Advances in Food and Nutrition Research, Vol. 54 issue 1043-4526

Advances in

FOOD AND NUTRITION RESEARCH VOLUME

54

ADVISORY BOARDS KEN BUCKLE University of New South Wales, Australia

MARY ELLEN CAMIRE University of Maine, USA

ROGER CLEMENS University of Southern California, USA

HILDEGARDE HEYMANN University of California, Davis, USA

ROBERT HUTKINS University of Nebraska, USA

RONALD JACKSON Quebec, Canada

HUUB LELIEVELD Global Harmonization Initiative, The Netherlands

DARYL B. LUND University of Wisconsin, USA

CONNIE WEAVER Purdue University, USA

RONALD WROLSTAD Oregon State University, USA

SERIES EDITORS GEORGE F. STEWART

(1948–1982)

EMIL M. MRAK

(1948–1987)

C. O. CHICHESTER

(1959–1988)

BERNARD S. SCHWEIGERT (1984–1988) JOHN E. KINSELLA

(1989–1993)

STEVE L. TAYLOR

(1995–

)

Advances in

FOOD AND NUTRITION RESEARCH VOLUME

54 Edited by

STEVE L. TAYLOR University of Nebraska, Lincoln

AMSTERDAM • BOSTON • HEIDELBERG • LONDON NEW YORK • OXFORD • PARIS • SAN DIEGO SAN FRANCISCO • SINGAPORE • SYDNEY • TOKYO Academic Press is an imprint of Elsevier

Academic Press is an imprint of Elsevier 84 Theobald’s Road, London WC1X 8RR, UK Radarweg 29, PO Box 211, 1000 AE Amsterdam, The Netherlands Linacre House, Jordan Hill, Oxford OX2 8DP, UK 30 Corporate Drive, Suite 400, Burlington, MA 01803, USA 525 B Street, Suite 1900, San Diego, CA 92101-4495, USA First edition 2008 Copyright # 2008 Elsevier Inc. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means electronic, mechanical, photocopying, recording or otherwise without the prior written permission of the publisher. Permissions may be sought directly from Elsevier’s Science & Technology Rights Department in Oxford, UK: phone (+44) (0) 1865 843830; fax (+44) (0) 1865 853333; email: [email protected]. Alternatively you can submit your request online by visiting the Elsevier web site at http://elsevier.com/locate/permissions, and selecting Obtaining permission to use Elsevier material. Notice No responsibility is assumed by the publisher for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions or ideas contained in the material herein. Because of rapid advances in the medical sciences, in particular, independent verification of diagnoses and drug dosages should be made. ISBN: 978-0-12-373740-3 ISSN: 1043-4526 For information on all Academic Press publications visit our website at books.elsevier.com Printed and bound in USA 08 09 10 11 12 10 9 8 7 6 5 4 3 2 1

CONTENTS

Contributors

1. Biosensors and Bio-Based Methods for the Separation and Detection of Foodborne Pathogens

vii

1

Arun K. Bhunia Introduction Separation and Concentration of Pathogens from Samples Biosensor-Based Detection Methods Conclusions Acknowledgments References I. II. III. IV.

2. The Immunological Components of Human Milk

2 4 8 31 32 32

45

Heather J. Hosea Blewett, Michelle C. Cicalo, Carol D. Holland, and Catherine J. Field I. Introduction II. Effect of Breast-Feeding/Human Milk on Infectious

Diseases and Defenses III. Effect of Breast Milk on Immune Development IV. Tolerance V. Anti-Inflammatory Factors in Human Milk VI. Conclusions References

3. PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

46 48 56 63 66 69 69

81

Ludwig Niessen I. Introduction II. Conclusions and Future Perspectives

References

82 126 128

v

vi

Contents

4. Molluscan Shellfish Allergy

139

Steve L. Taylor I. II. III. IV. V. VI. VII.

Molluscan Shellfish Classification and Importance as Food Prevalence of Molluscan Shellfish Allergies IgE-Mediated Reactions in Molluscan Shellfish Allergy Diagnosis and Treatment of Molluscan Shellfish Allergy Molluscan Shellfish Allergens Cross-Reactions Conclusion Acknowledgments References

141 142 146 148 159 163 168 168 168

5. Nutritargeting

179

Hans Konrad Biesalski and Jana Tinz I. Nutritargeting for Selective Accumulation II. Nutritargeting as a Way of Bypassing Absorption Barriers III. Conclusion

References

6. The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

181 202 210 210

219

Susan Reinwald, Connie M. Weaver, and Jeffrey J. Kester Why Focus on Calcium Citrate Malate? Ca Needs and Current Intakes Description and Properties of CCM Studies of Ca Bioavailability from CCM Studies of Ca Retention and Bone Building in Children and Adolescents VI. Studies of Bone Maintenance in Adults VII. Other Health Benefits VIII. Limitations of CCM IX. Conclusion References I. II. III. IV. V.

Index

221 222 232 244 276 289 298 323 324 328 347

CONTRIBUTORS

Numbers in parentheses indicate the pages on which the authors' contributions begin.

 Arun K. Bhunia

Molecular Food Microbiology Laboratory, Department of Food Science, Purdue University, 745 Agriculture Mall Drive, West Lafayette, Indiana 47907 (1)  Hans Konrad Biesalski

Department of Biological Chemistry and Nutrition, University of Hohenheim, Garbenstrasse 30, 70593 Stuttgart, Germany (179)  Michelle C. Cicalo

Department of Agricultural, Food and Nutritional Sciences, Alberta Institute for Human Nutrition, University of Alberta, Edmonton, Alberta, T6G 2P5, Canada (45)  Catherine J. Field

Department of Agricultural, Food and Nutritional Sciences, Alberta Institute for Human Nutrition, University of Alberta, Edmonton, Alberta, T6G 2P5, Canada (45)  Carol D. Holland

Department of Agricultural, Food and Nutritional Sciences, Alberta Institute for Human Nutrition, University of Alberta, Edmonton, Alberta, T6G 2P5, Canada (45)  Heather J. Hosea Blewett

Department of Agricultural, Food and Nutritional Sciences, Alberta Institute for Human Nutrition, University of Alberta, Edmonton, Alberta, T6G 2P5, Canada (45)  Jeffrey J. Kester

Coffee & Snacks Technology Division, The Procter & Gamble Company, Miami Valley Innovation Center, Cincinnati, Ohio 45252 (219)  Ludwig Niessen

Technische Universita¨t Mu¨nchen, Lehrstuhl fu¨r Technische Mikrobiologie, Weihenstephaner Steig 16, D-85350 Freising, Germany (81)

vii

viii

Contributors

 Susan Reinwald

Department of Foods and Nutrition, Purdue University, West Lafayette, Indiana 47907 (219)  Steve L. Taylor

Department of Food Science and Technology, Food Allergy Research and Resource Program, University of Nebraska, Lincoln, Nebraska 68583-0919 (139)  Jana Tinz

Department of Biological Chemistry and Nutrition, University of Hohenheim, Garbenstrasse 30, 70593 Stuttgart, Germany (179)  Connie M. Weaver

Department of Foods and Nutrition, Purdue University, West Lafayette, Indiana 47907 (219)

CHAPTER

1 Biosensors and Bio-Based Methods for the Separation and Detection of Foodborne Pathogens Arun K. Bhunia*

Contents

I. Introduction II. Separation and Concentration of Pathogens from Samples A. Antibody, a key molecule in bioseparation and detection III. Biosensor-Based Detection Methods A. Fiber optic biosensor B. SPR sensor C. Piezoelectric (PZ) biosensors D. Electrochemical immunosensor E. Fluorescence resonance energy transfer F. Fourier transform infrared spectroscopy G. Light scattering H. Impedance-based biochip sensor I. Cell-based sensor IV. Conclusions Acknowledgments References

2 4 5 8 9 13 18 19 22 23 23 24 28 31 32 32

* Molecular Food Microbiology Laboratory, Department of Food Science, Purdue University, 745 Agriculture

Mall Drive, West Lafayette, Indiana 47907. E-mail: [email protected] Advances in Food and Nutrition Research, Volume 54 ISSN 1043-4526, DOI: 10.1016/S1043-4526(07)00001-0

#

2008 Elsevier Inc. All rights reserved.

1

2

Abstract

Arun K. Bhunia

The safety of our food supply is always a major concern to consumers, food producers, and regulatory agencies. A safer food supply improves consumer confidence and brings economic stability. The safety of foods from farm-to-fork through the supply chain continuum must be established to protect consumers from debilitating, sometimes fatal episodes of pathogen outbreaks. The implementation of preventive strategies like hazard analysis critical control points (HACCP) assures safety but its full utility will not be realized unless supportive tools are fully developed. Rapid, sensitive, and accurate detection methods are such essential tools that, when integrated with HACCP, will improve safety of products. Traditional microbiological methods are powerful, error-proof, and dependable but these lengthy, cumbersome methods are often ineffective because they are not compatible with the speed at which the products are manufactured and the short shelf life of products. Automation in detection methods is highly desirable, but is not achievable with traditional methods. Therefore, biosensorbased tools offer the most promising solutions and address some of the modern-day needs for fast and sensitive detection of pathogens in real time or near real time. The application of several biosensor tools belonging to the categories of optical, electrochemical, and mass-based tools for detection of foodborne pathogens is reviewed in this chapter. Ironically, geometric growth in biosensor technology is fueled by the imminent threat of bioterrorism through food, water, and air and by the funding through various governmental agencies.

I. INTRODUCTION Food safety and food biosecurity continued to draw the attention of consumers, food manufacturers, and producers. Foodborne pathogen statistics show slight declines in the number of cases but increased number of outbreaks (Lynch et al., 2006), and product recalls continue to place a huge economic burden on producers and processors. The elimination of pathogens from raw unprocessed products had been the focus to reduce burdens before the products are transported to the processing plant. On-farm, pathogen-controlling strategies will help achieve that goal. However, the presence of pathogens in ready-to-eat products is a serious concern since these products generally do not receive any further treatment before consumption. In fact many recent foodborne outbreaks resulted from consumption of undercooked or processed ready-to-eat meats (hotdogs, sliced luncheon meats, and salami), dairy products (soft cheeses made with unpasteurized milk, ice cream, butter, etc.), or

Biosensors and Bio-Based Methods

3

minimally processed fruits (apple cider, strawberries, cantaloupe, etc.) and vegetables (sprouts, lettuce, etc.) (Altekruse et al., 2006; CDC, 2006; Doyle and Erickson, 2006; Lynch et al., 2006; Sivapalasingam et al., 2004). Food animals and poultry are the most important reservoirs for many of the foodborne pathogens. Therefore, meat, milk, or egg products may carry Salmonella, Campylobacter, Listeria, or Escherichia coli O157:H7 organisms. These products should be tested before retail distribution. Animal by-products, such as feed supplements, may also transmit pathogens to other animals [for example, Salmonella, bovine spongiform encephalopathy (BSE)] (Dormont, 2002). The application of untreated manure onto farmland may contaminate soil or water and eventually transmits microbes to fruits or vegetables (Brandl, 2006; Solomon et al., 2002). Seafoods are another potential source of pathogens, such as Vibrio, Listeria, Yersinia, Salmonella, Shigella, Clostridium, Campylobacter, and Hepatitis A (Carter, 2005; Feldhusen, 2000). Immunologically challenged populations such as the elderly, infants, person with malignant cancer, AIDS, or organ transplants are at higher risk than healthy ones for some of the foodborne pathogens (Trevejo et al., 2005). The infectious doses of many of these pathogens are very low (
10–1000 bacterial cells) (Balbus and Embrey, 2002). Detection technologies, both traditional and rapid, have helped ensure food safety, but ongoing concern with intentional administration of harmful microorganisms or toxins to food or water demands further improvement in detection technologies for fast time-to-result with a high degree of accuracy. In recent years, there has been an explosion of research activities in the area of sensor development with a primary focus on the biologically significant molecules including pathogenic microorganisms. Culture-based methods are considered a gold-standard for foodborne pathogen detection (Gracias and McKillip, 2004; Swaminathan and Feng, 1994), and this serves as a foundation for some of the modern-day rapid methods. The analysis of foods for the presence of both pathogenic and spoilage bacteria is a standard practice for ensuring food safety and quality. Traditional culture methods rely on specific microbiological media to isolate and enumerate viable bacterial cells in foods. These methods usually consist of five steps involving pre-enrichment, selective enrichment, selective plating, biochemical tests, and serological tests. The pre-enrichment step is beneficial since this step not only increases the populations of the target organism but also allows recovery of sublethally injured or stressed bacteria resulting from exposure to processing and storage conditions of heating, drying, freezing, cooling, preservatives, etc. Injured microbes are capable of recovering in food and causing disease in humans. Selective antimicrobial compounds are then added to the medium in the beginning or within 2–4 h of culturing to suppress the growth of competitive microorganisms. An aliquot of culture from

4

Arun K. Bhunia

the enrichment liquid is then plated onto selective or differential agar plates for the isolation of pure cultures. The identity of the isolated cultures is determined by phenotypic analysis of virulence traits or by biochemical characterization (metabolic fingerprinting). Culture methods are usually very sensitive, relatively inexpensive, and can give both qualitative and quantitative information on the number and the nature of the microorganisms. However, these methods are labor intensive and lengthy, requiring 5–7 days. Rapid and sensitive methods are highly desirable during implementation of hazard analysis critical control points (HACCP), especially in the food-processing plant for monitoring pathogens in raw materials, ready-to-eat food products, and to verify manufacturing process control. Bacteria-specific generic rapid methods such ATP-based luminescence and total plate count (APC) are also needed for monitoring cleaning and hygienic practices employed in a processing plant. Biosensor-based tools continue to capture the imaginations of researchers and users for their potential for the sensitive detection of pathogens in automated or semiautomated instruments in near real time. Broadly, pathogen detection is centered on four basic physiological or genetic properties of microorganisms: metabolic patterns of substrate utilization, phenotypic expression analysis of signature molecules by antibodies, nucleic acid analysis, and the analysis of the interaction of pathogens with eukaryotic cells (cytopathogenic effects). Many of today’s popular commercially available rapid methods use culture-based methods coupled with automated or semiautomated nucleic acid-, antibody-, or substrate utilization-based methods to obtain results in 24–72 h. Interestingly, many of the modern-day biosensor-based methods are developed utilizing one of the above four principles or combinations of some sort. However, antibody-based methods are the most popular because of their versatility, convenience, and relative ease in interpretation of the data. It is interesting to note that a majority of biosensors use antibody for capture and detection of the target analyte.

II. SEPARATION AND CONCENTRATION OF PATHOGENS FROM SAMPLES For pathogen detection, the sample preparation step is crucial. It is even more important when biosensor tools are employed for the detection. Food or environmental samples are highly complex consisting of fats, carbohydrates, proteins, salts, antimicrobial preservatives, etc., and moreover, the target pathogen numbers are generally very low. Thus, highly efficient pathogen separation and concentration strategies are needed to

Biosensors and Bio-Based Methods

5

achieve successful detection of pathogens and to avoid false-negative results. Several strategies including antibody-based and physical- and chemical-based separation and concentration methods have been developed for separation and concentration of pathogens from various sample matrices (Stevens and Jaykus, 2004). Antibody-based methods include immunomagnetic separation (IMS) (discussed in Section II.A.1), while the physical and chemical methods include centrifugation, filtration, chromatographic separation, and dielectrophoresis (DEP) (Chen et al., 2005a,b; Li and Bashir, 2002; Stevens and Jaykus, 2004).

A. Antibody, a key molecule in bioseparation and detection Antibodies are widely used for pathogen capture, concentration, and detection purposes (Liddell, 2005). The antibody-based assay methods are simple, less cumbersome, and easy to interpret and these methods allow detection of not only intact microbial cells but also their secreted toxins or by-products (Bhunia, 1997; Macario and De Macario, 1988). However, in some cases, antibody-based methods may not be able to differentiate live from dead cells. Immunoassays coupled with an active culturing method can overcome this problem. Additionally, microbes are routinely exposed to stress conditions such as acidic or alkaline pH, osmotic stress (salt), antimicrobial preservatives, storage temperatures, and heat shock conditions in food, which may alter their morphology and affect physiology resulting in aberrant antigen expression, which could weaken signals during antibody-based detection (Geng et al., 2003, 2006a, Hahm and Bhunia, 2006). The availability of an antigen-specific antibody is the key to the success of immunoassays. Furthermore, the binding affinity and avidity of antibodies are important properties, which should be thoroughly characterized before employing antibodies for specific applications. Polyclonal antibodies (PAbs) contain an assortment of antibody molecules recognizing different antigens and epitopes, and therefore may show some cross-reactions with antigens from different microbes. PAbs can be made epitope-specific for improved detection. The quality of PAbs may vary from batch to batch, which could affect the end-result. On the other hand, monoclonal antibody (MAb) is homogeneous and highly specific. Since MAb is produced by a single preselected clone (hybridoma line), it is always highly specific toward an antigen. Carefully designed experiments employing both PAbs and MAbs can provide the highest specificity in an immunoassay or immunosensor applications with reproducible and desirable results.

6

Arun K. Bhunia

1. Immunomagnetic separation Antibodies are also an integral part of sample preparation allowing the specific capture and concentration of bacteria from complex food matrices for detection by various methods. IMS methods use magnetic particles coated with ligands, including antibodies to purify target molecules from a mixture. Most of the particles used for these separations are superparamagnetic, that is, they only exhibit magnetic properties in the presence of an external magnetic field. They can be easily removed from a suspension by a magnetic separator (Safarik et al., 1995). Since there is usually no magnetic remmnance, the particles are not attracted to each other and therefore they can be easily suspended into a homogeneous mixture in the absence of any external magnetic field. The separation process for the purification of target cells using magnetic particles and magnetic separators usually consists of two fundamental steps. First, the suspension containing the cells of interest is mixed with immunomagnetic particles. Interaction of the target cells and the beads occurs during the incubation step (usually no longer than 30–60 min). Then the magnetic complex is separated using an appropriate magnetic separator, and the supernatant is discarded. Second, the magnetic complex is washed several times to remove unwanted contaminants. In this form, the selected cells with attached magnetic particles can be used for the further experiments. The most common magnetic carriers are the DynabeadsÒ (Dynal, Inc., Oslo, Norway) with diameter ranging from 2.8 to 4.5 mm. These are polystyrene beads coated with iron oxide and antibodies are generally immobilized using streptavidin and biotin chemistry. Immunomagnetic beads have been used for concentration and separation of selected microorganism from environmental samples (Mitchell et al., 1994) or foods (Skjerve et al., 1990). Either direct- or indirect-IMS can be used for recovery of the target organism. In the direct approach, the target organism is mixed with the magnetic particles that are coated with antibody specific for the organism. When the particles come in contact with the bacterial cells, they attach via the primary antibody. Once the particles are concentrated, the remaining solution is discarded and only the bound bacteria are recovered. In the indirect approach, the primary antibody is added to the suspension and allowed to attach to the target organism. Then the magnetic particles, coated with a secondary antibody specific for the primary antibody, are added and allowed to attach to the primary antibody. The magnetic particle complexes are then separated using the magnetic concentrator and the solution is removed, with only the bound bacteria remaining. The bacteria collected do not need to be detached since they are viable and can multiply as long as a sufficient amount of media is provided (Torensma et al., 1993).

Biosensors and Bio-Based Methods

7

Although experimentation for each specific application must be done to determine the number of immunomagnetic particles needed for capture, the general guidelines for the use of small particles (<5 mm sized) are in the ratio of 3:1–20:1 (beads: target cells) (Safarik et al., 1995). The incubation time could vary from 10 to 60 min. Longer incubations tend to improve capture efficiency; however, they may result in considerable nonspecific binding. Washing steps generally reduce nonspecific binding and the use of mild detergents, such as Tween-20, during initial incubation and subsequent washing steps further decreases nonspecific binding (Okrend et al., 1992; Safarik et al., 1995). One of the major drawbacks of using IMS is that there is a high likelihood that the magnetic particles will capture more than one of the target cells or that the particles or cells form aggregates, thus resulting in formation of only one colony when plated on a solid agar surface (Skjerve et al., 1990). Using fluorescence and scanning electron microscopy, it has been estimated that, depending on the bead size, each colony formed from an aggregate may contain up to six bacteria (Safarik et al., 1995). Immunomagnetic beads have been used for capture of E. coli O157:H7 (Chapman and Ashton, 2003; Evrendilek et al., 2001; Yu and Bruno, 1996), Salmonella (Favrin et al., 2001; Jordan et al., 2004; Rijpens et al., 1999; Trkov et al., 1999), and Listeria (Fluit et al., 1993; Kaclikova et al., 2001; Uyttendaele et al., 2000). Sometimes, the capture efficiency is highly variable, which depends on the pathogen and the quality of the antibodies used. In recent years, application of IMS coupled with PCR assays are showing very promising results for the detection of E. coli O157:H7 (Fu et al., 2005), Salmonella enterica (Jenikova et al., 2000; Mercanoglu and Aytac, 2002; Mercanoglu and Griffiths, 2005), and Listeria monocytogenes (Amagliani et al., 2006; Ueda et al., 2006). The detection limit for IMS with PCR was 1 cfu/1–25 g of sample following enrichment for L. monocytogenes (Hudson et al., 2001). IMS with flow cytometry had a detection limit of 3  104 (Jacobsen et al., 1997; Jung et al., 2003a) and with colony-blot it was 1–10 cfu/25 g (Wieckowska-Szakiel et al., 2002). IMS has been used in conjunction with an immunofluorescence assay for successful detection of Listeria cells as low as 103 cfu/ml (Duffy et al., 1997). The major drawbacks of the IMS-based assays are the requirement of an enrichment and a sample clean up step. Microbeads (typical size is ca. 50–200 nm) coated with a polyclonal anti-Listeria antibody to separate L. monocytogenes for flow cytometry has been used (Jacobsen et al., 1997). In that experiment, the recovery rate of pure culture of L. monocytogenes was about 91% when cell concentration was 109 cells/ml. When the cell concentration was lowered to between 104 and 108 cells/ml, the recovery rate was between 40% and 70%.

8

Arun K. Bhunia

A modified immunoseparation method employing agarose beads called Immunobeads was also used for Listeria capture. Immunobeads are Protein A conjugated agarose beads. In this experiment, Immunobeads were covalently linked with a MAb showing a high degree of specificity for L. monocytogenes (Gray and Bhunia, 2005). Immunobeads were able to capture
10% of L. monocytogenes cells at initial cell concentration levels of 1–100 cfu/100 ml from hotdog extracts in 12–18 h. The captured Listeria cells were then tested by a cytotoxicity assay for specific detection of L. monocytogenes (Gray and Bhunia, 2005). A flow-through immunocapture system called PathatrixÒ (Matrix MicroScience Ltd., Cambridgeshire, UK) has been developed that can process up to 250 ml of sample homogenates. The liquid is pumped through a tubing system in which the sample passes over an area where IMS beads are trapped using a magnet and the captured cells are collected in a small sample volume. This system has been validated for capture and detection of Salmonella, E. coli O157:H7, and Listeria species (Prentice et al., 2006). An automated immunomagnetic capture system called BeadRetriever (Dynal Biotech Ltd., Wirral, UK) has been used for pathogen capture and concentration. This system works on the inverse magnetic particle processing principle, where the paramagnetic beads bound to a magnetic rod are moved from tube to tube containing specific reagents, such as test samples containing target pathogen, washing solutions, enzyme conjugated pathogen specific antibody, and substrates. This system has been used for the detection of E. coli (Chapman and Cudjoe, 2001; Fegan et al., 2004; Reinders et al., 2002), Salmonella (Duncanson et al., 2003), and L. monocytogenes (Amagliani et al., 2006).

III. BIOSENSOR-BASED DETECTION METHODS Biosensors are devices that detect biological or chemical recognition complexes in the form of either antigen–antibody, enzyme–substrate, or receptor–ligand, placed in proximity to a transducer that generates a signal. Biosensor-based technologies have been increasingly used in the development of methods to sensitively detect foodborne pathogens (Anderson and Taitt, 2005; Baeumner, 2004; Bhunia and Lathrop, 2003; Deisingh and Thompson, 2004; Geng and Bhunia, 2007; Iqbal et al., 2000; Ivnitski et al., 1999; Leonard et al., 2003; Rasooly and Herold, 2006). The pathogen-detecting biosensor market is estimated to be $563 million and grows at a compounded annual rate of 4.5%, with the food processing making up $192 million of that amount (Alocilja and Radke, 2003). The application of biosensors for pathogen detection from food samples is challenging because of the complex nature of food matrices, which

Biosensors and Bio-Based Methods

9

consist of fats, proteins, carbohydrates, and additives with different acidities, salt concentrations, and colorings. Application of nano/micro technology to detect pathogens from such complex systems presents numerous challenges. This is further complicated by the fact that the populations of target microorganisms are often extremely small compared to the indigenous ones. Therefore, exceptionally intelligent strategies should be employed for detection of such low numbers of pathogens directly from food. Varieties of biosensor-based methods have been and continued to be developed and those are grouped as electrochemical (impedance-based, amperometric), optical (fiber optic, surface plasmon resonance), thermometric (thermister, pyroelectric), and mass based (piezoelectric, surface acoustic). Among these, optical biosensors appear to be the most widely used sensors for foodborne pathogens because of their sensitivity, available instrumentation, and relative ease of data interpretation. Besides optical sensors, electrochemical and mass-based sensors are also used for foodborne pathogens as discussed in this chapter.

A. Fiber optic biosensor Fiber optic biosensor is one of the first commercially available optical biosensors, marketed by Research International (Monroe, WA) for the detection of foodborne as well as pathogens of biosecurity importance. The manual version of the instrument is called Analyte 2000 and the portable semiautomated version is called RAPTORTM. The basic principle of the fiber optic sensor is that when light propagates through the core of the optical fiber (waveguide), it generates an evanescent field outside the surface of the waveguide. When fluorescentlabeled analytes such as pathogens or toxins bound to the surface of the waveguide, are excited by the evanescent wave generated by a laser (635 nm), and emit fluorescent signal (Bhunia et al., 2007; Taitt et al., 2005), the signal travels back through the waveguide in high order mode to be detected by a fluorescence detector in real time (Fig. 1.1) (Anderson et al., 1992, 1996; Hirschfeld, 1985; Hirschfeld et al., 1984; Marazuela and Moreno-Bondi, 2002; Mehrvar et al., 2000). The waveguides are generally made up of polystyrene fibers or glass slides, and the latter one is also called planar waveguide. On the planar waveguides, multiple analytes could be detected in a patterned microarray format (Ligler et al., 2003). To detect the analytes, a laser of 635 nm is used and two-dimensional imaging systems are employed where chargecoupled device (CCD) (Golden et al., 2005; Wadkins et al., 1997) or complimentary metal oxide silicon (CMOS) chips (Moreno-Bondi et al., 2003; Vo-Dinh et al., 1999) were used for acquiring images. Recently, a portable automated device called Naval Research Laboratory (NRL) array

10

Arun K. Bhunia

Fiber optic waveguide Laser Antibody Bacteria

Evanescent boundary Laser detector

Signal

Fluorescent molecules

Time (min)

FIGURE 1.1 Schematic drawing showing fiber optic waveguide-based detection of pathogens. Graph showing the real-time rise in signal as the fluorescent-labeled antibody binds to the antigen forming a sandwich.

biosensor was built that has supporting microfluidic system and data acquisition system for onsite use (Golden et al., 2005). Analyte 2000 (Research International, Monroe, WA) and the semiautomated RAPTORTM (Research International) use four polystyrene optical fibers (4-cm long) and a laser source of 635 nm. Analyte 2000 can be used with 1–4 separate fibers while the RAPTORTM holds a coupon that holds four fibers together so that a maximum of four analytes can be detected at one time from a sample. Moreover, RAPTORTM is built with a sample injection port, microfluidic channels, laser diode, and computer interface for data analysis. The fibers can be reused until a positive response is recorded. The assay principle for evanescent wave biosensors is based on a sandwich immunoassay. First, capture antibodies or receptor molecules are immobilized onto the optical waveguides. Upon binding of an analyte, a Cyanine 5 (Cy5)-labeled or Alexa-Fluor 647-labeled antibody is then added (Anderson and Nerurkar, 2002; Marazuela and Moreno-Bondi, 2002). The laser is launched into the proximal end of the optical waveguides and the analyte bound fluorescent molecules within several hundred nanometers of the waveguides are excited by an evanescent field. Then a portion of their emission energy reemits into the waveguides. A photodiode allows for quantitation of the collected emission light at wavelengths of 670 to 710 nm (Anderson et al., 1996). Antibodies are commonly used for the capture of target molecules on the waveguides and they are immobilized by either physical adsorption or through a self-assembly monolayer (SAM). In the former situation,

Biosensors and Bio-Based Methods

11

antibodies are nonspecifically bound to a polystyrene surface through ionic interactions and aid in capture. Poly-L-lysine or gluteraldehyde are also used to facilitate immobilization. The physical adsorption method, though simple, often results in a greater variation in signal output. Solvents, pH changes, or salts may affect the antibody cross-linking and thus may affect reproducibility. Antibodies are also immobilized on the waveguides through the formation of a SAM in which avidin/biotin chemistry, Protein A, and Protein G are used. Avidin derivatives (streptavidin, neutravidin) can be covalently linked onto the surface or can be bound through a biotinylated protein layer such as bovine serum albumen. Biotinylated antibody is then allowed to bind to the avidin layer. Layers of Protein A or Protein G also could be covalently linked onto the waveguides for immobilization of the IgG subclass of antibodies (Anderson et al., 1997). Ligand-specific receptor molecules have also been used on sensor surfaces for detection of specific toxins. For example, an acetylcholine receptor has been used to detect a-bungarotoxin and a-cobratoxin (Rogers et al., 1989) and gangliosides GM1 and GT1b were used in microarray format for capture of cholera and tetanus toxin (Fang et al., 2003), respectively. Use of optical fiber biosensors for real-time detection of biowarfare agents (BWA) especially those of bacterial cells, toxins, or spores in the air, soil, or environment has been investigated by the Naval Research Laboratory (Taitt et al., 2005). In addition, many laboratories are also employing fiber optic biosensors for detection of wide varieties of foodborne pathogens, which are discussed below. Staphylococcus aureus produces 17 types of enterotoxins, which are responsible for food poisoning and fatal toxic shock syndrome (Stewart, 2005). Among these, staphylococcal enterotoxin (SE), type B (SEB) is considered as one of the most potent biothreat agents. Fiber optic biosensors have been developed for the detection of SEB (King et al., 1999; Tempelman et al., 1996). Later, fiber optic-based RAPTORTM using Alexa Fluor-labeled detection antibody was able to sensitively detect SEB alone (Anderson and Nerurkar, 2002) or SEB in combination with other biothreat agents: Bacillus anthracis, Francisella tularensis, and Bacillus globigii spores (Jung et al., 2003b). A combination of surface plasmon resonance (SPR) and a side-polished single-mode optical fiber with a thin metal layer was developed for the detection of SEB at nanogram quantities (Slavik et al., 2002). An array biosensor patterned on glass slides was also able to detect 12 different analytes including several bacterial pathogens and some toxins: SEB, ricin, cholera toxin, botulinum toxin, and fumonosin each at 0.5 ng/ml (Ligler et al., 2003). Using the NRL array biosensor, SEB was also detected at 0.1 ng/ml when spiked into various food products: tomatoes, sweet corn, green beans, mushrooms, and tuna (Sapsford et al., 2005). Clostridium botulinum neurotoxin was also

12

Arun K. Bhunia

detected using a fiber optic sensor or NRL array biosensor (Ogert et al., 1992; Sapsford et al., 2005) from various spiked foods at 20 ng/ml concentrations. Seo et al. (1999) used a planar optic biosensor that measures the phase shift variation in refractive index due to antigen binding to antibody. In this method, they were able to detect S. enterica serovar Typhimurium with a detection limit of 1  105 cfu/ml. When chicken carcass fluid was inoculated with 20 cfu/ml, the sensor was able to detect this pathogen after 12 h of nonselective enrichment. A compact fiber optic sensor was also used for detection of S. Typhimurium at a detection limit of 1  104 cfu/ml (Zhou et al., 1997, 1998); however, its efficacy with food samples is unproven. Later, Kramer and Lim (2004) used the fiber optic sensor, RAPTORTM, to detect this pathogen from spent irrigation water for alfalfa sprouts. They showed that the system can be used to detect Salmonella spiked at 50 cfu/g seeds. An evanescent wave-based multianalyte array biosensor (MAAB) was also employed for successful testing of chicken excreta and various food samples (sausage, cantaloupe, egg, sprout, and chicken carcass) for S. Typhimurium (Taitt et al., 2004). While some samples exhibited interference with the assay, overall, the detection limit for this system was reported to be 8  103 cfu/g. An evanescent fiber optic biosensor was also developed and used successfully for E. coli O157:H7. DeMarco and his colleagues (DeMarco and Lim, 2002; DeMarco et al., 1999) were able to detect 3–30 cfu/ml in spiked ground beef samples. They also compared the detection limit for two types of fiber optic waveguides. For a silica-based waveguide, they were able to detect 9  103 cfu/g, while for a polystyrene waveguide, the limit was 5.2  102 cfu after overnight enrichment of samples (DeMarco and Lim, 2002; DeMarco et al., 1999). More recently, Geng et al. (2006b) used Alexa Fluor-647-labeled antibody for the sensitive detection of E. coli O157:H7 from ground beef after only 4 h of enrichment with an initial inoculation level of 1 cfu/g. In a report, Maraldo et al. (2006) used a fiber optic sensor to directly monitor bacterial growth on the tapered fiber. They immobilized GFP-expressing E. coli on the fiber using poly-L-lysine. Growth rapidly decreased the transmission of the evanescent signal. A fiber optic sensor was also developed for successful detection of Listeria species. Strachan and Gray (1995) were able to detect PCR-amplified products of Listeria spp. on a fiber optic sensor. In this method, DNA oligomers (40 bp) derived from the flagellin gene were immobilized onto the glass fibers using gluteraldehyde. PCR-amplified products internally labeled with FAM (Fluorescence amadite) were allowed to hybridize for detection by a solid-state sensor. A fiber optic immunosensor was designed using a MAb for both capture and detection in a sandwich format, which produced a positive signal from L. monocytogenes cells (
108 cfu/ml) with a significantly lower signal from Listeria innocua

Biosensors and Bio-Based Methods

13

(Bhunia et al., 2001). Later, the sensitivity of the assay was greatly improved by using a Listeria genus-specific PAb as the capture antibody and a MAb as the detection antibody (Geng et al., 2004). The detection limit for L. monocytogenes was established to be 1  103 cfu/ml. The sensor was highly specific and was able to detect the target pathogen at the 1  104 cfu/ml level from artificially inoculated meat samples in the presence of natural background microflora. Recently, the RAPTORTM was used in an assay to detect L. monocytogenes employing a flow-through antibody immobilization method on waveguides and the detection limit was determined to be 1  103 and 5  105 cfu/ml in frankfurter samples (Nanduri et al., 2006). Tims et al. (2001) were able to detect pure cultures of L. monocytogenes with the detection limit of 4.1  108 cfu/ml. They concluded that the quality of antibodies is the key in improving sensitivity. This NRL sensor was used for the rapid detection of Campylobacter jejuni and small toxins, including several mycotoxins [ochratoxin A, fumonisin B, aflatoxin B1, and deoxynivalenol (DON)] from food products (Ngundi et al., 2005, 2006; Sapsford et al., 2006). They used a sandwich immunoassay format to detect C. jejuni in milk and yogurt and a competitive immunoassay format to detect the mycotoxins. Recently, a fiber optic microsphere-based DNA array was also reported for the detection of multiple BWA including B. anthracis, Yersinia pestis, F. tularensis, Brucella melitensis, C. botulinum, Vaccinia virus, and one biological warfare agent simulant, Bacillus thuringiensis Kurstaki in a multiplexed format (Song et al., 2006). This system was validated with contaminated sewage samples and they suggested that the system could be integrated into a portable instrument for BWA detection.

B. SPR sensor SPR is a phenomenon that occurs during optical illumination of a metal surface, and it can be used for biomolecular interaction analysis. Receptors or antibodies immobilized on the surface of a thin film of a precious metal (gold) deposited on the reflecting surface of an optically transparent waveguide are used to capture the target analyte. The sensing surface is located above or below a high index-resonant layer and a low indexcoupling layer (Fig. 1.2). When a visible or near-infrared radiation (IR) is passed through the waveguide in such a way, it causes an internal total reflection on the surface of the waveguide. At a certain wavelength in the red or near-IR region, the light interacts with a plasma or cloud of electrons on the high-index metal surface, and the resonance effect causes a strong absorbance. The exact wavelength of this absorption depends on the angle of incidence, the metal, the amount of capture molecules immobilized on the surface, and the surrounding material. The presence of

14

Arun K. Bhunia

A SPR-angular modulation Surface plasmon resonance boundary Coupling layer Metal layer

Bacteria Antibody q

Prism Monochromatic light beam

Detector

B SPR-wavelength modulation Surface plasmon resonance boundary Coupling layer Metal layer

Bacteria Antibody

q Prism Polychromatic light beam

Detector

FIGURE 1.2 Schematic drawing showing SPR sensor with different configurations: (A) angular modulation and (B) wavelength modulation as described by Homola et al. (2002).

ligands or antigens interacting with the receptor or antibody causes a shift in the resonance to longer wavelengths, and the amount of shift can be related to the concentration of the bound molecules. Surface immobilization of the capture molecules follows standard procedures that are commonly practiced in many biosensor applications and some are discussed in the previous section. Layers of carboxymethyl dextran, Protein A or Protein G, streptavidin-coated surface, or EDC [N-ethyl-N(diethylaminopropyl) carbidimide]/NHS (N-hydroxysuccinimide)-based amine coupling through amide bond are used for protein (antibody, receptor, etc.) cross-linking. SPR-based sensors are governed by two basic principles: wavelength interrogation and angle interrogation (Fig. 1.2, Homola et al., 2002). Wavelength interrogation uses a fixed angle of incidence but measures spectral changes, while in angle interrogation, a fixed wavelength is used but the angle of reflectance is monitored. Most of the commercial SPR systems are operated based on the angle interrogation mode such as the prism-based BIACORE (Biacore AB, Uppsala, Sweden), SpreetaTM (Texas

Biosensors and Bio-Based Methods

15

Instrument, Dallas, TX), SPR spectroscope (MultiscopTM, Optrel GbR, Germany), Reichert SR7000 (Reichert Analytical Instruments, Depew, NY), and resonant mirror based IAsys (Thermo Labsystems, Cambridge, UK). There are several advantages of SPR-based sensors. They allow realtime or near real-time (under 30 min) detection of binding events between two molecules. The detection system is label free, thus eliminating the need for additional reagents, assay steps, and time. The sensor can be reused for the same analyte repeatedly — the bound analytes can be desorbed by changing the pH of the solution. It is highly sensitive and it can detect molecules in the femtomolar range. Furthermore, the binding kinetics (affinity) between two molecules can be easily calculated (Bhunia et al., 2007; Rasooly and Herold, 2006). SPR-based sensors have been widely investigated for their suitability in the detection of foodborne pathogens (Leonard et al., 2004). In most applications, this system shows promising results with toxins while signals with whole cells were inconsistent and, depending on the instrumentations, some are unable to detect whole cells. The literature on SE detection by SPR is abundant. Enterotoxin detection methods were optimized in different SPR systems. IAsys and BIACORE systems were used for the detection of SEA and SEB, respectively, in a sandwich immunoassay format at the 10–100 ng range when suspended in various complex food matrices including milk, hotdogs, potato salad, and mushrooms (Rasooly, 2001; Rasooly and Rasooly, 1999). In these methods, immobilized antibody on the chip surface was allowed to capture the toxins and then a second antibody was added to amplify the SPR signal. Naimushin et al. (2002) used a two-channel SPR system similar to the single channel SpreetaTM for the detection of SEB. In the two-channel system, one channel served as a reference for real-time monitoring of the sample. Homola et al. (2002) reported a novel dual-channel SPR based on ‘‘wavelength modulation’’ for the detection of SEB in a direct binding-to-antibody or in a sandwich assay configuration. In the direct-binding assay, toxin bound to immobilized antibody on the chip surface was detected at 5 ng/ml, while in the sandwich assay format, a second antibody was used to amplify the signal, thus improving the sensitivity and the detection limit (0.5 ng/ml). A two-step approach of SPR and mass spectrometry was proposed for detection of SEB (Nedelkov and Nelson, 2003; Nedelkov et al., 2000). In this method, an SPR system, Biacore X instrument, was used to capture SEB on the chip surface. Then the bound toxin was analyzed by the matrix-assisted laser desorption/ionization time-offlight (MALDI-TOF) mass spectrometry and a concentration of 1 ng/ml of toxin suspended in milk or mushroom was detected. Besides enterotoxin, in a recent report, Subramanian et al. (2006a) used a Reichert SR7000 SPR to detect cells of S. aureus at a detection limit of 105 cfu/ml in a direct or a sandwich immunoassay configuration. A self-assembled monolayer

16

Arun K. Bhunia

based on alkane monothiol and dithiol dendritic tether conjugated to antiS. aureus antibody was used on the sensor chip surface for detection. An SPR-based system was also used for the detection of E. coli O157: H7 cells with variable success. In the earlier published works, Medina and colleagues (Fratamico et al., 1998; Medina et al., 1997) employed the BIACORE system in a sandwich immunoassay format to detect E. coli O157:H7 cells with a detection limit of 5–7  107 cfu/ml. Oh et al. (2002) reported the detection of E. coli O157:H7 at a detection limit of 104 cfu/ml using an SPR spectroscope (MultiscopTM, Optrel GbR, Germany) system. They used an 11-mercaptoundecanoic acid-mediated SAM of Protein G to immobilize E. coli O157:H7-specific MAb. Later, the sensitivity was improved by two orders of magnitude (102 cfu/ml) by employing a nano-fabrication strategy for monolayer assembly (Oh et al., 2003). The same SPR set up was employed for the detection of multiple pathogens in a multiplex format using different specific antibodies to E. coli O157:H7, Salmonella Typhimurium, Legionella pneumophilia, and Yersinia enterocolitica (Oh et al., 2005). However, the efficacy of the system to detect pathogens from food matrices or in presence of competing microflora was not verified. Su and Li (2005) used a miniaturized portable SPR, SpreetaTM, to determine the sensitivity of the system to detect E. coli O157:H7 cells using a PAb as capture antibody and compared the data with a quartz crystal microbalance (QCM) immunosensor. The detection range for SPR was determined to be 105108 cfu/ml, while it was 106108 cfu/ml for QCM. Using SpreetaTM, Meeusen et al. (2005) detected E. coli O157:H7 within 35 min and the limit of detection (LOD) was determined to be 8.7  106 cfu/ml. The sensitivity suffered when the target cells were mixed with heterogeneous bacterial cultures. The detection limit increased to 107 cfu/ml when the nontarget bacterial (Salmonella Typhimurium) concentration was 106 cfu/ml or less. The sensor response was further diminished when nontarget bacteria were present at 107 cfu/ml. In spite of such interference, they forecast that the technology could be used in the food industry for pathogen monitoring during HACCP implementation. Subramanian et al. (2006b) used mixed assembled monolayers consisting of polyethylene glycol-terminated alkanethiol to immobilize antibody for detection of E. coli O157:H7 in the Reichert SR7000 SPR biosensor. They used the direct and sandwich immunoassay formats to determine the LOD. The sandwich assay was found to be more sensitive (LOD ¼ 103 cfu/ml) than the direct assay (104106 cfu/ml). Using wavelength interrogation SPR, Taylor et al. (2005) were able to detect viable or heat-killed or detergent-lysed cells of E. coli O157:H7. They used a selfassembled monolayer of alkanethiol on a gold surface to immobilize MAb using EDC/NHS-coupling chemistry. Following the capture of cells, a second antibody was used to amplify the signals with a resulting

Biosensors and Bio-Based Methods

17

detection limit for lysed cells of 104 cells/ml, heat-killed cells of 105 cells/ml, and viable cells of 106 cfu/ml. Koubova et al. (2001) reported the use of SPR for the detection of Salmonella Enteritidis at a detection limit of 106 cells/ml and concluded that the sensitivity was comparable with ELISA. The BIACORE 3000 system was used to monitor serum antibody to Salmonella Typhimurium and Salmonella Enteritidis during infection in chickens ( JongeriusGortemaker et al., 2002). Recombinant flagellar antigens were immobilized on the sensor chip, and the sera from experimentally infected or noninfected birds were tested for preharvest monitoring of pathogens. Bokken et al. (2003) used the same BIACORE system in a sandwich format to detect Salmonella group B, D, and E. They successfully detected 53 Salmonella serovars at 1  107 cfu/ml, and the background signal from various non-Salmonella organisms was well below the positive signals received from the target bacteria. Oh et al. (2004) employed the MultiscopTM SPR to detect Salmonella Typhimurium at a range of 102109 cfu/ml in a buffer system under an ideal laboratory set up. They used a SAM of 11-mercaptodecanoic acid with Protein G to immobilize antibody on the gold surface. Since they have not tested the sensor with food samples, it is difficult to speculate about the sensitivity of the sensor in the presence of inhibitors like food particles or natural microflora. Literature on the application of SPR for L. monocytogenes detection is somewhat scanty. In an earlier proof-of-concept study, Koubova et al. (2001) were able to detect L. monocytogenes at 106 cells/ml without showing data on its relative selectivity or specificity. Later, Lathrop et al. (2003) employed a resonant mirror biosensor (IAsys) and demonstrated that this system can detect surface protein extracts from L. monocytogenes cells. A MAb to a 66-kDa protein was immobilized on the sensor surface by using EDC/NHS-coupling chemistry. The specificity of the assay depended on the cross-reactivity of the antibody. It showed reaction with L. monocytogenes and L. innocua and the signal from other Listeria spp. was equivalent to the background signal. The IAsys system failed to show any discernable signal from whole cells even at 108 cfu/ml, suggesting that this sensor configuration may not be suitable for the detection of whole cells (Lathrop et al., 2003). Leonard et al. (2004) employed the BIACORE 3000 to detect L. monocytogenes cells at 1  105 cfu/ml through a subtractive inhibition assay using anti-Listeria PAbs and through stepwise removal of bound bacteria by allowing binding of anti-Fab antibody. More recently, using the same SPR system, and a protein-specific antibody (antiInternalin B), the same group (Leonard et al., 2005) was able to detect L. monocytogenes at 2  105 cells/ml. While the cross-reactivity of the anti-InlB antibody has been determined by ELISA inhibition assay, the specificity of the sensor with those cross-reactive bacteria has not been tested.

18

Arun K. Bhunia

SPR systems also showed encouraging results with their ability to detect mycotoxins. The BIACORE was used to detect a mycotoxin, DON, produced by Fusarium species, from spiked wheat sample in a competitive inhibition assay (Schnerr et al., 2002). Biotinylated DON was immobilized on the sensor chip which was previously coated with streptavidin. Mycotoxin extracts from wheat samples were first allowed to react with the antibody and then injected into the BIACORE. The detection range was established to be 0.13–10 mg/ml. In a slightly modified format, DON was also detected by SPR at a range of 2.5–30 ng/ml (Tudos et al., 2003). It is noteworthy that besides its potential use in pathogen detection, SPR is now widely used to study the molecular interaction of food-related bacteria with host cells. Uchida et al. (2004) used the BIACORE 1000 to analyze the adhesion characteristics of strains of Lactobacillus acidophilus to human A-type antigen or human colonic mucin for use as probiotics. Kim et al. (2006a) used the IAsys sensor to determine the binding affinity of a Listeria adhesion protein with its corresponding mammalian cell receptor, Hsp60, and demonstrated that the ligand–receptor interaction was highly specific.

C. Piezoelectric (PZ) biosensors This sensor detects changes in the mass on the surface of a quartz crystal without the use of any labeling molecules. Antibodies are used for the specific binding of the analytes. Once bound, the complex increases the mass of the crystal, thereby changing the resonance frequency when an oscillating electric field is applied across the device. The frequency variation is measured by a quartz crystal analyzer (O’Sullivan et al., 1999). SEs were detected at microgram quantities using this sensor (Harteveld et al., 1997; Lin and Tsai, 2003). Salmonella Typhimurium cells were detected with a detection range of 9.9  105 to 1.8  108 cfu/ml (Park and Kim, 1998). Pathirana et al. (2000) reported an improved method with a detection limit of a few hundreds cells. They first immobilized the antiSalmonella antibody on the quartz crystal by the Langmuir–Blodgett method and the resonant frequency was monitored by using a PM-700 Maxtek plating monitor with a frequency resolution of 0.5 Hz at 5 MHz. A variation of the PZ system is called a QCM, which consists of a thin quartz disc with implanted gold electrodes. QCM has been used for the detection of L. monocytogenes in the range of 2.5  105 to 2.5  107 cells/ crystal (Minunni et al., 1996), Salmonella Typhimurium at 1  105 to 5  108 cfu/ml (Wong et al., 2002), Salmonella Paratyphi at 102105 cfu/ml (Fung and Wong, 2001), Bacillus cereus at 104 cells/ml (Vaughan et al., 2003), and E. coli O157:H7 at 103108 cfu/ml (Su and Li, 2004). QCM has been shown to be effective for detection of Mycobacterium tuberculosis

Biosensors and Bio-Based Methods

19

from clinical specimens with a detection limit of 2  103 cells/ml (He et al., 2003).

D. Electrochemical immunosensor Electrochemical immunosensors are an extension of conventional antibody-based enzyme immunoassays (ELISA) where catalysis of substrates by an enzyme conjugated to an antibody produces products in the form of pH change, ions, and oxygen consumption that generate electrical signals on a transducer (Warsinke et al., 2000). Potentiometric, capacitive, and amperometric transducers have been used for such applications. In amperometric detection, for example, alkaline phosphatase (AP) conjugated to an antibody hydrolyzes p-nitrophenyl phosphate to phenol, which is detected by voltammetry. In light-addressable potentiometric sensors (LAPS), urease-conjugated antibody hydrolyzes urea, resulting in the production of carbon dioxide and ammonia that changes the pH of the solution (Fig. 1.3). A silicon chip coated with a pH-sensitive insulator and an electrochemical circuit measures the alternating photocurrent as a light emitting photodiode shines on the silicon chip. These sensors are very

Urease

Urea CO2 + 2NH3 Electrochemical sensor

Fluorescence

Bacteria Antibody Biotin Streptavidin Biotinylated BSA Solid support

FIGURE 1.3 Schematic drawing of a light addressable potentiometric sensor (LAPS) for pathogen detection. (Adapted from reference Gehring et al., 1998).

20

Arun K. Bhunia

sensitive and have been used for detection of Salmonella and E. coli O157: H7 in 30–90 min. Light-addressable potentiometric sensors (LAPS) have been used for the detection of E. coli O157:H7 (Gehring et al., 1998; Tu et al., 1999). In this assay configuration (Fig 1.3), capture antibody was first immobilized on a membrane or magnetic beads for the capture of target cells. In a sandwich format, a fluorescent-labeled antibody was allowed to bind to the target cells. Urease-labeled anti-fluorescent antibody was then added. In presence of urea, NH3 was produced that changed the pH of the solution on the n-type sensor coated with a pH sensitive insulator that recorded the voltage change. The detection limit was reported for such sensor to be 7.1  102 cells/ml for heat-killed cells and 2.5  104 cells/ml for live cells. Experiments with food samples showed that E. coli O157:H7 at 1 cfu/g of hamburger could be detected after 6 h of enrichment (Tu et al., 1999, 2002). LAPS was also demonstrated to be suitable for detection of BWA, Y. pestis and spores of Bacillus subtilis (globigii) (Dill et al., 1997; Uithoven et al., 2000). A potentiometric alternating biosensing (PAB) system based on LAPS was also used to detect E. coli cells at 10 cells/ml in vegetables such as lettuce, carrots, and rucola in about 1.5 h (Ercole et al., 2002, 2003). This method was employed for the quality verification of fresh produce. A disposable electrochemical sensor using conductive polyaniline in a sandwich configuration was used to detect E. coli O157: H7 in fresh produce including alfalfa, lettuce, sprouts, and strawberries (Muhammad-Tahir and Alocilja, 2004). A silicon chip-based LAPS was employed for detection of Salmonella Typhimurium at concentrations of 119 cfu (Dill et al., 1999). In this case, the pH change during catalysis of urea with urease was sensitively detected using a silicon chip. An immunoelectrochemical sensor has been used for the detection of E. coli O157:H7 cells from buffer (Brewster and Mazenko, 1998; Ruan et al., 2002a). Target bacteria were mixed in a solution with AP-labeled antibody and captured on a membrane. The addition of substrate, p-aminophenyl phosphate (p-APP), produced an electroactive product, p-aminophenol (p-AP), which was detected by the BAS 100B/W Electrochemical Analyzer (Brewster and Mazenko, 1998). The sensitivity was estimated to be 5  103 cells/ml and the assay time was 25 min. Later, the assay was modified where bacteria were first captured by immunomagnetic beads, and then reacted with AP-conjugated antibody followed by reaction with the substrate, 1-napthyl phosphate (1-NP), a substitute for p-APP, resulted in an improved signal (Gehring et al., 1999). This system was able to detect E. coli O157:H7 at 4.7  103 cells/ml in a porcine carcass wash within 80 min. Essentially using the similar antibody capture strategy on magnetic beads and AP-labeled detection antibody, Gehring et al. (2004) described an enzyme-linked immunomagnetic chemiluminescence assay (ELIMCL) for detection of E. coli O157:H7 in 75 min with a detection

Biosensors and Bio-Based Methods

21

limit of 7.6  103 cfu. Addition of the chemiluminescence substrate, APS-5, for AP resulted in luminescence, which was measured in a FB-12 Luminometer (Zylux, Oak Ridge, TN). This system allowed detection of the pathogen in ground beef with initial cell concentrations of 10 cfu/g after only 5.5 h of enrichment. Electrochemical immunoassay with immunomagnetic bead-captured bacteria as described above was also used for detection of C. jejuni from chicken carcasses with a detection limit of 2.1  104 cfu/ml (Che et al., 2001). A menadione-catalyzed luminol chemiluminescence assay was developed for rapid quality assessment of food products for generic E. coli (Kawasaki et al., 2004). The assay principle is based on the catalysis of active oxygen (O2 and H2O2) produced by aerobic respiration of viable cells with menadione. The addition of luminol produced chemiluminescence that was detected by a luminometer. The system was able to detect E. coli at 1–10 cfu/ml in milk, vegetable juice, green tea, and coffee after 7 h of enrichment. An electrochemical chemiluminescence biosensor for Salmonella Typhimurium was described (Varshney et al., 2003). In this method, they collected bacteria captured on immunomagnetic beads and then reacted with horseradish peroxidase (HRP)-labeled antibody. The addition of luminol produced a chemiluminescence signal (mV) that was collected through a fiber optic light guide. The detection limit was established as 1.97  103/ml. The sensor was highly specific for Salmonella Typhimurium and showed significantly higher signals than for other serovars of Salmonella and other common foodborne bacteria such as Citrobacter freundii, Pseudomonas aeruginosa, L. monocytogenes, C. jejuni, and E. coli. A highly specific chemiluminescence sensor was also reported for E. coli O157:H7 using the same basic configuration as above except the antibody was highly specific (Ye et al., 2002). The reported detection limit was 1.8  102 cfu/ml with a signal output value of 3.8 mV. These assays could be completed in 90 min. A disposable electrochemical enzyme-amplified genosensor was described for specific detection of Salmonella (Del Giallo et al., 2005). A DNA probe specific for Salmonella was immobilized onto screenprinted carbon electrodes and allowed to hybridize with a biotinylated PCR-amplified product of Salmonella. The hybridization reaction was detected using streptavidin conjugated-AP where the enzyme catalyzed the conversion of electroinactive a-naphthyl phosphate to electroactive a-naphthol, which was detected by differential pulse voltammetry. The monitoring of oxygen consumption during active bacterial growth in medium was measured by electrochemical cyclic voltammetry as a means to detect the growth of live cells (Ruan et al., 2002b). In this method, Salmonella Typhimurium growth in a selective medium was shown to be inversely proportional to the rate of oxygen consumption. A linear response was observed for cell concentrations of 1–2  100 to

22

Arun K. Bhunia

1–2  106 cells, and the growth was detected at 10 h and 2.1 h, respectively. Though it was claimed to be more sensitive than PCR or immunoassay, it is highly unlikely to be specific because the specificity directly depends on the selectivity of the medium used. An electrochemical sensor using an array microelectrode was tested for the detection of allergens such as mite and cedar pollen (Okochi et al., 1999). Blood was used in the assay and the release of serotonin, a chemical mediator of allergic response, which is electrochemically oxidized at the potential around 300 mV, was monitored for electrochemical detection by cyclic voltammetry.

E. Fluorescence resonance energy transfer Fluorescence resonance energy transfer (FRET) allows the measurement of FRET during interaction of two molecules labeled with two different fluorophores whose absorbance and emission spectra overlap. One fluorophore acts as a donor (reporter) and the other one as an acceptor (quencher) (Majoul, 2004). The FRET-based assay is considered as a homogeneous ‘‘one-step’’ assay without the requirement for a washing step. The application of FRET in pathogen detection has been successfully demonstrated. Bruno et al. (2001) used a cuvette-based spectrofluorometer to detect B. cereus spores (1–2.5  105/ml) and E. coli cells (3.5  105/ml) in 30 min. They used Oregon Green 514 (OG-514)-labeled antibody and QSY-7-labeled spores of B. cereus or vegetative cells of E. coli O157:H7. When OG 514-labeled antibody binds to QSY-7-labeled cells or spores, OG-514 activity is quenched due to proximal location of QSY-7. The introduction of unlabeled spores or bacteria causes antibody detachment due to the equilibrium shift and the antibody binds to unlabeled cells which results in an increased fluorescence activity due to separation of the reporter from the quencher (Bruno et al., 2001). Employing another pair of fluorophores (Alexa Fluor 546 and Alexa Fluor 594), Ko and Grant (2003) demonstrated that Listeria or Salmonella antigens could be successfully detected using FRET. Very recently, they (Ko and Grant, 2006) used FRET-based fiber optic sensor for the detection of Salmonella Typhimurium cells at 103 cfu/g in a homogenized pork sample. A FRETbased PCR assay was also employed to detect L. monocytogenes from a model food — nonfat dry milk at concentrations of 103104 cfu/25 ml of sample (Koo and Jaykus, 2003). In this assay, a single internal oligonucleotide probe labeled with fluorescein reporter dye at the 50 -end and a 30 DABCYL-labeled quencher dye was used to amplify the hly or iap gene. During amplification of the target DNA, the reporter is freed from the quencher due to the endonuclease activity of the Taq DNA polymerase and the release of the reporter (fluorescence activity) was proportional to the rate of amplification of the target.

Biosensors and Bio-Based Methods

23

F. Fourier transform infrared spectroscopy Fourier transform infrared spectroscopy (FT-IR) spectroscopy is used to generate bacterial spectral scans based on the molecular composition of a sample. Basically, infrared spectroscopy consists of the infrared source, the sample, and the detector. When IR is absorbed or transmitted through the sample to the detector, it generates a ‘‘scan’’ or ‘‘fingerprint’’ profile. A library of spectral scans can be generated for different bacterial species and strains, which can be used for future comparison. This method requires transfer of cells (biomass) from the growth media to an IRreflecting substrate for spectral collection. It is a nondestructive rapid method and sample identification depends on the available spectral library. FT-IR has been used for classification or identification of several foodborne pathogens: Yersinia, Staphylococcus, Salmonella, Listeria, Klebsiella, Escherichia, Enterobacter, Citrobacter, etc. (Gupta et al., 2005; Mossoba et al., 2005; Sivakesava et al., 2004). FT-IR photoacoustic spectroscopy was used for the identification of spores of several Bacillus species with 100% accuracy (Thompson et al., 2003). The same system was also used for the identification of E. coli O157:H7 on an apple surface (Irudayaraj et al., 2002). The FT-IR system equipped with a focal plane array (FPA) detector allowed the rapid and precise identification of several bacterial species including S. aureus, Y. enterocolitica, Klebsiella pneumoniae, E. coli, C. freundii, Salmonella Typhimurium, and Enterobacter cloacae (Kirkwood et al., 2004). Recently, a comprehensive analysis of S. aureus strains isolated from milk or milk products was done using FT-IR (Lamprell et al., 2006). Furthermore, this method allowed successful discrimination of S. aureus from other staphylococcal species. Lipopolysaccharide extracts from different pathogenic and nonpathogenic E. coli strains were also analyzed by FT-IR with principle component analysis and canonical variate analysis (Kim et al., 2006b). The data showed that E. coli strains can be discriminated with >95% accuracy. Listeria species were also reliably classified by FT-IR coupled with an artificial neural network technology with a success rate of 96% (Rebuffo et al., 2006), while the identification rate for L. monocytogenes alone was 99.2%.

G. Light scattering Light scattering dates back many decades and has been used for many years in the semiconductor industry for the monitoring of defects on wafers. Light scattering technology differentiates samples based on refractive index, size, shape, and composition. When an illuminated light from a polarized monochromatic light source shines on a sample (bacteria, for example), scattered light forms distinct patterns which

24

Arun K. Bhunia

could be used for identification and detection of bacteria. However, stage of growth, growth medium, growth temperature, aeration, and the final dilution of the suspended medium can affect the reproducibility of this method. Fraatz et al. (1988) employed multiparameter light scattering to detect culture contamination, which is of great importance to the fermentation industry. They were able to detect the contamination of E. coli with B. thuringiensis at levels of 1% or higher. Bronk et al. (1995) used polarized light scattering to measure the diameter of rod-shaped bacteria and later, Van De Merwe et al. (1997) determined the effect of nutrients on the diameter of rod-shaped bacteria. The same group also examined the effect of metal toxicity on E. coli cells using light scattering (Bronk et al., 2001). Differential polarization light scattering (DPLS) was used to differentiate spores of B. subtilis (Diaspro et al., 1995). It is highly sensitive and it can discriminate between two different strains of B. subtilis. DPLS has been used for the characterization of microorganisms in suspension (Bronk et al., 2001; Perkins and Squirrell, 2000; Wyatt, 1969). However, there are challenges associated with bacteria in suspension, such as the purity of cultures and the arrangement of cells which appear in chains or clusters. The orientations of and distances between cells change with time. Therefore, an averaging method to account for the relative orientation and movement is needed. However, a colony on a solid surface such as agar is more stable and its optical response could be modeled with scalar diffraction theory. The optical back-scattering method is widely used for wafer inspection and for studying biological cells (Hielscher et al., 1997; Jordan et al., 2002), but it did not produce reproducible results when tested with bacterial colonies (Nebeker et al., 2001). Conversely, optical forward scattering yielded reproducible scattering patterns. Recently, a diode laser was used to generate light scattering images of Listeria colonies growing on agar plates for their identification and classification (Banada et al., 2007; Bayraktar et al., 2006. Fig. 1.4). The scatter images of bacterial colonies were characterized using Zernike moment invariants, and principal component analysis and hierarchical clustering were performed on the results of feature extraction. The system was able to distinguish different species of Listeria with 90–100% accuracy and could be used in a simple and noninvasive manner to characterize bacterial colonies on agar plates (Banada et al., 2007).

H. Impedance-based biochip sensor The concept of impedance microbiology is more than a century old; however, it gained its popularity only in the mid-seventies. Impedance is based on the changes in conductance in a medium due to the microbial breakdown of inert substrates into electrically charged ionic compounds and acidic by-products. The detection time, that is, the time necessary for

Biosensors and Bio-Based Methods

A tter

age

25

Petri dish with colonies

im

Sca

Laser

B

L. monocytogenes

L. innocua

FIGURE 1.4 Optical light scattering for detection of bacterial colonies grown on solid agar plates. (A) Forward light scattering device and (B) scatter images of colonies of L. monocytogenes and L. innocua. (Adapted from references, Bayraktar et al., 2006; Banada et al., 2007.)

these changes to reach a threshold value, is inversely proportional to the initial inoculums and the physiological state of the cells. The principle of all impedance-based systems is that they measure the relative or absolute changes in conductance, impedance, or capacitance at regular intervals (Fig. 1.5). In media-based impedance methods, bacterial metabolism results in increased conductance and capacitance, with decreased impedance (Ivnitski et al., 1999). The major advantage of this system is that it allows the detection of only the viable cells, which is the major concern in food safety. The basic technical equipment required for performing impedance microbiology consists of special incubators and their culture vessels (equipped with electrodes) and an evaluation unit with computer, printer, and appropriate software. Microbial metabolism results in an increase in both conductance and capacitance causing a decrease in impedance and a consequent increase in admittance. In the Rapid Automated Bacterial Impedance Technique (RABIT) system, the admittance was plotted against time to provide results (Bolton, 1990). The final electrical signal is frequency- and temperature dependent and it has a conductive and a capacitive component. At present, impedance instruments are able to detect 105107 bacteria/ml (Ivnitski et al., 2000). Several commercially available systems are operated

26

Arun K. Bhunia

A

Measurement electrodes

Inlet

Outlet

DEP capture electrodes 100 cfu/ml

Relative conductance (%)

B 100 90 80 70 60 50 40 30 20 10 0

10 cfu/ml

1 cfu/ml

0

2

4 6 Time (h)

8

10

FIGURE 1.5 Impedance-based detection of bacterial growth on microfluidic biochip. Bacterial cells are first captured by applying DEP force on chip and then the bacterial cells are allowed to grow. Bacterial growth and utilization of inert substrates into charged ionic species will then change the conductivity of the solution. Panel (A) is showing a prototype chip fabricated by Bashir and his colleagues (Chang et al., 2002; Li and Bashir, 2002) with interdigitated electrodes for DEP capture of bacteria and the interdigitated measurement electrodes to monitor growth. Panel (B) is showing a conductance plot generated based on bacterial growth of arbitrary numbers of colony forming units (cfu)/ml.

based on the impedance measurement. The BactometerÒ (bioMe´rieux, Marcy l’Etoile, France) has the capacity of testing up to 512 samples resulting in total microbial counts in 6–24 h and more specific counts (yeast, mold, lactic acid bacteria, etc.) in 24–48 h. The Malthus AT analyzer (Malthus Instruments, Bury, UK), BacTracTM, and m-Trac microorganism growth analyzer (SyLab, Purkersdorf-Vienna, Austria) are used

Biosensors and Bio-Based Methods

27

for bacterial growth measurement. Quicker results can be obtained in the impedance method by using it in conjunction with an IMS step to initially concentrate the bacteria (Safarik et al., 1995). The bacterial contamination in milk has been analyzed using the Bactometer for quality assessment purposes (Madden and Gilmour, 1995). For specific detection of Listeria, this system was used with a high conductive Listeria electrical detection (LED: conductivity >2 mS) medium and Listeria-selective supplements. It took about 30 h to induce a 30% change in capacitance (Capell et al., 1995). The LED medium was also successfully applied for the detection of Listeria in cheese samples (Rodrigues et al., 1995). The impedance-based assay has also been used for the detection and enumeration of Campylobacter (Falahee et al., 2003), E. coli (Colquhoun et al., 1995; Upadhyay et al., 2001), Staphylococcus (Glassmoyer and Russell, 2001), and Salmonella (Fehlhaber and Kruger, 1998; Yang et al., 2003) from food samples. The impedance method has been accepted by the Association of Official Analytical Chemists, Intl., (AOAC) as a first action method (Gibson et al., 1992). To improve sensitivity, and to overcome limitations posed by above technologies, microelectronics or microfabricated electronic devices such as a semiconductor chips referred to as ‘‘biochips’’ are used. In this biology-based microelectrical-mechanical systems (Bio-MEMS) device, the cells are confined into a very small volume with rapid turnover of substrate into electrically charged by-products resulting in rapid and sensitive detection of bacterial growth by impedance measurement. The biochip is a microfabricated silicon device (microchip) with interdigitated electrodes, which can detect a few bacterial cells in nanoliter volumes (Gomez et al., 2001, 2002). One hundred bacterial cells confined into a volume of 10 nl results in a concentration of 107 cells/ml are detected in the device. L. monocytogenes cells were successfully detected at <10 cells/5.27 nl chamber with only a 2-h incubation step (Gomez et al., 2002). Even the presence of heat-killed bacterial cells did not interfere with the signal. Further on-chip separation of live bacterial cells from dead cells by employing a DEP force allowed strategic localization of cells in different compartments on the biochip (Chang et al., 2002; Li and Bashir, 2002; Fig. 1.5). Immobilized antibody on the chip surface allowed specific capture of DEP-driven L. monocytogenes cells for impedance-based detection (Yang et al., 2006). The sensitivity of the impedance-based measurement was improved manyfold with a detection limit of 10–1000 cells/ml by introducing a newly formulated low conductive growth medium (LCGM) into the chip (Banada et al., 2006; Yang et al., 2005). In addition, bacterial capture on the biochip was facilitated by employing various specific and nonspecific means such as lysozyme (Huang et al., 2003a,b), functionalized polystyrene bead-based, or avidin– biotin-based antibody immobilization methods (Huang et al., 2003c).

28

Arun K. Bhunia

Wang et al. (2006) described a flow-through microfluidic biochip that allows on-chip lysis of cells for detection of intracellular proteins or nucleic acids using an antibody or DNA probe labeled with fluorescence dye for pathogen detection. Much of the success with biochip detection also depends on the sample preparation to prevent food particle contamination. Employing appropriate membrane separation technologies with micron-sized pores, the clarified samples can be delivered to the biochip for growth monitoring by impedance measurement (Chen et al., 2005a,b). Ruan et al. (2002a) reported an impedance immunosensor method for detection of E. coli by immobilizing an anti-E. coli antibody on the electrode surface and applying an impedance measurement. The recognition process was further amplified by the coupling of the E. coli antibody-AP conjugate to the surface that stimulated the precipitation of an insoluble material onto the electrode surface. This impedance immunosensor allowed analysis of the E. coli O157:H7 cells with the detection limit of 6  103 cells/ml. Suehiro et al. (2003) used the agglutination of target bacteria through an antibody-antigen reaction to separate E. coli from Serratia marcescens by using dielectrophoretic impedance measurement.

I. Cell-based sensor The detection systems that incorporate whole cells or cellular components have a distinct advantage of responding in a manner that can offer insight into the physiological effects of an analyte in minutes (Pancrazio et al., 1999). Mammalian cell-based biosensors take advantage of natural cellular fluorescence, metabolism, impedance, and intracellular and extracellular potentials to gather data in reference to a test sample. An advantage to biosensors employing mammalian cells is that they provide additional information as to the possible physiological effects of the sample according to their biochemical or physiological response. Cell-based assays (CBAs) continue to serve as a reliable method to probe for the presence of pathogens in clinical, environmental, or food samples (Stenger et al., 2001; Ziegler, 2000. Fig. 1.6). The CBA systems can report perturbations in the ‘‘normal’’ physiological activities of mammalian cells as a result of exposure to an ‘‘external’’ or environmental challenge (Ziegler, 2000). Some of the CBAs utilize the metabolic responses of cells (like cyanobacteria) to detect biological products, like oxygen and herbicides in water (Rawson et al., 1989). In another type, mammalian cells or plasma membranes are used as electrical capacitors. Electrical impedance (EI) uses the inherent electrical properties of cells to measure the parameters related to the tissue environment (Kyle et al., 1999). The mechanical contact between cell–cell and cell–substrates is measured via conductivity or EI (Deng et al., 2003;

Biosensors and Bio-Based Methods

29

Pathogens or toxins Substrate Enzyme

Color, impedance

Receptor Interaction of pathogens with cellbased sensor

Cell lysis or release of signaling molecules

Detector

FIGURE 1.6 Schematic representation of cell-based sensor (CBB) for pathogen detection. After binding to receptor on mammalian cells, pathogen or toxin will aid in the release of signaling molecules such as fluorescence or enzyme that can be detected using an appropriate sensor.

Giaever and Keese, 1991, 1993). The cell can be equated to a simple circuit since it is nothing more than conductive fluid encapsulated by a membrane surrounded by another conductive fluid. The conductive fluids make up the resistance elements of the circuit, while the membrane acts as a capacitor. Impedance methods have been used to monitor tissue cultures online and in real time. Cells derived from a male monkey’s kidney cells were adherently grown on interdigitated electrode structures (IDES) (Ehret et al., 1996). Changes in impedance were able to detect changes in cell density, growth, or cellular behavior. These biosensors are able to provide detailed information about the growth characteristics of the tissue culture, including information on spreading, attachment, and cellular morphology. Furthermore, any external factors such as live bacteria or active cytotoxins that affect the integrity of the membrane will alter the conductivity and, thus, will provide a signal. An interdigitated microsensor electrode was employed to detect the cytotoxic action of L. monocytogenes on macrophage cell line. Although positive signals were obtained, the reproducibility of the assay was unsatisfactory (Gray, 2004). Also, mammalian cells are used to measure biochemical and metabolic end-products (delivered from cultured cells to the medium) (Ziegler, 2000). The CBAs can also measure the direct electrical response of electrogenic cells (neural cells, heart muscle cells, pancreas beta cells) or a neural cell network (Ziegler et al., 2000). For example, neurons were used with great sensitivity to sense cell death dynamics, receptor–ligand interactions, alterations in metabolism, and generic membrane perforation processes. Neurons were shown to be an excellent sensor system to monitor their chemical environment and generate typical responses that are concentration- and substance specific (Gross et al., 1992).

30

Arun K. Bhunia

CytosensorÒ Microphysiometer technology has been used to detect perturbation in mammalian cells (Hafner, 2000). The system measures small changes in extracellular acidification using a light addressable potentiometric sensor. If the metabolism is interfered with, acid excretion will be affected which could be sensitively measured by LAPS. In principle, this system should be suitable for monitoring pathogen interaction with mammalian cells. Mammalian cells have been widely used for the analysis of the pathogenic potential of foodborne bacteria (Bhunia and Wampler, 2005). For L. monocytogenes, various cell types were used such as the enterocyte-like Caco-2 (Pine et al., 1991; Van Langendonck et al., 1998), macrophage (Dallas et al., 1996), epithelial HT-29 (Roche et al., 2001), and hybrid lymphocyte-Ped-2E9 (Bhunia et al., 1994, 1995). Early work reported that a multiplicity of infection (MOI) of 100:1 (L. monocytogenes:hybridoma) resulted in 85% cell death in 4 h, as measured by the Trypan blue exclusion assay. Later, using the colorimetric lactate dehydrogenase (LDH) enzyme or AP release assays, the same system produced 80–95% cytotoxicity in 4–6 h, in which enzyme release correlated directly with the Trypan blue exclusion assay (Bhunia and Westbrook, 1998). L. monocytogenes induced severe membrane pore formations and cell death was shown to be due to the induction of apoptosis (Bhunia and Feng, 1999; Menon et al., 2003). Sulfhydryl-activated listeriolysin O (LLO) is the primary factor responsible for cell lyses, thus addition of a thiol-reducing compound, dithiothreitol (DTT), to the assay mixture expedited the assay where the cytotoxic effect was determined in 1.5–2 h (Westbrook and Bhunia, 2000). This assay is specific and sensitive in distinguishing virulent from avirulent species of Listeria. The assay time was again shortened to 1 h when a fluorescence-based cytotoxicity assay was incorporated (Shroyer and Bhunia, 2003). This hybridoma cell-based assay was used for detection of L. monocytogenes from food samples using a two-step method of immunobead capture and cytotoxicity analysis (Gray and Bhunia, 2005). Recently, work from our laboratory has shown that enterotoxigenic Bacillus species can be detected using the same Ped-2E9 cell-based cytotoxicity assay (Banerjee et al., 2007; Gray et al., 2005). The Ped-2E9 cell cytotoxicity assay is considerably faster than the other conventional CBAs like the MTT (3-[4,5-dimethyl thiazolyl-2]-2, 5-diphenyltetrazolium bromide)-based CHO cell assay, where cytotoxic effect was determined in just 1 h. The sensitivity of Ped-2E9 hybridoma cells to pathogenic Listeria and Bacillus species makes this cell line a potential candidate to be employed in a cell-based biosensor device. A novel genetically engineered B-cell-based sensor was developed to detect various pathogens relevant to food safety and biowarfare agents (Rider et al., 2003). The B-cells were engineered to express cytosolic aequorin, a calcium-sensitive bioluminescent protein, and pathogen-specific

Biosensors and Bio-Based Methods

31

surface antibodies. The assay was able to detect 500 cfu of E. coli O157:H7, 1000 spores of B. anthracis, and 200 cfu of Y. pestis in minutes. Banerjee et al. (2005) proposed a simple filtration tube-based cell sensor with a portable colorimetric detector (Ocean Optics spectrophotometer), where the Ped-2E9 cell line was immobilized in a gelatin matrix. Upon addition of a toxin preparation from Listeria or Bacillus, the Ped-2E9 cells released ALP and converted colorless p-nitrophenyl phosphate into a chomogenic product, which was detected by the spectrophotometer. Zhao et al. (2006) used a lipid bilayer (liposome) with an embedded cholesterol receptor for determining the action of LLO in an artificial cell-based biosensor. The liposome was immobilized in silica nano-composite materials (sol-gel) and the action of the toxin was quantified by measuring the release of a fluorescence reporter from liposome. The advantages of this system are that the liposome could be stored in ambient conditions for up to 5 months, and this system can detect nanogram quantities of toxin rapidly (in 30 min). A mammalian cell-based biochip for allergen detection was also proposed (Matsubara et al., 2004). They cultured a basophilic mast cell line (RBL-2H3) that releases histamine upon activation by an allergen, in a microfluidic biochip molded with PDMS (poly-dimethylsiloxane). The mast cells were pretreated with a fluorescent dye, quinacrine, that binds to histamine in acidic compartments of the cell granule by mass action. Upon exposure to the allergen, the IgE-activated cells release histamine along with the fluorescent dye, which is measured by a photomultiplier tube attached to a microscope.

IV. CONCLUSIONS Many of the sensor platforms discussed above demonstrated the proof-ofconcept by testing with pure bacterial cultures or toxins; however, only a handful of those were tested thoroughly with real-world food samples for their ruggedness, robustness, sensitivity, and cross-reactivity. Future efforts should focus on continued improvement in the applicability of some of those most promising sensors for their ability to detect foodborne pathogens from real-world food and environmental samples. Furthermore, the cost of the sensors should be addressed. Although at this time, it may not be a cost-effective technology, with continued advancement and mass production, the sensors should one day be affordable for the routine testing of samples. Sensors are effective only when a clean sample is delivered to the device. In spite of tremendous progress in sensor development, efforts to improve sample processing and preparation are lagging behind, which should be given a high priority to fully appreciate the usefulness of sensor technologies. Sensor technologies are

32

Arun K. Bhunia

also becoming a powerful tool in biomedical applications in probing the human body for early diagnosis of malignant cancer, cardiovascular disease, diabetes, etc. If we continue to embrace this exciting field of science and technology, one day this will be integral part of human life and the way we live.

ACKNOWLEDGMENTS The research in author’s laboratory is supported through a cooperative agreement with the Agricultural Research Service of the US Department of Agriculture project number 1935-42000-035 and the Center for Food Safety Engineering at Purdue University and USDA-NRI.

REFERENCES Alocilja, E. C., and Radke, S. M. (2003). Market analysis of biosensors for food safety. Biosens. Bioelectron. 18, 841–846. Altekruse, S. F., Bauer, N., Chanlongbutra, A., DeSagun, R., Naugle, A., Schlosser, W., Umholtz, R., and White, P. (2006). Salmonella Enteritidis in broiler chickens, United States, 2000–2005. Emerg. Infect. Dis. 12, 1848–1852. Amagliani, G., Omiccioli, E., del Campo, A., Bruce, I. J., Brandi, G., and Magnani, M. (2006). Development of a magnetic capture hybridization-PCR assay for Listeria monocytogenes direct detection in milk samples. J. Appl. Microbiol. 100, 375–383. Anderson, G. P., and Nerurkar, N. L. (2002). Improved fluoroimmunoassays using the dye Alexa Fluor 647 with the RAPTOR, a fiber optic biosensor. J. Immunol. Methods 271, 17–24. Anderson, G. P., and Taitt, C. A. R. (2005). Biosensor-based detetction of foodborne pathogens. In ‘‘Foodborne Pathogens: Microbiology and Molecular Biology’’ (P. Fratamico, A. K. Bhunia, and J. L. Smith, eds.), pp. 33–50. Caister Academic Press, Norfolk. Anderson, G. P., Golden, J. P., Shriverlake, L. C., and Ligler, F. S. (1992). Optimization of sensor probe taper angle for a fiber optic biosensor. FASEB J. 6, A169. Anderson, G. P., Breslin, K. A., and Ligler, F. S. (1996). Assay development for a portable fiberoptic biosensor. ASAIO J. 42, 942–946. Anderson, G. P., Jacoby, M. A., Ligler, F. S., and King, K. D. (1997). Effectiveness of protein A for antibody immobilization for a fiber optic biosensor. Biosens. Bioelectron. 12, 329–336. Baeumner, A. (2004). Nanosensors identify pathogens in food. Food Technol. 58, 51–55. Balbus, J. M., and Embrey, M. A. (2002). Risk factors for waterborne enteric infections. Curr. Opin. Gastroenterol. 18, 46–50. Banada, P. P., Liu, Y.-S., Yang, L. J., Bashir, R., and Bhunia, A. K. (2006). Performance evaluation of a low conductive growth medium (LCGM) for healthy and stressed Listeria monocytogenes and other common bacterial species. Int. J. Food Microbiol. 111, 12–20. Banada, P. P., Guo, S., Bayraktar, B., Bae, E., Rajwa, B., Robinson, J. P., Hirleman, E. D., and Bhunia, A. K. (2007). Optical forward-scattering for detection of Listeria monocytogenes and other Listeria species. Biosens. Bioelectron. 22, 1664–1671. Banerjee, P., Banada, P. P., Rickus, J. L., Morgan, M., and Bhunia, A. K. (2005). A portable cellbased optical detetcion device for rapid detection of Listeria and Bacillus toxins. Proc. SPIE. 5996, 1–7. Banerjee, P., Morgan, M. T., Rickus, J. L., Ragheb, K., Corvalan, C., Robinson, J. P., and Bhunia, A. K. (2007). Hybridoma Ped-2E9 cells cultured under modified conditions can sensitively detect Listeria monocytogenes and Bacillus cereus. Appl. Microbiol. Biotechnol. 73, 1423–1434.

Biosensors and Bio-Based Methods

33

Bayraktar, B., Banada, P. P., Hirleman, E. D., Bhunia, A. K., Robinson, J. P., and Rajwa, B. (2006). Feature extraction from light scatter patterns of Listeria colonies for identification and classification. J. Biomed. Opt. 11, 34006-1–34006-8. Bhunia, A. K. (1997). Antibodies to Listeria monocytogenes. Crit. Rev. Microbiol. 23, 77–107. Bhunia, A. K., and Feng, X. (1999). Examination of cytopathic effect and apoptosis in Listeria monocytogenes-infected hybridoma B-lymphocyte (Ped-2E9) line in vitro. J. Microbiol. Biotechnol. 9, 398–403. Bhunia, A. K., and Lathrop, A. (2003). Pathogen detection, food-borne. In ‘‘McGraw-Hill Yearbook of Science and Technology’’ pp. 320–323. McGraw-Hill, New York. Bhunia, A. K., and Wampler, J. L. (2005). Animal and cell culture models for foodborne bacterial pathogens. In ‘‘Foodborne Pathogens: Microbiology and Molecular Biology’’ (P. Fratamico, A. K. Bhunia, and J. L. Smith, eds.), pp. 15–32. Caister Academic Press, Norfolk. Bhunia, A. K., and Westbrook, D. G. (1998). Alkaline phosphatase release assay to determine cytotoxicity for Listeria species. Lett. Appl. Microbiol. 26, 305–310. Bhunia, A. K., Steele, P., Westbrook, D., Bly, L., Maloney, T., and Johnson, M. (1994). A sixhour in vitro virulence assay for Listeria monocytogenes using myeloma and hybridoma cells from murine and human sources. Microb. Pathog. 16, 99–110. Bhunia, A. K., Westbrook, D. G., Story, R., and Johnson, M. G. (1995). Frozen stored murine hybridoma cells can be used to determine the virulence of Listeria monocytogenes. J. Clin. Microbiol. 33, 3349–3351. Bhunia, A. K., Jaradat, Z. W., Naschansky, K., Shroyer, M., Morgan, M. T., Gomez, R., Bashir, R., and Ladisch, M. (2001). Impedance spectroscopy and biochip sensor for detection of Listeria monocytogenes. Proc. SPIE 4206, 32–39. Bhunia, A. K., Banada, P. P., Banerjee, P., Valadez, A., and Hirleman, E. D. (2007). Light scattering, fiber optic and cell-based sensors for sensitive detection of foodborne pathogens. J. Rapid Methods Automat. Microbiol. 15, 121–145. Bokken, G. C. A. M., Corbee, R. J., van Knapen, F., and Bergwerff, A. A. (2003). Immunochemical detection of Salmonella group B, D and E using an optical surface plasmon resonance biosensor. FEMS Microbiol. Lett. 222, 75–82. Bolton, F. J. (1990). An investigation of indirect conductimetry for detection of some foodborne bacteria. J. Appl. Bacteriol. 69, 655–661. Brandl, M. T. (2006). Fitness of human enteric pathogens on plants and implications for food safety. Annu. Rev. Phytopathol. 44, 367–392. Brewster, J. D., and Mazenko, R. S. (1998). Filtration capture and immunoelectrochemical detection for rapid assay of Escherichia coli O157:H7. J. Immunol. Methods 211, 1–8. Bronk, B. V., Druger, S., Czege, J., and Van de Merwe, W. (1995). Measuring diameters of rodshaped bacteria in vivo with polarized light scattering. Biophys. J. 69, 1170–1177. Bronk, B. V., Li, Z. Z., and Czege, J. (2001). Polarized light scattering as a rapid and sensitive assay for metal toxicity to bacteria. J. Appl. Toxicol. 21, 107–113. Bruno, J. G., Ulvick, S. J., Uzzell, G. L., Tabb, J. S., Valdes, E. R., and Batt, C. A. (2001). Novel immuno-FRET assay method for Bacillus spores and Escherichia coli O157:H7. Biochem. Biophys. Res. Commun. 287, 875–880. CDC (2006). Update on multi-state outbreak of E. coli O157:H7 infections from fresh spinach. E. coli O157:H7 Outbreak in Spinach. Department of Health and Human services, Center for Disease control and Prevention (CDC), Atlanta, GA In October 6, 2006. http://www. cdc.gov/foodborne/ecolispinach/100606.htm. Accessed Feb. 23, 2007. Capell, C. J., Kirby, R. M., and Moss, M. O. (1995). A method and medium for the electrical detection of Listeria spp. from food. Int. J. Food Microbiol. 25, 169–177. Carter, M. J. (2005). Enterically infecting viruses: Pathogenicity, transmission and significance for food and waterborne infection. J. Appl. Microbiol. 98, 1354–1380.

34

Arun K. Bhunia

Chapman, P. A., and Ashton, R. (2003). An evaluation of rapid methods for detecting Escherichia coli O157 on beef carcasses. Int. J. Food Microbiol. 87, 279–285. Chapman, P. A., and Cudjoe, K. S. (2001). Evaluation of BeadRetrieverTM, an automated system for concentration of Escherichia coli O157 from enrichment cultures by immunomagnetic separation. J. Rapid Methods Automat. Microbiol. 9, 203–214. Chang, H., Ikram, A., Kosari, F., Vasmatzis, G., Bhunia, A., and Bashir, R. (2002). Electrical characterization of micro-organisms using microfabricated devices. J. Vac. Sci. Technol. B 20, 2058–2064. Che, Y., Li, Y., and Slavik, M. (2001). Detection of Campylobacter jejuni in poultry samples using an enzyme-linked immunoassay coupled with an enzyme electrode. Biosens. Bioelectron. 16, 791–797. Chen, W. T., Hendrickson, R. L., Huang, C. P., Sherman, D., Geng, T., Bhunia, A. K., and Ladisch, M. R. (2005a). Mechanistic study of membrane concentration and recovery of Listeria monocytogenes. Biotechnol. Bioeng. 89, 263–273. Chen, W. T., Ladisch, M. R., Geng, T., and Bhunia, A. K. (2005b). Membrane for selective capture of the microbial pathogen Listeria monocytogenes. AIChE J. 51, 3305–3308. Colquhoun, K. O., Timms, S., and Fricker, C. R. (1995). Detection of Escherichia coli in potable water using direct impedance technology. J. Appl. Bacteriol. 79, 635–639. Dallas, H. L., Thomas, D. P., and Hitchins, A. D. (1996). Virulence of Listeria monocytogenes, Listeria seeligeri, and Listeria innocua assayed with in vitro murine macrophagocytosis. J. Food Prot. 59, 24–27. Deisingh, A. K., and Thompson, M. (2004). Biosensors for the detection of bacteria. Can. J. Microbiol. 50, 69–77. Del Giallo, M. L., Ariksoysal, D., Marrazza, G., Mascini, M., and Ozsoz, M. (2005). Disposable electrochemical enzyme-amplified genosensor for Salmonella bacteria detection. Anal. Lett. 38, 2509–2523. DeMarco, D. R., and Lim, D. V. (2002). Detection of Escherichia coli O157:H7 in 10- and 25-gram ground beef samples with an evanescent-wave biosensor with silica and polystyrene waveguides. J. Food Prot. 65, 596–602. DeMarco, D. R., Saaski, E. W., McCrae, D. A., and Lim, D. V. (1999). Rapid detection of Escherichia coli O157:H7 in ground beef using a fiber-optic biosensor. J. Food Prot. 62, 711–716. Deng, J. D., Schoenbach, K. H., Buescher, E. S., Hair, P. S., Fox, P. M., and Beebe, S. J. (2003). The effects of intense submicrosecond electrical pulses on cells. Biophys. J. 84, 2709–2714. Diaspro, A., Radicchi, G., and Nicolini, C. (1995). Polarized-light scattering—A biophysical method for studying bacterial cells. IEEE Trans. Biomed. Eng. 42, 1038–1043. Dill, K., Song, J. H., Blomdahl, J. A., and Olson, J. D. (1997). Rapid, sensitive and specific detection of whole cells and spores using the light-addressable potentiometric sensor. J. Biochem. Biophys. Methods 34, 161–166. Dill, K., Stanker, L. H., and Young, C. R. (1999). Detection of salmonella in poultry using a silicon chip-based biosensor. J. Biochem. Biophys. Methods 41, 61–67. Dormont, D. (2002). Prions, BSE and food. Int. J. Food Microbiol. 78, 181–189. Doyle, M. P., and Erickson, M. C. (2006). Reducing the carriage of foodborne pathogens in livestock and poultry. Poult. Sci. 85, 960–973. Duncanson, P., Wareing, D. R. A., and Jones, O. (2003). Application of an automated immunomagnetic separation-enzyme immunoassay for the detection of Salmonella spp. during an outbreak associated with a retail premises. Lett. Appl. Microbiol. 37, 144–148. Duffy, G., Sheridan, J. J., Hofstra, H., McDowell, D. A., and Blair, I. S. (1997). A comparison of immunomagnetic and surface adhesion immunofluorescent techniques for the rapid detection of Listeria monocytogenes and Listeria innocua in meat. Lett. Appl. Microbiol. 24, 445–450.

Biosensors and Bio-Based Methods

35

Ehret, R., Baumann, W., Brischwein, M., Schwinde, A., Stegbauer, K., and Wolf, B. (1996). Monitoring of celluar behaviour by impedance measurements on interdigitated electrode structures. Biosens. Bioelectron. 12, 29–41. Ercole, C., Gallo, M. D., Pantalone, M., Santucci, S., Mosiello, L., Laconi, C., and Lepidi, A. (2002). A biosensor for Escherichia coli based on a potentiometric alternating biosensing (PAB) transducer. Sens. Actuators B: Chem. 83, 48–52. Ercole, C., Del Gallo, M., Mosiello, L., Baccella, S., and Lepidi, A. (2003). Escherichia coli detection in vegetable food by a potentiometric biosensor. Sens. Actuators B Chem. 91, 163–168. Evrendilek, G. A., Richter, E. R., and Chism, G. W. (2001). Concurrent detection of Escherichia coli O157:H7 and Salmonella from a single enrichment in 24 h. J. Food Safety 21, 75–86. Falahee, M. B., Park, S. F., and Adams, M. R. (2003). Detection and enumeration of Campylobacter jejuni and Campylobacter coli by indirect impedimetry with an oxygen scavenging system. J. Food Prot. 66, 1724–1726. Fang, Y., Frutos, A. G., and Lahiri, J. (2003). Ganglioside microarrays for toxin detection. Langmuir 19, 1500–1505. Favrin, S. J., Jassim, S. A., and Griffiths, M. W. (2001). Development and optimization of a novel immunomagnetic separation-bacteriophage assay for detection of Salmonella enterica serovar Enteritidis in broth. Appl. Environ. Microbiol. 67, 217–224. Fegan, N., Higgs, G., Vanderlinde, P., and Desmarchelier, P. (2004). Enumeration of Escherichia coli O157 in cattle faeces using most probable number technique and automated immunomagnetic separation. Lett. Appl. Microbiol. 38, 56–59. Fehlhaber, K., and Kruger, G. (1998). The study of Salmonella enteritidis growth kinetics using rapid automated bacterial impedance technique. J. Appl. Microbiol. 84, 945–949. Feldhusen, F. (2000). The role of seafood in bacterial foodborne diseases. Microbiol. Infect. 2, 1651–1660. Fluit, A. C., Torensma, R., Visser, M. J., Aarsman, C. J., Poppelier, M. J., Keller, B. H., Klapwijk, P., and Verhoef, J. (1993). Detection of Listeria monocytogenes in cheese with the magnetic immuno-polymerase chain reaction assay. Appl. Environ. Microbiol. 59, 1289–1293. Fraatz, R. J., Prakash, G., and Allen, F. S. (1988). A polarization sensitive light-scattering system for the characterization of bacteria. Am. Biotechnol. Lab. 6, 24–28. Fratamico, P. M., Strobaugh, T. P., Medina, M. B., and Gehring, A. G. (1998). Detection of Escherichia coli O157:H7 using a surface plasmon resonance biosensor. Biotechnol. Tech. 12, 571–576. Fu, Z., Rogelj, S., and Kieft, T. L. (2005). Rapid detection of Escherichia coli O157:H7 by immunomagnetic separation and real-time PCR. Int. J. Food Microbiol. 99, 47–57. Fung, Y. S., and Wong, Y. Y. (2001). Self-assembled monolayers as the coating in a quartz piezoelectric crystal immunosensor to detect Salmonella in aqueous solution. Anal. Chem. 73, 5302–5309. Gehring, A. G., Patterson, D. L., and Tu, S. I. (1998). Use of a light-addressable potentiometric sensor for the detection of Escherichia coli O157:H7. Anal. Biochem. 258, 293–298. Gehring, A. G., Brewster, J. D., Irwin, P. L., Tu, S. I., and Van Houten, L. J. (1999). 1-Naphthyl phosphate as an enzymatic substrate for enzyme-linked immunomagnetic electrochemistry. J. Electroanal. Chem. 469, 27–33. Gehring, A. G., Irwin, P. L., Reed, S. A., Tu, S. I., Andreotti, P. E., Akhavan-Tafti, H., and Handley, R. S. (2004). Enzyme-linked immunomagnetic chemiluminescent detection of Escherichia coli O157:H7. J. Immunol. Methods 293, 97–106. Geng, T., and Bhunia, A. K. (2007). Optical biosensors in foodborne pathogen detection. In ‘‘Smart Biosensor Technology’’ (G. K. Knopf and A. S. Bassi, eds.), pp. 503–519. Taylor and Francis, Boca Raton, Florida.

36

Arun K. Bhunia

Geng, T., Kim, K. P., Gomez, R., Sherman, D. M., Bashir, R., Ladisch, M. R., and Bhunia, A. K. (2003). Expression of cellular antigens of Listeria monocytogenes that react with monoclonal antibodies C11E9 and EM-7G1 under acid-, salt- or temperature-induced stress environments. J. Appl. Microbiol. 95, 762–772. Geng, T., Morgan, M. T., and Bhunia, A. K. (2004). Detection of low levels of Listeria monocytogenes cells by using a fiber-optic immunosensor. Appl. Environ. Microbiol. 70, 6138–6146. Geng, T., Hahm, B. K., and Bhunia, A. K. (2006a). Selective enrichment media affect the antibody-based detection of stress-exposed Listeria monocytogenes due to differential expression of antibody-reactive antigens identified by protein sequencing. J. Food Prot. 69, 1879–1886. Geng, T., Uknalis, J., Tu, S. I., and Bhunia, A. K. (2006b). Fiber-optic biosensor employing Alexa-Fluor conjugated antibody for detection of Escheria coli O157:H7 from ground beef in four hours. Sensors 6, 796–807. Giaever, I., and Keese, C. R. (1991). Micromotion of mammalian cells measured electrically. Proc. Natl. Acad. Sci. USA 88, 7896–7900. Giaever, I., and Keese, C. R. (1993). A morphological biosensor for mammalian cells. Nature 366, 591–592. Gibson, D. M., Coombs, P., and Pimbley, D. W. (1992). Automated conductance method for the detection of Salmonella in foods: Collaborative study. J. AOAC Int. 75, 293–302. Glassmoyer, K. E., and Russell, S. M. (2001). Evaluation of a selective broth for detection of Staphylococcus aureus using impedance microbiology. J. Food Prot. 64, 44–50. Golden, J. P., Taitt, C. R., Shriver-Lake, L. C., Shubin, Y. S., and Ligler, F. S. (2005). A portable automated multianalyte bisensor. Talanta 65, 1078–1085. Gomez, R., Bashir, R., Sarikaya, A., Ladisch, M. R., Sturgis, J., Robinson, J. P., Geng, T., Bhunia, A. K., Apple, H. L., and Werely, S. (2001). Microfluidic biochip for impedance spectroscopy of biological species. Biomed. Microdevices 3, 201–209. Gomez, R., Bashir, R., and Bhunia, A. K. (2002). Microscale electronic detection of bacterial metabolism. Sens. Actuators B Chem. 86, 198–208. Gracias, K. S., and McKillip, J. L. (2004). A review of conventional detection and enumeration methods for pathogenic bacteria in food. Can. J. Microbiol. 50, 883–890. Gray, K. M. (2004). Cytotoxicity and cell-based sensors for detection of Listeria monocytogenes and Bacillus species. Ph.D. Dissertation, Purdue University, West Lafayette p. 130. Gray, K. M., and Bhunia, A. K. (2005). Specific detection of cytopathogenic Listeria monocytogenes using a two-step method of immunoseparation and cytotoxicity analysis. J. Microbiol. Methods 60, 259–268. Gray, K. M., Banada, P. P., O’Neal, E., and Bhunia, A. K. (2005). Rapid Ped-2E9 cell-based cytotoxicity analysis and genotyping of Bacillus species. J. Clin. Microbiol. 43, 5865–5872. Gross, G. W., Rhoades, B., and Jordan, R. (1992). Neuronal networks for biochemical sensing. Sens. Actuators B 6, 1–8. Gupta, M. J., Irudayaraj, J. M., Debroy, C., Schmilovitch, Z., and Mizrach, A. (2005). Differentiation of food pathogens using FTIR and artificial neural networks. Trans. ASAE 48, 1889–1892. Hafner, F. (2000). Cytosensor(R) microphysiometer: Technology and recent applications. Biosens. Bioelectron. 15, 149–158. Hahm, B. K., and Bhunia, A. K. (2006). Effect of environmental stresses on antibody-based detection of Escherichia coli O157:H7, Salmonella enterica serotype Enteritidis and Listeria monocytogenes. J. Appl. Microbiol. 100, 1017–1027. Harteveld, J. L. N., Nieuwenhuizen, M. S., and Wils, E. R. J. (1997). Detection of staphylococcal enterotoxin B employing a piezoelectric crystal immunosensor. Biosens. Bioelectron. 12, 661–667.

Biosensors and Bio-Based Methods

37

He, F. J., Zhao, J. W., Zhang, L. D., and Su, X. N. (2003). A rapid method for determining Mycobacterium tuberculosis based on a bulk acoustic wave impedance biosensor. Talanta 59, 935–941. Hielscher, A. H., Mourant, J. R., and Bigio, I. J. (1997). Influence of particle size and concentration on the diffuse backscattering of polarized light from tissue phantoms and biological cell suspensions. Appl. Optics 36, 125–135. Hirschfeld, T. (1985). Instantaneous source wavelength identification with a minimal number of detectors. Appl. Optics 24, 2484–2485. Hirschfeld, T., Callis, J. B., and Kowalski, B. R. (1984). Chemical sensing in process analysis. Science 226, 312–318. Homola, J., Dostalek, J., Chen, S., Rasooly, A., Jiang, S., and Yee, S. S. (2002). Spectral surface plasmon resonance biosensor for detection of staphylococcal enterotoxin B in milk. Int. J. Food Microbiol. 75, 61–69. Huang, T. T., Sturgis, J., Gomez, R., Geng, T., Bashir, R., Bhunia, A. K., Robinson, J. P., and Ladisch, M. R. (2003a). Composite surface for blocking bacterial adsorption on protein biochips. Biotechnol. Bioeng. 81, 618–624. Huang, T. T., Geng, T., Sturgis, J., Li, H. B., Gomez, R., Bashir, R., Bhunia, A. K., Robinson, J. P., and Ladisch, M. R. (2003b). Lysozyme for capture of microorganisms on protein biochips. Enz. Microbial Technol. 33, 958–966. Huang, T. T., Geng, T., Akin, D., Chang, W. J., Sturgis, J., Bashir, R., Bhunia, A. K., Robinson, J. P., and Ladisch, M. R. (2003c). Micro-assembly of functionalized particulate monolayer on C-18-derivatized SiO2 surfaces. Biotechnol. Bioeng. 83, 416–427. Hudson, J. A., Lake, R. J., Savill, M. G., Scholes, P., and McCormick, R. E. (2001). Rapid detection of Listeria monocytogenes in ham samples using immunomagnetic separation followed by polymerase chain reaction. J. Appl. Microbiol. 90, 614–621. Iqbal, S. S., Mayo, M. W., Bruno, J. G., Bronk, B. V., Batt, C. A., and Chambers, J. P. (2000). A review of molecular recognition technologies for detection of biological threat agents. Biosens. Bioelectron. 15, 549–578. Irudayaraj, J., Yang, H., and Sakhamuri, S. (2002). Differentiation and detection of microorganisms using Fourier transform infrared photoacoustic spectroscopy. J. Mol. Struct. 606, 181–188. Ivnitski, D., Abdel-Hamid, I., Atanasov, P., and Wilkins, E. (1999). Biosensors for detection of pathogenic bacteria. Biosens. Bioelectron. 14, 599–624. Ivnitski, D., Abdel-Hamid, I., Atanasov, P., Wilkins, E., and Stricker, S. (2000). Application of electrochemical biosensors for detection of food pathogenic bacteria. Electroanalysis 12, 317–325. Jacobsen, C. N., Fremming, C., and Jakobsen, M. (1997). Immunomagnetic separation of Listeria monocytogenes for flow cytometric determination of viable cells in liquid. J. Microbiol. Methods 31, 75–81. Jenikova, G., Pazlarova, J., and Demnerova, K. (2000). Detection of Salmonella in food samples by the combination of immunomagnetic separation and PCR assay. Int. Microbiol. 3, 225–229. Jongerius-Gortemaker, B. G. M., Goverde, R. L. J., van Knapen, F., and Bergwerff, A. A. (2002). Surface plasmon resonance (BIACORE) detection of serum antibodies against Salmonella enteritidis and Salmonella typhimurium. J. Immunol. Methods 266, 33–44. Jordan, M., Diaz, R. E., and Hirleman, E. D. (2002). Semi-empirical model of light scattering from submicron pyramidal pits. Opt. Eng. 41, 518–528. Jordan, D., Vancov, T., Chowdhury, A., Andersen, L. M., Jury, K., Stevenson, A. E., and Morris, S. G. (2004). The relationship between concentration of a dual marker strain of Salmonella typhimurium in bovine faeces and its probability of detection by immunomagnetic separation and culture. J. Appl. Microbiol. 97, 1054–1062.

38

Arun K. Bhunia

Jung, Y. S., Frank, J. F., and Brackett, R. E. (2003a). Evaluation of antibodies for immunomagnetic separation combined with flow cytometry detection of Listeria monocytogenes. J. Food Prot. 66, 1283–1287. Jung, C. C., Saaski, E. W., McCrae, D. A., Lingerfelt, B. M., and Anderson, G. P. (2003b). RAPTOR: A fluoroimmunoassay-based fiber optic sensor for rapid detection of biological threats. IEEE Sens. J. 3, 352–360. Kaclikova, E., Kuchta, T., Kay, H., and Gray, D. (2001). Separation of Listeria from cheese and enrichment media using antibody-coated microbeads and centrifugation. J. Microbiol. Methods 46, 63–67. Kawasaki, S., Yamashoji, S., Asakawa, A., Isshiki, K., and Kawamoto, S. (2004). Menadionecatalyzed luminol chemiluminescence assay for the rapid detection of viable bacteria in foods under aerobic conditions. J. Food Prot. 67, 2767–2771. Kim, K.-P., Jagadeesan, B., Burkholder, K. M., Jaradat, Z. W., Wampler, J. L., Lathrop, A. A., Morgan, M. T., and Bhunia, A. K. (2006a). Adhesion characteristics of Listeria adhesion protein (LAP)-expressing Escherichia coli to Caco-2 cells and of recombinant LAP to eukaryotic receptor Hsp60 as examined in a surface plasmon resonance sensor. FEMS Microbiol. Lett. 256, 324–332. Kim, S., Burgula, Y., Ojanen-Reuhs, T., Cousin, M. A., Reuhs, B. L., and Mauer, U. J. (2006b). Differentiation of crude lipopolysaccharides from Escherichia coli strains using Fourier transform infrared spectroscopy and chemometrics. J. Food Sci. 71, M57–M61. King, K. D., Anderson, G. P., Bullock, K. E., Regina, M. J., Saaski, E. W., and Ligler, F. S. (1999). Detecting staphylococcal enterotoxin B using an automated fiber optic biosensor. Biosens. Bioelectron. 14, 163–170. Kirkwood, J., Al-Khaldi, S. F., Mossoba, M. M., Sedman, J., and Ismail, A. A. (2004). Fourier transform infrared bacteria identification with the use of a focal-plane-array detector and microarray printing. Appl. Spectrosc. 58, 1364–1368. Ko, S., and Grant, S. A. (2003). Development of a novel FRET method for detection of Listeria or Salmonella. Sens. Actuators B: Chem. 96, 372–378. Ko, S., and Grant, S. A. (2006). A novel FRET-based optical fiber biosensor for rapid detection of Salmonella typhimurium. Biosens. Bioelectron. 21, 1283–1290. Koo, K., and Jaykus, L.-A. (2003). Detection of Listeria monocytogenes from a model food by fluorescence resonance energy transfer-based PCR with an symmetric fluorogenic probe set. Appl. Environ. Microbiol. 69, 1082–1088. Koubova, V., Brynda, E., Karasova, L., Skvor, J., Homola, J., Dostalek, J., Tobiska, P., and Rosicky, J. (2001). Detection of foodborne pathogens using surface plasmon resonance biosensors. Sens. Actuators B Chem. 74, 100–105. Kramer, M. F., and Lim, D. V. (2004). A rapid and automated fiber optic-based biosensor assay for the detection of Salmonella in spent irrigation water used in the sprouting of sprout seeds. J. Food Prot. 67, 46–52. Kyle, A. H., Chan, C. T. O., and Minchinton, A. I. (1999). Characterization of threedimensional tissue cultures using electrical impedance spectroscopy. Biophys. J. 76, 2640–2648. Lamprell, H., Mazerolles, G., Kodjo, A., Chamba, J. F., Noel, Y., and Beuvier, E. (2006). Discrimination of Staphylococcus aureus strains from different species of Staphylococcus using Fourier transform infrared (FTIR) spectroscopy. Int. J. Food Microbiol. 108, 125–129. Lathrop, A. A., Jaradat, Z. W., Haley, T., and Bhunia, A. K. (2003). Characterization and application of a Listeria monocytogenes reactive monoclonal antibody C11E9 in a resonant mirror biosensor. J. Immunol. Methods 281, 119–128. Leonard, P., Hearty, S., Brennan, J., Dunne, L., Quinn, J., Chakraborty, T., and O’Kennedy, R. (2003). Advances in biosensors for detection of pathogens in food and water. Enz. Microb. Technol. 32, 3–13.

Biosensors and Bio-Based Methods

39

Leonard, P., Hearty, S., Quinn, J., and O’Kennedy, R. (2004). A generic approach for the detection of whole Listeria monocytogenes cells in contaminated samples using surface plasmon resonance. Biosens. Bioelectron. 19, 1331–1335. Leonard, P., Hearty, S., Wyatt, G., Quinn, J., and O’Kennedy, R. (2005). Development of a surface plasmon resonance-based immunoassay for Listeria monocytogenes. J. Food Prot. 68, 728–735. Li, H. B., and Bashir, R. (2002). Dielectrophoretic separation and manipulation of live and heat-treated cells of Listeria on microfabricated devices with interdigitated electrodes. Sens. Actuators B Chem. 86, 215–221. Liddell, E. (2005). Antibodies. In ‘‘The immunoassay Handbook’’ (D. Wild, ed.). 3rd Ed. Elsevier Ltd., New York. Ligler, F. S., Taitt, C. R., Shriver-Lake, L. C., Sapsford, K. E., Shubin, Y. S., and Golden, J. P. (2003). Array biosensor for detection of toxins. Anal. Bioanal. Chem. 377, 469–477. Lin, H.-C., and Tsai, W.-C. (2003). Piezoelectric crystal immunosensor for the detection of staphylococcal enterotoxin B. Biosens. Bioelectron. 18, 1479–1483. Lynch, M., Painter, J., Woodruff, R., and Braden, C. (2006). Surveillance for foodbornedisease outbreaks: United States, 1998–2002. Morb. Mortal. Wkly. Rep. 55, 1–42. Macario, A. J. L., and De Macario, E. C. (1988). Monoclonal-antibodies against bacteria. Biotechnol. Adv. 6, 135–150. Madden, R. H., and Gilmour, A. (1995). Impedance as an alternative to MPN enumeration of coliforms in pasteurized milks. Lett. Appl. Microbiol. 21, 387–388. Majoul, I. (2004). Analysing the action of bacterial toxins in living cells with fluorescence resonance energy transfer (FRET). Int. J. Med. Microbiol. 293, 495–503. Maraldo, D., Shankar, P. M., and Mutharasan, R. (2006). Measuring bacterial growth by tapered fiber and changes in evanescent field. Biosens. Bioelectron. 21, 1339–1344. Marazuela, M. D., and Moreno-Bondi, M. C. (2002). Fiber-optic biosensors—an overview. Anal. Bioanal. Chem. 372, 664–682. Matsubara, Y., Murakami, Y., Kobayashi, M., Morita, Y., and Tamiya, E. (2004). Application of on-chip cell cultures for the detection of allergic response. Biosens. Bioelectron. 19, 741–747. Medina, M. B., VanHouten, L., Cooke, P. H., and Tu, S. I. (1997). Real-time analysis of antibody binding interactions with immobilized E. coli O157:H7 cells using the BIAcore. Biotechnol. Tech. 11, 173–176. Meeusen, C. A., Alocilja, E. C., and Osburn, W. N. (2005). Detection of E. coli O157:H7 using a miniaturized surface plasmon resonance biosensor. Trans. ASAE 48, 2409–2416. Mehrvar, M., Bis, C., Scharer, J. M., Moo-Young, M., and Luong, J. H. (2000). Fiber-optic biosensors: Trends and advances. Anal. Sci. 16, 677–692. Menon, A., Shroyer, M. L., Wampler, J. L., Chawan, C. B., and Bhunia, A. K. (2003). In vitro study of Listeria monocytogenes infection to murine primary and human transformed B cells. Comp. Immunol. Microbiol. Infect. Dis. 26, 157–174. Mercanoglu, B., and Aytac, S. A. (2002). Immunomagnetic separation and a cultural reference method for detection of Salmonella spp. in foods. Archiv Lebensmittelhyg. 53, 43–45. Mercanoglu, B., and Griffiths, M. W. (2005). Combination of immunomagnetic separation with real-time pcr for rapid detection of Salmonella in milk, ground beef, and alfalfa sprouts. J. Food Prot. 68, 557–561. Minunni, M., Mascini, M., Carter, R. M., Jacobs, M. B., Lubrano, G. J., and Guibault, G. G. (1996). A quartz crystal microbalance displacement assay for Listeria monocytogenes. Anal. Chim. Acta 325, 169–174. Mitchell, B. A., Milbury, J. A., Brookins, A. A., and Jackson, B. J. (1994). Use of immunomagnetic capture on beads to recover Listeria from environmental samples. J. Food Prot. 57, 743–745.

40

Arun K. Bhunia

Moreno-Bondi, M. C., Alarie, J. P., and Vo-Dinh, T. (2003). Multi-analyte analysis system using an antibody-based biochip. Anal. Bioanal. Chem. 375, 120–124. Mossoba, M. M., Al-Khaldi, S. F., Kirkwood, J., Fry, F. S., Sedman, J., and Ismail, A. A. (2005). Printing microarrays of bacteria for identification by infrared micro spectroscopy. Vib. Spectrosc. 38, 229–235. Muhammad-Tahir, Z., and Alocilja, E. C. (2004). A disposable biosensor for pathogen detection in fresh produce samples. Biosyst. Eng. 88, 145–151. Naimushin, A. N., Soelberg, S. D., Nguyen, D. K., Dunlap, L., Bartholomew, D., Elkind, J., Melendez, J., and Furlong, C. E. (2002). Detection of Staphylococcus aureus enterotoxin B at femtomolar levels with a miniature integrated two-channel surface plasmon resonance (SPR) sensor. Biosens. Bioelectron. 17, 573–584. Nanduri, V., Kim, G., Morgan, M., Ess, D., Hahm, B. K., Kothapalli, A., Valadez, A., Geng, T., and Bhunia, A. K. (2006). Antibody immobilization on waveguides using a flow-through system shows improved Listeria monocytogenes detection in an automated fiber optic biosensor: RAPTOR. Sensors 6, 808–822. Nebeker, B. M., Buckner, B., Hirleman, E. D., Lathrop, A. A., and Bhunia, A. K. (2001). Identification and characterization of bacteria on surfaces using light scattering. Proc. Soc. Photoopt. Instrument. Eng. 4206, 224–234. Nedelkov, D., and Nelson, R. W. (2003). Detection of staphylococcal enterotoxin B via biomolecular interaction analysis mass spectrometry. Appl. Environ. Microbiol. 69, 5212–5215. Nedelkov, D., Rasooly, A., and Nelson, R. W. (2000). Multitoxin biosensor-mass spectrometry analysis: A new approach for rapid, real-time, sensitive analysis of staphylococcal toxins in food. Int. J. Food Microbiol. 60, 1–13. Ngundi, M. M., Shriver-Lake, L. C., Moore, M. H., Lassman, M. E., Ligler, F. S., and Taitt, C. R. (2005). Array biosensor for detection of ochratoxin A in cereals and beverages. Anal. Chem. 77, 148–154. Ngundi, M. M., Taitt, C. R., McMurry, S. A., Kahne, D., and Ligler, F. S. (2006). Detection of bacterial toxins with monosaccharide arrays. Biosens. Bioelectron. 21, 1195–1201. O’Sullivan, C. K., Vaughan, R., and Guibault, G. G. (1999). Piezoelectric immunosensors— theory and applications. Anal. Lett. 32, 2353–2377. Ogert, R. A., Brown, J. E., Singh, B. R., Shriver-Lake, L. C., and Ligler, F. S. (1992). Detection of Clostridium botulinum toxin A using a fiber optic-based biosensor. Anal. Biochem. 205, 306–312. Oh, B. K., Kim, Y. K., Bae, Y. M., Lee, W. H., and Choi, J. W. (2002). Detection of Escherichia coli O157:H7 using immunosensor based on surface plasmon resonance. J. Microbiol. Biotechnol. 12, 780–786. Oh, B. K., Lee, W., Lee, W. H., and Choi, J. W. (2003). Nano-scale probe fabrication using selfassembly technique and application to detection of Escherichia coli O157:H7. Biotechnol. Bioprocess Eng. 8, 227–232. Oh, B. K., Kim, Y.-K., Park, K. W., Lee, W. H., and Choi, J.-W. (2004). Surface plasmon resonance immunosensor for the detection of Salmonella typhimurium. Biosens. Bioelectron. 19, 1497–1504. Oh, B. K., Lee, W., Chun, B. S., Bae, Y. M., Lee, W. H., and Choi, J. W. (2005). The fabrication of protein chip based on surface plasmon resonance for detection of pathogens. Biosens. Bioelectron. 20, 1847–1850. Okochi, M., Yokouchi, H., Nakamura, N., and Matsunaga, T. (1999). Electrochemical detection of allergen in small-volume whole blood using an array microelectrode: A simple method for detection of allergic reaction. Biotechnol. Bioeng. 65, 480–484. Okrend, A. J. G., Rose, B. E., and Lattuda, C. P. (1992). Isolation of Escherichia coli O157:H7 using O157 specific antibody coated beads. J. Food Prot. 55, 214–217. Pancrazio, J. J., Whelan, J. P., Borkholder, D. A., Ma, W., and Stenger, D. A. (1999). Development and application of cell-based biosensors. Ann. Biomed. Eng. 27, 697–711.

Biosensors and Bio-Based Methods

41

Park, I. S., and Kim, N. (1998). Thiolated Salmonella antibody immobilization onto the gold surface of piezoelectric quartz crystal. Biosens. Bioelectron. 13, 1091–1097. Pathirana, S. T., Barbaree, J., Chin, B. A., Hartell, M. G., Neely, W. C., and Vodyanoy, V. (2000). Rapid and sensitive biosensor for Salmonella. Biosens. Bioelectron. 15, 135–141. Perkins, E. A., and Squirrell, D. J. (2000). Development of instrumentation to allow the detection of microorganisms using light scattering in combination with surface plasmon resonance. Biosens. Bioelectron. 14, 853–859. Pine, L., Kathariou, S., Quinn, F., George, V., Wenger, J. D., and Weaver, R. E. (1991). Cytopathogenic effects in enterocyte-like Caco-2 cells differentiate virulent from avirulent Listeria strains. J. Clin. Microbiol. 29, 990–996. Prentice, N., Murray, J. S., Scott, M. F., Coombs, J. P., and Parton, A. (2006). Rapid isolation and detection of Escherichia coli O157:H7 in fresh produce. J. Rapid Methods Automat. Microbiol. 14, 299–308. Rasooly, A. (2001). Surface plasmon resonance analysis of staphylococcal enterotoxin B in food. J. Food Prot. 64, 37–43. Rasooly, A., and Herold, K. E. (2006). Biosensors for the analysis of food- and waterborne pathogens and their toxins. J. AOAC Int. 89, 873–883. Rasooly, L., and Rasooly, A. (1999). Real time biosensor analysis of Staphylococcal enterotoxin A in food. Int. J. Food Microbiol. 49, 119–127. Rawson, D. M., Willmer, A. J., and Turner, A. P. F. (1989). Whole-cell biosenors for environmental monitoring. Biosensors 4, 299–311. Rebuffo, C. A., Schmitt, J., Wenning, M., von Stetten, F., and Scherer, S. (2006). Reliable and rapid identification of Listeria monocytogenes and Listeria species by artificial neural network-based Fourier transform infrared spectroscopy. Appl. Environ. Microbiol. 72, 994–1000. Reinders, R. D., Barna, A., Lipman, L. J. A., and Bijker, P. G. H. (2002). Comparison of the sensitivity of manual and automated immunomagnetic separation methods for detection of Shiga toxin-producing Escherichia coli O157:H7 in milk. J. Appl. Microbiol. 92, 1015–1020. Rider, T. H., Petrovick, M. S., Nargi, F. E., Harper, J. D., Schwoebel, E. D., Mathews, R. H., Blanchard, D. J., Bortolin, L. T., Young, A. M., Chen, J., and Hollis, M. A. (2003). A B cellbased sensor for rapid identification of pathogens. Science 301, 213–215. Rijpens, N., Herman, L., Vereccken, F., Jannes, G., De Smedt, J., and De Zutter, L. (1999). Rapid detection of stressed Salmonella spp. in dairy and egg products using immunomagnetic separation and PCR. Int. J. Food Microbiol. 46, 37–44. Roche, S. M., Velge, P., Bottreau, E., Durier, C., Marquet-van der Mee, N., and Pardon, P. (2001). Assessment of the virulence of Listeria monocytogenes: Agreement between a plaque-forming assay with HT-29 cells and infection of immunocompetent mice. Int. J. Food Microbiol. 68, 33–44. Rodrigues, M., Capell, C. J., and Kirby, R. M. (1995). A new capacitance medium for presumptive detection of Listeria spp. from cheese samples. J. Microbiol. Methods 23, 291–296. Rogers, K. R., Valdes, J. J., and Eldefrawi, M. E. (1989). Acetylcholine receptor fiber-optic evanescent fluorosensor. Anal. Biochem. 182, 353–359. Ruan, C., Wang, H., and Li, Y. (2002a). A bienzyme electrochemical biosensor coupled with immunomagnetic separation for rapid detection of Escherichia coli O157:H7 in food samples. Trans. ASAE 45, 249–255. Ruan, C., Yang, L., and Li, Y. (2002b). Rapid detection of viable Salmonella typhimurium in a selective medium by monitoring oxygen consumption with electrochemical cyclic voltammetry. J. Electroanal. Chem. 519, 33–38. Safarik, I., Safarikova, M., and Forsythe, S. J. (1995). The application of magnetic separations in applied microbiology. J. Appl. Bacteriol. 78, 575–585. Sapsford, K. E., Taitt, C. R., Loo, N., and Ligler, F. S. (2005). Biosensor detection of botulinum toxoid A and staphylococcal enterotoxin B in food. Appl. Environ. Microbiol. 71, 5590–5592.

42

Arun K. Bhunia

Sapsford, K. E., Ngundi, M. M., Moore, M. H., Lassman, M. E., Shriver-Lake, L. C., Taitt, C. R., and Ligler, F. S. (2006). Rapid detection of foodborne contaminants using an Array Biosensor. Sens. Actuators B Chem. 113, 599–607. Schnerr, H., Vogel, R. F., and Niessen, L. (2002). A biosensor-based immunoassay for rapid screening of deoxynivalenol contamination in wheat. Food Agric. Immunol. 14, 313–321. Seo, K. H., Brackett, R. E., Hartman, N. F., and Campbell, D. P. (1999). Development of a rapid response biosensor for detection of Salmonella typhimurium. J. Food Prot. 62, 431–437. Shroyer, M., and Bhunia, A. (2003). Development of a rapid 1-h fluorescence-based cytotoxicity assay for Listeria species. J. Microbiol. Methods 55, 35–40. Sivakesava, S., Irudayaraj, J., and DebRoy, C. (2004). Differentiation of microorganisms by FTIR-ATR and NIR spectroscopy. Trans. ASAE 47, 951–957. Sivapalasingam, S., Friedman, C. R., Cohen, L., and Tauxe, R. V. (2004). Fresh produce: A growing cause of outbreaks of foodborne illness in the United States, 1973 through 1997. J. Food Prot. 67, 2342–2353. Skjerve, E., Rorvik, L. M., and Olsvik, O. (1990). Detection of Listeria monocytogenes in foods by immunomagnetic separation. Appl. Environ. Microbiol. 56, 3478–3481. Slavik, R., Homola, J., and Brynda, E. (2002). A miniature fiber optic surface plasmon resonance sensor for fast detection of staphylococcal enterotoxin B. Biosens. Bioelectron. 17, 591–595. Solomon, E. B., Yaron, S., and Matthews, K. R. (2002). Transmission of Escherichia coli O157: H7 from contaminated manure and irrigation water to lettuce plat tissue and its subsequent internalization. Appl. Environ. Microbiol. 68, 397–400. Song, L., Ahn, S., and Walt, D. R. (2006). Fiber-optic microsphere-based arrays for multiplexed biological warfare agent detection. Anal. Chem. 78, 1023–1033. Stenger, D. A., Gross, G. W., Keefer, E. W., Shaffer, K. M., Andreadis, J. D., Ma, W., and Pancrazio, J. J. (2001). Detection of physiologically active compounds using cell-based biosensors. Trends Biotechnol. 19, 304–309. Stevens, K. A., and Jaykus, L. A. (2004). Bacterial separation and concentration from complex sample matrices: A review. Crit. Rev. Microbiol. 30, 7–24. Stewart, G. C. (2005). Staphylococcus aureus. In ‘‘Foodborne Pathogens: Microbiology and Molecular Biology’’ (P. Fratamico, A. K. Bhunia, and J. L. Smith, eds.), pp. 273–284. Caister Academic Press, Norfolk. Strachan, N. J. C., and Gray, D. I. (1995). A rapid general method for the identification of PCR products using a fiberoptic biosensor and its application to the detection of Listeria. Lett. Appl. Microbiol. 21, 5–9. Su, X. L., and Li, Y. B. (2004). A self-assembled monolayer-based piezoelectric immunosensor for rapid detection of Escherichia coli O157:H7. Biosens. Bioelectron. 19, 563–574. Su, X. L., and Li, Y. (2005). Surface plasmon resonance and quartz crystal microbalance immunosensors for detection of Escherichia coli O157:H7. Trans. ASAE 48, 405–413. Subramanian, A., Irudayaraj, J., and Ryan, T. (2006a). Mono and dithiol surfaces on surface plasmon resonance biosensors for detection of Staphylococcus aureus. Sens. Actuators B Chem. 114, 192–198. Subramanian, A., Irudayaraj, J., and Ryan, T. (2006b). A mixed self-assembled monolayerbased surface plasmon immunosensor for detection of E. coli O157:H7. Biosens. Bioelectron. 21, 998–1006. Suehiro, J., Shutou, M., Hatano, T., and Hara, M. (2003). High sensitive detection of biological cells using dielectrophoretic impedance measurement method combined with electropermeabilization. Sens. Actuators B Chem. 96, 144–151. Swaminathan, B., and Feng, P. (1994). Rapid detection of food-borne pathogenic bacteria. Annu. Rev. Microbiol. 48, 401–426. Taitt, C. R., Golden, J. P., Shubin, Y. S., Shriver-Lake, L. C., Sapsford, K. E., Rasooly, A., and Ligler, F. S. (2004). A portable array biosensor for detecting multiple analytes in complex samples. Microb. Ecol. 47, 175–185.

Biosensors and Bio-Based Methods

43

Taitt, C. R., Anderson, G. P., and Ligler, F. S. (2005). Evanescent wave fluorescence biosensors. Biosens. Bioelectron. 20, 2470–2487. Taylor, A. D., Yu, Q. M., Chen, S. F., Homola, J., and Jiang, S. Y. (2005). Comparison of E. coli O157:H7 preparation methods used for detection with surface plasmon resonance sensor. Sens. Actuators B Chem. 107, 202–208. Tempelman, L. A., King, K. D., Anderson, G. P., and Ligler, F. S. (1996). Quantitating staphylococcal enterotoxin B in diverse media using a portable fiber-optic biosensor. Anal. Biochem. 233, 50–57. Thompson, S. E., Foster, N. S., Johnson, T. J., Valentine, N. B., and Amonette, J. E. (2003). Identification of bacterial spores using statistical analysis of Fourier transform infrared photoacoustic spectroscopy data. Appl. Spectrosc. 57, 893–899. Tims, T. B., Dickey, S. S., Demarco, D. R., and Lim, D. V. (2001). Detection of low levels of Listeria monocytogenes within 20 hours using an evanescent wave biosensor. Am. Clin. Lab. 20, 28–29. Torensma, R., Visser, M. J. C., Aarsman, C. J. M., Poppelier, M. J. J. G., Fluit, A. C., and Verhoef, J. (1993). Monoclonal antibodies that react with live Listeria spp. Appl. Environ. Microbiol. 59, 2713–2716. Trevejo, R. T., Barr, M. C., and Robinson, R. A. (2005). Important emerging bacterial zoonotic infections affecting the immunocompromised. Vet. Res. 36, 493–506. Trkov, M., Majerikova, I., Jerasek, B., Stefanovicova, A., Rijpens, N., and Kuchta, T. (1999). Detection of Salmonella in food over 30 h using enrichment and polymerase chain reaction. Food Microbiol. 16, 393–399. Tu, S. I., Uknalis, J., and Gehring, A. (1999). Detection of immunomagnetic bead captured Escherichia coli O157:H7 by light addressable potentiometric sensor. J. Rapid Methods Automat. Microbiol. 7, 69–79. Tu, S. I., Uknalis, J., Gore, M., and Irwin, P. (2002). The capture of Escherichia coli O157:H7 for light addressable potentiometric sensor (LAPS) using two different types of magnetic beads. J. Rapid Methods Automat. Microbiol. 10, 185–195. Tudos, A. J., Lucas-van den Bos, E. R., and Stigter, E. C. A. (2003). Rapid surface plasmon resonance-based inhibition assay of deoxynivalenol. J. Agric. Food Chem. 51, 5843–5848. Uchida, H., Fujitani, K., Kawai, Y., Kitazawa, H., Horii, A., Shiiba, K., Saito, K., and Saito, T. (2004). A new assay using surface plasmon resonance (SPR) to determine binding of the Lactobacillus acidophilus group to human colonic mucin. Biosci. Biotechnol. Biochem. 68, 1004–1010. Ueda, S., Maruyama, T., and Kuwabara, Y. (2006). Detection of Listeria monocytogenes from food samples by PCR after IMS-plating. Biocontrol. Sci. 11, 129–134. Uithoven, K. A., Schmidt, J. C., and Ballman, M. E. (2000). Rapid identification of biological warfare agents using an instrument employing a light addressable potentiometric sensor and a flow-through immunofiltration-enzyme assay system. Biosens. Bioelectron. 14, 761–770. Upadhyay, P., Patra, A. K., Mukhopadhyay, R., and Panda, A. K. (2001). Real time detection and quantification of inclusion bodies expressed in Escherichia coli by impedance measurements. Biotechnol. Lett. 23, 839–843. Uyttendaele, M., Van Hoorde, I., and Debevere, J. (2000). The use of immuno-magnetic separation (IMS) as a tool in a sample preparation method for direct detection of L. moncytogenes in cheese. Int. J. Food Microbiol. 54, 205–212. Van De Merwe, W. P., Li, Z. Z., Bronk, B. V., and Czege, J. (1997). Polarized light scattering for rapid observation of bacterial size changes. Biophys. J. 73, 500–506. Van Langendonck, N., Bottreau, E., Bailly, S., Tabouret, M., Marly, J., Pardon, P., and Verge, P. (1998). Tissue culture assays using Caco-2 cell line differentiate virulent from non-virulent Listeria monocytogenes strains. J. Appl. Microbiol. 85, 337–346.

44

Arun K. Bhunia

Varshney, M., Li, Y. B., Nanapanneni, R., Johnson, M. G., and Griffis, C. L. (2003). A chemiluminescence biosensor coupled with immunomagnetic separation for rapid detection of Salmonella typhimurium. J. Rapid Methods Automat. Microbiol. 11, 111–131. Vaughan, R. D., Carter, R. M., O’Sullivan, C. K., and Guilbault, G. G. (2003). A quartz crystal microbalance (QCM) sensor for the detection of Bacillus cereus. Anal. Lett. 36, 731–747. Vo-Dinh, T., Alarie, J. P., Isola, N., Landis, D., Wintenberg, A. L., and Ericson, M. N. (1999). DNA biochip using a phototransistor integrated circuit. Anal. Chem. 71, 358–363. Wadkins, R. M., Golden, J. P., and Ligler, F. S. (1997). A patterned planar array immunosensor for multianalyte detection. J. Biomed. Opt. 2, 74–79. Wang, H.-Y., Bhunia, A. K., and Lu, C. (2006). A microfluidic flow-through device for high throughput electrical lysis of bacterial cells based on continuous DC voltage. Biosens. Bioelectron. 22, 582–588. Warsinke, A., Benkert, A., and Scheller, F. W. (2000). Electrochemical immunoassays. Fresenius J. Anal. Chem. 366, 622–634. Westbrook, D. G., and Bhunia, A. K. (2000). Dithiothreitol enhances Listeria monocytogenes mediated cell cytotoxicity. Microbiol. Immunol. 44, 431–438. Wieckowska-Szakiel, M., Bubert, A., Rozalski, M., Krajewska, U., Rudnicka, W., and Rozalska, B. (2002). Colony-blot assay with anti-p60 antibodies as a method for quick identification of Listeria in food. Int. J. Food Microbiol. 72, 63–71. Wong, Y. Y., Ng, S. P., Ng, M. H., Si, S. H., Yao, S. Z., and Fung, Y. S. (2002). Immunosensor for the differentiation and detection of Salmonella species based on a quartz crystal microbalance. Biosens. Bioelectron. 17, 676–684. Wyatt, P. J. (1969). Identification of bacteria by differential light scattering. Nature 221, 1257–1258. Yang, L. J., Ruan, C. M., and Li, Y. B. (2003). Detection of viable Salmonella typhimurium by impedance measurement of electrode capacitance and medium resistance. Biosens. Bioelectron. 19, 495–502. Yang, L. J., Banada, P. P., Liu, Y. S., Bhunia, A. K., and Bashir, R. (2005). Conductivity and pH dual detection of growth profile of healthy and stressed Listeria monocytogenes. Biotechnol. Bioeng. 92, 685–694. Yang, L. J., Banada, P. P., Chatni, R., Lim, K. S., Bhunia, A. K., Ladisch, M., and Bashir, R. (2006). A multifunctional micro-fluidic system for dielectrophoretic concentration coupled with immunocapture of low numbers of Listeria monocytogenes. Lab Chip 6, 896–905. Ye, J., Liu, Y., and Li, Y. (2002). A chemiluminescence fiber-optic biosensor coupled with immunomagnetic separation for rapid detection of E. coli O157:H7. Trans. Am. Soc. Agric. Eng. 45, 473–478. Yu, H., and Bruno, J. (1996). Immunomagnetic-electrochemiluminescent detection of Escherichia coli O157 and Salmonella typhimurium in foods and environmental water samples. Appl. Environ. Microbiol. 62, 587–592. Zhao, J., Jedlicka, S. S., Lannu, J. D., Bhunia, A. K., and Rickus, J. L. (2006). Liposome-doped nanocomposites as artificial cell-based biosensors: Detection of listeriolysin O. Biotechnol. Prog. 22, 32–37. Zhou, C. H., Pivarnik, P., Auger, S., Rand, A., and Letcher, S. (1997). A compact fiber-optic immunosensor for Salmonella based on evanescent wave excitation. Sens. Actuators B Chem. 42, 169–175. Zhou, C., Pivarnik, P., Rand, A. G., and Letcher, S. V. (1998). Acoustic standing-wave enhancement of a fiber-optic Salmonella biosensor. Biosens. Bioelectron. 13, 495–500. Ziegler, C. (2000). Cell-based biosensors. Fresenius J. Anal. Chem. 366, 552–559. Ziegler, C., Harsch, A., and Gopel, W. (2000). Natural neural networks for quantitative sensing of neurochemicals: An artificial neural network analysis. Sens. Actuators B Chem. 65, 160–162.

CHAPTER

2 The Immunological Components of Human Milk Heather J. Hosea Blewett,* Michelle C. Cicalo,* Carol D. Holland,* and Catherine J. Field*

Contents

I. Introduction II. Effect of Breast-Feeding/Human Milk on Infectious Diseases and Defenses A. Evidence for benefits on infectious diseases B. Antimicrobial components in human breast milk (Table 2.2) III. Effect of Breast Milk on Immune Development A. Immune development in the infant B. Immune cells present in human milk C. Cytokines D. Hormones and bioactive peptides E. Nucleotides F. Long-chain polyunsaturated fatty acids (LCP) G. Other immune components H. Compounds that promote microbiological colonization of the infant’s colon IV. Tolerance A. Compounds found in breast milk that may be involved in the induction of tolerance B. Priming of the immune system V. Anti-Inflammatory Factors in Human Milk A. Cytokines B. Antioxidants

46 48 48 48 56 56 58 59 61 61 61 62 62 63 64 65 66 67 68

* Department of Agricultural, Food and Nutritional Sciences, Alberta Institute for Human Nutrition,

University of Alberta, Edmonton, Alberta, T6G 2P5, Canada Advances in Food and Nutrition Research, Volume 54 ISSN 1043-4526, DOI: 10.1016/S1043-4526(07)00002-2

#

2008 Elsevier Inc. All rights reserved.

45

46

Heather J. Hosea Blewett et al.

C. Anti-Proteases D. LCPUFAs VI. Conclusions References

Abstract

68 68 69 69

Breast-feeding is generally accepted as the optimal method of feeding infants. However, we have yet to fully understand the complex mixture of bioactive compounds contained in human milk. Epidemiological studies have indicated that breast-feeding is associated with health benefits in the infant for many immunerelated conditions. Breast milk contains various antimicrobial substances, factors that promote immune development, constituents that promote tolerance/priming of the infant immune system, as well as anti-inflammatory components. This chapter identifies and discusses the immunological compounds in human milk and the available evidence for their effect on the immune system of the infant. Current feeding regimens recommended for infants are based primarily on the current understanding of the nutritional requirements of the neonate, but perhaps will be modified to reflect the consequences on immune function both immediate and later in life.

I. INTRODUCTION In the nineteenth century, the first immunological molecules isolated from human milk were antibodies, giving rise to the notion that breast milk could have a positive influence on the infant’s immunity (Bernt and Walker, 1999). One of the earliest studies reporting an association between breast-feeding and a lower incidence of morbidity and mortality during the first year of life involved 20,000 healthy infants born in the Massachusetts General Hospital in 1932 (Grulee et al., 1935). Since that time, studies have consistently reported reduced disease incidence or severity, particularly infectious and gastrointestinal infections, in breastfed infants compared to those who were not breast-fed (Arifeen et al., 2001; Beaudry et al., 1995; Duffy et al., 1997; Duncan et al., 1993; Feachem and Koblinsky, 1984; Howie et al., 1990; Kramer et al., 2001; Morrow et al., 1999; Palti et al., 1984; Wilson et al., 1998; Yoon et al., 1996). The beneficial role of breast-feeding on immune function in infancy is well established and has contributed to the rationale for recommending exclusive breast-feeding (defined as the sole consumption of human milk, no other liquids or foods) from within an hour of birth (Morrow and Rangel, 2004) for the first 6 months of life for all healthy women and infants by associations such as the American Academy of Pediatrics,

Immune Compounds in Milk

47

Health Canada, and the World Health Organization (1997; Canadian Paediatric Society, Dietitians of Canada, & Health Canada, 2005; World Health Organization, 2001). Health organizations recommend that breastfeeding be continued while the infant consumes complementary foods during the first year of life as desired by mother and child (1997; Canadian Paediatric Society et al., 2005; World Health Organization, 2001). For a variety of reasons, including insufficient milk production, work/ school or travel demands, convenience or perception of breast-feeding, or drugs/illness of mom or baby, some mothers choose to feed breast milk substitutes alone or in combination with breast milk (Lewallen et al., 2006). Although there have been many modifications in the nutrient composition of infant formula aimed at improving immune function, such as fortifying with nucleotides (Hawkes et al., 2006) or long-chain polyunsaturated fatty acids (LCPUFAs) (Field et al., 2000), they have only begun to provide the immune benefits conferred by human milk. Human milk is a synergistic package of essential nutrients and bioactive components. Epidemiological studies have demonstrated that consumption is associated with health benefits for many immune-related conditions (Table 2.1). Breast milk contains the nutrients necessary to support the development of the infant’s immune system as well as other components that defend against infection. This includes various antimicrobial substances, factors that promote immune development, constituents that promote tolerance and the priming of the infant immune system, as well as anti-inflammatory components. The purpose of this chapter is to discuss the evidence for the immune benefits of human milk. TABLE 2.1 Breast-feeding reduces the risk of developing various immune-related conditions Condition

References

Necrotizing Enterocolitis Coeliac disease Type 1 diabetes Type 2 diabetes Obesity Atherosclerosis Breast cancer Hodgkin’s lymphoma Rheumatoid arthritis Eczema Allergy Respiratory tract Infection Asthma

Lucas and Cole, 1990 Akobeng et al., 2006 Malcova et al., 2006 Owen et al., 2006 Arenz et al., 2004 Martin and Abraham, 2005 Potischman and Troisi, 1999 Davis, 1998 Karlson et al., 2004 Kull et al., 2005 van Odijk et al., 2003 Chantry et al., 2006 Kull et al., 2004

48

Heather J. Hosea Blewett et al.

II. EFFECT OF BREAST-FEEDING/HUMAN MILK ON INFECTIOUS DISEASES AND DEFENSES A. Evidence for benefits on infectious diseases Young infants, in both developed (Brandtzaeg, 2003) and developing countries (Bernt and Walker, 1999), are at high risk for gastrointestinal infections (especially diarrhea). Diarrheal diseases are a leading cause of morbidity and mortality in developing countries (Bernt and Walker, 1999; Morrow and Rangel, 2004). It accounts for 22% of all deaths in children under 5 years (Morrow and Rangel, 2004; Morrow et al., 2005) and claims five million children per year or
500 deaths per hour (Brandtzaeg, 2003). The protective effect of breast milk on diarrheal disease has been described in many countries around the world (Ahiadeke et al., 2000; Arifeen et al., 2001; Clemens et al., 1999; Quigley et al., 2006; RuizPalacios et al., 1990; Scariati et al., 1997; Wang et al., 2005; Yoon et al., 1996). Breast-feeding is currently the most effective intervention for preventing morbidity and mortality caused by infectious disease in young children (Bernt and Walker, 1999; Kramer et al., 2003; Morrow et al., 2005; Newburg et al., 2004). The protective effect of breast-feeding is enhanced by longer duration and exclusivity of breast-feeding (Kramer et al., 2003). A WHO meta-analysis of 35 studies from 14 countries found an average four- to fivefold decrease in the incidence of diarrhea during the first 6 months of life among infants who were exclusively breast-fed compared with infants who were not breast-fed at all (Morrow and Rangel, 2004). Breast-feeding has been identified by public health agencies as a costeffective strategy for reducing the burden of childhood diarrheal disease worldwide (Morrow and Rangel, 2004).

B. Antimicrobial components in human breast milk (Table 2.2) 1. Immunoglobulins The intestinal mucosa is favored as portals of entry by most infectious agents and secretory IgA (sIgA) is the major immune defense in the intestine. Although the newborn infant produces very low quantities of immunoglobulins (Ig), breast milk is a rich source of sIgA with lesser amounts of sIgG and sIgM (Hanson and Korotkova, 2002; Koenig et al., 2005; Leon-Sicairos et al., 2006; Lonnerdal, 2003). The IgA in human milk is synthesized by resident B-cells in the mammary gland (Kolb, 2002) that have migrated from the mother’s intestine (Hanson and Korotkova, 2002). IgA is synthesized as a dimer and joining chain and, similar to IgA in the intestine, is linked to a secretory component and secreted into breast milk via the enteromammary pathway (Lonnerdal, 2003; Morrow and Rangel, 2004). This packaging makes it relatively resistant to proteolytic enzymes

Immune Compounds in Milk

TABLE 2.2

49

Compounds in milk with antimicrobial properties

Immunoglobulins Lysozyme Lactoperoxidase Nucleotide-hydrolyzing antibodies k-casein a-lactoglobulin Haptocorrin Mucins Lactadherin Anti-secretory lectins

Free secretory component Oligosaccharides Fatty acids Maternal leukocytes and cytokines sCD14 Complement and complement receptors b-defensin-1 Toll-like receptors Bifidus factor Prebiotics

in the infant’s gut (Lonnerdal, 2003; Morrow and Rangel, 2004) enabling the neonate to orally acquire this immune defense from their mothers. sIgA together with lactoferrin comprises
30% of protein in milk (Hanson et al., 2003a). The concentration of sIgA is reported to be highest in colostrum with the concentration decreasing during the first month to remain stable throughout lactation (Hanson and Korotkova, 2002; Morrow and Rangel, 2004). It has been estimated that an exclusively breast-fed infant ingests daily 0.5–1.0 g of sIgA (Hanson et al., 1994). (Table 2.2) sIgA provides microbial defense in three ways: preventing bacteria and viruses from attaching to mucosal surfaces (immune exclusion), neutralizing microbial toxins, and increasing virus excretion (Van de Perre, 2003). Through all of the above processes, sIgA would prevent both the establishment of bacterial colonies in the intestine and/or translocation across the mucosal barrier, thereby preventing an inflammatory response that would be both energy costly and damaging to the infant. More recently, it has been reported that specific sIgA can also limit the inflammatory effects initiated by other antibody reactions ( Jackson and Nazar, 2006), interfere with growth factors (e.g., iron) and enzymes necessary for pathogenic bacteria and parasites (Dickinson et al., 1998), and facilitate mucosal immunity by promoting antigen uptake by M-cells in the gut-associated lymphoid tissue (GALT) (Mantis et al., 2002). sIgA antibodies have been identified in breast milk against bacterial pathogens such as Escherichia coli (Manjarrez-Hernandez et al., 2000), Vibrio cholerae, Campylobacter, Shigella, Giardia lamblia, Haemophilus influenzae, and Clostridium difficile (Hanson and Korotkova, 2002; Lonnerdal, 2003; Manjarrez-Hernandez et al., 2000); against viruses such as Rotavirus, Cytomegalovirus, HIV, Influenza virus, respiratory syncytial virus, and pneumococcus (Filteau, 2003; Lonnerdal, 2003); and against yeasts such

50

Heather J. Hosea Blewett et al.

as Candida albicans (Filteau, 2003; Hanson et al., 2003a; Lonnerdal, 2003). sIgA against maternal microflora and dietary proteins have also been identified in human milk (Hanson et al., 2003a). Bacterial translocation of intestinal microflora in breast-fed infants is limited due to the presence of sIgA coating the bacteria (reviewed in Hanson and Yolken, 1999). This provides a potential mechanistic explanation for the reduced neonatal septicaemia associated with breast-feeding (Ashraf et al., 1991; Bhutta and Yusuf, 1997; Winberg and Wessner, 1971). It has been reported that IgG from the milk of healthy mothers has nucleotide-hydrolyzing activity that is not related to the activity of known enzymes (Semenov et al., 2004). Human milk appears to contain a mixture of antibodies, some hydrolyzing ATP/AMP and others hydrolyzing only AMP (Semenov et al., 2004). It has been suggested that these antibodies neutralize bacterial and viral DNA and RNA by forming complexes with them (Semenov et al., 2004). Although these antibodies may play a protective role in breast milk and enhance the passive immunity of neonates, more research is needed to fully determine their biological role (Semenov et al., 2004).

2. Lactoferrin and related peptides Lactoferrin is the major whey protein present in breast milk (Teraguchi et al., 1996) with many microbicidal properties (Leon-Sicairos et al., 2006). The concentration of lactoferrin in milk has been reported as 1 g/liter in mature milk and 7 g/liter in colostrum (Houghton et al., 1985). The concentration of lactoferrin in breast milk is controlled by the reproductive hormones prolactin and estrogen (Ward et al., 2005). Lactoferrin has been demonstrated to resist digestion in the infant gut as it has been recovered intact from the stool of breast-fed infants (Bernt and Walker, 1999). Lactoferrin acts mainly in an iron-free state (apo-lactoferrin) and its microbicidal activity is reported to increase in proportion to its concentration in milk (Leon-Sicairos et al., 2006). Lactoferrin is a well-established, iron-binding protein (Bernt and Walker, 1999; Lonnerdal, 2003) that can bind two ferric ions at a time, and it is believed that its ability to withhold iron from pathogens explains a great part of its antimicrobial ability (Bernt and Walker, 1999; Jackson and Nazar, 2006; Lonnerdal, 2003; Morrow and Rangel, 2004; Ward et al., 2005). The chelation of iron can also induce ‘‘twitching’’ by iron-requiring pathogens, which is a specific bacterial surface motility that prevents bacteria from forming biofilms (Singh et al., 2002). These biofilms are encased surface communities that are resistant to host defense mechanisms and antibiotics (Singh et al., 2002). The demonstration that the bacteriostatic activity of lactoferrin can be independent of the level of iron saturation (Arnold et al., 1980) suggests that lactoferrin has other antimicrobial mechanisms. Lactoferrin has been

Immune Compounds in Milk

51

reported to possess direct cytotoxic activity against bacteria, viruses, and fungi (Bernt and Walker, 1999; Gomez et al., 2003). Bovine lactoferrin was reported to protect against Rotavirus by preventing virus attachment to intestinal cells and inhibiting a postabsorption step, possibly through the withholding of calcium, which is necessary for the formation of new viral particles (Seganti et al., 2004). The glycans on lactoferrin have been demonstrated to also function as receptors for type 1 fimbrial lectin of E. coli (Teraguchi et al., 1996). It has been suggested that lactoferrin may only confer beneficial immune effects when consumed in the form of breast milk (Lonnerdal, 2003). When added to infant formula, lactoferrin may be affected by its prior bioactivity; how it was added (blended or dissolved); and extent of heat treatment of the formula (Lonnerdal, 2003). There is evidence that lactoferrin can be inactivated by invading pathogens or even enhance microbial pathogenicity. For example, the pneumococcal surface protein A of Streptococcus pneumoniae was reported to bind to lactoferrin and protect the bacteria from the killing action of lactoferrin (Ward et al., 2005). A portion of the bactericidal activity of lactoferrin appears to reside in its pepsin-breakdown products lactoferricin B and H (Clare et al., 2003; Kolb, 2002). Lactoferricin has antibacterial properties against a wide range of gram-positive and gram-negative bacteria such as Listeria, E. coli, Salmonella, and Campylobacter (Shah, 2000), without inhibiting the growth of bifidobacteria (Leon-Sicairos et al., 2006). Lactoferricin has been demonstrated to inhibit the attachment of bacteria (such as enteropathogenic E. coli) to intestinal cells (Zhang et al., 1999) and have cytotoxic activity against viruses (Plaut et al., 2000) and fungi (Andersson et al., 2000). Specifically, lactoferricin B has been shown to disrupt liposomes, causing leakage and fusion of vesicles and enabling the peptide to cross the membrane barrier and make contact with cytoplasmic targets (Ulvatne et al., 2001). This is supported by data from Haukland et al. (2001), who observed lactoferricin B in the cytoplasm of both Staphylococcus aureus and E. coli.

3. Lysozymes and other enzymes Lysozyme is a major part of the whey protein fraction of human milk (Lonnerdal, 2003) and is found in highest concentration in colostrum (Leon-Sicairos et al., 2006). Human milk contains
3000 times the concentration of lysozyme as bovine milk and is reported to be more stable (Clare et al., 2003). This protein is hypothesized to play a major role in immune defense of the infant (Hanson et al., 2003a), likely acting in concert with lactoferrin, sIgA, and other antimicrobial compounds (Leon-Sicairos et al., 2006). Lysozyme functions by hydrolyzing b-1,4 linkages of N-acetylmuramic acid and N-acetylglucosamine on the outer cell wall of gram-positive bacteria (Chipman and Sharon, 1969). It also

52

Heather J. Hosea Blewett et al.

appears to function, at least in vitro, in a synergistic manner with lactoferrin to kill gram-negative bacteria (Ellison III and Giehl, 1991). Lactoferrin removes lipopolysaccharide (LPS) from the outer cell membrane so that lysozyme can enter and degrade the inner proteoglycan matrix of the membrane (Ellison III and Giehl, 1991). Lysozyme is also reported to have antiviral activity (Lee-Huang et al., 1999). Human milk contains active lactoperoxidase. The concentration of lactoperoxidase in colostrum and milk is about 11  45 mg/ml and 13  30 mg/ml, respectively (Korhonen, 1977). Lactoperoxidase, in association with thiocyanate and hydrogen peroxide, has been shown to inhibit growth of Streptococcus cremoris 972 (Steele and Morrison, 1969). This data was supported by Bjorck et al. (1975), who demonstrated that the antibacterial properties of lactoperoxidase are closely connected to the oxidation of thiocyanate, both in vitro and in milk. Since thiocyanate is found in human saliva, lactoperoxidase may therefore be an effective defense against bacteria found in the mouth and upper gastrointestinal tract (Lonnerdal, 2003).

4. Oligosaccharides Oligosaccharides are a heterogeneous group of carbohydrates comprising the third most abundant constituent in milk (Dai et al., 2000; Morrow and Rangel, 2004; Newburg, 2000). Like most components of breast milk, they are found in high concentration in colostrum (
22 g/liter) and are less abundant (
12 g/liter) in mature milk (Erney et al., 2000). The types of oligosaccharide present in milk also change during lactation (Newburg, 2000) and the concentration tends to decrease within a feeding (Thurl et al., 1993). Many of these oligosaccharides occur in free form, while others are linked to glycoproteins [e.g., lactoferrin, k-casein, and sIgA (Kelleher and Lonnerdal, 2001)] or lactose (Newburg, 2000; Shah, 2000). Oligosaccharides are produced by an antigen-independent mechanism in epithelial cells in the mammary gland (Dai et al., 2000). The amount produced by these cells is determined in part by genetics (Newburg, 2000). Oligosaccharides have been shown in vitro to resist hydrolysis by gastrointestinal enzymes (Engfer et al., 2000), indicating that they would be present and remain intact in the small intestine. Due to homology of cell surface receptors for common environmental pathogens and microbes present on the mucosal epithelium, including E. coli, Campylobacter jejuni, and S. pneumoniae (Shah, 2000), it has been shown that that milkderived oligosaccharides can bind pathogens, preventing attachment and thereby protecting the infant from infection (Holmgren et al., 1983). Recently, Coppa et al. (2006) tested various fractions of oligosaccharides in vitro and showed that acidity and molecular weight of oligosaccharides appear to determine their efficacy against specific pathogens. Specifically, the action against Salmonella fyris was due to acid and neutral low-molecular

Immune Compounds in Milk

53

weight oligosaccharides, while V. cholerae was inhibited primarily by neutral high-molecular weight oligosaccharides (Coppa et al., 2006). Coppa et al. (2006) conclude that the protective effect of oligosaccharides stems from a joint action of various compounds that act on multiple different bonds. The prebiotic properties of oligosaccharides will be discussed in detail in a later section.

5. Fats and fatty acids The fat content of breast milk is 3–4 g/liter in colostrum, transitional, and mature milk, with 93–97% of the lipids in the form of triglycerides (reviewed by German and Dillard, 2006). In breast milk, the milk fat globule is comprised of a triglyceride core bound by a single layer of lipids and further surrounded by a bilayer membrane made up of lipids and proteins, including cholesterol, phosphatidylcholine, and sphingomyelin (German and Dillard, 2006). Milk fats, in addition to their nutritive and developmental benefits, have been demonstrated to provide antimicrobial activity in infant gut (German and Dillard, 2006). The lipid products of gastric and intestinal lipolysis (primarily medium-chain saturated, long-chain unsaturated fatty acids, and monoglycerides) have been demonstrated to have antiviral, antiprotozoan, and antibacterial properties (German and Dillard, 2006; Isaacs, 2001; Thormar et al., 1987; Welsh et al., 1978). Lauric acid has been described as one of the most antimicrobial fatty acids in milk (reviewed by Hamosh et al., 1999). Caprylic acid (eight carbons in chain length) has been demonstrated in vitro to reduce S. aureus and E. coli in milk (Nair et al., 2005) and the infectivity of Chlamydia trachomatis was reduced in vitro by incubation with lauric acid (12:0) and caprylic acid (10:0) (Bergsson et al., 1998). In contrast, the triglyceride and diglyceride fractions appear to not have antimicrobial activity (Welsh et al., 1978). Data from Isaacs et al. (1995) suggests that monoglycerides with a fatty acid chain of <12 carbons exhibit more antiviral activity than the same free fatty acid. Their data also suggests that medium-chain monoglycerides are more effective against viruses than monoglycerides containing a long-chain (>12 carbons in chain length) fatty acid (Isaacs et al., 1995). Others have identified monocaprylin as a potent antibacterial agent in vitro (Bergsson et al., 1998; Nair et al., 2005). The mechanism for the antimicrobial effects of fatty acids and monoglycerides has not been established but it has been suggested that free fatty acids damage bacteria by disrupting their cell membranes (Bergsson et al., 1998; Hamosh et al., 1999; Thormar et al., 1987) or by changing intracellular pH (Sun et al., 1998). Passive protection might also be provided by components in the milk fat globules (i.e., mucins), which could prevent attachment of pathogens in the infant’s stomach (reviewed by Filteau, 2000) and small intestine (Schroten et al., 1992).

54

Heather J. Hosea Blewett et al.

6. Components of the maternal innate and acquired immune system Active, as opposed to only passive, protection against microbial may also be provided by human milk. Theoretically, the leukocytes and cytokines in milk (discussed in detail in a later section) could directly contribute to the effective host defense in the infant’s intestine. In support of this, studies have demonstrated phagocytosis of bacteria by leukocytes from breast milk (Williamson and Murti, 1996). Mature milk is reported to contain a soluble form of CD14 (sCD14). sCD14 is a glycoprotein that is part of the LPS recognition complex that binds microbial and other bacterial wall components and is reported to be produced by mammary epithelial cells in concentrations 20-fold higher than serum (Labeta et al., 2000). Recent studies suggest that sCD14 could also act as a ‘‘sentinel’’ molecule in the microbial defense of the neonatal intestine (Vidal et al., 2001). Several complement components (C3 and C4), receptors (CF2, CD21), and activation fragments are found in human milk (reviewed in Ogundele, 2001). It has been suggested that these participate in immune bacteriolysis, neutralization of viruses, immune adherence, immunoconglutination, and enhance phagocytosis in the infant’s intestine (Brandtzaeg, 2003; Ogundele, 2001). Human b-defensin-1 (detected in breast milk in concentrations of
1–10 mg/ml) has been demonstrated to have antimicrobial activity against E. coli, but could also be involved in upregulating the adaptive immune system in the gut ( Jia et al., 2001). Tolllike receptors play a crucial ‘‘sensing’’ role in the early innate immune response to invading pathogens. Although the exact role of the soluble form of the toll-like receptor 2 (TLR2), recently reported in breast milk, is not known, it might be postulated to play a role in protection from microbial infection (LeBouder et al., 2003).

7. Other non-antibody protein defense agents in milk Many microorganisms express surface molecules (adhesions or lectins), which specifically recognize carbohydrate residues on the epithelial cells. Many of these compounds are believed to act like oligosaccharides by successfully competing with pathogens for the binding sites on the epithelial surfaces of the intestine (Gopal and Gill, 2000). The candidates include lactadherin (Kvistgaard et al., 2004), free secretatory component (de Araujo and Giugliano, 2001), mucins (Peterson et al., 1998; Schroten, 2001), and antisecretory lectins (Hanson, 1998). Lactadherin is a glycoprotein produced by mammary epithelial cells during lactation and associated with the milk fat globule membrane (Newburg et al., 1998). Its concentration in milk peaks at 0.139 mg/ml immediately postpartum and declines thereafter (reviewed by Kvistgaard et al., 2004). It has been reported to bind to human Rotavirus,

Immune Compounds in Milk

55

thus preventing viral attachment to host cell receptors (Kvistgaard et al., 2004) and its concentration has been inversely associated with Rotavirus symptoms in infected breast-fed infants (Newburg et al., 1998). Interestingly, bovine lactadherin was not found to possess antiviral properties (Kvistgaard et al., 2004). Free secretatory component is abundant in breast milk and may on its own block epithelial adhesion of, and thereby limit infection by enterotoxigenic E. coli (de Araujo and Giugliano, 2001), Salmonella typhimurium (Bessler et al., 2006), C. difficile toxin A (Dallas and Rolfe, 1998), and pneumococcus (Hammerschmidt et al., 1997). Additionally, several hydrolysis products of k-casein (specifically glycomacropeptide) isolated from milk have been demonstrated to possess broad antimicrobial activity against several gram-positive and gramnegative bacteria and yeast (reviewed by Kelleher and Lonnerdal, 2001; Liepke et al., 2001). Similarly, some of the polypeptide fractions of a-lactalbumin (LTD1 and LTD2, and LDC) have been demonstrated to have antimicrobial activity against E. coli, Klebsiella pneumoniae, S. aureus, Staphylococcus epidermis, Streptococci, and C. albicans (Pellegrini et al., 1999). Treatment of human milk with pepsin did not yield antibacterial peptides from a-lactalbumin (Pellegrini et al., 1999). The protein haptocorrin has been shown in vitro to resist digestion by proteolytic enzymes (Adkins and Lonnerdal, 2003). Haptocorrin has been reported to inhibit the growth of enteropathogenic E. coli, possibly by sequestering vitamin B12 that is required for microbial growth (Adkins and Lonnerdal, 2003).

8. Compounds that promote ‘‘healthy’’ intestinal microflora The microflora in the gut of infants affects their capacity to resist infection. It is now well documented that the colon of breast-fed infants contains fewer potentially pathogenic bacteria such as E. coli, Bacteroides, Campylobacter, and Streptococcus, and more beneficial bacteria such as Lactobacillus and Bifidobacterium, as compared to formula-fed infants (Kleessen et al., 1995). In addition to the antimicrobial components in human milk that inhibit the growth of pathogenic bacteria, there are bifidus factors (Kunz et al., 1999), prebiotics (Kunz et al., 1999), and compounds with prebiotic activity [i.e., proteins (Lonnerdal, 2003)] that nourish and stimulate the growth of beneficial bacteria. Bifidobacteria produce several acids, including acetic, lactic, and pyruvic (Shah, 2000). Their antimicrobial effects were traditionally thought to stem from their lowering of pH to a range unacceptable for bacterial growth; however, more recent studies have reported that bifidobacteria do not directly produce butyric acid but indirectly stimulate the production of butyric acid through promoting the growth of butyric acid-producing bacteria such as Roseburia spp. (Duncan et al., 2004).

56

Heather J. Hosea Blewett et al.

Bifidogenic peptides from lactoferrin including hLACFR-Ia, hLACFRIb, hLACFR-Ic, hLACFR-IIa, and hLACFR-IIb; hPIGR-Ia and hPIGR-Ib; and fragments of the polyimmunoglobulin receptor hPIGR have been isolated from human milk (Liepke et al., 2002). These peptides were demonstrated to promote the growth of several strains of bifidobacteria that usually colonize infants’ intestines and may be more effective than most currently known bifidogenic carbohydrates (Liepke et al., 2002). More specifically lactoferricin has been found to be structurally related to certain bifidogenic peptides and is hypothesized to participate in the colonizing newborn infants’ bacterial flora (Liepke et al., 2002). Several oligosaccharides (specifically galacto- and fructo-oligosaccharides) with prebiotic properties have been shown to promote colonization with bifidobacteria when added to infant formula (Boehm et al., 2004). By both providing a metabolic substrate for these bacteria and preventing the attachment of harmful bacteria, oligosaccharides promote growth of beneficial bacteria in the infant intestine (Dai et al., 2000; Morrow and Rangel, 2004; Morrow et al., 2005). Probifidogenic properties have also been found for N-acetyl-glucosamine in milk (reviewed in Kleessen et al., 1995). The secretatory component of IgA may also have some prebiotic properties (Liepke et al., 2002). It has also been hypothesized that the LCPUFAs in human milk facilitate the adhesion of probiotics to mucosal surface (Das, 2002). Studies have also identified a potential role for sCD14 during bacterial colonization of the gut (Labeta et al., 2000; Vidal et al., 2001).

III. EFFECT OF BREAST MILK ON IMMUNE DEVELOPMENT A. Immune development in the infant The neonatal period is particularly critical as the newborn is exposed to a large number of microorganisms, proteins, and chemicals that they have not previously encountered. Ultimately, resistance to infection relies on a balance between innate and adaptive (antigen driven) immunity. At birth, the cellular components of the immune system are in place, both mucosal and systemic antibody responses can be detected, and most infants can respond appropriately to immunization (Kelly and Coutts, 2000). However, the immune system of the infant is not the same as the adult, but whether one can define the immune system of the infant as ‘‘immature’’ or ‘‘immunosuppressed’’ in a strict definition is debatable. As little antigen exposure occurs in utero, the infant is born with an acquired immune system that is antigen naive [lower level expression of costimulatory molecules such as CD40L and require a greater stimuli for activation (Kelly and Coutts, 2000)]. The limitation of T-cells being able to mount the appropriate immune responses may also relate to deficiencies in antigen presentation by B- and other antigen presenting cells (Kelly and Coutts, 2000).

Immune Compounds in Milk

57

As a result of the lower responses by T- and B-cells, during the neonatal period, cells of the innate immune system, predominantly macrophages, neutrophils, and natural killer cells, become responsible for the clearance of foreign antigen. However, neonates have been reported to mount a less-efficient mononuclear phagocytic response to numerous pathogens (Marodi, 2006). When the T-cells respond, the neonate displays preferential T-helper 2 (Th2) type cytokine response which is antibody dominant as opposed to a cell-mediated cytokine-mediated T-helper 1 (Th1) response (Cummins and Thompson, 1997). This naivety and altered response by the adaptive arm of the immune system likely contributes to the lower immune competence in the infant (Hanson et al., 2003b). From an immunological standpoint, this naivety translates to the infant’s immune cells requiring ‘‘education’’ in the period immediately after birth. Postnatal maturation of the immune system is characterized by the development of a balanced Th1/Th2 response (Bjorksten, 1999). The infant’s intestinal immune system develops rapidly in the early postnatal period as it comes into contact with dietary and microbial antigens in the gut (Brandtzaeg, 2003; Rautava et al., 2002). In addition to eliminating infectious agents and minimizing the damage they cause, the infant’s immune system also has to process harmless antigens and has evolved intricate mechanisms to discriminate between antigens with the potential to cause damage and those without (tolerance). Induction of tolerance is believed to occur primarily in the gut and contributed to by unique features of GALT, including specialized B- and T-cells, the production of IgA, and the Th2 response (Mowat, 2003; Strobel, 2001). Failure to regulate tolerance and active immune responses (education of the immune system) can lead to diseases such as food-related allergy, autoimmunity, and inflammatory bowel disorders (Kelly and Coutts, 2000). Human milk contains its own immune system and a wide range of soluble and cellular factors (Table 2.3), which most recently have been demonstrated to produce long-term benefits to the infant by facilitating immune development and maturation (Field, 2005). TABLE 2.3 Compounds found in human milk that could influence immune development

Maternal immune cells Macrophages Neutrophils T-cells B-cells and their immunoglobulins Cytokines Nucleotides

Long-chain polyunsaturated fatty acids Other immune components Chemokines Other soluble factors Compounds that promote microbiological colonization of the infant’s colon Hormones and bioactive peptides

58

Heather J. Hosea Blewett et al.

B. Immune cells present in human milk Depending on the phase and stage of lactation, a variety of leukocytes are present in colostrum (
4  109/liter) and mature milk (
108–109/liter) (Goldman, 1993; Michie, 1998). Over the course of a single day, it is estimated that a breast-fed baby consumes on average 108 immune cells (Michie, 1998). Macrophages (55–60%) and neutrophils (30–40%) dominate over lymphocytes (5–10%) (Goldman, 1993). All of the aforementioned cell types are present in an activated phenotype when found in breast milk (Michie, 1998). It has been suggested that their presence in milk is due to transepithelial migration of leukocytes into mammary tissue that are stimulated by specific chemoattractants in the mammary gland (Michie et al., 1998). Viable leukocytes from milk have been isolated in feces from infants fed human milk (Michie, 1998); thus, it is possible that key surface molecules on these cells remain antigenically intact in the gut. From the following discussion, it can be concluded that the immune cells present in mother’s milk play a pivotal role in bridging the gap between birth and the child’s development of a fully functional immune system.

1. Macrophages The macrophages isolated from breast milk express activation markers (i.e., CD11c, Leu-M3, and Leu-M5) (Rivas et al., 1994) are phagocytic, and secrete immunoregulatory factors (reviewed by Field, 2005). Oral administration of macrophages to newborn mice survived for several hours in the gut and some were found to cross the mucosal barrier to reach peripheral lymphoid organs (Hughes et al., 1988). Freshly isolated macrophages from breast milk were recently reported to differentiate into dendritic cells after incubation with IL-4 (Ichikawa et al., 2003). These IL-4-stimulated macrophages were found to be efficient stimulators of T-cells, suggesting their potential role in mediating T-cell-dependent immune responses in the infant (Ichikawa et al., 2003).

2. Neutrophils Breast milk neutrophils are also present in an activated form, as evidenced by increased levels of CD11b/CD18 and lower expression of L-selectin (Goldman et al., 1998). However, these neutrophils may have a limited functional capacity once secreted into milk as they demonstrate lower adherence, polarity, and motility when in the activated state (Thorpe et al., 1986). Little is known about the impact of milk neutrophils on immune development in the infant, but most researchers suggest that the main role is maternal protection as they have limited functional capacity once they are secreted into milk.

Immune Compounds in Milk

59

3. T-Cells

The majority of lymphocytes in milk are T-cells (>80%; Wirt et al., 1992). Human milk contains both T-cells and the compounds responsible for activating them (Wirt et al., 1992). Breast milk T-cells differ both in relative abundance and in quality from those found in the peripheral blood compartment (Sabbaj et al., 2005). The higher proportion of TCRgdþCD8þ (expressing L-selectin, a4b7 integrin, mucosal addressin cell adhesion molecule-1) as compared to blood suggests that these cytotoxic T-cells (CD8þ) have selectively homed from the maternal mucosal immune system to the mammary gland (Sabbaj et al., 2005; Wirt et al., 1992). Breast milk CD4þ cells are also present in an activated state (expressing activation markers CD40L, sCD30, CD62L, CCR7, IL-2 receptor, human mucosa lymphocyte antigen-1, or late activation protein-1) and express CD45ROþ, a surface protein associated with immunological memory (Bertotto et al., 1997; Eglinton et al., 1994; Sabbaj et al., 2005). It has been hypothesized that activated T-cells from maternal origin might compensate for the immature function of neonatal T-cells and promote their maturation. Additionally, activated antigen mature lymphocytes might help compensate for the low antigen presenting capacity of macrophages. In animal models, milk-derived lymphocytes can traverse the neonatal intestine, suggesting that their influence extends beyond the intestine (Jain et al., 1989). Some recent studies have shown that immunophenotypic differences in systemic lymphocyte populations occur following exposure to maternal milk. These differences include a decrease in CD4þ:CD8þ cells, an increase in natural killer cells and an increase in IFNg production (Hawkes et al., 1999). The functional consequences of a report that breast-fed infants have a thymus twice the size of that of non-breast-fed infants (Hasselbalch et al., 1999) has yet to be explained but supports the role of human milk on T-cell development.

4. B-cells and immunoglobulins The B-cells account for less than 20% of all lymphocytes in breast milk (reviewed by Field, 2005). IgA, IgG, and IgM are all present in human breast milk (Koenig et al., 2005). Little is known about the potential role of milk B-cells on immune development in the infant but one might hypothesize that these cells could influence the infant’s immune system.

C. Cytokines Cytokines are multifunctional glycoproteins involved in cell communication and immune system activation (Ustundag et al., 2005). Human milk contains an array of cytokines, some in concentrations that could potentially influence immune function. This list includes IL-1b (Grosvenor et al., 1993b; Hawkes et al., 2002c; Ustundag et al., 2005), IL-2 (Bryan et al., 2006;

60

Heather J. Hosea Blewett et al.

Ustundag et al., 2005), IL-4 (Bottcher et al., 2000b, 2003), IL-5 (Bottcher et al., 2000b), IL-6 (Bottcher et al., 2000b; Hawkes et al., 2002; Ustundag et al., 2005), IL-8 (Bottcher et al., 2000a, 2003; Grosvenor et al., 1993; Michie et al., 1998; Ustundag et al., 2005), IL-10 (Bottcher et al., 2000b; Garofalo et al., 1995), IL-12 (Bryan et al., 1999), IL-13 (Bottcher et al., 2000b; Bryan et al., 1999), IL-16 (Bottcher et al., 2003), IL-18 (Takahata et al., 2001), TNF-a (Hawkes et al., 2002; Ustundag et al., 2005), TGF-b (Bottcher et al., 2000b; Hawkes et al., 2001), and IFNg (Bottcher et al., 2000b). The exact source of the cytokines present in the aqueous fraction of breast milk remains to be determined, though it is suspected that the primary source is cells present in the mammary gland (Bryan et al., 2006). However, leukocytes recovered from expressed human milk have been shown to be capable of producing a number of cytokines (Hawkes et al., 2002). The extent to which cytokines survive passage through the infant stomach is largely unknown, but recent work has suggested that some cytokines may be sequestered and protected until they reach the intestine (Calhoun et al., 1999). Although particular cytokines can be in high concentrations in some women’s breast milk, in general, the concentrations of cytokines vary widely, change through lactation, and are influenced by the mother’s health, making it difficult to assess their roles (individually or together) in the development of the infant’s immune system (Erbagci et al., 2005; Ustundag et al., 2005). The intake of cytokines, through human milk, has the potential to influence the maturation and development of immune cells in the infant. Neonates have a limited ability to produce many of the cytokines found in human milk (Field et al., 2001). For example, maternal cytokines (TGF-b, IL-6, and IL-10) in milk could contribute to the development and differentiation of IgA-producing cells (Bottcher et al., 2000b) and maturation of the naive intestinal immune system (Donnet-Hughes et al., 2000). For example, TGF-b is present in milk and has been proposed to stimulate appropriate maturation of naive infant intestinal immune system (Hanson et al., 2003b). Maternal cytokines (TGF-b, IL-6, and IL-10) in milk are believed to contribute to the development and differentiation of the infant’s IgA-producing cells (Bottcher et al., 2003; Kalliomaki et al., 1999; Mowat, 2003) and IL-6 is hypothesized to enhance the development of the infant’s mucosal immunity (Brandtzaeg, 2003). Additionally, the cytokines present in milk may assist both the transport of maternal leukocytes into milk (Ustundag et al., 2005) and across the infants gut epithelium (Michie, 1998). Unfortunately, most of the research on milk cytokine activities has been conducted in vitro and there are many factors in breast milk that could either facilitate or inhibit cytokine activities (i.e., adhesion molecules and soluble receptors and antagonist receptors for cytokines (reviewed by Filteau, 2001) that are not accounted for in these studies.

Immune Compounds in Milk

61

D. Hormones and bioactive peptides Many hormones, growth factors, and partially digested milk peptides have been detected in human milk, including cortisol, sex hormones (estrogen, progesterone, and derivatives), thyroid hormones (Buts, 1998), parathyroid hormone-related peptiden (Escande et al., 2001), adrenocorticotropic hormones, gastrointestinal regulatory peptides (gastrin, GIP, GRP, neurotensin, peptide YY, somatostatin, substance P, VIP, bombesin; Berseth et al., 1990), erythropoietin, gonadotropin, human-chorionic gonadotropin, insulin, leptin (Ilcol et al., 2006), adiponectin (Martin et al., 2006), hypothalamus-related hormones (GnRH, GHRH, GH, prolactin, TRH, TSH; Groer, 2005) (Buts, 1998), prolactin and procalcitonin, growth factors (EGF, IGF-1, IGF-II, NGF; Buts, 1998; Hirai et al., 2002) and their binding proteins, a-lactalbumin, b-lactoglobulin, and lactoferrin (LF) (reviewed by Aggett et al., 2003; Groer, 2005; Lonnerdal, 2003). Although little is known about the activity of these compounds on the naive immune system of an infant when delivered orally, one would suspect that they impact immune development in some synergistic manner.

E. Nucleotides Nucleotides are present in human milk and encompass
2–5% the nonproteinaceous nitrogen present in breast milk (Buts, 1998). Dietary nucleotides are reported to benefit the systemic immune system by promoting lymphocyte proliferation, NK activity, macrophage activation, and by producing a variety of other immunomodulatory factors (reviewed by Aggett et al., 2003; Buts, 1998). Feeding nucleotidesupplemented formula to full- and preterm infants improved responses to immunizations, promoted T-cell maturation, and reduced the risk of diarrheal disease (reviewed by Aggett et al., 2003). Although the mechanisms remain somewhat unclear, animal studies suggest that dietary nucleotides promote a Th1 response and modulate maturation and differentiation of T- and B-cells (Aggett et al., 2003). The immune benefits of nucleotides in milk are somewhat debatable as a recent study failed to demonstrate that nucleotide supplementation (5 mg/100 kcal) to formula fed infants had any clinical advantageous to immune development in healthy term infants (Hawkes et al., 2006).

F. Long-chain polyunsaturated fatty acids (LCP) It is well established that dietary (n-6) and (n-3) LCP modulate Th1 and Th2 immune cell responses generation in the adult (Calder and Grimble, 2002). Docosahexaenoic acid (DHA) and arachidonic acid (AA) constitute a relatively small fraction of the total fatty acids in human breast milk, but have recently been suggested to participate in immune development

62

Heather J. Hosea Blewett et al.

(Field et al., 2001). Adding the LCP AA and DHA to preterm formula resulted in lymphocyte populations and cytokines more similar to human milk-fed infants than to infants who received unsupplemented formula (Field et al., 2001).

G. Other immune components Human milk is also reported to contain chemokines and other soluble immune factors, including granulocyte-colony stimulating factor (Calhoun et al., 1999), monocyte-chemotactic protein 1 (Eglinton et al., 1994), sFas ligand (Takahata et al., 2001), and RANTES (Bottcher et al., 2000a, 2003; Michie et al., 1998). If any of these compounds were to come in contact with the infant’s naive immune system, they could impact immune development. For example, granulocyte-colony stimulating factor is important for the growth and differentiation of neutrophils (Bell, 2006). Monocyte-chemotactic protein 1 can act as chemoattractant for Th1 cells (Shiratsuchi et al., 2007), RANTES play a role in T-cell activation and differentiation (Takahata et al., 2001) and serve as a chemoattractant for basophils and eosinophils and induces chemotaxis (Bottcher et al., 2000b). Osteoprotegerin (OPG) is found in mammary gland epithelial cells and in human milk at concentrations that are up to 1000 times higher than that found in human serum (Vidal et al., 2004b). The gavage experiments of Vidal and colleagues in neonatal rats suggest that milk OPG survives gastrointestinal passage, crosses the intestinal epithelium, and can enter the pup’s circulation (Vidal et al., 2004a). OPG can bind to TNF-related apoptosis-inducing ligand (TRAIL) and induce caspase-dependent apoptosis of primarily Th1 cells (Vidal et al., 2004a), which is hypothesized to be important in regulating Th1/Th2 balance in the infant’s developing immune system (Vidal et al., 2004a). The concentration of sCD14 is 100–1000 times higher in breast milk than in serum (Snijders et al., 2006). sCD14 can act as an acute phase protein and may also regulate T-cell activation (Snijders et al., 2006). In vitro sCD14 is able to stimulate B-cell growth and differentiation (Filipp et al., 2001). The presence of sCD14 in breast milk may serve to activate B-cells of the neonatal innate immune system before the infant acquires a full T-cell repertoire to respond to immunocompromising situations (Filipp et al., 2001).

H. Compounds that promote microbiological colonization of the infant’s colon A major factor in the development of mucosal immunity in the infant is exposure to the microbial flora colonizing the gut (Brandtzaeg, 1996). Unlike pathogens which induce strong activation of immune defense

Immune Compounds in Milk

63

mechanisms, bacterial antigens from the indigenous microflora, enhanced by breast-feeding (see earlier section), have the potential to accelerate development of the infant’s own mucosal barrier function and alter maturation of the infants’ systemic immune system (Boehm et al., 2004; Filteau, 2000; Forchielli and Walker, 2005). This is illustrated in studies of germ-free animals, which after intestinal colonization rapidly expand their immune systems (reviewed by Hanson et al., 2003b). Bacterial colonization of the colon has also been reported to be essential in establishing a balance between Th1 and Th2 immune responses (Furrie, 2005). The mechanisms by which microbes influence the phenotype and function of lymphoid cells associated with the GALT are not known, but have been hypothesized to be complex and involve microbial antigen uptake and processing (Kelly and Coutts, 2000).

IV. TOLERANCE Infancy is a time where there is a fine balance between an antigen response that results in tolerance (suppression) and one that results in sensitization (priming). The direction of the response is influenced by the nature, dose, and frequency of exposure of the antigen, all of which can be influenced by the maternal diet, as well as the age, genetic polymorphisms, and immunological status of the infant (Mayer and Shao, 2004). Breast-feeding is thought to promote oral tolerance in the infant (van Odijk et al., 2003), and exclusive breast-feeding may even prevent or delay the onset of atopic illness such as allergies (Bernt and Walker, 1999). This phenomenon is particularly noticeable in infants with atopic heredity (i.e., infants whose parents suffer from atopic illness such as asthma or allergies) (van Odijk et al., 2003). The relationship between breast-feeding and allergic disease is reviewed in van Odijk et al. (2003). As much as 5–8% of the population in industrialized nations suffers from gastrointestinal allergies (Bernt and Walker, 1999). Food allergies may originate as a result of a failure to effectively develop tolerance (Korotkova et al., 2004). Dietary proteins that have been detected in breast milk include ovalbumin (egg), b-lactoglobulin (cow’s milk), gliadin (wheat), and Ara h1/Ara h2 (peanuts) (reviewed in Palmer and Makrides, 2006). Although it is well established that dietary antigens/ potential allergens are present in human milk, the consequences on the infant’s immune system are not clear. Animal studies have shown that tolerance to food proteins can be transferred to an offspring via maternal milk (Korotkova et al., 2004). The allergic response (high IgE production) in young rats has been suppressed by administering milk from immunized dams (Roberts and Turner, 1983). It is hypothesized that breast milk promotes tolerance to dietary and microflora via the immunosuppressive

64

Heather J. Hosea Blewett et al.

cytokines (i.e., IL-10 and TGF-b) and antigens present in breast milk (Brandtzaeg, 2003).

A. Compounds found in breast milk that may be involved in the induction of tolerance 1. TGF-b and IL-10 Tolerization is an active process that often involves the downregulation of the immune response through the secretion of the cytokines like TGF-b and IL-10 (Harbige and Fisher, 2001). TGF-b is present in human milk (Saito et al., 1993) and can be absorbed by the infant gut rapidly (Letterio et al., 1994). Radiolabeled TGF-b that was administered by gavage into the stomachs of 5-day-old mice is later found in various tissues including the lung, heart, liver, and kidney, suggesting that TGF-b may influence sites beyond the gut (Letterio et al., 1994). Low levels of TGF-b in breast milk have been related to an increased risk of atopic illness in infants, which supports the role of this cytokine in the development of tolerance (Laiho et al., 2003). Other dietary nutrients may influence the concentration of TGF-b in human milk as levels of TGF-b were reported to be positively correlated to PUFA content and negatively correlated to SFA content (Laiho et al., 2003). IL-10 is found in both the aqueous and lipid layer of human milk (Garofalo et al., 1995). There is some evidence that the IL-10 present in human milk is bioactive (Garofalo et al., 1995). Human milk inhibited the proliferation of human blood lymphocytes in vitro and this inhibition was lessened by adding antihuman IL-10 antibodies along with the milk (Garofalo et al., 1995). IL-10 plays a role in the synthesis of IgA (Dunstan et al., 2004), though the process of IgA synthesis is thought to be initiated by TGF-b (Ogawa et al., 2004). Consumption of human milk is thought to lead to greater IL-10 production in the infant (Dvorak et al., 2004). Whether greater IL-10 production by mucosal immune cells promotes oral tolerance remains to be determined.

2. N-6 and n-3 fatty acids In human breast milk, there are roughly 10 different LC-PUFA consistently detected, representing both the n-3 and the n-6 series and including AA and DHA (Koletzko et al., 2001). However, LA is the primary milk PUFA (Koletzko et al., 2001). Maternal intake of PUFA prior to (Koletzko et al., 2001) and during lactation is reflected in breast milk PUFA content (Hawkes et al., 2002). For example, DHA-rich tuna oil supplementation was found to increase the DHA content of breast milk (Hawkes et al., 2002). Membrane phospholipid fatty acid composition in infants is strongly influenced by maternal diet (Korotkova et al., 2004) and can alter the

Immune Compounds in Milk

65

function of the immune cells (Field et al., 2000). Hence, changes in the infant’s diet via changes in maternal diet could influence neonatal development of tolerance and sensitization (Korotkova et al., 2004). Low n-6/ n-3 ratios (due to a higher content of n-3) in breast milk have been related to a lower risk of atopic illness in the breast-fed infant (Hanson et al., 2003b). In particular, animal studies suggest that the essential fatty acid content of the maternal diet significantly affects the development of immunological tolerance to food antigens in the suckled offspring (Korotkova et al., 2004). Immunoregulatory benefits have been attributed to n-3 PUFA (reviewed in Palmer and Makrides, 2006). The magnitude of these benefits may be inversely proportional to the age of the individual (reviewed in Palmer and Makrides, 2006). In other words, dietary intervention during critical early stages of immune development (i.e., in uterus or via breast milk) before the establishment of allergic responses is thought to be most preferable (reviewed in Palmer and Makrides, 2006). Cohort studies have demonstrated lower levels of n-3 PUFA in the milk of mothers whose infants showed symptoms of atopic illness before the age of 18 months (reviewed in Palmer and Makrides, 2006). Preliminary data from studies on n-3 PUFA supplementation during the perinatal period appear promising (reviewed in Palmer and Makrides, 2006). However, the completion of current and planned n-3 LC-PUFA interventions will allow for solid conclusions to be drawn (reviewed in Palmer and Makrides, 2006).

B. Priming of the immune system A balance between tolerance and sensitization (priming) is necessary for the gut immune system to discriminate between harmless antigens and those associated with pathogenic and nonpathogenic microbes (Harbige and Fisher, 2001). Antigen exposure via mother’s milk has been shown to prime the immune response of the suckling pup against that antigen in rats (Strobel, 2001). Clinical trials have shown that breast-fed babies have enhanced specific antibody titer to some, but not all vaccines (Hanson et al., 2003b; Kelly and Coutts, 2000). The ability to transfer vaccinations from mother to infant via her milk is of great interest because it could eliminate potential problems associated with directly vaccinating the infant (Gust et al., 2004). One possible explanation for the ability to immunize infants with their mother’s milk has been attributed to the presence of anti-idiotypic antibodies in the breast milk (Hanson et al., 2003a). Anti-idiotypic antibodies are antibodies with specificity against other autologous (i.e., from the same individual) antibodies (reviewed in Field, 2005). Therefore, anti-idiotypic antibodies, if present in breast milk, could have the capability of priming the infant’s antibody response against the antigen the idiotype is directed to (Van de Perre, 2003).

66

Heather J. Hosea Blewett et al.

V. ANTI-INFLAMMATORY FACTORS IN HUMAN MILK Inflammation is a necessary part of the immune response that helps protect the infant from infection (reviewed by Calder, 2006). The inflammatory response traps pathogens and signals the arrival of immune cells to destroy the antigen. However, this process results in a great deal of ‘‘collateral’’ damage of healthy tissue if it is not controlled. Gastrointestinal infections like necrotizing enterocolitis or those caused by Rotavirus can result in severe damage to intestinal tissue due to an over active inflammatory response. A decreased risk of developing necrotizing enterocolitis in preterm breast-fed infants compared to preterm formula fed infants was reported in a prospective multicenter study of 926 preterm infants (Lucas and Cole, 1990). A study by the Department of Pediatrics at the University of Turin found that breast-fed infants were less likely to contract or suffer complications due to Rotavirus infection compared to their formula-fed counterparts (Gianino et al., 2002). These studies indicate that breast milk protects the infant from infection, which could be due in part to anti-inflammatory components in the human milk ensuring an appropriate and effective immune response of the infant. There have been very few experimental studies on the antiinflammatory properties of human milk. Neutrophils are the main immune cells involved in the inflammatory process and in vitro studies have shown that human milk can limit the oxidative injury produced by them (reduced cytochrome c and consumed H2O2) (Grazioso and Buescher, 1996). Human milk also lowered the enzymatic activity of neutrophils (both myeloperoxidase and b-glucuronidase) (Grazioso and Buescher, 1996). Using an animal model of inflammation to test the antiinflammatory activity of human milk in vivo, researchers found that injecting colostrum along with carrageenan into subcutaneous air sacs in rats resulted in a suppressed inflammatory response compared to injecting carrageenan alone (Murphey and Buescher, 1993). Another group of researchers induced colitis in rats with an acetic acid enema to test the anti-inflammatory properties of a human milk diet. The rats that were fed a human milk diet had lower colonic myeloperoxidase activity (indicating less neutrophil infiltration) compared to rats fed chow or an infant formula-based diet (Grazioso et al., 1997). The explanation for the prophylactic nature of human milk is not currently known. However, some components of human milk have potential anti-inflammatory effects; these include cytokines (as well as their receptors and antagonists), antioxidants, antiproteases, and fatty acids (Garofalo and Goldman, 1999). The literature pertaining to the anti-inflammatory properties of these compounds in human milk will be discussed in the following sections.

Immune Compounds in Milk

67

A. Cytokines 1. IL-10 IL-10 inhibits the production of pro-inflammatory cytokines, providing the necessary balance to ensure that the inflammatory response is limited to destroying the pathogen and not healthy tissue. In vivo evidence of the necessity of IL-10 as an anti-inflammatory cytokine is provided by genetically altered mice that are not able to produce IL-10. These mice mount an immune response to the normal microflora in their gut, but without the IL-10 to suppress the inflammation, they develop enterocolitis (similar to ulcerative colitis and celiac disease in humans) (Sydora et al., 2003). This suggests that IL-10 in human milk might help regulate aberrant immune responses in the infant.

2. TGF-b The anti-inflammatory properties of TGF-b are reviewed by DonnetHughes et al. (2000), but briefly TGF-b inhibits the production of inflammatory cytokines and promotes the healing of intestinal cells damaged by injury or infection. A feeding trial examining the effectiveness of a polymeric diet (supplemented with TGF-b) in the management of pediatric crohn’s disease provides the most convincing in vivo evidence of the anti-inflammatory properties of TGF-b (Fell et al., 2000). The enteral diet containing high levels of TGF-b resulted in decreased mucosal IL-1 mRNA (pro-inflammatory cytokine) and clinical remission of in 79% of the children (Fell et al., 2000).

3. IL-1 receptor antagonist The IL-1 receptor antagonist (IL-1ra) is present in human milk. IL-1ra limits inflammation by competing with IL-1 (pro-inflammatory cytokine) for receptor binding (Dinarello, 1995). The reduced inflammatory response in rats with colitis fed human milk compared to chow or formula was similar to the inflammatory response in rats fed infant formula supplemented with IL-1ra (Grazioso et al., 1997). These results suggest that the IL-1ra content of human milk contributes to its anti-inflammatory properties.

4. Other compounds with potential to regulate inflammation Soluble TNF-a receptors bind to TNF-a (a pro-inflammatory cytokine), limiting its activity (Buescher and Williams-Koeppen, 1998). Plateletactivating factor acetylhydrolase (PAF-AH) degrades PAF, thereby limiting the gastrointestinal mucosal injury caused by PAF (Furukawa et al., 1993).

68

Heather J. Hosea Blewett et al.

B. Antioxidants Free radicals, or reactive oxygen species, are produced during the normal metabolic activity of cells (Sharda, 2006). These free radicals can damage cells by lipid peroxidation and alteration of protein and/or nucleic acid structures leading to oxidative stress (Sharda, 2006). Antioxidants in both milk and formula prevent significant lipid oxidation, breast milk suppresses oxidative DNA damage better than formula does; however, expressed milk is more sensitive to degradation than formula (Turoli et al., 2004). We have yet to identify all of the compounds in human milk that have antioxidant properties; however, there are several antioxidants in human milk that can scavenge free radicals and thereby limit the damage caused by oxidative stress. These compounds include a-tocopherol (Romeu-Nadal et al., 2006), b-carotene (Sakurai et al., 2005), cysteine (Darragh and Moughan, 1998), ascorbic acid (Sakurai et al., 2005), catalase (Friel et al., 2002), and glutathione peroxidase (Friel et al., 2002). The ability of human milk to resist oxidative stress is greater than formula (Friel et al., 2002). In vitro studies have shown that human milk degrades the naturally occurring hydrogen peroxide as well as that produced by neutrophils. This is possibly due to the catalase content of human milk (Grazioso and Buescher, 1996). Lactoferrin has been shown to inhibit the production of proinflammatory cytokines (IL-6 and TNF-a) as well as inflammatory mediators (nitric oxide, granulocyte-macrophage colony stimulating factor; reviewed by Hanson et al., 2003a; Lonnerdal, 2003). The anti-inflammatory activity of lactoferrin is generally attributed to its ability to search out free iron, which is a potent oxidizer.

C. Anti-Proteases Inflammatory cells produce proteases, which allow the cells to enter the affected area. Some pathogens also produce proteases in order to enter the body. Human milk contains active protease inhibitors (e.g., a-1antitrypsin, a-1-antichymotrypsin, and elastase inhibitor) that can limit the ability of pathogens to gain entry into the body and limit the inflammation caused by the inflammatory response (Lindberg et al., 1982).

D. LCPUFAs The effects of LCPUFAs in inflammation have been reviewed by Calder (2006). Briefly, it is hypothesized that the effects of LCPUFA n-3 fatty acids on immune function are mediated by their ability to compete with the metabolism of the n-6 fatty AA. AA can be metabolized into the pro-inflammatory prostaglandin-E2 (PGE2) or leukotriene-B4 (LTB4).

Immune Compounds in Milk

69

Prostaglandin E2 is one of the most important prostaglandins formed as it initiates the typical sensations associated with inflammation: pain, fever, and swelling (Wahle et al., 2004). The metabolism of AA to yield PGE2 and LTB4 can be inhibited by DHA, thereby decreasing the capacity of immune cells to synthesize eicosanoids from AA. DHA will then give rise to PGE3 and LTB5, which are considered less biologically potent than the eicosanoids derived from AA. However, their activities have not yet been fully investigated.

VI. CONCLUSIONS Human milk is a complex mixture of interacting compounds, of which the composition differs not only between women but also within the lactation period. Although it is well documented that breast milk provides antimicrobial defense to the infant, research is still in its infancy in our understanding of the importance of the many minor components in this complex nutritional supplement on neonatal immune development, tolerance, and prevention of the inflammatory response. These gaps in our knowledge will be a fruitful area of research for nutritionists for many years. Current feeding regimens recommended for infants are based primarily on the current understanding of the nutritional requirements of the neonate, but perhaps will be modified to reflect the consequences on immune function both immediate and later in life.

REFERENCES Adkins, Y., and Lonnerdal, B. (2003). Potential host-defense role of a human milk vitamin B-12-binding protein, haptocorrin, in the gastrointestinal tract of breastfed infants, as assessed with porcine haptocorrin in vitro. Am. J. Clin. Nutr. 77, 1234–1240. Aggett, P., Leach, J. L., Rueda, R., and MacLean, J. (2003). Innovation in infant formula development: A reassessment of ribonucleotides in 2002. Nutrition 19, 375–384. Ahiadeke, C., Gurak, D. T., and Schwager, S. J. (2000). Breastfeeding behavior and infant survival with emphasis on reverse causation bias: Some evidence from Nigeria. Soc. Biol. 47, 94–113. Akobeng, A. K., Ramanan, A. V., Buchan, I., and Heller, R. F. (2006). Effect of breast feeding on risk of coeliac disease: A systematic review and meta-analysis of observational studies. Arch. Dis. Child. 91, 39–43. American Academy of Pediatrics. Work Group on Breastfeeding (1997). Breastfeeding and the use of human milk. Pediatrics 100, 1035–1039. Andersson, Y., Lindquist, S., Lagerqvist, C., and Hernell, O. (2004). Lactoferrin is responsible for the fungistatic effect of human milk. Early Hum. Dev. 59, 95–105. Arenz, S., Ru¨ckerl, R., Koletzko, B., and von Kries, R. (2004). Breast-feeding and childhood obesity—a systematic review. Int. J. Obes. Relat. Metab. Disord. 28, 1247–1256. Arifeen, S., Black, R. E., Antelman, G., Baqui, A., Caulfield, L., and Becker, S. (2001). Exclusive breastfeeding reduces acute respiratory infection and diarrhea deaths among infants in Dhaka slums. Pediatrics 108, E67.

70

Heather J. Hosea Blewett et al.

Arnold, R. R., Brewer, M., and Gauthier, J. J. (1980). Bactericidal activity of human lactoferrin: Sensitivity of a variety of microorganisms. Infect. Immun. 28, 893–898. Ashraf, R. N., Jalil, F., Zaman, S., Karlberg, J., Khan, S. R., Lindblad, B. S., and Hanson, L. A. (1991). Breast feeding and protection against neonatal sepsis in a high risk population. Arch. Dis. Child 66, 488–490. Beaudry, M., Dufour, R., and Marcoux, S. (1995). Relation between infant feeding and infections during the first six months of life. J. Pediatr. 126, 191–197. Bell, S. G. (2006). Immunomodulation, part II: Granulocyte colony-stimulating factors. Neonatal Netw. 25, 65–70. Bergsson, G., Arnfinnsson, J., Karlsson, S. M., Steingrimsson, O., and Thormar, H. (1998). In vitro inactivation of Chlamydia trachomatis by fatty acids and monoglycerides. Antimicrob. Agents Chemother. 42, 2290–2294. Bernt, K. M., and Walker, W. A. (1999). Human milk as a carrier of biochemical messages. Acta Paediatr. Suppl. 88, 27–41. Berseth, C. L., Michener, S. R., Nordyke, C. K., and Go, V. L. (1990). Postpartum changes in pattern of gastrointestinal regulatory peptides in human milk. Am. J. Clin. Nutr. 51, 985–990. Bertotto, A., Vagliasindi, C., Gerli, R., Spinozzi, F., Castellucci, G., Fabietti, G., Crupi, S., Radicioni, M., Cozzali, R., Ferraro, L., Niccoli, A., De Rosa, O., et al. (1997). Soluble CD30 antigen in human colostrum. Biol. Neonate 71, 69–74. Bessler, H. C., de Oliveira, I. R., and Giugliano, L. G. (2006). Human milk glycoproteins inhibit the adherence of Salmonella typhimurium to HeLa cells. Microbiol. Immunol. 50, 877–882. Bhutta, Z. A., and Yusuf, K. (1997). Early-onset neonatal sepsis in Pakistan: A case control study of risk factors in a birth cohort. Am. J. Perinatol. 14, 577–581. Bjorck, L., Rosen, C., Marshall, V., and Reiter, B. (1975). Antibacterial activity of the lactoperoxidase system in milk against pseudomonads and other gram-negative bacteria. Appl. Microbiol. 30, 199–204. Bjorksten, B. (1999). The intrauterine and postnatal environments. J. Allergy Clin. Immunol. 104, 1119–1127. Boehm, G., Jelinek, J., Stahl, B., van Laere, K., Knol, J., Fanaro, S., Moro, G., and Vigi, V. (2004). Prebiotics in infant formulas. J. Clin. Gastroenterol. 38, S76–S79. Bottcher, M. F., Jenmalm, M. C., Bjorksten, B., and Garofalo, R. P. (2000a). Chemoattractant factors in breast milk from allergic and nonallergic mothers. Pediatr. Res. 47, 592–597. Bottcher, M. F., Jenmalm, M. C., Garofalo, R. P., and Bjorksten, B. (2000b). Cytokines in breast milk from allergic and nonallergic mothers. Pediatr. Res. 47, 157–162. Bottcher, M. F., Fredriksson, J., Hellquist, A., and Jenmalm, M. C. (2003). Effects of breast milk from allergic and non-allergic mothers on mitogen- and allergen-induced cytokine production. Pediatr. Allergy Immunol. 14, 27–34. Brandtzaeg, P. (1996). The human intestinal immune system: Basic cellular and humoral mechanisms. Baillieres Clin. Rheumatol. 10, 1–24. Brandtzaeg, P. (2003). Mucosal immunity: Integration between mother and the breast-fed infant. Vaccine 21, 3382–3388. Bryan, D. L., Hawkes, J. S., and Gibson, R. A. (1999). Interleukin-12 in human milk. Pediatr. Res. 45, 858–859. Bryan, D. L., Forsyth, K. D., Gibson, R. A., and Hawkes, J. S. (2006). Interleukin-2 in human milk: A potential modulator of lymphocyte development in the breastfed infant. Cytokine 33, 289–293. Buescher, E. S., and Williams-Koeppen, P. (1998). Soluble tumor necrosis factor-alpha (TNF-alpha) receptors in human colostrum and milk bind to TNF-alpha and neutralize TNF-alpha bioactivity. Pediatr. Res. 44, 37–42. Buts, J. P. (1998). Bioactive factors in milk. Arch. Pediatr. 5, 298–306.

Immune Compounds in Milk

71

Calder, P. C. (2006). Polyunsaturated fatty acids and inflammation. Prostaglandins Leukot. Essent. Fatty Acids 75, 197–202. Calder, P. C., and Grimble, R. F. (2002). Polyunsaturated fatty acids, inflammation and immunity. Eur. J. Clin. Nutr. 56(Suppl. 3), S14–S19. Calhoun, D. A., Lunoe, M., Du, Y., Staba, S. L., and Christensen, R. D. (1999). Concentrations of granulocyte colony-stimulating factor in human milk after in vitro simulations of digestion. Pediatr. Res. 46, 767–771. Canadian Paediatric Society, Dietitians of Canada, and Health Canada. (2005). Nutrition for healthy term infants. Ottawa, Minister of Public Works and Government Services. Chantry, C. J., Howard, C. R., and Auinger, P. (2006). Full breastfeeding duration and associated decrease in respiratory tract infection in US children. Pediatrics 117, 425–432. Chipman, D. M., and Sharon, N. (1969). Mechanism of lysozyme action. Science 165, 454–465. Clare, D. A., Catignani, G. L., and Swaisgood, H. E. (2003). Biodefense properties of milk: The role of antimicrobial proteins and peptides. Curr. Pharm. Des. 9, 1239–1255. Clemens, J., Elyazeed, R. A., Rao, M., Savarino, S., Morsy, B. Z., Kim, Y., Wierzba, T., Naficy, A., and Lee, Y. J. (1999). Early initiation of breastfeeding and the risk of infant diarrhea in rural Egypt. Pediatrics 104, e3. Coppa, G. V., Zampini, L., Galeazzi, T., Facinelli, B., Ferrante, L., Capretti, R., and Orazio, G. (2006). Human milk oligosaccharides inhibit the adhesion to Caco-2 cells of diarrhealpathogens: Escherichia coli, Vibrio cholerae, and Salmonella fyris. Pediatr. Res. 59, 377–382. Cummins, A. G., and Thompson, F. M. (1997). Postnatal changes in mucosal immune response: A physiological perspective of breast feeding and weaning. Immunol. Cell Biol. 75, 419–429. Dai, D., Nanthkumar, N. N., Newburg, D. S., and Walker, W. A. (2000). Role of oligosaccharides and glycoconjugates in intestinal host defense. J. Pediatr. Gastroenterol. Nutr. 30 (Suppl. 2), S23–S33. Dallas, S. D., and Rolfe, R. D. (1998). Binding of Clostridium difficile toxin A to human milk secretory component. J. Med. Microbiol. 47, 879–888. Darragh, A. J., and Moughan, P. J. (1998). The amino acid composition of human milk corrected for amino acid digestibility. Br. J. Nutr. 80, 25–34. Das, U. N. (2002). Essential fatty acids as possible enhancers of the beneficial actions of probiotics. Nutrition 18, 786. Davis, M. K. (1998). Review of the evidence for an association between infant feeding and childhood cancer. Int. J. Cancer. Suppl., 11, 29–33. de Araujo, A. N., and Giugliano, L. G. (2001). Lactoferrin and free secretory component of human milk inhibit the adhesion of enteropathogenic Escherichia coli to HeLa cells. BMC Microbiol. 1, 25. Dickinson, E. C., Gorga, J. C., Garrett, M., Tuncer, R., Boyle, P., Watkins, S. C., Alber, S. M., Parizhskaya, M., Trucco, M., Rowe, M. I., and Ford, H. R. (1998). Immunoglobulin A supplementation abrogates bacterial translocation and preserves the architecture of the intestinal epithelium. Surgery 124, 284–290. Dinarello, C. A. (1995). Interleukin-1 and interleukin-1 receptor antagonist. Nutrition 11, 492–494. Donnet-Hughes, A., Duc, N., Serrant, P., Vidal, K., and Schiffrin, E. J. (2000). Bioactive molecules in milk and their role in health and disease: The role of transforming growth factor-beta. Immunol. Cell Biol. 78, 74–79. Duffy, L. C., Faden, H., Wasielewski, R., Wolf, J., and Krystofik, D. (1997). Exclusive breastfeeding protects against bacterial colonization and day care exposure to otitis media. Pediatrics 100, E7. Duncan, B., Ey, J., Holberg, C. J., Wright, A. L., Martinez, F. D., and Taussig, L. M. (1993). Exclusive breast-feeding for at least 4 months protects against otitis media. Pediatrics 91, 867–872.

72

Heather J. Hosea Blewett et al.

Duncan, S. H., Louis, P., and Flint, H. J. (2004). Lactate-utilizing bacteria, isolated from human feces, that produce butyrate as a major fermentation product. Appl. Environ. Microbiol. 70, 5810–5817. Dunstan, J. A., Roper, J., Mitoulas, L., Hartmann, P. E., Simmer, K., and Prescott, S. L. (2004). The effect of supplementation with fish oil during pregnancy on breast milk immunoglobulin A, soluble CD14, cytokine levels and fatty acid composition. Clin. Exp. Allergy 34, 1237–1242. Dvorak, B., Fituch, C. C., Williams, C. S., Hurst, N. M., and Schanler, R. J. (2004). Concentrations of epidermal growth factor and transforming growth factor-alpha in preterm milk. Adv. Exp. Med. Biol. 554, 407–409. Eglinton, B. A., Roberton, D. M., and Cummins, A. G. (1994). Phenotype of T cells, their soluble receptor levels, and cytokine profile of human breast milk. Immunol. Cell Biol. 72, 306–313. Ellison, R. T., III, and Giehl, T. J. (1991). Killing of gram-negative bacteria by lactoferrin and lysozyme. J. Clin. Invest. 88, 1080–1091. Engfer, M. B., Stahl, B., Finke, B., Sawatzki, G., and Daniel, H. (2000). Human milk oligosaccharides are resistant to enzymatic hydrolysis in the upper gastrointestinal tract. Am. J. Clin. Nutr. 71, 1589–1596. Erbagci, A. B., Cekmen, M. B., Balat, O., Balat, A., Aksoy, F., and Tarakcioglu, M. (2005). Persistency of high proinflammatory cytokine levels from colostrum to mature milk in preeclampsia. Clin. Biochem. 38, 712–716. Erney, R. M., Malone, W. T., Skelding, M. B., Marcon, A. A., Kleman-Leyer, K. M., O’Ryan, M. L., Ruiz-Palacios, G., Hilty, M. D., Pickering, L. K., and Prieto, P. A. (2000). Variability of human milk neutral oligosaccharides in a diverse population. J. Pediatr. Gastroenterol. Nutr. 30, 181–192. Escande, B., Lindner, V., Massfelder, T., Helwig, J. J., and Simeoni, U. (2001). Developmental aspects of parathyroid hormone-related protein biology. Semin. Perinatol. 25, 76–84. Feachem, R. G., and Koblinsky, M. A. (1984). Interventions for the control of diarrhoeal diseases among young children: Promotion of breast-feeding. Bull. World Health Organ. 62, 271–291. Fell, J. M., Paintin, M., Arnaud-Battandier, F., Beattie, R. M., Hollis, A., Kitching, P., DonnetHughes, A., MacDonald, T. T., and Walker-Smith, J. A. (2000). Mucosal healing and a fall in mucosal pro-inflammatory cytokine mRNA induced by a specific oral polymeric diet in paediatric Crohn’s disease. Aliment. Pharmacol. Ther. 14, 281–289. Field, C. J. (2005). The immunological components of human milk and their effect on immune development in infants. J. Nutr. 135, 1–4. Field, C. J., Thomson, C. A., Van Aerde, J. E., Parrott, A., Euler, A., Lien, E., and Clandinin, M. T. (2000). Lower proportion of CD45R0þ cells and deficient interleukin10 production by formula-fed infants, compared with human-fed, is corrected with supplementation of long-chain polyunsaturated fatty acids. J. Pediatr. Gastroenterol. Nutr. 31, 291–299. Field, C. J., Clandinin, M. T., and Van Aerde, J. E. (2001). Polyunsaturated fatty acids and T-cell function: Implications for the neonate. Lipids 36, 1025–1032. Filipp, D., Alzadeh-Khiavi, K., Richardson, C., Palma, A., Paredes, N., Takeuchi, O., Akira, S., and Julius, M. (2001). Soluble CD14 enriched in colostrum and milk induces B cell growth and differentiation. Proc. Natl. Acad. Sci. USA 98, 603–608. Filteau, S. M. (2000). Role of breast-feeding in managing malnutrition and infectious disease. Proc. Nutr. Soc. 59, 565–572. Filteau, S. M. (2001). Milk components with immunomodulatory potential. Adv. Nutr. Res. 10, 327–350. Filteau, S. (2003). The influence of mastitis on antibody transfer to infants through breast milk. Vaccine 21, 3377–3381.

Immune Compounds in Milk

73

Forchielli, M. L., and Walker, W. A. (2005). The role of gut-associated lymphoid tissues and mucosal defence. Br. J. Nutr. 93(Suppl. 1), S41–S48. Friel, J. K., Martin, S. M., Langdon, M., Herzberg, G. R., and Buettner, G. R. (2002). Milk from mothers of both premature and full-term infants provides better antioxidant protection than does infant formula. Pediatr. Res. 51, 612–618. Furrie, E. (2005). Probiotics and allergy. Proc. Nutr. Soc. 64, 465–469. Furukawa, M., Narahara, H., Yasuda, K., and Johnston, J. M. (1993). Presence of plateletactivating factor-acetylhydrolase in milk. J. Lipid Res. 34, 1603–1609. Garofalo, R. P., and Goldman, A. S. (1999). Expression of functional immunomodulatory and anti-inflammatory factors in human milk. Clin. Perinatol. 26, 361–377. Garofalo, R., Chheda, S., Mei, F., Palkowetz, K. H., Rudloff, H. E., Schmalstieg, F. C., Rassin, D. K., and Goldman, A. S. (1995). Interleukin-10 in human milk. Pediatr. Res. 37, 444–449. German, J. B., and Dillard, C. J. (2006). Composition, structure and absorption of milk lipids: A source of energy, fat-soluble nutrients and bioactive molecules. Crit. Rev. Food Sci. Nutr. 46, 57–92. Gianino, P., Mastretta, E., Longo, P., Laccisaglia, A., Sartore, M., Russo, R., and Mazzaccara, A. (2002). Incidence of nosocomial rotavirus infections, symptomatic and asymptomatic, in breast-fed and non-breast-fed infants. J. Hosp. Infect. 50, 13–17. Goldman, A. S. (1993). The immune system of human milk: Antimicrobial, antiinflammatory and immunomodulating properties. Pediatr. Infect. Dis. J. 12, 664–671. Goldman, A. S., Chheda, S., and Garofalo, R. (1998). Evolution of immunologic functions of the mammary gland and the postnatal development of immunity. Pediatr. Res. 43, 155–162. Gomez, H. F., Ochoa, T. J., Carlin, L. G., and Cleary, T. G. (2003). Human lactoferrin impairs virulence of Shigella flexneri. J. Infect. Dis. 187, 87–95. Gopal, P. K., and Gill, H. S. (2000). Oligosaccharides and glycoconjugates in bovine milk and colostrum. Br. J. Nutr. 84(Suppl. 1), S69–S74. Grazioso, C. F., and Buescher, E. S. (1996). Inhibition of neutrophil function by human milk. Cell Immunol. 168, 125–132. Grazioso, C. F., Werner, A. L., Alling, D. W., Bishop, P. R., and Buescher, E. S. (1997). Antiinflammatory effects of human milk on chemically induced colitis in rats. Pediatr. Res. 42, 639–643. Groer, M. W. (2005). Differences between exclusive breastfeeders, formula-feeders, and controls: A study of stress, mood, and endocrine variables. Biol. Res. Nurs. 7, 106–117. Grosvenor, C. E., Picciano, M. F., and Baumrucker, C. R. (1993). Hormones and growth factors in milk. Endocr. Rev. 14, 710–728. Grulee, C., Sandord, H., and Schwartz, H. (1935). Breast and artificially fed infants; study of the age incidence in the morbidity and mortality in 20,000 cases. JAMA 104, 1986–1988. Gust, D. A., Strine, T. W., Maurice, E., Smith, P., Yusuf, H., Wilkinson, M., Battaglia, M., Wright, R., and Schwartz, B. (2004). Underimmunization among children: Effects of vaccine safety concerns on immunization status. Pediatrics 114, e16–e22. Hammerschmidt, S., Talay, S. R., Brandtzaeg, P., and Chhatwal, G. S. (1997). SpsA, a novel pneumococcal surface protein with specific binding to secretory immunoglobulin A and secretory component. Mol. Microbiol. 25, 1113–1124. Hamosh, M., Peterson, J. A., Henderson, T. R., Scallan, C. D., Kiwan, R., Ceriani, R. L., Armand, M., Mehta, N. R., and Hamosh, P. (1999). Protective function of human milk: The milk fat globule. Semin. Perinatol. 23, 242–249. Hanson, L. A. (1998). Breastfeeding provides passive and likely long-lasting active immunity. Ann. Allergy Asthma Immunol. 81, 523–533. Hanson, L. A., and Korotkova, M. (2002). The role of breastfeeding in prevention of neonatal infection. Semin. Neonatol. 7, 275–281.

74

Heather J. Hosea Blewett et al.

Hanson, L. A., Hahn-Zoric, M., Berndes, M., Ashraf, R., Herias, V., Jalil, F., Bhutta, T. I., Laeeq, A., and Mattsby-Baltzer, I. (1994). Breast feeding: Overview and breast milk immunology. Acta Paediatr. Jpn. 36, 557–561. Hanson, L. A., Korotkova, M., Lundin, S., Haversen, L., Silfverdal, S. A., Mattsby-Baltzer, I., Strandvik, B., and Telemo, E. (2003a). The transfer of immunity from mother to child. Ann. NY Acad. Sci. 987, 199–206. Hanson, L. A., Korotkova, M., and Telemo, E. (2003b). Breast-feeding, infant formulas, and the immune system. Ann. Allergy Asthma Immunol. 90, 59–63. Harbige, L. S., and Fisher, B. A. (2001). Dietary fatty acid modulation of mucosally-induced tolerogenic immune responses. Proc. Nutr. Soc. 60, 449–456. Hasselbalch, H., Engelmann, M. D., Ersboll, A. K., Jeppesen, D. L., and Fleischer-Michaelsen, K. (1999). Breast-feeding influences thymic size in late infancy. Eur. J. Pediatr. 158, 964–967. Haukland, H. H., Ulvatne, H., Sandvik, K., and Vorland, L. H. (2001). The antimicrobial peptides lactoferricin B and magainin 2 cross over the bacterial cytoplasmic membrane and reside in the cytoplasm. FEBS Lett. 508, 389–393. Hawkes, J. S., Neumann, M. A., and Gibson, R. A. (1999). The effect of breast feeding on lymphocyte subpopulations in healthy term infants at 6 months of age. Pediatr. Res. 45, 648–651. Hawkes, J. S., Bryan, D. L., Neumann, M. A., Makrides, M., and Gibson, R. A. (2001). Transforming growth factor beta in human milk does not change in response to modest intakes of docosahexaenoic acid. Lipids 36, 1179–1181. Hawkes, J. S., Bryan, D. L., and Gibson, R. A. (2002). Cytokine production by human milk cells and peripheral blood mononuclear cells from the same mothers. J. Clin. Immunol. 22, 338–344. Hawkes, J. S., Gibson, R. A., Roberton, D., and Makrides, M. (2006). Effect of dietary nucleotide supplementation on growth and immune function in term infants: A randomized controlled trial. Eur. J. Clin. Nutr. 60, 254–264. Hirai, C., Ichiba, H., Saito, M., Shintaku, H., Yamano, T., and Kusuda, S. (2002). Trophic effect of multiple growth factors in amniotic fluid or human milk on cultured human fetal small intestinal cells. J. Pediatr. Gastroenterol. Nutr. 34, 524–528. Holmgren, J., Svennerholm, A. M., and Lindblad, M. (1983). Receptor-like glycocompounds in human milk that inhibit classical and El Tor Vibrio cholerae cell adherence (hemagglutination). Infect. Immun. 39, 147–154. Houghton, M., Santoso, H., Soetjiningsih, and Gracey, M. (1985). Lactoferrin concentrations in the breast milk of Indonesian mothers. Paediatr. Indones. 25, 163–166. Howie, P. W., Forsyth, J. S., Ogston, S. A., Clark, A., and Florey, C. D. (1990). Protective effect of breast feeding against infection. BMJ 300, 11–16. Hughes, A., Brock, J. H., Parrott, D. M., and Cockburn, F. (1988). The interaction of infant formula with macrophages: Effect on phagocytic activity, relationship to expression of class II MHC antigen and survival of orally administered macrophages in the neonatal gut. Immunology 64, 213–218. Ichikawa, M., Sugita, M., Takahashi, M., Satomi, M., Takeshita, T., Araki, T., and Takahashi, H. (2003). Breast milk macrophages spontaneously produce granulocytemacrophage colony-stimulating factor and differentiate into dendritic cells in the presence of exogenous interleukin-4 alone. Immunology 108, 189–195. Ilcol, Y. O., Hizli, Z. B., and Ozkan, T. (2006). Leptin concentration in breast milk and its relationship to duration of lactation and hormonal status. Int. Breastfeed J. 1, 21. Isaacs, C. E. (2001). The antimicrobial function of milk lipids. Adv. Nutr. Res. 10, 271–285. Isaacs, C. E., Litov, R. E., and Thormar, H. (1995). Antimicrobial activity of lipids added to human milk, infant formula, and bovine milk. J. Nutr. Biochem. 6, 362–366. Jackson, K. M., and Nazar, A. M. (2006). Breastfeeding, the immune response, and long-term health. J. Am. Osteopath. Assoc. 106, 203–207.

Immune Compounds in Milk

75

Jain, L., Vidyasagar, D., Xanthou, M., Ghai, V., Shimada, S., and Blend, M. (1989). In vivo distribution of human milk leucocytes after ingestion by newborn baboons. Arch. Dis. Child 64, 930–933. Jia, H. P., Starner, T., Ackermann, M., Kirby, P., Tack, B. F., and McCray, P. B., Jr. (2001). Abundant human beta-defensin-1 expression in milk and mammary gland epithelium. J. Pediatr. 138, 109–112. Kalliomaki, M., Ouwehand, A., Arvilommi, H., Kero, P., and Isolauri, E. (1999). Transforming growth factor-beta in breast milk: A potential regulator of atopic disease at an early age. J. Allergy Clin. Immunol. 104, 1251–1257. Karlson, E. W., Mandl, L. A., Hankinson, S. E., and Grodstein, F. (2004). Do breast-feeding and other reproductive factors influence future risk of rheumatoid arthritis? Results from the nurses’ health study. Arthitis Rheum. 50, 3458–3467. Kelleher, S. L., and Lonnerdal, B. (2001). Immunological activities associated with milk. Adv. Nutr. Res. 10, 39–65. Kelly, D., and Coutts, A. G. (2000). Early nutrition and the development of immune function in the neonate. Proc. Nutr. Soc. 59, 177–185. Kleessen, B., Bunke, H., Tovar, K., Noack, J., and Sawatzki, G. (1995). Influence of two infant formulas and human milk on the development of the faecal flora in newborn infants. Acta Paediatr. 84, 1347–1356. Koenig, A., de Albuquerque Diniz, E. M., Barbosa, S. F., and Vaz, F. A. (2005). Immunologic factors in human milk: The effects of gestational age and pasteurization. J. Hum. Lact. 21, 439–443. Kolb, A. F. (2002). Engineering immunity in the mammary gland. J. Mammary Gland Biol. Neoplasia 7, 123–134. Koletzko, B., Rodriguez-Palmero, M., Demmelmair, H., Fidler, N., Jensen, R., and Sauerwald, T. (2001). Physiological aspects of human milk lipids. Early Hum. Dev. 65 (Suppl.), S3–S18. Korhonen, H. (1977). Antimicrobial factors in bovine colostrum. J. Sci. Agric. Soc. Finland 49, 434–447. Korotkova, M., Telemo, E., Hanson, L. A., and Strandvik, B. (2004). Modulation of neonatal immunological tolerance to ovalbumin by maternal essential fatty acid intake. Pediatr. Allergy Immunol. 15, 112–122. Kramer, M. S., Chalmers, B., Hodnett, E. D., Sevkovskaya, Z., Dzikovich, I., Shapiro, S., Collet, J. P., Vanilovich, I., Mezen, I., Ducruet, T., Shishko, G., Zubovich, V., et al. (2001). Promotion of breastfeeding intervention trial (PROBIT): A randomized trial in the Republic of Belarus. JAMA 285, 413–420. Kramer, M. S., Guo, T., Platt, R. W., Sevkovskaya, Z., Dzikovich, I., Collet, J. P., Shapiro, S., Chalmers, B., Hodnett, E., Vanilovich, I., Mezen, I., Ducruet, T., et al. (2003). Infant growth and health outcomes associated with 3 compared with 6 mo of exclusive breastfeeding. Am. J. Clin. Nutr. 78, 291–295. Kull, I., Almqvist, C., Lilja, G., Pershagen, G., and Wickman, M. (2004). Breast-feeding reduces the risk of asthma during the first 4 years of life. J. Allergy Clin. Immunol. 114, 755–760. Kull, I., Bohme, M., Wahlgren, C. F., Nordvall, L., Pershagen, G., and Wickman, M. (2005). Breast-feeding reduces the risk for childhood eczema. J. Allergy Clin. Immunol. 116, 657–661. Kunz, C., Rodriguez-Palmero, M., Koletzko, B., and Jensen, R. (1999). Nutritional and biochemical properties of human milk, Part I: General aspects, proteins, and carbohydrates. Clin. Perinatol. 26, 307–333. Kvistgaard, A. S., Pallesen, L. T., Arias, C. F., Lopez, S., Petersen, T. E., Heegaard, C. W., and Rasmussen, J. T. (2004). Inhibitory effects of human and bovine milk constituents on rotavirus infections. J. Dairy Sci. 87, 4088–4096.

76

Heather J. Hosea Blewett et al.

Labeta, M. O., Vidal, K., Nores, J. E., Arias, M., Vita, N., Morgan, B. P., Guillemot, J. C., Loyaux, D., Ferrara, P., Schmid, D., Affolter, M., Borysiewicz, L. K., et al. (2000). Innate recognition of bacteria in human milk is mediated by a milk-derived highly expressed pattern recognition receptor, soluble CD14. J. Exp. Med. 191, 1807–1812. Laiho, K., Lampi, A. M., Hamalainen, M., Moilanen, E., Piironen, V., Arvola, T., Syrjanen, S., and Isolauri, E. (2003). Breast milk fatty acids, eicosanoids, and cytokines in mothers with and without allergic disease. Pediatr. Res. 53, 642–647. LeBouder, E., Rey-Nores, J. E., Rushmere, N. K., Grigorov, M., Lawn, S. D., Affolter, M., Griffin, G. E., Ferrara, P., Schiffrin, E. J., Morgan, B. P., and Labeta, M. O. (2003). Soluble forms of Toll-like receptor (TLR)2 capable of modulating TLR2 signaling are present in human plasma and breast milk. J. Immunol. 171, 6680–6689. Lee-Huang, S., Huang, P. L., Sun, Y., Huang, P. L., Kung, H. F., Blithe, D. L., and Chen, H. C. (1999). Lysozyme and RNases as anti-HIV components in beta-core preparations of human chorionic gonadotropin. Proc. Natl. Acad. Sci. USA 96, 2678–2681. Leon-Sicairos, N., Lopez-Soto, F., Reyes-Lopez, M., Godinez-Vargas, D., Ordaz-Pichardo, C., and de la, G. M. (2006). Amoebicidal activity of milk, apo-lactoferrin, sIgA and lysozyme. Clin. Med. Res. 4, 106–113. Letterio, J. J., Geiser, A. G., Kulkarni, A. B., Roche, N. S., Sporn, M. B., and Roberts, A. B. (1994). Maternal rescue of transforming growth factor-beta 1 null mice. Science 264, 1936–1938. Lewallen, L. P., Dick, M. J., Flowers, J., Powell, W., Zickefoose, K. T., Wall, Y. G., and Price, Z. M. (2006). Breastfeeding support and early cessation. J. Obstet. Gynecol. Neonatal Nurs. 35, 166–172. Liepke, C., Zucht, H. D., Forssmann, W. G., and Standker, L. (2001). Purification of novel peptide antibiotics from human milk. J. Chromatogr. B Biomed. Sci. Appl. 752, 369–377. Liepke, C., Adermann, K., Raida, M., Magert, H. J., Forssmann, W. G., and Zucht, H. D. (2002). Human milk provides peptides highly stimulating the growth of bifidobacteria. Eur. J. Biochem. 269, 712–718. Lindberg, T., Ohlsson, K., and Westrom, B. (1982). Protease inhibitors and their relation to protease activity in human milk. Pediatr. Res. 16, 479–483. Lonnerdal, B. (2003). Nutritional and physiologic significance of human milk proteins. Am. J. Clin. Nutr. 77, 1537S–1543S. Lucas, A., and Cole, T. J. (1990). Breast milk and neonatal necrotising enterocolitis. Lancet 336, 1519–1523. Malcova, H., Sumnik, Z., Drevinek, P., Venhacova, J., Lebl, J., and Cinek, O. (2006). Absence of breast-feeding is associated with the risk of type 1 diabetes: A case-control study in a population with rapidly increasing incidence. Eur. J. Pediatr. 165, 114–119. Manjarrez-Hernandez, H. A., Gavilanes-Parra, S., Chavez-Berrocal, E., Navarro-Ocana, A., and Cravioto, A. (2000). Antigen detection in enteropathogenic Escherichia coli using secretory immunoglobulin A antibodies isolated from human breast milk. Infect. Immun. 68, 5030–5036. Mantis, N. J., Cheung, M. C., Chintalacharuvu, K. R., Rey, J., Corthesy, B., and Neutra, M. R. (2002). Selective adherence of IgA to murine Peyer’s patch M cells: Evidence for a novel IgA receptor. J. Immunol. 169, 1844–1851. Marodi, L. (2006). Neonatal innate immunity to infectious agents. Infect. Immun. 74, 1999–2006. Martin, H., and Abraham, D. (2005). Visual vignette. Unilateral carotid vascular atherosclerosis. Endocr. Pract. 11, 352. Martin, L. J., Woo, J. G., Geraghty, S. R., Altaye, M., Davidson, B. S., Banach, W., Dolan, L. M., Ruiz-Palacios, G. M., and Morrow, A. L. (2006). Adiponectin is present in human milk and is associated with maternal factors. Am. J. Clin. Nutr. 83, 1106–1111. Mayer, L., and Shao, L. (2004). Therapeutic potential of oral tolerance. Nat. Rev. Immunol. 4, 407–419.

Immune Compounds in Milk

77

Michie, C. A. (1998). The long term effects of breastfeeding: A role for the cells in breast milk? J. Trop. Pediatr. 44, 2–3. Michie, C. A., Tantscher, E., Schall, T., and Rot, A. (1998). Physiological secretion of chemokines in human breast milk. Eur. Cytokine Netw. 9, 123–129. Morrow, A. L., and Rangel, J. M. (2004). Human milk protection against infectious diarrhea: Implications for prevention and clinical care. Semin. Pediatr. Infect. Dis. 15, 221–228. Morrow, A. L., Guerrero, M. L., Shults, J., Calva, J. J., Lutter, C., Bravo, J., Ruiz-Palacios, G., Morrow, R. C., and Butterfoss, F. D. (1999). Efficacy of home-based peer counselling to promote exclusive breastfeeding: A randomised controlled trial. Lancet 353, 1226–1231. Morrow, A. L., Ruiz-Palacios, G. M., Jiang, X., and Newburg, D. S. (2005). Human-milk glycans that inhibit pathogen binding protect breast-feeding infants against infectious diarrhea. J. Nutr. 135, 1304–1307. Mowat, A. M. (2003). Anatomical basis of tolerance and immunity to intestinal antigens. Nat. Rev. Immunol. 3, 331–341. Murphey, D. K., and Buescher, E. S. (1993). Human colostrum has anti-inflammatory activity in a rat subcutaneous air pouch model of inflammation. Pediatr. Res. 34, 208–212. Nair, M. K., Joy, J., Vasudevan, P., Hinckley, L., Hoagland, T. A., and Venkitanarayanan, K. S. (2005). Antibacterial effect of caprylic acid and monocaprylin on major bacterial mastitis pathogens. J. Dairy Sci. 88, 3488–3495. Nestle Nutrition Services. (1999). Normal microbial flora of the gut and the immune system. In ‘‘Probiotics, Other Nutritional Factors, and Intestinal Microflora.’’ (Lars A. Hanson and Robert H. Yolken, eds.), pp. 217–228. Lippincott-Raven, Philadelphia. Newburg, D. S. (2000). Are all human milks created equal? Variation in human milk oligosaccharides. J. Pediatr. Gastroenterol. Nutr. 30, 131–133. Newburg, D. S., Peterson, J. A., Ruiz-Palacios, G. M., Matson, D. O., Morrow, A. L., Shults, J., Guerrero, M. L., Chaturvedi, P., Newburg, S. O., Scallan, C. D., Taylor, M. R., Ceriani, R. L., et al. (1998). Role of human-milk lactadherin in protection against symptomatic rotavirus infection. Lancet 351, 1160–1164. Newburg, D. S., Ruiz-Palacios, G. M., Altaye, M., Chaturvedi, P., Guerrero, M. L., MeinzenDerr, J. K., and Morrow, A. L. (2004). Human milk alphal,2-linked fucosylated oligosaccharides decrease risk of diarrhea due to stable toxin of E. coli in breastfed infants. Adv. Exp. Med. Biol. 554, 457–461. Ogawa, J., Sasahara, A., Yoshida, T., Sira, M. M., Futatani, T., Kanegane, H., and Miyawaki, T. (2004). Role of transforming growth factor-beta in breast milk for initiation of IgA production in newborn infants. Early Hum. Dev. 77, 67–75. Ogundele, M. (2001). Role and significance of the complement system in mucosal immunity: Particular reference to the human breast milk complement. Immunol. Cell Biol. 79, 1–10. Owen, C. G., Martin, R. M., Whincup, P. H., Smith, G. D., and Cook, D. G. (2006). Does breastfeeding influence risk of type 2 diabetes in later life? A quantitative analysis of published evidence. Am. Clin. J. Nutr. 84, 1043–1054. Palmer, D. J., and Makrides, M. (2006). Diet of lactating women and allergic reactions in their infants. Curr. Opin. Clin. Nutr. Metab. Care 9, 284–288. Palti, H., Mansbach, I., Pridan, H., Adler, B., and Palti, Z. (1984). Episodes of illness in breastfed and bottle-fed infants in Jerusalem. Isr. J. Med. Sci. 20, 395–399. Pellegrini, A., Thomas, U., Bramaz, N., Hunziker, P., and von, F. R. (1999). Isolation and identification of three bactericidal domains in the bovine alpha-lactalbumin molecule. Biochim. Biophys. Acta 1426, 439–448. Peterson, J. A., Patton, S., and Hamosh, M. (1998). Glycoproteins of the human milk fat globule in the protection of the breast-fed infant against infections. Biol. Neonate 74, 143–162. Plaut, A. G., Qiu, J., and St, G. J., III. (2000). Human lactoferrin proteolytic activity: Analysis of the cleaved region in the IgA protease of Haemophilus influenzae. Vaccine 19(Suppl. 1), S148–S152.

78

Heather J. Hosea Blewett et al.

Potischman, N., and Troisi, R. (1999). In-utero and early life exposures in relation to risk of breast cancer. Cancer Causes Control 10, 561–573. Quigley, M. A., Cumberland, P., Cowden, J. M., and Rodrigues, L. C. (2006). How protective is breast feeding against diarrhoeal disease in infants in 1990s England? A case-control study. Arch. Dis. Child 91, 245–250. Rautava, S., Kalliomaki, M., and Isolauri, E. (2002). Probiotics during pregnancy and breastfeeding might confer immunomodulatory protection against atopic disease in the infant. J. Allergy Clin. Immunol. 109, 119–121. Rivas, R. A., el Mohandes, A. A., and Katona, I. M. (1994). Mononuclear phagocytic cells in human milk: HLA-DR and Fc gamma R ligand expression. Biol. Neonate 66, 195–204. Roberts, S. A., and Turner, M. W. (1983). Specific suppression of rat IgE responses with milk from immunized females and with feeds of serum antibody. Immunology 48, 195–199. Romeu-Nadal, M., Morera-Pons, S., Castellote, A. I., and Lopez-Sabater, M. C. (2006). Determination of gamma- and alpha-tocopherols in human milk by a direct highperformance liquid chromatographic method with UV-vis detection and comparison with evaporative light scattering detection. J. Chromatogr. A 1114, 132–137. Ruiz-Palacios, G. M., Calva, J. J., Pickering, L. K., Lopez-Vidal, Y., Volkow, P., Pezzarossi, H., and West, M. S. (1990). Protection of breast-fed infants against Campylobacter diarrhea by antibodies in human milk. J. Pediatr. 116, 707–713. Sabbaj, S., Ghosh, M. K., Edwards, B. H., Leeth, R., Decker, W. D., Goepfert, P. A., and Aldrovandi, G. M. (2005). Breast milk-derived antigen-specific CD8þ T cells: An extralymphoid effector memory cell population in humans. J. Immunol. 174, 2951–2956. Saito, S., Yoshida, M., Ichijo, M., Ishizaka, S., and Tsujii, T. (1993). Transforming growth factor-beta (TGF-beta) in human milk. Clin. Exp. Immunol. 94, 220–224. Sakurai, T., Furukawa, M., Asoh, M., Kanno, T., Kojima, T., and Yonekubo, A. (2005). Fatsoluble and water-soluble vitamin contents of breast milk from Japanese women. J. Nutr. Sci. Vitaminol. (Tokyo) 51, 239–247. Scariati, P. D., Grummer-Strawn, L. M., and Fein, S. B. (1997). A longitudinal analysis of infant morbidity and the extent of breastfeeding in the United States. Pediatrics 99, E5. Schroten, H. (2001). Chemistry of milk mucins and their anti-microbial action. Adv. Nutr. Res. 10, 231–245. Schroten, H., Hanisch, F. G., Plogmann, R., Hacker, J., Uhlenbruck, G., Nobis-Bosch, R., and Wahn, V. (1992). Inhibition of adhesion of S-fimbriated Escherichia coli to buccal epithelial cells by human milk fat globule membrane components: A novel aspect of the protective function of mucins in the nonimmunoglobulin fraction. Infect. Immun. 60, 2893–2899. Seganti, L., Di Biase, A. M., Marchetti, M., Pietrantoni, A., Tinari, A., and Superti, F. (2004). Antiviral activity of lactoferrin towards naked viruses. Biometals 17, 295–299. Semenov, D. V., Kanyshkova, T. G., Karotaeva, N. A., Krasnorutskii, M. A., Kuznetsova, I. A., Buneva, V. N., and Nevinsky, G. A. (2004). Catalytic nucleotide-hydrolyzing antibodies in milk and serum of clinically healthy human mothers. Med. Sci. Monit. 10, BR23–BR33. Shah, N. P. (2000). Effects of milk-derived bioactives: An overview. Br. J. Nutr. 84(Suppl. 1), S3–S10. Sharda, B. (2006). Free radicals: Emerging challenge in environmental health research in childhood and neonatal disorders. Int. J. Environ. Res. Public Health 3, 286–291. Shiratsuchi, Y., Iyoda, T., Tanimoto, N., Kegai, D., Nagata, K., and Kobayashi, Y. (2007). Infiltrating neutrophils induce allospecific CTL in response to immunization with apoptotic cells via MCP-1 production. J. Leukoc. Biol. 81, 412–420. Singh, P. K., Parsek, M. R., Greenberg, E. P., and Welsh, M. J. (2002). A component of innate immunity prevents bacterial biofilm development. Nature 417, 552–555. Snijders, B. E., Damoiseaux, J. G., Penders, J., Kummeling, I., Stelma, F. F., van, R. R., van den Brandt, P. A., and Thijs, C. (2006). Cytokines and soluble CD14 in breast milk in relation with atopic manifestations in mother and infant (KOALA Study). Clin. Exp. Allergy 36, 1609–1615.

Immune Compounds in Milk

79

Steele, W. F., and Morrison, M. (1969). Antistreptococcal activity of lactoperoxidase. J. Bacteriol. 97, 635–639. Strobel, S. (2001). Immunity induced after a feed of antigen during early life: Oral tolerance v. sensitisation. Proc. Nutr. Soc. 60, 437–442. Sun, C. Q., O’Connor, C. J., Turner, S. J., Lewis, G. D., Stanley, R. A., and Roberton, A. M. (1998). The effect of pH on the inhibition of bacterial growth by physiological concentrations of butyric acid: Implications for neonates fed on suckled milk. Chem. Biol. Interact. 113, 117–131. Sydora, B. C., Tavernini, M. M., Wessler, A., Jewell, L. D., and Fedorak, R. N. (2003). Lack of interleukin-10 leads to intestinal inflammation, independent of the time at which luminal microbial colonization occurs. Inflamm. Bowel Dis. 9, 87–97. Takahata, Y., Takada, H., Nomura, A., Ohshima, K., Nakayama, H., Tsuda, T., Nakano, H., and Hara, T. (2001). Interleukin-18 in human milk. Pediatr. Res. 50, 268–272. Teraguchi, S., Shin, K., Fukuwatari, Y., and Shimamura, S. (1996). Glycans of bovine lactoferrin function as receptors for the type 1 fimbrial lectin of Escherichia coli. Infect. Immun. 64, 1075–1077. Thormar, H., Isaacs, C. E., Brown, H. R., Barshatzky, M. R., and Pessolano, T. (1987). Inactivation of enveloped viruses and killing of cells by fatty acids and monoglycerides. Antimicrob. Agents Chemother. 31, 27–31. Thorpe, L. W., Rudloff, H. E., Powell, L. C., and Goldman, A. S. (1986). Decreased response of human milk leukocytes to chemoattractant peptides. Pediatr. Res. 20, 373–377. Thurl, S., Henker, J., Taut, H., Tovar, K., and Sawatzki, G. (1993). Variations of neutral oligosaccharides and lactose in human milk during the feeding. Z. Ernahrungswiss. 32, 262–269. Turoli, D., Testolin, G., Zanini, R., and Bellu, R. (2004). Determination of oxidative status in breast and formula milk. Acta Paediatr. 93, 1569–1574. Ulvatne, H., Haukland, H. H., Olsvik, O., and Vorland, L. H. (2001). Lactoferricin B causes depolarization of the cytoplasmic membrane of Escherichia coli ATCC 25922 and fusion of negatively charged liposomes. FEBS Lett. 492, 62–65. Ustundag, B., Yilmaz, E., Dogan, Y., Akarsu, S., Canatan, H., Halifeoglu, I., Cikim, G., and Aygun, A. D. (2005). Levels of cytokines (IL-1beta, IL-2, IL-6, IL-8, TNF-alpha) and trace elements (Zn, Cu) in breast milk from mothers of preterm and term infants. Mediators Inflamm. 2005, 331–336. Van de Perre, P. (2003). Transfer of antibody via mother’s milk. Vaccine 21, 3374–3376. van Odijk, J., Kull, I., Borres, M. P., Brandtzaeg, P., Edberg, U., Hanson, L. A., Host, A., Kuitunen, M., Olsen, S. F., Skerfving, S., Sundell, J., and Wille, S. (2003). Breastfeeding and allergic disease: A multidisciplinary review of the literature (1966–2001) on the mode of early feeding in infancy and its impact on later atopic manifestations. Allergy 58, 833–843. Vidal, K., Labeta, M. O., Schiffrin, E. J., and Donnet-Hughes, A. (2001). Soluble CD14 in human breast milk and its role in innate immune responses. Acta Odontol. Scand. 59, 330–334. Vidal, K., Serrant, P., Schlosser, B., van den, B. P., Lorget, F., and Donnet-Hughes, A. (2004a). Osteoprotegerin production by human intestinal epithelial cells: A potential regulator of mucosal immune responses. Am. J. Physiol. Gastrointest. Liver Physiol. 287, G836–G844. Vidal, K., van den, B. P., Lorget, F., and Donnet-Hughes, A. (2004b). Osteoprotegerin in human milk: A potential role in the regulation of bone metabolism and immune development. Pediatr. Res. 55, 1001–1008. Wahle, K. W., Heys, S. D., and Rotondo, D. (2004). Conjugated linoleic acids: Are they beneficial or detrimental to health? Prog. Lipid Res. 43, 553–587. Wang, X. Y., Xu, Z. Y., von, S. L., Zhang, Y. L., Zhao, S. J., Hao, Z. Y., Han, O. P., Kilgore, P., Xing, Z. C., Han, C. Q., Ma, J. C., Chen, J. C., et al. (2005). Incidence of diarrhea caused by rotavirus infections in rural Zhengding, China: Prospective, population-based surveillance. J. Infect. Dis. 192(Suppl. 1), S100–S105.

80

Heather J. Hosea Blewett et al.

Ward, P. P., Paz, E., and Conneely, O. M. (2005). Multifunctional roles of lactoferrin: A critical overview. Cell Mol. Life Sci. 62, 2540–2548. Welsh, J. K., Skurrie, I. J., and May, J. T. (1978). Use of Semliki forest virus to identify lipidmediated antiviral activity and anti-alphavirus immunoglobulin A in human milk. Infect. Immun. 19, 395–401. Williamson, M. T., and Murti, P. K. (1996). Effects of storage, time, temperature, and composition of containers on biologic components of human milk. J. Hum. Lact. 12, 31–35. Wilson, A. C., Forsyth, J. S., Greene, S. A., Irvine, L., Hau, C., and Howie, P. W. (1998). Relation of infant diet to childhood health: Seven year follow up of cohort of children in Dundee infant feeding study. BMJ 316, 21–25. Winberg, J., and Wessner, G. (1971). Does breast milk protect against septicaemia in the newborn? Lancet 1, 1091–1094. Wirt, D. P., Adkins, L. T., Palkowetz, K. H., Schmalstieg, F. C., and Goldman, A. S. (1992). Activated and memory T lymphocytes in human milk. Cytometry 13, 282–290. World Health Organization (2001). The Optimal Duration of Exclusive Breastfeeding. A Systematic Review. Yoon, P. W., Black, R. E., Moulton, L. H., and Becker, S. (1996). Effect of not breastfeeding on the risk of diarrheal and respiratory mortality in children under 2 years of age in Metro Cebu, The Philippines. Am. J. Epidemiol. 143, 1142–1148. Zhang, G. H., Mann, D. M., and Tsai, C. M. (1999). Neutralization of endotoxin in vitro and in vivo by a human lactoferrin-derived peptide. Infect. Immun. 67, 1353–1358.

CHAPTER

3 PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi Ludwig Niessen*

Contents

I. Introduction A. Detection of aflatoxin producers B. Detection of trichothecene producers C. Trichothecene biosynthesis cluster genes as sequence source for primer design D. Other sequence sources for detection of trichothecene producers E. Detection of ochratoxin A producers F. Primers targeted to anonymous genomic markers G. AFLP marker-based primers for A. ochraceus and A. carbonarius H. Detection of A. ochraceus and A. carbonarius with cDNA AFLP-based primers I. RAPD marker-based primers for A. carbonarius and A. niger J. Primers targeted to genetically defined sequences K. rRNA gene-based approaches for the PCR diagnosis of OTA-producing fungi L. Calmodulin gene-targeted primers for detection of A. carbonarius and A. japonicus M. Primers for OTA biosynthetic pathway genes N. Detection of fumonisin producers O. Detection of patulin producers II. Conclusions and Future Perspectives References

82 102 103 103 106 109 110 110 112 113 114 114 116 117 120 124 126 128

* Technische Universita¨t Mu¨nchen, Lehrstuhl fu¨r Technische Mikrobiologie, Weihenstephaner Steig 16,

D-85350 Freising, Germany Advances in Food and Nutrition Research, Volume 54 ISSN 1043-4526, DOI: 10.1016/S1043-4526(07)00003-4

#

2008 Elsevier Inc. All rights reserved.

81

82

Abstract

Ludwig Niessen

Mycotoxins are secondary metabolites produced by filamentous fungi which have toxicologically relevant effects on vertebrates if administered in small doses via a natural route. In order to improve food safety and to protect consumers from harmful contaminants, the presence of fungi with the potential to produce such compounds must be checked at critical control points during the production of agricultural commodities as well as during the process of food and feed preparation. Polymerase chain reaction (PCR)-based diagnosis has been applied as an alternative assay replacing cumbersome and time-consuming microbiological and chemical methods for the detection and identification of the most serious toxin producers in the fungal genera Fusarium, Aspergillus, and Penicillium. The current chapter covers the numerous PCR-based assays which have been published since the first description of the use of this technology to detect Aspergillus flavus biosynthesis genes in 1996.

I. INTRODUCTION Mycotoxins are secondary metabolites produced by filamentous fungi that in small concentrations can evoke an acute or chronic disease in vertebrate animals when introduced via a natural route (Gravesen et al., 1994). Some authors have added attributes such as missing immunogenicity, thermostability, or low molecular weight. Some mycotoxins have an additional effect on bacteria or plants, for example, they act as antibiotics or phytotoxins. Ustiloxins, cyclic peptide mycotoxins produced by Ustilaginoidea virens in false smut balls on rice panicles, are highly active phytotoxins (Koiso et al., 1994). Also the mycotoxin, tenuazonic acid from Alternaria spp., acts as a phytotoxin in solanaceous plants and has also antibiotic activity ( Janardhanan and Hussain, 1983). Some compounds, which are usually classified among the mycotoxins, do not exactly fit the above definition, for example, zearalenone, which acts as an estrogen analogue (Mirocha et al., 1978). The substance is regularly produced together with other Fusarium mycotoxins so that the toxicological effects observed in animals after consumption of Fusarium-contaminated feed were attributed to zearalenone in early studies. The majority of the >400 mycotoxins currently known (Bauer and Gareis, 1987) can be categorized in 8 groups according to their chemical characteristics, that is, ergot alkaloids (example: ergovalin), chinones (citrinin), coumarins (ochratoxin), cyclopeptides (enniatins), diketopiperazines (roquefortine C), sesquiterpenes (deoxynivalenol), furofuranes (aflatoxins), and lactones (patulin, zearalonone) (Turner and Aldridge, 1983). Substances can

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

83

also be grouped according to their toxic activity under chronic conditions as mutagenic, carcinogenic, or teratogenic. Grouping according to their site of action results in hemo-, hepato-, nephro-, dermato-, neuro-, or immunotoxins. Exposure may occur through ingestion, inhalation, and dermal contact (Hendry and Cole, 1993; Pitt, 2000). Mycotoxins are among the oldest environmental toxicants menacing human existence since ancient times (Kampelmacher, 1973; Scho¨ntal, 1984). To date, massive outbreaks of human mycotoxicoses occur but are more or less restricted to developing countries, that is, an outbreak of acute aflatoxicosis in the Makueni district and neighboring districts in Kenya in 2004 with 125 fatalities as one of the most recent cases (Muture and Ogana, 2005). In developed countries and in threshold countries, the major concerns are chronic effects of ingesting small concentrations of mycotoxins over a long period of time (Etzel, 2002). The majority of mycotoxin producers can be found in the fungal genera Aspergillus, Penicillium, Fusarium, and Alternaria which concomitantly happen to be the most abundant contaminants of food and feed. All genera belong to the ascomycotina but the most potent toxin producers among them are the species which regularly occur in the anamorphic state or of which no teleomorph is known. All four genera have in common the presence of high numbers of species, distinction of which is very complicated and requires a high degree of specialization. Moreover, constant changes in the taxonomy of these genera may lead to misidentification of an isolate and false evaluation of its toxigenic potential. Aimed at both overcoming the obstacles of identification and developing more rapid tools for detection, nucleic acid-based methods have been developed and used over the last 10 years as a tool for the analysis of mycotoxigenic fungi. The polymerase chain reaction (PCR) (Saiki et al., 1988) has replaced cumbersome and time-consuming microbiological analysis by amplification of specific genomic markers rather than growing the living organism under study. Reviewing the literature shows that within the last 10 years from the first report to the present, PCR-based detection systems have been set up for the major species and groups of mycotoxigenic fungi. Systems were developed in three major ‘‘waves’’ of innovation which very much reflect the three periods in which different groups of toxins came into focus of scientific interest and public awareness. Figure 3.1 gives a graphic representation of publications over time from 1996 until April 2007. It must be noted here that only the first publication of a detection system for the depicted species and groups of species are shown. In many cases, alternative PCR-based systems have been subsequently described. An exhaustive list with full appreciation of the systems and application published until November 2006 can be found in Table 3.1. The list gives fungal species and groups of fungal organisms detected with the mycotoxins typically produced

84

F. avenaceum F. crookwellense F. sambucinum F. solani F. torulosum F. venenatum F. verticillioides S. chartarum fumonisin producers trichothecene producers (tri5)

96

97

98

F. graminearum P. roqueforti

A. flavus (nor-1, ver-1, omtA) A. parasiticus (nor-1, ver-1, omtA) A. versicolor (nor-1, ver-1, omtA) F. avenaceum/tricinctum F. culmorum F. graminearum group 2 (= F. pseudograminearum) F. poae

Alt. alternata A. niger A. nomius A. terreus A. sydowii A. versicolor Chaetomium globosum Cladosporium herbarum Myrothecium roridum Paecilomyces variotii patulin producers (idh)

99

00

01

A. nidulans A. ustus F. acuminatum S. chartarum (tri5) fumonisin producers (fum1)

A. niger A. ochraceus (pks) OTA/citrinin producers (pks)

02

Claviceps purpurea F. graminearum chemotypes (tri7) F. subglutinans Trichoderma harzianum A. ochraceus F. culmorum chemotypes (tri13) F. equiseti F. oxysporum F. proliferatum P. expansum

03

04

05

A. carbonarius (pks)

06

07

A. tubingensis P. verrucosum (nps)

A. carbonarius F. sporotrichioides (tri5) F. langsethiae (tri5) P. nordicum (pks) Wallemia sebi enniatin producers (ennsyn)

FIGURE 3.1 Development of PCR-based detection systems for mycotoxin producing-fungi from 1996 until April 2007. First publication of a diagnostic primer pair was taken as the time mark for each species depicted. In many cases, more systems were published later for the same fungus. Mycotoxin biosynthesis genes used as sequence source are given in bold.

TABLE 3.1 Overview of PCR assays for the detection of mycotoxin-producing fungi and toxins produced by the target organisms Target species

Toxins produceda

Alternaria alternata

Size (bp)

Primer nameb

Primer sequence 5 0 ! 30

PCR, quant. real-time PCR (TaqMan)

n.s.

*AaltrF1 *AaltrR1 probe *AaltrP1

PCR

450

Aalt-F Aalt-R

GGCGGGCTGGAACCTC GCAATTACAAAAGGTTTATGTTTGTCGTA FAM-TTACAGCCTTGCTGAA TTATTCACCCTTGTCTTT-TAMRA GGCGGGCTGGAACCTCTCGG AATGGATGCTAGACCTTTGC

PCR

340

AAF2 AAR3

TGCAATCAGCGTCAGTAACAAAT ATGGATTGCTAGACCTTTGCTGAT

PCR

809

PCR

371

PCR

189

OPX7F809 OPX7R809 CARBO1 CARBO2 A1B_fw A1B_rv CAR1 CAR2

AGGCTAATGTTGATAACGGATGAT GCTGTCAGTATTGGACCTTAGAG AAGCGAATCGATAGTCCACAAGAATAC TCTGGCAGAAGTTAATATCCGGTT GAATTCACCACACATCATAGC TTAACTAGGATTTGGCATTGAAC GCATCTCTGCCCCTCGG GGTTGGAGTTGTCGGCAG

CARBO_q1 CARBO_q2 probe CARBO_probe Ac12RL-OTAF Ac12RL-OTAR

CCGATGGAGGTCATGACATGA AATGCGAACCGGATATTAACTTCTG FAM-CAGCGGCGGAGATA-MGB

Mule` et al., 2006

AATATATCGACTATCTGGACGAGCG CCCTCTAGCGTCTCCCGAAG

Atoui et al., 2007

DNA target

Assay type

see A. alternata

rRNA gene, ITSregion

A. alternata

see A. alternata

A. alternata

alternariol, alternariol monomethylether, altertoxins see A. carbonarius

rRNA gene, ITS1-5.8SITS2 region rRNA gene, ITS1–5.8SITS2 region RAPD fragment Calmodulin gene AFLP marker

Aspergillus carbonarius A. carbonarius

see A. carbonarius

A. carbonarius

see A. carbonarius

A. carbonarius

see A. carbonarius

A. carbonarius

naphto-4-pyrones, ochratoxin A

A. carbonarius

see A. carbonarius

rRNA gene, ITS1–5.8SITS2 region Calmodulin gene

PCR

420

quant. real-time PCR (TaqMan)

167

otapks gene, AT domain

quant. real-time PCR (SYBR green 1)

141

References Haugland and Vesper, 2000

Haugland and Vesper, 2000 Zur et al., 2002 Konstantinova et al., 2002 Fungaro et al., 2004 Perrone et al., 2004 Schmidt et al., 2004a Patino et al., 2005

(continued)

85

TABLE 3.1

(continued)

86

Size (bp)

Primer nameb

Primer sequence 50 ! 30

PCR, multiplex with omt-A and ver-1

400

nor-1 nor-2

ACCGCTACGCCGGCACTCTCGGCAC GTTGGCCGCCAGCTTCGACACTCCG

Geisen, 1996 Fa¨rber et al., 1997; Geisen et al., 1998; Criseo et al., 2001; Chen et al., 2002

ver-1 gene (¼aflM)

PCR, multiplex with nor-1 and omt-A

537

ver-1 ver-2

GCCGCAGGCCGCGGAGAAAGTGGT GGGGATATACTCCCGCGACACAGCC

see A. flavus/ A. parasiticus

omt-A gene (¼aflP)

PCR, multiplex with nor-1 and ver-1

797

omt-1 omt-2

GTGGACGGACCTAGTCCGACATCAC GTCGGCGCCACGCACTGGGTTGGGG

apa-2 gene (¼nor-1) (¼aflD)

PCR

1032

APA-450 APA-1482

TATCTCCCCCCGGGCATCTCCCGG CCGTCAGACAGCCACTGGACACGG

A. flavus A. parasiticus

kojic acid, 3-nitropropionic acid, cyclopiazonic acid, aflatoxin B1, B2, G1, G2, aspergillic acid see A. flavus/ A. parasiticus

Geisen, 1996 Fa¨rber et al., 1997; Geisen et al., 1998; Criseo et al., 2001; Chen et al., 2002 Geisen, 1996 Fa¨rber et al., 1997; Geisen et al., 1998; Criseo et al., 2001; Chen et al., 2002 Shapira et al., 1996 Zachova et al., 2003

ver-1 gene (¼aflM)

PCR

895

VER-496 VER-1391

ATGTCGGATAATCACCGTTTAGATGGC CGAAAAGCGCCACCATCCACCCCAATG

A. flavus A. parasiticus

see A. flavus/ A. parasiticus

PCR

1024

OMT-208 OMT-1232

GGCCCGGTTCCTTGGCTCCTAAGC CGCCCCAGTGAGACCCTTCCTCG

A. flavus A. parasiticus

see A. flavus/ A. parasiticus

omt-1 gene (¼omt-A) (¼aflP) Various genes in aflatoxin biosynthe sis cluster

Target species

Toxins produceda

A. flavus A. parasiticus

DNA target

Assay type

kojic acid, 3-nitropropionic acid, cyclopiazonic acid, aflatoxin B1, B2, G1, G2, aspergillic acid

nor-1 gene (¼aflD)

A. flavus A. parasiticus

see A. flavus/ A. parasiticus

A. flavus A. parasiticus

A. flavus A. parasiticus

PCR, RT-PCR

Various primers, see reference

References

Shapira et al., 1996 Zachova et al., 2003 Shapira et al., 1996

Scherm et al., 2005

A. flavus A. parasiticus

see A. flavus/ A. parasiticus

aflR gene

Nested PCR

798 400

A. flavus

see A. flavus/ A. parasiticus

nor-1 gene (¼aflD)

quant. real-time PCR (TaqMan)

A. flavus

see A. flavus/ A. parasiticus see A. flavus/ A. parasiticus

rRNA gene, ITS1 region rRNA gene, ITS1–5.8S region Various genes in aflatoxin biosynthe sis cluster Alkaline protease gene

PCR

420

quant. real-time PCR (LightCycler)

199

A. flavus

A. flavus

see A. flavus/ A. parasiticus

A. flavus, A. fumigatus

Kojic acid, 3-nitropropionid acid, cyclopiazonid acid, aspergillic acid, aflatoxin B1, gliotoxin, verrucologen, fumitremorgin A & B, fumitoxins, fumigaclavines, tryptoquivalins naphto-4pyrones, malformins, ochratoxin A (few isolates)

A. niger

66

Manonmani et al., 2005

Various primers, see reference

Degola et al., 2007

alp11 alp12 nested alp13 alp14

AGCACCGACTACATCTAC GAGATGGTGTTGGTGGC CTGGCATACAACGCCGCTG TTGTTGATCGCAACC

Tang et al., 1993 Hayette et al., 2001

ANGF79 ANGR139

CACGTTCAAGCCGGACTACGC CAAGATGTTGTCCATCACCGCT

Kanbe et al., 2002

Multiplex RT-PCR

PCR

690 747 527

DNA topoisomer ase II gene

AACCGCATCCACAATCTCAT AGTGCAGTTCGCTCAGAACA GCACCCTGTCTTCCCTAACA ACGACCATGCTCAGCAAGTA GTCCAAGCAACAGGCCAAGT TCGTGCATGTTGGTGATGGT 6-FAM-TGTCTTGATCGGCGCCCG-TAMRA ACTACCGATTGAATGGCTCG TTCACTAGATCAGACAGAGT CTCCCACCCGTGTTTACTGT GCTTTCTTCATCGATGCCT

aflR1 forward aflR1 reverse nested aflR2 forward aflR2 reverse nortaq-1 nottaq-2 Probe norprobe ASPU Fl2r Forward Reverse

PCR

600

Mayer et al., 2003

Sugita et al., 2004 Bu et al., 2005

87

(continued)

TABLE 3.1 (continued)

88

Target species

Toxins produceda

A. niger

see A. niger

A. niger

see A. niger

A. niger

see A. niger

A. nomius

A. ochraceus

Kojic acid, tenuazonic acid, aflatoxin B1, B2, G1, G2, aspergillic acid Penicillic acid, ochratoxin A, xanthomegnin, viomellin, vioxanthin see A. ochraceus

A. ochraceus

see A. ochraceus

A. parasiticus

kojic acid, aspergillic acid, aflatoxin B1, B2, G1, G2 see A. parasiticus

A. ochraceus

A. parasiticus

DNA target

Assay type

Size (bp)

Primer nameb

Primer sequence 50 ! 30

rRNA gene, ITS1 region rRNA gene, ITS1–5.8SITS2 region RAPD marker

PCR

n.s. 420

ACTACCGATTGAATGGCTCG ACGCTTTCAGACAGTGTTCG TCCGTAGGTGAACCTGCG CCGGAGAGAGGGGACGGC

Sugita et al., 2004

PCR

ASPU Ni1r ITS1 NIG

PCR

372

PCR, quantitative real-time PCR (TaqMan)

n.s.

CAGTCGTCCAGTACCCTAAC GAGCGAGGCTGATCTAAGTG CGAGTGTAGGGTTCCTAG CGA CCGGCGGCCTTGC 6-FAM-TCCCACCCGTGTTTA CTGTACCTTAGT TGCT T-TAMRA

Sartori et al., 2006

rRNA gene, ITS-region

OPXF372 OPXR372 *AflavF1 *nomiR1probe *AflavP1

AFLP marker (AJ511647)

PCR, quant. realtime PCR (LightCycler)

260

OCA-V OCA-R

ATACCACCGGGTCTAATGCA TGCCGACAGACCGAGTGGATT

Schmidt et al., 2003

rRNA gene, ITS1–5.8SITS2 region polyketide synthase gene, KS domain apa-2 gene

PCR

400

OCRA1 OCRA2

CTT CCT TAG GGG TGG CAC AGC GTT GCT TTT CAG CGT CGG CC

Patino et al., 2005

PCR

690

AoOTA-L AoOTA-R

CAT CCT GCC GCA ACG CTC TAT CTT TC CAA TCA CCC GAG GTC CAA GAG CCT CG

Dao et al., 2005

PCR

1032

APA-450 APA-1482

TAT CTC CCC CCG GGC ATC TCC CGG CCG TCA GAC AGC CAC TGG ACA CGG

Shapira et al., 1996

ver-1 gene

PCR

895

VER-496

ATG TCG GAT AAT CAC CGT TTA GAT GGC CGA AAA GCG CCA CCA TCC ACC CCA ATG CGA GTG TAG GGT TCC TAG CGA GCC CGG GGC TGA CG TCC CAC CCG TGT TTA CTG TAC CTT AGT TGC T T

Shapira et al., 1996

VER-1391 A. parasiticus A. sojae

Kojic acid, aspergillic acid, aflatoxin B1, B2, G1, G2

rRNA gene, ITS-region

PCR, quant. realtime PCR (TaqMan)

n.s.

*AflavF1 *AparaR3 probe *AflavP1

References

Gonzalez-Salgado et al., 2005

Haugland and Vesper, 2000

Haugland and Vesper, 2000

A. terreus

A. terreus

Terrein, patulin, citrinin, citreoviridin, territrem see A. terreus

rRNA gene, ITS region

quant. real-time PCR (TaqMan)

n.s.

*AterrF1 AterrR1 probe *AterrP1

DNA toposiomer ase II gene rRNA gene, ITS-region

PCR

386

ATRF81 ATRR120

quant. real-time PCR (TaqMan)

n.s.

*AustsF1 *AustsR probe *AustsP1

TTA CCG AGT GCG GGT CTT TA CGG CGG CCA GCA AC FAM-AAC CTC CCA CCC GTG ACT ATT GTA CCT TG-TAMRA TAC CTT CAA GCC TGA CTA CG ACC TGC TCG GCC AGT TTG CTG

Haugland and Vesper, 2000

Haugland and Vesper, 2000

A. ustus

austamide, austdiol, austins, austocystins

A. versicolor

see. A. versicolor

rRNA gene, ITS-region

quant. real-time PCR (TaqMan)

n.s.

*AversF2 *AversR1 probe *AversP1

A. versicolor

b-tubulin gene

PCR

127

Chaetomium globosum

sterigmatocystin, nidulotoxin chaetoglobosins, chetomin

rRNA gene, ITS region

quant. real-time PCR (TaqMan)

n.s.

AspBTF AspBTR *CglobF1 *CglobR1 probe *CglobP1

Cladosporium herbarum

epi- and fagicladosporic acid

rRNA gene, ITS region

quant. real-time PCR (TaqMan)

n.s.

*CherbF1 *CherbR1 probe *CherbP1

Claviceps purpurea

Ergot alkaloids

PCR

275

Fusarium acuminatum

Antibiotic Y, chlamydosporol, trichothecenes type A, enniatins, moniliformin antibiotic Y, chlamydosporol, fusarin C, moniliformin, enniatins

b-tubulin gene, intron 3 600-bp RAP D marker

PCR

602

BT3 BTPUR2 FAC-F FAC-R

GAT CAT TAC CGA GTG CAG GTC T GCC GAA GCA ACG TTG GTC FAM-CCC CCG GGC AGG CCT AAC C-TAMRA CGGCGGGGAGCCCT CCATTGTTGAAAGTTTTGACTGATTTTA FAM-AGACTGCATCACTCT CAGGCATGAAGTTCAG-TAMRA CAT CCA TTT CAG ATG GTA TTT CCT TGT TTT GAT CGA GTC TTG GAC G CCGCAGGCCCTGAAAAG CGCGGCGCGACCA FAM-AGATGTATGCTACTAC GCTCGGTGCGACAG-TAMRA AAGAACGCCCGGGCTT CGCAAGAGTTTGAAGTGTCCAC FAM-CTGGTTATTCATAACCCTT TGTTGTCCGACTCT G-TAMRA TCTAGA(G/T)GT (A/G)CCCATACCGGCA GGCTGGAGAATGTCCCACAA GGGATATCGGGCCTCA GGGATATCGGCAAGATCG

PCR

920

FaF FaR

CAAGCATTGTCGCCACTCTC GTTTGGCTCTACCGGGACTG

F. avenaceum

RAPD marker

Kanbe et al., 2002

Haugland and Vesper, 2000

Dean et al., 2005 Haugland and Vesper, 2000

Haugland and Vesper, 2000

Tooley et al., 2001 Williams et al., 2002

Lees, 1995 Doohan et al., 1998

89

(continued)

90

TABLE 3.1

(continued)

Target species

Toxins produceda

DNA target

Assay type

Size (bp)

Primer nameb

Primer sequence 50 ! 30

F. avenaceum

see F. avenaceum

RAPD marker

PCR

220

JIAf JIAr

GCTAATTCTTAACTTACTAGGGGCC GTGTAATAGGTTATTTACATGGGCG

F. avenaceum

see F. avenaceum

RNA gene, ITS region

PCR

314

FAF1 FAR

AACATACCTTAATGTTGCCTCGG-ROX ATCCCCAACACCAAACCCGAG

F. avenaceum

see F. avenaceum

quant. real-time PCR (TaqMan)

n.s.

Waalwijk et al., 2004b

see F. avenaceum

quant. real-time PCR (TaqMan)

85

avenaceum MGB-F avenaceum MGB-R avenaceum MGB probe TMAVf TMAVr TMAVp

CCATCGCCGTGGCTTTC CAAGCCCACAGACACGTTGT ACGCAATTGACTATTGC

F. avenaceum, F. arthrosporioides

RAPD marker of Lees, 1995 in Doohan et al., 1998 RAPD marker

Straumfors Halstensen et al., 2006a

F. avenaceum, F. tricinctum

antibiotic Y, chlamydosporol, fusarin C, moniliformin, enniatins, butenolide, chrysogine, visoltricin culmorin, fusarin C, trichothececenes type B, zearalenone, butenolide, chrysogine

RAPD marker

PCR

345

Fa-U17f Fa-U17r

AGATCGGACAATGGTGCATTATAA GGCCCTACTATTTACTCTTGCTTTTG FAM-CTCCTGAGAGGTC CCAGAGATGAACATAACTTC-TAMRA CAAGCATTGTCGCCACTCTC GTTTGGCTCTACCGGGACTG

RAPD marker

PCR

842

CRO-Af CRO-Ar

CTCAGTGTCCACCGCGTTGCGTAG CTCAGTGTCCCAATCAAATAGTCC

Yoder and Christianson, 1998

F crookwellense

References Turner et al., 1998 Straumfors Halstensen et al., 2006b Mishra et al., 2003

Schilling et al., 1996 Turner et al., 1998; Simpson et al., 2001

F. crookwellense, F. culmorum

see F. crookwellense

RAPD marker

PCR

897

CRO-Cf CRO-Cr

TATTGGGATCTATCCAAGTCTTGT AAGCAGGAAACAGAAACCCTTTCC

F. culmorum

culmorin, fusarin C, trichothececenes type B, zearalenone, butenolide, chrysogine

RAPD marker

PCR

472

OPT18F OPT18R

GATGCCAGACCAAGACGAAG GATGCCAGACGCACTAAGAT

F. culmorum

see F. culmorum

RAPD marker

quant. PCR (competitive)

570

Fc01F Fc01R

ATGGTGAACTCGTCGTGGC CCCTTCTTACGGCAATCTCG

F. culmorum

see F. culmorum

PCR

245

F. culmorum

see F. culmorum

quant. real-time PCR (TaqMan)

n.s.

see F. culmorum

nested PCR

368

175F 430R culmorum-MGB-F culmorum MGB-R culmorum MGB probe FculAF FculAR nested FculBF FculBR

TTTTAGTGGAACTTCTGAGTA T-FAM AGTGCAGCAGGACTGCAGC TCACCCAAGACGGGAATGA GAACGCTGCCCTCAAGCTT FAM-CACTTGGATATATTTCC-TAMRA

F. culmorum

rRNA gene, ITS region RAPD marker of Nicholson et al., 1998 RAPD marker of Schilling et al., 1996

F. culmorum

see F. culmorum

F. culmorum

see F. culmorum

F. culmorum high DON producing isolates

see F. culmorum

255

TGCCAGACCAAGACGAAGTGAGAG TGAACTGCCACTCCGTTGCAAGTG TTGATCAAACCATCATCATC AGAAAGGGTTAGAATCATGC

RAPD marker of Lees, 1995 in Doohan et al., 1998 b-tubulin gene

Quant. Real-time PCR (TaqMan)

131

Fc131s2 forw. Fc131s2 rev. Fc131s2-MGB probe

GTACCAGAGCACGGCGTTG TCGCTCTCGATCAAAAGAAGG FAM-ACAAGTCCCCTCGACGTG-TAMRA

PCR

296

tri5-tri6 intergenic region

PCR

200

bt1 bt2 N1–2 N1–2R

GGTAACCAAATCGGTGCTGCTTTC GATTGACCGAAAACGAAGTTG CTTGTTAAGCTAAGCGTTTT AACCCCTTTCCTATGTGTTA

Yoder and Christianson, 1998 Schilling et al., 1996 Chelkowski et al., 1999; Knoll et al., 2000; Williams et al., 2002; Tan and Niessen, 2003; Agodi et al., 2005; Brandfass and Karlovsky, 2006 Nicholson et al., 1998; Simpson et al., 2001 Mishra et al., 2003 Waalwijk et al., 2004b

Klemsdal and Elen, 2006 Straumfors Halstensen et al., 2006b Leisova et al., 2006

Pinson-Gadais et al., 2007 Bakan et al., 2002

91

(continued)

TABLE 3.1 (continued)

92

DNA target

Assay type

Size (bp)

Primer nameb

Primer sequence 50 ! 30

tri5-tri6 intergenic region RAPD marker

PCR

650

4056 3551

ATCCCTCAAAAACTGCCGCT ACTTTCCCACCGAGTATTTC

Bakan et al., 2002

PCR

332

UBC85F UBC85R

GCAGGGTTTGAATCCGAGAC AGAATGGAGCTACCAACGGC

gaoA gene

PCR

898

GaoA-V2 GaoA-R2

AGGGACAATAAGTGCAGA ACTGTGCACTGTCGCAAGTG

F. graminearum

culmorin, fusarin C, trichothecenes type B, zearalenone, butenolide, chrysogine see F. graminearum

Schilling et al., 1996 Chelkowski et al., 1999; Gargouri et al., 2001; Obradovic et al., 2001; Williams et al., 2002; Straumfors Halstensen et al., 2006b Niessen and Vogel, 1997

RAPD marker

quant. PCR (competitive)

400–500

Fg16F Fg16R

CTCGGGATATGTTGCGTCAA GGTAGGTATCCGACATGGCAA

F. graminearum

see F. graminearum

b-tubulin gene

quant. real-time PCR (TaqMan)

111

Fgtubf Fgtubr probe FGtubTM

F. graminearum

see F. graminearum

RAPD marker of Nicholson et al., 1998

quant. real-time PCR (TaqMan)

n.s.

graminearum MGB-F graminearum MGB-R graminearum MGB probe GzTri7f1 GzTri7r1

GGTCTCGACAGCAATGGTGTT GCTTGTGTTTTTCGTGGCAGT FAM-ACAACGGAACGGCACCTCTGA GCTCCAGC-TAMRA GGCGCTTCTCGTGAACACA

Target species

Toxins produceda

F. culmorum low DON producing isolates F. graminearum group 2 isolates (F. pseudograminearum)

see F. culmorum

F. graminearum

culmorin, fusarin C, trichothecenes type B, zearalenone, butenolide, chrysogine

see F. graminearum

PCR

173–327

References

Nicholson et al., 1998 Simpson et al., 2001 Reischer et al., 2004

Waalwijk et al., 2004b

TGGCTAAACAGCACGAATGC AGATATGTCTCTTCAAGTCT GGCTTTACGACTCCTCAACAATGG AGAGCCCTGCGAAAG(C/T)ACTGGTGC

Lee et al., 2001

F. graminearum DON producing isolates F. graminearum DON producing isolates F. graminearum NIV producing isolates F. graminearum NIV producing isolates F. graminearum F. culmorum F. graminearum F. culmorum

see F. graminearum

PCR

243

Tri13F Tri13R

TACGTGAAACATTGTTGGC GGTGTCCCAGGATCTGCG

Waalwijk et al., 2003

PCR

161

GzTri7f1 GzTri7r1

GGCTTTACGACTCCTCAACAATGG AGAGCCCTGCGAAAG(C/T)ACTGGTGC

Lee et al., 2001

PCR

415

Tri13F Tri13R

TACGTGAAACATTGTTGGC GGTGTCCCAGGATCTGCG

Waalwijk et al., 2003

quant. PCR (competitive) PCR

340

Fgc17F Fgc17R CUL-Af

TCGATATACCGTGCGATTTCC TACAGACACCGTCAGGGGG TTTCAGCGGGCAACTTTGGGTAGA

Nicholson et al., 1998

CUL-Ar FEF1 FER1

AAGCTGAAATACGCGGTTGATAGG CATACCTATACGTTGCCTCG-Fluorescine TTACCAGTAACGAGGTGTATG

198F2 198R1 Tox5–1 Tox5-powd R Pfusf Flanr

GACAGCAAGATTGACCTTTTGG GACATACTCTACAAGTGCCAA GCTGCTCATCACTTTGCTCAG GGGATGTGGGGAATAACAAGGCC CCGCGCCCCGTAAAACG CTGGCGTGTRAAGGACAGATC

see F. graminearum

tri7 gene, inserted region tri13 gene

see F. graminearum

RAPD marker

see F. graminearum

RAPD marker

equisetin, fusarochromanone, trichothecenes type A & B, zearalenone, chrysogine see F. equiseti

rRNA gene, ITS region

PCR

389

RAPD marker

PCR

96

F. langsethiae F. sporotrichioides F. langsethiae F. sporotrichioides

see F. sporotrichioides

tri5 gene

PCR

400

see F. sporotrichioides

PCR

300

F. langsethiae F. sporotrichioides

see F. sporotrichioides

rRNA gene, ITS1–5.8SITS2 region rRNA gene

F. equiseti

F. equiseti

see F. graminearum

tri7 gene, inserted region tri13 gene

quant. real-time PCR (TaqMan)

380

77

Yoder and Christianson, 1998 Mishra et al., 2003

Nicholson et al., 2004 Niessen et al., 2004 Yli-Mattila et al., 2004

GAGCGTCATTTCAACCCTCAA GACCGCCAATCAATTTGGG

93

(continued)

94

TABLE 3.1

(continued)

Target species

F. oxysporum

Toxins produceda

DNA target

Assay type

Size (bp)

Primer nameb

Primer sequence 5 0 ! 30

TMLANf TMLANr TMLANp OF1 FOR1

FAM-AGCTTGGTGTTGGGATCTGT CCTTACCG-TAMRA

Straumfors Halstensen et al., 2006a Mishra et al., 2003

rRNA gene, ITS region

PCR

340

RAPD marker

PCR

220

Fp82F Fp82R

CAAGCAAACAGGCTCTTCACC TGTTCCACCTCAGTGACAGGTT

Parry and Nicholson, 1996

F. poae

Fusaric acid, naphthoquinone pigments, nectriafurone, monilifomin, gibepyrones Fusarinc, trichothecenes type B & B, butenolide, gamma-lactones see F. poae

tri5 gene

PCR

400

see F. poae

quant. real-time PCR (TaqMan)

n.s.

F. poae

see F. poae

FpoF ITS4

F. proliferatum

fumonisins, fusaric acid, fusarin C, moniliformin, naphthoquinone pigments, beauvericins, fusaproliferin, fusapyrone see F. proliferatum

RAPD marker of Parry and Nicholson, 1996 rRNA gene, ITS1–5.8SITS2 region mitochondrial rRNA gene, small subunit region

GCTGCTCATCACTTTGCTCAG TCGTGGTGAAACAAT GTA T AAATCGGCGTATAGGGTTGAGATA GCTCACACAGAGTAACCGAAACCT FAM-CAAAATCACCCAACCGACCCTTTCTAMRA CGGATCAGCCCGTCCTTC TCCTCCGCTTATTGATATGC

Niessen et al., 2004

F. poae

Tox5–1 Tox5-poae R poae 1-F poae 1-R poae probe

*FCORN2 *FPRO1

AAGTCTTCCAGTATGGGGGAG TAAACTAACTCAACTAGACGAG

F. poae

F. proliferatum

PCR

PCR

n.s.

PCR

585

ACATACCACTTGTTGCCTCG-HEX CGCCAATCAATTTGAGGAACG

References

Waalwijk et al., 2004b

Straumfors Halstensen et al., 2006b Beck and Barnett, 2003

Mule´ et al., 2004

F. pseudograminearum

F. pseudograminearum F. sambucinum

F. sambucinum

Culmorin, fusarin C, trichothecenes type B, zearalenone, butenolide, chrysogine see F. pseudograminearum trichothecenes type A, butenolide, enniatins see F. sambucinum

F. solani

Fusaric acid, naphthoquinone pigments

F. solani

see F. solani

calmodulin gene EF-1a gene

PCR

532

RAPD marker

PCR

779

RAPD marker

PCR

312

RNA gene, ITS region cutinase gene

PCR

315

PCR

189

rRNA gene, 18S region

nested PCR

744

rRNA gene, ITS2–28S region tri5 gene

PCR

F. sporotrichioides

Trichothecenes type A, butenolide, fusarin C see F. sporotrichioides

565 288

PCR

400

F. sporotrichioides

see F. sporotrichioides

rRNA gene, ITS1–5.8SITS2 region

PCR

300

F. sporotrichioides

PRO1 PRO2 Fp1–1 Fp1–2

CTTTCCGCCAAGTTTCTTC TGTCAGTAACTCGACGTTGTTG CGGGGTAGTTTCACATTC(C/T)G GAGAATGTGATGA(C/G)GACAATA

FPG-F FPG-R SAM-Ef SAM-Er

GTCGCCGTCACTATC CACTTTTATCTCTGGTTGCAG CAGAAGCGGAGCAAGTTCACAATC CAGAAGCGGATGGAGATGTAAAGT

FSF1 FSR1 forward reverse probe

ACATACCTTTATGTTGCCTCG-TAMRA GGAGTGTCAGACGACAGCT Alexandrakis et al., ATCGAGGACCTCGACTCG 1998 GCAGCAACGATCAAGCTA biotin-AGATCGCCGGAACTGTTCT GTTCGGCTACA AGGGATGTATTTATTAGATAAAAAATCAA Jaeger et al., 2000 CGCAGTAGTTAGTCTTCAGTAAATC

first roundPffor Pfrev2 second round Fusofor Fusorev FspITS2K P28SL Tox5–1 Tox5-sporo R2 Pfusf Fspor

CCAATGCCCTCCGGGGCTAAC GCATAGGCCTGCCTGGCG CTTGGTGTTGGGATCTGTGTGCAA ACAAATTACAACTCGGGCCCGAGA GCTGCTCATCACTTTGCTCAG TCAACTTCGGGATGTGGAGG CCGCGCCCCGTAAAACG ACTGTGTTTGCACACAGATC

Aoki and O’Donnell, 1999 Gargouri et al., 2001

Williams et al., 2002 Yoder and Christianson, 1998 Mishra et al., 2003

Kulik et al., 2004

Niessen et al., 2004 Yli-Mattila et al., 2004

95

(continued)

96

TABLE 3.1

(continued)

Target species

Toxins produceda

DNA target

Assay type

Size (bp)

Primer nameb

Primer sequence 50 ! 30

F. sporotrichioides

see F. sporotrichioides

tri13 gene

PCR

332

Fumonisins, fusaric acid, fusarin C, moniliformin, naphthoquinone pigments, beauvericin see F. subglutinans

RAPD marker

PCR

445

AAAAGCCCAAATTGCTGATG TGGCATGTTCATTGTCACCT GGCCACTCAAGAGGCGGAAAG GTCAGACCAGAGCAATGGGC

Demeke et al., 2005

F. subglutinans

AF330109CF AF330109CR 61–2F 61–2R

PCR

631

CTGTCGCTAACCTCTTTATCCA CAGTATGGACGTTGGTATTATATCTAA TGCAGATAATGAGGGTCTGC GGAACATTGGGCAAAACTAC CAAAGCGCTCCCTCAATCTCGTAC CAAAGCGCTCATCAACTCCATATA

Mule´ et al., 2004

PCR

SUB1 SUB2 1–3F 1–3R TOR-Bf TOR-Br VEN-Bf VEN-Br

GGCGGATAAGGATAGTGGTAGAAG GGCGGATAAGCAAATAAGATGCTT

FUS1 FUS2

CTTGGTCATGGGCCAGTCAAGAC CACAGTCACATAGCATTGCTAGCC

53–6F 53–6R *FCORN2 *FVERT1

TTTACGAGGCGGCGATGGGT GGCCGTTTACCTGGCTTCTT AAGTCTTCCAGTATGGGAAG TGGTGGACTAGTCTGAATCC

F. subglutinans F. subglutinans, F. nygamai F. torulosum

see F. subglutinans

calmodulin gene RAPD marker

see F. sambucinum

RAPD marker

PCR

608 550 664

F. venenatum

see F. sambucinum

RAPD marker

PCR

276

F. verticillioides

fragment from shotgun cloning

PCR

1600

F. verticillioides

Fumonisins, fusaric acid, fusarin C, moniliformin, naphthoquinone pigments, gibepyrones see F. verticillioides

RAPD marker

PCR

561

F. verticillioides

see F. verticillioides

mitochondrial rRNA gene, small subunit region

PCR

n.s.

References

Mo¨ller et al., 1999

Zheng and Ploetz, 2002 Yoder and Christianson, 1998 Yoder and Christianson, 1998 Murillo et al., 1998

Mo¨ller et al., 1999 Beck and Barnett, 2003

F. verticillioides

see F. verticillioides

F. verticillioides

see F. verticillioides

calmodulin gene fum1 gene

F. verticillioides

see F. verticillioides

Fum19 gene

F. verticillioides, fumonisin producing isolates F. verticillioides, fumonisin producing isolates F. verticillioides fumonisin producing isolates Fusarium spp. potential fumonisin producers

see F. verticillioides

fum1 gene

see F. verticillioides

Fusarium spp. potential fumonisin producers

PCR

587 69

VER1 VER2 PQF1-F PQF1-R

CTTCCTGCGATGTTTCTCC AATTGGCCATTGGTATTATATATCTA GAGCCGAGTCAGCAAGGATT AGGGTTCGTGAGCCAAGGA

Mule´ et al., 2004 Lo´pez-Errasquı´n et al., 2007

quant. real-time RTPCR (SYBR green 1) quant. real-time RTPCR (SYBR green 1) PCR

68

PQF19-F PQF19-R

ATCAGCATCGGTAACGCTTATGA ACTGTAAGTTGAGGAAGCCCTTGT

Lo´pez-Errasquı´n et al., 2007

250

Fum5–5F Fum5–6R

GAAATGGATCT(A/T)TTCGAGGC CCTTTCGATACATGCAGAAAG

Gonzalez-Jaen et al., 2004

rRNA gene, IGS region

PCR

n.s.

VERTF-1 VERTF-2

GCGGGAATTCAAAAGTGGCC GAGGGCGCGGAAACGGATCGG

Patino et al., 2004

see F. verticillioides

fum1 gene

PCR

354

FUM35F FUM35R

CTTGAACGCGGAGCTAGATTAT ATCCGTGTATGCATATGTCGAG

Sanchez-Rangel et al., 2005

Fumonisins, beauvericin, moniliformin, naphthoquinone pigments, fusaric acid, fusarin C, gibebyrones see fumonisin producers

rRNA gene, ITS1 region

PCR PCR-ELISA

108

int1 int2 probe

CCGAGTTTACAACTCCCAA ACAGAGTTTAGGGGTCCTCT biotin-ATCAGCCCGCTCCCGGTAA

Grimm and Geisen, 1998

fum1 gene

PCR

845

Fum5F Fum5R

GTCGAGTTGTTGACCACTGCG CGTATCGTCAGCATGATGTAGC

Bluhm et al., 2002

(continued)

97

TABLE 3.1

(continued)

98 Target species

Toxins produceda

Fusarium spp. potential trichothecene producers

Fusarium spp. potential trichothecene producers Fusarium spp. potential trichothecene producers Fusarium spp. potential trichothecene producers Myrothecium roridum, M. verrucaria

DNA target

Assay type

Size (bp)

Primer nameb

Primer sequence 50 ! 30

Trichothecenes type A & B, zearalenone, culmorin, fusarin C, butenolide, enniatin, beauvericin, chrysogine, gamma-lactones, chlamydosporol, antibiotic Y, equisetin, fusarochro manone, chrysogine see trichothecene producers

tri5 gene

PCR

658

Tox5–1 Tox5–2

GCTGCTCATCACTTTGCTCAG CTGATCTGGTCACGCTCATC

Niessen and Vogel, 1998; Schnerr et al., 2001; Tan and Niessen, 2003; Demeke et al., 2005; Agodi et al., 2005; Strausbaugh et al., 2005; PinsonGadais et al., 2007

tri5 gene

PCR

tr5F tr5R

AGCGACTACAGGCTTCCCTC AAACCATCCAGTTCTCCATCTG

Doohan et al., 1999

see trichothecene producers

tri6 gene

PCR

596

Tri6F Tri6R

CTCTTTGATCGTGTTGCGTC CTTGTGTATCCGCCTATAGTGATC

Bluhm et al., 2002

see trichothecene producers

tri5 gene

quant. real-time PCR (TaqMan)

76

TMTrif TMTrir TMTrip

verrucarins, roridins, satratoxins, mycotoxins, roritoxins

rRNA gene, ITS region

PCR, quant. real-time PCR (TaqMan)

n.s.

*MyroF1 *MyroR1 *MyroP1

CAGCAG(A/C)T(A/G)CTCAAGGTAGACCC Straumfors Halstensen et al., AACTGTA(C/T)AC(A/G)ACCATGCCAAC 2006a VIC-AGCGACTACAGGCTTCCC TCCAAACAAT-TAMRA AGTTTACAAACTCCCAAACCCTTT Haugland and GTGTCACTCAGAGGAGAAAACCA Vesper, 2000 FAM-CGC CTG GTT CCG GGC CC-TAMRA

References

PCR

520

AoLC35- 12L AoLC35–12R

GCCAGACCATCGACACTGCATGCTC CGACTGGCGTTCCAGTACCATGAGCC

Dao et al., 2005

PCR, quant. realtime PCR (TaqMan)

n.s.

*PvariF1 *PvariR1probe *PvariP1

Haugland and Vesper, 2000

idh gene

PCR

600

IDH1 IDH2

CCCGCCGTGGTTCAC GTTGTTGAAAGTTTTAATTGATTGATTGT FAM-CTCAGACGGCAACCTTCCAGGCATAMRA CAATGTGTCGTACTGTGCCC ACCTTCAGTCGCTGTTCCTC

rRNA gene, ITS region

PCR, quant. realtime PCR (TaqMan)

n.s.

*PbrevF1 *PbrevP1 probe *Pbrev P1

Haugland and CCTTGTTGCTTCGGCGA Vesper, 2000 TCAGACTACAATCTTCAGACAGAGTTCTAA FAM-CCTGCCTTTTGGCTGCCGGG-TAMRA

rRNA gene, ITS-region

PCR, quant. realtime PCR (TaqMan)

n.s.

*PcitrF1 *PcitrR1probe PcitrP2

tryptoquivalins

cyp51 gene

PCR

750

Pri-207 Pri-38c

Haugland and CCGTGTTGCCCGAACCTA Vesper, 2000 TTGTTGAAAGTTTTAACTAATTTCGTTATAG FAM-CCCCTGAACGCTGTCTGAAGTTGCATAMRA TAGCTCCAAAACAAATCGTCTGGC Hamamoto et al., CACTTGATCTGCCCTGTTAACA 2001

roquefortine C, patulin, citrinin, communensins, chaetoglobosin C ochratoxin A, anacine, verrucolone

polygalact uronase gene

PCR

404

PEF PER

ATCGGCTGCGGATTGAAAG AGTCACGGGTTTGGAGGGA

Marek et al., 2003

otapksPN gene

quant. real-time PCR (TaqMan)

n.s.

otapkstaq1 otapkstaq2 probe otapks PNprobe

CACGGTTTGGAACACCACAAT TGAAGATCTCCCCCGCCT

Geisen et al., 2004

ochratoxin A/ citrinin producers

ochratoxin A, citrinin and others

Paecilomyces variotii

patulin, viridoxin

Patulin producers

patulin, roquefortine C, citrinin, communesins, chaetoglobosin C botryodiploidin, mycophenolic acid, Raistrick phenols, brevianamide A citrinin, tanzawaic acid A

P. brevicompactum, P. alberechii

P. citrinum, P. westlingi

P. digitatum, DMI resistant isolates P. expansum

P. nordicum

polyketide synthase gene, KS domain rRNA gene, ITS region

Paterson et al., 2000 Paterson, 2004, 2006

FAM-CGTACCAATCCCCATCCAGGGCTCTAMRA

99

(continued)

100 TABLE 3.1

(continued)

Target species

Toxins produceda

P. verrucosum

ochrtoxin A, citrinin, verrulolone, verrucins roquefortin C, isofumigaclavine A & B, PR-toxin, mycophenolic acid roquefortin C, isofumigaclavine A & B, PR-toxin, mycophenolic acid, patulin, penitrem A satratoxin G & H

P. roqueforti

P. roqueforti, P. carneum

Stachybotrys chartarum S. chartarum

satratoxin G & H

DNA target

Assay type

Size (bp)

Primer nameb

Primer sequence 50 ! 30

otanpsPN gene

PCR

800

otanps-for otanps-rev

AGTCTTCGCTGGGTGCTTCC CAGCACTTTTCCCTCCATCTATCC

Bogs et al., 2006

rRNA gene, ITS region

PCR, quant. realtime PCR (TaqMan)

n.s.

*PchryF1 *Pchry R2probe *PenP2

CGGGCCCGCCTTAAC TTAAATAATTTATATTTGT TCTCAGACTGCAT FAM-CGCGCCCGCCGAAGACA-TAMRA

Haugland and Vesper, 2000

rRNA gene, ITS1- 5.8SITS2 regions

PCR

300

ITS183 ITS401

CTGTCTGAAGAATGCAGTCTGAGAAC CCATACGCTCGAGGACCGGAC

Pedersen et al., 1997 Esberg Boysen, 1999; Williams et al., 2001

rRNA gene, 18S and ITS1 region rRNA gene, ITS1 region

PCR

210

IT51 StacR3

GATATGCTTAAGTTCAGCGGGTA TGCCACTCAGAGAATACTGAAA

quant. real-time PCR (TaqMan)

107

STAF1 STAR1 probe

GTTGCTTCGGGCGGGAAC TTTGCGTTTGCCACTCAGAG FAM-CTGCGCCCGGATCCAGGC-TAMRA

Haugland and Heckman, 1998 Li et al., 2001 Cruz-Perez et al., 2001

References

S. chartarum

satratoxin G & H

tri5 gene

PCR

445

S. chartarum

Satratoxin G & H

tri5 gene

PCR

n.s.

S. chartarum

Satratoxin G & H

tri5 gene

PCR

165

Trichoderma harzianum biotypes 2 und 4 Wallemia sebi

chrysophanol, koninginin A, trichorzianines A&B wallemiol A & B

RAPD marker

PCR

444

rRNA gene, 18S region

PCR, quant. real-time PCR

328

ScTox5–1 ScTox5–4 tri5S1 tri5S2 ST5F ST5R Th-F Th-R

GTCTATACTCGACAATAGTCC GTCCTTCTGAGAGAACACTA CCTCACCCTCAGATGTTGACATAC TCCTTGTAGAAGGACATGAGGTCA GTGGCAACCCGCAAAAGC TTGCTCTTTCTTGGAATATTTTGG CGGTGACATCTGAAAAGTCGTG TGTCACCCGTTCGGATCATCCG

Peltola et al., 2002

Wall-SYB7 Wall-SYB8

GATTGGATGACGTTATATTAT ACAACAAAATGTCGTACCG

Zeng et al., 2004

Koster et al., 2003 Dean et al., 2005 Chen et al., 1999

AGE ¼ agarose gel electrophoresis, BAL ¼ bronchoalveolar fluid, FAM ¼ 6-carboxyfluorescein label, MGB ¼ minor groove binder, n.s. ¼ not specified, RAPD ¼ randomly amplified polymorphic DNA, RT-PCR ¼ reverse transcription PCR, TAMRA ¼ 6-carboxytetramethylrhodamine label. a According to Frisvad and Thrane, 2004. b Primers marked with * are subject to patent.

101

102

Ludwig Niessen

(see Frisvad and Thrane, 2004), the source of the sequence used for primer design, type of assay applied, primer names and sequences, and the references of first publication as well as follow-up studies in which the respective primers were used. The following chapters provide an overview over the use of PCRbased systems available to date for molecular identification and detection of mycotoxin producing fungi.

A. Detection of aflatoxin producers Accordingly, the first systems were developed for producers of aflatoxins as the most potent compounds among the mycotoxins. The first PCR-based detection system for a mycotoxin-producing fungus was published by Tang et al. (1993) who described detection of Aspergillus flavus by nested PCR in human bronchoalveolar lavages. Their primers were based on the gene coding for alkaline protease, an enzyme with elastolytic activity which was suggested to function as a virulence factor during induction of allergic bronchopulmonary aspergillosis in A. fumigatus and other pathogenic Aspergillus species (Moser et al., 1994). However, this early publication aimed at A. flavus as a lung pathogen rather than as a toxin producer and can therefore not be regarded as the starting point of developments in PCRbased detection systems for mycotoxigenic fungi. Clearly focused at evaluation of toxigenic properties of Aspergillus species from section Flavi were two PCR assays published by Geisen (1996) and in a parallel publication by Shapira et al. (1996), which are therefore regarded as the first PCR-based assays for a mycotoxigenic fungus. Both authors used sequences of the same three genes involved in the biosynthesis of aflatoxins in A. flavus, A. parasiticus, and A. versicolor to design gene-specific primers. The assay published by Geisen (1996) made use of the three primer pairs in a multiplex PCR in which it was demonstrated that A. sojae and A. oryzae, both essentially identical with A. flavus but typically not producing aflatoxins, lack the nor-1 gene and that other non-aflatoxin producing A. flavus strains gave no rise to a PCR product with one or all of the primer pairs used. The feasibility of both copublished assays for detection of aflatoxin producers in contaminated corn (Shapira et al., 1996), cereals (Geisen et al., 1998), and figs (Fa¨rber et al., 1997) was demonstrated in follow-up studies. Mayer et al. (2003) used sequences of the nor-1 gene to set up primers and a probe for a TaqManTM real-time PCR assay with which A. flavus was quantified in contaminated food samples and cereals. Using a different concept for primer design and SYBR-Green I as a fluorescent dye, Bu et al. (2005) described a quantitative real-time PCR assay for A. flavus, among other medically important fungi, in pure cultures and medical specimens. Primers used were based on sequences from the ITS1–5.8S region of the

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

103

ribosomal RNA (rRNA) gene of A. flavus. Similar to the formerly mentioned work, the conventional PCR assay described by Sugita et al. (2004) made use of specific primers designed from the sequence of another part of the ITS1 region of the A. flavus rRNA gene to analyze medical samples. Besides the Aspergillus spp. mentioned above, A. nomius is another species in section Flavi which is known as a producer of aflatoxins but also of tenuazonic acid (Frisvad and Thrane, 2004), a compound typically produced by Alternaria tenuissima. Haugland and Vesper (2000) published primers for the diagnosis of a wide range of fungal species in a patent application. The system described for specific detection of A. nomius was based on sequences from the ITS region of the rRNA gene and was described together with a fluorescently labeled probe to be applied in a TaqMan assay for quantitative real-time PCR. No PCR-based detection assays have been described until presently for the rarely encountered aflatoxin producers A. bombycis, A. ochraceoroseus, and A. pseudotamari (Bennett and Klich, 2003).

B. Detection of trichothecene producers Trichothecenes are sesquiterpenoid mycotoxins which share the 12,13-epoxytrichothecene skeleton as the common structural feature. The presence or absence of an 8-keto moiety leads to differentiation of group B and group A trichothecenes, respectively, the latter of which have a valerianyl-, acetyl-, or hydroxyl moiety in that position. Furthermore, group C trichothecenes (macrocyclic trichothecenes) are differentiated by the presence of a macrolide ring system attached at position 4b and 15 of the trichothecene verrucarol (Grove, 1993). Trichothecenes are produced by species in the fungal genera Cryptomela, Fusarium, Myrothecium, Stachybotrys, Trichoderma/ Hypocrea, Trichothecium, and Verticimonosporium (Davis and Diener, 1987; Frisvad and Thrane, 2004; Turner and Aldridge, 1983). Toxins of the trichothecene type were also found to be produced by a hypocrealean epibiont of the plant species Baccharis cordifolia (Jarvis et al., 1991; Rosso et al., 2000). Fusarium spp., however, produce the widest variety of different trichothecene compounds among which the B-trichothecenes deoxynivalenol (DON) and nivalenol (NIV) as well as the A-trichothecenes T-2 toxin, HT-2 toxin, neosolaniol (NEOS), and diacetoxyscirpenol (DAS) are the most widespread and/or toxic compounds isolated from natural sources.

C. Trichothecene biosynthesis cluster genes as sequence source for primer design The genetics and regulation of trichothecene biosynthesis have been elucidated in detail in F. sporotrichioides (Hohn et al., 1993), Myrothecium roridum (Trapp et al., 1998), and F. graminearum (Gibberella zeae; Kimura et al., 2003).

104

Ludwig Niessen

Sequencing of parts of the trichothecene gene cluster was done for newly described species in the F. graminearum group, F. crookwellense, F. culmorum, F. lunulosporum, and F. pseudograminearum. The tri5 gene, which codes for trichodiene synthase catalyzing the first specific step in the biosynthesis of all known trichothecenes in all producing fungi, was particularly well characterized in many Fusarium spp., but also in Stachybotrys chartarum (Koster et al., 2003 direct submission to GenBank), M. roridum (Trapp et al., 1998), and in Trichoderma harzianum (Gallo, 2004). Niessen and Vogel (1998) aligned tri5 sequences of F. sporotrichioides, F. poae, F. sambucinum, and F. graminearum, which at that time were the only available data, to find two highly conserved regions in the gene. Primers designed to hybridize to the gene amplified a 658-bp product from 20 different species and varieties within Fusarium, including 1 odd strain of F. dlamini and Cladobotryum dendroides, the industrial producer of galactose oxidase which had previously been demonstrated to be a nonsporulating isolate of F. graminearum (Niessen and Vogel, 1997). Based on the same gene, Schnerr et al. (2001) designed primers which resulted in a smaller PCR product detecting essentially the same set of species as in Niessen and Vogel (1998) but with a better fit to application in quantitative real-time PCR. SYBR green I and a calibration curve produced with known concentrations of F. graminearum DSM 4527 DNA as a template was used to quantify DNA concentrations of trichothecene producers. The method was applied to analyze DNA in 300 naturally infected samples of wheat. Comparison of DNA concentrations with DON concentrations in the samples revealed a positive correlation between both parameters. Primers developed by Niessen and Vogel (1998) were applied in follow-up studies by various authors to detect the tri5 gene in pure cultures and in sample materials by conventional PCR (Agodi et al., 2005; Demeke et al., 2005; Tan and Niessen, 2003). Sequence information was also used to set up species-specific assays for identification, detection, and quantification of typical producers of trichothecene mycotoxins. During a project in which a polyphasic approach was applied to study the taxonomy of species within section Sporotrichiella of Fusarium, Niessen et al. (2004) developed tri5 gene-based primers to set up species-specific detection assays for F. langsethiae, which was described as a new species a result of that study (Torp and Nirenberg, 2004), F. kyushuense, F. poae, and F. sporotrichioides. The former and the latter species were identified as the major producers of A-type trichothecenes in cereals in Scandinavian countries (Torp and Langseth, 1999). The detection systems made use of a forward primer described in Niessen and Vogel (1998), which were combined to reverse primers binding specifically to the intron region of the tri5 gene in the respective species. Primer pairs were highly specific for identification of F. kyushuense, F. poae, and F. sporotrichioides. Due to the close taxonomical relation of F. langsethiae to the latter species, that fungus

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

105

could only be identified by using a combination of two separate PCR reactions. Primers were demonstrated to be useful for the detection of all the four species in inoculated barley and in naturally contaminated oats. Strausbaugh et al. (2005) set up a pair of tri5-directed primers for identification and quantification of F. culmorum with a TaqMan quantitative realtime PCR assay in the roots of wheat and barley plants. The test was highly sensitive in pure cultures and root materials. However, the authors stated that the designed primers fully cross-reacted with F. graminearum and F. pseudograminearum genomic DNA. S. chartarum (syn. S. atra) has been identified as a producer of satratoxins, a group of highly potent mycotoxins belonging to the macrocyclic trichothecenes. The fungus was identified as the source of mycotoxicosis in the so called ‘‘sick building syndrome,’’ a condition observed in individuals living or working in buildings with elevated aerial concentrations of fungal propagules which leads to severe health problems and has caused the death of children in some cases (Etzel et al., 1998). Straus and Wong published the DNA sequence of the tri5 gene of the fungus [GenBank, direct submission (1998), accession no. AF053926] which was subsequently used by Peltola et al. (2002) to design a species-specific pair of PCR primers for the identification of the toxigenic subgroup 1 of S. chartarum. Nontoxic strains and strains with low toxicity in a boar spermatozoa motility test were combined in subgroup 2 and did not give a product with the primer pair which thus was useful to distinguish the two taxonomical groups found in S. chartarum. The presence of two lineages in this fungus were later also found by Koster et al. (2003), who found two phylogenetically distinct lineages when testing genotypic variation of tri5, ITS, and two housekeeping genes in a geographically diverse distinct set of isolates. Also Dean et al. (2005) developed tri5-based primers for the identification of S. chartarum. The primers were combined with oligonucleotides specific for A. versicolor, P. purpurogenum, and Cladosporium spp., respectively, in a multiplex PCR assay. The authors state that the system might be useful to alert building occupants and remediators to the potential presence of mycotoxin-producing fungi in their indoor environment. However, the system was not demonstrated to work with drawn air samples. Besides tri5, other genes from the trichothecene biosynthesis cluster have also been used as the source of sequences to design species- and group-specific PCR primers. A group-specific PCR assay for the detection of trichothecene-producing Fusarium spp. involving primers binding to the tri6 gene, which codes for a transcription factor in the biosynthetic pathway of that group of toxins, was set up by Bluhm et al. (2002). The authors used the system together with primers for detection of fumonisin producers in pure cultures and artificially infected cornmeal with a sensitivity comparable to enzyme-linked immunosorbent assays. Bakan et al. (2002) applied intergenic sequences between the tri5 and

106

Ludwig Niessen

tri6 genes (transcription factor) to distinguish between high and low DON-producing isolates of F. culmorum through amplification of DNA fragments differing substantially in size in a duplex PCR. Testing of 17 and 13 isolates of high and low DON producers, respectively, revealed 100% correlation between producer type and the size of the amplicon produced in this assay. In order to differentiate DON- and NIV-producing chemotypes in F. graminearum, Lee et al. (2001) designed a pair of primers hybridizing adjacent to an inserted region present in the tri7 gene of the fungus. It was demonstrated that a 161-bp PCR product was produced from DNA of isolates producing NIV, whereas the product resulting with DNA isolated from DON-producing isolates was between 173 and 327 bp in size resulting from the presence of 2–16 copies of an 11-bp tandem repeat in that portion of the gene. Primers were used by Waalwijk et al. (2003) to study the incidence of both genotypes in wheat isolations of F. graminearum from the Netherlands. The PCR assay described by Lee et al. (2001) might prove very useful in differentiating both chemotypes in epidemiological studies in Asian countries, where both chemotypes occur but also could it be used in plant quarantine in the United States and Canada, where no NIV-producing isolates of F. graminearum have been observed (Mirocha et al., 1989). A primer pair hybridizing to sequences within the tri13 gene of the trichothecene gene cluster was published by Demeke et al. (2005). The gene codes for a cytochrome P450 monooxygenase for C-4 hydroxylation of trichothecenes. The screening of 85 samples of wheat, barley, oats, and corn from Canada revealed detection of F. sporotrichioides in 56% of samples analyzed. The comparison with results of a kernel-plating technique showed good correlations between both methods. However, most samples positive for F. sporotrichioides with PCR did not contain detectable concentrations of T-2 toxin or HT-2 toxin, the principal mycotoxins produced by the fungus. A much better correlation between PCR detection of fungal biomass and presence of detectable concentrations of a mycotoxin was found in this study for F. graminearum and DON. Also based on the nucleotide sequence of the tri13 gene, Waalwijk et al. (2003) published a pair of primers which gave rise to PCR products of different sizes in producers of DON and NIV, respectively, in the latter fungus and in F. culmorum. The authors noted a slight increase in the number of NIV genotypes in a comparative study of wheat isolations of both species from the years 2000 and 2001.

D. Other sequence sources for detection of trichothecene producers Various sequence sources other than genes from the trichothecene biosynthesis pathway were used to set up PCR-based systems for identification and detection of trichothecene producers. Highly specific

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

107

identification of F. graminearum was demonstrated by Niessen and Vogel (1997) who used the gaoA gene published for C. dendroides NRRL 2903, which is the source of industrial production of galactose oxidase. The authors demonstrated that F. graminearum strains not only contained a 100% homologous gene but most strains tested showed galactose oxidase activity in a microplate assay. Using the gaoA-specific primer pair in a triplex PCR assay, Knoll et al. (2000) demonstrated the usefulness of the method for detection of trichothecene producers in contaminated wheat. The same gaoA-specific primers were used by Knoll et al. (2002) in an assay involving DNA Detection Test StripsTM for rapid detection of the PCR product without agarose gel electrophoresis. Another alternative detection and quantification method was used by Niessen et al. (1998), who employed the gaoA-specific primers in a solid phase PCR assay using the DIAPOPS technology (Chevrier et al., 1993). One of the primers was covalently bound to microwell material, thereby fixing the product during PCR. The detection of solid phase-bound product was done in a colorimetric assay using a sequence-specific biotinylated hybridization probe and streptavidin-coupled alkaline phosphatase with 4-nitrophenylphosphate as the substrate. The system was sensitive enough to detect an equivalent of 300 copies of the target gene even in a 100-fold excess of wheat DNA as background. The authors did not demonstrate usefulness of their system to detect F. graminearum DNA in contaminated sample material. Two different housekeeping genes were used as the sequence sources for the development of PCR identification and detection systems for trichothecene-producing Fusarium spp. The gene coding for elongation factor 1a (EF-1a) was used by Aoki and O’Donnell (1999) as the sequence source for a PCR assay detecting F. pseudograminearum, a species formerly recognized as the heterothallic group 1 population of F. graminearum. The primers were shown to be highly specific for the identification of the target species. Gargouri et al. (2001) applied the assay to screen Gibberella zeae isolates obtained from plants with wheat foot rot collected at different climatic regions in Tunisia. F. pseudograminearum (F. graminearum group 1) was mostly detected in samples grown under semiarid low land conditions. Reischer et al. (2004) aligned sequences of the beta tubulin gene from several isolates of F. graminearum and of closely related species as well as Fusarium spp. frequently found as part of the Fusarium Head Blight complex and extracted a primer pair for the specific identification of the former species. TaqMan quantitative real-time PCR technology was used to quantify F. graminearum in field inoculated wheat plants with high sensitivity and a dynamic range of six orders of magnitude of target DNA concentrations. As in aflatoxin producers, also producers of Fusarium toxins have been detected by PCR assay which were based on primers hybridizing to genes

108

Ludwig Niessen

coding for rRNA. Primer design is specifically facilitated by the availability of complete or partial rRNA sequences from public databases so that much work can be done in silico without the necessity of sequencing ones own DNA. Most authors used variable regions present within the internal transcribed spacers separating the genes coding for 18S rRNA and 5.8S rRNA (ITS1) and between the latter gene and the gene coding for 28S rRNA. Haugland and Vesper (2000) filed a patent with the US Patent and Trademark Office in which detection of a wide variety of fungal organisms based on rRNA sequences was claimed. All systems described in the text make use of group- or species-specific primer pairs derived from rRNA genes in combination with a specific detection probe. Probes were tagged with 6-FAM as the fluorochrome and TAMRA as a specific quencher to be used in TaqMan quantitative real-time PCR assays. Mishra et al. (2003) used the ITS region in the rRNA genes of F. avenaceum, F. culmorum, F. equiseti, F. oxysporum, and F. sambucinum to identify the target organisms in a fluorescent assay. Each forward primer used was marked with a different fluorescent dye in order to evaluate the presence of a PCR product by visual inspection of the PCR tubes. Kulik et al. (2004) designed a forward primer for identification of F. sporotrichioides which included a 30 mismatch in the ITS2 region of the rRNA gene which could be used to differentiate isolates of that species from closely related isolates. Combination of the forward primer with a reverse primer published earlier by Hue et al. (1999) resulted in a PCR assay, which was useful for identification of F. sporotrichioides pure cultures but also for detection of the toxin producer in plant tissue. As an alternative to the use of sequence information from defined genes, otherwise functionally defined DNA also sources of undefined origin can be used to set up specific PCR primers. Such undefined sequence sources can be generated by amplification of genomic DNA with short (decamer) oligonucleotide primers under quite unspecific conditions (Williams et al., 1990). The analysis results in production of a polymorphic pattern of few to several PCR fragments which are separated on an agarose gel. Since the pattern may differ between the taxonomic groups analyzed, single fragments can be used as species-specific markers. These markers are subsequently extracted from the gel and sequenced after cloning into an appropriate vector. Sequence information can be used to design specific PCR primers either by simple elongation of the decamer primers with the specific sequence or by designing new primers according to the internal sequence of the fragment. Assays using primers based on randomly amplified polymorphic DNA (RAPD) have been developed for the most toxic and widespread toxigenic species within Fusarium. Most of the assays were set up quite early during the development of the use of PCR as a diagnostic method in toxigenic fungi because little specific sequence information was available then.

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

109

Schilling et al. (1996) were among the first authors to report on the use of a PCR-based detection system for Fusarium species. They set up primers for the identification of F. culmorum, F. graminearum, and F. avenaceum which they used to detect the organisms in contaminated cereals. The primers for F. culmorum and F. graminearum proved to be highly specific for their targets. However, the system developed for F. avenaceum showed crossreaction with F. tricinctum, two species now known to be closely related taxonomically. Primers developed by Schilling et al. (1996) were used in various studies by other authors who found further proof for the usefulness of the system (Chelkowski et al., 1999; Gargouri et al., 2001; Obradovic et al., 2001; Williams et al., 2002). Only recently, Klemsdal and Elen (2006) used the complete sequence of the F. culmorum-specific 472-bp RAPD fragment described by Schilling et al. (1996) to design two new sets of primers which they used in a nested PCR to detect F. culmorum in a highly sensitive assay. This assay was applied to identification of pure cultures but also to the detection of the target species in inoculated field samples. Quite early during the development of the use of PCR for toxigenic Fusarium species, Nicholson et al. (1998) used internal competitors in defined concentrations to set up a quantitative PCR for F. graminearum and also for F. culmorum, the major producer of DON in cereals. The system made use of a competitor fragment which was constructed to have binding sites for the forward and reverse primer but resulted in amplification of a fragment of different length and sequence so that it could be distinguished from the specific product by agarose gel chromatography. The intensity of the competitor band was used to calculate the amount of target DNA present in an unknown sample. Aimed at resolving the identity of the fungus used in the production of mycoprotein (Quorn), Yoder and Christianson (1998) applied RAPD to the taxonomic study of species within section Discolor of Fusarium. Several taxon-specific RAPD fragments were obtained and PCR identification systems were set up for F. crookwellense, F. culmorum, F. graminearum, F. sambucinum, F. torulosum, and F. venenatum, to which species the Quorn-producing strain was finally assigned.

E. Detection of ochratoxin A producers The following paragraphs of this chapter deal with PCR-based methods which were developed during recent years in order to provide analytical tools for detection and identification of those fungal organisms which were described as producers of ochratoxin A. Most of the systems were developed to analyze pure cultures or contaminated commodities to estimate toxicological hazards associated with a fungal strain. However, it is worthwhile to note that some of the diagnostic tools described in the following chapters were rather aimed at the

110

Ludwig Niessen

organisms in their role as human or animal pathogens than as sources of toxicosis. This is especially true for A. niger, a generally regard as safe (GRAS) fungus nowadays widely used in the industrial production of food enzymes and organic acids. Recent findings which show that between 3% and 10% of isolates in A. niger are able to produce ochratoxin A under favorable conditions might put some constraints to safety considerations when using that organism. However, Schuster et al. (2002) concluded that isolates can still be used in safe biotechnological applications provided that nontoxigenic properties have been properly tested. The PCR-based methods now available may provide useful tools to analyze either the taxonomic classification or even the mycotoxigenic potential of a given isolate. They will thus make both products and processes safer.

F. Primers targeted to anonymous genomic markers Anonymous genomic markers are sections within the genome, which are specifically linked to a taxonomical unit, a certain phenotype, or physiological property without being assigned to a defined genetic function. Typically they are generated either by treatment of the genomic DNA with restriction endonucleases, amplification of DNA regions flanked by microsatellites or other repetitive sequence elements, or amplification of DNA using short randomly priming oligonucleotides under low stringency conditions. All the different techniques available have in common that polymorphic banding patterns are generated which may be employed to distinguish taxonomical groups. Sequence information obtained from anonymous markers have widely been used to set up PCR primers for specific detection and identification of fungal organisms. The following sections provide information on how these techniques have been employed to set up species-specific detection systems for potentially OTA-producing fungi.

G. AFLP marker-based primers for A. ochraceus and A. carbonarius In analogy to the detection of trichothecene-producing Fusarium spp., anonymous genomic markers have also been applied as sequence source for primer design in PCR assays for producers of ochratoxin A. Amplified fragment length polymorphism (AFLP) is a molecular biological fingerprinting technique introduced by Vos et al. (1995) for genetic mapping of plants. Majer et al. (1996) appear to be the first who used the technique to detect genetic variation in fungi (Cladosporium fulvum and Pyrenopaziza brassicae). For a recent review of the AFLP technique, see Bensch

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

111

and Akesson (2005). In AFLP, genomic DNA of the organism under study is fragmented by restriction endonucleases (mostly EcoRI together with MseI) as a first step. In a second step, adapter oligonucleotides are ligated to the sticky ends of the resulting restriction fragments. Oligonucleotide primers incorporating the adapter sequence and one of either restriction sites are used to amplify all restriction fragments in a preamplification step. Preamplified product is used as the template in a second round PCR using oligonucleotides similar to the first round primers but with a 30 -end extension of one to three nucleotides which lead to selective amplification of only a fraction of the total preamplified fragments. Typically, about 100 fragments are amplified which are size separated by polyacrylamide gel electrophoresis (PAGE) and detected by either silver staining or a fluorescent dye attached to one of the primers. The resulting banding patterns can be normalized using internal and external size markers and compared using appropriate software packages. Data are used to set up phylogenetic trees, for taxonomical identification down to the level of strains or individuals, to study population structures, gene mapping, and linkage studies or marker analysis in all groups of organisms. Since AFLP fingerprints are highly reproducible, they can be stored in reference databases and used for species identification of unknown samples circumventing cumbersome multilocus sequencing. Schmidt et al. (2003, 2004a) used AFLP to detect specific markers for A. ochraceus and A. carbonarius. Both fungal species were found to be the predominant producers of OTA in green coffee (Martins et al., 2003; Pardo et al., 2004; Taniwaki et al., 2003). Moreover, the latter species has been identified as the major producer of that toxin in grapes (Battilani et al., 2003; Serra et al., 2003, 2006) and raisins (Abarca et al., 2003; Tjamos et al., 2004). Schmidt and coworkers compared strains of both species isolated from coffee-related sources as well as closely related taxa and demonstrated that the resulting AFLP fingerprints were quite distinct at the species level in both taxa. Several of the amplified fragments were found to be characteristic to either of the species and could be used as specific AFLP markers for A. ochraceus (Schmidt et al., 2003) and A. carbonarius (Schmidt et al., 2004a), respectively. The marker fragments were cloned and sequenced and primers designed from the sequenced markers enabled detection of both species. Specificity of the primers was tested with DNA of several different target strains as well as closely related Aspergillus and Penicillium spp. and DNA isolated from noninfected green coffee. Based on the A. ochraceus-specific primer pair, Schmidt et al. (2004b) set up a real-time PCR assay for quantitative estimation of A. ochraceus DNA. The authors used a LightCyclerTM (Roche diagnostics) system with SYBR Green I as the intercalating fluorescent dye to quantify the concentration of DNA of the fungus in 30 samples of naturally infected green coffee from various regions. The assay had a

112

Ludwig Niessen

detection limit of 4.7 pg per reaction compared to a detection limit of 400 pg per reaction in conventional PCR with detection in ethidium bromide-stained agarose gels. Correlation between the DNA concentration found with the assay and the OTA content of the respective samples was low (r ¼ 0.55) but statistically significant. Perrone et al. (2006) used AFLP to distinguish isolates of closely related Aspergillus section Nigri species derived from grapes and to compare the results with the OTAproducing capacities of the isolates under study. They found that isolates assigned to A. carbonarius, A. niger, and the morphologically indistinct A. tubingensis were clearly distinct by their AFLP fingerprint. Moreover, the authors demonstrated that 25% of the A. tubingensis strains analyzed were able to produce ochratoxin A in pure cultures with a proportion of toxin producers similar to that found in A. niger. From that result it was concluded that A. tubingensis strains may well account for OTA concentrations found in samples of Italian wine (Brera et al., 2005; Otteneder and Majerus, 2000; Pietri et al., 2001). Similar observations were made by Medina et al. (2005) who analyzed Aspergillus section Nigri isolates from Spanish grapes for their ability to produce OTA. In their study, 14% of the A. tubingensis isolates produced the toxin.

H. Detection of A. ochraceus and A. carbonarius with cDNA AFLP-based primers cDNA AFLP is a variation of the original protocol of Vos et al. (1995) in which expressed genes are analyzed rather than the complete genome of an organism (Bachem et al., 1996). Messenger RNA is isolated and used as a template for the preparation of cDNA by reverse transcription which then undergoes the regular AFLP procedure. In an attempt to spot genes differentially expressed under conditions promoting OTA production in A. ochraceus, Mu¨hlencoert (2004) used this technique to find expressed markers for genes involved in biosynthesis of the toxin. Most interestingly, Mu¨hlencoert et al. (2004) reported that OTA production in A. ochraceus NRRL 3174 depended on the initial pH of the culture broth (AM medium; Adye and Mateles, 1964) rather than on a specific combination of carbon and nitrogen source as is the case in P. nordicum (Fa¨rber and Geisen, 2004). OTA production in A. ochraceus NRRL 3174 grown at starting pH 5.0 was induced by shifting the medium to pH 6.5 after 80 h of cultivation. AFLP of cDNA produced from mycelia at different growth stages of cultures grown under the respective starting pH conditions resulted in four fragments which were present only under OTA permissive conditions. Two of the fragments were cloned successfully and sequenced. Pairs of PCR primers were designed from the nucleotide sequences of the 550-bp fragment 3 and the 470-bp fragment 4. PCR primers designed from the longer fragment 3 showed high specificity to

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

113

DNA isolated from various strains of A. ochraceus, whereas primers specific to fragment 4 revealed two products of different sizes with DNA of A. ochraceus (410 bp) and A. carbonarius (350 bp), respectively. Although Mu¨hlencoert (2004) demonstrated by reverse transcription quantitative real-time PCR analysis that both primer pairs amplified a specific product only from cDNA present under OTA-permissive conditions, neither fragment could be clearly assigned to a gene potentially involved in the biosynthesis of the toxin. The 30 -end of the sequence of fragment 3 shared limited similarity with some zinc finger proteins in Mus musculus. The only similarity to a fungal sequence was with the Nectria haematococca kinesin-related protein 1, which is involved in chromosome movement during the mitotic cell cycle.

I. RAPD marker-based primers for A. carbonarius and A. niger Fungaro et al. (2004) described the development of primers with high specificity to A. carbonarius, one of the major OTA producers in coffee (Buecheli and Taniwaki, 2002; Joosten et al., 2001; Magnani et al., 2005; Taniwaki et al., 2003). Fungaro et al. (2004) subjected strains of A. carbonarius, A. tubingensis, and A. niger to RAPD analysis. Primer OPX7 revealed informative patterns which resolved the three taxa. An 809-bp fragment differentiated A. carbonarius from the other species. Primers designed from the sequence of fragment OPX7809 resulted in amplification of an 809-bp PCR product exclusively from A. carbonarius DNA (see Table 3.1). However, primers could not distinguish between toxigenic and nontoxigenic isolates of that species. Based on the same methodology, Sartori et al. (2006) developed a pair of primers that lead to amplification of a 372-bp PCR product specifically with isolates of A. niger (see Table 3.1). In a multiplex PCR application, the authors combined three primer pairs for the simultaneous detection of A. ochraceus (primers OCA-V/R; Schmidt et al., 2003), A. carbonarius (primers OPX7F809/OPX7R809; Fungaro et al., 2004), and A. niger (Sartori et al., 2006) in DNA mixtures as well as in artificially and naturally infected green coffee beans using a CTAB extraction protocol originally described for leaf tissue (Doyle and Doyle, 1987). Sartori et al. (2006) state that their assay was the first to detect A. niger in a species-specific assay. However, reviewing the literature revealed that three different pairs of primers had already been described for that purpose in earlier publications. The earliest was by Kanbe et al. (2002) who used the topoisomerase II gene as their sequence source for primer design. Sugita et al. (2004) described successful use of a primer pair designed upon the ITS1 sequence of A. niger to amplify a PCR product of nonspecified length in a speciesspecific assay. The former two primer pairs were developed for medical applications, whereas Gonzalez-Salgado et al. (2005) and Sartori et al. (2006)

114

Ludwig Niessen

had their focus on detection of A. niger in vine berries. However, none of the earlier publications gave proof of applicability of the respective assays to detect the target fungus in contaminated sample materials.

J. Primers targeted to genetically defined sequences Nucleotide sequences of a great variety of fungal genes can be readily retrieved from sequence databases, for example, GenBank, RefSeq, or PDB, opening the opportunity to develop and even test PCR primers in silico by searching for sequence similarities with the 130 billion bases (as of April 2006) accessible with the Entrez Nucleotide database and the BLAST tool (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi? db=Nucleotide). The hits produced by this in silico hybridization already provide a good estimate of the range of taxa covered by the primers under development. Of course, this kind of approach does not prevent from testing the newly developed primers for specificity with genomic DNA isolated from several strains of the taxon under study as well as from closely related taxa. Also testing of the primers with DNA isolated from the matrix should be exercised when the assay will subsequently be applied to contaminated sample materials. In the following section of this chapter, several PCR assays are reviewed which use the nucleotide sequence of well-defined fungal genes in order to set up primers for detection and identification of potential OTA-producing fungi.

K. rRNA gene-based approaches for the PCR diagnosis of OTA-producing fungi rRNA genes are multicopy genes, varying in copy number from 50 to 300 between species; however, there is also considerable variation between isolates in certain fungal species (Howlett et al., 1997). Because of the higher copy numbers, assays based on rRNA genes tend to be more sensitive as compared to single copy genes. The presence of two distinct types of ITS2 sequences was described in isolates belonging to the Gibberella fujikuroi species complex (O’Donnell et al., 1998). Similar observations were made for Ascochyta spp., where Fatehi and Bridge (1998) demonstrated the presence of multiple PCR fragments of identical length but with significant sequence differences. This might pose problems when analyzing the results of a PCR in which one or both primers bind to that part of the rDNA. However, it is unknown to date if this is a general phenomenon or only restricted to the group where it was first described. The first PCR-based assay for detection of A. niger used sequences from the 18S rRNA gene as the target for primer binding ( Jimenez et al., 1999). The authors used primers originally published by Melchers et al. (1994),

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

115

which they applied to analyze the presence of the fungus in artificially contaminated cosmetic and pharmaceutical raw materials and products after an enrichment step. It has to be noted that the primer pair used in the studies was not designed for specific detection of A. niger but rather is genus specific for Aspergillus. These primers were not included in Table 3.1 of the current chapter since their application to naturally contaminated samples will show a high degree of false positive results from the presence of fungi other than A. niger. Specific variation within the ITS region of the rRNA gene was recently used to set up species-specific detection systems for species in Aspergillus section Nigri. In an attempt to develop a generic PCR assay for the recognition of the seven most frequently encountered opportunistic pathogens among Aspergillus spp., Sugita et al. (2004) successfully used ITS sequences as the source for primer development. During the study, species-specific assays were developed for detection of A. fumigatus, A. flavus, and A. niger as the most frequently occurring fungi in human pulmonary infections. In order to optimize the sensitivity of the assays developed, primers were used in a nested PCR with a pair of Aspergillusspecific primers for the first round and respective species-specific oligonucleotides as nested primers (see Table 3.1). However, the authors clearly did not intend to detect the latter fungus because of its toxigenic potential, rather they were interested in its role as inducer of pulmonary infections in humans. Aiming at the development of molecular biological tools to facilitate the discrimination of species within the Aspergillus section Nigri (black aspergilli), Gonzalez-Salgado et al. (2005) combined a generic forward primer hybridizing in the ITS1 region of the rRNA gene (ITS1; White et al., 1990) with various reverse primers to design PCR assays detecting and identifying A. niger, A. japonicus, A. heteromorphus, and A. ellipticus, respectively. Testing of the primers with a wide range of black aspergilli from different hosts and regions revealed specific reaction with strains of the respective species. However, the assay could not distinguish strains of A. niger from A. tubingensis, a feature which would be a great advantage because, according to the authors, only the former species produces OTA but is morphologically indiscernible from the latter. Digestion of the resulting PCR product with the restriction endonuclease RsaI, however, revealed that the 420-bp A. niger fragment was restricted into two portions of 345 and 76 bp, while the A. tubingensis product remained uncut. Two ITS-based assays specific for A. carbonarius and A. ochraceus, respectively, were developed by Patino et al. (2005). Both species are considered the most important producers of OTA in coffee (Taniwaki et al., 2003) and grapes (Cabenes et al., 2002) in warmer climates. Primer pairs were designed to bind to the ITS1 and ITS2 regions flanking the 5.8S rRNA gene in fungal genomes. The authors selected those parts of the

116

Ludwig Niessen

aligned sequences for primer design that displayed the maximum degree of bias between A. carbonarius and A. ochraceus. Although this strategy promises a high degree of specificity of the primers selected, it has the disadvantage of producing products of equal length in both PCR assays, which renders impossible their use in a multiplex assay for both species. However, multiplexing several primer pairs in one assay is highly recommended if PCR is going to be used as a screening tool in quality control because the number of tests run and the time needed for their performance must be kept as low as possible. The assays developed proved to be highly specific when tested with DNA of a wide range of nontarget organisms. However, no test was run using DNA isolated from noninfected matrix material, for example, coffee beans and grapes. The detection limit of 1–10 pg of purified DNA per assay demonstrated the high sensitivity of the method developed.

L. Calmodulin gene-targeted primers for detection of A. carbonarius and A. japonicus Calmodulin is a CALcium MODULated proteIN (Cheung, 1970) abundantly present in the cytoplasm of all eukaryotic cells. Its structure has been highly conserved during evolution. It confers calcium sensitivity on a number of different enzymes including Ca2þ/calmodulin-dependent protein kinases involved in the regulation of the mycotoxin, aflatoxin, in A. parasiticus ( Jayashree et al., 2000). Similar to rRNA genes, b-tubulin (benA) or elongation factor 1a (EF-1a), the calmodulin (cmdA) gene provides highly conserved as well as variable sequence regions suitable for development of species-specific PCR primers. The positions of the variable regions within the gene are highly stable in eukaryotes. Based on the alignment of a partial sequence of representative strains of A. carbonarius, A. japonicus, and A. aculeatus, Perrone et al. (2004) detected a high degree of homology between strains assigned to A. carbonarius (99.98%) and A. japonicus/A. aculeatus (99.40%), respectively. This fact provides further evidence for identity of the latter two species. Apart from highly conserved regions, the authors identified three variable regions suitable for design of specific PCR primers. Sequences of cmdA within the A. niger group isolates showed only 89% homology between isolates and no sequences were found which distinguished all A. niger group isolates from other OTA producers analyzed during the study. Primer pairs designed for detection of A. carbonarius (CARBO1/CARBO2, see Table 3.1) and for A. japonicus/A. aculeatus were found to be highly specific for their respective target when tested with DNA from closely related Aspergillus spp. of sections Nigri and Circumdati. The detection of A. carbonarius DNA was demonstrated to be highly sensitive in an optimized PCR assay with a detection limit of 12.5 pg of DNA per reaction.

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

117

The assay was demonstrated to be useful in screening vast numbers of isolates of black aspergilli from grapes in order to evaluate the toxigenic potential connected with this commodity. Based on the same gene, Mule` et al. (2006) recently published a quantitative real-time PCR using the TaqMan chemistry for quantification of A. carbonarius. Primers were chosen to amplify a shorter fragment of the gene as compared to Perrone et al. (2004) and a specific probe was designed to detect the PCR product in a fluorescence assay. Primers and probe were demonstrated to be highly specific for detection of A. carbonarius DNA and the system was applied in the detection and quantification of the fungus in samples of grapes. Quantification of the A. carbonarius DNA content and the concentrations of OTA were shown to be highly correlated (R2 ¼ 0.918) in 15 grape samples analyzed. Therefore, the system might prove to be useful for future quality control and HACCP testing during growth of grapes and production of wine and grape products.

M. Primers for OTA biosynthetic pathway genes Following the biosynthetic pathway proposed by Huff and Hamilton (1979), the presence of various enzymes catalyzing key reactions in the formation of OTA can be anticipated (see Niessen et al., 2005). A polyketide synthase can be postulated to link together the building block C2-bodies of the isocumarine portion of the toxin. Also some kind of cyclase will be necessary to build a closed ring system from a polyketide chain. An enzymatic activity can be anticipated to be necessary for chlorination of the isocumarine body to result in OTa, the actual precursor of OTA, and finally an enzyme with peptide synthase activity must be postulated to link together OTa and phenylalanine to result in OTA as the toxic end product. As with several other mycotoxins, for example, trichothecenes, aflatoxins, and fumonisins, it might further be anticipated that the genes coding for these enzymes as well as genes coding for possible regulators and transporters will form a cluster of genes in close physical vicinity within the fungal genome (for review see Keller and Hohn, 1997). Based on the aforementioned assumptions, Geisen et al. (2004) applied a reverse genetical approach to detect and characterize a polyketide synthase gene from OTA-producing Penicillium spp. They used generic primers LC3 and LC5 to amplify a 750-bp portion of a fungal polyketide synthase of the MSAS type (Bingle et al., 1999) from P. nordicum BFE487. The primers gave rise to a 750-bp fragment with DNA isolated from P. nordicum strains but not with the closely related P. verrucosum. The fragment was sequenced (GenBank accession no. AY196315) and compared to published sequences. It displayed homology to the polyketide synthase gene pksL2 from A. flavus (Feng and Leonard, 1998). After transferring the nucleotide sequence (the fragment contained one continuous

118

Ludwig Niessen

open reading frame) to an amino acid sequence, an even more stringent homology with different fungal polyketide synthases over the whole fragment length was observed. A nested specific primer pair (otapks 1 and otapks 2, see Table 3.1) was deduced from the identified nucleotide sequence and tested for specificity with DNA isolated from several food borne fungi as well as closely related P. verrucosum strains. The primers yielded a 500-bp PCR fragment exclusively with DNA from P. nordicum strains, whereas all other analyzed food-related fungi yielded negative results. TaqManÒ quantitative real-time PCR with a specific primer pair and a fluorogenic probe (see Table 3.1) was applied to monitor the growth kinetics of P. nordicum BFE487 in artificially inoculated wheat grains (Geisen et al., 2004). The results of that experiment showed congruence between growth kinetics established by counts of colony forming units (cfu) and quantitative real-time PCR (qRT-PCR). The same primers were applied by the authors to quantify the level of expression of the otapksPN gene during growth of P. nordicum BFE487 in artificially inoculated wheat (Geisen et al., 2004). Data were compared to concentrations of OTA found in the respective samples. It was demonstrated that OTA concentrations became detectable at day 4 of the experiment, when expression of the otapksPN gene was first detected by qPCR with cDNA. The levels of gene expression declined after day 8, when OTA concentrations were found to remain at a constantly high level. Using the qRT-PCR system described above, Geisen (2004) demonstrated that environmental parameters prevailing under food production conditions had a substantial influence on the expression of the otapksPN gene in P. nordicum and concluded that expression analysis of OTA biosynthetic key genes might be useful as a critical control point in HACCP concepts for the food industry. In order to isolate a genomic clone containing the complete otapksPN gene and additional adjacent genomic regions, a lambda phage genomic DNA gene bank was constructed (Karolewiez and Geisen, 2005). It was anticipated that the genes of the ochratoxin A biosynthetic pathway display similarly clustered organization as can be found in other secondary metabolite biosynthetic pathway genes, for example, aflatoxins (Yu et al., 2004). The 500-bp PCR product generated with primers otapks 1/otapks 2 was digoxigenin-labeled and used as a probe to screen the library. Five different phage clones were found to yield a hybridization signal with the probe, indicating that the otapksPN gene or at least a part of it was present in the fungal insert DNA. Excision of the inserted fragment from the multiple cloning site revealed a 10-kbp genomic DNA fragment of P. nordicum BFE487, which hybridized with the otapksPN gene probe. The fragment was completely sequenced. Karolewiez and Geisen (2005) detected four genes located on the fragment: asphPN (alkaline serine protease homologue), aspPN (alkaline serine protease), npsPN (nonribosomal peptide synthase), and otapksPN

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

119

(ochratoxin polyketide synthase). Two of these genes had homologies to genes which are to be anticipated to be present in the ochratoxin biosynthetic pathway as described above. The involvement of the otapksPN gene in the biosynthesis of OTA was demonstrated by knocking the gene out. The resulting transformant was unable to produce the toxin under conditions under which the parent wild type produced the metabolite. PCR primers were designed from each of the three open reading frames present on the 10-kbp genomic fragment. The primers designed from the sequence of a putative npsPN gene (GeneBank accession no. AY534879, coding for a non ribosomal peptide synthase) yielded a 750-bp PCR product from strains of both P. nordicum and P. verrucosum, whereas the primer pair derived from the otapksPN gene (GeneBank accession no. AY199315) yielded a 500-bp product exclusively with DNA isolated from strains of P. nordicum (Bogs et al., 2006). The latter two primer pairs were useful in differentiating P. verrucosum from P. nordicum by analyzing isolates with both PCR assays. The specificity of the designed primers was fully verified when target DNA isolated from various Penicillium spp. and other fungal contaminants typically occurring in food and feed-related sources were used as template in a PCR with otapksPN- and the otanpsPN-specific primer pairs. When the OTA-producing capabilities of P. nordicum and P. verrucosum strains isolated from cured meat and from meat production environments were compared to the results obtained with the otapksPN- and otanpsPNspecific primers, the latter PCR displayed positive reaction exclusively with strains capable of producing detectable amounts of OTA in pure culture (HPLC analysis). It must be noted here that none of the sequences described for the OTA biosynthetic pathway genes in P. nordicum have homologies with genes found in OTA-producing Aspergillus spp. In particular, no homologies were found between the sequences of the otapksPN gene and a polyketide synthase potentially involved in OTA biosynthesis in A. ochraceus as demonstrated by knockout experiments (O’Callaghan et al., 2003). Also, neither of the gene-specific primers described above for P. nordicum showed any cross-reactivity when tested with A. ochraceus or other OTA-producing Aspergillus spp., even under low stringency conditions (R. Geisen, personal communication). These results indicate that OTA biosynthesis in A. ochraceus, but also in other OTA-producing Aspergillus spp., might follow a different route as compared to Penicillium. During their studies on OTA biosynthetic pathway genes, O’Callaghan et al. (2003) did not only clone a polyketide synthase from A. ochraceus but cloned and sequenced several more differentially expressed cDNA fragments of yet unassigned origin from typical producers of OTA. Based on that work, University College Cork (Ireland) filed worldwide (WO 2004/072224 A2) as well as European (EP 1 592 705 A2)

120

Ludwig Niessen

patent applications based on an Irish priority application dated 12.03.2003 (IE 20030095). Claims cover the use of those sequences for the purpose of detecting OTA producers in pure cultures and sample materials as well as the use of those sequences for primer walking to uncover sequences beyond those already cloned. Finally, Dao et al. (2005) used a strategy similar to that described by Geisen (2004) to sequence the ketosynthase domain of a polyketide synthase gene in A. ochraceus NRRL 3174. According to the authors, part of their sequence (not accessible in GenBank at the time of writing this chapter) was identical with the sequence published by O’Callaghan et al. (2003) (accession no. AY272043). From the sequences obtained during their study, Dao et al. (2005) designed a PCR assay which specifically detected A. ochraceus (primers AoOTA-L/AoOTA-R, see Table 3.1) and another one for detection of fungi potentially able to produce OTA and the mycotoxin, citrinin, in a group-specific manner (primers AoLC35– 12L/AoLC35–12R, see Table 3.1). The spectrum of species detected by the latter assay comprised A. carbonarius, A. melleus, A. ochraceus, P. citrinum, and P. verrucosum, but also Monascus ruber as a typical producer of citrinin in food and feed, among other Monascus spp. (Wang et al., 2005). Detecting producers of both toxins may be an advantage because they can be found to be co-occurring in contaminated cereals (Vrabcheva et al., 2000). Primer pairs designed from the sequences of two unassigned DNA fragments cloned from A. ochraceus (presumably strain NRRL 3174 or M333) were patented by Evialis, a French-based company specialized in animal nutrition products. Patent application EP 1 329 521 A1 from 20.01.2003 was based on a French priority application (FR 0200682) of 21.01.2002 (Librihi, 2003). The claim covers the use of unassigned DNA sequences cloned from A. ochraceus and from P. viridicatum for the detection of fungi producing OTA or citrinin. Nucleotide–nucleotide BLAST search against the EMBL nucleotide data base revealed weak similarities of the sequences with fungal polyketide synthases. The specificity of the primer pairs S3/S4 and S5/S6 were identical with the primers described by Dao et al. (2005), with the former primers being specific for A. ochraceus and the latter group specific for producers of OTA and citrinin. However, primers described in the two publications are neither identical nor were the primers of Dao et al. (2005) based on the patented sequences, although the senior author of that publication is listed as inventor in EP 1 329 521 A1 (Librihi, 2003).

N. Detection of fumonisin producers Fumonisins are a group of mycotoxins produced by species within the G. fujikuroi complex. The major producing species are F. verticillioides, F. proliferatum, F. subglutinans, and F. nygamai (Bennett and Klich, 2003).

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

121

They affect animals by interfering with their sphingolipid metabolism (Merrill et al., 2001). Besides various animal diseases, they are suspected to be responsible for certain forms of human esophageal cancer observed in Transkai (South Africa), China, and Northeast Italy (Peraica et al., 1999; Sydenham et al., 1991). Moreover, fumonisin B1 has been associated with neural tube defects in experimental animals and may therefore be involved in cases of spina bifida in humans (Hendricks, 1999). The toxin has been assigned a 2B carcinogen status (probably carcinogenic to humans) by the International Research Agency for Cancer (IARC, 1993; Rheeder et al., 2002). As in other mycotoxin producers, genes involved in the biosynthesis and regulation of fumonisins are organized in clusters within the genome. Waalwijk et al. (2004a) studied the fumonisin gene cluster of F. proliferatum and found 19 genes to be involved in biosynthesis and regulation of the toxin. F. proliferatum (mating population D of G. fujikuroi Leslie, 1995) was isolated from rice, corn, and other cereals in tropical and subtropical countries (Samson et al., 2004). Beck and Barnett (2003) filed a patent to the US Patent and Trademark Office, in which primer pairs for the specific identification of F. proliferatum and F. verticillioides as the major fumonisin producers in corn were described. The system was based on the sequence of the small subunit of the mitochondrial rRNA gene of the fungus. No follow-up studies have been published in which the system was used for detection of F. proliferatum or F. verticillioides in contaminated sample materials. Using a partial sequence of the calmodulin gene from F. proliferatum, F. subglutinans, and F. verticillioides, Mule´ et al. (2004) designed specific primer pairs for the identification of the three species. The authors found their primers to be highly specific for the sensitive detection of the respective species in a screening of DNA from 150 strains, mainly isolated from maize in Europe and the United States. However, application of the primers to detection of the target species in sample materials was not reported. RAPD markers were used as the sequence source for development of PCR-based detection systems for F. verticillioides and F. subglutinans, both of which species produce fumonisins besides various other mycotoxins. Mo¨ller et al. (1999) set up a multiplex PCR in which primers for the detection of F. subglutinans and F. verticillioides were combined to analyze both species in contaminated maize samples. Decamer primers were applied in RAPD analysis of species within the G. fujikuroi complex. A 600-bp amplification fragment was found to be specifically produced with primer UBC18 and the sequence of the fragment was used as source for the design of a speciesspecific primer pair for F. verticillioides (assigned to F. moniliforme by the authors). PCR did not amplify a specific fragment with DNA from F. nygamai despite its high degree of similarity with the UBC18 RAPD fragment of both species. Zheng and Ploetz (2002) developed another

122

Ludwig Niessen

RAPD-based PCR which they applied in the screening of F. subglutinans isolates from the mango plant, Mangifera indica, where the fungus causes a destructive disease called mango malformation. Primers derived from an RAPD fragment generated with the arbitrary decamer primer OPZ5 were specific for the mango malformation isolates, which were not picked up by the primers published by Mo¨ller et al. (1999). Testing various isolates of different species within the G. fujikuroi complex showed that the system was specific for F. subglutinans and F. nygamai. DNA from the latter species resulted in amplification of a significantly shorter product with the primer pair developed by Zheng and Ploetz (2002). No application of the primers in contaminated sample material was demonstrated. Genomic markers of unknown function were used by Murillo et al. (1998) who used the sequence of cloned shotgun fragments of genomic F. verticillioides DNA to set up a primer pair which lead to amplification of a 1600-bp PCR product with DNA of that species. The assay was applied for identification of pure fungal cultures grown from infected maize tissues but was not applied directly for detection of the fungus in sample material. Mo¨ller et al. (1999) tested the primers developed by Murillo et al. (1998) for crossreaction with DNA isolated from representatives of other species from the G. fujikuroi complex and found that the expected 1600-bp product was also amplified with DNA from isolates of mating populations B, C, D, E, F, and also with F. nygamai and F. oxysporum DNA. It would therefore be of advantage to apply the primers described in Murillo et al. (1998) in screening for potential fumonisin producers rather than to screen for F. verticillioides alone. Attempts were made to use PCR in the analysis of the mycotoxigenic potential of fumonisin producers because it is well established that only a certain percentage of isolates are able to produce the toxin in vitro and in planta. Based on sequence differences within the intergenic region (IGS) of the rRNA gene between fumonisin-producing and nonproducing isolates of F. verticillioides, Patino et al. (2004) set up a PCR system which resulted in amplification of a fragment only with DNA from toxigenic isolates among 54 strains of F. verticillioides tested from different geographical regions and hosts. Since rRNA genes are multicopy genes, the assay developed with the primers was highly sensitive. Application of the primers for detection of fumonisin producing F. verticillioides in sample material was not demonstrated. Recently, two PCR-based assays were developed for the selective identification of fumonisin-producing isolates of F. verticillioides which used sequence information from genes involved in the biosynthesis of the toxin. Gonzalez-Jaen et al. (2004) analyzed the occurrence of the genes fum1 (¼fum5), fum6, and fum8 in species within the G. fujikuroi complex by Southern blot hybridization and found that the genes were only present in F. verticillioides, F. proliferatum, F. fujikuroi, and F. nygamai, which represent

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

123

the principal producers of fumonisins. The authors used the alignment of a partial genomic sequence of the fum1 genes and found similar phylogenetic relations among the four species as obtained with genes not related to fumonisin biosynthesis. Primers were derived from the sequence representing the b-ketoacyl reductase domain within the fum1 gene and tested for specificity with DNA of Fusarium species and Fusarium-related species including fumonisin-producing and nonproducing isolates of F. verticillioides. Primers appeared to be highly specific for F. verticillioides isolates which produced fumonisin in vitro, and it was assumed that the nonproducing isolates must have lost the fum1 gene or at least the part of it where PCR primers hybridize in fumonisin producers. No application of the primers for detection of fumonisin producers in sample materials was published. Recently, also Sanchez-Rangel et al. (2005) set up a PCR in which primers hybridized to the b-ketoacyl reductase domain of the fum1 gene in F. verticillioides. Similar to the results obtained by Gonzalez-Jaen et al. (2004), they were able to distinguish between fumonisin-producing isolates and nonproducing isolates of F. verticillioides with the primer pair designed. No amplification of a 354-bp PCR product occurred with DNA from other Fusarium spp. tested, even if closely related to the target species. The correlation of PCR results to in vitro fumonisin production of F. verticillioides revealed a number of cases in which a fum1 gene was detected but toxin concentrations produced were negligible or very low. A similar effect was not described by Gonzalez-Jaen et al. (2004); however, the number of isolates tested by these authors was rather small compared to what Sanchez-Rangel et al. (2005) published. The latter authors speculated that the principal ability of a F. verticillioides isolate to produce fumonisin will depend on the presence or absence of the fum1 gene but there might be other factors which are responsible for the concentrations finally produced. These concentrations might be too low to be detected by the analytical system they used. Besides PCR-based detection of single species of toxicologically relevant taxa within species, primers and assays were developed for the identification and detection of groups of species sharing fumonisin production as a common feature. Based on sequences of the fum1 gene, Bluhm et al. (2002) published a pair of primers with specificity for the identification of F. proliferatum together with F. verticillioides which they found to be useful for detection of these fungi in artificially contaminated cornmeal. The primers were applied in a multiplex PCR assay in which potential producers of fumonisins ( fum1 gene) were detected together with potential trichothecene producers (tri6 gene). In this assay, also a primer pair detecting Fusarium spp. at the genus level based on rRNA sequences (ITS) was integrated. No attempts were made, however, to apply the system in naturally contaminated sample material. Grimm and Geisen (1998) compared nucleotide sequences of the ITS1 region

124

Ludwig Niessen

within the rRNA genes of typical fumonisin-producing Fusarium species with those of species which do not produce that toxin. They found a high degree of homology but also some differences between the two groups of species analyzed. A pair of PCR primers and a biotinylated probe were designed which made use of those differences to specifically amplify a 108-bp fragment from typical fumonisin producers. For detection of the PCR fragment, Grimm and Geisen (1998) used a microplate-based method, enzyme-linked oligosorbent assay (ELOSA), in which a specific biotinylated capture probe was fixed to a microwell plate previously coated with streptavidin. PCR was done with a mastermix containing DIG-11-dUTP which was incorporated into the PCR product instead of dTTP to label it with digoxigenin. Labeled PCR product was then trapped specifically by binding to the immobilized probe and was subsequently detected by binding of a peroxidase-conjugated anti-DIG antibody. Enzyme activity leads to measurable changes in OD at 405 nm when a specific DIG-labeled PCR product had been amplified with the primers used and was bound to the specific capture probe. With this double specificity assay, F. verticillioides, F. proliferatum, F. nygamai, and F. napiforme were detected, whereas other Fusarium spp. and fungi from other genera tested did not give a signal. The assay was not used to quantify the biomass of fumonisin producers and it was not applied to detect target organisms in sample material.

O. Detection of patulin producers Patulin is a tetraketide mycotoxin which has been found to be produced by a variety of different fungi, most of which are referable to the ascomycete genera Byssochlamys and Eupenicillium. Also Aspergillus species (A. clavatus, A. giganteus, and A. terreus) have been found to be effective producers of the toxin. Frisvad and Filtenborg (1989) revised the taxonomy of terverticillate penicillia based on secondary metabolite profiles and found that two ecological groups of fungal species produce patulin: P. carneum, Paecilomyces varioti, and P. glandicola are producers mainly found in silage, P. coprobium, P. glandicola, P. vulpinum, P. clavigerum, and P. concentricum are producers among the coprophilic fungi. In foods, however, P. expansum and P. griseofulvum are the major producers of patulin with apples and unfermented apple juice being the main source of the toxin in human consumption. To prevent consumers from patulin contamination, the Joint Food and Agriculture Organisation-World Health Organisation Expert Committee on Food Additives has established a provisional maximum tolerable daily intake for the compound of 0.4 mg/kg bw per day (WHO, 1995). Patulin is regulated in the European Union at levels of 50, 25, and 10 mg/kg, respectively, in fruit juices and fruit nectar, solid apple products, and apple-based products for

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

125

infants and young children [Regulation (EC) No. 466/2001, amended by Regulation (EC) No. 455/2004]. The idh gene codes for an isoepoxidon dehydrogenase which catalyzes conversion of isoepoxydon to phylostine as a specific step in the biosynthesis of patulin (Sekiguchi and Gaucher, 1979). The sequence of a complete idh gene was published by Fedeshko (1992) and partial sequences are available on GenBank from B. nivea, P. griseofulvum, and P. expansum. Using the sequence of Fedeshko (1992), Paterson et al. (2000) set up a genespecific PCR for producers of patulin. Testing of various isolates of P. expansum revealed the presence of the idh gene and all isolates which produced patulin in vitro. Few of the P. brevicompactum isolates tested during the study obviously had the idh gene present, but these did not produce patulin under in vitro conditions. The authors demonstrated the usefulness of their primer pair to detect the gene in contaminated twigs, bark, soil, and fallen apples but failed to have a positive reaction in healthy apples picked just prior to analysis. No PCR product and patulin production was observed in several other Penicillium species tested. In a follow-up study, Paterson (2004) demonstrated that the idh gene is a quite widespread feature in the genus Penicillium but they also showed the gene to be present in Aspergillus, Paecillomyces, and Byssochlamys. The detection of the gene was in most cases improved if DNA extracts were diluted prior to PCR in order to reduce inhibitor effects and to enable proper product formation. Only recently, Paterson (2006) introduced results from a study in which the idh gene-specific primers were applied to the analysis of orchard soil as critical control point in an HACCP concept for the prevention of patulin contamination of apple products. Based on the nucleotide sequence of the polygalacturonase gene of P. expansum, Marek et al. (2003) designed a pair of primers which lead to amplification of a 404-bp PCR product specifically with DNA isolated from strains of this fungus. No product was amplified from various Penicillium spp. tested. The assay was sensitive to detecting DNA a concentration equivalent to 25 cfu of P. expansum. However, the detection of the fungus in contaminated food was not demonstrated by the authors. P. carneum and Pae. variotii are producers of patulin which frequently occur in silage and may therefore be dangerous as a contaminant of animal feed. The former species was taxonomically separated from P. roqueforti because of genotypical and chemotypical differences, with patulin produced by the new species P. carneum and P. paneum and not by P. roqueforti. The three species were not tested by Patterson (2004) for presence of an idh gene but it can be anticipated to be present in both new species. Pedersen et al. (1997) designed primers binding to the ITS region of isolates of both P. roqueforti and P. carneum so that both species were detected in complex food samples (cereals, cheese). The problem of detection a patulin nonproducer together with a patulin producer with the PCR

126

Ludwig Niessen

described was reduced by the fact that P. roqueforti produces other mycotoxins, for example, PR toxin and mycophenolic acid, so this species is also a hazardous fungus in foods were it can produce its toxins. A PCRbased detection system for A. terreus as another producer of patulin was published by Haugland and Vesper (2000) as a patent application. Primers were designed to bind to the ITS region of the rRNA gene of the fungus and were applied in quantitative real-time PCR using the TaqMan system with a species-specific probe.

II. CONCLUSIONS AND FUTURE PERSPECTIVES Reviewing the literature on PCR-based diagnosis of mycotoxinproducing fungi has shown that a tremendous toolbox of oligonucleotide primers has been developed during the last decade, which allows amplification of an appropriate DNA fragment from all of the relevant toxigenic fungi, and from many of the less relevant species, too. In many publications, specificity has been tested with a more or less extensive set of fungal species. However, some of the publications reviewed do not offer much detail regarding the spectrum of species picked up by a primer pair. It should therefore become standard procedure in future developments to test the cross-reactivity of a primer pair at least with the most closely related species. Building up a new assay should start with an in silico analysis of possible cross-reactions with the primers designed. This first check should give a gross overview over the spectrum of species which are to be tested for cross-reaction. Testing of a wide taxonomical spectrum becomes even more demanding if the target sequence for primer design was taken from genes coding for universal proteins, for example, TEF1a, b-tubulin, calmodulin, or genes coding for rRNA. The spectrum of species tested should at least take in account the fungi potentially occurring in sample materials which might be planned to be analyzed with the future assay and the DNA isolated from the sample itself if food or feed material is involved. Various PCR-based assays developed during the last decade used genes as sequence sources for primer design which were either present only in the target species but unrelated to mycotoxin biosynthesis, for example, gaoA in F. graminearum (Niessen and Vogel, 1997), or which were involved in the biosynthesis and regulation of the mycotoxins produced by the target species or group of species. Examples for assays developed along that line may be found for all of the mycotoxins of major concern, except for producers of zearalenone. Biosynthesis of that toxin is currently under investigation and various genes involved have recently been characterized (Gaffoor and Trail, 2006; Lysoe et al., 2006). The development of PCR-based detection systems based on those genes can therefore be anticipated in due course.

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

127

One of the major motivations for the development of PCR-based detection systems in many publications is the prospect of using the analysis to forecast the presence and concentrations of mycotoxins in sample material. One might therefore anticipate that assays based on mycotoxin biosynthetic genes might better fit that purpose as systems based on genes unrelated to their biosynthesis. However, in only a few cases has correlation between the presence of a PCR signal or its intensity and the presence or concentrations of certain mycotoxins been analyzed and in even fewer cases have positive correlations been established. At that point, the general question has to be raised, if PCR with genomic target DNA as a template is the technology of choice to estimate mycotoxin concentrations in sample materials. Given the fact that biosynthesis is a highly complex process with poorly understood regulation at the transcriptional level (other mechanisms as well?) and that it is highly influenced by environmental factors, it seems unlikely to find a highly positive correlation between the amplification signal and mycotoxin concentrations. A study of the literature reviewed here shows that in some cases such a correlation has been established with quantitative real-time PCR based on mycotoxin biosynthesis genes (Sarlin et al., 2006; Schnerr et al., 2002). However, similarly good correlations between results of quantitative real-time PCR and mycotoxin concentrations were found when primers were targeted to anonymous sequences (Leisova et al., 2006; Waalwijk et al., 2004b) or to sequences of a housekeeping gene (Mule` et al., 2006). Other authors found very poor correlation between the parameters (Schmidt et al., 2004b). Overall, this means that the prediction of mycotoxin concentrations using a PCR-based system is unlikely to work in a way that would allow for this technique to replace analysis of mycotoxins unless assays are developed which are based on the expression of genes involved in mycotoxin biosynthesis, that is, systems using cDNA as the target for amplification. Such a system has been developed by R. Geisens group at the Federal Institute for Nutrition in Karlsruhe, Germany. The system makes use of a microarray to which cDNA of genes involved in the production of OTA can be immobilized and visualized by fluorogenic detection probes. Good correlations of signals were found to fungal biomass but also to OTA produced under various environmental conditions. With the currently available systems for PCR-based detection and identification, however, qualitative information about the presence or absence of a certain fungus can be obtained and this should be used to advantage in food and feed quality control because the technology has the power to provide insights into the mycotoxigenic potential of analyzed samples. This information can then be used in order to decide whether samples should proceed down the process of production or should be retained for further analysis of mycotoxins. PCR-based multiplex systems

128

Ludwig Niessen

could be used to determine which mycotoxins to analyze, as recently introduced by Kristensen et al. (2006a,b) who used microarray technology and the SnaPshot technology to detect and differentiate 16 different mycotoxin-producing Fusarium spp. in multiplex assays. The latter platform offers the possibility of detecting very high numbers of different fungal species and groups of species in a short time and with limited work. The systems described above might show one possible way in which molecular detection of mycotoxigenic fungi may be utilized in order to optimize food and feed production processes for minimized risk of mycotoxin production. In analogy to computer aided manufacturing (CAM), this would be addressed as genome-aided processing (GAP) in food production. Still, enormous work has to be done in order to accomplish that state. However, keeping in mind that most of the developments described in this chapter were done in very recent years, GAP-based systems may yet become reality and be applied for the welfare of consumers.

REFERENCES Abarca, M. L., Accensi, F., Bragulat, M. R., Castella´, G., and Caban˜es, F. J. (2003). Aspergillus carbonarius as the main source of ochratoxin A contamination in dried vine fruits from the Spanish market. J. Food Prot. 66, 504–506. Adye, J., and Mateles, R. I. (1964). Incorporation of labelled compounds in aflatoxins. Biochim. Biophys. Acta 86, 418–420. Agodi, A., Barchitta, M., Ferrante, M., Sciacca, S., and Niessen, L. (2005). Detection of trichothecene producing Fusarium spp. by PCR: Adaptation, validation and application to fast food. Italian J. Public Health 3, 7–11. Alexandrakis, G., Jalali, S., and Gloor, P. (1998). Diagnosis of Fusarium keratitis in an animal model using the polymerase chain reaction. Br. J. Ophthalmol. 82, 306–311. Aoki, T., and O’Donnell, K. (1999). Morphological and molecular characterization of Fusarium pseudograminaearum sp. nov., formerly recognized as the Group 1 population of F. graminearum. Mycologia 91, 597–609. Atoui, A., Mathieu, F., and Lebrihi, A. (2007). Targeting a polyketide synthase gene for Aspergillus carbonarius quantification and ochratoxin A assessment in grapes using realtime PCR. Int. J. Food Microbiol. 115, 313–318. Bachem, C. W. B., van der Hoeven, R. S., de Bruijn, S. M., Vreugdenhil, D., Zabeau, M., and Visser, R. G. F. (1996). Visualization of differential gene expression using a novel method of RNA fingerprinting based on AFLP: Analysis of gene expression during potato tuber development. Plant J. 9, 745–753. Bakan, B., Giraud-Delville, C., Pinson, L., Richard-Molard, D., Fournier, E., and Bryggo, Y. (2002). Identification by PCR of Fusarium culmorum strains producing large and small amounts of deoxynivalenol. Appl. Environ. Microbiol. 68, 5472–5479. Battilani, P., Pietri, A., Bertuzzi, T., Languisco, L., Giorni, P., and Kozakiewicz, Z. (2003). Occurrence of ochratoxin A-producing fungi in grapes grown in Italy. J. Food Prot. 66, 633–636. Bauer, J., and Gareis, M. (1987). Ochratoxin A in der Nahrungsmittelkette. J. Vet. Med. B 34, 613–627.

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

129

Beck, J. J., and Barnett, C. J. (2003). In ‘‘Detection of Fusarium species infecting corn using the polymerase chain reaction’’. p. 23U. S. Patent Application #200330113722, June 19, 2003. Bensch, S., and Akesson, M. (2005). Ten years of AFLP in ecology and evolution: Why so few animals? Mol. Ecol. 14, 2899–2914. Bennett, J. W., and Klich, M. (2003). Mycotoxins. Clin. Microbiol. Rev. 16, 497–516. Bingle, L. E. H., Simpson, T. J., and Lazarus, C. M. (1999). Ketosynthase domain probes identify two subclasses of fungal polyketide synthase genes. Fungal Genet. Biol. 26, 209–223. Bluhm, B. H., Flaherty, J. E., Cousin, M. A., and Woloshuk, C. P. (2002). Multiplex Polymerase Chain Reaction assay for the differential detection of trichothecene- and fumonisinproducing species of Fusarium in cornmeal. J. Food Prot. 65, 1955–1961. Bogs, C., Battilani, P., and Geisen, R. (2006). Development of a molecular detection and differentiation system for ochratoxin A producing Penicillium species and its application to analyse the occurrence of Penicillium nordicum in cured meat. Int. J. Food Microbiol. 107, 39–47. Brandfass, C., and Karlovsky, P. (2006). Simultoneous detection of Fusarium culmorum and F. graminearum in plant material by duplex PCR with melting curve analysis. BMC Microbiol 6:4 doi:10.1186/1471-2180-6-4, 10 pp. Brera, C., Soriano, J. M., Debegnach, F., and Miraglia, M. (2005). Exposure assessment to ochratoxin A from the consumption of Italian and Hungarian wines. Microchem. J. 79, 109–113. Bu, R., Sathiapalan, R. K., Ibrahim, M. M., Al-Mohsen, I., Almodavar, E., Gutierrez, M. I., and Bhatia, K. (2005). Monochrome LightCycler PCR assay for detection and quantification of five common species of Candida and Aspergillus. J. Med. Microbiol. 54, 243–248. Buecheli, P., and Taniwaki, M. H. (2002). Research on the origin, and on the impact of postharvest handling and manufacturing on the presence of ochratoxin A in coffee. Food Addit. Contam. 19, 655–665. Cabenes, F. J., Accens, F., Bragulat, M. L., Abarca, M. L., Castella, G., Minguez, S., and Pons, A. (2002). What is the source of ochratoxin A in wine? Int. J. Food Microbiol. 79, 213–215. Chelkowski, J., Bateman, G. L., and Mirocha, C. J. (1999). Identification of toxigenic Fusarium species using PCR assays. J. Phytopathol. (Berlin) 147, 307–311. Chen, X., Romaine, C. P., Ospina-Giraldo, M. D., and Royse, D. J. (1999). A polymerase chain reaction-based test for the identification of Trichoderma harzianum biotypes 2 and 4, responsible for the worldwide green mold epidemic in cultivated Agaricus bisporus. Appl. Microbiol. Biotechnol. 52, 246–250. Chen, R. S., Tsay, J. G., Huang, Y. F., and Chiou, R. Y. Y. (2002). Polymerase chain reactionmediated characterization of molds belonging to the Aspergillus flavus group and detection of Aspergillus parasiticus in peanut kernels by a multiplex polymerase chain reaction. J. Food Prot. 65, 840–844. Cheung, W. Y. (1970). Cyclic 30 ,50 -nucleotide phosphodiesterase: Demonstration of an activator. Biochem. Biophys. Res. Commun. 38, 533–538. Chevrier, D., Rasmussen, S. R., and Gues-Jon, J. L. (1993). PCR product quantification by non radioactive hybridization procedures using an oligonucleotide covalently bount to microwells. Mol. Cell. Probes 7, 187–197. Criseo, G., Bagnara, A., and Bisignano, B. (2001). Differentiation of aflatoxin-producing and non-producing strains of Aspergillus flavus group. Lett. Appl. Microbiol. 33, 291–295. Cruz-Perez, P., Buttner, M. P., and Stetzenbach, L. D. (2001). Specific detection of Stachybotrys chartarum in pure cultures using quantitative polymerase chain reaction. Mol. Cell. Probes 15, 129–138. Dao, H. P., Mathieu, F., and Lebrihi, A. (2005). Two primer pairs to detect OTA producers by PCR method. Int. J. Food Microbiol. 104, 61–66.

130

Ludwig Niessen

Davis, N. D., and Diener, U. L. (1987). Mycotixins. In ‘‘Food and Beverage Mycology.’’ (L. R. Beuchat, ed.), pp. 517–570. Avi, New York. Dean, T. R., Roop, B., Betancourt, D., and Menetrez, M. Y. (2005). A simple multiplex polymerase chain reaction assay for the identification of four environmentally relevant fungal contaminants. J. Microbiol. Methods 61, 9–16. Degola, F., Berni, C., Dall’Astra, C., Spotti, E., Marchelli, R., Ferrero, I., and Restivo, F. M. (2007). A multiplex RT-PCR approach to detect aflatoxigenic strains of Aspergillus flavus. J. Appl. Microbiol. 9 pp. doi:10.1111/j.1365–2672.2006.03256.x. Demeke, T., Clear, R. M., Patrick, S. K., and Gaba, D. (2005). Species specific PCR-based assays for the detection of Fusarium species and a comparison with the whole seed agar plate method and trichothecene analysis. Int. J. Food Microbiol. 103, 271–284. Doohan, F. M., Parry, D. W., Jenkinson, P., and Nicholson, P. (1998). The use of speciesspecific PCR-based assays to analyse Fusarium ear blight of wheat. Plant Pathol. 47, 197–205. Doohan, F. M., Weston, G., Rezanoor, H. N., Parry, D. W., and Nicholson, P. (1999). Development and use of a reverse transcription PCR assay to study expresdion of tri5 by Fusarium species in vitro and in planta. Appl. Environ. Microbiol. 65, 3850–3854. Doyle, J. J., and Doyle, J. L. (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19, 11–15. Esberg Boysen, M. (1999). In ’’Molecular Identification and quantification of the Penicillium roqueforti group‘‘, 154, Agraria Acta Universitatis Agriculturae Sueciae, Upsala (Doctoral Thesis, Swedish University of Agricultural Sciences) Upsala, 150 pp. Etzel, R. A., Montana, E., Sorensen, W. G., Kullman, G. J., Allan, T. M., and Dearborn, D. G. (1998). Acute pulmonary hemorrhage in infants associated with exposure to Stachybotrys atra and other fungi. Arch. Pediatr. Adolesc. Med. 152, 757–762. Etzel, R. (2002). Mycotoxins. JAMA 287, 425–427. Fa¨rber, P., and Geisen, R. (2004). Analysis of differentially-expressed ochratoxin A biosynthesis genes in Penicillium nordicum. Eur. J. Plant Pathol. 110, 661–669. Fa¨rber, P., Geisen, R., and Holzapfel, W. H. (1997). Detection of aflatoxinogenic fungi in figs by a PCR reaction. Int. J. Food Microbiol. 36, 215–220. Fatehi, J., and Bridge, P. (1998). Detection of multiple rRNA-ITS regions in isolates of Ascochyta. Mycol. Res. 102, 762–766. Fedeshko, R. W. (1992). Polyketide Enzymes and Genes, 2 vols. PhD thesis, University of Calgary, Canada. Feng, G. H., and Leonard, T. J. (1998). Culture conditions control expression of the genes for aflatoxin and sterigmatocystin biosynthesis in Aspergillus parasiticus and A. nidulans. Appl. Environ. Microbiol. 64, 2275–2277. Frisvad, J. C., and Filtenborg, O. (1989). Terverticillate penicillia: Chemotaxonomy and mycotoxin production. Mycologia 81, 837–861. Frisvad, J. C., and Thrane, U. (2004). Mycotoxin production by common filamentous fungi. In ‘‘Introduction to Food- and Airborne Fungi.’’ (R. A. Samson, E. S. Hoekstra, and J. C. Frisvad, eds), pp. 321–330. Centraalbureau voor Schimmelcultures, Utrecht. Fungaro, M. H. P., Vissotto, R. C., Sartori, D., Vilas-Boas, L. A., Furlanto, M. C., and Taniwaki, M. H. (2004). A molecular method for detection of Aspergillus carbonarius in coffee beans. Curr. Microbiol. 49, 123–127. Gaffoor, I., and Trail, F. (2006). Characterization of two polyketide synthase genes involved in zearalenone biosynthesis in Gibberella zeae. Appl. Environ. Microbiol. 72, 1793–1799. Gallo, A. (2004). Isolation and characterisation of a trichodiene synthase homologous gene in Trichoderma harzianum. Physiol. Mol. Plant Pathol. 65, 11–29. Gargouri, S., Hajlaoui, M. R., Guermech, A., and Marrakchi, M. (2001). Identicifation des espe`ces fongiques associe´es a` la pourriture du pied du ble et etude de leur re´partition selon les e´tages bioclimatques en Tunisie. EPPO Bull. 31, 499–503.

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

131

Geisen, R. (1996). Multiplex polymerase chain reaction for the detection of potential aflatoxin and sterigmatocystin producing fungi. Syst. Appl. Microbiol. 19, 388–392. Geisen, R. (2004). Molecular monitoring of environmental conditions influencing the induction of ochratoxin A biosynthesis genes in Penicillium nordicum. Mol. Nutr. Food Res. 48, 532–540. Geisen, R., Mulfinger, S., and Niessen, L. (1998). Detection of Aspergillus flavus in wheat by PCR. J. Food Mycol. 1, 211–218. Geisen, R., Mayer, Z., Karolewiez, A., and Fa¨rber, P. (2004). Development of a real time PCR system for detection of Penicillium nordicum and for monitoring of ochratoxin A production in foods by targeting the ochratoxin polyketide synthase gene. Syst. Appl. Microbiol. 27, 501–507. Gonzalez-Jaen, M. T., Mirete, S., Patino, B., Lopez-Errasquin, E., and Covadonga, V. (2004). Genetic markers for the analysis of variability and for production of specific diagnostic sequences in fumonisin-producing strains of Fusarium verticillioides. Eur. J. Plant Pathol. 110, 525–532. Gonzalez-Salgado, A., Patino, B., Vazquez, C., and Gonzalez-Jaen, M. T. (2005). Deserimination of Aspergillus niger and other Aspergillus species belonging to section Nigri by PCR assays. FEMS Microbiol. Lett. 245, 353–361. Gravesen, S., Frisvad, J. C., and Samson, R. A. (1994). In ‘‘Microfungi’’, p. 168. Munksgaard, Copbenhagen. Grimm, C., and Geisen, R. (1998). A PCR-ELISA for the detection of potential fumonisin producing Fusarium species. Lett. Appl. Microbiol. 26, 456–462. Grove, J. F. (1993). Macrocyclic trichothecenes. Nat. Prod. Rep. 10, 429–448. Hamamoto, H., Hasegawa, K., Nakaune, R., Lee, Y. J., Makizumi, Y., Akutsu, K., and Hibi, T. (2001). Tandem repeat of a transcriptional enhancer upstream of the sterol 14a-demethylase gene (CYP51) in Penicillium digitatum. Appl. Environ. Microbiol. 66, 3421–3426. Haugland, R. A., and Heckman, J. L. (1998). Identification of putative sequence specific PCR primers for detection of the toxigenic fungal species Stachybotrys chartarum. Mol. Cell. Probes 12, 387–396. Haugland, R. A., and Vesper, S. J. (2000). In ‘‘Method for identifying and quantifying specific fungi and bacteria’’, p. 29. US Patent and Trademark Office Patent #6,387,652, May 14, 2002. Hayette, M. P., Vaira, D., Susin, F., Boland, P., Christiaens, G., Melin, P., and de Mol, P. (2001). Detection of Aspergillus species DNA by PCR in branchoalveolar lavage fluid. J. Clin. Microbiol. 39, 2338–2340. Hendricks, K. (1999). Fumonisins and neural tube defects in south Texas. Epidemiology 10, 198–200. Hendry, K. M., and Cole, E. C. (1993). A review of mycotoxins in indoor air. J. Toxicol. Environ. Health 38, 183–198. Hohn, T. M., McCormick, S. P., and Desjardin, A. E. (1993). Evidence of a gene cluster involving trichothecene-pathway biosynthetic genes in Fusarium sporotrichioides. Curr. Genet. 24, 291–295. Howlett, B. J., Rolls, B. D., and Cozijnsen, A. J. (1997). Organisation of ribosomal DNA in the ascomycete Leptosphaeria maculans. Microbiol. Res. 152, 261–267. Hue, F. X., Huerre, M., Rouffault, M. A., and de-Bievre, C. (1999). Specific detection of Fusarium species in blood and tissues by a PCR technique. J. Clin. Microbiol. 37, 2434–2438. Huff, W. E., and Hamilton, P. B. (1979). Mycotoxins - their biosynthesis in fungi: Ochratoxins metabolites of combined pathways. J. Food Prot. 42, 815–820. International Agency for Research on Cancer (IARC) (1993). Toxins derived from Fusarium moniliforme: Fumonisins B1 and B2 and Fusarin C. In ‘‘IARC Monographs on the Evaluation of the Carcinogenic Risks to Humans: Some Naturally Occurring Substances: Food Items and Constituents, Heterocyclic Aromaotic Amines and Mycotoxins,’’ vol. 56, pp. 445–466. International Agency for Research on Cancer, Lyon, France.

132

Ludwig Niessen

Janardhanan, K. K., and Hussain, A. (1983). Studies on isolation, purification and identification of tenuazonic acid, a phytotoxin produced by Alternaria alternata (Fr.) Keissler causing leaf blight of Datura innoxia Mill. Mycopathologia 83, 135–140. Jaeger, E. E. M., Carrol, N. M., Choudhury, S., Dunlop, A. A. S., Towler, H. M. A., Matheson, M. M., Adamson, P., Okhravi, N., and Lightman, S. (2000). Rapid detectioin and identification of Candida, Aspergillus, and Fusarium species in ocular samples using nested PCR. J. Clin. Microbiol. 38, 2902–2908. Jayashree, T., Praveen-Rao, J., and Subramanyam, C. (2000). Regulation of aflatoxin production by Ca2þ/calmodulin-dependent protein phosphorylation and dephosphorylation. FEMS Microbiol. Lett. 83, 215–219. Jarvis, B. B., Mokhtari, R. N., Schenkel, E. P., Barros, C. S., and Matzenbacher, N. I. (1991). Trichothecene mycotoxins from Brazilian Baccharis spp. Phytochemistry (Oxford) 30, 789–798. Jimenez, L., Bosko, Y., Smalls, S., Ignar, R., and English, D. (1999). Molecular detection and identification of Aspergillus niger contamination in cosmetic/pharmaceutical raw materials and finished products. J. Rapid Methods Autom. Microbiol. 7, 39–46. Joosten, H. M. L. J., Goetz, J., Pittet, A., Schellenberg, M., and Bucheli, P. (2001). Production of ochratoxin A by Aspergillus carbonarius on coffee cherries. Int. J. Food Microbiol. 65, 39–44. Kampelmacher, E. H. (1973). Since Eve ate apples. Can. J. Public Health 64, 231–237. Kanbe, T., Yamaki, K., and Kikuchi, A. (2002). Identification of the pathogenic Aspergillus species by nested PCR using a mixture of specific primers to DNA topoisomerase II. Microbiol. Immunol. 46, 841–848. Karolewiez, A., and Geisen, R. (2005). Cloning a part of the ochratoxin A biosynthetic gene cluster of Penicillium nordicum and characterization of the ochratoxin polyketide synthase gene. Syst. Appl. Microbiol. 28, 588–595. Keller, N., and Hohn, T. M. (1997). Metabolic pathway gene clusters in filamentous fungi. Fungal Genet. Biol. 21, 17–29. Kimura, M., Tokai, T., O’Donnell, K., Ward, T. J., Fujimura, M., Hamamoto, H., Shibata, T., and Yamaguchi, I. (2003). The trichothecene biosynthesis gene cluster of Fusarium graminearum F15 contains a limited number of essential pathway genes and expressed nonessential genes. FEBS Lett. 27, 105–110. Klemsdal, S. S., and Elen, O. (2006). Development of a highly sensitive nested-PCR method using a single closed tube for detection of Fusarium culmorum in cereal samples. Lett. Appl. Microbiol. 42, 544–548. Knoll, A., Niessen, L., and Vogel, R. F. (2000). Application of a PCR protocol for the diagnosis of trichothecene producing Fusarium species in deoxynivalenol contaminated wheat. Mycotoxin Res. 16A, 240–243. Knoll, A., Vogel, R. F., and Niessen, L. (2002). Identification of Fusarium graminearum in cereal samples by DNA Detection Test Strips TM. Lett. Appl. Microbiol. 34, 144–148. Koiso, Y., Natori, M., Iwasaki, S., Sato, S., Sanoda, R., Fujita, Y., Yaegashi, H., and Sato, Z. (1994). Ustiloxin: A phytotoxin and a mycotoxin from false smut balls on rice panicles. Tetrahedron Lett. 33, 4157–4160. Konstantinova, P., Bonants, P. J. M., van Gent-Pelzer, M. P. E., van der Zouwen, P., and van der Bulk, R. (2002). Development of specific primers for detection and identification of Alternaria spp. in carrot material by PCR and comparison with blotter and plating assays. Mycol. Res. 106, 23–33. Koster, B., Scott, J., Wong, B., Malloch, D., and Straus, N. (2003). A geographically diverse set of isoltates indicates two phylogenetic lineages within Stachybotrys chartarum. Can. J. Bot. 81, 633–643. Kristensen, R., Berdal, K. G., and Holst-Jensen, A. (2006a). Simultaneous detection and identification of trichothecene- and moniliformin-producing Fusarium species based on multiplex SNP analysis. J. Appl. Microbiol. pp. 11. doi:10.1111/j.1365–2672.2006.03166.x.

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

133

Kristensen, R., Gauthier, G., Berdal, K. G., Hamels, S., Remacle, J., and Holst-Jensen, A. (2006b). DNA micorarray to detect and identify trichothecene- and moniliformin-producing Fusarium species. J. Appl. Microbiol. pp. 11. doi: 10.1111/j.1365–2672.2006.03165.x. Kulik, T., Fordonski, G., Pszczolkowska, A., Plodzien, K., and Lapinski, M. (2004). Development of PCR assay based on ITS2 rDNA polymorphism for the detection and differentiation of Fusarium sporotrichioides. FEMS Microbiol. Lett. 239, 181–186. Lee, T., Oh, D. W., Kim, H. S., Lee, J., Kim, Y. H., Yun, S. H., and Lee, Y. W. (2001). Identification of deoxynivelenol- and nivalenol-producing chemotypes of Gibberella zeae by using PCR. Appl. Environ. Microbiol. 67, 2966–2972. Lees, A. (1995). Diagnosis and Control of Foot Rot Pathogens of Wheat. Open University, PhD thesis. Buckinghamshire, UK. Leisova, L., Kucera, L., Chrpova, J., Sykorova, S., Sip, V., and Ovesna, J. (2006). Quantification of Fusarium culmorum in wheat and barley tissue using real-time PCR in comparison with DON content. J. Phytopathol. 154, 603–611. Leslie, J. F. (1995). Gibberella fujikuroi: Available populations and variable traits. Can. J. Bot. 73 (Suppl. 1), S281–S291. Li, S., Hartman, G. L., Jarvis, B. B., and Tak, H. (2001). A Stachybotrys chartarum isolate from soybean. Mycopathologia 154, 41–49. Librihi, A. (2003). In ‘‘Proce´de´ de de´tection de champignons producteurs d’ochratoxine A ou de citrinine’’, 35 pp. EP 1 329 521 A1, 23.07.2003. Lo´pez-Errasquı´n, E., Va´zquez, C., Jime´nez, M., and Gonza´lez-Jae´n, M. T. (2007). Real-Time RT-PCR assay to quantify the expression of fum1 and fum19 genes from the fumonisinproducing Fusarium verticillioides. J. Microbiol. Methods 68, 312–317. Lysoe, E., Klemsdal, S. S., Bone, K. R., Frandsen, R. J. N., Johansen, T., Thrane, U., and Giese, H. (2006). The PKS4 gene of Fusarium graminearum is essential for zearalenone production. Appl. Environ. Microbiol. 72, 3924–3932. Magnani, M., Fernandes, T., Prete, C. E. C., Homechim, M., Ono, E. Y. S., Vilas-Boas, L. A., Sartori, D., Furlaneto, M. C., and Fungaro, M. H. P. (2005). Molecular identification of Aspergillus spp. isolated from coffee beans. Scientia Agricola 62, 45–49. Manonmani, H. K., Anand, S., Chandrashekar, A., and Rati, E. R. (2005). Detection of aflatoxingenic fungi in selected food commodities by PCR. Process Biochem. 40, 2859–2864. Marek, P., Thirunavukkarasu, A., and Kumar, V. (2003). Detection of Penicillium expansum by polymerase chain reaction. Int. J. Food Microbiol. 89, 139–144. Martins, M. L., Martins, H. M., and Gimeno, A. (2003). Incidence of microflora and of ochratoxin A in green coffee beans (Coffea arabica). Food Addit. Contam. 20, 1127–1131. Majer, D., Mithen, R., Lewis, B. G., Vos, P., and Oliver, R. P. (1996). The use of AFLP fingerprinting for the detection of genetic variation in fungi. Mycol. Res. 100, 1107–1111. Mayer, Z., Bagnara, A., Fa¨rber, P., and Geisen, R. (2003). Quantification of the copy number of nor-1, a gene of the aflatoxin biosynthetic pathway by real-time PCR, and its correlation to the cfu of Aspergillus flavus in foods. Int. J. Food Microbiol. 82, 143–151. Medina, A., Mateo, R., Lopez-Ocana, L., Valle-Algarra, F. M., and Jimenez, M. (2005). Study of Spanish grape mycobiota and ochratoxin A production by isolates of Aspergillus tubingensis and other members of Aspergillus section Nigri. Appl. Environ. Microbiol. 71, 4696–4702. Melchers, W. J. G., Verweil, P. E., van den Hurk, P., van Belkum, A., de Pauw, B. E., Hoogkamp-Korstanje, J. A. A., and Meis, J. F. G. M. (1994). General primer-mediated PCR for detection of Aspergillus species. J. Clin. Microbiol. 32, 1710–1717. Merrill, A. H., Jr., Sullards, M. C., Wang, E., Voss, K. A., and Riley, R. T. (2001). Sphingolipid metabolism: Roles in signal transduction and desruption by fumonisins. Environ. Health Perspect. 109(Suppl. 2), 283–289. Mirocha, C. J., Pathre, S. V., Behrens, J., and Schauerhamer, B. (1978). Uterotropic activity of cis and trans isomers of zearalenone and zearalenol. Appl. Environ. Microbiol. 35, 986–987.

134

Ludwig Niessen

Mirocha, C. J., Abbas, H. K., Windels, C. E., and Xi, W. (1989). Variation in deoxynivalenol, 15-acetyldeoxynivalenol, 3-acetyldeoxynivalenol, and zearalenone production by Fusarium graminearum isolates. Appl. Environ. Microbiol. 55, 1315–1316. Mishra, P. K., Fox, R. T. V., and Culhan, A. (2003). Development of a PCR-based assay for rapid and reliable identification of pathogenic Fusaria. FEMS Microbiol. Lett. 218, 329–332. Mo¨ller, E. M., Chelkowski, J., and Geiger, H. H. (1999). Species-specific PCR assays for the fungal pathogens Fusarium moniliforme and Fusarium subglutinans and their application to diagnose maize ear rot disease. J. Phytopathol. (Berlin) 147, 497–508. Moser, M., Menz, G., Blaser, K., and Crameri, R. (1994). Recombinant expression and antigenic properties of a 32-kilodalton extracellular alkaline protease, representing a possible virulence factor from Aspergillus fumigatus. Infect. Immun. 62, 936–942. Mu¨hlencoert, E. (2004). In ’’Ochratoxin A production by Aspergillus ochraceus’’, pp. 124. Technische Universita¨t Mu¨nchen, Munic, Germanythesis, (http://mediatum.ub.tum. de/mediatum/servlets/MCRFileNodeServlet/mediaTUM_derivate_000000000001191/ mediaTUM_derivate_000000000001191.pdf ). Mu¨hlencoert, E., Mayer, I., Zapf, M. W., Vogel, R. F., and Niessen, L. (2004). Production of ochratoxin A by Aspergillus ochraceus. Europ. J. Plant. Pathol. 110, 651–659. Mule´, G., Susca, A., Stea, G., and Moretti, A. (2004). A species-specific PCR assay based on the calmodulin partial gene for identification of Fusarium verticillioides, F. proliferatum and F. subglutinans. Eur. J. Plant Pathol. 110, 495–502. Mule`, G., Susca, A., Logrieco, A., Stea, G., and Visconti, A. (2006). Development of a quantitative real-time PCR assay for the detection of Aspergillus carbonarius in grapes. Int. J. Food Microbiol. 111, S28–S34. Murillo, I., Cavallarin, L., and San-Segundo, B. (1998). The development of a rapid PCR assay for detection of Fusarium moniliforme. Eur. J. Plant Pathol. 104, 301–311. Muture, B. N., and Ogana, G. (2005). Aflatoxin levels in maize and maize products during the 2004 food poisoning outbreak in eastern province of Kenya. East Afr. Med. J. 82, 275–279. Nicholson, P., Simpson, D. R., Weston, G., Rezanoor, H. N., Lees, A. K., Parry, D. W., and Joyce, D. (1998). Detection and quantification of Fusarium culmorum and Fusarium graminearum in cereals using PCR assays. Physiol. Mol. Plant Pathol. 53, 17–37. Nicholson, P., Simpson, D. R., Wilson, A. H., Chandler, E., and Thomsett, M. (2004). Detection and differentiation of trichothecene and enniatin-producing Fusarium species on small-grain cereals. Eur. J. Plant Pathol. 110, 503–514. Niessen, M. L., and Vogel, R. F. (1997). Specific identification of Fusarium graminearum by PCR with gaoA targeted primers. Syst. Appl. Microbiol. 20, 111–123. Niessen, M. L., and Vogel, R. F. (1998). Group specific PCR-detection of potential trichothecene-producing Fusarium-species in pure cultures and cereal samples. Syst. Appl. Microbiol. 21, 618–631. Niessen, L., Klusmann, J., and Vogel, R. F. (1998). Quantitative estimation of Fusarium graminearum DNA using a solid phase PCR assay (DIAPOPS). J. Food Mycol. 1, 73–84. Niessen, L., Schmidt, H., and Vogel, R. F. (2004). The use of tri5 gene-sequences for PCR detection and taxonomy of trichothecene-producing species in the Fusarium section Sporotrichiella. Int. J. Food Microbiol. 95, 305–319. Niessen, L., Schmidt, H., Mu¨hlencoert, E., Fa¨rber, P., Karolewiez, A., and Geisen, R. (2005). Advances in the molecular diagnosis of ochratoxin A-producing fungi. Food Addit. Contam. 22, 324–334. Obradovic, D., Bagi, F., Kevresan, S., Petrovic, T., and Balaz, F. (2001). A simplified method of DNA extraction for identification of Fusarium graminearum group 2 isolates by PCR. Acta Phytopathol. Entomol. Hung. 36(3–4), 243–249. O’Callaghan, J. O., Caddick, M. X., and Dobson, A. D. W. (2003). A polyketide synthase gene required for ochratoxin A biosynthesis in Aspergillus ochraceus. Microbiology 149, 3485–3491.

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

135

O’Donnell, K., Cigelnik, E., and Nirenberg, H. I. (1998). Molecular systematics and phylogeography of the Gibberella fujikuroi species complex. Mycologia 90, 465–493. Otteneder, H., and Majerus, P. (2000). Occurrence of ochratoxin A (OTA) in wines: Influence of the type of wine and its geographical origin. Food Addit. Contam. 17, 793–798. Pardo, E., Marı´n, S., Ramos, A. J., and Sanchis, V. (2004). Occurrence of ochratoxigenic fungi and ochratoxin A in green coffee from different origins. Food Sci. Technol. 10, 45–50. Parry, D. W., and Nicholson, P. (1996). Development of a PCR assay to detect Fusarium poae in wheat. Plant Pathol. (Oxford) 45, 383–391. Paterson, R. R. M. (2004). The isoepoxydon dehydrogenase gene of patulin biosynthesis in cultures and secondary metabolites as candidate PCR inhibitors. Mycol. Res. 108, 1431–1437. Paterson, R. R. M. (2006). Primers from the isoepoxydon dehydrogenase gene of the patulin biosynthetic pathway to indicate critical control points for patulin contamination of apples. Food Control 17, 741–744. Paterson, R. R. M., Archer, S., Kozakiewicz, Z., Lea, A., Locke, T., and O’Grady, E. (2000). A gene probe for the patulin metabolic pathway with potential for use in patulin and novel disease control. Biocontrol Sci. Technol. 10, 509–512. Patino, B., Mirete, S., Gonzalez-Jaen, M. T., Mule, G., Rodriguez, T., and Velazquez, C. (2004). PCR detection assay of the fumonisin producing Fusarium verticillioides strains. J. Food Prot. 67, 1278–1283. Patino, B., Gonzalez-Salgado, A., Gonzalez-Jaen, M. T., and Vazquez, C. (2005). PCR detection assays for the ochrtoxin-producing Aspergillus carbonarius and Aspergillus ochraceus species. Int. J. Food Microbiol. 104, 207–214. Pedersen, L. H., Skouboe, P., Boysen, M., Soule, J., and Rossen, L. (1997). Detection of Penicillium species in complex food samples using the polymerase chain reaction. Int. J. Food Microbiol. 35, 169–177. Peltola, S., Niessen, L., Nielsen, K. F., Jarvis, B. B., Andersen, B., Salkinoja-Salonen, M., and Mo¨ller, E. M. (2002). Toxigenic diversity of two different RAPD groups of Stachybotrys chartarum isolates analyzed by potetial for trichothecene production and for boar sperm cell motility inhibition. Can. J. Microbiol. 48, 1017–1029. Peraica, M., Radic, B., Lucic, A., and Pavlovic, M. (1999). Toxic effects of mycotoxins in humans. Bull. World Health Organ. 77, 754–766. Perrone, G., Susca, A., Stea, G., and Mule`, G. (2004). PCR assay for identification of Aspergillus carbonarius and Aspergillus japonicus. Eur. J. Plant Pathol. 110, 641–649. Perrone, G., Mule`, G., Susca, A., Battilani, P., Pietri, A., and Logrieco, A. (2006). Ochratoxin A production and amplified fragment length polymorphism analysis of Aspergillus carbonarius, Aspergillus tubingensis, and Aspergillus niger strains isolated from grapes in Italy. Appl. Environ. Microbiol. 72, 680–685. Pietri, A., Bertuzzi, T., Pallanori, L., and Piva, G. (2001). Occurrence of ochratoxin A in Italian wines. Food Addit. Contam. 18, 647–654. Pinson-Gadais, L., Barreau, C., Chaurand, M., Gregoire, S., Monmarson, M., and RichradForget, F. (2007). Distribution of toxigenic Fusarium spp. and mycotoxin production in milling fractions of durum wheat. Food Addit. Contam. 24, 53–62. Pitt, J. I. (2000). Toxigenic fungi and mycotoxins. Br. Med. Bull. 56, 184–192. Reischer, G. H., Lemmens, M., Farnleitner, A., Adler, A., and Mach, R. L. (2004). Quantification of Fusarium graminearum in infected wheat by species specific real-time PCR applying a TaqMan probe. J. Microbiol. Methods 59, 141–146. Rheeder, J. P., Marasas, W. F., and Vismer, H. F. (2002). Production of fumonisin analogs by Fusarium species. Appl. Environ. Microbiol. 68, 2102–2105. Rosso, L., Maier, M. S., and Bertoni, M. D. (2000). Trichothecenes production by the Hypocrealean epibiont of Baccharis coridifolia. Plant Biol. (Stuttg.) 2, 684–686.

136

Ludwig Niessen

Saiki, R. K., Gelfand, D. H., Stoffel, S., Sharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Ehrlich, H. A. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487–491. R. A. Samson, E. S. Hoekstra, and J. C. Frisvad, (eds), (2004). In ‘‘Introduction to Food- and Airborne Fungi.’’ pp. 1–282. Centralbrueau voor Schimmelcultures, Utrecht, Netherlands. Sanchez-Rangel, D., SanJuan-Badillo, A., and Plasencia, J. (2005). Fumonsin production by Fusarium verticillioides strains isolated from maize in Mexico and development of a polymerase chain reaction to detect potential toxigenic strains in grains. Agric. Food Chem. 53, 8565–8571. Sarlin, T., Yli-Mattila, T., Jestoi, M., Rizzo, A., Paavanen-Huhtala, S., and Haikara, A. (2006). Real-time PCR for quantification of toxigenic Fusarium species in barley and malt. Eur. J. Plant Pathol. 114, 371–380. Sartori, D., Furlanto, M. C., Martins, M. K., Fereira de Paula, M. R., Pizzirani-Kleiner, A. A., Taniwaki, M. H., and Fungaro, M. H. P. (2006). PCR method for the detection of potential ochratoxin-producing Aspergillus species in coffee beans. Res. Microbiol. 157, 350–354. Scherm, B., Palomba, M., Serra, D., Marcello, A., and Megheli, Q. (2005). Detection of transcripts of the aflatoxin genes aflD, aflO, and aflP by reverse transcription-polymerase chain reaction allows differentiation of alfatoxin-producing and non-producing isolates of Aspergillus flavus and Aspergillus parasiticus. Int. J. Food Microbiol. 98, 201–210. Schilling, A. G., Moeller, E. M., and Geiger, H. H. (1996). Polymerase chain reaction-based assays for species-specific detection of Fusarium culmorum, F. graminearum and F. avenaceum. Phytopathology 86, 515–522. Schmidt, H., Ehrmann, M., Vogel, R. F., Taniwaki, M. H., and Niessen, L. (2003). Molecular typing of Aspergillus ochraceus and construction of species specific SCAR primers based on AFLP. Syst. Appl. Microbiol. 26, 138–146. Schmidt, H., Taniwaki, M. H., Vogel, R. F., and Niessen, L. (2004a). Utilization of AFLP markers for PCR-based identification of Aspergillus carbonarius and indication for its presence in green coffee samples. J. Appl. Microbiol. 97, 899–909. Schmidt, H., Bannier, M., Vogel, R. F., and Niessen, L. (2004b). Detection and quantification of Aspergillus ochraceus in green coffee by PCR. Lett. Appl. Microbiol. 38, 464–469. Schnerr, H., Niessen, L., and Vogel, R. F. (2001). Real time detection of the tri5 gene in Fusarium species by LigthCycler-PCR using SYBR Green 1 for continuous fluorescence monitoring. Int. J. Food Microbiol. 71, 53–61. Schnerr, H., Vogel, R. F., and Niessen, L. (2002). Correlation between DNA of trichotheceneproducing Fusarium species and deoxynivalenol concentrations in wheat samples. Lett. Appl. Microbiol. 35, 121–125. Scho¨ntal, R. (1984). Mycotoxins and the Bible. Perspect. Biol. Med. 28, 117–120. Schuster, E., Dunn-Coleman, N., Frisvad, J. C., and van Dijck, P. W. M. (2002). On the safety of Aspergillus niger - a review. Appl. Microbiol. Biotechnol. 59, 426–435. Sekiguchi, J., and Gaucher, G. M. (1979). Isoepoxydon, a new metabolite of the patulin pathway in Penicillium urticae. Biochem. J. 182, 445–453. Serra, R., Abrunhosa, L., Kozakievicz, Z., and Venancio, A. (2003). Black Aspergillus species as ochratoxin A producers in Portuguese wine grapes. Int. J. Food Microbiol. 88, 63–68. Serra, R., Mendoca, C., and Venancio, A. (2006). Fungi and ochratoxin A detected in healthy grapes and wine production. Lett. Appl. Microbiol. 42, 42–47. Shapira, R., Paster, N., Eyal, O., Menasherov, M., Mett, A., and Salomon, R. (1996). Detection of aflatoxingenic molds in grains by PCR. Appl. Environ. Microbiol. 62, 3270–3273. Simpson, D. R., Weston, G. E., Turner, J. A., Jennings, P., and Nicholson, P. (2001). Differential control of head blight pathogens of wheat by fungicides and consequences for mycotoxin contamination of grain. Eur. J. Plant Pathol. 107, 421–431.

PCR-Based Diagnosis and Quantification of Mycotoxin-Producing Fungi

137

Straumfors Halstensen, A., Nordby, K. C., Eduard, W., and Sletner Klemsdal, S. (2006a). Real-time PCR detection of toxigenic Fusarium in airborne and settled grain dust and associations with trichothecene mycotoxins. J. Environ. Monit. 8, 1235–1241. Straumfors Halstensen, A., Nordby, K. C., Sletner Klemsdal, S., Elen, O., Clasen, P. E., and Eduard, W. (2006b). Toxigenic Fusarium spp. as determinants of trichothecene mycotoxins in settled grain dust. J. Occup. Environ. Hyg. 3, 651–659. Strausbaugh, C. A., Overturf, K., and Koehn, A. C. (2005). Pathogenicity and real-time PCR detection of Fusarium spp. in wheat and barley roots. Can. J. Plant Pathol. 27, 430–438. Straus, N. A., and Wong, B. (1998). Stachybotrys chartarum trichodiene synthase (TRI5) gene, complete cds. GenBank accession no. AF053926, direct submission, 17. March 1998. . Sugita, T., Kamimura, K., Uchida, K., Yamaguchi, H., and Nagai, A. (2004). PCR identification system for the genus aspergillus and three major pathogenic species: Aspergillus fumigatus, Aspergillus flavus and Aspergillus niger. Med. Mycol. 42, 433–437. Sydenham, E. W., Shephard, G. S., Thiel, P. G., Marasas, W. F. O., and Stockenstrom, S. (1991). Fumonisin contamination of commercial corn-based human foodstuffs. J. Agric. Food Chem. 39, 2014–2018. Tan, M. K., and Niessen, L. (2003). Analysis of rDNA ITS sequences to determine genetic relationships among, and provide a basis for simplified diagnosis of Fusarium species causing crown rot and head blight of cereals. Mycol. Res. 107, 811–821. Tang, C. M., Holden, D. W., Aufauvre-Brown, A., and Cohen, J. (1993). The detection of Aspergillus spp. by the polymerase chain reaction and its evaluation in bronchoalveolar lavage fluid. Am. Rev. Respir. Dis. 148, 1313–1317. Taniwaki, M. H., Pitt, J. I., Teixeira, A. A., and Imanaka, B. T. (2003). The source of ochratoxin A in Brazilian coffee and its formation in relation to processing methods. Int. J. Food Microbiol. 82, 173–179. Tjamos, S. E., Antoniou, P. P., Kazantzidou, A., Antonopoulos, D. F., Papageorgiou, I., and Tjamos, E. C. (2004). Aspergillus niger and Aspergillus carbonarius in Corinth raisin and wine-producing vineyards in Greece: Population composition, Ochratoxin A production and chemical control. J. Phytopathol. (Berlin) 152, 250–255. Tooley, P. W., Goley, E. D., Carras, M. M., Frederick, R. D., and Weber, E. L. (2001). Characterization of Claviceps species pathogenic on sorghum by sequence analysis of the b-tubulin gene intron 3 region and EF-1a gene intron 4. Mycologia 93, 541–551. Torp, M., and Langseth, W. (1999). Production of T-2 toxin by a Fusarium resembling Fusarium poae. Mycopathologia 147, 89–96. Torp, M., and Nirenberg, H. I. (2004). Fusarium langsethiae sp. nov. on cereals in Europe. Int. J. Food Microbiol. 95, 247–256. Trapp, S. C., Hohn, T. M., McCormick, S., and Jarvis, B. B. (1998). Characterization of the gene cluster for biosynthesis of macrocyclic trichothecenes in Myrothecium roridum. Mol. Gen. Genet. 257, 421–432. Turner, W. B., and Aldridge, D. C. (1983). In ’’Fungal Metabolites‘‘ II, p. 631. Academic Press, London. Turner, A. S., Lees, A. K., Rezanoor, H. N., and Nicholson, P. (1998). Refinement of PCRdetection of Fusarium avenaceum and evidence from DNA marker studies for phenetic relatedness to Fusarium tricinctum. Plant Pathol. (Oxford) 47, 278–288. Vos, P., Hogers, R., Bleeker, M., Reijans, M., van de Lee, T., Hornes, M., Frijters, A., Pot, J., Peleman, J., Kuiper, M., and Zabeau, M. (1995). AFLP: A new technique for DNA fingerprinting. Nucleic Acids Res. 23, 4407–4414. Vrabcheva, T., Usleber, E., Dietrich, R., and Ma¨rtlbauer, E. (2000). Co-occurrence of ochratoxin A and citrinin in cereals from Bulgarian villages with a history of Balkan endemic nephropathy. J. Agric. Food Chem. 48, 2483–2488.

138

Ludwig Niessen

Waalwijk, C., Kastelein, P., de Vries, I., Kerenyi, Z., van der Lee, T., Hesselink, T., Ko¨hl, J., and Kema, G. (2003). Major changes in Fusarium spp. in wheat in the Netherlands. Eur. J. Plant Pathol. 109, 743–754. Waalwijk, C., van der Lee, T., de Vries, I., Hesselink, T., Arts, J., and Kema, G. H. J. (2004a). Synteny in toxigenic Fusarium species: The fumonisin gene cluster and the mating type region as examples. Eur. J. Plant Pathol. 110, 533–544. Waalwijk, C., van der Heide, R., de Vries, T., van der Lee, T., Schoen, C., Costrel-de Corainvill, G., Ha¨user-Hahn, I., Kastelein, P., Ko¨hl, J., Lonnet, P., Demarquet, T., and Kema, G. H. J. (2004b). Quantitative detection of Fusarium species in wheat using TaqMan. Eur. J. Plant Pathol. 110, 481–494. Wang, Y. Z., Ju, X. L., and Zhou, Y. G. (2005). The variability of citrinin production in Monascus type cultures. Food Microbiol. 22, 145–148. White, T. J., Burns, T., Lee, S., and Taylor, J. W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In ‘‘PCR Protocols: A Guide to Methods and Applications,’’ (M. A. Inis, D. H. Gelfand, J. J. Sninsky, and T. J. White, eds), pp. 315–322. Academic Press, New York. Williams, J. G. K., Kubelik, A. R., Livak, K. J., Rafalski, J. A., and Tingey, S. V. (1990). DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18, 6531–6536. Williams, R. H., Ward, E., and McCartney, H. A. (2001). Methods for integrated air sampling and DNA analysis for detection of airborne fungal spores. Appl. Environ. Microbiol. 67, 2453–2459. Williams, K. J., Dennis, J. I., Smyl, C., and Wallwork, H. (2002). The application of speciesspecific assays based on the polymerase chain reaction to analyse Fusarium crown rot of durum wheat. Australas. Plant Pathol. 31, 119–127. WHO, World Health Organization (1995). Evaluation of certain food additives and contaminants. In ’’Fourty-Fourth Report of the Joint FAO/WHO Expert Committee on Food Additives‘‘, Technical Report Series 859, pp. 36–38. WHO, Geneva. Yli-Mattila, T., Paavaen-Huhtala, S., Parikka, P., Konstantinova, P., and Gagkaeva, T. Y. (2004). Molecular and morphological diversity of Fusarium species in Finland and north western Russia. Eur. J. Plant Pathol. 110, 573–585. Yoder, W. T., and Christianson, L. M. (1998). Species-specific primers resolve members of Fusarium section Fusarium: Taxonomic status of the edible ‘‘Quorn’’ fungus reevaluated. Fungal Genet. Biol. 23, 68–80. Yu, J., Chang, P. K., Ehrlich, K. C., Cary, J. W., Bhatnagar, D., Cleveland, T. E., Payne, G. A., Linz, J. E., Woloshuk, C. P., and Bennett, J. W. (2004). Clustered pathway genes in aflatoxin biosynthesis. Appl. Environ. Microbiol. 70, 1253–1262. Zachova, I., Vytrasova, J., Pejchalova, M., Cervenka, L., and Tavcar-Kalcher, G. (2003). Detection of aflatoxigenic fungi in feeds using the PCR method. Folia Microbiol. 48, 817–821. Zeng, Q. Y., Westermark, S. O., Rasmuson-Lestander, A., and Wang, X. R. (2004). Detection and quantification of Wallemia sebi in aerosols by real-time PCR, conventional PCR, and cultivation. Appl. Environ. Microbiol. 70, 7295–7302. Zheng, Q., and Ploetz, R. (2002). Genetic diversity in the mango malfomation pathogen and development of a PCR assay. Plant Pathol. 51, 208–212. Zur, G., Shimoni, E., Hallerman, E., and Kashi, Y. (2002). Detection of Alternaria fungal contamination in cereal grains by a polymerase chain reaction-based assay. J. Food Prot. 65, 1433–1440.

CHAPTER

4 Molluscan Shellfish Allergy Steve L. Taylor*

Contents

I. Molluscan Shellfish Classification and Importance as Food II. Prevalence of Molluscan Shellfish Allergies III. IgE-Mediated Reactions in Molluscan Shellfish Allergy IV. Diagnosis and Treatment of Molluscan Shellfish Allergy A. Severity of allergic reactions of molluscan shellfish B. Natural history of molluscan shellfish allergy C. Minimal eliciting (threshold) dose for mollusks D. Allergic reactions to specific types of molluscan shellfish E. Allergies to gastropods F. Allergies to bivalves G. Allergies to cephalopods H. Food-dependent, exercise-induced molluscan shellfish allergy I. Occupational allergies to molluscan shellfish V. Molluscan Shellfish Allergens VI. Cross-Reactions A. Between molluscan shellfish species B. Between molluscan and crustacean shellfish species

141 142 146 148 149 150 150 151 151 153 155 157 158 159 163 163 165

* Department of Food Science and Technology, Food Allergy Research and Resource Program,

University of Nebraska, Lincoln, Nebraska 68583-0919 Advances in Food and Nutrition Research, Volume 54 ISSN 1043-4526, DOI: 10.1016/S1043-4526(07)00004-6

#

2008 Elsevier Inc. All rights reserved.

139

140

Steve L. Taylor

C. Between molluscan shellfish and mites or insects D. Effect of processing on allergenicity of molluscan shellfish E. Detection of residues of molluscan shellfish VII. Conclusion Acknowledgments References

Abstract

166 167 167 168 168 168

Food allergies affect 3.5–4.0% of the worldwide population. Immediate-type food allergies are mediated by the production of IgE antibodies to specific proteins that occur naturally in allergenic foods. Symptoms are individually variable ranging from mild rashes and hives to life-threatening anaphylactic shock. Seafood allergies are among the most common types of food allergies on a worldwide basis. Allergies to fish and crustacean shellfish are very common. Molluscan shellfish allergies are well known but do not appear to occur as frequently. Molluscan shellfish allergies have been documented to all classes of mollusks including gastropods (e.g., limpet, abalone), bivalves (e.g., clams, oysters, mussels), and cephalopods (e.g., squid, octopus). Tropomyosin, a major muscle protein, is the only well-recognized allergen in molluscan shellfish. The allergens in oyster (Cra g 1), abalone (Hal m 1), and squid (Tod p 1) have been identified as tropomyosin. Cross-reactivity to tropomyosin from other molluscan shellfish species has been observed with sera from patients allergic to oysters, suggesting that individuals with allergies to molluscan shellfish should avoid eating all species of molluscan shellfish. Cross-reactions with the related tropomyosin allergens in crustacean shellfish may also occur but this is less clearly defined. Occupational allergies have also been described in workers exposed to molluscan shellfish products by the respiratory and/or cutaneous routes. With food allergies, one man’s food may truly be another man’s poison. Individuals with food allergies react adversely to the ingestion of foods and food ingredients that most consumers can safely ingest (Taylor and Hefle, 2001). The allergens that provoke adverse reactions in susceptible individuals are naturally occurring proteins in the specific foods (Bush and Hefle, 1996). Molluscan shellfish, like virtually all foods that contain protein, can provoke allergic reactions in some individuals. Key Words:

Shellfish, Mollusc, Allergy, Allergen, IgE, Tropomyosin

Molluscan Shellfish Allergy

141

I. MOLLUSCAN SHELLFISH CLASSIFICATION AND IMPORTANCE AS FOOD Seafoods can include fish and shellfish. Shellfish belong to two major phyla — Mollusca and Anthropoda. The Anthropoda phylum contains the Crustacea class of shellfish that includes shrimp, prawns, lobster, crab, crayfish, and barnacles (Table 4.1). The Mollusca phylum is divided into eight classes including three classes that are of importance for human food — Gastropoda, Bivalvia, and Cephalopoda as displayed in Table 4.1 (Hickman et al., 2004). The major gastropod species in the food supply include abalones, conches, limpets, freshwater and marine snails, and whelks (Brusca and Brusca, 1990; Hefle et al., 2007). Gastropoda contains more than 70,000 species but many are not eaten as food (Hickman et al., 2004). Clams, cockles, scallops, mussels, and oysters are the major edible bivalves (Brusca and Brusca, 1990; Hefle et al., 2007). Squid, cuttlefish, and TABLE 4.1

Shellfish species

Crustacean shellfish Shrimps Prawns Crabs Lobsters Crayfish Barnacles Molluscan shellfish Gastropods Abalones Limpets Terrestrial (land) snails Marine snails Whelks Conches Bivalves Clams Oysters Mussels Scallops Cockles Cephalopods Squids Octopuses Cuttlefishes

142

Steve L. Taylor

octopus are primary cephalopods in commerce (Brusca and Brusca, 1990; Hefle and Bush, 2001). Collectively, mollusks comprise a large, diverse group with more than 100,000 species living in saltwater, in freshwater, and on land. Molluscan shellfish play an important role in human nutrition and the world economy (Wild and Lehrer, 2005). Table 4.2 provides data on the worldwide production/catch of various molluscan shellfish species for 2005. The most widely available species are oyster, squid, clam, mussel, and scallop. Aquaculture has become an important contributor to the production of molluscan shellfish with the exception of the cephalopods. However, the popularity and frequency of consumption of various molluscan shellfish varies widely across various countries and cultures. Accurate information on comparative consumption patterns for molluscan shellfish in various countries does not exist. Molluscan shellfish are consumed as freshly cooked or even raw seafood items particularly in coastal communities. But mollusks also are consumed as processed foods in a variety of forms.

II. PREVALENCE OF MOLLUSCAN SHELLFISH ALLERGIES The importance of molluscan shellfish allergy is increasingly recognized. The European Union recently added molluscan shellfish to the list of most commonly allergenic foods in Europe (EFSA, 2006). Although not known TABLE 4.2 Worldwide production and catch of molluscan shellfish — 2005 Capture (in tons)

Freshwater mollusks Abalones, winkles, conches Oysters Mussels Scallops Clams, cockles, arkshells Squids, cuttlefishes, octopuses Misc. marine mollusks Total

Aquaculture (in tons)

Total

415,105

145,462

560,567

120,400

333,947

454,347

166,145 143,182 711,342 705,649

4,615,400 1,795,779 1,224,843 4,175,907

4,781,545 1,938,961 1,936,185 4,881,556

3,892,145

16

3,892,161

1,049,731

1,107,395

2,157,126

Data from Food & Agriculture Organization of the United Nations.

20,602,448

Molluscan Shellfish Allergy

143

with certainty, the prevalence of molluscan shellfish allergy is likely to parallel consumption patterns being more frequent in locales where consumption is frequent. The overall prevalence of food allergies is unknown on a worldwide basis. However, in the United States, the overall prevalence of food allergies has been estimated at 3.5–4.0% or 10–12 million Americans (Sicherer et al., 1999, 2004). The prevalence and severity of food allergies appear to be increasing in several developed countries for reasons that are not entirely clear (Taylor and Hefle, 2001). Food allergies occur more frequently in infants and young children than among adults (Taylor and Hefle, 2001). The prevalence of food allergies among infants younger than the age of 3 can be as high as 8% (Sampson, 1990). In infants, the most common allergenic foods are milk, eggs, and peanuts (Sampson and McCaskill, 1985). Most food allergies developed in infancy are outgrown during infancy or early childhood (Bock, 1982; Hill and Hosking, 1992). Allergies to certain foods such as milk, eggs, and soybeans are much more likely to be outgrown than allergies to other foods such as peanuts (Bock, 1982; Bock and Atkins, 1989). Among adults, the most common allergenic foods are crustacean shellfish (shrimp, crab, lobster), peanuts, and tree nuts such as almonds, walnuts, and cashews (Sicherer et al., 1999, 2004). The prevalence of allergies to specific foods is unknown for the most part. Good estimates exist of the prevalence of milk allergy in infancy (Host and Halken, 1990) and peanut and tree nut allergy throughout the life span (Sicherer et al., 1999). However, the prevalence of allergies to seafoods including molluscan shellfish is not precisely known. The most accurate estimates of prevalence would be derived from clinical challenge studies conducted on a representative sample of the general population. However, the only studies of mollusk allergy in the general population have been questionnaire-based surveys (Rance et al., 2005; Sicherer et al., 2004). Self-reporting through surveys may yield an overestimate of the prevalence of a particular food allergy (Altman and Chiaramonte, 1997). Certainly, the existence of allergy to molluscan shellfish was not corroborated by clinical diagnostic approaches in the individual patients involved in these surveys. However, these surveys do provide intriguing information on the prevalence of molluscan shellfish allergy. Sicherer et al. (2004) conducted a nationwide random telephone survey of the prevalence of seafood allergies in the United States and a standardized questionnaire. Responses were categorized on the basis of convincing symptoms and self-reported physician confirmation of the allergy. The survey involved 14,948 individuals with 67 reporting reactions to molluscan shellfish including scallops, clams, oysters, and mussels. The self-reported prevalence in this study population was 0.4%.

144

Steve L. Taylor

Rance et al. (2005) conducted a questionnaire-based survey of food allergy in 2716 school children in France. Four cases of molluscan shellfish allergy were reported to mussels, snails, and oysters among this group. Thus, the self-reported prevalence of molluscan shellfish allergy in this population of children was 0.15%. These two surveys are in reasonably good agreement regarding prevalence estimates for molluscan shellfish allergy. That is especially true since all the ages were included in the surveyed population of Sicherer et al. (2004) while only children were involved in the French survey (Rance et al., 2005). Hypothetically, sensitization to molluscan shellfish might develop later in life than for other foods because of the infrequent consumption pattern. In 1999, the Codex Alimentarius Commission adopted a list of the most commonly allergenic foods and food groups (CAC, 1999). This list includes milk, eggs, fish, crustacean shellfish, peanuts, tree nuts, soybeans, and wheat (CAC, 1999; FAO, 1995). These eight foods or food groups are thought to account for more than 90% of all IgE-mediated food allergies on a worldwide basis (Bousquet et al., 1998). Subsequently, various countries or regions have considered the Codex guidance and developed their own lists of the most commonly allergenic foods. While the United States list these eight foods or food groups, the list in the European Union additionally includes sesame seeds, celery, mustard, lupine, and molluscan shellfish. The Canadian list additionally includes sesame seeds and refers to shellfish which presumably encompasses both crustacean and molluscan shellfish. At this time, only the European Union and Canada recognize molluscan shellfish as among the commonly allergenic foods. Beyond the commonly allergenic foods or food groups, any food that contains protein has the potential to elicit an allergic reaction among susceptible individuals (Taylor and Hefle, 2001). Hefle et al. (1996) identified more than 160 other foods beyond the 8 foods or food groups recognized by Codex that had been documented as causing food allergies on a less frequent basis. Molluscan shellfish are considered to be among a group of allergenic foods, just below the well-recognized, eight most commonly allergenic foods or food groups. In fact, individuals with shellfish allergies, usually manifested primarily by adverse reactions to crustacean shellfish, are often told to avoid all types of shellfish including molluscan shellfish. Thus, molluscan shellfish may be avoided to a similar extent as if this group of foods was more commonly allergenic. Molluscan shellfish are among a group of foods including sesame seeds, poppy seeds, cottonseed, and other legumes beyond peanuts and soybeans, that are worthy of mention because, although they less frequently cause allergies, they have been associated with severe reactions (Taylor and Hefle, 2001).

Molluscan Shellfish Allergy

145

Do molluscan shellfish belong on a list of most commonly allergenic foods? When the original Codex list of the eight most commonly allergenic foods was originally proposed in 1995 (FAO, 1995), prevalence data were indeed scant so that the expert panel had to make their recommendation on the basis of limited information. Subsequently, the correctness of this list was endorsed by Bousquet et al. (1998) based upon better, though still incomplete, information on comparative prevalence and evidence of severe reactions. Bousquet et al. (1998) especially noted the dearth of data relating to the prevalence of shellfish allergies, both crustaceans and mollusks. However, if the true prevalence of molluscan shellfish allergies does fall within the range of 0.15–0.40% as suggested by the surveys of Sicherer et al. (2004) and Rance et al. (2005), then the prevalence of molluscan shellfish allergies may be in the same range as more well-accepted commonly allergenic foods such as fish (Sicherer et al., 2004) and tree nuts (Sicherer et al., 1999). The comparative prevalence of molluscan shellfish allergies within groups of patients from allergy clinics can offer some clues. Clearly, these populations are skewed toward individuals who seek medical assistance for their allergies. Thus, the prevalence in these populations is going to be considerably higher than for the general population. However, the prevalence of molluscan shellfish allergy within such predisposed groups can be compared to the prevalence of allergies to more well-accepted commonly allergenic foods to see if they are comparable. Unfortunately, although numerous studies of this type have been reported in the medical literature, many studies involve infants and young children who may not yet have been exposed to molluscan shellfish and other studies do not distinguish molluscan from crustacean shellfish. Castillo et al. (1996) studied 142 food-sensitized patients from Gran Cranaria, Spain. Of these individuals, 120 reported clinical symptoms following ingestion of one or more foods. While shrimp was the most common allergenic food, squid was the second most common allergenic food with 33 cases. Additionally, 12 cases were reported to oyster, 10 to clam, and 10 to mussels. In another Spanish study, Crespo et al. (1995) evaluated 355 children on the basis of clinical history, skin prick tests (SPTs), and specific serum IgE to mollusks. Allergies to molluscan shellfish were noted in 10 of these children or 2.8%. However, mollusks caused 1.6% of 608 allergic reactions among this group of children. In a survey of patients with food allergies appearing at 17 clinics in 15 cities in the Baltic region of Europe, 6.2% of participants indicated allergies to clam, 3.2% to oyster, and 1.4% to snail (Erikson et al., 2004). These percentages are even more noteworthy in light of the fact that the survey indicated that fewer than 50% of these clinic patients had even eaten clams, oysters, or snails.

146

Steve L. Taylor

Among a total of 305 pediatric patients in Japan who were diagnosed as having IgE-mediated food allergies, 12 cases of allergy to molluscan shellfish (3.9%) were identified (Ebisawa et al., 2003). Seven of these cases were to cuttlefish and five cases involved octopus. Clearly, while these foods may be consumed by young children in Japan, such dietary habits would not be so common in many other countries. By contrast, 93.4% of these Japanese children were diagnosed with egg allergy and another 58.0% with milk allergy (Ebisawa et al., 2003). The number of studies estimating the comparative prevalence of molluscan shellfish allergy is limited. The frequency of consumption of molluscan shellfish might be higher in some of the locales where such studies have been performed. Clearly, more comparative clinical data would be helpful. However, the molluscan shellfish certainly seem to be a comparatively common allergenic food in some locales and among some populations.

III. IgE-MEDIATED REACTIONS IN MOLLUSCAN SHELLFISH ALLERGY Individualistic adverse reactions to foods can occur through several different types of mechanisms (Taylor and Hefle, 2001). True allergic reactions can include both IgE-mediated immediate hypersensitivity reactions and cell-mediated delayed hypersensitivity reactions (Taylor and Hefle, 2001). However, only IgE-mediated reactions have been documented to occur with ingestion of molluscan shellfish in sensitive individuals. While all humans have IgE antibodies that are involved in defense against parasitic infections, only humans who are predisposed to the development of allergies will produce IgE antibodies upon exposure to certain protein allergens present in their environment including their diet. Only a few of the many proteins found in foods are capable of stimulating the production of specific IgE antibodies in susceptible individuals (Taylor, 2002). With molluscan shellfish, only one, or perhaps a few, of the numerous proteins is known to provoke the production of IgE antibodies that specifically recognize one or more species of molluscan shellfish. The first step in the development of an IgE-mediated food allergy is sensitization. In this phase, exposure to the allergen stimulates production of specific IgE antibodies. Exposure is certainly a critical aspect of sensitization but exposure does not usually result in allergic sensitization. Instead, exposure to dietary proteins usually results in oral tolerance, a normal immunologic response that is not associated with adverse reactions (Strobel, 1997). Even among individuals predisposed to development of IgE-mediated allergies, exposure to most dietary proteins will induce oral tolerance. The reasons why some allergic individuals mount

Molluscan Shellfish Allergy

147

an IgE-mediated response to one particular antigen while other similar individuals produce a similar response to an antigen from a completely different source remains unclear. Although sensitization can occur on the first known exposure to the allergen, this is not always the case. Thus, an individual may develop a food allergy at any age. Sensitization to molluscan shellfish, and especially some species of molluscan shellfish, is unusual probably because exposure is uncommon or infrequent even among susceptible individuals. Once sensitized, individuals will react adversely upon subsequent exposure to the particular allergen, the so-called elicitation phase of the allergic response. After the allergen-specific IgE antibodies are formed, they attach to mast cells in the tissues and basophils in the blood. Mast cells and basophils possess granules that contain physiologically active chemicals that mediate the allergic response (Church et al., 1998). During the elicitation phase, exposure of the sensitized individual to the allergen results in the allergen cross-linking two IgE antibodies on the surface of the mast cell or basophil membrane. The cross-linking stimulates the release of mediators from the mast cells and basophils into the tissues and blood. Histamine is one of the primary mediators of IgE-mediated allergic reactions (Simons, 1998). However, many other mediators have been identified including various leukotrienes and prostaglandins (Taylor and Hefle, 2001). Many different symptoms can occur during IgE-mediated food allergies including cutaneous, gastrointestinal, respiratory, and sometimes cardiovascular symptoms (Table 4.3). Reactions can sometimes be fairly mild, but severe and life-threatening reactions involving symptoms such as laryngeal edema, asthma, and anaphylactic shock can occur on occasion. TABLE 4.3

Symptoms of IgE-mediated allergic reactions

Gastrointestinal:

Nausea Vomiting Diarrhea Abdominal cramping

Cutaneous:

Pruritis Dermatitis Urticaria Angioedema

Respiratory:

Conjunctivitis Rhinitis Asthma Laryngeal edema

Systemic:

Anaphylactic shock Hypotension

148

Steve L. Taylor

Individuals with allergies to the same food can experience quite different symptoms depending upon their degree of sensitization, the dose of exposure to the offending food, and the sensitivity of receptors in their various tissues to the specific mediators. The nature and severity of the symptoms experienced by a food-allergic individual may vary from one episode to another also depending on the dose of the offending food that has been inadvertently ingested, the degree of sensitization at the time of the episode, and probably other factors (Taylor and Hefle, 2001). Fatal reactions, attributed to food-allergic reactions, have been well documented (Bock et al., 2001, 2007; Sampson et al., 1992; Yunginger et al., 1988). Fatal reactions usually involve the inadvertent ingestion of the offending food by individuals who know that they were allergic to that food. Although asthma is not a particularly common manifestation of food allergy, the individuals at greatest risk of life-threatening reactions are those with food-induced asthma (Sampson et al., 1992). In IgE-mediated food allergies, symptoms begin to emerge in most cases within a few minutes after ingestion of the offending food. Hence, these responses are known as immediate hypersensitivity reactions.

IV. DIAGNOSIS AND TREATMENT OF MOLLUSCAN SHELLFISH ALLERGY The diagnosis of IgE-mediated food allergies cannot be based solely on the symptomatic profile of the patient (Metcalfe, 1984). The dietary history of the patient should be carefully taken in an attempt to establish a convincing association between intake of the molluscan shellfish and elicitation of an adverse reaction. With immediate hypersensitivity reactions to molluscan shellfish that may be eaten only occasionally, the history can often be very important and revealing in the diagnostic workup. In cases where a convincing history is not obtained, the optimal method for documenting the existence of a specific food-associated adverse reaction is the double-blind, placebo-controlled food challenge (DBPCFC) (Bock et al., 1988). Neither the history nor the DBPCFC can reveal the mechanism of the adverse reaction. Therefore, once the adverse reaction is well documented, the proof of an IgE mechanism should be sought. SPTs using molluscan shellfish extracts (Bock et al., 1977) and radioallergosorbent tests (RASTs), where binding of IgE antibodies from serum of the patient to molluscan shellfish proteins bound to a solid phase is measured in vitro (Adolphson et al., 1986), are the two most common procedures used to establish an IgE mechanism. With seafood allergies, mixtures of shellfish, including both crustacean and molluscan, are sometimes used especially with the SPT. The use of such mixed antigens is expeditious but does not allow any association of the allergic

Molluscan Shellfish Allergy

149

reaction with a specific type of shellfish. The use of mixed antigens also often leads to advice to avoid all seafoods or all shellfish. A more specific diagnosis can be made if the extracts contain only a certain species of shellfish or a more narrowly defined group (clams, shrimp, etc.). Bousquet et al. (1998) established criteria for the placement of foods or groups of foods on the list of commonly allergenic foods. The criteria included compelling evidence of the association of the food with allergic reactions ideally involving positive DBPCFCs, evidence of severe and life-threatening reactions, and evidence of an IgE mechanism through positive SPTs or RASTs. For molluscan shellfish, these criteria are not met because the medical literature contains very little, if any, evidence of positive DBPCFCs for molluscan shellfish. However, DBPCFCs are contraindicated in cases of very severe food allergies (Bock et al., 1988). Allergic reactions to foods, including molluscan shellfish, can be treated with certain drugs (Furukawa, 1988; Simons, 1998). Antihistamines will counteract the effects of histamine (Simons, 1998), but do not counteract the effects of the other mediators released from mast cells and basophils during an allergic reaction. Epinephrine or adrenaline is considered as the lifesaving drug for individuals at risk of severe anaphylactic reactions to foods (Sampson et al., 1992). Epinephrine is available as a self-injectable drug. Consumers with a history of severe anaphylactic reactions to molluscan shellfish or other foods should carry epinephrine at all times. The only prophylactic approach to prevent allergic reactions to foods is a specific avoidance diet (Taylor et al., 1986, 1999). With molluscan shellfish allergies, individuals are advised to avoid the ingestion of one or more species of molluscan shellfish. Often, patients with shellfish allergies are advised to avoid all molluscan shellfish species or all shellfish (both molluscan and crustacean) or even all seafood. While some evidence exists for cross-reactions, the need for avoidance diets restricting all shellfish or all seafood is not clear in most cases. With better diagnosis, more specific advice could be given on the most appropriate avoidance diets. Since cross-reactions between finfish and molluscan shellfish have not been identified, avoidance of all seafood is probably especially unnecessary. Physician will need to conduct a lengthier diagnosis including possibly several DBPCFCs to provide sound advice on which specific shellfish must be avoided. Often, the expeditious approach of counseling patients to avoid all shellfish is chosen.

A. Severity of allergic reactions of molluscan shellfish Severe, life-threatening anaphylactic reactions can occur among a subset of individuals with IgE-mediated food allergies; fatalities have been recorded (Bock et al., 2001, 2007; Sampson et al., 1992; Yunginger et al., 1988). In the United States, the majority of fatal food-allergic reactions

150

Steve L. Taylor

result from the inadvertent ingestion of peanuts and tree nuts (Bock et al., 2007). However, severe, life-threatening reactions have been described for many allergenic foods on a less frequent basis. Individuals with foodinduced asthma seem to be at particularly high risk for development of severe and life-threatening reactions (Sampson et al., 1992). Fatal allergic reactions from the ingestion of molluscan shellfish are rarely reported. Two deaths have been ascribed to snail allergy (Pumphrey, 2004; Wu and Williams, 2004). Several other severe anaphylactic shock reactions have also been linked to snails (Banzet et al., 1992; Guilloux et al., 1998; Moneret-Vautrin et al., 2002). In a report from the Allergy Vigilance Network of 107 fatal or near-fatal reactions occurring mainly in France in 2002, Moneret-Vautrin et al. (2004) did not distinguish between molluscan and crustacean shellfish but did note that 5 of the cases were attributed to snails which amounted to 4.7% of all reactions. Limpet, another gastropod species, has also been linked to several severe anaphylactic episodes, although no fatal reactions have been recorded (Maeda et al., 1991; Morikawa et al., 1990). Oyster is the only other molluscan species that has been clearly implicated in a case of anaphylactic shock (Gonzalez Galan et al., 2002). Several of the molluscan species have been associated with the provocation of bronchospasm or asthma which can be life threatening is some cases. Most such reactions have been attributed to snail (Ardito et al., 1990; Banzet et al., 1992; Pajno et al., 1994; Tomas et al., 1997) and limpet (Azofra and Lombardero, 2003; Carrillo et al., 1991, 1994; Castillo et al., 1994).

B. Natural history of molluscan shellfish allergy Generally, the prevalence of food allergies is greater among infants and young children than adults (Sampson, 1990). As noted previously, some of the food allergies that commonly affect infants and young children, especially egg and milk allergies, are frequently outgrown. The age distribution of allergies to molluscan shellfish seems to differ from milk, eggs, and some other allergenic foods and affects older children and adults more frequently than infants and young children (EFSA, 2006). This observation has not been documented by clinical studies. However, the later introduction of mollusks into the human diet seems to coincide with this trend. No information exists on the likelihood that molluscan shellfish allergy will be outgrown once manifested.

C. Minimal eliciting (threshold) dose for mollusks The threshold dose for the offending food for elicitation of allergic reactions in sensitized individuals is quite low, perhaps as low as 1 mg or less (Taylor et al., 2002). No information exists on the threshold dose for

Molluscan Shellfish Allergy

151

molluscan shellfish but total avoidance including caution with respect to cross contamination particularly in foodservice facilities is probably wise.

D. Allergic reactions to specific types of molluscan shellfish The existence of allergic reactions to molluscan shellfish is a well-accepted clinical fact. However, an examination of the medical literature actually reveals only a modest level of evidence of allergic reactions to molluscan shellfish especially as compared to the eight most commonly allergenic foods or food groups. Shellfish allergies are very frequently mentioned in the medical literature, but these reactions are often related to crustacean shellfish with no mention of molluscan shellfish allergies. Although many people with crustacean shellfish allergy also avoid molluscan shellfish, the existence of molluscan shellfish allergies among these individuals is unknown. Molluscan shellfish allergy is probably best described as an underreported clinical entity, and the underreporting causes considerable uncertainty about the clinical importance of molluscan shellfish allergy. Molluscan shellfish allergy has been described in the medical literature to virtually all of the commonly ingested types of molluscan shellfish. The following sections will summarize published reports of allergic reactions to the major categories of edible molluscan shellfish — gastropods, bivalves, and cephalopods.

E. Allergies to gastropods Among the gastropods, snail allergy is certainly the most frequently described cause of allergic reactions. IgE-mediated snail allergy has been described in several European countries where snails are a popular food including Italy (Amaroso et al., 1988; Ardito et al., 1990; Grembiale et al., 1996; Longo et al., 2000; Meglio et al., 2002; Pajno et al., 1994, 2002; Peroni et al., 2000), France (Banzet et al., 1992; Guilloux et al., 1998; Moneret-Vautrin and Kanny, 1995; Moneret-Vautrin et al., 2002, 2004; Petrus et al., 1997; Vuitton et al., 1998), Portugal (Palma Carlos et al., 1985; Tomas et al., 1997), Spain (De la Cuesta et al., 1989), and the Netherlands (van Ree et al., 1996a). Snails can provoke a range of allergic reactions including severe reactions such as asthma and laryngeal edema on occasion. As noted earlier, fatal reactions have also been ascribed to snail allergy (Pumphrey, 2004; Wu and Williams, 2004). Snail allergy appears to occur more frequently among individuals with allergies to dust mites or other mites (Amaroso et al., 1988; De la Cuesta et al., 1989; DeMaatBleeker et al., 1995; Pajno et al., 2002; Peroni et al., 2000; Tomas et al., 1997; Van Ree et al., 1996a). In fact, the possibility exists that individuals with snail allergy were first sensitized to mites and then experience cross-reactions on ingestion of snails.

152

Steve L. Taylor

Most of the allergic reactions to snails are described for terrestrial snail, usually Helix sp. Such snails are frequently eaten in some cultures as escargot and other delicacies. However, marine snails of several types, including whelks and turban shells, are also likely to be a source of allergic reactions, although rarely reported. Several cases of turban shell allergy are reported from Japan where this mollusk is eaten (Ishikawa et al., 1998c; Juji et al., 1990). One of these cases was a single case of exercise-induced anaphylaxis in a young female (Juji et al., 1990). Stewart and Ewan (1996) noted a case of anaphylactic shock in the United Kingdom associated with ingestion of whelk. Several dozen patients who were sensitized to the common whelk, Buccinum undatum, were identified in Korea (Lee and Park, 2004), although no evidence is provided of either allergic histories to ingestion of whelk or the results of clinical oral challenge studies to confirm the provocation of adverse reactions. Allergic reactions to the gastropod, limpet, are also well described. All reported cases to date are from Spain, Japan, or Singapore which may parallel frequency of consumption of this particular mollusk. Allergic reactions to limpet appear to be quite severe in many of the reported cases. The first cases of limpet allergy were two cases in Spain of asthma provoked by ingestion of limpet as described by De la Cuesta et al. (1989). Later, two cases of severe, systemic anaphylaxis to ingestion of limpet were reported from the Canary Islands (Carrillo et al., 1991). These cases were both quite severe and involved hypotension, asthma, and loss of consciousness in addition to other symptoms. Evidence of an IgE-mediated reaction was obtained. Later, Carrillo et al. (1994) described six cases of allergic reactions to limpet. Two of the described cases were severe, although these may be the same two patients described in the report from several years earlier. All six of these limpet-allergic individuals experienced asthmatic reactions to ingestion of limpet. Castillo et al. (1994) identified five patients experiencing anaphylaxis with severe asthma upon ingestion of limpet. Joral et al. (1997) identified an additional two cases of anaphylaxis to limpet from Spain. Five more limpet-allergic patients from Spain were described by Azofra and Lombardero (2003); all five patients experienced asthma which was quite severe in three of the five subjects. Morikawa et al. (1990) reported four patients with allergic reactions to grand keyhole limpet in Japan including three subjects who experienced asthmatic reactions, one of which was quite severe. Maeda et al. (1991) described three Japanese patients with severe anaphylactic reactions to both limpet and abalone. A single case of exercise-induced anaphylaxis to lapas, a type of limpet, was also reported in Japan (Juji et al., 1990). From Singapore, Thong et al. (2005) reported 11 patients with anaphylaxis to limpet and abalone. Evidence of cross-reactions between dust mite allergy and limpet was presented in several of these cases (Azofra and Lombardero, 2003; Castillo et al., 1994).

Molluscan Shellfish Allergy

153

Abalone allergy is also known but is reported even less frequently than snail and limpet allergy. However, Lopata et al. (1997) described a rather large group of 38 individuals with histories of adverse reactions to abalone in South Africa. About two-third of these individuals reported immediate reactions while one-third experienced the onset of symptoms 2–7 h after ingestion of abalone. The symptoms described in these cases included respiratory or cutaneous symptoms in 75% of the patients and 25% with gastrointestinal symptoms. Evidence of IgE-mediated reactions was not obtained for all of these individuals so an allergic mechanism may not have been responsible in all cases. However, evidence of an IgEmediated mechanism was obtained for some of these patients with 45% having an elevated RAST to abalone and 14 of 24 patients having a positive SPT to abalone. Some evidence existed for cross-reactions to snails, crayfish, mussels, oysters, and squid. In South Africa, a survey of 105 fish-allergic individuals indicated that 35.2% of them believed they were allergic to abalone (Zinn et al., 1997). However, the suspicions of these patients were not confirmed by diagnostic assessments. A single patient with an allergic reactions to abalone was identified in Japan along with four additional limpet-allergic patients who showed some evidence of cross-reactivity to abalone (Morikawa et al., 1990). A further 11 patients with allergic reactions to abalone or grand keyhole limpet were also identified in Japan (Maeda et al., 1991). Dohi et al. (1991) described a case of exercise-induced anaphylaxis associated with ingestion of abalone.

F. Allergies to bivalves Although bivalves are likely the most frequently ingested class of molluscan shellfish, the existence of allergic reactions to bivalves is rather poorly documented in the medical literature. IgE-mediated allergic reactions to oyster, clam, scallop, mussel, and cockle have been reported as described below. Oyster allergy has only been reported on a few occasions in the medical literature. Moneret-Vautrin et al. (2002) briefly described three patients with anaphylaxis to oyster from the French Allergy Vigilance Network. The prevalence of oyster allergy in France was estimated at 0.4% (Rance et al., 2005), but this was based upon a questionnaire survey of 2716 school children without any diagnostic follow-up. Also, one case equals an estimated prevalence of 0.4%, so a larger survey is needed to obtain a better estimate. A dozen cases of clinical hypersensitivity to oyster were identified in Spain with evidence of IgE-mediated mechanisms (Castillo et al., 1994, 1996). In a study of 105 subjects with suspected fish allergy from South Africa, 25 individuals reported allergy to oyster but no diagnostic procedures were conducted to confirm the

154

Steve L. Taylor

survey results (Zinn et al., 1997). In a very large survey of 17,280 adults conducted as part of the multicenter European Community Respiratory Health Survey, 2.3% of respondents cited allergy to oyster but no confirmatory diagnostic evaluations were performed (Woods et al., 2001). One case of anaphylactic shock has been ascribed to oyster (Gonzalez Galan et al., 2002), so reactions to this bivalve can apparently be severe on occasion. A single case of exercise-induced anaphylaxis linked to oyster ingestion has also been described (Maulitz et al., 1979). Evidence of clam allergy is not as profound. The first reports of clam allergy involved a total of six subjects identified in 1916 (Cooke and Vander Veer, 1916; Strickler and Goldberg, 1916). In a survey of 1139 patients with a history of food hypersensitivity in Denmark, Estonia, Lithuania, and Russia, 6.2% indicated that they were allergic to clams, although no diagnostic confirmation was performed (Erikson et al., 2004). Skin testing of 625 Japanese adult asthmatic individuals showed that 6.9% were sensitized to clam but the diagnosis was not supported by histories of these individuals on ingestion of clam or results of challenge trials (Arai et al., 1998). Moneret-Vautrin et al. (2002) briefly identified a single case of clam allergy from the French Allergy Vigilance Network. The most definitive cases of clam allergy were documented by Parker et al. (1990) and Jimenez et al. (2005) but only involve a total of three patients. Parker et al. (1990) identified two clam-allergic patients in Canada; one of these patients had gastrointestinal symptoms confirmed by DBPCFC while the other one gave a history of laryngeal edema and was not challenged. Jimenez et al. (2005) described the case of an adult woman who experienced pruritis and facial angioedema on three occasions after ingestion of razor clam. Ten individuals with clam allergy were identified from the Canary Islands of Spain (Castillo et al., 1994, 1996). A unique case of clam allergy involves a young girl who experienced tongue edema and pruritis after ingestion of clam, mustard, egg, and pork 2 years after receiving an intestinal transplant (Chehade et al., 2004). This girl had not experienced any food allergies prior to the transplant. Published cases of allergy to scallops are difficult to locate. Nakamura et al. (2005) indicate that scallop allergy is common in Japan but provides no citations to any case reports. In another study from Japan of 99 shrimpallergic patients, 46 subjects reported eating scallops and 9 of them reported allergic reactions (Tomikawa et al., 2006) but no other evidence is provided of scallop allergy. A single case of a serious systemic reaction to the ingestion of scallop in an adult male was reported by the French Allergy Vigilance Network (2006a). In South Africa, a survey of 105 individuals with suspected fish allergy revealed that 2 individuals suspected an allergy to scallops (Zinn et al., 1997). However, these suspicions were not confirmed by diagnostic evaluations.

Molluscan Shellfish Allergy

155

Mussel allergy is more frequently reported than either scallop or clam allergy. The prevalence of mussel allergy among school children in France was estimated at 0.8% (Rance et al., 2005), but this estimate was based upon a questionnaire survey with no diagnostic follow-up. In South Africa, a survey of 105 individuals with suspected fish allergy revealed that 33.3% suspected an allergy to black mussels (Zinn et al., 1997). However, these suspicions were not confirmed by diagnostic evaluations. These prevalence estimates are rather weak because of the lack of diagnostic confirmation. However, mussel allergy has been well documented in several reports in the medical literature. Ten patients with mussel allergy were identified in Spain including many who had respiratory symptoms (Castillo et al., 1994, 1996). Eleven cases of allergy to mussels presenting primarily as urticaria and angioedema have also been confirmed in Italy (Nettis et al., 2001). Severe allergic reactions have also been attributed to mussels. Mussels have been implicated in three cases of anaphylaxis requiring emergency treatment in Italy (Novembre et al., 1998; Pastorello et al., 2001). Cianferoni et al. (2001) reported one case of anaphylaxis to mussels requiring emergency treatment, but it is unclear if that case is also reported in the earlier publication from this group (Novembre et al., 1998). Thus, the evidence for the existence of mussel allergy is reasonably strong. Additional patients are known to be sensitized to mussels by the presence of mussel-specific IgE in their blood serum or positive SPTs. Moneret-Vautrin and Petithory (1987) indicated that 2.3% of 256 patients at an allergy referral center were sensitized to mussels but the symptoms of the patients to mussel ingestion were not described. Andre et al. (1995) identified six patients who were sensitized to mussels but provided no information regarding whether these individuals suffered adverse reactions upon ingestion of mussels. In a large study of 13,300 people from Berlin Germany, only 0.1% were determined to be sensitized to mussels (Zuberbier et al., 2004); no further evidence of allergy to mussels was provided. Allergic reactions to cockles probably occur but are not particularly well described in the clinical literature. Cockles are described as the cause of single cases of food allergy reported to the French Allergy Vigilance Network (French Allergy Vigilance Network, 2006b; Moneret-Vautrin et al., 2002).

G. Allergies to cephalopods Allergic reactions to squid are rather well documented. Carrillo et al. (1992) describe seven patients with histories of reactions from the ingestion of squid or the inhalation of vapors from cooking of squid. All of these patients experienced asthmatic reactions. Positive SPTs and RASTs were obtained. Six of the seven patients had a history of coexisting

156

Steve L. Taylor

shrimp allergy. The cross-reaction with shrimp was confirmed by SPT and RAST in these six individuals. No cross-reactivity could be confirmed between squid and oyster and the patients’ histories provided no suggestion of cross-reactivity with other molluscan shellfish. In a study of 48 seafood-allergic patients in the Canary Islands of Spain, 24 individuals were identified as allergic to squid including 18 individuals who were also allergic to crustacean shellfish (Castillo et al., 1994). Later, a group of 33 squid-allergic individuals were described from the Canary Islands that likely includes the 24 patients identified earlier (Castillo et al., 1996). Squid allergy has also been described in Japan (Miyazawa et al., 1996; Tanaka et al., 2000; Tomikawa et al., 2006). Four patients with immediate hypersensitivity to ingestion of Pacific squid (Todarodes pacificus) were documented as part of a study primarily aimed at identification of the major squid allergen. Tanaka et al. (2000) studied 23 patients with seafood allergies and determined that 18 of them were sensitized to squid. However, none of the patients were confirmed as squid-allergic by either history or challenge trials. In a study of 99 patients with shrimp allergy, 63 individuals had attempted squid ingestion and 11 subjects were identified as squid-allergic (Tomikawa et al., 2006). Faeste et al. (2003) described an individual from Norway who was weakly sensitized to squid and more strongly sensitized to crustacean shellfish but provided no other evidence of squid allergy. A case of severe anaphylaxis to squid was reported to the French Allergy Vigilance Network from the isle of Reunion (Morisset and Parisot, 2003). In a case from France, a mitesensitized child experienced angioneurotic edema after ingestion of squid and had a positive labial challenge test (Petrus et al., 1999). A total of 656 children in Thailand were surveyed by parental questionnaires to identify 41 children with possible food allergies (Santadusit et al., 2005). Diagnostic evaluation confirmed that seafoods were the most common cause of food allergy among a group of 29 children between 3 and 6 years of age; squid or crab was identified as the causative seafood product by challenge trial in three of these children (Santadusit et al., 2005). In South Africa, a survey of 105 individuals with suspected fish allergy revealed that 12 of the 105 subjects suspected an allergy to squid (Zinn et al., 1997), but these suspicions were not confirmed by diagnostic evaluations. A survey of 659 Portuguese adults revealed 3 individuals reporting allergy to squid and octopus but further confirmation of these self-reported allergies was not sought (Falcao et al., 2004). Several cases of exercise-induced anaphylaxis associated with squid ingestion have been described — all in Japan (Dohi et al., 1991; Miyake et al., 1988a,b; Tanaka, 1994). Allergic reactions to octopus are more rarely reported. Castillo et al. (1994) indicate that some of the 24 squid-allergic patients were also allergic to octopus but the exact number is unclear. Similarly,

Molluscan Shellfish Allergy

157

Carrillo et al. (1992) determined that their seven squid-allergic patients were highly cross-reactive to octopus extracts in in vitro IgE-binding experiments but no other evidence of octopus allergy is provided. A single case of IgE-mediated urticaria resulting from octopus was described in Japan (Arai et al., 1998). Subsequently, three additional cases of octopus allergy were briefly described in a study focused primarily on the elucidation of the octopus allergen (Ishikawa et al., 2001). Tanaka et al. (2000) indicated that 19 of 23 seafood-allergic subjects were sensitized to octopus but did not confirm the octopus allergy by either history or challenge trials. In a study of 99 shrimp-allergic patients in Japan, 62 subjects had tried octopus and 11 of them reported symptoms from eating octopus (Tomikawa et al., 2006). Five cases of allergy to octopus were diagnosed in a series of pediatric food allergy cases from Japan (Ebisawa et al., 2003). A recent case report from Spain describes an adult female who had octopus allergy but could tolerate ingestion of squid, cuttlefish, shrimp, crab, and lobster (San Miguel-Moncin et al., 2007). A survey of 659 Portuguese adults revealed 3 individuals reporting allergy to squid and octopus but further confirmation of these self-reported allergies was not sought (Falcao et al., 2004). Only nine allergic reactions to cuttlefish have been described (Caffarelli et al., 1996; Ebisawa et al., 2003; Shibasaki et al., 1989). One patient was a 10-year-old female who experienced a severe reaction to ingestion of cuttlefish that was manifested by urticaria, angioedema, asthma, abdominal pain, laryngeal edema, and hypotension (Shibasaki et al., 1989). SPT and RAST were positive. This patient reportedly tolerated octopus, clam, oyster, abalone, mussel, and scallop but reacted to crab and shrimp. Caffarelli et al. (1996) describe a 14-year-old female who had cuttlefish-dependent, exercise-induced anaphylaxis. Ebisawa et al. (2003) reported 7 cases of allergy to cuttlefish among a series of 305 pediatric cases of food allergy but provided no specifics on the circumstances or symptoms of these patients.

H. Food-dependent, exercise-induced molluscan shellfish allergy With food allergies, some individuals react only when they eat the particular food in conjunction with exercise. Several such cases have been described for molluscan shellfish. In one of the earliest reports of exercise-induced food anaphylaxis, the provocateurs were oysters and shrimp for an adult male in conjunction with long-distance running (Maulitz et al., 1979). A 17-year-old female experienced urticaria, dyspnea, syncope, and hypotension while riding a bicycle after eating Lapas shellfish, a type of limpet (Juji et al., 1990). This same patient later experienced a similar reaction from running after eating Turbo cornutus, a marine snail.

158

Steve L. Taylor

This reaction was confirmed using an exercise challenge. Evidence of a cross-reaction with keyhole limpet was also provided. A 14-year-old male experienced asthma and severe anaphylaxis on several occasions after running or swimming following the ingestion of snails (Longo et al., 2000). No exercise challenge was reported to confirm this history. A positive RAST to snail, crab, and dust mite was reported. Caffarelli et al. (1996) described the case of a 14 year-old female who experienced dyspnea, hoarseness, facial and neck swelling, and diffuse urticaria after eating cuttlefish and playing volleyball; an exercise challenge confirmed the reaction. In a questionnaire survey of school children in Japan, one student was identified with squid-associated exercise-induced anaphylaxis after playing soccer (Tanaka, 1994), although exercise challenge was not conducted to confirm the reaction. In an investigation of 11 cases of foodassociated exercise-induced anaphylaxis, Dohi et al. (1991) described two mite-sensitized young women who reported histories of exercise-induced reactions associated with ingestion of molluscan shellfish. The first patient had episodes associated with crab and shrimp as well as squid. The squid reaction occurred after playing tennis. The second patient had reactions to abalone after either bicycling or running. Miyake et al. (1988a) reported three cases of food-dependent, exercise-induced anaphylaxis in male children. One of these cases involved ingestion of either squid or shrimp associated with playing volleyball and was described more fully in another report (Miyake et al., 1988b).

I. Occupational allergies to molluscan shellfish Occupational allergies can also occur in the food industry. In these cases, individuals experience reactions from the inhalation or skin contact with the offending food. They may or may not be able to eat the offending food safely. Occupational contact with various seafoods, either by skin contact or inhalation, is a rather well-known cause of occupational allergies (Jeebhay et al., 2001). Molluscan shellfish have been less commonly implicated in these occupational allergies than other seafoods such as crustacean shellfish and fish. Several cases have been described of occupational allergies to molluscan shellfish. These reactions can be provoked by either the shells or the meat of the mollusks. The mechanisms involved in these occupational allergies are often not well investigated but can involve IgEmediated, immediate hypersensitivity reactions or cell-mediated, delayed hypersensitivity reactions. With respect to the shellfish meat, asthma and contact urticaria were reported in a restaurant worker from the handling of scallops (Goetz and Whisman, 2000). Inhalation of lyophilized clam in a factory producing freeze-dried clam was reported as a cause of occupational asthma (Desjardins et al., 1995). Occupational asthma has also been linked

Molluscan Shellfish Allergy

159

to abalone (Clarke, 1979), mussels (Nava et al., 1983), and clam liver extract in a laboratory research scientist (Karlin, 1979). Cases of contact dermatitis have been described from cuttlefish in a restaurant worker (Burches et al., 1992), squid, oysters, mussels, and scallops among several different restaurant workers (Freeman and Rosen, 1991), oysters in oyster shuckers (Yamura and Kurose, 1966), fisherman from handling of cuttlefish (Olszanski and Kotlowski, 1997; Tomaszunas et al., 1988), and mussels in mussel processors (Glass et al., 1998; Zhoutyi and Borzov, 1973). A single case of contact urticaria in a restaurant cook was linked to squid (Valsecchi et al., 1996). In the most significant report of occupational allergy, Tomaszunas et al. (1988) identified 66 deep-sea fishermen with occupational allergies, principally asthma, as a result of handling cuttlefish. Occupational asthma from cuttlefish has also been reported among 50 fishermen (Olszanski and Kotlowski, 1997). The dust from mollusk shells can also provoke occupational allergies. Inhalation of mollusk shell dust in a nacre button factory was associated with hypersensitivity pneumonitis (Orriols et al., 1990, 1997). A similar case was identified in Korea (Kim et al., 1982). Several Japanese investigators have described occupational asthma occurring among workers who culture oysters (Nakashima, 1969; Wada et al., 1967). Exposure to dust from mother-of-pearl in a souvenir maker (Tas, 1972) and to cuttlefish bones in a jewelry polisher (Beltrami et al., 1989) was linked to occupational asthma.

V. MOLLUSCAN SHELLFISH ALLERGENS The major allergen of molluscan shellfish is tropomyosin, a muscle protein. The term major allergen is used to define proteins that elicit IgE binding in the sera of half or more of patients with allergies to the specific source (Metcalfe et al., 1996). Tropomyosin is a ubiquitous muscle protein in all animals. Tropomyosin is a 34- to 36-kDa protein that is highly water soluble and heat stable as evidenced by the fact that tropomyosin can be isolated from the water used to boil shrimp (Daul et al., 1994). Tropomyosin can actually be found in both muscle and many nonmuscle cells in animals. In muscle cells, tropomyosin is associated with the thin filaments in muscle and plays a role in the contractile activity of muscle cells. In nonmuscle cells, tropomyosin is found in microfilaments but its function is less well understood. Tropomyosins are present in all eukaryotic cells. Different isoforms of tropomyosin are found in different types of muscle cells (skeletal, cardiac, smooth), brain, fibroblasts, and other nonmuscle cells. While these tropomyosins are highly homologous, small differences do exist in their

160

Steve L. Taylor

amino acid sequences. These differences may be important in the various functions of tropomyosins in muscle and nonmuscle cells. Tropomyosin is a well-known allergenic protein. Tropomyosin was first identified as the major allergen from shrimp (Daul et al., 1994; Shanti et al., 1993). Tropomyosin is now recognized as a pan-allergen among invertebrate animal species (Reese et al., 1999). Allergenic tropomyosins have been found in many invertebrate species including crustacean shellfish (shrimp, crab, lobster, etc.), arachnids (house dust mites), insects (e.g., cockroaches), and molluscan shellfish (e.g., squid, octopus, cuttlefish, mussel, scallop, and oyster) (Reese et al., 1999). Table 4.4 contains a list of allergenic tropomyosins from various molluscan shellfish species. As shown in Table 4.4, tropomyosin has been identified as the major allergen of gastropod species including abalone, whelk, and turban shell, bivalve species such as clam, mussel, oyster, and scallop, and cephalopod species including squid, cuttlefish, and octopus. While tropomyosin is also a known allergen of snails, it appears to be a more minor allergen in snails (Asturias et al., 2002).

TABLE 4.4 Tropomyosin allergens from molluscan shellfish species Species

Allergen

Reference

Snail (Helix aspersa) Abalone (Haliotis discus) Abalone (Haliotis midae) Abalone (Haliotis rufescens) Common whelk (Buccinum undatum) Turban shell (Turbo cornutus) Fan shell (Pinna atropurpurea) Razor clam (Ensis macha) Mussel (Perna viridis) Oyster (Crassostrea gigas)

Hel as 1 Hal d 1 Hal m 2 Hal r 1

Asturias et al., 2002 Choi et al., 2003 Lopata et al., 1997 Chu et al., 2000

Buc u 1

Lee and Park, 2004

Tur c 1

Ishikawa et al., 1998c

Pin a 1

Leung and Chu, 1998

Ens m 1 Per v 1 Cra g 1

Scallop (Chlamys nobilis)

Chl n 1

Octopus (Octopus vulgaris) Squid (Todarodes pacificus)

Oct v 1

Jimenez et al., 2005 Chu et al., 2000 Ishikawa et al., 1997; Ishikawa et al., 1998a; Leung and Chu, 2001 Chu et al., 2000; Lu et al., 2004 Ishikawa et al., 2001

Tod p 1

Miyazawa et al., 1996

Molluscan Shellfish Allergy

161

The IgE-binding epitopes of tropomyosin have been elucidated in some cases. Evidence exists for the presence of both common and crossreactive and more species-specific epitopes (EFSA, 2006). As will be discussed later, the diversity in epitopes likely explains the lack of uniform allergic cross-reactivity that is observed clinically. One of the primary IgEbinding epitopes of the oyster allergen, Cra g 1, has been identified as IQLLEEDMERSEER (Ishikawa et al., 1998a, 1999). Another oyster allergen, Cra g 2, contains an identical epitope (Ishikawa et al., 1998b); this may be another isoform of tropomyosin. The tropomyosin epitope in the gastropod species, T. cornutus, is different and resides at the carboxyl-terminal region of the protein (Ishikawa et al., 1998a). In fact, the carboxyl-terminal region of tropomyosins is highly conserved across both molluscan and crustacean shellfish species (Chu et al., 2000). The epitope region for Cra g 1 falls within a segment of the tropomyosin molecule that is more highly variable (Chu et al., 2000). While invertebrate tropomyosins are likely pan-allergens, vertebrate tropomyosins appear to be nonallergenic (Reese et al., 1999). Using bioinformatics approaches to compare the sequences of tropomyosins from various species, Goodman et al. (2002) determined that tropomyosins from vertebrate species — rabbit, pig, chicken, and human — share 53–57% amino acid sequence identity to the known shrimp tropomyosin allergen, Met e 1. This comparison likely explains why vertebrate tropomyosins are not allergenic and do not cross-react with IgE antibodies specific to invertebrate tropomyosins. Fig. 4.1 provides a percent identity matrix for the amino acid sequences of tropomyosins from a range of invertebrate and vertebrate species. As previously noted by Goodman et al. (2002), the vertebrate tropomyosins show between 50% and 60% amino acid sequence identity with all invertebrate tropomyosins. However, the amino acid sequence identities are higher for the molluscan tropomyosins ranging from 68% to 88% and even higher within the various classes of molluscan shellfish — 91–100% among cephalopod tropomyosins, 70–100% among tropomyosins from bivalves, and 85–97% among gastropod tropomyosins. The amino acid sequence identities for crustacean versus molluscan tropomyosins range from 56 to 68%, only slightly higher than the comparison to vertebrate tropomyosins. The comparison to mite and cockroach tropomyosins shows 56–66% amino acid sequence identity with molluscan tropomyosins. Evidence suggests that tropomyosin is not the only molluscan shellfish allergen. Non-tropomyosin allergens have been identified in a number of molluscan shellfish species including the gastropods: snail (Amoroso et al., 1988; Asturias et al., 2002; Guilloux et al., 1998), pen shell (Leung et al., 1996) whelk (Lee and Park, 2004; Leung and Chu, 1998a,b; Leung et al., 1996), fan shell (Leung and Chu, 1998a,b) abalone

Even-toed ungulates

Rabbits and hares

A

C

D

E

F

G

H

I

J

K

L

M

N

O

P

Q

R

S

T

U

V

W

X

Y

Z

AA

BB

86

81

81

81

80

82

88

80

74

74

74

70

72

72

60

62

62

63

63

61

63

62

52

55

54

46 45

Primates

Roaches

Bivalves

Mites and ticks

Primates

Haliotis diversicolor Haliotis rufescens (California red abalone) Helix aspersa (brown garden snail) Ommastrephes bartramii (red flying squid) Sepioteuthis lessoniana (Bigfin reef squid) Sepia esculenta (golden cuttlefish) Todarodes pacificus (Japanese flying squid) Octopus vulgaris (common octopus) Crassostrea virginica (eastern oyster) Crassostrea gigas (Pacific oyster) Mytilus galloprovincialis (Mediterranean mussel) Mytilus edulis (edible mussel) Perna viridis Chlamys nipponensis (Japanese scallop) Mizuhopecten yessoensis (Yesso scallop) Mimachlamys nobilis Charybdis feriatus (crab) Homarus americanus (American lobster) Panulirus stimpsoni Homarus americanus (American lobster) Farfantepenaeus aztecus (pen a 1) Periplaneta americana (American cockroach) Dermatophagoides pteronyssinus (dust mite) Lepidoglyphus destructor Homo sapiens (human) Homo sapiens (human) Sus scrofa (pig) Oryctolagus cuniculus (rabbit)

Crustaceans

B 97

Cephalopods

A 100

Gastropods Gastropods Gastropods Gastropods Cephalopods Cephalopods Cephalopods Cephalopods Cephalopods Bivalves Bivalves Bivalves Bivalves Bivalves Bivalves Bivalves Bivalves Crustaceans Crustaceans Crustaceans Crustaceans Crustaceans Roaches Mites and ticks Mites and ticks Primates Primates Even-toed ungulates Rabbits and hares

B

97 100

85

78

79

78

78

79

86

78

72

72

71

68

70

70

59

61

60

61

61

60

62

61

51

53

52

C

86

85 100

84

84

84

82

83

88

80

71

70

70

71

72

72

63

63

63

64

64

63

65

64

52

56

55

46

D

81

78

84 100

100

99

96

92

88

79

71

71

70

70

71

71

63

63

62

63

63

61

64

64

52

54

53

47

E

81

79

84 100

100

98

96

92

88

79

71

71

70

70

71

71

62

63

62

63

63

61

64

64

52

54

53

47

F

81

78

84

99

98 100

98

92

88

80

71

71

70

71

71

71

63

64

63

64

63

61

65

64

52

54

54

47

G

80

78

82

96

96

98 100

91

88

79

71

70

69

70

70

70

61

63

62

63

63

61

64

64

52

54

53

47

H

82

79

83

92

92

92

91 100

89

80

71

71

70

72

73

72

63

64

63

64

64

62

64

63

54

55

55

48

I

88

86

88

88

88

88

88

89 100 100

84

84

84

78

79

79

66

67

68

67

68

65

66

66

53

55

55

46

J

80

78

80

79

79

80

79

80 100 100

75

75

76

72

73

73

62

65

65

64

64

62

63

63

53

55

55

47

K

74

72

71

71

71

71

71

71

84

75 100 100

94

70

71

70

56

58

57

57

57

57

56

56

48

51

50

42

L

74

72

70

71

71

71

70

71

84

75 100 100

94

69

71

70

56

57

56

57

57

57

56

56

48

51

50

42

M

74

71

70

70

70

70

69

70

84

76

94 100

69

70

70

55

57

55

56

56

56

55

55

49

51

50

43

N

70

68

71

70

70

71

70

72

78

72

94

95

92

O

72

70

72

71

71

71

70

73

79

73

71

71

70

95 100

92

57

58

56

57

57

56

60

59

50

51

51

44

P

72

70

72

71

71

71

70

72

79

73

70

70

70

69

70

69 100 92

92 100

58

57

59

58

57

57

58

58

58

57

56

56

60

59

59

58

50

51

51

53

51

52

44

45

Q

60

59

63

63

62

63

61

63

66

62

56

56

55

57

57

58 100

97

91

92

92

85

83

80

56

59

59

52

R

62

61

63

63

63

64

63

64

67

65

58

57

57

58

58

59

97 100

94

95

93

82

83

81

55

57

57

51

S

62

60

63

62

62

63

62

63

68

65

57

56

55

57

56

57

91

94 100

82

81

80

53

55

55

49

99

98

T

63

61

64

63

63

64

63

64

67

64

57

57

56

58

57

58

92

95

99 100

99

82

81

81

54

56

57

50

U

63

61

64

63

63

63

63

64

68

64

57

57

56

57

57

58

92

93

98

99 100

82

81

80

54

56

56

50 48

V

61

60

63

61

61

61

61

62

65

62

57

57

56

56

56

56

85

82

82

82

82 100

81

79

52

55

55

W

63

62

65

64

64

65

64

64

66

63

56

56

55

59

60

60

83

83

81

81

81

81 100

96

56

58

58

51

X

62

61

64

64

64

64

64

63

66

63

56

56

55

58

59

59

80

81

80

81

80

79

96 100

56

58

57

51

Y

52

51

52

52

52

52

52

54

53

53

48

48

49

51

50

50

56

55

53

54

54

52

56

56 100

86

85

82

Z

55

53

56

54

54

54

54

55

55

55

51

51

51

53

51

51

59

57

55

56

56

55

58

58

86 100

98

73

AA BB

54 46

52 45

55 46

53 47

53 47

54 47

53 47

55 48

55 46

55 47

50 42

50 42

50 43

52 45

51 44

51 44

59 52

57 51

55 49

57 50

56 50

55 48

58 51

57 51

85 82

98 100 72 73 72 100

FIGURE 4.1 Percent identity matrix for tropomyosins from molluscan shellfish, crustacean shellfish, insects and mites, and vertebrate sources. Compiled with the assistance of John C. Wise, Bioinformatics Specialist, University of Nebraska, Food Allergy Research & Resource Program.

Molluscan Shellfish Allergy

163

(Choi et al., 2003; Maeda et al., 1991; Morikawa et al., 1990), and limpet (Azofra and Lombardero, 2003; Maeda et al., 1991; Morikawa et al., 1990); the bivalves: oyster (Leung and Chu, 1998; Leung et al., 1996), scallop (Leung and Chu, 1998; Leung et al., 1996), and razor clam (Jimenez et al., 2005); and the cephalopods: squid (Leung and Chu, 1998; Leung et al., 1996), octopus (Leung and Chu, 1998; Leung et al., 1996), and cuttlefish (Lin et al., 1993). These non-tropomyosin allergens remain mostly unidentified. However, several of them have been proposed to be hemocyanin (Juji et al., 1990; Koshte et al., 1989; Maeda et al., 1991; Mistrello et al., 1992; Morikawa et al., 1990), myosin heavy chain (Martins et al., 2005), and amylase (Azofra and Lombardero, 2003). The cross-reactivity of these allergens is not as well defined as tropomyosin. As one example, the 49-kDa allergen from abalone, Haliotis midae, has been designated as Hal m 1 by the International Union of Immunological Societies (IUIS). Five abalone-allergic subjects displayed IgE binding to Hal m 1 and to a second major allergen of 38 kDa which is probably tropomyosin (Lopata et al., 1997). That allergen is designated as Hal m 2 in Table 4.4, although it has not received a formal designation by IUIS. The clinical significance of these non-tropomyosin allergens remains to be determined for the most part. Evidence exists for cross-reacting allergens in other molluscan shellfish species including Turban shell, whelk, short-neck clam, clam, and mussel (Ishikawa et al., 1999; Leung et al., 1996).

VI. CROSS-REACTIONS Solid evidence exists to indicate that tropomyosins are pan-allergen among invertebrate species (Reese et al., 1999). However, nontropomyosin allergens also exist in at least some species of molluscan shellfish. The clinical picture of cross-reactivity is more complex than might be anticipated.

A. Between molluscan shellfish species Clearly, some individuals with molluscan shellfish allergy are reactive to all species of molluscan shellfish. Cross-reactivity has been established by clinical history, challenge trials (in a few instances), skin prick testing, and IgE-binding studies. Most clinical studies of cross-reactivity have been limited to a few species often within one class of molluscan shellfish. However, the totality of the evidence indicates that individuals with documented reactivity to one molluscan species and evidence of IgE against that species should be counseled to avoid other molluscan shellfish species. This recommendation is especially prudent for the individual classes of molluscan shellfish: gastropods, bivalves, and cephalopods.

164

Steve L. Taylor

The degree of amino acid sequence homology between the tropomyosin allergens of molluscan shellfish species also supports this recommendation as documented in Fig. 4.1. The tropomyosins of several cephalopod species including squid, cuttlefish, and octopus share 91–100% amino acid sequence identity similar to findings of 92–96% previously reported by Motoyama et al. (2006). The tropomyosins of several bivalve species including oyster, mussel, clam, and scallop share 70–100% amino acid sequence identity. The tropomyosins of several gastropod species including abalone and snail share 85–97% amino acid sequence identity. Overall, within the entire molluscan shellfish grouping, amino acid sequence identities for tropomyosin range from 68% to 100% (Fig. 4.1). By contrast, the degree of amino acid sequence identity for the tropomyosins is lower between crustacean and molluscan shellfish species at 56–68% and lower yet for various vertebrate species at 47–55% (Fig. 4.1). However, clinical evidence of cross-reactivity among the various species of molluscan shellfish is not invariably found. Lopata et al. (1997) noted significant evidence of cross-reactions among molluscan shellfish species in patients allergic to abalone. However, Carrillo et al. (1992) identified no cross-reactivity between squid and octopus (both cephalopods) or other molluscan shellfish species but did find evidence of crossreactions with shrimp. Similarly, a single patient with cuttlefish allergy (another cephalopod) tolerated octopus and other molluscan shellfish species but reacted to crab and shrimp (Shibasaki et al., 1989). While Van Ree et al. (1996a) found no significant differences between the allergens of terrestrial and sea snails, Vuitton et al. (1998) noted that only four of seven patients with allergy to terrestrial snails also indicated reactivity to sea snails. Case reports exist of isolated allergy to octopus (Caiado et al., 2007) and snail (San Miguel-Moncin et al., 2007). In both of these cases, evidence indicated that tropomyosin was not the responsible allergen so the non-tropomyosin allergens may assume more importance in such cases. Certainly, if tropomyosin is the major allergen for most of these patients, the clinical cross-reactivity does not match the degree of amino acid sequence identity very well. If the epitopes on tropomyosin are located in variable regions where the amino acid sequence does vary, this could explain the observed clinical cross-reactivity patterns. The differences among various clinical cases may suggest that all patients do not respond to the same epitopes. In their telephone-based survey of individuals with seafood allergies, Sicherer et al. (2004) identified 67 individuals with self-reported allergy to molluscan shellfish. The inquiries were isolated to clam, scallop, oyster, and mussel which all belong in the bivalve class. Of these 67 individuals, 34 (51%) reported reactions to only 1 species, 13 (19%) to 2 species, 5 (8%) to 3 species, and 15 (22%) to all 4 species. Obviously, the interpretation of this observation is limited because diagnostic confirmation of survey

Molluscan Shellfish Allergy

165

responses was not done. Wu and Williams (2004) evaluated 70 patients from Hong Kong, who were sensitized to molluscan shellfish including 28 patients with a history of severe anaphylaxis. Each of these patients underwent SPTs with extracts of five different species of molluscan shellfish (scallop, clam, oyster, abalone, and limpet). Within this group, the probability of a positive skin test was highest for limpet (0.45) followed by abalone (0.32), oyster (0.21), clam (0.16), and scallop (0.13). The probability of cross-reactive SPTs among the bivalves (scallop, clam, and oyster) ranged from 0.33 (oyster and either clam or scallop) to 0.67 (scallop and clam). The probability of cross-reactive SPTs was higher among the gastropods (limpet and abalone) with a 79% likelihood that an abalonesensitized patient would react to limpet and a 54% likelihood that a limpet-sensitized patient would react to abalone. Curiously, the probability that an individual sensitized to a bivalve species would also be sensitized to limpet or abalone ranged from 0.42 to 0.88, while the probability that an abalone- or limpet-sensitized patient would also be sensitized to one of the bivalve species ranged from 0.18 to 0.25. If tropomyosin is indeed the major allergen for most of these subjects, a higher concordance of results might have been expected. The clinical cross-reactivity among crustacean species is generally higher (Waring et al., 1985; Wu and Williams, 2004).

B. Between molluscan and crustacean shellfish species Cross-reactivity between molluscan and crustacean shellfish species also occurs rather frequently. Since tropomyosin is the major allergen in both molluscan and crustacean shellfish, the frequency of cross-reactions is not surprising. Allergy to crustacean shellfish is more frequently diagnosed than molluscan shellfish allergy (Hefle et al., 2007). Many of these individuals may be at risk of reactions to molluscan shellfish also. Appropriately, most individuals with either molluscan or crustacean shellfish allergy are advised to avoid all shellfish. However, cross-reactivity between molluscan and crustacean shellfish is not invariably found. In a telephone-based survey of individuals with seafood allergies, only 14% reported allergic reactions to one or more crustaceans and one or more mollusks (Sicherer et al., 2004). This finding may be partially attributed to avoidance and lack of experience with many of the species following discovery and diagnosis of the original shellfish allergy. Among 70 individuals sensitized to shellfish on the basis of positive SPTs, 25 were sensitized to crustaceans only, 18 were sensitized to mollusks only, and 27 were sensitized to both crustacean and molluscan shellfish (Wu and Williams, 2004). In a study of 24 shellfishallergic children, Crespo et al. (1995) identified 23 with crustacean allergy but only 10 with allergies to molluscan shellfish. However, 9 of these 10

166

Steve L. Taylor

patients with molluscan shellfish allergy were also allergic to crustacean shellfish (Crespo et al., 1995). Laffond (1996) evaluated 38 shellfishallergic subjects and determined that 25 were sensitized to both crustaceans and mollusks, 12 to crustaceans only, and only 1 to mollusks only. Several investigators have noted that tropomyosin is a common allergen among both crustacean and molluscan shellfish and have demonstrated in vitro cross-reactivity with IgE antibodies from patient sera (Leung and Chu, 1998; Leung et al., 1996; Motoyama et al., 2006; Reese et al., 1999). The tropomyosins of crustacean species share only 56–68% amino acid sequence identities with tropomyosins of molluscan shellfish species (Fig. 4.1). This is high enough to explain the in vitro crossreactivity in IgE binding. However, the existence of true clinical crossreactivity has not been documented by oral food challenge in most cases. Certainly, the cross-reactions between the molluscan and crustacean shellfish species require much more careful and definitive study. However, minor differences in the structures of tropomyosin between different molluscan and crustacean shellfish species could account for the noted differences. Sensitization to tropomyosin in a molluscan species, snail, is not always accompanied by sensitization to tropomyosin in a crustacean species, shrimp (Van Ree et al., 1996a). A second possibility is that unique allergens, other than tropomyosin, are involved with some species. More clinical studies on the cross-reactions between molluscan and crustacean shellfish species are needed to better define the frequency of cross-reactions and the identity of the allergens involved. Crossreactions have been studied in so few patients with shellfish allergy that it is impossible to make generalizations about the ideal avoidance diets for such individuals, although the avoidance of both molluscan and crustacean shellfish is probably prudent in the absence of other information.

C. Between molluscan shellfish and mites or insects Tropomyosin is also a major allergen in dust mites, known as Der p 10 and Der f 10, and in several species of cockroaches, Periplaneta americana — Per a 7 — and Blatella germanica — Bla g 1 (Aki et al., 1995; Asturias et al., 1998, 1999; Pomes et al., 1998; Santos et al., 1999). Clinically, a strong correlation exists between snail allergy and house dust mite allergy (Ardito et al., 1990; Banzet et al., 1992; DeMaat-Bleeker et al., 1995; Pajno et al., 2002; Sidenius et al., 2001; Van Ree et al., 1996a; among others). In most cases, it appears as though sensitization to dust mite occurred first (Meglio et al., 2002). However, a few cases exist where sensitization to snail occurred first (Martins et al., 2005; Van Ree et al., 1996a). This cross-reactivity occurs with amino acid sequence identity of 65% for tropomyosins of mite and snail. Clinically relevant cross-reactivity has also been observed for limpet and dust mite (Azofra and Lombardero, 2003).

Molluscan Shellfish Allergy

167

The tropomyosins of mite and insect species show some sequence identity (63–65%) with snail tropomyosin and share similar epitopes (EFSA, 2006; Fig. 4.1). Still, tropomyosin appears to play a minor role in the crossreactivity of dust mites and snails (Asturias et al., 2002; Guilloux et al., 1998; Van Ree et al., 1996a). Other non-tropomyosin allergens are likely to be involved including Der p 4 (amylase), Der p 5, Der p 7, and hemocyanin (Martins et al., 2005; Mistrello et al., 1992; Van Ree et al., 1996). While snail is the main molluscan shellfish species involved in cross-reactions with dust mites, some patients allergic to dust mites and snails are also sensitized to mussels (DeMaat-Bleeker et al., 1995; Van Ree et al., 1996b). In their study of 70 patients sensitized to molluscan shellfish, Wu and Williams (2004) noted that 90% were also sensitized to dust mites. However, the clinical significance of this sensitization was not documented.

D. Effect of processing on allergenicity of molluscan shellfish Little research has been conducted on the effect of processing on the allergenicity of molluscan shellfish. Empirical evidence suggests that molluscan shellfish are allergenic in both the raw and cooked states since they are commonly eaten in both forms. Tropomyosin is known to be heat stable and water soluble (Daul et al., 1994). The IgE-binding ability of scallop tropomyosin was enhanced by Maillard browning induced by heating in the presence of reducing sugars (Nakamura et al., 2005). In contrast, the IgE-binding ability of squid tropomyosin was decreased markedly by Maillard browning induced by heating in the presence of ribose, a reducing sugar (Nakamura et al., 2006). The interpretation of these findings is difficult because IgE binding may not always correlate with clinical allergenicity. The Maillard reaction may alter the solubility of proteins which could affect the assessment of in vitro IgE binding. The amount of tropomyosin extractable from squid, octopus, and cuttlefish was diminished by treatment with either 2.5 or 4.7 kGy of cobalt-60 gamma radiation (Sinanoglou et al., 2007). Although the cephalopod tropomyosin was less extractable and thus less detectable, its residual allergenicity remains unknown in the absence of clinical challenges of allergic patients.

E. Detection of residues of molluscan shellfish The only proven therapy for molluscan shellfish allergy is strict dietary avoidance. Problems may arise with avoidance diets when clam is present due to mislabeling or to cross-contact during food processing (Taylor and Hefle, 2005; Taylor et al., 1986, 1999). The food industry typically develops allergen control programs to prevent the occurrence of undeclared allergenic residues in other foods (Taylor et al., 2006). The industry often uses

168

Steve L. Taylor

enzyme-linked immunosorbent assays (ELISA) for the detection of residues of allergenic foods (Taylor and Nordlee, 1996). At present, no commercially available assays exist for the quantification of mollusk tropomyosin or other molluscan allergens (EFSA, 2006). An ELISA test kit has been developed and is currently in market for the detection of crustacean tropomyosin (Poms et al., 2004), but its ability to detect molluscan tropomyosin is not known. Sinanoglou et al. (2007) developed an ELISA for the detection of tropomyosin from squid, octopus, and cuttlefish with a detection limit of 0.05 ppm. However, the specifics of this ELISA were not provided and it is not commercially available for use by the food industry.

VII. CONCLUSION Molluscan shellfish allergy is assuming more public health importance since molluscan shellfish are designated as commonly allergenic foods in Canada and the European Union. Despite that designation, the prevalence of molluscan shellfish allergy appears to be relatively low in most geographic locales. The allergenicity of molluscan shellfish have been more poorly studied than their crustacean counterparts. Allergic reactions have been documented to most molluscan shellfish species and particularly to snail, abalone, whelk, limpet, clam, mussel, oyster, scallop, squid, octopus, and cuttlefish. Tropomyosin, a muscle protein, is likely the major allergen of molluscan shellfish allergen, although other proteins may also play important roles in allergenicity. More research on molluscan shellfish allergy seems warranted to better understand this condition and to improve the advice given to individuals with molluscan shellfish allergy with regard to their avoidance diets.

ACKNOWLEDGMENTS This research was conducted with a contribution of the University of Nebraska Agricultural Research Division, supported in part by funds provided through United States Department of Agriculture. Additional support was provided by the Food Allergy Research and Resource Program. Mention of a trade name, proprietary products, or company name is for presentation clarity and does not imply endorsement by the authors of the University of Nebraska.

REFERENCES Adolphson, C. R., Gleich, G. J., and Yunginger, J. W. (1986). Standardization of allergens. In ‘‘Manual of Clinical Immunology’’ (N. Rose, H. Friedman, and J. Fahey, eds.), pp. 652–659. ASM Press, Washington, DC.

Molluscan Shellfish Allergy

169

Aki, T., Kodama, T., Fujikawa, A., Miura, K., Shigeta, S., Wada, T., Jyo, T., Murooka, Y., Oka, S., and Ono, S. (1995). Immunochemical characterization of recombinant and native tropomyosins as a new allergen from the house dust mite, Dermatophagoides farinae. J. Allergy Clin. Immunol. 96, 74–83. Altman, D. R., and Chiaramonte, L. T. (1997). Public perception of food allergy. Environ. Toxicol. Pharmacol. 4, 95–99. Amaroso, S., Cocchiara, R., Locorotondo, G., Parlato, A., Lampiasi, N., Albeggiani, G., Falagiani, P., and Geraci, D. (1988). Antigens of Euparipha pisana (snail). I. Identification of allergens by means of in vivo and in vitro analysis. Int. Arch. Allergy Appl. Immunol. 85, 69–75. Andre, F., Andre, C., Colin, L., and Cavagna, S. (1995). IgE in stools as indicator of food sensitization. Allergy 50, 328–333. Arai, Y., Sano, Y., Ito, K., Iwasaki, E., Mukouyama, T., and Baba, M. (1998). Food and food additives hypersensitivity in adult asthmatics. I. Skin scratch test with food allergens and food challenges in adult asthmatics. Arerugi 47, 658–666. Ardito, S., Falgiani, P., Giannoccaro, F., Munno, G., Riva, G., Ferrannini, A., and Turisi, A. (1990). Reazione all’ingestione di lumache del genere Helix pomatia e possible rapporto con la sensibilizzazione ai dermatofagoidi. Folia Allergol. Immunol. Clin. 37, 199–204. Asturias, J. A., Arilla, M. C., Gomez-Bayon, N., Martinez, A., Martinez, J., and Palacios, R. (1998). Sequencing and high level rustacean in Escherichia coli of the tropomyosin (Der p 10) from Dermatophagoides pteronyssinus. Biochim. Biophys. Acta 1397, 27–30. Asturias, J. A., Gomez-Bayon, N., Arilla, M. C., Martinez, A., Palacios, R., SanchezGascon, F., and Martinez, J. (1999). Molecular characterization of American cockroach tropomyosin (Periplaneta americana allergen 7), a cross-reactive allergen. J. Immunol. 162, 4342–4348. Asturias, J. A., Eraso, E., Arilla, M. C., Gomez-Bayon, N., Inacio, F., and Martinez, A. (2002). Cloning, isolation, and IgE-binding properties of Helix aspersa (brown garden snail) tropomyosin. Int. Arch. Allergy Immunol. 128, 90–96. Azofra, J., and Lombardero, M. (2003). Limpet anaphylaxis: Cross-reactivity between limpet and house-dust mite Dermatophagoides pteronyssinus. Allergy 58, 146–149. Banzet, M. L., Adessi, B., Vuitton, D. A., and L’Amecoforcal, (1992). Manifestations allergiques apre`s ingestion d’escargots chez 12 maladies allergiques aux acariens: une nouvelle allergie croisee? Rev. Fr. Allergol. 32, 198–202. Beltrami, V., Innocenti, A., Pieroni, M. G., Civai, R., Nesi, D., and Bianco, S. (1989). Occupational asthma due to cuttle-fish bone dust. Med. Lav. 80, 425–428. Bock, S. A. (1982). The natural history of food sensitivity. J. Allergy Clin. Immunol. 69, 173–177. Bock, S. A., and Atkins, F. M. (1989). The natural history of peanut allergy. J. Allergy Clin. Immunol. 83, 900–904. Bock, S. A., Buckley, J., Holst, A., and May, C. D. (1977). Proper use of skin tests with food extracts in diagnosis of hypersensitivity to food in children. Clin. Allergy 7, 375–383. Bock, S. A., Munoz-Furlong, A., and Sampson, H. A. (2007). Further fatalities caused by anaphylactic reactions to foods, 2001–2006. J. Allergy Clin. Immunol. 119, 1016–1018. Bock, S. A., Sampson, H. A., Atkins, F. M., Zeiger, R. S., Lehrer, S., Sachs, M., Bush, R. K., and Metcalfe, D. D. (1988). Double-blind, placebo-controlled food challenge (DBPCFC) as an office procedure: A manual. J. Allergy Clin. Immunol. 82, 986–997. Bock, S. A., Munoz-Furlong, A., and Sampson, H. A. (2001). Fatalities due to anaphylactic reactions. J. Allergy Clin. Immunol. 107, 191–193. Bousquet, J., Bjorksten, B., Bruijnzeel-Koomen, C. A. F. M., Huggett, A., Ortolani, C., Warner, J. O., and Smith, M. (1998). Scientific criteria and the selection of allergenic foods for labeling. Allergy 53, 3–21. Brusca, R. C., and Brusca, G. J. (1990). ‘‘Invertebrates’’. Sinauer Associates, Inc., Suderland, MA.

170

Steve L. Taylor

Burches, E., Morales, C., and Pelaez, A. (1992). Contact dermatitis from cuttlefish. Contact Dermatitis 26, 277. Bush, R. K., and Hefle, S. L. (1996). Food allergens. Crit. Rev. Food Sci. Nutr. 36S, S119–S163. CAC (1999). Report of the Twenty-third Session of the Codex Alimentarius Commission. Alinorm 99/37, Rome. Caffarelli, C., Perrone, F., and Terzi, V. (1996). Exercise-induced anapylaxis related to cuttlefish intake. Eur. J. Pediatr. 155, 1025–1026. Caiado, J., Lundberg, M., Oman, H., Pedro, E., Pereira-Santos, M., and Periera Barbosa, M. (2007). Isolated snail allergy without house dust mites sensitisation: Case report. Allergy 62(Suppl. 83), 218. Carrillo, T., De Castro, F. R., Cuevas, M., Caminero, J., and Cabrera, P. (1991). Allergy to limpet. Allergy 46, 515–519. Carrillo, T., Castillo, R., Caminero, J., Cuevas, M., Rodriguez, J. C., Acosta, O., and De Castro, F. R. (1992). Squid hypersensitivity: A clinical and immunologic study. Ann. Allergy 68, 483–487. Carrillo, T., De Castro, F. R., Blanco, C., Castillo, R., Quiralte, J., and Cuevas, M. (1994). Anaphylaxis due to limpet ingestion. Ann. Allergy 73, 504–508. Castillo, R., Carrilo, T., Blanco, C., Quiralte, J., and Cuevas, M. (1994). Shellfish hypersensitivity: Clinical and immunological characteristics. Allergol. Immunopathol. 22, 83–87. Castillo, R., Delgado, J., Quiralte, J., Blanco, C., and Carillo, T. (1996). Food hypersensitivity among adult patients: Epidemiological and clinical aspects. Allergol. Immunopathol. 24, 93–97. Chehade, M., Nowak-Wegrzyn, A., Kaufman, S. S., Fishbein, T. M., Tschernia, A., and LeLeiko, N. S. (2004). De novo food allergy after intestinal transplantation: A report of three cases. J. Pediatr. Gastroenterol. Nutr. 38, 545–547. Choi, J. H., Yoon, S. H., Suh, Y. J., Suh, C. H., Nahm, D. H., Kim, Y. K., Min, K. U., and Park, D. H. (2003). Measurement of specific IgE to abalone (Haliotis discus hannai) and identification of IgE-binding components. Korean J. Asthma Allergy Clin. Immunol. 23, 349–357. Chu, K. H., Wong, S. H., and Leung, P. S. C. (2000). Tropomyosin is the major mollusk allergen: Reverse transcriptase polymerase chain reaction, expression and IgE reactivity. Mar. Biotechnol. 2, 499–509. Church, M. K., Holgate, S. T., Shute, J. K., Walls, A. E., and Sampson, A. P. (1998). Mast cell-derived mediators. In ‘‘Allergy: Principles and Practice, Vol. I’’ (E. Middleton, C. E. Reed, E. F. Ellis, N. F. Adkinson, J. W. Yunginger, and W. W. Busse, eds.), 5th Ed., pp. 146–167. Mosby, St. Louis, MO. Cianferoni, A., Novembre, E., Mugnaini, L., Lombardi, E., Bernardini, R., Pucci, N., and Vierucci, A. (2001). Clinical features of acute anaphylaxis in patients admitted to a university hospital: An 11-year retrospective review. Ann. Allergy Asthma Immunol. 87, 27–32. Clarke, P. A., (1979). Immediate respiratory hypersensitivity to abalone (letter). Med. J. Aust. 1, 623. Cooke, R. A., and Vander Veer, A. (1916). Human sensitization. J. Immunol. 1, 201–305. Crespo, J. F., Pascual, C., Burks, A. W., Helm, R. M., and Esteban, M. M. (1995). Frequency of food allergy in a pediatric population from Spain. Pediatr. Allergy Immunol. 6, 39–43. Daul, C. B., Slattery, M., Reese, G., and Lehrer, S. B. (1994). Identification of the major brown shrimp (Penaeus aztecus) allergen (Pen a 1) as the muscle protein tropomyosin. Int. Arch. Allergy Immunol. 105, 49–55. De la Cuesta, C. G., Garcia, B. E., Cordoba, H., Dieguez, I., and Oehling, A. (1989). Food allergy to Helix terrestre (snail). Allergol. Immunopathol. 17, 337–339. DeMaat-Bleeker, F., Akkerdas, J. H., VanRee, R., and Aalberse, R. C. (1995). Vineyard snail allergy possibly induced by sensitization to house dust mite. Ann. Allergy 50, 438–440.

Molluscan Shellfish Allergy

171

Desjardins, A., Malo, J. L., L’Archeveque, J., Cartier, A., McCants, M., and Lehrer, S. B. (1995). Occupational IgE-mediated sensitization and asthma caused by clam and shrimp. J. Allergy Clin. Immunol. 96, 608–617. Dohi, M., Suko, M., Sugiyama, H., Yamashita, N., Tadokoro, K., Juji, F., Okudaira, H., Sano, Y., Ito, K., and Miyamoto, T. (1991). Food-dependent, exercise-induced anaphylaxis: A study on 11 Japanese cases. J. Allergy Clin. Immunol. 87, 34–40. Ebisawa, M., Ikematsu, K., Imai, T., and Tachimoto, H. (2003). Food allergy in Japan. Allergy Clin. Immunol. Int. 15, 214–217. Erikson, N. E., Moller, C., Werner, S., Magnusson, J., Bengtsson, U., and Zoloubas, M. (2004). Self-reported food hypersensitivity in Sweden, Denmark, Estonia, Lithuania, and Russia. J. Investig. Allergol. Clin. Immunol. 14, 70–79. European Food Safety Authority. (2006). Opinion of the scientific panel on dietetic products, nutrition and allergies on a request from the Commission related to the evaluation of molluscs for labelling purposes. EFSA J. 327, 1–25. Faeste, C. K., Wiker, H. G., Lovik, M., and Egaas, E. (2003). Hidden shellfish allergen in a fish cake. Allergy 58, 1204–1205. Falcao, H., Lunet, N., Lopes, C., and Barros, H. (2004). Food hypersensitivity in Portuguese adults. Eur. J. Clin. Nutr. 58, 1621–1625. FAO (1995). Food Allergies. Report of the Technical Consultation of the Food and Agriculture Organization of the United Nations/World Health Organization, Rome. Freeman, S. and Rosen, R. H. (1991). Urticarial contact dermatitis in food handlers. Med. J. Aust. 155, 91–94. French Allergy Vigilance Network (2006a). Reseau d’Allergo Vigilance. Declaration d’accident grave alimentaire: cas no. 402 a 434. Cerc. Invest. Clin. Biol. Allergol. Aliment. 11, 175–189. French Allergy Vigilance Network (2006b). Evaluation des anaphylaxies severes declarees au 1er semester 2006 comparativement aux annees precedents. Cerc. Invest. Clin. Biol. Allergol. Aliment. 11, 233–235. Furukawa, C. T. (1988). Comparative trials including a beta 2 adrenergic agonist, a methylxanthine, and a mast cell stabilizer. Ann. Allergy 60, 472–476. Glass, W. I., Power, P., Burt, R., Fishwick, D., Bradshaw, L. M., and Pearce, N. E. (1998). Work-related respiratory symptoms and lung function in New Zealand mussel openers. Am. J. Ind. Med. 34, 163–168. Goetz, D. W., and Whisman, B. A. (2000). Occupational asthma in a seafood restaurant worker: Cross-reactivity of shrimp and scallops. Ann. Allergy Asthma Immunol. 85, 461–466. Gonzalez Galan, I., Garcia Menaya, J. M., Jimenez Ferrera, G., and Gonzalez Mateos, G. (2002). Anaphylactic shock to oysters and white fish with generalized urticaria to prawns and white fish. Allergol. Immunopathol. 30, 300–303. Goodman, R. E., Silvanovich, A., Hileman, R. E., Bannon, G. A., Rice, E. A., and Astwood, J. D. (2002). Bioinformatic methods for identifying known or potential allergens in the safety assessment of genetically modified crops. Comm. Toxicol. 8, 251–269. Grembiale, R. D., Naty, S., Pelaia, G., Tranfa, C. M. E., and Marisco, S. A. (1996). Snail ingestion and asthma. Allergy 51, 361. Guilloux, L., Vuitton, D. A., Delbourg, M., Lagier, A., Adessi, B., Marchand, C. R., and Ville, G. (1998). Cross-reactivity between terrestrial snails (Helix species) and housedust mite (Dermatophagoides pteronyssinus). II. In vitro study. Allergy 53, 151–158. Hefle, S. L., and Bush, R. K. (2001). Seafood allergies. In ‘‘Wilderness Medicine’’ (P. S. Auerbach, ed.), 4th ed., pp. 1327–1337. Mosby, Inc., St. Louis, MO. Hefle, S. L., Nordlee, J. A., and Taylor, S. L. (1996). Allergenic foods. Crit. Rev. Food Sci. Nutr. 36S, S69–S89. Hefle, S. L., Bush, R. K., and Taylor, S. L. (2007). Seafood allergies. In ‘‘Wilderness Medicine’’ (P. S. Auerbach, ed.), 5th Ed., pp. 1559–1566. Mosby/Elsevier, Philadelphia.

172

Steve L. Taylor

Hickman, C. P., Roberts, L. S., Larson, A., l’Anson, H., and Eisenhour, D. J. (2004). Molluscs— phylum mollusca. In ‘‘Integrated Principles of Zoology’’ (C. P. Hickman, L. S. Roberts, and A. Larson, eds.), 13th ed., pp. 326–354. McGraw Hill Higher Education, Boston. Hill, D. J., and Hosking, C. S. (1992). Patterns of clinical disease associated with cow milk allergy in childhood. Nutr. Res. 12, 109–121. Host, A., and Halken, S. (1990). A prospective study of cow’s milk allergy in Danish infants during the first three years of life. Allergy 45, 587–596. Ishikawa, M., Shimakura, K., Nagashima, Y., and Shiomi, K. (1997). Isolation and properties of allergenic proteins in the oyster Crassostrea gigas. Fish. Sci. 63, 610–614. Ishikawa, M., Ishida, M., Shimakura, K., Nagashima, Y., and Shiomi, K. (1998a). Tropomyosin, the major oyster Crassostrea gigas allergen and its IgE-binding epitopes. J. Food Sci. 63, 44–47. Ishikawa, M., Nagashima, Y., and Shiomi, K. (1998b). Identification of the oyster allergen Cra g 2 as tropomyosin. Fish. Sci. 64, 854–855. Ishikawa, M., Ishida, M., Shimakura, K., Nagashima, Y., and Shiomi, K. (1998c). Purification and IgE-binding properties of a major allergen in the gastropod Turbo cornutus. Biosci. Biotechnol. Biochem. 62, 1337–1343. Ishikawa, M., Nagashima, Y., and Shiomi, K. (1999). Immunological comparison of shellfish allergens by comparative enzyme-linked immunosorbent assay. Fish. Sci. 65, 592–595. Ishikawa, M., Suzuki, F., Ishida, M., Nagashima, Y., and Shiomi, K. (2001). Identification of tropomyosin as a major allergen in the octopus Octopus vulgaris and elucidation of its IgEbinding epitopes. Fish. Sci. 67, 934–942. Jeebhay, M. F., Robins, T. G., Lehrer, S. B., and Lopata, A. L. (2001). Occupational seafood allergy: A review. Occup. Environ. Med. 58, 553–562. Jimenez, M., Pineda, F., Sanchez, I., Orozco, I., and Senent, C. (2005). Allergy due to Enis macha. Allergy 60, 1090–1091. Joral, A., Navarro, J. A., Villas, F., Garmendia, J., and Villareal, O. (1997). Limpet anaphylaxis. Allergy 52(Suppl. 37), 117. Juji, F., Takashima, H., Suko, M., Doi, M., Takaishi, T., Okudaira, H., Ito, K., and Miyamoto, T. (1990). A case of food-dependent exercise induced anaphylaxis possibly induced by shellfish (Sulculus supertexta and Turbo cornutus). Arerugi 39, 1515–1522. Karlin, J. M. (1979). Occupational asthma to clam’s liver extract. J. Allergy Clin. Immunol. 63, 197. Kim, W. H., Lee, S. K., Lee, H. C., Hong, C. S., Huh, K. B., Lee, W. Y., and Lee, S. Y. (1982). Shell-grinder’s asthma. Yonsei Med. J. 23, 123–130. Koshte, V. L., Kagan, S. L., and Aalberse, R. C. (1989). Cross-reactivity of IgE antibodies to caddis fly with arthropoda and mollusca. J. Allergy Clin. Immunol. 84, 174–183. Laffond, Y. E. (1996). Reacciones alergicas por moluscos y crustaceos. Allergol. Immunol. (Madrid) 24(Suppl. 1), 36–44. Lee, B.-J., and Park, H.-S. (2004). Common whelk (Buccinum undatum) allergy: Identification of IgE-binding components and effects of heating and digestive enzymes. J. Korean Med. Sci. 19, 793–799. Leung, P. S. C., and Chu, K. H. (1998a). Molecular and immunological characterization of shellfish allergens. In ‘‘New Developments in Marine Biotechnology’’ (Y. Le Gal and H. O. Halvorson, eds.), pp. 155–164. Plenum Press, New York. Leung, P. S. C., and Chu, K. H. (1998b). Molecular and immunological characterization of shellfish allergens. Front. Biosci. 3, 306–312. Leung, P. S. C., and Chu, K. H. (2001). CDNA cloning and molecular identification of the major oyster allergen from the Pacific oyster Crassostrea gigas. Clin. Exp. Allergy 31, 1287–1294.

Molluscan Shellfish Allergy

173

Leung, P. S. C., Chow, W. K., Duffey, S., Kwan, H. S., Gershwin, M. E., and Chu, K. H. (1996). IgE reactivity against a cross-reactive allergen in rustacean and mollusca: Evidence for tropomyosin as the common allergen. J. Allergy Clin. Immunol. 98, 954–961. Lin, R. Y., Shen, H. D., and Han, S. H. (1993). Identification and characterization of a 30 kd major allergen from Parapenaeus fissures. J. Allergy Clin. Immunol. 92, 837–845. Longo, G., Barbi, E., and Puppin, F. (2000). Exercise-induced anaphylaxis to snails. Eur. J. Allergy Clin. Immunol. 55, 513–514. Lopata, A. L., Zinn, C., and Potter, P. C. (1997). Characteristics of hypersensitivity reactions and identification of a unique 49 Kd IgE-binding protein (Hal-m-1) in abalone (Haliotis midae). J. Allergy Clin. Immunol. 100, 642–648. Lu, Y., Oshima, T., Ushio, H., and Shiomi, K. (2004). Preparation and characterization of monoclonal antibody against abalone allergen tropomyosin. Hybrid. Hybridomics 23, 357–361. Maeda, S., Morikawa, A., Kato, M., Motegi, Y., Shigeta, M., Tokuyama, K., Kuroume, T., Naritomi, Y., Suehiro, K., Kusaba, K., Minoshima, M., and Iwata, S. (1991). Eleven cases of anaphylaxis caused by grand keyhole limpet (abalone-like shellfish). Arerugi 40, 1415–1420. Martins, L. M. L., Peltre, G., da Costa Faro, C. J., Vieira Pires, E. M., and De Cruz Inacio, F. F. (2005). The Helix aspersa (brown garden snail) allergen repertoire. Int. Arch. Allergy Immunol. 136, 7–15. Maulitz, R. M., Pratt, D. S., and Schocket, A. L. (1979). Exercise-induced anaphylactic reaction to shellfish. J. Allergy Clin. Immunol. 63, 433–434. Meglio, P., Plantamura, M., Arabito, E., Falagiani, P., Torre, A., and Rossi, P. (2002). Does SIT to Der p protect from snail sensitization? Allergy 57, 868–869. Metcalfe, D. D. (1984). Diagnostic procedures for immunologically-mediated food sensitivity. Nutr. Rev. 42, 92–97. Metcalfe, D. D., Astwood, J. D., Townsend, R., Sampson, H. A., Taylor, S. L., and Fuchs, R. L. (1996). Assessment of the allergenic potential of foods derived from genetically engineered crop plants. Crit. Rev. Food Sci. Nutr. 36S, 165–186. Mistrello, G., Falagiani, P., Riva, G., Gentili, M., and Antonicelli, L. (1992). Cross-reactions between shellfish and house-dust mite. Allergy 47, 287. Miyake, T., Kawamori, J., and Yoshida, T. (1988a). Food-dependent exercise-induced anaphylaxis in childhood. J. Jpn. Pediatr. Soc. 92, 1328–1332. Miyake, T., Kawamori, J., and Yoshida, T. (1988b). A pediatric case of food-dependent exercise-induced anaphylaxis. Arerugi 37, 53–56. Miyazawa, H., Fukamachi, H., Inagaki, Y., Reese, G., Daul, C. B., Lehrer, S. B., Inouye, S., and Sakaguchi, M. (1996). Identification of the first major allergen of a squid (Todarodes pacificus). J. Allergy Clin. Immunol. 98, 948–953. Moneret-Vautrin, D. A., and Kanny, G. (1995). L’anaphylaxie alimentaire. Nouvelle enquete multicentrique francaise. Ann. Gastroenterol. Hepatol. 31, 256–263. Moneret-Vautrin, D. A., and Petithory, D. (1987). Risques allergiques des technologies alimentaires et des consummations de produits nouveaux. Med. Nutr. 23, 217–224. Moneret-Vautrin, D. A., Kanny, G., and Parisot, L. (2002). Permiere enquete sur le ‘Reseau d’allergo-vigilance’ en allergie alimentaire. Allergie Immunol. 34, 194–198. Moneret-Vautrin, D. A., Kanny, G., Morisset, M., Rance, F., Fardeau, M. F., and Beaudouin, E. (2004). Severe food anaphylaxis: 107 cases registered in 2002 by the Allergy Vigilance Network. Allergie Immunol. 36, 46–51. Morikawa, A., Kato, M., Tokuyama, K., Kuroume, T., Minoshima, M., and Iwata, S. (1990). Anaphylaxis to grand keyhole limpet (abalone-like shellfish) and abalone. Ann. Allergy 65, 415–417.

174

Steve L. Taylor

Morisset, M., and Parisot, L. (2003). Registre national des accidents severes a risque´ letal du no. 130 au no. 138. Cerc. Invest. Clin. Biol. Allergol. Aliment. 8, 136–137. Motoyama, K., Ishizaki, S., Nagashima, Y., and Shiomi, K. (2006). Cephalopod tropomyosins: Identification as major allergens and molecular cloning. Food Chem. Toxicol. 44, 1997–2002. Nakamura, A., Watanable, K., Ojima, T., Ahn, D. H., and Saeki, H. (2005). Effect of Maillard reaction on allergenicity of scallop tropomyosin. J. Agric. Food Chem. 53, 7559–7564. Nakamura, A., Sasaki, F., Watanabe, K., Ojiva, T., Ahn, D. H., and Saeki, H. (2006). Changes in allergenicity and digestibility of squid tropomyosin during the Maillard reaction with ribose. J. Agric. Food Chem. 54, 9529–9534. Nakashima, T. (1969). Studies on bronchial asthma observed in cultured oyster workers. Hiroshima J. Med. Sci. 18, 141–184. Nava, C., Brambilla, G., Briatico-Vangosa, G., Marchisio, M., and Talamo, F. (1983). L’asma professionale negli alimentaristi: Studio di tre casi. Med. Lav. 74, 302–307. Nettis, E., Pannofino, A., Dambra, P., Loria, M. P., Di Maggio, G., Damiani, E., Ferrannini, A., and Tursi, A. (2001). IgE-mediated urticaria/angioedema after ingestion of mussels. Acta Derm. Venereol. 81, 62. Novembre, E., Cianferoni, A., Bernardini, R., Mugnaini, L., Caffarelli, C., Cavagni, G., Giovane, A., and Vierucci, A. (1998). Anaphylaxis in children: Clinical and allergologic features. Pediatric 101, e1–e8. Olszanski, R., and Kotlowski, A. (1997). Hypersensitivity to cuttlefish. Eur. J. Allergy Clin. Immunol. 37, 214. Orriols, R., Manresa, J. M., Aliaga, J. L., Codina, R., Rodrigo, M. J., and Morell, F. (1990). Mollusk shell hypersensitivity pneumonitis. Ann. Intern. Med. 113, 80–81. Orriols, R., Aliaga, J. L., Anto, J. M., Ferrer, A., Hernandez, A., Rodrigo, M. J., and Morell, F. (1997). High prevalence of rustac shell hypersensitivity pneumonitis in nacre factory workers. Eur. Respir. J. 10, 780–786. Pajno, G. B., Morabito, L., Ruggeri, C., Falagiani, P., and Barberio, G. (1994). Allergie alimentaire et asthme. Bronchospasme apre`s ingestion d’escargots chez des enfants allergiques aux acariens. Rev. Fr. Allergol. 34, 141–144. Pajno, G. B., La Gutta, S., Barberio, G., Canonica, G. W., and Passalacqua, G. (2002). Harmful effect of immunotherapy in children with combined snail and mite allergy. J. Allergy Clin. Immunol. 109, 627–629. Palma Carlos, A., Meguis Clode, M., Inacio, F. F., and Vinhas de Sousa, A. (1985). Asthme par ingestion d’escargot. Allerg. Immunol. 17, 5–6. Parker, S. L., Leznoff, A., Sussman, G. L., Tarlo, S. M., and Krondl, M. (1990). Characteristics of patients with food-related complaints. J. Allergy Clin. Immunol. 86, 503–511. Pastorello, E. A., Rivolta, F., Bianchi, M., Mauro, M., and Pravettoni, V. (2001). Incidence of anaphylaxis in the emergency department of a general hospital in Milan. J. Chromatogr. B 756, 11–17. Peroni, D. G., Piacentini, G. L., Bodini, A., and Boner, A. L. (2000). Snail anaphylaxis during house dust mite immunotherapy. Pediatr. Allergy Immunol. 11, 260–261. Petrus, M., Cougnaud, V., Rhabbour, M., Causse, E., and Netter, J. C. (1997). Allergie a l’escargot et aux acariens chez l’enfant. Arch. Pediatr. 4, 767–769. Petrus, M., Nyunga, M., Causse, E., Chung, E., and Cossarizza, G. (1999). Allergie au calamar et aux acariens chez l’enfant. Arch. Pediatr. 6, 1075–1076. Pomes, A., Melen, E., Vailes, L. D., Retief, J. D., Arruda, L. K., and Chapman, M. D. (1998). Novel allergen structures with tandem amino acid repeats derived from German and American cockroach. J. Biol. Chem. 273, 30801–30807. Poms, R. E., Klein, C. L., and Anklam, E. (2004). Methods of allergen analysis in food: A review. Food Add. Contam. 21, 1–31. Pumphrey, R. S. (2004). Fatal anaphylaxis in the U.K., 1992–2001. Novartis Found. Symp. 257, 116–128.

Molluscan Shellfish Allergy

175

Rance, F., Grandmottet, X., and Grandjean, H. (2005). Prevalence and main characteristics of schoolchildren diagnosed with food allergies in France. Clin. Exp. Allergy 35, 167–172. Reese, G., Ayuso, R., and Lehrer, S. B. (1999). Tropomyosin: An invertebrate pan-allergen. Int. Arch. Allergy Immunol. 119, 247–258. Sampson, H. A. (1990). Food allergy. Curr. Opinion Immunol. 2, 542–547. Sampson, H. A., and McCaskill, C. M. (1985). Food hypersensitivity and atopic dermatitis: Evaluation of 113 patients. J. Pediatr. 107, 669–675. Sampson, H. A., Mendelson, L., and Rosen, J. (1992). Fatal and near-fatal anaphylactic reactions to foods in children and adolescents. N. Engl. J. Med. 327, 380–384. San Miguel-Moncin, M., Pineda, F., Llamas, E., Amat, P., Garcia, R., Garcia-Rubio, I., Lluch, M., and Malet, M. (2007). Octopus hypersensitivity. Allergy 62(Suppl. 83), 330. Santadusit, S., Anthapaisalsarudee, S., and Vichyanond, P. (2005). Prevalence of adverse food reactions and food allergy among Thai children. J. Med. Assoc. Thai. 88(Suppl. 8), S27–S32. Santos, A. B., Chapman, M. D., Aalberse, R. C., Vailes, L. D., Ferian, V. P., Oliver, C., Rizzo, M. C., Naspitz, C. K., and Arruda, L. K. (1999). Cockroach allergens and asthma in Brazil: Identification of tropomyosin as a major allergen with potential cross-reactivity with mite and shrimp allergens. J. Allergy Clin. Immunol. 104, 329–337. Shanti, K. N., Martin, B. M., Nagpal, S., Metcalfe, D. D., and Rao, P. V. (1993). Identification of tropomyosin as the major shrimp allergen and characterization of its IgE-binding epitopes. J. Immunol. 151, 5354–5363. Shibasaki, M., Ehara, T., and Takita, H. (1989). Late anaphylactic reaction to cuttlefish. Ann. Allergy 63, 421–422. Sicherer, S. H., Munoz-Furlong, A., Burks, A. W., and Sampson, H. A. (1999). Prevalence of peanut and tree nut allergy in the U.S. as determined by a random digit dial telephone survey. J. Allergy Clin. Immunol. 103, 559–562. Sicherer, S. H., Munoz-Furlong, A., and Sampson, H. A. (2004). Prevalence of seafood allergy in the United States determined by a random telephone survey. J. Allergy Clin. Immunol. 114, 159–165. Sidenius, K. E., Hallas, T. E., Poulsen, L. K., and Mosbech, H. (2001). Allergen cross-reactivity between house-dust mites and other invertebrates. Allergy 56, 723–733. Simons, F. E. R. (1998). Antihistamines. In ‘‘Allergy: Principles and Practice, Vol. I’’ (E. Middleton, C. E. Reed, E. F. Ellis, N. F. Adkinson, J. W. Yunginger, and W. W. Busse, eds.), 5th ed., pp. 612–637. Mosby, St. Louis. Sinanoglou, V. J., Batrinou, A., Konteles, S., and Sflomos, K. (2007). Microbial population, physicochemical quality, and allergenicity of molluscs and shrimp treated with cobalt-60 gamma radiation. J. Food Prot. 70, 958–966. Stewart, A. G., and Ewan, P. W. (1996). The incidence, aetiology, and management of anaphylaxis presenting to an Accident and Emergency department. Quart. J. Med. 89, 859–864. Strickler, A., and Goldberg, J. M. (1916). Anaphylactic food reactions in dermatology. Preliminary report. J. Am. Med. Assoc. 66, 249–252. Strobel, S. (1997). Oral tolerance: Immune responses to food antigens. In ‘‘Food Allergy: Adverse Reactions to Foods and Food Additives’’ (D. D. Metcalfe, H. A. Sampson, and R. A. Simon, eds.), 2nd ed., pp. 107–135. Blackwell Science, Boston. Tanaka, S. (1994). An epidemiological survey of food-dependent exercise-induced anaphylaxis in kindergartners, schoolchildren and junior high school students. Asia Pac. J. Public Health 7, 26–30. Tanaka, R., Ichikawa, K., and Hamano, K. (2000). Clinical characteristics of seafood allergy and classification of 10 seafood allergens by cluster analysis. Arerugi 49, 479–486. Tas, J. (1972). Respiratory allergy caused by mother-of-pearl. Isr. J. Med. Sci. 8, 630. Taylor, S. L. (2002). Protein allergenicity assessment of foods produced through agricultural biotechnology. Ann. Rev. Pharmacol. Toxicol. 42, 99–112. Taylor, S. L., and Hefle, S. L. (2001). Food allergies and other food sensitivities. Food Technol. 55, 68–83.

176

Steve L. Taylor

Taylor, S. L., and Hefle, S. L. (2005). Allergen control strategies. Food Technol. 59, 40–43. Taylor, S. L., and Nordlee, J. A. (1996). Detection of food allergens. Food Technol. 50, 231–234. Taylor, S. L., Bush, R. K., and Busse, W. W. (1986). Avoidance diets: How selective should we be? N. Engl. Reg. Allergy Proc. 7, 527–532. Taylor, S. L., Hefle, S. L., and Munoz-Furlong, A. (1999). Food allergies and avoidance diets. Nutr. Today 34, 15–22. Taylor, S. L., Hefle, S. L., Bindslev-Jensen, C., Bock, S. A., Burks, A. W., Christie, L., Hill, D. J., Host, A., Hourihane, J. O’B., Lack, G., Metcalfe, D. D., Moneret-Vautrin, D. A., et al. (2002). Factors affecting the determination of threshold doses for allergenic foods: How much is too much? J. Allergy Clin. Immunol. 109, 24–30. Taylor, S. L., Hefle, S. L., Farnum, K., Rizk, S. W., Yeung, J., Barnett, M. E., Busta, F., Shank, F. R., Newsome, R., Davis, S., and Bryant, C. M. (2006). Analysis and evaluation of the current manufacturing and labeling practices used by food manufacturers to address allergen concerns. Comp. Rev. Food Sci. Food Safety 5, 138–157. Thong, B. Y. H., Cheng, Y. K., Leong, K. P., Tang, C. Y., and Chng, H. H. (2005). Anaphylaxis in adults referred to a clinical immunology/allergy centre in Singapore. Singapore Med. J. 46, 529–534. Tomas, M. R., Faria, E., Alenduoro, P., Tavares, B., Pereira, C., Lourenco, M., Pinto Mendes, J. P., and Chieira, C. (1997). Asthma induced by snail. Allergy 52(Suppl. 37), 117. Tomaszunas, S., Weclawik, Z., and Lewinski, M. (1988). Allergic reactions to cuttlefish in deep-sea fishermen. Lancet i, 1116–1117. Tomikawa, M., Suzuki, N., Urisu, A., Tsuburai, T., Ito, S., Shibata, R., Ito, K., and Ebisawa, M. (2006). Characteristics of shrimp allergy from childhood to adulthood in Japan. Arerugi 55, 1536–1542. Valsecchi, R., Pansera, B., Reseghetti, A., Leghissa, P., Cortinovis, R., and Cologni, L. (1996). Contact urticaria from Loligo japonica. Contact Dermatitis 35, 367–368. Van Ree, R., Anonicelli, L., Akkerdas, J. H., Pajno, G. B., Barberio, G., Corbetta, L., Ferro, G., Zambito, M., Garritani, M. S., Aalberse, R. C., and Bonifazi, F. (1996a). Asthma after consumption of snails in house dust mite allergic patients: A case of IgE cross reactivity. Allergy 51, 387–393. Van Ree, R., Antonicelli, L., Akkerdaas, J. H., Garritani, M. S., Aalberse, R. C., and Bonifazi, F. (1996b). Possible induction of food allergy during mite immunotherapy. Allergy 51, 108–113. Vuitton, D. A., Rance, F., Paquin, M. L., Adessi, B., Vigan, M., Gomot, A., and Dutau, G. (1998). Cross-reactivity between terrestrial snails (Helix species) and house-dust mite (Dermatophagoides pteronyssinus). I. In vivo study. Allergy 53, 144–150. Wada, S., Nishimoto, Y., Nakashima, T., Shigenobu, T., Onari, K., and Awaya, M. (1967). Clinical observations of bronchial asthma in workers who culture oysters. Hiroshima J. Med. Sci. 16, 255–266. Waring, N. P., Daul, C. B., deShazo, R. D., McCants, M. L., and Lehrer, S. B. (1985). Hypersensitivity reactions to ingested crustacea: Clinical evaluation and diagnostic studies in shrimp-sensitive individuals. J. Allergy Clin. Immunol. 76, 440–445. Wild, L. G., and Lehrer, S. B. (2005). Fish and shellfish allergy. Curr. Allergy Asthma Rpts. 5, 74–79. Woods, R. K., Abramson, M., Bailey, M., and Walters, E. H. (2001). International prevalences of reported food allergies and intolerances. Comparisons arising from the European Community Respiratory Health Survey (ECRHS) 1991–1994. Eur. J. Clin. Nutr. 55, 298–304. Wu, A. Y., and Williams, G. A. (2004). Clinical characteristics and pattern of skin test reactivities in shellfish allergy patients in Hong Kong. Allergy Asthma Proc. 25, 237–242. Yamura, T., and Kurose, H. (1966). Oyster-shucker’s dermatitis. Arerugi 15, 813.

Molluscan Shellfish Allergy

177

Yunginger, J. W., Sweeney, K. G., Sturner, W. Q., Giannandrea, L. A., Tiegland, J. D., Bray, M., Benson, P. A., York, J. A., Biedrzycki, L., Squillace, D. L., and Helm, R. M. (1988). Fatal food-induced anaphylaxis. J. Am. Med. Assoc. 260, 1450–1452. Zinn, C., Lopata, A., Visser, M., and Potter, P. C. (1997). The spectrum of allergy to South African bony fish (Teleosti). Evaluation by double-blind, placebo-controlled challenge. South Afr. Med. J. 87, 146–152. Zhoutyi, V. R., and Borzov, M. V. (1973). Dermatitis in workers processing mussels. Vestn. Dermatil. Venereol. 47, 71–73. Zuberbier, T., Edenharter, G., Worm, M., Ehlers, I., Reimann, S., Hantke, T., Roehr, C. C., Bergmann, K. E., and Niggemann, B. (2004). Prevalence of adverse reactions to food in Germany—a population study. Allergy 59, 338–345.

This page intentionally left blank

CHAPTER

5 Nutritargeting Hans Konrad Biesalski* and Jana Tinz*

Contents

Abstract

I. Nutritargeting for Selective Accumulation A. Vitamin A B. Vitamin E C. b-Carotene/carotenoids/fat-soluble antioxidants II. Nutritargeting as a Way of Bypassing Absorption Barriers A. Digestion and intestinal absorption of fat-soluble dietary components B. Fat malassimilation C. Bioavailability of dietary, emulsified and solubilized fat soluble vitamins D. Comparative bioavailability study (water-soluble micelles vs a regular supplement) E. Coenzyme Q10 (CoQ10) III. Conclusion References

181 181 201 201 202 203 203 204 205 206 210 210

The term ‘‘nutritargeting’’ in analogy to the term ‘‘drug targeting’’ means targeting nutrients to specific ‘‘target’’ tissues. What is the rationale for this idea? Some tissues obviously are able to accumulate micronutrients selectively and to use them predominantly for specific functions. It has, for instance, been known for a long time that the accumulation of b-carotene in the skin does not only provide a ‘‘golden-yellow’’ color but considerable antioxidative protection as well. Yet

* Department of Biological Chemistry and Nutrition, University of Hohenheim, Garbenstrasse 30,

70593 Stuttgart, Germany Advances in Food and Nutrition Research, Volume 54 ISSN 1043-4526, DOI: 10.1016/S1043-4526(07)00005-8

#

2008 Elsevier Inc. All rights reserved.

179

180

Hans Konrad Biesalski and Jana Tinz*

b-carotene is only one of many antioxidants, which can be detected in the skin. Other carotenoids, for example, lutein and zeaxanthine, are preferentially found in the macula lutea, the so-called yellow spot in the eye. Here, carotenoids are subject to a metabolism typical for that tissue, which cannot be found in other tissues (e.g., formation of meso-zeaxanthine). In addition, they can specifically be absorbed into the macula. In the macula, they protect the retinal pigment epithelial cells against oxidative damage from UV light. Indeed, these two carotenoids can be protective against agedependent macula degeneration. Another example is the tissues that are particularly rich in vitamin C, for example, the cortex of the suprarenal gland or the lens: here, vitamin C fulfills both antioxidative functions and metabolic ones as it helps in the formation of collagen structures. Approximately 40% of the body’s ascorbate is stored in skeletal muscle because this tissue is relatively abundant and its cellular concentration is tenfold higher than the plasma level. Similarly, the intracellular ascorbate concentration in the brain (3 mM) greatly exceeds the level in the extracellular fluid (200–400 mM). The majority of ascorbate is stored in the astroglial cells that are capable of reducing great quantities of DHAA to ascorbate, which then becomes available for release back into the extracellular fluid. Thus, the accumulation of vitamins respectively micronutrients in single tissues is not limited to a pure storage process like the storage of vitamin A in the liver, but is often connected with important and tissue-specific metabolic functions. When single micronutrients are applied for prevention or even intervention in diseases of organs or tissues, they are usually administered in higher doses for a longer period of time. The hope is to accumulate it this way sufficiently in the tissue and to thus be able to ensure the therapeutic success. This procedure, however, leads to a ‘‘flooding’’ of the whole organism with micronutrients and their potential enrichment in tissues which would usually not accumulate the respective micronutrient. Thus, unexpected side effects may occur. An attractive solution to these problems in the future could be to wrap up or apply micronutrients in such a way that they can selectively reach the targeted tissue. For this approach, called ‘‘drug targeting’’ by pharmacologists, one could introduce the analogous expression ‘‘nutritargeting’’ with respect to micronutrients. For such a nutritargeting there are already a lot of examples and developments which show that it is possible to accumulate micronutrients in target tissues while simultaneously circumventing or protecting other tissues. A substantial requirement for the development of ‘‘carriers’’ for nutritargeting is the availability of procedures or specific carriers, which allow the selected nutrients to bypass the main barriers that

Nutritargeting

181

are encountered when, for example, circumventing the enteral route in the targeting process. The entrance areas for such a targeting are the nasal mucosa, the oral mucosa, the cornea, the skin, or the lung. In the case of enteral application of proteins, the packaging has to resist gastric digestion and the body must be able to absorb the particles through the intestinal mucosa without hydrolyzing the proteins in order for them to reach the systemic circulation. Another field in which nutritargeting may play an important role is the diseases where either systemic absorption is not possible (e.g., malabsorption/maldigestion) or where local deficits occur, which may not or only inadequately be supplied by systemic application.

I. NUTRITARGETING FOR SELECTIVE ACCUMULATION A. Vitamin A 1. Rationale to use a topical (targeted) vitamin A supply Vitamin A is essential for growth and development of cells and tissues. In its active form, retinoic acid (RA), it controls the regular differentiation as a ligand for retinoic acid receptors (RAR, RXR) and is involved in the integration (gap junction formation) of cell formations (Biesalski, 1996; Biesalski et al., 1999). Vitamin A plays a substantial role, especially in the respiratory epithelium and the lung. During moderate vitamin A deficiency, the incidence for diseases of the respiratory tract is considerably increased and repeated respiratory infections can be influenced therapeutically by a moderate vitamin A supplementation (Biesalski et al., 2001; Greenberg et al., 1997; John et al., 1997).

2. Significance of vitamin A for structure and function of the mature lung A major target tissue for vitamin A is the respiratory tract and the bronchial epithelium. During a marginal vitamin A deficiency, prior to systemic effects, the sensitivity of the epithelium is increased due to a focal loss of ciliae and an increase of goblet cells (Stofft et al., 1992a,b; Figs. 5.1 and 5.2). Similar morphological changes can be detected in heavy smokers with chronic obstructive pulmonary diseases (COPD), who show areas of local vitamin A deficiency but normal plasma levels (Auerbach et al., 1979). Smoking and toxins [e.g., benzo(a)pyrene (BaP), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)] can cause a reduction in retinyl palmitate (RP) pools, the main storage reservoir of vitamin A in cells (Biesalski and Stofft, 1992) and at least in a local vitamin A deficiency.

182

Hans Konrad Biesalski and Jana Tinz*

−VA Tracheal epithelium

”””””””” Pseudo stratified

Endocervical epithelium Simple columnar

−VA

Stratified minimum morphological changes Vitamin A deficient endocervical, tracheal epithelium. continuous basal and squamous cells

Early vitamin A- deficiency loss of ciliae and continuous basal cells loss of barrier function

Stratified squamous metaplasia

Severe vitamin A deficiency tracheal epithelium Stratified epidermoid keratinizing

FIGURE 5.1

Influence of vitamin A status on epithelial phenotypes.

FIGURE 5.2 Morphological changes of the bronchial epithelium of the respiratory tract during vitamin A deficiency.

It has been reported that toxins (BaP, TCDD) are able to disrupt the normal vitamin A metabolism and interact with vitamin A metabolizing enzymes (LRAT, REH) in different tissues (Hanberg et al., 1998; Nilsson et al., 2000). In lungs, intestine, adrenals, and liver, it has been well established that BaP and TCDD affect these tissue stores of vitamin A and cause decreased levels of vitamin A (Biesalski and Stofft, 1992; Nilsson et al., 2000).

Nutritargeting

183

Additionally, a further study described an increased catabolism and mobilization of vitamin A in the whole body (Kelley et al., 1998). On the basis of a few reports, it is assumed that a ‘‘local’’ vitamin A deficiency exists in meta- and dysplastic areas. Measurements of vitamin A concentrations in metaplastic areas of the respiratory epithelium and the cervix epithelium actually proved that vitamin A in comparison to the surrounding tissues was not found (Biesalski, 1996). Clearly one cannot say what is cause and effect. Studies carried out by Edes et al. (1991) confirm an induction of a vitamin A deficit. These studies showed that a depletion of vitamin A ester stores is caused by toxins, present in cigarette smoke (predominantly polyhalogenated compounds), in different tissues. An essential importance for the development of obstructive respiratory diseases, within the scope of cancer mortality of smokers, was indicated by epidemiological studies. It was shown that the relative risk for smokers, with obstructive ventilation parameters [FEV 1% < 60 (Melvyn et al., 1987), respectively 70] (Skillud et al., 1987), to be affected by lung cancer, is significantly higher than that of comparative groups with normal lung-function parameters. A survey about the dietary habits within the scope of the ‘‘National Health and Nutritional Examination Survey’’ showed that an inverse correlation (Morabia et al., 1989) exists between COPD and vitamin A supply as the only one of 12 examined dietary components. If a diminished supply of vitamin A increases the appearance of obstructive respiratory diseases, a marginal or local vitamin A deficit could be responsible for the observed changes of the respiratory mucosa. Such a deficit results in a loss of cilia, an increase of secreting cells and finally the formation of squamous metaplasia (Biesalski et al., 1985; Chytil, 1985; Shah and Rajalekshmi, 1984). Such changes (decrease of ciliated cells with simultaneous increase of the secretion) are noted for smokers (Gouveia et al., 1982; Mathe´ et al., 1983) and cause a reduction of the mucociliary clearance. This reduction of the mucociliary clearance, associated with an increased adsorption of the respiratory syncytial virus (RSV) (Donelly, 1996), could also explain the extraordinarily high morbidity and mortality for respiratory infections of children with vitamin A deficiency in developing countries (Sommer, 1993). There is good evidence from experimental studies that the alteration of the respiratory mucosa, caused by the vitamin A deficiency, can be redifferentiated into its functional original epithelium, in vivo as well as in vitro, following vitamin A supply (Biesalski et al., 1985; McDowell et al., 1984a,b, 1987a,b; Rutten et al., 1988a,b). Squamous metaplasia of the bronchial mucosa, which occurs in smokers in spite of a sufficient supply with vitamin A as an effect of inhalative noxae, could also be reversed through systemic application of high retinoid concentrations in vitro (Lasnitzki and Bollag, 1982, 1987) and in humans in vivo (Gouveia et al., 1982; Mathe´ et al., 1983).

184

Hans Konrad Biesalski and Jana Tinz*

The assumption of ‘‘local’’ vitamin A deficits as a basis for the inhalation approach is supported by studies, which showed that especially polyhalogenated compounds (e.g., TCDD) cause a local vitamin A depletion (Hakansson and Ahlborg, 1985; Thunberg and Hakansson, 1983; Thunberg et al., 1980), which again contributes to the development of metaplastic- and possibly to dysplastic changes (Chopra and Joiakim, 1991). Thus, metaplastic changes are reversible by ‘‘topic’’ application (in vitro) of vitamin A (retinoic ester and RA). Consequently, a topical (inhalative) in vivo treatment of metaplasia of the respiratory tract could represent an efficient measure. In contrast, since RA is absorbed uncontrolled into the cells and a regulation of the cytoplasmatic retinoic acid-binding protein (CRABP) formation does not exist in that case, an application of inhalative RA is toxicologically more questionable. By application of an inhalable vitamin A ester, an accumulation of the target cells can be achieved by much lower than the toxicological concentrations. In these target cells, the retinyl esters, after controlled hydrolysis, are released as retinol. Under the same controlled and consequently physiological conditions, retinol is re-esterified to the active metabolite RA. Consequently, the produced amount of retinol is adjusted to the respective amount of cytoplasmatic retinol-binding protein (CRBP) and along with it a corresponding amount of CRABP is expressed. Though many experiments in vitro as well as in vivo showed the effectiveness of RA on the reversibility of squamous epithelial metaplasia (see above), an inhalation of RA would hardly be justified because cellular regulation mechanisms are circumvented which is not the case for retinyl esters.

3. Treatment of squamous metaplasia with inhalation of vitamin A Lung cancer is an extremely aggressive neoplasia, with the majority of admitted patients already showing metastatic dissemination. The best conventional treatment is a complete resection of local manifestation of bronchial carcinoma. However, only 40–50% of patients currently survive for >5 years after the surgery (Younes et al., 1999). Primary prevention particularly eliminating exposure to tobacco, which is by far the most frequently encountered bronchial carcinogen, has failed to bring lung cancer under control. Thus, in the light of the poor prognosis of most patients diagnosed with lung cancer, alternatives to control the metaplasia-carcinoma-sequence are necessary. One approach is chemoprevention with vitamin A, which aims to arrest or reverse premalignant cells during their progression to overt malignancy (Sporn et al., 1976). Progressive changes in the bronchial epithelium, that is, from squamous metaplasia to dysplasia and possibly carcinoma, have been proposed (Auerbach et al., 1979; Boers et al., 1996; Saccomano et al., 1974). Squamous metaplasia of the respiratory mucosa occurs as a result of vitamin A deficiency ( Jetten and Smits, 1985; Stofft et al., 1992a,b). Vitamin A is the

Nutritargeting

185

generic term that describes an array of compounds (retinoids) that have the biologic activity of retinol. Retinoids are essential for embryonic development, cellular growth, and differentiation of different tissues including the tracheobronchial mucosa (Chytil, 1992; Hinds et al., 1997; Stofft et al., 1992a,b). Retinoids, including RA, retinol, and retinyl esters, can reverse squamous metaplastic changes of the respiratory epithelium as a result of exposure to metaplasia-inducing toxins in vitro and in animal experiments (Denning and Verma, 1994; Inayama et al., 1996; McDowell et al., 1984a,b). However, promising results of chemoprevention from application of high oral retinoid doses in former animal studies and human trials could not be confirmed by Lee et al. in a large trial (Gouveia et al., 1982; Lee et al., 1994; Mathe´ et al., 1983; Nettesheim and Griesemer, 1978). This may be due to a lower bioavailability of oral retinoids for the target cells in the bronchial epithelium compared to in vitro studies, where vitamin A was topically applied (Biesalski, 1996). Further, inhalation of vitamin A (retinyl ester) has recently been reported to be an effective approach to supply the respiratory mucosa with vitamin A (Biesalski et al., 1999). Retinyl esters are taken up by the respiratory mucosa and stored to serve as a plasma-independent source of vitamin A. Vitamin A inhalation avoids problems with absorption from the gastrointestinal tract, control of hepatic release, and cellular uptake, respectively. Thus, both the recent report of successful vitamin A supplementation in vitamin Adeficient children by inhalation of retinyl esters and the promising results of the new screening method (autofluorescence bronchoscopy) to detect intraepithelial premalignant lung lesions precisely (Biesalski et al., 1999; Ha¨ussinger et al., 1999, 2000; Lam et al., 1998) provoked renewed interest in chemoprevention by inhaled retinoids. At present no biopsy-proven data are available about the impact of inhaled aerosolized analogs of vitamin A on preneoplastic tracheobronchial lesions. The aim of a recent observational was twofold: first, to assess the feasibility RP inhalation and second, to investigate the response of epithelial changes (squamous metaplasia and dysplasia) to an inhaled RP aerosol in current smokers and ex-smokers (Kohlha¨ufl et al., 2001). Nineteen subjects with biopsy-proven diagnosis of metaplasia or dysplasia of the bronchial mucosa were recruited for the study at the 300 bed — Asklepios Center for Respiratory Medicine and Thoracic Surgery, Munich-Gauting, which is a specialized secondary care referral center performing 3000 bronchoscopies per year. Premalignant lesions in the bronchial epithelium were identified by using white light (WL)- and autofluorescence (AF)- bronchoscopy. On the second bronchoscopy, biopsies were taken at the identical areas. These areas were identified by the protocol of the initial bronchoscopy. In addition, the exact location was guided by AF bronchoscopy, which shows a reduction of AF intensity in areas of previous biopsies as well as in areas with premalignant lesions.

186

Hans Konrad Biesalski and Jana Tinz*

Individuals who met the eligibility requirements underwent a screening biopsy using AF bronchoscopy as an adjunct to WL bronchoscopy after a 3-month therapy with RP with two inhalations per day (each around 3.000 IU). In all patients, three endobronchial biopsies were taken again from three preselected sites: the bifuration of the right upper lobe, left mainstem bronchus, and the right segment 6. Further, AF bronchoscopy guided the sampling site for any additional suspicious lesions. If additional suspicious lesions were observed by AF bronchoscopy, they were biopsied. Baseline plasma levels of RP of the study group increased but did not differ significantly from plasma levels after the 3-month inhalation trial (54.4
32.6 nmol/liter vs 99.7
68.2 nmol/liter; p ¼ 0.12). This preliminary study supports the feasibility of vitamin A application by aerosolized retinyl esters and showed a significant response of premalignant lesions of the bronchial epithelium. Complete reversal of metaplasia or dysplasia was noted in 44% of the biopsies. Partial remission of bronchial lesions was noted in 12% of the biopsies. The overall response rate (remission and partial remission) was 56% (confidence interval 0.30–0.79; p < 0.05). The large range of the confidence interval can be explained by the small number of participants in this preliminary study. The lack of a control group in this pilot study suggests caution in immediate application of these results. Since all smokers continued to smoke during the study, the epithelium was continuously exposed to carcinogenic, cocarcinogenic, or promoting substances. Thus, it seems unlikely that in this high-risk group the preneoplastic epithelial lesions can be reversed spontaneously. A recent prospective study reported no spontaneous remission of dysplastic areas in smokers for a 4-year period. Malignancy occurred in 25% of patients with grade I dysplasia, in 50% of patients with grade II dysplasia, and in 75% of patients with grade III dysplasia (Ponticello et al., 2000). Also, among subjects who continued to smoke the metaplasia index did not change over a 6-month period in a randomized placebo-controlled trial of oral vitamin A supplementation (Lee et al., 1994). These results are supported by an earlier animal study (hamster model). These studies showed that in carcinogen-treated animals areas of metaplastic epithelium did not reverse, but became atypical and progressed to carcinoma in situ. In contrast, only those areas of metaplastic epithelium were reversible which were induced by ‘‘pure’’ inflammatory agents (McDowell et al., 1978). It was also shown that heavy smokers who stop smoking need at least two additional years to recover a normal bronchial histology (Bertram and Rogers, 1981). However, at present bronchoscopic studies are not available, which provide long-term data concerning the spontaneous remission rates of these early epithelial lesions in smokers.

Nutritargeting

4. The rationale for vitamin A inhalation

187

In an intervention trial with oral supplementation of b-carotene (20 mg/day) and vitamin E (50 mg/day) for 6.5 years, the incidence and mortality of lung cancer increased in the b-carotene group (relative risk, RR: 1.18) (Albanes et al., 1996). Similarly in another intervention study, lung cancer risk increased (RR 1.28) in subjects supplemented with 30-mg b-carotene and 25.000 IU vitamin A (RP) for a time period of 5 years (Goodman et al., 2004). In animal (ferrets) experiments, it was documented that the combination of smoke exposure and b-carotene results in a strong downregulation of the RARb and activation of AP-1, which may contribute to an increased lung cancer risk (Wang et al., 1999). In contrast to these studies, in our study vitamin A inhalation was performed with RP in a low-dose and not with high-dose b-carotene. Furthermore, retinoids do not induce downregulation of RARb (Li et al., 1998). The inhalation of retinyl esters provides the cells with an intracellular available vitamin A source. Under normal dietary conditions, retinyl esters can be detected in different cells of the respiratory tract in high concentrations compared with other tissues except hepatic tissue (Biesalski et al., 1990). It is assumed that retinyl esters either formed by esterification of intracellular retinol, bound to CRBP, or as demonstrated recently they were taken up as such from the bloodstream (Gerlach et al., 1989; Napoli, 1996). From these intracellular pools of retinyl esters, retinol may be acquired following hydrolysis of the retinyl esters by means of the cholate-independent retinyl ester hydrolase which predominates in the lung (Biesalski et al., 1990). Retinol bound to CRBP may then be further oxidized to RA which enters the nucleus bound to CRABP to interact with RARs and their target genes. So far all steps of RA formation as the biologically active compound are controlled to avoid critical accumulation of RA within the cells. The importance of the intracellular retinyl esters was recently shown in rat lung fibroblasts (McGowan et al., 1997). The authors inhibited the hydrolysis of retinyl esters and consequently the formation of RA in lung fibroblasts. As a result of this inhibition, the expression and the steady state level of the tropoelastin mRNA were reduced. These findings suggest that intracellular retinyl esters are important sources for retinol and RA, respectively. During marginal vitamin A deficiency, the retinyl ester stores of respiratory epithelium become rapidly depleted, while plasma retinol levels are only slightly decreased (Biesalski and Weiser, 1989; Biesalski et al., 1990). This depletion of retinyl ester stores in the respiratory mucosa results in a loss of ciliae and an increase in mucous-secreting cells, an event which could lead to an impairment of lung function (Biesalski and Stofft, 1992; Biesalski and Weiser, 1990; Stofft et al., 1992a,b). It is also known that an impairment of the mucociliary clearance increases the susceptibility against respiratory infectious diseases frequently associated with marginal vitamin A deficiency (Sommer et al., 1984). Depletion of the retinyl

188

Hans Konrad Biesalski and Jana Tinz*

ester stores of the respiratory mucosa results in the development of squamous metaplasia which completely reverses to a normal epithelium after addition of vitamin A (in vitro) or dietary intake (animal experiments) (Denning and Verma, 1994; Inayama et al., 1996; McDowell et al., 1984a,b). The reversibility of cigarette smoke-induced metaplastic changes after addition of retinyl esters in vitro clearly documents that application of retinyl esters from the luminal side is an efficient approach (Rutten et al., 1988a,b). Substances found in cigarette smoke condensate (i.e., BaP, polyhalogenated compounds) deplete tissue stores of retinyl esters (Fiorella et al., 1995; Hakansson and Ahlborg, 1985; Rutten et al., 1988a,b; Thunberg et al., 1980). Exposure to these substances could result in a local vitamin A deficiency, which probably may not be compensated by systemic retinol therapy, but by topical retinol inhalation therapy.

5. Toxicological considerations By inhalative application of vitamin A, an accumulation of peripheral vitamin A stores is achieved. For the lung and the respiratory epithelium, concentrations in the range of 1–20 mg/g were obtained (Biesalski, 1990). Looking at quantitative concentrations in the respiratory epithelium and in the mixed epithelium of the nasal mucosa yielded an accumulation of vitamin A — after topical administration in different animal species — in the epithelium of the nose increased by factor 10–100 (in human of factor 5–20) compared to the concentrations of the respiratory mucosa (Lewis, 1973). The therapy of atrophic rhinitis by means of vitamin A-containing nose drops showed that high-dose topical application of the vitamin leads to the restitution of metaplastically modified nasal mucosa, side effects, especially differentiation impairments, were not reported (Breuninger and Kahn, 1960; Duncan and Briggs, 1962).

6. The influence of an insufficient vitamin A supply for the postnatal development of the lung A disease seen recurrently in connection with vitamin A supply is the bronchopulmonary dysplasia (BDP). The pathogenesis of BDP certainly depends on a multitude of factors. Some of the observed morphological changes do remind strongly of the appearances as observed in vitamin A deficiency of humans and animals. Particularly noted should be the focal loss of ciliated cells with keratinizing metaplasia and necrosis of the bronchial mucosa as well as the increase of mucous-secreting cells (Stahlman, 1984; Stofft et al., 1992a,b). Especially focal keratinizing metaplasia, as it may occur after a vitamin A deficiency, is strengthening the assumption of an impairment of the differentiation on the level of the gene expression. Since vitamin A regulates the expression of different cytokeratins and therefore influences

Nutritargeting

189

the terminal differentiation, it seems obvious to suppose common mechanisms. Consequently, the premature but especially the neonate are dependent on a sufficient supply with vitamin A, to ensure the regulation of the cellular differentiation of the respiratory epithelium and lung epithelium. The earlier a child is born before the due date, the lower are its serum retinol levels (Mupanemunda et al., 1994). Since a further decrease of the serum retinol level and retinol-binding protein (RBP) level occurs postnatally, the plasma value at the time of birth is described as a critical factor regarding lung development. Repeatedly it was shown that the serum retinol level and RBP level in prematures are significantly lower than that of neonates (Shah and Rajalekshmi, 1984). In the liver of prematures, significantly lower retinol levels can be found in comparison to neonates (Shensi et al., 1985). Plasma values lower than 20 mg/dl are not rare in this case and they should be taken as an indicator of a relative vitamin A deficit. But a moderate vitamin A deficiency is not only a problem of countries with poor or inadequate food sources. Recently we published data that even in countries with excellent food sources and availability, insufficient vitamin A supply will occur (Schulz et al., 2007). The aim of this trial was to analyze vitamin A and b-carotene status and investigate the contribution of nutrition to vitamin A and b-carotene supply in mother–infant pairs of multiparous births or births within short birth rates. Twenty-nine volunteers aged between 21 and 36 years were evaluated for 48 hours after delivery. In order to establish overall supply, retinol and b-carotene were determined in maternal plasma, cord blood, and colostrum via HPLC analysis. A food frequency protocol was obtained from all participants. Regardless of the high-tomoderate socioeconomic background, 27.6% of participants showed plasma retinol levels below 1.4 mmol/liter, which can be taken as borderline deficiency. In addition, 46.4% showed retinol intake <66% of RDA and 50.0% did not consume liver at all, although liver contributes as a main source for preformed retinol. Despite a high total carotenoid intake of 6.9
3.9 mg/day, 20.7% of mothers showed plasma levels <0.5 mmol/liter b-carotene. Retinol and b-carotene levels were highly significant correlated between maternal plasma versus cord blood and colostrum. In addition, significantly lower levels were found in cord blood [31.2
13% (retinol), 4.1
1.4% (b-carotene)] compared with maternal plasma. Despite the fact that vitamin A- and b-carotene-rich food is generally available, in contrast to developing countries, risk groups for low vitamin A supply indeed exist in the western world. Reduced plasma levels during the first developmental months have a considerable influence on the total development as well as on the susceptibility for infections of infants. With reduced retinol plasma levels,

190

Hans Konrad Biesalski and Jana Tinz*

repeated infections are more often described (Barreto et al., 1994; Filteau et al., 1993) and they are counted among the main complications of a poor vitamin A supply in developing countries. In addition, the serum vitamin A level during infectious diseases, particularly of the respiratory tract, continues to drop (Neuzil et al., 1994). On the one hand, this can be explained with an increased metabolic demand and on the other hand with a renal elimination of retinol and of RBP during the process of acute infections (Stephensen et al., 1994).

7. Possibilities of prevention and therapy On the basis of the importance of vitamin A as described above, the question arises to what an extent a therapeutical intervention can occur, especially for imminent premature deliveries but also for prematures, to achieve a prevention ahead of developing diseases and/or immaturities of the lung. One solution could be the intravenous administration of vitamin A, but due to the infusion systems used so far, it appeared that vitamin A is almost completely absorbed to the polyethylene tubes, respectively, and is damaged by light (Zachman, 1989). A possible improvement for the availability consists of coating the infusion systems with foil to avoid a further reduction of the vitamin due to light. Since the solutions are not available in the market anymore, and on the other hand new parenteral vitamin A preparations are not available yet, the significance of supplying the mother with vitamin A before the delivery must be pointed out. The existing results of two randomized double-blind controlled studies of prematures show that the supplementation with vitamin A in a study lead to a considerable reduction (55%) of the risk to be affected by BDP (Pearson et al., 1992; Shensi et al., 1985). Another study though did not observe any changes. In a third study, 12 prematures received vitamin A intravenously for a period of 28 days (400 IE/day), and during later development, vitamin A was also administered orally (1500 IE/day) [Italian Collaborative Group on Preterm Delivery (ICGPd), 1993]. In the process of the supplementation, a significant change of the initially reduced plasma- and RBP-values occurred. The latter is an indication for an actual vitamin A deficiency of prematures because an increase of retinol-RBP can only be seen if a vitamin A deficiency really exists (principle of the relative-dose-response-test). A direct effect of the plasma concentration on the development of BPD could not be determined. The authors are coming to the logical conclusion that the plasma level (after delivery) hardly reflects the supply of the lung with vitamin A (before delivery). It has to be considered that in this study, it was again documented that especially prematures obviously feature a relative vitamin A deficiency. Thus, the attention should be directed to their supply with vitamin A. On the other hand, the vitamin A supply of the premature for achieving adequate concentrations in the lung either seems not

Nutritargeting

191

sufficient or the availability of the vitamin for the corresponding cells of the lung is not guaranteed. An alternative solution could be the inhalative application of vitamin A. With this, the lung is directly attained and retinyl esters administered by inhalation can be absorbed into the cells and metabolized in a controlled way, as shown in different animal studies (Biesalski, 1996; Biesalski and Weiser, 1993). It should be elucidated to what extent the ‘‘topical’’ application of retinyl esters on the respiratory epithelium, especially with BDP, can contribute to the replenishment of the lung stores and thus leading to the improvement of the clinical outcome. These results show that retinyl esters in respiratory epithelium and in alveolar cells form a pool of vitamin A, which can be used physiologically by the tissue. The formation of retinol and at least RA from retinyl esters is strictly controlled. So far an unphysiological formation of RA and a subsequent toxicity seems not possible. Retinyl esters, however, are biochemically inert with respect to gene expression or vitamin A activity as long as they are not hydrolyzed. Consequently, the inhalative application, especially in cases of insufficient lung development, could represent a true alternative. The oral contribution is hardly successful because of the poor RBP synthesis of the liver and the lack of availability of a parenteral solution is currently not available.

8. Vitamin A inhalation for treatment of vitamin A deficiency Vitamin A deficiency is worldwide one of the most prevalent nutritiondependent deficiency diseases. It leads to changes of the respiratory epithelium, which result in repeated infections of the respiratory tract, the main cause of death in vitamin A-deficient children. The difficulty in supplying the respiratory epithelium with vitamin A is that the affected children frequently suffer as well from infections of the gastrointestinal tract with subsequent reduction of the absorption of fat-soluble vitamins. Nutritargeting can in these cases avoid the problems of malabsorption and ensure the micronutrient supply. The effectiveness of various therapeutical modalities of supplemental vitamin A has been examined in numerous studies using tablets or capsules. On the basis of these studies, increased consumption of dietary vitamin A has been advocated (World Health Organization, 1984, 1992). In India and Indonesia, the provision of extra vitamin A resulted in considerable reduction of mortality (ca. 40%) in preschool children (Bhandari et al.; 1994; Humphrey et al., 1996). While the efficacy of excessive oral doses over more than 8–12 weeks has been questioned, it is evident that an insufficient, low dose given once per week is apparently of little effect on morbidity or mortality (Ramakrishnan et al., 1995a,b). Indeed, recurrent diarrheal episodes or the existence of malnutrition may explain the poor efficacy seen with oral supplementation with low doses (Ramakrishnan et al., 1995a).

192

Hans Konrad Biesalski and Jana Tinz*

In contrast to oral supplementation, the present investigation aims to evaluate the efficacy of inhalation of the vitamin as an alternative route bypassing absorption and liver storage. The advantage of this approach might be that problems frequently seen during protein calorie malnutrition (PCM) due to impaired RBP synthesis with impaired vitamin A release from the liver (Rahmathullah et al., 1991; Ramakrishnan et al., 1995a) can be compensated. In addition the most sensitive target tissue, the lung, is directly supplied. In a placebo-controlled randomized supplementation trial (approved by the ethic commission of Ethiopia) in the rural area (AZOZO) district of Gondar Ethiopia from 220 households, 161 children (2–5 years of age) were selected at random for the study; at a first visit to the local clinic, nutritional assessment, and stool examination (parasites or ova) were performed (Biesalski et al., 1999). 141 children with parasites were treated with mebendazole. Heparin blood was obtained for assessment of vitamin A, RBP, and TTR (transthyretine) concentrations. Twenty-five children selected at random received aerosol treatment with RP; 6000 vitamin A units per 2 weeks over 3 months being provided. Twenty-five further children served as controls receiving a placebo also aerosol delivered. The aerosol was administered through the mouth during breath inhalation with an adapter. No adverse effects or reactions were observed during inhalation and the children complied well with the treatment. Trained field workers performed the inhalation trials and blood sampling. In the study and control group, Heparin blood samples were collected before and at completion of the study for measurements of vitamin A, RBP, and TTR concentrations. The mean initial serum retinol concentration derived from the 161 children was 0.74
0.46 mmol/liter. Fourteen children (8.7%) exhibited a vitamin A deficiency defined by extremely low serum retinol concentration <0.35 mmol/liter and 78 children (48%) revealed marginal deficiency as indicated by low serum concentrations (<0.70 mmol/liter). Serum retinol concentration was not different in the study- and control group prior to inhalation (Fig. 5.3). The serum retinol concentration increased considerably (1.43
0.46 mmol/liter, p < 0.001) compared with the initial value (0.68
0.31 mmol/liter) following supplementation (six inhalations, totally 36.000 IU) and compared with the control group (pre: 0.75
0.42; p < 0.05, post: 0.79
0.37). The RBP concentration was low prior to the treatment (pre: 0.93
0.12 mmol/liter) and increased after inhalation (post: 1.68
0.24 mmol/liter). The concentrations in controls (pre: 0.89
0.14 mmol/ liter; post: 0.9
0.11) remained low. Supplemental vitamin A did not affect TTR concentrations in the treatment (pre: 157.2
43.7 mg/liter vs post: 170.9
35.1 mg/liter) or the control group (pre: 165.7
36.1; post: 168.1
28 mg/liter).

193

Nutritargeting

RBP Study group Placebo group

2

Normal range RBP

Normal range retinol 1

1

μmol/I RBP

μmol/I Retinol

2

Retinol Whole population (161) Study group (25) Placebo group (25)

0

0 Pre-Inhalation

Post-Inhalation

Pre- PostInhalation

Biesalski et al., Brit. J. Nutr. 1999

FIGURE 5.3 Inhalation of vitamin A improves vitamin A deficiency in Ethiopian children with severe fat malabsorption.

In this study, the depleted target tissues were supplied with retinyl ester implicating topical/systemic inhalation method, thereby first bypassing the GI-tract and liver. Indeed, following inhalation, the RP is likely to be carried to the liver where it is taken up, bound to RBP, and re-excreted into the circulation before it is utilized. Another assumption might be that the retinyl esters are taken up as such and may serve as a directly available cellular pool (Biesalski, 1996; Gerlach et al., 1989). As shown, aerosol supported RP supplementation enhanced vitamin A and RBP concentrations, while no effect was observed in the release of TTR. Indeed, it is well known that TTR metabolism is regulated independently and that its changes in concentration changes are usually associated with alterations in nutritional status. Consequently, the considerable decreases in retinol and RBP concentrations in face of unchanged TTR levels indicates that these alterations are solely due to vitamin A deficiency or its supplementation. The fact that the release of RBP increased following inhalation strongly indicates that the observed vitamin A deficiency is primarily owning to low intake or malabsorption of vitamin A and not due to protein energy malnutrition (Blaner, 1989). It is essential to examine whether the uptake of retinyl esters in the respiratory mucosa might be associated with an excess formation of free retinol or RA in the cells with the formation exceeding the binding

194

Hans Konrad Biesalski and Jana Tinz*

capacity of CRBP or CRABP. In experimental studies with inhalative application of retinol margarinate, the uptake of retinyl esters showed great variation in different sites of the lung tissue (Biesalski, 1996). Yet, the cellular concentration of retinol remained essentially unchanged. This indicates that the formation of retinol is strictly controlled despite high or low uptake of retinyl esters. In this connection, it is also necessary to emphasize that long-term topical administration of high vitamin A in liquids containing 15.000 IU/ml is an established therapy of atrophic rhinitis, rhinitis sicca, and further metaplastic changes of the nasal epithelium (Simm, 1980). The applications lead to the normalization of the epithelium and reappearance of a normal function without any reported side effects. An impairment of the mucociliary clearance increases the susceptibility against respiratory infectious diseases frequently associated with marginal vitamin A deficiency (Sommer et al., 1984). Interestingly vitamin A status following supplementation with 15-mg RP monthly for 2.5 months (Rahman et al., 1996) was not improved in the presence of respiratory tract infections (Sommer et al., 1986). Inhalative application of vitamin A, as used in the present study, exerts direct and immediate effects on the epithelia of the upper respiratory tract. A further advantage of the inhalative route is a complete absorption of the retinyl ester, the rate being independent of the mucosal integrity of the gastrointestinal system. Indeed, the gut might be one of the less integrated organs as a consequence of vitamin A deficiency. Thus, inhalation of retinyl esters might be suitable for vitamin A therapy in the presence of malnutrition and diarrhea. We found that supplementation of vitamin A in the form of an aerosol is an effective, safe, and routinely manageable method to enhance vitamin A and RBP concentrations. Consequently, this modality of treatment may serve as an alternative vitamin A therapy during chronic or acute episodes of malnutrition, malabsorption, or in case of insufficient compliance to other therapies and might be useful in respiratory diseases associated with vitamin A deficiency.

9. Topical supply of vitamin A to mucous membranes Prolonged vitamin A deficiency as well as acute and chronic inflammation and toxins can result in a focal appearance of squamous cells in different mucous membranes, which expand to replace normal epithelium (Biesalski, 1996; Hakansson and Ahlborg, 1985; McCullough et al., 1999). This effect leads to a lower epithelial barrier function and a higher risk for infection shown by Quadro et al. (2000) and Bloem et al. (1990). According to Biesalski and Stofft (1992) and Stofft et al. (1992a,b), an increase in goblet and a decrease in ciliated cells can be detected in the respiratory tract during a vitamin A deficiency. Guzman et al. (1996)

Nutritargeting

195

showed in vitro that vitamin A controls the development and maintenance of mucociliary differentiation in the respiratory epithelium. Ponnamperuma et al. (1999) demonstrated that squamous metaplasia of vaginal epithelium is a result of a vitamin A-deficient diet in ovariectomized mice. In a recent study, we evaluated the uptake of topically applied RP in buccal mucosal cells (BMCs). This could be a way to circumvent the hepatic pathway and to increase the bioavailability of micronutrients in special target tissues (Sobeck et al., 2003). A 0.1% PR-containing toothpaste (AronalÒ forte GABA International AG, Therwil, Switzerland) or a placebo toothpaste (AronalÒ forte Placebo) was used in the morning for the clinical study. ElmexÒ toothpaste (GABA International AG) was used by all volunteers in the evening. Forty healthy participants, 25 female and 15 males, aged 19–33 years with a body mass index between 18 and 24 kg/m2 took part in the study. Excluding criteria were smoking, current dental surgery, illness of the pharynx or the cavity of the mouth, malabsorption, long-time medication, use of a toothpaste with vitamin A during the last 2 months prior to the study, pregnancy, and metabolic diseases. The duration of the study was 84 days. From day 0 to 56, the volunteers cleaned their teeth exactly 3 min in the morning with an RP-containing or placebo toothpaste and in the evening with ElmexÒ , by using the AronalÒ o¨ko dent toothbrush and a standardized quantity of toothpaste (1.7 g). BMC samples were taken by the participants themselves during that phase on day 0, 3, 7, 10, 14, 17, 21, 28, and 56 with a surgical, soft toothbrush. During the wash-out phase from day 56 to 84, the volunteers cleaned their teeth exactly 3 min in the morning with the placebo formulation and in the evening with ElmexÒ . Samples were taken on day 70 and 84. Additionally, blood samples were taken from the on day 0 and 56 to exclude any side effects. BMCs were collected using a recently modified and optimized version of a published method (Erhardt et al., 2002). They were harvested by brushing a surgical soft toothbrush lightly across the inside of the cheek for twenty times (one up–down stroke counted as one time) after rinsing the mouth thoroughly with drinking water. Immediately after brushing, the volunteers were asked to rinse their mouth with isotonic salt solution to collect the cells. The period from day 0 (0.034 pmol/mg DNA) to day 3 (0.007 pmol/mg DNA) showed a short but not significant decrease of RP. The concentration of RP in BMCs on day 0 and day 84 (0.038 pmol/mg DNA) was nearly identical. The uptake of RP on day 7 (0.065 pmol/mg DNA), day 10 (0.092 pmol/mg DNA), day 14 (1.780 pmol/mg DNA), day 17 (3.041 pmol/mg DNA), day 21 (4.163 pmol/mg DNA), and day 56 (2.191 pmol/mg DNA) was significantly increased compared to the placebo group.

196

Hans Konrad Biesalski and Jana Tinz*

3.5

**

10

3.0

8

2.5

6

2.0 1.5

4 1.0 2

0.5 0.0

0 0

3

7

12 volunteers topical application from day 0 to day 9 at 8.00 a.m.; cell harvesting at 5.00 p.m.

FIGURE 5.4

Retinol (pmol/μg DNA)

Retinyl palmitate (pmol/μg DNA)

12

10

17

21 days

Sobeck et al. Eur. J. Med. Res. 7, 2002

Uptake of RP (0.1%) and formation of retinol from dental gel into BMCs.

The course of retinol concentrations in BMCs is shown in Fig. 5.4. The values of retinol showed a significant increase between day 17 (0.181 pmol/mg DNA) and day 21 (0.268 pmol/mg DNA), 28 (0.208 pmol/mg DNA), and 56 (0.156 pmol/mg DNA) compared to the placebo group. A delay of 10 days in the increase of retinol could be detected compared to the course of RP. Regarding the wash-out phase, the levels of retinol decreased from day 56 to 0.003 pmol/mg DNA on day 84. Day 0 showed a concentration of 0.002 pmol/mg DNA. To exclude effects of RP accumulation in the blood, samples were taken from the volunteers on day 0 and 56. No significant differences could be observed in the placebo and the treated group. Bitzen et al. (1994) detected high interindividual differences in RP as well as retinol levels in blood samples of young healthy volunteers after an oral dose of RP. The significant uptake of topically applied RP and its metabolization to retinol in peripheral tissue is of high importance as retinoids play a pivotal role in growth and differentiation of mucous epithelia (Epstein and Gorsky, 1999; Massaro and Massaro, 1997). We applied a low-dose RP (5000 IU), which resulted in a significant increase of RP in the mucosa but not in the plasma. Plasma retinol is homeostatically regulated and as a consequence retinol never increases even when high doses are given. In contrast RP in plasma (chylomicrons) increases significantly following an intake of greater than 10.000 IU shown by Willett et al. (1984) and Bitzen et al. (1994). These data also show that determination of micronutrients in buccal cells gives more valuable information on the individual status than plasma levels.

Nutritargeting

197

An absence of retinoids can lead to inflammation and metaplastic alterations such as gingivitis, shown by Gonza´les et al. (2001). Topically applied RP provides the buccal and gingival mucosa with a sufficient amount of vitamin A. We suggest that an enrichment with vitamin A may lead to prophylactic effects (e.g., a reduction of inflammatory diseases) or a therapeutic reversal of metaplastic alterations. A prolonged Vitamin A-deficient diet results primarily in single changes of cellular terminal differentiation, changing into squamous metaplasia after complete depletion of the cellular storage. However, such cellular metaplastic changes also occur independently of the systemic supply, induced by local inflammation, pro-inflammatory cytokines, or chronic irritation (e.g., polychlorinated compounds), resulting finally in a local vitamin A deficiency. To reduce inflammation and subsequent irritation an adequate oral hygiene is an essential preventive action. An additional effect may be obtained by local application of vitamin A as persistent inflammation places an increased demand on this essential compound (Kanda et al., 1990). Furthermore, a sufficient vitamin A level in mucosal tissues boosts the immune system to prevent oral inflammation of the gums.

10. Evaluation of the effects of topical vitamin A application on rat vaginal mucosa Test substances applied to oral mucosa of animals are in part swallowed and therefore may act systemically. To prevent this, the tests were also carried out in vivo on the vaginal mucosa of rats. Studies on vaginal epithelia of ovariectomized (OVX) rats have shown that a vitamin A-free diet enhanced squamous metaplasia (Ponnamperuma et al., 1999). Since the oral mucosa is morphologically nearly identical to the vaginal one, this tissue is most suitable to test the efficacy and bioavailability of an oral care product. Furthermore, rats have the anatomical benefit of a completely separated vagina and urethra; the applied preparation therefore cannot be rinsed off by the urine. To exclude interference of the female sex hormones with the vitamin A state, ovariectomized animals were used as the appearance of squamous cells in the oestrous phase can morphologically not be distinguished from those of a vitamin A deficiency as shown by Ponnamperuma et al. (1999). Leukocytes were estimated as they indicate both, the diestrous phase and an adequate supply with vitamin A. In this experiment, we investigated the reversal of squamous metaplastic changes in rat vaginal mucosa as an indicator to test efficacy and bioavailability of topical vitamin A (Biesalski et al., 2001). The animals treated with 200, 400, and 800 IU A showed a healing effect of vitamin A on the cornified vaginal epithelium as early as 2 days after starting the experiment. In the smear of all concentrations, almost exclusively leukocytes — indicating a successful healing and mucosal regeneration — with only sporadic epithelial cells and squamous cells

198

Hans Konrad Biesalski and Jana Tinz*

were identified. The application of 200 IU of vitamin A resulted in a mean healing duration of 19.33
1.21 (SD) days before completely cornified vaginal epithelium occurred again. The protective effect of 400 IU of vitamin A lasted 31.75
0.96 (SD) days while 800 IU of vitamin A resulted in a healing duration of 43.0
0.82 (SD) days. Fig. 5.5 demonstrates that the healing duration correlates with increasing concentrations of vitamin A palmitate. In the placebo-treated group, only a pure squamous cell stage was seen. As no change in the cell picture occurred up to four days after treatment, further observations were ceased. The relative activity of vitamin A palmitate in Aronal forte toothpaste was compared to an experimental low-dose toothpaste and the formerly used dental gel as a standard. The animals treated with 384 and 768 IU of vitamin A dental gel, respectively, showed the healing effect as early as one day after the vaginal installations, leading to a mean healing duration of 31.3
1.21 (SD) and 40.5
0.56 (SD) days, respectively. The protective effect on the vaginal mucosa with 391 IU and 782 IU of vitamin A per animal of Aronal forte, respectively, lasted 33.3
0.82 (SD) and 41.5
1.05 (SD) days, respectively. With the low-dose toothpaste (305 IU of vitamin A), a mean protective effect of 29.3
1.21 (SD) days was achieved. The administration of the double concentration per animal gave a clearly prolonged duration of 35.3
1.63 (SD) days. The placebo-treated animals showed only squamous cells in the lavage fluid for up to 4 days after treatment; further observations were therefore stopped. The statistical evaluation by means of the four-point parallel line assay resulted for the Aronal forte toothpaste in a significant higher activity of factor 1.11 (C.l. 1.03–1.19; p ¼ 0.05) in comparison to the dental gel standard. The evaluation carried out on the quality of the experiment

Protection time [days]

50 40 30 20 10 0 200

400

600

800

Dosage of vitamin A in dental gel [IU] Biesalski et al. Eur. J. Med. Res. 6, 2001

FIGURE 5.5 Epithelial protection time (until reappearance of squamous cells) following topical vitamin A application on vad-rat vaginal mucosa.

Nutritargeting

199

using the t-test gave a significantly different slope of the regression lines. This demonstrates a good dose-effect relationship. In the check for parallelism of the regression lines, the null hypothesis was confirmed. The relative efficacy of the experimental low-dose toothpaste was different by a factor of 0.92 (C.l. 0.82–1.02; p ¼ 0.05; Finney, 1978). A good dose-effect relationship with significant slope of the regression lines was shown with the t-test. But in case of the parallelism, there was a significant difference. In order to demonstrate pharmacological activity of vitamin A in Aronal forte toothpaste, treatment with 87.6 IU and 175 IU of vitamin A, respectively, and a retention time of 1 and 3 min were carried out for 11 days. The healing effect of vitamin A could be seen already 1 day after the first topical treatment with 1 or 3 min retention time prior to rinsing. The lavage fluid consisted of an equal mix of leukocytes, epithelial cells, and squamous cells, indicating the start of the healing process upon the cornified mucosa. As treatment progressed, a correlated increase in the proportion of leukocytes was observed, as sign of mucosal productivity. After the last application, cell differentiation was continued until pure squamous cells appeared. Protective effects of 7.60
1.14 (SD) and 8.0
0.82 (SD) days were registered with the lower and higher dose. At a retention time of 3 min, the cell picture in the smear changed from a pure squamous type to a mixture of leucocytes and epithelial cells after the first day of treatment. With progression of the treatment, the leucocytes became the dominant cell type, corresponding to an increase in epithelia cells. After the cessation of the treatment on day 11, the examination of the smears was continued until pure squamous cells were found as a result of the vitamin A being used up. The protective effect of vitamin A was registered to be 7.80
0.84 (SD) and 9.75
0.96 (SD) days, respectively. By means of the parameter-free, one-sided X-test, the protection in days after cessation of the vitamin A supply was statistically evaluated (Van der Waerden and Nievergelt, 1956). These results question whether an increase in amount and retention time of Aronal forte toothpaste results in an elongation of epithelial protection. With the short supply of vitamin A for 1 minute, no dose-dependent improvement was detected. However, with a retention time of 3 minutes, the higher dose correlated positively with the duration of vitamin A protection. The differences between the higher and lower dose were statistically significant (p < 0.025). The control group was treated twice daily with 0.10 ml of placebo with rinsed out after 3 minutes. The squamous cell phase seen initially did not change with the treatment. After 4 days, the administration of placebo had to be discontinued as the general condition of the animals had deteriorated. The conducted experiments confirm the hypothesis that topically applied vitamin A is taken up fast into deeper cell layers and exerts pharmacological activity on mucous membranes. For the first time, we evidently demonstrated that squamous epithelial changes induced by vitamin A deficiency of OVX-rats are totally reversed in to a fully healthy

200

Hans Konrad Biesalski and Jana Tinz*

status by topical application of RP in dental care products. Applying a total amount of 800 IU over 2 days exhibited healing and protective activity from total keratosis for 43.0
0.82 days. Restricted retention time of 1 min and low concentration (87.6 IU vitamin A) twice daily still show healing effects 24 h after first application. The squamous cells were no longer predominant and, with progressive healing, the proportion of leukocytes and epithelial cells grew. After only 2 days of treatment, squamous metaplastic vaginal epithelium showed a full reversal of the epithelium into a healthy status, protected for another 7–11 days from full cornification after completed therapy. Higher concentrations (157 IU) and longer retention of 3 min lead to a statistically significant (p ¼ 0.025) increase of the protection time. Furthermore, in vivo where a significant enrichment of RP from Aronal forte in human buccal mucosa was measured (Sobeck et al., 2003). No more retinyl esters were detected 17 days after completion of the treatment, indicating a washout during the cellular differentiation. We therefore conclude a fast uptake and long storage of vitamin A occurs in epithelial cell layers. The obtained results confirm earlier findings where vitamin A-deficient rats were used to prove the uptake of retinyl esters into lung, liver, kidney, and plasma after inhalation thereof (Biesalski, 1996). However, long-term topical administration of high vitamin A concentrations is a wellestablished therapy in atrophic rhinitis, rhinitis sicca, and metaplastic changes in the nasal or ocular epithelium (Deshpande et al., 1997; Simm, 1980). The application leads to the normalization of mucous membranes and reappearance of a normal function with no side effects. Our findings are most important as vitamin A deficiency is believed to compromise mucosal immunity by altering the integrity of mucosal epithelia of the genitourinary tract (Semba, 1998) and most likely also the oral tract. Retinoids are important for the regulation and cell differentiation of epithelial layers. Their absence provokes inflammatory changes, cornification, and metaplasia and therefore weakens the natural barrier function of the mucosal membrane. In addition, the secretory IgA response to various pathogens is thought to be impaired (Aukrust et al., 2000) and mucin production on the transcriptional level is disturbed (Guzman et al., 1996). Mucin, however, plays an essential role as a first line of defense in the oral cavity. Topical vitamin A delivery on the oral or genital tract may in conclusion improve the endothelial barrier function and contribute to a lower risk for viral transmission or pathogenicity of microorganisms (Semba, 1998). Interestingly, we also observed an improved general health in animals treated with the dental care products while placebo-treated animals were only kept alive by oral vitamin A supply. Together with the findings of the experiments with Aronal forte, these results support the use of vitamin A by topical application onto mucous membranes as a basic supplement in malnourished people. A prerequisite though is high

Nutritargeting

201

availability and biological activity of vitamin A palmitate from the vehicle. Furthermore in contrast to studies with high oral intake of vitamin A, no toxic effects were seen. An intracellular pool of vitamin A independent from the bloodstream could be established by targeted treatment of vitamin A palmitate which might circumvent these toxic effects.

B. Vitamin E Similarly, the inhalation of vitamin E could be an effective way to selectively supply the lung with this vitamin which is essential for its antioxidative defense. According to recent scientific findings, the lung is not provided with vitamin E via LDL, as most of the other tissues are, but via HDL. This means that the supply of the lung with vitamin E decreases when LDL rises, HDL decreases and the supply of vitamin E remains constant. It is difficult to estimate to what extent this phenomenon is relevant for the resistance of the lung to oxidative stress. Some data show that vitamin E is accumulated in the lung during chronic stress. Thus, higher values of vitamin E are usually found in the alveolar macrophages of smokers. The concentration of vitamin E in the epithelial lining fluid (ELF) is, however, considerably lower. Basically, the intravenous application of micronutrients can also be classified as nutritargeting. Specifically, when target tissues like the endothelium of the vessels must be supplied with a higher dose of vitamin E to ensure good protection during surgery with ischemia/reperfusion injury, the parenteral route is superior over the ‘‘controlled’’ oral route (Bartels et al., 2004). Vitamin E accumulates in the aortic endothelial cells after parenteral, but not oral, administration (Fig. 5.6). The latter is due to the fact that vitamin E is integrated into VLDL by the liver and that the maximum concentration in the LDL is 7–10 molecules per LDL particle. Therefore, there is only a limited transfer of vitamin E from LDL to endothelial cells. An accumulation of vitamin E in endothelial cells can yet be seen as a preventive measure against the ischemia/reperfusion syndrome.

C. b-Carotene/carotenoids/fat-soluble antioxidants Basically all fat-soluble compounds of the diet are absorbed and partially metabolized in the upper part of the small intestine. Afterwards, they are transported to their target organs via the systemic circulation. Therefore, it is impossible to deliver b-carotene to the lower parts of the intestine via the chymus. b-Carotene reaches this part of the intestines only after systemic absorption. It was documented in several studies that high doses of b-carotene lead to a downregulation of ornithine-decarboxylase (ODC) in patients

202

Hans Konrad Biesalski and Jana Tinz*

1.4

Parenteral

Oral

1.2 pmol/mm2

1.0 Vitamin E

0.8

Placebo

0.6 0.4 0.2 0.0 Before

After

Before

After Engelhart et al. Free Rad. Res. 29, 1998

FIGURE 5.6 Accumulation of vitamin E in aortic endothelial cells following oral (3  1.0 mg) or parenteral (3  0.5 mg) administration during 3 days.

suffering from intestinal polyps. When supplementation (30 mg/day) was stopped, the ODC values in the tissue, that is, in the adenomatous polyps, rose again while b-carotene in the blood declined in parallel fashion (Phillips et al., 1993). Since an increased activity of the ODC goes along with neoplastic changes, a reduction of ODC activity in these tissues is interpreted as tumor prevention. However, such an approach is problematic because b-carotene must be administered in very high doses. This may result in an unnecessary accumulation of this provitamin in other tissues and, eventually, lead to harmful effects. Yet when b-carotene is coated with pectin (edible coating), the pectin prevents b-carotene — or other carotenoids as well as fat-soluble compounds — from being absorbed in the upper parts of the small intestine. As a consequence, these coated compounds can be transported via the chymus to the colon, where the pectin is broken down to short-chain fatty acids by bacteria. These fatty acids play an important role as growth regulators of the colonic mucosa cells. At the same time, the active agents, such as b-carotene, are released and can then be absorbed by the mucosa.

II. NUTRITARGETING AS A WAY OF BYPASSING ABSORPTION BARRIERS Another interesting feature of nutritargeting is the ability to circumvent absorption or metabolization barriers during malabsorption, maldigestion, or when there is a lack of transport proteins, for example, tocopherol-

Nutritargeting

203

or retinol-binding protein. The identification of the different pathways that tissues and organs can use to accumulate micronutrients is one of the fundamental prerequisites to administer nutrients selectively. Presently, however, only very few mechanisms by which organs can be provided with micronutrients via nutritargeting in a controlled way have been identified. The provision of fat-soluble vitamins and lipids is difficult, if not impossible, in various diseases. This is especially true for diseases that are accompanied by a lot of oxidative stress, for example, mucoviscidosis. The requirements of fat-soluble antioxidative substances are certainly high in these cases and can barely be covered by intramuscular injections because fat-soluble vitamins can hardly, if at all, be absorbed from oily preparations. Alternatively, the vitamins can administered via the buccal mucosa: the fat-soluble substances have to be packaged in such a way that they can be transported in a watery compartment and are thus able to largely dissolve in the saliva. When they have an adequate size, they can then penetrate the buccal mucosa. One approach is the development of the so-called nanocolloids, that is, particles with a polar nucleus, in which the fat-soluble vitamin is dissolved, and an apolar wrapping (monolayer). This structure makes an oral application of fat-soluble substances possible. First tests demonstrated that vitamin A palmitate, atocopherol, as well as coenzyme Q10 are thus able to enter the systemic circulation via the buccal mucosa.

A. Digestion and intestinal absorption of fat-soluble dietary components Various factors are required for regular fat digestion. Sublingual lipase and eventually a gastric lipase — which are both stable in an acidic environment — start digesting dietary fats in the stomach. In the intestine, pancreatic bicarbonate as well as bile acids are essential for emulsification of fats and fat-soluble substances which are then cleaved by pancreatic lipases. The cleavage products are incorporated into micelles and can then penetrate the unstirred water layer (UWL) which covers the intestinal surface. There, they can deliver the cleavage products of dietary fats as well as fat-soluble substances (e.g., carotenoids, vitamin E, vitamin A) to the luminal surface of the enterocytes.

B. Fat malassimilation The regular digestion of dietary fats and fat-soluble substances and/or their absorption via the lipid route is compromised in the frame of various diseases such as cystic fibrosis, short bowel syndrome, cholestasis, and chronic inflammatory bowel diseases.

204

Hans Konrad Biesalski and Jana Tinz*

C. Bioavailability of dietary, emulsified and solubilized fat soluble vitamins Fig. 5.7 illustrates how the absorption of dietary fat-soluble substances via the lipid route is affected when lipids are insufficiently emulsified and incorporated into micelles. When fat-soluble vitamins are provided in stable water-soluble solubilizates (diameter of the micelles: 20–50 nm), they can directly permeate through the UWL and reach the membrane of the enterocytes where they can be absorbed. The block in the lipid route can thus be circumvented via the aqueous route. Fat particles in emulsions are as well quite small (diameter: 500–5000 nm). Digestion and absorption of fat-soluble vitamins from emulsions might thus be enhanced as well. The fat particles are, however, larger than those in the water-soluble form and therefore do not directly diffuse through the UWL. Furthermore, emulsions are more unstable toward changes in pH and might disaggregate in the acidic environment of the stomach, while the water-soluble micelles are more pH stable.

“Lipid route” Fat partide

Digestion of fat and fat soluble substances Bile acid bicarbonate, Disturbed at CF intestinal motility

“Aqueous route” AQUANOVA vitamin solubilisate

*

Bile acids

*

Intestinal lumen

UWL

Emulsified fat particle Ø 0.5–5 μm Pancreatic enzymes, bile acid bicarbonate, Absorption of solubilized vitamins intestinal motility Mixed micelles Ø < 80 nm

Microvilli

50 nm

Product micelles

Micelles of AQUANOVA® vitamin Esolubilisate

Membrane of the enzterocytes

FIGURE 5.7 Absorption of dietary fat-soluble substances via the lipid route affected by insufficiently emulsified and micellised lipids.

Nutritargeting

205

D. Comparative bioavailability study (water-soluble micelles vs a regular supplement) In a study with 14 healthy adult volunteers, we have assessed the bioavailability of d-a-tocopheryl acetate solubilizate (100 IU in form of a jelly baby; manufacturer of the solubilizate: Aquanova German Solubilisate Technologies GmbH, Darmstadt/Germany) in comparison to a regular supplement with the fat-soluble form of d-a-tocopheryl acetate (Back et al., 2005). Four hundred-microgram crystalline vitamin C were administered together with vitamin E at all days either via the jelly babies or diluted in water. Vitamin C was added to the jelly babies in order to complement the ‘‘antioxidant cocktail’’ and furthermore, supplying a water-soluble vitamin served as a control measure. Since vitamin C is absorbed via another mechanism than the fat-soluble vitamins, no differences between the reference and study supplements should be observed between the 3-study days. At all study days, subjects had venous blood samples taken after fasting for at least 12 h. Afterwards, the vitamins were administered. On day 0, the subjects were instructed to suck the jelly baby slowly and keep it in the mouth as long as possible in order to achieve a more or less constant salivary vitamin concentration. On days 10 and 20, the jelly baby or supplement, respectively, was swallowed with some water. Further venous blood samples were taken 1, 5, 15, 30, 60, 180, 240, 300, and 320 min after ingesting the vitamins. Table 5.1 gives a survey of the area under the curve (AUC) of a-tocopherol and vitamin C at days 0, 10, and 20. There were no significant differences in the AUCs of vitamin C between day 0, 10, and 20, yet there was a significant difference between AUCs of a-tocopherol on day 0 and 20. In order to assess the magnitude of the change in plasma concentrations after ingestion of the jelly babies and reference supplement, the difference between maximum and minimum plasma concentrations was calculated. For vitamin C, plasma concentration was always about 40 mmol/liter and not significantly different between study days. There was, however, a significant difference between day 0 and day 10, respectively, versus day 20 in the plasma concentration for a-tocopherol. In summary, our bioavailability study provided for the first time data for the short-term bioavailability of a-tocopherol solubilizate in comparison to regular fat-soluble preparations. Our results pointed to a higher short-term bioavailability of vitamin E in micelles versus fat-soluble forms of this vitamin in healthy adult volunteers both with regard to AUCs and with regard to maximum increases in plasma vitamin concentrations.

206

Hans Konrad Biesalski and Jana Tinz*

TABLE 5.1 Comparison of AUCs AUC day 0

AUC day 10

AUC day 20

p

a-tocopherol 20.1 20.7 13.5 day 0 versus [(mmol/ (10.9–58.1) (9.8–39.5) (6.9–30.6) day 20: liter)  h)] p ¼ 0.016 b-carotene 20.5 11.6 4.4 day 0 versus [((mmol/ (4.2–86.7) (2.7–32.0) (0.38–25.0) day 20: liter)  p ¼ 0.016 min)] Vitamin C 145.0 131.2 118.0 NS (77.4–196.7) (47.7–206.4) (53.3–220.6) [(mmol/ liter)  h)]

In a case study, Traber et al. (1986) reported that they successfully increased tocopherol in plasma and adipose tissue in a child with congenital hepatic cholestasis by oral administration of vitamin E as TPGS (a water-soluble form of vitamin E: tocopheryl succinate polyethylene glycol 1000) (100-mg tocopherol/kg body weight per day), while tocopheryl acetate emulsified with medium-chain triglycerides and polysorbate 80 did not have that effect. By administering the same form of vitamin E in a daily dose of 4000 IU, normal vitamin E plasma concentrations and increased adipose tissue a-tocopherol concentrations could be achieved in a 71-yearold patient with severe fat malabsorption and vitamin E deficiency (secondary to short-bowel syndrome) (Traber et al., 1994). Most of the above-mentioned bioavailability, intervention, and case studies came to the conclusion that water-miscible or water-soluble preparations of fat-soluble vitamins were superior to regular supplements. Based on the evidence from our own bioavailability study as well as from the studies mentioned above, it therefore seems justified to assume that fat-soluble vitamin deficit patients with fat maldigestion and/or malabsorption can be corrected more efficiently by using water-soluble as opposed to fat-soluble preparations. Another advantage of water-soluble preparations in general might be that lower daily doses are required when compared to fat-soluble preparations to achieve the same results.

E. Coenzyme Q10 (CoQ10) Since the bioavailability of CoQ10 in humans is relatively low due to its lipophilic nature and large molecular weight, several formulation technologies exist to improve its bioavailability from dietary

Nutritargeting

207

supplements (and therapeutics). Different Galenic preparations are available: crystalline CoQ10 powder in hard gelatine capsules, as well as oily dispersions and solubilizates of CoQ10 in soft gel capsules. These formulations largely differ in their bioavailability of CoQ10. In our study, the main interest was to compare CoQ10 supplements (market standard formulations) with a novel solubilizate formulation of CoQ10 (Solu? Q10) based on polysorbates (Schulz et al., 2006). Since CoQ10 underlies biologic regulation and metabolism, we focused on early absorption parameters (0–4 h after ingestion). Additionally, longterm accumulation in blood and tissue was examined after consecutive dosing during 2 weeks. As shown in Fig. 5.8, both solubilizate formulations showed equal AUC0–4 h levels with 0.17
0.13 mmol/mmol  h and 0.17
0.09 mmol/mmol  h, respectively, and both were highly significantly superior to crystalline CoQ10 (p < 0.01). Both preparations also showed superiority over oily dispersion 1 (0.08
0.07 mmol/mmol  h; p < 0.05), but missed statistical significance over oil dispersion 2 with 0.10
0.05 mmol/mmol  h. Differences between formulations in AUC0–12 h, Cmax, and Tmax missed statistical significance. As expected, crystalline CoQ10 led to lowest Cmax and highest Tmax values. In general, solubilizates

AUC0=4h [mmol/mmol*h]

0.4

**

**

*

*

*

Solubilizate 1 Solubilizate 2

0.3

Oily dispersion 1 Oily dispersion 2

0.2

Crystalline

0.1

si o er sp

O

ily

di

di ily O

n 2 C ry st al lin e

1 n si o er sp

bi lu So

So

lu

bi

liz

liz

at

at

e

e

2

1

0.0

Data are means ± SD * p < 0.05 (solubilizates vs. oily dispersion 1; oily dispersion 2 vs. crystalline) ** p < 0.01 (solubilizates vs. crystalline)

FIGURE 5.8 Bioavailability of 60-mg CoQ10 single dosing (early absorption). AUC0–4 h (mmol/mmol  h) after a single dose of 60-mg CoQ10. Data are expressed as mean
SD. Differences between formulations were tested with ANOVA and post hoc test StudentNewman–Keuls test. * p < 0.05 (both solubilizates vs oily dispersion 1 and oily dispersion 2 vs crystalline); **p < 0.01 (both solubilizates vs crystalline).

208

Hans Konrad Biesalski and Jana Tinz*

reached higher levels and faster absorption rates compared to oily dispersions and crystalline CoQ10. After multiple dosing of CoQ10 for 14 consecutive days, a significant increase in plasma CoQ10 concentrations was seen in all groups (p < 0.01). The highest mean increase was reached by solubilizate 1. As depicted in Fig. 5.9, after 1 week of supplementation, solubilizate 1 seemed to have already reached a plateau level in plasma, whereas, for the other preparations, a further slight increase could be observed in the second week of supplementation. Looking at AUC0–14 day, the relative bioavailability of solubilizate 1 was 142% compared with crystalline CoQ10, followed by oily dispersion 2 (131%), solubilizate 2 (107%), and oily dispersion 1 (89%). Intracellular CoQ10 levels in BMC were analyzed independent of formulations. A significant increase (p ¼ 0.0282) in intracellular CoQ10 content was observed in volunteers with baseline levels of <12 pmol/mg DNA (Fig. 5.10). Within this group, the correlation between plasma and intracellular CoQ10 status pre- and postsupplementation was evaluated and found to be significant with r ¼ 0.2659 and p ¼ 0.0164 (Pearson correlation coefficient). An increase of CoQ10 levels in plasma over time was more prominent compared to BMC. Volunteers starting with very

Plasma ΔCoQ10 (mmol/mmol cholesterol)

0.25 0.20 0.15 0.10 0.05 0.00 1

2 3 4

5 6

7 8 9 10 11 12 13 14 15

Days of supplementation Solubilizate 1 Solubilizate 2 Oily dispersion 1 Oily dispersion 2 Crystalline

FIGURE 5.9 Increase in plasma CoQ10 concentrations (mmol/mmol cholesterol) after 1, 7, and 14 consecutive days of supplementation (60 mg/day). Means are plotted after baseline correction and correction for total cholesterol.

Nutritargeting

209

*

BMC CoQ10 [pmol/mg DNA]

15

10

5

0 Pre

Post

Supplementation

FIGURE 5.10 Intracellular CoQ10 content in BMC pre- and postsupplementation (14 days). Values are expressed as mean
SD. Volunteers with baseline levels <12 pmol/mg DNA were pooled (n ¼ 41); *p < 0.05 paired t-test.

high intracellular concentrations of CoQ10 leveled off normal values within 2 weeks of supplementation, indicating that there might be regulatory biologic systems within the physiologic range. The superiority in early uptake is also reflected in calculating AUC0–4 h. Both solubilizates indicate clear superiority over oily dispersions and crystalline CoQ10 (p < 0.01) in this time frame. This might be explained by the structure of the water-soluble forms, small enough to be directly incorporated into the intestinal border. For preparation of a solubilizate, the detergent polysorbate 80 is used. Nerurkar et al. (1996) showed that permeability of CaCo-2 cells is enhanced by polysorbate 80 due to inhibition of an apically polarized efflux system. Additionally, Seeballuck et al. (2004) showed in an in vitro model with CaCo-2 cells that polysorbate 80 stimulates the secretion of triglyceride-rich lipoproteins (chylomicrons). Chylomicrons are the lipoprotein fraction mainly responsible for transport of lipophilic substances out of the intestines into the lymphatic system. Future aspects: a step to selectively target vitamin E to cells (fibroblasts) was achieved by creating functionalized microemulsions. For a-tocopherol targeting to skin fibroblasts the RGD [motif of fibronectin that is chosen for the a-tocopherol targeting to skin fibroblasts and is the binding sequence (ligand) to integrin subunit a5 b1]-motif [GRGDSPA (synthetic peptide derived from the fibronectin receptor binding protein)] of fibronectin was chosen, which is the binding sequence (ligand) to integrin subunit a5b1. The significant higher uptake after 60 min of the peptide-functionalized microemulsion versus microemulsions without

210

Hans Konrad Biesalski and Jana Tinz*

the peptide implies the functionality of the ligand (Kramer, 2005). This kind of peptide functionalization might be a future and promising step to target nutrients selectively to cells and tissues.

III. CONCLUSION With increasing knowledge about the role and the mode of action of micronutrients, it becomes increasingly important to transport these substances in a controlled way to the tissues to be protected. The technology developed for drug targeting can be adopted to the specific requirements in nutritargeting and organospecific accumulation can thus be rendered either possible or impossible. This option could play an important role, for example, in cancer therapy, when the healthy tissue has to be protected against the side effects of the therapy but at the same time the tumor has to be cut off from the supply. Radiotherapy, hyperthermia, and the photodynamic therapy as well as some chemotherapeutics work through the generation of free radicals. Thus, the accumulation of radical scavengers such as the vitamins C and E or carotenoids in the tumor is not desirable (Biesalski and Frank, 2002). On the other hand, an accumulation of these radical scavengers in the healthy tissue could provide protection against therapy-induced damages. There is a wide spectrum for the application of nutritargeting. At the moment, it is essential to classify organs and tissues which selectively accumulate specific micronutrients. This approach ensures that, in the future, risk groups can be supplied with the required substances much more effectively than presently.

REFERENCES Albanes, D., Heinonen, O. P., Taylor, P. R., Virtamo, J., Edwards, B. K., Rautalahti, M., Hartman, A. M., Palmgren, J., Freedman, L. S., Haapakoski, J., Barrett, M. J., Pietinen, P., et al. (1996). Alpha-Tocopherol and beta-carotene supplements and lung cancer incidence in the alpha-tocopherol, beta-carotene cancer prevention study: Effects of base-line characteristics and study compliance. J. Natl. Cancer Inst. 88, 1560–1570. Auerbach, O., Hammond, E. C., and Garfinkel, L. (1979). Changes in bronchial epithelium in relation to cigarette smoking, 1955–1960 vs. 1970–1977. N. Engl. J. Med. 300, 381–386. Aukrust, P., Mulle, F., Ueland, T., Svardal, A. M., Berge, R. K., and Froland, S. S. (2000). Decreased vitamin A levels in common variable immunodeficiency: Vitamin A supplementation in vivo enhances immunoglobulin production and downregulates inflammatory response. Eur. J. Clin. Invest. 30, 252–259. Back, E. I., Frindt, C., Ocenaskova´, E., Nohr, D., Stern, M., and Biesalski, H. K. (2005). Can changes in hydrophobicity increase the bioavailability of a-tocopherol? Eur. J. Nutr. 45, 1–6.

Nutritargeting

211

Barreto, M. L., Santos, L. M., Assis, A. M., Araujo, M. P., Farenzena, G. G., Santos, P. A., and Fiaccone, R. L. (1994). Effect of vitamin A supplementation on diarrhoea and acute lowerrespiratory-tract infections in young children in Brazil. Lancet 344, 228–231. Bartels, M., Biesalski, H. K., Engelhart, K., Sendlhofer, G., Rehak, P., and Nagel, E. (2004). Pilot study on the effect of parenteral vitamin E on ischemia and reperfusion induced liver injury: A double blind, randomized, placebo-controlled trial. Clin. Nutr. 23, 1360–1370. Bertram, J. F., and Rogers, A. W. (1981). Recovery of bronchial epithelium on stopping smoking. BMJ 283, 1567–1569. Bhandari, N., Bhan, M. K., and Sazawal, S. (1994). Impact of massive dose of vitamin A given to preschool children with acute diarrhea on subsequent respiratory and diarrhea morbidity. Br. Med. J. 309, 1404–1407. Biesalski, H. K. (1990). Quantitative and qualitative microdetermination of different fatty acid esters of retinol including their isomeric configurations in small tissue samples. Methods Enzymol. 189, 83–91. Biesalski, H. K. (1996). Effects of intratracheal application of vitamin A on concentrations of retinol derivates in plasma, lungs and selected tissue of rats. Int. J. Vitam. Nutr. Res. 66, 106–112. Biesalski, H. K., and Frank, J. (2002). Antioxidants in cancer therapy: Is there a rationale to recommend antioxidants during cancer therapy? In ‘‘Thiol Metabolism and Redox Regulation of Cellular Functions’’ (A. Pompella, G. Ba´nhegyi, and M. Wellman-Rousseau, eds.), NATO Science Series, Series I: Life and Behavioural Sciences. Vol. 347, pp. 252–264. IOS Press, The Netherlands. Biesalski, H. K., and Weiser, H. (1989). Sensitive analysis of retinyl esters by isocratic adsorption chromatography. J. Clin. Chem. Clin. Biochem. 27, 65–74. Biesalski, H. K., and Weiser, H. (1990). Microdetermination of retinyl esters in Guinea pig tissues under different vitamin A-status conditions. Micronutr. Anal. 7, 97–116. Biesalski, H. K., and Stofft, E. (1992). Biochemical, morphological, and functional aspects of systemic and local vitamin A deficiency in the respiratory tract. Ann. NY Acad. Sci. 669, 325–331. Biesalski, H. K., and Weiser, H. (1993). b-carotene supplements can not meet all vitamin A requirements of vitamin A-deficient rats. NY Acad. Sci. 691, 216–219. Biesalski, H. K., Wellner, U., Stofft, E., and Baessler, K. H. (1985). Vitamin A deficiency and sensory function. Acta Vitaminol. Enzymol. 7(Suppl.), 45–54. Biesalski, H. K., Wellner, U., and Weiser, H. (1990). Increased noise susceptibility during vitamin A deficiency in guinea pigs. J. Nutr. 120, 726–737. Biesalski, H. K., Reifen, R., Fu¨rst, P., and Edris, M. (1999). Retinyl palmitate supplementation by inhalation of an aerosol improves vitamin A status of preschool children in Gondar (Ethiopia). Br. J. Nutr. 82, 179–182. Biesalski, H. K., Sobeck, U., and Weiser, H. (2001). Topical application of vitamin A reverses metaplasia of rat vaginal epithelium. Eur. J. Med. Res. 6, 391–398. Bitzen, U., Winquist, M., Nilsson-Ehle, P., and Fex, G. (1994). Retinyl palmitate is a reproducible marker for chylomicron elimination from blood. Scand. J. Clin. Lab. Invest. 54, 611–613. Blaner, W. S. (1989). Retinol-binding protein: The serum transport protein for vitamin. Endocrinol. Rev. 10, 308–316. Bloem, M. W., Wedel, M., and Egger, R. J. (1990). Mild vitamin A deficiency and risk of respiratory tract diseases and diarrhea in preschool and school children in north-eastern Thailand. Am. J. Epidemiol. 131, 332–339. Boers, J. E., Ten Velde, G. P. M., and Thunnissen, F. B. J. M. (1996). P53 in squamous metaplasia: A marker for risk of respiratory tract carcinoma. Am. J. Respir. Crit. Care Med. 153, 411–416.

212

Hans Konrad Biesalski and Jana Tinz*

¨ ber die lokale Wirkung von Vitamin A an der Breuninger, H., and Kahn, A. N. (1960). U Nasenschleimhaut. HNO-Wegweiser fu¨r die Facha¨rztliche Praxis 8, 280–282. Chopra, D. P., and Joiakim, A. P. (1991). Differences in lectin binding in squamous metaplasia induced by benzo(a)pyrene and vitamin A deficiency in hamster tracheal explants. In Vitro Cell Dev. Boil. 27, 223–228. Chytil, F. (1985). Function of vitamin A in the respiratory tract. Acta Vitaminol. Enzymol. 76, 27–31. Chytil, F. (1992). The lungs and vitamin A. Am. J. Physiol. Lung Cell Mol. Physiol. 262, L517–L527. Denning, M. F., and Verma, A. K. (1994). The mechanism of the inhibition of squamous differentiation of rat tracheal 2C5 cells by retinoic acid. Carcinogenesis 15, 503–507. Deshpande, A. A., Tabatabay, C., Hughes, P. M., and Gurny, R. (1997). Therapeutic applications of retinoids in ophthalmology [Review]. Int. J. Pharm. 157, 1–15. Donelly, B. I. (1996). Vitamin A and respiratory syncytial virus infection. Arch. Pediatr. Adolesc. Med. 150, 882–892. Duncan, R. B., and Briggs, M. (1962). Treatment of uncomplicated anosmia by vitamin A. Arch. Otolaryngol. 75, 36–44. Edes, T. E., Gysbers, D. G., Buckley, C. S., and Thornton, W. H., Jr. (1991). Exposure to the carcinogen benzopyrene depletes tissue vitamin A: Beta-carotene prevents depletion. Nutr. Cancer 15, 159–166. Engelhart, K., Jentzsch, A. M., Fu¨rst, P., and Biesalski, H. K. (1998). Short-term parenteral application of a-tocopherol leads to increased concentration in plasma and tissues of the rat. Free Rad. Res. 29, 421–426. Epstein, J. B., and Gorsky, M. (1999). Topical application of vitamin A to oral leukoplakia: A clinical case series. Cancer 86, 921–927. Erhardt, J. G., Mack, H., Sobeck, U., and Biesalski, H. K. (2002). b-Carotene and a-tocopherol concentration and antioxidant status in buccal mucosal cells and plasma after oral supplementation. Br. J. Nutr. 87, 471–475. Filteau, S. M., Morris, S. S., Abbott, R. A., Tomkins, A. M., Kirkwood, B. R., Arthur, P., Ross, D. A., Gyapong, J. O., and Raynes, J. G. (1993). Influence of morbidity on serum retinol of children in a community-based study in northern Ghana. Am. J. Clin. Nutr. 58, 192–197. Finney, D. J. (1978). In ‘‘Statistical Methods in Biological Assay,’’ (C. Griffin & Co. LTD, ed.), London and High Wycombe. pp. 69–125. Fiorella, P. D., Olson, J. R., and Napoli, J. L. (1995). 2,3,7,8-tetrachlorodibenzo-p-dioxin induces diverse retinoic acid metabolites in multiple tissues of the Sprague-Dawley rat. Toxicol. Appl. Pharmacol. 134, 222–228. Gerlach, T., Biesalski, H. K., Weiser, H., Haeussermann, B., and Baessler, K. H. (1989). Vitamin A in parenteral nutrition: Uptake and distribution of retinyl esters after intravenous application. Am. J. Clin. Nutr. 50, 1029–1038. Gonza´les, J. R., Hermann, J. M., Boedeker, R. H., Francz, P. I., Biesalski, H. K., and Meyle, J. (2001). Concentration of interleukin-1b and neutrophil elastase activity in gingival crevicular fluid during experimental gingivitis. J. Clin. Periodontol. 28, 544–549. Goodman, G. E., Thornquist, M. D., Balmes, J., Cullen, M. R., Meyskens, F. L., Jr., Omenn, G. S., Valanis, B., and Williams, J. H., Jr. (2004). The beta-carotene and retinol efficacy trial: Incidence of lung cancer and cardiovascular disease mortality during 6-year follow-up after stopping beta-carotene and retinol supplements. J. Natl. Cancer Inst. 96, 1743–1750. Gouveia, J., Mathe´, G., Hercend, T., Gros, F., Lemaigre, G., Santelli, G., Homasson, J. P., Gaillard, J. P., Angebault, M., Bonniot, J. P., Lededente, A., Marsac, J., et al. (1982). Degree of bronchial metaplasia in heavy smokers and its regression after treatment with a retinoid. Lancet 1, 710–712.

Nutritargeting

213

Guzman, K., Gray, T. E., Yoon, J. H., and Nettesheim, P. (1996). Quantitation of mucin RNA by PCR reveals induction of both MUC2 and MUC5AC mRNA levels by retinoids. Am. J. Physiol. 271, 1023–1028. Greenberg, B. L., Semba, R. D., Vink, P. E., Farley, J. J., Sivapalasingam, M., Steketee, R. W., Thea, D. M., and Schoenbaum, E. E. (1997). Vitamin A deficiency and maternal-infant transmission of HIV in two metropolitan areas in the United States. AIDS 11, 325–332. Hanberg, A., Nilsson, C. B., Trossvik, C., and Hakansson, H. (1998). Effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin on the lymphatic absorption of a single oral dose of [3H]retinol and on the intestinal retinol esterification in the rat. J. Toxicol. Environ. Health A 55, 331–344. Hakansson, H., and Ahlborg, U. G. (1985). The effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on the uptake, distribution and excretion of a single oral dose of [11, 12–3H] retinyl acetate and on the vitamin A status in the rat. J. Nutr. 115, 759–771. Ha¨ussinger, K., Stanzel, F., and Huber, R. M. (1999). Autofluorescence detection of bronchial tumors with D-light/AF. Diag. Ther. Endosc. 5, 105–112. Ha¨ussinger, K., Picheler, J., Stanzel, F., Markus, A., Stepp, H., Morresi-Hauff, A., and Baumgartner, R. (2000). Autofluorescence bronchoscopy: The D-light system. Prog. Respir. Res. 30, 243–252. Hinds, T. S., West, W. L., and Knight, E. M. (1997). Carotenoids and retinoids: A review of research, clinical, and public health applications. J. Clin. Pharmacol. 37, 551–558. Humphrey, J. H., Agoestina, T., Wu, L., Usman, A., Nurachim, M., Subardja, D., Hidayat, S., Tielsch, J., West, K. P., and Sommer, A. (1996). Impact of neonatal vitamin A supplementation on infant morbidity and mortality. J. Pediatr. 128, 489–496. Inayama, Y., Kitamura, H., Shibagaki, T., Usuda, Y., Ito, T., Nakatani, Y., and Kanisawa, M. (1996). In vivo growth and differentiation potential of tracheal basal cells of rabbits in vitamin A deficiency. Int. J. Exp. Pathol. 77, 89–97. Italian Collaborative Groupon Preterm Delivery (ICGPD). (1993). Supplementation and plasma levels of vitamin A premature newborns at risk for chronic lung disease. Dev. Pharmacol. Ther. 20, 144–151. Jetten, A. M., and Smits, H. (1985). Regulation of differentiation of tracheal epithelial cells by retinoids. Ciba Found. Symp. 113, 61–76. John, G. C., Nduati, R. W., Mbori-Ngacha, D., Overbaugh, J., Welch, M., Richardson, B. A., Ndinya-Achola, J., Bwayo, J., Krieger, J., Onyango, F., and Kreiss, J. K. (1997). Genital shedding of human immunodeficiency virus type 1 DNA during pregnancy: Association with immunosuppression, abnormal cervical or vaginal discharge, and severe vitamin A deficiency. J. Infect. Dis. 175, 57–62. Kanda, Y., Yamamoto, N., and Yoshino, Y. (1990). Utilization of vitamin A in rats with inflammation. Biochim. Biophys. Acta 1034, 337–341. Kelley, S. K., Nilsson, C. B., Green, M. H., Green, J. B., and Hakansson, H. (1998). Use of model-based compartmental analysis to study effects of 2,3,7,8-tetrachlorodibenzo-pdioxin on vitamin A kinetics in rats. Toxicol. Sci. 44, 1–13. Kohlha¨ufl, M., Haussinger, K., Stanzel, F., Markus, A., Tritschler, J., Muhlhofer, A., MorresiHauf, A., Golly, I., Scheuch, G., Jany, B. H., and Biesalski, H. K. (2001). Inhalation of aerosolized vitamin A: Reversibility of metaplasia and dysplasia of human respiratory epithelia - a prospective pilot study. Eur. J. Med. Res. 7, 72–78. Kramer, I. (2005). ‘‘Nutritargeting. Development and Investigation of an Innovative Carrier System for the Targeted Delivery of Alpha-Tocopherol and Lutein in vitro’’. Dissertation Universita¨t Hohenheim, Shaker Verlag. Lam, S., Kennedy, T., and Unger, M. (1998). Localisation of bronchial intraepithelial neoplastic lesions by fluorescence bronchoscopy. Chest 13, 696–702.

214

Hans Konrad Biesalski and Jana Tinz*

Lasnitzki, I., and Bollag, W. (1982). Prevention and reversal by a retinoid of 3,4-benzpyrene and cigarette smoke condensate-induced hyperplasia of rodent respiratory epithelia in organ culture. Cancer Treat Rep. 66, 1375–1380. Lasnitzki, I., and Bollag, W. (1987). Prevention and reversal by non-polar carotenoid (Ro 150778) of 3,4-benzpyrene and cigarette smoke condensate-induced hyperplasia of rodent respiratory epithelia grown in vitro. Eur. J. Cancer Clin. Oncol. 23, 861–865. Lee, J. S., Lippman, M., Benner, S. E., Lee, J., Ro, J. Y., Lukeman, J. M., Morice, R. C., Peters, E. J., Pang, A. C., Fritsche, H. A., and Hong, W. K. (1994). Randomized placebo-controlled trial of isoretinoin in chemoprevention of bronchial squamous metaplasia. J. Clin. Oncol. 12, 937–945. Lewis, D. W. (1973). Vitamin A, occurrence and distribution in fractionated mucus. Lipids 8, 321–323. Li, Y., Dawson, M. I., Agadir, A., Lee, M. O., Jong, L., Hobbs, P. D., and Zhang, X. K. (1998). Regulation of RARb expression by RAR- and RXR-selective retinoids in human lung cancer cell lines: Effect on growth inhibition and apoptosis induction. Int. J. Cancer 75, 88–95. Massaro, G. D., and Massaro, D. (1997). Retinoic acid treatment abrogates elastase-induced pulmonary emphysema in rats. Nat. Med. 3, 675–677. Mathe´, G., Gouveia, J., Hercend, T., Gros, F., Dorval, T., Hazon, J., Misset, J. L., Schwarzenberg, L., Ribaud, P., Lemaire, G., Santinelli, G., Homasson, J. P., et al. (1983). Detection of precancerous bronchus metaplasia in heavy smokers and its regression following retinoid treatment. In ‘‘Modulation and Mediation of Cancer by Vitamins’’ (F. L. Meyskens and K. N. Prasad, eds.), pp. 317–321. Karger, Basel. McCullough, F. S. W., Northrop-Clewes, C. A., and Thurnham, D. (1999). The effect of vitamin A on epithelial integrity. Proc. Nutr. Soc. 58, 289–293. McDowell, E., Becci, P. J., Barett, L. A., and Trump, B. F. (1978). Lung biology in health and disease. In ‘‘Pathogenesis and Therapy of Lung Cancer’’ (C. C. Harris, ed.), Vol. 10, p. 461. Marcel Dekker, New York. McDowell, E. M., Keenan, K. P., and Huang, M. (1984a). Effects of vitamin A-deprivation on hamster tracheal epithelium. A quantitative morphologic study. Virchows Arch. B Cell Pathol. Incl. Mol. Pathol. 45, 197–219. McDowell, E. M., Keenan, K. P., and Huang, M. (1984b). Restoration of mucociliary tracheal epithelium following deprivation of vitamin A. A quantitative morphologic study. Virchows Arch. B Cell Pathol. Incl. Mol. Pathol. 45, 221–240. McDowell, E. M., Ben, T., Coleman, B., Chang, S., Newkirk, C., and De Luca, L. M. (1987a). Effects of retinoic acid on the growth and morphology of hamster tracheal epithelial cells in primary culture. Virchows Arch. B Cell Pathol. Incl. Mol. Pathol. 54, 38–51. McDowell, E. M., Ben, T., Newkirk, C., Chang, S., and De Luca, M. (1987b). Differentiation of tracheal mucociliary epithelium in primary cell culture recapsulates normal fetal development and regeneration following injury in hamsters. Am. J. Pathol. 129, 511–522. McGowan, S. E., Doro, M. M., and Jackson, S. (1997). Endogenous retinoids increase perinatal elastin gene expression in rat lung fibroblasts and fetal explants. Am. J. Physiol. 273, L410–L416. Melvyn, S. M., Tockman, M. D., and Anthonisen, N. (1987). Airways obstruction and the risk of lung cancer. Ann. Int. Med. 106, 512–518. Morabia, A., Sorenson, A., Kumanyika, H., Abbey, H., Cohen, B. H., and Chee, E. (1989). Vitamin A, cigarette smoking, and airway obstruction. Am. Rev. Respir. Dis. 140, 1312–1316. Mupanemunda, R. H., Lee, D. S. C., Fraher, L. J., Koura, I. R., and Chance, G. W. (1994). Postnatal changes in serum retinol status in very low birth weight infants. Early Hum. Dev. 38, 45–54. Napoli, J. (1996). Retinoic acid biosynthesis and metabolism. FASEB J. 10, 993–1001.

Nutritargeting

215

Nerurkar, M. M., Burton, P. S., and Borchardt, R. T. (1996). The use of surfactants to enhance the permeability of peptides through Caco-2 cells by inhibition of an apically polarized efflux system. Pharm. Res. 13, 528–534. Nettesheim, P., and Griesemer, R. A. (1978). Experimental models for studies of respiratory tract carcinogenesis. In ‘‘Pathogenesis and Therapy of Lung Cancer’’ (C. C. Harris, ed.). Marcel Dekker Inc., New York. Neuzil, K. M., Gruber, W. C., Chytil, F., Stahlman, M. T., Engelhardt, B., and Graham, B. S. (1994). Serum vitamin A levels in respiratory syncytial virus infection. J. Pediatr. 124, 433–436. Nilsson, C. B., Hoegberg, P., Trossvik, C., Azais-Braesco, V., Blaner, W. S., Fex, G., Harrison, E. H., Nau, H., Schmidt, C. K., van Bennekum, A. M., and Hakansson, H. (2000). 2,3,7,8-tetrachlorodibenzo-p-dioxin increases serum and kidney retinoic acid levels and kidney retinol esterification in the rat. Toxicol. Appl. Pharmacol. 169, 121–131. Pearson, E., Bose, C., Snidow, T., Ransom, L., Young, T., Bose, G., and Stiles, A. (1992). Trial of vitamin A supplementation in very low birth weight infants at risk for bronchopulmonary dysplasia. J. Pediatr. 121, 420–427. Phillips, R. W., Kikendall, J. W., Luk, G. D., Willis, S. M., Murphy, J. R., Maydonovitch, C., Bowen, P. E., Stacewicz-Sapuntzakis, M., and Wong, R. K. (1993). Beta-carotene inhibits rectal mucosal ornithine decarboxylase activity in colon cancer patients. Cancer Res. 53, 3723–3725. Ponnamperuma, R. M., Kirchhof, S. M., Trifiletti, L., and De Luca, L. M. (1999). Ovariectomy increases squamous metaplasia of uterine horns and survival SENCAR mice fed a vitamin A-deficient diet. Am. J. Clin. Nutr. 70, 502–508. Ponticello, A., Barra, E., Giani, U., Bocchino, M., and Sanduzzi, A. (2000). p53 immunohistochemistry can identify bronchial dysplastic lesions proceeding to lung cancer: A prospective study. Eur. Respir. J. 15, 547–552. Quadro, L., Gamble, M. V., Vogel, S., Lima, A. A., Piantedosi, R., Moore, S. R., Colantuoni, V., Gottesman, M. E., Guerrant, R. L., and Blazer, W. S. (2000). Retinol and retinol-binding protein: Gut integrity and circulating immunoglobulins. J. Infect. Dis. 1, 97–102. Rahman, M. M., Mahalanabis, D., Alvarez, J. O., Wahed, M. A., Islam, M. A., Habte, D., and Khaled, M. A. (1996). Acute respiratory infections prevent improvement of vitamin A status in young infants supplemented with vitamin A. J. Nutr. 126, 628–633. Ramakrishnan, U., Latham, M. C., Abel, R., and Frongillo, E. A., Jr. (1995a). Vitamin A supplementation and morbidity among preschool children in South India. Am. J. Clin. Nutr. 61, 1295–1303. Ramakrishnan, U., Latham, M. C., and Abel, R. (1995b). Vitamin A supplementation does not improve growth of preschool children; A randomized, double-blind field trial in South India. J. Nutr. 125, 202–211. Rahmathullah, L., Underwood, B. A., Thulasiraj, R. D., and Milton, R. C. (1991). Diarrhea, respiratory infections and growth are not affected by a weekly low-dose vitamin A supplement: A masked, controlled field trial in children in Southern India. Am. J. Clin. Nutr. 54, 568–577. Rutten, A. A., Wilmer, J. W., and Beems, R. B. (1988a). Effects of all-trans retinol and cigarette smoke condensate on hamster tracheal epithelium in organ culture. I. A cell proliferation study. Virchows Arch. B Cell Pathol. Incl. Mol. Pathol. 55, 167–175. Rutten, A. A., Beems, R. B., and Wilmer, J. W. (1988b). Effects of all-trans retinol and cigarette smoke condensate on hamster tracheal epithelium in organ culture. II. A histomorphological study. Virchows Arch. B Cell Pathol. Incl. Mol. Pathol. 55, 177–186. Saccomano, G., Archer, V. E., Auerbach, O., Saunders, R. P., and Brennan, L. M. (1974). Development of carcinoma of the lung as reflected in exfoliated cells. Cancer 33, 256–270.

216

Hans Konrad Biesalski and Jana Tinz*

Schulz, C., Engel, U., Kreienberg, R., and Biesalski, H. K. (2007). Vitamin A and beta-carotene supply of women with gemini or short birth intervals: A pilot study. Eur. J. Nutr. 46, 12–20. Schulz, C., Obermu¨ller-Jevic, U. C., Hasselwander, O., Bernhardt, J., and Biesalski, H. K. (2006). Comparison of the relative bioavailability of different coenzyme Q10 formulations with a novel solubilizate (Solutrade mark Q10). Int. J. Food Sci. Nutr. 57, 46–55. Seeballuck, F., Lawless, E., Ashford, M. B., and O’Driscoll, C. M. (2004). Stimulation of triglyceride-rich lipoprotein secretion by polysorbate 80: In vitro and in vivo correlation using Caco-2 cells and a cannulated rat intestinal lymphatic model. Pharm. Res. 21, 2320–2326. Semba, R. D. (1998). The role of vitamin A and related retinoids in immune function. Nutr. Rev. 56, 38–48. Shah, R. S., and Rajalekshmi, R. (1984). Vitamin A status of the newborn in relation to gestational age, body weight, and maternal nutritional status. Am. J. Clin. Nutr. 40, 794–800. Shensi, J. P., Chytil, F., and Stahlman, M. T. (1985). Liver vitamin A reserves of very low birth weight neonates. Pediatr. Res. 19, 892–893. Simm, K. (1980). Klinische Erprobung von Coldastop bei Rhinitis sicca, Nasentropenabusus und postoperativen pathologischen Heilungsverla¨ufen. Therapie Woche 30, 8002–8003. Skillud, D. M., Offord, K. P., and Miller, R. D. (1987). Higher risk of lung cancer in chronic obstructive pulmonary disease. A prospective matched controlled study. Ann. Int. Med. 105, 503–507. Sobeck, U., Fischer, A., and Biesalski, H. K. (2002). Determination of vitamin A palmitate in buccal mucosal cells: A pilot study. Eur. J. Med. Res. 7, 287–289. Sobeck, U., Fischer, A., and Biesalski, H. K. (2003). Uptake of vitamin A in buccal mucosal cells after topical application of retinyl palmitate: A randomised, placebo-controlled and double-blind trial. Br. J. Nutr. 90, 69–74. Sommer, A. (1993). Vitamin A supplementation and childhood morbidity. Lancet 342, 1420–1424. Sommer, A., Katz, J., and Tarwatjo, I. (1984). Increased risk of respiratory disease and diarrhea in children with preexisting mild vitamin A deficiency. Am. J. Nutr. 40, 1090–1095. Sommer, A., Rarwotjo, I., and Katz, J. (1986). Increased risk of xerophthalmia following diarrhea and respiratory disease. Am. J. Clin. Nutr. 45, 977–980. Sporn, M. B., Dunlop, N. M., Newton, D. L., and Smith, J. M. (1976). Prevention of chemical carcinogenesis by vitamin A and its synthetic analogs (retinoids). Fed. Proc. 35, 1332–1338. Stahlman, M. T. (1984). Chronic lung disease following hyaline membrane disease. In ‘‘Neonatal Medicine’’ (L. Stern and P. Vert, eds.), pp. 454–473. Masson, New York. Stephensen, C. B., Alvarez, J. O., Kohatsu, J., Hardmeier, R., Kennedy, J. I., and Gammon, R. B., Jr. (1994). Vitamin A is excreted in the urine during acute infection. Am. J. Clin. Nutr. 60, 388–392. Stofft, E., Biesalski, H. K., Zschaebitz, A., and Weiser, H. (1992a). Morphological changes in the tracheal epithelium of guinea pigs in conditions of ‘‘marginal’’ vitamin A deficiency. A light, scanning- and transmission-electron microscopic study under special breeding conditions appropriate to early vitamin A deficiency. Int. J. Vitam. Nutr. Res. 62, 134–142. Stofft, E., Biesalski, H. K., Niederauer, U., Zscha¨bitz, A., and Weiser, H. (1992b). Morphological changes in the tracheal epithelium of guinea pigs in conditions of ‘‘acute’’ vitamin A deficiency. Int. J. Vitam. Nutr. 62, 143–147. Thunberg, T., and Ha˚kansson, H. (1983). Vitamin A (retinol) status in the Gunn rat. The effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin. Arch. Toxicol. 53, 225–233.

Nutritargeting

217

Thunberg, T., Ahlborg, U. G., Hakansson, H., Krantz, C., and Monier, M. (1980). Effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin on the hepatic storage of retinol in rats with different dietary supplies of vitamin A (retinol). Arch. Toxicol. 45, 273–285. Traber, M. G., Kayden, H. J., Green, J. B., and Green, M. H. (1986). Absorption of watermiscible forms of vitamin E in a patient with cholestasis and in thoracic duct-cannulated rats. Am. J. Clin. Nutr. 44, 914–923. Traber, M. G., Schiano, T. D., Steephen, A. C., Kayden, H. J., and Shike, M. (1994). Efficacy of water-soluble vitamin E in the treatment of vitamin E malabsorption in short-bowel syndrome. Am. J. Clin. Nutr. 59, 1270–1274. Van der Waerden, B. L., and Nievergelt, E. (1956). ‘‘Tafeln zum Vergleich zweier Stichproben mittels -Test und Zeichentest’’. Berlin-Go¨ttingen-Heidelberg, Springer-Verlag. Wang, X. D., Liu, C., Bronson, R. T., Smith, D. E., Krinsky, N. I., and Russell, R. M. (1999). Retinoid signaling and activator protein-1 expression in ferrets given b-carotene supplements and exposed to tobacco smoke. J. Natl. Cancer Inst. 91, 60–66. Willett, W. C., Stampfer, M. J., Underwood, B. A., Sampson, L. A., Hennekens, C. H., Wallingford, J. C., Cooper, L., Hsieh, C. C., and Speizer, F. E. (1984). Vitamin A supplementation and plasma retinol levels: A randomized trial among women. J. Natl. Cancer Inst. 73, 1445–1448. World Health Organization (1984). Prevention and control of vitamin A deficiency and Xerophthalmia. WHO 37th World Health Assembly, agenda item 20.A37/A. Conference paper No. 6. World Health Organization (1992). National strategies for overcoming micronutrient malnutrition. WHO 45th World Health Assembly, provisional agenda item 21.A45/17. Younes, R. N., Gross, J. L., and Dehienzelin, D. (1999). Follow-up in lung cancer. Chest 115, 1494–1499. Zachman, R. D. (1989). Retinol (vitamin A) and the neonate: Special problems of the human premature infant. Am. J. Clin. Nutr. 50, 413–424.

This page intentionally left blank

CHAPTER

6 The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science Susan Reinwald,* Connie M. Weaver,* and Jeffrey J. Kester†

Contents

I. Why Focus on Calcium Citrate Malate? II. Ca Needs and Current Intakes A. The role of Ca in the body B. General Ca requirements C. Specific Ca needs D. Current intakes E. Implications III. Description and Properties of CCM A. Chemical formula of CCM and its component anions B. Ca content C. How CCM is made D. Aqueous solubility E. CCM in fortified foods and beverages F. CCM in dietary supplements IV. Studies of Ca Bioavailability from CCM A. Ca absorption B. Factors that influence Ca absorption C. How CCM fits with the influencing factors — human studies with CCM D. Animal studies with CCM

221 222 222 223 224 226 231 232 232 232 234 235 237 242 244 244 256 257 269

* Department of Foods and Nutrition, Purdue University, West Lafayette, Indiana 47907 {

Coffee & Snacks Technology Division, The Procter & Gamble Company, Miami Valley Innovation Center, Cincinnati, Ohio 45252

Advances in Food and Nutrition Research, Volume 54 ISSN 1043-4526, DOI: 10.1016/S1043-4526(07)00006-X

#

2008 Elsevier Inc. All rights reserved.

219

220

Susan Reinwald et al.

V. Studies of Ca Retention and Bone Building in Children and Adolescents A. Ca balance studies B. Bone density studies (2–3 years) C. Long-term bone density studies (4–7 years) VI. Studies of Bone Maintenance in Adults A. Studies in postmenopausal women B. Studies in elderly men and women — including effects on fracture risk and risk of falls VII. Other Health Benefits A. Oral health B. Blood pressure reduction C. No increase in the risk of kidney stones D. No effect on the status of other minerals (Fe, Zn, Se, and Mg) E. Effect on serum lipids F. Colon health VIII. Limitations of CCM IX. Conclusion References

Abstract

276 278 280 283 289 290 294 298 298 304 306 308 319 321 323 324 328

There has been considerable investigation into the health benefits of calcium citrate malate (CCM) since it was first patented in the late 1980s. This chapter is a comprehensive summary of the supporting science and available evidence on the bioavailability and health benefits of consuming CCM. It highlights the important roles that CCM can play during various life stages. CCM has been shown to facilitate calcium retention and bone accrual in children and adolescents. In adults, it effectively promotes the consolidation and maintenance of bone mass. In conjunction with vitamin D, CCM also decreases bone fracture risk in the elderly, slows the rate of bone loss in old age, and is of benefit to the health and well-being of postmenopausal women. CCM is exceptional in that it confers many unique benefits that go beyond bone health. Unlike other calcium sources that necessitate supplementation be in conjunction with a meal to ensure an appreciable benefit is derived, CCM can be consumed with or without food and delivers a significant nutritional benefit to individuals of all ages. The chemistry of CCM makes it a particularly beneficial calcium source for individuals with hypochlorydia or achlorydia, which generally includes the elderly and those on medications that decrease gastric acid secretion. CCM is also recognized as a calcium source that does not increase the risk of kidney stones, and in fact it protects against stone-forming potential. The versatile nature of CCM makes it a convenient and practical calcium salt for use in moist foods and beverages. The major factor that may preclude selection of CCM as

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

221

a preferred calcium source is the higher cost compared to other sources of calcium commonly used for fortification (e.g., calcium carbonate and tricalcium phosphate). However, formation of CCM directly within beverages or other fluid foods and/or preparations, and the addition of a concentrated CCM solution or slurry, are relatively cost-effective methods by which CCM can be incorporated into finished food and beverage products.

I. WHY FOCUS ON CALCIUM CITRATE MALATE? Regular ingestion of adequate calcium (Ca), particularly by way of consumption of foods naturally high in Ca, requires a deliberate approach to balanced nutrition for a large number of individuals. Everyday exposure to an increasingly wide variety of appealing food and beverage choices can divert the emphasis and preference away from inherently Ca-rich foods that all too often are largely underconsumed by those most in need of them. Under certain circumstances, such as lactose intolerance, allergies, strict vegetarianism, and personal dislikes, dairy foods are not even considered as a viable option or are consumed in insufficient quantity to meet Ca requirements by many subgroups. In situations such as these, Ca supplementation and/or fortification of regularly consumed foods and beverages is an ideal adjunctive approach, conferring benefits to those both interested in reducing the risk for chronic disease and seeking to promote optimal health. Although there are often claims to the contrary, different Ca salts are not, in effect, bioequivalent. While a number of commonly used Ca salts are currently available in the market place, each one is distinct in terms of its chemical composition, the functional and aesthetic properties it imparts to various food matrices, and its efficacy when it comes to delivering health benefits. In many respects, the attributes of calcium citrate malate (CCM), a compound salt of citrate and malate, set it apart from other Ca salt preparations. Other Ca salts do not match CCM’s combination of qualities that include: comparatively high aqueous solubility, enhanced absorbability and bioavailability under a wide range of circumstances for all age groups, compositional flexibility (i.e., adjustable molar ratios and mineral content), convenient and practical compatibility with food systems, and an imperceptible presence as a fortificant in foods and beverages at concentrations that make a discernable contribution to health. The choice of a source of Ca is best made from an informed perspective. Recognizing that other Ca salts can also be effectively utilized as fortificants (Rafferty et al., 2007), there has been a wealth of investigation into the bioavailability and health benefits of CCM since it was first patented in the late 1980s. The purpose of this chapter is to present a comprehensive summary of the supporting science and available evidence on the bioavailability and health benefits of consuming CCM.

222

Susan Reinwald et al.

II. Ca NEEDS AND CURRENT INTAKES A. The role of Ca in the body Ca is a mineral essential to the optimal functioning of virtually every cell in the body. It is required by nonskeletal cells for functions such as muscle contraction, neurotransmission, signal transduction, enzyme secretion, vascular function, blood coagulation, and glandular secretion. There is
1 g of Ca in plasma and extracellular fluids (ECFs), 6–8 g is found in body tissues and within cells, and over 99% of total body Ca is found in bones and teeth, primarily in the form of hydroxyapatite Ca10(OH)(PO4)3 (Weaver and Heaney, 2006a). The main functional roles played by Ca in the skeleton can be summarized as structural and metabolic. Ca provides the mineral material that principally contributes to growth and development of a dynamic skeletal framework that facilitates stature, posture, is a lever system for locomotion, mechanical strength, provides protection for vital organs, and simultaneously serves as a labile reservoir to enable effective Ca homeostasis in the body. Ca normally circulates in the bloodstream, within a 2.25–2.50 mmol concentration range, bound to proteins (40–45%), complexed with ions (8– 10%), and ionized as Ca2þ (45–50%) (Weaver and Heaney, 2006a). Circulating Ca in excess of that required for maintenance of plasma levels is ideally transferred from the blood to be deposited in bone via the bone formation process. The Ca concentration outside of blood vessels in the ECF that bathes cells is tightly regulated close to 1.25 mmol (Weaver and Heaney, 2006a), almost to the point of invariance. It is this ECF Ca pool that cells are immediately reliant upon to sustain vital cellular functions that are imminently critical to the maintenance of life (e.g., cardiac muscle contraction). Circulating Ca is constantly utilized to replenish ECF pools, and when Ca derived from dietary intake is insufficient to replace the amount of Ca used for replenishment, Ca in bone is transferred to the blood via a bone resorption process. A regular adequate dietary intake of Ca is required to promote the maintenance of Ca balance in tissues and to attenuate undue resorption and subsequent bone loss that can lead to skeletal fragility and fractures. Bidirectional Ca fluxes between the blood and bone are mediated by parathyroid hormone (PTH) and vitamin D (1,25(OH)2 D3) (Awuney and Bukoski, 2006). Homeostatic regulation of Ca is via an orchestrated interplay among three main organs, the intestines, the kidney, and bones (Fleet, 2006). An increase in PTH from the parathyroid glands stimulates the mobilization of Ca from the skeleton via resorption by osteoclasts, increased renal production of the active form of vitamin D, and through stimulated tubular reabsorption of Ca within the kidneys. Vitamin D stimulates circulating Ca levels by way of increasing intestinal Ca

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

223

absorption and renal Ca reabsorption. Decreases in PTH and vitamin D essentially exert the reverse effects. Bone remodeling, characterized by a spatial and temporal coupling of bone resorptive activities at select loci with subsequent bone formation at the same location, is a natural ongoing process in the skeleton. It facilitates tissue renewal and organ adaptation to stimuli in healthy individuals. High remodeling rates (Dawson-Hughes, 2006a) and/or net remodeling imbalances, caused by bone resorptive activities habitually surpassing those of bone formation, result in bone loss from discrete remodeling packets on the surface of bone matrices. It is indicative of the homeostatic mechanism designed to compensate for hypocalcemia in the event of a plasma Ca insufficiency. Decreases in bone mass subtly but surely weaken the strength and structure of the skeleton over time. Bone fragility is a latent sign of a chronic Ca deficiency which, more often than not, develops imperceptibly in most individuals until it is professionally diagnosed. In the event of dietary Ca abundance, Ca in excess of adequate circulating concentrations is deposited in the skeleton. This occurs to the extent of the body’s ability to store Ca, and any excess beyond this threshold is excreted. Accrual of Ca into bone is governed by such factors as dietary intake (including the absorption, bioavailability, utilization of nutrients and minerals, and other dietary constituents that influence absorption or retention), calciotropic hormones, genetic potential, lifestyle factors, life stage, general health, and the adaptive response to physical/mechanical stimuli within the constraints of metabolic economy.

B. General Ca requirements Although Ca is required throughout the body to maintain health and reduce chronic disease risk, its retention in the skeleton is used as an indicator of adequate intake (AI) and bone health. Ca intakes that optimize bone health throughout the life span, by promoting attainment of peak bone mass during growth and protecting against subsequent bone loss and fragility, are also considered to provide a buttress against many other chronic disorders. Although the cause of conditions such as hypertension, hypercholesterolemia, colon cancer, premenstrual syndrome, tooth loss, and nephrolithiasis are multifactorial in nature, these disorders may progress without adequate Ca (Bryant et al., 1999). Bone mineral is
32% Ca. The more bone mass acquired during growth and maintained as we age, the larger is our reservoir of Ca for metabolic and structural needs. The amount of Ca required is varied across age groups and is dependent on the physiological and metabolic needs inherent during different developmental and maturational stages. These include, although are not limited to, periods of rapid growth and age-related changes in absorption and excretion (Bryant et al., 1999).

224

Susan Reinwald et al.

Recommended intakes of Ca vary widely in different countries around the world. This is because worldwide there are distinct regional food sources, different dietary intakes, as well as varying dietary practices, lifestyles, environmental factors, and unique genetic profiles due to ethnic variability. All of these factors can result in very different exposures and bioavailabilities when it comes to adequate nutrition. Recommended intakes for Ca (mg/day) in the United States rank among the highest in the world (Dawson-Hughes, 2006a) for all life stage categories — with the exception of infants and toddlers for which they are considerably lower in comparison with the broad ranges recommended by a number of other countries (Hicks and Abrams, 2006). AIs have been estimated by the Standing Committee on the Scientific Evaluation of Dietary Reference Intakes (DRI), the Food and Nutrition Board, and the Institute of Medicine (1997) and herein appear in categorized form in the first two columns on the left side of Table 6.1. The three columns on the right side provide data pertaining to actual Ca intakes reported in National Health and Nutrition Examination Survey (NHANES) conducted during the 1999–2000 period. While the age group categories for actual intakes do not exactly correspond with those defining the groups for AI, they overlap enough to allow one to gauge the general trends of current intakes by age and gender. Diet recall surveys and frequency questionnaires obviously have a number of inherent limitations in terms of supplying exact data on actual intakes; however, they usually provide valuable general information that can be compared against established AIs to determine specific groups at risk, potential health problems if trends persist, and the general level of success pertaining to health interventions.

C. Specific Ca needs 1. Infants To meet rapid developmental and growth needs during infancy, Ca requirements and Ca absorption are inherently high (Matkovic, 1991). Based on a stable isotope method, mean (SD) Ca absorption has been observed to be as high as 76.8  14.7% for infants (n ¼ 18) fed human breast milk and slightly less for those (n ¼ 10) fed formula milks 61.6  14.4% (Hicks and Abrams, 2006). For infants of both sexes born at term, breast milk is the preferred source of nutrition for at least the first 6 months of life. It provides
264 mg Ca/liter or
210 mg (5.3 mmol) Ca/day based on an average intake of
780 ml breast milk/day (Standing Committee of the Scientific Evaluation of Dietary Reference Intakes, Food and Nutrition Board, and Institute of Medicine, 1997). Exclusively breastfed infants are considered to receive ideal nutrition to support optimal growth and rapid development for the first 6 months after birth.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

225

TABLE 6.1 Current dietary reference intake (DRI) established for Ca intake by gender and age group juxtaposed against estimated intakes Recommended AIsa Sex and age group

Infants (month) (, & <) 0–6 (, & <) 7–12 Children (year) (, & <) 1–3 (, & <) 4–8 Females (year) 9–13 *14–18 *19–30 *31–50 51–70 >70 Males (year) 9–13 14–18 19–30 31–50 51–70 >70

Target intake Ca (mg/d)

Data on U.S. Ca intakes (1999–2000)b Sex and age groupc

Mean intake Ca (mg/d)

Median intake Ca (mg/d)

210 270

500 800

1300 1300 1000 1000 1200 1200

1300 1300 1000 1000 1200 1200

Children (year) Girls < 6 Boys < 6 Females (year) 6–11 12–19 20–39 40–59 60 Males (year) 6–11 12–19 20–39 40–59 60

785 916

708 809

860 793 797 744 660

812 661 684 621 563

915 1081 1025 969 797

843 956 856 834 716

a

Ca requirements in the United States are currently set as AIs. The recommended AI for Ca is an approximated value estimated to cover the needs of all healthy individuals in the age group based on experimental or observational data that show a mean intake which appears to sustain a desired indicator of health (e.g., desirable Ca retention); however, lack of sufficient evidence precludes specifying with confidence the percentage of individuals covered by this intake (Standing Committee of the Scientific Evaluation of Dietary Reference Intakes, Food and Nutrition Board, and Institute of Medicine, 1997). b Estimated from one 24-h dietary recall conducted in the National Health and Nutrition Examination Survey (NHANES, 1999–2000). Data are based on a total of n ¼ 8640 individuals (variously spread across gender and age groups) deemed to have complete and reliable recall to include in the analyses (Wright et al., 2003). c Age categories are those recommended in NHANES. * Pregnancy or lactation does not change the AIs for these age groups.

While one group of investigators observed a positive transient effect of a Ca intake that was in excess of the amount intrinsic to breast milk in infants under 6 months of age (Specker et al., 1997), the improvement in

226

Susan Reinwald et al.

bone mineral accretion for the formula-fed infants cannot be categorically attributed to the additional Ca. The moderate-mineral infant formula that contained 510 mg Ca/liter would have to have been deemed comparable in terms of nutritional bioavailability, and comprise a nutritional profile that replicates the composition of human milk for all components except the Ca content. Currently there are no convincing data to suggest Ca intake, beyond what is biologically available from breast milk, provides any additional short- or long-term benefit(s) to bone health (Abrams, 2006; Greer et al., 2006). The concentration of Ca in breast milk appears to be controlled by a mechanism independent of Ca intake. A randomized, double-blind, placebo-controlled trial showed that Gambian women, with chronically low daily Ca intakes (300–400 mg), do not significantly increase the Ca concentration of their milk during lactation when supplemented with an adequate Ca intake by today’s standards (i.e., 1500 mg/day) ( Jarjou et al., 2006). In fact, maternal supplementation yielded no direct effect on infant birth weight, growth, or bone mineral status during the first year of life. During lactation, physiological mechanisms are suspected to operate to ensure sufficient Ca for breast milk production to meet an infant’s natural needs (Prentice et al., 1995). Nevertheless, recommended intakes for early infants in Australia, Belgium, and Ireland are currently as high as 330, 400, and 800 mg Ca/day, respectively (Looker, 2006). It is conceivable that some compensation might be made to adjust for less-efficient absorption of Ca from formula milk, low mineral reserves attributable to a very low birth weight or infant prematurity, or other special circumstances; however, because Ca is considered to be a ‘‘threshold nutrient,’’ whereby intakes in excess of an adequate level do not generally provide an added benefit, the rationale for such high intakes in infants remains uncertain.

D. Current intakes Infant Ca requirements increase slightly from 7 to 12 months of age as body size increases. Breast milk, in combination with the introduction of some solid foods containing Ca, is estimated to provide enough Ca nourishment to sustain normal growth and development. Countries such as Australia, Belgium, and Ireland (with recommended Ca intakes for infants of 550, 600, and 800 mg Ca/day, respectively) exceed the U.S. recommended AI at 270 mg (6.8 mmol) Ca/day for this age group by as much as 49–337%. These recommendations are for higher amounts of Ca than most infants would receive through breast milk. Up until the age of 1 year, the long-term effect(s) of Ca intake levels that greatly exceed those of breast milk remains uncertain. However, infants fed formula may require a higher Ca intake due to reduced absorptive potential from formula milks, although slightly higher Ca retention from alternate sources to

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

227

breast milk are reported to compensate for absorption differences (Standing Committee of the Scientific Evaluation of Dietary Reference Intakes, Food and Nutrition Board, and Institute of Medicine, 1997). Statistically adjusted data (Nusser et al., 1996) reflecting how well intakes of Ca were met by infants during 1994–1996 was supplied by the US Department of Agriculture (USDA) Continuing Survey of Food Intakes by Individuals (CSFII) (Standing Committee of the Scientific Evaluation of Dietary Reference Intakes, Food and Nutrition Board, and Institute of Medicine, 1997), which indicated median intakes of 457 and 703 mg Ca/day for 0- to 6-month- and 7- to 12-month-old infants, respectively.

1. Children As is the case for infant groups, gender differences are not a major factor influencing Ca requirements for the 1- to 3-year toddler age group or the 4- to 8-year children’s age group. Requirements continue to increase from infancy to the onset of puberty due to continued growth and development. In general, from infancy through childhood Ca needs appear to be approximately matched by AIs based on the 1999–2000 Survey data (Wright et al., 2003) and other data (Storey et al., 2004). Currently, the evidence that prepubertal Ca supplementation with >800 mg/day is of added benefit is largely inconclusive in terms of its meaningful biological significance and long-term influence (Iuliano-Burns et al., 2006). Childhood is an important developmental period in which good dietary habits ought to be established in preparation for the onset of puberty when the Ca accretion rate begins to markedly increase in response to increased needs. Unfortunately, the general trend is for dietary Ca intakes to decline as children get older (Johnson, 2000), with girls generally consuming less Ca than boys (Fioritto et al., 2006; Nicklas, 2003).

2. Preadolescence and adolescence During adolescence, gender differences in physical development, according to the Tanner scale and Ca needs, emerge. This is due to the timing of the growth spurt during which peak height velocity in girls occurs earlier in Tanner staging (and chronologically) than in boys (i.e.,
11.5 vs
13.5 years, respectively). Ca accretion rate rapidly peaks during early adolescence and up to 40% of total lifetime bone mass is accumulated by the end of this life stage (Greer et al., 2006). At the completion of growth, boys are generally taller and heavier than girls as a result of undergoing a longer prepubertal growth period, an increased peak height velocity during the growth spurt, and a longer adolescent growth spurt (Anonymous, 2005). Despite these differences, there are no gender-specific AIs for preadolescents (older children 9–13 years) or the adolescent age group (14–18 years). This situation arose as a result of a predominance of Ca studies in girls compared to boys, such that male data were lacking in order to make a case for separate

228

Susan Reinwald et al.

recommendations in these age groups. Therefore, 1300 mg (32.5 mmol) Ca/day was determined to be adequate for both sexes based on studies fitting with the indicated criteria (Weaver and Heaney, 2006b) (Table 6.2). Intakes in relation to requirements show that >50% of both females and males did not meet the Ca recommendations in preadolescent and adolescent age groups during the 1999–2000 period, with females consuming less Ca than males of the same age (Wright et al., 2003). The ability to respond to exceedingly low Ca intakes is limited and insufficient (Greer et al., 2006).

3. Adults A lack of regular physical activity, together with a habitually low Ca intake during adolescence, interferes with the attainment of one’s genetic potential for peak bone mass during the ages 19 through 30 years. TABLE 6.2 Criteria upon which Adequate Intake (AI) values were based for calcium by life stage groupsa Life stage groupb

Criterionc

Infants (month) 0–6 6–12

Human milk content Human milk þ solid food

Children (year) 1–3 4–8 9–13 14–18 Adults (year) 31–50 51–70 >70

a

Extrapolation of desirable calcium retention from 4 to 8 years Calcium accretion/DBMC/calcium balance Desirable calcium retention/factorial/DBMC Desirable calcium retention/factorial/DBMC Calcium balance Desirable calcium retention/factorial/DBMC Extrapolation of desirable calcium retention from 51 to 70 years/DBMD/fracture rate

Pregnancy (year) 18 19–50

Bone mineral mass Bone mineral mass

Lactation (year) 18 19–50

Bone mineral mass Bone mineral mass

Table adapted from information published previously (Weaver and Heaney, 2006b) All groups excluding pregnancy and lactation are males and females. Criteria are dependent on the data available in the literature. Desirable calcium retention ¼ the intake at which there is no net loss of calcium. DBMC ¼ change in bone mineral content. DBMD ¼ change in bone mineral density. Factorial ¼ calcium needs for growth þ calcium losses (urine, feces, sweat) adjusted for absorption. b c

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

229

By adulthood, one’s final statural height is established; however, gradual consolidation of bone mass is a protracted process that can continue to varying extents at different skeletal sites for up to
10 years. The 1000 mg Ca/day recommended AI (25 mmol) for this life stage applies to both men and women alike, although the data forming the basis for the recommendations was based predominantly on studies in women. NHANES 1999– 2000 findings reveal that women in this age range are, on average, only consuming
80% of the recommended Ca intake and, disturbingly, the median intake is
30% less than the AI. Based on average Ca intakes in the same period, men are consuming adequate levels of Ca; however, 50% are likely to be anywhere up to
150 mg/day under the AI recommendations.

4. Middle-aged adults Based on available Ca balance data, from 31 to 50 years of age a Ca intake of 1000 mg/day is considered to adequately equip both genders to maintain the bone mass attained during young adulthood to the extent that normal physiological processes during this life stage will allow. Age at onset of bone loss is not well defined and appears to vary across anatomical locations (Bainbridge et al., 2002); however, by
40 years of age general agerelated bone loss proceeds at the rate of
0.5% to 1.0% per year (Bryant et al., 1999). The latter half of this life stage (40–50 years) also coincides with the premenopausal period in women which is associated with a decline in fertility (The Practice Committee of the American Society for Reproductive Medicine, 2006), episodic fluctuations in hormone levels (Santoro et al., 1996), and a fall in Ca absorption (Wishart et al., 2000). There is an approximate 200–250 mg/day shortfall in the mean Ca intake of women included in this age group, and median intakes indicate 50% are only consuming just over half of the recommended adequate Ca intake. The average Ca intake of men approximately meets the Ca needs, although median intakes fall short of the AI by just over 100 mg Ca/day.

5. Older adults Men and women ages 51 through 70 years and beyond require a Ca intake of 1200 mg (30 mmol)/day for maximal Ca retention, which is usually negative during normal physiological functioning during this life stage as a result of the aging process. Averting the exacerbation of involutioninduced bone loss is therefore necessary, essentially as a damage control measure when Ca absorptive efficiency, food Ca utilization efficiency, and Ca retention decline during this period (Heaney, 2001a). Moreover, other factors including an overall decrease in physical activity and skeletal muscle mass and a reduction in cutaneous exposure to sunlight (vitamin D), due to more time spent being homebound, all contribute to predisposing

230

Susan Reinwald et al.

older adults to a lowered bone mass, bone microarchitectural deterioration, compromised bone strength, and increased fracture risk over time (Heaney, 2001a). Compared to the recommend AI in older adults, actual Ca intakes are abysmally low. While the recommended AI for those aged between 51 and 70 years and >70 years old increase by 200 mg above the 1000 mg Ca/day recommended for the prior two decades (31–50 years), actual intakes go in the opposite direction and decrease even further than those reported in the period spanning 40–59 years of age. Average Ca intakes for women more or less fitting into this older adult age group according to NHANES (1999–2000) are only
44–56% of the AI (Wright et al., 2003). Furthermore, median intakes show that 50% of women achieve approximately half of the AI for Ca. This is of particular concern during the years of transition to menopause and during early menopause. Natural dysregulation of a female’s hypothalamic-pituitarygonadal axis occurs at this time resulting in the cessation of appreciable ovarian estrogen production. This in turn stimulates an accelerated rate of bone loss which is superimposed on normal age-related bone loss (O’Flaherty, 2000). Estimates of the rate of total bone loss for older women vary, ranging from 3% to 10% per decade at age 50 up to 25–40% per decade by age 60 (O’Flaherty, 2000). After the age of 50, average losses in cortical bone may range from 9% to 12% per decade and in cancellous bone, losses may increase to as high as 13% per decade (O’Flaherty, 2000). The magnitude and consequences of bone loss during this stage of life can be mediated to some extent by entering the menopausal phase with a healthy bone density and by continued adequate Ca intake, without which women are more likely to develop osteoporosis. As older men age, Ca intakes that were previously comparable to recommended intakes markedly decline and become inadequate. On average, men over the age of 60 have Ca intakes that are
44% lower than what is recommended, and median intakes are even lower. Inadequate data in men and women >70 years of age preclude determination of an AI based on maximal Ca retention for this age group; therefore, data are currently extrapolated from 51- to 70-year olds (Standing Committee of the Scientific Evaluation of Dietary Reference Intakes, Food and Nutrition Board, and Institute of Medicine, 1997).

6. Pregnancy and lactation Although significant changes in Ca and bone metabolism accompany pregnancy and lactation, the requirements for Ca during these periods have been determined to be identical to those of age-matched nonpregnant and nonlactating women based on current available evidence. During pregnancy, adaptive maternal responses come into effect, peaking by the third trimester of gestation. Intestinal Ca absorption efficiency essentially doubles to meet the
250–300 mg Ca/day needs of the growing and

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

231

developing fetus (Kovacs and Fuleihan, 2006). Pregnant adolescents who are still growing at the time of a pregnancy may require Ca intakes beyond the current AI levels; however, more research needs to be undertaken to substantiate this. Augmentation of Ca absorption is the dominant adaptive mechanism during lactation, although bone is also temporarily borrowed from the skeleton, regardless of Ca intake, to facilitate availability of the
280–400 mg Ca/day required to breast-feed infants (Kovacs and Fuleihan, 2006). Any acute changes to maternal BMD are typically transient in nature and rapidly reversed after childbirth and postweaning. Furthermore, there are no consistent indications that high parity or extended lactation per se is detrimental in the long term to a woman’s BMD or future fracture risk (Karlsson et al., 2001; Streeten et al., 2005).

E. Implications Adequate amounts of Ca, consumed regularly on a daily basis, are essential throughout the life cycle to promote and protect bone mass and architecture, as well as overall health (Fioritto et al., 2006). Based on recent survey data (Forshee et al., 2006; Wright et al., 2003), the prevalence of Ca inadequacy in the United States beyond infancy still presents a serious public health concern as evidenced by average Ca intakes that fall below recommendations for many groups in the population (Miller et al., 2001). For instance, the probability of Ca adequacy in the American diet has been estimated to be
46% for adult women and
59% for adult men. Across an entire lifespan, women can lose up to
42% of their spinal and
58% of their femoral peak bone mass (Rosen and KIel, 2006). This is a particularly daunting prospect when one considers that young girls not meeting adequate Ca intakes, of which there are many (Fioritto et al., 2006), may never achieve their genetic potential for peak bone mass to begin with; thus, they are required to draw on an already compromised store of bone Ca later in life. Calcium has earned a reputation as one of the most at-risk nutrients (Foote et al., 2004) and in 2005 the Dietary Guidelines Advisory Committee classified Ca as a shortfall nutrient because average Ca intake often falls to <60% of the recommended intake in subsets of the population (Kennedy and Meyers, 2005). The pressing need to improve the Ca status of Americans has been highlighted by the Healthy People 2010 Objective, an initiative that endeavors to increase, to at least 75%, the number of US individuals 2 years or older that meet current Ca recommendations (Looker, 2003). The general population requires ongoing education to more fully appreciate the relevance of Ca in relation to current and future health, the imminent risks associated with habitual inadequate intakes, and practical means by which to achieve recommended intakes.

232

Susan Reinwald et al.

III. DESCRIPTION AND PROPERTIES OF CCM A. Chemical formula of CCM and its component anions Citric acid C6H8O7 Malic acid C4H6O5 Calcium citrate malate Ca6(C6H5O7)2(C4H4O5)3 (e.g., hexa-Ca dicitrate trimalate or the anhydrous form of the 6:2:3 molar ratio fully neutralized salt). CCM is a compound salt of the Ca cation with citrate and malate anions. CCM powder is different from a simple physical blend of Ca citrate and Ca malate powders, as evidenced by a higher aqueous solubility (Fox et al., 1993b) and a unique x-ray powder diffraction pattern (unpublished data). The unique chemical composition of CCM renders it moderately soluble in water, with good compatibility in many food/ beverage matrices. CCM is reportedly more bioavailable as a Ca source when added to foods or dietary supplements than other Ca salts currently on the market. CCM does not have a single chemical formula, but rather can be formulated to yield a range of compositions with varying Ca: citrate:malate molar ratios that bracket compositions corresponding to the fully-neutralized salt. CCM molar ratios of 6:2:3, 5:2:2, and 8:2:5 form neutral Ca salts with slightly different solubilities (Fox et al., 1993b). Partial neutralization by Ca and even a slight excess of Ca are also options, such that the molar ratios 4:2:3 and 5:1:1 form slightly acidic and basic CCM salts, respectively. Numerous states of hydration of CCM powder are possible and as few as two to as many as 16–20 H2O molecules may be present (Fox et al., 1993a). Further details regarding the composition and/or properties of CCM can be obtained from numerous US patents that describe the technology (Andon, 1995; Burkes et al., 1995; Fox et al., 1993a,b; Jacobs, 1994; Nakel et al., 1988; Saltman and Smith, 1993).

B. Ca content The neutral 6:2:3 molar ratio CCM salt is comprised of 23.7% elemental Ca on a dry weight basis. Various states of hydration of the CCM powder will of course yield slightly lower Ca contents and the preparation of an octahydrate form of CCM powder (6:2:3 molar ratio) that comprises 20.73% Ca by weight has been described previously (Fox et al., 1993b). CCM compositions with a higher proportion of citrate and/or malate moieties (e.g., 4:2:3 molar ratio) will contain a proportionally lower Ca content. Table 6.3 lists the Ca content of various Ca salts. Dairy products are among the most Ca-dense foods. On average, milk contains 0.12% Ca by weight. Single-strength fruit juice beverages

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

TABLE 6.3

233

The Ca content of various Ca salts

Ca salt

Calcium oxide Calcium hydroxide Calcium carbonate Tricalcium phosphate Calcium chloride Calcium oxalate Calcium formate Dicalcium phosphate Calcium fumarate Calcium acetate Calcium citrate Calcium citrate malate Calcium malate Calcium glycinate Calcium lactate calcium lactate gluconate Calcium lysinate Calcium ascorbate Calcium gluconate

Chemical formula (anhydrous salts)

CaO Ca(OH)2

M.W. (g/mol)

% Ca (elemental Ca)

56.08 74.10

71.47 54.09

CaCO3

100.09

40.04

Ca3(PO4)2

310.18

39.00

CaCl2 CaC2O4 Ca(CHO2)2 CaHPO4

110.98 128.10 129.12 136.06

36.11 31.29 31.04 29.46

CaC4H2O4

154.14

26.00

158.17 498.44 1014.90

25.34 24.12 23.70

Ca(C4H4O5) Ca(C2H4NO2)2

172.15 188.20

23.28 21.30

Ca(C3H5O3)2 Ca2(C18H32O20)

218.22 648.60

18.37 12.36

CaC12H28N4O4 Ca(C12H14O12)

332.46 390.31

12.06 10.27

Ca(C6H11O7)2

430.38

9.31

Ca(C4H6O4) Ca3(C6H5O7) Ca6(C6H5O7)2(C4H4O5)3

supplemented with CCM can be formulated to include anywhere between 0.05% and about 0.26% by weight (wt) of solubilized Ca, or approximately half to double the level of Ca in milk. CCM-supplemented fruit juice concentrates may comprise between 0.2% and 1.20% by wt. solubilized Ca, which requires a proportionally higher level of added citric and malic acids (Burkes et al., 1995). CCM is currently used to fortify various commercially available beverages such as single-strength orange juice (OJ) at a level of 350 mg Ca/8 fl oz, a fitness water beverage at a level

234

Susan Reinwald et al.

of 100 mg Ca/8 fl oz, and a 15% juice þ 7% skim milk enriched beverage blend at a level of 450 mg Ca/8 fl oz (a level of fortification that is 50% greater than skim milk at 300 mg Ca/8 fl oz).

C. How CCM is made CCM is formed by neutralization of an alkaline Ca source with citric and malic acids. The alkaline Ca source can be Ca hydroxide (Ca(OH)2), Ca carbonate (CaCO3), or Ca oxide (CaO). The neutralization reactions involved in the formation of the neutral 6:2:3 molar ratio CCM salt from Ca(OH)2 and CaCO3 are as follows: 6CaðOHÞ2 þ 2ðC6 H8 O7 Þ þ 3ðC4 H6 O5 Þ

! Ca6 ðC6 H5 O7 Þ2 ðC4 H4 O5 Þ3

þ12H2 O 6CaCO3 þ 2ðC6 H8 O7 Þ þ 3ðC4 H6 O5 Þ þ6H2 O þ 6CO2

! Ca6 ðC6 H5 O7 Þ2 ðC4 H4 O5 Þ3

In many cases, Ca(OH)2 is a preferred Ca source for CCM formation because CO2 is not produced as a byproduct of the neutralization, as it is when CaCO3 is a reactant. If CaCO3 is used as a starting material, the evolution of CO2 gas that occurs as CCM is formed needs to be considered and controlled. CCM can be formed by carrying out the neutralization reaction in water to produce a concentrated solution or slurry, which can then be added at low levels to fortify various foods and beverages. Alternatively, the concentrated solution or slurry may be dried to produce a CCM powder that can be used for food and beverage fortification, or as an ingredient in a dietary supplement. In either case, production of the CCM occurs according to the following generalized scheme. Citric acid and malic acid are first dissolved in water with mixing at the desired concentrations according to the target molar ratio of CCM being produced. Complete solubilization of the citric and malic acids together prior to reaction with the alkaline Ca source ensures the simultaneous availability of the two acids during the neutralization reaction. The required amount of an alkaline Ca source (Ca(OH)2, CaCO3, or CaO) is dispersed in a separate quantity of water in another vessel to produce a slurry of the material. The slurry of the Ca source is then added with mixing to the solution of citric and malic acids under a controlled rate of addition. After addition of the slurry, the blend is cooled with mixing and allowed to age for a period of time to allow the neutralization reaction to go to completion. A neutral CCM salt is formed when the weights of alkaline Ca source, citric acid, and malic acid correspond to 6, 2, and 3 moles, respectively. As neutralization proceeds and CCM is formed, the resulting solution eventually becomes saturated and CCM precipitates as a solid. The CCM is recovered by separating it from the supernatant liquid by

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

235

means of decantation, filtration, or centrifugation methods. The material is then dried at temperatures ideally not exceeding 100  C using a conventional drying process to yield CCM powder with moisture content <10% by wt. The resulting dried salt is a stable powder form of CCM that can be milled to the desired mesh size (which typically ranges between 6 and 50 microns) most appropriate for the intended application (Fox et al., 1993b). Another approach for fortifying liquid foods such as beverages with CCM is to form the CCM complex in situ by allowing the neutralization reaction to proceed directly within the product itself. This is accomplished by adding the individual reactants to the beverage in the proper proportion and order of addition (e.g., citric and malic acids, followed by the alkaline Ca source). If the liquid food or beverage inherently contains citric and/or malic acid (e.g., orange and apple juices), the level of acids naturally present should be considered in terms of formulating to yield a given CCM molar ratio in the finished product. The in situ approach is the manner in which commercially available CCM-fortified OJ is manufactured, with additional citric and malic acids added to complement the levels naturally occurring in OJ and Ca(OH)2 added as the Ca source.

D. Aqueous solubility Ca is a comparatively difficult element for the body to absorb and digest. It is essentially only available for consumption associated with various other moieties (e.g., citrate, phosphate, and other anions). Each Ca source has unique physical, structural, and chemical properties such as mass, density, coordination chemistry, and solubility that are largely determined by the anions associated with the Ca2þ. Aqueous solubility of various Ca salts can vary markedly and comparisons are frequently made under standardized conditions. The water solubility of CCM is moderate when ranked versus other Ca sources frequently used as dietary supplements and food/beverage fortificants. The solubility of CCM (6:2:3 molar ratio) is 1.10-g salt in 100 ml of H2O at 25  C (Fox et al., 1993a). Table 6.4 lists the solubility of various Ca sources in water at specific temperatures, and also includes some information on potential sensory characteristics. Based on the tabulated values, it can be seen that CCM, with its solubility in water slightly over 1% by weight at 25  C, is approximately 500 and >150–700 times more soluble than tricalcium phosphate and CaCO3, respectively. As individual Ca salts, Ca malate and Ca citrate have relatively low solubility in water compared to CCM (by approximately three- and tenfold, respectively). Since there are multiple chemical formulas for CCM, solubility profiles will also vary. CCM compositions with less Ca relative to the amount of accompanying organic acids are

236

Susan Reinwald et al.

TABLE 6.4 Solubility and sensory characteristics of various Ca sources

Ca salt

Potential sensory characteristics

% Solubility Ca salt in H2O

Calcium chloride6H2O Calcium lactate Gluconate Calcium acetate

Bitter notes, tissue irritant

74

Clean tasting Vinegary taste

Calcium formate Calcium lactate5H2O Calcium gluconateH2O Calcium fumarate3H2O

N/A Neutral, bitter at high levels Neutral taste

40 40 30–34 16 9

Calcium citrate malate (6:2:3) Calcium malate3H2O Calcium citrate

Calcium hydroxide Calcium oxide Dicalcium phosphate Tricalcium phosphate Calcium carbonate Calcium oxalate

Temperature ( C)

20

20 0 100 20 20

3

20

1.22

20

1.1

25

0.31–0.4

25

Bitter notes and tangy/sour flavor at high concentrations Slight bitter, alkaline taste Alkaline, bitter taste Chalky mouthfeel at neutral pH gritty in liquids

0.096

25

0.1

20

0.1 0.02

25 25

0.002

25

Soapy flavor, lemony taste N/A

0.0014– 0.0056 0.00067

25

Neutral to slight fruity flavor in juice-based products Neutral taste and flavor Slight sourness

20

N/A ¼ not available; RT ¼ room temperature. Solubility data obtained from material safety data sheets (MSDS), CRC Handbook of Chemistry and Physics (Lide, 2004–2005), and a U.S. patent (Fox et al., 1993a). Sensory descriptions acquired from various sources (Kuntz, 2003; Puspitasari et al., 1991; Quilici-Timmcke, 2002; Tordoff, 2001; Wade, 2004; Yang and Lawless, 2005).

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

237

inherently more acidic and, in turn, have higher aqueous solubility (Fox et al., 1993b). For example, a molar ratio of Ca:citrate:malate of 4:2:3 (acidic) versus 6:2:3 (neutral) versus 5:1:1 (alkaline) results in a 100% >91% >45% relative amount of Ca in solution per unit weight of CCM, respectively (Fox et al., 1993a). The high aqueous solubility of CCM compared to other frequently used Ca sources is paramount to its ease of use and functionality when it comes to fortifying foods and beverages.

E. CCM in fortified foods and beverages In 1994, an NIH consensus statement indicated that a large percentage of Americans fail to meet recommended guidelines for optimal Ca intake (National Institutes of Health, 1994). A decade later the Surgeon General’s Report (2004) reiterated this finding by stating that the average American consumes levels of Ca far below the amount recommended for optimal bone health (US Department of Health and Human Services, 2004). To complicate matters, the US population as a whole is living an increasingly sedentary lifestyle compared to past generations, creating a paradoxical situation that essentially limits the amount of food and calories we can and should reasonably consume to ensure we get sufficient nutrition to maintain optimal health. A large percentage of the American population already consumes excess calories without meeting the recommendations for a number of nutrients and minerals including Ca (e.g., 1000–1500 mg Ca/day is widely recommended for adults). Currently in this country, an estimated 127 million adults are overweight, 60 million are obese, and 9 million are severely obese. Thirty percent of children and adolescents are also overweight, and 15% are presently classified as obese (American Obesity Association, 2006). Therefore, adding more Ca to the diet without introducing additional calories and incidental dietary fat requires improvements in food choices; it calls for the availability and consumption of nutrient-dense foods that include Ca-fortified foods and beverages. For individuals that are lactose maldigesters/intolerant, strict vegetarians, or for those that have allergies to milk proteins, or simply dislike consuming dairy products on a daily basis, Ca fortification offers alternative food sources rich in Ca. If consumed regularly, fortified foods can circumvent what might otherwise likely result in a chronic dietary deficit of Ca. Three cups of low-fat or fat-free milk per day or an equivalent amount of low-fat yogurt and/or low-fat cheese (1.5 ounces ¼ 1 cup of milk) provide an adequate amount of Ca for most adolescents. Children 2- to 8-years old require two cups of milk per day, or the equivalent in alternative dairy foods. A one cup serving of whole milk supplies
290 mg Ca. It was recently demonstrated that it was virtually impossible for adolescents not consuming dairy products in their diet, and without an intentional plan for

238

Susan Reinwald et al.

meeting Ca requirements with dairy substitution, to meet recommended AIs for Ca while also consuming the recommended intake of total calories, fat, and other essential nutrients (Gao et al., 2006). Dairy-free diets in girls and boys result in mean (SEM) Ca intakes that are only
40% of the Ca AI (i.e., 498  50.5 and 480  62.4 mg Ca/day, respectively). According to the linear programming performed by Gao et al., the introduction of 0.5–1.5 servings per day of Ca-fortified fruit juice in dairy-free diets with the highest Ca intakes can provide a practical alternative to the inclusion of dairy foods, providing a dietary approach considered to be within established pediatric guidelines. In effect, 1.5 servings of Ca-fortified juice can improve daily Ca intakes for females and males in this category by a corresponding 33% and 29% and supply 1302 and 1640 mg Ca/day, respectively, thus enabling achievement of the desired AI goals. Supplementation of the diet with CCM-fortified beverages can help avoid problems associated with swallowing pills, which can be a barrier to compliance, especially for children. Swallowing is also problematic for many older persons attempting to consume medications (Griffith, 2005) and/or supplement their diets with additional Ca (Dawson-Hughes et al., 1997). Furthermore, compliance may be improved when consuming whole fortified foods as opposed to supplements because the former involves substituting one food for another that is generally similar in appearance, taste, and availability. This may be particularly true if a conscious decision is made to select nutrient-fortified foods and beverages during the weekly grocery shopping. A weekly habit of purchasing Ca-fortified foods is likely easier to adhere to than a daily supplementation regimen that may require tablets to be taken multiple times per day. Taking supplements on a regular basis is an important determinant of the effectiveness of any oral nutritional intervention (Bruce et al., 2003). Ca-fortified foods have the added advantage over Ca supplements of providing multiple nutrients. Ca fortification of foods began in the late 1980s, although it was not until the late 1990s that the number of fortified foods and consumer awareness appreciably increased (Forshee et al., 2006). Incorporation of a Ca source into foods and beverages can be a complicated process and it requires careful planning to be successful. Consideration must be given to the type of Ca salt that is best suited for the particular application. Each Ca compound has distinct physicochemical attributes that: (i) influence the convenience of the manufacturing process, (ii) either enhance or diminish the nutritional and organoleptic properties of the end product, and (iii) influence the shelf life and stability. The choice of available FDA-designated GRAS (Generally Recognized as Safe) Ca salts for the purpose of fortification is extensive. However, depending on the food or beverage matrix and the desired level of fortification, certain Ca sources will be better choices for optimizing the organoleptic attributes, stability, and Ca bioavailability.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

239

CCM is a highly absorbable source of Ca that can be used to fortify a wide variety of food and beverage products. It is probably best known as a fortificant of OJ and other fruit juice/drink beverages. The aqueous solubility of CCM ensures that it remains dissolved in the juice, thereby avoiding precipitation that can confer a gritty mouthfeel or unpalatable aftertaste. Less soluble Ca salts may be only partially dissolved, with the insoluble particles either suspended in the beverage along with other juice particulates or sedimented at the bottom of the container. CCM has recently been used to fortify high-temperature, short-time (HTST) pasteurized milk without the need for stabilizers or chelating agents required in many other Ca-fortified protein-containing beverages (Luhadiya et al., 2006). CCM-fortified milk is a stable and hedonically acceptable product. Low concentrations of stabilizers and chelating agents are an available option if an exceptionally high level of Ca fortification is desired. The inherently high Ca concentration of cow’s milk, in addition to added Ca provided by CCM, results in a particularly Ca-rich beverage that can be used alone or be incorporated into other beverage/food products. CCM has also been used successfully to fortify plant milks (e.g., soy), milk/juice blends, and fitness waters. It is important to remember that the effectiveness of any fortified food product fundamentally depends on its palatability. As is the case for any nutrient-fortified product, sensory quality and stability during processing and storage of CCM-fortified foods/beverages need to be confirmed at the desired level of fortification. CCM has been used to fortify beverages at levels sufficient to qualify for an excellent source of Ca nutrient content claim (i.e., 20% Daily Value/serving), while its effect on taste and appearance is neutral. A number of divalent mineral salts (Ca, Fe, and Zn) are capable of stimulating complex oral and retronasal sensations (Yang and Lawless, 2005). Based on sensory studies, inorganic Ca salts have been associated with bitter tastes and less intense bitter aftertastes (Yang and Lawless, 2005). For example, Ca chloride imparts a disagreeable bitter brackishness at high concentrations and can be a stomach irritant. The bitter taste associated with some divalent salts can often be modified to a certain degree by anions, especially organic anions. Ca lactate gluconate is generally bland tasting, although at 0.10 M it has been identified as bitter by a trained descriptive panel characterizing the oral and sensory properties of divalent salts (Yang and Lawless, 2005). Ca citrate can be very acidic and convey a slight bitter note. Ca acetate can impart a vinegary taste. A soapy flavor may be detected with Ca carbonate, particularly when it is added to a food system with high pH and fat (Wade, 2004). If hydrocolloids are required to maintain less soluble Ca salts in suspension, the texture of the product is usually altered to some extent (van Mossevelde, 1997). Ca can interact with free ionized carboxylic groups on certain nonstarch food polysaccharides, including

240

Susan Reinwald et al.

alginates, pectins, gellan, and xanthan gums and, hence, influence the textural and rhelogical (i.e., flow) properties. The impact on texture and flow may either be positive or negative depending on the specific product application. Ca can also interact with protein molecules, especially in the presence of heat, leading to poor dispersion stability, sedimentation, flocculation, or gelation. Poor organoleptic properties will prevent even the best fortified product from achieving its prime objective, which ultimately is acceptance and consumption by the target population. Other important factors naturally include price, quality, and perceived value. Heaney and colleagues conducted an experiment that demonstrated the difference in physical characteristics between Ca sources used to fortify commercially available beverages. The objective was to examine the physical state of the Ca in 14 fortified beverages compared to unfortified fat-free milk (Heaney et al., 2005a). Measurements reflected how well an isotope (i.e., 45Ca) in extrinsically labeled beverages (prepared with 5 mCi 45Ca, agitated and equilibrated overnight) partitioned between the pelleted particulate phase (solid moiety) and the supernatant liquid (soluble moiety) when the beverage was subjected to centrifugation. A Beverage Score was assigned to produce values that increase as both dissolved Ca and specific activity of the Ca in the sedimented pellet increase (Figure 6.1). Determination of the amount of tracer in the pellet (as a percent of predicted) provided an approximate indication of the extent to which unassimilable Ca exchanges with the Ca in solution. A high percentage of total Ca separable by centrifugation, in addition to a poor exchange between the solid and soluble fractions, was surmised to be indicative of relatively poor absorbability and was reflected in a lower Beverage Score. Samples were also ashed and analyzed by atomic absorption spectrophotometry and liquid scintillation spectrometry to compare the measured Ca per serving to the level listed on the Nutrition Facts panel on the package label. In Ca-fortified OJ, CCM was the Ca source that exhibited the lowest amount of separable Ca in the sedimented pellet (8.1% #5. and 9.7% #4.), the highest percentage of 45Ca exchangeability between the pelleted particulate phase and the supernatant phase, and therefore the highest overall Beverage Scores of the fortified juices (Figure 6.1). CCM-fortified OJ exhibited Beverage Scores comparable to cow’s milk, suggesting a potential for excellent bioavailability of Ca from these sources. When used as a sole source of Ca in OJ, tricalcium citrate and tricalcium phosphate yielded the highest level of separable Ca, the lowest level of exchangeable Ca, and consequently the lowest Beverage Scores (#9 and #11 in Figure 6.1, respectively). Overall, the Heaney et al. study [155] showed that Ca was more uniformly suspended in OJ beverages than in soy or rice-based beverages.

Cow’s milk

1. # Ca source • [product/brand]

* = comparable to cow's milk

2. Tricalcium phosphate Ca lactate • [minute maid + vit D]

(94.1)

2.

3. Tricalcium phosphate Ca lactate • [minute maid]

(94.6)

3.

* *(99.3)

(96.8)

6.

7. Ca phosphate, Ca lactate • [kroger]

(96.1)

7.

9.

(70.4) (96.9)

11. Tricalciumphosphate; malic acid, citric acid • [wells blue bunny]

12. Ca carbonate • [silk]

14. Tricalcium phosphate • [soy dream]

20

11.

12.

(70.6)

13.

(57.5)

14. (90.1)

15. Tricalcium phosphate • [rice dream] 10

10.

(86.8)

(66.0)

13. Tricalcium phosphate • [vita soy]

0

8.

(97.4)

10. Ca phosphate, Ca lactate • [albertsons]

Rice milk

5.

6. Tricalcium phosphate, Ca lactate, Ca hydroxide, phosphoric acid • [shurfine]

8. Ca lactate, tricalcium phosphate • [florida’s natural]

Soy milk

4.

(99.3)

5. CCM (Ca citrate malate) • [tropicana]

9. Tricalcium citrate • [old orchards]

30

40

50

Extent of tracer exchangeability (%)

Total % separable Ca in pellet

4. CCM (Ca hydroxide, malic acid, citric acid) • [tropicana + vit D] Orange juice

1.

Beverage score = (99.5)

60

70

80

90

15. 100

0

20

40

60

80

100

FIGURE 6.1 Graphical illustration of the results of a Ca beverage study (Heaney et al., 2005a). The black bar at the top of the left graph represents the Beverage Score for milk, the traditional Ca-rich referent beverage. In the same graph, the comparative Beverage Score (i.e., dissolved Ca as determined by specific tracer activity as a result of extrinsic labeling) of various Ca sources in other brand name products (#2 through 15) are shown as gray bars with percentage values. The graph on the right depicts gray bars that indicate the corresponding amount of 45Ca exchanged with Ca in solution which likely represents an assimilable source of Ca versus the overlapped white bars that show the percentage of total Ca that remained in the pellet after centrifugation.

242

Susan Reinwald et al.

F. CCM in dietary supplements Sales of Ca supplements alone were $875 million in the United States in 2002, and comprised
60% of all mineral supplement sales (Anonymous, 2004). In 2004, sales of Ca supplements increased by 9.3% (Uhland et al., 2004), possibly to some extent in response to the Surgeon General’s report on bone health that was issued that year. More recently in 2006, it was projected that dietary supplement sales in the United States would approach $5 billion (Anonymous, 2006). While Ca derived from a balanced diet is preferable, Ca supplements are a popular noncaloric alternative for increasing daily Ca intake. There are a vast number of oral Ca supplements available in the market place in the form of capsules, tablets, chewable tablets, effervescent tablets, liquids, powders, suspensions, wafers, and granules. However, not all Ca salts are equally soluble or bioavailable and the dose of Ca on the label of a supplement may not necessarily be reflective of the relative amount of available Ca once consumed. Furthermore, the same Ca salt may be more or less bioavailable depending on the production process and materials used to manufacture the supplement. Many pills and tablets are coated with acid-insoluble coating agents, waxes, or shellac to act as a sealant, mask taste and odor, or ease swallowing. Various methods of preparation may interfere with Ca bioavailability from a supplemental source. Factors such as overcompression of tablets, formulations without the inclusion of starch (a disintegrant), or the inclusion of various other excipients comprising of complex fillers/binders may be a cause of poor disintegration and dissolution of Ca supplements. It is not unusual for chiropractors to visualize undissolved CaCO3 tablets on radiographs in the lower intestine during lumbar spine examinations (Cook, 1994). The variable efficacy of two commercially available CaCO3 tablets, brand-X and brand-Y, was demonstrated by Kobrin et al. (1989) in multiple experiments using an official US Pharmacopeia (USP) test method for in vitro evaluation and short- and long-term tests to assess in vivo effects. The two brands of Ca tablets were comprised of two different oyster shell-derived sources of CaCO3, each containing 500 mg of elemental Ca per tablet. In vivo testing involved ingestion of two tablets of a given brand during each meal for 24 h. In vitro testing involved tablet dissolution and disintegration tests performed in acetic and hydrochloric acids. The disintegration time of brand-X in vinegar was >15-fold longer than that of brand-Y. The brand-X supplement did not meet USP limits for CaCO3 disintegration and dissolution. In vitro assessments may of course be criticized, and with good reason, for not exactly mimicking what occurs in vivo in the more complex environment of the gastrointestinal tract. However, given that Ca has a high radiodensity, roentgenographs or x-rays were also used to confirm the presence of undisintegrated CaCO3 tablet remnants in stool samples collected for 48-h postdosing.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

243

In another study, serum phosphorus (P) and Ca levels were assessed in patients with hyperphosphatemia and hypocalcemia, respectively, subsequent to therapeutic supplementation with each brand of CaCO3. Roentgenographs revealed tablet-shaped opacities after supplementation with brand-X, but not after supplementation with brand-Y. Intact tablet remnants of brand-X supplements, which were 99.7% of their original weight, were recovered in the feces of all subjects, although no remnants were recovered for brand-Y. Furthermore, only brand-Y supplements restored serum Ca and P levels to the desired range in patients with medical conditions dependant on Ca bioavailability. Kobrin also cited other investigators that performed in vitro studies on 32 brands of commercially available CaCO3 preparations and found that only 7 of them met USP standards for disintegration and dissolution. Intestinal transit time and gastric motility vary within the general population and can influence Ca availability, particularly if tablet disintegration is slow under physiological conditions. A slowly disintegrating Ca salt supplement with inherently poor solubility characteristics, coupled with a fasted state, achlorhydria, or pharmacologically induced achlorhydria, can result in Ca supplements appearing in the rectum of patients that are x-rayed, having bypassed the principal intestinal sites of absorption in the ileum and jejunum. Physical evidence of tablet remnants in stools clearly indicates a Ca supplement has not been available for absorption. While absorption of CCM is enhanced in the presence of a light meal, it can also be consumed on an empty stomach and still be sufficiently absorbed (Heaney et al., 1989b; Higdon, 2005). The same cannot be said for some other Ca salts and Ca supplements in tablet form (Cook, 1994). Instead, their availability and benefit are contingent upon the presence of sufficient stomach acid and/or the ionic strength of the intestinal contents during a meal. Absorption of Ca from carbonate sources in patients with achlorhydria has been demonstrated to be significantly impaired if supplementation does not coincide with a meal (Recker, 1985). Ca carbonate is often used in supplement tablets or pills because of the high Ca density and low cost. However, a powdered Ca dietary supplement, intended to be mixed/dissolved into beverages or other fluid foods (e.g., soups and sauces) by the consumer just prior to consumption, is a novel product form applicable only to a soluble Ca salt such as CCM. A powdered Ca supplement would of course avoid the problems some consumers experience with swallowing pills and tablets, as well as eliminate any uncertainty associated with tablet disintegration and dissolution. Ca excess, or hypercalcemia, from dietary sources of Ca, including fortified foods and supplements is very rare. In relation to daily Ca intakes, hypercalcemia is typically only likely to result in the event of extreme habitual overzealousness, which of course is not recommended. Daily Ca intakes that fall short of systemic needs are infinitely more

244

Susan Reinwald et al.

prevalent. Excellent traditional food sources of Ca include milk, yogurt, cheese, tofu, and canned fish with soft edible bones, although these foods are not consumed regularly enough by individuals that are unable to meet their Ca needs. Fortification of an expanding number of food and beverage products, including many products that do not supply appreciable levels of Ca in their unfortified state, may prove to be an effective strategy for helping to narrow the gap between current Ca consumption levels and the recommended intakes. We live in an era in which average lifespan and average age of the population are increasing. Basic prophylactic measures such as increased consumption of fortified foods and beverages and mineral supplements comprising highly bioavailable Ca can enhance our protection against chronic debilitating diseases associated with aging, such as osteoporosis.

IV. STUDIES OF Ca BIOAVAILABILITY FROM CCM In the context of nutrition, bioavailability refers to the difference between the amount of an exogenous nutrient or mineral a person is exposed to, and the amount of that substance that is absorbed and reaches the systemic circulation. Exposure is typically, although not exclusively, via an ingested dose. Bioavailability is considered to reflect accessibility of a substance to a potential site of action (Balant, 1991) for use or storage. Utilization is essentially a separate issue beyond bioavailability. Once absorbed, available nutrients are utilized according to physiological status, metabolic function, and nutritional need (Heaney, 2001b), despite their relative abundance. Movement of a substance across the outer membrane of the gastrointestinal tract represents absorption. Effective absorption of Ca at the intestinal mucosa is at the forefront of the bioavailability process. Absorption is influenced by numerous factors, both intrinsic and extrinsic, that produce effects both singularly and in combination with each other. CCM is often distinguished from other Ca sources on the basis of its ostensibly high absorbability and bioavailability in the face of factors that mediate outcomes in relation to Ca uptake and metabolism. This chapter explains and examines the factors that generally govern and influence Ca absorption; it looks at how agreeably CCM fits with these factors in terms of being able to deliver health benefits based on data available from human and animal studies (summarized in Tables 6.5 and 6.6, respectively).

A. Ca absorption Intestinal absorption of Ca is via two distinct mechanistic routes which involve the (i) transcellular pathway, a saturable active transfer process that is unidirectional (i.e., mucosal-to-serosal), and (ii) the paracellular

TABLE 6.5 Summary of studies that investigated the absorption/bioavailability of Ca from CCM ingested as a supplement or food fortificant Author, year

Subjects (n), age, and gender

Andon et al., 1996b

n ¼ 57 , x: 57 year

Miller et al., 1989

n ¼ 6 children <: n ¼ 3 ,: n ¼ 3 Age range 11–17 years

Miller et al., 1988

n ¼ 12 adolescents <: n ¼ 6 ,: n ¼ 6 Age 10–17 years

Treatments Ca loads

Objective and design

Results

Significance

250 mg Ca as CCM via radiolabeled oral dose. Juices were extrinsically labeled with 45Ca. CCM molar ratio in apple juice was 1.0:0.7:1.3 (equivalent to 6:4.2:7.8); CCM molar ratio in OJ was 1.0:1.8:1.5 (equivalent to 6:10.8:9) 250 mg Ca as CCM enriched with tracer in form of chewable tablets

Compare Ca bioavailability from CCM in orange (OJ) versus apple juice (AJ) using single oral isotope method; specific activity in serum measured 5-h postdose

% FxAbs of Ca (x: SEM) in serum: CCM-OJ (36  1%) CCM-AJ (42  2%)

CCM-AJ > CCM-OJ p < .003

Stable dual isotope tracers used to quantify CaAbs in urine and serum. Comparison of CCM chewable versus CCM swallowable supplements and CaCO3 from data collected previously in same subjects

Chewable CCM > CaCO3 (p ¼ .047) and swallowable CCM > CaCO3 (p ¼ .094)

Treatments in randomized order with 3-week washout period 1. 250-mg elemental Ca as CaCO3 (enriched with 44Ca)

Compare CaAbs for CCM versus CaCO3 using dual isotope method using a crossover design and measured urinary isotope ratio after 24 h

Based on urinary excretion which correlated with serum data (r ¼ 0.85): x: SD% CaAbs from chewable CCM for molar ratio 6:2:3 (41.4  8.2%) > swallowable CCM for molar ratio 5:1:1 (39.5  10.6%) > CaCO3 (26.7  7.8%) Mean FxAbs  SEM results 1. CCM: 36.2  2.7% (range: 27.3–53.3%) 2. CaCO3: 26.4  2.2% (range: 12.8–39.6%)

t-test for FxAbs difference CCM > CaCO3 (p < .03)

(continued)

246

TABLE 6.5 (continued)

Author, year

Subjects (n), age, and gender

Martini and Wood, 2002

n ¼ 12 elderly subjects <: n ¼ 3, 76  6 year (x: SEM) ,: n ¼ 9, 70  3 year (: SEM)

Brink et al., 2003

n ¼ 10 , > 5 year postmenopausal Age 58–65 year

Treatments Ca loads 2. 250-mg elemental Ca as CCM (enriched with 44 Ca) Intrinsically labeled; 42 Ca i.v. tracer 30-min after oral Ca load; CCM molar ratio was 5:1:1 (equivalent to 6:1.2:1.2) 6 weeks on a standardized lowCa basal diet (300 mg Ca/ day) Weeks 2, 4, and 6, one of the following high-Ca treatments (adding 1000 mg Ca/day as a divided oral dose at breakfast and dinner) was randomly added to the basal diet for a 1-week period 1) Milk 2) Ca citrate malate fortified OJ (CCM-OJ) 3) CaCO3 supplement (Os-Cal)

Consumed a western style breakfast with 60.2 mg Ca in food þ oral intake of 200 mg of a given Ca salt [CCM, CaCO3,

Objective and design

Results

Significance

Mean difference in FxAbs for CCM versus CaCO3 was 9.7  3.7% or a 37% increase in CaAbs for CCM

6-week crossover trial in a metabolic unit to compare the relative bioavailability of Ca from three dietary supplemental sources by measuring serum PTH response to Ca intake (an indirect method)

Assessed true FxAbs of Ca in a 10-week randomized 8-way crossover design study with 7- to 14-day washout periods. Dual

Postprandial suppression of serum PTH not different among the three supplemental sources tested, suggesting Ca bioavailability equivalence among them During 1-week high-Ca diet periods: fasting serum Ca "3% (p < .0001), serum 1.25(OH)2 vitamin D #20% (p < .0001), and bone resorption biomarker (serum NTX) 14% (p < .02) compared to low-Ca periods x: SD Ca Abs (%) CCM n ¼ 8 29.6  10.6 CaCO3 n ¼ 9 29.9  12.3 Milk n ¼ 9 29.4  8.8 TCP n ¼ 9 24.7  14.8

p > .05 for comparison of Ca sources

CaLG, CaL CCM CaCO3 and milk comparison. (p > .05) TCP < CaLG and

Smith et al., 1987

n ¼ 10 per group for Expt. 1 n ¼ 12 per group for Expt. 2 Age range 21–30 years All subjects ,

Jackman et al., 1997

n ¼ 35 adolescent girls, postmenarcheal Age range 12–15 years

247

tricalcium phosphate (TCP), Ca lactate gluconate (CaLG), and Ca L-lactate (CaL)] 250-mg oral Ca load (labeled) for both experiments, and simultaneous i.v. administration of a second tracer, 47Ca Expt. 1—CaCO3 tablets versus Ca citrate malate (CCM) tablets; intrinsically labeled; CCM molar ratio 6:2:3 Expt. 2—milk (2% fat) versus CCM added to OJ; extrinsically labeled; CCM molar ratio 3:3:2 (equivalent to 6:6:4) Mean  SD Ca content of basal diet provided 799  163 mg/day, and was adjusted for Ca content by adding CCM to dietary beverages so that mean  SD Ca (mg/day) intake for groups was as follows: Gp n Low Ca High Ca A* 10 841  153 1842  153 B* 3 1023  150 2173  149 C* 3 1154  153 1694  142 D* 5 1358  143 2096  153 E 14 1332  102 -

isotope technique to measure Ca tracer ratios in urine Comparison of Ca availability from CCM (tablet form and as a fortificant in juice), CaCO3, and milk Interindividual differences tested, subjects assigned to either treatment alternative in each experiment Double-isotope technique employed to assess serum and urine Ca

Crossover design* for groups on both high and low intakes Ca balance measured in subjects during two 21-day Ca-balance studies separated by a 4-week washout period;

CaLG n ¼ 9 32.1  7.6 CaL n ¼ 18 31.5  9.3

Absolute % absorption (SEM): Expt. 1: CCM (37.3  2.0) vs CaCO3 (29.6  1.7) Expt. 2: CCM-OJ (38.3  1.5) vs Milk (29.4  2.4) Ca availability from CCM was at least as good, if not better than it was in either CaCO3 (in supplement form) or milk Ca retention modeled as a nonlinear function of Ca intake Ca intake explained 79% and 6%, respectively of the variation in fecal and urinary Ca excretion. x maximal Ca retention was 473 mg/day. 1300 mg Ca/day was the smallest intake that allowed some subjects to achieve 100% of maximal Ca retention (95% CI: 26%, 100%).

CaL (p < .05) TCP same as CCM, CaCO3, and milk Expt. 1: CCM > CaCO3 (p < 01) Expt. 2: CCM-OJ > Milk (p < .01)

 x: maximal Ca retention (95% CI: 245, 701 mg Ca/day)

(continued)

248

TABLE 6.5

(continued)

Author, year

Subjects (n), age, and gender

Treatments Ca loads

Objective and design

Andon, 2003 Abstr 188.3

n ¼ not specified Group 1: adolescents age range 9–17 years Group 2: , age range 20–30 years Group 3: , age range 40–77 years

All oral Ca test loads (250 mg) intrinsically labeled with Ca tracer and consumed as tablets or in juice

Assessed the impact of molar ratio (MR) on CaAbs in 5 different Ca citrate malate (CCM) compositions comprising a threefold range in MR (data from 154 previous studies).

Heaney et al., 1989b

n ¼ 47 , used in various comparisons Age range 20–30 years ▪ Observation study: used subgroup of n ¼ 1–3

▪ Observation study. Oral treatments as follows: (1) CaCO3 (2) calf bone substance or CBS

Evaluated the effect of co-ingestion of a light meal with various sources of Ca on CaAbs efficiency. Double-isotope method employed.

Results Ca retention estimated to plateau at intakes > 2 g/ day x CaAbs for: 1) tablet (37.7%) vs juice (38.9%) vehicle 2) age group (gp 1: 37.9% vs gp 2: 37.8% vs gp 3: 39.0%) 3) MR (lowest to highest MR yielded % CaAbs of 42.0, 38.8, 36.2, 36.0, 38.3%). CCM indexed to an equimolar Ca dose of milk (Ca index for milk set at 100) consistently exceeded that of milk (138), other dairy products (86–100), Ca salts used as fortificants (86–93), Ca-fortified soy milk (77), and other vegetable sources (18–103). ▪ Observation study: x FxAbs of Ca: without meal for CaCO3 (0.0803), CBS (0.0780), HA (0.077) with meal for milk

Significance

1) Effect of vehicle Tablet > Juice p > .05 2) Effect of age p > .05 3) Effect of different molar ratios of CCM p > .05

▪ Obs: Significance not reported r Expt 1: p > .05 CaCO3 w/meal > CaCO3 w/out meal ▲ Expt. 2: p < .01

r Expt. 1: n ¼ 10 for a ‘with-meal’ assessment and n ¼ 26 for a ‘without-meal’ assessment ▲ Expt. 2: n ¼ 10

249

Heaney et al., 2005b

n ¼ 25, premenopausal , Age range 21–43 year, x: 34.4 year

Heaney et al., 1990a

Age range 20–40 year adult , n ¼ 39 CaC2O4 n ¼ 21 hydroxyapatite (HA) n ¼ 10 CaCO3 w/meal n ¼ 43 CaCO3 w/out

(3) synthetic hydroxyapatite or HA (4) milk (5) Ca citrate malate or CCM where: - all Ca loads
250 mg þ labeled with 45Ca and 47Ca i.v. tracer administered to subjects r Expt. 1: 250 mg Ca load (as CaCO3) þ 45 Ca þ 47Ca i.v. tracer: (a) with meal, and (b) without meal. ▲ Expt. 2: 250 mg Ca load (as Ca citrate malate in OJ) þ 45Ca þ 47Ca i.v. tracer: (a) with meal (b) without meal. 500 mg Ca as an oral load delivered in OJ as a fortificant with a light meal as follows: 1. Ca citrate malate (CCM) 2. tricalcium phosphate/Ca lactate (TCP/CL)

All tests under load conditions at intake levels comparable to the Ca content of a typical meal Ca sources in liquid form were extrinsically labeled (i.e., Ca

The test Ca source was always consumed at the midpoint of a neutral test meal with no food post-load (4 h). ▪ Observation study: Subjects tested twice under non-meal conditions. r Expt. 1: Not a crossover design ▲ Expt. 2: Subjects crossed over for withand without-meal comparison

Pharmacokinetic methods used to assess the bioavailability of two Ca salts used to fortify OJ. Subjects tested 3x’s, 2x’s with one fortification, and 1x with the other (random sequence); 4-week washout between treatments Compilation of values for Ca FxAbs and approximate solubility of various Ca salts and food sources obtained in 352 studies in human subjects with and without

(0.247), and CCM (0.304) r Expt. 1: x  SEM for FxAbs of Ca after oral intake of CaCO3 with meal ¼ 0.296  0.0170 vs without meal ¼ 0.246  0.0265 (NS) ▲ Expt. 2: x  SEM for FxAbs of Ca at base-line under fasting conditions for CCM was 0.2847  0.095 vs 0.3743  0.0166 with meal. Difference in FxAbs þ 0.0896  0.0246. 90% of subjects exhibited improved FxAbs of Ca when Ca load was ingested with a meal. AUC9-hr was 48% greater for CCM vs TCP/CL x: SD (mg) for Ca absorbed was: CCM-OJ (148  9.0) > TCP/CL-OJ (100  8.9)

CCM w/meal > CCM w/out meal

Data summarized as: ()
x  SEM solubility (mM/L) [] [FxAb with or without a meal]: CaC2O4: (0.04) [0.102

The solubility data is presented as an approximation

CCM > TCP/CL (p < .001)

(continued)

250

TABLE 6.5

(continued)

Author, year

Griffin et al., 2002

Subjects (n), age, and gender

Treatments Ca loads

Objective and design

Results

meal n ¼ 10 Ca3(PO4)2, or TCP n ¼ 7 Ca citrate (CC) n ¼ 20 CCM n ¼ 13 bisglycino-Ca (BS) n ¼ 34 spinach n ¼ 108 milk w/meal n ¼ 10 milk w/out meal n ¼ 11 kale n ¼ 37 bonemeal (BM)

citrate and milk) or intrinsically labeled during synthesis and ingested as a liquid (i.e., bisglycinocalcium). Solid preparations intrinsically labeled prior to precipitation [i.e., CaCO3, Ca oxalate (CaC2O4), TCP, HA, and CCM], spinach and kale grown hydroponically and labeled via a nutrient solution during growth All tests were performed after subjects fasted overnight

the coingestion of food Solubility in this study referred to the amount of the substance that can be dissolved in water at neutral pH Most studies performed using the double-isotope method, some later tests used a 5 h, single isotope method

n ¼ 59 girls at or near menarche Age range: 11.0–13.9 years

Average Ca intake was
1500 mg/day via consumption of Ca-fortified OJ (i.e., one 8-oz glass AM and PM supplying 700 mg Ca/d as CCM) in

Assessed the effect of oligofructose or inulin þ oligofructose vs placebo on Ca Abs in a balanced, randomized, crossover design using dual isotope

.040] w/ HA: (0.08) [0.166  .090] w/out CaCO3: (0.14) [0.296  .054] w/ [0.235 .123] w/out TCP: (0.97) [0.252  .130] w/ CC (7.3) [0.242  .049] w/out CCM: (80) [0.363  .076] w/ BS: (1500) [0.440  .104] w/out Spinach: [0.046  .004] w/ Milk: [0.317  .023] w/ [0.267 . 025] w/out Kale: [0.409  .030] w/ BM: [0.272  .019] w/out The relationship of solubility to absorbability was determined to be tenuous and CaAbs from food sources was considered to be influenced by other food components Mean (SD) Ca Abs from CCM due to the placebo treatment alone ranged from 31.8  10.0% to 32.3  9.8%. Ca Abs from CCM increased

Significance

Ca Abs from CCM in the presence of inulin þ oligofructose > placebo; p ¼ .01

Griffin et al., 2003

n ¼ 54 girls Mean age: 12.4  1.2 years

conjunction with the following treatments (3 weeks each) adhered to in randomized order with an intervening 2-week washout period: 1. placebo (sucrose) 2. oligofructose 3. inulin þ oligofructose mixture OJ extrinsically labeled with 46 Ca as CaCO3. Average Ca intake maintained at 1390  453 mg/day via consumption of Ca-fortified OJ (i.e., one 8-oz glass AM and PM supplying 700 mg Ca/d as CCM) in conjunction with the following treatments (3-wk each) adhered to in randomized order with an intervening 2-week washout period: 1. placebo (sucrose) 2. Synergy1 (long-chain inulin enriched with oligofructose) OJ extrinsically labeled with 46 Ca as CaCO3.

methodology. Ca Abs measured from the ratio of the fractional excretion of 46 Ca:42Ca (the latter delivered intravenously) in a 48-hr urine collection.

Assessed benefits due to enhanced Ca absorption resulting from the addition of modest amounts of longchain inulin enriched with oligofructose in a balanced randomized crossover design. Ca Abs measured using dual-isotope methodology via the ratio of 46 Ca with 42Ca (intravenous tracer) as it appeared in urine collected over 48 hr.

significantly in the presence of inulin þ oligofructose (38.2  9.8%), although not in response to oligofructose alone (31.8  9.3%).

Overall, mean (SD) Ca Abs due to the placebo treatment was 33.1  9.2%. In the presence of Synergy1, Ca Abs significantly increased to 36.1  9.8%. Girls displaying lower Ca absorption during the placebo period benefited most from the addition of nondigestible, fermentable, oligofructose.

Ca Abs from CCM in OJ during intake of the placebo or with the non-digestible, fermentable oligosaccharide treatments were high despite the fact that subjects e xceeded the AI recommended for Ca. Ca Abs from CCMfortified OJ during intake of the placebo and following consumption of the non-digestible, fermentable, oligofructose treatment was consistently high (Synergy1 > placebo; p ¼ .027) despite the subjects exceeding the AI recommended for Ca.

251

252

TABLE 6.6 Summary of animal studies that investigated the absorption/retention/bioavailability of Ca from CCM Author, year

Animals (n)

Treatments Ca loads

Objective and design

Results

Significance

Weaver et al., 2002

Adult male rats n ¼ 10–15

Oral gavage with various Ca fortification salts of different solubilities that were intrinsically labeled with 44Ca

Determination of FxAbs of Ca based on the femur uptake model 48-h after feeding

Mean FxAbs of Ca (%) SEM from the five salts was: Ca fumarate: 30.09  1.02 > Ca malate fumarate: 29.13  1.65 > Ca citrate: 28.69 2.25 > CCM: 28.06  1.58 > CaCO3: 27.42  3.09

p > .05 for all comparisons

Andon et al., 1996b

Dogs: adult , (n ¼ 6)

Animals dosed with 47Ca extrinsically labeled beverages Dogs: 125 mg dose Ca as: (1) CCM-OJ or (2) CCMAJ Rats: 6 mg dose Ca administered as either (1) 2% fat milk (2) CCM-OJ (3) CCM-AJ

Ca retention for CCM-AJ > CCM-OJ in: Rats 61  2 vs 52  2% Dogs 29  2 vs 15  1% Ca from CCM in AJ better retained than that from OJ In rats Ca retention CCM-AJ and CCMOJ > milk (42  2%) Higher ratio of fructose: glucose and lower acid content of CCMAJ improved Ca retention in rats

CCM-AJ > CCM-OJ Rats: p < .05 Dogs p < .001

Rats: young adult < (n ¼ 6)

Whole body 47Ca retention assessed in dogs and rats 72-h postdose Additional analysis to determine the effect of different carbohydrate and organic acid profiles of juices on CaAbs in rats

45

Comparison of juices p < . 05 Juices vs milk p < .05 Effect of organic acid AJ vs OJ p ¼ .002 Effect of sugars AJ vs OJ p ¼ .0001

Smith et al., 1987

Expt. 1. n ¼ 7/group Expt. 2 n ¼ 13/group Rats in Expt. 1 were 30–40% older than those in Expt. 2

Kochanowski, 1990

Andon et al., 1993

Young (weanling) growing female rats (n ¼ 14/ group)

Young adult male rats n ¼ 6–7/ group

Expt. 1. Labeled (45Ca or 47Ca) oral test loads of 6 mg Ca/rat via gastric tubing as CCM or CaCO3 (powder vehicle) Expt. 2 Extrinsically labeled CCM-OJ or milk

Estimated relative Ca retention after 6-days to determine % retention of the oral test load

Rats fed either marginal (0.3%) or adequate (0.6%) Ca as CCM or CaCO3 for either 4 or 12 weeks’

Examined bone histomorphometry parameters as an indicator of Ca bioavailability

253

Equimolar amount of intrinsically [int] or extrinsically [ext] labeled Ca as an oral dose of either: CCM [int] CCM [ext] CaCO3 [int]

Mean % SEM Ca retention for Expt. 1: CCM powder ¼ 35.1 1.6% > CaCO3 powder ¼ 30.8  2.6%

Expt. 1. CCM > CaCO3; p > .05 Expt. 2 CCM-OJ > milk; p < .001

Expt. 2 CCM-OJ ¼ 51.1  1.7% > milk ¼ 42.2  1.8%

Longitudinal study determined whole body fractional Ca retention at 8, 16, 29, and 32 weeks of age with various Ca salts labeled either

Rats fed 0.6% CCM were heavier than both groups of CaCO3-fed rats at 4 weeks and 8 weeks Longitudinal bone growth rate (0.3%) CCM > (0.6%) CaCO3 at 4 weeks Trabecular bone 4 weeks: CCM 23–25% > CaCO3 Trabecular bone 12 weeks: CCM 44–47% > CaCO3 Advancing age decreased Ca retention Rank order relative to CCM [int](100%) > CaCO3 [int] (834%) > HAP [int] Ca retention over

Body weight CCM > CaCO3 4 weeks p < .05

CCM > CaCO3 longitudinal growth p < .05 CCM > CaCO3 trabecular bone 4- and 12 weeks p < .05

Ca retention: young > older age for all Ca salts; p < .001. CCM > CaCO3 > HAP at all ages; p < .001 Extrinsic > intrinsic labeling values in

(continued)

254

TABLE 6.6 (continued)

Author, year

Animals (n)

Treatments Ca loads CaCO3 [ext] Ca hydroxyapatite (HAP)[int] Ca hydroxyapatite (HAP)[ext] Oral Ca test load (5.1 mg) by gavage w/ and w/ out a meal Milk or CCM dissolved in a variety of citrus juice beverages

Heaney et al., 1989b

Male rats n ¼ 6–24 per group treatment

Henry and Pesti, 2002

Young boiler chicks n ¼ 10 pens of 3–8 chicks per treatment

Expt. 1 CCM vs CaCO3 each at 0.7% and 0.9% Expt. 2. CCM vs Ca CO3 at 0.50, 0.55, 0.60, 0.65, or 0.70% Ca

Lihono et al., 1997a)

1-day old male broiler chickens

Expt. 1. Animals fed corn/ soybean-meal-based

Objective and design intrinsically or extrinsically

Evaluated the effect of coingestion of CaCO3 vs CCM salts w/ and w/out a meal. Radiolabeled CCM and CaCO3 ingested and activity measured 7 days postdose using whole body counting method to determine Ca retention Comparison of CCM vs CaCO3 in two feeding studies in terms of bone/body growth and development

Feeding study assessed the effects of microbially derived

Results estimated by extrinsic labeling in younger rats

Significance young rats (
20%)

Mean Ca retention fraction w/out food was 48% for CCM in juice and 42.7% for milk Mean Ca retention fraction w/ food was 61.2% for CCM in juice and 50.8% for milk

CCM w/ meal > CCM w/out meal p < .001 for all juices CaCO3 w/ meal vs CaCO3 w/out meal was p < .01 and p < .001

Expt. 1. Feed efficiency and growth 0–18 days CCM > CaCO3, no differences in bone development Expt. 2. CCM > CaCO3 for: (1) weight gain (2) dry fat-free tibia weight (3) tibia ash (4) tibia Ca

Expt.1. CCM > CaCO3 for growth p  .05 Expt. 2. parameters CCM > CaCO3 (1) p < .022 (2) p < .0002 (3) p < .023 (4) p < .0001 (5) p < .047

Adding phytase to CCM in food did not cause changes in weight

Ca bioavailability for CCM w/ or w/ out phytase in

n ¼ 20 birds per treatment

(Pointillart and Gue´guen, 1993)

Male pigs (2-month old) n ¼ 9/group

diets, w/ w/out
0.12% added phytase and either: -Ca from CCM at 0, 0.1, 0.2, and 0.3% -Ca from CaCO3 at 1% Expt. 2. Fed spray-dried soymilk incubated with microbial phytase prior to hydrothermal cooking and either: -Ca from CCM (0.31, 0.46, 0.61%) -Ca from CaCO3 (0.76%). Fed 0.7% Casupplemented diet 0.5% Ca from milk 0.5% Ca from CCM 0.2% Ca from CaCO3 in basal diet Phytate content in diets

phytase enzyme treatments on the bioavailability of Ca from soy-based foods over 17 days Examined bone, weight gain and feed intake

gain Adding phytase to CaCO3 in food vs CaCO3 alone improved weight gain

diets was the same p < .17 Ca bioavailability for CaCO3 w/ phytase > CaCO3 w/out phytase in diets p < .05

Balance study and assessment of bone parameters Pair fed pigs for 10 weeks, 10-day balance trial 2 weeks before euthanization for n ¼ 6/group

Milk > CCM for growth rate and feed efficiency Milk ¼ CCM for growth rate and feed efficiency when adjusted for bodyweights

Before adjustment for bodyweight bone growth milk > CCM p < .05 or p < .03 after adjustment p > .05

Urinary hydroxyproline excretion CCM ¼ Milk Most morphological parameters for bone milk > CCM Bone parameters not related to growth CCM ¼ or > Milk

Apparent density and stress parameter for metatarsal bone CCM > milk p < .05

255

256

Susan Reinwald et al.

pathway, a nonsaturable process dependent on diffusion-driven transfer which is potentially bidirectional (i.e., predominantly mucosal-to-serosal, but also potentially serosal-to-mucosal). Transcellular absorption involves lumenal Ca crossing the brush border of intestinal enterocytes, down its electrochemical potential gradient, and entering the cytosol via Ca channels and membrane-binding transport proteins. The intracellular vitamin D-induced Ca-binding protein calbindin-D9K (rate limiting) and membrane-bound vesicles mediate the translocation of Ca through the cytosol to the basolateral membrane where it is ejected from the enterocyte against its electrochemical potential gradient via transport proteins. When the intracellular concentration of Ca is low, the basolateral membrane Ca-ATPase splits ATP and uses the liberated energy to pump Ca extracellularly. When intracellular concentrations of Ca are high, the Naþ/Ca2þ exchanger in the basolateral membrane uses energy derived from the Naþ gradient to expel intracellular Ca. The membrane-bound vesicles that transport Ca also extrude it from the lateral membrane via exocytosis. The duodenum followed by the jejunum are the intestinal locations that most effectively absorb Ca transcellularly, whereas the ileum is the site of longest residency and, therefore, the region of the intestines of greatest total Ca absorption (Weaver and Heaney, 2006a). Transcellular absorption is regulated by 1,25(OH)2 vitamin D3 and limited by the presence of a finite number of Ca channels and binding sites and therefore functions optimally when Ca intake is relatively low. A high concentration of Ca in the intestinal lumen relative to the ECF tends to drive Ca absorption via the paracellular route. Water naturally seeps through the ‘‘microspaces’’ (Wasserman, 2004), or cellular junctions between adjacent enterocytes, during absorption thus creating a paracellular pathway between which 8–30% of the total Ca absorbed (McCormick, 2002) is entrained as a solute. The transfer of Ca by a solvent drag-induced mechanism is via a passive diffusion process in response to increases in the osmolarity of the lumenal contents. This pathway is not site specific and the opportunity for Ca absorption via this route occurs throughout the entire length of the small intestine (Weaver and Liebman, 2002).

B. Factors that influence Ca absorption The absorbability and subsequent bioavailability of Ca salts in humans and animals is simultaneously influenced by a number of exogenous and endogenous factors. In summary, these factors include, although are not limited to:

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

    

     



257

Ca load (i.e., per day and per dose) Measurement methodologies Chemistry of the Ca salt Food matrix or type of supplement The presence or absence of enhancing and/or interfering substances (e.g., inulin-type fructans, fructooligosaccharides, phytates, excipients, medications) The composition and/or timing of meals Nutritional status (i.e., replete or deficient) Health status, family history of osteoporosis Lifestyle factors (e.g., physical activity, smoking, alcohol intake) Race and genetic factors [e.g., FOK1 gene polymorphism of the vitamin D receptor (VDR)] Age, life stage  Body size  Hormonal status (including seasonal effects) Physiological function  Gastric acid secretion  Endogenous solubility  Intestinal motility, mucosal permeability, and mucosal mass  Species differences (i.e., endogenous phytase synthesis, coprophagy)

C. How CCM fits with the influencing factors — human studies with CCM 1. Ca intake The net amount of Ca absorbed increases with increasing intake (DawsonHughes, 2006b). Balance and tracer studies have shown that fractional Ca absorption efficiency is generally increased by a low and reduced by a high Ca diet (Heaney et al., 1990b; Norman et al., 1981). Percentage Ca absorption is, for that reason, inversely related to size of the Ca load (Andon et al., 2004; Schulze et al., 2003; Weaver et al., 1996) and usual intake is considered to explain 26% of the interindividual variation in Ca absorption (Barger-Lux et al., 1995). Barger-Lux and Heaney (2005) have described Ca absorption efficiency as more highly variable than Ca intake itself. Dividing up one’s daily Ca dose into equal increments that are consumed at regularly spaced intervals over the course of the day is recommended as a useful means by which to increase the absorption efficiency and efficacy of Ca (Blanchard and Aeschlimann, 1989; Heaney, 1991). Ca supplements that include >500 mg Ca per tablet/ capsule can quickly overwhelm the active transport mechanism of the intestinal system and passive transport must be more heavily relied upon for absorption of high acute Ca doses (Dawson-Hughes, 2006b).

258

Susan Reinwald et al.

Ideally, Ca supplements should not be used to replace Ca consumed from natural food sources; although in the event that food choices or caloric intake do not supply adequate levels of Ca, supplements may be of great benefit when used to complement one’s dietary intake. However, the reality is that Ca intakes across a number of groups in the population are generally too low (Braun and Weaver, 2006). As a result, larger doses of Ca in the form of supplements are routinely relied upon to supply absorbable Ca and, hence, the various factors that influence absorption become increasingly important.

2. Methodologies Measurement of Ca absorption and bioavailability is ultimately the means by which the scientific community gauges the effectiveness of a Ca source. Methods used to measure Ca bioavailability have been summarized previously (Heaney, 2001b) and in brief include: (i) balance studies (i.e., INTAKE – EXCRETION ¼ NET ABSORPTION) — which are difficult to perform in a practical sense; (ii) serum concentrations — similar to the pharmacokinetic measurement of the area under the curve (AUC), which has limited sensitivity; (iii) tracer methods — using radioactive or stable isotopes which yield highly sensitive and reproducible results for intrinsically labeled Ca sources; (iv) urinary increment — which is an imprecise method given that only 1–6% of the variation in urinary Ca is explained by Ca intake (Braun et al., 2006; Jackman et al., 1997); (v) target system effects — dependent on the nutritional and physiological homogeneity of populations (e.g., inbred experimental animals); and (vi) in vitro methods — that are not entirely relevant to inherently complex in vivo environments. Overall, serum and urinary increment methods have shown that a Ca source (e.g., CaCO3) accompanied by citrate is better absorbed than one that is not (Heaney et al., 1999). Citrate that is absorbed into circulation is inclined to bind Ca ions and thereby artificially elevate incremental data compared to other salts (Heaney, 2001b). A number of studies utilizing the most sensitive isotopic tracer methods have demonstrated that CCM is highly absorbable compared to other Ca sources (Abrams et al., 2003; Heaney et al., 1989b; Miller et al., 1988; Smith et al., 1987). Direct isotopic labeling of a food source or salt (incorporating an isotope during ingredient synthesis, i.e., intrinsic labeling) is not always possible or practical, and extrinsic labeling (adding an isotopic tracer to the prepared test meal) must be employed instead, as is necessitated when the source cannot be intrinsically labeled such as in the case for mined Ca salts. Most Ca salts can be intrinsically labeled prior to incorporation into the food product being fortified. The accuracy of extrinsic labeling to estimate Ca absorption from a fortified food or beverage is

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

259

largely reliant upon a complete exchange between the Ca source in the food or beverage and the added isotope. This exchange should be tested prior to using the extrinsic labeling approach. The high molecular weight (MW) of organic chelates can potentially interfere with exchangeability, and if the Ca source in the fortified food or beverage is partially or completely insoluble (e.g., CaCO3 or tricalcium phosphate), extrinsic labeling is likely to overestimate the true fractional absorption because of incomplete exchange with the added isotope (Andon et al., 1993; Heaney et al., 2005b). This has not been tested for CCM, nevertheless its high solubility suggests that exchange is likely to be complete as long as the isotope form is also soluble. For example, CaCl2 (the common commercial form for radiocalcium tracers) is highly soluble, while CaCO3 (the common commercial form of stable Ca tracers) is not. While not a definitive test, the data from Smith et al. (1987) provide some confidence that extrinsic labeling of CCM yields similar results as intrinsic labeling (i.e., similar fractional absorption was measured for intrinsically labeled CCM tablets versus extrinsically labeled CCM OJ; 37.3% vs 38.3%).

3. Supplemental Ca source and form Supplemental Ca is available from a wide variety of sources and the same type of Ca can be delivered in different forms (e.g., swallowable or chewable tablet, different ratios of components). In terms of substances used to chelate minerals, malate and citrate are considered to be among the best absorbed (Anonymous, 2007). They are easily ionized which enhances the absorption of minerals to which they are bound by increasing the amount of ionized minerals in the intestinal tract. Citrate and malate anions are absorbed in the upper digestive tract (Demigne et al., 2004). Other substances used in this capacity and which facilitate mineral absorption include ethanolamine phosphate, ascorbate, fumarate, succinate, lysinate, glycerate, picolinate, and acetate (Anonymous, 2007). In contrast, carbonate and oxides tend to exert a detrimental effect on mineral absorption (Dawson-Hughes et al., 1986; Prather and Miller, 1992; Seligman et al., 1983). The source and physical form of Ca, whether it be in a supplement or added to foods, has been shown to significantly influence absorption efficiency and bioavailability in both humans and animals. Miller et al. (1989) tested Ca absorption from CCM using single and double stable isotope techniques. Six healthy Caucasian children (three boys and three girls) ranging in age from 11 to 17 years participated in a study to determine whether a single serum sample can provide an accurate estimate of Ca absorption. The stable isotopes 44Ca and 42Ca were quantified in serum and urine. A comparison of the Ca absorption data also was made with a previous study involving the same subjects (Miller et al., 1988). After an overnight fast the children received a standardized breakfast plus three chewable tablets comprising 215 mg Ca from CCM

260

Susan Reinwald et al.

(6:2:3 molar ratio) that had been enriched via intrinsic labeling with 35 mg 44 Ca to provide a total Ca load of 250 mg. Exactly 30 min after the oral dose of Ca, a 10 ml intravenous injection of 42Ca tracer was administered. A 24-h urine sample and 90, 120, 150, 180, and 500-min incremental blood samples were collected for tracer determinations. Average (SD) Ca absorption estimated from the ratio of urinary tracers was 41.4  8.2%. Serum 44Ca, measured 150 min after the oral dose of Ca, correlated significantly with Ca absorption based on urinary tracer determination (r ¼ 0.85, p < .05). A paired comparison with the same subjects (in a previous study) showed that mean (SEM) Ca absorption (%) from a chewable tablet comprising CCM of 6:2:3 molar ratio (41.4  8.2%) was similar to a nonchewable tablet comprising CCM of molar ratio 5:1:1 (39.5  10.6%), and that Ca absorption from a CaCO3 tablet was lower than both CCM tablets (26.7  7.8%) (Figure 6.2). The chewable and nonchewable CCM supplement tablets were better absorbed than the tablets formulated with CaCO3 (p ¼ .047 and p ¼ .094, respectively). In another study, the difference in fractional absorption between Ca from CCM and CaCO3 was tested in 12 healthy adolescents (6 males and 6 females) aged 10–17 years using a 2-period crossover design (Miller et al., 1988). The average (SEM) dietary Ca intake based on a food frequency questionnaire was 600.4  65.7 mg/day. The order of Ca supplementation for groups was randomized and for each treatment two tablets were ingested with a standardized breakfast. Each tablet contained 60

Calcium absorption (%)

50

*

**

CCM

CCM

40 30 20 10

CaCO3

0 Molar ratio 5:1:1 Molar ratio 6:2:3 (swallowable) (chewable)

FIGURE 6.2 Data are the mean (SEM) for absorption of various Ca salts in children (n ¼ 6; three males and three females) based on a study by Miller et al. (1989). *p ¼ .094, **p ¼ .047.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

261

114.6 mg elemental Ca (enriched with 10.4 mg 44Ca), either as CaCO3 or 5:1:1 molar ratio CCM (250 mg Ca total dose). Exactly 30 min after tablet ingestion subjects were intravenously injected with 3.6 mg 42Ca. Ca absorption was estimated using high resolution fast-atom-bombardment mass spectrometry to quantify 42Ca and 44Ca relative to 40Ca in urine samples before and 24 h after tracer administration. Fractional absorption of Ca from CCM (mean  SEM: 36.2  2.7%) was significantly higher (p < .03) than from CaCO3 (26.4  2.2%), representing a 37% improvement in Ca absorption from CCM. Andon (2003) compared five different CCM formulations covering a threefold range of Ca:citrate:malate molar ratios from 154 previous studies in humans. Intrinsically labeled tablets or juices comprising 250 mg Ca as CCM were tested in adolescents and groups of women 20 to 30-years and 40 to 77-years old. A comparison of mean values for age groups, molar ratios, and vehicles revealed no differences. Comparison with reported values in the literature, after adjustment to equalize Ca doses and indexing versus a standard (i.e., milk ¼ 100), revealed Ca absorption from CCM consistently exceeded absorption from other sources including milk, various dairy products, fortified foods, and Ca supplements.

4. Food/beverage matrices Different foods and beverages vary in their compositional matrices, a factor known to affect the absorption of the same Ca salt from different sources. For instance, CCM added to beverages does not result in an equivalent across-the-board percent absorption of Ca. Rather, Ca absorption from CCM tends to be higher when added to apple juice than when added to OJ (Andon et al., 1996b), and both of these juice vehicles supply a more absorbable source of Ca than can be obtained from fortification of lemon juice with CCM (Mehansho et al., 1989b). Heaney and others maintain that fractional Ca absorption values for most of the Ca salts commonly used to fortify foods or formulated as supplements are similar to absorption values from milk, with the exception of CCM which is slightly higher (Heaney et al., 1990a; Weaver et al., 1999). A comparison of Ca-fortified food sources with the highly ranked natural sources of absorbable Ca found in milk and yogurt (based on a 1 cup serving and an equivalent 300 mg Ca content) exemplifies the relative potential value of CCM-fortified foods in terms of estimated absorption efficiency (%) and absorbability (mg) per serving (Figure 6.3; Braun and Weaver, 2006; Weaver et al., 1999). In the same food/beverage matrices, the Ca source used for fortification of the system can significantly influence the amount of Ca that is bioavailable. A product’s label generally states the amount of Ca added to a fortified product; however, this is not always a good indicator of what the consumer can expect to be absorbed or bioavailable following

262

Susan Reinwald et al.

180

60

160 Absorbable Ca per serve (mg)

120

40

100 30 80 20

60 40

10

Estimated absorption efficiency (%)

50 140

20 0

0

Milk

Yogurt

Orange juice with CCM

Fruit punch with CCM Soy milk with tricalcium phosphate

FIGURE 6.3 Graph compares the absorption characteristics of naturally Ca-rich foods with beverages that have been fortified with CCM. The left axis indicates the absorbable Ca per serve and the right axis shows the corresponding absorption efficiency estimated for each product.

consumption. This point was clearly demonstrated in a randomized crossover pharmacokinetic study of 25 healthy premenopausal women between the ages of 21 and 43 years that consumed a 500 mg Ca load from CCM versus tricalcium phosphate/Ca lactate (TCP/CL) (Heaney et al., 2005b). Each Ca source was delivered in an OJ vehicle at the midpoint of a light breakfast, that itself was low in Ca. The participants were tested three times, twice with one fortification source and once with the other in a random sequence. Care was taken to synchronize test periods with menstrual period stage by testing 29  3 days apart. The AUC of serum Ca plotted against time through 9-h postdosing (AUC0–9 h) was assessed to determine the serum Ca increment above baseline after the test load. Net absorbed Ca, calculated from AUC(9-h), was 48% greater for CCM versus TCP/CL (p < .001) and the mean (SEM) amount of Ca absorbed was 148  9.0 mg versus 100  8.9 mg, respectively. The less sensitive pharmacokinetic method of measuring Ca bioavailability was used for this study rather than the more sensitive isotopic tracer method, which requires a market-ready product be extrinsically labeled and the

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

263

isotopic tracer uniformly equilibrated between phases for accurate results. Tricalcium phosphate is an insoluble Ca source that exists in the juice in particulate form, which impedes uniform exchange of Ca isotope between the solution and dispersed particulate phases and precludes the use of extrinsic labeling for estimating bioavailability. Heaney has advocated that manufacturers be encouraged to disclose bioavailability information to consumers that may naively presume bioequivalence of Ca sources in fortified products (Anonymous, 2002; Heaney, 2001b). To compare fractional absorption of Ca from two CCM-fortified juices in humans, a study was designed for two groups of n ¼ 57 women (mean ages: 56 and 58 years) that were administered 5 mCi 45Ca with 250 mg of 40 Ca as CCM in either OJ or apple juice (Andon et al., 1996b). Including both endogenous and added citric and malic acids, the CCM molar ratios were 1.0:0.7:1.3 (equivalent to 6:4.2:7.8) and 1.0:1.8:1.5 (equivalent to 6:10.8:9), respectively. An overnight fast and low-Ca breakfast pretreatment was followed by a 5-h postdose specific activity test of serum. The mean (SEM) fractional absorption of Ca delivered orally was observed to be significantly higher (p < .003) for CCM-AJ (42  2%) versus CCM-OJ (36  1%). This study was not a crossover design whereby uncharacteristic individual differences, if they existed, could be nullified. The method employed is most reliable when used in a crossover design to compare relative bioavailability. Two recent studies (Griffin et al., 2002, 2003) measured the Ca absorption from fortified OJ in adolescent girls age 10–15 years. For a 3-week period, the girls consumed a daily diet providing
1500 mg Ca/day, which included two servings per day of CCM-fortified OJ supplying 700 mg Ca/day as CCM (personal communication). At the end of the 3-week adaptation period, fractional Ca absorption was measured utilizing a double-isotope method involving extrinsic labeling of the juice with 46 Ca as CaCO3 and a 42Ca intravenous tracer. The labeled juice was consumed with breakfast following an overnight fast and with dinner. Fractional Ca absorption was estimated from the ratio of the two isotopes excreted in a 48-h complete urine collection. Three study cohorts were tested, two in Houston, TX (n ¼ 30 and 29, respectively) and one in Omaha, NE (n ¼ 25). Ca absorption from the CCM-fortified OJ was consistently high in all three cohorts [mean (SD): 31.8  10.0%, 32.3  9.8%, and 33.6  9.4%, respectively]. These studies are important to highlight because they demonstrate high Ca bioavailability from CCM even when the daily Ca intake exceeds the current AI for adolescents (1300 mg/day) and, perhaps more importantly, after a 3-week adaptation period. The primary objective of these studies was not to specifically measure bioavailability of Ca from CCM, rather it was to assess the effect of nondigestible, fermentable, oligosaccharides such as inulin and fructooligosaccharide (FOS), on Ca absorption in girls at or near menarche.

264

Susan Reinwald et al.

On this point, the findings were mixed, as a significant increase in fractional Ca absorption (p < .01) resulting from consumption of 8 g/day of a blend of inulin and FOS was measured in the Houston cohort; however, no significant effect was observed in the Omaha cohort. No gastrointestinal issues associated with the use of inulin were reported for these studies.

5. Age and life stage A host of factors that are age related serve to impair Ca absorption as we get older. Compared to healthy young adults, healthy older men and women absorb Ca less efficiently as they age (Gallagher et al., 1979; Ireland and Fordtran, 1973; Scopacasa et al., 2004). This predisposition in the elderly is thought to be at least partly attributable to Ca absorption being dependent on adequate vitamin D levels to hinder PTH stimulation and hyperparathyroidism. Vitamin D is necessary for the active transport of Ca across the intestinal mucosa (Heaney, 2003c), and Ca absorption efficiency has been shown to improve when the precursor molecule to bioactive vitamin D, 25(OH)D (i.e., calcidiol) is at the higher end of the reference range in postmenopausal women (Heaney et al., 2003). However, no direct relationship between serum 25(OH)D and Ca absorption was observed in young adolescents (Abrams et al., 2005b). Age has been shown to adversely affect 1,25(OH)2D3 serum levels in men (Agnusdei et al., 1998) and intestinal responsiveness to 1,25(OH)2D3 (Ebeling et al., 1992; Pattanaungkul et al., 2000) in women, both of which reduce Ca absorption. Exposure of the skin to sunlight, which is required for in vivo vitamin D synthesis, is generally less frequent and efficient in the elderly who are more likely to be housebound or institutionalized (Kinyamu et al., 1997). Although studies focusing on Ca absorption efficiency in relation to CCM and vitamin D are currently lacking, CCM in combination with vitamin D has been shown to be effective in terms of averting the typical seasonal (wintertime) increase in PTH in women residing in northern latitudes. This dietary combination is also linked to a reduction in fracture risk in older men and women. Longitudinal data on Ca absorption, collected over the course of 17 years in middle-aged women as they transitioned to menopause, reveals the negative correlation that exists between estrogen status and Ca absorption efficiency over time (Heaney et al., 1989a). Heaney and colleagues established that the reduction in estrogen levels after menopause, together with the natural decrease in Ca absorption attributable to aging, accounts for an approximate 20–25% decline in absorptive potential in women from age 40 to 60 years. As previously discussed, CCM has been shown to be a highly absorbable Ca source in postmenopausal women when administered in fruit juices (Andon et al., 1996b).

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

265

Martini and Wood (2002) tested the bioavailability of 3 different sources of Ca in 12 healthy elderly subjects (9 women and 3 men of mean  SEM age: 70  3 and 76  6 years, respectively) in a 6-week crossover trial conducted in a Human Study Unit. Each Ca source supplied 1000 mg Ca/day and was ingested for 1 week with meals (as 500 mg Ca 2x/day), thus contributing to a high-Ca intake (1300 mg Ca/day). A low-Ca intake (300 mg Ca/day strictly from the basal diet) was adhered to for 1 week in-between each treatment. The Ca sources included skim milk, CCM-fortified OJ, and a dietary supplement of CaCO3. Assessment parameters were indirect measures predicted to reflect the relative bioavailability of Ca postprandially via an acute PTH suppression test (hourly for 4 h). Longer-term responses to Ca supplementation were assessed via a number of urinary and serum hormone, mineral, and bone resorption biomarkers (i.e., vitamin D, Ca, phosphorus, and collagen type 1 N-telopeptide cross-links). The postprandial PTH suppression tests revealed no significant difference among Ca sources or Ca-responsive measures over 1 week in response to the three Ca sources. Conversely, high-Ca versus low-Ca diets were significantly different for a number of parameters, which inexplicably did not include serum Ca. Based on their results, the investigators of this study inferred that the three Ca sources tested were equivalent in terms of Ca bioavailability. These data subsequently aroused some criticism (Heaney, 2003b). It was pointed out that, peculiarly, serum Ca measurements did not distinguish absorptive calcemia in response to the oral Ca loads that contributed to suppression of PTH in serum and the increase in urinary Ca 4-h postprandially. One key factor of many that could obscure a demarcation in response to different Ca sources in the elderly is consumption of the Ca test load in conjunction with a more complex test meal than is typically served under assessment conditions. In general, humans tend to absorb less soluble sources of Ca, such as CaCO3, less efficiently than more highly soluble forms, such as CCM, on an empty stomach (Heaney et al., 1989b) or in the absence of sufficient food. In the presence of adequate or more complex foods, gastric emptying is slowed (Hunt, 1980) and Ca absorption and bioavailability may not be appreciably different among Ca sources due to prolonged gastric emptying (Song et al., 2001) and/or slowing of intestinal motility. Citric acid, a component used in the formulation of CCM, has also been shown to delay gastric emptying in fasted volunteers administered freeze-dried Ca in the form of Ca alginate beads (Stops et al., 2006). The prevalence of hypo- and achlorhydria is high in the elderly population (Bo-Linn et al., 1984). Furthermore, sufficient food consumption in the elderly is not always possible and in some situations potent gastric antisecretory medications may be prescribed for long-term use in older people (Bo-Linn et al., 1984; Evenepoel, 2001). A source of Ca that is more

266

Susan Reinwald et al.

likely to be absorbed and made bioavailable under a wider range of conditions may, under such circumstances, be preferable to Ca sources dependent upon food intake and sufficient gastric acid secretions for adequate absorption. CCM delivers highly absorbable Ca in the presence or absence of food and may be among the best choices as a supplemental Ca source, particularly for elderly populations.

6. Intrinsic conditions Ca salts differ from one another in terms of the anions and molecules that they are associated with. CCM’s characteristic aqueous solubility is directly related to the citrate and malate anions. The in vitro solubility of any Ca salt is essentially constant under standard conditions (e.g., at neutral pH in water). Once a Ca source is consumed, it encounters a host of variable environmental factors, such as pH changes, interactions with other food components, and the hormonal milieu, that alter its solubility and/or potential for absorption. It is the net impact of these internal factors, together with the combination of introduced variables, such as the food matrix in which Ca is incorporated and the timing of Ca intake, that contribute to determining just how beneficial to health a Ca source will be. In vitro solubility characteristics of six Ca salts, namely Ca lactate, Ca phosphate (CaP) (monobasic), Ca citrate, Ca gluconate, CaCO3, and CCM, were compared by Roth-Bassell and Clydesdale (1992). Ca salts (10 mM) in a mineral stock solution were tested under conditions designed to simulate the gastric acid environment of the stomach (pH 2.0 using 1.0 N HCl) followed by the neutral environment of the intestines (pH 7.0, using 1.0 N NaOH). Total Ca, total soluble Ca, and ionic Ca were measured. CCM and Ca citrate formed significantly higher levels of a soluble Ca complex. The Ca from Ca lactate and CaCO3 that did solubilize was entirely in the ionic form. CaP and Ca gluconate was predominantly soluble in the ionic form. Ionic Ca at neutral pH is considered to be reactive and capable of forming insoluble complexes with various intestinal food constituents, a propensity that can alter the potential for Ca absorption. Information pertaining to the statistical analysis for this in vitro experiment was not, for some undisclosed reason, published in the paper. Bench top simulations designed to mimic physiological conditions provide information that has some theoretical merit, although results acquired this way may not truly represent in vivo conditions that are infinitely more complex. It is somewhat counterintuitive to think that the aqueous solubility of a Ca source has little impact on its capacity to be absorbed at the intestinal mucosal surface. However, contrary to conventional wisdom, Heaney et al. (1990a) have demonstrated that solubility plays a limited role with the coingestion of food. Weaver and Liebman (2002) concede that only

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

267

salts at the extreme ends of the solubility spectrum have appreciably different Ca absorption efficiencies. Ca is usually liberated from complex dietary compounds during digestion in the highly acidic milieu of the stomach. Pancreatic and biliary bicarbonate secretion occurs in response to duodenal acidification to neutralize the pH of the stomach chyme entering the intestines. Ca is typically considered to be present in a soluble and/or apparently ionized form (Ca2þ) in the small intestine preceding absorption (Gue´guen and Pointillart, 2000). Nevertheless, it has been demonstrated in vivo that dissociation of a Ca salt, with a low MW, neutral charge, and comparatively lower solubility, is not necessarily a prerequisite for absorption since paracellular diffusion of intact Ca oxalate (MW 128.10) and CaCO3 salts (MW 100.09) can occur (Hanes et al., 1999). Ca chelated to an amino acid (i.e., bisglycinocalcium or Ca bis-glycinate, MW 188.20) has also been shown to be absorbed intact (Heaney et al., 1990a). CCM is a large soluble salt with an MW > 1000 (i.e., MW 1014.90 for the anhydrous form of CCM with a 6:2:3 molar ratio of Ca:citrate:malate), which may be too large to traverse tight paracellular cellular junctions. The overall effect(s) exerted as a consequence of intact Ca salts being absorbed and entering the general circulation or reaching a target organ is uncertain (e.g., Ca oxalate in the kidneys). Citrate and malate anions chelated to Ca in CCM are considered to enhance Ca absorption (Weaver and Liebman, 2002), possibly by forming relatively stable soluble complexes, such that precipitation of Ca by phosphate in the gut is not chemically favored and the likelihood of Ca absorption is improved. Generally, Ca absorption is expected to be enhanced by substances which increase its solubility [e.g., hydrochloric acid (Hardy and Ball, 2005), ascorbic acid, and citric acid].

7. Meal effects The positive effects of a coingested meal on Ca absorption in humans has been demonstrated in two studies by Heaney et al. (1989b). Absorption of Ca (250 mg) both with and without a neutral test meal was assessed in 20to 30-year-old women. The Ca sources tested were CCM (n ¼ 10 subjects involved in a cross-over, within-subject design) and CaCO3 (n ¼ 26 subjects without a meal and n ¼ 10 with a meal). The double isotope method was employed; 45Ca served as the oral tracer and 47Ca as the intravenous tracer. The meal effect on the mean (SEM) fractional absorption of labeled Ca test loads in women was significant for CCM (p < .01), ranging from 0.2848 (.0300) without a meal to 0.3743 (.0166) with a meal. The overall 31% increase in Ca absorption fraction when CCM was coingested with a meal was due to 9 of the 10 subjects demonstrating increased absorption efficiency. Following CaCO3 ingestion, Ca fractional absorption was 0.246 (.0265) without a meal, and only increased by 20% to 0.296 (.0170) with a meal (p > .05). Variation in the results for CaCO3

268

Susan Reinwald et al.

under nonmeal conditions was widespread in women, ranging from under
.05 to >.50. When consumed with a meal, outcomes narrowed substantially from >.20 to <.40. CCM results were significantly less variable than those for CaCO3 (p < .01). The general enhancing effect of a meal on Ca absorption observed by Heaney (Heaney et al., 1989b) was not detected by Brink and coworkers when a Ca L-lactate salt was ingested by healthy postmenopausal women (Brink et al., 2003). In Brink’s study, subjects were evaluated to determine true Ca absorption via the dual labeling stable isotope technique. Mean (SD) Ca absorption was substantially higher in the absence of a meal (45.0  10.2%), rather than after coingestion of the Ca with an Asian or Western style breakfast (29.7  8.6 and 31.5  9.3%, respectively; p < .0001). The large negative effect of a meal on Ca absorption was attributed to the high fiber content of the breakfasts. No effects of the different food matrices due to the style of breakfasts were observed. Brink also examined Ca absorption from 6 different intrinsically labeled Ca sources (i.e., 200 mg elemental Ca from milk, CaCO3, CCM, tricalcium phosphate, Ca L-lactate, and Ca lactate/gluconate) in 10 postmenopausal women using a randomized 8-way crossover design with a washout period of 7 or 14 days. True Ca absorption (%) after a single oral test load was similar among all Ca sources consumed with a meal, with the exception of tricalcium phosphate which was significantly lower.

8. Interfering substances Various constituents in plant foods can impede Ca absorption. Plantbased diets can be high in oxalate and phytate, which are recognized as inhibitors of Ca absorption. In fact, Ca absorption is considered to be inversely proportional to oxalic acid content of the food (Weaver et al., 1999). Phytic acid poses Ca absorption problems for those species unable to endogenously synthesize phytase (e.g., humans, birds, and pigs). The Ca in CCM is chelated with the citrate and malate anions, which may make CCM less reactive than other sources of Ca toward food components known to interact with Ca2þ cations. For example, Lihono et al. (1997a) reported data suggesting that the Ca in CCM may be less likely to complex with phytates than other Ca salts. On this basis, CCM may be more appropriate for the fortification of soy or other phytic acidcontaining products. Protein has long been classified as a factor that causes Ca to be wastefully excreted from the body. Less is documented in relation to how it affects Ca absorption. Dawson–Hughes has reported that a dietary protein increase of 20% combined with a low Ca intake of
800 mg/day in elderly men and women lowers the amount of absorbable Ca by 23%. In contrast, a high protein diet (between 18.16% and 29.14% of total dietary energy from protein) in the presence of a high Ca intake

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

269

(>1300 mg Ca/day in the form of CCM) plus vitamin D supplementation, increased fractional Ca absorption overall, compensating for the adverse effects of protein on Ca absorption observed in the placebo group consuming inadequate Ca (Dawson-Hughes and Harris, 2002).

9. Various other factors Body size and statural height have a direct effect on the length of the intestinal tract, intestinal transit time, and mucosal mass, all of which impact Ca absorption because they lengthen exposure to absorptive surfaces. A height advantage of 4 inches in women can result in a 30% increase in Ca absorptive potential (Barger-Lux and Heaney, 2005), while smaller increases in Ca absorption attributable to height in young girls have also been observed (i.e., 3–3.5%) (Abrams et al., 2005c). A larger mucosal mass has been shown to be a direct determinant of Ca absorptive transport capacity in rats (Yeh and Aloia, 1984), and the trend is presumed to be similar in humans (Barger-Lux and Heaney, 2005). The general health of the intestinal mucosa (e.g., the absence of inflammatory bowel conditions such as colitis, Crohn’s disease) is also important for maximizing Ca absorption. Certain medications can either directly or indirectly affect Ca absorption, among them corticosteroids and anticonvulsants, respectively. Smoking (Krall and Dawson-Hughes, 1999) and alcohol intake (Wolf et al., 2000), both of which are modifiable behaviors, are also disruptive to Ca absorption efficiency. Fok1 gene polymorphisms of the vitamin D receptor (VDR), which constitutes a genetic rather than a modifiable factor, influences Ca absorption (Abrams et al., 2005a; Ames et al., 1999), as does race, with blacks being better able to absorb Ca as opposed to whites (Abrams et al., 1995). CCM has not been specifically evaluated as the administered Ca source for a number of these additional factors that influence Ca absorption, and more research with CCM is warranted in these areas.

D. Animal studies with CCM A number of studies designed to test the effectiveness of CCM as a Ca source under various conditions have also been performed in various animal models including rats, chicks, pigs, and dogs (Table 6.6). Based on rodent studies, there is evidence to suggest both positive effects and no particular advantage of CCM in terms of absorption and bioavailability relative to other Ca salts. There was no difference in fractional Ca absorption among CCM and four other Ca salts of varying solubilities [i.e., Ca fumarate (CF), Ca malate fumarate (CMF), Ca citrate, CCM, and CaCO3] in rats administered an intrinsically labeled Ca dose via oral gavage after being fasted (Weaver et al., 2002). Forty-eight hours postdose the rats (n ¼ 15/group) were euthanized and the harvested femurs (whole bones)

270

Susan Reinwald et al.

were dissolved and subjected to scintillation counting to determine tissue uptake of 45Ca for each Ca salt. Mean (SEM) values for fractional absorption ranged from 27.42  3.09% for CaCO3 to 30.09  1.02% for CF and were not significantly different. Fractional absorption of Ca from CCM was 28.6  1.58%, which is considerably lower than that determined by other investigators using extrinsic labeling. The accuracy of the later method is highly contingent upon a satisfactory exchange of the isotopic label. Weaver’s results are essentially in agreement with a human study (Brink et al., 2003) in which true fractional absorption of Ca in postmenopausal women was determined not to be different between intrinsically labeled CaCO3 and CCM under meal conditions (mean  SD: 29.9  12.3% vs 29.6  10.6%, respectively); however, food is considered to have a potential equalizing effect on the absorption of Ca salts (Heaney et al., 1989b). Smith et al. (1987) also determined there was no difference between percent retention of powdered sources of CCM and CaCO3 that were labeled with 47Ca while in solution phase and administered via gastric tubing to older rats (35.1  1.6% vs 30.8  2.6%, respectively; p > .05). The lower retention values for this rodent experiment, compared to higher retention values in younger animals, were considered to reflect the Ca absorption decrease expected in older rats due to a larger proportion of the Ca pool being turned over and accounted for by excretion. In contrast to studies suggesting there is no advantage of CCM compared to other less soluble Ca salts in rodents, another five studies indicate that CCM is significantly better absorbed, more bioavailable, clearly influenced by the vehicle in which it is delivered, and/or is associated with health benefits. In animals, as is the case with humans, absorption and bioavailability is influenced by age. Smith’s result of Ca retention equivalence between CCM and CaCO3 in older rats is different to how younger rodents responded (Smith et al., 1987). CCM in OJ was determined to be relatively better absorbed and retained than the Ca in 2% fat milk (mean  SEM retention rates: 51.1  1.7 vs 42.2  1.8%; p < .001), respectively. This result was reproduced when, based on extrinsic labeling, the Ca from CCM in both AJ and OJ was reported to be better absorbed in juvenile rats than was the Ca from milk (p < .05) (Andon et al., 1996b). The efficacy of any Ca source as a food/beverage fortificant is also dependent upon accompanying ingredients and food components. During Andon’s investigation of juice vehicles, it was also determined that the mean (SEM) Ca retention from CCM-AJ was significantly higher than from CCM-OJ in rats (61  2 vs 52  2%, respectively; p < .05) (Andon et al., 1996b). This difference was attributed to the intrinsic profile of organic acids present in the juices in which the molar ratios of Ca: citrate:malate were 1.0:1.8:1.5 in CCM-OJ and 1.0:0.7:1.3 in CCM-AJ, while the respective molar ratios for glucose:fructose were 1:1 and 1:2.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

271

These results indicate that the absorption of CCM as a beverage fortificant is significantly influenced by the chemistry and composition of the delivery vehicle, being optimized by a lower organic acid content and a higher fructose to glucose ratio. To systematically determine the contribution to Ca absorption coming from the organic acids versus the carbohydrates in fruit juices, another group of rats was administered mock juices formulated to mimic the citric and malic acid profile of actual juices, except minus the carbohydrate content (Andon et al., 1996b). The result was that the variation in Ca absorbability in rats consuming CCM-fortified OJ versus AJ test solutions was eliminated, whereas adding back carbohydrates resulted in the mean Ca retention of AJ exceeding that of OJ (p < .002). A subsequent increase in the level of fructose added to CCMfortified mock OJ, equal to that present in the AJ, significantly improved Ca retention from the CCM-OJ test solution (p < .0001) (Andon et al., 1996b). Taken together, these results showed that the organic acids and carbohydrates in CCM fortified juice were essentially equipotent in terms of their capacity to modify Ca absorption. A combination of age, type of Ca salt, and the isotopic labeling method used to assess the effects of various Ca salts are all important factors in the determination of Ca absorption and bioavailability. Therefore, in an entirely separate animal study Andon and colleagues investigated the effect of age (at 2, 4, 5, and 8 months), Ca source (CCM, CaCO3, and hydroxyapatite or HA), and radiolabeling method (intrinsic [int] vs extrinsic [ext] for both CaCO3 and HA) on whole body retention (WBR) of 47Ca in a longitudinal study using growing male rats (Andon et al., 1993). Advancing age was found to be associated with a decrease in percent whole body retention of 47Ca for all Ca sources (at a rate of
3.4%/ week, p < .001), even though gastric acid secretion was determined to be greater in older rats. The relative bioavailability of each Ca salt tested was consistent at all ages (p < .001), and the combined mean (SEM) percent fractional 47Ca retention values (measured from 3 days postdose/baseline at each time point assessed) during aging were summarized (proportional to CCM) as: CCM[int] (100%) > CaCO3 [int] (83  4%) > HAP[int] (57  4%). As previously mentioned, extrinsic radiolabeling is not always as accurate as intrinsic methods, and in this experiment extrinsic tags yielded retention values that were determined to be overestimated in younger animals (
20%) compared to intrinsic measures, although differences due to this factor subsided with advancing age. According to Andon, overstated extrinsic data would have erroneously altered the Ca salt rank order to: CaCO3 [ext] > CCM[ext] > HA[ext] in younger rats. Data from this study indicated that Ca source did in fact influence the extent of Ca absorption, and the results are in agreement with human absorption studies (Miller et al., 1989, 1988). Despite the reasonably good precision of whole body

272

Susan Reinwald et al.

retention studies, in the end they cannot provide mechanisms of action for the results obtained (Weaver and Heaney, 2006c). A Ca salt ingested in the presence of food versus the same salt consumed on an empty stomach will usually be better absorbed with food regardless of the salt’s solubility index. The solubility properties of a specific Ca salt tend to influence just how big the differential is for absorption between the fed and unfed state. The effects of a coingested meal on Ca absorption in animals were demonstrated in a series of six separate rat experiments (Heaney et al., 1989b). After a 16-h fast, rodents received a CCM-fortified juice beverage or a milk drink, each of which was radiolabeled with 47Ca and administered orally in either the absence or presence of food that was tantamount to a meal. Seven days later, fractional Ca retention was assessed via whole body counting. A significant increase (p < .001) in Ca retention attributable to meal effects was evident in all CCM rat experiments using citrus juices as the vehicle, and in one out of two comparisons using milk (p < .10 and p < .001). On average, Ca retention in the absence of food was 42.7% for milk and 48% for CCM in juice. When consumed with a meal, 50.8% of the Ca in milk versus 61.2% of the Ca from CCM in juice was absorbed. It is expected that any Ca-rich beverage consumed in the presence of solid food will be mixed with the food in the stomach and as a result endure a longer transit time through the gastrointestinal tract giving the Ca an extended opportunity to be absorbed. Measurements of Ca absorption and bioavailability are undeniably of great importance; however, in actuality they do not in themselves provide us with a direct measure of the health benefit of a Ca source. Not all Ca that is absorbed, determined to be bioavailable, and/or retained in the body can be presumed to provide a discernible physiological benefit. Physical quantitative endpoints, such as a change in bone parameters, represent an integrated measurement of absorption, bioavailability, utilization, storage, and efficacy. Such all-encompassing assessments may serve to elucidate possible differences among various Ca salts in homogeneous populations (e.g., inbred experimental animals) at times when they are not identified by other investigators focusing strictly on conventional bioavailability measures. To assess the physiological value of one Ca salt versus another, Kochanowski examined bone histomorphometry parameters in young (weanling) growing female rats (n ¼ 14/group) that were fed either marginal (0.3%) or adequate (0.6%) Ca as CCM or CaCO3 for either 4 or 12 weeks (Kochanowski, 1990). Rats are usually weaned around 30 days of age and are growing rapidly by 12-week old. Rats fed 0.6% CCM were heavier than both groups of CaCO3-fed rats at 4 weeks (p < .05) and 8 weeks (p > .05). Ca source did not appear to influence tibia and femur bone fat-free dry weight. The longitudinal bone growth rate for

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

273

rats fed the lowest level of CCM (0.3%) exceeded that of rats fed high amounts of CaCO3 (0.6%) at 4 weeks (170.6 mm/day vs 148.8 mm/day, respectively); however, there were no significant differences by 12 weeks. Differences detected in trabecular bone volume (TBV) attributable to Ca source persisted throughout the study. TBV in the metaphyses of the tibia was 23–25% higher for CCM-fed rats than for CaCO3-fed rats at 4 weeks (p < .05), and 44–47% higher at 12 weeks (p < .05). While cortical bone was not affected by either Ca level or source, the effect of Ca source in trabecular bone was independent of Ca level; this was a finding that the investigators presupposed would only be evident at marginal Ca intakes. On the basis of sensitive histomorphometry analysis, CCM was concluded to be more bioavailable than CaCO3. However, in this instance it may be more appropriate to conclude that the relative ‘‘efficacy’’ of absorbed Ca from CCM was responsible for the protective effect observed via bone parameters. The anions that accompany the Ca in CCM may, for example, improve Ca efficacy in terms of providing a relative cation excess that can protect bone from a predominantly acidic diet (Heaney, 2001b). Only one study assessing the Ca absorption capacity for CCM in dogs has been performed (Andon et al., 1996b). Two year old mature female beagle dogs (n ¼ 6/group) were administered extrinsically labeled CCMfortified orange (CCM-OJ) and CCM-fortified apple juice (CCM-AJ). Based on whole body scintillation counting performed 72-h postdose, Ca retention for CCM-AJ was significantly better than that for CCM-OJ in dogs (29.2% vs 15.1%, respectively; p < .001). The general outcome for dogs was similar to that for rats, with the exception of a much higher percent Ca retention occurring in rats for both fortified beverages than in dogs. Age and developmental stage, considering the rats were still growing and the dogs were already mature, probably contributes to the higher absorption of Ca seen in the rats. The efficacy of CCM has been evaluated in pigs by Pointillart and Gue´guen (1993). The inherently high requirement of growing pigs for Ca was the impetus for comparing the bioavailability of Ca from a diet containing milk (i.e., skim milk powder) with one containing added CCM in 2-month-old crossbred male pigs (two groups of n ¼ 9). The animals were fed a 0.7% Ca-supplemented diet (0.5% Ca from either milk or CCM, and an extra 0.2% Ca from CaCO3 in the basal diet) for a period of 10 weeks which included a 10-day metabolic balance period 2 weeks prior to euthanization. While the diets were matched for energy and protein content, they differed with respect to protein type and in this study the complement of proteins in the milk-based diet appeared to surpass the CCM-based diet as a facilitator of growth rate and feed efficiency. Urinary hydroxyproline, a bone resorption marker, in addition to absorption and retention measures of Ca and phosphorus, were not different between treatments. Bone parameters related to growth

274

Susan Reinwald et al.

rate (i.e., tibia and metatarsal fresh weight and total ash) were significantly higher in the milk group (p < .05 or p < .03); however, after adjusting for body weight, the milk- and CCM-diet exerted similar effects on bone (p > .05). Bone parameters that were not correlated with growth rate were either similar for milk versus CCM (i.e., bending moment, stress, ash percentage) or significantly higher for the CCM diet [i.e., apparent density (g/cm3) and stress (N/mm2) p < .05]. It was concluded that Ca absorption from CCM was essentially equivalent to that of milk, with the differences related to growth being attributed to the higher protein efficiency of the milk-based diet. An important factor appears to have been overlooked in Pointillart’s study concerning the different grain sources used for the milk diet (37% barley, 24% corn) versus the CCM diet (29% wheat, 25% corn, 13% soy meal) in the attempt to achieve equivalence in terms of energy, amount of protein, crude fiber, fat, and vitamins. Each of these grains contains a variable concentration of phytic acid/phytates in addition to phosphorusrich compounds known to inhibit Ca absorption and account for up to 70% of the total phosphorus content in the diet of an animal (Brumm, 2000). However, the phosphate in phytate is largely indigestible and unavailable for the maintenance of optimal bone status. This is a documented problem in swine (Spencer et al., 2000) that unlike rodents (Lihono et al., 1997b; Mason et al., 1993) do not typically exhibit the required intestinal phytase activity to effectively hydrolyze phytate (Veum et al., 2002). Low-phytase cultivars and phytase-treated grain sources can be fed to livestock; however, this issue was not addressed in the results of this study, aside from an acknowledgment that phosphorus levels in the two diets were not equivalent. Interestingly, organic acids such as citric acid and its salt improve phytate-phosphorus utilization in swine (Boling et al., 2000). The presence of CCM in the gut could also be speculated to interfere with phytate-Ca associations. Nevertheless, different grain compositions of diets containing variable phytate concentrations are confounding, with or without being treated for phytase, and for this reason the results of Pointillart’s study may have been biased to a certain extent. CCM is considered to ameliorate the interfering effect of phytates consumed by animals, and as a result enhance Ca absorption and bioavailability. A study in chicks by Lihono et al. (1997a) directly investigated this possibility in food derived from soy beans. The effects of microbially derived phytase enzyme treatments on the bioavailability of Ca from soybased foods fed to young male broiler chickens were examined in two separate experiments. In experiment one, the effect of phytase was tested when day-old chicks were fed corn/soybean-meal-based diets, with or without
0.12% added phytase, that also included Ca from CCM (at levels 0%, 0.1%, 0.2%, and 0.3% to provide total Ca of 0.45%, 0.55%, 0.65%, and 0.75%, respectively) or Ca from CaCO3 (at the 1% level, which

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

275

included Ca from the basal diet) for a total of 17 days. For experiment two, chicks were fed diets that included spray-dried soymilk that had been incubated with microbial phytase prior to hydrothermal cooking. The diets also contained Ca from CCM (at levels 0.31%, 0.46%, 0.61%) or Ca from CaCO3 (at the 0.76% level). Results revealed that phytase had no effect on weight gain, feed intake, tibia/body weight, ash%, and ash Ca% when CCM was added to the corn/soy meal diet or the hydrothermally cooked soymilk diet (p < .17). However, the same two diets with CaCO3 as the Ca source, but without phytase, reduced the mean weight gain, feed intake, tibia/body weight, and ash % compared to the CaCO3 supplemented diets with phytase added (p < .05). The Ca delivered as CCM appeared to be less prone to Ca:phytate complex formation and was the more effective Ca fortificant when compared to CaCO3. Young boiler chicks were also the animal model used by Henry and Pesti (2002) in an experiment related to the effect of CCM on bone development versus commercial-grade limestone (i.e., CaCO3). Both Ca sources at 0.7% and 0.9% resulted in no differences for measures of dry fat-free tibia, tibia weight, tibia ash, or tibia Ca content. However, CCMfed chicks up to the time they were 18 days old gained more weight and had better feed conversion ratios than CaCO3-fed chicks. Diets comprising 0.50%, 0.55%, 0.60%, 0.65%, or 0.70% of Ca as CCM or limestone, each with added dicalcium phosphate (DCP), were also fed to chicks. A positive effect of CCM versus limestone as a Ca source was observed in relation to weight gain during growth (p < .022), dry fat-free tibia weight (p < .0002), tibia ash (p < .023), and tibia Ca (p < .0001) in CCM-fed chicks. The level of CCM was only significant for tibia ash (p < .047). Furthermore, the incidence of tibia dyschondroplasia (TD) was also reduced with CCM þ DCP administration compared to limestone in male chicks. Notwithstanding species differences, Henry’s results in this instance are very similar to those of Kochanowski’s rodent experiment in which more robust growth was associated with CCM in young growing animals (Kochanowski, 1990). While CCM was considered a good source of Ca for growing chicks, the seemingly positive effect of CCM was attributed more to the inadequacy of limestone as a Ca source rather than remarkable increases in Ca bioavailability from CCM. Nevertheless, it should also be considered that the anions present in CCM may exert positive effects in and of themselves considering they are Krebs cycle intermediates and required by the body for energy production. For example, only relatively small amounts of exogenous malate are required to increase mitochondrial oxidative phosphorylation and adenosine triphosphate (ATP) production (Abraham and Flechas, 1992) to generate increased amounts of potential energy in vivo. If this energy is tapped for the purposes of growth and development or tissue repair, it may be a contributing

276

Susan Reinwald et al.

factor to the improved growth observed in animals following CCM supplementation. Effective absorption and bioavailability are extremely important if significant health benefits are to be derived from supplemental sources of Ca. Both human studies and animal experiments confirm that CCM performs extremely well in terms of providing Ca that is overall reliably and consistently absorbed, easily administered, and suitable for use under a wide range of conditions. When considering only published data from human studies, CCM has been shown to be highly absorbable when administered to both children and adults, in both tablet and beverage form, in doses ranging from acute (200 mg Ca) to chronic (700 mg Ca/day) and for compositions that cover a broad range of Ca:citrate: malate molar ratios from 5:1:1 (equivalent to 6:1.2:1.2) to 1.0:1.8:1.5 (equivalent to 6:10.8:9). To provide some perspective, the CCM in commercially available CCM-fortified OJ has a molar ratio of
6:9:5 including both the endogenous and added citric and malic acids (unpublished data), a molar ratio that falls within the aforementioned range of compositions that have been tested and shown to be highly bioavailable.

V. STUDIES OF Ca RETENTION AND BONE BUILDING IN CHILDREN AND ADOLESCENTS Adequate Ca must be consumed, absorbed, and effectively retained in the skeleton to build strong healthy bones during childhood and adolescence. Achieving the highest percentage of one’s genetic potential for bone mass by the end of the skeletal maturation period is considered an important determinant of fracture risk as a result of osteoporosis later in life (Bonjour et al., 1994). The retention of Ca in bone is constantly under strong homeostatic control via regulation by genetics, calciotropic hormones, and weight bearing exercise (Standing Committee of the Scientific Evaluation of Dietary Reference Intakes, Food and Nutrition Board, and Institute of Medicine, 1997). During youth, an increase in intestinal net Ca absorption efficiency also acts to facilitate the phase of continuous net Ca retention that drives the accrual of bone mineral (Loud and Gordon, 2006; Manz and Schoenau, 2002). Hormone-dependent changes during this time trigger a growth spurt resulting in a drastic increase in bone size and mass which requires a proportional amount of Ca. Regularly drinking milk with meals is currently the exception rather than the norm (Weaver, 2006); over the past few decades, advertising of nondairy Ca-poor beverages and foods has affected mealtime choices (French et al., 2001). This is especially true for American adolescents, a substantial proportion of whom are at risk for low total Ca retention because they habitually replace the consumption of traditional Ca-rich foods with more

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

277

visually appealing and psychologically motivated beverage choices. In fact, by the 1990s it was determined that adolescent girls and boys consumed twice as much soft drinks as milk, with intakes reaching 44 gallons of soft drink per capita in 1997 (Lytle and Kubik, 2003). Public policy suggests dairy as the first choice for meeting Ca recommendations because of the package of nutrients contained in milk that support bone growth (DRIs, Surgeon General’s Report, and Dietary Guidelines). For those who do not consume adequate dairy products to achieve their recommended intake of Ca, there is a role for the intake of Ca supplements and various Ca-fortified foods and beverages, especially during the period of exponentially high bone mass accretion. In 1994, Andon reviewed the available evidence pertaining to Ca supplementation with CCM in trials conducted during childhood and adolescence. He made the observation that Ca requirements at the time were based on the premise that Ca absorption is highly efficient in youth. Considering many conditions and factors can negatively affect the skeleton (Loud and Gordon, 2006), Andon contended high absorptive efficiency during youth may not necessarily hold true for all populations studied (Andon et al., 1994). Furthermore, the point was made that recommendations for Ca intake were also based on Ca absorption estimates of 40% in populations in which it was assumed skeletal Ca accretion was optimal with respect to bone mass. While CCM provides Ca that is generally recognized as being well absorbed (Liebman, 1998), it can and has been argued that this is not the case for all Ca sources. Updating Andon’s concerns to represent the same issues he raised in the 1990s, according to the current (2007) established AI for children and adolescents between 9 and 18 years, an intake of 1300 mg Ca /day that is 36–40% absorbable would provide
468–520 mg of available Ca/day at a time when Ca accretion can reach levels as high as
500 mg/day or more with optimal intakes. A meta-analysis of pooled Ca balance studies during late childhood and adolescence determined mean Ca absorption from various sources did not typically exceed 30% (Matkovic and Heaney, 1992), which only translates to
390 mg of available Ca/day during this important period of growth and development. Male adolescents (aged 11–14 years) participating in a Spanish study designed to determine dietary mean (SD) Ca utilization, absorbed up to 31% of dietary Ca (i.e., 271.7  51.7 mg/day) and only retained
20% (i.e., 170.6  50.9 mg/day) of the total Ca intake which was 881.7  39.9 mg/day (Seiquer et al., 2006). The amount of Ca required for optimal Ca retention and bone mass accumulation during childhood and adolescence may, in part, depend on the Ca source. Ca intake recommendations may need to be revised upwards to account for less absorbable Ca sources in order for young adolescents to reach peak bone mass. CCM as a supplementary Ca source for children and adolescents during this critical window for bone accretion is featured

278

Susan Reinwald et al.

in the following review of balance studies, and short- and long-term bone density studies that are currently available.

A. Ca balance studies Ca retention can be determined by measuring the retention of an orally administered isotope (e.g., 47Ca) by means of a whole-body gamma counter (Shipp et al., 1987), although radiation issues may arise when the study population is young. Using excreta-recovery methods, retention is generally calculated as Ca intake fecal Ca urinary Ca (Zafar et al., 2004), although sometimes sweat losses are also factored in. Balance studies can also be used to determine Ca requirements based on determination of the maximal Ca intake at which Ca retention improves before a threshold is reached, above which Ca intake is not the limiting factor (Weaver et al., 2004). Data that identifies the optimal Ca intake for maximal Ca retention in adolescent boys was unavailable until 2006 when Braun and colleagues published the results of a rigorous 3-week metabolic balance study with a crossover design in which 31 boys aged 12–15 years were randomly assigned to Ca intakes ranging from 700 to 2100 mg/day (Braun et al., 2006). During the study, the boys resided under observation and strictly controlled conditions in a campus environment and their Ca intake was adjusted at meal times via the inclusion of beverages fortified with various amounts of Ca as CCM. Following a 1-week equilibration period, subjects were randomized to one of five ‘‘low-level’’ dietary Ca intakes (ranging between 693  68 and 1081  70 mg Ca/day) which was consumed by each participant for 2 weeks. A washout period ensued (2 weeks), followed by another equilibration period (1 week) before Ca intakes were increased to one of five correspondingly ‘‘higher-levels’’ (ranging between 1176  67 and 1986  71 mg Ca/day) for the final 2 weeks. Maximal Ca retention as a function of Ca intake (i.e., based on dietary Ca intake minus Ca excreted via the urine and feces) was determined using a nonlinear regression model and compared against previous data collected from 35 girls of similar sexual maturity that participated in an identically designed study by the same investigators. The lowest mean Ca intake that resulted in the maximal accretion of 628.9 mg Ca/day in boys was 1140 mg Ca/day. Ca retention in boys was 171  38 mg/day higher than that for girls; however, the average Ca intake that maximized Ca retention in the skeletons of girls was not different to that of boys, despite males generally being larger in size and exhibiting a greater skeletal mass. Ca retention curves for boys and girls displayed an approximate parallel trajectory, with boys exceeding girls at all intakes due to more efficient Ca absorption and lower urinary Ca excretion.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

279

The relationship between Ca retention and dietary Ca intake in 21 healthy adolescent girls aged 12–15 years was assessed by Jackman et al. (1997). Two 21-day Ca balance studies were carried out while subjects resided in housing at a university campus. Each study comprised a 7-day equilibration phase and a 14-day test period. A crossover design was employed and a 14-day washout period separated the two 21-day periods. Ca intakes were controlled so that they ranged from 841 to 2173 mg/day. This enabled the investigators to determine whether Ca retention actually plateaus due to an upper threshold effect. In order to balance the study, each subject was stratified to a group according to baseline measurements known to impact Ca retention (e.g., BMI, postmenarcheal age). A basal diet containing
800 mg Ca/day, mostly from dairy products, was prepared; it also included a beverage fortified with various added amounts of Ca in the form of CCM so that one of four ‘‘low,’’ or one of four relatively ‘‘high’’ amounts of supplemental Ca could be randomly administered to subjects during each test period of the trial. Ca retention was measured by subtracting the total Ca in excreta from total Ca intake. Results from another similar study in which Ca retention in age-matched girls was tested at 1332 mg/day were also added to the data pool during analysis (Weaver et al., 1995). Mean maximal Ca retention was 473 mg/day (95% CI: 245, 701 mg/day), and the minimal Ca intake required to achieve it was 1300 mg/day. For Ca intakes >2 g/day, retention continued to improve. At the 1300 mg Ca/day intake level, maximal Ca retention was observed to decrease with postmenarcheal age. Using a nonlinear regression model, Ca intake explained 79% of the variation in fecal Ca excretion, and only 6% of the variation in urinary Ca excretion as measured by atomic-absorption spectrophotometry. Kinetic studies provide additional information over balance studies as various parameters of Ca metabolism such as absorption and bone formation and resorption rates can be elucidated concurrently (Weaver et al., 2004). The mechanisms by which a high Ca intake (mean  SD: 1896  48 mg/day), versus a low Ca intake (848  80 mg/day), increases Ca retention in adolescent girls was investigated in a randomized, crossover study utilizing Ca tracers and kinetic modeling (Wastney et al., 2000). Changes in bone turnover biomarkers were also monitored to provide circumstantial validation of the kinetic changes detected. The subjects included n ¼ 10 healthy white adolescent girls ranging in age from 11 to 14 years old (mean  SD: 12  1 year) and on average >9-month postmenarcheal (range: 12-month premenarcheal to 32-month postmenarcheal) that had been spontaneously consuming 800 mg Ca/day. Each study arm comprised a 7-day adaptation period to the designated Ca intake and a 14-day metabolic study period. The latter was initiated by administering an oral dose of 44Ca as CaCO3 to subjects followed 1 h afterward by an intravenous dose of 42Ca as CaCl2; all excreta

280

Susan Reinwald et al.

(urine and feces) and periodic blood samples were collected thereafter. Each arm of the study was separated by a 1-month washout period. High Ca intakes were attained by supplying CCM-fortified fruit-flavored beverages. Collected samples were analyzed by atomic absorption spectroscopy to determine Ca levels and isotope ratios were ascertained by fast atom bombardment mass spectrophotometry. Tracer data from serum, feces, and urine were fitted to a three-compartmental model. A high versus a low Ca intake in Wastney’s study resulted in a respective increase in the amount of Ca absorbed (mean  SD: 19.6  7.5 vs 8.0  2.5 mmol/day; p < .05), urinary Ca excreted (2.8  1.7 vs 2.1  1.1 mmol/day; p < .001), fecal Ca excreted (26.4  12.1 vs 12.6  5.51 mmol/day; p < .05), and bone Ca retained (14.5  8.9 vs 3.24  3.59 mmol/day; p < .001). Fractional absorption of Ca did not change with higher Ca intakes during the pubertal growth stage of these girls. The constant Ca absorption efficiency suggests that the range of Ca intakes studied were all above the saturation intake for active Ca absorption when passive Ca absorption is dominant. Of the Ca absorbed, the percentage retained on the high intake was 74% compared to 40% on the low intake, and Ca retention was highest in girls within 6 months of menarche and lowest in subjects >10-month premenarcheal and >20month postmenarcheal. In agreement with the kinetic data, Ca deposition in bone was not determined to be different between the two intakes based on bone formation markers. The changes in urinary bone resorption biomarkers normalized for creatinine (NTX:Cr, PYR:Cr, DPX:Cr) were somewhat variable and ranged from 11% to 23%. A marked reduction in the collagen degradation product hydroxyproline ( 23%) was the only biochemical indicator of a significant suppressive effect on bone resorption pertaining to a higher Ca intake (p < .05), whereas kinetic data showed that the additional Ca supplied as CCM resulted in a 32% decrease in bone resorption compared to the low Ca intake. The data from this study showed that high Ca intakes due to CCM fortification of beverages can profoundly decrease bone resorption and increase Ca retention in the bones of adolescent girls, particularly around the time of menarche when Ca absorption appears to be more efficient.

B. Bone density studies (2–3 years) Bone mineral density (BMD) measured using dual x-ray absorptiometry (DEXA) is the current standard method by which to assess BMD in children and adolescents (Loud and Gordon, 2006). It has some limitations in that it only measures bone in two dimensions (g/cm2) and by utilizing the projected area for areal measurements does not account for bone volume or distance of the subject from the beam [i.e., surrounding tissue mass and (re)positioning]. Moreover, the continuous changes in

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

281

bone shape and size commensurate with growth during adolescence serve to complicate the interpretation of BMD (Loud and Gordon, 2006). The gold standard non-invasive three-dimensional (g/cm3) method by which to evaluate bone is via quantitative computed tomography (QCT); however, this technology is used sparingly in young children due to the associated radiation dose (Loud and Gordon, 2006). To date, more shortrather than longer-term Ca intervention bone density studies have been completed in adolescents. The most rapid increases in bone mass occur in girls between 11 and 14 years of age. From this time, until approximately age 20, between 40% and 50% of adult bone mass is accrued (Lloyd et al., 1996). Considering the average Ca intake of adolescent girls is typically well below recommended intakes [i.e., not more than 66% of the AI according to 1999–2000 survey data (Wright et al., 2003)], the effect of Ca supplementation on various bone parameters in 112 healthy Caucasian girls (mean  SD age: 11.9  0.5 year) was investigated in a 2-year double-blind, placebo-controlled trial (Lloyd et al., 1996). A stratified randomization was used to balance groups with respect to natural differences in body mass index (BMI) and initial bone density. The girls consumed their normal diet, which provided 960 mg dietary Ca/day. They were assigned to either the supplemented group, that received two 250 mg Ca tablets per day in the form of CCM, or the placebo group that received two inert microcrystalline cellulose tablets. Total body and region-of-interest bone parameters were measured using DEXA at baseline and at 18 and 24 months to determine percent change. Nutrition, anthropometric, and pubertal stage assessments, as well as clinical chemistry measures including urinary Ca, hormone and gonadotropin concentrations were also performed. Over the course of the trial, 21 girls dropped out of the study, although each group was similarly affected in terms of reduced subject numbers (n ¼ 11 Ca vs n ¼ 10 placebo). With compliance in the Ca group at 71%, the average amount of supplemental Ca ingested daily was 360 mg. At 18 months, the Ca supplemented group compared to the placebo group gained more total body bone mass (TB-BMD: 9.6% vs 8.3%; p < .05) and increased lumbar spine bone mass (LS-BMD: 18.7% vs 15.8%; p < .03) (Lloyd et al., 1993). Supplementation with CCM made a significant difference; it increased bone gain by 24 g/year which converts to a 1.3% increase in bone mass per annum. In the same study by Lloyd et al. (1996), but after 2 years of CCM supplementation, the Ca group versus the placebo group demonstrated significantly higher BMD (12.2% vs 10.1%; p ¼ .005) and bone mineral content increases (BMC: 39.9% vs 35.7%; p ¼ .01) for total body, while bone area remained similar between groups (p ¼ .15). At the lumbar spine and pelvis, supplemental Ca improved bone accretion compared to placebo by as much as 12–24%. Annualized bone acquisition rate was highest in Ca supplemented subjects with above-median values for

282

Susan Reinwald et al.

Tanner scores (p < .006). Overall, the results were impressive; added Ca from CCM resulted in a 20% average increase in the rate of bone gain, or an additional 61 g of bone mineral, in teenage girls over a 2-year period. The authors estimated that the Ca intake for the supplemented group in this study included substantially more available Ca due to the high absorbability of Ca derived from CCM. A number of human studies substantiate that the percentage of Ca absorbed from CCM is relatively high [e.g., 42% and 36% (Andon et al., 1996b), 41.4% (Miller et al., 1989), 37.43% (Heaney et al., 1989a), 36.2% (Miller et al., 1988)]. Based on an improvement in the rate of bone gain resulting from the level of Ca supplementation in this study, CCM added to the diet of teenage girls provided an adequate daily intake of Ca which could potentially manifest in a 5–6% increase in absolute peak bone mass over a 4-year period — providing the rate of increase observed for the 2 years of this study is sustained. According to epidemiological data (Matkovic et al., 1979; Wasnich and Miller, 2000), a gain of this magnitude may be sufficient to significantly decrease hip fracture risk later in life (Matkovic et al., 1979). Seventy pairs of identical twins comprising n ¼ 86 girls and n ¼ 54 boys, of average (SD) age 10  2 year and ranging from 6 to 14 years old, were enrolled in a 3-year double-blind, placebo-controlled trial designed to investigate the effect of 1000 mg/day of supplemental Ca from CCM versus placebo tablets (Johnston et al., 1992). One twin from each pair was randomized to ingest 2 250 mg CCM tablets in the morning and evening, while the other twin consumed placebo tablets on the same schedule. A co-twin study is superlative in that it automatically controls for a multitude of variables that are usually difficult to control for in nontwin cohorts and thereby enables detection of small differences. Bone density measurements in each region of interest were performed via absorptiometry at baseline. At 6 months, and annually from the first to the third year, the distal and midshaft of the radius were reassessed. In the hip (i.e., at Ward’s triangle, the femoral neck, and greater trochanter) and lumbar spine region (L2 to L4), bone mass was reassessed at 3 years. Twenty-five twin pairs dropped out during the course of the study. Spontaneous Ca intake averaged 908 mg/day from the diet in the placebo group, whereas the supplemented twins consumed 984 mg Ca/day from food and, after compliance was factored in, it was estimated they averaged an additional 718 mg Ca/day for a total intake of 1612 mg. Throughout the trial, 22 twins remained prepubertal. It was this specific subgroup in which Ca supplementation with CCM demonstrated a significantly increased rate of bone accrual from 6 month onwards, as evidenced by a BMD gain with 95% confidence intervals that did not include zero. The overall average increase in BMD at all six sites measured was þ2.9%, with positive effects occurring at the midshaft (þ5.1%), distal radius (þ3.8%), and lumbar spine (þ2.8%). Gains related to Ca supplementation were not

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

283

apparent after puberty. This was possibly due to other factors, including sex steroids, which may potentially have dominated Ca accretion to the point that bone is optimally stimulated. Alternatively, the supplemental Ca effects may have been diminutive in comparison to other rapid physiological changes occurring at this time. The question of whether bone density gains resulting from increased Ca intakes are sustained after an intervention was subsequently put to the test. As a follow-up to Johnston’s 1992 co-twin study, Slemenda and coworkers enrolled 13 of the male and 32 of the female twin pairs (ages 6–14 years) that had already participated in the aforementioned 3-year trial and monitored them for 3 years postsupplementation to examine the effects on skeletal growth of withdrawal of the added 1000 mg Ca/day as CCM (Slemenda et al., 1997). Each twin in a pair had been administered one of the two treatments. Methods included absorptiometry (dual x-ray and dual photon) for bone mass measurements of the radius, lumbar spine, and proximal femur. Assays were performed for serum biochemical markers of bone turnover [i.e., osteocalcin (OC), a measure of bone formation during puberty (Kanbur et al., 2002) and tartrate resistant acid phosphatase (TRAP), a marker reflecting osteoclast resorptive activity], anthropological techniques, and Tanner staging. During growth, lower serum concentrations of bone turnover markers are generally associated with a higher bone mass, and this was the case during CCM supplementation in the study by Johnston et al. (1992). A within-pair –15.1% difference in serum osteocalcin of prepubertal subjects was observed after 3 years of Ca supplementation compared to placebo (p < .05). Three years post-supplementation the within-pair differences in OC attributed to Ca intake did not persist. An erosion of the significant benefit to bone mass bestowed by Ca to prepubertal subjects during supplementation was also evident at 3 years post-supplementation. Among all subjects, TRAP levels were not significantly different between groups during Ca supplementation or 3 years after supplementation ceased. Supplementation with CCM appeared to slow bone turnover and promoted more bone accrual compared to the placebo, although the residual benefits stemming from the earlier period of supplementation were not sustainable in this study. Considering that during the 3-year follow-up period, spontaneous Ca intake was only 920 mg/day, or
400 mg/day below what is currently recommended as an adequate amount of daily Ca for adolescents, it is not entirely surprising that bone status would eventually be compromised.

C. Long-term bone density studies (4–7 years) A double-blind, placebo-controlled trial to determine the effect of 500 mg Ca/day supplementation as CCM on bone gain in 112 adolescent girls ages 12–16 years (Lloyd et al., 1997) represented a continuation of

284

Susan Reinwald et al.

previously described studies (Lloyd et al., 1993, 1996). After 2 years of Ca or placebo treatment, which includes the 2-year intervention study of Lloyd et al. (1996), the subjects were rerandomized into four groups comprising: placebo tablets for 4 years from age 12 to 16 years (PP); placebo tablets for 2 years from age 12 to 14 years and then Ca supplementation for 2 years from age 14 to 16 years (PC); Ca supplementation for 2 years during age 12–14 years and then placebo tablets for 2 years from age 14 to 16 years (CP); Ca supplementation for 4 years from age 12 to 16 years (CC). Throughout the 4-year intervention, spontaneous Ca intakes averaged 983 mg/day among all participants. After compliance was factored in, supplemental Ca intake averaged 350 mg Ca/day, resulting in an average total Ca intake of 1333 mg/day during periods when Ca supplementation occurred. During the initial 2 years of the study, bone gain was significantly higher in the groups that were supplemented with Ca (Lloyd et al., 1996). In terms of ranking the overall effects, the average 5-year gain (4-year intervention plus 1-year post-intervention) for total body BMC and BMC of the lumbar spine region was PP < CP < PC < CC (p > .05). Gains for BMD were similarly ranked such that PP < CP < PC < CC (p > .05). Bone area was lowest in the PP group compared to the other treatments supplying supplemental Ca; however, intergroup differences were not significant. It is highly possible that a lack of intergroup differences was indicative of a sample size problem resulting from the relatively high dropout rate (26%) which reduced the total number of subjects (n ¼ 13–22/group). In addition, the 1-year postintervention period, during which subjects did not receive any Ca supplementation, likely diminished the intergroup differences that may have existed at the end of treatment. Data at the conclusion of the 4-year treatment period were not reported. One year after completion of the Ca intervention, when the participants were 17 years old, the benefits attributable to previous Ca supplementation (Lloyd et al., 1996) were no longer significant. Lloyd concluded that an assessment of the benefit of Ca to bone in a cohort that is some years away from skeletal maturity may not demonstrate a positive effect. This may be because benefits imparted by Ca in subjects with very high remodeling activity levels may be representative of a very pronounced bone remodeling transient. This is a phenomenon that occurs when a bone-active agent/nutrient initially acts to suppress bone remodeling activation and bone resorption, slowing bone loss due to an interruptive partial closure of the remodeling space. This can transiently alter the remodeling balance and, in the short-term, may provide a nonsustainable gain in bone mass, possibly an increase as high as 30%, until a steady state is re-established (Heaney, 2003a). It is difficult to logically reconcile that the growth and development of adolescent skeletons are virtually unaffected by previous Ca intakes; however, the dynamics of Ca metabolism during growth are complex. A number of

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

285

factors aside from those related to nutrition are involved; and overall, mechanisms governing bone metabolism at this time are not as clearly understood as may be expected. On the balance of existing evidence, it seems prudent to maintain an abundant intake of Ca throughout adolescence, via supplementation if need be, to avoid a Ca shortfall. The pubertal growth spurt is a time of increased bone mass acquisition and when bone modeling markedly alters the size and geometry of bones to support longitudinal bone growth. In late adolescence, bone consolidation mediates endosteal apposition and periosteal expansion. While the short-term benefits attributable to Ca supplementation during growth have been established, little was known about the long-term effects of Ca supplementation on bone mass during the transitional period from childhood to young adulthood. This gap in the knowledge was addressed via a long-term (4 years þ additional 3 years non-obligatory extension ¼ total of 7 years), randomized, double-blind, placebo-controlled clinical trial that was organized for young girls. The aim of the trial was to evaluate the effectiveness of Ca supplementation versus a placebo on bone accretion (Matkovic et al., 2005). An observational study was also run in parallel to evaluate the effect of higher intake levels of dairy products (Matkovic et al., 2000, 2004a). Healthy prepubertal (stage 2) Caucasian females of average age (SD) 10.8  0.8 years with a spontaneous Ca intake <1480 mg/day at baseline (determined by food records) were initially stratified according to baseline total body BMD (TBBMD) and BMI (kg/m2) measurements to ensure the initial equivalence of groups. Subjects were supplemented with 1000 mg Ca/day as CCM (via a 500-mg dose AM and PM) or else followed the same regimen with placebo tablets. The dairy group was comprised of those participants already consuming >1480 mg/day at baseline. Data pertaining only to the first 4 year period for the placebo group (n ¼ 120) versus the supplemented group (n ¼ 100) reflected the effect of an average spontaneous Ca intake of 830 mg/day (from diet) and 1500 mg/day (from diet þ CCM supplementation), respectively. Primary outcome measures included TBBMD and BMD of the radius (proximal and distal) via DEXA, and metacarpal cortical area and total area (CA and TA) via radiogrammetry. Based on follow-up univariate analyses, when baseline measurements were used as covariates, additional Ca via supplementation with CCM positively influenced bone acquisition. This occurred at all skeletal regions of interest throughout the bone modeling phase during the pubertal growth spurt compared to the placebo (p < .05). However, bone turnover markers, stature, bone width, and bone mineral area turned out not to be significantly different between the supplemented and placebo groups after 4 years. A limitation of the 4 years analyses in this study pertains to the omission of an adjustment to correct for baseline differences.

286

Susan Reinwald et al.

Subjects evaluated over 7 years included n ¼ 79 receiving Ca supplementation, n ¼ 100 administered the placebo, and n ¼ 85 consuming a dairy-rich diet. Data pertaining to the supplemented versus placebo group at 7 years, by which time the pubertal growth spurt was over, revealed that the significant improvement conferred by Ca supplementation to TBBMD and radial BMD after 4 years was lost. Significant gain in metacarpal CA and CA:TA attributable to Ca supplementation after 4 years was sustained up to the 7-year endpoint. Bone mass acquisition was determined to be more rapid throughout the entire trial in the Ca supplemented group. Although fracture rate was not a primary research outcome, fewer subjects in the Ca group reported a bone fracture due to moderate trauma (n ¼ 9) than was the case in the placebo group (n ¼ 20). This was also true for forearm fractures, the most common fracture site during adolescence, with 3 reported forearm fractures in the Ca group versus 11 in the placebo group. Results during the last 3 years of this study also included areal BMD of the hip (femur neck and trochanter) and lumbar spine (L2-L4) as measured by DEXA, as well as a final peripheral quantitative tomography (pQCT) measurement at the proximal radius. In order to account for compliance, which was estimated to average (SD)
65  22% with Ca supplementation over 7 years, analysis for these measures was via posthoc stratification of participants into two subgroups based on total cumulative Ca intake above and below the median intake of 1006 mg/day (excluding baseline). This resulted in an average (SD) Ca intake of 1494  292 mg/day for the ‘‘high Ca’’ group versus 748  161 g/day for the ‘‘low Ca’’ intake group. Daily Ca intake among participants in the observational dairy study averaged
1200 mg/day and this was coupled with a higher protein intake (p < .001) than was observed among those in the clinical trial. This nutritional combination commensurate with a high dairy intake conferred benefits in terms of bone growth and periosteal expansion; subjects were taller and cortical bone area in the proximal radius was higher in the dairy groups versus either a high or low intake of Ca among clinical subjects (p ¼ .0003). BMD of the hip and forearm was significantly augmented by both Ca supplementation and high dairy consumption. High versus low Ca intake made a significant difference at the proximal radius for volumetric BMD and CA:TA. BMD at the lumbar spine was not affected by Ca supplementation, although in the dairy group a significant BMD increase at L2-L4 was observed. Milk with its combination of minerals and protein appeared to impact bone growth and bone area, while Ca supplementation promoted bone accretion via an improvement in volumetric bone density, particularly less than 1 year before and after menarche. A ‘‘catch-up’’ phenomenon is being hypothesized for female adolescents ingesting less than adequate Ca levels during the pubertal growth

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

287

spurt. Bone modeling slows down after menarche, and it has been suggested that Ca absorption, as well as the requirement for Ca or Ca intake threshold, also declines at this time. Under these circumstances, current average Ca intakes may be sufficient enough to enable unimpaired consolidation of bone mass after growth, such that existing bone mineralization deficits may be reversible at this life stage. It has been proposed that an increase in Ca intake during the most crucial years of growth and development may simply accelerate the attainment of peak bone mass (Andon et al., 1994). Alternatively, the Ca intakes classified as ‘‘low’’ in most of the adolescent studies comparing a high versus a low Ca intake may not be low enough to significantly or permanently compromise bone accretion at a life stage characterized by dynamic hormonal changes that may do more to dominate bone accretion than a suboptimal Ca intake. Based on Matkovic’s 7-year trial, a catch-up in bone acquisition was evident in participants on the placebo diet in terms of BMD measurements for total body and the radius for example, but did not occur at the metacarpals. Furthermore, taller persons with a larger skeleton clearly benefited from Ca supplementation with CCM, resulting in significantly higher BMD at the proximal radius after 7 years (p < .05). Moreover, subjects who consumed a high habitual Ca intake over the course of the 7-year study, irrespective of the assigned group (averaging 1353 mg Ca/day), displayed significantly higher BMD at the proximal radius (p < .05) that persisted into early adulthood compared to subjects who consumed a low habitual Ca intake (averaging 668 mg Ca/day). This finding provides support for the conclusion that meeting the current Ca DRI of 1300 mg/day throughout adolescence from a combination of diet and supplementation can benefit BMD as a young adult. The results of Matkovic’s study are particularly important in that they reflect long-term outcomes rather than short-lived changes consistent with a short-term bone remodeling transient. In comparison, physical activity may not have the same ‘‘catch-up’’ capacity. The case has been made that exercise when young is likely to provide lifelong benefits to bone structure and strength (Warden et al., 2007). It is possible that comparisons of ‘‘catch-up’’ with diet and physical activity are not yet possible until we have comparable ranges of deficiency and timing of deficiency prior to a period of adequacy. To generalize from the Matkovic study, dietary Ca intakes in the United States in placebo arms of randomized controlled trials are only moderately deficient compared to the very low Ca intakes of children in certain regions of Oriental (Lee et al., 1993, 1995) and Third World countries (Dibba et al., 2000), for example, who consume little or no milk. Data from Matkovic’s same cohort of young females, that were involved in the 7-year clinical trial that monitored the transitional period from childhood to early adulthood, was also used to assess BMD of the

288

Susan Reinwald et al.

skull and lower extremities during growth with Ca supplementation versus placebo (Matkovic et al., 2004b). The skull is unusual in that it is a non-weight bearing site compared to bones in the lower limbs. It is comprised of comparatively dense bone, makes a relatively larger contribution to TBBMD during childhood than it does in later years, and it has a high volume to projected area when scanned by DEXA. The effectiveness of Ca supplementation was determined using data only from subjects attending 7 or more of the 15 planned semiannual visits for assessment purposes; however, the statistical analysis was described as being performed on an ‘‘intent-to-treat’’ basis. Intent-to-treat implies there is no definitive cut off criterion for compliance — providing at least one postbaseline assessment has been obtained. Unless the arbitrary requirement for seven or more assessment visits to warrant inclusion of a subject in the statistical evaluation was specified apriori, the data from subjects completing anywhere between one and seven visits should be included in an ‘‘intent-to-treat’’ analysis. The biological efficacy of Ca treatment in relation to bone accretion was evaluated by way of a subgroup analysis performed using a posthoc stratification procedure that assessed cumulative Ca intake in the lower and upper terciles (<824 mg/day and >1305 mg/day, respectively). Variables were analyzed relative to menarche, and a linear mixed effect model (i.e., fixed group effects and random subject effects) was employed. BMD of the skull in the Ca group supplemented with CCM reached a higher level more rapidly than it did in the placebo arm (p < .0001). Nevertheless, the difference between groups during the bone consolidation period that followed the bone modeling phase of the pubertal growth spurt at the skull was minimal. This suggests the catch-up phenomenon influenced the bone of the skull of subjects administered the placebo. The rate of bone accretion in the lower limbs increased most during the 2 YSM (Years Since Menarche) period and BMD of the Ca-supplemented group was significantly greater than the placebo group (p < .0001). In contrast to the subjects in the lower tercile, those subjects in the upper tercile of Ca intake (>1305 mg/day) were able to maintain the additional bone mass acquired. This outcome provides further support that a recommendation to meet the current DRI through a combination of dietary and supplemental Ca is prudent advice to facilitate the building of bone mass during adolescence that persists into young adulthood. Catch-up growth in the lower extremities, a region prone to higher and more dynamic mechanical stresses and a higher rate of bone remodeling, was limited when Ca intake was low. In adolescents, the skeleton appears to be particularly responsive to Ca supplementation before pubertal maturation (Bonjour and Rizzoli, 2002). The Ca salt used to supplement diets may also modulate the nature of the bone response (Bonjour and Rizzoli, 2007).

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

289

The studies outlined in this chapter demonstrate the effectiveness of CCM as a Ca source in children and adolescents. Periods of marginal Ca deficiency may be partially or totally corrected by the ‘‘catch-up’’ phenomenon depending on the timing and length of the suboptimal period, the skeletal site, and the degree of insufficiency relative to programmed body size.

VI. STUDIES OF BONE MAINTENANCE IN ADULTS The amount of bone amassed at skeletal maturity (peak bone mass) and the rate of bone loss thereafter determines how dense and fracture resistant bones will be in old age. A lifelong AI of Ca is one of the best defenses against pathological bone loss in later adult life as the body becomes less efficient at balancing Ca needs with advancing age. Ca facilitates the maximal accrual of bone mass and contributes to the maintenance of bone density during aging by slowing the rate at which bone is inevitably lost. Osteoporosis is a latent chronic disease process involving excessive bone loss, as well as microarchitectural and material properties deterioration of the skeleton leading to skeletal fragility. Both men and women are afflicted with osteoporosis, although it is more prevalent in women than men. This is due mainly to the sudden hormonal changes women experience at menopause, compared to the more gradual endocrinological changes men experience, and the longer lifespan and smaller bone mass of women in general. Osteoporosis develops due to a combination of factors that usually always includes a long-term Ca insufficiency and/or hypoestrogenicity. In 2005, 30% of osteoporosis-related fractures occurred in patients 50–64 years of age, which corresponds with the average age of onset of menopause in women and the postmenopausal years, respectively (Burge et al., 2007). By 2025, the burden of osteoporosis in the United States is projected to increase by 50%, the annual number of fractures could exceed three million, and the associated economic cost could be as high as $25.3 billion each year. Up to 70% of the fractures and 80% of the economic burden is likely to be borne by those 65 years of age (Burge et al., 2007). Vitamin D works in conjunction with Ca to protect the skeleton; it has been shown to be effective in reducing the incidence of muscle atrophy and there is evidence to suggest it reduces the risk of falls in women who have suffered a stroke (Sato et al., 2005). A meta-analysis of randomized clinical trials (Bischoff-Ferrari et al., 2005) demonstrated that oral vitamin D supplementation reduces the risk of fracture (hip and nonvertebral) in the elderly, and an extension of this investigation established that the efficacy of vitamin D (vitD) is dependent on the addition of supplemental Ca (Boonen et al., 2007). The following studies

290

Susan Reinwald et al.

outline the benefits of supplementation with CCM as the Ca source for postmenopausal women and elderly women and men.

A. Studies in postmenopausal women The rate of bone loss in response to different levels of supplemental vitamin D (100 or 700 IU/day) was studied in a 2-year double-blind, randomized trial in 247 healthy ambulatory postmenopausal women (Dawson-Hughes et al., 1995). All subjects resided in a northern latitude (42  N) where exposure of the skin to the sun is limited in the winter time and adequate vitamin D synthesis may be reduced. The usual dietary vitamin D and Ca intakes of the subjects (mean age  SD:
63.3  5.2 years) were in the vicinity of 100  90 IU/day and 450  250 mg/day (mean  SD), respectively. Added to usual dietary intakes, supplementation essentially raised respective total daily intakes of vitamin D to
200 or 800 IU/day. The current recommended AI for vitamin D is 400 IU. Regardless of the dosage of supplemental vitamin D, all participants were administered 500 mg Ca/day in the form of CCM (with a Ca:citrate: malate molar ratio of 6:2:3). Despite the supplemental Ca added to the usual dietary Ca at the time of the study, intakes by current standards were at least
200 mg/day short of the AI levels recommended for women of this age (i.e., 1200 mg Ca/day). At 6-month intervals, which coincided with the peak and nadir of seasonal sun exposure and circulating 25OH vitamin D, dual x-ray absorptiometry measures of hip, lumbar spine, and whole body bone density were used to gauge the rate of bone loss in response to treatments. In these women with low dietary Ca intakes to begin with, total intakes of
200 and 800 IU vitamin D/day for 2 years had similar effects on lumbar spine and whole body bone loss in the presence of an additional 500 mg/day supplemental Ca supplied by CCM. Overall, 800 IU vitamin D/day with added Ca made a significant impact, reducing the mean (SEM) percentage of bone lost at the femoral neck (–1.06  0.34%; p ¼ .003), compared to 200 IU vitamin D/day þ Ca (–2.54  0.37%). The attenuation of bone loss attributable to the higher vitamin D intake mostly pertained to the winter/spring months (70%) rather than the fall/summer months (30%) when exposure of the skin to ultraviolet light is increased. Inadequate vitamin D (
200 IU/day) resulted in a bone density loss at the femoral neck in postmenopausal women supplemented with levels of Ca that were below the recommended AI, but not when vitamin D levels exceeded recommended intakes. Ca as CCM appears to be more effective in postmenopausal women when dietary vitamin D levels are adequate. Wintertime presents additional nutritional challenges, particularly to postmenopausal women living in northern regions where exposure to sunlight, which is important for the synthesis of vitamin D, is limited.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

291

The benefit of vitamin D supplementation (400 IU of vitamin D) was evaluated in a 1-year double-blind, placebo-controlled trial involving 249 healthy postmenopausal women (mean  SEM age: 61.4 to 61.9  0.5 year). They also all received 377 mg/day of supplemental Ca (250 mg/day of elemental Ca as CCM and 127 mg/day of elemental Ca as Ca phosphate). The purpose of this study was to determine whether bone loss varies according to seasonal changes in exposure to sunlight at a latitude of 42 N in the United States when vitamin D is made orally available (Dawson-Hughes et al., 1991). By current standards, the usual baseline vitamin D intakes of 100 IU in these subjects at the time of the trial were at least 300 IU/day less than the intake levels presently recommended. Although it is still considered highly controversial, a number of experts in the field of nutrition contend that 400 IU of vitamin D/day is still largely inadequate (Norman et al., 2007) and levels that exceed the present upper tolerable limits are more appropriate to reduce the likelihood of vitamin D deficiencies (Vieth, 2006). In the months primarily corresponding to summertime and fall (period 1), lumbar spinal bone density (L2-L4) and whole body density increased similarly in both the placebo and vitamin D-supplemented groups of women. During the main months of winter and spring (period 2), bone loss in the spine was reduced by more than half in the vitamin D group compared to the placebo-treated women (p ¼ .032), with the overall annual benefit to spinal bone density being significant for vitamin D þ Ca (p ¼ .04). Ca supplementation alone, which increased mean intakes to
800 mg Ca/day in both groups, was equally as effective as vitamin D þ Ca in terms of changes in whole body BMD throughout winter and summertime periods. It was not as effective in the spine during period 2 or over the course of the entire year. Nevertheless, the supplemental Ca in this trial, comprising 66% CCM, did exert a positive effect by reducing the rate of bone modeling in postmenopausal women. The addition of supplemental vitamin D contributed to a lowering of PTH levels and higher 25OH vitamin D levels during wintertime, which generally serves to protect bone mass. A 2-year randomized, double-blind, placebo-controlled trial in 301 healthy postmenopausal women demonstrated that by increasing the Ca intake of women previously habituated to inadequate intakes (i.e., extremely low ¼ <400 mg Ca/day or low ¼ >400 to <650 mg Ca/ day), the bone loss that characteristically occurs during postmenopause can be attenuated or even halted (Dawson-Hughes et al., 1990). The protective effects of Ca were dependent on the anatomical site, years since menopause, and the source of supplemental Ca used. Early postmenopausal women (5 years) generally experience a more accelerated rate of bone loss compared to women 6-year postmenopausal, in whom the rapid rate of bone loss finally slows. The subjects were randomized to

292

Susan Reinwald et al.

receive 500 mg/day of elemental Ca, as either CaCO3 or CCM (with a Ca:citrate:malate molar ratio of 6:2:3) or microcrystalline cellulose placebo tablets. Results were analyzed after separating early and late postmenopausal women, of respective mean (SD) ages 54.5  3.4 years and 59.9  5.4 years, and women with extremely low basal Ca intakes from those that were slightly higher before supplementation. The 500 mg Ca/day supplementation in this trial significantly increased serum levels of ionized Ca (p < .05), although it could not prevent bone loss in the spine associated with the early stage of menopause. In retrospect, the levels of Ca in this 1990 study can hardly be expected to achieve as much considering the current recommended AI levels of 1200 mg Ca/day for 51- to 70-year-old women exceeds the maximum amount of Ca that was consumed by these subjects via diet and supplements (i.e., Ca intakes ranged between 900 and 1150 mg/day). At the time of this study the RDA was a mere 800 mg Ca/day. Among late-stage postmenopausal women, bone loss was less rapid for Ca treatments versus placebo. Based on the mean percentage change in bone density from baseline in women with low basal Ca intakes (<400 mg/day), additional Ca in the form of CCM versus placebo (in that order) attenuated bone loss at the femoral neck (mean  SE: þ0.87  1.01% vs –2.11  0.93%; p < .05) and radius (þ1.05  0.75% vs –2.33  0.72%; p < .05). It also reduced bone loss in the spine (–0.38  0.82% vs –2.85  0.77%; p < .05). In comparison to the placebo treatment, CaCO3 maintained baseline bone density at the femoral neck (þ0.08  0.98%; p < .05) and radius (þ0.24  0.70%; p < .05), but not in the spine (–2.54  0.85%). Although the CaCO3 treatment exerted positive effects in this category of women, it was at least nine, three, and five times less effective at ameliorating bone loss or maintaining bone density in the femoral neck, radius, and spine of postmenopausal women (respectively), than was CCM. The higher overall Ca intakes from both supplemental sources in later postmenopausal women maintained bone in the femoral neck and radius; however, bone loss in the spine did persist. At the supplementation level in this study over a 2-year period, CCM was more effective than CaCO3 at protecting bone mass in women 6-year postmenopausal on extremely low Ca intakes. Ca not only works in conjunction with vitamin D to enhance bone health, its effects on bone maintenance have been surmised to be enhanced in postmenopausal women by the presence of other minerals. A 2-year double-blind, placebo-controlled trial evaluated the effect of supplementary Ca (1000 mg elemental Ca/day as CCM) on lumbar spine bone loss in the presence and absence of a combination of trace minerals integral to bone maintenance (i.e., copper, 2.5 mg/day; manganese, 5.0 mg/day; zinc, 15.0 mg/day). Participants included 59 healthy postmenopausal women of mean age (SD) 66  7 years who were on average 18.1  8.9-year postmenopausal (Strause et al., 1994). At baseline, the mean Ca

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

293

intake was
600 mg Ca/day, which is low by current standards. Subjects were randomized to one of four treatments: (i) Ca placebo þ trace mineral placebo, (ii) Ca placebo þ active trace minerals, (iii) Ca þ trace mineral placebo, and (iv) Ca þ active trace minerals. CCM was selected as the Ca source on account of its comparatively high bioavailability. It was delivered in a divided dose as 500 mg Ca with the morning meal and 500 mg Ca 2-h postprandial in the evening. The Ca:citrate:malate molar ratio was 6:2:3. Basal dietary Ca intake did not change from baseline among subjects receiving the Ca placebo. After 2 years, the CCM þ trace mineral group (n ¼ 14) was the only treatment that completely halted bone loss from the spine with a mean (SEM) percent change in L2-L4 vertebral BMD of þ1.48  1.40% (p ¼ .0099 vs placebo), while the placebo group (n ¼ 18) showed significant bone loss from baseline (–3.5  1.24%; p ¼ .0061). BMD changes for the CCM (n ¼ 13) and the trace mineral (n ¼ 14) groups were intermediate (–1.25  1.46% and –1.89  1.40%, respectively) and not significantly different from any of the other treatments. The interaction between Ca and trace minerals was not significant, yet Ca was significant as a main effect (p ¼ .045). Lack of a significant difference between CCM and the placebo treatment was attributed to the high dropout rate of participants. Fifty four of the original 113 subjects dropped out resulting in diminished power to detect differences. Supplementation with various other sources of Ca (e.g., CaCO3) has been observed to cause interactions that interfere with mineral bioavailability, particularly with respect to iron (Cook et al., 1991; Prather and Miller, 1992) and zinc (Wood and Zheng, 1997). In this study though, CCM in combination with trace minerals enhanced the maintenance of spinal BMD in older postmenopausal women. The years surrounding menopause are typically associated with weight gain, which as a consequence increases risk factors associated with coronary heart disease (Wing et al., 1991). Conversely, weight loss brought about by habitual caloric restriction usually stimulates generalized bone loss (Compston et al., 1992; Jensen et al., 2001; Villareal et al., 2006). During periods of dieting, Ca intake is also frequently restricted to suboptimal levels, a situation that can easily be reversed with supplementary Ca that may serve to protect against diet-induced bone loss. Ricci and coworkers evaluated the effect of supplemental Ca from CCM (1 g/day in a divided dose) on BMD and bone turnover markers in a randomized, double-blind, placebo-controlled trial. The main goal of the trial was to test whether additional Ca reduces the risk of bone dissolution and bone mineral loss during a weight reduction regimen in obese postmenopausal women (Ricci et al., 1998). The weight loss trial was completed by 16 women in the placebo group and 15 women in the Ca-supplemented group. The mean (SD) age of participants was 58.3  9.1 years. BMIs ranged from 28 to 48 kg/m2 at baseline, and after 25 weeks of moderate dieting the

294

Susan Reinwald et al.

Ca and placebo groups [consuming a mean (SD) total of 1646  182 and 515  105 mg Ca/day, respectively; p < .05], on average (SD) lost 10.0  5.3% of their body weight (p > .05). The decline in BMD from baseline was 1.4% higher in the placebo group versus the Ca-supplemented group, although not statistically different (p < .08). Urinary pyridinum and deoxypyridinoline cross-links (bone resorption markers), osteocalcin (bone formation marker), and serum PTH were significantly suppressed by Ca supplementation (p < .05, < .01, < .05, respectively). During any period of calorie restriction, it is imperative to continue to meet nutrient needs, especially those for Ca, in order to limit corresponding adverse effects on bone density. Supplementation with CCM did not hinder weight reduction and it ensured that weight loss was less likely to be accompanied by a loss of bone mass.

B. Studies in elderly men and women — including effects on fracture risk and risk of falls In addition to microarchitectural deterioration and a reduction in the material properties of bone, an age-related decrease in bone mass potentiates fracture risk among the elderly (Heaney, 2001a; Prince et al., 1997). To determine the extent to which supplementation with Ca and vitamin D can lessen fracture risk in men and women 65 years of age, a 3-year, double-blind, placebo-controlled trial was designed to examine changes in BMD, biochemical markers of bone metabolism, and the incidence of nonvertebral fractures every 6 months (Dawson-Hughes et al., 1997). Healthy, ambulatory, home-dwelling subjects (176 men and 213 women with mean dietary intakes at baseline of <800 mg Ca/day and
200 IU vitamin D/day) received either 500 mg Ca/day as CCM plus 700 IU of vitamin D3 or placebo. Of the 389 enrolled subjects, only 318 completed the study. During the first year of the study, the Ca þ vitamin D group showed mean BMD improvements from baseline at the femoral neck and lumbar spine (L2-L4) compared to the placebo group that demonstrated bone loss at these sites (p ¼ .05 and p < .001, respectively). At the same time, the loss of total body BMD during the first year was significantly less for the Ca þ vitamin D group versus the placebo group (p < .001). During the second and third years, the advantages of supplementation at the femoral neck and spine observed during the first year were maintained, although not increased. However, the mean (SD) annual change in total body BMD was significantly greater in both sexes due to Ca þ vitamin D treatment versus placebo during the second and third years (þ0.23  0.70% vs 0.14  0.68% change/year, respectively; p < .001). Based on these findings, the investigators concluded that CCM þ vitamin D supplementation provided a long-term benefit to the skeleton as a whole. Biochemical markers of bone metabolism changed significantly in a

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

295

favorable direction for the supplement versus the placebo-treated group, particularly for plasma 25OH vitamin D3, serum PTH, serum osteocalcin, and 24-h urinary Ca:creatinine ratio (p < .005 for all measurements for both men and women). The number of falls reported in the two groups was similar; however, the cumulative incidence (all 389 subjects) of a first fracture (non-vertebral) at 3 years was 5.9% in the Ca þ vitamin D group (n ¼ 11) and 12.9% (n ¼ 26) in the placebo group (p < .02). Furthermore, the 3-year cumulative incidence of a first pathological fracture, classified as ‘‘osteoporotic,’’ was significantly lower in the Ca þ vitamin D versus the placebo group (p ¼ .01). While the fracture risk outcomes must be interpreted with care due to the relatively small sample size in this trial by Dawson-Hughes et al., based on these results and the balance of other similar studies with larger sample sizes (reviewed in detail elsewhere, Boonen et al., 2004), there exists a strong case for supplementation with Caþ vitamin D as a cost-effective prophylactic measure to combat fractures due to osteoporosis. It should also be noted that genetics and physical activity are also integral to the health and fracture resistance of the skeleton. The baseline physical activity scores were similar for men and women participating in the Dawson-Hughes et al. study, although genetic differences were not assessed. The type of supplements used, in addition to the characteristics of the subjects and their daily environment (e.g., home-dwelling vs institutionalized), are possible reasons for variations in outcomes among similar trials. Further analysis of the risk of falling, at least once, during the above 3-year study was evaluated via an intent-to-treat analysis (BischoffFerrari et al., 2006). A total of 231 participants, of which 97 were men (49%) and 134 were women (55%), self-reported at least one fall during the 3-year period, with most falls occurring in the first year. Fifty-four percent of falls were sustained by individuals in the placebo group while 46% of reported falls were in the Ca þ vitamin D group (p > 0.05). Stratification by activity levels (i.e., more or less active) revealed active individuals were somewhat more prone to falls. While the odds ratio for falls was not affected by supplementation based on the entire population of subjects or among men, a 46% reduction in risk was observed among women supplemented with CCM þ vitamin D versus placebo; and that was significant as early as 1 year into the study. Less active women benefited most, particularly those who received ongoing treatment during the follow-up period when it was observed that CCM þ vitamin D contributed to a 74% reduction in falls. A limitation noted by the authors of this study is the initial lack of power to detect effect modification, and the interaction terms of sex, activity level, and baseline 25OH vitamin D level not reaching significance. In addition, results pertaining to free-living older persons may not apply to individuals confined to nursing homes or other care centers.

296

Susan Reinwald et al.

Age-related bone loss occurs in the elderly (Meta et al., 2006), particularly as dietary intake of Ca tends to decrease with age (Heaney et al., 1982; Volkert et al., 2004). Maintaining dietary Ca and serum 25OH vitamin D concentrations at the upper levels of normal ranges in the elderly may contribute toward limiting the loss of BMD in older persons. This theory was tested in 316 women and 122 men (mean ages 73.7 and 75.9 years, respectively) who were enrolled in a 4-year placebo-controlled, double-blind trial and randomized to receive daily supplementation with 750 mg Ca/day from CCM, 15 mg/day of 25OH vitamin D3, or a placebo treatment as three equivalent divided doses with meals (Peacock et al., 2000). At baseline and 6-month intervals, BMD of the hip region, lumbar spine, and total body was assessed. Bone structure at the hip was evaluated by measuring cortical bone thickness and femoral medulla width at the upper femur from x-ray radiographs taken at baseline and at 12-month intervals. Blood and urinary biochemical tests were also performed, and fracture history and incidence were recorded. Based on an intent-to-treat analysis of the men and women combined, the placebo group lost BMD compared to baseline ( 0.0144 g/cm2; p ¼ .0001) at the total hip region at a rate of
0.5% per year (p < .001), whereas the small change in BMD from baseline at the total hip for the Ca supplemented group was not significant (–0.0023 g/cm2; p ¼ .45). The change in BMD for the 25OH vitamin D3 group ( 0.0095 g/cm2; p ¼ .002) was intermediate and not significantly different from either the placebo or CCM group. Overall, changes at the greater trochanter, femoral neck, and Ward’s triangle followed a similar pattern to the total hip. Cortical bone thickness of the femoral shaft decreased and medullary width increased significantly more in the placebo group than in the Ca group (p < .002) or 25OH vitamin D3 group (p < .03). This indicated increased resorptive activity and age-related expansion of the medullary cavity in the absence of supplementation with Ca or 25OH vitamin D. Based on the bone density and structural data, the investigators concluded that two important components of bone strength at the hip were preserved with CCM supplementation (i.e., BMD and cortical bone thickness). Taken as a whole, Ca as CCM supplied at the upper end of the normal range surpassed the placebo in terms of minimizing bone turnover, supplying mineral for deposition in bone, and reversing the secondary hyperparathyroidism evident at baseline. Benefits beyond the placebo alone were provided by 25OH vitamin D3, although in terms of ameliorating bone loss and slowing bone turnover these benefits were minimal. Based on results pertaining to subjects in this study, 25OH vitamin D3 became less important to BMD, serum Ca, and serum PTH in the presence of adequate Ca. While the results of this study can only be generalized to older (60- to 90-year old) Caucasian, community-dwelling persons at risk of Ca and vitamin D insufficiency, it can be concluded that the treatments were safe and

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

297

demonstrated the benefits associated with CCM supplementation in the elderly. An issue sometimes raised in relation to bone maintenance in the elderly concerns the endogenous acid generated by the metabolism of dietary protein, which when regularly excreted in the urine can cause calciuresis via various mechanisms (Dawson-Hughes, 2003a,b). Opinions have varied in terms of the extent to which protein-induced increases in Ca excretion may impact bone mass via bone dissolution and/or resorption (Barzel and Massey, 1998; Heaney, 1998, 2002). Protein intake in conjunction with Ca supplementation has now been positively associated with bone accrual, and only more recently has the notion of Ca economy been considered as a compensatory mechanism in response to an acute increase in the dietary protein load (Bonjour, 2005; Kerstetter et al., 2005). Dawson-Hughes and Harris investigated associations between protein intake (as a percentage of energy) and rates of bone loss in response to a placebo or supplemental Ca (500 mg/day from CCM þ 700 IU/day vitamin D) treatment in elderly men (n ¼ 161) and women (n ¼ 181) over 65 years of age (Dawson-Hughes and Harris, 2002). Subjects completed a 3-year randomized, placebo-controlled trial during which BMD (total body, femoral neck, and spine) and protein intake were assessed at 6-month intervals and at 18-month intervals, respectively. Participants consumed a relatively high mean (SD) protein intake of 79.1  25.6 g/day in conjunction with daily Ca intakes of 871  413 mg/day for the placebo group, or 1346  358 mg Ca/day for the CCM þ vitamin D-supplemented subjects. A higher protein intake positively increased the percentage change in total body BMD (p < .042) and femoral neck BMD (p > .05) in the supplemented subjects, although not in the placebo-treated group which lost bone. Supplemental Ca from CCM þ vitamin D not only protected the skeleton from bone loss, it also promoted bone gain in the presence of an increased protein intake. Conservation of bone mass may occur via Ca lowering the turnover rate of bone, or via minimization of the adverse effects of mild acidosis on bone resorption (Dawson-Hughes, 2003b). In the placebo group, Ca absorption actually declined with increasing protein intake as a percentage of energy (ANCOVA; p ¼ .017), although the absorption method used did not predict true Ca absorption. In the elderly, an increased protein intake in concert with supplemental Ca from CCM þ vitamin D at recommended intake levels may promote BMD gain. The chemical nature of CCM is such that it provides 25 mEq of additional alkali, which may have compensated somewhat for the protein-related increase in acid load (Remer, 2001). Since there is an age-related functional decline in the ability to excrete acid, CCM as a Ca source for the elderly may be especially beneficial (Bushinsky, 2001).

298

Susan Reinwald et al.

Above all, it is important for the elderly population to meet current recommended intakes for Ca and vitamin D (Ca þ vitD) on a regular basis for maximum skeletal benefit. Unfortunately, compliance with taking dietary supplements that may have been recommended, prescribed, or co-prescribed in conjunction with standard medical treatments for osteoporosis (e.g., bisphosphonates) is often poor and intermittent, thus limiting their effectiveness (Bayly et al., 2006; Prince et al., 2006; Rossini et al., 2006). To determine whether a sustained benefit related to supplementation exists with Ca þ vitamin D on BMD, 295 healthy ambulatory men and women (68 years old), who were participants in the previously discussed 3-year randomized, placebo-controlled trial involving simultaneous administration of Ca (500 mg/day as CCM) and vitamin D (700 IU/day), were followed-up for an additional 2 years (DawsonHughes et al., 2000). Obligatory supplementation ceased after the 3-year intervention, although subjects were free to take supplements during the follow-up period if they chose to. Postintervention use of all supplements and medications was recorded and found to be comparatively evenly distributed among participants according to prior treatment classifications. Mean baseline BMD at 0 months was considered the reference point for evaluating subsequent changes in each group after the followup period. Overall, mean femoral neck, lumbar spine (L2-L4), and total body BMD improvements resulting from the 3 years of CCM þ vitamin D supplementation were lost in elderly men and women by the end of the 2-year post-intervention period. The only exception to this was a modest persistent positive effect (p < .05) on total body BMD in men, mostly attributed to maintenance of bone mass in the legs. The observed reduction in bone remodeling rate during the supplementation regimen was also diminished during the 2-year follow-up based on serum osteocalcin and intact PTH biochemical measures. In summary, no cumulative skeletal benefit of Ca þ vitamin D supplementation was identified for elderly women 2 years beyond the treatment intervention, and only a very modest and limited continuing benefit was observed for elderly men, suggesting that prolonged Ca supplementation in the elderly is advisable to maintain bone health.

VII. OTHER HEALTH BENEFITS A. Oral health 1. Tooth retention An AI of Ca and vitamin D is essential for retarding the rate of systemic bone loss that occurs naturally as a consequence of aging and declining hormone levels (e.g., menopause). Declining BMD can lead to osteopenia,

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

299

osteoporosis, and an increased susceptibility to pathologic bone fractures. Early data from rodent experiments suggested that oral bone surrounding and mechanically supporting teeth, particularly alveolar bone, is also dependent on an AI of Ca (Erricsson and Ekberg, 1975; Ohya et al., 1992; Shoji, 2000) and vitamin D (Davideau et al., 2004) to provide some protection against bone resorption in this region. Therefore, it is not unexpected that periodontal disease in humans may be more prevalent in osteopenic and osteoporotic subjects than in individuals with higher bone densities (Mohammad et al., 2003; Wactawski-Wende et al., 2005) and that it possibly shares a number of common etiologies (Nishida et al., 2000; Yoshihara et al., 2005). Periodontal disease is characterized by a sequence of chronic oral inflammation and excessive alveolar bone resorption (i.e., receding alveolar bone) that results in root surface exposure of teeth, increased sensitivity, eventual detachment of the periodontal ligament, and subsequent tooth loss. Alveolar ridge bone exhibits intrinsic porosity, a structural fragility, and a proximity to vasculature that in effect virtually ensures it has the potential to be a vulnerable site in times of rapid bone resorption, much like the trabecular-rich regions in the hip and spine. Subsequent retention of the quantity and quality of bone in edentulous jaws also becomes critically important in terms of being able to provide surface support for dental implants and dentures that are desirable for both functional and cosmetic purposes (Bodic et al., 2005) (Figure 6.4). The impact of Ca and vitamin D supplementation on tooth loss in 145 healthy elderly subjects (65 years of age, and not taking medications or supplements that alter Ca metabolism) was assessed during a 3-year randomized, placebo-controlled trial that was primarily designed to investigate bone loss from the hip (Dawson-Hughes et al., 1997; Krall et al., 2001). Participants randomized to the supplemented group consumed 500 mg/day of elemental Ca as CCM and 700 IU/day of cholecalciferol (vitamin D3). The placebo group consumed an equivalent number of inert microcrystalline cellulose pills daily. Observations in the same subjects also continued during a 2-year follow-up period that began after cessation of the compulsory supplementation regimen (Dawson-Hughes et al., 2000; Krall et al., 2001). During the second phase, participants were divided into two categories based on either a lower (<1000 mg) or higher (>1000 mg) daily Ca intake. Questionnaires were used to gather information relevant to tooth loss at 1.5, 3, and 5 years. Actual tooth counts were conducted at 1.5 and 5 years, and a final periodontal exam also was scheduled at 5 years. The rate of compliance was based on pill counts at 6-month intervals and averaged 92% and 93% for the placebo and supplemented groups, respectively. During the randomized trial, the incidence of one or multiple teeth being lost in subjects was 13% in the supplemented group and 27% in the placebo group (p < .05). By the end

300

Susan Reinwald et al.

Evidence-based health-associated benefits of CCM

Reduces tooth erosion

Reduces tooth loss Mineral absorption unaffected Reduces blood pressure

Mg Zn Fe Se

Improves serum lipid profiles

Promotes axial bone density Cardiac muscle contraction No kidney stones Colon health

High absorption, bioavailability and retention

Promotes appendicular bone density

Nerve impulse transmission

Growth and development

Skeletal muscle contraction

Enhances enzyme and cellular activity

General health benefits of Ca

FIGURE 6.4 Illustrated summary of the health benefits pertaining to CCM.

of the follow-up period, 59% of subjects consuming <1000 mg Ca and 40% of subjects regularly consuming higher levels of Ca lost one or more teeth. Based on the odds ratio and the 95% confidence interval for tooth loss, it was determined that supplementation during the randomized clinical trial and the level of Ca intake (but not vitamin D intake) during the follow-up period significantly reduced the risk of tooth loss (p < .05 and p < .03, respectively). These results suggest that prophylactic CCM and vitamin D supplementation for osteoporosis also exerts a beneficial effect on tooth retention. A prior study by Krall and colleagues demonstrated an association between dental status and BMD in healthy postmenopausal women, thus lending support to the hypothesis that systemic bone loss may also contribute to tooth loss (Krall et al., 1994). A later prospective study within

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

301

a 7-year period assessed the association of tooth loss with systemic bone loss in the whole body, hip, and spine of postmenopausal women via three nutritional interventions (Krall et al., 1996). Subjects randomized to the first arm of the intervention were divided into a group supplemented with 500 mg/day elemental Ca as either CCM or CaCO3, and a second group taking a placebo. At the end of 2 years, more women (p ¼ .054) in the placebo group than in the Ca-supplemented group lost teeth (11% compared to 4%, respectively) and the association was stronger (p ¼ .04) among nonsmokers in the placebo group (12%) and the supplemented group (3%). The second and third interventions involved randomization of subjects to groups that were all supplemented with Ca, and additionally supplemented with either vitamin D (400 IU/day) or placebo for 1-year (Study 2), or a low (100 IU) or high (700 IU) daily dose of vitamin D for 2 years (Study 3), respectively. Subsequently, vitamin D was not found to be associated with tooth loss. However, compilation of data from all of the intervention groups demonstrated that the rate of change from baseline for BMD of the whole body and femoral neck was positively associated with the likelihood of tooth loss. BMD of the spine was increased in all groups; however, in subjects that lost teeth, the total gain was less at this site. This study showed that mitigation of systemic bone loss may simultaneously lessen oral bone loss and promote tooth retention. Furthermore, it revealed that supplementation with Ca was a nutritional intervention of consequence in terms of slowing the rate of BMD decline in the whole body and hip, as well as increasing tooth retention. Surgical treatments for oral bone loss alone were estimated to cost in the vicinity of $5–$6 billion per year at least 5 years ago, an amount that does not include the costs associated with impaired dentition due to tooth loss (Hildebolt, 2007). The potential associated psychological, social, and physical harm that may have to be endured was also not considered. Therefore, it seems prudent to ensure that one’s dietary intake of bioavailable Ca is adequate to avoid at least one potentially modifiable risk factor for tooth loss.

2. Tooth erosion The erosive potential of acidic foods and beverages on dental enamel has been well documented (Ganss et al., 2002; Johansson et al., 2002; Yip et al., 2003). Frequent exposure to extrinsic sources of organic acids found in pickled foods, fruits, fruit juices, juice blends, and soft drinks can readily give rise to chemical dissolution of the surface enamel and underlying dentine. Together with the high sugar content in many beverages, a low pH imparts a desirable flavor profile and organoleptic qualities (e.g., bite, tang, freshness, sourness), as well as functionalities including preservation and stabilization (Jandt, 2006). However, a beverage that induces an

302

Susan Reinwald et al.

oral cavity pH  5.5 is critical in relation to the biological hydroxyapatite [i.e., a nonstoichiometric carbonated Ca hydroxyapatite (Simmer, 1995)] that comprises tooth enamel (Brunton and Hussain, 2001). This is because acid in the beverage rapidly associates with ions that are normally supersaturated in saliva (Ca, phosphate, and hydroxyl ions), thus reducing salvia ion concentration. When the degree of ion saturation with respect to tooth mineral diminishes, the Law of Mass Action takes effect and causes mineral to be leached from teeth, which in effect softens and demineralizes exposed tooth surfaces. Based on this phenomenon, it stands to reason that the addition of Ca ions and/or Ca salts to acidic beverages and foodstuffs should therefore partially protect tooth enamel from the ingested organic acids by slowing the rate of enamel dissolution. In fact, findings from other studies support this notion (Attin et al., 2003; Hughes et al., 1999, 2000; Jensdottir et al., 2005; Lussi et al., 2005; Parry et al., 2001). Moreover, a number of different product modifications have already been the subject of experiments targeting the problem of tooth erosion associated with consumption of acidified beverages (Attin et al., 2005; Barbour et al., 2005; Grenby, 1996). As discussed in a previous section, adding Ca to beverages can be problematic in terms of solubility and precipitation effects (Parker, 2004). Furthermore, in certain beverages (e.g., cranberry juice) interactions of free Ca with matrix components can cause changes in color and loss of clarity (Klahorst, 2001). Simply adding less acid has been shown to adversely affect the taste and flavor profile of soda beverages (Barbour et al., 2003). Another option is to use a combination of acids, such as citric acid as the primary acidulant together with a weaker acidulant, such as malic acid (Grenby, 1996). In terms of further reducing the erosive potential of acidic beverages, a potentially better strategy may involve the addition of CCM. Adding citric and malic acid in combination with Ca provides a soluble salt complex that has health and dental benefits (Andon et al., 1992; Parker, 2004). Fortification of an orange-flavored beverage with increasing amounts of CCM has been shown to increase the pH of the system and, hence, reduce the erosive potential in a Ca concentration-dependent manner. This has been achieved without influencing the beverage sensory properties or reducing consumer acceptability (Assmann et al., 2003). To test the hypothesis that the addition of CCM reduces dental erosion, the erosive effects of four different drinks was compared: a citric acidbased orange-flavored soft drink fortified with CCM (pH 4.0, 1344 mg Ca/liter); the same drink without CCM (pH 3.6, 72 mg Ca/liter); and positive and negative controls consisting of a diet phosphoric acidbased cola (pH 3.1, 35 mg Ca/liter) and distilled water, respectively (Rugg-Gunn et al., 1998). In a randomized cross-over design comprised of four 6-day periods, 11 subjects were required to wear a palatal

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

303

intra-oral appliance that held sterilized bovine incisor enamel slabs in place. During each of the 6-day periods, participants removed and immersed the slabs in one of the room temperature drinks for 15 min four times daily before replacing it in their mouth. The intra-oral appliances were routinely removed and kept moist during meals. Prolifometry was used to quantify the loss of slab enamel attributable to the exposure to each drink. Results showed a significant effect of the type of drink on enamel loss (p < .001), however, only the phosphoric acid-based cola drink was significantly different (p < .01) from the rest of the drinks with respect to depth of enamel loss (14.3 mm). There was no statistically significant difference for this parameter in response to distilled water (5.0 mm), or the citric acid-based soft drink with and without CCM (5.2 mm and 6.1 mm, respectively). However, this study appeared to have some limitations. First, bovine and human enamel are not equivalent in a number of chemical and structural respects; for example, bovine and human enamel possess some exclusive and significant chemical elements, bovine enamel is comprised of larger crystal grains and more lattice defects than human enamel, there are response differences in terms of acid-resistance with respect to the development of caries-like lesions, and it has been suggested that enamel etching could, as a result, vary between bovine and human enamel (Abuabara et al., 2004). Consequently, the comparative value of the model needs to be carefully considered. Second, the 15-min period of slab exposure to an unstirred beverage is unlikely to be representative of the in vivo dynamics associated with various drinking habits (e.g., fast or slow sipping versus the steady swallowing of larger mouthfuls or guzzling). Third, as noted by the authors, the exposure of bovine enamel to drinks was at room rather than body temperature, a factor known to decrease erosion potential in the presence of acids (Amaechi et al., 1999). It was unexpected that distilled water caused the amount of erosion exhibited and, although the erosion for the orange drinks trended in the expected direction, more subjects are likely required to demonstrate significant differences. Human studies and rodent experiments demonstrating the potential for CCM to reduce the risk of tooth enamel erosion are included in the patent of Andon et al. (1992). One experiment assessed rats provided with soft drink, soft drink with added CCM, or water as their only source of fluids for 21 days. Based on a predefined erosion scale, the average extent of dental erosion compared to the unfortified soft drink was 4.5 and sixfold less in water and soft drink þ CCM, respectively. Another study used the Vickers hardness measurement to assess the mean (SEM) reduction in surface hardness of human enamel specimens (n ¼ 8 per group) immersed for 60 min in 15 ml of OJ (–101  8.7), OJ þ CCM (0.9  5.8), grapefruit juice (–130  12.7), grapefruit juice þ CCM (2.8  6.4), or

304

Susan Reinwald et al.

water (–0.4  4.3). This later method uses a nonnatural setting, as the buffering effect of saliva is negated in vitro and the time of enamel exposure is unusually long. Despite these limitations, the results are remarkable in terms of the magnitude of protection that CCM provided against the erosive potential of fruit juices. Considering fruit juice and soft drink consumption is widespread, particularly among children and adolescents (Lussi et al., 2000; Rampersaud et al., 2003), and bearing in mind that these beverages often replace dairy consumption in the diet (Harnack et al., 1999), adding CCM to juices and other acidified beverages to improve the nutritive value and to lower erosive potential appears to be a practical initiative.

B. Blood pressure reduction High blood pressure (hypertension) is a condition more frequently associated with adults; however, it can be present at any age (e.g., infancy). In fact, over the past two decades, the incidence of hypertension among children and adolescents has been documented to be on the rise (Sorof et al., 2004). In 2002, among a cohort of 5102 students aged 10–19 years, the prevalence of elevated blood pressure (BP) was estimated to be as high as 4.5%. The cause of hypertension in children is increasingly being linked to excess weight gain, unhealthy eating habits, stress, and insufficient physical activity (Sorof et al., 2004). Conversely, a family history of hypertension can be a predisposing factor, as can an underlying renal or cardiac pathology (i.e., secondary hypertension). Childhood hypertension is considered to be a long-term health risk as it predicts adult hypertension, and even mild-to-moderate hypertension can, over time, result in damage to the heart, kidneys, and blood vessels. The absence of a pathologic etiology for hypertension in children usually indicates a nonpharmacologic approach to BP management involving dietary and lifestyle modifications and can be an effective intervention to restore normotension. Dietary CCM supplementation has already been implicated in a BP lowering effect in children with low baseline Ca intakes (Gillman et al., 1995). In a randomized, double-blind, placebo-controlled trial, 101 students (50 girls and 51 boys, average age 11 years) were assigned to either (i) an intervention group (n ¼ 51) that consumed two servings of 300 mg Cafortified fruit juice per day for 12 weeks (with CCM as the daily source of 600 mg supplemental Ca) or (ii) a placebo group (n ¼ 50) that consumed two servings of an identical-looking unfortified fruit juice per day for 12 weeks. Subjects included 61 black, 9 Hispanic, 16 Asian, and 15 white students. An automated devise was used to record four BP measurements per subject each sitting. The final three measurements were averaged and recorded at the baseline, study midpoint, during the final stage of the

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

305

study, and post-intervention. In summary, the mean overall change in BP and the average difference in BP change between the CCM and placebo group were calculated. Anthropometry measurements were performed at baseline and at 12 weeks. Dietary assessment, medication questionnaires, and compliance monitoring were carried out as planned during the course of the intervention to strengthen confidence in the results. Diastolic BP (DBP), which measures the pressure in the arteries when the heart is at rest, was largely unaffected by the intervention. Systolic BP (SBP), or the maximum pressure exerted when the heart contracts, did change in response to CCM supplementation in most children. The data specifically showed that over 12 weeks, children in the lowest quartile of baseline daily Ca intake (150– < 347 mg/1000 kcal) were affected most significantly by CCM supplementation in terms of a reduction in systolic BP (effect estimate: –3.5 mm Hg), whereas children in the highest quartile of baseline daily Ca intake (514– < 882 mg/1000 kcal) demonstrated no appreciable reduction in systolic BP due to CCM supplementation. Children in quartiles two and three of the baseline Ca intake benefited from a CCM-induced reduction in SBP with the effect estimated to be –2.8 mm Hg and –1.3 mm Hg, respectively. The overall trend for the estimated effect of Ca intake on BP across quartiles was highly significant (p ¼ 0.009). Covariate adjusted estimates of the mean difference in SBP revealed that the CCM group was 1.1 mm Hg lower than that of the placebo group at the midpoint of the trial (6 weeks). From baseline to the final stage of the study (12 weeks), SBP in the CCM group was 1.8 mm Hg less than that of the placebo group (effect estimate: –1.8 mm Hg; 95% CI: –4.0, 0.3). However, the reduction in SBP promoted by CCM supplementation was essentially lost by 6-weeks post-intervention. Subgroup analyses, which also included adjustments for confounding variables, indicated that the difference in SBP change was –2.0 mm Hg among black children, –1.5 mm Hg among nonblack children, –2.3 mm Hg among boys, and –0.9 mm Hg among girls. It was also generally observed that the placebo group gained slightly more weight (2.9 kg) than the intervention group (2.7 kg) after 12 week and SBP in the placebo group increased during the trial. Despite the short duration of this study and the low-dose supplementation regimen with CCM, a modest lowering of SBP among subjects was observed. This effect was more prominent among boys and among black children, who may consume lower amounts of dairy products due to a higher incidence of lactose intolerance. The data provide evidence to support the hypothesis that a highly absorbable form of Ca can potentially influence SBP in ‘‘at risk’’ younger populations. Even seemingly small reductions in SBP of a large population over time can potentially impact public health by way of reducing the risk of coronary and stroke incidents in the future.

306

Susan Reinwald et al.

C. No increase in the risk of kidney stones The incidence of kidney stones in the United States has steadily increased over the previous three decades [National Kidney and Urologic Diseases Information Clearing House (NKUDIC), 2005]. In 2000, more than 600,000 patients went to emergency rooms for problems related to kidney stones [National Kidney and Urologic Diseases Information Clearing House (NKUDIC), 2005], 177,496 patients were hospitalized and the cost of evaluating and treating kidney stones was $2.07 billion dollars (Pearle et al., 2004). It is predicted that 10% of the US population will have a kidney stone at some point in time (Sullivan, 2005). While there are many types of kidney stones, the most common are formed from dissolved urinary Ca and oxalate that forms an insoluble accretion [i.e., Ca oxalate monohydrate crystals (Qiu et al., 2003)] in the kidneys or ureters. Sooner or later, if the crystalline mass becomes large enough (6 mm), the stone initiates symptoms of discomfort. Oxalate is the dissociated form of oxalic acid, either derived from dietary sources (10–20%) (Holmes et al., 2001) or synthesized endogenously in the liver (
80%) (Gershoff and Faragalla, 1959; Morozumi et al., 2006). Oxalic acid is a ubiquitous substance in animal tissues and occurs naturally in a large number of plants (Monje and Baran, 2002). The main sources of dietary oxalic acid are plant-derived foods with relatively high concentrations (i.e., 200 ppm), for example, buckwheat, star fruit, black pepper, purslane, poppy seeds, rhubarb, tea, spinach, plantains, cocoa and chocolate, ginger, almonds, cashews, garden sorrel, mustard greens, bell peppers, sweet potatoes, soybeans, tomatillos, beets and beet greens, oats, pumpkin, cabbage, green beans, mango, eggplant, tomatoes, lentils, and parsnips. In human tissues, oxalic acid levels generally range between 0.6 and 4 mg/kg in blood, kidney, liver, muscle, brain and bone, with the highest concentrations occurring in the kidneys (Committee for Veterinary Medicinal Products, 2003). The presence of Ca in kidney stones and the abnormally high Ca levels in idiopathic (absorptive) hypercalciuric individuals that are inherently more prone to kidney stones, initially led to the belief that dietary Ca may be a cause of renal stone formation (Coe et al., 1992). Recent evidence suggests that, as a therapeutic approach to reducing the risk for kidney stones, Ca-restricted diets may pose a greater risk to normocalciuric individuals prone to kidney stone formation; such an approach may increase urinary oxalate and the likelihood of recurrent stones, as well as promote bone loss (Borghi et al., 2002; Coe et al., 1997; Curhan et al., 1997). The amount of oxalate excreted in urine has been found to be positively associated with Ca oxalate supersaturation and stone formation (Holmes et al., 2001). While free oxalic acid is readily absorbed from the gut lumen (Morozumi et al., 2006), an increased dietary Ca to oxalate

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

307

ratio reduces gastrointestinal oxalate absorption and subsequent oxalate excretion (Morozumi et al., 2006; Williams et al., 2001). Citrate, the dissociated form of citric acid and a Krebs cycle intermediate, is also recognized as playing an important role in the reduction of kidney stones when it is excreted in the urine (Qiu et al., 2003). Its chemical composition is such that it can chelate metal ions and impart increased solubility to a salt complex. Moreover, citrate is protective by way of contributing to the control of crystal habit and growth of renal stones via modulation of the morphology and growth kinetics of Ca oxalate crystals (Qiu et al., 2003). Citrate is usually effective in this capacity at very low concentrations (Tiselius, 2005). Malate, the dissociated form of the dicarboxylic acid malic acid, also has been implicated in chelating Ca and forming soluble salts that protect against urinary tract calculi in rodents (Thomas and Thomas, 1977). CCM therefore includes three chemical components considered to be of potential benefit in terms of protecting against kidney stones. To further evaluate Ca’s role in the presence of oxalate, Liebman and Chai examined the effect of oxalate loading (OL) over 24 h on mean oxalate absorption and urinary oxalate excretion in 10 healthy non-kidney stone forming (6 males and 4 females, mean SD age: 28  7 years) and 4 kidney stone forming subjects (2 males and 2 females, 35  11 years) in response to concurrent dosing with a 300 mg source of elemental Ca (Liebman and Chai, 1997). Three OL tests were performed in a crossover design with a 1-week washout period between each test. Oxalate loading consisted of 180 mg unlabeled þ 18 mg labeled 1,2[13C2]oxalic acid and tests took place in the following order: (i) alone (baseline), (ii) with CaCO3 (OL þ Ca), and (iii) with CCM (OL þ CCM). For all urinary indices tested, stone forming and non-stone forming individuals were similar, and subsequently pooled into one group with each subject serving as his/ her own control. Mean 24-h oxalate absorption decreased from 18.3% (baseline) to 8.1% and 7.2% for OL þ Ca and OL þ CCM, respectively. Mean 24-h exogenous oxalate was significantly reduced from 36.2 mg (baseline) to 16.1 mg (OL þ Ca) and 14.3 mg (OL þ CCM), whereas endogenous oxalate was unchanged across all treatments. Post-OL urine sampling for Ca showed that, of the two Ca sources, CCM was more bioavailable than CaCO3; however, oxalate absorption did not differ significantly between the two Ca sources. Six subjects also completed 24-h oxalate excretion and absorption tests so that the effectiveness of various Ca doses (100, 200, and 300 mg Ca) in conjunction with an OL versus baseline (0 mg Ca) could be assessed. Total urinary oxalate excretion was significantly reduced in the presence of Ca at all doses, although endogenous oxalate remained unchanged. Zero mg Ca and 100 mg Ca resulted in higher oxalate absorption (11.3% and 9.1%, respectively) compared to 200 mg Ca (5.9%) and 300 mg Ca (7.6%).

308

Susan Reinwald et al.

In summary, 200 mg elemental Ca administered either as CaCO3 or CCM reduced oxalate absorption and excretion in the event of an oxalic acid challenge. A randomized study was designed to compare the stone-forming potential of low-fat milk versus CCM-fortified OJ in 12 idiopathic hypercalciuric adults (6 healthy males and 6 females aged 18–30 years) (Coe et al., 1992). After a washout and subsequent baseline period (7 days each), at which times it was confirmed that participants were on basal Ca intakes of <800 mg/day, one of the beverages was added to their daily diet for 28 consecutive days. The beverages provided a total of 600 mg additional Ca/day in divided doses over the course of the day. After a 7-day washout period, testing was repeated with the other beverage. Apart from subjects being asked to avoid excessive dairy consumption and all fluid milk consumption that was not a test beverage, usual dietary habits were encouraged during the study. During the course of the study, 24-h urine samples were collected to evaluate the effect of Ca supplementation on a number of urinary measures, including Ca, citrate, malate, and Ca oxalate levels, pH, and Ca:citrate ratio. In both sexes, CCM-OJ provided an alkali load that significantly increased urinary pH compared to basal levels and versus milk consumption, and also increased urinary citrate excretion versus basal levels. An elevated urine pH and citrate level are generally considered to reduce Ca oxalate supersaturation and crystallization potential (Odvina, 2006). However, in this study the relative supersaturation measurement for Ca oxalate was not different between the CCM-OJ and milk treatment groups, or between either treatment and the basal levels. Although the alkalizing effect of milk was less than that of CCM-OJ, it also induced a higher urinary pH compared to basal levels (p < .01 and p < .05 in women and men, respectively). The biochemical changes in urine associated with both CCM-OJ and milk consumption in this study indicated the two beverages were equally effective at modifying stone formation risk factors in hypercalciuric adults. These findings suggest that normocalciuric individuals are therefore unlikely to be put at increased risk of kidney stones due to consumption of these beverages at the moderate intake levels tested in this study. Furthermore, vegans, and individuals with lactose intolerance and/or a milk protein allergy, should be able to supplement with CCM-OJ with minimal risk for stone formation.

D. No effect on the status of other minerals (Fe, Zn, Se, and Mg) The chemistry of metal ions and their interactions with other molecules or ions in food/beverage matrices, in dietary supplements, and in the body itself, has great biological relevance. For decades now, Ca has been

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

309

heavily promoted by health professionals as one of the most important minerals to regularly consume in adequate amounts to reach one’s potential peak bone mass and to protect against bone loss. As is expected in complex systems, a high Ca intake naturally alters the body’s mineral status, which conceivably might exert an interactive effect in terms of altering the bioavailability of other minerals, such as magnesium (Mg), iron (Fe), zinc (Zn), and selenium (Se). That possibility has been a concern which has been investigated in both human studies and animal experiments over the years. It has already been established that the potential exists for various forms and sources of Ca to interact with and interfere with micro- and macromineral bioavailability (Cook et al., 1991; DawsonHughes et al., 1986; Deehr et al., 1990; Smith, 1988). Based on an overview of numerous studies, the extent to which Ca and trace mineral interactions occur appears to be related to such factors as the source of Ca, the ratio of Ca in relation to other minerals, the timing of Ca and trace mineral intake, meal interactions, food formulations, and natural food chemical compositions (Smith, 1988). As described in the following sections, CCM has been evaluated for its impact on the absorption of other minerals and, based on the results of these studies, appears to provide a unique delivery system for dietary Ca that does not appreciably affect the availability or status of other minerals.

1. Iron Iron deficiency is considered to be the most prevalent nutrient deficiency worldwide (Ilich-Ernst et al., 1998; Turnlund et al., 1990). Depletion of iron in the blood as a result of low dietary iron intake, inadequate intestinal absorption, or increased iron losses can lead to iron-deficient anemia (Haas and Brownlie, 2001). Iron exists in two forms, heme and nonheme. Heme iron (Fe2þ) is the central pigmented oxygen-carrying portion of hemoglobin and myoglobin protein molecules in animal tissues. Nonheme iron (Fe3þ) is derived from plant tissues and animal tissues other than hemoglobin and myoglobin. Heme iron is better absorbed than nonheme iron because the former binds fewer of the luminal iron chelators that more readily bind inorganic iron (Conrad and Umbreit, 2002). The availability of iron is affected by dietary components known to inhibit iron absorption in a dose-dependent manner (Hallberg, 1998). Inhibitors of iron bioavailability generally include, although are not limited to: phytates (Hurrell et al., 1992), fibers (Hallberg, 1987), Ca (Hallberg, 1998), phosphate (Monsen and Cook, 1976), ethylenediaminetetraacetic acid (EDTA) (Cook and Monsen, 1976), tannic acids (Brune et al., 1989), and other polyphenols (Cook et al., 1995). Chronic exposure to elevated levels of supplemental Ca has also been implicated in reducing hemoglobin concentrations in both animals (Smith, 1988) and humans (Hallberg, 1998).

310

Susan Reinwald et al.

Hemoglobin is the iron-containing oxygen-transport metalloprotein in red blood cells (RBCs) of the blood in humans and animals. Heme and non-heme iron each enter intestinal mucosal cells via different specific receptors on the luminal mucosal surface (i.e., Fe2þ via divalent metal transporter-1 and Fe3þ via mobilferrin-integrin) (Roughead et al., 2002). Since the absorption of both types of iron can be affected by Ca, it is hypothesized that a disruption to iron absorption, caused for example by competitive binding (Hallberg, 1998), may occur at some point of transfer within the mucosal cells or at the site of release from the intestinal cell into the circulation (Perales et al., 2006; Smith, 1988). The potential for Ca to interfere with the bioavailability of Fe can also be related to numerous other factors including the presence of Fe chelating agents, such as various organic acids, that form acid–Fe complexes of variable solubilities (Salovaara et al., 2002). The effect of the source of Ca on the magnitude of Ca–Fe interactions in vivo was assessed in rodents (Smith, 1988), using a whole body radioisotopic retention test as an endpoint to determine true iron bioavailability (i.e., Fe that is absorbed and utilized). A single 50 mg liquid dose of 59 Fe-labeled FeCl3 was administered by oral gavage to rats at a Ca:Fe ratio of 60:1 and 120:1 to replicate a human iron intake of
15 mg/day and a Ca intake of 800 mg/day or 1600 mg/day, respectively. Ca sources included CaCO3, Ca Phosphate (CaP), bone meal, and Ca hydroxyapatite (CaHA), while the control dose contained no Ca and was normalized to represent 100% Fe retention for comparison purposes. Isotope counts were performed immediately after dosing (to measure 100% retention) and subsequent counts over 6 days were divided by the 100% count to estimate Fe retention. For CaCO3, Fe retention was 68% at a Ca:Fe ratio of 60:1, and only declined a further 2% when the ratio was increased to 120:1. Fe retention values for other forms of Ca at a 60:1 Ca:Fe ratio were as follows: 77% for bone meal, 89% for CaP, and 99% for CaHA. Fe retention decreased in response to the higher Ca:Fe ratio of 120:1 (i.e., Fe retention in the presence of bone meal, CaHA, and CaP was 49%, 72%, and 78%, respectively). This is indicative of a dose-response effect of Ca on Fe retention. This study also underscored the importance of the source of Ca in relation to Fe retention. Possibly due to the organic anions that accompany the Ca in CCM (Deehr et al., 1990) and/or the components of the food matrix to which CCM is added, the Ca–Fe interactions that typically interfere with Fe bioavailability seem not to be of significant nutritional detriment (Mehansho et al., 1989a). The positive nutritional effects of the fruit beverage components citric acid and ascorbic acid were demonstrated in a rat experiment (n ¼ 6/group) that evaluated Ca and Fe bioavailability following consumption of OJ with added CCM versus an aqueous control, that is, CCM in deionized water (H2O) (Mehansho et al., 1989a).

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

311

Whole-body isotope retention experiments were performed (via the method described above in the Smith experiment and with confirmed corrections for isotope decay rates), using extrinsically labeled ferric chloride hexahydrate and Ca from CCM (i.e., [59Fe]FeCl3 and [47Ca] CaCl2) to determine the bioavailability of these minerals at an Fe:Ca ratio of 1:167 mol/mol. CCM solubility was also assessed via a filtration method. CCM solubility was 73.3% in H2O compared to 100% in OJ. To put these solubility values in perspective, CaCO3 in water was tested using the same method and its solubility was only 5%. Subsequent whole-body isotopic counting revealed that Ca in H2O significantly reduced Fe retention from 43.1% for Fe þ H2O to 12.3% for Ca þ Fe þ H2O. Compared to water (control), OJ significantly (p < .05) enhanced the bioavailability of Ca ([47Ca] retention was 42.8% vs 33.0%, respectively) and Fe ([59Fe] retention was 38.0% vs 8.0–12.3%, respectively). Various components of OJ, including citric acid, ascorbic acid, fructose, and sucrose, were then methodically added back to the aqueous control in the presence of Fe and Ca to establish which of these components, alone or in combination, were contributing to the improved Ca and Fe retention associated with the OJ vehicle. The addition of citric acid to water, at a level equivalent to the amount present in OJ (41.6 mM, pH 3.9), lowered the pH of water from 6.5 to 4.0 and completely solubilized added CCM. Nonetheless, the extent to which in vitro solubility is relevant to final absorption is an issue that remains controversial (Heaney, 2001b). In fact, added citric acid did not appear to alter Ca absorption from the water vehicle; however, citric acid significantly increased Fe retention when added to water containing CCM (8.0% vs 23.7%). Fe retention was further increased (23.7–37.6%) by the addition of ascorbic acid (i.e., Fe þ Ca þ cit þ AA þ H2O). Conversely, ascorbic acid added to H2O þ Fe þ Ca in the absence of citric acid did not alleviate the significant reduction (30.8%) in Fe retention attributable to Ca–Fe interactions. In OJ, Ca–Fe interactions were not significant in terms of interfering with Fe retention. In water, added citric and ascorbic acid mitigated the negative effect of Ca on Fe absorption and, as a result, Fe retention was comparable to OJ. Addition of fructose and/ or sucrose, with or without added citric or ascorbic acid, did not significantly influence 59Fe retention. Citric acid was determined to be the most effective component in OJ contributing to high Fe retention in the presence of CCM. In the Mehansho et al. experiment, the potential for ascorbic acid to solubilize Fe was reported to be limited to low pH environments. Other investigators have reported that ascorbic acid facilitates iron absorption by forming a chelate with ferric iron at an acidic pH that remains soluble at the alkaline pH of the duodenum (Lynch and Cook, 1980). Salovaara

312

Susan Reinwald et al.

and coworkers observed a 70-fold increase in Fe3þ uptake resulting from 80 mmol/L AA at a low acid concentration in the CaCo-2 cell line (Salovaara et al., 2002). The presence of both citric and ascorbic acids in a beverage that also delivers a soluble source of Ca therefore appears to be most desirable for maximizing Fe bioavailability. The value of CCM as a Ca source that does not antagonize Fe absorption was confirmed among a cohort of 19 healthy postmenopausal women (mean  SD: 63  6 years) using a single-blind, placebo-controlled, randomized crossover design (Deehr et al., 1990). Whole-body retention of 59 Fe was tested at baseline and immediately after the ingestion of an extrinsically labeled test meal containing the radiolabel 59Fe at 1.85 105 Bq as FeSO4. Immediately after the test meal, each subject received either placebo tablets with 450 ml water or 500 mg elemental Ca in the form of (i) 450 ml whole milk, (ii) 450 ml OJ þ CCM (comprising a 6:2:3 molar ratio of Ca:citrate:malate), or (iii) two CCM tablets with 450 ml water. Precisely 30 min after the start of the meal a second whole-body count was performed and subjects were subsequently fasted for 4 h, with the exception of drinking 250 ml distilled water. A steady state condition for 59Fe in humans is typically reached between 10 and 14 days (Wienk et al., 1999). Participants returned every 2 weeks for an additional whole body scan before repeating the same procedure with the next treatment. Serum concentrations of ferritin, which have a direct correlation with the total amount of Fe stored in the body (Jacobs and Worwood, 1975), were also measured via radioimmunoassay (RIA). In comparison to the placebo, Fe absorption from milk and CCM in H2O was reduced by 60% and 30%, respectively (p < .05). A relatively small reduction in Fe retention (11%) in response to CCM in OJ was not significantly different from placebo. In humans, the Ca in milk has been reported to be as inhibitory to Fe absorption as Ca in the form of CaCO3 and HA (Dawson-Hughes et al., 1986). The lack of antagonism to Fe absorption associated with CCM in OJ is believed to be attributable to the presence of citric acid and ascorbic acid in the OJ and the organic anions in CCM. Cow’s milk also contains organic acids, although at much lower levels. Cow’s milk contains
150 mg citrate/100 ml (Linzell et al., 1976) and 2 mg ascorbic acid/100 ml (Platt and Moncrieff, 1947), whereas OJ contains between 838 and 2539 mg citric acid/100 ml as free and combined citrate (Walton et al., 1945) and
30–40 mg ascorbic acid/ 100 ml (Lee and Coates, 1997). Smith and Rotruck (1988) previously suggested that Ca and Fe do not compete for the same ligands in OJ. However, citrate is a polyvalent anion with binding affinity for both trivalent (Fe3þ) and divalent cations (Ca2þ) (Pierre and Gautier-Luneau, 2000). It therefore appears that OJ has an ample supply of organic anions (e.g., citrate, malate, and ascorbate) to effectively chelate, solubilize, and enhance the bioavailability of both mineral cations.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

313

Ilich-Ernst et al. (1998) have confirmed the lack of effect of Ca from CCM on Fe status over 4 years in a randomized, double-blind, placebocontrolled intervention trial involving 354 healthy Caucasian girls (mean  SD: 10.8  0.8 years). The participants were initially at Tanner stage 2 of puberty and subsequently became menarcheal. Girls at this stage of development are considered to have high Ca and Fe requirements (i.e., 1300 mg Ca/day and 8–15 mg Fe/day according to current nutritional guidelines). Subjects consumed either placebo tablets or 1000 mg elemental Ca as CCM in tablet form. After assessment of dietary records and adjustments for treatment compliance, Ca supplemented subjects during the course of the study had a total Ca intake of
1500 mg Ca/ day, of which
700 mg was CCM. Participants in the placebo group averaged
829 mg Ca/day from dietary sources. Serum ferritin and RBC indexes were evaluated annually and at 4 years, respectively. Serum ferritin concentrations were not significantly different between girls in the CCM or placebo group at baseline or at any annual assessment point over 4 years. The lack of antagonism of CCM on Fe status was corroborated by RBC indicators (i.e., hemoglobin, hemocrit, and corpuscular indexes) that were also similar at 4 years between both groups. In summary, results from both rodent and human studies indicate that OJ is an excellent vehicle for the Ca source CCM in terms of ensuring high bioavailability of both Ca and Fe.

2. Zinc The potential for interaction between supplemental Ca and the trace element Zn, resulting in impairment of Zn utilization, is of particular concern now that recommended optimal intakes of Ca are as high as 1500 mg/day (NIH Consensus Development Panel on Optimal Calcium Intake, 1994). Ca antagonism of Zn absorption or utilization has been reported in some studies, but not in others. Wood and colleagues demonstrated that milk and lactose-free milk significantly reduced Zn absorption in both lactose-tolerant and intolerant postmenopausal women (Wood and Hanssen, 1988). Bertolo et al. (2001) reported that an amount of Ca similar to that present in infant formulas results in a 42% reduction in Zn uptake in piglets. Various other animal studies have also indicated that Ca interferes with Zn status (Dursun and Aydogan, 1994; Hoekstra et al., 1967; Smith, 1988). Zinc is an essential trace element required to support normal growth and development (Lind et al., 2004). It is also integral to a healthy immune system (Frassinetti et al., 2006), DNA synthesis (Wu and Wu, 1987), and serves as a cofactor to a large number of enzymes and transcription factors in the body (Chimienti et al., 2003). The requirement for zinc is especially important in rapidly growing children, developing adolescents, and pregnant women because of the

314

Susan Reinwald et al.

increased need to endogenously synthesize numerous Zn-containing proteins during these life stages. A number of researchers have suggested that antagonism among ingested minerals at the site of uptake in the intestines represents the underlying mechanism of action for Ca interference with Zn absorption, since divalent minerals appear to compete with each other for brush border membrane transport mechanisms (Gunshin et al., 1991; RothBassell and Clydesdale, 1991). Although this is a viable hypothesis, it does not account for the lack of effect of Ca on Zn bioavailability reported in certain studies (Dawson-Hughes et al., 1986; Lonnerdal et al., 1984; Spencer et al., 1984; Yan et al., 1996). It is likely that interactions between ingested Ca and Zn are complex, involving a combination of various factors that may influence bioavailability. These include the following: Ca:Zn ratios, the timing of ingestion of each mineral (e.g., simultaneously or separately; with a meal or between meals), competitive interactions between Ca and Zn for binding sites of ligands present in food or beverages [e.g., phytates, hemicelluloses (Walsh et al., 1994)], the solubility of Ca and Zn in relation to their own concentration and the concentration of other minerals present, their solubility in the presence of certain food components (Corneau et al., 1996) [e.g., formation of poorly soluble, digested, and absorbed Ca-phytate-Zn or phytate-Zn-Ca-amino acid side-chain complexes (Erdman and Fordyce, 1989)], and possibly the Ca source that is ingested. The source of Ca as a factor integral to Zn bioavailability was investigated by Smith via whole-body retention studies in rats that were administered a single-dose of 65Zn-labeled ZnSO4 and supplemented with either CaCO3, CaP, bone meal, or CaHA at Ca:Zn ratios of 60:1 and 120:1 (Smith, 1988). The 120:1 Ca:Zn ratio best approximates the daily recommended intakes of Ca and Zn for U.S. women aged between 19 and 50 years (i.e., 1000 mg Ca/day and 8 mg Zn/day or Ca:Zn of 125:1). Similar dosing and retention assessment protocols were used as described previously for 59Fe retention in rats (Smith, 1988). Compared to the placebo group receiving no Ca, rats supplemented with CaCO3 demonstrated a 25% decrease in Zn retention at the 120:1 ratio, while CaP, bone meal, and CaHA depressed Zn retention as much as 50–60%. Although these animal data suggest that Ca source can significantly impact Zn retention, Dawson-Hughes et al. (1986) did not detect an effect on Zn bioavailability from dosing postmenopausal women with either CaCO3 or CaHA based on whole-body extrinsically labeled 65Zn retention. For reasons pertaining to poor patterns of food selection and low energy intakes, many adolescent girls in industrialized countries do not consume diets containing the recommended amount of Zn to meet their physiological requirements (DRI for adolescent girls in the US ranges from 8 to 9 mg/day) (Gibson et al., 2002). Antagonism of Zn utilization

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

315

from a high-Ca diet could potentially exacerbate a suboptimal Zn intake. A metabolic study was designed to determine the effect of long-term Ca supplementation on Zn utilization in 26 healthy Caucasian adolescent girls (mean  SD: 11.3  0.5 years), all of which were within one SD for various anthropometry and bone mass measurements (McKenna et al., 1997). Subjects were randomized to receive either 1000 mg Ca/day as CCM (n ¼ 13) or placebo tablets (n ¼ 13). To facilitate adaptation of the girls to higher Ca intakes, supplementation with CCM began 15 weeks prior to a 14-day balance study. The initial 7 days of the balance study involved equilibration and adaptation to a controlled basal dietary intake of 722 mg Ca/day and 6.3 mg Zn/day, in addition to the assigned treatment. All biological samples (feces and urine) were collected within discrete 24-h periods during days 8–14 and identical meal samples were chemically analyzed for Ca and Zn content by standard laboratory procedures. According to results of the McKenna et al. study, a high-Ca intake (1000 mg/day as CCM þ 667 mg Ca/day on average from the diet) did not antagonize Zn absorption (p > .05) when 5.5 mg Zn was in the diet (
46% of the RDA). During the 15 week lead up to the balance study, the intake of Zn among participants, based on dietary records, was estimated to be 67% of the RDA. Five girls (four in the placebo group and one in the CCM group) were determined to be in negative Zn balance. Ideally, for a balance study it is preferable to employ a crossover design in the same subjects to minimize any confounding effects that are constant within an individual (Weaver and Heaney, 2006c). Overall, the high Ca level in this study did exceed the optimal recommended intake for adolescent girls and Zn intake was marginal, yet supplementary CCM did not appear to exert an adverse effect on Zn absorption.

3. Selenium Selenium (Se) is a non-metal element predicted to interact predominantly with nutrients that have an effect on the pro-oxidant/antioxidant balance of cells (Dodig and Cepelak, 2004). As an essential trace mineral, Se shares many chemical properties with sulfur (Burk, 1983). It is an integral cofactor of the Se-dependent glutathione peroxidase system (GSH-Px), which functions as a group of water-soluble enzymes to catalyze destruction or neutralization of water-soluble and membrane-bound hydroperoxides that are capable of causing free radical damage due to reactive oxygen species (Bettger, 1993). Se is also essential for normal functioning of the thyroid gland and immune system and it has a protective, as well as therapeutic, role in different diseases (Dodig and Cepelak, 2004; Greger et al., 1981). The amount of Se derived from both vegetable and animal products in the diet is dependent on the Se content of the soil in the geographical area

316

Susan Reinwald et al.

in which animals are raised and produce is grown. Therefore, determining the propensity for dietary Ca and Se interactions has been of particular interest to those raising livestock in Se-poor regions. Animals in these regions generally have a compromised Se status, so that any additional interference to the utilization of ingested Se by high Ca intakes is obviously undesirable. In swine, an increase in dietary Ca enhanced Se retention, whereas low levels of dietary Ca appeared to interfere with Se absorption (Buescher et al., 1961; Lowry et al., 1985). In dairy calves, a wide range of dietary Ca intakes had no significant effect on 75Se absorption (Alfaro et al., 1987). Alternatively, others showed that dietary Ca derived from limestone (comprised primarily of CaCO3) and the Ca naturally present in hay quantitatively affected apparent Se absorption in a curvilinear manner in non-lactating cows (Harrison and Conrad, 1984). Interactions between dietary Ca and Se that significantly influence overall Se retention do not appear, thus far, to have been reported in humans (Greger et al., 1981). A couple of theories have been proposed to explain how dietary Ca might possibly affect Se utilization. It has been suggested that Se availability may be directly influenced by intestinal interactions involving Ca or minerals linked to Ca utilization (e.g., phosphorus) (Lowry et al., 1985). Indirect effects on the capacity of a target tissue to respond to Se are also considered possible means by which bioavailability or retention might be influenced (Parizek, 1978). It has also been conjectured (Hill and Matrone, 1970; Howell and Hill, 1978) that elements with valence shell electronic structures most similar to Se (i.e., Se2–, Se4þ, and Se6þ) are most likely to act antagonistically. Based on this criterion, Ca2þ does not fit the profile of a probable Se antagonist. To address the question of whether Ca intake influences Se utilization, the impact of Ca supplementation during puberty on Se parameters in adolescent girls was investigated (Holben et al., 2002). The objective was to test their hypothesis of no interactive effect of Ca in the form of CCM on Se status. Subjects included 16 healthy Caucasian adolescent girls in Tanner pubertal stage 2 that ranged in age from 11 to 14 years during the 3 year intervention. Annual 2-week balance studies were conducted under strictly controlled conditions in a metabolic ward, during which data were collected to estimate Se absorption, retention, and blood status (i.e., erythrocyte Se and GSH-Px and serum GSH-Px). The effect of supplementation with 1000 mg Ca/day as CCM tablets (n ¼ 7) versus methylcellulose placebo tablets (n ¼ 9) was evaluated, while dietary Se was maintained at a level of
100 mg/day and Ca from food was the same for each group. Self-selected diets prior to and between each balance study were assessed for Se and Ca intakes via dietary records. Girls were adapted to the metabolic diet during week 1 of the balance study and during week 2 total daily excreta were collected for chemical analysis by

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

317

standard methods. Se retention (mg/day), calculated as Se intake [fecal Se þ urinary Se], and apparent Se absorption (%), calculated as 100x [(Se intake fecal Se)/(Se intake)], were subsequently measured annually for each group and statistically compared. A lack of difference in all Se parameters, except for higher fecal Se excretion during the second balance study in the Ca-supplemented group (by
5 mg Se/day), persuaded the investigators to pool the data and not stratify results by Ca treatment rather than by years. By the investigator’s own admission, the power to detect treatment differences may have been limited by the small sample size. The overall conclusion was that Se status in the adolescent girls was not adversely affected by long-term daily consumption of 1775 mg Ca/day, of which 1000 mg Ca/day came from CCM. Moreover, the apparent percent absorption of Se in this cohort actually exceeded that of adults based on the results reported in previous Se balance studies (Holben et al., 2002).

4. Magnesium Magnesium (Mg) is a divalent element required for energy metabolism, muscle contraction and relaxation, nerve impulse transmission, bone mineralization, enzyme function, and numerous other physiological functions (Dominguez et al., 2006; Rude, 1998). A chronic deficiency of Mg may influence cardiac and vascular diseases, renal failure, hypoparathyroidism, and bone health. Dietary Ca and Mg reportedly interact via numerous dynamic and complex mechanisms that are not fully understood. Recommendations for higher daily Ca intake raise the question of whether Mg status might be negatively influenced, particularly when Mg intake is marginal. To date, results of studies that assessed the effect of high-Ca intake on Mg status in adults are inconsistent, although according to Sojka et al. (1997) the majority of investigators believe that Ca does not interfere with Mg balance. Other reports concerning the effect of high Ca intake as CCM on Mg status in adolescent girls also exist (Andon et al., 1996a; Sojka et al., 1997). The effect of a high-Ca intake on Mg balance in 26 healthy, Caucasian, adolescent females (mean age: 11.3 years) was investigated in a 14-day double-blind study (Andon et al., 1996a). The subjects comprised a subset of girls from a larger ongoing placebo-controlled Ca trial, selected based on the closeness of their anthropometric and bone measurements (all within one SD). Girls were assigned to either a low-Ca group (n ¼ 13) that consumed placebo tablets, or a high-Ca group (n ¼ 13) that consumed 1000 mg elemental Ca/day as CCM. Treatments began 15 weeks prior to the balance study to facilitate adaptation to the higher Ca intake. Food intake during this period was self-selected and monitored by dietary records.

318

Susan Reinwald et al.

The 14-day balance study was conducted in a metabolic unit and the first week served as an adaptation period. During week 2, all excreta and duplicate food samples were collected for analysis by standard analytical methods. The basal diet for all subjects was rigorously controlled at the metabolic facility. The mean daily intake of Mg among the girls in this study was 176 mg/day, which is less than the current DRI of 240 mg/day for females aged 9–13 years. Daily Ca intake from food sources was 667 mg/day or approximately half the current RDA. Even though girls in the CCM-supplemented group consumed a significantly higher amount of Ca (1667 mg/day) than the placebo group (667 mg/day) (p ¼ 0.0001) for an extended period of time, Mg utilization was not different (p > 0.05) between treatments in terms of urinary, fecal, and total Mg excretion (mg/day), or Mg balance (mg/day). Furthermore, Mg absorption as a percentage of intake was not significantly different (50% vs 55% for the low and high-Ca intake groups, respectively). Based on these results, it was concluded that a high-Ca intake comprising 1000 mg Ca/day as CCM in addition to 667 mg/day dietary Ca, does not put adolescent girls at risk of compromising the utilization of dietary Mg. A randomized cross-over design was employed to assess the effect of high versus low Ca intake on Mg metabolism (Sojka et al., 1997). Five healthy adolescent girls (mean  SD: 12.8  0.8 years) participated in two 21-day balance studies separated by a 5-week washout period. The control (low-Ca) diet contained 800 mg Ca/day from dietary sources, whereas the high-Ca diet included an additional 1000 mg Ca/day as CCM from four servings of a fortified fruit drink (total intake of 1800 mg Ca/day). Both diets included 300 mg Mg/day. Subjects adapted to the study diet for 7 days prior to Mg tracer administration. An oral dose of 40 mg 26 Mg 1 h after breakfast (measures dietary Mg), was followed by an intravenous injection of 20 mg 25Mg 1 h later (measures Mg removal from the blood). Relative to the time of injection, blood samples were drawn at 1, 1.5, 2, 3, 4, 6, 8, 12, 24, 48, and 72 hr. Complete urine collections were performed at 8, 8–16, and 16–24 h, as well as every 24 h thereafter through 14 days. Complete fecal collections were also made through 14 days. Excreta and diet samples were chemically analyzed for Mg by atomic absorption spectroscopy and stable isotope enrichment was measured using thermal ionization mass spectroscopy. Tracer data were fitted on the basis that Mg was in a steady state and analysis was via an eight-compartment model using the SAAM (Simulation Application for the Analysis of Models) kinetic modeling program. The results showed that a low- versus a high-Ca diet did not significantly (p > 0.05) influence the Mg kinetics or balance based on fecal and urinary excretion (mg/day) and absorption parameters (% and mg/day). The low-Ca intake resulted in a mean Mg absorption of 44%, whereas absorption averaged 39% on the high-Ca diet. The urinary Mg excretion

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

319

data in this study has been criticized (Sabatier et al., 2003) for being underestimated based on a divergence of the kinetic model-generated curve and observed values in the early part of the curve (see Fig. 2c in the following reference, Sojka et al., 1997). A kinetic modeling approach has the advantage of providing an understanding of pool sizes of Mg in relation to compartments and the rate of Mg transfer between them, as opposed to balance studies in which the measured balance (positive or negative) may reflect changes in body pool sizes rather than in total body stores (Sojka et al., 1997). Utilization of a crossover design in Andon’s study (Andon et al., 1996a) would have strengthened the conclusions, although this may not have been possible with the subset of participants being selected from another larger trial. However, in general the Andon et al. and Sojka et al. studies are in agreement with regard to the conclusion that CCM does not negatively influence Mg status in adolescent girls consuming in excess of the RDA for Ca. Based on the balance of the evidence to date, it appears that CCM does not significantly interfere with the status of other minerals including Fe, Zn, Se, and Mg. It is widely acknowledged that Ca does have the potential to interact with other elements based on its chemical properties in certain environments. In many instances, accompanying food components or ingredients can change the dynamics of these mineral interactions by either facilitating or interfering with mineral solubility, absorption, and utilization (i.e., bioavailability). In the case of CCM, more often than not its chemical composition in complex systems or as a dietary supplement is advantageous or neutral, rather than inhibitory, in relation to the utilization of other minerals.

E. Effect on serum lipids Over time, hypercholesterolemia, or high blood cholesterol, can accelerate the onset of atherosclerosis and increase the risk of cardiovascular events such as stroke, myocardial infarction, and transient ischemic attacks. Excess saturated fatty acids (SFA) in the diet have the most dramatic effect in terms of elevating serum cholesterol level, particularly the low density lipoprotein (LDL) fraction that is implicated in exacerbating cardiovascular disease risk. There is increasing evidence suggesting that the absorption of saturated fatty acids can be reduced by the presence of high levels of Ca in the diet (Denke et al., 1993; Reid et al., 2002; Shahkhalili et al., 2001; Welberg et al., 1994). The mechanism involves formation of insoluble Ca-SFA soaps in the gastrointestinal tract (Teegarden, 2006) that precipitate out of solution and are excreted in the feces rather than incorporated into biliary micelles. The tendency for significant fecal elimination of Ca soaps is dependent upon the amount and nature of the Ca

320

Susan Reinwald et al.

compounds and fats present, in addition to the acidity of the intestinal contents (Boyd et al., 1931). CaCO3 has been the subject of most of the Ca-SFA interaction investigations thus far. Bell and coworkers reported an LDL cholesterol (LDL-C) reduction of 4.4% (p ¼ .001) and a high density lipoprotein cholesterol (HDL-C) increase of 4.1% (p ¼ .031) in hypercholesterolemic patients administered 1200 mg CaCO3/day for 6 weeks in a placebo controlled crossover study (Bell et al., 1992). The HDL-C fraction of serum lipids is associated with protective effects in relation to cardiovascular health. Bostick and colleagues on the other hand found no significant effect of supplementation with 1000 or 2000 mg CaCO3/day over 4 months on serum total cholesterol or HDL-C concentrations in 193 men and women (Bostick et al., 2000). No effect of 1000 mg CaCO3/day on LDL-C was detected in hypotensive and normotensive outpatients during 8-week test periods in a double-blind, placebo-controlled crossover study (Karanja et al., 1987). A similar study design tested the effect of 1000 mg supplemental Ca/day as CaCO3 during two 10-week periods on serum cholesterol concentrations in 50 children with familial hypercholesterolemia (type II-A; age range 4–19 years) (Groot et al., 1980). LDL-C in the children decreased by 4% (p < .05) and apolipoprotein A-1 (or Apo A-1, which improves the cholesterol clearing capacity of HDL-C) increased by 4% (p < .05). Children in the Groot et al. study were on low cholesterol high polyunsaturated fat diets that have not been shown to result in significantly increased fecal fatty acid excretion. A short-term, randomized, double-blind, crossover study examined the effect of CaCO3 supplementation (900 mg Ca/day) on digestibility of saturated fat in chocolate containing high levels of cocoa butter (Shahkhalili et al., 2001). In this study, Ca supplementation resulted in a substantial LDL-C reduction of 15% (p < .02). A 1-year randomized study assessed the effects of 1000 mg Ca/day as Ca citrate on the serum lipid profile of 223 healthy postmenopausal women (Reid et al., 2002). A nonsignificant (p > .05) 6% reduction in LDL-C, a 7% increase in HDL-C (p ¼ .01) was observed along with a significantly improved HDL-C:LDL-C ratio (p ¼ .001) for Ca citrate versus placebo. The LDL-C lowering effect of supplemental Ca appears to be quite variable. Only one study thus far has evaluated the effect of CCM fortification of the diet on serum lipid profiles. It was a randomized, single-blind, crossover metabolic diet study with two 10-day periods separated by a 10-day washout (Denke et al., 1993). The subjects included 13 healthy men (mean  SD: 43  4 years) classified as moderately hypercholesterolemic (mean  SD: 6.19  0.37 mmol serum cholesterol at baseline) and with a low baseline Ca intake (mean  SD: 466  199 mg Ca/day). The low-Ca basal diet contained 34% energy from fat (primarily as beef tallow), 13% from saturated fat, 240 mg cholesterol/day, and 410 mg Ca/day. The high-Ca diet was similar in composition except that CCM

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

321

supplementation brought the total Ca intake to 2200 mg/day. CCM was added to the daily diet in the form of fortified OJ (550 mg Ca) and muffins (750 mg Ca), as well as two CCM tablets (500 mg Ca). Baseline serum cholesterol concentrations were measured and during the last 3 days of each dietary period, subjects were monitored in a metabolic ward and fecal, urinary, and blood samples were collected. It was assumed, based on the results of other studies cited by the authors, that by this time 90% of the dietary induced effects on LDL-C would have reached a steady state. Results of the Denke et al. study demonstrated that fecal SFA excretion was increased by 7% with the addition of high levels of Ca as CCM. Relative to the low-Ca diet, the high-Ca diet also resulted in an 11% reduction of LDL-C, a 6% reduction in total cholesterol, and a 7% decrease in apolipoprotein B (or Apo B, which is a primary component of LDL-C). The changes in the serum lipid profile were statistically significant (p < .05). HDL-C and Apo A-1 were not significantly different between low- and high-Ca intake, nor was there a Ca effect on bile acid excretion. Further analysis of the data revealed that the increase in fecal fat excretion did not entirely account for the higher than expected reduction in serum cholesterol level, suggesting that the hypocholesterolemic effect of CCM may involve other mechanisms that are not yet understood. Diets high in SFA have been shown to be the most responsive to the cholesterol lowering effect of Ca supplementation. Although only evaluated in a single study, CCM appears comparable to other Ca sources in terms of its cholesterol lowering potential. Higher intakes of Ca, up to 2 g/day, generally appear to be most effective at reducing LDL-C and increasing fecal fat excretion. Supplementation of Ca at high doses may raise concerns about predisposing certain individuals to kidney stone formation. However, as previously discussed, this is less of an issue with CCM as a Ca source considering its citrate and malate content, its excellent assimilation as a fortificant in OJ, and the reduced lithogenic (i.e., calculi formation) potential (Harvey et al., 1985).

F. Colon health Colon cancer is currently the third leading cause of cancer deaths for men and women in the United States (American Cancer Society, 2006). The American Cancer Society predicted that during 2006 the incidence of new cases of colon and rectal cancer among Americans could be as high as 106,680 and 41,930, respectively (Jemal et al., 2006). During that same period, as many as 55,000 deaths were expected to be attributable to colorectal cancers ( Jemal et al., 2006). The etiology of colorectal cancer is complex and multifactorial; it is governed by dynamics such as genetic predisposition, family history, and exposure to infectious agents. In addition, modifiable factors include obesity, physical activity, alcohol and

322

Susan Reinwald et al.

tobacco intake (Kamangar et al., 2006; Kushi et al., 2006), and habitual consumption of a Western-diet high in fat and phosphate and low in Ca and vitamin D (Newmark et al., 1990; Richter et al., 1995). While early epidemiological studies examining the association between Ca intake and colorectal cancer largely yielded inconsistent results (Chia, 2004; Martinez and Willett, 1998), evidence from more recent prospective trials suggest a modest and more consistent inverse association between Ca intake and incidence of colorectal cancer (Schatzkin and Peters, 2004). It has been hypothesized that Ca counteracts the potential irritancy of secondary bile salts, essentially cytotoxic surfactants (Govers et al., 1996) produced during fat digestion, via the formation of poorly absorbable/insoluble soaps (Flood et al., 2005). The Ca fatty acid soap complexes formed in the lumen of the colon have a neutralizing, rather than an aggravating, effect on the colonic mucosa. Therefore, excessive proliferation of the mucosal cells is hindered (Flood et al., 2005). Ca also may exert direct protective effects on the proliferative rate of the colonic mucosa via other mechanisms independent of soap complex formation (Chakrabarty et al., 2005; Martinez and Willett, 1998). To test the effect of nutrition on murine colonic mucosa, a nutrient poor rodent diet (i.e., a stress diet) was formulated to mimic a Westerndiet that is high in fat (40% corn oil) and phosphate (0.8 mg P/kcal), and low in Ca (0.11 mg Ca/kcal) and vitamin D (0.11 IU/kcal) (Richter et al., 1995). The stress diet was fed to 74 6-week-old mice for 8 weeks. Subgroups of the mice were then either sacrificed or randomized to remain on the stress diet or were switched to one of two Ca-enriched rescue diets. The tricalcium phosphate (TCP) rescue diet was equivalent to the stress diet with the exception of substituting the low Ca content with 0.9 mg Ca/ kcal as TCP. The CCM rescue diet was comprised of the stress diet with 0.9 mg Ca/kcal as CCM. After another 6 weeks of feeding the designated diets (i.e., 14 weeks into the study), a subgroup of mice from each treatment leg was sacrificed for histological analysis. The remaining mice continued in their respective groups for an additional 6 weeks, at which time they were also sacrificed (20 weeks into the study). A nutrient adequate control diet (AIN-76) was fed to a fourth group of control mice throughout the experiment. After as few as 8 weeks, significant adverse mucosal alterations were induced in the sigmoid colon of mice fed the stress diet compared to control mice. Abnormal cell multiplication (i.e., hyperplasia) and a high rate of cell division (i.e., hyperproliferation) were observed. After 20 weeks, mice on the stress diet exhibited mucosal morphological abnormalities similar to those expected in animals administered carcinogens for the purpose of tumor induction (i.e., hyperplasia characterized by elongation of occasional colonic crypts in addition to enlargement and elongations of nuclei at the base of the crypts). Conversely, 6 weeks after

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

323

switching to the Ca rescue diets, [3H] thymidine labeling of colonic epithelial cells was not different in both rescue diets when compared to control levels. Epithelial cell numbers of mice on rescue diets also demonstrated no differences compared to control mice 6 weeks after switching to the TCP rescue diet and 12 weeks after switching to the CCM rescue diet. Despite the continuing risk to colon health from a stress diet high in fat and low in vitamin D, the addition of adequate Ca (as either TCP or CCM) to the diet reversed the induced hyperplasia and hyperproliferation. TCP is predicted to be more reactive in the lower gastrointestinal tract due to a lower solubility (0.002 g TCP solubilizes in 100 ml water under standard conditions) (Richter et al., 1995). The protective effect of CCM, a moderately soluble Ca salt [1.10 g of 6:2:3 ratio CCM/100 ml water under standard conditions (Fox et al., 1993a)] with potentially higher than average bioavailability, is presumed to be related to its reactivity in the upper gastrointestinal tract (Richter et al., 1995). Considering Ca is associated with numerous health benefits, maintaining an adequate Ca intake via diet and supplementation to also potentially increase protection against colorectal cancer seems like a reasonable recommendation.

VIII. LIMITATIONS OF CCM The benefits of CCM, which are supported by scientific research, have been well described in this chapter; however, potential limitations also need to be discussed. While the Ca content of anhydrous CCM (23.7% for the 6:2:3 molar ratio formulation) is higher than certain other soluble Ca salts (e.g., Ca lactate, Ca gluconate; see Table 6.3), it is well recognized that the Ca content of CCM is lower than that of insoluble Ca sources often used for food fortification. For example, CaCO3 and TCP are
40% and 39% elemental Ca by weight, respectively. Thus, fortification of a food or beverage to a given Ca level will require approximately half as much added CaCO3 or TCP as would be required for CCM. In certain non-fluid or low-moisture foods, a lower level of addition of the more Ca dense sources may translate into a sensory or processing advantage. Fortification of food and beverage products with premade, dried, CCM powder will cost more than fortification with CaCO3 or TCP to an equivalent Ca level. However, the cost of fortifying with CCM powder is likely to be comparable to fortification with other soluble Ca salts. For beverages and certain fluid foods, fortification can often be accomplished using an in situ approach that is a relatively cost-effective strategy for incorporating CCM into finished food and beverage products. In situ fortification refers to the formation of the CCM complex directly within the product of interest via addition of an alkaline Ca source (e.g., Ca(OH)2 or CaCO3) that reacts with the endogenous and/or added citric and malic

324

Susan Reinwald et al.

acids in the proper proportion to form CCM. This is the manner in which commercial CCM-fortified 100% juice, such as not-from-concentrate OJ, is produced. Another potentially cost-effective approach for CCM fortification is to produce a separate concentrated solution or slurry of CCM, starting with the alkaline Ca source and the citric and malic acids in the correct molar ratio. The concentrated CCM solution or slurry may then be added at a low level to the finished food or beverage product of interest to yield the desired level of fortification (Luhadiya et al., 2006). With respect to dietary supplements, CaCO3 is often favored because of the high Ca density and low cost. The number of tablets (or the size of the tablets) that one is required to consume to achieve a desired level of Ca supplementation is smaller for CaCO3 than for CCM or other soluble Ca salt of relatively low Ca density. However, a powdered dietary supplement, intended to be mixed/dissolved into beverages or other fluid foods (e.g., soups, sauces) by the consumer just prior to consumption, is a novel product form applicable only to a soluble Ca salt such as CCM. CCM is moderately soluble in water and has higher aqueous solubility compared to a number of other Ca sources often used for food fortification and in dietary supplements. However, the Ca lactate and gluconate salts have higher solubility that conceivably may be advantageous in unique applications when a very high concentration of the Ca salt is required (e.g., concentrated syrups and/or liquid nutritional supplements). It is well known that soluble Ca salts can potentially destabilize food systems if the conditions under which they are added are not carefully controlled (Vyas and Tong, 2004) or an incompatible Ca salt is used. CCM has been shown to be compatible with protein-rich beverages (e.g., milkbased, soy-based) that are heat pasteurized with a high-temperature short-time (HTST) process (Luhadiya et al., 2006). However, fortification of ultra-high temperature (UHT) treated milk products with high levels of soluble Ca may lead to excessive flocculation, thickening and/or sedimentation resulting from Ca-protein interactions. Addition of stabilizers and/or ingredients to reduce the Ca-protein complexation may help to minimize these undesired textural changes. While CCM is exceptionally well suited to fortification of juice beverages because of the compatibility of its organic anions with those naturally present in fruit, it does not provide a desirable taste profile in cola flavored beverages (Chang et al., 2002). Table 6.7 presents a comparison between CCM and CaCO3.

IX. CONCLUSION Ca consumption habitually falls short of the recommended AI for many subgroups in the population. These shortfalls represent a major health problem, one that is getting progressively worse over time as evidenced

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

325

by the increasing incidence of osteopenia, osteoporosis, and pathologic bone fractures in the United States and other industrialized nations. Currently, dietary Ca insufficiency appears to be related to food choice, based on the fact that calorie intake per person reached an all time high in the United States at the beginning of the twenty-first century (United States Department of Agriculture, 2003). Continual public health recommendations to consume adequate low-fat dairy products go unheeded by consumers. In the advent of a dietary Ca deficit, supplementation and fortification of foods and beverages with Ca can easily provide an additional amount of Ca without the addition of extra calories. The cornerstone to enhancing bone health depends largely on consumers being aware of the Ca-bone health connection and acknowledging the longterm implications nutrition can have on the quality of their lives. Making a conscious effort to discriminate between products and purchase Ca-fortified foods and beverages, or to regularly supplement, depends on a perception that adequate nutrition confers protective and beneficial health effects. To encourage consumption, Ca-fortified foods must be palatable to the extent that their taste and texture are equally or more preferred to the non-fortified products on the market. Ideal Ca fortificants are inconspicuous in food formulations and are adequately assimilable or bioavailable from the products in which they are incorporated. This is where CCM has an important and distinct advantage over other Ca sources that may be prone to precipitating out of solution, impart an undesirable taste or texture, and/or are not as bioavailable. CCM has been shown to be highly absorbable in numerous studies and its unique chemical composition lends itself to inclusion in a variety of food and beverage products that are consumed every day. CCM can be incorporated into many popular foods and beverages in amounts per serving that make an appreciable nutritional contribution, without significantly affecting taste and texture. On the balance of the available evidence from human and animal studies presented in this chapter, it appears that CCM is well absorbed across a wide range of compositions and circumstances. For example, studies using isotopic and pharmacokinetic methods have shown that CCM is highly absorbable by both children and adults, in both tablet and beverage form, when consumed at levels ranging from an acute dose to chronic consumption (i.e., 200 mg Ca to 700 mg Ca/day, respectively), and for compositions covering a broad range of Ca:citrate:malate molar ratios that bracket the 6:2:3 neutral salt (i.e., molar ratios from 5:1:1 to 1.0:1.8:1.5 or the equivalent 6:10.8:9). This chapter has highlighted the current body of scientific evidence that demonstrates CCM plays an important role in terms of facilitating Ca retention and bone accrual in children and adolescents. CCM effectively enables adults to consolidate and maintain bone mass, it works in

326

Susan Reinwald et al.

TABLE 6.7 Comparison of CCM with Ca carbonate

Absorbability

Ca density Cost

Ease of use in a dietary supplement

Optimal application as a food fortificant

Stability

CCM

CaCO3

Organic form of Ca in a soluble ionized state — the presence of stomach acid is less essential for adequate Ca absorption Intermediate (23.7%) More expensive on an equivalent Ca basis

Inorganic form of Ca, negligible aqueous solubility, requires the presence of food to stimulate gastric acid secretion for adequate absorption High (40%) Less expensive (raw material abundant and low cost) Higher Ca density allows for fewer (or smaller) pills/tablets

Lower Ca density translates to more pills/tablets (or larger pills/tablets) to deliver a given Ca dose Dissolution rate can be tailored which, along with the moderate aqueous solubility, allows for a powdered dietary supplement that can be mixed/dissolved into beverages or other fluid foods (e.g., soups, sauces) by the consumer just prior to consumption Compatible in neutral and acid systems. Optimal in beverages and fluid food matrices Does not precipitate in beverages at high concentrations.

Not applicable to a powdered dietary supplement form

Optimal in non-fluid or low-moisture products, in which the higher Ca density may be advantageous (e.g., dry cereal or food bars) Greatly increases the heat stability of skim milk powders. Potential for (continued)

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

TABLE 6.7

327

(continued) CCM

Taste profile

Compatible with protein-rich beverages (e.g., milk-based; soybased) treated with high-temperature short-time (HTST) pasteurization. However, may be issues with flocculation, thickening, or sedimentation due to Ca-protein interactions when subjected to ultrahigh temperature (UHT) heat treatment Generally neutral, no noticeable off-flavor

CaCO3

gritty texture and tendency to sediment in liquid products

Sometimes associated with a soapy off-flavor or chalky mouthfeel

conjunction with vitamin D to decrease fracture risk from falls in the elderly, slows the rate of bone loss in old age, and in this respect and others is also of immense benefit to the health and well-being of postmenopausal women. CCM is exceptional in that it confers a number of unique health benefits that go beyond Ca retention and maintenance of bone mass in the appendicular and axial skeleton. Unlike other Ca sources that necessitate supplementation be in conjunction with a meal to ensure that the optimal benefit is derived, CCM can be consumed with or without food and delivers a significant nutritional benefit to individuals of all ages. The unique chemistry of CCM makes it an especially beneficial Ca source for individuals with hypochlorydia or achlorydia, which generally includes the elderly and those on various long-term prescription medications that impair gastric acid secretion. CCM is also recognized as a Ca source that does not increase the risk of kidney stones, and in fact it protects against stone-forming potential. CCM has been shown to be effective in promoting oral health, that is, tooth retention is enhanced

328

Susan Reinwald et al.

and tooth erosion minimized. Other benefits include BP reduction, improved serum lipid profiles, colon health, and evidence of no interfering effect on the status of other minerals essential to the body. From a food technology perspective, CCM is a relatively adaptable and ‘‘user-friendly’’ Ca salt, particularly in moist foods and beverages. The major factor that may preclude selection of CCM as a preferred Ca source is the higher cost compared to other sources of Ca commonly used for fortification (e.g., CaCO3; TCP). However, in situ formation of CCM directly within beverages or other fluid foods and/or preparation and addition of a concentrated CCM solution or slurry, are relatively costeffective strategies for incorporating CCM into finished food and beverage products. Furthermore, from a societal perspective, the cost of habitually purchasing good quality Ca-fortified foods and supplements is negligible compared to the exorbitant costs associated with substandard nutrition and the resulting pathologies.

REFERENCES Abraham, G. E., and Flechas, J. D. (1992). Management of fibromyalgia: Rationale for the use of magnesium and malic acid. J. Nutr. Med. 3, 49–59. Abrams, S. A. (2006). Building bones in babies: Can and should we exceed the human milkfed infant’s rate of bone calcium accretion? Nutr. Rev. 64, 487–494. Abrams, S. A., O’Brien, K. O., Liang, L. K., and Stuff, J. E. (1995). Differences in calcium absorption and kinetics between black and white girls aged 5–16 years. JBMR 10, 829–833. Abrams, S. A., Griffin, I. J., Davila, P. M., and Hawthorne, K. M. (2003). Calcium absorption is similar from milk and two types of fortified orange juice at high intake levels. JBMR 18, Abst. S104. Abrams, S. A., Griffin, I. J., Hawthorne, K. M., Chen, Z., Gunn, S. K., Wilde, M., Darlington, G., Shypailo, R. J., and Ellis, K. J. (2005a). Vitamin D receptor Fok1 polymorphisms affect calcium absorption, kinetics, and bone mineralization rates during puberty. JBMR 20, 945–953. Abrams, S. A., Griffin, I. J., Hawthorne, K. M., Gunn, S. K., Gundberg, C. M., and Carpenter, T. O. (2005b). Relationships among Vitamin D Levels, parathyroid hormone, and calcium absorption in young adolescents. J. Clin. Endocrinol. Metab. 90, 5576–5581. Abrams, S. A., Griffin, I. J., Hawthorne, K. M., and Liang, L. (2005c). Height and height Z-score are related to calcium absorption in five- to fifteen-year-old girls. J. Clin. Endocrinol. Metab. 90, 5077–5081. Abuabara, A., dos Santos, A. J. S., Aguiar, F. H. B., and Lovadino, J. R. (2004). Evaluation of microleakage in human, bovine, and swine enamels. Braz. Oral. Res. 18, 312–316. Agnusdei, D., Civitelli, R., Camporeale, A., Parisi, G., Gennari, L., Nardi, P., and Gennari, C. (1998). Age-related decline of bone mass and intestinal calcium absorption in normal males. Calcif. Tissue Int. 63, 197–201. Alfaro, E., Neathery, M. L., Miller, W. J., Gentry, R. P., Crowe, C. T., Fielding, A. S., Etheridge, R. E., Pugh, D. G., and Blackmon, D. M. (1987). Effects of varying the amounts of dietary calcium on selenium metabolism in dairy calves. J. Dairy Sci. 70, 831–836. Amaechi, B. T., Higham, S. M., and Edgar, W. M. (1999). Factors influencing the development of dental erosion in vitro: Enamel type, temperature and exposure time. J. Oral. Rehab. 26, 624–630.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

329

American Cancer Society (2006). Cancer facts and figures 2006. Available from: http://www. cancer.org/downloads/STT/CAFF2006PWSecured.pdf [Accessed October 2006]. American Obesity Association (2006). Updated statistics on overweight and obesity in the U.S. Ames, S., Ellis, K., Gunn, S., Copeland, K., and Abrams, S. (1999). Vitamin D receptor gene Fok1 polymorphism predicts calcium absorption and bone mineral density in children. JBMR 14, 740–746. Andon, M. B. (1995). Concentrated bioavailable calcium source U.S. Patent No. 5,468,506. The Procter and Gamble Company. Andon, M. B. (2003). Effect of citrate: malate molar ratio on calcium absorption from calcium citrate malate. In ‘‘FASEB Conference, Abst. 188.3,’’ Experimental Biology, San Diego, California. Andon, M. B., Kanerva, R. L., Rotruck, J. T., and Smith, K. T. (1992). Method of preventing tooth enamel erosion utilizing an acidic beverage containing calcium. U.S. Patent No. 5,108,761. Andon, M. B., Kanerva, R. L., Schulte, M. C., and Smith, K. T. (1993). Effect of age, calcium source, and radiolabeling method on whole body 47Ca retention in the rat. Am. J. Physiol. Endocrinol. Metab. 265, E554–E558. Andon, M. B., Lloyd, T. A., and Matkovic, V. (1994). Supplementation trials with calcium citrate malate: Evidence in favor of increasing the calcium RDA during childhood and adolescence. J. Nutr. 124, 1412S–1417S. Andon, M. B., Ilich, J. Z., Tzagournis, M. A., and Matkovic, V. (1996a). Magnesium balance in adolescent females consuming a low- or high-calcium diet. Am. J. Clin. Nutr. 63, 950–953. Andon, M. B., Peacock, M., Kanerva, R. L., and DeCastro, J. A. S. (1996b). Calcium absorption from apple and orange juice fortified with calcium citrate malate (CCM). J. Am. Coll. Nutr. 15, 313–316. Andon, M. B., Griffin, I. J., Hicks, P. D., and Gunn, S. K. (2004). Pubertal girls only partially adapt to low dietary calcium intakes. JBMR 19, 759–763. Anonymous (2002). Calcium in orange juice not always well absorbed. Available at: http:// www.iconocast.com/News_Files/HNewsF3_XX_XX/News7.htm [Accessed July 2007]. Anonymous (2004). Role of calcium in bone building less than exercise. Available from: http://www.foodnavigator-usa.com/news/news-ng.asp?id=52720-role-of-calcium [Accessed November 2007]. Anonymous (2005). The merk manuals online medical dictionary: Physical growth. Available from: http://www.merck.com/mmpe/sec19/ch269/ch269b.html [Accessed January 2007]. Anonymous (2006). Packaged facts: Nutritional supplements in the U.S. Available from: http://www.gii.co.jp/sample/catalog/e_FD.pdf [Accessed December 2006]. Anonymous (2007). Vitamin B12. Available from: http://www.gastricbypassfamily. com/B12.html [Accessed January 2007]. Assmann, S., Medeiros, D. M., and Chambers, E. (2003). Fortification with calcium citrate malate may not influence the sensory properties of an orange flavored beverage. J. Food Qual. 26, 395–407. Attin, T., Meyer, K., Hellwig, E., Buchalla, W., and Lennon, A. M. (2003). Effect of mineral supplements to citric acid on enamel erosion. Arch. Oral Biol. 48, 753–759. Attin, T., Weiss, K., Becker, K., Buchalla, W., and Wiegand, A. (2005). Impact of modified acidic soft drinks on enamel erosion. Oral Dis. 11, 7–12. Awuney, E. M., and Bukoski, R. D. (2006). Cellular functions and fluxes of calcium. In ‘‘Calcium in Human Health’’ (C. M. Weaver and R. P. Heaney, eds.), pp. 13–35. Humana Press Inc., Totowa, NJ.

330

Susan Reinwald et al.

Bainbridge, K. E., Sowers, M. F., Crutchfield, M., Lin, X., Jannausch, M., and Harlow, S. D. (2002). Natural history of bone loss over 6 years among premenopausal and early postmenopausal women. Am. J. Epidemiol. 156, 410–417. Balant, L. (1991). Is there a need for more precise definitions of bioavailability? Eur. J. Clin. Pharmacol. 40, 123–126. Barbour, M. E., Parker, D. M., Allen, G. C., and Jandt, K. D. (2003). Human enamel dissolution in citric acid as a function of pH in the range 2.3  pH  6.30 - a nanoindentation study. Eur. J. Oral Sci. 111, 258–262. Barbour, M. E., Shellis, R. P., Parker, D. M., Allen, G. C., and Addy, M. (2005). An investigation of some food-approved polymers as agents to inhibit hydroxyapatite dissolution. Eur. J. Oral Sci. 113, 457–461. Barger-Lux, M., and Heaney, R. P. (2005). Calcium absorptive efficiency is positively related to body size. J. Clin. Endocrinol. Metab. 90, 5118–5120. Barger-Lux, M. J., Heaney, R. P., Lanspa, S. J., Healy, J. C., and DeLuca, H. F. (1995). An investigation of sources of variation in calcium absorption efficiency. J. Clin. Endocrinol. Metab. 80, 406–411. Barzel, U. S., and Massey, L. K. (1998). Excess dietary protein can adversely affect bone. J. Nutr. 128, 1051–1053. Bayly, J. R., Hollands, R. D., Riordan-Jones, S. E., Yemm, S. J., Brough-Williams, I., Thatcher, M., Woodman, N. M., and Dixon, T. (2006). Prescribed vitamin D and calcium preparations in patients treated with bone remodelling agents in primary care: A report of a pilot study. Curr. Med. Res. Opin. 22, 131–137. Bell, L., Halstenson, C. E., Halstenson, C. J., Macres, M., and Keane, W. F. (1992). Cholesterollowering effects of calcium carbonate in patients with mild to moderate hypercholesterolemia. Arch. Intern. Med. 152, 2441–2444. Bertolo, R. F. P., Bettger, W. J., and Atkinson, S. A. (2001). Divalent metals inhibit and lactose stimulates zinc transport across brush border membrane vesicles from piglets. J. Nutr. Biochem. 12, 73–90. Bettger, W. J. (1993). Zinc and selenium, site-specific versus general antioxidation. Can. J. Phys. Pharmacol. 71, 721–724. Bischoff-Ferrari, H. A., Willet, W. C., Wong, J. B., Giovannucci, E., Dietrich, T., and DawsonHughes, B. (2005). Fracture prevention with vitamin D supplementation: A meta-analysis of randomized controlled trials. JAMA 293, 2257–2264. Bischoff-Ferrari, H. A., Orav, E. J., and Dawson-Hughes, B. (2006). Effect of cholecalciferol plus calcium on falling in ambulatory older men and women. Arch. Intern. Med. 166, 424–430. Blanchard, J., and Aeschlimann, J. M. (1989). Calcium absorption in man: Some dosing recommendations. J. Pharmacokin. Pharmacodyn. 17, 631–644. Bo-Linn, G. W., Davis, G. R., Buddrus, D. J., Morawsji, S. G., Ana, C. S., and Fordtran, J. S. (1984). An evaluation of the importance of gastric acid secretion in the absorption of dietary calcium. J. Clin. Invest. 73, 640–647. Bodic, F., Hamel, L., Lerouxel, E., Basle, M. F., and Chappard, D. (2005). Bone loss and teeth. Joint Bone Spine 72, 215–221. Boling, S. D., Webel, D. M., Mavromichalis, I., Parsons, C. M., and Baker, D. H. (2000). The effects of citric acid on phytate-phosphorus utilization in young chicks and pigs. J. Anim. Sci. 78, 682–689. Bonjour, J. P. (2005). Dietary protein: An essential nutrient for bone health. J. Am. Coll. Nutr. 24, 526S–536S. Bonjour, J. P., and Rizzoli, R. (2002). Bone mass acquisition. In ‘‘Osteoporosis: Pathophysiology and Clinical Management’’ (E. S. Orwoll and M. Bliziotes, eds.), pp. 69–82. Humana Press, New Jersey.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

331

Bonjour, J. P., and Rizzoli, R. Peak bone mass and prevention of osteoporosis. Available from: http://www.nnia.co.za/CPD/articles/peakbonemass.pdf [Accessed February 2007]. Bonjour, J. P., Theintz, G., Law, F., Slosman, D., and Rizzoli, R. (1994). Peak bone mass. Osteoporos. Int. 4, 7–13. Boonen, S., Lips, P., Bouillon, R., Bischoff-Ferrari, H. A., Vanderschueren, D., and Haentjens, P. (2007). Need for additional calcium to reduce the risk of hip fracture with vitamin D supplementation: Evidence from a comparative meta-analysis of randomized controlled trials. J. Clin. Endocrinol. Metab. 92, 1415–1423. Boonen, S., Rizzoli, R., Meunier, P. J., Stone, M., Nuki, G., Syversen, U., LehtonenVeromaa, M., Lips, P., Johnell, O., and Reginster, J. Y. (2004). The need for clinical guidance in the use of calcium and vitamin D in the management of osteoporosis: A consensus report. Osteoporos. Int. 15, 511–519. Borghi, L., Schianchi, T., Meschi, T., Guerra, A., Allegri, F., Maggiore, U., and Novarini, A. (2002). Comparison of two diets for the prevention of recurrent stones in idiopathic hypercalciuria. N. Eng. J. Med. 346, 77–84. Bostick, R. M., Fosdick, L., Grandits, G. A., Grambsch, P., Gross, M., and Louis, T. A. (2000). Effect of calcium supplementation on serum cholesterol and blood pressure: A randomized, double-blind, placebo-controlled, clinical trial. Arch. Fam. Med. 9, 31–38. Boyd, O., Crum, C. L., and Lyman, J. F. (1931). The absorption of calcium soaps and the relation of dietary fat to calcium utilization in the white rat. J. Biol. Chem. 95, 29–41. Braun, M., and Weaver, C. M. (2006). A call to evaluate the impact of calcium-fortified foods and beverages. Nutr. Today 41, 40–47. Braun, M., Martin, B. R., Kern, M., McCabe, G. P., Peacock, M., Jiang, Z., and Weaver, C. M. (2006). Calcium retention in adolescent boys on a range of controlled calcium intakes. Am. J. Clin. Nutr. 84, 414–418. Brink, E. J., van den Heuvel, E. G. H. M., and Muijs, T. (2003). Comparison of six different calcium sources and meal type on true fractional calcium absorption in postmenopausal women. Curr. Top. Nutraceut Res. 1, 161–168. Bruce, D., Laurance, I., McGuiness, M., Ridley, M., and Goldswain, P. (2003). Nutritional supplements after hip fracture: Poor compliance limits effectiveness. Clin. Nutr. 22, 497–500. Brumm, M. C. (2000). Reducing phosphorus content of swine manure. Manure Matters 6, 1–2. Brune, M., Rossander, L., and Hallberg, L. (1989). Iron absorption and phenolic compounds: Importance of different phenolic structures. Eur. J. Clin. Nutr. 43, 547–557. Brunton, P. A., and Hussain, A. (2001). The erosive effect of herbal tea on dental enamel. J. Dent. 29, 517–520. Bryant, R. J., Cadogan, J., and Weaver, C. M. (1999). The new dietary reference intakes for calcium: Implications for osteoporosis. J. Am. Coll. Nutr. 18, 406S–412S. Buescher, R. G., Bell, M. C., and Berry, R. K. (1961). The effect of excessive calcium on selenium-75 in swine. J. Anim. Sci. 20, 368–372. Burge, R., Dawson-Hughes, B., Solomon, D. H., Wong, J. B., King, A., and Tosteson, A. (2007). Incidence and economic burden of osteoporosis-related fractures in the United States, 2005–2025. JBMR 22, 465–475. Burk, R. F. (1983). Biological activity of selenium. Ann. Rev. Nutr. 3, 53–70. Burkes, A. L., Butterbaugh, J. L., FIeler, G. M., Gore, W. J., and Zuniga, M. E. (1995). Storage stable calcium-supplemented beverage concentrates. U.S. Patent No. 5,422,128. Bushinsky, D. A. (2001). Acid-base imbalance and the skeleton. Eur. J. Nutr. 40, 238–244. Chakrabarty, S., Wang, H., Canaff, L., Hendy, G. N., Appelman, H., and Varani, J. (2005). Calcium sensing receptor in human colon carcinoma: Interaction with Ca2þ and 1,25-dihydroxyvitamin D3. Cancer Res. 65, 493–498.

332

Susan Reinwald et al.

Chang, P., Lee, T., Olszewski, J., Edgar, B. G., Orr, R., and Curtiss, H. (2002). Calcium supplemented beverages and methods of making that same. PepsiCo, Inc., U.S. Patent No. 20,020,102,331. Chia, V. (2004). Brief critical reviews—calcium and colorectal cancer: Some questions remain. Nutr. Rev. 62, 115–120. Chimienti, F., Aouffen, M., Favier, A., and Seve, M. (2003). Zinc homeostasis-regulating proteins: New drug targets for triggering cell fate. Curr. Drug Targets 4, 323–338. Coe, F. L., Parks, J. H., and Webb, D. R. (1992). Stone-forming potential of milk or calciumfortified orange juice in idiopathic hypercalciuric adults. Kidney Int. 41, 139–142. Coe, F. L., Parks, J. H., and Favus, M. J. (1997). Diet and calcium: The end of an era. Ann. Intern. Med. 126, 553–555. Committee for Veterinary Medicinal Products (2003). Oxalic acid: Summary report. Available from: http://www.emea.eu.int/pdfs/vet/mrls/089103en.pdf [Accessed November 2007]. Compston, J. E., Laskey, M. A., Croucher, P. I., Coxon, A., and Kreitzman, S. (1992). Effect of diet-induced weight loss on total body bone mass. Clin. Sci. (Lond.) 82, 429–432. Conrad, M. E., and Umbreit, J. N. (2002). Pathways of iron absorption. Blood Cell Mol. Dis. 29, 336–355. Cook, A. (1994). Osteoporosis—do I eat TUMs? Available from: http://www.chiroweb.com/ archives/12/21/01.html [Accessed November 2007] Cook, J. D., and Monsen, E. R. (1976). Food iron absorption in man II. The effect of EDTA on absorption of dietary non-heme iron. Am. J. Clin. Nutr. 29, 614–620. Cook, J. D., Dassenko, S. A., and Whittaker, P. (1991). Calcium supplementation: Effect on iron absorption. Am. J. Clin. Nutr. 53, 106–111. Cook, J. D., Reddy, M. B., and Hurrell, R. F. (1995). The effect of red and white wines on nonheme iron absorption in humans. Am. J. Clin. Nutr. 61, 800–804. Corneau, L., Lavigne, C., and Zee, J. A. (1996). Effect of calcium and zinc concentrations and calcium source on in vitro calcium and zinc solubility in a fiber-fortified enteral formula. Nutr. Res. 16, 1659–1669. Curhan, G. C., Willett, W. C., Speizer, F. E., Spiegelman, D., and Stampfer, M. J. (1997). Comparison of dietary calcium with supplemental calcium and other nutrients as factors affecting the risk for kidney stones in women. Ann. Intern. Med. 126, 497–504. Davideau, J. L., Lezot, F., Kato, S., Bailleul-Forestier, I., and Berdal, A. (2004). Dental alveolar bone defects related to vitamin D and calcium status. J. Steroid Biochem. Mol. Biol. 89–90, 615–618. Dawson-Hughes, B. (2003a). Calcium and protein in bone health. Proc. Nutr. Soc. 62, 505–509. Dawson-Hughes, B. (2003b). Interaction of dietary calcium and protein in bone health in humans. J. Nutr. 133, 852S–854S. Dawson-Hughes, B. (2006a). Calcium and vitamin D. In ‘‘Primer on the Metabolic Bone Diseases and Disorders of Mineral Metabolism’’ (M. J. Favus, ed.), pp. 257–259. The American Society for Bone and Mineral Research, Washington DC. Dawson-Hughes, B. (2006b). Calcium throughout the life cycle. In ‘‘Calcium in Human Health’’ (C. M. Weaver and R. P. Heaney, eds.), pp. 371–385. Humana Press, Totowa, NJ. Dawson-Hughes, B., and Harris, S. S. (2002). Calcium intake influences the association of protein intake with rates of bone loss in elderly men and women. Am. J. Clin. Nutr. 75, 773–779. Dawson-Hughes, B., Seligson, F. H., and Hughes, V. A. (1986). Effects of calcium carbonate and hydroxyapatite on zinc and iron retention in postmenopausal women. Am. J. Clin. Nutr. 44, 83–88. Dawson-Hughes, B., Dallal, G. E., Krall, E. A., Sadowski, L., Sahyoun, N., and Tannenbaum, S. (1990). A controlled trial of the effect of calcium supplementation on bone density in postmenopausal women. N. Engl. J. Med. 323, 878–883.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

333

Dawson-Hughes, B., Dallal, G. E., Krall, E. A., Harris, S. S., Sokoll, L. J., and Falconer, G. (1991). Effect of vitamin D supplementation on wintertime and overall bone loss in healthy postmenopausal women. Ann. Intern. Med. 115, 505–512. Dawson-Hughes, B., Harris, S. S., Krall, E. A., Dallal, G. E., and Falconer, G. (1995). Rates of bone loss in postmenopausal women randomly assigned to one of two dosages of vitamin D. Am. J. Clin. Nutr. 61, 1140–1145. Dawson-Hughes, B., Harris, S. S., Krall, E. A., and Dallal, G. E. (1997). Effect of calcium and vitamin D supplementation on bone density in men and women 65 years of age or older. N. Engl. J. Med. 337, 670–676. Dawson-Hughes, B., Harris, S. S., Krall, E. A., and Dallal, G. E. (2000). Effect of withdrawal of calcium and vitamin D supplements on bone mass in elderly men and women. Am. J. Clin. Nutr. 72, 745–750. Deehr, M. S., Dallal, G. E., Smith, K. T., Taulbee, J. D., and Dawson-Hughes, B. (1990). Effects of different calcium sources on iron absorption in postmenopausal women. Am. J. Clin. Nutr. 51, 95–99. Demigne, C., Sabboh, H., Puel, C., Remsey, C., and Coxam, V. (2004). Organic anions and potassium salts in nutrition and metabolism. Nutr. Res. Rev. 17, 249–258. Denke, M. A., Fox, M. M., and Schulte, M. C. (1993). Short-term dietary calcium fortification increases fecal saturated fat-content and reduces serum-lipids in men. J. Nutr. 123, 1047–1053. Dibba, B., Prentice, A., Ceesay, M., Stirling, D. M., Cole, T. J., and Poskitt, E. M. E. (2000). Effect of calcium supplementation on bone mineral accretion in Gambian children accustomed to a low-calcium diet. Am. J. Clin. Nutr. 71, 544–549. Dodig, S., and Cepelak, I. (2004). The facts and controversies about selenium. Acta Pharm. 54, 261–276. Dominguez, L. J., Barbagallo, M., Lauretani, F., Bandinelli, S., Bos, A., Corsi, A. M., Simonsick, E. M., and Ferrucci, L. (2006). Magnesium and muscle performance in older persons: The INCHIANTI study. Am. J. Clin. Nutr. 84, 419–426. Dursun, N., and Aydogan, S. (1994). Comparative effects of calcium deficiency and supplements on the intestinal absorption of zinc in rats. Jpn. J. Physiol. 44, 157–166. Ebeling, P. R., Sandgren, M. E., DiMagno, E. P., Lane, A. W., DeLuca, H. F., and Riggs, B. L. (1992). Evidence of an age-related decrease in intestinal responsiveness to vitamin D: Relationship between serum 1,25-dihydroxy D3 and intestinal vitamin D receptor concentrations in normal women. J. Clin. Endocrinol. Metab. 75, 176–182. Erdman, J. W., Jr., and Fordyce, E. J. (1989). Soy products and the human diet. Am. J. Clin. Nutr. 49, 725–737. Erricsson, Y., and Ekberg, O. (1975). Dietetically provoked general and alveolar osteopenia in rats and its prevention or cure by calcium and fluoride. J. Periodont. Res. 10, 256–269. Evenepoel, P. (2001). Alteration in digestion and absorption of nutrients during profound acid suppression. Best Pract. Res. Clin. Gastroenterol. 15, 539–551. Fioritto, L. M., Mitchell, D. C., Smiciklas-Wright, H., and Birch, L. L. (2006). Girl’s calcium intake is associated with bone mineral density during middle childhood. J. Nutr. 136, 1281–1286. Fleet, J. C. (2006). Molecular regulation of calcium metabolism. In ‘‘Calcium in Human Health’’ (C. M. Weaver and R. P. Heaney, eds.), pp. 163–189. Humana Press, Inc., Totowa, NJ. Flood, A., Peters, U., Chatterjee, N., Lacey, J. V., Jr., Schairer, C., and Schatzkin, A. (2005). Calcium from diet and supplements is associated with reduced risk of colorectal cancer in a prospective cohort of women. Cancer Epidemiol. Biomarkers Prev. 14, 126–132. Foote, J. A., Murphy, S. P., Wilkens, L. R., Basiotis, P. P., and Carlson, A. (2004). Dietary variety increases the probability of nutrient adequacy among adults. J. Nutr. 134, 1779–1785.

334

Susan Reinwald et al.

Forshee, R. A., Anderson, P. A., and Storey, M. L. (2006). Changes in calcium intake and association with beverage consumption and demographics: Comparing data from CSFII 1994–1996, 1998 and NHANES 1999–2002. J. Am. Coll. Nutr. 25, 108–116. Fox, M. M., Heckert, D. C., and Luhrsen, K. R. (1993a). Calcium citrate malate composition. U.S. Patent No. 5,186,965. Fox, M. M., Luhrsen, K. R., and Burkes, A. L. (1993b). Calcium fortified salad dressing product. The Procter and Gamble Company, U.S. Patent No. 5,215,769. Frassinetti, S., Bronzetti, G., Caltavuturo, L., Cini, M., and Della Croce, C. (2006). The role of zinc in life: A review. J. Environ. Pathol. Toxicol. Oncol. 25, 597–610. French, S. A., Story, M., and Jeffery, R. W. (2001). Environmental influences on eating and physical activity. Annu. Rev. Public Health 22, 309–335. Gallagher, J. C., Riggs, B. L., Eisman, J., Hamstra, A., Arnaud, S. B., and DeLuca, H. F. (1979). Intestinal calcium absorption and serum vitamin D metabolites in normal subjects and osteoporotic patients. J. Clin. Invest. 64, 729–736. Ganss, C., Klimek, J., and Borkowski, N. (2002). Characteristics of tooth wear in relation to different nutritional patterns including contemporary and medievil subjects. Eur. J. Oral. Sci. 110, 54–60. Gao, X., Wilde, P. E., Lichtenstein, A. H., and Tucker, K. L. (2006). Meeting adequate intake for dietary calcium without dairy foods in adolescents aged 9 to 18 years (National Health and Nutrition Examination Survey 2001–2002). J. Am. Diet. Assoc. 106, 1759. Gershoff, S. N., and Faragalla, F. F. (1959). Endogenous oxalate synthesis and glycine, serine, deoxypyridoxine interrelationships in vitamin B6-deficient rats. J. Biol. Chem. 234, 2391–2393. Gibson, R. S., Health, A. L. M., and Ferguson, E. L. (2002). Risk of suboptimal iron and zinc nutriture among adolescent girls in Australia and New Zealand: Causes, consequences, and solutions. Asia Pac. J. Clin. Nutr. 11, 543–552. Gillman, M. W., Hood, M. Y., Moore, L. L., Nguyen, U. S. D. T., Singer, M. R., and Andon, M. B. (1995). Effect of calcium supplementation on blood pressure in children. J. Pediatr. 127, 186. Govers, M. J., Termont, D. S., Lapre, J. A., Kleibeuker, J. H., Vonk, R. J., and van der Meer, R. (1996). Calcium in milk products precipitates intestinal fatty acids and secondary bile acids and thus inhibits colonic cytotoxicity in humans. Cancer Res. 56, 3270–3275. Greer, F. R., Krebs, N. F., and Committee on, N. (2006). Optimizing bone health and calcium intakes of infants, children, and adolescents. Pediatrics 117, 578–585. Greger, J. L., Smith, S. A., and Snedeker, S. M. (1981). Effect of dietary calcium and phosphorus levels on the utilization of calcium, phosphorus, magnesium, manganese, and selenium by adult males. Nutr. Res. 1, 315–325. Grenby, T. H. (1996). Lessening dental erosive potential by product modification. Eur. J. Oral Sci. 104, 221–228. Griffin, I. J., Davila, P. M., and Abrams, S. A. (2002). Non-digestible oligosaccharides and calcium absorption in girls with adequate calcium intakes. Br. J. Nutr. 87, S187–S191. Griffin, I. J., Hicks, P. M. D., Heaney, R. H., and Abrams, S. A. (2003). Enriched chicory inulin increases calcium absorption mainly in girls with lower calcium absorption. Nutr. Res. 23, 901–909. Griffith, R. (2005). Managing difficulties in swallowing solid medication: The need for caution. Nurse Prescr. 3, 201–203. Groot, P. H. E., Grose, W. F. A., Dijkhuis-Stofflesma, R., Fernandes, J., and Ambagtsheer, J. J. (1980). The effect of oral calcium carbonate administration on serum lipoproteins of children with familial hypercholesterolaemia (Type II-A). Eur. J. Pediatr. 135, 81–84. Gue´guen, L., and Pointillart, A. (2000). The bioavailability of dietary calcium. J. Am. Coll. Nutr. 19, 119S–136S.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

335

Gunshin, H., Noguchi, T., and Naito, H. (1991). Effect of calcium on the zinc uptake by brush border membrane vesicles isolated from the rat small intestine. Agric. Biol. Chem. 55, 2813–2816. Haas, J. D., and Brownlie, T. I. V. (2001). Iron deficiency and reduced work capacity: A critical review of the research to determine a causal relationship. J. Nutr. 131, 676S–690S. Hallberg, L. (1987). Wheat fiber, phytates and iron absorption. Scand. J. Gastroenterol. Suppl. 129, 73–79. Hallberg, L. (1998). Does calcium interfere with iron absorption? Am. J. Clin. Nutr. 68, 3–4. Hanes, D. A., Weaver, C. M., Heaney, R. P., and Wastney, M. (1999). Absorption of calcium oxalate does not require dissociation in rats. J. Nutr. 129, 170–173. Hardy, G., and Ball, P. (2005). Clogbusting: Time for a concerted approach to catheter occlusions? Curr. Opin. Clin. Nutr. Metab. Care 8, 277–283. Harnack, L., Stang, J., and Story, M. (1999). Soft drink consumption among US children and adolescents: Nutritional consequences. J. Am. Diet. Assoc. 99, 436–441. Harrison, J. H., and Conrad, H. R. (1984). Effect of dietary calcium on selenium absorption by the non-lactating dairy cow. J. Dairy Sci. 67, 1860–1864. Harvey, J. A., Zobitz, M. M., and Pak, C. Y. (1985). Calcium citrate: Reduced propensity for the crystallization of calcium oxalate in urine resulting from induced hypercalciuria of calcium supplementation. J. Clin. Endocrinol. Metab. 61, 1223–1225. Heaney, R. P. (1991). Calcium supplements: Practical considerations. Osteoporos. Int. 1, 1433–2965. Heaney, R. P. (1998). Excess dietary protein may not adversely affect bone. J. Nutr. 128, 1054–1057. Heaney, R. P. (2001a). Calcium needs of the elderly to reduce fracture risk. J. Am. Coll. Nutr. 20, 192S–197S. Heaney, R. P. (2001b). Factors influencing the measurement of bioavailability, taking calcium as a model. J. Nutr. 131, 1344S–1348S. Heaney, R. P. (2002). Protein and calcium: Antagonists or synergists? Am. J. Clin. Nutr. 75, 609–610. Heaney, R. P. (2003a). Advances in therapy for osteoporosis. Clin. Med. Res. 1, 93–99. Heaney, R. P. (2003b). Sensitivity of parathyroid hormone response to calcium intake. Am. J. Clin. Nutr. 78, 493–497. Heaney, R. P. (2003c). Vitamin D depletion and effective calcium absorption. JBMR 18, 1342. Heaney, R. P., Gallagher, J. C., Johnston, C. C., Neer, R., Parfitt, A. M., and Whedon, G. D. (1982). Calcium nutrition and bone health in the elderly. Am. J. Clin. Nutr. 36, 986–1013. Heaney, R. P., Recker, R. R., Stegman, M. R., and Moy, A. J. (1989a). Calcium absorption in women: Relationships to calcium intake, estrogen status, and age. JBMR 4, 469–475. Heaney, R. P., Smith, K. T., Recker, R. R., and Hinders, S. M. (1989b). Meal effects on calcium absorption. Am. J. Clin. Nutr. 49, 372–376. Heaney, R. P., Recker, R. R., and Weaver, C. M. (1990a). Absorbability of calcium sources: The limited role of solubility. Calcif. Tissue Int. 46, 300–304. Heaney, R. P., Weaver, C. M., and Fitzsimmons, M. L. (1990b). Influence of calcium load on absorption fraction. JBMR 5, 1135–1138. Heaney, R. P., Dowell, R., and Barger-Lux, M. J. (1999). Absorption of calcium as carbonate and citrate salts with some observations on method. Osteoporos. Int. 9, 19–23. Heaney, R. P., Dowell, M. S., Hale, C. A., and Bendich, A. (2003). Calcium absorption varies within the reference range for serum 25-hydroxyvitamin D. J. Am. Coll. Nutr. 22, 142–146. Heaney, R. P., Rafferty, K., and Bierman, J. (2005a). Not all calcium-fortified beverages are equal. Nutr. Today 40, 39–44. Heaney, R. P., Rafferty, K., Dowell, M. S., and Bierman, J. (2005b). Calcium fortification systems differ in bioavailability. J. Am. Diet. Assoc. 105, 807–809.

336

Susan Reinwald et al.

Henry, M. H., and Pesti, G. M. (2002). An investigation of calcium citrate malate as a calcium source for young broiler chicks. Poult. Sci. 81, 1149–1155. Hicks, P. D., and Abrams, S. A. (2006). Formula-fed full term infants have lower fractional absorption but greater total calcium absorption than human milk-fed infants. FASEB J. 20, A991. Higdon, J. (2005). Preventing osteoporosis through diet and lifelstyle. Linus Pauling Institute Spring/Summer 2005 Research Report. Hildebolt, C. F. Oral bone loss assessment and repair. Available from: http://research. medicine.wustl.edu/ocfr/Research.nsf/s/B4883B6A205D60BA8625677D00592BBC [Accessed March 2007]. Hill, C. H., and Matrone, G. (1970). Chemical parameters in the study of in vivo and in vitro interactions of transition elements. Fed. Proc. 29, 1474–1481. Hoekstra, W. G., Faltin, E. C., Lin, C. W., Roberts, H. F., and Grummer, R. H. (1967). Zinc deficiency in reproducing gilts fed a diet high in calcium and its effect on tissue zinc and blood serum alkaline phosphatase. J. Anim. Sci. 26, 1348–1357. Holben, D. H., Smith, A. M., Ilich, J. Z., Landoll, J. D., Holcomb, J. P., and Matkovic, V. (2002). Selenium intakes, absorption, retention, and status in adolescent girls. J. Am. Diet. Assoc. 102, 1082–1087. Holmes, R. P., Goodman, H. O., and Assimos, D. G. (2001). Contribution of dietary oxalate to urinary oxalate excretion. Kidney Int. 59, 270–276. Howell, G. O., and Hill, C. H. (1978). Biological interaction of selenium with other trace elements in chicks. Environ. Health Perspect. 25, 147–150. Hughes, J. A., West, N. X., Parker, D. M., Newcombe, R. G., and Addy, M. (1999). Development and evaluation of a low erosive blackcurrant juice drink. Final drink and concentrate, formulae comparison in situ and overview of the concept. J. Dent. 27, 345–350. Hughes, J. A., West, N. X., Parker, D. M., van den Braak, M. H., and Addy, M. (2000). Effects of pH and concentration of citric, malic, and lactic acids on enamel, in vitro. J. Dent. 28, 147–152. Hunt, J. N. (1980). A possible relation between the regulation of gastric emptying and food intake. Am. J. Physiol. Gastrointest. Liver Physiol. 239, G1–G4. Hurrell, R. F., Juillerat, M. A., Reddy, M. B., Lynch, S. R., Dassenko, S. A., and Cook, J. D. (1992). Soy protein, phytate, and iron absorption in humans. Am. J. Clin. Nutr. 56, 573–578. Ilich-Ernst, J. Z., McKenna, A. A., Badenhop, N. E., Clairmont, A. C., Andon, M. B., Nahhas, R. W., Goel, P., and Matkovic, V. (1998). Iron status, menarche, and calcium supplementation in adolescent girls. Am. J. Clin. Nutr. 68, 880–887. Ireland, P., and Fordtran, J. S. (1973). Effect of dietary calcium and age on jejunal calcium absorption in humans studied by intestinal perfusion. J. Clin. Invest. 52, 2672–2681. Iuliano-Burns, S., Wang, X. F., Evans, A., Bonjour, J. P., and Seeman, E. (2006). Skeletal benefits from calcium supplementation are limited in children with calcium intakes near 800 mg daily. Osteoporos. Int. 17, 1794–1800. Jackman, L. A., Millane, S. S., Martin, B. R., Wood, O. B., McCabe, G. P., Peacock, M., and Weaver, C. M. (1997). Calcium retention in relation to calcium intake and postmenarcheal age in adolescent females. Am. J. Clin. Nutr. 66, 327–333. Jacobs, A., and Worwood, M. (1975). Ferritin in serum: Clinical and biological implications. N. Eng. J. Med. 292, 951–956. Jacobs, S. A. (1994). Calcium supplements. U.S. Patent No. 5,314,919. Jandt, K. D. (2006). Probing the future in functional soft drinks on the nanometre scale—towards tooth friendly soft drinks. Trends Food Sci. Technol. 17, 263–271. Jarjou, L. M. A., Prentice, A., Sawo, Y., Laskey, M. A., Bennett, J., Goldberg, G. R., and Cole, T. J. (2006). Randomized, placebo-controlled, calcium supplementation study in pregnant Gambian women: Effects on breast-milk calcium concentrations and infant

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

337

birth weight, growth, and bone mineral accretion in the first year of life. Am. J. Clin. Nutr. 83, 657–666. Jemal, A., Siegel, R., Ward, E., Murray, T., Xu, J., Smigal, C., and Thun, M. J. (2006). Cancer Statistics, 2006. CA Cancer J. Clin. 56, 106–130. Jensdottir, T., Bardow, A., and Holbrook, P. (2005). Properties and modification of soft drinks in relation to their erosive potential in vitro. J. Dent. 33, 569–575. Jensen, L. B., Kollerup, G., Quaade, F., and Sorensen, O. H. (2001). Bone mineral changes in obese women during a moderate weight loss with and without calcium supplementation. JBMR 16, 141–147. Johansson, A. K., Lingstrom, P., and Birkhed, D. (2002). Comparison of factors potentially related to the occurrence of dental erosion in high- and low-erosion groups. Eur. J. Oral Sci. 110, 204–211. Johnson, R. K. (2000). Changing eating and physical activity patterns of US children. Proc. Nutr. Soc. 59, 295–301. Johnston, C. C., Miller, J. Z., Slemenda, C. W., Reister, T. K., Hui, S., Christian, J. C., and Peacock, M. (1992). Calcium supplementation and increases in bone mineral density in children. N. Engl. J. Med. 327, 82–87. Kamangar, F., Dores, G. M., and Anderson, W. F. (2006). Patterns of cancer incidence, mortality, and prevalence across five continents: Defining priorities to reduce cancer disparities in different geographic regions of the world. J. Clin. Oncol. 24, 2137–2150. Kanbur, N. O., Derman, O., and Kinik, E. (2002). Osteocalcin. A biochemical marker of bone turnover during puberty. Int. J. Adolesc. Med. Health 14, 235–244. Karanja, N., Morris, C., Illingworth, D. R., and McCarron, D. A. (1987). Plasma lipids and hypertension: Response to calcium supplementation. Am. J. Nutr. 45, 60–65. Karlsson, C., Obrant, K. J., and Karlsson, M. (2001). Pregnancy and lactation confer reversible bone loss in humans. Osteoporos. Int. 12, 828–834. Kennedy, E., and Meyers, L. (2005). Dietary reference intakes: Development and uses for assessment of micronutrient status of women—a global perspective. Am. J. Clin. Nutr. 81, 1194S–1197S. Kerstetter, J. E., O’Brien, K. O., Caseria, D. M., Wall, D. E., and Insogna, K. L. (2005). The impact of dietary protein on calcium absorption and kinetic measures of bone turnover in women. J. Clin. Endocrinol. Metab. 90, 26–31. Kinyamu, H. K., Gallagher, J. C., Balhorn, K. E., Petranick, K. M., and Rafferty, K. A. (1997). Serum vitamin D metabolites and calcium absorption in normal young and elderly freeliving women and women living in nursing homes. Am. J. Clin. Nutr. 65, 790–797. Klahorst, S. (2001). Design elements: Calcium’s role. Available from: http://www. foodproductdesign.com/articles/463/463_0101de.html [Accessed March 2007]. Kobrin, A. M., Goldstein, S. J., Shangraw, R. F., and Raja, R. M. (1989). Variable efficacy of calcium carbonate tablets. Am. J. Kidney Dis. XIV, 461–465. Kochanowski, B. A. (1990). Effect of calcium citrate-malate on skeletal development in young, growing rats. J. Nutr. 120, 876–881. Kovacs, C. S., and Fuleihan, G. E. (2006). Calcium and bone disorders during pregnancy and lactation. Endocrinol. Metab. Clin. North Am. 35, 21–51. Krall, E. A., and Dawson-Hughes, B. (1999). Smoking increases bone loss and decreases intestinal calcium absorption. JBMR 14, 215–220. Krall, E. A., Dawson-Hughes, B., Papas, A., and Garcia, R. I. (1994). Tooth loss and skeletal bone density in healthy postmenopausal women. Osteoporos. Int. 2, 104–109. Krall, E. A., Garcia, R. I., and Dawson-Hughes, B. (1996). Increased risk of tooth loss is related to bone loss at the whole body, hip, and spine. Calcif. Tissue Int. 59, 433–437. Krall, E. A., Wehler, C., Garcia, R. I., Harris, S. S., and Dawson-Hughes, B. (2001). Calcium and vitamin D supplements reduce tooth loss in the elderly. Am. J. Med. 111, 452–456.

338

Susan Reinwald et al.

Kuntz, L. A. (2003). Elemental calcium facts. Available from: http://www.foodproductdesign. com/archive/2003/0203INI.html [Accessed March 2007]. Kushi, L. H., Byers, T., Doyle, C., Bandera, E. V., McCullough, M., Gansler, T., Andrews, K. S., and Thun, M. J. (2006). American Cancer Society guidelines on nutrition and physical activity for cancer prevention: Reducing the risk of cancer with healthy food choices and physical activity. CA Cancer J. Clin. 56, 254–281. Lee, H. S., and Coates, G. A. (1997). Vitamin C contents in processed Florida citrus juice products from 1986–1995 survey. J. Agric. Food Chem. 45, 2550–2555. Lee, W. T. K., Leung, S. S. F., Ng, M. Y., Wang, S. F., Xu, Y. C., Zeng, W. P., and Lau, J. (1993). Bone mineral content of two populations of Chinese children with different calcium intakes. Bone Miner. 23, 195–206. Lee, W. T. K., Leung, S. S. F., Leung, D. M. Y., Tsang, H. S. Y., Lau, J., and Cheng, J. C. Y. (1995). A randomized double-blind controlled calcium supplementation trial, and bone and height acquisition in children. Br. J. Nutr. 74, 125–139. Lide David, R. (ed.) (2004–2005) In ‘‘CRC Handbook of Chemistry and Physics’’ 85th Ed. CRC Press, Boca Raton, Florida. Liebman, B. (1998). Calcium supplements: The way to go? Available from: http://www. encyclopedia.com/doc/1G1-20467468.html [Accessed March 2007]. Liebman, M., and Chai, W. (1997). Effect of dietary calcium on urinary oxalate excretion after oxalate loads. Am. J. Clin. Nutr. 65, 1453–1459. Lihono, M. A., Serfass, R. E., Sell, J. L., and Palo, P. E. (1997a). Bioavailability of calcium citrate malate added to microbial phytase-treated, hydrothermally cooked soymilk. J. Food Sci. 62, 1226–1230. Lihono, M. A., Serfass, R. E., Sell, J. L., and Palo, P. E. (1997b). Bioavailability of calcium citrate malate added to microbial phytase-treated, hydrothermally cooked soymilk. J. Food Sci. 62, 1226–1230. Lind, T., Lonnerdal, B., Stenlund, H., Gamayanti, I. L., Ismail, D., Seswandhana, R., and Persson, L. A. (2004). A community-based randomized controlled trial of iron and zinc supplementation in Indonesian infants: Effects on growth and development. Am. J. Clin. Nutr. 80, 729–736. Linzell, J. L., Mepham, T. B., and Peaker, M. (1976). The secretion of citrate into milk. J. Physiol. 260, 739–750. Lloyd, T., Andon, M. B., Rollings, N., Martel, J. K., Landis, J. R., Demers, L. M., Eggli, D. F., Kieselhorst, K., and Kulin, H. E. (1993). Calcium supplementation and bone mineral density in adolescent girls. JAMA 270, 841–844. Lloyd, T. A., Martel, J. K., Rollings, N. J., Andon, M. B., Kulin, H., Demers, L. M., Eggli, D. F., Kieselhorst, K., and Chinchilli, V. M. (1996). The effect of calcium supplementation and Tanner stage on bone density, content, and area in teenage women. Osteoporos. Int. 6, 276–283. Lloyd, T. A., Rollings, N. J., and Chinchilli, V. M. (1997). The effect of enhanced bone gain achieved with calcium supplementation during ages 12 to 16 does not persist in late adolescence. In ‘‘Third International Symposium on Nutritional Aspects of Osteoporosis’’ (P. Burckhardt, B. Dawson-Hughes, and R. P. Heaney, eds.), Springer-Verlag, London. Lonnerdal, B., Cederblad, A., Davidsson, L., and Sandstrom, B. (1984). The effect of individual components of soy formula and cows’ milk formula on zinc bioavailability. Am. J. Clin. Nutr. 40, 1064–1070. Looker, A. C. (2003). Interaction of science, consumer practices and policy: Calcium and bone health as a case study. J. Nutr. 133, 1987S–1991S. Looker, A. C. (2006). Dietary calcium: Recommendations and intakes around the world. In ‘‘Calcium in Human Health’’ (C. M. Weaver and R. P. Heaney, eds.), pp. 105–127. Humana Press Inc., Totowa, NJ.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

339

Loud, K. J., and Gordon, C. M. (2006). Adolescent bone health. Arch. Pediatr. Adolesc. Med. 160, 1026–1032. Lowry, K. R., Mahan, D. C., and Corley, J. R. (1985). Effect of dietary calcium on selenium retention in postweaning swine. J. Anim. Sci. 60, 1429–1437. Luhadiya, A. P. C., Yang, D. K., and Heisey, M. T. (2006). Calcium fortified beverages. The Procter and Gamble Company, U.S. Patent No. 6,994,877. Lussi, A., Jaeggi, T., and Zero, D. T. (2005). Impact of modified acidic soft drink on enamel erosion. Oral Dis. 11, 7–12. Lussi, A., Kohler, N., Zero, D. T., Schaffner, M., and Megert, B. (2000). A comparison of the erosive potential of different beverages in primary and permanent teeth using an in vitro model. Eur. J. Oral Sci. 108, 110–114. Lynch, S. R., and Cook, J. D. (1980). Interaction of vitamin C and iron. Ann. NY Acad. Sci. 355, 32–44. Lytle, L. A., and Kubik, M. Y. (2003). Nutritional issues for adolescents. Best Pract. Res. Clin. Endocrinol. Metab. 17, 177. Manz, F., and Schoenau, E. (2002). Calcium requirements. Ann. Nestle 60, 117–128. Martinez, M. E., and Willett, W. C. (1998). Calcium, vitamin D, and colorectal cancer: A review of the epidemiologic evidence. Cancer Epidemiol. Biomarkers Prev. 7, 163–168. Martini, L., and Wood, R. J. (2002). Relative bioavailability of calcium-rich dietary resources in the elderly. Am. J. Clin. Nutr. 76, 1345–1350. Mason, A. C., Weaver, C. M., Kimmel, S., and Brown, R. K. (1993). Effect of soybean phytate content on calcium bioavailability in mature and immature rats. J. Agric. Food Chem. 41, 246–249. Matkovic, V. (1991). Calcium metabolism and calcium requirements during skeletal modeling and consolidation of bone mass. Am. J. Clin. Nutr. 54, 245S–260S. Matkovic, V., and Heaney, R. P. (1992). Calcium balance during human growth: Evidence for threshold behavior. Am. J. Clin. Nutr. 55, 992–996. Matkovic, V., Kostial, K., Simonovic, I., Buzina, R., Brodarec, A., and Nordin, B. E. (1979). Bone status and fracture rates in two regions of Yugoslavia. Am. J. Clin. Nutr. 32, 540–549. Matkovic, V., Badenhop-Stevens, N. E., Landoll, J. D., Goel, P., and Li, B. (2000). Long-term effect of calcium supplementation and dairy products on bone mass of young females. JBMR 17, S172. Matkovic, V., Landoll, J. D., Badenhop-Stevens, N. E., Ha, E. Y., Crncevic-Orlic, Z., Li, B., and Goel, P. (2004a). Nutrition influences skeletal development from childhood to adulthood: A study of hip, spine, and forearm in adolescent females. J. Nutr. 134, 701S–705S. Matkovic, V., Landoll, J. D., Goel, P., Badenhop-Stevens, N., Ha, E. J., Li, B., and CrncevicOrlic, Z. (2004b). Bone mineral density of skull and lower extremities during growth and calcium supplementation. In ‘‘Nutritional Aspects of Osteoporosis,’’ (P. Burckhardt, B. Dawson-Hughes, and R. P. Heaney, eds.), pp. 3–15. Elsevier Academic Press, Burlington, MA. Matkovic, V., Goel, P. K., Badenhop-Stevens, N. E., Landoll, J. D., Li, B., Ilich, J. Z., Skugor, M., Nagode, L. A., Mobley, S. L., Ha, E. J., Hangartner, T. N., and Clairmont, A. (2005). Calcium supplementation and bone mineral density in females from childhood to young adulthood: A randomized controlled trial. Am. J. Clin. Nutr. 81, 175–188. McCormick, C. C. (2002). Passive diffusion does not play a major role in the absorption of dietary calcium in normal adults. J. Nutr. 132, 3428–3430. McKenna, A. A., Ilich, J. Z., Andon, M. B., Wang, C., and Matkovic, V. (1997). Zinc balance in adolescent females consuming a low- or high-calcium diet. Am. J. Clin. Nutr. 65, 1460–1464. Mehansho, H., Kanerva, R. L., Hudepohl, G. R., and Smith, K. T. (1989a). Calcium bioavailability and iron-calcium interaction in orange juice. J. Am. Coll. Nutr. 8, 61–68.

340

Susan Reinwald et al.

Mehansho, R., Hudepohl, G. R., Kanerva, R. L., Luhrsen, K. R., and Smith, K. T. (1989b). Calcium bioavailability in fruit juices. FASEB J. 3, A771. Meta, M., Lu, Y., Keyak, J. H., and Lang, T. (2006). Young-elderly differences in bone density, geometry and strength indices depend on proximal femur sub-region: A cross sectional study in Caucasian-American women. Bone 39, 152–158. Miller, G. D., Jarvis, J. K., and McBean, L. D. (2001). The importance of meeting calcium needs with foods. J. Am. Coll. Nutr. 20, 168S–185S. Miller, J. Z., Smith, D. L., Flora, L., Slemenda, C., Jiang, X. Y., and Johnston, C. C. J. (1988). Calcium absorption from calcium carbonate and a new form of calcium (CCM) in healthy male and female adolescents. Am. J. Clin. Nutr. 48, 1291–1294. Miller, J. Z., Smith, D. L., Flora, L., Peacock, M., and Johnston, C. C. J. (1989). Calcium absorption in children estimated from single and double stable calcium isotope techniques. Clin. Chim. Acta 183, 107–114. Mohammad, A. R., Hooper, D. A., Vermilyea, S. G., and Mariotti, A. (2003). An investigation of the relationship between systemic bone density and clinical periodontal status in postmenopausal Asian-American women. Int. Dent. J. 53, 121–125. Monje, P. V., and Baran, E. J. (2002). Characterization of calcium oxalates generated as biominerals in cacti. Plant Physiol. 128, 707–713. Monsen, E. R., and Cook, J. D. (1976). Food iron absorption in human subjects. IV. The effects of calcium and phosphate salts on the absorption of nonheme iron. Am. J. Clin. Nutr. 29, 1142–1148. Morozumi, M., Hossain, R. Z., Yamakawa, K., Hokama, S., Nishijima, S., Oshiro, Y., Uchida, A., Sugaya, K., and Ogawa, Y. (2006). Gastrointestinal oxalic acid absorption in calcium-treated rats. Urol. Res. 34, 168–172. Nakel, G. M., Russell, W. E., Dake, T. W., and Heckert, D. C. (1988). Beverages and beverage concentrates nutritionally supplemented with calcium. The Procter and Gamble Company, U.S. Patent No. 4,737,375. National Institutes of Health (1994). National Institutes of Health Consensus Development Conference Statement: Optimal calcium intake. Available from: http://consensus.nih. gov/1994/1994OptimalCalcium097html.htm [Accessed November 2007]. National Kidney and Urologic Diseases Information Clearing House (NKUDIC) (2005). What you should know about kidney stones. In ‘‘Urinary Tract and Kidney Diseases and disorders Sourcebook’’ I. L. Alexander (ed.), (2005). pp. 348–360. Omnigraphics Inc., Detroit, MI. Newmark, H. L., Lipkin, M., and Maheshwari, N. (1990). Colonic hyperplasia and hyperproliferation induced by a nutritional stress diet with four components of Western-style diet. J. Natl. Cancer Inst. 82, 491–496. Nicklas, T. (2003). Calcium intake trends and health consequences from childhood through adulthood. J. Am. Coll. Nutr. 22, 340–356. NIH Consensus Development Panel on Optimal Calcium Intake (1994). NIH Consensus conference. Optimal calcium intake. JAMA 272, 1942–1948. Nishida, M., Grossi, S., Dunford, R. G., Ho, A. W., TRevisan, M., and Genco, R. J. (2000). Calcium and the risk for periodontal disease. J. Periodont. 71, 1057–1066. Norman, A. W., Bouillon, R., Whiting, S. J., Vieth, R., and Lips, P. (2007). 13th Workshop consensus for vitamin D nutritional guidelines. J. Steroid Biochem. Mol. Biol. 103, 204–205. Norman, D. A., Fordtran, J. S., Brinkley, L. J., Zerwekh, J. E., Nicar, M. J., Strowig, S. M., and Pak, C. Y. (1981). Jejunal and ileal adaptation to alterations in dietary calcium: Changes in calcium and magnesium absorption and pathogenetic role of parathyroid hormone and 1,25-dihydroxyvitamin D. J. Clin. Invest. 67, 1599–1603. Nusser, S. M., Carriquiry, A. L., Dodd, K. W., and Full, W. A. (1996). A semi-parametric transformation approach to estimating usual daily intake distributions. J. Am. Stat. Assoc. 91, 1440–1449.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

341

O’Flaherty, E. J. (2000). Modeling normal aging bone loss, with consideration of bone loss in osteoporosis. Toxicol. Sci. 55, 171–188. Odvina, C. V. (2006). Comparative value of orange juice versus lemonade in reducing stoneforming risk. Clin. J. Am. Soc. Nephrol. 1, 1269–1274. Ohya, K., Amano, H., and Ogura, H. (1992). Alveolar bone resorption process in the molar tooth region in calcium-deficient rats. Kokubyo Gakkai Zasshi 59, 585–593. Parizek, J. (1978). Interactions between selenium compounds and those of mercury or cadmium. Environ. Health Perspect. 25, 53–55. Parker, D. M. (2004). Liquid oral compositions comprising calcium compound and an acidulant. U.S. Patent No. 6,719,963 B2. Parry, J., Shaw, L., Arnaud, M. J., and Smith, A. J. (2001). Investigation of mineral waters and soft drinks in relation to dental erosion. J. Oral Rehab. 28, 766–772. Pattanaungkul, S., Riggs, B. L., Yergey, A. L., Vieira, N. E., O’Fallon, W. M., and Khosla, S. (2000). Relationship of intestinal calcium absorption to 1,25-dihydroxyvitamin D [1,25 (OH)2D] levels in young versus elderly women: Evidence for age-related intestinal resistance to 1,25(OH)2D action. J. Clin. Endocrinol. Metab. 85, 4023–4027. Peacock, M., Liu, G., Carey, M., McClintock, R., Ambrosius, W., Hui, S., and Johnston, C. C. (2000). Effect of calcium or 25OH vitamin D3 dietary supplementation on bone loss at the hip in men and women over the age of 60. J. Clin. Endocrinol. Metab. 85, 3011–3019. Pearle, M. S., Calhoun, E. A., and Curhan, G. C. (2004). Urolithiasis. In ‘‘Urologic Diseases in America. DHHS, Public Health Service (PHS), NIH, NIDDK’’ (M. S. Litwin and C. S. Saigal, eds.), pp. 3–39. Government Publishing Office (GPO), 2004; NIH Publication No. 04–5512, Washington, DC. Perales, S., Barbera, R., Lagarda, M. J., and Farre, R. (2006). Fortification of milk with calcium: Effect on calcium bioavailability and interactions with iron and zinc. J. Agric. Food Chem. 54, 4901–4906. Pierre, J. L., and Gautier-Luneau, I. (2000). Iron and citric acid: A fuzzy chemistry of ubiquitous biological relevance. Biometals 13, 91–96. Platt, B. S., and Moncrieff, A. (1947). Nutritional comparison of human and cow’s milk for infant feeding. Br. Med. Bull. 5, 177–180. Pointillart, A., and Gue´guen, L. (1993). Calcium bioavailability in pig fed a dry milk-based diet versus a standard diet containing Ca citrate malate. In ‘‘Bioavailability ‘93: Nutritional, Chemical and Food Processing Implications of Nutrient Availability’’. (U. Schlemmer, ed.), pp. 1–5. Ettlingen, May 9–12th [Proceedings]. Prather, T. A., and Miller, D. D. (1992). Calcium carbonate depresses iron bioavailability in rats more than calcium sulphate or sodium carbonate. J. Nutr. 122, 327–332. Prentice, A., Jarjou, L. M., Cole, T. J., Stirling, D. M., Dibba, B., and Fairweather-Tait, S. (1995). Calcium requirements of lactating Gambian mothers: Effects of a calcium supplement on breast-milk calcium concentration, maternal bone mineral content, and urinary calcium excretion. Am. J. Clin. Nutr. 62, 58–67. Prince, R. L., Dick, I. M., Lemmon, J., and Randell, D. (1997). The pathogenesis of age-related osteoporotic fracture: Effects of dietary calcium deprivation. J. Clin. Endocrinol. Metab. 82, 260–264. Prince, R. L., Devine, A., Dhaliwal, S. S., and Dick, I. M. (2006). Effects of calcium supplementation on clinical fracture and bone structure—results of a 5-year, double-blind, placebo-controlled trial in elderly women. Arch. Intern. Med. 166, 869–875. Puspitasari, N. L., Lee, K., and Greger, J. L. (1991). Calcium fortification of cottage cheese with hydrocolloid control of bitter flavor defects. J. Dairy Sci. 74, 1–7. Qiu, A. R., Wierzbicki, J. A., Orme, C. A., Cody, A. M., Hoyer, J. R., Nancollas, G. H., Zepeda, S., and De Yoreao, J. J. (2003). Molecular modulation of calcium oxalate crystallization by osteopontin and citrate. PNAS 101, 1811–1815.

342

Susan Reinwald et al.

Quilici-Timmcke, J. (2002). Opportunities expanding for calcium-fortified foods. Available from: http://www.ffnmag.com/asp/articleDisplay.asp?strArticleId¼104&strSite¼ FFNSite [Accessed April 2007]. Rafferty, K., Walters, G., and Heaney, R. P. (2007). Calcium fortificants: Overview and strategies for improving calcium nutriture of the U.S. population. J. Food Sci. 72, R152–R158. Rampersaud, G. C., Bailey, L. B., and Kauwell, G. P. (2003). National survey beverage consumption data for children and adolescents indicate the need to encourage a shift toward more nutritive beverages. J. Am. Diet. Assoc. 103, 97–100. Recker, R. R. (1985). Calcium absorption and achlorhydria. N. Engl. J. Med. 313, 70–73. Reid, I. R., Mason, B., Horne, A., Ames, R., Clearwater, J., Bava, U., Orr-Walker, B., Wu, F., Evans, M. C., and Gamble, G. D. (2002). Effects of calcium supplementation on serum lipid concentrations in normal older women: A randomized controlled trial. Am. J. Med. 112, 343. Remer, T. (2001). Influence of nutrition on acid-base balance—metabolic aspects. Eur. J. Nutr. 40, 214–220. Ricci, T. A., Chowdhury, H. A., Heymsfield, S. B., Stahl, T., Pierson, R. N., and Shapses, S. A. (1998). Calcium supplementation suppresses bone turnover during weight reduction in postmenopausal women. JBMR 13, 1045–1050. Richter, F., Newmark, H. L., Richter, A., Leung, D., and Lipkin, M. (1995). Inhibition of Western-diet induced hyperproliferation and hyperplasia in mouse colon by two sources of calcium. Carcinogenesis 16, 2685–2689. Rosen, C. J., and KIel, D. P. (2006). Age-related osteoporosis. In ‘‘Primer on the Metabolic Bone Diseases and Disorders of Mineral Metabolism’’ (M. J. Favus, ed.), American Society for Bone and Mineral Research, Washington, DC. Rossini, M., Bianchi, G., Di Munno, O., Giannini, S., Minisola, S., Sinigaglia, L., and Adami, S. (2006). Determinants of adherence to osteoporosis treatment in clinical practice. Osteoporos. Int. 17, 914–921. Roth-Bassell, H. A., and Clydesdale, F. M. (1991). The influence of zinc, magnesium, and iron on calcium uptake in brush border membrane vesicles. J. Am. Coll. Nutr. 10, 44–49. Roth-Bassell, H. A., and Clydesdale, F. M. (1992). In vitro solubility characteristics of six calcium salts. J. Food Prot. 55, 1003–1005. Roughead, Z. K., Zito, C. A., and Hunt, J. R. (2002). Initial uptake and absorption of nonheme iron and absorption of heme iron in humans are unaffected by the addition of calcium as cheese to a meal with high iron bioavailability. Am. J. Clin. Nutr. 76, 419–425. Rude, R. K. (1998). Magnesium deficiency: A cause of heterogenous disease in humans. J. Bone Miner. Res. 13, 749–758. Rugg-Gunn, A. J., Maguire, A., Gordon, P. H., McCabe, J. F., and Stephenson, G. (1998). Comparison of erosion of dental enamel by four drinks using an intra-oral device. Caries Res. 32, 337–343. Sabatier, M., Pont, F., Arnaud, M. J., and Turnlund, J. R. (2003). A compartmental model of magnesium metabolism in healthy men based on two stable isotope tracers. Am. J. Physiol. Regul. Integr. Comp. Physiol. 285, R656–R663. Salovaara, S., Sandberg, A., and Andlid, T. (2002). Organic acids influence iron uptake in the human epitheleal cell line Caco-2. J. Agric. Food Chem. 50, 6233–6238. Saltman, P. D., and Smith, K. T. (1993). Calcium and trace mineral supplements comprising estrogen. U.S. Patent No. 5,232,709. Santoro, N., Brown, J. R., Adel, T., and Skurnick, J. H. (1996). Characterization of reproductive hormonal dynamics in the perimenopause. J. Clin. Endocrinol. Metab. 81, 1495–1501. Sato, Y., Iwamoto, J., Kanoko, T., and Satoh, K. (2005). Low-dose vitamin D prevents muscular atrophy and reduces falls and hip fractures in women after stroke: A randomized controlled trial. Cerebrovasc. Dis. 20, 187–192.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

343

Schatzkin, A., and Peters, U. (2004). Advancing the calcium-colorectal cancer hypothesis. J. Natl. Cancer Inst. 96, 893–894. Schulze, K. J., O’Brien, K. O., Germain-Lee, E. L., Baer, D. J., Leonard, A., and Rosenstein, B. J. (2003). Efficiency of calcium absorption is not compromised in clinically stable prepubertal and pubertal girls with cystic fibrosis. Am. J. Clin. Nutr. 78, 110–116. Scopacasa, F., Wishart, J. M., Horowitz, M., Morris, H. A., and Need, A. G. (2004). Relation between calcium absorption and serum calcitriol in normal men: Evidence for age-related intestinal resistance to calcitriol. Eur. J. Clin. Nutr. 58, 264–269. Seiquer, I., Lopez-Frias, M., Munoz-Hoyos, A., Galdo, G., Delqado-Andrade, C., Mesias, M., and Navarro, M. P. (2006). Dietary calcium utilization among a group of Spanish boys aged 11–14 years on their ususal diets. J. Physiol. Biochem. 62, 9–16. Seligman, P. A., Caskey, J. H., Frazier, J. L., Zucker, P. M., Podell, E. R., and Allen, R. H. (1983). Measurements of iron absorption from prenatal multivitamin-mineral supplements. Obstet. Gynecol. 61, 356–362. Shahkhalili, Y., Murset, C., Meirim, I., Duruz, E., Guinchard, S., and Cavadini, C. (2001). Calcium supplementation of chocolate: Effect on cocoa butter digestibility and blood lipids in humans. Am. J. Clin. Nutr. 73, 246–252. Shipp, C. C., Maletskos, C. J., and Dawson-Hughes, B. (1987). Measurement of 47 calcium retention with a whole-body counter. Calcif. Tissue Int. 41, 307–312. Shoji, K. (2000). Bone mineral density of alveolar bone in rats during pregnancy and lactation. J. Periodont. 71, 1073–1078. Simmer, J. P. (1995). Molecular mechanisms of dental enamel formation. Crit. Rev. Oral Biol. Med. 6, 84–108. Slemenda, C. W., Peacock, M., Hui, S., Zhou, L., and Johnston, C. C. (1997). Reduced rates of skeletal remodeling are associated with increased bone mineral density during the development of peak skeletal mass. JBMR 12, 676–682. Smith, K. T. (1988). Calcium and trace mineral interactions. Cereal Foods World 33, 776–782. Smith, K. T., and Rotruck, J. T. (1988). Trace mineral and calcium interactions. In ‘‘Trace Elements in Man and Animals 6’’ (L. S. Hurley, C. L. Keen, B. Lonnerdal, and R. B. Rucker, eds.), pp. 221–228. Plenum Publishing Corporation, NY. Smith, K. T., Heaney, R. P., FLora, L., and Hinders, S. M. (1987). Calcium absorption from a new calcium delivery system (CCM). Calcif. Tissue Int. 41, 351–352. Sojka, J., Wastney, M., Abrams, S., Lewis, S. F., Martin, B., Weaver, C., and Peacock, M. (1997). Magnesium kinetics in adolescent girls determined using stable isotopes: Effects of high and low calcium intake. Am. J. Physiol. Regul. Integr. Comp. Physiol. 273, R710–R715. Song, Y. M., Sheu, W. H. H., and Lee, W. J. (2001). Acute biochemical variations induced by calcium citrate and calcium carbonate in Type 2 diabetic patients: Impaired calcium absorption in Type 2 diabetic patients with prolonged gastric emptying time. J. Diabet. Complic. 15, 97–102. Sorof, J. M., Lai, D., Turner, J., Poffenbarger, T., and Portman, R. J. (2004). Overweight, ethnicity, and the prevalence of hypertension in school-aged children. Pediatrics 113, 475–482. Specker, B. L., Beck, A., Kalkwarf, H., and Ho, M. (1997). Randomized trial of varying mineral intake on total body bone mineral accretion during the first year of life. Available from: http://pediatrics.aappublications.org/cgi/content/abstract/99/6/e12 [Accessed July 2007]. Spencer, H., Kramer, L., Norris, C., and Osis, D. (1984). Effect of calcium and phosphorus on zinc metabolism in man. Am. J. Clin. Nutr. 40, 1213–1218. Spencer, J. D., Allee, G. L., and Sauber, T. E. (2000). Phosphorus bioavailability and digestibility of normal and genetically modified low-phytate corn for pigs. J. Anim. Sci. 78, 675–681.

344

Susan Reinwald et al.

Standing Committee of the Scientific Evaluation of Dietary Reference Intakes, Food and Nutrition Board, and Institute of Medicine (1997). In ‘‘Dietary Reference Intakes for Calcium, Phosphorus, Magnesium, Vitamin D, and Fluoride.’’ National Academy Press, Washington, DC. Stops, F., Fell, J. T., Collett, J. H., Martini, L. G., Sharma, H. L., and Smith, A. M. (2006). The use of citric acid to prolong the in vivo gastro-retention of a floating dosage form in the fasted state. Int. J. Pharm. 308, 8–13. Storey, M. L., Forshee, R. A., and Anderson, P. A. (2004). Associations of adequate intake of calcium with diet, beverage consumption, and demographic characteristics among children and adolescents. J. Am. Coll. Nutr. 23, 18–33. Strause, L., Saltman, P., Smith, K. T., Bracker, M., and Andon, M. B. (1994). Spinal bone loss in postmenopausal women supplemented with calcium and trace minerals. J. Nutr. 124, 1060–1064. Streeten, E. A., Ryan, K. A., McBride, D. J., Pollin, T. I., Shuldiner, A. R., and Mitchell, B. D. (2005). The relationship between parity and bone mineral density in women characterized by a homogeneous lifestyle and high parity. J. Clin. Endocrinol. Metab. 90, 4536–4541. Sullivan, M. (2005). Shattering myths about kidney stones. In ‘‘Urinary Tract and Kidney Diseases and Disorders Sourcebook’’ (I. L. Alexander, ed.), pp. 361–365. Omnigraphics Inc., Detroit, MI. Teegarden, D. (2006). Dietary calcium and obesity. In ‘‘Calcium in Human Health’’ (A. Beddich, ed.), pp. 327–339. Humana Press, Totowa, NJ. The Practice Committee of the American Society for Reproductive Medicine (2006). The menopausal transition. Fertil. Steril. 86, S253–S256. Thomas, J., and Thomas, E. (1977). Experimental lithiasis in the rat. Urinary level of malic acid and oxaloacetic acid increased by administration of succinic acid, malic acid and oxaloacetic acid. Ann. Urol. 11, 89–94. Tiselius, H. G. (2005). Aetiological factors in stone formation. In ‘‘Oxford Textbook of Clinical Nephrology’’ (A. M. A. Davidson, J. S. Cameron, J.-P. Grunfeld, C. Ponticelli, E. Ritz, C. G. Winearls, and C. van Ypersele, eds.), Oxford University Press, USA. Tordoff, M. G. (2001). Calcium: Taste, intake, and appetite. Physiol. Rev. 81, 1567–1597. Turnlund, J. R., Smith, R. G., Kretsch, M. J., Keyes, W. R., and Shah, A. G. (1990). Milk’s effect on the bioavailability of iron from cereal-based diets in young women by use of in vitro and in vivo methods. Am. J. Clin. Nutr. 52, 373–378. U.S. Department of Health and Human Services (2004). In ‘‘Bone Health and Osteoporosis: A Report of the Surgeon General.’’ U.S. Department of Health and Human Services, Office of the Surgeon General, Rockville, MD. Uhland, V., Lewis, K., and Spehar, C. (2004). American Top 25: Supplements climbing the charts. Available from: http://www.naturalfoodsmerchandiser.com/ASP/articleDisplay. asp?strArticleId¼1046&strSite¼NFMSITE&Screen¼CURRENTISSUE [Accessed December 2006]. United States Department of Agriculture (2003). Agriculture Fact Book 2001–2002. Available from: http://www.usda.gov/factbook/2002factbook.pdf [Accessed March 2007]. van Mossevelde, B. (1997). Culinary cure: Calcium fortification. Available from: http:// www.foodproductdesign.com/archive/1997/0997CSP.html [Accessed March 2007]. Veum, T. L., Ledoux, D. R., Bollinger, D. W., Raboy, V., and Cook, A. (2002). Low-phytic acid barley improves calcium and phosphorus utilization and growth performance in growing pigs. J. Anim. Sci. 80, 2663–2670. Vieth, R. (2006). Critique of the considerations for establishing the tolerable upper intake level for vitamin D: Critical need for revision upwards. J. Nutr. 136, 1117–1122. Villareal, D. T., Fontana, L., Weiss, E. P., Racette, S. B., Steger-May, K., Schechtman, K. B., Klein, S., and Holloszy, J. O. (2006). Bone mineral density response to caloric restrictioninduced weight loss or exercise-induced weight loss: A randomized controlled trial. Arch. Intern. Med. 166, 2502–2510.

The Health Benefits of Calcium Citrate Malate: A Review of the Supporting Science

345

Volkert, D., Kreuel, K., Heseker, H., and Stehle, P. (2004). Energy and nutrient intake of young-old, old-old and very-old elderly in Germany. Eur. J. Clin. Nutr. 58, 1190–1200. Vyas, H. K., and Tong, P. S. (2004). Impact of source and level of calcium fortification on the heat stability of reconstituted skim milk powder. J. Dairy Sci. 87, 1177–1180. Wactawski-Wende, J., Hausmann, E., Hovey, K., Trevisan, M., Grossi, S., and Genco, R. J. (2005). The association between osteoporosis and alveolar crestal height in postmenopausal women. J. Periodont. 76, 2116–2124. Wade, M. A. (2004). Calcium: The chosen form: Fortifying products with calcium requires an understanding of the benefits of various forms and their interactions. Prepared Foods 175, 54–58. Walsh, C. T., Sandstead, H. H., Prasad, A. S., Newberne, P. M., and Fraker, P. J. (1994). Zinc: Health effects and research priorities for the 1990’s. Environ. Health Perspect. 102, 5–46. Walton, B., Sinclair, E., Bartholomew, E. T., and Ramsey, R. C. (1945). Analysis of the organic acids of orange juice. Plant Physiol. 20, 3–18. Warden, S. J., Fuchs, R. K., Castillo, A. B., Nelson, I. R., and Turner, C. H. (2007). Exercise when young provides lifelong benefits to bone structure and strength. JBMR 22, 251–259. Wasnich, R. D., and Miller, P. D. (2000). Antifracture efficacy of antiresorptive agents are related to changes in bone mineral density. J. Clin. Endocrinol. 85, 231–236. Wasserman, R. H. (2004). Vitamin D and the dual processes of intestinal calcium absorption. J. Nutr. 134, 3137–3139. Wastney, M. E., Martin, B. R., Peacock, M., Smith, D., Jiang, X. Y., Jackman, L. A., and Weaver, C. M. (2000). Changes in calcium kinetics in adolescent girls induced by high calcium intake. J. Clin. Endocrinol. Metab. 85, 4470–4475. Weaver, C. M. (2006). Back to basics: Have milk with meals. J. Am. Diet. Assoc. 106, 1756–1758. Weaver, C. M., and Heaney, R. P. (2006a). Calcium. In ‘‘Modern Nutrition in Health and Disease’’ (M. E. Shils, M. Shike, A. L. Ross, R. J. Cabollero, and R. J. Cousins, eds.), pp. 194–210. Lippincott Williams and Wilkins, Philadelphia. Weaver, C. M., and Heaney, R. P. (2006b). Appendix 1. In ‘‘Calcium in Human Health’’ (A. Bendich, ed.), p. 433. Humana Press, Totowa, NJ. Weaver, C. M., and Heaney, R. P. (2006c). Clinical approaches for studying calcium metabolism and its relationship to disease. In ‘‘Calcium in Human Health’’ (A. Bendich, ed.), . 433. Humana Press, Totowa, NJ. Weaver, C. M., and Liebman, M. (2002). Biomarkers of bone health appropriate for evaluating functional foods designed to reduce risk of osteoporosis. Br. J. Nutr. 88, S225–S232. Weaver, C. M., Martin, B. R., Plawecki, K. L., Peacock, M., Wood, O. B., Smith, D. L., and Wastney, M. E. (1995). Differences in calcium metabolism between adolescent and adult females. Am. J. Clin. Nutr. 61, 577–581. Weaver, C. M., Heaney, R. P., Teegarden, D., and Hinders, S. M. (1996). Wheat bran abolishes the inverse relationship between calcium load size and absorption fraction in women. J. Nutr. 126, 303–307. Weaver, C. M., Proulx, W. R., and Heaney, R. (1999). Choices for achieving adequate dietary calcium with a vegetarian diet. Am. J. Clin. Nutr. 70, 543S–548S. Weaver, C. M., Martin, B., Costa, M. B., Saleeb, F. Z., and Huth, P. J. (2002). Absorption of calcium fumarate is equivalent to other calcium salts when measured in the rat model. J. Agric. Food Chem. 50, 4974–4975. Weaver, C. M., Wastney, M. E., and Spence, L. A. (2004). Quantitative clinical nutrition approach to the study of calcium and bone metabolism. In ‘‘Nutrition and Bone Health’’ (M. Holick and B. Dawson-Hughes, eds.), pp. 307–326. Humana Press, New Jersey. Welberg, J. W., Monkelbaan, J. F., de Vries, E. G., Muskiet, F. A., Cats, A., Oremus, E. T., Boersma-van, E. W., van Rijsbergen, H., van der Meer, R., and Mulder, N. H. (1994). Effects of supplemental dietary calcium on quantitative and qualitative fecal fat excretion in man. Ann. Nutr. Metab. 38, 185–191.

346

Susan Reinwald et al.

Wienk, K. J. H., Marx, J. J. M., and Beynen, A. C. (1999). The concept of iron bioavailability and its assessment. Eur. J. Nutr. 38, 51–75. Williams, C. P., Child, D. F., Hudson, P. R., Davies, G. K., Davies, M. G., John, R., Anandaram, P. S., and De Bolla, A. R. (2001). Why oral calcium supplements may reduce renal stone disease: Report of a clinical pilot study. J. Clin. Pathol. 54, 54–62. Wing, R. R., Matthews, K. A., Kuller, L. H., Meilahn, E. N., and Plantinga, P. L. (1991). Weight gain at the time of menopause. Arch. Intern. Med. 151, 97–102. Wishart, J. M., Scopacasa, F., Horowitz, M., Morris, H. A., Need, A. G., Cliftin, P. M., and Nordin, B. E. (2000). Effect of perimenopause on calcium absorption: A longitudinal study. Climacteric 3, 102–108. Wolf, R. L., Cauley, J. A., Baker, C. E., Ferrell, R. E., Charron, M., Caggiula, A. W., Salamone, L. M., Heaney, R. P., and Kuller, L. H. (2000). Factors associated with calcium absorption efficiency in pre- and perimenopausal women. Am. J. Clin. Nutr. 72, 466–471. Wood, R. J., and Hanssen, D. A. (1988). Effect of milk and lactose on zinc absorption in lactose-intolerant postmenopausal women. J. Nutr. 118, 982–986. Wood, R. J., and Zheng, J. J. (1997). High dietary calcium intakes reduce zinc absorption and balance in humans. Am. J. Clin. Nutr. 65, 1803–1809. Wright, J. D., Wang, C. Y., Kennedy-Stephenson, J., and Ervin, R. B. (2003). Dietary intake of ten key nutrients for public health, United States: 1990–2000. Advanced data from vital and health statistics. no. 334. Hyattsville, Maryland: National Center for Health Statistics, . Wu, F. Y. H., and Wu, C. W. (1987). Zinc in DNA replication and transcription. Ann. Rev. Nutr. 7, 251–272. Yan, L., Prentice, A., Dibba, B., Jarjou, L. M., Stirling, D. M., and Fairweather-Tait, S. (1996). The effect of long-term calcium supplementation on indices of iron, zinc and magnesium status in lactating Gambian women. Br. J. Nutr. 76, 821–831. Yang, H. H. L., and Lawless, H. T. (2005). Descriptive analysis of divalent salts. J. Sens. Stud. 20, 97–113. Yeh, J. K., and Aloia, J. F. (1984). Effect of hypophysectomy and 1,25-dihydroxyvitamin D on duodenal calcium absorption. Endocrinology 114, 1711–1717. Yip, K. H. K., Smales, R. J., and Kaidonis, J. A. (2003). The diagnosis and control of extrinsic acid erosion of tooth substance. Gen. Dent. 51, 350–353. Yoshihara, A., Seida, Y., Hanada, N., Nakashima, K., and Miyazaki, H. (2005). The relationship between bone mineral density and the number of remaining teeth in community dwelling older adults. J. Oral Rehab. 32, 735–740. Zafar, T. A., Weaver, C. M., Zhao, Y., Martin, B. R., and Wastney, M. E. (2004). Nondigestible oligosaccharides increase calcium absorption and suppress bone resorption in ovariectomized rats. J. Nutr. 134, 399–402.

INDEX A Abalone, 152–153, 157–160, 163, 165 Aberrant antigen expression, 5 Absorption barriers, nutritargeting, 202–210 A. carbonarius and A. japonicus, calmodulin gene-targeted primers, 116–117 Adenosine triphosphate (ATP) production, 275 Adequate intake (AI), 223 Adrenaline, 149 Aflatoxin producers, detection, 102–103 Alkaline phosphatase (AP), 19 Allergenic protein, see Tropomyosin Alternaria spp., phytotoxin and antibiotic activity, 82 Alternaria tenuissima, 102 Alveolar bone resorption, 299 Alveolar ridge bone, 299 Amplified fragment length polymorphism (AFLP), 110, 112 Anaphylactic reactions, 149, 152 Angioedema, 147, 154–155, 157 Antibodies anti-fluorescent, 20 horseradish peroxidase, 21 monoclonal, 5 polyclonal, 5 use for pathogen capture, concentration, and detection purposes, 5 Anti-fluorescent antibody, 20 Antigen-specific antibody, 5 Antihistamines, 149 Anti-idiotypic antibodies, 65 Antimicrobial preservatives, 5 Antisecretory lectins, 54 Aquaculture, 142 Arachidonic acid (AA), 61 Area under the curve, 205–206 Aspergillus species A. aculeatus, 116 A. bombycis, 103 A. carbonarius, 111, 113

A. ellipticus, 115 A. flavus, 102, 115, 117 A. heteromorphus, 115 A. melleus, 120 A. niger, 110, 113–115 A. nomius, 103 A. ochraceoroseus, 103 A. ochraceus, 111–112, 116, 120 and A. carbonarius with cDNA AFLP-based primers, detection, 112 markers for, 111 A. parasiticus, 116 A. pseudotamari, 103 A. tubingensis, 112, 115 A. versicolor, 105 species-specific detection systems, 115 asphPN gene, 118 Asthma, 147–148, 150–152, 157–159 Atomic absorption spectrophotometry, 240, 279 ATP-based luminescence, 4 Atrophic rhinitis therapy, 188, 194 AUC, see Area under the curve B Baccharis cordifolia, 103 Bacillus anthracis, 11 Bacillus subtilis, 20 Bacillus thuringiensis, 13 Bacterial antigens, 63 Bacteria-specific generic rapid methods, 4 BaP, see Benzo(a)pyrene Basolateral membrane, 256 BDP, see Bronchopulmonary dysplasia Benzo(a)pyrene, 181–182 BIACORE system, detection E. coli, 16 Bifidogenic carbohydrates, 56 Bifidogenic peptides, 56 Biochemical characterization, 4 Biology-based microelectrical-mechanical systems (Bio-MEMS), 27 Bioluminescent protein, 30

347

348

Index

Biomolecular interaction analysis, 13 Biosensors detection system based on, 8–9 electrochemical immunosensors, 19–22 fiber optic, 9–13 impedance-based biochip sensor, 24–28 piezoelectric (PZ) biosensors, 18–19 SPR sensor, 13–18 tools, applications of, 2, 4 Bioterrorism, threat, 2 Biotinylated protein layer, 11 Biowarfare agents (BWA), detection, 11 Bivalvia, 141 BLAST tool, 114 Blatella germanica, 166 Blood and urinary biochemical tests, 296 Blood pressure (BP) management, 304 BMCs, see Buccal mucosal cells B. nivea, 125 Body mass index (BMI), 281 Bone mineral density (BMD), 280 Bone(s) density studies, 278 dissolution, risk of, 293 fracture risk in elderly men and women, 294 maintenance in adults, 289–290 metabolism, 230 biochemical markers of, 294 mineral accretion, 226 mineralization deficits, 287 in postmenopausal women, 290 remodeling of, 223 resorption markers, 273, 294 Bovine incisor enamel, 303 Bovine lactadherin, 55 Bovine lactoferrin, 51 Bovine serum albumen, 11 Bovine spongiformencephalopathy (BSE), 3 Breast-feeding beneficial role of, 46 for preventing onset of atopic illness, 63 for promoting oral tolerance in infant, 63 Breast milk, see Human milk Bronchial epithelium morphological changes, 182 progressive changes, 184 Bronchopulmonary dysplasia (BDP), 188 Buccal mucosal cells, 195 Byssochlamys, 124–125

C Ca absorption and bioavailability, isotopic labeling method, 271 Ca2þ/calmodulin-dependent protein kinases, 116 Ca:citrate:malate molar ratios, 261 Ca fumarate (CF), 269 Calcium aqueous solubility of, 235 concentration in breast milk, 226 dietary intake and sources of, 222, 243 factors influencing absorption of, 256 fractional absorption of, 261, 263, 280 health benefit of, 272 blood pressure reduction, 304–305 effect on serum lipids, 319 no effect on status of other minerals (Fe, Zn, Se, and Mg), 308 no increase in risk of kidney stones, 306–308 tooth erosion, 301–304 tooth retention, 298–299 intestinal absorption of, 244 requirements by human body, 223 retention and bone building in children and adolescents, 276 role in human body, 222 role in presence of oxalate, 307 Se antagonist, 316 solubility and sensory characteristics of, 236 specific needs by adults, 228–229 by children, 227 by infants, 224–226 by middle-aged adults, 229 by older adults, 229–230 by preadolescence and adolescence, 227–228 pregnancy and lactation, 230–231 transcellular absorption, 256 in vitro solubility characteristics of, 266 Calcium citrate malate (CCM) animal studies with, 269 benefits of, 323 biochemical changes in urine associated with, 308 chemical formula of CCM and its component anions, 232 comparison with Ca carbonate, 325–326 in dietary supplements, 242–244

Index

effect of phytates consumed by animals, 274 factors influencing absorption of, 243 formation of, 234–235 in fortified foods and beverages, 237 health benefits pertaining to, 220, 300 influencing factors-human studies age and life stage, 264–266 Ca intake, 257–258 food/beverage matrices, 261–264 interfering substances, 268–269 meal effects, 267 methodologies for measuring Ca absorption, 258–259 supplemental Ca source and form, 259–261 various other factors, 269 limitations of, 323–324 Calcium modulated protein, 116 Calmodulin, 116 Ca malate fumarate (CMF), 269 Campylobacter, 3, 27 Campylobacter jejuni, 13, 52 Ca:phytate complex formation, 275 b-Carotene, activity of, 201–202 a-Carotene, analysis of, 189 b-Carotene, AUCs, 206 CCM-fortified apple juice (CCM-AJ), 273 CCM-fortified beverages, 238 CCM-fortified orange (CCM-OJ), 273 C. dendroides, 107 Cell-based assays (CBAs), 28 Cell-based sensor, 28 Cell communication and immune system activation, 59 Cephalopoda, 141 Charge-coupled device (CCD), 9 Childhood hypertension, 304 Chinones, 82 Chlamydia trachomatis, 53 Chronic obstructive pulmonary diseases, 181, 183 C-4 hydroxylation of trichothecenes, 106 Chylomicrons, role of, 209 Citric acid, 232 Citrinin, 82, 120 Cladosporium spp., 104–105, 110 Clostridium botulinum, 11 Clostridium difficile, 49 cmdA gene, 116 Cockles, food allergy, 155 Codex Alimentarius Commission, 144 Coenzyme Q10 (CoQ10)

349

bioavailability of, 206–210 biological activity of, 207 Colon cancer, 321 Colony forming units (cfu), 118 Complimentary metal oxide silicon (CMOS), 9 COPD, see Chronic obstructive pulmonary diseases Coprophilic fungi, 124, see also Patulin CoQ10, see Coenzyme Q10 Cortical bone, 286, 296 Corticosteroids, 269 Coumarins, 82 CRABP, see Cytoplasmatic retinoic acid-binding protein Cra g 1 epitope region, see Tropomyosin Crohn’s disease, 269 Cross-reactions, see also Molluscan shellfish, allergies molluscan and crustacean shellfish species, 165–166 molluscan shellfish and mites or insects, 166–167 molluscan shellfish species, 163–165 processing on allergenicity, effect, 167 residues detection, 167–168 Crustacean shellfish, 143 Cuttlefish, allergic reactions, 157 Cyclopeptides, 82 Cytokines, 59–60 Cytopathogenic effects, 4 Cytoplasmatic retinoic acid-binding protein (CRABP), 184 Cytoplasmatic retinol-binding protein (CRBP), 184

D Dental enamel, erosion, 301, see also Oral health Deoxynivalenol, 82, 103 Dexonivalenol (DON), 18 Diacetoxyscirpenol (DAS), 103 DIAPOPS technology, for detection of trichothecene producers, 107 Diarrheal diseases, 48 Diastolic BP (DBP), 305 Dicalcium phosphate (DCP), 275 Dielectrophoresis (DEP), 5 Dietary nucleotides, 61 Dietary reference intake (DRI), 225 Diet-induced bone loss, 293

350

Index

Differential polarization light scattering (DPLS), 24 Differential pulse voltammetry, 21 Diketopiperazines, 82 DNA Detection Test StripsTM, 107 Docosahexaenoic acid (DHA), 61 Double-blind, placebo-controlled food challenge (DBPCFC), 148, 154 Drug targeting approaches, 180 and technology, 210 Dual x-ray absorptiometry (DEXA), 280 Dynabeads, separation of selected microorganism, 6 Dysplasia, biopsy-proven diagnosis, 185–186 E EDC/NHS-coupling chemistry, 16 Eenniatins, 82 Electrical impedance (EI), 28 Electrochemical cyclic voltammetry, 21 Electrochemical immunosensors, 19–22 Endogenous phytase synthesis, 257 Enterotoxin, detection methods, 15 Entrez Nucleotide database, 114 Enzyme-linked immunomagnetic chemiluminescence assay (ELIMCL), 20 Enzyme-linked immunosorbent assays (ELISA), 168 Enzyme-linked oligosorbent assay (ELOSA), 124 Epinephrine, 149 Epithelial lining fluid (ELF), 201 Ergot alkaloids, 82 Ergovalin, 82 Escherichia coli, 3, 7, 49 Ethylenediaminetetraacetic acid (EDTA), 309 Eupenicillium, 124 Excreta-recovery methods, Ca retention, 278 Extracellular fluids (ECFs), 222 F Fast atom bombardment mass spectrophotometry, 280 Fat-soluble components and antioxidants activity, 201–202 dietary components, 203 substances absorption, 204 vitamins, 204

Fiber optic biosensor basic principle of, 9 biowarfare agents, detection of, 11 for foodborne pathogens, 9 Fiber optic waveguides, 12 Fluorescein reporter dye, 22 Fluorescence amadite (FAM), 12 Fluorescence detector, 9 Fluorescence resonance energy transfer (FRET), 22 Focal plane array (FPA) detector, 23 Fok1 gene polymorphisms, 269 Food allergies, 143–150, 154, 156–157 Food/beverage matrices, 261 Food biosecurity, 2 Foodborne pathogens detection of, 2, 15 elimination of, 2 methods for detection, 8 Food-induced asthma, 148 Food-processing plant, for monitoring pathogens, 4 Food source, isotopic labeling of, 258 Food supply, safety of, 2 Fourier transform infrared spectroscopy (FT-IR), 23 Fracture risk and risk of falls, in elders, 294 Francisella tularensis, 11 French Allergy Vigilance Network, 153–156 Fructooligosaccharide (FOS), 263 FT-IR photoacoustic spectroscopy, 23 fum1 genes, 123 Fumonisin producers, detection, 120–124 Furofuranes, 82 Fusarium species, 82, 124, 109 F. avenaceum, 108 F. crookwellense, 104, 109 F. culmorum, 104, 106, 108–109 F. equiseti, 108 F. graminearum, 104–105, 109 F. nygamai, 120 F. oxysporum, 108 F. proliferatum, 120–122 F. pseudograminearum, 104–105, 107 F. sambucinum, 104, 108 F. sporotrichioides, 103–104, 108 F. subglutinans, 120 F. verticillioides, 120, 122 G Galactose oxidase, 104, 107 gaoA gene, 107

Index

Gastrointestinal allergies, 63 Gastrointestinal mucosal injury, 67 Gastrointestinal oxalate absorption, 307 Gastrointestinal regulatory peptides, 61 Gastropoda, 141 Generally regard as safe (GRAS), 110, 238 Genetic polymorphisms, 63 G. fujikuroi, 120, 122 Gibberella zeae, 107 Glutathione peroxidase system (GSH-Px), 315 Gram-positive bacteria, 51 Granulocyte-colony stimulating factor, 62 Gut-associated lymphoid tissue (GALT), 49 H Haemophilus influenzae, 49 Haliotis midae, 163 Hal m 2, allergen, 163 Hazard analysis critical control points (HACCP), 2, 4, 16 Hemoglobin, 310 High resolution fast-atom-bombardment mass spectrometry, 261 High-temperature, short-time (HTST) pasteurized milk, 239 Histamine, 147, 149 Histomorphometry analysis, 273 Horseradish peroxidase (HRP)-labeled antibody, 21 Human b-defensin-1, 54 Human milk anti-inflammatory factors in, 66 antioxidants, 68 anti-proteases, 68 cytokines, 67 LCPUFAs, 68–69 antimicrobial components in components of maternal innate and acquired immune system, 54 fats and fatty acids, 53 immunoglobulins, 48–50 lactoferrin and related peptides, 50–51 lysozymes and other enzymes, 51–52 oligosaccharides, 52–53 other non-antibody protein defense agents, 54–55 aqueous and lipid layer of, 64 compounds for inducing tolerance in infants N-6 and n-3 fatty acids, 64–65 TGF-b and IL-10, 64

351

compounds with antimicrobial properties, 49 development of infant’s immune system, 47 feeding regimens recommended for infants, 46 immune development, effect on cytokines, 59–60 hormones and bioactive peptides, 61 immune cells present in human milk, 58 in infants, 56–57 long-chain polyunsaturated fatty acids (LCP), 61–62 nucleotides, 61 other immune components, 62 immunological compounds in, 46 impact on infectious diseases, 48 influence on infant’s immunity, 46 protective effect of, 48 Hydrothermal cooking, 275 Hyperparathyroidism, 264, 296 Hyperphosphatemia, 243 Hypersensitivity reactions, 146, 148, 158 Hypocalcemia, 223, 243 Hypothalamic-pituitarygonadal axis, 230 I idh gene, 125, see also Patulin IgE-activated cells, 31 IgE antibodies, 146–148, 161, 166 IgE-mediated allergic reactions, symptoms, 147 IgE-mediated food allergy, 146, 149 IL-1 receptor antagonist, 67 Immune bacteriolysis, 54 Immune cells, in human milk B-cells and immunoglobulins, 59 macrophages, 58 neutrophils, 58 T-Cells, 59 Immune system, priming of, 65 Immunoglobulins, 50–51 Immunomagnetic separation (IMS), 5–6 Impedance-based biochip sensor, 24–28 Impedance immunosensor method, for E. coli, 28 Impedance microbiology, 24 Infectious disease, mortality caused by, 48 Interdigitated electrode structures (IDES), 29 Intergenic region (IGS), 122

352

Index

International Union of Immunological Societies (IUIS), 163 Intestinal enterocytes, 256 Intestinal immune system, 57, 60 Intestinal mucosa and cells, 264, 310 Intracellular CoQ10 in BMC, 208–209 Intra-oral appliances, 303 Isoepoxidon dehydrogenase, 125 Italian Collaborative Group on Preterm Delivery (ICGPd), 190

Lactate dehydrogenase (LDH) enzyme, 30 Lactobacillus acidophilus, 18 Lactoferrin, 50–51 Lactones, 82 Langmuir-Blodgett method, immobilization of anti-Salmonella antibody, 18 Legionella pneumophilia, 16 Leukotrienes, 147 Light addressable potentiometric sensor (LAPS), 19 LightCyclerTM, 111 Light scattering, for detection of bacteria, 23 Limit of detection (LOD), 16 Lipopolysaccharide (LPS), 52 Liquid scintillation spectrometry, 240 Listeria adhesion protein (LAP), 18 Listeria electrical detection (LED), 27 Listeria monocytogenes, 3, 7 Long-chain polyunsaturated fatty acids (LCP), 61–62 Long-chain polyunsaturated fatty acids (LCPUFAs), 47 Low conductive growth medium (LCGM), 27 Low density lipoprotein (LDL), 319 Lumbar spinal bone density, 291 Luminal iron chelators, 309 Luminal mucosal surface, 310 Lysozymes, 51–52

Mammalian cells, physiological activities, 28 Mammary epithelial cells, 54 Mangifera indica, 122 Maternal cytokines, 60 Maternal mucosal immune system, 59 Membrane-binding transport proteins, 256 Metabolic fingerprinting, 4, see also Biochemical characterization Metaplasia, biopsy-proven diagnosis, 185–186 Met e 1, allergen, 161 Microbial metabolism, 25 Micronutrients, role and activities, 210 Microorganisms, genetic properties of, 4 Milk fat globule, 53 Molluscan shellfish allergies, 142, 145, 149, 151 allergens, 159–163 allergic reactions, 151 to bivalves, 153–155 to cephalopods, 155–157 cross-reactions, 163–168 diagnosis and treatment of, 148–159 food-dependent, exercise-induced, 157–159 to gastropods, 151–153 natural history of, 150 severity of allergic reactions, 149–150 classification and importance as food, 141–142 worldwide production and catch of, 142 Monascus ruber, 120 Monoclonal antibody (MAb), 5 Mucociliary clearance impairment of, 194 reduction of, 183 Mucosal immunity in infant, development of, 62 Multianalyte array biosensor (MAAB), 12 Muscle atrophy, 289 Mus musculus, 113 Mussel allergy, 155 Mycobacterium tuberculosis, 18 Mycotoxins, 18, 82, 106, 116, 120, 124, 127 Mycotoxin-producing fungi and toxins, PCR assays for, 85–101

M

N

K Klebsiella pneumoniae, 55 Krebs cycle intermediate, 307 L

Magnetic remmnance, 6 Magnetic separator, 6 Malic acid, 232 Mammalian cell-based biosensors, 28

Necrotizing enterocolitis, 66 Nectria haematococca, 113 Neonatal innate immune system, 62 Neosolaniol (NEOS), 103

Index

Nivalenol (NIV), 103 Nonlinear regression model, 278 Nonpathogenic microbes, 65 npsPN gene, 118 NRL array biosensor, 12 Nucleotide-nucleotide BLAST search, 120 Nucleotides, 61 Nutrient deficiency iron, 309–313 magnesium, 317–319 selenium, 315–317 zinc, 313–315 Nutritargeting pathways, 202–210 role of, 190 O Obstructive respiratory diseases, development of, 183 Occupational allergies, 158–159, see also Molluscan shellfish, allergies Ochratoxin, 109–110, 112, 118 Ochratoxin A, 118 producers, detection, 109–110 Ochratoxin polyketide synthase, 119 ODC, activity of, 202 Oligosaccharides, 52–53, 263 Optical fiber biosensors, 11 Optically transparent waveguide, 13 Oral bone loss, 301 Oral health, 298–304 Organic chelates, molecular weight (MW), 259 Ornithine-decarboxylase (ODC), 201 Osmotic stress, 5 Osteocalcin (OC), 283 Osteopenia, 298 Osteoporosis, 230, 244, 257, 276, 289, 295, 300 medical treatments, 298 Osteoprotegerin (OPG), 62 OTA biosynthetic pathway genes, primers, 117–120 otapksPN gene, 118 Ovarian estrogen, 230 Oxalate loading (OL), 307 Oyster, 142, 145, 150, 156, 159, 161, 163, 165 P Paecilomyces, 125, see also idh gene Pan-allergen, 160, 163 Parathyroid hormone (PTH), 222

353

Pathogenic microorganisms, 3 Pathogens biosensor-based detection methods, 8–9 controlling strategies, 2 food-processing plant for monitoring, 4 outbreak of, 2 potential source of, 3 separation and concentration of, 4–5 strategies for detecting, 5 use of antibody for capture, concentration, and detection purposes, 5 Pathologic bone fractures, 299 Patulin, 82 fungal species from silage, 124 fungi producing and detection, 124–126 Penicillium spp., 111 Periodontal disease in humans, 299 Peripheral quantitative tomography (pQCT), 286 Periplaneta americana, 166 Phenotypic expression analysis, of signature molecules, 4 Phylostine, 125 Piezoelectric (PZ) biosensors, 18–19 pksL2 gene, 117 Planar optic biosensor, 12 Planar waveguide, 9 Plasma CoQ10 concentrations, 208 Pneumonitis, 159 P. nordicum, 112, 118–119, see also OTA biosynthetic pathway genes, primers Polarized monochromatic light source, 23 Polyacrylamide gel electrophoresis (PAGE), 111 Polyclonal antibodies (PAbs), 5 Polyclonal anti-Listeria antibody, 7 Polyhalogenated compounds, in local vitamin A, 184 Polyketide synthase gene, 117, 120 Polymerase chain reaction (PCR), 83 assays for, detection mycotoxinproducing fungi and toxins, 85–101 detection systems, for mycotoxin producing-fungi, 84 fungi producing OTA and mycotoxin, citrinin, 120 IMS coupled with, 7 Polystyrene optical fibers, 10 Postnatal development of lung, 188–190 Potentiometric alternating biosensing (PAB) system, 20

354

Index

Potentiometric sensor, 30 P. purpurogenum, 105, see also Trichothecene Premenstrual syndrome, 223 Primers anonymous genomic markers, targeted to, 110 genetically defined sequences, targeted to, 114 Pro-inflammatory prostaglandin-E2 (PGE2), 68 P. roqueforti, 125–126, see also Patulin Prostaglandins, 69, 147 Protein allergens, 146 Protein calorie malnutrition (PCM), 192 Proteolytic enzymes, 48 PTH biochemical, 298 P. verrucosum,117–119, see also OTA biosynthetic pathway genes, primers P. viridicatum, in detection fungi producing OTA, 120 Pyrenopaziza brassicae, 110 Q Quantitative computed tomography (QCT), 281 Quantitative real-time PCR (qRT-PCR), 118 Quartz crystal microbalance (QCM) immunosensor, 16 R Radioallergosorbent tests (RASTs), 148–149, 155, 157–158 Radiocalcium tracers, 259 Radioimmunoassay (RIA), 312 Radiolabeling method, 269 Randomly amplified polymorphic DNA (RAPD), 108 A. carbonarius and A. niger, marker-based primers for, 113 F. culmorum-specific 472-bp RAPD fragment, 109 F. verticillioides and F. subglutinans, PCR-based detection, 121 screening of F. subglutinans, RAPD-based PCR, 121–122 species within G. fujikuroi complex, analysis of, 121 RAPD marker-based primers, for A. carbonarius and A. niger, 113–114 Rapid Automated Bacterial Impedance Technique (RABIT) system, 25

Respiratory mucosa, alteration of, 183 Respiratory syncytial virus, 183 Restriction endonucleases, EcoRI, 111 Retinoic acid (RA), 181, 187 Retinoids deficiency effect, 197 importance for, 200 role of, 196 Retinol biological activity, 185 formation and in plasma, 196 Retinol-binding protein (RBP), 189 Retinyl esters application, 191 Retinyl palmitate, 181 Rice-based beverages, 240 Roquefortine C, 82 Rotavirus, 51, 66 RP, see Retinyl palmitate rRNA genes, 114 for PCR diagnosis of OTA-producing fungi, 114–116 RSV, see Respiratory syncytial virus S Salmonella, 3, see also Human milk; Oligosaccharides; Polymerase chain reaction (PCR) enterica, 7 fyris, 52 typhimurium, 55 S. atra, see S. chartarum Saturated fatty acids (SFA), 319 S. chartarum, 105, see also Trichothecene Self-assembly monolayer (SAM), 10 Sensitization, 144, 146–148, 166–167, see also Molluscan shellfish, allergies Serological tests, for isolating bacterial cells, 3 Sesquiterpenes, 82 Shellfish species, 141 Shigella, 3, 49 Shrimp allergy, 156 Sick building syndrome, 105 Simulation Application for the Analysis of Models (SAAM), 318 Skeletal fragility, 289 Skeletal maturation, 276 Skin prick tests (SPTs), 145, 157 SPR-angular modulation, 14 SPR sensor, 13–18 SPR-wavelength modulation, 14 Squamous metaplasia, treatment, 184–186

Index

Squid, allergenic food, 145 Staphylococcal enterotoxin (SE), 11 Staphylococcus aureus, 11, 51, see also Lactoferrin Streptococcus, see also Lysozymes cremoris, 52 pneumoniae, 51 Surface immobilization, 14 Surface plasmon resonance (SPR), 11 Systemic bone loss, rate of, 298 Systolic BP (SBP), 305 T Ò

TaqMan , 118 TaqMan quantitative real-time PCR assay, 105 Tartrate resistant acid phosphatase (TRAP), 283 T-cell-dependent immune responses, 58 T. cornutus, 161 Tenuazonic acid, 82, 103 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD), 181–182 Tibia dyschondroplasia (TD), 275 a-Tocopherol, AUCs, 206 Todarodes pacificus, 156 Toll-like receptor 2 (TLR2), 54 Topoisomerase II gene, 113 Total body bone mass (TB-BMD), 281 Toxic shock syndrome, 11 Toxins detection, PCR assays for, 85-101 Trabecular bone volume (TBV), 273 Tricalcium phosphate (TCP), 322 Trichoderma harzianum, 104 Trichothecene, 104 biosynthesis cluster genes, 103–106 producers, detection, 103 sequence sources for, 106–109 tri5, 6, 7, 13 gene, 104–106 Tropomyosin, 159, 161, 163–164, 167 allergens, 160 percent identity matrix for, 162 b-Tubulin, 107, 116, 126 U Ultra-high temperature (UHT) treated milk products, 324 Urinary bone resorption biomarkers, 280 Urticaria, 147, 155, 157–159 Ustilaginoidea virens, 82 Ustiloxins, 82

355

V Vaccinia virus, 13 Vitamin A application effects of, 194, 197–202 chemoprevention, 184 comparative bioavailability of, 205–206 deficiency diseases, 181 local, 183–184, 188 marginal, 181, 183, 187 treatment, 191–194 deficient diet effect, 197 effects evaluation of, 197–202 ester, application of, 184 influence of, 182, 188–190 inhalation of, 185, 187–188, 191–194 insufficient supply of, 188–190 palmitate, activity of, 198 pharmacological activity, 199 prevention and therapy of, 190–191 role of, 181, 194–197 significance of, 181–184 target tissue of, 181 toxic effects, 188 Vitamin C area under the curve (AUCs), 206 comparative bioavailability of, 205–206 Vitamin D supplementation, 269 synthesis of, 290 Vitamin D receptor (VDR), 257, 269 Vitamin E accumulation of, 202 comparative bioavailability of, 205–206 inhalation of, 201 Vitamins administration, nanocolloids method, 203 W Whole-body gamma counter, 278 Whole body retention (WBR), 269 Y Yersinia enterocolitica, 3, 16 Z Zearalenone, 82, 126 Zernike moment invariants, 24 Zinc finger proteins, 113