Dermatol. Symp. Proc., 4, 239, 1999. 126. Freyschmidt-Paul, P. et al., Induction of hair regrowth in C3H/HeJ alopecia areata by treatment with the topical immunosuppressant FK506, J. Invest. Dermatol., 114, 871, 2000. 127. Freyschmidt-Paul, P. et al., Current and potential therapeutic agents for the treatment of alopecia areata, Curr. Pharm. Des., 7, 213, 2001. 128. Gardner, S.P. et al., Normalisation of hair follicle morphology in C3H/HeJ alopecia areata mice after treatment with squaric acid dibutylester, Eur. J. Dermatol., 10, 443, 2000. 129. Gardner, S.H., The Role of Autoantibodies to Hair Follicles in Alopecia Areata, Ph.D. thesis, University of Bradford, UK, 2001. 130. Sundberg, J.P. et al., Inflammatory bowel disease involving the cecum in C3H/HeJ mice, Gastroenterology, 107, 1726, 1994. 131. Grp Italian Std Epidemiologici in Derm, Epidemiological evidence of the association between lichen planus and two immune-related diseases: alopecia areata and ulcerative colitis, Arch. Dermatol., 127, 688, 1991. 132. Treem, W.R. et al., Ulcerative colitis and total alopecia in a mother and her son, Gastroenterology, 104, 1187, 1993. 133. Brandwein, S.L. et al., Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora, J. Immunol., 159, 44, 1997. 134. Gilhar, A. et al., Autoimmune hair loss (alopecia areata) transferred by T lymphocytes to human scalp explants on SCID mice, J. Clin. Invest., 101, 62, 1998. 135. McElwee, K.J. et al., Experimental induction of alopecia areata-like hair loss in C3H/HeJ mice using full-thickness skin grafts, J. Invest. Dermatol., 111, 797, 1998. 136. Zoller, M. et al., Transient CD44 variant isoform expression and reduction in CD4+/CD25+ regulatory T cells in C3H/HeJ mice with alopecia areata, J. Invest. Dermatol., 118, 983, 2002. 137. McElwee, K.J. et al., Alopecia areata in C3H/HeJ mice involves leucocyte mediated root sheath disruption in advance of overt hair loss, Vet. Pathol., in press. 138. Freyschmidt-Paul, P. et al., Treatment with an anti-CD44v10-specific antibody inhibits the onset of alopecia areata in C3H/HeJ mice, J. Invest. Dermatol., 115, 653, 2000. 139. McElwee, K.J. et al., Resistence to alopecia areata in C3H/HeJ mice is associated with increased expression of regulatory cytokines and a failure to recruit CD4+ and CD8+ cells, J. Invest. Dermatol., 119, 142b, 2002. 140. Grabbe, S. et al., B2 integrins are required for skin homing of primed T cells but not for priming naive T cells, J. Clin. Invest., 109, 183, 2002. 141. Borson, N.D. et al., Temporal sequence of transcription of perforin, fas ligand, and tumor necrosis factor-a genes in rejecting skin allografts, Transplantation, 67, 672, 1999. 142. Dieleman, L.A. et al., Kinetics of cytokine expression during healing of acute colitis in mice, Am. J. Physiol., 271, G130, 1996.
1391_C29.fm Page 448 Tuesday, November 18, 2003 5:44 PM
448
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
143. Hubner, G. et al., Differential regulation of pro-inflammatory cytokines during wound healing in normal and glucocorticoid-treated mice, Cytokine, 8, 548, 1996. 144. Parenteau, G.L. et al., Prolongation of skin allografts by recombinant tumor necrosis factor and interleukin-1, Ann. Surg., 221, 572, 1995. 145. Cumberbatch, M. and Kimber, I., Dermal tumour necrosis factor-a induces dendritic cell migration to draining lymph nodes, and possibly provides one stimulus for Langerhans’ cell migration, Immunology, 75, 257, 1992. 146. Cumberbatch, M., Fielding, I., and Kimber, I., Modulation of epidermal Langerhans’ cell frequency by tumour necrosis factor-a, Immunology, 81, 395, 1994. 147. Cotran, R.S. and Pober, J.S., Cytokine-endothelial interactions in inflammatory immunity and vascular injury, J. Am. Soc. Nephrol., 1, 225, 1990. 148. Poper, J.S. and Cotran, R.S., Cytokines and endothelial cell biology, Physiol. Rev., 70, 427, 1990. 149. Kainulainen, V. et al., Suppression of syndecan-1 expression in endothelial cells by tumor necrosis factor-a, J. Biol. Chem., 271, 18759, 1996. 150. Slowik, M.R. et al., Tumor necrosis factor activates human endothelial cells through the p55 tumor necrosis factor but the p75 receptor contributes to activation at low tumor necrosis factor concentration, Am. J. Pathol., 143, 1724, 1993. 151. Galbraith, G.M.P. and Pandey, J.P., Tumor necrosis factor alpha (TNF-alpha) gene polymorphism in alopecia areata, Hum. Genet., 96, 433, 1995. 152. Bugeon, L. and Dallman, M.J., Costimulation of T cells, Am. J. Respir. Crit. Care. Med., 162, S164, 2000. 153. Freyschmidt-Paul, P. et al., Fas-deficient C3H.MRL-Fas mice are not susceptible to alopecia areata after grafting of alopecia areata-affected skin from C3H/HeJ mice, J. Invest. Dermatol., in press. 154. McElwee, K.J. et al., Melanocyte and gonad activity as potential modifying factors in C3H/HeJ mouse alopecia areata, Exp. Dermatol., 10, 420, 2001. 155. Oh, H.S. and Smart, R.C., An estrogen receptor pathway regulates the telogen-anagen hair follicle transition and influences epidermal differentiation, Proc. Natl. Acad. Sci. U. S. A., 93, 12525, 1996. 156. Stenn, K.S., Paus, R., and Filippi, M., Failure of topical estrogen receptor agonists and antagonists to alter murine hair follicle cycling, J. Invest. Dermatol., 110, 95, 1998. 157. Smart, R.C., Oh, H.-S., and Robinette, C.L., Effects of 17-B-Estradiol and ICI 182 780 on hair growth in various strains of mice, J. Invest. Dermatol. Symp. Proc., 4, 285, 1999. 158. Freyschmidt-Paul, P. et al., Successful treatment of alopecia areata-like hair loss with the contact sensitizer squaric acid dibutylester (SADBE) in C3H/HeJ mice, J. Invest. Dermatol., 113, 61, 1999. 159. Tang, L. et al., Topical mechlorethamine autoimmune-arrested follicular activity in mice with an alopecia areata-like disease by targeting infiltrated lymphocytes, J. Invest. Dermatol., 120, 400, 2003. 160. Gibson, D.M., Maclean, S.J., and Cherry, M., Recombination between kappa chain genetic markers and the Lyt-3 locus, Immunogenetics, 18, 111, 1983. 161. Galbraith, G.M.P. and Pandey, J.P., Km1 allotype associated with one subgroup of alopecia areata, Am. J. Hum. Genet., 44, 426, 1989. 162. Galbraith, G.M.P., Thiers, B.H., and Pandey, J.P., Gm allotype associated resistance and susceptibility to alopecia areata, Clin. Exp. Immunol., 56, 149, 1984. 163. Paus, R., Christoph, T., and Muller-Rover, S., Immunology of the hair follicle: a short journey into terra incognita, J. Invest. Dermatol. Symp. Proc., 4, 226, 1999. 164. Ahmad, W. et al., Alopecia universalis associated with a mutation in the human hairless gene, Science, 279, 720, 1998. 165. Sundberg, J.P., Dunstan, R.W., and Compton, J.G., Hairless Mouse, HRS/J hr/hr, Springer-Verlag, Heidelberg, 1989. 166. Sundberg, J.P., The hairless (hr) and rhino (hrrh) mutations, chromosome 14, in Handbook of Mouse Mutations with Skin and Hair Abnormalities: Animal Models and Biomedical Tools, Sundberg, J.P., Ed., CRC Press, Boca Raton, FL, 1994, p. 291. 167. Sundberg, J.P. et al., The “hairless” gene in mouse and man, Arch. Dermatol., 135, 718, 1999. 168. Ahmad, W. et al., Molecular basis for the rhino-8J mouse mutation: a nonsense mutation in the mouse hairless gene, Genomics, 53, 383, 1998.
1391_C29.fm Page 449 Tuesday, November 18, 2003 5:44 PM
SKIN-GRAFT-TRANSFER MOUSE MODELS OF ALOPECIA AREATA
449
169. Christiano, A.M. et al., Molecular Pathology of Papular Atrichia: Hairless Gene Mutations in Humans and Rhino Mice, paper presented at Third International Alopecia Areata Workshop, Washington, DC, 1998. 170. Panteleyev, A.A. et al., Molecular basis for the rhino Yurlovo (hrrhY) phenotype: severe skin abnormalities and female reproductive defects associated with an insertion in the hairless gene, Exp. Dermatol., 7, 281, 1998. 171. Ahmad, W.A. et al., Molecular basis of a novel rhino (hrrh-Chr) phenotype: a nonsense mutation in the mouse hairless gene, Exp. Dermatol., 7, 298, 1998. 172. Panteleyev, A.A. et al., Molecular and functional aspects of the hairless (hr) gene in laboratory rodents and humans, Exp. Dermatol., 7, 249, 1998. 173. Ahmad, W., Panteleyev, A.A., and Christiano, A.M., The molecular basis of congenital atrichia in humans and mice: mutations in the hairless gene, J. Invest. Dermatol. Symp. Proc., 4, 240, 1999. 174. McElwee, K.J. et al., Alopecia areata versus juvenile alopecia in C3H/HeJ mice: tools to dissect the role of inflammation in focal alopecia, Exp. Dermatol., 8, 354, 1999. 175. Colombe, B.W., Lou, C.D., and Price, V.H., The genetic basis of alopecia areata: HLA associations with patchy alopecia areata versus alopecia totalis and alopecia universalis, J. Invest. Dermatol. Symp. Proc., 4, 216, 1999. 176. deAndrade, M. et al., Alopecia areata in families: association with the HLA locus, J. Invest. Dermatol. Symp. Proc., 4, 220, 1999. 177. Tarlow, J.K. et al., Severity of alopecia areata is associated with a polymorphism in the interleukin1 receptor antagonist gene, J. Invest. Dermatol., 103, 387, 1994. 178. Galbraith, G.M. et al., Contribution of interleukin 1 beta and KM loci to alopecia areata, Hum. Hered., 49, 85, 1999. 179. Tazi-Ahnini, R. et al., Association analysis of IL1A and IL1B variants in alopecia areata, Heredity, 87, 215, 2001. 180. Cox, A. et al., An analysis of linkage disequilibrium in the interleukin-1 gene cluster, using a novel grouping method for multiallelic markers, Am. J. Hum. Genet., 62, 1180, 1998. 181. Dugoujon, J.M. et al., Gm and Km allotypes in autoimmune diseases, G. Ital. Cardiol., 22, 85, 1992. 182. Dugoujon, J.M. and Cambon-Thomsen, A., Immunoglobulin allotypes (GM and KM) and their interactions with HLA antigens in autoimmune diseases: a review, Autoimmunity, 22, 245, 1995. 183. Tazi-Ahnini, R. et al., Structure and polymorphism of the human gene for the interferon-induced p78 protein (MX1): alopecia areata association with the Down syndrome region, J. Invest. Dermatol., 114, 827, 2000. 184. Gilhar, A. et al., Alopecia areata is a T-lymphocyte mediated autoimmune disease: lesional human T-lymphocytes transfer alopecia areata to human skin grafts on SCID mice, J. Invest. Dermatol. Symp. Proc., 4, 207, 1999.
1391_C29.fm Page 450 Tuesday, November 18, 2003 5:44 PM
1391_C30.fm Page 451 Tuesday, November 18, 2003 5:46 PM
CHAPTER
30
Spontaneous Rat Model of Alopecia Areata in the Dundee Experimental Bald Rat (DEBR) Kevin J. McElwee
CONTENTS I. II. III. IV. V. VI.
History ................................................................................................................................451 Laboratory Animals: Model Establishment and Development .........................................452 Disease Susceptibility ........................................................................................................453 Course of Disease ..............................................................................................................453 Genetics ..............................................................................................................................455 Assessment of Disease.......................................................................................................456 A. Clinical Manifestation ...............................................................................................456 B. Histopathology Examination .....................................................................................457 C. Immunophenotyping ..................................................................................................458 D. Autoantibodies ...........................................................................................................459 VII. Therapeutic Responses.......................................................................................................461 A. Corticosteroids ...........................................................................................................461 B. Contact-Sensitizing Agents........................................................................................461 C. Cyclosporin A ............................................................................................................462 D. FK506 ........................................................................................................................462 E. In Vivo Lymphocyte Depletion..................................................................................462 VIII. Lessons Learned.................................................................................................................463 IX. Conclusion..........................................................................................................................465 Acknowledgments ..........................................................................................................................465 References ......................................................................................................................................465
I. HISTORY Human alopecia areata (AA) is a nonscarring, inflammatory based hair loss disease that is relatively common in the dermatology clinic, accounting for 2% of new dermatology outpatients in the United Kingdom and United States [1]. The life-time risk for AA development in the general population is 1.7% and at any one time between 0.05% and 0.1% of the population will express the lesion, AA [2]. Although not a life-threatening condition, the increasingly image-oriented society 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
451
1391_C30.fm Page 452 Tuesday, November 18, 2003 5:46 PM
452
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
in which we live makes hair loss an emotionally disturbing event for many people with AA [3]. In response, national and international support groups have been organized, primarily by AA-affected patients themselves, such as the National Alopecia Areata Foundation (NAAF) in the United States, Alopecia Areata Deutschland (AAD) in Germany, and the Association Alopecia Areata (AAA) in France. These groups are involved in patient support, information distribution and education of the general population, and fund-raising for research. Such groups have facilitated an increase in awareness and understanding of AA, and have catalyzed AA research through the development of research guidelines and organization of research workshops [4–6]. In addition, most animal models for AA thus far utilized in research have been financially supported by the National Alopecia Areata Foundation and largely owe their existence to these support and pressure groups. Circumstantial evidence suggests that AA may have an autoimmune pathogenesis where anagenstage hair follicles become the target for an immune cell attack [7]. The evidence primarily consists of observation of a mononuclear cell infiltrate in and around dystrophic hair follicles [8,9] and the knowledge that some people with AA can regrow hair when undergoing immunosuppressive therapy [10]. More recently, production of autoantibodies specific to hair follicle antigens have been identified with greater frequency in AA-affected individuals [11]. These and other circumstantial evidence are of some assistance in understanding the pathogenesis of AA [12]. However, detailed characterization and functional studies are required to demonstrate the significance of these circumstantial observations and to elucidate disease mechanisms. Primarily due to ethical limitations, functional studies cannot readily be conducted in humans. Consequently, animal models of human AA are required. AA is a relatively rare form of hair loss in nonhuman mammals and few cases have been identified beyond reasonable doubt. Isolated examples of AA-like disease have been found in dogs, cats, horses, and nonhuman primates [13,14]. However, the use of such affected individual animals in AA research is restricted due to their limited numbers, genetic variability, and scattered geographical distribution. More recently, an AA-like condition associated with a vitiligo-like disease has been identified in an inbred chicken strain [15]. However, rodents are the most popular species from which to derive animal models of human diseases due to their small size, the inbred nature of many strains, and extensive availability of rodent reagents for use in scientific research [16]. Inbred rodents living in a controlled environment provide useful models to explore specific aspects of disease and to perform controlled experiments that cannot be conducted with humans. With information derived from animal models, studies on humans may be designed to confirm animal model observations. Monitoring of mice has identified a low frequency of spontaneous AA-like conditions in multiple strains [17], but to be of practical value a relatively high incidence of spontaneous or induced disease expression is required. There are two spontaneous rodent models of spontaneous AA that have been employed in laboratory research that involve a relatively high disease phenotype penetrance: the C3H/HeJ mouse [18] and the Dundee Experimental Bald Rat (DEBR). The DEBR is described here.
II. LABORATORY ANIMALS: MODEL ESTABLISHMENT AND DEVELOPMENT The DEBR is a hooded rat strain that was originally developed in 1984 and maintained at the University of Dundee, Scotland [19,20]. Initially, spontaneous alopecia was identified in an inbred stock of BDIX rats at the Ninewells Hospital and University Medical School in Dundee. The University of Dundee BDIX colony was derived from the Medical Research Council Laboratory of Animal Health (LAH) center at Carshalton, Surry, England. In turn, the LAH Carshalton center colony was derived from a cross between BDI and BDVIII with subsequent selection of brother–sister pairs for agouti coat color and dark, pigmented eyes by Druckrey [21] and arrived at the LAH Carshalton center in or before 1977. The LAH Carshalton center became the Experimental Embryology and Teratology Unit in 1981 and was finally closed in 1988. Consequently, the original BDIX
1391_C30.fm Page 453 Tuesday, November 18, 2003 5:46 PM
SPONTANEOUS RAT MODEL OF ALOPECIA AREATA IN THE DUNDEE EXPERIMENTAL BALD RAT
453
colony from which DEBRs are derived no longer exists. The Babraham Institute in Cambridge, England indicated expression of similar hair-loss lesions in an LAH Carshalton-derived BDIX colony in 1994, but this colony also no longer exists. Attempts to locate other BDIX colonies and substrains derived from the LAH Carshalton center have not been successful. Existing strains of BDIX rats are all apparently derived from a single primary source, the BDIX/Han substrain from the Medizinische Hochschule in Hannover, Germany, which obtained the BDIX strain direct from Druckrey in 1979. Currently, no hereditary nonscarring, inflammatory alopecia lesions are known to be reported in the BDIX/Han strain or derivate colonies and substrains. The original BDIX colony maintained at the University of Dundee suffered from exceptionally poor fecundity. To rescue the phenotype for future research use, two BDIX rats were crossed with Wistar rats (Charles River, Kent, England) and the DEBR descendants of this cross were derived from full-sibling matings. Two separate DEBR substrains — one black hooded and one brown hooded — exist. Maintained as distinct colonies, the black and brown hooded substrains exhibit similar gross morphological and histological features.
III. DISEASE SUSCEPTIBILITY The hooded rat phenotype was introduced onto the normal, agouti-haired BDIX rats when the initial Wistar cross and subsequent sib matings introduced the recessive “extension factor” hooded gene (H) on rat Chromosome 14 [22]. The recessive gene introduced a pelage coat of white hair on the flanks and abdomen and pigmented hair on the head/neck with extension along the dorsal midline in DEBR rats (Figure 30.1A). Two separately inbred DEBR substrains exist, one black hooded and the other brown hooded, but both substrains have essentially the same AA phenotype properties. DEBR rats develop a full coat of hair within the first 2 weeks of life and hair growth continues normally. Hair loss follows the normal pattern of hair replacement in rats with the earliest expression observed in the third replacement-coat generation [19]. Spontaneous hair loss in the first or second pelage coat generation has never been observed. The first onset of overt hair loss can occur from age 4 months of in females and from age 6 months in males. The initiation of overt hair loss onset may occur at any time in adult rats, although onset is most commonly observed in females aged 5 to 8 months and in males aged 7 to 10 months. If hair loss has not initiated by 12 months of age, the rats are very unlikely to develop AA. Spontaneous expression of AA is apparent in 42% of individuals by age 18 months in a colony with equal frequencies of each sex. However, females are more likely to be affected than males by a ratio of approximately 4:1. Universal alopecia may be observed in approximately 15% of females affected by AA and 5% of affected males. Spontaneous hair regrowth can be observed in approximately 15% of AA-affected rats, although spontaneous regrowth is rarely observed before age 12 months. Twenty-four percent of DEBR rats have nail deformities with the frequency of expression equally distributed between males and females.
IV. COURSE OF DISEASE Occasionally, AA-affected rats may present with a general diffuse thinning of the pelage coat instead of the more distinctive patchy hair-loss presentation. However, hair loss most typically develops as multiple lesions and progresses with approximate lateral symmetry. Hair loss onset can be associated with, and occasionally preceded by, a slight loss of pigmentation in hair in the hooded region. Hair loss is almost always initiated first on the face around the nose and vibrissae follicles. These alopecic lesions typically spread back over the head around the eyes (Figure 30.1B). The vibrissae will continue to grow hair for some months despite the presence of dystrophic
1391_C30.fm Page 454 Tuesday, November 18, 2003 5:46 PM
454
Figure 30.1
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
A
B
C
D
E
F
Gross presentation of hair loss in DEBR. Normal-haired DEBR (A) typically first lose hair on the face around the myastacial pads and eyes (B) with first onset observed from age 4 months in females. This initial presentation quickly progresses and separate lesions develop on the flanks, (C) typically at age 6 to 10 months in females. Flank hair loss may expand to leave a collar of hair (D) and sometimes a strip of hair along the mid-dorsum. Approximately 20% of AA-affected rats develop a near-universal hair loss at age 12 to 18 months (E). Spontaneous hair regrowth can occur in a subset of aged, AA-affected DEBR (F). Hair regrowth is nonpigmented, and rarely regains color. Any areas of pigmented hair, in this case on the head between the ears (F), is usually hair that survived the initial lesion.
interdigitating pelage follicles. However, eventually the vibrissae too will become dystrophic, visible as kinked, short hair fibers, and eventually production of vibrissa fibers may cease altogether. Hair loss separately occurs on the flanks, most usually as two separate areas with approximate bilateral symmetry that expand and which may coalesce with time (Figure 30.1C and D). The maximum extent of lesion expression can be very heterogeneous, even between littermates, but overall, female rats are more commonly affected than males, as they lose hair more rapidly and to a greater extent. The most common end-stage presentation involves almost complete loss of hair from the head and extensive loss on the flanks, sometimes with lesions separated by a collar of hair growth around the neck and forelimbs (Figure 30.1D), a strip of hair growth along the dorsal midline, and some limited diffuse hair growth on the ventral surface. Some rats may progress further with loss of the hair collar but retain hair along the dorsal midline and diffuse ventral hair growth. Notably, the area of hair most resistant to AA is located between the anus and the base of
1391_C30.fm Page 455 Tuesday, November 18, 2003 5:46 PM
SPONTANEOUS RAT MODEL OF ALOPECIA AREATA IN THE DUNDEE EXPERIMENTAL BALD RAT
A
Figure 30.2
455
B
Nail presentation in DEBR. Onchogryphosis is a common feature of the digits of the hind paws (a) and is less frequently observed on the forepaws of DEBR. The aberrant nail presentation does not correlate with the degree of hair loss. Onchogryphosis is possible in the absence of any overt hair loss. Histology shows aberrant nails to be devoid of apparent inflammation (b). Bar = 2 mm.
the tail in both males and females, and typically this is the last area of hair to be lost in the minority of rats that progress to universal alopecia (Figure 30.1E). During the progressive alopecia development phase, regions of bald skin containing hair follicles that originally produced pigmented hair can usually be identified by a bluish hue, a result of melanin deposition in the dystrophic anagen follicles. In aged rats with long-term, extensive alopecia, melainin incontinence is not apparent in the skin and a distinction between pigmented and nonpigmented regions cannot easily be made by gross observation (compare Figure 30.1D and E). If spontaneous hair regrowth occurs in a region of skin that contained pigmented hair before lesion development, the hair regrowth is predominantly white and rarely regains normal pigmentation (Figure 30.1F). Where present, dystrophic nails typically present as exceptionally long and twisted (onchogryphosis) with minor irregularities on the nail surface (Figure 30.2). Although females show a greater frequency of hair loss, there is no sex bias or alteration of how the nail abnormalities present. In addition, it is not necessary for rats to have extensive hair loss for nail deformities to occur. Some rats with only limited hair loss on the head can have severe onchogryphosis. Unlike human AA, extreme nail involvement resulting in near absence of recognizable, cornified material has not been observed in DEBR. No other lesions have been identified in rats with AA; however, beyond age 2 years, rapid weight loss and pursuant death is common with AA-lesion–affected DEBR as compared to normal-haired DEBR of the same age. Both black- and brown-hooded DEBR substrains demonstrate a high degree of sensitivity to anesthetic such that anesthetic application carries an increased risk of death as compared to PVG/OlaHsd and Wistar rat strains. This can present significant problems in long-term studies involving repeated anesthetic exposure.
V. GENETICS Studying inbred rodent models offers significant advantages when considering genomewide screens to identify AA susceptibility and severity-modifying genes. Their small size, rapid proliferation, controlled cross-breeding, and availability of microsatellite markers, enables a highly accurate genetic comparison of AA-affected and nonaffected rodent offspring. In inbred strains, a disease should be monomorphic between individuals and represent a specific type of AA if the disease is due to a single dominant or recessive gene. However, the unpredictable onset, variability
1391_C30.fm Page 456 Tuesday, November 18, 2003 5:46 PM
456
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
in the phenotype presentation, and variable phenotype expression frequency and distribution in rodent models, indicate that AA is a complex, polygenic trait and likely involves significant gene–environment interaction [23]. Two separately inbred DEBR substrains exist: one black hooded with a BDIX-derived RT1dv1 haplotype [24] and the other brown hooded with a Wistar-derived RT1l haplotype. Both substrains are inbred to generation F40 or more as of August 2002. Notably, the original BDIX strain from which the DEBR substrains have been derived has a defect in the expression of RT1.B, apparently due to absence of the structural or controlling gene, while RT1.D locus class II molecules are more strongly expressed in BDIX than in other strains [25]. Whether this defect persists in the DEBR substrains is not known. Preliminary breeding investigations show the disease to be genetically dominant and polygenic with incomplete penetrance. DEBR of the brown-hooded substrain have been crossbred with PVG/OlaHsd rats yielding 21% F1 offspring with an overt hairloss phenotype and 26% expression in the F2 generation. The frequency of F1 and F2 rats with a subclinical AA state — that is, no hair loss but limited focal hair follicle inflammation — is significantly higher. Phenotype segregation observation suggests that five gene loci are involved with inheritance of the alopecia phenotype. On the assumption that the DEBR alopecic phenotype is a polygenic disease, the phenotype penetrance rate in the primary DEBR strains is exceptionally high. Genomewide analysis of an F2 intercross between DEBR and PVG/OlaHsd is currently underway. Spontaneous rodent models of AA will play an important role in recognizing candidate gene loci. The location of AA susceptibility genes in the rodent genomes should predict the location of homologous genes in the human genome by the use of comparative maps for mice and humans (available at www.jax.org). Various rodent models may contain common key dominant-susceptibility genes but different minor genetic-susceptibility or severity-modifying genes that may be associated with various phenotype characteristics or involve different interactions with environmental triggers. When the locations of these genetic factors are known in humans, rodent genetics will continue to be useful in the long-term goal of defining gene–gene and gene–environment interactions and identifying candidate severity-modifying genes. In the long term, manipulation of AA models to create transgenic and knockout rodents will define the significance of AA-associated genes. VI. ASSESSMENT OF DISEASE A. Clinical Manifestation A hair-pull test at the periphery of lesions may not be positive in the same way as with humans, as the high ratio of telogen- to anagen-stage hair follicles in rodents is the reverse of what is observed in humans without alopecia. However, examination of hair pulled from the periphery of an AA lesion in DEBR can variably reveal typical telogen club hairs, fiber with tapered, proximal ends, and fibers with irregular form (Figure 30.3). Hair fibers from the hooded region may also exhibit disruption of pigment incorporation with irregular pigment deposits along the length of hair fibers. The majority of hair pulled from the periphery of lesions presents as normal. The repetitive grooming habits of rodents likely remove loose and defective hair fibers quickly. Finding exclamation-mark hairs in a clinical examination of human hair loss is taken as a useful, although not exclusive, diagnostic feature of AA [26]. Very occasionally, exclamation-mark hairs can be identified in AA-affected DEBR, but these are not common. All types of hair follicles present in rodents can become affected including pelage (awl, auchene, zigzag, and guard hairs), vibrissae, eyelid cilia, and tail follicles. Observation of the skin surface in AA lesions within the hooded region reveals apparent exudation of keratinized, pigmented material from some hair follicles. Internal organ examination reveals the presence of pigment in enlarged skin-draining lymph nodes. The spleen may also be enlarged as compared to normal-haired, non-AA-affected DEBR.
1391_C30.fm Page 457 Tuesday, November 18, 2003 5:46 PM
SPONTANEOUS RAT MODEL OF ALOPECIA AREATA IN THE DUNDEE EXPERIMENTAL BALD RAT
A
Figure 30.3
457
B
Hair fiber defects associated with AA in DEBR. Hair fibers obtained from the periphery of active AA lesions in DEBR show a range of aberrant presentations under scanning electron microscopy. A constriction in the diameter of a probable guard hair is a candidate focal point for future breakage (A). Other pelage hairs may show additional focal points of dystrophy (B). Bar = 20 mm.
Skin grafts from lesions transferred to prelesional DEBR rats enabled regrowth of normal hair from initially dystrophic hair follicles. A reciprocal study resulted in haired, prelesional skin grafts swiftly developing a dystrophic state when transferred to mature, lesional animals. Lesional skin grafted to nude mice regrew normal-length hair. These simple studies suggest the importance of systemic influence over the localized affected hair follicles, potentially by the immune system, and that AA-like lesions in DEBR rats are a true, nonscarring, reversible form of AA. B. Histopathology Examination Histopathological features of human AA include peri- and intrafollicular lymphocytic infiltrates of anagen-stage hair follicles, while catagen- and telogen-stage hair follicles remain unaffected. In association with this focal inflammation, severe hair follicle dystrophy, including root sheath and hair cortex disruption, is observed and subsequent miniaturization of these follicles may occur (Figure 30.4). Although there is severe disruption of hair follicle organization, total destruction of hair follicles, or scarring, usually does not occur in AA, and hair regrowth is possible either spontaneously or due to a successful treatment. For the histopathology of the DEBR model, the biopsy position and lesion duration are important in defining infiltrate intensity. Biopsies from the center of long-standing lesions show a significantly reduced infiltrate in comparison to biopsies taken from the edge of an actively advancing bald patch, as is similarly observed with human AA. The intensity of inflammation around anagen-stage hair follicles can also be variable from rat to rat. It is important to bear this in mind when utilizing the DEBR model. In comparison to normal hair production in unaffected rats or in rats prior to the onset of AA, hair follicles are dystrophic in lesional DEBR. The degree of dystrophy varies within each rat. Most typically, hair follicles at the edge of an advancing area of alopecia are most severely inflamed and correspondingly have the greatest degree of morphological disruption (Figure 30.4B and E). With increasing age and stabilization of the alopecia, the degree of inflammation around anagenstage hair follicles is significantly reduced while hair follicles may still exhibit extensive dystrophy
1391_C30.fm Page 458 Tuesday, November 18, 2003 5:46 PM
458
Figure 30.4
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
A
B
C
D
E
F
Anagen-stage hair follicle dystrophy and inflammation in DEBR. Prior to hair loss, anagen-stage pelage (A) and guard hair follicles (D) demonstrate normal morphology and no discernable aberrations. However, anagen-stage hair follicles at the periphery of advancing AA lesions may exhibit extensive dystrophy associated with an intense peri- and intra-follicular inflammation (B, E). In long-term lesions, anagen-stage pelage (C) and guard hair follicles (F) are often smaller with hair bulbs located in the upper dermis, and exhibit extensive dystrophy and no significant hair fiber production, but the degree of leukocyte inflammation is typically much reduced. Bar = 25 mm.
(Figure 30.4C and F). As the lesions progress, those normally pigmented hair follicles in the hooded region exhibit the phenomenon of melanin, or pigmentary, incontinence. Pigment normally incorporated into the hair fiber can be observed at the base of hair follicles beside the dermal sheath and occasionally within the dermal papilla of vibrissae, pelage, and pigmented tail follicles. Macrophages containing melanin can be identified in regional skin-draining lymph nodes. Samples taken from AA lesions for transmission electron microscopic examination reveal prominent lymphocyte and macrophage infiltration to peri- and intrafollicular locations (Figure 30.5). C. Immunophenotyping Development of hair loss is correlated with peri- and then intrafollicular mononuclear cell infiltration of anagen-stage vibrissae and pelage follicles. Well before the onset of hair loss, such lymphocytic activity is foreshadowed by the development of an increased perifollicular presence of MHC class II+ cells, macrophages, and particularly CD8+ cells [27,28]. In lesional follicles where there is overt disruption of the hair follicle, the interfollicular infiltrate is primarily composed of CD4+ cells, but CD8+ cells and macrophages constitute the intrafollicular infiltrate [28]. The CD4+ to CD8+ cell ratio of perifollicular cells is around 2:1 and coincides with up-regulation of MHC class II expression in the hair follicle, similar to that observed in humans [27,28]. It is probable that the density of the mononuclear infiltrate and the ratio of CD4+:CD8+ cells varies with time.
1391_C30.fm Page 459 Tuesday, November 18, 2003 5:46 PM
SPONTANEOUS RAT MODEL OF ALOPECIA AREATA IN THE DUNDEE EXPERIMENTAL BALD RAT
A
459
K
B H
L
L L K C
V
K
F
F
L L
Figure 30.5
Peri- and intrafollicular infiltration of anagen-stage hair follicles in AA-affected DEBR. Transmission electron microscopy reveals a leukocyte (L) presence in the periphery in blood vessels (V) between collagen bundles (C) and adjacent to dystrophic hair follicles (H). Some leukocytes penetrate to intrafollicular locations (B), in this example interdigitating between fibroblast-like cells (F) of the dermal sheath and and keratinocytes (K) of the outer root sheath. Bar = 2 mm.
Prior to and during very early onset of hair loss in DEBR rats, the dominant infiltrate cell type is CD8+ [28]. CD4+ cells predominate later in lesion development. The most intense mononuclear infiltrate occurs in rats and mice with active disease progression. The infiltrate is significantly reduced in rats, mice, and humans with long-term stable lesions. The localized hair follicle infiltrate is of greater significance in understanding AA pathogenesis, as AA is a broadly organ-specific disease for the hair follicle and its appendages. One probable explanation for the various ratios of the hair follicle infiltrate is that the majority of infiltrating cells are secondary and have no specificity for any hair follicle epitope, as has been suggested for other autoimmune diseases. Only a minority of the infiltrating cells may actually be specific to hair follicles and promote destruction; the CD4+ and CD8+ cell populations are unlikely to be functionally homogeneous. The majority of the cells may be irrelevant to AA pathogenesis other than indirect effects via cytokine production. These changes in ratios over time may also reflect potential changes in the disease pathogenesis. The initiation mechanism need not be the same as the mechanism involved in progressive expansion of AA, which in turn may be different from immune activity in chronic, stable lesions. D. Autoantibodies Comparison of hair follicle specific–autoantibodies using a refined indirect immunofluorescent technique revealed that individual serum from DEBR rats contain hair follicle-specific IgG autoantibodies [29–31]. While individual sera revealed detailed differences, the target tissues identified were hair cortex and cuticle and the inner root sheath, especially the Henle’s layer. Notably, targeting of the outer root sheath or sebaceous glands was not apparent (Figure 30.6). The morphological targets are the same in different hair follicle types. In published studies, vibrissae are utilized in the assay due to their large size and corresponding ease of observation. However, the same morphological targets are observed in pelage follicles. In DEBR, autoantibodies were found in highest concentration from animals in a progressive, active lesional state, although around 30% of rats aged less than 4 months and in advance of any obvious hair loss also expressed low levels of hair follicle–specific autoantibodies. Some sera also
1391_C30.fm Page 460 Tuesday, November 18, 2003 5:46 PM
460
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
A
M
Figure 30.6
B
C
IRS
M
C
IRS
Hair follicle autoantibodies in DEBR. Blood serum from AA-affected DEBR contains autoantibodies sepecific for hair follicle structures discernable by indirect immunofluoresence. However, the morphological structures targeted by autoantibodies in samples taken from different rats is highly variable. One sera (A) may target the differentiating hair matrix (M) and hair cuticle (C), while serum from a littermate (B) may target the hair matrix (M) and inner root sheath (IRS). Various combinations of targets are apparent in different serum samples with no apparent correlation to the nature of the AA lesions. Bar = 10 mm.
contained autoantibodies specific to skeletal muscle and cell nuclear components. Hair follicle–specific autoantibodies were absent from other rat strains (PVG/OlaHsd, Wistar) that did not exhibit AA. Examination of sera from patients with alopecia areata using the same technique revealed similar patterns of hair follicle structures and cell nuclear-component staining, but in addition the outer root sheath, sebaceous glands and epidermis were also affected [31]. Preliminary Western blot analysis of DEBR sera suggest several targets in the 25- to 65-kDa range with occasional, additional targets in the 110- to 220-kDa range (K.J.M., personal observations, 1995). The production of hair follicle–specific autoantibodes further supports the notion that AA is an autoimmune disease. However, the significance of these autoantibodies has often been brought into question. There are three main possible modes of action for hair follicle–specific autoantibodies. The autoantibodies may be the prime initiators of AA, similar in their pathogenicity to autoantibodies produced in pemphigus vulgaris or myasthenia gravis. Alternatively, they may actually be of advantage to the patient with AA as opsonizers for removal of debris from around dystrophic hair follicles and/or in the bloodstream. Another possibility is that the autoantibodies may arise secondarily to a prior immune, cell-mediated insult, and further promote pathogenic destruction either via C3-complement pathway and/or by opsonization of hair follicle components for future leukocyte-mediated attack. Not all antibodies may be relevant. Different types may have different pathogenic abilities, depending on structure and the specific antigen epitope that the autoantibodies bind. For other autoimmune diseases, over time the range of autoantibody targets can increase due to epitope spreading. As chronic disease progresses and more antigenic debris is produced, a wider range of B-cell clones are promoted to antibody production. Autoantibodies before and during early disease onset will likely be of greater significance in defining disease initiation.
1391_C30.fm Page 461 Tuesday, November 18, 2003 5:46 PM
SPONTANEOUS RAT MODEL OF ALOPECIA AREATA IN THE DUNDEE EXPERIMENTAL BALD RAT
461
VII. THERAPEUTIC RESPONSES Patients with AA are capable of regrowing hair even after many years of hair loss, and spontaneous regrowth can occur in people with AA. However, there is no permanent cure for AA and there is no universally proven therapy for inducing remission. There are a range of therapies for which at least partial success has been claimed. All current modalities used are more effective in those with milder forms of the disease than in people with extensive hair loss. Popular treatments include nonspecific immune inhibitors such as systemic or locally injected corticosteroids, contact sensitizers, such as dinitrochlorobenzene (DNCB); squaric acid dibutyl ester (SADBE); diphencyprone (DPCP); UV light treatment, particularly in conjunction with 8-methoxypsoralen in PUVA therapy; minoxidil; and experimental use of specific immunosuppressants [32]. The DEBR model has also been examined for hair growth in response to various therapeutic modalities [33]. A. Corticosteroids Topical corticosteroids are commonly used for the treatment of limited, focal AA although only limited data provide evidence in support of their use. Only two placebo-controlled studies with small numbers of patients reported treatment response in about 60% of cases, but this response rate has not been confirmed by other studies [34–36]. This may in part be due to insufficient penetration of topically applied drugs to the hair bulb. Controlled studies for the use of intralesional and systemic corticosteroids are also lacking. However, published studies suggest a greater hair growth response rate to intralesional injection [37–39]. AA has been treated with systemic corticosteroids since 1952 [40]. Initially, corticosteroids were applied orally daily or every second day for several months, but this continuous application of corticosteroids is regarded as inappropriate today. The doses that are needed to gain hair regrowth in AA range from 30 to 150 mg daily, thus leading to side effects such as hypertension, diabetes, immunosuppression, osteoporosis, and tendency to thrombosis. More recently, pulsed administration of corticosteroids has been employed to treat severe AA [41–44]. Pulsed application of corticosteroids in single doses, given once monthly until successful hair regrowth is achieved, may reduce the side effects of corticosteroids to an acceptable level. Small-scale, unpublished studies on the DEBR model have shown a hair growth response to systemic corticosteroids at equivalent doses per kilogram of rat weight as used in humans. B. Contact-Sensitizing Agents DNCB, DPCP, also called diphencyprone (DCP), and (SADBE) are topical contact sensitizers. They are primarily used for people with extensive scalp hair loss. The reaction to the chemical(s) can result in good hair regrowth with claims of a 38% success rate for DPCP [45], 63% for DNCB [46], and up to 70% for SADBE [47]. The variability in success rates is due in part to investigators’ different definitions of what constitutes successful regrowth. Given that these treatments are mostly used by people with long-term extensive hair loss, each has a relatively good success rate in growing cosmetically acceptable hair when treatment is given by a dermatologist experienced in its use. How contact-sensitizing agents modulate AA and permit or promote hair growth is not known, but may involve the promotion of regulatory immune cells that supercede the activity of pathogenic cells in the skin. Untreated AA is characterized by an increased expression of the Th1 cytokines IFN-g, IL-2, and IL-1b, whereas after successful treatment with a contact sensitizer, there is increased expression of the Th2 cytokine IL-10 and of TGF-b and TNF-a [48]. These cytokines may be secreted during the down-regulatory phase of the contact dermatitis that occurs as a process of disease self-limitation after the allergen is removed. In unpublished studies, DEBR responded with various degrees of hair growth to the application of DNCB. However, the adverse reaction to
1391_C30.fm Page 462 Tuesday, November 18, 2003 5:46 PM
462
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
treatment in DEBR was severe, involving extensive skin vesicle and pustule formation. As a result, studies of the DEBR using DNCB were abandoned at an early stage. Whether lower dosage or the use of DCP or SADBE would induce hair regrowth with reduced side effects in DEBR is not known. C. Cyclosporin A Cyclosporin A (CyA) is a specific inhibitor of lymphocyte activation, and in principle, it may be useful in treating patients with AA. CyA has been reported to restore hair growth in a subset of patients when administered orally to humans [10,49,51]. However, while systemic immune suppression may release AA-affected hair follicles from their dystrophic state, it can potentially leave the patient partially exposed to infection and side effects, including neurotoxicity and impairment of renal function. Such a side effect profile renders widespread use of oral CyA for AA unacceptable. Attempts to use topical formulations of CyA for AA, and thereby avoid side effects seen with systemic application, have been largely unsuccessful thus far [52–55]. As with humans, CyA in standard formulations must be given systemically to DEBR rats to promote hair growth [56]. At 10 mg/kg, 5 days/week for 7 weeks, CyA in olive oil quickly reversed established AA lesions in DEBR displaying extensive areas of hair loss. New hairs appeared after 10 days and there was simultaneous regrowth of hair over the whole body with restoration of a full pelt by 5 weeks [57,58]. Semiquantitative histological examination of flank skin biopsies revealed early reduction of the cellular infiltrate associated with conversion of dystrophic anagen follicles to normal, hair-producing follicles. Topical application of 0.5% CyA in ethanol has little effect on the hair-loss state. However, recent research suggests that AA-affected DEBR can be successfully treated topically with 0.5% CyA in a unique lipsomal formulation [59]. This suggests that the vehicle used in topical application has a significant impact on the penetration of the drug to the depth of dystrophic hair follicles, and special formulations for CyA and other similar drugs such as FK506 may be required for the successful treatment of human AA. D. FK506 FK506 (tacrolimus) suppresses IL2 production and release in activated T cells by inhibiting calcineurin. Subsequently, activation and proliferation of T cells is inhibited [60]. Because T-cell activation and proliferation as well as an overexpression of HLA are likely significant in the pathogenesis of AA, FK506 is a promising candidate treatment. In the DEBR model for AA, oral application promoted little response [56]. However, topically applied FK506 in both acetone (Figure 30.7) and a propylene glycol vehicle successfully induced hair regrowth [61]. Routine histology (Figure 30.8) and immunohistochemical studies showed reduced peri- and intrafollicular infiltrates of CD4+ and CD8+ T cells in rats treated successfully with FK506 as compared to controlvehicle treated skin. These encouraging results in animal models and recent studies in neurodermitis patients that have demonstrated the safety of treatment with topical FK506 [62–64], suggest that topical application of FK506 could also be a safe and effective treatment of AA in humans. E. In Vivo Lymphocyte Depletion Although CD4+ cell depletion has been seriously investigated as a therapy for multiple sclerosis, systemic lupus erythmatoses and psoriasis in humans with some success, CD4+ cell depletion is unlikely to become a practical therapy for AA in humans, given that CD4+ cell depletion may leave individuals susceptible to infection. However, studies on the activity of CD4+ and CD8+ cells in DEBR lesion perpetuation have included selective in vivo depletion using monoclonal antibody injections. Lesional DEBR rats were given intraperitoneal injections of a CD4+ cell-depleting monoclonal antibody (MAb) cocktail or a CD8 cell-depleting MAb over a 15-day therapy course. Control groups were injected with equivalent volumes of an irrelevant MAb. Removal of CD4+ or
1391_C30.fm Page 463 Tuesday, November 18, 2003 5:46 PM
SPONTANEOUS RAT MODEL OF ALOPECIA AREATA IN THE DUNDEE EXPERIMENTAL BALD RAT
A
Figure 30.7
B
463
C
Topical FK506 treatment of AA in DEBR. In topical treatment studies, 2-cm2 areas of bald flank skin are marked by tattoos, and rats receive the drug to one flank and the control vehicle to the other as an intraindividual control (A). FK506 application in acetone 5 days per week (80 ml of 0.1% FK506 per unit area per day) promotes hair regrowth within the area of drug application, clearly visible by 29 days (B) and progressing to a near-normal pelage density and hair length by day 56 (C).
CD8+ T cells using this approach, confirmed by flow cytometric analysis of blood samples and immunohistology of skin biopsies, enables good hair regrowth in lesional animals [65,66]. The studies suggest that close interaction and stimulus between CD4+ and CD8+ cells is required to perpetuate the AA lesion, possibly with CD8+ cells in their typical cytotoxic role and CD4+ cells in their helper support role. However, the activation events for CD4+ and CD8+ cells in DEBR remain unknown.
VIII. LESSONS LEARNED Human AA is a complex disease in which clinical and pathological presentation varies considerably among individuals. In part, this reflects the mixed genetic background and variable environmental influences on AA-affected patients. Inbred rodents living in a controlled environment provide useful models to explore specific aspects of the disease and to perform experiments that cannot be conducted on humans. Information gained from such models will help define how AA develops and provide clues as to new and improved treatments. Despite being a congenic strain, DEBR rats demonstrate many forms of hair loss which is similar to human lesion progression, including clinical presentation of circumscribed patchy alopecia that may wax, wane, and migrate, and can become more extensive, up to and including universal hair loss. Rat hair loss can occur in any region of skin and affect any type of hair. Hair fibers become dystrophic and exclamation-mark hairs are sometimes present at the periphery of bald patches. Hair follicle dystrophy is associated with a peri- and intra-follicular mononuclear cell infiltrate with CD4+ and CD8+ lymphocytes as the dominant cell types. Only anagen hair follicles are targeted; telogen and catagen hair follicles escape the attention of the inflammatory infiltrate. Hair follicle-specific IgG autoantibodies are produced in association with rat AA and the autoantibodies target the lower hair follicle and bulb, with morphological targets apparently well conserved between species. AA is a nonscarring form of hair loss in all species with the possibility of spontaneous regrowth and a hair growth response to the same immunomodulatory therapies.
1391_C30.fm Page 464 Tuesday, November 18, 2003 5:46 PM
464
Figure 30.8
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
A
B
C
D
Histology after treatment of AA in DEBR with topical FK506. Topical application of FK506 leads to hair growth and a relatively normal pelage (A) and guard hair follicle (C) morphology with few inflammatory cells by day 56. In contrast, flank skin from the same rat receiving the acetone vehicle contains pelage (B) and guard hair follicles (D) with considerable dystrophy and inflammation. Bar = 25 mm.
From our current understanding of rodent models, the development of AA relies upon a general genetic susceptibility. Major rodent AA-susceptibility genes may be supplemented by a variety of minor disease-severity–modifying genes. However, the actual onset of the disease, and its extent, persistence, and resistance to treatment in a given individual rodent may potentially be modulated by epigenetic factors, such as diet, hormones, general viral load, and other environmental influences. The events that lead to human AA development also likely involve both genetic and environmental factors that influence general susceptibility and severity of disease. Both genetic and environmental factors will modulate AA at three levels: overall reactivity of the immune system, specific inciting antigens and how they are presented to the immune system, and the target issue itself [67]. The mechanism of rodent AA seems to be fundamentally, but not exclusively, Th1 cells mediated with CD8+ cells being key instigators of hair follicle disruption. Antigen presentation within the skin itself and within immune system organs likely incite reactive leukocyte clones. The onset of disease is dependent on several factors including the breakdown of immune privilege in hair follicles and perhaps other hair follicle-specific defects, presence of autoreactive lymphocytes, appropriate antigen presentation in association with co-stimulation, and a deficiency of lymphocyte regulation.
1391_C30.fm Page 465 Tuesday, November 18, 2003 5:46 PM
SPONTANEOUS RAT MODEL OF ALOPECIA AREATA IN THE DUNDEE EXPERIMENTAL BALD RAT
465
Without knowing the source of the specific antigen epitopes that trigger AA onset, it is not possible to conclusively define AA as fundamentally autoimmune in nature. However, rodent model research has produced evidence consistent with this hypothesis.
IX. CONCLUSION The AA model in DEBR reveals a phenotype closely resembling human AA, and has shown promise as a model to investigate the pathogenesis of AA. Given the limited understanding of AA initiation and progression and the limited success of current therapeutic modalities, animal models will prove vital to determine pathogenesis and genetic susceptibility to AA. Recent data have strengthened the argument that AA is an immunologically mediated condition. Nonhuman species expressing AA also show promise as models for development and evaluation of new and existing therapies for AA. Ultimately, the models may be used to determine methods of permanent reversal of this presumptive autoimmune disease, which may have implications for research beyond the field of hair biology.
ACKNOWLEDGMENTS I am grateful to R. Oliver, J.P. Sundberg, and R. Hoffmann for their support, and to D. Black, L. Bechtold, S. Kissling, E. Wenzel, and A. Huth for their technical assistance. The work was supported in part by the National Alopecia Areata Foundation. I am a recipient of the Alfred Blaschko Memorial Fellowship, Marburg.
REFERENCES 1. Dawber, D., de Berker, D., and Wojnarowska, F., Disorders of hair: alopecia areata, in Rook/Wilkinson/Ebling Textbook of Dermatology, Champion, R.H. et al., Eds., Blackwell Science, Oxford, 1998, p. 2919. 2. Safavi, K.H. et al., Incidence of alopecia areata in Olmsted County, Minnesota 1975 through 1989, Mayo Clin. Proc., 70, 628, 1995. 3. Thompson, W. and Shapiro, J., Alopecia Areata: Understanding and Coping with Hair Loss, Johns Hopkins University Press, Baltimore, 1996, p. 2. 4. Goldsmith, L.A., Summary of alopecia areata research workshop and future research directions, J. Invest. Dermatol., 96, 98, 1991. 5. McElwee, K.J., Third International Research Workshop on Alopecia Areata, J. Invest. Dermatol., 112, 822, 1999. 6. Olsen, E. et al., Alopecia areata investigational assessment guidelines. National Alopecia Areata Foundation, J. Am. Acad. Dermatol., 40, 242, 1999. 7. McDonagh, A.J. and Messenger, A.G., The pathogenesis of alopecia areata, Dermatol. Clin., 14, 661, 1996. 8. Perret, C., Wiesner-Menzel, L., and Happle, R., Immunohistochemical analysis of T-cell subsets in the peribulbar and intrabulbar infiltrates of alopecia areata, Acta Derm. Venereol., 64, 26, 1984. 9. Ranki, A. et al., Immunohistochemical and electron microscopic characterization of the cellular infiltrate in alopecia (areata, totalis, and universalis), J. Invest. Dermatol., 83, 7, 1984. 10. Gupta, A.K. et al., Oral cyclosporine for the treatment of alopecia areata. A clinical and immunohistological analysis, J. Am. Acad. Dermatol., 22, 242, 1990. 11. Tobin, D.J. et al., Antibodies to hair follicles in alopecia areata, J. Invest. Dermatol., 102, 721, 1994. 12. McElwee, K.J. et al., Alopecia areata: an autoimmune disease? Exp. Dermatol., 8, 371, 1999. 13. Conroy, J.D., Alopecia areata, in Spontaneous Animal Models of Human Disease, Andrew, E.J., Ward, B.C., and Altman, N.H., Eds., Academic Press, New York, 1979, p. 30.
1391_C30.fm Page 466 Tuesday, November 18, 2003 5:46 PM
466
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
14. McElwee, K.J. et al., Comparison of alopecia areata in human and nonhuman mammalian species, Pathobiology, 66, 90, 1998. 15. Smyth, J.R. Jr. and McNeil, M., Alopecia areata and universalis in the Smyth chicken model for spontaneous autoimmune vitiligo, J. Investig. Dermatol. Symp. Proc., 4, 211, 1999. 16. Sundberg, J.P. and King, L.E. Jr., Mouse mutations as animal models and biomedical tools for dermatological research, J. Invest. Dermatol., 106, 368, 1996. 17. McElwee, K.J. et al., Spontaneous alopecia areata-like hair loss in one congenic and seven inbred laboratory mouse strains, J. Investig. Dermatol. Symp. Proc., 4, 202, 1999. 18. Sundberg, J.P., Cordy, W.R., and King, L.E. Jr., Alopecia areata in aging C3H/HeJ mice, J. Invest. Dermatol., 102, 847, 1994. 19. Michie, H.J. et al., The DEBR rat: an animal model of human alopecia areata, Br. J. Dermatol., 125, 94, 1991. 20. Oliver, R.F. et al., The DEBR rat model for alopecia areata, J. Invest. Dermatol., 96, 97, 1991. 21. Druckery, H., Genotypes and phenotypes of ten inbred strains of BD-rats, Arnzneim-Forsch., 21, 1274, 1971. 22. Levan, K.K. et al., Rat gene map, Rat Genome, 2, 30, 1996. 23. McElwee, K.J. et al., Genetic susceptibility and severity of alopecia areata in human and animal models, Eur. J. Dermatol., 11, 11, 2001. 24. Kendall, C. et al., Characterization of strain specific typing antisera for genetic monitoring of inbred strain of rats, Lab. Anim. Sci., 35, 364, 1985. 25. Male, D.K., Pryce G., and Butcher G.W., Serological evidence for a defect in RT1.B (I-A) expression by the BDIX rat strain, J. Immunogenet., 14, 301, 1987. 26. Peerboom-Wynia, J.G.R. et al., Scanning E.M.comparing exclamation mark hairs in alopecia areata with normal hair fibres mechanically broken by traction, Clin. Exp. Dermatol., 14, 47, 1989. 27. Michie, H.J. et al., Immunobiological studies on the alopecic (DEBR) rat, Br. J. Dermatol., 123, 557, 1990. 28. Zhang, J.G. and Oliver, R.F., Immunohistological study of the development of the cellular infiltrate in the pelage follicles of the DEBR model for alopecia areata, Br. J. Dermatol., 130, 405, 1994. 29. McElwee, K.J., Pickett, P., and Oliver, R.F., Hair follicle autoantibodies in DEBR rat sera, J. Invest. Dermatol., 104, 34, 1995. 30. McElwee, K.J., Pickett, P., and Oliver, R.F., Autoantibodies to the hair follicle in sera from the DEBR rat model for Alopecia Areata, Br. J. Dermatol., 134, 55, 1996. 31. McElwee, K.J., Drummond, S., and Oliver, R.F., Hair follicle specific autoantibodies associated with alopecia areata in sera from the DEBR rat model and humans, Excerpta Medica Int. Congress, 1111, 253, 1996. 32. Freyschmidt-Paul, P. et al., Current and potential agents for the treatment of alopecia areata, Curr. Pharmacol. Design, 7, 213, 2001. 33. Sundberg, J.P. et al., Alopecia areata in humans and other mammalian species, J. Invest. Dermatol., 104, 33s, 1995. 34. Pascher, F., Kurtin, S., and Andrade, R., Assay of 0.2% fluocinolone acetonide cream for alopecia areata and totalis, Dermatologica, 141, 193, 1970. 35. Leyden, J.J. and Kligman, A.M., Treatment of alopecia areata with steroid solution, Arch. Derm., 106, 924, 1972. 36. Lehnert, W., Zur Lokalbehandlung schwerer Formen der Alopecia Areata mit Kortikosteroidsalbe, Derm. Mschr., 160, 396, 1974. 37. Kalkoff, K.W. and Macher E., Über das Nachwachsen der Haare bei der Alopecia areata und maligna nach intracutaner Hydrocortisoninjektion, Hautarzt, 9, 441, 1958. 38. Orentreich, N. et al., Local injection of steroids and hair regrowth in alopecias, Arch. Dermatol., 82, 894, 1960. 39. Abell, E. and Munro D.D., Intralesional treatment of alopecia areata with triamcinolone acetonide by jet injector, Br. J. Dermatol., 88, 55, 1973. 40. Dillaha, C.J. and Rothman, S., Therapeutic experiments in alopecia areata with orally administered cortisone, JAMA, 150, 546, 1952. 41. Burton, J.L. and Shuster, S., Large doses of glucocorticoid in the treatment of alopecia areata, Acta Dermatoven., 55, 493, 1975.
1391_C30.fm Page 467 Tuesday, November 18, 2003 5:46 PM
SPONTANEOUS RAT MODEL OF ALOPECIA AREATA IN THE DUNDEE EXPERIMENTAL BALD RAT
467
42. Perriard-Wolfensberger, J. et al., Pulse of methylprednisolone in alopecia areata, Dermatology, 187, 282, 1993. 43. Sharma, V.K., Pulsed administration of corticosteroids in the treatment of alopecia areata, Int. J. Dermatol., 35, 133, 1996. 44. Friedli, A. et al., Pulse methyprednisolone therapy for severe alopecia areata: an open prospective study of 45 patients, J. Am. Acad. Deramtol., 39, 597, 1998. 45. Shapiro, J. et al., Treatment of chronic severe alopecia areata with topical diphenylcyclopropenone and 5% minoxidil: a clinical and immunopathologic evaluation, J. Am. Acad. Dermatol., 29, 729, 1993. 46. Swanson, N.A. et al., Topical treatment of alopecia areata, Arch. Dermatol., 117, 384, 1981. 47. Flowers, F.P. et al., Topical squaric acid dibutylester therapy for alopecia areata, Cutis, 30, 733, 1982. 48. Hoffmann, R. et al., Cytokine mRNA levels in Alopecia areata before and after treatment with the contact allergen diphenylcyclopropenone, J. Invest. Dermatol., 103, 530, 1994. 49. Paquet, P. et al., Oral cyclosporin and alopecia areata, Dermatology, 185, 314, 1992. 50. Ferrando, J. and Grimalt, R., Partial response of severe alopecia areata to cyclosporine A, Dermatology, 199, 67, 1999. 51. Parodi, A. et al., Alopecia universalis and cyclosporin A, Br. J. Dermatol., 135, 657, 1996. 52. Mauduit, G. et al., Treatment of severe alopecia areata with topical applications of cyclosporin A, Ann. Dermatol. Venereol., 114, 507, 1987. 53. Parodi, A. and Rebora, A., Topical cyclosporine in alopecia areata, Arch. Dermatol., 123, 165, 1987. 54. de Prost, Y. et al., Placebo-controlled trial of topical cyclosporin in severe alopecia areata, Lancet, 2, 803, 1986. 55. Gilhar, A., Pillar, T., and Etzioni, A., Topical cyclosporin A in alopecia areata, Acta. Derm. Venereol., 69, 252, 1989. 56. Sainsbury, T.S.L. et al., Differential effects of FK506 and cyclosporine on hair regrowth in the DEBR model of alopecia areata, Transplant. Proc., 23, 3332, 1991. 57. Oliver, R.F. and Lowe, J.G., Oral cyclosporin A restores hair growth in the DEBR rat model for alopecia areata, Clin. Exp. Dermatol., 20, 127, 1995. 58. McElwee, K.J., Lowe, J.G., and Oliver, R.F., Effects of potent immunotherapies, oral cyclosporin A and topical FK506, in the DEBR rat model for alopecia areata, Excerpta Medica Int. Congress, 1111, 259, 1996. 59. Verma, D.D. et al., Treatment of alopecia areata in the DEBR model using Cyclosporin A lipid vesicles, J. Exp. Dermatol., in press. 60. Schreiber, S.L. and Crabtree, G.R., The mechanism of action of cyclosporin A and FK506, Immunol. Today, 13, 136, 1992. 61. McElwee, K.J. et al., Topical FK506: a potent immunotherapy for alopecia areata? Studies using the Dundee experimental bald rat model, Br. J. Dermatol. 137, 491, 1997. 62. Nakagawa, H. et al., Tacrolimus ointment for atopic dermatitis, Lancet, 344, 883, 1994. 63. Ruzicka, T. et al., A short-term trial of tacrolimus ointment for atopic dermatitis. European Tacrolimus Multicenter Atopic Dermatitis Study Group, N. Engl. J. Med., 337, 8161, 1997. 64. Alaiti, S. et al., Tacrolimus (FK506) ointment for atopic dermatitis: a phase I study in adults and children, J. Am. Acad. Dermatol., 38, 69, 1998. 65. McElwee, K.J., Spiers, E.M., and Oliver, R.F., In vivo depletion of CD8+ T cells restores hair growth in the DEBR model of alopecia areata, Br. J. Dermatol., 135, 211, 1996. 66. McElwee, K.J., Spiers, E.M., and Oliver, R.F., Partial restoration of hair growth in the DEBR model for Alopecia areata after in vivo depletion of CD4+ T cells, Br. J. Dermatol., 140, 432, 1999. 67. Marrack, P., Kappler, J., and Kotzin, B.L., Autoimmune disease: why and where it occurs, Nat. Med., 7, 899, 2001.
1391_C30.fm Page 468 Tuesday, November 18, 2003 5:46 PM
1391_C31.fm Page 469 Tuesday, November 18, 2003 5:49 PM
CHAPTER
31
Spontaneous Canine Model of Alopecia Areata Desmond J. Tobin and Thierry Olivry
CONTENTS I. History ................................................................................................................................469 A. Background ................................................................................................................469 B. Spontaneous Alopecia Areata in Nonhuman Mammals ...........................................470 C. Canine Homologue of Human AA............................................................................470 II. Animals ..............................................................................................................................470 III. Epidemiology .....................................................................................................................471 IV. Course of Disease ..............................................................................................................471 V. Assessment of Disease.......................................................................................................471 A. Clinical Manifestation ...............................................................................................471 B. Histopathological Examination .................................................................................472 C. Immunopathological Data .........................................................................................473 1. Immunophenotyping ............................................................................................473 2. Direct Immunofluorescence Microscopy ............................................................474 3. Indirect Immunofluorescence Microscopy ..........................................................474 4. Immunoblotting....................................................................................................475 5. Selective Immunoprecipitation ............................................................................475 6. Passive Transfer of Canine Anti–HF IgG ...........................................................477 D. Immunogenetics.........................................................................................................478 VI. Therapeutic Responses.......................................................................................................478 VII. Expert Experience ..............................................................................................................478 VIII. Lessons Learned.................................................................................................................478 IX. Conclusion..........................................................................................................................480 References ......................................................................................................................................480
I. HISTORY A. Background Alopecia areata (AA) is a common cause of hair loss afflicting approximately 1.7% of the general human population [1]. At least 0.1% of the human population will express the disorder at 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
469
1391_C31.fm Page 470 Tuesday, November 18, 2003 5:49 PM
470
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
any one time [2], and it is likely that minor forms of the disorder go unnoticed. It also may not be uncommon among nonhuman mammals (reviewed in McElwee et al. [3]). AA results from selective, largely reversible, damage to the anagen hair follicle (HF) [4–8]. Thus, the manifestation of patchy hair loss is predominantly seen on anagen-bearing skin, such as the scalp in humans. However, other body parts can be affected and the disease can progress to complete loss of all body hair. While not life threatening, the disease is nonetheless serious because it is disfiguring and in humans can cause severe psychological problems and loss of employment [9]. Affected animals may experience a reduction in their monetary value. The etiology of AA remains unclear. Hair loss is associated with an immune-mediated pathology and an autoimmune basis is now strongly suspected (reviewed in McElwee et al. [10]). The recent availability of accepted research guidelines, drawn up by the National Alopecia Areata Foundation (San Rafael, CA [11]), will help avoid addition to the rather confusing AA literature. Much of the earlier data was often based on small numbers of patients, poorly controlled or uncontrolled studies, on differences whose significance were not analyzed statistically, and on results that were often contradictory. However, part of this apparent confusion may be due to the possibility that not all cases of AA represent manifestations of the same disease. Much of the recent progress in AA research is due to the development of two animal models for human AA: the inbred rodent models of the C3H/HeJ mouse [12] and the DEBR rat [13]. Both models have provided very useful data not only on the genetics of AA but also on the associated immune perturbations [14–16] and the assessment of various treatment modalities [17,18]. B. Spontaneous Alopecia Areata in Nonhuman Mammals Only a limited number of case reports and letters on spontaneous AA-like hair loss in dogs appear in the pre-1990s literature. Moreover, it is not always clear if the diagnosis was unequivocally that of AA. AA-like hair loss has been reported in many breeds of dogs including Bernese mountain [19], Dachshund [20–23], Doberman pinscher [19,24], German shepherd dog [24,25], Magyar viszla [24], miniature poodle [21], and in several mixed breeds [24–29]. Recently, we have described a dog with AA-like hair loss in which intrabulbar cytotoxic T lymphocytes infiltrated lower hair follicles, and we demonstrated that this was associated with the alopecia [25]. Moreover, in a recent study of four dogs with progressive, nonscarring, AA-like hair loss we reported that sera of affected dogs contained anti-HF IgG [29]. AA-like disease has been reported in other mammals including cats [21], horses [21,30,31], cows [32,33], and nonhuman primates [21,34]. The poor characterization of many of these cases prevents assessment of their scientific or clinical value. However, animal models, including outbred animals, are likely to be valuable for the dissection of the common pathways underlying the pathogenesis of AA and for the development and evaluation of therapies for AA. C. Canine Homologue of Human AA Our recent immunopathological analyses of dogs with AA-like hair loss [25,29] raised the possibility that AA may not only be more widespread than previously thought, but that a more comprehensive characterization of AA-like hair loss in this species may support the use of canine AA as a homologue for the human condition.
II. ANIMALS As mentioned above, AA-like hair loss has been reported in several canine species including Bernese mountain [19], dachshund [20–23], Doberman pinscher [24–19], German shepherd [24,25], Magyar viszla [24], miniature poodle [21], and several mixed breed dogs [24–29]. In a
1391_C31.fm Page 471 Tuesday, November 18, 2003 5:49 PM
SPONTANEOUS CANINE MODEL OF ALOPECIA AREATA
471
recent large-scale study [35], AA-like hair loss in 25 client-owned dogs was systematically assessed using AA-associated clinical, histological, and immunological criteria [11]. Nineteen of the 25 dogs with AA were reported as purebred by their owners and included four German shepherd and crosses, three dachshunds, two beagles, two setters, and two Labrador retriever crosses. The remaining subjects represented crossbred dogs. In this group of dogs with AA, the age of onset of hair loss varied between 1 and 13 years (median, 5 years). Of interest is that dachshunds usually appeared to develop the disease at an earlier age than dogs of other breeds (median, 2 years). The male-tofemale sex ratio was 0.79, and most subjects had been either castrated or spayed. Even though reference populations are not available for comparison, the dachshund breed appears predisposed to develop AA, as this breed seems overrepresented when all cases reported previously are examined altogether.
III. EPIDEMIOLOGY At the time of this writing, all descriptions of canine AA have been of single cases. One case study of 25 patients has been submitted for publication recently [35]. This study regrouped patients from Europe and North America that had been diagnosed with AA between 1994 and 1999. Unfortunately, because of the widespread distribution of the origin of the subjects, an estimation of prevalence and incidence could not be made. It is assumed, however, that spontaneously occurring canine AA is a rare disease.
IV. COURSE OF DISEASE The age of onset of alopecia varies greatly. In one recent study of 25 dogs with AA [35], age of onset ranged from 1 to 11 years (median, 5 years). A minority of dogs had developed AA by age 2 years (young adults). Estimation of odds ratios for disease predisposition has proved difficult, since dogs are often assembled from various North American and European locations and a reference population was not accessible. Where information on disease outcome was available, spontaneous and complete hair regrowth was found to occur in the majority of subjects. Interestingly, regrown hair was commonly white, a feature also seen in humans with AA [36].
V. ASSESSMENT OF DISEASE A. Clinical Manifestation The initial lesion reported by the owners is alopecia. In a minority of cases the growth of white hair, that is, leukotrichia, may precede the first alopecic lesion and supports the growing belief that the hair bulb melanocytes are a target in AA [5,36,37]. Lesions usually develop first on the face (Figure 31.1) and head (muzzle, chin [Figure 31.2], forehead, periocular, ears), in common with the bias toward scalp and beard in human AA. Similarly, in subjects with variable coat color, hair loss usually occurs first in dark brown or black areas, again presumed to correlate with the preferential targeting of pigmented hair and the relative sparing of nonpigmented hair in humans with AA [6,36]. At the time of diagnosis, lesions usually consist of spontaneously arising and well-demarcated alopecic patches. Facial lesions usually exhibit a bilateral symmetry. Hair loss may also be seen on the legs (Figure 31.3) and in some cases hair loss can progress to a more generalized distribution in some patients.
1391_C31.fm Page 472 Tuesday, November 18, 2003 5:49 PM
472
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Figure 31.1
Sharp-edged alopecic patch with skin hyperpigmentation on the face of a Labrador retriever with AA.
Figure 31.2
Alopecia and hyperpigmentation on the chin (same dog as in Figure 31.1).
B. Histopathological Examination The histological hallmark of human AA is the so-called “swarm of bees” mononuclear cell infiltrate focused at the anagen hair bulb [8] (Figure 31.4a and b). Hematoxylin and eosin-stained sections of canine AA skin biopsy specimens usually reveal an anagen population of approximately 75%, catagen 10%, and a raised telogen count of around 15%. Telogen counts are also high in human AA [38]. Bulbitis is observed in a majority of lesional anagen HF, although, perhaps
1391_C31.fm Page 473 Tuesday, November 18, 2003 5:49 PM
SPONTANEOUS CANINE MODEL OF ALOPECIA AREATA
Figure 31.3
Patchy hair loss on the dorsal aspect of the forefoot (same dog as in Figure 31.1).
Figure 31.4
Lymphocytic bulbitis and peribulbitis in a dog with AA. Bar = 130 mm (a) and 30 mm (b).
473
surprisingly, not in all HFs. The extent of the folliculotropic infiltration studied is variable and within the lesion around/in various affected HFs. In a recent large-scale study [35], the extent of the mononuclear cell infiltrate has been graded as mild in about 50% of HFs, moderate in 10%, and severe in 3% of follicles. Similarly, peribulbitis was seen around 44% of HFs, and was graded as mild in 33%, moderate in 10%, and severe in 1% of HFs studied. Distorted dystrophic hair shafts were a feature in about a quarter of the affected dogs examined (Figure 31.5). C. Immunopathological Data 1. Immunophenotyping Examination of skin sections immunostained for the pan T-cell marker CD3 reveals a predominantly T-lymphocyte infiltration. T cells are not usually found in/at the HF infundibulum, while the incidence of T lymphocytes increases proximally from the HF isthmus (in about 50% of dogs),
1391_C31.fm Page 474 Tuesday, November 18, 2003 5:49 PM
474
Figure 31.5
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Lymphocyte infiltration in the bulb is associated with dystrophic shaft formation (arrowhead). Bar = 25 mm.
inferior HF segment (in the vast majority of dogs), to the hair bulb in all dogs. T-lymphocyte infiltration of the perifollicular dermis is also present in all dogs and can extend some distance from the immediate HF area in a few cases. The severity of infiltration is usually mild in the isthmus and inferior segments, but can be mild to severe in hair bulbs and around lower HF structures. To date only limited lymphocyte immunophenotyping has been performed on lesional canine AA skin [25]. In reports containing this information, there appears to be a 1:3 to 1:4 ratio of hair follicle infiltrating CD8+ to CD4+ cells (reviewed in McElwee et al. [3]). However, T cells invading growing hair follicles are more commonly CD8+, while CD4+ cells predominate in the peribulbar T-cell infiltrates and in this way also reflect the human condition. Careful selection of the biopsy site is required and in some cases more than one biopsy is required to fully appreciate the extent of the follicular infiltrate. In a recent study [35] intra- and peri-bulbar lymphocytes expressed the ab T-cell receptor and were either CD8 or CD4. 2. Direct Immunofluorescence Microscopy Deposition of immunoglobulin and complement around HF, especially at the edge of active lesions has been associated with AA [39]. Direct immunofluorescence (DIF) staining for IgG on paraffin-embedded sections of lesional canine AA skin reveals the common ex vivo deposition of IgG in HF structures [35]. Deposits of IgG are usually found on the lower HF glassy membrane and less often within the follicular papilla, medulla, outer root sheath (ORS), or hair matrix. IgG deposits may also be detected around the HF including between collagen fibers and in dermal plasma cells. 3. Indirect Immunofluorescence Microscopy Antibodies to HF-specific antigens are much more common, and present in higher titers, in patients with AA than in control patients, including those with scarring alopecia [40,41]. Moreover, the anti-HF antibodies that have been detected in rats, mice, horses, and dogs (reviewed in McElwee et al. [3]) with AA-like disease appear to target similar HF proteins, and thus suggest a high degree
1391_C31.fm Page 475 Tuesday, November 18, 2003 5:49 PM
SPONTANEOUS CANINE MODEL OF ALOPECIA AREATA
475
IRS
Epi HF
Hb
Figure 31.6
Indirect immunofluorescence analysis of antibodies to HF in canine AA. Canine IgG antibodies also react specifically with HFs in murine back skin, and may target inner root sheath and medulla in the mid to lower HF. Note lack of reactivity to the upper HF, epidermis (Epi), and dermis. Bar = 50 mm. Hb, hair bulb.
of epitope conservation across species. In a recent study of four dogs with progressive, nonscarring, AA-like hair loss, we reported that sera of affected dogs contained IgG antibodies (some up to titers of 1:2560) that reacted with components of the lower anagen HF (Figure 31.6), especially the inner root sheath (IRS) and medulla [29]. No reactivity was detected in normal healthy dogs or in sera from dogs with inflammatory skin disease due to demodicosis. Moreover, a similar pattern of reactivity was found when canine AA sera were incubated with normal human and murine skin. Furthermore, in a larger study of 14 dogs with AA-like hair loss [35], canine AA sera contained high titer antibodies (>1:500) that reacted to multiple HF structures including IRS, ORS, matrix, and precortex. In addition, the serum from canine AA patients contain antibodies that label the same structure of the HF as that targeted by a monoclonal antibody against trichohyalin (AE15) (Figure 31.7). 4. Immunoblotting Immunoblotting analysis of circulating serum antibodies provides the possibility to gain further information regarding the nature of the target proteins in this disease [14,41,42]. To date, antibody reactivity in whole canine AA sera has been assessed against electroblotted 6-M urea-extractable human HF protein [29]. In a recent study of four dogs with progressive, nonscarring, AA-like hair loss, we reported that sera of affected dogs contained IgG antibodies that reacted intensely with HF proteins of 200 to 220 kDa and also with multiple antigens in the 50 to 60 kDa range (Figure 31.8). Co-migration studies suggested that reactivity to the 200- to 220-kDa doublet reflected in turn reactivity to the IRS and medulla-rich protein trichohyalin [29], while some of the targeted proteins in the 50- to 60-kDa range were likely to represent keratins. We have recently expanded on this study and assessed anti-HF antibody reactivity in a large number of dogs affected with AA-like hair loss [35]. Confirming the previous study, this analysis revealed a strong and heterogeneous pattern of anti-HF reactivity in canine AA serum IgG against multiple antigens between 40 to 60 kDa and to a 200- to 220-kDa doublet. 5. Selective Immunoprecipitation While immunoblotting analysis can provide information on the molecular weight of antibodytargeted HF antigens, this method does not easily reveal antigen identity per se. Therefore, we have
1391_C31.fm Page 476 Tuesday, November 18, 2003 5:49 PM
476
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
IRS IRS
Hb a Figure 31.7
Hb b
Co-localization of AA-target HF antigens in canine AA. The pattern of immunoreactivity with this canine AA serum (a) is very similar to that of a monoclonal antibody AE 15 to trichohyalin (b). Note that both antisera target the inner root sheath. Bar = 150 mm. Hb, hair bulb.
200
50
A Figure 31.8
B
Western immunoblotting analysis of HF antigens defined by IgG antibodies in canine AA sera. (A) 6 M urea–extractable proteins were obtained from normal human scalp anagen HFs and separated by SDS-8% PAGE and immunoblotted with canine AA and (B) control canine sera. Note that AA serum reactivity to HF antigens of 40 to 60 kDa and 200 to 220 kDa. Control sera, including sera from dogs with demodicosis, are minimally reactive/nonreactive to these proteins.
1391_C31.fm Page 477 Tuesday, November 18, 2003 5:49 PM
SPONTANEOUS CANINE MODEL OF ALOPECIA AREATA
477
200
A Figure 31.9
B
C
Selective immunoprecipitation of trichohyalin protein from 6 M urea–extractable proteins (obtained from normal human scalp anagen HFs) by canine AA sera (B). Positive control (A) was AE15 monoclonal antibody to trichohyalin. Control canine sera failed to immunoprecipitate this HF antigen (C).
exploited the ability of antibodies to immunoprecipitate their specific target antigens using a selective immunoprecipitation assay [29,42]. We have to date performed two studies [29,35], in which we have shown that canine AA serum IgG antibodies can immunoprecipitate trichohyalin protein (200 to 220 kDa) from crude extracts of total HF protein (Figure 31.9). By contrast, normal canine sera failed to immunoprecipitate this antigen. 6. Passive Transfer of Canine Anti–HF IgG Unlike autoantibodies in pemphigus vulgaris and myasthenia gravis, the pathogenic potential of anti-HF autoantibodies in AA remains to be shown. As these may occur prior to the onset of clinical hair loss [14], it is possible that they may not in some cases be formed secondarily to a preexisting immune insult (e.g., cell mediated). We have recently made two attempts to assess the pathogenic potential of anti-HF antibodies in equine and canine sera via their passive transfer into anagen skin of naïve mice [31,35]. In preparation for passive transfer, high-titer anti–HF IgG was purified from the sera of AAaffected dogs. Control IgG was purified normal canine serum. Purified AA IgG reacted with HF, including IRS, ORS, matrix, and HS in murine anagen skin, indicating not only retained reactivity to HFs but also confirming significant cross-species conservation of HF target epitopes. No reactivity to HF was found in control IgG. Moreover, purified AA IgG showed very strong reactivity to a 200- to 220-kDa antigen band, that is, presumptive trichohyalin and weaker reactivity also to multiple antigens between 40 to 60 kDa [35]. Twice weekly intradermal administration of AA and control IgG into anagen III back skin of four C57BL/10scsn mice was performed for 1 month. While both IgG from AA and normal dogs delayed regrowth of hair in and immediately around the site of IgG administration, AA IgG administration resulted in an increased delay of anagen reentry of up to 2 weeks compared with control normal IgG. Limited serum IgG in this study and the resultant low numbers of mice included in the study prevented a more complete assessment of the pathogenic potential of anti-HF IgG in canine AA. However, it should be noted that high-titer anti-HF equine IgG also disrupted hair regrowth (via extension of telogen) when passively transferred to C57BL/6 mice [31].
1391_C31.fm Page 478 Tuesday, November 18, 2003 5:49 PM
478
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
D. Immunogenetics At this time, there is no information on immunogenetic typing of AA-affected canine patients.
VI. THERAPEUTIC RESPONSES As stated above, spontaneous remission occurs in most canine patients with AA. When natural hair regrowth does not occur, treatment with oral glucocorticoids or cyclosporine is initiated. In a recent case series [35], treatment with immunosuppressive doses of prednisone (1 to 2 mg per kg per day) or cyclosporine (5 to 10 mg per kg per day) was reported to lead to remission of clinical signs. In some patients, the treatment could be discontinued after a few months, and lesions did not recur. In rare individuals left untreated, hair loss can remain permanent.
VII. EXPERT EXPERIENCE Spontaneous canine AA is a disease that is seen rarely by veterinarians. The diagnosis of canine AA is not difficult and is based on a combination of clinical signs supported by histopathological examination of lesional and perilesional skin biopsy specimens. Clinical differential diagnoses for canine AA includes pseudopelade, demodicosis, dermatophytosis, staphylococcal folliculitis, and ischemic alopecias such as dermatomyositis and rabies-vaccine reactions. The main histopathological differential diagnosis is canine pseudopelade, but in the latter, lymphocyte epidermotropism targets the mid-HF sections, and there is involution of lower HF segments. Such cases, albeit rare, can be available by contacting veterinary dermatologists worldwide. Access to a veterinary dermatology Internet list (contact T. Olivry) allows easy dissemination of the request and increases the availability of canine AA case material that can be provided to interested researchers.
VIII. LESSONS LEARNED Studies to date support the use of dogs with AA as a potential outbred model for human AA. These studies, using both pure and mixed breeds, have identified strong similarities between canine AA and the disorder in human patients. Important features of canine AA being compatible with human AA include similarities in clinical presentation (including spontaneous remissions), distribution and phenotype of HF-associated mononuclear cell infiltrates, preferential targeting of anagen HFs, presence of anti-HF IgG antibodies that target similar HF components, and HF proteins of similar molecular weight. Taken together, these studies reflect a remarkably strong correspondence between canine AA and human AA on all major themes. Studies to date indicate that canine AA most commonly presents as a patchy alopecia on the scalp and face, as is the case in the human disorder [43]. The appearance of lesions earlier in pigmented areas in some dogs of variable coat color concurs with evidence that human AA may also preferentially target pigmented hair and spare white hair [44], although, like human AA, this is not an absolute feature in canine AA. The finding that spontaneous hair regrowth occurs in the majority of AA-affected dogs is a notable one, as the majority of untreated human AA patients will also regrow their hair within 1 year [45]. Moreover, like the human correlate [46], immunosuppressive therapy is successful in stimulating hair regrowth in dogs, including those not showing spontaneous regrowth. Hair regrowth in human AA is often initially white, confirming the involvement of melanogenic melanocytes
1391_C31.fm Page 479 Tuesday, November 18, 2003 5:49 PM
SPONTANEOUS CANINE MODEL OF ALOPECIA AREATA
479
located in the anagen hair bulb in this disorder [5,36,37]. Similarly, regrowing white hair occurs in the majority of canine AA cases examined to date, suggesting that target cell(s), and antigens therein are likely to be conserved in nature. It is perhaps noteworthy that a recent study [35] reported that the melanocyte defect may be more severe/long-lasting in canine AA, as regrowing hair may fail to regain pigmentation even after several molts. Canine AA exhibits the histological hallmark of human AA — the so-called “swarm of bees” mononuclear cell infiltrate focused at the anagen hair bulb [8]. Not only are anagen HFs preferentially targeted by the AA disease insult in both human [7] and canine [35] AA, but a nonscarring (peri)bulbitis is a feature in all cases studied to date. Indeed, the T-cell–rich infiltrate in canine AA locates principally in/around the hair bulb and thus correlates even more closely with human AA than does the C3H/HeJ mouse AA model [12]. As is the case in human AA [47], T-cell phenotyping of canine AA reveals that greater numbers of CD8+ T cells invade the HF bulb epithelium while more CD4+ T cells were distributed peribulbarly [25,35]. The role of humoral factors in the pathogenesis of alopecia areata remains controversial. It is in dissecting this aspect of AA that animal models may prove very useful, given the ethical considerations involved in using human subjects for this type of manipulation [3,48] Even if AA IgG antibodies do not prove to be pathogenic, autoantibodies, via the epitopes they target, are likely to tell us a great deal about the HF autoantigen(s) in AA. One of the most unifying features of AA in humans and other mammals is the presence of antibodies directed to HF-specific target proteins detected using direct and indirect immunofluorescence and by immunoblotting [14,26,29,31,40–42,50]. Circulating IgG antibodies in canine AA patients react with multiple components of anagen HFs, again corresponding to the situation in humans [14,31,40]. It is of note that the hair bulb and precortex, the site of significant keratinocyte and melanocyte differentiation, is most commonly targeted in both species. In this way, humoral factors could disturb cell differentiation and so compromise hair formation/cycling. Like all other species examined to date, canine AA sera contain IgG antibodies that preferentially reacted with antigens in the 40- to 60-kDa and 200- to 220-kDa molecular weight range [14,26,29,31,40–42,50]. Keratins are well represented in the former and trichohyalin (the IRS-rich protein) in the latter. Indeed, human AA but not control sera (including from scarring alopecias), was able to selectively immunoprecipitate the 46/47-kDa HF-specific keratin recognized by AE14 [42]. We have previously reported that canine AA sera can immunoprecipitate trichohyalin [29] and this was confirmed in further cases of canine AA [35]. As a member of the intermediate filament-associated protein family, trichohyalin is thought to be necessary for correct alignment of keratin filaments of the IRS and medulla [50]. Thus, it is likely that disruption of IRS differentiation during anagen (AA-targeted phase of the hair cycle) will result in defective hair shaft formation. The precise role of anti-HF antibodies in the pathogenesis remains unknown. Clearly, high-titer antibodies to HFs are not observed in normal individuals despite the release of HF antigens during the normal HF cycle or in even in scarring alopecias with their associated tissue damage [48]. Moreover, an abnormal autoantibody response to HF is present both in affected mice and to a lesser degree in their, as yet, clinically unaffected littermates in the C3H/HeJ mouse model of AA [14]. This suggests that the presence of antibodies to HF appears before the onset of hair loss and so may not be produced as a secondary response to HF damage in AA. Purified IgG from an AAaffected horse has been reported to retard hair regrowth when passively transferred to normal mice [31]. However, an earlier study reported the failure of whole AA serum to inhibit hair growth when passively transferred into human scalp skin grafted onto nude mice [51]. Our recent attempt to passively transfer purified canine AA IgG into naïve mice suggests that AA IgG retards re-entry of telogen HF into anagen for longer than in skin treated with normal canine IgG [35]. However, the AA IgG failed to prevent hair regrowth, and histologically there was no bulbitis. These studies need to be repeated with larger numbers of animals in order to reach statistical significance.
1391_C31.fm Page 480 Tuesday, November 18, 2003 5:49 PM
480
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
IX. CONCLUSION In conclusion, the current literature provides good evidence that dogs with AA-like disease exhibit very similar clinical, histological, and immunopathological features to those seen in AA in humans. Given the outbred nature of canine AA, these findings provide us with a new model system to evaluate the pathology of AA in humans and also to assess treatment modalities.
REFERENCES 1. Safavi, K.H. et al., Incidence of alopecia areata in Olmsted County, Minnesota, 1975–1989, Mayo Clin. Proc., 70, 628, 1995. 2. Safavi, K.H., Prevalence of alopecia areata in the first national health and nutrition examination survey, Arch. Dermatol., 128, 702, 1992. 3. McElwee, K.J. et al., Comparison of alopecia areata in human and non-human mammalian species, Pathobiology, 66, 90, 1998. 4. Tobin, D.J., Morphological analysis of hair follicles in alopecia areata, Microsci. Res. Tech., 38, 443, 1997. 5. Tobin, D.J., Fenton, D.A., and Kendall, M.D., Ultrastructural observations on the hair bulb melanocytes and melanosomes in acute alopecia areata, J. Invest. Dermatol., 94, 803, 1990. 6. Goos, M., Zur histopathologie der alopecia areata, Arch. Derm. Forsch., 240, 160, 1971. 7. Messenger, A.G., Slater, D.N., and Bleehen, S.S., Alopecia areata: alterations in the hair growth cycle and correlation with follicular pathology, Br. J. Dermatol., 114, 337, 1986. 8. Van Scott, E.J., Morphologic changes in pilosebaceous units and anagen hairs in alopecia areata, J. Invest. Dermatol., 31, 35, 1958. 9. Thompson, W. and Shapiro, J., Alopecia areata, in Understanding and Coping with Hair Loss, John Hopkins University Press, Baltimore, 1996, p. 1. 10. McElwee, K.J. et al., Alopecia areata: an autoimmune disease? Exp. Dermatol., 8, 371, 1999. 11. Olsen, E. et al., investigational assessment guidelines. National Alopecia Areata Foundation, J. Am. Acad. Dermatol., 40 (2 Pt 1), 242, 1999. 12. Sundberg, J.P., Cordy, W.R, and King, L.E., Alopecia areata in aging C3H/HeJ mice, J. Invest. Dermatol., 102, 847, 1994. 13. Michie, H. J. et al., The DEBR rat: an animal model of human alopecia areata, Br. J. Dermatol., 125, 94, 1991. 14. Tobin, D.J. et al., Autoantibodies to hair follicles in C3H/HeJ mice with alopecia areata-like hair loss, J. Invest. Dermatol., 109, 329, 1997. 15. Michie, H.J. et al., Immunobiological studies on the alopecic (DEBR) rat, Br. J. Dermatol., 123, 557, 1990. 16. McElwee, K.J. et al., Experimental induction of alopecia areata-like hair loss in C3H/HeJ mice using full-thickness skin grafts, J. Invest. Dermatol., 111, 797, 1998. 17. Tobin, D.J. et al., Diphencyprone immunotherapy alters anti-hair follicle antibody status in patients with alopecia areata, Eur. J. Dermatol., 12, 327, 2002. 18. Freyschmidt-Paul, P. et al., Treatment of alopecia areata in C3H/HeJ mice with the topical immunosuppressant FK506 (Tacrolimus), Eur. J. Dermatol., 11, 405, 2001. 19. Scarff, D.H. Disorders of pigmentation, in Manual of Small Animal Dermatology, Locke, P.H., Harvey, R.G., and Mason, I.S., Eds., British Small Animal Veterinary Association, Looke Printer Poole, 1993, chap. 3. 20. Conroy, J.D., Alopecia in dogs and cats, J. Am. Anim. Hosp. Assoc., 4, 200, 1968. 21. Conroy, J.D., Alopecia areata, in Spontaneous Animal Model of Human Disease, Andrews, E.J., Ward, B.C., and Altman, N.H., Eds., Academic Press, New York, 1979, p. 30. 22. Muller, G.H., Kirk, R.W., and Scott, D.W., Small Animal Dermatology, W.B. Saunders, Philadelphia, 1983.
1391_C31.fm Page 481 Tuesday, November 18, 2003 5:49 PM
SPONTANEOUS CANINE MODEL OF ALOPECIA AREATA
481
23. Gross, T.L., Ihrke, P.J., and Walder, E.J., Alopecia areata, in Veterinary Dermatopathology: A Macroscopic and Microscopic Evaluation of Canine and Feline Skin Disease, Gross, T.L., Irhke, P.J., and Walder, E.J., Eds., Mosby Year Book, St. Louis, 1992, p. 291. 24. Tobin, D.J. et al., Hair follicle-specific antibodies in mammalian species with alopecia areata, J. Invest. Dermatol., 108, 654, 1997. 25. Olivry, T. et al., Antifollicular cell-mediated and humoral immunity in canine alopecia areata, Vet. Dermatol., 7, 67, 1996. 26. Guernsey, G.E., Alopecia areata in a dog, Can. Vet. J., 26, 403, 1985 (letter). 27. Yager, J. and Wilcock, B.P., Lymphocytic folliculitis resembling human alopecia areata and universalis, in Color Atlas and Text of Surgical Pathology of the Dog and Cat, Mosby Year Book Europe Limited (Wolfe), St. Louis, 1994, p. 196. 28. Scott, D.W., Miller, W.H., and Griffin, C.E., Small Animal Dermatology, 5th ed., W.B. Saunders, Philadelphia, 1995. 29. Tobin, D.J., Olivry, T., and Bystryn, J.-C., Anti-trichohyalin antibodies in canine alopecia areata, in Advances in Veterinary Dermatology, Kwochka, K.W., Willemse, T., and von Tscharner, C., Eds., Butterworth-Heinemann, Boston, 355. 30. Scott, D.W., Large Animal Dermatology, W.B. Saunders, Philadelphia, 1988, 393. 31. Tobin, D.J., Alhaidari, Z., and Olivry, T., Equine alopecia areata autoantibodies target multiple hair follicle antigens and may alter hair growth in passive transfer studies, Exp. Dermatol., 7, 289, 1998. 32. Scott, D.W. and Guard, C.L.G., Alopecia areata in a cow, Agric. Pract., 9, 16, 1988. 33. Paradis, M., Fecteau, G., and Scott, G.W., Alopecia areata in a cow, Can. Vet. J., 29, 727, 1988. 34. Eichberg, J.W. and DeVillez, R.L., Alopecia totalis in a chimpanzee, J. Med. Primatol., 13, 81, 1984. 35. Tobin, D.J. et al., A natural canine homologue of alopecia areata in humans, Br. J. Dermatol., in press. 36. Messenger, A.G. and Bleehen, S.S., Alopecia areata: light and electron microscopic pathology of the regrowing white hair, Br. J. Dermatol., 110, 155, 1984. 37. Gilhar, A. et al., Melanocyte-associated T cell epitopes can function as autoantigens for transfer of alopecia areata to human scalp explants on Prkdc(scid) mice, J. Invest. Dermatol., 117, 1357, 2001. 38. Kim, I.H. et al., Quantitative image analysis of hair follicles in alopecia areata, Acta Derm. Venereol., 79, 214, 1999. 39. Bystryn, J.-C., Orentreich, N., Stengel, F., Direct immunofluorescence studies in alopecia areata and male pattern alopecia, J. Invest. Dermatol., 73, 317, 1979. 40. Tobin, D.J. et al., Hair follicle structures targeted by antibodies in alopecia areata, Arch. Dermatol., 133, 57, 1997. 41. Tobin, D.J. et al., Antibodies to hair follicles in alopecia areata, J. Invest. Dermatol., 102, 721, 1994. 42. Tobin, D.J. and Bystryn, J-C., Alopecia areata is associated with antibodies to hair follicle-specific antigens located predominantly in the proliferative region of hair follicles, in Hair Research for the Next Millennium, Neste, D.J.J. and Randall, V.A., Eds., Elsevier Science, Amsterdam, 1996, p. 237. 43. Gollnick, H. and Orfanos, C.E., Alopecia areata: pathogenesis and clinical picture, in Hair and Hair Diseases, Orfanos, C.E. and Happle, R., Eds., Springer, Berlin, 1990 p. 529. 44. Guin, J.D, Kumar, V., and Petersen, B.H., Immunofluorescence findings in rapid whitening of scalp hair, Arch. Dermatol., 117, 576, 1981. 45. Madani, S. and Shapiro, J., Alopecia areata update, J. Am. Acad. Dermatol., 42, 549, 2000. 46. Shapiro, J., Alopecia areata. Update on therapy, Dermatol. Clin., 11, 35, 1993. 47. Perret, C., Weisner-Menzel, L., and Happle, R., Immunohistochemical analysis of T-cell subsets in the peribulbar and intrabulbar infiltrates in alopecia areata, Acta Derm. Venereol., 64, 26, 1984. 48. Tobin, D.J. and Bystryn, J-C., Immunology of alopecia areata, in Hair and Hair Disorders: Research, Pathology and Management, Camacho, F.M., Randall, V.A., and Price, V., Eds., Martin Dunitz, London, 2000, p. 187. 49. McElwee, K.J., Pickett, P., and Oliver, R.F., The DEBR rat, alopecia areata and autoantibodies to the hair follicle, Br. J. Dermatol., 134, 55, 1996. 50. O’Guin, W.M., Sun, T.T., and Manabe, M., Interaction of trichohyalin with intermediate filaments: three immunologically defined stages of trichohyalin maturation, J. Invest. Dermatol., 98, 24, 1992. 51. Gilhar, A. et al., Failure of passive transfer of serum from patients with alopecia areata and alopecia universalis to inhibit hair growth in transplants of human scalp skin grafted on to nude mice, Br. J. Dermatol., 126, 166, 1992.
1391_C31.fm Page 482 Tuesday, November 18, 2003 5:49 PM
1391_C32.fm Page 483 Tuesday, November 18, 2003 5:51 PM
CHAPTER
32
Experimental Chimeric SCID Mouse/Human Skin Model of Alopecia Areata: Induction by Transfer of Cellular Immunity Richard S. Kalish and Amos Gilhar
CONTENTS I. History ................................................................................................................................483 II. Laboratory Animals............................................................................................................484 A. Human Skin Graft/SCID Mouse as an Experimental System for Studying Inflammatory Conditions ...........................................................................................484 B. Characteristics of SCID Mice ...................................................................................484 C. Immunodeficient Mice as Recipients for Human Scalp Grafting ............................484 III. Disease Induction...............................................................................................................485 A. The Role of T Cells...................................................................................................485 B. The Role of Pretransfer Activation with Follicular Antigen ....................................485 C. The Roles of CD4+ and CD8+ T-Cell Subsets ..........................................................486 D. The Role of Melanocyte-Derived Antigen................................................................486 IV. The Disease Assessment ....................................................................................................487 A. Clinical Manifestation ...............................................................................................487 B. Histopathological and Immunopathological Examination........................................489 V. Lessons Learned.................................................................................................................489 References ......................................................................................................................................489
I. HISTORY Much clinical evidence suggests that alopecia areata (AA) is an autoimmune disease. AA responds to immunosuppressive doses of systemic steroids [1], as well as immunotherapy with contact sensitizers [2]. The condition also has an association with known autoimmune processes such as autoimmune thyroiditis [3] and vitiligo [4]. As is the case with other autoimmune diseases, AA has associations with HLA, specifically DQB1 03 [5,6], HLA-B18 [7], and possibly HLA-A2 [8]. The LOD score for HLA-DR is 2.34 and that for DQB1 is 2.41, with a significant association with DQB1 302 [9]. Alopecia totalis/universalis has an association with DQB1 0301 [10,11]. This
0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
483
1391_C32.fm Page 484 Tuesday, November 18, 2003 5:51 PM
484
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
association is not found for patchy AA, suggesting a genetic difference between these two conditions. However, both patient groups have a positive association with HLA-DQ3 (DQB1 03). Hair loss in AA is associated with a perifollicular lymphocytic infiltrate made up primarily of CD4+ cells, along with a CD8+ intrafollicular infiltrate [12]. Evidence for immune activation includes expression of both HLA-DR and ICAM-1 on the follicular epithelium [13–15]. The role of antibodies in AA is uncertain. Circulating autoantibodies to follicular structures are found in patients with AA [16]. Similar antibodies are also reported in normal controls, and there is no consistent pattern of reactivity of antibodies to hair follicle structures. It is not possible to transfer AA by injection of patient IgG into human skin explants on nude mice [17].
II. LABORATORY ANIMALS A. Human Skin Graft/SCID Mouse as an Experimental System for Studying Inflammatory Conditions Severe combined immunodeficiency (SCID) mice are a useful model for the study of human inflammatory diseases [18,19]. SCID mice can accept grafts of both human skin and human leukocytes. Human immune reactions can be demonstrated in human skin grafted to SCID mice, and human skin graft/SCID mouse systems have been used to model inflammation [20], leukocyte homing [21,22], delayed hypersensitivity [12,23,24], skin allograft rejection [25,26], and autoimmune diseases of the skin. Human skin graft/SCID mouse systems have been extensively used in the study of psoriasis [27–33]. B. Characteristics of SCID Mice SCID mice are deficient in the ability to rearrange both T-cell receptor genes and immunoglobulin genes [34]. This results in a lack of T cells, B cells, and antibodies [35]. The mice exhibit lymphopenia, with almost empty splenic follicles and lymph nodes, as well as absent thymic cortex [36]. The function of antigen-presenting cells is normal [37]. The mutation responsible for the SCID phenotype involves a DNA-dependent protein kinase (Prkdc) that inhibits DNA recombination [38,39]. With age, SCID mice exhibit a low number of rearranged B and T cells (“leakiness”) [40,41]. Natural killer (NK) function is normal or elevated in SCID mice [42], and NK cells can mediate rejection of hematopoietic grafts, as well as clearance of infiltrating lymphocytes in skin grafts. SCID mice will not reject xenografts of human skin; however, engraftment of human bone marrow and lymphocytes are more complex [43]. Issues include the lack of human colonystimulating factors in the mouse, as well as the presence of NK activity. Several approaches have been taken to reduce NK activity, including development of NOD-SCID mice, and beige-SCID mice [44–46]. The choice of SCID mouse type and NK activity must be considered in data interpretation and experimental design. C. Immunodeficient Mice as Recipients for Human Scalp Grafting Bald (lesional) AA scalp grafted to immunodeficient nude mice will regrow hair [47,48]. It is presumed that hair regrowth results from removal of the hair follicle from the host immune system. Hair also regrows when AA lesional scalp is grafted to SCID mice. Regrowth of hair is associated with loss of CD8+ T cells from the infiltrate, along with a decrease in infiltrating CD4+ cells, particularly at the hair bulb [49]. Grafting of normal human hair to SCID mice initially results in a dystrophic catagen, with subsequent regrowth of normal anagen follicles [50]. Human hair will grow continually on a SCID mouse for at least 1 year [51].
1391_C32.fm Page 485 Tuesday, November 18, 2003 5:51 PM
INDUCTION BY TRANSFER OF CELLULAR IMMUNITY
485
NUMBER OF HAIRS PER GRAFT (STD)
NOT INJECTED
PBMC
SCALP T-CELLS
SCALP TC-HOM
0
DAY 68 Figure 32.1
2
4
DAY 75
6
8
DAY 82
The grafts were injected intradermally with T cells as indicated on day 40. Number of hairs per graft (N = 18 grafts). On day 82 the difference between Scalp TC-Hom and other treatments was statistically significant (ANOVA, p < 0.001). TC-HOM, T cell cultured with hair follicle homogenate. (From Gilhar, A. et al., J. Clin. Invest., 101, 62, 1998, with permission.)
III. DISEASE INDUCTION A. The Role of T Cells We have developed a system for transfer of AA to human scalp grafts on SCID mice by injection of lesional T cells [52]. Lesional (bald) scalp is grafted to CB-17 Prkdcscid (SCID) mice (Charles River, UK). Two-mm punch biopsies are used for grafting, and the grafts are inserted through an incision in the skin into the subcutaneous tissue over the lateral thoracic cage of each mouse, and covered with a standard band-aid dressing. Additional scalp biopsies are obtained for isolation of lymphocytes by collagenase treatment and mincing. These lymphocytes are cultured with irradiated autologous peripheral blood monocytes as antigen presenting cells, and IL-2. Homogenized hair follicles are added as a source of potential autoantigen. Forty days after grafting, the hair starts to regrow and the cultured autologous T cells are injected into the grafts, inducing loss of hair, along with morphological changes of AA. The number of hairs per graft on days 75 and 82 was significantly (ANOVA, p < 0.05) lower in grafts injected with T cells incubated with hair follicle homogenate than in control groups (Figure 32.1). Grafts injected with these T cells also had a significant reduction in hairs per graft on day 82 relative to day 68 (ANOVA, p < 0.05). B. The Role of Pretransfer Activation with Follicular Antigen Activation of lesional T cells to induce hair loss is specific for T cells cultured with hair follicle autoantigen. Control lesional and peripheral-blood T-cell cultures activated with PHA, or IL-2 do not induce hair loss. Lesional T cells cultured with homogenate of nonfollicular scalp also failed to induce hair loss [53]. The requirement for hair follicle homogenate to active lesional T cells
1391_C32.fm Page 486 Tuesday, November 18, 2003 5:51 PM
486
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
suggests that the pathogenic T cells are specific for a follicular autoantigens. Inability to induce hair loss with activated peripheral blood T cells may reflect a low proportion of pathogenic T cells in the peripheral blood. The data suggest that the proportion of pathogenic T cells in lesional skin is also very low, and requires antigen specific stimulation to obtain sufficient amplification of cell numbers to transfer hair loss. These data suggest that AA is an autoimmune condition mediated by T cells activated by a follicular antigen. C. The Roles of CD4+ and CD8+ T-Cell Subsets We next addressed the role of CD4+ and CD8+ T cells in the immunopathogenesis of AA, using the human scalp graft/SCID mouse transfer model [54]. Lesional scalp T cells were cultured with hair follicle homogenate, autologous antigen-presenting cells, and IL-2 as described above. Every 5 days the T cells were restimulated with feeders, antigen, and IL-2 for a total of culture of 30 days. After 30 days of culture, the T cells were separated into CD4+ and CD8+ cells by selection with magnetic beads. These T cells were injected into autologous lesional scalp grafts on SCID mice. Three treatment groups of transferred T cells included: CD4+ cells, CD8+ cells, and mixed CD4+ and CD8+ T cells. Experiments were repeated using both negative and positive selection of CD4+ and CD8+ T cells. In five experiments, the injection of unseparated T cells or mixed CD4+ and CD8+ T cells induced reproducible significant hair loss (ANOVA, p < 0.01). It was not possible to induce hair loss with injection of separated CD4+ or CD8+ T cells. This indicates that optimal hair loss requires cooperation between CD4+ and CD8+ T cells. Since the T cells were activated in vitro prior to injection, it may be expected that CD8+ effector cells would induce hair loss without the need for CD4+ help. The finding that both CD4+ and CD8+ T cells are required for optimal hair loss suggests that both T-cell subsets have a role in the induction of pathology. CD4+ T cells are generally more effective at cytokine production. Interferon-g produced by CD4+ cells may facilitate the effects of CD8+ T cells by inducing HLA-A, B, and C, as well as ICAM-1 (CD54) on follicular epithelium. There is additional support for an effector role for CD8+ T cells in the pathogenesis of AA. The intrafollicular T-cell infiltrate is predominantly composed of CD8+ T cells [55]. Intrafollicular T cells are cytotoxic and possess both the Fas/Fas ligand and granzyme B cytotoxic mechanisms [56]. In contrast the perifollicular infiltrate is composed primarily of CD4+ T cells. Depletion of either CD8+ T cells [57] or CD4+ T cells [58] can reverse AA in the Dundee experimental bald rat, indicating a synergy or cooperation between CD8+ and CD4+ T cells. One of the features of AA is aberrant expression of HLA-A, B, and C on the follicular epithelium of the hair bulb [59]. Paus et al. [60] have hypothesized that this expression of class I MHC allows an autoaggressive response by CD8+ T cells. The authors suggested that the CD8+ cells induce MHC class II on affected hair follicles, resulting in a second wave of CD4+ cells. We have previously reported CD4+ autoreactive T cells in the AA lesions [61]. D. The Role of Melanocyte-Derived Antigen It has been hypothesized that the autoantigen of AA is melanocyte derived [60]. The initial basis for this is the clinical observation that with disease activity, pigmented hairs are lost preferentially to nonpigmented (e.g., white) hairs. Furthermore, with regrowth there is a tendency for the initial regrowing hairs to be white. Melanocytes are a significant component of the hair bulb, which is the site of immunological attack. There is also an association of AA with vitiligo [62,63], and melanocytes of the hair bulb show both histological and ultrastructural abnormalities in AA [64]. Mice immunized against melanocyte-associated (e.g., melanoma) antigens can exhibit alopecia [65]. Since CD8+ T cells have a role in AA, it is logical to search for melanocyte antigens recognized by CD8+ T cells in association with HLA-A, B, and C molecules. Many such T-cell epitopes have been
1391_C32.fm Page 487 Tuesday, November 18, 2003 5:51 PM
INDUCTION BY TRANSFER OF CELLULAR IMMUNITY
487
identified in the search for melanoma-associated antigens, with particular attention paid to peptides presented by HLA-A2, which is present in approximately half the population [66]. HLA-A2 may also be associated with AA [67]. These melanocyte-associated peptides are derived from melanosomeassociated proteins such as gp100, MART-1/Melan-A, melanocortin 1 receptor (MC1R), or tyrosinase, and are present in both normal melanocytes and melanomas. MAGE antigens tend to be preferentially expressed on melanoma cells, and are less likely to function as autoantigens for AA. The following peptides were commercially synthesized (Chiron Technologies, Raleigh, NC) with free amino- and carboxylic-acid termini: Gp100/G9-154, KTWGQYWQV [68–70]; Gp100/G9-209, ITDQVPFSV [68–70]; Gp100/G9-280, YLEPGPVTA [68–70]; MC1R 291, AIIDPLIYA [71]; MC1R 244, TILLGIFFL [71]; MC1R 283, FLALIICNA [71]; MART-1 (amino acid sequence No. 27–35), AAGIGILTV [72,73]; and tyrosinase, AFLPWHRFL [74]. The goal of this study was to test the hypothesis that melanocyte-associated antigens can function as autoantigens to induce hair loss in AA. For this purpose, six HLA-A2 positive patients with AA were selected for studies of HLA-A2-restricted, melanocyte peptide epitopes. Patients exhibited either alopecia totalis, or severe AA. Severe AA is defined as large areas of alopecia with small residual areas of hair. These patients would be categorized as S4 (76% to 99% hair loss) by the AA investigational assessment guidelines [75]. Scalp biopsies were grafted to CB-17 Prkdcscid (SCID) mice (Charles River, UK) as described above, and additional scalp biopsies were obtained as a source of autologous lesional T cells. Scalp T cells were cultured with IL-2, autologous antigen-presenting cells, and either hair follicle homogenate (positive control) or melanocyte T-cell epitopes. The cells were then injected into autologous scalp explants on SCID mice, and the number of hairs per graft was measured. Melanoma peptide-activated T cells were able to significantly (ANOVA, p < 0.001) reduce the numbers of hair regrowing [76]. T cells incubated with follicular homogenate as a source of autoantigen resulted in a similar significant reduction in hair numbers. For all six donors, no hairs were present at day 90 in any of the three grafts per donor from grafts injected with T cells activated by either melanocyte peptides or hair follicle homogenate. There was no reduction of hair in grafts injected with control T cells cultured with IL-2 and antigen-presenting cells alone. As was observed following activation of T cells with the follicular homogentate, melanocyte peptide-activated T cells induced follicular expression of ICAM-1, HLA-DR, and HLA-A, B, and C. This demonstrates that melanocyte peptide epitopes are capable of activating T cells to induce hair loss in AA. Biopsies were taken from the mice in the above experiment after 90 days and analyzed both by histology and immunohistochemistry. Noninjected grafts showed growth of normal terminal anagen hairs. In contrast, injected grafts showed dystrophic hair follicles with a dense infiltrate of CD4+ T cells, as well as an intrafollicular infiltrate of CD8+ T cells. In contrast to noninjected grafts, the follicular epithelium of the injected grafts expressed HLA-A, B, and C; HLA-DR; and ICAM-1. These are known features of active AA. The ability of melanocyte-associated peptides to activate T cells to transfer AA indicates that melanocyte peptides are capable of functioning as autoantigens in AA. Multiple peptides were recognized in this small panel of six HLA-A2 positive patients, suggesting that there is a wide array of melanocyte autoantigen peptides. This work demonstrates the power of the human skin graft/SCID mouse system not only to delineate mechanisms of pathogenesis, but to identify autoantigens.
IV. THE DISEASE ASSESSMENT A. Clinical Manifestation Clinical assessment for the hair loss phenotype takes place by counting the number of hairs regrown per human scalp skin transplanted onto the SCID mice as described in Section III.
1391_C32.fm Page 488 Tuesday, November 18, 2003 5:51 PM
488
Figure 32.2
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Histology of alopecia areata scalp explants prior to grafting, and on day 82. (A) Alopecia areata biopsy prior to grafting (¥20), (B) Noninjected graft day 82, horizontal section with mouse skin on upper part. Cross-section demonstrates ten human terminal hairs in anagen (¥20). (C) Graft injected with scalp T cells, with normal anagen hair follicles (¥32). (D) Graft injected with scalp T cells cultured with follicular homogenate. Hair follicles are surrounded by a dense lymphocytic infiltration (¥20). Mouse skin present at upper left and right. (From Gilhar, A. et al., J. Clin. Invest., 101, 62, 1998, with permission.)
1391_C32.fm Page 489 Tuesday, November 18, 2003 5:51 PM
INDUCTION BY TRANSFER OF CELLULAR IMMUNITY
489
B. Histopathological and Immunopathological Examination The histopathological examination of hair-loss, human scalp skin grafted onto SCID mice reveals evidence of AA in autologous, follicular antigen-activated, lesional T-cell–injected grafts: a dense infiltrate of mononuclear cells and follicular dystrophy with matrix and hair bulb degeneration (Figure 32.2). Few anagen follicles were present but only at higher levels of the dermis, and no terminal hairs were noted. In contrast, grafts injected with PBMC or scalp T cells cultured without hair follicle homogenate revealed normal terminal hairs without follicular damage (Figure 32.2). Other features of AA that are reproduced include expression of ICAM-1, HLA-DR, and HLA-A, B, and C by follicular epithelium.
V. LESSONS LEARNED First, we learned that immunodeficient mice, particularly SCID mice, are suitable recipients for human scalp transplantation. This suitability will provide available tools for other experimental inflammatory skin diseases, such as passive transfer of autoantibodies in autoimmune blistering skin diseases and psoriasis. Second, the ability to transfer of AA hair loss by injection of autologous lesional T cells into scalp grafts on SCID mice highly indicates that T cells are responsible for the induction of hair loss in this model. Furthermore, we learned that transfer of hair loss requires activation with autoantigen, specifically follicular antigen. In addition, we found that induction of hair loss requires cooperation between CD4+ and CD8+ T cells. Lastly, we learned that melanocyteassociated antigens in peptide form can serve as autoantigens for activation of lesional T cells to transfer AA. Thus, this model provides investigators with a tool not only in determining the immune cell types responsible for AA, but also the antigenic epitopes of the autoreactive T cells.
REFERENCES 1. Kiesch, N. et al., Pulse steroid therapy for children’s severe alopecia areata? Dermatology, 194, 395, 1997. 2. Micali, G. et al., Treatment of alopecia areata with squaric acid dibutylester, Int. J. Dermatol., 35, 52, 1996. 3. Milgraum, S.S. et al., Alopecia areata, endocrine function, and autoantibodies in patients 16 years of age or younger, J. Am. Acad. Dermatol., 17, 57, 1987. 4. Shellow, W.V., Edwards, J.E., and Koo, J.Y., Profile of alopecia areata: a questionnaire analysis of patient and family, Int. J. Dermatol., 31, 186, 1992. 5. Welsh, E.A. et al., Human leukocyte antigen-DQB1 03 alleles are associated with alopecia areata, J. Invest. Dermatol., 103, 758, 1994. 6. Morling, N. et al., DNA polymorphism of HLA class II genes in alopecia areata, Dis. Markers, 9, 35, 1991. 7. Hacham-Zadeh, S. et al., HLA and alopecia areata in Jerusalem, Tissue Antigens, 18, 71, 1981. 8. Hordinsky, M.K. et al., Familial alopecia areata. HLA antigens and autoantibody formation in an American family, Arch. Dermatol., 120, 464, 1984. 9. de Andrade, M. et al., Alopecia areata in families: association with the HLA locus, J. Invest. Dermatol. Symp. Proc., 4, 220, 1999. 10. Colombe, B.W. et al., HLA class II antigen associations help to define two types of alopecia areata, J. Amer. Acad. Dermatol., 33, 757, 1995. 11. Colombe, B.W., Lou, C.D., and Price, V.H., The genetic basis of alopecia areata: HLA associations with patchy alopecia areata versus alopecia totalis and alopecia universalis, J. Invest. Dermatol. Symp. Proc., 4, 216, 1999. 12. Todes-Taylor, N. et al., T cell subpopulations in alopecia areata, J. Am. Acad. Dermatol., 11, 216, 1984.
1391_C32.fm Page 490 Tuesday, November 18, 2003 5:51 PM
490
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
13. Messenger, A.G. and Bleehen, S.S., Expression of HLA-DR by anagen hair follicles in alopecia areata, J. Invest. Dermatol., 85, 569, 1985. 14. Khoury, E.L., Price, V.H., and Greenspan, J.S., HLA-DR expression by hair follicle keratinocytes in alopecia areata: evidence that it is secondary to the lymphoid infiltration, J. Invest. Dermatol., 90, 193, 1988. 15. Mcdonagh, A.J. et al., HLA and ICAM-1 expression in alopecia areata in vivo and in vitro: the role of cytokines, Br. J. Dermatol., 129, 250, 1993. 16. Tobin, D.J. et al., Hair follicle structures targeted by antibodies in patients with alopecia areata, Arch. Dermatol., 133, 57, 1997. 17. Gilhar, A. et al., Failure of passive transfer of serum from patients with alopecia areata and alopecia universalis to inhibit hair growth in transplants of human scalp skin grafted on to nude mice, Br. J. Dermatol., 126, 166, 1992. 18. Bosma, M.J. and Carroll, A.M., The SCID mouse mutant: definition, characterization, and potential uses, Annu. Rev. Immunol., 9, 323, 1991. 19. Boehncke, W.H., The SCID-hu xenogeneic transplantation model: complex but telling, Arch. Dermatol. Res., 291, 367, 1999. 20. Taub, D.D. et al., Chemokine-induced human lymphocyte infiltration and engraftment in huPBL-SCID mice, Methods Enzymol., 287, 265, 1997. 21. Kunstfeld, R. et al., HECA-452+ T cells migrate through superficial vascular plexus but not through deep vascular plexus endothelium, J. Invest. Dermatol., 108, 343, 1997. 22. Blades, M.C. et al., Stromal cell-derived factor 1 (CXCL12) induces human cell migration into human lymph nodes transplanted into SCID mice, J. Immunol., 168, 4308, 2002. 23. Tsicopoulos, A. et al., Tuberculin-induced delayed-type hypersensitivity reaction in a model of huPBMC-SCID mice grafted with autologous skin, Am. J. Pathol., 152, 1681, 1998. 24. Rosenblatt-Velin, N. et al., Transformed and nontransformed human T lymphocytes migrate to skin in a chimeric human skin/SCID mouse model, J. Invest. Dermatol., 109, 744, 1997. 25. Briscoe, D.M. et al., The allogeneic response to cultured human skin equivalent in the hu-PBL-SCID mouse model of skin rejection, Transplantation, 67, 1590, 1999. 26. Rayner, D., Nelson, R., and Murray, A.G., Noncytolytic human lymphocytes injure dermal microvessels in the huPBL-SCID skin graft model, Hum. Immunol., 62, 598, 2001. 27. Gilhar, A. et al., T-lymphocyte dependence of psoriatic pathology in human psoriatic skin grafted to SCID mice, J. Invest. Dermatol., 109, 283, 1997. 28. Boehncke, W.H. et al., Pulling the trigger on psoriasis, Nature, 379, 777, 1996. 29. Boehncke, W.H. et al., Induction of psoriasiform inflammation by a bacterial superantigen in the SCID-hu xenogeneic transplantation model, J. Cutan. Pathol., 24, 1, 1997. 30. Wrone-Smith, T. and Nickoloff, B.J., Dermal injection of immunocytes induces psoriasis, J. Clin. Invest., 98, 1878, 1996. 31. Nickoloff, B.J., Is psoriasis a T-cell disease? Controversies in experimental dermatology, Exp. Dermatol., 9, 359, 2000. 32. Nickoloff, B.J. et al., Characterization of a T cell line bearing natural killer receptors and capable of creating psoriasis in a SCID mouse model system, J. Dermatol. Sci., 24, 212, 2000. 33. Gilhar, A. et al., Psoriasis is mediated by a cutaneous defect triggered by activated immunocytes: induction of psoriasis by cells with NK receptors, J. Invest. Dermatol., 119, 384, 2002. 34. Lieber, M.R. et al., The defect in murine severe combined immune deficiency: joining of signal sequences but not coding segments in V(D)J recombination, Cell, 55, 7, 1988. 35. Bosma, G.C., Custer, R.P., and Bosma, M.J., A severe combined immunodeficiency mutation in the mouse, Nature, 301, 527, 1983. 36. Custer, R.P., Bosma, G.C., and Bosma, M.J., Severe combined immunodeficiency (SCID) in the mouse. Pathology, reconstitution, neoplasms, Am. J. Pathol., 120, 464, 1985. 37. Czitrom, A.A. et al., The function of antigen-presenting cells in mice with severe combined immunodeficiency, J. Immunol., 134, 2276, 1985. 38. Kirchgessner, C.U. et al., DNA-dependent kinase (p350) as a candidate gene for the murine SCID defect, Science, 267, 1178, 1995. 39. Blunt, T. et al., Identification of a nonsense mutation in the corboxyl-terminal region of DNA-dependent protein kinase catalytic subunit in the scid mouse, Proc. Natl. Acad. Sci. U. S. A., 93, 10285, 1996.
1391_C32.fm Page 491 Tuesday, November 18, 2003 5:51 PM
INDUCTION BY TRANSFER OF CELLULAR IMMUNITY
491
40. Carroll, A.M. et al., T cell leakiness in scid mice, Curr. Top. Microbiol. Immunol., 152, 117, 1989. 41. Carroll, A.M., Hardy, R.R., and Bosma, M.J., Occurrence of mature B (IgM+, B220+) and T (CD3+) lymphocytes in scid mice, J. Immunol., 143, 1087, 1989. 42. Dorshkind, K. et al., Natural killer (NK) cells are present in mice with severe combined immunodeficiency (scid), J. Immunol., 134, 3798, 1985. 43. Boehncke, W.H., The SCID-hu xenogeneic transplantation model: complex but telling, Arch. Dermatol. Res., 291, 367, 1999. 44. Shultz, L.D. et al., Multiple defects in innate and adoptive immunologic function in NOD/LtSz-scid mice, J. Immunol., 154, 180, 1995. 45. Takizawa, Y. et al., New immunodeficient (nude-scid, beige-scid) mice as excellent recipients of human skin grafts containing intraepidermal neoplasms, Arch. Dermatol. Res., 289, 213, 1997. 46. Greiner, D.L., Hesselton, R.A., and Shultz, L.D., SCID mouse models of human stem cell engraftment, Stem Cells, 16, 166, 1998. 47. Gilhar, A. and Krueger, G.G., Hair growth in scalp grafts from patients with alopecia areata and alopecia universalis grafted onto nude mice, Arch. Dermatol., 123, 44, 1987. 48. Gilhar, A. et al., Failure of passive transfer of serum from patients with alopecia areata and alopecia universalis to inhibit hair growth in transplants of human scalp skin grafted on to nude mice, Br. J. Dermatol., 126, 166, 1992. 49. Tsuboi, H. et al., Characterization of infiltrating T cells in human scalp explants from alopecia areata to SCID nude mice: possible role of the disappearance of CD8+ T lymphocytes in the process of hair regrowth, J. Dermatol., 26, 797, 1999. 50. Hashimoto, T. et al., Histologic and cell kinetic studies of hair loss and subsequent recovery process of human scalp hair follicles grafted onto severe combined immunodeficient mice, J. Invest. Dermatol., 115, 200, 2000. 51. Kyoizumi, S. et al., Radiation sensitivity of human hair follicles in SCID-hu mice, Radiat. Res., 149, 11, 1998. 52. Gilhar, A. et al., Autoimmune hair loss (alopecia areata) transferred by T lymphocytes to human scalp explants on SCID mice, J. Clin. Invest., 101, 62, 1998. 53. Gilhar, A. et al., Alopecia areata is a T-lymphocyte mediated autoimmune disease: lesional human T-lymphocytes transfer alopecia areata to human skin grafts on SCID mice, J. Investig. Dermatol. Symp. Proc., 4, 207, 1999. 54. Gilhar, A. et al., Alopecia areata is mediated by cooperation between CD4+ and CD8+ T-lymphocytes: Transfer to human scalp explants on Prkdcscid mice, Arch. Dermatol., 138, 916, 2002. 55. Todes-Taylor, N. et al., T cell subpopulations in alopecia areata, J. Am. Acad. Dermatol., 11, 216, 1984. 56. Bodemer, C. et al., Role of cytotoxic T cells in chronic alopecia areata, J. Invest. Dermatol., 114, 112, 2000. 57. McElwee, K.J., Spiers, E.M., and Oliver, R.F., In vivo depletion of CD8+ T-cells restores hair growth in the DEBR model for alopecia areata, Br. J. Dermatol., 135, 211, 1996. 58. McElwee, K.J., Spiers, E.M., and Oliver, R.F., Partial restoration of hair growth in the DEBR model for alopecia areata after in vivo depletion of CD4+ T cells, Br. J. Dermatol., 140, 432, 1999. 59. Brocker, E.B et al., Abnormal expression of class I and class II major histocompatibility antigens in alopecia areata: modulation by topical immunotherapy, J. Invest. Dermatol., 88, 564, 1987. 60. Paus, R., Slominski, A., and Czarnetzki, B.M., Is alopecia areata an autoimmune-response against melanogenesis-related proteins, exposed by abnormal MHC class I expression in the anagen hair bulb? Yale J. Biol. Med., 66, 541, 1994. 61. Kalish, R.S., Johnson, K.L., and Hordinsky, M.K., Autoreactive T-cells are variably enriched relative to peripheral blood in the scalp lesions of alopecia areata, Arch. Dermatol., 128, 1072, 1992. 62. Shong, Y.K. and Kim, J. A., Vitiligo in autoimmune thyroid disease, Thyroidology, 3, 89, 1991. 63. Shellow, W.V., Edwards, J. E., and Koo, J. Y., Profile of alopecia areata: a questionnaire analysis of patient and family, Int. J. Dermatol., 31, 186, 1992. 64. Tobin, D.J., Fenton, D.A., and Kendall, M.D., Ultrastructural observations on the hair bulb melanocytes and melanosomes in acute alopecia areata, J. Invest. Dermatol., 94, 803, 1990. 65. Becker, J.C. et al., Lymphocyte-mediated alopecia in C57Bl/6 mice following successful immunotherapy for melanoma, J. Invest. Dermatol., 107, 627, 1996.
1391_C32.fm Page 492 Tuesday, November 18, 2003 5:51 PM
492
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
66. UCLA Tissue Typing Laboratory, Histocompatibility Testing 1980, Tissue Typing Laboratory, University of California-Los Angeles, 1980 (antigen frequencies). 67. Hordinsky, M.K. et al., Familial alopecia areata. HLA antigens and autoantibody formation in an American family, Arch. Dermatol., 120, 464, 1984. 68. Parkhurst, M.R. et al., Improved induction of melanoma-reactive CTL with peptides from the melanoma antigen gp100 modified at HLA-A 0201-binding residues, J. Immunol., 157, 2539, 1996. 69. Salgaller, M.L. et al., Immunization against epitopes in the human melanoma antigen gp100 following patient immunization with synthetic peptides, Cancer Res., 56, 4749, 1996. 70. Bakker, A.B. et al., Identification of a novel peptide derived from the melanocyte-specific gp100 antigen as the dominant epitope recognized by an HLA-A2.1-restricted anti-melanoma CTL line, Int. J. Cancer, 62, 97, 1995. 71. Salazar-Onfray, F. et al., Synthetic peptides derived from the melanocyte-stimulating hormone receptor MC1R can stimulate HLA-A2-restricted cytotoxic T lymphocytes that recognize naturally processed peptides on human melanoma cells, Cancer Res., 57, 4348, 1997. 72. Bettinotti, M.P. et al., Stringent allele/epitope requirements for MART-1/Melan A immunodominance: implications for peptide-based immunotherapy, J. Immunol., 161, 877, 1998. 73. Rivoltini, L. et al., Induction of tumor-reactive CTL from peripheral blood and tumor-infiltrating lymphocytes of melanoma patients by in vitro stimulation with an immunodominant peptide of the human melanoma antigen MART-1, J. Immunol., 154, 2257, 1995. 74. Kang, X. et al., Identification of a tyrosinase epitope recognized by HLA-A24-restricted, tumorinfiltrating lymphocytes, J. Immunol., 155, 1343, 1995. 75. Olsen, E. et al., Alopecia areata investigational assessment guidelines, J. Am. Acad. Dermatol., 40, 242, 1999. 76. Gilhar, A. et al., Melanocyte-associated T cell epitopes can function as autoantigens for transfer of alopecia areata to human scalp explants on Prkdc(scid) mice, J. Invest. Dermatol., 117, 1357, 2001.
1391_C33.fm Page 493 Tuesday, November 18, 2003 5:53 PM
SECTION
I
Scleroderma
1391_C33.fm Page 494 Tuesday, November 18, 2003 5:53 PM
1391_C33.fm Page 495 Tuesday, November 18, 2003 5:53 PM
CHAPTER
33
Spontaneous Mouse Models of Systemic Scleroderma Paul J. Christner and Sergio A. Jimenez
CONTENTS I. History ................................................................................................................................495 II. Laboratory Animals............................................................................................................496 III. Course and Assessment of Disease ...................................................................................496 A. Tight Skin 1 (Tsk1) Mouse........................................................................................496 1. Cutaneous Alterations..........................................................................................496 2. Internal Organ Involvement.................................................................................497 3. Humoral Immune Abnormalities.........................................................................499 4. Cellular Immune Abnormalities ..........................................................................501 5. Abnormalities in Connective Tissue Metabolism ...............................................502 6. The Molecular Defect in Tsk1/+ Mice................................................................503 7. A Mutation in the Fibrillin-1 Gene: the Genetic Defect in Tsk1 Mice .............504 B. The Tsk2 — A Novel Mutation Resembling SSc.....................................................507 1. Immunology.........................................................................................................507 2. Genetics................................................................................................................507 3. Biochemical Studies ............................................................................................509 C. Transgenic Animal Models Exhibiting Some Features of SSc ................................510 IV. Conclusion..........................................................................................................................511 References ......................................................................................................................................512
I. HISTORY Animal models of systemic connective tissue diseases have provided valuable insights into the causative mechanisms and the pathogenesis of these diseases, and have allowed the testing of potentially useful therapeutic interventions. Several spontaneous and induced animal models of systemic sclerosis or scleroderma (SSc) have been described. However, spontaneous murine animal models for the disease have been extensively studied because of the large number of inbred mouse strains available and the large body of genetic information for this species. Although these animal models do not reproduce all the clinical and pathological manifestations of human SSc, they display 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
495
1391_C33.fm Page 496 Tuesday, November 18, 2003 5:53 PM
496
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
some of the most important pathological alterations of this disorder and the prudent interpretation of the results obtained from their study has provided substantial and valuable information about the pathogenesis of SSc. Here, two spontaneous murine models of SSc will be reviewed. In particular, the review will focus on the pathological phenotype as the result of a genomic mutation that is transmitted genetically as a stable trait, emphasizing the similarities and differences with the human disease. In addition, other models that result from either genetic alterations induced by gene transfer in transgenic animals or by gene inactivation in knockout mice will be described. Further study of these murine models is likely to allow identification of the genes that participate in the pathogenesis of SSc, and may help to elucidate the alterations in the molecular pathway(s) that regulate a variety of physiological processes leading to tissue fibrosis, the hallmark of this disease. These animal models will also be of substantial value to test potential therapeutic agents that may eventually be employed for the treatment of SSc.
II. LABORATORY ANIMALS There are two animal models of SSc that are transmitted genetically in a typical Mendelian dominant pattern. These are the tight skin 1 (Tsk1) and tight skin 2 (Tsk2) mice. It is currently believed that each of these phenotypes is the result of a mutation in a single gene. Genetically transmitted disease models have the advantage that their phenotype is stable and the causative gene has been (Tsk1) or is in the process of being identified (Tsk2). Therefore, each molecular event in the pathway leading from the genetic mutation to the disease phenotype is likely to be elucidated. Identification of the molecular alterations in these murine models may provide valuable clues to understanding the molecular pathogenesis of SSc.
III. COURSE AND ASSESSMENT OF DISEASE A. Tight Skin 1 (Tsk1) Mouse The Tsk mouse is a spontaneous dominant mutation that occurred in the inbred B10.D2 (58N)/Sn strain. Recently, a different mutation causing a tight skin phenotype has been described. Therefore, the original Tsk mutation is now referred to as Tsk1. The Tsk1 mutation was identified at the Jackson Laboratories by Helen Bunker and was reported in detail by Green et al. [1]. The most striking feature of these mice is the presence of thickened and tight skin which is firmly bound to the subcutaneous and deep muscular tissues. The Tsk1 mutation is lethal and homozygous embryos (Tsk1/Tsk1) degenerate and die in utero at 8 to 10 days of gestation. The heterozygous animals (Tsk1/+) display cutaneous and visceral alterations that closely resemble those present in patients with SSc, as well as biochemical and molecular abnormalities that mimic the fibrotic connective tissue alterations characteristic of the disease [2,3]. 1. Cutaneous Alterations Skin tightness in Tsk1/+ mice is readily detected at 7 days of age and is manifested by difficulty in gathering a fold of skin in the interscapular region [1–3]. At age 2 months, the animals exhibit a hunched posture with a pronounced hump and prominent skin thickening (Figure 33.1). Studies by Menton and Hess [4] and Menton et al. [5] confirmed the initial report of dermal thickening in Tsk1/+ mice and demonstrated decreased pliability and increased skin stiffness. Increased skin thickness was also found by Osborn et al. [6] and Jimenez et al. [2]. Light microscopy studies of Tsk1/+ mice skin showed dermal thickening and replacement of adipose tissue by collagen (Figure 33.2). Electron microscopy [4] revealed changes in the connective tissue architecture of
1391_C33.fm Page 497 Tuesday, November 18, 2003 5:53 PM
SPONTANEOUS MOUSE MODELS OF SYSTEMIC SCLERODERMA
Figure 33.1
497
Photograph of a Tsk1/+ mouse that carries one mutated and one normal Fbn1 gene. Note the hunched posture indicative of the excessive accumulation of connective tissue in the interscapular region.
the dermis, including irregular spatial organization of collagen fibrils that were of small diameter and tightly packed. Furthermore, abundant deposition of fine microfibrillar material in the deep dermis was noted (Figure 33.3). The thickened peritendinous fascia resulted in atrophy of tail and ankle tendons. Extensive collagen replacement of the subcutaneous fatty tissue was observed in the dorsal, lateral, and ventral thoracic and abdominal regions, and in the forelimbs and hindlimbs. Prominent changes were also noted around the mammary glands, the brown fat of the scapular regions, and the ventral side of the sternum. Connective tissue surrounding the kidneys, adrenal glands, and pancreas was also substantially increased [2,3]. 2. Internal Organ Involvement The most prominent visceral changes in Tsk1/+ mice occur in the lungs and heart [1]. Lung abnormalities are characterized by marked distention that is present at birth. Histologically, the alterations in the lung resemble human emphysema, with little fibrosis (Figure 33.4). Szapiel et al. [7] noted inflammatory cell accumulation in the interstitium and alveolar spaces. These alveolar spaces were dilated with thin, disrupted walls and subpleural cysts and bullae. Rossi et al. [8] found increased numbers of neutrophils in bronchoalveolar lavage fluids of Tsk1/+ lungs in the absence of infection. The T- and B-cell levels were normal in the lungs of these mice. O’Donnell et al. [9] investigated the elastin and collagen matrices in the Tsk1/+ mouse lung by scanning electron microscopy and found significant elastin destruction but no collagen destruction. Keil et al. [10] examined by scanning electron microscopy the lungs of Tsk1/+ in comparison to those of pallid and beige mutants and C57BL/6 (controls) at 1, 12, and 24 months of age. The parenchyma of Tsk1/+ mice lungs appeared distorted at all ages with enlargement of alveolar ducts and sacs and alveoli with a large number of pores. These changes increased with age. Only the Tsk1/+ mice had increased numbers of alveolar pores throughout life compared to the controls. Although the other mutant mice studied also displayed alterations in lung architecture compared to controls, the authors concluded that the pathogenetic mechanism leading to emphysema was unique to the Tsk1/+ mouse. Gardi et al. [11] examined collagen synthesis in Tsk1/+ lungs from birth to 12 months. They reported no differences at birth. However, by 2 months the collagen synthetic rate was markedly increased in Tsk1/+ lungs compared to controls as assessed by prolylhydroxylase activity and radiolabeled proline incorporation into collagen. At 6 and 12 months the increase was only slightly higher than the increase seen at 2 months, observations which the authors attributed to ongoing
1391_C33.fm Page 498 Tuesday, November 18, 2003 5:53 PM
498
Figure 33.2
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Light microscopy of Masson’s trichrome-stained skin sections from 10-day-old normal (A) and Tsk1/+ (B) mice. Note the marked increase in dense, blue-staining connective tissue in the skin from Tsk1/+ mice compared with normal mice (original magnification ¥100).
parenchymal destruction. They also reported a relative increase in type I collagen in Tsk1/+ mice lungs over time. The cardiac enlargement reported by Green et al. [1] was confirmed by Osborn and Bauer [12]. Myocardial hypertrophy in these mice did not appear to be due to increased blood pressure or to valvular/arterial lesions. Increased cardiac weight and electron-microscopic evidence of moderately increased myocardial collagen deposits were found. No inflammatory cells were observed histologically. Osborn et al. [13] performed biochemical analysis of the collagen content of 1- and 12month-old Tsk1/+ hearts compared to normal controls. They reported that type I collagen was markedly increased with a proportional decrease in types III and V collagen in Tsk1/+ myocardium. Bashey et al. [14] reported that hearts from Tsk1/+ mice had up to two-fold greater protein and collagen biosynthesis and 2.5-fold greater type VI collagen content compared to controls. Gardi et al. [15] investigated cardiac collagen synthesis and content during the development of right ventricular hypertrophy (RVH) in Tsk1/+ mice. At 3 months both parameters were markedly increased. At 8 months the synthetic rate had returned to control values but the content was still elevated and there was no change in collagen types compared to controls. At 16 months the collagen synthesis and content in the Tsk1/+ hearts was comparable to control values; however, there was a shift to more type I collagen in the Tsk1/+ mouse hearts compared to controls. Martorana et al. [16] reported that RVH first began to develop between 8 and 16 months and progressed up to 24 months of age in the Tsk1/+ mouse. No pulmonary vascular changes were detected in the Tsk1/+ mice. Chapman and Eghbali [17] examined collagen gene expression in Tsk1/+ myocardium and reported elevated collagen types I, III, and IV mRNA levels. Using immunofluorescence light microscopy and
1391_C33.fm Page 499 Tuesday, November 18, 2003 5:53 PM
SPONTANEOUS MOUSE MODELS OF SYSTEMIC SCLERODERMA
A
499
B
D C
E Figure 33.3
F
Ultrastructural study of normal and Tsk1/+ mice skin. Normal mouse (A, C, and E); Tsk1/+ mouse (B, D, and F). Low-power views (5000¥) showing basal keratinocytes, the dermo-epidermal junction as represented by the lamina densa (open arrows), and the upper dermis (A and B). In both mice, the dermis is dominated by collagen bundles. Microfibrillar bundles and elastic fibers are indicated by closed arrows. Larger microfibrillar bundles with abundant microfibrils are present, but little elastin (B). Elastic fibers and microfibrillar bundles in high-magnification views appear less well defined in Tsk1/+ skin (D and F) than in normal skin (C and E). In particular, the striation pattern of microfibrils (arrowheads) seen with the normal animals (C and E) was less apparent in the Tsk1/+ mice skin. (From Kielty, C.M. et al., J. Cell Biol., 140, 1159, 1998, with permission.)
monospecific antibodies, they reported the presence of collagen type I fibers that were thicker and denser in perivascular areas of the Tsk1/+ heart compared to the normal heart. No abnormal accumulation of type III collagen was observed. 3. Humoral Immune Abnormalities Mononuclear inflammatory cell infiltration of affected organs is not seen in the Tsk1/+ mouse. However, certain immunological abnormalities are present including the presence of antinuclear antibodies (ANA), which have been detected in about 50% of Tsk1/+ mice at 8 months of age. Prior to this age all animals tested were negative for ANA. The serum autoantibodies did not recognize dsDNA, SS-A/Ro, SS-B/La, Sm, RNP, or Scl-70 specificities when tested by immunodiffusion. However, antibodies that recognize the Scl-70 marker antigen (topoisomerase 1) were demonstrated in supernatants from hybridomas established from Tsk1/+ mice splenocytes [18]. These antibodies have been extensively characterized by Muryoi et al. [19] and Shibata et al. [20]. Shibata et al. [21] demonstrated the presence of autoantibodies to the nuclear protein RNA polymerase I, which is considered to be, like the presence of Scl-70 autoantibodies, a specific marker for SSc. They showed that the Tsk1/+ mouse developed autoantibodies directed against the 190-kDa
1391_C33.fm Page 500 Tuesday, November 18, 2003 5:53 PM
500
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
A
B Figure 33.4
Light photomicrograph of a lung section from normal (A) and Tsk1/+ (B) mice. The sections were stained with hematoxylin and eosin. Note the marked distortion of lung parenchyma with enlarged and fragmented alveoli in the section from the Tsk1/+ mouse (original magnification ¥200).
subunit. Autoantibodies to this same subunit are present in SSc patients. Shibata et al. [21] further determined that the autoantibodies against RNA polymerase I were encoded by the VH J558 gene family. Muryoi et al. [20] have reported the presence of serum anticellular antibodies in all Tsk1/+ mice studied and in none of the controls. The authors then produced a large panel of hybridomas in order to determine the frequency and specificity of clones producing antibodies with anticellular and antinuclear activity. They found that the frequency of hybridomas producing either type of autoantibody was higher in Tsk1/+ mice than in C57BL/6-pa/pa mice. However, the significance of these findings is not clear, because the frequency of clones producing anticellular antibodies in these two strains (Tsk1/+ and C57BL/6-pa/pa) was found to be lower than that in other strains. By testing the specificity of anticellular autoantibodies to other self- and foreign antigens by radioimmunoassays, they concluded that only a small fraction of Tsk1/+ mouse anticellular antibodies were natural antibodies. In order to understand the molecular basis of the generation of the autoantibody repertoire in the Tsk1/+ mouse, Muryoi et al. [20] and Kasturi et al. [22] investigated the expression of V gene families and VH/VK pairing in Tsk/+ mouse autoantibodies. They found that in the case of Vk gene families, Vk4, Vk22, Vk23, and Vk28 were overrepresented, and that VHJ558 and VGAM were slightly overrepresented in Tsk1/+ mice, whereas VHQ52 and VH7183 were
1391_C33.fm Page 501 Tuesday, November 18, 2003 5:53 PM
SPONTANEOUS MOUSE MODELS OF SYSTEMIC SCLERODERMA
501
underrepresented. The pairing of VH and Vk gene families was random. This work was confirmed by Kasturi et al. [23] who later reported that 14 of 18 autoantibodies in Tsk1/+ mice shared a conserved heptapeptide sequence motif, YNEKFKG, in the second complementarity-determining region of heavy chains. They concluded that the usage of germ-line genes from diverse J558 genes bearing a common motif to encode autoantibodies suggests a regulatory role for this motif. Overall these studies indicated that the utilization of V gene families by Tsk1/+ mice for the production of anticellular antibodies differs from other murine strains. In other work, Muryoi et al. [24] reported that the B-cell clones producing autoantibodies in the Tsk1/+ mouse and in SSc patients share an interspecies cross-reactive idiotope, suggesting that the human and mouse repertoires are conserved during phylogeny, and are activated during the development of SSc. However, the significance of these extensive findings is still not clear, because the role of autoantibodies in the pathogenesis of SSc and in the Tsk1/+ mouse is not yet known. 4. Cellular Immune Abnormalities Alterations in cellular immunity have been examined in Tsk1/+ mice [25]. Responses to the Tand B-cell mitogens, concanavalin A and lipopolysaccharide, were found to be normal. The production of IL-2 was also found to be in the range of normal strains. However, a low, autologous mixed lymphocyte response was observed, as is typical of autoimmune strains of mice [26] and of human SSc [27]. The role of cellular immunity in the pathogenesis of tissue fibrosis in Tsk1/+ mice was examined by Phelps et al. [28]. These authors showed that infusion of bone marrow cells or T and B lymphocytes from Tsk1/+ mice into pallid mice led to tissue fibrosis, cellular infiltration, autoantibody production, and increased transcription of the a1(I) collagen gene. Several other studies have presented data indicating that participation of the immune system is required to cause the cutaneous fibrosis observed in the Tsk1/+ mice. Ong et al. reported the involvement of CD4+ T cells and that IL-4 was necessary for the development of fibrosis [29,30]. They showed that neutralizing antibodies to IL-4 prevented the development of dermal fibrosis in mice and suggested that Th2 cells and/or factors elaborated by a certain T-cell subset may play a key role in regulating dermal collagen content. They also reported that cutaneous fibrosis did not occur in Tsk1/+ mice with a null mutation for IL-4, and suggested that a specific usage of a portion of the T-cell repertoire, specifically the Vbeta8.2 gene segment, could prevent the development of fibrosis in Tsk 1/+ mice [29]. Kodera et al. [31] showed that embryos carrying the lethal Tsk1/Tsk1 genotype could be rescued by disrupting either one (+/-) or both (-/-) of the IL-4 genes. The IL4 deficient mice failed to develop cutaneous hyperplasia although they exhibited pulmonary emphysema. They also reported that IL-4 could stimulate the levels of TGF-b mRNA in fibroblasts and that the levels of TGF-b in the lungs of Tsk1/+, IL-4 (-/-) mice were lower than those in the lungs of Tsk1/+, IL-4(+/+) animals. McGaha et al. [32] reported that crossing the Tsk1/+ mouse to an IL-4 a receptor–deficient mouse prevented cutaneous fibrosis in the F1 generation, but did not prevent the emphysematous changes in the lungs. Tsuji-Yamada et al. [33] reported that injection of a plasmid that encodes for IL-12 into Tsk1/+ mice markedly decreased skin thickness, serum levels of antinuclear antibodies, and IL-4 production by spleen cells. The authors concluded that the expression of IL-12 prevented collagen accumulation and suppressed autoimmunity via improvement of the Th1/Th2 lymphocyte balance. In other studies, Wallace et al. [34] reported that CD4+ T cells were involved in the pathogenesis of skin fibrosis in Tsk1/+ mice. By breeding Tsk1/+ to CD4-deficient mutant mice, they showed that in the Tsk1/+ mice lacking CD4+ T cells, there was a marked reduction in skin fibrosis as well as decreased cellularity and only mild collagen disorganization compared to controls. In similar experiments with CD8-deficient Tsk1/+ mice they reported no change in fibrosis but significantly reduced levels of serum anti-topoisomerase 1 antibodies compared to CD4-deficient Tsk1/+ mice. Employing the same crossings, Hatakeyama et al. [35] reported a good correlation between the
1391_C33.fm Page 502 Tuesday, November 18, 2003 5:53 PM
502
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
levels of anti–topoisomerase 1 antibodies and the histological and biochemical alterations of the Tsk1 phenotype. Although the studies above suggest the involvement of inflammatory cells in the development of cutaneous fibrosis, other laboratories have reported contradictory results. Siracusa et al. [36], employing a cross between Tsk1/+ and Rag mice, reported that the tight skin phenotype of Tsk1/+ mice is not dependent on the presence of mature T or B lymphocytes. These results were confirmed by Dodig et al. [37]. In their investigations Tsk1/+ mice were mated to BALB/cByJSmn-Prkdcskid mice. Mice homozygous for the Prkcdskid mutation (skid/skid) lack mature T and B lymphocytes. Phenotypically tight F1 mice were back crossed to BALB/cByJSmn-Prkdcskid to produce N2 mice which were Tsk1/+, Prkcdskid/Prkcdskid. These tight skin mice were genotyped to ensure that they were homozygous for the skid mutation and assessed for antibody levels by ELISA. The results showed that skid/skid mice (T- and B-cell deficient) developed the tight skin phenotype. Kasturi et al. [38] and Saito et al. [39] also reported that the presence of mature B cells was not necessary for the development of cutaneous fibrosis in Tsk1/+ mice and that the fibrosis was independent of the presence of autoantibodies. They crossed Tsk1/+ mice with three immunocompromised mice strains: the JH-/-, which lacks mature B cells; the RAG2-/-, which lacks mature T and B cells; and the vit/vit, which is hyporesponsive in contact hypersensitivity. They found that mice which were JH-/-, Tsk1/+ still developed cutaneous fibrosis. The authors were unsuccessful in producing any Tsk1/+, RAG2-/- mice and could not, therefore, determine the role of T-cells in the development of cutaneous fibrosis. The authors did not describe the results obtained with Tsk1/+, vit/vit mice. Most recently, Oble and Teh [40] also reported that Tsk1/+ mice with a-receptor–deficient T cells showed no difference in skin thickness nor any obvious changes in architecture of the dermis. They concluded that the presence of CD4+ cells was not necessary for expression of the tight skin phenotype. Therefore, the putative role of inflammatory cells or their products in the pathogenesis of tissue fibrosis in Tsk1/+ mice has not been conclusively resolved to date. It has been suggested that mast cells may be important initiators of cutaneous fibrosis in SSc [41]. Walker et al. [42] examined this hypothesis in the Tsk1/+ model and found a twofold increase in mast cell numbers in Tsk1/+ skin compared to normal mouse skin up to 6 months of age. In these younger Tsk1/+ animals, the majority of mast cells were degranulated. By 15 months of age, the number of skin mast cells was comparable in Tsk1/+ and control groups and significantly reduced in both compared to younger animals. These observations suggest that mast cells may play an as yet undefined role in the progressive accumulation of connective tissue in the Tsk/+ mice. The increase in mast cells and their degranulation are similar to those seen in SSc [43], and Walker et al. [42] also showed that inhibition of mast cell degranulation by the administration of disodium cromoglycate significantly reduced the width of the subcutaneous fibrous layer in Tsk1/+ mice suggesting that mast cells and their products were key participants in the development of tissue fibrosis. Subsequent studies on the role of mast cells in tissue fibrosis have been controversial. Everett et al. [44] reported that mast cells were clearly not necessary for the development of fibrosis in the Tsk1/+ mouse; however, the presence of mast cells in a late stage of the fibrotic process correlated with a more pronounced fibrosis. They concluded that the Tsk1/+ skin lesions are a pleiotropic manifestation in which mast cells are involved/recruited by some as yet uncharacterized mechanism. 5. Abnormalities in Connective Tissue Metabolism The histological evidence suggesting an increase in skin collagen in the Tsk1/+ mouse has been confirmed by extensive biochemical studies [2,45]. The average total collagen content of skin from Tsk1/+ mice was 2.5-fold greater than that of normal mice skin. Since there is evidence that shifts in collagen type are associated with certain pathological conditions, this possibility was examined in the Tsk1/+ mutant. These studies failed to show qualitative differences in the collagens found in skin of Tsk1/+ and normal mice. These results are similar to those reported in biochemical
1391_C33.fm Page 503 Tuesday, November 18, 2003 5:53 PM
SPONTANEOUS MOUSE MODELS OF SYSTEMIC SCLERODERMA
503
studies of affected skin from SSc patients showing increased collagen content but no alteration in the relative proportions of the various collagen types. Glycosaminoglycans (GAG) are the other major connective tissue component of skin. Ross et al. [46] and Dorner et al. [47] examined the GAG content of Tsk1/+ skin and found significant increases in total hexosamine and uronic acid for a given skin surface area. The mechanisms responsible for the excessive accumulation of extracellular matrix in Tsk1/+ skin were further examined in an organ culture system [2]. The results of these studies indicated that excessive biosynthesis was the primary mechanism of collagen accumulation in the Tsk1/+ tissues. No qualitative differences in the products synthesized by Tsk1/+ and normal skin organ cultures were found upon electrophoretic analysis [2,3]. Studies by Uitto [48] and Jimenez et al. [49] of collagen biosynthesis in organ cultures of SSc skin have shown similar findings. Further in vitro studies of collagen biosynthesis and its regulation employed dermal fibroblast cultures established from Tsk1/+ and normal littermate control mice [45]. Collagen synthesis as assessed by incorporation of 14C-proline and production of 14C-hydroxyproline was two-fold greater in the Tsk1/+ fibroblast cultures. All of the increase was in the highly soluble fraction secreted into the culture medium. These findings are similar to results of collagen and protein biosynthesis studies in cultures of SSc dermal fibroblasts [50–53]. Characterization of the newly synthesized proteins from Tsk1/+ and control fibroblast cultures showed quantitative but not qualitative differences [45]. This is similar to the findings of Uitto et al. [54] with SSc and normal human fibroblasts. An increase in fibronectin synthesis is also seen in cultures of Tsk1/+ fibroblasts similar to the increased fibronectin reported in SSc skin by Cooper et al. [55]. A study of the expression of three collagen genes employing hybridizations with a1(I), a2(I), and a1(III) procollagen cDNA showed a five-fold increase in steady-state mRNA levels for the corresponding transcripts in Tsk1/+ fibroblasts [45]. In other studies, elevated type VI collagen mRNA levels were also found in cultured Tsk1/+ fibroblasts [2]. These results are similar to the findings of parallel increases in types I and III procollagens and type VI collagen mRNAs in SSc fibroblasts [53,56]. Pablos et al. [57] used in situ RNA hybridization in skin sections from Tsk1/+ and control mice to examine the expression of TGF-b, procollagens a1(I) and a1(III), and collagen a2(VI). They found that all genes were under temporospatial regulation and exhibited characteristic patterns of expression during postnatal growth and development. TGF-b, was expressed only during rapid post-natal growth of the skin in parallel with high expression of a1(I), a1(III) and a2(VI) collagen genes. Fibroblasts expressing types I and III collagens were increased in Tsk1/+ fibrotic lesions. An abnormal pattern of collagen a2(VI) gene expression was observed only at later stages of fibrosis, suggesting a noncoordinate regulation of type VI collagen. They concluded that the fibrosis observed in Tsk1/+ mice was the result of a subpopulation of fibroblasts overexpressing type I and III collagens and that this overexpression did not appear to be mediated by TGF-b. Pablos et al. [58] examined Tsk1/+ and normal skin tissue sections stained with proliferating cell nuclear antigen as an indicator for cellular proliferation and found no significant differences between each group. They also found no difference in apoptosis using in situ end-labeling of fragmented DNA and nuclear staining with propidium iodide. Thus, neither process could account for the fibrotic phenotype seen in the Tsk1/+ mice and it was concluded that transcriptional activation of collagen genes was responsible for the increased accumulation of collagen. Sgonc et al. [59] later confirmed that apoptosis was not involved in the development of the Tsk1/+ phenotype. 6. The Molecular Defect in Tsk1/+ Mice To elucidate the mechanisms by which the Tsk1 mutation modulated the coordinate expression of several genes of the large family of extracellular matrix proteins, the cis acting elements responsible for increased transcription of the a1(I) procollagen gene in Tsk1/+ fibroblasts were examined. Transient transfections of a series of human a1(I) procollagen promoter reporter gene
1391_C33.fm Page 504 Tuesday, November 18, 2003 5:53 PM
504
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
constructs into Tsk1/+ and normal fibroblast cultures were performed [60]. The results showed that the transcription of the a(1) procollagen gene was increased by more than threefold in the fibroblasts derived from Tsk1/+ mice. The experiments also showed that the up-regulation of the a1(I) procollagen gene was due to the lack of the strong inhibitory influence of the regulatory sequence contained in the promoter between -675 and -804 bp. This lack of inhibition was shown to be caused by lower binding activity of nuclear extracts from fibroblasts of Tsk1/+ mice to oligonucleotides spanning the mapped regulatory sequence. Additionally, it was shown that Tsk1/+ nuclear extracts displayed decreased binding to a consensus AP-1 sequence. Philips et al. [60] postulated that a strong negative regulatory sequence contained within the -675 bp to -804 bp region of the a1(I) procollagen gene promoter binds AP-1 transcription factor and mediates inhibition of gene transcription in normal murine fibroblasts. The Tsk1/+ fibroblasts lack this inhibitory control, due to lower available amounts and/or decreased binding activity to this inhibitory sequence. Therefore, they display increased a1(I) procollagen gene expression. Other studies employing reporter transgenes harboring upstream fragments of the 5' flanking region of the mouse a2(I) procollagen gene introduced into Tsk1/+ mice confirmed the transcriptional activation of collagen genes in Tsk1/+ mice [61]. These studies demonstrated that the reporter transgenes displayed higher expression starting at age 1 week and their expression was further stimulated by TGF-b in cultured cells. An important observation was that the transcriptional activation of the mouse transgene involved also an upstream enhancer and suggested the participation of fibroblast-specific pathways. 7. A Mutation in the Fibrillin-1 Gene: the Genetic Defect in Tsk1 Mice Initial genetic studies employing visible markers mapped the Tsk1 mutation to mouse chromosome 2 [1]. More recently, Siracusa et al. [62,63] localized the gene to a 3.5-cM region closely linked to the b2 macroglobulin gene. These observations were confirmed by Everett et al. [64]. Subsequently, Siracusa et al. [65] identified the Tsk1 mutation as a large in-frame duplication of exons 17 through 40 inserted between exons 40 and 41 within the fibrillin-1 gene (Figure 33.5). As a result of the large duplication, numerous important domains in the encoded mutant protein are duplicated, resulting in the addition of 18 Ca++-binding EGF domains and one fibrillin, one RGD integrin, and two TGF-b–binding domains. These results were confirmed by Bona et al. [66], who, in addition, found four amino acid differences between the two fibrillin-1 gene copies in the Tsk1/+ mouse. These sequence differences, however, are not likely to have functional impact [66]. The studies of Siracusa et al. [65] showed that Tsk1/+ mice express both the normal 11kb fibrillin1 mRNA transcript and a mutant 14kb transcript encoded by the mutated gene. Dermal fibroblasts from Tsk1/+ mice synthesize and secrete both the normal 350 kD and the mutant 450-kD fibrillin1 molecule in approximately equal amounts (Figure 33.6). This mixture of fibrillin-1 molecules is incorporated into the ECM. Siracusa et al. [65] hypothesized that the abnormal fibrillin-1 would change the homeostasis in the ECM owing to the greater number of EGF binding domains and the duplication of the TGF-b–binding domain in the mutant fibrillin-1 molecule. It would be expected that greater amounts of these growth factors would be recruited to the ECM resulting in the production of excessive amounts of collagen. Saito et al. [67] provided support for this hypothesis showing that the mutant fibrillin-1 binds greater amounts of TGF-b than the normal protein. Immunohistochemical and ultrastructural analyses of normal and Tsk1/+ mouse skin indicated differences in the gross organization and distribution of the microfibrillar arrays. The beaded microfibrillar structures in Tsk1/+ were abnormal, displaying diffuse interbead segments with longer periodicity which tended to aggregate [68] (Figure 33.7). Transmission electron microscopy indicated that the mass of the microfibrils in the skin of Tsk1/+ mice was greater than in normal skin. These data showed that the mutant fibrillin-1 from Tsk1/+ mice becomes incorporated into a discrete population of beaded microfibrils with altered molecular organization. However, Gayraud et al. [69], using Tsk1/Tsk1 dermal fibroblasts in co-culture with a human cell line that cannot assemble fibrillin1, concluded that the mutant fibrillin-1 microfibrils co-polymerize with wild-type fibrillin-1 and that
1391_C33.fm Page 505 Tuesday, November 18, 2003 5:53 PM
SPONTANEOUS MOUSE MODELS OF SYSTEMIC SCLERODERMA
A
B
C
D
505
E
Fbn1
mutant Fbn1 LTBP1
LTBP2
Ltbp3
Figure 33.5
Schematic representation of protein motifs encoded by normal and mutant Fbn1 transcripts. Regions A to E indicate the five domains of the Fbn1 protein. “Fbn1” indicates the wild-type mouse Fbn1 protein and “mutant Fbn1” indicates the Tsk1-specific protein. The dashed lines indicate the region duplicated in the Tsk-specific transcript, and the arrow indicates the single junction resulting from the duplication. The human “LTBP1,” human “LTBP2,” and mouse “Ltbp3” proteins represent the three related TGF-b–binding proteins. Symbols represent the corresponding structural motifs: (patterned rectangles) cysteine-rich EGF-like repeats; (rectangles) EGF-CB repeats; (circles) Fib motif; (circles) Fib-like motif; (ovals) TGF-bp repeats; (black shaded and patterned ovals) TGFbp-like repeats; (asterisks) RGD domain; (thick bars) proline-rich region; (thin bars) proline/glycinerich region; (very thin lines) amino- and carboxy-terminal amino acids. (From Siracusa, L.D. et al., Genome Res., 6, 300, 1996, with permission.)
+/+ TSK/+
+/+ TSK/+
+/+
TSK/+
TSK-Fib
Fib
FN
Figure 33.6
SDS-PAGE analysis of newly synthesized radiolabeled fibrillin-1 immunoprecipitated from medium of normal and Tsk1/+ dermal fibroblast cultures. Tsk1/+ cells synthesized and secreted both normal (Fib, ~330 kDa) and Tsk1 fibrillin-1 (Tsk-Fib, ~450 kDa) in comparable amounts. Lanes 1, 3, and 5, medium from normal mice cells; lanes 2, 4, and 6, medium from Tsk1/+ mice cells. Lanes 1 and 2, crude medium; lanes 3 and 4, fibrillin-1 immunoprecipitated with a fibrillin-1–specific antiserum; lanes 5 and 6, immunoprecipitation controls using normal rabbit serum. FN, fibronectin. (From Kielty, C.M. et al., J. Cell Biol., 140, 1159, 1998, with permission.)
1391_C33.fm Page 506 Tuesday, November 18, 2003 5:53 PM
506
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
the co-polymerization rescues the abnormal morphology of the Tsk1/Tsk1 fibrillin-1 aggregates. These authors believe that lung and other connective tissue abnormalities of Tsk1/+ mice are due to co-polymerization of mutant and wild-type fibrillin-1 molecules into functionally deficient microfibrils. They postulate that in contrast with other fibrillin-1 mutations which cause the Marfan syndrome and other related syndromes with prominent vascular alterations, the vascular complications are not present in the Tsk1/+ mice because the level of functional microfibrils does not decrease below the critical threshold required to cause structural alterations of the large blood vessel walls.
Figure 33.7
Rotary shadowing analysis of normal and Tsk1/+ skin microfibrils. Normal skin microfibrils (A and C); Tsk1/+ skin microfibrils (B and D). (a) Normal mice skin microfibrils exhibited well-organized packing and regular diameter. (B) Tsk1/+ mice skin microfibrils. Some appeared normal in morphology and periodicity, whereas others appeared as periodic rows of beads with indistinct interbeads and repeat distances longer than normal (arrowheads). (C) Normal mice skin microfibrils after incubation for 10 minutes in 5 mM EDTA. (D) Tsk/+ mice skin microfibrils after incubation for 10 minutes in 5 mM EDTA. The apparently normal microfibrils responded to EDTA as control mice microfibrils, but the abnormal microfibrils remained morphologically distinct (arrowheads). (From Kielty, C.M. et al., J. Cell Biol., 140, 1159, 1998, with permission.)
1391_C33.fm Page 507 Tuesday, November 18, 2003 5:53 PM
SPONTANEOUS MOUSE MODELS OF SYSTEMIC SCLERODERMA
507
The identification of fibrillin-1 as the mutated gene in the Tsk1/+ mice stimulated a large number of studies to examine whether alterations in fibrillin-1 were also present in SSc. Some of these studies focused on the Choctaw Indians, an ethnic group in which there is an extremely high incidence of SSc displaying a strong component of heritability. Studies in this population reported that there is genetic linkage to fibrillin-1 in affected individuals [70]. Tan et al. [71] reported an association of a single nucleotide polymorphism with SSc in the Choctaw Indian and extended this observation to Japanese populations. It should be noted, however, that this polymorphism is found in the nontranslated region of the gene and, therefore, it does not affect or modify the primary structure or the function of the protein. Studies were also undertaken to determine whether patients with SSc developed antibodies to fibrillin-1. Several reports have described the presence of antifibrillin-1 antibodies in sera from patients with SSc [72–74] and localized forms of scleroderma [75]. Similar to these observations, Murai et al. [76] reported that Tsk1/+ mice displayed high titer of antibodies (IgG) recognizing the carboxy-terminal region of fibrillin-1 molecules. B. The Tsk2 — A Novel Mutation Resembling SSc A second mutant mouse characterized by a tight skin phenotype was reported in 1986 [77]. The mutation appeared in the offspring of a male from the 101/H mouse strain as a result of administration of the mutagenic agent, ethylnitrosourea. This mutation has been called Tsk2 and has been localized to mouse chromosome 1. Like the Tsk1 mutation, the Tsk2 mutation is inherited as an autosomal dominant trait and appears to be lethal in utero; therefore, only heterozygous Tsk2/+ animals survive. Studies to characterize the Tsk2/+ mice have shown that these animals indeed develop a tight skin phenotype that becomes apparent at 3 to 4 weeks of age [78]. Histological examination of skin samples showed marked thickening of the dermis and excessive deposition of thick collagen fibers, which extended deeply into the subdermal adipose tissue and occasionally surrounded the fascicles of the panniculus carnosus (Figures 33.8A and B). Numerous mononuclear cells were present in the lower dermis and in the adipose tissue septa (Figures 33.8C and D). Furthermore, in contrast to normal skin, the dermal–adipose junction was not distinct in Tsk2/+ skin samples, because of accumulation of abundant connective tissue and the presence of mononuclear cells infiltrating the intercellular spaces of the adipose tissue (Figures 33.8E and F). 1. Immunology Immunological studies were performed by Wooley et al. [79] on the T cells infiltrating the dermis to determine whether Tsk2/+ mice exhibited a T-cell receptor bias. RT-PCR reactions using RNA extracted from the skin and lymph nodes were performed with 18 of the 21 Vb types. These experiments showed that mRNA extracted from involved skin exhibited a restricted pattern with positive Vb signals corresponding to eight T-cell subtypes (Vb1, 6, 8.1, 8.2, 10, 11, 16, and 18). Band intensity analysis revealed that three Vb subtypes (8.1, 11, and 18) predominated, and this pattern was consistent among the four skin samples from four different Tsk2/+ mice tested. The authors postulated that a restricted T-cell population participated in the inflammatory cell infiltrate seen in these mice. However, Sgonc et al. [59,80] reported that this inflammatory infiltrate did not lead to endothelial cell apoptosis and, therefore, the role of inflammatory cells in the pathogenesis of the Tsk2/+ phenotype is not clear. 2. Genetics Christner et al. [78] localized the Tsk2 gene to a 15 cM region on chromosome 1 flanked by the molecular markers D1Mit4 and D1Mit5. In a subsequent study, the authors described a highresolution linkage map of the gene further delimiting Tsk2 to a 1.5-cM interval between the molecular markers D1Mit233 and D1Mit213 [81], as shown in Figure 33.9. The approximate
1391_C33.fm Page 508 Tuesday, November 18, 2003 5:53 PM
508
Figure 33.8
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Light photomicrographs of skin sections from 7- to 8-month-old normal (A) and Tsk2/+ (B) mice, stained with Masson’s trichrome. Note the marked increase in dense, blue-staining collagen fibers in the skin from Tsk2/+ mice compared with normal mice. Skin sections from normal (C) and Tsk2/+ (D) mice, stained with Verhoeff-Van Gieson stain. Note the densely packed connective tissue in the dermis of Tsk2/+ mice, extending into the subdermal adipose tissue. Also note the presence of mononuclear inflammatory cells in the lower dermis and in the adipose tissue septa. Higher magnification of the dermal–adipose junction of normal (E) and Tsk2/+ (F) mice, stained with hematoxylin and eosin. Note the abundant collagen in the dermis–adipose boundary in the skin from Tsk2/+ mice and the presence of mononuclear cells in the subdermal tissue and infiltrating the adipocyte septa. (Original magnification ¥100 in A and B, ¥200 in C and D, ¥400 in E and F.) (From Christner, P.J. et al., Arthritis Rheum., 38, 1791, 1995, with permission.)
position of the Tsk2 gene was reported at 28 cM by aligning the results of this study to the chromosome 1 consensus map at the molecular markers D1Mit175 and D1Mit236. This region is syntenic with the region of human chromosome 2, which contains the type III procollagen gene, and the authors mentioned that type III collagen gene may be considered a candidate gene for Tsk2 [81].
1391_C33.fm Page 509 Tuesday, November 18, 2003 5:53 PM
SPONTANEOUS MOUSE MODELS OF SYSTEMIC SCLERODERMA
Figure 33.9
509
A molecular genetic linkage map of the proximal portion of mouse chromosome 1. Selected mapped loci are listed on the side of the chromosome. The map on the right is a partial version of a consensus map. The map on the left was generated from various crosses. The maps have been aligned at the D1Mit175 and D1Mit236 loci. Genes mapped in the human genome are underlined, and their map positions on human chromosomes are shown on the far right. (From Christner, P.J. et al., Mammalian Genome, 7, 610, 1996, with permission.)
3. Biochemical Studies The downstream effects of the Tsk2 mutation have been investigated by Christner et al. [78,82]. Histological examination confirmed that the dermis of Tsk2/+ mice was significantly thicker and biochemical analysis showed that Tsk2/+ mouse skin had 50% more collagen than the normal control mouse skin. Using Tsk2/+ cultured dermal fibroblasts, the authors showed that collagen synthesis was approximately 100% higher in Tsk2/+ cells compared to normal controls. Steadystate mRNA levels for a1(I) and a1(III) collagens were 50% and 100% higher, respectively (Figure 33.10). Transient transfection experiments with COL1A1 promoter constructs demonstrated that the elevated levels of a1(I) collagen mRNA in Tsk2/+ cells were due largely to increased transcriptional activity of the corresponding gene. Electrophoretic mobility shift assays performed with a probe encompassing the relevant COL1A1 promoter region revealed increased DNA-protein binding activities in nuclear extracts prepared from Tsk2/+ fibroblasts compared with normal fibroblasts. Competition experiments using consensus Sp1 and NF-1 oligonucleotides and supershift experiments using anti-Sp1 and anti–NF-1 antibodies indicated that at least two transcription factors, Sp1 and NF-1, or their homologs, are involved in the up-regulated transcriptional activity of COL1A1 promoter in Tsk2/+ fibroblasts. Subsequent experiments were performed with promoter deletion constructs of the mouse type III collagen gene. Transient transfection experiments with the shortest promoter construct (from -96 to +16 bp) yielded 25-times-higher CAT activity than that observed in normal fibroblasts [83]. Electrophoretic mobility shift assays showed that again Sp1 and NF-1 or their homologues were involved in the up-regulated transcriptional activity of the type III collagen gene promoter in Tsk2/+ fibroblasts. Additional experiments with type VI collagen have shown that the steady-state levels of mRNA for this collagen are increased 3.5-fold in Tsk2/+ dermal fibroblasts compared to controls [83]. The Tsk2 mutation, which was originally caused by exposure to the toxic agent ethylnitrosourea, is particularly interesting because of the awareness that several human cutaneous fibrotic diseases resembling SSc appear to result from exposure to chemical substances such as in the case of the
1391_C33.fm Page 510 Tuesday, November 18, 2003 5:53 PM
510
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
toxic oil syndrome and the L-tryptophan–induced eosinophilia-myalgia syndrome. Studies to identify the mechanisms responsible for the connective tissue abnormalities in the Tsk2 mutation may, therefore, provide valuable information regarding the role of environmental exposures in the pathogenesis of SSc and other chemically induced fibrotic diseases. C. Transgenic Animal Models Exhibiting Some Features of SSc In addition to the animal models that display some features of SSc as a result of a genetically transmitted trait, there are also other models that have been obtained by genetic manipulations induced either by the introduction of genes by gene transfer in transgenic animals or by the abolishment of a gene, by gene inactivation in knockout animals. Following the identification of a mutation in the fibrillin-1 gene in Tsk1 mice, several laboratories initiated studies to establish transgenic mice harboring the mutation. Saito et al. [84] generated transgenic mice expressing the Tsk1 mutated fibrillin-1 in order to determine whether the mutation was responsible for the tight skin phenotype. With the same goal in mind these authors also injected normal mice after birth with a plasmid-bearing mutated fibrillin-1. Their results demonstrated that the transgenic mice carrying the Tsk1 mutant fibrillin-1 transgene developed permanent cutaneous hyperplasia. Those mice injected with the mutant fibrillin-1 plasmid after birth developed transient hyperplasia. The transgenic mice also produced antitopoisomerase I and antifibrillin-1 antibodies as do Tsk1/+ mice and SSc patients. However, in contrast to Tsk1/+ mice, neither the transgenic nor the plasmid injected mice developed lung emphysema. The results suggest that the cutaneous hyperplasia (tight skin) of the Tsk1/+ mouse is caused by the tandem duplication in the gene encoding fibrillin-1, but that the lung emphysema may be due to another cause. They also suggest that the level and duration of expression of the mutated fibrillin-1 protein may determine the severity of the fibrosis. Several other models with relevance to various aspects of SSc pathogenesis have been described. Sato et al. [85] investigated the role of CD19, a cell-surface protein that regulates intrinsic and antigen receptor-induced B-lymphocyte signaling thresholds. They produced CD19 transgenic mice that overexpress CD19. Mice with this transgene developed spontaneous autoantibodies in a genetic background not associated with autoimmunity. Subsequently, Sato et al. attempted to quantify the amount of excess CD19 expression required to induce autoantibody production. They found that even a 15% increase in CD19 production resulted in production of antibodies such as antispindle pole, rheumatoid factor, anti-ssDNA, anti-dsDNA, and anti-histone in C57BL/6-CD19 transgenic mice. They found remarkably similar changes in CD19 expression on the surface of B cells from patients with SSc. CD19 density on peripheral blood B cells from SSc patients was 20% higher compared to controls, whereas CD20, CD22, and CD40 were unchanged. They concluded that modest changes in the expression of CD19 may shift the balance between tolerance and immunity toward autoimmunity and that alterations in cell-surface signaling molecules may be important in the production of autoantibodies in patients with SSc. Ong et al. [29] have used IL4 and Stat6 knockout mice to understand the downstream events resulting from the fibrillin-1 duplication and leading to the development of tight skin in the Tsk1/+ mouse. They reported that Tsk1/+ mice carrying a null mutation for either IL4 or Stat6 failed to develop tissue fibrosis. They concluded that development of the CD4+ T cell determines whether fibrosis will occur. CD4+ T cells can develop into either T-helper 1 (Th1) or T-helper 2 (Th2) cells based on the immunizing conditions. When the CD4+ T cell develops into a Th1 cell no fibrosis occurs, whereas when it develops into a Th2 cell fibrosis does occur. By modulating the amount of IL-4 or Stat6, the ratio of Th1/Th2 can be changed. They further determined that alteration of the T-cell receptor (TCR) repertoire in Tsk1/+ mice could also prevent dermal fibrosis. By introducing TCR transgenes into Tsk1/+ mice, they were able to show that exclusive usage of the
1391_C33.fm Page 511 Tuesday, November 18, 2003 5:53 PM
SPONTANEOUS MOUSE MODELS OF SYSTEMIC SCLERODERMA
511
Vbeta8.2 gene segment by T cells prevented the development of fibrosis-causing Th2 cells. They suggested that the restricted TCR usage prevents the generation of a very small subset of antigenspecific CD4+ T cells that cause skin fibrosis or that the exclusive usage of Vb8.2 by CD4+ T cells leads to an alteration of cytokines (e.g., absence of IL-4) preventing the development of Th2 cells. Liu et al. [86] obtained transgenic mice to study the role of collagen degradation on fibrosis. These mice carried a transgene with a mutation in the a1 collagen gene sequence that encodes the specific site for mammalian collagenase cleavage and therefore the resultant protein was resistant to digestion. These mice died in utero presumably because of excessive accumulation of collagenase-resistant mutant collagen coded by the transgene. However, when the same mutation was produced by gene targeting, the mice survived, probably because the production of mutant collagen was less in these mice than in the transgenic mice, although with increasing age they developed marked dermal fibrosis similar to that seen in SSc patients. In addition to type I collagen, type V collagen has been implicated in the molecular pathway resulting from the fibrillin-1 mutation in the Tsk1/+ mouse. In order to gain an understanding of the events downstream of the fibrillin-1 mutation, Phelps et al. [25] bred Tsk1/+ mice to type V collagen-deficient mice. These collagen type V knockout mice exhibit skeletal abnormalities, skin fragility, and alterations in the collagen fiber organization. The F1 mice did not develop cutaneous hyperplasia and did not produce autoantibodies. The diameter of the collagen fibrils in the dermis was comparable to controls. The results indicated that genetic complementation from the cross with a collagen V–defective mouse could reverse the phenotypic changes displayed by Tsk1/+ mice.
IV. CONCLUSION This review of the spontaneous mouse models for scleroderma described in the literature demonstrates that there are at least two models in which to study various aspects of this complex disorder. Each model has its strengths in mimicking certain aspects of the disease — inflammatory, vascular, immunologic, or fibrotic — as well as important differences as summarized in Table 33.1. It is apparent that the prudent interpretation of results obtained with each of these models can contribute to our knowledge of the mechanisms underlying this presently incurable disorder. The most extensively studied model from the histologic, immunologic, and biochemical viewpoint is the Tsk1 mutation. However, the Tsk1/+ mouse has several deficiencies as a model for human SSc including the absence of inflammatory, vascular, gastrointestinal, and joint involvement. These deficiencies are offset by the fact that the genetic mutation, a tandem duplication in fibrillin-1, which causes the Tsk1/+ phenotype has been identified. The mechanisms by which the mutated fibrillin-1 leads to tight skin and tissue fibrosis are now being actively investigated in several laboratories. With the likely identification of the gene for Tsk2, there will be two different mutations located on two separate chromosomes, and therefore involving at least two separate genes, which lead to a similar cutaneous fibrotic phenotype. It will then be possible to determine whether there are molecular events shared by both pathways and which are necessary to cause tissue fibrosis. Furthermore, the existence of transgenic animal models of SSc will allow the application of the techniques of cellular and molecular biology to address relevant questions related to the pathogenesis of SSc.
1391_C33.fm Page 512 Tuesday, November 18, 2003 5:53 PM
512
Table 33.1
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Comparison of Animal Models and Human Scleroderma Feature
Clinical features Skin thickening Arthritis Visceral involvement Gastrointestinal Vascular Pulmonary Renal Cardiac Genetic transmission Immunological changes Mononuclear cell infiltrate IL-2 production TGF-b abnormalities ANA Scl-70 Anticentromere Anti–ds-DNA Antifibrillin Biochemical changes Increased tissue collagen Collagen phenotype changes Increased collagen biosynthesis Abnormal collagen regulation Increased procollagen gene expression Increased procollagen gene transcription Increased GAG Increased fibronectin
Tsk1/+
Tsk2/+
Human SSc
+ -
+ -
+ +
Emphysema ? + +
? ? ? ? ? +
+ + Fibrosis + + Rare
Normal + + + +
+(? cells) ? ? ? ? ? ? ?
+(T cells) increased + + + + +
+ + + + + + +
+ + + + + ? ?
+ + + + + + +
REFERENCES 1. Green, M.C., Sweet, H.O., and Bunker, L.E., Tight-skin, a new mutation of the mouse causing excessive growth of connective tissue and skeleton, Am. J. Pathol., 82, 493, 1976. 2. Jimenez, S.A., Millan, A., and Bashey, R.I., Scleroderma-like alterations in collagen metabolism occurring in the Tsk (tight skin) mouse, Arthritis Rheum., 27, 180, 1984. 3. Jimenez, S.A. et al., The tight skin (Tsk) mouse as an experimental model of scleroderma, in CRC Handbook of Animal Models for Rheumatic Diseases, Greenwald, R.A. and Diamond, H.S., Eds., CRC Press, Boca Raton, FL, 1988, p. 169. 4. Menton, D.N. and Hess, R.A., The ultrastructure of collagen in the dermis of tight-skin (Tsk) mutant mice, J. Invest. Dermatol., 7, 139, 1980. 5. Menton, D.N. et al., The structure and tensile properties of the skin of tight-skin (Tsk) mutant mice, J. Invest. Dermatol., 70, 4, 1978. 6. Osborn, T.G. et al., Tight-skin mouse: physical and chemical properties of the skin, J. Rheumatol., 10, 793, 1983. 7. Szapiel, S.V. et al., Hereditary emphysema in the tight-skin (Tsk/+) mouse, Am. Rev. Respir. Dis., 123, 680, 1981. 8. Rossi, G.A. et al., Hereditary emphysema in the tight skin mouse, Am. Rev. Respir. Dis., 129, 850, 1984. 9. O’Donnell, M.D. et al., Ultrastructure of lung elastin and collagen in mouse models of spontaneous emphysema, Matrix Biol., 18, 357, 1999. 10. Keil, M. et al., A scanning electron microscopic investigation of genetic emphysema in tight-skin, pallid, and beige mice, three different C57 BL/6J mutants, Lab. Invest., 74, 353, 1996.
1391_C33.fm Page 513 Tuesday, November 18, 2003 5:53 PM
SPONTANEOUS MOUSE MODELS OF SYSTEMIC SCLERODERMA
513
11. Gardi, C. et al., Lung collagen synthesis and deposition in tight-skin mice with genetic emphysema, Exp. Mol. Pathol., 56, 163, 1992. 12. Osborn, T.G. and Bauer, N.E., Physical and biochemical manifestations of cardiomyopathy in the tight-skin mouse, Arthritis Rheum., 27, 75s, 1984. 13. Osborn, T.G. et al., Collagenous abnormalities in the heart of the tight-skin mouse, J. Mol. Cell Cardiol., 19, 581, 1987. 14. Bashey, R.I. et al., Increased collagen synthesis and increased content of type VI collagen in myocardium of tight skin mice, Cardiovasc. Res., 27, 1061, 1993. 15. Gardi, C. et al., Cardiac collagen changes during the development of right ventricular hypertrophy in tight-skin mice with emphysema, Exp. Mol. Pathol., 60, 100, 1994. 16. Martorana, P.A. et al., Tsk mice with genetic emphysema. Right ventricular hypertrophy occurs without hypertrophy of muscular pulmonary arteries or muscularization of arterioles, Am. Rev. Respir. Dis., 142, 333, 142. 17. Chapman, D. and Eghbali, M., Expression of fibrillar types I and III and basement membrane collagen type IV genes in myocardium of tight skin mouse, Cardiovasc. Res., 24, 578, 1990. 18. Bocchieri, M.H. et al., Evidence for autoimmunity in the tight skin (Tsk/+) mouse model of progressive systemic sclerosis, Arthritis Rheum., 34, 599, 1991. 19. Muryoi, T. et al., Self reactive repertoire of tight skin mouse: immunochemical and molecular characterization of anti-topoisomerase I autoantibodies, Autoimmunity, 9, 109, 1991. 20. Muryoi, T. et al., Self-reactive repertoire of tight skin (Tsk/+) mouse: immunochemical and molecular characterization of anti-cellular autoantibodies, Cell Immunol., 144, 43, 1992. 21. Shibata, S. et al., Immunochemical and molecular characterization of anti-RNA polymerase I autoantibodies produced by tight skin mouse, J. Clin. Invest., 92, 984, 1993. 22. Kasturi, K.N. et al., Tight skin mouse autoantibody repertoire: analysis of VH and VK gene usage, Mol. Immunol., 30, 969, 1993. 23. Kasturi, K.N., Yio, X.Y., and Bona, C.A., Molecular characterization of J558 genes encoding tightskin mouse autoantibodies: identical heavy-chain variable genes code for antibodies with different specificities, Proc. Natl. Acad. Sci. U. S. A., 91, 8067, 1994. 24. Muryoi, T. et al., Antitopoisomerase I monoclonal autoantibodies from scleroderma patients and tight skin mouse interact with similar epitopes, J. Exp. Med., 175, 1103, 1992. 25. Phelps, R.G. et al., Effect of targeted mutation in collagen V a2 gene on development of cutaneous hyperplasia in tight skin mice, Mol. Med., 4, 356, 1998. 26. Hom, J.T. and Talal, N., Decreased syngeneic mixed lymphocyte response (SMLR) in genetically susceptible autoimmune mice, Scand. J. Immunol., 15, 5, 1982. 27. Morse, J.H. and Bodi, B.S., Autologous and allogeneic mixed lymphocyte reaction in progressive systemic sclerosis, Arthritis Rheum., 25, 390, 1982. 28. Phelps, R.G. et al., Induction of skin fibrosis and autoantibodies by infusion of immunocompetent cells from tight skin mice into C57BL/6 Pa/Pa mice, J. Autoimmunity, 6, 701, 1993. 29. Ong, C.J. et al., A role of T helper 2 cells in mediating skin fibrosis in tight-skin mice, Cell Immunol., 196, 60, 1999. 30. Ong, C. et al., Anti-IL-4 treatment prevents dermal collagen deposition in the tight-skin mouse model of scleroderma, Eur. J. Immunol., 28, 2619, 1998. 31. Kodera, T. et al., Disrupting the IL-4 gene rescues mice homozygous for the tight-skin mutation from embryonic death and diminishes TGF-b production by fibroblasts, Proc. Natl. Acad. Sci. U. S. A., 99, 3800, 2002. 32. McGaha, T. et al., Lack of skin fibrosis in tight skin (Tsk) mice with targeted mutation in the interleukin-4Ra and transforming growth 3 factor-b genes, J. Invest. Dermatol., 116, 136, 2001. 33. Tsuji-Yamada, J. et al., Effect of IL-12 encoding plasmid administration on tight-skin mouse, Biochem. Biophys. Res. Commun., 280, 707, 2001. 34. Wallace, V.A. et al., A role for CD4+ T-cells in the pathogenesis of skin fibrosis in tight skin mice, Eur. J. Immunol., 24, 1463, 1994. 35. Hatakeyama, A. et al., Correlation between the concentration of serum anti-topoisomerase I autoantibodies and histological and biochemical alterations in the skin of tight skin mice, Cell Immunol., 167, 135, 1996.
1391_C33.fm Page 514 Tuesday, November 18, 2003 5:53 PM
514
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
36. Siracusa, L.D. et al., The mouse tight skin (Tsk) phenotype is not dependent on the presence of mature T and B lymphocytes, Mamm. Genome, 9, 907, 1998. 37. Dodig, T.D. et al., Development of the tight-skin phenotype in immune-deficient mice, Arthritis Rheum., 44, 723, 2001. 38. Kasturi, K.N. et al., B-cell deficiency does not abrogate development of cutaneous hyperplasia in mice inheriting the defective fibrillin-1 gene, J. Autoimmunity, 10, 505, 1997. 39. Saito, S., Kasturi, K., and Bona, C., Genetic and immunologic features associated with sclerodermalike syndrome of Tsk mice, Curr. Rheumatol. Rep. 1, 34, 1999. 40. Oble, D.A. and Teh, H.S., Tight skin mouse subcutaneous hypertrophy can occur in the absence of a/b T cell receptor-bearing lymphocytes, J. Rheumatol., 28, 1851, 2001. 41. Hawkins, R.A. et al., Increased dermal mast cell population in progressive systemic sclerosis: A link in chronic fibrosis? Ann. Intern. Med. 102, 182, 1985. 42. Walker, M. et al., Mast cells and their degranulation in the Tsk mouse model of scleroderma, Proc. Soc. Exp. Biol. Med., 180, 323, 1985. 43. Pearson, M.E. et al., Immunologic dysfunction in scleroderma: Evidence for increased mast cell releaseability and HLA-Dr positivity in the dermis, Arthritis Rheum., 31, 672, 1988. 44. Everett, E.T. et al., The role of mast cells in the development of skin fibrosis in tight-skin mutant mice, Comp. Biochem. Physiol. A Physiol., 110, 159, 1995. 45. Jimenez, S.A. et al., Increased collagen biosynthesis and increased expression of type I and type III procollagen gene in tight skin (Tsk) mouse fibroblasts, J. Biol. Chem., 261, 657, 1986. 46. Ross, S.C. et al., Glycosaminoglycan content in skin of the tight-skin mouse, Arthritis Rheum., 26, 653, 1983. 47. Dorner, R.W., Osborn, T.G., and Ross, S.C., Glycosaminoglycan composition of tight skin and control mouse skins, J. Rheumatol., 14, 295, 1987. 48. Uitto, J., Collagen biosynthesis in human skin: a review with emphasis on scleroderma, Ann. Clin. Res., 1971;3, 250, 1971. 49. Jimenez, S.A., Yankowski, R., and Frontino, P.M., Biosynthetic heterogenetiy of sclerodermatous skin in organ cultures, J. Mol. Med., 2, 423, 1977. 50. LeRoy, E.C., Increased collagen synthesis by scleroderma skin fibroblasts in vitro: a possible defect in the regulation or activation of the scleroderma fibroblasts, J. Clin. Invest., 54, 880, 1974. 51. Buckingham, R.B. et al., Increased collagen accumulation in dermal fibroblast cultures from patients with progressive systemic sclerosis (scleroderma), J. Lab. Clin. Med., 92, 5, 1978. 52. Jimenez, S.A. and Bashey, R.I., Collagen synthesis by scleroderma fibroblasts in culture, Arthritis Rheum., 20, 902, 1977. 53. Jimenez, S.A. et al., Coordinate increase in the expression of type I and type III collagen genes in progressive systemic sclerosis fibroblasts, Biochem. J., 237, 837, 1986. 54. Uitto, J., Bauer, E.A., and Eisen, A.Z., Scleroderma: Increased biosynthesis of triple-helical type I and III procollagens associated with unaltered expression of collagenase by skin fibroblasts in culture, J. Clin. Invest., 64, 921, 1979. 55. Cooper, S.M. et al., Increase in fibronectin in the deep dermis of involved skin in progressive systemic sclerosis, Arthritis Rheum., 22, 983, 1979. 56. Peltonen, J. et al., Increased expression of type VI collagen genes in progressive systemic sclerosis lesions in situ, Arthritis Rheum., 33, 1829, 1990. 57. Pablos, J.L. et al., Transforming growth factor-b1 and collagen gene expression during postnatal skin development and fibrosis in the tight-skin mouse, Lab. Invest., 72, 670, 1995. 58. Pablos, J.L. et al., Apoptosis and proliferation of fibroblasts during postnatal skin development and scleroderma in the tight-skin mouse, J. Histochem. Cytochem., 45, 711, 1997. 59. Sgonc, R. et al., Lack of endothelial cell apoptosis in the dermis of tight skin 1 and tight skin 2 mice, Arthritis Rheum., 42, 581, 1999. 60. Philips, N., Bashey, R.I., and Jimenez, S.A., Increased a1(I) procollagen gene expression in tight skin (Tsk) mice myocardial fibroblasts is due to a reduced interaction of a negative regulatory sequence with AP-1 transcription factor, J. Biol. Chem., 270, 9313, 1995. 61. Denton, C.P. et al., Activation of a fibroblast-specific enhancer of the proa2(I) collagen gene in tightskin mice, Arthritis Rheum., 44, 712, 2001.
1391_C33.fm Page 515 Tuesday, November 18, 2003 5:53 PM
SPONTANEOUS MOUSE MODELS OF SYSTEMIC SCLERODERMA
515
62. Siracusa, L.D. et al., The tight skin (Tsk) mutation in the mouse, a model for human fibrotic diseases, is tightly linked to the b2-microglobulin (B2m) gene on chromosome 2, Genomics, 17, 748, 1993. 63. Goldstein, C. et al., Of mice and Marfan: genetic linkage analyses of the fibrillin genes, Fbn1 and Fbn2, in the mouse genome, Mamm. Genome, 5, 696, 1994. 64. Everett, E.T. et al., The tight-skin (Tsk) mutation is closely linked to b2m on mouse chromosome 2, Mamm. Genome, 5, 55, 1994. 65. Siracusa, L.D. et al., A tandem duplication within the fibrillin-1 gene is associated with the mouse tight skin mutation, Genome Res., 6, 300, 1996. 66. Bona, C.A. et al., Structure of the mutant fibrillin-1 gene in the tight skin (Tsk) mouse, DNA Res., 4, 267, 1997. 67. Saito, S. et al., Characterization of mutated protein encoded by partially duplicated fibrillin-1 gene in tight skin (Tsk) mice, Mol. Immunol., 36, 169, 1999. 68. Kielty, C.M. et al., The tight skin mouse: demonstration of mutant fibrillin-1 production and assembly into abnormal microfibrils, J. Cell Biol., 140, 1159, 1998. 69. Gayraud, B. et al., New insights into the assembly of extracellular microfibrils from the analysis of the fibrillin-1 mutation in the tight skin mouse, J. Cell Biol., 150, 667, 2000. 70. Tan, F.K. and Arnett, F.C., Genetic factors in the etiology of systemic sclerosis and Raynaud phenomenon, Curr. Opin. Rheumatol., 12, 511, 2000. 71. Tan, F.K. et al., Association of fibrillin-1 single-nucleotide polymorphism haplotypes with systemic sclerosis in Choctaw and Japanese populations, Arthritis Rheum., 44, 893, 2001. 72. Tan, F.K. et al., Autoantibodies to the extracellular matrix microfibrillar protein, fibrillin-1, in patients with scleroderma and other connective tissue diseases, J. Immunol., 163, 1066, 1999. 73. Tan, F.K. et al., Autoantibodies to fibrillin-1 in systemic sclerosis: ethnic differences in antigen recognition and lack of correlation with specific clinical features or HLA alleles, Arthritis Rheum., 43, 2464, 2000. 74. Pandey, J.P. et al., Anti-fibrillin-1 autoantibodies in systemic sclerosis are GM and KM allotyperestricted, Exp. Clin. Immunogenet., 18, 123, 2001. 75. Arnett, F.C. et al., Autoantibodies to the extracellular matrix microfibrillar protein, fibrillin-1, in patients with localized scleroderma, Arthritis Rheum., 42, 2656, 1999. 76. Murai, C. et al., Spontaneous occurrence of anti-fibrillin-1 autoantibodies in tight-skin mice, Autoimmunity, 28, 151, 1998. 77. Peters, J. and Ball, S.T., Tight skin-2 (Tsk-2), Mouse News Lett., 74, 91, 1986. 78. Christner, P.J. et al., The tight skin 2 mouse. An animal model of scleroderma displaying cutaneous fibrosis and mononuclear cell infiltration, Arthritis Rheum., 38, 1791, 1995. 79. Wooley, P.H. et al., T-cells infiltrating the skin of Tsk2 scleroderma-like mice exhibit T cell receptor bias, Autoimmunity, 27, 91, 1998. 80. Sgonc, R., The vascular perspective of systemic sclerosis: of chickens, mice and men, Int. Arch. Allergy Immunol., 120, 169, 1999. 81. Christner, P.J. et al., A high-resolution linkage map of the tight skin 2 (Tsk2) locus: A mouse model for scleroderma (SSc) and other cutaneous fibrotic diseases, Mamm. Genome, 7, 610, 1996. 82. Christner, P.J. et al., Transcriptional activation of the a1(I) procollagen gene and up-regulation of a1(I) and a1(III) procollagen messenger RNA in dermal fibroblasts from tight skin 2 mice, Arthritis Rheum., 41, 2132, 1998. 83. Christner, P.J. et al., Upregulated expression of collagen type III and VI genes in the Tsk2 mouse model, Arthritis Rheum., 41, S279, 1998. 84. Saito, S. et al., Induction of skin fibrosis in mice expressing a mutated fibrillin-1 gene, Mol. Med., 6, 825, 2000. 85. Sato, S. et al., Quantitative genetic variation in CD19 expression correlates with autoimmunity, J. Immunol., 165, 6635, 2000. 86. Liu, X. et al., A targeted mutation at the known collagenase cleavage site in mouse type I collagen impairs tissue remodeling, J. Cell Biol., 130, 227, 1995.
1391_C33.fm Page 516 Tuesday, November 18, 2003 5:53 PM
1391_C34.fm Page 517 Tuesday, November 18, 2003 5:56 PM
CHAPTER
34
Experimental Mouse Model of Scleroderma/Graft versus Host Disease: Induction by Transfer of Cellular Immmunity Anita C. Gilliam
CONTENTS I. History ................................................................................................................................518 A. GVHD as a Model for Scleroderma .........................................................................518 B. The Diversity of GVHD ............................................................................................519 C. Major Issues in Characterizing a Mouse Model of Scleroderma.............................520 1. General Issues......................................................................................................520 2. The Reproducibility of Major Features of Human Scleroderma in Mouse Scl GVHD ...............................................................................................520 a. Vascular Injury...............................................................................................520 b. Mast Cell Degranulation................................................................................520 c. Up-regulation of Tissue Chemokines............................................................521 d. Tissue Influx of Inflammatory Cells and Their Activation...........................521 e. Up-regulation of Cytokines ...........................................................................522 f. Up-regulation of Collagen Synthesis Leading to Tissue Fibrosis ................522 g. Collagen Degradation ....................................................................................522 II. Animals ..............................................................................................................................522 A. Generating Scl GVHD...............................................................................................522 1. Strains of Mice ....................................................................................................522 2. Sex and Age.........................................................................................................522 B. Inherent Susceptibility to Fibrosis ............................................................................523 III. Disease Induction...............................................................................................................523 A. Mice Preparation........................................................................................................523 B. Irradiation of Recipient Mice ....................................................................................523 C. Bone Marrow and Spleen Cell Collection from Donor Mice ..................................523 1. Bone Marrow Cells (Source of Hematopoietic Cells for Engraftment).............523 2. Spleen Cells (Source of Mature T Cells to Generate GVHD)...........................524 D. Transplantation...........................................................................................................524 E. Maintenance of Transplanted Recipient Mice ..........................................................524 F. Experimental Design .................................................................................................524 0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
517
1391_C34.fm Page 518 Tuesday, November 18, 2003 5:56 PM
518
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
1. Controls for Scl GVHD.......................................................................................524 2. Controls for Engraftment.....................................................................................525 IV. Course of Disease ..............................................................................................................525 V. Assessment of Disease.......................................................................................................525 A. Skin in Scl GVHD.....................................................................................................525 1. Caliper Measurements .........................................................................................525 2. Histopathological and Morphometric Analysis...................................................525 a. Routine Histology..........................................................................................526 b. Image Analysis ..............................................................................................526 3. Ultrasonographic Evaluation ...............................................................................526 4. Cutaneous Immune Cell Infiltrates......................................................................526 a. Quantification of Immunostaining by Image Analysis .................................526 b. Flow Cytometric Analysis of Cutaneous Immune Cell Infiltrates ...............526 B. Lung in Scl GVHD....................................................................................................527 VI. Expert Experience ..............................................................................................................527 A. Skin ............................................................................................................................527 1. Skin Thickening and Collagen Synthesis............................................................527 2. Keratinocyte Injury ..............................................................................................527 3. Mast Cell Degranulation......................................................................................527 4. Chemokines and Cytokines .................................................................................527 5. Cutaneous Inflammatory Cells ............................................................................528 B. Lungs..........................................................................................................................528 C. Spleen.........................................................................................................................528 D. Liver ...........................................................................................................................529 E. Kidney........................................................................................................................530 VII. Therapeutic Responses.......................................................................................................530 A. Antibodies to TGF-b .................................................................................................530 B. Latency-Associated Peptide.......................................................................................530 C. Halofuginone..............................................................................................................530 D. Nedocromil Sodium...................................................................................................530 VIII. Conclusion..........................................................................................................................531 References ......................................................................................................................................531
I. HISTORY A. GVHD as a Model for Scleroderma Chronic graft versus host disease (GVHD) is a major complication of allogeneic bone marrow transplantation (BMT) that has autoimmune features resembling lupus erythematosus (lichenoid GVHD) or scleroderma (sclerodermatous GVHD, Scl GVHD). Henry Claman et al. [1–9] first recognized mouse Scl GVHD as a possible model for scleroderma in the 1980s. Also in the 1980s, two examples of mouse Scl GVHD were described [10–12]. The B10.D2>BALB/c transplantation pair is the best described and most commonly used. Since that early series of publications, there has been a revival of interest in the model because of a new concept in the possible etiology of scleroderma: microchimerism of persistent fetal cells in postpartum women [13–16]. An attractive, but still controversial, hypothesis is that a graft versus host (or host versus graft?)-like reaction due to microchimerism may help explain the predominant occurrence of scleroderma in women in their postchildbearing years. Maternal microchimerism (retention of maternal cells in the fetus) has also been proposed as a possible explanation of autoimmunity in men and children [17].
1391_C34.fm Page 519 Tuesday, November 18, 2003 5:56 PM
INDUCTION BY TRANSFER OF CELLULAR IMMMUNITY
519
As Claman et al. suggested in the 1980s [1–9], mouse Scl GVHD is a very useful model for scleroderma because it is possible to study the immunology and progression of early disease, and because interventions can be tested in the model. Since Claman’s initial work on the murine model, Levi Schaefer et al. [18–22] have used mouse Scl GVHD (the B10.D2>BALB/c transplantation pair) to study the role of mast cells in fibrosis. Mast cells release a wide variety of mediators of inflammation (histamine, proteases, cytokines) and when added to fibroblast cultures can stimulate both fibrogenic and fibrolytic changes [23]. Our understanding of the role that mast cells play in scleroderma is still incomplete, however. Levi-Schaffer et al. [20] and Pines and Nagler [24] tested interventions with halofuginone, an alkaloid inhibitor of collagen synthesis in mouse Scl GVHD (B10.D2>BALB/c). Chen et al. [25] induced long-term survival in this model with rapamycin, a macrolide used to suppress organ transplant rejection. Others have shown hepatic and small bowel inflammation in mouse Scl GVHD (B10.D2>BALB/c) [26] that is ameliorated by feeding recipient mice with proteins extracted from BALB/c splenocytes to induce oral tolerance [27,28]. Nagler et al. [28] demonstrated altered serum interleukin 10 (IL-10), interferon-gamma (IFN-g) and tumor necrosis factor alpha (TNF-a) levels, suggesting that the decrease in gut inflammation was due to a cytokine shift from proinflammatory to anti-inflammatory pattern. The B10.D2>BALB/c Scl GVHD mice also have biliary cirrhosis, similar to that in human primary biliary cirrhosis. Biliary cirrhosis has also been demonstrated in some individuals with CREST syndrome [29]. Howell et al. [30] characterized the hepatic GVHD in a series of articles in which they demonstrated increased ICAM-1 and Iad on bile duct epithelium, injury to bile ducts associated with increased T cells, an increased CD4/CD8 T-cell ratio, and increased Mac-1 positive macrophages. Hepatic GVHD lesions and elevated serum IgE were suppressed by anti-CD4 but not anti-CD8 T-cell antibodies in the mice with Scl GVHD [31]. A skewed T-cell receptor repertoire by two-color immunofluorescence on spleen and liver lymphocytes suggested a polyclonal response to multiple host non-MHC antigens [32]. Parotid gland dysfunction has also been documented in these mice (B10.D2>BALB/c) [33]. We have focused on the cutaneous immunology of early mouse Scl GVHD (B10.D2>BALB/c) because of the ready accessibility of skin and the extensive published data on and reagents for skin biology. We characterized the early cutaneous inflammatory cells and showed that monocyte/macrophages making TGF-b1, a potent fibrogenic cytokine, predominate over lymphocytes in skin [34]. Up-regulation of mRNA for chemokines MCP-1 (macrophage chemotactic factor); RANTES (regulated upon activation, normal T cell expressed and secreted), and MIP-1a (macrophage inhibitory factor) occurs early in cutaneous disease, and precedes cutaneous inflammatory cell influx [35]. We have also shown that latency-associated peptide (LAP), the naturally occurring pre-propeptide inhibitor of TGF-b, and antibodies to TGF-b both inhibit skin thickening in the mouse model, confirming the critical role of TGF-b in fibrosis [34–37]. B. The Diversity of GVHD GVHD results when immunologically competent cells with disparate histocompatibility antigens are transplanted into an immunologically compromised or suppressed individual that cannot reject the grafted cells. The donor cells then attack recipient host cells, tissues, organs, and immune system. Typically in human allogeneic BMT or stem cell transplantation, donor cells are matched for at least four to six major histocompatibility antigens. No attempt is made to match for minor antigens, which are less well characterized and for which reagents are not readily available. Therefore, it is no surprise that manifestations of GVHD can be quite different among individuals and from one animal model to another because they are dependent mainly on the unique genetic backgrounds of the individuals transplanted. Different mouse-strain pair combinations allow us to generate acute or chronic, mild nonfatal or devastating fatal disease; disease mainly with vasculitis
1391_C34.fm Page 520 Tuesday, November 18, 2003 5:56 PM
520
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
or with fibrosis; or disease directed to specific organs (skin, lungs, kidneys, liver, etc.). These mouse models are invaluable tools to dissect out the pathogenesis of epithelial injury, vasculitis, or tissue fibrosis because disease can be characterized from early to late time points, and interventions can be tested within fairly short periods of time (weeks to months). Most chronic human GVHD is of the classic lichenoid, scaling variant (lupus-like), with prominent cytotoxicity to epithelial cells producing “dermatitis, hepatitis, and enteritis” [38], whereas Scl GVHD develops in only a small percentage of humans with chronic GVHD, that is, 3.6% in one study [39]. Similarly, Scl GVHD can be generated in only a few mouse strain pairs that are transplanted across minor histocompatibility loci. These models most closely resemble human sibling allogeneic BMT, in which donor and recipient bone marrow are matched for major HLA loci, but may be disparate at minor histocompatibility loci. The B10.D2>BALB/c model (B10.D2 H-2d bone marrow and spleen cells transplanted to lethally irradiated BALB/c H-2d mice) is the most commonly used strain pair. Another strain-pair model utilizes C57Bl/6 (H-2b) bone marrow and spleen cells transplanted to LPJ (H-2b) mice (C57Bl/6>LPJ) [40]. In both of these models, syngeneic bone marrow/spleen transplanted mice serve as controls. In contrast to classic GVHD, transplanted animals with Scl GVHD do not develop skin dermatitis or diarrhea clinically. Histologically, minimal cytotoxic effects are seen in skin epidermis in Scl GVHD. The main features of mouse Scl GVHD that resemble scleroderma are skin thickening and lung fibrosis. C. Major Issues in Characterizing a Mouse Model of Scleroderma 1. General Issues Scleroderma is a complex disease involving production of autoantibodies to various cellular antigens (components of nucleoli, centromeres, small nuclear ribonucleoproteins, and RNase molecules), vascular injury, and skin and visceral fibrosis. No one animal model recapitulates all features of human scleroderma. Just as there are subsets of patients with different types of disease (systemic sclerosis, CREST), and with different autoantibody patterns associated with different ethnic groups [41], the mouse (Tight Skin, Tsk; bleomycin-induced sclerosis; and Scl GVHD) and UCD chicken scleroderma models may each reproduce some but not all features of human scleroderma. Scl GVHD most closely resembles explosive rapidly progressive scleroderma that evolves over months rather than years. This form of scleroderma may be more amenable to treatment, which could interrupt the disease process before significant irreversible tissue injury has occurred. 2. The Reproducibility of Major Features of Human Scleroderma in Mouse Scl GVHD a. Vascular Injury In human scleroderma, reduplicated basement membrane and concentric sclerosis with perivascular fibrosis are seen in deep dermal vessels. In mouse Scl GVHD, no vascular injury is seen in routine hematoxylin and eosin (H and E) sections of skin in mice with Scl GVHD, much like human sclerodermatous GVHD. In contrast, vascular injury is prominent in the UC Davis chicken model for scleroderma. b.
Mast Cell Degranulation
Claman et al. [9,42] were the first to describe degranulated “ghost” mast cells in scleroderma. In mouse Scl GVHD, mast cell degranulation is also seen, whereas most dermal mast cells are intact in syngeneic transplanted control mice.
1391_C34.fm Page 521 Tuesday, November 18, 2003 5:56 PM
INDUCTION BY TRANSFER OF CELLULAR IMMMUNITY
c.
521
Up-regulation of Tissue Chemokines
RANTES, MCP-1, MIP1a, and MIP1b are increased in skin [43,44]. In mouse Scl GVHD, mRNA for cutaneous RANTES, MCP-1, and MIP1a are increased preceding development of skin fibrosis [35]. d. Tissue Influx of Inflammatory Cells and Their Activation T Cells — Chronic autoimmune diseases are thought to be antigen driven, and the focus to date has been on T cells in scleroderma, presumably specific for unknown cellular antigens [45–48]. Evidence for this includes skewing of T-cell receptor repertoires with oligoclonal proliferation of T-cell subsets in individuals with systemic sclerosis [49], and in individuals with CREST and primary biliary cirrhosis [29]. In general, scleroderma is said to be a predominantly Th2 process, but conflicting reports are found in the literature with respect to up-regulation of Th1 versus Th2 cytokines. There is a higher percentage of activated CD3+ DR+ T cells in peripheral blood of systemic sclerosis patients compared to matched controls, with detectable IFN-g mRNA-positive cells [50]. Under basal conditions, PBMC of a majority of the scleroderma patients showed both Th1 and Th2 cell activation. In mouse Scl GVHD, T cells in liver and spleen have an altered Tcell receptor repertoire skewed toward Vb2 and Vb3 [51], and both cutaneous T cells and monocyte/macrophages express Iad, consistent with an activated phenotype [35]. Th1 versus Th2 cytokine predominance is not yet established in the model. Monocyte/Macrophages — CD14+ monocytes predominate over T cells in scleroderma skin in early disease [52]. There is chronic activation of pulmonary T cells and macrophages [46], presumably brought there by increased chemokines. Parallels are seen in other rheumatic diseases. Activated macrophages, often located strategically near the pannus, and increased monocyte/macrophage chemokines are present in affected joints in rheumatoid arthritis. Clinical improvement in rat adjuvant–induced arthritis can be linked to down-regulation of the monocyte/macrophage system [53,54]. In mouse Scl GVHD, we observed that TGF-b producing monocyte/macrophages predominate over other immune cells (T cells, NK cells) in Scl GVHD skin before fibrosis begins, an important finding in understanding the pathophysiology of Scl GVHD and scleroderma, and in targeting a cell type for immunomodulatory therapies. T cells and monocytes are derived from CD34+ bone marrow precursors. Monocytes pass through several intermediate stages in the bone marrow (monoblasts and promonocytes). Then they enter the circulation as monocytes for approximately 5 days after which they home to various tissues and organs via mechanisms that are still poorly understood, but are thought to be similar to those of lymphocytes. In tissue, they differentiate into mature resident tissue macrophages or dendritic cells, a final stage thought in the past to be irreversible. The systemic and local triggers for differentiation of monocytes are not as well understood as those for lymphocytes. They include cytokines, T-cell interactions, matrix molecule interactions, and microorganisms. Several markers of differentiation and activation can be used to characterize monocyte/macrophages. They include up-regulation of surface markers (class II MHC, CD40, scavenger receptors, CD11b, LFA-1, and CD44); chemokine secretion (MCP-1, MIP-1a), and cytokine production (up-regulated TGF-b, IL-1b , TNF-a, GMCSF). During inflammation, macrophages can immigrate to the draining lymph nodes in response to cutaneous MCP-1 carried there via lymphatics [55]. There, they may play a role in presentation of antigens from inflamed skin, resembling dendritic cells. In mouse Scl GVHD, we have shown up-regulation of macrophage activation markers (CD11b, scavenger receptor molecules, and Iad) in early cutaneous Scl GVHD, suggesting a critical role of monocyte/macrophages in disease [35]. Like T cells, macrophages may contribute to the chemokine and cytokine environment that favors fibrosis, and our data suggest that they may also be important in antigen presentation.
1391_C34.fm Page 522 Tuesday, November 18, 2003 5:56 PM
522
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
e. Up-regulation of Cytokines Up-regulation of a critical fibrogenic cytokine, TGF-b, has been demonstrated in skin and lung of individuals with scleroderma [56]. TGF-b can induce increased collagen mRNA and protein synthesis in normal human fibroblasts in vitro. The inability of TGF-b to up-regulate collagen production in cultured scleroderma fibroblasts is thought to reflect a refractory state in which collagen synthesis by scleroderma fibroblasts is no longer under regulatory control of TGF-b. Connective tissue growth factor (CTGF) is also up-regulated in scleroderma, and may be an important inducer of fibroblast collagen synthesis that is downstream from TGF-b [57,58]. In mouse Scl GVHD, up-regulated TGF-b1 mRNA and protein and CTGF mRNA are present in mouse Scl GVHD skin by day 7 post-BMT, preceding collagen synthesis [34,35,36]. f.
Up-regulation of Collagen Synthesis Leading to Tissue Fibrosis
Type I collagen mRNA and protein synthesis are up-regulated in skin of individuals with scleroderma [59]. In mouse Scl GVHD, we have shown increased synthesis of cutaneous type I collagen, documented by RNase protection assays, RT/PCR, and by immunostaining of frozen skin sections in Scl GVHD [34,35,36]. g. Collagen Degradation This area of research is underdeveloped compared to the study of the immune cells, fibroblasts, and collagen synthesis in scleroderma. It is thought that extracellular matrix deposition is balanced in vivo by degradation, and one theory of scleroderma pathogenesis is that it may be a disease of “imbalance,” where collagen synthesis exceeds degradation. Clearly, some scleroderma patients have had complete resolution of their disease, and it is well known that scleroderma in a single patient is difficult to study over time because disease can wax and wane. Increased levels of tissue inhibitors of metalloproteinases (TIMPS) are documented in scleroderma serum, suggesting decreased collagen degradation [60]. In mouse Scl GVHD, no studies have been performed to date on collagen degradation in the murine model, but it provides the ideal system for those studies.
II. ANIMALS A. Generating Scl GVHD 1. Strains of Mice The two mouse strain pairs used to generate Scl GVHD are B10.D2>BALB/c and C57Bl/6>LPJ. We have the most experience with the B10.D2>BALB/c model and will concentrate on this strain pair in our discussion. The strain designations are BALB/cJ (H-2d, Mls2a, Mls3a) and B10.D2 (nSNJ H-2d, Mls-2a, Mls3a). 2. Sex and Age Male or female mice at 6 to 8 weeks of age are utilized as donors and recipients. We generally transplant female mice because when male mice from different litters are placed together, the fighting that ensues can lead to unwanted injuries with scarring of the skin. We have transplanted bone marrow and spleen from male mice into female mice in order to track donor cells by PCR analysis of Y chromosome sequences [35].
1391_C34.fm Page 523 Tuesday, November 18, 2003 5:56 PM
INDUCTION BY TRANSFER OF CELLULAR IMMMUNITY
523
B. Inherent Susceptibility to Fibrosis Although it has not been studied in a methodical manner, some individuals are known to be more susceptible to fibrosis than others. For instance, keloid formation tends to be familial and is common in black individuals. There is a correlation between the MHC antigens and ethnically associated scleroderma, most dramatically illustrated in the Choctow American Indians [41]. In mice, the C57Bl/6 strain is more likely than the BALB/c strain to develop lung and skin fibrosis after intratracheal or intradermal administration of bleomycin [61,62]. C57Bl/6 mice are also more likely to develop lung fibrosis when exposed to asbestos fibers than 129 mice [63]. Decreased responsiveness in vitro to peptide growth factor PDGFa and to TNFa of 129 fibroblasts compared to C57BL/6 fibroblasts was suggested as a possible explanation of the fibrosis-resistant phenotype. In addition, C57Bl/6 mice are prone to lung fibrosis after ionizing radiation to the thorax (these doses are much higher than those employed for BMT) [64]. TGF-b that localized to alveolar macrophages by immunostaining was seen in fibrotic lungs of the irradiated mice but not in lungs of control unirradiated C57Bl/6 mice in those experiments. The fibrosis-prone mouse strains such as C57Bl/6 may reflect an inherent strain difference in responses to growth factors or cytokines, leading to tissue injury. Cytokine promoter polymorphisms are implicated in inflammatory disorders such as subacute systemic lupus erythematosus [65] and are another possible explanation for strain differences in fibrosis. Therefore, there are clearly strain differences in susceptibility to fibrosis in mice, but the genetic components of fibrosis are complex and multiple, and are not well characterized at this time.
III. DISEASE INDUCTION A. Mice Preparation Donor and recipient mice (Jackson Laboratory, Bar Harbor, ME) are approximately 6 to 8 weeks old, and have been allowed to adapt for approximately 1 week after shipping. They are maintained from time of arrival in Microisolator cages (Lab Products, Seaford, DE), three to five mice per cage. B. Irradiation of Recipient Mice Recipient mice are irradiated in groups of five to eight with 700 cGy using a Gammacel 137Cs source. BALB/c mice are sensitive to ionizing radiation and increased mortality unrelated to GVHD occurs at higher doses. C. Bone Marrow and Spleen Cell Collection from Donor Mice We use a standard protocol for preparation of transplantation inoculum [66]. Donor mice are sedated with ketamine, and injected intraperitoneally with 100 ml of heparin (10,000 units/ml, Sigma, St. Louis, MO). They are then sacrificed by cervical dislocation, and dipped in iodine solution and then in 75-percent ethanol. 1. Bone Marrow Cells (Source of Hematopoietic Cells for Engraftment) Using ethanol-cleaned surgical instruments, skin is stripped away from the lower extremity starting at the Achilles tendon with an incision. The femur is disarticulated from the pelvic socket with heavy scissors releasing the leg. The soft tissue is then stripped from femur and tibia with
1391_C34.fm Page 524 Tuesday, November 18, 2003 5:56 PM
524
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
fine scissors, and the fibula is discarded. Using heavy scissors, the ends of each bone are clipped and discarded. Three cleaned bones from each leg (femur, knee joint, and tibia) are then placed in a sterile Petri dish with media containing heparin (RPMI 1640 [BioWhittaker, Frederick, MD] with 20 U/ml heparin [Fisher Scientific, Pittsburgh, PA]). Bone marrow is flushed from the bone marrow canal into a 50-ml falcon tube using 27-gauge needles and 5-ml syringes preloaded with media/heparin. Bone marrow cells are resuspended in a final volume of 50 ml of media/heparin, washed two times in media/heparin and counted for total numbers and viability, using trypan blue exclusion. Bone marrow from four to five mice yields approximately 50 to 150 ¥ 106 bone marrow cells for transplantation. Injecting donor animals with 150 mg 5-fluorouracil (5-FU) 2 days before collection of bone marrow can increase yield. The bone marrow cells appear to be more fragile after 5-FU mobilization, however, and must be handled carefully. 2. Spleen Cells (Source of Mature T Cells to Generate GVHD) At the same time that leg bones are collected, spleen is removed, and minced with a sharp scalpel in a sterile Petri dish with media/heparin. Spleen pieces are pressed through an autoclaved stainless steel wire mesh screen over a 50-ml falcon tube to disaggregate cells. The mesh is washed in media/heparin, and spleen cells are collected into 50-ml media/heparin and centrifuged cells are then washed two times in media/heparin and counted for total numbers and viability. D. Transplantation Bone marrow and spleen cells are combined to ultimately deliver a ratio of 2:1 bone marrow (2 ¥ 106) and spleen (1 ¥ 106) cells in a volume of 0.2 ml per mouse. This is a standard dose for generating GVHD [67]. In a pilot experiment with a small number of animals, we found no difference in cutaneous GVHD when we increased the ratio of spleen/bone marrow cells in the inoculum. The bone marrow/spleen preparation is kept at room temperature. If some clotting occurs, the preparation is drawn up repeatedly in a 5-cc syringe with an 18-gauge needle to disaggregate the clots before use. Transplantation must occur within 6 hours of fresh bone marrow/spleen collection in order to have viable transplanted cells. It is also critical to deliver the entire 0.2 ml inoculum. Animals receiving less than the full transplantation inoculum may develop GVHD at a slower rate, producing more variability in skin thickening at given time points after transplantation. Deaths during the transplantation procedure itself are usually due to emboli (clotted bone marrow/spleen preparations or air emboli) during tail vein injections. Deaths at early time points (1 to 2 weeks after transplantation) are most likely due to failure of engraftment. E. Maintenance of Transplanted Recipient Mice Transplanted animals are maintained in Microisolator cages and given autoclaved acidified water (pH 2.5 with acetic acid) and autoclaved chow. Antibiotics are not used in drinking water. F.
Experimental Design
1. Controls for Scl GVHD In addition to transplantation of BALB/c mice with B10.D2 bone marrow/spleen cells (experimental group), transplantation with syngeneic BALB/c bone marrow/spleen cells is always performed (control group).
1391_C34.fm Page 525 Tuesday, November 18, 2003 5:56 PM
INDUCTION BY TRANSFER OF CELLULAR IMMMUNITY
525
2. Controls for Engraftment Irradiated but not transplanted mice are included in each experiment to confirm that the irradiation dose was lethal. These mice typically die between 7 and 10 days. Engraftment can be evaluated by examination of spleen in sacrificed animals. Numerous colonies should be present in spleens of engrafted animals within 4 to 5 days after transplantation.
IV. COURSE OF DISEASE BALB/c mice transplanted with B10.D2 bone marrow and spleen cells show minimal systemic effects of Scl GVHD at any time point. Both experimental and control groups have a brief period of lethargy following total body irradiation and BMT. The experimental group of mice (B10.D2>BALB/c) do not develop dermatitis, enteritis, or dramatic weight loss in contrast to animals with classic acute GVHD, in which death often occurs within 3 to 7 weeks post-BMT. In classic GVHD, death is most likely due to profound immunosuppression and to loss of barrier function in the gastrointestinal tract and skin, which increases susceptibility to infection. Mice with Scl GVHD fail to gain weight as rapidly as syngeneic BMT control mice or normal mice but mortality is low compared with classic GVHD. In fact, we have followed transplanted animals with Scl GVHD and syngeneic BMT controls to up to 75 days after transplantation, and have noted little morbidity associated with fibrosing disease. In one study, approximately 50% of mice with Scl GVHD (B10.D2>BALB/c) were alive at day 60 post-BMT [25]. The course of their skin manifestation is described next.
V. ASSESSMENT OF DISEASE A. Skin in Scl GVHD When animals are sacrificed for evaluation after day 14 to 21 post-BMT, experimental mice have thicker back skin subjectively than control mice by visual examination. 1. Caliper Measurements Although caliper measurements are routinely used to evaluate mouse ear thickness in contact dermatitis protocols, we have not found caliper measurements of skin to be as reliable as measurements by image analysis of histopathological sections of skin. 2. Histopathological and Morphometric Analysis Skin samples (1-cm strips) are fixed in 10% buffered formalin (Surgipath Medical Industries, Richmond, IL) on filter paper to prevent curling. Quantification of skin thickening is best performed by histological analysis of paraffin sections stained with H and E (Surgipath). We use image analysis of multiple 10¥ views of skin sections, typically six to ten per mouse skin collected from the back, utilizing the Optimas 6.1 program (Bothell, WA). Any image analysis program allowing morphometric analysis can be used. Depending on the quality of histological sections, these results are quite reliable and significantly different in experimental versus control mice by day 21 after BMT. We use area of dermis (from bottom of epidermis to dermis–fat interface) on a 10¥ view of skin as an “integrated” skin thickness. This method minimizes the small variations of dermal skin thickness from one area to another if the thickness is measured directly.
1391_C34.fm Page 526 Tuesday, November 18, 2003 5:56 PM
526
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
a. Routine Histology All the tissue at one time point from one experiment is processed at the same time to obtain consistent cutting and staining conditions. Caveat: If paraffin sections are floated too long on the warming water bath in the histology laboratory, they may spread excessively and lead to unreliable measurements of skin thickness. Numerous holes in the tissue are a clue to this problem that can be solved by recutting sections with careful attention to spreading artifact. Correct orientation of sections is essential; tangentially oriented sections of skin are not measurable. b.
Image Analysis
Images of skin for an experiment are captured at the same time with the same image analysis threshold settings to minimize variability from one microscope slide to another. Then images can be analyzed separately at a later time. 3. Ultrasonographic Evaluation We have also used ultrasonography to evaluate skin thickness on sedated mice with comparable results [34]. DermaScan (Cortex Technology, Madsund, Denmark) makes a 20-MHz instrument designed for evaluation of human skin, and a small probe can be purchased that is appropriate for mouse skin. The advantage to ultrasound is that sequential evaluation of skin thickness is possible without sacrificing the animals. However, ultrasonography is less sensitive than histological measurements that we now use exclusively. 4. Cutaneous Immune Cell Infiltrates We have evaluated density of skin inflammatory infiltrates by immunostaining for T cells and monocyte/macrophages, and have quantified immune cell composition by flow cytometric analysis of single cell suspensions prepared from a 1 ¥ 1–cm piece of back skin. a. Quantification of Immunostaining by Image Analysis This is performed on slides stained with specific antibodies (Abs) and corresponding isotype Abs. Isotype control Ab staining is always tested on the same slide as specific Ab staining, and subtracted in the analysis. Dermal area is calculated in arbitrary square units by outlining the dermis on a 10¥ view for each microscopic image. The same threshold settings are used on the set of slides stained with the same Ab. Density of positive immune cell staining within the outlined areas is plotted as percent of positive area. A minimum of six measurements is taken from two or more skin sections from each animal, and the variation among animals is expressed as standard error. b.
Flow Cytometric Analysis of Cutaneous Immune Cell Infiltrates
A standard method for preparation of cutaneous immune cells for flow cytometric analysis is utilized [68]. Small pieces of depilated skin are digested in RPMI containing 10 mM HEPES (Irvine Scientific, Santa Anna, CA), 0.01% DNase (Sigma), 0.27% collagenase (Sigma), and 1000 units of hyaluronidase (Sigma) at 37∞C for 2 hours. The digested skin is filtered through 100-mm nylon mesh to generate a single-cell suspension of skin cells that contain resident cells (keratinocytes, dendritic cells, fibroblasts, endothelial cells, and perivascular cells such as mast cells) and infiltrating cells (lymphocytes, monocytes, and NK cells). Approximately 4 ¥ 106 cells are typically obtained from a 1 ¥ 2–cm2 piece of skin for control mice, and 8 ¥ 106 cells for mice with Scl GVHD at day 21 post-BMT. Prior to specific antibody staining, all isolated skin cells are blocked with purified
1391_C34.fm Page 527 Tuesday, November 18, 2003 5:56 PM
INDUCTION BY TRANSFER OF CELLULAR IMMMUNITY
527
mouse IgG (1 mg per 106 cells, Sigma) for 5 minutes on ice. For cytokine and chemokine staining, permeabilization buffer containing 1% saponin is used as washing and staining buffers. Specific and isotype-matched antibodies are then directly applied (1 mg per 106 cells). Prior to fixation with 1% paraformaldehyde in PBS, all samples are washed twice in PBS supplemented with 1% BSA, 1% FCS, and 0.05% sodium azide. Sample data are acquired on a Becton Dickenson FACScan (Franklin Lakes, NJ) and analyzed using Cell Quest software. B. Lung in Scl GVHD Mice with Scl GVHD have increased lung fibrosis by image analysis of routine H and E sections, quantified as a decrease in free alveolar space on 10¥ sections of lung. VI. EXPERT EXPERIENCE In our laboratory, we have characterized the following findings in the mouse Scl GVHD model regarding the skin, lung, and other organ systems. A. Skin 1. Skin Thickening and Collagen Synthesis By histological examination, skin collected from back is approximately 30 to 40% thicker in mice with Scl GVHD than controls (Figures 34.1A and B) by day 21 post-BMT. Routine H and E-stained sections and Masson’s trichrome-stained sections for collagen show increased density of cutaneous collagen. RNase protection assays and semiquantitative RT/PCR analysis of total RNA prepared from back skin show up-regulation of proa1(I) collagen mRNA [34,35]. Increased collagen protein can be documented by immunostaining for type I collagen [35,36]. 2. Keratinocyte Injury Very rare apoptotic cells are found in epidermis at any time point in Scl GVHD (Figures 34.1A and B), consistent with mild GVHD directed to epithelium, whereas the skin fibrosis predominates. This is in dramatic contrast to classic GVHD, where numerous apoptotic keratinocytes are present in epithelium, and their numbers are predictive of severe cutaneous and visceral GVHD [69]. Mucosal epithelia are very sensitive indicators of early or mild GVHD. Mild cytotoxic changes are demonstrated in tongue epithelium (Figures 34.1E and F) where infiltrating lymphocytes and occasional apoptotic keratinocytes are found in experimental (Figure 34.1F) but not in control mice (Figure 34.1E). The lack of significant epithelial injury is consistent with the absence of a scaling dermatitis or diarrhea in Scl GVHD, and may help to explain the longevity of Scl GVHD mice that have little compromise in skin or gut barrier function. 3. Mast Cell Degranulation Increased numbers of degranulated mast cells are seen in Scl GVHD mice compared to controls (Figures 34.1C, D) [70]. 4. Chemokines and Cytokines Up-regulation of mRNA for chemokines RANTES, MCP-1, and MIP-1a is seen in skin at day 21 post-BMT, preceding the influx of cutaneous mononuclear cells [35]. Increased chemokines for
1391_C34.fm Page 528 Tuesday, November 18, 2003 5:56 PM
528
Figure 34.1
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
(A, B) Representative hematoxylin and eosin–stained sections of skin of mice with Scl GVHD (B) compared with syngeneic BMT control mice (A). There is increased skin thickness in B, and an influx of mononuclear cells that is usually in the deep dermis, where fibrosis is first apparent in early scleroderma. Minimal epidermal injury is seen in Scl GVHD. (C, D) Increased mast cell degranulation is seen in routine hematoxylin and eosin-stained sections in skin of Scl GVHD (D) compared with controls (C). (E, F) Mild cytotoxic graft versus host disease is seen in tongue of mice with Scl GHVD (F) compared with controls (E). Apoptotic cells associated with lymphocytes in epidermis (satellitosis) are rare. Slightly increased numbers of lymphocytes tag basal keratinocytes, indicating mild GVHD.
monocyte/macrophages (MCP-1 and MIP-1a) are particularly interesting in view of the predominance of CD11b+ monocyte/macrophages over CD3+ cells in the dermal infiltrates by immunostaining and flow cytometric analysis. 5. Cutaneous Inflammatory Cells We analyzed the composition of dermal immune cells by several methods: immunostaining, flow cytometry, and magnetic bead separation of CD11b+ cells and CD3+ cells. By flow cytometry, the cutaneous immune cells in skin by day 21 post-BMT are predominantly monocyte/macrophages (20 to 22% of total cells in dermal suspensions), whereas the percentage of T cells is less (15%). NK cells are a very minor percentage of total dermal cells (8%) [35]. B. Lungs BALB/c mice transplanted with B10.D2 bone marrow and spleen cells also develop lung fibrosis, measured by image analysis of histological sections as a decrease in free alveolar space (Figures 34.2A and B). Our focus has been on the skin fibrosis; immune cells, chemokines, and cytokines have not yet been characterized in the lungs in this model. C. Spleen The spleen shows histological changes of bone marrow engraftment at times following BMT, with no apparent differences in experimental and control mice (Figures 34.2C and D). Figures 34.2E and F show histology of skin and spleen in a mouse that failed to engraft.
1391_C34.fm Page 529 Tuesday, November 18, 2003 5:56 PM
INDUCTION BY TRANSFER OF CELLULAR IMMMUNITY
Figure 34.2
529
(A, B) Increased numbers of inflammatory cells and decreased free alveolar space are seen in lungs of mice with Scl GVHD (B) compared with controls (A). (C, D) Spleens of mice with Scl GVHD are comparable to controls by histology of routine hematoxylin and eosin-stained sections. (E, F) Routine hematoxylin and eosin-stained sections of skin (E) and spleen (F) of a moribund mouse that failed to engraft. Skin shows early necrosis with focal areas of epidermal loss, and loss of the subcutaneous fat layer, typically found in cachexia. Spleen histology is abnormal with focal areas of cell death and early necrosis. (G, H) Periportal inflammation is seen in liver of mice with Scl GVHD (H) but not in controls (G) by day 21 post-BMT, consistent with early biliary cirrhosis.
D. Liver Some periportal inflammation is present in liver in Scl GVHD by day 21 (Figures 34.2G and H), consistent with the biliary cirrhosis documented by others. We have not examined liver at later time points. In some early pilot experiments, we observed binding of IgG antibodies in Scl GVHD
1391_C34.fm Page 530 Tuesday, November 18, 2003 5:56 PM
530
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
mouse serum to bile duct epithelium by immunofluorescence on frozen sections of normal mouse liver. Not all mice had these antibodies, however, and they were very low in titer. E. Kidney No inflammation is present in kidneys of mice with Scl GVHD or controls (not shown).
VII. THERAPEUTIC RESPONSES A. Antibodies to TGF-b Since elevated fibrogenic TGF-b mRNA and protein are seen in skin of mice with Scl GVHD, we tested inhibition of Scl GVHD with in vivo anti-TGF-b antibodies. When 150 mg of polyclonal rabbit antimouse TGF-b antibodies (Sigma) are administered by tail vein injection to mice with Scl GVHD at days 1 and 6 (total 300 mg), influx of inflammatory cells into dermis, skin thickening, and lung fibrosis do not occur [34]. The dose was selected based on published studies in other systems in which blocking of fibrosis in vivo by TGF-b antibodies was effective. B. Latency-Associated Peptide Latency-associated peptide (LAP) is the naturally occurring peptide inhibitor of TGF-b that is co-synthesized with TGF-b as a larger precursor protein. LAP is cleaved, dimerizes, and reassociates noncovalently with dimerized TGF-b to inactivate it. This complex of TGF-b and LAP is designated the small latent TGF-b complex. A large latent TGF-b complex (LAP-TGF-b-LTBP) is bound to extracellular matrix via TGF-b binding protein (LTBP) that is encoded on a different chromosome and is synthesized separately from LAP and TGF-b. Together, these forms of LAP-bound TGF-b regulate the release of active TGF-b into tissue. It is thought that a large reservoir of latent TGFb in tissue provides a means to rapidly release active TGF-b following injury [71,72]. Therefore, we also tested the ability of human recombinant LAP (specific for the TGF-b1 isoform, homology to mouse LAP approximately 86%, R&D, Systems Inc., Minneapolis, MN) to prevent skin thickening. When 2 ng of LAP was delivered by tail vein injection at days 1 and 6 post-BMT, skin thickening was completely inhibited and lung fibrosis was partially inhibited [35,36]. Collagen synthesis was decreased, documented by immunostaining with an antibody to newly synthesized mouse type I collagen. In contrast to inhibition with antibody, influx of cutaneous cells and their activation were not blocked by LAP, suggesting that LAP may affect a step further downstream in the TGF-b pathway of fibrosis [36]. TGF-b is a pleiotropic cytokine with many effects on immune cells, and we speculate that the chemokine functions of TGF-b may have been affected by the antibody intervention. However, we have not tested this hypothesis in our model. C. Halofuginone Daily intraperitoneal injections of halofuginone (1 mg/mouse), an alkaloid inhibitor of collagen synthesis, prevented skin thickening and loss of subdermal fat when given for 52 days starting 3 days before transplantation. Skin type I collagen synthesis is decreased [20]. Halofuginone is thought to act directly to inhibit collagen synthesis. D. Nedocromil Sodium Mast cell degranulation is seen in early human scleroderma and mouse Scl GVHD. A mast cell stabilizer, nedocromil sodium, alleviated skin fibrosis when applied topically to mice with Scl
1391_C34.fm Page 531 Tuesday, November 18, 2003 5:56 PM
INDUCTION BY TRANSFER OF CELLULAR IMMMUNITY
531
GVHD at 5 mg/day from days 3 to 15 post-BMT. Peritoneal and cutaneous mast cell numbers were normalized by this treatment [21].
VIII. CONCLUSION In conclusion, the mouse Scl GVHD model is a useful model for studying human scleroderma because of the following factors: 1. Microchimerism and a chronic GVHD-like reaction may be important in the pathophysiology of scleroderma. 2. Skin and lung fibrosis with inflammatory infiltrates are seen in Scl GVHD that resemble early inflammatory scleroderma. 3. Increased T-cell and monocyte/macrophage chemokines (RANTES, MCP-1, and MIP-1a) and cytokines (TGF-b1) are seen in mouse Scl GVHD that resemble chemokine and cytokine changes in human scleroderma. Therefore, immunomodulatory agents can be selectively targeted to specific cell types, chemokines, or cytokines early when therapy may be more effective. 4. The model allows sequential assessment in developing disease that occurs over a relatively short period of time. The effects of interventions can be readily evaluated in this mouse model in which the immune system can be manipulated. At present, very few transgenic or knockout mice are available on the B10.D2 or BALB/c background. As they become available, the effects of welldefined genetic manipulations in the mice can be studied.
REFERENCES 1. Jaffee, B.D. and Claman, H.N., Chronic graft-versus-host disease (GVHD) as a model for scleroderma. I. Description of model systems, Cell. Immunol., 77, 1, 1983. 2. Claman, H.N. et al., Chronic graft-versus-host disease as a model for scleroderma. II. Mast cell depletion with deposition of immunoglobulins in the skin and fibrosis, Cell. Immunol., 94, 73, 1985. 3. Claman, H.N., Mast cell depletion in murine chronic graft-versus-host disease, J. Invest. Dermatol., 84, 246, 1985. 4. Claman, H.N. et al., Mast cell “disappearance” in chronic murine graft-vs-host disease (GVHD)ultrastructural demonstration of “phantom mast cells,” J. Immunol., 137, 2009, 1986. 5. Choi, K.L., Giorno, R., and Claman, H.N., Cutaneous mast cell depletion and recovery in murine graft-vs-host disease, J. Immunol., 138, 4093, 1987. 6. Choi, K.L. and Claman, H.N., Mast cells in murine graft-versus-host disease: a model of immunologically induced fibrosis, Immunol. Ser., 46, 641, 1989. 7. Claman, H.N., Graft-versus-host disease and animal models for scleroderma, Curr. Opin. Rheumatol., 2, 929, 1990. 8. Claman, H.N., Mast cells and fibrosis. The relevance to scleroderma, Rheum. Dis. Clin. North Am., 16, 141, 1990. 9. Claman, H.N., On scleroderma. Mast cells, endothelial cells, and fibroblasts, JAMA, 262, 1206, 1989. 10. Bangert, J. et al., A comparison of two histologic patterns of murine graft-vs-host skin disease (GVHSD), J. Invest. Dermatol., 80, 329, 1983. 11. Charley, M.R. et al., Murine graft-versus-host skin disease: a chronologic and quantitative analysis of two histologic patterns, J. Invest. Dermatol., 81, 412, 1983. 12. Charley, M.R. and Deng, J.S., Murine models of graft-versus-host disease with features of scleroderma, Immunol. Ser., 46, 625, 1989. 13. Nelson, J.L. et al., Microchimerism and HLA-compatible relationships of pregnancy in scleroderma [see comments], Lancet, 351, 559, 1998. 14. Nelson, J.L., Microchimerism and the pathogenesis of systemic sclerosis, Curr. Opin. Rheumatol., 10, 564, 1998.
1391_C34.fm Page 532 Tuesday, November 18, 2003 5:56 PM
532
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
15. Nelson, J.L., Microchimerism and autoimmune disease, N. Engl. J. Med., 338, 1224, 1998 (letter; comment). 16. Johnson, K.L. et al., Fetal cell microchimerism in tissue from multiple sites in women with systemic sclerosis, Arthritis Rheum., 44, 1848, 2001. 17. Maloney, S. et al., Microchimerism of maternal origin persists into adult life, J. Clin. Invest., 104, 41, 1999. 18. Levi-Schaffer, F. et al., Effect of coculture of rodent mast cells with murine chronic graft-versus-host disease (cGVHD)-derived fibroblasts, J. Allergy Clin. Immunol., 89, 501, 1992. 19. Levi-Schaffer, F. and Rubinchik, E., Mast cell/fibroblast interactions, Clin. Exp. Allergy, 24, 1016, 1994. 20. Levi-Schaffer, F. et al., Inhibition of collagen synthesis and changes in skin morphology in murine graft-versus-host disease and tight skin mice: effect of halofuginone, J. Invest. Dermatol., 106, 84, 1996. 21. Levi-Schaffer, F. et al., Nedocromil sodium ameliorates skin manifestations in a murine model of chronic graft-versus-host disease, Bone Marrow Transplant., 19, 823, 1997. 22. Levi-Schaffer, F. et al., Regulation of the functional activity of mast cells and fibroblasts by mononuclear cells in murine and human chronic graft-vs.-host disease, Exp. Hematol., 25, 238, 1997. 23. Rubinchik, E. and Levi-Schaffer, F., Mast cells and fibroblasts: two interacting cells, Int. J. Clin. Lab. Res. 24, 139, 1994. 24. Pines, M. and Nagler, A., Halofuginone: a novel antifibrotic therapy, Gen. Pharmacol., 30, 445, 1998. 25. Chen, B.J., Morris, R.E., and Chao, N.J., Graft-versus-host disease prevention by rapamycin: cellular mechanisms, Biol. Blood Marrow Transplant., 6, 529, 2000. 26. Vierling, J.M. et al., Hepatic lesions in murine chronic graft-versus-host disease to minor histocompatibility antigens. A reproducible model of nonsuppurative destructive cholangitis, Transplantation, 48, 717, 1989. 27. Ilan, Y. et al., Induction of oral tolerance in splenocyte recipients toward pretransplant antigens ameliorates chronic graft versus host disease in a murine model, Blood, 95, 3613, 2000. 28. Nagler, A. et al., Oral tolerization ameliorates liver disorders associated with chronic graft versus host disease in mice, Hepatology, 31, 641, 2000. 29. Mayo, M.J. et al., Association of clonally expanded T cells with the syndrome of primary biliary cirrhosis and limited scleroderma, Hepatology, 29, 1635, 1999. 30. Howell, C.D. et al., Liver T cell subsets and adhesion molecules in murine graft-versus-host disease, Bone Marrow Transplant., 16, 139, 1995. 31. Li, J., Helm, K., and Howell, C.D., Contributions of donor CD4 and CD8 cells to liver injury during murine graft-versus-host disease, Transplantation, 62, 1621, 1996. 32. Howell, C.D. et al., Biased liver T cell receptor V beta repertoire in a murine graft-versus-host disease model, J. Immunol., 155, 2350, 1995. 33. Levy, S. et al., Parotid salivary gland dysfunction in chronic graft-versus-host disease (cGVHD): a longitudinal study in a mouse model, Bone Marrow Transplant., 25, 1073, 2000. 34. McCormick, L.L. et al., Anti-TGF-beta treatment prevents skin and lung fibrosis in murine sclerodermatous graft-versus-host disease: a model for human scleroderma, J. Immunol., 163, 5693, 1999. 35. Zhang, Y. et al., Murine sclerodermatous graft-versus-host disease, a model for human scleroderma: cutaneous cytokines, chemokines, and immune cell activation, J. Immunol., 168, 3088, 2002. 36. Zhang, Y., McCormick, L.L., and Gilliam, A.C., Latency-associated peptide prevents skin fibrosis in sclerodermatous graft-versus-host disease, a model for human scleroderma., J.. Invest. Dermatol., in press. 37. Zhang, Y. and Gilliam, A.C., Animal models for scleroderma: an update, Curr. Rheumatol. Rep., 4, 150, 2002. 38. Gilliam, A.C. and Murphy, G.F., Cellular pathology of cutaneous graft-versus-host disease, in Graft versus Host Disease, 2nd ed., Burakoff, S.J. et al., Eds., Marcel Dekker, Inc., New York, 1997, p. 291. 39. Chosidow, O. et al., Sclerodermatous chronic graft-versus-host disease. Analysis of seven cases, J. Am. Acad. Dermatol., 26, 49, 1992. 40. Charley, M.R., Gilliam, J.N., and Sontheimer, R.D., Ultraviolet B exposure converts murine lichenoid graft-vs-host disease (GVHSD) into sclerotic GVHSD, J. Invest. Dermatol., 80, 328, 1983.
1391_C34.fm Page 533 Tuesday, November 18, 2003 5:56 PM
INDUCTION BY TRANSFER OF CELLULAR IMMMUNITY
533
41. Johnson, R.W., Tew, M.B., and Arnett, F.C., The genetics of systemic sclerosis, Curr. Rheumatol. Rep., 4, 99, 2002. 42. Seibold, J.R., Giorno, R.C., and Claman, H.N., Dermal mast cell degranulation in systemic sclerosis, Arthritis Rheum., 33, 1702, 1990. 43. Distler, O. et al., Expression of RANTES in biopsies of skin and upper gastrointestinal tract from patients with systemic sclerosis, Rheumatol. Int., 19, 39, 1999. 44. Hasegawa, M., Sato, S., and Takehara, K., Augmented production of chemokines (monocyte chemotactic protein-1 (MCP- 1), macrophage inflammatory protein-1alpha (MIP-1alpha) and MIP-1beta) in patients with systemic sclerosis: MCP-1 and MIP-1alpha may be involved in the development of pulmonary fibrosis, Clin. Exp. Immunol., 117, 159, 1999. 45. White, B., Immune abnormalities in systemic sclerosis, Clin. Dermatol., 12, 349, 1994. 46. Luzina, I.G. et al., Gene expression in bronchoalveolar lavage cells from scleroderma patients, Am. J. Respir. Cell Mol. Biol., 26, 549, 2002. 47. Rose, N.R. and Leskovsek, N., Scleroderma: immunopathogenesis and treatment, Immunol. Today, 19, 499, 1998. 48. White, B., Immunopathogenesis of systemic sclerosis, Rheum. Dis. Clin. North Am., 22, 695, 1996. 49. Yurovsky, V.V., The repertoire of T-cell receptors in systemic sclerosis, Crit. Rev. Immunol., 15, 155, 1995. 50. Valentini, G. et al., Peripheral blood T lymphocytes from systemic sclerosis patients show both Th1 and Th2 activation, J. Clin. Immunol., 21, 210, 2001. 51. Chen, W. and Howell, C.D., Oligoclonal expansion of T cell receptor V beta 2 and 3 cells in the livers of mice with graft-versus-host disease, Hepatology, 35, 23, 2002. 52. Kraling, B.M., Maul, G.G., and Jimenez, S.A., Mononuclear cellular infiltrates in clinically involved skin from patients with systemic sclerosis of recent onset predominantly consist of monocytes/macrophages, Pathobiology, 63, 48, 1995. 53. Szekanecz, Z. et al., Chemokines in rheumatoid arthritis, Springer Semin. Immunopathol., 20, 115, 1998. 54. Szekanecz, Z. et al., Temporal expression of inflammatory cytokines and chemokines in rat adjuvantinduced arthritis, Arthritis Rheum., 43, 1266, 2000. 55. Palframan, R.T. et al., Inflammatory chemokine transport and presentation in HEV: a remote control mechanism for monocyte recruitment to lymph nodes in inflamed tissues, J. Exp. Med., 194, 1361, 2001 (see comments). 56. Peltonen, J. et al., Evaluation of transforming growth factor b and type I procollagen gene expression in fibrotic skin diseases by in situ hybridization, J. Invest. Dermatol., 94, 365, 1990. 57. Shi-wen, X. et al., Autocrine overexpression of CTGF maintains fibrosis: RDA analysis of fibrosis genes in systemic sclerosis, Exp. Cell Res., 259, 213, 2000. 58. Denton, C.P. and Abraham, D.J., Transforming growth factor-beta and connective tissue growth factor: key cytokines in scleroderma pathogenesis, Curr. Opin. Rheumatol., 13, 505, 2001. 59. LeRoy, E.C., Increased collagen synthesis by scleroderma skin fibroblasts in vitro, J. Clin. Invest., 54, 880, 1974. 60. Young-Min, S.A. et al., Serum TIMP-1, TIMP-2, and MMP-1 in patients with systemic sclerosis, primary Raynaud’s phenomenon, and in normal controls, Ann. Rheum. Dis., 60, 846, 2001. 61. Schrier, D.J., Kunkel, R.G., and Phan, S.H., The role of strain variation in murine bleomycin-induced pulmonary fibrosis, Am. Rev. Respir. Dis., 127, 63, 1983. 62. Hoyt, D.G. and Lazo, J.S., Alterations in pulmonary mRNA encoding procollagens, fibronectin and transforming growth factor-beta precede bleomycin-induced pulmonary fibrosis in mice, J. Pharmacol. Exp. Ther., 246, 765, 1988. 63. Brass, D.M., Tsai, S.Y., and Brody, A.R., Primary lung fibroblasts from the 129 mouse strain exhibit reduced growth factor responsiveness in vitro, Exp. Lung Res., 27, 639, 2001. 64. Rube, C.E. et al., Dose-dependent induction of transforming growth factor beta (TGF-beta) in the lung tissue of fibrosis-prone mice after thoracic irradiation, Int. J. Radiat. Oncol. Biol. Physics, 47, 1033, 2000. 65. Werth, V.P. et al., Association of a promoter polymorphism of tumor necrosis factor-alpha with subacute cutaneous lupus erythematosus and distinct photoregulation of transcription, J. Invest. Dermatol., 115, 726, 2000.
1391_C34.fm Page 534 Tuesday, November 18, 2003 5:56 PM
534
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
66. Korngold, R. and Sprent, J., Graft-versus-host disease in experimental allogeneic bone marrow transplantation, Proc. Soc. Exp. Biol. Med., 197, 12, 1991. 67. Korngold, R., Pathophysiology of graft-versus-host disease directed to minor histocompatibility antigens, Bone Marrow Transplant., 7 (Suppl. 1), 38, 1991. 68. Hammerberg, C., Duraiswamy, N., and Cooper, K.D., Temporal correlation between UV radiation locally-inducible tolerance and the sequential appearance of dermal, then epidermal, class II MHC+CD11b+ monocytic/macrophagic cells, J. Invest. Dermatol., 107, 755, 1996. 69. Murphy, G.F. et al., Characterization of target injury of murine acute graft-versus-host disease directed to multiple minor histocompatibility antigens elicited by either CD4+ or CD8+ effector cells, Am. J. Pathol., 138, 983, 1991. 70. McCormick, L.L. et al., Activated macrophages express scavenger receptors in skin of mice with sclerodermatous graft versus host disease, a model for scleroderma, J. Invest. Dermatol., 117, 443, 2001. 71. Letterio, J.J. and Roberts, A.B., Regulation of immune responses by TGF-beta, Annual Rev. Immunol., 16, 137, 1998. 72. Roberts, A.B., Molecular and cell biology of TGF-b, Minor Electrolyte Metab., 24, 111, 1998.
1391_C35.fm Page 535 Tuesday, November 18, 2003 5:58 PM
CHAPTER
35
Experimental Mouse Model of Scleroderma: Induction by Bleomycin Toshiyuki Yamamoto
CONTENTS I. II. III. IV. V.
History ................................................................................................................................535 Animals ..............................................................................................................................536 Disease Induction...............................................................................................................537 Course of Disease ..............................................................................................................538 Assessment of Disease.......................................................................................................538 A. Clinical Manifestation ...............................................................................................538 B. Histopathological Examination .................................................................................538 C. Immunopathological Data .........................................................................................539 D. Biochemical Data ......................................................................................................539 E. Serum Cytokine .........................................................................................................539 VI. Therapeutic Responses.......................................................................................................541 VII. Expert Experience ..............................................................................................................542 VIII. Conclusion..........................................................................................................................542 References ......................................................................................................................................543
I. HISTORY Scleroderma is a connective tissue disease which shows fibrosis of the skin [1,2]. Although the pathogenesis of scleroderma is not fully elucidated as yet, it is characterized by excessive accumulation of extracellular matrix (ECM) in the skin and various internal organs, vascular injury, and immunological abnormalities [3]. In early stages of scleroderma, activated fibroblasts in the affected areas produce high amounts of collagen [4–6]. Histological analysis of the initial stage of scleroderma reveals perivascular infiltrates of mononuclear cells in the dermis, which is associated with increased collagen synthesis in the surrounding fibroblasts [7,8]. A number of studies have demonstrated the crucial role of several fibrogenic cytokines released from immunocytes infiltrating in the affected sites for initiating and/or leading to the sequential events of fibrosis [9–12].
0-8493-1391-0/04/$0.00+$1.50 © 2004 by CRC Press LLC
535
1391_C35.fm Page 536 Tuesday, November 18, 2003 5:58 PM
536
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Although animal models are useful to provide clues and therapeutic interventions for various human diseases, animal models that exhibit al aspects of systemic sclerosis (SSc) are not currently available. Bleomycin is produced by Streptomyces verticullis, and is a frequently used antitumor antibiotic for various kinds of cancers [13]. Lung fibrosis is a well-known side effect of bleomycin. In addition, cutaneous changes including fibrosis, hyperpigmentation, alopecia, gangrene, edema, Raynaud’s phenomenon, and “flagellate” erythema (scratch dermatitis) have been described [14–17]. Scleroderma is also reported to be developed in malignancy-bearing patients after bleomycin therapy [18–20]. Bleomycin-induced pulmonary fibrosis, an established rodent model that has been extensively investigated [21–26], resembles human lung fibrosis histologically and biochemically. Rodents develop pulmonary fibrosis when given bleomycin by intratracheal or intravenous administration or by 1-week continuous infusion [27,28]. In these animals, the amounts of lung ECM were found to be increased [29–31]. In vitro, bleomycin up-regulates collagen mRNA expression in human lung or dermal fibroblasts [32,33]. Bleomycin was also shown to induce alveolar [34,35] as well as peripheral [36] macrophages to produce growth stimulatory factors for fibroblasts. Recent in vitro findings suggest that lung fibroblasts show chemotactic activity for neutrophils and monocytes in response to bleomycin [37]. Previously, Mountz et al. [38] reported that rats injected repeatedly with sublethal doses of bleomycin over a 58-week period developed severe dermal fibrosis similar to those found in human scleroderma, with structural abnormalities of collagen fibers. We have recently established a mice model for scleroderma by repeated local treatment of bleomycin [39–43]. Daily injections of bleomycin induced dermal sclerosis, but not fibrosis, in Balb/c mice after 4 weeks. Histological examination demonstrated thickened collagen bundles, deposition of homogenous materials in the bleomycin-injected skin with cellular infiltrates, which mimicked the histological features of human scleroderma.
II. ANIMALS Mice were usually used at 4 to 6 weeks old. Dermal sclerosis can be induced after 4 weeks of injections of bleomycin in various mice strains, although there is some variation among strains in the intensity of dermal sclerosis [40]. There is no difference of the intensity of dermal sclerosis between males and females. In particular, C3H/He, DBA2, B10.D2, and B10.A mice developed intense dermal sclerosis characterized by deposition of homogenous materials in the dermis and thickened collagen bundles. In A/J, C3H/He, B10.A, and B10.D2 mice, dermal thickness showed a more than 2.5-fold increase, as compared with phosphate buffered saline (PBS) treatment. On the contrary, dermal thickness was not strongly induced in C57BL/6J strain. Recent findings suggest that mast cells are important initiators of SSc [44], since mast cells are increased in number in the lesional skin of early stage scleroderma [45,46]. Mast cells produce a number of cytokines, growth factors, and mediators that are capable of activating fibroblasts or endothelial cells [47]. Furthermore, mast cells abundantly produce chemokines, including RANTES, macrophage inflammatory protein-1a (MIP-1a), and monocyte chemoattractant protein1 (MCP-1) [48]. In particular, MCP-1 is shown to up-regulate type I collagen gene expression in cultured fibroblasts [49], suggesting an important involvement in fibrosis. In tight skin (Tsk) mice, mast cells are abundant in the thickened dermis and exhibit prominent degranulation [50]. A decrease in fibrosis associated with inhibition of mast cell degranulation by cromolyn and ketotifen was also reported [50,51]. In this model, mast cells were increased in number in parallel with the induction of dermal sclerosis. Also, a marked degranulation was found in particular at the early phase, with elevated plasma histamine levels [39]. On the contrary, bleomycin could induce dermal sclerosis even in genetically mast cell-deficient WBB6F1-W/WV mice similarly to control littermates [40].
1391_C35.fm Page 537 Tuesday, November 18, 2003 5:58 PM
EXPERIMENTAL MOUSE MODEL OF SCLERODERMA: INDUCTION BY BLEOMYCIN
537
Although transforming growth factor-b (TGF-b), a key fibrogenic cytokine, is produced by mast cells, macophages are the main source of TGF-b. TGF-b can be detected immunohistologically on the infiltrating cells in both WBB6F1+/+ and WBB6F1-W/WV mice [40]. We thus speculate that mast cells may be associated but not necessary for the induction of dermal sclerosis. Mast cells may be not the sole pathway to the induction of dermal sclerosis. Mononuclear cell infiltrates in the skin is one of the most characteristic histological features in early scleroderma [52], which is suggested to secret cytokines stimulating ECM production. Moreover, infiltrating T lymphocytes, predominately CD4+, are also the major lymphocytes seen in the involved skin of scleroderma. As in human SSc, T cells, macrophages and mast cells are present in increased numbers or an activated state in involved tissues in animal models of SSc. In vivo T-cell depletion with anti-T-cell antibodies has been shown to either reduce or completely abrogate bleomycin-induced pulmonary fibrosis [53,54]. On the other hand, results of athymic nude mice lacking functional T lymphocytes have been controversial. One study showed histologically similar fibrosis in nude, euthymic mice after bleomycin treatment [55], whereas another study showed that bleomycin was not fibrogenic in nude mice [56]. On the contrary, a recent study demonstrated that bleomycin-induced lung fibrosis occurred in C57BL/6 severe combined immunodeficient (SCID) and (C57BL/6¥CB.17)F1 SCID mice comparable to that seen in wild-type mice, suggesting that initial induction of lung fibrosis is lymphocyte independent [57]. Our results using SCID mice confirmed that dermal sclerosis can be induced even in SCID mice comparable to control mice, suggesting that bleomycin-induced scleroderma is independent of T cells [42]. Furthermore, we have confirmed that dermal sclerosis can be induced also in nude mice (T.Y., unpublished data, 2002). These results suggest that dermal sclerosis can be inducible without the involvement of immunocytes. It is shown that bleomycin directly affects on lung fibroblasts to up-regulate collagen synthesis in vitro [32]. We also indicated that bleomycin up-regulates mRNA expressions of type I collagen and fibronectin, as well as fibrogenic cytokines in cultured normal skin fibroblasts [33]. In situ hybridization showed that cultured fibroblasts incubated with bleomycin expressed a1(I) collagen transcripts more intensely, as compared with untreated fibroblasts (Figure 35.1). Bleomycin exposure to rat lung fibroblast cultures results in elevated TGF-b mRNA synthesis, TGF-b mRNA steady-state levels, and TGF-b protein [58]. Increased TGF-b mRNA transcription is followed by TGF-b mRNA accumulation and TGF-b protein, which is followed by increased procollagen gene transcription [58]. A recent study showed that TGF-b is a mediator of the fibrotic effect of bleomycin at the transcriptional level and that the TGF-b response element is required for bleomycin stimulation of the pro a1(I) collagen promoter [59]. Taken together, these results show that induction of dermal sclerosis in this model can be mediated by fibrogenic cytokines released from various immunocytes, or by direct effect of bleomycin increasing ECM production, which is in part mediated by TGF-b. III. DISEASE INDUCTION Bleomycin is dissolved into PBS, and sterilized by filtration. Dermal sclerosis was induced by subcutaneous injections of 100 ml of bleomycin into the shaved back skins with 27-gauge needles every day for about 4 weeks. The concentrations of bleomycin used in the injection were ranging from 100 mg/ml to 1 mg/ml. Histopathological examination revealed definite dermal sclerosis characterized by deposition of homogenous materials in the thickened dermis with cellular infiltrates. Masson trichrome stain showed dense deposition of collagen in the thickened dermis. Dermal thickness was gradually increased, and significantly increased up to two-fold when the sclerosis was developed. Furthermore, in some strains, epidermal thickness was also induced as well [41].
1391_C35.fm Page 538 Tuesday, November 18, 2003 5:58 PM
538
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
B
A
C
Figure 35.1
In situ expression of a1(I) collagen in cultured human skin fibroblasts. (A) Fibroblasts were hybridized with control sense probe and (B) antisense probe. (C) Fibroblasts stimulated with bleomycin for 24 hours were hybridized with antisense probe.
IV. COURSE OF DISEASE Dermal sclerosis is gradually induced and histological sclerosis was observed after 4 weeks of treatment with bleomycin. Other than skin, lung fibrosis with thickened alveolar walls with cellular infiltrates was also observed early on. However, the kidney, liver, and heart were not involved. Cutaneous changes were relatively localized to around the injected site skin, and sclerotic changes were not induced in the remote region, such as fingers or abdominal skin. The induced sclerotic changes remained at least 6 weeks, when untreated.
V. ASSESSMENT OF DISEASE A. Clinical Manifestation Clinically, dermal sclerosis at the site of injections is not significant by cross inspection. B. Histopathological Examination Histological examination showed the changes with thickened and homogenous collagen bundles and cellular infiltrates in the dermis in mice treated with bleomycin, compared with those treated with PBS (Figure 35.2A and B). Mononuclear cell infiltration was observed in the dermis, which mainly consisted of CD4+ T cells and macrophages (Figure 35.2C). Thickening of vascular walls
1391_C35.fm Page 539 Tuesday, November 18, 2003 5:58 PM
EXPERIMENTAL MOUSE MODEL OF SCLERODERMA: INDUCTION BY BLEOMYCIN
539
was also found in the lower dermis (Figure 35.2D). Toluidine blue stain demonstrated increased numbers of mast cells around sclerotic lesions. In particular, degranulation was prominent an early phase (1 to 2 weeks) (Figure 35.2E). Myofibroblasts have features that intermediate between those of the fibroblasts and smooth muscle cells. They are observed in the wound healing [60,61] or tissue fibrotic process, including liver cirrhosis [62,63], kidney [64], lung [65], or skin [66]. It is shown that scleroderma skin expresses a-smooth muscle actin (a-SMA), suggesting myofibroblastic phenotype [67]. Myofibroblasts are shown to persist in scleroderma fibroblasts cultures [67]. TGF-b and platelet-derived growth factor (PDGF), fibrogenic cytokines important in fibrosis process, induce the expression of a-SMA by fibroblasts [68,69]. In our model, a-SMA–positive myofibroblast-like cells were observed in the dermis at 1 week, and gradually increased in parallel with the induction of dermal sclerosis [43]. Mononuclear infiltration in the lung was also found, and alveolar wall thickening was observed in the sclerotic stages (Figure 35.2F). Expression of type I collagen was enhanced in the sclerotic skin following bleomycin treatment (Figure 35.2G). C. Immunopathological Data TGF-b plays an important role in the fibrotic process [70]. TGF-b, which is found abundantly in platelets and released from activated macrophages or lymphocytes, is a strong chemoattractant for fibroblasts [71]. TGF-b increases the synthesis of collagen type I and type III or fibronectin by many cell types in vitro [72–74]. In addition, TGF-b modulates cell-matrix adhesion protein receptors [75,76]. TGF-b also regulates the production of proteins that can modify the ECM by proteolytic action, such as plasminogen activator, an inhibitor of plasminogen, or procollagenase [77–79]. TGF-b is capable of stimulating its own synthesis by fibroblasts through autoinduction [80]. Thus, maintenance of increased TGF-b production may lead to the progressive deposition of ECM, resulting in fibrosis. TGF-b induces rapid fibrosis and angiogenesis when injected subcutaneously into newborn mice [81]. Thus, multiple actions of TGF-b are supportive of the notion that TGF-b plays a key role in the pathogenesis of scleroderma. Bleomycin induces alveolar macrophages to secrete TGF-b [82]. In this model, immunohistological analysis showed that TGF-b was detected on the infiltrating cells, which were predominantly composed of macrophages, as well as fibroblasts at the sclerotic stage following bleomycin treatment. TGF-b1 and TGF-b2 mRNA expression were also detected in the lesional skin. In addition, recent findings show that scleroderma fibroblasts express elevated levels of TGFb receptor type I and type II mRNA, which correlate with elevated a2(I) collagen mRNA levels, suggesting that activation in scleroderma fibroblasts is, in part, due to an autocrine TGF-b loop [83]. We have recently observed increased immunohistological localization of TGF-b receptor I and II in sclerotic fibroblasts in the bleomycin-treated skin (T.Y., unpublished data, 2002). D. Biochemical Data Hydroxyproline content in the skin was significantly increased as compared with control PBStreated skin in parallel with the development of dermal sclerosis. SDS-PAGE showed up-regulation of type I collagen in the sclerotic skin. Northern blot analysis revealed up-regulation of type I collagen mRNA expression in the sclerotic skin after bleomycin treatment [39]. Of interest, autoantibody was detected in the serum after repeated bleomycin treatment [39]. E. Serum Cytokine Recent hypotheses have indicated that an imbalance exists between the type 1 and type 2 cytokine response in the pathogenesis of scleroderma. Type 2 cytokines include interleukin (IL)-4, IL-5, IL-10, IL-13 and MCP-1. A recent report shows that most CD4+ T-cell clones generated from
1391_C35.fm Page 540 Tuesday, November 18, 2003 5:58 PM
540
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
A
C
F
Figure 35.2
B
D
E
G
Histopathological evaluation of dermal sclerosis induced by bleomycin. Mice were treated with (A) PBS or (B) bleomycin for 4 weeks. Note marked dermal sclerosis with thickened and homogeneous collagen bundles in the dermis. (C) Cellular infiltrates of macrophages stained for BM-8. (D) Thickened vascular walls in the lower dermis. (E) Marked degranulation of mast cells shown by toluidine blue stain. (F) Lung sections showing thickened alveolar walls with cellular infiltrates. (G) Immunohistological expression of type I collagen in bleomycin-treated mice.
scleroderma skin biopsies exhibited type 2 cytokine profiles [84]. IL-4, which is produced by activated memory T-cells and mast cells, is known to promote fibroblast proliferation, collagen gene expression, and collagen synthesis [85–87]. Increased IL-4 and IL-6 levels are detected in the sera of SSc patients [88]. Serum in the majority of SSc patients showed elevated levels of CD30 [84], which is expressed on activated type 2 cells. In our model, serum IL-4, IL-6, and tumor necrosis factor-a (TNF-a) levels were significantly elevated following bleomycin treatment.
1391_C35.fm Page 541 Tuesday, November 18, 2003 5:58 PM
EXPERIMENTAL MOUSE MODEL OF SCLERODERMA: INDUCTION BY BLEOMYCIN
541
VI. THERAPEUTIC RESPONSES As mentioned above, TGF-b is suggested to play a crucial role in fibrosis. Indeed, TGF-b mRNA is elevated in the lesional skin of SSc and other fibrotic conditions [89–91], and also shown to co-localize with type I collagen in scleroderma skin lesions [89]. Recent studies have demonstrated that blockade of TGF-b by either antibody against TGF-b or soluble TGF-b receptor inhibits the development of tissue fibrosis in experimental animal models [92–96]. Bleomycin up-regulates TGF-b1 mRNA expression in cultured rat lung [32] or human skin fibroblasts [33]. This bleomycin sensitivity requires the activation of a specific TGF-b promoter-binding protein [59]. We observed increased expression of TGF-b at protein and mRNA levels in the lesional skin following bleomycin treatment, and further demonstrated that systemic administration of anti-TGF-b antibody, which cross-reacts with TGF-b1 and -b2, in combination with local bleomycin treatment suppressed the development of scleroderma [92]. However, on account of the problem of half-life, repeated injections of TGF-b antibody were required. Gene therapy targeting TGF-b signaling may be expected. Interferons (IFNs), in particular IFN-g, cause potent inhibition of collagen production, which correlates with reduction in the corresponding steady-state mRNA levels, in cultured skin fibroblasts [97–101]. In vitro study showed that IFN-g decreased TGF-b-induced a-SMA expression in palatal fibroblasts, as well as alteration of morphology [102]. In this model, systemic administration of IFN-g reduced dermal sclerosis even after the onset of scleroderma [103]. We speculate that IFNg was effective because it was administered just after the final treatment of bleomycin. On the other hand, IFN-a did not suppress the dermal sclerosis induced by bleomycin, which is consistent with the in vitro effect [98] and clinical efficacy [104]. IFN-g is a powerful type 1 inducer of cellular immunity that may indirectly contribute to the improvement of the imbalance of the type 2 shift. A recent report has shown that IFN-g inhibits the TGF-b–induced phosphorylation of Smad3 and the accumulation of Smad3 in the nucleus, whereas it induces the expression of Smad7, which prevents the interaction of Smad3 with the TGF-b receptor [105]. Bleomycin is known to generate reactive oxygen species (ROS), such as superoxide and hydroxyl radicals. ROS can cause several abnormalities such as endothelial cell damage or enhanced platelet activation, leading to up-regulation of expression of adhesion molecules or secretion of inflammatory or fibrogenic cytokines including PDGF and TGF-b. Other effects of oxygen radicals include the stimulation of skin fibroblast proliferation at low concentrations [106], and the production of increased amounts of collagen [107]. A recent study has demonstrated that several of the autoantigens targeted by scleroderma autoantibodies are fragmented in the presence of ROS and specific metals such as iron or copper [108]. They suggest that tissue ischemia generates ROS, which induces the fragmentation of specific autoantigens. These findings support the notion that scleroderma is characterized by ischemia-reperfusion injury, overproduction of ROS is commonly found in scleroderma patients with active disease [109], and scleroderma is occasionally associated with a variety of environmental toxins or organic solvents. Therefore, a reduction of free radical formation may contribute to the decrease of collagen content by inhibition of proline hydroxylation, which leads to the improvement of scleroderma. We observed the inhibitory effect of lecithinized superoxide dismutase (SOD), which shows high tissue accumulation and long half-life in blood, on bleomycin-induced scleroderma [110]. On the contrary, postonset administration of SOD could not attenuate the dermal sclerosis. Recent studies demonstrate that halofuginone, an alkaloid originally isolated from the plant Dichroa febrifuga, suppressed avian skin collagen synthesis in vivo [111]. In vitro, halofuginone attenuates collagen synthesis, as well as collagen gene expression in avian and murine skin fibroblasts [112]. Halofuginone specifically inhibits a1(I) collagen gene expression without affecting the synthesis of other types of collagen such as types II and III [112,113]. Halofuginone prevents skin fibroblasts in murine models of scleroderma, the chronic GVHD and the Tsk mouse [114].
1391_C35.fm Page 542 Tuesday, November 18, 2003 5:58 PM
542
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
On the contrary, we could not confirm the efficacy of this agent on bleomycin-induced scleroderma in our system [115].
VII. EXPERT EXPERIENCE Both intradermal as well as subcutaneous bleomycin injections can induce dermal sclerosis, because mouse skin is very thin. Besides daily injections, alternate day administration can also induce dermal sclerosis.
VIII. CONCLUSION We described here the histologic, immunologic, and biochemical characteristics of an experimental mouse model for scleroderma induced by bleomycin. Table 35.1 summarizes various aspects in this model. Skin sclerosis was induced only at the injected site skin in this model. In addition, gastrointestinal, cardiac, hepatic and renal involvement were also absent, although lung fibrosis was observed. The possible mechanisms of bleomycin-induced scleroderma are speculated in Figure 35.3. The induction of dermal sclerosis is, in part, mediated by fibrogenic cytokines, that is, TGF-b, derived from immunocytes. On the other hand, this experimental model may be specific for bleomycin, because of its direct effect on ECM synthesis in fibroblasts that modulate immune cell behavior by conditioning the local cellular and cytokine microenvironment [116]. To explore the pathogenesis of this model may enhance our understanding of the pathogenesis of human scleroderma, although this model may represent a specific subtype of scleroderma compulsorily induced by bleomycin. Animal models for scleroderma present promising tools for future studies of cellular and molecular mechanisms of this disease, and for the evaluation of new therapeutic interventions such as gene therapy.
Table 35.1 Characterization of Bleomycin-Induced Scleroderma Feature Scleroderma Sclerodactyly Epidermal proliferation Dermal sclerosis Dermal thickness Thickened collagen fibers Collagen deposition Thickened vascular wall Mononuclear cell infiltrate Mast cell increase Visceral involvement Lung Increased tissue collagen Increased procollagen gene expression Myofibrotic change Autoantibody
Bleomycin-Induced Scleroderma + + + + + + + + + + + + +
1391_C35.fm Page 543 Tuesday, November 18, 2003 5:58 PM
EXPERIMENTAL MOUSE MODEL OF SCLERODERMA: INDUCTION BY BLEOMYCIN
543
Bleomycin
T cell
Th1/2
Mast cell
Macrophage Endothelial cell
B cell
adhesion molecule
bFGF
TGF-β autoantibody
bFGF
TGF-β
IL-1 TNF-α MCP-1
TGF-β
Fibroblast altered gene expression oxidant damage
Integrin TGF-β CTGF PDGF Extracellular matrix
Proliferation Figure 35.3
Schematic design of the role of bleomycin in the pathogenesis of cutaneous fibrosis/sclerosis.
REFERENCES 1. Krieg, T. and Meurer, M., Systemic scleroderma. Clinical and pathophysiological aspects, J. Am. Acad. Dermatol., 18, 457, 1988. 2. LeRoy, E.C. et al., Scleroderma (systemic sclerosis): classification, subsets and pathogenesis, J. Rheumatol., 15, 202, 1988. 3. Jimenez, S.A. and Christner, P., Animal models of systemic sclerosis, Clin. Dermatol., 12, 425, 1994. 4. Bostein, G.R., Sherer, G.K., and LeRoy, E.C., Fibroblast selection in scleroderma. An alternative model of fibrosis, Arthritis Rheum., 25, 189, 1982. 5. Krieg, T. et al., Collagen synthesis by scleroderma fibroblasts, Ann. N. Y. Acad. Sci., 460, 375, 1986. 6. Mauch, C. et al., Control of fibrosis in systemic scleroderma, J. Invest. Dermatol., 100, 92, 1993. 7. Fleischmajer, R., Perlish, J.S., and Reeves, J.R.T., Cellular infiltrates in scleroderma skin, Arthritis Rheum., 20, 975, 1977. 8. Scharffetter, K., Lankat-Buttgereit, B., and Krieg, T., Localization of collagen mRNA in normal and scleroderma skin by in-situ hybridization, J. Clin. Invest.,Eur. J. Clin. Invest., 18, 9, 1988. 9. Fagundus, D.M. and LeRoy, E.C., Cytokines and systemic sclerosis, Clin. Dermatol., 12, 407, 1994. 10. Postlethwaite, A.E., Connective tissue metabolism including cytokine in scleroderma, Curr. Opin. Rheumatol., 7, 535, 1995. 11. Kovacs, E.J. and DiPietro, L.A., Fibrogenic cytokines and connective tissue production, FASEB J., 8, 854, 1994.
1391_C35.fm Page 544 Tuesday, November 18, 2003 5:58 PM
544
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
12. LeRoy, E.C. et al., A strategy for determining the pathogenesis of systemic sclerosis. Is transforming growth factor the answer? Arthritis Rheum., 32, 817, 1989. 13. Umezawa, H. et al., New antibiotics, bleomycin A and B, J. Antibiot., 19, 200, 1966. 14. Cohen, I.S. et al., Cutaneous toxicity of bleomycin in therapy, Arch. Dermatol., 107, 553, 1973. 15. Nixon, D.W., Pirozzi, D., and York, R.M., Dermatologic changes after systemic cancer therapy, Cutis, 27, 181, 1981. 16. Yamamoto, T., Yokozek,i H., and Nishioka, K., Dermal sclerosis in the lesional skin of ‘flagellate’ erythema (scratch dermatitis) induced by bleomycin, Dermatology, 297, 399, 1998. 17. Surville-Barland, J. et al., Bleomycin-induced digital gangrene, Eur. J. Dermatol., 8, 221, 1998. 18. Finch, W.R. et al., Bleomycin-induced scleroderma, J. Rheumatol., 7, 651, 1980. 19. Kerr, L.D. and Spiera, H., Scleroderma in association with the use of bleomycin: a report of 3 cases, J. Rheumatol., 19, 294, 1992. 20. Passiu, G. et al., Bleomycin-induced scleroderma: report of a case with a chronic course rather than the typical acute/subacute self-limiting form, Clin. Rheumatol., 18, 422, 1999. 21. Snider, G.L. et al., , E.C.Chronic interstitial pulmonary fibrosis produced in hamsters by endotracheal bleomycin, Am. Rev. Respir. Dis., 117, 289, 1978. 22. Zia, S., Hyde, D.M., and Giri, S.N., Development of a bleomycin hamster model of subchronic lung fibrosis, Pathology, 24, 155, 1992. 23. Thrall, R.S. et al., Bleomycin-induced pulmonary fibrosis in the rat: inhibition with indomethacin, Am. J. Pathol., 95, 117, 1979. 24. Aso, Y., Yoneda, K., and Kikkawa, Y., Morphological and biological study of pulmonary changes induced by bleomycin in mice, Lab. Invest., 35, 558, 1976. 25. Chandler, D.B., Hyde, D.M., and Giri, S.N., Morphometric estimates of infiltrative cellular changes during the development of bleomycin-induced pulmonary fibrosis in hamsters, Am. J. Pathol., 112, 170, 1983. 26. Bowden, D.H., Unraveling pulmonary fibrosis, the bleomycin model, Lab. Invest., 50, 487, 1984. 27. Harrison, J.H. and Lazo, J.S., High dose continuous infusion of bleomycin in mice: A new model for drug-induced pulmonary fibrosis, J. Pharmacol. Exp. Ther., 243, 1185, 1987. 28. Lindenschmidt, R.C. et al., Intratracheal versus intravenous administration of bleomycin in mice: acute effects, Toxicol. Appl. Pharmacol., 85, 69, 1986. 29. Kelley, J. et al., Bleomycin selectively elevates mRNA levels for procollagen and fibronectin following acute lung injury, Biochem. Biophys. Res. Commun., 131, 836, 1985. 30. Westergren-Thorsson, G. et al., Altered expression of small proteoglycans, collagen, and transforming growth factor-b1 in developing bleomycin-induced pulmonary fibrosis in rats, J. Clin. Invest., 92, 632, 1993. 31. Raghow, R. et al., Profiles steady state levels of messenger RNAs coding for type I procollagen, elastin, and fibronectin in hamster lungs undergoing bleomycin-induced interstitial pulmonary fibrosis, J. Clin. Invest., 76, 1733, 1985. 32. Clark, J.C., Starcher, B.C., and Uitto, J., Bleomycin-induced synthesis of type I procollagen by human lung skin fibroblasts in culture, Biochim. Biophys. Acta, 631, 359, 1980. 33. Yamamoto, T., Eckes, B., and Krieg, T., Bleomycin increases steady-state levels of type I collagen, fibronectin and decorin gene expression in human skin fibroblasts, Arch. Dermatol. Res., 292, 556, 2000. 34. Denholm, E.M. and Phan, S.H., The effects of bleomycin on alveolar macrophage growth factor secretion, Am. J. Pathol., 134, 355, 1989. 35. Kovacs, E.J. and Kelley, J., Secretion of macrophage-derived growth factor during acute lung injury by bleomycin, J. Leukoc. Biol., 37, 1, 1985. 36. Yamamoto, T., Katayama, I., and Nishioka, K., Fibroblast proliferation by bleomycin stimulated peripheral blood mononuclear cell factors, J. Rheumatol., 26, 609, 1999. 37. Takamizawa, A. et al., Bleomycin stimulates lung fibroblasts to release neutrophil and monocyte chemotactic activity, J. Immunol., 162, 6200, 1999. 38. Mountz, J.D. et al., Bleomycin-induced cutaneous toxicity in the rat: analysis of histopathology and ultrastructure compared with progressive systemic sclerosis (scleroderma), Br. J. Dermatol., 108, 679, 1983.
1391_C35.fm Page 545 Tuesday, November 18, 2003 5:58 PM
EXPERIMENTAL MOUSE MODEL OF SCLERODERMA: INDUCTION BY BLEOMYCIN
545
39. Yamamoto, T. et al., Animal model of sclerotic skin. I. Local injections of bleomycin induce sclerotic skin mimicking scleroderma, J. Invest. Dermatol., 112, 456, 1999. 40. Yamamoto, T. et al., Animal model of sclerotic skin. II. Bleomycin induced scleroderma in genetically mast cell deficient WBB6F1-W/WV mice, J. Rheumatol., 26, 2628, 1999. 41. Yamamoto, T. et al., Animal model of sclerotic skin. III: Histopathological comparison of bleomycininduced scleroderma in various mice strains, Arch. Dermatol. Res., 292, 535, 2000. 42. Yamamoto, T. and Nishioka, K., Animal model of sclerotic skin. IV, Induction of dermal sclerosis by bleomycin is T cell independent, J. Invest. Dermatol., 117, 999, 2001. 43. Yamamoto, T. and Nishioka, K., Animal model of sclerotic skin. V, Increased expression of a-smooth muscle actin in fibroblastic cells in bleomycin-induced scleroderma, Clin. Immunol., 102, 77, 2002. 44. Gruber, B.L., Mast cells: accessory cells which potentiate fibrosis, Intern. Rev. Immunol. 12, 259, 1995. 45. Hawkins, R.A. et al., Increased dermal mast cell populations in progressive systemic sclerosis: a link in chronic fibrosis? Ann. Intern. Med., 102, 1182, 1985. 46. Nishioka, K. et al., Mast cell numbers in diffuse scleroderma. Arch. Dermatol., 123, 205, 1987. 47. Galli, S.J., New concepts about the mast cell, N. Engl. J. Med., 328, 1657, 1989. 48. Selvan, R.S., Butterfield, J.H., and Krangel, M.S., Expression of multiple chemokine genes by human mast cells, J. Biol. Chem., 269, 13893, 1994. 49. Gharaee-Kermani, M., Denholm, E.M., and Phan, S.H., Costimulation of fibroblast collagen and transforming growth factor b1 gene expression by monocyte chemoattractant protein-1 via specific receptors, J. Biol. Chem., 271, 17779, 1996. 50. Walker, M., Harley, R., and LeRoy,, E.C., Inhibition of fibrosis in Tsk mice by blocking mast cell degranulation, J. Rheumatol., 14, 299, 1987. 51. Walker, M., Harley, R., and LeRoy,, E.C., Ketotifen prevents skin fibrosis in the tight skin mouse, J. Rheumatol., 17, 57, 1990. 52. Fleischmajer, R., Perlish, J.S., and Reeves, I.R.T., Cellular infiltrates in scleroderma skin, Arthritis Rheum., 20, 975, 1977. 53. Thrall, R.S. et al., The effect of T cell depletion on the development of bleomycin induced pulmonary fibrosis in the rat, Am. Rev. Respir. Dis., 121, 99, 1980. 54. Piguet, P.F. et al., Tumor necrosis factor/cachectin plays a key role in bleomycin induced pneumopathy and fibrosis, J. Exp. Med., 170, 655, 1989. 55. Szapiel, S.V. et al., Bleomycin-induced interstitial pulmonary disease in the nude, athymic mouse, Am. Rev. Respir. Dis., 120, 893, 1979. 56. Schrier, D.J., Phan, S.H., and McGarry, B.M., The effects of nude (nu/nu) mutation on bleomycin induced pulmonary fibrosis. A biochemical evaluation, Am. Rev. Respir. Dis., 127, 614, 1983. 57. Lake-Bullock, M.H.V. et al., T cell independence of bleomycin-induced pulmonary fibrosis, J. Leukoc. Biol., 65, 187, 1999. 58. Breen, E. et al., Bleomycin regulation of transforming growth factor-b mRNA in rat lung fibroblasts, Am. J. Respir. Cell Mol. Biol., 6, 146, 1992. 59. King, S.L. et al., Bleomycin stimulates proa1(I) collagen promoter through transforming growth factor-b response element by intracellular and extracellular signaling, J. Biol. Chem., 269, 13156, 1994. 60. Skalli, O. et al., Myofibroblasts from diverse pathologic settings are heterogeneous in their content of actin isoforms and intermediate filament proteins, Lab. Invest., 60, 275, 1989. 61. Darby, I., Skalli, O., and Gabbiani, G., Alpha-smooth muscle actin is transiently expressed by myofibroblasts during experimental wound healing, Lab. Invest., 63, 21, 1992. 62. Bhatal, P.S., The presence of modified fibroblasts in cirrhotic livers in man, Pathology, 4, 139, 1972. 63. Rudolph, R., McLure, W.J., and Woodward, M., Contractile fibroblasts in chronic alcoholic cirrhosis, Gastroenterology, 76, 704, 1979. 64. Nagle, R.B. et al., Induction of smooth muscle characteristics in renal interstitial fibroblasts during obstructive nephropathy, Lab. Invest., 29, 422, 1973. 65. Adler, K.B. et al., Actin-containing cells in human pulmonary fibrosis, Am. J. Pathol., 102, 427, 1981. 66. Sappino, A.-P. et al., Smooth muscle differentiation in scleroderma fibroblastic cells, Am. J. Pathol., 137, 585, 1990. 67. Kirk, T.Z. et al., Myofibroblasts from scleroderma skin synthesize elevated levels of collagen and tissue inhibitor of metalloproteinase (TIMP-1) with two forms of TIMP-1, J. Biol. Chem., 270, 3423, 1995.
1391_C35.fm Page 546 Tuesday, November 18, 2003 5:58 PM
546
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
68. Serini, G. and Gabbiani, G., Modulation of alpha-smooth muscle actin expression in fibroblasts by transforming growth factor-b isoforms: an in vivo and in vitro study, Wound Repair Regen., 4, 278, 1996. 69. Bostrom, H. et al., PDGF-A signaling is a critical event in lung alveolar myofibroblasts development and alveogenesis, Cell, 85, 863, 1996. 70. Kovacs, E.J., Fibrogenic cytokines, The role of immune mediators in the development of scar tissue, Immunol. Today, 12, 17, 1991. 71. Roberts, A.B. and Sporn, M.B., The transforming growth factor bs, in Handbook of experimental pharmacology. Peptide growth factors and their receptors. Vol 95, Sporn, M.B. and Roberts, A.B., Eds., Springer-Verlag, New York, 1990, p. 419. 72. Varga, J., Rosenbloom, J., and Jimenez, S.A., Transforming growth factor b (TGFb) causes a persistent increase in steady-state amounts of type I and type III collagen and fibronectin mRNAs in normal human dermal fibroblasts, Biochem. J., 247, 597, 1987. 73. Raghow, J. et al., Transforming growth factor-b increases steady state levels of type I procollagen and fibronectin messenger RNAs posttranscriptionally in cultured human dermal fibroblasts, J. Clin. Invest., 79, 1285, 1987. 74. Ignotz, R.A. and Massague, J., Transforming growth factor-b stimulates the expression of fibronectin and collagen and their incorporation into the extracellular matrix, J. Biol. Chem., 261, 4337, 1988. 75. Heino, J. et al., Regulation of cell adhesion receptors by transforming growth factor-beta, J. Biol. Chem., 264, 380, 1989. 76. Ignotz, R.A., Heino, J., and Massague, J., Regulation of cell adhesion receptors by transforming growth factor-beta, J. Biol. Chem., 264, 389, 1989. 77. Laiho, M. et al., Enhanced production and extracellular deposition of the endothelial-type plasminogen activator in cultured human lung fibroblasts by transforming growth factor beta, J. Cell Biol., 103, 2403, 1986. 78. Laiho, M., Saksela, O., and Keski-Oja, J., Transforming growth factor-beta induction of type-1 plasminogen activator inhibitor. Pericellular deposition and sensitivity to exogenous urokinase, J. Biol. Chem., 262, 17467, 1987. 79. Edwards, D.R. et al., Transforming growth factor beta modulates the expression of collagenase and metalloproteinase inhibitor, EMBO J., 6, 1899, 1987. 80. Obberghen-Schilling, E.V. et al., Transforming growth factor b1 positively regulates its own expression in normal and transformed cells, J. Biol. Chem., 263, 7741, 1988. 81. Roberts, A.B. et al., Transforming growth factor type b: rapid induction of fibroblasts and angiogenesis in vivo and stimulation of collagen formation in vitro, Proc. Natl. Acad. Sci. U. S. A., 83, 4167, 1986. 82. Denholm, E.M. and Rollins, S.M., Expression and secretion of transforming growth factor-b by bleomycin-stimulated rat alveolar macrophages, Am. J. Physiol., 264, 36, 1993. 83. Kawakami, T. et al., Increased expression of TGF-b receptors by scleroderma fibroblasts, Evidence for contribution of autocrine TGF-b signaling to scleroderma phenotype, J. Invest. Dermatol., 110, 47, 1998. 84. Mavilia, C. et al., Type 2 helper T-cell predominance and high CD30 expression in systemic sclerosis, Am. J. Pathol., 151, 1751, 1997. 85. Postlethwaite, A.E. et al., Human fibroblasts synthesize elevated levels of extracellular matrix proteins in response to interleukin 4, J. Clin. Invest., 90, 1479, 1992. 86. Gillery, P. et al., Interleukin-4 stimulates collagen gene expression in human fibroblast monolayer cultures. Potential role in fibrosis, FEBS Lett., 302, 231, 1992. 87. Sempowski, G.D. et al., Subsets of murine lung fibroblasts express membrane-bound and soluble IL-4 receptors. Role of IL-4 in enhancing fibroblast proliferation and collagen synthesis, J. Immunol., 152, 3606, 1994. 88. Needlemann, B.W., Wigley, F.M., and Stair, R.W., Interleukin-1, interleukin-2, interleukin-4, interleukin-6, tumor necrosis factor a, and interferon-g levels in sera from patients with scleroderma, Arthritis Rheum., 28, 775, 1985. 89. Kulozik, M. et al., Co-localization of transforming growth factor b2 with a1(I) procollagen mRNA in tissue sections of patients with systemic sclerosis, J. Clin. Invest., 86, 917, 1990. 90. Peltonen, J. et al., Evaluation of transforming growth factor b and type I procollagen gene expression in fibrotic skin diseases by in situ hybridization, J. Invest. Dermatol., 94, 365, 1990.
1391_C35.fm Page 547 Tuesday, November 18, 2003 5:58 PM
EXPERIMENTAL MOUSE MODEL OF SCLERODERMA: INDUCTION BY BLEOMYCIN
547
91. Gruschwitz, M. et al., Transcription and expression of transforming growth factor type beta in the skin of progressive systemic sclerosis: a mediator of fibrosis? J. Invest. Dermatol., 94, 197, 1990. 92. Yamamoto, T. et al., Anti-sclerotic effect of anti-transforming growth factor-b antibody in bleomycininduced scleroderma, Clin. Immunol., 92, 6, 1999. 93. McCormick, L.L. et al., Anti-TGF-b treatment prevents skin and lung fibrosis in murine sclerodermatous graft-versus host disease: a model for human scleroderma, J. Immunol., 163, 5693, 1999. 94. Giri, S.N., Hyde, D.M., and Hollinger, M.A., Effect of antibody to transforming growth factor b on bleomycin induced accumulation of lung collagen in mice, Thorax, 48, 959, 1993. 95. Denis, M., Neutralization of transforming growth factor-b1 in a mouse model of immune-induced lung fibrosis, Immunology, 82, 584, 1994. 96. Wang, Q. et al., Reduction of bleomycin induced lung fibrosis by transforming growth factor b soluble receptor in hamsters, Thorax, 54, 805, 1999. 97. Duncan, M.R. and Berman, B., g-interferon is the lymphokine and b interferon the monokine responsible for inhibition of fibroblast collagen production and late but not early fibroblast proliferation, J. Exp. Med., 162, 516, 1985. 98. Jimenez, S.A., Freundlich, B., and Rosenbloom, J., Selective inhibition of human diploid fibroblast collagen by interferons, J. Clin. Invest., 74, 1112, 1984. 99. Duncan, M.R. and Berman, B., Persistence of a reduced-collagen-producing phenotype in cultured scleroderma fibroblasts after short term exposure to interferons, J. Clin. Invest., 79, 1318, 1987. 100. Rosenbloom, J. et al., Inhibition of excessive scleroderma fibroblast collagen production by recombinant gamma-interferon. Association with a coordinate decrease in types I and III procollagen messenger RNA levels, Arthritis Rheum., 29, 851, 1986. 101. Kahari, V.-M. et al., Interferon-alpha and interferon-gamma reduce excessive collagen synthesis and procollagen mRNA levels of scleroderma fibroblasts in culture, Biochim. Biophys. Acta, 968, 45, 1988. 102. Yokozeki, M. et al., Interferon-g inhibits the myofibroblastic phenotype of rat palatal fibroblasts induced by transforming growth factor-b1 in vitro, FEBS Lett., 442, 61, 1999. 103. Yamamoto, T. et al., Effect of interferon-g on experimental scleroderma induced by bleomycin, Arch. Dermatol. Res., 292, 362, 2000. 104. Black, C.M. et al., Interferon-a does not improve outcome at one year in patients with diffuse cutaneous scleroderma. Results of a randomized, double-blind, placebo-controlled trial, Arthritis Rheum., 42, 299, 1999. 105. Ulloa, L., Doody, J., and Massagué, J., Inhibition of transforming growth factor-b/SMAD signaling by the interferon-g/STAT pathway, Nature, 397, 710, 1999. 106. Murrell, G.A.C., Francis, M.J.O., and Bromley, L., Modulation of fibroblast proliferation by oxygen free radicals, Biochem. J., 265, 659, 1990. 107. Chojkier, M. et al., Stimulation of collagen gene expression by ascorbic acid in cultured human fibroblasts. A role for lipid peroxidation, J. Biol. Chem., 264, 16957, 1989. 108. Casciola-Rosen, L., Wigley, F., and Rosen, A., Scleroderma autoantigens are uniquely fragmented by metal-catalyzed oxidation reactions: implications for pathogenesis, J. Exp. Med., 185, 71, 1997. 109. Sambo, P. et al., Monocytes of patients with systemic sclerosis (scleroderma) spontaneously release in vitro increased amounts of superoxide anion, J. Invest. Dermatol., 112, 78, 1999. 110. Yamamoto, T. et al., Effect of superoxide dismutase on bleomycin-induced dermal sclerosis: Implications for the treatment of systemic sclerosis, J. Invest. Dermatol., 113, 843, 1999. 111. Granot, I. et al., Increased skin tearing in broilers and reduced collagen synthesis in skin in vivo and in vitro in response to the coccidiostat halofuginone, Poult. Sci., 70, 1559, 1991. 112. Granot, I. et al., Halofuginone: an inhibitor of collagen type I synthesis, Biochim. Biophys. Acta, 1156, 107, 1993. 113. Choi, E.T. et al., Halofuginone, a specific collagen type I inhibitor, reduces anastomotic intima hyperplasia, Arch. Surg., 130, 257, 1995. 114. Levi-Schaffer, F. et al., Inhibition of collagen synthesis and changes in skin morphology in murine graft-versus-host disease and tight skin mice: effect of halofuginone, J. Invest. Dermatol., 106, 84, 1996. 115. Yamamoto, T. and Nishioka, K., Analysis of the effect of halofuginone on bleomycin-induced scleroderma, Rheumatology, 41, 259, 2002. 116. Buckley, C.D. et al., Fibroblasts regulate the switch from acute resolving to chronic persistent inflammation, Trends Immunol., 22, 199, 2001.
1391_C35.fm Page 548 Tuesday, November 18, 2003 5:58 PM
1391__Index.fm Page 549 Tuesday, November 18, 2003 6:01 PM
Index A Active induction method, EAE model, 172–175 Adaptive immune system canine, 80–85 (See also Canine immune system) human, 44–66 (See also specific components) antigen processing and presentation, 50–52 B1 cells, 44–45 B lymphocytes (B cells), 44 chemokines, 65–66 cytokines, 53–65 growth factors, 65–66 immunoglobulins (Igs), 45–48 Langerhans cells, 52–53 major histocompatibility complex (MHC), 48–50 minor histocompatibility a (H) antigens, 50 Adhesion-molecule knock-out (KO) mice, 134 Adhesion molecules. See also ICAMs; Selectins; VCAMs laminin and mucous membrane pemphigoid, 251–258 mouse, 125–126 in psoriasis-like skin lesions, 342–343 Adhesion molecule very late antigen, 39–40 Adoptive transfer method, 179–185 approach, 180–183 cell preparation, 181–183 EAE illustration, 184–185 intraperitoneal, 181 intravenous, 181 local, 181 strength and limitation, 183–184 Adrenal steroids, in murine atopic dermatitis, 378–379 Albinism Griscelli syndrome, 7 ocular type 1, 7 oculocutaneous type 2, 7 Allergen avoidance, in atopic dermatitis, 363 Allergen-specific immunotherapy, in atopic dermatitis, 362
Allergy, food. See Food hypersensitivity Alopecia areata canine spontaneous, 469–481 animals (breed predilection), 470–471 assessment, 471–478 clinical manifestation, 471–472 disease course, 471 epidemiology, 471 expert experience, 478 histopathology, 472–473 history, 469–470 immunogenetics, 478 immunopathology, 473–477 lessons learned, 478–479 therapeutic responses, 478 vs. human, 478–479 Dundee experimental bald rat (DEBR) model, 451–467 animals, 452–453 assessment, 456–460 clinical manifestation, 456–457 disease course, 453–455 disease susceptibility, 453 genetics, 455–456 histopathology, 457–458 history, 451–452 immunopathology, 459–460 immunophenotyping, 458–459 lessons learned, 463–465 sexual dichotomy, 453 therapeutic responses, 461–463 feline, 470 genetics, 433–434 history, 429–434, 451–452 human as autoimmune disease, 430–433 acquired immunity, 433–433 innate immunity, 431–432 human vs. canine, 478–479 immune privilege collapse model of, 161–162 juvenile, 442 murine models for, 434 acquired (cellular) immunity in, 437–440 549
1391__Index.fm Page 550 Tuesday, November 18, 2003 6:01 PM
550
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
animals used in, 434 C3H mice, 435 cell transfer and depletion studies, 437 genetics in, 441–442 innate (humoral) system in, 436–437 longitudinal graft study, 438–440 melanin in C3H/HeJ model, 441 in pharmaceutical tests, 441 rationale for, 434–442 sexual dichotomy in, 441 skin graft induction, 437 species used in, 434 vs. papular atrichia, 442 murine SCID graft induction, 483–492 animals, 484 assessment, 487–489 clinical manifestation, 487–488 disease induction, 485–487 histopathology, 489 history, 483–484 immunopathology, 489 lessons learned, 489 in nonhuman mammals, 470 totalis, 429 trophoneurotic hypothesis of, 430 universalis, 429 Ancestral haplotypes, 80 Anterior chamber-associated immune deviation (ACAID), 144, 146–147. See also under Immune privilege Antibodies. See Immunoglobulins Antidepressants, in atopic dermatitis, 362 Anti-epiligrin cicatricial pemphigoid, 252. See also Mucous membrane pemphigoid Antigen-presenting cells (APCs). See also Langerhans cells in alopecia areata, 439–440 ocular, 146–147 Antigen processing and presentation, 50–52 Antigens adhesion molecule very late, 39–40 minor histocompatibility (H), 50 Antihistamines, in atopic dermatitis, 361 Antimicrobial peptides (AMPs), 35 Antinuclear antibodies (ANAs), in scleroderma, 499–501 Apoptosis, 55 Astemizole, in atopic dermatitis, 362 Asthma, 58 atopic dermatitis and, 371–385 Athymic mice. See Nude mice Atopic dermatitis asthma and, 371–385 canine spontaneous, 353–369 animals, 354–355
assessment, 356–361 clinical manifestation, 356–359 disease course, 355–356 epidemiology, 355 expert experience, 363 histopathology, 359 history, 353–354 immunogenetics, 361 immunopathology, 360–361 lessons learned, 363 therapeutic response, 361–363 murine epicutaneous induction, 417–426 animals, 418–419 assessment, 421–422 clinical manifestation, 421 disease course, 421 disease induction, 419–421 histopathology, 422 history, 417–418 immunogenetics, 422 immunopathology, 422 lessons learned, 423–435 therapeutic responses, 422–423 food allergy–induced, 399–415 animals, 401 assessment, 401–407 clinical manifestation, 401–402 disease course, 410 disease induction, 401 expert experience, 408–409 histopathology, 402–403 history-410, 400 immunopathology, 403–407 lessons learned, 409–412 therapeutic responses, 407–408 vs. human disease, 411–412 spontaneous in NC/Nga mice, 375–386 transgenic induction, 387–398 Azathioprine in canine pemphigus foliaceus, 317 in canine pemphigus vulgaris, 269
B B1 cells, 44–45 B2 cells, 129–130 B6SIL ¥ BALB/c mice, 388 B10.D2>BALBc mice, 517–531 B10-D2-NSN mice, pemphigus vulgaris in, 275–283 B10-D2-OSN mice, pemphigus vulgaris in, 275–283 B19RIII mouse, EAE in, 174
1391__Index.fm Page 551 Tuesday, November 18, 2003 6:01 PM
INDEX
BALB/cBy mice, 388 BALB/c mice anti-laminin 5 antibody passive transfer, 251–258 bullous pemphigoid in, 170–172, 201–221 pemphigus vulgaris in, 275–283 Basement membrane zone, 9, 19–30 components, 20–26 integrins, 24–25 laminins, 24 noninflammation-related, 25 type VII collagen, 20–24 type XVIII collagen, 25 overview, 19 structures, 20 BAY X 1005, in psoriasis, 337 B cells (B lymphocytes), 44 canine, 83 mouse, 128 rat, 97–98 marginal zone, 97–98 migratory, 97 Beagles, breed predilections, 354 Beige mice, 332 Beta chemokines, 124–125 Beuceron dogs, breed predilections, 354 Bleomycin-induced murine scleroderma, 535–547 Boston terrier, breed predilections, 354 Bovine alopecia areata, 470 BP180 antibody, 170–172 BP230 antibody, 170 Breed predilections, dogs alopecia areata, 470–471 atopic dermatitis, 354–355 border collies, 242 cocker spaniel, 310 cocker spaniels, 242 collie, 264, 310 dachshunds, 242 Doberman pinscher, 310 German shepherd, 242, 264 pemphigus foliaceus, 310 pemphigus vulgaris, 264 poodles, 242 Siberian husky, 242 Brittany spaniels, C3 deficiency in, 83 Bullous pemphigoid canine spontaneous, 201–209 disease scoring, 172 human epidemiology, 202 IgG passive transfer model, 170–172 murine experimental IgG passive transfer, 213–223 animals, 214 anti-BP antibodies in, 217–218
551
clinical manifestation, 216 complement in, 218 disease course, 216 disease induction, 214–216 histopathology, 216 history, 213–214 immunopathology, 216–217 lessons learned, 217–221 mast cells in, 218–219 neutrophils and, 219 proteolytic enzymes in, 220 therapeutic potential, 220–221 vs. human, 220 murine passive IgG transfer model, 213–223 animals, 214 anti-BP antibodies in, 217–218 clinical manifestation, 216 complement in, 218 disease course, 216 disease induction, 214–216 histopathology, 216 history, 213–214 immunopathology, 216–217 lessons learned, 217–221 mast cells in, 218–219 neutrophils and, 219 proteolytic enzymes in, 220 therapeutic potential, 220–221 vs. human, 220 spontaneous in companion animals, 201–211 age of onset, 209 animals affected, 202 assessment, 203–208 clinical manifestation, 203–204 disease course, 202–203 epidemiology, 202 expert experience, 208 histopathology, 204 history, 201–202 immunogenetics, 208 immunological data, 204–205 lessons learned, 209 therapeutic responses, 208
C C2 complement protein, 80 C3-activating pathway, 42–43 C3 complement protein, 81 canine, 83 rat, 99 C3 convertases, 43 C3 deficiency, canine, 83 C3H/HeJ (H2K) mice, 399–415
1391__Index.fm Page 552 Tuesday, November 18, 2003 6:01 PM
552
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
C3H/HeJ mouse, hair loss in, 161 C3H mice, 435 C4 complement protein canine, 80–81 human, 80 C5-deficient mice, pemphigus vulgaris in, 275–283 C5-sufficient (B10-D2-NSN) mice, pemphigus vulgaris in, 275–283 C57B1/6LPJ mice, 517–531 C57BI 6 (H2s) mouse, EAE in, 174 C57Bl/6-bal/bal mice, 292–294 C57BL/61J mice, bullous pemphigoid in, 214 Cadherin antigen Dsg4, 296–300 Cadherins, 7–8, 126, 289 in psoriasis-like skin lesions, 342 Cancavalin A, in scleroderma, 501 Canine C4 complement protein, 80–81 Canine immune system, 79–89 antibodies (Igs), 81–82 chemokines, 85 complement system, 80–81 cytokines, 84–85 dendritic cells, 84 lymphocytes, 83–84 major histocompatibility complex (MHC), 80 mast cells, 81 neutrophils, 82–83 Canine spontaneous alopecia areata animals (breed predilection), 470–471 assessment, 471–478 disease course, 471 epidemiology, 471 expert experience, 478 history, 469–470 lessons learned, 478–479 therapeutic responses, 478 vs. human, 478–479 Canine spontaneous atopic dermatitis, 353–369 animals, 354–355 assessment, 356–361 disease course, 355–356 epidemiology, 355 expert experience, 363 history, 353–354 lessons learned, 363 therapeutic response, 361–363 Canine spontaneous bullous pemphigoid, 201–209. See also Bullous pemphigoid in companion animals vs. human, 202 Canine spontaneous epidermylosis bullosa acquisita, 227–236 animals, 228 assessment, 229–234 disease course, 228–229
epidemiology, 228 expert experience, 234 history, 227–228 lessons learned, 234–236 therapeutic responses, 234 vs. human, 235–236 Canine spontaneous mucous membrane pemphigoid, 211–250 animals, 242 assessment, 243–246 disease course, 242–243 epidemiology, 242 expert experience, 247 history, 241–242 lessons learned, 247–248 therapeutic responses, 246–247 vs. human, 247–248 Canine spontaneous pemphigus foliaceus, 309–319 animals, 310 assessment, 311–317 drug-induced, 313 expert experience, 317 history, 309 lessons learned, 318 panepidermal pustular, 314 therapeutic response, 317 Canine spontaneous pemphigus vulgaris animals, 264 assessment, 265–266 disease course, 264 epidemiology, 264 expert experience, 269–270 history, 263–264 lessons learned, 270–271 therapeutic responses, 269 vs. human, 270–271 Cantharidin, 289 Cardiotropin-1, 59, 61 Cataract, 147–148 Catenins, 289 Cathedicins, 35 Cats. See also Feline entries bullous pemphigoid in, 202, 203, 205, 208 CB6 ¥ BALB/c mice, 388 CC chemokines, 66–69 CD3 + 1 helper T cells, 83 CD4+/CD8+ cells, in food-induced murine atopic dermatitis, 404 CD4+ cells mouse, 129 in murine scleroderma, 510–511 rat, 101 in scleroderma, 501–502 CD4 cytokines, 83 CD8 cytokines, 83
1391__Index.fm Page 553 Tuesday, November 18, 2003 6:01 PM
INDEX
CD11/CD18 complex, 37 CD14 receptors, 37 CD-15R antigen, 98 CD18, in alopecia areata, 439 CD19, in murine scleroderma, 510 CD25 cells, 101 CD34+ hemotopoietic stem cells, 39, 40 CD44var.10 receptors, 439 CD45RG cells, 101 CD84/NKG21 group, 38 Cells B (See B cells) B1, 44–45 CD34+ hemotopoietic stem, 39 dendritic, 52–53 (See also Dendritic cells) canine, 84 Langerhans, 5, 52–53 mast, 40–41 natural killer (NK), 38–39 T (See T cells) Ceramidase, 381 Ceramide, in murine atopic dermatitis, 381 Chemokine receptors, 57 Chemokines canine, 83–85 in humans, 66–69 MDC, 377 TARC, 85, 377 Chlamydia trachomatis, 148 Chlorambucil, in canine pemphigus vulgaris, 269 Chymase inhibitor, in murine atopic dermatitis, 380 Cicatricial pemphigoid. See Mucous membrane pemphigoid Ciliary neurotrophic factor, 59, 61 Class switching, 48 CLIP peptides, 51 Clobetasole propionate, in murine atopic dermatitis, 378 Cocker spaniel, breed predilections, 310, 354 Collagen types of, 9 type VII, 20–24 type VIII, 25 Collagen abnormalities, in graft versus host disease, 522 Collie, breed predilections, 264, 310 Columbia University rat strains, 93 Common cytokine receptor gamma chain, 57–58 Complement system canine, 80–81 human, 41–44 mouse, 126 Connective tissue abnormalities, in murine scleroderma, 502–503
553
Constitutively expressed transgenic techniques, 188–189, 190–191 Contact-sensitizing agents, in alopecia areata, rat, 461 Corticosteroids in atopic dermatitis, 361–362 in canine pemphigus foliaceus, 317 in canine pemphigus vulgaris, 269 in food-induced murine atopic dermatitis, 408 in mucous membrane pemphigoid, 246 in murine atopic dermatitis, 378, 383–384, 394 in murine mucous membrane pemphigoid, 257 in pemphigus vulgaris, 288–289 in rat alopecia areata, 461 Cows, alopecia areata in, 470 Crystallins, 147–148 CT-1, 59, 61 Cutaneous adverse food reactions. See Food hypersensitivity CXC chemokines, 66–69, 124–125 Cyclophosphamide, in canine pemphigus vulgaris, 269 Cyclosporin A in alopecia areata, rat, 462 in atopic dermatitis, 361 in psoriasis, 337 Cytokine knock-out (KO) mice, 134 Cytokine receptor modules (CRMs), 59 Cytokines. See also Growth factors and individual types canine, 83–85 in humans, 38, 53–65 interferons, 54 interleukins, 55–64 (See also IL entries) tumor necrosis factor (TNF), 54–55 mouse, 123–124 in murine atopic dermatitis, 379–380 rat, 103–105
D Dachshund, breed predilections, 354, 470 Dalmation, breed predilections, 354 DBA/2NCr mice, anti-laminin 5 antibody passive transfer, 251–258 Decay-accelerating factor (DAF), 99 Defensins, 122–123 Dehydroepiandrosterone (DHEA), in murine atopic dermatitis, 378–379 Delayed-type hypersensitivity, 145 Dendritic cells canine, 84 migration to lymph nodes, 103 mouse, 129
1391__Index.fm Page 554 Tuesday, November 18, 2003 6:01 PM
554
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
rat, 96–97, 102–103 Dermatitis atopic (See Atopic dermatitis) Malassezia, 355, 363 staphylococcal, 363 Desmocollin, 8 Desmoglein 3 (dsg3), 4–5. See Dsg3 Desmogleins, 8 Dexamethasone, in psoriasis, 337 Dichroa febrifuga, in collagen disorders, 541–542 Diet manipulation, in murine atopic dermatitis, 380–381 Diphencyprone, in rat alopecia areata, 461–462 DLA genes, 80 DNCB, in rat alopecia areata, 461–462 Doberman pinscher, breed predilections, 310, 354, 470 Dogs. See also Canine entries breed predilections atopic dermatitis, 354–355 border collies, 242 cocker spaniels, 242 collie, 264 dachshunds, 242 German shepherd, 242, 264 Great Danes, 228 pemphigus foliaceus, 310 pemphigus vulgaris, 264 poodles, 242 Siberian husky, 242 Dolphin, MHC molecules in, 80 DPCP, in alopecia areata, rat, 461–462 Drug-induced canine spontaneous pemphigus foliaceus, 313 Dsg3 mice, 292–294 Dsg 4 cadherin antigen, 296–300 Dundee experimental bald rat (DEBR) model, 161 alopecia areata, 451–467 (See also Rat spontaneous alopecia areata) history, 451–452
E EGF-R, integrins and, 347–348 English bulldog, breed predilections, 354 English setter, breed predilections, 354 Eosinophils canine, 83 in humans, 39–40 Eotaxin, 377 Epidermis, 4–9 dermis, 8–10 desmoglein 3 (dsg3), 4–5 keratinocytes, 7–8 Langerhans cells, 5.102, 52–53, 130
melanocytes, 5–7 murine vs. human, 297 Epidermylosis bullosa acquisita, 242 canine spontaneous, 227–236 animals, 228 assessment, 229–234 clinical manifestation, 229–230 disease course, 228–229 epidemiology, 228 expert experience, 234 histopathology, 230–231 history, 227–228 immunogenetics, 233–234 immunopathology, 231–232 lessons learned, 234–236 therapeutic responses, 234 vs. human, 235–236 Epiligrin, 252 Epithelial basement membrane zone. See Basement membrane zone Epithelium, Langerhans cells, 149 Equine bullous pemphigoid, 202, 204, 205, 208 E-selectin, 10 Experimental autoimmune encephalomyelitis (EAE) active induction model, 172–175 adoptive transfer SCID mouse example, 184–185 Experimental autoimmune uveitis, 148 Experimental methods. See also specific methods and models active induction, 170–175 adoptive transfer, 179–185 passive transfer, 170–172 strength and limitations, 170, 183–184, 190–193 transgenic techniques, 187–195
F FA+AD mice, 402–403 Familial systemic lupus erythematosus, 80 Fas-FasL pathway, in alopecia areata, 440 FasL molecules, 145–146 Fatty acid supplements in atopic dermatitis, 362 in murine atopic dermatitis, 383–384 Fcg receptors, 83 Fc receptors, 37 mouse, 128 Feline alopecia areata, 470 Feline bullous pemphigoid, 202, 203, 205, 208 Feline pemphigus foliaceus, 310, 312 Feline pullous pemphigoid, 202 Fibrillin-1 gene, in murine scleroderma, 504–507 Fibroblast growth factor, 124 Fibroblasts, rat, 96–97
1391__Index.fm Page 555 Tuesday, November 18, 2003 6:01 PM
INDEX
555
FK506 (tacrolimus) in murine atopic dermatitis, 379, 383–384 in rat alopecia areata, 462 Fluocinolone acetonide, in food-induced murine atopic dermatitis, 408 Food allergy–induced murine atopic dermatitis, 399–415. See also under Murine atopic dermatitis Food hypersensitivity, atopic dermatitis and, 356 Fox terrier, breed predilections, 354
G Gamma chemokines, 124–125 GATA factors, 129 G-CSF, mouse, 124 Genes DLA, 80 resistance, 132–133 German shepherd, breed predilections, 264, 354, 470 German short-haired pointer, breed predilections, 354 Glucocorticosteroids. See Corticosteroids and specific drugs GM-CSF, 59 canine, 86 mouse, 124 Golden retriever, breed predilections, 354 Gp130 proteins, 59–61 Graft versus host disease, 41 human chronic, 519–520 as scleroderma model, 517–534 (See also under Murine scleroderma) Granulocyte-colony stimulating factor. See G-CSF Granulocyte-macrophage colony-stimulating factor. See GM-CSF Granulocytes, canine, 83 Great Danes, breed predilections, 228 Griscelli syndrome, 7 Growth factors. See also Cytokines and specific factors in humans leukemia inhibitory factor (LIF), 65 platelet-derived growth factor (PDGF), 65 stem cell factor, 65 transforming growth factor, 65 mouse, 124
H H1 blockers, in atopic dermatitis, 362 Hair follicle, immune privilege of, 155–165. See also under Immune privilege
Hair follicle-specific IgGs, 430–433 Halofuginone in graft versus host disease, 530 in scleroderma, 541–542 H antigens, 50 Heparin, low-dose, in canine pemphigus vulgaris, 269 Heterohybridomas, canine, 82 HLA-G, 146 Horses. See also Equine entries alopecia areata in, 470 bullous pemphigoid in, 202, 204, 205, 208 MHC molecules in, 80 HSV keratitis, 148 Human defensins, 35 Human immune system, 33–78. See also under Immune system adaptive, 44–66 (See also Adaptive immunity and specific components) antigen processing and presentation, 50–52 B1 cells, 44–45 B lymphocytes (B cells), 44 chemokines, 65–66 cytokines, 53–65 growth factors, 65–66 immunoglobulins (Igs), 45–48 Langerhans cells, 52–53 major histocompatibility complex (MHC), 48–50 minor histocompatibility a (H) antigens, 50 innate, 35–40 (See also Innate immunity and specific components) complement, 41–44 eosinophils, 39–40 mast cells and basophils, 40–41 natural killer (NK) cells, 38–39 neutrophils, 37–38 phagocytes, 36–37 Human neutrophil peptides, 35 Hypersensitivity, food. See Food hypersensitivity Hypodermis, 10
I ICAM-1, 10 ICAMs, mouse, 127–128 IFN-a, 54 IFN-b, 54 IgA, 47 canine, 81 mouse, 128 IgD, 46 IgE, 47 canine, 82
1391__Index.fm Page 556 Tuesday, November 18, 2003 6:01 PM
556
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
in food-induced murine atopic dermatitis, 403–405 in murine atopic dermatitis, 376–377, 382–384 IgG, 46–47 canine, 81–82 hair follicle-specific, 430–433 mouse, 128 rat, 98–99 IgG4, in pemphigus foliaceus, 325–326. See also Murine passive transfer pemphigus foliaceus Ig-like killer immunoglobulin receptors, 38 IgM, 46 canine, 81 mouse, 128 rat, 99 IL-1, 55–57 rat, 103 IL-1b, 52–53 IL-2, 57–58 in alopecia areata, 430 rat, 103 IL-3, 59 IL-4, 57–58 in murine atopic dermatitis, 379, 423 rat, 103–104 IL-4-Tg mouse, 388 IL-5, 59 in food-induced murine atopic dermatitis, 407 in murine atopic dermatitis, 379, 423 IL6 mouse, 104 rat, 104 IL-6, 59–61 IL-7, 58 IL-8, 61 IL-9, 58 IL-10, 61–62 in psoriasis, 337 rat, 104 IL-12, 62–63 in murine atopic dermatitis, 379–380 rat, 104–105 IL-13, 63–64, 86 canine, 86 in food-induced murine atopic dermatitis, 407 IL-14, 63–64 IL-16, 64 IL-17, 64 IL-18, 56–57 in murine atopic dermatitis, 383 IL-21, 58 IL-25, 64 IL-27, 63 IL-28, 64
IL-29, 64 Immune cell knock-out (KO) mice, 135 Immune privilege anagen hair follicle as site, 157 concept, 156 hair follicle, 149–150, 155–165 (See also Alopecia areata) alopecia areata and, 161–162 in mouse, 157–161 physiological function of, 161 potential functions of, 160–161 ocular, 143–154 anatomical and structural factors, 144–145 anterior-chamber-associated immune deviation (ACAID), 146–147 anti-inflammatory and immunosuppressive factors, 145–146 ocular diseases and, 147–149 vs. hair follicle, 160 potential mechanisms, 156 Immune privilege collapse model, of alopecia areata, 161–162 Immune system canine, 79–89 antibodies (Igs), 81–82 chemokines, 84–85 complement system, 80–81 cytokines, 84–85 dendritic cells, 84 lymphocytes, 83–84 major histocompatibility complex, 80 mast cells, 82 neutrophils, 82 human, 33–78 mouse, 119–140 innate, 120–129 rat, 91–117 cells, 103–104 complement system, 99 cytokines and chemokines, 103–105 immunoglobulins (antibodies), 98–99 major histocompatibility complex (MHC), 94–95 organs, 95–98 Immunoglobulins (Igs), 45–48. See also Ig entries anti-lens, 147–148 canine, 81–82 class switching, 48 gene regulation, 48 mouse, 128 rat, 98–99 Immunosuppressants, murine hair cycle and, 159–160 Inducibly expressed transgenic techniques, 189–190, 192
1391__Index.fm Page 557 Tuesday, November 18, 2003 6:01 PM
INDEX
557
INF-g, 54 alopecia areata and, 430 in murine atopic dermatitis, 380 INF-g-inducing factor (IL-18), 56–57 Inflammation-related adhesion molecules. See Eselectin; ICAM; Selectins; VCAMs Inflammatory bowel disease, 436–437 Innate immune system. See also specific components human, 35–40 complement, 41–44 eosinophils, 39–40 mast cells and basophils, 40–41 natural killer (NK) cells, 38–39 neutrophils, 37–38 phagocytes, 36–37 ocular, 145 (See also Immune privilege) Integrins, 34–35, 102 EGF-R and, 347–348 hyperproliferation/inflammation and, 345–347 mouse, 126 in psoriasis-like skin lesions, 335–350 suprabasal as marker, 348 suprabasal expression, 347 Interferons. See also INF entries canine, 86 mouse, 128 in murine atopic dermatitis, 377, 423–424 in scleroderma, 541 Interleukins, 55–64. See also IL entries canine, 86 in food-induced murine atopic dermatitis, 407 mouse, 124, 129 in murine atopic dermatitis, 423 rat, 103–104 in scleroderma, 501 International Society for Animal Genetics, 80 In vivo lymphocyte depletion, in alopecia areata, in rat, 462–463 Irish setter, breed predilections, 354
Keratitis, HSV, 148 KIR receptors, 38 Knock-out (KO) mice adhesion-molecule, 134 cytokine, 134 immune cell, 135 RAG, 134
L Labrador retriever, breed predilections, 354 Labrit dogs, breed predilections, 354 Laminins, 24 Langerhans cells, 5 absence from cornea, 149 human, 52–53 mouse, 130 rat, 102 Latency-associated peptide (LAP), in graft versus host disease, 530 Lectin-like receptors, 38 Leishmania major, 132 Leukemia inhibitory factor (LIF), in humans, 59, 60–61, 65 Leukocyte adhesion deficiency, 37 Leukotriene inhibitors, in atopic dermatitis, 362 Lhasa apso, breed predilections, 354 Loratidine, in atopic dermatitis, 362 Lupus erythematosus familial systemic, 80 vesicular cutaneoous, 242 Lymph nodes, dendritic cell migration, 103 Lymphocyte depletion, in rat alopecia areata, 462–463 Lymphocytes. See B cells; T cells Lymphosarcoma, canine thymus, 264
M J Jackson Laboratory mice, 133, 135, 388 Janus kinases, 123 Japanese Nishiki Nezumi mice, 372 Juvenile alopecia areata, 442
K KC proteins, 289 Keratinocytes, 7–8 Keratins, 8 in alopecia areata, 436
Macrophage-derived chemokine (MDC), 377 Macrophages. See also Monocyte/macrophages human vs. rat, 101–102 rat, 101–102 Magyar miszla (dog), breed predilections, 470 Major basic protein (MBP), 40 Major histocompatibility complex (MHC). See also MHC entries canine, 80 in humans, 48–50 mouse, 130 rat, 94–95 Malassezia dermatitis, 355, 363 Mannose-binding lectin pathway, 43
1391__Index.fm Page 558 Tuesday, November 18, 2003 6:01 PM
558
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Mannose receptors, 36–37 Mast cell degranulation, 520 Mast cells canine, 81 ghost, 520 human, 40–41 phenotypes, 41 mouse, 127–128 rat, 100 M-CSF, mouse, 124 Melanin, in alopecia areata, 441 Melanocytes, 5–7 Membrane attack complex (MAC), 126 Membrane cofactor proteins (MCPs), 99 Methylprednisolone. See also Corticosteroids in pemphigus vulgaris, 289 MHC ancestral haplotypes, 80 MHC molecules class I, 80 hair loss and, 162 murine hair cycle and, 157–159 class II, 80 human antigen processing and presentation, 50–51 class I, 50–51 class II, 49, 51 peptide binding, 49–50 MHC tetramers, 51–52 Miniature schnauzer, breed predilections, 354 Minor histocompatibility (H) antigens, 50 Misoprostol, in atopic dermatitis, 362 Mixed breed dogs, disease predilections, 354, 470 Monocyte/macrophages in graft versus host disease, 521 rat, 101–102 Monocytes, human vs. rat, 101–102 Mouse, laboratory. See also Murine entries 129xBL/6 Dsg3null, 292–294 B6SIL ¥ BALB/c, 388 B10.D2>BALBc, 517–531 B10-D2-OSN, 275–283 B19RIII, 174 BALB/c, 214, 251–258, 275–283 bullous pemphigoid in, 170–172 BALB/cBy, 388 beige, 332 C3H, 435 C3H/HeJ, 161 C3H/HeJ (H2K), 399–415 C5-deficient, 275–283 C5-sufficient (B10-D2-NSN), 275–283 C57B1/6LPJ, 517–531 C57BI 6 (H2s), 174 C57Bl/6-bal/bal, 292–294 C57BL/61J, 214
CB6 ¥ BALB/c, 388 CBA/CaHN-Bikxxid/J, 433 DBA/2NCr, 251–258 dendritic cells, 84 Dsg3, 292–294 FA+AD, 402–403 hair follicle immune privilege in, 157–161 IL-4-Tg, 388 Jackson Laboratory, 275–283, 388 NC/Nga, atopic dermatitis and asthma, 371–385 Nishiki Nezumi, 372 PL/J (H2u), 174 SCID (See SCID mice) EAE adoptive transfer, 184–185 Scl GVHD, 517–531 SJL/H2, 174 Stat6 knockout, 510–511 tsk1, 496–507 tsk1+ ¥ Rag, 502 tsk2, 507–510 vs. rat as model, 92 Mouse models, 130–135 disease susceptibility, 132–133 knock-out (KO) mice, 134–135 (See also Knockout (KO) mice) naturally occurring mutations, 133–135 nomenclature of inbred strains, 131 nude mice, 134 SCID mice, 133–134 use of inbred strains, 131–132 Mucous membrane pemphigoid, 149 canine spontaneous, 211–250 animals, 242 assessment, 243–246 clinical manifestation, 243 disease course, 242–243 epidemiology, 242 expert experience, 247 histopathology, 243–244 history, 241–242 immunogenetics, 246 immunopathology, 244–246 lessons learned, 247–248 therapeutic responses, 246–247 vs. human, 247–248 murine anti-laminin antibody passive transfer model, 251–259 animals, 253 clinical manifestation, 255 disease course, 255–257 disease induction, 253–255 histopathology, 255–256 history, 252 immunopathology, 256–257 lessons learned, 257–258
1391__Index.fm Page 559 Tuesday, November 18, 2003 6:01 PM
INDEX
therapeutic response, 257 "Multiple hit" hypothesis, of pemphigus vulgaris, 291 Murine alopecia areata, 434 acquired (cellular) immunity in, 437–440 C3H mice, 435 cell transfer and depletion studies, 437 genetics in, 441–442 innate (humoral) system in, 436–437 juvenile, 442 longitudinal graft study, 438–440 melanin in C3H/HeJ model, 441 in pharmaceutical tests, 441 rationale for, 434–442 SCID graft induction, 483–492 animals, 484 assessment, 487–489 disease induction, 485–487 history, 483–484 lessons learned, 489 sexual dichotomy in, 441 skin graft induction, 437 species used in, 434 vs. papular atrichia, 442 Murine atopic dermatitis epicutaneous induction, 417–426 animals, 418–419 assessment, 421–422 disease course, 421 disease induction, 419–421 lessons learned, 423–435 therapeutic responses, 422–423 food allergy–induced, 399–415 animals, 401 assessment, 401–407 disease course, 410 expert experience, 408–409 history-410, 400 lessons learned, 409–412 therapeutic responses, 407–408 vs. human disease, 411–412 NC/Nga mice, 371–385 assessment, 374–378 disease course, 374 epidemiology, 372–374 expert experience, 381–382 history, 372 skin barrier abnormalities, 381 therapeutic responses, 378–381 vs. human disease, 382–384 oral allergen induction, 399–415 spontaneous in NC/Nga mice, 375–386 transgenic induction, 387–398 animals, 388 assessment, 390–394
559
clinical manifestation, 390 disease course, 389–390 disease induction, 388–389 expert experience, 394–395 histopathology, 391–392 history, 387–388 immunogenetics, 394 immunopathology, 391–393 lessons learned, 395–396 therapeutic responses, 394 Murine bullous pemphigoid, anti-BP180 passive transfer model, 213–223 animals, 214 assessment of disease, 216–217 disease course, 216 disease induction, 214–216 history, 213–214 lessons learned, 217–221 relevance to human disease, 220 Murine experimental pemphigus vulgaris, with desmoglein-targeting antibodies, 275–283 disease course and assessment, 279–280 disease induction, 277–278 history, 275–276 lessons learned, 281–282 therapeutic response, 280–281 vs. human, 282 Murine immune system adaptive, 129–130 B cells, 129–130 Langerhans cells, 130 major histocompatibility complex (MHC), 130 T cells, 129 innate, 120–129 adhesion molecules, 125–126 B-1 cells and Igs, 128 cells, 126–129 chemokines, 124–125 complement, 126 cytokines, 123–124 defensins, 122–123 gamma/delta T cells, 128 interferon-producing cells, 128 intraepithelial lymphocytes, 129 mast cells, 127–128 natural killer (NK) cells, 127 NF-kB receptor family, 122–123 Toll-like receptors, 120–121 Murine mucous membrane pemphigoid, antilaminin antibody passive transfer model animals, 253 disease disease course and assessment, 255–257 disease induction, 253–255
1391__Index.fm Page 560 Tuesday, November 18, 2003 6:01 PM
560
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
history, 252 lessons learned, 257–258 Murine pemphigus foliaceus, passive transfer, 321–328 animals, 322 assessment, 323–324 disease induction, 322–323 history, 321–322 immunogenetics, 324 lessons learned, 324–326 therapeutic potential, 326 Murine pemphigus vulgaris, with nondesmoglein 1 and 2 antibodies, 285–305 animals, 292–294 disease induction, 294–296 history and rationale, 286–291 lessons learned, 296–297, 296–300, 298–300 "multiple-hit" hypothesis, 291 Nicolskiy's sign, 295 Murine psoriasis SCID/human skin graft, 331–339 animals, 334 assessment, 335–337 clinical manifestation, 335 disease induction, 334–335 histopathology, 335–336 immunogenetics, 336–337 immunopathology, 336 lessons learned, 337 therapeutic response, 337 transgenic expression of integrin, 341–350, 345–348 assessment, 345 clinical manifestation, 345 disease induction, 344–345 histopathology, 345 history, 341–342 immunopathology, 345 rationale, 342–343 Murine scleroderma bleomycin-induced, 535–547 animals, 536–537 assessment, 538–540 disease course, 538 disease induction, 537 history, 535–536 therapeutic responses, 541–542 connective tissue abnormalities, 502–503 cutaneous manifestations, 496–497 graft versus host disease model, 517–534 animals, 522–523 assessment, 525–527 disease course, 525 disease induction, 523–525 diversity of disease, 519–520
expert experience, 527–530 history, 518–522 reproducibility, 520–522 therapeutic responses, 530–531 histopathology, 509–510 immunopathology, 499–502 internal organ involvement, 497–499 molecular defects in, 503–504 spontaneous, 495–515 history, 495–496 tsk1 mouse, 496–507 tsk2 mutation, 507–510 in transgenic models, 510–511 vs. human, 512 Murine vs. human epidermis, 297 Mycoptes musculinus, 373
N NAChRa9 receptor, 287–288 Natural killer (NK) cells human, 38–39 mouse, 127 ocular immune privilege and, 146 rat, 100–101 NC/Nga mouse, atopic dermatitis and asthma, 371–385 Nedocromil sodium, in graft versus host disease, 530 Neshiki nezumi (Japanese mouse), 372 Neurotropin, 124 Neurotropin-1/B-cell stimulating factor (NNT-BSF2, 60 Neutrophils canine, 82–83 human, 37–38 NF-kB proteins, 122 Niacinimide/tetracycline, in mucous membrane pemphigoid, 246 Nicolskiy's sign, 295, 323 NK cell receptor protein, 38 Nude mice, 134, 332
O Occular immune privilege, 143–154. See also under Immune privilege Ocular albinism type 1, 7 Oculocutaneous albinism type 2, 7 Omega 3/omega 6 fatty acids, in atopic dermatitis, 362 Onchocerciasis, 148–149
1391__Index.fm Page 561 Tuesday, November 18, 2003 6:01 PM
INDEX
561
Onchocercia volvulus, 148–149 Oncostatin M, 59, 60–61
P P19 protein, 63 Panepidermal pustular canine spontaneous pemphigus foliaceus, 314 Papular atrichia, 442 Parasitic infections, 47–48 of eye, 148–149 Passive transfer method, 170–172 Pathogen-associated molecular pathways (PAMPs), 121 PDGFa, in graft versus host disease, 523 Pemphigoid bullous (See Bullous pemphigoid) cicatrical as term, 149 cicatricial (See Mucous membrane pemphigoid) mucous membrane (See Mucous membrane pemphigoid) mucous membrane as term, 149 Pemphigus foliaceus, 287 canine spontaneous, 309–319 animals, 310 assessment, 311–317 clinical manifestation, 311 disease course, 310–311 drug-induced, 313 epidemiology, 310 expert experience, 317 histopathology, 311–312 history, 309 immunopathology, 314–317 lessons learned, 318 panepidermal pustular, 314 therapeutic response, 317 vs. human, 318 feline, 310, 312 murine passive transfer, 321–328 animals, 322 assessment, 323–324 disease course, 323 disease induction, 322–323 history, 321–322 immunogenetics, 324 lessons learned, 324–326 Nicolskiy's sign in, 323 therapeutic potential, 326 Pemphigus vulgaris canine spontaneous, 263–273 animals, 264 assessment, 265–266 clinical manifestation, 265–266
disease course, 264 epidemiology, 264 expert experience, 269–270 histopathology, 266–267 history, 263–264 immunopathology, 268–269 lessons learned, 270–271 therapeutic responses, 269 vs. human, 270–271 murine with desmoglein-targeting antibodies, 275–283 animals, 275 clinical manifestation, 279 disease course and assessment, 279–280 disease induction, 277–278 histopathology, 279–280 history, 275–276 immunopathology, 280 lessons learned, 281–282 therapeutic response, 280–281 vs. human, 282 murine with nondesmoglein 1 and 2 antibodies, 285–305 animals, 292–294 disease induction, 294–296 gross pathology, 295 histopathology, 297–298 history and rationale, 286–291 identification of cadherin Dsg4 antigen, 296–297, 298–300 interpretation of mechanism, 296 lessons learned, 296–300 "multiple-hit" hypothesis, 291 Nicolskiy's sign, 295 spontaneous canine, variants, 265–266 Peptide growth factor, in graft versus host disease, 523 Peptides antimicrobial (AMPs), 35 CLIP, 51 human neutrophil, 35 Periateriolar lymphatic sheath (PALS), 96 Persimmon leaf extract, in murine atopic dermatitis, 380–381 Phagocytes, 36–37 Phagocytosis, in humans, 36–37 CD14 receptors and, 37 Fc receptors and, 37 mannose and CR3 receptors in, 36 scavenger receptors and, 36 Toll-like receptors in, 36–37 Pharmaceutical product testing, murine models in, 441 Phosphodiesterase inhibitors, in atopic dermatitis, 362
1391__Index.fm Page 562 Tuesday, November 18, 2003 6:01 PM
562
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Pigs bullous pemphigoid in, 202, 203, 206, 298 MHC molecules in, 80 Plakoglobin, 289 Plasminogen activator (PA), in pemphigus vulgaris, 280 Platelet-derived growth factor (PDGF), 65 PL/J (H2u) mouse, EAE in, 174 Poodle, breed predilections, 354, 470 Prednisolone in canine pemphigus foliaceus, 317 in mucous membrane pemphigoid, 246 Programmed cell death. See Apoptosis Proteins. See also specific types gp130, 59–61 KC, 289 major basic, 40 membrane-bound complement, 41–43 membrane cofactor (MCPs), 99 NF-kB, 122 NK cell receptor, 38 p19, 63 P-selectin, 10 Psoriasis history, 331–333 immunogenetics, 336–337 murine models chimeric SCID/human cellular immunity transfer, 331–339 transgenic expression of integrin, 341–350 susceptibility loci, 337 Pug dogs, breed predilections, 354
R RAG knock-out (KO) mice, 134 Rat albino, 92 Columbia University strains, 93 Dundee experimental bald (DEBR), 161 as laboratory model, 92–93 non-Wistar strains, 93 vs. mouse as model, 92–93 Wistar crosses, 93 Wistar Institute strains, 93 Rat immune system cells, 103–104 dendritic cells, 102–103 lymphocytes, 101 mast cells, 100 monocyte/macrophages, 101–102 natural killer (NK) cells, 100–101 complement system, 99 cytokines and chemokines, 103–105
immunoglobulins (antibodies), 98–99 major histocompatibility complex (MHC), 94–95 organs, 95–98 spleen, 96–98 thymus, 95–96 Rat Resource and Research Center, 93 Rat spontaneous alopecia areata animals, 452–453 assessment, 456–460 disease course, 453–455 genetics, 455–456 history, 451–452 lessons learned, 463–465 sexual dichotomy, 453 therapeutic responses, 461–463 Rattus norwegicus (Norway rat), 91 Rattus rattus (house rat), 91 Reactive oxygen species, bleomycin and, 541 Receptors. See also specific types CD3 complement, 83 CD14, 37 CD44var.10, 439 chemokine, 57 complement, 43–44 cytokine, 123 Fc, 37, 128 Fcg, 83 Ig-like killer immunoglobulin, 38 IL-1, 56 lectin-like, 38 nAChRa9, 287–288 natural killer (NK), 337 scavenger, 36–37 T-cell, 53 Toll-like, 36–37, 120–121 Resistance genes, 132–133 Respiratory bursts, 37–38
S SADBE, in rat alopecia areata, 461–462 Scavenger receptors, 36–37 Schnauzer, miniature, breed predilections, 354 SCID mice, 133–134 3EAE adoptive transfer, 184–185 alopecia areata, 483–489 (See also under Murine alopecia areata) human skin grafting onto, 253 human skin psoriasis induction model, 331–339 "leaky" phenotype, 334 psoriasis transfer model, 331–339 Scleroderma, murine. See also Murine scleroderma bleomycin-induced, 535–547 spontaneous, 495–515
1391__Index.fm Page 563 Tuesday, November 18, 2003 6:01 PM
INDEX
563
animals, 496 history, 495–496 tsk1 mouse, 496–507 tsk2 mutation, 507–510 in transgenic models, 510–511 vs. human, 512 Scl GVHD mice, 517–531 Scottish terrier, breed predilections, 354 Sealyham terrier, breed predilections, 354 Selectins alopecia areata and, 430 E, 10 mouse, 126, 127–128 P, 10 in psoriasis-like skin lesions, 342–343 Sexual dichotomy atopic dermatitides, 372 canine pemphigus foliaceus, 310 graft versus host disease, 522 mucous membrane pemphigoid, 242 Signature sequences, 57 SJL/H2 mouse, EAE in, 174 Skin components, 4–10 (See also specific components) basement membrane zone, 9 dermis, 9–10 epidermis, 4–9 hypodermis, 10 function, 3–4 Smoothe™ (fluocinolone acetonide), in food-induced murine atopic dermatitis, 408 Spleen in ocular immune privilege, 147–148 rat, 96–98 Spontaneous canine pemphigus vulgaris, variants, 265–266 Staphylococcal dermatitis, 363 STAT6 deficiency, in murine atopic dermatitis, 383 Stat6 knockout mice, 510–511 STAT protein, 60 STATs, 123 Stem cell factor, 65 Syndecan-2, 126 Systemic lupus erythematosus, familial, 80
T TACK chemokines, 342 Tacrolimus (FK506) in murine atopic dermatitis, 379, 383–384 in rat alopecia areata, 462 TAP molecules, 159
TARC (thymus and cytokine-regulated chemokine), 85, 342, 377 T-cell receptors, 53 T cells (T lymphocytes), 53 in alopecia areata, 439–440 canine, 83–84 gamma-delta, 128 in graft versus host disease, 521 mouse, 129 in murine atopic dermatitis, 423 rat, 101 Terfenadine, in atopic dermatitis, 362 Tet-off system, 189, 192 Tet-off/transcriptional silencer system, 190, 192 Tet-on system, 188–190, 192 TGFa, in graft versus host disease, 523 TGF-b in graft versus host disease, 530 in murine atopic dermatitis, 380 in scleroderma, 541 TGF-b1, murine hair cycle and, 159–160 Th2 cytokine, in murine atopic dermatitis, 395 Thallium acetate, alopecia areata and, 430 Thymus. See also T cells rat, 95–96 Thymus and cytokine-regulated chemokine (TARC). See TARC TLR1, 121 TLR2, 121 TLR3, 121 TLR4, 121 TLR5, 121 TLR6, 121 TLR7, 121 TLR9, 121 T lymphocytes. See T cells TNF-a, in alopecia areata, 439 TNF receptor, 123 Toll-like receptors. See also TLR entries in humans, 36–37 in mice, 120–121 Trachoma, 148 Transforming growth factor (TGF), 65 Transgenic techniques, 187–195 constitutively expressed, 188–189 inducibly expressed, 189–190 strength and limitations, 190–193 Tretinoic acid, in psoriasis, 337 Triamcinolone, in atopic dermatitis, 362 Tricyclic antidepressants, in atopic dermatitis, 362 Trophoneurotic hypothesis, of alopecia areata, 430 Tsk1 mouse, 496–507 Tsk1+ ¥ Rag mice, 502 Tsk2 mouse, 507–510
1391__Index.fm Page 564 Tuesday, November 18, 2003 6:01 PM
564
ANIMAL MODELS OF HUMAN INFLAMMATORY SKIN DISEASES
Tumor necrosis factor (TNF), 54–55. See also TNF entries canine, 86 mouse, 124 rat, 105
U
W West Highland white terrier, breed predilections, 354 White terrier, breed predilections, 354 Wire-haired fox terrier, breed predilections, 354 Wistar Institute, 92 Wistar Institute rat strains, 93
Uveitis, experimental autoimmune, 148
Y V Vascular cell adhesion molecules (VCAMs), 40 VCAM-1, 10 VCAMs, mouse, 127–128 Vesicular cutaneoous lupus erythematosus, 242
Yorkshire terrier, breed predilections, 354 Yucatan minipigs, bullous pemphigoid in, 202, 203