ADVANCES IN
Immunology
VOLUME 49
This Page Intentionally Left Blank
ADVANCES IN
Immunology EDITED BY
FRANK J. DIXON Scripps Clinic and Research Foundotion Lo jollo, California
ASSOCIATE EDITORS
K. FRANK AUSTEN LEROYE. HOOD JONATHAN W. UHR TADAMITSU KISHIMOTO FRITZMELCHERS
VOLUME 49
ACADEMIC PRESS, INC. Harcourt Brace Jovanovich, Publishers
Sun Diego N e w York Boston London Sydney Tokyo Toronto
This book is printed on acid-free paper. @
Copyright 0 1991 BYACADEMIC PRESS, INC. All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the publisher.
Academic Press, Inc. San Diego, California 92101 United kingdom Edition plbltshed by ACADEMIC PRESS LIMITED 2428 Oval Road, London NWl 7DX
Library of Congress Catalog Card Number: 61-17057
ISBN 0-12-022449-6 (alk. paper)
PRINTED IN THE UNITED STATES OFAMERICA 9 1 9 2 9 9 9 4
9 8 7 6 5 4 3 2 1
CONTENTS
Human Immunoglobulin Heavy-Chain Variable RegionGenes: Organization, Polymorphism, and Expression
VIRGINIA PASCUAL A N D J. DONALD CAPRA I. Introduction 11. Gross Organization of the Human Ig Complex
111. V, Families N.Polymorphism of V, Gene Segments V. DSegments VI. Human JkI Segments VII. Expression of Human V, Gene Segments VIII. Regulation 1X. Conclusions References
1 3 6 21 28 33 35 52 61 64
Surface Antigens of Human Leucocytes
V. HoREJS~ I. Introduction 11. Antigen-Specific Receptors
111. MHC Glycoproteins N.Adhesion Molecules V. Receptors for Immunoglobulins (Fc-Receptors) VI. Receptors for Complement Components VII. Receptors for Lymphokines and Other Growth and Differentiation Factors VIII. Membrane Enzymes IX. Transport Proteins X. Other Interesting Molecules XI. Concluding Remarks References Note Added in Proof
75 76 80 82 89 91 94 111 114 116 118 126 147
Expression, Structure, and Function of the CD23 Antigen
G. DELESPESSE, U. SUTER,D. MOSSALAW, B. BETTLER, M. SARFATI, H. HOFSTETTER, E. KILCHERR, P. DEBRE, A N D A. DALLOUL
149 150
I. Introduction 11. Cellular Expression V
vi
CONTENTS
111. Biochemical Structure
155
Iv. Regulation of CD23 Cleavage
158 158 16'2 167 174 176 177
V. Regulation of CD23 Expression VI. Molecular Biology of FcrRII VII. Biological Activity of CD23 VIII. CD23 Expression in Various Clinical Conditions 1X. Conclusions References
Immunology and Clinical Importance of Antiphospholipid Antibodies H. PATKICK MCNEIL, COI.IN N . C I I E S TER MAN, A N D S T E V E N A. K R I L I S
I. Introduction 11. Phospholipid Biochemistry 111. Historical Background
IV. Clinical Aspects of Antiphospholipid Antibodies V. The Immunology of Antiphospholipid Antibodies VI. The Pathogenic Potential of aPL Antibodies VII. Summary and Conclusions References
193 194 198 200 224 252 257 259
AdoptiveT Cell Therapy of Tumors: Mechanisms Operative in the Recognition and Eliminationof Tumor Cells Ptiii.iP D. GREENBERG 1. Introduction 11. Principles of Adoptive Therapy with Specifically Immune T Cells 111. Mechanisms by Which T Cells Mediate Tumor Rejection IV. Recognition of Distinct Tumor Antigens by CD4+and CD8+T Cells as a Potential Basis for Selective Efficacy of a T Cell Subset V. Accessory Cell, Antigen-Presenting Cell, and Cytokine Requirements for Effective Expression of Antitumor Responses by CD4+and
28 1 286 299
CD8+T Cell Subsets VI. Concluding Statements References
324 332 335
318
The Developmentof Rational Strategies for Selectivelmmunotherapy against Autoimmune DemyelinatingDisease LAw REN CE
S'I'E IN M A N
1. Introduction 11. Multiple Epitopes of Myelin Basic Protein in Mice and Humans 111. Human and Rodent TCR Usage Restriction in T Cells Responding to Specific Epitopes of Myelin Basic Protein
rV. Possibilities for Future Immune Intervention in Multiple Sclerosis References
357 357 363 368 375
CONTENTS
vi i
The Biology of Bone Marrow Transplantation for Severe Combined Immune Deficiency
ROBERTSON PARKMAN 1. Introduction 11. Severe Combined Immune Deficiency 111. Characteristics of Stem Cell Engraftment for the Correction of SCID IV. Histocompatible Bone Marrow Transplantation V. Transplantation with Fetal Tissues VI. Bone Marrow Transplantation with T Cell-Depleted Haploidentical Bone Marrow VII. Lack of Stem Cell Engraftment VIII. Graft-versus-Host Disease I><. Tolerance X. Posttransplant Inmunocompetence XI. Conclusions References
38 1 381 388 392 392 393 396 397 398 399 402 402
INDEX
41 1
CON~ENTS OF RECENT VOLIJMES
435
This Page Intentionally Left Blank
ADVANCES IN IMMUNOLOGY, VOL. 49
Human Immunoglobulin Heavy-Chain Variable Region Genes: Organization, Polymorphism, and Expression VIRGINIA PASCUAL AND J. DONALD CAPRA Deparhnonh of Microbiology and Internal hdicine, Univemiiy of Texas Southwestern Medical
Center, Dollas, Texas 75235
1. Introduction
Five years ago a review of the germ-line structure, polymorphism, and expression of human heavy-chain variable region (V,) genes would have occupied only a few pages. Within recent years, however, there has been an explosion of information available on the genes of the human immunoglobulin heavy-chain (IgH) complex. These genes are located on the long arm of chromosome 14. They encode one of the two chains of the antibody molecule, and, as such, an understanding of their structure and organization is vital to a comprehension of antibody specificity. To some extent it is surprising that it has taken so long for so many immunologists and molecular biologists to have finally turned their full attention to the human heavy-chain complex. Indeed, some of the first human genes isolated and studied were from the immunoglobulin loci. Many of these early reports concerned genes that had been isolated from human DNA by taking advantage of cross-hybridization with probes derived from murine systems. Other investigators utilized those human malignancies from the B cell series to isolate probes that became useful for analyzing the human germ-line repertoire. Despite a number of important insights that derived from pivotal work from the Rabbitts, Givol, and Leder laboratories (Rechavi et al., 1982, 1983; Kirsch et al., 1982; Bentley and Rabbitts, 1983),it has really only been within the last 5 years that several investigators have devoted considerable energy to the fine mapping of this gene complex. Though considerable work still needs to be done, an enormous body of information on the general organization and structure of these genes has derived from several laboratories (Lee et al., 1987; Berman et al., 1988; Walter et al., 1990). The division of human immunoglobulin genes into various families was initially obvious from the protein data, although it appears that significant portions of the repertoire were missed by sequencing myeloma proteins. The reasons for this still remain clouded. However, 1 Copyright 0 1991 by Academic Press, Inc.
All rights of reproduction in any form reserved.
2
VIRGINIA PASCUAL AND J. DONALD CAPRA
using molecular techniques, most of the gene families have now been uncovered and their numbers, location, etc. are slowly being sorted out. A major surprise has been the significant interdigitation of the human V H genes, considering the clustering of similar V H genes in the mouse (Kodaira et al., 1986). Polymorphism has always been a hallmark of the immune system, and some of the earliest insights into the genetics of immunoglobulins were deduced from examinations of the polymorphisms of the constant region of human IgG (hence, Gm markers). Polymorphism in the variable regions was expected and initially was thought to be an explanation for distinctions in immune responses among different individuals. T o some extent, V H polymorphism was thought to be relevant to the notion of shared idiotypic specificities among antibodies with similar specificities in the human population. This latter notion became quite popular as autoantibodies (which have always been a major focus of “human” immunologists’ attention) were studied serologically. The precise molecular basis of these polymorphisms is now in hand and the extent of the polymorphism within each of the human VEI families as well as within the D and J gene segments is rapidly unfolding. How each of the various gene segments ( V H , DH,and J H ) recombine to form a functional immunoglobulin gene and achieve expression as a protein is an area of obvious interest. The advent of human hybridoma technology as well as the use of the Epstein-Barr virus to transform human B lymphocytes has revolutionized the approach to our understanding of the structure of human antibodies. These techniques for B cell immortalization, coupled with molecular biological advances that have allowed the isolation, identification, and structural determination of molecular structures from relatively modest amounts of mRNA, have provided more information on the structure of distinct human antibodies within the last year than the sum total provided by all the myeloma proteins in the preceding two decades. The information derived from such structures provides the opportunity to answer the age-old question in the field of autoimmunity, “Are autoantibodies direct copies of germ-line genes, or are they products of somatic mutation?” A corollary of this question that can now be addressed explicitly is “Are autoantibodies that exist in individual A different from those in individual B because of polymorphism of their VH gene segments?’ Thus a whole panoply of questions concerning the expressed repertoire can now be addressed and referred to the germ-line repertoire in a meaningful way: How is the repertoire developed and expressed at various stages of ontogeny? in various compartments? in autoimmune disease?” These are some of the questions of widespread contemporary interest. “
Ig HEAW-CHAIN VARIABLE REGION GENES
3
One of the most fascinating and rapidly growing areas of molecular biology concerns the regulation of gene expression. Large regions of DNA that were previously referred to as “junk” are now known to contain specific regulatory elements that determine when and in what tissues specific genes are expressed. Immunoglobulin genes and in particular human immunoglobulin heavy-chain genes are no different and contain similar elements. How these regulatory elements are utilized in the expression of human heavy chains may be of considerable importance in the pathogenesis of autoimmunity and hypogammaglobulinemia, and as a target for therapeutic intervention. This review is undertaken in the late summer of 1990 and provides a survey of the major issues involving the organization, polymorphism, and expression of human immunoglobulin heavy-chain genes. Excellent reviews on K and h chains exist elsewhere (Zachau, 1989), and general reviews of antibody protein structures abound (Hasemann and Capra, 1989). Many of the issues addressed in this review revolve around the nature of the genetic control of antibody variability. This has been one of the most fascinating problems in mammalian genetics. Humans, like other vertebrate organisms, appear to be capable of synthesizing an almost infinite variety of antibody sequences and specificities. Within the last decade we have appreciated that rather than having millions of genes encoding antibody molecules, they are encoded by a relatively limited number (probably less than 1000) of gene segments that, through the process of combinatorial joining (different V segments, D segments, and J segments), result in distinct antibody variable regions. Somatic processes act on these genes to provide the organism with an almost limitless repertoire. We shall see that process unfold in most of the discussions within this review. II. Gross Organization of the Human lg Complex
The IgH cluster has been mapped to chromosome 14 (Croce et al., 1979; Shander et al., 1980), band 14q32.33 (Kirsch et al., 1982; Cox et al., 1982). Based on 8;14 translocations in Burkitt’s lymphoma cells, the order is telomere-VH-DH-JH-CH (Fig. 1). The locus contains 100-200 variable region ( V H ) gene segments, over 20 diversity (D) segments, 6 joining ( J H ) segments, and a constant region complex (CH) of 9 functional genes ( F , 6, 73, y1, ( ~ 1 ,y2, y4, E, and CYZ) and 2 pseudogenes ($E and @y)(Schroeder et al., 1988; Sat0 et al., 1988; Honjo et al., 1989; Capra and Tucker, 1989; Hofier et al., 1989). The recombination of VH, D, and JH gene segments occurs early in B cell
VIRGINIA PASCUAL AND J. DONALD CAPRA
4
A.
m T m ............
Chr. 14
1111~
LiJ a ........... _._....................... ....... ...... ................-.. ................. ..........
B.
@OO)
"H6 (>20)
-v-"D"lu4 regions
segments
8
:
88
50
Y3
Y1
n u
n u
Qqa1 yy
26 19 13 25
u n
72 Y4
E a$
n u
nu
u n
30 18 23 10 Kb
FIG.1. The organization of Ig heavy-chain genes. The banding pattern of a Ciemsastained human chromosome 14 is shown in A indicating the position of the heavy-chain gene cluster. The overall organization of the locus (without the fine exon structure) is shown relative to chromosomal orientation in B. Known distances separating gene segments are denoted below in kilobases. Pseudogenes are designated by $. Adapted from Capra and Tucker (1989).
differentiation and, along with the light chain, determines the binding specificity of the antibody. The CH regions mediate effector functions, such as the ability to activate complement or cross the placenta. The total size of the locus has been estimated from pulsed-field gel measurement to be 2500-3000 kb (Berman et d., 1988; Matsuda et d., 1988;Walter et al., 1990).However, with certain exceptions, a precise map, particularly of the VH segments, is lacking. Serologic studies long ago established that the entire group of constant region genes was tightly linked, based on many family studies wherein recombination rarely occurred between those genes for which polymorphic serologic markers were available. More recently, similar studies have been done with restriction fragment-length polymorphisms (RFLPs) as well as allele-specific oligonucleotide probes (Ghanem et al., 1988; Bottaro et al., 1989a,b).Structural defects within the constant region have become common findings (Bottaro et al., 1989a; Hendriks et al., 1989; Huck et al., 1989). Probes are now available for an extensive analysis of the human Ig complex, including probes for switch regions (Keyeux et al., 1989a,b; Soua et al., 1989). That the variable regions were closely associated with the constant regions has obviously been known for years. However, only recently have V, D, and J gene segments been linked to constant region genes in a formal way. Walter and Cox (1988,1989) mapped VHV genes using two-dimensional DNA electrophoresis, and several laboratories located a human VHVI gene less than 100 kb from Cp. Buluwela and Rabbitts (1988)used cosmids covering the entire region and described
Ig HEAVY-CHAIN VARIABLE REGION GENES
5
VHVI as the first functional VH gene segment of the IgH locus closest to D and J H . These studies actually preceded the first linkage ofV, D, and J in the mouse (Christoph and Krawinkel, 1989). Schroeder et al. (1988), using pulsed-field electrophoresis, identified the VHVI gene only 77 kb on the 5’ side of the JH locus and immediately adjacent to a set of previously described VH gene segments. Similarly, Berman et al. (1988), again by pulsed-field electrophoresis, identified VHVI as the D-proximal VH gene segment, as did Sat0 et al. (1988).Thus, VHVI was mapped D proximal by two independent means-overlapping cosmid clones and pulsed-field electrophoresis. Upstream of VHVI, members of the “multiple-member” human VH families (VHI-V) are extensively intermingled (a discussion of the VH families follows in Section 111). This interdigitation was first apparent for VHI, VHIII, and VHIV from the large number of isolated cosmid clones (Kodaira et al., 1986; Lee et al., 1987) and lambda clones (Berman et al., 1988; Berman and Alt, 1990) that contained members of different VH gene families. This was in marked contrast to the situation in the mouse, in which typically both lambda phage as well as cosmid clones contain only single VH genes, and if two genes are found on the same clone they invariably belong to the same VH gene family (Meek et al., 1990). However, in human systems, several investigators have reported that frequently a single recombinant clone contains members of different VH families. Further analyses using pulsed-field gel electrophoresis demonstrated interdigitation of all the multiple-member VH gene families across the entire VH complex. At the present time it is estimated that the entire human VH complex is contained within 2500 kb. However, the size is subject to several assumptions, including the possibility that there is a large section that has been duplicated as well as the possibility that there may be a large section with few, if any, VH genes (T. Honjo, personal communication; Walter et al., 1990). Much of the information concerning the gross organization of the human VH complex was actually derived from studies on human D segments from several laboratories (see Section IV), in which it was established that the D region exists in the human (again, unlike the murine situation) in several different clusters, and, in particular, some clusters are interspersed between VH gene segments. Although perhaps varying in degree, interdigitation is found in the murine VH locus and in the human VKand some of the T cell receptor loci. However, the widespread interspersion of divergent VH genes seems characteristic of the human VH locus (as it does of the rabbit VH locus). Berman and
6
VIRGINIA PASCUAL AND J. DONALD CAPRA
Alt (1990) have postulated that the extensive intermingling may be a random by-product of evolution or may confer some selective advantage to a particular antibody response. The most extensive studies of the human V H locus have been carried out in the Honjo laboratory (Sato et al., 1988; Matsuda et al., 1988, 1990), where a major effort has been undertaken to study the organization of variable region genes of the human immunoglobulin heavychain complex b y cosmid cloning. I n the course of the analysis, the translocation of several human VH segments to chromosome 16 has been discovered. Several of these “orphon” VH segments were sequenced and some were found to be “functional” whereas others were pseudogenes containing both nonsense and frameshift mutations in the coding regions as well as diverged recombination signal sequences. One (B65-3) was nearly identical to a functional gene (15-1) reported by Berman et al. (1988).Though these orphon genes are devoid of D and J gene segments and are likely not functional, this conclusion must be tempered with caution as there are increasing reports of a transchromosomal association of immune receptor genes. The finding of orphon genes among the human VH genes is reminiscent of the situation in human VK (Zachau, 1989). In addition, it has been reported that some human constant region genes exist on chromosomes other than chromosome 14.
111. VH Families
As soon as immunoglobulin heavy-chain variable regions of the first few myeloma proteins had been sequenced at the protein level in 1969 and 1970 (Edelman et al., 1969; Cunningham et al., 1969; Wikler et al., 1969), they were arranged into V region subgroups (Wang et al., 1970; Capra, 1971; Kehoe and Capra, 1971; reviewed in Capra and Kehoe, 1975). T h e first sequenced protein (Eu) became the prototypic member of the VHI subgroup, and proteins Ou, He, Daw, and Cor were designated VHII, as they were related to each other and were distinct from the Eu sequence. Later, proteins Tie, Was, Jon, Zap, Tur, Nie, and Gal were sequenced and formed the VHIII subgroup. Unlike the numbering in the constant regions, wherein subclasses are by convention numbered based on the percentage of total IgG in normal serum (i.e., IgGl > IgG2 > IgG3 > IgG4), in the variable regions, the convention has been to name subgroups based on their order of discovery. Thus, nomenclature for VHI, VHII, and VHIII does not imply freq u en cy .
Ig HEAVY-CHAIN VARIABLE REGION GENES
7
By the time the first nucleotide sequences of human immunoglobulin heavy-chain variable regions (circa 1980-1982) became available, almost 100 human myeloma proteins had been sequenced at the protein level and they fell rather neatly into three V region families. It is important to appreciate that the frequency of expression of each family cannot be estimated from the published sequences, as there has been considerable selection of the proteins that were sequenced. Actually, this selection bias became operative after the first six sequences were published (one VHI, four VHIIS, and one VHIII), as these six sequences were done prior to the era of automated sequencers. The large number of VHIII sequences that appeared in the literature from 1970 to 1980 is largely a reflection of automated-sequencer bias rather than the notion that the VHIII family is the most frequently expressed VH family in human immunoglobulin variable regions. At the protein level, it was relatively easy to distinguish the three original families of immunoglobulin variable regions. In their first framework area (position 1-30), the distinctive amino acids characteristic of each family were well known and appreciated. Variations from these “prototypic sequences” were clearly noted and ascribable, depending upon one’s theoretical orientation (germ line versus somatic), to either additional copies of germ-line genes within the VEIfamily or to somatic mutation (reviewed in Capra and Kehoe, 1975). In the early 1980s, the first nucleotide sequences of human immunoglobulin variable region genes became available. These sequences corresponded to the protein sequences of VHI, VHII, and VHIII, and because these had been isolated in a “random” fashion it was generally felt by the mid-1980s that human variable regions consisted of three families of molecules (Rechavi et al., 1983). It should be emphasized that the terms VH subgroup, f a m i l y , and clan are strictly operational. In previous years the terms had intense emotional impact, as the germ line versus somatic theories of variability in a sense forced the original definitions of these groupings of variable region genes. The more families there were, the more genes there were, and, therefore, these distinctions became critical for theoretical arguments for antibody diversity. This is no longer the case. We now know that mammalian genomes contain from 100 to 1000VH genes and that the majority of diversity occurs through somatic processes, although the number of germ-line genes is considerably more than had been anticipated in the 1970s and early 1980s by the serologists and protein chemists. Though there is no universally accepted definition of a VH family, molecular biological techniques allow a convenient separation that
8
VIRGINIA PASCUAL AND J. DONALD CAPRA
follows fairly nicely a mathematical definition; that is, V H gene segments that cross-hybridize by Southern filter hybridization under standard conditions (0.1X saturated sodium citrate, 0.1% sodium dodecyl sulfate, 65°C) are members of the same VH gene family, whereas those VH gene segments that do not cross-hybridize under these conditions are members of a distinct V H gene family. In practical terms, this means approximately 80% nucleotide sequence identity places two genes within the same family and less than 70% nucleotide sequence identity classifies molecules as belonging to separate V H families. The few sequences within the 70 and 80% identity range (and there are surprisingly few) serve as subject for discussion, but in neither an operational nor a theoretical sense are they of particular importance. Immediately after the first group of VH genes was available, several laboratories screened human cosmid and phage libraries to address issues of VH gene organization. In one of the initial reports (Kodaira et al., 1986), 23 different cosmid clones of the human heavy-chain variable region genes were described. These encompassed over 1000kb of DNA and contained 61 VH gene segments. The genes were linked into several different clusters, one of which (cluster 71) was analyzed in detail and contained seven V H segments arranged in the same orientation, albeit with different intervals. The striking finding from this study was that the cosmid clones invariably contained genes from two different subgroups (VH families), and in toto, of the 61 clones, 23 were VHI, 8 were VHII (all were later reclassified as VHIV),and 30 were VHIII. Almost half of the genes encountered were pseudogenes. A. THEVHI FAMILY As mentioned above, the VHI subgroup was originally described in 1969 with the protein sequence of the Eu protein (Edelman et al., 1969). In 1980, the first nucleotide sequence of a human VH gene was homologous to the VHI Eu protein sequence and, thus, the VHI gene family was described. Southern filter hybridization studies using the VHIprobe revealed multiple hybridizing restriction fragments of varying intensity. At the present time, 16 human VHI germ-line genes have been sequenced from several laboratories (see Fig. 2). The exact number of VHI gene segments is not known and estimates range from 25 to 200 (Kodaira et al., 1986; Walter et al., 1990). Like the situation in the murine J558 gene family, the number of bands on Southern filter hybridization is “too many to count” and it is impossible to determine by this technique whether individual restriction fragments contain one or more VH gene segments. From several studies it appears that nearly 50% of human VHI genes are pseudogenes (similar to the situation in
Ig HEAW-CHAIN VARIABLE REGION GENES
9
VHIII-see later). Additionally, the number of VHI genes is rather comparable to the number of VHIII genes (again, see later). Thus, the VHI family could potentially provide nearly 50% of the total immunoglobulin repertoire. However, as will be discussed later, for reasons that are not entirely clear at the present time, VHI-expressed antibodies are underrepresented. As can be seen in Fig. 2, and as has been deduced from both serologic protein as well as nucleotide sequence data, the VHI family can easily be subdivided into several subfamilies. The operational need for such subfamilies, etc., is debatable, but is useful in discussing related sequences. These distinctions obviously relate to the evolutionary origin of such V H gene segments and the relatedness of expressed antibodies (see later). Figure 2 shows the nucleotide sequence of the human VHI genes isolated and sequenced from genomic DNA. Of the 16, only 6-7 are apparently functional ( V ~ 1 . 1was originally reported as a pseudogene but appears functional to us). The nine pseudogenes are variously crippled; most contain frameshifts or defective recombination sequences. If one just focuses on the functional genes, certain patterns emerge. There are “linked substitutions,” suggesting subfamilies as discussed above. Also, the major area of coding region variability is in the complementarity-determining regions (CDRs) (See Fig. 2). In Fig. 2, the last triplet of the coding region is shown as AGA, with two nucleotides “split out” (usually GA) prior to the heptamer (CACAGTG). The GA is variably used in expressed antibodies. Issues of polymorphism within the VHIfamily will be addressed in a later section. Suffice it to say at this point that the precise number of VHI genes is difficult to address because very similar VHI nucleotide sequences reported from different laboratories could be explained by allelism and/or by the very well-known process of duplication of VH genes with slight isotypic variation (i.e., VH.21-2 versus VH3-1).Additionally, as will be discussed below, the number OfVHI genes may vary from individual to individual. There is now firm evidence that certain VH genes have been “deleted” in some people (see later). B. THEVHII FAMILY The VHII family was also described first at the protein level and was indeed the second VH sequence reported (Wikler et aZ., 1969). At the nucleotide level, the first VHII gene was reported by Takahashi et aZ. (1982, 1984) and is referred to as VCE-I. It was isolated from a rearranged gene in a B cell tumor. By Southern filter hybridization, between 10 and 25 VHII V gene segments are evident (with the same
10
VIRGINIA PASCUAL AND J. DONALD CAPRA
21-2 3-1 7-2 ha1263 HG3 122-1 115-1 8-2
*
om *no1 +Wl-5 *Wl-7 IV65-1 1 V65-3
**
+1 21-2 . t c a l A E t c t 3-1 / 1-2 - t - c - a - c - v a - m - A ha1263 t-t-a-c--/ K;3 * / c v -a-t--t--a/-A 1 1'7 :----ea-t---t--a-/-A C 122-1 .--c-a--a-/----C A $15-1 .--c-atcc.--a-/---C T 18-2 . - t - - c - a - c - c - - c - a - / P c--c-a-c--t-ta-/-C--A-A $no1 .-t-caa-c-cca-t+-a-/+T m #v11-5 P -a/A -tc-a-c.+ ~ 1 - 7 .-a-q-c--a-/1v65-1 . - c - a - c - a - t - a - / - - - C - A ~ G . - G lyV65-3 .--c-a.-a-/-+ T
..
a
-.... ----T-c-
7-2
ha1263
122-1 115-1 98-2
.----.... .-
d
****-******
-
"
-
A
c
d m
-
A
Y
.. -.. -..
, "
21-2 3-1
-
-
.
.
-
----,.-n
A
A
4
-
.
-
n
m
-
1
n
A
A
-
- -
I
-
T
C----c
-- - -............................
P
....
.... d - C G - - a : .-.. ....-A
... ..
-
--
I
AaACAA - - . P - A ! l T - T
I
x.
--IL--------. A- - . ---T--....---me
-*
.r
" .
-I
AA -+ *m w.... 9no1 W71-5 Wl1-7 W65-1 W65-3
.-....+-A-. -A+-. --T-.
...P A - - T - C 4 c ... P A - A - A - A - A"- - "- , ... " . . ...A, "
- G d - - F - - A * ~ m n 3.
-
-AA
I "
, " " .
P
-
PA C
A
FIG.2. V H I germ-line gene sequences. Leaders, coding, and heptamer/nonamers are in capital letters; introns are in lower case. CDRl and CDR2 are denoted by asterisks. Here - 19 is the beginning of the leader, + 1 is the amino terminus of the expressed heavy chain, and 99 is typically the final amino acid of the V H gene segment; 21 -2,3-1, 7-2, and 1-1 are functional V H I genes reported by Berman et al. (1988);ha1263 is a functional V H I gene reported by Chen et a / . (l989a); HG3 is a functional V,,I gene reported by Rechavi et al. (1983); V,, is a functional V H I gene reported by Matsuda et al. (1988); 22-1, 15-1, and 8-2 are pseudogenes reported by Berman et 01. (1988); HA2 is a pseudogene reported by Rechavi et a / . (1983); V201 is a pseudogene reported by Takahashi et al. (1984); V71-5, V71-1, V71-5, and V71-7 are pseudogenes reported by Kodaira et al. (1986); and V65-1, V65-3, V65-I, and 665-3 are orphon pseudogerles described by Matsuda et a / . (1990).
P
11
Ig HEAW-CHAIN VARIABLE REGION GENES
............................. 21-2 3-1 7-2 hub3 ffi3
27
*22-1 $15-1 $8-2 y lm
lV2Ol pvll-5
ZEF
gg
Ncnmaer
*********
21-2 3-1 7-2 ha1263 ffi3 $22-1 $15-1 w-2 WLU
two1 Wl-5 Wb5-1 Wb5-3
T-----C -Ad-AC+A-
o -A-a-.-.-m+ T-
--TFF3Z
FIG.2-Continued
caveats as described for the VHI family as to what this means in terms of actual gene numbers). Kodaira et al. (1986) isolated eight VHII genes in their original genomic library, but they have been reclassified as VHIV (see later). The number of expressed genes using VHII sequences is relatively few, and like VHI, VHII seems to be underrepresented in the expressed repertoire. Walter et al. (1990) estimate by pulsed-field electrophoresis that there are only five VHII gene segments.
C. THEVHIII FAMILY The first VHIII family member was the Nie protein sequenced in the Hilshmann laboratory. At the DNA level, the first VHIII sequence was isolated from a B cell tumor. At the present time, the VHIII family is thought to be the largest VH family, being larger than the VHI family by a few genes. The VHIII family is the .most extensively studied and sequenced. Honjo's laboratory originally described 23 different VHIII gene segments (although some could have been alleles), and Berman et al. (1988) and several other laboratories have now described 25 VHIII genomic sequences. These are shown in Fig. 3 and are compared with hv3005. As in Fig. 2, the sequences are depicted from the
12
VIRGINIA PASCUAL AND J . DONALD CAPRA
-19 Intrcn** hv3005 4 / g t g a - w w = = w a w 3 a ~ c = ~ . .ts aSJ2 / 1.9111 / 9-1 AU-A-A-/-t t-a--q------g-12-2 m A----CA-/-t-.-tkgt-a--q-q-aq. 13-2 --T-----A-A+-/ t-t-,-a.i-ag+A -A -/-c-J-& -t-t 8-lB m .--t--/A -A -A .-t-. 22-29 H11 --A-A-/-------t---W--aq--qW 6 C--~-~----A-/a-t-a-a-a-ta-q-t-a-g-aqvH19 V65-2* -/A A -A -t-ta3-----3--aqV65-4* A P A - A - / - - - - - - t P .q. .------t-gCq", lyvH105 __C A--OA-/--tq-. .t--a---aB-g-aq115-2B A-A-A-A-/-tv.. .a--cat--g-q-----t~aq1 2-3 ---T-O2--A-A-/-a-.tt--a-t-=-g-t-a--q-ag-
....-
--
-
--
-
... ...
+ 3033
-
"
+ 2.9111 +VIl-l lyvll-3 lyvll-6
--W----A------
-t-/A--A__C
-- A
34W6
1hv3.3
-
W
P
*+m ... ..... ....-.
-
A
-.*. .
..........-zkq---t-a--t-cacty--aq-
-A-/--.
---
/---t-----
q-t-a-g-aq-
tst-----¶-----3-----s-a9.---J-1-
.... ....
.... ... ... .... ...
~
.
* * * +
+
... .... .... .... ...... . ..
---. -.... --. .... ... . .... ... -.
..
~A~A-/------g--t4-tt--a-~t~-. -q-aq---?L--A------A-G/ a q -¶ ------¶ -9 ---------t + A - / a-ct-qctqatgac-a-t-aagcaga-tat-ttq?=ag. m A-A-/ t
**
m**
hv3005 . a q . q c a t t t t c t q a t a a q q . - t t q c . a q / p . p GET2 1.9111 9-1 -a-. --q----actta-. -teq--. .-/12-2 . a - - q - - - - a = - . - - t e q - . - / ~ . ~ 13-2 T-a-. -a----&ttt-.--tcg-----. 8-lB -a-. .-at-. -c-t. . g - - - - . - / ~ - . 22-25 a-a-a-. .--q----ct-.-t--~-g-/ r H11 --g-. ---q------Oz-q-. .tqt-q------.-/ -A- - . W 6 -a-. . - - q ~ . - q - t - t - t - - - - . - / ~ - . ~ vH19 /------o---. V65-2' a q - a - a b g t g t . - a - - - - m t t t - . - ~ / - - - - - - - - - D + . A +-+---V65-4* a. a. . - . a t a ~ ~ ~ - ~ - q - t . - - ~ g ~ / ~ ~ ~ . " m 1 vH105 --g-. .--q---+.-tc?g-/ 15-25 a-a-a-. ---q-~--teq--. A .+ /-A V + 2-3 --a?. -q-. T-t-t-t-. .G -- / 3033 -a-. --q----x-.--g-t-t-t-----.-/-------o--. $2.9111 -aa-c-----cc.~-acactacaa-../~A-. AA-A-AA--A+ wl-1 , --q---ixtt-. -t-q----. -/ - A 1W1-3 .--g-----ccg-. --tocq----.-/ m 1wl-6 --q-------cc-q-.tqt~-.-/----. + W 6 v.. ---g-g-, --tcg--. -/ m LL'hv3.3 -q.. ---q---.CtYl-.-tc-q----/ GAv3 ---g----cixg-. -teq----. -/------o---. vHB - ~ - ~ - g - . - t e q - - - . - / ~ ~ 4 ~ - - . ~ ~ - A -
--.
.-
.-.
..-/----. -/---.
.-/-
_-
.
.
-
--
.
=
T
AA-
7
-A
m
7
A -A
7 A
m
A X '
T
A+ -A -A
-A -A
T A-AA-AI
-A
-
m
FIG.3. The human VHIII germ-line gene segments: ho3005 and CLSJ2 are functional genes reported by Chen (1990); 1.9111, 9-1, 12-2, 13-2, and 8-1B are functional genes reported by Berman et al. (1988);22-B was originally reported as a pseudogene by Chen (1990) but appears normal. V ~ 2 is6 a functional VHIII gene reported by Mathyssens and Rabbitts (1980); VH19is a functional VHIII gene reported by Baer et al. (1988); If11 is a functional VHIII gene reported by Rechavi et al. (1983); V64-2 and V65-4 are functional orphon genes reported by Matsuda et al. (1990); V"105, V71-1, V71-3, and V71-6 are VHIII pseudogenes reported by Kodaira et al. (1986); V15-2B,2-3,3003, and 2.9111 are VHIII pseudogenes reported by Berman et al. (1988); V"D26 is a VHIII pseudogene reported by Buluwella et al. (1988); ho3.3 is a VHIII pseudogene reported by Turnbull et 01. (1987); V3 is a VHIII pseudogene reported by Matsuda et 01. (1988); and VHBarn(VH*)is a VHIII pseudogene reported by Baer et al. (1985).
.-t -
****
*****+CORl*****
moo05 f
-.--..-
f
-
i
.
6
GIs2 ., 1.9111 W A 9-1 T-cx c -a---cA 3 12-2 -.ffi ., Gc A A -13-2 C I 0-18 . B ffi 22-29 -.K -A*-Xlc- - c m1 3 m n -I r-c------c--ffi W6 I wfl9 -.-3 A*-ACA -A C A P A T G m V65-2* . P A AA -A V65-4* G LA m - % 3 - A ., m I C 1wfl05 . m 115-29 -.ffi A-C-CTAC-C-AC C A-...... 12-3 -.ffi TA--cTAc-m C A-Aa 13003 -ffi C C-O----DA-A-QT c Q2.9111 C AP -GC - &W - K! " A d + 1w1-1 3 -A-A 1Wl-3 - A = T P A A P m ., C $Wl-6 -.ffi CCICX: (-6 A-.-GA-C-CI%C-PA---G--A..LA-GF c " 1hV3.3 -A..G-----------------__--*A - . Y A - - - - - T A GA-c-cmc--.A--G-A-ffi.-AQF
-
-.
I
-
- ..-
--
I.
-. -.= -.
I
-
--. I
( . -. -.
- .-
A
:3 -.
m
-., I
-
-. II
3.
-
,. -
-A-A- 4
- 1
***********************YIRII.++*+r************************** hV3005 P GIsJ2 m 1.9111 9-1 ( r - ? G C A - A . W I G A ~ < r A - A . A 12-2 G - - C l % - A - C A - A + t C ~ - C - G - A - - C ~ A . A - A d A m m -____ -A 13-2 .-C m " 8-18 +Am-. .-C A. m . 22-9 TAC-4?Gl%--. T H11 (rTAc-. .cDcIu3i--.------------aG W6 -G-......-P < m I " c w19 +44wFaa---c-...... a 4 m m ., -I v64-2* P 4 m V65-4* T A C - m A - A - . .+A ., 4 P A m @ a 0 5 -AC-m-. C 4- C m . 115-29 - M Z W - - A - - A P A - . P $2-3 ~A-CA-A~A~-C~A~-A-A.-A-A,,A,,, 13003 W ~ A - C A - A ~ A - G U X W A - A ~ ~ A - - A . A - A I U A $2.9111 -A-X-C-A+-.A-A-A. A --_---_ Iyvll-1 4 . -A0 - A m C A C 1vll-3 . -Am c I r m I $vll-6 - A C - m - . C Q W 6 ~ A - ~ A - C A - A + A C ~ * A ~ - A - A . ~ ~ A - A m . 1hv3.3 TAC-C+-Fcm*m.+...&x-.-.n QV3 P A - " - . ' + A C ~ - G - A ~ A - A ~ A - A lWB ( r ~ ~ ~ ~ A ~ ~ A A . . C A ~ A A A -
-...... ...... ......
....... ....... ..... ..
.--
-
-
--
......... ....
-
,.
-
-
. I
-"
...... ......
.
-
--
.-
%zF ........... -- GA -m-m .............GoGAuL ............A-C-C-- A ........... - -g-g----aI........... .--To - -c--g-----q............ 44- - ______oA-A ........... .--o-g- t ..,. ........... .+ - -g----a ............-A .- -.a-a ............-A .- u 0 . ........... . - A--O--a--tc-9--ag--a -.A ............-A -. ........... .+A- - C---a-a--g--+g-
mow5 A
S 3 -. n -. -.A--<-.A-A-C . A 3 --. --. -.A -A--- .
-2 1.9111 9-1 12-2 13-2 8-18
NmauRr
*********
P Tmcnx
.
I
22-9 Hl1 W 6 vH19 m V65-2* V65-4* 1 W 0 5 C. ixwmxaa*-G-q-a 115-29 -.A .+AC- G -g -a -a -$2-3 -A-A-C .T-c J -q a '--' 13003 A-A-C .T-c---y----a-I 12.9111A-.-3 C- +A--aa-ca--a1W1-1 -.--A1-. .+A.y*vll-3 . %? A +A-..-----a l W l - 6 c-. 4 A-<.Ic-G -.--gVVw26 A -.A -C -1hV3. 3 -.-__I=. - - - - - C - ~ -T-a --.g --
-
" , . I
-. -.-
.
-l'-C-A-A-CA--C-
........... .......... =-------.. ....................
.-
.......... -. . ............ ........... ............+ ................. -............ ........... --g-t-aaz-q-----t. .<-Ma
FIG.3-Continued
-
t
~
~
~
14
VIRGINIA PASCUAL A N D J. DONALD CAPRA
beginning of the leader at amino acid - 19 and are shown through the heptamer-nonamer. The CDRs are indicated, as are the splice sites. All nucleotides that are identical to the hu3005 sequence are indicated by a dash, and deletions are indicated by dots. Some genes have not been completely sequenced (pseudogene 3003). The striking features of these sequences are both their similarities and their differences. Note, for example, that some are virtually identical in their coding regions (e.g., hv3005, 1 . 9 I I I , and GLSJ2, which differ in C D R l and CDR2 and just before the heptamer). Otherwise they are over 99% identical. They are listed as separate germ-line genes in Fig. 3 and indeed most individuals have all three of these genes (see Section IV). For the other genes it is not certain that they represent separate germ-line genes (loci) or if they are alleles. That is, the difference between allelism and pseudoallelism is not clear, barring only a few exceptions in the human system. Besides the striking similarities of these sequences, there are obvious “linked substitutions.” This is evident from simply scanning the sequences, many of which, for example, in the leader area, share the T, A, and A. This same group of genes tends to share a G just at the end of the leader. These kinds of relationships undoubtedly represent the evolutionary origin of these genes, and clearly they must have evolved from a common ancestral VHIII sequence. As was evident in the VHI genes and as will be evident among the VHIV genes, members of the same VH family may be different lengths. Typically these length differences are seen in CDRs (i.e., see CDR2 in Fig. 3) or in the leader intron (see Fig. 3, where there are several examples illustrated). A large number of pseudogenes in the VHIII family is seen, as of the 25 genes shown, only 11 appear to be functional-2 are human orphon genes and 7 are pseudogenes. Because the two human orphon genes are unlikely to be functional, over 50% ofthe genes in the VHIII family are pseudogenes. A majority of the distinctions between these genes result in amino acid sequence differences, especially in CDRS, but in C D R l as well. Though there are obviously a number of framework differences (see, for example, framework 3),as was originally suggested by D. Givol over a decade ago, the majority of the variability in the germ line is similar to the majority of the variability in the expressed genes. That is, selection has occurred both at the germ-line level (in evolution) as well as in expressed antibodies (during an immune response), largely in the hypervariable regions. There are from 30 to 200 VHIIIgenes, depending upon how one does the calculation. Their diversity seems more extensive than is the case for any of the other VH families; some VHIII members, falling out ofthe
lg HEAVY-CHAIN VARIABLE REGION GENES
15
80% homology category, could be described as belonging to different VH families. The large number of pseudogenes determined in both the VHI and the VHIII families has prompted discussion concerning the use of these genes as potential donors for gene conversion events. The unequivocal demonstration that such conversion takes place in both the chicken (Reynaud et al., 1985) and the rabbit (Knight and Becker, 1990) provides impetus to search for such mechanisms in the human VH system. The fact that several pseudogenes seem to be conserved suggests that they may have some role in the expressed repertoire. D. THEVHIV FAMILY Lee et al. (1987) defined the human VHIV family from two nucleotide sequences, originally described b y Kodaira et a2. (1986), that did not seem to relate in any significant way to VHI,VHII, and VHIII. Using a probe isolated by a gene that was adjacent to a VHIII gene, six additional variable region gene segments were defined. They were more than 90% similar to each other but less than 70% homologous to members of the three known VH families (VHI,VHlI, VHIII). Lee et al. (1987) estimated that the human VHIV gene family had a minimum of nine members. Thus the first of a number of “smaller” VH gene families was described only 3 years ago. Since that time, at the germ-line level, VHIV genes have been described by Berman et al. (1988) and Sanz et al. (1989a). The original 7 members have now been expanded to 10, with a few more likely to be described, as there are some restriction fragments on Southern filter hybridization that do not appear to correspond to any of the sequenced genes. The VHIV family is most closely related to VHII, and, in retrospect, some protein sequences described as VHII could be redefined as VHIV (see Hasemann and Capra, 1989). In retrospect, v H 5 , a VH transcript found in a human T cell line by Baer et al. (1988), is a VHIV gene and is identical to v ~ 4 - 2 2of Sanz et at. (1989a). Of the nine VHIV gene segments sequenced, only one is a pseudogene. Recently Walter et al. (1990) estimated that there are 14 VHIV gene segments. The VHIV gene family was the first of the human VH families to be nearly completely sequenced at the nucleotide level and allows for certain evolutionary relationships to be appreciated. The VHIV family likely arose by duplication of a common ancestral gene, giving rise to the two large clusters that have as their major distinction a length difference in CDR1. These two groups of genes effectively give rise to all the other known sequences, which, by and large, differ within the
16
VIRGINIA PASCUAL AND J. DONALD CAPRA
10
20
30
40
50
60
70
80
90
100
V7l-2 VH4.12 .......................................c-.. A.. .A. v2-1 .................................................................................. A....A.. VH4.18 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . TA ----A ---~~~--~.. VH4.22 ............................................... C.......G....TA..A...A. .. V12G-1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. . . . . . . G . . . . T A. . A . . . A . . . 1-911 ............................................... ......C.......G........... TA..A....A.. VH4.13 ............................................... ......C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A.....A.. VH4.14 ......................................................................................... T-.. . V71-4 .................................................................................... A-.--l... . VH4.11 .................................................................................... A-..-T-.. . VH4.15 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C . . . . . . . . . A . . . l . VH4.16 ................................................................................... A....A.. v11 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. . . . A . . . VH4.17 ................................................................................... A. ....A.. VH4.23 ........ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G.-.-.-A------G---.--.~ ..... V58 ..........A..C..G..G.... ....l ......................... G....A...G..T.. (... . VH4.21 .......................................... C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A.. v79 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G . . . . . . . . . . . . G . . . . . . A. . . . . A . . VH4.19 110
120
130
140
150
160
170
180
190
200
A C T A C T G G A C C T G G A T C C G C C A G C C C C C A G G G A A G G G A C ~ G A G V71-2 VH4.12 ..............................................G.... ........G..........C.................G...............AG.........T............l.......... ......G v2-1 G.... ..........C.................G...............AG.........T............T..........G........... VH4.18 .... . G . . . . G . . A G . C l . . l . G . VH4.22 .GC......C.T..l.G.. V12G-I ...GG. ..G..............................................C........T............T..........G........... 1-911 ...GG. .G............C..T...l...G... VH4.13 . . . G G . .............................................................................................. VH4.14 .................................................................................................... V71-4 .................................................................................................... VH4.11 .................................................................................................... VH4.15 .................................................................................................... VH4.16 ...GG.........G....C.................G...............G.A......C.T.......A.C.............G........... v11 .GG...G.C...G...G.A.C.T..C...G.. VH4.17 ...--.. ............................................................................................. VH4.23 .....................................G..........................l...............A................... V58 ........ ............................................................................................ VH4.21 ...GC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v79 ...GG.....T. ..G....C.................G...............G.A......c.T.......................G........... VH4.19
210 V71-2 VH4.12 v2-1 VH4.18 VH4.22 V12G-1 1.911 VH4.13 VH4.14 V71-4 VH4.11 VH4.15 VH4.16 v11 VH4.17 VH4.23 V58 VH4.21 v79 VH4.19
220
230
240
250
260
270
280
290
TCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAG~TGAGCTCTG~GACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGA ......................A..........................................C............................ .. ....................... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ...............................................C..A........T.................. ...............C... ..................................................................C..A........................... G . C. T.. .G. .......C.T....
............ ...G .......l.C........... ...... ...GC.lC.......G. ................................................................................................. ................................................................................................. .................................................................................................
.................................................................................................
............ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
................... ....A..........................................C.............................. .................. .....A..........................................C.............................. ...... . . . . . . . . . . . . . . . . . . . . . . . ...c...c..c... ...... ..l..C....... .......................A..........................................C...................G.......... .......................A.. ..............C....................
FIG.4. The human VHIV gene segments. Twenty sequences are shown, although they probably represent only 10 different germ-line genes. V71-1, V2-1, V12G-1, V71-4, V11, V58,and V79 are from the original description of Lee et al. (1987); 1-911 is from Berman et al. (1988) and the rest are from Sanz et al. (1989a). The only likely “new” genes from Sanz et 01. are VH4.21 and VH4.22. Note that V12G-1,1-911,and VH4.13 are identical genes isolated and sequenced in three different laboratories.
.. ... ..
17
Ig HEAVY-CHAIN VARIABLE REGION GENES
v71-2 Wl-4 Vl1 W9 Vl2G-1 V2-1 v58 vh4.21 2.911
1 -19 P
v7l-2 Wl-4 Vl1 v79 Vl2Gl v2-1
10
20
30
WrmGaVs
-v-I-A-I-A-Y-I-
-.-w-e--I-
-A-Y--. -A-Y-F. I-A-PI-
-..-.*-v-.+W--V-S--G--
-.--.MI*1-v-
40 QPFQamn
-__ ~
~
~
F . 8 -
vh4.21 2.911
~
-€I-
FIG.5. The translated amino acid sequence of nine of the V d gene segments. Note the length differences in CDRl and that the majority of the variation is in CDRl and CDR2; 2.911 is shown, although it is a pseudogene.
two main clusters by only 25 nucleotides and have no gaps. One exception is the 71-2 sequence, which is virtually identical to 71-4 with the exception of an additional 6-bp gap. The VHIV family will likely serve as a model for understanding the evolutionary role in the human system of different VH gene segments, as specific antibody responses seem to derive exclusively from particular VHIV gene segments (see later). Using modern techniques of molecular biology, the subtle differences between the different VHIV genes can be studied and the precise structural basis for additional VH genes can be appreciated. These sequences are depicted in Figs. 4 and 5.
E. THEVHV FAMILY The VHV gene family was originally described in studies of the rearranged gene of patients in a family with chronic lymphatic leukemia (Shen et al., 1987).The VHV gene showed only distant homology with the other four described VH gene families and on Southern filter hybridization the VHV probe detected two to four restriction fragments, depending on the enzyme used. Three VHV genes have been described, VH251, V ~ 3 2 and , vH15. These differ by less than 10% of their total sequence, although VHlS is a badly crippled pseudogene. V ~ 3 (as 2 will be discussed later) is polymorphic in a way that is rather typical for human VH genes; that is, it is either present or absent in a
18
VIRGINIA PASCUAL AND J. DONALD CAPRA
particular individual. Figure 6 shows the sequences of all the VHV genes that have been reported at the germ-line level. The striking identity of so many of these sequences has led to the notion that at least the smaller human VH gene families show remarkably little polymorphism (see later). Two of the functional VflV genes have been located. One is rather D proximal (approximately 150 kb from D), whereas the other is quite distant from D (greater than 800 kb). The structural 2 striking at the protein level distinction between vH251 and V ~ 3 is (see Fig. 7),wherein all but one of the amino acid differences between the two VHV genes are in CDRl and CDRB. This implies selection at the germ-line level for variation in CDRs. As will be discussed below, distinct immune responses derive from each of these VHV germ-line genes. Recently Kennedy et al. (1989)reported that VHV gene sequences could be mapped to two sides of a translocation break point. Also,
d
r
-
n
c
?
" " r
&
c -___r
-.
"
n
A A
I
m
-CA-A
* *
-
&f2 $
"
&& $&-------c
E
E-
2*
m
m
m
m
m
m
m
m
lXl3i.a
w =
*a== $ m &
--
V#Br.a02
FIG.6. The VHV gene segments (adapted from Sanz et al., 198%);VHVAU is from van der Heijden et al. (1990).
r
Ig HEAVY-CHAIN VARIABLE REGION GENES
19
FIG.7. The derived amino acid sequence of the V ~ 2 5 and 1 Vtf32 gene segments.
Walter et al. (1990) provide evidence that one VHV gene is 180-360 kb from CH.
F. THEVHVI FAMILY VHVI family was described almost simultaneously in three different laboratories [Buluwela and Rabbitts (1988), in overlapping cosmids from the J-D region; Berman, using a similar approach (Berman et al., 1988);and Schroeder et al. (1987), in a cDNA derived from fetal liver]. Because all three sequences were published simultaneously, it was only in retrospect that it was appreciated that all three VHVI genes were identical, nucleotide for nucleotide. Later, Sanz et al. (1989a) described several additional VHVI gene sequences that again were identical, nucleotide for nucleotide, emphasizing the amazing conservation of structure of this VH gene segment (Fig. 8). Several laboratories have now confirmed the original observation of Buluwela and Rabbitts that the single VHVI gene segment is the most V-proximal VH gene segment (Schroeder et al., 1988). Because a considerable body of experimental evidence exists in the murine system that proximity to D and J is critical in the expression of the immunoglobulin repertoire, the placement of the VHVI gene as the most D proximal of the human genes is important. The fact that it is apparently nonpolymorphic may be of more than passing interest. Recently Meek et al. (1991)described the structure of the VHVI gene in a number of higher primates (gorilla, chimpanzee, orangutan, etc.) and found that within a species there was no sequence variation and between these primates and humans there was less than 2% nucleotide sequence variation. Thus, the extraordinary conservation both of position and structure of the VHVI gene is of considerable interest. There is but a single copy of the VHVI gene in any of these species.
20
VIRGINIA PASCUAL AND J. DONALD CAPRA
FIG.8. The human VHVI gene segments.
G. D-PROXIMAL VH GENES As discussed previously, several laboratories have documented that VHVI is the most D proximal of the human VH genes. Honjo has reported a preliminary physical map of a 150-kb region stretching from J H through D, which includes five human VH gene segments. In order, they are VHVI-V35 (VHI),VHI (not sequenced), and V79 (a VHIV gene that to date has not been seen to be expressed-see later) (T. Honjo, personal communication). Walter et al. recently published a physical map of the human heavy-chain gene cluster (see Fig. 9). They have positioned 62 V H gene segments within a 1500-kb region of the IgH gene cluster. The location of the VHVI gene is indicated, and several genes that they have identified by two-dimensional analysis are indicated. The correlation of this physical map with the sequence map is under way in several laboratories. A significant difficulty with the physical map, as has been pointed out by several investigators, including Walter et al. (1990), is the problem of “polymorphism” revealed, often reflecting the presence or absence of a particular VH gene segment. As mentioned previously, one of the VHV gene segments ( V ~ 3 2 ) is variably present in the human population. Shen et al. (1987) placed VHV rather D proximal whereas others (Kennedy et al., 1989) have located VHV more distal. Walter et al. (1990) point out that the three
Ig HEAVY-CHAIN VARIABLE REGION GENES
21
VHV genes map to different regions of the IgH complex and that the polymorphic VH32gene segment maps rather D proximal. Thus, until single-locus probes are widely used, and several individuals are tested, a precise physical map will be difficult to obtain. More importantly, the map will undoubtedly be different in different individuals. IV. Polymorphism of VH Gene Segments
The extent of polymorphism or genetic variation among immunoglobulin genes has for many years been the subject of extensive study in humans as well as in animal models. Some of the questions that can be addressed by studying polymorphism include the pattern of inheritance of V H genes, the contribution of germ-line variation to the diversity of the repertoire of B cell specificities, and the correlation between this repertoire and particular autoimmune disorders.
VH1-9 VHl-1 VH1.4 VHl-10 VH1-12 VH1-16 VH1-19 VH3-2 VH3J VH3-6 VH3-10 VH3.13 VH1-22 VH4-lO.VH4-ll'
VH1.3 VHl-23 VHl-25 VH3-5 VH3-7
FIG.9. Physical map of the immunoglobulin heavy-chain gene cluster (from Walter et ol., 1990).The positions of 62 VH gene segments within a 1500-kb region of the IgH gene cluster were determined by two-dimensional DNA electrophoresis analysis. BSSHII: fragments observed in leukocyte DNA digested with BssHII. SFI I: fragments observed in DNA digested with S j I . S, S j I cleavage sites; Bs, BssHII cleavage sites; N, NotI cleavage sites. Sites that were only partially cleaved in leukocyte DNA are indicated by parentheses. The positions of the numerous S j I sites within the C H region are not indicated. V H gene segments that are known to be polymorphic are indicated by asterisks. The position of the 5' NotI site of the 650-kb NotI fragment could not b e determined. A common 80-kb inserti0n;deletion polymorphism is indicated by the dotted line.
22
VIRGINIA PASCUAL AND J. DONALD CAPRA
Restriction fragment-length polymorphism studies and nucleotide sequence analysis have provided conflicting information concerning the degree of variation among germ-line VH genes in different strains of mice. Striking RFLP differences have been noted by several investigators and patterns of restriction fragments have been used to document both VH gene order and recombination in most of the inbred strains (Brodeur and Riblet, 1984; Rathbun et al., 1987). These RFLP differences are clearly reflected in significant nucleotide sequence differences in allelic genes in the murine system. For example, Loh et al. (1984) compared the sequences of five NPb-related VH gene segments of BALB/c and C57BL/10 mice and were not able to establish allelic relationships among them. These data suggested that there was not a selective pressure for maintaining a particular structure and that mutation, recombination, and conversion events were probably operating at a high rate in the generation of the germ-line antibody repertoire. Perlmutter et al. (1985a) studied the TI5 VH gene family in the same two strains and found that the four VH genes in this family diverged by up to 5% from their allelic counterparts. Analysis of the specific substitutions led them to conclude that environmental selection for functional combining sites was probably responsible for the pattern of variation in the germ-line genes. Recently, however, Kaartinen et al. (1989) sequenced the VH ( 0 x 1 ) genes from several strains of mice and found the opposite result: four alleles of VH 0 x 1 have 99-99.7% sequence identity to each other. These and other recent nucleotide sequence data suggest that at least some of the murine VH genes may display little if any polymorphism. In the human system, the first RFLP analysis using either murine or human probes corresponding to the VHI, V& and VHIII gene families revealed a more homogeneous pattern than had been reported in mice, even though some polymorphisms were evident (Matthyssens and Rabbits, 1980; Rechavi et al., 1982, 1983; Johnson et al., 1984; Turnbull et al., 1987; Pincus, 1988; Walter and Cox, 1988). Despite nucleotide sequence analysis of expressed V H genes (see later), it has been difficult to assess the contribution of V H gene polymorphism versus somatic mutation in the diversification of the repertoire, primarily because of the difficulty in assigning cDNA sequences to particular germ-line counterparts, especially within the large VHI and VHIII gene families. Despite these difficulties, several studies have shown that some expressed VH genes from individuals of different genetic backgrounds were 100% identical at the nucleotide level. Schroeder et a2. (1987) and Nickerson et al. (1989) reported several nucleotide sequences of VH cDNA clones derived from fetal liver. Some of these
Ig HEAW-CHAIN VARIABLE REGION GENES
23
gene segments have been found without a single nucleotide difference in the germ line (Mathyssens and Rabbitts, 1980; Berman et al., 1988) and/or expressed in autoantibodies with different specificities (Sanz et al., l989a-d; Dersimonian et al., 1987, 1989; Cairns et al., 1989; Siminovitch et al., 1989; Logtenberg et al., 1989), implying an enormous degree of sequence conservation among VH genes from unrelated individuals. A. POLYMORPHISMS IN THE VHI, VHII, AND VHIII FAMILIES As mentioned earlier, the complexity of the “classical” VH families, especially VHI and VHIII, made the interpretation of RFLP studies difficult, primarily because it was impossible to determine with certainty the exact number of VH gene segments in each hybridizing band. Polymorphisms were described, however, in the VHIIfamily, by Johnson et al. (1984). They detected one locus with two alleles and two loci characterized by the presence or absence of a polymorphic fragment among six or seven members ofthe VHIIfamily that they studied. Recently, two modifications of RFLP studies have been applied to study polymorphisms in the VHIII family. They are based on the hybridization patterns detected with (1) flanking-region probes instead of probes derived from the coding regions of specific genes and (2) allele-specific oligonucleotides. 1. Flanking-region probes give a simpler pattern of hybridization and reveal a larger number of polymorphic fragments. Souroujon et al. (1989) studied the patterns of hybridization of genomic DNA from a panel of unrelated individuals and several families using “flanking” probes derived from the 5’ and 3’ ends of the V ~ 2 6gene segment (Matthyssens and Rabbitts, 1980). They were able to identify several haplotypes defined by five polymorphic loci that segregate in a Mendelian fashion. They concluded that the human VHIII family was highly polymorphic. Chen et al. (1989b)arrived at similar conclusions using a probe corresponding to a 1.2-kb EcoRI fragment from the 3’ end flanking region of the human hu3005 gene segment. In both analyses, polymorphisms in terms of haplotypes as opposed to allelism seemed to be the more common situation. 2. Analysis of sequence variation in human genomic DNA using synthetic oligonucleotides corresponding to human VH sequences suggests that some V H elements have multiple alleles, whereas others are remarkably conserved. Using oligonucleotide probes corresponding to framework and complementarity-determining regions from single VH genes, Van Dijk et al. (1989) analyzed the patterns of hybridization
24
VIRGINIA PASCUAL AND J. DONALD CAPRA
of several members of the VHIII family. Their analysis suggests that even though some VHIII gene segments are quite conserved in the population, the VHIII family is heterogeneous, probably the result of V H sequence variation. Mechanisms of segmental gene conversion among related elements was proposed as an explanation for the fact that short sequences are shared among V H elements in a discontinuous fashion. The reported lack of polymorphism (see later) in the human VHVIgene segment (Sanz et al., 1989a; Van Dijk et al., 1989) supports this view, as the absence of homologous sequences in the germ line would preclude the occurrence of recombination events.
In an extension of the work of Van Dijk et al. (1989), Sasso et al. (1990) examined coding-region polymorphisms in VHIII germ-line genes. They identified the germ-line source of the fetally expressed gene 56P1, and showed it to be distinct from 1.9III,a homologous germ-line gene that differs from 56P1 by only five nucleotides. They also identified another very similar gene, T5M10, which comigrates with 56P1 as seen on Southern blots and is likely to be hu3005 (Chen et al., 1988, 1989a, b). In the germ-line DNA of 52 unrelated individuals, they identified these three germ-line genes (56P1,1.9ZI17 and T5M10) in 62,92, and 35%, respectively (Fig. 10, and see Table I). Guillaume et al. (1990) have recently performed a similar analysis. These kinds of studies emphasize how difficult it is to decisively document allelic relationships among VH elements in the outbred human population. Several different genes that exist in most people differ by only a few nucleotides (some of which do not encode amino
TABLE I GENECOMBINATIONS OBSERVED AMONG UNRELATED IN D IV ID U A L S ~ Gene phenotype
Occurrences
56P1
T5M 10
1.9111
Observed
Expected
+ +
+ +-
-
-
+ +
+ +
+ + + +
9 5 23 11 0 4 0 0
10.3 6.4 19.3 11.8 0.9 0.6 1.7 1.0
-
-
From Sasso et al. (1990).
-
-
(0 - E)'/E 0.2 0.3 0.7 0.1 0.9 19.3 1.7 1.0
Ig HEAVY-CHAIN VARIABLE REGION GENES
25
FIG.10. Identification of the germ-line gene 56P1. DNA extracted from PBLs was digested with TaqI and separated on a 1% agarose gel, 15 pg/lane. The gel was then dried and hybridized with M19, a 21-bp oligonucleotide probe corresponding to CDRB of the 56Pl sequence. The migration of HindIII-digested lambda phage size markers is shown to the right. The arrowhead indicates 5.0kb. From Sasso et al. (1990).
acid differences). These reflect, as mentioned previously, the products of gene duplication. By crossing over, some of these genes get deleted (such that some individuals do not have certain VH loci) (see Table I) whereas others have the full complement (again, see Table I). As Sasso et al. (1990) emphasize, “sequence similarity alone is not sufficient evidence to establish whether two VH elements are alleles.” This is a major point that has been frequently overlooked in the search of germ-line counterparts” to expressed genes. These results help reconcile previous controversial data derived from nucleotide sequence and RFLP analysis. Whereas some VHIII genes can be highly polymorphic in the population, others are extremely well conserved. We do not know how selective forces act upon different members of the same VH family in a different manner so as to preserve some structures and allow for the diversification of others ‘I
26
VIRGINIA PASCUAL AND J. DONALD CAPRA
through evolution. Availability of homologous sequences for recombinatiodgene conversion is a possibility. In this regard, there is evidence that the particular VHIII cluster that Van Dijk et al. (1589)found to be polymorphic is the result of a gene duplication event (Chen and Yang, 1990), so that homologous flanking regions are in the genome. On the other hand, the degree of preservation of some structures, such as the 9-1 and the V ~ 2 germ-line 6 VH gene segments, is remarkable. These gene segments have been sequenced by four independent laboratories without a single nucleotide change. These particular gene segments were the first to establish the connection between the fetal and the autoimmune repertoires (Schroeder et al., 1987, 1988, 1990; Sanz et al., 1989a-d). Capability for recognizing self might be paradoxically one of the selective forces that fixes in the genome a repertoire of VH structures intended to defend the organism against foreign antigens.
B. POLYMORPHISMS IN THE VHIV, VHV, AND VHVI FAMILIES The more recent discovery and characterization of the “small VH families,” VHIV, VHV, and VHVI, have facilitated the study of human polymorphisms as well as the role played by somatic mutation among expressed VH genes by allowing the comparison of any given sequence to its germ-line counterpart. Three independent laboratories reported the sequence of the human VHVIgene segment without a single nucleotide difference (Schroeder et al., 1987; Buluwela and Rabbits, 1988; Berman et al., 1988). To test whether this lack of polymorphism might be extended to the VHIV and VHV families, Sanz et al. (1989a) amplified the VHIV, VHV, and VHVI gene segments from several unrelated individuals and found that these three families display very little polymorphism. Only 14 differences were seen in a total of 2312 nucleotides sequenced among the VHIV genes, implying a slower than expected divergence time for the members of this family. Two substitutions were the maximum number observed among allelic VH genes from the VHV family, and seven VHVI genes were 100% identical. The VHIV genes that have been sequenced by several laboratories are presented in Fig. 4. It is rather remarkable that some of these genes, from entirely different racial and ethnic sources, have been isolated and independently sequenced by different laboratories, yet they are remarkably similar. The few differences may be technical, characteristic of the individuals involved, or may be true polymorphisms. Sanz et al. (1989a) addressed this issue in the VHIV families and found that the differences among their sequences and the sequences of Lee
27
Ig HEAVY-CHAIN VARIABLE REGION GENES
et al. (1987)could, in general, be found in the general population (see Table 11). However, despite this conservation of sequence (less than 1% nucleotide sequence variation), there are significant differences among individuals when probed with VHIV probes on Southern filter hybridization [see Sanz et al. (l989a-d) for VHIV differences, as well as Silvestris et al. (1989)l. In unpublished work from our laboratory ( J . Andris and J. D. Capra) using “long” gels and restricted VHIV probes, we have detected significant RFLPs in most humans. Strikingly, however, we have observed several examples in the expressed repertoire in unrelated individuals of certain VHIV sequences that appear to be “germ-line encoded” (V. Pascual and J. D. Capra, unpublished). Thus, it may turn out that the VHIV family is no more or less polymorphic than VHI, VHII, and VHIII, and that all are considerably less polymorphic than most murine genes, and not very different from most genes in the mammalian genome. Among VHV genes, polymorphism was reported in the original description of the VHV family by Humphries et al. (1988) to consist of the presence or absence of the V ~ 3 2gene segment (one of the two functional germ-line VHV genes). This has been found by several other investigators, and Sanz et al. (1989a), assessing this by polymerase chain reaction (PCR) (see Table 11), found that 50%of the population did not have the V ~ 3 gene. 2 The few nucleotide differences seen in the V ~ 2 5 gene 1 were also assessed by PCR-dot blot analysis by Sanz et al. (1989a) and were found to be true polymorphisms. No polymorphisms have yet been reported for the VHVI gene sequence. TABLE I1 ALLELE-SPECIFIC OLIGONUCLEOTIDEANALYSIS OF VHIVIVHVGENES* ~~
~
Distinction
Population
A versus B
A versus B
VH family
Locus
Position
IV IV IV IV IV
V71-4 V71-4 11 11 V71-2
85 48 170 214 267
G G A A T
A C G G C
251 251 32
53 235 32
C T T
G C C
V V V a
From Sanz et d.(1989a).
12 12 12 12 12 5 2 10
17 17 17
28
VIRGINIA PASCUAL AND J . DONALD CAPRA
Thus, though the polymorphism is minimal, most human VH genes are polymorphic. Based on sequencing studies in several laboratories, some seem nonpolymorphic (VHVI; VH20P1). Whether these nonpolymorphic genes represent the rule or the exception is not presently known. It is unlikely that the distinction is related to proximity to D and J, because, although VHVI is D/J proximal, the 20P1 gene is not one of the genes identified by Matsuda et al. (1990) as physically linked to DIJ. Because they have identified at least seven other genes physically linked to D/J and most appear to exist as allelic counterparts, physical location does not seem to be the determining factor in the presence or absence of polymorphism (T. Honjo, personal communication; see also Walter et al., 1990).Similarly, expression in the fetal repertoire does not seem associated with the presence or absence of polymorphism; whereas 20P1 and VHVI are expressed in the fetal repertoire, so is 56P1,which is not polymorphic when present and is absent in many normals. V. D Segments
As described above, the variable region of the immunoglobulin heavy chain is composed of three different elements, the variable (VH), diversity (D),and joining ( J H ) elements. These elements are encoded by genes that are separated in the germ line by thousands of nucleotides. At the pre-B cell stage, the recombination machinery brings together a D segment with one of the six known human J H segments. The D-JH complex subsequently joins to a VH gene segment to generate a complete heavy-chain V gene. Recombination is mediated by special signal sequences (heptamer and nonamer) separated by 23base spacers 3’ and 5’ to VH and J H gene segments, respectively, and by 12-base spacers flanking both ends of the D segments. The term D segment was first proposed by Schilling et al. (1980) to highlight the “diversity” found in the heavy chain of anti-cu-1,3-dextran antibodies from position +99 to the beginning of the J segment, spanning the third complementarity or hypervariable region (CDR3) (Kehoe and Capra, 1971). In several different systems, CDR3 has been shown to play a crucial role in determining antigen specificity and idiotypic expression. The D segments contribute to these functions and diversify the heavy-chain repertoire in the following ways: (1)adding a third element to the rearrangement of VH and JH gene segments, (2) generating unique amino acid residues at the V-D and D-J junctions during the process of rearrangement, (3) undergoing somatic mutation and/or gene conversion, and (4) through nonconventional mechanisms such as D-D recombination.
Ig HEAVY-CHAIN VARIABLE REGION GENES
29
A. ORGANIZATION OF THE HUMAN D LOCUS The human D gene segments are located in chromosome band 14q32 (Cox et al., 1982; Kirsch et al., 1982). In mice there are 12 D gene segments that are classified into three families ( D Q S Z , DSPZ, and D F L I G ) according to sequence homologies (Kurosawa et al., 1981; Kurosawa and Tonegawa, 1982). The human D locus has only recently been fully elucidated. Siebenlist et al. (1981) identified a human D family, D L R , whose members were encoded at regular intervals of 9 kb along a 33-kb stretch of human DNA. A unique D segment, the human equivalent of the mouse 0 9 5 2 , was described within the JH locus by Ravetch et al. (1981), 25 nucleotides upstream of the JH1 nonamer sequence. Mapping analysis located a “major D locus” between the VH and JH loci, flanked by the D L R d and the D ~ s gene z segments 5‘ and 3‘, respectively (Siebenlist et al., 1981; Buluwela et al., 1988).There is a 20-kb separation between the DLRl gene segment and the closest VH gene segment (the single member of the VHVI family) (Sato et al., 1988),implying that the major D locus itself spans around 70 kb. Recently, several D segments have been found interspersed with VH gene segments (Zong et al., 1988; Buluwela et al., 1988; Matsuda et al., 1988).Some of these D segments display great homology with members of the major cluster, suggesting that duplications, germ-line gene conversion, and/or interchromosomal rearrangements have occurred between the VH and the D loci. Based on nucleotide sequence homology, the D gene segments have been classified into families. Ichihara et al. (1988a, b) sequenced a 15-kb DNA fragment corresponding to 1-1/2 ofthe 9-kb repeating units previously reported by Siebenlist et al. (1981). Each unit contained members of six different families: Dxp, DA,D K ,DN, D M ,and DLR(Fig. 11).Sonntag et al. (1989)reported the sequence of a D segment from a D-JH rearrangement that shared 60% homology with the mouse DFLI.5 family. Southern blots using the rearrangement as a probe suggested the presence of related genes in the germ line. Therefore, the number of D families can be estimated to be around eight (including DQSZas a monogenic family). The number of individual D gene segments is probably over 30. Only one D pseudogene has been identified. It seems to have been generated by duplication of the DAl gene segment. CANBE INVOLVED IN B. A NEW KIND OF D SEGMENT NONCONVENTIONAL REARRANGEMENTS In germ-line configuration, the D segments are sandwiched by recombination signal sequences that consist of a heptamer/12-bp spacer/ nonamer (Sakano et al., 1980, 1981). Heptamer sequences are conserved except in the DMz and D A gene ~ segments, whereas nonamers
30
VIRGINIA PASCUAL AND J . DONALD CAPRA 1 kb
A
DM1 I
E
m
DLRl D *A1
1
1
n
B B H
B
1
DXPl DXP'1
m
I 1
DN1 I
I I
Ill
I
1
1
EEH
H
B
E
0 genes
(a) CGATTCTGA ACAGCCCCGAGT
DM I
CACTGTG AGAAAAGCTTCC
GGATTTTGT GGCGCCTCGTGT
DLRl
-.
AUiATATTGTACTAATGCTGTITCCTATACC
A G e G G A TGATCACATLU
'YAI
%PI
GGTTTAGM TGAGCTCTCTGT
DXP. I
GGTTTGGGG TGAGGTCTGTGT
DHQ52
GGTTTTTGG CTGAGCTGAGMC
-
-TCACAGAGTCCA w
I
CGTTTTCTG MGGTGTCTGTGT CICIGTt GGGTATAGCACCAGCTGGTAC
DN 1
ACACAGCCCCATT
-CTAACTGGGGA
CACAGTG TCACACACTCCA
w
ACACTCACCCAG
C
m ATTGGCAGCTCT
(bl DMl DLm I DliA1
@@@ CATATT
8
TACTA
ATGGT
GTATG GTATG _ _ -TTACT --
GGGTAT
GCTGG
CTGCT
TATMC
DXPI
TATUC
DXP* 1 Dyl
a@)
@ @
TACTA
ATGCT
TThCT GGCTAT
GCTGG
CTGCT
DHQ52
FIG. 11. (A) Organization of five DH genes on one 9-kb repeating unit. DLRJgene corresponds to the D, gene described by Siebenlist et al. (1981). The solid boxes indicate the locus Of DHgenes on the repeating unit. B, BamHI; E, EcoRI; H, HindIII. From Ichihara et al. (1988a). (B) The nucleotide sequences of the Dktgenes located in the 9-kb D N A fragment plus the D,,Q52 gene and homologous stretches among the D H genes. (a) All &coding sequences are sandwiched by 12 2 1-bp-spacer-containing hepatmer and nonamer signal sequences except for D,,,Aj.The nucleotide sequences of the DH genes are boxed. The signal heptamers and nonamers are underlined. The dotted line indicates the analogous signal sequences that may be functional. (b) The homologous segments more than five nucleotides long are listed. The homologous sequences only between Dxpl and Dxp'j arc omitted. The order of stretches are arbitrary. The homologous stretches are circled (common among three DHgenes) or underlined (common between two DHgenes). From Ichihara et al. (1988a).
diverge in general from the coiisensus sequence. A particular kind of D segment, surrounded by multiple heptamerlnonamer-like sequences as well as spacers of different lengths, was reported b y Ichihara et al. (1988a, b) under the name of "DIR" segments. The availability of 12and 23-bp spacers flanking both ends of the coding segment sequences suggests that the DIR segments might be a substrate for D-D recombination. Several examples of expressed DIR segments have been re-
Ig HEAW-CHAIN VARIABLE REGION GENES
31
ported (Ichihara et al., 1988b; I. Sanz, personal communication), including a DLRS-DIR fusion in an anti-DNA antibody (Davidson et az., 1990).
C. D GENESEGMENTS CANGENERATE ENORMOUS DIVERSITY Besides the diversity generated by the multiplicity of available VH, D, and J H gene segments in the germ line and their combinatorial association, several mechanisms that involve D segments further contribute to the repertoire of heavy-chain diversity. 1 . Flexibility in the Recombination Site Exonucleases and terminal deoxynucleotidyl transferase (TdT) “chew” and fill in, respectively, the coding ends of D and J H gene segments, generating unique amino acid residues at their junction. The same process occurs at the V-D joint except that the coding 3‘ end of the V H gene segment is usually preserved from exonuclease activity. It has been recently shown that in mice TdT activity increases with age. Longer nucleotide additions, or “N” segments, are therefore seen in the CDR3 of adult versus young animals. The mechanism of flexible recombination allows not only the deletion and/or insertion of nucleotides at the junctions, but also the utilization of the same D segment in different reading frames. From the data available in the literature and the sample of antibodies that we have sequenced in our laboratory, it seems that a particular reading frame is favored either in antibodies of the same specificity (Dersimonian et al., 1987; Cairns e t al., 1989)or, as is shown in Fig. 12 [two examples of DN-4 in polyreactive rheumatoid factor (RF) and anti-acetylcholine receptor (AChR) antibodies], in the context of different specificities.
mi-4 (GL) C R F m mi-4 (GL)
D-Ab37
-
G G C Q ; T c G G m
--A-----iX--
b)
L W 2 (GL) M60 K71
cmEx9xa CrKXrrAAI\GpGcc
FIG.12. (A) Nucleotide sequence of two D segments expressed in autoantibodies of different specificities that use the same reading frame from the DN-4germ-line gene (V. Pascual, A. Lefvert, and J. D. Capra, unpublished data). (B) Nucleotide sequence comparison of two D segments from a 104-day-old fetal liver cDNA library using the DQJP gene segments in different reading frames (Schroeder et al., 1990).
32
VIRGINIA PASCUAL AND J. DONALD CAPM
2. Somatic Mutation Because the total repertoire of germ-line D segments is still unknown (and it is likely that many more D segments exist interspersed within the V H complex), it is difficult to assess whether a particular expressed D segment has accumulated somatic mutation or is the direct copy of an unreported germ-line D gene segment. Figure 13 provides an example of two clonally related antibodies sequenced in our laboratory in which the DLRZ gene segment is expressed in almost germ-line configuration (A) and with eight point mutations (B) (onefourth the extension of the segment). This pattern correlates well with the rate of mutations found in the whole heavy chain (Pascual et nl., 1990a).
3. Gene Conversion Gene conversion has been shown in several species to be an efficient way of generating diversity, starting with a limited number of germline genes (Reynaud et al., 1985; Knight and Becker, 1990). Even though w e do not know the role that gene conversion events play in the human system, there are several examples among expressed D segments (I. Sanz, personal communication), which contain “blocks” of DNA displaying homology to different germ-line genes, that could be explained by this mechanism. It is worth noting that the degree of homology shared by D segments in their flanking regions is high enough to allow recombination events to occur. 4 . Novel Mechanisms of Rearrangement In their initial description of the D locus, Kurosawa and Tonegawa (1982) proposed that D segments might rearrange among themselves in order to generate additional diversity. They postulated that the rearrangement could be mediated through internal “heptamer-like” sequences present in the coding sequence of some murine D segments. Subsequently, several examples of possible D-D fusions have been described in mice and humans (Siebenlist et al., 1981; Ollier et al., 1985; Meek et al., 1989; van der Heijden et al., 1990; Davidson et DIR2 (GL) RF-sJ2 RF-sJ1
FIG.13. An example of two clonally related antibodies sequenced in our laboratory in which the DLRZgene segment is used in almost germ-line configuration (left) and with eight mutations (right).
Ig HEAW-CHAIN VARIABLE REGION GENES
33
al., 1990).Meek et al. (1989)demonstrated the presence of direct and inverted D-D fusions mediated by heptamednonamer signal sequences or by isolated heptamers in murine bone marrow. They also showed that isolated D segments can rearrange to J H segments in either transcriptional orientation, further increasing the potential diversity of the repertoire. I n the human system, similar mechanisms probably take place and, as has been mentioned, DIR segments are very likely involved in these fusion events.
D. EXPRESSION OF D SEGMENTS During murine ontogeny the D segment situated most 3’ proximal in the genome ( 0 0 5 2 ) is preferentially rearranged (Alt et al., 1988).Accessibility to the action of the recombinase by a “linear tracking” mechanism is the commonly accepted explanation for this observation. The human equivalent to murine 0 9 5 2 is also called 0 ~ 5 2 . 0 ~ is5 not 2 only the most 3’-proximal D gene segment, but it also has been shown to rearrange preferentially during the development of the human immune system: in two independent cDNA libraries derived from fetal liver at 104 and 130 days of gestation, Schroeder et al. (1987) showed that 6 and 8 out of 14 clones, respectively, used D gene segments that shared five or more nucleotides with the 0 0 5 2 gene segment. Southern blot analysis of Epstein-Barr virus (EBV)-transformed B cell lines derived from human fetal liver is also consistent with the preferential rearrangement of the D o 5 2 gene segment (Nickerson et al., 1989). As in adult mice, whose repertoire of B cell specificities is normalized in such a way that members of each of the three D families are proportionally represented, structural analysis of myeloma proteins and DNA sequencing of human antibodies do not show a preferential utilization of the 0 9 5 2 gene segment. Among the human autoantibodies that w e have sequenced in our laboratory, approximately 50% can be assigned to one of the reported germ-line D segments, and less than 2% show significant homology with the DQQ gene segment.
VI. Human JH Segments
The human J H locus is located between the major D cluster and the immunoglobulin constant region locus. It spans approximately 2.6 kb of DNA and contains six functional genes and three pseudogenes, all in the same transcriptional orientation. J H segments are flanked in their 3’ ends by a potential RNA splice site, and in their 5’ ends by the heptamerlspacerlnonamer signal sequences that are involved in the
34
VIRGINIA PASCUAL A N D J. DONALD CAPRA
rearrangement with upstream D segments. The three J H pseudogenes have open reading frames in their coding regions, but they contain abnormal splice sites and their heptamer sequences differ the most from the consensus functional heptamer. The spacer between the heptamer and nonamer varies in length from 20 to 25 nucleotides in all functional J H segments and pseudogenes, and only the J H segments ~ possess the conventional 23-bp spacer length. Interestingly, JH4 is the single most expressed J H segment in the human repertoire. 2 segment is found between the first two J H The human 0 ~ 5 gene segments, raising the possibility that additional J H segments may be interspersed among D segments, even though neither sequence analysis of the major D cluster nor of the expressed J H gene segments supports this idea. J H gene segments rearrange to D segments through their respective flanking signal sequences. This is the first event in the assembly of the immunoglobulin heavy chain, and also the first source of diversity: in the process of joining the D and J coding regions, exonuclease “nibbling back” and “filling in” of the 3’ and 5’ ends, respectively, take place, with the generation of new amino acid residues that will be part of heavy-chain CDR3, one of the regions in the antibody molecule critical for making contact with the antigen. Figure 14 represents the nucleotide sequences of the six functional J H gene segments (Ravetch et al., 1981).The polymorphic nucleotides observed in our sample of autoantibodies as well as in the literature are also included. As Schroeder et al. (1987) pointed out, the 5’ end of certain J H segments, such asJH4 and, in our experience, alsoJH6, are particularly prone to truncation. Whether this finding has to do with the fact that the recombinase preferentially cleaves target sequences adjacent to a TpG dinucleotide (Hope et al., 1986), which is not available at the 5’ ends of eitherJH4 or JH6, is a possible but speculative explanation. Regarding the expression of J H segments, data from the fetal repertoire and from the autoantibody studies clearly indicate that there is bias toward the expression of particular J H segments. Only two J H 1 sequences are available (Robbins et aZ., 1990; Roudier et d.,1990),and very few J H ~gene segments have been reported. Schroeder et al. (1987,1990) found that at 104 and 130 days of gestation, J H a~ n d J ~ 4are the most commonly J H genes expressed, followed by]& and, in a small proportion,JH6 and J H 2 . In our analysis of autoantibody sequences, J H and ~ J H are ~ the predominant JH segments, followed by ] ~ 3 , ] ~ 2 and]& , (Fig. 15). Summarizing all the data, of 65 VH sequences reviewed from the literature and our own data, 25 antibodies
Ig HEAVY-CHAIN VARIABLE REGION GENES
35
NoMmer
********* GL Jfl
GL J H ~ GL JH2 GL J92 -A
GL J$
A A
GL
Jrp
GL JH5 GL J t 3
= JH6 FIG. 14. Nucleotide sequence of the six functional J H segments and the three pseudogenes. Asterisks indicate the hepatamer, nonamer, and splicing sequences. Polymorphisms are represented above and underneath the corresponding sequence ; et al., 1990a) (Ravetch et al., 1981; Schroeder et al., 1987; Sanz et al., 1 9 8 9 ~Pascual
use J H segments, ~ 14 use J H ~ and , a similar number useJH6, whereas there are only 7JH5,3J H ~ and , 2 J H ~used (Pascual et al., 1990b). VII. Expression of Human VH Gene Segments
Until recently, our knowledge of the human repertoire of B cell specificities was based on structural studies of human monoclonal paraproteins derived from patients with B cell dyscrasias. As discussed in detail in Section 11, it was concluded from these studies that, according to amino acid sequence homology, human VH regions could be classified into three major groups or families, I, 11, and 111. However, little was known regarding the expression of human VH genes in situations other than paraproteinemias. Serologic reagents that could distinguish the three known VH families were not widely available. Thus, their utilization in various B cell compartments (i.e., bone marrow, peripheral blood, and spleen) was not approachable. Similarly, chemical (protein) analysis was too cumbersome to be widely used. In the last decade, however, hybridoma technology development and EBV immortalization of B cells have permitted the study of the expressed human B cell repertoire in normal and pathological situations. Additionally, amplification of genomic DNA or cDNA via the polymer-
36
VIRGINIA PASCUAL A N D J. DONALD CAPRA
% 40
30
20
10
0 JH1
JH2
L JH3
JH4
JH5
JH6
JH
FIG.15. J H usage among human autoantibodies. Distribution of J H segments among 40 human autoantibodies sequenced by our group (Sanz et nl., 1989~;Pascual et ol., 199Ob; V. Pascual, unpublished data).
ase chain reaction provided an exceptionally efficient tool for analyzing gene structures even in situations of low message abundance or sparce sample size. In this section, we summarize the current data concerning the human expressed V H repertoire.
A. EXPRESSION OF HUMAN VH GENESEGMENTS DURING ONTOGENY We learned from the murine system that one of the hallmarks of the B cell repertoire during ontogeny was its limited heterogeneity. Though the selection of VH gene segments in the adult animal can be considered random, restriction in the fetal repertoire is manifested by a sequential and programmed ability to respond to different antigens. This restriction has some molecular correlates, such as the preferential rearrangement of particular V H and D gene segments. In that regard, the V ~ 7 1 8 and 3 v ~ Q 5 2gene families, which are the most D-proximal VH families in the murine genome, together with the most JH-proximal D segment, D Q S ~are , overexpressed in fetal liver and bone marrow as well as in adult bone marrow (Yancopoulos et al., 1984; Perlmutter et
Ig HEAW-CHAIN VARIABLE REGION GENES
37
al., 1985b). On the other hand, diversification mechanisms such as N-terminal addition and somatic hypermutation do not seem to play an important role during the early development of the murine immune system. A second characteristic of the murine fetal repertoire is its high degree of connectivity. Hybridomas derived from fetal or neonatal mice display a high percentage of self-reactivity. Among them, antiidiotypes have been shown to be of particular relevance in maintaining positive interactions among B cells as well as in shaping the mature B cell repertoire (Kearney et al., 1987). Similar to the situation described previously in mice, Schroeder et al. (1987) provided the first evidence that a restriction in the fetal repertoire also existed in humans. They analyzed a human cDNA library from a 130-day-old fetal liver and sequenced 14 functional V-D-J rearrangements. A single member of the VHIII family (56P1) was found expressed in three of the clones, and two other gene segments belonging to the VHI (51P1)and the VHIII families (60P2)were found twice. Interestingly, the most D-proximal VH gene segment in humans, the single member of the VHVI family, was also found. Considering that the human VHI and VHIII families each contain more than 25 members, there was clearly an overrepresentation of the Dproximal monogenic VHVI family. Recently, the same kind of analysis has been extended in humans to an earlier stage of development: Schroeder and Wang (1990) constructed a cDNA library from a 104day-old fetal liver and found that, except for the presence of two members of the VHII family and one member of the VHV family, the repertoire overlaps with the 130-day-old fetus. Again, the 56P1 gene segment is the most common single gene expressed, and a total of five members of the VHIII family contribute to 60% of the repertoire (Fig. 16). The overexpression of VHIII genes at 104 and 130 days of gestation could also be a reflection of a trend toward the normalization of the repertoire, because the VHIII family is the most complex in the human genome. Cuisinier et al. (1989) have analyzed Ig transcripts from a 7-week-old human fetal liver by dot blot hybridization using probes corresponding to the six human VH families. Their results suggest that the VHVand VHVI families are first expressed at the time when Ig gene rearrangement begins in fetal liver (Gathings et al., 1977). Whether the transcripts described by Cuisinier et al. truly represent V-D-J rearrangements, or are sterile products indicative of chromatin accessibility to the recombinase at that particular time in ontogeny, has not been addressed at this time. Berman and Alt (1990)studied by Northern blot
38
VIRGINIA PASCUAL AND J. DONALD CAPRA
6
- 104 ALLELE
: 5 u 4 ; 3 * 2 1
1
2
3
4
5
6
V, Family
FIG.16. Twenty-four Cp’ independent V H - D H - J H transcripts from two unrelatec fetuses at 104 and 130 days of gestation. The 12 V H elements that contributed to thesc rearrangements are grouped by family and identified by a representative cDNA clone From Schroeder and Wang (1990).
assay the hybridization ratio of different VH probes to mu RNA frorr fetal liver (16-24 weeks of gestation) and compared it to different aduli lymphoid tissues. They conclude that the most D-proximal VH family VHVI, is overrepresented in fetal liver compared to adult tissues whereas VHIII and VHIV expression is similar at both stages of devel, opment. Another approach to studying the human fetal repertoire is the gen. eration of EBV-transformed B cell lines from fetal tissues. Logtenberg et al. (1989) analyzed by Northern filter hybridization a total of 18; monoclonal IgM-secreting EBV lines derived from adult and feta tissues. They found a correlation between the frequency of VH famil, use and the complexity of each family, suggesting that the populatior of transformable B cells was randomized in both repertoires. From thr study of fetal cDNA, five VHIII genes were found to contribute to 60% of the repertoire, thus it might be that the “normalization of the reper toire” is not a reflection of the actual situation, but a restriction within z limited set of VHIII gene segments. The mechanism responsible for the preferential expression of partic ular VH gene segments during ontogeny remains unknown. Linea track “accesibility” to the recombinase has been proposed as an ex planation for D-proximal VH gene expression in mice (Wood anc Tonegawa, 1983; Yancopoulos et al., 1984), and this could be appliec to the expression in humans of the VHVI gene segment early in feta life. On the other hand, 56P1, the single most common gene segmen found in the analyses of the 104- and 130-day-old fetal livers (ever though has not been precisely mapped), does not seem to be located L
Ig HEAW-CHAIN VARIABLE REGION GENES
39
proximal (T. Honjo, personal communication). However, 56Pl is structurally the human gene most similar to the murine VH8lX gene segment, a member of the 7183 V H family that is not only D proximal but is also the most commonly expressed VH gene segment during murine ontogeny. The homology between both gene segments has been analyzed by Hillson and Perlmutter (1990) and approaches 78% at the nucleotide level. The homology extends beyond the coding regions and reaches 90% in two segmental intervals corresponding to frameworks I and 111. According to the same authors, these two regions are conserved in a “family-specific” way, and, in the mature protein, encode a possible binding site different from the classical antigenbinding site defined by the hypervariable regions. Whether the recognition of certain antigens through these nonconventional binding sites is responsible for the selection of particular gene segments within the repertoire remains speculative. Another explanation for the increased expression of particular VH gene segments has been proposed by Chen (1990).He sequenced the flanking regions of two germ-line genes frequently expressed during ontogeny as well as in the autoimmune repertoire: V ~ 2 (Mathyssens 6 and Rabbitts, 1980),the germ-line equivalent of3OPl (Schroeder et al., 1987), and human hv3005, a germ-line gene that differs from the 56Pl gene segment by only two nucleotides in the coding region (Schroeder et al., 1987). H e found in both cases many short stretches that were highly homologous to known enhancer sequences, as oppossed to a control pseudogene, 2.91ZZ (Berman et al., 1988), which only possessed four of those enhancer-like regions in its flanks. More studies need to be done in order to draw conclusions regarding the role of these flanking sequences in promoting preferential gene expression (see Section VIII).
B. VH REPERTOIRE IN B CELLMALIGNANCIES The expression of VHgene segments in B cell malignancies has been the subject of extensive study for a number of years. From myeloma proteins to DNA rearrangements in acute lymphoblastic leukemias, all stages of B cell differentiation “frozen” during the malignant proliferation have been analyzed in terms of VH usage. Occasionally it has been possible as well to determine the rate of somatic mutation and/ or intraclonal diversity (Cleary et al., 1988; Silberstein et al., 1989; Roudier et al., 1990). Several conclusions can be drawn from these analyses, e.g., VH usage in B cell malignancies somehow reflects the development of the immune system. In that regard, acute lymphoblas-
40
VIRGINIA PASCUAL A N D J. DONALD CAPRA
tic leukemia (ALL) and chronic lymphocytic leukemia (CLL), which are the malignant correlates of pre-B and intermediate B cells, respectively, are restricted in their VH family usage and very frequently rearrange genes from the fetal repertoire. For instance, the 51P1 gene segment (Schroeder et al., 1987) has been found rearranged with 99100% identity in three CLLs (Ravetch et al., 1981; Chen et al., 1989,; Kipps e t al., 1989).On the other hand, serological analysis using the G6 monoclonal antiidiotypic reagent (Mageed et al., 1986),which recognizes the 51P1 gene segment, suggests that up to 20% of patients with CLL rearrange 51P1-like genes (Kipps, 1990).Several other VH genes from the restricted fetal repertoire have been identified by different groups in CLL rearrangements; 30P1, the fetal counterpart of the germ-line V ~ 2 gene 6 segment (Mathyssens and Rabbits, 1980), which expresses the 16/6idiotype present in a subset of anti-DNA antibodies (Chen e t al., 1988, 1990b, c), is found in 10% of patients with this disease (Rubenstein et al., 1989). Evidence supporting a biased rearrangement of VH gene segments in CLL has been also provided by Humphries et al. (1988), who reported that up to 30% of patients with ALL and CLL rearrange one member of the VHV family, the V ~ 2 5 gene 1 segment. Logtenberg et u1. (1989)analyzed by Northern blotting the V H family expression in CLL and reached similar conclusions: the small VHIV, VHV, and VHVI families were represented in 50,20, and 15% of the cases, respectively. Considering that the contribution of these three families to the VH repertoire is accounted for by approximately 20 functional gene segments, their presence in 85% of the CLL patients is indicative of a strong selection. VH usage in B cell neoplasias that arise during later stages of B cell differentiation seems to be normalized according to the complexity of the VH families. Cleary et al. (1988) have extensively studied the repertoire of VH genes as well as the intraclonal diversity in the malignant proliferation of activated B cells that occurs in follicular B cell lymphomas. They find expression of VHIII gene segments not related to the fetal repertoire. Silberstein et al. (1989) did the same kind of analysis on a population of B cells from patients with plasmacytoid lymphomas and found expression of VHI gene segments, again not previously described during ontogeny. Furthermore, all the protein sequence analyses from patients with multiple myeloma and Waldenstrom’s macroglobulinemia performed two decades ago revealed usage of VHI, VHII, and VHIII gene segments that, retrospectively, do not have correlates in the human fetal repertoire.
Ig HEAVY-CHAIN VARIABLE REGION GENES
41
C. VH REPERTOIREIN HUMANAUTOANTIBODIES For a number of years the role played by the B cell repertoire in human autoimmunity has been an enigma; even though we are now able to address the processes, we are still far from understanding them. Basic questions regarding the genetic origin of autoantibodies, such as the capacity of the germ line to directly encode autospecificities, the role of polymorphism, and the contribution of somatic mutation to this autoimmune repertoire, have begun to be understood. However, we still do not know whether autoimmunity is the result of a failure to normalize the primary B cell repertoire nor whether pathogenic autoantibodies arise from the same precursors as the antibodies involved in responses to foreign antigens, or if they derive from a different subset of B cells and use a different array of VH gene segments. We do not know whether the regulatory factors are involved in B cell expansion of clones with anti-self specificity under certain circumstances that otherwise have the potential to be present in all of us. In this section we will summarize the data accumulated during the last years by several laboratories, including our own, regarding the structural characterization of human autoantibodies, those that exist in normal individuals (so-called natural autoantibodies), as well as autoantibodies derived from patients with autoimmune diseases. 1 . V HUtilization in Human Natural Autoimmune Responses The presence of natural autoantibodies in humans was first reported by Guilbert et al. in 1982. They studied a serum pool from 800 normal donors as well as individual sera from three donors, and detected binding of all major classes of immunoglobulins to the nine selfproteins examined. Dighiero et al. (1985) extended these studies to normal newborn mice using hybridoma technology and confirmed the existence of B cell clones reacting with self-antigens with a pattern of specificities similar to that of natural autoantibodies found in normal human serum. Subsequently, the isolation of autoantibodies from normal human donors using different techniques (i.e,, immortalization with EBV, hybridomas, and stimulation with anti-CD3 and adult T cells, Staphylococcus aureus, and polyclonal B cell activators) has confirmed the presence of B cell precursors for autoantibodies in the preimmune as well as normal adult repertoires, These naturally occurring autoantibodies are predominantly IgMs, even though different isotypes have been also reported. Typically, they bind antigen in a polyspecific, low-affinity manner. It has been suggested that the CD5+ population of B cells, which is naturally expanded during ontogeny
42
VIRGINIA PASCUAL AND J . DONALD CAPRA
and neonatal life, is the source of most natural autoantibodies (Casali et al., 1987; Casali and Notkins, 1989; Burastero and Casali, 1989).More studies need to be done in order to confirm this fact. The characterization of the human natural autoantibodies reported to date is summarized in Table 111. Several conclusions seem obvious: (1)as mentioned above, most of the autoantibodies belong to the IgM isotype and bind antigen in a polyspecific way, even though exceptions are seen in both regards; (2) every VH family is represented in the sample, with some important generalizations. Sanz et al. (1989~) sequenced seven natural autoantibodies derived by EBV transformation of CD5+ cells from normals. They found that members of the VHIV family were expressed in three of them, implying somehow a restriction in VH usage. No restriction seems to occur, however, among natural autoantibodies with anti-DNA specificity. Members of five VH families have been found expressed in this particular system (Hoch and Schwaber, 1987; Sanz et aZ., 1989c; Dersimonian et al., 1987, 1989; Cairns et al., 1989). Logtenberg et al. (1989) generated a panel of EBV-transformed B cell lines from normal fetal and adult sources. They selected four clones that expressed V H gene segments from the monogenic VHVI family and found in every instance that the these VHVI antibodies reacted with DNA and fulfilled the characteristics of natural autoantibodies. In summary, excluding the four clones reported by Logtenberg et al., which were selected based on VH usage, among the group of natural autoantibodies, five express VHIII gene segments, five express VHIV, two express VHI, and one (partial sequence) expresses a VHII gene segment (Table 111). It is important to appreciate that the VHIV family contains 14 members and appears overrepresented in this particular sample. There is a third conclusion regarding characterization of human natural autoantibodies. As Table I11 shows, there are several examples of natural autoantibodies that use VH gene segments in germ-line configuration and that are related to the fetal repertoire: Kim13.1, a natural autoantibody with reactivity against cardiolipin as well as R F activity (Siminovitch et al., 1989), displays 99.8% homology to the 51P1 gene segment reported by Schroeder et al. (1987). The anti-DNA antibody Kim4.6, derived from a normal adult (Cairns et al., 1989), is 99.8% identical to 19.111, a member of the VHIII family reported by Berman et at. (1988), which has been also identified in a fetal rearrangement (Nickerson et al., 1989).Two other polyreactive anti-DNA antibodies derived from fetal liver, L16 and ML1 (Logtenberg et al., 1989), use the VHVI gene segment without mutation (recall that VHVI is represented in the fetal repertoire).
Ig HEAVY-CHAIN VARIABLE REGION GENES
2.
43
Expression in Autoantibodies Derived from Patients with Autoimmune Diseases As mentioned above, the role the B cell repertoire plays in the generation of autoimmune diseases has only very recently begun to be understood. One of the first questions addressed was whether patients with autoimmune diseases have a particular set of VH genes responsible for the generation of autoantibodies that are absent in the normal population. RFLPs as well as amino acid and nucleotide sequence analyses of murine autoantibodies such as rheumatoid factor (Schlomchik et al., 1987a, b; Aguado et al., 1987) and anti-DNA antibodies (Trepicchio et al., 1987) revealed that there were not major structural differences among autoantibodies arising in murine models of autoimmunity and autoantibodies induced or selected in normal mice. These studies also provided evidence that the accumulation of mutations in the VH regions was common, suggesting positive selection by antigen. Structural data on the VH regions of human autoantibodies became available at the protein level through the study of human monoclonal paraproteins with R F activity (Capra and Kehoe, 1974; Andrews and Capra, 1981; Newkirk et al., 1987), providing a structural correlate at the heavy-chain level for at least two of the three major cross-reactive idiotypes that had previously been defined in this system: Wa and Po (Kunkel et al., 1973,1974). In this regard, Wa( +) RFs use members of the VHI family, and Po( +) RFs express VHIII regions. Recently it has been shown that members of the VHIV family give rise to the third major group of R F paraproteins (Silverman et al., 1990a, b), defined by the Bla cross-reactive idiotype (Agnello et al., 1980). These studies have also provided evidence that proteins with similar idiotypes contain similar structures in their hypervariable regions, and suggest a common germ-line origin. However, autoimmune manifestations are not usually present in patients with B cell dyscrasias, and thus the question of how these monoclonal paraproteins with R F activity, compared to the autoantibodies present in patients with autoimmune diseases, remained. In an attempt to answer these questions, polyclonal and monoclonal reagents recognizing CRI expressed on monoclonal RF heavy and light chains have been used to test their expression in the polyclonal population of R F autoantibodies present in the serum of patients with rheumatoid arthritis (RA) (Forre et al., 1979; Mageed and Jefferis, 1988; Shokri et al., 1990). These studies show that, even though R F autoantibodies bearing the cross-reactive idiotypes characteristic of monoclonal paraproteins are present in patients with classical RA,they represent a minor proportion of the IgM RF, suggesting that RFs in RA VH
TABLE 111 CHARACTERIZATION OF HUMAN AUTOANTIBODIES Antibody
Fetal cDNA
Ab47 21/28
-
? HG3
Normal SLE
8ElO HAFlO Kim13.1 RF-TS1 RF-TS3 LS 1 Ab19 4B4 1812 Ab18 Ab25 PopVH RF-KL1 RF-SJ2 RF-SJ 1 Kim4.6
51Pl 51P1
HG3 HG3 ? ?
Leprosy RA Normal RA RA CAD
?
MG
9.1 VH26 VH26 VH26 VH26 VH26 CLSJZ GLSJ2 19.111
SLE SLE Normal Normal CLL
-
-
20P1 30P1 30P1 30P1 30P1 30P1
56P1 56P1 FL2-2
Germ line
Homology Source"
RA RA RA Normal
Isotype
Reactivity'' RF/ssDNA DNA, pNT, ctyo.c, platelets DNAIM. leprae RF monospecific CardiolipidRF R F monospecific RF monospecific Cold agglutinin AChR DNA/polyspecific DNA/polyspecific Pol yspecific Antithyroglobulin Antimyelin/ DNA RF monospecific R F monospecific RF monospecific dsDNA
VH family I I I I
I I I I
I1 111 111
111 111 111 111 111 111 111
(%)
96 96 96 100 96 100 100 97 97 96 95 99 95 100
Ref.' Sanz et al. (1989~) Dersimonian e t al. (1987) Dersimonian et a / . (1987) Robbins et al. (1990) Siminovitch et al. (1989) Pascual et al. (1990a) Pascual et a/. (1990) Silberstein et al. (1989) V. Pascual Dersimonian e t a ! . (1987) Dersimonian et al. (1987) Sanz et al. (1989~) Sam et 01. (1989~) Spatz et a / . (1990) Pascual e t al. (1990) Pascual et al. (1990) Pascual et al. (1990) Cairns et 01. (1989)
RF-SJ3 RF-TS2 Ab58 C6B2 2A4 SM-1 CK TMC PR-TS2
LES-C
&
Ab44 FS-2 SMA-3 FS-1 Ab17 AB37 SMA-1 2022 383 LI6/ML1 A10/A431
19.111 19.111
? 71-4 71-2 71-2 12G-1 V"4-21 VH4-21 VH~-21 VH~-21 VH4-21 V"4-21 VH4-21 VH4-21 VH32 V~251 V~251 V~251 VH6 V H ~
RF RF MG Sickle cell Myeloma Hyperthyroid SLE Normal
RA CLL Normal CAD MG CAD Normal MG MG IDDM Normal Fetus Normal
RF monospecific RF monospecific AChR DNAIpNTICL DNA Thyroglobulin Nephritic factor RF monospecific RF po1:rspecific RF Polyspecific Cold agglutinin Striated muscle Cold agglutinin Polyspecific AChR Striated muscle Insu1in Rabies virus Ab-2 DNA, PdT, cyto. c DNA, PdT, cyto. c
111 111
111 IV IV IV IV IV IV IV IV IV IV IV IV V V
V V VI VI
99 97 94 93 86 90 100 100 100 98 96 96 95 87 100 100 98 93 100 98
V. Pascual Pascual et al. (1990a) V. Pascual Hoch and Schwaber (1987) Davidson et al. (1990) V. Pascual V. Pascual V. Pascual V. Pascual Roudier et al. (1990) Sanz et al. (1989c) V. Pascual V. Pascual V. Pascual Sanz et al. (1989~) V. Pascual V. Pascual Sanz et al. (1989c) van der Heijden et al. (1990) Logtenberg et al. (1989) Logtenberg et aE. (1989)
a Abbreviations: SLE, systemic lupus erythematosus; RA, rheumatoid arthritis; CAD, cold agglutinin disease; MG, myasthenia gravis; CLL, chronic lymphocytic leukemia; RF, rheumatoid factor; IDDM, insulin-dependent diabetes mellitus. Abbreviations: PdT, poly dT; cyto. c, cytochrome c. References without dates are unpublished observations.
46
VIRGINIA PASCUAL AND J. DONALD CAPRA
derive from a different subset of germ-line genes or that they are subjected to extensive somatic mutation. A second group of autoantibodies that has been extensively studied at the serological level is the anti-DNA system. Over 20 public idiotypes have been described since the initial report by Shoenfeld et al. (1983).The majority of them recognize monoclonal antibodies derived from the peripheral blood of patients with systemic lupus erythematosus (SLE) or leprosy and bind DNA and synthetic polynucleotides, although some also recognize cardiolipin and/or have RF activity. Anti-DNA antibody cross-reactive idiotypes are not thought to be markers for pathogenic antibodies. Isenberg et al. (1984) showed that levels of the 16/6 idiotype (Id) in SLE were higher in patients with active disease (54%) compared to those with inactive disease (25%). They also reported that the idiotype was not disease specific, as it was present in 25% of patients with RA and 4% of normal controls. Antibodies bearing the 16/6cross-reactive idiotype have been also detected in 37%of patients with Klebsiella infections (ElRoiey et al., 1987),as well as in patients with M . tuberculosis (Shoenfeld et al., 1986b),and there is a substantial degree of idiotypic sharing between lupus- and leprosy-derived antibodies (Mackworth-Young et al., 1987). Crossreactive idiotypes of anti-DNA antibodies have also been detected among monoclonal paraproteins, and the correlation between idiotype expression and DNA binding has been analyzed: whereas the 16/6 Id is present in 8.7% of myeloma proteins, only 1.9% also binds DNA (Shoenfeld et a!., 1986a). On the other hand, a recently described cross-reactive idiotype (F4) present on 12% of myeloma proteins (mainly of the IgG isotype) is strongly associated with anti-DNA activity (Davidson et al., 1989). The third system of human autoantibodies that has been analyzed in detail at the idiotypic level are the antiacetylcholine receptor antibodies present in 90% of patients with myasthenia gravis. Even though the antiacetylcholine response in these patients is clearly polyclonal, substantial sharing of idiotypes has been shown using either polyclonal rabbit antiidiotypic antisera or murine monoclonal anti-Ids that inhibit 50-69% of antigen binding to human antireceptor antibodies (Levfert et al., 1982, 1986, 1987). Finally, we should briefly introduce the cold agglutinin system. Williams et al. (1968) used the term cross-spectJicity to describe the antigenic similarity observed among this particular group of antibodies when tested against polyclonal antisera prepared against individual cold agglutinins. Twenty two years later, Silverman and Carson (1990), using antipeptide reagents directed against framework and hyper-
Ig HEAVY-CHAIN VARIABLE REGION GENES
47
variable regions from the six human V H families, determined that the structural basis for the cold agglutinin cross-reactivity was actually the usage of a particular subset of genes from the VHIV family. Recent sequencing data from our own laboratory, which will be described below, confirm these results and provide further evidence for the role of specific V H genes in the generation of autospecificities.
3.
VH
Usage among Human Rheumatoid Factors from Patients with RA
In an attempt to elucidate the relationship between monoclonal paraproteins with R F activity and the polyclonal population of R F present in patients with RA, we have analyzed the molecular structure of eight RFs derived from the synovial membrane of two patients with classical RA and one with the juvenile polyarticular form of the disease, as well as two RFs derived from the peripheral blood lymphocytes of one patient with classical RA and another patient with SLE. Because the synovial membrane is not only one of the most severely inflamed tissues in patients with RA, but also the most important source of plasma cells secreting immunoglobulins with R F activity (Natvig and Munthe, 1975),we consider that our sample is representative of the R F involved in the pathogenesis of disease. The results of these studies are summarized in Table IV. Of the nine clones analyzed by our group and another recently published by Robbins et al. (1990), also of synovial origin, six use V H gene segments from the VHIII family, three use VHI gene segments, and one, the only polyspecific TABLE IV CHARACTERIZATION OF HUMAN RF ISOLATEDFROM THE SYNOVIAL MEMBRANEOF PATIENTS WITH RA AND SLE. RFAN AND KES DERIVE FROM PBLs. Clone
Isotype
Donor
Specificity
RA RA RA RA RA RA RA RA
Monospecific Monospecific Monospecific Monospecific Monospecific Monospecific Monospecific Monospecific Monospecific Monospecific Polyspecific
RA SLE RA From Robbins et al., 1990.
VE, family
JH
48
VIRGINIA PASCUAL AND J. DONALD CAPRA
RF present in the sample, uses a member of the VHIV family. Regarding the genetic origin of these autoantibodies, out of the seven VHIII gene segments studied, two (RF-KLl and RFAN) seem to derive from V~26-likegerm-line genes and four (RF-SJI, RF-SJ2, RF-SJ3, and RFTS2) from 19.ZZZ/hv3005-like germ-line genes. In this second group, the percentage of identity reaches 99.4% at the nucleotide level, with only two nucleotide substitutions within the coding region, between RF-SJ2/hv3005 and RF-SJ3I19.111, respectively. Recall that V ~ 2 6 , 19.111, and hv3005 are three of the VHIII genes present in the fetal VH repertoire. Actually, 3005 is very likely the polymorphic counterpart of the 56Pl gene segment, the single most represented gene in the two fetal samples studied by Schroeder et al. (1987,1990). We were able to clone and sequence from the donor of RF-SJ2 a germ-line gene 100% identical to the fetal 56P1, which is with a high probability the actual origin of this particular RF heavy chain (Pascual et al., 1990a). Among the VHI RFs, only one seems to have an obvious germ-line counterpart; RF-TS1 is 95% homologous at the nucleotide level to the 51P1 gene segment, again a member of the fetal repertoire. The 51 P1 gene segment is the prototypic VHI gene segment in the RF system: it bears the idiotype recognized by the Mab G6 (Mageed et al., 1986), which in association with VKIIIb light chains defines the classical Wa( +) major cross-reactive idiotype described in a subgroup of RF monoclonal paraproteins (Kunkel et al., 1973, 1974). The other two VHI RFs (RFTS3 and HAFIO) do not display significant homology with either VHI germ-line genes or any of the VHI R F paraproteins. Finally, PR-TS2 is the only polyreactive RF in our sample derived from the synovium of one of the patients presenting with the classical form of RA. Its nucleotide sequence is identical to the VH~-21germ-line gene segment, a member of the VHIV family that, as we will discuss bdow, seems to be overrepresented among human autoantibodies (Fig. 17). 4 . VH Usage among Anti-DNA Antibodies from Patients with SLE
The VH gene segments expressed in anti-DNA antibodies include two sequences from patients with SLE (18/2 and 21/28), one from a patient with leprosy (8E10, which is included in this group because of its identity with the heavy chain of the antibody 21/28), and one from a myeloma patient (2A4), which is included because it is the only IgG anti-DNA antibody sequenced so far that expresses the cross-reactive idiotypes (31 and F4) frequently found in patients with SLE (85 and 60%, respectively). Antibody 18/2 is a polyspecific IgM that expresses the 16/6 cross-reactive idiotype (Dersimonian et al., 1987).Its heavy chain is 100% homologous to the germ-line V~26Ifetal30P1 gene
Ig HEAW-CHAIN VARIABLE REGION GENES
49
FIG.17. Distribution of expected versus found V H families among 40 human autoantibodies sequenced by our group (Sanz et al., 1989~;Pascual et al., 1990b; V. Pascual, unpublished data).
segments. As mentioned above, 16/6(+) antibodies are seen in a variety of conditions in addition to SLE, but their presence in kidney samples from patients with lupus nephritis is well documented (Isenberg and Collins, 1985), suggesting that they might play a pathogenic role. Antibodies 21/28 and 8E10 (Dersimonian et al., 1987) are also polyspecific IgMs and utilize a VHI gene segment. Antibody 2A4 is the only IgG anti-DNA antibody sequenced (Davidson et al., 1990). It derives from the EBV-transformed bone marrow B cells of a patient with multiple myeloma and expresses a V H gene segment from the VHIV family with 24 nucleotide differences compared to its closest germ-line counterpart, the V71-2 gene segment (Lee et al., 1987), which results in the net gain of two positive charges, a well-known characteristic of antibodies binding DNA. Considering that the F4 cross-reactive idiotype has also been identified on IgG anti-DNA antibodies expressing VHIII gene segments (Davidson et al., 1990), it seems likely that this particular idiotype is generated as the result of somatic mutation in the context of antigenic selection.
50
VIRGINIA PASCUAL AND J. DONALD CAPRA
Besides anti-DNA, another set of antibodies worth mentioning in this regard are the anti-Sm. Even though they do not play a known pathogenic role, it is well established that these autoantibodies arise specifically in patients with SLE, and the frequency of their precursors in the normal population, as oppossed to the vast majority of autoantibodies, is extremely low, Sanz et al. (1989b) sequenced the heavy chain of one IgM anti-Sm antibody (4B4) and found that the nucleotide sequence was 100% identical to the germ-line 9.1 gene segment (Berman et al., 1988)and its fetal correlate, 20P1 IM26 (Schroeder et al., 1987,1990).Once again, a linkage between the fetal and autoimmune repertoire is evident.
5 . V H Usage among Autoantibodies in Patients with Myasthenia Gravis Antiacetylcholine receptor antibodies are the hallmark of patients with myasthenia gravis (MG). These antibodies have been shown to transmit the disease to animals and to cross the placenta and are involved in the pathogenesis of neonatal MG. In collaboration with A. Levfert we have sequenced three anti-AChR antibodies from EBVtransformed B cell lines derived from the PBL of patients with MG. Agreeing with the known polyclonal nature of the response, we found that the three antibodies studied belonged to the VHV, VHII,and VHIII families. Ab37 is an IgM that displays at the heavy-chain level 100% identity with the V ~ 3 2germ-line gene, one of the two functional members of the VHV family. The heavy chains of the other two antibodies, Ab19 and Ab58, both of the IgG isotype, do not have any obvious germ-line counterpart. Ab19 shows less than 88% homology with the only known VHII sequence (HVCE-I),and this is also the case for Ab58 when compared to the known VHIIIgerm-line sequences (V. Pascual, A. Lefvert, and J. D. Capra, unpublished data). A second system of autoantibodies present in patients with MG is the one defined by antistriated muscle reactivity. These autoantibodies are present in 30% of patients with the disease, and the frequency increases to 95% when there is an associated thymoma. They react with identical components of skeletal muscle and thymic myoid cells and are produced locally in the thymus. In collaboration with Dr. Vanda Lennon (Mayo Clinic), we have sequenced the heavy chains of three antistriated muscle antibodies, one IgM, and two IgGs. Similar to our results in the anti-AChR system, we found expression of members of the VHV, VHIII, and VHIV families. The IgM antistriated muscle antibody, SM-1, at the heavy-chain level, is 100% identical to the V~251, a functional VHV gene segment. SM-2 uses a member of the
Ig HEAW-CHAIN VARIABLE REGION GENES
51
VHIII family with no obvious germ-line counterpart in the same way as the anti-AChR antibodies described above. SM-3 expresses the VH4-21 gene segment, displaying 96.5% homology at the nucleotide level to this gene segment. Eight out of ten nucleotide substitutions scattered throughout the frameworks and hypervariable regions encode amino acid substitutions, suggesting selection at the protein level, indicative of an antigen-driven response (V. Pascual, V. Lennon, and J. D. Capra, unpublished data). 6. V H Usage among Human Cold Agglutinins Cold agglutinins are antibodies that bind to the surface of erythrocytes and cause agglutination in the cold (4°C). Even though the vast majority of cold agglutinins occur in lymphoproliferative syndromes, we include them in this section because of the direct role they play in the generation of clinical symptoms. Cold agglutinins directed against I/i carbohydrates on human red blood cells share cross-reactive idiotypes (Williams et al., 1968);using antipeptide reagents it has been shown that they use members of the VHIV family (Silverman et al., 199Oa,b).Stevenson et at. (1986)described a Mab (9G3) that reacts with neoplastic cells that secrete cold agglutinins, as well as against the normal B cell counterparts of these neoplastic cells from normal adult lymphoid tissue and fetal spleen at 15 weeks of gestation (Stevenson et al., 1989). As part of a collaborative study, we have determined the nucleotide sequence of two of these cold agglutinins derived from two patients with B cell lymphomas and found in both cases expression of the V A - 2 1 gene segment (Pascual et al., 1991).A common substitution in CDRl of both autoantibodies results in the replacement of an aspartic acid for a glycine. The availabiiity of a cell line expressing the VH4-21 gene segment in germ-line configuration (PR-TS2)allowed us to establish that the structural basis for the cross-reactive idiotype is the v ~ 4 - 2 1gene segment itself, and that amino acid substitutions in the CDRs are very likely responsible for the acquisition of cold agglutinin activity. D. CONCLUSIONS From the sequences we have discussed, we can draw several conclusions. (1)VH gene segments encoding autoantibodies in normal and autoimmune situations seem to derive from the same germ-line pool. Autoimmunity is not the result of the inheritance and/or expression of a particular set of genes present only in individuals with disease. (2) Most of the IgM autoantibodies in normal and autoimmune situations express VH gene segments in germ-line configuration. Most ofthe
52
VIRGINIA PASCUAL AND J. DONALD CAPRA
IgG autoantibodies seem to arise by somatic mutation, probably as the result of antigenic selection. Exceptions occur, as in the cold agglutinin system. Antibody systems that express members of the large V H families, such as the RFs, are difficult to evaluate in this regard, due to the lack of information about the complete repertoire of VH genes in the germ line. (3)There is a connection between V H genes expressed in autoimmune situations and the fetal V H repertoire. It remains unclear whether the recognition of self is a fundamental characteristic during the ontogeny of the immune system, and whether a failure in the normalization of this fetal repertoire accounts for the development of autoimmunity later in life. (4)As Fig. 17 shows, the distribution of V H genes expressed in humans indicates an overrepresentation of certain V H families and particular V H gene segments, such as the 19.ZZZI56Pl and the v~4-21gene segments. An important question remains unresolved: Why does the human immune system chose to overexpress some genes instead of recruiting diversity from the germline repertoire? If we examine recent data from other animal systems, such as the chicken and rabbit, a more dramatic picture emerges in this regard (Reynaud et al., 1989; Knight and Becker, 1990):an extremely restricted set of V H genes is responsible for the diversity of almost the entire repertoire. The limited number of functional germ-line genes, together with an efficient mechanism to introduce pseudogene sequences in the expressed repertoire through gene conversion events, seems to be the explanation in the chicken. In humans, many more studies are necessary before drawing such conclusions, and to resolve these questions a more extensive knowledge is required of the repertoire in pathologic as well as in normal situations (with special attention to responses against foreign antigens), together with a detailed analysis of the regulatory mechanisms that govern gene rearrangement and expression, B and T cell interactions, etc.
VIII. Regulation
A. INTRODUCTION A greal deal of excitement was generated not only in immunology but in the entire field of cell and molecular biology by the discovery in the early 1980s of tissue-specific enhancers (Dunn and Gough, 1984). These elements were the first cellular (rather than viral) enhancers to be well documented and were of particular interest because they displayed well-marked cell specificity, active only in lymphoid cells.
Ig HEAW-CHAIN VARIABLE REGION GENES
53
The expression of immunoglobulin genes is restricted to the B lineage and thus represents an attractive model system for the study of tissue-specific gene regulation. Transfection experiments with mutated genes revealed promoter and enhancer elements on both heavyand light-chain genes that are required for tissue-specific expression (Banerji et al., 1983; Gillies et al., 1983; Bergman et al., 1984; Falkner and Zachau, 1984). Two critical regions of both immunoglobulin heavy- and light-chain genes include a region upstream of known promoter elements that has been called the conserved decanucleotide (ATGCAAATNA), within which is a more highly conserved octanucleotide (ATGCAAAT) (Falkner and Zachau, 1984; Parslow et al., 1984).This octanucleotide also occurs in a variety of other mammalian genes and in the SV40 enhancer. Promoters and enhancers represent two classes of DNA elements that appear to cooperate in the control of efficient transcription. Enhancer elements can potentiate transcription from an appropriate promoter region in a tissue-specific manner somewhat independent of their orientation or distance from the promoter. The promoter region contains sequences upstream from the transcription initiation site that are involved in the tissue-specific activation or repression of transcription. Although it is still not completely clear how these DNA elements function, it has been demonstrated that they specifically bind nuclear proteins that are involved in the control of gene expression. As mentioned above, immunoglobulin genes are expressed specifically in cells of the B lymphocyte lineage. Very early in B cell differentiation, the heavy-chain locus becomes transcriptionally active and the variable region gene segment is assembled from various components by DNA rearrangement. As discussed previously, DNA rearrangement is accomplished in two steps: D to J ~ and I V to D/JHjoining, with the first rearrangement sometimes occurring in T cells. Transcription of the heavy-chain gene is tissue specific and is restricted to B and T lymphocytes, implying that lymphoid cells contain transactivating factors required for heavy-chain gene activation. Because complete V-D-J joining is restricted to B cells, only these cells can synthesize functional heavy chains. IN CONTEXT B. THEPROBLEM
The regulation of immunoglobulin gene expression is of fundamental importance not only to issues of development but to issues of autoimmunity. Immunoglobulin genes are expressed at specific times in development and there appears to be a significant relationship between those genes expressed early in development and those genes
54
VIRGINIA PASCUAL AND J. DONALD CAPRA
expressed in autoimmunity (see Section VII). It is unclear if these two issues are related, although a growing body of evidence suggests that they are. Fundamentally, there are two likely possibilities. Either the expression of genes early in development sets the immune system in such a way that stimuli later in life reactivate similar genes, or the process of autoimmunity somehow interferes with developmental regulation in some way such that the proteins involved in such regulation are altered. Thus, one can view autoimmunity as either a process that is driven by antigen and/or idiotype interaction with B cells and/or T cells at the combining site, thereby influencing gene expression, or, that the very process of regulation (DNA-binding proteins and the like) is altered to, in a sense, recreate the fetal or developmental milieu. C. THEOCTAMER AND OTHERPROMOTER REGIONELEMENTS All humans and murine immunoglobulin heavy-chain variable region genes contain the sequence ATGCAAAT approximately 70 nucleotides 5’ from the site of transcription initiation. This octanucleotide, in reverse orientation, is also found in all light-chain variable region genes (Parslow et al., 1984; Falkner and Zachau, 1984), and in the immunoglobulin heavy-chain transcriptional enhancer (see later). Earlier transfection studies established that this octamer was involved in the lymphoid-specific transcription of immunoglobulin genes. Further analysis of this region suggested that, in addition to the octamer, a heptamer (CTAATGA) and a pyrimidine-rich region further upstream were also essential for the function of immunoglobulin heavy-chain promoters. The critical importance of this octamer (or decamer) was demonstrated in many laboratories, including that of Dreyfuss et al. (1987), who introduced the decanucleotide at a position similar to the upstream flanking sequence of the mouse renin gene. This single alteration of the mouse renin gene resulted in the renin gene being tissue specific in a fashion similar to that in immunoglobulin heavychain genes. The gene remained inactive in nonlymphoid cells but became a potent promoter in B cells, especially when associated with SV40 or immunoglobulin heavy-chain enhancers (see later). In all respects, the engineered fragment behaved like an authentic VH promoter. A complication in making a direct jump from the octamer motif to complete control of immunoglobulin transcription, including tissue specificity, is that the octamer motif has been found in a variety of eukaryotic regulatory elements, including promoters, enhancers, and origins of replication. Some of these elements are constitutively active in all cell types whereas others direct cell type-regulated or tissue-
Ig HEAW-CHAIN VARIABLE REGION GENES
55
specific activity. In the case of the small nuclear RNA genes and the histone H2b gene, deletion of the octamer greatly reduces transcription and in the latter case also eliminates cell cycle regulation. In both the heavy- and light-chain immunoglobulin gene promoters and in the heavy-chain enhancer, an intact octamer has been shown to be necessary to direct B cell-specific transcription. Several proteins that specifically bind the octamer sequence have been identified in nuclear extracts (Landolfi et al., 1986; Scheidereit et al., 1987; Hanke et al., 1988; Lebowitz et al., 1988) and most of these have now been cloned and sequenced. OTFl (also called Octl, NFl, OPB100, and NF3) has been found in all tissue types tested whereas others (OTF2; also called Oct2 and NFA2) are found almost exclusively in lymphoid cells. Recently it has been shown that several of the proteins that are involved in binding to the octamer DNA motif contain a functional homeobox domain. The homeobox is a 180-bp protein coding sequence found in nearly every eukaryote that has been investigated, spanning a broad evolutionary spectrum from yeast to man (Levine and Hoey, 1988). Originally considered the key to segmentation in flies, the homeobox has assumed a even broader role in recent years. No longer restricted to developmental processes in Drosophila, the homeobox appears to be an essential element of many DNA-binding proteins that act as transcription factors. Scheidereit et al. (1988) isolated the human lymphoid-specific transcription factor, OTF2, and showed that it contained a homeodomain that was required for DNA binding and that bound specifically to DNA elements that are recognized by Drosophila homeodomain proteins. They were also able to show that OTF2 was encoded by a single-copy gene and, importantly, that its cell type specificity was regulated at the level of mRNA abundance. OTF2 thus became the first mammalian homeobox protein for which a specific function was demonstrated. It is important to appreciate that studies using Drosophila indicate that a given DNA site can be recognized by distinct homeoproteins and that a given homeobox protein can recognize more than one site-suggesting that there are regulatory interactions between homeobox genes. The activity of a given gene is probably determined by the relative affinities and concentrations of the interacting factors. KO et al. (1988) mapped the homeobox gene to human chromosome 19 and demonstrated by sitedirected mutagenesis of the homeobox domain that they could abolish DNA binding. Unexpectedly, OTF2, the yeast mating type protein, and the Drosophila homeobox protein were found to recognize similar DNA motifs, suggesting that all homeobox proteins may bind to ATrich, immunoglobulin octamer-like sequences.
56
VIRGINIA PASCUAL AND 1. DONALD CAPRA
Essentially all immunoglobulin heavy-chain genes that have been expressed contain octamer motifs. In addition, there are other motifs further upstream that seem characteristic of immunoglobulin heavychain genes. These have been described in some detail by Chen (1990) (see later).
D. THEENHANCER ELEMENT Transcriptional enhancers appear to facilitate the establishment of active transcription by aiding the assembly of transcription complexes. In particular, enhancers have been proposed to control the establishment of heavy- and light-chain gene expression that occurs in pre-B and mature B lymphocytes, respectively (Alt et al., 1988). Subsequently, Ig gene expression is stably maintained during cell proliferation and cell differentiation. Studies in which cloned, rearranged heavy-chain genes have been introduced into cultured cells show that expression of these genes is dependent on the presence of a transcriptional enhancer. When the enhancer is mutated, expression is impaired by several orders of magnitude (Gillies et al., 1983).A p heavychain gene lacking the enhancer is transcriptionally inactive even when transferred into the mouse germ line. This suggests that the Ig enhancer is required for establishment of active transcriptional states during normal B cell differentiation (Queen et al., 1986; Wang and Calame, 1985). Enhancer sequences that activate transcription from eukaryotic promoters were discovered in the SV40 virus and subsequently in many other viruses (Gruss et al., 1981).Immunoglobulin genes were among the first of several eukaryotic genes to have enhancers identified. Several models have been proposed to describe enhancer activity. One model suggests enhancers provide a bidirectional entry site for polymerase or other transcription factors (Moreau et al., 1981).Other models suggest protein interactions between factors bound at enhancers and promoters, binding of topoisomerases to enhancer regions, changes in the general form of chromatin structure, or enhancermediated targeting of promoters to particular regions of the nuclear matrix. The enhancers of immunoglobulin gene transcription are located in the intron between JK and CK, J H , and Cp, but downstream of the poly(A) site in lambda. Proteins have been purified that bind to the human immunoglobulin enhancers (Gimble et al., 1988).The K B motif (GGGACTTTCC) occurs in the 5' region of the enhancer and appears to bind a trans-acting factor that is largely responsible for the tissue specificity of K gene expression (Sen and Baltimore, 1986). Similar
Ig HEAVY-CHAIN VARIABLE REGION GENES
57
sequences are found in the enhancers of SV40 and human immunodeficiency virus long terminal repeats (HIV LTRs). Just downstream of the K B motif is the first of the so-called E motifs. These octamer motifs (consensus CAGGTGGC) were first identified in heavy-chain enhancers as sites of protein binding detected b y altered susceptibility to in uivo methylation b y dimethyl sulfate. I n the K murine enhancer, three E-like motifs are present. Recently, Chen (1990) has described a region of immunoglobulin VH genes containing two partial repeats, GGGGGaaaTCA and GGGGGcgcTCA (the capital letters represent the matched nucleotide and are homologous to the enhancer nuclear factor K B motif). This motif was first identified as a nuclear factor binding site in the murine K light-chain enhancer region and was subsequently shown to be important to enhancer activity. This motif was also found in the enhancers of human immunodeficiency virus (GGGACTTTCC)and SV40 virus and in the upstream regulatory region of the class I major histocompatibility complex genes. In addition, it was demonstrated that a single copy of K B motif could act as an activating element, whereas a dimer of the K B motif introduced a 10-fold increase in the transcription of a recorder gene. T h e precise function of both upstream and downstream characteristic sequences in the human VH genes is at present unknown. However, as Chen points out, the presence of this enhancer motif in a gene that is known to be ) it may be a candidate to developmentally regulated ( V ~ 2 6suggests explain developmental regulation (see Fig. 18). Chen has proposed that if transcriptional reguiatory elements are involved in the program rearrangement and expression of VH genes expressed early in ontogeny, they would be expected to share special promoters. H e undertook a detailed sequence analysis of two particular VH genes known to be developmentally regulated as well as several others that were available in the literature, as well as pseudogenes. H e concluded that these elements were characteristic of developmentally regulated genes and were badly divergent in pseudogenes. Chen reports that the human hu3005 gene contains in addition to the conserved octamer promoter a single completely matched octamer sequence, 9 octamer-like sequences (7/8 matches), 13 E-motif-like sequences, and a single SV40 enhancer motif. As noted previously, genes for two octamer-binding proteins have recently been shown to contain homeodomains. Thus it seems likely that the mammalian homeobox-containing genes are also involved in the regulation of tissue and organ development. Similar to human hu3005, V ~ 2 has 6 many sequences that are identical or homologous to Ig enhancer motif octamers, the Apl/C Jun binding site and the SV40
-8-mer
-280
3005
VH26 2.9111 -168
3005 VH26 H11 12-2
VH105 71-6 2.9111
........................................................................................................
3005 VH2 6 13-2 6-18 9-1 Hll
-4 I( E F G L S W V F L V A L L R Gab T C A C C A n ; G A G ~ C ~ ~ C ~ ~ ~ A f f i ~ ~ ~ G ~ T A G . ~ ~ C N ; A C T G n ; ) r G T G M ; M U n ; A G T G A G ~ C . . T - 4G8 C A C I T G T C T C T T C A A A A A T A G T A C AG AC C T T A A CA T G A GG A G AG G A T A A C T TC G G AG A T C A A T C T I C G G AG A A T A A T C . G TTC A G T GAG C T T A CA T C TGT A G G G AG
12z2
TTT
........
c
CNT
T
A
TA
. C
WT
C A
T
G
G
G G G G
....
....
1.9111 22-28 VH105 71-6 15-28 2-3 3033 2.9111 25 73
3005,l. 9 VH26
13-2 8-18 9-1 H11 12-2 22-28 vH105 71-6
15-28 2-3.3033 2.9111
G G G
c A C
.
CC CC C CC CC. CC
.
G TC G .'KT CG T TC G G T T T ACAC T A W
c A
C
G G G G
C A
T T A
T T T T
A A h A
M A M C M A G A
AG AG
G G
A T
G I
A
G 3005
~
F
A
T
~
~
T
VH26 13-2 8-16 9-1
S
C T
cDR2
CDRlA I ~ C C C AC A CTAC AIGCCFOG ~
A C
G
T
H A
C
Y V R ~ G T ~ A T
AG A
A G
G
A
A
AG
Mi
Y11
CcK;c
VHlOS, 71-6
8-16 9-1 H11 12-2 1.9111 22-26 VHlO5 71-6 15-26 2-3,3033 2.9111
TA TA A
CTAC CTAC CTCA
A
T
NNG
AG G AG C A A l T C
G
G
G G
G
C
G T
G
A
G
C C
G G G
0 G 0 G 0
L ~
A A
A
TG
A
A
A
TG
A
T
G
C
A G
G
G
A
AOTTC A T A
G
A A A
A A
A
A
G T
A
C G
A
G G
G
G
TACACAACTAGGGCCACGA AG C A C . G T CF
T T OACACC GACACC
T
C A
C
A
T T I T A
T C C T C C T I A G TCACC T A CCCT
G .
M G G
A A C C A A C
---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+ T T T T T
....
CAC C ...... TC ACAG AG T A G ffimAC C A A-C TAGACAAfXcTl3CU;CACGA
T
A
...... .........
......
..
A A
CG T
YI S V YA D VC $ W . . I Y Y A D S 63 T C ~ ~ ~ ~ ~ ~ A ~T T AA ~T A C C CA~ AT C1A 9T3 ~ CT C AG T GG GGTAGC C CT C TCGCOGTCACC TC G cr T ATAGC G T C C TCCCG TMACCAMCFWGGUiGIUCG T CAC CO TAATAG G GCCACG G
G ~ C L T A T G ~
C AG
T
A C CTAC C AG
15-26 2-3 3033 2.9111
? C
G G
A
C
C
T
FIG.18-Continued
A
A C C A T A
C T A C T A C
C A A C
G
C
G
C C
G'KAUGGCACA T T T A C T C AT T GC
~
T
M
3005 VH2 6 13-2 8-18 9-1 H11 12-2 1,9111 22-28
VH105 71-6
15-28 2-3 3033 2.9111 3005 VH26 13-2 1.9111
7 -mar4 **Q-m.K** A C A C A G ~ ; A G C G G M C ~ A T N ~ ~ ; C G C C C A ~ C A ~G C ~GC G ~ MG ~ G . G I M T U G C C G C ~ ~ C A ~ T C A G A G ~4 3 C 3 C ~ ~ A G C G T GCA A G A A A Tcc T A C T C A G C
G G
C
G A
G
A A
G
A
G
. ............................................................................ ............................................................................... G C T A ACCA GCGGT K C T G ............................................ ............................................................................
A ........................... ....................................................... .................................. ......... .... c GG T T C CACGCCA GT ............................................................................ GG cc ....... .c AC AG c .GG c Gc CAGGA c XCC A AC .... A CTCTC GCTA M A C A M C GGGAAG ...........
C GTC CTT M C T M;c GC CC L A C C C... -____-_--+-_-------+---------+---------+---------+---------+---------+---------+---------+---------~---------+---------+ A G A C A CCAC G G A G . C G A GCAT C A C ACA G r. c. .A A. G A CGTC CA M A C CTAGG C CGCCA A A GT
-
TAG
A
M
G G
CA
G
A
G G C
M
A A
C G
A
G AT T
.................................
T G C A G A ~ ; G A ~ ~ ~ C T . G T T T C ~ T C A G G A T G ~ ; G G A C ~ G T C T T C I TT C T~ ; ATC A G . T T CCT CCC CCA ~CAG M C CTT T C F T ~ ~ A G ~ ~ ~ C C T M C M T G T C T T C T C T A 5T5G1 C A T A T G A ~ G
G
CA ...
A
T T C
T
T T
CN;
A
c c c TT .................................
15-28 3033
FIG.18. Comparison of several human VHIII germ-line genes. The complete nucleotide and amino acid sequences of human hc3005 are given, and sequences of other genes are given only at the positions where they differ from the ho3005 sequence. The potentially functional genes are on the top, and are separated from the pseudogenes at the bottom by a dashed line. All sequences were aligned for maximum homology. The introduced gaps are marked by dots, which also indicate the unsequenced regions. To reduce the complexity of the figure, nucleotide sequences of different genes are listed together in one line when they are identical over that specific region. The conserved nucleotide sequences for the promoter, for splicing, and for rearrangement are marked. The potential enhancer-like sequences and the two characteristic stretches for the early-expressed V H genes are underlined. Genes 13-2,8-1B, 9-1,12-2,1.9111,22-2B,15-2B,2-3, and 2.91ZI were reported by Berman et al. (1988);H 1 1 , VH105, and 71-6 were reported by three different laboratories (Humphries et al., 1988; Kodaira et al., 1986; Rechavi et al., 1983). From Chen (1990).
Ig HEAVY-CHAIN VARIABLE REGION GENES
61
enhancer GT/C motif. As is shown in Fig. 19, two E-motif-like sequences are shared by all VHIII functional genes and two other Emotif-like sequences and one octamer-like sequence are conserved in both functional and nonfunctional genes. Chen suggests that in the VHVI gene (the most DH proximal), its location may account for its programmed expression in the fetus. However, the other genes that are expressed in the fetus (and in the autoimmune repertoire) d o not appear to be J proximal. The possibility, therefore, is suggested that specific DNA sequences either at the promoter or in the enhancer region of these genes dictate their regulation. IX. Conclusions
As the organization, polymorphism, and expression of human immunoglobulin genes begin to be understood, certain general conclusions seem evident. At the organizational level, it remains striking that over half of the gene segments in the VHI and VHIII families appear to be pseudogenes, whereas the VHIV, VHV, and VHVI families contain so few. Too little is known about the VHII family to draw conclusions in this regard. Thus, the “larger” families are replete with pseudogenes and the smaller families are not. This notion, coupled with the apparent use of only a few of the members of the larger gene families in the fetal and autoimmune repertoires, suggests that the major mechanism of diversity in the larger families may be gene conversion. Because only half of the VHIV genes have been seen in expressed antibodies, the possibility exists that in the VHIV family this process also takes place. Ifthis conclusion is correct, then the functional human VH germline repertoire is considerably smaller than previously estimated. Mechanisms of diversity discovered only within the last few years will undoubtly play an increasingly important role in the development of the adult repertoire. Another conclusion that seems inescapable from an analysis of the germ-line organization of human V H genes concerns the differences between genes within the family. Strikingly, selection appears to be on the CDRs in the course of evolution. Though this view is neither novel nor heretical, because so many V H genes are now known in the human system, the finality of that conclusion seems more powerful. Thus, the forces that lead to diversification and selection in the somatic cells are likely to be similar to those that lead to preservation of specific V H genes in the germ cells. We are still not clear as to why more than one V H gene is necessary. However, studies on highly restricted immune responses (such as the cold agglutinin antibodies) should in the very
62
VIRGINIA PASCUAL AND J. DONALD CAPRA HAUE
POSITIONS TO
UATCHES
SEQUENCE
FROM,
Enhancer oCTA notif 1. nurine Ig Enhancer OCTA hv3005 -1036, - 1 0 4 1 hVl005 -1679, -1672 hvl005 -076. -869 hVl005 -519, -526 241 hv1005 240. 522 hvl005 529, hvl005 562, 555 hvl005 504, 577 VH26 -604. -611 VH26 240. 241
A T T T G C A T A T T T G c A T - c -
2. Human Ig Enhancer OCTA hv3005 .-1571. -1570 hv3005 -54, -47 VH26 -1391. -1198
A
A.
4 .
HhE2 hv3005 VH26
-642,
7. UkEl hvl005 hv1005 hv3005 VH26 VH26
8. UkEl' hv3005 VH26 9. HkEl'
hv3005 hv3005 VH26
10.UkEl VH26 VH26 ll.HkE3 hv1005 hv1005
c.
-------- -- ca -- -- -_ - _- _ - - - - t - - - - - - c - - -
- - - - - _- 4 c
G T
- - _ - _t - - _ _ _t
- -
T T T
G
- 9 - - - - - - -
A A C A T G G C A A G A T C C C
-146,
5. m c 4 6. HhE4 hvlOO5 VH26 VH26 VH26
a - - - - - a - - -
150. 157 51. 60 -1164, -1157 -1073, -1066
MhE2 hv3005 VH2 6
vnac
-----
-----
C A G C T C C C 9 3 79 100 79 1 0 0 71 100 64
frequency
3 .
- - -
E notif
8. I q Enhancer
1 . UhEl 2. HhEl hv3005 hVl005
- - - - -
182, 7, 07, -14,
-14,
_- -- c- -_ - _- _- c T
109 14 -139
C A G C
94 -7 -649 -7
_- _- __ _ __ -_ __
536, 529 229, 222 -1823, -1810 -1055, - 1 0 4 0 -206, -199 I4 7,
---C A C C T -----
- -
-
- t -
'I t -
- - - t -- -- -- -_ -- - - c -
---_ -_9 _ ---
417, -701, 410, 74. -356, -696,
81 -349 -703
C A T C T G G C - c -
75, 6, 416, 417,
82 -2 409 410
177,
104 -830 -189
C A T G T C G T
184 162
C A T A T G C T
153
-
-609,
-823,
-196, 177, lS5, 160.
APl/c-jun Enhanc8r VH26 - 1 4 3 1 , -1425 -1318, -1112 VH26
D. SV40 Enhancer GT/C notif hv1005 -1760, -1767 VH26 -941. -941 VH26 -922, - 9 1 5
7 'I
7 7 7
7 7
C A G G T C G T C A G G T C T T
C A G A T C G C
-330,
7 7 7
G G C
73 -602 -321 424 -694 425
80.
7
7 7 7 7 7
C G C
------_
q
7 0 7 7
7 7
a 7
-- -- -- -- -- - -_ _- _- _- _- -__ t _- - - - - - c- -a
-_ -- -_- _- _ _ _
-- -_ -_- _- -_ _ -----_
C A C C T G G a c c
C -
-- -- -- t- -- -_ -_- _ -----_ _ - - - - _aa
-
-------
7 7
7 7 7 8
7 7 7
T C A C T C A
_-__-__
7 7
- -- -- -- -- t- -- --------
7 7 7
G T G G A A A G
C
a
FIG.19. Identification of potential enchancer elements. From Chen (1990).
Ig HEAVY-CHAIN VARIABLE REGION GENES
63
near future shed some light on these issues. Particularly, in the VHIV family it is likely that specific variations in framework and CDRs among distinct members of the VHIV family will allow a precise understanding of the molecular forces that led to the fixing of so many related genes in almost all mammals. Extensive analysis of polymorphisms now provides a clearer understanding of this issue. Though humans are clearly polymorphic in their VH loci, they are not more so than most other model gene systems studied and, indeed, may be less so. Polymorphism of coding segments is present although unusual, and far more common appears to be the presence or absence of specific loci (i.e., V ~ 3 2and V~3005).Apparently, with a number of very closely related germ-line VH genes, the addition or subtraction of a few may have no practical consequences, although this conclusion must be tempered with caution, as more work needs to b e done. However, at least for the system studied, there does not appear to be a role for the presence or absence of specific germ-line V genes in autoimmunity. T h e connection between the fetal and autoimmune repertoire seems both more impressive and perplexing. As more and more autoantibodies are sequenced, it seems crystal clear that by and large their germline counterparts are found in the fetal repertoire and generally not in the general VH structures that have been so patiently sequenced by so many investigators. That is, only certain members of each of the VH gene families appear to be used in the fetus and these same members are repeatedly utilized in autoantibodies far beyond their statistical numbers. The reason for the selective use of specific VH gene segments remains obscure. Likely, however, regulatory elements near the VH genes play a critical role.
ACKNOWLEDGMENTS The authors would like to thank Margaret Wright and Angela Houston for superb secretarial assistance. We are also grateful to our many collaborators who have provided several human antibodies and allowed us to quote some unpublished work: Dr. Bernard Brodeur, Dr. Paolo Casali, Dr. Howard Dang, Dr. Abner Notkins, Dr. Ann Lefvert, Dr. Vanda Lennon, Dr. Sandy McLachlin, Dr. Jacob Natvig, Dr. Lars Ostberg, Dr. Ingrid Randen, Dr. Freda Stevenson, Dr. Norman Talal, Dr. Keith Thompson, and Dr. Susan Zolla-Pazner. The work from the authors’ laboratory was supported by grants from the National Institutes of Health (A1 12127),the Robert Welch Foundation (I-874),and the Council for Tobacco Research (2294-Rl).
64
VIRGINIA PASCUAL A N D J. DONALD CAPRA
REFERENCES Agnello, V., Arbetter, A., d e Kasep, G. I., Powell, R., Tan, E. M., and Joslin, F. (1980). Evidence for a subset of rheumatoid factors that cross-react with DNA-histone and have a distinct cross-reactive idiotype. J. Exp. Med. 151, 1514-1527. Aguado, M. T., Balderas, R. S., Rubin, R. L., Duchosal, M. A., Kofler, H.,Birshtein, B. K., Secher, D. S., Dixon, F. J., and Theofilopoulos, A. (1987).Specificity and molecular characteristics of monoclonal IgM rheumatoid factors from arthritic and non-arthritic mice. J . Zmmunol. 139, 1080-1088. Alt, F. W., Blackwell, T. K., and Yancopoulos, G. D. (1988). Development ofthe primary antibody repertoire. Science 238, 1079-1087. Andrews, D. W., and Capra, J . D. (1981).Complete amino acid sequence of variable domains from two monoclonal human anti-gammaglobulins of the Wa cross-idiotypic group: Suggestion that the J segments are involved in the structural correlate of the idiotype. Proc. Natl. Acad. Sci. U.S.A.78,3799-3803. Baer, R., Chen, K.-C., Smith, S. D., and Rabbitts, T. H. (1985).Fusion ofan immunoglobulin variable gene and a T cell receptor constant gene in the chromosome 14 inversion associated with T cell tumours. Cell (Cambridge,Mass.) 43,705. Baer, R., Foster, A., Lavenir, I., and Rabbitts, T. H. (1988).Immunoglobulin VH genes are transcribed by T cells in association with a new 5’ exon. J . Exp. Med. 167,20112016. Baneji, J., Olson, L., and Schaffner, W. (1983).A lymphocyte-specific cellular enhancer is located downstream of the joining region in immunoglobulin heavy chain genes. Cell (Cambridge, Mass.) 33, 729. Bentley, D. L., and Rabbitts, T. H. (1983). Evolution of immunoglobulin V genes: Evidence indicating that recently duplicated human V sequences have diverged by gene conversion. Cell (Cambridge, Mass.)32,181-189. Bergman, Y., Rice, D., Grosschedl, R., and Baltimore, D. (1984). Two regulatory elements for immunoglobulin gene expression. Proc. Natl. Acad. Sci. U.S.A. 81, 70417045. Berman, J. E., and Alt, F. W. (1990).Human heavy chain variable region gene diversity, organization, and expression. Znt. Rev. Zmmunol. 5,203-214. Berman, J. E., Mellis, S. J., Pollock, R., Smith, C. L., Suh, H., Heinke, B., Kowal, C., Surti, U., Chess, L., Cantor, C. R., and Alt, F. W. (1988).Content and organization of the human Ig VHIcous: Definition ofthree new Vtl families and linkage to the Ig CHlocus. EMBO J . 7,727-738. Bottaro, A., Gallina, R., DeMarchi, M., and Carbonara, A. 0.(1989a).Genetic analysis of new restriction fragment length polymorphisms (RFLP) in the human IgH constant gene locus. Eur. J . Immunol. 19,2151-2157. Bottaro, A., DeMarchi, M., DeLange, G. G., Boccazzi, C., Fubini, L., Borra, C., Cappello, N., and Carbonara, A. 0. (1989b). Human IGHC locus restriction fragment length polymorphisms in lgG4 deficiency: Evidence for a structural IGHC defect. Eur. J . Immunol. 19,2159-2162. Brodeur, P. D., and Riblet, R. (1984).The immunoglobulin heavy chain variable region (Igh-V) locus in the mouse. I. One hundred Igh-V genes comprise seven families of homologous genes. Eur. J . Immunol. 14,922-930. Buluwela, L., and Rabbitts, T. H. (1988).A V H gene is located within 95 Kb ofthe human immunoglobulin heavy chain constant region genes. Eur.]. Immunol. 18,1843-1845. Buluwela, L., Albertson, D. G., Sherrington, P., Rabbitts, P. H., Spurr, N., and Rabbitts, T. H. (1988). The use of chromosomal translocations to study human immunoglobulin
Ig HEAVY-CHAIN VARIABLE REGION GENES
65
gene organization: Mapping DH segments within 35 kb of the C, gene and identification of the new DH locus. EMBO J . 7,2003-2010. Burastero, S. E., and Casali, P. (1989). Characterization ofhuman CD5 (Leu-1, OKTl)+ B lymphocytes and the antibodies they produce. Contrib. Microbial. Immunol. 11, 231-262. Cairns, E., Kwong, P. C., Misener, V., Ip, P., Bell, D. A., and Siminovitch, K. A. (1989). Analysis of variable region genes encoding a human anti-DNA antibody of normal origin. J . Immunol. 143,685-691. Capra, J . D. (1971). A hypervariable region of human immunoglobulin heavy chains. Nature (London)230,61-63. Capra, J. D., and Kehoe, J. M. (1974). Structure of antibodies with shared idiotypy: The complete sequence of the heavy chain variable regions of two immunoglobulin M anti-gamma globulins. Proc. Natl. Acad. Sci. U.S.A.71,4032-4036. Capra, J. D., and Kehoe, J. M. (1975). Hypervariable regions, idiotypy and the antibody combining site. Adu. Immunol. 20, 1-40. Capra, J. D., and Tucker, P. W. (1989). Human immunoglobulin heavy chain genes. J . Biol. Chem. 264,12745-12748. Casali, P., and Notkins, A. L. (1989). Probing the human B cell repertoire with EBV: Polyreactive antibodies and CD5+ B lymphocytes. Annu. Reo. Immunol. 7,513-535. Casali, P., Burastero, S . E., Nakamura, M., Inghirami, G., and Notkins, A. L. (1987). Human lymphocytes making rheumatoid factor and antibody to ssDNA belong to the Leu-l+ B-cell subset. Science 23,77-81. Chen, P. P. (1990). Structural analyses of human developmentally regulated v H 3 genes. Scand. J. Immunol. 31,257-267. Chen, P. P., and Yang, P.-M. (1990). A segment of VH gene locus is duplicated. Scand. J. Immunol. 31,593-599. Chen, P. P., Liu, M.-F., Sinha, S., and Carson, D. A. (1988). A 16/6 idiotype-positive anti-DNA antibody is encoded by a conserved VH gene with no somatic mutation. Arthritis Rheum. 31,1429-1431. Chen, P. P., Liu, M. F., Glass, C. A., Sinha, S., Kipps, T. J., and Carson, D. A. (1989a). Characterization of two immunoglobulin VH genes that are homologous to human rheumatoid factors. Arthritis Rheum. 32,72-76. Chen, P. P., Siminovitch, K. A., Olsen, N. J., Erger, R. A., and Carson, D. A. (1989b). A highly informative probe for two polymorphic VH gene regions that contain one or more autoantibody-associated VH genes. J . Clin. Inuest. 84,706-710. Chen, P. P., R. W., Soto-Gil, R. W., and Carson, D. A. (1990a). The early expression of some human autoantibody-associated heavy chain variable region genes is controlled by specific regulatory elements. Scand. J . Immunol. 31,673-678. Chen, P. P., Silverman, G. J., Liu, M.-F., and Carson, D. A. (1990b). Idiotypic and molecular characterization of human rheumatoid factors. Chem. Immunol. 48,63-81. Chen, P. P., Olsen, N. J., Yang, P.-M., Soto-Gil, R. W., Olee, T., Siminovitch, K. A., and From human autoantibodies to the fetal antibody repertoire to B Carson, D. A. (1990~). cell malignancy: It's a small world after all. Int. Reu. Immunol. 5,239-251. Christoph, T., and Krawinkel, U. (1989). Physical linkage of variable, diversity and joining gene segments in the immunoglobulin heavy chain locus of the mouse. Eur. J . Immunol. 19,1521-1523. Cleary, M. L., Galili, N., Trela, M., Levy, R., and Sklar, J. (1988). Single cell origin of bigenotypic and biphenotypic B cell proliferations in human follicular lymphomas. 1.E x p . Med. 167,582-597.
66
VIRGINIA PASCUAL AND J. DONALD CAPRA
Cox, D. W., Markovic, V. D., and Teshisma, I. E. (1982). Genes for immunoglobulin heavy chains and for al-antitrypsin are localized to specific regions of chromosome 14q. Nature (London)297,428-430. Croce, C. M., Shander, M., Martinis, J., Cicurel, L., D’Ancora, G., Dolby, T. W., and Koprowski, H. (1979).Chromosomal location of the genes for human immunoglobulin heavy chains. Proc. Natl. Acad. Sci. U.S.A.76,3416-3419. Cuisinier, A.-M., Guigou, V., Boubli, L., Fougereau, M., and Tonnelle, C. (1989). Preferential expression of VH5and V“6 immunoglobulin genes in early human B-cell ontogeny. Scand. J . Immunol. 30,493-497. Cunningham, B. A., Pflumm, M. N., Rutishauser, U., and Edelman, G. M. (1969).Subgroups of amino acid sequences in the variable regions of immunoglobulin heavy chains. Proc. Natl. Acad. Sci. U.S.A.64,997-1003. Davidson, A., Smith, A., Katz, J., Preud’homme, J.-L., Soloman, A., and Diamond, B. (1989). A cross-reactive idiotype on anti-DNA antibodies defines a H chain determinant present almost exclusively on IgG antibodies. J . Immunol. 143,174-180. Davidson, A., Manheimer-Lory, A., Aranow, C., Peterson, R., Hannigan, N., and Diamond, B. (1990). Molecular characterization of a somatically mutated anti-DNA antibody bearing two systemic lupus erythematosus-related idiotypes.J. Clin. Inuest. 85, 1401- 1409. Dersimonian, H., Schwartz, R. S., Barrett, K. J., and Stollar, B. D. (1987). Relationship of human variable region heavy chain germline genes to genes encoding anti-DNA autoantibodies.J . Immunol. 139,2496-2501. Dersimonian, H., McAdam, K. P. W. J., Mackworth-Young, C., and Stollar, B. D. (1989). The recurrent expression of variable region segments in human IgM anti-DNA autoantibodies. j . Immunol. 142,4027-4033. Dighiero, G., Lymberi, P., Holmberg, D., Lundquist, I., Coutinho, A., and Avrameas, S. (1985). High frequency of natural autoantibodies in normal newborn mice. J. Immunol. 134,765-771. Dreyfuss, M., Doyen, N., and Rougeon, F. (1987).The conserved decanucleotide from the immunoglobulin heavy chain promoter induces a very high transcriptional activity in B-cells when introduced into a heterolgous promoter. EMBO J . 6, 1685-1690. Dunn, A. R., and Cough, N. (1984). Tissue-specific enhancers. Trends Biochem. Sci. 9, 81-82. Edelman, G . M., Cunningham, B. A., Gall, W. E., Gottlieb, P. D., Rutihauser, U., and Waxdal, M. J. (1969).The covalent structure of the entire y C immunoglobulin molecule. Proc. Natl. Acad. Sci. U.S.A.63,78-85. EIRoiey, A., Sela, O., Isenberg, D., Feldman, R., Colaco, C., Kennedy, R., and Shoenfeld, Y. (1987). The sera of patients with Klebsiella infections contain a common anti-DNA idiotype (16/6 Id) and anti-polynucleotide activity. Clin. Exp. Immunol. 67, 507-515. Falkner, F. G., and Zachau, H. G. (1984). Correct transcription of an immunoglobulin K gene requires an upstream fragment containing conserved sequence elements. Nature (London)310,71-74. Forre, O., Dobloug, J. H., Michaelsen, T. E., and Natvig, J. B. (1979). Evidence of similar idiotypic determinants on different rheumatoid factor populations. Scand.J. Immunol. 9,281-287. Gathings, W. E., Lawton, A. R., and Cooper, M. D. (1977).Immunofluorescent studies of the development of the pre-B cells, B lymphocytes and immunoglobulin isotype diversity in humans. Eur. J . Immunol. 7,804.
Ig HEAVY-CHAIN VARIABLE REGION GENES
67
Ghanem, N., Lefranc, M.-P., and Lefranc, G . (1988). Definition ofthe RFLP alleles in the human immunoglobulin IGHG gene locus. Eur. J . Zmmunol. 18,1059-1065. Gillies, S. D., Morrison, S. L., Oi, V. T., and Tonegawa, S. (1983). A tissue-specific transcription enhancer element is located in the major intron of a rearranged immunoglobulin heavy chain gene. Cell (Cambridge,Mass.) 33,717-728. Gimble, J . M., Flanagan, J. R., Recker, D., and Max, E. E. (1988). Identification and partial purification of a protein binding to the human immunoglobulin kappa enhancer K Esite. ~ Nucleic Acids Res. 16,4967-4988. Cruss, P., Dhar, R., and Khoury, G. (1981).Simian virus 40 tandem repeated sequences as an element of early promoter. Proc. Natl. Acad. Sci. U.S.A.78,943-947. Guilbert, G., Dighiero, C . , and Avrameas, S. (1982). Naturally occurring antibodies against nine common antigens in human sera. I. Detection, isolation and characterization. J . Immunol. 128,2779. Guillaume, T., Rubinstein, D. B., Young, F., Tucker, L., Logtenberg,T., Schwartz, R. S., and Barrett, K. J. (1990). Individual VH genes detected with oligonucleotide probes from the complementarity-determining regions. J. Zmmunol. 145, 1934-1945. Hanke, J. H., Landolfi, N. F., Tucker, P. W., and Tucker, J. D. (1988). Identification of murine nuclear proteins that bind to the conserved octamer sequence of the immunoglobulin promoter region. Proc. Natl. Acad. Sci. U.S.A.85,3560-3564. Hasemann, C. A., and Capra, J. D. (1989). “Immunoglobulins: Structure and Function. Fundamental Immunology,” 2nd ed. Ed. William E. Paul. Raven Press, New York. Hendriks, R. W., Van Tol, M. J. D., De Lange, G. G . , and Schuurman, R. K. B. (1989). Inheritance of a large deletion within the human immunoglobulin heavy chain constant region gene complex and immunological implications. Scand. J . Zmmunol. 29, 535-541. Hillson, J. L., and Perlmutter, R. M. (1990). Autoantibodies and the fetal antibody repertoire. Znt. Rev. Zmmunol. 5,215-229. Hoch, S., and Schwaber, J. (1987). Identification and sequence of the VH gene elements encoding a human anti-DNA antibody. J . Zmmunol. 139,1689-1693. Hofker, M. H., Walter, M. A., and Cox, D. W. (1989). Complete physical map of the human immunoglobulin heavy chain constant region gene complex. Proc. Natl. Acad. Sci. U.S.A.86,5567-5571. Honjo, T., Shimizu, A., and Yaoita, Y. (1989). Constant-region genes of the immunoglobulin heavy chain and the molecular mechanism of class switching. In “Immunoglobulin Genes” (T. Honjo, F. W. Alt, and T. H. Rabbitts, eds.), pp. 123-149. Academic Press, San Diego, California. Hope, T. J., Aguilera, R. J.,Minie, M. E., and Sakano, H. (1986). Endonucleolytic activity that cleaves immunoglobulin recombination sequences. Science 231,1141- 1145. Huck, S., Lefranc, G . , and Lefranc, M.-P. (1989). A human immunoglobulin IGHG3 allele (GmbO, b l , c3, c5, u) with an IGHG4 converted region and three hinge exons. lmmunogenetics 30,250-257. Humphries, C. G . ,Shen, A., Kuziel, W. A., Capra, J. D., Blattner, F. R., and Tucker, P. W. (1988). A new human immunoglobulin VH family preferentially rearranged in immature B-cell tumours. Noture (London)331,446-449. Ichihara, Y.,Abe, M., Yasui, H., Matsuoka, H., and Kurosawa, Y. (1988a). At least five DH genes of human immunoglobulin heavy chains are encoded in 9-kilobase DNA fragments. Eur. J . Zmmunol. 18,649-652. Ichihara, Y., Matsuoka, H., and Kurosawa, Y. (1988b). Organization of human immunoglobulin heavy chain diversity gene loci. EMBOJ.7,4141-4150.
68
VIRGINIA PASCUAL A N D J. DONALD CAPRA
Isenberg, D. A., and Collins, C. (1985).Detection of cross-reactive anti-DNA antibody idotypes on renal tissue-bound immunoglobulins from lupus patients. J . Clin. lnuest. 76,287-294. Isenberg, D. A., Shoenfeld, Y.,Madaio, M. P., Rauch, J., Reichlin, M., Stollar, B. D., and Schwartz, R. S. (1984).Anti-DNA antibody idiotypes in systemic lupus erytheniatosus. Lancet 2,417-422. Johnson, M. J., Natali, A. M., Cann, H. M., Honjo, T., and Cavalli-Sforza, L. L. (1984). Polymorphisms of human variable heavy chain gene showing linkage with constant heavy chain genes. Proc. Natl. Acad. Sci. U.S.A. 81,7840-7844. Kaartinen, M., Solin, M.-L., and Makela, 0. (1989).Allelic forms of immunoglobulin V genes in different strains of mice. EMBOJ. 8, 1743-1748. Kearney, J., Vakil, M., and Nicholson, N. (1987).Non-random VH gene expression and idiotype anti-idiotype expression in early B cells. In “Evolution andvertebrate Inimunity: The Antigen Receptor and MHC Gene Families” (G. Kelso and D. Schulze, eds.), pp. 175-190. Univ. of Texas Press, Austin. Kehoe, J. M., and Capra, J. D. (1971). Localization of two additional hypervariable regions in immunoglobulin heavy chains. Proc. Natl. Acad. Sci. U.S.A. 68, 20192021. Kennedy, M. A., Morris, C. M., Hollings, P. E., and Fitzgerald, P. H. (1989). Involvement of immunoglobulin heavy- and light-chain (kappa) gene clusters in a human B-cell translocation, t(2;14).Cytogenet. Cell Genet. 52,50-56. Keyeux, G . , Ghanem, N., Lefranc, G., and Lefranc, M.-P. (1989a). Identification of the PvuII RFLPs from the switch human immunoglobulin alpha (IGSA) regions. Nucleic Acids Res. 17,3623. Keyeux, G., Lefranc, G., and Lefranc, M.-P. (1989b).A specific switch alpha probe of the human immunoglobulin IGHA locus. Nucleic Acids Res. 17,3624. Kipps, T. J. (1990). Immunoglobulin idiotypes in human B cell neoplasia: Iniplications for pathogenesis and therapy. Chem. lmmunol. 48, 167-185. Kipps, T. J., Tomhave, E., Pratt, L. F., Duffy, S., Chen, P. P., and Carson, D. A. (1989). Developmentally restricted immunoglobulin heavy chain variable region gene expressed at high frequency in chronic lymphocytic leukemia. Proc. Natl. Acud. Sci. U.S.A.86,5913-5917. Kirsch, I. R., Morton, C. C., Nakahara, K., and Leder, P. (1982). Human immunoglobulin heavy chain genes mapped to a region of translocations in malignant B lymphocytes. Science 216,301-303. Knight, K. L., and Becker, R. S. (1990).Molecular basis of the allelic inheritance of rabbit immunoglobulin VH allotypes: Implications for the generation of antibody diversity. Cell (Cambridge, Mass.) 60,963-970. KO,H.-S., Fast, P., McBride, W., and Staudt, L. M. (1988).A human protein specific for the immunoglobulin octamer DNA motif contains a function homeobox domain. Cell (Cambridge, Mass.) 55, 135-144. Kodaira, M., Kinashi, T., Umemura, I., Matsuda, F., Noma, T., Ono, Y., and Honjo, T. (1986). Organization and evolution of variable region genes of the human iniintiiioglobulin heavy chain.]. Mol. Biol. 190,529-541. Kunkel, H . G., Agnello, V., J o s h , F. G., Winchester, R. J., arid Capra, J . D. (197:3). Cross-idiotypic specificity among monoclonal IgM proteins with anti-gamma globulin activity. J . Err’. Med. 137, 331-342. Kunkel, H. G., Winchester, R. J., J o s h , F. G., and Capra, J. D. (1974).Similarities in the light chains of anti-gamma globulins showing cross-idiotypic specificities.]. Erp. Med. 139,128-136.
Ig HEAVY-CHAIN VARIABLE REGION GENES
69
Kurosawa, Y ., and Tonegawa, S. (1982). Organization, structure, and assembly of immunoglobulin heavy chain diversity DNA segments.J. Exp. Med. 155,201-218. Kurosawa, Y., von Boehmer, H., Haas, W., Sakano, H., Traunecker, A., and Tonegawa, S . (1981). Identification of D segments of immunoglobulin heavy-chain genes and their rearrangement in T lymphocytes. Nature (London)290,590. Landolfi, N. F., Capra, J. D., and Tucker, P. W. (1986). Interaction of cell-type-specific nuclear proteins with immunoglobulin VH promoter region sequences. Nature (London) 323,548-551. Lebowitz, J. H., Kobayashi, T., Staudt, L., Baltimore, D., and Sharp, P. A. (1988). Octamer-binding proteins from B or HeLa cells stimulate transcription of the immunoglobulin heavy-chain promoter in oitro. Genes Deo. 2, 1227-1237. Lee, K. H., Matsuda, F., Kinashi, T., Kodaira, M., and Honjo, T. (1987).A novel family of variable region genes of the human immunoglobulin heavy chain. J . Mol. Biol. 195, 76 1-768. Lefvert, A. K., James, R. W., Alloid, C., and Fulpius, B. W. (1982). A monoclonal antiidiotypic antibody against anti-receptor antibodies from myasthenic sera. Eur. ]. l m munol. 12,790. Lefvert, A. K., Sunden, H., and Holm, G. (1986). Acetylcholine receptor antibodies and anti-idiotypic antibodies produced in blood lymphocyte cultures from patients with myasthenia gravis. Scand. J . lmmunol. 23,655. Lefvert, A. K., Holm, G., Sunden, H., and Pirskanen, R. (1987). Cellular production of antibodies related to the acetylcholine receptor in myasthenia gravis: Correlation with clinical stage. Scand.J. lmmunol. 25,265. Levine, M., and Hoey, T. (1988). Homeobox proteins as sequence-specific transcription factors. Cell (Cambridge,Mass.) 55,537-540. Logtenberg, T., Young, F. M., Van Es, J. H., Gmelig-Meyling, F. H. J., and Alt, F. W. (1989). Autoantibodies encoded by the most JH-proximal human immunoglobulin heavy chain variable region gene. J. Exp. Med. 170, 1347-1355. Loh, D. Y., Bothwell, A. L. M., White-Scharf, M. E., Imanishi-Kari, T., and Baltimore, D. (1984). Molecular basis of a mouse strain-specific anti-hapten response. Cell (Cambridge, Mass.) 33,85-93. Mackworth-Young, C . , Sabbaga, J., and Schwartz, R. S . (1987). Idiotypic markers of polyclonal B cell activation: Public idiotypes shared by monoclonal antibodies derived from patients with systemic lupus erythematosus and leprosy.]. Clin. Inoest. 79, 572-58 1. Mageed, R. A., and Jefferis, R. (1988). Analysis of rheumatoid factor autoantibodies in patients with essential mixed cryoglobulinemia and rheumatoid arthritis. Scand. ]. Rheumatol., Suppl. 75, 172-178. Mageed, R. A., Dearlove, M., Goodall, D. M., and Jefferis, R. (1986). Immunogenic and antigenic epitopes of immunoglobulins. XVII. Monoclonal anti-idiotypes to the heavy chain of human rheumatoid factors. Rheumatol. l n t . 6, 179-186. Matsuda, F., Lee, K. H., Nakai, S., Sato, T., Kodaira, M., Zong, S. Q., Ohno, H., Fukuhara, S., and Honjo, T. (1988). Dispersed localization of D segments in the human immunoglobulin heavy-chain locus. EMBOJ. 7, 1047-1051. Matsuda, F., Shin, E. K., Hirabayashi, Y., Nagaoka, H., Yoshida, M. C., Zong, S. Q., and Honjo, T. (1990).Organization of variable region segments of the human immunoglobulin heavy chain: Duplication of the D5 cluster within the locus and interchromosomal translocation of variable region segments. EMBO ]. 9, 25012506. Matthyssens, G., and Rabbitts, T. H. (1980). Structure and multiplicity of genes for the
70
VIRGINIA PASCUAL AND J . DONALD CAPRA
human immunoglobulin heavy chain variable region. Proc. Notl. Acad. Sci. U.S.A.77, 6561-6565. Meek, K. D., Hasemann, C. A., and Capra, J. D. (1989). Novel rearrangement at the immunoglobulin D locus. J . E x p . Med. 170,39-57. Meek, K. D., Rathbun, G., Reininger, L., Jaton, J.-C., Kofler, R., Tucker, P. W., and Capra, J. D. (1990). Organization of the murine immunoglobulin VH complex: Placement of two new VH families (vH10 and v H 1 1 ) and analysis of VH family clustering and interdigitation. M o l . Immunol. 27, 1073-1081. Meek, K. D., Eversole, T., and Capra, J. D. (1991). Conservation of the most J H proximal immunoglobulin VH gene segment (VHVI)throughout primate evolution. (Submitted for publication). Moreau, P., Hen, R., Wasylyk, B., Everrett, R., Gaub, M., and Chambon, P. (1981).The SV40 72-bp repeat has a striking effect on gene expression both in SV40 and other chimeric recombinations. Nucleic Acids Res. 9,6047-6069. Natvig, J. B., and Munthe, E. (1975). Self-associating IgG rheumatoid factors represent a major response of plasma cells in rheumatoid inflammatory tissue. Ann. N.Y. Acad. Sci. 256,88-95. Newkirk, M. M., Mageed, R. A., Jefferis, R., Chen, P. P., and Capra, J. D. (1987). Complete amino acid sequences of variable regions of two human IgM rheumatoid factors, BOR and KAS of the Wa idiotypic family, reveal restricted use of heavy and light chain variable and joining region segments../. E x p . Med. 166,550-564. Nickerson, K. G., Berman, J . , Glickman, E., Chess, L., and Alt, F. W.(1989). Early human IgH gene assembly in Epstein-Barr virus-transformed fetal B cell lines: Preferential utilization of the most JH-proximal D segment (DQ52) and two unusual VH-related rearrangements../. Exp. Med. 169, 1391-1403. Ollier, P., Rocca-Serra, J., Somme, G., Theze, J., and Fougereau, M. (1985).The idiotypic network and the internal image: Possible regulation of a germline network by paucigene encoded Ab2 (anti-idiotypic) antibodies in the GAT system. E M B O J . 3,3681. Parslow, T. G., Blair, D. L., Murphy, W. J., and Granner, D. K. (1984). Structure ofthe 5’ ends of immunoglobulin genes: A novel conserved sequence. Proc. Natl. Acad. Sci. U.S.A.81,2650-2654. Pascual, V., Randen, I., Thompson, K., Sould, M., Forre, C., Natvig, J. B., and Capra, J. D. (1990a). The complete nucleotide sequences of the heavy chain variable regions of six monospecific rheumatoid factors derived from EBV transformed B cells isolated from the synovial tissue of patients with rheumatoid arthritis: Further evidence that some autoantibodies are unniutated copies of germline genes. J . Clin. Ztioest. 86, 1:3201328. Pascual, V., Andris, J., and Capra, J. D. (1990b). I t i t . Reo. Inimunol. 5,231-238. Perlmutter, R. M., Berson, B., Griffin, J. A., and Hood, L. (1985a). Diversity i n the germline antibody repertoire: Molecular evolution of the T15 V H gene fami1y.J. E x p . Med. 162,1998-2016. Perlmutter, R. M., Kearney, J., Chang, S. P., and Hood, L. E. (1985b). Developmentally controlled expression of immunoglobulin VH genes. Science 227, 1597-1600. Pincus, S. H. (1988). Human immunoglobulin heavy-chain-variable (V,) region gene families defined by hybridization with cloned human and murine VH-genes. Hum. Immunol. 22,199-215. Queen, C., Foster, J., Stauber, C., and Stafford, J. (1986).Cell-type specific regulation of a K immunoglobulin gene by promoter and enhancer elements. Immunol. Reo. 89, 49-68.
Ig HEAVY-CHAIN VARIABLE REGION GENES
71
Rathbun, G. A., Capra, J. D., and Tucker, P. W. (1987). Organization of the murine immunoglobulin VH complex in inbred strains. E M B O J . 6,2931-2937. Ravetch, J. V., Siebenlist, U., Korsmeyer, S., Waldmann, T., and Leder, P. (1981). Structure of the human immunoglobulin p locus: Characterization of embryonic and rearranged J and D genes. Cell (Cambridge,Mass.)27,583-591. Rechavi, G., Bienz, B., Ram, D., Ben-Neriah, Y., Cohen, J. P., Zakut, R., and Givol, D. (1982). Organization and evolution of immunoglobulin VH gene subgroup. Proc. Natl. Acud. Sci. U.S.A.79,4405-4409. Rechavi, G., Ram, D., Glazer, L., Zakut, R., and Givol, D. (1983). Evolutionary aspects of immunoglobulin heavy chain variable region (VH) gene subgroups. Proc. Natl. Acad. Sci. U.S.A. 80,855-859. Reynaud, C.-A., Anquez, V., Dahan, A., and Weill, J.-C. (1985). A single rearrangement event generates most of the chicken immunoglobulin light chain diversity. Cell (Cambridge, Mass.)40,283-291. Robbins, D. L., Kenny, T. P., Coloma, M. J., Gavilondo-Cowley, J. V., Soto-Gil, R. W., Chen, P. P., and Larrick, J. W. (1990). Serologic and molecular characterization of a human rheumatoid factor derived from rheumatoid synovial cells. Arthritis Rheum. 33,1188-1195. Roudier, J.,Silverman, G. J., Chen, P. P., Carson, D. A., and Kipps, T. J. (1990). Intraclonal diversity in the VH genes expressed by CD5- chronic lymphocytic leukemiaproducing pathologic IgM rheumatoid factor. J . lmmunol. 144, 1526-1530. Rubenstein, D., Guillaume, T., Tucker, L., Young, F., Logtenberg, T., Schwartz, R., and Barrett, K. J. (1989). Detection of germ line polymorphisms and preferentially expressed human V genes with oligonucleotide probes. lnt. Congr. Immunol., 7th, 1989 Abstract, p. 30. Sakano, H., Maki, R., Kurosawa, Y., Roeder, W., and Tonegawa, S. (1980). Two types of somatic recombination are necessary for the generation of complete immunoglobulin heavy chain genes. Nature (London)286,676-683. Sakano, H., Kurosawa, Y.,Weigert, M., and Tonegawa, S. (1981). Identification and nucleotide sequence of a diversity DNA segment (D) of immunoglobulin heavy-chain genes. Nature (London)290,562-565. Sanz, I., Kelly, P., Williams, C., Scholl, S., Tucker, P., and Capra, J. D. (1989a). The smaller human VH gene families display remarkably little polymorphism. EMBOJ. 8, 374 1-3748. Sanz, I., Dang, H., Takei, M., Talal, N., and Capra, J. D. (1989b). VH sequence of a human anti-Sm autoantibody: Evidence that autoantibodies can be unmutated copies of germline genes.]. Immunol. 142,883-887. Sanz, I., Casali, P., Thomas, J. W., Notkins, A. L., and Capra, J. D. (1989~).Nucleotide sequences of eight human natural autoantibody VH regions reveal apparent restricted use of VH families. J . Zmmunol. 142,4054-4061. Sanz, I., Hwang, C., Hasemann, C., Thomas, J. W., Wasserman, R., Tucker, P., and Capra, J. D. (1989d). Polymorphisms of immunologically relevant loci in human disease: Autoimmunity and human heavy chain variable regions. Ann. N.Y. Acad. Sci. 546, 133-142. Sasso, E. H., van Dijk, K. W., and Milner, E. C. B. (1990). Prevalence and polymorphism of human v H 3 genes.]. Immunol. 145,2751-2757. Sato, T., Matsuda, F., Lee, K. H., Shin, E. K., and Honjo, T. (1988). Physical linkage of a variable region segment and the joining region segment of the human immunoglobulin heavy chain locus. Biochem. Biophys. Res. Commun. 154,265-271.
72
VIRGINIA PASCUAL AND J. DONALD CAPRA
Scheidereit, C., Heguy, A., and Roeder, R. G. (1987).Identification and purification of a human lymphoid-specific octamer-binding protein (OTF-2) that activates transcription of an immunoglobulin promoter in oitro. Cell (Cambridge,Muss.) 51,783-793. Scheidereit, C., Cronilish, J. A., Gerster, T., Kawakanii, K., Balniaceda, C.-G., Currie, R. A., and Roeder, R. G. (1988). A human lymphoid-specific transcription factor that activates immunoglobulin genes is a homoeobox protein. Nuture (London)336,551557. Schilling, J., Clevinger, B., Davie, J. M., and Hood, L. (1980).Amino acid sequence of homogeneous antibodies to dextran and DNA rearrangements in heavy-chain Vregion gene segments. Nature (London)283,35-40. Schroeder, H. W., Jr., and Wang, J. Y. (1990). Preferential utilization of conserved immunoglobulin heavy chain variable gene segments during human fetal life. Proc. Nutl. Acad. Sci. U.S.A. 87,6146-6150. Schroeder, H. W., Jr., Hillson, J. L., and Perlmutter, R. M. (1987). Early restriction ofthe human antibody repertoire. Reports pp. 791-793. Schroeder, H. W., Jr., Walter, M. A., Hofker, M. H.. Ebens, A., van Dijk, K. W., Liao, L. C., Cox, D. W., Milner, E. C. B., and Perlmutter, H.M. (1988). Physical linkage of a human immunoglobulin heavy chain variable region gene segment to diversity and joining region elements. Proc. Nutl. Acad. Sci. U.S.A.85,8196-8200. Schroeder, H. W., Jr.. Hillson, J. L., and Perlmutter, R. M. (1990). Structure and evolution of mammalian V H families. Int. Immunol. 2,41-50. Sen, R., and Baltimore, D. (1986).Inducibility of K immunoglobulin enhancer-binding proten NF-KB by a posttranslational mechanism. Cell (Cambridge, Mass.) 47, 921928. Shander, M., Martinis, J., and Croce, C. M. (1980).Genetics ofhuman immunoglobulins -Assignment of the genes of Mv-immunoglobulin, alpha-immunoglobulin, and gammaimmunoglobulin chains to human chromosome 14. Trunsplunt. Proc. 10,417-420. Shen, A., Humphries, C., Tucker, P., and Blattner, F. (1987). Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia. Proc. Nutl. Acad. Sci. U.S.A.84,8563-8567. Shlomchik, M. J., Marshak-Rothstein, A., Wolfwicz, C. B., Rothstein, T. L., and Weigert, M. G. (1987a). The role of clonal selection and somatic mutation i n autoimmunity. Nature (London)328,805-811. Shlomchik, M. J.,Aucoin, A. J., Pisetsky, D. S., and Weigert, M. G. (1987b).Structureand function of anti-DNA autoantibodies derived from a single autoimmune mouse. PXJC. Natl. Acud. Sci. U.S.A.84,9150-9154. Shoenfeld, Y., Isenberg, D. A., Rauch, J., Madaio, M., Stollar, B. D., and Schwartz, R. S. (1983). Idiotypic cross-reactions of monoclonal human lupus autoantibodies. j . E x p . Med. 158,718. Shoenfeld, Y., Ben-Yehuda, O.,Naparstek, Y., Wilner, Y., Frolichman, R., Schattner, A., Lavie, G., Joshua, H., Pinkhas, J., Kennedy, R. C., Schwartz, R. S., and Pick, A. I. (1986a).The detection of a common idiotype of anti-DNA antibodies in the sera of patients with monoclonal gammopathies. /. Clin. Immunol. 6, 194-204. Shoenfeld, Y., Vilner, Y., and Coates, A. R. M. (1986b). Monoclonal anti-tuberculosis antibodies react with DNA and monoclonal anti-DNA antibodies react with Mycobacterium tuberculosis. Clin. E x p . Immunol. 66,255-261. Shokri, F., Mageed, R. A., Tunn, E., Bacon, P. A., and Jefferis, R. (1990). Qualitative and quantitative expression of VHI associated cross-reactive idiotopes within IgM rheumatoid factor from patients with early synovitis. Ann. Rheum. Dis. 49, 150-154. Siebenlist, U., Ravetch, J. V., Korsmeyer, S., Waldmann, T., and Leder, P. (1981).Human
Ig HEAVY-CHAIN VARIABLE REGION GENES
73
immunoglobulin D segments encoded in tandem multigenic families. Nature (London) 294,631-635. Silberstein, L. E., Litwin, S., and Carmack, C. E. (1989). Relationship of variable region genes expressed by a human B cell lymphoma secreting pathologic anti-PRz erythrocyte autoantibodies. ]. E r p . Med. 169, 1631-1643. Silverman, G. J., and Carson, D. A. (1990). Structural characterization of human monoclonal cold agglutinins: Evidence for a distinct primary sequence-defined vH4 idiotype. Eur. j . Immunol. 20,351-356. Silverman, G. J., Chen, P. P., and Carson, D. A. (l990a).Cold agglutinins: Specificity, idiotypy and structural analysis. Chern. Irnmunol. 48,109-125. Silverman, G. J,, Schrohenloher, R. E., Achavitti, M. A., Koopman, W. J., and Carson, D. A. (1990b). Structural characterization of the second major cross-reactive idiotype group of human rheumatoid factors: Association with the V H gene ~ family. Arthritis Rheum. 33,1347-1360. Silvestris, F., Searles, R. A., Capra, J. D., and Williams, R. C., Jr. (1989). Studies of anti-F (ab’)zantibodies and VH region distribution among SLE kindreds. J. Autoimmun. 2,395-401. Siminovitch, K. A., Misener, V., Kwong, P. C., Song, Q.-L., and Chen, P. P. (1989). A natural autoantibody is encoded by germline heavy and lambda light chain variable region genes without somatic mutation. J . Clin. Invest. 84, 1675-1678. Sonntag, D., Weingartner, B., and Grutzmann, R. (1989).A member ofa novel human DH gene family: DHFL16. Nucleic Acids Res. 17, 1267. Soua, Z., Ghanem, N., Salem, M. B., Lefranc, G., and Lefranc, M.-P. (1989). Frequencies of the human immunoglobulin IGHA2*M 1 and IGHA2*M2 alleles corresponding to the A2m( 1) and A2m(2) allotypes in the French, Lebanese, Tunisian, and Black African populations. Nucleic Acids Res. 17,3625. Souroujon, M. C., Rubinstein, D. B., Schwartz, R. S., and Barrett, K. J. (1989). Polymorphisms in human H chain V region genes from the VHIII gene family.]. Immunol. 143, 706-7 11. Spatz, L. A., Wong, K. K., Williams, M., Desai, R., Golier, J., Berman, J. E., Alt, F. W., and Latov, N. (1990). Cloning and sequence analysis of the VH and VL regions of an anti-myelidDNA antibody from a patient with peripheral neuropathy and chronic lymphocytic leukemia. 1.Immunol. 144,2821-2828. Stevenson, F. K., Wrightham, M., Glennie, M. J., Jones, D. B., Cattan, A. R., Feizi, T., Hamblin, T. J., and Stevenson, G. T. (1986). Antibodies to shared idiotypes as agents for analysis and therapy for human B cell tumors. Blood 68,430-436. Stevenson, F. K., Smith, G. J., North, J., Hamblin, T. G., and Glennie, J. J. (1989). Identification of normal B-cell counterparts of neoplastic cells which secrete cold agglutinins of anti-I and anti-I specificity. Br. ]. Haernatol. 72,9-15. Takahashi, N., Ueda, S., Obata, M., Nikaido, T., Nikai, S., and Honjo, T. (1982). Structure of human immunoglobulin gamma genes. Implications for evolution of a gene family. Cell (Cambridge, Mass.)29,671-679. Takahashi, N., Noma, T., and Honjo, T. (1984). Rearranged immunoglobulin heavy chain variable region (VH) pseudogene that deletes the second complementaritydetermining region. Proc. Natl. Acud. Sci. U.S.A.81,5194-5198. Trepicchio, W., Jr., Maruya, M., and Barrett, K. J. (1987). The heavy chain genes of a lupus anti-DNA autoantibody are encoded in the germ line of a nonautoimmune strain ofmouse and conserved in strains of mice polymorphic for this gene 10cus.J. Immunol. 139,3139-3145. Turnbull, I. F., Bernard, O., Sriprakash, K. S., and Matthews, J. D. (1987). Human
74
VIRGINIA PASCUAL AND J. DONALD CAPRA
immunoglobulin variable region genes: A new VH sequence used to detect polymorphism. Zmmunogenetics 25,184-192. van der Heijden, R. W. J:, Bunschoten, H., Pascual, V., Uytdehaag, F. G. C. M., Osterhaus, A. D. M. E., and Capra, J. D. (1990). Nucleotide sequence of a human monoclonal anti-idiotypic antibody specific for a rabies virus-neutralizing monoclonal antibody reveals extensive somatic variability suggestive of an antigen-driven immune response. J . Zmmunol. 144,2835-2839. Van Dijk, K. W., Schroeder, H. W., Jr., Perlmutter, R. M., and Milner, E. C. B. (1989). Heterogeneity in the human Ig VH locus.]. Zmmunol. 142,2547-2554. Walter, M. A., and Cox, D. W. (1988). Analysis of genetic variation reveals human immunoglobulin VH-region gene organization. Am. J . Hum. Genet. 42,446-451. Walter, M . A., and Cox, D. W. (1989). A method for two-dimensional DNA electrophoresis (2D-DE): Application to the immunoglobulin heavy chain variable region. Genomics 5,157-159. Walter, M. A., Surti, U., Hofier, M. H., and Cox, D. W. (1990).The physical organization of the human immunoglobulin heavy chain gene complex. EMBO]. 9,3303-3313. Wang, A X , Pink, J. R. L., Fudenberg, H. H., and Ohms, J. (1970).A variable region subclass of heavy chains common to immunoglobulins G, A, and M and characterized by an unblocked amino-terminal residue. Proc. Natl. Acad. Sci. U.S.A. 66,657-663. Wang, X.-F.,and Calame, K. (1985). The endogenous immunoglobulin heavy chain enhancer can activate tandem VH promoters separated by a large distance. Cell (Cambridge, Mass.) 43,659-665. Wikler, M., Kohler, H., Sinoda, T.,and Putnam, F. W. (1969). Macroglobulin structure: Homology of p and y-heavy chains of human immunoglobulins. Science 163,75-78. Williams, R., Kunkel, H. G., and Capra, J. D. (1968).Antigenic specificities related to the cold agglutinin activity of IgM globulins. Science 161,379-381. Wood, C., and Tonegawa, S. (1983). Diversity and joining segments of mouse immunoglobulin heavy chain genes are closely linked and in the same orientation: Implications for the joining mechanisms. Proc. Natl. Acad. Sci. U.S.A. 80,3030-3034. Yancopoulos, G . D., Desiderio, S. V., Paskin, M., Kearney, J. F., Baltimore, D., and Alt, F. W. (1984). Preferential utilization of the most VH proximal V H gene segments in pre-B-cell lines. Nature (London) 311,727. Zachau, H. G. (1989).Immunoglobulin light-chain genes ofthe K type i n man and mouse. In “Immunoglobulin Genes” (T. Honjo, F. W., Alt, and T. H. Rabbitts, eds.), pp. 91-109. Academic Press, San Diego, California. Zong, S. Q., Naki, S., Matsuda, F., Lee, K. H., and Honjo, T. (1988).Human immunoglobulin D segments: Isolation of a new D segment and polymorphic deletion of the D1 segment. Zmmunol. Lett. 17,329. This article was accepted for publication in September 1990.
ADVANCES IN IMMUNOLOGY, VOL. 49
Surface Antigens of Human leukocytes
v. HOREJS~ Institute ofMd.culor Genetics, CzechoslovakianAcademy d Sciences, h u e 4-K& Guhaslovakia
1. Introduction
The aim of this chapter is to give a comprehensive overview of the well-characterized surface molecules of human leukocytes. There are, of course, a number of detailed reviews on individual leukocyte antigens or their groups, such as integrins, homing receptors, Fc-receptors, etc., but in my view it is useful to have a brief compilation of this field as a whole which would enable one to find quickly at least basic information on both the well-known and less familiar molecules and provide a broader perspective on them. A similar review was published two years ago (HofejSi and Bafil, 1988) but due to rapid progress in this field it is now to a large extent outdated. An extremely useful and extensive source of recent information on many human leukocyte surface antigens is the Leucocyte Typing I V volume (Knapp et al., 1989a), which summarizes the results of the 4th International Workshop on Human Leucocyte Differentiation Antigens (Vienna, 1989).Because of the enormous extent of the field reviewed, I cited only the most recent, most important (subjectively judged), or most comprehensive articles on the subjects discussed; vast majority of relevant references could not be given because of the lack of space. Much progress has been made in recent years toward functional characterization of many leukocyte surface “antigens,” which makes it convenient to divide the subject into natural groups of functionally related molecules. In the text I concentrated mainly on functional aspects, relations between various membrane molecules, and controversial aspects, while most of the descriptive data on, for example, expression and structural and functional details can be found in the references cited. Basic properties of the most completely characterized (cloned) molecules are shown in Table IV, and other less wellcharacterized antigens are listed in Table V. Table I1 summarizes the human leukocyte surface molecules anchored in membrane through a glycosylphosphatidyl inositol moiety (i.e., so-called type 3 membrane proteins), while Table I11 contains references on the soluble forms of leukocyte surface molecules. 75 Copyright 6 1991 by Academic Press, Inc. All rights ofreproduction in any form reserved.
76
V. HOREJSf
This chapter is devoted primarily to the surface molecules of human leukocytes. However, in some important cases more details are known on mouse or rat homologues. Such data are also occasionally included without necessarily stressing nonhuman origin of the molecule discussed. II. Antigen-Specific Receptors
Clonotypic antigen-specific receptors of B lymphocytes, i.e., surface immunoglobulins (Ig), mostly of the IgM and IgD isotype, are structurally identical to secreted Igs except for a short stretch of hydrophobic amino acids at the C-terminus of their heavy chains that anchors them in the membrane. Surface IgM and IgD appear to exist mostly as “half-molecules” composed of a single heavy and light chain (Vogel and Haustein, 1989) linked to other molecules analogous to the C D 3 complex ofT cells. Surface IgM is thus noncovalently associated with a covalent heterodimer of a 34-kDa and a 39-kDa inducibly phosphorylated protein (Hombach et al., 1990; Campbell and Cambier, 1990), the former being identical to the previously described mb-1 protein (Sakaguchi et al., 1988).The surface Ig-associated CD3-like complex is probably composed of more components (Vogel and Haustein, 1989; Parkhouse, 1990);the molecules associated with surface IgD differ at least partially from those associated with IgM (Vogel and Haustein, 1989; Wienands et al., 1990). Surface Ig is associated also with the CD19 glycoprotein (9OkDa) (Pesando et al., 1989); cocapping of surface Ig with a novel 155-kDa broadly expressed antigen was reported (Samoszuk et al., 1989). Interaction of surface IgM and IgD with ligands (antigen or antibodies against Ig) results in signal transduction but it is not quite clear how the nature ofthe signal depends on the isotype ofthe receptor involved and what role is played by the Ig-associated molecules. It seems likely that IgD transduces a stimulatory signal while IgM transduces a suppressive signal (Goodnow et al., 1989; Mongini et al., 1989) but both isotypes employ the same G-protein (Harnett et al., 1989).Crosslinking of surface Igs induces their association with cytoskeleton (Albrecht and Noelle, 1988) and with ligand-loaded Fc-receptors and complement receptors (Tsokos et al., 1990). The role of surface Ig molecules is at least twofold: first, their interaction with specific antigen provides a primary activating signal to the B cell (for review on the mechanisms involved, see, e.g., Cambier and Ransom, 1987); second, surface Ig serves as a vehicle for internali-
SURFACE ANTIGENS O F HUMAN LEUCOCYTES
77
zation of the captured antigen, which is then “processed” intracellularly to yield fragments capable of complexing with Class I1 major histocompatibility complex (MHC) glycoprotein (MHC gp 11). These complexes reappear on the B cell surface where they can be recognized by specific helper T cells that provide a second signal (or rather multiple “second signals” in the form of lymphokines) necessary for proliferation and terminal differentiation of B cells into Ig-producing plasma cells or memory cells. This “minimal model” (Jones, 1987) of B cell activation is attractive due to its simplicity, but in most physiological situations other antigen-presenting cells (dendritic cells, macrophages) appear to be additional necessary components of the system (Metlay et al., 1989).In the absence of the second (helper) signal, the interaction of the antigen with surface Ig usually induces a state of irreversible nonreactivity (anergy) of the B cell (Goodnow et al., 1988). Structure, function, and molecular genetics of antigen-specific receptors of T cells, rather inconveniently called “receptors of T lymphocytes for antigen” (TCR), have been recently reviewed (Clevers et al., 1988; Davis and Bjorkman, 1988). T cell receptors (TCRs) appear to be extraordinarily complicated complexes consisting of clonotypic Ig-like chains a and p or y and 6, so-called CD3 complex, and probably several other components. The CD3 complex, consists of noncovalently associated chains called y (27 kDa), 6 (20 kDa), E (20 kDa), 5 (16 kDa), and 7 (21 kDa). Small amounts ofthe CD3 complex can be surface-expressed independently of the TCR alp chains (Ley et al., 1989).The roles of individual CD3 subunits in signal transduction are not known but the 5 and 7 subunits appear to be particularly important. Most TCRs contain covalent homodimers of 5 but a fraction (approximately 10%) possesses a 5-7 heterodimer (Baniyash et al., 1988);these two types ofTCR seem to differ markedly in their signal-transducing properties (Merkep et al., 1988, 1989). The 5 chain which has a much larger intracellular than extracellular domain has a sequence similarity to the y chain of the high-affinity IgE receptor and to nucleotide-binding proteins as well as a potential for extensive tyrosine phosphorylation (Weissman et al., 1988).It plays an important role in the TCR complex assembly (Geisler et al., 1989).Interestingly, the 5 chain is associated also with the CD16 Fc-receptor (Lanier et al., 1989b), indicating a more general role of this molecule in functioning of receptors. Primary structure of the q chain is not known but it seems to be structurally similar to the 5 subunit (Orlof‘fet al., 1989). In the course ofT cell activation the 5 (and possibly also q)chain is phosphorylated by the lymphocyte-specific CD4/CD8associated tyrosine protein kinase p56““ (Barber et al., 1989).
78
V. HOREJSf
TCR associates also with the “accessory” molecules CD4 and CD8 (Anderson et al., 1988; Jonsson et al., 1989) and with at least two other poorly characterized components (Fraser et al., 1989). The mechanism of signal transduction through the TCR/CD3 complex seems to be principally similar to that operating in the case of surface Ig in B lymphocytes (i.e., hydrolysis of phosphatidylinositol bisphosphate, stimulation of protein kinase C, rise of cytoplasmic Ca2+ level; for review, see Isakov et al., 1987)but detailed description of the activation pathway is far from being complete. In contrast to Igs, TCRs appear to recognize effectively only structures associated with MHC glycoproteins. It seems likely that TCRs can actually bind any complementary structures, just like immunoglobulins (Rao et al., 1984; Siliciano et al., 1986) but this MHCindependent binding is usually nonproductive in terms of activation of the T cell. Only the interaction of a TCR with an antigen (native, denatured, or partially cleaved) complexed with an MHC gp on the surface of the recognized cell can provide the proper activating signal to the T cell (either activation of the cytolytic machinery of T, or lymphokine production by T h ) . Important factors probably are: (1) multiple interactions (cross-linking) of the TCRs with the cellbound ligand; (2)participation of the CD4 and CD8 glycoproteins that are receptors for monomorphic region(s) of the MHC molecules and are associated with the indispensable ~ 5 6 ’tyrosine “~ kinase; and (3) probably also additional interactions mediated by various “nonspecific” adhesion molecules. Similarly to B cells, also in T cells a second signal is necessary (in addition to the primary TCR-mediated signal) to achieve a positive activation. If this second signal is not provided, for example, in the case of some types of antigen-presenting cells (APC) or aldehyde-fixed APCs, the result is not only the lack of response but a long-lasting acquired unresponsiveness (anergy) (Schwartz, 1989). The nature of this second signal is not known but some component of the cell-cell contact may be essential. The processes of selection of TCR repertoire during thymic maturation (elimination of the potentially self-reactive ones and positive selection of those preferentially recognizing complexes of foreign substances with self-MHC gp) were reviewed (e.g., von Boehmer, 1988). The y6-type TCRs (reviewed b y Raulet, 1989) are expressed on a minor subpopulation of human T cells that appear to be a lineage developmentally and functionally distinct from the conventional TCR alp+ T cells. They may preferentially recognize complexes of antigens with CD1 glycoproteins (instead of MHC gp) (Porcelli et
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
79
al., 1989)and may be predisposed to recognize fragments of evolutionarily conserved heat-shock proteins and mycobacterial antigens (Young and Elliot, 1989). A non-TCR surface protein of unknown function (215 kDa) was described specifically expressed on sheep TCR yS+ T cells (Mackay et al., 1989). Several cases of “anomalous” TCRs or TCR-like molecules were described such as the mouse 85-kDa dimer apparently not linked to the CD3 complex (Nagasawa et al., 1987) and a T cell line receptor containing a component encoded by an Ig-heavy chain variable region gene (Ucker et al., 1985) and a TCR PlS (Hochstenbach and Brenner, 1989; Kishi et ul., 1989). There are numerous reports on membrane-bound and soluble antigen-binding products of T cells apparently different from conventional TCRs but their biochemical characterization is still incomplete. Thus, a TCR P-related receptor distinct from classical TCR heterodimers was described (Hubbard et ul., 1989)which reportedly exists as a soluble homodimer of a 31-kDa subunit. Other non-MHC-restricted antigen-binding molecules composed of 23-kDa subunits were allegedly detected on thymocytes (Rellahan and Cone, 1989). It would be interesting to know what, if any, is the relationship of these molecules to the elusive product of the mouse I-J gene, which is possibly a novel type of a receptor for self-MHC molecules (Nakayama et al., 1989). The nature of all these rather mysterious molecules will be unambiguously determined only after cloning of corresponding cDNAs. In addition to these reports, the existence of a soluble antigenspecific T cell product bearing the TCR Vp8 determinants was described, which had a helper function (Guy et al., 1989). It is again not quite clear whether this is a form of a conventional TCR; the soluble material had a molecular mass higher than 500 kDa, indicating it consisted of large aggregates or even membrane fragments. The nature of the putative NK cell antigen receptor remains elusive. These cells express a number of cell adhesion molecules (Trinchieri, 1989) and it is possible that concerted action of these “nonspecific” mediators of adhesion is sufficient to explain their recognition of target cells. An evolutionarily extremely conserved surface protein of 40 kDa was suggested as the elusive NK cell antigen receptor (Harris et al., 1987), but as yet little structural or other data were reported on this interesting molecule. The same authors recently described a 42-kDa phylogenetically conserved molecule that appears to be a critical target cell antigen (Harris et al., 1989). An NK cell surface truncated lamininlike molecule may be another functionally relevant structure (Schwarz and Hiserodt, 1988) but in this case one can consider it as a
80
v. HOREJS~
component of yet another “nonspecific” adhesion system involving probably a laminin receptor on the target cells. 111. MHC Glycoproteins
These most completely studied leukocyte surface molecules have been reviewed many times (e.g., Lew et al., 1986; Kappes and Strominger, 1988). In humans there are three broadly expressed conventional “isotypes” of MHC Class I glycoproteins (MHC gp I) (HLA-A, -B, and -C), that is, the molecules composed of an integral membrane glycoprotein a and a noncovalently associated beta-2-microglobulin (b2m). In addition, several other (and probably more currently unidentified) “nonclassical” MHC Class I molecules (HLA-E, -F, TLX, etc.) exist (Shimizu et al., 1988; Holmes, 1989; Kim, 1989). The CD1 glycoproteins also have similar structure comprising b2m (Calabi and Milstein, 1986) and an intestinal Fc-receptor (Simister and Mostov, 1989). A fraction of surface-expressed MHC gp I molecules may be devoid of b2m (Williams et al., 1989).These b2m-free MHC gp I may be abundant on activated cells but their significance is unknown (Schnabl et al., 1989). Human MHC Class I1 glycoproteins (DR, DO, DP; expressed on B cells, monocytes, macrophages, dendritic cells, and activated T cells) are noncovalent heterodimers of integral membrane glycoprotein chains a and p. The existence of “mixed dimers” such as DRaDQP has also been described (Kwok et al., 1988). Major features of MHC gp are their extreme polymorphism and their ability to bind a great variety of structurally diverse peptides, denatured and even some native proteins, and probably also other compounds. The peptides appear to be bound in a structurally distinct cleft present on the surface of the MHC molecules (Bjorkman et al., 1987; Garrett et al., 1989) but even separated a and /3 chains of MHC gp I1 may be able to bind peptides (Rothenhausler et al., 1990). Although direct structural data are available only for MHC gp I, a similar peptide-binding groove is predicted to be present on the MHC gp I1 (Brown et al., 1988).The peptides appear to be indispensable components of the MHC gp complexes (Townsend et al., 1989), so that peptide-free MHC molecules may not exist at all. Most of the MHCassociated peptides come from endogenous cell proteins; in the case of virus-infected cells or APCs that engulfed an exogenous material, certain (currently undetermined) fractions of the cell surface MHC molecules are occupied by fragments of the non-self-proteins and these complexes can be recognized by appropriate T cells.
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
81
Polymorphism of MHC glycoproteins is restricted mostly to the amino acid residues supposed to be in or near the peptide-binding site, and the allelic products are clearly capable of interaction with different sets of peptides, although there are some peptides binding to essentially all allelic forms of MHC gp (Sinigaglia et al., 1988). MHC polymorphism seems to greatly enhance the ability of an individual (because of heterozygosity) and especially of a species as a whole to react to many different antigens and diminishes the chance that a pathogen would produce too few or no fragments capable ofbinding to the MHC molecules, which would enable it to escape immune recognition. MHC glycoproteins also interact with a number of other molecules: some bacterial toxins bind to a site different from the above discussed peptide-binding site (Scholl et al., 1989)and these complexes may be avidly recognized by T cells carrying specific subsets of TCRs. MHC gp I and MHC gp I1 bind to the CD8 and CD4 glycoproteins, respectively (Doyle and Strominger, 1987; Norment et al., 1988).MHC gp I1 are associated intracellularly with several components, one of which is the regulatory subunit of CAMP-dependent protein kinase (Newel1 et al., 1988).This may be directly related to the observations on signaltransducing capacity of MHC gp I1 (Cambier and Lehmann, 1989). MHC gp I1 are probably complexed with the low-affinity IgE receptor CD23 (Bonnefoy et al., 1988). A molecule called BL2 (68 kDa) of unknown function was also reported to copurify with DR under some conditions (Wang et al., 1984). MHC gp I are associated with many receptors, for example, for insulin, glucagon, epidermal growth factor (reviewed by Edidin, 1988),luteinizing hormone, j3-adrenergic receptor (Solano et al., 1988), and possibly also for IL-2 (Sharon et al., 1988). There are also reports on MHC gp I association with the C D l a glycoprotein on thymocytes (Amiot et al., 1988b) and perhaps even with the TCR/CD3 complex (Bushkin et al., 1986; Brams and Claesson, 1989). Very interesting is the observation on close proximity of MHC gp I and MHC gp I1 molecules on the cell surface (Szollosi et al., 1989) but functional significance of this phenomenon is unclear. Some of these and possibly other unknown molecular associations of MHC gp may underlie a number of unexplained phenomena: MHC gp seem to be involved in Ig secretion (Burlingham et al., 1989) and in poorly understood B cell interactions during their repertoire development (Takahama et al., 1989); cross-linking of MHC gp I can deliver either positive or negative activation signal (Gilliland et al., 1989). Expression of MHC gp I confers resistance to NK-mediated killing,
82
V. HOREJSf
which could be because of association with the elusive NK target molecule(s) (Storkus et al., 1989). The previously mentioned “nonclassical” MHC gp I molecules as well as the structurally similar CD1 glycoproteins probably also bind antigenic fragments (Porcelli et al., 1989). Several unexplained features of C D l molecules deserve mentioning. It is not clear why CDlc (but not CDla and CDlb) molecules are expressed on approximately 50% of B cells (Delia et al., 1988). CDla molecules may be associated with C D l b and C D l c (Amiot et al., 1988a),with MHC gp I (Amiot et al., 1988b), and with CD8 (Snow et al., 1985) on thymocyte surface. An interesting hierarchy of CD1 expression was described: C D l c excludes expression of CDla and C D l b and C D l b excludes expression of C D l a (Arufrb and Seed, 1989). It is not known whether different “isotypes” of MHC gp have specific functions or if their existence is a redundancy of the system; there are claims that DR molecules present antigens specifically to T h while DQ molecules present antigens to T, (Nieda et al., 1988). The peptide-binding ability relevant to antigen presentation may not be limited to MHC gp; recently a non-MHC protein belonging to the HSP-70 family was shown to behave in this way and even to play a role in antigen presentation (Vanbuskirk et al., 1989).It is possible that this protein plays a role in facilitating peptide binding to MHC gp. Some similar role may be played also by the so-called Ii chain that is associated with MHC gp 11 intracellularly but not on the cell surface; it seems to be indispensable for proper functioning of APCs (B. Stockinger et al., 1989). The role of free Ii molecules, now called CD74, present on the surface of B cells and monocytes is unclear. IV. Adhesion Molecules
Adhesion of various types of leukocytes to other cells and to the components of extracellular matrix is essential for many basic functions of these cells. This is reflected in a large and ever increasing number of known molecules involved in these interactions. Actually, the TCR and MHC gp could also be classified as structures involved in a specialized type of cell-cell adhesion. Other “nonspecific” adhesion systems will be briefly discussed here. A. GLYCOPROTEINSCD4 AND CD8--RECEPTORS FOR MHC g p Detailed reviews on these members of the Ig superfamily have been published recently (Parnes, 1989; Bierer et al., 1989). CD4 is a singlechain 55-kDa molecule, while CD8 exists in the form of either CD8a
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
83
covalent homodimers expressed on NK cells (Minami et al., 1989) or a-/3 heterodimers present on a subpopulation of T cells (Shive et al., 1988);the CD8 (32 kDa) and CD8p (30kDa) molecules are structurally closely related products of two separate genes. As already stated, CD4 is a receptor for a monomorphic part of MHC gp I1 molecules (Doyle and Strominger, 1987), while CD8 similarly binds MHC gp I (Norment et aZ., 1988). In this respect it is not clear how this receptor function of CD8 is related to the observation that CD8 is associated with MHC gp I in the membranes of T cells (Blue et al., 1988) and with CD1 on thymocyte (Snow et al., 1985).Both CD4 and CD8 are intracellularly associated with the tyrosine protein kinase ~ 5 6 ’ (Barber ‘~ et al., 1989) and, as stated before, these CD4/CD8-p56 complexes functionally associate with TCR (Anderson et al., 1988; Jonsson et al., 1989).CD4 is known to be the receptor for HIV or rather for its surface gp 120 (McDougal et al., 1986). Interestingly, recombinant CD4 was shown to bind IgG indicating a possible role of this molecule as a Iow-affinity Fcy-receptor (Lederman et al., 1990). A secreted, monomeric form of CD8, probably a translation product of alternatively spliced mRNA, is produced by activated T cells (Giblin et al., 1989). Its physiological function is not known but the serum concentration of soluble CD8 may be a diagnostically useful parameter (Pui et al., 1989). A protein present on the surface of APCs was described which may be able to interact (similarly to MHC gp 11) with CD4 (Beretta et al., 1987).
B. RECEPTORSFOR THE COMPONENTS OF EXTRACELLULAR MATRIX The number of sometimes similar members of this group is large and orientation in this area is complicated by apparent multifunctionality of some of these molecules as well as by the current use of several nomenclatural systems. There is a large group of noncovalent heterodimeric molecules called “integrins” (for reviews, see Hynes, 1987; Hemler, 1988). At least four (but probably more; see Cheresh et al., 1989; Freed et al., 1989; Krissansen et al., 1990)subgroups of integrins are known, characterized by usage of specific /3 subunits. There are at least six /3l integrins (also called VLA antigens) that consist of a common pl chain (130 kDa; CD29, GPIIa) and different a chains (a1 through a6). Their basic properties including the known ligands are shown in Table I. These molecules are expressed on various cell types; the name VLA stands for “very late activation” as some of them appear weeks after activation of T cells. Notably, the VLA-2 molecule present on different cell types may preferentially bind distinct ligands (Kirchhofer et al., 1990). The pl subunit may be also
TABLE I THEpi INTEGRINS (VLA ANTIGENS) Synonyms
Molecular mass of the (I subunit (kDa)
Function
VLA-1 VLA-2 (CD49b, GPIa)
200
VLA-3 VLA-4 (CD49d, L25)
150' 140
VLA-5
150
Fibronectin receptor
VLA-6 (CD49, GPIc)
160
Laminin receptor
150
'
Collagenand laminin receptor
Fibronectin receptor Murine homologue (LPAM) is a receptor for homing to Peyer's patches; fibronectin receptor
Papers describing cDNA cloning. These a subunits are composed of covalently bound chains of 120-135 kDa and 20-30 kDa.
References Hemler et al. (1987) Hemler et al. (1987); Takada and Hemler (1989)"; Elices and Hemler (1989) Hemler et al. (1987) Takada et al. (1989)"; Wayner et 01. (1989); Elices and Hemler (1989); McIntyre et al. (1989) Hemler et al. (1987); Wayner et al. (1989); Fitzgerald et al. (1987a)" Sonnenberg et al. (1988); Hemler et al. (1989)
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
85
expressed in a free form unassociated with any a chain (Hemler et al., 1987). The pl integrins are not just passive adhesion structures but their ligation can deliver positive or negative signals in the cells carrying them (Groux et al., 1989a; Matsuyama et al., 1989), which is in agreement with the observed associations of these receptors with intracellular components related to the cytoskeleton (Argraves et al., 1989). Functionally closely related is the group of p3 integrins also called “cytoadhesins” characterized by the presence of the p3 subunit (115 kDa, GPIIIa; CD61). The two known members of this group are the vitronectin receptor (Lam et al., 1989) (which is able to bind other ligands; its a subunit is called a, or CD51) and so-called GPIIb/IIIa (CD41), expressed mostly on platelets (the a subunit is called a I I b or GPIIb), that also has a rather broad binding specificity (for review, see Phillips et al., 1988). Both a chains, i.e., CD51 and GPIIb, are composed of two covalently bound subunits of molecular masses of approximately 125 kDa and 25 kDa, respectively. The expression of the p4 integrin seems to be restricted to epithelial cells (Kajiji et al., 1989); the a chain of this heterodimer is identical to the a chain of VLAS (Hemler et al., 1989). It is not clear what is the relation between the novel 100-kDa integrin p subunits (Hemler et al., 1989; Krissansen et al., 1990; Gresham et al., 1989)forming alternative vitronectin-binding complexes with the a, (CD51) subunit. Subunit structure of a late differentiation antigen associated with the helper function of T cells, called LDAl (150 kDa and 116 kDa), indicates it may also be identical with one of the already known integrins (SuciuFoca et al., 1985). The last integrin subfamily p2 is discussed separately below. Several nonintegrin receptors for the components of intercellular matrix have been described. Major thrombocyte receptor for the von Willebrand factor is the CD42 complex composed of subunits CD42a (GPIX; 23 kDa) (Hickey et al., 1989)and CD42b (GPIb, which consists of covalently joined chains of 125 kDa and 18 kDa) (Lopez et al., 1988). An important receptor of this group is the 80-kDa glycoprotein CD44 (Pgp-1), which structurally belongs to the family of cartilage link proteins (reviewed by Haynes et al., 1989). It appears to be a receptor for collagen and possibly also fibronectin (Jalkanen and Jalkanen, 1989), critically involved, for example, in adhesion of various leukocytes to endothelia and in T cell rosetting with erythrocytes, but apparently also in T cell activation. CD44 exists in several forms differing in molecular mass; it is intracellularly linked to cytoskeletal components (for references, see the review by Haynes et al., 1989). It is not clear
86
V.HOREJSf
whether the recently described collagen receptor of T lymphocytes is also related to CD44 (Arencibia and Sundqvist, 1989). A nonintegrin 92-kDa fibrinogen receptor was recently found on the surface of some B cell lines (Levesque et al., 1990). A well-characterized receptor of platelets and monocytes for thrombospondin and collagen is the CD36 glycoprotein (88 kDa; GPIV; OKM5) (Tandon et al., 1989), which also mediates cytoadherence of malaria-infected erythrocytes (Oquendo et al., 1989). LFA-1-ICAM-1 (CD1la/CD18-CD54) C. THEADHESIONSYSTEM Glycoprotein LFA-1 is one of three known members of the p2 or leukocyte integrins (for review, see e.g., Kishimoto et al., 1989). It is a noncovalent dimer of the 02 (CD18; 95 kDa) and a (CDlla; 180 kDa) subunits. The p2 integrin subunit can be alternatively associated with two other a chains, C D l l b or C D l l c ; these molecules seem to act primarily as type 3 complement receptors (CR3) but also probably participate in intercellular adhesion (Lo et al., 1989). The function of CDllb/CD18 (CR3) as a cell adhesion molecule is in agreement with the presence in its structure of a binding site for the RGD sequence and another carbohydrate-binding site (Wright et al., 1989; Ross et al., 1985).CR3 was directly shown to recognize fibrinogen (Wright et al., 1988). This receptor may play a role in adhesion of neutrophils to endothelial cells coated with deposited complement fragments (Marks et al., 1989).An important adhesion-associated molecule of monocytes is also the third member of the LFA-1 family (leukocyte integrin subfamily), CD1lc/CD18 (p150/95), which also exhibits the activity of CR3 (Keizer et al., 1987). LFA-1 is a major leukocyte adhesion molecule that binds its broadly expressed ligand called (ICAM-1 (CD54; 90 kDa) that is an IFN-yinducible molecule structurally similar to N-CAM (Simmons et al., 1988). An alternative ligand for LFA-1 is a molecule structurally related to ICAM-1, called ICAM-2 (Staunton et al., 1989). CD54 is also the receptor for most rhinoviruses (Greve et al., 1989) and together with CD36 plays a role in adherence of malaria-infected erythrocytes to endothelial cells (Berendt et al., 1959). The strength of the LFA-1ICAM-1 interaction is regulated by TCR-dependent phosphorylation of LFA-1 (Buyon et al., 1990; Dustin and Springer, 1989). Both LFA-1 and ICAM-1 are intracellularly associated to cytoskeleton components indicating active roles in cellular activation (Kupfer and Singer, 1989; Vogetseder et al., 1989). Critical importance of the LFA-1-ICAM-1 adhesion system is indicated by the observed severe impairment of immune functions in patients suffering from defective LFA-1 expression (Springer et al., 1984).
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
87
D. THEADHESIONSYSTEM CD2-LFA-3 (CD58) The CD2 glycoprotein (reviewed by Moingeon et al., 1989) present on all T cells recognizes its broadly expressed ligand LFA-3 (CD58); interestingly, CD2 and CD58 are both heavily glycocylated molecules, have a high degree of sequence similarity and evolved probably from a common ancestor (Seed, 1987).CD2 is likely to be actively involved in T cell activation as indicated by strong stimulatory affects of suitable pairs of anti-CD2 monoclonal antibodies (Mab) or a combination of purified LFA-3 and an anti-CD2 Mab (Hiinig et d., 1987; Denning et al., 1988). It is therefore tempting to speculate that CD2 may under some conditions bind yet another ligand (a lymphokine?) in addition to LFA-3. Actually, CD2 was shown to bind sulfated polysaccharides (Parish et al., 1988) and other carbohydrate structures (Semenuk and Brain, 1985).The structure of CD2 with its large cytoplasmic domain is certainly indicative of a signal-transduction function. Activation of T cells via CD2 is functionally linked to the TCRICD3 pathway (reviewed by Moingeon et d . ,1989). In agreement with this, physical association of CD2 with TCR was reported (Brown et al., 1989)but this exciting finding is yet to be confirmed. Very interesting is also the reported association of CD2 with CD45, the cytoplasmic domain of which has a tyrosine phosphatase activity (Schraven et al., 1989). As yet unexplained is the nature of a conformational change of CD2 on activated cells, which is manifested by appearance of a new epitope called T113 (Meuer et al., 1984). The ligand of CD2, LFA-3 (CD58), exists in two alternative forms: one of them is a conventional membrane-spanning molecule, while the other is anchored through a GPI moiety (Dustin et al., 1987)but little is known about potential functional differences between these forms. LFA-3 molecules also appear to be able to deliver activation signals to the antigen-presenting cells (Le et al., 1987).
E. “HOMING RECEPTORS” AND RELATEDMOLECULES Homing of lymphocytes in secondary lymphoid organs (lymph nodes, Peyer’s patches), directing leukocytes to the sites of inflammation, and formation of thrombocyte plugs in the sites of vascular damage are all based on specific interactions of these cells with vascular endothelia. Adhesion of leukocytes to specific endothelial cells is mediated by several adhesion systems reviewed recently in several papers (Berg et al., 1989; Yednock and Rosen, 1989; Stoolman, 1989). The major system directing homing of lymphocytes into lymph nodes is based on a leukocyte receptor called LAM-1 (Tedder et al., 1989), identical to previously described differentiation antigens Leu-8 and
88
v. HOREJS~
TQ1 (Camerini et al., 1989),homologous to a murine receptor called MEL-14. This receptor of 90 kDa, expressed variably on various kinds of leukocytes, consists of three structurally distinct domains (membrane-proximal complement receptorlike, short EGF-like, and N-terminal lectinlike), which may exist in two forms differing in their way of anchoring in membrane (Camerini et al., 1989).This membrane lectin seems to bind specifically to carbohydrate moieties of endothelial glycoproteins called “addressins” (Streeter et al., 1988). A molecule structurally similar to the LAM-l/Leu-8 homing receptor called ELAM-1 is expressed on endothelial cells and presumably interacts with a carbohydrate structure(s)on the leukocyte surface (Bevilacqua et al., 1989). Yet another similar molecule is the platelet and endothelial cell granule membrane glycoprotein GMP-140 (PADGEM, CD62) (Johnston et al., 1989) that participates at the interaction of activated platelets with neutrophils and monocytes (Larsen et al., 1989)possibly due to binding to heparin (Skinner et al., 1989).This family of cell adhesion lectins is sometimes called “selectins” or “LEC-CAMS.” Homing to Peyer’s patches seems to be critically dependent on the integrin molecule VLA-4 (Holzmann and Weissman, 1989). Another receptor indispensable for all types of homing is the collagen receptor CD44 discussed previously, and other adhesive molecules such as LFA-1 are probably also involved. Homing of hemopoietic stem cells to bone marrow stroma is probably mediated by incompletely characterized galactose- and manosespecific membrane lectins (Matsuoka et al., 1989).
F. OTHERLEUKOCYTE SURFACE MOLECULESPOSSIBLY INVOLVED IN ADHESION Several other leukocyte surface molecules are potentially involved in adhesion phenomena. The CD57 (HNK-1; 110 kDa) antigen present mostly on NK cells is probably related to several neural cell adhesion molecules (Kuhnemund et al., 1988). The CD56 (NKH-l/Leu-19; 140 and 220 kDa) marker of NK cells was identified as a form of the neural adhesion molecule N-CAM (Lanier et al., 1989a);it was directly shown to play a role in adhesion of N K cells (Nitta et al., 1989).The LAK-1 antigen, which was recently identified as the CD31 glycoprotein (140 kDa), is possibly another adhesion molecule of LAK cells (Zocchi et al., 1987). Several “nonspecific cross-reactive antigens” (NCA; 55160 kDa) expressed on granulocytes are highly homologous to the homotypic cell adhesion molecule CEA (Audette et al., 1987;Arakawa et al., 1990)and therefore they are also likely to be involved in granulocyte adhesion.
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
89
Two other molecules, called E2 (a 32-kDa collagenlike molecule) (Gelin et al., 1989) and H19 (identical to the 20-kDa CD59 glycoprotein discussed in section VI,C) (Groux et al., 1989b) also appear to play a role in adhesion of T cells. Mab against the TOR-1 antigen (33 kDa) inhibited mixed lymphocyte reaction and T cell rosetting indicating possible involvement of this molecule in T cell adhesion (Cardella et al., 1989).A galactose-specific lectin (similar to the hepatocyte asialoglycoprotein receptor) present on the surface of Hodgkin’s cells mediates their adhesion to T cells (Paietta et al., 1989). A hyaluronate receptor (80 kDa) may be one of the adhesive receptors of macrophages (Green et a1., 1988). Finally, homotypic carbohydratecarbohydrate interactions may be also important in intercellular interactions (Kojima and Hakomori, 1989). V. Receptors for Immunoglobulins (Fc-Receptors)
This functionally important group of receptors was recently reviewed (Kinet, 1989). A. RECEPTORSFOR IgG All three types of leukocyte receptors for IgG (reviewed by Unkeless et al., 1988)belong to the Ig family. The high-affinity monocyte receptor for IgG CD64 (FcyRI; 70 kDa) (Allen and Seed, 1989) binds with high-affinity monomeric IgG, so that under physiological conditions it must be completely saturated with the ligand. The low-affinity IgG receptor CDw32 (FcyRII; 40-45 kDa) exists in several forms differentially expressed on lymphocytes and monocytes. It is encoded by a minimum of three genes FcyRIIa, II’a and IIb (Brooks et al., 1989). These forms possess very similar extracellular N-terminal domains but differ substantially in their intracellular domains. Alternative splicing of the FcyRIIb mRNA probably produces additional heterogeneity. The CDw32 receptors bind effectively aggregated IgG (i.e., immune complexes, opsonized particles) and are essential for the IgG-induced respiratory burst and IgG-induced phagocytosis (Huizinga et al., 1989). Cross-linking of these Fcy-receptors with surface Ig molecules on B cells by means of immune complexes results in B cell inactivation (Sinclair and Panoskaltsis, 1987; Schad and Phipps, 1989), which is probably an important immunoregulatory mechanism. Alternative forms of murine FcyRII were shown to differentially mediate endocytosis, obviously because of differences in their cytoplasmic domains (Miettinen et al., 1989). IL-4 induces by an unknown mechanism loss of ligand-binding capacity of the murine B cell FcyRII (Laszlo and
90
V. HOREJSf
Dickler, 1988).The soluble form of FcyRII that naturally arises, probably by a proteolytic mechanism, behaves as a suppressive IgG-binding factor (Varin et al., 1989). The other low-affinity IgG receptor, CD16 (FcyRII; 50-70 kDa) occurs in two forms encoded by distinct genes: the form expressed on NK cells is a transmembranous protein, while the granulocyte-specific form is anchored in membrane through a GPI moiety (Ueda et al., 1989).Cross-linking of this receptor stimulates various NK cell activities (Werfel et al., 1989).The NK isoforni of CD16 [and probably also the CDw32 receptor (Ra et ul., 1989)]is noncovalently associated with the covalent dimer of the 9-kDa y subunit of the high-affinity IgE receptor (Hibbs et al., 1989) and (or alternatively?) with the highly homologous 5 chain of the TCR/CD3 complex (Lanier et al., 1989b). Two other nonleukocyte, intestinal epithelium Fcy-receptors were described: one of them is the remarkable MHC gp I-like newborn rat molecule called FcRn (Simister and Mostov, 1989) and the other is as yet poorly characterized structurally (Kobayashi et al., 1989). A 210-kDa surface glycoprotein of throinbocytes was also reported to be an Fc-receptor (Stricker et al., l987b). The low-affinity Fcy-receptor activity of CD4 has been mentioned previously (section IV,A).
B. RECEPTORSFOR IgE These receptors and soluble IgE-binding factors were thoroughly reviewed by Metzger (1988).The high-affinity IgE receptor ( FcsRI) of basophils and mastocytes, which is responsible for the familiar atopic reactions, is a noncovalent complex of at least three components: the IgE-binding subunit Q (45 kDa), which shares significant sequence similarity with Fcy-receptors (Kinet et al., 1987), subunit /3 (33 kDa), which probably crosses the membrane four times (Kinet et al., 1988), and a covalent dimer of the subunit y (9 kDa), which is homologous to the 5 chain of the CD3 complex (Miller et al., 1989)and is also associated with the Fcy-receptors CD16 and CDw32. The FcsRI appears to be linked to a 100-kDa Ca2+ channel activated upon IgE binding to the receptor (Hemmerich and Pecht, 1988). The low-affinity IgE receptor CD23 (FcsRII; 45 kDa) is a singlechain type 2 integral membrane protein (i.e., with extracellular C-terminus) belonging structurally to the family of membrane lectins (for recent review, see Gordon et al., 1989).CD23 seems to be associated with MHC gp I1 (Bonnefoy et al., 1988);it is strongly up-regulated by IL-4 and is involved in feedback regulation of IgE synthesis. CD23 exists as two closely related forms: FcsRIIa and FcsRIIb have identical extracellular but distinct N-terminal intracellular domains. The
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
91
former is constitutively expressed on B cells and some T cells; the latter is present on eosinophils and can be induced by IL-4 on B cells and monoQytes (Yokota et al., 1988). The extracellular domain of CD23 is spontaneously cleaved off and the soluble molecule behaves as one of the regulatory IgE-binding factors (Delespese et al., 1989). Moreover, it seems to have a B cell growth factor-like activity (Swendemann and Thorley-Lawson, 1987) but the mechanism of this phenomenon is unclear. It is not known whether the CD23 receptor is a true lectin; its interaction with IgE seems to be independent of the IgE carbohydrate moiety (Vercelli et aZ., 1989). CD23 may be also involved in some unknown way in intercellular interactions (Uchibayashi et aZ., 1989). The B cell-specific glycoprotein called Lyb-2 is structurally similar to CD23 but its function is not known (Parnes et al., 1989). There is yet another IgE-binding protein partially associated with the cell surface. It is a galactose-specific lectin identical to the rat antigen Mac-2 uniquely anchored on the macrophage (and other cells) surface through an integral cell surface carbohydrate(s) (Cherayil et al., 1989). Its biological role is not known. C. RECEPTORSFOR IgM, IgA, AND IgD The original claims that the T cell surface glycoprotein CD7 is an IgM receptor (Sandrin et al., 1987) were not confirmed and thus the nature of this receptor remains obscure. A 60-kDa IgM-binding protein was found on activated lymphocytes (Sanders et al., 1987) but little is known about its structure and function. The IgA receptor present on myeloid cells appears to be a heavily glycosylated 60-kDa molecule (Shen et al., 1989, and citations therein), which is probably structurally related to the secretory component of IgA (Crago et al., 1989). The secretory component is actually a fragment of the well-known receptor for transepithelial transport of IgA and IgM (Mostov et al., 1984). A receptor for IgD on T cell clones was also described (Coico et al., 1987). VI. Receptors for Complement Components
This is a group of often structurally related membrane receptors capable of recognizing different complement components and their fragments. As most of these receptors have been recently thoroughly reviewed (Dierich et al., 1988; Campbell et al., 1988), I will only briefly point out some interesting or most recently described features.
92
V. HOkEJSf
A. RECEPTORSFOR FRAGMENTS OF THE C3 AND C4 COMPONENTS The complement receptor type 1 (CR1 or CD35; receptor for C3b and C4b) and CR2 (CD21; receptor for C3d and C3g) are structurally similar to each other, to CD55 [decay accelerating factor (DAF)],CD46 [membrane cofactor protein (MCP)1, and the serum components C4binding protein and factor H. These molecules consist of repeated homologous “modules” of 60 amino acid residues and the corresponding genes are grouped in a cluster on human chromosome 1 (see the reviews cited above and Ahearn and Fearon, 1989). The broadly expressed CR1 (CD35; reviewed by Ahearn and Fearon, 1989) appears to play a role mainly in inhibition of complement activation on autologous cells. It exhibits an unusual type of polymorphism-the four known allelic forms markedly differ in the length of polypeptide chain (160-240 kDa) but all these molecules are functional receptors. The binding sites for C3b and C4b on CR1 are distinct (Klickstein et al., 1988). CR1 seems to be a rigid rodlike molecule occurring on the cell surface in clusters (Paccaud et al., 1988) associated intracellularly with cytoskeleton (Jack et ul., 1986). A 60-kDa secreted form of CR1 of unknown function may exist (Hourcade et al., 1988). The expression of CR2 (CD21; for reviews see Ahearn and Fearon, 1989; Cooper et al., 1988) is limited mainly to B lymphocytes. In addition to its complement receptor function it is also used as an attachment site by the Epstein-Barr virus. CD21 may be associated with p53, a cellular antioncogene-encoded phosphoprotein (Bare1 et al., 1989); also, association of CD21 with the CD5 antigen on chronic lymphoblastoid leukemia cells has been described (Bergui et al., 1988) but functional significance of this complex is quite unclear. CD21 may be also involved in phosphorylation of some nuclear proteins (Delcayre et al., 1987),which is probably relevant to the well-known B cell activation caused by the interaction of CD21 with its natural ligands (Carter and Fearon, 1989). The last major complement receptor of this group, CR3 ( C D l l b / CD18; receptor for iC3b) is structurally different and belongs to the leukocyte integrin (LFA-1) family (for review, see Kishimoto et al., 1989). It has a major role in adhesion of myeloid cells to opsonized particles. As discussed in section IV,C, in addition to their complement receptor role, CDllbICD18 molecules also have important celladhesion functions. The iC3b-binding (CR3) activity and adhesion function also has the CDllc/CD18 antigen (p150/95) expressed most strongly on tissue macrophages (Hogg et al., 1986; see section IV,C).
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
93
B. RECEPTORSFOR OTHERCOMPLEMENT COMPONENTS The broadly expressed C l q receptor was described as a 56-kDa glycoprotein existing mostly as a dimer (Malhotra and Sim, 1989),but a slightly different molecular mass was reported by others (Ghebrehiwet, 1987).The C5a receptor, which is an important chemotactic receptor of granulocytes, appears to be an oligomer of a 45-kDa subunit possibly associated with other component(s) (Rollins et al., 1988); the C5a receptors of neutrophils and eosinophils seem to be different (Gerard et al., 1989). COMPLEMENT-REGULATORY PROTEINS C. MEMBRANE There are several broadly expressed membrane proteins that prevent the damage of bystander cells by activated complement. The DAF (decay accelerating factor, CD55; 70 kDa; for review, see Lublin and Atkinson, 1989) inhibits the generation of C3 convertases by dissociating C2a and Bb (Fujita et al., 1987). It is a glycosyl phosphatidylinositol (GP1)-anchored glycoprotein structurally similar to the CRlICR2 family; in spite of this type of anchoring it appears to be somehow linked to cytoskeleton (Kammer et al., 1988). A highmolecular mass form of DAF was described (Kinoshita et al., 1987) as well as a secreted form of unknown biological role (Caras et al., 1987a). Membrane cofactor protein (MCP, CD46) has a similar binding specifity as CR1 (CD35). It inhibits complement activition on autologous tissues by accelerating the decay of C3 convertases or by acting as a cofactor for I-dependent proteolytic cleavage (Seya and Atkinson, 1989). CD46 is structurally very similar to CD55 (Lublin et al., 1988). There are two species of mature CD46 present on most cell types (approximately 56 and 65 kDa, respectively) that differ in glycosylation (Ballard et at., 1988). It is possible that these two GPI-anchored chains form a noncovalent dimer in the native state. CD55 and CD46 appear to complement each other in their protective roles. Two GPI-linked membrane proteins, HRF (homologous restriction factor, 65 kDa) and CD59 (20 kDa) contribute to protection of cells from complement attack by binding C8 and C9 and thus preventing the membrane attack complex assembly (Zalman et al., 1987; Davies et al., 1989).The CD59 glycoprotein appears to be a human structural homologue of mouse Ly-6 family proteins of unknown function (Davies et al., 1989); it may also act as an adhesion molecule (Groux et al., 1989b). Both HRF and CD59 exist also in soluble forms (Watts et al., 1990; Davies et al., 1989). Soluble HRF may also play a role in preventing assembly of the membrane attack complex (Watts et al., 1990); the
94
v. HOREJS~
function of soluble CD59 remains to be determined. For a summary of GPI-linked membrane proteins and soluble forms of human leukocyte surface antigens, see Tables I1 and 111. VII. Receptors for Lymphokinesand Other Growth and Differentiation Factors
Multiple soluble mediators of polypeptide or glycoprotein nature are essential in regulation of leukocyte growth, differentiation, and proliferation. All of them act presumably through specific receptors expressed on the surface of target cells. In many cases these receptors are present only in small amounts, which makes their isolation and characterization difficult.
A. RECEPTORS FOR INTERLEUKINS Among the most thoroughly studied are the three known receptors for IL-2 (reviewed by Waldmann, 1989). One of these is the lowaffinity receptor CD25 (55 kDa) expressed on activated lymphocytes, which also occurs in a soluble form potentially involved in regulation of IL-2 concentration (Reske-Kunz et al., 1987). Interaction of IL-2 with this receptor appears to deliver a negative signal (Kumar et al., 1987).The other receptor (p75, IL-2RP) has somewhat higher affinity for IL-2 and is constitutively expressed on NK cells and weakly on other resting lymphocytes. Interestingly, this receptor is selectively expressed on lymphocytes of patients with infectious mononucleosis (Kamio et al., 1990).The p75 IL-2 receptor transmits a positive activation signal (Yagita et al., 1989a). The extracellular domain of p75 is structurally similar to the receptors for several other interleukins and hormones (Bazan, 1989) while the intracellular domain does not resemble any other known receptor. The high-affinity IL-2 receptor on activated T cells is a noncovalent heterodimer composed of CD25 and p75, which is associated at least on some cells with another poorly characterized 95-1 15-kDa subunit (Herrmann and Diamantstein, 1988; Szollosi et al., 1987), possibly with other components of 22 kDa and 40 kDa (Saragovi and Malek, 1990), and with MHC gp I (Sharon et al., 1988). Obviously, the supramolecular structure of IL-2 receptor(s) is still far from being completely understood. The mechanisms of signal transduction by the IL-2 receptors are not known except that a tyrosine kinase regulated through p75 is involved (Ferris et al., 1989). IL-2 may also bind to some cell surface carbohydrates (Sherblom et al., 1989) but the biological significance of such lectinlike interaction remains unclear. It is not clear whether this phenomenon is related to the
TABLE I1 GPI-LINKEDMEMBRANE PROTEINS OF HUMAN LEUKOCYTES" Antigen
Molecular mass (kDa)
CD14
53
CD16
50-70
CD24
45
CD48 CDw50 CD55 CD58
41 140,108
CD59
18-20
CD67
100
CD73
69
Mo3e
55-80
HRF
65
NCA
55-160
Blast-1 Human Thy-1
45 26-29
Alkaline phosphatase
78
a
73 45-60
Notes Highly monocyte-specific; unknown function Fc y RIII; the form expressed on granulocytes is GPI-linked, the NK cell form is transmembranous Expressed on B cells and granulocytes; function unknown Broadly expressed; function unknown Broadly expressed; GPI linkage uncertain DAF (complement regulatory protein) LFA-3; broadly expressed adhesion molecule (ligand of CD2); an alternative transmembranous form exists A Ly-6C homologue; a complementprotective molecule (HRF-like activity) Expressed on granulocytes; function unknown Ecto-5 '-nucleotidase present on lymphocyte subpopulations Receptor for MIF? Probably identical to the M5 antigen Complement-protective molecule
A family of CEA-like granulocyte glycoproteins B cell activation antigen Expressed on neurons, a thymocyte subpopulation and some T cell lines Mouse homologue is identical to Ly31; expressed on leucocyte subpopulations - -
References Baiil et al. (198913); Haziot et al. (1988) Simmons and Seed (1988a); Ueda et ol. (1989) van der Schoot et 01. (1989) Hadam (1989b) Hadam ( 1 9 8 9 ~ ) Caras et al. (1987b) Dustin et al. (1987) Stefanova et 01. (1989); Davies et al. (1989) Stockinger (1989b) Dorken et al. ( 1 9 8 9 ~ ) Liu et al. (1989); Gadd et al. (1989) Zalman et al. (1987); Hansch et al. (1988) Audette et al. (1987); Arakawa et ol. (1990) Staunton and Thorley-Lawson (1987) Low and Kincade (1985) Dairiki et al. (1989)
For several other GP1-linked molecules identified during the 4th International Workshop see van der Schoot et al. (1989)and Selvaraj et al. (1989).
TABLE I11 SOLUBLE FORMS OF HUMAN LEUKOCYTE SURFACEANTIGENS Antigen
Notes
References
_____
CD7 CD8 CDlO
W
0,
CD14 CD16
Present in the supernatant of activated T cells A product of alternatively spliced mRNA; secreted by activated T cells Shed from lymphoblastoid cells; for references on soluble CDlO in diseased states see the review by LeBien and McCormack (1989) High concentrations (pg/ml) in normal sera and in pathological urine Released from stimulated neutrophils
CD21 CD23
Present in serum; high in CLL patients Soluble fragment (28 kDa) has a B cell stimulatory activity; produced as a proteolytic fragment of the membrane-bound CD23
CD25
Two distinct possibly immunoregulatory forms are released by activated cells; high levels are present in sera of T-leukemia patients
Jung and Fu (1989) Norment et al. (1989); Tomkinson et al. (1989) Komada et al. (1986) Baiil et al. (1989b) Huizinga et al. (1988); Thaler et al. (1989) Lowe et al. (1989) Delespese et al. (1989); Swendemann and Thorley-Lawson (1987) Lee et al. (1989); Lowe et al. (1989) Reske-Kunz et al. (1987); Henmann et ol. (1989); Semenzato et al. (1987, 1988)
CD26 CD30 CD35 CD44 CD55 CD59 CD71 ED 4
MHCgpI MHC gp I1 Growth hormone receptor TNF-a receptor TNF-/3 receptor IL-6 receptor IFN-y receptor HRF
Serum level is changed under various pathological conditions High serum levels in malignant lymphoma Present in normal sera Present in normal sera Secreted form is produced from alternatively spliced mRNA Soluble form is possibly associated with unidentified components Proteolytic cleavage product of the surface CD71 Multiple species present in serum Soluble form of DQ is a product of alternatively spliced mRNA Soluble form present in normal sera Present Present Present Present Present
in urine (30 kDa) in urine (30 kDa) in urine in urine in urine
Sanda et al. (1989) Josimovic-Alasevic et al. (1989) Yoon and Fearon (1985) Lucas et al. (1989) Caras et al. (1987a) Davies et al. (1989) Chitambar and Zivkovic (1989); Huebers et (11. (1990); Villar et al. (1989) Hassan et al. (1987); Briata et a [ . (1989j Leung et al. (1987) Engelmann et al. (1990) Engelmann et al. (1990) Novick et al. (1989) Novick et al. (1989) Watts et al. (1990)
98
v. HOREJSI
membrane-associated IL-2 observed recently on a subpopulation of human T lymphocytes (Kaplan et al., 1988). There are probably at least two species of 1L-1 receptor: one of these is an 80-kDa glycoprotein expressed, for example, on T cells and fibroblasts. The extracellular part of this molecule consists of three Ig-like domains, while the structure of the cytoplasmic domain indicates a potential for association with a signal-transducing G-protein (Sims et al., 1989). A distinct 66-kDa 1L-1 receptor is present on pre-B cells and macrophages (Bomsztyk et al., 1989). Mechanism of signal transduction involves rapid phosphorylation of the receptor upon IL-1 binding (Gallis et al., 1989).Interestingly, IL-1 and its receptor appear to be endocytosed and translocated to the nucleus (Curtis et al., 1990). Similarly, as in the case of IL-2, a second recognition system dependent upon specific high-mannose carbohydrate structures may be utilized by IL-1 (and also by TNF) (Muchmore et al., 1989). The IL-1 molecules, or rather IL-1 precursors, bound in this way to the cell surface behave as a membrane IL-1 (Brody and Durum, 1989). It is not quite clear whether another directly membrane-associated form of IL-1 or TNF exists (Kriegler et al., 1988; Luettig et al., 1989) but certainly the cell surface IL-1 and TNF are functionally important (Kriegler et al., 1988; Kurt-Jones et al., 1985; Hurme, 1987). The recently cloned receptor for IL-3 (140 kDa) belongs to the structurally distinct family of cytokine receptors (Itoh et al., 1990) as well as the murine IL-4 receptor (Mosley et al., 1989; Harada et ul., 1990). The latter receptor may exist in at least three forms-a 140-kDa transmembranous form, another lacking the cytoplasmic domain, and a secreted form. The IL-4 receptor may be actually composed of at least two chains (Fernandez-Botran et al., 1989). There are apparently two species of mouse IL-5 receptors: the lowaffinity receptor has a molecular mass of 46 kDa, while the high-affinity species consists of the 46-kDa subunit associated with another component (Mita et al., 1989).Complex nature ofthe IL-5 receptor was also observed in the experiments employing an IL-5 receptor-specific Mab (Rolink et al., 1989). The IL-6 receptor is another well-characterized receptor of this group. It is expressed most strongly on plasma cells and myelomas as an 80-kDa integral membrane glycoprotein. Its extracellular portion is structurally similar to several other cytokine receptors such as IL-2RP (p75) (Bazan, 1989)but the N-terminus is formed by an Ig-like domain (Yamasaki et al., 1988). After binding of IL-6 the receptor becomes associated with a 130-kDa signal-transducing subunit (Taga et al., 1989).
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
99
The receptor for so-called high-molecular-weight B cell growth factor (BCGF) (a 50-60-kDa lymphokine) is probably identical or closely linked to the BA5 antigen (90 kDa) of activated B cells (Ambrus et al., 1988). The B cell antigen AB-1 (55 kDa) may be the receptor for another incompletely characterized lymphokine called lowmolecular-weight BCGF (Jung and Fu, 1984). DIFFERENTIATION, AND B. RECEPTORSFOR OTHERGROWTH, REGULATORY FACTORS The receptor for interferons a and 0 (95 kDa) was reviewed recently (Mogensen et al., 1989). The receptor for interferon y is a 90-kDa integral membrane protein with a large intracellular domain (Auget et al., 1988). Carbohydrate moiety of this receptor is essential for the ligand binding probably because of its importance in proper conformation shaping (Fischer et al., 1990). Basic information is available also on distinct receptors for TNFa and -/3 (76-96 kDa) (Stauber et al., 1988; Stauber and Agganval, 1989). Soluble forms of both of these receptors (approximately 30 kDa) have been found in urine (Engelmann et al., 1990). Properties of receptors for “colony-stimulating factors” (CSF) were reviewed by Nicola (1989). These receptors seem to be functionally linked as interaction of one of them with its specific ligand results in synchronized modulation of other receptors of this group. The best known of these molecules is the CSF-1 (monocyte-CSF) receptor, which is expressed mainly on macrophages. This 165-kDa receptor (reviewed by Sherr, 1990)has an extracellular portion consisting of five Ig-like domains and a duplicated cytoplasmic domain of high degree of sequence similarity to the tyrosine kinases of the src family (Coussens et al., 1986).A form of this receptor modified in the cytoplasmic kinase domain is identical to the product of the retroviralfms oncogene. This truncated receptor phosphorylates itself constitutively (while the normal receptor is a ligand-dependent enzyme), which results in deregulated cell proliferation (Sherr et al., 1985; Wheeler et al., 1986). CSF-1 receptor is associated with phosphatidylinositol-3 kinase, which becomes activated by the CSF-l-dependent tyrosine phosphorylation (Varticoviski et al., 1989). CSF-1 receptor is highly homologous to the platelet-derived growth factor (PDGF) receptor (Williams, 1989). The receptor for GM-CSF (85kDa) is a heavily glycosylated protein structurally belonging to the cytokine receptor family (Gearing et al., 1989) with a relatively short cytoplasmic domain devoid of kinase activity. The G-CSF receptor may consist of 120- and 150-kDa subunits (Uzumaki et aZ., 1989).
100
v. HOREJS~
C. RECEPTORS FOR INSULIN AND OTHERGROWTH FACTORS Structure and function of the receptor for insulin have been thoroughly reviewed (Van Obberghen and Gammeltoft, 1986). This structurally unusual molecule, a covalent heterotetamer consisting of two light (84 kDa) extracellular and two heavy (130 kDa) transmembrane subunits, forms aggregates after its interaction with insulin, which stimulate autophosphorylation of the heavy subunit cytoplasmic domain (O’Brien et al., 1987). The cytoplasmic domain is structurally closely related to the src family of tyrosine kinases. The role of MHC gp I molecules associated with the insulin receptor (Edidin, 1988) is not exactly known. Interestingly, the affinity of the insulin-receptor interaction is influenced by the allotype of the associated MHC gp I (Kittur et al., 1987), and recent data suggest that the associated MHC gp I may regulate the receptor autophosphorylation (T. Hansen et al., 1989). Details of the mechanism of signal transduction through the insulin receptor are not known but a phosphorylation-mediated activation of multiple serine kinases seems to be an essential early step (Czech et al., 1988). It is not clear whether the receptor autophosphorylation is always functionally relevant, as some Mabs against the receptor mimic metabolic effects of insulin without stimulation of receptor autophosphorylation (Soos et al., 1989). Receptors for two insulinlike growth factors (IGF) on various cells, including leukocytes, have been identified (for review, see Czech, 1989).The IGF-type I uses either the insulin receptor or a structurally similar receptor (Tollefsen and Thompson, 1988). The receptor for IGF-type I1 (270kDa) has an interesting dual specificity: in addition to its ability to bind IGF-type 11, it is also a lectin-recognizing mannose6-phosphate residue (Roth, 1988).The latter receptor activity is physiologically important for capture and internalization of lysosomal enzymes that carry the mannose-6-phosphate “tag.” Physiological relevance of IGF-type I1 and why it uses the same receptor as the mannose-6-phosphate glycoproteins is unknown. There is another broadly expressed mannose-6-phosphate receptor (46 kDa) structurally similar to the 270-kDa one which is however devoid of any IGF-type I1 receptor activity (Czech, 1989; Pohlmann et al., 1987). The receptor for growth hormone is a 130-kDa glycoprotein (Leung et al., 1987) structurally belonging to the cytokine receptor family, which exists in the membrane as a covalent heterodimer (Asakawa et al., 1986).A 51-kDa soluble fragment of this receptor occurs in serum and may play a role in regulation of effective growth hormone concentration (Leung et al., 1987).
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
101
Based on structural considerations and/or observed effects of monoclonal antibodies, several of the well-defined leukocyte surface molecules are suspected to be receptors for as yet unidentified stimulatory soluble mediators. Among them are, for example, the T cell molecules CD5, CD27, and CD28 (see Table IV). Mabs against these molecules markedly augment the T cell activation. A functionally distinct subpopulation of B cells producing IgM autoantibodies is CD5+ (Kipps, 1989) but the reason of this phenotype is unclear, as well as the role of the CD5 molecule in the physiology of T and B cells. The CD28 antigen appears to act through an unusual mechanism: its cross-linking by Mabs results in substantial increase of half-life of mRNAs coding for several lymphokines (Lindsten et al., 1989).The level of CD28 expression (in conjunction with the apparently mutually exclusive expression of CDllb/CD18) may differentiate the T, and T, subpopulations within CD8+ T cells (Yamada et al., 1985). CD28 is expressed also on plasma cells (Kozbor et al., 1987). Identification of natural ligand of CD28 is certainly an important goal in this field of leukocyte biology. Another candidate for a receptor is the early activation antigen CD69, a covalent dimer of 34-kDa and 27-kDa subunits that have a common polypeptide backbone (Testi et al., 1989).Yet another potential lymphokine receptor is a 70-kDa activation antigen called TLiSAl (Burns et al., 1985). A Mab against this antigen blocks stimulation by interferons a or y (Chen et al., 1986) and its expression is downregulated by transforming growth factor /3 (Jin et al., 1989). Finally, the B lymphocyte activation molecule CD40 might be a receptor for a hormone as its structure is similar to the nerve growth factor (NGF) receptor (Stamenkovicand Seed, 1989a);it was suggested that CD40 may be a low-affinity IL-6 receptor (Clark, 1989). The NGF actually induces growth and differentiation of human B lymphocytes, but this is probably because of its interaction with the “conventional” receptor (85 kDa) expressed on these cells at a much lower density than on neurons (Otten et al., 1989). D. RECEPTORSFOR NEUROTRANSMITTERS The well-recognized interactions between the immune and neural systems are based among other factors on the presence of receptors for neuroactive substances on leukocytes. Thus, /3-adrenergic receptors (Fuchs et al., 1988), opioid receptors (Carr et al., 1988; Sibinga and Goldstein, 1988), and substance P receptors (Pascual et al., 1989) were found on mouse and human leukocytes. It is not quite clear whether these receptors are identical to the analogous neuronal molecules. By far the best studied receptors of this group are the adrenergic receptors
TABLE IV MOLECULESOF KNOWN PRIMARY STRUCTURE (cDNA CLONED) LEUKOCYTE SURFACE Antigen CDla CDlb CDlc CD2
Synonyms
Molecular mass (kDa)
+ 12 (Ig family)
T6, Leu-6
49
T11, Leu-5, LFA-2
45 + 12 (Ig family) 43 + 12 (Ig family) 50
CD3y
27
CD36 CD3e CD3c
20 20 (16)2
CD4
T4, Leu-3
55 (Ig family)
CD5
T1, Leu-]
67
CD7 CD8a
3A1, Leu-9 T8, Leu-2
35-40 (Ig family) 32 (Ig family)
CD8B CD9
Human Ly-3 P24
30 (Ig family) 24 (Ig family)
Notes All CDI are associated with b2m; antigen-presenting molecules? See CDla See CDla Adhesive molecule (receptor for CD58) Structure similar to CD36, E; associated to TCR See CD3y See CD3y; unglycosylated Associated also with CDlb; structurally similar to the y subunit of FceRI Receptor for MHC gp I1 and HIV gp 120; assoc. with the ~ 5 6 ' tyrosine '~ kinase Present on T cells and a B cell subpopulation T cell-specific molecule Receptor for MHC gp I; associated with the ~ 5 6 ' ' ~ tyrosine kinase; a-a homodimer on NK cells; a-P heterodimer on T cells See CD8a Present on pre-B cells, ALL, monocytes, and thrombocytes
References (cloning) Calabi and Milstein (1986); Aruffo and Seed (1989) See CDla See CDla Sewell et al. (1986) Gold et al. (1986) van den Elsen e t al. (1984) Krissansen et al. (1986) Weissman et al. (1988)
Maddon et al. (1985) Jones et al. (1986) Aruffo and Seed (1987b) Sukhatme et al. (1985)
Norment and Littman (1988) Tang et al. (1989)
CDlO
CALLA
100
CDlla
LFA-1
180 (integrin family)
CDllb
Mac-1, Leu-15, Mol (achain)
170 (integrin family)
CDllc
p150,95, Leu-15
150 (integrin family)
CD13
MY7
150
CD14
MY4, Leu-M3
53
CD16
Leu-11
50-70 (Ig family)
CD18
95 (integrin family)
CD19
LFA-lb, integrin subunit ,82 B4, Leu-12
FcyRIII; 2 close genes code for 2 forms differing in membrane anchoring See C D l l
90 (Ig family)
Associated with surface Ig
CD20
B1, Leu-16
35
CD21
B2
140 (CR family)
CD22
Leu-14
130,140 (lg family)
Linked to a Ca2+channel of B cells? C3d receptor (CR2); EBV receptor B cell specific; sequence similar to myelinassociated glycoprotein (MAG)
Neutral endopeptidase; type 11 membrane protein Associated with CD18; the LFA-1 complex is an adhesion molecule (receptor for CD54) Associated with CD18; the complex is iC3b receptor (CR3) Associated with CD18; the complex is an adhesive molecule and iC3b receptor Surface N-aminopeptidase of myeloid cells PI-linked monocyte marker
8
. Letarte et ~ l(1988) Kishimoto et a!. (1987b)
. Corbi et ~ l(1988) Corbi et d ( 1 9 8 7 )
Look et al. (1989) Goyert et al. (1988); Ferrero and Goyert (1988) Simmons and Seed (1988a)
. Law et ~ l(1987); Kishimoto et ~ l(1987a) . Stamenkovic and Seed (198813) Stamenkovic and Seed (1988a) Moore et QZ. (1987) Stamenkovic and Seed (1989)
(continued)
TABLE IV (Continued) ~~
Antigen
Synonyms
Molecular mass (kDa)
CD23
Blast-2
45 (lectin family)
CD25 CD26
Tac Tal, Tp103
55 120
CD27 CD28
T14 9.3, Tp44
44 (Ig family)
CD29
4B4, GPIIa, integrin subunit p l SG134, GPIIa’, LAK-1
CD31 CDw32
135 (integrin family)
130 (Ig family)
CD33
MY9
67
CD34
MY10
115
CD36
160-250 (CR family) OKM5, GPIV
FceRII; two similar species of different expression; type I1 membrane protein Low-affhity IL-2 receptor Dipeptidylpeptidase IV; marker of activated T cells
(55)~
40 (Ig family)
CD35
Notes
85
Expressed on most T cells and plasma cells A component of the VLAdimers (see Table I) Present on myeloid and LAK cells, thrombocytes At least 3 “isotypes” exist (products of close genes) Marker of myeloid precursors; structurally similar to CD22 and MAG Heavily glycosylated; limited structural similarity to CD43; marker of hemopoietic progenitors Receptor for C3b and C4b (CR1); allotypes differ in molecular mass Receptor for thrombospondin and collagen; receptor for Plasmodium-infected erythrocytes
References (cloning) Kikutani et al. (1986); Yokota et al. (1988) Leonard et al. (1985) Camerini and Seed (1989) Camerini and Seed (1989) Aruffo and Seed (1987a) Argraves et al. (1987) Stockinger et al. (1990) Brooks et al. (1989) Simmons and Seed (1988b) Simmons and Seed (1990)
Klickstein et al. (1987) Oquendo et al. (1989)
CD37
RFB-7
40-45
CD38
T10, Leu-17
45
CD40
c1
50
Similar to CD53 and rat OX44 Type I1 membrane protein of thymocytes and plasma cells Sequence similar to nerve growth factor receptor; possibly low-affinity receptor of IL-6 Complex GPIIb/IIIa is a thrombocyte adhesion molecule (fibronectin receptor)
Classon et al. (1989) Stamenkovic et al. (1989~) Stamenkovic et al. (1989b)
CD41
GPIIb
120 (GPIIba) + 23(GPIIbS) (integrin family) 110 (integrin family)
Fitzgerald et al. (198713)
CD42a
GPIIIa (CD61) (integrin PEchain) GPIX
23
Lopez et a!. (1988)
GP42b
GPIb
CD43
Leukosialin, sialophorin Pgp-1, Hermeshoming receptor
0 01
CD44 CD45
T200, L-CA
Forms a complex with CD42b (receptor for von Willebrand factor) 135 (CPIba) t GPI a and /3 are covalently linked 25(GPIbp) 95 Neurons, T cells, granulocytes 80 Adhesive molecule (receptor for collagen) involved in homing At least 5 “isotypes” exist 180-220 (Tyr(products of alternatively phosphatase familyintracellular spliced mRNA); cytoplasmic domain is a domain) tyrosine phosphatase (see section VIII)
Poncz et al. (1987)
Hickey et al. (1989) Shelley et nl. (1989) Goldstein et a2. (1989); Stamenkovic et 02. (1989a) Streuli et al. (1987)
(continued)
TABLE 1V (Continued) Antigen
z
Synonyms
Molecular mass (kDa)
CD45RA
2H4
220,205
CD45RB
Pd7
190-205
CD45RO
UCHLl
180
CD46
HuLym5, MCP
66 (CR family)
CD49
VLA-1 through VLA-5 (achains)
CD51 CD53
120 + 24 (integrin family) 32-40
CD54
ICAM-1, LB-2, OKT27
85 (Ig family)
CD55
DAF
73 (CR family)
CD56
NKH1, Leu-19
135,220(Ig family)
Notes
References (cloning)
CD45 isotypes containing the segment encoded by exon A CD45 molecules containing the segment encoded by exon B CD45 molecules devoid of the segments encoded by exons A, B, and C Membrane cofactor protein (complement-regulatory protein) See Table I
Streuli e t al. (1987, 1988a)
Vitronectin receptor a chain; forms dimer with CD61 Polypeptide crosses the membrane 4 times; structure similar to CD37 and rat OX44 Adhesive molecule (ligand of LFA-1); receptor for rhinoviruses Decay accelerating factor (a GPI-linked complementprotective protein) A form of the neural cell adhesion molecule NCAM
Suzuki et al. (1987)
Streuli e t al. (1987, 1988a) Streuli et al. (1987, 1988a) Lublin e t al. (1988)
Angelisova et al. (1990)
Simmons e t al. (1988) Caras et al. (1987a) Cunningham e t al. (1987)
CD58
LFA-3
45-60
CD59
MEM-43, HRF-20
18-20
CD61
GPIIIa integrin, p3 chain
110 (integrin family)
CD62
GMP140, PADGEM
150 (lectin family, CR family)
CD64 CD71
T9
70 (Ig family) (90)Z
CD74
41,35,31
IL-1 receptor
80 (cytokine receptor family, Ig family) 75 (cytokine receptor family)
IL-2 receptor
IL-3 receptor IL-4 receptor (mouse)
P75
105 (cytokine receptor family) 140 (cytokine receptor family)
Adhesive molecule (ligand of CD2); 2 forms exist differing in membrane anchoring; sequence similarity of CD2 Human homologue of Ly-6 family; complementprotective molecule (HRFlike); GPI-linked Forms noncovalent complexes with GPIIb (see CD41) and CD51 Structurally similar to the LAM-1 homing receptor; thrombocyte adhesion molecule? Monocyte FcyRI Receptor for transferin; type I1 membrane protein Surface form of MHC g p I1 invariant chain (Ii); type I1 membrane protein
Seed (1987)
Davies et al. (1989)
Fitzgerald et al. (198%) Johnston et al. (1989)
Allen and Seed (1989) Schneider et al. (1984) Strubin et al. (1986) Sims et al. (1989)
Medium-affinity IL-2 receptor; the complex with CD25 is high-affinity receptor
Hatakeyama et al. (1989)
Itoh et al. (1990) Multiple forms and alternative IL-4 receptors exist
Mosley et al. (1989)
(continued)
TABLE IV (Continued) Antigen
r 0
Q1
Synonyms
Molecular mass (kDa)
IL-6 receptor
80 (cytokine receptor family)
CSF-1 receptor
165 (cytokine receptor family; st-c kinase family)
GM-CSF receptor
85 (cytokine receptor
IFNy receptor
family) 90
Growth hormone receptor PDGF receptor
Insulin receptor
IGF-I1 receptor
160 (cytokine receptor family; src kinase family) (90+ 130)~ (st-c kinase family) 250
Mannose-&phosphate receptor LDL receptor
46
Scavenger receptor
(7713
160
Notes After interaction with IL-6 associates with a 130-kDa subunit CSF-1 (M-CSF)-dependent tyrosine kinase; identical to c-fms protooncogene product
References (cloning) Yamaski et al. (1988) Coussens et al. (1986)
Gearing et al. (1989) Soluble form is present in urine Soluble form is present in serum Similar to CSF-1 receptor
Auget et al. (1988)
Insuiin-dependent tyrosine kinase Dual specificity: binds IGFtype 2 and mannose-6phosphate Structurally similar to IGFtype 2 receptor Receptor for cholesterol uptake Collagenlike structure; receptor for modified LDL and some polyanions; implicated in pathogenesis of atherosclerosis
Ullrich et al. (1985)
Leung et al. (1987) Williams et al. (1989)
Oshima et al. (1988) Pohlmann et al. (1987) Yamamoto eta!. (1984) Kodama et al. (1990); Rohrer et al. (1990)
Homing receptor
LAM-1, Leu-8, TQ1
90 (lectin family; CR family)
Poliovirus receptor
45 (Ig family)
Adrenergic receptors
P-gl ycoprotein
MDR-glycoprotein
ICAM-2
B7
170
46 (Ig family) BB1
60 (Ig family)
Blast-1
45 (Ig family)
mb-1 PC-I Human Thy-1
34 26-29
4F2 (achain)
80
44G4
(95L
(w
2
Membrane lectin essential for homing to lymph nodes Broadly expressed; primary function unknown A family of homologous receptors multiply crossing the membrane; structurally similar to rhodopsin Transport protein for some xenobiotics; responsible for multidrug resistance Adhesive molecule (an alternative ligand of LFA1) Marker of previously activated B cells B cell activation antigen; GPI-linked Associated with surface Ig Structurally similar to CD71 GPI-linked molecule of neurons and some th ymocytes Covalently bound to a 40kDa chain; probably a Ca2+/Na+exchanger Pre-B and endothelial cell molecule structurally similar to transferrin receptor
Tedder et al. (1989); Camerini et al. (1989) Mendelsohn et al. (1989) Kobilka et al. (1987); Dohlman et al. (1987) (review) Ueda et al. (1987) Staunton et al. (1989) Freeman et al. (1989) Staunton and ThorleyLawson (1987) Sakaguchi et al. (1988) Buckley and Coding (1989) Seki et al. (1985) Quackenbush et al. (1987) Gougos and Letarte (1989)
(continued)
TABLE IV (Continued) Antigen FmRI
Synonyms
Molecular mass (kDa)
a chain
45 (Ig family)
B chain
33 (912
y chain
LAR
200 (Tyr-phosphatase family; Ig family)
NCA
55-16 (Ig family)
E2
32
Mac2 (mouse)
32 (lectin family)
Band 3-like protein
100
Glucose transporter
54
Lyb-2
45 (lectin family)
Folate binding protein Human MRC OX-2
40
50-60 (Ig family)
Notes
References (cloning)
IgE-binding subunit; similar Kinet et al. (1987) to Fcy receptors Multiplycrossing membrane Kinet et al. (1988) Miller et al. (1989) Structurally similar to the 5 chain of CD3 complex; associated also with Fc receptors? Cytoplasmic domain similar Streuli et al. (1988b) to CD45 (tyrosine phosphatase); extracellular domain similar to N-CAM A family of GPI-linked Audette et al. (1987); granulocyte CEA-like Arakawa et al. (1990) molecules Gelin et al. (1989) Collagenlike product of the MIC-2 pseudoautosomal gene; possibly involved in adhesion Galactose-specific IgECherayil et al. (1989) binding lectin; identical to the soluble protein CBP35 Anion transporter crosses the Demuth et al. (1986) membrane 10 times Mueckler et al. (1985) Polypeptide crosses the membrane 12 times Structurally similar to CD23; Parnes et al. (1989) type I1 membrane protein GPI-linked receptor Lacey et al. (1989) Broadly expressed human homologue of rat MRC ox-2
McCaughan et al. (1987); Clark et al. (1985)
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
111
of thrombocytes and neurons. Structure and function of this family of proteins multiply spanning the membrane and coupled to G-proteins were reviewed (Dohlman et al., 1987) and therefore will not be discussed here.
E. CHEMOTACTIC RECEPTORSAND RELATEDMOLECULES Several receptors appear to be involved in guiding myeloid cells to the sites of inflammation. One is the previously mentioned C5a receptor (section V1,B); another is the receptor for N-formyl peptides, which is a 50-70-kDa molecule coupled to a 20-kDa G-protein (Harwood et al., 1989; Painter et al., 1987). Another potent chemotactic factor, leukotriene B4, also acts through a specific receptor (Koo et al., 1988). Interactions of specific ligands with the receptors for C5a, formylpeptides, and leukotriene B4 stimulate granulocytes and monocytes to “oxidative burst,” which is an effective bactericidal mechanism employed by these cells. This type of rapid metabolic response is also elicited by, for example, cross-linking of Fc-receptors on these cells. The mechanisms of signal transduction through these myeloid cell receptors were studied in considerable detail and involve, for example, coupling to phospholipases via G-proteins (Cockroft and Stutchfield, 1989; Gierschik et al., 1989; Feltner et al., 1986; for review, see Hamilton and Adams, 1987). Several other molecules are functionally related to this group of receptors. The receptor for a cytokine called macrophage migration inhibitory factor (MIF) has been recently cloned (Steckel et al., 1989), which contradicts the previous reports on a glycolipid nature of this receptor. The MIF receptor may be related or identical to the Mo3e monocyte antigen (50-80 kDa) (Liu et al., 1989). Another molecule involved in monocyte activation is the acutephase protein called C-reactive protein (CRP), which contributes to opsonization of some bacteria. There are probably two species of CRP receptors (40 kDa and 60 kDa) whose molecular nature is yet to be elucidated (Tebo and Mortensen, 1990; Ballou et al., 1989). Interestingly, a Mab against the CD31 antigen (130kDa) inhibited chemotaxis of granulocytes (Ohto et al., 1985), indicating possible association of this molecule with a chemotactic receptor. VIII. Membrane Enzymes
Several of the well-defined surface proteins of human leukocytes possess enzymic activities and it is likely that other membrane-bound enzymes are yet to be discovered. In some cases the enzymic activity is
112
V. HOREJSf
localized extracellularly (“ectoenzymes”),and in other cases intracellularly. Among the well-known leukocyte ectoenzymes is the type I1 membrane glycoprotein CDlO (CALLA; 100 kDa), expressed strongly on pre-B cells, granulocytes, and some other cells (for review, see LeBien and McCormack, 1989), which is identical to neutral endopeptidase (enkephalinase) (Letarte et al., 1988). This enzyme seems to proteolytically activate or inactivate various peptidic or polypeptidic soluble mediators (LeBien and McCormack, 1989). The surface glycoprotein of myeloid cells CD13 (150 kDa) has an activity of N-aminopeptidase (Look et al., 1989).The activation antigen CD26, identical to the molecules described previously under the names T a l (Fox et al., 1984; Dang et al., 1990)and Tp103 (Fleischer et al., 1986), is identical to the membrane enzyme dipeptidylpeptidase IV (Mattern et al., 1989). This ectoenzyme appears to be involved in some as yet unknown way in T cell activation (Schon et al., 1989). A remarkable group of ectoenzymes are those anchored in the leukocyte membrane through a GPI moiety, such as 5’-nucleotidase (CD73; 69 kDa) (Darken et al., 1989c), alkaline phosphatase [the mouse enzyme of 78 kDa is identical to the alloantigen Ly31 (Dairiki et d., 1989)],and also acetylcholinesterase that is present mostly on erythrocytes (Suhail and Rizvi, 1989). The function of CD73, (i.e., 5’-nucleotidase) obviously is to dephosphorylate 5’-nucleoside monophosphates to nucleosides that can be taken up by transport systems. It is of interest that T cell subpopulations differ markedly in expression of CD73 and that the generation of alloreactive cytolytic T lymphocytes is inhibited by blocking the 5’-nucleotidase activity (Massaia et al., 1988). For unknown reasons membrane alkaline phosphatase is a late marker of B cell activation (Burg and Feldbush, 1989). Other less well-characterized ectoenzymes are, for example, an ATPase of cytolytic T lymphocytes that appears to protect these cells from cytotoxic effects of extracellular ATP (Filippini et al., 1990). An ectoprotein kinase activity was detected on neutrophils (Dusenbery et al., 1988) as well as a membrane protease cleaving C3 on the U937 cells (Maison et al., 1989). A chymotrypsinlike membrane protease (180 kDa) associated with cellular activation was found on the neutrophi1 surface (King et al., 1987), which may be possibly related to a 300-kDa surface proteinase released into medium by neutrophils upon stimulation (Pontranoli et al., 1986). Several of the known leukocyte surface receptors possess enzymic activities in their intracellular domains, such as the already discussed
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
113
receptors for CSF-1 or insulin, while the CD4 and CD8 glycoproteins are intracellularly associated with the p56ICktyrosine kinase structurally similar to the cytoplasmic domains of the CSF-1 and insulin receptors (for review on this src-like family of tyrosine kinases, see Hanks et al., 1988). Cytoplasmic domain of the activation antigen CD30 (120 kDa) probably has a serine protein kinase activity (H. Hansen et al., 1989) but its extracellular ligand is as yet unknown. The 5/9 antigen expressed differentially on functional T cell subsets was also reported to possess a kinase activity (Risso et al., 1987) but this claim is yet to be verified after a more detailed structural characterization. On the other hand, the cytoplasmic domain of the CD45 molecules has a tyrosine-phosphatase activity (for reviews, see Thomas, 1989; Hunter, 1989). The CD45 family comprises at least five members (170-220 kDa) differing in their N-terminal heavily O-glycosylated domains. These distinct molecular forms are encoded by a single gene and arise by translation of alternatively spliced mRNA (Streuli et al., 1987).These strictly leukocyte-specific antigens have several interesting features: the expression of some of the forms correlates with cell lineage and with the cell differentiation stage (Thomas and Lefranqois, 1988), and additional complexity of the CD45 molecules is probably due to differential glycosylation of the individual polypeptides (Baiil et al., 1989a). CD45 molecules may be associated with the CD2 glycoprotein of T cells (Schraven et al., 1989). The CD45 tyrosine phosphatase appears to activate the CD4/CD8-linked ~ 5 6 ' "tyrosine ~ kinase (Mustelin et al., 1989), which is in agreement with the repeatedly observed functional effects of antibodies against CD45 in various in vitro cellular tests. For example, cross-linking with CD45 markedly affects signal transduction by various T cell surface molecules (Ledbetter et al., 1988). Cytoplasmic domain of CD45 is probably linked to the cytoskeletal protein fodrin (Bourguignon et al., 1985). As yet, nothing is known about the presumed natural ligand of the extracellular domain of CD45 molecules. Structural differences of the Nterminal segments of the CD45 isoforms and their developmentally regulated expression suggest that these regions do interact with some ligand(s)and that such interactions regulate the enzymic activity of the cytoplasmic domain. In this respect it is interesting that the carbohydrate structures of the CD45 molecules on functionally abnormal T cells of the lpr mice (a strain with high incidence of autoimmune diseases) are different from those of normal lymphocytes (Yamashitaet al., 1989). A specialized cell-adhesion function of the CD45 carbohydrate moiety may be indicated by an observati-on that the murine
114
v. HOREJS~
CD45-derived carbohydrates inhibited the binding of NK cells to their targets (Gilbert et al., 1988). The expression of CD45 isoforms correlates in an as yet incompletely understood fashion with the differentiation stage of T lymphocytes: the cells expressing the 220-kDa and 205-kDa isoforms (CD45RA) also have a low level of some adhesion molecules (CD29, CD2, CD44, LFA-1, LFA-3) and appear to be mostly virgin T cells, while the cells that switched to the expression of the 180-kDa isotype (CD45RO) also have high levels of the adhesion molecules and represent the memory T cells prestimulated by a previous encounter with antigen (Akbar et al., 1988). Development of thymocytes is also accompanied by changes in expression of the CD45 isoforms (Pilarski and Deans, 1989).The coregulation of CD45 isoforms expression with several cell adhesion molecules might also be indicative of a function of the extracellular domains of CD45 molecules. There are CD45 molecular forms expressed with a high degree of specificity on B cells (Dorken et al., 1989h) but no details are known on their structure and possible function. Elucidation of all details of the structural and functional aspects of CD45 molecules is certainly an exciting subject of leukocyte biology. Another CD45-like molecule was described, called LAR (Streuli et al., 1988b), for which cDNA was cloned, but so far little is known about the protein product of predicted molecular mass over 200 kDa. Cytoplasmic domain of LAR is highly homologous to CD45 and is also supposed to have a tyrosine-phosphatase activity, while the extracellular domain is completely different from CD45 and markedly similar to the cell adhesion molecule N-CAM. IX. Transport Proteins
Relatively little is known about this group of leukocyte surface molecules. Some of them have been studied in much more detail in other cell types such as erythrocytes; it is likely that identical or homologous molecules are also present on various types of leukocytes. The activation antigen 4F2, a covalent heterodimer of an 80-kDa and 40-kDa chain, appears to be a CaZf/Na+exchanger (Bron et al., 1986; Quackenbush et al., 1987). A thoroughly studied membrane protein of this group is the P-glycoprotein (MDR-glycoprotein, 170 kDa), which is responsible for the phenomenon of so called “multiple drug resistance” in some neoplastic cells, including leukemia and lymphomas (for review, see Gottesman and Pastan, 1988; Jurankaet al., 1989). This inducible molecule mediates rapid ATP-driven excretion of various
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
115
relatively hydrophobic xenobiotics. The polypeptide chain of the P-glycoprotein presumably crosses the membrane 12 times and its sequence is similar to the family of bacterial periplasmic transport proteins and to the cystic fibrosis gene product. A similar multiplemembrane-spanning structure also has the anion exchanger known in erythrocytes as “band 3” (100 kDa); very similar proteins are present also in other cell types including leukocytes (Demuth et al., 1986). This transport molecule is linked to several intracellular proteins (Willardson et al., 1989). Another erythrocyte protein of similar structure is the glucose transporter (55kDa), which is also present in other cell types (Meuckler et al., 1985). Properties of the erythrocyte membrane transporters are reviewed in a recent monograph (Agre and Parker, 1989). The predicted structure of several other leukocyte surface molecules may suggest they are also membrane transporters or ion channels. Among them is the B cell-specific antigen CD20 (35kDa; Stamenkovic and Seed, 1988a), which is identical or closely linked to a Ca2+channel (Bubien et al., 1989), another mainly B cell-specific antigen CD37 (40 kDa; Classon et al., 1989), and a pan-leukocyte antigen CD53 (35 kDa; Angelisova et al., 1990). A number of substances are transported via specific receptors and endocytosis of the receptor-ligand complex. The best known receptor of this kind is the receptor for transferrin (CD71; for review, see Huebers and Finch, 1987). It is a typical “activation antigen” present on various types of proliferating cells including early thymocytes and activated lymphocytes. CD71 is a covalent homodimer of a 90-kDa subunit oriented with its C-terminus extracellularly. Endocytosis of the transferrin-receptor complex proceeds via coated pits (Iacopetta et al., 1988). An antigenically distinct form of transferrin receptor expressed preferentially on erythroid precursors was described (Cotner et al., 1989); its structural and functional relation to the conventional receptor is unclear. A soluble form of transferrin receptor (78 kDa) is produced by the action of a membrane protease (Chitambar and Zivkovic, 1989). Transferrin receptor may serve as a target structure recognized by some NK cells on the surface of tumor cells (Vodinelich et al., 1983). It is not known whether the interaction of transferrin with the receptor provides an activation signal independent of the primary “nutritional” function (iron supply) (Kay and Benzie, 1986). The PC-1 antigen has an expression and overall structure (homodimer of a 120-kDa glycoprotein) similar to the transferrin receptor (Buckley and Goding, 1989), suggesting it may also be a receptor for an as yet unidentified ligand.
116
V. HoREJSf
An incompletely characterized receptor of myeloid cells for hemopexin (80 kDa) serves for delivery of heme moieties to myeloperoxidases of these cells (Taketani et al., 1987). DNA or rather nucleoproteins originating from damaged cells are captured and internalized for reutilization by a specific DNA receptor (39 kDa) present in large amounts on most leukocytes, albeit with some specificity of expression on T cell subpopulations (Bennet et al., 1988). It is not clear how this molecule is related to another functionally similar receptor (94 kDa) (Jacob et al., 1989). The receptor for low-density lipoprotein (LDL; 160 kDa; reviewed b y Schneider, 1989),strongly expressed, for example, on macrophages, mediates uptake of cholesterol. Extracellular domain of this receptor is extremely rich in cysteine and consists of three structurally distinct regions (Yamamoto et al., 1984). Structurally and functionally related to the LDL receptor is the so-called macrophage scavenger receptor (Kodama et al., 1990; Rohrer et al., 1990), which exists in at least two distinct but structurally closely related forms. This receptor is a trimer of a 77-kDa collagenlike subunit avidly binding chemically modified LDL molecules but also a number of various polyanionic substances. Activation of macrophages via this receptor is probably critically involved in development of atherosclerosis. The recently cloned folate-binding protein, a 40-kDa GPI- linked molecule, probably serves a receptor function in a variety of cells including granulocytes (Lacey et al., 1989). X. Other Interesting Molecules
There are a number of well-characterized leukocyte surface molecules that are interesting because of either their expression or their structure, but do not have a clearly defined function. Some of them were already mentioned as being potential growth factor receptors, for example, CD5, CD27, CD28, CD40, CD69, and TLiSAl (see section VII,C), transport molecules such as CD20, CD37, and CD53 (section IX), or adhesion molecules (CD56, CD57, CD59, E2, TOH-1, NCA; see section IV,F). Highly specific expression of some other molecules may indicate specialized but so far unknown functions. Among such cell-typespecific antigens are: CD6, CD7, or CDw60, present nearly exclusively on T cells, CD19, CD22, CD24, CD39, CD72-CD78, B5, B7, and several others present mainly on B cells; CD38 expressed on thymocytes and plasma cells; a monocyte marker CD14; and several granulocyte-specific molecules (CD15, CD17, CD66, and CD67). An-
SURFACE ANTIGENS O F HUMAN LEUCOCYTES
117
other interesting molecule of unknown function is the activation antigen of B cells Blast-1 (Staunton and Thorley-Lawson, 1987). Strictly regulated expression of the CD33 and CD34 molecules on myeloid precursors or of the 44G4 antigen on pre-B cells (Gougos and Letarte, 1988) also indicates that they may play as yet undiscovered stagespecific roles. There are striking differences among species in the specificity of expression of some leukocyte surface markers. For example, the marker of mouse thymocytes and T cells, Thy-1, is present on just a minor fraction of human thymocytes and some rare leukemias (Foon et al., 1984). Expression of CD2 in mouse is not limited to T cells (Yagita et al., 1989b), while sheep TCRyV T cells are CD2 negative (Mackay et al., 1988). The significance of these species differences remains to be explained, but a possibility is that such molecules may be at least in some cells redundant, or their functions are performed by alternative molecules in different species. Surprisingly little is known about functions of the major leukocyte sialoglycoprotein CD43 (90 kDa; Shelley et al., 1989),which is defective in the Wiskott-Aldrich syndrome. The large, evolutionarily conserved, and phosphorylated cytoplasmic domain of this membrane protein suggests a role in signal transduction; the functional effects of anti-CD43 antibodies (Nong et al., 1989) are also compatible with a receptor role of CD43, but the natural ligand is yet to be discovered. An extremely interesting membrane protein called APO-1 (52 kDa) was recently described by Trauth et al. (1989). Binding of a Mab to this antigen induces apoptosis of the cells carrying it (activated lymphocytes, various cell lines), which may result in suppression of lymphoma growth in uiuo. Several leukocyte antigens are practically useful as diagnostic markers characterizing various types of leukemic and lymphoma cells that may under some circumstances also serve as targets for immunotherapeutic agents. In addition to the widely employed marker of ALL CDlO (CALLA),useful markers of various types of myeloid leukemias are the CD33, CD34, and CD14 antigens. Similarly, a common antigen of CLL denoted as cCLLa appears to be a good marker and potential therapeutic target on that type of leukemic cells (Faguet and Agee, 1987). An antigen called YB5.B8, present on a small fraction of bone marrow cells and mast cells, is a marker of some M1-type myeloid leukemia; the expression of this 150-kDa molecule is associated with poor prognosis of the disease (Ashman et al., 1988).An antigen called NC-2 (50 kDa) is expressed on all peripheral blood leukocytes and erythrocytes but only in approximately 5% of subjects; these NC-2+
118
v. HOREJS~
individuals seem to be particularly prone to leukemia (O’Connor et al., 1989). Full elucidation of this phenomenon might possibly bring important insights into the mechanisms of leukemogenesis. Finally, it should be noted that several of the previously discussed molecules serve as receptors for viruses: CD4 (HIV), CD54 (rhinoviruses), CDBl(EBV), and CD4-TCR complex (MuLV) (O’Neill et al., 1987). The receptor for poliovirus is a broadly expressed 45-kDa glycoprotein belonging to the Ig superfamily (Mendelsohn et al., 1989).A brief review on virus receptors was published by White and Littman (1989). XI. Concluding Remarks
There are many more or less well-characterized leukocyte surface molecules that could not be discussed in this chapter because little or nothing is known about their functions. Among them are numerous antigens recognized by unique (unclustered) Mabs examined during the International Workshops on Human Leukocyte Differentiation Antigens (e.g., McMichael et al., 1986; Knapp et al., 1989a).A selection of such antigens, as well as several of the molecules briefly mentioned in the text, are shown in Table V; it is not possible to decide whether some of them are identical to other molecules described under different names. Most of the unique but incompletely characterized antigens identified during the Workshop studies are not included in this table. A comprehensive and detailed overview of the properties of all CD-antigens can be found in the Leucocyte Typing ZV book (Knapp et al., 1989a) and a brief version in the report on the 4th International Workshop (Knapp et al., 198913). A characteristic feature of many recent studies on leukocyte surface molecules is their accent on defining exactly the structures, mainly by means of sequencing the corresponding cDNAs (Table IV). However, very little is generally known about native supramolecular assemblies of leukocyte surface molecules; for example, it is not known whether even the most thoroughly studied molecules exist in native state as monomers or rather as some ordered, loosely-bound oligomeric structures or labile noncovalent complexes with other components. Current biochemical isolation procedures always expose these molecules to more or less harsh conditions potentially dissociating weakly associated molecules. Usually SDS PAGE is the only, obviously quite insufficient, source of information on subunit structure of the membrane protein under study. Development of methods yielding a more realistic picture of membrane molecules in their native environment is certainly a high priority because this information would greatly
TABLE V SOMEOTHERHUMAN LEUKOCYTE SURFACE ANTIGENS ~~
Name
Expression
Molecular mass (kDa)
CD6 (T12,ZHl) CDwl2 CD15
T cells, some B cells Myeloid cells Granulocytes
CD17 CD39 CD47
Granulocytes, thrombocytes B cells, monocytes Broadly expressed
80 47-52
CDw52 (Campath 1)
Broadly expressed
25-30
CDwGO
T cells
CD63 CDw65 CD66 CD68 (Ki-M6)
Thrornbocytes Granulocytes Granulocytes Macrophages
53
CD70 (Ki-24)
Activated lymphocytes, Stemberg-Reed cells B cells 43,39
?
CD72
120 90-100
Notes Phosphoprotein Several granulocyte glycolipids and glycoproteins carring the fucosyl-NAclactosamine determinant Lactosylceramide Rh-associated glycoprotein Heavily glycosylated; Mabs used for bone marrow purging Several T cell glycolipids and glycoproteins carrying the NeuAcNeuAc-Gal group A granulocyte glycolipid
180-200 110
Mostly intracellular antigen
References Swack et al. (1989) Knapp (1989) Bettelheim (1989)
Symington (1989) Dorken et al. (1989a) Hadam (1989a) Avent et al. (1988) Hale et al. (1983, 1989) Rieber (1989) Higgs et al. (1988) Metzelaar et al. (1989) Stockinger (1989a) Majdic (1989) Stockinger (1989~) Stein et a2. (1989) Dorken et al. (1989b)
TABLE V (Continued) ~
Name CDw75 (OKB4) CD76 CD77 CDw78 (Leu-21) sTA lODl
~~
Expression B cells, some T cells B cells, some T cells, granulocytes Activated B cells B cells Some activated T cells Small subpopulation of CD4'T cells
53? 85,67
D44
Lymphocytesubpopulations
28-30
Tpl33-145 H2 TH5.2 TP90 Tp45
Lymphocyte subpopulations Most T cells, some B cells T cells T cell subpopulation T cell subpopulation
135,145 80 55-60 90 45
IVF7 TALLA gP37 VIP-receptor L35
Tcells T-ALL T-leukemia, T-blasts T cells, some ALL Activated T cells, granulocytes Activated T cells
(38)~ 150 37
c-
L36
CB23
Thymocyteand T cell subpopulations
Notes
Dorken et al. (1989d) Dorken et al. (1989e)
Globoside 3
Dorken et al. (1989f) Dorken et al. (1989g) David et al. (1990) Kobata et al. (1990)
Induced on PHAactivated and HIVinfected T cells Expression delineates T, and T,?
Stricker et al. (1987a)
Possibly associated with TCR Does not modulate Does notmodulate
97 90 43
References
Probably sialytransferase
67? 110 902 18
PI8
'
Molecularmass (kDa)
Possibly human Qa/Tla homologue
Calvo et al. (1986) Isler et al. (1988) Grunewald et al. (1989) Thieme et al. (1987) Carrel et al. (1987a) Carrel et 01. (1987b) Janson et al. (1987) Seon et al. (1983) Seon et ol. (1986) Shannon et al. (1986) Maino and Janszen (1986) Maino and Janszen ( 1986) Funaro et al. (1989)
w
DBB.42 DNA.7 DND.53 BB-1
B cells Germinal center B cells Some B cells Activated B cells
45 43 20,35 70
A1.Bl B5 B-ly7
70 75 144
HC2 Bgp95
Some B cells Activated B cells Small subpopulations of B cells, hairy cell leukemia Activated B cells B cells, monocytes
BB2
B-blasts
76
BL2 BL3 MN-1 Bac-1 B7.2 g~70
B cells B cells B cells Activated B cells Activated B cells Burkitt's lymphoma
68 105 42 59 45-50 70
Ag104 DM-1 DM-2 KC- 1 NKH-2 A1-3 Ber-Mac3 MOFll
Activated B cells LAK-cell precursors LAK-cell precursors NK cells NK cell subpopulation Activated monocytes Monocytes Activated myeloid cells
45-60 38 44 145 60 52 140 210
GMP140
Neutrophils
140
70 80
Probably identical to B7 (see Table IV)
IFN-y-inducible Similar to CD39 but distinct Associated with DR?
Soluble form present in patients' sera
Mab blocks NK function
Linked to cytoskeleton
A1 Saati et al. (1989) A1 Saati et al. (1989) A1 Saati et al. (1989) Yokochi et al. (1982); Freeman et al. (1989) Serra et al. (1989) Freedman et al.(1985) Poppema et al. (1989) Posnett (1989) Valentine et al. (1988) Clark and Yokochi (1984) Wang et al. (1984) Wang et al. (1984) Link et al. (1986) Suzuki et al. (1985) Southern et al. (1987) Gazitt et al. (1986) Val16 et al. (1989) Morris and Pross (1989) Morris and Pross (1989) Clayberger et al. (1986) Hercend et al. (1985) Ewan et al. (1986) Backe et al. (1989) Vincendeau-Schemer et al. (1989) Suchard and Boyer (1989) (continued )
TABLE V (Continued) Name
K2
M
Expression
Molecular mass (kDa)
2.28
Activated monocytes
70
BH-C6
Neutrophils
157
Leu-M2 (Mac120)
Monocytes
120
uc-45
45
M06
Neurons and spreading monocytes Granulocytes Mature macrophages Myeloid cells Monocytes, platelets Granulocytes Basophils Cultured monocytes Myeloid, NK cells, some lymphocytes Myeloid cells
MY26
Granulocytes
18-20
MY901
NK cells, AML
65
MY906
AML
72
M206 MAC387
Monocytes Myeloid cells
180 72,56
GFA-2 25F9 SG133 MoU26 SG185 Bsp-1 12B1 CK226
Notes
Mab blocks adhesion to opsonized particles
References Sung and Walters (1989) Pytowski et al. (1988) Raff et al. (1980); SuomalainenNevanlinna et al. (1987) Hogg et al. (1981)
95 86 27 130 60 45 93 75,80
Involved in phagocytosis
80
Lost from cultured monocytes
Similar to 25F9
Lopez et al. (1985) Zwadlo et al. (1985) Goyert et al. (1986) Goyert et al. (1986) Goyert et al. (1986) Bodger et al. (1987) Farace et al. (1986) Poggi et al. (1989) Todd et al. (1984) Warren and Civin (1985) Griffin and Schlossman (1984) Griffin and Schlossman (1984) Maruyama et al. (1983) Jones et al. (1987)
I
MAX1
Macrophages
64
MAX3
Macrophages
68
LP3
Myeloid cells
( W 2
NHL-30.5 “24-antigen” 27E10 61D3 M21C5 Act1 ACT35
AML Monocytes, macrophages Myeloid cells Monocytes Activated lymphocytes Activated lymphocytes Activated lymphocytes
180 174 17 65 80-85 63 35
TU66
76
P60I63 Eal Ea2
Subpopulation of monocytes, activated lymphocytes Activated lymphocytes Activated lymphocytes Activated lymphocytes
Ea3
Activated lymphocytes
31
Leu-13
Broad
16
MD2.6
Lymphocyte subsets
75
L24 K 31
Broad Broad Thymocytes, lymphocytes
(1 4 0 ) ~
tQ
0
MW4
Molecular mass similar to growth hormone receptor
Strong on Sezary cells Lost after culture Late activation antigen Expression very similar to CD25
60m 78 86,73
180 60
Early activation antigen Associated with a 23-kDa component Mab blocks PHAinduced activation IFN-a and IFN-y inducible Disappears after activation Similar to PC-1 Absent from stem cells Mab inhibits antigeninduced proliferation
Emmrich and Andreesen (1985) Emmrich and Andreesen (1985) Partridge et al. (1987)
Askew et al.(1987) Dougherty et al. (1986) Zwadlo et al. (1986) Nunez et al. (1982) Omary et al. (1988) Lazarovits et al. (1984) Schwarting and Stein (1989) Ziegler et al. (1989) Kolecki et al. (1989) Newman et al. (1986) Newman et al. (1986) Newman et al. (1986) Jaffe et al. (1989) Koning et al. (1986) Clayberger et 01. (1987) Viehmann et al. (1989) Pugliese et al. (1987) (continued)
TABLE V (Continued) Name
Expression
Molecular mass (kDa)
Notes Possibly involved in T cell adhesion Possibly associated with membrane Ig Mab induces apoptosis Diagnostic marker of CLL
References Cardella et al. (1989)
TOR1
Broad
33
ARH-77
Broad
155
APO-1 cCLLa
Leukocyte cell lines CLL
52 69
SN6
Bone marrow, some leukemic cell lines Broad Hemopoietic progenitors Leukocyte subpopulations
(80)~
Haruta and Seon (1986)
45 115 34
Peters et al. (1984) Katz et al. (1986) Yagi et al. (1987) Pesando et al. (1986)
A-3A4 B.3.C.5 53.6 Many B cell and nonlineage antigens Several antigens of ALL and other leukocytes
Nonglycosylated
Samoszuk et al. (1989) Trauth et al. (1989) Faguet and Agee (1987)
Quackenbush and Letarte (1985)
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
125
improve our understanding of functions of these molecules. Systematic studies employing suitable cross-linking reagents, fluorescence energy-transfer experiments, and similar approaches should be potentially useful in this respect. It can be disturbing when a molecule is well characterized structurally but nothing is known about its function. In this common situation the effects of specific monoclonal antibodies on the antigencarrying cells are often considered as indicative of possible function. Numerous studies describe stimulatory effects of various Mabs upon T or B lymphocytes. However, it seems likely that these results in most cases may not reflect the true function of the antigen under study. According to these experiments nearly every T cell surface molecule would be a receptor transmitting a stimulatory signal, provided that a Mab against a suitable epitope is used. The extent of cross-linking of the surface molecules may also be important: antibodies against MHC gp I can either inhibit or potentiate T cell activation depending upon the degree of cross-linking (Gilliland et aZ., 1989).It can be speculated that proper cross-linking or microaggregation of essentially any leukocyte surface protein may in some unknown “nonspecific” ways induce the observed “activation” effects. This explanation seems to be likely, especially in the case of GPI-linked membrane glycoproteins. Suitable Mabs against essentially all tested molecules of this group were stimulatory and the activating effect was dependent on internalization of the cross-linked molecules (Bamezai et al., 1989).It is not clear how the GPI-linked proteins, without obvious means of linkage to the cell interior, can mediate any signal transduction, but perhaps their endocytosis is the “nonspecific” signal. Because of this possibility of false conclusions based on the experiments employing Mabs as indicators of possible signal transducing properties of leukocyte surface molecules, I have not stressed the functional properties of leukocyte surface molecules deduced from this kind of experiments. Finally, one might ask what is the ultimate goal in this area of molecular immunology? It is hoped that one day we will be able to say that all leukocyte surface molecules have been discovered, their structures, functions, and mutual relations elucidated. A review on this topic will then be probably much longer than the present one, even if it will only list all the surface molecules in tables. It seems likely that only a minor fraction of all leukocyte surface molecules have been described and that at least hundreds are yet to be discovered. Further progress no doubt will be hampered by several factors: many of the undiscovered molecules may be expressed at low densities and some of them may be poorly immunogenic, which will make it difficult to
126
V. HoREJSf
prepare corresponding Mabs that have been major tools in this field. At present there is no obvious way to guess how many of the leukocyte surface molecules are yet to be discovered. Two approaches are taken by the people working in this field: either a directed search for a specific receptor or other functional molecule, or a “shotgun” preparation of Mabs and describing novel antigens without previous knowledge of their functions. Although the latter method is often criticized as less scientific, it should be remembered that most of the CD-molecules were originally described as a result of this approach, and in many cases their functions were discovered independently several years later; sometimes a mere determination of primary structure of the apparently functionless molecule gave a clue to a possible function. An unanswered question is whether all leukocyte surface molecules are functional or whether some of them are “uninteresting,” redundant, and truly functionless. There is no doubt that full elucidation of structure and function of leukocyte surface molecules will bring further important consequences for theoretical understanding of immune system and leukocyte biology in general, as well as for diagnostic and therapeutic practice.
REFERENCES Agre, P., and Parker, J. C., eds. (1989).“Red Blood Cell Membranes: Structure, Function, Clinical Applications.” Dekker, New York. Ado. Zmmunol. 46,183. Ahearn, J. M., and Fearon, D. T. (1989). Akbar, A. N., Terry, T., Timms, A., Beverley, P. C. L., and Janossy, G. (1988). J . Zmmunol. 140,2171. Albrecht, D. L., and Noelle, R. J. (1988). J. Zmmunol. 141,3915. Allen, J. M., and Seed, B. (1989).Science 243,378. A1 Saati, T., Caspar, S., Brousset, P., Chittal, S., Caverivikre, P., Hounieu, H., Dastugue, N., Idoipe, J.-B., Icart, J., Mazerolles, C., and Delsol, C. (1989).Blood 74,2476. Ambrus, J. L., Jr., Juregensen, C. H., Brown, E. J., McFarland, P., and Fauci, A. S. (1988). J. Immunol. 141,861. Amiot, M., Dasot, H., Fabbi, M., Degos, L., Bernard, A., and Boumsell, L. (1988a). Zmmunogenetics 27,187. Amiot, M., Dasot, H., Degos, L. Dausset, J., Bernard, A., and Bournsell, L. (1988b). Proc. Natl. Acud. Sci. U.S.A. 85,4451. Anderson, P., Blue, M.-L., and Schlossman, S. F. (1988).J. Zrnmunol. 140,1732. Angelisovh, P., VIEek, c.,StefanovB, I., LipoldovB, M., and HoiejSi, V. (1990).Zmmunogenetics 32,281. Arakawa, F.,Kuroki, M., Misumi, Y., Oikawa, S., Nakazato, H., and Matsuoka, Y. (1990). Biochem. Biophys. Res. Comrnun. 166,1063. Arencibia, I., and Sundqvist, K . 4 . (1989).Eur. J . Zmmunol. 19,929. Argraves, W. S.,Suzuki, S., Arai, H., Thompson, K., Pierschbacher, M. D., and Ruoslahti, E.(1987).].Cell Biol. 105, 1183.
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
127
Argraves, W. S., Dickerson, K., Burgess, W. H., and Ruoslahti, E. (1989). Cell (Cambridge, Mass.) 58,623. Aruffo, A., and Seed, B. (1987a). Proc. Natl. Acad. Sci. U.S.A.84,8573. Aruffo, A., and Seed, B. (1987b).EMBOJ. 6,3313. Aruffo, A., and Seed, B. (1989).J. Zmmunol. 143,1723. Asakawa, K., Hedo, J. A., McElduff, A., Roniller, D. G., Waters, M. J., and Gorden, P. (1986). Biochem. J. 238,379. Ashman, L. K., Roberts, M. M., Gadd, S. J., Cooper, S. J., and Juttner, C. A. (1988).Leuk. Res. 12,923. Askew, D., Eaves, A. C., and Takei, F. (1987). I n “Leucocyte Typing 111. White Cell Differentiation Antigens” (A. J. McMichael et al., eds.), p. 315. Oxford Univ. Press, Oxford. Audette, M., Buchegger, F., Schreyer, M., and Mach, J.-P. (1987).Mol. Immunol. 24,55. Auget, M., Dembi5, Z., and Merlin, G. (1988).Cell (Cambridge,Mass.) 55,273. Avent, N. D., Judson, P. A., Parsons, S. F., Mallison, G., Anstee, D. J., Tanner, M. J., Evans, P. R., Hodges, E., Maciver, A. G., and Holmes, C. (1988).Biochem. J. 251,499. Backe, E., Schwarting, R., Gerdes, J., and Stein, H. (1989). Znt. Congr. lmmunol., 7th Abstr. No. 28-2. Ballard, L. L., Bora, N. S., Yu, G . H., and Atkinson, J. P. (1988).J.Zmmunol. 141,3923. Ballou, S. P., Buniel, J., and Macintyre, S. S. (1989).J.Zmmunol. 142,2708. Bamezai, A., Goldmacher, V., Reiser, H., and Rock, K. L. (1989).J.lmmunol. 143,3107. Baniyash, M., Garcia-Morales, P., Bonifacino, J. S., Samelson, L. E., and Klausner, R. D. (1988).J.Biol. Chem. 263,9874. Barber, E. K., Dasgupta, J. D., Schlossman, S . F., Trevillyan, J. M., and Rudd, C. E. (1989).Proc. Natl. Acad. Sci. U.S.A.86,3277. Barel, M., Fiandino, A., Lyamani, F., and Frade, R. (1989).Proc. Natl. Acad. Sci. U.S.A. 86,10054. Bazan, J. F. (1989). Biochem. Biophys. Res. Commun. 164,788. BaZil, V., Hilgert, I., KriStofova, H., Maurer, D., and HoiejSi, V. (1989a).Zmmunogenetics 29,202. Batil, V., BaudyS, M. Hilgert, I., $tefanovB, I., Low, M. G., Zbroiek, J., and HoiejSi, V. (1989b).Mol. Immunol. 26,657. Bennet, R. M., Hefeneider, S . F., Bakke, A., Merrit, M., Smith, C. A., Mourich, D., and Heinrich, M. C. (1988).J. lmmunol. 140,2937. Berendt, A. R., Simmons, D. L., Tansey, J., Newbold, C. I., and Marsh, K. (1989).Nature (London)341,57. Beretta, A., Grassi, F., Pelagi, M., Clivio, A,, Parravicini, C., Giovinazzo, G., Andronico, F., Lopalco, L., Verani, P., Butto, S., Titti, F., Rossi, G. B., Viale, G., Ginelli, E., and Siccardi, A. G . (1987). Eur.J.Zmmunol. 17,1793. Berg, E. L., Goldstein, L. A., Jutila, M. A., Nakache, M., Picker, L. J., Streeter, P. R., Wu, N. W., Zhou, D., and Butcher, E. C. (1989).Zmmunol. Reu. 108,5. Bergui, L., and Tesio, L., Schena, M., Riva, M., Malavasi, F., Schulz, T., Marchisio, P. C., and Caligaris-Cappio, F. (1988).I3ur.J.Zmmunol. 18,89. Bettelheim, P. (1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 798. Oxford Univ. Press, Oxford. Bevilacqua, M. P., Stengelin, S., Gimbrone, M. A., Jr., and Seed, B. (1989). Science 243, 1160. Bierer, B. E., Sleckman, B. P., Ratnofsky, S . E., and Burakoff, S. J. (1989). Annu. Rev. Zmmunol. 7,579.
128
V. HOREJSf
Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennet, W. S., Strominger, J. L., and Wiley, D. C. (1987).Nature (London) 327,506. Blue, M.-L., Craig, K. A., Anderson, P., Branton, K. R., Jr., and Schlossnian, S. F. (1988). Cell (Cambridge, Mass.) 54,413. Bodger, M. P., Mounsey, G. L., Nelson, J., and Fitzgerald, P. H. (1987).Blood 69,1414. Bomsztyk, K., Sims, J. E., Staunton, T. H., Slack, J., McMahan, C. J., Valentine, M. A., and Dower, S. K. (1989).Proc. Natl. Acad. Sci. U.S.A.86,8034. Bonnefoy, J. Y.,Guillot, O., Spits, H., Blanchard, D., Ishizaka, K., and Banchereau, J. (1988). J . E x p . Med. 167,57. Bourguignon, L. Y. W., Suchard, S. J., Nagpa, M. L., and Glenney, J. R., Jr. (1985).J. Cell B i d . 101,477. Brams, P., and Claesson, M. H. (1989).Immunology 66,348. Briata, P., Radka, S . F., Sartoris, S., and Lee, J. S. (1989). Proc. Natl. Acad. Sci. U.S.A.86, 1003. Brody, D. T., and Durum, S. K. (1989).].Zmmunol. 143, 1183. Bron, C., Rousseaux, M., Lisa, A.-L., and MacDonald, H. R. (1986).J. Zmmunol. 137,397. Brooks, D. G., Wei Qiao Qiu, Luster, A. D., and Ravetch, J. V. (1989).].E x p . Med. 170, 1369. Brown, J. H., Jardetzky, T., Saper, M. A., Samraoui, B., Bjorkman, P. J.. and Wiley, D. C. (1988).Nature (London)332,845. Brown, M. H.,Cantrell, D. A,, Brattsand, G., Crumpton, M. J., And Gullberg, M. (1989). Nature (London) 339,551. Bubien, J. K., Bell, P. D., Frizzell, R. A., and Tedder, T. F., (1989). I n “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Darken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 51.Oxford Univ. Press, Oxford. Buckley, M. F., and Coding, J. W. (1989).Int. Congr. Zmmunol., 7th Abstr. No. 27-2. Burg, D. L.,and Feldbush, T. L. (1989).J. Immunol. 142,381. Burlingham, W. J., Ceman, S. S., and DeMars, R. (1989).Proc. Natl. Acad. Sci. U.S.A.86, 8005. Burns, G. F., Triglia, T., Werkmeister, J. A., Begley, C. G., and Boyd, A. W. (1985).].Exp. Med. 161, 1063. Bushkin, Y.,Posnett, D. N., Pernis, B., and Wang, C. Y. (1986).].E x p . Med. 164,458. Buyon, J. P., Slade, S. C., Reibman, J., Abramson, S. B., Philips, M. R., Weissmann, G., and Winchester, R. (l990).]. Zmmunol. 144, 191. Calabi, F., and Milstein, C. (1986).Nature (London) 323,540. Calvo, C.-F., Bernard, A., Huet, S., Leroy, E., Boumsell, L., and Senik, A. (1986). ]. Immunol. 136, 1144. Cambier, J. C., and Lehmann, K. R. (1989)./.Exp. Med. 170,877. Cambier, J.C., and Ransom, J. T. (1987). Annu. Rev. Immunol. 5,175. Camerini, D., and Seed, B. (1989).In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 406. Oxford Univ. Press, Oxford. Camerini, D., James, S. P., Stamenkovic, I., and Seed, B. (1989).Nature (London)342, 78. Campbell, K. S., and Cambier, J. C. (1990).E M B O ] . 9,441. Campbell, R. D., Law, S. K. A., Reid, K. B. M., and Sim, R. B. (1988).Annu. Aeo. Immunol. 6, 161. Caras, I. W., Davitz, M. A., Rhee, L., Weddell, G., Martin, D. W., Jr., and Nussenzweig, V. (1987a). Nature (London)325,545.
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
129
Caras, I. W., Weddell, G. N., Davitz, M. A., Nussenzweig, V., and Martin, D. W., Jr. (1987b). Science 238, 1280. Cardella, C. J., Ng, C. M., Brady, H., and Klein, M. (1989). Transplant. Proc. 21, 1031. Carr, D. J. J., Kim, C.-H., de Costa, B., Jacobson, A. E., Rice, K. C., and Blalock, J. E. (1988).Cell. lmmunol. 116,44. Carrel, S.,Salvi, S.,Giuffre, L., Isler, P., and Cerottini, J.-C. (1987a).Eur.J. lmmunol. 17, 835. Carrel, S.,Isler, P., Salvi, S.,GiuffrP, L., Pantateo, G., Mach, J.-P., and Cerottini, J.-C. (1987b). Eur. J . lmmunol. 17, 1395. Carter, R. H., and Fearon, D. T. (1989).J.lmmunol. 143,1755. Chen, L.-K., Tourvieille, B., Burns, G. F., Bach, F. H., Mathieu-Mahul, D., Sasportes, M., and Bensussan, A. (1986). Eur.J.lmmunol. 16,767. Cherayil, B. J., Weiner, S.J., and Pillai, S. (1989).J . E x p . Med. 170, 1959. Cheresh, D. A., Smith, J. W., Cooper, H. M., and Quaranta, V. (1989). Cell (Cambridge, Mass.)57,59. Chitambar, C. R.,and Zivkovic, Z. (1989). Blood 74,602. Clark, E. A. (1989).In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 1054. Oxford Univ. Press, Oxford. Clark, E. A., and Yokochi, T. (1984).In “Leucocyte Typing” (A.Bernard, L. Boumsell, J. Dausset, C. Milstein, and S. F. Schlossman, eds.), p. 339. Springer-Verlag, Berlin. Clark, N. J., Gagnon, J., Williams, A. F. W., and Barclay, A. N. (1985). EMBOJ.4, 113. Classon, B. J., Williams, A. F. W., Willis, A. C., Seed, B., and Stamenkovic, I. (1989). J . E x p . Med. 169, 1497. Clayberger,C., Dyer, B., McIntyre, B., Koller,T. D., Hardy, B., Parham, P., Lanier, L. L., and Krensky, A. M. (1986).J.Immunol. 136,1537. Clayberger, C., Krensky, A. M., McIntyre, B. W., Koller, T. D., Parham, P., Brodsky, F., Linn, D. J., and Evans, E. L. (1987).J.Immunol. 138,1510. Clevers, H., Alarcon, B., Wileman, T., and Terhost, C. (1988).Annu. Reo. lmmunol. 6, 629. Cockcroft, S . , and Stutchfield, J. (1989). Bi0chem.J. 263,715. Coico, R. F., Berzofsky, J. A., York-Jolly, J., Ozaki, S.,Siskind, G. W., and Thorbecke, G. J. (1987).J.lmmunol. 138,4. Cooper, N. R.,Moore, M. D., and Nemerow, G. R. (1988).Annu. Rev. lmmunol. 6,85. Corbi, A. L., Miller, L. J., O’Connor, K., Larson, R. S.,and Springer, T. A. (1987).EMBO J . 6,4023. Corbi, A. L., Kishimoto, T. K., Miller, L. J., and Springer, T. A. (1988).]. Biol. Chem. 263, 12403. Cotner, T., Dasgupta, A., Papayannopoulou, T., and Stamatoyannopoulos, G . (1989). Blood 73,214. Coussens, L., Van Beveren, C., Smith, D., Chen, E., Mitchell, R. L., Isacke, C. M., Verma, C. M., and Ullrich, A. (1986). Nature (London)320,277. Crago, S. S.,Word, C. J., and Tomasi, T. B. (1989).J . lmmunol. 142,3909. Cunningham, B. A., Hemperly, J. J., Murray, B. A., Prediger, E. A., Backenbury, R.,and Edelman, G. M. (1987).Science 236,799. Curtis, B. M., Widmer, M. B., DeRoos, P., and Qwarnstrom, E. E. (1990).J . lmmunol. 144,1295. Czech, M. P. (1989). Cell (Cambridge, Mass.) 59,235. Czech, M. P., Klarlund, J. K., Yagaloff, K. A., Bradford, A. P., and Lewis, R. E. (1988). J . Biol. Chem. 263, 11017.
130
V. HOREJgf
Dairiki, K., Nakamura, S., Ikegami, S., Nakamura, M., Fujimori, T., Tamaoki, N., and Tada, N. (1989). Inmunogenetics 29,235. Dang, N. H., Hafler, D. A., Schlossman, S. F., and Breitmeyer, J . B. (1990). Cell. Inlmu1101. 125,42. David, V., Bachelez, H., Leca, G., Degos, L., Boumsell, L., and Bensussan, A. (1990). J. Immunol. 144, 1. Davies, A., Simmons, D. L., Hale, G., Harrison, R. A., Tighe, H., Lachmann, P. J.. and Waldmann, H. (1989).J . Exp. Med. 170,637. Davis, M. M., and Bjorkman, P. J. (1988). Nature (London) 334,395. Delcayre, A. X., Fiandino, A., Barel, M., and Frade, R. (1987). Eur.J. lmmunol. 17,1827. Delespese, G., Sarfati, M., and Hofstetter, H. (1989). lmmunol. Today 10, 159. Delia, D., Cattoretti, G., Polli, N., Fontanella, E., Aiella, A., Giardini, R., Rilke, F., and Dellaporta, G. (1988). Blood 72,241. Demuth, D. R., Showe, L. C., Ballantine, M., Palumbo, A., Fraser, P. J., Cioe, L., Rovera, G., and Curtis, P. J . (1986). EMBO J. 5, 1205. Denning, S. M., Dustin, M. L., Springer, T. A., Signer, K. H., and Haynes, B. F. (1988). J. Immunol. 141,2980. Dierich, M. P., Schulz, T. F., Eigentler, A,, Huemer, H., and Schwible, W. (1988). Mol. Immunol. 25, 1043. Dohlman, H. G., Caron, M. G., and Lefkovitz, R. J . (1987). Biochemistry 26,2656. Dorken, B., Moller, P., Pezzutto, A., Schwartz-Albiez. R., and Moldenhauer, G. (l989a). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von den1 Borne, eds.), p. 89. Oxford Univ. Press, Oxford. Dorken, B., Moller, P., Pezzutto, A., Schwartz-Albiez, R., and Moldenhauer, G . (l989b). In: Leucocyte Typing IV. White Cell Differentiation Antigens (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 99. Oxford University Press, Oxford. Dorken, B., Moller, P., Pezzutto, A., Schwartz-Albiez, R., and Moldenhauer, G. (1989~). In: Leucocyte Typing IV. White Cell Differentiation Antigens (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 102. Oxford University Press, Oxford. Dorken, B., Moller, P., Pezzutto, A., Schwartz-Albiez, R., and Moldenhauer, G. (1989d). In: Leucocyte Typing IV. White Cell Differentiation Antigens (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 109. Oxford University Press, Oxford. Dorken, B., Moller, P., Pezzutto, A,, Schwartz-Albiez, R., and Moldenhauer, G. (1989e). In: Leucocyte Typing IV. White Cell Differentiation Antigens (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 115, Oxford University Press, Oxford. Dorken, B., Moller, P., Pezzutto, A,, Schwartz-Albiez, R., and Moldenhauer, G. (1989f). In: Leucocyte Typing IV. White Cell Differentiation Antigens (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von den1 Borne, eds.), p. 118, Oxford University Press, Oxford. Dorken, B., Moller, P., Pezzutto, A., Schwartz-Albiez, R., and Moldenhauer, G . (1989g). In: Leucocyte Typing IV. White Cell Differentiation Antigens (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 122, Oxford University Press, Oxford. Dorken, B., Moller, P., Pezzutto, A,, Schwartz-Albiez, R., and Moldenhauer, G. (1989h). In: Leucocyte Typing IV. White Cell Differentiation Antigens (W. Knapp, B. Dorken,
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
131
W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G . Kr. von dem Borne, eds.), p. 128, Oxford University Press, Oxford. Dougherty, G . J., Allen, C., Selvendran, Y., and Hogg, N. (1986). Znt. Congr. Zmmunol., 6th Abstr. No. 2.44.2. Doyle, C., and Strominger, J. L. (1987). Nature (London)330,256. Dusenbery, K. E., Mendiola, J. R., and Skubitz, K. M. (1988). Biochem. Biophys. Res. Commun. 153,7. Dustin, M. L., and Springer, T. A. (1989).Nature (London)341,619. Dustin, M. L., Selvaraj, P., Mattalino, R. J., and Springer, T. A. (1987).Nature (London) 329,846. Edidin, M. (1988).Immunol. Today 9,218. Elices, M. J., and Hemler, M. E. (1989). Proc. Natl. Acad. Sci. U.S.A.86,9906. Emmrich, F., and Andreesen, R. (1985). Zmmunol. Lett. 9,321. Engelmann, H., Novick, D., and Wallach, D. (199O).J.Biol. Chem. 265, 1531. Ewan, V. A., Cieplinski, W., Hancock, W. H., Goldschneider, I., Boyd, A. W., and Rickles, F. R. (1986).J . Zmmunol. 136,2408. Faguet, G. B., and Agee, J. F. (1987).Blood 70,437. Farace, F., Kieffer, N., Caillou, B., Vainchenker, W., Tursz, T., and Dokhelar, M. C. (1986).Eur. J . Zmmunol. 16, 1521. Feltner, D. E., Smith, R. H., and Marasco, W. A. (1986).J.Zmmunol. 137, 1961. Fernandez-Botran, R., Uhr, J. W., and Vitetta, E. S. (1989).Proc. Natl. Acad. Sci. U.S.A. 86,4235. Ferrero, E., and Goyert, S. M. (1988). Nucleic Acids Res. 16,4173. Ferris, D. K., Willette-Brown, J., Ortaldo, J. R., and Farrar, W. L. (1989)J. Zmmunol. 143, 870. Filippini, A., Taffs, R. E., Agui, T., and Sitkovsky, M. V. (199O).J.Biol. Chem. 265,334. Fischer, T., Thoma, B., Scheurich, P., and Pfizenmaier, K. (1990).J . Biol. Chem. 265, 1710. Fitzgerald, L. A., Poncz, M., Steiner, B., Rall, S. C., Jr., Bennett, J. S., and Phillips, D. R. (1987a). Biochemistry 26,8158. Fitzgerald, L. A., Steiner, B., Rall, S. C., Jr., Shan-shan Lo, and Phillips, D. R. (l987b). J . Biol. Chem. 262,3936. Fleischer, B., Schendel, D. J., and von Steldern, D. (1986). Eur.J. Zmmunol. 16,741. Foon, K. A., Neubauer, R. H., Wickstrand, C. J., Schroff, R. W., Rabin, H., and Seeger, R. C. (1984)../. Immunogenet. 11,233. Fox, D. A,, Hussey, R. E., Fitzgerald, O., Acuto, O., Poole, C., Palley, L., Daley, J. F., Schlossman, S. F., and Reinherz, E. L. (1984)../.Zmmunol. 133, 1250. Fraser, J. D., Goldsmith, M. A., and Weiss, A. (1989). Proc. Natl. Acad. Sci. U.S.A.86, 7133. Freed, E., Gailit, J., van der Geer, P., Ruoslahti, E., and Hunter, T. (1989). Cell (Cambridge, Mass.)8,2955. Freedman, A. S., Boyd, A. W., Anderson, K. C., Fisher, D. C., Schlossman, S. F., and Nadler, L. M. (1985).]. Zmmunol. 134,2228. Freeman, G .J., Freedman, A. S., Lee, G., Segil, J., Whitman, J., and Nadler, L. M. (1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G . Kr. von dem Borne, eds.), p. 141. Oxford Univ. Press, Oxford. Fuchs, B. A., Albright, J. W., and Albright, J. F. (1988). Cell Immunol. 114,231. Fujita, T., Inoue, T., Ogawa, K., Iida, K., and Tamura, N. (1987).J.E x p . Med. 166,1221. Funaro, A., Baricordi, R., Zaccolo, M., Roggero, S., Geuna, M., Peruzzi, L., and Malavasi,
132
v. HOREJS~
F. (1989).In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 373. Oxford Univ. Press, Oxford. Gadd, S. J., Majdic, O., Maurer, D., Eher, R., and Knapp, W. (1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr, von dem Borne, eds.), p. 946. Oxford Univ. Press, Oxford. Gallis, B., Prickett, K. S., Jackson, J., Slack, J., Schooley, K., Sims, J. E., and Dower, S. K. (1989).Nature (London)342,692. Garrett, T. P. J., Saper, M. A., Bjorkman, P. J., Strominger, J. L., and Wiley, D. C. (1989). Nature (London)342,692. Gazitt, Y., Lerner, A., and Benbassat, H. (1986).Zmmunol. Lett. 12,43. Gearing, D. P., King, J. A., Cough, N. M., and Nicola, N. A. (1989).E M B O J . 8,3667. Geisler, C., Kuhlmann, J., and Rubin, B. (1989).J.Zmmunol. 143,4069. Gelin, C., Aubrit, F., Phalipon, A., Raynal, B., Cole, S., Kaczorek, M., and Bernard, A. (1989). E M B O J . 8,3253. Gerard, N. P., Hodges, M. K.. Drazen, J. M., Weller, P. F., and Gerard, C. (1989).J.B i d . Chem. 264,1760. Ghebrehiwet, B. (1987). In “Methods in Enzymology” (G. Di Sabato, ed.), Vol. 150, p. 558. Academic Press, San Diego, California. Giblin, P., Ledbetter, J . A., and Kavathas, P. (1989).Proc. Natl. Acad. Sci. U.S.A.86,998. Gierschik, P., Sidiropoulos, D., and Jakobs, K. H. (1989).]. Biol. Chem. 264,21470. Gilbert, C. W., Zaroukian, M. H., and Esselman, W. J. (1988).J. Zmmunol. 140,2821. Gilliland, L. K., Norris, N. A., Grosmaire, L. S., Ferrone, S., Gladstone, P., and Ledbetter, J. A. (1989).Hum. Zmmunol. 25,269. Gold, D. P., Puck, J. M., Pettey, C. L., Cho, M., Coligan, J., Woody, J. N., and Terhorst, C. (1986). Nature (London)321,431. Goldstein, L. A., Zhou, D. F. H., Picker, L. J., Minty, C. N., Bargatze, R. F., Ding, J. F., and Butcher, E. C. (1989).Cell (Cambridge, Mass.) 56, 1063. Goodnow, C. C., Crosbie, J., Adelstein, S., Lavoie, T. B., Smith-Gill, S. J . , Brink, R. A., Pritchard-Briscoe, H., Wotherspoon, J. S., Loblay, R. H., Raphael, K., Trent, R. J., and Basten, A. (1988).Nature (London) 334,676. Goodnow, C. G., Crosbie, J., Jorgensen, H., Brink, R. A., and Basten, A. (1989).Nature (London) 342,385. Gordon, J., Floresromo, L., Cairns, J. A., Millsum, M. J., Lane, P. J., Johnson, G. D., and Maclennan, I. C. M. (1989).lmmunol. Today 10,153. Gottesman, M., and Pastan, I. (1988).J . Biol. Chem. 263, 12163. Gougos, A., and Letarte, M. (1988).J . Zmmunol. 141, 1934. Gougos, A., and Letarte, M. (1989). Znt. Congr. Zmmunol. 7th Abstr. No. 34-9. Goyert, S. M., Ferrero, E. M., Seremetis, S. V., Winchester, R. J., Silver, J., and Mattison, A. C. (1986).J . Zmmunol. 137,3909. Goyert, S. M., Ferrero, E. M., Rettig, W. J., Yenamandra, A. K., Obata, F., and LeBeau, M. M. (1988). Science 239,497. Green, S. J., Tarone, G., and Underhill, C. B. (1988).E x p . Cell Res. 178,224. Gresham, H. D., Goodwin, J. L., Allen, P. M., Anderson, D. C., and Brown, E. J . (1989). J . Cell Biol. 108, 1935. Greve, J. M., Davis, G., Meyer, A. M., Forte, C. P., Yost, S. C., Marlor, C. W., Kaniarack, M. E., and McClelland, A. (1989). Cell (Cambridge,Mass.) 56,839. Griffin, J . D., and Schlossman, S. F. (1984). In “Leucocyte Typing” (A. Bernard, L. Boumsell, J. Dausset, C. Milstein, and S. F. Schlossman, eds.), p. 404. Springer-Verlag, Berlin.
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
133
Groux, H., Huet, S., Valentin, H., Pham, D., and Bernard, A. (1989a). Nature (London) 339, 152. Groux, H., Huet, S., Aubrit, F., Tran, H. C., Boumsell, L., and Bernard, A. (1989b). J . Zmmunol. 142,3013. Grunewald, J., Janson, C. H., Tehrani, M. J., Porwit, A., Matsuo, Y., Mellstedt, H., and Wigzell, H. (1989). Scand. J . Zmmunol. 30,573. Guy, R., Ullrich, S. J.. Foo-Philips, M., Hathcock, K. S., Appella, E., and Hodes, R. J. (1989). Science 244, 1477. Hadam, M. (1989a).In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 658. Oxford Univ. Press, Oxford. Hadam, M. (1989b). In “Leukcocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dern Borne, eds.), p. 661. Oxford Univ. Press, Oxford. Hadam, M. (19894.In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 667. Oxford Univ. Press, Oxford. Hale, G., Bright, S., Chumbley, G., Hoang, T., Metcalf, D., Munro, A. J., and Waldmann, H. (1983). Blood 62,873. Hale, G., Xia, M., and Waldmann, H. (1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G . Kr. von dem Borne, eds.), p. 673. Oxford Univ. Press, Oxford. Hamilton, T. A., and Adams, D. 0, (1987).Zmmunol. Today 8,151. Hanks, S. K., Quinn, A. M., and Hunter, T. (1988). Science 241,42. Hansch, G . M., and Weller, P. F., and Nicolson-Weller, A. (1988). Blood 72, 1089. Hansen, H., Lemke, H., Konnecke, I., and Havsteen, B. (1989). Znt. Congr. Zmmunol., 7th, Abstr. No. 101-10. Hansen, T., Stagsted, J., Pedersen, L., Roth, R. A., Goldstein, A., and Olsson, L. (1989). Proc. Natl. Acad. Sci. U.S.A. 86,3123. Harada, N., Castle, B. E., Gorman, D. M., Itoh, N., Schreurs, J., Barrett, R. L., Howard, M., and Miyajima, A. (1990). Proc. Natl. Acud. Sci. U.S.A. 87,857. Harnett, M. M., Holman, M. J., and Klaus, G . G . B. (1989). Eur.J.Zmmunol. 19,1933. Harris, D. T., Evans, B., Friedmann, L., and Koren, H. S. (1987).J . Leukocyte Biol. 42, 368.
Harris, D. T., Jaso-Friedmann, L., Devlin, R. B., Koren, H. S., and Evans, D. L. (1989). J . lmmunol. 143,727. Haruta, Y., and Seon, B. K. (1986).Proc. Natl. Acad. Sci. U.S.A.83,7898. Harwood, A. E., Habib, T. J., Peruski, L. F., and Nairn, R. (1989).Znt. Congr. Zmmunol., 7th Abstr. No. 73-12. Hassan, J., Feighery, C., Bresnihan, B., and Whelan, A. (1987).Tissue Antigens 30,167. Hatakeyama, M., Tsudo, M., Minamoto, S., Kono, T., Doi, T., Miyata, T., Miyasaka, M., and Taniguchi, T. (1989). Science 244,551. Haynes, B. F., Telen, M. J,, Hale, C. P., and Denning, S. M. (1989).Zmmunol. Today 10, 423. Haziot, A., Chen, S., Ferrero, E., Low, M. G., Silber, R., and Goyert, S. M. (1988). J . Zmmunol. 141,547. Hemler, M. E. (1988). Zmmunol. Today 9,109. Hemler, M. E., Huang, C., and Schwarz, L. (1987).J. Biol. Chem. 262,3300. Hemler, M. E., Crouse, C., and Sonnenberg, A. (1989).J . Biol. Chem. 264,6529. Hemmerich, S., and Pecht, I. (1988). Biochemistry 27,7488.
134
*
V. HOREJSf
Hercend, T., Griffin, J. D., Bensussan, A., Schmidt, R. E., Edson, M. A., Brennan, A., Murray, C., Daley, J. F., Schlossman, S. F., and Ritz, J. (1985).J.Clin. lnoest. 75,932. Herrmann, T., and Diamantstein, T. (1988).Mol. Zmmunol. 25, 1201. Herrmann, T., Josimovic-Alasevic, O., Mouzaki, A., and Diamantstein, T. (1989). lmmunology 66,384. Hibbs, M. L., Selvaraj, P., Carpen, O., Springer, T. A., Kuster, H., Jouvin, H.-H. E., and Kinet, J.-P. (1989).Science 246, 1608. Hickey, M. J., Williams, S . A., and Roth, G. J. (1989). Proc. Nut/. Acud. Sci. U.S.A. 86, 6773. Higgs, J. B., Zeldes, W., Kozarsky, K., Schteingart, M., Kan, L., Bohlke, P., Krieger, K., Davis, W., and Fox, D. A. (1988).j.lmmunol. 140,3758. Hochstenbach, F., and Brenner, M. B. (1989). Nature (London)340,562. Hogg, N., Slusarenko, M., Cohen, J . , and Reiser, J. (1981).Cell (Cambridge, Mass.) 24, 875. Hogg, N., Takacs, L., Palmer, D. G., Selvendran, Y., and Allen, C. (1986). Eur. J. lmmunol. 16,240. Holmes, N. (1989).ltnmunol. Today 10,52. Holzmann, B., and Weissman, I. L. (1989). E M B O J . 8, 1735. Hombach, J., Tsubata, T., Leclercq, L., Stappert, H., and Reth, M. (1990).Nature (London) 343,760. HoiejSi, V., and Baiil, V. (1988). Biod1em.J.253, 1. Hourcade, D., Miesner, D. R., Atkinson, J. P., and Holers, V. M. (1988).J.E x p . Med. 168, 1255. Hubbard, R. A., Spiedel, M. T., Marchalonis, J. J., andcone, R. E. (1989). Mol. lmmunol. 26,447. Huebers, H. A., and Finch, C. A. (1987). Physiol. Reo. 67,520. Huebers, H. A,, Beguin, Y., Pootrakul, P., Einspahr, D., and Finch, C. A. (1990).Blood 75, 102. Huizinga, T. W. J., van der Schoot, C. E., Jost, C., Klaasen, R., Kleijer, M., von den) Borne, A. E. G . Kr., Roos, D., and Tetteroo, P. A. T. (1988).Nature (London) 333, 667. Huizinga, T. W. J., Kerst, M., Nuyens, J. H., Vlug, A., von dem Borne, A. E. G. Kr., Roos, D., and Tetteroo, P. A. T. (1989).J.Immutrol. 142,2365. Hiinig, T., Tiefenhalter, G . , Meyer zum Buschenfelde, K.-M., and Meuer, S. C. (1987). Nature (London)326,298. Hunter, T. (1989). Cell (Cambridge, Mass.) 58, 1013. Hurme, M. (1987).J.lmmunol. 139, 1168. Hynes, R. 0. (1987). Cell (Cambridge, Mass.) 48,549. Iacopetta, B. J., Rothenberger, S., and Kuhn, L. C. (1988). Cell (Cumbridge, Mass.) 54, 485. Isakov, N., Mally, M. I., Scholz, W., and Altman, A. (1987).ltnmunol. Reu. 95,89. Isler, P., Salvi, S., Rapin, C., GiuffrC, L., Cerottini, J.-C., and Carrel, S. (1988).Eur. J. Immunol. 18, 1491. Itoh, N., Yonehara, S., Schreurs, J., Gornian, D. M., Maruyama, K., Ishii, A., Yahara, I., Arai, K., and Miyajima, A. (1990). Science 247,324. Jack, R. M., Ezzell, R. M., Hartwig, J., and Fearon, D. T. (1986).J.Immunol. 137,3996. Jacob, L., Viard, J.-P., Allenet, B., Anin, M.-F., Slania, F. B. H., Vandekerckhove, J., Primo, J., Markovits, J., Jacob, F., Bach, J.-F., LePecq, J.-B., and Louvard, D. (1989). Proc. Natl. Acad. Sci. U.S.A.86,4669. Jaffe, E. A., Armellino, D., Lam, G., Cordon-Cardo, C., Murray, H. W., and Evans, R. L. (1989).J.Zrnmutiol. 143,3961.
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
135
Jalkanen, S., and Jalkanen, M. (1989).Znt. Congr. Zmmunol., 7th, Abstr. No. 54-20. Janson, C. H., Tehrani, J., Mellstedt, H., and Wigzell, H. (1987). Scand.]. Immunol. 26, 237. Jin, B., Scott, J. L., Vadas, M. A., and Burns, G. F. (1989).Immunology 66,570. Johnston, G . I., Cook, R. G., and McEver, R. P. (1989). Cell (Cambridge, Mass.) 56, 1033. Jones, B. (1897). Immunol. Rev. 99,5. Jones, D. B., Flavell, D. J., and Wright, D. H. (1987). In “Leucocyte Typing 111. White Cell Differentiation Antigens” (A. J. McMichael et al., eds.), p. 692. Oxford Univ. Press, Oxford. Jones, N. H., Clabby, M. L., Dialynas, D. P., Huang, H.-J. S., Herzenberg, L. A., and Strorninger, J. L. (1986).Nature (London)323,346. Jonsson, J.-I., Boyce, N. W., and Eichrnann, K. (1989). Eur. J. Zmmunol. 19,253. Josirnovic-Alasevic, O., Diirkop, H., Schwarting, R., Backe, E., Stein, H., and Diarnantstein, T. (1989). Eur.J. Zmmunol. 19, 157. Jung, L. K. L., and Fu, S. M. (1984).]. E x p . Med. 160,1919. Jung, L. K. L., and Fu, S. M. (1989).J. Immunol. Methods 116,137. Juranka, P. F., Zastawny, R. L., and Ling, V. (1989). FASEBJ. 3,2583. Kajiji, S . , Tamura, R. N., and Quaranta, V. (1989).EMBOJ. 8,673. Karnio, M., Uchiyarna, T., Hori, T., Kodaka, T., Ishikawa, T., Onishi, R., Uchino, H., Yoneda, N., Tatsumi, E., and Yarnaguchi, N. (1990).Blood 75,415. Karnrner, G. M., Walter, E. I., and Medof, M. E. (1988).J. Immunol. 141,2924. Kaplan, D. R., Bergrnann, C. A., Gould, D., and Landrneier, B. (1988).J. Immunol. 140, 819. Kappes, D., and Strorninger, J. L. (1988).Annu. Reu. Biochem. 57,991. Katz, F. E., Tindle, R. W., Sutherland, R., and Greaves, M. F. (1986). I n “Leucocyte Typing 11” (E. L. Reinherz, B. F. Haynes, L. M. Nadler, and I. D. Bernstein, eds.), Vol. 3, p. 305. Springer-Verlag, New York. Kay, J . E., and Benzie, C. R. (1986). Zmrnunol. Lett. 12,55. Keizer, G . D., Te Velde, A. A., Schwarting, R., Figdor, C. G., and de Vries, J. E. (1987). Eur. J. Immunol. 17, 1317. Kikutani, H., Inui, S., Sato, R., Barsurnian, E. L., Owaki, H., Yarnasaki, K., Kaisho, T., Uchibayashi, N., Hardy, R. R., Hirano, T., Tsunasawa, T., Sakiyarna, F., Swemura, M., and Kishirnoto, T. (1986). Cell (Cambridge,Mass.)47,657. Kim, I. C. (1989).J. Biol. Chern. 264,9780. Kinet, J.-P. (1989). Cell (Cambridge,Mass.) 57,351. Kinet, J.-P., Metzger, H., Hakimi, J., and Kochan, J. (1987). Biochemistry 26,4605. Kinet, J.-P., Blank, U., Ra, C., White, K., Metzger, H., and Kochan, J. (1988).Proc. Natl. Acad. Sci. U.S.A.85,6483. King, C. H., Goralnik, C. H., Kleinhenz, P. J., Marino, J. A., Sedor, J. R., and Mahrnoud, A. A. F. (1987).]. Clin. Znuest. 79, 1091. Kinoshita, T., Rosenfeld, S. I., and Nussenzweig, V. (1987).]. Zmmunol. 138,2994. Kipps, T. J. (1989).Adu. Immunol. 47, 117. Kirchhofer, D., Languino, L. R., Ruoslahti, E., and Pierschbacher, M. D. (199O).J.Biol. Chem. 265,706. Kishi, H., Scott, B., Borgulya, P., Karjalainen, K., and von Boehmer, H. (1989). Int. Congr. Zmmunol., 7th Abstr. No. 46-15. Kishirnoto, T. K., O’Connor, K., Lee, A,, Roberts, T. M., and Springer, T. A. (1987a).Cell (Cambridge, Muss.) 48,681. Kishirnoto, T. K., Hollander, T., Roberts, T. M., Anderson, D. C., and Springer, T. A. (1987b). Cell (Cambridge, Mass.) 50, 193.
136
V. HOREJSf
Kishirnoto, T. K., Larson, R. S., Corbi, A. L., Dustin, M. L., Staunton, D. E., and Springer, T. A. (1989). Ado. Immunol. 46, 149. Kittur, D., Shirnizu, Y., DeMars, R.,and Edidin, M. (1987).Proc. Notl. Acad. Sci. U.S.A. 84,1351. Klickstein, L., B., Wong, W. W., Smith, J. A., Weis, J. H., Wilson, J. G., and Fearon, D. T. (1987).J . E x p . Med. 165, 1095. Klickstein, L. B., Bartow, T. J., Miletic, V., Rabson, L. D., Smith, J. A., and Fearon, D. T. (1988).]. E x p . Med. 168, 1699. Knapp, W. (1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R.Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dern Borne, eds.), p. 781. Oxford Univ. Press, Oxford. Knapp, W., Dorken, B., Gilks, W. R.,Rieber, E. P., Schmidt,R. E., Stein, H.,andvondein Borne, A. E. G. Kr., eds. (1989a). “Leucocyte Typing IV. White Cell Differentiation Antigens.” Oxford Univ. Press, Oxford. Knapp, W., Rieber, P., Dorken, B., Schmidt, R.E., Stein, H., and von dem Borne, A. E. G. Kr. (1989b).Immunol. Today 10,253. Kobata, T., Yagita, H., Matsuda, H., Tansyo, S., Yakura, H., Katagiri, M., and Okumura, K. (1990).]. Immunol. 144,830. Kobayashi, K., Blaser, M. J., and Brown, W. R. (1989).J.Immunol. 143,2567. Kobilka, B. K., Matsui, H., Kobilka, T. S., Yang-Feng, T. L., Francke, U., Caron, M. G., Lefkovitz, R. J., and Regan, J. (1987). Science 238,650. Kodarna, T., Freeman, M., Rohrer, L., Zabrecky, J., Matsudaira, P., and Krieger, M. (1990). Nature (London)343,531. Kojirna, N., and Hakornori, S.-I. (1989).J . Biol. Chem. 264,20159. Kolecki, P., Volk, H.-D., Herrmann, T., and Diamantstein, T. (1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dern Borne, eds.), p. 509. Oxford Univ. Press, Oxford. Kornada, Y., Peiper, S., Tarnowski, B., Melvin, S., Karniya, H., and Sakurai, M. (1986). Leuk. Res. 10,665. Koning, F., Bakker, A., Dubelaar, M., Lesslauer, W., Mullink, R.,Schuits, R., Ligthart, G., Naipal, A,, and Bruning, H. (1986).Hum. Immunol. 17,325. Koo, C. H., Healy, A., and Goetzl, K. J. (1988). FASEBJ. 2,2160 (Abstr. No. A668). Kozbor, D., Moretta, A., Messner, H. A., Moretta, L., and Croce, C. M. (1987).J.Immunol. 138,4128. Kriegler, K., Perez, C., DeFay, K., Albert, I., and Lu, S. D. (1988). Cell (Cambridge, Mass.)53,45. Krissansen, G. W., Owen, M. J., Verbi, W., and Crurnpton, M. J. (1986).EMBOJ. 5,1799. Krissansen, G. W., Elliot, M. J., Lucas, C. M., Stomski, C., Berndt, M. C., Cheresh, D. A., Lopez, A. F., and Burns, G. F. (19W).J . Biol. Chem. 265,823. Kiihnernund, V., and Jungalwala, F. B., Fischer, G., Chou, D. K. H., Keilhauer, G., and Schachner, M. (1988).J.Cell Biol. 106,213. Kurnar, A., Moreau, J.-L., Bardn, D., and Theze, J. (1987).J.Immunol. 138, 1485. Kupfer, A., and Singer, S. J. (1989).J.E x p . Med. 170, 1697. Kurt-Jones, E. A., Virgin, H. W., and Unanue, E. R. (1985).J.Immunol. 135,3652. Kwok, W. W., Schwarz, D., Neporn, B. D., Hock, R.A., Thurtle, P. S., and Nepom, G. T. (1988).J.Immunol. 141,3123. Lacey, S. W., Sanders, J. M., Rothberg, K. G., Anderson, R. G . W., and Kamen, B. A. (1989).J . Clin. Invest. 84,715. Lam, S. C.-T., Plow, E. F., D’Souza, S. E., Cheresh, D. A., Frelinger, A. L., 111, and Ginsberg, M. H. (1989).J.Biol.Chem. 264,3742.
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
137
Lanier, L. L., Testi, R., Bindl, J,, and Phillips, J. H. (1989a).J. Erp. Med. 169,2233. Lanier, L. L., Yu, G., and Phillips, J. H. (1989b).Nature (London) 342,803. Larsen, E., Celi, A., Gilbert, G. E., Furie, B. C., Erban, J. K., Bonfanti, R., Wagner, D. D., and Furie, B. (1989). Cell (Cambridge, Mass.) 59,305. Laszlo, G., and Dickler, H. B. (1988).J.Zmmunol. 141,3416. Law, S. K. A., Gagnon, J., Hildreth, J. E. K., Wells, C. E., Willis, A. C., and Wong, A. J. (1987). EMBOJ. 6,915. Lazarovits, A. I., Moscicky, R. A,, Kurnick, J. T., Camerini, D., Bhan, A. K., Baird, L. G., Erikson, M., and Colvin, R. B. (1984).J.Zmmunol. 133, 1857. Le, P., Denning, S., Springer, T., Haynes, B., and Singer, K. (1987). Fed. Proc. 46,447 (Abstr. No. 761). LeBien, T. W., and McCormack, R. T. (1989). Blood 73,625. Ledbetter, J. A., Tonks, N. K., Fischer, E. H., and Clark, E. A. (1988). Proc. Natl. Acad. Sci. U.S.A. 85,8628. Lederman, S., Yellin, M. J., Cleary, A. M., Gulick, R., and Chess, L. (1990).]. Immunol. 144,214. Lee, B.-W., Simmons, C. F., Jr., Wileman, T., and Geha, R. S. (1989).J.Zmmunol. 142, 1614. Leonard, W. J., Depper, J. M., Kronke, M., Robb, R. J., Waldmann, T. A., and Greene, W. C. (1985).J.Biol. Chem. 260,1872. Letarte, M., Vera, S., Tran, R., Addis, J. B. L., Onizuka, R. J., Quackenbush, E. J., Jongeneel, C. V., and McInnes, R. R. (1988).J.E x p . Med. 168,1247. Leung, D. W., Spencer, S. A., Cachianes, G., Hammonds, R. G., Collins, C., Henzel, W. J., Barnard, R., Waters, M. J., and Wood, W. I. (1987).Nature (London)330,537. Levesque, J.-P., Hatzfeld, J., and Hatzfeld, A. (1990).J . Biol. Chem. 265,328. Lew, A. M., Lillehoj, E. P., Cowan, E. P., Maloy, W. L., van Schravendijk, M. R., and Coligan, J. E. (1986). Zmmunology 57,3. Ley, S. C., Tan, K.-N., Kubo, T., Sy, M.-S., and Terhorst, C. (1989).Eur.J.Zmmunol. 19, 2309. Lindsten, T., June, C. H., Ledbetter, J. A., Stella, G., and Thompson, C. B. (1989). Science 244,339. Link, M. P., Bindl, J., Mecker, T. C., Carswell, C., Doss, C. A., Warnke, R. A., and Levy, R. (1986).J . Zmmunol. 137,3013. Liu, D. Y., Ree, J. Y.,Trochelman, R. D., and Todd, R. F., I11 (1989).Eur.J.Zmmunol. 19, 721. Lo, S. K., Van Seventer, G. A., Levin, S. M., and Wright, S. D. (1989).J.Zmmunol. 143, 3325. Look, A. T., Ashmun, R. A,, Shapiro, L. H., and Peiper, S. C. (1989).J.Clin. Inoest. 83, 1299. L6pez, A. F., Begley, G . , Andrews, P., Butterworth, A. E., and Vadas, M. A. (1985). J . Zmmunol. 134,3969. Lopez, J. A., Chung, D. W., Fujikawa, K., Hagen, F. S., Davie, E. W., and Roth, G. J. (1988). Proc. Natl. Acad. Sci. U.S.A. 85,2135. Low, M. G., and Kincade, P. W. (1985). Nature (London)318,62. Lowe, J., Brown, B., Hardie, D., Richardson, P., and King, N. (1989). Zmmunol. Lett. 20, 103. Lublin, D. M., and Atkinson, J. P. (1989).Annu. Reo. Zmmunol. 7,35. Lublin, D. M., Liszewski, M. K., Post, T. W., Arce, M. A., LeBeau, M. M., Rebentisch, M. B., Lemons, R. S., Seya, T., and Atkinson, J. P. (1988).J.Erp. Med. 168, 181. Lucas, M. G., Green, A. M., and Telen, M. J. (1989). Blood 73,596. Luettig, B., Decker, T., and Lohmann-Matthes, M.-L. (1989).J . Immunol. 143,4034.
138
v. HOREJS~
Mackay, C. R., Maddox, J. F., and Brandon, M. R. (1988). Eur.J. lmmunol. 18, 1681. Mackay, C. R., Beya, M.-F., and Matzinger, P. (1989).Eur. J. lmmunol. 19, 1477. Maddon, P. J., Littman, D. R., Godfrey, M., Maddon, D. E., Chess, L., and Axel, R. (1985). Cell (Cambridge,Mass.) 42,93. Maino, V. C., and Janszen, M. E. (1986).J.lmmunol. 137,3093. Maison, C., Villiers, C., Barro, C., and Colomb, M. (1989). lnt. Congr. lmmunol, 7th Abstr. NO. 22-20. Majdic, 0.(1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 838. Oxford Univ. Press, Oxford. Malhotra, R., and Sim, R. B. (1989). Biochem. J. 262,625. Marks, R. M., Todd, R. F., 111, and Ward, P. A. (1989).Nature (London)339,314. Maruyama, S., Naito, T., Kakita, H., Kishimoto, S.,Yamamura, Y.,and Kishimoto, T. (1983).J . Clin. lmmunol. 3,57. Massaia, M., Pileri, A., Boccadoro, M., Bianchi, A., Palumbo, A., and Dianzani, U. (1988). J. lmmunol. 141,3768. Matsuoka, T., Hardy, C., and Tavassoli, M. (1989).J.Clin. lnuest. 83,904. Matsuyama, T., Yamada, A., Kay, J., Yamada, K. M., Akiyama, S. K., Schlossman, S. F., and Morimoto, C. (1989).J.Exp. Med. 170, 1133. Mattern, T., Flad, H.-D., Feller, A. C., Hexmann, E., and Ulmer, A. J. (1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dein Borne, eds.), p. 416. Oxford Univ. Press, Oxford. McCaughan, G. W., Clark, M. J., and Barclay, A. N. (1987). lmmunogerietics 25,329. McDougal, J. S., Kennedy, M. S., Sligh, J. M., Cort, S. P., Mawle, A., and Nicholson, J. K. A. (1986). Science 231,382. McIntyre, B. W., Evans, E. L., and Bednarczyk, J. L. (1989).J. B i d . Chem. 264,13745. MeMichael, A. J.. Beverley, P. C. L., Cobbold, S., Crumpton, M. J., Gilks, W., Gotch, F. M., Hogg, N., Horton, M., Ling, N., MacLennan, I. C. M., Mason, D. Y., Milstein, C., Spiegelhalter, D., and Waldmann, H., eds. (1987). “Leucocyte Typing 111. White Cell Differentiation Antigens.” Oxford Univ. Press, Oxford. Mendelsohn, C. L., Wimmer, E., and Racaniello, V. R. (1989). Cell (Cambridge, Mass.) 56,855. MerCep, M., Bonifacino, J. S., Garcia-Morales, P., Samelson, L. E., Klausner, R. D., and Ashwell, J. 0. (1988).Science 242,571. MerCep, M., Weissman, A. M., Frank, S. J., Klausner, R. D., and Ashwell, J. D. (1989). Science 246, 1162. Metlay, J. P., Pur6, E., and Steinman, R. M. (1989).Ado. lmmunol. 47,45. Metzelaar, M. J., Sixma, J. J., and Nieuwenhuis, H. K. (1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Diirken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 1043. Oxford Univ. Press, Oxford. Metzger, H. (1988).Ado. lmmunol. 43,277. Meuer, S. C., Hussey, R. E., Fabbi, M., Fox, D., Acuto, O., Fitzgerald, K. A., Hodgdon, J. C., Protentis, J.-P., Schlossman. S. F., and Reinherz, E. L. (1984).Cell (Combridge, Mass.) 36,897. Miettinen, H. M., Rose, J. K., and Mellman, I. (1989). Cell (Combridge, Moss.) 58,317. Miller, L., Blank, U., Metzger, H., and Kinet, J.-P. (1989). Science 244,334. Minami, N., Tokito, S., Nakayama, K.-I., Ishihara, T., and Nakauchi, H. (1989). lnt. Congr. lmmunol., 7th Abstr. No. 10-4.
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
139
Mita, S., Tominaga, A., Hitoshi, Y., Sakamoto, K., Honjo, T., Akagi, M., Kikuchi, Y., Yamaguchi, N., and Takatsu, K. (1989). Proc. Natl. Acad. Sci. U.S.A.86,2311. Mogensen, K. E., Uze, G., and Eid, P. (1989). Experientia 45,500. Moingeon, P., Chang, H.-C., Sayre, P. H., Clayton, L. K., Alcover, A., Gardner, P., and Reinherz, E. L. (1989).lmmunol. Reo. 111, 111. Mongini, P. K. A., Blessinger, C., Posnett, D. N., and Rudich, S. M. (1989).J.lmmunol. 143,1565. Moore, M. D., Cooper, N. R., Tack, B. F., and Nemerow, G. R. (1987). Proc. Natl. Acad. Sci. U.S.A.84,9194. Morris, D. G., and Pross, H. F. (1989).J.Exp. Med. 169,717. Mosley, B., Beckmann, M. P., March, C. J., Idzerda, R. L., Gimpel, S. D., Van den Bos, T., Friend, D., Alpert, A., Anderson, D., Jackson, J., Wignall, J. M., Smith, C., Gallis, B., Sims, J. E., Urdal, D., Widmer, M. B., Cosman, D., and Park, L. S. (1989). Cell (Cambridge, Mass.) 59,335. Mostov, K. E., Friedlander, M., and Blobel, G. (1984). Nature (London)308,37. Muchmore, A., Shaw, A., and Wingfield, P. (1989). lnt. Cong. lmmunol., 7th Abstr. No. 55-30. Mueckler, M., Caruso, C., Baldwin, S. A., Panico, M., Blench, I., Morris, H. R., Allard, W. J., Lienhard, G. E., and Lodish, H. F. (1985).Science 229,941. Mustelin, T., Coggeshall, K. M., and Altman, A. (1989).Proc. Natl. Acad. Sci. U.S.A. 86, 6302. Nagasawa, R., Gross, J., Kanagawa, O., Townsend, K., Lanier, L. L., Chiller, J., and Allison, J. P. (1987).J.lmmunol. 138,815. Nakayama, T., Kubo, R. T., Kishimoto, H., Asano, Y., and Tada, T. (1989).lnt. lmmunol. 1,50. Newell, M. K., Justement, L. B., Miles, C. R., and Freed, J. H. (1988).J.lmmunol. 140, 1930. Newman, W., Fanning, V. A., Rao, P. E., Westberg, E. F., and Patten, E. (1986). J . lmmunol. 137,3702. Nicola, N. A. (1989). Annu. Reo. Biochem. 58,45. Nieda, M., Juji, T., Imao, S., and Minami, M. (1988).J.lmmunol. 141,2975. Nitta, T., Yagita, H., Sato, K., and Okumura, K. (1989).J.E x p . Med. 170, 1757. Nong, Y.-H., Remold-O’Donnell, E., LeBien, T. W., and Remold, H. G. (1989).J.Exp. Med. 170,259. Norment, A. M., and Littman, D. R. (1988).EMBOJ. 7,3433. Norment, A. M., Slater, R. D., Parham, P., Engelhard, V. H., and Littman, D. R. (1988). Nature (London)336,79. Norment, A. M., Lonberg, N., Lacy, E., and Littman, D. R. (1989)J. lmmunol. 142,3312. Novick, D., Engelmann, H., Wallach, D., and Rubinstein, M. (1989).J . E x p . Med. 170, 1409. Nunez, G., Ugolini, V., Capra, J. D., and Stastny, D. (1982). Scand.1. lmmunol. 16,515. O’Brien, R. M., Soos, M. A., and Siddle, K. (1987).EMBOJ. 6,4003. O’Connor, R., Bradley, J. G., O’Meara, A., and Cotter, T. G. (1989). Blood 73,553. Ohto, H., Maeda, H., Shibata, Y., Chen, R. F., Ozaki, Y., Higashihara, M., Takeuchi, A., and Tohyamata, H. (1985). Blood 66,873. Omary, M. B., Kelleher, D., and Kagnoff, M. F. (1988).J.lmmunol. 141,3492. O’Neill, H. C., McGrath, M. S., Allison, J. P., and Weissman, I. L. (1987).Cell (Cambridge, Mass.) 49, 143. Oquendo, P., Hundt, E., Lawler, J., and Seed, B. (1989). Cell (Cambridge, Mass.) 58,95.
140
v. HOREJS~
Orloff, D. G., Frank, S. J.. Robey, F. A., Weissman, A. M., and Klausner, R. D. (1989). J . Biol. Chem. 264,14812. Oshima, A., Nolan, C. M., Kyle, J. W., Grubb, J. H., and Sly, W. S. (1988).J.Biol. Chem. 263,2553. Otten, U., Ehrhard, P., and Peck, R. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 10059. Paccaud, J.-P., Carpentier, J.-L., and Schifferli, J. A. (1988).J.Zmmunol. 141,3889. Paietta, E., Stockert, R. J., McManus, M., Thompson, D., Schmidt, S., and Wiernik, P. H. (1989).J . Zmmunol. 143,2850. Painter, R. G., Zahler-Bentz, K., and Dukes, R. E. (1987).J.Cell Biol. 105,2959. Parish, C. R., McPhun, V., and Warren, H. S. (1988).J.Zmmunol. 141,3498. Parkhouse, R. M. E. (1990). Zmmunology 69,298. Parnes, J. R. (1989).Adu. Immunol. 44,265. Parnes, J . R., Nakayama, E.,andvon Hoegen, I. (1989).Int. Congr. Immunol., 7th,Abstr. NO.64-24. Partridge, L. J., Jones, D. B., Rooney, N., Dransfield, I., and Burton, D. R. (1987). In “Leucocyte Typing 111. White Cell Differentiation Antigens” (A. J. McMichael et al., eds), p. 691. Oxford Univ. Press, Oxford. Pascual, P. W., Blalock, J. E., and Bost, K. L. (1989).]. Zmmunol. 143,3697. Pesando, J. M., Hoffman, P., and Abed, M. (1986).J.Zmmunol. 137,3689. Pesando, J. M., Bouchard, L. S., and McMaster, B. E. (1989).J.E x p . Med. 170,2159. Peters, P. M., Kamarck, M. E., Hemler, M. E., Strominger, J. L., and Ruddle, F. H. (1984). J . E x p . Med. 159, 1441. Phillips, D. R., Charo, I. F., Parise, L. V., and Fitzgerald, L. A. (1988).Blood 71,831. Pilarski, L. M., and Deans, J. P. (1989).Zmmunol. Lett. 21, 187. Poggi, A., Zocchi, M. R., Moretta, L., and Moretta, A. (1989).Eur.J. Zmmunol. 19,2069. Pohlmann, R., Nagel, G., Schmidt, B., Stein, M., Lorkowski, G., Krentler, C., Cully, J., Meyer, H. E., Grzeschik, K. H., Mersmann, G., Hasilik, A., and von Figura, K. (1987). Proc. Natl. Acad. Sci. U.S.A.84,5575. Poncz, M., Eisman, R., Heidenreich, R., Silver, S. M., Vilaire, G., Surrey, S., Schwartz, E., and Bennett, J. S . (1987).J . Biol. Chem. 262,8476. Pontranoli, S., Melloni, E., Michetti, M., Sacco, O., Sparatore, B., Salamino, F., Damiani, G., and Horecker, B. L. (1986).Proc. Natl. Acud. Sci. U.S.A.83,1685. Poppema, S., Visser, L., Shaw, A., and Slupsky, J. (1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 132. Oxford Univ. Press, Oxford. Porcelli, S., Brenner, M. B., Greenstein, J. L., Balk, S. P., Terhorst, C., and Bleicher, P. A. (1989).Nature (London)341,447. Posnett, D. (1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 137. Oxford Univ. Press, Oxford. Pugliese, O., Siracusano, A,, Wirz, M., Vismara, D., Lombardi, G., and Piccolella, E. (1987).In “Leucocyte Typing 111. White Cell Differentiation Antigens” (A. J. McMichael et al., eds.), p. 295. Oxford Univ. Press, Oxford. Pui, C. H., Ip, S. H., Thompson, E., Dodge, R. K., Brown, M., Wilimas, J., Carrabis, S., Kung, P., Berard, C. W., and Crist, W. M. (1989). Blood 73,209. Pytowski, B., Easton, T. G., Valinsky, J. E., Calderon, T., Sun, T., Christman, J. K., Wright, S. D., and Michl, J. (1988).J.E x p . Med. 167,421. Quackenbush, E. J., and Letarte, M. (1985).J.Zmmunol. 134, 1276. Quackenbush, E. J., Clabby, M., Gottesdiener, K., Barbosa, J., Jones, N. H., Strorninger, J. L., Speck, S., and Leiden, J. M. (1987). Proc. Natl. Acad. Sci. U.S.A. 84,6526.
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
141
Ra, C., Jouvin, M.-H. E., Blank, U., and Kinet, J.-P. (1989). Nature (London)341,752. Raff, H. V., Picker, L. J., and Stobo, J. D. (1980).J.E x p . Med. 152,581. Rao, A., KO,W. W.-P., Faas, S. J., and Cantor, H. (1984).Cell (Cambridge,Mass.)36,879. Raulet, D. H. (1989). Annu. Reu. Immunol. 7, 175. Rellahan, B. L., and Cone, R. E. (1989).Cell. Immunol. 123, 166. Reske-Kunz, A. B., Osawa, H., Josimovic-Alasevic, O., Rude, E., and Diamantstein, T. (1987).]. Immunol. 138, 192. Rieber, E. P. (1989).In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 361. Oxford Univ. Press, Oxford. Risso, A,, Cosulich, M. E., Mazza, M. R., and Bargellesi, A. (1987). Cell. Irnmunol. 110, 413. Rohrer, L., Freeman, M., Kodama, T., Penman, M., and Krieger, M. (1990). Nature (London)343,570. Rolink, A. G., Melchers, F., and Palacios, R. (1989).J.Exp. Med. 169, 1693. Rollins, T. E., Siciliano, S., and Springer, M. S. (1988).J. Biol. Chem. 263,520. Ross, G. D., Cain, J. A., and Lachrnann, P. J. (1985).J.Immunol. 134,3307. Roth, R. A. (1988). Science 239,1269. Rothenhausler, B., Dornmair, K., and McConnell, H. M. (1990). Proc. Natl. Acad. Sci. U S A . 87,352. Sakaguchi, N., Kashiwamura, S.-I., Kimoto, M., Thalmann, P., and Melchers, F. (1988). EMBOJ. 7,3457. Samoszuk, M. K., Gidanian, F., Lo-Hsueh, M., and Rietveld, C. (1989).Hybridoma 8, 427. Sanda, M. G., Pierson, R., Smith, C., Reemtsmal, K., and Rose, E. (1989). Transplant. Proc. 21,2525. Sanders, S. K., Kubagawa, H., Suzuki, T., Butler, J. L., and Cooper, M. D. (1987). J. Immunol. 139,188. Sandrin, M. S., Vaughan, H. A., Lovering, K. E., Curnow, K., Deacon, N. J., and McKenzie, I. F. C. (1987). In “Leucocyte Typing 111. White Cell Differentiation Antigens” (A. J. MeMichael et al., eds.), p. 216. Oxford Univ. Press, Oxford. Saragovi, H., and Malek, T. R. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 11. Schad, V., and Phipps, R. P. (1989).]. Immunol. 143,2127. Schnabl, E., Stockinger, H., Majdic, O., Williere, G., Gaugitsch, H., Lindley, I., Hofer, E., and Knapp, W. (1989). I n t . Congr. Immunol., 7th Abstr. No. 17-80. Schneider, C., Owen, M. J., Banville, D., and Williams, J. G. (1984).Nature (London) 311,675. Schneider, W. J. (1989). Biochim. Biophys. Actu 988,303. Scholl, P., Diez, A., Mourad, W., Parsonett, J., Geha, R. S., and Chatila, T. (1989). Proc. Natl. Acad. Sci. U.S.A.86,4210. Schon, E., Demuth, H. U., Eichmann, E., Horst, H.-J., Korner, I.-J., Kopp, J., Mattern, T., Neubert, K., NOH, F., Ulmer, A. J., Barth, A,, and Ansorge, S. (1989). Scand.J.Immunol. 29, 127. Schraven, B., Samstag, Y.,and Meuer, S. (1989). Int. Congr. Immunol., 7th Abstr. No. 58-38. Schwarting, R., and Stein, H. (1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Reiber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 464. Oxford Univ. Press, Oxford. Schwartz, R. H. (1989). Cell (Cambridge, Mass.) 57, 1073. Schwarz, R. E., and Hiserodt, J. C. (1988).J.Immunol. 141,3318. Seed, B. (1987).Nature (London)329,840.
142
V. HOhEJSf
Seki, T., Spurr, N., Obata, F., Goyert, S., Goodfellow, P., and Silver, J. (1985).Proc. Natl. Acad. Sci. U.S.A. 82,6657. Selvaraj, P., Low, M. G., Lopez, P., and Springer, T. A. (1989).In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 743. Oxford Univ. Press, Oxford. Semenuk, M., and Brain, M. C. (1985). Blood 66, Suppl. 1, 102a (Abstr. NO. 294). Semenzato, G., Foa, R., Agostini, C., Zambello, R., Trentin, L., Vinante, F., Benedetti, F., Chilosi, M., and Pizzolo, G. (1987). Blood 70,396. Semenzato, G., Trentin, L., Zambello, R., Agostini, C., Bulian, P., Siviero, F., Ambrosetti, A., Vinante, F., Prior, M., Chilosi, M., and Pizzolo, G . (1988).Leukemia 2,788. Seon, B. K., Negoro, S., and Barcos, M. P. (1983). Proc. Natl. Acud. Sci. U.S.A.80,845. Seon, B. K., Fukukawa, T., Jackson, A. L., Chervinsky, D., Tebbi, C. K., Freeman, A. I., and Matsuzaki, H. (1986). Mol. Immunol. 23,569. Serra, C., Engel, P., Gallart, T., and Vives, J. (1989).lnt. Congr. lmmunol., 7th Abstr. No. 27-21. Sewell, W. A., Brown, M. H., Dunne, J., Owen, M. J., and Crumpton, M. J. (1986).Proc. Natl. Acad. Sci. U.S.A.83,8718. Seya, T., and Atkinson, J. P. (1989).Biochem.]. 264,581. Shannon, B. T., O’Dorisio, M. S., Mulne, A. F., Grossman, N. J., and Ruymann, F. B. (1986). lnt. Congr. lmmunol., 6th Abstr. No. 2.64.7. Sharon, M., Gnarra, J. R., Baniyash, M., and Leonard, W. J. (1988).]. Immunol. 141,3512. Shelley, C. S., Remold-O’Donnell, E., Davis, A. E., 111, Bruns, G. A. P., Rosen, F. S . , Carroll, M. C., and Whitehead, A. S. (1989). Proc. Natl. Acad. Sci. U.S.A.86,2819, Shen, L., Lasser, R., and Fanger, M. W. (1989).]. lmmunol. 143,4117. Sherblom, A. P., Sathyamoorty, N., Decker, J. M., and Muchniore, A. V. (1989). 1.lmmunol. 143,939. Sherr, C. J. (1990). Blood 75, 1. Sherr, C. J., Rettenmier, C. W., Sacca, R., Roussel, M. F., Look, A. T., and Stanley, E. H. (1985). Cell (Cambridge, Muss.) 41,665. Shimizu, Y.,Geraghty, D. E., Koller, B. H., Orr, H. T., and De Mars, R. (1988).Proc. Natl. Acad. Sci. U.S.A.85,227. Shive, L., Gorman, S. D., and Parnes, J. R. (1988).]. E x p . Med. 168,1993. Sibinga, N. E. S., and Goldstein, A. (1988).Annu. Reo. lmmunol. 6,219. Siliciano, R. F., Hemesath, T. J., Pratt, J. C., Dintzis, R. Z., Dintzis, H. M., Acuto, O., Shin, H. S., and Reinherz, E. L. (1986). Cell (Cambridge, Mass.) 47, 161. Simister, N. E., and Mostov, K. E. (1989).Nature (London)337, 184. Simmons, D., and Seed, B. (1988a). Nature (London)333,568. Simmons, D., and Seed, B. (1988b).J.lmmunol. 141,2797. Simmons, D., and Seed, B. (1990).]. E r p . Med. (in press). Simmons, D., Makgoba, M. W., and Seed, B. (1988).Nature (London)331,624. Sims, J. E., Acres, R. B., Grubin, C. E., McMahan, C. J., Wignall, J. M., March, C. J., and Dower, S. K. (1989).Proc. Natl. Acad. Sci. U.S.A.86,8946. Sinclair, N. R., and Panoskaltsis, A. (1987). lmmunol. Today 8,76. Sinigaglia, F., Guttinger, M., Kilgus, J., Doran, D. M., Matile, II., Etlinger, H., Trzeciak, A., Gillessen, D., and Pink, J. R. L. (1988). Nature (London)336,778. Skinner, M. P., Fournier, D. J., Andrews, R. K., Gorman, J. J., Chesterman, C. N., and Berndt, M . C. (1989).Biochem. Biophys. Res. Commun. 164, 1373. Snow, P. M., van de Rijn, M., and Terhorst, C. (1985).Eur.]. lmmunol. 15,529.
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
143
Solano, A. R., Cremaschi, G., Sanchez, M. L., Borda, E., Sterin-Borda, L., and Podesta, E. J. (1988). Proc. Natl. Acad. Sci. U.S.A.85,5087. Sonnenberg, A., Modderman, P. W., and Hogervorst, F. (1988).Nature (London)336, 487. Soos, M. A., O’Brien, R. M., Brindle, N. P. J., Stigter, J. M., Okamoto, A. K., Whittaker, J., and Siddle, K. (1989). Proc. Natl. Acad. Sci. U.S.A.86,5217. Southern, S. O., Swain, S. L., and Dutton, R. W. (1987).J. Zmmunol. 138,2568. Springer, T. A., Thompson, W. S., Miller, L. J., Schmalsteig, F. C., and Anderson, D. C. (1984).J . Erp. Med. 160, 1901. Stamenkovic, I., and Seed, B. (1988a).J . Erp. Med. 167, 1975. Stamenkovic, I., and Seed, B. (1988b).J. E x p . Med. 168, 1205. Stamenkovic, I., and Seed, B. (1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 64. Oxford Univ. Press, Oxford. Stamenkovic, I., Amiot, M., Pesando, J. M., and Seed, B. (1989a). Cell (Cambridge, Mass.)56, 1057. Stamenkovic, I., Clark, E. A., and Seed, B. (1989b). EMBOJ. 8, 1403. In “Leucocyte Typing IV. White Cell Stamenkovic, I., Staunton, J., and Seed, B. (1989~). Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 87. Oxford Univ. Press, Oxford. Stauber, C. B. and Aggarwal, B. B. (1989).J. Biol. Chem. 264,3573. Stauber, G . B., Aiyer, R. A., and Aggarwal, B. B. (1988).J. Biol. Chem. 263, 19098. Staunton, D. E., and Thorley-Lawson, D. A. (1987). EMBOJ. 6,3695. Staunton, D. E., Dustin, M. L., and Springer, T. A. (1989). Nature (London)339,61. Steckel, F., Apeler, H., van Koppen, A., and Sorg, C. (1989). Znt. Congr. Zmmunol., 7th Abstr. No. 20-28. hefanova, I., Hilgert, I., KriStofova, H., Brown, R., Low, M. G., and HoFejSi, V. (1989). Mol. Immunol. 26, 153. Stein, H., Schwarting, H., Niedobitek, G., and Dallenbach, F. (1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 446. Oxford Univ. Press, Oxford. Stockinger, H. (1989,). I n “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 836. Oxford Univ. Press, Oxford. Stockinger, H. (1989b). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 840. Oxford Univ. Press, Oxford. Stockinger, H. (1989~).In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. C. Kr. von dem Borne, eds.), p. 841. Oxford Univ. Press, Oxford. Stockinger, B., Pessara, U., Lin, R. H., Habicht, J,, Grez, M., and Koch, N. (1989). Cell (Cambridge, Mass.) 56,683. Stockinger, H., Gadd, S. J., Eher, R., Majdic, O., Kasinrerk, W., Strass, B., Schreiber, W., Schnabl, E., and Knapp, W. (1990).J . Zmmunol. (in press). Stoolman, L. M. (1989). Cell (Cambridge, Mass.) 56,907. Storkus, W. J., Alexander, J., Payne, J. A,, Cresswell, P., and Dawson, J. R. (1989). J . Zmmunol. 143,3853. Streeter, P. R., Raves, B. T. N., and Butcher, E. C. (1988).J. Cell Biol. 107, 1853.
144
v. HOREJSI
Streuli, M., Hall, L. R., Saga, Y., Schlossman, S. F., and Saito, H. ( 1 9 8 7 ) ~E.x p . Med. 166, 1548. Streuli, M., Morimoto, C., Schrieber, M., Schlossman, S. F., and Saito, H. (1988a). J. Zmmunol. 141,3910. Streuli, M., Krueger, N. X., Hall, L. R., Schlossman, S. F., and Saito, H. (1988b).J. E r p . Med. 168,1523. Stricker, R. B., McHugh, T. M., Moody, D. J., Morrow, W. J. W., Stites, D. P., Shuman, M. A., and Levy, J. A. (1987a).Nature (London)327,710. Stricker, R. B., Reyes, P. T., Corash, L., and Shuman, M. A. (1987b).J.Clin. Znoest. 79, 1589. Strubin, M., Berte, C., and Mach, B. (1986). EMBOJ. 5,3483. Suchard, S. J. and Boxer, L. A. (1989).J.Clin. Znoest. 84,484. Suciu-Foca, N., Reed, E., Rubinstein, P., MacKenzie, W., Ng, A.-I., and King, D. W. (1985).Nature (London)318,465. Suhail, M., and Rizvi, S. I. (1989).Biochem. J. 259,897. Sukhatme, V., Sizer, K. C., Vollmer, A. C., Hunkapiller, T., and Parnes, J. R. (1985).Cell (Cambridge, Mass.) 40,591. Sung, S . 4 . J., and Walters, J. A. (1989).J . Immunol. 142, 1903. Suomalainen-Nevanlinna, H. A., Schroder, J., and Anderson, L. C. (1987). Scund. J. Zmmunol. 25,421. Suzuki, S., Argraves, W. S., Arai, H., Languino, L. R., Pierschbacher, M. D., and Ruoslahti, E. (1987).J.Biol. Chem. 262, 14080. Suzuki, T., Sanders, S. K., Butler, J. K., and Cooper, M. D. (1985). Proc., Fed. Am. SOC. E x p . Biol. 44, 1328. Swack, J. A., Gangemi, R. M. R., Rudd, C. E., Morimoto, C., Schlossman, S. F., and Romain, P. L. (1989).Mol. Immunol. 26, 1037. Swendemann, S., and Thorley-Lawson, D. A. (1987).EMBOJ. 6, 1637. Symington, F. W. (1989).J.Immunol. 142,2784. Szollosi, J.. Damjanovich, S., Goldman, C. K., Fulwyler, M. J., Aszalos, A. A., Goldstein, G., Rao, P., Talle, M. A., and Waldmann, T. A. (1987). Proc. Nutl. Acad. Sci. U.S.A.84, 7246. Szollosi, J., Damjanovich, S., Balazs, M., Nagy, P., T r h , L., Fulwyler, M. J., and Brodsky, F. M. (1989).J. Zmmunol. 143,208. Taga, T., Hibi, M., Hirata, Y., Yamasaki, Y., Yasukawa, K., Matsuda, T., Hirano, T., and Kishimoto, T. (1989). Cell (Cambridge,Mass.) 58,573. Takada, Y., and Hemler, M. E. (1989).J.Cell Biol. 109,397. Takada, Y., Elices, M. J., Crouse, C., and Hemler, M. E. (1989).EMBOJ. 206,1361. Takahama, Y., Ono, S., Ishihara, K., Muramatsu, M., and Hamaoka, T. (1989). Eur. J. Immunol. 19,2227. Taketani, S., Kohno, H., and Tokunaga, R. (1987).J. Biol. Chem. 262,4639. Tandon, N. N., Kralisz, U., and Jamieson, G. A. (1989).J.Biol. Chem. 264,7576. Tang, S. C., Seehafer, J., Slupsky, J., Shaw, J., Bleackley, R. C., and Shaw, A. R. E. (1989). Int. Congr. Zmmunol., 7th Abstr. No. 27-24. Tebo, J. M., and Mortensen, R. F. (199O).J.Immunol. 144,231. Tedder, T. F., Isaac, C. M., Ernst, T. J., Demetri, G. D., Adler, D. A., and Disteche, C. M. (1989).j. E x p . Med. 170, 123. Testi, R., Phillips, J . H., and Lanier, L. L. (1989).J.Zmmunol. 143, 1123. Thaler, C. J., Faulk, W. P., and McIntyre, J. A. (1989).J.Zmmunol. 143, 1937. Thieme, T., Yoshihara, P., and Burger, D. (1987).Cell. Immunol. 108,28. Thomas, M. L. (1989).Annu. Reo. Zmmunol. 7,339. Thomas, M. L., and Lefrancois, L. (1988). Zmmunol. Today 9,320.
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
145
Todd, R. F., 111, Bhan, A. K., Kabawat, S. E., and Schlossman, S. F. (1984).In “Leucocyte Typing” (A. Bernard, L. Boumsell, J. Dausset, C. Milstein, and S. F. Schlossman, eds.), p. 424. Springer-Verlag, Berlin. Tollefsen, S., and Thompson, K. (1988).J. Biol. Chem. 263, 16267. Tomkinson, B. E., Brown, M. C., Ip, S. H., Carrabis, S., and Sullivan, J. L. (1989). 1.Jmmunol. 142,2230. Townsend, A., Ohlen, C., Bastin, J., Ljunggren, H.-G., Foster, L., and Karre, K. (1989). Nature (London)340,443. Trauth, B. C., Klas, C., Peters, A. M. j.,Matzku, S., Miiller, P., Falk, W., Debatin, K.-M., and Krammer, P. H. (1989). Science 245,301. Trinchieri, G. (1989).Adu. Immunol. 47, 187. Tsokos, Q. C., Kinoshita, T., Thyphronitis, G., Patel, A. D., Dickler, H. B., and Finkelman, F. D. (1990).J. Immunol. 144,239. Uchibayashi, N., Kikutani, H., Barsumian, E. L., Suemura, M., and Kishimoto, T. (1989). Jnt. Congr. Zmmunol., 7th Abstr. No. 19-60. Ucker, D. S., Kurasawa, Y., and Tonegawa, S. (1985).J . Immunol. 135,4204. Ueda, E., Kinoshita, T., Nojima, J., Inoue, K., and Kitani, T. (1989).J. Zmmunol. 143, 1274. Ueda, K., Clark, D. P., Chen, C.-J., Roninson, I. B., Gottesman, M. M., and Pastan, I. (1987).J . Biol. Chem. 262,505. Ullrich, A., Bell, J. R., Chen, E. Y., Herrera, R., Petruzzelli, L. M., Dull, T. J., Gray, A., Coussens, L., Liao, Y.-C., Tsubokawa, M., Mason, A., Seeburg, P. H., Grunfeld, C., Rosen, 0. M., and Ramachandran, J . (1985).Nature (London)313,756. Unkeless, 1. C., Scigliano, E., and Freedman, V. (1988).Annu. Rev. Zmmunol. 6,251. Uzumaki, H., Okabe, T., Sasaki, N., Hagiwara, K., Takatu, F., Tobita, M., Yasukawa, K., Ito, S., and Umezawa, Y. (1989). Proc. Natl. Acad. Sci. U.S.A. 86,9323. Valentine, M. A., Clark, E. A., Shu, G. L., Norris, N. A., and Ladbetter, J. A. (1988). J . Jmmunol. 140,4071. Valk, A., Garrone, P., Aubry, J.-P., and Banchereau, J. (1989).I n “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 510. Oxford Univ. Press, Oxford. Vanbuskirk, A., Crump, B. L., Margoliash, E., and Pierce, S. K. (1989).J . E x p . Med. 170, 1799. van den Elsen, P., Shepley, B. A., Borst, J., Coligan, J. E., Markham, A. F., Orkin, S., and Terhorst, C. (1984). Nature (London)312,413. van der Schoot, C. E., Huizinga, T. W. J., Gadd, S., Majdic, O., Wijmans, R., Knapp, W., and von dem Borne, A. E. G. Kr. (1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 887. Oxford Univ. Press, Oxford. Van Obberghen, E., and Gammeltoft, S. (1986). Experientia 42,727. Varin, N., Sauth, C., Galinha, A., Even, j.,Hogarth, P. M., and Fridman, W. H. (1989). Eur. J . Immunol. 19,2263. Varticovski, L., Druker, B., Morrison, D., Cantley, L., and Roberts, T. (1989).Nature (London)342,699. Vercelli, D., Helm, B., Marsh, P., Padlan, E., Geha, R. S., and Could, H. (1989). Nature (London)338,649. Viehmann, K., Dreger, P., Harpprecht, J., Liiffler, H., and Miiller-Ruchholtz, W. (1989). Int. Congr. Immunol., 7th Abstr. No. 28-14. Villar, L. M., Roy, G., Lazaro, I., Alvarez-Cermeno, J. C., Gonzales, M., Brieva, J. A.,
146
V. HOREJSf
Della Sen, M. L., Leoro, G., Bootello, A., and GonzBlez-Porquk, P. (1989). Eur. J . Zmmunol. 19, 1835. Vincendeau-Schemer, C., Vincendeau, P., Belloc, F., Boisseau, M., and Bezian, J. H. (1989). Znt. Congr. Zmmunol., 7th Abstr. No. 38-24. Vodinelich, L., Sutherland, R.,Schneider,C., Newman, R.,and Greaves, M. (1983).Proc. Natl. Acad. Sci. U.S.A.80,835. Vogel, L., and Haustein, D. (1989). Immunology 67,251. Vogetseder, W., Schulz, T. F., Mitterer, M., Schwaeble, W., and Dierich, M. P. (1989). Znt. Congr. Zmmunol., 7th Abstr. No. 54-45. von Boehmer, H. (1988).Annu. Reo. Zmmunol. 6,309. Waldmann, T. A. (1989). Annu. Reu. Biochem. 58,875. Wang, C . Y., Azzo, W., Al-Katib, A., Chiorazzi, N., and Knowles, D. M., I1 (1984). J . Zmmunol. 133,684. Warren, J. T., and Civin, C. I. (1985).J . Zmntunol. 134, 1827. Watts, M. J., Dankert, J. R.,and Morgan, B. P. (1990). Biochem.J.265,471. Wayner, E. A., Garcia-Pardo, A., Humphries, M. J., McDonald, J. A., and Carter, W. G . (1989).J.Cell Biol. 109, 1321. Weissman, A. M., Baniyash, M., Hou, D., Samelson, L. E., Burgess, W. H., and Klausner, R. D. (1988).Science 239, 1018. Werfel, T., Uciechowski, P., Tetteroo, P. A. T., Kurrle, R., Deicher, H., and Schmidt, R. E. (1989).]. Znimunol. 142, 1102. Wheeler, E. F., Rettenmier, C. W., Look, A. T., and Sherr, C. J. (1986).Nature (London) 324,377. White, J. M., and Littman, D. R. (1989).Cell (Cumbridge,Mass.) 56,725. Wienands, J., Honibach, J., Radbruch, A., Riesterer, C., and Reth, M. (1990).EMBOJ. 9, 449. Willardson,B. M.,Thevenin, B. J.-M., Harrison, M. L., Kuster, W. M., Benson, M. D.,and Low, P. S. (1989).J.Biol. Chem. 264, 15893. Williams, D. B., Barber, B. H., Flavell, R. A., and Allen, H. (1989).J.Zmmunol. 142,2796. Williams, L. T. (1989).Science 243, 1564. Wright, S. D., Weitz, J . I., Huang, A. J,, Levin, S. M., Silverstein, S. C., and Loike, J. D. (1988). Proc. Natl. Acad. Sci. U.S.A. 85,7734. Wright, S. D., Levin, S. M., Jong, M. C. T., Chad, Z., and Kabbash, L. G . (1989).J.E x p . Med. 169, 175. Yagi, M., Stamatoyannopoulos, G . , and Papayannopoulou, T. (1987).J . Zmmunol. 138, 2208. Yagita, H., Nakata, M., Azuma, A., Nitta, T., Takeshita, T., Sugamura, K., and Okumura, K. (1989a).J . Exp. Med. 170, 1445. Yagita, H., Nakamura, T., Karasuyama H., and Okumura, K. (1989b). Proc. Natl. Acad. Sci. U.S.A.86,645. Yamada, H., Martin, P. J., Bean, M. A., Braun, M. P., Beatty, P. G., Sadamoto, K., and Hansen, J. A. (1985). Eur.J. Zmmunol. 15, 1164. Yamamoto, T., Davis, C. G., Brown, M. S., Schneider, W. J., Casey, M. L., Coldstein, J. L., and Russel, D. W. (1984).Cell (Cambridge, Mass.) 39,27. Yamasaki, Y., Taga, T., Hirata, Y., Yawata, H., Kawanishi, Y., Seed, B., Taniguchi, T., Hirano, T., and Kishimoto, T. (1988). Science 241,825. Yamashita, Y., Yniai, Y. and Osawa, T. (1989). Mol. Zmmunol. 26,905. Yednock, T. A., and Rosen, S. D. (1989).Ado. Zmmunol. 44,313. Yokochi, T., Holly, R. D., and Clark, E. D. (1982).J . Zmmunol. 128,823. Yokota, A., Kikutani, H., Tanaka, T., Sato, R., Barsumian, E. L., Suemura, M., and Kishimoto, T. (1988). Cell (Cambridge, Mass.) 55,611.
SURFACE ANTIGENS OF HUMAN LEUCOCYTES
147
Yoon, S. H., and Fearon, D. T. (1985).J . Zmmunol. 134,3332. Young, R. A,, and Elliot, T. J. (1989). Cell (Cambridge,Mass.) 59,5. Zalman, L. S., Wood, L. M., and Miiller-Eberhard, H. J. (1987).J. E x p . Med. 166,947. Ziegler, A., Uchanska-Ziegler, B., Stein, H., and Hadam, M. (1989). In “Leucocyte Typing IV. White Cell Differentiation Antigens” (W. Knapp, B. Dorken, W. R. Gilks, E. P. Rieber, R. E. Schmidt, H. Stein, and A. E. G. Kr. von dem Borne, eds.), p. 467. Oxford Univ. Press, Oxford. Zocchi, M. R.,Bottino, C., Ferrini, S., Moretta, L., and Moretta, A. (1987).J . E x p . Med. 166,319. Zwadlo, G., Brocker, E.-B., von Bassewitz, D.-B., Feige, U., and Sorg, C. (1985). J . Zmmunol. 134,1487. Zwadlo, G., Schlegel, R., and Sorg, C. (1986).J. Zmmunol. 137,512. This article was accepted for publication in June 1990.
NOTE ADDED IN PROOF.A number of relevant papers have been published since submitting the manuscript of this review. Among them are, e.g., those describing association of TCR with thefyn tyrosine kinase [Samelson et al. (1990),Proc. Natl. Acad. Sci. U.S.A.87,43581, expression of novel Ig-like molecules on pre-B cells [Karasuymaet al. (1990)J. E x p . Med. 172,9691.3-D structure ofCD4 [Wang et al. (1990),Nature (London) 348, 411; Ryu et al., ibid., p. 4191, existence of membrane-bound CSF-1 [Stein et al. (1990), Blood 76, 13081, cloning of cDNA coding for the CD3 1) chain [Jin et al. (1990), Proc. Natl. Acad. Sci. U.S.A.87,33191, TNF receptor [Smith et al. (1990), Science 248, 10191, chemotactic peptide receptor [Boulay et al. (1990),Biochem. Biophys. Res. Commun. 168, 11031, CD75 sialyltransferase [Stamenkovic et al. (1990),J . E x p . Med. 172, 6411,CD38 (Jackson and Bell (1990),J. Zmmunol. 144,28111,and a family of CD45-like molecules (Krueger et al. (lWO),EMBOJ.9,32411. Further, CD28 was identified as the receptor for the B-cell surface molecule B7 [Linsley et al. (1990),Proc. Natl. Acad. Sci. U.S.A.87,50311, CD14 as the receptor for the complex of LPS with LPS-binding protein [Wright et 01. (l990), Science 249,14311, and CD44 as the hyaluronate receptor [Aruffoet 01. (1990), Cell 61, 13031.
This Page Intentionally Left Blank
ADVANCES IN IMMUNOLOGY, VOL. 49
Expression, Structure, and Function of the CD23 Antigen G.DELESPESSEt U. SUTER,t D. MOSSALAYI,.* B. BETTLER,t M. SARFATI,' H. HOFSTEllER,t E. KILCHERR,' P. DEBRE,** A N D A. DALLOUL** Univenify oiMontmol, Now-Dame Hospital, Reswrch Center, Montrwl, Quebec H2L 4M1, Conodo t CIBA-GEIGY,CH-4002 Basel, Switzerland ** Pitio-Salpcihiere,75651 Cedox 13, Paris, Fmnce
1. Introduction
In 1987, the name CD23 antigen (here referred to as CD23) was given to a surface molecule reacting with the CD23 cluster of antibodies (1,2). This molecule, first identified by Spiegelberg and co-workers (3,4) as a low-affinity receptor for IgE (FceRII), is expressed on human peripheral blood B lymphocytes and on several lymphoblastoid B cell lines. The same molecule, expressed at high levels on Epstein-Barr virus (EBV)-transformed cells and at low density on freshly isolated B cells (5-7), was independently described as a B cell activation marker [named BLAST-2 or Epstein-Barr virus cell surface (EBVCS) molecule]. A hallmark of the CD23 molecule is that this transmembrane glycoprotein is continuously cleaved into soluble fragments, referred to as soluble CD23 (sCD23), that are released in the extracellular fluid. Most intriguingly,the two forms of CD23 may have different and sometimes antagonistic functions. In humans, some sCD23 fragments retain the ability to bind to IgE and have therefore been named IgE-binding factors (IgE-BFs). Four classes of IgE-binding molecules have now been characterized at the molecular level (Table I). They are structurally unrelated and encoded by different genes (8-10). In order to avoid confusion, especially with the T cell-derived IgE-binding facTABLE I IgE-BINDING MOLECULES Molecule MAC-2 (aBP; CBP-35) (I chain of FceRI FccRII (CD23) IgE-binding factor
Function Galactose-specific lectin High-affinity IgE receptor Low-affinity IgE receptor Secreted by rodent T lymphocytes; homology to retroviral polymerases
149 Copyright 0 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.
150
G . DELESPESSE E T A L .
tors described by Ishizaka (9) in rodents, the IgE-binding soluble CD23 fragments will be referred to hereafter as sCD23. II. Cellular Expression
Initially considered to be B cell specific, CD23 has subsequently been detected on a large variety of human hematopoietic cells as well as on some epithelial cells. A. B LYMPHOCYTES Both on mouse and on human B cells, the expression of CD23 appears to be associated with that of IgD (11).The great majority of freshly isolated circulating or splenis sIgM/sIgD mature B cells are CD23 positive (12-16). B cells lacking sIgD (sIgM single positive) do not express CD23 even after interleukin-4 (IL-4) stimulation; similarly, after switching to IgG, IgA, and IgE, B lymphocytes cannot be induced to express CD23 (13,14). During ontogeny, the expression of CD23 follows that of sIgD (11,14). Freshly isolated bone marrow sIgM+/sIgD+ B cells are CD23-; however, CD23 may be induced upon incubation with both the culture supernatant of phytohemagglutinin (PHA)-activated T cells and IgE (13).The conclusion of these studies is that CD23 is a B cell differentiation marker, the expression of which is restricted to mature B cells coexpressing sIgM and sIgD. However, transformed B cells, like the IgG-secreting RPMI 8866 cells, may express CD23 after switching (17-20) and, in some cases, malignant B cells from patients with chronic lymphocytic leukemia may coexpress sIgG or sIgA together with CD23 even in the absence of sIgD (21,22). Several studies in the mouse strongly suggest that CD23 may distinguish conventional mature B cells (expressing low levels of IgM and high levels of IgD) from B cells of the Lyl lineage (expressing high levels of IgM and little or no IgD). Cells of the Lyl lineage differ from their conventional counterparts by their predominance during ontogeny, by their anatomical localization, by their capacity for self-renewal, and by their ability to produce low-affinity, polyreactive autoantibodies (23). Recent observations further indicate that a subset of B cells from the Lyl lineage may lack the Lyl antigen; these cells, which are predominantly found in the spleen, particularly of some autoimmune strains of mice, have been named Lyl sister B cells. Lyl B cells and their sister B cells are CD23- (24-26). Moreover, following appropriate stimulation with IL-4 or IL-4 and lipopolysaccharide (LPS), these cells fail to express CD23 or to secrete IgE, although they secrete IgGl and increase their class I1 major histocompatibility complex
THE CD23 ANTIGEN
151
(MHC) antigens (T. J. Waldschmidt, personal observation). Taken collectively, these studies indicate that CD23 may be a better marker than Lyl to distinguish conventional mature B cells (CD23') from B cells of the Lyl/sister lineage. They also indicate that CD23-bearing B cells are the precursors of IgE-secreting cells. The CD5 antigen is thought to be the human counterpart of Lyl antigen. In contrast to the mouse model, CD23 is equally expressed on human CD5+, and CD- circulating or tonsillar B cells (21). Moreover, chronic lymphocytic leukemia B cells are CD5 and CD23 doublepositive (22,27). Finally, according to recent studies, all the CD23' umbilical cord blood B cells coexpress CD5 (M. Sarfati and S. Fournier, personal observation). Another major difference between mouse Lyl+ and human CD5+ B cells is that the latter express high levels of sIgD (28). CD 23 is found on the majority of freshly isolated resting mature B cells and its expression is not increased after stimulation by anti-IgM or Staphylococcus aureus Cowan I (SAC) (29). The effect of phorbol esters on B cell CD23 expression has been diversly appreciated (27,30-32). Perhaps the divergences may be explained by the relative purity of the B cell preparations tested and it is possible that phorbol esters may act indirectly to increase the density of CD23. Indeed, it was agreed that these protein kinase C (PKC)-stimulatingagents have a synergistic effect with known inducers of CD23, such as IL-4 (32). CD23 may be up-regulated following cognate interactions of human B cells with intact or paraformaldehyde-fixed alloreactive T cells (33). Because this was observed within 16 hours following T-B cell interaction, it was concluded that CD23 is an early marker of B cell activation and that it may be induced in the absence of interleukin production. However, the authors have not examined whether the T cell clones were capable of producing IL-4, the role of which can therefore not be formally ruled out. Cell cycle analysis has indicated that CD23 is preferentially expressed at Go (1,30,34). Our interpretation of the available evidence is that CD23 is not a marker of activated B cells. However, the IL-4-induced up-regulation of CD23 is much more important in the presence of costimulants such as anti-IgM, LPS, and SAC, as well as in the presence of T cells or of their culture supernatant (29,35).As mentioned above, this superinduction was shown to require PKC activation but not an increase of intracellular Ca2+ (32).
B. T LYMPHOCYTES In spite of accumulating strong evidence, there is yet no consensus regarding the ability of normal (untransformed) T cells to express CD23. In most of the earlier studies employing an IgE rosette assay,
152
G . DELESPESSE ET AL.
IgE-binding sites were detected on a small proportion of human and rodent T lymphocytes (36-42). However, in each species, there was some discrepancy with regard to the phenotype of the IgE-binding T cells that were found to be either CD4+ or CD8+ (36,41,43,44). The initial studies employing anti-CD23 monoclonal antibodies (Mabs) are also divergent. Some laboratories failed to detect surface CD23 or CD23 mRNA in normal T cells, even after IL-4 stimulation (1,12,20,45). Other investigators found a small proportion of CD23+ cells among normal circulating or tonsillar T lymphocytes (46,47) or among T cells from patients with Kimura disease (48).The proportion of CD23+ T cells could be increased following in uitro stimulation with either mitogens or allergens, used alone or in combination with IL-4 (47,49,50).The constitutive expression ofCD23 by some human T lymphotropic virus (HTLV-1)-transformed T cells clones has been clearly demonstrated both at the mRNA and at the protein levels (20,51-53). Moreover, CD23 was detected on the surface of T lymphocytes isolated from human immunodeficiency virus (H1V)-infected patients (54,55). It is of interest to note that CD23 was found on both CD4 and CD8 T cells and that T cells from HIV-infected patients were shown to release soluble factors capable of inducing normal T cells to release molecules binding to both IgE and to H107 anti-CD23 Mab. Most conclusive are the recent observations made on purified blood lymphocytes (PBLs) of allergic donors (56). These cells were stimulated either with purified allergen (to which the donor is sensitive) or with antigens such as tetanus toxoid or tuberculin, which do not induce a sustained IgE antibody response. CD23 was expressed on more than 30% of allergen-induced T cell blasts. Interestingly, the expression of CD23 on T cells was transient and best observed after 5 days of stimulation; this effect was inhibited by interferon-y (IFN-y) whereas it was enhanced by the addition of IL-4, which had no effect when used alone. Most importantly, CD23 mRNA was detected on highly purified allergen-stimulated T cell blasts. Two additional observations further support the view that T cells may indeed express CD23. Two cycle cell sortings of peripheral blood mononuclear cells (PBMCs) reacting with both anti-CD23 and anti-CD3 Mabs yielded a population that was 100% CD3+ and 70% CD23' and that contained CD23 mRNA [T.Nutman (National Institutes of Health) personal observations]. In addition, T. Kawabe and J. Yodoi (personal observation) have shown by using in situ hybridization that CD23 mRNA is present in some normal peripheral T lymphocytes. Finally, CD23 cDNA was cloned from the HTLV-1-negative HUT-78 T cell line (57); the sequence of this cDNA is identical to that of type b CD23 (see later) with the
THE CD23 ANTIGEN
153
exception that it contains an additional 64-bp repeat in the untranslated 3' region. Taken collectively, the above observations indicate that CD23 may be transiently expressed on a subpopulation of human T cells. Murine T cells were repeatedly found to be unreactive with B3B4 Mab, which is the only anti-CD23 Mab available in the mouse (58). Moreover, CD23 mRNA has never been detected in murine T cells (45).Contrasting with these negative results are the observations made in mice bearing an IgE-secreting plasmacytoma (43). A significant proportion of their CD8+ T cells is capable of binding IgE; most interestingly, these cells do not react with B3B4 Mab whereas they are clearly stained by a polyclonal antimouse CD23 antibody (59). These results were taken to indicate that murine T cell CD23 is similar but not identical to B cell CD23. However, another possible interpretation is that the CD23 molecules detected on CD8 T cells have been passively adsorbed and that they are in fact of B cell origin. Obviously, the determination of CD23 mRNA in such T cells should discriminate between these two possibilities. Irrespective of the outcome of this experiment it must be noted that the CD23+/CD8+T cells are capable of decreasing IgE production by the plasmacytoma as evaluated both at the protein and at the mRNA levels (43,60). C. M ONOCYTES/ MACROPHAGES Freshly isolated normal human monocytes or alveolar macrophages bear little or no CD23. However, CD23 is clearly detected on circulating monocytes of patients with elevated IgE levels (61,62) as well as on alveolar macrophages isolated from patients with allergic asthma or extrinsic alveolitis (63,64). In uitro, IL-4 induces CD23 expression on normal monocytes (65)and it was subsequently reported that monocytes express exclusively type b CD23 mRNA (66). In the murine system, B3B4 Mab fails to stain all cell types other than B cells (67). The polyclonal antimouse CD23 antiserum has not been tested on mouse macrophages, because, even after incubation with IL-4, these cells failed to form IgE rosettes (D. Conrad, personal observations). These negative results are in contrast to a very large number of earlier reports showing that both mouse and rat macrophages are capable of expressing low-affinity receptors for IgE (68-70). However, with the exception of one study, the structure of Fc& on rodent macrophages has not been characterized. Finbloom and Metzger immunoprecipitated two IgE-binding proteins from solubilized rat macrophages after cross-linking IgE to its receptor (71).One component, 40-70 kDa, was labeled after cell surface radioiodination; the other 33-kDa component
154
C. DELESPESSE ET AL.
was not labeled. No data are available regarding the antigenic composition and the molecular structure of rat or mouse macrophage IgE receptor, thus it is possible that the latter is different from CD23. A possible candidate might be the MAC-2 antigen, also known as €-binding protein (8). D. EOSINOPHILS The expression, the structure, and the function of the low-affinity receptor for IgE on activated (hypodense) eosinophils have been analyzed in detail by the M. Capron and co-workers (70,72-75). At least one other laboratory has confirmed the existence of a functional IgE receptor on eosinophils, the function of which is up-regulated b y platelet-activating factor (PAF) and leukotriene B4 (LTB4) (76). The presence of CD23 on an eosinophil cell line (Eol-3) has been clearly demonstrated at the mRNA and protein levels (66).According to the work of Capron, the IgE-binding site on eosinophils is identical or very similar to CD23 in terms of antigenic composition and protein structure (70,77). Moreover, CD23 mRNA was identified in a preparation of enriched hypodense eosinophils (78). However, attempts to clone eosinophil CD23 cDNA by using a B cell CD23 cDNA probe have not been successful (M. Capron, personal observations). This failure should be related to the inability of several investigators to detect CD23 on human eosinophils. However, because these negative results have not been published, it is most difficult to further analyze this open issue. E. LANCERHANS CELLS Several investigators have reported the presence, in patients with atopic dermatitis, of IgE-binding epidermal and dermal Langerhans cells (79-82). These were mainly detected in tissue sections from lesional skin of patients with elevated serum IgE levels; the number of positive cells was significantly reduced after local glucocorticoid treatment. Further studies indicated that the IgE-binding site on Langerhans cells is associated with the CD1 antigen: (1)IgE binds only to CDla-positive and not to CDla-negative Langerhans cells and (2) OKT6 (an anti-CD1 Mab) prevents the binding of IgE to Langerhans cells (79). Langerhans cells isolated froms the skin of normal individuals were shown to express CD23 following incubation with IL-4 and/or IFN-y. These cells express CD23 mRNA and surface CD23 and release soluble CD23 in the culture supernatants (83).Interestingly, the induction of CD23 by either IL-4 or IFN-y is inhibited in the presence of IL-1, IL-3, and IL-6, all of which may be produced b y keratinocytes. Finally, Langerhans cells coated with specific IgE anti-
THE CD23 ANTIGEN
155
bodies were shown to be very efficient in presenting antigen to T cells (84).
F. OTHERCELLTYPES The presence of low-affinity IgE-binding sites on murine and human natural killer (NK) cells has been reported by a number of laboratories (85-87). However, there is no evidence that CD23 is expressed on normal NK cells. In one patient with chronic lymphocytosis due to the accumulation of CD2+/CD16+/CD3-/CD8- large granular lymphocytes, we failed to detect any CD16/CD23 double-positive cells even after incubation with IL-4 (G. Delespesse, personal observation). Follicular dendritic cells, especially those localized in the light zone of germinal centers, are particularly rich in CD23 as determined on tissue sections from various lymphoid organs (88-91). However, it is not known whether CD23 is synthesized by these cells or whether it has been passively adsorbed. The expression of CD23 on a subset of follicular dendritic cells must be linked to the recent findings that sCD23, in synergy with IL-la, promotes the in uitro survival of germinal center B cells (centrocytes) that are normally programmed to die as a result of apoptosis (92). Rat and human platelets express functional IgE receptors that are involved in IgE-dependent parasite killing and mediator release (93-99). Thes receptors were found to react with the anti-CD23 Mab 135 (M. Capron, personal observation. There is growing evidence that CD23 may also be present on some epithelial cells. For example, EBV-containing nasopharyngeal carcinoma cells express type b CD23 mRNA (100). Although this will be discussed later, two recent observations should be mentioned here. First, CD23 is expressed in uiuo by a subset of thymic epithelial cells localized in the subcapsular regions. Second, a significant proportion of bone marrow stromal cells express CD23 and contain CD23 mRNA (M. D. Mossalayi, unpublished observations). Finally, by using immunohistochemical analysis, CD23 has been detected in Reed-Sternberg cells in 13out of 15 patients with Hodgkin’s disease (101).
111. Biochemical Structure
Human CD23 is a single-chain 45-kDa glycoprotein; it contains one chain of N-linked carbohydrates of the complex type, several O-linked carbohydrates, and sialic acid residues (102- 108). Immunoprecipitation studies using either anti-CD23 Mab orIgE revealed the presence of three components with masses of 60-95,45, and 37 kDa (107-109). The high-molecular-weight component is due to the formation of ag-
156
G. DELESPESSE ETAL.
gregates of the 45-kDa molecules after solubilization of the cells. Indeed, the molecules of 45 and 60-95 kDa display identical peptide maps and they share several antigenic determinants (106,109). The 37-kDa component is a breakdown product of the 45-kDa CD23. Indeed, it is O-glycosylated (indicating that it does not constitute the backbone CD23 precursor peptide) and its antigenic and peptide maps are very similar to those of the 45-kDa CD23 (108).As discussed below, the 37-kDa fragment is released in the culture supernatant of CD23bearing cells; however, in the absence of enzyme inhibitors, it is rapidly degraded into smaller molecules (110).On freshly isolated B cells, as well as on B cell lines, CD23 and its soluble fragments are phosphorylated, as shown by 32P labeling studies (M. Lefellier and G. Delespesse, personal observations). The structure of mouse CD23 is very similar to that found in humans. It is a 49-kDa glycoprotein containing two N-linked carbohydrates of the complex type, sialic acid residues, and O-linked carbohydrates (102,111-1 16). After solubilization, murine CD23 has the tendency to cross-link to itself; these polymeric CD23 complexes, formed after solubilization of the cells, were shown to be able of rebinding to IgE, whereas the monomeric soluble 49-kDa CD23 components were not. The formation of such aggregates is thought to account for the multivalency of solubilized murine CD23 (117). The N-linked carbohydrates are not required for the IgE-binding activity of CD23 (118).On human B cells, CD23 is spatially associated with HLA-DR, as shown by cross-linking studies as well as by the ability of one anti-HLA-DR antibody to coprecipitate CD23 from digitonin-solubilized B cells (119). As already mentioned, cross-inhibition studies have suggested that on Langerhans cells CD23 may be closely associated with CD1 antigen; however, structural data are missing (79). On mouse B cells, CD23 was shown to be spatially associated with membrane immunoglobulin and more particularly with IgD (67). The ability of CD23 to transmit a signal to B cells, together with the very short length of the intracytoplasmic domain of this molecule (see below), strongly suggest that CD23 may be associated with other molecule(s) involved in signal transduction. Human soluble CD23 fragments are mainly produced by the cleavage of cell surface CD23, although a small fraction of sCD23 may also be formed intracellularly by proteolytic cleavage of newly synthesized 45-kDa CD23 (109,120). Soluble CD23 exists in several molecular forms that differ in size: (1)37 kDa, cleaved at amino acid 82 of the CD23 molecule, (2) 33 kDa, cleaved at position 102, (3) 29 kDa, cleaved at position 125, and (4) 25kDa, cleaved at position 148 to 150
THE CD23 ANTIGEN
157
(110). Soluble CD23 components are first released as 37- to 33-kDa molecules that may be subsequently transformed into a stable 25-kDa fragment; this breakdown of sCD23 is specifically prevented by iodoacetamide. The culture supernatants (CSNs) of the majority of CD23bearing cell lines contain 25-kDa CD23; however, there are several exceptions. One example is the U937 macrophage cell line, whose CSN contains mainly 37- to 33-kDa sCD23. Moreover, the CSN of IL-4 stimulated normal PBMCs or purified B cells contains 37- to 33-kDa sCD23. However, independently of their origin, the 37- to 33-kDa components are rapidly transformed into 25-kDa molecules following their purification. Further analysis of these observations led to the conclusion that some CD23-bearing cells release inhibitors that prevent the degradation of the 37- to 33-kDa CD23 into 25-kDa fragments (G. Delespesse, unpublished observations). The structures of these inhibitors and their modes of action are under investigation. All the above human sCD23 molecules retain the ability to bind to IgE, albeit with a low affinity (K,= lo6 M-') as determined by equilibrium dialysis (E. Kilchherr, personal observations). The IgE-binding activity of sCD23 was initially demonstrated by (1)its binding to IgE but not to IgG immunoadsorbents, (2)its ability to inhibit rosette formation of IgE but not of IgG-coated erythrocytes with U937 cells bearing both IgE and IgG receptors, and (3)its ability to bind IgE after immobilization by means of an anti-CD23 Mab directed against an epitope located outside the IgE-binding site of the molecule (121,122). In addition to the IgE-binding molecules described above, the cleavage of CD23 also generates poorly characterized 10- to 12-kDa fragments that do not bind to IgE. Finally, it is of note that none of the human IgE-binding sCD23 fragments is N-glycosylated. Murine sCD23 is also formed by the proteolytic cleavage of surface CD23, and includes 38-, 35-,28-, and 25-kDa components. There are two major differences between human and murine sCD23: (1)murine 38- and 35-kDa sCD23 are N-glycosylated and (2) murine sCD23 does not bind to IgE. However, the latter conclusion is now being revised (67). In a recent study, purified and radiolabeled 37-kDa sCD23 and 45-kDa CD23 were used as substrates to identify the enzymes leading to the formation of 25-kDa CD23 (123). These substrates generate a 25-kDa sCD23 when incubated with several CD23-bearing cells, including CH01-7 cells (transfected with CD23 cDNA); in contrast, CD23- cells, including CHO control cells, have no effect. Highly purified native 37-kDa or recombinant 29-kDa sCD23 also cleaves the same substrates into 25-kDa fragments. These data, suggesting an
158
G. DELESPESSE ETAL.
autoproteolytic mechanism, are supported by two additional observations: (1)the sCD23 released by CH01-7 cells are cleaved exactly at the same sites as B cell-derived sCD23, and (2) some CD23 mutants have lost their proteolytic activity (G. Delespesse and H. Hofstetter, unpublished observations). IV. Regulation of CD23 Cleavage
IgE, the only known natural ligand of CD23, reduces the rate of CD23 cleavage (46,50,114,123). Some anti-CD23 Mabs may exert the same effect (124). The stabilizing effect of IgE results in an apparent up-regulation of CD23 expression; this was observed on various cell types, including normal or transformed cells. In all but one case, the ligand-induced up-regulation of CD23 is not accompanied by an increased synthesis of CD23 protein (50,114). The exception refers to one T cell line that responded to anti-CD23 Mab by an increased accumulation of CD23 mRNA (53).The cleavage of CD23 is increased by agents interfering with the N-glycosylation, including tunicamycin (an inhibitor of N-linked glycosylation) or swainsonine and castanospermine (inhibitors of the assembly of complex-type carbohydrates) (108,l 15,118).These observations are taken to indicate that any natural agent, capable of interfering with the N-glycosylation process, may exert profound and opposite effects on the production of sCD23 and the expression of membrane CD23. IFN-y has been reported to exert such opposite effects on the expression of CD23 (which is unchanged) and the release of sCD23 (which is increased) by IL-4-activated human monocytes (125). However, it has not been determined whether these effects of IFN-y are accompanied by a change of the N-glycosylation of CD23. Taken collectively, the observations summarized in this section indicate that there may be a dissociation between the expression of CD23 by a given cell and its release of sCD23. V. Regulation of CD23 Expression
A. NORMALB LYMPHOCYTES As mentioned, virtually all the freshly isolated sIgM/sIgD normal B lymphocytes express both CD23 antigen and CD23 mRNA (type a), suggesting that this molecule is constitutively expressed (20).We have reported evidence that this is not the case (126). After 24-48 hours of incubation in the absence of stimulant, highly purified normal B cells lose both CD23 mRNA and CD23 antigen, whereas soluble CD23
THE CD23 ANTIGEN
159
accumulates in the CSN. This is not due to altered cellular viability, because at the end of the incubation period the cells may be stimulated to proliferate or to reexpress CD23. The major inducer of CD23 is IL-4, which triggers the expression of both type a and type b CD23 mRNA with a predominant effect on type b (66).The effect or IL-4 is detectable after 6 hours and peaks after 36-48 hours; it is not accompanied by the activation of the cells, which remain at the Go stage of the cell cycle (1,30,34,127,128).Most interestingly, a prolonged exposure of the cells to IL-4 is required for an optimal induction of CD23. Analysis of the kinetics of IL-4 receptor internalization and recycling suggests that CD23 is mainly induced following interaction of IL-4 with the IL-4 receptors after recycling (128). As already discussed, it has been suggested that B cell activation following cognate interaction with helper T cells, in the apparent absence of cytokine release, may lead to the early expression of CD23 (33,129).However, the possibility that these T helper cells express and release locally some CD23-inducing lymphokine has not been ruled out. Moreover, it must be reiterated that the effect of CD23 inducers is amplified (superinduction) in the presence of a costimulatory signal, involving PKC activation (32,35) (see above). IL-2 was reported to up-regulate CD23 expression on normal human B cells, when used together with anti-IgM antibody, whereas IL-2 alone has no effect (21). We have confirmed these observations, but it is of note that the increased expression of surface CD23 by anti-IgM- and IL-%stimulated B cells was not accompanied by a significantly increased accumulation of sCD23 in the CSN (29). Because the effect of IL-2 has not been analyzed at the mRNA level, at least on normal B cells, it is possible that the apparent up-regulation of CD23 is due to stabilization of the CD23 molecule rather than to increased synthesis. Leukotriene B4 at 10-'oto 10 -12M synergizes with both IL-4 and 11-2 for the induction of CD23 on resting (high-density)normal B cells but not on low-density B cells. LTB4 alone has no effect and LTC4 is inactive even in the presence of IL-2 or IL-4 (130). Other investigators have recently confirmed and extended these observations on the role of autacoids in CD23 regulation (131-133). According to these preliminary studies, LTB4 and PAF are not only capable of augmenting the effect of IL-4 but also of up-regulating CD23 when used alone. IL-5 by itself does not influence CD23 expression, whereas it displays a synergistic effect with IL-4 (134,135). Recent observations in the mouse indicate that T helper (TH1) cells (which do not produce IL-4) or their CSN may induce CD23 expression on normal B cells. This activity could not be related to any known cytokine (136).Most interestingly, Sharma et al.
160
C. DELESPESSE E T A L .
(137) recently observed that recombinant low-molecular-weight B cell growth factor (LMW-BCGF) is capable of transiently inducing type b CD23 mRNA while suppressing type a CD23 mRNA accumulation in a BCGF-dependent cell line. IFN-y and IFN-a inhibit IL-4-induced expression of CD23 on normal B cells at the protein (138)and mRNA levels. Prostaglandin Ez (139) also inhibits the IL-4-induced upregulation of surface CD23; however, it is not known whether this is accompanied by a change of either the cleavage rate of CD23 or of the CD23 mRNA lead. Transforming growth factor P (TGF-P) and glucocorticoids inhibit both the cellular expression and the release of sCD23 by IL-4-stimulated B cells (140).
B. MONOCYTES AND MACROPHAGES As mentioned above, there is no formal proof that rodent macrophages are capable of expressing CD23. In normal humans, monocytes or alveolar macrophages (obtained by bronchial lavage) express little or no CD23. CD23-bearing monocytes have been described in pathological conditions associated with increased IgE levels (141)and more recently in Kawasaki disease (142). CD23 has also been found on alveolar macrophages of patients suffering from allergic asthma or from extrinsic alveolitis (64,141). In witro, normal monocytes may be induced by IL-4 to express type b CD23 mRNA and CD23 antigen and to release sCD23 (29,65,66). IFN-y increases the release of sCD23 by IL-4-stimulated monocytes. In one study, IFN-y was found to have no effect on the expression of surface CD23 by IL-4-stimulated monocytes, whereas in a more recent report it was found to exert an inhibitory effect (65,125). In the latter case it was proposed that IFN-y increases the cleavage rate of CD23, explaining its enhancing effect on the release of sCD23 (125). Our own results indicate that IFN-y alone is capable of inducing the secretion of sCD23 by normal monocytes (66). On U937 cells, IFN-y was shown to increase CD23 mRNA and CD23 antigen and the release of sCD23 (66,143,144). The autacoids PAF and LTB4 were recently reported to up-regulate CD23 expression by unstimulated or IL-4-stimulated normal monocytes as well as U937 cells (145). Interleukin-6 was also shown to enhance the expression of CD23 on U937 cells and to have a synergistic effect with IL-4 and IFN-y (146). Finally, preliminary results suggest that P-adrenergic agonists, used in the treatment of asthmatic patients, selectively increase CD23 expression by normal monocytes (B. Dugas, personal observations). If confirmed, these observations are of clinical importance because CD23 has been shown to induce the release of inflam-
THE CD23 ANTIGEN
161
matory mediators by monocytes (147-149). IFN-a inhibits both CD23 expression and the release of sCD23 by IL-4-stimulated normal monocytes but not by U937 cells (66).Other inhibitors of CD23 expression on monocytes include TGF-P, 1,25-OH-vitamin DB, and glucocorticoids (150-151a). C. OTHERCELLTYPES IFN-y and IL-4 were shown to increase the expression of IgE receptors (most likely CD23) on human platelets (98),Langerhans cells (83), and thymic epithelial cells ( M. D. Mossalayi, unpublished data). Little is known with regard to the regulation of the IgE-binding sites on eosinophils with the exception that these are increased by LTB4 and PAF (76);moreover, TGF-P inhibits CD23 expression on the Eol-3 cell line (151). D. EPSTEIN-BARR VIRUS-INDUCED CD23 EXPRESSION In vitro, EBV specifically infects normal B lymphocytes and immortalizes them into lymphoblastoid cell lines. All the EBV-transformed B cell lines are CD23+ and historically the first anti-CD23 Mabs were thought to be specific for an antigen selectively expressed on the cell surface of EBV-transformed cells (EBVCS) (5). Two EBV genes, Epstein-Barr nuclear antigen 2 (EBNA-2) and latent membrane protein 1 (LMP-l), were shown to be required for both the immortalization of normal B cells and for the induction of CD23 expression (152-154). In the most recent study, stable transfection of EBVnegative lymphoma cells indicates that EBNA-2 and LMP-1 cooperatively induce high CD23 expression (155).Single LMP-1 transfectants display an increased expression of CD23 (type b), as well as of LFA-1, LFA-3, and ICAM-1; by contrast, single EBNA-2 transfectants have an increased expression of CD23 (preferentially type a) and CD21 only. In addition to these studies, a possible role of sCD23 in the autocrine proliferation of EBV cell lines has been suggested (156-158). This was proposed following the observation that semipurified sCD23 was capable of augmenting the growth of EBV-transformed cells under appropriate culture conditions (159). However, the material used in these studies was a mixture of 25-kDa sCD23 and of an unidentified 12-kDa molecule. Moreover, as discussed below, highly purified native or recombinant sCD23 has no BCGF activity when tested alone either on EBV-transformed or on normal B cells (160). The role of CD23 and especially of sCD23 in the proliferation of EBV-transformed cells should therefore still be considered as an open question.
162
G . DELESPESSE ET AL.
VI. Molecular Biology of FcrRll
A. CLONING OF HUMAN AND MOUSEFceRII cDNA Cloning of the cDNA encoding the human FceRII/CD23 protein was simultaneously reported by three independent research groups. Kikutani et al. (20) used a combination of molecular gene transfer methodology and degenerated oligonucleotides based on protein sequencing data, whereas Ludin et al. (18)applied the hybrid-selection procedure, relying on an oocyte-expression system combined with the use of CD23-specific monoclonal antibodies. Ikuta et al. (19)used an approach that was only based on partial protein sequence information obtained by sequencing of purified CD23 protein. All three groups depended on the EBV-positive RPMI 8866 B cell line as the original source of mRNA. T h e isolated CD23-specific cDNA as well as the deduced amino acid sequence was essentially identical in all three reports. The full-length CD23 cDNA is about 1.5kb long and contains an open reading frame coding for a protein of 321 amino acid residues with a calculated molecular weight of 36,000. The cDNA predicts that the CD23 is a membrane-bound protein with a short cytoplasmic domain (23 residues) and a long extracellular domain (277 residues). A very hydrophobic stretch of 20 amino acids is located from position 24 to 44, which is reminiscent of the primary structure of a transmembrane region. Given the obvious lack of an amino-terminal signal sequence in the predicted amino acid sequence of the CD23 protein, this hydrophobic domain serves presumably also as an internal signal sequence. This special arrangement places the low-affinity receptor for IgE into the class of type I1 membrane proteins (amino terminus inside/carboxy terminus outside of the cell; see Ref. 161).The extracellular part of the FceRII/CD23 contains one consensus sequence for N-glycosylation. Tunicamycin experiments have confirmed the actual N-glycosylation of the naturally occurring CD23 molecule (108).Two groups of researchers have recently cloned the murine FceRII homolog. Bettler e t d.(45) used a low-stringency hybridization approach suggested by the cross-hybridization of the cloned human FceRII/ CD23 cDNA to genomic mouse DNA (126), whereas Gollnick et al. (162) applied a direct-expression cloning strategy in COS cells. Lipopolysaccharide- and interleukin-4-stimulated murine B cells served as the source of mRNA. The isolated cDNA and its derived amino acid sequence predict that, in analogy to its human counterpart, the murine CD23 is also a type I1 membrane protein. There is an identity of 57% at the amino acid level between the human and murine forms of the CD23. The murine sequence has an insertion of 21 amino acids, which
THE CD23 ANTIGEN
163
is probably the result of an exon duplication (see later). Furthermore, the murine CD23 is naturally truncated at its carboxy terminus, deleting an Arg-Gly-Asp motif, a common recognition site of integrin receptors. This sequence is found in its reverse configuration in human CD23 and is suspected to be involved in cellular adhesion (78). In contrast to its human homolog, the amino acid sequence of the murine CD23 contains two consensus sequences for N-linked glycosylations, which may be involed in the regulation of the FceRII protein stability (45). The availability of murine as well as human CD23 cDNA opens the possibilities for extensive “in uitro” mutagenesis and reintroduction of the mutant molecules into the cell of choice, or even into transgenic animals. These experiments will allow to further address important questions concerning the function of CD23 and its soluble fragments. Furthermore, the specificity of the murine FceRII for rodent IgE as well as the human CD23 for human IgE is an excellent basis to analyze these differences in specificities using a homolog-scanning mutagenesis approach (163).
B. HOMOLOGY OF CD23 WITH ANIMAL LECTINS In contrast to the high-affinity receptor for IgE, wherein several subunits have to be simultaneously expressed (lo), the introduction of a single species of the FceRII/CD23 cDNA in several different mammalian cell types yielded excellent expression of a functional membrane-bound IgE-specific binding molecule (18-20,45,162). It is of note that there are no similarities among the amino acid sequences of the FcrRIUCD23 and any of the subunits of the high-affinity IgE receptor. However, there is an extensive amino acid homology between CD23 and a superfamily of C-type animal lectins (164,165), including the asialoglycoprotein receptor, pulmonary surfactant apoprotein, mannose-binding proteins, cartilage proteoglycan core protein, chicken hepatic lectin, and tetranectin. Invertebrate proteins, such as a flesh-fly lectin, the sea urchin lectin echinoidin (166), and lectins from acorn barnacle (167), also belong to the family. These proteins share a region of amino acid homology of approximately 90 residues, which includes four perfectly conserved cysteines. The area can be extended toward the amino terminus to at least 120 amino acids, including two more cysteines for some members of this family. Several of these proteins bind specific carbohydrates within this particular domain in a calcium-dependent fashion (164,165). Recently, this lectin superfamily gained considerable attention by the discovery that a novel class of molecules, termed selectins (MEL-14/LAM-1, ELAM-1,
164
C. DELESPESSE E T A L
and PDAGEM/GMP-l40/CD62), have an amino-terminal lectin domain (168).These biologically important membrane proteins play crucial roles in regulating cell adhesion processes such as lymphocyte migration (169).Interestingly, the human CD23 was also implicated to play a role in cell adhesion (66,170). In addition, two lymphocyte type I1 membrane proteins share considerable amino acid homologies with CD23: the Lyb-2 antigen (171,172), a mouse B cell differentiation antigen, and A1 (173), a murine cell surface antigen that is found on some T cell lymphomas.
ANALYSISOF CD23 C. STRUCTURAL The homology of the human FcrRIUCD23 with the carbohydratebinding domain of lectins is completely contained within the 25-kDa sCD23. sCD23 contains eight cysteines, and six of them are part of the homology domain (164). In order to determine functional domains of the molecule, especially its IgE-binding site, Bettler et al. (174) constructed internal and carboxy-terminal deletion mutants that lacked the cysteines in progressive order. The CD23 mutants were stably expressed in CHO cells and were examined for IgE binding using a rosetting assay. Furthermore, the deletion mutants were tested for the binding of a panel of monoclonal antibodies that are known to inhibit the IgE binding to the CD23. The collective results of these assays delimited the binding site for IgE to a region of 128 amino acids (residues 160-287). Strikingly, the sequence homology between CD23 (residues 163-282) and the carbohydrate-binding domain in animal lectins is close to identical to the IgE-binding domain as defined b y the deletion approach. This analysis further suggests that the correct folding of the CD23 homology domain is critical for its function, because the deletion of conserved cysteines abolishes IgE binding. Recently, Vercelli et al. (175) mapped the CD23-binding site of human IgE to the C Econstant ~ region domain. These researchers used deglycosylated IgE, indicating that carbohydrates are not absolutely essential for the recognition of IgE by CD23. The role of the Cr3 domain in the binding to CD23 was confirmed by showing that one anti-IgE Mab, specific for a 10-amino acid stretch (position 367-376) in the C E domain, ~ strongly inhibits IgE binding (176). It therefore emerges that, although IgE is heavily glycosylated and the IgEbinding domain of CD23 is a lectinlike structure, CD23 is recognizing the protein moiety of IgE. The potential of the lectin module to evolve to mediate, in addition to carbohydrate recognition, protein-protein interactions is of considerable interest with respect to further examinations of the possible mechanisms by which receptors containing a
THE CD23 ANTIGEN
165
lectin motif may control cell adhesion (168,169). Regardless of its binding of carbohydrates or protein moieties or both, there are indications that the function of the lectin module may be strictly dependent on calcium ions (169,177). The structure-function analysis by Bettler et al. (174)also revealed the epitope of MHM6, a monoclonal antibody that was shown to exert growth-promoting effects of B lymphocytes (178).The binding of this antibody maps to the lectin domain of CD23, suggesting that this domain may also be involved in triggering B cell growth. It is still unclear whether CD23 is the receptor for an as-yet unknown B cell growth factor, However, the fact that the lectin domain may bind two different ligands provides exciting prospects for possible regulatory allosteric binding, possibly linking B cell growth and IgE synthesis. Finally, it is of note that the binding sites of IgE to its high-affinity receptor (FceRI) and to CD23 are located close to each other, explaining why high concentrations of sCD23 are capable of blocking the binding of IgE to mast cells/basophils (179). OF THE HUMAN FceRIUCD23 GENEAND D. GENOMIC STRUCTURE ANALYSISOF ITSTRANSCRIPTIONAL REGULATION FceRIUCD23 is encoded within the human genome by a single gene (164) that was recently located on chromosome 19 (180).The structural CD23 gene spans about 13kb and consists of 11exons. There is a good correlation between the exodintron structure and the corresponding domains of the protein. Exons 5-7 code for highly related 21-amino acid repetitive sequences, which suggests that they may have arisen by exon duplications. The mouse FceRII contains an insertion of 21 amino acids that extends this repetitive structure in the murine system even further and suggests an additional exon in the mouse FcrRII gene (45). The closely linked exons 9-11, which are separated by a large 5-kb intron from the rest of the human gene, encode sCD23. This striking division of the gene parallels the dimorphic nature of its protein product. Interestingly, the carbohydrate-binding domain of the asialoglycoprotein receptor shows exactly the same genomic arrangement as the FceRII/CD23 gene, e.g., the introns are located at exactly the same amino acid positions with respect to the homology domain, suggesting a common ancestral origin of these two genes. It is likely that the genes coding for two other members of the lectin superfamily, pulmonary surfactant apoprotein and manose-binding protein, were subsequently created by exon fusion, possibly by a reverse transcriptase-mediated event (164). It will be of great interest to fit the as-yet unknown genomic structures of other members of the lectin superfamily in this evolutionary picture. The cDNA and gene cloning,
166
G . DELESPESSE E T A L .
combined with the structural information from the deletion studies and the prediction of the disulfide bridges derived from homologous molecules (181,182), led to the prediction of good models for the secondary structure of the human and murine CD23 (67,183). Initially, Northern blot analysis revealed several CDZ3-specific mRNAs in macrophages and T cell lines that were not present in RPMI 8866 cells and normal B cells (20,52). For most of these transcripts it is still unclear whether they originate from the use of different polyadenylation signals or different processing of a common precursor. However, Yokota et al. (66) described two species of mRNA derived from the human CD23 gene, CD23a and CD23b. They differ by six amino acids at the cytoplasmic amino terminus and are generated using different cellspecific transcriptional start sites that lead to distinct 5' leader sequence in the corresponding mRNA. Given the genomic sequence encoding CD23a as a reference, the CD23b mRNA is lacking the first two exons and starts with an optional exon that is located in intron 11. CD23a is expressed in freshly isolated B cells and in B cell lines, whereas CD23b is found in several other cell types, including monocytes and eosinophils. The FceRIIb mRNA is also strongly induced b y interleukin-4 on B cells as well as monocytes and on peripheral blood lymphocytes of atopic humans. It is of note that no counterpart to the CD23b mRNA was found in the mouse. This may explain the different cellular distribution of the FceRII in the murine hematopoietic system. Suter et al. (184)identified and analyzed the promoter regulating the expression of CD23a. The CD23a-specific mRNA start site(s) were determined using primer extension as well as S 1 nuclease protection techniques, and the promoter as well as its flanking regions were sequenced. Two TATA boxes, which are important elements for the binding of the transcription machinery, were detected, each about 30 b p upstream of its corresponding CAP site. Computer-assisted sequence analysis identified four Alu sequences and two 188-bp repeat elements that form an extensive inverted repeat surrounding the CD23a promoter. The symmetrical arrangement of these repeats may allow the formation of extensive secondary structures that could be involved in the regulation of the FceRIIa expression during B cell development. The CD23a promoter was fused to a chloramphenical acetyltransferase (CAT) reporter gene and was transiently introduced into Jijoye cells, a Burkitt's lymphoma B cell line that was shown to be inducible for the expression of CD23 by the addition of interleukin-4 (53,185).This system led to the identification of several putative regulatory sequences within the CD23a promoter. Fine mapping of the promoter region showed that 190 bp 5' of the first transcription initia-
THE CD23 ANTIGEN
167
tion site are sufficient for an efficient expression in B cells. The deletion of a DNA segment containing a CCAAT motif, an element that is known to play a functional role in several polymerase I1 promoters, completely abolished the functionality of the truncated promoter. In addition, a negatively regulating element was identified further upstream in the proregion. It maps to a sequence that consists mainly of pyrimidines. Further analysis also suggested an interleukin-4responsive element within 250 bp upstream of the TATA boxes. It will be of great interest to extend these studies to the analysis of the promoter region that is regulating the CD23b expression. Studying the regulation of the CD23 gene will provide a valuable model to determine the molecular events associated with the expression of CD23 at the protein level. VII. Biological Activity of CD23
There is mounting evidence that CD23 is a multifunctional molecule, moreover, that the biological activities of membrane CD23 may be distinct from those of sCD23. A. FUNCTION OF MEMBRANE CD23 To date, the only ligand known to bind FceRIUCD23 is IgE; however, as discussed above, it is likely that other ligands do exist. The IgE-dependent functions of CD23 vary according to the cell type on which it is expressed. On monocytes, macrophages, platelets, and eosinophils, CD23 was shown to be involved in IgE-dependent cytotoxicity and mediator release (186-189). On monocytes, CD23 may also mediate the phagocytosis of IgE-coated particles (105).The IgEdependent killing of parasites by monocytes or eosinophils requires a functional association between CD23 and C D l l b (the receptor for the complement component iC3b) (190). On epidermal Langerhans cells, CD23 was shown to be capable of IgE-dependent antigen presentation to T cells (84). Most important is the observation that CD23-bearing normal murine B cells are very efficient in IgE-dependent antigen presentation to T cells (191).This observation implies that B cell CD23 is capable of internalizing IgE immune complexes. These findings have now been repeated in the human system employing EBVtransformed B cells as antigen-presenting cells (192). The B cells involved in the IgE- and CD23-dependent antigen focusing are not antigen specific; however, and most importantly, they are as efficient as sIgM-bearing antigen-specific B cells. A major difference between antigen-specific B cells and CD23-bearing B cells is that the latter are
168
G. DELESPESSE ETAL
several orders of magnitude more abundant. The prediction derived from this study is that specific IgE antibodies may amplify the antigenspecific T cell component of the immune response. An important issue is whether these antigen-presenting B cells are activated following their interaction with antigen-specific T helper cells; this would result in the production of antibodies with unrelated specifities. A possible answer to the question this poses is provided by our recent observation that cross-linking of B cell CD23 by IgE immune complexes prevents the activation and differentiation of these cells (193). The proliferative response of tonsillar B cells to anti-IgM and IL-4 is suppressed by polymeric IgE (or IgE immune complexes) as well as by F(ab)z fragments of anti-CD23 Mab. Fab fragments are inactive unless they are cross-linked by antimouse Ig antibody. The B cell proliferation following costimulation with anti-IgM (or SAC) and IL-2 (or LMW-BCGF) is not affected by CD23 cross-linking, unless the B cells have been preincubated with IL-4. Because IL-4 not only increases the density of CD23 on the cell surface but also induces CD23 type b (which is not expressed on resting B cells), it is possible that the inhibition results from the cross-linking of type b CD23. In any case, these observations predict that IgE immune complexes may prevent the recruitment of new IgE-secreting cells from their sIgM/sIgD/CD23 precursor B cells. This view is supported by the finding that the addition of polymeric IgE to IL-4-stimulated PBMCs strongly inhibits their IgE response (G. Delespesse, unpublished observations). The IgE- and CD23mediated expansion of the pool of antigen-specific T helper cells, together with the paralyzing effect of IgE Immune complexes on such B cells, may be viewed not only as a negative-feedback mechanism of IgE synthesis but also as a mechanism whereby the production of the other isotypes may be favored. Indeed, the increased number of antigen-specific T helper cells may activate only CD23- B cells (switched to IgG or IgA) or CD23-low B cells, which are not exposed to IL-4 and therefore will not switch to IgE. The T helper cells might also stimulate IgE memory B cells and thereby amplify the specific IgE antibody response. However, in the murine model, the role of IgE memory B cells in secondary or prolonged IgE responses appears to be minimal (194). Whereas our observations indicate that cross-linking of CD23 is most efficient in preventing the proliferation/differentiation of precursor B cells, Saxon and colleagues (195) reported that cross-linking of CD23 (by IgE immune complexes or anti-CD23 Mab) directly suppresses the ongoing synthesis of IgE by a subclone of U266 myeloma cells, coexpressing surface IgE and CD23. The spontaneous in vitru synthesis of
T H E CD23 ANTIGEN
169
IgE by B cells of atopic donors is inhibited in a similar fashion. The suppression of IgE is isotype specific and it is not accounted for by an antiproliferative effect. The data were taken to indicate that CD23 cross-linking on IgE-secreting cells specifically inhibits the synthesis/ secretion of IgE. These observations are, however, difficult to reconcile with the fact that CD23 is lost after switching, including to IgE (13). It has been proposed that CD23 is closely related to the B cell receptor for LMW-BCGF (34,196,197); however, as reviewed elsewhere, this concept is now abandoned (126).The molecular structure of CD23 suggests that it may be involved in cellular adhesion. This possibility was recently supported by the observation that various cell lines start to form cellular aggregates after transfection with CD23 cDNA (179). Two other functional properties of membrane CD23 have been reported. Yodoi and co-workers (198,199) described a positive interaction between CD23 and the a chain of IL-2-R (p55). Cross-linking of CD23 by means of anti-CD23 Mab together with goat antimouse antibodies up-regulates the expression of IL-2-R/p55 on a number of human cell lines, including a stable CD23 transfectant. Conversely, the binding of IL-2 to its B cell receptor augments the expression of CD23. Most interestingly, the cross-linking of CD23 by IgE immune complexes up-regulates the expression of class I1 MHC molecules by mouse B lymphocytes. This finding should be related to the role of CD23 in antigen presentation (199a). Transduction through CD23 was recently analyzed in SAC plus IL-4-stimulated human B lymphocytes (200).This study suggests that CD23 may be connected to the phosphoinositide signaling pathway by a GTP-dependent component that is insensitive to pertussis toxin. Preliminary results from Yodoi and co-workers further suggest that CD23 is associated with a protein tyrosine kinase (K. Jugie and J. Yodoi, unpublished observations).
B. FUNCTION OF SOLUBLE CD23 There is increasing evidence that sCD23 may exert several effects, either alone or in synergy with other cytokines, on a large variety of hematopoietic cells. In synergy with IL-1, sCD23 may be viewed as a differentiating factor for early thymocytes, myeloid cell precursors, and some germinal center B cells. Additional activities ascribed to sCD23 include (1)the regulation of IgE synthesis, (2)the promotion of B and T cell growth, and (3)the inhibition of monocyte migration.
170
G . DELESPESSE E T A L .
1 . Effect of sCD23 on Human T Cell Precursors The differentiation of very early T cell precursors (TCRCD7+2-3-4-8-; see Refs. 201-203) into functionally active TCR+ CD2+3+4+/8+lymphocytes is a complex process mediated by cellular interactions between thymocytes and stromal cells as well as soluble cytokines (204). Initial studies aiming to analyze the role of soluble factors in the differentiation of CD7+ precursors revealed that the culture supernatant of activated non-T cells contained the differentiating activity. The latter could be ascribed to IL-1 and another molecule sharing several structural features with sCD23 (202). More recently, Mossalayi et al. (205) demonstrated that after sequential incubation with IL-1 followed by recombinant 25-kDa sCD23, CD7' precursors are induced to express CD2, CD3, TCRaP, CD4, or CD8. The possible physiological significance of these findings is suggested by the observation (M. D. Mossalayi and A. H. Dalloul, unpublished observations) that a subset of cultured thymic epithelial cells express CD23 mRNA and release sCD23 following stimulation with IL-4 and/ or IFN-7. More importantly, in situ hybridization reveals that CD23 mRNA is expressed in the subcapsular region (outer cortex) of the thymus, a region known to contain very early thymocytes.
2. Effect of sCD23 on T Cell Proliferation It has been suggested that CD23 and sCD23 play an accessory role in T cell response to mitogens and allogeneic or autologous I3 cells (47). More recent observations indicate that pretreatment of CD4+ T cells with both IL-1 and sCD23 increase their subsequent response to CD2 triggering (206). Similarly, the mitogen-induced proliferation of CD4+ T cells, known to require cellular interactions with HLA-DR+ accessory cells, is strongly inhibited by anti-CD23 Mab. The data were taken to suggest that CD23, and sCD23 may play an accessory role in T cell activation. 3. Effect of sCD23 on Early Myeloid Precursors Recombinant sCD23 also promotes the proliferation of IL-1-treated CD34+ early myeloid precursors (207). The proliferation is inhibited by anti-CD23 Mab but not by anti-IL-3. Myeloid colonies obtained following stimulation with sCD23 have the same composition as those generated by IL-3, including a significant proportion of basophilic cells. These IL-3-like effects of sCD23 may be physiologically significant. Indeed, several investigators failed to detect IL-3 mRNA in bone marrow-derived stromal cells, although these cells are known to sup-
THE CD23 ANTIGEN
171
port stem cell growth. In contrast, many stromal cells contain CD23 mRNA and express CD23 on their surface (M. D. Mossalayi, unpublished observation). Because 40-50% of sCD23-induced colonies contained basophilic cells, it is possible that sCD23 may also contribute, in pathological conditions, to the local differentiation of basophils/ mast cells in epithelial surfaces, which are known to contain CD23bearing Langerhans cells. 4 . Effect of sCD23 on Germinal Center B Cells Germinal centers are composed of proliferating cells (i.e., centroblasts) generating nondividing cells (i.e., centrocytes). Purified centrocytes die as a result of apoptosis, a programmed process involving the activation of endonucleases. Recent data (92)demonstrate that centrocytes may be rescued in the presence of both IL-la and recombinant 25-kDa sCD23; as a result of this treatment, centrocytes differentiate into plasmacytoid cells. The in vivo relevance of these findings is supported by the high density of CD23 on a subset of follicular dendritic cells located at the same place as the centrocytes, i.e., in the light zone of the germinal centers.
5. Effect of sCD23 on Macrophage Migration The addition of purified sCD23 to U937 monocytic cells inhibits their spontaneous migration; this effect is specific inasmuch as it is neutralized by anti-CD23 Mab (208). It would be interesting to know whether sCD23 exerts the same effect on normal monocytes/ macrophages and whether this is accompanied by an activation or differentiation process. 6. Effect of sCD23 on B Lymphocyte Proli$eration This issue remains controversial in spite of several recent studies employing recombinant sCD23 and Mabs. Three independent groups of investigators provided evidence suggesting that sCD23 is a B cell growth factor. In the initial study, affinity-purified sCD23 was found to promote the proliferation both of anti-IgM-activated normal B cells and of EBV-transformed cells (159). However, the purified material contained a 12-kDa protein in addition to the 25-kDa sCD23, and, moreover, it was comitogenic for PHA-stimulated murine thymocytes, a property of IL-1. Both the BCGF and the IL-l-like activities were abolished by adsorption on an anti-CD23 column. It was suggested that sCD23 alone or in association with the 12-kDa protein has BCGF
172
G . DELESPESSE ETAL.
activity. A second group of investigators subsequently reported that highly purified native or recombinant 25-kDa sCD23 was able to induce the proliferation ofphorbol ester-activated B cells (209)and ofthe marmoset BY5-8 lymphoblastoid cell line (210).They next showed that intact 45-kDa CD23 [purified from cell lysates in the presence of the enzyme inhibitor l-chloro-3-tosylamido-7-amino-2-heptanone hydrochloride (TLCK)] was more active and yielded more reproducible results than the soluble 25-kDa fragment (211). However, the activity of the sCD23 could not be blocked b y anti-CD23 Mab, whereas the neutralizing effect of this antibody on the intact 45-kDa CD23 was not reported. A third group of researchers found that CD23-bearing normal human B cells were capable of improving the proliferative response of CD23cells to various stimulants. The activity was ascribed to both CD23 and its soluble fragments (212). Our laboratory was able to confirm that affinity-purified sCD23 (containing 33- and 25-kDa sCD23 as well as a 12-kDa protein) is capable of increasing the proliferation of anti-IgMactivated B cells (126).However, in keeping with another recent study (160), we failed to detect any BCGF activity of highly purified native or recombinant 37- or 25-kDa sCD23, neither on preactivated normal B cells nor on several B cell lines. Similarly, cocultivation of irradiated CHO cells transfected with CD23 cDNA failed to increase the proliferation of anti-IgM-pulsed B cells without altering their response to IL-4 or other growth-promoting cytokines (193).
7 . Effect of sCD23 on the Synthesis of Human ZgE Our initial studies have indicated that the IgE-binding molecules released by CD23-bearing B cells are capable of increasing the spontaneous in uitro synthesis of IgE by in uiuo preactivated B cells present in the blood of allergic donors (17,213). These IgE-binding molecules were subsequently found to be identical to sCD23 (121,214). The possible role of CD23 or of its soluble fragments in the regulation of IgE synthesis has been confirmed by the observation, made in several laboratories, that some anti-CD23 Mabs are capable of suppressing, in an isotype-specific manner, the IL-4-induced synthesis of IgE by normal lymphocytes as well as the spontaneous IgE production by lymphocytes of allergic donors (122,124,139,215). Three nonmutually exclusive mechanisms may be considered to explain the inhibiting effect of anti-CD23 antibodies or of their F(ab’)n fragments: (1)they prevent the differentiation of IgM precursor B cells b y crosslinking CD23 on their cell surface, (2) they trigger CD23-bearing
THE CD23 ANTIGEN
173
accessory cells to release inhibitors of IgE synthesis, and (3) they neutralize the IgE-potentiating activity of sCD23. As discussed in the previous section, the first mechanism is probably sufficient to explain the inhibition of the IL-4-induced IgE synthesis by normal lymphocytes. However, cross-linking of CD23 on either B cells or on accessory cells does not account for the inhibition ofthe ongoing synthesis of IgE by lymphocytes of allergic patients. Indeed, IgE B cells are CD23and monovalent Fab fragments of anti-CD23 are as active as the intact antibodies (216). These data, providing indirect evidence for the IgEpotentiating activity of sCD23, are in keeping with the recent finding of a parallelism between the ability of several anti-CD23 Mabs to inhibit IgE synthesis and to prevent the cleavage of membrane CD23 (124). The direct demonstration of the IgE-potentiating activity of sCD23 has been most difficult for the following two reasons: (1)in the usual culture conditions employed to analyze IgE synthesis, the endogenous production of sCD23 is more than sufficient, and (2) the active molecule is the unstable 37-kDa sCD23. The ability of sCD23 to augment the synthesis of human IgE has been confirmed by a number of investigators (134,135,217).For example, deVries and co-workers reported that the synthesis of IgE induced by suboptimal concentrations of IL-4 was strongly increased in the presence of exogenous native or recombinant sCD23 (134,218). In our preliminary reports (219) we have indicated that highly purified native 37-kDa (but not 25-kDa) sCD23 enhanced both the IL-4-induced synthesis and the spontaneous synthesis of IgE by lymphocytes that have been largely depleted of monocytes (to minimize the endogenous production of sCD23). In order to better assess the activity of the unstable 37-kDa molecule, we next developed a coculture system wherein various types of irradiated CHO transfectants were cultured together with human lymphocytes. Transfectants expressing wild-type CD23 or secreting 37-kDa (but not 25-kDa) sCD23 strongly increased the synthesis of IgE by IL-4-stimulated lymphocytes. More recently we have developed a stable, recombinant 29-kDa molecule that has a very strong IgE-potentiating activity (216). The availability of this molecule should permit analysis of the mode of action of sCD23 at the cellular and molecular levels. It is interesting to note that this 29-kDa sCD23 is also capable of cleaving both radioiodinated 37- and 45-kDa CD23 into 25-kDa molecules, suggesting that it may have some proteolytic activity (123a). Finally, there is no experimental evidence that the IgE-potentiating effect of sCD23 is related to its IgE-binding property.
174
G. DELESPESSE ETAL
VIII. CD23 Expression in Various Clinical Conditions
A. NORMAL INDIVIDUALS In healthy individuals the serum level of sCD23 (ranging from 0.2 to 3 ng/ml) remains stable over a long period of time, indicating that it is not affected by environmental factors. It is not correlated with serum IgE concentration, whereas it is clearly influenced by age, with children having higher values than adults (220,221). Neonatal sera contain more sCD23 than the corresponding maternal sera (G. Delespesse, unpublished observations). As indicated in the previous sections, CD23 is found at low levels on the majority of mature resting B cells, and freshly isolated PBMCs express only type a CD23 mRNA.
B. ALLERGIC DISEASES In atopic patients CD23 is overexpressed on B cells and on monocytes (62,141,222,223); freshly isolated PBMCs express the two isoforms of CD23 (66,179). Serum sCD23 levels are significantly higher than in age-matched healthy individuals, but there is an overlap between the two groups (220,221). The levels of sCD23 are weakly but significantly correlated with those of IgE. Serum sCD23 is not bound to IgE. High levels of serum sCD23 are also found in patients with parasitic diseases associated with elevated serum IgE (224). The overexpression of CD23, and particularly of the type b isoform, is best explained by an imbalance in the production of IL-4 and IFN-7. CD23 may contribute to the pathogenesis of atopic diseases at two levels: (1)IgE regulation and (2) IgE-dependent mediator release by monocytes and other inflammatory cells. C. HYPOGAMMAGLOBULINEMIA Patients with common variable immune deficiency (CVID) have normal or elevated serum sCD23 levels (G. Delespesse and A. Saxon, unpublished observations). On B cells the expression of CD23 varies from undetectable to normal (12,13,50). There is preliminary evidence that the serum CD23 level increases following intravenous immunoglobulin therapy (225). It is likely that additional studies on CD23 expression will permit a better classification of this heterogeneous group of patients. D. AUTOIMMUNEDISEASES The number of circulating CD23-bearing B cells is increased in patients with rheumatoid arthritis (RA) but not in those with systemic
THE CD23 ANTIGEN
175
lupus erythematosus (226). In agreement with this study, we have observed elevated levels of sCD23 in the serum and more importantly in the synovial fluid of these patients (G. Delespesse and J.P. Pelletier, personal observations). The potential significance of these observations is currently analyzed.
E. LYMPHOPROLIFERATIVE DISEASES Malignant proliferation of sIgM/sIgD B cells, leading to B cell chronic lymphocytic leukemia (B-CLL)or small cell lymphocytic lymphoma (SLL), is accompanied by a markedly increased serum sCD23 level. The serum of B-CLL patients contains 3-500 times more sCD23 than does the serum of normal individuals or of patients with other lymphoproliferative diseases. Moreover, the level of sCD23 is correlated with the clinical stage of the disease (227). The accumulation of sCD23 in the serum of B-CLL patients results not only from the increased number of CD23-bearing B cells but also from the overexpression of CD23 on the surface of these cells (22). In spite of some controversy, there is no correlation between the density of CD23 on B-CLL cells and the clinical stage (228-231). The expression of CD23 on B-CLL cells is not constitutive, inasmuch as, like normal B cells, the malignant cells lose CD23 and CD23 mRNA when incubated in the absence of stimulant (22). However, by opposition to fresh normal B cells (which contain only type a CD23 mRNA), highly purified B-CLL B cells contain the two isoforms of CD23 mRNA (228). As indicated above, IL-4 is the only agent known to induce type b CD23 on normal B cells. However, the response of B-CLL B cells to IL-4 is drastically reduced when compared to normal B cells. Other factors are therefore responsible for the in v i m overexpression of CD23 in this disease. IL-2 was reported to up-regulate CD23 on B-CLL and normal B cells (21); however, in vitro stimulation with various concentrations of IL-2 (with or without IL-4) fails to reconstitute the high levels observed on freshly isolated cells. It is therefore concluded that, in addition to IL-4 and IL-2, other factors are involved in the up-regulation of CD23 in B-CLL disease. The characterization of these factors and the possible clinical significance of CD23 overexpression in B-CLL are under investigation. Patients with hairy cell leukemia may display a moderately increased level of serum sCD23; most interestingly, the latter is strongly reduced during and after successful therapy with IFN-a. It has been proposed that the measurement of sCD23 may be used as an index to monitor the clinical response to IFN-a (232).
176
G. DELESPESSE E T A L .
IX. Conclusions
The structure of CD23 is now well characterized at the molecular and protein levels. In contrast, our knowledge regarding the function of this molecule or of its soluble fragments should still be considered as incomplete and preliminary. It is probably premature to conclude that CD23 and sCD23 are multifunctional molecules with an activity profile comparable to interleukins. Indeed, in spite of the increasing number of well-documented publications, most of the biological activities ascribed to these molecules were reported by only one group of investigators. Moreover, with only one exception (the IgE- dependent antigen focusing to T cells), the biological activities of CD23 and sCD23 were found in the human but not in the mouse model. For example, all the available evidence indicates that in the mouse, CD23 and sCD23 have no role in IgE regulation. It must be determined whether the discrepancy between the two models is due to technical reasons (as was the case for the IgE-binding activity of sCD23) or to a fundamental difference between the two species. Is this discordance related to the inability of mouse cells to express type b CD23? T h e latter observation was taken to explain the lack of CD23 expression by any mouse cell different from the conventional mature B lymphocytes (sIgM dull, sIgD bright, and CD5-). The earlier observations that rodent monocytes/macrophages display functional IgE-specific binding sites must be reconciled with the findings that these cells cannot express CD23. Are these IgE-binding sites related to MAC-2antigens or to a new family of IgE-binding proteins? The structure of CD23 predicts both a lectin activity and a role in cellular adhesion. However, this view requires more experimental support, and, moreover, the binding to IgE (the only biological activity documented in uiuo) does not require carbohydrate interactions. Interestingly, all the well-documented functions of CD23 (antigen presentation, parasite killing, and mediator release) are IgE dependent whereas most of the functions ascribed to sCD23 are clearly IgE independent (maturation of thymocytes, myeloid precursors, and centrocytes). As already mentioned, it is not known whether the IgEpotentiating activity of human sCD23 requires the binding of this molecule to IgE. Current studies are aiming to characterize the binding sites of sCD23 on their target cells and the mechanisms of synergy with IL-1. A unique feature of CD23 is its autoproteolysis into soluble fragments; however, this model is based on strong but indirect evidence. The direct assessment of this concept and of the localization of the active site is under way. It is anticipated that the availability of
THE CD23 ANTIGEN
177
molecular probes, recombinant stable molecules, and monoclonal antibodies will allow a better definition of the biology of this intriguing molecule. ACKNOWLEDGMENTS The contribution ofC. Delespesse and M. Sarfati was supported by grants from MRC, Canada. The authors gratefully acknowledge the following investigators for providing access to unpublished results: Dr. J.Y. Bonnefoy, Dr. B. Dugas, Dr. J. Gordon, Dr. T. Waldschmidt, Dr. D. Conrad, and Dr. J. Yodoi. The authors also with to thank A. Allard for literature retrieval and sorting, and Norma Del Bosco for excellent secretarial assistance.
REFERENCES 1. Bonnefoy, J. Y., Aubry, J. P., Peronne, C., Wijdenes, J., and Banchereau, J. (1987). Production and characterization of a monoclonal antibody specific for the human lymphocyte low affinity receptor for IgE: CD23 is a low affinity receptor for IgE. J . Immunol. 138,2970-2978. 2. Yukawa, K., Kikutani, H., Owaki, H., Yamasaki, K., Yokota, A., Nakamura, H., Barsumian, E. L., Hardy, R. R., Suemura, M., and Kishimoto, T. (1987). A B cell-specific differentiation antigen, CD23, is a receptor for IgE (Fc epsilon R) on lymphocytes. J . Immunol. 138,2576-2580. 3. Lawrence, D. A., Weigle, W. O., and Spiegelberg, H. L. (1975). Immunoglobulins cytophilic for human lymphocytes, monocytes, and neutrophils. J . Clin. Invest. 55, 368-387. 4. Gonzalez-Molina, A., and Spiegelberg, H. L. (1976). Binding of IgE myeloma proteins to human cultured lymphoblastoid cells. J . Immunol. 117, 1838-1845. 5. Kintner, C., and Sugden, B. (1981). Identification of antigenic determinants unique to the surfaces of cells transformed by Epstein-Barr virus. Nature, (London)294, 458-460. 6. Sugden, B., and Metzenberg, S. (1983). Characterization of an antigen whose cell surface expression is induced by infection with Epstein-Barr virus. J . Virol. 46, 800-870. 7. Thorley-Lawson, D. A., Nadler, L. M., Bhan, A. K., and Schooley, R. T. (1985). BLAST-2 (EBVCS), an early cell surface marker of human B cell activation, is superinduced by Epstein-Barr virus. J . Immunol. 134,3007-3012. 8. Liu, F. T. (1990). Molecular biology of IgE-binding proteins, IgE-binding factors, and IgE receptors. CRC Crit. Rev. Immunol. 10,289-306. 9. Ishizaka, K. (1988). IgE-binding factors and regulation of the IgE antibody response. Annu. Rev. Immunol. 6,513-534. 10. Blank, U., Ra, C., Miller, L., White, K., Metzger, H., and Kinet, J. P. (1989). Complete structure and expression in transfected cells of high affinity LgE receptor. Nature (London)337,187-189. 11. Waldschmidt, T. J., Conrad, D. H., and Lynch, R. C . (1989). Expression of B cell surface receptors. 11. IL-4 can accelerate the developmental expression of the murine B cell IgE Fc receptor. I . Immunol. 143.282q-2827.. 12. Suemura, M., Kikutani, H., Barsumian, E. L., Hatton, Y., Klshimoto, S., Sato, R., Maeda, A., Nakamura, H., Owaki, H., Hardy, R. R.,and Kishimoto, T. (1986). Monoclonal anti-Fc epsilon receptor antibodies with different specificities and studies on the expression of Fc epsilon receptors on human B and T cells. 1.Immunol. 137,1214-1220.
178
G. DELESPESSE ET A L
13. Kikutani, H., Suemura, M., Owaki, H., Nakamura, H., Sato, R., Yamasaki, K., Barsumian, E. L., Hardy, R. R., and Kishimoto, T. (1986). Fc epsilon receptor, a specific differentiation marker transiently expressed on mature B cells before isotype switching. J . E r p . Med. 164,1455-1469. 14. Waldschmidt, T. J., Conrad, D. H., and Lynch, R. G . (1988). The expression of B cell surface receptors. I. The ontogeny and distribution of the murine B cell IgE Fc receptor. J . lmmunol. 140,2148-2154. 15. Deleted. 16. Hudak, S. A., Gollnick, S. O., Conrad, D. H., and Kehry, M. R. (1987). Murine B-cell stimulatory factor 1 (interleukin 4) increases expression of the Fc receptor for IgE on mouse B cells. Proc. Natl. Acad. Sci. U.S.A. 84,4606-4610. 17. Sarfati, M., Rector, E., Wong, K., Ruhio-Trujillo, M., Sehon, A. H., and Delespesse, G. (1984). In oitro synthesis ofIgE by human lymphocytes. 11. Enhancement ofthe spontaneous IgE synthesis by IgE-binding factors secreted by RPMI 8866 lymphoblastoid B cells. Immunology 53, 197-205. 18. Ludin, C., Hofstetter, H., Sarfati, M., Levy, C. A., Suter, U., Alainio, D., Kilchherr, E., Frost, H., and Delespesse, G. (1987). Cloning and expression of the cDNA coding for a human lymphocyte IgE receptor. EMROJ.6,109-114. 19. Ikuta, K., Takami, M., Kim, C. W., Honjo, T., Miyoshi, T., Tagaya, Y., Kawabe, T., and Yodoi, J. (1987). Human lymphocyte Fc receptor for IgE: Sequence homology of its cloned cDNA with animal lectins. Proc. Natl. Acad. Sci. U.S.A.84,819-823. 20. Kikutani, H., Inui, S., Sato, R., Barsumian, E. L., Owaki, H., Yamasaki, K., Kaisho, T., Uchibayashi, N., Hardy, R. R., Hirano, T., and Kishimoto, T. (1986). Molecular structure of human lymphocyte receptor for immunoglobulin E. Cell.(Cambridge, Mass.)47,657-656. 21. Hivroz, C., Valle, A., Brouet, J. C., Banchereau, J., and Grillot-Courvalin, C. (1989). Regulation by interleukin 2 of CD23 expression of leukemic and normal B cells: Comparison with interleukin 4. Eur. J . lmmunol. 19, 1025-1030. 22. Sarfati, M., Fournier, S., Christoffersen, M., and Biron, G. (1990). Expression of CD23 antigen and its regulation by IL-4 in chronic lymphocytic leukemia. Leuk. RCS.14,47-55. 23. Hayakawa, K., and Hardy, R. R. (1988). Normal, autoimmune and malignant CD5+ B cells: The Lyl+ B lineage. Annu. Reo. lmmunol. 6,197-218. 24. Waldschmidt. T. J., Kroese, F. G. M., Tygrett, L. T., Conrad, D. H., and Lynch, R. G. (1990). The expression of B cell surface receptors. 111. The murine low affinity IgE Fc receptor is not expressed on Lyl or Lyl like B cells. (Submitted for publication.) 25. Kehry, M. R., and Hudak, S . A. (1989). Characterization of B-cell populations bearing Fc epsilon receptor 11. Cell. lmmunol. 118,504-515. 26. Lebrun, P., Sidman, C. L., and Spiegelherg, H. L. (1988). IgE formation and Fc receptor-positive lymphocytes in normal, imrnuno-deficient, and auto-immune mice infected with Nippostrongylus brasiliensis. J . Immunol. 141,249-257. 27. Defrance, T., Vanbervliet, B., Durand, I., and Banchereau, J. (1989). Human interleukin 4 down-regulates the surface expression of CD5 on normal and leukemic B cells. Eur.J. lmmunol. 19,293-299. 28. Gadol, N., and Ault, K. A. (1986). Phenotypic and functional characterization of human LEU1 (CD5) B cells. lmmunol. Reo. 93,23-39. 29. Delespesse, G . ,Sarfati, M., and Peleman, R. (1989). Influence of recombinant IL-4, IFN-alpha, and IFN-gamma on the production of human IgE-binding factor (soluble CD23).J. lmmunol. 142, 134-138.
THE CD23 ANTIGEN
179
30. Walker, L., Guy, G., Brown, G., Rowe, M., Milner, A. o., and Gordon, (1986). Control of human B-lymphocyte replication. I. Characterization of novel activation states that precede the entry of Go B cells into cycle. Immunology 58,583-589. 31. Gordon, J., Webb, A. J., Guy, G. R., and Walker, L. (1987).Triggering of B lymphocytes through CD23: Epitope mapping and studies using antibody derivatives indicate an allosteric mechanism of signalling. Immunology 60,517-521. 32. Chartash, E. K., Crow, M. K., and Friedman, S. M. (1989). Biochemical basis of synergy between antigen and T-helper (Th) cell-mediated activation of resting human B cells. J . Clin. lnuest. 84, 1410-1417. 33. Crow, M. K., Kushner B., Jover, J. A., Friedman, S. M., Mechanic, S. E., and Stohl, W. (1989). Human peripheral blood T helper cell-induced B cell activation results in B cell surface expression of the CD23 (BLAST-2)antigen. Cell. lmmunol. 121, 99-112. 34. Gordon, J., Rowe, M., Walker, L., and Guy, G. R. (1986). Ligation of the CD23,p45 (BLAST-2,EBVCS) antigen triggers the cell-cycle progression of activated B lymphocytes. Eur. J . Immunol. 16, 1075-1080. 35. Conrad, D. H., Keegan, A. D., Kalli, K. R., Van Dusen, R., Rao, M. and Levine, A. D. (1988). Superinduction of low affinity IgE receptors on murine B lymphocytes by lipopolysaccharide and IL-4. J . lmmunol. 141,1091-1097. 36. Young, M. C., Leung, D. Y., and Geha, R. S. (1984).Production ofIgE-potentiating factor in man by T cell lines bearing Fc receptors for IgE. Eur. J . lmmunol. 14, 871-878. 37. Yodoi, J.. and Ishizaka, K. (1979). Lymphocytes bearing Fc receptors for IgE. I. Presence of human and rat T lymphocytes with Fc epsilon recept0rs.J. Zmmunol. 122,2577-2583. 38. Yodoi, J., Ishizaka, T., and Ishizaka, K. (1979). Lymphocytes bearing Fc receptors for IgE. 11. Induction of Fc epsilon-receptor bearing rat lymphocytes by IgE. J . Immunol. 123,455-462. 39. Yodoi, J., and Ishizaka, K. (1979). Lymphocytes bearing receptors for IgE. 111. Transition of Fc gamma R(+) cells to Fc epsilon R cells by IgE. J. Immunol. 123, 2004-2010. 40. Yodoi, J., and Ishizaka, K. (1980).Induction of Fc epsilon-receptor bearing cells in uitro in human peripheral lymphocytes. J. Immunol. 124,934-938. 41. Spiegelberg, H. L., Thompson, L. F., McNeil, D., and Buckley, R. H. (1985).IgE Fc receptor positive T, B and NK cells in patients with the hyper-IgE syndrome. Int. Arch. Allergy Appl. Immunol. 77,277-279. 42. Chen, S. S., Bohn, J . W., Liu, F. T., and Katz, D. H. (1981). Murine lymphocytes expressing Fc receptors for IgE (FcR epsilon). I. Conditions for inducing FcR epsilon+ lymphocytes and inhibition of the inductive events by suppressive factor of allergy (SFA).J. lmmunol. 127, 166-173. 43. Mathur, A., Maekawa, S., Ovary, Z., and Lynch, R. G. (1986). Increased T epsilon cells in BALBIc mice with an IgE-secreting hybridoma. Mol. lmmunol. 23,11931201. 44. Thompson, L. F., Spiegelberg, H. L., and Buckley, R. H. (1985). IgE Fc receptor positive T and B lymphocytes in patients with the hyper IgE syndrome. C h . E x p . lmmunol. 59,7744. 45. Bettler, B., Hofstetter, H., Rao, M., Yokoyama, W. M., Kilchherr, F., and Conrad, D. H. (1989). Molecular structure and expression of the murine lymphocyte lowaffinity receptor for IgE (Fc epsilon RII). Proc. Natl. Acad. Sci. U.S.A. 86, 75667570.
180
G . DELESPESSE E T A L
46. Delespesse, G., Sarfati, M., Rubio-Trujillo, M., and Wolowiec, T. (1986). IgE receptors on human lymphocytes. 11. Detection of cells bearing IgE receptors in unstimulated mononuclear cells by means of a monoclonal antibody. Eur.J.Zmmunol. 16,815-821. 47. Armitage, R. J., Goff, L. K., and Beverley, P. C. (1989).Expression and functional role of CD23 on T cells. Eu7.J. Zmmunol. 19,31-35. 48. Nagai, T., Adachi, M., Noro, N., Yodoi, J., and Uchino, H. (1985).T and B lymphocytes with immunoglobulin E Fc receptors (Fc epsilon R) in patients with nonallergic hyperimmunoglobulinemia E: Demonstration using a monoclonal antibody against Fc epsilon R-associated antigen. Clin. Immunol. Zmmunoputhol. 35,261275. 49. Prinz, J. C., Endres, N., Rank, G., Ring, J., and Rieber, E. P. (1987). Expression of Fc epsilon receptors on activated human T lymphocytes. Eur. J . Zmmunol. 17, 757-761. 50. Delespesse, G., Sarfati, M., Rubio-Trujillo, M., and Wolowiec, T. (1986). IgE receptors on human lymphocytes. 111. Expression of IgE receptors on mitogenstimulated human mononuclear cells. Eur. J . Zmmunol. 16, 1043-1047. 51. Nutman, T. B., Delespesse, G., Sarfati, M., and Volkman, D. J. (1987). T-cellderived IgE-binding factors. I. Cloned and transformed T cells producing IgEbinding factors. J. lmmunol. 139,4049-4054. 52. Sarfati, M., Nutman, T. B., Suter, U., Hofstetter, H., and Delespesse, G . (1987). T-cell-derived IgE-binding factors. 11. Purification and characterization of IgEbinding factors produced by human T cell leukemia/lymphoma virus-ltransformed T lymphocytes. J . Zmmunol. 139,4055-4060. 53. Kawabe, T., Takami, M., Hosoda, M., Maeda, Y., Sato, S., Mayumi, M., Mikawa, H., Arai, K., and Yodoi, J. (1988).Regulation of Fc epsilon R2/CD23 gene expression by cytokines and specific ligands (IgE and anti-Fc epsilon R2 monoclonal antibody). Variable regulation depending on the cell types. J. Zmmunol. 141, 13761382. 54. Carini, C., Margolick, J., Yodoi, J., and Ishizaka, K. (1988). Formation of IgEbinding factors by T cells of patients infected with human immunodeficiency virus type 1. Proc. Natl. Acad. Sci. U.S.A. 85,9214-9218. 55. Carini, C., Margolick, J., Yodoi, J., and Ishizaka, K. (1988). Formation of IgEbinding factors by lymphocytes of HIV-infected patients. Znt. Arch. Allergy Appl. Immunol. 88, 116-1 18. 56. Prinz, J. C., Bauer, X., Mazur, G., and Rieber, E. P. (1990). Allergen-directed expression of Fc receptors for IgE (CD23) on human T lymphocytes is modulated by interleukin 4 and interferon-y. Eur. J . Zmmunol. 20, 1259-1264. 57. Nonaka, M., Hsu, D. K., Hanson, C. M., Aosai, F., and Katz, D. H. (1989).Cloning of cDNA coding for low-affinity Fc receptors for IgE on human T lymphocytes. Znt. Zmmunol. 1,254-259. 58. Rao, M., Lee, W. T., and Conrad, D. H. (1987).Characterization of a monoclonal antibody directed against the murine B lymphocyte receptor for IgE. J . Zmmztnol. 138,1845-1851. 59. Mathur, A., Conrad, D. H., and Lynch, R. G . (1988).Characterization of the murine T cell receptor for IgE (Fc epsilon RII). Demonstration of shared and unshared epitopes with the B cell Fc epsilon RII.]. Zmmunol. 141,2661-2667. 60. Lynch, R. C., Mathur, A., Waldschmidt, T. J.,Sandor, M., Mueller, A., and Johanns, P. (1988). Immunoglobulin (Fc)receptors on murine T- and B-lumphocytes: Investigations using tumor models. Mol. Immunol. 25, 1151-1157.
THE CD23 ANTIGEN
181
61. Melewicz, F. M., and Spiegelberg, H. L. (1980). Fc receptors for IgE on a subpopulation of human peripheral blood monocytes. J . Immunol. 125, 1026-1031. 62. Melewicz, F. M., Zeiger, R. S., Mellon, M. H., O’Connor, R. D., and Spiegelberg, H. L. (1981). Increased peripheral blood monocytes with Fc receptors for IgE in patients with severe allergic disorders. J . Immunol. 126, 1592-1595. 63. Melewicz, F. M., Kline, L. E., Cohen, A. B., and Spiegelberg, H. L. (1982). Characterization of Fc receptors for IgE on human alveolar macrophages. Clin. E x p . Immunol. 49,364-70. 64. Pforte, A., Breyer, G., Prinz, J. C., Gais, P., Burger, G., Haussinger, K., Rieber, E. P., Held, E., and Zieglerheitbrock, H. W. L. (1990). Expression of the Fc-receptor for IgE (Fc-epsilon-RII, Cd23) on alveolar macrophages in extrinsic allergic alveolitis. J . Exp. Med. 171,1163-1169. 65. Vercelli, D., Jabara, H. H., Lee, B. W., Woodland, N., Geha, R. S., and Leung, D. Y. (1988). Human recombinant interleukin 4 induces Fc epsilon R2/CD23 on normal human monocytes.]. E x p . Med. 167,1406-1416. 66. Yokota, A., Kikutani, H., Tanaka, T., Sato, R., Barsumian, E. L., Suemura, M., and Kishimoto, T. (1988). Two species of human Fc epsilon receptor I1 (Fc epsilon RII-CD23): Tissue-specific and IL-4-specific regulation of gene expression. Cell (Cambridge, Mass.) 55,611-618. 67. Conrad, D. H. (1990). Fc RII/CD23: The low affinity receptor for IgE. Annu. Reo. Immunol. 8,623-645. 68. Boltz-Nitulescu, G., Bazin, H., and Spiegelberg, H. L. (1981). Specificity of fc receptors for IgGZa, IgGl/IgG2b, and IgE on rat macrophages. J . Exp. Med. 154, 374-384. 69. Boltz-Nitulescu, G., Plummer, J. M., and Spiegelberg, H. L. (1984). Increased expression of the IgE Fc receptors on rat macrophages induced by elevated serum IgE levels. Immunology 53,9-16. 70. Capron, M., Jouault, T., Prin, L., Joseph, M., Ameisen, J. C., Butterworth, A. E., Papin, J. P., Kusnierz, J. P., and Capron, A. (1986). Functional study of a monoclonal antibody to IgE Fc receptor (Fc epsilon R2) of eosinophils, platelets, and macr0phages.J. E x p . Med. 164,72-89. 71. Finbloom, D. S., and Metzger, H. (1982). Binding of immunoglobulin E to the receptor on rat peritoneal macrophages. J . Immunol. 129,2004-2008. 72. Capron, M., Capron, A., Dessaint, J. P., Torpier, G.,Johansson, S. G., and Prin, L. (1981). Fc receptors for IgE on human and rat eosinophils. J . Immunol. 126, 2087-2092. 73. Capron, M. (1989). Eosinophils: Receptors and mediators in hypersensitivity. Clin. Exp. Allergy. 1,3-8. 74. Capron, M., Grangette, C., Torpier, G., and Capron, A. (1989). The second receptor for IgE in eosinophil effector function. Chem. Immunol. 47, 128-178. 75. Capron, M., Spiegelberg, H. L., Prin, L., Bennich, H., Butterworth, A. E., Pierce, R. J., Ouaissi, M. A., and Capron, A. (1984). Role of IgE receptors in effector function of human eosinophils. J . Zmmunol. 132,462-468. 76. Moqbel, R., Macdonald, A. J., Cromwell, O., and Kay, A. B. (1990). Release of leukotriene C4 (LTC4) from human eosinophils following adherence to IgE- and IgC-coated schistosomula of Schistosoma mansoni. Immunology 69,435-442. 77. Jouault, T., Capron, M., Balloul, J. M., Ameisen, J. C., and Capron, A. (1988). Quantitative and qualitative analysis ofthe Fc receptor for IgE (Fc epsilon RII) on human eosinophils. Eur. J . Immunol. 18,237-241. 78. Grangette, C., Gruart, V., Ouaissi, M. A., Rizvi, F., Delespesse, G., Capron, A., and
182
G . DELESPESSE E T A L .
Capron, M. (1989). IgE receptor on human eosinophils (FceRI1)-Comparison with B-cell CD23 and association with an adhesion molecule. J . Immunnl. 143, 3580-3588. 79. Bruynzeel-Koomen, C., van der Donk, E. M., Bruynzeel, P. L., Capron, M., de Cast, G . C., and Mudde, G . C. (1988). Associated expression of C D l antigen and Fc receptor for IgE on epidermal Langerhans cells from patients with atopic dermatitis. C h .Erp. Zmmunol. 74, 137-142; erratum: ibid., No. 3, p. 504. 80. Barker, J. N. W. N., Alegre, V. A., and MacDonald, D. M. (1988). Surfacebound immunoglobulin E on antigen-presenting cells in cutaneous tissue of atopic dermatitis.]. Inwest. Derniatol. 90, 117-121. 81. Bieber, T., Dannenberg, B., Prinz, J. C., Rieber, E. P., Stolz, W., Braun-Falco, O., and Ring, J. (1989). Occurrence of IgE-bearing epidermal Langerhans cells in atopic eczema: A study of the time course of the lesions with regard to the IgE serum level. 1. Inwest. Dermatol. 93,215-219. 82. Schmitt, D. A., Bieber. T., Cazenave, J. P., and Hanau, D. (1990). Fc receptors of human Langerhans cells. J . Inwest. Dermutol. 94,15S-21S. 83. Bieber, T., Rieger, A., Neuchrist, C.. Prinz, J. C., Rieber, E. P., Boltz-Nitulescu, G . , Scheiner, O., Kraft, D., Ring, J., and Stingl, C . (1989). Induction of Fc epsilon R2/CD23 on human epidermal Langerhans cells by human recombinant interleukin 4 and gamma interferon.]. Exp. Med. 170,309-314. 84. Mudde, G. C., Van Reijsen, F. C., Boland, G .J., De Cast, G. C., Bruijnzeel, P. L. B., and Bruijnzeel-Koomen, C. A. F. M. (1990). Allergen presentation by epidermal Langerhans cells from patients with atopic dermatitis is mediated by IRE.lmmunology 69,335-34 1. 85. Galli, S. J., Dvorak, A. M., Ishizaka, T., Nabel, G . , Der Simonian, H., Cantor, H., and Dvorak, H. F. (1982). A cloned cell with N K function resembles basophils by ultrastructure and expresses IgE receptors. Nature (London) 298,288-290. 86. Kimata, H., and Saxon, A. (1988). Subset of natural killer cells is induced by immune complexes to display Fc receptors for IgE and IgA and demonstrates isotype regulatory function. ]. Clin.Inwest. 82, 160-167. 87. Rosenthal, K. L., Ishizaka, T., Befus, A. D., Dennert, G., Hengartner, H., and Bienenstock, J. (1984). Expression of IgE receptors and histamine in cloned natural killer cell lines. J . Zmmunol. 133,642-646. 88. Masuda, A,, Kasajima, T., Mori, N., and Oka, K. (1989). Immunohistochemical study of low affinity Fc receptor for IgE in reactive and neoplastic follicles. Clin. lmmunol. lmmunopathol. 53,309-320. 89. Johnson, G . D., Hardie, D. L., Ling, N. R., and MacLennan, I. C. (1986). Human follicular dendritic cells (FDC): A study with monoclonal antibodies. Clin. E x p . lmmunol. 64,205-213. 90. Gordon, J., Flores-Romo, L., Cairns, J. A., Millsum, M. J., Lane, P. J., Johnson, G. D., and MacLennan, 1. C. (1989). CD23: A multi-functional receptor/ lymphokine? Zmmunol. Today 10,153-157. 91. Conrad, D. H. (1989). Low affinity IgE receptors (Fc epsilon RII). Clin. Reu. Allergy 7, 165-192. 92. Liu, Y. J., Cairns, J. A., Jansen, K. U., Bonnefoy, J. Y., Gordon, J., and Maclennan, I. C. M. (1991). Recombinant 25-kilodalton CD23 and interleukin 1 alpha promote survival and differentiation of germinal center B cells. (Submitted for publication.) 93. Capron, A., Ameisen, J. C., Joseph, M., Auriault, C., Tonnel, A. B., and Caen, J. P. (1985). New functions for platelets and their pathological implications. lnt. Arch. Allergy Appl. lmmunol. 77, 107-114.
THE CD23 ANTIGEN
183
94. Cines, D. B., van der Keyl, H., and Levinson, A. I. (1986).In uitro binding ofan IgE protein to human platelets. J. Immunol. 136,3433-3440. 95. Joseph, M., Auriault, C., Capron, A., Vorng, H., and Viens, P. (1983). A new function for platelets: IgE-dependent killing of schistosomes. Noture, (London) 303,810-812. 96. Joseph, M., Capron, A., Thorel, T., and Tonne], A. B. (1986). Nedocromil sodium inhibits IgE-dependent activation of rat macrophages and platelets as measured by schistosome killing, chemiluminescence and enzyme release. Eur. J. Respir. Dis., Suppl. 147,220-222. 97. Joseph, M., Capron, A., Ameisen, J. C., Capron, M., Vorng, H., Pancre, V., Kusnierz, J. P., and Auriault, C. (1986). The receptor for IgE on blood platelets. Eur. J . Immunol. 16,306-312. 98. Pancre, V., Joseph, M., Capron, A., Wietzerbin, J., Kusnierz, J. P., Vorng, H., and Auriault, C. (1988). Recombinant human interferon-gamma induces increased IgE receptor expression on human platelets. Eur. J . Immunol. 18,829-832. 99. Pancre, V., Cesbron, J. Y., Joseph, M., Barbier, M., Capron, A., and Auriault, C. (1988). IgE-dependent killing of Schistosomo mansoni schistosomula by human platelets: Modulation by T cell products. Int. Arch. Allergy Appl. Immunol. 87, 371-375. 100. Billaud, M., Busson P., Huang, D., Mueller-Lantzch, N., Rousselet, G., Pavlish, O., Wakasugi, H., Seigneurin, J. M., Tursz, T., and Lenoir, G. M. (1989).Epstein-Barr virus (EBV)-containing nasopharyngeal carcinoma cells express the B-cell activation antigen blast2/CD23 and low levels of the EBV receptor CR2. J. Virol. 63, 4121-4128. 101. Rowlands, D. C., Hansel, T. T., and Crocker, J. (1990). Immunohistochemical determination of Cd23 expression in Hodgkins disease using paraffin sections. J. Pathol. 160,239. 102. Conrad, D. H., and Peterson, L. H. (1984).The murine lymphocyte receptor for IgE. I. Isolation and characterization of the murine B cell Fc epsilon receptor and comparison with Fc epsilon receptors from rat and human. J. Immunol. 132,796803. 103. Meinke, G. C., Magro, A. M., Lawrence, D. A., and Spiegelberg, H. L. (1978). Characterization of an IgE receptor isolated from cultured B-type lymphoblastoid cells. J. Immunol. 121, 1321-1328. 104. Fritsche, R., Meinke, G. C., and Spiegelberg, H. L. (1981). Immunoprecipitation of the solubilized membrane receptor for IgE of human cultured lymphoblastoid cells. Scand. J. Immunol. 13,225-230. 105. Spiegelberg, H. L. (1984). Structure and function of Fc receptors for IgE on lymphocytes, monocytes, and macrophages. Ado. Immunol. 35,61-88. 106. Nakajima, T., and Delespesse, G. (1986). IgE receptors on human lymphocytes. 1. Identification of the molecules binding to monoclonal anti-Fc epsilon receptor antibodies. Eur. J. Zmmunol. 16,809-814. 107. Pecoud, A. R., and Conrad, D. H. (1981). Characterization of the IgE receptor by tryptic mapping. J. Immunol. 127,2208-2214. 108. Letellier, M., Nakajima, T., and Delespesse, G. (1988). IgE receptor on human lymphocytes. IV. Further analysis of its structure and of the role of N-linked carbohydrates. J. Immunol. 141,2374-81. 109. Nakajima, T., Sarfati, M., and Delespesse, G. (1987).Relationship between human IgE-binding factors (IgE-BF) and lymphocyte receptors for IgE. J. Immunol. 139, 848-54.
184
G . DELESPESSE E T A L .
110. Letellier, M., Sarfati, M., and Delespesse, G. (1989). Mechanisms of formation of IgE-binding factors (soluble CD23). I. Fc epsilon R I1 bearing B cells generate IgE-binding factors ofdifferent molecular weights. Mol. Immunol. 26,1105-1 112. 111. Conrad, D. H., Wingard, J. R., and Ishizaka, T. (1983). The interaction of human and rodent IgE with the human basophil IgE receptor. J . Immunol. 130,327-333. 112. Lee, W. T., and Conrad, D. H. (1985).The murine lymphocyte receptor for IgE. 111. Use of chemical cross-linking reagents to further characterize the B lymphocyte Fc epsilon receptor. J . Immunol. 134,518-525. 113. Holowka D., Conrad, D. H., and Baird, B. (1985). Structural mapping of membranebound immunoglobulin E-receptor complexes: Use of monoclonal anti-IgE antibodies to probethe conformation of receptor-bound IgE. Biochemistry 24,62606267. 114. Lee, W. T., Rao, M., and Conrad, D. H. (1987). The murine lymphocyte receptor for IgE. IV. The mechanism of ligand-specific receptor upregulation on B cells. J . Immunol. 139,1191-1198. 115. Conrad, D. H., Keegan, A. D., Rao, M., and Lee, W. T. (1987). Synthesis and regulation of the IgE receptor on B lymphocyte cell lines. Int. Arch. Allergy Appl. Immunol. 82,402-404. 116. Staros, J. V., Lee, W. T., and Conrad, D. H. (1988). Membrane-impermeant crosslinking reagents: Application to the study of the cell surface receptor for IgE. In “Methods in Enzymology” ( J . F. Riordan and B. L. Vallee, eds.), vol. 158, pp. 503-512. Academic Press, San Diego, California. 117. Lee, W. T., and Conrad, D. H. (1984). The murine lymphocyte receptor for IgE. 11. Characterization of the multivalent nature of the B lymphocyte receptor for IgE. J. Exp. Med. 159,1790-1795. 118. Keegan, A. D., and Conrad, D. H. (1987). The murine lymphocyte receptor for IgE. V. Biosynthesis, transport, and maturation of the B cell Fc epsilon receptor. J . Immunol. 39,1199-1205. 119. Bonnefoy, J. Y.,Guillot, O., Spits, H., Blanchard, D., Ishizaka, K., and Banchereau, J. (1988).The low-affinity receptor for IgE (CD23) on B lymphocytes is spatially associated with HLA-DR antigens.]. Exp. Med. 167,57-72. 120. Lee, B. W., Simmons, C. F., Jr., Wileman, T., and Geha, R. S. (1989). Intracellular cleavage of newly synthesized low affinity Fc epsilon receptor (Fc epsilon R2) provides a second pathway for the generation of the 28-kDa soluble Fc epsilon R2 fragment. J. Immunol. 142, 1614-1620. 121. Sarfati, M., Nakajima, T., Frost, H., Kilchherr, E., and Delespesse, G. (1987). Purification and partial biochemical characterization of IgE-binding factors secreted by a human B lymphoblastoid cell line. Immunology 60,539-545. 122. Sarfati, M., and Delespesse, G. (1988). Possible role of human lymphocyte receptor for IgE (CD23) or its soluble fragments in the in oitro synthesis of human IgE. J. Immunol. 141,2195-2199. 123. Delespesse, G., Sarfati, M., and Rubio-Trujillo, M. (1987). In oitro production of IgE-binding Factors by human monuclear cells. Immunology 60, 103-1 10. 123a. Letellier, M., Nakajima, T., Pulido-Cejudo, G., Hofstetter, H., and Delespesse, G . (1990). Mechanism of formation of human IgE-binding factors (soluble CD23). 111. Evidence for a receptor (FcrRI1)-associated proteolytic activity. ]. Exp. Med. 172,693-700. 124. Bonnefoy, J. Y.,Shields, J., and Mermod, J. J. (1990). Inhibition ofhuman interleukin 4-induced IgE synthesis by a subset of anti-CD23/Fc epsilon RII monoclonal antibodies. Eur. J . Immunol. 20,139-144.
THE CD23 ANTIGEN
185
125. te Velde, A. A., Rousset, F., Peronne, C., d e Vries, J. E., and Figdor, G. (1990). IFN-alpha and IFN-gamma have different regulator effect on IL-4-induced membrane expression of Fc epsilon RIIb and release of soluble Fc epsilon RIIb by human monocytes. J. Immunol. 144,3052-3059. 126. Delespesse, G., Hofstetter, H., Sarfati, M., Suter, U.,Nakajima, T., Frost, H., Letellier, M., Peleman, R., and Kilchherr, E. (1989). Human Fc epsilon RII. Molecular, biological and clinical aspects. Chem. Immunol. 47,79-105. 127. Clark, E. A., Shu, G . L., Luscher, B., Draves, K. E., Banchereau, J., Ledbetter, J. A., and Valentine, M. A. (1989). Activation of human B cells. Comparison of the signal transduced by IL-4 to four different competence signals. J. Immunol. 143,38733880. 128. Galizzi, J. P., Zuber, C. E., Cabrillat, H., Djossou, O., and Banchereau, J. (1989). Internalization of human interleukin 4 and transient down-regulation of its receptor in the CD23-inducible Jijoye cel1s.J. Biol. Chem. 264,6984-6989. 129. Jover, J. A,, Chartash, E. K., Kushner, B., Friedman, S . M., and Crow, M. K. (1989). T helper cell-induced CD23 (BLAST-2) expression: An activation marker for the high density fraction ofhuman B cells. Clan. Immunol. Immunopathol. 53,99-112. 130. Yamaoka, K. A., Claesson, H. E., and Rosen, A. (1989). Leukotriene B4 enhances activation, proliferation and differentiation of human B lymphocytes. J. Immunol. 143,1996-2000. 131. Paul-Eugene, N. Dugas, B., Lagente, V., Mencia-Huerta, J. M., and Braquet, P. (1990). Pharmacological modulation of the FceRII/CD23 expression on human monocytes and the human monocytic cell line U937. FASEB. 4, Abstr. 380. 132. Dugas, B., Paul-Eugene, N., Calenda, A., Kikutani, H., Kishimoto, T., MenciaHuerta, J. M., and Braquet, P. (1990). Regulation ofthe FceRII/CD23 expression on human mononuclear cells by inflammatory mediators. FASEBJ. 4, Abstr. 381. 133. Mencia-Huerta, J. M., Dugas, B., Paul-Eugene, N., and Braquet, P. (1990). Inflammatory lipid mediators regulate the interleukin-4-induced IgE synthesis by human B lymphocytes. FASEBJ. 4, Abstr. 1100. 134. PBne, J., Rousset, F., Briere, F., Chretien, I., Wideman, J., Bonnefoy, J. Y., and De Vries, J. E. (1988). Interleukin 5 enhances interleukin 4-induced IgE production by normal human B cells. The role of soluble CD23 antigen. Eur. J. Zmmunol. 18, 929-935. 135. PBne, J.. Chretien, I., Rousset, F., Bribre, F., Bonnefoy, J. Y., and De Vries, J. E. (1989). Modulation of IL-4-induced human IgE production in oitro by IFN-gamma and IL-5: The role of soluble CD23 (s-CD23).J. Cell. Biochem. 39,253-264. 136. Keegan, A. D., Snapper, C. M., VanDusen, R., Paul, W. E., and Conrad, D. H. (1989). Superinduction of the murine B cell FccRII by T helper cell clones. Immunology 142,3868-3874. 137. Sharma, S., Morgan, J., Shrayer, D., Maize], A., Kumar, A., and Jackson, J. (1990). Human BCGF-12 KD and its role in B cell neoplasia. In “Cytokines: Basic Principles and Clinical Application” (in press). 138. Denoroy, M. C., Yodoi, Y.,and Banchereau, J. (1990). Interleukin 4 and interferon alfa and gamma regulate Fc epsilon R2/CD23 mRNA expression on normal human B cells. Mol. Immunol. 27, 129-134. 139. PBne, J.. Rousset, F., Briere, F., Chretien, I., Bonnefoy, J. Y., Spits, H., Yokota, T., Arai, K., Banchereau, J., and d e Vries, J. E. (1988). IgE production by normal human lymphocytes is induced by interleukin 4 and suppressed b y interferons y and a and prostaglandin E2. Proc. Natl. Acad. Sci. U.S.A. 85,6880-6884. 140. Wu, C. Y., Sarfati, M., Heusser, C., Fournier, S., Rubio-Trujillo, M., Peleman, R.,
186
G . DELESPESSE E T A L .
and Delespesse, G. (1991). Glucorticoids increase the synthesis of IgE by interleukin 4-stimulated human lymphocytes. J. Clin. Znoest. (in press). 141. Spiegelberg, H. L. (1987).The expression of IgE Fc receptors on lymphocytes of allergic patients. Znt. Reo. Immunol. 2,63-74. 142. Furukawa, S., Matsubara, T., Motohashi, T., Nakachi, S., Sasai, K., and Yabuta, K. (1990). Expression of FceR2/CD23 on peripheral blood macrophages/monocytes in Kawasaki disease. Clin. Immunol. Immunopathol. 56,280-286. 143. Mayumi, M., Kawabe, T., Kim, K. M., Heike, T., Katamura, K., Yodoi, J . , and Mikawa, H. (1988). Regulation of Fc epsilon receptor expression on a human monoblast cell line U937. Cliti. E x p . Imniunol. 71,202-206. 144. Mayunii, M., Kawabe, T., Nishioka, H., Tanaka, M., Kim, K. M., Heike, T., Yodoi, J., and Mikawa, H. (1989). Interferon and (2', 5')oligoadenylate enhance the expression of low affinity receptors for IgE (Fc epsilon R2/CD23) on the human monoblast cell line U937. Mol. Inimunol. 26,241-247. 145. Pauleugene, N., Dugas, B., Picquot, S., Lagente, V., Menciahuerta, J. M., and Braquet, P. (1990). Influence of interleukin-4 and platelet-activating factor on the Fc-epsilon-R1I/Cd23 expression on human monocytes. J. Lipid Med. 2,95-101. 146. Boltz-Nitulescu, G., Willheini, M., Gessi, A., Berger, R., Luger, T., and Forster, 0. (1990). Interleukin-6 induces FccRII-specific mRNA and augments FceRIUCD23 expression on human myelomonocytic cell lines. FASEBJ. Abstr. 2281. 147. Rankin, J. A. (1986). IgE immune complexes induce leukotriene 8 4 release from rat alveolar macrophages. Ann. Inst. Pasteur, Zmmunol. 137,364-367. 148. Rankin, J. A., Hitchcock, M., Merrill, W. W., Huang, S. S., Brashler, J. R., Bach, M. K., and Askenase, P. W. (1984). IgE immune complexes induce immediate and prolonged release of leukotriene C4 (LTC4) from rat alveolar macrophages. J . Immunol. 132, 1993-1999. 149. Rankin, J. A., Hitchcock, M., Merrill, W., Bach, M. K., Brashler, J. R., and Askenase, P. W. (1982). IgE-dependent release of leukotriene C4 from alveolar macrophages. Nature (London) 297,329-331. 150. Naray-Fejes-Toth, A., Cornwell, G. G., and Guyre, P. M . (1985). Glucocorticoids inhibit IgE receptor expression on the human rnonocyte cell line U937. Immunology 56,359-366. 151. Tanaka, M., Lee, K. C., Yodoi, J., Saito, H., Iwai, Y., Kim, K. M., Morita, M., Mayumi, M., and Mikawa, H. (1989). Regulation of Fc epsilon receptor 2 (CD23) expression on a human eosinophilic cell line EoL3 and a human nionocytic cell line U937 by transforming growth factor beta. Cell. Zmmunol. 122,96-107. 151a. Fargeas, C., Wu, C., Luo, H., Sarfati, M., Delespesse, G., and Wu, J. (1990). 1,25-(0H)2 vitamin D3 inhibits the CD23 gene expression by hunian peripheral blood monocytes.]. Zmmunol. (in press). 152. Wang, F., Gregory, C. D., Rowe, M., Rickinson, A., Wang, D., Birkenbach, M., Kikutani, H., Kishimoto, T., and Kieff, E. (1987). Epstein-Barr virus nuclear antigen 2 specifically induces expression of the B-cell activation antigen CD23. Proc. Natl. Acad. Sci. U.S.A.84,3452-3456. 153. Calender, A., Billaud, M., Aubry, J. P., Banchereau, J., Vuillaume, M., and Lenoir, G. M. (1987). Epstein-Barr virus (EBV) induces expression of B-cell activation markers on in oitro infection of EBV-negative B-lymphoma cells. Proc. Natl. Acad. Sci. U.S.A. 84,8060-8064. 154. Cordier, M., Calender, A., Billaud, M., Zimber, U., Rousselet, G., Pavlish, 0.. Banchereau, J., Tursz, T., Bornkamm, C., and Lenoir, G. M. (1990). Stable transfection of Epstein-Barr virus (EBV) nuclear antigen 2 in lymphoma cells containing
THE CD23 ANTIGEN
187
the EBV P3HRl genome induces expression of B-cell activation molecules CD21 and CD23.1. Virol. 64,1002-1013. 155. Wang, F., Gregory, C., Sample, C., Rowe, M., Liebowitz, D., Murray, R., Rickinson, A., and Kieff, E. (1990). Epstein-Barr virus latent membrane protein (Lmpl) and nuclear protein-2 and protein-3C are effectors of phenotypic changes in lymphocytes-B-EBNA-2 and Lmpl cooperatively induced Cd23. ]. Virol. 64,23092318. 156. Thorley-Lawson, D. A., and Mann, K. P. (1985). Early events in Epstein-Barr virus infection provide a model for B cell activation.]. Exp. Med. 162,45-59. 157. Hurley, E. A., and Thorley-Lawson, D. A. (1988). B cell activation and the establishment of Epstein-Barr virus latency. ]. E x p . Med. 168,2059-2075. 158. Swendeman, S. L., and Thorley-Lawson, D. (1988). Soluble CD23/BLAST-2 (SCD23/BLAST-2) and its role in B cell proliferation. Curr. Top. Microbiol. Zmmunol. 15,157-164. 159. Swendeman, S., and Thorley-Lawson, D. A. (1987).The activation antigen BLAST2, when shed, is an autocrine BCGF for normal and transformed B cells. EMBO]. 6, 1637- 1642. 160. Uchibayashi, N., Kikutani, H., Barsumian, E. L., Hauptmann, R., Schneider, F. J., Schwendenwein, R., Sommergruber, W., Spevak, W., maurer-Fogy, I., Suemura, M., et al. (1989). Recombinant soluble Fc epsilon receptor I1 (Fc epsilon R I P CD23) has IgE binding activity but no B cell growth promoting activity.]. Zmmunol. 142,3901-3908. 161. Singer, S. J.. Maher, P. A., and Yaffe, M. P. (1987). On the transfer of integral proteins into membranes. Proc. Natl. Acad. Sci. U.S.A.84,1960-1964. 162. Gollnick, S. O., Troustine, M. L., Yamashita, L. C., Kehry, M. R., and Moore, K. W. (1990). Isolation, characterization and expression of cDNA clones encoding the mouse Fc receptor for IgE (FcRII).J. Zmmunol. 144,1974-1982. 163. Cunningham, B. C., Jhurani, P., Ng, P., and Wells, J. A. (1989). Receptor and antibody epitopes in human growth hormone identified by homolog-scanning mutagenesis. Science 243,1330-1336. 164. Suter, U.,Bastos, R., Hofstetter, H. (1987). Molecular structure of the gene and the 5'-flanking region of the human lymphocyte immunoglobulin E receptor. Nucleic Acids Res. 15,7295-7308. 165. Drickamer, K. (1988). Two distinct classes of carbohydrate-recognition domains in animal lectins. J . Biol. Chem. 263,9557-9560. 166. Giga, Y., Ikai, A., and Takahashi, K. (1987). The complete amino acid sequence of echinoidin, a lectin from the coelomic fluid of the sea urchin Anthocidaris crussispina.]. Biol. Chem. 262,6197-6203. 167. Muramoto, K., and Kamlya, H. (1990).The amino-acid sequence of multiple lectins ofthe acorn barnacle Megabalunus rosa and its homology with animal lectins. Biochcm. Biophys. Acta 1039,42-52. 168. Stoolman, L. M. (1989). Adhesion molecules conrolling lymphocyte migration. Cell (Cambridge, Mass.) 56,907-910. 169. Springer, T. A. (1990).Adhesion receptors ofthe immune system. Nature, (London) 346,425-434. 170. Deleted in proof. 171. Nakayama, E., von Hoegen, I., and Parnes, J. R. (1989). Sequence of the Lyb-2 B e l l differentiation y t i g e n defines a gene superfamily of receptors with inverted membrane orientation. Proc. Natl. Acad. Sci. U.S.A.86, 1352-1356. 172. von Hoegen, I., Nakayama, E., and Parnes, J. R. (1990). Identification of a human
188
G. DELESPESSE E T A L .
protein homologous to the mouse Lyb-2 B cell differentiation antigen and sequence of the corresponding cDNA. J . Irnmunol. 144,4870-4877. 173. Yokoyama, W. M., Jacobs, L. B., Kanagawa, O., Shevach, E. M., and Cohen D. I. (1989). A murine T lymphocyte antigen belongs to a supergene family of type I1 integral membrane proteins. J . Zrnrnunol. 143, 1379-1386. 174. Bettler, B., Maier, R., Ruegg, D., and Hofstetter, H. (1989). Binding site for IRE of the human lymphocyte low-affinity Fc receptor (FcrRII/CD23) is confined to the domain homologous with animal lectins. Proc. Natl. Acad. Sci. U.S.A. 86, 71187122. 175. Vercelli, D., Helm, B., Marsh, P., Padlan, E., Geha, R. S., and Could, H. (1989).The B-cell binding site on human immunoglobulin E. Nature (London) 338,649-651. 176. Chrbtien, I., Helm, B. A., Marsh, P. J., Padlan, E. A., Wijdenes, J., and Banchereau, J. (1988).A monoclonal anti-IgE antibody against an epitope (amino acids 367-376) in the CH3 domain inhibits IgE binding to the low affinity IgE receptor (CD23). J . Zmmunol. 141,3128-3134. 177. Richards, M. L., and Katz, D. H. (1990). The binding of IgE to murine FcrRII is calcium-dependent but not inhibited by carbohydrate. J. Zmmunol. 144, 26382646. 178. Cordon, J., Rose, M., Walker, L., and Guy, G. (1986). Ligation of the CD23p45 (BLAST-2, EBCCS) antigen triggers the cell-cell cycle progression of activated B lymphocytes. Eur. J. Immunol. 16, 1075-1080. 179. Kikutani, H., Yokota, A., Uchibayashi, N., Yukawa, K., Tanaka, T., Sugiyama, K., Barsumian, E. L., Suemura, M., and Kishimoto, T. (1989). Structure and function of Fc epsilon receptor I1 (Fc epsilon RIUCD23): A point of contact between the effector phase of allergy and B cell differention. Ciba Found. Symp. 147,23-35. 180. Wendel-Hansen, V., Riviere, M., Uno, M., Jansson, I., Szpirer, J., Islam, M. Q., Levan, G., Klein, G., Yodoi, J., and Rosen, A. (1990). The gene encoding CD23 leukocyte antigen (FccRII)is located on human chromosome 19. Somatic Cell Mol. Genet. 16,283-286. 181. Fuhlendorf, J., Celemmensen, I., and Magnusson, S . (1987). Primary structure of tetranectin, a plasminogen kringle 4 binding plasma protein: Homology with asialoglycoprotein receptors and cartilage proteoglycan core protein. Biochemistry 26,6757-6764. 182. Muramoto, K., and Kamiya, H. (1990). The position of the disulfide bonds and the glycosylation site in a lectin of the acorn barnacle Megahalanus rose. Eiochim. Biophys. Acta 1039,52-60. 183. Delespesse, G., Sarfati, M., and Hofstetter, H. (1989). Human IgE-binding factors. Immunol. Today 10,159-164. 184. Suter, U., Texido, C., and Hofstetter, €1. (1989). Expression of human lymphocyte IgE receptor (FcrRII/CD23). Identification of FceRIIa promoter and its functional analysis in B lymphocytes. J . Immunol. 143,3087-3092. 185. Rousset, F., de Waal Malefijt, T., Slierendregt, B., Aubry, J. P., Bonnefoy, J. Y., Defrance, T., Banchereau, J., and d e Vries, J. E. (1988). Regulation of Fc receptor for IgE (CD23) and class I1 MHC antigen expression on Burkitt’s lymphoma cell lines by human IL-4 and INF-y.1. Immunol. 140,2625-2632. 186. Capron, M., Capron, A., Joseph, M., and Verwaerde, C. (1983). IgE receptors on phagocytic cells and immune response to schistosome infection. Monogr. Allergy 18,33-44. 187. Joseph, M., Tonnel, A. B., Torpier, G . , Capron, A., Arnoux, B., and Benveniste, J . (1983). Involvement of immunoglobulin E in the secretory processes of alveolar macrophages from asthmatic patients.J. Clin. Inoest. 71,221-230.
THE CD23 ANTIGEN
189
188. Capron, A., Joseph, M., Ameisen, J. C., Capron, M., Pancre, V., and Auriault, C. (1987).Platelets as effectors in immune and hypersensitivity reactions. Znt. Arch. Allergy Appl. Immunol. 82,307-312. 189. Butterworth, A. E., Bensted-Smith, R., Capron, A., Capron, M., Dalton, P. R., Dunne, D. W., Grzych, J . M., Kariuki, H. C., Khalife, J., Koech, D., et al. (1987). Immunity in human schistosomiasis mansoni: Prevention by blocking antibodies of the expression of immunity in young children. Parasitology 94,281-300. 190. Capron, M., Kazatchkine, M. D., Fischer, E., Joseph, M., Buttenvorth, A. E., Kusnierz, J . P., Prin, L., Papin, J . P., and Capron, A. (1987). Functional role of the alpha-chain of complement receptor type 3 in human eosinophil-dependent antibody-mediated cytotoxicity against schistosomes.J. Zmmunol. 139,2059-2065. 191. Kehry, M. R., and Yamashita, L. C. (1989). Low-affinity IgE receptor (CD23) function on mouse B cells: Role in Ige-dependent antigen focusing. Proc. Natl. Acad. Sci. U.S.A.86,7556-7560. 192. Pirron, U., Schlunch, T., Prinz, J. C., and Rieber, E. P. (1990). IgE-dependent antigen focusing by human B lymphocytes is mediated by the low-affinity receptor for IgE. Eur.J. Immunol. 20, 1547-1551. 193. Luo, H., Hofstetter, H., Banchereau, J., and Delespesse, G. (1991).Cross-linkingof CD23 antigen by its natural ligand (IgE) or by anti-CD23 antibody prevents B lymphocyte proliferation and differentiation. J. Zmmunol. (in press). 194. Finkelman, F. R., Holmes, J., Katona, I. M., Urban, J. F., Jr., Beckmann, M. P., Park, L. S.,Schooley, K. A., Coffman, R. L., Mosmann, T. R., and Paul, W. E. (1990). Lymphokine control of in oioo immunoglobulin isotype selection. Annu. Res. Zmmunol. 8,303-335. 195. Sherr, E., Macy, E., Kimata, H., Gilly, M., and Saxon, A. (1989). Binding the low affinity Fc epsilon R on B cells suppresses ongoing human IgE synthesis.J. Immunol. 142,481-489. 196. Gordon, J., Webb, A. J., Walker, L., Guy, G. R., and Rowe, M. (1986). Evidence for an association between CD23 and the receptor for a low molecular weight B cell growth factor. Eur. J. Immunol. 16, 1627-1630. 197. Guy, G. R., and Gordon, J. (1987). Coordinated action of IgE and a B-cellstimulatory factor on the CD23 receptor molecule up-regulates B-lymphocyte growth. Proc. Natl. Acad. Sci. U.S.A.84,6239-6243. 198. Yodoi, J., Hosoda, M., Maeda, Y., Sato, S., Takami, M., and Kawabe, T. (1989). Low affinity IgE receptors: Regulation and functional roles in cell activation. Ciba Found. Symp. 147,133-148. 199. Hosoda, M., Makino, S.,Kawabe,T., Maeda,Y., Satoh, S.,Takami, M., Mayumi, M., Arai, K., Saitoh, H., and Yodoi, J. (1989). Differential regulation of the low affinity Fc receptor for IgE (Fc epsilon R2/CD23) and the IL-2 receptor (Tac/p55) on eosinophilic leukemia cell line (EoL-3).J . Zmmunol. 143,147-152. 199a.Richards, M. L., Marcelletti, S. F., and Katz, D. H. (1988). IgE-antigen complexes enhance FceR and Ia expression by murine B lymphocytes. J . Exp. Med. 168, 571-587. 200. Kolb, J. P., Renard, D., Dugas, B., Genot, E., Petitkoskas, E., Sarfati, M., Delespesse, G., and Poygioli, J . (1990). Monoclonal anti-Cd23 antibodies induce a rise in intracellular calcium and polyphosphoinositide hydrolysis in human activated B-cells. Involvement of a GP protein. J . Zmmunol. 145,429-437. 201. Haynes, B. F., Martin, M. E., Key, H., and Kurtzberg, J. (1988). Early events in human T cell ontogeny: Phenotypic characterization and immunohistological localization of T cell precursors in early human fetal tissues.]. E x p . Med. 168,1061. 202. Mossalayi, M. D., Dallou, A. H., Bertho, J. M., Lecron, J. C., Goube de Laforest, P.,
190
G . DELESPESSE E T A L .
and DebrC, P. (1990). In oitro differentiation and proliferation of purified human thymic and bone marrow CD7+ CD2- T-cell precursors. E x p . Hematol. 18,326331. 203. Bertho, J. M., Mossalayi, M. D., Dalloul, A. H., Courboine, G., and Debre, P. (1990). Isolation of an early T cell precursor (CFU-TL) from human bone marrow. Blood 75,1064-1068. 204. Fowlkes, B. J., and Pardoll, D. M. (1989). Molecular and cellular events of T cell development. Ado. Immunol. 44,207-264. 205. Mossalayi, M. D., Lecron, J. C., Dalloul, A. H., Sarfati, M., Bertho, J. M., Hofstetter, H., Delespesse, G., and DebrC, P. (1990). Soluble CD23 (Fc epsilon RII) and interleukin 1 synergistically induce early human thymocyte maturation. J . Exp. Med. 171,959-964. 206. Bertho, J. M., Foureade, C., Dalloul, A. H., Debrb, P., and Mossalayi, M. D. (1991). Accessory function of CD23 on bone marrow derived CD4+ T cell growth. Eu7.J. Immunol. (in press). 207. Mossalayi, M. D., Arock, M., Bertho, J. M., Blanc, C., Dalloul, A. H., Hofstetter, €I., Sarfati, M., Delespesse, G., and Debre, P. (1990). Proliferation of early human myeloid precursors induced by interleukin-1 and recombinant soluble Cd23. Blood 75,1924-1927. 208. Flores-Romo, L., Cairns, J. A., Millsum, M. J., and Cordon, J. (1989). Soluble fragments of the low-affinity IgE receptor (CD23) inhibit the spontaneous niigration of U937 nionocytic cells: Neutralization of MIF-activity by a CD23 antibody. Immunology 67,547-549. 209. Gordon, J., Cairns, J. A., Millsum, M. J., Gillis, S., and Guy, G. H. (1988). Interleukin 4 and soluble CD23 as progression factors for human B lymphocytes: Analysis of their interactions with agonists of the phosphoinositide “dual pathway” of signaling. Eur.1. Immunol. 18, 1561-1565. 210. Callard, R. E., Lau, Y. L., Shields, J. G., Smith, S. H., Cairns, J. A., Flores-Romo, L., and Gordon, J. (1988). The marmoset B-lymphoblastoid cell line (B95-8) produces and responds to B-cell growth and differentiation factors: Role of shed CD23 (sCD23). Immunology 65,379-384. 211. Cairns, J. A., and Gordon, J. (1990). Intact, 45-kDa (membrane) form of Cd23 is consistently mitogenic for normal and transformed B-lymphoblasts. Eur.J. Immunol. 20,539-543. 212. Armitage, R. J., and Golf, L. K. (1988). Functional interaction between B cell subpopulations defined by CD23 expression. Eur. J . Immunol. 18, 1753-1760. 213. Sarfati, M., Rector, E., Rubio-Trujillo, M., Wong, K., Sehon, A. H., and Delespesse, G. (1984). In uitro synthesis of IgE by human lymphocytes. 111. IgE-potentiating activity ofculture supernatants from Epstein-Barr virus (EBV) transformed B cells. Immunology 53,207-214. 214. Sarfati, M., Nutnian, T., Fonteyn, C., and Delespesse, G. (1986). Presence of antigenic determinants common to Fc IgE receptors on human macrophages, T and B lymphocytes and IgE-binding factors. Immunology 59,569-575. 215. Maggi, E., Del Prete, G. F., Parronchi, P., Tiri, A., Macchia, D., Biswas, P., Sirnonelli, C., Ricci, M., and Romagnani, S. (1989). Role for T cells, IL-2 and IL-6 in the IL-4-dependent in oitro human IgE synthesis. Immunology 68,300-306. 216. Sarfati, M., Wu, C., Rubio-Trujillo, M., Hofstetter, H., Letellier, M., and Delespesse, G. (1990). The low-affinity receptor for IgE (CD23) and its soluble fragments (sCD23) exert opposite effects on human IgE synthesis. (In preparation). 217. Yodoi, J., Kawabe, T., and Takami, M. (1989). Regulation of IgE synthesis. Lym-
THE CD23 ANTIGEN
191
phocyte Fcc receptor, IgE binding factorb), and glycosylation-modulating factors. Clin.Reo. Allergy 7, 141-163. 18. Chretien, I., P h e , J., BriBre, F., De Waal Malefijt, R., Rousset, F., and de Vries, J. E. (1990). Regulation of human IgE synthesis. I. Human IgE synthesis in oitro is determined by the reciprocal antagonistic effects of interleukin 4 and interferongamma. Eur./. Immunol. 20,243-251. 19. Delespesse, G., Sarfati, M., Luo, H., and Hofstetter, H. (1989). Regulation of IgE synthesis by purified native and human IgE-binding factors. FASEB J . 3, Abstr. 4309. 20. Yanagihara, Y., Sarfati, M., Marsh, D., Nutman, T., and Delespesse, G. (1990). Serum levels of IgE-binding factor (soluble Cd23) in diseases associated with elevated IgE. Clin. E x p . Allergy 20,395-401. 21. Kim, K. M., Nanbu, M., Iwai, Y.,Tanaka, M., Yodoi, J., Mayunii, M., and Mikawa, H. (1989). Soluble low affinity Fc receptors for IgE in the serum of allergic and nonallergic children. Pediatr. Res. 26,49-53. 22. Spiegelberg, H. L., O’Connor, R. D., Simon, R. A,, and Mathison, D. A. (1979). Lymphocytes with immunoglobulin E Fc receptors in patients with atopic disorders.J. Clin.Inoest. 64,714-720. 23. Suemura, M., and Kishimoto, T. (1987). IgE class-specific regulatory factor(s) and Fc epsilon receptors on lymphocytes. Int. Reo. Immunol. 2,27-42. 24. Watanabe, N., Yanagihara, Y., Joh, K., Hamada, A., Tomita, Y., and Kobayashi, A. (1989). Fc-epsilon-receptor-bearing lymphocytes in patients with clonorchiasis. Int. Arch. Allergy Appl. Immunol. 89, 103-107. 25. Matheson, D., Li, S., Yeoh, E., Ling, Z., and Webb, B. (1990). Immunomodulatory effects of IVIg: Increased soluble CD23 and sensitivity of B cells to IL-4. FASEBJ. Abstr. 2407. 26. Kumagai, S., Ishida, H., Iwai, K., Tsubata, T., Umehara, H., Ozaki, S., Suginoshita, T., Araya, S., and Imura, H. (1989). Possible different mechanisms of B-cell activation in systemic lupus erythematosus and rheumatoid arthritis-Opposite expression of low-affinity receptors for IgE (Cd23) on their peripheral B-cells. Clin. E x p . Immunol. 78,348-353. 27. Sarfati, M., Bron, D., Lagneaux, L., Fonteyn, C., Frost, H., and Delespesse, G . (1988). Elevation of IgE-binding factors in serum of patients with B cell-derived chronic lymphocytic leukemia. Blood 71,94-98. 28. Fournier, S., Tran, I. D., Suter, U., Biron, G., Delespesse, G., and Sarfati, M. (1990). The in oioo expression of type b CD23 mRNA in B chronic lymphocytic leukemic cells is associated with an abnormally low CD23 upregulation by IL4: Comparison with their normal cellular counterparts. (Submitted for publication.) 29. Dadmarz, R., and Cawley, J. C. (1988). Heterogeneity ofCLL: High CD23 antigen and IFN receptor expression are features of favourable disease and of cell activation. B r . ] . Haematol. 68,279-282. 30. Gibson, J., Neville, S., Joshua, D., and Kronenberg, H. (1989). CD23 antigen expression in CLL. Br. J . Haematol. 72,598. 31. Barnett, D., and Reilly, J. T. (1989). Lack of correlation between cell surface activation, antigen expression and clinical stage in B-CLL. Br.J. Haematol. 73,572. 32. Genot, E., Sarfati, M., Sigaux, F., Petit-Koskas, E., Billard, C., Mathiot, C., Falcoff, E., Delespesse, G., and Kolb, J. P. (1989). Effect of interferon-alpha on the expression and release of the CD23 molecule in hairy cell leukemia. Blood 74, 24552463. This article was accepted for publication in September 1990.
This Page Intentionally Left Blank
ADVANCES IN IMMUNOl.OGY. VOL.. 49
Immunology and Clinical Importance of Antiphospholipid Antibodies H. PATRICK McNEIL, * COLIN N. CHESTERMAN, t AND STEVEN A. KRlLlS *
t
hiversify of New South Wales, School of Medicine, St. George Hospitol, Kogorah, Austrolio, 2217 Deportment of Haematology, Prince of Woler Hospitol, Rondwick, Australia, 2031
1. Introduction Antiphospholipid (aPL) antibodies occur in autoimmune diseases such as systemic lupus erythematosus (SLE),and in association with a wide range of other conditions including infections and certain drug therapy. The study of these autoantibodies h'as generated considerable interest as their presence in some patients confers an increased risk of vascular thromboses. Because aPL antibodies appear to be directed at phospholipids in plasma membranes, it has been postulated that they may exert direct pathogenic effects in uiuo by interfering with hemostatic processes that take place on the phospholipid membranes of cells such as platelets or endothelium. There are two major methods for detecting aPL antibodies. The first is based on a solid-phase immunoassay employing purified phospholipid antigens, most commonly cardiolipin (CL); thus, antibodies detected in this assay are generally termed anticardiolipin (aCL)antibodies. The second relies on the inhibition of in vitro blood coagulation caused by certain aPL antibodies, which is known as the lupus anticoagulant (LA) or lupus inhibitor phenomenon. aCL antibodies also bind other anionic phospholipids and may be more properly given the more general term aPL antibodies. To avoid confusion with LA, we will refer to antibodies that bind anionic phospholipids in solid phase assays as aCL antibodies (though recognizing their wider specificity) compared to LA, which are also likely to be aPL antibodies, but which may be directed against different epitopes. When the term aPL antibodies is used, this will refer to either LA or aCL-type antibodies. This problem with terminology serves to illustrate that the antigens to which aPL antibodies are directed have yet to be fully characterized. Although phospholipids are simple molecules, it is apparent that interactions with aPL antibodies are complex and dependent upon not only the type of phospholipid, but also its physical state (1).The concept 193 Copyright Q 1991 by Academic Press, Inc. All rights of reproduction in any lorrn reserved.
194
H . PATRICK McNEIL E T A L .
that the structural presentation of lipid antigens is a major factor influencing antibody-antigen interactions is of key importance, as will be discussed below. A brief review of phospholipid biochemistry pertinent to immunologic reactions is the first topic addressed in this chapter. In addition, clinical aspects relevant to aPL antibodies will be summarized and the immunology of aPL antibodies will be discussed in some detail, with particular reference to the antibodies themselves and to the antigens with which they interact. It is logical to assume that characterization of these antigens might lead to an understanding of how aPL antibodies predispose to thrombosis. A number of hypotheses relating to this question will be reviewed, indicating areas of the hemostatic process in which evidence indicates these immunoglobulins exert pathological effects. II. Phospholipid Biochemistry
Phospholipids are of the general structure shown in Fig. 1, coinposed of a glycerol backbone with a phosphodiester group at C3’ linked to a polar head group alcohol, and two esterified fatty acid chains at C1’ and C2’. Naturally occurring phospholipids contain saturated fatty acids at the C1’ locus, but those at the C2’ position are usually unsaturated (2). Chemically, the simplest phospholipid is phosphatidic acid (PA) in which the alcohol is absent. This molecule is referred to as the “phosphatidyl” component in more complex structures, which derive their names from the head group alcohol. In human cells, these head groups consist of either a nitrogenous base (choline, ethanolamine, or serine) glycerol, or inositol. The resulting phospholipids are termed phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidylglycerol (PGj, and diphosphatidylglycerol, also called cardiolipin (CL), and phosphatidylinositol (PI). CL is unique in containing two diester phosphates linked by glycerol. The chemical structure of the polar head group determines the net electrical charge or ionic state of the phospholipid. PC and PE are electrically neutral having both a negatively charged phosphate group and a positively charged amine group (i.e., zwitterionic). PS, PG, PA, PI, and C L are all negatively charged or anionic. The physical properties of phospholipids can be studied in model membrane systems, simplest of which consists of a dispersion of the lipid in an aqueous buffer. In these dispersions, phospholipids will adopt one of three structures indicated in Fig. 2. These are the micellar phase, the bilayer or lamellar phase typical of biological membranes,
195
ANTIPHOSPHOLIPID ANTIBODIES
A
B
-CHz-CHz-+N
ICH313
Serine -CHz-?H-N+Hs
HO
OH FIG.1. Chemical structure of phospholipids. (A) Cardiolipin. (B) Phosphatidylethanolamine. The chemical groups of which phospholipids are composed are shown in boxes in (B). The three-carbon glycerol moiety has two fatty acids esterified at C1‘ and C2‘ carbons, forming diacylglycerol. The phosphate group attached in ester linkage at the C3’ position of diacylglycerol forms the “phosphatidyl” component of phospholipids, which then are named by the alcohol head group linked to the phosphate group; thus if ethanolamine, choline, serine, or inositol is attached, the phospholipid is PE, PC, PS, or PI, respectively. In (A), cardiolipin (CL) has a second glycerol moiety as the headgroup to which an additional phosphatidyl component is attached. Thus CL is diphosphatidyl glycerol and has two phosphate diester groups. In (A) and (B), variation in the fatty acid chains is illustrated in both length and degree of unsaturation. Fatty acids at C1’ are usually saturated but those at the C2’ position are unsaturated. The number of double bonds varies, and each may be the cis or trans isomer. The cis isomer causes a kink in the chain, expanding the packing volume of the hydrophobic portion of the molecule.
and the hexagonal phase (3).The phase that phospholipids will adopt will depend on factors intrinsic to the molecule, such as nature of headgroup, length and degree of unsaturation of the fatty acid chains, and extrinsic factors such as hydration, temperature, pH, ionic strength, and presence of divalent cations, other lipids, and proteins (4).These factors influence phase behavior by altering the shape of the molecule (3,5), which simply depends on the area of the hydrophobic fatty acid chains versus the hydrophilic head group (Fig. 2). PE sponta-
196
H . PATRICK McNEII, E T A L
LIPID
PHASE
MICELLAR
MOLECULAR SHAPE
INVERTED CONE
PC
HEXAGONAL
CONE
FIG.2. Phospholipid structures in aqueous dispersions. Phospholipids adopt one of‘ these three basic structures when hydrated. Under physiological conditions, only PE adopts the hexagonal phase, but CL, PA, and PS can be induced to do so at low pH or with the addition of Ca2+as indicated. The “shape” of the molecule determines phase behavior and is influenced by the area or packing volume of‘ the hydrophilic versus hydrophobic portions of the molecule.
neously adopts the hexagonal phase because the head group is substantially smaller than in PC, and hydrogen bonding between phosphate and amino groups further reduces the area per molecule in the head group region. All other phospholipids preferentially adopt the
ANTIPHOSPHOLIPID ANTIBODIES
197
lamellar phase but can be induced to adopt the hexagonal phase by alterations in the lipid environment. For example, calcium ions can induce C L to do this by binding to the anionic head group, reducing electrostatic repulsive forces and thus decreasing the head group area. Additionally, unsaturation of the fatty acid chains (predominantly the cis isomer) produces a kink, increasing the hydrophobic area and inducing hexagonal phase change (3,5). In cellular membranes, phospholipids are arranged in an ordered bilayer with the hydrophobic fatty acid chains directed towards the interior of the membrane and the hydrophilic polar head groups directed to either side of the membrane. Membrane proteins are either attached peripherally by polar or ionic interactions or are imbedded in or even span the lipid bilayer. Membranes are “fluid” such that individual lipid molecules exchange places with their neighbors more than a million times per second in the lateral phase. Exchange of lipid molecules from one layer to the other (flip-flop) is a much rarer event (6).The cellular plasma membrane demonstrates a marked asymmetry in the distribution of phospholipid classes between the inner and outer layers of the bilamellar structure. The choline-containing zwitterionic phospholipids, sphingomyelin (SM) and PC, are located in the outer layer in combination with small quantities of PE. The inner or cytosolic layer is composed of minor amounts of PC and SM, a large amount of PE, and virtually all the PS and PI (7).Thus, anionic phospholipids are not found on the outer surface of plasma membranes during normal conditions, but it has been demonstrated in vitro that PS and PE can become exteriorized on platelets during activation with a combination of collagen plus thrombin (7). In mammalian tissues, CL is most plentiful in cardiac tissue, but is exclusively localized to mitochondrial membranes where it represents 21% of the total lipid phosphorous (8). C L is not found in plasma membranes nor in subcellular organelles and is synthesized only in the inner mitochondrial membrane. In plasma membranes, approximately 50-60% of the total phospholipids comprise SM and PC, 20-30% PE, 10-15% PS, and <5% PI (9, 10). Both SM and PC preferentially adopt a lamellar structure and hence exert a major structural effect on maintaining the stability of cell membranes. While P E preferentially adopts the hexagonal phase, it is stabilized in cell membranes by the presence of other lipids. However, specialized membrane functions such as exocytosis are likely to require transient hexagonal structures in which PE may be involved, possibly involving interactions between calcium ions and PS (3,7).
198
H. PATRICK McNElL ET AL.
111. Historical Background
The study of aPL antibodies began in 1907 when Wasserman introduced a diagnostic test for syphilis ( 1 l), using a saline extract of liver from fetuses with congenital syphilis as the antigen to detect an antibody, reagin, in the sera of patients with syphilis. In 1941, Pangborn demonstrated that the active antigenic component was a phospholipid, which she termed cardiolipin (CL) (12),and subsequently all tests had in common the principle of detection of antibodies to extracted CL. In 1938 a program of premarital and antepartum mass blood screening for syphilis was instituted in the United States and extended to military personnel during World War 11. As a result, it became clear that there were a large number of people with positive tests for syphilis without clinical or epidemiological evidence of the disease. This phenomenon was referred to as the biological false positive serological test for syphilis (BFP-STS),and was noted in two distinct situations (13).First, reagin was detected in the serum of patients during or after a number of infections with no relation to syphilis, and the false positive response spontaneously disappeared following recovery from the infection. This was known as the acute BFP-STS. The second type, known as the chronic BFP-STS, is marked b y the absence of precipitating causes and by its persistence over many months or years. During the 1950s Moore'and his colleagues studied a cohort of chronic BFP-STS reactors . was and noted a high incidence of autoimmune diseases ( 1 3 ~ 4 )SLE found particularly frequently, or developed in the ensuing years of observation. Subsequent authors confirmed this association (15,16).Additionally, the BFP-STS was detected frequently in patients known to have SLE, with a number of studies finding an incidence of 33-44% (17-19). In 1952 Conley and Hartmann described two patients with SLE who had BFP-STS reactions whose plasma demonstrated a unique inhibitor of in uitro coagulation (20).Similar cases were reported at this time by Mueller et al. (21), Hitzig et al. (22), and Frick (23). Most of these patients had BFP-STS. Subsequently, this inhibitor was recognized in patients without SLE but the inhibitor was ternled lupus anticoagulant (LA) by Feinstein and Rapaport (24).The association between LA and BFP-STS was increasingly recognized, but of interest is the fact that the LA was not found in patients with syphilis (25).Laurel1 and Nilsson studied two patients with both BFP-STS and LA and found both activities present in the gammaglobulin fraction of serum (26). Numerous studies on the mechanism of action of LA were performed (27-29), and these were reviewed by Lechner (30)and Feinstein and Rapaport (24), indicating that the LA interferes with the interaction of preformed
ANTIPHOSPHOLIPID ANTIBODIES
199
prothrombin activator complex with prothrombin. There was evidence that LA required the presence of a plasma cofactor for maximal inhibitory effect (28,29,31). Evidence was then obtained which indicated that the LA was an immunoglobulin directed against the phospholipid portion of the prothrombin activator complex (32,33).Lechner (30)and Shapiro (33) fractionated LA positive plasma and found the activities resided in IgC or IgM fractions or both. Lechner (30) and Firkin et u1. (34) showed that the LA activity of IgM or IgC fractions of plasma could be neutralized with specific anti-IgM or -1gC antibodies, respectively. Despite these laboratory studies, which clarified the nature of the LA and its inhibitory effect on in uitro clotting, it became clear that most patients possessing LA did not suffer hemorrhagic complications, even during surgery. As early as 1963, Bowie and co-workers found 4 out of 8 patients with LA who had suffered thromboembolic phenomena (35).In their extensive review, Feinstein and Rapaport (24) found that if bleeding did occur, it was almost always due to prothrombin deficiency or thrombocytopenia, and occurred rarely in association with LA if these were absent. This was confirmed in Lechner’s review (30), which also noted a high incidence of BFP-STS, thrombosis, and thrombocytopenia in patients with LA compared to those without. In 1976, two clinical studies of the LA were published (36,37),and u p to 50% of these patients did not have SLE, a result that has been consistently found in subsequent studies, including a large series by Bowie and co-workers (38). In 1983, Harris, Hughes, and co-workers developed a solid-phase immunoassay to directly detect circulating antibodies that bind to C L (39). Since CL is the antigenic component of the syphilis serological test, this assay was developed to improve the sensitivity of detecting aCL antibodies in patients with SLE, compared with the BFP-STS result. The radioimmunoassay described by Harris et ul. was in fact 200-400 times more sensitive than the Venereal Disease Research Laboratory (VDRL) precipitation test. aCL antibodies were found in 61%of a group ofpatients with SLE and strong associations were found with the LA, BFP-STS, thrombosis, and thrombocytopenia. The aCL antibody assay has significant advantages over coagulation tests, being able to be performed on serum, with only small quantities needed. Although studies of the LA were mostly the domain of hematologists prior to 1983, the development of the aCL antibody assay resulted in widespread interest in these antibodies and of the clinical syndromes associated with their presence. These syndromes will be discussed in the following section.
200
H . PATRICK McNEIL E T A L
IV. Clinical Aspects of Antiphospholipid Antibodies
A. METHODS OF DETECTION OF aPL ANTIBODIES
The serological tests for syphilis are primarily of historical importance to the group of patients of interest to this review. These tests are insensitive and will not be further discussed in this section. The two methods in current use for detecting aPL antibodies are (1)in vitro coagulation tests to demonstrate LA activity, and (2)solid-phase immunoassays employing various phospholipid antigens, most commonly CL, but also other pure phospholipids or mixtures, e.g., thromboplastin. 1 . ldentijicatiun uf LA Activity
The LA has been defined by an international committee as “an anticoagulant which prolongs the partial thromboplastin time (PTT) and occasionally the prothroinbin time (PT) of normal plasma but does not specifically inactivate any of the known clotting factors” (40).This is a rather unsatisfactory definition since many LA do not prolong the PTT at all (41,42). Shapiro and Thiagarajan more accurately defined the LA as “immunoglobulins which interfere to a variable extent with phospholipid dependent coagulation tests without inhibiting the activity of specific coagulation factors” (33),although this definition says little about the mechanism of action of LA. Recently, Triplett and Brandt have suggested that there are three aspects that are of importance in defining and identifying LA (43). First, LA activity is suggested by the demonstration of an abnormality of a phospholipiddependent clotting test. Clearly, the selection of the best test is important and, above all, it must be sensitive. Second, it must be established that the abnormality is due to an inhibitor of clotting, and not other causes such as a clotting factor deficiency. This step requires mixing studies with normal plasma, which will correct the abnormality if due to clotting factor deficiency, but the effect of an inhibitor will persist. Third, evidence must be obtained that the inhibitor is directed at phospholipid and not a specific coagulation protein. Correction of the abnormality by the addition of phospholipid or activated platelets is usually sufficient for this purpose. Although this approach is logical and appears straightforward, there is still a lot of controversy regarding the detection of LA, particularly lack of agreement on the best clotting test to use and lack of reproducibility of results between laboratories. There have been numerous studies comparing the sensitivity of various tests to detect LA (41,42, 44-50). The activated PTT (aPTT) is often used, but it fails to detect
ANTIPHOSPHOLIPID ANTIBODIES
20 1
weak inhibitors (41,42), because the added phospholipid corrects the inhibitor. Moreover, the sensitivity of the aPTT depends upon the composition of the added thromboplastin (47,51,52). In particular, thromboplastins with large amounts of phospholipids rich in PS appear to be least sensitive (52). Other tests commonly used are the kaolin clotting time (KCT) and the dilute Russell viper venom time (dRWT). The KCT (45) is the PTT with kaolin (PTTK) (a type of aPTT) without thromboplastin, the phospholipid source being that endogenously present in the test plasma. Exner has shown that the KCT is the most sensitive test for detection of LA (41,46), and other groups have confirmed this in a number of recent studies (42,48,49). However, the KCT is exquisitely sensitive to the presence of added phospholipid (46), and careful preparation of plasma is essential. This includes atraumatic venipuncture, immediate rapid centrifugation, and filtration through a 0.22-pm filter. Plasma so treated can then be safely frozen and tested later without loss of LA activity (46). Additionally, normal plasma which is to be used in mixing studies must be also treated accordingly. Because of this, many workers feel that the KCT is difficult to adapt for routine screening (43,49). However, Gibson et al. examined the accuracy of a simplified KCT screening test by testing only a 4 : 1 mixture of normal: test plasma compared to normal plasma alone (53). The difference between the 4 : 1 mixture and normal plasma is known as the delta-KCT (dKCT) and is considered abnormally prolonged if the dKCT is > 10% X KCT of normal plasma. Gibson et d ’ s study showed this screen to be sensitive with all known LA plasmas being abnormal, and although a few false positives were detected, these were easily recognized in further mixing studies. The d R W T was recommended b y Thiagarajan’s group (54), and can be easily automated. It has been found to be a sensitive test for the LA by some (41,49,54), but not all workers (48). The variability in sensitivity of the d R W T to LA may be due to differences in the type of phospholipid used in the assay (55), thus limiting the widespread application of this test, unless standardized phospholipid compositions are used. The second step is to determine the etiology of the abnormal screening test. Mixing the test plasma with normal plasma will correct the abnormality if the problem is a clotting factor deficiency. If the clotting test of the mixture remains prolonged, an inhibitor is most likely. Many workers recommend a 1: 1 mix, especially using the aPTT. Triplett and Brandt have suggested that 4 parts test plasma to 1 part normal is more sensitive (56). Exner demonstrated that plasmas “behave” variably in mixing studies employing the KCT (45). Some LA plasmas had
202
H . PATRICK MCNEIL E T A L
near normal KCTs when tested alone, but were prolonged when mixed with normal plasma (Type 3 Exner pattern). This is an example of the LA cofactor effect. Regardless ofthe mixing pattern, a mixture of4 parts normal to 1 part test plasma was able to detect prolongation of all LA plasmas, and has the additional advantage that the LA plasma is a minor component, thus minimizing effects of administered anticoagulant medication, or an associated hypoprothrombinemia. A crucial aspect is the choice of “normal” plasma. Frozen pools, or commercial lyophilized preparations may be unsuitable since the normal plasma must be platelet free, thus it should be treated identically to the test sample as described above. Using these techniques, the normal pool can be frozen in aliquots, retaining its platelet-free nature (46). One further point regarding mixing patterns is the differentiation of LA from factor VIII inhibitors. It is generally assumed that LA are immediate acting, prolonging a normal : test mixture immediately, whereas factor VIII inhibitors require a period of incubation to demonstrate inhibition of clotting (57).Recently, 3 groups have shown that some LA plasmas demonstrate a time dependency, with increasing inhibition after 60 minutes incubation (58-60). This effect may be related to the amount of phospholipid present in the assay system. Clyne and White have suggested that with small amounts of phospholipid, all LA plasmas are immediate acting, while at very high concentrations of phospholipid all LA might exhibit time dependency (59). The final step in LA diagnosis is the demonstration that phospholipids can correct the abnormality, which is important to avoid confusion with factor VIII inhibitors, especially in LA associated with HIV infection in hemophilia A patients. In 1978, Firkin et al. noted that activated platelets were able to correct the LA when added to the test system (34), and later showed that this was due to a component on the platelet membrane (61). This bypassing effect, known as the platelet neutralization procedure (PNP) has been used as a specific confirmatory procedure for the LA (44,50).A similar effect using increasing amounts of phospholipid in a dilute aPTT to correct the LA has been described (62). Recently, Rauch and Janoff have used hexagonal phase PE in a dilute aPTT system to correct LA activity, with excellent differentiation from antifactor inhibitors (63) (see section V). Since LA are quite heterogeneous (58), in some circumstances more than one clotting test may be required to demonstrate the LA. For example, the tissue thromboplastin inhibition test (TTI) (which is simply a dilute PT) described by Schleider et al. (37) is considered by some workers to be a good test for identifying LA, although others consider it neither sensitive not specific (42-44,46,54,58). Neverthe-
ANTIPHOSPHOLIPID ANTIBODIES
203
less, in LA associated with chlorpromazine treatment, the TTI is frequently negative (58),and will be missed if only one test is used. The use of two tests, one employing minimal phospholipid for sensitivity, the other increased phospholipid or platelets for specificity, has been recommended by some authors (43,52).
2 . The aCL Antibody Solid Phase lmmunoassay The solid phase CL immunoassay was described in 1983 with the objective of finding a more sensitive, specific, and quantitative method of identifying patients with phospholipid binding antibodies (39). Briefly, C L is coated onto the surface of microtiter wells by addition of an ethanolic CL solution and evaporation of the solvent. This results in a layer of immobilized lamellar CL (1).Nonspecific binding sites are blocked with a protein solution (e.g., bovine serum), then test serum or plasma is added and incubated in the wells. After washing, bound aCL antibodies are detected with an antihuman immunoglobulin that is either radiolabeled or enzyme linked. This second antibody can be directed against gamma, mu, or alpha chains (to detect IgG, IgM, or IgA isotypes) or can be polyvalent, detecting any class of antibody. The initial assays were radiometric (3Y), but enzyme-linked assays were developed soon after (64-66), and are now in widespread use. Initially, there was a lack of standardization of the aCL antibody test, both with respect to the actual techniques used and the methods of reporting results. This may account for the wide variation in results obtained in different studies. There have been two major attempts to standardize the assay (67,68). The first of these recommended the use of standard units for measurement of IgG and IgM aCL antibodies. These were the GPL and MPL units, respectively, and were based on the binding of affinity purified IgG and IgM aCL antibodies such that 1 GPL or MPL unit was the binding activity of lpg/ml of affinity purified aCL antibody (67).Freeze-dried sera calibrated in GPL and MPL units were distributed worldwide so that individual laboratories could calibrate their own positive sera. It was recommended that the assay results (OD units or CPM) be converted to GPL or MPL units using a log-log plot (logOD vs. logGPL/MPL). The second workshop arose from the Third International Symposium on Antiphospholipid Antibodies in 1988 and included the exchange of sera among 60 laboratories in 13countries (68).Reference sera were distributed and additional sera exchanged. There was a significant day to day variation in the levels of the reference sera, but overall there was excellent agreement among laboratories when asked to give results semiquantitatively. The general conclusion was that
204
H . PATRICK MCNEIL ET AL.
aCL antibody levels be reported semiquantitatively as negative, low positive, medium positive, or high positive corresponding to approximate GPL/MPL units of <5, 5-20, 20-100, or >loo, respectively. In individual laboratories, more quantitative expression of results may be possible, especially when performing longitudinal studies on single patients. This marked improvement in standardization has most likely been due to optimization of the aCL antibody test. Gharavi et al. made significant improvements in the methodology and determined that an ELISA could detect aCL antibodies with a sensitivity of 20-40 ng/ml (64).This second generation assay or slight variations of it have been incorporated by many laboratories, but recently we have found third generation commercial kits are even more sensitive and easier and quicker to perform (69). The universal use of these third generation aCL antibody assays may further enhance standardization. An important question is the need to detect specific isotypes of aCL antibodies. The polyvalent second antibodies are theoretically able to detect any of the three major isotypes and appear to be a convenient way to detect total amount of aCL antibody. However, there are two problems with the polyvalent test. The first is the observation that some samples are negative in a polyvalent assay, but positive in IgG- or IgM-specific assays (70).The second is that specific isotypes appear to be associated with certain clinical events. For example, it has been suggested that the IgM isotype in the absence of IgG or IgA is less likely to be associated with thrombosis. Most workers perform assays for IgG and IgM isotypes, but IgA-aCL antibodies also occur commonly, usually concurrently with other isotypes (64,71-74). Furthermore, cases of IgA-aCL antibodies in isolation are not uncommonly recognized and justify the measurement of this isotype (64,70-72). One problem with measurement of the IgM isotype is that low affinity or nonspecific binding (to uncoated wells) of IgM antibodies can cause false positive results (75,76).This nonspecific binding appears to correlate with total levels of serum polyclonal IgM (75). Sera that contain aCL antibodies usually also display binding to other anionic phospholipids when these are substituted for C L in solid phase assays (64,74,77-80). Since CL was used primarily for historical reasons, there was some enthusiasm for the view that aPL antibodies may be more closely associated with specificities for other phospholipids such as PS, which unlike C L is present in plasma membranes. Thus, it was suggested that a better correlation with LA activity and clinical events might be observed. However, the results of many studies have failed to find any association of clinical events with a particular antiphospholipid specificity (72-74,80). There is a close relation-
ANTIPHOSPHOLIPID ANTIBODIES
205
ship between the presence and level of aCL antibodies and antibodies to other anionic phospholipids (64,73,74,77,80,81),suggesting that the same antibody population is cross reacting with all anionic phospholipids (see below). Thus, the more general term antiphospholipid (aPL) antibody has been applied to what are often known as aCL antibodies. There are two poorly understood peculiarities of the aCL antibody assay. First, when certain aCL-positive sera are diluted with normal pooled human sera, the subsequent level of aCL antibody is lower than predicted from the dilution ratio (82,83).Second, when sera is heated to 56' C for 30 minutes, the aCL antibody levels can increase considerably, and negative samples become positive (84-87), IgG (but not IgM-aCL) antibodies are affected in this way. The explanation is unclear but an effect involving complement or production of immune complexes or aggregates has been suggested (84,87).This could lead to artifactual results in batches of sera inactivated for virus, e.g., HIV. Another type of phospholipid solid phase immunoassay has been developed recently employing thromboplastin (the phospholipid mixture used in the PTT) as the antigen with the aim of detecting antibodies causing LA activity (88-90). The rationale is that LA are likely to be directed against components of thromboplastin, which contains lipids like PS but not CL. A major problem is that there has been no standardization of the thromboplastin preparations used. The relationship between antibodies binding to thromboplastin in these ELISAs and aCL-type antibodies is still uncertain, but most studies have found variable overlaps. Additionally, there has not been total agreement between the thromboplastin ELISA results and LA as detected by clotting tests. One reason may b e that the epitopes to which LA and aCL antibodies are directed are more complex than the type ofphospholipid; structural presentation appears to be of key importance. This matter will be reviewed in detail in section V of this chapter. The recent results of one group, with considerable experience in using the thromboplastin ELISA (89), suggest that this test may be detecting aCL-type antibodies rather than LA(Sl)(see below). In summary, it will be seen in the following sections that aCL antibody assays and LA tests detect different antibody subgroups. Therefore, both assays should be performed to detect the presence of aPL antibodies. Second, the tests employed should be sensitive and specific; for the aCL antibody test, this means isotype-specific second or third generation assays, and semiquantitative expression of results in pg/ml of bound antibody. The value of using non-CL anionic phospholipids is doubtful. Identification of LA activity should follow the
206
H. PATRICK MCNEIL E T A L
three-step procedure outlined with particular care in the collection and handling of plasma. The KCT, which does not require standardized reagents, is an excellent test that easily combines screening and mixing studies.
B. CONDITIONS IN WHICHaPL ANTIBODIES OCCUR 1 . Normal Populutions Most workers have measured aCL antibody levels in normal populations, usually to define a normal range for their own assay. Only a few studies have been published providing detail on the distribution of levels in normal populations (70,71,92,93).These show that aCL antibody levels are not norinally distributed, with the majority having undetectable levels. This distribution is unsuitable for analysis of normal range by mean +- standard deviation and is best defined using a percentile principle. Unfortunately, many studies have and continue to use meadstandard deviation analysis. The limited data available suggests that the healthy individuals with elevated levels possess single isotypes, either IgC or IgM, but not both (70,92),in contrast to individual patients that frequently possess two or three isotypes. Two studies of healthy elderly populations have been published (92,93). Manoussakis et ul. found a very high incidence of aCL antibodies (51.6%),which were exclusively of the IgG isotype (92). This frequency was not confirmed b y Fields et ul. using a polyvalent aCL assay (IgC + IgM only), detecting abnormal levels in 12%of cases (93). The prevalence of LA in a normal population was reported for the first time by Shi et ul. from our laboratory (70). The dKCT of a 4:l norma1:test mix was assayed in 499 blood donors. There were 40 cases (8%) with a dKCT >lo% of the control KCT and 39 of these had abnormal Exner mixing patterns (45) diagnostic of LA. Young females comprised most of the LA group, significantly different from the agei sex distribution of the group as a whole. Of the 40 cases, only 3 had elevated aCL antibody levels although there were a total of 54 abnormal aCL antibody tests in the overall group. The finding that 8% of a normal population have evidence of LA is surprisingly high. The fact that this abnormality was found in a subgroup of young women (the same patient group in which LA are well recognized, e.g., in SLE) suggests that these results are of relevance. It also appears that LA and aCL antibodies are found in different subgroups of subjects, suggesting each activity is due to different antibody populations.
207
ANTIPHOSPHOLIPID ANTIBODIES
2. SLE and Other Autoimmune Disorders The frequency of aPL antibodies in SLE has been studied by a large number of researchers. The results of these studies are summarized in Tables I (94-114) and I1 (115-125). Initial estimates of the frequency of LA in SLE by Dubois (94) and by early workers in the 1950s [reviewed by Feinstein and Rapaport (24)] were low, probably for a variety of reasons, including nonsensitive tests, different types of patients (SLE spectrum was much narrower), and because the detection of LA was not considered clinically important. Excluding these early reports, the frequency of LA and aCL antibodies in SLE averaged over
TABLE I FREQUENCY OF LA IN SLE Authors
Year
Total
LA +
Feinstein and Rapaport (24)" Dubois (94) Johansson and Lassus (25) Exner et al. (45) Angles-Can0 et al. (95) Gazengel et a1. (96) Boey et a1. (97) Harris et al. (39) Isenberg et al. (98) Mintz et al. (99) Bennett et al. (100) Colaco and Elkon (101) Harris et al. (102) Pauzner e t al. (103) Derksen et al. (104) Petri et al. (105) Meyer et u1. (106) Averbuch et al. (107) Hazeltine et al. (108) Derksen et al. (109) Nicastro et al. (110) Johns et a1. (111) Long et al. (112) Mokuno et al. (113) Rowel1 and Tate (114)
1972 1974 1974 1978 1979 1980 1983 1983 1984 1984 1984 1985 1985 1986 1987 1987 1987 1987 1988 1988 1989 1989 1989 1989 1989
196 520 44 17 28 49 49 65 55 43 67 52 167 66 74
349 41
18 2 14 12 12 14 25 32 9 15 14 19 40 32 19 4 21 7 11 47 28 45 40 94 6
1811
560
Total"
' Summary of 4 previous studies.
60 35 36 61 111 144 110
88
* Excludes Feinstein and Rapaport (24) and Dubois (94)
%LA+ 9 0.4 31 71 43 29 51 49 17 35 21 37 24 48 26 7 60 19 18 42 19 41 45 37 14 31
208
H . PATRICK MCNElL E T A L .
TABLE I1 FREQUENCY OF aCL ANTIBODIES I N SLE Authors
Year
Harris et al. (39) Koike et al. (115) Knight and Peter (116) Harris et al. (102) Tincani et al. (117) Petri et al. (105) Meyer et al. (106) Sturfelt et al. (118) Fort et al. (119) Manoussakis et al. (120) Hazeltine et al. (108) Derksen et al. (109) Kalunian et al. (72) Weidmann et a1. (73) Wang et al. (74) McHugh et (11. (121) Shergy et al. (122) Okada et al. (123) Khamashta et a1. (124) Cheng and Yap (125) Mokuno et al. (113)
1983 1984 1985 1985 1985 1987 1987 1987 1987 1987 1988 1988 1988 1988 1988 1988 1988 1988 1988 1988 1989
Total
Total
aCL+
65 24 100 197 51 60 48 59 45 86 65 111 85 92 111 98 32 156 55 39 349
40 10 47 82 25 15 30 32 17 18 14 63 36 53 49 23 44 19 17 122
61 42 47 42 49 25 62 54 38 21 22 57 42 58 44 23 50 28 35 44 35
1928
772
40
16
%aCL+
nearly 2000 patients in the literature is 31% and 40%, respectively. Some of these studies may have used nonsensitive tests, so the actual frequency may be even higher (especially for the LA). The reports listed in Tables I and I1 include studies from North America, United Kingdom, Europe, Scandinavia, Japan, Malaysia, and Australia, illustrating that similar frequencies of LA and aCL antibodies are distributed throughout different ethnic and geographic groups of patients with SLE. Although SLE appears to be the most common condition in which aPL antibodies are found, other autoimmune and apparently nonautoimmune conditions are also associated with their presence, as well as those in normal individuals. Schleider et al. (37) found that of 58 patients with LA, only half had SLE or SLE-like disorders. The remaining 29 had various conditions including malignancies, hemolytic anemia, juvenile and adult rheumatoid arthritis (RA), and many other apparently unrelated conditions. Boxer et al. (36)collected 37 cases of
ANTIPHOSPHOLIPID ANTIBODIES
209
LA, 18 of whom had SLE, and similarly to Schleider et al., malignancies, non-SLE autoimmune states such as thrombocytopenia, and miscellaneous conditions were found in the rest. In a study of 219 patients with LA, Gastineau et aZ. (38) confirmed these findings, again noting that SLE accounts for one half of patients with LA, and that this group has a marked female predominance compared with the non-SLE group, where an equal sex distribution is found, an observation also noted by Schleider e t aL(37).Jude et aZ.(126) reported on 100 cases of LA, and noted that 3 separate groups could be distinguished on the basis of age of occurrence. The first were children in which a history of a prior infectious episode was usually noted. The second group (ages 15-35) was characterized by a marked female predominance (7:l),and 80%of this group had SLE or SLE-like diseases. The third group (45-80 years of age) showed a 2 : 1 female predominance and only 37%had autoimmune disorders, of which only half had SLE/SLE-like diseases, and there were 4 drug-induced lupus syndromes. The rest had similar categories of diseases noted by the previous studies (36-38). A consistent finding in many studies of the LA is that only half have SLE (36-38,80,126,127). In a review of the major reports up to 1984, Derksen and Kater noted that the diagnostic categories associated with LA in 658 patients were SLE or SLE-like disorders in 365 (55%),drug induced (90% phenothiazines) in 78 (12%),and the remaining 215 (33%)comprised miscellaneous conditions (127). A similar systematic analysis on conditions associated with aCL antibodies has not been reported. However, Harris et aZ. (39,102) found that aCL antibodies were detected in other autoimmune disorders besides SLE and the lupuslike group now known as the primary antiphospholipid syndrome (PAPS) (see below). These included Sjogrens syndrome (42%),mixed connective tissue disease (MCTD) (22%),RA (ll%),immune thrombocytopenia (up to 30%)(128,129), Behcet’s syndrome (20%)(130), and occasionally in multiple sclerosis and scleroderma. Bueno et al.(131) also found aCL antibodies in a third of patients with immune thrombocytopenia. Colaco et aZ.(132) detected IgM-aCL antibodies in 68%of patients with myasthenia gravis, 38% in the myasthenic syndrome, 29% in multiple sclerosis, and 27% of cases of migraine. There was some cross-reactivity with ssDNA, suggesting these aCL antibodies may have been low affinity. The authors speculated that membrane-bound antigens associated with phospholipids may be important in the etiology of these antibodies. There have been additional reports of cases of transverse myelitis and multiple sclerosis-like syndromes occurring in the presence of aPL antibodies (132-137).
2 10
H . PATRICK MCNElL E T A L
Fort et al. (119) examined 243 consecutive patients with rheumatic diseases and found aCL antibodies in SLE (38%),RA (33%),and psoriatic arthritis (28%),but at low frequencies (<14%) in osteoarthritis, poly/dermatomyositis, and gout. The apparent high incidence of aCL antibodies in RA found in this study should be viewed with some caution since (1) 54% of RA patients were antinuclear antibody (ANA) positive, suggesting some of these may be better classified as SLE, and (2) the presence of rheumatoid factors can cause variable effects on aCL antibody results, including false positive IgM-aCL antibody, and inhibition or augmentation of IgG-aCL antibody (138-140). Manoussakis et al. (120) noted positive aCL results in 6.7% of RA patients. Nevertheless, Keane et al. (141) reported aCL antibodies in nearly 50%of patients with RA, as did Colaco and Male (142). Malia et al. (143) detected elevated aCL antibodies in 25% of 28 patients with systemic sclerosis, but other studies have found lower frequencies of mostly low titer aCL antibodies (102,120,144-146). Arroyo et al. (147) found an incidence of IgG and IgM aCL antibodies of 25%and 33%,respectively, in Sjogrens syndrome, slightly less often than noted by Harris et al. (102).
3 . lnfectious Diseases Moore and Mohr recognized as early as 1952 that aCL antibodies were a frequent accompaniment of various infections with their definition of the acute BFP-STS (13). More recently, Vaarala et ul. (71) and Colaco et al. (142,148)have confirmed this observation using the more sensitive aCL antibody immunoassay. A list of infections in which aCL antibodies have been described is shown in Table I11 (148-150). In addition to the reports listed that indicate the frequency of occurrence of aPL antibodies, cases of LA associated with infections have been described in hepatitis A (151), mumps (30), unspecified infections (go),acute rheumatic fever (152), and common childhood infections (126-153). In another study, 27% of sera for which streptococcal serology was requested were found to have elevated levels of aCL antibodies (118). In virtually all cases where follow-up samples were tested, aPL antibodies occurring in these infections were transient. Human immunodeficiency virus (HIV) infection is a recent addition to infections in which aPL antibodies occur. Gold et al. (155) and Bloom et al. (156) first noted LA in 26 of 52 and 24 of 34 hospitalized cases with AIDS-associated infections, respectively. Cohen et al. (157) found LA in 10 of 50 patients with AIDS, and similarly to the previous two studies, the occurrence of LA was most common when opportunis-
ANTIPHOSPHOLIPID ANTIBODIES
21 1
TABLE 111 OCCURRENCE OF aPL ANTIBODIES I N VARIOUS INFECTIONS ~~
Infection Leprosy Tuberculosis Pneumococcal pneumonia Bacterial endocarditis Leptospirosis Relapsing fever Rat-bite fever Malaria Typhus M ycoplasma Measles Chickenpox Hepatitis A Infectious mononucleosis Smallpox Parvovirus Rubella Ornithosis Adenovirus Mumps Lyme disease Human immunodeficiency virus Bacterial septicemia
Frequency reported (%)
60 5-45 2-5 5 10 30 20 100 20 20-33 5 5-20 10-100 20-70 20 80 37-80 44 45 54 30 10-100 43-80
Reference
13 13,154 13 13 13 13 13 13,142 13 13,71 13 13,71 13,148 39,148,149 13 148 71,148 71 71 71 150 155-165 166
tic infections were present, and tended to disappear upon resolution of the infection. aCL antibodies were found in 40/52 HIV-positive patients by Canoso et al. (158).Subsequent studies (159-165) have found varying frequencies of aCL antibodies in HIV-infected patients, possibly because of the different categories of patients studied (e.g., asymptomatic vs. full-blown AIDS) and/or presence of opportunistic infections, which in some studies appear to be most closely associated with the presence of aCL antibodies. Additionally, the effect of heat inactivation of sera causing artifactual positive results may account for the variable frequencies noted. Vaarala et al. (166)recently detected aCL antibodies in the majority of patients with bacterial septicemia. Of interest is the observation that lipopolysaccharide from a gram-negative bacteria was able to absorb the aCL antibody, suggesting these antibodies may be cross-reacting antibacterial immunoglobulins. Although aPL antibodies occurring in infections are generally considered to be not associated with thrombo-
212
H . PATRICK McNEIL ETAL.
sis, Syrjanen et al. (167,168) noted IgG-aCL in 15 of 54 (28%)stroke patients aged under 50 years. Furthermore, there was a higher incidence of preceeding infections in stroke patients versus controls, and 10 of 15 aCL-positive patients had evidence of preceeding infection. Saikku et al. (169) have also noted a high incidence of serological evidence of chlamydia infection in patients with myocardial infarction (68%vs. 7% in controls). Although intriguing, the significance of these results remains uncertain.
4 . Drug-Induced aPL Antibodies Both LA and aCL antibodies have been found in association with the administration of various drugs, suggesting an etiological association. Although SLE or a lupuslike disease can occur with hydralazine, procainamide, or other drug therapies, drug-induced aPL antibodies usually arise without associated clinical signs of UPU US, although other autoantibodies may occur concurrently (170,171). The phenothiazine group of drugs, particularly chlorpromazine, is the most common cause of drug-induced aPL antibodies (127). Much less common, dilantin, hydralazine, procainamide, quinidine, valproate, amoxycillin, propranolol, or streptomycin have been described as etiologic factors (36-38,80,172,173). Zarrabi et u1. found that up to 75% of patients treated with chlorpromazine for more than 2.5 years developed LA (170).Canoso and colleagues detected both LA and aCL antibodies in one third to one half of patients receiving chlorpromazine for more than one year (174,175). There are two striking findings with respect to chlorpromazineinduced aPL antibodies. First, the isotype is almost exclusively IgM (170,174,175),as are the associated antinuclear antibodies (171). Second, patients in this situation do not seem to develop the clinical complications seen in patients with SLE, such as thrombosis (175), although occasional thrombotic events have been observed (80,153). In these cases, other predisposing factors may have been present, and in one study (80),most patients were taking procainamide, rather than chlorpromazine, a situation where both IgG and IgM autoantibodies develop (171), and where thrombosis has been noted in case reports
(173). The reasons why aPL antibodies develop during chlorpromazine therapy are unknown, but understanding them may provide an insight into the etiologic events occurring when these autoantibodies arise in patients with SLE. Chlorpromazine is an amphiphilic compound that interacts with phospholipids. It is cationic and intercalates into plasma
ANTIPHOSPHOLIPID ANTIBODIES
213
membranes in the inner half of the bilayer (176,177).When administered it is >98% bound to plasma "proteins," and being lipophilic, associates with lipoproteins rather than albumin (178). Chlorpromazine and the related drug trifluoperazine have been shown to disrupt structure of erythrocytes and platelets in vitro (176,179).Thus, it is conceivable that chlorpromazine incorporation into phospholipid membranes (including lipoproteins) creates cryptic epitopes forming neoantigens, these being an immunogenic stimulus for the production of aPL antibodies.
C. SYNDROMES ASSOCIATED WITH aPL ANTIBODIES The clinical syndromes associated with the presence of aPL antibodies have predominantly been defined by retrospective studies employing three types of analysis. First, groups of patients, such as those with SLE, are divided on the basis of presence or absence of aPL antibodies, and differences in clinical symptoms and events are compared between the two subgroups. Second, patients with documented aPL antibodies have been collected, and previous clinical events in the group reviewed. Finally, groups of patients suffering from the clinical event or disease are collected and the incidence of aPL antibodies measured are then compared to a control group. A large number of these studies have been performed and are summarized in Table IV (180-182), Table V (183-185), Table VI, Table VII (186-196), and Table VIII (197-209). The first type of analysis reveals that there are three major areas where aPL antibody-positive SLE patients differ from aPL-negative ones. The former have a much higher incidence of thrombosis, either arterial or venous, thrombocytopenia (TCP), and in females, fetal loss. The data to justify this statement are presented in Tables IV-VI, summarizing the major reports in which 10 or more patients have been studied, including those finding statistical differences between aPL antibody-positive and -negative groups, and those not finding differences.
1. Thrombosis Table IV shows the results of 21 studies of 1428 SLE patients, in which 554 possessed aPL antibodies (39%),and there were 346 patients with histories of thromboses (24%).Thromboses were much more frequent in patients with aPL antibodies (42%)than in those without (13%),(x2 = 155, p = 1.0 x lo-").
2 14
H . PATRICK McNEIL E T A L
TABLE IV INCIDENCEOF THROMBOSIS IN aPL ANTIBODY-POSITIVE AND -NEGATIVE PATIENTS WITH SLE OR SLE-LIKEDISEASES Frequency of thrombosis Total Author
Year ~~
~~~
Angles-Can0 et al. (95) Boey et al. (97) Harris et 01. (39) Mintz et a1. (99) Gluek et al. (180) Colaco and Elkon (101) Tincani et ul. (117) Pauzner et al. (103) Derksen et al. (104) Sturfelt et al. (118) Fort et 01. (119) Averbuch et al. (107) Kalunian et al. (72) Derkseii et al. (109) Wang et al. (74) Cronin et al. (181) Khamashta et al. (124) Hasselaar et al. (182) Nicastro et al. (110) Long et al. (112) Rowell and Tate (114) Total
fl
aPL+ fl
aPLYO
n
%
Test
~
1979 1983 1983 1984 1985 1985 1985 1986 1987 1987 1987 1987 1988 1988 1988 1988 1988 1989 1989 1989 1989
28 60 65 43 77 52 47 66 74 59 44 36 85 111 111 64 55 74 144 92 41
3/12 18/31 23/40 8/15 12/18 5/19 6/23 15/32 14/19 9/32 5/16 517 8/36 19/47 9149 9/29 7/19 24/36 3/28 28/40 316
25 58 58 53 67 26 26 47 74 28 31 71 22 40 19 31 37 67 11 70 50
21 16 3/29 4/25 8/28 16/59 1/33 6/24 4/34 6/55 5/27 9/28 4/29 3/49 7/64 3/62 0135 3/36 7/38 51116 16/52 1/35
1428
2331554
42
1131874
13 LA 10 LA 16 aCL 28 LA 27 LA LA 3 aCL 25 LA 12 11 LA 19 aCL 32 aCL LA 14 6 aCL LA 11 aCL 5 aCL 0 8 aCL LA 18 LA 4 31 LA 3 LA -
13
2. Fetul loss Table V shows the results of 10 studies of 554 SLE patients. In (A) there were 391 patients, of whom 165 possessed aPL antibodies (43%), and there were 98 patients who had suffered fetal loss (25%).Fetal loss was much more common in patients with aPL antibodies (38%)than in those without (16%),(x2 = 23, p = 1.9 X lop6).In (B) there were 163 patients who had a total of 353 pregnancies, of which 147 ended in fetal loss (42%).Fetal loss occurred more frequently in the aPL antibodypositive group (59%)than in the negativegroup (20%)(x2= 51.7, p =-4 x 10-9).
215
ANTIPHOSPHOLIPID ANTIBODIES
TABLE V INCIDENCEOF FETALLoss IN aPL ANTIBODY-POSITIVE AND -NEGATIVE PATIENTS WITH SLE OR SLE-LIKEDISEASES Frequency of fetal loss Author
Year
Total n
n
(A) n = Patients Boey et al. (97) Colaco and Elkon (101) Derue et al. (183) Pauzner et al. (103) Lockshin et al. (184) Fort et al. (119) Wang et al. (74)
1983 1985 1985 1986 1987 1987 1988
53 49 40 66 50 22 111
9/26 3/17 16/19 15/32 10/13 219 7/49
39 1
621165
63 236 54 353
Total
(B) n = Pregnancies Derksen et 01. (104) Loizou et al. (185) Kharnashta et al. (124) Total
1987 1988 1988
aPL+
aPL%
n
%
Test
5/27 1/32 7/21 6/34 2/37 4/13 11/62
19 3 33 18 5 31 18
LA LA aCL, LA aCL aCL aCL
38
361226
16
19/26 841143 13/29
73 59 45
7/37 23/93 1/25
19 25 4
116/198
59
31/155
20
35 18 84 47 77 22 14 -
LA aCL aCL
3. Thrombocytopenia Table VI shows the results of 13 studies of 869 patients, of whom 406 had aPL antibodies (47%),and TCP occurred in 202 patients overall (23%).TCP was more common in those with aPL antibodies (38%)than in those without (11%) (x2 = 87.5, p = 3.5 X lo-’). Since a number of these studies came from the same institution and may have included the same patients, and since Lechner’s review did not include a proper control group, these reports were excluded and the remaining data reanalyzed. This showed the same results; TCP was more common in the aPL antibody-positive group (37%)than in the negative group (10%) (x2 = 62.4, p = 2.4 x lo-’)). When the data in Tables IV-VI were analyzed separately for studies using LA only or aCL antibody only, the same clear statistical differences between LA- or aCL-positive versus negative groups were seen. Thus the incidence of thrombosis in the LA-positive group was 51%
216
H. PATRICK MCNEIL E T A L .
TABLE VI INCIDENCEOF THROMBOCYTOPENIA I N aPL ANTIBODY-POSITIVE AND -NEGATIVE PATIENTS WITH SLE OR SLE-LIKEDISEASES Frequency of thrombocytopenia
aPL+
aPL-
Author
Year
Total n
n
%
Lechner (30) Boey et al. (97) Harris et al. (39) Colaco and Elkon (101) Harris et al. (128) Tincani et al. (117) Pauzner et al. (103) Derksen et al. (104) Averbuch et al. (107) Sturfelt et al. (118) Wang et al. (74) Hazeltine et al. (108) Khamashta et al. (124)
1974 1983 1983 1985 1985 1985 1986 1987 1987 1987 1988 1988 1988
64 60 65 52 116 46 66 74 36 59 111 65 55
34/64 9/31 11/40 7/19 31/59 4/21 14/32 17/19 417 4/32 9/49 2/14 7/19
53 29 27 37 53 19 44 89 57 13 14 14 37
869 628
1531406 921252
38 37
Total Total”
n
70
Test
3 8 24 21 8 15 7 14 7 10 0 8
LA LA aCL LA aCL aCL LA LA LA aCL aCL aCL aCL
1/29 2/25 8/33 12/57 2/25 5/34 4/55 4/29 2/27 6/62 0151 3/36 491463 381376
11 10
Excluding Harris et nl. (39), Boey et al. (97). and Colaco and Elkon (101) since from same institution as Harris et al. (128),and Lechner (30)since no control group.
versus 14% in the LA-negative group, and 31% in the aCL-positive group versus 12% in the aPL-negative group. ( p = 2 x lo-’ and 5x respectively). Similarly, the incidence of fetal loss was 36% versus 13%for LA, and 39% versus 18% for aCL, (p = 8.3 X lop4and 9.4 x lov4,respectively) and for TCP it was 55% versus 14% for LA and 29% versus 9% for aCL ( p = 1.4 x lo-’ and 2 X lo-” respectively). The second type of analysis is shown in Table VII, which includes the results of 26 major studies and 4 smaller ones. A total of 1147 patients with aPL antibodies are represented (most but not all LA). Three hundred fifty-four patients had suffered one or more thrombotic events (31%). This is lower than the 42% risk of thrombosis noted above for SLE patients with aPL antibodies, suggesting that within the overall group, there exist high-risk (e.g., SLE) and low-risk subgroups (e.g., drug induced). Indeed Gouault et al. (210) studied 134 cases with LA, and the incidence of thrombosis was twice as high in patients with
217
ANTIPHOSPHOLIPID ANTIBODIES
TABLE VII INCIDENCEOF THROMBOSIS I N PATIENTS WITH LA OR aCL ANTIBODIES Author
Year
Total
Lechner (30) Clauvel and Sultan (186) Manucci et al. (47) Mueh et 01. (153) Cameras and Vennylen (188) Boey et al. (97) Gladman et al. (191) Elias and Eldor (151) Jungers et al. (193) Colaco and Elkon (101) Gastineau et al. (38) Harris et al. (196) Jude et al. (126) Johansson and Lassus (25) Angles-Can0 et al. (95) Gazengel et al. (96) Alexandre et al. (187) Waddell and Brown (189) Ros et al. (190) Prentice et al. (192) Mintz et al. (99) Lubbe et al. (194) Lechner and Pabinger-Fasching (195)= Vennylen et al. (152) Derksen et al. (104) Triplett et al. (80)
1974 1977 1979 1980 1982 1983 1983 1984 1984 1985 1985 1986 1988 1974 1979 1980 1980 1982 1983 1984 1984 1984 1985 1986 1987 1988
20 10 35 14 31 19 35 29 19 205 83 100 35 12 14 10 14 50 15 15 10 113 61 34 100
Total ~
a
64
1147
Thrombosis 17 10 1 8 8 18 3 19 20 5 53 31 15 8 3 5 5
2 8 3 8 5 32 31 17 19 354 (31%)b
~~~~~
Incliides 4 previous small studies. Percentage with thrombosis.
autoimmune disease than in patients with LA but without autoimmune disease. The third type of analysis collects patients with a clinical complication (e.g., fetal loss) and looks at the frequency of aPL antibodies. Table VIII shows the results of 16 studies on 827 patients who had a history of recurrent fetal loss. Two hundred thirty-eight women were found to have aPL antibodies (29%). Most of these studies included control groups that varied; some were healthy pregnant women, others
218
H. PATRICK McNEIL ET AL.
were women with explained fetal loss. The incidence of aPL antibodies in the control groups was low, often zero. Dividing the table into LA and aCL subgroups, the frequency of each was 25% and 37%, respectively. This latter type of analysis has also been performed for TCP. Harris et al. (129) found aCL antibodies in 31% of patients with chronic autoimmune TCP, as did Bueno et al. (131). Seventy-two percent of SLE patients with TCP had aCL antibodies (128),a similar frequency noted by Derksen et al. (109) and Kalunian et ul. (72) (82%and 70%, respectively, of SLE patients with TCP). This form of analysis is difficult to perform in patients with thrombosis since it is a multifactorial condition and, being common, one might expect a low incidence of aPL antibodies. However, Hamsten et al. (211) and Morton et al. (212)found aCL antibodies in 21%and 19%of “nonautoimmune” patients with ischemic heart disease. Wangel et al. (213), DeCaterina et al. (214), and Klemp et al. (215) detected aCL antibodies in 13%,11%, and between 51 and 80%of similar groups of patients, respectively. In DeCaterina et d . ’ s study, up to 42% of patients had low positive aCL antibodies. The incidence of aPL antibodies in stroke appears to be lower; two studies have found them in 4%of stroke patients, (216,217), and another in only 1 of 89 stroke patients under the age of 50 (218).I n contrast, Kushner (219)detected aCL + / LA in 47%of 65 patients with cerebral ischemia. The incidence of aPL antibodies in patients with venous thrombosis is unknown, but Kienast et al. (220) found them in 3.2%of 218 consecutive patients presenting with unexplained arterial or venous thrombosis. In an ongoing study in our own institution, nearly 30% of patients presenting with deep venous thrombosis have been found to have aCL antibodies (221). The above data provide firm evidence for an association between aPL antibodies (either LA or aCL) and arterial or venous thrombosis, thrombocytopenia, and fetal loss in females. Alarcon-Segovia and Sanchez-Guerrero (222) have also found that hemolyic anemia, or a positive Coombs’ test is also associated with these antibodies, as have two other groups (108,145).These features occurring b y themselves, or commonly together, have been described as a syndrome, the antiphospholipid syndrome (APS) (222-227). Proposed criteria are one or more clinical features (i.e., thrombosis, TCP, or recurrent fetal loss) plus either LA or aCL antibody (225).Although it is possible to identify patients with the APS who also have SLE, there do exist others who do not fulfill criteria for SLE but have some lupuslike manifestations, and others who have no lupus features. This latter group has been designated the primary APS (PAPS) (222,227). Case reports of individual
219
ANTIPHOSPHOLIPID ANTIBODIES
INCIDENCE OF
TABLE VIII aPL ANTIBODIESIN PATIENTS WITH RECURRENTIDIOPATHIC FETALLOSS Total
aPL+
n
%
Test
24 23 61 55 14 120 27 29 44 99 63 23 19 19 187 20
2 16 8 15 7 12 22 14 5 42 11 13 13 12 38 10
8 69 13 27 50 10 81 48 11 42 17 57 68 63 20 50
LA aCL aCL aCL LA LA aCL LA aCL aCL LA aCL LA LA aCL f LA aCL
827
238
29
Authors
Year
n
Cameras and Vermylen (197) Derue et al. (183) Cowchock et al. (198) Lockwood et al. (199) Clauvel et al. (200) Edelrnan et al. (201) Pattison et al. (202) Howard et al. (203) Petri et al. (204) Unander et al. (205) Barbui et 01. (206) Kalunian et al. (72) Derksen e t al. (109) Long et al. (207) Tincani et al. (208) Maier and Parke (209)
198 1 1985 1986 1986 1986 1986 1987 1987 1987 1987 1987 1988 1988 1989 1989 1989
Total
clinical events associated with aPL antibodies are too numerous to list in this review. With respect to thrombosis, virtually any vascular bed can be involved on the arterial or venous sides. We have previously summarized reports of arterial lesions (228), which include cerebral, coronary, axillary, brachial, ilio-femoral, aorta, visceral, and retinal arteries. On the venous side, there are many reports of deep venous thrombosis (DVT) and/or pulmonary embolism (PEmb), but inferior vena cava thrombosis causing Budd-Chiari syndrome has also been observed (229-231), as has renal vein thrombosis (232). Asherson and colleagues recently described 70 patients, 26 males and 44 females, with the PAPS where there was no evidence of SLE over 2-5 years of observation (233). The following features were observed: DVT in 31 (+PEmb in 13), arterial occlusion in 31, especially stroke or transient ischemia, 15 myocardial infarctions, recurrent fetal loss in 24, 32 had history of TCP, 10 positive Coombs’ test, 7 Evans’ syndrome, ANA in 32, but less than 1 : 160 in 29, and antimitochondrial antibody (AMA) in one third. A notable feature of this series is the relatively high number of males, compared with that in SLE.
220
H. PATRICK McNEIL E T A L .
Cerebrovascular disease as a result of arterial occlusion is a prominent feature in the APS. A number of major reviews of patients presenting with this problem have been published recently (228,234-237). The strokes are often multiple and can lead to multi-infarct dementia. Chorea is seen occasionally (238). Cardiac valvular lesions are found frequently, and are likely sources of cerebral emboli in some cases (239). Indeed, endocardia1 disease, including Libmann-Sachs and marantic endocarditis, is being increasingly recognized as part of the APS. Myocardial infarctions, although not noted initially (195), have been increasingly observed in young patients in association with aPL antibodies (228,240).In situ thrombosis has been documented in normal coronary arteries in some cases (228),but accelerated atherosclerosis is seen commonly in SLE (241),and raises the possibility that aPL antibodies may be involved in this process, apart from or related to the promotion of a prothrombotic tendency. Although most of the information gathered has been retrospective, there are a small number of prospective trials that also confirm the above associations with aPL antibodies. From our institution, Morton et al. (212)described the presence of aCL antibodies in 19%of patients with ischemic heart disease about to undergo coronary artery bypass grafting (CABG). The presence or subsequent development of elevated aCL antibody was found to be associated with increased risk of graft occlusion as assessed by angiography after 12 months. The risk was linearly related to level of aCL antibody. Aspirin appeared to protect graft occlusion much more in the aCL antibody-positive group than in those patients without the antibody (242). Lockshin et al. (66,81,184)have prospectively studied asymptomatic women with aPL antibodies and found that the presence of high-titer IgG isotype aCL antibody is predictive of recurrent fetal loss. Again, the risk is linearly related to aCL level (81).Such a quantitative risk relationship noted in these two prospective studies has also been found in two other retrospective reviews. Loizou et al. (185) studied 84 SLE patients, 46 of whom had aCL antibodies. The fetal loss rate in the ACL-negative group was 25%compared to 59% in the aCL-positive group. Dividing the latter into three subgroups based on low-, medium-, or highpositive levels, the fetal loss rates were 53%, 69%, and 89%, respectively. Harris et al. (196) reviewed 121 patients stratified into aCLnegative, low-positive, and high-positive aCL antibody patients. The risk of complications increased with antibody levels. For example, venous thrombosis occurred in 10%of patients without aCL antibody, 29% in low-positives, and 44% in high-positives. In summary, the following statements can be made about the clinical
ANTIPHOSPHOLIPID ANTIBODIES
22 1
relevance of aPL antibodies. Approximately 30-40% of patients with SLE have aPL antibodies. 50%of patients with aPL antibodies do not have SLE, but may have other autoimmune rheumatic diseases, miscellaneous conditions, or may be the result of certain drugs, expecially chlorpromazine. Transient aPL antibodies occur during many infections. Approximately 30% of patients possessing persistent aPL antibodies have suffered a thrombotic event, although it is likely that certain subgroups exist with higher or lower risks. The presence ofaPL antibodies defines a group of patients within SLE who display a syndrome of clinical features consisting of one or more of thrombosis, TCP, and fetal loss. The risk of this syndrome in SLE overall is around 25%;this risk increases to 40%in the presence of aPL antibodies and decreases to 15% in their absence. This syndrome is known as the antiphospholipid syndrome (APS) and is also seen in the absence of SLE, where it is known as the primary APS (PAPS),and also occurs in an overlap area between PAPS and SLE. The risk of this syndrome may be related to the level of aCL antibody and also to the isotype (see below). In studies of patients with features of this syndrome, (e.g., fetal loss, ischemic heart disease, venous thrombosis, immune thrombocytopenia) aPL antibodies have been found with variable but often high frequency.
D. GENETIC STUDIES OF aPL ANTIBODIES There have been only a few studies on the incidence of aPL antibodies within families. Shapiro and Thiagarajan found five instances in the literature of two family members having LA (33).These included sisters, brothers, a mother and daughter, and a father and son. Mackie et al. (243)described three families that included 19 individuals, 11 of whom had SLE or SLE-like diseases. Seven of nineteen had LA and nine of nineteen had aCL antibodies, but the two activities were discordant in some cases, thus twelve of nineteen had either LA or aCL antibodies. Interestingly, 5 spouses of patients with SLE or SLE-like diseases had aPL antibodies, suggesting an environmental factor may be important. Matthey et al. (244) also described a family where all members had aPL antibodies (father and mother included), though none had SLE. Jacobson et al. (245) described two brothers with LA who both suffered stroke. Mackworth-Young et al. (246) studied 22 patients with SLE and 101 first-degree relatives. Four patients (18%) and 8 relatives (7.9%)had aCL antibodies. All 8 relatives had clinical or serolgical abnormalities, compared to 30% of aCL antibody-negative relatives. The 8 relatives came from different families and only 3 were related to an aCL antibody-positive patient. Thus, 3 of4 aCL antibody-
222
H. PATRICK McNEIL E T A L .
positive SLE patients had one relative with aCL antibodies, but an additional 5 relatives from SLE patients negative for aCL had aCL themselves. In a large study, Alarcon-Segovia et al. (247) examined 72 families having at least one SLE member, totalling 467 individuals (89 SLE, 378 healthy). Fifty-five percent of the SLE patients and 17% of healthy relatives had aCL antibodies. Patients tended to possess both IgG and IgM isotypes, but relatives had mostly only IgG-aCL. Relatives of patients with aCL antibodies had a high incidence of abnormal complement haplotypes, compared to aCL-negative relatives of aCLnegative patients. Furthermore, patients with PAPS had relatives with SLE. In a study of 10 families ofpatients with PAPS, Alarcon-Segovia found an increased frequency of HLA-DR7 and/or certain complement-deficiency alleles. Savi et al. (248) also found an increased incidence of HLA-DR7 in SLE patients with aCL antibodies, and we have found the HLADRw53 haplotype (which associates with DR4 or DR7) to be more frequent in aCL-positive versus aCL-negative patients undergoing coronary artery bypass grafting (249). Thus, there appears to be strong genetic factors involved in the development of aPL antibodies, possibly involving complement deficiency alleles and HAL-DR haplotypes, but their presence in spouses suggests environmental agents may also be involved.
E. TREATMENT OF aPL ANTIBODY-ASSOCIATED SYNDROMES From the above discussion, it is clear that aPL antibodies (either LA or aCL) represent a significant risk factor for thrombosis, fetal loss, and thrombocytopenia. The treatment of the latter follows usual hematological recommendations, such as cortiocosteroid therapy, immunosuppressives, and more recently intravenous gammaglobulin. Often, no treatment is required if the reduction in platelet count is mild. The management of thrombotic events can be divided into acute and prophylactic, and into thromboses involving venous or arterial sites. Since not all persons with aPL antibodies will suffer a thrombosis, and there is currently no way of identifying those who will, preventive therapy is not recommended. Once a thrombotic event has occurred, acute management should follow standard methods, but should be individualized depending on age, site of occlusion, and presence of coexisting diseases. Since thrombosis in the setting of aPL antibodies often occurs in young persons, often with normal vasculature, vigorous intervention including thrombolytic therapy may be indicated. We have recently completed a review of this topc (228).
ANTIPHOSPHOLIPID ANTIBODIES
223
The duration of subsequent prophylactic antithrombotic therapy remains a controversial topic, but since it is likely the prothrombotic diathesis is ongoing, it has been recommended that therapy continue for as long as the aPL antibodies are present (250). Case reports of serious thrombotic recurrence following cessation of warfarin therapy in aCL-positive patients supports this recommendation (251).Warfarin therapy is effective in patients who have had venous thrombosis (151,250).The use of antiplatelet agents such as aspirin or dipyridamole may be the best form of treatment for preventing arterial thromboses (228), and aspirin alone has been shown to be highly effective in preventing aPL antibody-associated coronary artery bypass graft occlusion (242). The use of immunosuppressive agents is reserved for patients in whom antithrombotic therapy is not preventing vascular occlusion, but the efficacy of this treatment is unproven. The management of aPL-associated fetal loss is based on anecdotal reports, although a few comparative studies, mostly uncontrolled, have been reported. In 1983 Lubbe and Walker (252) reported a successful pregnancy outcome in a woman with previous fetal loss, following treatment with prednisone and aspirin, and later reported similar results in five other women (253). Subsequently, other workers have used prednisone plus aspirin and most have achieved improved fetal outcomes (192,254-257). The doses of prednisone required to suppress LA activity often result in unacceptable side effects (81,258),and Lockshin’s group recently reported in an uncontrolled comparative study that prednisone therapy was not effective (81). The numbers in the study were small, but there was a suggestion that aspirin therapy was effective. Also recently, Gatenby et al. (258)found that prednisone plus aspirin improved fetal outcome, while prednisone alone was ineffective. Two uncontrolled studies have also indicated antiplatelet therapy is effective in this situation. In a Dutch study, 37 women with prior fetal loss were treated with aspirin and dipyridamole with improvement in live birth rate from 18%to 93% (259). Forty-two women in a United Kingdom study were treated with aspirin alone, improving fetal survival from 10%to 88% (260). It is possible that the therapy of Lubbe and Branch may have been successful because of the aspirin component, rather than the immunosuppression. Thus, antithrombotic treatment may be the best treatment for fetal loss in similarity to aPL antibody-associated thrombosis, and Rosove et al. (261) used subcutaneously administered heparin throughout pregnancy to improve live birth rate from 1/28 to 13/14. Because of the side effects of steroids, a number of groups have used intravenous gammaglobulin successfully to prevent fetal loss (262,
224
H . PATRICK McNEIL E T A L
263). Others have tried plasma exchange with variable results (264,265). Since live births often occur despite the presence ofaPL antibodies, Lockshin considers that a prior history of late fetal loss, not attributable to other causes, in association with high-titer IgG-aCL or LA, is currently the only firm indication for treatment (266),and has stressed the need for close fetal monitoring, and preterm delivery if indicated (267). V. The Immunology of Antiphospholipid Antibodies
A. ANTIBODY ISOTYPE AND SUBCLASS
1, aCL Antibodies All 3 major immunoglobulin isotypes (IgG, IgM, and IgA) have been found in most patient groups in whom aCL antibodies occur. There are two notable exceptions; the IgM isotype occurs almost exclusively in chlorpromazine-induced aCL antibodies (170,174,175), and the IgC isotype similarly is almost invariable when aCL antibodies occur in HIV infection (158). In other circumstances, all isotypes occur with variable frequency, depending on the particular patient group. However, most studies find each isotype with an equal frequency of approximately 60% (Table IX) (64,71-74,80,222,227). In individual patients, each isotype has been found to occur exclusively, or in combination with another, or all three may he present. The clinical relevance of aCL antibody isotype is controversial, with inconsistent results between studies. Overall, it does appear that specific clinical events do correlate with certain isotypes. In a number of TABLE IX aCL ANTIBODY ISOTYPE Isotype frequency (%) Author Gharavi et al. (64) Triplett et al. (80) Weidmann et a1. (73) Wang et 01. (74) Vaarala et al. (71) Kalunian et 01. (72) Alarcon-Segovia (222) Mackworth-Young et al. (227) ND, Not determined.
Patient group PAPSISLE LA-positive S LE SLE Infections SLE PAPS PAPS
Number
IgG
IgM
IRA
40 61 53 49 47 36 9 20
90 77 23 63 32 61 89 70
63 62 57 43 62 53 55
53 N D” 75 61 60 64 ND ND
60
ANTIPHOSPHOLIPID ANTIBODIES
225
studies, Harris and co-workers have found that the IgG isotype, especially when present in high levels over a prolonged time period, is associated with high risk of thrombosis, fetal loss, and TCP (39,64,128,185,196,268).This concept is supported by examining the distribution of aCL isotypes in studies such as those listed in Table IX. The IgG isotype is very frequently found in patient groups selected because of the presence of complications (64,222,227). Lockshin’s group also consider the IgG isotype to be a specific predictor of risk of fetal loss, and in patients with SLE, the risk increases with the level of IgG-aCL antibody (66,81,184,266).Harris’s group has also consistently reported that the incidence of complications increases with increasing level of IgG-aCL antibody (185,196). Other authors have found slightly different results. Kallunian et al. (72) studied patients with SLE, in whom thrombosis and fetal loss were associated with the IgA isotype and thrombocytopenia with IgG. No complications were associated with IgM-aCL antibodies. Triplett et al. (80) studied 100 patients with LA, 61 of whom had aCL antibodies. Clinical complications did occur in a few patients with IgM only, but the majority had IgG +/- IgM. The level of aCL antibody did not distinguish between patients with complications and those without in these two studies. Unander et al. (205) studied women with recurrent fetal loss and noted the majority (83%)had the IgG isotype (+/- IgM) although 7/42 possessed IgM only. Those patients with the highest IgG-aCL antibody level appeared to fare the worst. In another series of similarly selected women, Lockwood et al. (199) found IgG-aCL antibodies to be associated with fetal loss, while those with IgM suffered only fetal growth retardation but managed a live birth. In contrast, Cronin et al. (181) found IgM but not IgG to be associated with fetal loss. Importantly, many of these studies did not specifically test for the IgA isotype, which could have possibly been present in the IgM-only patients. When considering subtypes of clinical complications, a number of studies have found the IgG isotype to be specifically associated with neurological complications in SLE and related autoimmune disorders including the PAPS (121,181,236),particularly cerebral infarction. Regarding hematological abnormalities, Alarcon-Segovia and co-workers found that thrombocytopenia correlated with IgG isotype (269),as did Harris (128),while hemolytic anemia was associated with IgM, and the combination (Evans’ syndrome) was associated with the presence of both IgG and IgM-aCL antibodies (270).Cervera et al. reported similar results (145).Weidmann et al. also found thrombocytopenia was asso-
226
H. PATRICK MCNEIL ETAL.
ciated with the IgG isotype, especially when present in high levels (73). . . The summary of all these studies is that the IgG isotype appears to be most strongly associated with thrombosis, thrombocytopenia, and fetal loss with some evidence that these complications are more likely to occur in patients with high levels. In those studies where these complications have occurred in the absence of the IgG isotype (80,205),IgA-aCL antibodies have not been measured. Thus IgA may also be “prothrombotic” (64),and the presence of IgM-aCL antibodies in the absence of IgG and IgA isotypes may be associated with a low risk of thrombotic events. However, in two different patient groups, individuals with IgG-aCL antibodies have been identified which do not appear to be associated with these clinical complications. Manoussakis et al. (92) found aCL antibodies almost exclusively of the IgG isotype in 52% of a group of healthy elderly individuals. Canoso et al. (158),Panzer et al. (161),and Stimmler et al. (162) have found an extremely high incidence of aCL antibodies, almost invariably IgG, in patients with HIV infection, with no apparent risk of thrombosis. However, it is quite possible that the IgG-aCL antibodies occurring in these two situations are inherently different from those present in patients with SLE, the PAPS, and related conditions. There have been a number of studies of the subclass of IgG-aCL antibodies with similar findings reported in each. Gharavi et al. (271) in a study of 35 patients with SLE and related diseases, found that IgG-aCL antibodies were distributed through all subclasses. In particular, IgGz and IgG, were present in 43% and 51% of cases, respectively, these two subclasses being quite uncommon with other autoantibodies such as anti-dsDNA which are predominantly IgGl or IgGn. Snowden et al. (272) studied 17 patients with SLE and SLE-like diseases and 11 others who had aCL antibodies associated with miscellaneous conditions not associated with thrombosis. The SLE group had predominantly IgG, and IgG2, and 2 patients had IgG,, whereas in the non-SLE group, IgGl and IgG3 were most common. Rote et al. (273) also found IgGl and IgGz predominated in 36 patients with aCL antibodies (98%and 89%).IgG3 was uncommon (36%)and in low quantities, and IgG,, though more common (56%),was also present in low amounts. Unander et al. (205)studied 10 women with fetal loss without SLE. IgG,, IgG2, and IgG, predominated (10/10, 8/10, and 10/10), while only 5 had IgG3. Tsutsumi et al. (274) found IgG1, IgG2, and IgG3. These consistent results indicate (1) further evidence that aCL antibodies and anti-DNA antibodies are different (see below), (2)there may be differences between IgG-aCL antibody subclasses between
ANTIPHOSPHOLIPID ANTIBODIES
227
those occurring in SLE where thrombosis is common, and those occurring in nonthrombotic conditions (it would be of interest to study IgC subclasses of aCL antibodies occurring in association with HIV infection), and (3) since IgCz and IgC4 are non-complement-fixing, complement may not be important in mediating pathogenic effects of aCL antibodies.
2. LA Antibodies Plasma that display LA activity can be fractionated and the LA activity shown to be due to IgC or IgM antibodies. Using these techniques, Lechner (30) studied 22 patients and found LA activity in 6 to be due to IgM only, 7 IgC only, and 9 both IgC and IgM. Of these latter 16 with IgC + / - IgM, SLE or SLE-like diseases predominated, while the IgM-LA-only group comprised a mixture of nonthrombotic patients. This absence of thrombosis in patients having IgM-LA only was again noted by the same author in a more recent review (195).Shapiro and Thiagarajan (33)found the majority of LA they studied were due to the IgC isotype, although they described in detail the characteristics of a monoclonal IgM-LA occurring in a patient with Waldenstrom’s macroglobulinemia (32). Boey, Colaco, and co-workers fractionated plasmas from 14 patients with LA and found 4 due to IgC only, 3 IgM, and 7 with both isotypes (97,101). LA have been described in association with phenothiazine therapy (170,174), and like the aCL antibodies occurring in this situation are invariably of the IgM isotype, and not associated with thrombosis (175). Thus, in similarity to aCL antibodies, both isotypes of LA occur and IgC may be more closely associated with thrombosis. An additional factor to consider is the isotype of LA, which commonly coexists in patients with aCL antibodies. As will be discussed in a later section, we have found that aCL antibodies and LA are separate antibody subgroups, and that isotype differences between the two can occur (275). For example, in one patient, aCL antibodies were of IgC isotype only, while LA was due to both IgC and IgM isotypes. In another, LA was of IgC isotype only, but aCL antibodies were due to both IgC and IgM. Thus, isotype discordance between the two antibodies can occur and thrombosis in a patient with IgM-aCL antibodies only could conceivably be associated with an IgC-LA present concurrently.
3. BFP-STS Whereas the Wasserman reaction is predominantly of historical importance, recently a solid-phase immunoassay has been developed, in which the VDRL antigen (CL/PC/cholesterol) is coated onto microtiter wells and the isotype of bound antibody is determined (79,276).
228
H . PATRICK MCNEIL E T A L .
Strandberg Pedersen et al. (276) found that in syphilis, both IgG and IgM anti-VDRL antibodies occurred, while in BFP-STS reactors, the IgM isotype predominated. B. AFFINITYPURIFICATION OF aPL ANTIBODIES In order to investigate the exact physicochemical and possible functional effects of aPL antibodies, it is necessary to separate from patient sera those immunoglobulins that specifically bind to phospholipid antigens. An affinity purification method is required to achieve this, and is best accomplished by immobilizing the phospholipid ligand on a solid phase support or in liposomes. These techniques will be described below, indicating the relative advantages and disadvantages of each, and the characteristics of the purified immunoglobulins obtained using each method.
1 . Immobilization of Phospholipids by Covalent Attachment onto a Solid-Phase Support No satisfactory method has been developed, although Laine et al. had covalently attached a glycolipid onto a solid support, and used this affinity column to purify antiglycolipid antibodies (277). A potential disadvantage of this approach is that chemical modification of the phospholipid during the linking reaction could alter the ability of aPL antibodies to bind. As discussed below, aPL antibodies appear to be directed against the phosphodiester groups in the head group region. Covalent linking invariably involves this hydrophilic domain with a resulting structural change of the antigenic epitope, and thus interference in antibody binding. In a similar manner, the structural presentation of phospholipid antigens is of great importance in determining antibody binding. Phospholipid antigens tend to form predetermined structures spontaneously depending on factors discussed in section 11. Molecules covalently linked to a solid support may not allow this spontaneous structure to form with the result that antibodies will not bind in an optimal fashion.
2 . Purification Using Phospholipid Liposomes In the 1930s and 1940s, a number of authors used various mixtures of lipids in an attempt to purify antibodies directed against C L [Witebsky
(1931, 1933), Bier and Trapp (1941), Davis et a1 (1945), reviewed in Alving and Richards (278)l. In 1974, Cooper et al. (279) used VDRL antigen (PC/CL/CHOL) to purify an IgM paraprotein with aCL antibody activity from a patient with Waldenstrom’s macroglobulinemia b y absorption then elution with 3M NaCL and ether. However, the
ANTIPHOSPHOLIPID ANTIBODIES
229
technique was described in most detail by Alving and Richards in 1977 (278), in which rabbit antiglycolipid antibodies were absorbed onto lipid liposomes, separated by centrifugation, then eluted using 1M sodium iodide (NaI) or a saline-chloroform mixture. The initial description employed liposomes containing phospholipid, cholesterol (CHOL), dicetyl phosphate (DCP), and a glycolipid, which was the ligand in those experiments. The eluted protein was shown to contain specific antiglycolipid antibody but also some nonspecific protein that was not characterized. Both IgG and IgM antibodies were purified. Although all the antibody activity in the serum could be removed during incubation with liposomes, only 50% could be eluted by NaI despite repeated elutions. Harris et al. (77) modified this technique by using liposomes containing only CL to affinity purify aPL antibodies from patients with SLE or related diseases. A similar technique of centrifugation and elution with 1M NaI was followed. Five antibody preparations were purified; 3 were IgG, and 2 were the IgM isotype. Similar to Alving and Richards’ results, the activity of the antibodies in a C L immunoassay was less than the sera from which they were derived probably because C L was present in the eluted immunoglobulins, but the affinity purified antibodies showed typical binding in C L immunoassays and also bound other anionic phospholipids. Four of the 5 preparations were reported to possess LA activity; with the IgG antibodies, this activity was only present at concentrations above 200 pg/ml; with the IgM antibodies, one had LA activity at 500 pg/ml, while the other had no activity at 150 pg/ml. Pengo et al. (280) used CL/CHOL/DCP liposomes to purify IgG antibodies from 5 patients with LA. Elution of antibodies employed 3 M NaCl, then mixing with ethyl ether to separate lipids from the purified antibodies. The authors had previously found that elution with 1M NaI resulted in significant contamination of antibody preparation with lipid ligand, and demonstrated that this did not occur with the above technique using radiolabelled CL. Organic solvent extractions of contaminating lipid following liposome purification have also been used by Frampton and Cameron (butanol) (281), Schorer et al. (chloroform) (282), and Levy et al. (chloroform) (283). The affinity purified antibodies prepared by Pengo et al. (280) contained albumin, and these authors used a subsequent protein A absorption. The final preparation showed LA activity at concentrations as low as 3.3 pg/ml and bound to CL, PS, PA, and PI in phospholipid immunoassays but the specific amount of immunoglobulin binding in these assays was not stated. These results are in contrast to those of Harris et al. (77)
230
H. PATHICK MCNEIL E T A L .
where LA activity was only demonstrated at very high antibody concentrations. Pengo et al. also found that their affinity purified antibody preparations could be separated into several bands by isoelectric focusing. The immunoglobulins possessing LA and aCL activities focused at pH 5.8. This result is in contrast to those of Bellotti et al. (284) who found that one polyclonal and three monoclonal immunoglobulins with LA activity had isoelectric points around p H 10-11. Violi et al. (285) used the technique described by Harris et al. to affinity purify aPL antibodies and indicated these preparations possessed LA activity, but the brief communication was lacking in substantial detail and has not been followed up with a more complete study. Similarly, Yamamoto et al. (286) described experiments in abstract form indicating antibodies binding phospholipids in solid-phase immunoassays could be affinity purified and possessed LA activity, but again, this data has not been published in detail. A problem with these studies is the poor characterization of the purified antibodies. It is unclear whether both Harris et al. or Pengo et al.’s method produced a mixture of LA plus aCL antibody types, or a single group possessing both activities. Thus, while liposome techniques offer advantages over covalently linked phospholipid columns, there remains considerable disadvantages. The major limitation is that the phospholipid is not truly immobilized, which results in contamination of the eluted immunoglobulin with lipid ligand, requiring an organic solvent extraction. It is also difficult to monitor the purification process since leaking phospholipid ligand can interfere with both the solid-phase immunoassay and tests for LA activity. As noted by Alving and Richards (278), and Harris et al. (77), it is not possible to purify all the antibody activity present in the original serum. Finally, there are technical disadvantages; phospholipid liposomes are difficult to standardize; further purification steps are required to remove nonspecifically bound protein.
3 . Phospholipid Affinity Columns Not Involving Covalent Linking A technique in which phospholipid ligands could be truly immobilized in a solid-phase support in a spontaneously adopted structure without the need for chemical modification would appear to offer considerable advantages over the above techniques. Marcus described a technique to immobilize lipid micelles containing glycolipids into a polyacrylamide gel (287),which was used to affinity purify antiglycolipid antibodies. We have recently described a modification of this technique in which mixtures of either PS and CHOL, or CL, CHOL, and DCP are incorporated into a solution of acrylamide/bisacrylamide, and immobilized by rapid polymerization (275,288,289).
ANTIPHOSPHOLIPID ANTIBODIES
23 1
The rigid gel is then homogenized and packed into a glass cylinder. Using radiolabelled PS, we showed that aCL antibodies bound to and could be eluted from the affinity column without contamination by lipid ligand. The major advantages over liposome techniques are that this technique is simple, and the purified preparation is phospholipid free. We found that these columns were able to purify antibodies that exhibited typical binding in solid-phase immunoassays (i.e., aCL-type antibodies) but they did not possess LA activity. This was the first report demonstrating that LA and aCL antibodies could be separately purified. Exner and co-workers have also published a method in which C L was absorbed onto a porous column prepared from siliconized sand coated with polystyrene (290). Again, the technique is simple and easily monitored, but the authors have not demonstrated that the CL is immobilized, and aPL antibodies appear to bind to a polystyrene column to which C L has not been added, raising doubts about the specificity of the technique.
4 . Affinity Purijication Using Nonphospholipid Ligands There is evidence that aPL antibodies can bind to the membranes of various cells and/or cross-react with nonphospholipid molecules. This topic will be discussed in a later section. However, this observation has been used to affinity purify aPL antibodies. Khamashta et al. used freeze-thawed platelets or erythrocytes to bind and elute aCL antibodies (291). Hazeltine et al. (108) also eluted aCL antibodies from the erythrocytes of a patient with a positive Coombs’ test in association with aCL antibodies. Fleck et al. (292)eluted antibodies with apparent LA activity using immobilized prothrombin. In summary, of the possible methods used to affinity purify aPL antibodies, the liposome technique is currently in widespread use despite having significant limitations. The polyacrylamide immobilization technique has significant advantages over liposome techniques, and we believe it will become the method of choice when affinity purifying aPL antibodies.
C. aPL ANTIBODY SUBSETS Although there has been an assumption in the literature that LA and aCL are similar antibodies, there is increasing evidence that they are separate antibody subgroups. Epidemiological studies indicate discordance between the presence of each activity in approximately 35% of patients with SLE/SLE-like diseases (80,293),although this varies from study to study. Many cases of aCL antibodies without LA have
232
H. PATRICK McNEIL E T A L
been noted (39,66,81,105,118,181,182),however some of these may be due to nonsensitive tests for LA activity. Even when a combination of sensitive tests are used, marked discordance has been noted (243).LA in the absence of aCL occur frequently (80,105,175,184,294),occasionally u p to 50% (175). Since the aCL antibody assay is a sensitive test, this discordance is unlikely to be due to false negative results, although since many studies have not assayed for IgA-aCL antibodies, this remains a possibility. In syphilis, there is complete discordance between reagin and LA (25).In 499 healthy individuals, LA was found in 40 cases, aCL in 54, but both in only 3 (70). Even when LA and aCL antibodies occur together, most studies indicate that the levels of each do not correlate (80,184,243,295),despite one report to the contrary (296). Additionally, treatment with steroids can result in variable changes in the levels of either activity (297-299). Explanations for the observed discordance have included (1) LA are in fact anti-PS antibodies that cross-react variably with C L (300), (2) since LA are heterogeneous (58), they are likely to have variable affinity for thromboplastin in a clotting test, versus C L in a solid-phase assay (91,243,294,295),while having similar phospholipid specificity, or (3)LA and aCL antibodies are indeed separate antibody subgroups (70,80,175,275,288,290,301). The second line of evidence suggesting aCL and LA are different is the results of studies on the immunological specificity of each antibody activity. These will be reviewed in detail in the following section but include differential absorption of LA and aCL by phospholipid preparations (26,33,294),and the experiments of Janoff and Rauch indicating LA recognize epitopes containing hexagonal structures of PE (1,63,302,303),with recent supporting data from Hughes’ group (294). In contrast, aCL are directed to lamellar arrangements of anionic phospholipids (1,64,77,79). Direct evidence for the separate subgroup hypothesis has been provided by experiments performed in our laboratory. The first suggestion came when we developed a polyacrylamide-phospholipid affinity column (288,289), described above, in which we were able to purify aCL-type antibodies that did not possess LA activity. Subsequently, we showed that plasmas containing both aCL and LA could be separated into fractions containing each activity in the absence of the other (275)(Fig. 3). In some patients, there was isotype discordance between aCL and LA. Furthermore, fractions containing aCL activity were polyspecific for all anionic phospholipids. Conversely, immunoglobulins with LA activity did not bind to any phospholipid in a solid-phase immunoassay, suggesting LA are directed to a more complex lipid
233
ANTIPHOSPHOLIPID ANTIBODIES
150 0
ffl
E
u
c
0
120;
-
Ql
N W 0
t 0
Z
90
a
m
Y
U
0
t I-
cn
m
a
60
.. .. . .
I-
ci
. .. ..
.
10
T CI
0 4
. ...
30 a
.
-J
.
30
50
70
90
110
130
0
F R A C T I O N NUMBER FIG.3. Cation exchange of plasma containing both LA and aCL antibody activities. Solid line = absorbance 280 nm; dotted line = aCL antibody level; dashed line = LA activity; broken solid line indicates the linear gradient ofeluting buffer (see Ref. 275). In this patient and four others, LA and aCL antibody activities could be separately resolved.
epitope (see below). Additionally, there was heterogeneity of aCL antibodies within individual patients, indicating that subsets of aCL exist. The sum of this information suggests that there exist a family of aPL antibodies that occur with variable concurrence in individual patients, such that the presence or absence of specific antibody subsets defines observable parameters, such as aCL level, LA activity, antimitochondrial antibody (AMA) of M5 type (see below), and possibly predisposition to thrombosis.
D. aPL ANTIBODYSPECIFICITY: THEIMMUNOLOGY OF PHOSPHOLIPID ANTIGENS When interpreting the large body of information concerning the structures to which aPL antibodies bind, it is important to first define the specific group of antibodies under study. A logical approach is to classify aPL antibodies by the methods used to detect them, and by the
234
H . PATRICK McNEIL E T A L .
diseases in which they occur, or if induced in experimental animals, b y the immunogen to which they have been raised (Table X).
1, Reagin and the BFP-STS It will become apparent from the following discussion that reagin, the aCL antibody occurring in syphilis, is immunologically distinct from those aCL antibodies occurring in SLE and related disorders that cause the BFP-STS, even though both are detected by the same test. Nevertheless, it is advantageous to review them together because of historical considerations, and because although both groups appear to be directed against CL, the binding epitopes of each are clearly different. This difference is due to structural presentation of the lipid antigen, and an appreciation of this concept will facilitate the more complex discussion regarding LA epitopes, and cross reactions of aPL antibodies with nonlipid structures. The antigen used in serological tests for syphilis consists of a combination of CL, PC, and CHOL in a ratio of 1 : 10 : 30 w/w/w (304).There is no doubt that CL is the antigenic component of the VDRL complex (12,305),despite some suggestions to the contrary (142),although PC is an essential auxilliary lipid, which by itself has no reactivity with reagin. This VDRL antigen consists of a core of cholesterol surrounded by a lamellar arrangement of PC and CL (306). However, the physical nature of this structure differs markedly from the typical bilayer phase of CL liposomes (1). Much of the information on the specificity of reagin has come from experiments on reaginlike antibodies induced in rabbits by injection of VDRL antigen complexed with syphilitic serum (307),or with methylated BSA (MBSA) (305).The serological reactivity of these specifically determined aPL antibodies and syphilitic sera were found to be the same in most, but not all respects (308). Nevertheless, in a series of experiments using synthetic C L analogues both as immunogens and as TABLE X CLASSIFICATION OF PHOSPHOLIPID ANTIBODIES Antibody type
Test
Disease
Reagin Acute BFP-STS Chronic BFP-STS LA aCL antibody Antilipid antibody
Agglutination Agglutination Agglutination Coagulation test RIA/ELISA Agglu tination/ELISA
Syphilis Infections SLEIAPS SLE/APS SLEIAPS Experimental
ANTIPHOSPHOLIPID ANTIBODIES
235
antigens in the VDRL test, Inoue and Nojima determined that the antigenic component of CL consisted of 2 phosphodiester groups separated by 3 methylene groups (glycerol),but the central hydroxyl group was also important (309). Additionally, the diglyceride structure was essential since if this part of the molecule was substituted with benzene rings, reactivity was absent. Structures containing only 1 phosphodiester group (e.g., PA, PG) were not as active as CL, and indeed Fowler and Allen (310) found that PA substitued for CL in VDRL produced rabbit antisera with different immunological specificity to reagin. Costello et al. (311) have recently found virtually identical results to Inoue using CL analogues both with syphilitic sera and in sera from patients with autoimmune states. Further evidence that reagin interacted with this region was obtained by Schiefer et al. who used spin-labeled probes inserted into CL/PC liposomes either near the head group or in the hydrophobic interior (312). Binding of rabbit anti-VDRL antibodies to these CL/PC liposomes produced tighter packing at the polar head groups but the interior probe was unaffected. In further studies by Nojima’s group, it was found that CHOL was not a necessary component of the VDRL-MBSA complex to produce active rabbit antisera, but PC was vital (305,313).Of relevance here is Kanemasa’s observation that CL-CHOL particles form an irregular network structurally without any lamellar arrangement (306), indicating the necessity of a particular structural arrangement for immunogenicity. Nojima’s group also showed that hydrolysis of up to 80%(but no more) of the polar head groups of PC by phospholipase C did not diminish antigenic reactivity (313). However, if diglyceride is substituted for PC, active liposomes are not formed. Thus PC appears vital for the proper orientation of the molecules but the structure can be maintained without most of the choline head groups (314).The sum of all these studies is that aCL antibodies occurring in syphilis recognize the CL antigen epitope presented in an ordered spherical lamellar arrangement of which PC contributes a vital role. The sera of patients with SLE, the APS, and related autoimmune disorders can also contain antibodies that react with the VDRL antigen (BFP-STS), almost always at low titers of serum (13).This is not due to low antibody levels since patient sera display high binding to pure CL in solid phase immunoassays (39). Conversely, sera of patients with syphilis who have high VDRL titers often have low or negative binding in CL solid-phase assays (79,102). The aCL solid-phase assay is 200-400 times more sensitive in detecting aCL antibodies in SLE patients than the VDRL agglutination test (39).Strandberg Pedersen et al. adapted the agglutination test to an ELISA using the VDRL antigen
236
H . PATRICK McNEIL E T A L .
and found that this test was considerably more sensitive in detecting aCL antibodies in syphilis than the C L ELISA (276). Harris’s group has also reported identical results (79). Furthermore, inhibition studies showed that CL liposomes absorb aCL antibodies from SLE sera best while VDRL liposomes remove syphilitic aCL antibodies better than CL liposomes (77,79,276).Using inhibition and direct binding studies at very low antigen concentrations, Harris et u1. also showed that syphilitic aCL antibodies recognize CL in VDRL best, or less strongly pure CL, but not PA nor PS (79).PA or PS mixed with PC and CHOL were more active against syphilitic aCL antibodies than PA or PS alone. Conversely in SLE and related conditions, the aCL antibodies recognized PA and PS equally as well as CL, the VDRL antigen less strongly, but the addition of PC and CHOL to PA or PS markedly diminished antibody binding. Thus, the differential sensitivities of aCL antibodies in each condition to the CL or VDRL ELISA are not due to the method of detection, but to differences in the antigen. Since this is CL in both conditions, aCL antibodies in syphilis and autoimmune diseases are clearly immunologically distinct because they recognize variations in structural presentation of the CL antigen (1). However, the antibodies causing the BFP-STS in autoimmune states are likely to be the same as those binding in solid phase CL assays, and the lack of correlation between the two noted by many studies (65,66,77,78,108,142)is due to the VDRL complex being an inappropriate antigen to detect these antibodies. 2 . uCL Antibodies The aCL antibodies occurring in autoimmune states display an additional feature alluded to above, i.e., they cross-react quite strongly with other anionic phospholipids but not the zwitterionic phospholipids. Harris et al. were the first to clearly show that the binding of aCL antibodies to C L in solid phase assays could be inhibited by incubation of the sera with liposomes of PA, PI, PS, PG, or CL, but not PE nor SM (78). The same group subsequently showed that affinity purified aCL antibodies or patient sera bound directly to these same anionic phospholipids coated onto microtiter wells (64,77,79).These findings have been confirmed in many subsequent studies (73,74,80,81).Apart from occasional patient sera reported to display differential binding, as a general rule, aCL antibodies are polyspecific with more or less equal activity with all the anionic phospholipids but not PC, SM, and not usually PE. This wide immunological specificity is quite different from reagin, which appears only to recognize C L in the VDRL arrange-
237
ANTIPHOSPHOLIPID ANTIBODIES
ment (see above). As PA is bound equally, and often more strongly than CL, the antigenic group for these antibodies must consist of a single phosphodiester group plus diglyceride. The hydroxyl group found in C L and the variable head groups appear not to be antigenically important. However, the phosphatidyl group is also found in PC and PE, and it is therefore problematic why these latter phospholipids do not react with these antibodies. One explanation is that the phosphodiester groups must be negatively charged to interact with these aCL antibodies. In PC and PE, the cationic choline and ethanolamine head groups are likely to interact with (6)and neutralize the anionic phosphate groups, whereas CL, PI, PA, and PG have either uncharged or anionic head groups, and PS has an electrically neutral head group. This would explain why the addition of PC to PA or PS markedly reduced binding of aPL antibodies (Fig. 4).However, since immunoglobulins are very much larger than phospholipid molecules, it is quite likely that each immunoglobulin binding region will interact with a number of repeating phosphodiester groups. It is therefore problematic why the antibodies recognize each anionic phospholipid equally since, for this to occur, it follows that each phospholipid must adopt identical spatial structures when present in a lamellar configuration. In view of the variable head group
0 0 -0- 0-CH2- CH2-NH3+-O-y- 0-CH2- CH2- NH3'
6-
A
?
CH2-vH-CH2
Oc=o Qc=o
B
QQ qH2-qH-CH2
8
SH2IHc=o c=o
CH2
O= y- 0-CH2- FH-NH3'
Q
P
c=o c=o
9-
O=y- 0-CH2- TH- NH3'
9
coo-
coo-
FH2-FH-CH2 P
O
c=o c=o
FIG.4. (A) The head group area of two adjacent PE molecules. The cationic ethanolamine head group is able to interact with an adjacent phosphate, thus neutralizing this anionic component. (B) The head group area of two adjacent PS molecules. Because the head group is electrically neutral (having a cationic NH3 and anionic carboxyl group) the anionic phosphate is not neutralized. Thus the presence of ethanolamine or choline groups in PE, PC, and SM neutralize the anionic phosphate, and it is likely that aCL antibodies require phosphate groups to be negatively charged to bind to phospholipids.
238
H . PATRICK McNElL ETAL.
sizes, and different fatty acid compositions, this would seem unlikely. Nevertheless, if this explanation is accepted, what is the immunological significance of antibodies with such a broad specificity? Does this mean that the antigen-antibody interaction will be of low affinity? Is it likely that antibodies of possible pathogenic significance should apparently be so polyspecific? Insight into the answers to some of the questions can be gained by examining the immunologic properties of naturally occurring antilipid antibodies (315). In 1965, Boyden (316) showed that the sera of normal individuals and nonimmunized animals contain antibodies reacting with various antigens and these are termed “natural antibodies.” It has since been shown that most of these natural antibodies are polyspecific and able to react with self-antigens (317,318). Although polyspecific, these antibodies bind to tissue sections indicating that binding affinities are not necessarily low. Natural autoantibodies react with small haptens, in a polyspecific manner, and although the affinity of the antibody for these small molecules is low, it becomes high when they are associated with macromolecules (318).Naturally occurring antibodies directed against lipid antigens have been found to be ubiquitous in normal human sera (1). Alving has found that all of the antilipid antibodies share a common characteristic of having a subsite in the antibody combining site that has a specificity for soluble phosphate esters (315). Thus, lipid antigens (or nonlipid antigens) that display repeating phosphodiester groups are likely to be recognized by these natural autoantibodies. The physiological role of such antibodies is by no means clear, but it has been suggested that small haptens may be involved in eliminating debris, dead cells or toxic substances by binding to macromolecules, and then being recognized by polyspecific natural antibodies (319). Regardless of their role, it remains uncertain whether aPL antibodies occurring in autoimmune states represent clonal expansions of polyspecific natural antibodies or arise from another origin (320). Interestingly, high levels of IgG and IgA isotypes of natural autoantibodies have been described in SLE ‘(321).Sutjita et al. (322) raised an antiidiotype antibody directed against the antigen binding region of a naturally occurring polyspecific antibody with reactivity against CL. This idiotype was identified on a high proportion of sera from patients with autoimmune diseases, suggesting that aPL antibodies in these conditions are related to and presumably arise from these polyspecific natural autoantibodies. An alternative explanation for the apparent polyspecificity of aCL antibodies is that these autoantibodies are in fact not directed to pure lipid antigens, but to complexes formed between lipid membranes and
ANTIPHOSPHOLIPID ANTIBODIES
239
proteins. There has been to date little evidence for this hypothesis. The information that is available comes predominantly from experiments examining the interaction of aPL antibodies with cell surfaces. From this perspective, it is pertinent to point out that membrane phospholipids, under normal conditions, are unlikely to be accessable for interactions with circulating antibodies. This is because membrane glycoproteins and glycolipids extend outward from and cover the lipid bilayer. For example, when glycolipid/phospholipid liposomes are formed in a ratio normally found in erythrocytes, the binding of the relevant aPL antibody is suppressed compared with binding to liposomes not containing glycolipid (315).This is due to steric hindrance by the carbohydrate head groups of the glycolipid. Furthermore, as discussed earlier, anionic phospholipids are confined to the cytosolic surface of the membrane, and CL is only found in mitochondria. Alving’s group has investigated the binding of monoclonal antiliposome antibodies to macrophages (323).The antibodies did not bind to intact cells, but binding did occur following cell adherence, or after trypsin treatment, suggesting that only after removal of membrane hindrance groups by adherence or enzymatic treatment were the antibodies able to bind to membrane phospholipids. Rauch’s group has produced human monoclonal antibodies from lymphocytes of patients with SLE, and selected various clones on the basis of LA activity or phospholipid specificity (302).These antibodies were tested for their ability to bind to platelets under resting and disrupted conditions using phospholipases, trypsin, proteases, and DNAase. Binding varied between the different clones, and with different treatments, but in general, the data suggested that the antibodies were directed against both phospholipid and protein determinants. Antiplatelet activity correlated with anti-PE and aCL activity of these antibodies (303).The same group also detected aCL antibodies bound to erythrocytes from patients with SLE, and postulated that these were directed aginst the Rh antigen on the cell surface (108).Green et al. (324) had previously demonstrated that this antigen is composed of a lipid protein complex. There are theoretical reasons to suggest that aCL antibodies recognize a lipid-protein epitope. There are a number of lipid-binding proteins that bind to anionic phospholipid surfaces, such as certain apolipoproteins, lipocortins, placental anticoagulant protein, extrinsic pathway inhibitor, C-reactive protein, P-2-glycoprotein-I, and some coagulation proteins. Many of these have functions in coagulation pathways and are of potential interest when considering aPL antibodymediated thrombosis. Interactions between aCL antibodies and such
240
H. PATRICK McNElL ET AL.
lipid-protein complexes may not be dependent on the actual lipid present, with any anionic phospholipid surface complexed with a specific protein suitable for binding. This concept could explain the apparent phospholipid polyspecificity. Indeed, recently, we have found that after purification of aCL antibodies using sequential fractionation techniques, they did not bind to CL in solid phase assays or in polyacrylamide affinity columns. Binding only occurred if an additional serum or plasma cofactor, subsequently identified as P-2-glycoprotein-I (P-BGPI),was present. P-2GPI is a plasma glycoprotein known to interact with anionic macromolecules such as PS, CL, heparin, and DNA (325).The cofactor effect on aCL antibody-CL interactions was dose dependent. Moreover, aCL antibodies recognized P-2GPI bound to CL or PS but not P-2GPI bound to heparin sepharose, nitrocellulose, or affigel suggesting that a complex consisting of P-2GPI and anionic phospholipid is the epitope to which aCL antibodies are directed (326). In summary, most evidence suggests that the aCL antibodies that occur in autoimmune diseases are polyspecific for anionic phospholipids recognizing epitopes composed of repeating single negatively charged phosphodiester groups. The variable head group is not essential but must not be positively charged. These antibodies recognize lamellar phospholipid structures and differ from reagin, which binds the complete CL epitope (composed of two phosphodiester groups spaced by three carbons with a central hydroxyl group) in a structurally different complex which must include PC. There is some evidence suggesting aCL antibodies arise from naturally occurring polyspecific antilipid antibodies. Alternatively, the polyspecificity could be due to aCL antibodies being directed to a protein complexed with anionic phospholipid, and studies from our laboratory indicate that the protein component is P-BGPI.
3. LA Antibodies As discussed in previous sections, LA activity is found in the plasmas of the same group of patients in whom aCL antibodies occur. However, LA does not occur in syphilis (25). Some authors believe that LA activity is caused by the same antibodies detected in CL solid-phase assays (59), but increasing epidemiological data noted above (70,80,175,184) does not support this concept. Currently, many workers in the field believe that there are aCL antibodies that do not possess LA activity (280), and possibly vice versa (80), although the existence of antibodies with dual activities is accepted as real. Our studies suggest that LA and aCL antibodies are separate antibodies
ANTIPHOSPHOLIPID ANTIBODIES
24 1
that appear to occur concurrently in patients (288), but possibly with much less concordance in “normal” individuals (70), which display different phospholipid specificity (275).We found that after separation into antibody subsets, aCL-type antibodies recognize anionic phospholipids immobilized on microtiter wells in an identical fashion to the plasma from which they are derived, but they did not display LA activity. Thus, the polyspecificity for anionic phospholipids seen in plasma with aCL antibodies is due to this class of antibody. In contrast, LA immunoglobulins, once separated from aCL-type antibodies, did not bind any phospholipid in solid-phase assays. Although we have therefore determined that aCL and LA have different specificities, we did not define the particular antigens to which LA are directed. Indeed, the specificity of LA antibodies has yet to be adequately characterized. When reviewing the large body of literature concerning LA, the vast majority of publications state that LA are immunoglobulins with specificity towards anionic phospholipids, quoting in reference the study by Thiagarajan et al. of an IgM monoclonal LA (32).Indeed the authors of that study stated in a further publication as recently as 1987 (280),“the assumption (that LA have immunologic specificity towards anionic phospholipids) has been directly demonstrated in only one patient,” referring to their previous study. However, Thiagarajan et al.’s studies both in 1980 and 1987 have not definitively clarified the specificity of LA, and a review of this assumption is warranted. First of all, there is much evidence that LA are aPL antibodies, but there is less information regarding the specific epitopes to which they are directed. The evidence that LA are aPL antibodies is predominantly indirect: (1) there is a strong association between aCL antibodies (detected either as BFP-STS or in solid-phase assays) and LA activity (16,20,23,25,26,30,35,37,39,127,142);(2) LA activity can be corrected or neutralized by the addition of phospholipids or procoagulant platelets (26,30,34,44,52,60,295); (3)LA prolong phospholipid dependent clotting tests, and evidence favors that this occurs by inhibition of the interaction between preformed prothrombin activator complex (factor V,-X,-phospholipid) and prothrombin (28);and (4) the most sensitive tests to detect LA employ minimal amounts of phospholipid (37,41,43,45,46).Indeed the KCT is exquisitely sensitive to the presence of added phospholipid such that the KCT of normal plasma varies with the amount of added phospholipid, similar to the variation of the KCT with the “strength” of an LA, suggesting that coagulation factors, e.g., prothrombin, and the LA compete for coagulant-active phospholipid surfaces (52).
242
H. PATRICK McNElLETAL
Thiagarajan et al.’s report in 1980 of a monoclonal IgM paraprotein from a patient with macroglobulinemia, which acted as an LA, is cited as direct evidence that LA bind anionic phospholipids (32).The IgM or its Fab fragment caused the typical coagulation abnormalities of an LA and inhibited the binding of factor X and prothrombin to phospholipid micelles. However, the IgM did not inhibit binding of factor X to intact, or thrombin treated platelets, nor to platelet membrane preparations, even though addition of platelets to patient plasma corrected the LA effect. IgM or Fab fragment precipitated with PS, PA, or PI but not PC nor PE in an immunodiffusion system. Although these detailed studies indicate that this particular monoclonal antianionic phospholipid antibody acted as an LA, the extrapolation of these results to the polyclonal LA that occur in autoimmune patients may not be applicable. First, the concentration of the IgM in the patients’ plasma was 20-30,000 pg/ml, and when the purified IgM was added to normal plasma, an LA effect began to be noted at paraprotein concentrations of 200 pglml(327). This compares to Thiagarajan et al.’s later estimate on affinity purified polyclonal LA, that the dRWT could detect LA at concentrations of 3 pg/ml (280). Second, Thiagarajan et al. were unable to repeat the inhibition of prothrombin binding to phospholipid when using polyclonal IgG-LA from patient plasma (33).Third, even though specificity for anionic phospholipid was demonstrated, the affinity of the monoclonal IgM for phospholipid was calculated by other workers to be low (328). Fourth, Rauch et al. have produced human monoclonal antibodies with LA activity which have wide ranging but diverse reactivities against phospholipids (302). Other monoclonal LA have been described which bind PS and PE but not CL, PA, nor PI (329), or with other specificities (284). These observations suggest that the properties of one monoclonal LA may not be relevant to polyclonal LA occurring in the usual clinically relevant setting. The second direct evidence purported to show that LA are antianionic phospholipid antibodies comes from studies of affinity purified aPL antibodies. Harris et al. (77) and Pengo e t al. from Thiagarajan’s group (280) have used CL liposomes to purify immunoglobulin, which have shown (1)activity against anionic phospholipids in solid phase assays, and (2) LA activity. The affinity purified antibodies prepared by Harris et al. only exhibited LA activity at high (> 200 pg/ml) concentrations, although binding to CL occurred at 2-4 pg/ml. The preparation purified by Thiagarajan’s group caused LA activity at 3.3 pg/ml and bound CL, PS, PA, and PI in ELISA but the report did not state the amount of antibody binding in the ELISAs. These affinity purified antibodies also inhibited binding of prothrombin to PS-coated micro-
ANTIPHOSPHOLIPID ANTIBODIES
243
titer wells b y approximately 70% when present in a concentration of 134 pg/ml. This observation has been interpreted as evidence that vitamin K-dependent coagulation factors, such as prothrombin, react with PS surfaces in an interaction involving Ca2+ (since the presence of EDTA abolished prothrombin binding) and that LA inhibit this binding presumably by acting as anti-PS antibodies. However, our findings that LA do not bind isolated PS in microtiter wells are at odds with Thiagarajan’s group’s observations. As noted above, our own group has recently developed alternative affinity purification techniques, and shown that the LA and aCL antibody activities can be separately purified (288-290). These recent findings suggest the possibility that the preparations purified by Harris et al. and by Thiagarjan’s group contained a mixture of both LA and aCL antibody subgroups. Thus the binding of immunoglobulin to anionic phospholipids could be due to aCL-type antibodies present concurrently with LA antibodies in the purified preparation. The same applies to the inhibition of prothrombin binding to PS. The difference in immunoglobulin concentration required to cause the different effects supports this contention. Therefore, inhibition of prothrombin binding to PS might be due to aCL antibodies, not LA, and the interpretation that these experiments clarify the specificity and mechanism of action of LA is not substantiated. However, these experiments and those of Zwaal and Hemker (7) (see below) indicate that PS is the major procoagulant phospholipid responsible for calcium-mediated interactions with prothrombin and factor X occurring in uitro. This has lead to the suggestion that LA are anti-PS antibodies, and thus are usually but not always cross-reactive with CL, thus explaining the usual concordance but not infrequent discordance between LA and aCL antibodies. Branch et al. have been major proponents of this theory. They were one of the first groups to develop an ELISA using thromboplastin as the antigen as a putative assay for LA activity (88). In a subsequent publication (300), they assayed 15 sera with LA activity for antibodies to PS, CL, PC, PE, PG, and PI, and found that all 15 cases possessed IgG antibodies to PS, but of 11 sera tested for aCL antibodies, 1 was negative. CL and PS liposomes absorbed LA activity as assessed by binding in the thromboplastin ELISA; PS in every case, but one of the sera was not affected by incubation with CL. Branch et al. suggested this data indicated that LA activity was always associated with the presence of aPS antibodies. The small number of cases studied leaves their data open to other interpretations, for example, the phospholipid ELISAs were measuring aCL-type antibodies present concurrently in the LA sera.
244
H . PATRICK McNEIL E T A L .
Since this study, a number of other groups have developed thromboplastin ELISA (89-91). Some have provided indirect evidence that this assay is detecting antibodies that cause LA activity (90). However, once again, our demonstration that LA do not bind in solid-phase ELISAs suggests this not to be the case, even though we used isolated phospholipids and not thromboplastin (275). In support of our results, Harris and Hughes’ group identified 7 patients with LA whose sera did not bind to any phospholipid, including thromboplastin, in solid-phase assays, yet LA activity in all could be corrected by addition of thromboplastin (294), indicating that LA do not bind phospholipids immobilized in microtiter wells, regardless of the type of lipid. Further evidence for this has been provided by Vermylen’s group who have used the thromboplastin ELISA to test for LA. They recently presented the results of assaying 146 plasmas sent for LA testing using a number of clotting tests, and ELISAs for antibodies to CL, PS, and thromboplastin (91). There was reasonable agreement between the different clotting tests (r = 0.75) and between the 3 different ELISAs (r = 0.80),but poor correlation between clotting tests and ELISAs (r = 0.50), suggesting that the thromboplastin and PS ELISA are detecting aCL-type antibodies and not LA. Some recent experiments provide the basis for an alternative approach to study LA specificity. As discussed in section IV of this chapter, the platelet neutralization procedure (PNP) (34,44,61) has been recommended as a vital step to demonstrate the phospholipid specificity of a coagulation inhibitor to distinguish LA from specific factor inhibitors (43). There are at least two possible explanations of why this neutralization occurs: (1) the procoagulant platelet material binds and absorbs the LA immunoglobulins, removing the inhibition of clotting, or (2) the platelet material provides a procoagulant surface for the assembly of activated clotting factors. Kelsey et al. (52) tested the effects ofLA plasma in an aPTT system to which various liposomes were added. Liposomes containing CHOL/PC/PE and PS corrected the LA effect in a linear fashion related to the amount of PS in the liposome. No other phospholipid except PS had this effect, including those which aCL antibodies interact with, but liposomes containing PS alone or PC/PS had no such effect. Kelsey et al. interpreted these results to indicate that the liposome containing CHOL/PC/PE/PS provided additional active phospholipid surfaces to support coagulation factor assembly, rather than absorption of LA by excess antigen, but suggested that both LA and coagulation factors could bind competitively to these surfaces. The exact nature of these coagulation-active surfaces has yet to be defined. Thiagarajan’s group considered PS immobilized in a microtiter well was sufficient (280), but the limita-
ANTIPHOSPHOLIPID ANTIBODIES
245
tions of that interpretation have already been discussed. Kelsey et al.’s results suggest PS is essential, but that a complex rather than simple surface is required, involving the additional presence of PE and CHOL. Zwaal and Hemker (7) studied the procoagulant effect of various phospholipid liposomes in in uitro clotting systems and also found PS to be an essential requirement. However P U P S was much less active than more complex mixtures including PE and/or CHOL, and it was clear that subtle changes in phospholipid composition had important consequences with respect to prothrombinase activity. Furthermore, liposomes containing PS and PE adopt a lamellar phase, but addition of calcium results in phase separation of PS, allowing PE to adopt the hexagonal phase. Exner et al. studied the effects of various phospholipids added to the Russell viper venom time (330), and found platelets and thromboplastin corrected the prolonged clotting time, with PE being the most effective single phospholipid. Vermylen’s group generated platelet vesicles containing procoagulant activity using high doses of calcium ionophore. When added to LA plasma, these vesicles completely corrected LA activity, but when removed by centrifugation, LA activity was regenerated indicating the vesicles produced a catalytic surface for clotting to occur but did not bind LA. Furthermore, these vesicles did not absorb aCL-type antibodies when present concurrently in the plasma (91).However, Khamashta et a2. (291)have shown that freeze-thawed platelets can bind aCL antibodies. Rauch’s group has produced human monoclonal antibodies with LA activity from peripheral blood lymphocytes of patients with SLE (302,303). The LA activity of these antibodies can be corrected by addition of hexagonal phase PE, but not lamellar PE to a system also containing thromboplastin (331).That the hexagonal phase was important, and not the specific phospholipid, was demonstrated using egg PE derived from egg PC [egg PE(PC)].This phospholipid adopts the lamellar phase at 37°C and the hexagonal phase on heating to 43°C. Egg PE(PC) neutralized LA activity when the experiment was performed at 43°C but not 37°C. As emphasized in a previous section, some caution is advised when extrapolating from monoclonal antibody studies. However, Rauch and Janoff have also shown that addition of hexagonal phase PE corrects the LA activity in plasma of patients with SLE (63). Hughes’ group has also confirmed these findings, noting that CL, PS, PC, or PE liposomes did not correct plasma LA activity but hexagonal phase PE or Thrombofax’” did (294). Janoff and Rauch have examined this effect further, suggesting that LA interacts with the lipid at the interface between the hexagonal aggregrates and the aqueous medium. This is likely to consist of a
246
H. PATRICK McNElL E T A L
monolayer of lipid with unusual packing properties that can expose different epitopes than those exposed by a bilayer system (1). They have suggested that this unusual monolayer may have similarities to bilayer lysophospholipids and further showed that mono-oleoyl PE (MOPE) (lyso-PE) in a bilayer arrangement can correct hybridoma LA activity. Janoff and Rauch have interpreted this to indicate that bilayer lyso-PE (MOPE) exposes different epitopes not present on bilayer diacyl-PE and that hybridoma LA interacts with cryptic epitopes on PE formed either (1) on the outer monolayer when PE adopts the hexagonal phase, or (2) when PE is hydrolyzed by phospholipase (e.g., during cell activation to release arachidonic acid) to produce lyso-PE. How do Janoff and Rauch’s findings fit with those of Kelsey et al. (52) and Zwaal and Hemker (7) who have found that PS appears to be the important phospholipid which can correct LA activity? It should be noted that the 4-component liposome used by Kelsey et al., which contained PE and CHOL, was necessary, while P U P S liposomes did not correct LA activity. Additionally, as noted above, some workers, including Zwaal, have suggested that PE and PS are synergistically involved in causing procoagulant activity (3,7),most likely involving calcium interactions with PS, allowing subsequent PE hexagonal phase change. Thus, it is conceivable that hexagonal PE, though not the epitope to which LA are directed, provides a specific architecture that induces an unusual structure in the overlying monolayer of other lipids, including PS, whereas these lipids in bilayer form are not recognized by LA antibodies. Of relevance is Rauch’s finding that the LA hybridomas did not bind to CL, PE, PS, PI, nor PC in 22/25,18/24, 17/19, 17/19, and 20/21 clones, respectively, when tested in solidphase assays (303), which present phospholipid in an immobilized lamellar form (I), consistent with our findings that polyclonal LA do not bind phospholipids in this structural presentation (275).The view that LA are directed against phospholipid epitopes, which include hexagonal or cryptic epitopes, could explain the discordance between LA and aCL antibodies, which as discussed earlier, recognize phospholipid in a lamellar form. Other workers have modified this distinction to suggest that the difference between LA and aCL antibodies is an affinity for phospholipids either in suspension or on a monolayer, although both may ultimately recognize PS (91).Staub et al. found that PE extracted from platelet membranes inhibited aCL antibody binding more than any other phospholipid, but the aCL antibodies did not bind PE coated on a microtiter well (294).Janoff and Rauch also noted that aCL antibodies in SLE sera (detected in a liposome lysis assay) could be removed
ANTIPHOSPHOLIPID ANTIBODIES
247
by incubation with hexagonal PE (1).This difference between antibody recognition of phospholipid, either in suspension (such as an absorption experiment) or in monolayer (as in a solid phase assay), has also been noted by Harris et al. for the VDRL antigen (79). aCL antibody activity could be inhibited by incubation with VDRL antigen, but there was no binding of the same sera to VDRL immobilized in an ELISA. In this instance, the antigen in each case is CL, but differential recognition occurs because of altered structure of the C L antigen. A similar situation could be postulated with LA and aCLboth may recognize PS, but each may recognize different structural presentations of the antigen. An additional interesting aspect of Rauch’s findings is that the occurrence of cryptic phospholipid epitopes in uivo (such as involving hexagonal phase or lysophospholipids) may be a result of disease or tissue damage, thus exposing a neoantigen that could be the immunogenic stimulus for aPL antibodies. In this regard, P-2GPI has been thought to be important in binding anionic macromolecules released during tissue destruction or in infections (332). Since we have evidence to suggest that aCL antibodies are directed to a lipid-P-2GPI epitope (325), it is possible that a complex of phospholipid bound to P-2GPI could be the neo-antigen for aCL-type antibodies. Is there any evidence that LA also interact with such a complex? There are two pieces of evidence that suggest this may be the case. The first is the LA cofactor phenomenon. This describes the situation where a mixture of normal and patient plasma causes a longer clotting time than the patient plasma alone, indicating that normal plasma provides a cofactor that augments the LA-mediated inhibition of in uitro clotting. This was first noted by Loeliger (31), who suggested prothrombin was the cofactor. Subsequently, it has been thought to be d u e to immunoglobulin (28), or a complementlike molecule (29), but the identity of the cofactor remains unknown. The cofactor effect is only demonstrated in a proportion of patients, presumably because the cofactor level is low in only some patients. This implies that the cofactor is involved in all plasmas, but is present in sufficient quantities in those plasmas not demonstrating this effect. How the cofactor acts is totally unknown, but since it is clearly important in the interaction between LA and phospholipids, it is possible that LA are indeed directed to a lipid-protein (cofactor) complex. The second suggestion is the finding of nonneutralizing antiprothrombin antibodies in a high number of plasmas with LA activity (292,333,334). Rapaport’s group has provided the most interesting results finding antiprothrombin antibodies in 31/42 plasmas with LA,
248
H. PATRICK MCNEIL E T A L .
including 24/25 of the “strongest” LA (292).Absorption of plasma with insolubilized prothrombin removed LA activity, which could then be eluted. However, a concentration of approximately 500 pg/ml of eluted antibody was required to prolong the R W C T . Despite this, this data suggests that prothrombin may be relevant to the epitopes to which LA are directed. In summary, although there is a widespread belief that LA are directed against anionic phospholipids, there is only limited evidence that this is so. Recent studies suggest that LA recognize cryptic phospholipid epitopes formed in the presence of hexagonal phase PE or lyso-PE, possibly involving an unusually structured monolayer overlying these aggregates. The presence of PS in this monolayer may be a necessary requirement that would be consistent with the observed essential nature of this phospholipid in correcting LA activity. The LA cofactor phenomenon and the finding of antibodies directed against prothrombin in LA plasma raise the possibility that LA immunoglobulins recognize lipid-protein complexes.
4 . Reactivity of aPL Antibodies with Nonphospholipid Antigens In 1974, Guarnieri and Eisner found that rabbit antisera raised against the VDRL antigen cross-reacted with a VDRL-like structure in which D N A was substituted for CL (335).Similarly to the CL containing VDRL antigen, PC and CHOL were required in an appropriate amount for the cross-reaction with DNA to occur. The authors suggested the cross-reaction occurred because D N A has repeating phosphodiester groups separated by 3 carbon atoms, similar to the antigenic C L epitope. With the development of monoclonal antibody (Mab) technology, a number of groups produced clones of immunoglobulin-secreting cells initially in mice, and later humans, and examined the reactivity of these antibodies against phospholipids and other antigens. Stollar and colleagues studied anti-DNA Mab raised in MRL/lpr mice (selected because these mice spontaneously develop an SLE-like disease), and some of the Mab directed against DNA showed cross-reactivity against C L and PA, and others exhibited LA activity. Other clones showed a more restricted serological specificity (336).Koike et al. obtained similar results using B/W.Fl as well as MRL/lpr mice (337). Rauch subsequently produced anti-DNA Mab from normal BALB/c mice following immunization with CL, and found that these polyspecific anti-DNA/ aCL Mab shared idiotypic determinants with the anti-DNA autoantibodies of lupus-prone MRL/lpr mice (338). Stollar’s group then demonstrated that several bacteria reacted with anti-DNA Mab from MRL/
ANTIPHOSPHOLIPID ANTIBODIES
249
lrp mice and that this appeared to be due to bacterial cell phospholipids (339). Similar studies have been done by the same groups of workers using lymphocytes from patients with SLE to produce human hybridomas (302,303,340).All these studies have found that polyspecific Mab reactive with CL, other phospholipids, DNA, both native and denatured, and polynucleotides can be produced. Sutjita et al. also produced similar polyspecific Mab from the lymphocytes of normal individuals (320). These results have been interpreted by some workers as evidence that autoantibodies in SLE, including anti-DNA, can arise by immunization with phospholipids such as CL or others of bacterial origin (340). Since there is evidence both in mice and humans that these autoantibodies share idiotypes of antibodies produced in normals, it has been suggested that these polyspecific autoantibodies arise because of activation of B cells producing natural autoantibodies (340). Despite these interesting studies of Mab, polyclonal aCL and antiDNA antibodies occurring in patient sera do not appear to possess the same degree of polyspecificity for nonphospholipid molecules. There do appear to be two types ofanti-DNA antibodies; first, antibodies with restricted specificity for dsDNA, and second, antibodies that are polyspecific for DNA (often ssDNA) and other antigens, including CL (337).However, Harris et al., using inhibition studies (78),and afEnity purified anti-DNA and aCL antibodies (77), showed that these were antibodies with restricted specificity and that the two activities are found in separate antibody populations. Eilat et al. came to the same conclusion regarding these antibodies in SLE sera and in the NZB/ NZW mouse SLE model. They also suggested that the cross-reactivity noted by others was due to highly amplified solid-phase assays, which can detect cross-reacting antibodies of low affinity (341).Smeenk et ul. confirmed the results of these two studies, and similarly to Eilat et al., suggested that the large number of cross-reacting Mab produced by other workers was again due to the use of solid-phase assays to screen hybridomas, resulting in a bias toward low-affinity cross-reacting clones (342).Thus, it is now generally accepted that aCL and anti-DNA antibodies are separate antibody populations, further illustrating the caution needed in extrapolating from studies of Mab, unless confirmatory evidence is available using polyclonal antibodies.
5. Antimitochondrial Antibodies The aCL antibodies that occur in syphilis, reagin, also appear to bind to mitochondria, giving rise to an antimitochondrial antibody (AMA)
250
H . PATRICK McNEIL E?’ AL.
reactivity that can be detected, usually with an immunofluorescent technique (343). Incubation of syphilitic sera with CL removes the AMA, suggesting that mitochondrial CL is the antigen and that reagin, rather than an associated antibody, causes the AMA (344). The pattern of immunofluorescence can be distinguished from AMA occurring in liver diseases such as primary biliary cirrhosis (PBC) or chronic active hepatitis (CAH). AMA can be classified into seven types based on immunofluorescent patterns (344,345). Syphilitic AMA are designated M1, those in PBC M2, in other liver diseases M4 and M6, and in certain forms of heart disease M7. The other two patterns occur in SLE-like diseases; M3 in drug-induced lupus syndromes, and M 5 in autoinimune disorders with features similar to the antiphospholipid syndrome. In 1984, Norberg et al. first noted an association between AMA-M5 and aCL antibodies (346), and this was confirmed by Tincani and co-workers in 1985 (117), and in a larger study in 1987 (344), although Meyer et al. failed to confirm this (347). The specificity of AMA-M5 was investigated by absorption of positive sera with niitochondrial membranes, which removed the AMA reactivity, but absorption with mitochondrial phospholipid extract or CL liposoines did not absorb AMA despite removing aCL antibody activity. This suggested that AMA may not be an aPL antibody, and Meroni et al. found isotype discordance between AMA and aCL antibody activities when both occurred in the same patient (344). However, since CL is a major component of mitochondria, the association between AMA-M5 and aCL antibodies suggests that further studies are warranted. One possibility is that AMA-M5 are directed against a CL-protein epitope and that CL alone is insufficient to bind to and absorb the antibody activity. 6. Binding of aPL Antibodies to Cell Membranes Interactions between aPL antibodies and cells will be reviewed in section VI of this chapter relevant to the pathogenic potential of aPL antibodies. This section will refer to those studies that provide information on the antigens on cell membranes to which aPL antibodies may be directed. The association of aPL antibodies with thrombosis, thrombocytopenia, and Coombs’-positive hemolytic anemia, suggests that these immunoglobulins are able to bind to platelets, endothelial cells, and erythrocytes, yet only a handful of studies have produced evidence of this binding so far. Hazeltine et al. were able to elute immunoglobulin from erythrocytes of patients with aCL antibodies and Coombs’ positivity (108).This eluted fraction exhibited aCL antibody activity, and normal fixed erythrocytes were able to absorb aCL activity from other
ANTIPHOSPHOLIPID ANTIBODIES
251
Coombs’-positive sera. Since the hemolytic anemia seen in SLE is usually associated with antibodies directed against the Rh antigen, Hazeltine et al. suggested that aCL antibodies might bind to this antigen on erythrocytes. In 1972, Green showed that the Rh antigen became inactivated by butanol extraction and could be regenerated with addition of phospholipids. PC and PE were most active, much more than PS or CL. Additionally, fully saturated phospholipids were inactive; the phospholipid had to contain at least one unsaturated fatty acid (348). In further studies, Green et al. found that phospholipase A2 or phospholipase C treatment of erythrocyte membranes completely removed Rh antigenic activity, suggesting that both the C2’ fatty acid (invariably unsaturated) and the head group were required. The sum of all these findings and other observations by Green et al. suggest that a hexagonal PE structure may interact with and stabilize the protein component of the Rh antigen (324). Tincani’s group has also eluted an IgM aCL antibody from erythrocytes (349). There is other evidence that hexagonal PE may be important in aCL antibody-cellular interactions. Khamashta et al. used affinity purified aCL antibodies to examine binding to platelets (291). There was no interaction with intact platelets, but binding of the affinity purified antibodies was observed with freeze-thawed platelets. Furthermore, aCL antibody activity could be inhibited by incubation with phospholipids extracted from platelet membranes. PE was most inhibitory, more than PS or PI. However, commercially available bovine brain PE did not inhibit aCL antibody activity. Phospholipids obtained from different tissues vary only in the fatty acid content. PE from human tissues contains predominantly unsaturated PE, especially arachidonic acid (9).Thus, it is likely that the difference in interaction of aCL with human versus bovine PE was because the former is more unsaturated. As noted previously, increasing unsaturation of fatty acids on PE favors adoption of the hexagonal phase. The studies of Rauch and her colleagues using human Mab with LA and/or aPL activity have already been mentioned (302,303). Fifty Mab were studied for LA, aPL, anti-DNA, and antiplatelet reactivity. Strong correlations between antiplatelet activity and anti-PE, aCL, and antiDNA activities were found. Furthermore, experiments employing pretreatment of platelets with phospholipases and trypsin suggested the determinants these Mab were directed to consist of phospholipidprotein complexes. Interestingly, the importance of the C2’ fatty acid was demonstrated since phospholipase A2 decreased antibody binding; these results are identical to those observed by Green et al. (324) for erythrocytes noted above.
252
H. PATRICK McNEIL ET A L
The protein component of these putative lipid-protein epitopes is unknown, but recent studies have used Western blotting of platelet membrane preparations to detect binding of antiplatelet antibodies. Howe and Lynch found a specific pattern of binding to proteins of molecular weight 120 and 80 kDa in sera from thrombocytopenic patients with SLE (350).This pattern was different from that found in ITP. Kaplan e t al. found binding of SLE sera to platelet proteins of 108 and 66 kDa (351).These two studies did not specifically look for aPL antibodies. However, Jouhikainen et al., in a large series of SLE sera, recently reported that binding to a 65-kDa platelet protein was strongly associated with the presence of LA (352). The identity of this platelet protein is unknown, and the relationship of it to plasma P-BGPI, which has been shown to bind to platelets (353), is also unknown. Immunoglobulin that bind to endothelial cells have been described in patients with SLE (354-356). LeRoux et al. found that there was a correlation between antiendothelial antibodies (AEA) and LA (355). However, in larger series, Vismara et al. found AEA and aPL antibodies were separate groups (357), as did McCarty and Kuzava (358),and Rosenbaum et al. (359).Vismara et al. did find that incubation of sera with C L reduced the AEA binding to a mild extent in some patients, and that an affinity purified aCL antibody preparation did exhibit endothelial cell binding. In contrast, Rosenbaum et al. could not decrease AEA binding with CL, but some reduction did occur following incubation with erythrocytes. In summary, there is only preliminary evidence that aPL antibodies interact with cellular membranes, but what evidence there is suggests that lipid-protein epitopes may be involved, possibly including PE. VI. The Pathogenic Potential of aPL Antibodies
In section IV of this review, the association between aPL antibodies and a clinical syndrome characterized by thrombosis, thrombocytopenia, and fetal loss was documented. Within SLE this clinical syndrome is seen in about one quarter of patients, but more frequently when aPL antibodies are present (40%) than when they are absent (15%). In SLE, the presence of other autoantibodies, immune complexes, and the effects of treatment may all contribute to these clinical events, thus the pathogenic potential of aPL antibodies is difficult to evaluate. However, the recognition of this same clinical syndrome in patients without any evidence of SLE or SLE-like features, in association with aPL antibodies (the antiphospholipid syndrome) is more suggestive
ANTIPHOSPHOLIPID ANTIBODIES
253
that these autoantibodies are of pathogenic importance. The fact that one ofthese aPL antibodies can cause a biologically relevant effect (LA activity) even though this involves in uitro clotting, provides additional support for the concept that in uiuo biological effects may be occurring because of these antibodies. Six patients have been described in whom there was a fall in the measured level of aCL antibody prior to or at the time of thromboocclusive events (360). The authors suggested this may be due to consumption of aPL antibody in the course of thrombosis, but whatever the reason, this observation provides firm support for an etiological association between the antibodies and thrombosis. Many hypotheses have been put forward to explain such a functional effect, but none have received universal acceptance, predominantly because consistent findings have been lacking. Initially there was considerable enthusiasm for an effect on endothelial prostacyclin production. In 1980, McVerry et al. (361) reported that the plasma of 2 SLE patients with histories of thrombosis inhibited the release of prostacyclin from rabbit aorta. Shortly after, Carreras et al. (362) found that the IgG fraction of a patient with a history of fetal loss, which contained LA activity, inhibited release of prostacyclin by rat aorta or bovine endothelium, and reduced levels of prostacyclin metabolites were found in uiuo.In subsequent studies, the same group found LA in 2 of 24 women with fetal loss, one of whom demonstrated inhibition of prostacyclin release (197), and in 14 patients with LA, 8 were found to have prostacyclin inhibition, 6 having a history of thrombosis (188). These results were supported by experiments performed by Marchesi et al. (363), de Castellarnau et al. (364), Elias and Eldor (151),and Vila et al. (365). A major problem with all these studies was that not all patients who thrombosed demonstrated the effect on prostacyclin and vice versa. Additionally, the accuracy of assays for prostacyclin available at that time have been questioned (366), and detailed studies reported in the past three years have found variable effects on prostacyclin production that do not correlate with clinical events (282,366373). Another major endothelial cell function that aPL antibodies might effect is the thrombomodulin-protein C-protein S natural anticoagulant pathway. Congenital deficiency of proteins C or S is associated with increased risk of venous thrombosis, and in uitro, phospholipid is required for assembly of activated protein C-(aPC)-protein S complexes, though the relevance of this to in uiuo events is uncertain. Comp et al. (374), Cariou et al. (371,375), and Freyssinet et al. (376) have provided evidence that Ig fractions from patients with aPL anti-
254
H . PATRICK McNEIL ETAL.
bodies exert in vitro inhibitory effects on thrombomodulin-mediated protein C activation. However, once again this effect has been observed in patients with and without thrombotic events (371), and in other cases not observed at all (282).Inhibitory effects on the anticoagulant activity of formed aPC have also been described (377,378), but since the assay systems in these studies employ phospholipid dispersions, these inhibitory effects can be viewed as similar to the in vitro LA effect, which clearly is not predictive of in viuo function. aPC is also involved in the fibrinolytic pathway, and there are conflicting reports of aPL antibody effects on fibrinolysis. Angles-Can0 et al. (95)found absent plasminogen activator release after venous occlusion in 24 of 28 SLE patients, 12 of whom had LA. Sanfelippo and Drayna noted an inhibitory effect of LA plasma on prekallikrein activity and kaolin-induced contact activation of fibrinolysis (379). Further evidence of impaired fibrinolysis has been reported (220,380), but these results have not been confirmed by other studies (371,381-383). Additionally, fibrinolytic abnormalities have been found to correlate with disease activity in SLE but not LA or aCL antibodies (384). The three postulated mechanisms described above have all involved endothelial cell function. Evidence that aPL antibodies can bind these cells is weak (357),and endothelial cell antibodies and aPL antibodies appear to be separate populations when they are found together in SLE (357-359). Additional pathogenic mechanisms involving platelets have also been suggested. First there is some evidence that aPL antibodies can bind to platelets and erythrocytes, and these studies have been reviewed in the previous section. The occurrence of TCP and positive Coombs’ test in association with a PL antibodies also suggest a possible functional effect on platelets and/or crythrocytes. In 1974, Regan et al. (385) found functional platelet abnormalities in 12 of 21 SLE patients but only 3 had LA and there was no correlation with thrombosis. More recently, effects of aPL antibody-positive plasma or Ig fractions on platelet function have been described, including impaired aggregation (180,282,363,385), or evidence of in uiuo activation (191,363,386).Other reports have found normal aggregation (95,369), and normal or increased thromboxane production (369). Consistent findings and correlations of observed effects with clinical events have been lacking in these studies. Decreased levels of the C4 complement component have been found in some studies of patients with aPL antibodies. Unander et al. (205) found lower mean C4 levels in 10 women with habitual abortion and high aCL levels compared to 22 with lower aCL levels. Unander’s
ANTIPHOSPHOLIPID ANTIBODIES
255
group has also noted lower mean C4 levels in aCL-positive versus -negative SLE patients (387). The frequency of low C4 levels is also higher in aPL antibody-positive groups. Cheng and Yap (125)noted 13 of 17 aCL-positive SLE sera had low C4 levels compared to 7 of 22 in the aCL-negative SLE group. Hazeltine et al. (108) found a similar higher incidence of hypocomplementemia in aCL- or LA-positive versus -negative SLE patients. In contrast, Hammond et al. (388)found no difference in C4 levels in aCL-positive or -negative SLE groups, but there was a correlation between aCL antibodies and reduced numbers of complement type 1receptors (CR1)and increased amounts of bound C4d and C3d on erythrocytes in these patients. Petri et al. (204) found that there was no difference in C4 levels between a group of habitual aborters and controls, although aCL was detected in only 11% of the former group. The cause of the low C4 could be that persons developing aPL antibodies have a high incidence of C4 null alleles, as suggested by Alarcon-Segovia (247), or due to increased complement turnover. Unander et al. (205) have found evidence of C2 activation, supporting the latter contention, but Lockshin et al. (389) suggested there was impaired complement synthesis. As noted previously IgG-aCL antibodies appear to be predominantly IgG,, IgG2, and IgG, and since the latter two isotypes are non-complement-fixing, a role for complement in pathogenic effects of aPL antibodies would appear unlikely, possibly indicating that the low C4 levels represent genetic factors. However, it has been shown that CL can directly activate the complement pathway by interaction with C1 (390). Furthermore, in Hammond et al.’s study (388), the IgM isotype only correlated with erythrocyte C4d and C3d numbers, suggesting IgM-aCL can bind these cells, fix complement, and thus cause hemolytic anemia. Further support for this hypothesis is that the IgM but not the IgG isotype is associated with Coombs’ positivity and hemolytic anemia (145,270). Thus, although the exact mechanism by which aPL antibodies exert pathogenic effects is unknown, most workers favor a mechanism involving binding to either endothelial cells or platelets or both, presumably to phospholipids in the cell membranes and thereby disrupting essential functions such as prostacyclin release, fibrinolysis, or protein C pathways on endothelium, or platelet aggregatiodactivation. Although these theories are attractive, they are conceptually unsound. As described in previous sections, there is minimal evidence that aPL antibodies are able to bind these cells, and theoretically they should not be able to interact with membrane phospholipids because of steric hindrance from glycoproteins and glycolipids, and because anionic
256
H . PATRICK McNEIL E T A L .
phospholipids are confined to the cytosolic surface. We have suggested in previous paragraphs that aPL antibodies may in fact be directed at lipid-protein epitopes, and if this is confirmed, definition of the protein component as a cell surface molecule would provide a more sound approach to studying interactions of these antibodies with cell membranes. There has been little attention paid to interactions of aPL antibodies with coagulation factors, apart from the protein C pathway. We have already mentioned the finding of antiprothrombin antibodies in patients with LA (292). Vermylen et d . (152) suggested these could be idiotypic antibodies directed against the antigen-combining region of LA. Since LA may be directed against procoagulant phospholipid surfaces, an idiotypic antibody would have a combining site with a structure similar to this, and conceivably could provide a surface for assembly of clotting factors. In fact anti-idiotypic antibodies against LA have recently been isolated and shown to decrease LA activity (391). Effects of aPL antibodies on coagulation inhibitors is another potential pathogenic mechanism worth investigating. In 1981, Cosgriff and Martin described a patient with LA and thrombosis in whom a low functional but high antigenic level of antithrombin I11 (AT-111) was found (392). However, Boey et al. (393)found reduced AT-I11 levels in SLE patients with and without LA and with and without histories of thrombosis. Hasselaar et al. (182) reported similar results. Another major inhibitor of procoagulant pathways is the extrinsic pathway inhibitor (EPI), a glycoprotein of molecular weight 54 kDa, which is carried on lipoproteins, probably associated with phospholipids. This inhibitor binds to tissue factor-VII, and the resulting complex binds to and inactivates factor X, switching off extrinsic pathwaymediated coagulation, which continues in a controlled fashion via factor IX,-mediated tenase activity (394). There has only been one report of EPI levels in 11 patients with LA, and normal levels were found in this study (395). A second lipoprotein-associated coagulation inhibitor is beta-2glycoprotein-I (P-2GPI) (apolipoprotein H). This is a heavily glycosylated glycoprotein of molecular weight 50 kDa which binds to anionic phospholipids, heparin, DNA, platelets, and mitochondria (332). It inhibits contact factor activation of coagulation in vitro (396), and may function to bind anionic macromolecules that enter the bloodstream as a result of tissue damage or infections, and thus diminish unwanted activation of coagulation (332).It has also been shown to inhibit prothrombinase activity (397).Low levels of P-2GPI have been found in disseminated intravascular coagulation (332), possibly due to con-
ANTIPHOSPHOLIPID ANTIBODIES
257
sumption during clotting. P-2GPI also inhibits platelet aggregration (398), and has been identified as the aPC-binding protein purified by Canfield and Kiseel(399). As noted above, we have demonstrated that P-2GPI is necessary for aCL antibodies to interact with anionic phospholipid (325), suggesting that P-2GPI bound to anionic phospholipid is the epitope to which aCL antibodies are directed. These preliminary results provide the basis for further study into possible effects of aCL antibodies on P-2GPI function since interference here could conceivably contribute to the prothrombotic diathesis associated with these autoantibodies. Additionally, since P-2GPI is an apolipoprotein with demonstrated effects on lipoprotein lipase (400), these findings provide an avenue for investigating effects of aCL antibodies on lipid metabolism, in view of the well-recognized accelerated atherogeneis seen in patients with SLE. In summary, the recognition of the PAPS in which aPL antibodies represent the only autoantibody expressed, together with temporal changes in aPL levels at the time of thrombosis provides suggestive evidence that these immunoglobulins are pathogenic in mediating clinical events. Unfortunately, the exact mechanism whereby this might occur has not been elucidated. A major problem with previous studies has been the use of serum, plasma, or Ig fractions from patients in in vitro studies. Especially in SLE, these preparations are likely to contain a soup of autoantibodies, immune complexes, cytokines, and other bio-active substances unrelated to the aPL antibodies present concurrently. Thus, separation into aPL antibody subsets and affinity purification are essential prior to characterization and examination of functional effects (401). VII. Summary and Conclusions
Having reviewed the literature on the association of aPL antibodies with clinical manifestations, it is clear that this group of autoantibodies are of considerable importance. The presence of aPL antibodies in some but not all individuals confers a risk of a clinical syndrome characterized by recurrent arterial or venous thrombosis, thrombocytopenia, hemolytic anemia, or positive Coombs’ test, and in females, recurrent idiopathic fetal loss. In SLE, the risk is approximately 40%, compared with a risk of 15% in the absence of aPL antibodies. However, only one half of persons possessing these antibodies have SLE, and overall the risk is around 30%. In some circumstances, such as in chlorpromazine or infection-associated aPL antibodies, there appears to be no increased risk. At the other end of the spectrum are
258
H. PATRICK McNEILETAL.
seen patients whose only clinical manifestations comprise features of this clinical syndrome, and this entity has been designated the primary antiphospholipid syndrome (PAPS). aPL antibodies are also important because they are not uncommon. They have been found frequently in women with idiopathic recurrent fetal loss (30%),in non-autoimmune patients with ischemic heart disease (20%),or venous thrombosis (up to 30%),or stroke (4-47%),and in chronic immune thrombocytopenia (30%). These autoantibodies can be detected using sensitive solid-phase immunoassays employing the C L antigen, or in appropriate coagulation tests to detect LA activity. These assays are simple to perform but require care in selection of the best test and in interpretation of results. Current tests d o not distinguish between those persons at risk of the clinical events and those not at risk. Detection of specific isotypes (especially IgG) and antibody level may aid in such a designation. Treatment of aPL antibody-associated syndromes remains a controversial subject. Since thromboses are associated with significant morbidity and potential mortality, there is a good argument for longterm preventive antithrombotic therapy, at least for as long as the antibodies are detectable, in those patients in whom clinical complications have previously occurred. It is not generally recommended that this treatment be offered to individuals in whom aPL antibodies are detected but who have not suffered previous thromboses, since the risk of such events does not appear to be equal within a group of aPL antibody-positive persons. This particularly applies to pregnant women, since live births and uncomplicated pregnancies are observed regularly in the presence of aPL antibodies without specific treatment. A previous history of at least one unexplained, late fetal loss is considered a prerequisite before intervention in subsequent pregnancies. There is no consensus on what this intervention should be, and in general either immunosuppressive therapy or antithrombotic treatments or both have been used. There is some evidence that antithrombotic therapy may be effective, and certainly appears to be associated with less morbidity than immunosuppressive regimes. Recent evidence indicates that aPL antibodies comprise a family of phospholipid-binding autoantibodies. There are clear differences in immunological specificity among reagin (the syphilitic aCL antibody), LA, and aCL-type antibodies detected in solid-phase assays in patients with autoimmune disorders. It seems that although all three appear to bind anionic phospholipids to variable degrees, the antigens with which they interact are quite distinct, since each recognizes different structural arrangements of similar phospholipids. Reagin interacts
ANTIPHOSPHOLIPID ANTIBODIES
259
with CL in a structural complex that includes PC, whereas aCL antibodies in SLE and the PAPS bind to lamellar CL, and these latter antibodies equally recognize the other anionic phospholipids. However, the presence of PC inhibits interaction of these aCL antibodies with anionic phospholipids. This interaction has recently been demonstrated to be more complicated, with the recognition that aCL antibodies also require a plasma glycoprotein, P-2-glycoprotein I (P-SGPI) to bind to anionic phospholipid surfaces, and it appears that a lipid-protein complex composed of P-2GPI bound to phospholipid represents the true antigenic epitope to which aCL antibodies are directed. The fine specificity of LA immunoglobulins has yet to be determined, but recent evidence suggests that these antibodies recognize cryptic arrangements of unusually packed phospholipids, probably including PS occurring as a result of the presence of hexagonal aggregates of PE. It is clear that the specificity of LA differs from aCL-type antibodies since LA have been shown not to bind phospholipids in solid-phase assays. Further studies on the specificities of aPL antibodies will be aided by purification techniques that resolve plasma into antibody subsets, and improved affinity purification techniques that have recently been developed. Considerable circumstantial evidence suggests aPL antibodies are involved in mediating clinical complications, rather than simply being markers of a clinical syndrome. Although no uniform mechanism has yet been demonstrated, it is likely that this piece of the puzzle will be solved following more detailed characterization of these antibodies and better definition of the antigens to which they are directed.
REFERENCES 1. Janoff, A. S., and Rauch, J. (1986). The structural specificity of anti-phospholipid antibodies in autoimmune disease. Chem. P h y s . Lipids 40,315-332. 2. Merrill, A. H., and Nichols, J. W. (1985). Techniques for studying phospholipid membranes. In “Phospholipids and Cellular Regulation”( J. F. Kuo, ed.), Vol. 1, Chapter 2. CRC Press, Boca Raton, Florida. 3. Cullis, P. R., Hope, M. J., de Krujff,B., et al. (1985). Structural properties and functional roles of phospholipids in biological membranes. In “Phospholipids and Cellular Regulation” (J. F. Kuo, ed.), Vol. 1, Chapter 1. CRC Press, Boca Raton, Florida. 4. Tilcock, C. P. S. (1986). Lipid polymorphism. Chem. P h y s . Lipids 40,109-125. 5. Cullis, P. R., Hope, M. J., and Tilcock, C. P. S. (1986).Lipid polymorphism and the roles of lipids in membranes. Chem. Phys. Lipids 40,127-144. 6. Yeagle, P. (1987). “The Membranes of Cells.” Academic Press, Orlando, Florida.
260
H . PATRICK McNElL E T A L .
7. Zwaal, R. F. A,, and Hemker, H. C. (1982). Blood cell menibranes and haemostasis. Haemostasis 11,12-39. 8. Hostetler, K. Y. (1982).Polyglycerophospholipids:Phosphatidylglycerol, diphosphatidylglycerol and bis(monoacylg1ycero)phosphate.I i i “Phospholipids” ( J . N. Hawthorne and G . B. Ansell, eds.), Elsevier, Amsterdam. 9. Ansell, G. B., and Spanner, S. (1982). Phosphatidylserine, phosphatidylethanolamine, and phosphatidylcholine. In “Phospholipids” ( J . N. Hawthorne and C. B. Ansell, eds.), Elsevier, Amsterdam. 10. Barenholz, Y., and Gatt, S. (1982).Sphingomyelin: Metabolism, chemical synthesis, chemical and physical properties. In “Phospholipids” ( J . N. Hawthorne and G. B. Ansell, eds.). Chapter 4. Elsevier, Amsterdam. 11. Wasserman, A. (1907). Uber die Entwicklung uiid den gegenwartigen Stand der Serodiagnostik gegenuber syphilis. Berl. Klin. Wochenschr. 44,1599. 12. Pangborn, M. C. (1941). A new serologically active phospholipid from beef heart. Proc. Soc. Exp. Biol. Med. 48,484-486. 13. Moore, J. E., and Mohr, C. F. (1952). Biologically false positive serologic tests for syphilis. JAMAJ . Am. Med. Assoc. 150,467-473. 14. Moore, J. E., and Lutz, W. B. (1955).The natural history of systemic lupus erythematosus: An approach to its study through chronic biologic false positive reactors J . Chronic Dis. 1,297-316. 15. Haserick, J . R., and Long, R. (1951). Systemic lupus erythematosus preceded by false positive test for syphilis: Presentation of five case. Ann. Intern. Med. 37, 559-565. 16. Harvey, A. M., and Shulman, L. E. (1966). Connective tissue disease and the chronic biologic false positive test for syphilis. Med. Clin. North Am., 50, 12711279. 17. Rein, C. R., and Kostant, G. H. (1950). Lupus erytheniatosus: Serologic and chemical aspects. Arch. Dermatol. Syph. 61,898-903. 18. Montgomery, H., and McCreight, W. G. (1949). Disseminated lupus erytheinatosus. Arch. Dermatol. Syph. 60,356. 19. Coburn, A. F., and Moore, D. H. (1943).The plasma protein in disseminated lupus erythematosus. Bull. Johns Hopkiits Hosp. 73, 196-221. 20. Conley, C. L., and Hartmann, R. C. (1952). Haemorrhagic disorder caused by circulating anticoagulant in patients with disseminated lupus erythematosus. J . Clin. Invest. 31,621-622. 21. Mueller, J. F., Ratnoff, O., and Heinle, R. W. (1951).Observations on the characteristics of an unusual circulating anticoagulant. J . Lab. Clin. Med. 38,254-261. 22. Hitzig, W. H., Labhart, A., and Uehlinger, E. (1951).Transitorische hemnikorperhamophilie bei rheumatismus. Helv. Med. Acta 18,410-412. 23. Frick, P. G. (1955). Acquired circulating anticoagulants in systemic “collagen disease.” Blood 10,691-706. 24. Feinstein, D. I., and Rapaport, S. I. (1972).Aquired inhibitors ofblood coagulation. Prog. Hemostasis Thromb. 1,75-95. 25. Johansson, E. A., and Lassus, A. (1974). The occurrence of circulating anticoagulants in patients with syphilitic and biologically false positive antilipoidal antibodies. Ann. Clin. Res. 6, 105-108. 26. Laurell, A., and Nilsson, I. M. (1957). Hypergammaglobulinaemia, circulating anticoagulant, and biologic false positive Wasserman reaction. J . Lab. Clin. Med. 49,694-707. 27. Breckenridge, R. T., and Ratnoff, 0. D. (1963). Studies on the site of action of a
ANTIPHOSPHOLIPID ANTIBODIES
28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47.
26 1
circulating anticoagulant in disseminated lupus erythematosus. Am. J . Med. 35, 813-819. Yin, E. T., and Gaston, L. W. (1965).Purification and kinetic studies on a circulating anticoagulant in a suspected case of lupus erythematosus. Thromb. Diath. Haemorrh. 14,88-115. Rivard, G . E., Schiffman, S., and Rapaport, S . I. (1974). Cofactor of the lupus anticoagulant. Thromb. Diath. Haemorrh. 32,554-563. Lechner, K. (1974).Acquired inhibitors in nonhemophilic patients. Haemostasis 3, 65-93. Loeliger, A. (1959). Prothrombin as co-factor of the circulating anticoagulant in systemic lupus erythematosus? Thromb. Diath. Haemorrh. 3,237-256. Thiagarajan, P., Shapiro, S. S., and DeMarco, L. (1980).A monoclonal IgM coagulation inhibitor with phospholipid specificity: Mechanism of a lupus anticoagulant. 1.Clin. Invest. 66,397-405. Shapiro, S. S., and Thiagarajan, P. (1982).Lupus anticoagulants. Prog. Hemostasis Thromb. 6,263-285. Firkin, B. G., Booth, P., Hendrix, L., and Howard, M. A. (1978). Demonstration ofa platelet bypass mechanism in the clotting system using an acquired anticoagulant. A m . ] . Hematol. 5 , 8 1 4 2 . Bowie, E. J. W., Thompson, J. H., Pascuzzi, C. A., and Owen, C. A. (1963).Thrombosis in systemic lupus erythematosus despite circulating anticoagulant. 1.Lab. Clin. Med. 62,416-430. Boxer, M., Ellman, L., and Carvalho, A. (1976). The lupus anticoagulant. Arthritis Rheum. 19,1244-1248. Schleider, M. A., Nachman, R. L., Jaffe, E. A., and Coleman, M. (1976). A clinical study of the lupus anticoagulant. Blood, 48,499-509. Gastineau, D. A., Kazmier, F. J., Nichols, W. C., and Bowie, E. J. W. (1985).Lupus anticoagulant: An analysis ofthe clinical and laboratory features of 219 cases. Am.]. Hematol. 19,265-275. Harris, E. N., Gharavi, A. E., Boey, M. L. et al. (1983).Anticardiolipin antibodies: detection by radioimmunoassay and association with thrombosis in systemic lupus erythematosus. Lancet 2, 1211-1214. Green, D., Houghie, C., Kazmier, F. J. et d(1983). Report of the working party on acquired inhibitors of coagulation: Studies of the “lupus” anticoagulant. Thromb. Haemostasis 49, 144-146. Exner, T. (1985). Similar mechanisms of various lupus anticoagulants. Thromb. Haemostasis 53, 15-18. Rosner, E., Pauzner, R., Lusky, A., Modan, M., and Many, A. (1987).Detection and quantitative evaluation of lupus anticoagulant activity. Thromb. Haemostasis 57, 144-147. Triplett, D. A., and Brandt, J. (1989). Laboratory identification of the lupus anticoagulant. B r . ] . Haematol. 73, 139-142. Triplett, D. A., Brandt, J. T., Kaczor, D., and Schaefer, J. (1983). Laboratory diagnosis of lupus inhibitors: A comparison of the tissue thromboplastin inhibition procedure with a new platelet neutralization procedure. Am.J . Clin. Pathol. 79,678-682. Exner, T., Rickard, K. A., and Kronenberg, H. (1978).A sensitive test demonstrating lupus anticoagulant and its behavioural patterns. Br. 1.Haematol. 40, 143-151. Exner, T. (1985).Comparison of two simple tests for the lupus anticoagulant.Am.]. Clin. Pathol. 83,215-218. Mannucci, P. M., Canciani, M. T., Mari, D., and Meucci, P. (1979). The varied
262
H . PATRICK M c N E l L ETAL.
sensitivity of partial thromboplastin time reagents in the demonstration of the lupus-like anticoagulant. Scand. J . Haematol. 22,423-432. 48. Lesperance, B., David, M., Rauch, J., et al. (1988). Relative sensitivity ofdifferent tests in the detection of low titre lupus anticoagulants. Thromb. Haemostasis 60, 2 17-2 19. 49. Lo, S. C. L., Oldmeadow, M. J., Howard, M. A., and Firkin, B. G. (1989). Comparison of laboratory tests used for identification of the lupus anticoagulant. Am. J . Hematol. 30,213-220. 50. Kornberg, A., Silber, L., Yona, R., and Kaufman, S. (1989). Clinical manifestations and laboratory findings in patients with lupus anticoagulants. Eur.J . Haematol. 42, 90-95. 51. Brandt, J. T., Triplett, D. A., Musgrave, K., and Orr, C. (1987).The sensitivity of different coagulation reagents to the presence of lupus anticoagulants. Arch. Pathol. h b . Med. 111,120-124. 52. Kelsey, P. R., Stevenson, K. J., and Poller, L. (1984). The diagnosis of lupus anticoagulants by the activated partial thromboplastin time-the central role of phosphatidylserine. Thromb. Haemostasis 52, 172-175. 53. Gibson, J., Starling, E., Date, L. et al. (1988). A simplified and sensitive screening test for detection of the lupus anticoagulant. Proc. Znt. Symp. Antiphospholipid Antibodies, 3rd, 1988. 54. Thiagarajan, P., Pengo, V., and Shapiro, S. S. (1986). The use of the dilute Russell viper venom time for the diagnosis of lupus anticoagulants. Blood 68, 869874. 55. Brandt, J. T., and Triplett, D. A. (1989).The effect ofphospholipid on the detection of lupus anticoagulants by the dilute Russell viper venom time. Arch. Pathol. Lab. Med. 113,1376-1378. 56. Triplett, D. A., and Brandt, J . T. (1988). Lupus anticoagulants: Misnomer, paradox, riddle, epiphenomenon. Hematol. Pathql. 2,121-143. 57. Margolius, A., Jackson, D. P., and Ratnoff, 0.D. (1961).Circulatinganticoagulants: A study of 40 cases and a review of the literature. Medicine (Baltimore)40, 145202. 58. Triplett, D. A., Brandt, J. T., and Maas, R. L. (1985).The laboratory heterogeneity of lupus anticoagulants. Arch. Pathol. Lab. Med. 109,946-951. 59. Clyne, L. P., and White, P. F. (1988).Time dependency of lupuslike anticoagulants. Arch. Intern. Med. 148, 1060-1063. 60. Lazarchick, J., and Kizer, J . (1989).The laboratory diagnosis of lupus anticoagulants. Arch Pathol. Lab. Med. 113, 177-180. 61. Howard, M. A., and Firkin, B. G. (1983). Investigation of the lupus-like inhibitor bypassing activity of platelets. Thromb. Haemostasis 50,775-779. 62. Clyne, L. P., Dainiak, N., Hoffman, R., and Hardin, J. (1980). In-oitro correction of anticoagulant activity and specific clotting factor assays i n SLE. Thromb. Res. 18, 643-655. 63. Rauch, J., Tannenbaum, M., and Janoff, A. S. (1989). Distinguishing plasma lupus anticoagulants from anti-factor antibodies using hexagonal phase phospholipids. Thromb. Haemostasis 62,892-896. 64. Gharavi, A. E., Harris, E. N., Asherson, R. A., and Hughes, G. R. V. (1987).Anticardiolipin antibodies: Isotype distribution and phospholipid specificity. Ann. Rheum. Dis. 46,l-6. 65. Loizou, S., McCrea, J . D., Rudge, A. C., et al. (1985).Measurement of anticardiolipin antibodies by an enzyme linked imrnunosorbent assay (ELISA): Standardisation and quantitation of results. Clin. E x p . lmmunol. 62,738-745.
ANTIPHOSPHOLIPID ANTIBODIES
263
66. Lockshin, M. D., Druzin, M. L., Goei, S., et al. (1985).Antibody to cardiolipin as a predictor of fetal distress or death in pregnant patients with systemic lupus erythematosus. N. Eng1.J.Med. 313,152-156. 67. Harris, E. N., Gharavi, A. E., Patel, S. P., and Hughes, G. R. V. (1987).Evaluation of the anticardiolipin antibody test: Report of an international workshop held 4 April 1986. Clin. Erp. Immunol. 68,215-222. 68. Harris, E. N. (1990). Antiphospholipid antibodies. Br. J . Haematol. 74, 1-9. 69. Layton, G . (1989). Instruction Booklet-Medical Innovations Anti-cardiolipin Antibody Test Kit. Sydney, Australia. 70. Shi, W., Krilis, S. A., Chong, B. H., et al. (1990). Prevalence of lupus anticoagulant in a healthy population: Lack of correlation with anticardiolipin antibodies. Aust. N. Z. J . Med. 20,231-236. 71. Vaarala, O., Palosuo, T., Kleemola, M., and Aho, K. (1986).Anticardiolipin response in acute infections. Clin. Immunol. Immunopathol. 41,8-15. 72. Kalunian, K. C., Peter, J. B., Middlekauff, H. R., et 01. (1988).Clinical significance of a single test for anti-cardiolipin antibodies in patients with systemic lupus erythematosus. Am. J . Med. 85,602-608. 73. Weidmann, C. E., Wallace, D. J., Peter, J. B., et al. (1988). Studies of IgG, IgM and IgA antiphospholipid antibody isotypes in systemic lupus erythematosus.J . Rheumatol. 15,74-79. 74. Wang, Y., Furphy, L., Webb, J., et al. (1988). Antiphospholipid antibodies in systemic lupus erythematosus. Aust. N. 2. J . Med. 18,200A. 75. Cowchock, S., Fort, J., Munoz, S., Norberg, R., and Maddrey, W. (1988). False positive ELISA tests for anticardiolipin antibodies in sera from patients with repeated abortion, rheumatologic disorders and primary biliary cirrhosis: correlation with elevated polyclonal IgM and implications for patients with repeated abortion. Clin. Exp. Immunol. 73,289-294. 76. Levy, R. A., Qamar, T., Lockshin, M. D., et al. (1988). Nonspecific binding of IgM anticardiolipin antibodies: Idiopathic and chlorpromazine induced. Clin. E x p . Rheumatol. 6,206A. 77. Harris, E. N., Gharavi, A. E., Tincani, A., et al. (1985). Affinity purified anticardiolipin and anti-DNA antibodies. J . Clin. Lab. Immunol. 17, 155-162. 78. Harris, E. N., Gharavi, A. E., Loizou, S., et al. (1985). Crossreactivity of antiphospholipid antibodies. J . Clin. Lab. Immunol. 16, 1-6. 79. Harris, E. N., Gharavi, A. E., Wasley, G. D., and Hughes, G. R. V. (1988).Use ofan enzyme-linked immunosorbent assay and inhibition studies to distinguish between antibodies to cardiolipin from patients with syphilis or autoimmune disorders.J. Infect. Dis. 157,23-31. 80. Triplett, D. A., Brandt, J. T., Musgrave, K. A., and Orr, C. A. (1988). The relationship between lupus anticoagulants and antibodies to phospholipid. JAMA,J.Am. Med. Assoc. 259,550-554. 81. Lockshin, M. D., Druzin, M. L., and Qamar, T. (1989).Prednisone does not prevent recurrent fetal death in women with antiphospholipid antibody. Am. /. Obstet. Gynecol. 160,439-443. 82. Harris, E. N. (1987). Product information supplied with Rayne Institute freeze dried anticardiolipin antibody standard sera. 83. Layton, G., personal communication. 84. Hasselaar, P., Derksen, R. H. W. M., Blokzijl, L., and decroot, P. G. (1989).Heat treatment of serum induces false positive results in the anticardiolipin ELISA. Br. J. Haematol. 71, Suppl. 1, 36. 85. Layton, G., personal communication.
264
H . PATRICK MCNEIL E T A L .
86. Cheng, H.-M., and Phuah, E.-B. (1989). Heat-labile serum inhibitor of antiphospholipid antibody binding in ELISA. Immunol. Lett. 22,263-266. 87. Santiago, M. B., Bueno, C., Viana, V., et (11. (1989). Influence of serum inactivation on detection of anticardiolipin antibodies (ACA) by ELISA. Clin. E x p . Rheumatol. 7,99-104. 88. Branch, D. W., Rote, N. S., and Scott, J . S. (1986). The demonstration of lupus anticoagulant by an enzyme-linked immunoadsorbent assay. Clin. Immunol. Immunopathol. 39,298-307. 89. Vermylen, J., Arnout, J., Debois, P., et al. (1988). An enzyme linked immunosorbent assay for antiphospholipid antibodies using thrombofax. Clin. E x p . Rheumatol. 6,214A. 90. Lopez-Soto, A,, Casals, F. J., Font, J., et al. (1989). Detection of antiphospholipid antibodies by ELISA-method with bovine thromboplastin as antigen. Thromb. Res. 53,623-628. 91. Arnout, J., Huybrechts, E., and Vermylen, J. (1989).Further studies on the heterogeneity of antiphospholipid antibodies. Post grad. Med. J . 65,698. 92. Manoussakis, M. N., Tzioufas, A. G., Silis, M. P., et al. (1987).High prevalence of anti-cardiolipin and other autoantibodies in a healthy elderly population. Clin. Exp. Immunol. 69,557-565. 93. Fields, R. A., Toubbeh, H., Searles, R. P., and Bankhurst, A. D. (1989).The prevalence of anticardiolipin antibodies in a healthy elderly population and its association with antinuclear antibodies. J. Rheumatol. 16,623-625. 94. Dubois, E. L. (1974) “Lupus erythematosus,” 2nd ed. Univ. of South Carolina Press, Columbia. 95. Angles-Cano, E., Sultan, Y., and Clauvel, J.-P. (1979). Predisposing factors to thrombosis in systemic lupus erythematosus. J . Lab. Clin. Med. 94,312-323. 96. Gazengel, C., Dougados, M., Kremp, O., et d. (1980). Anticoagulants circulants d’activite antiprothrombinase au cours du lupus erythemateux dissemine. Nouo. Presse Med. 9,2325-2328. 97. Boey, M. L., Colaco, C. B., Gharavi, A. E., et al. (1983). Thrombosis in syteinic lupus erythematosus: striking association with the presence of circulating lupus anticoagulant. Br. Med. /. 287,1021-1023. 98. Isenberg, D. A., Shoenfield, Y., and Schwartz, R. S. (1984). Multiple serologic reactions and their relationship to clinical activity in systemic lupus erythematosus. Arthritis Rheum. 27,132-138. 99. Mintz, G . , Acevedo-Vazquez, E., Gutierrez-Espinosa, G., and Avelar-Garnica, F. (1984).Renal vein thrombosis and inferior vena cava thrombosis i n systemic lupus erythematosus. Arthritis Rheum. 27,539-544. 100. Bennett, R. E., Calabrese, L. H., Lucas, F. V., and Clough, J. D. (1984). The association between anti-DNA antibodies and the lupus anticoagulant. Arthritis Rheum. 27, S39. 101. Colaco, C. B., and Elkon, K. B. (1985). The lupus anticoagulant. Arthritis Rheum. 28,67-74. 102. Harris, E. N., Gharavi, A. E., and Hughes, G. R. V. (1985). Antiphospholipid antibodies. Clin. Rheum. Dis.11,591-609. 103. Pawner, R., Rosner, E., and Many, A. (1986).Circulating anticoagulant in systemic lupus erythematosus: Clinical manifestations. Actu Haematol. 76,SO-94. 104. Derksen, R. H. W. M., Bouma, B. N., and Kater, L. (1987). The prevalence and clinical associations of the lupus anticoagulant in systemic lupus erythematosus. Scond. J . Rheumutol. 16,185-192.
ANTIPHOSPHOLIPID ANTIBODIES
265
105. Petri, M., Rheinschmidt, M., Whiting-O’Keefe, Q., et al. (1987). The frequency of lupus anticoagulant in systemic lupus erythematosus. Ann. Intern. Med. 106,524531. 106. Meyer, O., Cyna, L., and Bourgeois, P., et al. (1987).Profile and cross-reactivities of antiphospholipid antibodies in systemic lupus erythematosus and syphilis. Clin. Rheumatol. 6,369-377. 107. Averbuch, M., Koifman, B., and Levo, Y. (1987). Lupus anticoagulant, thrombosis and thrombocytopenia in systemic lupus erythematosus. Am. J. Med. Sci. 293,2-5. 108. Hazeltine, M., Rauch, J., Danoff, D., et al. (1988).Antiphospholipid antibodies in systemic lupus erythematosus: Evidence of an association with positive Coombs’ test and hypocomplementemia. J. Rheumatol. 15,80-86. 109. Derksen, R. W. H. M., Hasselaar, P., Blokzijl, L., et al. (1988).Coagulation screen is more specific than the anticardiolipin antibody ELISA in defining a thrombotic subset of lupus patients. Ann. Rheum. Dis. 47,364-371. 110. Nicastro, M. A., Molina, M. M., Sanchez-Avalos, J. C., and Molinas, F. C. (1989). Incidence of the lupus-like inhibitor in a hematologic and collagen diseases population. Thromb. Haemostasis 62,3778. 111. Johns, A. S., Ockelford, P. A., Chamley, L. et al. (1989).Comparison oftests for the lupus anticoagulant and phospholipid antibodies in systemic lupus erythematosus. Thromb. Haemostasis 62,380s. 112. Long, A. A., Ginsberg, J., Brill-Edwards, P., et al. (1989).Thromboembolic disease and circulating anticoagulant in SLE. Arthritis Rheum. 32, R10. 113. Mokuno, C., Taniguchi, O., Hashimoto, H., and Hirose, S. (1989). Predictive value of LAC and anti-CL for fetal loss in SLE. Arthritis Rheum. 32, S73. 114. Rowell, N. R., and Tate, G. M. (1989).The lupus anticoagulant in systemic lupus erythernatosus. Acta Derm.-Venereol.69,111-115. 115. Koike, T., Sueishi, M., Funaki, H., et al. (1984).Anti-phospholipid antibodies and biological false positive serological tests for syphilis in patients with systemic lupus erythematosus. Clin. E x p . lmmunol. 56, 193-199. 116. Knight, P. J., and Peter, J. B. (1986). Occurrence of antibodies to cardiolipin in systemic lupus erythematosus. Arthritis Rheum. 29, S27. 117. Tincani, A., Meroni, P. L., Brucato, A., et al. (1985).Antiphospholipid and antimitochondria1 type M 5 antibodies in systemic lupus erythematosus Clin. E x p . Rheumatol. 3,321-326. 118. Sturfelt, G., Nived, O., Norberg, R., et al. (1987). Anticardiolipin antibodies in patients with systemic lupus erythematosus. Arthritis Rheum. 30,382-388. 119. Fort, J. G., Cowchock, F. S., Abruzzo, J. L., and Smith, J. B. (1987). Anticardiolipin antibodies in patients with rheumatic diseases. Arthritis Rheum. 30,752-760. 120. Manoussakis, M. N., Gharavi, A. E., Drosos, A. A., et al. (1987). Anticardiolipin antibodies in unselected autoimmune rheumatic disease patients. Clin. lmmunol. Immunopathol. 44,297-307. 121. McHugh, N. J., Maymo, J., Skinner, R. P., et al. (1988). Anticardiolipin antibodies, livedo reticularis, and major cerebrovascular and renal disease in systemic lupus erythematosus. Ann. Rheum. Dis. 47, 110-115. 122. Shergy, W. J., Kredich, D. W., and Pisetsky, D. S. (1988). The relationship of anticardiolipin antibodies to disease manifestations in pediatric lupus erythematosus. J. Rheumatol. 15,1389-1394. 123. Okada, J., Endo, H., and Kasniwazaki, S. (1988). IgC anti-cardiolipin antibodies in patients with systemic lupus erythematosus in Japanese. Clin. E x p . Rheumatol. 6, 209A.
266
H. PATRICK MCNEIL E T A L
124. Khamashta, M. A., Gil, A., Pascual, D., et al. (1988).Antiphospholipid antibodies in SLE: Clinical associations. Clin. E x p . Rheumatol. 6,205A. 125. Cheng, H.-W., and Yap, S.-F. (1988).Anticardiolipin antibody and complement. Arthritis Rheum. 31,1211-1212. 126. Jude, B., Goudemand, J., Dolle, I., et al. (1988).Lupus anticoagulant: A clinical and laboratory study of 100 cases. Clin. Lab. Haematol. 10,41-51. 127. Derksen, R. H. W. M., and Kater, L. (1985). Lupus anticoagulant: Revival of an old phenomenon. Clin. E x p . Rheumatol. 3,349-357. 128. Harris, E. N., Asherson, R. A., Gharavi, A. E., et al. (1985). Thrombocytopenia in SLE and related autoimmune disorders: Association with anticardiolipin antibody. Br. J . Haematol. 59,227-230. 129. Harris, E. N., Gharavi, A. E., Hedge, U., et al. (1985).Anticardiolipin antibodies in autoimmune thrombocytopenic purpura. Br. J . Haematol. 59,231-234. 130. Hull, R. G., Harris, E. N., Gharavi, A. E., et al. (1984).Anticardiolipin antibodies: Occurrence in Behcets Syndrome. Ann. Rheum. Dis. 43,746-748. 131. Bueno, C., Melo, N. B., Santiago, M. B., et 01. (1988).Antiphospholipid antibodies in autoimmune thrombocytopenic purpura. Clin. E x p . Rheumatol. 6,199A. 132. Colaco, C. B., Scadding, G. K., and Lockhart, S. (1987).Anticardiolipin antibodies in neurological disorders: Cross-reaction with anti-single stranded DNA activity. Clin. E x p . lmmunol. 68,313-319. 133. Fulford, K. W. M., Catterall, R. D., Delhanty, J. J., et al. (1972). A collagen disorder of the nervous system presenting as multiple sclerosis. Brain 95,373-386. 134. Harris, E. N., Gharavi, A. E., Mackworth-Young, C. G., et al. (1985). Lupoid sclerosis: A possible pathogenic role for antiphospholipid antibodies. Ann. Rheum. Dis. 44,281-283. 135. Hardie, R. J . , and Isenberg, D. A. (1985). Tetraplegia as a presenting feature of systemic lupus erythematosus complicated by pulmonary hypertension. Ann. Rheum. Dis. 44,491-493. 136. Marabani, M., Zoma, A., Hadley, D., and Sturrock, R. D. (1989).Transverse myelitis occurring during pregnancy in a patient with systemic lupus erythematosus. Ann. Rheum. Dis. 48,160-162. 137. Pender, M. P., and Chalk, J . B. (1989).Connective tissue disease mimicking multiple sclerosis. Aust. N. Z. J. Med. 19,469-472. 138. Staub, H. L., Chahade, W. H., Khamashta, M. A., et al. (1989). False positive IgM anticardiolipin antibody in the presence of rheumatoid factor. Arthritis Rheum. 32, S72. 139. Agopian, M. S., Boctor, F. N., and Peter, J . B. (1988).False-positive test result for IgM anticardiolipin antibody due to IgM rheumatoid factor. Arthritis Rheum. 31, 1212-1213. 140. Lightfoot, R. W., Leair, D., and Olsen, N. J. (1988).Alteration ofanticardiolipin titre by rheumatoid factor. Arthritis Rheum. 31, S29. 141. Keane, A., Woods, R., Dowding, V., et al. (1987). Anticardiolipin antibodies in rheumatoid arthritis. Br. J. Rheumatol. 26,346-350. 142. Colaco, C. B., and Male, D. K. (1985).Anti-phospholipid antibodies in syphilis and a thrombotic subset of SLE: Distinct profiles of epitope specificity. Clin. E x p . lmmunol. 59,449-456. 143. Malia, R. G., Greaves, M., Rowlands, L. M., et al. (1988).Anticardiolipin antibodies in systemic sclerosis: Immunological and clinical associations. Clin. E x p . lmmunol. 73,456-460. 144. McHugh, N. J.. Reilly, P. A., and McHugh, L. A. (1989).Pregnancy outcome and autoantibodies in connective tissue disease. J. Rheumatol. 16,42-46.
ANTIPHOSPHOLIPID ANTIBODIES
267
145. Cervera, R., Font, J., Lopez-Soto, A., et al. 1989. Anticardiolipin antibodies in patients with autoimmune diseases: Isotype distribution and clinical associations in a series of 167 cases. Abstr. ZLAR, p. 25. 146. Bamberga, P., Asero, R., Vismara, A., et al. (1987). Anticardiolipin antibodies in progressive systemic sclerosis. Clin. Exp. Rheumatol. 5,387-392. 147. Arroyo, R. A., Ridley, D. J., Brey, R. L., et al. (1989).Anticardiolipin antibodies in patients with primary Sjogrens syndrome. Arthritis Rheum. 32, S73. 148. Colaco, C. B., Mackie, I. J., Irving, W., and Machin, S. J. (1989). Anticardiolipin antibodies in viral infection. Lancet 2,622. 149. Misra, R., Venables, P. J. W., Plater-Zyberk, C., et al. (1989). Anticardiolipin antibodies in infectious mononucleosis react with the membrane of activated lymphocytes. Clin. E x p . Immunol. 75,35-40. 150. Mackworth-Young, C. G., Harris, E. N., Steare, A. C., et al. (1988). Anticardiolipin antibodies in Lyme disease. Arthritis Rheum. 31,1052-1056. 151. Elias, M., and Eldor, A. (1984). Thromboembolism in patients with the “lupus”type circulating anticoagulant. Arch. Intern. Med. 144,510-515. 152. Vermylen, J., Blockmans, D., Spitz, B., and Deckmyn, H. (1986). Thrombosis and immune disorders. Clin. Haematol. 15,393-412. 153. Mueh, J. R., Herbst, K. D., and Rapaport, S. I. (1980). Thrombosis in patients with the lupus anticoagulant. Ann. Intern. Med. 92, 156-159. 154. Tuma, M. F. F., Pinto, M. N., Brum-Fernandes, A. J., et al. (1987).Anticardiolipin antibodies in patients with tuberculosis. Clin. E x p . Rheumatol. 5(2), 177. 155. Gold, J. E., Haubenstock, A., and Zalusky, R. (1986). Lupus anticoagulant and AIDS. N. Engl.j. Med. 314,1252-1253. 156. Bloom, E. J., Abrams, D. I., and Rodgers, G. (1986). Lupus anticoagulant in the acquired immunodeficiency syndrome. JAMA, J . Am. Med. Assoc. 256,491-493. 157. Cohen, A. J., Philips, T. M., and Kessler, C. M. (1986). Circulating coagulation inhibitors in the acquired immunodeficiency syndrome. Ann. Intern. Med. 104, 175- 180. 158. Canoso, R. T., Zon, L. I., and Groopman, J. E. (1987). Anticardiolipin antibodies associated with HTLV-I11 infection. Br. J . Haematol. 65,495-498. 159. Intrator, L., Oksenhendler, E., Desforges, L., and Bierling, P. (1988). Anticardiolipin antibodies in HIV infected patients with or without immune thrombocytopenic purpura. Br. J . Haematol. 68,269-270. 160. Brien, W., Inwood, M., and Denome, G. (1988). Antiphospholipid antibodies in haemophiliacs. Br. J. Haematol. 68,270. 161. Panzer, S., Stain, C., Hartl, H., etal. (1989).Anticardiolipin antibodies are elevated in HIV-1 infected haemophiliacs but do not predict for disease progression. Thromb. Haemostasis 61,81-85. 162. Stimmler, M. M., Quismorio, F. P., McGehee, W. G., et al. (1989).Anticardiolipin antibodies in acquired immunodeficiency syndrome. Arch. Intern. Med. 149, 1833- 1835. 163. Arroyo, R. A., Brey, R., Higgs, J., et al. (1989). Anticardiolipin antibody in patients with human immunodeficiency virus infection. Arthritis Rheum. 32, S73. 164. Mizutani, W. T., Woods, V. L., McCutchen, J. A., and Zvaifler, N. J. (1988).Anticardiolipin antibodies in human immunodeficiency virus infected gay males may b e associated with a deteriorating clinical course. Arthritis Rheum. 31, S35. 165. Capel, P., Clumeck, N., Feremans, W., et al. (1989). Lupuslike anticoagulant and anticardiolipin antibodies in non-hospitalized HIV infected patients. Thromb. Haemostasis 62,376. 166. Vaarala, O., Vaara, M., and Palosuo, T. (1988). Effective inhibition of cardiolipin-
268
H. PATHICK McNEIL E T A L .
binding antibodies in Gram-negative infection by bacterial lipopolysaccharide. Scand.]. Immunol. 28,607-612. 167. Syjanen, J . , Vaarala, O., Iivanainen, M., et al. (1988).Anticardiolipin response and its association with infections in young and middle-aged patients with cerebral infarction. Acta Neurol. Scand. 78,381-386. 168. Syjanen, J., Valtonen, V., Iivanainen, M., et ul. (1988). Preceeding infection as an important risk factor for ischaemic brain infarction in young and middle aged patients. Br. Med.J.296, 1156-1160. 169. Saikku, P., Leinounen, M., Mattila, K., et al. (1988). Serological evidence of‘ an association of a novel chlamydia, TWAR, with chronic coronary heart disease and acute myocardial infarction. Lancet 2,983-986. 170. Zarrabi, M., Zucker, S., Miller, F., et (11. (1979). Immunologic and coagulation disorders in chlorproniazine-treated patients. Ann. Intern. Med. 91, 194-199. 171. Canoso, R. T., and deoliveira, R. M. (1986).Characterisation and antigenic specificity of chlorpromazine-induced antinuclear antibodies. J. Lab. Clin. Med. 108, 213-216. 172. Schlesinger, P. A., and Peterson, L. (1988). Procainamide-associated lupus anticoagulants and thrombotic events. Arthritis Rheum. 31, S29. 173. Asherson, R. A,, Zulman, J., and Hughes, G. R. V. (1989).Pulmonary thromboembolism associated with procainamide induced lupus syndrome and anticardiolipin antibodies. Ann. Rheum. Dis. 48,232-235. 174. Canoso, R. T., and Sise, H. S. (1982).Chlorpromazine-induced lupus anticoagulant and associated immunologic abnormalities. Am. J. Hematol. 13, 121-129. 175. Canoso, R. T., and deoliveira, R. M. (1988).Chlorpromazine-induced anticardiolipin antibodies and lupus anticoagulant: Absence of thrombosis. Am. J . Hematol. 27,272-275. 176. Butikofer, P., Lin, Z. W., Kuypers, F. A., et al. (1989). Chlorpromazine inhibits vesiculation, alters phosphoinositide turnover and changes deformability of ATPdepleted RBC’s. Blood 73, 1699-1704. 177. Mori, T., Takai, Y., Minakuchi, R., et al. (1980). Inhibitory action of chlorpromazine, dibucaine and other phospholipid-interacting drugs on calcium-activated phospholipid dependent protein kinase. J. Biol. Chem. 255,8378-8380. 178. Sjoqvist, F., Borga, O., and Orme, M. L’E. (1980). Fundamentals ofclinical pharmacology. In “Drug Treatment” (G. S. Avery, ed.). ADIS Press. 179. Wang, C. T., Lee, J. Y.,Chan, J. C., et al. (1987). Effect oftrifluoperazine on human platelet membrane. Thromb. Haemostutis 58,545. 180. Gluek, H. I., Kant, K. S., Weiss, M. A., et al. (1985). Thrombosis in systemic lupus erythematosus. Arch. Intern. Med. 145, 1389-1395. 181. Cronin, M. E., Biswas, R. M., VanderStraeton, C., et 01. (1988). IgG and IgM anticardiolipin antibodies in patients with lupus and anticardiolipin antibody associated clinical syndromes. J. Rheumatol. 15,795-798. 182. Hasselaar, P., Derksen, R. H. W. M., Blokzijl, L., et al. (1989).Risk factors for thrombosis in lupus patients. Ann. Rheum. Dis. 48,933-940. 183. Derue, G. J., Englert, H. J., Harris, E. N., et al. (1985). Fetal loss in systemic lupus: Association with anticardiolipin antibodies. J. Obstet. Gynaecol. 5, 207209. 184. Lockshin, M. D., Qamar, T., Druzin, M. L., and Goei, S. (1987). Antibody to cardiolipin, lupus anticoagulant, and fetal death. J. Rheumatol. 14,259-262. 185. Loizou, S., Byron, M. A., Englert, H. J., et al. (1988).Association of quantitative anticardiolipin antibody levels with fetal loss and time of loss in systemic lupus erythematosus. Q. J . Med. 68,525-531.
ANTIPHOSPHOLIPID ANTIBODIES
269
186. Clauvel, J. P., and Sultan, Y. (1977).Anticoagulant circulant et syndrome d e Willebrand au cows d e lupus erythemateux dissemine. Archiel. Hematol. 11, 109. 187. Alexandre, P., Andre, E., Briquel, M. E., et al. (1980). Inhibiteurs acquis de la coagulation. Nouo. Presse Med. 9,2901-2904. 188. Carreras, L. O., and Vermylen, J. G. (1982). “Lupus” anticoagulant and thrombosis-possible role of inhibition of prostacyclin formation. Thromb. Haemostasis 48,38-40. 189. Waddell, C. C., and Brown, J. A. (1982). The lupus anticoagulant in 14 male patients. JAMA,J. Am. Med. Assoc. 248,2493-2495. 190. Ros, J. O., Tarres, M. V., Baucells, M. V., et al. (1983). Prednisolone and maternal lupus anticoagulant. Lancet 2,576. 191. Gladman, D. D., Urowitz, M. B., Tozman, E. C., and Glynn, M. F. X. (1983). Haemostatic abnormalities in systemic lupus erythematosus. Q. J . Med. 207,424433. 192. Prentice, R. L., Gatenby, P. A., Loblay, R. H., et al. (1984). Lupus anticoagulant in pregnancy. Lancet 2,464. 193. Jungers, P., Liote, F., Dautzenberg, M. D., et al. (1984). Lupus anticoagulant and thrombosis in systemic lupus erythematosus. Lancet 1,574-575. 194. Lubbe, W. F., Butler, W. S., Palmer, S . J., and Liggins, S . C. (1984). Lupus anticoagulant and pregnancy. Br. J. Obstet. Gynaecol. 91,357-363. 195. Lechner, K., and Pabinger-Fasching, I. (1985).Lupus anticoagulants and thrombosis. Haemostasis 15,254-262. 196. Harris, E. N., Chan, J. K. H., Asherson, R. A., et al. (1986).Thrombosis, recurrent fetal loss, and thrombocytopenia: Predictive value of the anticardiolipin antibody test. Arch. Intern. Med. 146,2153-2156. 197. Carreras, L. O., and Vermylen, J. (1981). “Lupus” anticoagulant and inhibition of prostacyclin formation in patients with repeated abortion, intrauterine growth retardation and fetal death. Br. 1.Obstet. Gynaecol. 88,890-894. 198. Cowchock, S., Smith, J. B., and Gocial, B. (1986). Antibodies to phospholipids and nuclear antigens in patients with repeated abortions. Am. J. Obstet. Gynecol. 155, 1002-1010. 199. Lockwood, C. J., Reece, E. A., Romero, R., and Hobbins, J. C. (1986).Antiphospholipid antibody and pregnancy wastage. Lancet 2,742-743. 200. Clauvel, J . P., Tchobroutsky, C., Danon, F., et al. (1986). Spontaneous recurrent fetal wastage and autoimmune abnormalities: A study of fourteen cases. Clan. Immunol. Immunopathol. 39,523-530. 201. Edelman, P., Rouquette, A. M., Verdy, E., et al. (1986).Autoimmunity, fetal losses, lupus anticoagulant: Beginning of systemic lupus erythematosus or new autoimmune entity with gynaeco-obstetrical expression. Hum. Reprod. 1,295-297. 202. Pattison, N. S., McKay, E. J., Liggins, G. C., and Lubbe, W. F. (1987).Anticardiolipin antibodies: Their presence as a marker for lupus anticoagulant in pregnancy. N . Z. Med. J . 100,61-64. 203. Howard, M. A., Firkin, B. G., Healy, D. L., and Choong, S. C. (1987). Lupus anticoagulant in women with multiple spontaneous miscarriage. Am. J . Hematol. 26,175-178. 204. Petri, M., Golbus, M., Anderson, R., et al. (1987). Antinuclear antibody, lupus anticoagulant, and anticardiolipin antibody in women with idiopathic habitual abortion. Arthritis Rheum. 30,601-606. 205. Unander, A. M., Norberg, R., Hahn, L., and Arfors, L. (1987). Anticardiolipin antibodies and complement in ninety-nine women with habitual abortion. Am. J. Obstet. Gynecol. 156,114-119.
270
€1. PATRICK McNElL E T A L
206. Barbui, T., Cortelazzo, S., Galli, M., etal. (1987). Lupus anticoagulant and repeated abortions: A case controlled study. Thromb. Haemostasis 58,232. 207. Long, A. A., Robinson, M., Burrows, R., et 01. (1989). Lupus anticoagulant and adverse fetal outcome in pregnancy. Arthritis Rheum. 32, R10. 208. Tincani, A., Bertoli, M. T., Allegri, F., et al. (1989). Antiphospholipid antibodies and fetal loss. Postgrad. Med. J . 65,696. 209. Maier, D. B., and Parke, A. (1989).Subclinical autoimmunity in recurrent aborters. Fertil. Steril. 51,280-285. 210. Gouault, H. M., lntrator, L., Sobel, A,, and Bruneau, C. (1987). Anticoagulant circulant de type antiprothrombinase. Ann. Med. Interne 138,251-255. 211. Hamsten, A., Norberg, R., Bjorkholm, M., et al. (1986).Antibodies to cardiolipin in young survivors of myocardial infarction: An association with recurrent cerebrovascular events. Lancet 1, 113-1 16. 212. Morton, K. E., Gavaghan, T. P., Krilis, S. A., et 01. (1986). Coronary artery bypass graft failure-an autoimmune phenomenon? Lancet 2, 1353-1357; correction: ibid., pp. 977-978. 213. Wangel, A. G., Voyvodic, F., and Arthur, D. (1988). Anticardiolipin antibodies in patients with chest pain. Clin. E x p . Rheumatol. 6,201A. 214. DeCaterina, R., D’Ascanio, A., Mazzone, A., et al. (1988). Prevalence of anticardiolipin antibodies in patients with ischaemic heart disease. Clin. E x p . Rheumatol. 6,201A. 215. Klemp, P., Cooper, R. C., Strauss, F. J.,et al. (1988). Anticardiolipin antibodies in ischaemic heart disease. Clin. E x p . Immunol. 74,254-257. 216. Hart, R. G., Miller, V. T., Coull, B. M., and Bril, V. (1984). Cerebral infarction associated with lupus anticoagulants-preliminary report. Stroke 15,114-118. 217. Montalban, J., Barquinero, J . , Ordi, J., et al. (1988). Antiphospholipid antibodies and stroke. Clin. E x p . Rheumatol. 6,209A. 218. Norberg, R., Ernerudh, J., Hamsten, A., et al. (1987). Phospholipid antibodies in cardiovascular disease. Acta Med. Scand. 715,93-98. 219. Kushner, M. J. (1989).Population study of lupus anticoagulants and anticardiolipin antibodies in stroke. Stroke 20, 153. 220. Kienast, J.,Bohm, H., Ostermann, H., and vanderloo, J. (1989). Antiphospholipid antibodies in patients prone to thrombosis: Prevalence, specificity and relation to impaired fibrinolysis. Thromb. Haentostasis 62,374. 221. Chesterman, C. N., personal communication. 222. Alarcon-Segovia, D., and Sanchez-Guerrero, J . (1989). Primary antiphospholipid syndrome. J . Rheumatol. 16,482-488. 223. Hughes, G. R. V. (1985). The anticardiolipin syndrome. Clin. E x p . Rheumatol. 3, 285-286. 224. Hughes, G. R. V., Harris, E. N., and Gharavi, A. E. (1986). The anticardiolipin syndrome.]. Rheumatol. 13,486-489. 225. Harris, E. N. (1987).Syndrome ofthe black swan. Br.]. Rheumatol. 26,324-326. 226. Hughes, G. R. V.. Asherson, R. A., and Khamashta, M. A. (1989). Antiphospholipid syndrome: Linking many specialties. Ann. Rheum. Dis. 48,355-356. 227. Mackworth-Young, C. G., Loizou, S., and Walport, M. J. (1989). Primary antiphospholipid syndrome: Features of patients with raised anticardiolipin antibodies and no other disorder. Ann. Rheum. Dis. 48,362-367. 228. McNeil, H. P., Krilis, S. A., and Chesterman, C. N. (1991). Arterial thrombosisdiagnosis and management. In “Phospholipid Binding Antibodies” (E. N. Harris, T. Exner, G. R. V. Hughes, and R. A. Asherson, eds.), Chpt. 11. CRC Press, Boca Raton, Florida.
ANTIPHOSPHOLIPID ANTIBODIES
271
229. Pomeroy, C., Knodell, R. G., Swaim, W. R., et al. (1984).Budd-Chiari syndrome in a patient with the lupus anticoagulant. Gastroenterology 86, 158-161. 230. Averbuch, M., and Levo, Y. (1986). Budd-Chiari syndrome as the major complication of systemic lupus erythematosus with the lupus anticoagulant. Ann. Rheum. Dis. 45,435-437. 231. VanSteenbergen, W., Beyls, J., Vermylen, J . , et al. (1986). ‘Lupus’ anticoagulant and thrombosis of the hepatic veins (Budd-Chiari syndrome). Report of three patients and review of the literature. J. H e p a t o l . 3,87-94. 232. Asherson, R. A., Lanham, J. G., Hull, R. G., et al. (1984). Renal vein thrombosis in systemic lupus erythematosus: Association with the “lupus anticoagulant.” Clin. E x p . Rheumatol. 2,75-79. 233. Asherson, R. A., Khamashta, M. A., Ordi-Ros, J,, et a1 (1989). The ‘primary’ antiphospholipid syndrome: Major clinical and serological features. Medicine 68,366374. 234. Levine, S. R., and Welch, K. M. A. (1987). Cerebrovascular ischaemia associated with lupus anticoagulant. Stroke 18,257-263. 235. Levine, S. R., Kim, S., Deegan, M. J., and Welch, K. M. A. (1987).Ischemic stroke associated with anticardiolipin antibodies. Stroke 18, 1101-1 106. 236. Asherson, R. A., Khamashta, M. A., Gil, A., et al. (1989).Cerebrovascular disease and antiphospholipid antibodies in systemic lupus erythematosus, lupus-like disease, and the primary antiphospholipid syndrome. Am. J . Med. 86, 391399. 237. Kushner, M., and Simonian, N. (1989). Lupus anticoagulants, anticardiolipin antibodies and cerebral ischemia. Stroke 20,225-229. 238. Asherson, R. A., Derksen, R. H. W. M., Harris, E. N., et 01. (1987). Chorea in systemic lupus erythematosus and “lupus-like” disease: Association with antiphospholipid antibodies. Semin. Arthritis Rheum. 16,253-259. 239. Asherson, R. A., and LubbC, W. F. (1988). Cerebral and valve lesions in SLE: Association with antiphospholipid antibodies. J. Rheumatol. 15,539-541. 240. Asherson, R. A., Khamashta, M. A., Baguley, E., et al. (1989).Myocardial infarction and antiphospholipid antibodies in SLE and related disorders. Q. J . Med. 272, 1103-1115. 241. Klippel, J. H. (1989). Survival in SLE. Proc. Znt. Conf. Systemic L u p u s E r y thematosus, 2nd., 1989, p. 187. 242. Gavaghan, T. P., Baron, D. W., Krilis, S. A,, et al. (1988). Coronary artery bypass graft occlusion in patients with antibodies to cardiolipin is prevented by aspirin. Clin. E x p . Rheumatol. 6,204A. 243. Mackie, I. J,, Colaco, C. B., and Machin, S. J. (1987). Familial lupus anticoagulants. Br. J. Haematol. 67,359-363. 244. Matthey, F., Walshe, K., Mackie, I. J., and Machin, S. J. (1989). Familial occurrence of the antiphospholipid syndrome. J. Clin. Pathol. 42,495-497. 245. Jacobson, D. M., Lewis, J. H., Bontempo, F. A., et al. (1986). Recurrent cerebral infarctions in two brothers with antiphospholipid antibodies that block coagulation reactions. Stroke 17,98-102. 246. Mackworth-Young, C., Chan, J., Harris, N., et al. (1987). High incidence ofanticardiolipin antibodies in relatives of patients with systemic lupus erythematosus. J. Rheumatol. 14,723-726. 247. Alarcon-Segovia, D., and Granados, J. (1989).Genetic factors in the development of anticardiolipin antibodies and the antiphospholipid syndrome. Book Plenary Lect., Proc. ILAR, p. 42. 248. Savi, M., Ferraccioli, G. F., Neri, T. M., et al. (1988). HLA-DR antigens and
272
H . PATRICK McNEIL E T A L
anticardiolipin antibodies in Northern Italian systemic lupus erythematosus patients. Arthritis Rheum. 31, 1568-1570. 249. McNeil, H. P., Gravaghan, T. P., Krilis, S. A., Geczy, A. F., and Chesterman, C. N. (1990). HLA-DR antigens and anticardiolipin antibodies. Clin. E x p . Rheumatol. 8, 425-426. 250. Harris, E. N., Asherson, R. A., and Hughes, G. R. V. (1988). Antiphospholipid antibodies-autoantibodies with a difference. Annu. Reu. Med. 39,261-271. 251. Asherson, R. A., Chan, J . K. H., Harris, E. N., et al. (1985).Anticardiolipin antibody, recurrent thrombosis, and warfarin withdrawal. Ann. Rheum. Dis. 44,823-825. 252. Lubbe, W. F., and Walker, E. B. (1983). Chorea gravidarum associated with circulating lupus anticoagulant: Successful outcome of pregnancy with prednisone and aspirin. Br. J. Obstet. Gynuecol. 90,487-490. 253. Lubb6, W. F., Butler, W. S., Palmer, S. J., and Liggins, G. C. (1983). Fetal survival after prednisone suppression of maternal lupus-anticoagulant. Lancet 1, 13611363. 254. Branch, D. W., Scott, J. R., Kochenour, N. K., and Hershgold, E. (1985).Obstetric complications associated with the lupus anticoagulant. N. Engl. J. Med. 313,13221326. 255. Farquharson, R. G., Pearson, J. F., and John, L. (1984).Lupus anticoagulant and pregnancy management. Lancet 2,228-229. 256. Tincani, A,, Cattaneo, R., Martinelli, M., et al. (1987).Antiphospholipid antibodies in recurrent fetal loss: Only one side of the coin? Clin. E x p . Rheumatol. 5, 390392. 257. Ordi, J.,Barquinero, J., Vilardell, M., et al. (1989). Fetal loss treatment in patients with antiphospholipid antibodies. Ann. Rheum. Dis.48,798-802. 258. Gatenby, P. A., Cameron, K., and Shearman, R. P. (1989). Pregnancy loss with phospholipid antibodies: Improved outcome with aspirin containing treatment. Aust. N. Z. J . Obstet. Gynuecol. 29,294-298. 259. Wallenburg, H. C. S., and Rotmans, N. (1988). Prophylactic low-dose aspirin and dipyridamole in pregnancy. Lancet 1,939. 260. Elder, M. G., deSwiet, M., Robetson, A., et 01. (1988). Low-dose aspirin in pregnancy. Lancet 1,410. 261. Rosove, M. H., Tabsu, K., Howard, P., et al. (1987).Heparin therapy for prevention of fetal wastage in women with anticardiolipin antibodies and lupus anticoagw lants. Blood 70, Suppl., 379. 262. Scott, J. R., Branch, D. W., Kochenour, N. K., and Ward, K. (1988). Intravenous immunoglobulin treatment of pregnant patients with recurrent pregnancy loss caused by antiphospholipid antibodies and Rh immunization. Am. /. Obstet. Gynecol. 159,1055-1056. 263. Parke, A., Maier, D., Wilson, D., et al. (1989). Intravenous gamma-globulin, antiphospholipid antibodies, and pregnancy. Ann. Intern. Med. 110,495-496. 264. Derksen, R. H. W. M., Hasselaar, P., Blokzijl, L., and deCroot, P. (1987).Lack of efficacy of plasma-exchange in removing antiphospholipid antibodies. Lancet 2, 222. 265. Frampton, G., Cameron, J. S., Thorn, M., et al. (1987). Successful removal of antiphospholipid antibody during pregnancy using plasma exchange and low-dose prednisolone. Lancet 2, 1023-1024. 266. Lockshin, M. D., and Levy, R. A. (1989).Anticardiolipin antibodies and pregnancy. Book Plenary Lect., Proc. ILAR, pp. 43-45. 267. Druzin, M. L., Lockshin, M., Edersheim, T. G., et al. (1987).Second-trimester fetal
ANTIPHOSPHOLIPID ANTIBODIES
273
monitoring and preterm delivery in pregnancies with systemic lupus erythematosus and/or circulating anticoagulant. Am. J . Obstet. Gynecol. 157, 1503-1510. 268. Harris, E. N. (1989).The immunology of antiphospholipid antibodies. Book Plen a y Lect., Proc. ILAR, pp. 37-38. 269. Alarcon-Segovia, D. (1988). Pathogenic potential of antiphospholipid antibodies.]. Rheumatol. 15,890-893. 270. Deleze, M., Oria, C. V., and Alarcon-Segovia, D. (1988).Occurrence ofboth hemolytic anemia and thrombocytopenic purpura (Evans’ syndrome) in systemic lupus erythematosus. Relationship to antiphospholipid antibodies. J . Rheumatol. 15, 611-615. 271. Gharavi, A. E., Harris, E. N., Lockshin, M. D., et al. (1988). IgG subclass and light chain distribution of anticardiolipin and anti-DNA antibodies in systemic lupus erythematosus. Ann. Rheum. Dis. 47,286-290. 272. Snowden, N., Wilson, P., and Pumphrey, R. (1989). Anticardiolipin antibodies in systemic lupus erythematosus. Ann. Rheum. Dis. 4 8 , 8 0 4 6 . 273. Rote, N. S., Dostal, D. A., and Branch, D. W. (1988). Subclass of IgG antibodies against cardiolipin and phosphatidylserine in women with recurrent pregnancy loss. Proc. Int. Symp. Antiphospholipid Antibodies, 3rd, 1988. 274. Tsutsumi, A., Koike, T., Ichikawa, K., et al. (1988). IgG subclass distribution of anticardiolipin antibodies in patients with systemic lupus erythematosus. J . Rheumatol. 15, 1764-1767. 275. McNeil, H. P., Chesterman, C. N., and Krilis, S. A. (1989).Anticardiolipin antibodies and lupus anticoagulants comprise separate antibody subgroups with different phospholipid binding characteristics. Br. J . Haematol. 73,506-513. 176. Strandberg Pedersen, N., Orum, O., and Mouritsen, S. (1987). Enzyme-linked immunosorbent assay for detection of antibodies to the venereal disease research laboratory (VDRL) antigen in syphilis. J . Clin. Microbiol. 25, 1711-1716. 177. Laine, R. A., Yogeswaran, G., and Hakomori, S. (1974). Glycosphingolipids covalently linked to agarose gel or glass beads: Use ofthe compounds for purification of antibodies directed against globoside and hematoside. J . Biol. Chem. 249,44604465. !78. Alving, C. R., and Richards, R. L. (1977).Immune reactivities of antibodies against glycolipids I. lrnmunochernistry 14,373-381. 179. Cooper, M. R., Cohen, H. J., Huntley, C. C., et al. (1974). A monoclonal IgM with antibody specificity for phospholipids in a patient with lymphoma. Blood 43, 493-504. 180. Pengo, V., Thiagarajan, P., Shapiro, S. S., and Heine, M. J. (1987). Immunological specificity and mechanism of action of IgG lupus anticoagulants. Blood 70,69-76. 181. Frampton, G., and Cameron, J. S. (1988). Purified antiphospholipid antibodies from lupus nephritis patients enhance thromboxane production by activated platelets. Clin. E x p . Rheumatol. 6,203A. 182. Schorer, A. E., Wickham, N. W. R., and Watson, K. V. (1989). Lupus anticoagulant induces a selective defect in thrombin-mediated prostacyclin release and platelet aggregration. B r . J . Haematol. 71,399-407. 183. Levy, R. A., Lockshin, M. D., Qamar, T., and Gharavi, A. E. (1989).Affinity purification of anticardiolipin antibodies. Arthritis Rheum. 32, R11. 184. Bellotti, V., Gamba, G., Merlini, G., et 01. (1989). Study of three patients with monoclonal gammopathies and ‘lupus-like’ anticoagulants. 73,221-227. 185. Violi, F., Valesini, G., Ferro, D., et al. (1986). Anticoagulant activity of anticardiolipin antibodies, Thromb. Res. 44,543-547.
274
1-1. PATRICK McNEIL E T A L
286. Yamamoto, M., Watanabe, K., Ado, Y., et (11. (1985). Further evidence that lupus anticoagulants are anti-phospholipid antibodies. Thromb. Huemostasis 54,276. 287. Marcus, D. M. (1976). In “Glycolipid Methodology” (L. A. Witting, ed.), pp. 233245. Am. Oil Chem. SOC.,Chicago, Illinois. 288. McNeil, H. P., Krilis, S. A., and Chesterman, C. N. (1988). Purification of antiphospholipid antibodies using a new affinity method. Thromb. Res. 52,641-648. 289. McNeil, H. P., Krilis, S . A,, and Chesterman, C. N. (1988). Immunoaffinity purification and characterisation of antiphospholipid antibodies. Aust. N. Z. J . Med. 18, 520A. 290. Exner, T., Sahman, N., and Trudinger, B. (1988). Separation of anticardiolipin antibodies froin lupus anticoagulant on a phospholipid-coated polystyrene column. Biochem. Biophys. Res. Commun. 155, 1001-1007. 291. Khamashta, M . A., Harris, E. N., Gharavi, A. E., et al. (1988). Immune mediated mechanism for thrombosis: Antiphospholipid antibody binding to platelet membranes. Ann. Rheum. Dis. 47,849-854. 292. Fleck, R. A., Rapaport, S . I., and Rao. L. V. M. (1988).Anti-prothrombin antibodies and the lupus anticoagulant. Blood 72,512-519. 293. Lockshin, M . D. (1987).Anticardiolipin antibody. Arthritis Rheum. 30,471-472. 294. Staub, H. L., Khamashta, M. A., Harris, E. N., et al. (1989).Lupus anticoagulant and anticardiolipin antibodies: The affinities may differ. Postgrad. Med. J. 65,700. 295. McNeil, H. P., Chesterman, C. N., and Krilis, S . A. (1988). Binding specificity of lupus anticoagulants and anticardiolipin antibodies. Thromb. Res. 52,609-619. 296. Harris, E. N., Loizou, S . , Englert, H., et aZ. (1984). Anticardiolipin antibodies and lupus anticoagulant. Lancet 2,1099. 297. Derksen, R. H. W. M., Biesma, D., Bounia, B. N., et nl. (1986). Discordant effects of prednisone on anticardiolipin antibodies and the lupus anticoagulant. Arthritis Rheum. 29,1295-1296. 298. Gleicher, N. (1986).Pregnancy and autoimmunity. Acta Haematol. 76,68-77. 299. Kilpatrick, D. C. (1986). Antiphospholipid antibodies and pregnancy wastage. Lancet 2,980. 300. Branch, D. W., Rote, N. S., Dostal, D. A., and Scott, J. R. (1987).Association of lupus anticoagulant with antibody against phosphatidylserine. Clin. Zmmunol. Zmmunopathol. 42,63-75. 301. Buchanan, R., and Wardlaw, J . (1987).The specificity of the anticardiolipin antibody response in systemic lupus erythematosus and its relationship to the lupus anticoagulant. Arthritis Rheum. 30, S53. 302. Rauch, J., Tannenbaum, H., Senecal, 3.-L., et al. (1987). Polyfunctional properties of hybridoma lupus anticoagulant antibodies. J . Rheumatol. 14,132-137. 303. Rauch, J., Meng, Q.-H., and Tannenbaum, H. (1987). Lupus anticoagulant and anti-platelet properties of human hybridoma autoantibodies. J . Immunol. 139, 2598-2604. 304. Kwapinski, J. B. (1965) “Methods of Serological Research.” Wiley, London. 305. Inoue, K., and Nojima, S. (1967). Immunochemical studies of phospholipids. 111. Production of antibody to cardiolipin. Biochim. Biophys. Acta 144,409-414. 306. Kanemasa, Y. (1974). Electron microscopic observations of lipid antigens with special reference to the Wasserman antigen. J p n . I. Microbiol. 18, 193-202. 307. Eagle, H. (1932).Studies in serology of syphilis; induction of antibodies to tissue lipoids (positive Wasserman reaction) in normal rabbits.]. Erp. Med. 55,667-681. 308. Aho, K., Rojtedt, I., and Saris, N.-E. (1973). Reactivity of various anticardiolipin antibodies with intact mitochondria. Clin. Erp. Znimunol. 14,573-579.
ANTIPHOSPHOLIPID ANTIBODIES
275
309. Inoue, K., and Nojima, S. (1969). Immunochemical studies of phospholipids. IV. The reactivities of antisera against natural cardiolipin and synthetic cardiolipin antigens. Chem. Phys. Lipids 3,70-77. 310. Fowler, E., and Allen, R. H. (1962). Studies on the production of Wasserman reagin. J . Immunol. 88,591-594. 311. Costello, P. B., Green, F. A., and Powell, G. L. (1989).The structural requirements of the cardiolipin headgroup for antibody recognition. Arthritis Rheum. 32, S122. 312. Schiefer, H.-G., Schummer, U., Hegner, D., et al. (1975). Electron spin resonance studies on the lipid-protein interaction between cardiolipin and anticardiolipin antibodies. Hoppe-Seyler’s 2. Physiol. Chem. 356,293-299. 313. Kataoka, T., and Nojima, S. (1970). Immunochemical studies of phospholipids. VI. Haptenic activity of phosphatidyl-inositol and the role of lecithin as an auxilliary lipid. J . Immunol. 105,502-511. 314. Marcus, D. M., and Schwarting, G. A. (1976). Immunochemical properties ofglycolipids and phospholipids. Ado. Immunol. 23,203-240. 315. Alving, C. R. (1986). Antibodies to liposomes, phospholipids and phosphate esters. Chem. Phys. Lipids 40,303-314. 316. Boyden, S. V. (1965). Natural antibody and the immune response. Ado. Immunol. 51,28. 317. Avrameas, S., Guilbert, B., and Dighiero, B. (1981). Natural antibodies against tubulin, actin, myoglobin, thyroglobulin, fetuin, albumin and transferrin are present in normal sera. Ann. Inst. Pasteur Immunol. 132,103-113. 318. Ternynck, T., and Avrameas, S. (1986). Murine natural monoclonal autoantibodies: A study of their polyspecificities and their affinities. Immunol. Reu. 94,99-112. 319. Grabar, P. (1975). Autoantibodies and immunological theories: An analytical review. Clin. Immunol. Immunopathol. 4,453-466. 320. Sutjita, M., Hohmann, A., Comacchio, R., and Bradley, J. (1988). Polyspecific human and murine antibodies to diphtheria and tetanus toxoids and phospholipids. Clin. E x p . Immunol. 73,191-197. 321. Matsiota, P., Druet, P., Dosquet, P., e t al. (1987). Natural autoantibodies in systemic lupus erythematosus. Clin. E r p . Immunol. 69,79-88. 322. Sutjita, M., Hohmann, A., Comacchio, R., et al. (1989). A common anti-cardiolipin antibody idiotype in autoimmune disease: Identification using a mouse monoclonal antibody directed against a naturally-occuring antiphospholipid antibody. Clin. E x p . Immunol. 75,211-216. 323. Fogler, W. E., Swartz, G . M., and Alving, C. R. (1987).Antibodies to phospholipids and liposomes: Binding of antibodies to cells. Biochim. Biophys. Acto 903,265272. 324. Green, F. A., Hildegardis, L., Hui, L., et al. (1984).The phospholipid requirement for RH,(D) antigen activity: Mode of inactivation by phospholipases and of protection by anti-RHJD) antibody. Mol. Immunol. 21,433-438. 325. McNeil, H. P., Simpson, R. J., Chesterman, C. N., and Krilis, S. A. (1990). Antiphospholipid antibodies are directed against a complex antigen that includes a lipid-binding inhibitor of coagulation: beta-2 glycoprotein-I (apolipoprotein H). Proc. Natl. Acad. Sci. U.S.A.87,4120-4124. 326. McNeil, H. P., Chesterman, C. N., and Krilis, S. A., unpublished observations. 327. Shapiro, S. S., Thiagarajan, P., and DeMarco, L. (1981). Mechanism of action of the lupus anticoagulant. Ann. N.Y. Acad. Sci. 370,359-365. 328. Dahlback, B., Nilsson, I. M., and Frohm, B. (1983). Inhibition ofplatelet prothrombinase activity by lupus anticoagulant. Blood 62,218-225.
276
tl. PATRICK McNEIL ETAL.
329. Wisloff, F., Michaelson, T. E., and Godal, H. C. (1987). Monoclonal IgM with lupus anticoagulant activity in a case of Waldenstrom’s macroglobulinaemia. Eur. J. Haematol. 38,456-460. 330. Exner, T., Rickard, K. A,, and Kronenberg, H. (1975). Studies on phospholipids in the action of a lupus coagulation inhibitor. Pathology 7,319-328. 331. Rauch, J., Tannenbaum, M., Tannenbaum, H., et al. (1986). Human hybridoma lupus anticoagulants distinguish between lamellar and hexagonal phase lipid systems. J. Biol. Chem. 261,9672-9677. 332. Schousboe, I. (1985). P-2-glycoprotein-I: A plasma inhibitor of the contact activation of the intrinsic blood coagulation pathway. Blood 66,1086-1091. 333. Bajaj, S. P., Rapaport, S. I., Fiever, D. S., et a1. (1983). A mechanism for the hypoprothrombinemia of the acquired hypoprothrombinemia-lupus anticoagulant syndrome. Blood 61,684-692. 334. Edson, J. R., Vogt, J. M., and Hasegawa, D. K. (1984). Abnormal prothrombin crossed-immunoelectrophoresis in patients with lupus inhibitors. Blood 64,807816. 335. Guarnieri, M., and Eisner, D. (1974).A DNA antigen that reacts with antisera to cardolipin. Biochem. Biophys. Res. Commun. 58,347-353. 336. Lafer, E. M., Rauch, J., Andrzejewski, C., et al. (1981). Polyspecific monoclonal lupus autoantibodies reactive with both polynucleotides and phospholipids. J. E x p . Med. 153,897-909. 337. Koike, T., Maruyama, N., Funaki, H., et al. (1984).Specificity of mouse hybridoma antibodies to DNA. 11. Phospholipid reactivity and biological false positive serological test for syphilis. Clin. E x p . lmmunol. 57,345-350. 338. Rauch, J., Tannenbaum, H., Stollar, B. D., and Schwarts, R. S. (1984). Monoclonal anti-cardiolipin antibodies bind to DNA. Eur. J . lmmunol. 14,529-534. 339. Carroll, P., Stafford, D., Schwartz, R. S., and Stollar, B. D. (1985).Murine monoclonal anti-DNA autoantibodies bind to endogenous bacteria. J . lmmunol. 135,10861090. 340. Shoenfeld, Y., Rauch, J., Massicotte, H., et al. (1983).Polyspecificity ofmonoclonal lupus autoantibodies produced by human-human hybridomas. N. Eng. J . Med. 308,414-420. 341. Eiliat, D., Zlotnick, A. Y., and Fischel, R. (1986).Evaluation of the cross-reaction between anti-DNA and anti-cardiolipin antibodies in SLE and experimental animals. Clin. E x p . lmmunol. 65,269-278. 342. Smeenk, R. J. T., Lucassen, W. A. M., and Swaak, T. J. G . (1987). Is anticardiolipin activity a cross reaction of anti-DNA or a separate entity? Arthritis Rheum. 30, 607-617. 343. Wright, D. J. M., Doniach, D., Lessof, M. H., et a1. (1970). New antibody in early syphilis. Lancet 1,740-743. 344. Meroni, P. L., Harris, E. N., Brucato, A., et al. (1987). Anti-mitochondrial M5 and anticardiolipin antibodies in autoimmune disorders: Studies on their association and a cross-reactivity. Clin. E x p . lmmunol. 67,484-491. 345. Meek, F., Khoury, E. L., Doniach, D., and Baum, H. (1980).Mitochondria1 antibodies in chronic liver diseases and connective tissue disorders: Further characterisation of the autoantigens. Clin.E x p . Immunol. 41,43-54. 346. Norberg, R., Gardlund, D., Thorstensson, R., and Lidman, K. (1984).Further immunological studies of sera containing antimitochondrial antibodies type M5. Clin. E x p . Immunol. 58,639-644.
ANTIPHOSPHOLIPID ANTIBODIES
277
347. Meyer, O., Abcia, F., Gyna, L., et al. (1987). Anti-mitochondria1 type 5 antibodies
348. 349. 350. 351. 352.
and anti-cardioiipin antibodies in systemic lupus erythematosus and auto-immune diseases. Clin. E x p . Immunol. 69,485-492. Green, F. A. (1972). Erythrocyte membrane lipids and Rh antigen activity.]. Biol. Chem. 247,881-887. Balestrieri, G., Tincani, A., Allegri, F., et al. (1988). Antiphospholipid antibodies and red cell membranes. Clin. E x p . Rheumatol. 6,197A. Howe, S. E., and Lynch, D. M. (1987). Platelet antibody binding in systemic lupus erythematosus. J. Rheumatol. 14,482-486. Kaplan, C., Champiex, P., Blanchard, D., et al. (1987). Platelet antibodies in systemic lupus erythematosus. Br. J . Haematol. 67,89-93. Jouhikainen, T., Kekomaki, R., Leirisalo-Repo, M., et al. (1989).Platelet antibodies detected by immunoblotting in systemic lupus erythematosus: Association with the lupus anticoagulant, thrombosis and thrombocytopenia. Thromb. Haemostasis
62,373A. 353. Schousboe, I. (1980). Binding of&-glycoprotein I to platelets: Effect of adenylate cyclase activity. Thromb. Res. 19,225-237. 354. Cines, D. B., Lyss, A. P., Reeber, M., et al. (1984). Presence of complement-fixing antiendothelial cell antibodies in systemic lupus erythemat0sus.J. Clin. Invest. 73, 611-625. 355. LeRoux, G., Wautier, M. P., Guillevia, L., and Wautier, J.-L. (1986). IgG binding to endothelial cells in systemic lupus erythematosus. Thromb. Haemostasis 56,144146. 356. Hashemi, S., Smith, C. D., and Izaguirre, C. A. (1987). Anti-endothelial cell anti-
357.
358.
359.
360.
361.
bodies: detection and characterization using a cellular enzyme-linked immunosorbent assay. J. Lab. Clin. Med. 109,434-440. Vismara, A., Meroni, P. L., Tincania, A,, et al. (1988). Relationship between anticardiolipin and anti-endothelial cell antibodies in systemic lupus erythematosus. Clin. E x p . lmmunol. 74,247-253. McCarty, G. A., and Kuzava, J. M. (1988). Correlation between anti-cardiolipin and anti-endothelial cell antibodies in rheumatic and non-rheumatic disease patients. Clin. Exp. Rheumatol. 6,208A. Rosenbaum. J., Pottinger, B. E., Woo, P., et al. (1988). Measurement and characterisation of circulating anti-endothelial cell IgG in connective tissue diseases. Clin. E x p . lmmunol. 72,450-456. Denkard, C., Sanchez-Guerrero, J., and Alarcon-Segovia, D. (1989). Fall in antiphospholipid activity at time of throniboocclusive episodes in systemic lupus erythematosus. J. Rheurnatol. 16,614-617. McVerry, B. A,, Machin, S. J., Parry, H., and Goldstone, A. H. (1980). Reduced prostacyclin activity in systemic lupus erythematosus. Ann. Rheum. Dis.39,524-
525. 362. Carreras, L. O., DeFreyn, G., Machin, S. J., et 01. (1981). Arterial thrombosis,
intrauterine death and “lupus” anticoagulant: Detection of immunoglobulin interfering with prostacyclin formation. Lancet 1,244-246. 363. Marchesi, D., Parbtani, A., Frampton, G., et al. (1981). Thrombotic tendency in systemic lupus erythematosus. Lancet 1,719. 364. de Castellarnau, C., Vila, L., Sancho, M. J., et al. (1983). Lupus anticoagulant, recurrent abortion, and prostacyclin production by cultured smooth muscle cells. Lancet 2,1137-1138.
278
H . PATRICK McNElL E T A L .
365. Vila, L., d e Castellarnau, C., Borrell, M., et al. (1985). Lupus anticoagulant and vascular prostacyclin production. Thrornb. Haemostasis 54,38A. 366. Asherson, R. A., Harris, E. N., Hughes, G. R. V., et al. (1987). Prostacyclin in systemic lupus and anticardiolipin syndrome. Ann. Rheum. Dis. 46,422-423. 367. Violi, F., Valesini, G., Iuliano, L., et al. (1987). Anticardiolipin antibodies and prostacyclin synthesis. Thromb. Haemostasis 57,374. 368. Petraiuolo, W., Bovill, E., and Hoak, J. (1988).The lupus anticoagulant stimulates the release of prostacyclin from human endothelial cells. Thromb. Res. 50,847855. 369. Hasselaar, P., Derksen, R. H. W. M., Blokzijl, L.,and deCroot, P. G. (1988).
Thrombosis associated with antiphospholipid antibodies cannot be explained by effects on endothelial and platelet prostanoid synthesis. Thromb. Haemostasis 59, 80-85. 370. Coade, S. B., van Haaren, E., Loizou, S., et al. (1989). Endothelial prostacyclin release in systemic lupus erythematosus. Thromb. Huemostasis 61,97-100. 371. Cariou, R., Tobelem, G., Belluci, S., et a1. (1988). Effect of lupus anticoagulant on antithrombogenic properties of endothelial cells-inhibition of thrombomodulindependent protein C activation. Thromb. Haemostasis 60,54-58. 372. Walker, T. S., Triplett, D. A., Javed, N., and Musgrave, K. (1988). Evaluation of lupus anticoagulants: Antiphospholipid antibodies, endothelium associated immunoglobulin, endothelial prostacyclin secretion, and antigenic protein S levels. Thromb. Res. 51,267-281. 373. Rustin, M. H. A., Bull, H. A., Machin, S. J., et 01. (1988).Effects of lupus anticoagulant in patients with systemic lupus erythematosus on endothelial prostacyclin release and procoagulant activity. J. Invest. Dermatol. 90,744-748. 374. Comp, P. C., DeBault, L. E., Esmon, N. L.,and Esmon, C. T. (1983). Human thrombomodulin is inhibited by IgG from two patients with non-specific anticoagulants. Blood 62, Suppl. 1,299. 375. Cariou, R., Tobelem, G., Soria, C., and Caen, J . (1986). Inhibition of protein C activation by endothelial cells in the presence of lupus anticoagulant. N. Engl. J . Med. 314, 1193-1194. 376. Freyssinet, J.-M., Wiesel, M.-L., Gauchy, J., et al. (1986).An IgM lupus anticoagulant that neutralizes the enhancing effect of phospholipid on purified endothelial thrombomodulin activity-a mechanism for thrombosis. Thromb. Haentostasis 55, 309-313. 377. Lo, S. C., Salem, H. H., Howard, M. A., et al. (1989). Inhibition of protein C and protein S function by plasma from patients with the lupus anticoagulant. Thromb. Haemostasis 62,375A. 378. Kitchen, S., Malia, R. G., Sampson, B. M., et al. (1989). Inhibition of protein S cofactor activity by antiphospholipid antibodies. Br. J. Haematol. 71, Suppl. 1,3. 378. Sanfelippo, M. J., and Drayna, C. J. (1982).Prekallikrein inhibition associated with the lupus anticoagulant. Am. J. Clin. Pathol. 77,275-279. 380. Tsakiris, D. A., Marbet, G. A., Makris, P. E., et al. (1989). Impaired fibrinolysis as an
essential contribution to thrombosis in patients with lupus anticoagulant. Thromb. Haemostasis 61, 175-177. 381. Borrell, M., Fontcuberta, J., Muniz, E., et al. (1987). Fibrinolytic activity and other coagulation proteins in patients with lupus anticoagulant. Thmrnb. Haemostasis 58,393A. 382. Francis, R. B., McCehee, W. G., and Feinstein, D. I. (1988). Endothelial-
ANTIPHOSPHOLIPID ANTIBODIES
279
dependent fibrinolysis in subjects with the lupus anticoagulant and thrombosis.
Thromb. Huemostasis, 59,412-414. 383. Francis, R. B., and Neely, S. (1989).Effect ofthe lupus anticoagulant on endothelial fibrinolytic activity in oitro. Thromb. Huemostasis 61,314-317. 384. Awada, H., Barlowatz-Meimon G . , Dougados M., et ul.(1988).Fibrinolysis abnormalities in systemic lupus erythematosus and their relation to vasculitis. J . Lub. Clin. Med. 111,229-236. 385. Regan, M., Lackner, H., and Karpatkin, S. (1974).Platelet function and coagulation profile in lupus erythematosus. Ann. Intern. Med. 81,462-468. 386. Galli, M., Cortelazzo, S., Viero, P., et ul. (1988).Interaction between platelets and lupus anticoagulant. Eur. J . Huemutol. 4 1 , 8 8 4 4 . 387. Norberg, R., Nived, O., Sturfelt, G., et al. (1987).Anticardiolipin and complement activation: Relation to clinical symptoms. J . Rheumatol. 14, 149-153. 388. Hammond, A., Rudge, A. C., Loizou, S., et ul. (1989).Reduced numbers ofconiplement receptor type 1 on erythrocytes are associated with increased levels of anticardiolipin antibodies. Arthritis Rheum. 32,259-264. 389. Lockshin, M. D., Harpel, P. C., Druzin, M. L., et al. (1985). Lupus pregnancy. Arthritis Rheum. 28, 58-66. 390. Kovacsovics, T., Tschopp, J., Kress, A., and Isliker, H . (1985). Antibodyindependent activation of C1, the first component of coniplenient by cardiolipin.].
lmmunol. 135,2695-2700. 391. Gris, J. C., Schved, J. F., Tousch, D., et uI. (1988).Anti-idiotypic antibodies against anti-phospholipid autoantibodies which suppress lupus-like anticoagulant activity. Nouv. Reo. Fr. Haeinatol. 30, 143-147. 392. Cosgriff, T. M., and Martin, B. A. (1981).Low functional and high antigenic antithrombin 111 level in a patient with the lupus anticoagulant and recurrent thromhosis. Arthritis Rheum. 24,94-96. 393. Boey, M. L., Loizou, S., Colaco, C. B., et al. (1984).Antithrombin 111 in systemic lupus erythematosus. Clin. E x p . Rheumatol. 2,53-56. 394. Rapaport, S. I. (1989).Inhibition offactor VIIJtissue factor-induced blood coagulation with particular emphasis upon a factor X,-dependent inhibitory mechanism.
Blood 73,359-365. 395. Bajaj, M. S., Rana, S. V., Wysolmerski, R. B., and Bajaj, S. P. (1987).Inhibitor o f t h e factor VI1,-tissue factor complex is reduced in patients with disseniinated intravascular coagulation but not in patients with severe hepatocellular disease. J . Clin.
Znoest. 79,1874-1878. 396. Henry, M . L., Everson, B., and Ratnoff, 0. D. (1988). Inhibition of the activation of Hageman factor (factor XII) by Pz-glycoprotein I. J . Lub. Cliii. Med. 111, 519-523. 397. Nimpf, J., Bevers, E. M., Bonians, P. H. H., et al. (1986). Prothrombinase activity of human platelets is inhibited by Pz-glycoprotein-I. Biochim. Biophys. Acta 884, 142- 149. 398. Nimpf, J . , Wurm, H., and Kostner, G. M. (1987).Pz-glycoprotein-I (apo H ) inhibits the release reaction of human platelets during ADP-induced aggregration. Atherosclerosis 63, 109-114. 399. Canfield, W. M., and Kiseel, W. (1982). Evidence of normal functional levels of activated protein C inhibitor in combined factor V/VIII deficiency disease.J. Clin. Znoest. 70,1260-1272. 400. Nakaya, Y., Schaefer, E. J., and Brewer, H. B. (1980). Activation of human post
280
H. PATRICK McNEIL E T A L .
heparin lipoprotein lipase by apolipoprotein H (&-glycoprotein-I). Biochem. Biop h y s . Res. Commun. 95,1168-1172. 401. McNeil, H. P., Chesterman, C. N., and Krilis, S. A. (1990).Characterisationof the epitopes to which antiphospholipid antibodies are directed following separation into antibody subgroups. Aust. N. Z. J . Med. (abstr.) (in press). This article was accepted for publication in June 1990.
ADVANCES IN IMMUNOLOGY. VOL. 49
Adoptive T Cell Therapy of Tumors: Mechanisms Operative in the Recognition and Elimination of Tumor Cells PHILIP D. GREENBERG Depotintent of Medicine and Immunology, University of Washington and Fred Hutchinson Cancer Research Center Seattle, Washington 98195
1. Introduction
Defining the role of the host immune system in preventing, controlling, and eliminating malignant cells has been a difficult and often confusing enterprise for investigators during the last several decades. Studies performed in rodents with chemically induced syngeneic transplantable tumors (Foley, 1953; Prehn and Main, 1957) demonstrated that the host immune system could specifically recognize and reject malignant cells, and implied a central role for the immune system in regulating the outgrowth of tumor cells. However, skeptics remained doubtful about the meaning of these results, since earlier studies using transplantable tumors performed prior to the development of inbred mouse strains had made similar claims, but rather than lead to the isolation of tumor-specific transplantation antigens had ultimately led to the identification of the major histocompatibility complex and the role of histocompatibility antigens in transplant rejection. These concerns about the role of histocompatibility antigens were subsequently abated by Klein’s studies (Klein et ul., 1960) demonstrating that, after resection of a methylcholanthrene-induced tumor, the primary host could reject a subsequent challenge with its own resected tumor. Following this unequivocal demonstration of the presence of immunogenic tumor antigens, studies during the ensuing decade elucidated the remarkable heterogeneity of tumor antigens expressed in chemically induced tumors, with each individual tumor expressing an apparently unique tumor antigen capable of inducing recognition of itself but not other similarly induced tumors (Old et ul., 1962; Prehn, 1962; Baldwin, 1955; Globerson and Feldman, 1964). Moreover, evaluations of other tumor systems increasingly documented the presence of immunogenic tumor antigens, including analyses of UV-induced tumors (Kripke, 1974), polyoma virus-transformed tumors (Sjogren et ul., 1961),and retrovirus-transformed tumors (Old et ul., 1963; Klein, 1966).These observations emphasized the wide array of antigens expressed on tumors that distinguish transformed from normal cells, and resulted in a euphoria surrounding the field of tumor 28 1 Copyright B 1991 by Acddeniic Press, lnc All rights of reproduction in anv form reserved
282
PHILIP D. GREENBERG
immunology that culminated in the proposition by Sir MacFarlane Burnet of the theory of immunological surveillance (Burnet, 1970). Burnet proposed that a major function of the immune system is to recognize and eliminate cells that become disparate from the host as a result of events such as somatic mutation, that the major value for this surveillance is to prolong host survival by elimination of newly appearing malignant cells, and that tumor elimination is mediated almost entirely by T cells. Unfortunately, the promise for immunotherapy suggested by these early tumor transplantation studies and the potential for manipulating antitumor responses implied in Burnet’s hypothesis were not adequately realized in the decade of the 1970s, and the backlash from the lack of definitive progress and of clinical application resulted in serious doubts about the viability of the field of tumor immunology. Many problems became apparent. First, experimental observations identified many deficiencies in the hypothesis of immunological surveillance (Moller and Moller, 1976).This was highlighted by the finding that athymic nude mice-which, due to a congenital lack of mature T cells, were considered an appropriate model for testing the surveillance hypothesis-did not develop spontaneous tumors at a higher rate than did normal mice (Rygaard and Povlsen, 1976). Second, transplantable tumors that were presumably immunogenic often grew in syngeneic hosts possessing intact immune systems, and in some cases host T cells were even found to potentiate tumor growth (Prehn, 1976). Third, searches to identify the tumor rejection antigens expressed on immunogenic transformed tumor cells, with the exception of retroviral antigens, were uniformly unsuccessful. Finally, efforts to demonstrate tumor-specific T cell immunity in human cancer patients or a role for human immune responses in controlling tumor growth provided unconvincing results. In retrospect, with the advent of the technical and theoretical advances in cellular and molecular immunology in the l980s, the bases for most of these problems have become clear and in many instances resolutions have been identified. First, Burnet’s proposition that the immune system functions largely to reject abnormal modified cells in many respects may be correct, but this function probably evolved to provide a mechanism for the host to control viral infections rather than to reject spontaneously occurring tumors. However, this more appropriate perception of the essential role of T cells in surveillance and elimination of virally infected cells (Zinkernagel and Doherty, 1979) does not necessarily imply that T cells have no function in surveillance
ADOPTIVE T CELL THERAPY OF TUMORS
283
and eradication of tumor cells, but rather that this function may be relevant only in more limited settings. The importance of T cells in surveillance against the outgrowth of tumor cells is probably best demonstrated with virally transformed tumors, such as EBV-induced B cell lymphomas (Moss et al., 1977; Thorley-Lawson et al., 1977; Thorley-Lawson, 1980), which occur with markedly increased frequency in transplant patients specifically depleted of T cells (Martin et al., 1984), and with UV-induced squamous cell cancers that occur with high frequency in renal transplant patients (Hardie et al., 1980). Second, the reasons for growth of presumably immunogenic tumors in immunocompetent hosts have become more apparent with an improved understanding of the function of T cell subsets and the requirements for induction and expression of T cell responses. Thus, the growth of tumors expressing potentially immunogenic determinants can reflect such issues as ineffective presentation of tumor antigens by antigen-presenting cells (APC), including the tumor itself, that may lead to T cell anergy due to a failure to provide the costimulatory signals necessary to activate antigen-specific T cells (Mueller et al., 1989); induction of suppressor T cells as a consequence ofproliferating tumor cells (Fujimoto et al., 1976; Gorelik, 1983; North, 1984); or failure of the effector T cell response to expand at a rate commensurate with control of a rapidly proliferating tumor (De Boer et al., 1985). Third, insights into the nature of antigens recognized by T cells and the use of molecular genetic techniques have permitted isolation of tumor antigens capable of inducing T cell responses. The earlier perceptions that cytotoxic T cells recognize foreign proteins integrally inserted in the cell membrane had focused efforts for more than a decade on the use of the powerful new monoclonal antibody technology combined with biochemical purification techniques to isolate tumor antigens expressed on the cell membrane. However, analyses of the requirements for recognition of virally infected cells by CD8+ cytotoxic T cells (T,) by Townsend (Townsend et al., 1984,1986; Townsend and Bodmer, 1989) and Braciale (Braciale et al., 1987) demonstrated that Class I-restricted T, do not recognize integral membrane proteins but rather recognize intracellular proteins that are synthesized in the cytoplasm, degraded to small peptides, translocated into the endoplasmic reticulum for insertion into a cleft in the Class I MHC molecule, and transported through the Golgi stack for expression on the cell surface in the context of the MHC molecule (Bjorkman et al., 1987a,b; Nuchtern et al., 1989). The subsequent use of molecular technology to probe tumor cells for expression of abnormal genes and
284
PHILIP D. GREENBERG
gene products has permitted identification of the unique tumor antigens immunogenic to T cells that are expressed b y chemically and UV-induced murine tumors (Lurquin et al., 1989; H. Schreiber et al., 1988), and similar methods appear useful for identifying immunogenic human tumor antigens (Van den Eynde et al., 1989; Knuth et al., 1989). Finally, and perhaps most encouraging, tissue culture technology has made it possible to expand and clone antigen-specific T cells that may initially be present only in low frequency, and has permitted detection of apparent tumor-specific T cells in patients with cancer (Vose and Bonnard, 1982; Mukherji and MacAlister, 1983; Mitsuya et al., 1983; de Vries and Spits, 1984; Slovin et al., 1986; Anichini et al., 1989; Barnd et al., 1989). Studies in animal models have suggested that T cells obtained from the cells infiltrating a tumor mass may be enriched for tumor-reactive T cells (Chapdelaine et al., 1979), and one promising approach has been to obtain and expand the T cells present in biopsies of human tumors and of the lymph nodes draining the tumors. Such T cells, which have often been labelled TIL (tumor infiltrating lymphocytes) (a descriptive moniker that unfortunately invites imprecise inclusion of effector cells other than the relevant T cell subpopulation in the mononuclear infiltrate) frequently exhibit unique specificity for the autochthonous tumor (Topalian et al., 1987,1989; Yi et al., 1989; Itoh et al., 1988; Belldegrun et al., 1989). These studies have once again suggested that it should be possible to modulate the immune system of cancer patients to promote eradication of tumors, but this perception now has a more firm theoretical and experimental base. There are many potential approaches for enhancing tumor immunity that require examination, including methods to specifically or nonspecifically augment the function of tumor-reactive effector cells. One approach that has received a great deal of attention in the past several years (reviewed in S. A. Rosenberg and Lotze, 1986) has been to use high doses of IL-2 to generate a population of nonspecific cytolytic effector cells, termed lymphokine-activated killer (LAK) cells, that preferentially lyse transformed targets, and to infuse such autologous LAK cells with or without concurrent administration of high doses of IL-2 into cancer patients. LAK cell therapy has had therapeutic benefit in some patients, but such effector cells are frequently toxic and lack several of the most attractive qualities of T cells, including target specificity and memory. Therefore, an alternative but more complex approach is to treat patients by the adoptive transfer of in uitro expanded, tumor-specific T cells. This approach is based on the suppositions that some tumor-bearing hosts generate weak antitu-
ADOPTIVE T CELL THERAPY OF TUMORS
285
mor T cell responses that have no apparent effect on tumor growth due to poor induction and expression in uiuo; that tumor-reactive T cells from many such hosts can be identified, isolated, and expanded in uitro to large numbers under conditions in which limitations often present in uiuo, such as insufficient cytokine production, ineffective presentation of tumor antigens, and inhibitory regulatory circuits can be overcome; and that reinfusion of this expanded tumor-reactive T cell population will result in a therapeutic antitumor effect. Clearly, the generation of T cells for tumor therapy is more complicated than the use of LAK cells, but such therapy has the potential to provide the host with a more effective and a nontoxic response. The rationale of this approach, which has been extensively evaluated in preclinical animal models by many laboratories, including ours, has now been verified by studies in which human T cells have been isolated from tumors of cancer patients, expanded in uitro, demonstrated to have specificity in uitro for autochthonous tumor cells, and shown to mediate a therapeutic effect following reinfusion into the patient. The greatest successes have been observed in the treatment of malignant melanoma, in which more than 40% of patients appear to respond to such therapy (S. A. Rosenberg et al., 1988). These results, and the theoretical insights and experimental findings that provided the basis for such clinical investigations, have engendered significant enthusiasm for expanded efforts at human adoptive immunotherapy with tumor-specific T cells. However, even in the treatment of melanoma, the majority of patients do not respond to therapy, and very few of the responders actually achieve complete eradication of the tumor. Thus, there remain many important issues to be resolved if such T cell therapy is to be made more generally and completely effective. These involve not only principles of adoptive cell transfer, but more general concepts of tumor immunobiology, including definition of the requirements for inducing T cell responses to tumor antigens, the identity of the T cell subpopulation(s) responsible for mediating antitumor activity, the nature of the tumor antigens recognized by these T cells, and the immunologic effector mechanisms that contribute to tumor eradication. Resolution of many of the obstacles impeding progress in human tumor immunotherapy will require investigations in animal models in which the tumor antigens can be defined and individual immunologic parameters can be isolated and assessed. In this chapter, our studies in murine tumor models, as well as related and relevant studies from other laboratories, will be reviewed. The discussion will attempt to identify the principles and
286
PHILIP D. GREENBERG
issues elucidated in such animal models that may provide insights for the development of effective approaches to modulate T cell function to promote eradication of human tumors. II. Principles of Adoptive Therapy with Specifically Immune T Cells
A large number of animal models have been developed to evaluate the requirements for eradicating established tumors by the adoptive transfer of tumor-specific T cells. These models include a diverse group of tumors with distinct biologies, but can generally be divided into three major categories defined by the pattern of tumor growth, including: (1) disseminated hematologic malignancies, which typically represent leukemias and lymphomas that grow predominantly in lymphoreticular sites and tend not to form large solid masses; (2) solid tumors, which typically represent sarcomas that form progressive vascularized masses at the primary site, and have variable propensities to metastasize; and (3)experimental solid tumor metastases, which typically represent sarcomas and melanomas that are inoculated intravenously and tend to establish metastases in the lung or liver. Although there are many differences between each of these models, several principles have emerged that have general application for approaches to augment host T cell immunity and promote tumor eradication with the use of adoptive transfer of tumor-specific T cells. A. PROBLEMS POSEDBY A LARGETUMOR BURDEN A common observation in these tumor models is that a large growing tumor presents considerable and often insurmountable obstacles to potentially effective cellular therapy. Thus, even under theoretically ideal conditions, in which the tumor is known to be immunogenic and sensitive to lysis by immunologic effector mechanisms, and in which immune cells transferred into the host at the time of tumor transplantation can mediate tumor rejection, the infusion of immune T cells into the host after the tumor has become established and grown to a large size rarely has a detectable antitumor effect. This lack of efficacy does not reflect a simple arithmetic relationship in which administration of a greater number of effector cells could eliminate the large number of tumor cells, since in most instances infusion of very large numbers of specifically immune T cells, to increase the immediate effector-totarget ratio beyond that predicted to be necessary based on the ratio effective with T cell therapy of a small tumor burden, still has minimal antitumor activity (Fefer et al., 1976). Several reasons, as described below, have been elucidated to explain this limitation of specific cellu-
ADOPTIVE T CELL THERAPY OF TUMORS
287
lar immunotherapy, but in general it has been necessary to either initiate T cell therapy at a time when the tumor burden is low, such as with treatment of pulmonary micrometastases, or to reduce the size of the tumor prior to T cell therapy by surgical resection of solid tumor masses or by treatment of the host with chemotherapeutic drugs that reduce the number of tumor cells and potentially facilitate adoptive T cell transfer by modifying the host immune system. Large growing tumors can interfere with adoptive T cell therapy by inducing cells and factors that prevent the expression of immunity. Many aspects of this suppressive phenomenon represent nonspecific biological consequences to the immune system of a metabolically active growing tumor, and immunologic effector functions in general have been shown to be depressed in human as well as animal tumorbearing hosts (Maccubbin et al., 1989; Eura et al., 1988).Some of this immunodeficiency results from release by the tumor of substances, such as TGF-P, P15E, and prostaglandins, that suppress immunologic functions (Cianciolo et al., 1981, 1984; Snyderman and Cianciolo, 1984; Farram et al., 1982). These factors, which may interfere with systemic immune responses, can also impede expression of immunologic effector functions at the site of the tumor, thus essentially establishing the growing tumor mass as an immunologically privileged site (Spitalny and North, 1977). Additionally, macrophages from tumorbearing animals are frequently immunologically dysfunctional, exhibiting overproduction of inhibitory factors such as prostaglandins or underproduction of stimulatory factors such as IL-1, and consequently suppress or fail to support the generation of host immune responses (Fujii et al., 1987; Ting and Rodrigues, 1980). Another potential cause of immune suppression is the release of antigenic material from the growing tumor, resulting in free circulating antigen or the formation of antigen-antibody complexes. Such material has the capacity to specifically and nonspecifically suppress or block immunologic effector functions (Hellstrom and Hellstrom, 1974; K. Takahashi et al., 1988; Schatten et al., 1984). Most important, all of these suppressor activities are abated by reduction of the tumor mass. Another mechanism by which a growing tumor could subvert expression of an effective immune response in the host is inducing the generation of antigen-specific T suppressor (T,) cells in response to the replicating antigen. Unfortunately, despite substantial effort, it has not been possible to isolate a phenotypically unique T, subset, to identify antigens that selectively induce T, rather than effector T cell responses, or to identify a signal transduction pathway that induces suppressor rather than effector functions in T cells. In light of recent
288
PHILIP D. GREENRERG
advances that have improved our understanding of T cell subsets and T cell activation, this has prompted a re-examination of many of the conditions leading to detection of T,, and in many situations alternative explanations have become apparent. Some of these explanations will be described later in this section, but it must be emphasized that biological phenomena in tumor-bearing hosts most consistent with the operative mechanism being T cell-mediated suppression of host responses have been described with many immunogenic tumors. Since the identity and role of T, remains controversial, and since the approaches used to reduce the tumor burden also appear to ablate T, (North, 1982), only a brief description of the biology of T, will be provided. For a more detailed discussion ofT,, the reader is referred to the numerous reviews on this topic, which describe not only the role of T cells with suppressor functions but also the potential contributions of complex regulatory circuits involving multiple effector and inducer T, and suppressor factors (North, 1985; Schatten et al., 1984; Benacerraf and Germain, 1981; Webb et al., 1983; Green et al., 1983, 1989). One of the clearest examples of the contribution of T, to the downregulation of tumor immunity has been provided by North's studies, in which the efficacy of adoptive therapy of tumor-bearing hosts that are immunologically intact was compared to therapy of hosts previously rendered T-deficient by adult thymectomy followed by lethal irradiation and reconstitution with T-depleted bone marrow. Transfer of specifically immune T cells into T-deficient tumor-bearing hosts resulted in complete rejection of an established syngeneic fibrosarcoma, or of a disseminated mastocytoma in a parallel model, whereas the immune T cells were totally ineffective when transferred into immunologically intact tumor-bearing hosts (Berendt and North, 1980; Dye and North, 1981).The importance of T, in abrogating the expression of tumor immunity in the intact hosts was confirmed in mixing experiments, in which the efficacy of transfer of specifically immune T cells into T-deficient hosts was completely inhibited by the concurrent administration of T cells derived from tumor-bearing intact hosts. Such T, were demonstrated to interfere with the generation of CD8' cytolytic effector cells in the tumor-bearing host (North and Bursuker, 1984a,b; Mills and North, 1983, 1985). Studies in other tumor therapy models, in which the host was treated prior to T cell therapy to eliminate all host T cells or was selectively depleted of potential T,, have further documented a possible role for T, in interfering with the expression of tumor immunity (Fernandez-Cruzet al., 1980;North, 1982; Perry et al., 1978). T cells capable of down-regulating human nielanoma-specific T cell responses have also been identified in some
ADOPTIVE T CELL THERAPY OF TUMORS
289
individuals from which tumor-specific T cell clones have been isolated and analyzed (Mukherji et al., 1989). Although these and the many other demonstrations of the phenomenon of T cell mediated suppression suggest that the presence of T, could contribute to the difficulty detecting and expressing tumor-specific T cell responses in tumorbearing hosts, the lack of definitive cellular markers ofT, and of molecular characterization of suppression make it difficult to determine the role of T, in tumors that are of unknown or unclear immunogenicity. As previously suggested, the failures to identify T cell receptors with defined specificity that transduce signals to T, or to clone genes for T,-derived suppressor functions or factors have dictated that the mechanisms underlying observed suppressive phenomena be re-examined. An explanation for at least some of the observed T, phenomena has been provided by the studies of Mosmann and colleagues, who have demonstrated that the CD4+ T helper ( T H ) population contains two distinct subpopulations that can be differentiated on the basis of the sets of lymphokines each produce, and that these TH subpopulations may be mutually inhibitory for each other during the evolution of an immune response (Mosmann et al., 1986; Mosmann and Coffman, 1989a,b). T Hclones ~ uniquely produce IL-2 and y-IFN and preferentially induce macrophage activation and DTH responses (Stout and Bottomly, 1989; Cher and Mosmann, 1987), whereas T H clones ~ uniquely produce IL-4, IL-5, and IL-6, and consequently are better helper cells for B cell responses (Killar et al., 1987; Boom et al., 1988). Particular immunization regimens have been previously shown to induce preferentially either DTH responses or antibody responses to an antigen (Parish, 1972; Crowle and Hu, 1966), and recent studies suggest this may reflect consequences of selective generation of either T H or ~ T H effector ~ responses (Heinzel et al., 1989; Mosmann and Coffman, 1989a). The predominant generation of a single THsubset in response to an immunogen could reflect the provision of inductive signals with selective activity for one subset, such as IL-1, which may preferentially activate T Heffector ~ cells (Greenbaum et al., 1988; KurtJones et al., 1987; Lichtman et al., 1988), or the production of factors by one TH subset that interferes with the generation of the other subset. Recent studies have demonstrated that production of y-IFN by T H ~ cells inhibits the growth of T H 2 but not T Hcells ~ (Gajewski and Fitch, 1988), and that production of a newly described factor by T H cells ~ selectively inhibits proliferation and cytokine production by T Hcells ~ (Fiorentino et al., 1989). Further experiments are necessary to elucidate the principles underlying the preferential activation of T Hor~ T H ~ cells and/or the dominant activity or persistence of inhibitory cy-
290
PHILIP D. GREENBERG
tokines produced by one T H subset during an immune response, but the existing data suggest that apparent T cell suppression of a desired effector response may reflect in part preferential activation of the alternative THeffector subpopulation. In this regard, it should be noted that the T, extensively described in North's model, which interfere with the generation of a CD8' T, response, are of the CD4+ phenotype (North, 1985; North and Bursuker, 1984a). Similarly, the observed regulation of the CD8' cytotoxic response to human melanoma was mediated by autologous CD4' T cell clones (Mukherji et al., 1989). Thus, methods to selectively augment desired CD4' T cell responses in tumor-bearing hosts, such as enhancing the generation of TI11 cells b y infusing Mab to IL-4 to interfere with the proliferation of TH2 cells (Heinzel et al., 1989; Finkelman et al., 1986), or promoting the generation O f T H 2 cells by infusing Mab that neutralize y I F N (Finkelman et al., 1988), may provide mechanisms to overcome the activity of apparent antigen-specific Ts. Although specific and nonspecific suppressor cells or regulatory T H cells may be induced by a growing tumor, the presence of such activity is by no means a requisite explanation for the inability of tumorspecific T cells to effectively treat a large tumor burden. Insights into the qualitative and quantitative obstacles for an effective T cell response to a growing tumor can be derived from the study of mathematical models, which have been formulated from experimental results defining tumor growth patterns and the requirements for the generation and expansion of an immune response (De Boer and Hogeweg, 1986; De Boer et al., 1985).These models, which permit analysis ofthe roles of independent variables in the outcome of interactions between the immune system and a growing antigenic tumor, include an afferent arm requiring an inflammatory response to bring macrophages to the tumor site, interactions of antigen-presenting macrophages and tumor antigen-reactive CD4+ T cells necessary for induction of CD4' T cell proliferation and lymphokine production, and a proliferative response of CD8' T cells dependent on recognition of tumor cells and the availability of IL-2 as a second signal; and an efferent arm represented b y induction of a tumor- and cytokine-dependent inflammatory response, activation of tumoricidal macrophages by T cell-secreted lymphokines, and expression of cytolytic CD8' T cell activity. In one such mathematical model, which specifically excludes consideration of negative regulation by suppressor cells or factors (De Boer et al., 1985),the variable of tumor immunogenicity is reflected in the number of tumor reactive T cell precursors entered into the equation as being present in the host at the time of exposure to the tumor (i.e.,the magnitude of the
ADOPTIVE T CELL THERAPY OF TUMORS
291
initial response), and the outcome of tumor challenge is determined by a series of differential equations that define the relationship between tumor growth, the proliferation of CD4+ TH in response to available tumor antigen and APC, and the lysis of tumor cells both by cytolytic macrophages activated by CD4' T cells and by CD8+ Tc expanding in response to available IL-2. Although the exclusion of suppressor mechanisms may inappropriately simplify such a model, it does permit analysis of the theoretical requirements for an effective immune response when tumor immunogenicity, tumor growth rate, and tumor burden are the major obstacles. Several interesting conclusions can be derived from this type of mathematical model. First, the number of tumor-reactive CD4+ TH precursors initially present, and the time point in tumor growth at which these cells get activated, have an enormous impact on the capacity of the host to reject the growing tumor. Thus, as would be expected, tumor rejection is the most likely outcome if the tumor is highly immunogenic and induces an early inflammatory response. Second, a poorly immunogenic tumor destined to grow progressively can be rejected if a small number of tumorspecific TH are added (i.e., adoptive therapy) at a time when the tumor burden is low, but addition of even a large number of THis ineffective in the presence of a large tumor burden. Third, the efficacy of CD8+ Tc in tumor elimination is less dependant on the number of tumorreactive Tc initially present than on the availability of IL-2 produced by TH to promote expansion of this population. These mathematical predictions are in accord with experimental observations, in which it has been shown that the T cell response to tumors such as lymphomas or sarcomas is often quantitatively inadequate to prevent progressive tumor growth (Lannin et al., 1982; De Weger et al., 1987) I n these settings, functional effector cells were isolated from the host despite tumor progression, and increasing the number of tumor-reactive T cells by adoptive transfer of T cells or prior immunization of the host made it possible to reject such tumors. Results from adoptive therapy studies of a disseminated leukemia in our laboratory, as discussed in this review, are also remarkably consistent with predictions provided by this mathematical model. These studies all emphasize the importance of performing adoptive therapy at a time when the tumor burden is low. Several approaches can be used to reduce the tumor burden to permit effective expression of tumor immunity. In settings in which there are large growing primary tumors, surgical resection can be employed. For example, in a lung carcinoma model, transferred immune cells were ineffective in hosts with a large primary tumor, but could prevent the outgrowth of
292
PHILIP D. GREENBERG
micrometastatic pulmonary lesions if the primary tumor was surgically removed (Treves et al., 1975). An alternative approach, which is more generally applicable to the treatment of disseminated tumors, employs tumoricidal chemotherapeutic drugs. Studies in a variety of tumor models have demonstrated that reduction of the tumor burden by administration of chemotherapy is essential to achieve an immunotherapeutic effect (Schlick et al., 1986; Campbell et al., 1988; Einstein et al., 1976; Mihich, 1969; D. L. Klein et al., 1979). Several models have been developed in our laboratory for analysis of the treatment of disseminated leukemias and lymphomas by the adoptive transfer of immune T cells, and our results will provide the basis for much of the discussion in this review. The most extensively studied prototypic model has involved the treatment of disseminated FBL-3, a Friend retrovirus-induced erythroleukemia, in C57BL/6 (B6) mice (Fig. 1).In this model, mice are inoculated intraperitoneally with 5 x 10" FBL-3 leukemia cells on day 0 and left untreated until day 5, at which time disseminated tumor is detectable in the peripheral blood and lymphoid organs (Greenberg et al., 1980). Mice receiving no therapy on day 5 die 1-2 weeks later with progressive ascites, splenomeg-
CY+ (BGIThy-1.1)~FBL
100
80
.->
-
CY+ (B6IThy-l.l)a FBL +aThy-1.1 (Day 50)
I
No No Therapy
L
60-
L
a
v,
)
Alone
40-
20
L
1 CY
CY+ (BG/Thy-l.l)a FBL +aThy-1.1 (Day 30)
-
0 0
CY+ (B6IThY-l.l)a (B6IThy-l.l)a FBL +aThy-1.1 (Day 40)
CY+ (BG/Thy-l.l)a FBL +aThy-1.1 (Day 20) I
I
20
40
I
I
I
60
80
Days FIG.1. Requirement for a prolonged T cell response for complete tumor eradication. BG/Thy-1.1 mice were inoculated with 5 x lo6 FBL leukemia cells on day 0, and received no therapy or were treated on day 5 with either 180 mg/kg cyclophosphamide (CY) alone or CY and 2 x lo' spleen cells from FBL-primed BG/Thy-l.l donor mice. Beginning on day 20, 30,40, or 50, the designated groups of mice were depleted of T cells in oioo by inoculation of an IgCz, monoclonal antibody to Thy-1.1.
ADOPTIVE T CELL THERAPY OF TUMORS
293
aly, and lymphadenopathy. Immunotherapy alone by transfer of immune T cells on day 5 has no apparent antitumor effect. By contrast, chemotherapy alone on day 5 with 180 mg/kg cyclophosphamide does have an antitumor effect, but only prolongs survival for 2-3 weeks and does not cure any mice. Bioassay of mice treated on day 5 with chemotherapy alone has demonstrated that cyclophosphamide is directly tumoricidal and markedly reduces the tumor burden, but disseminated leukemia cells become detectable again by day 10,and then increase progressively in number until death (Greenberg et al., 1980). Combined treatment on day 5 with cyclophosphamide followed in 6 hours (to allow for drug clearance) by immune T cells results in further prolongation of survival, and, if an adequate number (>5 x lo6)of immune cells are transferred, completely eradicates the leukemia cells and cures mice. The large tumor burden present on day 5,rather than tumor-induced T,, appears to be the major obstacle to effective therapy with T cells alone in this model. This was directly evaluated in therapy studies performed in T-deficient hosts, which cannot generate T,. Treatment of tumor-bearing T-deficient mice on day 5 with a very high dose (5x lo7)of immune spleen cells alone had no apparent antitumor effect (Fig. 2),whereas treatment of T-deficient hosts with cyclophosphamide prior to transfer of a much smaller number of T cells resulted in complete tumor elimination (Greenberg et al., l98la,1985).Thus, the major contribution of cyclophosphamide in this model appears to be a reduction of the tumor burden to a size small enough to permit effective expression of adoptively transferred tumor immunity. In conclusion, large tumor burdens present qualitative and quantitative problems to the immune system that significantly interfere with efforts to treat tumors by augmentation of the number and function of tumor-specific T cells. It should be recognized that the obstacles posed by a large tumor burden have much less impact on the antitumor activity of immunotherapy with nonspecific immunologic effector cells. For example, treatment with LAK and IL-2 has demonstrable efficacy against large tumor burdens and response rates are not significantly improved by reduction of the tumor mass (S. A. Rosenberg et al., 1986;S. A. Rosenberg and Lotze, 1986).By contrast, lymphocytes derived from the tumor infiltrate (TIL), which contain tumor-specific T cells and are 50-100 times more potent than LAK cells in therapy of micrometastases, have virtually no detectable antitumor activity against large tumor burdens unless cyclophosphamide is added to the immunotherapy regimen (S. A. Rosenberg et al., 1986, 1988;Lafreniere et al., 1989).This underscores the major differences between therapy with T cells, which are subject to positive and negative regula-
294
PHILIP D. GREENBERG
(86/Thy-1.1 )a FBL Alone 0
20
40
-I
I
60
80
Days FIG.2. Efficacy of CD4+ T cells in the therapy of disseminated FBL in T-deficient hosts. B6 mice were rendered T deficient by thymectomy at 5 weeks of age, followed by lethal irradiation and reconstitution with T-depleted bone marrow. These mice were then inoculated with 5 x lo6 FBL intraperitoneally on day 0 and received no therapy, therapy on day 5 with only 180 mg/kg CY, therapy on day 5 with only 5 x lo7 immune spleen cells from congenic FBL-primed BG/Thy-1.1 mice (B6/Thy-1.1,pBL), or therapy on day 5 with CY plus lo7 immune cells. Mice received either unfractionated immune cells or purified CD4+ T cells obtained by negative selection with Mab and complement.
tory influences following cell transfer, but have the capacities to specifically recognize tumor cells, to proliferate, and to persist, and thus can potentially completely eliminate all residual tumor cells, and therapy with nonspecific cytolytic effector cells, which bind to and rapidly lyse target cells but have limited specificity and life span after cell transfer, and consequently may induce a significant reduction in the size of a large tumor mass but rarely result in complete tumor eradication.
B. REQUIREMENT FOR SPECIFICALLY IMMUNE T CELLSTO MEDIATE A PROLONGED ANTITUMOR EFFECT Although a variety of effector populations can contribute to the antitumor activity of adoptive therapy, studies in many tumor models has confirmed that the cells necessary for adoptive transfer, and usually sufficient for therapeutic efficacy, are tumor-specific T cells. The essential contribution of tumor-specific, MHC-restricted T cells has been well documented in our adoptive chemoimmunotherapy model
ADOPTIVE T CELL THERAPY OF TUMORS
295
for treatment of B6 mice bearing disseminated FBL leukemia. Following cyclophosphamide therapy, the efficacy of adoptive transfer of unfractionated spleen cells derived from syngeneic B6 mice immunized to FBL was compared with transfer of selected subpopulations of spleen cells. The therapeutic activity was dependent solely on the transfer of T cells, since immune donor spleen cells depleted ofT cells had no therapeutic activity, and purified T cells retained the therapeutic efficacy present in the unfractionated population (Berenson et al., 1975).The efficacy of T cells in this model is dose dependent, with low doses (
lo7cells) curing nearly all mice. The specificity of these T cells for tumor antigens was demonstrated by developing a similar adoptive therapy model in B6 mice for the treatment of disseminated EL-4, a chemically induced lymphoma that is antigenically distinct from the retrovirus-transformed FBL leukemia. T cells from B6 mice sensitized to either FBL or EL-4 were found to be effective only in therapy of the tumor to which the T cells had been previously immunized (Cheever et al., 1980, 1981). Tumor-specific T cells would be predicted to recognize tumor antigens only in the context of a presenting MHC molecule, and the MHC restriction of T cells effective in adoptive therapy was demonstrated in studies performed in (BALB/c x B6)Fl mice bearing either disseminated FBL bf B6 origin or LSTRA of BALB/c origin, parental strain retrovirus-transformed tumors that express cross-reactive retroviral tumor antigens but are disparate in MHC antigens (Greenberg et al., 1981b). CBFl T cells primed with infectious retrovirus responded to both parental tumors, but CBFl T cells boosted to the retroviral antigens in the context of the B6 MHC were effective in therapy of FBL and not LSTRA, whereas CBFl cells boosted to retroviral antigens in the context ofthe BALB/c MHC were effective in therapy of LSTRA and not FBL. These studies have been supported by analogous studies in many other tumor models, which have confirmed that, although a variety of effector mechanisms may participate in tumor eradication, specific elimination of tumor cells requires the transfer of tumor-specific T cells. Simplistically, tumor eradication following adoptive chemoimmunotherapy could reflect destruction of most of the tumor by chemotherapy followed by rapid killing of the residual tumor cells by transferred effector cells. However, studies in several adoptive therapy models demonstrated that T cell proliferation in the host after transfer is obligatory for therapeutic efficacy-irradiation prior to transfer rendered donor cells ineffective in therapy, and this lack of efficacy could not be overcome by infusion of larger numbers of T cells (Greenberg et al.,
296
PHILIP D. GREENBERG
1979; Colombo et al., 1985).This requirement for T cell proliferation implied that tumor eradication may not occur rapidly, and we therefore evaluated the kinetics of elimination of FBL leukemia cells in our adoptive chemoimmunotherapy model by sacrificing mice after potentially curative treatment and examining the peripheral blood and spleen for viable tumor cells (Greenberg et al., 1980). Mice treated on day 5 with cyclophosphamide plus immune T cells had significantly fewer tumor cells detectable within the first week after therapy than mice treated with cyclophosphamide alone, consistent with the transferred immune cells having an immediate antitumor effect. However, complete eradication of all residual tumor cells did not occur rapidly, and viable tumor cells remained detectable for 35 days following adoptive therapy. Analysis of tumor rejection by immune T cells using mathematical models that describe the induction and expression of T cell antitumor immunity with a series of differential equations similarly predict that significant tumor reduction can occur rapidly, but that complete tumor elimination requires a prolonged time period (De Boer et al., 1985). Studies evaluating adoptive therapy of advanced locally growing solid tumors have also demonstrated that complete tumor eradication occurs over a prolonged time period (Berendt and North, 1980; Fernandez-Cruz et al., 1980). The extended time period required for complete elimination of disseminated and advanced tumors presumably reflects the need for T cells to home to all tumor sites and to express tumoricidal activity at these sites, and implies that events occurring in the host during this time period that can interfere with expression of T cell immunity could lead to fatal tumor growth. This hypothesis was tested by examining the effect on tumor eradication of depleting mice in vivo of T cells at different time points after tumor therapy. Although mice bearing disseminated FBL that were treated on day 5 with cyclophosphamide and 2 x lo7 immune cells were cured of leukemia, similarly treated mice depleted of T cells on day 20 or day 30 (i.e.,25 days after cell transfer), by in vivo inoculation of an IgGz, monoclonal antibody (Mab) specific for the Thy antigen expressed on T cells, all died of recurrent leukemia (Fig. 1).Delaying T cell depletion until day 40 still resulted in 50% mortality, but no deaths were observed when T depletion was not initiated until day 50. This extended period during which T cell immunity is essential correlates directly with the detection of viable tumor cells in blood and lymphoid organs sampled from FBL-bearing hosts treated with potentially curative therapy (Greenberg et al., 1980). One exception to this requirement for prolonged T cell responses for complete tumor eradication appears to be the elimination of pulmo-
ADOPTIVE T CELL THERAPY OF TUMORS
297
nary micrometastases. Depletion of T cells following adoptive therapy of metastatic sarcomas has suggested that complete elimination of the microscopic pulmonary lesions can occur within a more rapid 3-6-day time period (Ward et al., 1988).However, this may reflect a unique experimental situation in which pulmonary metastases are seeded by intravenous inoculation of tumor cells, and cytolytic effector cells are then preferentially delivered directly to tumor sites following intravenous inoculation and trapping in the pulmonary capillary bed. In contrast to these findings with micrometastatic sarcomatous pulmonary lesions, elimination of sarcoma cells in soft tissue sites by intravenously injected T cells was found to occur over several weeks (North, 1984).Thus, unless effector cells can be administered directly to every site of tumor growth, complete tumor eradication appears to require adequate time to establish effective immune responses at all sites in which viable tumor cells are located. The elimination of tumor cells during this extended time period could reflect a persistent contribution by transferred donor tumorreactive T cells and/or the expression of an evolving host T cell response to the tumor. One approach to evaluate the contribution of host T cell immunity to tumor eradication has been to perform therapy studies in T-deficient hosts. However, this approach, by eliminating any potential host response, more specifically evaluates the maximum potential activity of the transferred donor cells. Therefore, we more directly analyzed this issue by performing studies with host B6 mice and congenic donor B6.PL(74NS) mice. The B6 strain expresses the Thy-1.2 allele on T cells, and B6.PL(74NS) mice, denoted BG/Thy-l.l, are genetically identical except for the expression of the Thy-1.1 allele on T cells. This genetic disparity permits, with use of the appropriate Mab, distinction of host from donor T cells. B6 host mice bearing disseminated FBL were treated on day 5 with cyclophosphamide and adoptive transfer of a curative dose of 2 x lo7 immune B6 or B6/Thy1.1donor cells, and sacrificed on day 60, shortly after tumor elimination was complete, for assessment of the presence and function of host and donor T cells. Consistent with the genetic low responder status of B6 mice to Thy antigens (Zaleski and Klein, 1978), no antibody response to either Thy allele that could interfere with interpretation of results was detectable in treated mice, and therapy was equally effective with syngeneic or congenic donor T cells (Greenberg and Cheever, 1984). At day 60, phenotypic analysis with fluoresceinated Mab demonstrated that only 1.3% of spleen cells were of donor origin. The tumor reactivity of host cells as well as these persistent donor T cells in the spleen was assessed by examining the phenotype of cells
298
PHILIP D. GREENBERG
responsible for the generation in vitro of an FBL-specific cytotoxic response (Table I). Depletion of donor T cells with aThy-1.1 ablated the antitumor response, but had little effect on the allogeneic response to H2d BALB/c antigens. By contrast, depletion of host Thy-1.2+ T cells had little effect on the antitumor response but ablated the allogeneic response. Thus, host T cells did not make a significant contribution to the antitumor response, despite the fact that the majority of immunocompetent T cells in the spleen, as reflected by alloreactivity, were of host origin. These results suggest that donor T cells capable of proliferating and persisting after transfer mediated the prolonged antitumor response necessary for complete tumor elimination. Although these studies were performed with adoptive transfer of donor T cells derived from the spleens of immunized mice, similar results have been obtained with adoptive transfer of in vitro generated FBL-specific T cell lines and T cell clones (Klarnet et al., 1987; Cheever et al., 1982, 1986), and have demonstrated that long-term cultured T cells can proliferate in uivo, distribute widely after transfer, eradicate disseminated tumor, and provide the host with long-term immunologic memory. Studies in other tumor therapy models have also demonstrated that persistent donor T cells provide the host with a functional memory
TABLE 1 CONTRIBUTION OF HOSTAND DONOR T CELLSTO TUMORREACTIVITYFOLLOWING CURATIVE ADOPTIVE THERAPY Cytotoxic T cell generation culturea Responder lymphocytes B6/Thy-l.l,~~~+B6 BGIThy-1.I,FRL+BG B6/Thy- 1 . 1 , ~ s ~ + B 6
Irradiated stimulator
Antibody-mediated depletion"
FBL BALBlc FBL BALBIc FBL BALBlc
aThy-1.1 aThy-1.2
Percent specific lysis of targey FBL
BALB/c
41 0 3
2 44 0 36 1 0
0 35 0
Responder spleen cells were obtained on day 60 from B6 hosts cured of disseminated FBL by treatment on day 5 with cyclophosphamide plus 2 x lo7 spleen cells from BG/Thy-1.1 donors im6). were culturedfor 5 days with either FBL tunior mune to FBL ( B 6 / T h y - l . l , ~ ~ ~ - t BRespondercells stimulator or allogeneic BALB/c spleen cells using culture conditions demonstrated to detect only secondary and no primary anti-FBL responses. Responder cells were selectively depleted of host or donor cells with either monoclonal uThy1.2 plus complement or monoclonal aThy-1.1 plus complement. Effector cells obtained aRer 5-day sensitization culture were tested in a 4-hour chromium release assay for cytotoxicity, at an E/T of 20 : 1.
'
ADOPTIVE T CELL THERAPY OF TUMORS
299
T cell response to the tumor (Colombo et al., 1985),and emphasize the importance of employing for therapy donor T cells that can be viably maintained in the host after cell transfer. 111. Mechanisms by Which T Cells Mediate Tumor Rejection
T cells bearing the T cell receptor aj3 heterodimer can be divided into two major subpopulations based on surface phenotype: a CD4+8subset and a CD4-8+ subset. Analyses of T cell functions have demonstrated that the majority of T cells with helper functions are derived from the CD4+ subset, and that the majority of T cells with cytolytic functions are derived from the CD8+ subset. However, the presumption that the T cell subpopulations participating in effector functions are strictly defined according to this predicted division of labor has often led to confusing perceptions, particularly in identifying the effector requirements for T cells to promote tumor eradication. This problem resulted from the initial false assumption that the molecules on T cells now known as CD4 and CD8 defined T cell lineages with unique functions (Shiku et al., 1975; Cantor and Boyse, 1975),whereas it is now evident that the CD4 and CD8 molecules are accessory structures on T cells that bind, respectively, to Class I1 and Class I MHC molecules (Swain, 1981; Dialynas et al., 1983). Thus, CD4+ T cells represent the T cell subset that recognizes antigens in the context of Class I I molecules and CD8+ T cells represent the Class I-restricted subset. Moreover, it is now apparent that, although the general separation into functional subsets was largely correct, the CD4+ “helper” T cell subset includes T cells with cytolytic function and the CD8+ cytotoxic T cell subset includes lymphokine-producing T cells with helper functions (Wagner et al., 1975; Swain et al., 1981; Golding and Singer, 1985; Lukacher et al., 1985; Widmer and Bach, 1981; Mizuochi et al., 1985).Thus, analysis of the mechanisms by which T cells mediate tumor rejection requires not only definition of the phenotype of the T cells involved, but elucidation of the effector mechanisms expressed and/or induced by these T cells. This is particularly important when analyzing studies with T cell clones, since it is possible to clone single cells with functions disparate from the majority of phenotypically similar T cells in the uncloned population. A. ROLEOF CD4+ AND CD8+ T CELLSUBSETS IN TUMOR ERADICATION Analysis of the participation of individual T cell subpopulations in tumor elimination can be accomplished using a variety of methods.
300
PHILIP D. GREENBERG
Our initial approach was to identify in uitro the T cell subset(s) reactive with tumor, to purify the relevant T cell subset(s), and then to examine the efficacy of the subset(s) in adoptive therapy. Following sensitization of B6 mice with irradiated FBL, both CD4+ and CD8+ T cells reactive with FBL can be detected in uitro. The CD4' subset cannot directly recognize FBL, which expresses only Class I and no Class I1 molecules, and therefore requires macrophages to process FBL antigens and present these tumor-derived antigens in the context of Class I1 molecules, The Class II-restricted response of CD4+ T cells to FBL has been demonstrated by in uitro measurement following stimulation with FBL of proliferation and production of lymphokines such as IL-2 (Kern et al., 1986; Greenberg et al., 1985). CD8+ T cells can directly recognize FBL tumor cells, and respond to in vitro stimulation with FBL by becoming cytolytic, although the generation of optimal CD8+ cytolytic responses requires the presence of CD4' TH or the addition of exogenous IL-2 (Kern et al., 1986; Greenberg et al., 198la). The potential contribution of each of'these subsets to tumor elimination was evaluated by modifying the adoptive therapy model to isolate the contribution of transferred T cells. Therefore, T-deficient host mice were produced b y adult thymectomy of B6 mice followed b y lethal irradiation and reconstitution with T-depleted bone marrow (Greenberg et al., 1985).These T-deficient B6 hosts were inoculated with 5 x lo6 FBL tumor cells on day 0 and treated on day 5 with lo7 purified T cells from FBL-primed BG/Thy-l.l congenic donors (Fig. 2). Congenic hosts and donors were used in these studies to permit definitive determination of the completeness and persistence of host T cell depletion. Treatment with either purified CD4' T cells or unfractionated spleen cells resulted in complete elimination of disseminated FBL leukemia. Cohorts of mice that were treated with cyclophosphamide and purified CD4+ T cells were sacrificed at multiple time points after cell transfer to evaluate the phenotype and function of tumor-reactive T cells present during periods of active tumor elimination and after tumor elimination was complete. At all time points, including 100 days after therapy, only donor lymphokine-producing CD4' T cells that were not cytolytic to FBL tumor cells were detectable in the host (Greenberg et al., 1985).Thus, in this setting in which no host or donor CD8+ Tc were present to participate in tumor elimination, tumor-specific CD4+ T cells that can neither directly recognize nor lyse the Class II-negative FBL tumor cells promoted complete eradication of disseminated FBL tumor.
ADOPTIVE T CELL THERAPY OF TUMORS
301
Tumor rejection by noncytolytic CD4+ T cells in the absence of a contribution by cytolytic CD8+ T cells has been confirmed in other tumor models (Fujiwara et al., 1984). This antitumor activity of CD4+ T cells does not appear to be limited to a particular tumor histology, since CD4+ T cells have been shown to mediate rejection of a wide variety of tumors, including leukemia, plasmacytoma, sarcoma, and hepatoma (Greenberg et al., 1985;Tomita et al., 1986;Yoshioka et al., 1986; Forni et al., 1985). There are many effector mechanisms by which CD4+ T cells can mediate and/or promote tumor eradication. The most direct is lysis of tumor cells by CD4+ T cells with cytolytic activity, but this requires that the target express Class I1 molecules. Killing by cytolytic CD4+ T cells occurs via recognition of antigen in the context of Class I1 molecules, and the release of short-range soluble factors that result in target lysis (Tite and Janeway, 1984; Ozaki et al., 1987) The release ofthese factors can be shown in vitro to result in the lysis of bystander targets, as well as the cell being directly recognized. Although such activity could potentially result in toxicity to nonmalignant host tissues, studies with antigen-specific Class IIrestricted T cell clones and hybridomas have demonstrated that normal antigen-presentingcells are resistant to both direct and bystander lysis, whereas transformed cells capable of presenting antigen are susceptible (Ozaki et al., 1987; Woods et al., 1989). Moreover, studies examining rejection of tissue allografts have suggested that cytolytic CD4+ T cells in vivo deliver their lytic signal into a very limited microenvironment between the effector and target cell and thus have remarkable specificity for only the relevant target and not bystander cells-alloreactive CD4+ T cells of H2b origin were shown to selectively reject the H2k and not the H2b keratinocytes in a B6 c* A/J allophenic skin graft, which is composed of mixed chimeric tissue containing randomly dispersed H2b and H2k cells (Rosenberg et al., 1989).T h e nature of the cytolytic factor(s) responsible for this activity by CD4+ T cells requires further investigation, but production of lymphotoxin (TNF-/3) represents at least one effector molecule produced by CD4+ T cells with preferential lytic activity for transformed cells (Meltzer and Bartlett, 1972; C. H. Evans and Heinbaugh 1981; Paul and Ruddle, 1988).Although these studies affirm the potential in vivo antitumor activity of cytolytic CD4+ T cells, other effector functions of this subset may be of greater significance, since CD4+ T cells can promote the rejection of tumors that cannot be induced to express Class I1 antigens (Greenberg et al., 1985).Thus, as will be discussed later in this section, the secretion by CD4+ T cells of lymphokines that
302
PHILIP D. GREENBERG
promote the activity of other effector cells, such as the induction of tumoricidal activity in macrophages, represent important mechanisms by which tumor-specific CD4+ T cells can mediate tumor eradication. The presence of Class I molecules on most tumor cells and the readily demonstrable cytolytic activity of Class I-restricted CD8+ T cells has prompted extensive investigation and enthusiasm for the use of CD8+ T cells to promote tumor eradication. Unlike CD4' T cells, cytotoxic CD8+ T cells directly lyse tumor targets in the absence of bystander killing. This specificity of target killing results from the release of cytotoxic granules into synapselike regions formed between the cytolytic CD8+ T cell and the target, with the consequent formation of pores in the target membrane and disruption of the cell (Podack, 1986; Young and Cohn, 1986; Dennert and Podack, 1983; Russell, 1983; Henkart and Yue, 1988).Studies in our model for adoptive chemoimmunotherapy of FBL leukemia have provided insights into the potential efficacy and some of the limitations of CD8+ T cells in tumor therapy. Treatment of mice bearing disseminated FBL with cyclophosphamide and purified directly cytolytic CD8' T cells resulted in a significant prolongation of survival, but, in distinction to our results with CD4+ T cells, most mice receiving even very high doses (2 x lo7) of CD8+ T cells eventually died of progressive tumor (Greenberg et al., 1981a, 1985; Greenberg, 1986) Analysis of the tumor growing in treated mice demonstrated that this limited efficacy did not reflect the outgrowth of Class I- variant tumor cells or cells resistant to lysis by CD8' Tc. Since our previous studies demonstrated that donor T cells must proliferate and persist in the host to be effective in therapy, we examined if the failure to cure mice by transfer of purified CD8' T cells reflected a requirement for growth factors such as IL-2 usually produced b y CD4' T cells. Therefore, using B6 and B6/Thy-l.l congenic host and donor mice for enumerating the fate of donor T cells after transfer, a regimen was developed in which the daily infusion of relatively low doses of recombinant IL-2 (2.5-5.0 x lo3 units/day) promoted the survival and in uiuo expansion of adoptively transferred antigen-specific T cells (Cheever et al., 1984; Greenberg, 1986).This dose of IL-2, which is approximately 10% of the lowest IL-2 dose necessary for the in vivo induction of LAK cells (Thompson et al., 1986), induced proliferation only of transferred T cells responding in vivo to specific antigenic stimulation and had no detectable effects on normal resting host lymphoid cells. Thus, the selective responsiveness of the transferred T cells presumably reflected induction of the highaffinity IL-2 receptor by a signal transduced through the T cell receptor following antigen recognition. For analysis of the effect of the IL-2
ADOPTIVE T CELL THERAPY OF TUMORS
303
administration on the therapeutic efficacy of transferred CD8+ T cells, studies were performed in T-deficient hosts to preclude potential contributions by host CD4+ T cells. Treatment of T-deficient mice bearing disseminated FBL with cyclophosphamide and purified CD8+ T cells resulted in prolongation of survival but did not cure mice, whereas the daily administration of recombinant IL-2 for 6 consecutive days following cell transfer, in doses that alone had no direct antitumor effect, resulted in complete tumor elimination in 100%of mice (Fig. 3).These results demonstrate that CD8+ T cells can mediate complete eradication of disseminated FBL leukemia in the absence of CD4+ effector T cells, but adequate amounts of IL-2 to promote the necessary cell growth and survival must be available. The efficacy of CD8+ Tc and the requirement for IL-2 have been further examined by generating and studying FBL-specific CD8+ Tc clones in this therapy model. The CD8+ T cell subset contains a subpopulation of cells that, following Class I-restricted recognition of a target cell, both produces IL-2 and becomes cytolytic (Widmer and Bach, 1981; Singer et al., 1987; Mizuochi et al., 1989). In an effort to
FIG.3. Efficacy of CD8+ T cells in the therapy of disseminated FBL in T-deficient hosts. B6 T-deficient hosts were produced as previously described and inoculated on day 0 with 5 x lo6 FBL intraperitoneally. Mice received no therapy, therapy on day 5 with only 180 mg/kg CY, or therapy on day 5 with CY plus unfractionated immune cells or purified CD8' T cells from FBL-primed BG/Thy-l.l donors. Prior to infusion, primed cells were cultured in oitro with FBL for 5 days to render them cytolytically active at the time of transfer. Selected mice received 2.5 x lo3 units rIL-2 daily intraperitoneally for 6 days beginning on the day of cell transfer.
304
PHILIP D. GREENBERG
circumvent the requirement ofCD8+ T cells for IL-2 in tumor therapy, such IL-2-producing CD8+ Tc clones specific for FBL were generated and expanded in uitro. Therapy of FBL with an IL-2-producing CD8+ clone, in contrast to CD8' Tc that do not produce IL-2, resulted in complete elimination of disseminated leukemia cells (Fig. 4). However, studies examining the helper functions of IL-2-producing CD8+ T cells have demonstrated that these cells produce more limiting amounts of IL-2 than CD4' T H , and consume all of the IL-2 produced (A. S. Rosenberg et al., 1988b).Consistent with the hypothesis that the amount of IL-2 being produced by this clone might limit the antitumor response, studies in BG/Thy-l. 1 congenic host mice demonstrated that the magnitude of antigen-specific in uiuo proliferation of this clone could be markedly augmented b y the administration of recombinant of IL-2 after cell transfer (Klarnet et al., 1987). Similarly, the efficacy of therapy with this Tc clone, which exhibited a dosedependent effect in tumor therapy, was enhanced by the administration IL-2 after cell transfer (Fig. 4).These results provide additional evidence that the therapeutic efficacy of CD8' T cells in the elimination of tumors may be limited by the availability of endogenous IL-2, but highlight the therapeutic potential of adoptive T cell therapy, in CY
1001
80
-m
60-
v,
40-
8
'L-2
-
>
-2 3
+ 2 X 107CD8+~L-2/Tc+
CY
-
No 2 0 - Therapy
CY + 5 X 106CD8+1~-2/~c+ IL-2 IL-2 CY
0 , 0
+ 2 x 107CD8+1~-2/~c
20
40
+ 5 X 106CD8+1~-2/~c I
1
60
80
Days FIG. 4. Therapy of disseminated FBL-3 leukemia with an IL-2-producing, FBLspecific CD8+ cytolytic T cell clone (CD8+1L-z,Tc).On day 0, BWThy-1.1 hosts were inoculated intraperitoneally with 5 x 10" viable FBL-3 leukemia cells and were left untreated, were treated on day 5 with 180 mg/kg CY, or were treated on day 5 with CY plus 5 x lo6 or 2 x lo7 FBL-specific, IL-2-producing, cytolytic CD8+ cloned T cells either alone or followed by 5000 U IL-2 given daily intraperitoneally for 6 days.
ADOPTIVE T CELL THERAPY OF TUMORS
305
which the clonal progeny of a single tumor-specific Class I-restricted Tc can completely eliminate a disseminated tumor. The antitumor activity of Tc derived from the CD8' subset has been demonstrated in many other tumor models against a very wide range of tumor histologies, including leukemia, lymphoma, hepatoma, plasmacytoma, sarcoma, glioma, mastocytoma, melanoma, and carcinoma (Greenberg, 1986; Mills and North, 1983,1985; Rosenstein et al., 1984; Dailey et al., 1982; Evans, 1984; Yamasaki et al., 1984; Matis et al., 1986; North, 1984; Forman et al., 1985; Awwad and North, 1988; Ward et al., 1988; Barker and Mokyr, 1988; Yoshioka et al., 1988; De Graaf et al., 1988; Wortzel et al., 1984; Schild et al., 1987; Kast et al., 1989; Fan and Edgington, 1989). In many of these models, the therapeutic activity of CD8' T cells is dependent on the presence of CD4' TH during the generation and/or expression of the antitumor response, consistent with our finding that the availability of endogenous IL-2 limits the efficacy of purified or cloned CD8+ Tc. The extent to which IL-2 or CD4+ TH are necessary for the therapeutic efficacy of CD8+ T cells likely reflects the magnitude and duration of the antitumor response necessary to treat the host, with settings that require prolonged immune responses such as rejection of disseminated leukemias or of locally advanced and metastatic tumors requiring that helper function be provided (Greenberg, 1986; Mills and North, 1985). By contrast, rejection of pulmonary micrometastases might be achievable by delivering only CD8+ T cells directly to the lung by intravenous injection (Ward et al., 1988), although even in this setting providing the CD8+ population with IL-2 may significantly augment the antitumor effect (Shu and Rosenberg, 1985). The value of providing IL-2 even in this setting of limited disease is supported by recent studies in our laboratory examining the treatment of pulmonary micrometastases of melanoma origin with tumor-specific CD8+ Tc clones that do not make IL-2-complete tumor elimination was achieved with a lower cell dose and in a higher percentage of mice if IL-2 was administered after transfer of the CD8+ Tc clones. The importance of providing adequate amounts of IL-2 has also been demonstrated in studies examining rejection of allografts disparate from the host only in Class I antigenshelper T cell function determined if a graft could be rejected by cytolytic CD8' T cells and regulated the rate of tissue rejection (A. S. Rosenberg et al., 1986, 1989). In conclusion, these studies have demonstrated that, under appropriate settings, effector T cells derived from either the CD4+ or CD8' subset can mediate tumor rejection in the absence of a contribution by effector T cells derived from the other subset. However, in addition to
306
PHILIP D. GREENBERG
T cell subpopulations, other cells of the immune system can interact with T effector cells and contribute to the elimination of tumor cells. Therefore, in order to understand the mechanisms by which T cells mediate tumor eradication, it is necessary to determine the roles of host macrophages, B cells, and NK cells in the elimination of tumor cells in settings in which adoptively transferred T cells make an essential contribution to tumor elimination. The importance of such non-T effector cells will be discussed in the sections that follow. IN TUMOR ELIMINATION B. ROLEOF MACROPHAGES Studies in many tumor models have suggested that tumoricidal macrophages make a critical contribution to the outcome of tumor therapy (Alexander et al., 1972; Evans, 1986; Evans and Alexander, 1972a,b; Evans et al., 1972; Hibbs et al., 1972; Herberman et al., 1980; Russell et al., 1980; Mantovani et al., 1986).This antitumor activity is not mediated by normal resting macrophages, but rather requires macrophage activation that induces at least two new functions: (1) the capacity to selectively bind to transformed cells; and (2) the capacity to deliver a cytolytic signal. These functions of activated macrophages have been the subject of numerous reviews (Adams and Hamilton, 1984; Johnson et al., 1984; Drysdale et ul., 1988), and will be only briefly discussed here. Selective binding of transformed rather than normal cells by activated macrophages is an energy-dependent phenomenon accomplished by a trypsin-sensitive binding structure on the macrophage (Fidler and Schroit, 1988; Hibbs, 1974; Marino and Adams, 1982), but neither the nature of this receptor nor the recognition structure expressed on the tumor cell have been identified. Activated macrophages can mediate target lysis by several distinct but not necessarily mutually exclusive mechanisms, including: (1)the release of TNF (although soluble T N F released at a distance from the tumor can directly mediate lysis following binding to specific receptors on tumor cells, delivery of macrophage membrane-bound T N F and/or secretion of T N F directly into a macrophage-tumor microenvironment results in more efficient target destruction and the lysis of a broader range of tumor targets) (Reed and Lucas, 1975; Haranaka et al., 1986; Klostergaard, 1987; Decker et al., 1987; Feinman et al., 1987; Tsujimoto et al., 1985; Urban et al., 1986);(2) the release of IL-1, which has cytocidal activity for a range of tumor targets (Onozaki et al., 1985; Lachman et al., 1986; Ruggiero and Baglioni, 1987; Lovett et al., 1986); ( 3 )the generation of reactive oxygen intermediates, particularly hydrogen peroxide (Nathan et al., 1979a,b; Nathan and Cohn, 1981); (4) secretion of neutral proteases that have high lytic potency selec-
ADOPTIVE T CELL THERAPY OF TUMORS
307
tively for neoplastic cells (Adams, 1980; Adams et al., 1980; Piessens and Sharma, 1980);and (5)a biochemical pathway leading to target cell death involving the formation of nitrites by deimination of L-arginine and resulting in inhibition of tumor cell mitochondria1 respiration and DNA synthesis (Hibbs et al., 1987a,b). Although activation of macrophages to a tumoricidal state can be induced by a variety of agents, including phorbol esters, LPS, muramyl dipeptide (MDP), and calcium ionophores (Drysdale et al., 1988),the most important agents in the context of T cell-mediated tumor elimination are lymphokines. Following antigen-specific triggering, T cells secrete a number of lymphokines that have complex effects on macrophages, including the induction of tumoricidal activity by two distinct lymphokine-dependent pathways. One of these pathways requires only a single signal, and can be induced by IL-4, GM-CSF, TNF, and possibly IL-2 (Philip, 1988; Grabstein et al., 1986; Crawford et al., 1987; Philip and Epstein, 1986). In general, macrophage killing induced by this one signal pathway proceeds via a mechanism requiring macrophage production of TNF (Decker et al., 1987; Philip, 1988; Philip and Epstein, 1986; Feinman et al., 1987). This effector mechanism will result only in the lysis of TNF-sensitive targets and, in the absence of other cooperative tumoricidal activities, can lead to selection in uiuo and in uitro of TNF-resistant tumor variants that can grow unimpeded (Feinman et al., 1987; Urban and Schreiber, 1983; Lattime and Stutman, 1989). The second pathway of macrophage activation requires two signals for induction of cytotoxicity, but such activated macrophages lyse a broader range of targets than TNF-secreting macrophages and rarely permit the outgrowth of tumor cells resistant to lysis (Fogler and Fidler, 1985). The requisite signals in this pathway are defined operationally as a first priming signal which is necessary to render the macrophage responsive to a second trigger signal, which results in target killing (Pace and Russell, 1981; Meltzer, 1981; Adams and Hamilton, 1984). The best defined priming signal, and the lymphokine most commonly discussed in the literature as macrophageactivating factor (MAF), is .)I-IFN,which at physiologic concentrations renders macrophages capable of selectively binding to transformed cells and responsive to a trigger signal for cytolysis (Pace et al., 1983; Schultz and Kleinschmidt, 1983; Svedersky et al., 1984a; Spitalny and Havell, 1984; Schreiber et al., 1985; R. D. Schreiber, 1984; Marino and Adams, 1982). Our laboratory has recently characterized a unique T cell-derived lymphokine that similarly primes macrophages for tumor cytotoxicity (Kern et al., 1989), but the biological importance of this lymphokine in T cell responses to tumors remains to be elucidated.
308
PHILIP D.GREENBERG
Following macrophage priming, a small amount of LPS endotoxin is commonly used as the second signal to trigger lytic activity in vitro, but it is assumed that this highly sensitive trigger step is more commonly mediated in vivo by cytokines released at the site of the immune response. Factors such as T N F and lymphotoxin are among the cytokines shown to have such triggering activity, and will only work as triggers if the macrophage has been previously primed (Meltzer, 1981; Krammer et al., 1985; Esparza et al., 1987; Drapier et al., 1988). These studies demonstrating that macrophages can be activated to a tumoricidal state by lymphokines expected to be produced by T cells responding to a tumor, and that macrophages can lyse tumor cells by multiple mechanisms, strongly suggest that macrophages are important effector cells during T cell-mediated tumor elimination. This conclusion is further supported by the demonstration that macrophages isolated from tumors undergoing immune-mediated regression exhibit greater cytotoxicity than macrophages isolated from progressing tumors (Russell and McIntosh, 1977). The role of tumoricidal effector macrophages would be expected to be particularly important for eliminating tumor cells in situations in which only CD4+ T cells recognize the immunogenic tumor antigen, and, as with the FBL leukemia model studied in our laboratory, the tumor cell itself cannot be directly recognized by such CD4+ T cells due to lack of expression of Class I1 molecules (Greenberg et al., 1985). Unfortunately, reagents have not been available to directly analyze the contributions of cytolytic macrophages b y selective depletion of this effector population or by interference with the cytolytic function. Disruption of macrophage function by the administration of reagents such as carageenan or silica has been shown to interfere with T cell tumor therapy (Mu16 et al., 1985), but these results cannot be interpreted as defining a role for effector macrophages, since the reagents also interfere with the accessory and antigen presentation functions of macrophages necessary for the induction and maintenance of the T cell proliferative response required for tumor elimination. Recently, monoclonal antibodies have been generated to membrane antigens that are expressed on macrophages primed with y-IFN and that correlate with tumoricidal activity (Paulnock and Lambert, 1990), but the utility of these antibodies for selectively interfering with macrophage effector functions in vivo remains to be determined. In light of these limitations, it has only been possible to indirectly assess the role of macrophages in tumor elimination mediated by tumor-specific T cells. We have examined the potential contribution of tumoricidal macrophages using two approaches: (l),determine if T
ADOPTIVE T CELL THERAPY OF TUMORS
309
cells responding to stimulation with tumor cells produce cytokines that can render macrophages tumoricidal; and (2), determine if macrophages in a diffusion chamber can be induced by T cells to eliminate viable tumor cells in uiuo. Macrophage-mediated killing of FBL, which is resistant to direct lysis by TNF, requires macrophage activation by the two-signal pathway. Therefore, the ability of FBL-specific T cells to produce MAF was defined functionally as the ability of culture supernatants obtained 20 hours after stimulation with FBL to prime a macrophage monolayer for lysis of FBL tumor cells in the presence of a trigger signal provided by 100 ng of LPS. By this assay, unfractionated splenic T cells immune to FBL were found to produce adequate amounts of MAF for the supernatants to prime macrophages for tumoricidal activity. Purified FBL-reactive CD4+ T cells produced similar amounts of MAF, but purified CD8+ T cells produced comparatively small amounts of MAF following stimulation with FBL. These results suggested that only the CD4' T cells might efficiently activate macrophages to participate in tumor elimination. However, previous studies had demonstrated that the in uiuo efficacy of the CD8+ subset is limited by the availability of exogenous IL-2 (Greenberg, 1986), which, in addition to promoting T cell growth, increases lymphokine secretion by CD8+ T cells (Kelso et al., 1982).Therefore, the ability of CD8' T cells to produce MAF in the presence of exogenous IL-2 was examined. Consistent with the requirement for IL-2 for optimal in uiuo efficacy and activity, stimulation of CD8+ T cells with FBL in the presence of IL-2 resulted in the production of MAF at levels similar to those detected following stimulation of CD4+ T cells. These results affirm that tumoricidal macrophages can be induced during tumorspecific T cell responses, and suggest that the CD8+ T cell subset as well as the CD4' T cell subset can produce M A F to induce this effector mechanism. Studies to define the nature of the MAF responsible for this lytic activity have demonstrated that the production by both CD4+ and CD8+ FBL-specific T cells of 7-IFN, a lymphokine known to prime tumoricidal macrophages (Schreiber et al., 1985),correlates with MAF activity. We have recently explored the ability of these T cell subsets to activate macrophages in viuo. Double diffusion chambers were implanted into the peritoneal cavities of mice, with the first chamber containing responder T cells, macrophage accessory cells, and irradiated FBL stimulator cells, and the second chamber containing potential effector macrophages and labeled viable tumor cells. Mice were sacrificed 3 days after chamber implantation to evaluate the antitumor response (Fig. 5). No killing was evident in the absence of specific
310
PHILIP D.GREENBERG
Chamber Containing Responding T Cells FB L- Pr I mad
J s i R U Q c Stlmuletor CD4*
T cells
Admln. of IL-2
(B6)x (FBL),
-
(FBL),
+
FIG. 5. In oioo activation of M@s for tumor cell lysis by purified CD4+ and CD8' FBL-immune T cell subsets. lo7 CD4+ or CD8' responder T cells from FBL-primed mice were placed with macrophage accessory cells and lo5 irradiated FBL stimulator tumor cells or B6 spleen cells into the upper chambers of Millipore double diffusion chambers. 2 x lo6 thioglycollate-induced peritoneal exudate cells plus 2 x 10' [3H]uridine-labeled RBL tumor cells were placed in the lower chamber. The chambers were sterilely implanted into the peritoneal cavities of B6 mice. Selected mice received 3 daily intraperitoneal injections of 2.5 x lo3 units of recombinant IL-2. The chambers were harvested after 72 hours and percent tumor lysis determined as a reflection of the amount of label lost from the chamber.
stimulation in the first chamber or if no effector macrophages were added to the second chamber. However, specific stimulation with FBL of either CD4+ or CD8+ T cells in the first chamber induced the production of a diffusible MAF that activated macrophages in the second chamber to kill viable tumor cells. Although exogenous IL-2 was not essential for MAF production by either subset, the administration of exogenous IL-2 increased the magnitude of tumor killing by both subsets, particularly the CD8+ T cell subset, which initially produced lower levels of MAF. In these in vivo experiments, no exogenous LPS trigger signal was added, implying that endogenous cytokines produced during the in vivo response of both CD4+ and CD8+ T cells can provide macrophages with both the priming and triggering
ADOPTIVE T CELL THERAPY OF TUMORS
311
signals essential to induce tumoricidal activity. Studies in Hamaoka’s laboratory using two non-cross-reactive tumors have demonstrated with diffusion chambers that the in uiuo production of MAF requires tumor-specific T cells, but that the tumor target need not express the stimulating antigen to be lysed by the activated macrophages (Sakamoto et al., 1986). Their results suggest that the activation of tumoricidal macrophages by T cells, including the CD8+ T cell subset, may provide a means to eliminate antigen-loss variant tumor cells (Sakamoto et al., 1988). Studies in two other tumor systems have provided additional circumstantial evidence that macrophages may contribute to the therapeutic efficacy of CD8+ T cells. In a model similar to our adoptive chemoimmunotherapy model, the efficacy of adoptive therapy with a CD8+ T cell clone was markedly enhanced by the concurrent administration of recombinant y-IFN. Analysis of the effects of the administered y-IFN demonstrated potential activation of tumoricidal macrophages, but no change in other effector mechanisms such as direct tumor lysis by CD8+ T cells (De Graaf et al., 1988). Studies in the second model employed a sponge matrix to isolate and analyze the cells involved in the eradication of tumor, and found that tumorspecific CD8+ T cells induced an inflammatory response by recruiting macrophages to participate in the antitumor response at the site of the tumor (Zangemeister-Wittke et al., 1989). Studies examining infectious agents rather than tumor cells as the replicating antigen have provided more definitive evidence that CD8+ T cells utilize macrophages to mediate effector functions. Virus-specific CD8+ T cells, independent of CD4+ T cells, can induce extensive inflammation at the site of a virus-specific T cell response (Doherty et al., 1990). This secretion of factors by antigen-specific CD8+ T cells that attract macrophages to the site of an ongoing immune response represents an important mechanism for recruiting potential effector macrophages. Moreover, CD8+ T cells specific for intracellular bacterial antigens have been shown to activate macrophages for microbicidal activity, an effector function with many similarities to tumoricidal activity (Mielke et al., 1989). Thus, the cumulative indirect evidence strongly suggests that tumoricidal macrophages represent an important in viuo participant in tumor elimination promoted by both subsets of tumor-specific T cells. Indeed, during elimination of Class 11- tumors by CD4+ T cells, as in our model with disseminated FBL leukemia, it is likely that macrophages are the major effector cell responsible for tumor lysis. Studies demonstrating that CD8+ T cells can also induce tumoricidal macro-
312
PHILIP D. GREENBERG
phages in vivo have raised the question of whether such macrophage effector cell activity is only complimentary to direct lysis by CD8+ T cells or if it is mandatory for complete tumor elimination. As new reagents that specifically interfere with the cytolytic activity of macrophages become available, further analyses will be necessary to precisely define the role of effector macrophages in tumor elimination. However, the recruitment of this population to the effector response has the intrinsic advantage of immediately broadening the scope of the T cell response. Macrophages, unlike antigen-specific T cells, do not recognize unique tumor antigens but rather more generally bind to transformed cells, and thus have the capacity to eliminate cells in a tumor population that have lost expression of the tumor antigen or become deficient in MHC antigen expression.
C. ROLEOF B CELLSIN TUMOR ELIMINATION B cells and their antibody products unquestionably have an important role in the field of tumor immunology. With the development of monoclonal antibody technology, a whole discipline has evolved with the goals of generating monoclonal antibodies to membrane antigens expressed on tumor cells, and of modifying these antibodies, such as by conjugation with toxins or radionuclides, to render them more effective in the treatment of tumors (reviewed in Dillman, 1989; Schlom, 1986; Badger and Bernstein, 1986). A description of these therapeutic approaches devoted to enhancing antibody antitumor activity is outside the scope of'this review, which will focus on only the potential contributions of B cell responses to T cell-mediated tumor rejection. The prerequisites for an effective antibody response to a tumor include that the tumor express an antigen capable of being recognized by B cells, that this tumor antigen also have an epitope presentable to CD4' T cells in the context of Class I1 molecules, and that a CD4+ T cell response, particularly of the T H 2 subtype producing IL-4, IL-5, and IL-6 be elicited (Mosmann and Coffmann, 1989a; Killar et al., 1987; Boom et al., 1988).The most direct mechanism by which tumorreactive antibodies can enhance tumor eradication is by lysing tumor cells in a complement-dependent fashion or by inducing apoptosis (Trauth et al., 1989). A second tumoricidal mechanism is antibodydependent cellular cytotoxicity (ADCC), which appears to be the major effector pathway by which therapy with unmodified monoclonal antibodies results in tumor eradication (Denkers et al., 1985).Lysis by ADCC proceeds via binding of the Ig variable region to the tumor target and of the Fc portion to an Fc receptor (FcR)-bearing effector
ADOPTIVE T CELL THERAPY OF TUMORS
'
313
cell, with subsequent signal transduction through the FcR and activation of the cytolytic mechanism of the effector cell. Although FcR+ macrophages and NK cells are the major ADCC effector cells, B cells can also function in ADCC to mediate tumor lysis (Padmanabham et al., 1988;Lopez et al., 1989). T cell responses to tumor promote ADCC both by the secretion of lymphokines that provide help for B cell antibody responses, and by secretion of lymphokines that activate ADCC effector cells (Morgan et al., 1989; Basham e t al., 1988; Eisenthal et al., 1988; Ostensen et al., 1987; Kushner and Cheung, 1989). The remaining and most complex mechanism by which antibody responses can participate in T cell antitumor responses is through a regulatory circuit defined as an idiotype network. Idiotypes are unique sequences in the variable regions of B cell and T cell receptors that are involved in antigen binding, and anti-idiotypes represent antibodies that bind to this idiotypic region of the receptor. The binding region of anti-idiotypic antibodies that recognize the same antigen-specific receptor can have many different molecular configurations, with one form being an internal image of the antigenic epitope normally recognized by the receptor. Such an internal image anti-idiotype may uniquely stimulate or inhibit antigen-specific responses by providing the antigenic epitope in a new context distinct from native antigen. The complexity of idiotype network regulation precludes a meaningful discussion of this phenomenon here, and the reader is referred to discussions of regulatory anti-idiotypes as naturally occurring events during tumor growth (Raychaudhuri et al., 1987; H. Schreiber, 1984; Kennedy et al., 1987), and of the use of anti-idiotypes to positively regulate tumor-specific T cell and B cell immunity (Nepom and Hellstrom, 1987). Our model for adoptive T cell therapy of disseminated FBL leukemia represents an appropriate model for examining the contribution of B cells to the outcome of tumor therapy. FBL is a Friend MuLVinduced leukemia, and immunization of B6 mice with FBL induces a strong antibody response that, cross-reacts with other tumors transformed with Friend or the closely related Rauscher and Moloney retroviruses (Glynn et al., 1968). Although we have never pursued monoclonal antibody therapy of FBL, infusion of FBL-specific polyclonal antibodies has had little effect in tumor therapy (Fefer, 1969). Therapy of related Moloney and Rauscher virus-transformed tumors with monoclonal antibodies has been examined in other laboratories and results have confirmed the potential in vivo contribution of an ADCC mechanism; however, effective immunotherapy with antibody
314
PHILIP D. GREENBERG
in these models ultimately required a tumor-specific T cell response (Kennel et al., 1985; Berends et al., 1989).Additionally, administration of a monoclonal antibody to Moloney virus-transformed cells has been shown to elicit a multilevel anti-idiotypic network (Powell et al., 1988). Thus, studies in the FBL and related retroviral tumor models suggest that all aspects of B cell and antibody function are potentially operative in response to these tumors. To determine if the B cell response makes a significant contribution to tumor elimination following therapy with T cells, we employed a strategy similar to the one used to evaluate the contribution to tumor elimination of T cell subsets. Briefly, mice were rendered B cell deficient by chronic treatment from birth with high doses of rabbit antimouse IgM (anti-p)antibody using a well-characterized regimen (Hayglass et al., 1986). These anti-p treated mice were demonstrated to have no IgM' cells or detectable serum immunoglobin and to be unresponsive to the B cell mitogen LPS, but to retain normal T cell function. The efficacy of adoptive chemoimmunotherapy of disseminated FBL with purified T cells was then compared in B-deficient and normal control tumor-bearing mice (Fig. 6). Mice depleted of B cells
100 a
6
(B deficient): CY + 5.0 x 10 B6 aFBLT cells 80-
0
>
*E a
*
(Control): LT CY +0.5 X 10 B ~ ~ F BCeIIS
1 No 60-
40-
8
20
-
Therapy
I
6
(B deficient): CY +0.5x10 BGaF,,T
cells
--
(B deficient): (Control): CY Alone -& C C Y Alone
n-
I
0
20
40
60
80
Days FIG.6. Efficacy of adoptive T cell therapy of disseminated FBL in host mice depleted of B cells. B6 host mice continuously treated from birth either with normal rabbit immunoglobulin (control) or with rabbit anti-p antibody to deplete B cells (B deficient) were inoculated with 5 x 10"FBL tumor cells on day 0 and received either no therapy, 180 nig/kg cyclophosphamide (CY) on day 5, or CY plus 5 x lo6 or 0.5 x 10" purified B6-immune T cells (>97% Thy-1.2+).
ADOPTIVE T CELL THERAPY OF TUMORS
315
exhibited a therapeutic response similar to normal host mice to both a high dose of adoptively transferred T cells, that cured 100% of mice, and a low dose that cured only a fraction of recipients. These results, which demonstrated that host B cells do not make a requisite contribution to T cell-mediated tumor eradication, do not imply that there are no circumstances in which antibody responses could augment the therapeutic antitumor responses following adoptive T cell therapy, or that the antibody response could not be specifically manipulated to enhance tumor elimination. However, considering that FBL expresses multiple epitopes to which antibodies can be generated, the data argues that the endogenous antibody response to most tumors will not generally be a major factor in determining if an ef‘fector T cell response is curative.
D. ROLEOF NK CELLS NK cells represent a cell population that was originally characterized on the basis of an in vitro defined function-the capacity to “
naturally” mediate spontaneous and nonadaptive non-MHC restricted cytolysis of a wide variety of targets, including some normal fresh cells, many cultured cell lines, immature hematopoietic cells, and tumor cells. The lytic activity for tumor cells received a great deal of attention, and investigators enthusiastically endowed NK cells with significant biological qualities previously reserved for T cells, such as immunologic surveillance against spontaneously arising tumors. This focus on tumor reactivity delayed identification of many of the diverse biological activities of NK cells, such as regulation of hematopoiesis and natural resistance to microbial infections, which may be more significant in the evolution of this effector population. A discussion of the biology of NK cells is beyond the scope of this chapter, but has been the subject of a recent extensive review (Trinchieri, 1989), and this section will be limited to evaluating the role of NK cells in tumor rejection responses for which there is a T cell component. Although NK cells do not represent an entirely homogeneous population, an operational definition has been provided by the Fifth International Workshop on Natural Killer Cells (Fitzgerald-Bocarsly et al., 1988):NK cells are large granular lymphocytes that express no C D 3 molecules or T cell receptor chains, express CD16 and NK1.1/2.1 (or Leu-19 in humans), and mediate cytolysis of targets even in the absence of MHC expression. By distinction, cells bearing a/3 or y6 T cell heterodimeric receptors that demonstrate non-MHC restricted lytic activity following activation by IL-2 or by other means are defined as cells of T cell origin that functionally are NK-like. The mechanism by
316
PHILIP D. GREENBERG
which NK cells recognize, bind, and selectively lyse targets has been a source of much investigation, but very little clarity, particularly with regard to the receptor on the NK effector cell and the recognition structure on transformed target cells. However, much like tumoricidal macrophages, NK cells show preferential binding of transformed cells, and similar to CD8+Tc, cytolysis proceeds via delivery of cytolytic granules (Herberman et al., 1986). Interest in NK cells as potential effector cells for tumor therapy increased dramatically with the demonstrations that the cytolytic activity of NK cells could be markedly enhanced by exposure to T cellderived lymphokines. Culture of peripheral blood lymphocytes with high concentrations of IL-2 was found to induce non-MHC restricted cytotoxic cells, termed LAK cells, that lyse NK-resistant targets, including many fresh tumor cells (Grimm et al., 1982, 1983). Moreover, the administration of in uitro generated autologous LAK cells into patients with solid tumors has been shown to induce at least partial regressions in a fraction of treated patients (S. A. Rosenberg et al., 1987). Although there was initially some disagreement about the phenotypes of the LAK'cell precursor and effector, it is now generally agreed that LAK cells represent activated NK cells (Phillips et al., 1987), and that the responsiveness to IL-2 results from expression of the intermediate-affinity, signal-transducing, p70 chain of the IL-2 receptor (Sharon et al., 1986; Kehri et al., 1988).The administration to patients of high-dose IL-2 and LAK cells represents a novel approach for the use of immunologically nonspecific effector cells to treat malignant disease, and has been extensively reviewed (S. A. Rosenberg and Lotze, 1986; S. A. Rosenberg et al., 1987). However, it has remained unclear whether conditions ever exist in uiuo, even in the microenvironment of an ongoing T cell immune response, for the induction and functional expression of LAK effector cells. The marked antitumor activity of NK cells pharmacologically activated to express the broad cytolytic reactivity of LAK cells highlights the potential contributions to T cell-mediated tumor eradication of NK cells activated b y T cell-derived lymphokines, even if such cells are less proficient killers of tumor cells than are fully activated LAK cells. y I F N can increase the cytolytic reactivity of NK cells (Perussia et d., 1980), and NK cells activated by IFN can lyse fresh tumor target cells, which are relatively resistant to lysis by unstimulated NK cells (Vanky et al., 1980). Moreover, IFN and IL-2 synergize in their enhancing effect on NK cell cytotoxicity (Svedersky et al., 1984b; Brunda et al., 1986). Thus, even if NK cells cannot be fully differentiated to LAK cells in uiuo under physiologic conditions, the milieu established b y
317
ADOPTIVE T CELL THERAPY OF TUMORS
an ongoing T cell response should be sufficient for activating NK cells at a tumor site to express enhanced tumoricidal activity. Therefore, we have examined if NK cells contribute to the eradication of disseminated FBL leukemia in our adoptive therapy model. B6 mice bearing disseminated FBL were depleted of NK cells, prior to therapy with cyclophosphamide and adoptively transferred T cells, by administration of monoclonal aNK1.l antibody (Koo and Peppard, 1984; Koo et al., 1986). The regimen of a N K l . l employed was demonstrated to efficiently eliminate NKcells from B6 mice (Koo et al., 1986; Peace and Cheever, 1989). The therapeutic efficacy of adoptive therapy with either a high or low dose of transferred T cells was not significantly altered in mice lacking NK function (Fig. 7). These results suggest that NK cells do not make a significant or essential contribution in our model to elimination of disseminated tumor cells. Although these results could be interpreted as evidence that NK cells are not an important effector cell in T cell-mediated tumor elimination, recent studies defining target recognition patterns of NK cells have implied that NK cells may be important effector cells in certain settings. In particular, reduced expression of Class I molecules on
100
11
80-
-
g601
73
a40
8
20
0
-
No Therapy
\
CY Alone-
\,
I
6
cY+5.0X10 B ~ ~ F B L
-
-:%
6
cY+1.0X10 B ~ ~ F B L
]-Y+
I
-6
1.Ox10 B6aFBL +aNK1.1 I
1
FIG. 7. Efficacy of adoptive T cell therapy of disseminated FBL in host mice depleted of NK cells. B6 host mice were inoculated on day 0 with 5 x lo6 FBL tumor cells, and received either no Mab or were depleted of NK cells by administration of aNK1.1 Mab on day 5 prior to therapy and on day 12 one week after adoptive therapy. On day 5, cohorts of mice received either no therapy, cyclophosphamide alone (CY),or CY plus 5 X 10" or 1 X 10" immune T cells from FBL-primed B6 mice.
318
PHILIP D. CREENBERG
target cells has been shown to correlate with increased sensitivity to lysis by NKcells (Harel-Bellam et al., 1986; O h l h et al., 1989;Karre et al., 1986; Ljunggren et al., 1988; Storkus et al., l987,1989a,b; Tanaka et al., 1988).This enhancement in the lytic activity of NK effector cells may have evolved as a means for NK cells to serve as a first line of defense for elimination of virally infected cells that commonly exhibit decreased Class I antigen expression Andersson et al., 1985;Jennings et al., 1985; Hecht and Summers, 1972), but could have significant impact on tumor rejection. Class I deficient tumor cells are commonly observed with human tumors and in many murine tumor models (reviewed in Tanaka et al., 1988).Such tumor cell variants are no longer targets for CD8' Tc effector cells, by virtue of a failure to express Class I molecules, but can be demonstrated to be rejected by NK effector cells (Karre et al., 1986; Ljunggren et al., 1988; Tanaka et al., 1988; Kawano et al., 1986).Thus, in situations in which Class I-loss variants exist amongst a heterogeneous tumor population, NK effector cells could play an important role in promoting complete tumor elimination. We have never detected the outgrowth of Class I-loss variants in the FBL tumor model, and thus this model may not be entirely adequate for making general conclusions about the contributions of NK cells to rejection of other tumors. Further studies examining the role of NK cells in rejection of tumor masses known to contain a subpopulation of Class I-deficient tumor cells are needed to better elucidate this potentially important function for NK effector cells activated by an ongoing immune T cell response to the tumor. IV. Recognition of Distinct Tumor Antigens by CD4+ and CD8+ T Cells as a Potential Basis for Selective Efficacy of a T Cell Subset
The discussion thus far has focused on the nature of the effector cell and effector mechanisms operative in the eradication of established tumors, and has revealed that each T cell subset, independent of the other subset, can mediate directly and/or indirectly by the recruitment of other non-T effector cells the complete elimination of a tumor. However, analyses of the T cells participating in tumor rejection have detected disparate effector T cell requirements in different tumor models. Rejection of some tumors results primarily from the activity of Class I-restricted CD8' T cells (Dailey et al., 1982; Mills and North, 1983; De Graaf et al., 1988; Greenberg, 1986;Kast et al., 1989;Ward et al., 1988; Wortzel et al., 1984; Schild et al., 1987; Barker and Mokyr, 1988), whereas Class II-restricted noncytolytic CD4' T cells are responsible for rejection of other tumors (Greenberg et al., 1985; Fujiwara et al., 1984; Forni et al., 1985; Fernandez-Cruz et al., 1980).
ADOPTIVE T CELL THERAPY OF TUMORS
319
Although the observed differences in the effector T cell subset required for tumor eradication could reflect susceptibility by the tumor to the effector mechanism mediated by one subset and resistance to the effector mechanism mediated by the other subset, most studies examining tumor lysis would not support this conclusion. The major effector mechanism by which noncytolytic CD4+ T cells mediate tumor rejection appears to reflect the activation of macrophages to lyse tumor cells, and most tumors remain susceptable to lysis by tumoricidal macrophages even after extensive attempts in vitro to generate resistant variants (Fogler and Fidler, 1985). Similarly, resistance of tumor cells to direct cytolysis by CD8+ Tc is a very rare event, unless variants lacking Class I gene expression have been generated, and, as discussed in the previous section, CD8+ T c recognizing Class I + tumor cells can secrete lymphokines that activate macrophages and/or NK cells to lyse Class I- targets. Thus, rather than presume that rejection of an individual tumor is dependent upon the activity of a unique effector mechanism, alternative explanations for the preferential activity of a T cell subset in the elimination of particular tumors need to be explored. Since tumor eradication requires a prolonged in vivo response, effective tumor therapy must include not only an efferent tumoricidal component but also an afferent component resulting in in vivo proliferation and expansion of the potential effector population. Therefore, the selective therapeutic efficacy of a particular T cell subset could reflect preferential activation of that subset in response to the tumor. For example, if the tumor antigens expressed by a tumor failed to elicit a broad repertoire of T cell responses, but rather were recognized predominantly and/or more efficiently by a single T cell subset, then cells from that T cell subset would likely appear to be more effective in therapy. Presentation of an antigen for activation of MHC-restricted T cells requires that the antigen be processed to a peptide that can bind to the appropriate MHC molecule to form an immunogenic complex (Unanue and Allen, 1987; Berzofsky et al., 1988; Watts et al., 1984; Buus et al., 1986; Maryanski et al., 1988; Gotch et al. 1988). The intracellular processing pathways that result in degradation of a protein to a peptide and introduction of this peptide into the binding region of the MHC molecules are with rare exception separate for Class I and Class I1 molecules (Germain, 1986). Presentation of antigen with Class I1 molecules generally requires that exogenous antigen enter a “professional” antigen-presenting cell b y phagocytosis, pinocytosis, or receptor-mediated endocytosis and be degraded to peptide fragments by acid-dependent endosomal proteases (Shimonkevitz et
320
PHILIP D. GREENBERG
al., 1983; Buus et al., 1987; McCoy and Schwartz, 1988), whereas presentation of antigen with Class I molecules generally requires that endogenously synthesized cytosolic proteins be degraded and translocated into the endoplasmic reticulum (Braciale et al., 1987; Morrison et al., 1986; Yewdell and Bennink, 1989; Nuchtern et al., 1989).The presence of these two largely distinct pathways, one of which usually requires the presence of an APC other than the tumor cell itself, makes it possible that a particular protein might more efficiently be processed in one pathway and thus predominantly presented with a single MHC molecule. Therefore, as a model system, we have examined if the specificity of the CD4' and CD8' T cell responses to FBL reflects recognition of the same tumor antigen(s) or if the observed therapeutic efficacy of both subsets in this tumor model results from expression by FBL of more than one tumor antigen, each of which is preferentially recognized by a single T cell subset. Our studies on the specificity of T cell responses to FBL have focused on the recognition of Friend murine leukemia virus (F-MuLV) retroviral glycoprotein antigens, since these represent the most strongly immunogenic determinants on this Friend retrovirustransformed erythroleukemia (Friend, 1957; Nowinski et al., 1978; Plata and Lilly, 1979; Chesebro et al., 1981).The immune responses to the products of the two major F-MuLV genes have been examined: the glycoprotein encoded by the gag region of the F-MuLV genome, and the envelope glycoprotein encoded by the enu gene (Klarnet et al., 1989a). A preliminary analysis of FBL-specific responses by the CD4+ and CD8+ T cell subsets suggested that these should be informative FBL antigens to examine, since a mutant Friend MuLV-transformed tumor line that expressed enu but had spontaneously lost gag gene expression stimulated CD4+ responder T cells but was not recognized by the CD8+ subset. Moreover, a Mab that bound the gp70 envelope protein inhibited the response of the FBL-immune CD4' subset and had no effect on the CD8+ subset. Therefore, the responses to these proteins was more directly examined by employing rat fibroblast lines transfected with either the whole F-MuLV genome or only the gag or enu gene plus the Db Class I molecule to which the FBL-specific CD8+ T cell response is restricted (Gomard et al., 1977; Holt et al., 1986).FBL-specific CD8' T c , generated by in uitro stimulation with FBL of cells from FBL-primed B6 mice, recognized and lysed targets transfected with the entire F-MuLV genome or with the gag gene, but failed to lyse targets expressing only the enu gene. Since all targets were equally lysable by alloreactive CD8' Tc, these results suggested that immunization with FBL generated an immunodominant Tc re-
ADOPTIVE T CELL THERAPY OF TUMORS
32 1
sponse to gag antigens but failed to elicit envelope-specific CD8+ Tc (Klarnet et al., 1989a). Since these xenogeneic transfected lines could not be used to directly assess the FBL-specific proliferative response of the CD4+ T cell subset due to stimulation by the xenoantigens, the responses to these lines ofcloned FBL-specific CD4+ T cells were evaluated. In the presence of autologous APC, all CD4+ T cell clones tested responded to the env-transfectant, and none responded to the gag-transfectant (Klarnet et al., 1989a).These results are consistent with another analysis of the response of Class 11-restricted T cells to FBL, in which all CD4+ T cell clones responded to soluble gp70 envelope protein (Matis et al., 1985). Thus, B6 mice exposed to FBL tumor generate a CD8+ T cell response that is primarily restricted to recognition of epitopes encoded by the gag gene, and a CD4+ T cell response that is primarily restricted to recognition of determinants on the envelope protein. This distinction between the F-MuLV proteins recognized by CD4+ and CD8+ T cells occurred despite both env and gag encoding large foreign proteins containing many potentially immunogenic epitopes. The selective response to these tumor antigens could reflect intrinsic qualities of each of these proteins that direct the products predominantly to a single processing pathway, or unique qualities attributable to the FBL tumor that result in both poor entry of the envelope protein into the endogenous pathway for presentation with Class I molecules and limited availability of gag products for uptake and processing by Class 11-expressing APC. Therefore, an alternative method for immunizing B6 mice to these proteins was evaluated. Recombinant vaccinia viruses containing the F-MuLV env and gag gene were constructed (Earl et al., 1986), since immunization with such live recombinant vaccinia viruses has been shown to induce both CD4+ and CD8+ T cell responses to the product of the inserted gene (Moss and Flexner, 1987). B6 mice were primed in vivo with either recombinant vaclenv or vaclgag, and then purified CD4+ and CD8+ T cells were obtained from primed spleen cells for in vitro testing of proliferative responses to FBL (Fig. 8). As predicted from our studies with transfected cell lines, immunization of mice with vaclenv elicited only an FBL-specific response by the CD4+ T cell subset, and immunization with vaclgag elicited only an FBL-specific response by the CD8+ T cell subset. These results suggest that individual tumor-associated proteins may be preferentially excluded from processing via the exogenous Class I1 or endogenous Class I pathway andlor from immunogenic presentation in the context of Class I or Class I1 molecules, and thus will activate predominantly only one T cell subset.
322
PHILIP D. GREENBERG
CD4+ Responders
CD8+ Responders
n
h
E
8 9
Stimulators
6000. 1
al u)
C
0
n
3
4000.
K
-e
.-f
2000.
-i? 2
n 0 .
1 F B L v a c h n v vaclgeg
FBL vacbnv vaclgag
In Vivo Priming FIG.8. Recognition of distinct F-MuLV-encoded antigens by FBL-specific CD4+ and CD8' T cells. Spleen cells from B6 mice primed in oioo with irradiated FBL or vaccinia-FMuLV (BGo~~L live ) , recombinant vaccinia-F-MuLVenvelope (B60vilc,eno), gag (B6,vac,E0K) virus were purified into CD4+and CD8+T cell subsets. Responder cells were cultured with irradiated tumor cells, (FBL),, or irradiated macrophages infected with vaccinia virus, (Mfl),,,, and proliferation measured after 3 days.
The basis for apparent selective immunogenicity of a protein for either Class I- or Class II-restricted T cells are not yet well defined, but some principles of antigen presentation are emerging. Despite a protein having many possible immunogenic epitopes, the T cell response tends to be limited to one or very few immunodominant epitopes (Schwartz, 1985; Manca et al., 1984; Cease et al., 1986; Berzofsky, 1988; Braciale et al., 1989; Bennink and Yewdell, 1988; H. Takahashi et al., 1988).The presence of an immunodominant epitope cannot be reasonably explained by assuming that all the other epitopes in a large complex foreign protein are tolerogenic or recognized as self-proteins, and thus there must be unique characteristics that distinguish immunodominant regions. This would include the abilities to be degraded from the native protein into a peptide of appropriate size, charge, and configuration by the host processing machinery, to bind to a host MHC molecule, and possibly to acquire a secondary structure such as to form an amphipathic a helix that enhances formation of a peptide-MHC complex (Berzofsky et al., 1987, 1988). Moreover, the presented epitope must be recognizable by the host repertoire of T cells. Thus the selective responses observed in our tumor system could
ADOPTIVE T CELL THERAPY OF TUMORS
323
reflect the failure to form a recognizable immunodominant epitope from the envelope protein that binds to Class I molecules, and similarly the lack of a recognizable immunodominant epitope derived from gag proteins for presentation with Class I1 molecules. The immunogenic presentation of an antigen is also subject to quantitative restrictions, requiring a threshold number of peptide-MHC complexes on an APC to trigger a response. The peptides derived from a particular antigen must compete successfully with other peptides derived from the same antigen, peptides from other antigens, and self-peptides degraded from host proteins for complexing with the available MHC molecules (Rock and Benacerraf, 1983; Maryanski et al., 1988; Adorini and Nagy, 1990). Thus, the generation of a T cell response to an immunogenic protein will depend on the amount of the relevant peptide available to compete, the avidity of the complex formed between the immunogenic peptide derived from the protein with the MHC molecule as compared to competing peptides, and the affinity of T cells for the peptide-MHC complex (i.e., high affinity would reduce the threshold number of complexes necessary to ensure triggering a response). Therefore, in our tumor model, envelope rather than gag proteins may be good Class I1 immunogens because envelope proteins are membrane antigens that are secreted into the extracellular space and thus are more available for presentation by phagocytic Class II+ APC. Similarly, the relevant gag protein may be a more abundant and persistent cytosolic protein for introduction into the endogenous Class I pathway. Although the molecular mechanisms are presently poorly understood, proteins apparently have intrinsic qualities that promote localization to and/or processing by the Class I or Class I1 pathway. For example, the major CD8+ Tc response to many infectious viruses appears to be to matrix and nucleoproteins, whereas the CD4+ T cell responses to the same viruses frequently recognize envelope antigens. Some features of proteins, such as the expression of sequences that promote translocation into or retention in the endoplasmic reticulum (Bonifacino et al., 1990), or the discoordinate overproduction of an individual chain of a multimeric protein, may result in degradation and enhanced presentation with Class I molecules. Similarly, proteins containing signal sequences that result in transport to the membrane and release into the extracellular space, lacking the retention or intracellular localization sequences necessary to prevent secretion (Wieland e t al., 1987; Rose, 1988),or possessing physicochemical characteristics that promote interactions with the APC surface such as a positive charge (Apple et al., 1988), may exhibit enhanced presentation with Class I1 molecules.
324
PHILIP D. GREENBERC
Regardless of the mechanism, our data evaluating the T cell response to F-MuLV antigens expressed by FBL demonstrate that even large unique foreign proteins expressed by tumor cells may not efficiently induce both CD4' and CD8+ T cell responses. Moreover, even if occasional CD4' T cell clones reactive with gag antigens or CD8' T cell clones reactive with an envelope determinant could be isolated in uitro, such clones might be poorly activated in uiuo by FBL tumor d u e to limited presentation of the relevant epitope, and thus would have minimal efficacy in adoptive therapy of the tumor. Thus, future studies elucidating how candidate tumor antigens are processed and presented may provide valuable insights into the nature of the effector T cell that would be most effective in promoting eradication of a tumor expressing that antigen. V. Accessory Cell, Antigen-Presenting Cell, and Cytokine Requirements for Effective Expression of Antitumor Responses by CD4+ and CD8+ T Cell Subsets
CD4' and CD8' effector T cells, in addition to recognizing potentially distinct tumor antigens and being restricted to different MHC molecules, differ in lymphokine production, lymphokine responsiveness, and requirements for APC and accessory cells. Thus, the capacity of the cells and microenvironment at or near a tumor site to induce and support antitumor responses by each T cell subset influences whether CD4' or CD8' effector T cells will be effective at eliminating tumor. For example, even if a tumor cell expresses a protein containing an immunogenic epitope potentially recognizable by CD4' or CD8' T cells, presentation of that antigen either by an APC lacking accessory functions or in the absence of adequate stimulatory cytokines could result in failure to elicit an endogenous or maintain an adoptively transferred T cell response (Hori et al., 1989; Fearon et al., 1990; Gill et al., 1989). Therefore, predicting the nature of the T effector cell necessary to eradicate a tumor, and determining how to augment the relevant effector functions, requires not only definition of the tumor antigen but also an understanding of the conditions necessary for generating and maintaining the T cell response to the tumor. Under typical in vitro and in uiuo conditions, efficient induction of tumorspecific CD8' T cell responses is dependent on lymphokines such as IL-2 usually provided by a concurrent CD4' THresponse to the tumor (Kern et al., 1986; Fearon et al., 1990). However, since some tumors may express antigens that can be recognized by only Class I- or Class II-restricted T cells and thus can only stimulate responses by one
ADOPTIVE T CELL THERAPY OF TUMORS
325
subset, it is essential to define the requirements for inducing and supporting antitumor responses by CD4+ and CD8+ T cells independent of a contribution by the other subset. A. REQUIREMENTSFOR INDUCING PROLIFERATIVE RESPONSESBY CD4+ AND CD8+ T CELLSUBSETS There are many effector functions mediated by CD4+ and CD8+ T cell subsets that can be measured to reflect responses by antigenspecific T cells. However, curative adoptive therapy of established tumors requires not only the expression of differentiated effector functions, but also the in uiuo proliferation of the transferred tumor-specific T cells (Greenberg et al., 1979; Colombo et al., 1985). The biological requirements for inducing such T cell proliferation are more complex and multifactorial than the requirements for only triggering expression of differentiated T cell effector functions, although satisfying the requirements for inducing T cell proliferative responses generally leads to the concurrent expression of such effector functions. Therefore, we have adapted our in uitro culture system to measure the proliferative responses of purified T cell subsets derived from FBL-primed mice, and have used this system to evaluate the immunologic requirements for inducing FBL-specific proliferation of each subset independently (Table 11). The proliferative responses of both purified Class IIrestricted CD4+ T cells and purified Class I-restricted CD8+ T cells to stimulation with FBL were dependent on the presence of macrophages. The CD4+ T cell response required macrophages as APC to process FBL tumor antigen in a chloroquine-sensitive endosomal pathway for presentation with Class I1 molecules (Kern et al., 1986). By contrast, CD8+ T cells required macrophages as accessory cells and not as APC for the proliferative responses to FBL, since the addition of exogenous recombinant IL-1 could substitute for macrophages in this response. This demonstration that 1L-1 was essential for triggering proliferation of the CD8+ subset was not predicted b y previously reported phenotypic studies examining IL-1 receptor (IL-1R) expression on T cells, which had detected IL-1R on CD4' T cells but not on CD8+ T cells (Lowenthal and MacDonald, 1987). However, studies subsequently performed in our laboratory with CD8+ T cell clones rather than CD8+ populations have clarified this apparent discrepancy. Although most cytolytic CD8+ T cell clones fail to make IL-2, a subset of cytolytic CD8+ T cell clones have the capacity to produce IL-2 and support their own proliferation (Widmer and Bach, 1981). We have generated such IL-2 producing CD8+ clones specific for FBL, and
326
PHILIP D. GREENBERG
TABLE I1 ACCESSORY CELLAND CYTOKINE REQUIREMENTS FOR FBL-SPECIFIC PROLIFERATION BY CD4+ AND CD8+ T CELLS Responding population" CD4 + ,FBL
Stiniulator (FBL),
Addition to cultureh, c . d. c . f -
M@ (M@)CHLQ CD~+,FBL
(FBL),
-
M@ ( M@)CHLQ
IL-1
Proliferative response (Acpn+ 2,248 19,180 2,637 1,054 7,465 8,120 9,470 16,548 3,823 14,912 5,748 4,880 120 32,859 10,657 15,271 14,824 4,267 14,388
CD~+,FBL
FBL
+ M@
-
IL-2 I L-4 CD~+,FBL
FBL
+ M@
-
IL-2 IL-4
16,155 28,291 34,008 6,581 27,505 9,742
Purified T cell subsets for each experiment were obtained from FRL-primed B6 spleen cells by selective depletion of macrophages, B cells, and the alternative T cell subset. Macrophages selected from normal spleen cells by plastic adherency, and used untreated or after treatment with 0.1 mM chloroquine (CHLQ), were added to T cell cultures at a ratio of 1 :20. ' Monoclonal aI-A" or uK"/D"was added to selected cultures. Recombinant IL-1 was added to selected cultures at a final titer of 6 U/ml. Monoclonal uIL-2 or aIL-4 was added to selected cultures. IRecombinant IL-2 (25 U/nil) or IL-4 (5.0 ng/ml) were added to selected cultures. Proliferative responses were assessed after 6 days in culture.
have demonstrated that these clones express a small number of IL-lR, and have a functional requirement for IL-1 to trigger IL-2 production (Klarnet et al., 1989b).By contrast, no IL-1R expression was detected on any IL-2-dependent CD8' clones, which fail to produce IL-2 and require exogenous IL-2 for survival. Thus, the failure to detect IL-1R
ADOPTIVE T CELL THERAPY OF TUMORS
327
on unfractionated CD8+ T cells presumably reflected the relatively low frequency of such IL-2 producing CD8+ T cells as well as the small number of IL-1R present on IL-2-producing cells (Klarnet et al., 198913) The importance of IL-1 for activating and inducing IL-2 production by CD8+ T cells in the absence of IL-2 producing CD4+ T cells has also been demonstrated functionally in the allogeneic CD8+ T cell response to mutant Class I molecules (Mizuochi et al., 1988). These results suggest that in uiuo activation of a tumor-specific CD8+ T cell response requires not only recognition of the tumor by antigenspecific CD8+ T cells but also the presence of either CD4+ TH to provide IL-2 or accessory cells to trigger IL-2 production by IL-2producing CD8+ T cells to support proliferation of the CD8+ T cell subset. Expansion of antigen-specific T cells is dependent on the delivery of a proliferative signal at the time of T cell receptor accomodation. Two major T cell growth factors, IL-2 and IL-4, have been identified. Since these lymphokines have potentially distinct effects on the generation and maintenance of responses b y the CD4+ and CD8+ T cells subsets, we have examined the role of each in the proliferative response of CD4+ and CD8+ T cells to FBL (Kern et al., 1988).The addition either of aIL-2 or of aIL-4 neutralizing Mab partially inhibited the FBLstimulated proliferative response of purified CD4+ T cells (Table 11). By contrast, the proliferative response of purified CD8+ T cells was completely inhibited by aIL-2, and aIL-4 had no effect on the response. These results demonstrate that both IL-2 and IL-4 are endogenous growth factors for FBL-specific CD4+ T cells, but that IL-2 is the only endogenous growth factor produced by responding CD8+ T cells. The production of both IL-2 and IL-4 by the CD4+ T cell subset implies that immunization with FBL elicits both T Hand ~ T HCD4+ ~ T cell responses (Mosmann and Coffman, 1989a,b).Although our studies on the effector mechanisms operative in tumor eradication suggest that CD4+ T H cells, ~ which can mediate DTH and activate macrophages (Cher and Mosmann, 1987; Stout and Bottomly, 1989), represent the more important CD4+ effector population, IL-4 has been shown to activate in uiuo non-T effector cells with antitumor activity (Tepper et al., 1989). Therefore, the relative contribution of IL-4-producing T H ~ cells to the generation and expansion of an effector response contributing to tumor eradication requires further evaluation. In contrast to the selective production of IL-4 as an endogenous growth factor only by the CD4+ subset, the FBL-stimulated proliferative response of both CD8+ and CD4+ T cells could be augmented by the addition of either exogenous recombinant IL-4 or recombinant IL-2. This augmenting effect of IL-4 on CD8+ T cell responses is also
328
PHlLIP D. GREENBERG
reflected by increased cytotoxic activity (Kern et al., 1988; Widmer and Grabstein, 1987).Although the CD8+ T cell population produced adequate IL-2 to induce a proliferative response, the substantial increase in proliferation observed with the addition of exogenous IL-2 and the smaller increase with IL-4 suggest that the response of tumor-specific CD8+T cells can be enhanced by the local production of IL-2 and IL-4 by CD4+ TH responding to the same tumor. Moreover, the results imply that the magnitude of the response to a tumor by CD8+T cells in the absence of a concurrent CD4+ TH response will be significantly limited by the amount of endogenously produced IL-2. This conclusion, based on results from the in uitro experiments, is also supported by in uiuo observations. Studies examining the ability of IL-2producing FBL-specific cytolytic CD8+ T cells to eliminate FBL leukemia cells have demonstrated that the amount of IL-2 produced by these T cells limits in uiuo antitumor activity (Fig. 4; and Klarnet et al., 1987). Similarly, the generation and expression of CD8+ T cells to reject allografts disparate only for Class I antigens can be augmented by providing an antigenic stimulus for a concurrent CD4+ TH cell response (A. S. Rosenberg et al., 1988a,b). These studies, in defining the requirements for generating an immune response to tumor cells, have also helped elucidate potential obstacles to the expression of an effective response. CD4' and CD8' T cells require macrophages to function as APC and/or IL-l-producing accessory cells, and thus the presence of a mononuclear infiltrate at sites of tumor growth is likely to be essential for maintenance of the antitumor responses at those sites. Macrophage accumulation at tumor sites can be regulated b y many distinct but potentially interacting mechanisms, such as the production by tumors of inhibitors of monocyte chemotaxis (Snydennan and Pike, 1976; Cianciolo et al., 1981) or alternatively of chemoattractants for mononuclear phagocytes (Bottazzi et al., 1983; Mantovani et al., 1986),the production by neutrophils infiltrating the tumor of factors that recruit T cells and subsequently inflammatory cells (Yamaki et al., 1988),and the production by CD4+ and CD8+ T cells at the tumor site of lymphokines that recruit macrophages and amplify the inflammatory response (Yamaki et al., 1988;Shijubo et al., 1989;Jayaraman et al., 1990; Zangemeister-Wittke et al., 1989; Evans, 1986; Doherty et al., 1990).Tumor masses lacking a significant macrophage infiltrate may inadequately support immune responses, which may explain why some tumor masses appear to be immunologically privileged sites (Spitalny and North, 1977). Therefore, methods to modify the function of the microenvironment at a tumor site need to be explored. One such approach is the administra-
ADOPTIVE T CELL THERAPY OF TUMORS
329
tion of recombinant IL-1, which cannot entirely replace the APC function of macrophages but can supplement macrophage accessory function. Recent studies have demonstrated that systemic administration of IL-1 can enhance the immunogenicity of a poorly immunogenic tumor (McCune and Marquis, 1990), and can promote tumor eradication by augmenting ineffective T cell antitumor responses (North et al., 1988). Limited production of T cell growth factors by the T cells participating in an antitumor response can also result in an inadequate effector response. As predicted from the in vitro studies demonstrating enhanced antigen-specific T cell proliferation in response to the addition of IL-2, the administration of exogenous recombinant IL-2 has been shown to augment the in vivo proliferation and therapeutic efficacy of adoptively transferred FBL-specific CD4+ and CD8+ T cells (Cheever et al., 1986; Klarnet et al., 1987). Moreover, insufficient production ofT cell growth factors during induction of an immune response may not only make the T cell response appear inadequate, but alternatively may result in a tumor appearing nonimmunogenic despite expressing recognizable antigenic determinants. Studies have demonstrated that previously undetected host T cell antitumor responses can become evident by the systemic administration of high doses of IL-2 or by the local inoculation of IL-2 directly into a growing tumor mass (Thompson et al., 1986; Forni et al., 1985). More recently, the introduction of the IL-2 gene into an apparently nonimmunogenic tumor has provided a novel approach for enhancing immunogenicity (Fearon et al., 1990). In these experiments, the wild-type tumor expressed an epitope potentially recognizable by Class I-restricted T cells but failed to elicit an antitumor response due to the lack of a Class 11-restricted response by CD4+ TH, whereas the transfected tumor cell expressing the IL-2 gene provided the help necessary to generate a tumor-specific CD8+ T cell response. Although in settings such as this, in which the tumor can only elicit a Class I-restricted response, the host may contain IL-2producing CD8+ T cells that could potentially be immunized in the absence of a CD4+ TH response, the initial low frequency of such cells and the magnitude of IL-2 production may be prohibitive for the generation of an effective primary response. Additionally, analysis of the requirements for priming IL-2 producing CD8+ T cells have suggested that activation may be dependent on expression of the antigen in association with a large number of Class I molecules on the stimulating cell, and thus weakly antigenic tumors may fail to elicit the response (Singer et al., 1987).Thus, in some settings, it may be necessary to provide exogenous lymphokines to induce and/or support T cell responses.
330
PHILIP D. GREENBERG
These studies have emphasized the importance of accessory cells and cytokines in the generation and maintenance of an antitumor response. The availability of large quantities of recombinant cytokines should make it possible to overcome some ofthe obstacles to establishing an effective response to a growing tumor. However, there are additional poorly defined qualities of antigen-presenting cells which may also impact on the expression of T cell responses. Cells can express immunogenic epitopes recognizable by CD4+ and CD8+ T cells but, due to an inability to provide appropriate costimulatory signals, may fail to activate the reactive T cells, and may alternatively tolerize or render the T cells anergic (Azuma et al., 1989; Hori et al., 1989; Schwartz, 1989). Such functional inactivation of responder T cells by the stimulator cell has been the subject of a recent review (Mueller et al., 1989), and may explain the apparent lack of immunogenicity of some tumors. For example, presentation to T cells of an antigen by Class 11-expressing pancreatic islet cells, which like some tumors may be a poor stimulator cell, has been shown to render reactive T cells hyporesponsive to the antigen when subsequently presented by a normally stimulatory APC (Markman et al., 1988).Thus, it is quite possible that many tumors express potentially immunogenic epitopes but the nature of antigen presentation by the tumor leads to clonal inactivation rather than clonal expansion. Further studies defining the principles underlying this phenomenon and elucidating mechanisms to overcome inactivation should increase the frequency with which therapeutic responses can be detected and expressed. OF T CELL B. ROLEOF B CELLSIN THE GENERATION ANTITUMOR RESPONSES APC are a heterogeneous population of cells that include, in addition to the macrophage population discussed, other cells expressing Class I1 molecules, including dendritic cells and B cells (Unanue, 1984; Kakiuchi et al., 1983;Ashwell et al., 1984; Metlay et al., 1989).B cells can process and present antigen similar to other APC (Chesnut and Grey, 1986),but, by virtue of the expression of an antigen-specific surface Ig-receptor, have the potential to be the most efficient APC. Thus, B cells can stimulate T cell responses at much lower antigen concentrations than other APC provided the antigen to be processed and presented contains an epitope that can be bound by the B cell Ig-receptor (Rock et al., 1984; Abbas et al., 1985; Lanzavecchia, 1985). This APC function of B cells has been shown to be important in uiuo during priming to soluble antigens, with B cell-deficient mice demonstrating poor induction of T cell responses (Ron et al., 1981, 1983; Hayglass et al., 1986).
33 1
ADOPTIVE T CELL THERAPY OF TUMORS
An efficient APC, such as an antigen-specific B cell, could be important for inducing tumor-specific T cell responses at the critical time when the tumor burden is small or in settings in which the amount of tumor-derived immunogenic protein available for antigen presentation is limited. Therefore, we have evaluated the role of B cells during the induction of T cell responses to the FBL tumor (Schultz et al., 1990). This was examined by depleting mice in uiuo of B cells, priming in uiuo to FBL, and then measuring the in uitro secondary T cell response to FBL. As previously described, mice were rendered B cell deficient by treatment from birth with high doses of rabbit antimouse IgM (anti-p) antibody. Such anti-p-treated mice have no detectable mature B cells or circulating IgM, but have normal T cell function (Hayglass et al., 1986).Lymph node T cells derived from anti-p-treated mice primed in uivo to FBL exhibited no measurable FBL-specific T cell proliferative response, and splenic T cells derived from anti-ytreated mice demonstrated a 50% reduction in the proliferative response to FBL, in comparison to the response of control mice treated with normal rabbit Ig (Fig. 9). These results are consistent with studies of the contribution of B cells to priming with soluble protein, which dso demonstrated that B cells have a more essential role in the genera-
B cell
B cell
Responder
Normal deficient --
Normal deficient --
Source
Lymph Node
Spleen
FIG.9. Role of B cells in priming mice for an FBL-specific proliferative T cell response. Lymph node or spleen cells were obtained after in uiuo priming with FBL of B6 mice previously treated from birth with rabbit immunoglobulin (normal) or anti-p (B cell deficient). Responder cells were stimulated in uitro with FBL or B6 spleen cells for 72 hours and thymidine uptake was determined.
332
PHILIP D. GREENBERG
tion of lymph node than splenic T cell responses ( Janeway et al., 1987; Ron and Sprent, 1987). Analysis of CD8+ T cell responses demonstrated that mice depleted of B cells generated very weak cytolytic responses to FBL. This poor priming of CD8+ T cells presumably resulted in large part from inefficient priming of FBL-specific CD4+ TH, since we have previously observed that the generation of optimal CD8+ T cell responses to FBL require CD4+ TH (Kern et al., 1986). These results demonstrate that B cells can make an important contribution to the priming of T cells with tumors. Thus, in contrast to our results showing that B cell responses to a tumor are not important during the effector phase of tumor rejection mediated by T cells (Fig. 6), efficient induction of an antitumor response may be greatly facilitated by B cell recognition, processing, and presentation of tumor antigens in the context of Class I1 molecules. These studies suggest that the generation of an effective T cell response to a tumor by the host will frequently be dependent upon recognition by the immune system of multiple tumor-defined determinants. For example, induction of a cytolytic CD8+ T cell response to tumor may not only require the presence of a tumor antigen that provides a unique Class I-restricted epitope, but also a determinant that can be recognized by Class IIrestricted CD4+ TH to provide adequate IL-2 for the CD8+ T cell response, as well as an epitope recognized by B cells for efficient antigen presentation and triggering of the CD4+ TEI. Although many tumors may express novel or mutated proteins, the derived antigens are not likely to frequently satisfy all these criteria, which could result in poor or absent T cell responses to a potentially immunogenic tumor. Thus, developing approaches for priming that employ and enhance the potential contributions of B cells and CD4+ T H , such as by constructing fusion proteins for immunization containing a wellcharacterized B cell determinant linked to a potential tumor antigen or by modifying a tumor cell to add helper determinants (Yoshioka et al., 1986), or that partially substitute for the roles of B cells and CD4+ TH, such as b y the administration of cytokines, will likely permit detection of specific T cell reactivity in a greater frequency of tumors. Potentially, such T cell responses could then be expanded and augmented to promote tumor eradication. VI. Concluding Statements
Studies in animal models, as discussed in this review, have defined many of the underlying principles, and provided many insights for the development of adoptive T cell therapy as a modality for the treatment
ADOPTIVE T CELL THERAPY OF TUMORS
333
of human malignancy. The growing numbers of laboratories examining T cell responses to human tumors, and the increasing frequency with which investigators using in nitro culture technologies are detecting T cells specifically reactive to autochthonous human tumors, suggest that the clinical application of adoptive T cell therapy will have significant therapeutic impact during this decade. However, despite the enormous potential and likely benefits that many individual patients will receive from such therapy, it is clear that many obstacles still exist before this approach can have widespread applicability. With the current methodologies being employed, tumor-specific T cells can only be generated in a fraction of cancer patients, and complete tumor eradication is only achieved in a subset of the patients treated with such T cells. Thus, it is essential that the existing results from animal models b e critically examined in an effort to elucidate the impediments to therapeutic success, and future studies be designed to develop methods to overcome these hurdles. As presented in this review, studies from our laboratory initially focused on determining the effector mechanisms essential for T cellmediated tumor rejection, based on an assumption at that time that a unique effector mechanism might be responsible or obligatory for tumor eradication. These studies, and supporting results from other laboratories, have demonstrated that: (1)both CD4+ and CD8+ T cells can independently promote complete tumor elimination in the absence of a contribution b y T cells of the other phenotype; (2) CD4+ T cells can directly lyse selected Class 11+cells, but the major antitumor effect of this subset results from the recruitment and activation of other effector cells, particularly macrophages; (3)CD8+ T cells can mediate tumor eradication not only by direct lysis, but similar to CD4+ T cells, also by the recruitment and activation of other effector cells such as macrophages; (4) the induction of tumor-specific antibody responses following T cell transfer is not an essential component of tumor eradication; and (5)NK cells do not make a significant contribution to tumor elimination by T cells, except potentially under special circumstances in which a subpopulation of Class I- tumor variants may be present. Thus, the data demonstrated that CD4+ and CD8+ T cells mediate tumor eradication by overlapping effector mechanisms, and failed to identify a unique effector role in tumor eradication for either subset. Although these results could be interpreted as suggesting that either T cell subset should be effective in tumor therapy, studies in a large number of experimental tumor therapy models have demonstrated that for many tumors only CD4+ or only CD8' T cells can mediate tumor eradication. These observations have prompted an evaluation of alter-
334
PHILIP D. GREENBERG
native explanations for the settings in which there is preferential activity of a single subset. Studies examining the requirements for T cell activation in response to a tumor have subsequently demonstrated that the ability of a T cell subset to specifically recognize and proliferate in response to a tumor may be the major determinant of therapeutic efficacy. Many factors could contribute to the preferential activation by a tumor of CD4' or of CD8' T cells, including the expression of MHC antigens, the presence of a mononuclear infiltrate at the tumor site containing APC and accessory cells, and the production or availability of adequate amounts of cytokines, including IL-1, IL-2, and IL-4. Additionally, presentation of antigens in the context of Class I or Class I1 molecules requires biochemical processing via distinct intracellular pathways, and individual proteins may be preferentially directed to or excluded from one pathway, or may be efficiently processed to relevant peptides by only one pathway. Thus, tumors containing unique or mutated and potentially immunogenic cellular proteins may selectively or predominantly elicit only CD4' or CD8' T cell responses because the antigen is adequately presented in the context of only one MHC molecule, and in this setting only T cells from the subset restricted to that MHC molecule will appear effective in tumor therapy. There are several goals for the next decade with regard to T cell therapy that need to be realized. These include not only improved methods to isolate tumor antigens, but the development of approaches to determine if such antigens will be efficiently processed and presented with Class I and/or Class I1 molecules. This should make it possible to predict the nature of the effector T cell and the cellular and cytokine requirements necessary for an effective antitumor response. Moreover, the relation of tumor antigens to normal host proteins needs to be more extensively explored. For example, it must be determined if immunogenic tumor antigens have to be distinct from host proteins, such as resulting from a mutation or the expression of a gene from a transforming virus, or could result from overexpression of normal proteins. T cell tolerance to many self-proteins does not result from clonal deletion but rather reflects peripheral inactivation of reactive T cells following recognition of the antigenic epitope presented by normal resting cells, and significant changes in the amount of a protein expressed by a tumor cell, as well as biological changes in the transformed tumor cell expressing and presenting the protein, could permit induction of an immune response that preferentially recognizes the tumor cell. Although the consequences to normal host tissues of breaking tolerance to such proteins will need to be determined, and
ADOPTIVE T CELL THERAPY OF TUMORS
335
may require methods to terminate the response, rendering such proteins immunogenic would significantly broaden the potential range of antigens expressed by tumors that might serve as targets for immunologic attack. One additional goal, which is already being pursued, is to modify the function or activity of effector T cells by the introduction of genes coding for relevant proteins. For example, the introduction of genes into CD4+ T cells resulting in the production of chemotactic factors that recruit macrophages to a tumor site, or of genes into CD8+ T cells resulting in the production of growth factors that promote cell proliferation, could substantially modify the therapeutic efficacy of a potential effector T cell. Several approaches, including the use of retroviral shuttle vectors, appear useful for promoting the introduction and expression of such genes into T cells. The continued application of advances in cellular and molecular biology to the field of T cell therapy of tumors should enhance the prospect that such therapy will significantly impact on our ability to control malignant disease during the next decade.
ACKNOWLEDGMENTS I wish to thank M. Jensen, D. Kern, J. Klarnet, C. 6hl&n,K. Okuno, S. Riddell, K. Schultz, and H. Sugawara for their efforts in designing, performing, and evaluating many of our laboratory’s experiments discussed in this review; M. Cheever for his contributions as a collaborator to many of the studies; S. Emery, J. Smith, and K. Slaven for their expert technical assistance; and Joanne Factor and Anita Rogers for preparation of this manuscript. The work was supported in part by U.S. Public Health Service Grant CA 33084 and American Cancer Society Grant IM-304.
REFERENCES Abbas, A. K., Haber, S., and Rock, K. L. (1985).Antigen presentation by hapten-specific B lymphocytes. 11. Specificity and properties of antigen-presenting B lymphocytes, and function of immunoglobulin receptors. J , immunol. 135, 1661-1667. Adams, D. 0. (1980). Effector mechanisms of cytolytically activated macrophages. I. Secretion of neutral proteases and effect of protease inhibitors. J. Immunol. 124, 286-292. Adams, D. O., and Hamilton, T. A. (1984). The cell biology of macrophage activation. Annu. Rev. Immunol. 2,283-318. Adams, D. O., Kao, K. J., Farb, R., and Pizzo, S. V. (1980). Effector mechanisms of cytolytically activated macrophages. 11. Secretion of a cytolytic factor by activated macrophages and its relationship to secreted neutral proteases. J. immunol. 124, 293-300. Adorini, L., and Nagy, Z. A. (1990).Peptide competition for antigen presentation. Immunol. Today 11,21-24. Alexander, P., Evans, R., and Grant, C. K. (1972). The interplay of lymphoid cells and macrophages in tumour immunity. Ann. inst. Pasteur, Paris 122,645-658.
336
PHILIP D. GREENBERG
Andersson, M., Paabo, S., Nilsson, T., and Peterson, P. A. (1985). Impaired intracellular transport of class I MHC antigens as a possible means for adenoviruses to evade immune surveillance. Cell (Cambridge,Moss.) 43,215-222. Anichini, A., Mazzocchi, A., Fossati, G., and Panniani, G. (1989). Cytotoxic T lymphocyte clones from peripheral blood and from tumor site detect intratumor heterogeneity of melanoma cells: Analysis of specificity and mechanisms of interacti0n.J. Immunol. 142,3692-3701. Apple, R. J., Domen, P. L., Muckerheide, A., and Michael, J. G. (1988).Cationization of protein antigens. IV. Increased antigen uptake by antigen-presenting cells. J . Zrnmunol. 140,3290-3295. Ashwell, J. D., DeFranco, A. L., Paul, W. E., and Schwartz, R. H. (1984). Antigen presentation by resting B cells. Radiosensitivity of the antigen-presentation function and two distinct pathways of T cell activation. J. E x p . Med. 159,881-905. Awwad, M., and North, R. J. (1988). Immunologically mediated regression of a murine lymphoma after treatment with anti-L3T4 antibody. A consequence of removing L3T4+ suppressor T cells from a host generating predominantly Lyt-2+ T cellmediated immunity. J. E x p . Med. 168,2193-2206. Azuma, T., Sato, S., Kitagawa, S., Hori, S., Kokudo, S., Hamaoka, T., and Fujiwara, H. (1989). Tolerance induction of allo-class I H-2 antigen-reactive Lyt-2+ helper T cells and prolonged survival of the corresponding class I H-2-disparate skin graft./. Immunol. 143, 1-8. Badger, C. C., and Bernstein, I. D. (1986). Prospects for monoclonal antibody therapy of leukemia and lymphoma. Cancer (Philadelphia)58,584-589. Baldwin, R. W. (1955). Immunity to methylcholanthrene-induced tumours in inbred rats following atrophy and regression of the implanted tumours. Br.J. Cancer 9,652-657. Barker, E., and Mokyr, M. B. (1988). Importance of Lyt-2+ T-cells in the resistance of melphalan-cured MOPC-315 tumor bearers to a challenge with MOPC-315 tumor cells. Cancer Res. 48,4834-4842. Barnd, D. L., Lan, M. S., Metzgar, R. S., and Finn, 0. J. (1989). Specific, major histocompatibility complex-unrestricted recognition of tumor-associated mucins by human cytotoxic T cells. Proc. Natl. Acad. Sci. U.S.A. 86,7159-7163. Basham, T. Y.,Race, E. R., Campbell, M. J., Reid, T. R., Levy, R., and Merigan, T. C. (1988). Synergistic antitumor activity with IFN and monoclonal anti-idiotype for murine B cell lymphoma. Mechanism of action. J. Immunol. 141,2855-2860. Belldegrun, A., Kasid, A., Uppenkamp, M., Topalian, S. L., and Rosenberg, S. A. (1989). Human tumor infiltrating lymphocytes: Analysis of lymphokine mRNA expression and relevance to cancer immunotherapy. J . Immunol. 142,4520-4526. Benacerraf, B., and Germain, R. N. (1981). A single major pathway of T-lymphocyte interactions in antigen-specific immune suppression. S c a d J . Immunol. 13, 1-10, Bennink, J. R., and Yewdell, J. W. (1988). Murine cytotoxic T lymphocyte recognition of individual influenza virus proteins. High frequency of nonresponder MHC class I alleles. J . Exp. Med. 168, 1935-1939. Berends, D., van der Kwast, T. H., de Both, N. J., and Mulder, P. G. (1989). Factors influencing antibody-mediated cytotoxicity during the immunotherapy of Rauschervirus-induced myeloid leukemic cells. Cancer Zmmunol. Immunother. 28, 123-130. Berendt, M. J., and North, R. J. (1980). T-cell-mediated suppression ofanti-tumor immunity. An explanation for progressive growth of an immunogenic tumor. J . E x p . Med. 151,69-80. Berenson, J. R., Einstein, A. B., Jr., and Fefer, A. (1975). Syngeneic adoptive immunotherapy and chemoimmunotherapy of a Friend leukemia: Requirement for T cells. J. Immunol. 115,234-238.
ADOPTIVE T CELL THERAPY OF TUMORS
337
Berzofsky, J. A. (1988). Immunodominance in T lymphocyte recognition Zmmunol. Lett. 18,83-92. Berzofsky, J . A., Cease, K. B., Cornette, J. L., Spouge, J. L., Margalit, H., Berkower, I. J., Good, M. F., Miller, L. H., and DeLisi, C. (1987). Protein antigenic structures recognized by T cells: Potential applications to vaccine design. Zmmunol. Reu. 98,9-52. Berzofsky, J. A,, Brett, S. J., Streicher, H. Z., and Takahashi, H. (1988). Antigen processing for presentation to T lymphocytes: Function, mechanisms, and implications for the T-cell repertoire. Immunol. Reo. 106,5-31. Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S., Strominger, J. L., and Wiley, D. C. (1987a). Structure of the human class I histocompatibility antigen, HLA-A2. Nature (London)329,506-512. Bjorkman, P. J., Saper, M. A., Samraouri, B., Bennett, W. S., Strominger, J. L., and Wiley D. C. (198713).The foreign antigen binding site and T cell recognition regions ofclass I histocompatibility antigens. Nature (London),329,512-518. Bonifacino, J. S., Suzuki, C. K., and Klausner, R. D. (1990). A peptide sequence confers retention and rapid degradation in the ER. Science 247,79-82. Boom, W. H., Liano, D., and Abbas, A. K. (1988). Heterogeneity of helper/inducer T lymphocytes. 11. Effects of interleukin 4- and interleukin 2-producingT cell clones on resting B lymphocytes. J . E x p . Med. 167,1350-1363. Bottazzi, B., Polentotarutti, N., Acero, R., Balsari, A., Boraschi, D., Ghezzi, P., Salmona, M., and Mantovani, A. (1983). Regulation of the macrophage content of neoplasms by chemoattractants. Science 220,210-212. Braciale, T. J., Morrison, L. A., Sweetser, M. T., Sambrook, J., Gething, M. J., and Braciale, V. L. (1987). Antigen presentation pathways to class I and class I1 MHCrestricted T lymphocytes. Zmmunol. Reo. 98,95-114. Braciale, T. J., Sweetser, M. T., Morrison, L. A., Kittlesen, D. J., and Braciale, V. L. (1989). Class I major histocompatibility complex-restricted cytolytic T lymphocytes recognize a limited number of sites on the influenza hemagglutinin. Proc. Natl. Acad. Sci. U.S.A.86,277-281. Brunda, M. J., Tarnowski, D., and Davatelis, V. (1986). Interaction of recombinant interferons with recombinant interleukin-2: Differential effects on natural killer cell activity and interleukin-2-activated killer cells. Znt. J . Cancer 37,787-793. Burnet, F. M. (1970). “Immunological Surveillance.” Pergamon, Oxford. Buus, S., Sette, A., Colon, S. M., Jenis, D. M., and Grey, H. M. (1986). Isolation and characterization of antigen-Ia complexes involved in T cell recognition. Cell (Cambridge, Mass.) 47, 1071-1077. Buus, S., Sette, A., and Grey, H. M. (1987). The interaction between protein-derived immunogenic peptides and Ia. Zmmunol. Reo. 98,115-141. Campbell, M. J., Esserman, L., and Levy, R. (1988). Immunotherapy of established murine B cell lymphoma. Combination of idiotype immunization and cyclophosphamide. J . Zmmunol. 141,3227-3233. Cantor, H., and Boyse, E. A. (1975). Functional subclasses of T-lymphocytes bearing different Ly antigens. I. The generation of functionally distinct T-cell subclasses is a differentiative process independent of antigen. J . E x p . Med. 141, 1376-1389. Cease, K. B., Berkower, I., York-Jolley, J., and Berzofsky, J. A. (1986). T cell clones specific for an amphipathic alpha-helical region of sperm whale myoglobin show differing fine specificities for synthetic peptides. A multiview/single structure interpretation of immunodominance. J . E x p . Med. 164,1779-1784. Chapdelaine, J. M., Plata, F., and Lilly, F. (1979). Tumors induced by murine sarcoma virus contain precursor cells capable of generating tumor-specific cytolytic T lymphocytes.J. E x p . Med. 149, 1531-1536.
338
PHILIP D.GREENBERC
Cheever, M. A,, Greenberg, P. D., and Fefer, A. (1980). Specificity of adoptive chemoimmunotherapy of established syngeneic tumors. J . lmmunol. 125,711-714. Cheever, M. A., Greenberg, P. D., and Fefer, A. (1981). Specific adoptive therapy of established leukemia with syngeneic lymphocytes nonspecifically expanded by culture with Interleukin 2. J. lmmunol. 126, 1318-1322. Cheever, M. A., Greenberg, P. D., Fefer, A., and Gillis, S. (1982). Augmentation ofthe anti-tumor therapeutic efficacy of long-term cultured T lymphocytes by in oiuo adniinistration of purified interleukin 2. J . E x p . Med. 155,968-980. Cheever, M. A., Greenberg, P. D., Irle, C., Thompson, J. A., Urdal, D. L., Mochizuki, D. Y.,Henney, C. S., and Gillis, S. (1984). Interleukin-2 administered in oioo induces the growth of cultured T cells in oio0.J. lmmunol. 132,2259-2265. Cheever, M. A., Thompson, D. B., Klarnet, J. P., and Greenberg, P. D. (1986). Antigendriven long-term cultured T cells proliferate in uioo, distribute widely, mediate specific tumor therapy and persist long-term as functional memory T cells. J . E x p . Med. 163,1100-1112. Cher, D. J., and Mosmann, T. R. (1987). Two types of murine helper T cell clone. 11. Delayed-type hypersensitivity is mediated by TH1 clones. /. lmmunol. 138, 36883694. Chesebro, B., Wehrly, K., Cloyd, M., Britt, W., Portis, J., Collins, J., and Nishio, J , (1981). Characterization of mouse monoclonal antibodies specific for Friend murine leukemia virus-induced erythroleukemia cells: Friend-specific and FMR-specific antigens. Virology 112, 131-144. Chesnut, R. W., and Grey, H. M. (1986). Antigen presentation by B cells and its significance in T-B interactions. Ado. lmmunol. 39,51-94. Cianciolo, G. J., Hunter, J., Silva, J., Haskill, J. S., and Snyderman, R. (1981). Inhibitors of monocyte responses to chemotaxins are present in human cancerous effusions and react with monoclonal antibodies to the P15(E) structural protein of retroviruses. J . Clin. lnoest. 68,831-844. Cianciolo, G. J., Phipps, D., and Snyderman, R. (1984). Human malignant and mitogentransformed cells contain retroviral P15E-related antigen. J . E x p . Med. 159, 964969. Colombo, M. P., Parenza, M., and Parmiani, G. (1985). Adoptive immunotherapy o f a BALB/c lymphoma by syngeneic anti-DBA/2 immune lymphoid cells: Characterization of the effector population and evidence for the role of the host’s non-T cells. Cancer Immunol. lmmunother. 20, 198-204. Crawford, R. M., Finbloom, D. S., Ohara, J., Paul, W. E., and Meltzer, M. S. (1987). B cell stimulatory factor-1 (interleukin 4) activates macrophages for increased tumoricidal activity and expression of Ia antigens.]. Immunol. 139, 135-141. Crowle, A. J., and Hu, C. C. (1966). Split tolerance affecting delayed hypersensitivity and induced in mice by pre-immunization with protein antigens in solution. Clin. E x p . lmmunol. 1,323-335. Dailey, M. O., Pillemer, E., and Weissman, I. L. (1982). Protection against syngeneic lymphoma by a long-lived cytotoxic T-cell clone. Proc. Natl. Acad. Sci. U.S.A. 79, 5384-5387. De Boer, R. J., and Hogeweg, P. (1986). Interactions between macrophages and T lymphocytes: Tumor sneaking through intrinsic to helper T cell dynamics. J . Theor. Biol. 120,331-351. De Boer, R. J., Hogeweg, P., Dullens, H. F., De Weger, R. A., and Den Otter, W. (1985). Macrophage T lymphocyte interactions in the anti-tumor immune response: A mathematical model. J . lmmunol. 134,2748-2758.
ADOPTIVE T CELL THERAPY OF TUMORS
339
Decker, T., Lohmann-Matthes, M. L., and Gifford, G. E. (1987). Cell-associated tumor necrosis factor (TNF) as a killing mechanism of activated cytotoxic macrophages. J. lmmunol. 138,957-962. De Graaf, P. W. Horak, E., and Bookman, M. A. (1988). Adoptive immunotherapy of syngeneic murine leukemia is enhanced by the combination of recombinant IFNgamma and a tumor-specific cytotoxic T cell clone. J. lmmunol. 140,2853-2857. Denkers, E. Y., Badger, C. C., Ledbetter, J. A., and Bernstein, I. D. (1985). Influence of antibody isotype on passive serotherapy of lymphoma. J. lmmunol. 135, 21832186. Dennert, G., and Podack, E. R. (1983).Cytolysis by H-2-specific T killer cells. Assembly of tubular complexes on target membranes. J. E x p . Med. 157,1483-1495. de Vries, J. E., and Spits, H. (1984). Cloned human cytotoxic T lymphocyte (CTL) lines reactive with autologous melanoma cells. I. In vitro generation, isolation and analysis to phenotype and specificity.]. Immunol. 132,510-519. De Weger, R. A,, Wilbrink, B., Moberts, R. M., Mans, D., Oskam, R., and Den Otter, W. (1987). Immune reactivity in SL2 lymphoma-bearing mice compared with SL2immunized mice. Cancer lmmunol. Immunother. 24,25-36. Dialynas, D. P., Wilde, D. B., Marrack, P., Pierres, A., Wall, K. A., Havran, W., Otten, G., Loken, M. R., Pierres, M., Kappler, J., and Fitch, F. W. (1983). Characterization of the murine antigenic determinant, designated L3T4a, recognized by monoclonal antibody GK1.5: Expression of L3T4a by functional T cell clones appears to correlate primarily with class I1 MHC antigen-reactivity. lmmunol. Reu. 74, 29-56. Dillman, R.0.(1989). Monoclonal antibodies for treating cancer. Ann. Intern. Med. 111, 592-603. Doherty, P. C., Allan, J. E., Lynch, F., and Ceredig, R.(1990). Dissection ofan inflammatory process induced by CD8+ T cells. Immunol. Today 11,55-59. Drapier, J. C., Wietzerbin, J., and Hibbs, J. B., Jr. (1988). Interferon-gamma and tumor necrosis factor induce the L-arginine-dependent cytotoxic effector mechanism in murine macrophages. Eur. J. lmmunol. 18,1587-1592. Drysdale, B. E., Agarwal, S., and Shin, H. S. (1988). Macrophage-mediated tumoricidal activity: mechanisms of activation and cytotoxicity. Prog. Allergy 40, 111-161. Dye, E. S., and North, R.J. (1981). T cell-mediated immunosuppression as an obstacle to adoptive immunotherapy of the P815 mastocytoma and its metastases. J. Exp. Med. 154,1033-1042. Earl, P. L., Moss, B., Morrison, R. P., Wehrly, K., Nishio, J., and Chesebro, B. (1986). T-lymphocyte priming and protection against Friend leukemia by vaccinia-retrovirus env gene recombinant. Science 234,728-731. Einstein, A. B., Cheever, M. A., and Fefer, A. (1976). The use of dimethyl myleran in adoptive chemoimmunotherapy of two murine leukemias. J. Natl. Cuncer lnst. (U.S.) 56,609-613. Eisenthal, A,, Shiloni, E., and Rosenberg, S. A. (1988). Characterization of IL-2-induced murine cells which exhibit ADCC activity. Cell lmmunol. 115,257-272. Esparza, I., Mannel, D., Ruppel, A., Falk, W., and Krammer, P. H. (1987). Interferon gamma and lymphotoxin or tumor necrosis factor act synergistically to induce macrophage killing of tumor cells and schistosomula of Schistosoma mansoni. J. Exp. Med. 166,589-594. Eura, M., Maehara, T., Ikawa, T., and Ishikawa, T. (1988). Suppressor cells in the effector phase of autologous cytotoxic reactions in cancer patients. Cancer lmmunol. Immunother. 27,147-153.
340
PHILIP D. GREENBERG
Evans, C. H., and Heinbaugh, J. A. (1981). Lymphotoxin cytotoxicity, a combination of cytolytic and cytostatic cellular responses. lmmunopharmacology 3,347-359. Evans, R. (1982). Macrophages and neoplasms: New insights and their implication in tumor imrnunobiology. Cancer Metastasis Reu. 1,227-239. Evans, R. (1984). Phenotypes associated with tumor rejection mediated by cyclophosphamide and syngeneic tumor-sensitized T lymphocytes: Potential mechanisms of action. lnt. J. Cancer 33,381-388. Evans, R. (1986). The immunological network at the site of tumor rejection. Biochim. Biophys. A C ~ 865, U 1-11. Evans, R., and Alexander, P. (lY72a). Mechanism of immunologically specific killing of tumour cells by macrophages. Nature (London)236, 168-170. Evans, R., and Alexander, P. (1972b). Role of macrophages in tuniour immunity. I. Co-operation between macrophages and lymphoid cells in syngeneic tumour immunity. Immunology 23,615-626. Evans, R., Grant, C. K., Cox, H., Steele, K., and Alexander, P. (1972). Thymus-derived lymphocytes produce an immunologically specific macrophage-arming factor. J . Exp. Med. 136,1318-1322. Fan, S.-T., and Edgington, T. S. (1989). Sufficiency of the C D 8 t T cell lineage to mount an effective tumoricidal response to syngeneic tumor-bearing novel class I MHC antigens. J . Immunol. 143,4287-4291. Farram, E., Nelson, M., Nelson, D. S., and Moon, D. K. (1982). Inhibition of cytokine production by a tumor cell product. Immunology 46,603-612. Fearon, E. R., Pardoll, D. M., Itaya, T., Golumbek, P., Levitsky, H. I., Simons, J. W., Karasuyama, H., Vogelstein, B., and Frost, P. (1990). Interleukin-2 production by tumor cells bypasses T helper function in the generation of an antitumor response. Cell (Cambridge, Mass.) 60,397-403. Fefer, A. (1969). Immunotherapy and chemotherapy of Moloney sarcoma virus-induced tumor in mice. Cancer Res. 29,182-192. Fefer, A., Einstein, A. B., Chewer, M. A., and Berenson, J . R. (1976). Models for syngeneic adoptive chemoimmunotherapy of niurine leukemias. Ann. N.Y. Acad. Sci. 276,573-583. Feinman, R., Henriksen-DeStefano, D., Tsujimoto, M., and VilCek, J. (1987). Tumor necrosis factor is an important mediator of tumor cell killing by human monocytes. J . Immunol. 138,635-640. Fernandez-Cruz, E., Woda, B. A., and Feldman, J. D. (1980). Elimination of syngeneic sarcomas in rats by a subset of T lymphocytes. J . Exp. Med. 152,823-841. Fidler, I. J., and Schroit, A. J . (1988). Recognition and destruction of neoplastic cells by activated macrophages: Discrimination of altered self. Biochem. Biophys. Acta 948, 151-173. Finkelman, F. D., Katona, I. M., Urban, J. F., Snapper, C. M., Ohara, J.. and Paul, W. E. (1986). Suppression of in uioo polyclonal IgE responses by monoclonal antibody to the lymphokine B cell stimulatory factor 1. Proc. Natl. Acad. Sci. U.S.A. 83,9675-9678. Finkelman, F. D., Katona, I. M., Mosmann, T. R., and Coffman, R. L. (1988). IFN-g regulates the isotypes of Ig secreted during in oioo humoral immune responses. J . Immunol. 140,1022-1027. Fiorentino, D. F., Bond, M. W., and Mosmann, T. R. (1989).Two types of mouse T helper cell. IV. Th2 clones secrete a factor that inhibits cytokine production by T h l clones. J . Exp. Med. 170,2081-2095. Fitzgerald-Bocarsly, P., Herberman, R., Hercend, T., Hiserodt, J., Kumar, V., Lanier, L., Ortaldo, J., Pross, H., Reynolds, C., Welsh, R., and Wigzell, H. (1988). A definition of natural killer cells. ltnmunol. Today 9,292.
ADOPTIVE T CELL THERAPY OF TUMORS
34 1
Fogler, W. E.. and Fidler, I. J. (1985). Nonselective destruction of murine neoplastic cells by syngeneic tumoricidal macrophages. Cancer Res. 45, 14-18. Foley, E. J. (1953). Antigenic properties of methylcholanthrene-induced tumors in mice of the strain of origin. Cancer Res. 13,835-837. Forrnan, J., Ciavarra, R., and Henderson, L. A. (1985). Recognition of an Igh-linked histocompatibility antigen, H-40, on B-cell tumors by cytotoxic T lymphocytes. Sum. lmmunol. Res. 4,41-47. Forni, G., Giovarelli, M., and Santoni, A. (1985). Lymphokine-activated tumor inhibition in oioo. I. The local administration of interleukin 2 triggers nonreactive lymphocytes from tumor-bearing mice to inhibit tumor growth.]. lmmunol. 134, 1305-1311. Friend, C. (1957). Cell-free transmission in adult Swiss mice of disease having the character of a leukemia.]. E x p . Med. 105,307-318. Fujii, T., Igarashi, T., and Kishimoto, S. (1987). Significance of suppressor macrophages for immunosurveillance of tumor-bearing mice. JNCl,J . Natl. Cancer lnst. 78, 509517. Fujimoto, S., Greene, M. I., and Sehon, A. H. (1976). Regualtion ofthe immune response to tumor antigens. I. Immunosuppressor cells in tumor-bearing hosts. J . Immunol. 116, 791-799, Fujiwara, H., Fukuzawa, M., Yoshioka, T., Nakajima, H., and Hamaoka, T. (1984). The role of tumor-specific Lyt-l+2- T cells in eradicating tumor cells in oioo. I. Lyt-l+2T cells do not necessarily require recruitment of host’s cytotoxic T cell precursors for implementation of in oioo immunity. J. lmmunol. 133, 1671-1676. Gajewski, T. F., and Fitch, F. W. (1988). Anti-proliferative effect of IFN-gamma in immune regulation. I. IFN-gamma inhibits the proliferation of Th2 but not T h l murine helper T lymphocyte clones. J . lmmunol. 140,4245-4254. Germain, R. N. (1986). Immunology. The ins and outs of antigen processing and presentation [news]. Nature (London)322,687-689. Gill, R. G., Rosenberg, A. S., Lafferty, K. J., and Singer. A. (1989). Characterization of primary T cell subsets mediating rejection of pancreatic islet grafts. J . Immunol. 143, 2 176-2178. Globerson, A., and Feldman, M. (1964) Antigenic specificity of benzo[a]pyrene-induced 32,1229-1243. sarcomas. J . Natl. Cancer lnst. (US.) Glynn, J. P., McCoy, J. L., and Fefer, A. (1968). Cross-resistance to the transplantation of syngeneic Friend, Moloney and Rauscher virus-induced tumors. Cancer Res. 28, 434-439. Golding, H., and Singer, A. (1985).Specificity, phenotype, and precursor frequency of primary cytolytic T lymphocytes specific for class I1 major histocompatibility antigens. 1.lmmunol. 135, 1610-1615. Gomard, E., Duprez, V., Reme, T., Colombani, M. J., and Levy, J. P. (1977). Exclusive involvement of H-2Db or H-2Kd product in the interaction between T-killer lymphocytes and syngeneic H-2b or H-2d viral 1ymphomas.J. E r p . Med. 146,909-922. Gorelik, E. (1983). Concomitant tumor immunity and the resistance to a second tumor challenge. Ado. Cancer Res. 39,71-120. Gotch, F., McMichael, A., and Rothbard, J. (1988). Recognition of influenza A matrix protein by HLA-A2-restricted cytotoxic T lymphocytes. Use of analogues to orientate the matrix peptide in the HLA-A2 binding site.J. E r p . Med. 168,2045-2057. Grabstein, K. H., Urdal, D. L., Tushinski, R. J., Mochizuki, D. Y., Price, V. L., Cantrell, M. A., Gillis, S., and Conlon, P. J. (1986). Induction ofmacrophage tumoricidal activity by granulocyte-macrophage colony-stimulating factor. Science 232,506-508. Green, D. R., Flood, P. M., and Gershon, R. K. (1983). Immunoregulatory T cell pathways. Annu. Rev. lmmunol. 1,439-463.
342
PHILIP D.GREENBERG
Green, D. R., Friedman, A., Ptak, W., McGhee, J., and Flood, P. M. (1989). Contrasuppression, tolerance and tumor immunity. Prog. Clin. Biol. Res. 288,245-258. Greenbaum, L. A., Horowitz. J. F., Woods, A., Pasqualini, T., Reich, E.-P., and Bottomly, K. (1988). Autocrine growth of CD4+ T cells: Differential effects of IL-1 on helper and inflammatory T cells. J . Zmmunol. 140, 1555-1560. Greenberg, P. D. (1986). Therapy of murine leukemia with cyclophosphamide and immune Lyt-2+ cells: Cytolytic T cells can mediate eradication of disseminated leukemia. J . Zmmunol. 136,1917-1922. Greenberg, P. D., and Cheever, M. A. (1984). Treatment of disseminated leukemia with cyclophosphamide and immune cells: Tumor immunity reflects long-term persistence of tumor-specific donor T cells. J . Zmrnunol. 133,3401-3407. Greenberg, P. D., Cheever, M., and Fefer, A. (1979). Suppression of the in oitro secondary response to syngeneic tumor and of in oioo tumor therapy with immune cells by culture-induced suppressor cells. J . Zmmunol. 123,515-522. Greenberg, P. D., Cheever, M. A., and Fefer, A. (1980). Detection of early and delayed antitumor effects following curative adoptive chemoimmunotherapy of established leukemia. Cancer Res. 40,4428-4432. Greenberg, P. D., Cheever, M. A,, and Fefer, A. (1981a). Eradication of disseminated murine leukemia by chemoimmunotherapy with cyclophosphamide and adoptively transferred immune syngeneic Lyt-l+2- lymphocytes. J . E x p . Med. 154,952-963. Greenberg, P. D., Cheever, M. A., and Fefer, A. (1981b). H-2. restriction of adoptive immunotherapy of advanced tumors. J . Zmmunol. 126,2100-2103. Greenberg, P. D., Kern, D. E., and Cheever, M. A. (1985). Therapy of disseminated murine leukemia with cyclophosphamide and immune Lyt-l+,2- T cells. Tumor eradication does not require participation of cytotoxic T cells. J . Exp. Med. 161, 1122-1134. Grimm, E. A., Mazumder, A., Zhang, H. Z., and Rosenberg, S. A. (1982). Lymphokineactivated killer cell phenomenon. Lysis of natural killer-resistant fresh solid tumor cells by interleukin 2-activated autologous human peripheral blood lymphocytes. J . Erp. Med. 155,1823-1841. Grimm, E. A., Robb, R. J,, Roth, J. A,, Neckers, L. M., Lachman, L. B., Wilson, D. J., and Rosenberg, S. A. (1983). Lymphokine-activated killer cell phenomenon. 111. Evidence that 11-2 is sufficient for direct activation of peripheral blood lymphocytes into lymphokine-activated killer cells. J . E r p . Med. 158, 1356-1361. Haranaka, K., Carswell, E. A., Williamson, B. D., Prendergast, J. S., Satomi, N., and Old, L. J. (1986). Purification, characterization, and antitumor activity of nonrecombinant mouse tumor necrosis factor. Proc. Natl. Acad. Sci. U.S.A. 83,3949-3953. Hardie, I. R., Strong, R. W., Hartley, L. C., Woodruff, P. W., and Clunie, G. J. (1980). Skin cancer in Caucasian renal allograft recipients living in a subtropical climate. Surgery ( S t . Louis) 87, 177-183. Harel-Bellam, A., Quillet, A., Marchiol, C., DeMars, R., Tursz, T., and Fradelizi, D. (1986) Natural killer susceptibility of human cells may be regulated by genes in the HLA region on chromosome 6. Proc. N a t l . Acud. Sci. U.S.A.83,5688-5692. Hayglass, K. T., Naides, S. J., Scott, C. F., Jr.. Benacerraf, B., and Sy, M. S . (1986). T cell development in B cell-deficient mice. IV. The role of B cells as antigen-presenting cells in uivo. J . Immunol. 136,823-829. Hecht, T. T., and Summers, D. F. (1972). Effect of vesicular stomatitis virus infection on the histocompatibility antigen of L cells. J . Virol. 10,578-585. Heinzel, F. P., Sadick, M. D., Holaday, B. J., Coffman, R. L., and Locksley, R. M. (1989). Reciprocal expression of interferon gamma or interleukin 4 during the resolution or
ADOPTIVE T CELL THERAPY OF TUMORS
343
progression of murine leishmaniasis. Evidence for expansion of distinct helper T cell subsets. J. E x p . Med. 169,59-72. Hellstrom, K. E., and Hellstrom, I. (1874). Lymphocyte-mediated cytotoxicity and blocking serum activity to tumor antigens. Ado. Zmmunol. 18,209-277. Henkart, P., and Yue, C. C. (1988). The role of cytoplasmic granules in lymphocyte cytotoxicity. Prog. Allergy 40,82-110. Herberman, R. B., Holden, H. T., Varesio, L., Taniyama, T., Puccetti, P., Kirchner, H., Gerson, J., White, S., Keisari, Y., and Haskill, J. S. (1980). Immunologic reactivity of lymphoid cells in tumors. Contemp. Top. Zmmunobiol. 10,61-78. Herberman. R. B., Reynolds, C. W., and Ortaldo, J. R. (1986). Mechanism ofcytotoxicity by natural killer (NK) cells. Annu Reo. Zmrnunol. 4,651-680. Hibbs, J. B., Jr. (1974). Discrimination between neoplastic and non-neoplastic cells in uitro by activated macrophages. J. Natl. Cancer Inst. ( U . S . )53, 1487-1492. Hibbs, J. B., Jr., Lambert, L. H., Jr., and Remington, J. S. (1972). Possible role of macrophage mediated nonspecificcytotoxicity in tumour resistance. Nature (London), New Biol. 235,48-50. Hibbs, J. B., Jr., Taintor, R. R., and Vavrin, Z. (1987a). Macrophage cytotoxicity: Role for L-arginine deiminase and imino nitrogen oxidation to nitrite. Science 235, 473476. Hibbs, J. B., Jr., Vavrin, Z., and Taintor, R. R. (198713). L-arginine is required for expression of the activated macrophage effector mechanism causing selective metabolic inhibition in target cells. J. Zmmunol. 138,550-565. Holt, C. A., Osorio, K., and Lilly, F. (1986). Friend virus-specific cytotoxic T lymphocytes recognize both gag and eno gene-encoded specificities. J. E x p . Med. 164,211226. Hori, S., Sato, S., Kitagawa, S., Azuma, T., Kokudo, S., Hamaoka, T., and Fujiwara, H. ( 1989).Tolerance induction of allo-class I1 H-2 antigen-reactive L3T4+ helper T cells and prolonged survival of the corresponding class I1 H-2 disparate skin graft. I.Zmmunol. 143,1447-1452. Itoh, K., Platsoucas, C. D., and Balch, C. M. (1988). Autologous tumor-specific cytotoxic T lymphocytes in the infiltrate of human metastatic melanomas: Activation by interleukin-2 and autologous tumor cells, and involvement of the T cell receptor. J . E x p . Med. 168,1419-1441. Janeway, C. A., Jr., Ron, J., and Katz, M. E. (1987). The B cell is the initiating antigenpresenting cell in peripheral lymph nodes. J . lmmunol. 138,1051-1055. Jayaraman, S., Martin, C. A., and Dorf, M. E. (1990). Enhancement of in oiuo cellmediated immune responses by three distinct cytokines. J . Zmmunol. 144,942-951. Jennings, S . R., Rice, P. L., Kloszewski, E. D., Anderson, R. W., Thompson, D. L., and Tevethia, S. S. (1985). Effect of herpes simplex virus types 1 and 2 on surface expression of class I major histocompatibility complex antigens on infected ce1ls.J. Virol.56, 757-766. Johnson, W. J., Somers, S. D., and Adams, D. 0.(1984). Expression and development of macrophage-activation for tumor cytotoxicity. Contemp. Top. Immunobiol. 13, 127146. Kakiuchi, T., Chesnut, R. W., and Grey, H. M. (1983). B cells as antigen-presenting cells: The requirements for B cell activation. J. Zmmunol. 131, 109-114. Kiirre, K., Ljunggren, H. G., Piontek, G., and Kiessling, R. (1986). Selective rejection of H-2-deficient lymphoma variants suggests alternative immune defence strategy. Nature (London)319,675-678. Kast, W. M., Offringa, R., Peters, P. J., Voordouw, A. C., Meloen, R. H., Van Der Eb, A. J.,
344
PHILIP D. GREENBERG
and Melief, C. J. M. (1989). Eradication of adenovirus El-induced tumors by E1Aspecific cytotoxic T lymphocytes. Cell 59,603-614. Kawano, Y.,Taniguchi, K., Toshitani, A., and Nomoto, K. (1986). Synergistic defense system by cooperative natural effectors against metastasis of B16 melanoma cells in H-2-associated control: Different behavior of H-2+ and H-2- cells in metastatic processes. J . Zmmunol. 136,4729-4734. Kehri, J. H., Dukovich, M., Whalen, C., Katz, P., Fauci, A. S., and Greene, W. C. (1988). Novel interleukin 2 (IL-2) receptor appears to mediate IL-2-induced activation of natural killer cells. J . Clin. Znoest. 81,200-205. Kelso, A., Glasebrook, A. L., Kanagawa, O., and Brunner, K. T. (1982). Production of macrophage-activating factor by T lymphocyte clones and correlation with other lymphokine activities. J. Zmmunol. 129,550-556. Kennedy, R. C., Zhou, E.-M., Lanford, R. E., Chanh, T. C., and Bona, C. A. (1987). Possible role of anti-idiotypic antibodies in the induction of tumor immunity. J . Clin. Inoest. 80,1217-1224. Kennel, S . J., Lankford, P. K., Flynn, K. M., and Winegar, R. (1985). Factors affecting passive monoclonal antibody therapy of Moloney sarcoma in BALB/c mice. Cancer Res. 45,3782-3789. Kern, D. E., Klarnet, J. P., Jensen, M. C. V., and Greenberg, P. D. (1986). Requirement for recognition of class 11 molecules and processed tumor antigen for optimal generation of syngeneic tumor-spe.cific class I-restricted CTL. J . Zmmunol. 136,4303-43 10. Kern, D. E., Peace, D. J., Klarnet, J. P., Cheever, M. A., and Greenberg, P. D. (1988). IL-4 is an endogenous T cell growth factor during the immune response to a syngeneic retrovirus-induced tumor. ]. Zmmunol. 141,2824-2830. Kern, D. E., Crabstein, K. A., Schreiber, K. D., and Greenberg, P. D. (1989). Identification of an unique T cell-derived lymphokine that primes macrophages for tumor cytotoxity.]. Zmmunol. 143,4308-4316. Killar, L., MacDonald, G., West, J., Woods, A., and Bottomly, K. (1987). Cloned, Iarestricted T cells that do not produce interleukin 4(IL 4)/B cell stimulatory factor l(BSF-1) fail to help antigen-specific B cells. J. Zmmunol. 138, 1674-1679. Klarnet, J. P., Matis, L. A., Kern, D. E., Mizuno, M. T., Peace, D. J., Thompson, J. A., Greenberg, P. D., and Cheever, M. A. (1987). Antigen-driven T cell clones can proliferate in vivo, eradicate disseminated leukemia and provide specific immunologic memory. /. Zmmunol. 138,4012-4017. Klarnet, J. P., Kern, D. E., Okuno, K., Holt, C., Lilly, F., and Greenberg, P. D. (1989,). FBL-reactive CD8+ cytotoxic and CD4+ helper T lymphocytes recognize distinct Friend murine leukemia virus-encoded antigens. ]. E x p . Med. 169,457-467. aarnet, J. P., Kern, D. E., Dower, S. K., Matis, L. A,, and Greenberg, P. D. (1989b). Helper-independent CD8+ cytotoxic T lymphocytes express interleukin-I (IL-1) receptors and require IL-1 for secretion of interleukin-2 (IL-2).] Immunol. 142,21872191. Klein, D. L., Brown, W., Cote, P., Garner, W., and Pearson, J. W. (1979).Chemoadoptive immunotherapy against a guinea-pig leukemia. Cancer Immunol. Zmmunother. 6, 17-25. Klein, G. (1966). Tumor antigens. Annu. Rev. Microbiol. 20,223-252. Klein, C., Sjogren, H. O., Klein, E., and Hellstrom, K. E. (1960). Demonstration of resistance against methycholanthrene-induced sarcomas in the primary autochthonous host. Cancer Res. 20,1561-1572. Klostergaard, J . (1987). Role of tumor necrosis factor in monocyte/macrophage tumor cytotoxicity in oitro. Nut. Immun. Cell Growth Regul. 6, 161-166. Knuth, A., Wolfel, T., Klehmann, E., Boon, T., and Meyer zum Biischenfelde, K. H.
ADOPTIVE T CELL THERAPY OF TUMORS
345
(1989). Cytolytic T cell clones against an autologous human melanoma: Specificity study and definition of three antigens by immunoselection. Proc. Natl. Acad. Sci. U.S.A.86,2804-2808. Koo, G. C., and Peppard, J. R. (1984). Establishment ofmonoclonal anti-Nk-1.1 antibody. Hybridoma 3,301-303. Koo, G. C., Dumont, F. J., Tutt, M., Hackett, J., Jr., and Kumar, V. (1986). The NK-1.1(-) mouse: A model to study differentiation of murine NK cells. J . Zmmunol. 137,37423747. Krammer, P. H., Kubelka, C. F., Falk, W., and Ruppel, A. (1985). Priming and triggering of tumoricidal and schistosomulicidal macrophages by two sequential lymphokine signals: Interferon-gamma and macrophage cytotoxicity inducing factor 2.1. Zmmunol. 135,3258-3263. Kripke, M. L. (1974). Antigenicity of murine skin tumors induced by ultraviolet light. J. Natl. Cancer Inst. (U.S.) 53, 1333-1336. Kurt-Jones, E. A., Hamberg, S., Ohara, J., Paul, W. E., and Abbas, A. K. (1987). Heterogeneity of helpedinducer T lymphocytes. J . Exp. Med. 166,1774-1787. Kushner, B. H., and Cheung, N. K. (1989). GM-CSF enhances 3F8 monoclonal antibodydependent cellular cytotoxicity against human melanoma and neuroblastoma. Blood 73,1936-1941. Lachman, L. B., Dinarello, C. A,, Llansa, N. D., and Fidler, I. J. (1986). Natural and recombinant human interleukin 1-beta is cytotoxic for human melanoma cells. J . Zmrnunol. 136,3098-3102. Lafreniere, R., Borkenhagen, K., Bryant, L. D., and Ng, E. (1989). Tumor-infiltrating lymphocytes cultured in recombinant interleukin-2: Enhancement of growth, cytotoxicity and phenotypic expression of cytotoxic T cell antigens by cyclophosphamide given intravenously prior to tumor harvest. J. B i d . Response Modif. 8,238-251. Lannin, D. R., Yu, S., and McKhann, C. F. (1982). Thymus-dependent response: Too little and too late for immunosurveillance. Transplantation 33,99-100. Lanzavecchia, A. (1985). Antigen-specific interaction between T and B cells. Nature (London)314,537-539. Lattime, E. C., and Stutman, 0. (1989). Tumor growth in uiuo selects for resistance to tumor necrosis factor. J. Zmmunol. 143,4317-4323. Lichtman, A. H., Chin, J., Schmidt, J. A., and Abbas, A. K. (1988). Role of interleukin-1 in the activation of T lymphocytes. Proc. Natl. Acad. Sci. U.S.A.85,9699-9703. Ljunggren, H. G., Ohlen, C., Hoglund, P., Yamasaki, T., Klein, G., Karre, K. (1988). Afferent and efferent cellular interactions in natural resistance directed against MHC class 1 deficient tumor grafts.J. Zmmunol. 140,671-678. Lopez, D. M., Blomberg, B. B., Padmanabhan, R. R., and Bourguignon, L. Y. (1989). Nuclear disintegration of target cells by killer B lymphocytes from tumor-bearing mice. FASEB J. 3,37-43. Lovett, D., Kozan, B., Hadam, M., Resch, K., andGemsa, D. (1986). Macrophage cytotoxicity: interleukin 1 as a mediator of tumor cytostasis. 1.Immunol. 136, 340-347. Lowenthal, J. W., and MacDonald, H. R. (1987). Expression of interleukin-1 receptors is restricted to the L3T4+ subset of mature T lymphocytes. J . Zmmunol. 138, 1-3. Lukacher, A. E., Morrison, L. A., Braciale, V. L., Malissen, B., and Braciale, T. J. (1985). Expression of specific cytolytic activity by H-21 region-restricted, influenza virusspecific T lymphocyte c1ones.J. Erp. Med. 162,171-187. Lurquin, C., Van Pal, A., Mariamie, B., De Plaen, E., Szikora, J. P., Janssens, C., Reddehase, M. J., Lejeune, J., and Boon, T. (1989). Structure of the gene of tumtransplantation antigen P91A. The mutated exon encodes a peptide recognized with Ld by cytolytic T cells. Cell (Cambridge,Mass.)58,293-303.
346
PHILIP D. GREENBERG
Maccubbin, D. L., Mace, K. F., Ehrke, M. J., and Mihich, E. (1989). Modification of host antitumor defense mechanisms in mice by progressively growing tumor. Cuncer Res. 49,4216-4224, Manca, F., Clarke, J. A,, Miller, A,, Sercarz, E. E., and Shastri, N. (1984).A limited region within hen egg-white lysozyme serves as the focus for a diversity of T cell clones. J . Immunol. 133,2075-2078. Mantovani, A., Ming, W. J., Balotta, C., Abdeljalil, B., and Bottazzi, B. (1986). Origin and regulation of tumor-associated macrophages: The role of tumor-derived chemotactic factor. Biochim. Biophys. Actu 865,5947. Marino, P. A., and Adams, D. 0. (1982). The capacity of activated murine macrophages for augmented binding of neoplastic cells: Analysis of induction by lymphokine containing MAF and kinetics of the reaction.]. Immunol. 128,2816-2823. Markmann, L., Lo, D., Naji, A,, Palmiter, R. D., Brinster, R. L., and Herber-Katz, E. (1988). Antigen presenting function of class I1 MHC expressing pancreatic beta cells. Nature (London)336,476-479. Martin, P. J., Schulman, H. M., Schubach, W. H., Hansen, J. A., Fefer, A., Miller, G., and Thomas, E. D. (1984). Fatal EBV-associated proliferation of donor B cells after treatment of acute GVHD with a murine monoclonal anti-T cell antibody. Ann. Intern. Med. 101,310-315. Maryanski, J. L., Pala, P., Cerottini, J. C., and Corradin, G. (1988). Synthetic peptides as antigens and competitors in recognition by H-2-restricted cytolytic T cells specific for HLA.J. Exp. Med. 167,1391-1405. Matis, L. A., Ruscetti, S. K., Longo, D. L., Jacobson, S., Brown, E. J., Zinn, S., and Kruisbeek, A. M. (1985). Distinct proliferative T cell clonotypes are generated in response to a murine retrovirus-induced syngeneic T cell leukemia: Viral gp70 antigen-specific MT4+ clones and Lyt-2+ cytolytic clones which recognize a tuniorspecific cell surface antigen. J . Immunol. 135,703-713. Matis, L. A., Shu, S., Groves, E. S., Zinn, S., Chou, T., Kruisbeek, A. M., Rosenstein, M., and Rosenberg, S. A. (1986). Adoptive immunotherapy of a syngeneic murine leukemia with a tumor-specific cytotoxic T cell clone and recombinant human interleukin 2: Correlation with clonal IL 2 receptor expression.J . Immunol. 136,3496-3501. McCoy, K. L., and Schwartz, R. H. (1988). The role of intracellular acidification in antigen processing. Zmnwnol. Rev. 106, 129- 147. McCune, C. S., and Marquis, D. M. (1990). Interleukin-1 as an adjuvant for active specific immunotherapy in a murine tumor model. Cuncer Res. 50, 1212-1215. Meltzer, M. S . (1981). Macrophage activation for tumor cytotoxicity: Characterization of priming and trigger signals during lymphokine activation. J . Immunol. 127, 179-183. Meltzer, M. S., and Bartlett, G. L. (1972). Cytotoxicity in vitro by products of specifically stimulated spleen cells: Susceptibility of tumor cells and normal cel1s.J. Natl. Cancer Inst. (U.S.)49, 1439-1449. Metlay, J. P., Pure, E., and Steinman, R. M. (1989). Control of the immune response at the level of antigen-presenting cells: A comparison of the function of dendritic cells and B lymphocytes. Ado. Immunol. 47,45-116. Mielke, M. E. A., Niedobitek, G., Stein, H., and Hahn, H. (1989). Acquired resistance to Listeria monocytogenes is mediated by Lyt-2+ T cells independently of the influx of monocytes into granulomatous lesions. J . Exp. Med. 170,589-594. Mihich, E. (1969). Combined effects of chemotherapy and immunity against leukemia L1210 in DBAA mice. Cancer Res. 29,848-854. Mills, C. D., and North, R. J. (1983). Expression of passively transferred immunity against an established tumor depends on generation of cytolytic T cells in recipient. Inhibition by suppressor T cel1s.J. E x p . Med. 157, 1448-1460.
ADOPTIVE T CELL THERAPY OF TUMORS
347
Mills, C. D., and North, R. J. (1985). Ly-1+2- suppressor Tcells inhibit the expression of passively transferred antitumor immunity by suppressing the generation of cytolytic T cells. Transplantation 39,202-208. Mitsuya, H., Matis, L., Megson, M., Bunn, P., Murray, C., Mann, D., Gallo, R., and Broder, S. (1983). Generation of an HLA-restricted cytotoxic T cell line reactive against cultured tumor cells from a patient infected with human T cell leukemia/ lymphoma virus.J. Exp. Med. 158,994-999. Mizuochi, T., Golding, H., Rosenberg, A. S., Glimcher, L. H., Malek, T. R., and Singer, A. (1985). Both L3T4+ and Lyt-2+ helper T cells initiate cytotoxic T lymphocyte responses against allogenic major histocompatibility antigens but not against trinitrophenyl-modified self. J . E x p . Med. 162,427-443. Mizuochi, T., McKean, D. J., and Singer, A. (1988). IL-1 as a co-factor for lymphokinesecreting CD8+ murine T cells.]. Immunol. 141, 1571-1575. Mizuochi, T., Hugin, A. W., Morse, H. C., Singer, A., and Buller, R. M. L. (1989). Role of lymphokine-secreting CD8+ T cells in cytotoxic T lymphocyte responses against vaccinia virus. J . Immunol. 142,270-273. Moller, G., and Moller, E. (1976). The concept of immunological surveillance against neoplasia. Transplant. Rev. 28,3-16. Morgan, A. C., Jr., Sullivan, W., Graves, S., and Woodhouse, C. S. (1989). Murine monoclonal IgG3 to human colorectal tumor-associated antigens: Enhancement of antibody-dependent cell-mediated cytotoxicity by interleukin 2. Cancer Res. 49, 2773-2776. Morrison, L. A., Lukacher, A. E., Braciale, V. L., Fan, D. P., and Braciale, T. J. (1986). Differences in antigen presentation to MHC class I-and class 11-restricted influenza virus-specific cytolytic T lymphocyte clones. J . E x p . Med. 163,903-921. Mosmann, T. R., and Coffman, R. L. (1989a). Heterogeneity of cytokine secretion patterns and functions of helper T cells. Adu. Immunol. 46, 111-147. Mosmann, T. R., and Coffman, R. L. (1989b). T H l and TH2 cells: Different patterns of lymphokine secretion lead to different functional properties. Annu. Reo. Immunol. 7 , 145-173. Mosmann, T. R., Chenvinski, H., Bond, M. W., Giedlin, M. A., and Coffman, R. L. (1986). Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J . Immunol. 136,2348-2357. Moss, B., and Flexner, C. (1987). Vaccinia virus expression vectors. Annu. Reu. Zmmunol. 5,305-324. Moss, D. J.. Scott, W., and Pope, J. H. (1977). An immunological basis for inhibition of transformation of human lymphocytes by EB virus. Nature (London)268,735-736. Mueller, D. L., Jenkins, M. K., and Schwartz, R. H. (1989). Clonal expansion versus functional clonal inactivation: A costimultory signalling pathway determines the outcome of T cell antigen receptor occupancy. Annu. Rev. Immunol. 7,445-480. Mukherji, B., and MacAlister, T. J. (1983). Clonal analysis of cytotoxic T cell response against human melanoma. J . E x p . Med. 158,240-245. Mukherji, B., Guha,A., Chakraborty, N. G., Sivanandham, M., Nashed, A. L., Sporn, J. R., and Ergin, M. T. (1989). Clonal analysis of cytotoxic and regulatory T cell responses against human melanoma. J. E x p . Med. 169,1961-1976. Mule, J. J., Rosenstein, M., Shu, S., and Rosenberg, S. A. (1985). Eradication of a disseminated syngeneic lymphoma by systemic adoptive transfer of immune lymphocytes is dependent upon a host component(s). Cancer Res. 45,526-531. Nathan, C. F., and Cohn, Z. A. (1981). Antitumor effects of hydrogen peroxide in uivo. J . E x p . Med. 154,1539-1553. Nathan, C. F., Brukner, L. H., Silverstein, S. C., and Cohn, Z. A. (1979a). Extracellular
348
PHILIP D. GREENBERG
cytolysis by activated macrophages and granulocytes. I. Pharmacologic triggering of effector cells and the release of hydrogen per0xide.J. E x p . Med. 149,8449. Nathan, C. F., Silverstein, S. C., Brukner, L. H., and Cohn, Z. A. (197Yb).Extracellular cytolysis by activated macrophages and granulocytes. 11. Hydrogen peroxide as a mediator of cytotoxicity. J. E x p . Med. 149, 100-113. Nepom, G. T., and Hellstrom, K. E. (1987). Anti-idiotypic antibodies and the induction of specific tumor immunity. Cancer Metastasis Reo. 6,489-502. North, R. J . (1982). Cyclophosphamide-facilitated adoptive inmunotherapy of an established tumor depends on elimination of tumor-induced suppressor T cells. J. Exp. Med. 155,1063-1074. North, R. J. (1984). The murine antitumor immune response and its therapeutic manipulation. Ado. Irnrnunol. 35,89-155. North, R. J. (1985). Down-regulation of the antitumor immune response. Ado. Cancer Res. 45, 1-43. North, R. J., and Bursuker, I. (1984a). Generation and decay ofthe immune response to a progressive fibrosarcoma. I. Ly-l+2- suppressor T cells down-regulate the generation of Ly-l-2+ effector T cells. J. Exp. Med. 159, 1295-1311. North, R. J., and Bursuker, I. (1984b). T cell-mediated suppression of the concomitant antitumor immune response as an example of transplantation tolerance. Transplant. Proc. 16,463-469. North, R. J., Neubauer, R. H., Huang, J . J. H., Newton, R. C., and Loveless, S. E. (1988). Interleukin-1-induced T cell-mediated regression of immunogenic murine tumors. Requirement for an adequate level of already acquired host concomitant immunity. J. Exp. Med. 168,2031-2043. Nowinski, R. C., Emery, S., and Ledbetter, J. (1978). Identification of an FMR cell surface antigen associated with murine leukemia virus-infected cells. J . Virol. 26, 805-8 12. Nuchtern, J. G., Bonifacino, J. S., Biddison, W. E., and Klausner, R. D. (1989). Brefeldin A implicates egress from endoplasmic reticulum in class I restricted antigen presentation. Nature (London)339,223-226. Ohlen, C., Bejarano, M. T., Gr:onberg, A., Torsteinsdottir, S., Franksson, L., Ljunggren, H. G . ,Klein, E., Klein, G., Karre, K. (1989). Studies ofsublines selected for loss ofHLA expression from an EBV-transformed lymphoblastoid cell line. Changes in sensitivity to cytotoxic T cells activated by allostimulation and natural killer cells activated by IFN or IL-2. J. Immunol. 142,3336-3341. Old, L. J,, Boyse, E. A., Clarke, D. A., and Carswell, E. A. (1962). Antigenic properties of chemically induced tumors. 11. Antigens of tumor cells. Ann. N . Y. Acad. Sci. 101, 80-106. Old, L. J., Boyse, E. A., and Stockert, E. (1963). Antigenic properties of experimental leukemias. I. Serological studies in vitro with spontaneous and radiation-induced 1eukemias.J. Natl. Cancer lnst.(U.S.)31,977-986. Onozaki, K., Matsushima, K., Aggarwal, B. B., and Oppenheiin, J. J. (1985). Human interleukin 1 is a cytocidal factor for several tumor cell lines. J. lrnrnunol. 135,39623968. Ostensen, M. E., Thiele, D. L., and Lipsky, P. E. (1987). Tumor necrosis factor-alpha enhances cytolytic activity of human natural killer cells. J. Irnrnunol. 138, 41854191. Ozaki, S., York-Jolley, J., Kawamura, H., and Berzofsky, J. A. (1987). Cloned protein antigen-specific, Ia-restricted T cells with both helper and cytolytic activities: Mechanisms of activation and killing. Cell. Irnrnunol. 105,301-316.
ADOPTIVE T CELL THERAPY OF TUMORS
349
Pace, J. L., and Russell, S. W. (1981). Activation of mouse macrophages for tumor cell killing. I. Quantitative analysis of interactions between lymphokine and lipopolysaccharide. J. Immunol. 126,1863-1867. Pace, J. L., Russell, S. W., Torres, B. A., Johnson, H. M., and Bray, P. W. (1983). Recombinant mouse gamma interferon induces the priming step in macrophage activation for tumor cell killing. I . Immunol. 130,2011-2013. Padmanabhan, R. R., Paul, R. D., Watson, G. A., and Lopez, D. M. (1988). Emergence ofa B lymphocyte population with ADCC effector function in mammary tumor bearing mice. J . Leukocyte Biol. 43,509-519. Parish, C. R. (1972). The relationship between humoral and cell-mediated immunity. Transplant Rev. 13,35-66. Paul, N. L., and Ruddle, N. H. (1988). Lymphotoxin. Annu. Reu. Immunol. 6,407-438. Paulnock, D. M., and Lambert, L. E. (1990). Identification and characterization of monoclonal antibodies specific for macrophages at intermediate stages in the tumoricidal activation pathway. J . Immunol. 144,765-773. Peace, D. J., and Chewer, M. A. (1989). Toxicity and therapeutic efficacy of high-dose IL-2: In oivo infusion of antibody to NK-1.1 attenuates toxicity without compromising efficacy against murine leukemia. J . E x p . Med. 169,161-173. Perry, L. L., Benacerraf, B., McCluskey, R. T., and Greene, M. I. (1978). Enhanced syngeneic tumor destruction b y in vioo inhibition of suppressor T cells using anti-I-J alloantiserum. Am. J . Pathol. 92,491-506. Perussia, B., Santoli, D., and Trinchieri, G . (1980). Interferon modulation of natural killer cell activity. Ann. N . Y. Acad. Sci. 350,55-62. Philip, R. (1988). Cytolysis of tumor necrosis factor (TNF)-resistanttumor targets. Differential cytotoxicity of monocytes activated by the interferons, IL-2, and TNF. J. Immunol. 140,1345-1349. Philip, R., and Epstein, L. B. (1986). Tumour necrosis factor as immunomodulator and mediator of monocyte cytotoxicity induced by itself, gamma-interferon and interleukin-1. Nature (London) 323,86-89. Phillips, J. H., Gemlo, B. T., Myers, W. W., Rayner, A. A., and Lanier, L. L. (1987).I n oivo and in oitro activation of natural killer cells in advanced cancer patients undergoing combined recombinant interleukin-2 and LAK cell therapy. J. Clin. Oncol. 5, 19331941. Piessens, W. F., and Sharma, S. D. (1980). Tumor cell killing by macrophages activated in vitro with lymphocyte mediators. 5. Role of proteases, inhibitors, and substrates. Cell. Immunol. 56,286-291. Plata, F., and Lilly, F. (1979). Viral specificity of H-2-restricted T killer cells directed against syngeneic tumors induced by Cross, Friend, or Rauscher leukemia virus. J. E x p . Med. 150,1174-1186. Podack, E. R. (1986). Molecular mechanisms ofcytolysis by complement and by cytolytic lymphocytes. J . Cell. Biochem. 30,133-170. Powell, T. J., Jr., Spann, R., Vakil, M., Kearney, J. F., and Lamon, E. W. (1988).Activation of a functional idiotype network response by monoclonal antibody specific for a virus (M-MuLV)-induced tumor antigen). J . Immunol. 140,3266-3272. Prehn, R. T. (1962). Specific isoantigenicities among chemically-induced tumors. Ann. N . Y. Acad. Sci. 101,107-113. Prehn, R. T. (1976). Do tumors grow because of the immune response of the host? Transplant. Rev. 28,34-42. Prehn, R. T., and Main, J. M. (1957). Immunity to methycholanthrene-induced sarcomas. J. Natl. Cancer Inst. US.18,769-778.
350
PHILIP D. GREENBERG
Raychaudhuri, S.,Saeki, Y., Chen, J. J., and Kohler, H. (1987). Analysis of the idiotypic network in tumor immunity. J . Immunol. 139,3902-3910. Reed, W. P., and Lucas, 2.J. (1975).Cytotoxic activity of lymphocytes. V. Role of soluble toxin in macrophage-inhibited cultures of tumor cells. J . Immunol. 115,395-404. Rock, K. L., and Benacerraf, B. (1983). Inhibition of antigen-specific T lymphocyte activation by structurally related Ir gene-controlled polymers. Evidence of specific competition for accessory cell antigen presentation. J . Exp. Med. 157, 1618-1634. Rock, K. L., Benacerraf, B., and Abbas, A. K. (1984). Antigen presentation by haptenspecific B lymphocytes. I. Role of surface immunoglobulin recept0rs.J. Exp. Med. 160, 1102-11 13. Ron, Y.,and Sprent, J. (1987).T cell priming i n oioo: A major role for B cells in presenting antigen to T cells in lymph nodes. J . Immunol. 138,2848-2856. Ron, Y., De Baetselier, P., Gordon, J., Feldman, M., and Segal, S. (1981). Defective induction of antigen-reactive proliferating T cells in B cell deprived mice. Eur. J . Immunol. 11,964-968. Ron, Y., De Baetselier, P., Tzehoval, E., Cordon, J., Feldman, M., and Segal, S. (1983). Defective induction of antigen-reactive proliferating T cells in B cell-deprived mice. I1 Anti-@treatment affects the initiation and recruitment of T cells. Eur. J . Immunol. 13, 167-171. Rose J. (1988). Regulation of protein export from the ER. Annu. Reo. Cell Biol. 4, 257-288. Rosenberg, A. S., Mizuochi, T., and Singer, A. (1986). Analysis of T-cell subsets in rejection of Kb mutant skin allografts differing at class I MHC. Nature (London)322, 829-83 1, Rosenberg, A. S.,Mizuochi, T., and Singer, A. (1988a). Cellular interactions resulting in skin-allograft rejection. Ann. N . Y. Acad. Sci. 532,76-85. Rosenberg, A. S., Mizuochi, T., and Singer, A. (1988b). Evidence for involvement of dual-function T cells in rejection of MHC class I disparate skin grafts. Assessment of MHC class I alloantigens as in oioo helper determinants.J. E x p . Med. 168,33-34. Rosenberg, A. S., Katz, S.I., and Singer, A. (1989).Rejection ofskin allografts by CD4+ T cells is antigen-specific and requires expression of target alloantigen on la-epidermal cel1s.J. Immunol. 143,2452-2456. Rosenberg, S. A., and Lotze, M. T. (1986). Cancer immunotherapy using interleukin-2 and interleukin-2-activated lymphocytes. Annu. Rev. Immunol. 4,681-709. Rosenberg, S . A., Spiess, P. J., and Lafreniere, R. (1986). A new approach to the adoptive immunotherapy of cancer with tumor infiltrating lymphocytes. Science 233, 13181321. Rosenberg, S. A., Lotze, M. T., M u d , L. M., Chang, A. E., Avis, F. P. Leitman, S., Linehan, W. M., Robertson, C. N., Lee, R. E., Rubin, J. T., Seipp, C. A., Simpson, C. G., and White, D. E. (1987). A progress report on the treatment of 157 patients with advanced cancer using lymphokine-activated killer cells and interleukin-2 or highdose interleukin-2 alone. N . Engl. ]. Med. 316,889-897. Rosenberg, S. A., Packard, B. S.,Aebersold, P. M., Solomon, D., Topalian, S. L., Toy, S. T., Simon, P., Lotze, M. T., Yang, J. C., Seipp, C. A. and Carter (1988). Use of tumor-infiltrating lymphocytes and interleukin-2 in the immunotherapy of patients with metastatic melanoma. A preliminary report. N . Engl. J . Med. 319, 1676-1680. Rosenstein, M., Eberlein, T., and Rosenberg, S.A. (1984). Adoptive immunotherapy of established syngeneic solid tumors: Role of T lymphoid subpopulations. J . Immunol. 132,2117-2122. Ruggiero, V., and Baglioni, C. (1987). Synergistic anti-proliferative activity of interleukin 1 and tumor necrosis factor. /. Immunol. 138,661-663.
ADOPTIVE T CELL THERAPY OF TUMORS
351
Russell, J. H. (1983). Internal disintegration model of cytotoxic lymphocyte-induced target damage. lmmunol. Reo. 72,97-118. Russell, S. W., and McIntosh, A. T. (1977). Macrophages isolated from regressing Moloney sarcomas are more cytotoxic than those recovered from progressing sarcomas. Nature (London)268,69-71. Russell, S. W., Gillespie, G. Y., and Pace, J . L. (1980). Evidence for mononuclear phagocytes in solid neoplasms and appraisal of their nonspecific cytotoxic capabilities. Contemp. Top. lmmunobiol. 10, 143-166. Rygaard, J., and Povlsen, C. 0.(1976).The nude mouse vs. the hypothesis of immunological surveillance. Transplant. Reo. 28,43-61. Sakamoto, K., Fujiwara, H., Nakajima, H., Yoshioka, T., Takai, Y., and Hamaoka, T. (1986). Requirements of adherent cells for activating Lyt-l+2- T cells as well as for functioning as antitumor effectors activated by factor(s) from Lyt-l+2- T cel1s.jpn.j. Cancer Res. 77,1142-1152. Sakamoto, K., Yoshioka, T., Shimizu, J., Sato, S., Nakajima, H., Fujiwara, H., and Hamaoka, T. (1988). Mechanisms for recognition of tumor antigens and mediation of antitumor effect by noncytolytic Lyt-2+ T cell subset.1pn.j. Cancer Res. 79,99-108. Schatten, S., Granstein, R. D., Drebin, J . A,, and Greene, M. I. (1984). Suppressor T cells and the immune response to tumors. CRC Crit. Rev. lmmunol. 4,335-379. Schild, H. J., Kyewski, B., von Hoegen, P., and Schirrmacher, V. (1987). CD4+ helper T cells are required for resistance to a highly metastatic murine tumor. Eur.j . lmmunol. 17,1863-1866. Schlick, E., Hewetson, P., and Ruffmann, R. (1986). Adjuvant chemoimmunotherapy of cancer: Influence of tumor burden and role of functional immune effector cells in mice. Cancer Res. 46,3378-3383. Schlom, J. (1986). Basic principles and applications of monoclonal antibodies in the management of carcinomas: The Richard and Hinda Rosenthal Foundation award lecture. Cancer Res. 46,3225-3238. Schreiber, H. (1984). Idiotype network interactions in tumor immunity. Ado. Cancer Res. 41,291-321. Schreiber, H., Ward, P. L., Rowley, D. A., and Stauss, H. J. (1988). Unique tumor-specific antigens. Annu. Reu. lmmunol. 6,465-483. Schreiber, R. D. (1984). Identification of gamma-interferon as a murine macrophageactivating factor for tumor cytotoxicity. Contemp. Top. lmmunobiol. 13, 171-198. Schreiber, R. D., Hicks, L. J., Celada, A., Buchmeier, N. A., and Gray, P. W. (1985). Monoclonal antibodies to murine gamma-interferon which differentially modulate macrophage activation and antiviral activity. j . lmmunol. 134, 1609-1618. Schultz, R. M. and Kleinschmidt, W. J. (1983). Functional identity between murine gamma interferon and macrophage activating factor. Nature (London) 305,239-240. Schultz, K. R., Klarnet, J. P., Gieni, R. S., Hay Glass, K. T., and Greenberg, P. D. (1990). The roll of B cells for in oioo T cell responses to a Friend virus-induced leukemia. Science 219,921-923. Schwartz, R. H. (1985). T-lymphocyte recognition of antigen in association with gene products of the major histocompatibility complex. Annu. Reo. lmmunol. 3,237-261. Schwartz, R. H. (1989). Acquisition of immunologic self-tolerance. Cell 57, 1073-1081. Sharon, M., Klausner, R. D., Cullen, B. R., Chizzonite, R., and Leonard, W. J. (1986). Novel interleukin-2 receptor subunit detected by cross-linking under high-affinity conditions. Science 234,859-863. Shijubo, N., Uede, T., and Kikuchi, K. (1989). Functional analysis of mononuclear cells infiltrating into tumors. V. A soluble factor involved in the regulation of cytotoxic/ suppressor T cell infiltration into tumors. j . lmmunol. 142,2961-2967.
352
PHILIP D. GREENBERG
Shiku, H., Kisielow, P., Bean, M. A.,Takahashi, T., Boyse, E. A., Oettgen, H. F., and Old, L. J. (1975). Expression of T-cell differentiation antigens on effector cells in cellmediated cytotoxicity in uitro. Evidence for functional heterogeneity related to the surface phenotype of T cells. J. Exp. Med. 141,227-241. Shimonkevitz, R., Kappler, J., Marrack, P., and Grey, H. (1983). Antigen recognition by H-2-restricted T cells. I. Cell-free antigen processing. J . E x p . Med. 158,303-316. Shu, S . , and Rosenberg, S. A. (1985). Adoptive immunotherapy of a newly induced sarcoma: immunologic characteristics of effector cells. J . lmmunol. 135,2895-2903. Singer, A., Munitz, T. I., Golding, H., Rosenberg, A. S., and Mizuochi, T. (1987). Recognition requirements for the activation, differentiation and function of T-helper cells specific for class I MHC alloantigens. Immunol. Reu. 98, 143-170. Sjogren, H. D., Hellstriim, I., and Klein, G. (1961). Transplantation of polyonia virusinduced tumors in mice. Cancer Res. 21,329-337. Slovin, S . F., Lacknian, R. D., Ferrone, S., Kiely, P. E., and Mastrangelo, M. J. (1986). Cellular immune response to human sarcomas: Cytotoxic T cell clones reactive with autologous sarcomas. J . Immunol. 137,3042-3048. Snyderman, R., and Cianciolo, G. J. (1984). Immunosuppressive activity ofthe retroviral envelope protein p15E and its possible relationship to neoplasia. lmmunol. Today 5, 240-244. Snyderman, R., and Pike, M. C. (1976). An inhibitor ofmacrophage chemotaxis produced by neoplasms. Science 192,370-372. Spitalny, G. L., and Havell, E. A. (1984). Monoclonal antibody to murine gamma interferon inhibits lymphokine-induced antiviral and macrophage tumoricidal activities. J . E x p . Med. 159,1560-1565. Spitalny, G . L., and North, R. J. (1977). Subversion of host defense mechanisms by malignant tumors: An established tumor as a privileged site for bacterial growth. J. Exp. Med. 145,1264-1277. Storkus, W. J., Howell, D. N., Salter, R. D., Dawson, J. R., and Cresswell, P. (1987). NK susceptibility varies inversely with target cell class I HLA antigen expression. J . lmmunol. 138,1657-1659. Storkus, W. J., Alexander, J., Payne, J . A., Cresswell, P., and Dawson, J. R . (1989a). The alphaa Ualpha 2 domains ofclass I HLA molecules confer resistance to natural killing. J. lmmunol. 143,3853-3857. Storkus, W. J., Alexander, J., Payne, J. A., Dawson, J. R., and Cresswell, P. (1989b). Reversal of natural killing susceptibility in target cells expressing transfected class I HLA genes. Proc. Natl. Acad. Sci. U.S.A.86,2361-2364. Stout, R. D., and Bottomly, K. (1989).Antigen-specific activation of effector macrophages by IFN-gamma producing (TH1) T cell clones. Failure of IL-4-producing (TH2) T cell clones to activate effector function in macrophages. J . lmmunol. 142,760-765. Svedersky, L. P., Benton, C. V., Berger, W. H., Rinderknecht, E., Harkins, R. N., and Palladino, M. A. (1984a). Biological and antigenic similarities of murine interferongamma and macrophage-activating factor. J . E x p . Med. 159,812-827. Svedersky, L. P., Shepard, H. M., Spencer, S. A., Shalaby, M. R., and Palladino, M. A. (1984b). Augmentation of human natural cell-mediated cytotoxicity by recombinant human interleukin 2. J . lmmunol. 133,714-718. Swain, S . L. (1981). Significance of Lyt phenotypes: Lyt2 antibodies block activities ofT cells that recognize class 1 major histocompatibility complex antigens regardless of their function. Proc. Natl. Acad. Sci. U . S . A. 78,7101-7105. Swain, S . L., Dennert, G., Normsley, S., and Dntton, R. W. (1981). The Lyt phenotype of a long-term allospecific T cell line. Both helper and killer activities to IA are mediated by Ly-1 cells. Eur.J.lmmunol. 11, 175-180.
ADOPTIVE T CELL THERAPY OF TUMORS
353
Takahashi, H., Cohen, J., Hosmalin, A., Cease, K. B., Houghten, R., Cornete, J. L., DeLisi, C., Moss, B., Germain, R. N., and Berzofsky, J. A. (1988).An immunodominant epitope of the human immunodeficiency virus envelope glycoprotein gp160 recognized by class I major histocompatibility complex molecule-restricted murine cytotoxic T lymphocytes. Proc. Natl. Acad. U . S. A. 85,3105-3109. Takahashi, K., Ono, K., Hirabayashi, Y., and Taniguchi, M. (1988). Escape mechanisms of melanoma from immune system by soluble melanoma antigen. J . Immunol. 140, 3244-3248. Tanaka, K., Yoshioka, T., Bieberich, C., and Jay, G. (1988). Role of the major histocompability complex class I antigens in tumor growth and metastasis. Annu. Reu. Zmmunol. 6,359-380. Tepper, R. I., Pattengale, P. K. and Leder, P. (1989). Murine interleukin-4 displays potent anti-tumor activity in uioo. Cell (Cambridge, Mass.) 57,503-512. Thompson, J. A., Peace, D. J., Klarnet, J. P., Kern, D. E., Greenberg, P. D., and Cheever, M. A. (1986). Eradication of disseminated murine leukemia by treatment with highdose interleukin-2. J . Immunol. 137,3675-3680. Thorley-Lawson, D. A. (1980). The suppression of Epstein-Barr virus infection in uitro occurs after infection hut before transformation of the cell. 1.Immunol. 124,745-751. Thorley-Lawson, D. A., Chess, L., and Strominger, J. L. (1977). Suppression of in uitro Epstein-Barr virus infection. A new role for adult human T 1ymphocytes.J. E x p . Med. 146,495-508. Ting, C. C., and Rodrigues, D. (1980). Switching on the macrophage-mediated suppressor mechanism by tumor cells to evade host immune surveillance. Proc. Natl. Acad. Sci. U. S . A. 77,4265-4269. Tite, J., and Janeway, C. A., Jr. (1984). Cloned helper T cells can kill B lymphoma cells in the presence of specific antigen: Ia restriction and cognate vs. noncognate interactions in cytolysis. Eur.]. Immunol. 14,878-886. Tomita, S., Fujiwara, H., Yamane, Y., Sano, S., Nakajima, H., Izumi, Y., Arai, H., Kawanishi, y., Tsuchida, T., and Hamaoka, T. (1986). Demonstration of intratumoral infiltration of tumor-specific Lyt-l+2- T cells mediating delayed-type hypersensitivity response and in uiuo protective immunity.1pn.J. Cancer Res. 77, 182-189. Topalian, S. L., Muul, L. M., Solomon, D., and Rosenberg, S. A. (1987). Expansion of human tumor infiltrating lymphocytes for use in immunotherapy trials. J . Immunol. Methods 102,127-141. Topalian, S. L., Solomon, D., and Rosenberg, S. A. (1989). Tumor-specific cytolysis by lymphocytes infiltrating human melanomas. J . Immunol. 142,3714-3725. Townsend, A. R. M., and Bodmer, H. (1989). Antigen recognition by class I-restricted T lymphocytes. Annu. Rev. Immunol. 7,601-624. Townsend, A. R. M., McMichael, A. J., Carter, N. P., Huddleston, J. A., and Brownlee, G . G. (1984). Cytotoxic T cell recognition of the influenza nucleoprotein and hemagglutinin expressed in transfected mouse L cells. Cell (Cambridge, Mass.) 39, 13-25. Townsend, A. R. M., Rothbard, J. M., Frances, M., Gotch, G., Bahadur, J., Wrath, D., and McMichael, A. J. (1986). The epitopes of influenza nucleoproteins recognized by cytotoxic lymphocytes can be defined with short synthetic peptides. Cell (Cambridge, MUSS.)44,959-968. Trauth, B. C., Klas, C., Peters, A. M., Matzku, S., Muller, P., Falk, W., Debatin, K. M., and Krammer, P. H. (1989).Monoclonal antibody-mediated tumor regression by induction of apoptosis. Science 245,301-305. Treves, A. J., Cohen, I. R., and Feldman, M. (1975). Immunotherapy of lethal metastases by lymphocytes sensitized against tumor cells in uitr0.J.Natl. Cancer Znst. (U.S.)54, 777-780.
354
PHILIP D. GREENBERG
Trinchieri, C. (1989).Biology of natural killer cells. Ado. lmmunol. 47, 187-376. Tsujimoto, M., Yip, Y. K., and Vilcek, J. (1985). Tumor necrosis factor: Specific binding and internalization in sensitive and resistant cells. Proc. Natl. Acad. Sci. U . S . A . 82, 7626-7630. Unanue, E. R. (1984). Antigen-presenting function of the macrophage. Annu. Reo. lmmunol. 2,395-428. Unanue, E. R., and Allen, P. M. (1987). The basis for the immunoregulatory role of macrophages and other accessory cells. Science 236,551-557. Urban, J. L., and Schreiber, H. (1983). Selection of macrophage-resistant progressor tumor variants by the normal host. Requirement for concomitant T cell-mediated immunity.]. E x p . Med. 157,642-656. Urban, J. L., Shepard, H. M.,Rothstein, J. L., Sugarman, B. J., and Schreiber, H. (1986). Tumor necrosis factor: A potent effector molecule for tumor cell killing by activated macrophages. Proc. Natl. Acad. Sci. U . S . A . 83,5233-5237. Van den Eynde, B., Hainaut, P., Herin, M., Knuth, A., Lemoine, C., Weynants, P., Van der Bruggen, P., Fauchet, R., and Boon, T. (1989). Presence on a human melanoma of multiple antigens recognized by autologous CTL. Int. J . Cancer 44,634-640. Vanky, F. T., Argov, S. A., Einhorn, S. A., and Klein, E. (1980). Role of alloantigens in natural killing. Allogeneic but not autologous tumor biopsy cells are sensitive for interferon-induced cytotoxicity of human blood lymphocoytes. J . E r p . Med. 151, 1151-1 165. Vose, B. M., and Bonnard, G. D. (1982). Human tumor antigens defined by cytotoxic and proliferating responses of cultured lymphoid cells. Nature (London)296,359-361. Wagner, H., Cotze, D., Ptschelinzew, L., and Rollinghoff, M. (1975). Induction of cytotoxic T lymphocytes against I-region-coded determinants: In oioo evidence for a third histocompatibility locus in the mouse. J . E x p . Med. 142, 1477-1487. Ward, B. A,, Shu, S., Chou, T., Perry-Lalley, D., and Chang, A. E. (1988).Cellular basis of immunologic interactions in adoptive T cell therapy of established metastases from a syngeneic murine sarcoma. J . Immunol. 141,1047-1053. Watts, T. H., Brian, A. A., Kappler, J. W., Marrack, P., and McConnell, H. M. (1984). Antigen presentation by supported planar membranes containing affinity-purified I-Ad. Proc. Natl. Acad. Sci. U . S . A. 81,7564-7568. Webb, D. R., Kapp, J. A., and Pierce, C. W. (1983).The biochemistry ofantigen-specific T cell factors. Annu. Reo. lmmunol. 1,423-438. Widmer, M. B., and Bach, F. H. (1981).Antigen-driven helper cell-independent cloned cytolytic T lymphocytes. Noture (London)294,750-752. Widmer, M. B., and Crabstein, K. H. (1987). Regulation of cytolytic T lymphocyte generation by B cell stimulatory factor. Nature (London)326,795-798. Wieland, F. T., Cleason, M. L., Serafini, T. A., and Rothman, J. E. (1987).The rate ofbulk flow from the ER to the cell surface. Cell (Combridge, Mass.) 50,289-300. Woods, G . , Kitagami, K., and Ochi, A. (1989). Evidence for an involvement of T4 t cytotoxic T cells in tumor immunity. Cell. Immunol. 118, 126-135. Wortzel, R. D., Urban, J. L., and Schreiber, H. (1984). Malignant growth in the normal host after variant selection in oitro with cytolytic T-cell lines. Proc. Natl. Acad. Sci. U . S . A. 81,2186-2190. Yamaki, T., Uede, T., Shijubo, N., and Kikuchi, K. (1988). Functional analysis of mononuclear cells infiltrating into tumors. 111. Soluble factors involved in the regulation of T lymphocyte infiltration into tumors. J . Immunol. 140,4388-4396. Yamasaki, T., Handa, H., Yamashita, J., Watanabe, Y., Namba, Y.,and Hanaoka, M. (1984).Specific adoptive immunotherapy with tumor-specific cytotoxic T-lymphocyte clone for murine malignant gliomas. Cancer Res. 44, 1776-1783.
ADOPTIVE T CELL THERAPY OF TUMORS
355
Yewdell, J. W., and Bennink, J. R. (1989). Brefeldin A specifically inhibits presentation of protein antigens to cytotoxic T lymphocytes. Science 244, 1072-1075. Yi, Li W., Lusheng, S, tour, A., Herberman, R. B., and Whiteside, T. L. (1989). Lymphocytes infiltrating human ovarian tumors: Synergy between tumor necrosis factor a and interleukin-2 in the generation of CD8+ effectors from tumor-infiltrating lymphocytes. Cancer Res. 49,5979-5985. Yoshioka, T.,Fukuzawa, M., Takai, Y., Wakamiya, N., Ueda, S., Kato, S., Fujiwara, H., and Hamaoka, T. (1986). The augmentation of tumor-specific immunity by virus help. 111. Enhanced generation of tumor-specific Lyt-l+2- T cells is responsible for augmented tumor immunity in oioo. Cancer Zmmunol. Zmmunother. 21,193-198. Yoshioka, T., Sato, S., Ogata, M., Sakamoto, K., Sano, H., Shima, J., Yamamoto, H., Fujiwara, H., and Hamaoka, T. (1988). Mediation of in oiuo tumor-neutralizing activity by Lyt-2+ as well as L3T4+ T cell subsets. Jpn. J . Cancer Res. 79,91-98. Young, J. D., and Cohn, Z. A. (1986). Cell-mediated killing: A common mechanism? Cell (Cambridge, Mass.) 46,641-642. Zaleski, M . , and Klein, J. (1978). Genetic control of the immune response to Thy-1 antigens. Zmmunol. Reo. 38, 120-162. Zangemeister-Wittke, U., Kyewski, B., and Schirrmacher, V. (1989). Recruitment and activation of tumor-specific immune T cells in situ. CD8+ cells predominate the secondary response in sponge matrices and exert both delayed-type hypersensitivitylike and cytotoxic T lymphocyte activity. J . Zmmunol. 143,379-385. Zinkernagel, R. M., and Doherty, P. C. (1979). MHC-restricted cytotoxic T cells: Studies on the biological role of polymorphic major transplantation antigens determining T-cell restriction-specificity, function, and responsiveness. Ado. Zmmunol. 27, 51177. This article was accepted for publication in June 1990.
This Page Intentionally Left Blank
ADVANCES IN IMMUNOLOGY,VOL. 49
The Development of Rational Strategies for Selective lmmunotherapy against Autoimmune Demyelinating Disease LAWRENCE STEINMAN Deparfments of Neurology and Neurological Sciences, Pediatrics, and Genetics, Stonford Univemity School of Medicine, Stonford, Colifomio 94305
1. Introduction
The pace of research on the pathogenesis and treatment of multiple sclerosis (MS), the principal human demyelinating disease of the central nervous system (CNS), has intensified in the past 3 years. In part, this is due to the application of advances in molecular biology, such as the polymerase chain reaction (PCR), and to developments in cellular immunology, such as technology for the growth of T cell clones. Many lessons that have been learned in an animal model of CNS demyelinating disease, experimental allergic encephalomyelitis (EAE), have been verified in the human disease MS. Indeed, certain successful approaches for treatment of EAE are being attempted in MS at the present time. Recent work on EAE in my laboratory has been the subject of extensive reviews in each of the last 2 years, 1989 and 1990, in Annual Reviews of Immunology (1,2) and elsewhere (3-6). The reader is kindly referred to these texts for background. This review describes the strong parallels that exist between T cell receptor (TCR) usage in the pathogenesis of EAE, and TCR usage in myelin basic protein (MBP)-specific T cells in the peripheral blood of MS patients (7-9) and in T cells in demyelinative plaques in MS brain (10). Based on these similarities, selective immunotherapy that targets either class I1 molecules of the major histocompatibility complex (MHC) or TCR-variable (TCR-V) regions will be described in EAE, with consideration given to application of these principles in MS. These new therapeutic approaches involve monoclonal antibodies (Mabs) directed to either HLA class I1 molecules or TCR-V region molecules, or peptides that compete with HLA class I1 molecules or vaccination against TCR-V regions. II. Multiple Epitopes of Myelin Basic Protein in Mice and Humans
Chronic EAE with relapses and remissions and with pathologic evidence of demyelination can be induced in mice with peptide frag357 Copyright 6 1991 by Academic Press, Inc. All rights of reproduction in any forni reserved.
358
LAWRENCE STEINMAN
ments of MBP (11-16). Other peptide fragments of MBP are also immunogenic, but instead of inducing disease these fragments can protect mice from the induction of EAE caused by a pathogenic fragment. Thus, not all immunogenic epitopes of MBP are pathogenic. In fact, some epitopes that are protective are actually immunodominant in comparison to pathogenic epitopes (17). The isolation of MBP-reactive T cell clones that mediate EAE facilitated the identification of individual encephalitogenic epitopes. The encephalitogenic T cell epitope within MBP 1-37 in H-2" mice was the first to be identified and has been characterized in greatest detail (11,12,18).In fact, within this epitope, the amino acids that contact the MHC and TCR have been deduced (19,20). We had initially observed that separate forms of native (intact) MBP, varying in their N-terminal sequences, differed in their ability to stimulate individual MBP clones that were encephalitogenic and responded to MBP fragment 1-37, restricted by I-A". In fact, bovine MBP, which is less encephalitogenic in PL/J mice, was less stimulatory than rat or mouse MBP. Because bovine MBP 1-37 differs from the mouse MBP 1-37 sequence at residues 2 and 17 only (Fig. l), we predicted that the epitope recognized by these clones would include one of these two residues (12). Using overlapping synthetic peptides containing these two residues, we determined that the encephalitogenic epitope was located within the first 11 residues. Peptides 1-11 and 1-16 were equipotent with intact rat or mouse MBP. Shorter peptides, pl-7 and pl-9, were less stimulatory (12). A few features of this T cell epitope were intriguing. First we noted that Acl-l1[4A], with an alanine-for-lysine substitution at position 4, produced a heteroclitic proliferative response compared to Acl-11 in encephalitogenic T cell clones reactive to the N terminus (18-20). Using a photoaffinity probe to measure direct binding to I-A", Wraith and co-workers showed that Acl-l1[4A] binds to I-A" with at least a 10-fold higher relative affinity when compared to Acl-11 (19,20). In contrast, peptides Acl-l1[3A] and Acl-ll[GA] did not stimulate T cell clones or T cell hybridomas reactive to Acl-11 (20). However, peptides Acl-l1[3A] and Acl-l1[6A] both significantly inhibited binding of the photoprobe to I-A" at 1000-fold molar excess. This implies that their inability to activate Acl-ll-reactive T cells reflects a defect in TCR interactions rather than in I-A" binding. To determine whether (PL/J X SJL)F1 mice possess T cells capable of responding to Acl-l1[3A] or Acl-l1[6A], they were immunized with these two substituted peptides as well as with the original Acl-11 peptide. Ten days later, their lymph node cells were stimulated in
359
AUTOIMMUNE DEMYELINATING DISEASE 10
20
RaVGuinea Pig MBP
Ac-AS O K R P S O R
H G SK Y L A T A S T M D H A R
Mouse MBP
Ac-
0
Bovine MBP
AC--A
(
-1
30 HG FL P R HR DTG I
S
FIG. 1. Amino acid sequences of the N-terminal portion of various myelin basic proteins from different species.
uitro with these same peptides. Peptide 89-101 was used as a negative control. When mice were immunized with Acl-11 they generated a good proliferative response when stimulated in vitro with Acl-11, but generated apoor response to either Acl-l1[3A] or Acl-ll[GA]. In the reciprocal experiment, mice immunized with Acl-l1[3A] generated a good proliferative response to Acl-l1[3A], but a very poor response to Acl-11. Similarly, mice immunized with peptide Acl-ll[GA] generated a good response to Acl-ll[GA], but a relatively poor response to Ac 1- 11. These results show that (PL/J x SJL)F1 mice are able to generate T cell responses to both Acl-l1[3A] and Acl-ll[GA], but that the majority of these responses are mutually non-cross-reactive with the response to Acl-11. They also explain why these substituted peptides failed to stimulate hybridoma 1934.4 and the panel of encephalitogenic T cell clones tested previously, even though they were able to bind to I-A". Taken together with the peptide binding analysis, these lymph node proliferation experiments show clearly that residues 3 and 6 of Acl-11 determine TCR interactions rather than I-A" interactions. MBP occurs naturally acetylated at its N terminus. Acetylation of residue 1, NAc-Ala, was essential for stimulation of all encephalitogenic clones that recognize the N terminus of MBP. Using a photoaffinity probe to measure direct binding of peptides to I-A", Wraith and co-workers showed that unacetylated 1-11[4A] (peptide 1-11, with alanine substituted at residue 4 for lysine) bound to I-A" weakly compared with Acl-l1[4A]. However, despite its decreased binding to I-A", unacetylated 1- 11[4A] effectively activated encephalitogenic T cell hybridoma 1934.4,which was produced by fusion of an encephalitogenic T cell clone reactive to Acl-11 and restricted by I-A" (20). Peptide 1-11 does not bind to I-A" or stimulate encephalitogenic T cell clones reactive to the N terminus of MBP (12). This implicates the N-acetyl group as a determinant important in interactions with I-A", but not absolutely necessary for effective TCR interactions. Taken
360
LAWRENCE STEINMAN
together, these data confirm the assignment of function to particular residues of Acl-11. Thus, Ac-Ala residue 1contacts the MHC, as does residue 4,Lys. Residues 3 and 6, Glu and Pro, interact with the TCR (Fig. 2). We have described other epitopes in the N-terminal region of MBP that are protective rather than pathogenic. Thus, PLSJ F1 mice immunized with MBP give better proliferative responses to AcN9-20 than to Acl-11. AcN9-20 can protect mice from EAE induced with Acl-11 ( vide infru ). AcN9-20 also elicited a stronger proliferative response in PLSJ mice than did pN35-47, which is encephalitogenic (21). A third epitope within the N terminus was identified. Nonencephalitogenic T cell clones isolated from homozygous PL/J or (PLSJ)F1 mice, restricted by Aa"Afi" or Aa"AF, respectively, recognize MBP 1-37 of rat or guinea pig MBP, but not mouse (self) MBP. Rat and guinea pig MBP contain His-10 and Gly-11, which are deleted in the mouse MBP sequence (Fig. 1). The epitope recognized by these clones is located within residues 9-16. Thus, in I-A" and in I-A"'s mice, certain peptides within the N terminus were encephalitogenic and others were immunogenic and protective (17). It is not clear what features of certain peptides render them encephalitogenic. Even encephalitogenic peptides do not always trigger EAE-inducing T cell clones that bear receptors for these peptides and that proliferate in response to them. We hypothesized that perhaps lymphokine activity in T cell clones could correlate with their pathogenicity. Thus, lymphokine activity in seven MBP-specific T cell clones was examined (22). All of these clones recognize MBP peptide AcN1-9. Five of these clones have the same VP and V a gene usage and exhibit similar Va-Ja and VP-DP-JP rearrangements (22). All of these clones were stimulated at similar concentrations of MBP, except one clone that proliferated at a 5- to 10-fold lower dose of NAcl-9. A strong positive correlation was found between levels of lymphotoxin (LT)and tumor necrosis factor-a! mRNA and the capacity of these clones to induce paralysis (22). No correlation was found
-
+
-
+
AC A - S - 0 - K - R P - S - 0 - R - H - G
' MHC interaction
+
TCR interaction
FIG.2. Putative interactions of N-terminal amino acids of myelin basic protein with TCR or MHC.
361
AUTOIMMUNE DEMYELINATING DISEASE
between interleukin-2 or interferon-y production and encephalitogenicity (22). Encephalitogenic fragments within p89-169 of MBP, the fragment that causes EAE in H-2s strains, have been identified. Epitopes were predicted using Rothbard's template for TCR recognition of peptide (23). The encephalitogenic epitope p89-101 contains the tetramer (HFFK) that Rothbard's guidelines predicted to be immunogenic (13,14). In contrast with the encephalitogenic response to the N terminus, there is more than one discrete population of encephalitogenic I-A" restricted T cells for SJL/J mice. Two distinct, overlapping encephalitogenic peptides were identified ( 13,14).One group of encephalitogenic clones recognizes both p89-101 and p89-100 ( 1 3 ~ 4 )The . clones recognizing p89-101 utilize the TCR gene Vpl7, whereas the p89-100 clones do not (13,14) (Table I). Both peptides p89-100 and p89-101 are encephalitogenic for SJL/J mice. Another encephalitogenic peptide in SJL/J mice, p96-109, was identified by Kono and colleagues (15)(Table I). Another I-AS-restrictedencephalitogenic epitope was discovered by Fritz and co-workers; an SJL/J MBP-specific T cell line that recognizes p17-27 causes EAE in recipient mice (16). Other cryptic encephalitogenic epitopes have been identified in H-2" mice. An epitope recognized by an encephalitogenic T cell clone, restricted to a hybrid I-E molecule (Table I), was identified. This T cell epitope, p35-47, contains sequence 42-45 RFFS, as predicted from Rothbard's template (23);p35-47 causes an EAE in H-2" mice that is as severe as that caused by MBP pNAcl-11. Thus, in Table I we enumerate seven immunologic epitopes of MBP in just two inbred mouse strains. The implications of this diversity of TABLE I MULTIPLEDISCRETE T CELLEPITOPES OF MYELINBASICPROTEIN Peptide
Encephalitogenic potential
Class I1 restriction
pl-11
+
Aa"Ai3"
p5-16 p17-27 p35-47 p89-100 p89-101 p96- 109
-
AaUAPL1, AaSAP Aa"Ap Ea"EP", Ea"EW AaSAp Aa'Ap AdAp
ND. Not determined.
?
+ + + +
VlX
VP
Va4.2 Va2.3 ND" ND ND ND ND ND
Vp8.2 Vp13 Vp8 ND Vp8VP17Vp17 ND +
362
LAWRENCE STEINMAN
encephalitogenic and nonencephalitogenic epitopes for outbred human populations will be discussed below. It should be noted that other myelin antigens, such as proteolipid protein (PLP),also cause EAE. A T cell line directed against PLP can adoptively transfer EAE. An encephalitogenic region, p139-151, has been identified for SJLIJ mice (24). Several groups have now identified immunogenic epitopes of MBP in MS patients and in healthy human controls. Hafler and colleagues defined the T cell specificity toward MBP in patients with MS, other neurologic diseases, and normal controls (8).Both MS patients and controls who were DR2,DQwl had T cell lines that proliferated to MBP 84-102, which included the encephalitogenic epitope for H-2s mice. The frequency of these lines was somewhat higher in MS patients (7.2 & 2.4%) compared to patients with other neurologic disease (4.1 1.0%)or normals (4.7 1.6%). A second region between MBP residues p143-168 elicited proliferation in T cell lines whose occurrence was equal among MS patients and controls. This epitope was associated with the DRwll phenotype. Significant but less striking increases in the frequency of reactivity to MBP residues 61-82 and 124-142 were also observed in MS patients. It is difficult to know whether an immunodominant epitope, determined by reference to its ability to proliferate and incorporate [3H]thymidine in response to antigen, would be pathogenic. Pathogenic epitopes are not always immunodominant, and immunodominant epitopes can be protective (17). Hafler and colleagues are acutely aware of these limitations and provide the following suggestions: _+
_+
To show that MS is a cell-mediated autoimmune disease analogous to EAE, certain criteria can be proposed. First, an association should exist between an immunodominant region of the presumed autoantigen and disease-associated MHC haplotypes (like HLA-DR2, DQwl]. Second, there should be an increase in frequency of T cells that react with this immunodominant epitope. Finally, the course of the disease must be altered by elimination of autoreactive T cells or by inducing immune tolerance to the autoantigen identified in the first two criteria. This final condition implies that in oitro experiments on their own cannot prove the association of an autoantigen with a disease, and instead clinical trials are necessary (8).
Martin and colleagues have obtained similar results in studies of cytotoxic T lymphocyte lines that recognize MBP and its fragments in association with HLA class I1 molecules. Both MS patients and healthy controls responded to MBP p87-106 in association with HLA-DR2 and DR4. Of note is that HLA-DR2,Dw2,DQwl and HLA-DR4(DQw7) share amino acid sequences between residues 71 and 83 of the third hypervariable region of the HLA-DQP chain. Martin and colleagues
AUTOIMMUNE DEMYELINATINC DISEASE
363
also described cytotoxic T cell lines recognizing MBP p154-172 in DR2 controls, in DR4 MS patients, and in DR6 individuals with MS and in controls. HLA-DR6,DQwG shares amino acid sequences with HLA-DR2 in the third hypervariable region of the HLA-DQP chain. The sequence p154-172 is encephalitogenic in monkeys (25), and p87-106 includes an encephalitogenic fragment seen in SJL/ J mice (13,14,16)and in Lewis rats (26).
111. Human and Rodent TCR Usage Restriction in T Cells Responding to Specific Epitopes of Myelin Basic Protein
The identification of multiple encephalitogenic epitopes of MBP indicated that the potential repertoire of MBP-specific T cells includes more than one population of T cells. However, the T cell response to each epitope appears limited to discrete populations of T cells. For example, encephalitogenic N-terminal MBP-specific T cell clones could not be distinguished from one another on the basis of their reactivity to peptides of MBP or class I restriction. Furthermore, there was a concordance between in vitro T cell recognition and encephalitogenic potential after active immunization. Both of these results suggested that the TCR repertoire of encephalitogenic N-terminal MBPspecific T cells in H-2” was limited. Recent advances in molecular biology have made it possible to examine the T cell receptor of individual T cells. With this technology it is possible to examine TCR gene expression of T cells mediating EAE, and to address whether T cells that appear phenotypically similar in their Ag/MHC recognition express common TCR genes. TCR gene expression has been examined for the encephalitogenic response to MBP 1-9 and MBP 89-101. A. THEENCEPHALITOGENIC N TERMINUS
TCR gene expression of MBP pl-9-specific T cells has been examined by three approaches: (1) cell surface staining with TCR VPspecific monoclonal antibodies; (2) Southern blot analysis, and (3)TCR gene sequencing. T cell clones from PL/J mice were initially stained with monoclonal antibodies specific for TCR VP8 (27-29). TCR VP8 is a three-member family of TCR genes encoding TCR (28,29) expressed b y several strains, including PL/J. This TCR gene family is deleted in certain strains, including SJL/J and SW/R. When a panel of 18 pl-9specific T cell clones isolated from 14 separate PL/J mice were stained with these antibodies, 14 (78%) expressed TCR VPS (30). This high percentage was a minimum estimate, as potential “sister” clones from
364
LAWRENCE STEINMAN
a single T cell line were excluded in this calculation. When all clones were included, 85% expressed TCR Vp8 (31). In many strains, inlcuding PL/J and BlO.PL, Vp8 is the predominant TCR Vp family expressed, accounting for 16-25% of peripheral T cells. Therefore, we asked whether the high frequency of usage ofTCR Vp8 was an in vitro cloning artifact, or whether it represented Vp8 usage in uiuo. Second, we examined whether the use of TCR Vp8 was specific for MBP 1-11. Lymph node cells from MBP 1-11-primed PLIJ mice were sorted by fluorescein-activated cell sorting (FACS) into CD4+lVP8+and CD4+/VP8- subpopulations. When stimulated i n uitro, >90% of the proliferative response to MBP 1-1 1occurred in the VpS' subpopulation. Thus, the high frequency of Vp8 usage was not a cloning artifact. Furthermore, I-E"-restricted encephalitogenic T cell clones specific for p35-47 are Vp8- (31).When p35-47-specific CD4+/ VpS' and CD4+/VP8- subpopulations were examined in primary cultures, the proliferative response occurred within the TCR Vp8- subpopulation (18).However, TCR Vp8 usage in the response to MBP is not specific for MBP 1-9. When independent I-A"-restricted T cell clones specific for the nonencephalitogenic epitope p5- 16 were examined with monoclonal antibodies specific for TCR Vp8, six of seven (84%) utilized TCR Vp8 (32).These results are also intriguing in that earlier studies by Morel (33)demonstrated that most Vp8' T cell clones specific for myoglobin were I-Ed restricted in DBAI2 (H-2d) mice. From their results, they suggested that V/38 usage correlated with I-E restriction. IfVp usage does correlate with class I1 restriction, based on our results, Vp8 expression may correlate with I-A restriction in PL/J mice. Heterogeneity in the T cell response to MBP 1-9 was further evaluated by molecular genetic techniques. By Southern blot analysis, Vp8.2 was identified as the TCR Vp gene used by Vp8' T cell clones (31,32). This was confirmed by the sequencing of TCR genes of eight MBP 1-9-specific T cell clones. Of these eight clones, seven utilized Vp8.2; one encephalitogenic clone expressed Vp4 (Table 11).There was less restrictive use of D p and Jp, with four clones utilizing Jp2.7, two using Jp2.3, and two clones expressing Jp2.5. Thus, the predominant Vp-Jp, expressed by four (50%) of these clones, was V8.2-Jp2.7. Even less heterogeneity was observed in a-chain gene usage. All eight clones used the same Va, Va4.3, a new member of the Va4 family [also referred to as VaPJR-25; see Acha-Orbea et al. (18)l.Six of these clones utilized JaTA31, one used JaTT11, and one used JaF1-12. The predominant Va-Ja, expressed by six (75%) clones, was Va4.3-JaTA31 (Table 11).Thus there was a striking degree of restriction in the a-and
AUTOIMMUNE DEMYELINATING DISEASE
365
TABLE I1 SUMMARYOF TCR SEQUENCES Clone
VP
JP
Va
Jff
8.2 8.2 8.2 8.2
2.7 2.7 2.7 2.7
PJR-25 PJR-25 PJR-25 PJR-25
TA31 TA31 TA31 TA3 1
8.2 8.2
2.3 2.3
PJR-25 PJR-25
TA31 TA3 1
8.2
2.5
PJR-25
T T ll
4
2.5
PJR-25
F1-12
Group 1
PJB-20 PJpR-2.2 PJpR-6.2 F1-21 Group 2 PJR-25 PJB-18 Group 3 PJpR-7.5 Group 4 F1-12
p-chain TCR gene usage in response to the encephalitogenic N terminus. TCR gene expression for MBP 1-9-specific T cells was examined in another H-2" strain, B1O.PL (34,35). This strain contains the same MHC, the H-2" haplotype, on a BlO background. As in PL/J mice, MBP 1-9 is encephalitogenic in BlO.PL, and pl-9-specific T cells are restricted by I-A" (12).Of 33 MBP 1-9-specific hybridomas, 79% utilized Vp8.2 with Jp2.7 (referred to as Jp2.6 or Jp2.7, depending upon whether or not the sixth J gene of the Jp2 cluster, a pseudogene, is considered in the numerical order) (32,36), and 21% used Vp13 with Jp2.2. Although p-chain gene usage was very similar to that seen for PL/J pl-9-specific T cell clones, a-chain gene expression was somewhat different. In contrast with the PL/J clones analyzed, all having used Va4.3, of the B1O.PL clones examined, 58% used Va2.3 and 42% expressed Va4.2. Both Va2.3- and Va4.2-bearing T cell hybridomas utilized the same J gene,ja39 (34,35). Within PL/J and B1O.PL mice, the expression of TCR genes in the MBP pl-9-specific response is quite strikingly limited. However, when comparing TCR gene expression in these two strains, certain differences are apparent. Even though Vp8.2 is used to the same extent by both strains, it is unclear why Va2.3, which was not expressed by any of the PL/J clones, was used more frequently than Va4 in B1O.PL mice. Polymorphic differences in TCR gene expression may exist among these strains. Clones expressing different V a genes may differ in their pl-Y/I-A" affinity. If so, they may differ in their proliferative capability and/or in uivo function.
366
LAWRENCE STEINMAN
Despite these differences in TCR V gene usage in PL/J and B1O.PL mice, in T cell clones recognizing MBP pl-9 in association with I-A”, there is a striking conservation of amino acid sequences in the Va-Ja junction and in the V@-D@-J@junction (18,35). C TERMINUS B. THEENCEPHALITOGENIC TCR gene usage in the encephalitogenic T cell response of SJL/J mice to the C terminus has been examined, although not as extensively as for MBP pl-9. The T cell response appears more complex. Three encephalitogenic peptides have been identified, p89-101, p89-100, and p96-109 (13-15). TCR V@ expression has been examined for T cells that respond to p89-101. Approximately 50% of T cells that proliferate in response to p89-101 also respond to p89-100. The other 50% require Pro-101 for stimulation. TCR V@gene expression for these two populations has been examined with a monoclonal antibody that recognizes Vp17, a single gene family expressed by several I-A+/I-Estrains, including SJL/J (37,38). Interestingly, all clones that recognize p89-101, but not p89-100, use TCRVP17. All clones that proliferate in response to p89-100 are V@17- (13). The TCR V@(s)expressed by Vp17- clones is not known at this time. Examination of TCR a-chain genes and further analysis ofthe @-chaingenes is currently in progress. Examination of susceptibility to EAE in different strains indicates that the MHC genotype, and not the TCR repertoire, controls susceptibility induced with MBP p89-101. H-2’ (1-As) strains SJL/J and A.SW, and H-2“ (I-A“) strains SW/R and BlO.T(GR), strains that differ in non-MHC genes, are all susceptible to EAE induced with MBP p89101.Sequence analysis of A a (39)and A@(40) suggest that I-As and I-Arl are very similar. Interestingly, SJL/J and SW/R have deleted approximately 50% of their VP genes, including V@S. However, these two strains express [email protected] contrast, ASW and BlO.T(GR) express V@8but not Vp17. Thus, susceptibility in this case does not correlate with the absence ofV@8or the expression ofVp17. By examination oftransgenic mice expressing various “susceptible” class I1 genes, it may be possible to assess the relative contribution of the MHC and the TCR repertoire in individual encephalitogenic responses.
C. EAE IN THE RAT The Lewis strain is the most extensively studied rat in EAE. In this strain, MBP p68-88 contains an encephalitogenic determinant, although another encephalitogenic epitope(s) probably exists (41). Encephalitogenic T cells specific for p68-88 are CD4+ and class I1 restricted, although there is some ambiguity in the identification of the
AUTOIMMUNE DEMYELINATING DISEASE
367
exact class 11-restricting element (42).Approximately 50% of CD4+ T cell clones raised against rat MBP are specific for p68-88 (42). The TCR composition of rat T cells specific for p68-88 has been examined by TCR sequencing of one clone and by subsequent probing of other clones by Northern and Southern analysis. The TCR data from the rat clearly support previous studies of MBP pl-9-specific T cells in H-2" mice, demonstrating a marked restriction in usage of Va and Vp in the T cell response to an individual encephalitogenic determinant (43).Of the p68-88-specific T cell hybridomas, 70% utilize the same Va gene and 100% express the same Vp gene. Interestingly, the V a gene is 77% homologous to Va2, one of two V a genes utilized by MBP pl-9specific mouse 'r cell clones. The Vp gene used by these clones is most closely related to mouse Vp8.2, sharing 80% homology. Although there is considerable homology between the V a and Vp genes used in rat and mouse T cell clones, rat T cells do not recognize MBP pl-9 on H-2" antigen-presenting cells (APCs), and conversely, mouse T cells do not respond to p68-88 cultured with rat APCs (43). Offner et al. (44) described an I-E-restricted sequence (p87-99) of rat MBP that is encephalitogenic in the Lewis rat. The TCR recognizing p87-99 in the context of I-E also appears to express Va2 and Vp8. Because of the similarity in Va and Vp gene usage among Lewis rats and H-2" mice, Heber-Katz (43) has suggested that TCR V-region usage is the critical determinant in EAE, independent of Ag/MHC. Although this hypothesis is intriguing, it does not account for all encephalitogenic T cell epitopes. In mice, multiple distinct encephalitogenic T cell epitopes include pl-9, p35-47, and p89-101. Thus, within one species, it is known that at least three separate Vp genes are used in encephalitogenic T cell responses to MBP (Table 11).Nevertheless, the TCR data from the rat clearly support previous studies of recognition of MBP pl-9 in H-2" mice in at least one aspect: there is a marked restriction in usage of V a and Vp in the T cell response to an individual encephalitogenic determinant. TCR usage has been studied by Hafler and colleagues in human peripheral blood-derived T cell clones that respond to epitopes on MBP (7). TCR usage in MS brain plaques has been evaluated by Oksenberg and colleagues (10).The Vp gene usage in 83 peripheral blood-derived T cell lines from MS patients and from healthy subjects reactive with MBP residues 84-102 was studied (7). One MS patient, Hy, who was HLA-DR2,DR7, had 24 out of 31 clones that used Vp17. Other p84-102-reactive clones from this patient used Vpl, Vp2, Vpll, Vp4, Vp7, and Vp14. A second MS patient who was also DR2,DR7 had one out of four clones utilizing Vp17, with Vp3, Vp4, Vp5, VPS,
368
LAWRENCE STEINMAN
and Vp8 being expressed in other clones from this patient (Fn). A DR2, DRwll MS patient responding to p84-102 used Vpl2, Vp17, Vpl, Vp2, and Vp7. A DR2,DR4 patient used Vpl2 and Vp17, as well as Vpl, Vp3, Vp5, Vp7, and Vp14. One control (DR2) responding to p84-102 used Vp17 in all five clones, and two other DR2 controls used Vpl2 and Vp5, and Vp6, Vp8, and Vp18, respectively. Comparison of the VDJ sequences of the six Vp17' T cell lines from subject Hy demonstrated only two different Dp sequences and only one Jp sequence, Jp2.l. T cell lines reactive to MBP p143-168 were studied in patients and controls. The DR2,Dwll patient who had other T cell lines responding to p84-102 used Vp14 in six of nine lines responding to p143-168. However, three other patients and two controls who had pl43-168-reactive T cell lines used Vp sequences other than Vp14 in the response to p143-168. These Vp genes included Vpl, Vp2, Vp3, Vp4, Vp5, Vp7, Vp8, Vpl2, and Vp17 (7). The identification of activated T cells in the brain of individuals with MS indicates that these cells are critical in the pathogenesis of this disease. In an attempt to elucidate the nature of the lymphocytic infiltration, we used the polymerase chain reaction (PCR) to amplify T cell antigen receptor V a sequences from transcripts derived from MS brain lesions. In each of three MS brains, only two to four rearranged TCR V a transcripts were detected. Va transcripts encoded by the Va12.1 region showed rearrangements to a limited number of Ja region segments. These results imply that TCR V a gene expression in MS brain lesions is restricted. Vp usage has also been studied in plaques from these patients. Vp usage included TCR Vp genes 5.1,5.2,7, and 18.Three Vp genes were expressed in each of these brains.
IV. Possibilities for Future Immune Intervention in Multiple Sclerosis
A. ANTIBODIESTO HLA CLASSI1 MOLECULES Nearly 60% of MS patients of Northern European Caucasoid background are HLA-DR2,DQwG (45). Comparison of nucleotide sequences in the membrane distal domain of DQp chains of haplotypes associated with susceptibility to MS reveals that the major subtypes [DR2,DQw6; DR4,DQw7; DR4,DQw8; DRw6,DQwG (18); and DRw6,DQwG (IS)]are identical or nearly identical for long stretches, including the highly polymorphic region encoding amino acids 71-83 (46).
AUTOIMMUNE DEMYELINATING DISEASE
369
1 . Prevention and Treatment of EAE with Anti-Class 11 Antibodies In 1981 it was demonstrated that EAE could be prevented by injection of anti-I-A prior to immunization with spinal cord homogenate (47). Anti-I-A treatment reduced the influx of radiolabeled lymphocytes that home to the CNS in EAE (48). When anti-I-A treatment is given after the first appearance of paralysis in EAE, mice return to normal within 48 hours. Anti-I-A treatment also reduced the number of relapses and mortality in chronic relapsing EAE (49). In rhesus monkeys, treatment of paralytic disease was successful with polymorphic mouse anti-HLA-DQ or HLA-DR antibodies that react with Rh-LAD (50).Therapy with monoclonal anti-class I1 antibodies is partially specific, blocking only responses restricted by a given class I1 isotype. Thus, although anti-I-A blocks EAE, experimental autoimmune myasthenia gravis (EAMG), and thyroiditis, in each of these diseases responses to purified protein derivative (PPD) were left intact (51,52).
2. Peptides that Block lnteraction of T Cells with the M H C EAE is a prototypic T cell-mediated autoimmune disease. MBP, a major component of myelin in the central nervous system, is one of the autoantigens capable of sensitizing encephalitogenic T cells. Several immunogenic determinants in MBP have been identified by using pepsin-digested peptides and synthetic oligopeptides. Although these determinants induce strong T cell immune responses in the context of a certain MHC class I1 molecule, not all the determinants are encephalitogenic. The N-terminal peptide AcN1-20 contains an 1-A"restricted, dominant encephalitogenic epitope. When the N-terminus of AcN1-20 is deacetylated, this peptide loses its encephalitogenicity. However, the immunogenicity of this deacetylated peptide, N1-20, still remains. Detailed mapping of T cell epitopes revealed the existence of another I-AU-restricted epitope, N9-16, within the deacetylated peptide, and this epitope was found to nonpathogenic. The known epitopes of MBP, their capacity to induce EAE, their MHC class I1 restriction, and the nature of the variable region gene of the T cell receptor /3 chain (Vp) are given in Table 111. It has been demonstrated that peptide fragments of antigenic proteins directly bind to the MHC class I1 molecule to be recognized by T cells. It has been suggested that a given MHC molecule has a single functional antigen-binding site. Peptides from unrelated antigens can compete with one another for T cell activation. Extending the observations, the possibility has been proposed that the relative immunodominance of an epitope might be determined in part by its affinity for the MHC class I1 molecule.
370
LAWRENCE STEINMAN
TABLE I11 DISCRETE T CELLEPITOPES OF MBP IN MICE Peptide AcN 1-20 N1-20 AcN9-16
N35-47 N89- 101 N89-100
Encephalitogenicity
+ c
-
+ t
+
Class I1 restriction I-AEA); I-AEA); I-AEA); I-AkAI; I-EEE); I-EEEj I-AzAj I-A;AsP
TCR" Vp usage
Vp8 predominantly Vp8 predominantly Vp8 predominantly Not known Not Vp8 Not Vp8 Vp17 predominantly Not Vp17
TCR, T cell antigen receptor.
Based on these findings we have attempted to see whether in uiuo competition between pathogenic and nonpathogenic self-peptides can be applied to the prevention of autoimmune disease. We first predicted which competitor peptides might be efficacious in viuo by screening their ability to block in uitro the stimulation of an encephalitogenic T cell clone that recognizes AcN1-20 with I-A". Peptides N 1-20 and AcN9-20 were shown to inhibit proliferative responses to the encephalitogenic peptide AcN1-11 both in uitro and in uiuo (17). AcN1-11 is a strong pathogenic peptide for PL/J and (PLSJ)F' mice, and T cells that can recognize this self-antigen mediate autoimmune encephalomyelitis in these strains of mice. The demonstration that peptide N1-20 can compete in the in uiuo induction of AcN 1-1 1-primed T cells suggested that this nonpathogenic peptide might be able to reduce the induction of autoaggressive T cells and thereby prevent EAE. Thus, the preventive effect of the competitor peptide N1-20 on induction of EAE with AcN1-11 was tested. As shown in Table IV, neither N1-11 nor AcN2-11 could prevent disease, even at a 6 : 1 ratio relative to AcN1-11, whereas injection of N1-20 significantly ( P < 0.001; Fisher's exact test) prevented the clinical development of EAE at a 3 : 1 ratio ( P < 0.001). In addition, AcN9-20 had a preventive effect on EAE at a 3 : 1 ( P < 0.001) or 6 : 1 ( P < 0.001) ratio. Injection of N1-20 at a 3 : 1 or 5 : 1 ratio did not prevent EAE induced with the I-A'-restricted peptide N89-101 in SJL/J mice. In reviewing representative sections of 20 mice treated with competitors (Nl-20 and AcN9-20), which did not show any clinical signs of EAE, no perivascular cuffs or submeningeal cell infiltrates were evident.
37 1
AUTOIMMUNE DEMYELINATING DISEASE
Further experiments with peptide inhibition have been performed. Peptide Acl-l1[4A] binds with greater affinity than does Acl-11 to I-A". Mice coimmunized with Acl-l1[4A] and Acl-11 were protected from EAE (20).Similar results were reported by Urban et al. (53). In a first experiment to test the protective effect of Acl-l1[4A] on EAE induction with Acl-11, Acl-l1[4A] completely inhibited disease induction, with 0 of 14 mice paralyzed compared with 8 of 13 control mice that were paralyzed ( P < 0.001) (20).In a second experiment, the protective effect of coimmunization with peptide Acl11[4A] was confirmed. The overall incidence of disease was substantially reduced ( P < 0.001), with 3 paralyzed out of 15 coimmunized mice, versus 14 of 15paralyzed control mice. The onset of disease was significantly delayed in the coimmunized group. Early disease began at day 8 in the control Acl-11 group. By day 14,9 of 15 control mice were paralyzed versus 0 paralyzed of 15 coimmunized mice ( P < 0.001). Late disease did not begin until day 16 in the coimmunized mice (20). TABLE IV PREVENTION OF EAE IN (PLSJ)F,AND SJL/J MICE WITH THE COMPETITOR PEFTIDES" Encephalitogen (nmol)
Mice
Competitor (nrnol)
Incidence of E A E ~
Day of onset
Severity
13.5 2 0.5 13.6 f 1.0
3.1 ? 1.1 3.0 f 1.2
15.1 f 1.7 11.0 17.4 t 0.5 17.0 15.0 2 1.5 12.0 2 0 12.6 5 0.6 15.2 5 2.1 15.8 2 1.6
2.9 t 1.2 2.0 3.8 ? 1.6 4.0 3.1 5 0.6 2.0 f 1.7 3.6 t 0.6 2.2 t 1.2 3.0 2 1.0
~
AcNl-ll(100)
PLSJFl
AcN1-ll(lO0)
PLSJFl
AcN1-ll(lO0)
PLSJFI
AcNl-ll(100)
PLSJFl
N89-101 (200)
SJL/J
N89-101(200)
SJLlJ
None AcN2-11 (600) N1-20 (600) None N1-20 (300) None AcN9-20 (600) None AcN9-20 (300) None N1-20 (1000) None N1-20 (600)
6/11 8/12 0/10* 10119 1/16* 5/11 1/12* 7/12 0/10* 3/14 319 4/11 518
Incidence of EAE is expressed as number of mice with clinical EAEhumber of mice immunized; day of onset as mean day of onset ? SD; severity as mean severity of sick mice SD. For the induction of EAE, mice were immunized with MBP peptide AcN1-I1 (100 nmol) or N89-101 (200 nmol) that had been dissolved in phosphate-buffered saline (PBS)and emulsified with complete Freund's adjuvant (CFA) in a 1 : 1mixture of PBS and CFA containing H37Ra. For prevention of EAE, the mixture included the competitor peptide (300,600,or loo0 nmol). On the same day and 48 hours later, pertussis toxin (List Chemicals) was injected intravenously. Mice were examined daily for signs of EAE and assessed for clinical severity, graded from 1to 5 as described (17). Some animals were killed 23-27 days after immunization for histological examination. *, Significant at P < 0.01 (x2 or Fisher's exact test).
372
LAWRENCE STEINMAN
B. ANTIBODIESTO TCR V REGIONMOLECULES The monoclonal antibody F23.1 depletes VP8' T cells from the peripheral blood (29). T cells reactive with Mab F23.1 constitute 25% of the T cells in lymph nodes of normal PL/J mice. In the (PLSJ)Fl mouse this percentage is 14%. The depletion of T cells reactive with Mab F23.1 is 98% complete 3 days after intraperitoneal (ip)administration of a dose of 0.5 mg (32). EAE was first induced with T cell clone PJR-25. This clone is fully encephalitogenic, capable of inducing paralysis and demyelination (11,54). PJR-25 expresses the epitope recognized by Mab F23.1 (31). Therapy was begun 24 hours after the mice first developed paralysis. In two experiments (PLSJ)F1 mice were randomly divided into two groups, with 16 mice each receiving two 100-pg injections of F23.1 ip at 72-hour intervals and 16 mice each receiving Mab L e u 9 b (S5.2),an isotype-matched control reactive with the CD2 antigen (a pan T cell marker on human but not on mouse T cells). Within 2-4 days, mice receiving F23.1 showed a marked reversal in their paralysis, and 13out of 16 were completely free of disease 10 days after therapy started. Only one relapse with tail weakness was seen, on day 35, in the animals given Mab F23.1. Next we tested whether EAE induced with pl-11 in complete Freund's adjuvant (CFA) in (PLSJ)Fl mice could be prevented with Mab F23.1. Immunization with MBP peptide pl-11 in CFA can induce clones that are both F23.1-positive and -negative and that are fully encephalitogenic. Successful prevention of disease with F23.1 would indicate that the F23.l-positive T cell clones predominate in the development of disease and that the depletion of these T cell clones in viuo would not simply result in an escape to F23.l-negative T cell clones that would cause disease. Results shown in Table V indicate that whereas 1 of 19 mice receiving Mab F23.1 developed EAE, 9 out of 20 mice given Mab S5.2 became paralyzed ( P < 0.001). These results serve to indicate that the Vp8-expressing clones function in the induction of EAE. (PLSJ)F1mice were immunized with guinea pig MBP. In (PLSJ)Fl mice there are at least two distinct encephalitogenic epitopes for MBP, pl-11 and p35-47. The response to p35-47 is restricted to I-EL'and involves mostly Vp8- T cells. After paralysis was present, mice were given 0.2 mg ip of the Mab F23.1 or KJ23,, a monoclonal antibody specific for the product of the TCR VP17, gene product (38,39).KJ23, prevents EAE induced with T cell lines responsive to MBP p89-101 in the SJL mouse. Of 19 (PLSJ)F1 mice given F23.1, 12 returned to
373
AUTOIMMUNE DEMYELINATING DISEASE
TABLE V PREVENTION OF MBP PEETIDE P1-I I-INDUCED EAE WITH Mab F23.1 ~~~
Monoclonal antibodya
Incidenceb
Clinical disease mean onset (day)
F23.1 S5.2
1/19 9/20
20 15'
a MabF23.1orS5.2 wasgivenip(500wg)ondays -1, 1, and 9; immunization with pl-11 was on day 0. The ratio of number of paralyzed mice to the total number of mice. All mice were examined through day 40. The standard deviation was 1.7days.
'
normal within 72 hours and 21 of 22 mice given KJ23, had moderate to severe paraplegia after 72 hours (Table VI). Relapses were seen in 5 of 19 F23.1-treated mice in the next 14 days. Thus, treatment with F23.1 reversed EAE in a situation wherein multiple encephalitogenic epitopes were present. VP8- T cells capable of responding to MBP pl-11 or P35-47 may have accounted for the relapses seen in the F23.1treated mice. In contrast, the SJL (I-As) mouse strain recognizes a peptide from MBP (p89-101) with at least three overlapping epitopes. There is evidence for limited TCR gene usage in recognition of one of these epitopes (15,16). However, depletion of this subset of T cells did not prevent antigen-induced EAE; elimination of a single V/3 subset, in a TABLE VI REVERSAL OF GUINEA PIGMBP-INDUCED EAE WITH Mab F23.1
Number of mice with clinical symptoms 72 hours after treatmentb Treatment" F23.1 KJ23a
Number of mice with clinical symptoms 14 days after treatment
None
Mild
Severe
None
Mild
Severe
Deaths
12 1
5 12
2 9
14 9
3 2
1
7
1 4
Treatment was begun 24 hours after mice exhibited EAE. At this time the mice were separated randomly into two groups. Mice in each group received one 2OO-pg ip injection of F23.1 or S5.2. Nineteen mice received F23.1 and 22 mice received KJ23a. 'Clinical status was graded as follows: none, no neurologic symptoms; mild, flaccid tail andlor mild paraparesis; severe, severe paraparesis or complete paraplegia.
374
LAWRENCE STEINMAN
polyclonal autoimmune disease such as this, may not be sufficient to prevent or reverse disease. C. VACCINATIONTO TCR V REGIONS Cohen and associates have shown that it is possible to use autoimmune T cell clones or lines as vaccines to prevent or reverse autoimmune disease. An inoculum of T cell clones below the threshold for triggering disease, or irradiated, fixed, or pressure-treated T cells, can serve as vaccines (55-58). The inoculated animals remained free of disease for prolonged times, and EAE could not be induced with T cell lines, T cell clones, or MBP in adjuvant. T cell clones specific for EAE-inducing T cells have been isolated from rats that recovered from EAE, suggesting an antiidiotypic mechanism for protection. These T cell clones are either CD4+ or CD8+. The CD8+ T cells lyse their targets specifically, and this cytotoxicity is not blockable with antiCD4, anti-CD8, anti-class I, or anti-class I1 antibodies. Recently, EAE in the Lewis rat was prevented by immunization with a nonapeptide spanning the V-D-J region of Vp8, expressed on about three-fourths of T cell clones recognizing encephalitogenic MBP p72-86 (59).Vandenbark and associates protected against EAE with a peptide from the CDR2 region of Vp8 (60). Highly selective therapies with antibodies or peptide directed against TCR or HLA class I1 molecules thus appear feasible for treatment of MS, especially because the elucidation of target TCR and HLA molecules is proceeding rapidly. It is worth noting that Teitelbaum and co-workers have treated EAE with a random copolymer (termed COPI) of tyrosine, alanine, lysine, and glutamate. This peptide was successfully employed in therapy of relapsing-remitting MS (61). COPI blocks MHC binding of MBP (62). Highly selective approaches with either monoclonal antibodies or peptides directed against TCR or HLA will be likely to involve several reagents per patient. Zaller and coworkers (63), and Sakai and coworkers (13) have noted that cocktails of monoclonal antibodies directed against different TCR V regions might be necessary to optimize antibody treatment. Thus, even the pathogenic response to a single epitope involves, in most cases, multiple TCRs, though one particular TCR may have a dominant influence on pathogenesis. In human diseases such as MS, the immune response, especially after disease is established, may involve multiple epitopes on several myelin antigens, including, but not limited to, MBP or PLP. In any case, it is likely that, given an individual patient's particular TCR repertoire and HLA type, therapy will be customized to a certain extent. Given the ease
AUTOIMMUNE DEMYELINATING DISEASE
375
with which it may now be possible to produce Mabs to human TCR V regions (64), and given current technologies to humanize and chimerize Mabs, it should not be difficult to envision being able to select from a set of humanized Mabs for any combination of TCR V a or V/3 chains that the physician wishes to target. A pharmaceutical company with such an armamentarium might be in an enviable position. Similarly, the formulation of peptide-based TCR vaccines should be feasible, again allowing for a physician to customize therapy from an available set of peptides from all human TCR V a or Vp regions. Finally, the design of pharmaceuticals that interfere with TCR-MHC interactions should be pursued vigorously in light of the success attained thus far with peptides that block TCR-MHC interactions in
EAE. ACKNOWLEDGMENTS The editorial assistance of T. Montgomery is appreciated. This work was supported by the National Institutes of Health, the National Multiple Sclerosis Society, and the Phil N. Allen Trust.
REFERENCES 1. Acha-Orbea, H., Steinman, L., and McDevitt, H. 0. (1989). T cell receptors in murine autoimmune diseases. Annu. Rev. Immunol. 7,371-405. 2. Zamvil, S., and Steinman, L. (1990). The T lymphocyte in autoimmune encephalomyelitis. Annu. Rev. Immunol. 8,579-621. 3. McDevitt, H. O., Wraith, D. C., Smilek, D., Lundberg, W., and Steinman, L. (1989). Evolution, function and utilization of major histocompatibility complex polymorphism in autoimmune disease. Cold Spring Harbor Symp. Quant. Biol.54,853-857. 4. Steinman, L. (1990). Genetic influences on neuroimmunologic disease. In “Transactions of the Association for Research in Nervous and Mental Disease” (B. Waksman, ed., pp. 11-14. Raven Press, New York. 5. Steinman, L. (1991). Multiple sclerosis and its animal models: The role ofthe major histocompatibility complex and the T cell receptor repertoire. In “Immunogenetics and Autoimmunity” (H. 0. McDevitt, ed.) (in press). 6. Wraith, D., and Steinman, L. (1991).New approaches to immunotherapy. In “Imniunogenetics and Autoimmunity” (H. 0. McDevitt, ed.) (in press). 7. Wucherpfennig, K., Ota, K., Endo, N., Seidman, J. G., Rosenzweig, A., Weiner, H. L., and Hafler, D. A. (1990). Shared human T cell receptor Vp usage to immunodominant regions of myelin basic protein. Science 248,1016-1019. 8. Ota, K., Matsui, M., Mildord, E., Mackin, G . ,Weiner, H. L., and Hafler, D. A. (1990). T cell recognition of an immunodominant myelin basic protein epitope in multiple sclerosis. Nature (London)346, 183-187. 9. Martin, R., Jaraquemada, D., Flerlage, M., Richert, J., Whitaker, J., Long, E. O., McFarlin, D. E., and McFarland, H. (1990). Fine specificity and HLA restriction of MBP-specific cytotoxic T cell lines from MS patients and healthy individuals. I . Immunol. 145,540-548.
376
LAWRENCE STEINMAN
10. Oksenberg, J. R., Stuart, S., Begovich, A. B., Bell, R., Erlich, H., Steinman, L., and Bernard, C. C. A. (1990).Limited heterogeneity of rearranged T cell receptor transcripts in brains of multiple sclerosis patients. Nature (London)345,344-346. 11. Zamvil, S., Nelson, P., Mitchell, D., Knobler, R., Fritz, R., and Steinman, L. (1985). Encephalitogenic T cell clones specific for myelin basic proterin: An unusual bias in antigen presentation. J. Exp. Med. 162,2107-2124. 12. Zamvil, S. S., Mitchell, D. J., Moore, A. C., Kitamura, K., Steinman, L., andRothbard, J. B. (1986). T cell epitope of the autoantigen myelin basic protein that induces encephalomyelitis. Nature (London)324,258-260. 13. Sakai, K., Sinha, A., Mitchell, D. J., Zamvil, S. S., McDevitt, H. O., Rothbard, J. B., and Steinman, L. (1988).Involvement of distinct T cell receptors in the autoimmune encephalitogenic response to nested epitopes of myelin basic protein. Proc. Natl. Acad. Sci. U.S.A.85,8608-8612. 14. Sakai, K., Zamvil, S. S., Mitchell, D. J., Lim, M., Rothbard, J. B., and Steinman, L. (1988).Characterization of a major encephalitogenic T cell epitope in SJL/J mice with synthetic oligopeptides of myelin basic protein. J. Neuroimmunol. 19,21-32. 15. Kono, D. H., Urban, J. L., Horvath, S. J., Ando, D. G., Saavedra, H. A., and Hood, L. (1988).Two minor determinants of myelin basic protein induce experimental allergic encephalomyelitis in SJL/J mice.J. E x p . Med. 168,213-227. 16. Fritz, R. B., Skeen, M. J., Chou, C.-H. J., and Zamvil, S . S. (1991).Localization ofan encephalitogenic epitope for the SJL mouse in the N-terminal region of myelin basic protein. J . Neuroimmunol. (in press). 17. Sakai, K., Mitchell, D. J., Hodgkinson, S. I., Zamvil, S. S., Rothbard, J. B., and Steinman, L. (1989). Prevention of experimental encephalomyelitis with peptides that block interaction of T cells with major histocompatibility complex proteins. Proc. Natl. Acud. Sci. U.S.A.86,9470-9474. 18. Acha-Orbea, H., Mitchell, D. J., Timmerman, L., Wraith, D. C., Waldor, M. K., Tausch, G . S., Zamvil, S. S., McDevitt, H. O., and Steinman, L. (1988). Limited heterogeneity of T cell receptors from lymphocytes mediating autoimmune encephalomyelitis allows specific immune intervention. Cell (Cambridge,Muss.)54,263273. 19. Wraith, D. C., McDevitt, H. O., Steinman, L., and Acha-orhea, H. (1989). T cell recognition as the target for immune intervention in autoimmune disease. Cell (Cambridge,Mass.) 57,709-715. 20. Wraith, D. C., Smilek, D. E., Mitchell, D. J., Steinman, L., and McDevitt, H. 0. (1989). Antigen recognition in autoimmune encephalomyelitis and the potential for peptide mediated immunotherapy. Cell (Cambridge, Mass.)59,247-255. 21. Zamvil, S., Mitchell, D., Moore, A,, Schwarz, A., Stiefel, W., Rothbard, J. B., and Steinman, L. (1987). T cell specificity for class I1 (I-A) and the encephalitogenic N-terminal epitope of the autoantigen myelin basic pr0tein.J. Immunol. 139, 10751079. 22. Powell, M. B., Mitchell, D., Lederman, J., Buckmeier, J., Zamvil, S. S., Graham, M., Ruddle, N. H., and Steinman, L. (1990). Lymphotoxin and tumor necrosis factoralpha production by myelin basic protein specific T cell clones correlates with eucephalitogenicity. l n t . lmmunol. 2,539-544. 23. Rothbard, J. B., and Taylor, W. R. (1988).A new sequence pattern common to T cell epitopes. E M B O J . 7,93-100. 24. Sato, J., Sakai, K., Endoh, M., Koike, F., Kunishita, T., Namikawa, T., Yamamura, T., and Tabira, T. (1987). Experimental allergic encephalomyelitis mediated by murine encephalitogenic T cell lines specific for myelin proteolipid apopr0tein.J. It?1mU710l. 138,179-184.
AUTOIMMUNE DEMYELINATING DISEASE
377
25. Karkhanis, Y. D., Carlo, D. J., Brostoff, S. W., and Eylar, E. H. (1975). Allergic encephalomyelitis. Isolation of an encephalitogenic peptide active in rhesus monkey.J. Biol. Chem. 250, 1718. 26. Vandenbark, A. A., Hashim, G. A., Celnik, B., Galang, X., Li, E., Heber-Katz, E., and Offner, H. (1989). Determinants ofhuman myelin basic protein that induce encephalitogenic T cells in Lewis rats.+/. Immunol. 143,3512. 27. Haskins, K., Hannum, C., White, J., Roehm, N., Kubo, R., Kappler, J., and Marrack, P. (1984).The antigen-specific major histocompatibility complex-restricted receptors on T cells. VI. An antibody to a receptor a1lotype.J. E x p . Med. 160,542-571. 28. Staerz, U. D., Rammensee, H.-G., Benedetto, J. D., and Bevan, M. J. (1985).Characterization of a murine monoclonal antibody specific for an allotype determinant on T cell antigen receptor. J . Immunol. 134,3994-4000. 29. Behlke, M. A., Henkel, T. J . , Anderson, S. J., Lan, N. C., Hood, L., Braciale, V. L., Braciale, T. J., and Loh, D. (1987).Expression of a murine polyclonal T cell receptor marker correlates with the use of specific members of the Vp8 gene segment subfamily. J . E x p . Med. 165,257-262. 30. Zamvil, S. S., Mitchell, D. J., Lee, N. E., Moore, A. C., Waldor, M. K., Sakai, K., Rothbard, J. B., McDevitt, H. O., Steinman, L., and Acha-Orhea, H. (1988). Predominant expression of a T cell receptor Vp gene subfamily in autoimmune encephalomyelitis. J . E x p . Med. 167, 1586. 31. Zamvil, S. S., Nelson, P. A., Steinman, L., and Mitchell, D. J. (1989). Treatment of autoimmune encephalomyelitis with an antibody to T cell receptor /3 chain. In “Cellular Basis o f Immune Modulation” (J. G. Kaplan, D. G. Green, and R. C. Bleackley, eds., pp. 461-464. Alan R. Liss, New York. 32. Burt, D. S., Mills, K. H. G., Skehel, J. J., and Thomas, D. B. (1989). Diversity of the class I1 (I-I”/I-Ek)-restrictedT cell repertoire and influenza hemagglutinin and antigenic drift. Six nonoverlapping epitopes on HA1 subunit are defined by synthetic peptides. I . E x p . Med. 170,383-397. 33. Morel, P. A., Livingstone, A. M., and Fathman, C. G. (1987). Correlation of T cell receptor Vp gene family with MHC restricti0n.J. E x p . Med. 166,583-589. 34. Urban, J. L., Kumar, V., Kono, D. H., Gomez, C., Horvath, S. J., Clayton, J., Ando, D. G., Sercarz, E. E., and Hood, L. (1988).Restricted use ofT cell receptor Vgenes in murine autoimmune encephalomyelitis raises possibilities for antibody therapy. Cell (Cambridge, Mass.) 54,577-592. 35. Kumar, V., Kono, D. H., Urban, J. L., and Hood, L. E. (1989). The T cell receptor repertoire and autoimmune diseases. Annu. Rev. Immunol. 7,657-682. 36. Fink, P. J., Matis, L. A., McEllingott, D. L., Bookman, M., and Hedrick, S. M. (1986). Correlation between T cell specificity and the structure of the antigen receptor. Nature (London)32,219-226. 37. Kappler, J. W., Wade, T., White, J., Kushnir, E., Blackman, M., Bill, J., Roehm, N., and Marrack, P. (1987).AT cell receptor Vp segment that imparts reactivity to a class I1 major histocompatibility complex product. Cell (Cambridge, Mass.) 49, 263271. 38. Kappler, J. W., Roehm, N., and Marrack, P. (1987).T cell tolerance by clonal elimination in the thymus. Cell (Cambridge, Mass.) 49,273-280. 39. Benoist, C. O., Mathis, D. J., Kanter, H. R., Williams, V. E., and McDevitt, H. 0. (1983). Regions of allelic hypervariability in the murine A a immune response gene. Cell (Cambridge, Mass.) 34, 169-177. 40. Estess, P., Begovich, A. B., Koo, M., Jones, P. P., and McDevitt, H. 0. (1986). Sequence analysis and structure-function correlations of murine q,k,u,s, and f haplotype I-AP cDNA clones. Proc. Natl. Acad. Sci. U.S.A. 83,3594-3598.
378
LAWRENCE STEINMAN
41. Happ, M. P., and Heber-Katz, E. (1987).Differences in repertoire of the Lewis rat T cell response to self and non-self myelin basic proteins. J . E x p . Med. 167,502-513. 42. Heber-Katz, E . , and Acha-Orbea, H. (1989). The V-region disease hypothesis: Evidence from autoimmune encephalomyelitis. Immunol. Today 10, 164-169. 43. Burns, F. R., Li, X., Shen, N., Ofher, H., Chou, Y. K., Vandenbark, A. A., and Heber-Katz, E. (1989).Both rat and mouse T cell receptors specific for the encephalitogenic determinants of myelin basic protein use similar V a and Vp chain genes. J . E x p . Med. 169,27-39. 44. Offner, H., Hashim, G. A., Celnik, B., Galang, A., Li, X., Burns, F. R., Shen, N., Heber-Katz, E., and Vandenbark, A. A. (1989).T cell determinants of myelin basic protein include a unique encephalitogenic I-E-restricted epitope for Lewis rats. J. E x p . Med. 170,355-367. 45. Tiwari, J. L., and Terasaki, P. I. (1985).“HLA and Disease Associations.” SpringerVerlag, New York. 46. Todd, J. A., Acha-Orbea, H., Bell, J. I., Chao, N., Fronek, Z., Jacob, C. O., McDermott, M., Sinha, A. A., Timmerman, L., Steinman, L., and McDevitt, H. 0.(1988). A molecule basis for MHC class 11-associated autoimmunity. Science 240, 1003-1009. 47. Steinman, L., Rosenbaum, J. T., Sriram, S., and McDevitt, H. 0. (1981). I n uiuo effects of antibodies to immune response gene products: Prevention of experimental allergic encephalitis. Proc. Natl. Acud. Sci. U.S.A.78,7111-71 14. 48. Steinman, L., Solomon, D., Zamvil, S., Lim, M., and Sriram, S. (1983).Prevention of EAE with anti-I-A antibody: Decreased accumulation of radiolabeled lymphocytes in the central nervous system. J . Neuroimmunol. 5 , 9 1 4 7 . 49. Sriram, S., and Steinman, L. (1983).Anti-I-A antibody suppresses active encephalomyelitis: Treatment model for IR gene linked diseases.J . E x p . Mcd. 158,1362-1367. 50. Jonkers, M., van Lambalgen, R., Mitchell, D., Durham, S. K., and Steinman, L. (1988). Successful treatment of EAE in rhesus monkeys with major histocompati1)ility complex class I1 specific monoclonal antibodies. J . Autoimmun. 1,399-414. and Steinman, L. (1983).In oiuo therapy 51. Waldor, M., Sriram, S., McDevitt, H. 0.. with monoclonal anti-I-A antibody suppresses immune response to acetylcholine receptor. Proc. Natl. Acad. Sci. U.S.A.80,2713-2717. 52. Vladutiu, A., and Steinman, L. (1987).Inhibition of experimental autoininiune thyroiditis in mice by anti-I-A antibodies. Cell. Zmmunol. 109, 169-180. 53. Urban, J., Horvath, S., and Hood, L. (1989). Autoimmune T cells: Immune recognition of normal and variant peptide epitopes and peptide-based therapy. Cell (Cambridge, Moss.)59,257-271. 54. Zamvil, S., Nelson, P., Trotter, J., Mitchell, D., Knobler, R., Fritz, R., and Steinman, L. (1985).T cell clones specific for myelin basic protein induce chronic relapsing EAE and demyelination. Nature (London)317,355. 55. Ben-Nun, A., Wekerle, H., and Cohen, I. R. (1981).Vaccination against autoimmune encephalomyelitis with T lymphocyte line reactive against myelin basic protein. Nature (London)292,60-61. 56. Holoshitz, J., Naparstek, Y., Ben-Nun, A., and Cohen, I. R. (1983). Lines of T lymphocytes induce or vaccinate against autoimmune arthritis. Science 219,56-58. 57. Maron, R., Zerubavel, R., Friedmann, R., and Cohen, I. R. (1983).T lymphocyte line specific for thryoglobulin produces or vaccinates against autoimmune thyroiditis in mice. J . Zmmunol. 131,2316-2322. 58. Lider, O., Reshef, T., Beraud, E., Ben-Nun, A., and Cohen, I. R. (1988). Antiidiotypic network induced by T cell vaccination against experimental autoimmune encephalomyelitis. Science 239, 181-183.
AUTOIMMUNE DEMYELINATING DISEASE
379
59. Howell, M . D., Winters, S. T., Olee, T., Powell, H. C., Carlo, D. J., and Brostoff, S. W. (1989). Vacccination against experimental allergic encephalomyelitis with T cell receptor peptides. Science 246,668-670. 60. Vandenbark, A. A., Hashim, G., and Offner, H. (1989). Immunization with a synthetic T cell receptor V-region peptide protects against experimental autoimmune encephalomyelitis. Nature (London)341,541-544. 61. Bornstein, M. B., Miller, A., Slagel, S., Weitzman, M., Crystal, H., Drexler, E., Keilson, M., Merriam, A., Wassertheil-Smoller, S., Spada, V., Weiss, W., Amon, R., Jacobsohn, I., Teitelbaum, D., and Sela, M. (1987). A pilot trial of Cop 1 in exacerbating-remitting multiple sclerosis. N. Engl. J. Med. 317,408-414. 62. Teitelbaum, D., Aharoni, R., Amon, R., and Sela, M. (1988). Specific inhibition of T cell response to myelin basic protein by experimental allergic encephalomyelitis suppressive Cop 1. Proc. Natl. Acad. Sci. U.S.A.85,9724-9728. 63. Zaller, D., Osman, G., Kanagawa, O., and Hood, L. (1990). Prevention and treatment of murine EAE with TCR VP-specific antibodies. J . E x p . Med. 171,1943-1955. 64. Choi, Y., Herman, A., DiGusto, P., Wade, T., Marrack, P., and Kappler, M . (1990). Residues ofthe variable region ofT cell receptor p-chain that interact with S. aureus toxin superantigens. Nature (London) 346,471-447.
This article was accepted for publication in September 1990.
This Page Intentionally Left Blank
ADVANCES IN IMMUNOLOGY, VOL 49
The Biology of Bone Marrow Transplantation for Severe Combined Immune Deficiency ROBERTSON PARKMAN Division of Reswrch Immunolagy/BoneMarrow Transplantation, Children%Hospital of Lor Angeles, and Pediatrics ond Microbiology, Univsrrity of Southem California School of Medicine, 10s Angeles, Colifomia wo54
1. Introduction
Allogeneic bone marrow transplantation for the treatment of infants with severe combined immune deficiency (SCID) has been a model system for many of the developments in clinical bone marrow transplantation during the last 20 years. The first successful human allogeneic bone marrow transplant was performed in a child with SCID in 1967; the first successful fetal liver transplant was reported in 1975; the first successful transplant with a histocompatible unrelated donor in 1977, and the first successful T lymphocyte-depleted histoincompatible bone marrow transplant in 1982 (1-5). Thus, transplantation in SCID patients has represented the first clinical application of many of the advances that have occurred in clinical bone marrow transplantation during the last 20 years. The biological problems present in the bone marrow transplantation of children with SCID, especially when histoincompatible bone marrow is used (i.e., lack of stem cell engraftment, graft-versus-host disease, posttransplant immune dysfunction) continue to present challenges in clinical bone marrow transplantation. II. Severe Combined Immune Deficiency
SCID was initially described as “the Swiss form of agammaglobulinemia” in a group of lymphopenic infants who had developed disseminated infections after vaccination with Bacille Calmette-Gukrin (BCC) (6).It is now clear, however, that SCID is not a single primary defect but is a clinical phenotype characterized by an absence of antigen-specific T and B lymphocyte immunity. At least a dozen different primary defects have been identified which can produce the SCID phenotype. As modern molecular genetic techniques improve, additional primary defects will be defined since at present the primary defect can be identified in less than 50% of SCID patients. The primary 381 Copyright 0 1991 by Academic Press, Inc.
All rights of reproduction in any form resewed.
382
ROBERTSON PARKMAN
defects in SCID represent a continuum starting with the absence ofthe pluripotent stem cell (reticular dysgenesis) and ending with the presence of phenotypically normal T lymphocytes capable of responding to mitogenic stimulation, but incapable of responding to specific antigenic stimulation. Abnormalities that occur at either the pluripotent or lymphoid stem cell level will result in an absence of both circulating T and B lymphocytes. Defects that occur later in T lymphocyte differentiation result in an absence of mature T lymphocytes with the presence of normal B lymphocytes, or the presence of dysfunctional T lymphocytes and normal B lymphocytes. The majority of SCID patients, therefore, have selective defects in T lymphocyte differentiation/function and have phenotypically and functionally normal B lymphocytes.
A. RETICULAR DYSCENESIS The most primitive defect that can produce the clinical phenotype of SCID is reticular dysgenesis, an autosomal recessive disorder, in which an absence of the pluripotent stem cell results in a lack of circulating lymphoid, erythroid, myeloid, and megakaryocytic elements (7).Affected infants suffer from infections due to the absence of both myeloid and lymphoid immunity. In addition to the usual infections from which SCID patients suffer (respiratory bacteria, viruses, fungi, and protozoa), patients with reticular dysgenesis suffer from infections with enteric bacteria as patients with neutropenia do.
B. ABSENCEOF LYMPHOID STEMCELL The initial patients described with severe combined immune deficiency (Swiss form of agammaglobulinemia) were lymphopenic and represented a selective absence of the lymphoid stem cell (6,8). The patients’ hematopoietic stem cells were normal, and, therefore, the patients had normal erythrocyte, granulocyte, and platelet counts. A primary defect at the lymphoid stem cell level results in the absence of both T and B lymphocytes, although natural killer (NK) cells can be present. The presence of NK cells in these patients, plus the determination that NK cells in adenosine deaminase (ADA)-deficient patients following the transplantation of ADA positive bone marrow are still ADA negative, indicates that NK cells are derived from the hematopoietic stem cell and not from the lymphoid stem cell.
C. ADENOSINEDEAMINASE DEFICIENCY The functional absence of the enzyme ADA is the most common definable cause of SCID (9). Twenty-five percent of all autosomal
BIOLOGY OF BONE MARROW TRANSPLANTATION
383
recessive cases of SCID are due to ADA deficiency. The patient’s leukocyte ADA levels vary (0.1-lo%),producing clinical heterogeneity. Most cases of ADA deficiency are due to point mutations leading to the presence of a dysfunctional enzyme (10,ll).Some point mutations have resulted in RNA that is rapidly degraded, resulting in the lack of detectable enzyme. A few cases ofADA deficiency are due to deletions of the ADA gene (12).The biological effects of ADA deficiency can be mimicked by the addition of the ADA inhibitor deoxycoformycin to cultures of pre-T lymphocytes (13).The absence of functional ADA results in the toxic accumulation of phosphorylated adenosine metabolites, particularly deoxyadenosine triphosphate (dATP) (14). The elevated levels of dATP and other phosphorylated nucleotides result in the inhibition of both ribonucleotide reductase and S-adenosylhomocystine hydrolase. The in uitro toxic effects of the deoxymetabolites are more pronounced in T, as compared to B, lymphocytes. Similar differences are presumed to exist in uiuo explaining why patients with ADA deficiency may have normal numbers of B lymphocytes but reduced numbers of T lymphocytes. In vitro improvement in nonspecific immunological function (mitogen responsiveness) has been observed following the incubation of peripheral blood leukocytes of some ADAdeficient patients with exogenous ADA (15).The in uitro improvement has been mirrored by in uiuo improvement in some ADA-deficient patients with the exogenous administration of ADA, including ADAcontaining human erythrocytes and polyethylene glycol-coupled bovine ADA (PEG-ADA) (16,17).Patients treated with exogenous ADA may have an increase in phenotypic T lymphocytes and the acquisition of mitogen responsiveness. However, few patients have developed adequate antigen-specific T and B lymphocyte function to protect them from exogenous infectious organisms. The patients who have responded have been older patients with higher endogenous levels of ADA, further demonstrating the clinical heterogeneity of the ADAdeficient form of SCID. Final conclusions concerning the potential role of exogenous ADA in the treatment of ADA-deficient SCID patients await further clinical investigation.
D. INTRATHYMIC DEFECTS DiGeorge syndrome is a congenital abnormality involving the third and fourth pharyngeal pouches, that can result in an absence of the parathyroid and thymus glands, midline cardiac defects, and facial abnormalities (18). The primary immunological defect in DiGeorge syndrome was felt to b e a quantitative decrease in the amount of thymic tissue resulting in a decrease in both the amount of thymic
384
ROBERTSON PARKMAN
stroma and the production of thymic hormones. In uitro incubation of peripheral blood leukocytes from DiGeorge patients with thymic hormones (thymosin, TP5, etc.) can result in an increase in the number of phenotypic T lymphocytes and of their proliferative responses to mitogenic stimulation (19).The in uitro improvements have been the basis for the clinical administration of thymic hormones to DiGeorge patients (20). In the majority of DiGeorge syndrome patients, there is no intrinsic abnormality of the lymphoid stem cells since the transplantation of fetal thymic stroma or the administration of thymic hormones results in the peripheral immunological reconstitution of patients with cells of recipient origin (21,22). The experiments of Gelfand and Pike, however, suggest that some forms of SCID are due to intrinsic defects of the thymus (23). The incubation of a patient’s bone marrow mononuclear cells with normal thymic stroma resulted in the appearance of phenotypically normal T lymphocytes, whereas incubations of the patient’s bone marrow with his or her own thymic stroma resulted in no improvement. These in uitro experiments, along with the clinical improvement seen in some SCID patients following the transplantation of thymic epithelium, suggest that the primary defect in some cases of SCID is due to an intrinsic defect of the thymic epithelium. The evaluation of the thymic stroma from such patients may demonstrate abnormalities in adhesion molecules necessary for normal positive and negative thymic selection (24,25). The presence ofTCR alp’, CD3+, CD4-, and CD8- autoreactive T lymphocytes in some SCID patients suggests that negative selection of autoreactive T lymphocytes may be defective (26).
E. INTERLEUKIN-I DEFICIENCY Interleukin-1 (IL-1) is produced by a large range ofcell types including monocytes and macrophages (27). In normal immunological function, processed antigen bound to the major histocompatibility complex is presented b y antigen-presenting cells (APC) to T lymphocytes through their antigen-specific T lymphocyte receptor (TCR). Costimulation with IL-1 produced by the APC is necessary for the initial activation of the antigen-specific CD4+ T lymphocytes, resulting in the production of IL-2. SCID patients with defects in IL-1 production have been identified. Monocytes from five SCID patients were incapable of IL-1 production after in uitro stimulation with lipopolysaccharide (28). In two cases, the defective IL-1 production was due to excessive prostaglandin production, since IL-1 production was normal after the addition of indomethacin. In four cases, the defect in IL-1 production appeared to be primary. Thus, the clinical phenotype of
BIOLOGY OF BONE MARROW TRANSPLANTATION
385
SCID can be produced by aprimary defect in macrophages/monocytes derived from the hematopoietic stem cell.
F. INTERLEUKIN-I RECEPTORDEFICIENCY The activation of T lymphocytes by IL-1 requires the specific interaction between IL-1 and its ligand receptor, the IL-1 receptor. A patient with SCID was identified whose T lymphocytes had defective or absent IL-1 receptors as determined by the inability of the patient’s T lymphocytes to absorb IL-1(29).The patient’s T lymphocytes could be normally activated when phorbol myristate acetate (PMA) was used as a costimulant. The inability of the patient’s T lymphocytes to be activated by IL-1 resulted in a patient with the SCID phenotype.
G . INTERLEUKIN-2 DEFICIENCY Interleukin-2 (IL-2) is the central lymphokine regulating the proliferation and differentiation of T lymphocytes. IL-2 is produced by a minority of mature T lymphocytes (5-15%). The IL-2 produced by the activated subpopulation is then capable of stimulating the proliferation and terminal differentiation of antigen-specific IL-2-dependent T lymphocytes expressing high-affinity IL-2 receptors. Patients have now been identified who have a selective inability to produce IL-2 (30).The phenotype of the patient’s circulating T lymphocytes is relatively normal, although a decrease in CD4+ T lymphocytes was seen in one case. A significant percentage (40%) of the peripheral blood T lymphocytes expressed IL-2 receptors in uiuo. Patients with a selective defect in IL-2 production displayed no in vitro proliferative responses to either mitogenic or antigenic stimulation; however, normal proliferative responses can be detected in the presence of exogenous IL-2. Analysis of the peripheral blood lymphocytes of the patients following in uitro stimulation with PMA and calcium ionophore showed the presence of RNA for y-interferon, but no transcripts for IL-2. Southern blot analysis showed the presence of an intact IL-2 gene. Clinical studies are presently under way to determine the role of recombinant exogenous IL-2 as therapy for the IL-2-deficient form of SCID.
H. INTERLEUKIN-2 RECEPTORDEFICIENCY Following activation, the majority of antigen-specific T lymphocytes express a series of new cell surface proteins including Class I1 histocompatibility antigens, the transferrin receptor, and the high-affinity IL-2 receptor. The presence of the high-affinity IL-2 receptor is necessary for the further proliferation and differentiation of the activated T
386
ROBERTSON PARKMAN
lymphocytes. The congenital inability to express the IL-2 receptor would, therefore, result in a lack of proliferation and terminal differentiation by T lymphocytes. A patient has been described whose cells, following in vitro activation with PHA, produced IL-2 and y-interferon normally, expressed normal levels of Class I1 histocompatibility antigens and transferrin receptors, but expressed no high-affinity IL-2 receptors (31).Southern blot analysis revealed the gene encoding the @chain of the IL-2 receptor to be present. The in vitro proliferative defect could not be corrected by the addition of IL-2 or other recombinant cytokines (IL-1, IL-4).
I. GENERALIZED ACTIVATION DEFECTS A heterogenous group of SCID patients has been described over the last 15 years in whom a generalized defect in lymphocyte activation has been demonstrated (32-35). When the patients’ T lymphocytes were stimulated with PHA or anti-CD3 antibody, lymphocyte activation as determined by an increase in intracellular calcium or the production of messenger RNA for cytokines such as IL-2, IL-4, GM-CSF, or y-interferon was not detected. Defects in activation can be due to abnormalities of the CD3-TCR complex, the transducing G proteins, or phospholipase C. Patients can be evaluated for defects at each step of activation. Many of the patients initially described as having “membrane abnormalities” probably represent defects of activation. In some cases, the defect can be bypassed by the addition of calcium ionophore (A23187 or ionomycin), indicating that the defect lies in the signal transduction mechanism, but that the cytoplasmic and nuclear mechanisms are intact. Ultimately, a series of primary defects in the signaling mechanism can be expected to be identified, all of which will result in defective activation. The patients with general activation defects differ from the patients in whom a selective defect in IL-2 production is present (35).
J. DEFECTSOF THE TCR-CD3 COMPLEX The antigen-specific activation of T lymphocytes requires triggering through the TCR. Effective signaling requires both a functional TCR molecule and a fully mature CD3 molecule. A SCID patient has been identified in whom abnormalities of the CD3 (-chain resulted in decreased surface TCR and CD3 expression(36). The intracellular assembly of the TCR alp-CD3 complex was normal; however, the defective CD3 <-chain production resulted in an inability of the TCR aIP-CD3 complex to be transported to the cell surface. The condition of the patient demonstrates that abnormalities in the CD3 molecule can re-
BIOLOGY OF BONE MARROW TRANSPLANTATION
387
sult in the clinical phenotype of SCID. Of interest is the fact that a sibling who is clinically well had the same biochemical abnormality, demonstrating that abnormalities of the CD3 (;-chain can produce a spectrum of clinical phenotypes.
K. ABSENCEOF CLASSI/CLASSI1 HISTOCOMPATIBILITY EXPRESSION (BARELYMPHOCYTE SYNDROME) The expression of Class I1 histocompatibility antigens by APC is necessary for the presentation of antigenic peptides. Patients who are congenitally unable to express Class I1 histocompatibility antigens, either alone or in conjunction with deficiencies in the expression of Class I histocompatibility antigens, present with defects of T and B lymphocyte immunity (37,38).The molecular basis of the lack of Class I1 histocompatibility expression has been characterized in one kindred (39). The patients’ B lymphocytes are affected at the transcriptional level and lack a specific Class I1 promoter-binding protein, RF-X. Multiple primary defects may lead to the absence of Class I1 histocompatibility expression; differences may exist between the molecular basis of the combined Class I and Class I1 deficiencies and the isolated Class I1 deficiency. At present, inadequate numbers of patients have been studied to determine if clinical differences exist between patients who have the combined effect and those who have a defect in only the expression of Class I1 histocompatibility antigens. IN ANTIGENPROCESSING L. DEFECTS
A group of SCID patients are characterized by phenotypically normal T lymphocytes, a normal proliferative response to stimulation with mitogen or allogeneic lymphocytes (mixed lymphocyte culture, MLC), but an absent response to stimulation with specific antigens. The patients are unable to respond to specific antigen stimulation in spite of recurrent infections with exogenous infectious agents [candida, herpes viruses (cytomegalovirus, herpes simplex, varicella-zoster)] or immunization (tetanus toxoid). The normal proliferative response to mitogenic stimulation, the normal production of IL-2, and normal IL-2 receptor expression suggest that no signaling defect exists and that the CD3-TCR complex is competent. The absence of antigen-specific proliferation may indicate that defects in antigen processing exist since both mitogens and allogeneic histocompatibility antigens can stimulate T lymphocytes without antigen processing, whereas antigens such as tetanus toxoid require antigen processing to produce antigenic peptide (40).
388
ROBERTSON PARKMAN
M. PERIPHERAL T LYMPHOCYTE DEFECTS Some SCID patients have increased numbers of CD3+, TCR y / 6 + T lymphocytes (41). The interrelationship between TCR alp- and ylbbearing T lymphocytes is still a source of controversy (42). The increase in TCR y / 6 + T lymphocytes may be compensatory to a primary defect in the maturation of TCR alp-bearing cells. Conversely, a primary defect may result in the selective production of TCR y/a-bearing cells. Even though CD3’ TCR y/6+ T lymphocytes are a normal component of the tissue T lymphocyte subpopulation (skin, gastrointestinal tract, vagina), they may have no protective function as circulating T lymphocytes. The primary defects that produce SCID can occur at many different steps during lymphoid differentiation, especially T lymphocyte differentiation. It is likely that additional primary defects, particularly in the area of lymphocyte activation and antigen processing, will be identified as our basic understanding of lymphoid differentiation increases. For example, no SCID patient has yet been identified who is the human equivalent of the SCID mouse, which is defective in the recombinase process for immunoglobulin and TCR gene rearrangements (43). Robert Good initially termed SCID patients as “experiments of nature”; each SCID patient represents the opportunity to define a specific defect in lymphocyte differentiation/filnction that results in clinical immunodeficiency. Thus, each SCID patient should be fully investigated to define their primary defect prior to transplantation.
111. Characteristics of Stem Cell Engraftment for the Correction of SCID
The initial bone marrow transplants for SCID patients consisted of the infusion of 50 x lo6 histocompatible nucleated bone marrow cells/ kg without pretransplant chemotherapy or posttransplant prophylaxis In such patients, immunocompeagainst graft-versus-host disease (44). tent T lymphocytes of donor origin, as determined by karyotypic analysis, could be identified by 2-3 weeks following transplantation. Although peripheral T lymphocyte chimerism was routinely detected, a lack of B lymphocyte chimerism was noted in many patients, especially those in whom host B lymphocytes were present prior to transplantation (45). Of particular importance was the fact that no engraftment of hematopoietic stem cells was seen following the transplantation of whole bone marrow (46).Bone marrow examination showed no spontaneously dividing cells with donor karyotype, and no peripheral erythrocyte chimerism was detected. The observations led
BIOLOGY OF BONE MARROW TRANSPLANTATION
389
to the conclusion that the successful transplantation of SCID patients could be achieved by the engraftment of only the lymphoid stem cell. Recent clinical experience, however, has shown that the engraftment of histocompatible normal lymphoid stem cells does not lead to the clinical correction of the patients’ underlying immunodeficiency in all SCID patients (28). In some cases, the engraftment of donor hematopoietic stem cells and the repopulation of the patient’s myeloid system with macrophage/monocytes of donor origin is required for correction of the patient’s underlying immunodeficiency (Table I). Patients with reticular dysgenesis can be successfully transplanted only if both hematopoietic and lymphoid stem cells engraft, since the engraftment of only lymphoid stem cells would result in a patient with persistent neutropenia, anemia, and thrombocytopenia (47). Since both hematopoietic and lymphoid stem cells are absent, the engraftment of both lymphoid and hematopoietic stem cells can be achieved without pretransplant cytoreduction. The correction of SCID patients due to the selective absence of the lymphoid stem cell can be corrected by the engraftment of only donor lymphoid stem cells. Posttransplant evaluation of such patients reveals that, while both T and B TABLE I STEMCELLENCRAFTMENT REQUIREDFOR CORRECTION OF SEVERE COMRINED IMMUNEDEFICIENCY Primary defect Reticular dysgenesis Absence of lymphoid stem cell ADA deficiency Intrathymic defect IL-1 deficiency IL-1 receptor deficiency IL-2 deficiency IL-2 receptor deficiency Activation defect TCR-CD3 complex defect Class I1 histocompatibility antigen deficiency Defective antigen processing Peripheral T lymphocyte defects
Lymphoid
Hematopoietic
+
+
+
-
+ + + + +
+ + + + +
-
+ + -
390
ROBERTSON PARKMAN
lymphocytes are of donor origin, the circulating hematopoietic elements (granulocytes, erythrocytes, and platelets) continue to be of recipient origin (46). Patients with ADA deficiency are routinely transplanted without cytoreduction if histcompatible bone marrow is transplanted (44).Following transplantation, T lymphocytes of donor origin can be identified, although B lymphocytes of recipient origin persist in some patients. Lymphoid stem cell engraftment has not been achieved in some ADA-deficient patients who were transplanted without pretransplant chemotherapy. After pretransplant cytoreduction, the patients have been successfully retransplanted, suggesting that the host’s immune system may have been the basis of the nonengraftment (48). Based upon the in vitro evidence that exogenous ADA can induce T lymphocyte differentiation, the infused bone marrow may provide a source of ADA that is capable of stimulating low levels of immunological function by the ADA-deficient recipient T lymphocytes (49).Alternatively, transplacentally-acquired maternal T lymphocytes may provide an ongoing source of ADA. The administration of cytotoxic agents prior to transplantation eliminates the recipient T lymphocyte precursors capable of responding to the exogenous ADA, permitting the engraftment of the donor lymphoid stem cells. Patients with IL-1 deficiency have been engrafted with donor lymphoid stem cells without correction of their in vivo proliferative responses or their clinical immunodeficiency (28). The lack of improvement seen following only donor lymphoid stem cell engraftment is due to the fact that the circulating macrophages/monocytes are still of recipient origin and are capable of normal IL-1 production. The successful correction of patients with the IL-1 deficient form of SCID, therefore, requires the engraftment of donor hematopoietic stem cells that can produce macrophages/monocytes capable of normal IL-1 production. The engraftment of donor hematopoietic stem cells requires that the recipient hematopoietic stem cells be ablated prior to transplantation by the administration or agents with adequate antihematopoietic stem cell activity, either total body irradiation or busulfan (50). Theoretically, it might be possible to correct the IL-l-deficient form of SCID by the selective engraftment of only donor hematopoietic stem cells. SCID due to defects in the IL-1 receptor would be correctable b y the engraftment of only the normal donor lymphoid stem cells since the patient’s monocytes are capable of normal IL-1 production. Patients with the IL-2 deficient form of SCID have been difficult to transplant due to the fact that the patients’ T lymphocytes are capable of normal proliferation and differentiation if an exogenous source of
BIOLOGY OF BONE MARROW TRANSPLANTATION
391
IL-2 is present (30). If the patients develop acute graft-versus-host disease following transplantation, phenotypically normal T lymphocytes of recipient origin can be detected. Following the termination of the graft-versus-host disease, the recipient-derived T lymphocytes disappear. A likely scenario is that the infused donor T lymphocytes, which initiate the graft-versus-host disease, produce IL-2, which is capable of supporting the proliferation and differentiation of the recipient T lymphocytes. The differentiated recipient T lymphocytes then reject the infused donor lymphoid stem cells, resulting in a lack of lymphoid stem cell engraftment and a return of the patient to the pretransplant immunodeficiency. IL-2-deficient SCID patients can be successfully transplanted only if they are cytoreduced prior to transplantation to eliminate the circulating T lymphocytes and the abnormal lymphoid stem cells. Patients with bare lymphocyte syndrome (defective Class I1 histocompatibility antigen expression) have been difficult to transplant successfully (37).A lack of lymphoid stem cell engraftment has been seen even after pretransplant cytoreduction. Further, the engraftment of only lymphoid stem cells would result in a patient with normal donor T lymphocytes, but the persistence of recipient macrophages/monocytes that were incapable of Class I1 histocompatibility expression. The persistence of the abnormal recipient macrophages/monocytes would mean that continuing defects in antigen presentation would be expected. Therefore, the complete correction of SCID patients with bare lymphocyte syndrome will require the engraftment of both donor lymphoid and hematopoietic stem cells so that following transplantation both lymphoid and hematopoetic elements have normal Class I1 histocompatibility antigen expression and normal antigen presentation. The majority of patients with DiGeorge syndrome can be corrected by the administration of thymic hormones or the transplantation of fetal thymic stroma; recently peripheral reconstitution in two patients has been reported following histocompatible bone marrow transplantation (51,52). At present, it is not clear whether the circulating donor T lymphocytes are derived from the engrafted donor lymphoid stem cells or from mature T lymphocytes that had differentiated in the donor prior to transplantation. SCID patients have received histocompatible peripheral blood transfusion with the persistence of mature donor T lymphocytes for 4 1/2 years, demonstrating that postthymic T lymphocytes may have prolonged in uiuo survival (53).The patient, described by Pyke and Gelfand, did not benefit from bone marrow transplantation since no intrinsic abnormality of the patient’s lymphoid stem cell existed (23). The successful correction of SCID due to intrinsic
392
ROBERTSON PARKMAN
abnormalities of the thymic stroma may require the transplantation of normal thymic stroma rather than the replacement of the lymphoid stem cells. IV. Histocompatible Bone Marrow Transplantation
During the last 23 years, histocompatible bone marrow transplantation has become the treatment of choice for all forms of SCID. Over 100 histocompatible transplants have been documented; the number is a minimal figure since not all histocompatible transplant attempts have been published. The review in 1977 by Kinney and Hitzig documented a 48% long-term survival with immunological reconstitution (54).In 1986, the European experience was reviewed by Fischer, who showed an increase to 68% in survival of histocompatible transplant recipients (55).Results from a single institution (Memorial Sloan Kettering) showed a 75%survival with immunological reconstitution (56). The improvement in the results of histocompatible bone marrow transplantation for SCID is d u e to several factors: (1) earlier diagnosis of the disease in at-risk families; (2) improvements in isolation techniques; (3)the prophylactic administration of antiPneumocystis carinii drugs; and (4)the introduction of effective antiviral agents, particularly for the herpes viruses (57-62). V. Transplantation with Fetal Tissues
Only a majority of children with SCID have histocompatible donors. Therefore, 75-80% do not have a histocompatible donor and cannot benefit from histocompatible bone marrow transplantation. T h e last 20 years are replete with attempts to develop techniques that would permit the successful immunological reconstitution of SCID patients who do not have histocompatible donors. Initial studies in murine systems demonstrated that fetal liver cells contained pluripotent stem cells that were capable of lymphoid and hematopoietic engraftment without fatal graft-versus-host disease (63-65). Based upon the murine studies, investigators throughout the 1970s attempted to transplant patients with SCID with unrelated histoincompatible fetal liver cells with or without fetal thymus. Keightley et al. reported the immunological reconstitution of a SCID patient following the transplantation of fetal liver cells (2,66).A review of the results with fetal liver transplantation has revealed that durable lymphoid engraftment was achieved in only one third of cases as demonstrated by karyotypic or HLA analysis (67).The rate of lymphoid engraftment was higher in individ-
BIOLOGY OF BONE MARROW TRANSPLANTATION
393
uals transplanted with fetal thymus in addition to fetal liver cells. In spite of lymphoid engraftment, most patients were unable to develop the antigen-specific T and B lymphocyte function necessary for immunological reconstitution. One potential problem associated with the engraftment of histoincompatible lymphoid stem cells was that no histocompatibility antigens were shared between the donor lymphoid cells and the hematopoietically derived recipient APC. Based upon murine experiments, the lack of shared histocompatibility antigens can result in an inability of the engrafted lymphoid cells to develop antigen-specific function (68,69). Because of the difficulties encountered with obtaining adequate numbers of fetal livers and thymuses and the observations of Pyke and Gelfand, that an intrinsic defect of the thymic stroma existed in one case of SCID, the use of cultured adult thymus was investigated by Hong and other investigators (70,71).Adult thymus glands were cultured to permit the death of the imunocompetent thymocytes. Following 14-21 days of culture, the residual thymic stroma was transplanted intraperitoneally to provide a source of normal thymic stroma. Antigenspecific immunological reconstitution was rarely achieved following the transplantation of cultured thymic epithelium. Many patients had mild cases of graft-versus-host disease (cutaneous erythema, elevation of hepatocellular enzymes) due to residual immunocompetent thymocytes; some patients developed B cell lymphomas (72). The residual transplanted thymocytes may have been capable of producing IL-2 and other cytokines, which could contribute to immunological function by recipient lymphoid cells. Since cloning techniques were not available in the 1970s to isolate functional T lymphocytes, the published immunological reconstitution studies were performed using karyotypic or HLA analysis. Thus, the immune reconstitution present in some patients might be due to the engraftment of mature donor T lymphocytes or to the effect of cytokines on the maturation of the patients’ defective lymphoid stem cells rather than due to the effects of the transplanted thymic stroma. VI. Bone Marrow Transplantation with T Cell-Depleted Haploidentical Bone Marrow
The lack of reproducible immunological reconstitution seen following transplantation of fetal liver cells or cultured thymus resulted in the focus of transplantation for SCID patients without histocompatible donors returning to the use of bone marrow. Murine studies demonstrated that graft-versus-host disease was preventable if histoincompa-
394
ROBERTSON PARKMAN
tible bone marrow was depleted of mature T lymphocytes b y either physical or immunological methods (73-78). Dickie and van Bekkum demonstrated that it was possible to physically separate the T lymphocytes capable of causing fatal graft-versus-host disease from the hematopoietic stem cells using bovine serum albumin (BSA) gradients (73). The introduction of antibodies to T lymphocyte-specific differentiation antigens permitted the complement-mediated lysis of histoincompatible bone marrow. These two techniques (i.e., physical separation and the immunologically-mediated destruction of T lymphocytes) were applied to clinical bone marrow transplantation in the early 1980s. In 1982, the successful transplantation in a child with SCID with histoincompatible bone marrow was reported; the mature T lymphocytes were depleted by the in uitro complement-mediated lysis of T lymphocytes by monoclonal antibody (T12) and rabbit complement (4). In 1983, Reisner et al. reported the successful transplantation in a patient with SCID using a combination of soybean agglutinin (SBA) and E-rosette formation (5).The investigators had previously demonstrated in both in uiuo and in uitro experiments that hematopoietic progenitors/stem cells were not agglutinated by SBA (79,80). The residual SBA-negative cells contained significant numbers of phenotypically mature T lymphocytes that could be removed by E-rosette formation. Throughout the 1980s, centers undertook transplantation in SCID patients using these two techniques. There has been center-to-center variation in results based on the quality of condition of the patients, expertise of the centers in the depletion techniques, and technique used. A direct comparison of the various techniques has revealed that the combination of SBA and E-rosette depletion produces a reproducible 2.5 to 3 log of depletion of functional T lymphocytes as determined by limiting dilution analysis (LDA) (81). The results with SBA-Erosette formation were superior to the results obtained with multiple E-rosette depletions, in uitro lysis with murine monoclonal antibodies and rabbit complement, lysis with rat monoclonal antibodies (CAMPATH-1) and human complement, treatment with ricin A-chain immunotoxins, or immunomagnetic bead-monoclonal antibody depletion. The only technique to have an efficiency equivalent to that of SBA-E-rosette depletion was the combination of SBA plus immunomagnetic bead separation (45). The principal problem associated with the immunological depletion techniques is that no human equivalent to the murine Thy antigen exists. Therefore, investigators have used single or multiple monoclonal antibodies to differentiation antigens found uniquely or preferen-
BIOLOGY OF BONE MARROW TRANSPLANTATION
395
tially on T lymphocytes (CD2, CD3, CD4, CD5, CD8) (82-85). However, all individuals have a small percentage of functional T lymphocytes that do not express the appropriate antigens. Thus, some (0.5-10%) peripheral blood T lymphocytes were not lysed. In addition, the efficiency of complement-mediated lysis is limited by the anticomplementary effects of the heparin that is routinely used as anticoagulant in the harvesting of the bone marrow (86). The use of immunotoxins circumvents many of the problems associated with complement-mediated lysis; however, methods to analyze the degree of depletion prior to the bone marrow being infused into the patient do not exist since only functional assays can determine the efficiency of the immunotoxin treatment (87). A review of centers using murine monoclonal antibodies and complement to deplete T lymphocytes has shown a 50-70% survival rate with T lymphocyte reconstitution of patients transplanted with histoincompatible bone marrow (85).The principal causes of failure in patients transplanted with monoclonal antibody-treated T lymphocyte-depleted haploidentical bone marrow are acute graft-versus-host disease and stem cell nonengraftment. Centers not using immunological techniques for T lymphocyte depletion have focused their efforts on the physical separation techniques (5,88-92). The use of the SBA-E-rosette formation technique has the advantage that the procedure is more reproducible from centerto-center and is not dependent upon surface characteristics that may be absent from some functional T lymphocytes. SBA-E-rosette depletion reproducibly results in a 99.0-99.5% depletion of phenotypic T lymphocytes as determined by fluorescence-activated cell sorter (FACS) analysis. Most of the phenotypic T lymphocytes present following depletion are nonfunctional as determined b y LDA. The reproducible expression of the appropriate surface glycoproteins, the lack of governmental approval requirements and the greater degree of T lymphocyte depletion achieved by the SBA-E-rosette formation technique has resulted in the majority of SCID patients undergoing transplantation by physical depletion techniques. A review by O’Reilly et al. of both Memorial Sloan Kettering results and world-wide results of SBA-E-rosette depleted haploidentical transplantation for SCID patients revealed a 67% survival rate with immune reconstitution of patients transplanted at Memorial Sloan Kettering and 73% survival rate in the world-wide experience (45). The SBA-E-rosette formation technique results are slightly superior to those reported using the immunological techniques. However, since significant differences in patients may exist (disease status, primary defect, use of pretransplant cytoreduction, etc.), no definitive state-
396
ROBERTSON PARKMAN
ment about which technique is superior can be made. The principal cause of failure in SCID patients transplanted with SBA-E-rosette T lymphocyte-depleted haploidentical bone marrow is a lack of stem cell engraftment. VII. lack of Stem Cell Engraftment
Results of T lymphocyte-depleted haploidentical transplantation for SCID patients using either the physical or immunological depletion techniques has revealed that a lack of lymphoid stem cell engraftment is the single most frequent cause of transplantation failure. Analysis of leukemia patients transplanted with T lymphocyte-depleted bone marrow has shown that the failure of stem cell engraftment was due to recipient-derived CD8+ T lymphocytes with specificity for Class I histocompatibility antigens uniquely expressed on donor cells (93,94). T lymphocyte-mediated rejection is not the basis for the lack of stem cell engraftment in most SCID patients since their disease is characterized by a lack of functional T lymphocytes. In cases of SCID due to IL-2 or ADA deficiency, it is possible that the infused bone marrow cells may provide factors (IL-2 or ADA) that enable the recipient T lymphocytes to differentiate into cytotoxic T lymphocytes (CTL) capable of rejecting the infused bone marrow (30,49). However, in most SCID patients, the prerequisites for the T lymphocyte-mediated rejection of the infused bone marrow do not exist. Analysis of SCID patients, in whom stem cell nonengraftment has occurred following transplantation without pretransplant cytoreduction, has shown that the presence of normal NK cell function (lysis of K562 cells, as opposed to only the presence of phenotypic NK cells) and/or an absence of IL-1 production correlates with the lack of engraftment (28,45). The relationship between a lack of 1L-1 production by monocytes and normal NK function is not clear. Since NK cells are derived from the hematopoietic rather than the lymphoid stem cell, it is not surprising that many SCID patients have normal NK function. In addition, some SCID patients have an increased percentage of CD3+, CD4-, CD8- T lymphocytes expressing either TCR alp or y/6, which have NK activity (26,41). The high incidence of stem cell nonengraftment in SCID patients without pretransplant cytoreduction has resulted in some centers routinely administering pretransplant chemotherapy to SCID patients who have normal NK function. The pretransplant chemotherapy must include agents capable of ablating both the lymphoid and hematopoietic stem cells. The administration of agents with only antilymphoid stem cell activity (antithymocyte globulin and/or cyclophos-
BIOLOGY OF BONE MARROW TRANSPLANTATION
397
phamide) may be inadequate. The only agents that have adequate antihematopoietic stem cell activity are total body irradiation and busulfan (50).Because of clinical hesitancy to use total body irradiation in children less than 18 months of age due to the potential deleterious effects of the irradiation on the developing nervous system, busulfan is the most commonly used antihematopoietic stem cell agent. Not all centers agree that the presence of NK cells is predictive of nonengraftment (48). The disagreement may be due to the fact that some centers have determined the presence of NK cells by phenotypic rather than functional analysis. The lack of stem cell engraftment seen in SCID patients with normal NK function is reminiscent of murine hybrid resistance, in which the transplantation of homozygous bone marrow into irradiated F1 recipients resulted in a lack of hematopoietic stem cell engraftment (95-98). Recently, Dennert et al. have described a population of CD3+, double-negative T lymphocytes with NK function that can mediate hybrid resistance in mice (99). The presence of analogous CD3' double-negative T lymphocytes in some SCID patients may represent a human model for hybrid resistance. The mechanism of nonengraftment in SCID patients differs from that found in leukemic patients and is more like hybrid resistance than classic T lymphocyte-mediated rejection. Besides using pretransplant chemotherapy to ablate residual host cells capable of mediating graft rejection, some investigators have used monoclonal antibodies to leukocyte adhesion molecules (anti-HLFA) to block the activity of recipient NK and NK-like cells (100).An increased rate of stem cell engraftment has been achieved following anti-HLFA antibody administration as compared to historical controls. VIII. Graft-versus-Host Disease
The incidence of graft-versus-host disease following T lymphocytedepleted haploidentical transplantation is related to the degree of T lymphocyte depletion (101). Patients transplanted with bone marrow depleted by antibody-mediated lysis techniques have a higher incidence of acute graft-versus-host disease than patients transplanted following physical separation technique; in addition, recipients of physically separated bone marrow have no published incidence of chronic graft-versus-host disease. In an analysis of T lymphocytedepleted histocompatible transplant recipients, Kernan et al. demonstrated that the transplantation of more than 1 x lo5 functional T lymphocytes/kg resulted in acute graft-versus-host disease, whereas the transplantation of less than 1 X lo5 functional T lymphocytes/kg
398
ROBERTSON PARKMAN
resulted in a low likelihood of acute graft-versus-host disease. Thus, the production of clinically evident acute graft-versus-host disease requires a threshold or minimal number of immunocompetent T lymphocytes as previously demonstrated in murine models (102,103). A unique biological event that occurs in SCID patients is the development of graft-versus-host disease due to transplacentally-derived maternal T lymphocytes. Some SCID patients present 1-2 weeks following birth with acute graft-versus-host disease characterized by cutaneous erythema and elevated hepatocellular enzymes, which can progress to bone marrow aplasia and death. Most patients develop a chronic dermatitis or hepatitis. HLA typing of peripheral blood leukocytes or T lymphocyte clones can demonstrate the presence of maternal T lymphocytes (104,105). Maternal T lymphocytes can also be identified in some patients without clinically evident graft-versus-host disease, suggesting that the persistence of maternal T lymphocytes is a frequent event in SCID patients. The maternal T lymphocytes have no in vitro responsiveness to stimulation with mitogens or recipientspecific histocompatibility antigens indicating that tolerance has been induced (106). IX. Tolerance
The lack of graft-versus-host disease following T lymphocytedepleted haploidentical bone marrow transplantation indicates that the donor-derived T lymphocytes develop tolerance to histocompatibility antigens uniquely expressed on recipient cells. Murine experiments have indicated that clonal deletion is the primary mechanism of tolerance following bone marrow transplantation (107-109). Investigation of human transplant recipients has shown that the donorderived T lymphocytes present in chimeric recipients are unable to respond to recipient histocompatibility antigens expressed on recipient-derived Epstein-Barr virus-infected B lymphoblast cell lines or cryopreserved pretransplant recipient leukocytes ( 1 10-1 12). Further, CTL or CTL precursors cannot be identified after in vitro stimulation with recipient cells. Coculture experiments have demonstrated that the donor-derived T lymphocytes present in the recipient are unable to suppress the reactivity of fresh donor T lymphocytes to recipient antigens, demonstrating that an active suppressor mechanism does not exist. The results suggest that donor-derived T lymphocytes, capable of responding to the unique recipient histocompatibility antigens, were eliminated during negative thymic selection that occurred during the recapitulation of immunological ontogeny that oc-
BIOLOGY OF BONE MARROW TRANSPLANTATION
399
curs following transplantation (113,114). The results in human transplant recipients are, therefore, similar to those of murine chimeric recipients. The persistence of tolerance requires the continued presence of the histocompatibility antigens to which the T lymphocytes are tolerant. The loss of tolerance by maternal T lymphocytes to unique paternal histocompatibility antigens were detected after the loss of a paternal graft (115). A recent evaluation of renal transplant recipients has shown that CTL precursors are present in individuals without mixed lymphocyte culture reactivity or detectable CTL (116).The CTL precursors were present in normal frequencies, but there was no IL-2 production. The selective absence of IL-2-producing T lymphocytes resulted in a lack of mixed lymphocyte culture responsiveness and CTL development. Although donor-derived T lymphocytes with specificity for recipient antigens cannot be detected following successful bone marrow transplantation, T lymphocytes with specificity for donor antigens (autoreactive T lymphocytes) have been identified by many investigators, indicating that the normal immunoregulatory mechanisms, including the intrathymic elimination of autoreactive T lymphocytes and the production of autoregulatory cells, may not be present following transplantation (110,117-120). X. Posttransplant lmmunocompetence
Whereas SCID patients transplanted with histocompatible bone marrow develop circulating immunocompetent T lymphocytes of donor origin by 2-3 weeks following transplantation, recipients of T lymphocyte-depleted haploidentical bone marrow require a longer period before functional T lymphocytes of donor origin can b e demonstrated (45,121-123). The delay before the appearance of functional T lymphocytes in haploidentical, as compared to histocompatible, transplant recipients suggests that the immunocompetent, donor-derived T lymphocytes seen following histocompatible transplantation may have differentiated within the donor. The removal of T lymphocytes from the transplantation inoculum means that the immune function seen following T lymphocyte-depleted transplantation is dependent upon a recapitulation of immunological ontogeny by the donor lymphoid stem cells. T h e immunological function seen in the SCID recipients of T lymphocyte-depleted haploidentical bone marrow parallels normal fetal immunological ontogeny more closely than it does the immunological reconstitution seen following histocompatible transplantation (124-128). I n patients without acute graft-versus-host disease, pheno-
400
ROBERTSON PARKMAN
typic T lymphocytes are usually first seen 2-3 months following transplantation, a time similar to the appearance of phenotypic T lymphocytes in the fetal thymus at 8-12 weeks of gestation (124,127). Initially the phenotypic T lymphocytes have no function (mitogen responsiveness, etc.) even if an exogenous source of IL-2 is provided. Three to six months following transplantation, a mitogenic response can be detected, initially with exogenous IL-2 and later without exogenous IL-2, demonstrating that there is a delay in the development of IL-2producing T lymphocytes as compared to the IL-2 responsive subpopulation. Limiting dilution analysis has demonstrated quantitative defects in helper T lymphocytes of transplant recipients more than 1 year following transplantation (129). Patients vary as to when they first demonstrate antigen-specific T lymphocyte function. I n some forms of SCID (IL-1 deficiency, bare lymphocyte syndrome), hematopoietic, in addition to lymphoid, engraftment is required before immunological reconstitution is achieved. Initially, no antigen-specific responses can be demonstrated in vitro in spite of immunizations with antigens, such as tetanus toxoid, or persistent antigenic stimulation with naturally occurring antigens, such as Candida albicans or cytomegalovirus. The lack of antigenspecific immunological responsiveness, in the context of normal mitogen-induced proliferation, parallels normal fetal immunological ontogeny. Further, normal TCR alp heterogeneity may not initially exist following transplantation, limiting the spectrum of antigens to which patients can respond. Previous analysis has shown limited heterogeneity in immunoglobulin production following bone marrow transplantation; an analogous limitation in the heterogeneity of TCR alp usage may exist (44,130). Present dogma states that both T and B lymphocytes are derived from a single lymphoid stem cell (131). Successful immunological reconstitution of SCID patients with preexisting B lymphocytes transplanted with histocompatible bone marrow has resulted in T lymphocytes being of donor origin and the persistence of the recipient B lymphocytes (91). The presence of split lymphoid chimerism suggests that the T and B lymphocytes are derived from separate lymphoid stem cells. The circulating T lymphocytes are selectively derived from the engrafted donor lymphoid stem cells, while the recipient B lymphocytes are uniquely derived from the recipient lymphoid stem cells. The resolution of the question of whether there are one or two lymphoid stem cells awaits further investigation. The use of retrovirally mediated gene insertion into murine lymphoid stem cells may provide a model to elucidate whether one or two lymphoid stem cell populations exist (132).
BIOLOGY OF BONE MARROW TRANSPLANTATION
40 1
Significant differences exist between B lymphocyte function in transplant recipients reconstituted with histocompatible as opposed to T lymphocyte-depleted haploidentical bone marrow. In SCID patients without B lymphocytes, the e n g r a h e n t of histocompatible donor lymphoid stem cells results in both T and B lymphocytes being of donor origin (45).Patients display normal immunoglobulin production and a normal capacity to produce specific antibody, normal isotype switching, etc., once immunological ontogeny is complete (133). In recipients with preexisting B lymphocytes, the recipient B lymphocytes can persist, and a dichotomy exists. Patients transplanted with histocompatible bone marrow have normal B lymphocyte function, while the histoincompatible recipients have abnormal B lymphocyte function (45,54).In the histoincompatible recipients, the donor T lymphocytes appeared to be incapable of interaacting effectively with the recipient B lymphocytes resulting in low immunoglobulin levels and an inability to make specific antibody as is seen in murine SCID recipients (134). However, since the capacity of the engrafted donor T lymphocytes to cooperate in vitro with donor B lymphocytes is unimpaired, the functional defect may reside in the recipient B lymphocytes. The defect may be at the level of the T and B lymphocyte interaction or is an intrinsic abnormality of the B lymphocytes. Evaluation of posttransplant B lymphocytes has shown them to be unresponsive when cocultured with normal donor T lymphocytes while the donor-derived T lymphocytes can stimulate normal donor B lymphocytes (45).While intrinsic B lymphocyte abnormalities are present in a minority of histocompatible recipients, they are present in the majority of haploidentical recipients with persistence of recipient B lymphocytes (123). Some investigators have attributed the lack of responsiveness of the recipient B lymphocytes to their developmental immaturity
(135). The successful transplantation of SCID patients with either fetal liver cells or T lymphocyte-depleted histoincompatible bone marrow presents an opportunity to determine the histocompatibility restrictions, if any, of human T and B lymphocyte interactions. Eleven years following successful transplantation with fetal liver cells, the analysis of a SCID patient, who shared no histocompatibility antigens with the donor, has demonstrated that donor-derived T lymphocyte clones could respond to specific antigen in the context of recipient, but not donor, histocompatibility antigens (136). Further, T lymphocyte clones derived from the recipient of a T lymphocyte-depleted haploidentical maternal bone marrow transplant initially responded to tetanus toxoid in the context of both maternal and paternal histocompatibility antigens (137,138). As the monocytes and tissue macro-
402
ROBERTSON PARKMAN
phages became exclusively of maternal origin, the specificity of newly derived T lymphocyte clones became restricted to histocompatibility antigens found only on the patient’s maternally-derived hematopoietic cells; no reactivity to antigen presented in the context of paternal histocompatibility antigens was detected. The histocompatibility restriction of the patient’s T lymphocytes had evolved as the origin of the patient’s hematopoietic cells changed. Both of these studies indicate that the histocompatibility restrictiorr of antigen presentation is determined by the histocompatibility antigens of the host’s hematopoietic system, rather than by the host’s somatic cells. Thus, the hematopoietic-derived dendritic cells within the thymus define the histocompatibility restriction of the T lymphocytes rather than the epithelial cells of the thymus (108,134). XI. Conclusions Patients with SCID represent a model in which to evaluate human lymphoid function/differentiation. Although multiple defects in immunological function/differentiation are theoretically possible, SCID patients define which defects can produce clinical immunodeficiency. Bone marrow transplantation is curative for SCID patients. The problems encountered in the bone marrow transplantation of SCID patients represent the major problems associated with bone marrow transplantation, particularly when histoincompatible donors are used.
ACKNOWLEDGMENTS The assistance of Drs. Kenneth Weinberg and Donald Kohn in the review of the manuscript and of Mrs. Deborah L. Carroll in the preparation of the manuscript is gratefully acknowledged.
REFERENCES 1. Gati, R. A., Meeuwissen, H. J., Allen, H. D., Hong, R., and Good, R. A. (1968).
Inimunological reconstitution of sex-linked lymphopenic immunological deficiency. Lancet 2,1366-1369. 2. Keightley, R. G., Lawton, A. A,, and Cooper, M. (1975).Successful fetal liver transplantation in a child with severe combined immunodeficiency. Lancet 2, 850-853. 3. O’Reilly, R. J., Dupont, B., Pahwa, S., Grimes, E., Smithwick, E. M., Pahwa, R., et al. (1977). Reconstitution in severe combined immunodeficiency by transplantation of marrow from an unrelated donor. N. Eng1.J. Med. 297, 1311-1318. 4. Reinherz, E.,Geha, R.,Rappeport, J. M., Wilson, M., Penta, A. C., Hussey, R.E., et al. (1982).Reconstitution after transplantation with T-lymphocyte-depleted HLA haplotype-mismatched bone marrow for severe combined immunodeficiency. Proc. Natl. Acad. Sci. U.S.A. 79,6047-6051.
BIOLOGY OF BONE MARROW TRANSPLANTATION
403
5. Reisner, Y., Kapoor, N., Kirkpatrick, D. et 01. (1983). Transplantation for sever combined immunodeficiency with HLA-A,B,D,Dr incompatible parental marrow fractionated by soybean agglutinin and sheep red blood cells. Blood 61,341-348. 6. Hitzig, W. H., and Willi, H. (1961). Hereditare lymphoplasmocytase dysginesie. Schweiz. Med. Wochenschr.91,1625-1633. 7. De V a l , 0.M., and Seyhaeve, V. (1959).Reticular dysgenesia. Lancet 2,113-1125. 8. Hitzig, W. H., Landolt, R., Muller, G., and Bodner, P. (1971). Heterogeneity of phenotypic expression in a family with Swiss-type agammaglobulinemia: Observations in the acquisition of agammaglobulinemia. J. Pediatr. 78,968-980. 9. Giblett, E. R., Anderson, J. E., Cohen, F. et al. (1972). Adenosine-deaminase deficiency in 2 patients with severely impaired cellular immunity. Lancet 2,10671069. 10. Valerio, D., Dekker, B. M. M., Duyvesteyn, M. G. C. et al. (1986).One adenosine deaminase allele in a patient with severe combined immunodeficiency contains a pair mutation abolishing enzyme activity. EMBOJ. 5, 113-119. 11. Bonithron, D. T., Markham, A. F., Ginsburg, D., and Orkin, S. H. (1985).Identification of a point mutation in the adenosine deaminase gene responsible for immunodeficiency. J . Clin. Invest. 76,894-897. 12. Marked, M. L., Hershfield, M. S., Wiginton, D. A. et al. (1987). Identification of a deletion in the adenosine deaminase gene in a child with severe combined immunodeficiency. J. lmmunol. 138,3203-3206. 13. Ballet, J-J., Insel, R., Merler, E., and Rosen, F. S. (1976).Inhibition ofmaturation of human precursor lymphocytes by coformycin, an inhibitor of the enzyme adenosine deaminase. J . Erp. Med. 143, 1271-1276. 14. Carson, D. A,, Kaye, J., and Seegmiller, J. E. (1977). Lymphospecific toxicity in adenosine deaminase deficiency and urine nucleoside phosphorylase deficiency. Possible role of nucleoside kinase(s). Proc. Natl. Acad. Sci. U.S.A.74,5677-5681. 15. Polmar, S. H. (1979). Enzyme replacement and other biochemical approaches to the therapy of adenosine deaminase deficiency. Ciba Found. Symp. 68,213. 16. Polmar, S. H., Stern, R. C., Schwartz, A. L. et al. (1976). Enzyme replacement therapy for adenosine deaminase deficiency and severe combined immunodeficiency. N . Engl. J . Med. 295,1337-1343. 17. Hershfield, M. S., Buckley, R. H., Greenberg, M. L. et al. (1987). Treatment of adenosine deaminase deficiency with polyethyene glycol-modified adenosine deaminase. N . Eng1.J.Med. 316,589-596. 18. Lischner, H. W., Punnett, H. H., and DiCeorge, A. M. (1967). Lymphocytes in congenital absence of the thymus. Nature (London)214,580-582. 19. Touraine, J. L., Incefy, G. S., Touraine, F. et al. (1974).Differentiation of human bone marrow cells into T lymphocytes by in uitro incubation with thymic extracts. Clin. E x p . Immunol. 17, 151-158. 20. Wara, D. W., Coldstein, A. L., Doyle, N. E. et al. (1975). Thymosin activity in patients with cellular immunodeficiency. N . Engl. J . Med. 292,70-74. 21. Cleveland, W. W., Fogel, B. J., Brown, W. T. etal. (1968).Fetal thymic transplant in a case of DiCeorge’s syndrome. Lancet 2,1211-1214. 22. August, C. S., Rosen, F. S., Filler, R. M., Janeway, C. A., Markowski, B., and Kay, H. E. M. (1968). Implantation of fetal thymus, restoring immunological competence in a patient with thymus aplasia (DiCeorge’s syndrome). Lancet 2,12101211. 23. Pyke, K. W., Dosch, H. M., Ipp, M. M., and Gelfand, E. W. (1975).Demonstration of an intrathymic defect in a case of severe combined immunodeficiency disease. N . Engl. J. Med. 293,424-428.
404
ROBERTSON PARKMAN
24. Vollger, L. W., Tuck, D. T., Springer, T. A., Haynes, B. F., and Singer, K. H. (1987). Thymocyte binding to human thymic epithelial cells is inhibited by monoclonal antibodies to CD-2 and LFA-3 antigens. J . lmmunol. 138,358-363. 25. Marrack, P., and Kappler, J . (1987). The T cell receptor. Science 238, 1073-1079. 26. Wirt, D. P., Brooks, E. G., Vaidya, S., Klimpel, G . R., Waldmann, T. A., and Goldblum, R. M. (1989). Novel T-lymphocyte population in combined immunodeficiency with features of graft-versus-host disease. N . Engl. J . Med. 321,370-374. 27. Durum, S. K., Schmidt, J. A., and Oppenheim, J. J. (1985). Interleukin 1: An immunological perspective. Annu. Reo. lmmunol. 3, 263-287. 28. Sahdev, I., O’Reilly, R., and Hoffman, M. K. (1989). Correlation between interleukin-1 production and engrafhnent of transplanted bone marrow stem cells in patients with lethal immunodeficiencies. Blood 73,1712-1719. 29. Chu, E., Rosenwasser, L. H., Dinarello, C. A., Rosen, F. S., and Geha, R. S. (1984). Immunodeficiency with defective T-cell response to interleukin 1. Proc. Natl. Acad. Sci. U.S.A.81,4945-4949. 30. Weinberg, K., and Parkman, R.(1990). Severe combined immune deficiency due to a specific defect in interleukin-2 production. N . Eng1.J.Med. 322, 1718-1723. 31. Weinberg, K. I., Pam, T., Annett, G. M. et al. (1989). Severe combined immune deficiency (SCID) due to defective interleukin 2 receptor a (IL2Ra) expression. Pediatr. Res. 25, 170a. 32. Yount, W. J., Utsinger, P. D., Whisnant, J., and Folds, J. D. (1978). Lymphocyte subpopulations in X-linked severe combined inimunodeficiency (SCID). Am. 1. Med. 65,847-854. 33. Gehrz, R. C., McAuliffe, J . J., Linner, K. M., and Kersey, J. H. (1980). Defective membrane function in a patient with severe combined immunodeficiency disease. C h . Exp. Immunol. 39,344-348. 34. Chatila, T., Wong, R.,Young, M., Miller, R., Terhorst, C., and Geha, R.S. (1989).An immunodeficiency characterized by defective signal transduction in T lymphocytes. N . Engl. J . Med. 320,696-702. 35. Pahwa, R., Chatila, T., Pahwa, S. et a1. (1989). Recombinant interleukin 2 therapy in severe combined immunodeficiency disease. Proc. Natl. Acad. Sci. U.S.A.86, 5069-5073. 36. Alarcon, B., Regueiro, J. R.,Arnaiz-Villena, A., and Terhorst, C. (1988). Familial defect in the surface expression of the T-cell receptor-CD3 complex. N . Engl. J . Med. 319,1203-1208. 37. Touraine, J. L., Betuel, H., Souillet, G., and Jeune, M.(1978). Combined imniunodeficiency disease associated with absence of cell surface HLA-A and B antigens. J . Pediatr. 93,47-51. 38. Hadam, M. R.,Dupfer, R., Peter, H. H., and Niethammer, D. (1984). Congenital agammaglobulinemia associated with lack of expression of HLA-D region antigens. In “Progress in Immunodeficiency Research and Therapy” (C. Griscelli and J. Vussen, eds.), pp. 43-50. Excerpta Medica, Amsterdam. 39. De Preval, C., Hadam, M. R.,and Mach, B. (1988). Regulation of genes for HLA class I1 antigens in cell lines from patients with severe combined immunodeficiency. N . Eng1.J.Med. 318,1295-1300. 40. Mellins, E., Smith, L., Apr, B., Cotner, T., Celis, E., and Pious, D. (1990). Defective processing and presentation of exogenous antigens in mutants with normal HLA class I1 genes. Nature (London)343,71-74. 41. Morio, T., Nagasawa, M., Nonoyania, S., Okawa, H., and Yata J.-I. (1990) Phenotypic profile and functions of T cell receptor-$-bearing cells from patients with primary immunodeficiency syndrome. J . Immunol. 144,1270-1275.
BIOLOGY OF BONE MARROW TRANSPLANTATION
405
42. Faure, F., Jitsukawa, S., Triebel, F., and Hercend, T. (1988). Characterization of human peripheral lymphocytes expressing the CD3-y/6 complex with antireceptor monoclonal antibodies. J . Immunol. 141,3357-3360. 43. Schuler, W., Weiler, I. J., Schuler, A. et al. (1986). Rearrangement of antigen receptor genes is defective in mice with severe combined immune deficiency. Cell (Cumbridge,Muss.) 46,963-972. 44. Parkman, R., Gelfand, E. W., Rosen, F. S., Snaderson, A., and Hirschhorn, R. (1975). Severe combined immunodeficiency and adenosine deaminase deficiency. N. Engl. J . Med. 292,714-719. 45. O’Reilly, R. J., Keever, C. A., Small, T. N., and Brochstein, J. (1989). The use of HLA-non-identical T-cell-depleted marrow transplants for correction of severe combined immunodeficiency disease. Immunodejic. Rev. 1,273-309. 46. Stiehm, E. R., Lawlor, G. J., Kaplan, M. S. et 01. (1972).Immunologic reconstitution in severe combined immunodeficiency without bone marrow chromosomal chimerism. N. Eng1.J. Med. 286,797-803. 47. Levinsky, R. J., and Tiedman, K. (1983). Successful bone-marrow transplantation for reticular dysgenesis. Lancet 1,671-673. 48. Fischer, A., Ledeist, F., Durandy, A. et al. (1983).Heterogeneity of immunologic and enzymatic deficiencies in the familial reticuloendotheliosis syndrome. Birth Defects, Orig. Artic. Ser. 19,317-319. 49. Polmar, S. H., Wetzler, E. M., Stern, R., and Hirschhorn, R. (1975).Restoration of in-vitro lymphocyte responses with exogenous adenosine deaminase in a patient with severe combined immunodeficiency. Lancet 2,743-746. 50. Parkman, R., Rappeport, J. M., Hellman, S. e t al. (1984). Busulfan and total body irradiation as antihematopoietic stem cell agents in the preparation of patients with congenital bone marrow disorders for allogeneic bone marrow transplantation. Blood 64,852-857. 51. Goldsobel, A. B., Haas, A., and Stiehm, R. (1987).Bone marrow transplantation in DiGeorge syndrome. J. Pediutr. 111,40-44. 52. Borzy, M. S., Ridgway, D., Noya, F. J., and Shearer, W. T. (1989). Successful bone marrow transplantation with split lymphoid chimerism in DiGeorge Syndrome. J. Clin. Immunol. 9,386-392. 53. Polmar, S. H., Schacter, B. Z., and Sorensen, R. U. (1986).Long-term immunological reconstitution by peripheral blood leucocytes in severe combined immune deficiency disease: Implications for the role of mature lymphocytes in histocompatible bone marrow transplantation. Clin. E r p . Immunol. 64,518-525. 54. Kinney, A. B., and Hitzig, W. H. (1979). Bone marrow transplantation for severe combined immunodeficiency. Eur. J . Pediatr. 131,155-177. 55. Fischer, A., Friedrich, W., Levinsky, R., Vossen, J., Griscelli, C. et al. (1986).Bone marrow transplantation for immunodeficiencies and osteopetrosis: European survey, 1968-1985. Lancet 2, 1080-1083. 56. O’Reilly, R. J., Kapoor, N., Kirkpatrick, D. et al. (1983).Transplantation of hematopoietic cells for lethal congenital immunodeficiencies. Birth Defects, Orig. Artic. Ser. 19, 129-137. 57. Durandy, A., Dumez, Y., Guy-Grand, D., Oury, C., Henrion, R., and Griscelli, C. (1982). Prenatal diagnosis of severe combined immunodeficiency. J. Pediatr. 101, 995-997. 58. Hirschhorn, R., Beratis, N., Rosen, F. S., Parkman, R., Stern, R., and Polmar, S. (1975). Adenosine deaminase deficiency in a child diagnosed prenatally. Lancet 1, 73-75. 59. Goodship, J . , Lau, Y.L., Malcolm, S., Pembrey, M. E., and Levinsky, R. J. (1988).
406
ROBERTSON PARKMAN
Use of X chromosome inactivation to establish carrier status for X-linked severe combined immunodeficiency. Lancet 1,729-732. 60. Hall, C. B., McBride, J. T., Walsh, E. E. et al. (1983). Aerosolized ribavirin treatment of infants with respiratory syncitial viral infection: A randomized doubleblind study. N . Eng1.J. Med. 308, 1443-1447. 61. Emanuel, D., Cunningham, I., Jules-Elysea, K. et cil. (1988). Cytomegalovirus pneumonia after bone marrow transplantation successfully treated with the combination of gancyclovir and high dose intravenous immune globulin. A n d n t e r n . Med. 109,777-782. 62. Shepp, D. H., Newton, B. A., Dandliker, P. S., Flournoy, N., and Meyers, J. D. (1985).Oral acyclovir therapy for mucocutaneous herpes simplex virus infections in immunocompromised marrow transplant recipients. Ann. Intern. Med. 102, 783-785. 63. Uphoff, D. (1958). Preclusion of secondary phase of irradiation syndrome by inoculation of fetal hematopoietic tissue following letal total body X-irradiation. J. Natl. Cancer Inst. ( U S . ) 20,625-632. 64. Niewisch, H., Hajdik, I., Sultanian, I., Vogel, H., and Matioli, G . (1970).Hemopoietic stem distribution in tissues of fetal and new born mice. J . Cell. Physiol. 76, 107-116. 65. Moore, M. A. S., McNeill, T. A., and Haskill, J. S. (1970). Density distribution analysis of in uioo and in oitro colony formingcells in developing fetal 1iver.J. Cell. Physiol. 75, 181-192. 66. Buckley, R. H., Whisnant, J. K., Schiff, R. I., Gilbertsen, R. B., Huang, A. T., and Platt, M. S . (1976).Correction of severe combined immunodeficiency by fetal liver cells. N . EngZ.1. Med. 294, 1076-1081. 67. O’Reilly, R. J., Kapoor, N., and Kirkpatrick, D. (1980).Fetal tissue transplants for severe combined immunodeficiency-their limitations and functional potential. In “Primary Immunodeficiencies” (M. Seligman and W. H. Hitzig, eds.), p. 419. ElseviedNorth-Holland Biomedical press, Amsterdam. 68. Zinkernagel, R. M., Althage, A., Callahan, G., and Welsh, R. M. (1980). On the irnmunocompetence of H-2 incompatible irradiation bone marrow chimeras. j . lmmunol. 124,2356-2365. 69. Singer, A., Hathcock, K. S., and Hodes, R. J. (1981). Self recognition in allogeneic radiation bone marrow chimeras. A radiation-resistant host element dictates the self specificity and immune response phenotype of T-helper cells./. Exp. Med. 153, 1286-1301. 70. Hong, R., Santosham, M., Schulte-Wisserman, H., Horowitz, S., Hsu, S . H., and Winkelstein, J. A. (1976).Reconstitution of B and T lymphocyte function in severe combined immunodeficiency disease after transplantation with thymic epithelium. Lancet 2,1270-1272. 71. Hong, R., and Schulte-Wissermann, H. (1984). Transplantation of cultured thymic epithelium. In “Bone Marrow and Organ Transplantation” (S. Slavin, ed.), pp. 45-53. Elsevier, Amsterdam. 72. Borzy, M. S., Hong, R., Horowitz, S. D. et al. (1979). Fatal lymphoma after transplantation of cultured thymus in children with combined immunodeficiency disease. N . Engl. J . Med. 301,565-568. 73. Dicke, K. A,, Hooft, J. I. M., and van Bekkum, D. W. (1968).The selective elimination of immunologically competent cells from bone marrow and lymphatic cell mixtures. 11. Mouse spleen cell fractionation on a discontinuous albumin gradient. Transplantation 6,562-566. 74. von Boehmer, H., Sprent, J., and Nabholz, M. (1975).Tolerance to histocompatibil-
BIOLOGY OF BONE MARROW TRANSPLANTATION
75. 76.
77. 78.
79. 80.
81.
82. 83. 84. 85.
86. 87.
88.
89. 90.
407
ity determinants in tetraparental bone marrow chimeras. J . E x p . Med. 141, 322334. Sprent, J., von Boehmer, H., and Nabholz, M. (1975). Association of immunity and tolerance of host H-2 determinants in irradiated F1 hybrid mice reconstituted with bone marrow cells from one parental strain. J . E x p . Med. 142,321-331. Onoe, K., Fernandez, G., and Good, R. A. (1980). Humoral and cell-mediated immune responses in fully allogeneic bone marrow chimera in mice. J . Exp. Med. 151,115-132. Muller-Ruchholtz, W., Wottge, H. U., and Muller-Hermerlink, H. K. (1976).Bone marrow transplantation in rats across strong histocompatibility barriers by selective elimination of lymphoid cells in donor marrow. Transplant Proc. 8,537-541. Hamilton, B. L., Brevan, M. J., and Parkman, R. (1981). Anti-recipient cytotoxic T lymphocyte precursors are present in the spleen of mice with acute graft versus host disease due to minor histocompatibility antigens.J. Immunol. 126,621-625. Reisner, Y., Itzicovitch, L., Meshorer, A., and Sharon, N. (1978). Hematopoietic stem cell transplantation using mouse bone marrow and spleen cells fractionated by lectins. Proc. Natl. Acud. Sci. U.S.A.75,2933-2936. Reisner, Y., Kapoor, N., O’Reilly, R. J., and Good, R. A. (1980). Allogeneic bone marrow transplantation using stem cells fractionated by lectins. VI. I n uitro analysis of human and monkey bone marrow cells fractionated by sheep red blood cells and soybean agglutinin. Lancet 2,1320-1324. Frame, J., Collins, N. H., Cartagena, T. et al. (1989). T-cell depletion of human bone marrow. Comparison of Campath-1 plus complement, anti-T cell ricin A chain immunotoxin and soybean agglutinin alone or in combination with sheep erythrocytes or immunomagnetic beads. Transplantation 47,984-988. Ritz, J. (1983). Use of monoclonal antibodies in autologous and allogeneic bone marrow transplantation. Clin. Hematol. 12,813-832. Hayward, A. R., Murphy, S., Githens, J., Troup, G., and Ambruso, D. (1982). Failure of a panreactive anti-T cell antibody, OKT3, to prevent graft versus host disease in severe combined immunodeficiency. J . Pediatr. 100,665-668. Trigg, M . E., Billing, R., Sonde], P. M. et al. (1985). Clinical trial depleting T lymphocytes from donor marrow for matched and mismatched allogeneic bone marrow transplants. Cancer Treut. Rep. 69,377-386. Parkman, R. (1986). Antibody-treated bone marrow transplantation for patients with severe combined immune deficiency. Clin. Immunol. Immunopathol. 40, 142-146. Wesolowski, J., Ault, K., Houghton, R., and Parkman, R. (1984).Heparin inhibition of antibody-dependent complement-mediated lysis. E x p . Hematol. 12,700-705. Filipovitch, A. H., Ramsay, N. K. C., McGlave, P. et al. (1983). Mismatched bone marrow transplantation at the University of Minnesota: use of related donors other than HLA MLC identical siblings and T-cell depletion. In “Recent Advances in Bone Marrow Transplantation” (R. P. Gale, ed.), pp. 769-783. Alan R. Liss, New York. Gotoh, Y. I., Yamaguciti, Y.,Minegishi, M. et a!. (1985). Deficiency of NK activity and HNK-1+ cells after transplantation of fetal thymus and liver or haploidentical soybean agglutinin treated marrow cells in two severe combined immunodeficiency patients. Clin. E x p . Immunol. 61,608-613. Fischer, A., Durandy, A., DeVillartay, J. P. et al. (1986). HLA-haploidentical bone marrow transplantation for severe combined immunodeficiency using E-rosette fractionation and cyclosporine. Blood 67,444-449. O’Reilly, R. J., Kapoor, H., Kirkpatrick, D. et al. (1983). Transplantation for severe
408
ROBERTSON PARKMAN
combined immunodeficiency using histoimcompatible parental marrow fractionated b y soybean agglutinin and sheep red blood cells: Experience in six consecutive cases. Transplant. Proc. 17,455-459. 91. O’Reilly, R. J., Brochstein, J., Collins, N. et al. (1986). Evaluation of HLAhaplotype disparate parental marrow grafts depleted of T lymphocytes by differential agglutination with a soybean lectin and E-rosette depletion for the treatment of severe combined immunodeficiency. Vox Sang. 51, Suppl. 2,81-86. 92. Friedrich, W., Coldniann, S. F., Ebell, W., and Blutters-Sawatzki, R. (1985).Severe combined immunodeficiency: Treatment by bone marrow transplantation in 15 infants using HLA-haploidentical donors. Eur. J . Pediatr. 144, 125-130. 93. O’Reilly, R. J., Keever, C. Kernan, N. A. et al. (1987). HLA nonidentical T cell depleted marrow transplants: a comparison of results in patients treated for leukemia and severe combined immunodeficiency disease. Transplant. Proc. 19, Suppl. 7,55-60. 94. Bordignon, C., Keever, C. A., Small, T. N. et al. (1989).Graft failure after T-celldepleted human leukocyte antigen identical marrow transplants for leukemia. 11. In uitro analyses of host effector mechanisms. Blood 74,2237-2243. 95. Cudkowicz, G., and Bennett, M. (1971). Peculiar itnniunobiology of bone marrow allografts. 11. Rejection of parental grafts by resistant F I hybrid mice.J. Exp. Med. 134,1513-1528. 96. Keissling, R., Hochman, P. S., Haller, O., Shearer, G. M., Wigzell, H., and Cudkowicz, G. (1977). Evidence for a similar or common mechanism for natural killer cell activity and resistance to hemopoietic grafts. Eur. J . Zmmunol. 7,655-663. 97. Daley, J. P., and Nakamura, I. (1984).Natural resistance of lethally irradiated F I hybrid mice to parental marrow grafts is a function of H-2, H-h restricted effectors. J. Exp. Med. 159, 1132-1148. 98. Murphy, W. J., Kumar, V., and Bennett, M. (1987). Rejection of bone marrow allografts by mice with severe combined immune deficiency (SCID).J. Exp. Med. 165,1212-1217. 99. Yankelevich, B., Knoblock, C., Nowicki, M., and Dennert, G. (1989). A novel cell type responsible for marrow graft rejection in mice. J . Zmmunol. 142,3423-3430. 100. Fischer, A., Griscelli, C., Blanche, S. et al. (1986). Prevention of graft failure by an anti-HLFA-1 monoclonal antibody in HLA-mismatched bone-marrow transplantation. Lancet 2, 1058-1061. 101. Kernan, N . A., Collins, N. H., Juliano, L., Cartagena, T., DuPont, B., and O’Reilly, R. J. (1986).Cloneable T lymphocytes in T-cell depleted bone marrow transplants correlate with development of graft-versus-host disease. Blood 68,770-773. 102. Hamilton, B. L., Bevan, M. J,, and Parkman, R. (1981). Anti-recipient cytotoxic T-lymphocyte precursors are present in the spleens of mice with acute graft versus host disease due to minor histocompatibility antigens. J . Immunol. 126,621-625. 103. Sprent, J., and Korngold, R. (1981). Immunogenetics of graft-versus-host reactions to minor histocompatibility antigens. Intmunol. Today. 1, 189-195. 104. Pollack, M. S., Kirkpatrick, D., Kapoor, N., and O’Reilly, R. J. (1982). Identification by HLA typing of intrauterine-derived material T-cell in four patients with severe combined immunodeficiency. N. Engl. J . Med. 307,662-666. 105. Flomenberg, N., Dupont, B., O’Reilly, R. J., Hayward, A,, and Pollack, M. S. (1983). The use of T cell culture techniques to establish the presence of an intrauterinederived maternal T cell graft in a patient with severe combined immunodeficiency (SCID). Transplantation 36,733-735. 106. Thompson, L. F., O’Connor, R. D., and Bastian, J. F. (1984). Phenotype and
BIOLOGY OF B O N E M A R R O W TRANSPLANTATION
107. 108. 109.
110. 111. 112. 113. 114. 115.
116. 117. 118.
119. 120. 121. 122.
409
function of engrafted maternal T cells in patients with severe combined immunodeficiency. J . Immunol. 133,2513-2517. Bevan, M., and Fink, P. (1978). The influence of thymus H-2 antigens on the specificity of maturing killer and helper cells. Immunol. Reo. 42,3-19. Ron, Y., Lo, D., and Sprent, J. (1986).T cell specificity in twice irradiated F1 parent bone marrow chimeras: failure to detect a role for immigrant marrow-derived cells in imprinting intrathymic H-2 restriction. J . Immunol. 137, 1764-1771. Kisielow, P., Bluthmann, H., Staerz, U. D., Steinmetz, M., and von Boehmer, H. (1988). Tolerance in T-cell-receptor transgenic mice involves deletion of nonmature CD4+8+thymocytes. Nature (London) 333,742-746. De Villartay, J,-P.,Griscelli, C., and Fischer, A. (1986). Self-tolerance to host and donor following HLA-mismatched bone marrow transplantation. Eur. J . Immunol. 16,117-122. Schiff, S. E., and Buckley, R. H. (1987).Modified responses to recipient and donor B cells by genetically donor T cells from human haploidentical bone marrow chimeras. J . Immunol. 138,2088-2094. Keever, C. A., Flomenberg, N., Brochstein, J. et al. (1988).Tolerance of engrafted donor T cells following bone marrow transplantation for severe combined immunodeficiency. Clin. Immunol. Immunopathol. 48,261-276. von Boehmer, H., and Hafen, K. (1986). Minor but not major histocompatibility antigens of thymic epithelium tolerize precursors of cytolytic T cells. Nature (London) 320,626-628. Lo, D., and Sprent, J. (1986). Identity of cells that imprint H-2 restricted T cell specificity in the thymus. Nature (London) 319,672-675. Keever, C. A., Flomenberg, N., Small, T. et ~ l(1989). . Loss oftolerance associated with disappearance of B cells in a patient sequentially transplanted with paternal and maternal bone marrow for the treatment of severe combined immunodeficiency disease. Hum. Immunol. 26,27-38. Vandekerckhove, B. A. E., Datema, G . , Koning, F. et al. (1990). Analysis of the donor-specific cytotoxic T lymphocyte repertoire in a patient with a long term surviving allograft. J. Immunol. 144,1288-1294. Roncarolo, M. G., Yssel, H., Touraine, J.-L., Betuel, H., De Vries, J. E., and Spits, H. (1988).Autoreactive T cell clones specific for class I and class I1 HLA antigens isolated from a human chimera. J . Erp. Med. 167, 1523-1534. Friedrich, W., Peter, H. H., Blutters-Sawatzki, R. et al. (1986). Analysis of the immunoreconstitution in 19 patients with severe combined immunodeficiency after haploidentical bone marrow transplantation. In “Progress in Immunodeficiency Research Therapy 11” (J. Vossen and C. Griscelli, eds.), pp. 351-358. Excerpta Medica, Amsterdam. Rosenkrantz, K., Keever, C., Kirsch, J. et al. (1987). In vitro correlates of graft-host tolerance after HLA-matched and mismatched marrow transplants: Suggestions from limiting dilution analysis. Transplant. Proc. 19, Suppl. 7,98-103. Parkman, R. (1989). Graft-versus-host disease: An alternative hypothesis. Immunol. Today 10,362-364. Buckley, R. H., Schiff, S. E., Sampson, H. A. et al. (1986). Development of immunity in human severe primary T cell deficiency following haploidentical bone marrow stem cell transplantation. j . Immunol. 136,2398-2407. Silber, G. M., Winkelstein, J. A., Moen, R. C., Horowitz, S. D., Trigg, M., and Hong, R. (1987). Reconstitution of T- and B-cell function after T-lymphocyte-depleted haploidentical bone marrow transplantation in severe combined immunodefi-
410
ROBERTSON PARKMAN
ciency due to adenosine deaminase deficiency. Clin. Immunol. Immunopathol. 44, 317-320. 123. Keever, C. A., Small, T. N., Flomenberg, N. et al. (1989). Immune reconstitution following bone marrow transplantation: Comparison of recipients of T celldepleted marrow with recipients of conventional marrow grafts. Blood 73, 13401350. 124. August, C. S., Berkel, A. I., Driscoll, S., and Merier, E . (1971).Onset of lymphocyte function in the developing human fetus. Pediatr. Res. 5,539-547. 125. Kay, H. E. M., Doe, J., and Hockley, A. (1970). Response ofhuman fetal thymocytes to phytohaemagglutinin (PHA). lmmunology 18,393-396. 126. van Furth, R., Schuit, H. R., and Hijmans, W. (1965). The immunological development ofthe human fetus.J. E x p . Med. 122,1173-1188. 127. Carr, M. C., Stites, D. P., and Fudenberg, H. H. (1973).Dissociation of resonses to phytohaemagglutinin and adult allogeneic lymphocytes in human fetal lymphoid tissues. Nature (London)241,279-281. 128. Parkman, R., and Merler, E. (1973).Discontinuous density gradient analysis ofthe developing human thymus. Cell. lmmunol. 8,328-331. 129. Rozans, M. K., Smith, B. R., Burakoff, S. J., and Miller, R. A. (1986).Long-lasting deficit of functional T cell precursors in human bone marrow transplant recipients revealed by limiting dilution methods. J . Immunol. 136,4040-4048. 130. Ghory, P., Schiff, S., and Buckley, R. (1986).Appearance of multiple benign paraproteins during early engraftment of soy lectin T-cell depleted haploidentical bone marrow cells in severe combined immunodeficiency. J . Clin. Immunol. 6, 161-169. 131. Wu, A. M., Till, J. E., Siminovitch, L., and McCulloch, E. A. (1968). Cytological evidence for a relationship between normal hematopoietic colony-forming cells and cells of the lymphoid system. J . Erp. Med. 127,455-463. 132. Keller, G., Paige, C., Gilboa, E., and Wagner, E. F. (1985). Expression ofa foreign gene in myeloid and lymphoid cells derived from multipotent haematopoietic precursors. Nature (London)318,149-154. 133. Lum, G. (1987). The kinetics of immune reconstitution after human marrow transplantation. Blood 69,369-380. 134. Zinkernagel, R. M., Ruedi, E., Althage, A., Hengartner, H., and Reimann, G. (1988). Thymic selection of H-2-incompatible bone marrow cells in SCID mice. J . E x p . Med. 168,1187-1192. 135. Small, T. N., Keever, C. A., Collins, N. H., Dupont, T., O’Reilly, R. J., and Flomenberg, N. (1989). Characterization of B cells in severe combined immunodeficiency disease. Hum. Immunol. 25,181-193. 136. Roncarolo, M. G., Yssel, H., Touraine, J.-L. et al. (1988).Antigen recognition by MHC-incompatible cells of a human mismatched chimera.J. Exp. Med. 168,21392152. 137. Chu, E., Umetsu, D., Rosen, F., and Geha, R. S. (1983). Major histocompatibility restriction of antigen recognition by T-cells in a recipient of haplotype mismatched human bone marrow transplantation. J . Clin. Invest. 72, 1124-1 129. 138. Geha, R. S. (1987). Cell cooperation in haploidentical bone marrow transplant recipient. Transplant. Proc. 19, Suppl. 7, 117-121. This article was accepted for publication in June 1990.
A
Acethylcholine receptor, Ig heavy-chain variable region genes and, 31,46, 50-51 Activated partial thromboplastin time, antiphospholipid antibodies and, 200-202,244 Activated protein C, antiphospholipid antibodies and, 253-254,257 Activation SCID and, 386 surface antigens of human leukocytes and, 125 Activation antigen, surface antigens of human leukocytes and, 115,117 Addressins, surface antigens of human leukocytes and, 88 Adenosine deaminase (ADA) deficiency, SCID and, 382-383,390,396 Adhesion, CD23 antigen and, 163-165, 169, 176 Adhesion molecules SCID and, 384,397 surface antigens of human leukocytes and, 82-89, 114, 116 antigen-specific receptors, 78-80 complement components, 92-93 Adoptive T cell therapy of tumors, 281-286,332-335 antigen recognition, 318-324 expression of antitumor responses, 324-325 B cells, 330-332 proliferation, 325-330 mechanisms of tumor rejection, 299 B cells, 312-315 macrophages, 306-312 NK cells, 315-318 T cell subsets, 299-306 principles, 286 requirement, 294-299 tumor burden, 286-294 Affinity purification, antiphospholipid antibodies and, 228-231,257,259 specificity, 242-243,251
Agglutination test, antiphospholipid antibodies and, 235 AIDS, antiphospholipid antibodies and, 210 Alleles adoptive T cell therapy of tumors and, 297 antiphospholipid antibodies and, 255 Ig heavy-chain variable region genes and, 9,14,22-28 surface antigens of human leukocytes and, 81 Allergens, CD23 antigen and, 152 Allergic asthma, CD23 antigen and, 160 Allergic diseases, CD23 antigen and, 174 Alveolitis, CD23 antigen and, 160 Amino acids autoimmune demyelinating disease and, 358,363,366,368 CD23 antigen and, 156,162-166 Ig heavy-chain variable region genes and D segments, 28,31 J H segments, 34 VH families, 7, 14, 18 VH gene expression, 35,43, 51 surface antigens of human leukocytes and, 81,92 Anemia, antiphospholipid antibodies and, 218,225,250-251,255,257 Antibodies adoptive T cell therapy of tumors and, 331,333 mechanisms, 312-315 principles, 289,297 antiphospholipid, See Antiphospholipid antibodies autoimmune demyelinating disease and, 363,368-374 CD23 antigen and, 149,176 biological activity, 168-169, 172 cellular expression, 152-153, 155 expression regulation, 159 FceRII, 165 Ig heavy-chain variable region genes and, 1-3,61 411
4 12
INDEX
D segments, 31-33 J H segments, 34
organization, 4 , 6 VH families, 9, 14, 16 VH gene expression, 40-45 SCID and, 397,401 surface antigens of human leukocytes and, 113,117 Antibody-dependent cellular cytotoxicity (ADCC), adoptive T cell therapy of tumors and, 312-313 Anticardiolipin antibodies (aCL), 193, 259 affinity purification, 230-232 antibody subsets, 233 antimitochondrial antibodies, 249-250 binding to cell membrane, 250-252 clinical aspects, 203-212,215-218, 220-224 history, 199 isotype, 224-227 LA antibodies, 241,243-247 pathogenic potential, 254-255,257 reactivity, 248-249 specificity, 234-240 Antiendothelial antibodies, 252 Antigen-presenting cells adoptive T cell therapy of tumors and, 283,291,334 expression, 324-325,328-329,331 recognition, 319-321,323 autoimmune demyelinating disease and, 367 CD23 antigen and, 167-168 SCID and, 384,387,393 surface antigens of human leukocytes and, 77-78,80,82-83,87 Antigens adoptive T cell therapy of tumors and, 281-285,334-335 expression of antitumor responses, 324,327,329-332 macrophages, 307-308,311-312 mechanisms, 299-301,304,313,318 principles, 287,289-290,295-296, 298 recognition, 318-324 antiphospholipid antibodies and, 193-194,256,258-259 affinity purification, 228
clinical aspects, 200,205 history, 198-199 LA antibodies, 241,243 specificity, 234-239,248-251 autoimmune demyelinating disease and, 368-370,372-374 CD23, See CD23 antigen of human leukocytes, See Surface antigens of human leukocytes Ig heavy-chain variable region genes and, 26,28,34, 54 VH gene expression, 36,39,41-43, 49,51-52 SCID and, 381-388 graft-versus-host disease, 398 lack of stem cell engraftment, 397 posttransplant immunocompetence, 400,402 stem cell engraftment, 391 tolerance, 398-399 transplantation, 393-395 Antiidiotypes, Ig heavy-chain variable region genes and, 37,40,46 Antimitochondrial antibody (AMA), 219-220,233,249-250 Antinuclear antibody (ANA), 210,212, 219 Antiphospbolipid antibodies, 193-194, 257-259 biochemistry, 194-197 clinical aspects autoimmune disorders, 207-210 detection methods, 200-206 drug-induced antibodies, 212-213 genetic studies, 221-222 infectious disease, 210-212 normal populations, 206 syndromes, 213-221 treatment, 222-224 history, 198-199 immunology aCL antibodies, 236-240 affinity purification, 228-231 antimitochondrial antibodies, 249-250 binding, 250-252 isotype, 224-228 LA antibodies, 240-248 reactivity, 248-249 reagin, 234-236
413
INDEX
specificity, 233-234 subsets, 231-233 pathogenic potential, 252-257 Antiphospholipid syndrome (APS),
218-221,235,243 Antiprothrombin antibodies, 247,256 Antithrombin 111,256 Antithrombotic treatment, 223,258 Apoptosis adoptive T cell therapy of tumors and,
312 CD23 antigen and, 155, 171 surface antigens of human leukocytes and, 117 Aspirin, antiphospholipid antibodies and, 223 Asthma, CD23 antigen and, 160 Autoantibodies antiphospholipid antibodies and, 212,
226,257-258 pathogenic potential, 252-253,257 specificity, 238,248-249 CD23 antigen and, 150 Ig heavy-chain variable region genes and, 2,23,33-3463 VH gene expression, 41-51 surface antigens of human leukocytes and, 101 Autochthonous tumor cells, adoptive T cell therapy of tumors and, 284-285, 333 Autoimmune demyelinating disease, 357 multiple sclerosis HLA antibodies, 368-371 TCR V region, antibodies to molecules, 372-374 TCR V region, vaccination to,
374-375
Ig heavy-chain variable region genes and, 2-3,61,63 polymorphism of V H gene segments,
21,26 regulation, 53-54 VH gene expression, 39,41,43,
46-47,50-51 B Bacteria adoptive T cell therapy of tumors and,
308 antiphospholipid antibodies and, 211,
248-249 SCID and, 382 surface antigens of human leukocytes and, 81,111,115 Bare lymphocyte syndrome, SCID and,
387,391 Basophils, CD23 antigen and, 165, 170 B cell growth factors CD23 antigen and, 161,171-172 surface antigens of human leukocytes and, 99 B cell malignancy, Ig heavy-chain variable region genes and, 39-40 B cells adoptive T cell therapy of tumors and,
289,306,312-315,330-332 antiphospholipid antibodies and, 249 CD23 antigen and, 149 biochemical structure, 156, 158 biological activity, 167-173 cellular expression, 150-151, 153 expression in clinical conditions,
174-175
myelin basic protein, 357-363 TCR usage restriction, 363 EAE in rat, 366-368 encephalitogenic C terminus, 366 encephalitogenic N terminus, 363-366
expression regulation, 158-160 FccRII, 162,164-167 Ig heavy-chain variable region genes and, 3,21,33 regulation, 53-56 tumors, 9, 11 VH gene expression, 35-38, 41,43,
Autoimmune diseases, antiphospholipid antibodies and, 193, 198,258 clinical aspects, 208-209,216 immunology, 225,235-236,240,250 Autoimmunity CD23 antigen and, 150,174-175
surface antigens of human leukocytes and, 115-117 adhesion molecules, 86 antigen-specific receptors, 76-78 immunoglobulins, 89,91
49-52
4 14
INDEX
MHC glycoproteins, 81-82 receptors, 99, 101 BFP-STS, See Biological false positive serological test for syphilis Biological false positive serological test for syphilis, 198-199,210 isotype, 227-228 specificity, 234-236,241 B lymphocytes CD23 antigen and, 149-151,176 biological activity, 169, 171 expression regulation, 158- 161 FccRII, 165 Ig heavy-chain variable region genes and, 2,53,56 SCID and, 381-383,387-390,393, 400-401 surface antigens of human leukocytes and, 76,78,92, 101, 125 Bone marrow adoptive T cell therapy of tumors and, 288,300 CD23 antigen and, 155 Ig heavy-chain variable region genes and, 33,36,49 surface antigens of human leukocytes and, 88, 117 transplantation for severe combined immune deficiency, See Severe combined immune deficiency Brain lesions, autoimmune demyelinating disease and, 368 Burkitt’s lymphoma CD23 antigen and, 166 Ig heavy-chain variable region genes and, 3 C
Calcium adoptive T cell therapy of tumors and, 307 antiphospholipid antibodies and, 197, 243,245-246 CD23 antigen and, 151,163 SCID and, 385-386 surface antigens of human leukocytes and, 90,114-1 15 Cancer, adoptive T cell therapy of tumors and, 283-285,333
Carbohydrate antiphospholipid antibodies and, 239 CD23 antigen and, 155-156,163-165. 176 surface antigens of human leukocytes and adhesion molecules, 88-89 immunoglobulins, 91 membrane enzymes, 113- 114 receptors, 94,98 Cardiolipin, See also Anticardiolipin antibodies antiphospholipid antibodies and, 193, 258-259 affinity purification, 229-231 antibody subsets, 232 antimitochondrial antibodies, 250 binding to cell membrane, 251-252 biochemistry, 194, 197 clinical aspects, 200,204-205 history, 198 LA antibodies, 240,242-247 pathogenic potential, 255 reactivity, 248-249 specificity, 234-240 Ig heavy-chain variable region genes and, 42,46 CDl CD23 antigen and, 154, 156 human leukocytes and, 78,80-83 CD2, human leukocytes and, 87,117 CD3 complex, human leukocytes and, 76-79,81,87,90 SCID and, 384,386-387,396-397 CD4 adoptive T cell therapy of tumors and, 333-335 antigen recognition, 318,320-321, 324 expression of antitumor responses, 324-330,332 mechanisms, 299-306 principles, 289-291 autoimmune demyelinating disease and, 364,366-367,374 CD23 antigen and, 152 human leukocytes and, 77-78,81-83, 90,113 SCID and, 384,385,396
INDEX
CD5 antigen, 151 human leukocytes and, 92,101 Ig heavy-chain variable region genes and, 42 CD8 adoptive T cell therapy of tumors and, 283,288,290-291,333-335 antigen recognition, 319-321,324 expression of antitumor responses, 324-330,332 mechanisms, 299-306,316,318 autoimmune demyelinating disease and, 374 CD23 antigen and, 152-153 human leukocytes and, 77-78,81-83, 101,113 CD11, human leukocytes and, 86,92 CD16, human leukocytes and, 77,90 CD18, human leukocytes and, 86,92 CD21, human leukocytes and, 92 CD23, human leukocytes and, 90-91 CD28, human leukocytes and, 101 CD42, human leukocytes and, 85 CD43, human leukocytes and, 117 CD44, human leukocytes and, 85-86, 88 CD45, human leukocytes and, 87, 113-114 CD73, human leukocytes and, 112 CD23 antigen, 149-150,176-177 biochemical structure, 155-158 biological activity, 167 expression in clinical conditions, 174-175 membrane CD23, 167-169 soluble CD23, 169-173 cellular expression, 155 B lymphocytes, 150-151 eosinophils, 154 Langerhans cells, 154-155 macrophages, 153-154 monocytes, 153-154 T lymphocytes, 151-153 cleavage regulation, 158 expression regulation, 158 B lymphocytes, 158-160 EBV-induced expression, 161 macrophages, 161 monocytes, 160-161
415
FcrRII cloning of cDNA, 162-163 genomic structure, 165-167 lectins, 163-164 structural analysis, 164-165 cDNA, See Complementary DNA CDRs, See Complementaritydetermining regions Cell adhesion molecules, surface antigens of human leukocytes and, 79,86,88 Central nervous system, autoimmune demyelinating disease and, 357,369 Centrocytes, CD23 antigen and, 171 Cerebrovascular disease, antiphospholipid antibodies and, 220 CH (Constant region complex), Ig heavy-chain variable region genes and, 3-4,6 Chemotactic receptor, surface antigens of human leukocytes and, 93,111 Chemotaxis, adoptive T cell therapy of tumors and, 328,335 Chemotherapy adoptive T cell therapy of tumors and, 287,292-296.311 SCID and, 388,390,396-397 Chlorpromazine, antiphospholipid antibodies and, 203,212-213,221, 224,257 Cholesterol antiphospholipid antibodies and affinity purification, 229-230 LA antibodies, 244-245 specificity, 234-236,248 surface antigens of human leukocytes and, 116 Chromatin, Ig heavy-chain variable region genes and, 37,56 Chromosomes Ig heavy-chain variable region genes and, 1 , 3 , 6 , 5 5 surface antigens of human leukocytes and, 91-92 Cleavage, CD23 antigen and, 156,158, 160,173 Clones adoptive T cell therapy of tumors and, 284,289-290,298,334
416
INDEX
antigen recognition, 321,324 expression of antitumor responses, 325-326,330 mechanisms, 299,301,303-305,311 antiphospholipid antibodies and, 238-239,246,249 autoimmune demyelinating disease and, 357 multiple sclerosis, 370, 372,374 myelin basic protein, 358-361 TCR usage restriction, 363-368 CD23 antigen and, 151-152,154, 162-165 Ig heavy-chain variable region genes and, 5,8,22,32 regulation, 55 VH gene expression, 41-42,47-48 SCID and, 393,398,402 surface antigens of human leukocytes and,79,91,98, 111, 114, 116 Clotting, antiphospholipid antibodies and affinity purification, 232 clinical aspects, 200-202 pathogenic potential, 253,256-257 specificity, 241,244-245,247 Coagulation, antiphospholipid antibodies and, 200,258 pathogenic potential, 256 specificity, 239,241-244,246 Cold agglutinins, Ig heavy-chain variable region genes and, 46-47,51-52 Collagen antiphospholipid antibodies and, 197 surface antigens of human leukocytes and, 85-86,88 Colony-stimulating factors, surface antigens of human leukocytes and, 99,113 Common variable immune deficiency (CVID), CD23 antigen and, 174 Competition, autoimmune demyelinating disease and, 370-371 Complementarity-determining regions (CDRs), l g heavy-chain variable region genes and, 34,51,61,63 D segments, 28,31 VH families, 9, 14-15, 18 Complementary DNA CD23 antigen and biological activity, 169, 172
cellular expression, 152, 154 FcERII, 162-163, 165 Ig heavy-chain variable region genes and, 19,22,33 V H gene expression, 35, 37-38, 44-45 surface antigens of human leukocytes and, 79,114, 118 Complement components, receptors for, surface antigens of human leukocytes and, 91-97 Complement deficiency alleles, antiphospholipid antibodies and, 222 Complement-mediated lysis, SCID and, 395 Complement type 1 receptors, antiphospholipid antibodies and, 255 Consensus sequences CD23 antigen and, 162 Ig heavy-chain variable region genes and, 30 Coronary artery bypass grafting (CABG), antiphospholipid antibodies and, 220,222-223 Cosmid clones, Ig heavy-chain variable region genes and, 5-6,8 C-reactive protein, surface antigens of human leukocytes and, 111 Cross-hybridization CD23 antigen and, 162 l g heavy-chain variable region genes and, 1 , 8 Cross-linkage CD23 antigen and, 156, 168-169, 172-173 surface antigens of human leukocytes and, 89-90,101,111,125 Cross-reactive idiotype, l g heavy-chain variable region genes and, 43,46, 48-49,51 Cross-reactivity antiphospholipid antibodies and, 209, 211,236,243,248-249 Ig heavy-chain variable region genes and, 47 Culture supernatants (CSN), CD23 antigen and, 157, 159 Cyclophosphamide, adoptive T cell therapy of tumors and, 293,295-297. 302-303,317
INDEX
Cys tei ne CD23 antigen and, 163-164 surface antigens of human leukocytes and, 116 Cytokines adoptive T cell therapy of tumors and, 285,289-290,308 expression of antitumor responses, 324,326,330,332 mechanisms, 309-310 antiphospholipid antibodies and, 257 CD23 antigen and, 159,169-170,172 SCID and, 386,393 surface antigens of human leukocytes and, 98-100,111 Cytolysis, adoptive T cell therapy of tumors and antigen recognition, 319 expression of antitumor responses, 325,328,332 mechanisms, 299-303,305-308, 312-313,316 principles, 290,295 Cytoplasm adoptive T cell therapy of tumors and, 283 CD23 antigen and, 162, 166 SCID and, 386 surface antigens of human leukocytes and, 87,89,117 membrane enzymes, 113-114 receptors, 98-100 Cytoskeleton, surface antigens of human leukocytes and, 85-86,92-93, 113 Cytotoxic T cells adoptive T cell therapy of tumors and, 283,290-291 antigen recognition, 319-321,324 mechanisms, 300,303-305,316,318 autoimmune demyelinating disease and, 363 Cytotoxic T lymphocytes, SCID and, 396,398-399 D
Decay accelerating factor, surface antigens of human leukocytes and, 93 Deep venous thrombosis. antiphospholipid antibodies and, 219
417
Deletion, Ig heavy-chain variable region genes and, 9,14,25,31 Delta-kaolin clotting time, antiphospholipid antibodies and, 201,206 Demyelinating disease, autoimmune, See Autoimmune demyelinating disease Dendritic cells adoptive T cell therapy of tumors and, 330 CD23 antigen and, 155, 171 SCID and, 402 Depletion, SCID and, 381,394-397, 399,401 Dermatitis CD23 antigen and, 154 SCID and, 398 DH gene segments, Ig heavy-chain variable region genes and, 2-3 Dicetyl phosphate, antiphospholipid antibodies and, 229-230 DiCeorge syndrome, SCID and, 383-384,391 Dilute Russell viper venom time (dRWT), antiphospholipid antibodies and, 201,242 DIR segments, Ig heavy-chain variable region genes and, 30-31,33 DNA antiphospholipid antibodies and, 209, 226,240,248-249,251,256 CD23 antigen and, 167 Ig heavy-chain variable region genes and, 1 , 3 D segments, 29,31-33 J H segments, 33 polymorphism of VH gene segments, 23-24 regulation, 53,55,61 VH families, 8, 9, 11 VH gene expression, 35,39-40, 42-43,46,48-50 surface antigens of human leukocytes and, 116 D-proximal VH genes, 5 V H families, 18,20-21 VH gene expression, 36-39 Drug-induced syndromes, antiphospholipid antibodies and, 193,209,212-213,250
418
INDEX
D segments, Ig heavy-chain variable region genes and, 18,28-34,36,53 organization, 3-6 DTH, adoptive T cell therapy of tumors and, 289,327
Effector cells, adoptive T cell therapy of tumors and, 284,333-334 antigen recognition, 318-319,324 expression of antitumor responses, 324-325,327,329,332 mechanisms, 299,301-302,306, 308-313.315 NK cells, 316-318 principles, 286,288-290,294-295,297 Electrophoresis, Ig heavy-chain variable region genes and, 4-5, 11 ELISA, antiphospholipid antibodies and, 205,235-236,242-244,247 Endocytosis, surface antigens of human leukocytes and, 89,98, 115, 125 Endoplasmic reticulum, adoptive T cell therapy of tumors and, 283,320,323 Endothelium antiphospholipid antibodies and, 193, 250,252-254 surface antigens of human leukocytes and, 86-88 Enhancers, Ig heavy-chain variable region genes and, 52-62 sequences, 39 eno, adoptive T cell therapy of tumors and, 320-321 Environmental agents, antiphospholipid antibodies and, 221-222 Enzymes antiphospholipid antibodies and, 203, 239 CD23 antigen and, 156-157,172-173 Ig heavy-chain variable region genes and, 17 SCID and, 382-383,398 surface antigens of human leukocytes and, 100,111-114 Eosinophils, CD23 antigen and, 154, 161,167 Epithelium CD23 antigen and, 150,155,161, 170- 171
SCID and, 384,393,402 Epitopes adoptive T cell therapy of tumors and, 334 antigen recognition, 321-324 expression of antitumor responses, 329-330 mechanisms, 312-313,315 antiphospholipid antibodies and, 193, 234-235,239-240,259 affinity purification, 228 antibody subsets, 232-233 binding to cell membranes, 252 clinical aspects, 213 LA antibodies, 241,246-248 pathogenic potential, 256-257 specificity, 234-235,239-240,248, 250 autoimmune demyelinating disease and multiple sclerosis, 369-370,372,374 myelin basic protein, 357-363 TCR usage restriction, 363-368 CD23 antigen and, 157 surface antigens of human leukocytes and, 87,125 Epstein-Barr virus adoptive T cell therapy of tumors and, 283 CD23 antigen and, 149,161-162, 167, 171 Ig heavy-chain variable region genes and, 2,33,35,38,42,49-50 SCID and, 398 surface antigens of human leukocytes and, 92 Erythrocytes antiphospholipid antibodies and, 231, 239,250-252,254-255 CD23 antigen and, 157 SCID and, 383,388 surface antigens of human leukocytes and, 114-115, 117 Eu protein sequence, Ig heavy-chain variable region genes and, 6 , 8 Evolution CD23 antigen and, 165 Ig heavy-chain variable region genes and, 14, 16,26, 55,61 surface antigens of human leukocytes and, 79,117
4 19
INDEX
Experimental allergic encephalomyelitis (EAE), 357 antibodies and, 369-375 myelin basic protein and, 357-358, 360-362 TCR usage restriction and, 363, 366-368 Expression adoptive T cell therapy of tumors and, 334 antigen recognition, 320 expression of antitumor responses, 324-332 mechanisms, 312,315 antiphospholipid antibodies and, 257 autoimmune demyelinating disease and, 364-366,368 CD23 antigen and, 174-176 biological activity, 167, 169 cellular expression, 150-155 FcERII, 162,166-167 regulation, 159-161 Ig heavy-chain variable region genes and, 2-3 D segments, 32-33 J H segments, 34 polymorphism of VH gene segments, 25,27 regulation, 53-54,61 VH families, 11, 14-15 VH genes, 35-52 SCID and, 387,391,396,398 surface antigens of human leukocytes and, 113, 116-117, 119-124 Extracellular matrix, surface antigens of human leukocytes and, 82-86 Extrinsic pathway inhibition, antiphospholipid antibodies and, 256 F
Factor X, antiphospholipid antibodies and, 242-243,256 Fatty acids, antiphospholipid antibodies and, 194-197,238,251 FBL, adoptive T cell therapy of tumors and antigen recognition, 320-321,324 expression of antitumor responses, 325-329,331-332
mechanisms, 300,302-304,308-310, 313-315 NK cells, 317-318 principles, 292,295-296,298 Fc receptor adoptive T cell therapy of tumors and, 312-313 surface antigens of human leukocytes and, 80,83,89-91,111 FcrRII, CD23 antigen and, 149, 162-167 Fetal loss, antiphospholipid antibodies and, 252-253,257-258 clinical aspects, 213-216,218-224 isotype, 225-226 Fetal tissues, transplantation with, SCID and, 392-393 Fibrinolysis, antiphospholipid antibodies and, 254-255 Flanking regions, Ig heavy-chain variable region genes and, 26,39 probes, 23 Friend murine leukemia virus, adoptive T cell therapy of tumors and, 320-321.324 G gag, adoptive
T cell therapy of tumors and, 320-321,323-324 Galactose, surface antigens of human leukocytes and, 88-89,91 Gammaglobulin, antiphospholipid antibodies and, 222-223 Gene conversion, Ig heavy-chain variable region genes and, 15,52,61 D segments, 28-29,32 polymorphism of VH gene segments, 24,26 Gene duplication, Ig heavy-chain variable region genes and, 25,29 Genetics adoptive T cell therapy of tumors and, 283,297 antiphospholipid antibodies and, 222, 255 CD23 antigen and, 162 Genomic structure, CD23 antigen and, 165-167 Genotype, autoimmune demyelinating disease and, 364,366
420
INDEX
Germ-line counterparts, Ig heavy-chain variable region genes and, 25 Germ-line encoded sequences, Ig heavy-chain variable region genes and, 27 Glucocorticoids, CD23 antigen and, 154, 160- 161 Glycolipid antiphospholipid antibodies and, 228-230,239,255 surface antigens of human leukocytes and, 111 GIycoprotein adoptive T cell therapy of tumors and, 320 antiphospholipid antibodies and, 239-240,255-256,259 CD23 antigen and, 149, 155, 158 SCID and, 395 surface antigens of human leukocytes and, 112-114, 118, 125 adhesion molecules, 82-88 antigen-specific receptors, 76-78 complement components, 93 immunoglobulins, 90-91 MHC glycoproteins, 80-82 receptors, 94,98, 100 P-2-Glycoprotein-I, antiphospholipid antibodies and, 240,247,252, 256-257,259 Glycosylation antiphospholipid antibodies and, 256 CD23 antigen and, 156-158,162-164 surface antigens of human leukocytes and, 93,99,113 Glycosylphosphatidyl inositol, surface antigens of human leukocytes and, 75,93-94, 112, 116, 125 GPL, antiphospholipid antibodies and, 203-204 G protein SCID and, 386 surface antigens of human leukocytes and, 76,98, 111 Graft rejection adoptive T cell therapy of tumors and, 301,305,328 SCID and, 397 Graft-versus-host disease, SCID and, 388,391-395,397-399
Granulocytes, surface antigens of human leukocytes and, 88, 90, 93, 111-112, 116 H
Haploidentical transplantation, SCID and, 393-397,399,401 Haplotypes antiphospholipid antibodies and, 222 autoimmune demyelinating disease and, 365,368 Ig heavy-chain variable region genes and, 23 Heat-shock proteins, surface antigens of human leukocytes and, 79,82 Hematopoietic cells, CD23 antigen and, 150,169 Hematopoietic stem cells, SCID and, 382,385 engraftment, 388-391 lack of engraftment, 396-397 transplantation with T cell-depleted bone marrow, 394 Heparin antiphospholipid antibodies and, 223, 240,256 SCID and, 395 surface antigens of human leukocytes and, 88 Hepatoma, adoptive T cell therapy of tumors and, 301,305 Histocompatible bone marrow transplantation, 392 HIV, See Human immunodeficiency virus HLA autoimmune demyelinating disease and, 367 class I1 molecules, 357,362-363, 368-371,374 SCID and, 392-393,398 HLA-DR antiphospholipid antibodies and, 222 CD23 antigen and, 156, 170 Homeobox domain, Ig heavy-chain variable region genes and, 55,57 Homing receptors, surface antigens of human leukocytes and, 87-88
42 1
INDEX
Homology autoimmune demyelinating disease and, 367 CD23 antigen and, 162-164,166 Ig heavy-chain variable region genes and D segments, 29,32-33 polymorphism of V H gene segments, 24,26 VH families, 8, 15, 17 VH gene expression, 35,39,44-45, 48-51 surface antigens of human leukocytes and, 76,88,92-93,99,114 Hormones, surface antigens of human leukocytes and, 94, 101 Human immunodeficiency virus antiphospholipid antibodies and clinical aspects, 202, 205, 210-211 isotype, 224,226-227 Ig heavy-chain variable region genes and, 57 Human immunoglobulin heavy-chain variable region genes, See Immunoglobulin heavy-chain variable region genes Human leukocytes, surface antigens of, See Surface antigens of human leukocytes Hybridization CD23 antigen and, 152, 162, 170 Ig heavy-chain variable region genes and polymorphism of VH gene segments, 23,27 VH families, 8-9, 15, 17 V H gene expression, 37-38 SCID and, 397 H ybridoma adoptive T cell therapy of tumors and, 30 1 antiphospholipid antibodies and, 246, 249 autoimmune demyelinating disease and, 358-359,365,367 Ig heavy-chain variable region genes and, 2,35,37,41 Hypogammaglobulinemia CD23 antigen and, 174
Ig heavy-chain variable region genes and, 3
I ICAM-1, CD23 antigen and, 161 Immunoglobulin adoptive T cell therapy of tumors and, 312,314,330-331 antiphospholipid antibodies and, 194, 199,259 affinity purification, 228,230 antibody subsets, 232 binding to cell membranes, 250,252 clinical aspects, 200,203,211 isotype, 224 pathogenic potential, 253-254,257 specificity, 237,241,243-244,248 CD23 antigen and, 150-151,156-158 SCID and, 388,400-401 surface antigens of human leukocytes and, 81-82,98, 118 antigen-specific receptors, 76-79 receptors, 89-91 Immunoglobulin A antiphospholipid antibodies and, 204, 224-226,232,238 surface antigens of human leukocytes and, 91 Immunoglobulin D CD23 antigen and, 150, 168,175 surface antigens of human leukocytes and, 76,91 Immunoglobulin E CD23 antigen and, 149-150, 174, 176 biochemical structure, 155-157 biological activity, 167-173 cellular expression, 150-152, 154-155 cleavage regulation, 158 expression regulation, 161 FcERII, 162-163, 165 surface antigens of human leukocytes and, 77,81,90-91 Immunoglobulin E-binding factors, CD23 antigen and, 149 Immunoglobulin G adoptive T cell therapy of tumors and, 296
422
INDEX
antiphospholipid antibodies and, 199, 242,251,255,258 affinity purification, 229 clinical aspects, 204-206,210,212, 222,224 isotype, 224-228 pathogenic potential, 253,255 specificity, 238,242-243 syndromes, 220 CD23 antigen and, 157 Ig heavy-chain variable region genes and, 2,6,49-51 surface antigens of human leukocytes and, 83,89-90 Immunoglobulin heavy-chain variable region genes, 1-3,61,63 D-proximal genes, 20-21 D segments, 28-33 J H segments, 33-35 organization, 3-6 polymorphism of VH gene segments, 2 1-28 regulation, 52-54 enhancer elements, 56-62 promoter elements, 54-56 VH families, 6-8 VH gene expression, 35-36,51-52 autoantibodies, 41-51 B cell malignancies, 39-40 ontogeny, 36-39 VHI genes, 5-9, 11, 14-15.61 expression, 37,40,42-43,47,49 polymorphism, 22-23,27 VHII genes, 6-9, 11,61 expression, 37,40,42,50 polymorphism, 22-23,27 VHIII genes, 5,7-9,ll-15,61 expression, 37-38,40,42-43,48 myasthenia gravis, 50-51 polymorphism, 22-27 regulation, 58-61 VHIV genes, 5,11,14-17,61,63 expression, 38,40,42-43, 47-51 polymorphism, 26-27 VHV genes, 4, 17-19,61 expression, 40, 50 polymorphism, 26-27 VHVI genes, 4-5,19-20,61 expression, 37-38,40,42 polymorphism, 26,28
Immunoglobulin M adoptive T cell therapy of tumors and, 314,331 antiphospholipid antibodies and affinity purification, 228-229 clinical aspects, 204,206, 209-210, 212,222 CD23 antigen and, 159, 167-168, 172, 175 Ig heavy-chain variable region genes and, 38,41-43,48-51 surface antigens of human leukocytes and, 76,91,101 Immunosuppression, antiphospholipid antibodies and, 223,258 Infectious disease, antiphospholipid antibodies and, 193,210-212,221, 257 Inflammation adoptive T cell therapy of tumors and, 290-291,311,328 CD23 antigen and, 161 surface antigens of human leukocytes and, 87,111 Inhibition adoptive T cell therapy of tumors and, 285,320,327 mechanisms, 307,313 principles, 287-289 antiphospholipid antibodies and, 193, 259 clinical aspects, 200-202 history, 198-199 pathogenic potential, 253-254, 256-257 specificity, 236,239,241-244,247, 252 autoimmune demyelinating disease and, 358,370-371 CD23 antigen and biochemical structure, 156-157 biological activity, 168-170, 172-173 cellular expression, 152, 154 expression regulation, 160-161 FcrRII, 164 Ig heavy-chain variable region genes and, 46 SCID and, 383 surface antigens of human leukocytes and, 89.92-93, 111-1 12, 114
423
lNDEX
Insulin receptor, surface antigens of human leukocytes and, 100,113 Integrin CD23 antigen and, 163 surface antigens of human leukocytes and, 83-86,92 Interferon adoptive T cell therapy of tumors and, 289-290,307-308,311,316 autoimmune demyelinating disease and, 361 CD23 antigen and, 152,154,158,161, 174-175 SCID and, 385-386 surface antigens of human leukocytes and, 99 Interleukin adoptive T cell therapy of tumors and, 289,312 CD23 antigen and, 151, 154-155,176 surface antigens of human leukocytes and, 94,98,101 Interleukin-1 adoptive T cell therapy of tumors and, 287,289,325-329,334 CD23 antigen and, 169-171 SCID and, 396 deficiency, 384-385,390 receptor deficiency, 385 Interleukin-2 adoptive T cell therapy of tumors and, 284,289-291,293,334 expression of antitumor responses, 324-329,332 mechanisms, 300,302-305,307, 309-310,315-316 autoimmune demyelinating disease and, 361 CD23 antigen and, 159, 168-169, 175 SCID and, 384,386-387 deficiency, 385,390 lack of stem cell engraftment, 396 posttransplant immunocompetence, 400 receptor deficiency, 385-386 stem cell engraftment, 390-391 tolerance, 399 transplantation with fetal tissue, 393 surface antigens of human leukocytes and, 94,98 Interleukin-3, CD23 antigen and, 170
Interleukin-4 adoptive T cell therapy of tumors and, 290,307,327-328,334 CD23 antigen and biochemical structure, 157 biological activity, 169-170, 172-173 cellular expression, 150-155 cleavage regulation, 158 expression, 159- 161, 174-175 FccRII, 162, 166-168 SCID and, 386 surface antigens of human leukocytes and, 89,91 Interleukin-6, CD23 antigen and, 160 Intrathymic defects, SCID and, 383-384 Ischemia, antiphospholipid antibodies and, 218-219,258
J
J gene segments, Ig heavy-chain variable region genes and, 4-6,28 JH
gene segments, Ig heavy-chain variable region genes and, 2-3,29, 31,33-35,53
K Kaolin clotting time (KCT), antiphospholipid antibodies and, 201-202,241 Karyotype, SCID and, 388,392
1 LAM-1, surface antigens of human leukocytes and, 87-88 Langerhans cells, CD23 antigen and, 154-155,161,167,171 Large granular lymphocytes adoptive T cell therapy of tumors and, 315 CD23 antigen and, 155 Latent membrane protein 1, CD23 antigen and, 161 Lectin CD23 antigen and, 163-165, 176 surface antigens of human leukocytes and, 88-91,94,100
424
INDEX
Leprosy, Ig heavy-chain variable region genes and, 46,48 Leukemia adoptive T cell therapy of tumors and mechanisms, 300-305,308,311,313, 317 principles, 286,291-293,295-296 CD23 antigen and, 150-151,175 Ig heavy-chain variable region genes and, 17,39-40 SCID and, 397 surface antigens of human leukocytes and, 92,114,117-118 Leukocytes SCID and, 383-384,398 surface antigens of, See Surface antigens of human leukocytes Leukotriene B4, CD23 antigen and, 154, 159,161 LFA-1 CD23 antigen and, 161 surface antigens of human leukocytes and, 86,88,92 LFA-3 CD23 antigen and, 161 surface antigens of human leukocytes and, 87 Ligands antiphospholipid antibodies and, 228-231 CD23 antigen and, 158, 165, 167 SCID and, 385 surface antigens of human leukocytes and, 113, 115, 117 adhesion molecules, 81,86-87 antigen-specific receptors, 76 immunoglobulins, 89 receptors, 99, 101, 111 Limiting dilution analysis, SCID and, 394,400 Linear tracking, Ig heavy-chain variable region genes and, 33,38 Linked substitution, Ig heavy-chain variable region genes and, 9, 14 Lipid, antiphospholipid antibodies and, 252,256-257,259 affinity purification, 228-230 antibody subsets, 232 biochemistry, 195, 197 clinical aspects, 205
specificity, 234,238-240,243,246-248 Lipopoly saccharide adoptive T cell therapy of tumors and, 307-310.314 antiphospholipid antibodies and, 21 1 CD23 antigen and, 150-151 SCID and, 384 Lipoprotein, antiphospholipid antibodies and, 213,256 Lipoprotein lipase, antiphospholipid antibodies and, 257 Liposomes, antiphospholipid an tibodies and affinity purification, 228-230 LA antibodies, 242,244-246 specificity, 234-236, 239, 250 Liver, SCID and, 392-393,401 Liver diseases, antiphospholipid antibodies and, 250 Low-molecular-weight B cell growth factor, CD23 antigen and, 160, 169 Lupus, See ulso Systemic lupus erythematosus (SLE) antiphospholipid antibodies and, 209, 212,219,248,250 Lupus anticoagulant (LA), antiphospholipid antibodies and, 193,258-259 affinity purification, 229-231 antibody subsets, 231-233 clinical aspects, 200-210,212,221, 224 history, 198-199 isotype, 227 pathogenic potential, 253-256 specificity, 234,239-248,251-252 syndromes, 215-218 Lyl lineage, CD23 antigen and, 150-151 Lymph nodes adoptive T cell therapy of tumors and, 284,331 autoimmune demyelinating disease and, 358-359,364,372 Lymphocytes, See ulso B lymphocytes; T lymphocytes antiphospholipid antibodies and, 239, 249 autoimmune demyelinating disease and, 368-369 CD23 antigen and, 164, 173, 175
INDEX
SCID and, 386-388 surface antigens of human leukocytes and, 94,113,115 Lymphoid cells adoptive T cell therapy of tumors and, 302 Ig heavy-chain variable region genes and, 52-53,55 SCID and, 393 Lymphoid stem cells, SCID and, 384, 389,400-401 absence, 382,390-391,393 Lymphokine-activated killer (LAK) cells, adoptive T cell therapy of tumors and, 284-285,302,306 Lymphokines adoptive T cell therapy of tumors and antigen recognition, 319 expression of antitumor responses, 324,328-329 mechanisms, 299-301,307-309,313, 316 principles, 289-290 autoimmune demyelinating disease and, 360 surface antigens of human leukocytes and, 101 Lymphoma, See also Burkitt’s lymphoma adoptive T cell therapy of tumors and, 283,286,291-292,295,305 CD23 antigen and, 161,164,175 Ig heavy-chain variable region genes and, 40,51 SCID and, 393 surface antigens of human leukocytes and, 114, 117 Lymphoproliferative disease, CD23 antigen and, 175 Lymphotoxin adoptive T cell therapy of tumors and, 308 autoimmune demyelinating disease and, 360 Lyso-phosphotidylethanolamine, 246, 248 M Macrophage-activating factor (MAF), adoptive T cell therapy of tumors and, 307,309-311
425
Macrophage migration inhibitory factor, surface antigens of human leukocytes and, 111 Macrophages adoptive T cell therapy of tumors and, 287,289-290,333 antigen recognition, 319 expression of antitumor responses, 325-328,330 mechanisms, 300,302,306-313,316 CD23 antigen and, 157,160, 166 biological activity, 167, 171 cellular expression, 153-154 expression in clinical conditions, 176 SCID and, 384-385,389-391,401-402 surface antigens of human leukocytes and, 89,91-92,98-99,116 Major histocompatibility complex adoptive T cell therapy of tumors and, 281,283,294-295,334 antigen recognition, 319,322-323 expression, 324-325,327-330,332 mechanisms, 299,315 autoimmune demyelinating disease and, 357-358 multiple sclerosis, 369-371,374-375 TCR usage restriction, 363,365-367 CD23 antigen and, 150-151,169 SCID and, 384,386-387,391 surface antigens of human leukocytes and, 78-79 Major histocompatibility complex glycoprotein, surface antigens of human leukocytes and, 80-82, 125 adhesion, 82-83 receptors, 77-78,94, 100 Mannose CD23 antigen and, 163,165 surface antigens of human leukocytes and, 98 Mapping autoimmune demyelinating disease and, 369 CD23 antigen and, 156,165-166 Ig heavy-chain variable region genes and, 1,29,55 organization, 3-4 V H families, 18,20-21 Melanoma, adoptive T cell therapy of tumors and, 285-286,288,290,305
426
INDEX
Membrane enzymes, surface antigens of human leukocytes and, 111-114 Membrane proteins antiphospholipid antibodies and, 197 CD23 antigen and, 164 surface antigens of human leukocytes and, 93-97,111,114,117 Messenger RNA autoimmune demyelinating disease and, 360 CD23 antigen and biological activity, 170 cellular expression, 152-155 cleavage regulation, 158 expression in clinical conditions, 174-175 expression regulation, 158-160 FcrRII, 162, 166 Ig heavy-chain variable region genes and, 2,55 SCID and, 386 surface antigens of human leukocytes and, 83,89, 101, 113 Metastases, adoptive T cell therapy of tumors and, 286,297,305 Methylated bovine serum albumin, antiphospholipid antibodies and, 234-235 Migration, CD23 antigen and, 164,169 Mitochondria, See also Antimitochondrial antibody antiphospholipid antibodies and, 197, 239,249-250,256 Mitogens adoptive T cell therapy of tumors and, 314 CD23 antigen and, 170 SCID and, 382-385,387,398,400 Monoclonal antibodies adoptive T cell therapy of tumors and, 283,320,327 mechanisms, 308,312-314,317 principles, 290,296-297 antiphospholipid antibodies and, 239, 242,245,248-249,251 autoimmune demyelinating disease and, 357,363,366 CD23 antigen and, 177 biochemical structure, 155, 157 biological activity, 171-172
cellular expression, 152-153, 155 FccRII, 162, 164-165 Ig heavy-chain variable region genes and, 46,48,51 multiple sclerosis and, 369,372-375 SCID and, 394-395,397 surface antigens of human leukocytes and, 87, 117, 125-126 receptors, 98, 100-101, 111 Monocytes adoptive T cell therapy of tumors and, 328 CD23 antigen and, 153, 158, 174, 176 biological activity, 167, 169, 171, 173 expression regulation, 160-161 FcrRlI, 166 SCID and, 384-385,389-391,396,401 surface antigens of human leukocytes and, 111,116 adhesion molecules, 86,88 immunoglobulins, 89,91 MHC glycoproteins, 82 MPL, antiphospholipid antibodies and, 203-204 mRNA, See Messenger RNA Multiple sclerosis, 357 antibodies, 368-374 antiphospholipid antibodies and, 209 myelin basic protein and, 362-363 TCR usage restriction and, 367-368 vaccination to TCR V regions, 374-375 Mutation, See also Somatic mutation adoptive T cell therapy of tumors and, 320,327,332,334 CD23 antigen and, 163-164 Ig heavy-chain variable region genes and, 6,22,32,43,53 SCID and, 383 Myasthenia gravis antiphospholipid antibodies and, 209 Ig heavy-chain variable region genes and, 46,50-51 Myelin basic protein, autoimmune demyelinating disease and, 357-363 multiple sclerosis, 369-370,372-374 TCR usage restriction, 363-366 Myeloid cells, surface antigens of human leukocytes and, 92, 111-112, 116 Myeloma CD23 antigen and, 168
427
INDEX
Ig heavy-chain variable region genes and, 1-2 D segments, 33 VH families, 6-7 V H gene expression, 39-40,46, 48-49 surface antigens of human leukocytes and, 98 Myocardial infarction, antiphospholipid antibodies and, 219-220
N Natural killer cells adoptive T cell therapy of tumors and, 302,315-319,333 CD23 antigen and, 155 SCID and, 382,396-397 surface antigens of human leukocytes and, 90,94,114-115 adhesion molecules, 83,88 antigen-specific receptors, 79 MHC glycoproteins, 81-82 N-CAM, surface antigens of human leukocytes and, 88, 114 Neurotransmitter receptors, surface antigens of human leukocytes and, 101,111 Neutralization, antiphospholipid antibodies and, 244 Neutrophils adoptive T cell therapy of tumors and, 328 surface antigens of human leukocytes and, 86,88,93, 112 Nucleotides autoimmune demyelinating disease and, 386 Ig heavy-chain variable region genes and D segments, 28-29,31,33 J H segments, 34 polymorphism of V H gene segments, 22-27 regulation, 57 V H families, 7-9, 16, 19 VH gene expression, 39,43,48-49, 51 SCID and, 383
0 Oligonucleotides CD23 antigen and, 162 Ig heavy-chain variable region genes and, 23,27 Ontogeny CD23 antigen and, 150 Ig heavy-chain variable region genes and, 2, 33,36-39,41,57 SCID and, 398-400 Oxidative burst, surface antigens of human leukocytes and, 111
P Paralysis, autoimmune demyelinating disease and, 371-372 Paraprotein antiphospholipid antibodies and, 242 Ig heavy-chain variable region genes and, 35,43,46-48 Partial thromboplastin time (PTT), antiphospholipid antibodies and, 200 Partial thromboplastin time with kaolin (PTTK), antiphospholipid antibodies and, 201 Pathogenesis antiphospholipid antibodies and, 193, 227,238,252-257 autoimmune demyelinating disease and, 357-358,360,368,370,374 CD23 antigen and, 174 Ig heavy-chain variable region genes and, 49-50 surface antigens of human leukocytes and, 81 Peptides adoptive T cell therapy of tumors and, 283,319,321-323,334 autoimmune demyelinating disease and, 357 multiple sclerosis, 369-371,373-375 myelin basic protein, 357-361 TCR usage restriction, 363,366 CD23 antigen and, 156 SCID and, 387 surface antigens of human leukocytes and, 80-82,112
428
INDEX
Peripheral blood lymphocytes adoptive T cell therapy of tumors and, 16 antiphospholipid antibodies and, 245 CD23 antigen and, 166 SCID and, 385 Peripheral blood mononuclear cells (PBMC), CD23 antigen and, 152, 157, 174 P-glycoprotein, surface antigens of human leukocytes and, 114-115 Phagocytosis adoptive T cell therapy of tumors and, 319,323,328 CD23 antigen and, 167 surface antigens of human leukocytes and, 89 Phenothiazine, antiphospholipid antibodies and, 212,227 Phenotype adoptive T cell therapy of tumors and, 325,333 mechanisms, 299-300,316 principles, 290,297 autoimmune demyelinating disease and, 362-363 Ig heavy-chain variable region genes and, 24 SCID and, 381-385,387,391 lack of stem cell engraftment, 396-397 posttransplant immunocompetence, 400 T cell-depleted bone marrow, 394-395 surface antigens of human leukocytes and, 101 Phorbol esters adoptive T cell therapy of tumors and, 307 CD23 antigen and, 151, 172 Phosphatidic acid, antiphospholipid antibodies and, 194,236-237,242, 248 Phosphatidylcholine (PC), antiphospholipid antibodies and, 259 biochemistry, 194, 196-197 LA antibodies, 242-246 specificity, 234-237,248,251
Phosphatidylethanolamine(PE), antiphospholipid antibodies and biochemistry, 194, 196-197 clinical aspects, 202 LA antibodies, 242-248 specificity, 236-237,251-252 Phosphatidylinositol (PI), antiphospholipid antibodies and, 194,229,251 LA antibodies, 242-243,246 specificity, 236-237 Phosphatidylserine (PS), antiphospholipid antibodies and, 194,259 affinity purification, 229-231 antibody subsets, 232 clinical aspects, 201,204 specificity, 236,240,242-248,251 Phosphodiester groups, antiphospholipid antibodies and, 235,237,240,248 Phospholipase antiphospholipid antibodies and, 235, 239,246,251 SCID and, 386 surface antigens of human leukocytes and, 111 Phospholipid, antiphospholipid antibodies and, See Antiphospholipid antibodies Phosphorylation CD23 antigen and, 156 SCID and, 383 surface antigens of human leukocytes and, 117 adhesion molecules, 86 antigen-specific receptors, 76-77 complement components, 92 receptors, 98-100 Phytohemagglutinin CD23 antigen and, 150,171 SCID and, 386 Plasma, antiphospholipid antibodies and, 259 antibody subsets, 232 binding to cell membrane, 252 clinical aspects, 200-202, 206, 224 isotype, 227 pathogenic potential, 253-254,257 specificity, 240-242,244-245, 247-248
INDEX
Plasma cells, surface antigens of human leukocytes and, 77,98, 116 Plasmacytoma adoptive T cell therapy of tumors and, 301,305 CD23 antigen and, 153 Plasma membrane, antiphospholipid antibodies and, 193, 197,204, 212-213 Platelet-activating factor, CD23 antigen and, 154,159-161 Platelet neutralization procedure, antiphospholipid antibodies and, 202,244 Platelets antiphospholipid antibodies and, 193, 197 affinity purification, 231 binding to cell membranes, 251-252 clinical aspects, 200,202-203,213 pathogenic potential, 254-257 specificity, 239,241-242,244-246 CD23 antigen and, 161,167 SCID and, 382 surface antigens of human leukocytes and, 85-86,88 Polymerase chain reaction autoimmune demyelinating disease and, 357,368 Ig heavy-chain variable region genes and, 27,35-36 Polymerization antiphospholipid antibodies and, 230 CD23 antigen and, 168 Polymorphism autoimmune demyelinating disease and, 365,368-369 Ig heavy-chain variable region genes and, 1-3 J H segments, 34 VH families, 9, 17-18, 20-21 VH gene expression, 41,48 VH gene segments, 21-28 surface antigens of human leukocytes and, SO-81,92 Polypeptides, surface antigens of human leukocytes and, 92,94,101, 112-113, 115 Poly saccharides CD23 antigen and, 162
surface antigens of human leukocytes and, 87 Prednisone, antiphospholipid antibodies and, 223 Primary antiphospholipid syndrome (PAPS), 257-259 clinical aspects, 209,219,221-222 isotype, 225-226 Priming adoptive T cell therapy of tumors and, 308-310,321,325,329-332 autoimmune demyelinating disease and, 370 Proliferation adoptive T cell therapy of tumors and, 283,334-335 antigen recognition, 319,321 expression of antitumor responses, 325-330 mechanisms, 300,302,304 principles, 289-290,294,298 autoimmune demyelinating disease and, 359-360,362,364-366,370 SCID and, 384-387,390-391,400 Promoters CD23 antigen and, 166-167 Ig heavy-chain variable region genes and, 53-56,61 OTF2,55 Prostacyclin, antiphospholipid antibodies and, 253,255 Prostaglandin adoptive T cell therapy of tumors and, 287 CD23 antigen and, 160 SCID and, 384 Protein adoptive T cell therapy of tumors and, 283,334-335 antigen recognition, 319-324 expression of antitumor responses, 324,331-332 antiphospholipid antibodies and, 195, 259 affinity purification, 229-230 clinical aspects, 200,203,213 pathogenic potential, 253-254, 256-257 specificity, 239-240,247-248, 250-252
430
INDEX
autoimmune demyelinating disease and, 369 CD23 antigen and, 176 biological activity, 169, 171 cellular expression, 152-154 cleavage regulation, 158 expression regulation, 160 FcERII, 162-165,167 Ig heavy-chain variable region genes and, 1-3 D segments, 33 regulation, 53-57 VH families, 6-9, 11, 15, 18 VH gene expression, 39,41,43,46, 51 SCID and, 387 surface antigens of human leukocytes and, 85,90,115-117,125 antigen-specific receptors, 76-77,79 MHC glycoproteins, 80,82 Protein C, antiphospholipid antibodies and, 253-256 Protein kinase, surface antigens of human leukocytes and, 77,81,83, 113 Proteolipid protein, autoimmune demyelinating disease and, 362,374 Proteolysis CD23 antigen and, 156-158, 173 surface antigens of human leukocytes and, 90,93, 112 Prothrombin, antiphospholipid antibodies and, 231,242-243,248 Prothrombin activator complex, antiphospholipid antibodies and, 199,241 Prothrombin time, antiphospholipid antibodies and, 200 Prototypic sequences, Ig heavy-chain variable region genes and, 6-7 Pseudoallelism, Ig heavy-chain variable region genes and, 14 Pseudogenes, Ig heavy-chain variable region genes and, 57,61 D segments, 29 J H segments, 33-34 organization, 3,6,8-9, 14-15, 17 VH gene expression, 39,52 Pulmonary embolism, antiphospholipid antibodies and, 219
Pulsed-field gel analysis, Ig heavy-chain variable region genes and, 4-5
R Reagin, antiphospholipid antibodies and, 258 biochemistry, 198 specificity, 234-236,240,249-250 Recombination, Ig heavy-chain variable region genes and, 3 , 6 , 9 D segments, 28,30-32 polymorphism of VH gene segments, 22,24,26 Renal transplant, SCID and, 399 Restriction fragment-length polymorphism, Ig heavy-chain variable region genes and, 4,22-23, 25,27,43 Reticular dysgenesis, SCID and, 382, 389 Retrovirus adoptive T cell therapy of tumors and, 282,320,335 mechanisms, 313-314 principles, 292,295 SCID and, 400 surface antigens of human leukocytes and, 99 Retrovirus-transformed tumors, adoptive T cell therapy of tumors and, 281, 295 Rheumatoid arthritis antiphospholipid antibodies and, 208-210 CD23 antigen and, 174 Ig heavy-chain variable region genes and, 4 3 , 4 6 4 7 Rheumatoid factors antiphospholipid antibodies and, 210 Ig heavy-chain variable region genes and, 31,43,46-47,52 RNA Ig heavy-chain variable region genes and, 33,38,55 SCID and, 383,385
S Sarcoma, adoptive T cell therapy of tumors and, 286,291,297,301,305
INDEX
SCID, See Severe combined immune deficiency Selectins CD23 antigen and, 163 surface antigens of human leukocytes and, 88 Selection, Ig heavy-chain variable region genes and, 22,25,40 Sequences autoimmune demyelinating disease and, 360-361,363-366,368 CD23 antigen and, 162-163, 166-167 Ig heavy-chain variable region genes and, 1,3,6,63 D segments, 28-33 JH segments, 33-34 polymorphism of V H gene segments, 22-27 regulation, 53,55-61 VH families, 6-11, 14-20 VH gene expression, 35,39,51 surface antigens of human leukocytes and, 77,90 Severe combined immune deficiency (SCID),381-388,402 graft-versus-host disease, 397-398 histocompatible bone marrow transplantation, 392 posttransplant immunocompetence, 399-402 stem cell engraftment, 388-392 lack of, 396-397 tolerance, 398-399 transplantation with fetal tissue, 392-393 with T cell-depleted bone marrow, 393-396 Sialic acid, CD23 antigen and, 155-156 Signal transduction adoptive T cell therapy of tumors and, 287,289,302,313,316 CD23 antigen and, 156 SCID and, 386 surface antigens of human leukocytes and, 113,125 adhesion molecules, 87 antigen-specific receptors, 76-78 MHC glycoproteins, 81 receptors, 98, 100
43 1
Sjogrens syndrome, antiphospholipid antibodies and, 209-210 SLE, See Systemic lupus erythematosus Solid-phase immunoassay, antiphospholipid antibodies and, 193,199,258-259 affinity purification, 230-231 antibody subsets, 232 clinical aspects, 200,203-206 isotype, 227 specificity, 235,243,249 Solid tumors, adoptive T cell therapy and, 284,293 Somatic mutation adoptive T cell therapy of tumors and, 282 Ig heavy-chain variable region genes and, 2,7,26 D segments, 28,32 VH gene expression, 37,39,41,46, 49,52 Southern blot analysis autoimmune demyelinating disease and, 363 SCID and, 385-386 Soybean agglutinin (SBA), SCID and, 394-396 Spleen, adoptive T cell therapy of tumors and antigen recognition, 321 expression of antitumor responses, 331-332 mechanisms, 300,309 principles, 293,295-298 Staphylococcus aureus Cowan I, CD23 antigen and, 151 Steroids, antiphospholipid antibodies and, 223,232 Stroke, antiphospholipid antibodies and, 218,221,258 Surface antigens of human leukocytes, 75-76,116-126 adhesion molecules, 82-89 antigen-specific receptors, 76-80 membrane enzymes, 111-114 MHC glycoproteins, 80-82 receptors chemotactic, 111 for complement components, 91-94 for growth factors, 99-101
432
INDEX
for immunoglobulins, 89-91
for interleukins, 94,98-99 membrane proteins, 93-97 for neurotransmitters, 101,111 T cell molecules, 101-110 transport proteins, 114-116 SV40 virus, Ig heavy-chain variable region genes and, 56-57 Syphilis, See also Biological false positive serological test for syphilis antiphospholipid antibodies and antibody subsets, 232 history, 198-199 specificity, 234-236,240,249-250 Systemic lupus erythematosus antiphospholipid antibodies and, 193, 198,257,259 affinity purification, 229 antibody subsets, 231 binding, 251-252 clinical aspects, 206-209, 212 isotype, 225-227 LA antibodies, 245-246 pathogenic potential, 252-255,257 specificity, 234-236,238-239, 248-249 syndromes, 213-216,218-222 CD23 antigen and, 174-175 Ig heavy-chain variable region genes and, 46-50 T
T cell-depleted haploidentical bone marrow, SCID and, 393-396 T cell receptor adoptive T cell therapy of tumors and, 299 autoimmune demyelinating disease and, 357 myelin basic protein, 358-360 usage restriction, 363-366 Ig heavy-chain variable region genes and, 5 SCID and, 384,386-388,396,400 surface antigens of human leukocytes and, 77-79,81-83,86-87 T cell receptor-variable regions autoimmune demyelinating disease and, 357
usage restriction, 363-364,366-367 multiple sclerosis and, 372-375 T cells, See also Cytotoxic T cells autoimmune demyelinating disease and multiple sclerosis, 369-375 myelin basic protein, 358,360-362 TCR usage restriction, 363-366 CD23 antigen and, 149, 176 biological activity, 167, 169-170 cellular expression, 151-153, 155 cleavage regulation, 158 expression regulation, 159 FcrRII, 164 Ig heavy-chain variable region genes and, 52,54 surface antigens of human leukocytes and, 116-117,125 adhesion molecules, 83,85,87,89 antigen-specific receptors, 76, 78-79 immunoglobulins, 91 membrane enzymes, 112-1 14 MHC glycoproteins, 80-81 receptors, 98, 101-110 T cell therapy of tumors, See Adoptive T cell therapy of tumors Terminal deoxynucleotidyl transferase (TdT), Ig heavy-chain variable region genes and, 31 T helper cells adoptive T cell therapy of tumors and, 289-291 expression of antitumor responses, 327-328,332 mechanisms, 299,312 CD23 antigen and, 159 surface antigens of human leukocytes and, 77 Thrombin, antiphospholipid antibodies and, 197 Thrombocytopenia (TCP), antiphospholipid antibodies and, 199,257-258 clinical aspects, 209,222 isotype, 225-226 pathogenic potential, 252,254 specificity, 250,252 syndromes, 213,215-216,218,221 Thrombomodulin, antiphospholipid antibodies and, 254
INDEX
Thromboplastin, antiphospholipid antibodies and antibody subsets, 232 clinical aspects, 200-201,205 specificity, 243-245 Thromboplastin inhibition test, antiphospholipid antibodies and, 202-203 Thrombosis, antiphospholipid antibodies and, 194,199,257-258 antibody subsets, 233 clinical aspects, 204,211-212 isotype, 225-227 pathogenic potential, 252-254, 256-257 specificity, 239,250 syndromes, 213-221,223 Thrombospondin, surface antigens of human leukocytes and, 86 Thromboxane, antiphospholipid antibodies and, 254 Thy-1, surface antigens of human leukocytes and, 117 Thymectomy, adoptive T cell therapy of tumors and, 288,300 Thymic hormones, SCID and, 384,391 Thymic stroma, SCID and, 384,392-393 Thymus CD23 antigen and, 169-171 Ig heavy-chain variable region genes and, 50 SCID and, 383-384,392-393,398, 400,402 surface antigens of human leukocytes and, 78-79,81,83,114-117 Tissue specificity, Ig heavy-chain variable region genes and, 3,52-56 T lymphocytes CD23 antigen and, 151-153 SCID and, 381-388 graft-versus-host disease, 397-398 lack of stem cell engraftment, 396 posttransplant immunocompetence, 399-402 stem cell engraftment, 388-391 tolerance, 398-399 transplantation, 393-396 surface antigens of human leukocytes and, 86,98,112,114, 125 Tolerance, SCID and, 398-399
433
Total body irradiation, SCID and, 397 Transcription autoimmune demyelinating disease and, 368 CD23 antigen and, 165-167 Ig heavy-chain variable region genes and, 15,33,37,53-56 SCID and, 387 Transfection adoptive T cell therapy of tumors and, 320-321,329 CD23 antigen and, 161,169 Ig heavy-chain variable region genes and, 53 Transferrin SCID and, 385-386 surface antigens of human leukocytes and, 115 Transforming growth factor-p adoptive T cell therapy of tumors and, 287 CD23 antigen and, 160-161 Translocation adoptive T cell therapy of tumors and, 283,320,323 Ig heavy-chain variable region genes and, 18 surface antigens of human leukocytes and, 98 Transplantation, bone marrow, for SCID, See Severe combined immune deficiency Transplantation antigens, adoptive T cell therapy of tumors and, 281 Transport proteins, surface antigens of human leukocytes and, 114-116 Transverse myelitis, antiphospholipid antibodies and, 209 Trypsin adoptive T cell therapy of tumors and, 301,306 antiphospholipid antibodies and, 239, 25 1 T suppressor cells, adoptive T cell therapy of tumors and, 287-289,293 Tumor-infiltrating lymphocytes (TIL), adoptive T cell therapy and, 284,293 Tumor necrosis factor adoptive T cell therapy of tumors and, 301,306-309
434
INDEX
autoimmune demyelinating disease and, 360 surface antigens of human leukocytes and, 98 Tumor rejection, adoptive T cell therapy of tumors and, 286,296,318,333 B cells, 312-315 macrophages, 306-312 mechanisms,299-306 NK cells, 315-318 Tumors adoptive T cell therapy of, See Adoptive T cell therapy of tumors Ig heavy-chain variable region genes and, 9, 11 surface antigens of human leukocytes and, 115 Tumor transplantation, 281-282,286 Tunicarnycin, CD23 antigen and, 158, 162 Tyrosine, surface antigens of human leukocytes and, 77 Tyrosine kinase CD23 antigen and, 169 surface antigens of human leukocytes and, 78,99-100,113
U UV-induced tumors, adoptive T cell therapy of tumors and, 281,283-284
V Vaccination, multiple sclerosis and, 374-375 Variable region genes, Ig heavy-chain, See Immunoglobulin heavy-chain variable region genes VDRL antigen, antiphospholipid antibodies and, 227-228,234-238 VH genes, See Immunoglobulin heavy-chain variable region genes Virus adoptive T cell therapy of tumors and, 282-283,323,334 mechanisms, 311,313-314,318 Ig heavy-chain variable region genes and, 56 surface antigens of human leukocytes and, 80, 118 VLA antigens, surface antigens of human leukocytes and, 83-85,88
W Waldenstrom’s macroglobulineniia antiphospholipid antibodies and, 227-228 Ig heavy-chain variable region genes and, 40
Volume 39
Volume 40
Immunological Regulation of Hematopoietic/LymphoidStem Cell Differentiation by Interleukin 3
Regulation of Human B Lymphocyte Activation, Proliferation, and Differentiation
JAMES N.
IHLEAND YACOB WEINSTEIN Antigen Presentation by B Cells and Its Significance in T-B Interactions
ROBERTW. CHESTNUT AND HOWARD M. GREY Ligand-Receptor Dynamics and Signal Amplification in the Neutrophil
LARRY A. SKLAR Arachidonic Acid Metabolism by the 5-Lipoxygenase Pathway, and the Effects of Alternative Dietary Fatty Acids
TAKH. LEEAND K. FRANK AUSTEN The Eosinophilic Leukocyte: Structure and Function
GERALD J. GLEICHAND CHERYL R. ADOLPHSON
DIANEF. JELINER AND PETERE. LIPSKY Biological Activities Residing in the Fc Region of Immunoglobulin
EDWARD L. MORGAN AND WILLIAM 0. WEIGLE Immunoglobulin-Specific Suppressor T Cells
RICHARDG. LYNCH Immunoglobulin A (IgA): Molecular and Cellular Interactions Involved in IgA Biosynthesisand Immune Response
MESTECKY AND JERRY R. MCGHEE JIRI
The Arrangement of Immunoglobulin and T Cell Receptor Genes in Human LymphoproliferativeDisorders
THOMAS A. WALDMANN Human Tumors Antigens
ldiotypic Interactions in the Treatment of Human Diseases RAIF S. GEHA Neuroimmunology
DONALD G. PAYAN, JOSEPHP. MCGILLIS,AND EDWARD J. GOETZL INDEX
RALPH A. REISFELDAND DAVIDA. CHERESH Human Marrow Transplantation: An Immunological Perspective
PAULJ. MARTIN, JOHN A. HANSEN, RAINERSTORB, AND E. DONNALL THOMAS
INDEX
436
CONTENTS OF RECENT VOLUMES
Volume 41 Cell Surface Molecules and Early Events Involved In Human T Lymphocyte Activation
ARTHURWEISSAND JOHN B. IMBODEN
The Molecular Genetics of the Arsonate Idiotypic System of A/J Mice
GARY RATHBUN, INAKISANZ, KATHERYN MEEK, PHILIPTUCKER, AND J. DONALD CAPRA The lnterleukin 2 Receptor
Function and Specificity of T Cell Subsets in the Mouse
JONATHAN~PRENTAND SUSAN R. WEBB Determinants on Major Histocompatibility Complex Class I Molecules Recognized by Cytotoxic T Lymphocytes
JAMES FORMAN Experimental Models for Understanding B Lymphocyte Formation
KENDALLA. SMITH Characterizationof Functional Surface Structures on Human Natural Killer Cells
JEROME RITZ, REINHOLDE. SCHMIDT, JEANMICHON, AND THIERRY HERCEND, STUART F. SCHLOSSMAN The Common Mediator of Shock, Cachexia, and Tumor Necrosis
B. BEUTLER AND A. CERAMI
PAULW. KINCADE Myasthenia Gravis Cellular and Humoral Mechanisms of Cytotoxicity: Structural and Functional Analogies
DING-EYOUNGAND ZANVIL A. COHN
LINDSTROM, DIANESHELTON, AND YOSHITAKA FUJII
JON
JOHN
Biology and Genetics of Hybrid Resistance
Alterations of the Immune System in Ulcerative Colitis and Crohn's Disease
RICHARDP. MACDERMOTT AND WILLIAM F. STENSON
MICHAELBENNETT INDEX INDEX
Volume 43 Volume 42 The Clonoiypa Repertoire of B Cell Subpopulations
NORMANR. KLINMAN AND PHYLLIS-JEAN LINTON
The Chemistry and Mechanism of Antibody Binding to Protein Antigens
ELIZABETH D. GETZOFF, JOHNA. TAINER, RICHARDA. LERNER, AND H. MARIOGEYSEN
CONTENTS OF RECENT VOLUMES
Structure of Antibody-Antigen Complexes: Implications for Immune Recognition
P. M. COLEMAN The y8 T Cell Receptor
MICHAELB. BRENNER, JACKL. STROMINGER, AND MICHAELS. KFUNGEL Specificity of the T Cell Receptor for Antigen
STEPHENM. HEDRICK Transcriptional Controlling Elements in the Immunological and T Cell Receptor Loci
KATHRYNCALAME AND SUZANNE EATON Molecular Aspects of Receptors and Binding Factors for IgE
HENRYMETZGER INDEX
Volume 44 Diversity of the Immunoglobulin Gene Superfamily
TIMHUNKAPILLERAND LEROYHOOD Genetically Engineered Antibody Molecules
SHERIEL. MORRISONAND VERNONT. 01 Antinuclear Antibodies: Diagnostic Markers for Autoimmune Diseases and Probes for Cell Biology
ENGM. TAN Interleukin-1and Its Biologically Related Cytokines
CHARLES A. DINARELLO
437
Molecular and Cellular Events of T Cell Development
B. J. FOWLKES AND DREWM. PARDOLL Molecular Biology and Function of CD4 and CD8
JANER. PARNES Lymphocyte Homing
TEDA. YEDNOCK AND STEVEND. ROSEN INDEX
Volume 45 Cellular Interactions in the Humoral Immune Response
ELLENS. VITETTA, RAPAEL FERNANDEZ-BOTRAN, CHRISTOPHER D. MYERS,AND VIRCINAM. SANDERS MHC-Antigen.lnteradions:What Does the T Cell Receptor See?
PHILIPPEKOURILSKYAND JEAN-MICHELCLAVERIE Synthetic T and B Cell Recognition Sites: Implications for Vaccine Development
DAVIDR. MILICH Rationale for the Development of an Engineered Sporozoite Malaria Vaccine
VICTORNUSSENZWEICAND RUTH S. NUSSENZWEIC Virus-Induced Immunosuppression: Infections with Measles Virus and Human ImmunodeficiencyVirus
MICHAELB. MCCHESNEYAND MICHAELB. A. OLDSTONE
438
CONTENTS OF RECENT VOLUMES
The Regulators of Complement Activation (RCA) Gene Cluster
DENNIS HOURCADE, V. MICHAELHOLERS, AND JOHNP. ATKINSON Origin and Significance of Autoreactive
T Cells MAURICEZAUDERER
The Cellular and Subcellular Bases of Immunosenescence
MARILYNL. THOMAN AND WILLIAM 0.WEIGLE Immune Mechanisms in Autoimmune Thyroiditis
JEANNINE CHARREIRE INDEX
INDEX Volume 47 Volume 46
Regulation of lmmunoglobin E Biosynthesis
KIMISHIGE ISHIZAKA Physical Maps of the Mouse and Human Immunoglobulin-like Loci
ERICLAI,RICHARD K. WILSON, AND LEROY E. HOOD Molecular Genetics of Murine Lupus Models
Control of the Immune Response at the Level of Antigen-Presenting Cells: A Comparison of the Function of Dendritic Cells and 8 Lymphocytes
JOSHUA P. METLAY, ELLENPus, AND RALPHM. STEINMAN
ARGYRIOSN. THEOFILOPOULOS, REINHOLD KOPLER, The CD5 B Cell PAULA. SINGER, AND THOMAS J. KIPPS FRANK J. DIXON
Biology of Natural Killer Cells Heterogeneity of Cytokine Secretion Patterns and Functions of Helper T Cells
TIMR. MOSMANN AND ROBERTL. COFFMAN The Leukocyte lntegrins
TAKASHI K. KISHMOTO, RICHARDS. LARSON, ANGELL. CORBI, MICHAELL. DUSTIN, E. STAUNTON, AND DONALD TIMOTHY A. SPRINGER Structure and Function of the Complement Receptors, CR1 (CD35) and CR2 (CD21)
JOSEPHM. AHEARNAND DOUGLAS T. FEAROW
GIORGIO TRINCHIERI The lmmunopathogenesis of HIV Infection
ZEDAF. ROSENBERCAND ANTHONYS. FAUCI The Obeses Strain of Chickens: An Animal Model with Spontaneous Autoimmune Thyroiditis
GEORGE WICK, HANSPETERBREZINSCHEK, KAREL HAL, HERMANN DIETRICH, HUGOWOLF,AND G u r w KROEMER INDEX
CONTENTS OF RECENT VOLUMES
Volume 48 Internal Movements in Immunoglobulin Molecules
ROALDNEZLIN Somatic Diversification of the Chicken Immunoglobulin Light-Chain Gene
WAYNE T. MCCORMACK AND CRAIG B. THOMPSON T Lymphocyte-Derived Colony-Stimulating Factors
Neuroimmunology
E. J. GOETZL, D. C. ADELMAN, S. P. SREEDHARAN
AND
Immune Privilege and Immune Regulation in the Eye JERRY
The Molecular Basis of Human Leukocyte Antigen Class II Disease Associations
DOMINQUE CHARRON
Y. NIEDERKORN
Molecular Events Mediating T Cell Activation
AMNON ALTMAN, K. MARKCOGGESHALL, AND TOMAS MUSTELIN
ANNEKELSOAND
DONALD METCALF
439
INDEX
This Page Intentionally Left Blank
