Advances in Parasitology Volume 34

Advances in PARASIT0LOGY

VOLUME 34

Editorial Board

C. Bryant Department of Zoology, Australian National University, G.P.O. Box 4, Canberra, A.C.T. 2601, Australia C. Combes Laboratoire de Biologie Animale, Universite de Perpignan, Avenue de Villeneuve, 66860 Perpignan Cedex, France J.P. Kreier Department of Microbiology, College of Biological Sciences, Ohio State University, 484 West 12th Avenue, Columbus, Ohio 43210-1292. USA

W.H.R. Lumsden 17A Merchiston Crescent, Edinburgh EHlO 5AX, UK E.J.L. Soulsby Department of Clinical Veterinary Medicine, University of Cambridge, Madingley Road, Cambridge CB3 OES, UK K.S. Warren Comprehensive Medical Systems, Inc., 461 Fifth Avenue, New York, N.Y. 10017, USA P. Wenk Tropenmedizinisches Institut , Universitat Tiibingen, D7400 Tiibingen 1, Wilhelmstrasse 31, Federal Republic of Gemany

M. Yokogawa Department of Parasitology, School of Medicine, Chiba University, Chiba, Japan

Advances in PARASITOLOGY Edited by

J.R. BAKER The Royal Society of Tropical Medicine and Hygiene, London, England

R. MULLER International Institute of Parasitology, St Albans, England and

D. ROLLINSON The Natural History Museum, London, England VOLUME 34

ACADEMIC PRESS Harcourt Brace & Company, Publishers London San Diego New York Boston Sydney Tokyo Toronto

ACADEMIC PRESS LIMITED 24/28 Oval Road LONDON NWl 7DX United States Edition published by ACADEMIC PRESS INC. San Diego CA92101

Copyright 0 1994, by ACADEMIC PRESS LIMITED This book is printed on acid-free paper All Rights Reserved No part of this book may be reproduced in any form by photostat, microfilm, or any other means, without written permission from the publishers

A catalogue record for this book is available from the British Library ISBN 0-12-0317344

Typeset by J&L Composition Ltd, Filey, North Yorkshire Printed in Great Britain by T.J. Press (Padstow) Ltd, Padstow, Cornwall

CONTRIBUTORS TO VOLUME 34 P.J. BRINDLEY,Molecular Parasitology Unit, and Tropical Health Program, Queensland Institute of Medical Research, The Bancroft Centre, 300 Herston Road, Brisbane, Queensland 4029, Australia J.M. CRAMPTON, Wolfson Unit of Molecular Genetics, Liverpool School of Tropical Medicine, Liverpool L 3 5 Q A , U K C.H. GREEN, Department of Veterinary Medicine (Tsetse Research Group), Bristol University, Langford, Bristol BS18 7DU, UK

R. HALL,Department of Biology, University of York, York Y O 1 5 D D , UK D.W. HALTON, Comparative Neuroendocrinology Research Group, School of Biology and Biochemistry, The Queen’s University of Belfast, Belfast BT7 I N N , Northern Ireland, UK A. G . MAULE,Comparative Neuroendocrinology Research Group, School of Clinical Medicine, The Queen’s University of Belfast, Belfast BT7 I N N , Northern Ireland, U K

C . SHAW,Comparative Neuroendocrinology Research Group, School of Clinical Medicine, The Queen’s University of Belfast, Belfast BT7 1N N , Northern Ireland, U K

D . SMART,Comparative Neuroendocrinology Research Group, School of Clinical Medicine, The Queen’s University of Belfast BT7 I N N , Northern Ireland, U K A.P . WATERS,Department of Parasitology, Postbus 9605, 2300 R C Leiden, The Netherlands

V

This Page Intentionally Left Blank

PREFACE As readers will already have noticed, Advances in Parasitology has had a “face lift” - a redesigned cover and some typographical changes which will, we hope, serve to make the series more attractive and a little easier to read. Coupled with these changes we intend to increase the frequency of publication from annual to roughly biannual. By so doing we hope to be able to give better coverage to the many recent and exciting advances brought about by the application of new approaches in molecular parasitology, immunology and epidemiology of parasitic diseases. In order to help with this new initiative the series has also acquired a third editor, Dr David Rollinson of the Department of Zoology at the Natural History Museum in London. David Rollinson will be known to most, if not all, readers of Advances in Parasitology both as a highly respected parasitologist and as an editor of various books on the subject. We, the “old timers” (John Baker and Ralph Muller) warmly welcome him as a long-time friend and new colleague, and we feel sure that, with these changes, the series is established on a firm base for continued expansion into the 21st century. The volume starts with two reviews concerned with molecular studies in relation to malaria, one concerned primarily with the insect vectors, the other with the parasites. Malaria is an increasingly important health problem in the world today. Effective control has been hampered by the development of insecticide resistance by the mosquito vectors and of drug resistance by the malaria parasite. Julian Crampton of the Liverpool School of Tropical Medicine reviews two important areas of research, both of which concern vector biology and malaria control. The first is the use of DNA probe technology to improve vector identification techniques. Many mosquito vectors are members of sibling species complexes which cannot be easily distinguished by morphological characters. There is a need to identify species in control programmes as the different species within a complex may exhibit differences in ecology, vectorial capacity and response to control measures, and new methods of DNA analysis can provide much needed alternatives for mosquito identification. The second area of research is quite novel and concerns the genetic manipulation of anophelines so as to disrupt the transmission cycle. The advent of vii

viii

PREFACE

recombinant DNA technology and transgenic techniques now provides the means for the controlled genetic manipulation of vector genomes by the direct introduction of DNA into the insect germ line. A fascinating insight into the development of transgenic techniques for mosquitoes is provided, and the potential value and use of this remarkable technology are detailed. Ribosomal RNA (rRNA) genes have been the subject of a number of detailed studies in recent years. Andrew Waters from the University of Leiden reviews the impact of such studies as they relate to the genus Plasmodium by considering three research areas: molecular biology, molecular phylogeny and diagnostics. This work clearly shows how unsuspected and interesting biological findings can emerge from detailed molecular research. Plasmodium species appear to have evolved an apparently unique response to the problem of living in mosquitoes and vertebrate hosts, and that is the switching ribosome. Two different types of rRNA gene, each containing unit specific sequence elements, are expressed in a stage specific manner. Nucleotide sequences of rRNA genes can be useful for constructing phylogenies. One of the intriguing findings, confirming earlier suspicions, is that the major human pathogen P . fulciparum has a unique and distant relationship to other human and primate malarias. Sequence variation within the rRNA gene has also been exploited in polymerase chain reaction based diagnostic tests for the detection and identification of the malaria parasite - all this from one gene family! A question that has taxed many parasitological minds is the extent and nature of molecular mimicry between parasite and host. Roger Hall from the University of York provides a refreshing and detailed overview of this topic and concludes that the existence of molecular mimicry as an adaptation of parasites to their hosts is an undoubted reality. He explores this fascinating area by first considering what is meant by molecular mimicry, how it might be studied, the consequences to host and parasite, and how widespread is it. Numerous examples of mimicry, some of them speculative, are considered and placed in four main classes: cytoadhesive proteins and their receptors; effectors of the immune system; hormones, serum proteins and their receptors; and cytoskeletal and muscle proteins. There are difficulties in recognizing and providing clear evidence for mimicry but in a few cases compelling explanations are available with some of the best examples being associated with microbial infections and autoimmune syndromes. Traditionally, research on the chemotherapy and the immunology of parasitic infections has been carried out independently and the interaction and possible synergy between the effects of drugs and the immune response of the host has been little studied. Recently, enhancement or even dependence of effective chemotherapeutic action on host immune defences has been reported in various parasitic infections and Paul

PREFACE

ix

Brindley from the Queensland Institute of Medical Research reviews new and important studies linking the efficacy of antischistosomal drugs to host immunological responses to schistosomes. He concludes that achieving a semi-immune state through repeated infection, or perhaps through vaccination, may allow lower curative doses of antischistosomal drugs to be used than in non-immune patients. While neuroendocrine secretion in vertebrates has been recognized for several decades, many new regulatory peptides have been identified and isolated in the last twenty years. More recently, research on the origins of peptidergic signalling in invertebrate neurons has been made possible by advances in the techniques of radioimmunoassay and immunocytochemistry. David Halton and colleagues at the Queen’s University in Belfast have been in the forefront of research in helminth neuropeptides, and here review this exciting and fruitful field of study. Many newer anthelmintics appear to act against parasite neuromusculature and it is likely that, when helminth regulatory peptides and their receptors have been fully characterized and a physiological function assigned to them, they will prove valuable as targets for drug action. The very elegant results which can be obtained demonstrating neuropeptide immunoreactivity in whole mounts of platyhelminths are illustrated by the cover photograph. Finally, Chris Green (University of Bristol) has contributed an excellent review of the possibility of tsetse control by trapping. Although not a new topic, having been tried since at least 1910 with varying degrees of success (see Glasgow, J.P. and Potts, W.H., 1970, in “The African Trypanosomiases” edited by H .W. Mulligan; London: George Allen and Unwin, for a history of the early work), considerable advances have been made in recent years -largely as a result of greater understanding of what attracts Glossina to traps and the work of Einar Bursell, Chris Green and others on the use of olfactory attractants based originally on chemicals in the breath of cattle. With increasing fears about the development of insecticide resistance by insects, and the recognition of the adverse ecological effects of wide-scale application of insecticides, the “ecologically friendly” method of trapping has once again come to the fore amongst methods of controlling tsetse and, hence, both human and animal African trypanosomiasis. JOHN BAKER RALPH MULLER DAVID ROLLINSON

This Page Intentionally Left Blank

CONTENTS CONTRIBUTORS TO VOLUME 34 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . PREFACE. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

v vii

Molecular Studies of Insect Vectors of Malaria J.M. Crampton 1. General Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 2. DNA Probes for the Identification of Malaria Vectors . . . . . . . . . . . . . . . . . . 3 3. Genetic Manipulation of Malaria Vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25

The Ribosomal RNA Genes of Plasmodium A.P. Waters

.........................

1. Introduction . . . . . . . . . . . . . .

3. Inferences of Phylogeny Based 4. Species Identification Based on Ribosomal RNA .......... ..................................

34

65

.............................

Molecular Mimicry R. Hall Introduction . . . . . . . . . . . . . . . .......................... Adaptive Mimicry ...................... Consequential Mimi : Autoimmunity . . . . . . . . . . . . . . . . . . . . . . . . . . How Does Molecula Considerations . . . . . . 5. Conclusions . . . . . . ........................ Acknowledgements References . . . . . . .

1. 2. 3. 4.

xi

81

118

xii

CONTENTS

Relationships Between Chemotherapy and Immunity in Schistosomiasis P.J. Brindley 1 . Introduction . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . 134

134 . . . . . . . . . . . . . . . . . . . 135 136 5. Antimonials . . . ............................. 137 . . . . . . . . . 139 ....................................... 143 ............ . . . . . . . . . . . . . . . . . . . 155 ...................................... 156 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . 156

3. Schistosomicidal Chemotherapy

Regulatory Peptides in Helminth Parasites D.W. Halton, C. Shaw, A.G. Maule and D. Smart 1. Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2. Occurrence and Distribution of Regulatory Peptides in Helminths . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ....... ... 3. Quantification and Characterization of Regulat es in Helminths . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .............. 4. Isolation and Structure of Helminth Regulatory Peptides . . . . . . . . . . . . . . . 5. Evolutionary Aspects of Helminth Regulatory Peptides . . . . . . . . . . . . . . . . 6. Functional Aspects of Helminth Regulatory Peptides . . . . 7. Future Developments . . . . . . . . ................... Note Added in Proof . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . .............................

164 168

184 195 201 214 217

Bait Methods for Tsetse Fly Control C.H. Green 1. 2. 3. 4. 5.

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Attractants for Tsetse Flies . . . . . . . . . . . . . . . Bait Systems for Tsetse Control . . . . . . . . . . . . Programmes of Tsetse Control Using Bait Systems .................... Conclusions . . . .

.......................................

258

276

Molecular Studies of Insect Vectors of Malaria Julian M. Crampton Wolfson Unit of Molecular Genetics, Liverpool School of Tropical Medicine, Liverpool, L3 5QA, UK

1. General Introduction

.....................................................

2. DNA Probes for the Identification of Malaria Vectors . . . . . . . . . . . . . . . . . . . . . . . . 2.1. Current methodsfor the identification of malaria vectors . . . . . . . . . . . . . . . . 2.2. Approaches to developing DNA-based methods for identification purposes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.3. Development of a DNA probe method for the simple identification of malariavectorspecimens . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.4. DNA probes for vector identification: the future . . . . . . . . . . . . . . . . . . . . . . . .

1 3 3 5 7 8

3. Genetic Manipulation of Malaria Vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 3.1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 3.2. The requirements for genetic manipulation . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9 3.3. The potential application of transgenic technology to malaria vectors . . . . . . 21 3.4. Transgenic mosquitoes: the future in relation to the control of malaria . . . . . 25 Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

25

References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

25

1. GENERAL INTRODUCTION

Despite enormous efforts over many years, malaria is an increasingly important health problem in the world today. Some 500 million people are estimated to be affected each year, with approximately 3 million deaths (Sturchler, 1989). The incidence of this disease is increasing due largely to the development of insecticide resistance by the mosquito vectors and by the appearance of drug resistance in the malaria parasite. These factors are exacerbated by migration of increasing numbers of people from non-endemic areas to regions where malaria is prevalent. ADVANCES IN PARASITOLOGY VOL 34

ISBN 0-12431734-6

Copyright0 1994 Academic P m s I.rmifed A / / ngho ofrepruducrion in m y furm reserved

2

JULIAN M. CRAMPTON

Research over the last century has increased our understanding of the complex relationship between insect vectors, the parasite causing the disease and the human host. One way of interrupting this cycle is to suppress the insect which acts as the vector and a number of techniques have been tried. These include chemical control through insecticides and larvicides, biological control through natural predators or toxins, such as that produced by Bacillus thuringiensis, environmental control through the removal of breeding sites and the raising of public awareness and genetic control through the mass release of sterile males. Another genetical approach, which may become a possibility through the advent of recombinant DNA technology, would be to compromise the vectorial capacity of the insect. Despite the current trend towards integrated pest management, in which several approaches are used in combination to suppress insect populations, the main emphasis for mosquito control has been the elimination of breeding sites and the application of chemical agents. There are now considerable problems associated with the use of synthetic insecticides. The most important of these is the seemingly inevitable evolution of resistance and there are now populations which are multiply resistant to all four classes of insecticidal compound (organophosphates, organochlorines, carbamates and pyrethroids). Coupled with this is the high cost of developing and registering new insecticidal variants, increasing legislation over their use and growing environmental awareness over their toxic residues. Genetic control, through the mass release of sterile male mosquitoes, has also been attempted but with little success (Grover, 1985). This is now thought to be due to the poor competitive mating ability of treated males following chemical or radiological sterilization. Less traumatic sterilization treatments may increase the effectiveness of such a strategy, as demonstrated by the successful eradication of the screw-worm fly from the Southern USA (Krafsur etal., 1987). However, such autocidal strategies of population control often prove prohibitively expensive since they involve the repeated mass release of treated males (McDonald et al., 1977). The problems associated with the widespread and continuing reliance on chemical insecticides has stimulated interest in alternative methods for malaria control. What is required is the development and evaluation of a new generation of methodologies which will have a profound and longlasting effect on malaria transmission. Clearly, biotechnology and molecular biology can play a central role in the search for, and production of, such new tools. The development of potential antimalarial vaccines and biotechnologically produced larvicidal compounds are obvious examples of the power of the approach. Perhaps surprisingly, this technology has not been applied to the anopheline vectors of malaria until very recently.

MOLECULAR STUDIES OF INSECT VECTORS OF MALARIA

3

Advances in the molecular analysis of vector-parasite relationships and vector molecular biology now make such an approach very attractive especially as past experience has shown that vector control is an effective way of disrupting malaria transmission. Two applications of molecular biology will be considered in relation to vector biology and malaria control. The first is the utilization of DNA probe technology to improve vector identification techniques. The aim here is to enhance the efficiency of existing control measures by providing accurate data about vector populations. The second is a completely revolutionary approach to malaria control through genetic manipulation of anophelines so as to disrupt the parasite transmission cycle. There are many other areas where molecular biology will have a profound impact on our understanding of the insect vectors of malaria. However, these two examples serve to emphasize the power of this technology and they are reviewed below.

2. DNA PROBES FOR THE IDENTIFICATION OF MALARIA VECTORS 2.1. Current Methods for the Identification of Malaria Vectors

Many mosquito vectors are members of sibling species complexes. Sibling species are reproductively distinct but cannot be distinguished by morphological features alone and require alternative methods for identification. It is important to distinguish these species in control programmes as the different species within a complex may exhibit differences in ecology, vectorial capacity and response to control measures (White, 1982). There are a number of techniques available for the identification of vector specimens and these are discussed below. The definitive method for species identification of mosquito malaria vectors such as the Anopheles gambiae complex, which includes the major vectors of malaria in Africa, is to perform crossing experiments of the offspring of the unknown specimen against laboratory colonies of known species (Davidson, 1964, 1966; Davidson and Hunt, 1973). Although this method has been of great value in the elucidation of species within a number of anopheline complexes, it is far too laborious and time consuming to use for routine identification of individuals. Many external morphological characteristics of anopheline species have been examined in an attempt to identify species-specific features. In the Anopheles gambiae complex, some characteristics of Anopheles melas are fairly reliable for separation of this species from freshwater Anopheles

4

JULIAN M. CRAMPTON

gambiae (Ribbands, 1944; Muirhead-Thompson, 1948). However, no reliable features have been found which allow the identification of the other species in this complex. The most reliable and widely used method for species identification is that of the polytene banding technique (Coluzzi and Sabatini, 1967, 1968, 1969; Green, 1972; Davidson and Hunt, 1973; Coluzzi et al., 1979). For species of the Anopheles gambiae complex, this technique allows the separation of the three freshwater species, Anopheles gambiae s.s., Anopheles arabiensis and Anopheles quadriannulatus by diagnostic X chromosome inversions, and identification of the other species using more subtle autosomal features. The main disadvantages of this method are that identification is limited to fourth instar larvae or semigravid blood-fed females and that the technique requires a good deal of skill to perform. The number of specimens which may be processed in a given time is also limited. Isoenzyme typing (Mahon el al., 1976; Miles, 1976, 1978) is also routinely used in some laboratories for species identification. This method relies on different species having different electromorphs of a number of enzymes. Starch gel electrophoresis is usually used and, in some cases, the gel is split to allow the assay of two different enzymes. This technique is time consuming and relatively expensive in terms of equipment and materials. The number of specimens which may be processed individually is also limited and some specimens give anomalous results. Specimens must be stored frozen in liquid nitrogen prior to identification due t o the lability of the enzymes on which the technique relies. The use of cuticular and internal hydrocarbons to identify Anopheles gambiae species has been investigated (Carlson and Service, 1979, 1980; Hamilton and Service, 1983). In this technique hydrocarbons are extracted using an organic solvent and analysed by gas chromatography. This method has not been fully evaluated, but the requirement for sophisticated equipment to obtain and handle data, together with the time-consuming nature of identification by this equipment makes this an unlikely technique for routine species identification. Some success in differentiating Anopheles gambiae sibling species using the fluorescent stain, Hoechst 33258, has been described (Gatti et al., 1977; Bonaccorsi et al., 1980). This reagent preferentially stains A-T rich regions in DNA and so allows the position of heterochromatic blocks of DNA to be visualized on mitotic chromosomes. Unfortunately, in addition to major differences in banding patterns between species, a significant level of intraspecies variation is also evident. This geatly reduces the potential of this method for routine species identification.

MOLECULAR STUDIES OF INSECT VECTORS OF MALARIA

5

2.2. Approaches to Developing DNA-based Methods for Identification Purposes

The problems discussed above have led to the investigation of DNA probe technology which is cheap, accurate and easy to use. There are essentially three approaches which may be taken when developing identification techniques based on DNA technology and these are discussed below. 2.2.1. The Directed Approach The first, which may be termed an orientated or directed approach, involves the cloning of a DNA sequence which has a high probability of displaying sequence variation between the species within a complex. An example of such a sequence is the ribosomal DNA. There are multiple copies of these genes in all organisms; each copy of the gene cluster is separated by spacer regions (Gale and Crampton, 1989). It is the DNA sequence of these spacer regions which commonly varies significantly between closely related species. Probe systems can, therefore, be generated which take advantage of this variation to identify each specimen. A number of researchers have utilized this approach to generate speciesspecific probes. One good example is the work of Collins et al. (1987, 1988) who defined probes which could be used to identify mosquitoes of the Anopheles gambiae complex. The method involved extracting the DNA from each specimen, digesting the DNA with restriction enzymes and fractionating the DNA by agarose gel electrophoresis. Subsequently, the digested DNA was transferred to nitrocellulose by Southern blotting following denaturation and hybridized to the 32P-labelled DNA probe. Specimens could then be identified by the size of the resulting band following autoradiography of the hybridized Southern blot. More recently, the same group have modified this procedure to utilize the polymerase chain reaction (PCR) for vector identification (Paskewitz and Collins, 1990). A set of three DNA primers has been derived from the ribosomal gene region of species in the Anopheles gambiae complex. Purified DNA isolated from each mosquito specimen is mixed with the primers and a PCR reaction carried out. Depending on the species of the specimen, an amplification product characteristic of that species is generated during the reaction and this can be visualized by agarose gel electrophoresis. This technique has great potential for species identification, although the reagents for PCR amplification are not cheap. 2.2.2. The “Shotgun” Approach The second method for generating DNA probes may be termed a “shotgun” approach. This involves the selection of any piece of DNA from

6

JULIAN M. CRAMPTON

the genome of the insect which is present in one of the species of interest but not in the others. Such a probe lends itself to being used in a very simple assay as it gives a yes-no answer, i.e. the target DNA sequence is either absent or present and thus gives a simple and unambiguous answer. Thus, in the ideal situation, a series of such probes, one for each of the species within a complex, will allow each specimen to be identified. A drawback to the method is, however, that a series of probes may be required to identify fully each mosquito specimen. The progress which has been made towards the development of this type of DNA probe system is described more fully in section 2.3. 2.2.3. Random AmpliJied Polymorphic DNA (RAPDs) The RAPD technique is PCR based and permits scores of markers to be assayed on DNA extracts from a single mosquito (Williams et al., 1990, 1993). In order to achieve this, the RAPD PCR reaction uses a single, short primer (usually about 10 bases in length) of a randomly chosen sequence. For a RAPD band to be produced during the PCR reaction, the primer needs to anneal to a binding site which is within 2-3 kilobase pairs of another oppositely orientated binding site. Where this occurs, the single oligonucleotide primer can prime amplification in both the forward and reverse direction resulting in the production of a PCR product. A typical RAPD reaction produces multiple amplification products, each representing a discrete genetic locus, and these can be readily fractionated and analysed by agarose gel electrophoresis. RAPD bands display a high degree of polymorphism so that screening taxa of interest with a number of different primers has proved to be a very rapid method for generating species-specific markers (Arnold et al., 1991). Another advantage of the RAPD technique is that RAPD markers derive from multiple loci and thus have the potential to provide information on the genetic structure of a population. Recently, Wilkerson et al. (1993) have begun to apply the RAPD technique to species of the Anopheles gambiae complex of mosquitoes. They have made a preliminary survey of a large number of RAPD primers in order to identify differences in the PCR products between Anopheles gambiae S . S . and Anopheles arabiensis. Seven primers produced diagnostic bands for these two species. The approach clearly has potential although the technique has to be used with caution. For example, the reproducibility of the PCR reactions is not reliable so that even fairly strong RAPD bands will occasionally fail to be produced in a particular amplification reaction; the absence of bands should not be used to draw inferences without confirmation from a number of duplicate reactions; in some cases there has also been difficulty in

MOLECULAR STUDIES OF INSECT VECTORS OF MALARIA

7

reproducing the same RAPD product profile using the same primers, template and reaction conditions between different laboratories.

2.3. Development of a DNA Probe Method for the Simple Identification of Malaria Vector Specimens

By using the “shotgun” approach we have developed DNA probes for the identification of species in the Anopheles gambiae complex which includes the major vectors of malaria in Africa. Six species within this complex have been identified on the basis of mating incompatibility (Davidson et al., 1967) - Anopheles gambiae s . s . , Anopheles arabiensis, Anopheles quadriannulatus, Anopheles melas, Anopheles merus and Anopheles bwambe. The first two are the most important vectors and are widely distributed throughout tropical Africa. Differential screening of clone banks generated from the DNA of each of those species has allowed the isolation of a number of cloned DNA probes which may be used for the identification of five of the six species in the complex (Gale and Crampton 1987a, b, 1988). In a similar way, DNA probes have also been developed to distinguish species in the Anopheles dirus complex (Panyim et al., 1988a, b) which are major vectors in Thailand and species of the Anopheles farauti complex of Australia (Cooper et al., 1991; Booth et al., 1991). Subsequent work has been directed towards refining these DNA probes and simplifying the methods for using them so that they become available for entomologists in the field. One of the major refinements has involved simplification of the sample preparation technique so that now all that is required is to squash a portion of the mosquito specimen, usually the head, directly onto a nylon filter membrane (Hill et al., 1991a). A further refinement has been to derive short oligonucleotide DNA probes from the original cloned sequences for both the Anopheles gambiae probes (Hill et a l . , 1991b) and the Anopheles furauti probes (Hartas et al., 1992). Such oligo-probes have a number of advantages for vector identification. First, they are cheap and easy to synthesize chemically; second, they may be tagged during synthesis so that they can be used with a variety of reporter molecules other than radiochemicals; and third, the kinetics of hybridization using singlestranded oligo-probes are such that the time taken for the identification process can be greatly shortened (Crampton et a l . , 1989). In addition to the use of oligo-probes, the conditions for hybridizing the probes have been greatly modified. The aim here has been to reduce both the reliance on laboratory equipment and the complexity of the hybridization solutions so that they are both cheap and very stable. It is now possible to carry out the whole process at room temperature and with a very simple

8

JULIAN M. CRAMPTON

hybridization solution which can be pre-mixed as a dry powder and stored for long periods at room temperature (Hill et al., 1992). A major drawback of DNA probe systems is that they have previously relied on the use of radiochemical labelling as a means for detecting hybridization to a target DNA sequence. Major advances in the utilization of nonradioactive reporter molecules have now made it possible to incorporate these techniques into a simplified vector identification protocol. A comparison of the available non-radioactive labelling and detection techniques has shown that the E-link plusTMsystem produced by ICI does not suffer from background problems, is the most sensitive and the cheapest ( 2 4 centslspecimen) of the current alternative systems (Hill et al., 1991a). In addition, it may be used with squash-blotted specimens (i.e. the DNA does not have to be isolated or purified from each specimen) and the result can be detected either as a colour change on the filter or by photographic detection of chemiluminescence. Similar results using the non-radioactive system have been reported by Cooper et al. (1991) using cloned probes to identify species of the Anopheles farauti complex. Further refinements of the detection system are underway to shorten and simplify this aspect of the process. The systems which have evolved for the use of DNA probes for mosquito identification are easy and quick to use and, above all, are cheap enough to allow many specimens to be identified at minimal cost. Indeed, the methodologies in their present form are now being assessed by a number of laboratories by comparing them with existing identification techniques (Collins et al., 1988). 2.4. DNA Probes for Vector Identification: The Future

An important aspect of this technology is that the method can be used with any probes which may be developed in the future. In addition, probes which would provide other useful epidemiological data, such as those for Plasmodium falciparum detection (Delves et al., 1989), blood meal analysis, or insecticide resistance determination could also be incorporated into this methodology. Hopefully, with further improvements and simplification of the technique and the development of probes for a range of mosquito species complexes, DNA probes technology may shortly realize its full potential in the field of mosquito identification. 3. GENETIC MANIPULATION OF MALARIA VECTORS 3.1. Introduction

Control of insect populations by genetic means is not new. A number of vector control programmes have utilized the mass release of sterile

MOLECULAR STUDIES OF INSECT VECTORS OF MALARIA

9

males, the generation of cytologically induced sterility through translocation and the use of mating behaviour to transfer lethal or sterilizing agents between the members of insect populations. The advent of recombinant DNA technology and transgenic techniques, however, now provides the means for the controlled genetic manipulation of vector genomes by the direct introduction of DNA into the insect germ line. Such manipulation of medically important insects would enable desirable modifications to be inherited by subsequent generations, potentially removing the need for frequent mass releases. Two particular advantages of using transgenic technology over classical genetics for future manipulation are evident and should be emphasized. One is the potential to exploit genes and gene constructs across species barriers, and the other the ability to introduce particular, defined sequences without the genome disruption of a conventional cross. The ability to introduce and express foreign genes and/or disrupt existing gene functions may lead to the development of a variety of control strategies. It may be possible, for example, to produce pathogen refractory strains, to reduce reproductive potential or vector competence, or to increase vector susceptibility to existing control measures. Clearly, the usefulness of genetic manipulation as an approach to the control of insect-borne disease has first to be assessed and there will be many practical, and perhaps ethical, difficulties to overcome. Nevertheless, transgenic technology clearly has considerable potential both for the furtherance of our understanding of mosquito molecular biology and for the development of novel genetic control strategies. 3.2. The Requirements for Genetic Manipulation

Despite the dramatic advances made recently with respect to genome manipulation in Drosophilu melunoguster there is an urgent need for a much greater understanding of the molecular biology of mosquito disease carriers. This must include an analysis of the complexity and organization of their genomes and an understanding of the distribution of coding and repetitive sequences. These details form an integral part of the design and interpretation of cloning and hybridization experiments. In addition, the exploitation of transgenic technology requires methods for the introduction of DNA both into living mosquitoes and into cultured cells. Ideally, this will involve a transformation vector which is capable of directing efficient and stable integration into the chromosomes of the recipient. The introduced DNA has not only to be expressed but should also carry a selectable marker for the identification of transformed individuals or cells. Ultimately, there will be a need to study alternative promoter and enhancer sequences so that the spatial and temporal expression of the

10

JULIAN M. CRAMPTON

introduced DNA may be controlled. Finally, none of this will be of any relevance unless appropriate genetic target systems can be identified, cloned and characterized at the molecular level. 3.2.1. Genome Organization and Complexity

If the genomes of insect disease vectors are to be manipulated in a controlled and directed fashion, it is important to determine the size of the genomes involved. Genome organization, that is the nature and dispersion pattern of repetitive sequences and how they are organized in relation to the coding sequences, is also important. This is because it will have a profound influence on the types of manipulation which can be envisaged and the approaches to be adopted in order to identify and to clone sequences of interest. Until recently, very little was known about the size and organization of mosquito genomes. However, the DNA of all higher eukaryotes is conveniently subdivided into three components, namely highly repetitive, moderately repetitive and unique or single copy sequences and the organization of these components can be determined through experiments which involve denaturing the DNA and measuring the reassociation of complementary strands over time. Generally, highly repetitive sequences will reassociate most quickly since there are so many copies, whereas unique sequences will reassociate more slowly. The complexities of these components and of the total genome are determined by comparing the reassociation values with that of a single copy sequence of known complexity, namely E. coli DNA. Of equal importance, however, is the way in which the different components are distributed throughout the genome. Black and Rai (1988) suggest that the existence of two basic organization patterns throughout all higher eukaryotes is indicative of a set of rules governing the establishment and spread of repetitive elements. The first pattern is known as short period interspersion (SPI), in which 1-2 kb segments of single copy sequence alternate regularly with short (0.2-0.6 kb) or moderately long ( 1 4 kb) repetitive sequences. This pattern is characteristic of the majority of animal species. The second pattern, long period interspersion (LPI), is characterized by long (5-6 kb) repetitive sequences alternating with very long (> 13 kb) uninterrupted stretches of unique sequence DNA. Clearly, the evolution of such organization is an interesting phenomenon in itself and the family Culicidae (to which the mosquitoes belong) may be of particular interest. According to Black and Rai (1988), this is the only family so far shown to contain species exhibiting both patterns of organization and it may, therefore, explain how the transition from one to the other occurs. Black and Rai (1988) have analysed the genomic DNA from four species of mosquito, namely Anopheles quadrimaculatus, Culex pipiens, Aedes

11

MOLECULAR STUDIES OF INSECT VECTORS OF MALARIA

albopictus and Aedes triseriatus. More recently, Cockburn and Mitchell (1989) have shown that the genomes of anopheline mosquitoes are generally relatively small and exhibit the LPI pattern of repetitive sequences. For example, the genome of Anopheles gambiae, the major mosquito vector of malaria in Africa, has a genome size of 2.7 x 10' bp (Besansky and Powell, 1992). This is in marked contrast to Aedes aegypti which has the more complex SPI pattern (Warren and Crampton, 1991). The Aedes aegypti genome is also relatively large (8.3 x 10' bp), being five times the size of the Drosophila genome or, to place this in context, one third the size of the human genome. Thus, almost every clone isolated from Aedes aegypti genomic libraries will contain repetitive DNA and this may well mask the hybridization characteristics of sequences of interest (particularly single copy sequences) when using complex genomic probes. This is in direct contrast to organisms like Drosophila or Anopheles, which display the LPI pattern, where cloned sequences are more likely to consist entirely of either repetitive or unique DNA. In insect studies to date, Anopheles quadrimacufatus, Anopheles gambiae and Drosophila melanogaster have been shown to exhibit the LPI pattern (Cockburn and Mitchell, 1989). Conversely, Aedes aegypti, Culex pipiens, Aedes triseriatus and Aedes albopictus exhibit the SPI pattern (Black and Rai, 1988; Crampton et al., 1990b). Clearly, there appears to be no simple relationship between genome size and organization.

3.2.2. Codon Usage in Mosquitoes The number of mosquito genes which have been cloned and sequenced is still very limited. However, sufficient sequences are now available for Aedes aegypti, Aedes albopictus and Anopheles gambiae to be able to begin the analysis of codon usage for these species of mosquito. In the case of the two species of Aedes mosquitoes, there is some preference for C G at the third base position, but this is not a general rule (Argentine and James, 1993). A comparison of codon usage for three homologous genes, an amylase, maltase and trypsin, of Aedes aegypti and Drosophila melanogaster showed that Drosophifa has a much stronger bias for C G at the third base when compared with Aedes. These conclusions are, however, limited by the very small sample size for the construction of the codon usage tables. In the case of Anopheles gambiae, rather more sequences have been determined, including 14 chromosomal genes (Besansky, 1993). There is variation in the degree of codon bias among the chromosomal genes, with a general bias in favour of C G at the third base position. Thus, although there are some general similarities in codon usage between Aedes, Anopheles and Drosophila in the preference for G and C-ending codons, it would

+

+

+

12

JULIAN M. CRAMPTON

appear that each has evolved a distinct pattern of codon usage. Such codon preferences will clearly be of relevance when it comes to the preparation of oligonucleotide probes and PCR primers for the identification and cloning of mosquito homologues of genes previously described in Drosophila. 3.2.3. Genome mapping

The molecular mapping of a number of insect genomes other than Drosophila has now been initiated. Foremost amongst these, is the programme which aims to map the genome of the mosquito, Anopheles gambiae, and uses the approach initially developed for the molecular mapping of the Drosophila genome (Saunders et al., 1989; Siden-Kiamos et al., 1990). A preliminary, low-resolution map for part of this genome has been generated using PCR-amplified, microdissected segments from polytene chromosomes as segment-specific probes and markers (Zheng et al., 1991). It is hoped that a complete molecular map will be generated which can then be correlated with the genetic map and the very detailed cytological map which is available for this insect. Such maps will be of considerable benefit when the mobility of potential DNA vector systems are to be tested, and to explore the nature of transgene integration events and their long-term stability in insect genomes. 3.2.4. Methods for Introducing DNA into Mosquito Embryos and Adults

(a) Microinjection of embryos. Here, we describe the system which we have developed in our own laboratory for transformation of the mosquito Aedes aegypti (Morris et al., 1989). However, similar techniques have been used elsewhere both for Anopheles and for other Aedes species, and all are based in general on the methods developed for Drosophila melanogaster. Unlike that of Drosophila, the rigid, opaque endochorion of the mosquito embryo cannot be removed, and the embryos are extremely sensitive to desiccation. However, glass capillaries with tips of 100-300 pm X 4-10 pm can be used to puncture the rigid endochorion without tearing it and deliver the DNA solution without damage to the embryo. The slightly viscous DNA solution cannot be expelled manually from such a fine needle and is therefore injected by means of a two-phase nitrogen supply. The lower pressure prevents backflow and the higher pressure delivers 160-800 pl of DNA solution (corresponding to 1-5% of the embryo volume) into the posterior pole of the embryo at the syncytial blastoderm stage, before cell partitioning occurs. This is where the pole cells, which are the germ line primordia, develop. Experience from Drosophila suggests that injection of DNA close to the site of pole cell formation is not critical to germ line incorporation, but the timing is clearly important if the DNA

MOLECULAR STUDIES OF INSECT VECTORS OF MALARIA

13

is to be taken up by the developing germ line cells. All of our injections are normally completed within 2 h of oviposition. Diving and after injection, the embryos are covered with a water-saturated halocarbon oil, which permits the normal uptake of water until they are returned to standard insectary conditions. In this way DNA has been introduced into mosquito embryos (Miller et a f . , 1987; McGrane et al., 1988; Morris et al., 1989), with survival rates comparable to those obtained with Drosophila (Spradling and Rubin, 1982). (b) The biolistic technique. The biolistic technique, which uses high velocity DNA-coated, tungsten microprojectiles to deliver DNA directly into the nuclei (Sandford et al., 1993), has been successfully applied to introduce DNA into large numbers of dechorionated Drosophifa embryos (Baldarelli and Lengyel, 1991). Transient expression from the P160 construct, a plasmid containing the actin 5C promoter fused to the E. cofi P-galactosidase gene, was detected. In addition, one germline transformation event was obtained when embryos were bombarded with the pn25.7wc helper and the P element vector 2pCasPeR in a ratio of 1:1.7. Once this method has been optimized it will have the advantage that a very large number of embryos (between 3000-5000) may be bombarded in one experiment, thus overcoming the time-consuming microinjection process. This would be particularly advantageous in a situation where microinjection survival rates are low and/or the microinjection process is difficult. These considerations have led Mialhe et al. (1992) to test the biolistic method for gene transfer in Anopheles gambiae mosquitoes. In these experiments a construct made up of the luciferase gene under the control of the Drosophifa heat shock promoter, hsp70, was used as the reporter gene system. Transient expression of the reporter gene was detected, and experiments are currently underway to select for stable transformants using the biolistic method and a construct which incorporates a selectable marker. (c) Sperm-mediated gene transfer. Considering reports of spermmediated gene transfer in rabbits, sea urchins, mice and chickens, some efforts have been directed towards determining whether or not insect sperm can transfer genes. The honey bee, Apis meffifera,has been used to examine this transformation technique, and was investigated by inseminating honey bee queens with sperm that had been incubated with a 1 kb linear DNA fragment, and assaying the DNA of Go progeny by the polymerase chain reaction (Milne, 1992). Preliminary evidence indicates that DNA incubated with bee sperm was present in about 30% of the progeny, appeared to be in the genome, only occurred in a fraction of the cells, and was probably not transferred by incorporation into the sperm genome. These preliminary results indicate that honey bee sperm can transfer genes into the genome. This method may represent an attractive

14

JULIAN M. CRAMPTON

alternative to microinjection in gene transfer technology in terms of its ease, success rate and broad applicability to other insects, but to date has not been attempted with insects other than the honey bee. This technique may work in other insects for which instrumental insemination with sperm has not been perfected by placing a concentrated DNA-containing solution in the reproductive tracts of females before natural mating to treat the sperm in vivo. However, it is clear that there is still a considerable amount of work to be done before sperm-mediated transformation can be considered for the genetic manipulation of mosquito malaria vectors. (d) Transformation of symbionts as a means of introducing genes into mosquitoes. Microinjection of embryos has been the system which has received most attention to date for producing transgenic insects. Another very interesting possibility is the idea of transforming symbionts isolated from the insect gut or ovary with gene constructs and reintroducing them back into the insect vector. This approach has received particular attention in tsetse flies where the gut symbionts have been isolated, cultured and transformed and shown to express the introduced DNA (Beard et al., 1993). The ability to introduce gene constructs into the insect via symbionts may be a very attractive alternative to direct genome manipulation, particularly in the case of gut symbionts, where they would be ideally placed for the expression of antiparasitic agents. Clearly, however, this form of manipulation would not be stable unless the symbionts were inherited in some way. Although this may be true for the Rickettsia-like microorganisms (RLMOs) which are present in the ovaries of tsetse flies and Culex mosquitoes, symbionts such as these would be difficult to reintroduce into the adult fly. In addition, RLMOs have not been detected in anophelines, but some consideration is now being given to the idea of introducing RLMOs isolated from other mosquito species into anophelines. If this is successful and the RLMOs survive and are passed through subsequent generations, this approach may provide a potentially powerful means for introducing specific gene constructs into anopheline mosquitoes. Gut symbionts, although easy to isolate, transform and reintroduce into the insect midgut, nevertheless may prove unsatisfactory as a means to introduce specific genes into large populations of insects as they are unlikely to be passed on to subsequent generations. Thus, although gut symbionts would seem to be ideally placed in terms of the expression of antimalarial factors, they do not seem to provide a realistic mechanism for the creation of mosquitoes which are refractory to the malaria parasite. 3.2.5. D N A Vector Systems Used in Mosquito Transformation Germ line transformation of insects and transfection of cultured cells requires the establishment of appropriate techniques for the introduction

MOLECULAR STUDIES OF INSECT VECTORS OF MALARIA

15

of a eukaryotic D N A transformation vector. This should be capable of directing the efficient and stable integration of D N A sequences into the chromosomes of the recipient, as well as providing some means for the identification of transformants. The transposable genetic P element from Drosophila melanogaster has been used in a variety of insect species in an attempt to create transgenic individuals and appropriate transformation vector constructs are now used as a routine research tool in Drosophila. P elements (Engels, 1988) are a distinct class of transposable element discovered when a syndrome of correlated genetic traits (hybrid dysgenesis) occurred if male flies from P strains (normally from wild populations) were mated with M strain females (normally from laboratory populations). A series of abnormalities resulted, which included high rates of mutation, male recombination, chromosomal rearrangements, sterility, abnormal germline development and meiotic drive. Genetic observations showed that a number of these mutations were unstable and had high reversion frequencies, all of which led to the hypothesis that P strains carry a family of transposable sequences called P elements. The abnormalities only arise in hybrids because of the absence of a repressive factor which, although, not fully understood, is normally found in P strains. It is now thought that P factors have arisen in wild Drosophila only within the past 30 years. The P element family consists of intact elements (2.9 kb) and a heterogeneous group of smaller elements (0.5-2.5 kb) which are derived from the intact element by internal deletion. The intact element encodes a transposase enzyme which catalyses excision and transposition. The smaller elements lack this function and are incapable of transposing themselves. They can, however, transpose when supplied with functional transposase in trans by an intact element. All P elements carry perfect 31 bp inverted repeat sequences at their termini that are absolutely required for excision and transposition. This process results in an 8 bp duplication at the target site. P elements are capable of precise excision which leaves behind a single copy of the 8 bp sequence. More frequently they will excise imprecisely leaving part of the element behind or removing flanking sequences. The pUChsneo transformation vector (Pirrotta, 1988) carries only the inverted terminal repeats of the P element. Between these termini it has been engineered to carry a neomycin resistance gene driven by the Drosophila heat shock promoter hsp70, which serves as a marker for the identification of transformed individuals, and a site where foreign D N A can be ligated. The inverted repeats are joined by 500 bp from the white locus of Drosophila which may function as a hybridization probe to distinguish random integration events from precise P-mediated transposition (Miller et al., 1987). The latter would involve only those sequences within, and including, the inverted terminal repeats of the P element, but excluding the white locus DNA. In our experience, however, this diagnostic feature

16

JULIAN M. CRAMPTON

is limited, perhaps because of a low frequency of precise excisions. The site of integration of foreign DNA within the genome, rather than the precision of the mechanism, is likely to be of greater importance to normal gene expression. Transposition of vector sequences and integration into the genome will only be mediated by the terminal repeats if they are supplied with a functional transposase. A helper plasmid, pUChsn(A2-3), which carries the entire P element transposase coding region is therefore introduced with the transformation vector. Although the helper carries most of the P element sequences, it is unable to transpose and integrate into the genome because of a specific deletion in one of its terminal repeats (Steller and Pirrotta, 1985). The sole function of the helper is therefore to supply transposase and, in Drosophila, further injections of helper have been used to switch transposition on in those generations following the initial transformation. Normally, P element transposition occurs only in the germ line of Drosophila because the intron between open reading frames 2 and 3 of the coding sequence is not removed in somatic tissue. However, transposase expression from constructs which have been modified in vitro to remove this intron does allow transposition in somatic tissue. There is now good evidence that similar processing problems prevent normal P element transposition in non-drosophilids (O’Brochta and Handler, 1988) although excision has been observed in mammalian and yeast cells (Rio et al., 1988). If there is a requirement for non-P element encoded proteins to achieve transposition in Drosophila, then the distribution of homologous genes in related genera may explain the divergent results obtained in other insects. The basis of the experimental design for the creation of transgenic mosquitoes is based on that developed for Drosophila melanogaster. Go individuals which survive microinjection with the P element vector/helper DNA, pUChsneolpUChsx(A2-3), are mated inter-se and allowed to produce progeny. These GI individuals are the first which might be expected to express antibiotic resistance throughout all tissues and larvae are therefore subjected to selection with the neomycin derivative, G418. The molecular nature of any transformation events is determined by DNA analysis using radioactively labelled transformation vector DNA to probe Southern blots of genomic DNA extracted from the putative transformants and their progeny (Miller et al., 1987; Morris et al., 1989). Intact vector P elements have been detected in 5 1 0 % of adults that have developed from injected mosquito embryos (Go), confirming that the introduced DNA is not immediately broken down by the mosquito. Furthermore, we have detected the chromosomal integration of vector DNA in several Go individuals. This probably reflects direct incorporation into a proportion of the somatic cell nuclei since it is only in the following generation (GI)

MOLECULAR STUDIES OF INSECT VECTORS OF MALARIA

17

that we might expect a germ line integration event to have been transmitted to every nucleus. More promisingly, vector DNA has been identified in the chromosomes of the G I and G2 progeny of injected embryos, suggesting that integration has occurred in the germ line of the mosquito and that this DNA shows normal Mendelian inheritance. Some of these events, however, appear to be unstable from one generation to the next and this phenomenon, together with the molecular basis of the transformation events, awaits further investigation. As indicated above, chromosomal integration of the introduced P element DNA has been observed in both Anopheles and Aedes mosquitoes and the integration events appear, in some cases, to be heritable and clearly involve the germ line of the transgenic mosquitoes (Miller et al., 1987; McGrane et al., 1988; Monis et al., 1989). Although these events did not result from normal P element transposition, some functional role of the P sequences can not be excluded. This is particularly true since similar experiments in Lucilia cuprina (Atkinson et al., 1992; T. Howells, personal communication) and Ceratitis capitata (Malacrida et al., 1992; M. Ashburner, personal communication) have failed to produce any integration of vector sequences. Research in other laboratories is now being directed towards the identification of these accessory Drosophila proteins, and the cloning of the genes involved may facilitate high efficiency P transposition in non-drosophilids. However, it is clear from this work and from other experiments involving the transfection of the same DNA into cultured mosquito cells (Lycett et al., 1989) that the P element system in its present form is not suitable for routine use in the mosquito. Thus, whereas the means are currently available for introducing DNA into both mosquito embryonic germ lines and cultured cells, a major stumbling block is the lack of an appropriate, high efficiency, DNA transformation vector system for manipulating the mosquito genome. In addition to the use of the P element-derived DNA vector systems, experiments to assess the mobility of a number of other transposable elements in mosquitoes have been attempted. These experiments have included the use of fully processed cDNA copies of both the Ac and Spm elements from Zea mays (Comley et al., 1992) which have been shown to transpose actively in a number of evolutionarily disparate organisms and may prove to act autonomously in mosquitoes (Kunze and Starlinger, 1989). In addition, experiments involving the introduction of the transposable elements hobo, gypsy and mariner into Anopheles gambiae embryos are currently underway (K. Vernick, personal communication). 3.2.6. The Search for a Mosquito Transformation System It is clear that the germ line integration events so far observed in mosquitoes do not involve normal P element transposition. The absence

18

JULIAN M. CRAMPTON

of this controlled mobility poses certain limitations, for example with respect to transposon tagging for functional cloning (see Section 3.3.1). Research elsewhere is concentrating on the precise mechanism of P transportation and attempts are being made to modify the P element system for more general use (O’Brochta, 1990). Such research may yet lead to the “universal vectors” originally envisaged. At the same time, there is the possibility that P elements may never function as efficient transposition-mediated transformation vectors in mosquitoes. This concern has stimulated the search for alternative systems for the transformation of mosquito vectors of malaria. (a) The FLPIFRT recombinase system in mosquitoes. Low frequency illegitimate recombination events such as those isolated from previous attempts to transform mosquitoes could be utilized effectively if the integrated sequence served as a target for a heterologous high frequency recombination system. Morris et al. (1991) have reported the activity in mosquito embryos of a yeast recombinase, FLP, acting on a specific target DNA sequence, FRT, isolated from the yeast 2 pm plasmid. In a series of experiments, plasmids containing the FLP recombinase under the control of the Drosophila melanogaster hsp70 heat shock promoter were coinjected with target plasmids containing F R T sites. FLP-mediated recombination was detected between: (i) target sites located on separate plasmids resulting in the formation of dimers or higher order multimers and (ii) target sites located on the dimers reformed in (i), leading to resolution of the dimers to their original monomeric forms. Synthetic FRT sites were also used and gave rise to similar results to those obtained using the FRT sites originally isolated from the yeast 2 pm plasmid. This successful demonstration of yeast FLP recombinase activity within the mosquito embryo suggests a possible future application of this system in establishing transformed lines of mosquitoes. (b) Transposable genetic elements in the mosquito genome. The isolation of endogenous transposable genetic elements may ultimately prove central to the development of efficient transformation and transposon tagging systems in mosquitoes. A number of approaches have been taken to identify such mobile elements and one of these was to analyse specific gene systems, such as the ribosomal DNA of mosquitoes, in an attempt to isolate variants of these genes which may have arisen from the insertion of transposons. No such insertions have, as yet, been identified in Aedes aegypti DNA (Gale and Crampton, 1989) but insertion events have been detected in the rDNA of Anopheles gambiae and these elements are being fully defined (Paskewitz and Collins, 1989). The elements appear to resemble a particular class of mobile element known as non-viral retroposons. It is unlikely, however, that these elements will prove useful as transformation vectors because of the ill-defined nature of their mode of

MOLECULAR STUDIES OF INSECT VECTORS OF MALARIA

19

transposition. We have recently adopted an alternative strategy to identify directly a specific class of mobile elements, known as retrotransposons, in the mosquito DNA. The approach relies on utilizing the characteristic biochemical and structural properties of these elements. This work has led to the successful isolation of several retrotransposon-like elements from the Aedes aegypti genome (Crampton et al., 1990a, b). More recently, we have used the polymerase chain reaction (PCR) to develop a particularly rapid methodology for identifying endogenous retrotransposon-like elements in mosquito DNA (Warren and Crampton, 1991). A similar approach has also been employed to identify sequences related to the mariner transposable element from Drosophila mauritiana in the genomes of a wide range of insect vector species, including Anopheles gambiae (Robertson, 1993). However, all the mariner-like elements which have been identified in Anopheles gambiae appear to be defective and thus not capable of transposition or mobilization. Attempts are underway to identify a functional element, and to construct a functional element from the available mosquito-derived mariner sequences. Once such elements have been isolated, fully characterized, and their ability to transpose autonomously established, they may be engineered to form the core of a transformation vector system. (c) Markers for the selectionlidentijication of transformed individuals. A very important feature to be incorporated into a DNA transformation vector for use in mosquitoes is an improved selectable marker system for the identification of transformed individuals. A number of research laboratories have now reported problems with the existing neomycin resistance technique. In our experience, the main problem is the low activity of the neomycin phosphotransferase produced by the Tn5 neo gene in the transformation vector. The system is also less than satisfactory in that mosquitoes exhibit a spectrum of sensitivities to G418 and the survival of transformed mosquitoes relies on high levels of expression of the resistance gene. In addition, Aedes aegypti cells appear to have a tendency to retain intact vector plasmids which do not integrate into the recipient chromosomes but which transiently express antibiotic resistance. Alternative selectable markers, including the Tn903 neomycin resistance gene, which has been reported to show much higher phosphotransferase levels in yeast cells (Langhinrichs et al., 1989), and hygromycin resistance, together with alternative promoters to drive their expression, are now being investigated. A considerable body of work now suggests that the Drosophila heat shock promoter currently incorporated in the P element transformation vector constructs, is not entirely satisfactory for driving the expression of selectable marker gene systems in mosquitoes (Lycett et al., 1989). Ultimately, therefore, cloned phenotypic markers available for use in transgenic mosquitoes, such as the eye colour mutations used routinely

20

JULIAN M. CRAMPTON

in Drosophila, would appear to offer the most efficient selection system for incorporation into a mosquito DNA transformation vector. Eye colour mutations exist in both Aedes and Anopheles, and recently the gene coding for white has been isolated and characterized from Anopheles gambiae (F.H. Collins, personal communication). (d) Stage- and tissue-spec@ promoterlenhancer sequences. At some stage it will be desirable to express defined genes in mosquitoes and other insects in a tissue- or stage-specific fashion. For this to be envisaged, stageand tissue-specific promoters have to be defined. None are, as yet, available but attempts to characterize the DNA sequences responsible for expressing certain genes, particularly in mosquito systems, are underway by identifying genes which are expressed in a tissue specific fashion and then defining the upstream, putative tissue-specific promoter sequence. One example of this approach, has been the identification of an Aedes aegypti sequence which is only expressed in the female salivary gland (James et al., 1989). The expectation is, therefore, that this will allow the definition of a salivary gland-specific promoter sequence which may eventually allow the controlled expression of an introduced gene sequence in this tissue. More recently, trypsin genes have been cloned and characterized from Aedes aegypti (Barillas-Mury et al., 1991), the blackfly, Simulium vittatum (Ramos et al., 1993) and Anopheles gambiae (Muller et al., 1993). In each case, the expression of one or more of these trypsin genes has been shown to be induced in the insect midgut by a blood meal. It is therefore likely that gut-specific, blood meal-inducible promoters will shortly be available for each of these insects. Such promoters are clearly of interest as they will allow the expression of antiparasitic agents in the insect gut when it takes a blood meal, that is, when the insect first comes in contact with the organisms which it can transmit to the human population. However, it will be necessary to develop methods for establishing the functionality of putative promoter sequences. To this end, we and others have begun to develop the methodologies for transfecting mosquito cells in culture. The simple, controlled environment of cultured cells allows one to follow the expression of cloned genes, and so delineate promoter and enhancer sequences. Genetically manipulated cell cultures are also able to over-produce specific proteins which facilitates their isolation and purification. Cultured mosquito cells have been used to examine different transfection techniques and vectors and to help establish a suitable system for germ line transformation of Aedes aegypti (Lycett, 1990). Initially, experiments involved introduction of the P element vector and helper constructs into several cell lines by a variety of techniques devised to generate transient cell membrane pores, including calcium phosphate precipitation (Wigler et al., 1977), dextran sulphate (Lopata et al., 1984), polybrene (Durbin and

MOLECULAR STUDIES OF INSECT VECTORS OF MALARIA

21

Fallon, 1985), electroporation (Chu et al., 1987) and lipofection (Felgner et al., 1987). Much of this work has concentrated on the immortal Mos20 fibroblast cell line which was derived from minced, trypsinized, neonate larvae of the Aedes aegypti London strain in 1969. Polybrene and electroporation mediated transfection have proved to be most successful for these cells, producing approximately 30 and 4000 transformants per lo6 cells, respectively. Subsequently, constructs incorporating the chloramphenicol acetyl transferase (CAT) reporter gene system have been utilized to optimize expression of the CAT gene under the control of the Drosophila heat shock promoter, hsp70, in the Mos20 mosquito cultured cells (Lycett et al., 1989, 1992; Lycett and Crampton, 1993). This type of approach, in addition to experiments utilizing a range of reporter genes and microinjection of embryos, will eventually allow fully functional constitutive, stage- or tissue-specific mosquito promoters to be defined. 3.3. The Potential Application of Transgenic Technology to Malaria Vectors

Once the systems necessary to create transgenic mosquitoes have been developed, how may this technology be applied? Two aspects will be discussed in order to illustrate the potential of the technology. The first deals with the use of the technique for analytical purposes and the second with applying transgenic technology to medically significant mosquito populations. 3.3.1. Transgenic Technology as an Analytical Tool

The introduction and insertion of a mobile genetic element at or near a particular locus can cause that allele to mutate producing a structural or developmental effect. In Drosophila in particular, transposable genetic elements (TGEs) have been used as mutagens in order to clone genes or gene clusters of interest via transposon tagging (Bingham et al., 1981; Searles et al., 1982). In essence, the T G E is introduced into the germ line of the insect by microinjection of the embryo, and the progeny scored for mutants in the phenotype of interest. Subsequently, cloned T G E probes are used for in situ hybridization to chromosomes of mutant and wild-type individuals. This identifies a TGE “newly” integrated at or near the genetic locus of interest. DNA clones are then retrieved from a genomic library prepared from the mutant stock using the TGE DNA as a probe. DNA sequences adjacent to the TGE in such clones represent the gene for the locus of interest. This approach is an extremely powerful application of the technology, as it allows the cloning of genes purely on the basis of their function.

22

JULIAN M. CRAMPTON

3.3.2. Genetic Manipulation of Malaria Vectors In the long term, perhaps the most exciting applications of transgenic technology will be in malaria vector populations in the field. Clearly, the type of manipulation to be envisaged will depend on the target insect and the scale of its medical impact. For example, transgenic technology may eventually have a role to play in controlling malaria by providing the means to suppress vector populations by rendering them vulnerable to subsequent control measures, such as insecticide susceptibility, temperature sensitivity o r ability to survive diapause. A second possibility and, perhaps, a more exciting approach, would be to alter the ability of the insect to transmit the disease.

3.3.3. Potential Target Genes for Manipulation Several types of useful target gene can be envisaged. There are those that render populations vulnerable to subsequent control measures (such as insecticide susceptibility, temperature sensitivity or inability to survive diapause); those that interrupt disease transmission by replacing vector with non-vector forms, and those that disrupt normal fertility, development or behaviour. In this respect there are a number of obvious targets for manipulation including the genes involved in the mosquito immune system, developmental control genes, genes influencing mosquito behaviour and insecticide resistance genes. Changes in esterase activity are correlated with insecticide resistance in a number of insects and the esterases which are involved in organophosphate resistance in Culex quinquefasciatus have been cloned and characterized (Mouche et al., 1986; Merryweather et al., 1990). In addition, the Aedes aegypti cytochrome P-450genes which are involved in more general detoxification mechanisms have now been isolated (Bonet et al., 1990). A number of genes are of particular interest because they are directly implicated in the ability of the insect to transmit parasites. Examples include the filarial susceptibility (p") and Plasmodium susceptibility (pls) loci of Aedes aegypti. The p" locus is genetically well defined and we have good data on its linkage relationships. Refractoriness to infection is due to a partially sex-linked, dominant gene (Macdonald and Ramachandran, 1965). There is marked variation in the susceptibility of this mosquito to different filarial worms, although all of the alleles concerned map at about the same place on the sex chromosome. Also of particular interest is a strain of Anopheles gambiae which has been selected for refractoriness to the malaria parasite and characterized genetically (Collins et al., 1986). However, no gene or gene product has yet been defined or identified at the molecular level which controls susceptibility of the vector to a parasite. Attempts are currently underway to clone these genes but it is difficult to

MOLECULAR STUDIES OF INSECT VECTORS OF MALARIA

23

undertake such a cloning excercise in the absence of any knowledge of the gene product. Clearly, the use of transgenic technology through transposon tagging will assist in the characterization of refractory genes and their products. 3.3.4. Creating an “Incompetent” Mosquito

An important genotypic characteristic not met by the majority of genes encoding refractoriness is that any such gene introduced into the mosquito would have to be capable of altering phenotype through the expression of a single gene copy. Unfortunately, at present, there is no gene or gene product defined at the molecular level which is known directly to affect phenotype in relation to parasite development in, or transmission by, mosquitoes. In contrast, a number of molecules are known to affect the transmission of malaria by anophelines. Foremost among these are the socalled transmission blocking vaccines, which can achieve a total transmission blockade (Winger et al., 1987). These vaccines attack antigens present on the gametes and ookinetes of the malaria parasite and antibodies which recognize these antigens are able to block the development of the parasite in the mosquito midgut. A very exciting possibility, therefore, is to introduce the genes coding for such antibodies into the mosquito genome thus directly conferring the transmission blocking phenotype to the insect. In this case, a transgenic mosquito would be created incorporating an antibody gene expressed in the insect midgut in response to a blood meal, and which therefore blocks transmission of malaria. This type of approach is attractive for a number of reasons. It eliminates the need for the detailed molecular analysis of refractory mechanisms in mosquitoes and it would be a “dominant” gene system (i.e. one gene copy only would be needed in each cell of the mosquito). The antigen targets on the stage of the malaria parasite present in the mosquito are highly conserved, suggesting that the parasite may be less able to avoid this type of transmission control mechanism. Finally, the use of transgenic insects incorporating an antibody gene could be applied to any vector transmitted pathogen (parasite or viral) where a target antigen can be identified as being inhibited by the expressed molecule. To date, mouse antibody genes have been cloned and introduced into mosquito cells in culture and mouse Fab molecules have been expressed and detected using immunohistochemical staining techniques. Efforts are currently underway to clone the transmission blocking antibody genes themselves and to assess their functionality in vivo. The trypsin genes from the mosquito Anopheles gambiae have recently been cloned (Muller et al., 1993) and the expression of two of the genes have been found to be induced in the female mosquito midgut when it takes a blood meal. It may

24

JULIAN M. CRAMPTON

therefore be possible in the near future to create a mosquito expressing the transmission blocking antibody genes in such a way as to block or disrupt the transmission of malaria. If successful, transgenic mosquitoes expressing antimalarial antibodies may represent a potential strategy for controlling malaria and may establish a precedent for a wide range of new antidisease strategies. 3.3.5. Transgenic Mosquitoes in Natural Populations

Now that the technology for the introduction of artificial genes is becoming established, it is necessary to consider the problems likely to be faced in experimental and natural populations. It may well be that such a situation would disrupt the normal adaptive process and therefore be opposed by natural selection. If this is so then some form of drive mechanism may be needed to force the desired gene through the population. This is not an alien concept to those who have worked on the genetic control of insect populations. However, the testing of such mechanisms has been limited since, in reality, they have awaited the advent of recombinant DNA technology to provide the necessary raw material. Two types of drive mechanism have been suggested. One is meiotic drive, where a given chromosome is transmitted to more than the expected 50% of offspring. Any desirable genes linked to the driven chromosome would eventually approach fixation even with the release of relatively few individuals. There is experimental evidence to support the use of meiotic drive in Aedes aegypti. This mechanism, driven by the MD locus has been used to force the marker gene re (red eye) into a laboratory cage population (Wood et al. , 1977). Interestingly, meiotic drive also occurs during hybrid dysgenesis and it might, therefore, also be possible to exploit this phenomenon by using P elements in Aedes aegypti. The second type of drive mechanism is the exploitation of genetic traits that reduce heterozygote fitness (Curtis and Graves, 1988). For example, the gene to be driven could be introduced into a translocation chromosome such that viable and fertile homozygotes were formed, whereas heterozygotes would display reduced fertility or viability. In this way, translocations, pericentric inversions, inter-racial hybrid sterility, cytoplasmic incompatibility and compound chromosomes all have potential since, in each case, hybrids have reduced fitness. Such mechanisms require larger release numbers since there is no exponential increase in the frequency of the driven chromosome as with meiotic drive. However, fixation of desirable genes would occur more quickly than with meiotic drive because of the reduced fitness of heterozygous combinations. Efficiency could be improved by providing the released individuals with some form of temporary advantage. For example, insecticide resistance could be incorporated into the genome

MOLECULAR STUDIES OF INSECT VECTORS OF MALARIA

25

and then insecticide applied (Whitten, 1970). Ideally, the insecticide resistance gene would be fused to the desirable gene and introduced as a unit to prevent disruption of useful combinations by meiotic recombination. The most useful end result of such programmes would be the progressive replacement rather than the eradication of disease-transmitting populations since an emptied ecological niche might be colonized rapidly by migration of wild types. 3.4. Transgenic Mosquitoes: The Future in Relation to the Control of Malaria

Eventually, embryo transformation will provide the raw material to test the proposed drive mechanisms in laboratory and natural populations. The questions posed by considering the release of transgenic insects emphasizes the need to assess the biological consequences of such a release. It is, however, difficult to gauge the possible hazards of such a release in the absence of experimental evidence and these ethical and safety considerations need to be faced at an early stage. In order to undertake an informed appraisal where the possible net benefits may be balanced against the potential hazards, considerable effect will have to be devoted to utilizing caged populations and the controlled release of molecularly tagged individuals together with mathematical modelling of these populations. There is clearly some way to go before any release of transgenic insects can be considered. The power of the technology is, however, so enormous that it must be explored and there is every indication that over the next few years the potential of transgenic technology in insects will be fully exploited. ACKNOWLEDGEMENTS

This investigation received financial support from the UNDPNirorld BanM WHO Special Programme for Research and Training in Tropical Diseases, the Wolfson Foundation, Wellcome Trust, Medical Research Council and Liverpool University. The author is a Wellcome Trust Senior Research Fellow in Basic Biomedical Sciences. REFERENCES Argentine, J.A. and James, A.A. (1993). Codon preference of Aedes aegypti and Aedes albopictus. Insect Molecular Biology 1, 189-194. Arnold, M.L., Buckner, C.M. and Robinson, J.J. (1991). Pollen-mediated introgression and hybrid separation in Louisiana irises. Proceedings of the National Academy of Sciences, USA 88, 1398-1402.

26

JULIAN M. CRAMPTON

Atkinson, P.W., Coates, C.J., Howells, A.J. and O’Brochta, D.A. (1992). Prospects for non-drosophilid germ-line transformation. Proceedings of the International Symposium on Management of Insect Pests: Nuclear and Related Molecular and Genetic Techniques, pp. 11. IAEA/FAO Publication, Vienna. Baldarelli, R.M. and Lengyel, J.A. (1991). Transient expression of DNA after ballistic introduction into Drosophila embryos. Nucleic Acids Research 18, 5903-5904. Barillas-Mury, C., Graf, R., Hagedorn, H.H. and Wells, M.A. (1991). cDNA and deduced amino acid sequence of a blood meal-induced trypsin from the mosquito, Aedes aegypti. Insect Biochemistry 21, 825-831. Beard, C.B., O’Neill, S.L., Mason, P., Mandelco, L., Woeses, C.R., Tesh, R.B., Richards, F.F. and Aksoy, S. (1993). Genetic transformation and phylogeny of bacterial symbionts from tsetse. Insect Molecular Biology 1, 12f131. Besansky, N.J. (1993). Codon usage patterns in chromosomal and retrotransposon genes of the mosquito Anopheles gambiae. Insect Molecular Biology 1, 171-178. Besansky, N.J. and Powell, J.R. (1992). Reassociation kinetics of Anopheles gambiae (Diptera: Culicidae) DNA. Journal of Medical Entomology 29, 125-128. Bingham, P.M., Levis, R. and Rubin, G.M. (1981). The cloning of DNA sequences from the white locus of Drosophila melanogaster using a novel and general method. Cell 25, 69f704. Black, W.C. and Rai, K.S. (1988). Genome evolution in mosquitoes: intraspecific and interspecific variation in repetitive DNA amounts and organisation. Genetical Research (Camb.) 51, 185-195. Bonaccorsi, S., Santini, G., Pimpinelli, S. and Coluzzi, M. (1980). Intraspecific polymorphism of sex chromosome heterochromatin in two species of the Anopheles gambiae complex. Chromosoma (Berlin) 76, 57-64. Bonet, R.G., Crampton, J.M. and Townson, H. (1990). P450 sequences from the mosquito Aedes aegypti. Transactions of the Royal Society of Tropical Medicine and Hygiene 84, 453. Booth, D.R., Mahon, R.J. and Sriprakash, K.S. (1991). DNA probes to identify the members of the Anopheles farauti complex. Medical and Veterinary Entomology 5 , 447-454. Carlson, D.A. and Service, M.W. (1979). Differentiation between species of the Anopheles gambiae complex (Diptera: Culicidae) by analysis of the cuticular hydrocarbons. Annals of Tropical Medicine and Parasitology 7, 589-592. Carlson, D.A. and Service, M.W. (1980). Identification of mosquitoes of the Anopheles gambiae complex A and B by analysis of the cuticular components. Science 207, 1089-1091. Chu, G., Hayakawa, H. and Berg, P. (1987). Electroporation for the efficient transfection of mammalian cells with DNA. Nucleic Acids Research 15, 1311-1326. Cockburn, A.F. and Mitchell, S.F. (1989). Repetitive DNA interspersion patterns in Diptera. Archives of Insect Biochemistry and Physiology 10, 105-113. Collins, F.H., Sakai, R.K., Vernick, K.D., Paskewitz, S., Seeley, D.C., Miller, L.H., Collins, W.E., Campbell, C.C. and Gwadz, R. W. (1986). Genetic selection of a Plasmodium refractory strain of the malaria vector Anopheles gambiae. Science 236, 607-610. Collins, F.H., Mendez, M.A., Rasmussen, M.O., Mehaffey, P.C., Besansky, N.J. and Finnerty, V. (1987). A ribosomal RNA gene probe differentiates member species of the Anopheles gambiae complex.American Journal of Tropical Medicine and Hygiene 37, 37-41.

MOLECULAR STUDIES OF INSECT VECTORS OF MALARIA

27

Collins, F.H., Petrarca, V., Mpofu, S., Brandling Bennett, A.D., Were, J.O., Rasmussen, M.O. and Finnerty, V. (1988). Comparison of DNA probe and cytogenetic methods for identifying field collected Anopheles gambiae complex mosquitoes. American Journal of Tropical Medicine and Hygiene 39, 545-550. Coluzzi, M. and Sabatini, A. (1967). Cytotaxonomic observations on species A and B of the Anopheles gambiae complex. Parassitologia 9, 73-88. Coluzzi, M. and Sabatini, A. (1968). Cytogenetic observations on species C of the Anopheles gambiae complex. Parassitologia 10, 155-165. Coluzzi, M. and Sabatini, A . (1969). Cytogenetic observations on the saltwater species Anopheles merus and Anopheles melas of the Anopheles gambiae complex. Parassitologia 11, 177-187. Coluzzi, M., Sabatini, A., Petrarca, V. and Di Deco, M.A. (1979). Chromosomal differentiation and adaptation to human environments in the Anopheles gambiae complex. Transactions of the Royal Society of Tropical Medicine and Hygiene 73, 483-497. Comley, I., Crampton, J.M. and Eggleston, P. (1992). In vivo heterologous gene expression in the mosquito Aedes aegypti. In “Insect Molecular Science” (J.M. Crampton and P. Eggleston, eds), pp. 252-253. Academic Press, London. Cooper, L., Cooper, R.D. and Burkot, T.R. (1991). The Anopheles punctulatus complex: DNA probes for identifying the Australian species using isotopic, chromogenic, and chemiluminescence detection systems. Experimental Parmitology 73, 27-35. Crampton, J.M., Knapp, T. and Ward, R. (1989). DNA probes for vector taxonomy. In “Leishmaniasis: The Current Status and New Strategies for Control” (D. Hart, ed.), pp. 963-970. Plenum Press, New York. Crampton, J.M., Morris, A.C., Lycett, G.J., Warren, A.M. and Eggleston, P. (1990a). Transgenic mosquitoes: a future vector control strategy? Parasitology Today 6, 31-36. Crampton, J.M., Morris, A.C., Lycett, G.J., Warren, A.M. and Eggleston, P. (1990b). Molecular characterisation and genome manipulation of the mosquito, Aedes aegypti. In “Molecular Insect Science” (H.H. Hagedorn, J.G. Hildebrand, M.G. Kidwell and J.H. Law, eds), pp. 1-11. Plenum Press, New York. Curtis, C.F. and Graves, P.M. (1988). Methods for replacement of malaria vector populations. Journal of Tropical Medicine and Hygiene 91, 43-48. Davidson, G. (1964). The five mating types of the Anopheles gambiae complex. Revista di Malariologia 13, 167-183. Davidson, G . (1966). Anopheles gambiae, a complex of species. Bulletin of the World Health Organisation 31, 625434. Davidson, G. and Hunt, R.H. (1973). The crossing and chromosome characteristics of a new, sixth species in the Anopheles gambiae complex Parassitologia 15, 121-128. Davidson, G., Paterson, H.E., Coluzzi, M., Mason, G.F. and Micks D.W. (1967). The Anopheles gambiae complex. In “Genetics of Insect Vectors of Disease” (J.W. Wright and R. Pal, eds), pp. 211-250. Elsevier, Amsterdam. Delves, C.J., Goman, M., Ridley, R.G., Matile, H., Lensman, T.M.W., Ponnudurai, T. and Scaife, J.G. (1989). Identification of Plasmodium falciparum using a probe containing repetitive DNA. Molecular Biochemistry and Parasitology 32, 105-112. Durbin, J.E. and Fallon, A.M. (1985). Transient expression of the chloramphenicol acetyl transferase gene in cultured mosquito cells. Gene 36, 173-178.

28

JULIAN M. CRAMPTON

Engels, W.R. (1988). P elements in Drosophila melanogaster, In “Mobile DNA” (D. Berg and M. Howe eds), pp. 437484. ASM Publications. Felgner, P.L., Gadek, T.R., Holm, M., Roman, R., Chan, H.W., Wenz, M., Northrop, J.P., Ringhold, G.M. and Danielson, M. (1987). Lipofection: a highly efficient, lipid mediated DNA transfection procedure. Proceedings of the National Academy of Science USA 84, 7413-7417. Gale, K.R. and Crampton, J.M. (1987a). DNA probes for species identification of mosquitoes in the Anopheles gambiae complex. Medical and Veterinary Entomology 1, 127-1 36. Gale, K.R. and Crampton, J.M. (1987b). A DNA probe to distinguish the species Anopheles quadriannulatusfrom other species of the Anopheles gambiae complex. Transactions of the Royal Society of Tropical Medicine and Hygiene 81,842-846. Gale, K.R. and Crampton, J.M. (1988). Use of a male specific DNA probe to distinguish female mosquitoes of the Anopheles gambiae complex. Medical and Veterinary Entomology 2 , 77-79. Gale, K.R. and Crampton, J.M. (1989). The ribosomal genes of the mosquito, Aedes aegypti. European Journal of Biochemistry 18,31 1-317. Gatti, M., Santini, G., Pimpinelli, S. and Coluzzi, M. (1977). Fluorescence banding techniques in the identification of sibling species of the Anopheles gambiae complex. Heredity 38, 105-108. Green, C.A. (1972). Cytological maps for the identification of females of the three freshwater species of the Anopheles gambiae complex. Annals of Tropical Medicine and Parasitology 66, 143-147. Grover, K.K. (1985). Chemosterilization trials against Aedes aegypti. In “Integrated Mosquito Control Strategies” (M. Laird and J.W. Miles, eds), Vol. 2, pp. 79-116. Academic Press, London. Hamilton, R.J. and Service, M.W. (1983). Value of cuticular and internal hydrocarbons for the identification of larvae of Anopheles gambiae Giles, Anopheles arabiensis Patton and Anopheles melas Theobald. Annals of Tropical Medicine and Parasitology 77, 203-210. Hartas, J., Whelan, P., Sriprakash, K.S. and Booth, D. (1992). Oligonucleotide probes to identify three sibling species of the Anopheles farauti Laveran (Diptera: Culicidae) complex. Transactions of the Royal Society of Tropical Medicine and Hygiene 86, 210-212. Hill, S.M., Urwin, R. and Crampton, J.M. (1991a). A comparison of nonradioactive labelling and detection systems with synthetic oligonucleotide probes for the species identification of mosquitoes in the Anopheles gambiae complex. American Journal of Tropical Medicine and Hygiene 44, 609-622. Hill, S.M., Urwin, R., Knapp, T.F. and Crampton, J.M. (1991b). Synthetic DNA probes for the identification of sibling species within the Anopheles gambiae complex. Medical and Veterinary Entomolo logy 5, 455463. Hill, S.M., Urwin, R. and Crampton, J.M. (1992). A simplified, non-radioactive DNA probe protocol for the field identification of insect vector specimens. Transactions of the Royal Society of Tropical Medicine and Hygiene 86,213-215. James, A.A., Blackmer, K. and Racioppi, J.V. (1989). A salivary gland-specific, maltase-like gene of the vector mosquito, Aedes aegypti. Gene 7 5 , 73-83. Krafsur, E.S., Whitten, C.J. and Novy, J.E. (1987). Screwworm eradication in North and Central America. Parasitology Today 3, 131-137. Kunze, R. and Starlinger, P. (1989). The putative transposase of transposable element Ac from Zea mays L interacts with sub-terminal sequences of Ac. EMBO Journal 8, 3177-3185.

MOLECULAR STUDIES OF INSECT VECTORS OF MALARIA

29

Langhinrichs, C., Berndorff, D., Seefeldt, C. and Stahl, U. (1989). G418 resistance in the yeast Saccharomyces cerevisiae: comparison of the neomycin resistance genes from Tn5 and Tn903. Applied Microbiology and Biotechnology 30,388-394. Lopata, M.A., Cleveland, D.W. and Sollner-Webb, B. (1984). High level transient expression of a chloramphenicol acetyl transferase gene by DEAE-dextran mediated DNA transfection coupled with a dimethyl sulfoxide or glycerol shock treatment. Nucleic Acids Research 12, 5707-571 7. Lycett, G.J. (1990). DNA transfection of mosquito cells in culture. Insect Molecular Genetics Newsletter 4 , 1-3 Royal Entomological Society of London Publication. Lycett, G.J. and Crampton, J.M. (1993). Stable transformation of mosquito cell lines using a Hsp70-neu fusion gene. Gene 136, 129-136. Lycett, G.J., Eggleston, P. and Crampton, J.M. (1989). DNA transfection of an Aedes aegypti mosquito cell line. Heredity 63, 277. Lycett, G., Crampton, J.M. and Eggleston, P. (1992). The expression of reporter genes in cultured cells of Aedes aegypti. In “Insect Molecular Science” (J.M. Crampton and P. Eggleston, eds), pp. 247-248. Academic Press, London. Macdonald, W.W. and Ramachandran, C.P. (1965). The influence of the gene F (filarial susceptibility, Brugia malayi) on the susceptibility of Aedes aegypti to seven strains of Brugia, Wuchereria and Dirofilaria. Annals of Tropical Medicine and Parasitology 59, 64-73. Mahon, R.J., Green, C.A. and Hunt, R.H. (1976). Diagnostic allyzomes for routine identification of adults of the Anopheles gambiae complex (Diptera, Culicidae), Bulletin of Entomological Research 66, 25-31. Malacrida, A., Gasperi, G., Baruffi, L., Torti, C. and Guglielmino, C. (1992). Basic studies for genetic manipulation in Ceratitis capitata Wied (Diptera, Tephritidae). In “Insect Molecular Science” (J.M. Crampton and P. Eggleston, eds), p. 256. Academic Press, London. McDonald, P.T., Hausermann, N. and Lorimer, N. (1977). Sterility introduced by release of genetically altered males to a domestic population of Aedes aegypti at the Kenya coast. American Journal of Tropical Medicine and Hygiene 26, 553-561. McGrane, V., Carlson, J.O., Miller, B.R. and Beatty, B.J. (1988). Microinjection of DNA into Aedes triseriatus ova and detection of integration. American Journal of Tropical Medicine and Hygiene 39, 502-510. Merryweather, A.T., Townson, H. and Crampton, J.M. (1990). Purification and properties of an esterase from organophosphate resistant Culex quinquefasciatus. Biochemical Journal 266, 83-90. Mialhe, E . , Laughinghouse, A . and Miller, L. (1992). Biolistic for gene transfer to mosquito embryos. I n “Proceedings of the International Symposium on Management of Insect Pests: Nuclear and Related Molecular and Genetic Techniques”, pp. 18-19. IAEAlFAO Publication, Vienna. Miles, S.J. (1976). The Anopheles gambiae complex: a biochemical key. Journal of Medical Entomology 15, 297-299. Miles, S.J. (1978). Enzyme variation in the Anopheles gambiae Giles group of species (Diptera: Culicidae). Bulletin of Entomological Research 68, 85-96. Miller, L.H., Sakai, R.K., Romans, P., Gwadz, R.W., Kantoff, P. and Caon, H.G. (1987). Stable integration and expression of a bacterial gene in the mosquito Anopheles gambiae. Science 237, 779-781. Milne, C. (1992). Sperm-mediated honey bee transformation. I n “Insect Molecular Science” (J.M. Crampton and P. Eggleston, eds), p. 251. Academic Press, London.

30

JULIAN M. CRAMPTON

Morris, A.C., Eggleston, P. and Crampton, J.M. (1989). Genetic transformation of the mosquito Aedes aegypti by micro-injection of DNA. Medical and Veterinary Entomology 3 , 1-7. Morns, A.C., Schaub, T.L. and James, A.A. (1991). FLP-mediated recombination in the vector mosquito, Aedes aegypti. Nucleic Acids Research 19, 5895-5900. Mouches, C., Pasteur, N., Berge, J.B., Hyrien, Q., Raymond, M., de Saint Vincent, B.R., de Silvestri, M. and Georghiou, G.P. (1986). Amplification of an esterase gene is responsible for insecticide resistance in a California Culex mosquito. Science 233, 778-780. Muirhead-Thompson, R. (1948). Studies in Anopheles gambiae and Anopheles melas in and around Lagos. Bulletin of Entomological Research 38, 527-558. Muller, H.-M., Crampton, J.M., della Torre, A., Sinden, R. and Crisanti, A. (1993). Members of a trypsin gene family in Anopheles gambiae are induced in the gut by blood meal. EMBO Journal 12, 2891-2900. O’Brochta, D.A. (1990). Genetic transformation and its potential in insect pest control. Bulletin of Entomological Research 80, 241-244. O’Brochta, D.A. and Handler, A.M. (1988). Mobility of P elements in drosophilids and non-drosophilids. Proceedings of the National Academy of Science USA 85,6052-6056. Panyim, S . , Yasothornsrikull, S., Tungpradubkul, S., Baimai, V., Rosenberg, R., Andre, R.G. and Green, C.A. (1988a). Identification of isomorphic malaria vectors using a DNA probe. American Journal of Tropical Medicine and Hygiene 38, 4 7 4 9 . Panyim, S., Yasothornsrikul, S. and Baimai, V. (1988b). Species-specific DNA sequences from the Anopheles dirus complex - potential for efficient identification of isomorphic species. I n “Biosystematics of Haematophagous Insects” (M.W. Service, ed.), Vol. 37, pp. 193-202. Systematics Association. Clarendon Press, Oxford. Paskewitz, S.M. and Collins, F.H. (1989). Site-specific ribosomal DNA insertion elements in Anopheles gambiae and Anopheles arabiensis: nucleotide sequence of gene-element boundaries. Nucleic Acids Research 17, 8125-8133. Paskewitz, S.M. and Collins, F.H. (1990). A method to distinguish mosquitoes of the Anopheles gambiae complex using the polymerase chain reaction. Medical and Veterinary Entomology 4, 367-373. Pirrotta, V. (1988). Vectors for P-mediated transformation in Drosophila. In “Vectors: a Survey of Molecular Cloning Vectors and Their Uses” (R.L. Rodriguez and D.T. Denhardt, eds), pp. 437456. Butterworths, Stoneham, MA. Ramos, A., Mahowald, A. and Jacobs-Lorena, M. (1993). Gut-specific genes from the Black Fly Simulium vittatum encoding trypsin-like and carboxypeptidase-like proteins. Insect Molecular Biology 1, 149-163. Ribbands, C.R. (1944). Differences between Anopheles melas (Anopheles gambiae var. melas) and Anopheles gambiae. AnnaLF of Tropical Medicine and Parasitology 38, 85-99. Rio, D.C., Barnes, G., Laski, F.A., Rine, J . and Rubin, G.M. (1988). Evidence for Drosophila P element transposase activity in mammalian cells and yeast. Journal of Molecular Biology 200, 411-415. Robertson, H.M. (1993). The mariner transposable element is widespread in nature. Nature 362, 241-245. Sandford, J.C., Smith, F.D. and Russell, J.A. (1993). Optimizing the biolistic process for different biological applications. Methods in Enzymology (in the press).

MOLECULAR STUDIES OF INSECT VECTORS OF MALARIA

31

Saunders, R.D.C., Glover, D.M., Ashburner, M., Siden-Kiamos, I., Louis, C., Monastirioti, M., Savakis, C. and Kafatos, F.C. (1989). PCR amplification of DNA microdissected from a single polytene chromosome band: a comparison with conventional microcloning. Nucleic Acids Research 17, 9027-9037. Searles, L.L., Jokerst, R.S., Bingham, P.M., Voelker, R.A. and Greenleaf, A.L. (1982). Molecular cloning of sequences from a Drosophila RNA polymerase XI locus by P element transposon tagging. Cell 31, 585-592. Siden-Kiamos, I., Saunders, R.D.C., Spanos, L., Majerus, T., Trenear, J., Savakis, C., Louis, C., Glover, D.M., Ashburner, M. and Kafatos, F.C. (1990). Towards a physical map of the Drosophila melanogaster genome: mapping of cosmid clones within defined genomic divisions. Nucleic Acids Research 18, 626145270. Spradling, A.C. and Rubin, G.M. (1982). Transposition of cloned P elements into Drosophila germ line chromosomes. Science 218, 341-347. Steller, H. and Pirrotta, V. (1985). Transposable P vector that confers selectable G418 resistance to Drosophila larvae. EMBO Journal 4, 167-171. Sturchler, D. (1989). How much malaria is there Worldwide? Parasitology Today 5, 39. Warren, A.M. and Crampton, J.M. (1991). The Aedes aegypti genome: complexity and organisation. Genetical Research (Cambridge) 58, 225-232. White, G.B. (1982). Malaria vector ecology and genetics. British Medical Bulletin 38, 207-212. Whitten, M.J. (1970). Use of chromosome rearrangements for mosquito control. In “The Sterility Principle for Insect Control or Eradication”, pp. 399-410. International Atomic Agency Symposium, Athens. Wigler, M., Siverstein, S., Lee, L.S., Pellicer, A,, Cheng, Y. and Axel, R. (1977). Transfer of purified Herpes virus thymidine kinase gene to cultured mouse cells. Cell 11, 223-232. Wilkerson, R.C., Parsons, T.J., Albright, D.G., Klein, T.A. and Braun, M.J. (1993). Random amplified polymorphic DNA (RAPD) markers readily distinguish cryptic mosquito species (Diptera: Culicidae: Anopheles). Znsect Molecular Biology 1, 205-21 1. Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990). DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research 18, 65314535, Williams, J.G.K., Rafalski, J.A. and Tingey, S.V. (1993). Genetic analysis using random amplified polymorphic markers. Methods in Enzymology 218, 704-740. Winger, L., Smith, J.E., Nicholas, J., Carter, E.H., Tirawanchai, N. and Sinden, R.E. (1987). Ookinete antigens of Plasmodium berghei: the appearance of a 21 kD transmission blocking determinant on the developing ookinete. Parasite Immunology 10, 193-207. Wood, R.J., Cook, L.M., Hamilton, A. and Whitelaw, A. (1977). Transporting the marker gene re (red eye) into a laboratory cage opulation of Aedes aegypti (Diptera: Culicidae), using meiotic drive at the M locus. Journal of Medical Entomology 14, 461-464. Zheng, L., Saunders, R.D.C., Fortini, D., della Torre, A., Coluzzi, M., Glover, D.M. and Kafatos, F.C. (1991). Low resolution map of the malaria mosquito, Anopheles gambiae. Proceedings of the National Academy of Science USA 88, 11187-11 191.

8

This Page Intentionally Left Blank

The Ribosomal RNA Genes of Plasmodium Andrew P.Waters

Department voor Parasitologie. Rijksuniversiteit te Leiden. Leiden. The Netherlands

1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.1. Molecular biology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.2. Molecular phylogeny . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.3. Diagnostics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

34 34 34 34

2. Molecular Biology of rRNA Genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.1. Life cycle considerations . . . . . . . . . . . . .............. 2.2. Organization of nuclear rRNAgenes . . 2.3. Sequence and expression of the rDNA units of Plas 2.4. Transcriptional control of rRNA gene expression in 2.5. Genetic control of expression . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.6. Transcription factors and rDNA . . . . . . ........................... 2.7. 5 s RNA genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.8. Organellar rRNA genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.9. The production of mature rRNA: processingof the primary transcript . . . . . 2.10. Ribosomes . . . ............................................ 2.11. Plasmodium ribosomal RNAsequences . . . .......................

35 35 37 40 42 45 46

48 49 50 53

54

3 . Inferences of Phylogeny Based on Ribosomal RNAAnalyses . . . . . . . . . . . . . . . . . 58 . . . . . . . . . . . . 58 3.1. Earlier classifications . . . . . . . . . . . . . . . . . . . . . . . . . 3.2. Molecular-based estimations . . . . . . . . . . . . . . . . . . 3.3. Evolution of the rDNA units within the genome . . . . . . . . . . . . . . . . . . . . . . . . 64 4 . Species Identification Based on Ribosomal RNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1. The principle of direct detection of rRNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.2. Ribosomal RNAgene-based PCR . . . . . . . . . . . . . . . . . . . . . . . ... ... 4.3. Drug testing and rRNA diagnosis . . . . . . . . . . . . . . . . . . . . . . .

65 65 69 70

5. Perspective . . . . . . . . . . . .

70

.............................................

Acknowledgements . . . . . . . . . . . . . . . . . . . . . .

........................

72

References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

72

ADVANCES IN PARASITOLOGYVOL 34 ISBN (L12431734-5

CopyrrghtO lW4 Academic Press Limited A / / rights of reproduchon in sny form reserved

34

ANDREW P. WATERS

1. INTRODUCTION

The study of ribosomal RNA (rRNA) genes offers the biologist at least three possible research areas: (1) molecular biology; (2) molecular inference of phylogeny based upon molecular sequence data; and (3) rRNA-based specific detection of organisms which can be used diagnostically. 1.1. Molecular Biology

This first area concerns the function of the rRNA genes and that is to provide the major portion of the RNA components of the ribosome which is the protein synthetic apparatus of the cell. The ribosome consists of a highly ordered and conserved proteidRNA complex which acts as the catalytic centre for the many ordered chemical reactions necessary for protein formation. Thus the processes of ribosomal RNA (rRNA) production from the genes that encode it, the post-transcriptional modifications, its export from the nucleus and its assembly into active ribosomes is a window into the molecular biology of any particular cell type. Much has been learned about these processes from the study of a great number of systems and the current knowledge of the molecular biology of rRNA genes in Plasmodium will be highlighted against that from other chosen systems. 1.2. Molecular Phylogeny

The ribosome is responsible for protein synthesis in all cells and some organelles with the general exception of viri. The constancy of this role in the cell has resulted in a generally conserved structure/function relationship between all equivalent rRNA molecules. This is especially true as the perhaps unexpected centrally catalytic nature of the rRNA molecules within the ribosomal processes emerges (Dahlberg, 1989). This constancy, which covers both prokaryotes and eukaryotes, is in turn exploited by those with an interest in phylogeny. The small subunit (SSU) rRNA molecule provides a dataset of which a large part is structurally conserved in all organisms. By comparing the structurally conserved regions of the SSU rRNA genes of different organisms it is possible to draw inferences of phylogeny. 1.3. Diagnostics

The RNA product of the ribosomal RNA genes is generally the most abundant macromolecule in any given cell. If it is possible specifically to

THE RIBOSOMAL RNA GENES OF PLASMODIUM

35

detect the rRNA of a particular organism then it is possible to use that detection in a diagnostic manner. The abundance of the rRNA in the cell also provides the potential for great sensitivity of detection. It has proved possible to exploit all of these avenues in the study of Plasmodium and this review will provide a summary of progress of research and attempt to place the findings in the context of the biology and known natural history of the genus.

2. MOLECULAR BIOLOGY OF rRNA GENES 2.1. Life Cycle Considerations

Normally it can be taken for granted that readers of a focused review such as this are sufficiently familiar with the organism under discussion as to render consideration of its life cycle redundant. In the case of Plasmodium, the molecular biology of the rRNA genes is apparently so linked to the biological progession of the life cycle that it is illuminating to preface discussion of the genes with a short description of the life cycle of this genus. The members of the unicellular apicomplexan parasitic genus Plasmodium employ a dichotomous life style existing in association with an invertebrate (usually Anopheline) mosquito vector and a vertebrate host (Figure 1). The individual species within this genus are responsible for the various forms of the disease malaria. The range of vertebrate host species affected by different malaria species is enormous and worldwide; primates and lower mammals, birds and reptiles are all susceptible to different species of the parasite. A general description of the life cycle can be considered as follows: vertebrate infection is initiated by mosquito bite (Figure 1, I). A fully differentiated form of Plasmodium, the sporozoite, is released into the vertebrate blood stream from the store in the salivary glands of the mosquito. In mammalian malaria the sporozites clear rapidly to the liver entering hepatocytes (Figure 1, 11). Within the hepatocyte the parasite undergoes a period of differentiation and multiplication giving rise to a mature form, the extra-erythrocytic schizont, which contains within it thousands of individual parasite forms, merozoites. These are released into the bloodstream, initiating the second blood-borne phase of the infection (Figure 1, 111). The merozoites invade bloodstream erythrocytes and also undergo a characteristically periodic phase of intracellular differentiation and asexual multiplication that involves progression through distinct morphologies culminating in the production of an erythrocytic schizont which again contains merozoites but usually only 10-32. Upon reinvasion, the merozoite

36

ANDREW P. WATERS

I

SPoRoZo'TES

3

IN MOSQUITO

0 UT

Figure 1 Life cycle of Plasmodium spp. The life cycle of Plasmodium spp. is illustrated as its passage through the human host. The roman numerals (I-VI) indicate the reference points in the life cycle mentioned in the text. The symbols A and C represent expression of the different forms of the small subunit ribosomal RNA genes through the life cycle. A and C are capitalized where they represent the major expressed form and are given in lower case when they are the minority form. [C] indicates the precursor form of the C SSU rRNA gene observed in gametocytes of P . falciparum (Waters et al., 1989).

THE RIBOSOMAL RNA GENES OF PLASMODlUM

37

can either reinitiate the asexual erythrocytic cycle or embark upon sexual differentiation and the process of gametocytogenesis. Gametocytogenesis involves the production of gametocytes (male and female) which are dormant gamete precursors (Figure 1, TV). Once formed, these forms are relatively stable and remain dormant until ingested by the mosquito as part of the blood meal during feeding. Once in the acidic environment of the insect midgut the gametocytes are triggered into final sexual differentiation forming the gametes which then fertilize to give the zygote and initiate the insect phase (Figure 1, V). The zygote develops into an ookinete which is motile and penetrates the midgut wall entering the lumen forming the oocyst (Figure 1 , VI). Here, reminiscent of schizogony, the oocyst again undergoes differentiation and multiplication resulting in the formation of a cell which upon rupture releases thousands of sporozoites which make their way to the salivary gland thus completing the cycle. From this it is clear that the progression of the parasite through its life cycle is a tremendous feat of biology involving the invasion of multiple tissues and structures of both hosts which is reflected in the various distinct and complex physical forms that the parasite displays. These forms and progressions result from the coordinated stage-specific expression of genes which is itself superimposed on a background expression of housekeeping genes. What might be anticipated about the biology of the parasite housekeeping from its life cycle? It has to perform the fundamental processes common to all cells in a variety of environments. The clearest distinction between these environments is at the simple level of host and vector., The host, usually warm blooded (or sun basking), offers a completely different set of environmental influences and selective pressures to the cold-blooded anopheline mosquito. It has become apparent through study of the ribosomal RNA (rRNA) genes of malaria parasites that this fluctuating environment may have provided the stimulus for a number of peculiar and unique phenomena. 2.2. Organization of Nuclear rRNA genes

2.2.1 General There are a number of structural ribosomal RNA molecules which are involved in the formation of an active eukaryotic ribosome. These are usually identified by their size and sedimentation properties as 28S, 18S, 5.8s and 5 s . The genes encoding these structural RNA species have a typical eukaryotic arrangement that is found in both lower and higher organisms. The major rDNA unit is polygenic and encodes three structural rRNA molecules (28, 18 and 5 . 8 s ) and will be discussed first. The genes

38

ANDREW P. WATERS

Typlcal Eukaryotlc rDNA Unit Arrangement

/ k /

A

rRNA genes chrom. 13/14-

12

-

actin-I ArRNN5S

6-tubulin

'"O-11

K

8,

DHFR B rRNA 6 , DrRNA 5 CrRNA

4

,3

7

D

6

C

5

H

K

E

PbS2l

E

H

X

SSUFRADMENT

-

B

1

4

\ C

I

1

6a LSU

5

I

1

6b 7 6b

I

I

5

I

6a

HP

1

H

CSP

2, 1,

3

X 1

K

7-

-

0

2

F

\

II

LSUFRAGMENT

THE RIBOSOMAL RNA GENES OF PLASMODlUM

39

within the unit are always identically disposed, separated and flanked by spacer regions (Figure 2A). The gene order within the unit is thus External Transcribed Spacer (ETS), 18S, Internal Transcribed Spacer 1 (ITSl), 5.8S, ITS2, 28s and ETS. The unit is transcribed as a single polygenic transcript. The 18s rRNA molecule is also called the small subunit (SSU) rRNA and the 28s the large subunit (LSU) rRNA according to the particular ribosomal subunit they are assembled into. There is also a typical higher order organization of the rDNA units themselves as they are dispersed usually at a single genomic locus in large tandem head to tail arrays. The copy number of the individual units is high and can vary from 100s to 1000s. Each unit usually has intrinsic promoter and terminator information although adjacent units may affect transcription of their neighbours (e.g. Xenopus luevis, De Winter and Moss, 1986; Labhart and Reeder, 1986). The genomic environment of each rDNA unit is actively homogenized such that hybridization of an rRNA probe to Southern blots of restricted DNA usually gives a single very intense band of hybridization (Dover, 1982; Flavell, 1986). 2.2.2. Plasmodium The overall organization of the rDNA units has been studied in most detail in Plasmodium berghei and data will be presented mainly from this system. Figure 2 Genomic organization of the nuclear and 35 kb circle encoded rRNA genes. A. General organization of eukaryotic rDNA units. These are shown as a tandem array. The expanded region shows the typical arrangement of the structural genes within an individual unit. This detail of the unit organization is given for the P. berghei A unit which is typically eukaryotic. It must be emphasized that this is for illustration purposes only, the unit does not exist as part of a tandem array in Plasmodium but as disparate units arranged in the genome as shown in B. Restriction endonuclease cut sites are indicated as follows: E = Eco RI, N = Nde I, Ns = Nsi I, H3 = Hind 111, RV = Eco RV. ITS indicates internal transcribed spacer and ETS, external transcribed spacer. B. Organization of the rDNA units of P. berghei. The genomic location of the four rDNA units on the 14 chromosomes of a reference clone of P. berghei. The same organization has been found in all clones and lines of P. berghei with one exception (Janse er al., 1992). Note the location of the 5s RNA genes on chromosome 12. The crude organization of the individual units is given to the right of the chromosome map. Restriction enzyme sites are indicated as before. Additional sites are: K = Kpn I, Pv = Pvu I, P = Pst I. Gene abbreviations are: CSP circumsporozoite protein; DHFR dihydrofolate reductase; PbS21 ookinete specific 21 kDa protein of P berghei (Paton et al., 1993). C. Organization of the rRNA genes on the 35 kb circle of Plasmodium. The organization is illustrated for P. fakiparum and is modified from Gardner et al. (1993), with permission. The relative position and direction of transcription of the LSU and SSU genes is given. The positions of tRNA genes (t) between units is indicated and the fragments given by Hind I11 digestion of the circle are numbered at the top. The asterisk marks the region of unique sequence which is flanked by the invert repeat regions which contain the rRNA genes.

40

ANDREW P. WATERS

Other species of Plasmodium will be referred to at appropriate points in the text. Dame and McCutchan (1983a, b) demonstrated the overall organization of the rDNA units of the NYU strain of P. berghei and showed that the organization of the units differed from the normal in two remarkable ways. Although the gene order within each individual unit was that of a typical eukaryote as described above, both the copy number and the higher order organization of the units relative to one another were unusual. Copy number analysis demonstrated that there were only four units per haploid genome and that they were unlinked (no closer than 150 kbp) to one another. Each of the four units (termed A , B, C and D) had a related but unique array of restriction enzyme sites and were subsequently shown to be on separate chromosomes (A.P. Waters and C. Janse, unpublished Figure 2B). Other species of Plasmodium all seem to have a greater copy number than the rodent malarias (all the rodent malarias appear to have a total of four units each one on a separate chromosome in the main homologous to those in P. berghei, A.P. Waters and C. Janse). The typical estimation appears to be between 8 and 10 copies (Langsley et al., 1983; Unnasch and Wirth, 1983). The restriction maps of the four units suggested a further subdivision could be made recognizing conserved features between the A and the B units (A-type) and a similar pairing of the C and D units (C-type). The terminology of the genes for P. fafciparum is somewhat confusing since they were also referred to in their order of characterization. The A SSU rRNA gene of P. fakiparum is equivalent in its expression pattern to the A gene from P. berghei but the B gene of P. fafciparum is equivalent to the C gene of P. berghei (McCutchan et al., 1988). The terms A and C will be used throughout this review (precedented in Waters et al., 1989). 2.3. Sequence and Expression of the rDNA Units of Plasmodium

2.3.1. Sequence of the SSU Genes Two fragments of the P. berghei rDNA were sequenced, each representing an SSU rRNA gene, one A and the other C. When the compiled sequences were compared with each other the results of the restriction mapping were borne out but gave more detail. The sequences of the genes were 96.5% identical; however, the sequences representing the 3.5% difference between the two genes were clustered rather than randomly dispersed throughout the genes (Gunderson et al., 1986, 1987). These unit specific regions lay in expansion regions of the SSU rRNA molecule, that is regions whose sequence complexity is not necessarily conserved between any pair of organisms (Clark et al., 1984). These regions lie outside the conserved

THE RIBOSOMAL RNA GENES OF PLASMODIUM

41

core sequence and have unknown functions. Secondary structures could be predicted, however, which were more or less equivalent (Gunderson et al., 1987; Waters et al., 1991), structures that are supported by compensatory mutations a criterion that is applied as a test of validity (Hancock et a/., 1988). The clustering of the sequence differences between the two units in non-conserved regions of the SSU molecule had two effects; one was that both units contained all the known information to form active subunits that could be assembled into ribosomes and the second was that it was possible to synthesize oligonucleotide probes complementary to the regionalized differences as tools to dissect the pattern of expression of the two units. Two probes in particular, TM3 (C specific) and TM4 (A specific), were used to study the pattern of expression of the C- and A-type units. Both probes detect both rDNA units of their subclass (i.e. C- or A-type). When hybridized to preparations of total RNA from the various stages of the life cycle of the parasite it was clearly seen that the A-type gene was preferentially expressed in asexual parasites at a ratio of 20:l of A:C and that the ratio was more than reversed in oocyst RNA purified from infected mosquitoes (it is actually very difficult to observe A gene expression in sporozoites) (Gunderson et al., 1987). Direct RNA sequencing from the appropriate parasite forms confirmed the hybridization data. The pattern of rRNA gene expression is summarized in Figure 1 superimposed on the life cycle. All Plasmodium species so far investigated have been shown to have two distinct types of rRNA gene which display varying degrees of regionalized sequence similarity (range 83-97%). Oligoprobes directed at these differences have also always shown a similar pattern of differential gene expression. Currently this holds true for rodent, avian, primate and human malarias. 2.3.2. Sequence of the LSU Genes Two large subunit rRNA genes have been sequenced from P. falciparum and show the same pattern of regionalized differences (A.P. Waters, J.-D. Li and T.F. McCutchan, unpublished) and represent members of the C- and A-type units. The asexually expressed molecule is predicted to be -3800 nt long and again contains all the conserved regions expected of a functional molecule and folds into an appropriate secondary structure. Confirmation that this unit was expressed in asexual bloodstage forms was obtained by comparison with cDNA clones. The asexually expressed gene corresponds in its restriction pattern to the previously identified pPFrib2 unit (Langsley et al., 1983). The second clone that has been sequenced (A.P. Waters, J.-D. Li and T. McCutchan, unpublished) does not contain the complete LSU rRNA gene but does resemble pPFribl and has every

42

ANDREW P. WATERS

restriction site reported by Langsley et al. (1983). However, it also has additional sites for the same enzymes. Nucleotides which are involved in recognition of the assembled small subunit to give the functional ribosome are also conserved. The 5’ region of the asexually expressed LSU molecule has appropriate complementarity with the 5.8s RNA molecule forming a functional hybrid that is typically eukaryotic (Gutell and Fox, 1988). The sequence of the LSU genes from P. berghei is largely uncharacterized, however it has been shown that the mature LSU rRNA species in asexual parasites is naturally nicked to give two species of 3200 and 800 nt respectively (Miller and Ilan, 1978; Dame and McCutchan, 1983b). 2.3.3. Sequence of the 5.8s Genes 5.8s RNA is a eukaryotic specific feature of ribosomes. The prokaryotic equivalent is contiguous with the LSU and 5.8s base pairs at the 5’ end of the eukaryotic LSU (Jacq, 1981). The 5.8s rRNA genes have been divided into five classes on the restriction fragment length polymorphism defined by AT-rich cutting restriction enzymes. Four gene types have been sequenced and show variation at the 3‘ end of the structural molecule (Shippen-Lentz et al., 1987,1990). One gene type was shown to be present in the genome 30-fold more abundantly than the other four. A 5.8s gene was also sequenced from the same clone containing the 28s gene (A.P. Waters and T. McCutchan, unpublished) which was most similar (yet not identical) to one of the minor units (unit IV) described by Shippen-Lentz et al. (1990) yet this clone was equivalent to pPFrib2. Since the rDNA unit copy number has been estimated as only 8 (Langsley et al., 1983), there are data which cannot be reconciled at present. The class I1 and IV molecules are capable of hybridizing to the 5’ end of the asexually expressed LSU molecule (A.P. Waters and T. McCutchan, unpublished). 2.4. Transcriptional Control of rRNA Gene Expression in Plasmodium

The demonstration of the ability of the parasite to express different distinct rRNA genes at different points in its life cycle has a number of implications which must be considered in the light of the circumstances of the life cycle. The switch in rRNA expression occurs at points of proliferation in the life cycle resulting in different forms of the parasite using different stagespecific ribosomes. Is there a mechanism that removes one form of the ribosome allowing its replacement with the alternative? Both the ookinete and the newly invaded exoerythrocyctic cell undergo multiple rounds of cell division giving rise to thousands of daughter forms which are either

THE RIBOSOMAL RNA GENES OF PLASMODIUM

43

sporozoites (C unit expression) or merozoites (A expression), respectively. Therefore, replacement of the ribosome might be more effectively regarded as dilution of the existing ribosome population reducing it to an undetectable level. The C and A genes encoding rRNA must also be differentially expressed and the logical level at which this might be controlled is through the promotion of transcription. These rDNA units might therefore be thought of as switchable, expressed at different stages of the life cycle. So when might the switch in expression occur? As previously discussed the progression of the life cycle involves exposure to two very different environments provided by host and vector. The simplest expectation, but not the only possibility, would be that the switch would take place upon transfer of the appropriate parasite form from vector to host and vice versa. In other words during occupancy of the vertebrate liver and in the insect midgut. It used to be impossible to observe these phenomena in a single Plasmodium species and many of the early studies were performed in a variety of systems using different species. The majority of the data that are now available come from the study of two systems, the P. berghei model in rodents and the human parasite, P. falciparum in culture. 2.4.1. The A to C Switch Using P. falciparum it has been possible to demonstrate that this onset of C gene transcription does indeed take place in a manner linked to the developmental pathway of the parasite. In the gametocytes of this species, a C gene precursor product accumulated which contained the SSU gene. The precursor was some lo00 nt longer than the mature SSU. Oligonucleotide mapping suggested that the extra sequence material was contiguous with the 5’ end of the SSU region, therefore including all or part of the ETS region. The precursor was apparently stable in P. falciparum gametocytes and only minimal processing of the precursor to the mature SSU form was apparent. After activation and fertilization of the gametocytes, however, two events were stimulated; increased transcription of the C gene and processing of the precursor form to give the mature SSU transcript. Culturing of the zygotes allows their continued differentiation and 16 h after fertilization the precursor was still visible but large amounts of the mature transcript were also accumulating. The caveats associated with this work are that it relies on cultured material and that ookinete culture is not a wholly successful undertaking with P. falciparum. Zygote formation is efficient but only a small percentage develop into truly mature ookinetes which can be used to infect mosquitoes. Recently we have been able to repeat these observations using the now highly developed rodent model of P. berghei (Waters et al., 1993~).In this model it is now possible

44

ANDREW P. WATERS

to obtain large amounts of pure gametocytes and to activate, fertilise and culture these through to ookinetes which are highly infective to Anopheles stephensi. In this model we see a different pattern of C gene expression during sexual development that occurs in two phases. Increased expression is not visible until 14 h after fertilization in ookinetes and is due to the upregulation of transcription. There is no apparent accumulation of precursor There is a small earlier peak of expression molecules (Waters et al., 1993~). at 20 h after merozoite invasion of erythrocytes when both asexual and sexual cells are trophozoites and morphologically indistinguishable. This may be the equivalent of the C gene expression seen in the developing gametocytes of P. falciparum. Can we reconcile the observed differences in C gene expression during gametocytogenesis in P. berghei and P. falciparum? The two species are quite distinct biologically and phylogenetically. Whereas one would expect the overall features of gametocyte development to be very similar, the duration of development, which takes 26 h in P. berghei and 8 days in P. fulciparum, is quite different. Thereafter the timing of the progression of the life cycle through the vector is quite similar. The appearances of the gametocytes are also quite distinct, those of P. falciparum produce avianlike scythe shaped forms whereas those of P. berghei do not deform the host erythrocyte. The appearance of the nucleus during gametocytogenesis in the two species may also be quite significant. An electron-dense area that has been interpreted as being the usual site of rRNA transcription, the nucleolus, is plainly visible in mature female gametocytes of P. fulciparum (Sinden, 1982), the species which produces the precursor, whereas none is visible in the equivalent forms of P. berghei (Sinden, 1978). The early burst of C-type transcription in P. berghei occurs before gametocytes and trophozoites can be morphologically distinguished. One may question, however, if a nucleolus is to be expected at all given the low copy number of the rDNA units and their disparate location in the genome. All of these differences may result in species specific requirement or preparation for the introduction of C unit transcripts. Both models may simply need more detailed investigation to demonstrate equivalent transcriptional events. 2.4.2. The C to A Switch This has been demonstrated using P. berghei sporozoites isolated from infected mosquitoes which are then used to infect in vitro cultures of human hepatoma cells. Full and efficient development of the liver stage forms occurs in a manner that mimics the development in the liver of the vertebrate host. Using the specific oligonucleotide probes the appearance of the A gene was monitored and was detectable 8 hours after infection

THE RIBOSOMAL RNA GENES OF PLASMODlUM

45

of the liver cells. Some of the parameters of liver stage development were also investigated. Invasion of sporozoites was necessary but not sufficient for switching which required some intracellular development. Irradiated, attenuated sporozoites were also capable of switching to A gene expression demonstrating that attenuated sporozoites develop through at least one observable developmental change (Zhu et al., 1990). This work also demonstrated that simple transition of sporozoites from 18°C to 37°C is not sufficient to trigger the switch in rRNA expression. Interaction of the sporozoite with the hepatocyte and development is required. The evolution of the dual rRNA system is part of a more complex response to the differences in environment provided by host and vector. 2.5. Genetic Control of Expression 2.5.1. General

Promoter elements and enhancers which control the onset and degree of transcription of rRNA genes vary widely in their positioning relative to the SSU. This is due to variation in length of the ETS region which effectively separates the promoter from the SSU. In yeast the 5’ ETS is 696 nt long (Klootwijk and Planta, 1989); in mouse, 4 kb (Miller and Sollner-Webb, 1981). In Saccharomyces cerevisiae the promoter is contained within the 212 nt adjacent to the transcription start site with a bidirectional 190 bp enhancer sequence located a further 2 kbp upstream (Elion and Warner, 1984, 1986; Johnson and Warner, 1989) that also has terminator activities (Kempers-Veenstra et al., 1986; Mestel et al., 1989) and demonstrable regulatory activity (Morrow et al., 1993; Schultz et al., 1993). Linker scanning analysis of the yeast promoter divided it into three domains; 111 (-146 to -76), I1 (-70 to -50) and I(-28 to +8) where 0 is the start of transcription (Kempers-Veenstra et al., 1985; Musters et al., 1989). Disruption of domains I and I1 almost abolished transcription and phase spacing of these two domains was also important implying that a transcription factor(s) might bind simultaneously to both elements (Musters et al., 1989).

2.5.2. Plasmodium Little is known at present about transcriptional start sites or promoter structures of any genes still less about functional characterization of such elements. Research in this area is hampered by a lack of basic tools such as transcription lysates of nuclei from Plasmodium for in vitro analysis of

46

ANDREW P. WATERS

transcription and stable transfection systems of Plasmodium for in vivo analysis. The recent description of transient transfection of zygotes of P. gallinaceum (Goonewaradene et al., 1993) will allow preliminary in vivo analyses to be made. A further complication is the demonstrable sequence conservation in the upstream regions of both A gene units in P. berghei and similar conservation between both C-type units (A.P. Waters and C. Janse, unpublished) which will defeat attempts to analyse unmodified units in vivo. Nuclear run-on analyses of rRNA transcription have been performed with nuclei isolated from P. falciparum and transcription of the A-type units has been shown to be resistant to high levels of a-amanitin (Rudenko and van der Ploeg, 1989). This indicates that transcription of the genes is carried out by a polymerase molecule with a drug resistance profile similar to that of a typical RNA polymerase I. Using PCR probes it has been possible to demonstrate that the transcription of the A-type genes of P . berghei initiates less than 1 kb upstream and that a processing site lies within 0.5 kb of the 5' end of the SSU gene (A.P. Waters and C. Janse, unpublished). Further mapping will reveal the exact location of the start of transcription and upstream processing sites. The predicted length of the A-type unit ETS is similar to that found in yeast. The sequence of the ETS of both the A and C genes of P . berghei has been determined and compared and shows little sequence homology to each other or other ETS regions. The actual figure of the aligned sequences is over 60% homologous but this is merely a reflection of the difficulties faced by alignment programmes trying to align two sequences of -80% AT content. 2.6. Transcription Factors and rDNA

2.6.1. General Transcription factors are proteins which interact either with the transcriptional enzymes, RNA polymerases I, I1 and 111, with specific DNA sequences that are important in the promotion of transcription or interact with both enzyme and DNA. These factors are responsible for both the enhancement of transcription and the accuracy of its initiation. It has been possible to characterize some of the transcription factors associated with the promotion of transcription of the complex rRNA gene unit in several systems. What has emerged from biochemical and genetic studies is a picture which demonstrates both unique and universal features associated with the promotion of transcription in general. Two factors, termed promoter selectivity factor (SL1) and upsteam binding factor (UBF), have been biochemically characterized that act as

THE RIBOSOMAL RNA GENES

OF

PLASMODIUM

47

transcription factors for rRNA genes in humans (Learned et af., 1986).UBF and RNA pol I are interchangeable between closely related species (Bell et al., 1990), however SL1 is species specific (Learned et al., 1985; Bell et al., 1989, 1990), responsible for recognition of the cognate template and therefore site specific. This is somewhat similar to the situation with RNA pol I1 with its requirement for a combination of general transcription factors and site-specific enhancers (Reinberg and Roeder, 1987). The similarity between the interactions of these two polymerases is further emphasized with the demonstration that they both are influenced by the general transcription factor known as the TATA-binding protein (TBP). TBP, which is known to be integral to the general activity of RNA pol I1 and bind to the TATA box DNA element in the promoter region of all pol I1 transcribed genes, also forms part of the SL1 complex (along with three other Tightly Associated Factors (TAFs) ). TBP is, therefore, also involved in the promotion of RNA pol I activity and rRNA transcription (Comai et al., 1992). Further genetic evidence showed the central role of TBP as a cofactor of transcription mediated by all three polymerases in yeast (Cormack and Struhl, 1992; Schultz et af., 1992). It is not clear how the product of a single gene (in yeast) is capable of differential interaction with the three types of RNA polymerase molecule. Perhaps multiple forms of TBP exist, generated by forms of post-transcriptional processing. Evidence in support of this latter point shows that different temperaturesensitive mutations within TBP can differentially affect the ability of the mutant protein to act as a co-factor to specific RNA polymerases (Schultz et a f . , 1992). Proteins binding to enhancer elements have also been demonstrated for example Reblp (Morrow et al., 1989) and Abflp (Morrow et al., 1990) both bind to different regions of the 190 bp rDNA enhancer element of S. cerevisiae. The combination of enhancer and transcription factors is thought to regulate transcription in one of two ways (Reeder, 1989), either through alteration of the receptivity of the gene for active polymerase or increased loading onto pre-assembled activation complexes (Conconi el a f . , 1989). 2.6.2. Plasmodium TBP has been cloned from the human parasite, P. falciparum (McAndrew et al., 1993). It is a widely diverged protein compared with those characterized from other species. In general it is highly conserved protein which shows > 80% identity in the -180aa C-terminal core domain (Greenblatt, 1991). However, TBP from P. falciparum shows only 3844% identity and is conserved primarily in length. A significant number of the basic amino acid residues arginine and lysine are positionally conserved (seven of nine

48

ANDREW P. WATERS

universally conserved positions (McAndrew et al., 1993)) which may influence binding to other protein factors (Buratowski and Zhou, 1992). The protein is so different that one is forced to consider if this gene is indeed a diverged member of a multigene family and that the true homologue of TBP is yet to be discovered. For instance, the otherwise conserved proline at position 65 of S . cerevisiae TBP (position 50 in P. falciparum) that determines ability to influence RNA pol I (Schultz et al., 1992) is not conserved in the TBP of P. falciparum (McAndrew et al., 1993). It is speculated that the unusual AT-rich constitution of the P. falciparum genome has resulted in the widely divergent form of TBP in this parasite (McAndrew et al., 1993). The gene encoding this form of TBP is single copy and located on chromosome 5 (McAndrew et al., 1993). 2.7. 5s RNA Genes

2.7.1. General The 5s RNA molecule consists of an approximately 120 nt transcript produced by RNA polymerase I11 which is associated with the large ribosomal subunit and the peptidyltransferase activity (Garrett et al., 1981). Like their complex counterpart (the 18, 5.8, 28s rRNA encoding unit), the genes are usually present in multiple copies that cluster in the genome but at a locus which is separate from that of the complex unit. The copy number of the 5s genes is usually in proportion with the copy number of the complex unit, reflecting the molar requirement for the respective transcripts. Yeast has an unusual organization of its rDNA where the complex unit and the 5s units are interdigitated in an equimolar tail-totail configuration. The two units are transcribed independently of each other (Gudenus et al., 1988). The promoter for transcription of 5s genes is internally disposed in the structural sequence of the gene (Ciliberto et al., 1983). A species-specific family of transcription factors (termed TFIIIA, B and C) promote transcription. The gene regulates its transcriptional binding through feedback inhibition (Brow and Geidushek, 1987), the 5s RNA molecule competing with the gene for binding to TFIIIA (Geidushek and Tocchini-Valentini, 1988). The general transcription factor TBP also forms part of the active transcription complex for this class of genes (Cormack and Struhl, 1992; Schultz er al., 1992; White er al., 1992). 2.7.2. Plasmodium The genes encoding the 5s RNA species are typical of most eukaryotes except that, in P. falciparum, they have been shown to be of low copy

THE RIBOSOMAL RNA GENES OF PLASMODIUM

49

number, matching that of the complex unit (Shippen-Lentz and Vezza, 1988). The three 5s RNA genes are physically linked to one another and contained within 1.5 kbp of DNA at a locus that is not linked to a complex unit of rRNA. Recent evidence demonstrated that in P. berghei the genes are located on chromosome 12, the same chromosome as the complex unit A but the relative positions of the two loci are unknown at present (A.P. Waters and C. Janse, unpublished). Earlier mapping work suggested that they are at least 5 kbp distant from any of the complex rDNA units (Dame and McCutchan, 1984). The three genes in P. falciparum code for identical transcripts with the exception of one or two uridine residues at the 3' end. Each of the units has a typical oligo(dT) pol I11 termination sequence at its 3' end. The three units are all expressed in asexual parasites although at different ratios (Shippen-Lentz and Vezza, 1988). It is not known if this ratio alters during the progression of the life cycle and neither is the significance of the 3' terminal polymorphisms. Each gene contains elements homologous with consensus internal elements involved in promotion of transcription and the gene can be transcribed in an heterologous, transformed human cell transcription extract (Shippen-Lentz and Vezza, 1988). This sugests that the promoter elements are sufficiently conserved to be functional. 2.8. Organellar rRNA Genes

Plasmodium parasites possess two extrachromosomal DNA elements that appear to replicate independently of nuclear DNA. One is a circularly disposed 35 kbp element whereas the second is a -6.0 kbp element which is highly repeated and can be found as a tandem array. It is unclear at the moment which of the various organellar structures contain either of these elements. Both elements contain distinct rDNA moieties which are transcribed and will be described separately.

2.8.1. The 35 kbp Circular DNA Element The 35 kbp circular DNA element was discovered as an aberrantly migrating band of P. knowlesi parasite DNA during buoyant density gradient separation (Williamson et al., 1985) and has subsequently been demonstrated in other parasites including P. falciparum. It has a number of genes that have been identified and include RNA polymerase subunit rpoB and rpoC genes and a palindromic element which contains both large and small rRNA genes and separated by tRNA genes. The rRNA genes are therefore present in two copies per circle arranged as mirror images of each other centred around the 3' end of the SSU. The relative arrangement

50

ANDREW P. WATERS

of the SSU and the LSU units within each palindromic unit is unusual since they are head t o head with each other (Figure 2C). Thus the transcription of the molecules is on opposite strands and independent unless a bidirectional promoter is invoked. The two copies of the LSU rRNA gene are identical for 300 nt at their 3’ end and may well be completely identical (Gardner et al., 1993) and thus as yet there is no evidence for their stagespecific transcription; the genes are transcribed throughout asexual growth. Evolutionary implications drawn from the sequence analysis of these molecules will be described in a later section. Both the SSU and the LSU genes contain the appropriate structural information to form active organellar ribosomes (Gardner et al., 1991, 1993).

2.8.2. The 6 kbp element The 6 kbp DNA element is a mitochondrial DN A-like element originally demonstrated in the rodent parasite, P. yoelii (Vaidya and Arasu, 1987) 5.8 kbp in length. The element is tandemly repeated in a head to tail fashion and the repeat unit cross-hybridized with Plasmodium DNA from other rodent species as well as primate, human and avian parasites. In P. yoelii and the avian parasite, P. gallinaceum, transcription of the fragment was demonstrated in vertebrate bloodstream, asexual parasite forms and the transcripts included fragments of rRNA-like molecules as well as cytochrome b and cytochrome oxidase subunit I (Aldritt et al., 1989; Vaidya et al., 1989). Complete sequence characterization of the element and database searching revealed the presence of rDNA-like fragments typical of a mitochondrial arrangement, transcription taking place on both strands of the DNA (Aldritt et al., 1989; Suplick et a l . , 1990; Feagin et al., 1992). There is sufficient sequence complexity in the rRNA fragments to cover the majority of the mitochondrial core sequences of both the large and small subunits suggesting functionality (Feagin et al., 1992). 2.9. The production of Mature rRNA: Processing of the Primary Transcript

2.9.1. General Processing is the series of cleavage events by which the primary multigene transcript of the complex rDNA unit is cut to yield the three mature structural rRNA molecules, the 5.8S, the 18s and the 28s. A minimum of six cuts will be required at exact points in the transcript to achieve the appropriate products although there are usually more. This is a highly ordered process which is mediated by both RNA and protein moieties

51

THE RIBOSOMAL RNA GENES OF PUSMODKJM m I

"

I

1

Lm

I1

,

I

I

1

Gene

Transcrlptlon

Tc

.

*

35s

-,C

Primary Transcript

32s

27SA A3

27SB

18s

-

28s

Mature Species

Figure 3 Processing of ribosomal RNA. The A unit of P. berghei is illustrated and detailed as in Figure 2A. Processing of the transcript is illustrated by showing the pathway used in S. cerevisiae and is modified from Mattaj et al. (1993). Asterisks indicate the processing events which are affected by either defects in or depletion of the indicated snoRNA species or nuclear proteins and are referred to in the text; f indicates cuts inhibited during gametocytogenesis leading to accumulation of the C gene precursor rRNA in P. fakiparum. The sizes of the precursors are indicated and the cuts are denoted in order, A referring to the production of the 18s species and B refemng to production of the 28s species. Tc indicates the theoretical start of transcription in the A unit.

many of which are very conserved. In yeast, the number and order of the cleavage events is known and many of the components involved in processing have been defined genetically. The state of knowledge of these events is summarized in Figure 3 showing the order and number of the cleavage events and the RNA and protein components known to mediate those events. Several (12 in yeast) small nucleolar RNA molecules (snoRNAs) play a role in rRNA maturation, e.g. snoU3 is involved in the

52

ANDREW P. WATERS

A0 cut in the 5’ ETSl region (Hughes et al., 1987; Hughes and Ares, 1991) and snoRNA U14 (Zagorski et al., 1988; Li et al., 1990); snoRNA30 (Morrissey and Tollervey, 1993) and snoRNAlO (Tollervey, 1987) are all involved in the production of mature 18s rRNA. The mechanism of action is not entirely clear at present for any of the snoRNA species. In the case of U3 snoRNA, it is thought to involve base pairing between a conserved region in the U3 molecule and a region of the ETS1, in a manner analogous to the snoRNA molecule involvement in intron splicing from pre-mRNA (Mattaj et al., 1993). A role for proteins in these events has been defined genetically. The protein fibrillarin is associated with all 12 known yeast snoRNAs (Schimmang et al., 1989) and is involved in all facets of post-transcriptional modification of the primary precursor since every cleavage event as well as methylation and ribosome assembly can be affected by different defects in this conserved nucleolar protein (Tollervey et al., 1991, 1993). The protein encoded by GAR1 in yeast is associated with snoR10, 30 and 31 (Girard et al., 1992; Morrissey and Tollervey, 1993) and again defects or depletion of this molecule leads to failure to accumulate 18s rRNA. Not surprisingly, all of the protein and RNA mediators mentioned above are essential for viability in yeast. 2.9.2. Processing of the r R N A Transcripts of Plasmodium The stage-specific predominance in expression of different forms of rRNA molecules raises the question of the processing of these molecules. Three possibilities present themselves: they may be (1) entirely stage specific having no shared mediators or sequence elements; (2) entirely conserved, using identical processes; (3) a mixture of 1 and 2. The evidence is far from complete and is currently being addressed preliminary work in this laboratory would suggest that option 3 is possibly correct. As stated earlier, sequence analysis of the ETS regions of C and A units of P. berghei shows that there is very little homology between the sequences. However, the 10 nucleotides immediately adjacent to the mature 5‘ SSU terminus are identical in both C and A units and the first five are conserved in other Plasmodium species (Goman et al., 1991; A.P. Waters, unpublished), S. cerevisiae (Yeh and Lee, 1992) and Tetrahymena thermophila (Miiller and Eckert, 1989). This implies that the factors and mechanisms which are responsible for the formation of the mature 5 ’ terminus of the SSU molecule are conserved (see below) but that other cut sites and promoters may well be stage and unit specific. Indeed the sizes of the precursors which predominate in either asexual bloodstage forms or in dividing oocyst in the mosquito show distinct size differences indicating that even if similar mechanisms are employed, sequence divergence

THE RIBOSOMAL RNA GENES OF PLASMODlUM

53

between the C- and A-type units has minimally involved insertions and/or deletions. For instance, there is demonstrable size variation in the ITS 1 of the C and A units of P. berghei (Dame and McCutchan, 1984). Furthermore, our own sequence data show there is immediate divergence of the sequence of ITS1 at its junction with the 3' end of the SSU (A.P. Waters, T. McCutchan and C. Janse). This would imply that either distinct mechanisms are involved in the processing events or that the sequence of the 18s rRNA alone determines the position of the cut. Uniquely in P. berghei there is also polymorphism at the very 3' end of the structural 18s unit (Gunderson et a f . , 1987) reinforcing the thought that unit specific mechanisms exist. None of the factors which have been described in the general section detailing processing of the preribosomal RNA have as yet been identified in Plasmodium although elements involved in splicing of mRNA have been described (Francoeur ef al., 1985). Of course, the interest will lie in the existence of multiple forms of such factors each produced in a stage-specific manner and associating with a particular transcript from a C- or A-type gene. Post-translational modifications may well alter the transcript specificity of these factors. If multiple genes exist for these factors they may have the ability to act on both transcripts but with reduced efficiency on the non-cognate form reflecting the divergence. Future research should answer these questions. 2.10. Ribosomes

2.10.1. General Ribosomes consist of a complex of the rRNA species already described and proteins. Two distinct subunits, the large and the small, associate around mRNA to form the active ribosome. Transient association with amino acid-charged tRNA molecules translates the mRNA and forms the covalent bonds between the amino acid residues building the protein. For thorough reviews about ribosome structure, function and activities, see Stern et al. (1989), Atkins et al. (1990), Ramagopal et al. (1992) and Lake (1985). 2.10.2. Plasmodium The ribosomes of Plasmodium have not been investigated in much detail chiefly due to problems in obtaining sufficient biomass and purity. In earlier research ribosomes were isolated from asexual bloodstage parasites of a variety of species, e.g. P. knowlesi (Sherman et a f . ,1975), P. lophurae

54

ANDREW P. WATERS

(Sherman and Jones, 1976,1977;Wallach and Boeke, 1983) and P. berghei (Miller and Ilan, 1978). The normal 30s and 50s sizes of the subunits were demonstrated as well as the presence of the rRNA species. In the case of P. berghei it was shown that the large rRNA molecule is nicked to give two species of approximately 800 nt and 3000 nt (Miller and Ilan, 1978). Cell-free translation lysates have been produced and shown to be translationally competent (Wallach and Boeke, 1983). Miller and Ilan (1984) compared the ribosomal protein spectrum of P. berghei and host rat liver and showed that numerous distinctions could be made. Beyond this little has been done to further our knowledge of ribosomes at the molecular level. Recently a random genome sequencing project has isolated the genes for several ribosomal proteins (J. Dame, Genbank Submissions) and a protein encoding elongation factor la which is ribosome associated (J. Dame; D. Williamson, both Genbank Submissions). Clearly one of the most interesting questions will be how many of the ribosomal components are stage specific? This addresses the level of duplication of the ribosomal proteins, the extent to which such components are interchangeable in C and A ribosomes and the possible role of stagespecific post-translational modification that may influence the function of specific ribosome components (this happens in Dictyostelium discoideum (Ramagopal, 1992)). Although it is possible to obtain sufficient material from asexual bloodstages to address these questions the difficulty will lie with obtaining sufficient amounts of material from the mosquito stages of the parasite. The potential of the in vitro culture systems for the oocyst stages of the parasite may provide this (Warburg and Miller, 1992). 2.1 1. Plasmodium Ribosomal RNA Sequence

2.11.1. Function All nuclear SSU rRNA genes which have been sequenced from any Plasmodium species contain all of the conserved sequence and structural elements which will allow the formation of an active 30s ribosomal subunit capable of interacting with the 50s subunit. Much of the sequence, and therefore structure, is conserved between the various characterized species of Plasmodium. Similarly in the one completely sequenced nuclear LSU gene, an A type of P. fakiparum all conserved known functional sequence motifs are typically eukaryotic in composition. Sequence data from a Ctype LSU gene from P. fakiparum and an A LSU gene from P. berghei support this. The sequence of extrachromosomal rDNA elements also contain all of these conserved elements (or most in the case of the 6.3 kbp

THE RIBOSOMAL RNA GENES OF PLASMODlUM

55

mitochondria1 element). Readers are referred to the reviews mentioned above for detailed analysis of structure and function. 2.1 1.2. Drug Resistance Within the Ribosome It has become apparent that the rRNA molecules are not merely scaffold for the ribosome serving to maintain the appropriate steric relationships of the active ribosomal proteins. Instead the catalytic nature of the rRNA itself has been steadily revealed over recent years (Dahlberg, 1989). Many antibiotics inhibit the ribosomal activities as their mechanism of action and subsequently have been shown to interact directly with rRNA (De Stasio et al., 1988). A consequence of this is that point mutation changes in the sequence of both the SSU and LSU can generate resistance to many antibiotics either specifically or generically. Again with the parasite possessing three types of ribosome in different compartments at any one point in its life cycle there are numerous potential targets for appropriate antibiotics. The sequence of rRNA genes, once elucidated, allows a search for the conserved active structures and also predictions about the natural antibiotic resistance spectrum of an organism. This latter approach was successfully applied to Giardia where the predicted resistance and sensitivity spectrum was demonstrated in cultures (Edlind, 1989). Jenson et al. have extensively studied the drug sensitivity of Plasmodium parasites and this affords the opportunity to correlate their observations with predictions that might be made from the sequences. The presence of stagespecific ribosomes allows the possibility of the display of a different drug sensitivity spectrum throughout the life cycle (Geary and Jensen, 1983; Divo et al., 1985; Geary et al., 1988, 1989). A review of the positions within the rRNA units where variation is associated with resistance to antibiotics reveals that none of these are variant between stage-specificunits (Table 1). Indeed there are no known antibiotic-interactive positions which vary between species of Plasmodium. However, sporozoites, asexual bloodstage forms and gametocytes have been reported as having different sensitivities to various antibiotics (Geary et al., 1989). This may be due to the distinctions that can be made between nuclear and extachromosomally encoded rRNAs. Stage-specific susceptibility to particular drugs can also be explained either by differences in uptake or by pharmacokinetic distinctions of the vertebrate and invertebrate hosts and not due to known differences in the rRNA target. It remains possible that novel changes might occur in the ribosomes of Plasmodium that may facilitate resistance. Only a few naturally occurring sequence forms predict specific antibiotic resistance in Plasmodium, for example, streptomycin. Resistance in bacteria to this drug is known to be due to mutations at positions ASz3+G and q l p U (E. coli 16s numbering)

56 Table I

ANDREW

P. WATERS

Summary of ribosomal RNA sequence and antibiotic drug resistance.

Antibiotic

Streptomycin Spectinomycin Hygrom ycin Paromomycin Kanamycin and gentamycin Kanamycin and apramycin Aminoglycosides

Ribosomal target

Resistance changea

ssu ssu ssu ssu ssu ssu ssu ssu

LSU LSU' Erythromycin and LSU MLSg Lincomycin LSU Clindamycin and LSU chloramphenicol Chloramphenicol LSU LSU LSU LSU LSU Thiostrepton LSU

Plasmodium Prediction Observed

equivalent Nu. Ci. Mi. U C C Resistant A A G Resistant C' C C Resistant? U U U Sensitive C C C Sensitive Cd C C Sensitive?

Resistant ?

Sensitive Resistant

Gd A A Sensitive? Resistant G

G G Sensitive

Ue A C Resistant? Ae G G Resistant? Sensitive G A U Sensitive

Erythromycin

AIm+G,U,C

G G

G G Sensitive G G Sensitive

A U A G A G

A U A G A A

Sensitive Sensitive

A Sensitive U Sensitive A Sensitive G Sensitive Sensitive A Sensitive G Resistant? ND

Nucleotide numbering is given for E. coli. Changes given are those reported in literature. Spectrum of resistance is seen with all possible replacements of C in order of strength they are G > A > U. ' Range of associated changes at other positions in SSU confer either temperature sensitivity to the resistance or abolish it. Plasmodium has sensitive genotype at all reported positions of this type. Methylation status of any residue of Plasmodium rRNA is not known. These changes confer resistance singly possibly due to disruption of mutual base pair formation. Natural changes in Plasmodium form base-paired combination. Resistance might not be expected and is not seen. Also confers resistance to chloramphenicol. g MLS = Macrolide, linocomycin and streptogramin B. ND = no published data. a

in the 16s rRNA molecule (Montandon et af., 1986). All nuclear 18s rRNA genes characterized so far in Plasmodium normally have a U residue at the equivalent position to CgI2(in P. berghei) and an altered sequence surrounding the A523 (Gunderson et al., 1986, 1987). Additionally the 6 kb rDNA fragment of P. fakiparum has a A,,,-G replacement (Feagin et

THE RIBOSOMAL RNA GENES OF PLASMODlUM

57

al., 1992). Consistent with this, all species of Plasmodium tested so far with this antibiotic are also resistant to streptomycin (Geary and Jensen, 1983; Puri and Dutta, 1982) although there is also evidence to suggest that streptomycin is not taken up well by infected erythrocytes (Geary et a f . , 1988). A combinatorial effect may well explain the lack of activity. Conversely all of the positions in the LSU where change is associated with resistance in bacteria are conserved in the sensitive form in P . falciparum (A.P. Waters and T. McCutchan, unpublished). Thus the parasite is expected to be sensitive to erythromycin which confirms the observed effect of the drug in culture (Geary and Jensen, 1983). Kanamycin is an example where an antibiotic is not active against malaria parasites when activity would be predicted from the 18s rRNA sequence (Table 1) (Divo et af., 1985). This can possibly be explained by lack of uptake of the drug since when erythrocytes are pre-loaded with kanamycin inhibitory effects are seen (Krugliak et al., 1987). Table 1 summarizes some of the sites of action in the ribosome of antibiotics and the predicted and actual effect on Plasmodium. It is anticipated that the nuclear encoded ribosomes would be sensitive to the peptide antibiotics, ricin and a-sarcin. Both the nuclear and the mitochondria1 LSU fragment have an altered thiostrepton site A I o 6 p G (E. cofi 23s rRNA numbering) (Feagin et al., 1992; A.P. Waters and T. McCutchan, unpublished. 2.11.3. The Function of Stage-Spec#c Sequence Differences All of the regionalized sequence differences between stage-specific SSU rRNA molecules of Plasmodium lie in what are termed expansion regions of the molecule. Expansion regions are located between the highly conserved “core” regions. Each expansion region is predictably either species specific showing no variation between C and A genes or stage specific and to date has no associated specific function. However, specific secondary structures can be predicted (Gunderson et a f . , 1987) in which compensatory base changes appear indicating requirement for a particular structure (Hancock et a f . ,1988). Equivalent structures between distantly related members of Plasmodium are not easy to define. A species specific region that forms a roughly equivalent structure in the 18s RNA has been reported (Waters et a f . , 1991) but there are no stage-specific equivalents. One of the attractive possibilities was that there might have been sequence motifs in the stage specific regions which facilitated mRNA association with the appropriate ribosome form in a manner equivalent to the bacterial Shine-Delgarno sequence. Such a motif might be expected to be conserved in equivalent regions between species and found at the 3’ end of the 18s molecule. No such motif is seen; however, a survey of stage specific genes similarly failed to reveal sequence homologies in the mRNA species that

58

ANDREW P. WATERS

may have implicated a different region of the rRNA molecules. A number of stage-specific pairs of SSU genes have now been sequenced (A.P. Waters, D. Higgins and T. McCutchan, submitted) revealing that closely related parasites (such as vivax-like primate malaria) show close similarity in the stage-specific motifs. Conserved stage-specific nucleotides and motifs are easily identified to the extent that the cognate stage-specific genes are more similar to one another than to the gene in the same species expressed at the other part of the life cycle. This will be more fully addressed in the following section. It provides a strong argument for the necessity of the identity of stage-specific rRNA genes although precise function cannot be attached to any particular domain or motif. A further stage-specific activity of the ribosomes is participation in the specific removal of the active ribosome population during replacement and introduction of the ribosome population that accompanies the stagespecific switching. This phenomenon has been initially addressed in cultured P . falciparum sexual stage parasites where the specific degradation of A gene SSU sequences was observed (Waters et al., 1989). Curiously the initial cleavage site was mapped to within a few nucleotides (nt 1641-1689 in P . falciparum) in a highly conserved region of the molecule shared not only by Plasmodium SSU rRNA genes but also all those of the various hosts. It has been postulated that the incoming ribosome population is protected from the activity of the putative ribonuclease either by compartmentalization or possibly by specific folding patterns induced by the stage-specific regions which obscure the cut site (Waters et al., 1989). The possibility that dilution of the current ribosome complement by the introduced form is the major apparent mechanism in the apparent removal of the existing ribosome population has already been discussed. Such a mechanism would allow for the conserved nature of the observed cut point in SSU rRNA. However, the pattern of degradation points to some level of temporal control of ribosome removal which perhaps serves to protect the incoming ribosome population (Waters et al., 1989).

3. INFERENCES OF PHYLOGENY BASED O N RIBOSOMAL RNA ANALYSES 3.1. Earlier Classifications

3.1.1. The Phylum, Apicomplexa and the Class, Sporozoa The genus Plasmodium is contained within the phylum Apicomplexa (Levine et al., 1980) which is defined by the possession of all or part of a

THE RIBOSOMAL RNA GENES OF PLASMODlUM

59

characteristic set of structures that together form what is termed the apical complex. It is a wide-ranging phylum and debate continues about membership and even if the emphasis placed on the apical complex as the defining characteristic for intraphyletic relationships was appropriate (Gajadhar et al., 1991). On the basis of biological criteria and light microscopy, all parasitic protozoa lacking contractile vacuoles, locomotor organelles and which utilize sexual reproduction as well as asexual fission were included in the class Sporozoa. All members produce encysted sporozoites (Kudo, 1966). More recently, Barta (1989) selected a group of 26 “biologically valid” characters of this class to produce a tree which demonstrated among other features, that the heteroxenous (use of more than one host during the life cycle) life cycle has been independently evolved on more than one occasion within the phylum; that blood infectious parasites did not cluster together and the definitive host is also the ancestral host. In the case of Plasmodium this would mean that the anopheline mosquito was ancestral. As Gajadhar et al. (1991) point out such assessments are qualitative and without the safeguard of a more quantitative approach. 3.1.2. The Genus Plasmodium Inferring the phylogeny within a genus may be no more simple. Although one is dealing with a group of organisms that are closely related and share a large number of features of their biology and life cycle, one is still left with the problem of deciding which are the significant characteristics upon which to make a valid estimation of phylogeny. Garnham (1966) produced the most comprehensive review of the phylogeny of Plasmodium based on his own choice of morphological and biological considerations. The criteria selected by Garnham were: 1. The vertebrate host; 2. The size of the erythrocytic schizont; 3. The shape of the gametocyte; 4. The site and shape of the exoerythrocytic schizont; 5 . The number of merozoites produced by the exoerythrocytic schizont. The host was considered to be by far the most important of these criteria. These criteria enabled Garnham to erect nine subgenera - three mammalian, four avian and two saurian - emphasizing host importance. Primate and human malaria was distributed in two subgenera, Plasmodium plasmodium and Plasmodium laverania. The latter contains only two species recognizing the unique aspects of the biology and morphology of P. falciparum the malignant tertian disease of humans, and its chimpanzee equivalent P. reichenowi. The rest of mammalian malaria is contained in

60

ANDREW P. WATERS

Plasmodium vinckeia an artifice purely of convenience containing malaria species infective to rodents, lemurs and water buffalo. However, the construction of the P. vinckeia subgenus emphasizes the limitation of this type of classification. Without better datasets to compare the species it was not possible to generate anything other than groups of similar parasites with no means of looking at the relationships within and between these groups. This limitation was emphasized when McCutchan et al. (1984) studied the nucleotide composition of the genomic DNA of a number of malaria parasites, a property successfully used to compare bacteria. This study confirmed the distinctive nature of P. falciparum grouping it apart from other human and primate malarias and placing it in a group with avian and rodent malarias all of which had an AT-rich genome (> 80%). Killick-Kendrick (1978) also commented on the unusual distribution of rodent malaria, its restriction not only to a particular geographical region (the high altitude forests of East Africa), but also to such a small number of species of susceptible rodent (Gramnomys and Thamnomys, thicket rats), the closest vertebrate host sharing a susceptibility to malaria being brush-tailed porcupines. This led to his suggestion that rodent malarias were a “gift” rather than an “heirloom” suggesting an evolutionary history that had not followed strict lines of the natural law of co-evolution of host and parasite.

3.2. Molecular-based Estimations Woese and co-workers have pioneered the use of SSU rRNA sequences as a dataset for the comparative inference of phylogeny (Woese, 1987; Olsen and Woese, 1993). The SSU can be used in such studies because of the degree of conservation associated with the molecule. A constant structure/function relationship exists between all SSU sequences from any organism. This is especially true if one examines “core” sequence where the structure is even more highly conserved. The molecule provides a dataset of -1400 nucleotides which can be assigned to core and is sufficient for statistical analysis. A brief review of the stastistical methods which can be used has recently been published (Waters et a f . , 1993b; for more detail consult the references therein). The molecule is considered to be an excellent model for the inference of deep branches within phylogenetic trees. If the goal is the evaluation of a group of more closely related organisms then one has two choices one can use as much of the molecule that can be unambiguously aligned on a structural basis or choose a different molecule. As molecular data accumulate it will be possible to make composite trees based upon data from a number of molecular and biological sources. Such a wealth of data is not yet available, however

THE RIBOSOMAL RNA GENES OF PUSMODlUM

61

much complete SSU data is and this has been exploited to produce a series of phylogenetic analyses which address the phylogenetic groupings of the species within Plasmodium and to analyse the relative position of the genus within the Apicomplexa. 3.2.1. Apicomplexa and Sporozoa The most recent study based on SSU sequence regarding the relationships with Apicomplexa implied that Plasmodium has a common ancestry with dinoflagellates as represented by the free-living dinoflagellate, Crypthecodinium cohnii. These two classes form a separate grouping with ciliates distinct from other protists. The study also revealed that within Apicomplexa, Plasmodium was relatively diverged more distant than Theiferiaannufuta,a tick-borne piroplasmic parasite of cattle, or Sarcocystis murk, a coccidial parasite that transfers between cat and mouse, were to each other (Gajadhar et al., 1991). This was surprising given the similarities in biology of Theiferia and Plasmodium and accelerated rates of evolutionary change within Plasmodium was postulated as a possible explanation (Gajadhar et af., 1991). A further puzzle concerning the origins of Plasmodium was demonstrated by the phylogenetic analysis of the rRNA genes contained on the 35 kb circular DNA element described earlier. Most unusually when the analyses were performed using the LSU rRNA gene of P . fafcipurum (Gardner el al., 1993) the most similar sequences were found to be the 23s rRNAs of chloroplast origin implying that the source of the circle was photosynthetic and possibly pointing towards the overall origin of the genus. This was substantiated by an analysis and comparison of a second gene on the 35 kb circle, the rpoC gene (Howe, 1992). Interestingly, when the SSU gene of this element was subject to the same analysis it grouped with the mitochondria1 rRNA genes of fungi, ciliates and Chfamydomonas reinhardtii (Wilson et af.,1991) which may be more in agreement with the analyses of the nuclear encoded genes. The authors were concerned, however, about bias that may be due to AT richness within the genes. 3.2.2. Plasmodium The analyses based on the nuclear-encoded SSU rRNA genes had a different purpose and that was to answer questions about the relationships between the different Pfasmodium species. Published work utilizes analyses of the SSU A genes, i.e. those expressed in the asexual bloodstage forms found in the vertebrate host. There were two reasons for this: (1) to avoid the possibility that the results would be biased by using a mixture of genes expressed in different stages which may evolve at different rates; (2) the

62

ANDREW P. WATERS t--

-~ - ' 1% dislanca

rodent P. berghei

9

A

Tgx ,

P. malariae 65.6%

vlvax 'tertlan'

'avian'

P.

VlVaX

P. lophurae

A / , A 65.2% 65 2%

P. tragile tragle 62 2% 62.2%

P. gallinamurn

c

-

*'

A 64.4%

P. talcipamtn

C

Figure 4 Phylogeny of Plasmodium based upon SSU rRNA gene sequences. A phylogenetic tree is illustrated modified, with permission, from Waters et al. (1993a). Except where indicated the analysis is of A genes of the included species. The tree is crudely subdivided to indicate the statistically significant phylogenetic groupings inferred from previous analyses. The percentage figures indicate the AT content of the gene included in the analysis.

main interest in malaria is its effect upon its vertebrate host making the gene expressed in those hosts a more appropriate basis for the analysis. The results of the analyses have again been summarized in the same review (Waters et al., 1993b) and deal with the results of two reports (Waters et al., 1991, 1993a). An unrooted tree is given in Figure 4 and shows the inferred relationship between three human, two avian, three primate and one rodent species. In general the groupings favoured by Garnham (1966) proved to be accurate and confirm that the vertebrate host can be viewed as the single most important phylogenetic characteristic of malaria parasites. The most surprising finding of the studies was the confirmation and clarification of the earlier genome composition analysis (McCutchan et af.,

THE RIBOSOMAL RNA GENES

OF PLASMODIUM

63

1984) and of Garnham’s suspicions that the major human pathogen P. falciparum has a unique but distant relationship to other human and primate malarias. In fact, it is most closely and statistically significantly associated with avian malaria but not P. berghei rodent malaria, the other parasite with an AT-rich genome. The overall branching order and topology of the tree combined with the statistical analysis was not compatible with Farenholz’s rule of parasitehost co-evolution implying that a lateral transfer effectively between vertebrate hosts had to be invoked (Waters et al., 1991). The lateral transfer would involve birds and humans or some closely related primate from which the parasite was then transferred into man. A number of possible scenarios for the origins and natural history of P. falciparum have been suggested and summarized (Waters et al., 1993b). These include: 1 . The parasite has a long association with man but was originally a chronic and benign infection that has evolved towards virulence as the host population has increased; 2. Man’s agricultural activities created the conditions for the introduction of a novel pathogen into the population, with the virulence that is often (and sometimes mistakenly (Read and Schrag, 1991)) thought to signal a new host-pathogen combination; 3. The possible role of the chimpanzee as an intermediate host facilitating the introduction of malignant tertian malaria should not be overlooked; 4. Both avian parasites and P. falciparum are related to an as-yetundescribed parasite; 5. The humadprimate form of the ancestor passed from primates to birds and gave rise to the highly successful avian parasites. Clearly this list is not exhaustive and some of the above are not mutually exclusive. One of the interesting features of the latest survey is that it suggests distinct lines of descent for the three human malaria species included in the analysis. P . vivax clusters strongly with the monkey tertian malarias of Southeast Asia as well as with the only quotidian primate malaria, P. knowlesi. This points strongly to an Asian origin of vivax malaria as suggested by Coatney et al. (1971), subsequently distributing from there as man migrated (Bruce-Chwatt, 1965). Quartan malaria also has its own distinct lineage, clustering neither with the vivax-like parasites nor with the aviadfalciparum cluster. This would imply that quartan parasites have a deep lineage and that the separation of quartan from tertian is an ancient event in the history of primate malaria. The same is clearly not true of the quotidian primate malaria which is shown to be a relatively recent experiment within the vivax branch. Due to an uncertainty about the relative position of the rodent lineage and

64

ANDREW P. WATERS

P. malariae and the position of the root for the tree, the provenance of human quartan malaria may be completely distinct from that of tertian. If so, the generation of the lineage which resulted in modern P. malariae could have arisen before the rodent lineage. We have suggested that the subgenus Plasmodium plasmodium now be subdivided and that all quartan parasites within that genus be included in a new subgenus Plasmodium quartans to recognize the deep division in the tree (Waters et al., 1993b). Future analysis will demonstrate if all the quartan parasites truly have the same lineage. It is worth also commenting on the phenomenon of AT-rich genomes. Plasmodium parasites have some of the most AT-rich genomes reported. The distribution of the composition is not uniform, structural genes having a higher CG content although still below normal values. The AT content of the SSU genes is similarly lower than the overall A T content of the genome for each species, although it has been noted that for other species (e.g. Drosophila melanogaster) there can be a different bias in base composition that is gene dependent (Hancock et al., 1988). The interesting feature of the AT content of the various SSU genes represented in the tree is that there is not a gradient of AT content across the tree. Thus, whatever the influence that overall genome composition has on the composition of the individual SSU genes it seems to have little influence on the topology of the tree. In this light it will be very interesting to see a similar comparison of the SSU genes of the 35 kb circles where the suspicion is that A T content of the genes compared influenced the analysis (Wilson et al., 1991). 3.3. Evolution of the rDNA Units Within the Genome

How are the forces of divergence, concerted evolution and selection reflected in the status of the nuclear rDNA units in Plasmodium? P. berghei has four nuclear rDNA units organized into two classes C and A and although the two classes are homogeneous they are still maintained as distinct forms in the genome. The level of sequence identity between the two A-type units extends outside the structural regions of the unit (the 18S, 5.8s and 28s) at least into the 5 ’ ETS and ITS1. The same is true for the C-type units yet there is very little sequence similarity between the C and A ETS regions. All four units exist on separate chromosomes. There must be a mechanism(s) which facilitates the active tandem evolution of both unit pairs. Is there any significance in the position of stage-specific genes from the same species on a phylogenetic tree which might reflect these forces and mechanisms? The placement of the C gene units from P. berghei, P. gallinaceum and P. falciparum illustrates the situation. In

THE RIBOSOMAL RNA GENES OF PLASMODIUM

65

each case the stage-specific genes group with the second type from the same species (Figure 4, A.P. Waters, D. Higgins and T. McCutchan, unpublished). This implies that overall homogenization of the rDNA unit complement within a species occurs at the same time and to a greater extent than the maintenance of stage-specific regions. Thus in P. berghei, the four rDNA units homogenize with sufficient frequency to maintain the species-specific component as the most significant characteristic of all units. Therefore, the sequence of a Plasmodium SSU gene is characteristic first of a member of Plasmodium, second of the species and finally of the stagespecific unit. Homogenization therefore acts at two levels, species and stage specifically; the former involves regions within the SSU unit whereas the latter demonstrably affects each of the ETS, SSU and ITS1. These arguments are made on the basis of the knowledge about the SSU region and the flanking ETS and ITS1 and will be clarified as the remainder of the units from multiple species are characterized. It can also be seen from the phylogenetic tree (Figure 4) that the C units have the longest branch lengths compared with the equivalent A gene from the same species. This might imply that there is a different rate of evolution in the stage-specific pairs effected either by accelerated accumulation of mutations or reduced correction. A mechanism for the latter can be envisaged since the process of homogenization of two loci necessitates mutual hybridization and, effectively, exchange of sequence content. The rDNA units are maintained on separate chromosomes and the rate of effective accumulation of mutation (drift) can essentially be viewed as a function of the frequency with which homogenization can occur relying on the three-dimensional distribution of the rDNA units in the nucleus. Thus the prediction would be that the C units are so disposed that homogenization is less frequent than between A units. Thus the organization of the rDNA units within Plasmodium provides a fascinating insight into the organization, evolution and maintenance of the genome of malaria parasites.

4. SPECIES IDENTIFICATION BASED ON RIBOSOMAL RNA 4.1. The Principle of Direct Detection of rRNA

Classical detection of microorganisms for medical diagnosis has relied upon culture of those organisms on defining media. This is a labourintensive and time-consuming process requiring highly skilled personnel and a sophisticated laboratory setting. More recent technologies have sought to simplify the process using, initially, antibody-based techniques and lately nucleic acid-based techniques. The most well-known application

66

ANDREW P. WATERS

is based on the polymerase chain reaction (PCR) technology, however, it is also possible to base detection systems on the direct detection of rRNA and its genes. PCR uses thermostable DNA polymerases to amplify a DNA target almost limitlessly. By judicious choice of the target DNA (defined by the oligonucleotides which determine both ends of the amplified target) the appearance of a specific amplified DNA band can be diagnostic. The potential of the PCR technology is huge and ingenious applications are revolutionizing molecular biology, medical science, forensic science and many other fields. The rRNA-based alternative for the simple detection of a microorganism is also polymerase amplified but in this case the amplification is the natural amplification of transcription carried out by the RNA polymerase I responsible for rRNA synthesis within the cell. In Plasmodium it has been estimated that in a schizont there are lo6 ribosomes and therefore the same number of 18 and 28s molecules.

Figure 5 Secondary structure of a small ribosomal subunit of Plasmodium berghei. The secondary structure of the A type SSU ribosomal RNA of P . berghei is reproduced from Waters and McCutchan (1990) with permission. This structure is generally highly conserved for all SSU rRNA molecules. Shaded areas depict the expansion regions which serve as the source of diagnostic oligonucleotides.

THE RIBOSOMAL RNA GENES OF PLASMODIUM

67

Therefore if specificity and sensitivity of detection of these targets can be achieved the rRNA of any organism can serve as a diagnostic target. Detection is achieved through the hybridization of the target RNA to a diagnostic antisense oligonucleotide which is modified to facilitate detection of hybridization. At present, the target RNA is immobilized and the hybridization is driven by the presence of excess oligonucleotide. The presence of species-specific regions within the SSU has already been mentioned in the previous section. Figure 5 demonstrates the regional organization of the molecule; the shaded areas represent the expansion regions which contain genus, species and, in Plasmodium, stage-specific information. Alignments of the SSU sequence will provide the information for the design of oligonucleotides which will hybridize specifically to the SSU of a single species thereby permitting the specific detection and identification of that species. The principle of the method for the specific detection of malaria was initially shown for the human malarias (Waters and McCutchan, 1989). The characterization of a single species-specific region of the SSU rRNA molecule provided sufficient information to allow the synthesis and use of oligonucleotides to discriminate unambiguously between nucleic acid preparations from each species. The sensitivity was also shown to be potentially sufficiently sensitive for use in field applications (20 parasites detectable) and relatively simple methods of preparation of the samples were applicable to the whole process (La1 et al., 1989; Waters and McCutchan, 1989). For the simple discrimination between parasite and host about 65% of the parasite SSU sequence is available as a target for detection so the simultaneous use of multiple oligonucleotides is possible (Waters and McCutchan, 1990). Characterization of the sequence of the LSU molecules will simply expand the database for the construction of diagnostic oligonucleotides. Figure 6 illustrates the potential of the methodology to discriminate between the human malaria species. The limitations of the current methodology relate to its application to the field situation. Methodologies need to be developed and refined such that the principle of the process can be carried out in rudimentary field laboratories with a mimim of equipment and training. Ideally the process should be adapted to dipstick technologies, however cost considerations may prove limiting. Why is there a perceived requirement for molecular diagnostic technologies in tropical disease and malaria in particular? Current methodologies in use are based on the identification of the parasite itself. The, by now, almost traditional method is the microscopic observation of the parasite on Giemsa-stained blood smears. The process is cheap, sensitive and the different human malarias can be discriminated on the basis of appearance. The major disadvantage lies in the fact that it is a labour-intensive method. Highly trained personnel spend 5-10 minutes

68

ANDREW P. WATERS

Figure 6 Demonstration of the specificity of ribosomal RNA-based detection of human Plasmodium species. Radiolabelled oligonucleotide probes specific for the SSU rRNA gene of each of the human malarias indicated were hybridized to strips of nitrocellulose to which parasite RNA had been immobilized. Specific detection of each species was possible. (From Waters and McCutchan (1990), with permission.)

examining each slide. In endemic areas the burden on the microscopists is simply too great and that individual soon ceases to be reliable. Therefore, a method that offers simple, sensitive, rapid and unambiguous detection and identification that requires little or no judgemental input from the user is very attractive. An alternative holistic method is the quantitative buffy coat (QBC@)process where parasites are detected through nuclear uptake of a fluorescent dye and discriminated from other nucleated cells on the basis of their unique sedimentation properties during centrifugation (Spielman et al., 1988). The method is easy, fast and sensitive and, with a small amount of training, the user can distinguish P. fulciparum and P . vivax and it may be used in the assessment of drug resistance in the field (Garin et al., 1992). However, it is not cheap and requires a centrifuge. Models are being developed which can be powered by car batteries.

THE RIBOSOMAL RNA GENES OF PLASMODlUM

69

4.2. Ribosomal RNA Gene-Based PCR

As stated above the oligonucleotides which are input into a PCR define the amplified DNA fragment. Thus knowledge of the sequence of the target DNA is essential in order to design appropriate oligonucleotides. For the detection of human malaria parasites by PCR the SSU gene sequences are the only dataset for all four parasites from which oligonucleotides could be designed such that the equivalent target molecule in each species is amplified. Furthermore due to the configuration of the SSU molecule, as described above, a number of options are available in the design of PCR experiments. It is possible of course to use unique pairs of primers for each species, however it is also possible to use a single common primer, the species specificity being supplied by the second oligonucleotide. In such experiments single tube detection of a mixture of human parasites can be achieved with just five primers, the single common primer and four species specific. With four possible products a method for discrimination must also exist, with careful choice of oligonucleotides this could be on the basis of size. Another possibility is to label each species specific primer with a different fluorescent tag which would then allow specific detection of the polymer. The potential that the SSU genes offer for the design of diagnostic PCR has been exploited by Snounou et al. (1993) who show that specific-sized DNA fragments can be amplified in a species-specific manner from field samples and that mixed infections can be identified. The value of PCR for mass field diagnosis has been questioned on the basis that it is too technical and too easy to contaminate the working environment such that completely erroneous results may be obtained (Waters and McCutchan, 1990). However, for epidemiological surveys where the samples are handled in a carefully controlled laboratory environment PCR should prove a valuable approach. Some misgivings may still apply. The enormous sensitivity of the technique means that detection of a single parasite is feasable. In endemic areas it has been suspected that individuals may well have a constant low-grade parasitaemia which, although not normally detectable upon microscopic examination of blood smears, would routinely show positive in PCR analysis. If true, then PCR is unlikely to give an indication of the dynamics of an epidemic. Competitive PCR can give accurate quantitation, but this is not feasible for epidemiological surveys. PCR may well prove to be very useful for the diagnosis of malaria infections in tourists. These are by and large naive subjects unlikely to be harbouring low-grade parasitaemias and the diagnosis would be carried out in a well-equipped laboratory by personnel well trained in various applications of the PCR process.

70

ANDREW P. WATERS

4.3. Drug Testing and rRNA Diagnosis

One novel approach which combines an assay for the efficacy of novel drug compounds and rRNA of Plasmodium lies in a screen for drugs which affect the liver stages of the parasite. As discussed in an earlier section the switch from C to A rRNA unit expression occurs within 8 hours of the sporozoite invading the liver. This then provides a means to assess the development of the exoerythrocytic stages and the ability of drugs to prevent either the switch or the subsequent development and amplification of the A gene signal. This method has been explored recently in the P. berghei in vitro culture system in the HepG2 human hepatoma cell line (Li et al., 1991). The recent development of the in vitro culture system for the mosquito stages of Plasmodium will allow similar assays to be developed for this part of the life cycle (Warburg and Miller, 1992).

5. PERSPECTIVE

The study of rRNA genes in Plasmodium has provided valuable information about the molecular biology, biology and evolutionary history of members of the genus. These members have evolved an apparently unique response to the problem of a heteroxenous life style in mosquitoes and vertebrate hosts and that is the switching ribosome. Two different types of rRNA gene containing unit-specific sequence elements are expressed in a stage-specific manner. Is this organization and expression of any biological significance? We can only answer probably; the regionalized organization of the stage-specific elements within the structural units of the two types of rDNA unit can be viewed in two ways: 1. The regions where the observed sequence differences accumulate are the only portions of the molecule where such changes can be tolerated without any deleterious effects on the functionality of the molecule. 2. There is a functional consequence to the accumulation of the stagespecific differences which allows the stage-specific ribosome to operate with maximum efficiency in its particular environment. There is no direct biological evidence which supports the strict requirement for the two types of ribosomes, however, indirect arguments can be used to address the question. The core sequence that is absolutely conserved in structure is restricted to about 1200 nt of the 2100 nt of the Plasmodium SSU unit. A further 600 nt form genus-specific sequence elements and structures, the remainder form either species-specific elements or stage specific. There is no consensus structure or sequence element for either C

THE RIBOSOMAL RNA GENES OF PLASMODUM

71

or A genes that can be found in all species (Enea and Corredor, 1991; A.P. Waters, D. Higgins and T. McCutchan, unpublished), although the relative position of the stage-specific domains within the molecule is conserved within the genus. Despite the lack of consensus, the sequence distinctions between the two classes are maintained in the genome which implies either an inability to homogenize the sequences or a biological requirement. Furthermore, according to the phylogenetic analysis, the multicopy C- and A-type genes evolve at different rates demonstrating the existence of mechanisms which discriminate between the rDNA units in the extent and possibly frequency of homogenization. The most important piece of evidence regarding the requirement for the maintenance of the different forms of the rRNA remains the fact that they are expressed in a stage-specific manner. Thus the parasite has in place mechanisms which allow for the more or less complete replacement of the ribosome population and performs this replacement at points in the life cycle where it parasitizes a new host or vector. This is a complex process requiring events some of which will be described in more detail below but a less than comprehensive list would include: maintenance of different units in the genome; their differential transcription; processing, transport and assembly into the ribosomes. Furthermore, during the replacement process, the existing ribosome population must be dissembled and removed. Only when stable transfection of Plasmodium becomes available will it become possible to address directly the question of the essential nature of the switching ribosomes. Has the switching ribosome evolved on more than one occasion? Developmentally distinct ribosomes have been described in Dictyostelium discoideum where the ribosomal protein content varies in a stage-specific manner on a constant rRNA component (Ramagopal, 1992). Clustered heterogeneity in SSU rRNA genes of a single species have also been reported for the halophilic Archebacterium Haloarcula marismortui which has two rRNA operons (Mylvaganam and Dennis, 1992). The sequence heterogeneity forms identical predicted secondary structures with compensatory base changes. The two genes are co-transcribed and equally represented. There is no evidence for differential expression of the two operons. Thus so far the stage-specific expression of heterogenous rRNA genes is unique to Plasmodium, to date there are no reports of this phenomenon in other heteroxenous organisms. Barta (1989) has suggested that the heteroxenous nature of apicomplexan life cycles has evolved independently, which would imply that the spectrum of adaptations would be species specific and not necessarily include stage-specific ribosomes. Clearly the study of rRNA genes has given insight into the biology of Plasmodium and continues to have much to offer and many challenges for the future.

72

ANDREW P. WATERS

ACKNOWLEDGEMENTS

The author would like to acknowledge his colleagues in the Department of Parasitology of Rijksuniversiteit te Leiden, The Netherlands, especially Chris Janse for dicussions and critical review of the manuscript. I would also like to acknowledge Tom McCutchan who established the investigation of ribosomal RNA in Plasmodium and is at the heart of the discovery of the unique features of the system and with whom I was fortunate enough to train. REFERENCES Aldritt, S.M., Joseph, J.T. and Wirth, D.F. (1989). Sequence identification of cytochrome b in Plasmodium gallinaceum. Molecular and Cellular Biology 9 , 3614-3620. Atkins, J.F., Weiss, R.B. and Gesteland, R.F. (1990). Ribosome gymnastics degree of difficulty 9.5, style 10.0. Cell 62, 413-423. Barta, J.R. (1989). Phylogenetic analysis of the class Sporozoea (phylum Apicomplexa, 1970): evidence for the independent evolution of heteroxenous life cycles. Journal of Parasitology 7 5 , 195-206. Bell, S.P., Pikaard, C.S., Reeder, R.H. and Tijan, R. (1989). Molecular mechanisms governing species-specific transcription of ribosomal RNA. Cell 59, 489497. Bell, S.P., Jantzen, H.-M. and Tijan, R. (1990). Assembly of alternative multiprotein complexes directs rRNA promoter selectivity. Genes and Development 4, 943-954. Brow, D.A. and Geidushek, E.P. (1987). Modulation of yeast 5s RNA synthesis in vitro by ribosomal protein YL3. Journal of Biological Chemistry 262, 13953-13958. Bruce-Chwatt, L.J. (1965). Paleogenesis and paleoepidemiology of primate malaria. Bulletin of the World Health Organisation 32, 363-387. Buratowski, S. and Zhou, H. (1992). Transcription factor IID mutants defective for interaction with transcription factor IIA. Science 255, 1130-1132. Ciliberto, G., Raugei, G., Costanzo, F., Dente, L. and Cortese, R. (1983). Common and interchangeable elements in the promotors of genes transcribed by RNA polymerase 111. Cell 32, 725-733. Clark, C.G., Tague, B.W., Ware, V.C. and Gerbi, S.A. (1984). Xenopus laevis 28s ribosomal RNA: a secondary structure model and its evolutionary and functional implications. Nucleic Acids Research 12, 6197-6220. Coatney, G.R., Collins, W.E., Warren, McW. and Contacos, P.G. (1971). “The Primate Malarias”. US Dept of Health, Bethesda, USA. Comai, L., Tanese, N. and Tijan, R. (1992). The TATA-binding protein and associated factors are integral parts of the RNA polymerase I transcription factor, SLI. Cell 68, 965-976. Conconi, A., Widmer, R.M., Koller, T. and Sogo, J.M. (1989). Two different chromatin structures coexist in ribosomal RNA throughout the cell cycle. Cell 57, 753-761.

THE RIBOSOMAL RNA GENES OF PLASMODlUM

73

Cormack, B.P. and Struhl, K. (1992). The TATA-binding protein is required for transcription by all three nuclear RNA polymerases in yeast cells. Cell 69, 685496. Dahlberg, A.E. (1989). The functional role of ribosomal RNA in protein synthesis. Cell 57,525-529. Dame, J.B. and McCutchan, T.F. (1983a). The four ribosomal DNA units of the malaria parasite Plasmodium berghei. Journal of Biological Chemistry 258, 69846990. Dame, J.B. and McCutchan, T.F. (1983b). Cloning and characterisation of a ribosomal RNA gene from Plasmodium berghei. Molecular and Biochemical Parasitology 8,263-279. Dame, J.B. and McCutchan, T.F. (1984). Identification of the 5s and 5.8s ribosomal RNA molecules and their genes in Plasmodium berghei. Molecular and Biochemical Parasitology 11, 301-307. De Stasio, E.A., Goringer, H.U., Tapprich, W.E. and Dahlberg, A.E. (1988). Probing ribosome function through mutagenesis of ribosomal RNA. I n “Genetics of Translation” (M.F. Tuite, M. Picard and M. Bolotin-Fukuhara Eds), pp. 1741. NATO AS1 Series H14B. De Winter, R.F.J. and Moss, T. (1986). The ribosomal spacer in Xenopus laevis is transcribed as part of the primary ribosomal RNA. Nucleic Acids Research 14, 60414051. Divo, A.A., Geary, T.G. and Jensen, J.B. (1985). Oxygen- and time-dependent effects of antibiotics and selected mitochondria1 inhibitors on Plasmodium falciparum in culture. Antimicrobial Agents and Chemotherapy 27, 21-27. Dover, G.A. (1982). Molecular drive a cohesive mode of species evolution. Nature 299, 111-117. Edlind, T.D. (1989). The sensitivity of Giardia lamblia to aminoglycoside antibiotics: correlation with rRNA sequence. Antimicrobial Agents and Chemotherapy 33,484-488. Elion, E.A. and Warner, J.R. (1984). The major promoter element of rRNA transcription in yeast lies 2 kb upstream. Cell 39,663-673. Elion, E.A. and Warner, J.R. (1986). An RNA polymerase I enhancer in Saccharomyces cerevisiae. Molecular and Cellular Biology 6,2089-2097. Enea, V. and Corredor, V. (1991). The evolution of plasmodia1 stage-specific rRNA genes is dominated by gene conversion. Journal of Molecular Evolution 32, 183-186. Feagin, J.E., Werner, E., Gardner, M.J., Williamson, D.H. and Wilson, R.J.M. (1992). Homologies between the contiguous and fragmented rRNAs of the two Plasmodium falciparum extrachromosomal DNAs are limited to core sequences. Nucleic Acids Research 20, 879-887. Flavell, R.B. (1986). Structure and control of expression of ribosomal RNA genes. Oxford Survey of Plant Molecular and Cellular Biology 3,252-274. Francoeur, A.M., Gritzmacher, C.A., Peebles, C.L., Reese, R.T. and Tan, E.L. (1985). Synthesis of small nuclear ribonucleoprotein particles in the malarial parasite, Plasmodium falciparum. Proceedings of the National Academy of Science USA 82, 3635-3639. Gajadhar, A.A., Marquardt, W.C., Hall, R., Gunderson, J., Ariztia-Carmona, E.V. and Sogin, M.L. (1991). Ribosomal RNA sequences of Sarcocystis muris, Theileria annulata and Crypthecoidinium cohnii reveal evolutionary relationships among apicomplexans, dinoflagellates and ciliates. Molecular and Biochemical Parasitology 45, 147-154.

74

ANDREW P. WATERS

Gardner, M.J ., Feagin, J.E., Moore, D .J ., Spencer, D.F., Gray, M. W., Williamson, D.E. and Wilson, R.J.M. (1991). Organisation and expression of small subunit ribosomal RNA genes encoded by a 35 kilobase circular DNA in Plasmodium falciparum. Molecular and Biochemical Parasitology 48, 77-88. Gardner, M.J., Feagin, J.E., Moore, D.J., Rangachari, K.,Williamson, D.H. and Wilson, R.J.M. (1993). Sequence and organisation of large subunit rRNA genes from the extrachromosomal 35 kb circular DNA of the malaria parasite Plasmodium falciparum. Nucleic Acids Research 21, 1067-1071. Garin, B., Salun, J.J., Peyron, F., Vigier, J.P., Busangu, I. and Perrone, J. (1992). Rapid in vivo detection of chloroquine resistance by the Quantitative Buffy Coat Malaria Diagnosis System. American Journal of Tropical Medicine Hygiene 47, 446-449. Garnham, P.C.C. (1966). “Malaria and other Haemosporidiae”. Blackwell, Oxford. Garrett, R.A., Douthwaite, S. and Noller, H.F. (1981). Structure and role of 5 s RNA-protein complexes in protein biosynthesis. Trends in Biochemical Science 5, 137-139. Geary, T.G. and Jensen, J.B. (1983). Effects of antibiotics on Plasmodium falciparum in vitro. American Journal of Tropical Medicine and Hygiene 32, 221-225. Geary, T.G., Divo, A.A. and Jensen, J.B. (1988). Uptake of antibiotics by Plasmodium falciparum in culture. American Journal of Tropical Medicine and Hygiene 38, 466-369. Geary, T.G., Divo, A.A. and Jensen, J.B. (1989). Stage specific actions of antimalarial drugs on Plasmodium falciparum in culture. American Journal of Tropical Medicine and Hygiene 40, 240-244. Geidushek, E.P. and Tocchini-Valentini, G.P. (1988). Transcription by RNA polymerase 111. Annual Review of Biochemistry 57, 873-914. Girard, J.P., Lehtonen, H., Caizergues-Ferrer, M., Amalric, F., Tollervey, D. and Lapeyre, B. (1992). GAR1 is an essential small nucleolar RNP protein required for pre-RNA processing in yeast. EMBO Journal 11, 673-682. Goman, M., Mons, B. and Scaife, J. (1991). The complete sequence of a Plasmodium malariae SSUrRNA gene and its comparison to other plasmodia1 SSUrRNA genes. Molecular and Biochemical Parasitology 45, 281-288. Goonewaradene, R., Daily, J., Kaslow, D., Sullivan, T.J., Duffy, P., Carter, R., Mendis, K. and Wirth, D. (1993). Transfection of the malaria parasite and expression of firefly luciferase. Proceedings of the National Academy of Science USA 90,5234-5236. Greenblatt, J. (1991). Roles of TFIID in transcriptional initiation by RNA polymerase 11, Cell 66, 1067-1070. Gudenus, R., Mariotte, S., Moenne, A., Ruet, A., Memet, S., Buhler, S.-M., Sentenac, A. and Thuriaux, P. (1988). Conditional mutants of RPC160, the gene encoding the largest subunit of RNA polymerase C. Genetics 119, 517-526. Gunderson, J.H., McCutchan, T.F. and Sogin, M.L. (1986). Sequence of the small subunit ribosomal RNA gene expressed in the bloodstream stages of Plasmodium berghei: evolutionary implications. Journal of Protozoology 33, 535-529. Gunderson, J.H., Sogin, M.L., Wollett, G., Hotlingdale, M., de la Cruz, V.F., Waters, A.P. and McCutchan, T.F. (1987). Structurally distinct ribosomes occur in Plasmodium. Science 238, 933-937. Gutell, R.R. and Fox, G.E. (1988). A compilation of large subunit RNA sequences presented in a structural format. Nucleic Acids Research 16, r175-r269.

THE RIBOSOMAL RNA GENES

OF PLASMODIUM

75

Hancock, J.M., Tautz, D. and Dover, G.A. (1988). Evolution of the secondary structures and compensatory mutations of the ribosomal RNAs of Drosophila melanogaster. Molecular Biology and Evolution 5, 393-414. Howe, C.J. (1992). Plastid origin of an extrachromosomal DNA molecule from Plasmodium, the causative agent of malaria. Journal of Theoretical Biology 158, 199-205. Hughes, J.M.X. and Ares, M., Jr (1991). Depletion of U3 small nucleolar RNA inhibits cleavage in the 5‘ external transcribed spacer of yeast pre-ribosomal RNA and impairs formation of 18s ribosomal RNA. EMBO Journal 10, 42314239. Hughes, J.M.X., Konings, D.A.M. and Cesarini, G. (1987). The yeast homologue of U3 snRNA EMBO Journal 6, 2145-2155. Jacq, B. (1981). Sequence homologies between the 5.8s rRNA and the 5‘ end of prokaryotic 23s rRNA: evidence for a common evolutionary origin. Nucleic Acids Research 9, 2913-2929. Janse, C.J., Ramesar, J. and Mons, B. (1992). Chromosome translocation in Plasmodium berghei. Nucleic Acids Research 20, 581-586. Johnson, S.P. and Warner, J.R. (1989). Unusual enhancer function of transcription of ribosomal RNA in Saccharomyces cerevisiae. Molecular and Cellular Biology 9, 498U993. Kempers-Veenstra, A.E., Musters, W., Dekker, A.F., Klootwijk, J. and Planta, R.J. (1985). Deletion mapping of the yeast RNA pol I promoter. Current Genetics 10, 253-260. Kempers-Veenstra, A.E., Oliemans, J., Offenberg, H., Dekker, A.F., Piper, P.W., Planta, R.J. and Klootwijk, J. (1986). 3’ end formation of transcripts from the yeast rRNA operon. EMBO Journal 5, 2703-2710. Killick-Kendrick, R. (1978). Taxonomy, zoogeography and evolution. In “Rodent Malaria” (R. Killick-Kendrick and W. Peters, Eds), pp. 1-52. Academic Press, London. Klootwijk, J. and Planta, R.J. (1989). Isolation and characterisation of yeast ribosomal precursors and pre-ribosomes. Methods in Enzymology 180, 96-109. Krugliak, M., Waldman, Z. and Ginsburg, H. (1987). Gentamicin and amikacin repress the growth of Plasmodium falciparum in culture, probably by inhibiting a parasite acid phospholipase. Life Sciences 40,125S1257. Kudo, R.R. (1966) “Protozoology”. C.C. Thomas, Springfield, IL, USA. Labhart, P. and Reeder, R.H. (1986). Characterisation of three sites of RNA 3‘ end formation in the Xenopus ribosomal gene spacer. Cell 45, 431-443. Lake, J.E. (1985). Evolving ribosome structure: domains in archebacteria, eubacteria, eocytes and eukaryotes. Annual Review of Biochemistry 54, 507-530. Lal, A.A., Changkasiri, S., Hollingdale, M.R. and McCutchan, T.F. (1989). Ribosomal RNA-based diagnosis of Plasmodium falciparum malaria. Molecular and Biochemical Parasitology 36, 67-72. Langsley, G., Hyde, J.E., Goman, M. and Scaife, J.G. (1983). Cloning and characterisation of the rRNA genes from the human malaria parasite Plasmodium falciparum. Nucleic Acids Research 11, 870S8717. Learned, R.M., Cordes, S. and Tijan, R. (1985). Purification and characterisation of a transcription factor that confers promoter specificity to a human RNA polymerase I. Molecular and Cellular Biology 5, 1358-1369. Learned, R.M., Learned, T.K., Haltiner, M.M. and Tijan, R. (1986). Humans rRNA transcription is modulated by the coordinate binding of two factors to an upstream control element. Cell 45, 847-857.

76

ANDREW P. WATERS

Levine, N.D., Corliss, J.O., Cox, F.E.G., Deroux, G., Grain, J., Honigberg, B.M., Leedale, G.F., Loeblich, A.R., 111, Lom, J., Lynn, D., Merinfeld, E.G., Page, F.C., Poljansky, G., Sprague, V., Vavra, J. and Wallace, F.G. (1980). A newly revised classification of the Protozoa. Journal of Protozoology 27, 37-58. Li, H.V., Zagorski, J. and Fournier, M.L. (1990). Depletion of U14 small nuclear RNA (sn128) disrupts production of 18s rRNA in Saccharomyces cerevisiae. Molecular and Cellular Biology 10, 1145-1152. Li, J., Zhu, J.D., Appiah, A., McCutchan, T.F., Long, G.W., Milhous, W.K. and Hollingdale, M.R. (1991). Plasmodium berghei: quantitation of in vitro effects of antimalarial drugs on exoerythrocytic development by a ribosomal RNA probe. Experimental Parasitology 72, 450-458. McAndrew, M.B., Read, M., Sims, P.F.G. and Hyde, J.E. (1993). Characterisation of the gene encoding an unusually divergent TATA-binding protein (TBP) from the extremely A T rich human malaria parasite Plasmodium falciparum. Gene 124, 165-171. McCutchan, T.F., de la Cruz, V.F., Lal, A.A., Gunderson, J.H., Elwood, H.L. and Sogin, M.L. (1988). Primary sequences of two small subunit ribosomal RNA genes from Plasmodium falciparum. Molecular and Biochemical Parasitology 28, 63-68. McCutchan, T.F., Dame, J.B., Miller, L.H. and Barnwell, J.W. (1984). Evolutionary relatedness of Plasmodium species as determined by the structure of DNA. Science 225, 808-811. Mattaj, I.W., Tollervey, D. and Seraphin, B. (1993). Small nuclear RNAs in messenger RNA and ribosomal RNA processing. FASEB Journal 7, 47-53. Mestel, R., Yip, M., Holland, J.P., Wang, E., Kang, J. and Holland, M.J. (1989). Sequences within the spacer region of yeast rRNA cistrons that stimulate 35s rRNA synthesis in vivo mediate RNA polymerase I-dependent promoter and terminator activities. Molecular and Cellular Biology 9, 1243-1254. Miller, F.W. and Ilan, J. (1978). The ribosomes of Plasmodium berghei: isolation and ribosomal ribonucleic acid analysis. Parasitology 77, 345-365. Miller, F.W. and Ilan, J. (1984). Evidence for major differences in ribosomal subunit proteins from Plasmodium berghei and rat liver. Molecular and Biochemical Parasitology 12, 249-260. Miller, K.G. and Sollner-Webb, B. (1981). Transcription of mouse rRNA genes by RNA polymerase I: in vitro and in vivo initiation and processing sites. Cell 27, 165-174. Montandon, P.E., Wagner, R. and Stutz, E. (1986). E. coli ribosomes with a C912 to U base change in the 16s rRNA are streptomycin resistant. EMBO Journal 5, 3705-3708. Morrissey, J.P. and Tollervey, D. (1993). Yeast snR30 is a small nucleolar RNA required for 18s rRNA synthesis. Molecular and Cellular Biology 13, 2469-2477. Morrow, B.E., Johnson, S.P.and Warner, J.R. (1989). Proteins that bind to the yeast rDNA enhancer. Journal of Biological Chemistry 264, 9061-9068. Morrow, B.E., Johnson, S.P. and Warner, J.R. (1993). The rRNA enhancer regulates rRNA transcription in Saccharomyces cerevisiae. Molecular and Cellular Biology 13, 1283-1289. Morrow, B.E., Ju, Q. and Warner, J.R. (1990). Purification and characterisation of the yeast rDNA binding protein REB1. Journal of Biological Chemistry 265, 20778-20783.

+

THE ,RIBOSOMAL

RNA GENES OF PLASMODIUM

77

Miiller, B. and Eckert, W.A. (1989). Characterisation of pre-rRNA components in ribosomal precursor particles from macronuclei of Tetrahymena thermophila. European Journal of Cell Biology 49, 225-235. Musters, W., Knol, J., Maas, P., Dekker, A.F., van Heerikhuizen, H. and Planta, R.J. (1989). Linker scanning of the yeast RNA polymerase I promoter. Nucleic Acids Research 17, 9661-9678. Mylvaganam, S. and Dennis, P.P. (1992). Sequence heterogeneity between the two genes encoding 16s rRNA from the halophilic archebacterium Haloarcula marismortui. Genetics 130, 399410. Olsen, G.J. and Woese, C.R. (1993). Ribosomal RNA; a key to phylogeny FASEB Journal 7, 113-123. Paton, M.G., Barker, G.C., Matsuoka, H., Ramesar, J., Janse, C.J., Waters, A.P. and Sinden, R.E. (1993). Structure and expression of a conserved and posttranscriptionally regulated gene encoding a surface protein of the sexual stages of the malaria parasite Plasmodium berghei. Molecular and Biochemical Parasitology 59, 263-275. Pun, S.K. and Dutta, G.P. (1982). Antibiotics in the chemotherapy of malaria. Progress in Drug Research 26, 167-205. Ramagopal, S. (1992). The Dictyostelium ribosome: biochemistry, molecular biology and developmental regulation. Biochemistry and Cellular Biology 70, 738-750. Read, A.F. and Schrag, S.J. (1991). The evolution of virulence: experimental evidence. Parasitology Today 7, 296297. Reeder, R.H. (1989). Regulatory elements of the generic ribosomal gene. Current Opinions in Cellular Biology 1, 4-74. Reinberg, D. and Roeder, R.G. (1987). Factors involved in specific transcription by mammalian RNA polymerase 11. Journal of Biological Chemistry 262, 3310-3321. Rudenko, G. and van der Ploeg, L.H.T. (1989). Transcription of telomere repeats in protozoa. EMBO Journal 8, 2633-2638. Schimmang, T., Toliervey, D., Kern, H., Frank, R. and Hurt, E.C. (1989). A yeast nucleolar protein related to mammalian fibrillarin is associated with small nucleolar RNA and is essential for viability. EMBO Journal 8, 4015-4024. Schultz, M.C., Choe, S.Y. and Reeder, R.H. (1993). In vitro definition of the yeast RNA polymerase I enhancer. Molecular and Cellular Biology 13, 2644-2654. Schultz, M.C., Reeder, R.H. and Hahn, S . (1992). Variants of the TATA-binding protein can distinguish subsets of RNA polymerase I, I1 and I11 promoters. Cell 69, 697-702. Sherman, I.W. and Jones, L.A. (1976). Protein synthesis by a cell-free preparation from the bird malaria Plasmodium lophurae. Journal of Protozoology 23,277-281, Sherman, I.W. and Jones, L.A. (1977). The Plasmodium lophurae (avian malaria) ribosome. Journal of Protozoology 24, 331-334. Sherman, I.W., Cox, R.A., Higginson, B., McLaren, D.J. and Williamson, J. (1975). The ribosomes of the simian malaria, Plasmodium knowlesi. 1. Isolation and characterisation. Journal of Protozoology 22, 568-572. Shippen-Lentz, D. and Vezza, A.C. (1988). The three 5s rRNA genes from the human malaria parasite Plasmodium falciparum are linked. Molecular and Biochemical Parasitology 27, 263-274. Shippen-Lentz, D., Ray, R., Scaife, J.G., Langsley, G. and Vezza, A.C. (1987). Characterisation and complete nucleotide sequence of a 5.8s ribosomal RNA gene from Plasmodiumfalcipanun. Molecular and Biochemical Parasitology 22,223-231.

78

ANDREW P. WATERS

Shippen-Lentz, D., Afroze, T. and Vezza, A.C. (1990). Heterogeneity and expression of the Plasmodium falciparum 5.8s ribosomal RNA genes. Molecular and Biochemical Parasitology 38, 113-120. Sinden, R.E. (1978). Cell biology. In “Rodent Malaria” (R. Killick-Kendrick and W. Peters, Eds), pp. 85-168. Academic Press, London. Sinden, R.E. (1982). Gametocytogenesis of Plasmodium fakiparum in vitro: an electron microscopic study. Parasitology 84, 1-1 1 . Snounou, G., Viriyakosol, S., Jarra, W., Thaithong, S. and Brown, K.N. (1993). Identification of the four human malaria parasite species in field samples by the polymerase chain reaction and detection of a high prevalence of mixed infections. Molecular and Biochemical Parasitology 58, 283-292. Spielman, A., Perrone, J.B., Teklehaimanot, A., Balcha, F., Warlaw, S.C. and Levine, R.A. (1988). Malaria diagnosis by direct observation of centrifuged samples of blood. American Journal of Tropical Medicine and Hygiene 39, 337-342. Stern, S., Powers, T., Changchien, L.-M. and Noller, H.F. (1989). RNA-protein interactions in 30s ribosomal subunits: folding and function of 16s rRNA. Science 244, 783-790. Suplick, K . , Morisey, J . and Vaidya, A.B. (1990). Complex transcription from the extrachromosomal DNA encoding mitochondrial functions of Plasmodium yoelii. Molecular and Cellular Biology 10, 6381-6388. Tollervey, D. (1987). A yeast small nuclear RNA is required for normal processing of pre-ribosomal RNA. EMBO Journal 6, 41694175. Tollervey, D., Lehtonen, H., Carmo-Fonseca, M. and Hurt, E.C. (1991). The small nucleolar RNP protein NOPl (fibrillarin) is required for pre-rRNA processing in yeast. EMBO Journal 10, 573-583. Tollervey, D., Lehtonen, H., Jansen, R., Kern, H. and Hurt, E.C. (1993). Temperature-sensitive mutations demonstrate roles for yeast fibrillarin in prerRNA processing, pre-rRNA methylation and ribosome assembly. Cell 72, 44-57. Unnasch, T.R. and Wirth, D.F. (1983). The avian malaria parasite Plasmodium lophurae has a small number of heterogenous ribosomal RNA genes. Nucleic Acids Research 11, 8443-8459. Vaidya, A.V. and Arasu, P. (1987). Tandemly arranged gene clusters of malarial parasites that are highly conserved and transcribed. Molecular and Biochemical Parasitology 22, 249-257. Vaidya, A.B., Akella, R. and Suplick, K. (1989). Sequences similar to genes for two mitochondrial proteins and portions of ribosomal RNA in tandemly arrayed 6-kilobase-pair DNA of a malarial parasite. Molecular and Biochemical Parasitology 35, 97-108. Wallach, M. and Boeke, J.D. (1983) In vitro translation and characterisation of a unique histidine-rich protein mRNA in the avian malaria Plasmodium lophurae. Proceedings of the National Academy of Science USA 80, 1867-1871. Warburg, A. and Miller, L.H. (1992). Sporogonic development of a malaria parasite in vitro. Science 255, 448-450. Waters, A.P. and McCutchan, T.F. (1989). Rapid, sensitive diagnosis of malaria based on ribosomal RNA. Lancet 8651, 1343-1346. Waters, A.P. and McCutchan, T.F. (1990). Ribosomal RNA - Nature’s own polymerase amplified target for diagnosis. Parasitology Today 6, 5 6 5 9 . Waters, A.P., Syin, C. and McCutchan, T.F. (1989). Developmental regulation of stage-specific ribosome populations in Plasmodium. Nature 342, 438-450.

TME~RIBOSOMAL RNA GENES OF PLASMODIUM

79

Waters, A.P., Higgins, D.G. and McCutchan, T.F. (1991). Plasmodium falciparum appears to have arisen as a result of lateral transfer between avian and human hosts. Proceedings of the National Academy of Science USA 88, 31463144. Waters, A.P., Higgins, D.G. and McCutchan, T.F. (1993a). The phylogeny of malaria: a useful study. Parasitology Today 9, 246-250. Waters, A.P., Higgins, D.G. and McCutchan, T.F. (1993b). Evolutionary relatedness of some primate models of malaria. Molecular Biology and Evolution 10, 914923. Waters, A.P., van Spaendonk, R., Ramesar, J. and Janse, C.J. (1993~).Transcription of the rRNA genes of Plasmodium berghei. Submitted. White, R.J., Jackson, S.P. and Rigby, P.W.J. (1992). A role for the TATA-box binding protein component of transcription factor IID complex as a general RNA polymerase I1 transcription factor. Proceedings of the National Academy of Science USA 89, 1949-1953. Williamson, D.R., Wilson, R.J.M., Bates, P.A., McReady, S., Perler, F. and Qiang, B.-U. (1985). Nuclear and mitochondria1 DNA of the primate malarial parasite Plasmodium knowlesi. Molecular and Biochemical Parasitology 14, 199-209. Wilson, R.J.M. Gardner, M.J., Feagin, J.E. and Williamson, D.H. (1991). Have malaria parasites three genomes? Parasitology Today 7 , 134-136. Woese, C.R. (1987). Bacterial evolution. Microbiological Reviews 51, 221-271. Yeh, L.-C.C. and Lee, J.C. (1992). Structure analysis of the 5' external transcribed spacer of the precursor ribosomal RNA from Saccharomyces cerevisiae. Journal of Molecular Biology 228, 827-839. Zagorski, J., Tollervey, D. and Fournier, M.J. (1988). Characterisation of an SNR gene locus in Saccharomyces cerevisiae that specifies both dispensible and essential small nuclear RNAs. Molecular and Cellular Biology 8, 3282-3290. Zhu, J., Waters, A.P., Appiah, A., Lal, A., McCutchan, T.F. and Hollingdale, M. (1990). Stage-specific ribosomal RNA expression of P . berghei switches during sporozoite invasion of hepatocytes. Journal of Biological Chemistry 265, 12740- 12744.

This Page Intentionally Left Blank

Molecular Mimicry Roger Hall

Department of Biology, University of York, York, YO1 5DD, U K

1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 ....................... 81 1.1. Definition . . . . . . . . . . . . . . 1.2. How is molecular mimicry 1.3. What are the potential consequences 1.4. How widespread is molecular mimicry? . . . . . . . . . . 84 2. AdaptiveMimicry . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85 2.1. Mimicry of cytoadhesive proteins and their receptors 85 94 2.2. Mimicry of effectors of the immune system ............................ 2.3. Hormones, hormone receptors and serum protein receptors . . . . . . . . . . . 100 2.4. Cytoskeletal and muscle proteins . . . . . . . . . . . . . . . . . . . . . . . . . . . 3. Consequential Mimicry: Autoimmunity 3.1. Bacterial mimicry . 3.2. Protozoal mimicry 3.3. Viral mimicry . . . . .

. . . . . . . . . 112

4. How Does Molecular Mimicry Cause Disease?Autoimmune Considerations 5. Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

118

Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

120

References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

120

1. INTRODUCTION 1.I.Definition

Molecular mimicry has been defined in several different ways. The first formal definition, provided by Damian (1964), states that molecular ADVANCES IN PARASITOLOGY VOL 34 ISBN % I 2 4 3 1 7 3 4 4

CopyriRhth,oI994 Academic Press Limited A / / rights of reproduction in any form reserved

82

ROGER HALL

mimicry is the sharing of antigenic determinants between a parasite and its host. An alternative, provided by Oldstone (1989a) states, that molecular mimicry is the possession of similar structures between molecules produced by dissimilar genes. He qualifies this statement by pointing out that this sharing can be at the level of linear sequence a n d o r conformation. There are problems with both definitions in the opinion of the present author. Damian’s is hampered by relying solely on an immunological criterion. Functional homologies (either of a linear or conformational nature) may be immunologically inert and, although biologically meaningful, would be disallowed under Damian’s definition but be accepted by Oldstone’s criteria. Conversely, important immunological cross reactions between highly conserved molecules, e.g. heat-shock proteins (with serious autoimmune consequences), would fit the Damian concept but are not acceptable under Oldstone senw stricto. A further complication is that Oldstone’s definition is restricted to proteins and thus excludes carbohydrate and lipid structures whereas these could be accommodated under Damian’s definition. I should, at this point state that I am not trying to imply that there is a rift between these two scientists. Rather, I am merely using their definitions as a means to discuss and highlight a central dilemma I have encountered whilst writing this review. Namely, what is molecular mimicry? The problem, at least in part, is due to the fact that molecular mimicry is quite simply not a single concept. At the very least, it is a term that embodies two essentially different notions which I shall term “adaptive mimicry” and “consequential mimicry”. I shall try to explain what I mean by these terms. The term “adaptive mimicry” is essentially self-explanatory and means that a parasite molecule mimics a host molecule for a biological reason. That reason may be immune evasion (Bloom, 1979) or subversion of some host-function for its own physiological or biochemical purposes, e.g. mimicry of a host ligand in order to recognize and enter a target cell. I would say that this definition would be best served by stating that true adaptive mimicry is where the homologous functional structure resides in a parasite molecule which is otherwise dissimilar to the host molecule. Such a state of affairs of course could arise by convergent evolution or, most intriguingly, by horizontal transfer of genetic material from host to parasite. It is arguable that functional mimicry may not be reflected at all in structural similarity but is still able to satisfy the definition of adaptive mimicry I am trying to espouse. The term “consequential mimicry” does not imply (but equally does not exclude) any adaptive force behind the observations of shared structures. Equally it does not impose the stricture that I put upon my definition of adaptive mimicry, namely that the homology need reside in an otherwise dissimilar molecule. The main point is that the result of the mimicry has

MOLECULAR MIMICRY

83

direct consequences for the host; this can be achieved by sharing of phylogenetically conserved molecules or by small regions of similarity in evolutionarily distinct molecules. It is largely identical to Damian’s definition and I have introduced it really to allow a discussion, in this review, of the large and fascinating field of literature claiming that many autoimmune diseases are a result of shared, cross-reacting epitopes between parasites and their hosts. For the purposes of this review I have also taken the liberty of broadening the term parasite to include any invasive microbe including bacteria, fungi and viruses as there appears to be no good intellectual reason for making a distinction between these and the “traditional” parasites (helminths and protozoa). 1.2. How is Molecular Mimicry Studied?

There are three basic approaches to uncovering mimicked structures.

1. A search for immunologically shared determinants between parasite and host molecules using antibodies and less often cellular-based assays. Such an approach may uncover both adaptive and consequential mimicry although proving either is by no means a simple process. It will also undoubtedly reveal a proportion of fortuitously shared structures that are both biologically meaningless to the parasite and have no consequences for the host. One advantage of this approach is that there is, in principle, no chemical bias and shared lipid, carbohydrate and protein epitopes can be revealed. 2. The direct demonstration of molecules in the parasite which mimic defined host functions. Such demonstrations, by functional assays, are highly likely to be biologically meaningful. 3. Direct sequence comparisons between host molecules and parasite molecules by searching protein databases. This is obviously restricted to protein molecules and a degree of “noise” is inevitable especially if one allows short matches of say four amino acids. This approach, however, does allow for rapid comparisons to be made and some functional motifs may be predicted as well as potential immunological cross reactions suggested. All three approaches have been employed and examples of each are available and will be discussed at appropriate points. 1.3. What are the Potential Consequences of Molecular Mimicry?

The consequences of molecular mimicry are discussed by Damian (1989) and can be broken down into those that bear on the parasite and those

84

ROGER HALL

that affect the host. In the context of the parasite the direct consequence will be enhanced fitness either by immune evasion (Sprent, 1962; Dineen, 1963; Damian, 1964) or by mimicry of functional structures facilitating physiological interaction with the host. From the point of view of the host the consequences are thought to be essentially two fold. 1. The evolution of extreme polymorphism of the mimicked structure in an attempt to become less susceptible to the parasite at the level of the population. Much speculation that polymorphism of blood group antigens, immune response and immune suppression genes is due to parasite pressure has been advanced (Snell, 1968; Mitchison and Oliveira, 1986), and mimicry may be the major underlying factor. As with many evolutionary questions the evidence for this is at once compelling but a’t the same time merely circumstantial. 2. The breakdown of self-tolerance, the development of an autoimmune response eventually leading to pathology. Essentially this is a mechanistic explanation for many autoimmune diseases the aetiology of which had until recently remained mysterious. These ideas are discussed extensively in recent reviews (Oldstone, 1987, 1989a, b; Barnett and Fujinami 1992; Tsuchiya and Williams, 1992; Horsfall, 1992; Baum et af., 1993) and will be expanded later in this article.

1.4. How Widespread is Molecular Mimicry?

Examples of molecular mimicry are now manifold and found in viruses, bacteria, protozoa and helminths (see Oldstone, 1989b). Perhaps the scale of the phenomenon is best illustrated in a study by Srinivasappa (Srinivasappa et al., 1986; Oldstone, 1989a) the results of which are reported in Table 1. The cross reactivity on uninfected host tissues of a panel of 708 monoclonal antibodies raised against 13 different viruses was assessed; 34 antibodies cross reacted which gives a figure of 4.8%. In another study, using the database sequence comparison approach, McLaughlin et af. (1987) compared six of the repeated antigen sequence motifs of plasmodia1 origin with human proteins; 29 matches of at least four amino acids were found. The biological relevance, if any, of these statistics is not clear. As stated earlier some of them are bound to be fortuitous “noise”. However, there are now many examples where the homology is so strong or the link between cross reactivity and autoimmunity so great that they cannot be dismissed lightly. In the remainder of this review I hope to demonstrate that molecular mimicry is a real phenomenon with definite consequences for host and parasite.

85

MOLECULAR MIMICRY

Table I The extent of molecular mimicry as determined by monoclonal antibody cross reactivity between viruses and their host. Virus Coxsackie B4 Japanese encephalitis Lymphocytic choriomeningitis Theiler’s virus Measles Rabies Vesicular stomatitis Herpes Simplex (I) Vaccinia Dengue Cytomegalovirus Human Mouse HIV-1 Total

Number of monoclonals tested 66 34 174 64 39 80 37 20 16 132

Number reacting with uninfected tissues 1 6 3 9 5 2 2 1 1 0

24 14 8

1 0 1

708

34

Based on a study of Srinivasappa et al. (1986) and reproduced from Oldstone (1989a) with permission of the author and Springer-Verlag.

2. ADAPTIVE MIMICRY 2.1. Mimicry of Cytoadhesive Proteins and Their Receptors

2.1.1. Thrornbospondin E Region and Proteins of Malaria The circumsporozoite protein (CSP) of malaria provides possibly the bestdefined example of molecular mimicry which can be shown to have a direct functional role. The CSP is the major surface protein of malaria sporozoites and it has been much characterized as a vaccine candidate (Nussensweig and Nussensweig, 1989). The structure of the protein, which is essentially the same in all species of malaria examined, is shown diagrammatically in Figure 1A (reviewed in Kemp et al., 1987). It consists of three clearly defined motifs known as regions I and I1 plus the central repetitive domain (Dame et a l . , 1984). The repeats which form about one-third to one-half of the molecule vary between species in both unit length and sequence although the total length is fairly well conserved. Species with small repeat units have more motifs than species with large repeat units, e.g. approximately 40 repeats of NANP in P . fulciparurn versus 12 repeats of GQPQAQGDGANA in P . knowlesi. Regions I and I1 on the other hand are highly conserved across the species boundary. The high level of

86

ROGER HALL

Generalised Structure o f CSP Slgnal Repeats

sequence

Charged area

Charged area REGION I

A

REGION I1

amino acid no. Pf Pv

Pk Pc Pb Py

345-372 312-329 297-314 312-329 274-298 302-319

E E E E E E

W W W W W W

S T T S S S

P P P P Q Q

C C C C C C

S S S S N S

V V V V V V

T T T T T T

C C C C C C

G G G G G G

N V N K S S

G G G G G G

I V V V I V

Q R R R R R

V V I M V V

R R R R R R

I S R R K K

K R K K R R

THROMBOSPONDIN amino acid no. 369-386 425-442 482.499

0

Figure 1 Structural features of the circumsporozoite protein (CSP) of Plasmodium spp. (A) Schematic of the overall architecture of the CSP. (B) Sequence comparison of region I1 of the CSP from various Plasmodium spp. to the three type I repeats of the cytoadhesive E region of thrombospondin. Homologous residues between thrombospondin and the various CSP sequences are enclosed in the main box. The Plasmodium spp. are abbreviated as follows: Pf, P . falciparum; Pv, P . vivax; Pk, P . knowlesi; Pc, P . chabaudi; Pb, P . berghei; Py, P . yoelii. Modified from Robson et al. (1988). with permission.

conservation of region I1 is shown in Figure 1B where the relevant sequences of six mammalian malaria species are compared. It is region I1 with which we are concerned in this review. The region I1 sequence of Plasmodium fafciparum (and other species of malaria) bears a striking homology to the type I repeats of the E regions of the cytoadhesive molecule thrombospondin (TS) (Frazier, 1987). The type I repeats are one of four regions in TS that mediate cytoadhesion (Prater et af., 1991). Furthermore, a study by Rich et af. (1990) demonstrated that the highly conserved VTCG motif (Figure 1B) was critical for adhesion to a number of human haematopoetic cell lines. Evidence has been published that this domain recognizes sulphated glycoconjugates (Holt et af., 1990). The sequence match, shown in Figure l B , extends over 18 amino acids with the P . fafciparum sequence being identical with one of the three E region sequences at 15 of the 18 positions. This homology is so striking that it led Frazier (1987) to speculate that this region may be the ligand by which sporozoites mediate their interaction with hepatocytes. This prediction was elegantly confirmed by Cerami et a f . (1992) who demonstrated that recombinant constructs of CSP containing region I1

MOLECULAR MIMICRY

87

Figure 2 Immunogold electron micrographs demonstrating that the CSP binds to micovilli of human and rat hepatocytes in the space of Disse. (A) Human liver section labelled in a triple sandwich with recombinant CSP followed by an antiCSP mAb and visualized with protein A-gold. Aggregates of CSP molecules bind to hepatocyte microvilli within the space of Disse (arrows) and to the lateral membranes of adjacent hepatocytes (arrowheads). The hepatocyte surfaces exposed to the bile canaliculi (UC) and to the sinusoidal membrane of endothelia (EC) are not labelled. H, hepatocyte; N , hepatocyte nucleus; S, sinusoid; E, erthrocyte. Note that the entire surface of the hepatocyte (arrows) except the area exposed to the bile canliculus (BC) is labelled. (B) Higher magnification of a rat liver space of Disse showing CSP aggregates bound to hepatocyte microvilli. H, hepatocyte; EC, endothelial cell. In this section the gold was part of a goat anti-mouse conjugate. (Reproduced from Cerami et al. (1992), with permission of Cell Press.)

88

ROGER HALL

would bind specifically to hepatocytes. This was demonstrated both on paraformaldehyde-fixed, frozen tissue sections of rat liver and on paraformaldehyde-fixed HepG2 (a human hepatoma cell line) cells. Constructs lacking region I1 did not bind and the specific binding was inhibitable with region I1 peptides. The peptides were also shown to be able to inhibit P . berghei sporozoite invasion of HepG2 cells as were antibodies directed against P. berghei region 11. The receptors for this ligand were demonstrated, by electron microscopy using immunogold labelling, to exclusively line the space of Disse in both human and rat liver sections (Figure 2). The space of Disse is the lumen of the liver exposed to the blood and hence the sporozoites. There was no binding to the hepatocyte membranes not in contact with the blood. Therefore, it can be concluded that region I1 of the CSP is a ligand for hepatocytes and this study is perhaps the clearest unequivocal demonstration of adaptive molecular mimicry to date. Robson et al. (1988) have described another malaria protein, which they term thrombospondin related anonymous protein (TRAP), that contains extensive homology with TS and properdin in exactly the same sequence as described for the CSP. TRAP, originally described as a blood-stage molecule, is now also thought to be expressed on the sporozoite and is probably identical to SSP2, another sporozoite antigen (Khusmith et al., 1991; Good et al., 1993). TRAP may play a role in the pathology of falciparum malaria which involves sequestration of the late blood stages in the deep vascular beds. This is a cytoadherence phenomenon and in in v i m models this can be inhibited with both TS and anti-TS antibodies (Roberts et al., 1985). It is highly tempting to speculate that this adherence is mediated at least in part through the TS motif carried by TRAP especially since platelet glycoprotein IV (the TS receptor) is implicated in the process (Barnwell et al., 1985). Whatever the explanation for this degree of homology it is remarkable and is surely more than fortuitous. Also of note is the fact that TRAP possesses an RGD motif which is found as a ligand on many cytoadhesive proteins including TS (Pierschbacher and Ruoslahti, 1984; Ruoslahti and Pierschbacher, 1987). 2.1.2. Elastin Mimicry by Theileria annulata One of the most extensive examples of molecular mimicry so far discovered involves a sporozoite surface antigen (SPAG-1) of the bovine apicomplexan parasite Theileria annulata (Williamson et a f . ,1989; Hall et al., 1992; Boulter et al., 1994). The SPAG-1 molecule is shown diagrammatically in Figure 3A. The molecule has two areas which contain repeats of the motif PGVGV. The most N terminal block contains this motif tandemly repeated 11 times whereas downstream there is a block of six

89

MOLECULAR MIMICRY

I

I [PGVGVI, I

[PGVGVI

I Hydrophoblt dOmalnS, putative signal ana membrane anchor sequences

4

Elastin llke PGVGV repeats contalnlng VGVAPG Units

A

(i)

S E

179 PGVGVPGVGVPGVGVPGVGVPGVGVPGVGV IIIIIIIIIIIIIIIIIIIIIIIIIIIIII 335 PGVGVPGVGVPGVGVPGVGVPGVGVPGVGV PGVGGVPGVGVAPGVGVPGVGVAPGVGV 236 Ill IIIIIII IIIIIIIIII IIIII PGV.GVPGVGV.PGVGVPGVGV.PGVGV 389

(ii)S

588

E 1010

CCCGGTGTAGGTGTTCCAGGAGTTGGTGTTCCAGGA I I I I II II I I II I1 I I II II I I II CCAGGAGTTGGAGTCCCTGGTGTCGGGGTCCCTGGT

GTAGGTGTTCCAGGAGTAGGTGTTCCAGGAGTAGGT I I II IIIIIIII II II II II I I II II GTCGGGGTTCCAGGTGTCGGGGTCCCTGGTGTCGGG GTTCCAGGTGTAGGTGTGCCAGGTGTAGGAGGTGTT IIIIIIIIIII I I II IIIIIIII II II GTTCCAGGTGTCGGAGTCCCAGGTGTT. . .GGAGTC CCCGGAGTTGGCGTTGCACCAGGGGTAGGTGTTCCA I1 I I I I I I I I I I I II I I II I I II CCAGGTGTTGGAGTC . . .CCTGGTGTTGGGGTCCCT GGAGTTGGTGTTGCACCAGGTGTAGGTGTT 761 I I IIIII II I I IIIII II Ill GGTGTTGGCGTC . . .CCTGGTGTTGGAGTT 1183

( iii )

..

424 PGVGVPGVGVPGVGVPGVGVA. , PGVGV . . . . VPGVGGA 456 IIIIIIIIIIIIIIIIIIII: IIIII IIIII.: E 335 PGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVP375

S

B Figure 3 Mimicry of bovine elastin by Theileriu unnulutu surface antigen SPAG-1. (A) Schematic of the structure of the SPAG-1 polypeptide emphasizing the location of the elastin homologous regions. (B) Sequence comparison between SPAG-1 PGVGV repeats and bovine elastin: (i) the most N terminal block of PGVGV repeats; (ii) the DNA sequence comparison over the same region compared in (i); (iii) the more C terminal block of repeats. The VGVAPG motifs are underlined. S denotes the SPAG-1 sequence and E denotes the bovine elastin sequence in all cases. (Reproduced from Hall et al. (1992), with permission from Elsevier Science Publishers.)

90

ROGER HALL

tandem repeats. The motif PGVGV is also repeated in the extracellular matrix protein elastin from a number of species including the host for T . annulata, Bos taurus. The motif occurs 11 times in tandem in bovine elastin and the alignment of the Theileria and bovine sequences is shown in Figure 3B. The homology is striking with only three differences over the N terminal block between the sequences all due to insertions in the Theileria sequence (Figure 3B(i)). Two of the three insertions are due to the presence of an A residue between the basic PGVGV units which allows the generation of a hexapeptide VGVAPG (underlined in Figure 3B). This structure is also present in the downstream repeat block (Figure 3B(iii)) and intriguingly also occurs twice in bovine elastin but downstream of the main repetitive region. Even more interestingly this VGVAPG motif has been demonstrated to be the ligand for an elastin receptor on certain cell types (Blood et al., 1988; Mecham et al., 1989; Robert et al., 1989) including macrophages and monocytes which are favoured targets for T. annuluta infection (Glass et a l . , 1989; Spooner et al., 1989). It is tempting to speculate that this represents a ligand for host cell recognition but unfortunately two lines of evidence argue against this. In the first place inhibition studies with VGVAPG peptides and an anti-VGVAPG monoclonal have proved inconclusive (Brown et al., unpublished observation). Secondly, and more importantly, a second complete SPAG-1 allele has been sequenced which does not contain the VGVAPG motifs, although it does retain the extensive PGVGV mimicry (Hall, unpublished observation). Thus we are left with the extensive elastin mimicry and no good functional explanation other than immune evasion. The evolution of this system is an intriguing question and some clues are perhaps provided by the comparison at the nucleotide level shown in Figure 3B(ii). As can be seen there is a high degree of third position wobble such that the protein sequence is maintained but the nucleotide sequence varies so that it reflects the overall AT richness of the Theileria genome. Consistent with this is the fact that of 43 silent third base changes 18 are A/T for G/C substitutions whereas only three are in the reverse direction. The question remains “Did this parasite acquire this genetic material by convergent evolution or horizontal gene transfer from the host?” However it was acquired, it is perhaps instructive to note that the analogous antigen possessed by the closely related species T. parva does not possess this extensive elastin mimicry but it does have one copy of the motif PGVGV (Nene et al., 1992). Does this represent a contraction of the original repetitive motif acquired by gene transfer from the cow, or is it a reflection of the precursor situation before the original motif was expanded tandemly? I fear we shall never know but the observation is fascinating.

MOLECULAR MIMICRY

91

2.1.3. Mimicry of Fibronectin Receptors Several extracellular (e.g. Entamoeba histolytica) and intracellular parasites (e.g. Leishmania spp. and Trypanosoma cruzi) have evolved receptors for fibronectin which they presumably utilize for different purposes. Fibronectin is a high-molecular-weight glycoprotein composed of 220 kDa subunits linked into dimers and polymers by disulphide bonds. It is present in blood, connective tissue and at cell surfaces. It interacts with cells and may mediate cell adhesion by cross bridging. The ligand for cell adhesion has been mapped to a three amino acid motif, RGD, which is also utilized by other integrin receptors (Ruoslahti and Pierschbacher, 1987). (a) Trypanosoma cruzi. Elegant data demonstrating the presence and utilization of fibronectin receptors by a parasite concerns the case of T . cruzi (Ouaissi et al., 1984, 1985, 1986). In this series of studies it was demonstrated that T . cruzi binds to fibronectin and that this interaction mediates host cell interactions. In their rigorous 1986 study Ouaissi and colleagues showed that short peptides containing the fibronectin ligand RGDS bound to the surface of trypmastigotes and, importantly, inhibited invasion of mouse 3T3 fibroblasts. They also demonstrated that monoclonal antibodies to the cell attachment site of fibronectin were inhibitory. Most interestingly these authors demonstrated that BALB/c mice were rendered resistant to T . cruzi infection by immunizing mice with a peptide containing the R G D motif (AVTGRGDSPC) coupled to tetanus toxoid. The suggestion is made that the parasite is able to utilize this as a host recognition system because fibronectin is often in the form of a dimer (or larger polymer) which can form a bridge between the two cells. (b) Leishmania spp. Studies with promastigotes of Leishmania chagasi (Rizvi et a f . , 1988) demonstrated that peptides based on R G D inhibited binding to macrophages, suggesting that this parasite might have evolved a structure similar to this to gain host cell entry. Indeed such a structure appears to reside on the surface protease gp63. This was demonstrated by showing that RGD-containing peptides could inhibit the interaction of macrophages with gp63-coated silica beads (Russell and Wright, 1988). This was originally explained by a predicted R G D motif in gp63. However it was subsequently shown that no RGD was present as sequencing errors had occurred (Button and McMaster, 1988, 1990). The data therefore, although intriguing and suggesting functional mimicry do not as yet have a satisfactory structural basis. (c) Entamoeba histolytica. In an interesting study Talamas-Rohana and Meza (1988) reported a molecule on the surface of Enfamoeba histofyfica that binds to fibronectin. They demonstrated that '251-labelled fibronectin (FN) bound to the surface of live trophozoites in a saturable manner and that the binding could be inhibited competitively by unlabelled fibronectin.

Table 2 Complement binding and regulatory structures mimicked by microorganisms to evade the complement system (andor augment infection).

Complement-bindindregulatory Complement-like functions of microorganism motif of proteins microorganism proteins SCR Block ACP C3 convertase assembly ? Block ACP C3 convertase assembly Block assembly and accelerates ? decay of ACP and CCP C3 convertases

References

Microorganism

Microorganism protein

Trypanosoma cruzi

gP160

Homologous complement protein(s)/ activity CRI, DAF

gp58168

?

87-93 kDa

DAF

Entamoeba histolytica

170 kDa surface galactose binding adhesin

CD59

Blocks MAC

aa 2&55 in CD.59

Candida albicans

p42-CR3

CR3

Binds iC3b but reason unclear

55/60 kDa doublet

CR2

Binds C3d but reason unclear

Shares mAb epitopes Alaei with human CR3 et al. (1993) ? Saxena and Calderone (1990)

CSP, TRAP

Properdin, C6,C7,C8,C9

Binds C3b and then host cells via CRl? Binds host cells directly

Plasmodium fakiparum

Type 1 repeat of thrombospondin also found in properdin, C6,C7,C8 and C9

Cooper (1991) Fischer etal. (1988) Joiner et al. (1988) Braga et al. (1992)

Robson el al. (1988)

Goundis and Reid (1988)

Eimeria tenella

Etp 100

Properdin, C6,C7 ,C8,C9, Factor B

Binds C3b and then host cells via CRl? Binds host cells directly

Type 1 repeat of thrombospondin also found in properdin C6,C7,C8 and C9

Tomley et al. (1991)

Babesia rhodaini

?

CRI?

Binds C3 and acts as bridge to recognize red blood cell?

?

Jack and Ward (1980)

Schistosoma mansoni

?

CRl?

Binds C3b and prevents cascade? ?

Tarleton and Kemp (1981)

Vaccinia

gp35

C4bp

Block CCP C3 convertase assembly

SCR

Kotwall and Moss (1988) Kotwall et al. (1990)

HSV

gc-1 ,gc-2

CRl ,DAF

Disassemble ACP C3 convertase

SCR-like

Seidel-Dugan et al. (1990)

EBV

?

CRl ,DAF,MCP

Factor I cofactor for C3 and C4 cleavage, disassemble ACP C3 convertase

?

Mold et al. (1988)

Abbreviations: CCP, classical pathway; ACP, alternative pathway; TRAP, thrombospondin-related anonymous protein; DAF, decay accelerating factor; SCR, short consensus repeat; MCP, membrane co-factor protein; MAC, membrane attack complex. (Reproduced in modified form from Cooper (1991), with permission of Elsevier Trends Journals.)

94

ROGER HALL

This was confirmed by a triple-layer immunofluorescence assay whereby unlabelled FN was bound to the trophozoites and then incubated first with rabbit anti-human FN serum followed by FITC-labelled sheep anti-rabbit IgG. The molecule responsible for this interaction was identified as a 37 kDa membrane peptide by probing western blots of plasma membrane fractions with 12sI-labelledFN. It was also demonstrated that the amoebae internalized the FN into digestive vacuoles and degraded it. Possibly the most notable observation was that upon interacting with FN the amoebae re-arranged their cytoskeleton resulting in the formation of actin containing “adhesion plaques”, revealed by probing the trophozoites with rhodamine-labelled phalloidin. The detailed molecular basis for this interaction remains to be fully elucidated but it can be speculated that it would provide the amoebae with a useful method of interacting both with cells prior to phagocytosis and also the extracellular matrix through which pathogenic forms must migrate. 2.2. Mimicry of Effectors of the Immune System

2.2.1. Mimicry of Complement Receptors and of Other Modulators of Complement Activation

The functional mimicry of complement receptors and modulating factors is a recurring theme in parasitology (for a review see Cooper, 1991). A few striking examples are outlined below and a more general list is documented in Table 2. Note also that I have not discussed the elegant examples provided by viruses as they are not the main thrust of this article. (a) Plasmodium spp. Region I1 of the CSP as well as being homologous to thrombospondin also possesses homology with the complement-binding region of properdin (Goundis and Reid, 1988) and four of the five terminal complement components (Stanley et al., 1985; Rao et al., 1987; DiScipio et al., 1988; Chakravarti et al., 1989) (Table 2). This has led to the suggestion that perhaps there is another functional role for this mimicry, possibly through binding complement which would then allow interaction with CR1 receptors and thus possibly another route to host cell recognition. A similar suggestion has been made for TRAP in that if it were present on the merozoite surface then it may bind CR1 on red cells via a C3b bridge using the properdin C3b binding domain (Table 2). No data are available to support either of these contentions. (b) Eimeria tenella. Variations of the region I1 motif of the CSP are found repeated five times in a microneme located sporozoite antigen of Eimeria tenella (Clarke et al., 1990; Tomley et al., 1991) (Table 2 ) . Furthermore, this antigen also has another region homologous to factor B

MOLECULAR MIMICRY

95

(amongst other things). The authors of this work speculate that this factor B-homologous region may bind C3b to the surface and that this interaction is then stabilized by the properdin/thrombospondin repeats. The biological reason for this they suggested is to utilize the complement components to facilitate host cell penetration. Direct data to test this are lacking. (c) Babesia rhodaini. A very clear example of the subversion of complement binding was demonstrated in the case of Babesia rhodaini by Jack and Ward (1980) (Table 2) who demonstrated that the ability of this parasite to invade red cells is critically dependent on the presence of complement. They showed that reagents that deplete complement (e.g. cobra venom) delay the onset of parasitaemia in rats whereas the drug suramin (which stabilizes complement levels) increases the parasitaemia. Also, trypan blue (which inhibits C3b receptors) delays parasitaemia. It has also been demonstrated directly that B. rhodaini binds C3 and thus it is believed that this parasite carries surface receptors for complement which facilitate red cell entry by allowing interactions with the red cell via a complement bridge to the C R l receptor. (d) Schistosoma mansoni. Several studies have established that S. mansoni possesses receptors for complement on various life-cycle stages (Santoro et a f . , 1979, 1980; Tarleton and Kemp, 1981) (Table 2). These include receptors for C l q and C3b. Perhaps the clearest demonstration of C3b receptors on adult worms is provided by an indirect assay based on the ability of the adult worms to bind antigen-F(ab’).+omplement complexes specifically (Tarleton and Kemp, 1981). These were then detected by using a second antibody against either the antigen (BSA), the first antibody or complement and the final sandwich was revealed utilizing fluoresceinated Staphylococcus aureus. Specificity controls showing dependence on activated complement (presumably C3b) were included. In addition, it was demonstrated that binding was dependent on the presence of a metabolic inhibitor (2-deoxyglucose) and it was suggested that this was because the complexes are otherwise rapidly cleared. The role and origin (host or parasite) of the receptors remains unclear and these authors suggest that the receptor might bind and inactivate C3b (produced either by the classical or alternative pathway) and prevent the remainder of the complement cascade proceeding to produce C9 and damage the worm. In other words this could be a sophisticated form of evasion of host defence mechanism. (e) Candida albicans. In 1985, Heidenreich and Dierich described the binding of erythrocytes coated with human iC3b and C3d to the germ tubes of Candida albicans. This was considered good evidence for specific receptors on the parasite similar in specificity to CR2 (C3d binding) and CR3 (iC3b binding) (Table 2). These findings have been confirmed (Edwards et a l . , 1986) and extended by observing that certain anti-human

96

ROGER HALL

CR3 monoclonal antibodies (recognizing both the a (OKM-1, Mol and M1/70HL) and possibly the p (7C3) chains of the receptor) bind specifically to the germ tubes (Eigentler et a f . ,1989; Mayer et a f . ,1990). Other specific anti-human CR3 monoclonal antibodies did not bind demonstrating only partial similarity and not identity with the human CR3. Interestingly, the monoclonal 7C3 that recognizes the p chain is directed against a carbohydrate determinant composed of lacto-N-fucopentaose. Eigentler et u f . (1989) used monoclonal OKM-1 to affinity purify presumptive CR3 like receptors and succeeded in isolating three species of molecule ( M , = 50, 100 and 130 kDa) each of which is presumed to have iC3b binding activity. In a more recent study affinity chromatography using C3(H20)-Sepharose was used to extract a 42 kDa molecule (p42-CR3) from lysates of pseudohyphae (Alaei et a f . , 1993). p42-CR3 was shown to cross-react with mAb OKM-1 and rabbit antibodies against it inhibited the binding of iC3b coated sheep erthrocytes to pseudohyphae. When the rabbit antiserum was used in affinity chromatography further components of 66 and 55 kDa as well as p42-CR3 were identified and evidence was presented that these represented glycosylated forms of p42-CR3. The authors do not discuss the relationship (if any) to the OKM-1 binding molecules purified by Eigentler but they do assert that the structure of the C. albicans CR3 receptor is distinct from the human counterpart. The basis for the mAb cross-reactivity and the iC3b binding will hopefully be revealed by cloning the p42-CR3 gene. The C. albicans CR2-like molecules have been studied in depth. Initially, using C3d ligand and monoclonal antibody affinity chromatography to purify proteins from cell lysates, species of 60 and 70 kDa were obtained; ligand activity is believed to reside on the 60 kDa molecule (Calderone et al., 1988; Linehan et a f . , 1988). To obtain large quantities for detailed analysis the same group of workers purified C3d binding proteins from the pseudohyphal culture medium (Saxena and Calderone, 1990). This culture filtrate (simply obtained by filtering the culture through filter paper) was fractionated by preparative isoelectric focusing and assaying fractions for C3d activity. The result was the identification of a pure sample containing a doublet of 60 and 55 kDa. These molecules are thought to be differentially glycosylated forms of the same protein. Analysis of the carbohydrate composition and structure plus the amino acid composition demonstrated that the C. albicans CR2 is distinct from the human receptor. (f) Entamoeba histolytica. Entumoeba histolytica trophozoites that are exposed to human serum do activate complement but are resistant to killing by the C5b-9 membrane attack complex (MAC) (Reed and Gigli, 1990). In a careful study Braga et al. (1992) demonstrated that this inhibition is mediated by interaction of a surface molecule with the termi-

MOLECULAR MIMICRY

97

nal complement components (Table 2). They approached this question by raising a monoclonal antibody (mAb 3D12) which abrogated complement resistance when added either as purified intact IgG or importantly as a Fab fragment. When the analysis was pursued further they discovered that mAb 3D12 recognized a previously characterized surface adhesin which has been shown to be a galactose-specific lectin (Petri et al., 1987, 1989, 1990). They then demonstrated that the purified adhesin inhibited by 90% the lysis of sensitive trophozoites by C5b-9 components. It was shown that the adhesin binds to C8 and C9 and that this binding could be inhibited by mAb 3D12. Sequence analysis and comparison revealed the noteworthy observation of a degree of homology to the host molecule CD59. Furthermore, the non-reduced lectin (composed of a heavy and light subunit) reacted with an antiserum to CD59. CD59 is an inhibitor of the complement MAC found in the membrane of human blood cells (Zhao et al., 1991). Thus it appears that E . histolytica has evolved a complement evasion strategy by mimicking both structurally and functionally the host molecule CD59. (g) Trypanosoma cruzi. The insect stage of T. cruzi, known as epimastigotes are sensitive to the alternative pathway of complement, whereas the trypomastigotes which are infective to mammals are resistant (Kipnis et al., 1981; Schenkman et al., 1986). The mechanisms involved in this evasion are not fully understood but are thought to involve inhibitors of C3 convertase and functional analogues of decay accelerating factor (DAF) (Table 2). One study demonstrated that a purified glycoprotein (gp58/68: non-reduced size M,=58 kDa and, reduced size M,=68 kDa), which is a fibronectidcollagen-binding molecule, was able to inhibit the formation of cell-bound and fluid-phase alternative pathway C3 convertase. However, gp58/68 did not display any other effect such as D A F activity or classical pathway convertase activity. It is suggested that the activity operates by binding to factor B (Fischer et al., 1988). Other workers have demonstrated D A F activities. Joiner et al. (1988) purified a 87-93 kDa fraction from the culture supernatant of trypomastigotes which interferes with the formation and accelerates the decay of the alternative and classical pathway C3 convertases. Another molecule, called gp160, has been purified and shown to bind C3b and block C3 convertase formation. The gene for this is reported to hybridize to the human DAF gene suggesting a structural basis for the observed functional mimicry (Cooper, 1991). Thus T. cruzi trypomastigotes apparently mimic a range of modulators of the complement cascade in order to avoid lysis. 2.2.2. Fc Receptor Mimicry One common strategy that parasites adopt to modulate and possibly avoid the host immune system is to bind immunoglobulin by its Fc portion. Such

98

ROGER HALL

Fc receptors are found on a wide array of parasites including bacteria (see Boyle, 1990a), protozoa (Ferreira de Miranda-Santos and Campus-Neto, 198l), schistosomes (Torpier et a f . , 1979; Tarleton and Kemp, 1981) and viruses (Ogata and Shigeta, 1979; Para et a f . ,1980; Tuckwiller et a f . ,1981). There appears to be a correlation between the presence of Fc receptors on a parasite and pathogenicity. However, the means whereby virulence is promoted as a consequence of the possession of Fc receptors is not fully elucidated but probably involves a range of effects. These include among others complement depletion and inhibition of opsonization (extensively reviewed by Langone, 1982; Widders, 1990). The present discussion will focus on bacterial Fc receptors (principally protein A) and those described on schistosomes. (a) Protein A and protein G . In 1966 Fosgren and Sjoquist described in detail the so called “pseudoimmune” reactivity of Staphylococcus aureus. These authors showed that the ability of most human S. aureus strains to bind non-immune IgG was mediated by a surface protein that had been named protein A by Grov et a f . (1964). In fact the first description of the activity of protein A is now credited to Jensen (1958). Protein A forms the prototype type I bacterial IgG Fc receptor (Boyle, 1990b). This is the first in a series of at least six types numbered I-VI (see Boyle, 1990a). Protein A is present on the surface of all natural human S. aureus isolates and is also secreted into the serum. Variation in the affinity for IgG from different mammalian species is observed (see Table 3 ) and there is also marked variation in affinity for different IgG subclasses (Table 4). The gene for protein A has been cloned and sequenced (Guss et a f . , 1990) and is shown diagrammatically in Figure 4. Peptide mapping and molecular expression studies have revealed that the protein contains 5 IgG binding domains. These occupy more than half the mature molecule and are located in a tandem block in the N-terminal section. They are designated E, D, A, B and C and they are all highly homologous to one another. An “homology gradient” has been noted among the regions such that the neighbouring regions are more homologous than non-neighbours. This has been interpreted to imply evolution by a series of stepwise duplications of the original Fc receptor domain. The other major well-characterized bacterial Fc receptors (types 11-VI) all reside on streptococci (Boyle, 1990a). I will describe briefly a type I11 receptor found in the group G streptococci called protein G and which has been well characterized (see Bjorck and Akerstrom, 1990, for more detail). Protein G binds a wider range of IgG than protein A and in particular has a high affinity for human IgG3. The gene for protein G has been cloned and sequenced and the immunoglobulin binding domains have been mapped. Interestingly there is no homology at all between the IgG binding domains of protein A and protein G. Also of note is the fact that

99

MOLECULAR MIMICRY

Table 3 Reactivity of protein A with different species of IgG. Species

IgG (ng) required to inhibit '"I-PrA binding by 50%

Human Rabbit Pig Goat Sheep cow Dog Rat

13 130 118 13 000 40 000 21 000 100

> 10-5

Reproduced from Boyle (lYYOb), with permission from

Academic Press.

Table 4 Reactivity of protein A with different human IgG subclasses. IgG (ng) required to inhibit '''I-PrA binding by 50%

IgG subclass

~~~

~

Reproduced from Boyle (IYYOb), with permission from Academic Press. STAPHYLOCOCCAL PROTEIN A

S

E

D

A

B

C

Xr

xc

Figure 4 Diagram of the different regions encoded by the gene for staphylococcal protein A. S is the signal sequence; E, D, A , B and C are the homologous, repetitive, immunoglobulin-binding (Fc receptor) regions. Xr is a repctitivc part of the X region involved in binding the cell wall whereas Xc is the region spanning the membrane. (After Guss et al. (1Y90), with permission from Academic Press.)

100

ROGER HALL

protein G binds serum albumin and a2-macroglobulin with very high affinity. Protein A shares the ability to bind a2-macroglobulin but does not bind albumin. The significance of these latter observations is not clear. (b) Schistosoma mansoni. Fc receptors have been demonstrated on larval and adult schistosomula using sheep erythrocyte rosetteing techniques (Torpier et a f . , 1979; Tarleton and Kemp, 1981). The demonstration on adult worms was more difficult than larvae requiring the use of a sensitive sandwich technique utilizing fluoresceinated S. aurew as described above for the complement receptor assays. The Fc receptors found by Torpier on schistosomula (larval forms) are of great interest because they were demonstrated to also bind to P2-microglobulin. The significance of this is that earlier work had shown that host antigens are adsorbed onto schistosomes (Smithers and Terry, 1976) and the identity of some of these components was demonstrated to be major histocompatibility antigens (Sher et a f . , 1978) which are composed of a heavy chain and a light chain identified as P2-microglobulin. Thus a direct receptor for these molecules has been defined. The ability of schistosomes to mimic functional receptors of the host and use them to coat themselves in host components presumably thereby escaping immune detection offers a subtle twist to the molecular mimicry concept. It is also an explanation (albeit incomplete) for the phenomenon of concomitant immunity whereby infected individuals are unable to kill their existing worm burden but are resistant to superinfection. 2.3. Hormones, Hormone Receptors and Serum Protein Receptors

The ability of parasites to exploit the extracellular hormonal signalling mechanisms of the host and exhibit a growth response represents a very subtle and complex form of subversion. A number of examples of possession of receptors by parasites for host hormones exist and may well be regarded as molecular mimicry par excellence. In addition some parasite surface proteins have domains modelled on hormones themselves providing possible modes for cellular recognition and entry. 2.3.1. Steroid Receptors in Candida albicans Candida afbicans possesses cytosolic binding proteins for the mammalian steroid hormones progesterone, corticosterone (Loose et a f . , 1981; Loose and Feldman, 1982; Das and Datta, 1985) and oestrogen (Powell et a f . , 1984; Skowronski and Feldman, 1989). The progesterone and oestrogen receptors are independent protein molecules. In the case of the progesterone receptor it was found that there was also a binding activity in

MOLECULAR MIMICRY

101

another non-pathogenic yeast, Saccharomyces cerevisiae, but that the activity was only 14% of that found in Cundida (Das and Datta, 1985). Pregnant women, women taking contraceptive pills and persons on glucocorticoid therapy have a much enhanced risk of systemic candidiasis. It is tempting to speculate that this pathogenesis is a response to the steroids mediated through the receptor molecules and forms an adaptation of the fungus to the mammalian host. The gene for the high-affinity corticosteroid binding protein has recently been cloned and sequenced (Malloy et a l . , 1993). Comparison of this sequence to the steroid-thyroid-retinoic acid receptor gene superfamily did not reveal any homology and it must be concluded that this represents a strict case of functional mimicry by convergent evolution. 2.3.2. Epidermal Growth Factor (EGF), Low Density Lipoprotein ( L D L ) and Transferrin Receptors in Trypanosoma brucei African trypanosomes grow in the gut of the tsetse fly vector and in the serum of the mammalian host. During these periods of growth the parasite undergoes a series of morphological and metabolic differentiation events. The cycle in the mammal is initiated by the injection of the metacyclic stage into the blood where a transition to rapidly dividing long slender forms occurs. Growth arrest then occurs on transition to short stumpies which are ingested by the fly where they transform in the gut into actively growing procyclics. These migrate to the salivary glands and arrest as the metacyclic stage before transmission and repetition of the cycle. The bloodstream and procyclic forms grown in culture show an absolute requirement for fetal bovine serum. This serum dependence can be explained if it provides a source of essential growth factors and nutrients. Evidence that this is the case is provided below. Strong evidence has been provided by Hide et al. (1989, 1990) that T. brucei possesses a functional homologue of mammalian epidermal growth factor receptor (EGFR) on its surface. These authors demonstrated that polyclonal antibodies both to pure mammalian EFGR and to synthetic peptides modelled on the external domain of EGFR react with a surface molecule of 135 kDa present on procyclics and bloodstream forms. Immunoprecipitates using these antibodies contained a kinase activity consistent with the presence of an EGFR-like molecule. They also demonstrated that a molecule of the same size present in membrane-enriched fractions could be labelled by cross-linking with biotinylated EGF. Furthermore, it was shown that a growth response to E G F was achieved by serum deprived procyclic forms in tissue culture. Taken as a whole, these data suggest that the trypanosomes are functionally mimicking a host cell EGFR as part of their growth regulation strategy. The precise physiological significance however remains unclear.

102

ROGER HALL

There is very good evidence for the uptake of low density lipoprotein (LDL) and transferrin by a process of receptor-mediated endocytosis in bloodstream forms of T. brucei (Coppens et al., 1987). Several lines of evidence support this. 1. Clearance values for these two proteins were two to three orders of magnitude greater than serum albumin. 2. Both proteins bound to the parasites in a saturable manner and this binding was inhibitable only by the homologous ligand. 3. LDL and transferrin colloidal gold conjugates were efficiently taken up and could be visualized by EM in the flagellar pocket and endocytotic vesicles. Presumably these are the routes whereby this parasite obtains important nutrients namely cholesterol and iron. Indeed, these authors stated that trypanosomes cultured in cholesterol-free medium had their growth rate halved and that after 24 hours in delipidized medium LDL uptake was increased by 40%. In a subsequent publication they demonstrated that the use of lipoprotein-depleted serum extended the doubling time in vitro from 14.4 h to 21.1 h and that normal growth was restored by the addition of LDL (Coppens et al., 1988). Using LDL affinity chromatography a 145 kDa glycoprotein has been purified from T. brucei (Coppens et a l . , 1991) and an antiserum raised against this cross reacts with the LDL receptor derived from rat liver (Coppens et al., 1992). Therefore the T. brucei LDL receptor shares some degree of structural homology with its mammalian counterpart in addition to its functional mimicry. It is noteworthy that other examples of receptors for serum proteins have been reported in protozoa. Thus Trichomonas vaginalis has LDL receptors (Peterson and Alderete, 1984), Trypanosoma cruzi bears high density lipoprotein receptors (Prioli et al., 1987) and transferrin receptors are found on Plasmodium fulciparum (Rodriguez and Jungery , 1986). The basis for all these examples of functional mimicry may be reflected in the structure of the molecules when they are cloned and characterized. 2.3.3. Epidermal Growth Factor Motifs in Plasmodium Surface Proteins Two surface proteins expressed on invasive stages of the malaria parasite P. falciparum have been found to contain motifs remarkably similar to domains found in EGF. One of these proteins, Pfs25, resides on the surface of the motile zygote (ookinete) that is formed by fertilization in the mosquito gut. Pfs25 contains four EGF-like domains in tandem and the degree of similarity is striking as shown in Figure 5 (Kaslow et al.,

103

MOLECULAR MIMICRY

CONSENSUS: PFS 2 5 L I N 12 NOTCH EGF LOL RECEPTOR

i n -x-

-

X G x x x, - C x L x L x x D x K x C

-

- -

B

Figure 5 Mimicry of EGF by sexual stage antigen of Plasmodium falciparum Pfs25. (A) Protein structure of Pfs25 arranged to emphasize the relatedness of the four EGF-like domains. Cysteine residues, and other identical or related amino acids are boxed. (B) EGF-like repeat consensus sequence from Pfs25, lin-12 (Greenwald, 1985), notch (Wharton et al., 1985), EGF (Gray et al., 1983; Scott et a l . , 1983) and human LDL-receptor (Sudhof et al., 1985). Cysteine residues are boxed. A double box frames the core of the consensus sequence. x represents any amino acid. -represents an unspecified number of amino acids. (Reproduced from Kaslow et al. (1988), with permission of the publisher.)

1988). The other protein is MSPl which is one of the major surface proteins of the invasive merozoite. This protein is known to be processed during merogony (Holder and Freeman, 1982; Hall et al., 1984; Blackman et af., 1991; Blackman and Holder, 1992). It is synthesized as a 190-210 kDa precursor which is extensively proteolytically processed to produce a 19 kDa C terminal fragment retained on the merozoite surface and which survives into the ring stage following red blood cell invasion. This 19 kDa fragment contains two tandemly repeated EGF domains (Figure 6) and antibodies directed to this region inhibit invasion. It is tempting to speculate that the parasite is mimicking the EGF structure in both proteins to function in binding to and invasion of the host cell. There are many other proteins known to contain these motifs in which it is believed to function in binding and signalling (Apella et af., 1988; Laurence and Gusterson, 1990).

104

ROGER HALL

Pf gp19

putative GPI attachment

Figure 6 Postulated EGF-like domain structure of MSPl gp19. Schematic representation of gp19 based on human epidermal growth factor structure (Cooke et al., 1987) showing conserved residues (within circles, single letter code is used), non-conserved residues (blank circles), inserteddeleted residues (-), Cys residues conserved in P . fakiparum only (*), and semi-conserved Pro residues (+). The P. yoeli protective mAb 302 epitope (Burns et al., 1989) is picked out using brackets. GPI, glycosylphosphatidyl inositol. (Reproduced from Cooper (1993), with permission of Elsevier Trends Journals.)

2.4. Cytoskeletal and Muscle Proteins

2.4.1. Malaria The malaria parasites have an intimate association with their host red cells. The red cell is normally a rigid biconcave disc the integrity of its shape being determined by the complex series of interacting cytoskeletal components. The ability of the parasite to deform the red cell membrane upon invasion and to cause the creation of a parasitophorous vacuole for its residency is indeed remarkable. Furthermore in the case of Plasmodium fakiparum the schizont-infected red cell has protuberences on its surface (the so called “knobs”) that contain parasite proteins. These “knobs” are mediators of the cytoadherence to capillary endothelia causing the sequestration which underlies the cerebral form of the disease. How is this control over the red cell archictecture achieved? Clues to this are provided by the intriguing homologies that exist between certain malaria antigens and cytoskeletal proteins.

MOLECULAR MIMICRY

105

MSPl, the major surface antigen of schizonts and merozoites, has been shown to have homology to the non-helical regions of intermediate filament proteins such as keratin, desmin and vimentin (Cheung et af., 1986). He points out that the common pattern, extending over 50 residues, is a stretch of glycine- and serine-rich repeats with a large hydr