Advances in
CANCER RESEARCH Volume 80
This Page Intentionally Left Blank
Advances in
CANCER RESEARCH Volume 80
E...
30 downloads
1130 Views
3MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
Advances in
CANCER RESEARCH Volume 80
This Page Intentionally Left Blank
Advances in
CANCER RESEARCH Volume 80
Edited by
George F. Vande Woude Division of Basic Sciences National Cancer Institute National Institutes of Health Bethesda, Maryland
George Klein Microbiology and Tumor Biology Center Karolinska Institutet Stockholm, Sweden
San Diego
San Francisco
New York Boston
London
Sydney
Tokyo
Contents
Contributors to Volume 80
ix
Involvement of Platelet-Derived Growth Factor in Disease: Development of Specific Antagonists Arne Östman and Carl-Henrik Heldin I. II. III. IV. V. VI. VII.
Introduction 2 Platelet-Derived Growth Factor (PDGF) and PDGF Receptors Intracellular Signal Transduction 5 In Vivo Function of PDGF 9 PDGF in Disease 13 PDGF and PDGF Receptors as Drug Targets 19 Future Perspectives 27 References 28
3
Tumor Suppression Activity of Adenovirus E1a Protein: Anoikis and the Epithelial Phenotype Steven M. Frisch I. II. III. IV. V.
Introduction 39 Historical Development of E1a as a Tumor Suppressor 40 Epithelial Conversion: Phenomenology 41 Epithelial Conversion: Mechanisms 41 Anoikis Sensitization and Tumor Suppression by E1a 44 References 46
Comparative Analysis of the Transforming Mechanisms of Epstein–Barr Virus, Kaposi’s Sarcoma-Associated Herpesvirus, and Herpesvirus Saimiri Blossom Damania and Jae U. Jung I. Introduction
51
v
vi
Contents
II. Comparative Analysis of Gamma Herpesvirus Gene Products III. Conclusion 73 References 74
55
Genetic Predisposition and Somatic Diversification in Tumor Development and Progression Darryl Shibata and Lauri A. Aaltonen I. Introduction 84 II. Hereditary Colorectal Cancer Syndromes 85 III. Tumor Mutations and Molecular Clocks: Gateways to the Fourth Dimension References 110
Primary Effusion Lymphoma: A Liquid Phase Lymphoma of Fluid-Filled Body Cavities Gianluca Gaidano and Antonino Carbone I. II. III. IV. V. VI. VII. VIII. IX.
Definition of Primary Effusion Lymphoma 116 Histogenes of Primary Effusion Lymphoma 119 Pathogenesis of Primary Effusion Lymphoma 121 Epidemiology of Primary Effusion Lymphoma 133 Clinical Features of Primary Effusion Lymphoma 135 Radioimaging of Primary Effusion Lymphoma 136 Differential Diagnosis of Primary Effusion Lymphoma 136 Therapy of Primary Effusion Lymphoma 137 Perspectives 138 References 140
Dimensions of Antigen Recognition and Levels of Immunological Specificity Neil S. Greenspan I. Introduction 148 II. Logical Preliminaries: Boundaries of Categories and Categories of Boundaries 149 III. Monovalent Recognition 153 IV. Multivalent Recognition 165 V. Specificity of Cellular Activation 171 VI. Organismal Specificity 174 VII. Conclusions 182 References 183
89
vii
Contents
Topoisomerase I-Mediated DNA Damage Philippe Pourquier and Yves Pommier I. II. III. IV. V. VI.
Introduction 189 Structural Domains of Top1 190 Top1 Functions and Protein Interactions 191 The Top1 Catalytic Cycle and Cleavage Complexes 195 Anticancer Top1 Poisons 198 Suppression and/or Enhancement of Top1 Cleavage Complexes by DNA Damage 201 VII. Processing of Top1-Mediated DNA Lesions 209 VIII. Conclusions 211 References 211
Index
217
This Page Intentionally Left Blank
Contributors
Numbers in parentheses indicate the pages on which the authors’ contributions begin.
Lauri A. Aaltonen, Department of Medical Genetics, Haartman Institute, University of Helsinki, FIN-00014 Helsinki, Finland (83) Antonino Carbone, Division of Pathology, Centro di Riferimento Oncologico, IRCCS, Istituto Nazionale Tumori, 33081 Aviano, Italy (115) Blossom Damania, Department of Microbiology and Molecular Genetics, New England Regional Primate Research Center, Harvard Medical School, Southborough, Massachusetts 01772 (51) Steven M. Frisch, The Burnham Institute, La Jolla, California 92037 (39) Gianluca Gaidano, Division of Internal Medicine, Department of Medical Sciences, Amedeo Avogadro University of Eastern Piedmont, 28100 Novara, Italy (115) Neil S. Greenspan, Institute of Pathology, Case Western Reserve University, Cleveland, Ohio 44106 (147) Carl-Henrik Heldin, Ludwig Institute for Cancer Research, Biomedical Center, S-751 24 Uppsala, Sweden (1) Jae U. Jung, Department of Microbiology and Molecular Genetics, New England Regional Primate Research Center, Harvard Medical School, Southborough, Massachusetts 01772 (51) Arne Östman, Ludwig Institute for Cancer Research, Biomedical Center, S-751 24 Uppsala, Sweden (1) Yves Pommier, Laboratory of Molecular Pharmacology, Division of Basic Sciences, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892 (189) Philippe Pourquier, Laboratory of Molecular Pharmacology, Division of Basic Sciences, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892 (189) Darryl Shibata, Department of Pathology, Norris Cancer Center, University of Southern California School of Medicine, Los Angeles, California 90033 (83)
ix
This Page Intentionally Left Blank
Involvement of Platelet-Derived Growth Factor in Disease: Development of Specific Antagonists Arne Östman and Carl-Henrik Heldin Ludwig Institute for Cancer Research Biomedical Center S-751 24 Uppsala, Sweden
I. Introduction II. Platelet-Derived Growth Factor (PDGF) and PDGF Receptors A. PDGF Isoforms B. Cell Types Producing PDGF C. Processing and Compartmentalization of PDGF D. PDGF Receptors E. Target Cells of PDGF F. Cellular Effects of PDGF Isoforms III. Intracellular Signal Transduction A. Receptor Activation B. Signaling via SH2 Domain Proteins C. Modulation of Signaling IV. In Vivo Function of PDGF A. Embryonal Development B. Wound Healing C. Vascular System D. Tissue Homeostasis V. PDGF in Disease A. Cancer B. Atherosclerosis C. Lung Fibrosis D. Glomerulonephritis VI. PDGF and PDGF Receptors as Drug Targets A. PDGF Antagonists B. PDGF Antagonists in Treatment of Cancer C. PDGF Antagonists in Treatment of Atherosclerosis D. PDGF Antagonists in Treatment of Lung Fibrosis E. PDGF Antagonists in Treatment of Glomerulonephritis VII. Future Perspectives References
Platelet-derived growth factor (PDGF) is a family of dimeric isoforms that stimulates, e.g., growth, chemotaxis and cell shape changes of various connective tissue cell types
Advances in CANCER RESEARCH Vol. 80 0065-230X/01 $35.00
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
2
Arne Östman and Carl-Henrik Heldin
and certain other cells. The cellular effects of PDGF isoforms are exerted through binding to two structurally related tyrosine kinase receptors. Ligand binding induces receptor dimerization and autophosphorylation. This enables a number of SH2 domain containing signal transduction molecules to bind to the receptors, thereby initiating various signaling pathways. PDGF isoforms have important roles during the embryonic development, particularly in the formation of connective tissue in various organs. In the adult, PDGF stimulates wound healing. Overactivity of PDGF has been implicated in certain disorders, including fibrotic conditions, atherosclerosis, and malignancies. Different kinds of PDGF antagonists are currently being developed and evaluated in different animal disease models, as well as in clinical trials. © 2000 Academic Press.
I. INTRODUCTION Accumulating evidence supports the notion that loss of growth control of cancer cells involves perturbation of signaling pathways that in the normal cell are controlled by growth regulatory factors. Thus in cancer cells, growth stimulatory factors may be produced that stimulate cell growth in an autocrine manner, growth factor receptors may be amplified or mutated so that they are also active in the absence of stimulation by growth factor, or intracellular components, which in the normal cell are controlled by growth factors, may be overactive. Analogously, growth inhibitors that normally control the growth of a particular cell type may be lacking, or receptors for growth inhibitors or their downstream effectors may be defect or absent. In each case the balance between stimulatory and inhibitory signals is altered, and loss of growth control results. Platelet-derived growth factor (PDGF) is a connective tissue cell mitogen that has been implicated in tumorigenesis. Its transforming properties were illustrated by the findings that the gene for one of the PDGF isoforms was acquired as the sis oncogene of the simian sarcoma virus (SSV) and that SSV transformation of cells involves autocrine stimulation by a PDGF-like growth factor (reviewed by Westermark et al., 1987). PDGF has also been implicated in autocrine as well as paracrine mechanisms in various types of human cancers, as well as in other diseases characterized by an excessive cell growth (reviewed by Heldin and Westermark, 1999). The signaling mechanisms whereby PDGF exerts its cellular effects and the in vivo function and role in disease of PDGF have been reviewed (Betsholtz and Raines, 1997; Heldin and Westermark, 1999; Heldin et al., 1998; Rosenkranz and Kazlauskas, 1999). The aim of this review is to briefly update the progress in our understanding of PDGF signaling and the role of PDGF in vivo and in diseases and to focus on the design and development of PDGF antagonists and discuss their potential clinical use.
Involvement of PDGF in Disease
3
II. PDGF AND PDGF RECEPTORS PDGF is a family of isoforms that exerts their cellular effect by binding to two structurally related tyrosine kinase receptors.
A. PDGF Isoforms PDGF family members are dimeric molecules with a conserved sequence of about 100 amino acid residues containing a characteristic motif of 8 cysteine residues. Three isoforms, i.e., homo- or heterodimers of A and B polypeptide chains, are well characterized (reviewed by Heldin and Westermark, 1999). Interestingly, however, another PDGF isoform has been discovered, i.e., PDGF C (Li et al., 2000). The C chain occurs as a homodimer (PDGF CC); it is not known whether it can also form heterodimers with other PDGF chains. Moreover, PDGFs are structurally similar to the vascular endothelial growth factor (VEGF) family (VEGF, VEGF-B, VEGF-C, and VEGF-D and placenta growth factor; reviewed in Joukov et al., 1997). Crystallization of PDGF BB revealed that the two subunits in the dimer are arranged in an antiparallel manner (Oefner et al., 1992). Two cysteine residues form interchain disulfide bonds. The other six conserved cysteine residues are arranged in a tight knot structure with one disulfide bond passing through the hole formed by the other two disulfide bonds and intervening amino acid residues. Two loops (loop 1 and loop 3) extend in one direction from the cystine knot and another (loop 2) in the other direction. Because of the antiparallel arrangement of the subunits in the dimer, loops 1 and 3 from one subunit will come close to loop 2 from the other. The receptor-binding epitope is built up by epitopes from all three loops, but the major contribution comes from loops 1 and 3 (Andersson et al., 1995; Schilling et al., 1998). Despite the fact that there is no amino acid sequence similarity among PDGF, nerve growth factor, and transforming growth factor- (TGF-), all factors have similar three-dimensional structures with cystine knots and dimeric configurations (Murray-Rust et al., 1993).
B. Cell Types Producing PDGF Several different cell types express PDGF, most often both the A and the B polypeptide chains (Heldin and Westermark, 1999). However, less is known about which cell types synthesize the newly discovered C chain. The A and B chains are independently regulated, and the synthesis is often induced in response to external stimuli. Thus, the production of PDGF by endothelial
4
Arne Östman and Carl-Henrik Heldin
cells is stimulated by thrombin (Daniel et al., 1986; Harlan et al., 1986), the production by vascular smooth muscle cells is induced by mechanical strain (Ma et al., 1999), and in several different cell types the production is induced by low oxygen (Kourembanas et al., 1997) and by various growth factors and cytokines. The PDGF A chain is also induced in uterus smooth muscle cells during the physiological hypertrophy of pregnancy (Mendoza et al., 1990).
C. Processing and Compartmentalization of PDGF The members of the PDGF family are synthesized as precursor molecules, which need to undergo proteolytic processing before they can act on their target cells. Thus, the A and B chain precursors are cleaved in their N termini, and the B chain in the C terminus, during their secretion from the producer cells (Östman et al., 1992). The C chain contains an N-terminally located CUB domain, which needs to be removed before the C chain can bind to receptors (Li et al., 2000). The A chain of PDGF occurs as two different splice forms; the long form, but not the short form, contains a C-terminal basic sequence that mediates interactions with negatively changed glycosaminoglycans in the extracellular matrix, as well as with structures inside the cell (Heldin and Westermark, 1999). Also, the B chain precursor contains a similar sequence. This means that the long form of the A chain and the B chain is retained close to the producer cell, whereas the short A chain may be more free to diffuse and to stimulate cells at a distance.
D. PDGF Receptors PDGF isoforms bind to structurally similar ␣- and -tyrosine kinase receptors. The receptors have five immunoglobulin (Ig)-like domains in their extracellular parts and tyrosine kinase domains intracellularly, which have characteristic inserted sequences without homology to other kinases (reviewed in Heldin et al., 1998). The PDGF ␣ receptor gene is localized on chromosome 4q12 close to the genes for the structurally related stem cell factor receptor, whereas the  receptor gene is located on chromosome 5 close to the gene for the structurally related colony stimulatory factor-1 receptor. This suggests that this gene family has arisen through gene duplication.
E. Target Cells for PDGF The classical target cells for PDGF, fibroblasts and smooth muscle cells, have both ␣ and  receptors, albeit generally more  receptors (reviewed in
Involvement of PDGF in Disease
5
Heldin and Westermark, 1999). Other cell types also express both receptors, including kidney mesangial cells, Leydig cells, and certain cells in the central nervous system, e.g., neurons, Schwann cells, and retinal pigment epithelial cells. There are, however, several examples of cells that express only one of the two receptor types. Thus, liver sinusoidal endothelial cells, astrocytes, platelets, and megakaryocytes have only ␣ receptors, and Itoh cells of the liver, myoblasts, capillary endothelial cells, pericytes, mammary epithelial cells, T cells, myeloid hematopoietic cells and macrophages have only  receptors.
F. Cellular Effects of PDGF Isoforms The PDGF ␣- and -receptor homo- and heterodimers induce similar, but not identical, cellular effects. All dimeric combinations transduce mitogenic signals. In some cell types, however, there are differences between the various receptor dimers in their abilities to mediate actin reorganization. Whereas all receptor dimers stimulate edge ruffling and loss of stress fibers, only ␣ and  receptor dimers induce the formation of circular actin structures on the dorsal surface of the cell (Eriksson et al., 1992). Also with regard to chemotaxis there is a difference between the various receptor dimers, at least in certain cell types; whereas  and ␣ receptor dimers stimulate chemotaxis, ␣␣ receptor dimers inhibit the chemotaxis of smooth muscle cells and fibroblasts (Koyama et al., 1996; Siegbahn et al., 1990). Both the ␣ and the  receptor mediate an increase in the intracellular Ca2⫹ concentration, but the  receptor is more efficient; in fact, the  receptor-induced Ca2⫹ increase is depressed by prior treatment of the cells with PDGF AA (Diliberto et al., 1992). PDGF also exerts an antiapoptotic effect (Yao and Cooper, 1995), inhibits gap junctional communication between cells (Hossain et al., 1998), and stimulates the contraction of collagen gels (Clark et al., 1989; Gullberg et al., 1990).
III. INTRACELLULAR SIGNAL TRANSDUCTION Ligand-induced dimerization of PDGF receptors activates a number of intracellular signaling pathways, which ultimately lead to cell growth, changes in cell morphology, and prevention of apoptosis. An extensive cross talk between different signaling pathways and the occurrence of parallel positive and negative signals fine-tune and modulate the responses.
A. Receptor Activation Because PDGF isoforms are dimeric molecules, their binding to receptors causes receptor dimerization. The A and C chains of PDGF bind ␣ receptors,
6
Arne Östman and Carl-Henrik Heldin
Fig. 1 Several PDGF isoforms bind to two related receptors. The specificity in assembly of different dimeric receptor complexes of known PDGF isoforms is shown. Ig domains in the extracellular part of receptors are illustrated by circles, and split kinase domains in the intracellular part are illustrated by rectangles.
whereas the B chain binds both ␣ and  receptors with high affinity (Heldin and Westermark, 1999; Li et al., 2000). Thus, PDGF AA and PDGF CC induce ␣␣ receptor dimers, PDGF AB ␣␣ or ␣ receptor dimers, and PDGF BB all three possible types of dimers (Fig. 1). Whereas ligand binding to the outermost three Ig-like domains induces dimerization of PDGF receptors (Heidaran et al., 1990), the dimeric complex is further stabilized by direct interactions involving Ig-like domain 4 (Miyazawa et al., 1998; Omura et al., 1997; Shulman et al., 1997). Dimerization of the receptor molecules brings the intracellular parts close to each other, thereby allowing autophosphorylation in trans between the two receptors. The autophosphorylation occurs on specific tyrosine residues and has two important consequences: phosphorylation of a conserved tyrosine residue located in the activation loop of the kinase domain leads to an increase of the kinase activity of the receptor and phosphorylation of several tyrosine residues outside the kinase domain produces docking sites for signaling molecules with SH2 domains (reviewed in Heldin et al., 1998).
B. Signaling via SH2 Domain Proteins SH2 domains contain about 100 amino acid residues folded in such a way that they recognize phosphorylated tyrosine residues in specific environments
Involvement of PDGF in Disease
7
(Pawson and Scott, 1997). A large number of SH2 domain-containing signaling molecules have been shown to bind to autophosphorylated ␣ and/or  receptors (reviewed in Heldin et al., 1998). Some of these molecules are themselves enzymes, e.g., phosphatidylinositol-3⬘-kinase (PI-3-kinase) and phospholipase C-␥ (PLC-␥), which both have the membrane phospholipid phosphatidyl-inositol-4,5-bisphosphate (PtdIns-4,5-P2) as substrate, the Src family of tyrosine kinases, the tyrosine phosphatase SHP-2, and the GTPaseactivating protein (GAP) for Ras. Other SH2 domains molecules, including Grb2, Grb7, Crk, Nck, and Shc, lack enzymatic activity and serve as adaptors linking the receptors with downstream effector molecules. Also, Stat molecules bind to PDGF receptors; after phosphorylation and activation they are translocated to the nucleus where they act as transcription factors and regulate the activity of specific genes. In some cases, binding of SH2 domain proteins to the autophosphorylated receptors leads to their activation by phosphorylation on tyrosine residues [e.g., PLC-␥ (Wahl et al., 1990) and Src (Erpel and Courtneidge, 1995)]. In other cases, the binding causes a conformational change in the molecule, which increases an intrinsic enzymatic activity [e.g., PI3-kinase (Backer et al., 1992; Panayotou et al., 1992) and SHP-2 (Pluskey et al., 1995)], whereas in still others, the signaling molecules may be constitutively active but their binding to the receptors brings them to the localization in the cell where they can interact with downstream effector molecules (e.g., the Grb2-Sos complex and RasGAP). Binding of each one of the SH2 domain-containing signaling molecules initiates a signal transduction pathway. This often involves activation of kinases. A systematic analysis of proteins after PDGF stimulation of cells revealed that over 100 changed their phosphorylation on serine/threonine or tyrosine residues (Soskic et al., 1999). However, the notion that intracellular signal transduction consists of a number of linear signaling pathways that mediate the different cellular effects of PDGF is an oversimplification. Rather, there is an extensive cross talk between different signaling pathways, creating an intracellular signaling network. Studies using microarrays to monitor mRNA expression profiles support this notion; rather small differences were observed when signaling via wild-type receptors were compared with signaling via tyrosine-mutated receptors (Fambrough et al., 1999). Irrespective of the extensive cross talk between signaling pathways, PI3kinase has been shown to be particularly important for cell motility and antiapoptotic responses. Thus, PI3-kinase, which produces PtdIns-3,4,5-P3, is essential for PDGF-induced actin reorganization and chemotaxis (Wennström et al., 1994a,b). Important downstream components that mediate these effects are members of the Rho family of small GTPases (Hawkins et al., 1995; Hooshmand-Rad et al., 1997). Interestingly, in addition to an early wave of PI3-kinase activity, important for morphological changes, PDGF also induces a second wave of PI3-kinase activity with a maximum after 4 –
8
Arne Östman and Carl-Henrik Heldin
6 hr which is important for the initiation of DNA synthesis (Jones et al., 1999). The antiapoptotic effect of PI3-kinase involves activation of the serine/threonine kinase Akt (Dudek et al., 1997; Kauffmann-Zeh et al., 1997) and NF-B (Romashkova and Makarov, 1999). PLC-␥, which cleaves PtdIns-4,5-P2 to diacylglycerol and Ins-1,4,5-P3, appears not to be essential for any of the PDGF responses. However, in cells deprived of other signals, PLC-␥ can mediate the stimulation of cell growth (Valius and Kazlauskas, 1993); upon overexpression, PLC-␥ makes cells more susceptible to migratory responses (Rönnstrand et al., 1999). It has been suggested that calcium mobilization downstream of PLC-␥ is required for the stimulation of sphingosine kinase by PDGF, which has been linked to growth stimulation in certain cell types (Olivera et al., 1999). Activation of Ras, which leads to activation of the MAP kinase cascade, is important for the mitogenic effect of PDGF. Ras is activated by the binding to the PDGF receptor, directly or indirectly, of the adaptor molecule Grb2 in complex with the nucleotide exchange molecule Sos1 (Bos, 1997). Sos1 converts Ras from its inactive GDP-bound form to the active GTP-bound form. Also the tyrosine kinase Src has been shown to be important for the mitogenic effect of PDGF (Twamley-Stein et al., 1993). In addition, Src may affect cytoskeletal organization and cell morphology via activation of another tyrosine kinase, Abl (Plattner et al., 1999).
C. Modulation of Signaling There are several examples of inhibitory signals induced at the PDGF receptor in parallel to the stimulatory signals and which modulate the effects (reviewed in Heldin, 1997). Thus, at the same time as the Grb2/Sos1 complex binds to the PDGF  receptor and activates Ras, another molecule, RasGAP, also binds to the receptor and counteracts Ras activation by converting active Ras-GTP to inactive Ras-GDP (Heidaran et al., 1993). Moreover, the tyrosine phosphatase SHP-2, through its ability to dephosphorylate the autophosphorylated receptor or its substrates, may also modulate signaling via PDGF receptors (Klinghoffer and Kazlauskas, 1995). Another example is a Src-like adaptor protein (Slap), which interacts with juxtamembrane autophosphorylation sites and inhibits PDGF signaling (Roche et al., 1998). One mechanism whereby the balance between stimulatory and inhibitory signals may be altered is through differential autophosphorylation of the receptor. One such example has been unraveled. The  receptor in a homodimeric complex is efficiently autophosphorylated on Tyr771, which binds RasGAP. In contrast, this tyrosine residue is not autophosphorylated when the  receptor forms a heterodimer with the ␣ receptor, which itself does not bind RasGAP (Ekman et al., 1999). Thus, PDGF AB, which preferentially
Involvement of PDGF in Disease
9
forms ␣ heterodimeric receptors, activates Ras more efficiently than PDGF BB, which forms homodimeric as well as heterodimeric receptor complexes. This may explain why PDGF AB gives a stronger mitogenic effect than PDGF BB on cells having both ␣ and  receptors. It is possible that signaling via PDGF receptors can be modulated by the selective dephosphorylation of specific autophosphorylation sites. Thus, the tyrosine phosphatase SHP-2 has been shown to selectively dephosphorylate Tyr771 in a process that is activated by binding of the cell to fibronectin (DeMali et al., 1999). Consistent with this finding, a SHP-2-dependent increased activation of MAP kinase has been observed (Zhao and Zhao, 1999), which may result from dephosphorylation of Tyr771 followed by a decreased binding of GAP and increased activation of Ras. Also the tyrosine phosphatase DEP-1 has been shown to selectively dephosphorylate certain autophosphorylated tyrosine residues in the PDGF  receptor (Kovalenko et al., 2000).
IV. IN VIVO FUNCTION OF PDGF PDGF has important roles in the regulation of cell growth, differentiation, and migration during the embryonal development, as well as during wound healing. PDGFs also have specialized functions in the vascular system as well as in the homeostasis of the connective tissue.
A. Embryonic Development Studies on the expression of PDGF and PDGF receptors by different cells during the development have revealed that PDGFs are often produced by certain epithelial cells and PDGF receptors by the adjacent mesenchymal cells, suggesting a paracrine mode of action (reviewed in Heldin and Westermark, 1999). Moreover, the expression patterns of the receptors suggest that PDGF have important roles in the development of connective tissue compartments in different organs. Interestingly, the different PDGF isoforms show different expression patterns. Also, PDGF A and C chains, which both bind to the ␣ receptor, are produced by completely different subsets of epithelial cells, e.g., in the embryonal kidney (Li et al., 2000). The notion that PDGFs are important for the development of connective tissue compartments is supported by experiments in which the genes for PDGF A or B chains, or receptors, were knocked out in the mouse. Targeting of the B chain or the  receptor led to severe effects on kidney development with a total absence of mesenchymal cells, leading to a poor filtration in the glomeruli (Levéen et al., 1994; Soriano, 1994). Also, blood vessels
10
Arne Östman and Carl-Henrik Heldin
were affected with a dilated aorta and characteristic bleeding at about the time of birth, which led to the death of the animals at that time. This is likely to be due to a deficiency of newly formed blood vessels to attract pericytes (Lindahl et al., 1997a) and in the development of the vascular smooth muscle cell layer (Hellström et al., 1999). In order to circumvent the embryonic lethality of PDGF -receptor-deficient animals, a chimeric analysis was undertaken, which revealed that, during the development, the  receptor is important for all muscle lineages, but not for fibroblast and endothelial lineages (Crosby et al., 1998). However, during wound healing, expression of  receptors on fibroblasts and endothelial cells is essential for efficient connective tissue repair (Crosby et al., 1999). PDGF A-chain knockout mice showed defects in the development of the alveoli of the lungs, giving an emphysema-like phenotype, which led to death of the mice at about 3 weeks of age (Boström et al., 1996). The defect is due to defect spreading of alveolar smooth muscle cell progenitors, whereby the alveolar walls do not develop (Lindahl et al., 1997b). PDGF A also stimulates the proliferation of different types of dermal mesenchymal cells and is, together with sonic hedgehog, involved in the development of hair follicles (Karlsson et al., 1999). Knockout of the ␣ receptor gave a more severe phenotype compared to the A chain knockout, which is expected, as this receptor binds PDGF A and B chains, as well as C chains. The phenotype includes cranial malformations and a deficiency of myotome formation (Soriano, 1997). The ␣ receptor is affected in the spontaneous Patch mouse mutant, which has a phenotype similar to the ␣ receptor knockout mouse, but in addition has a coat color defect that possibly is due to perturbed expression of the neighboring stem cell receptor gene (Stephenson et al., 1991). There is also expression of PDGF receptors on cells of nonmesenchymal origin, e.g., in the central nervous system, indicating that PDGF has functional importance, not only for connective tissue cells. The PDGF ␣ receptor is expressed in the neuronal tube at embryonal day (ED)9 in the mouse and occurs in the brain, brain stem, and spinal cord on E13.5 (Orr-Urtreger et al., 1992; Schatteman et al., 1992). At later stages, after E16, the ␣ receptor is expressed by oligodendroglial–astroglial precursor cells (O-2A cells) (Pringle et al., 1992), and PDGF has been shown to have an important role in the growth and differentiation of this cell type (Fruttiger et al., 1999). In culture, O-2A cells undergo premature differentiation in the absence of growth factors; PDGF, in combination with basic fibroblast growth factor, completely blocks differentiation of O-2A cells and causes functional immortalization of the cells (Wolswijk and Noble, 1992). Through its effect on oligodendrocyte development, PDGF has an important role in the myelination of cells (Butt et al., 1997; Fruttiger et al., 1999; Redwine and Armstrong, 1998). Thus, transplantation of PDGF-producing
Involvement of PDGF in Disease
11
cells was found to lead to an expansion of the oligodendrocyte compartment (Barres et al., 1992), and PDGF was shown to reduce chemically induced rat oligodendrocyte death and enhance myelination in vitro (Fressinaud et al., 1996). Also the myelinating cells in the periferal nervous system, Schwann cells, respond to PDGF through their expression of  receptors (Davis and Stroobant, 1990; Eccleston et al., 1990). These observations suggest an important therapeutic possibility for PDGF, i.e., to induce remyelination. PDGF receptors are also expressed on certain neurons (Oumesmar et al., 1997; Smits et al., 1991), and PDGF has been shown to have neuroprotective and neurotrophic effects on cultured rat dopaminergic neurons (Othberg et al., 1995; Pietz et al., 1996). Consistent with a role in neuroprotection and regeneration, PDGF and PDGF receptors were shown to be upregulated in infarcted human brain tissue and in facial nuclei of the rat after axotomi (Hermanson et al., 1995). Moreover, PDGF and PDGF receptor expression is increased after ischemic stroke (Krupinski et al., 1997), and administration of PDGF BB was found to protect the rat brain after experimental focal ischemia (Sakata et al., 1998).
B. Wound Healing In the adult, PDGF has been shown to stimulate wound healing. PDGF does not appear to alter the normal sequence of repair, but increases its rate. Local application of PDGF leads to an increased formation of granulation tissue (Grotendorst et al., 1985; Sprugel et al., 1987) and faster wound healing in rat skin (Pierce et al., 1988). PDGF also stimulates wound healing in other animal models, e.g., excisional wounds in rabbit ear (Mustoe et al., 1991) and burn injuries in pigs (Danilenko et al., 1995). In addition to local application of PDGF, beneficial effects on wound healing have also been observed after particle-mediated delivery of PDGF cDNAs (Eming et al., 1999) or after adenovirus-mediated overexpression of PDGF (Liechty et al., 1999) in the wounded area. PDGF was shown to stimulate wound healing in patients (Robson et al., 1992), and topical application of recombinant PDGF BB (becaplermin) has been subject to clinical trials and shown to have beneficial effects on the healing of different types of wounds (reviewed by LeGrand, 1998). The healing of soft tissues involves several steps, including reepitelialization, angiogenesis, and extracellular matrix deposition. PDGF acts on several cell types involved in the healing process. It stimulates mitogenicity and chemotaxis of fibroblasts and smooth muscle cells, and chemotaxis of neutrophils and macrophages. PDGF also stimulates the production of various matrix molecules, including fibronectin (Blatti et al., 1988), collagen (Canalis, 1981), proteoglycans (Schönherr et al., 1991), and hyaluronic acid
12
Arne Östman and Carl-Henrik Heldin
(Heldin et al., 1989). In addition, PDGF may indirectly promote wound healing, e.g., by stimulating macrophages to release other growth factors and cytokines that affect the healing process. PDGF may also have a role at later stages of wound healing. It stimulates contraction of collagen gels in vitro (Clark et al., 1989; Gullberg et al., 1990), suggesting that it may affect wound contraction in vivo. Moreover, PDGF stimulates the production and secretion of collagenase by fibroblasts (Bauer et al., 1985), suggesting a role in the remodeling phase of wound healing.
C. Vascular System PDGF  receptors are expressed by capillary endothelial cells, and PDGF has been shown to have an angiogenic effect (Battegay et al., 1994; Edelberg et al., 1998; Nicosia et al., 1994; Risau et al., 1992; Sato et al., 1993). The effect is, however, weaker than that of bona fide angiogenic factors of the VEGF or FGF families. PDGF is not likely to be important for the initial formation of blood vessels, vasculogenesis, as no apparent vascular abnormality was observed in PDGF or PDGF receptor knockout mice. However, as mentioned earlier, PDGF may have a significant role at later stages in the formation of blood vessels, through its ability to recruit pericytes and stimulate the development of vascular smooth muscle cells, which have important functions in reinforcing the structural integrity of the vessels (Hellström et al., 1999; Lindahl et al., 1997a). PDGF may also have a role in the regulation of the tonus of blood vessels. PDGF BB has been shown to stimulate endothelial cells to release NO and thereby relax rat aorta (Cunningham et al., 1992) and to lower the blood pressure through increased vascular compliance. However, PDGF has also been reported to induce the constriction of different types of blood vessels (Berk et al., 1986; Sachinidis et al., 1990). Another potentially important function of PDGF in the vascular system is to exert a feedback control on platelet aggregation. Human platelets, which are a rich source of PDGF, have PDGF ␣ receptors (Vassbotn et al., 1994a). After thrombin-induced platelet aggregation, PDGF and other constituents of the ␣-granulae are released. PDGF then binds to ␣ receptors on the platelets, thereby inhibiting platelet aggregation through an autocrine feedback control function (Bryckaert et al., 1989; Vassbotn et al., 1994a).
D. Tissue Homeostasis In tissues, macromolecules are exchanged between the vessels and the extracellular compartment. The exchange is regulated by the interstitial fluid
Involvement of PDGF in Disease
13
pressure, which normally is slightly negative. PDGF has been shown to have an important role in the control of the interstitial fluid pressure, probably through its ability to stimulate interactions between connective tissue cells and extracellular matrix molecules (Rodt et al., 1996). The PI3-kinase pathway is important for this effect, as mice with the PDGF  receptor replaced with a  receptor mutant lacking the two tyrosine residues involved in PI3-kinase activation were unable to control the interstitial fluid pressure (Heuchel et al., 1999).
V. PDGF IN DISEASE Whereas PDGF has important roles during embryonal development and wound healing, as described earlier, overactivity of PDGF has been implicated in the pathogenesis of a number of serious diseases, including cancer, as well as other disorders characterized by excessive cell growth, such as atherosclerosis and various fibrotic conditions.
A. Cancer 1. AUTOCRINE PDGF STIMULATION IN TUMORS Because glial cells, fibroblasts, and smooth muscle cells are normal target cells of PDGF, tumors from these cell types have been analyzed for autocrine PDGF stimulation. In glioblastomas, a large fraction of analyzed tumors demonstrated coexpression of PDGF ␣ receptor and PDGF A or B chains (Fleming et al., 1992; Guha et al., 1995; Hermanson et al., 1992). The notion that PDGF autocrine loops play a causative role in the development of glioblastomas is further supported by the observations that intracranial injections with SSV, carrying a viral form of the PDGF B chain, into marmosets, or a recombinant PDGF B-chain encoding retrovirus into mice, cause glioblastoma (Deinhardt, 1980; Uhrbom et al., 1998). Soft tissue sarcomas have also been suggested to contain PDGF autocrine loops (Smits et al., 1992; Wang et al., 1994). Coexpression of ligand and receptor was observed in clinical samples of fibroblast-derived tumors such as dermatofibroma and malignant fibrous histiocytoma. The fibrosarcomainducing potential of PDGF autocrine loops has also been demonstrated through tumor development on infections with PDGF B chain encoding viruses (Deinhardt, 1980; Pech et al., 1989). Dermatofibrosarcoma protuberans (DFSP) and the juvenile form giant cell fibroblastoma are skin tumors of intermediate malignancy. In most, if not all, of these tumors, a transloca-
14
Arne Östman and Carl-Henrik Heldin
tion that fuses the collagen 1A1 gene to the PDGF B chain gene occurs (O’Brien et al., 1998; Simon et al., 1997). Transfection of collagen 1A1/ PDGF B fusion genes into NIH/3T3 cells has confirmed their transforming potential (Greco et al., 1998; Shimizu et al., 1999). Biochemical studies have also demonstrated that fusion proteins are processed to mature PDGF BB (Shimizu et al., 1999). Taken together, these observations suggest that autocrine PDGF stimulation is important in the development of DFSP. Coexpression of PDGF and PDGF receptors, consistent with autocrine growth stimulation, has also been observed in various other types of human tumors by immunohistochemical staining and by in situ analyses of mRNA expression. Examples include meningiomas (Black et al., 1994; FigarellaBranger et al., 1994; Todo et al., 1996) ependymomas (Black et al., 1996), pituitary adenomas (Leon et al., 1994), mesotheliomas (Langerak et al., 1996), melanomas (Barnhill et al., 1996), choriocarcinomas (Holmgren et al., 1993), ovarian cancer (Henriksen et al., 1993), neuroendocrine tumors (Chaudhry et al., 1992), prostatic cancer (Fudge et al., 1996), pancreatic cancer (Ebert et al., 1995), gastric cancer (Chung and Antoniades, 1992), and lung cancer (Antoniades et al., 1992). Except for the gene translocation in DFSP, the mechanisms behind dysregulated PDGF expressions are not known. More recently, PDGF  receptor antibodies specifically recognizing the autophosphorylated receptor were used to demonstrate activated PDGF  receptors in human meningioma (Shamah et al., 1997). The ligand:receptor interaction in cells with autocrine PDGF BB stimulation has been analyzed extensively. It has been established that PDGF binds to its receptor already in the endoplasmatic reticulum (Fleming et al., 1989; Keating and Williams, 1988); however, for an efficient mitogenic signal to appear, the ligand:receptor complex needs to be translocated to the plasma membrane, possibly because important downstream signaling components are located there (Fleming et al., 1989; Hannink and Donoghue, 1988; Valgeirsdóttir et al., 1995).
2. LIGAND-INDEPENDENT ACTIVATION OF PDGF RECEPTORS IN TUMORS Whereas the mechanism for dysregulated expression of PDGF receptors in tumors in most cases is unknown, in some cases, overexpression of the PDGF ␣ receptor in glioblastoma is associated with amplification of the PDGF ␣ receptor gene (Fleming et al., 1992; Hermanson et al., 1996). Amplification occurred in a subset of tumors also characterized by loss of heterozygosity on chromosome 17p (Hermanson et al., 1996). Chronic myelomonocytic leukemia (CMML) is a rare disease associated with the activation of PDGF  receptors through a translocation that gives rise to a ligand-independent constitutively active form of the PDGF  recep-
Involvement of PDGF in Disease
15
tor (Carroll et al., 1996; Golub et al., 1994; Jousset et al., 1997). In CMML, the PDGF receptor is activated by dimerization mediated by the fusion partner, the Ets-like transcription factor TEL (Carroll et al., 1996; Jousset et al., 1997; Sjöblom et al., 1999). The disease-causing potential of the TEL/PDGF  receptor fusion gene has been demonstrated in two transgenic mouse models using immunoglobulin and CD11A promotors (Ritchie et al., 1999; Thomasson et al., 1999). The transforming potential of the PDGF receptor pathway has also been highlighted by studies of the E5 oncoprotein of bovine papilloma virus type 1, which acts by activation of the PDGF  receptor (reviewed in DiMaio et al., 1998). The mechanism involve E5-mediated oligomerization of the PDGF  receptor, whereby the receptor is also activated in the absence of ligand.
3. PARACRINE PDGF EFFECTS ON TUMOR STROMA, TUMOR ANGIOGENESIS, AND METASTASIS In a solid tumor, cells of the stromal, vessel, and tumor compartments interact in an interdependent way, which is crucial for the development and progression of tumors, as well as for tumor angiogenesis. One demonstration of the importance of the stromal compartment was the identification of stromal fibroblasts as the major source of VEGF in mammary tumors developing in transgenic mice expressing the polyoma middle T antigen under the control of the MMTV promotor (Fukumura et al., 1998). The potential of paracrine PDGF stimulation of stromal fibroblasts in tumor growth has been demonstrated by the forced overexpression of the PDGF B chain in two cell types lacking PDGF receptor expression, WM9 melanoma cells (Forsberg et al., 1993), and HaCaT keratinocytes (Skobe and Fusenig, 1998). PDGF-expressing WM9 cells formed tumors that grew more rapidly, had less necrosis, and had more well-vascularized connective tissue septa as compared to parental cells. In the case of HaCaT cells, PDGF B expression led to conversion of cells that formed benign tumors in mice through mechanisms proposed to involve both direct effects on stroma formation and angiogenesis and indirect effects on the keratinocytes mediated by activated stromal cells. Many common solid tumors, including colorectal adenocarcinoma, lung carcinomas, and breast carcinomas, display PDGF producing tumor cells and PDGF  receptor expressing stromal fibroblasts (Bhardwaj et al., 1996; Kawai et al., 1997; Lindmark et al., 1993; Sundberg et al., 1997; Vignaud et al., 1994). In addition to mediating growth promoting effects on tumor stroma, PDGF receptors expressed on stromal fibroblasts and pericytes may also be involved in the regulation of tumor interstitial fluid pressure and transcapillary transport (Pietras et al., 2000).
16
Arne Östman and Carl-Henrik Heldin
Antiangiogenic therapy has appeared as an attractive novel way of interfering with tumor growth (reviewed by Ferrara and Alitalo, 1999). Numerous studies have demonstrated striking effects in animal models of tumor growth by targeting angiogenic growth factors such as VEGF, FGF, and angiopoietin-1 (Ferrara and Alitalo, 1999). Angiogenic activity of PDGF BB has been demonstrated in rings of rat aorta, in the chick chorioallantoic membrane assay, and in cocultures of microvascular fragments and myofibroblasts (Battegay et al., 1994; Nicosia et al., 1994; Risau et al., 1992; Sato et al., 1993). Furthermore, PDGF BB might be of particular importance for pericyte recruitment, required for structural and functional integrity of capillaries, as determined by the phenotype of PDGF B chain knockout mice (Crosby et al., 1998; Lindahl et al., 1997a). PDGF  receptor expression is upregulated in endothelial cells in glioblastomas (Hermanson et al., 1988; Plate et al., 1992), and high expression has also been demonstrated in pericytes of the microvasculature of colon cancers (Sundberg et al., 1993). PDGF receptor signaling might thus contribute by various mechanisms to tumor angiogenesis, i.e., indirectly through action on stromal cells responsible for the production of VEGF or by direct action on pericytes or endothelial cells. Matrix metalloproteinases are extracellular matrix degrading enzymes contributing to the metastatic process. PDGFs induce the production of MMP-1 and -2 in cultured fibroblasts and embryonic bronchial arch explants (Alvares et al., 1995; Robbins et al., 1999). Induction of MMP-9 by PDGF BB has been demonstrated in vascular smooth muscle cells (Fabunmi et al., 1996). Furthermore, a critical role for PDGF ␣ receptor signaling in the physiological control of MMP-2 production is indicated by the reduced MMP-2 expression in the bronchial arch and heart tissue of mice homozygous for the Patch mutation, which inactivates the PDGF ␣ receptor (Robbins et al., 1999). It can thus be hypothesized that PDGF signaling contributes to metastasis and invasion by MMP induction. Experimental support for a prometastatic function of PDGF ␣ receptor signaling was provided with the observation that overexpression of the full-length PDGF ␣ receptor in the 3LL clone of Lewis lung carcinoma cells promotes lung metastasis (Fitzer-Attas et al., 1997). A positive correlation between PDGF A chain expression and lymph node metastasis was also noted when 32 primary invasive breast tumors were examined (Anan et al., 1996). The availability of specific PDGF antagonists (see later) will allow further studies on the role of PDGF stimulation in invasion and metastasis.
B. Atherosclerosis Atherosclerosis, as well as premature vessel obstruction following percutaneous transluminal angioplasty, bypass grafting, or transplantations, is as-
Involvement of PDGF in Disease
17
sociated with smooth muscle cell proliferation and migration and subsequent matrix deposition. The potency of PDGF as a smooth muscle cell mitogen and chemotactic agent has prompted studies exploring the possibility that PDGF receptor signaling contributes to these pathological processes. Immunohistochemical analysis of human atherosclerotic lesions has demonstrated a disease-associated upregulation of PDGF AB and BB production, as well as PDGF  receptor expression, compatible with a causative role for PDGF in the development of atherosclerosis (Ross et al., 1990; Rubin et al., 1988). The  receptor appears to be more important than the ␣ receptor in mediating the atherosclerotic reaction (Giese et al., 1999). A role of PDGF receptor signaling in the more acute process of neointima formation following percutaneous transluminal coronary angioplasty is suggested by immunohistochemical and in situ mRNA expression studies of human coronary arteries (Tanizawa et al., 1996; Ueda et al., 1996). Increased PDGF  receptor expression was observed in smooth muscle cells in areas undergoing repair; in these areas, PDGF AB/BB production was found in macrophages, spindle cells, endothelial cells, and smooth muscle cells. Increased expression of PDGF ligands and receptors has also been demonstrated in a number of experimental injury models of restenosis, as well as in the neointima forming in polytetrafluoroethylene vascular grafts implanted in baboons (Golden, 1991; Kanzaki et al., 1994; Kraiss et al., 1993; Majesky et al., 1990; Uchida et al., 1996). Concerning transplantation-induced vasculopathies, no report yet exists on the situation in human transplanted tissues. However, the neointima of rat aortic and cardiac allografts has been analyzed, and the pattern of PDGF and PDGF receptor expression suggests an involvement of PDGF-induced smooth muscle cell migration and proliferation in this type of neointima formation (Akyürek et al., 1996; Lemström and Koskinen, 1997). The mechanism underlying the induction of PDGF ligand and receptor expression in atherosclerotic conditions remains incompletely understood. Rheological factors, such as flow rate and shear stress, might contribute to increased PDGF expression. In rabbit and baboon models, where shear stress was manipulated experimentally, a reduction in shear stress was associated with increased PDGF ligand production by endothelial cells and concomitant increased receptor expression in smooth muscle cells (Kraiss et al., 1996; Mondy et al., 1997). The possibility that PDGF stimulation plays a causative role in the formation of neointima has been analyzed by studying the effects of infusion of PDGF BB in the rat carotid injury model of restenosis and of liposomemediated transfer of the PDGF B chain gene into porcine arteries. In the rat model, a large increase in intimal thickening was observed, despite only modest effects on smooth muscle cell proliferation, suggesting predominantly promigratory effects of PDGF BB (Jawien et al., 1992). Intimal thickening
18
Arne Östman and Carl-Henrik Heldin
was also observed in the porcine model after PDGF B chain gene transfer, and further analysis of lesions indicated stimulatory effects of PDGF BB on smooth muscle cell proliferation and migration, as well as extracellular matrix deposition (Nabel et al., 1993; Pompili et al., 1995).
C. Lung Fibrosis Lung fibrosis is associated with fibroblast proliferation and accumulation of extracellular matrix, processes known to be stimulated by PDGF. A role for PDGF in various forms of lung fibrosis is suggested by observations of PDGF overexpression in patients affected by these diseases, as well as by various lung fibrosis model studies where PDGF induction has been demonstrated and where, more recently, effects of PDGF antagonists have been observed. Studies on patient samples have shown that increased PDGF B chain production by invading macrophages, as well as by epithelial cells, occurs in association with idiopathic pulmonary fibrosis and bronchiolitis obliteransorganizing pneumonia as determined by in situ and immunohistochemical analyses (Antoniades et al., 1990; Aubert et al., 1997; Vignaud et al., 1991). Analysis of lavage fluids has also demonstrated increased PDGF levels in lavage fluid from patients with acute diffuse lung injury (Snyder et al., 1991), obliterative bronchiolitis after lung transplantation (Hertz et al., 1992), Hermansky–Pudlak syndrome (Harmon et al., 1994), histiocytosis X (Uebelhoer et al., 1995), and coal workers pneumoconiosis (Vanhee et al., 1994). Increased production of PDGF in animal models has also been shown after the induction of lung fibrosis by hyperoxia (Powell et al., 1992), bleomycin instillation (Walsh et al., 1993), or chrysotile asbestos (Liu et al., 1997). Transgenic mice, expressing the B chain of PDGF in the lung under the control of the lung surfactant protein promoter, showed abnormalities in the developing and adult lung, involving both emphysema and fibrotic lung disease (Hoyle et al., 1999). Conversely, decreased PDGF expression is associated with the reduced fibrosis that occurs after pirfenidone treatment in the bleomycin hamster model of lung fibrosis (Gurujeyalakshmi et al., 1999). Furthermore, direct evidence for the fibrotic potential of PDGF in the lung was obtained with the demonstration of pulmonary cell proliferation and collagen deposition after the intratracheal injection of PDGF-BB (Yi et al., 1996).
D. Glomerulonephritis Evidence indicates that PDGF stimulation has a large impact on the pathogenesis of renal disease. In 1989, PDGF receptor upregulation was demon-
Involvement of PDGF in Disease
19
strated in kidney specimens from rejected kidney transplants and in cases of glomerulonephritis (Fellström et al., 1989). Subsequent studies have compared PDGF receptor expression in human samples of proliferative and nonproliferative glomerulonephritis and observed increased receptor expression in proliferative forms (Gesualdo et al., 1994). Analysis of patient biopsies has also revealed increased PDGF expression in cases of IgA glomerulonephritis (Niemir et al., 1995) and renal vascular rejection (Alpers et al., 1996). Increased PDGF A chain production is associated with congenital multicystic renal dysplasia (Liapis et al., 1997). In agreement with these findings, upregulation of PDGF ligand and receptors was observed in rat and mouse models of proliferative glomerulonephritis (Gesualdo et al., 1991; Iida et al., 1991; Yoshimura et al., 1991). The approach of forced overexpression of PDGF or infusion of recombinant PDGF has also been used to evaluate the role of PDGF in kidney fibrosis (Floege et al., 1993; Isaka et al., 1993; Tang et al., 1996). When the effects of PDGF B chain and TGF- gene transfer were compared, it was noted that both genes induced glomerulosclerosis; however, TGF- stimulated predominantly extracellular matrix accumulation, whereas the PDGF B chain induced a proliferative response (Isaka et al., 1993). Both glomerular cell proliferation and tubulointerstitial hyperplasia have been observed after PDGF BB infusion (Floege et al., 1993; Tang et al., 1996).
VI. PDGF AND PDGF RECEPTORS AS DRUG TARGETS Considering the likely involvement of PDGF overactivity in several serious disorders, clinically useful PDGF antagonists are highly warranted. Various types of PDGF antagonists have been developed and have beneficial effects in various animal models; their potential clinical utility is currently evaluated in patients.
A. PDGF Antagonists Antagonists targeting each of the various steps in ligand-induced PDGF receptor activation, i.e., ligand binding, receptor dimerization, and subsequent activation of the receptor kinase, have been developed (Fig. 2). There are advantages and disadvantages for each of these approaches. In general, tyrosine kinase receptors display much larger diversity in their extracellular domains than in their kinase domains, thus suggesting that antagonists specific for the PDGF receptors would be easier to obtain by targeting ligand:receptor and receptor:receptor interactions than by targeting the kinase domain. Another general advantage with compounds acting extracellularly is that
20
Arne Östman and Carl-Henrik Heldin
Fig. 2 Mechanism of PDGF receptor activation and schematic illustration of different possible levels of action of PDGF antagonists. Thus, antagonists may suppress the expression of PDGF or PDGF receptors, bind to PDGF or PDGF receptors in such a way that ligand:receptor interaction is prevented, bind to the epitope in the receptor involved in receptor:receptor interactions and thereby prevent receptor dimerization, or may inactivate the kinase.
they are less likely to be sensitive to the multiple drug resistance phenotype, which involves cellular excretion of compounds and is commonly observed in solid tumors. A principal disadvantage with ligand:receptor and receptor:receptor interactions as drug targets is that they often involve interactions between large, flat surfaces of proteins and are thus inherently more difficult to block with low molecular weight compounds than the kinase domain where the ATP-binding pocket provides a good target for small molecules. Furthermore, interactions between PDGF and its receptors during autocrine stimulation occur in the secretory pathway, suggesting that PDGF autocrine stimulation is less sensitive to extracellularly acting agents compared to situations where PDGF receptor stimulation occurs through paracrine signaling. In addition, antagonists acting through various genetic approaches, including dominant-negative forms of ligand or receptor, as well as antisense-
Involvement of PDGF in Disease
21
mediated suppression of ligand or receptor expression, have been successfully used to block PDGF signaling (Fig. 2).
1. ANTAGONISTS INTERFERING WITH LIGAND:RECEPTOR INTERACTIONS Neutralizing polyclonal and monoclonal antibodies with various specificities against the PDGF isoforms have been raised in rabbits, goats, sheep, and mice (Ferns et al., 1991; Rutherford et al., 1997b; Thyberg et al., 1990; Vassbotn et al., 1990). Neutralizing mouse monoclonal antibodies specific for the PDGF ␣ or  receptor have also been generated (Koyama et al., 1994, 1996, 1998; LaRochelle et al., 1993; Lokker et al., 1997; Ramakrishnan et al., 1993; Tiesman and Hart, 1993). Therapeutic effects of antibodies against ligand or receptor have been obtained in animal models of restenosis and glomerulonephritis (Ferns et al., 1991; Giese et al., 1999; Hart et al., 1999; Johnson et al., 1992; Rutherford et al., 1997b). SELEX aptamers are inhibitory molecules that have been raised against a number of protein targets, including various growth factors (Floege et al., 1999a). Their mechanism of action is similar to ligand-neutralizing antibodies in that aptamers also bind to the target growth factor and interfere with receptor binding. Three DNA aptamers against PDGF AB and BB, between 37 and 45 nucleotides in length, were isolated after a screen of an oligonucleotide library (Green et al., 1996). All three aptamers neutralized PDGF AB- and BB-induced DNA replication with IC50 values of 1–10 nM. Photo-cross-linking of one of the aptamers, 20t, demonstrated interaction between the aptamer and the loop III region of the PDGF B chain, implicated in receptor binding. More recently, a PEG-conjugated and chemically modified form of the PDGF targeting aptamer 36t has been used successfully to block glomerulonephritis (Floege et al., 1996b) and arterial restenosis (Leppänen et al., 2000a) in rat models of these diseases. A third type of antagonist targeting ligand:receptor interactions are soluble PDGF receptors (Duan et al., 1991; Miyazawa et al., 1998; Rooney et al., 1994). Such molecules have been shown to block PDGF with IC50 values of 10–100 nM in tissue culture experiments. Furthermore, Ig or GST fusion variants of these proteins have been made (Heidaran et al., 1995; Leppänen et al., 2000b); it appears that the ligand-independent dimerization provided by the Fc and GST domains, respectively, yields proteins with significantly improved IC50 values. Linear or cyclic peptides containing sequences from loop 1 and loop 3 of PDGF B chain have also been shown to antagonize PDGF, albeit at high concentrations (Brennand et al., 1997b; Engström et al., 1992). The evaluation of these peptide antagonists is complicated by the fact that they also affect cell viability; whereas linear peptides showed unspecific cytotoxicity, the
22
Arne Östman and Carl-Henrik Heldin
cyclic peptide was claimed to induce apoptosis (Brennand et al., 1997a,b; Engström et al., 1992). As revealed by the determination of the three-dimensional structures of several ligand:receptor complexes, interactions between growth factors and their cognate receptors, like most other protein:protein interactions, involve protein contacts distributed over rather large surface areas (Starovasnik et al., 1997). This has raised general doubts about the possibility to generate low molecular weight PDGF antagonists targeting ligand:receptor interactions. However, in a report from 1994, 2-bromomethyl-5-chlorobenzene sulfonylphtalimide was shown to block receptor binding of PDGF (Mullins et al., 1994). The compound also showed in vivo effects in a rat model of restenosis after oral administration.
2. ANTAGONISTS INTERFERING WITH RECEPTOR DIMERIZATION As illustrated in Fig. 2, the signaling PDGF:receptor complex is stabilized not only by ligand:receptor interactions, but also by receptor:receptor interactions (Omura et al., 1997). Based on biochemical evidence, similar interactions occur between other tyrosine kinase receptors, such as SCF and VEGF receptors and members of the Eph family, and their ligands (Barleon et al., 1997; Blechman et al., 1995; Lackmann et al., 1998). Furthermore, structural evidence for this type of interaction has been provided in the case of FGF receptor-1 and the growth hormone receptor (De Vos et al., 1992; Plotnikov et al., 1999). The possibility of blocking PDGF signaling by targeting receptor:receptor interactions has been demonstrated through the use of Ig-like domain 4 monoclonal antibodies and soluble Ig-like domain 4 (Lokker et al., 1997; Omura et al., 1997; Shulman et al., 1997). The antibodies blocked PDGF-induced DNA replication at a concentration as low as 1 nM. The soluble Ig-like domain 4 blocked PDGF-induced receptor tyrosine phosphorylation when used at micromolar concentrations. Although none of these antagonists have yet been used in vivo, they provide evidence that epitopes mediating receptor: receptor interactions are candidate targets for future PDGF antagonists.
3. ANTAGONISTS BLOCKING PDGF RECEPTOR KINASE Low molecular weight tyrosine kinase inhibitors constitute a novel class of drugs with large potential (reviewed in Druker and Lydon, 2000; Klohs et al., 1997; Levitzki and Gazit, 1995). It was originally considered that selectivity would be difficult to obtain as most, if not all, of these compounds act by competing with ATP binding to the relatively well-conserved ATP-
Involvement of PDGF in Disease
23
binding cleft of tyrosine kinases. Advances have, however, supported the notion that selective compounds indeed can be generated. Cocrystallization of tyrosine kinase inhibitors with their tyrosine kinase targets has demonstrated that these compounds will form contacts with up to 18 amino acids distributed over the active site of the tyrosine kinase domain, thus allowing for high specificity (Mohammadi et al., 1998). Since 1995, a number of selective PDGF receptor kinase inhibitors have been characterized, and six compounds—CGP53716 (Buchdunger et al., 1995), STI-571 (Buchdunger et al., 1996) Ki6896 (Yagi et al., 1998), RPR101511A (Bilder et al., 1999), AG1296 (Kovalenko et al., 1994), and SU101 (Shawver et al., 1997)—have demonstrated in vivo efficacy in various animal disease models. For all these six drugs, the characterization of target selectivity remains incomplete. It is, however, clear that none of these compounds distinguishes between PDGF ␣ and  receptor kinases. The PDGF receptor kinase inhibitor STI-571 illustrates the somewhat unpredictable cross-reactivity of these types of antagonists; this compound, which is active against the PDGF receptor at concentrations more than 100-fold lower than those required to block the tyrosine kinase activity of the receptors for EGF, insulin, or IGF-1, inhibits the structurally less related cytoplasmic tyrosine kinase c-Abl with similar potency as the PDGF receptor kinase (Buchdunger et al., 1996; Druker and Lydon, 2000).
4. GENETIC APPROACHES THAT INTERFERE WITH PDGF RECEPTOR SIGNALING The fact that both the PDGF ligand and the active signaling receptor occur as dimers has allowed the development of dominant-negative forms of PDGF and PDGF receptor that, after different methods of gene transfer, have been used to block PDGF signaling. Dominant-negative forms of PDGF include variants that do not undergo processing (Mercola et al., 1990) or that are altered in the receptor-binding site (Vassbotn et al., 1993), as well as forms that promote the formation of unstable PDGF dimers that are rapidly degraded (Mercola et al., 1990). In each case, inactive heterodimers between wild-type and mutated PDGF are formed. In the case of PDGF receptors, a variant with a truncated intracellular domain has been used and shown to have a dominant-negative effect (Ueno et al., 1991). Another genetic approach involves the adenoviral-mediated transfer of a gene encoding the PDGF  receptor extracellular domain with subsequent PDGF antagonistic effects in a rat model of restenosis (Deguchi et al., 1999). In a similar model of restenosis, therapeutic effects were also obtained after local treatment with antisense oligonucleotides targeting PDGF  receptor expression (Sirois et al., 1997).
24
Arne Östman and Carl-Henrik Heldin
B. PDGF Antagonists in Treatment of Cancer The availability of PDGF antagonists has allowed initial investigations of the effects of inhibition of PDGF signaling in various tumor cell lines. The small organic molecule leflunomide (SU101), which acts as a PDGF receptor kinase inhibitor, was shown to inhibit the in vivo growth of a panel of glioma, ovarian, and prostate cancer cell lines that express PDGF receptors; however, the growth of other cell lines without PDGF receptor expression was not affected (Shawver et al., 1997). Also, low passage cultures of tumor cells derived from glioblastomas developing after an intracranial injection of PDGF B chain encoding retroviruses showed a reduced growth rate in vitro when cultured in the presence of PDGF receptor kinase inhibitors (Uhrbom et al., 1999). Reduction in the growth rate of glioma cells has also been demonstrated after treatment with dominant-negative forms of PDGF and PDGF receptors (Kaetzel et al., 1998; Shamah et al., 1993; Strawn et al., 1994; Vassbotn et al., 1994b). The notion that DFSP tumors might be treatable with PDGF antagonists is supported by the observation that the transformed phenotype of collagen 1A1/PDGF B fusion gene expressing cells can be reverted by the use of selective PDGF receptor kinase inhibitors (Shimizu et al., 1999). Interestingly, primary cultures of cells derived from DFSP tumors show sensitivity to PDGF receptor kinase inhibitors when grown in vitro or as subcutaneous tumors in nude mice (Shimizu et al., unpublished observations). Furthermore, a dependency of PDGF  receptor signaling in CMML is indicated by the therapeutic effects of PDGF receptor kinase inhibitors in mice transplanted with clonal tumor cells derived from Ig-TEL/PDGF  receptor transgenic mice (Thomasson et al., 1999). It is well documented that most solid tumors display an increased interstitial fluid pressure (Jain, 1987), and it has been suggested that pharmacological reduction of the interstitial fluid pressure might be a way to increase drug uptake in tumors and thereby obtain better therapeutic effects (Jain, 1998). A role of PDGF receptor signaling in regulation of the interstitial fluid pressure of tumors was provided by the observation that 4-day systemic treatment with the selective PDGF receptor kinase inhibitor STI-571 reduced tumor interstitial fluid pressure in a rat tumor model of a subcutaneously grown colon adenocarcinoma (Pietras et al., 2000). The reduction in tumor interstitial fluid pressure occurred without any effects on tumor size or mean arterial blood pressure. Interestingly, this treatment also increased transcapillary transport into the tumor of a radioactive tracer compound. The effects on interstitial fluid pressure and tumor uptake were mediated by the targeting of PDGF receptors on stromal and perivascular cells, as tumor epithelial cells in this tumor model are devoid of PDGF receptors. Given the frequent occurrence of paracrine PDGF stimulation of stromal cells, this potential ap-
Involvement of PDGF in Disease
25
plication of PDGF antagonists might be applicable to a large group of solid tumors.
C. PDGF Antagonists in Treatment of Atherosclerosis Circumstantial evidence supports a role for PDGF in the development of atherosclerosis. Moreover, the observation that PDGF BB antibodies significantly reduced the development of aortic lesions in rabbits fed a cholesterolenriched diet provides strong experimental support for the notion that PDGF stimulation contributes to the formation of cholesterol-induced atherosclerosis (Rutherford et al., 1997a). In addition, the effects of various forms of PDGF antagonists on the more short-time process of injury- or transplantation-induced neointima formation have been studied extensively in rat, porcine, and primate models. In a pioneering study by Ferns et al. (1991), neutralizing PDGF antibodies were used in the rat carotid artery injury model of neointima formation. Using an endpoint of 7 days postinjury, a 50% reduction in intimal area was observed. Similar effects have been described more recently, using the same animal model, by treatment with 2-bromomethyl-5-chlorobenzene sulfonylphtalimide (Mullins et al., 1994), PDGF  receptor antisense oligonucleotides (Sirois et al., 1997), PDGF receptor tyrosine kinase inhibitor CGP53716 (Myllärniemi et al., 1997, 1999), PDGF SELEX aptamers (Leppänen et al., 2000a), or adenoviral-mediated transfer of a gene encoding a soluble form of the PDGF  receptor (Deguchi et al., 1999). Two studies have also investigated the effects of PDGF antagonists in porcine models of restenosis. Local intravascular delivery of the tyrosine kinase inhibitor AG1295, impregnated on nanoparticles, was shown to reduce the intima/media ratio in a femoral artery balloon injury model when analyzed 4 weeks after injury (Banai et al., 1998). Another PDGF receptorselective tyrosine kinase inhibitor, RPR101511A, also showed protective effects, after systemic administration, in a study where neointima growth was provoked by deendothelialization of coronary arteries and analyzed 28 days after injury (Bilder et al., 1999). Finally, PDGF receptor monoclonal antibodies have been used in baboon models of restenosis. In one study, restenosis was induced by endarterectomy of the carotid artery and balloon dilatation of femoral arteries (Giese et al., 1999). Six-day treatment with the PDGF  receptor monoclonal antibody led to a 37 and 45% reduction in lesions of the carotid and femoral arteries, respectively. No effect was observed after treatment with PDGF ␣ receptor monoclonal antibodies. The second study evaluated the effects of a mouse/human chimeric PDGF  receptor antibody together with heparin after balloon angioplasty of the saphenous artery (Hart et al., 1999). Bolus
26
Arne Östman and Carl-Henrik Heldin
treatment with antibody, distributed over 22 days after injury, together with a continuous infusion of heparin, led to a 40% reduction in the intima/media ratio. As mentioned earlier, neointima formation also occurs in association with transplantation-associated arteriosclerosis. To study the contribution of activated PDGF receptors in this process, the effects of the PDGF receptor tyrosine kinase inhibitor CGP53716 were studied in a model where cardiac and aortic allografts from dark agouti rats were transplanted heterotopically into Wistar–Furth rats (Sihvola et al., 1999). Treatment with the PDGF antagonist reduced the development of cardiac and aortic arteriosclerosis, both with regard to the incidence of coronary artery lesions and the intensity of allograft coronary artery and aortic lesions. Accumulating evidence thus suggests pharmacological intervention of PDGF receptor signaling as a novel approach for the treatment of restenosis, as well as allograft arteriosclerosis. Reports from early clinical trials are likely to appear within the near future. Most animal studies indicate that PDGF AB and BB, acting though PDGF  receptors, are the critical mediators that the cellular process blocked by the PDGF antagonists is smooth muscle cell migration, rather than proliferation (Ferns et al., 1991; Hart et al., 1999; Jawien et al., 1992; Leppänen et al., 2000a). It is possible that even better effects can be achieved by combining PDGF antagonists with other treatments. The potential of such an approach is indicated by the observation that treatment with antibodies against PDGF and FGF led to significantly better results than treatment with PDGF antibodies only in the rat carotid injury model (Rutherford et al., 1997b). One general concern with most published studies is the lack of evaluation of the persistence of the beneficial effects of PDGF antagonist treatment. Evidence that this might indeed be a concern was provided by the finding that, in the rat carotid model, the therapeutic effects of the PDGF aptamer after a 2-week treatment did not persist 6 weeks after the end of treatment (Leppänen et al., 2000a).
D. PDGF Antagonists in Treatment of Lung Fibrosis The role of PDGF stimulation in transplantation-induced obliterative bronchiolitis was investigated by treatment with the PDGF receptor tyrosine kinase inhibitor CGP 53716 using a heterotopic rat tracheal allograft model (Kallio et al., 1999). Reduced myofibroproliferation was observed, and the degree of obliterative bronchiolitis was reduced by 50%. The therapeutic effect was observed in the absence of reduced immune activation, suggesting that the beneficial effect was obtained by the direct reduction of proliferation of myofibroblasts. Similarly, intraperitoneal delivery of the PDGF receptor tyrosine kinase inhibitor AG1296 reduced cell proliferation and collagen synthesis induced by the intratracheal instillation of vanadium pentoxide in
Involvement of PDGF in Disease
27
a rat model of pulmonary fibrosis (Rice et al., 1999). Liposome-mediated transfer of a gene encoding the extracellular ligand-binding domain of the PDGF  receptor has also been found to ameliorate bleomycin-induced lung fibrosis (Yoshida et al., 1999).
E. PDGF Antagonists in Treatment of Glomerulonephritis PDGF antagonists of three different kinds, PDGF antibodies, PDGF SELEX aptmers, and receptor tyrosine kinase inhibitors, have all shown protective effects in the anti-Thy-1-induced rat model of proliferative glomerulonephritis (Floege et al., 1999b; Johnson et al., 1992; Yagi et al., 1998). Characterization of the lesions after treatment has demonstrated effects on various aspects of the disease process, including reduced mesangial cell proliferation and matrix accumulation, as well as reduced glomerular macrophage influx.
VII. FUTURE PERSPECTIVES Studies have provided insights into the mechanism of action and in vivo function of PDGF. Parallel studies have shown that overactivity of PDGF occurs in several different diseases characterized by excessive cell growth, including cancer. In several diseases, evidence for a causative role of PDGF in the pathogenesis has been provided. Components along the PDGF signaling chain are therefore interesting targets for drug discovery. Several different types of PDGF antagonists have been described and shown to act in vivo. Some antagonists act extracellularly by binding to PDGF or to PDGF receptors, thus preventing ligand–receptor interaction. The advantage of such antagonists is their specificity; it is even possible to inactivate signaling via one of the PDGF receptors but not the other. The disadvantage is that the only available antagonists of this kind are high molecular weight molecules, i.e., antibodies, ligand-binding domains of PDGF receptors, and SELEX molecules, which are expensive to make and difficult to administer. A challenge for the future will be to find low molecular weight molecules that can inhibit the binding of PDGF to its receptors. This may not be easy, as protein:protein interactions encompassing large surface areas are difficult to inhibit with low molecular weight molecules. Knowledge about the three-dimensional structure of the ligand:receptor complex will help in these efforts. Other antagonists act intracellularly by inhibiting the PDGF receptor kinase. Their advantage is that they are low molecular weight compounds that
28
Arne Östman and Carl-Henrik Heldin
are relatively inexpensive and easy to administer. Their disadvantage is that they are not specific for PDGF receptor kinases, but inhibit other kinases to varying extents. This is not surprising given the fact that all efficient kinase inhibitors target the ATP-binding site that is conserved among kinases. Despite this fact, it has been possible to develop fairly selective kinase inhibitors. An important future goal will be to develop even more specific PDGF receptor kinase inhibitors, preferentially such that distinguish between ␣ and  receptor kinases. This will require crystallization of the receptor kinases with and without candidate inhibitors and subsequent chemical optimization of the lead compounds. In the context of cancer treatment, PDGF antagonists have predominantly been envisioned to be of use in the blocking of autocrine growth stimulation. However, an additional interesting possibility is that PDGF antagonists might be beneficial by inhibiting interactions between tumor cells and stromal fibroblasts and pericytes and endothelial cells, as well as interference with different aspects of metastasis. When using PDGF antagonists, it is important not to inhibit important normal effects of PDGF. The important role of PDGF during embryogenesis may not be too much of a concern except during pregnancy. Because topically added PDGF stimulates wound healing, it will be important to investigate whether the inhibition of PDGF slows down wound healing. Another concern may be the potentially important feedback inhibition on platelet aggregation exerted by PDGF released from platelets. Because this effect is mediated via PDGF ␣ receptors on platelets and because overstimulation of the  receptor is implicated in atherosclerosis, fibrosis, and certain forms of cancer, it may be advantageous to use antagonists that specifically inhibit signaling via the  receptor and that do not inhibit the ␣ receptor. The first clinical trials with PDGF antagonists have just started (Eckhardt et al., 1999) and the results are anxiously awaited. Given the promising results from experiments using animal models, it is likely that PDGF antagonists will be clinically useful in the treatment of certain diseases.
ACKNOWLEDGMENTS We thank Ingegärd Schiller for valuable help in the preparation of this manuscript.
REFERENCES Akyürek, L. M., Paul, L. C., Funa, K., Larsson, E., and Fellström, B. C. (1996). Transplantation 62, 1526–1529.
Involvement of PDGF in Disease
29
Alpers, C. E., Davis, C. L., Barr, D., Marsh, C. L., and Hudkins, K. L. (1996). Am. J. Pathol. 148, 439–451. Alvares, O., Klebe, R., Grant, G., and Cochran, D. L. (1995). J. Periodontol. 66, 552– 558. Anan, K., Morisaki, T., Katano, M., Ikubo, A., Kitsuki, H., Uchiyama, A., Kuroki, S., Tanaka, M., and Torisu, M. (1996). Surgery 119, 333 – 339. Andersson, M., Östman, A., Kreysing, J., Bäckström, G., van de Poll, M., and Heldin, C.-H. (1995). Growth Factors 12, 159 –164. Antoniades, H. N., Bravo, M. A., Avila, R. E., Galanopoulos, T., Neville-Golden, J., Maxwell, M., and Selman, M. (1990). J. Clin. Invest. 86, 1055 –1064. Antoniades, H. N., Galanopoulos, T., Neville-Golden, J., and O’Hara, C. J. (1992). Proc. Natl. Acad. Sci. USA 89, 3942– 3946. Aubert, J.-D., Paré, P. D., Hogg, J. C., and Hayashi, S. (1997). Am. J. Respir. Crit. Care Med. 155, 676–681. Backer, J. M., Myers Jr., M. G., Shoelson, S. E., Chin, D. J., Sun, X. J., Miralpeix, M., Hu, P., Margolis, B., Scolnik, E. Y., Schlessinger, J., and White, M. F. (1992). EMBO J. 11, 3469 – 3479. Banai, S., Wolf, Y., Golomb, G., Pearle, A., Waltenberger, J., Fishbein, I., Schneider, A., Gazit, A., Perez, L., Huber, R., Lazarovichi, G., Rabinovich, L., Levitzki, A., and Gertz, S. D. (1998). Circulation 97, 1960 –1969. Barleon, B., Totzke, F., Herzog, C., Blanke, S., Kremmer, E., Siemeister, G., Marmé, D., and Martiny-Baron, G. (1997). J. Biol. Chem. 272, 10382–10388. Barnhill, R. L., Xiao, M., Graves, D., and Antoniades, H. N. (1996). Br. J. Dermatol. 135, 898 – 904. Barres, B. A., Hart, I. K., Coles, H. S., Burne, J. F., Voyvodic, J. T., Richardson, W. D., and Raff, M. C. (1992). Cell 70, 31– 46. Battegay, E. J., Rupp, J., Iruela-Arispe, L., Sage, E. H., and Pech, M. (1994). J. Cell. Biol. 125, 917–928. Bauer, E. A., Cooper, T. W., Huang, J. S., Altman, J., and Deuel, T. F. (1985). Proc. Natl. Acad. Sci. USA 82, 4132– 4136. Berk, B. C., Alexander, R. W., Brock, T. A., Gimbrone, M. A., Jr., and Webb, R. C. (1986). Science 232, 87–90. Betsholtz, C., and Raines, E. W. (1997). Kidney Int. 51, 1361–1369. Bhardwaj, B., Klassen, J., Cossette, N., Sterns, E., Tuck, A., Deeley, R., Sengupta, S., and Elliott, B. (1996). Clin. Cancer Res. 2, 773 –782. Bilder, G., Wentz, T., Leadley, R., Amin, D., Byan, L., O’Conner, B., Needle, S., Galczenski, H., Bostwick, J., Kasiewski, C., Myers, M., Spada, A., Merkel, L., Ly, C., Persons, P., Page, K., Perrone, M., and Dunwiddie, C. (1999). Circulation 99, 3292– 3299. Black, P., Carroll, R., and Glowacka, D. (1996). Pediatr. Neurosurg. 24, 74 –78. Black, P. M., Carroll, R., Glowacka, D., Riley, K., and Dashner, K. (1994). J. Neurosurg. 81, 388–393. Blatti, S. P., Foster, D. N., Ranganathan, G., Moses, H. L., and Getz, M. J. (1988). Proc. Natl. Acad. Sci. USA 85, 1119 –1123. Blechman, J. M., Lev, S., Barg, J., Eisenstein, M., Vaks, B., Vogel, Z., Givol, D., and Yarden, Y. (1995). Cell 80, 105 –115. Bos, J. L. (1997). Biochim. Biophys. Acta 1333, M19 –M31. Boström, H., Willetts, K., Pekny, M., Levéen, P., Lindahl, P., Hedstrand, H., Pekna, M., Hellström, M., Gebre-Medhin, S., Schalling, M., Nilsson, M., Kurland, S., Törnell, J., Heath, J. K., and Betsholtz, C. (1996). Cell 85, 863 – 873. Brennand, D. M., Dennehy, U., Ellis, V., Scully, M. F., Tripathi, P., Kakkar, V. V., and Patel, G. (1997a). FEBS Lett. 413, 70 –74. Brennand, D. M., Scully, M. F., Kakkar, V. V., and Patel, G. (1997b). FEBS Lett. 419, 166 –170.
30
Arne Östman and Carl-Henrik Heldin
Bryckaert, M. C., Rendu, F., Tobelem, G., and Wasteson, Å. (1989). J. Biol. Chem. 264, 4336 – 4341. Buchdunger, E., Zimmermann, J., Mett, H., Meyer, T., Muller, M., Druker, B. J., and Lydon, N. B. (1996). Cancer Res. 56, 100 –104. Buchdunger, E., Zimmermann, J., Mett, H., Meyer, T., Müller, M., Regenass, U., and Lydon, N. B. (1995). Proc. Natl. Acad. Sci. USA 92, 2558 –2562. Butt, A. M., Hornby, M. F., Kirvell, S., and Berry, M. (1997). J. Neurosci. Res. 48, 588 – 596. Canalis, E. (1981). Metabolism 30, 970 – 975. Carroll, M., Tomasson, M. H., Barker, G. F., Golub, T. R., and Gilliland, D. G. (1996). Proc. Natl. Acad. Sci. USA 93, 14845 –14850. Chaudhry, A., Papanicolaou, V., Öberg, K., Heldin, C.-H., and Funa, K. (1992). Cancer Res. 52, 1006–1012. Chung, C. K., and Antoniades, H. N. (1992). Cancer Res. 52, 3453 – 3459. Clark, R. A. F., Folkvord, J. M., Hart, C. E., Murray, M. J., and McPherson, J. M. (1989). J. Clin. Invest. 84, 1036 –1040. Crosby, J. R., Seifert, R. A., Soriano, P., and Bowen-Pope, D. F. (1998). Nat. Genet. 18, 385 – 388. Crosby, J. R., Tappan, K. A., Seifert, R. A., and Bowen-Pope, D. F. (1999). Am. J. Pathol. 154, 1315–1321. Cunningham, L. D., Brecher, P., and Cohen, R. A. (1992). J. Clin. Invest. 89, 878 – 882. Daniel, T. O., Gibbs, V. C., Milfay, D. F., Garovoy, M. R., and Williams, L. T. (1986). J. Biol. Chem. 261, 9579–9582. Danilenko, D. M., Ring, B. D., Tarpley, J. E., Morris, B., Van, G. Y., Morawiecki, A., Callahan, W., Goldenberg, M., Hershenson, S., and Pierce, G. F. (1995). Am. J. Pathol. 147, 1261– 1277. Davis, J. B., and Stroobant, P. (1990). J. Cell Biol. 110, 1353 –1360. De Vos, A. M., Ultsch, M., and Kossiakoff, A. A. (1992). Science 255, 306 – 312. Deguchi, J., Namba, T., Hamada, H., Nakaoka, T., Abe, J., Sato, O., Miyata, T., Makuuchi, M., Kurokawa, K., and Takuwa, Y. (1999). Gene Ther. 6, 956 – 965. Deinhardt, F. (1980). In “Viral Oncology” (G. Klein, ed.), pp. 359– 398. Raven Press, New York. DeMali, K. A., Balciunaite, E., and Kazlauskas, A. (1999). J. Biol. Chem. 274, 19551–19558. Diliberto, P. A., Gordon, G. W., Yu, C.-L., Earp, H. S., and Herman, B. (1992). J. Biol. Chem. 267, 11888–11897. DiMaio, D., Lai, C. C., and Klein, O. (1998). Annu. Rev. Microbiol. 52, 397– 421. Druker, B. J., and Lydon, N. B. (2000). J. Clin. Invest. 105, 3–7. Duan, D.-S. R., Pazin, M. J., Fretto, L. J., and Williams, L. T. (1991). J. Biol. Chem. 266, 413 – 418. Dudek, H., Datta, S. R., Franke, T. F., Birnbaum, M. J., Yao, R., Cooper, G. M., Segal, R. A., Kaplan, D. R., and Greenberg, M. E. (1997). Science 275, 661– 665. Ebert, M., Yokoyama, M., Friess, H., Kobrin, M. S., Büchler, M. W., and Korc, M. (1995). Int. J. Cancer 62, 529 –535. Eccleston, P. A., Collarini, E. J., Jessen, K. R., Mirsky, R., and Richardson, W. D. (1990). Eur. J. Neurosci. 2, 985– 992. Eckhardt, S. G., Rizzo, J., Sweeney, K. R., Cropp, G., Baker, S. D., Kraynak, M. A., Kuhn, J. G., Villalona-Calero, M. A., Hammond, L., Weiss, G., Thurman, A., Smith, L., Drengler, R., Eckardt, J. R., Moczygemba, J., Hannah, A. L., Von Hoff, D. D., and Rowinsky, E. K. (1999). J. Clin. Oncol. 17, 1095 –1104. Edelberg, J. M., Aird, W. C., Wu, W., Rayburn, H., Mamuya, W. S., Mercola, M., and Rosenberg, R. D. (1998). J. Clin. Invest. 102, 837– 843. Ekman, S., Rupp Thuresson, E., Heldin, C.-H., and Rönnstrand, L. (1999). Oncogene 18, 2481–2488.
Involvement of PDGF in Disease
31
Eming, S. A., Whitsitt, J. S., He, L., Krieg, T., Morgan, J. R., and Davidson, J. M. (1999). J. Invest. Dermatol. 112, 297– 302. Engström, U., Engström, Å., Ernlund, A., Westermark, B., and Heldin, C.-H. (1992). J. Biol. Chem. 267, 16581–16587. Eriksson, A., Siegbahn, A., Westermark, B., Heldin, C.-H., and Claesson-Welsh, L. (1992). EMBO J. 11, 543 – 550. Erpel, T., and Courtneidge, S. A. (1995). Curr. Opin. Cell Biol. 7, 176 –182. Fabunmi, R. P., Baker, A. H., Murray, E. J., Booth, R. F., and Newby, A. C. (1996). Biochem. J. 315, 335 –342. Fambrough, D., McClure, K., Kazlauskas, A., and Lander, E. S. (1999). Cell 97, 727–741. Fellström, B., Klareskog, L., Heldin, C.-H., Larsson, E., Rönnstrand, L., Terracio, L., Tufveson, G., Wahlberg, J., and Rubin, K. (1989). Kidney Int. 36, 1099 –1102. Ferns, G. A. A., Raines, E. W., Sprugel, K. H., Motani, A. S., Reidy, M. A., and Ross, R. (1991). Science 253, 1129 –1132. Ferrara, N., and Alitalo, K. (1999). Nat. Med. 5, 1359 –1364. Figarella-Branger, D., Vagner-Capodano, A. M., Bouillot, P., Graziani, N., Gambarelli, D., Devictor, B., Zattara-Cannoni, H., Bianco, N., Grisoli, F., and Pellissier, J. F. (1994). Neuropathol. Appl. Neurobiol. 20, 439 – 447. Fitzer-Attas, C. J., Do, M. S., Feigelson, S., Vadai, E., Feldman, M., and Eisenbach, L. (1997). Oncogene 15, 1545 –1554. Fleming, T. P., Matsui, T., Molloy, C. J., Robbins, K. C., and Aaronson, S. A. (1989). Proc. Natl. Acad. Sci. USA 86, 8063 – 8067. Fleming, T. P., Saxena, A., Clark, W. C., Robertson, J. T., Oldfield, E. H., Aaronson, S. A., and Ali, I. U. (1992). Cancer Res. 52, 4550 – 4553. Floege, J., Eng, E., Young, B. A., Alpers, C. E., Barrett, T. B., Bowen-Pope, D. F., and Johnson, R. J. (1993). J. Clin. Invest. 92, 2952–2962. Floege, J., Ostendorf, T., and Janjic, N. (1999a). Nephrol. Dial. Transplant. 14, 1354 – 1357. Floege, J., Ostendorf, T., Janssen, U., Burg, M., Radeke, H. H., Vargeese, C., Gill, S. C., Green, L. S., and Janjic, N. (1999b). Am. J. Pathol. 154, 169 –179. Forsberg, K., Valyi-Nagy, I., Heldin, C.-H., Herlyn, M., and Westermark, B. (1993). Proc. Natl. Acad. Sci. USA 90, 393 – 397. Fressinaud, C., Vallat, J. M., and Pouplard-Barthelaix, A. (1996). Glia 16, 40 – 50. Fruttiger, M., Karlsson, L., Hall, A. C., Abramsson, A., Calver, A. R., Boström, H., Willetts, K., Bertold, C.-H., Heath, J. K., Betsholtz, C., and Richardson, W. D. (1999). Development 126, 457–467. Fudge, K., Bostwick, D. G., and Stearns, M. E. (1996). Prostate 29, 282–286. Fukumura, D., Xavier, R., Sugiura, T., Chen, Y., Park, E. C., Lu, N., Selig, M., Nielsen, G., Taksir, T., Jain, R. K., and Seed, B. (1998). Cell 94, 715 –725. Gesualdo, L., Di Paolo, S., Milani, S., Pinzani, M., Grappone, C., Ranieri, E., Pannarale, G., and Schena, F. P. (1994). J. Clin. Invest. 94, 50 – 58. Gesualdo, L., Pinzani, M., Floriano, J. J., Hassan, M. O., Nagy, N. U., Schena, F. P., Emancipator, S. N., and Abboud, H. E. (1991). Lab. Invest. 65, 160 –167. Giese, N. A., Marijianowski, M. M. H., McCook, O., Hancock, A., Ramakrishnan, V., Fretto, L. J., Chen, C., Kelly, A. B., Koziol, J. A., Wilcox, J. N., and Hanson, S. R. (1999). Arterioscler. Thromb. Vasc. Biol. 19, 900 – 909. Golden, M. A. (1991). J. Clin. Invest. 87, 406 – 414. Golub, T. R., Barker, G. F., Lovett, M., and Gilliland, D. G. (1994). Cell 77, 307– 316. Greco, A., Fusetti, L., Villa, R., Sozzi, G., Minoletti, F., Mauri, P., and Pierotti, M. A. (1998). Oncogene 17, 1313 –1319. Green, L. S., Jellinek, D., Jenison, R., Östman, A., Heldin, C.-H., and Janjic, N. (1996). Biochem. 35, 14413 –14424.
32
Arne Östman and Carl-Henrik Heldin
Grotendorst, G. R., Martin, G. R., Pancev, D., Sodek, J., and Harvey, A. K. (1985). J. Clin. Invest. 76, 2323–2339. Guha, A., Dashner, K., Black, P. M., Wagner, J. A., and Stiles, C. D. (1995). Int. J. Cancer 60, 168–173. Gullberg, D., Tingström, A.., Thuresson, A.-C., Olsson, L., Terracio, L., Borg, T. K., and Rubin, K. (1990). Exp. Cell Res. 186, 264 –272. Gurujeyalakshmi, G., Hollinger, M. A., and Giri, S. N. (1999). Am. J. Physiol. Lung Cell Mol. Physiol. 276, L311–L318. Hannink, M., and Donoghue, D. J. (1988). J. Cell Biol. 107, 287–298. Harlan, J. M., Thompson, P. J., Ross, R., and Bowen-Pope, D. F. (1986). J. Cell Biol. 103, 1129 – 1133. Harmon, K. R., Witkop, C. J., White, J. G., King, R. A., Peterson, M., Moore, D., Tashjian, J., Marinelli, W. A., and Bitterman, P. B. (1994). J. Lab. Clin. Med. 123, 617– 627. Hart, C. E., Kraiss, L. W., Vergel, S., Gilbertson, D., Kenagy, R., Kirkman, T., Crandall, D. L., Tickle, S., Finney, H., Yarranton, G., and Clowes, A. W. (1999). Circulation 99, 564 – 569. Hawkins, P. T., Eguinoa, A., Qiu, R.-G., Stokoe, D., Cooke, F. T., Walters, R., Wennström, S., Claesson-Welsh, L., Evans, T., Symons, M., and Stephens, L. (1995). Curr. Biol. 5, 393 – 403. Heidaran, M. A., Pierce, J. H., Jensen, R. A., Matsui, T., and Aaronson, S. A. (1990). J. Biol. Chem. 265, 18741–18744. Heidaran, M. A., Beeler, J. F., Yu, J.-C., Ishibashi, T., LaRochelle, W. J., Pierce, J. H., and Aaronson, S. A. (1993). J. Biol. Chem. 268, 9287– 9295. Heidaran, M. A., Mahadevan, D., and Larochelle, W. J. (1995). FASEB J. 9, 140 –145. Heldin, C.-H. (1997). FEBS Lett. 410, 17–21. Heldin, C.-H., and Westermark, B. (1999). Physiol. Rev. 79, 1283 –1316. Heldin, C.-H., Östman, A., and Rönnstrand, L. (1998). Biochem. Biophys. Acta 1378, F79 – F113. Heldin, P., Laurent, T. C., and Heldin, C.-H. (1989). Biochem. J. 258, 919 – 922. Hellström, M., Kalén, M., Lindahl, P., Abramsson, A., and Betsholtz, C. (1999). Development 126, 3047–3055. Henriksen, R., Funa, K., Wilander, E., Bäckström, T., Ridderheim, M., and Öberg, K. (1993). Cancer Res. 53, 4550 – 4554. Hermanson, M., Funa, K., Hartman, M., Claesson-Welsh, L., Heldin, C.-H., Westermark, B., and Nistér, M. (1992). Cancer Res. 52, 3213 – 3219. Hermanson, M., Funa, K., Koopmann, J., Maintz, D., Waha, A., Westermark, B., Heldin, C.-H., Wiestler, O. D., Louis, D. N., von Deimling, A., and Nistér, M. (1996). Cancer Res. 56, 164 – 171. Hermanson, M., Nistér, M., Betsholtz, C., Heldin, C.-H., Westermark, B., and Funa, K. (1988). Proc. Natl. Acad. Sci. USA 85, 7748 –7752. Hermanson, M., Olsson, T., Westermark, B., and Funa, K. (1995). Exp. Brain Res. 102, 415 – 422. Hertz, M. I., Henke, C. A., Nakhleh, R. E., Harmon, K. R., Marinelli, W. A., Fox, J. M. K., Kubo, S. H., Shumway, S. J., Bolman, R. M., III, and Bitterman, P. B. (1992). Proc. Natl. Acad. Sci. USA 89, 10385–10389. Heuchel, R., Berg, A., Tallquist, M., Åhlén, K., Reed, R. K., Rubin, K., Claesson-Welsh, L., Heldin, C.-H., and Soriano, P. (1999). Proc. Natl. Acad. Sci. USA 96, 11410–11415. Holmgren, L., Flam, F., Larsson, E., and Ohlsson, R. (1993). Cancer Res. 53, 2927–2931. Hooshmand-Rad, R., Claesson-Welsh, L., Wennström, S., Yokote, K., Siegbahn, A., and Heldin, C.-H. (1997). Exp. Cell Res. 234, 434 – 441. Hossain, M. Z., Ao, P., and Boynton, A. L. (1998). J. Cell. Physiol. 174, 66 –77. Hoyle, G. W., Li, J., Finkelstein, J. B., Eisenberg, T., Liu, J.-Y., Lasky, J. A., Athas, G., Morris, G. F., and Brody, A. R. (1999). Am. J. Pathol. 154, 1763 –1775.
Involvement of PDGF in Disease
33
Iida, H., Seifert, R., Alpers, C. E., Gronwald, R. G. K., Phillips, P. E., Pritzl, P., Gordon, K., Gown, A. M., Ross, R., Bowen-Pope, D. F., and Johnson, R. J. (1991). Proc. Natl. Acad. Sci. USA 88, 6560–6564. Isaka, Y., Fujiwara, Y., Ueda, N., Kaneda, Y., Kamada, T., and Imai, E. (1993). J. Clin. Invest. 92, 2597–2601. Jain, R. K. (1987). Cancer Res. 47, 3039 – 3051. Jain, R. K. (1998). Nat. Med. 4, 655 –657. Jawien, A., Bowen-Pope, D. F., Lindner, V., Schwartz, S. M., and Clowes, A. W. (1992). J. Clin. Invest. 89, 507–511. Johnson, R. J., Raines, E. W., Floege, J., Yoshimura, A., Pritzl, P., Alpers, C., and Ross, R. (1992). J. Exp. Med. 175, 1413 –1416. Jones, S. M., Klinghoffer, R., Prestwich, G. D., Toker, A., and Kazlauskas, A. (1999). Curr. Biol. 9, 512–521. Joukov, V., Kaipainen, A., Jeltsch, M., Pajusola, K., Olofsson, B., Kumar, V., Eriksson, U., and Alitalo, K. (1997). J. Cell. Physiol. 173, 211–215. Jousset, C., Carron, C., Boureux, A., Quang, C. T., Oury, C., Dusanter-Fourt, I., Charon, M., Levin, J., Bernard, O., and Ghysdael, J. (1997). EMBO J. 16, 69 – 82. Kaetzel, D. M., Reid IV, J. D., Pedigo, N., Zimmer, S. G., and Boghaert, E. R. (1998). J. Neurooncol. 39, 33–46. Kallio, E. A., Koskinen, P. K., Aavik, E., Buchdunger, E., and Lemström, K. B. (1999). Am. J. Respir. Crit. Care Med. 160, 1324–1332. Kanzaki, T., Shinomiya, M., Ueda, S., Morisaki, N., Saito, Y., and Yoshida, S. (1994). Eur. J. Clin. Invest. 24, 377– 381. Karlsson, L., Bondjers, C., and Betsholtz, C. (1999). Development 126, 2611–2621. Kauffmann-Zeh, A., Rodriguez-Viciana, P., Ulrich, E., Gilbert, C., Coffer, P., Downward, J., and Evan, G. (1997). Nature 385, 544 – 548. Kawai, T., Hiroi, S., and Torikata, C. (1997). Lab. Invest. 77, 431– 436. Keating, M. T., and Williams, L. T. (1988). Science 239, 914 – 916. Klinghoffer, R. A., and Kazlauskas, A. (1995). J. Biol. Chem. 270, 22208 –22217. Klohs, W. D., Fry, D. W., and Kraker, A. J. (1997). Curr. Opin. Oncol. 9, 562– 568. Kourembanas, S., Morita, T., Liu, Y., and Christou, H. (1997). Kidney Int. 51, 438 – 443. Kovalenko, M., Denner, K., Sandström, J., Persson, C., Gro, S., Jandt, E., Vilella, R., Böhmer, F., and Östman, A. (2000). J. Biol. Chem. 275, 16219– 16226. Kovalenko, M., Gazit, A., Böhmer, A., Rorsman, C., Rönnstrand, L., Heldin, C.-H., Waltenberger, J., Böhmer, F.-D., and Levitzki, A. (1994). Cancer Res. 54, 6106 – 6114. Koyama, H., Nishizawa, Y., Hosoi, M., Fukumoto, S., Kogawa, K., Shioi, A., and Morii, H. (1996). Circ. Res. 79, 757–764. Koyama, N., Hart, C. E., and Clowes, A. W. (1994). Circ. Res. 75, 682– 691. Koyama, N., Kinsella, M. G., Wight, T. N., Hedin, U., and Clowes, A. W. (1998). Circ. Res. 83, 305–313. Kraiss, L. W., Geary, R. L., Mattsson, E. J. R., Vergel, S., Au, Y. P. T., and Clowes, A. W. (1996). Circ. Res. 79, 45– 53. Kraiss, L. W., Raines, E. W., Wilcox, J. N., Seifert, R. A., Barrett, T. B., Kirkman, T. R., Hart, C. E., Bowen-Pope, D. F., Ross, R., and Clowes, A. W. (1993). J. Clin. Invest. 92, 338 – 348. Krupinski, J., Issa, R., Bujny, T., Slevin, M., Kumar, P., Kumar, S., and Kaluza, J. (1997). Stroke 28, 564–573. Lackmann, M., Oates, A. C., Dottori, M., Smith, F. M., Do, C., Power, M., Kravets, L., and Boyd, A. W. (1998). J. Biol. Chem. 273, 20228 –20237. Langerak, A. W., De Laat, P., Van der Linden-van Beurden, C. A. J., Delahaye, M., Van der Kwast, T. H., Hoogsteden, H. C., Benner, R., and Versnel, M. A. (1996). J. Pathol. 178, 151– 160.
34
Arne Östman and Carl-Henrik Heldin
LaRochelle, W. J., Jensen, R. A., Heidaran, M. A., May-Siroff, M., Wang, L.-M., Aaronson, S. A., and Pierce, J. H. (1993). Cell Growth Diff. 4, 547– 553. LeGrand, E. K. (1998). Am. J. Surg. 176, 48S– 54S. Lemström, K. B., and Koskinen, P. K. (1997). Circulation 96, 1240 –1249. Leon, S. P., Carroll, R. S., Dashner, K., Glowacka, D., and Black, P. M. (1994). J. Clin. Endocrinol. Metab. 79, 51– 55. Leppänen, O., Janjic, N., Carlsson, M.-A., Vargeese, C., Green, L., Bergqvist, D., Östman, A., and Heldin, C.-H. (2000a). Submitted for publication. Leppänen, O., Miyazawa, K., Bäckström, G., Pietras, K., Sjöblom, T., Heldin, C.-H., and Östman, A. (2000b). Biochemistry 39, 2370 – 2375. Levéen, P., Pekny, M., Gebre-Medhin, S., Swolin, B., Larsson, E., and Betsholtz, C. (1994). Genes Dev. 8, 1875–1887. Levitzki, A., and Gazit, A. (1995). Science 267, 1782–1788. Li, X., Aase, K., Pontén, A., Karlsson, L., Abramsson, A., Untela, M., Bäckström, G., Hellström, M., Boström, H., Soriano, P., Betsholtz, C., Heldin, C.-H., Alitalo, K., Östman, A., and Eriksson, U. (2000). Nature Cell Biol. 2, 302–309. Liapis, H., Yu, H., Flath, A., and Steinhardt, G. F. (1997). Nephron 76, 161–170. Leichty, K. W., Nesbit, M., Herlyn, M., Radu, A., Adzick, N. S., and Crombleholme, T. M. (1999). J. Invest. Dermatol. 113, 375 – 383. Lindahl, P., Johansson, B. R., Levéen, P., and Betsholtz, C. (1997a). Science 277, 242–245. Lindahl, P., Karlsson, L., Hellström, M., Gebre-Medhin, S., Willetts, K., Heath, J. K., and Betsholtz, C. (1997b). Development 124, 3943 – 3953. Lindmark, G., Sundberg, C., Glimelius, B., Påhlman, L., Rubin, K., and Gerdin, B. (1993). Lab. Invest. 69, 682–689. Liu, J.-Y., Morris, G. F., Lei, W.-H., Hart, C. E., Lasky, J. A., and Brody, A. R. (1997). Am. J. Respir. Cell Mol. Biol. 17, 129 –140. Lokker, N. A., O’Hare, J. P., Barsoumian, A., Tomlinson, J. E., Ramakrishnan, V., Fretto, L. J., and Giese, N. A. (1997). J. Biol. Chem. 272, 33037– 33044. Ma, Y.-H., Ling, S., and Ives, H. E. (1999). Biochem. Biophys. Res. Commun. 265, 606 – 610. Majesky, M. W., Reidy, M. A., Bowen-Pope, D. F., Hart, C. E., Wilcox, J. N., and Schwartz, S. M. (1990). J. Cell Biol. 111, 2149 –2158. Mendoza, A. E., Young, R., Orkin, S. H., and Collins, T. (1990). Proc. Natl. Acad. Sci. USA 87, 2177–2181. Mercola, M., Deininger, P. L., Shamah, S. M., Porter, J., Wang, C. Y., and Stiles, C. D. (1990). Genes Dev. 4, 2333–2341. Miyazawa, K., Bäckström, G., Leppänen, O., Persson, C., Wernstedt, C., Hellman, U., Heldin, C.-H., and Östman, A. (1998). J. Biol. Chem. 273, 25495 –25502. Mohammadi, M., Froum, S., Hamby, J. M., Schroeder, M. C., Panek, R. L., Lu, G. H., Eliseenkova, A. V., Green, D., Schlessinger, J., and Hubbard, S. R. (1998). EMBO J. 17, 5896–5904. Mondy, J. S., Lindner, V., Miyashiro, J. K., Berk, B. C., Dean, R. H., and Geary, R. L. (1997). Circ. Res. 81, 320–327. Mullins, D. E., Hamud, F., Reim, R., and Davis, H. R. (1994). Arterioscler. Thromb. 14, 1047– 1055. Murray-Rust, J., McDonald, N. Q., Blundell, T. L., Hosang, M., Oefner, C., Winkler, F., and Bradshaw, R. A. (1993). Structure 1, 153 –159. Mustoe, T. A., Pierce, G. F., Morishima, C., and Deuel, T. F. (1991). J. Clin. Invest. 87, 694–703. Myllärniemi, M., Calderon, L., Lemström, K., Buchdunger, E., and Häyry, P. (1997). FASEB J. 11, 1119–1126. Myllärniemi, M., Frösen, J., Ramirez, L. G. C., Buchdunger, E., Lemström, K., and Häyry, P. (1999). Cardiovasc. Drugs Ther. 13, 159 –168.
Involvement of PDGF in Disease
35
Nabel, E. G., Yang, Z., Liptay, S., San, H., Gordon, D., Haudenschild, C. C., and Nabel, G. J. (1993). J. Clin. Invest. 91, 1822–1829. Nicosia, R. F., Nicosia, S. V., and Smith, M. (1994). Am. J. Pathol. 145, 1023 –1029. Niemir, Z. I., Stein, H., Noronha, I. L., Krüger, C., Andrassy, K., Ritz, E., and Waldherr, R. (1995). Kidney Int. 48, 1530 –1541. O’Brien, K. P., Seroussi, E., Dal Cin, P., Sciot, R., Mandahl, N., Fletcher, J. A., Turc-Carel, C., and Dumanski, J. P. (1998). Gene Chrom. Cancer 23, 187–193. Oefner, C., D’Arcy, A., Winkler, F. K., Eggimann, B., and Hosang, M. (1992). EMBO J. 11, 3921–3926. Olivera, A., Edsall, L., Poulton, S., Kazlauskas, A., and Spiegel, S. (1999). FASEB J. 13, 1593 – 1600. Omura, T., Heldin, C.-H., and Östman, A. (1997). J. Biol. Chem. 272, 12676–12682. Orr-Urtreger, A., Bedford, M. T., Do, M.-S., Eisenbach, L., and Lonai, P. (1992). Development 115, 289–303. Othberg, A., Odin, P., Ballagi, A., Åhgren, A., Funa, K., and Lindvall, O. (1995). Exp. Brain Res. 105, 111–122. Oumesmar, B. N., Vignais, L., and Baron-Van Evercooren, A. (1997). J. Neurosci. 17, 125 – 139. Panayotou, G., Bax, B., Gout, I., Federwisch, M., Wroblowski, B., Dhand, R., Fry, M. J., Blundell, T. L., Wollmer, A., and Waterfield, M. D. (1992). EMBO J. 11, 4261– 4272. Pawson, T., and Scott, J. D. (1997). Science 278, 2075 –2080. Pech, M., Gazit, A., Arnstein, P., and Aaronson, S. A. (1989). Proc. Natl. Acad. Sci. USA 86, 2693–2697. Pierce, G. F., Mustoe, T. A., Senior, R. M., Reed, J., Griffin, G. L., Thomason, A., and Deuel, T. F. (1988). J. Exp. Med. 167, 974 – 987. Pietras, K., Östman, A., Sjöquist, M., Buchdunger, E., Reed, R. K., Heldin, C.-H., and Rubin, K. (2000). Submitted for publication. Pietz, K., Odin, P., Funa, K., and Lindvall, O. (1996). Neurosci. Lett. 204, 101–104. Plate, K. H., Breier, G., Farrell, C. L., and Risau, W. (1992). Lab. Invest. 67, 529 – 534. Plattner, R., Kadlec, L., DeMali, K. A., Kazlauskas, A., and Pendergast, A. M. (1999). Genes Dev. 13, 2400–2411. Plotnikov, A. N., Schlessinger, J., Hubbard, S. R., and Mohammad, M. (1999). Cell 98, 641– 650. Pluskey, S., Wandless, T. J., Walsh, C. T., and Shoelson, S. E. (1995). J. Biol. Chem. 270, 2897– 2900. Pompili, V. J., Gordon, D., San, H., Yang, Z., Muller, D. W. M., Nabel, G. J., and Nabel, E. G. (1995). Arterioscler. Thromb. Vasc. Biol. 15, 2254 –2264. Powell, P. P., Wang, C. C., and Jones, R. (1992). Am. J. Respir. Cell Mol. Biol. 7, 278 –285. Pringle, N. P., Mudhar, H. S., Collarini, E. J., and Richardson, W. D. (1992). Development 115, 535–551. Ramakrishnan, V., Escobedo, M.-A., Fretto, L. J., Seroogy, J. J., Tomlinson, J. E., and Wolf, D. L. (1993). Growth Factors 8, 253 –265. Redwine, J. M., and Armstrong, R. C. (1998). J. Neurobiol. 37, 413 – 428. Rice, A. B., Moomaw, C. R., Morgan, D. L., and Bonner, J. C. (1999). Am. J. Pathol. 155, 213 – 221. Risau, W., Drexler, H., Mironov, V., Smits, A., Siegbahn, A., Funa, K., and Heldin, C.-H. (1992). Growth Factors 7, 261–266. Ritchie, K. A., Aprikyan, A. A. G., Bowen-Pope, D. F., Norby-Slycord, C. J., Conyers, S., Sitnicka, E., Bartelmez, S. H., and Hickstein, D. D. (1999). Leukemia 13, 1790 –1803. Robbins, J. R., McGuire, P. G., Wehrle-Haller, B., and Rogers, S. L. (1999). Dev. Biol. 212, 255–263.
36
Arne Östman and Carl-Henrik Heldin
Robson, M. C., Phillips, L. G., Thomason, A., Robson, L. E., and Pierce, G. F. (1992). Lancet 339, 23–25. Roche, S., Alonso, G., Kazlauskas, A., Dixit, V. M., Courtneidge, S. A., and Pandey, A. (1998). Curr. Biol. 8, 975–978. Rodt, S. Å., Åhlén, K., Berg, A., Rubin, K., and Reed, R. K. (1996). J. Physiol. 495, 193 –200. Romashkova, J. A., and Makarov, S. S. (1999). Nature 401, 86 – 90. Rönnstrand, L., Siegbahn, A., Rorsman, C., Johnell, M., Hansen, K., and Heldin, C.-H. (1999). J. Biol. Chem. 274, 22089–22094. Rooney, B. C., Hosang, M., and Hunziker, W. (1994). FEBS Lett. 339, 181–184. Rosenkranz, S., and Kazlauskas, A. (1999). Growth Factors 16, 201–216. Ross, R., Masuda, J., Raines, E. W., Gown, A. M., Katsuda, S., Sasahara, M., Malden, L. T., Masuko, H., and Sato, H. (1990). Science 248, 1009 –1012. Rubin, K., Tingström, A., Hansson, G. K., Larsson, E., Rönnstrand, L., Klareskog, L., Claesson-Welsh, L., Heldin, C.-H., Fellström, B., and Terracio, L. (1988). Lancet 1, 1353 –1356. Rutherford, C., Martin, W., Carrier, M., Änggård, E. E., and Ferns, G. A. A. (1997a). Int. J. Exp. Pathol. 78, 21– 32. Rutherford, C., Martin, W., Salame, M., Carrier, M., Änggård, E., and Ferns, G. (1997b). Atherosclerosis 130, 45– 51. Sachinidis, A., Locher, R., Hoppe, J., and Vetter, W. (1990). FEBS Lett. 272, 95 – 98. Sakata, M., Yanamoto, H., Hashimoto, N., Iihara, K., Tsukahara, T., Taniguchi, T., and Kikuchi, H. (1998). Brain Res. 784, 250 –255. Sato, N., Beitz, J. G., Kato, J., Yamamoto, M., Clark, J. W., Calabresi, P., and Frackelton Jr., A. R. (1993). Am. J. Pathol. 142, 1119 –1130. Schatteman, G. C., Morrison-Graham, K., van Koppen, A., Weston, J. A., and Bowen-Pope, D. F. (1992). Development 115, 123 –131. Schilling, D., Reid, J. D., Hujer, A., Morgan, D., Demoll, E., Bummer, P., Fenstermaker, R. A., and Kaetzel, D. M. (1998). Biochem. J. 333, 637– 644. Schönherr, E., Järveläinen, H. T., Sandell, L. J., and Wight, T. N. (1991). J. Biol. Chem. 266, 17640–17647. Shamah, S. M., Alberta, J. A., Giannobile, W. V., Guha, A., Kwon, Y. K., Black, P. M., and Stiles, C. D. (1997). Cancer Res. 57, 4141– 4147. Shamah, S. M., Stiles, C. D., and Guha, A. (1993). Mol. Cell. Biol. 13, 7203 –7212. Shawver, L. K., Schwartz, D. P., Mann, E., Chen, H., Tsai, J., Chu, L., Taylorson, L., Longhi, M., Meredith, S., Germain, L., Jacobs, J. S., Tang, C., Ullrich, A., Berens, M. E., Hersh, E., McMahon, G., Hirth, K. P., and Powell, T. J. (1997). Clin. Cancer Res. 3, 1167–1177. Shimizu, A., O’Brien, K. P., Sjöblom, T., Pietras, K., Buchdunger, E., Collins, V. P., Heldin, C.-H., Dumanski, J. P., and Östman, A. (1999). Cancer Res. 59, 3719 – 3723. Shulman, T., Sauer, F. G., Jackman, R. M., Chang, C. N., and Landolfi, N. F. (1997). J. Biol. Chem. 272, 17400–17404. Siegbahn, A., Hammacher, A., Westermark, B., and Heldin, C.-H. (1990). J. Clin. Invest. 85, 916–920. Sihvola, R., Koskinen, P., Myllärniemi, M., Loubtchenkov, M., Häyry, P., Buchdunger, E., and Lemström, K. (1999). Circulation 99, 2295 –2301. Simon, M.-P., Pedeutour, F., Sirvent, N., Grosgeorge, J., Minoletti, F., Coindre, J.-M., TerrierLacombe, M.-J., Mandahl, N., Craver, R. D., Blin, N., Sozzi, G., Turc-Carel, C., O’Brien, K. P., Kedra, D., Fransson, I., Guilbaud, C., and Dumanski, J. P. (1997). Nature Genet. 15, 95–98. Sirois, M. G., Simons, M., and Edelman, E. R. (1997). Circulation 95, 669 – 676. Sjöblom, T., Boureux, A., Rönnstrand, L., Heldin, C.-H., Ghysdael, J., and Östman, A. (1999). Oncogene 18, 7055–7062. Skobe, M., and Fusenig, N. E. (1998). Proc. Natl. Acad. Sci. USA 95, 1050 –1055.
Involvement of PDGF in Disease
37
Smits, A., Funa, K., Vassbotn, F. S., Beausang-Linder, M., Ekenstam, F., Heldin, C.-H., Westermark, B., and Nistér, M. (1992). Am. J. Pathol. 140, 639 – 648. Smits, A., Kato, M., Westermark, B., Nistér, M., Heldin, C.-H., and Funa, K. (1991). Proc. Natl. Acad. Sci. USA 88, 8159 – 8163. Snyder, L. S., Hertz, M. I., Peterson, M. S., Harmon, K. R., Marinelli, W. A., Henke, C. A., Greenheck, J. R., Chen, B., and Bitterman, P. B. (1991). J. Clin. Invest. 88, 663 – 673. Soriano, P. (1994). Genes Dev. 8, 1888 –1896. Soriano, P. (1997). Development 124, 2691–2700. Soskic, V., Görlach, M., Poznanovic, S., Boehmer, F. D., and Godovac-Zimmermann, J. (1999). Biochemistry 38, 1757–1764. Sprugel, K. H., McPherson, J. M., Clowes, A. W., and Ross, R. (1987). Am. J. Pathol. 129, 601– 613. Starovasnik, M. A., Braisted, A. C., and Wells, J. A. (1997). Proc. Natl. Acad. Sci. USA 94, 10080–10085. Stephenson, D. A., Mercola, M., Anderson, E., Wang, C., Stiles, C. D., Bowen-Pope, D. F., and Chapman, V. M. (1991). Proc. Natl. Acad. Sci. USA 88, 6 –10. Strawn, L. M., Mann, E., Elliger, S. S., Chu, L. M., Germain, L. L., Niederfellner, G., Ullrich, A., and Shawver, L. K. (1994). J. Biol. Chem. 269, 21215–21222. Sundberg, C., Branting, M., Gerdin, B., and Rubin, K. (1997). Am. J. Pathol. 151, 479 – 492. Sundberg, C., Ljungström, M., Lindmark, G., Gerdin, B., and Rubin, K. (1993). Am. J. Pathol. 143, 1377–1388. Tang, W. W., Ulich, T. R., Lacey, D. L., Hill, D. C., Qi, M., Kaufman, S. A., Van, G. Y., Tarpley, J. E., and Yee, J. S. (1996). Am. J. Pathol. 148, 1169 –1180. Tanizawa, S., Ueda, M., Van der Loos, C. M., Van der Wal, A. C., and Becker, A. E. (1996). Br. Heart J. 75, 549– 556. Thomasson, M. H., Williams, I. R., Hasserjian, R., Udomsakdi, C., McGrath, S. M., Schwaller, J., Druker, B., and Gilliland, D. G. (1999). Blood 93, 1707–1714. Thyberg, J., Östman, A., Bäckström, G., Westermark, B., and Heldin, C.-H. (1990). J. Cell Science 97, 219–229. Tiesman, J., and Hart, C. E. (1993). J. Biol. Chem. 268, 9621– 9628. Todo, T., Adams, E. F., Fahlbusch, R., Dingermann, T., and Werner, H. (1996). J. Neurosurg. 84, 852–858. Twamley-Stein, G. M., Pepperkok, R., Ansorge, W., and Courtneidge, S. A. (1993). Proc. Natl. Acad. Sci. USA 90, 7696 –7700. Uchida, K., Sasahara, M., Morigami, N., Hazama, F., and Kinoshita, M. (1996). Atherosclosis 124, 9–23. Uebelhoer, M., Bewig, B., Kreipe, H., Nowak, D., Magnussen, H., and Barth, J. (1995). Chest 107, 701–705. Ueda, M., Becker, A. E., Kasayuki, N., Kojima, A., Morita, Y., and Tanaka, S. (1996). Am. J. Pathol. 149, 831– 843. Ueno, H., Colbert, H., Escobedo, J. A., and Williams, L. T. (1991). Science 252, 844 – 848. Uhrbom, L., Hesselager, G., Nistér, M., and Westermark, B. (1998). Cancer Res. 58, 5275–5279. Uhrbom, L., Hesselager, G., Östman, A., Nistér, M., and Westermark, B. (1999). Int. J. Cancer 85, 398–406. Valgeirsdóttir, S., Eriksson, A., Nistér, M., Heldin, C.-H., Westermark, B., and ClaessonWelsh, L. (1995). J. Biol. Chem. 270, 10161–10170. Valius, M., and Kazlauskas, A. (1993). Cell 73, 321– 334. Vanhee, D., Gosset, P., Wallaert, B., Voisin, C., and Tonnel, A. B. (1994). Am. J. Respir. Crit. Care Med. 150, 1049 –1055. Vassbotn, F. S., Andersson, M., Westermark, B., Heldin, C.-H., and Östman, A. (1993). Mol. Cell. Biol. 13, 4066 – 4076.
38
Arne Östman and Carl-Henrik Heldin
Vassbotn, F. S., Havnen, O. K., Heldin, C.-H., and Holmsen, H. (1994a). J. Biol. Chem. 269, 13874–13879. Vassbotn, F. S., Langeland, N., Hagen, I., and Holmsen, H. (1990). Biochim. Biophys. Acta 1054, 246 –249. Vassbotn, F. S., Östman, A., Langeland, N., Holmsen, H., Westermark, B., Heldin, C.-H., and Nistér, M. (1994b). J. Cell. Physiol. 158, 381– 389. Vignaud, J.-M., Allam, M., Martinet, N., Pech, M., Plenat, F., and Martinet, Y. (1991). Am. J. Respir. Cell Mol. Biol. 5, 531– 538. Vignaud, J. M., Marie, B., Klein, N., Plénat, F., Pech, M., Borrelly, J., Martinet, N., Duprez, A., and Martinet, Y. (1994). Cancer Res. 54, 5455 – 5463. Wahl, M. I., Nishibe, S., Kim, J. W., Kim, H., Rhee, S. G., and Carpenter, G. (1990). J. Biol. Chem. 265, 3944–3948. Walsh, J., Absher, M., and Kelley, J. (1993). Am. J. Respir. Cell Mol. Biol. 9, 637– 644. Wang, J., Coltrera, M. D., and Gown, A. M. (1994). Cancer Res. 54, 560 – 564. Wennström, S., Hawkins, P., Cooke, F., Hara, K., Yonezawa, K., Kasuga, M., Jackson, T., Claesson-Welsh, L., and Stephens, L. (1994a). Curr. Biol. 4, 385 – 393. Wennström, S., Siegbahn, A., Yokote, K., Arvidsson, A.-K., Heldin, C.-H., Mori, S., and Claesson-Welsh, L. (1994b). Oncogene 9, 651– 660. Westermark, B., Betsholtz, C., Johnsson, A., and Heldin, C.-H. (1987). In “Viral Carcinogenesis” (N. O. Kjeldgaard and J. Forchhammer, eds.), pp. 445– 457. Munksgaard, Copenhagen. Wolswijk, G., and Noble, M. (1992). J. Cell Biol. 118, 889 – 900. Yagi, M., Kato, S., Kobayashi, Y., Kobayashi, N., Iinuma, N., Nakamura, K., Kubo, K., Ohyama, S. I., Murooka, H., Shimizu, T., Nishitoba, T., Osawa, T., and Nagano, N. (1998). Gen. Pharmacol. 31, 765 –773. Yao, R., and Cooper, G. M. (1995). Science 267, 2003 –2006. Yi, E. S., Lee, H., Yin, S., Piguet, P., Sarosi, I., Kaufmann, S., Tarpley, J., Wang, N.-S., and Ulich, T. R. (1996). Am. J. Pathol. 149, 539 – 548. Yoshida, M., Sakuma-Mochizuki, J., Abe, K. y., Arai, T., Mori, M., Goya, S., Matsuoka, H., Hayashi, S., Kaneda, Y., and Kishimoto, T. (1999). Biochem. Biophys. Res. Commun. 265, 503–508. Yoshimura, A., Gordon, K., Alpers, C. E., Floege, J., Pritzl, P., Ross, R., Couser, W. G., BowenPope, D. F., and Johnson, R. J. (1991). Kidney Int. 40, 470 – 476. Zhao, R., and Zhao, Z. J. (1999). Biochem. J. 338, 35 – 39. Östman, A., Thyberg, J., Westermark, B., and Heldin, C.-H. (1992). J. Cell. Biol. 118, 509 – 519.
Tumor Suppression Activity of Adenovirus E1a Protein: Anoikis and the Epithelial Phenotype Steven M. Frisch The Burnham Institute La Jolla, California 92037
I. II. III. IV. V.
Introduction Historical Development of E1a as a Tumor Suppressor Epithelial Conversion: Phenomenology Epithelial Conversion: Mechanisms Anoikis Sensitization and Tumor Suppression by E1a References
Adenovirus E1a proteins reverse-transform diverse human tumor cells in culture. This has stimulated interest in the arenas of clinical and basic cancer research. Clinically, cancer gene therapy trials on E1a are in progress, and drug discovery strategies based on E1a are being considered. Biologically, the effect of E1a is unique in that it overrides most or all oncogenic signaling pathways to yield nontumorigenic cells. Apparently, this is a consequence of the ability of E1a to reprogram transcription in tumor cells so as to produce an epithelial phenotype that is refractory to oncogenic growth stimulation. The molecular basis for this effect is emerging. © 2000 Academic Press.
I. INTRODUCTION Tumor suppressor genes have yielded crucial insight into the mechanisms underlying cell cycle progression, apoptosis, and anchorage-dependent growth. Complementation of a defective tumor suppressor gene with the corresponding wild-type version is being explored for such genes as p53 and Rb. However, current data indicate that at least one tumor suppressor gene can function in a generalized fashion, independently of the genetic lesions causing the tumor: adenovirus E1a (Frisch, 1991; Frisch and Dolter, 1995). Paradoxically, E1a has been investigated for at least 25 years as a model oncogene (reviewed in Bayley and Mymryk, 1994). This is because E1a can cause quiescent rodent cells to enter S phase, immortalize them, or cooperate with ras to transform them. In contrast, oncogene cooperation with E1a Advances in CANCER RESEARCH Vol. 80 0065-230X/01 $35.00
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
40
Steven M. Frisch
has not been shown—despite extensive attempts—in human cells. [The 293 HEK cell line is often cited as an example, but this line was originally nontumorigenic (Graham et al., 1977).] Correspondingly, despite widespread infection with adenovirus, E1a sequences have not been associated with any human tumor. Conceivably, the opposite effects of E1a observed in human vs rodent cells could reflect lower affinities of the critical rodent cell proteins for E1a, given that E1a was naturally optimized for interaction with human proteins. However, it is unclear at present whether a species difference accounts for this discrepancy entirely, as reverse transformation of mouse melanoma cells by E1a has been described (Deng et al., 1998). E1a is currently in clinical trials for the treatment of head and neck, breast, and ovarian cancer (Reynolds, et al., 2000). However, its mechanism is not yet understood. This review presents a phenomologic summary of the tumor suppression effects of E1a in human cells. This is followed by an account of (what little is known about) the molecular mechanisms involved and of key future goals for understanding and applying the unique properties of E1a.
II. HISTORICAL DEVELOPMENT OF E1a AS A TUMOR SUPPRESSOR During the late 1980s and early 1990s, it was reported that E1a repressed metalloprotease genes (Pozzatti et al., 1986; Frisch et al., 1990) or activated nm23 gene expression (Leone et al., 1993), inhibiting metastasis. Additional reports showed that deletion of the C-terminal region of E1a enhanced the ability of E1a to transform rodent cells (Boyd et al., 1993), indicating that this domain attenuated transformation by E1a in cis. Despite this limitations these reports foreshadowed later developments that qualified E1a as a viral tumor suppressor gene. The tumor suppression activity of E1a in three human tumor cell lines (HT1080 fibrosarcoma, A2058 melanoma, and HeLa carcinoma cells) was reported in 1991 (Frisch, 1991), almost earning E1a true tumor suppressor gene status. However, two other observations, published almost concurrently, dampened enthusiasm for this idea. The first was that E1a inhibited primary tumorigenesis in human mammary carcinoma cells that possessed amplified HER2/c-erbB2 genes by repressing the expression of this oncoprotein (Yu et al., 1991). This raised the possibility that the tumor suppression activity of E1a would be limited to cells overexpressing this oncogene. The second was that transiently transfected E1a genes, as is the case with many transiently overexpressed proteins, caused apoptosis in human tumor cells (Rao et al., 1992). Both of these counterarguments were finally overcome, with the demonstration that E1a could suppress human tumor cells not transformed by HER2/c-erbB2 without causing apoptosis, when ex-
Adenovirus E1a Protein
41
pressed at more moderate levels by retroviral transduction (Frisch and Dolter, 1995). This firmly established that E1a was a generalized tumor suppressor, notwithstanding the semantic problem arising from the novelty of a viral tumor suppressor gene, especially one that had previously been dubbed an oncogene because of its properties in inappropriate (rodent) species.
III. EPITHELIAL CONVERSION: PHENOMENOLOGY A generalized tumor suppressor gene might be expected to revert tumor cells back to the cell types from which they arose. However, this appeared not to be the case for E1a. In fact, E1a repressed cell type-specific genes in human tumor cells [e.g., muscle genes in rhabdomyosarcoma cells (Frisch, 1994)], consistent with its blockage of muscle (Sandmoeller et al., 1996) and neuronal differentiation (Maruyama et al., 1987) in inducible culture systems. Concomitantly, E1a activated the expression of an array of epithelial cell adhesion molecules: E-cadherin, desmosomal proteins, and cytokeratin18 (Frisch, 1994). This effect, called “epithelial conversion,” is consistent with earlier observations that E1a induces cytokeratin-8 (endo A) in F9 embyronal carcinoma cells (Montano and Lane, 1987). In principle, epithelial conversion might suffice to explain tumor suppression by the following logic. The transformation of human epithelial cells is usually accompanied by the loss of various epithelial-specific protein functions due to transcriptional repression or mutation (Birchmeier et al., 1995; Guilford, 1999; Bullions and Levine, 1998; Jankowski et al., 1997; Gumbiner, 1997; Christofori and Semb, 1999) . Examples of this are as follows: (1) repression or mutation of E-cadherin, (2) mutation of -catenin or APC, and (3) mutation of hDLG, a tight junction protein that interacts with APC. By altering catenin-related signaling pathways involving transcription factors (e.g., LEF-1/TCF, activating c-myc, or cyclin D1 transcription) or by other mechanisms that remain to be elucidated (e..g, altered actin or microtubule cytoskeleton, crosstalk with integrin signaling pathways), these alterations contribute to transformation. The nature of this contribution is unknown at present. Alternatively, catenin-related signaling may somehow cause the loss of sensitivity to anoikis (reviewed in Frisch and Ruoslahti, 1997), promoting anchorage-independent growth. By this logic, a gene that converted various tumor cells into epithelial cells would be a predicted tumor suppressor, of which E1a is an example.
IV. EPITHELIAL CONVERSION: MECHANISMS As discussed in a previous review (Frisch, 1997), the promoters of epithelial cell adhesion genes (for brevity, called “epithelial promoters”) generally
42
Steven M. Frisch
resemble housekeeping gene promoters. They lack tissue-specific enhancers, using instead such ubiquitous transcriptional activators as Sp1, AP-2, and NF-1/CTF. Obviously, this raises the possibility that they are repressed in nonepithelial cells, perhaps including poorly differentiated carcinomas, by tissue-specific repressor proteins. The E-cadherin promoter is a case in point. This promoter is transcriptionally downregulated in a diversity of human tumor cells, substantially contributing to tumor malignancy. The proximal promoter elements recapitulate the behavior of the gene in transient transfection experiments and is organized simply as follows (Giroldi et al., 1997): ⫺80 E-box2
NF1/CTF
Sp1
GCAGGTGGAACCCTCAGCCAATCAGCGGTACGGGGGGCGGTGCTCCGGGGCT E-box1 CACCTGGCT
The wild-type promoter just depicted is more active in E-cadherin-expressing epithelial cells than in carcinoma cells or fibroblasts (Giroldi et al., 1997). However, mutations of both E-boxes increase the transcriptional activity of the promoter and result in promiscuous expression in all cell types. Moreover, transformation of MDCK epithelial cells by activated ras represses the promoter through the two E-boxes (Grooteclaes and Frisch, 2000). The fusion of E-cadherin-expressing with nonexpressing cell lines reveals dominant repression of the promoter through its E-boxes as well (Hajra et al., 1999). These data predict the existence of an oncogene-responsive, cell type-restricted repressor of E-cadherin transcription. Two possible repressors of the E-cadherin promoter have been identified as ␦EF1/ZEB (Grooteclaes and Frisch, 2000)—a zinc finger homeodomain repressor involved in muscle and lymphocyte gene repression—or mSna (Cano et al., 2000; Batlle et al., 2000), the mouse homologue of the Drosophila zinc finger repressor protein Snail. We identified ␦EF1/ZEB as follows. The C terminus of E1a binds a cellular corepressor protein called C-terminal binding protein (CtBP) (Schaeper et al., 1995; Turner and Crossley, 1998; Nibu et al., 1998; Poortinga et al., 1998) and, in doing so, severs the interaction between CtBP and various repressors (causing derepression). The interaction of E1a with CtBP partially suppresses transformation by the oncogenic domains of E1a (in cis) (Boyd et al., 1993) and preserves the epithelial phenotype in primary epithelial cells transfected with E1a (Gopalakrishnan and Quinlan, 1995). We observed that this interaction was also
Adenovirus E1a Protein
43
required for the induction of E1a of several epithelial gene promoters, including E-cadherin, in human tumor cells (Frisch and Grooteclaes, 2000). This implicated an E-box- and CtBP-interactive repressor protein in E-cadherin regulation, both properties possessed by ␦EF1/ZEB (Remacle et al., 1999; Postigo and Dean, 1999). Our gel mobility shift/antibody supershift and transient transfection results supported this identification. The second candidate E-cadherin repressor, mSna, was identified independently by the use of yeast one hybrid screening for E-box-binding proteins, followed by transient transfection and gel shift studies (showing that the transfected gene, but not necessarily the endogenous gene, had E-cadherin repressor activity). While the mechanism of repression by ␦EF1/ZEB clearly involves recruitment of CtBP (Postigo and Dean, 1999), which explains the derepression by E1a neatly, the mechanism of repression by mSna is not yet understood. (The Drosophila Snail homologue recruits CtBP, but mammalian Snail has been shown not to do so or does not possess obvious CtBP-binding motifs.) In any event, E1a apparently derepresses the E-cadherin promoter, either through displacement of CtBP or through interference with another repression complex. The other epithelial promoters that E1a derepresses do not necessarily interact with the same repressor, although, surprisingly, the overexpression of mSna downregulated not only E-cadherin but also plakoglobin, desmoplakin, and vimentin in MDCK cells (Cano et al., 2000; Batlle et al., 2000). Considering that CtBP and ␦EF1/ZEB both target numerous nonepithelial as well as epithelial promoters, how does E1a specifically activate the latter? This may be easily understood by considering two points. First, the epithelial promoters use ubiquitous transactivator proteins, so they are poised to be activated by derepression (reviewed in Frisch, 1997). In contrast, the induction of tissue-specific (e.g., muscle) genes would require both derepression and activation by tissue-specific transactivators. The latter are not necessarily expressed in the tumor cell lines used in these experiments. Moreover, even if they were expressed, tissue-specific activators (e.g., myoD) require coactivator proteins such as p300/CBP or P/CAF for activation (cf. (Puri et al., 1997). These coactivators are inhibited by the N-terminal 80 amino acids of E1a, which interact directly with them (O’Connor et al., 1999). In contrast, at least two of the transactivators used by epithelial promoters, Sp1 and NF1/CTF, function independently of the aforementioned coactivators and are not inhibited by E1a (Alevizopoulos et al., 1995; Hartzog and Winston, 1997). Hence, the net result of E1a expression expected in human tumor cells would be conversion to an epithelial phenotype, as is observed experimentally. How does epithelial conversion by E1a benefit adenovirus? Superficially, one possibility is that E1a allows the adenovirus to infect a nonepithelial cell (e.g., a fibroblast) and transcriptionally convert it into an epithelial cell, a
44
Steven M. Frisch
more permissive environment for the completion of viral transcription and replication. Perhaps a more mechanistically satisfying explanation is that repressed chromatin domains such as heterochromatin tend to be late-replicating. In principle, E1a may serve to displace repressors, reducing the risk of the adenovirus genome being packaged into such domains and promoting early replication of the virus. A by-product of this derepression is the activation of the epithelial gene program.
V. ANOIKIS-SENSITIZATION AND TUMOR SUPPRESSION BY E1a It has been found that the interaction of E1a with CtBP is required for sensitizing certain tumor cell lines to anoikis (Grooteclaes and Frisch, 2000). Cells that are anoikis sensitive, including most normal epithelial cells, are inherently incapable of generating metastatic tumors (reviewed in Frisch and Ruoslahti, 1997). Thus, the anoikis sensitization effect of E1a logically would be expected to suffice for tumor suppression. This has not yet been confirmed because the expression of the CtBP-binding domain alone is cytotoxic (and perhaps proapoptotic, even when expressed at low levels.) Interestingly, the N-terminal 80 amino acids of E1a, which binds p300/CBP and P/CAF, has its own tumor suppressor activity that functions without sensitizing cells to anoikis (Grooteclaes and Frisch, 2000). This is particularly surprising in light of the reported cell cycle progression effect of the E1a– p300 interaction (Howe et al., 1990), and one may need to invoke a “growth signal imbalance” model—analogous to that of c-myc overexpression—to explain it. Alternatively, an intriguing new possibility is that E1a stimulates the DNA-binding activity of p50E4F, a cellular repressor that, when overexpressed with E1a, enhances growth factor deprivation-induced cell death (Fernandez and Rooney, 1999); further analysis of the role of p50E4F will require mapping of the E1a domains involved. The mechanism of anoikis-sensitization is currently under investigation, and there are some compelling leads. Anoikis-sensitization in normal epithelial cells requires prior cell–cell contact, presumably resulting in a gene expression phenotype that is favorable for apoptosis (Frisch and Francis, 1994; Frisch and Ruoslahti, 1997). As mentioned earlier, E1a induces cell adhesion genes, but to levels not likely to cause anoikis-sensitivity. This leaves the question of how to define an “apoptosis-favorable transcriptional phenotype.” In other words, is the key parameter here the expression of individual apoptotic regulators, such as bcl-2 family members, IAPs, caspases, or death receptors? Alternatively, is the key parameter the subnuclear domain structure, which in some cases (e.g., PML bodies; Wang et al., 1998) can respond dy-
Adenovirus E1a Protein
45
namically to extracellular stimuli and act as a rheostat to set the cellular threshold for apoptosis? For that matter, can repressed chromatin domains involving corepressors (cf. Ikaros–heterochromatin–immunoglobulin enhancer complexes) (Brown et al., 1997) also control this threshold? The possibility that global alterations in chromatin structure may influence apoptosis is attractive to consider in light of the multifunctional nature of CtBP as a corepressor. Aside from recruiting histone deacetylases (Sundqvist et al., 1998), CtBP can also recruit a protein called CtIP (Schaeper et al., 1998). Although the precise function of this protein is known, it has limited homology to certain DNA repair enzymes and interacts physically and functionally with the C-terminus of the BRCA1 tumor suppressor, perhaps contributing to the latter’s regulation of apoptosis (Yu et al., 1998; Wong et al., 1998). CtBP can also potentially recruit Ku70 (Schaeper et al., 1998), a regulatory subunit of DNA-dependent protein kinase (DNA-PK) and a human homologue of a yeast protein that is involved in telomeric and silent mating type locus silencing (Taukamoto et al., 1997). This, again, may globally affect chromatin structure, influencing apoptosis. Finally, CtBP can homodimerize, affording access of one repressor to numerous possible effectors of repression (Sewalt et al., 1999). For example, ␦EF1/ZEB could, in principle, recruit CtBP to the E-cadherin promoter. This CtBP molecule could interact with another CtBP molecule, and the second could recruit the heterochromatin-interacting protein, HPC-2 (Sewalt et al., 1999). HPC-2 could in turn recruit the complex to repressive heterochromatin. The investigation of how the chromatin structure (in particular, subnuclear domain structure) affects apoptosis is in its infancy, but may prove critical to understanding the mechanism of apoptotic sensitizers such as E1a. Not mutually exclusive is the possibility that the epithelial conversion domain of E1a (i.e, the CtBP-interacting domain) regulates the expression of key apoptotic proteins. For example, the oncogenic transcriptional repressor Gfi-1 has a repression domain homologous to that in the putative E-cadherin repressor, mSna; interestingly, Gfi-1 inhibits apoptosis by repressing Bax expression (Grimes et al., 1996). If mSna acts similarly, then E1a might be expected to induce Bax by countering the mSna effect and thus sensitize cells to anoikis. The snail family member Slug is highly antiapoptotic (Inukai et al., 1999), by mechanisms that are not yet understood; E1a could promote apoptosis by interfering with candidate repressors of the epithelial transcription such as these. Alternatively, E1a sensitizes cells to TNF-induced apoptosis by inhibiting NF-B activity (Shao et al., 1999) or to radiation by activating, through interaction with Rb protein, the apoptotic sensitization potential of E2F (Pruschy et al., 1999). A p53 modulatory mechanism for anoikis sensitization is unlikely in light of the p53 mutant status of most or all of the tumor cells lines sensitized by E1a. Clearly, a concerted biochemical and genetic effort will be required to elu-
46
Steven M. Frisch
cidate the mechanism by which E1a sensitizes cells to anoikis. It will be worthwhile. Numerous oncogenes cause the breakdown of the epithelial phenotype at levels ranging from cell adhesion molecules to transcription factors. Embodied in this phenomenon is an important key to understanding carcinomas, the major human cancer: why is a fully programmed epithelial cell more sensitive to apoptosis than a poorly differentiated carcinoma cell? This cannot result solely from in vivo selection because oncogenes that compromise the epithelial phenotype can frequently confer apoptosis resistance in culture. The reversal of this resistance by reprogramming the epithelial phenotype may prove useful for designing new cancer therapies. In this connection E1a also sensitizes tumor cells to apoptosis induced by drugs such as etoposide and cisplatin (Frisch and Dolter, 1995), which may perhaps be exploited to augment their therapeutic efficacy.
REFERENCES Alevizopoulos, A., Dusserre, Y., Tsai-Pflugfelder, M., von der Weid, T., Wahli, W., and Mermod, N. (1995). A proline-rich TGF--responsive transcriptional activator interacts with histone H3. Genes Dev. 9, 6051– 3066. Batlle, E., Sancho, E., Franci, C., Dominguez, D., Monfar, M., Baulida, J., and de Herreros, A. (2000). The transcription factor Snail is a repressor of E-cadherin gene expression in epithelial tumor cells. Nature Cell Biol. 2, 84 – 89. Bayley, S. T., and Mymryk, J. S. (1994). Adenovirus E1A proteins and transformation. Int. J. Oncol. 5, 425–444. Birchmeier, W., Hulsken, J., and Behrens, J. (1995). Adherens junction proteins in tumor progression. Cancer Surv. 24, 129 –140. Boyd, J., Subramanian, T., Schaeper, U., La Regina, M., Bayley, S., and Chinnadurai, G. (1993). A region in the C-terminus of adenovirus 2/5 E1a protein is required for association with a cellular phosphoprotein and important for the negative modulation of T24-ras mediated transformation, tumorigenesis and metastasis. EMBO J. 12, 469 – 478. Brown, K., Guest, S., Smale, S., Hahm, K., Merkenschlager, M., and Fisher, A. (1997). Association of transcriptionally silent genes with Ikaros complexes at centromeric heterochromatin. Cell 91, 845 –854. Bullions, L., and Levine, A. (1998). The role of beta-catenin in cell adhesion, signal transduction and cancer. Curr. Opin. Oncol. 10, 81– 87. Cano, A., Perez-Moreno, M., Rodrigo, I., Locascio, A., Blanco, M., del Barrio, M., Portillo, F., and Nieto, M. (2000). The transcription factor Snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nature Cell Biol. 2, 76 – 83. Christofori, G., and Semb, H. (1999). The role of the cell-adhesion molecule E-cadherin as a tumor-suppressor gene. Trends Biochem. Sci. 24, 73 –77. Deng, J., Xia, W., and Hung, M.-C. (1998). Adenovirus 5 E1a-mediated tumor suppression associated with E1a-mediated apoptosis in vivo. Oncogene 17, 2167–2175. Fernandez, E., and Rooney, R. (1999). Suppression of E1a-mediated transformation by the p50E4F transcription factor. Mol. Cell Biol. 19, 4739– 4749. Frisch, S. (1991). Antioncogenic effect of adenovirus E1A in human tumor cells. Proc. Natl. Acad. Sci. USA 88, 9077– 9081.
Adenovirus E1a Protein
47
Frisch, S. (1997). The epithelial cell default-phenotype hypothesis and its implications for cancer. BioEssays 19, 705 –709. Frisch, S., and Ruoslahti, E. (1997). Integrins and anoikis. Curr. Opin. Cell Biol. 9, 701–706. Frisch, S. M. (1994). E1a induces the expression of epithelial characteristics. J. Cell Biol. 127, 1085–1096. Frisch, S. M., and Dolter, K. E. (1995). Adenovirus E1a-mediated tumor suppression by a c-erbB-2/neu-independent mechanism. Cancer Res. 55, 5551– 5555. Frisch, S. M., and Francis, H. (1994). Disruption of epithelial cell-matrix interactions induces apoptosis. J. Cell Biol. 124, 619 – 626. Frisch, S. M., Reich, R., Collier, I. E., Genrich, L. T., Martin, G., and Goldberg, G. I. (1990). Adenovirus E1A represses protease gene expression and inhibits metastasis of human tumor cells. Oncogene 5, 75 – 83. Giroldi, L., Bringuier, P., Weijert, M., Jansen, C., Bokhoven, A., and Schalken, J. (1997). “Role of E Boxes in the Repression of E-Cadherin Expression.” Biochem. Biophys. Res. Commun. 241, 453–458. Gopalakrishnan, S., and Quinlan, M. (1995). Modulation of E-cadherin localization in cells expressing wild-type E1A 12S or hypertransforming mutants. Cell Growth Differ. 6, 985 – 998. Graham, F. L., Smiley, J., Russell, W. C., and Nairn, R. (1977). Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J. Gen. Virol. 36, 59 –74. Grimes, H., Gilks, C., Chan, T., Porter, S., and Tsichlis, P. (1996). The Gfi-1 protooncoprotein repress Bax expression and inhibits cell death. Proc. Natl. Acad. Sci. USA 93, 14569 –14573. Guilford, P. (1999). E-cadherin downregulation in cancer: Fuel on the fire? Mol. Med. Today 5, 172–176. Grooteclaes, M., and Frisch, S. M. (2000). Evidence for a function of CtBP in epithelial gene regulation and anoikis. Oncogene, in press. Gumbiner, B. M. (1997). Carcinogenesis: A balance between beta-catenin and APC. Curr. Biol. 7, R443–R446. Hajra, K., Ji, X., and Fearon, E. (1999). Extinction of E-cadherin expression in breast cancer via a dominant repression pathway acting on proximal promoter elements. Oncogene 18, 7274–7279. Hartzog, G., and Winston, F. (1997). Nucleosomes and transcription: recent lessons from genetics. Curr. Opin. Genet. Dev. 7, 192–198. Howe, J., Mymryk, S., Egan, C., Branton, P., and Bayley, S. (1990). Rb and p300 appear to regulate cellular DNA synthesis. Proc. Natl. Acad. Sci. USA 87, 5883 – 5887. Inukai, T., Inoue, A., Kurosawa, H., Goi, K., Shinjyo, T., Ozawa, K., Mao, M., Inaba, T., and Look, A. (1999). SLUG, a ces-1-related zinc finger transcription factor gene with antiapoptotic activity, is a downstream target of the E2a-HLF oncoprotein. Mol. Cell 4, 343 – 352. Jankowski, J., Bruton, R., Shepherd, N., and Sanders, D. (1997). Cadherin and catenin biology represent a global mechanism for epithelial cancer progression. J. Clin. Pathol. 50, 289 – 290. Leone, A., Flatow, U., VanHoutte, K., and Steeg, P. S. (1993). Transfection of human nm23-H1 into the human MDA-MB-435 breast carcinoma cell line: Effects on tumor metastatic potential, colonization and enzymatic activity. Oncogene 8, 2325 –2333. Maruyama, K., Schiavi, S. C., Huse, W., Johnson, G. L., and Ruley, H. E. (1987). Myc and E1A oncogenes alter the responses of PC12 cells to nerve growth factor and block differentiation. Oncogene 1, 361– 367. Montano, X., and Lane, D. (1987). The adenovirus E1a gene induces differentiation of F9 teratocarcinoma cells. Mol. Cell Biol. 7, 1782–1790. Nibu, Y., Zhang, H., Bajor, E., Barolo, S., Small, S., and Levine, M. (1998). dCtBP mediates transcriptional repression by Knirps, Kruppel and Snail in the Drosophila embryo. EMBO J. 17, 7009.
48
Steven M. Frisch
O’Connor, M., Zimmerman, H., Nielsen, S., Bernard, H., and Kouzarides, T. (1999). Characterization of an E1a-CBP interaction defines a novel transcriptional adaptor motif (TRAM) in CBP/p300. J. Virol. 73, 3574– 3581. Poortinga, G., Watanabe, M., and Parkhurst, S. (1998). Drosophila CtBP: A Hairy-interacting protein required for embryonic segmentation and Hairy-mediated transcriptional repression. EMBO J. 17, 2067–2078. Postigo, A., and Dean, D. (1999). ZEB represses transcription through interaction with the corepressor, CtBP. Proc. Natl. Acad. Sci. USA 96, 6683 – 6688. Pozzatti, R., Muschel, R., Williams, J., Padmanabhan, R., Howard, B., Liotta, L., and Khoury, G. (1986). Primary rat embryo cells transformed by one or two oncogenes show different metastatic potentials. Science 232, 223 –227. Pruschy, M., Wirbelauer, C., Glanzmann, C., Bodis, S., and Krek, W. (1999). E2F-1 has properties of a radiosensitizer and its regulation by cyclin A kinase is required for cell survival of fibrosarcoma cells lacking p53. Cell Growth Differ. 10, 141–146. Puri, P., Sartorelli, V., Yang, X., Hamamori, Y., Ogryzko, V., Howard, B., Kedes, L., Wang, J., Graessmann, A., Nakatani, Y., and Levrero, M. (1997). Differential Roles of p300 and PCAF Acetyltransferases in Muscle Differentiation. Mol. Cell 1, 35 – 45. Rao, L., Debbas, M., Sabbatini, P., Hockenbery, D., Korsmeyer, S., and White, E. (1992). The adenovirus E1A proteins induce apoptosis, which is inhibited by the E1B 19-kDa and Bcl-2 proteins [published erratum appears in Proc. Natl. Acad. Sci. USA 1992 Oct 15;89(20): 9974]. Proc. Natl. Acad. Sci. USA 89, 7742–7746. Remacle, J., Kraft, H., Lerchner, W., Wuytens, G., Collart, C., Verschueren, K., Smith, J., and Huylebroeck, D. (1999). New mode of DNA binding of multi-zinc finger transcription factors: delta EF1 family members bind with two hands to two traget sites. EMBO J. 18, 5073 – 5084. Reynolds, T., Alberts, D., Gershenson, D., Gleich, L., et al. (2000). Activity of E1a in Human Clinical Trials. Proc. of Amer. Soc. Clin. Oncol. 19, 461a (ab. 1809). Sandmoeller, A., Meents, H., and Arnold, H. (1996). A novel E1a domain mediates skeletalmuscle-specific enhancer repression independently of Rb and p300 binding. Mol. Cell Biol. 16, 5846–5856. Schaeper, U., Boyd, J., Verma, S., Uhlmann, E., Subramanian, T., and Chinnadurai, G. (1995). Molecular cloning and characterization of a cellular phosphoprotein that interacts with a conserved C-terminal domian of adenovirus E1A involved in negative modulation of oncogenic transformation. Proc. Natl. Acad. Sci. USA 92, 10467–10471. Schaeper, U., Subramanian, T., Lim, L., Boyd, J., and Chinnadurai, G. (1998). Interaction between a cellular protein that binds to the C-terminal region of adenovirus E1A (CtBP) and a novel cellular protein is disrupted by E1A through a conserved PLDLS motif. J. Biol. Chem. 273, 8549–8552. Sewalt, R., Gunster, M., Vlag, J., Satijn, D., and Otte, A. (1999). C-terminal binding protein is a transcriptional repressor that interacts with a specific class of vertebrate polycomb proteins. Mol. Cell Biol. 19, 777–787. Shao, R., Hu, M., Zhou, B., Lin, S., Chiao, P., von Lindern, R., Spohn, B., and Hung, M. C. (1999). E1a sensitizes cells to TNF-induced apoptosis through inhibition of IKB kinases and NF-KB activities. J. Biol. Chem. 274, 21495 –21498. Sundqvist, A., Sollerbrant, K., and Svensson, C. (1998). The carboxy-terminal region of adenovirus E1A activates transcription through targeting of a C-terminal binding protein-histone deacetylase complex. FEBS Lett. 429, 183 –188. Taukamoto, Y., Kato, J., and Ikeda, H. (1997). Silencing factors participate in DNA repair and recombination in Saccharomysces cerevisiae. Nature 388, 900 – 903. Turner, J., and Crossley, M. (1998). Cloning and characterization of mCtBP2, a co-repressor that associates with basic Kruppel-like factor and other mammalian transcriptional regulators. EMBO J. 17, 5129 – 5140.
Adenovirus E1a Protein
49
Wang, Z., Ruggero, D., Ronchetti, S., Zhong, S., Gaboli, M., Rivi, R., and Pandolfi, P. (1998). Pml is essential for multiple apoptotic pathways. Nature Genet. 20, 266 –272. Wong, A., Ormonde, P., Pero, R., Chen, Y., Lian, L., Salada, G., Berry, S., Lawrence, Q., Dayananth, P., Ha, P., Tavtigian, S., Teng, D., and Bartel, P. (1998). Characterization of a carboxy-terminal BRCA1 interacting protein. Oncogene 17, 2279 –2285. Yu, D. H., Scorsone, K., and Hung, M. C. (1991). Adenovirus type 5 E1A gene products act as transformation suppressors of the neu oncogene. Mol. Cell Biol. 11, 1745 –1750. Yu, X., Wu, L., Bowcock, A., Aronheim, A., and Baer, R. (1998). The C-terminal (BRCT) domains of BRCA1 interact in vivo with CtIP, a protein implicated in the CtBP pathway of transcriptional repression. J. Biol. Chem. 273, 25388 –25392.
This Page Intentionally Left Blank
Comparative Analysis of the Transforming Mechanisms of Epstein–Barr Virus, Kaposi’s Sarcoma-Associated Herpesvirus, and Herpesvirus Saimiri Blossom Damania and Jae U. Jung Department of Microbiology and Molecular Genetics New England Regional Primate Research Center Harvard Medical School Southborough, Massachusetts 01772
I. Introduction II. Comparative Analysis of Gamma Herpesvirus Gene Products A. Transforming Genes B. Viral Signal Modulators C. Viral Homologues of Cellular Genes D. Unique Genes III. Conclusion References
Members of the gamma herpesvirus family include the lymphocryptoviruses (gamma1 herpesviruses) and the rhadinoviruses (gamma-2 herpesviruses). Gammaherpesvirinae uniformly establish long-term, latent, reactivatable infection of lymphocytes, and several members of the gamma herpesviruses are associated with lymphoproliferative diseases. Epstein–Barr virus is a lymphocryptovirus, whereas Kaposi sarcoma-associated herpesvirus and Herpesvirus saimiri are members of the rhadinovirus family. Genes encoded by these viruses are involved in a diverse array of cellular signaling pathways. This review attempts to cover our understanding of how viral proteins deregulate cellular signaling pathways that ultimately contribute to the conversion of normal cells to cancerous cells. © 2000 Academic Press.
I. Introduction Herpesviruses are a diverse group of DNA viruses that differ in their biology and disease potentials. A hallmark of herpesviruses is their ability to establish a life-long latent infection in their respective hosts. Pathogenesis Advances in CANCER RESEARCH Vol. 80 0065-230X/01 $35.00
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
52
Blossom Damania and Jae U. Jung
Fig. 1 Classification of herpesviruses. A phylogenetic tree depicting the three subfamilies of herpesviruses: alpha, beta, and gamma. The phylogram was constructed using the viral DNA polymerase gene by parsimony analysis using the neighbor-joining method. The number of amino acid changes can be determined using the scale shown at the bottom of the tree.
caused by these viruses is usually seen in the context of host immunosuppression or cross-species transmission. These viruses share a common evolutionary origin that is evident by the homology seen in a substantial number of herpesviral genes. Based on genomic organization and biological characteristics, herpesviruses are classified into three subfamilies: alpha, beta, and gamma (Fig. 1). The gamma herpesviruses are lymphotropic and some are capable of undergoing lytic replication in epithelial or fibroblast cells. The gammaherpesvirinae are grouped into two classes: lymphocryptoviruses (gamma-1) and rhadinoviruses (gamma-2). The lymphocryp-
EBV, KSHV, and HVS
53
toviruses include Epstein–Barr virus [EBV or human herpesvirus 4 (HHV4)], lymphocryptovirus of rhesus monkeys, and herpesvirus papio of baboons, whereas the rhadinovirus subgroup includes herpesvirus saimiri (HVS), Kaposi’s sarcoma-associated herpesvirus [KSHV or human herpesvirus 8 (HHV8)], rhesus monkey rhadinovirus (RRV), and mouse herpesvirus 68 (MHV68). The most widely studied gammaherpesviruses so far have been EBV, KSHV, and HVS. All three viruses have been shown to be associated with a wide variety of cancers. Both HVS and EBV have also been shown to transform lymphoid cells in culture and to induce lymphoproliferative diseases in the natural or experimental host. EBV has been shown to be associated with various diseases in humans (Burkitt, 1967; Epstein et al., 1964; LekstromHimes et al., 1996). These include infectious mononucleosis (IM), Burkitt’s lymphoma (BL), nasopharyngeal carcinoma (NPC), Hodgkin’s disease, and T-cell lymphomas (Ablashi et al., 1985a; Blacklow et al., 1971; Magrath, 1992; Magrath et al., 1992; Mueller, 1991; Mueller et al., 1989; Pallesen et al., 1993; Rickinson et al., 1987; Yao et al., 1989). Although primary EBV infection is normally asymptomatic, a proportion of EBV-infected individuals develop IM, a disease characterized by lymphadenopathy and fatigue, later in life. A rare disease called fatal IM or X-linked lymphoproliferative (XLP) syndrome is a malignancy that involves uncontrolled immunoblastic lymphomas driven by EBV-infected B cells (Purtilo et al., 1975). Burkitt’s lymphoma is a malignancy that predominantly affects children living in some regions of Africa that have a high incidence of malaria (Burkitt, 1967). The majority of BL tumors are EBV positive and are often characterized by distinct chromosomal translocations of the c-myc oncogene and immunoglobulin promoter sequences, resulting in the deregulation of c-myc expression (Dalla-Favera et al., 1987). Another EBV-associated disease is NPC, a malignancy of the squamous epithelium situated in the nasopharynx (RaabTraub et al., 1983; Pagano, 1994). Clonal expansion of latently infected cells gives rise to an epithelial dysplasia (Pathmanathan et al., 1995; Raab-Traub, 1989). The incidence of NPC is high in southern China, northern Africa, and Eskimo populations. Hodgkin’s disease is the most common malignancy in the Western world. The EBV genomes in these tumor cells are monoclonal (Weiss and Chang, 1992). In addition, EBV infection often leads to serious problems in immunosuppressed individuals. EBV-positive immunoblastic lymphomas in HIV-infected individuals are frequent, and about 100% of immunoblastic lymphomas of immunosuppressed posttransplant patients contain the virus. Finally, EBV, a primarily B-cell tropic virus, has also been detected in some types of human T-cell lymphomas. About 100% of nasal T-cell lymphomas in southeast Asia and 100% of T-cell tumors in XLP males contain the virus. Since 1994, KSHV DNA sequences have been widely identified in KS tu-
54
Blossom Damania and Jae U. Jung
mors from HIV-positive and HIV-negative patients (Chang et al., 1994; Moore and Chang, 1995; Staskus et al., 1997). In addition, KSHV has also been found consistently in specific lymphoproliferative diseases such as pleural effusion lymphomas (PELs) or body cavity-based lymphomas (BCBLs) and lymphoblastic variants of multicentric Castleman’s disease (MCD) (Cesarman et al., 1995; Gessain et al., 1996; Neipel et al., 1998; Pastore et al., 1995; Soulier et al., 1995). While it is still controversial, KSHV has also been shown to be associated with multiple myeloma (Dupin et al., 1999; Mitterer et al., 1998; Whitby et al., 1997). BCBLs were first identified in AIDS patients and were later found to have a high incidence of EBV and KSHV coinfection, although some lymphomas were only positive for KSHV (Cesarman et al., 1995; Knowles et al., 1989). BCBLs are thought to be monoclonal B cells in origin and lack many B lymphocyte antigens such as CD19, CD20, and lymphocyte homing and adhesion markers (Boshoff and Weiss, 1998; Drexler et al., 1998). MCD is an atypical lymphoproliferative disorder that includes hyperplasia, lymphadenopathy, and splenomegaly. Both HIV-infected and uninfected individuals develop MCD, although there is a high rate of KSHV infection in the lymph nodes of HIV patients with MCD (Cesarman and Knowles, 1997; Kikuta et al., 1997; Soulier et al., 1995). MCD is also principally or exclusively of B-cell origin. Different from these lymphomas, the KS lesion is composed of a mixed cell phenotype. One unusual cell consistently present is a spindle-shaped cell of endothelial origin. Whereas cells cultured from KS lesions do not contain KSHV, spindle cells in the KS lesion do contain KSHV genetic information. There is a high level of cytokine and chemokine expression within KS lesions and a dependence on these cytokines and chemokines for the maintenance of the lesion (Chang et al., 1994; Noel et al., 1996). In addition, KSHV has been shown to immortalize primary human endothelial cells to long-term proliferation and survival (Flore et al., 1998). A herpesvirus called rhesus monkey rhadinovirus (RRV) has been isolated that is related to but distinct from KSHV (Desrosiers et al., 1997). Two homologues of KSHV from two different macaque species have also been identified in retroperitoneal fibromatosis (Rose et al., 1997; Greensill et al., 2000). These viruses were named retroperitoneal fibromatosisassociated herpesvirus from Macaca nemestrina (RfHVMn) and Macaca mulatta (RFHVMm), respectively (Strand et al., 2000). A complete DNA sequence analysis of RRV shows that it is much closer to KSHV than to HVS or other rhadinoviruses (Alexander, 2000; Searles et al., 2000). HVS resides in the T lymphocytes of its natural host, the squirrel monkey, without causing any disease (Desrosiers and Falk, 1982). However, crossspecies transmission of HVS into other New World primates e.g., common marmosets, tamarins, and owl monkeys, results in rapidly progressing lymphomas, lymphosarcomas, and leukemias (Desrosiers, 1981; Desrosiers et
55
EBV, KSHV, and HVS
al., 1985; Fleckenstein, 1979). Subgroups A and C are highly oncogenic and are able to immortalize common marmoset T lymphocytes to interleukin 2independent growth in vitro (Desrosiers et al., 1985; Duboise et al., 1998b; Jung et al., 1991). HVS-transformed common marmoset cell lines are CD2+, CD8+, CD4-, and CD56+, indicating that they were derived from a population of suppressor/cytotoxic T lymphocytes (Kiyotaki et al., 1986). In addition, HVS subgroup C is also capable of immortalizing human, rabbit, and rhesus monkey lymphocytes into continuously proliferating CD4 and/or CD8-positive T-cell lines (Ablashi et al., 1985b; Biesinger et al., 1992; Duboise et al., 1998b; Mittrucker et al., 1993). They express surface markers of activated T cells and ␣ or ␥␦ T-cell receptors (Biesinger et al., 1992; Klein et al., 1996; Pacheco-Castro et al., 1996; Yasukawa et al., 1995).
II. COMPARATIVE ANALYSIS OF GAMMA HERPESVIRUS GENE PRODUCTS The striking correlation between gamma herpesviruses and disease induction in primates enables a study of the contributions of individual herpesviral genes to cell growth transformation. EBV, KSHV, and HVS contain several transforming genes at equivalent positions in the genome (Table I). These include LMP1, K1, and STP, which are some of the major transforming genes of these viruses. Unlike EBV, KSHV and HVS contain a battery of cellular gene homologues, some of which have been shown to have transforming capabilities in culture. This section lists a description of the function of these genes and their role in viral transformation.
Table I Viral Homologues of Cellular Genes EBV
KSHV
HVS
vBcl-2 vCyclin vIL-10 vCSF-1R
vBcl-2 vCyclin v-NCAM vIL-6 vGCR (vIL-8R) vFlip vCCP vIRF vMIP-1␣,
vBcl-2 vCyclin vCD59 vIL-17 vGCR (vIL-8R) vFlip vCCP vCD59
56
Blossom Damania and Jae U. Jung
A. Transforming Genes A striking feature of these three gamma herpesviruses is that they contain a distinct open reading frame (ORF) at the left end of their respective genomes, each of which has characteristic transforming ability. These include the latent membrane protein-1 (LMP1) of EBV, K1 of KSHV, and saimiri transformation protein (STP) of HVS. However, this functional conservation exists in the complete absence of any sequence homology. In addition, the STP, LMP1, and K1 proteins exhibit high sequence divergence among individual viral isolates (Biesinger et al., 1995; Desrosiers et al., 1985, 1986; Franken et al., 1996; Kasolo et al., 1998; Lagunoff and Ganem, 1997; Nicholas et al., 1997a, 1998; Palefsky et al., 1996; Zong et al., 1999). This is likely a result of their proximity to the terminal repeats of the viral genome, a region of high mutagenicity arising from the fact that these repetitive sequences undergo homologous recombination during the viral life cycle.
1. EBV LMP1 The first ORF of EBV encodes a well-characterized transforming protein, LMP1. The LMP1 protein has six transmembrane-spanning domains and a 199 amino acid cytoplasmic domain. LMP1 has been shown to transform rodent fibroblasts and be essential for the immortalization of primary B lymphocytes to lymphoblastoid cell lines (LCLs) (Baichwal and Sugden, 1988; Wang et al., 1985, 1988). LMP1 has been shown to mimic the B lymphocyte activation marker CD40 receptor (Gires et al., 1997; Hatzivassiliou et al., 1998; Kilger et al., 1998). Like CD40 and other members of the tumor necrosis factor receptors (TNF-Rs), the C-terminal domain of LMP1 is capable of interacting with TNF receptor-associated factors (TRAFs), with TNF receptor-associated death domain (TRADD), and with receptor-interacting protein (RIP) (Devergne et al., 1996, 1998; Eliopoulos et al., 1996, 1999; Izumi et al., 1997, 1999; Sandberg et al., 1997) (Fig. 2). Despite constitutive association with TRADD or RIP, LMP1 does not induce apoptosis in EBVnegative Burkitt lymphoma or human embryonic kidney 293 cells (Izumi et al., 1999). The interaction of LMP1 with TRAFs and TRADD has been shown to be essential for the activation of the NF-B pathway and for the EBV-induced immortalization of B lymphocytes. However, unlike CD40, the transduction of signals occurs in the absence of extracellular ligands or crosslinking. This is caused by multimerization of the LMP1 protein through its transmembrane domains, a property that mimics ligand-induced CD40 receptor aggregation (Fig. 2). Multimerization generates a constitutively active signal that results in pleiotropic effects, including the activation of NF-B and JNK activity and the induction of bcl-2, bclx, mcl1, and A20 gene ex-
EBV, KSHV, and HVS
57
Fig. 2 Schematic representation of LMP1, STP, K1, and R1 proteins. Interactions with cellular partners and activation of cellular pathways are indicated. Y-P represents the presence of phosphorylated tyrosine residues in K1 and R1.
pression (Eliopoulos et al., 1999; Eliopoulos and Young, 1998; Floettmann et al., 1996; Fries et al., 1999; Hatzivassiliou et al., 1998; Hsu et al., 1995; Huen et al., 1995; Izumi et al., 1997; Izumi and Kieff, 1997; Laherty et al., 1992; Takeshita et al., 1999). Hence, by mimicking the function of the B lymphocyte CD40 receptor, LMP1 contributes to EBV-induced transformation of primary B lymphocytes.
58
Blossom Damania and Jae U. Jung
2. HVS STP Sequence divergence at the left end of the viral genome defines three subgroups—A, B, and C of HVS—that differ with respect to their oncogenic potential. Subgroups A and C but not B immortalize common marmoset lymphocytes to IL-2-independent permanent growth. The first open reading frame of the HVS genome codes for distinct saimiri transformation proteins (STPs) in all three subgroups (Desrosiers et al., 1984, 1985; Koomey et al., 1984; Murthy et al., 1989). Deletion of STP genes from subgroup A and C viruses results in viruses that are capable of replication but unable to induce lymphomas in common marmosets and transform common marmoset T lymphocytes in vitro (Duboise et al., 1998b; Murthy et al., 1989). STP of HVS subgroup C, STP-C, can transform Rat-1 cells, resulting in an apparent loss of contact inhibition, formation of foci, growth at reduced serum concentrations, and formation of invasive tumors in nude mice. STP of HVS subgroup A, STP-A, is less potent than STP-C in its transforming ability (Jung et al., 1991). Furthermore, transgenic mice expressing STP-A developed peripheral pleomorphic T-cell lymphomas, whereas transgenic mice expressing STP-C developed extensive epithelial cell tumors and lymphomas. Both STP-A and STP-C proteins are predicted to have three distinct domains: an acidic amino terminus, collagen-like repeats in the central region, and a hydrophobic carboxy terminus. The primary amino acid sequence of STP-A11 has nine copies of a collagen-like motif (Gly-X-Y, where X and/or Y is a proline residue) that are not contiguous. In STP-C488 it is directly repeated 18 times and comprises more than 50% of the protein. These collagen-like repeats are inferred to form a long fibrous oligomeric structure, which can mimic a ligand-induced, constitutively active receptor (Choi, in press). The STP-A and STP-C proteins also contain a hydrophobic stretch at their carboxy termini sufficient for anchoring to a membrane (Fig. 2). As a result of its essential role in HVS transformation, STP-C has been studied extensively. It has been shown to associate with cellular ras ( Jung and Desrosiers, 1995) and this interaction is critical for its transforming activity in cell culture (Fig. 2). Furthermore, oncogenic v-ras can complement the HVS STP oncogene to induce lymphocyte transformation and does so more efficiently than normal c-ras (Guo et al., 1998). STP-C has also been shown to activate NF-B transcriptional activity by interacting with TRAFs 1, 2, and 3 (Fig. 2) (Lee et al., 1999a).
3. KSHV K1 At a position equivalent to HVS STP and EBV LMP1, KSHV contains a distinct open reading called K1 (Lagunoff and Ganem, 1997; Lee et al.,
EBV, KSHV, and HVS
59
1998b). K1 is a 46-kDa transmembrane glycoprotein and is predicted to have a signal peptide sequence at the amino terminus, an extracellular domain, a transmembrane domain, and a short cytoplasmic tail at the carboxyl terminus. Sequence analysis has demonstrated that the K1 gene is extremely variable, showing as much as 40% divergence at the amino acid level (Zong et al., 1999). Whereas the extracellular domain of K1 is extremely variable, the cytoplasmic tail is relatively well conserved (Kasolo et al., 1998; Lee et al., 1998b; Nicholas et al., 1997a; Zong et al., 1999). This carboxyterminal cytoplasmic tail contains a functional immunoreceptor tyrosinebased activation motif (ITAM) (Lagunoff et al., 1999; Lee et al., 1998a). The K1 ITAM can transduce signals to induce the nuclear factor of activated T cell (NFAT) activation, calcium mobilization, and tyrosine phosphorylation, events that are indicative of lymphocyte activation (Lagunoff et al., 1999; Lee et al., 1998a). However, unlike other ITAM-based signal transduction events, which require a ligand–receptor interaction, K1 signaling also occurs constitutively (Fig. 2) (Lagunoff et al., 1999). The K1 protein has been shown to interact with several cellular signal transduction proteins, which include vav, p85, and syk kinase (Lee et al., 1998a). In addition to the transformation of rodent fibroblasts, K1 can also functionally substitute for STP in HVS for the immortalization of common marmoset T lymphocytes to IL-2-independent growth and for the induction of lymphomas in common marmosets (Lee et al., 1998b). RRV, the simian homologue of KSHV, also contains a first ORF named R1 with similar transforming and signaling activities as KSHV K1 (Damania et al., 2000; Damania et al., 1999) (Fig. 2). Despite the absence of discernible homology among these transforming proteins, they all share the ability to self-oligomerize. EBV LMP1 has been shown to aggregate through its membrane-spanning domains, mimicking a ligand-induced activated CD40 (Albrecht et al., 1992; Gires et al., 1997; Kilger et al., 1998). KSHV K1 has also been shown to oligomerize through disulfide bonding of its extracellular domain (Lagunoff and Ganem, 1997; Lee et al., 1998a,b). The STP-C protein is capable of oligomerizing through its collagen repeats, and the integrity of this domain has been demonstrated to be essential for the transforming activity of the protein (Choi, in press; Jung and Desrosiers, 1995). However, as an alternative, oligomerization of these proteins may be caused by endogenous ligands expressed on the cell surface. In addition, both LMP1 and STP-C488 can activate the NF-B pathway through binding of TRAFs (Devergne et al., 1996, 1998; Eliopoulos et al., 1996, 1999; Izumi and Kieff, 1997; Lee et al., 1999a; Sandberg et al., 1997), whereas the K1 protein interacts with syk, a major B-cell kinase, to induce cellular tyrosine phosphorylation and B-cell activation events (Fig. 2) (Lagunoff et al., 1999; Lee et al., 1998a). Thus, these proteins share the ability to interact with cellular signal-transducing factors and show a commonality of cellular pathways activated. Through self or ligand-induced oligo-
60
Blossom Damania and Jae U. Jung
merization and interaction with cellular factors, these viral-transforming proteins appear to have adopted and modified cellular pathways as a means of transforming T and B lymphocytes.
B. Viral Signal Modulators With the exception of the HVS tyrosine kinase-interacting protein (Tip) gene, which is located at the left end of the viral genome, genes for EBV latent membrane protein 2A (LMP2A) and KSHV K15 are located at the right end of the viral genomes. The LMP2A, K15, and Tip proteins are all capable of associating with the major B- or T-cell receptor-associated kinases and altering their signaling activity. Cross-linking of the B-cell antigen receptor (BCR) and T-cell antigen receptor (TCR) triggers a signal transduction cascade that leads to the activation of B and T lymphocytes, respectively. The EBV LMP2A, KSHV K15, and HVS Tip proteins can antagonize these signaling events, thus potentially preventing the reactivation of viral lytic infection from latently infected cells.
1. EBV LMP2A LMP2A is expressed in B cells latently infected with EBV (Busson et al., 1992; Sample and Kieff, 1990). LMP2A contains 12 transmembrane domains linked by loops and a short stretch of amino-terminal and carboxy-terminal regions (Fig. 3). LMP2A is expressed in aggregates in the plasma membranes of latently infected B cells. The amino-terminal cytoplasmic region of LMP2A has been shown to contain three tyrosine-based SH2 domain-binding sites, two of which form a functional ITAM (Fruehling and Longnecker, 1997). This motif is tyrosine phosphorylated and is required for LMP2A association with the SH2 domain of lyn, fyn, syk, and csk kinases (Burkhardt
Fig. 3 Schematic representation of LMP2A, Tip, and K15 proteins. Interactions with cellular partners and activation of cellular pathways are indicated. Y-P represents the presence of phosphorylated tyrosine residues in these proteins.
EBV, KSHV, and HVS
61
et al., 1992; Longnecker et al., 1991; Scholle et al., 1999). This interaction has been shown to be necessary for LMP2A activity in the modulation of BCR signaling (Fig. 3) (Beaufils et al., 1993). It has also been suggested that LMP2A is phosphorylated at serine residues by MAPK (Panousis and Rowe, 1997). Whereas LMP2A is dispensable for EBV immortalization of B lymphocytes (Longnecker et al., 1992, 1993a, 1993b), its expression blocks normal BCR signaling in EBV-negative B cells (Fig. 3) (Miller et al., 1993). In addition, studies using EBV-positive B lymphocytes have shown that this signaling block prevents the reactivation of lytic replication, indicating that EBV LMP2A may play a significant role in the establishment and maintenance of viral latency in vivo (Miller et al., 1995; Miller et al., 1994).
2. KSHV K15 KSHV encodes a distinct open reading frame called K15 or latency-associated membrane protein (LAMP), which is located in the same genomic position as the EBV LMP2A (Choi, 1999a; Glenn et al., 1999; Poole et al., 1999). Whereas K15 isolates exhibit a complex splicing pattern, they all consist of 4 to 12 transmembrane-spanning domains and a short stretch of cytoplasmic domain (Fig. 3) (Choi, 1999a; Glenn et al., 1999; Poole et al., 1999). K15 is weakly expressed in latently infected BCBLs, and the level of its expression was increased significantly by TPA stimulation (Choi, 1999a; Glenn et al., 1999). K15 from different KSHV isolates exhibit dramatic sequence variation, showing as much as 60–70% divergence at the amino acid level (Poole et al., 1999). Like EBV LMP2A, the cytoplasmic domain of K15 contains signaling motifs that are highly conserved in most isolates (Poole et al., 1999). These include potential SH2- and SH3-binding motifs and a YASIL sequence (Choi, 1999a; Glenn et al., 1999; Poole et al., 1999). The cytoplasmic domain of K15 is constitutively tyrosine phosphorylated, and the tyrosine residue within the putative SH2-binding motif is indeed a major site of phosphorylation by cellular tyrosine kinases (Choi, 1999a). In addition, experiments with CD8–K15 chimeras indicate that unlike EBV LMP2A, the cytoplasmic domain of K15 is unable to elicit cellular signal transduction upon antibody stimulation. However, like EBV LMP2A, it is capable of inhibiting BCR signal transduction (Choi, 1999a). Thus KSHV K15 is likely to be a distant evolutionary relative of EBV LMP2A (Fig. 3).
3. HVS Tip The HVS tyrosine kinase-interacting protein (Tip) is latently expressed as a bicistronic message with STP in HVS subgroup C virus but not in HVS subgroups A and B. HVS Tip has been shown to associate with a major T-cell tyrosine kinase, lck. Two motifs of Tip are responsible for interacting with
62
Blossom Damania and Jae U. Jung
lck. These include the carboxyl termini of Src family kinase (CSKH) motifs and the SH3-binding motif (Jung et al., 1995a,b). Whereas interaction of Tip with lck leads to the activation of lck tyrosine kinase activity in vitro, stable expression of Tip downregulates the TCR-mediated signal transduction pathway (Fig. 3) (Jung et al., 1995b). This negative effect on lck-mediated TCR signal transduction is enhanced by a point mutation in Tip, with enhanced lck-binding affinity (Guo et al., 1997b). Conversely, a mutation in the lck-binding motif of Tip augments the transforming activity of HVS C488 in vitro and in vivo (Duboise et al., 1998c). This suggests that an interaction of Tip with lck modulates the transforming ability of HVS. In addition, Tip has been shown to interact with the nuclear RNA export factor, Tap (Tip- associated factor), independent of lck binding (Gruter et al., 1998; Yoon et al., 1997). Expression of Tip and Tap in T cells upregulates the expression of cell surface adhesion molecules, leading to lymphocyte aggregation (Yoon et al., 1997). The relevance of the Tip–Tap association for viral transformation remains to be elucidated.
C. Viral Homologues of Cellular Genes Gamma herpesviruses encode homologues of cellular genes that are likely to have been captured from the host. Some of these genes have extensive amino acid similarity to cellular genes whereas others show more diversity. Unlike EBV which contains only a few homologues of cellular genes, KSHV and HVS both contain numerous viral counterparts of cellular genes that may contribute to the deregulation of cellular growth (Tables I and II). In order to compensate for the lack of these viral homologues, EBV appears to upregulate the expression of the cellular genes themselves.
1. VIRUS-ENCODED CYCLINS (vCYCLINS) Cyclins are regulatory subunits of a specific class of cellular kinases and are now known effectors of cellular proliferation. While cyclins were originally identified as proteins of cellular origin, it now appears that many gamma herpesviruses contain a reading frame with sequence homology to cellular cyclins within their genome. The significance of virally encoded cyclins (vCyclins) in viral propagation and pathogenesis is as yet unclear. However, the fact that deregulation of cellular cyclin expression is a known event in tumor development suggests that vCyclins could be part of a mechanism utilized by these viruses to induce tumor formation.
a. EBV BDLF2 Although EBV encodes a viral homologue of the cellular mitotic cyclin B1 (Hayes, 1999), there have been no reports to date of the ability of BDLF2 to participate in EBV-induced transformation or immortalization. However,
EBV, KSHV, and HVS
63
EBV-immortalized B lymphocytes show a 100-fold upregulation in the expression of three genes, cdc-2, cyclin E, and cyclin D2 (Hollyoake et al., 1995). These genes are also upregulated during the normal activation of B lymphocytes. This suggests that EBV exploits the normal program of B-cell activation to induce B-cell proliferation events (Hollyoake et al., 1995). In addition, LMP1, EBNA 2, and EBNA-LP have been shown to upregulate the expression of cyclin D2 (Arvanitakis et al., 1995; Sinclair et al., 1995).
b. KSHV vCyclin KSHV Orf 72 has been shown to encode for a G1 cyclin that forms active kinase complexes with cdk6 (Godden-Kent et al., 1997; Li et al., 1997) and are resistant to CDK inhibitors, p16, p21Cip1, and p27Kip1 (Swanton et al., 1997). In addition, the KSHV v-cyclin–cdk6 complex has been shown to phosphorylate the p27Kip1 inhibitor, inducing destabilization and degradation of this inhibitor (Chang et al., 1996; Ellis et al., 1999; Godden-Kent et al., 1997; Mann et al., 1999; Schulze-Gahmen et al., 1999). The KSHV vcyclin–cdk6 complex has also been shown to phosphorylate Rb and histone (Godden-Kent et al., 1997; Li et al., 1997), thereby inactivating the tumor suppressor function of Rb and bypassing normal cell cycle checkpoints. Finally, KSHV v-cyclin has also been shown to activate expression of cyclin A in quiescent cells and differ from cellular G1 cyclins by initiating pathways to deregulate normal cellular checkpoints (Duro et al., 1999).
c. HVS vCyclin The HVS eclf2 gene product was the first viral cyclin to be identified. It was shown to primarily interact with cdk6 (Jung et al., 1994; Nicholas et al., 1992). Like the KSHV v-cyclin protein, the HVS cyclin protein has also been shown to form active kinase complexes with cdk6, to be resistant to CDK inhibitors, p16, p21Cip1, and p27Kip1 (Swanton et al., 1997), and to strongly phosphorylate Rb and histone H1 ( Jung et al., 1994; Swanton et al., 1997). X-ray crystal structure analysis shows that the putative binding area of the cdk inhibitor p27Kip1 in v-cyclin displayed a differently shaped surface than that in cellular cyclins (Schulze-Gahmen et al., 1999). Alteration of the surface structure of v-cyclin in the cdk inhibitor-binding region may account for the resistance of v-cyclin complexes to cdk inhibitors (SchulzeGahmen et al., 1999). Deletion of the HVS v-cyclin gene from the viral genome did not impair the ability of the mutant virus to replicate or induce T-cell immortalization (A. Ensser, personal communication). Thus, the function of v-cyclin in the HVS life cycle remains to be determined.
2. ANTI-APOPTOTIC GENES: vBcl-2 and vFlip Upon virus infection and replication, the innate ability of infected cells to undergo apoptosis represents an important antiviral defense mechanism. As
64
Blossom Damania and Jae U. Jung
most of the DNA viruses are genetically equipped to prevent this process, the same is true for EBV, KSHV, and HVS. They all contain functional vBcl-2 genes whereas only KSHV and HVS contain viral flice inhibitory proteins (vFlip).
a. vBcl-2 The BHRF1 gene is expressed in the EBV lytic cycle and shows both sequence and functional homology to the Bcl-2 protooncogene (Pearson et al., 1987). Its gene product protects cells against apoptosis (Henderson et al., 1993; Khanim et al., 1997; Tarodi et al., 1994; Theodorakis et al., 1996) and prevents terminal differentiation of epithelial cells (Dawson et al., 1998). The highly conserved nature of BHRF1 among different EBV isolates at both sequence and functional level supports the role of this gene in delaying cell death and facilitating the establishment of virus persistence (Khanim et al., 1997; McCarthy et al., 1996). However, several groups have used mutant viruses that are defective for BHRF1 and have shown that the BHRF1 gene is nonessential for growth transformation of B cells and for virus replication in cell culture (Lee and Yates, 1992; Marchini et al., 1991). Marshall et al. (1999) have reported the finding of a second EBV-encoded ORF called BALF1, which shows homology to cellular Bcl-2 and BHRF1. KSHV ORF16 encodes a viral Bcl-2 homologue that shows approximately 16% amino acid identity to cellular Bcl-2 but does contain the BH1 and BH2 domains required for the heterodimerization of Bcl-2 (Russo et al., 1996). It is expressed in KS lesions and in cell lines derived from primary effusion lymphomas (Sarid et al., 1997). The ability of KSHV vBcl-2 to heterodimerize with cellular Bcl-2 is controversial (Cheng et al., 1997). The HVS Orf16 also encodes for a vBcl-2 gene that has been shown to protect cells from Sindbis virus-induced apoptosis (Nava et al., 1997). This is thought to occur through the interaction of vBcl-2 with cellular Bcl-2, Bax, and Bak (Derfuss et al., 1998; Nava et al., 1997).
b. vFLIP The K13 Orf of KSHV encodes for a viral FLICE inhibitory protein (vFLIP) (Sarid et al., 1999; Talbot et al., 1999). KSHV vFLIP retains a conserved DEDD motif characteristic for FLICE inhibitors (Sarid et al., 1999). The KSHV vFLIP gene protects cells from Fas-mediated apoptosis by inhibiting caspase activation and permits clonal growth in the presence of death stimuli in vitro (Djerbi et al., 1999). Furthermore, it can act as a tumor progression factor by promoting tumor establishment and growth in vivo (Djerbi et al., 1999). Unlike vBcl2, the vFLIP transcript has been shown to be expressed during viral latency in BCBLs (Sarid et al., 1999). In addition, vFLIP is expressed at very low levels in early KS lesions with expression increasing dramatically in late-stage lesions (Sturzl et al., 1999). The in-
EBV, KSHV, and HVS
65
crease in expression of vFLIP transcripts is associated with a reduction in apoptosis in KS lesions, suggesting that functional vFLIP is produced in vivo (Sturzl et al., 1999). HVS Orf 71 encodes for a viral FLICE protein that contains death effector domains (DEDs; Thome et al., 1997; Wallach, 1997). This protein is also capable of blocking Fas-mediated apoptosis like KSHV vFLIP, but unlike KSHV vFLIP, HVS vFLIP is expressed in the lytic cycle of the virus (Thome et al., 1997; Wallach, 1997).
3. VIROCRINES: VIROKINES AND VIRAL RECEPTORS Cytokines play a critical role in the regulation of immune responses and are important targets of virus immune evasion mechanisms. One strategy used by these gamma herpesviruses is to encode virocrines composed of virokines and viral receptor proteins (DiMaio et al., 1998). Virokines are viral proteins that mimic cellular cytokines and chemokines, whereas viral receptors mimic cellular receptors.
a. EBV BARF-1 (vCSF-1R) The BARF-1 gene is a viral homologue of the cellular colony-stimulating factor-1 (CSF-1) receptor gene also called c-Fms, which is a protooncogene (Strockbine et al., 1998). BARF-1 has been shown to bind to CSF-1 and neutralize its activity (Strockbine et al., 1998). Expression of BARF-1 in rodent fibroblasts has been shown to induce morphological changes and foci formation in these cells (Wei and Ooka, 1989) and transformation of monkey kidney epithelial cells (Wei and Ooka, 1989). In addition, injection of these cells into newborn rats induced a diffused lymphoma-like tumor that regressed after a period of time (Wei and Ooka, 1989). Although BARF-1 is able to transform several cell lines, deletion of this gene from the wild-type EBV genome did not affect the ability to transform B lymphocytes (Cohen and Lekstrom, 1999). Furthermore, the injection of these transformed B cells into SCID mice induced the formation of tumors with an efficiency similar to that of wild-type virus (Cohen and Lekstrom, 1999). Thus, instead of being directly involved in B-cell transformation, BARF-1 likely modulates the host immune response by inactivating cellular CSF-1 activity and inhibiting the secretion of interferon (IFN)-␣ by mononuclear cells (Cohen and Lekstrom, 1999).
b. EBV vIL-10 The BCRF1 gene codes for a viral interleukin showing homology to cellular IL-10 (Moore et al., 1990). Some data suggest that this gene is critical for B-cell growth transformation (Miyazaki et al., 1993), and its gene product enhances viral transformation of primary B lymphocytes(Stuart et al., 1995).
66
Blossom Damania and Jae U. Jung
However, nonsense and deletion mutations in BCRF1 have no effect on latent infection, B-cell proliferation to long-term LCL, or virus replication in culture and in SCID mice (Swaminathan et al., 1993). The BCRF1 gene has been shown to be required for virus-transformed cells to block interferon-␥ release for autologous PBMCs (Swaminathan et al., 1993). de Waal Malefyt et al. (1991) have shown human and viral IL-10 strongly reduce antigenspecific human T cell proliferation by diminishing the antigen-presenting capacity of monocytes. This is thought to occur through downregulation of MHC II expression (de Waal Malefyt et al., 1991). In addition, vIL-10 was shown to induce local anergy to allogeneic and syngeneic tumors (Suzuki et al., 1995). Thus, vIL-10 appears to have an effect on the initial interferon, natural killer cell, and CD8 cytotoxic responses and may have a local effect on these responses to reactivated infection.
c. KSHV vIL-6 Cellular IL-6 has been implicated in many B lymphocyte-associated malignancies where it has been found to stimulate the growth of lymphomas, myelomas, and leukemias (Moore et al., 1996). A KSHV-encoded vIL-6 is secreted from BCBLs and has been shown to support proliferation of an IL6-dependent mouse myeloma cell line (Moore et al., 1996; Neipel et al., 1997; Nicholas et al., 1997b). Despite their similarity in sequence and function, cellular IL-6 and vIL-6 display differences in receptor usage. Whereas cellular IL-6 absolutely requires both the IL-6R␣ and the gp130 subunits, vIL-6 appears to require only gp130 (Molden et al., 1997). In addition, vIL6 has been shown to activate Jak1, STAT1, and STAT3 phosphorylation in hepatoma cells (Molden et al., 1997; Osborne et al., 1999). vIL-6 is also highly expressed in MCD and appears to contribute to the progression of this disease (Parravinci et al., 1997). Furthermore, vIL-6 has been shown to promote hematopoiesis and angiogenesis in athymic mice (Aoki et al., 1999). Thus, vIL-6 is a multifunctional cytokine that potentially contributes to KSHV-associated disease progression by continuously generating IL-6 receptor signaling pathways and preventing apoptosis of virus-infected cells.
d. KSHV MIPs KSHV ORFs K4 (vMIP-1), K4.1 (v-MIP-III), and K6 (vMIP-II) encode chemokines showing homology to cellular CC chemokines such as MIP-1␣ and RANTES. However, unlike cellular MIP-1␣, vMIP-II binds efficiently to both the CC chemokine receptor CCR3 and the CXC chemokine receptor CXCR4, albeit with lower affinity (Boshoff et al., 1997). vMIP-II has also been shown to elicit a potent chemoattractive effect on eosinophils (Boshoff et al., 1997). In contrast to cellular MIP-1␣ and RANTES, both vMIP-I and vMIP-II are highly angiogenic in the chorioallantoic assay (Boshoff et al.,
67
EBV, KSHV, and HVS
1997). Finally, HIV-1 transmission studies have shown that similar to cellular MIP-1, vMIP-I inhibits replication of HIV-1 strains dependent on the CCR5 coreceptor (Moore et al., 1996; Nicholas et al., 1997b). Thus, these multiple genes for vMIP likely contribute to KS pathogenesis, inflammatory infiltration, and angiohyperplasia and may also have relevance to KSHV and HIV-1 interactions (Dittmer and Kedes, 1998; Stine et al., 2000).
e. KSHV and HVS vGCR KSHV ORF 74 encodes for a G-protein-coupled receptor with high sequence homology to the IL-8 cellular receptor (Cesarman et al., 1996; Guo et al., 1997a). Arvanitakis et al. (1997) have shown that the KSHV vGCR is constitutively active and does not require ligand binding for its activity, although it can bind to both the CXC and the CC families of chemokines (Arvanitakis et al., 1997; Gershengorn et al., 1998). Geras-Raaka et al. (1998a,b,c) showed that human IFN-␥-inducible protein 10 (HuIP-10), vMIP-II, and stromal derived growth factor-1 (SDF-1) could inhibit KSHV vGCR signaling. Expression of the KSHV vGCR gene in rat kidney cells and NIH 3T3 fibroblasts induced cellular proliferation indicative of a transforming function for vGCR (Table II) (Arvanitakis et al., 1997; Bais et al., 1998). Most interestingly, transformation induced by vGCR is associated with an increased secretion of vascular endothelial growth factor (VEGF), which leads to the induction of an angiogenic response in cell culture and in nude mice (Bais et al., 1998). The KSHV vGCR-mediated signal has been shown to activate two protein kinases, JNK/SAPK and p38MAPK, characteristic of general inflammatory responses (Bais et al., 1998). The ecrl3 gene of HVS encodes for a viral GCR protein that also functions as an IL-8 receptor (Ahuja and Murphy, 1993; Nicholas et al., 1992). It is a high-affinity IL-8 receptor and a member of the ␣ (CXC) chemokine receptor family. Such chemoattractant receptors are involved in the migration of leukocytes from the blood to the sites of inflammation (Ahuja and Murphy,
Table II Transformation-Associated Genes EBV
KSHV
HVS
LMP-1 EBNA-2 EBNA-3A,C EBNA-LP EBERs BARF-1
K1 vIRF vGCR K12(kaposin)
STP Tip vSag
68
Blossom Damania and Jae U. Jung
1993; Nicholas et al., 1992). Studies on vGCR signaling have suggested that vGCR contributes to the oncogenic phenotype associated with KSHV and HVS. However, vGCR deletion mutants of HVS show no differences in viral replication, lymphocyte immortalization in vitro, and lymphoma induction in vivo (Choi et al., in press). Thus, the specific role of vGCR in the viral life cycle needs to be elucidated.
f. HVS vIL-17 HVS-encoded viral IL-17 is a newly discovered cytokine that activates NFB activity and induces the expression of cellular IL-6, IL-8, and surface ICAM-1 (Fossiez et al., 1998; Rouvier et al., 1993; Yao et al., 1995). It also enhances the proliferation of T cells induced by PHA. The viral chemokine binds to the cellular IL-17 receptor and mimics the effects of the cellular cytokine (Yao et al., 1995). While vIL-17 induces T-cell proliferation in cell culture, its transcription has not been detected in HVS-transformed human lymphocytes (Knappe et al., 1998a). Furthermore, deletion of the vIL-7 gene did not alter the viral replication and transforming ability of HVS C488 in culture and in animals (Knappe et al., 1998a). The specific role of IL-17 in HVS pathogenesis remains to be elucidated.
4. VIRUS-ENCODED SMALL RNAs The three gamma herpesviruses encode small RNAs that do not code for protein but are associated with nuclear proteins within the cell to form ribonucleoprotein complexes in the infected cell. Both EBV EBERs and HVS HSURs are not essential for viral transformation. The exact role of these ribonucleoprotein complexes remains to be discovered.
a. EBV EBERs Two EBV-encoded small RNAs (EBERs), EBER 1 and EBER 2, are both transcribed by cellular RNA polymerase III (Dobbelstein and Shenk, 1995; Falk et al., 1995; Murono et al., 1997; Rosa et al., 1981; Toczyski et al., 1994). EBER 1 can form a RNA–protein complex with a ribosomal protein L22, resulting in the relocalization of L22 from the nucleolus to the nucleoplasm (Dobbelstein and Shenk, 1995; Tomkinson and Kieff, 1992). EBERdeleted viruses are still able to initiate primary B-cell infection and growth transformation as efficiently as wild-type virus (Swaminathan et al., 1991). However, transfection of the EBER genes into an EBV-negative Akata B-cell line induced the capacity for growth in soft agar, tumorigenicity in SCID mice, resistance to apoptotic inducers, and upregulated expression of the Bcl2 antiapoptotic oncoprotein, which are all characteristic of EBV-positive Akata cells (Komano et al., 1999). Thus EBERs may have a precise function in specific cell types.
EBV, KSHV, and HVS
69
b. KSHV Nut-1/T1.1 RNAs Nut-1 RNAs are 1.1-kb KSHV transcripts actively transcribed in KS tumors and in BCBLs (Zhong and Ganem, 1997; Zhong et al., 1996). These RNAs are localized to the nucleus of infected cells and have no open reading frames longer than 62 codons, suggesting that they may not function as mRNAs in vivo (Zhong and Ganem, 1997; Zhong et al., 1996). Nut-1 RNAs are expressed in the KSHV lytic cycle and are found in high molecular weight ribonucleoprotein complexes in infected cell nuclei. These transcripts lack the trimethylguanosine (TMG) cap found in many U-like small nuclear RNAs, but a subpopulation of nut-1 RNAs can associate with Sm proteincontaining small nuclear ribonucleoproteins (Zhong and Ganem, 1997).
c. HVS HSURs Up to seven genes with homology to cellular U RNAs, called herpesvirus saimiri URNAs (HSURs), have been identified in the genomes of several HVS isolates (Albrecht and Fleckenstein, 1992). The HSURs were found to be expressed in tumor-derived lymphocytes of New World primates and rabbits (Geck et al., 1994; Murthy et al., 1986). At least some of the HSURs expressed in eukaryotic cells in the absence of rest viral genes were shown to assemble into ribonucleotide particles and function as U RNAs (Murthy et al., 1989). The observation that HSURs directly interact with a protein involved in mRNA destabilization suggests that HSURs attenuate the rapid degradation of mRNA of certain cellular genes, including cytokines and protooncogenes, by competing for this cellular protein (Geck et al., 1994; Myer et al., 1992). Thus, HSURs may facilitate transformed cell growth by increasing or prolonging the synthesis of important cellular regulatory genes. However, similar to EBV EBERs, HVS recombinant viruses with HSUR deletions replicate at levels similar to wild-type HVS and transform primary T lymphocytes as efficiently as wild-type HVS (Ensser et al., 1999). Thus, the specific role of HSURs needs to be determined in vivo.
5. COMPLEMENT INHIBITORY GENES The complement system is the primary humoral defense mechanism against microorganisms (Abbas, 1994; Cooper, 1991). Many large DNA viruses, including vaccinia virus, herpesvirus simplex, and EBV, are believed to have mechanisms of evading or exploiting the complement cascade (Friedman et al., 1996; Harris et al., 1990; Isaacs et al., 1992; Mold et al., 1988). Two different forms of HVS Orf4, complement control protein (vCCP), have been detected: a membrane-bound form and a secreted form. Both forms of vCCP have been shown to inihibit the complement cascade at the level of C3 and are associated with the virion particle (Fodor et al., 1995). While KSHV also contains vCCP genes encoded by Orf4, its functional role has not been
70
Blossom Damania and Jae U. Jung
studied. HVS Orf15 strongly resembles the gene for human CD59, the membrane attacking complex inhibitory factor (Rother et al., 1994). HVS vCD59 has been shown to inhibit lysis at the level of C9 in the cascade with less species restriction compared to cellular CD59. Like cellular CD59, it is also a GPI-linked membrane protein (Rother et al., 1994). Cellular CD59 has been shown to be present in the HIV envelope and it can protect HIV from complement-mediated lysis (Saifuddin et al., 1995). The presence of these two genes in the HVS genome, which function at different points in the complement cascade, speaks to the importance of complement to the life cycle of HVS. However, deletion mutations in HVS vCCP or vCD59 have no effect on viral replication and in vitro immortalization of the primary T cell (unpublished results). Thus, these gene products play roles other than transformation. For example, they may represent a humoral immune evasion mechanism by KSHV and HVS to support persistent infection in the natural host.
D. Unique Genes A small subset of genes encoded by the gamma herpesviruses do not share any discernible homology to known cellular genes. These genes encode for proteins that activate gene expression, maintain viral latency, and modulate lymphocyte-signaling pathways or the host immune system.
1. EBV UNIQUE GENES a. EBV EBNA-2 Many of the EBV genes that are expressed during latency have been shown to be involved in transformation. EBNA-2 is an EBV latency-associated antigen that is composed of 484 amino acids containing a polyproline stretch, an 18-residue arginine–glycine repeat, and a highly acidic carboxyl terminus. It has been shown to be a potent transcriptional activator, activating both viral and cellular genes (Grossman et al., 1994; Jayachandra et al., 1999; Nitsche et al., 1997; Sample and Kieff, 1990; Wang et al., 1991). This activity is thought to be essential for B-cell transformation (Kaiser et al., 1999). It is capable of interacting with cellular transcription factors, such as Cp-binding factor (CBF1), TAF40, TFIIB, TFIIE, TFIIH, and RPA 70 (Tong et al., 1995a,b,c). Deletion of the EBNA-2 gene from wild-type EBV has shown that such mutant viruses are incapable of immortalizing B lymphocytes (Miller et al., 1974). Furthermore, specific deletion of the CBF-1-interacting domain in the EBNA-2 gene in the wild-type virus also renders the virus incapable of immortalizing B lymphocytes (Tong et al., 1995c).
EBV, KSHV, and HVS
71
b. EBV EBNA-3 The genes encoding EBNA 3A, 3B, and 3C lie in a tandem array in the genome. The three proteins share a common amino-terminal domain but different carboxy-terminal domains. All three EBNA3 proteins can interact with the transcription factor CBF-1 and interfere with EBNA2 activation (Le Roux et al., 1994; Marshall and Sample, 1995; Robertson et al., 1996; Waltzer et al., 1996). EBNA 3B has been shown to be dispensable for the immortalization of B lymphocytes by EBV (Tomkinson and Kieff, 1992). However, both EBNA 3A and EBNA 3C have been shown to be essential for this process. EBNA 3C has been shown to cooperate with ras in cotransfection assays to immortalize and transform rodent fibroblasts (Parker et al., 1996). Similar to the adenoviral E1A and papillomavirus E7 proteins, EBNA 3C has been shown to directly interact with the Rb protein (Parker et al., 1996) and thus may override the G1-S phase checkpoint, leading to cellular proliferation. EBNA-3A has been shown to repress promoters containing CBF-1binding sites (Cludts and Farrell, 1998), which is likely to occur through sequestering of the CBF-1 transcription factor.
c. EBV EBNA-LP EBNA-LP (EBV nuclear antigen leader protein) is transcribed from a small ORF in the leader exons of the EBNA messages (Bodescot et al., 1986). The EBNA-LP protein is composed of repetitive units that are derived from repetitive nucleotide sequences in the EBV internal repeat (IR1). EBNA-LP is a nuclear protein that is phosphorylated on its serine residues. EBNA-LP has been shown to colocalize with the promyelocytic leukemia (PML) protein. Since PML is involved in the sequestering of transcription factors, it has been suggested that EBNA-LP may disrupt PML function, leading to the transcriptional activation of viral promoters in conjunction with EBNA-2 (Harada and Kieff, 1997; Nitsche et al., 1997). EBNA-LP mutant viruses are defective for immortalization or have 10-fold reduced immortalization efficiency (Hammerschmidt and Sugden, 1989; Mannick et al., 1991).
d. EBV EBNA-1 The EBNA-1 protein is a sequence-specific DNA-binding protein that binds to the EBV origin of replication (oriP) and is required for the initiation of viral replication and segregation of viral episomes at mitosis (Ambinder et al., 1990; Jones et al., 1989; Middleton and Sugden, 1994; Rawlins et al., 1985; Yates et al., 1984; Yates, 1988). The EBNA-1 protein contains a glycine–alanine repeat sequence that has been shown to interfere with the cytotoxic T-cell (CTL)-mediated response to EBV-infected B cells. The EBNA1 protein is required for the establishment and maintenance of EBV genome during latency (Lee et al., 1999b). It indirectly contributes to the immortalization of B lymphocytes (Lee et al., 1999b).
72
Blossom Damania and Jae U. Jung
2. KSHV UNIQUE GENES a. KSHV LANA (Orf 73) The KSHV homologue of EBV EBNA-1 is latency-associated nuclear antigen (LANA). This protein is expressed from ORF 73 of the KSHV genome and contains an acidic repeat sequence and leucine zipper motif (Dittmer et al., 1998; Russo et al., 1996). LANA has been shown to be necessary and sufficient for the persistence of KSHV episomes (Ballestas et al., 1999). Analogous to EBV EBNA-1, LANA has been suggested to tether the KSHV genome to chromosomes during mitosis to enable the efficient segregation of KSHV episomes to progeny cells (Ballestas et al., 1999). In addition to the maintenance of KSHV latency, it has been shown to interact with p53 and block its apoptotic activity (Friborg, 1999).
b. KSHV vIRF The ORF K9 of KSHV encodes for a unique gene not found in HVS or EBV called viral interferon regulatory factor, vIRF (Li et al., 1998; Moore et al., 1996; Zimring et al., 1998). This gene has high homology to the restricted regions of cellular interferon regulatory factors. Cellular interferon signaling is thought to play a significant role in preventing cellular transformation and in inducing antiviral responses in the infected host. KSHV vIRF acts as a viral transcription factor that inhibits interferon signaling but does not bind directly to interferon-stimulated response elements located in interferon-regulated promoters (Gao et al., 1997; Li et al., 1998; Zimring et al., 1998). Stable expression of vIRF in rodent fibroblasts induced transformation, resulting in focus formation, growth on soft agar, and tumor induction in nude mice (Gao et al., 1997; Li et al., 1998; Zimring et al., 1998). Reports have shown that KSHV vIRF interacts with the cellular transcriptional coactivator p300 and its homologue CBP (Burysek et al., 1999; Jayachandra et al., 1999; Li, in press). This interaction induces cellular myc protooncogene expression and represses the transcriptional activation of the cellular interferon gene expression, thereby downregulating host anti-viral activity and facilitating cell growth transformation (Burysek, et al., 1999; Jayachandra et al., 1999).
c. Kaposin (K12) Another potential KSHV oncogene is the K12 (kaposin) gene, which has been shown to have transforming ability (Muralidhar et al., 1998), although its contribution to viral pathogenesis is not yet clear (Sadler et al., 1999). Furthermore, the K12 gene has been shown to undergo a complex translation program (Sadler et al., 1999).
EBV, KSHV, and HVS
73
3. HVS UNIQUE GENES a. HVS Viral Superantigen (vSag) ORF14, an immediately early gene product of HVS, shares significant homology with the restricted regions of the mouse mammary tumor virus superantigen (vSag) (Thomson and Nicholas, 1991). The recombinant HVS vSag binds to MHC class II molecules and stimulates T-cell proliferation (Yao et al., 1996). vSag deletion mutants have been constructed independently by two groups, suggesting that it is not required for viral replication (Knappe et al., 1997, 1998b). Knappe et al. 1997, 1998b) have reported that mutant viruses without the vSag gene are replication competent and fully capable of transforming human and marmoset T cells. In contrast, Duboise et al. (1998a) have reported that vSag is required for transformation and for high level persistence in vivo. However, because the conditions used by both groups are very different from each other, these results are not necessarily in disagreement. The detailed role of vSag in T lymphocyte proliferation and HVS pathogenesis needs to be elucidated.
III. CONCLUSION Historically, DNA tumor viruses have been essential tools in the analysis of cellular pathways involving signal transduction, transcriptional regulation, and transformation. Many tumor viruses stimulate the proliferation of the infected cell. Analysis of viral genes associated with transformation has revealed many different strategies by which viruses achieve this end. Like other DNA tumor viruses, the gamma herpesviruses EBV, KSHV, and HVS encode a diverse array of viral genes that contribute to converting normal cell growth to cancerous cell growth (Table III). By encoding unique viral genes, viral counterparts to cellular genes, or upregulating expression of a subset of cellular genes, these viruses have evolved means of deregulating normal cellular pathways that otherwise lead to apoptosis, activation of the host immune system, and cell growth arrest. Thus, regardless of the means, the sum of all the functions contributed by the multitude of herpesviral genes described above results in the deregulation of cell growth, which eventually leads to cellular transformation and viral replication.
ACKNOWLEDGEMENTS We thank K. Toohey for photography support. This work was supported by NIH Grants CA31363, CA82057, CA86841, AI38131, RR00168, and ACS grant RPG001102. B. Damania is a fellow of the Cancer Research Institute and J. Jung is the Leukemia & Lymphoma Society Scholar.
74
Blossom Damania and Jae U. Jung
Table III Summary of Viral Gene Functions Viral gene EBV LMP-1 LMP2A EBNA-2 EBNA-3A,B,C EBNA-LP BARF-1 vIL-10 BDLF2 BHRF1 KSHV K1 K15 vIRF vCyclin vGCR vMIP-1␣, vIL-6 vBcl-2 vFLIP HVS STP Tip vSag vGCR vCyclin vIL-17 vBcl-2 vFLIP vCD59 vCCP
Function
Oncogene Signal transducer Transcriptional activator Transcriptional activator Transcriptional regulator CSF-1 receptor Cytokine B1 cyclin Apoptosis inhibitor Oncogene Signal transducer Transcriptional regulator G1 cyclin IL-8 receptor Chemokine Cytokine Apoptosis inhibitor Apoptosis inhibitor Oncogene Signal transducer Superantigen IL-8 receptor G1 cyclin Cytokine Apoptosis inhibitor Apoptosis inhibitor Complement inhibitor Complement inhibitor
REFERENCES Abbas, A. K. (1994). 2nd Ed. Saunders, Philadelphia, PA. Ablashi, D. V., Levine, P. H., Papas, T., Pearson, G. R., and Kottaridis, S. D. (1985a). Cancer Res. 45, 3981–3984. Ablashi, D. V., Schirm, S., Fleckenstein, B., Faggioni, A., Dahlberg, J., Rabin, H., Loeb, W., Armstrong, G., Peng, J. W., Aulahk, G., et al. (1985b). J. Virol. 55, 623 – 633. Ahuja, S. K., and Murphy, P. M. (1993). J. Biol. Chem. 268, 20691–20694. Albrecht, J. C., and Fleckenstein, B. (1992). Nucleic Acids Res. 20, 1810. Albrecht, J. C., Nicholas, J., Cameron, K. R., Newman, C., Fleckenstein, B., and Honess, R. W. (1992). Virology 190, 527– 530.
EBV, KSHV, and HVS
75
Alexander, L., Denenkamp, L., Knapp, A., Auerbach, M., Czajak, S., Damania, B., Desrosiers, R. C. (2000). J. Virol. 74(9), 4361– 4376. Ambinder, R. F., Shah, W. A., Rawlins, D. R., Hayward, G. S., and Hayward, S. D. (1990). J. Virol. 64, 2369–2379. Aoki, Y., Jaffe, E. S., Chang, Y., Jones, K., Teruya-Feldstein, J., Moore, P. S., and Tosato, G. (1999). Blood 93, 4034 – 4043. Arvanitakis, L., Geras-Raaka, E., Varma, A., Gershengorn, M. C., and Cesarman, E. (1997). Nature 385, 347– 350. Arvanitakis, L., Yaseen, N., and Sharma, S. (1995). J. Immunol. 155, 1047–1056. Baichwal, V. R., and Sugden, B. (1988). Oncogene 2, 461– 467. Bais, C., Santomasso, B., Coso, O., Arvanitakis, L., Raaka, E. G., Gutkind, J. S., Asch, A. S., Cesarman, E., Gershengorn, M. C., Mesri, E. A., and Gerhengorn, M. C. (1998). Nature 391, 86–89. Ballestas, M. E., Chatis, P. A., and Kaye, K. M. (1999). Science 284, 641– 644. Beaufils, P., Choquet, D., Mamoun, R. Z., and Malissen, B. (1993). EMBO J. 12, 5105 – 5112. Biesinger, B., Muller-Fleckenstein, I., Simmer, B., Lang, G., Wittmann, S., Platzer, E., Desrosiers, R. C., and Fleckenstein, B. (1992). Proc. Natl. Acad. Sci. USA 89, 3116 – 3119. Biesinger, B., Tsygankov, A. Y., Fickenscher, H., Emmrich, F., Fleckenstein, B., Bolen, J. B., and Broker, B. M. (1995). J. Biol. Chem. 270, 4729 – 4734. Blacklow, N. R., Watson, B. K., Miller, G., and Jacobson, B. M. (1971). Am. J. Med. 51, 549 – 552. Bodescot, M., Brison, O., and Perricaudet, M. (1986). Nucleic Acids Res. 14, 2611–2620. Boshoff, C., Endo, Y., Collins, P. D., Takeuchi, Y., Reeves, J. D., Schweickart, V. L., Siani, M. A., Sasaki, T., Williams, T. J., Gray, P. W., Moore, P. S., Chang, Y., and Weiss, R. A. (1997). Science 278, 290–294. Boshoff, C., and Weiss, R. A. (1998). Adv. Cancer Res. 75, 57– 86. Burkhardt, A. L., Bolen, J. B., Kieff, E., and Longnecker, R. (1992). J. Virol. 66, 5161– 5167. Burkitt, D. (1967). Int. J. Cancer 2, 562– 565. Burysek, L., Yeow, W. S., and Pitha, P. M. (1999). J. Hum. Virol. 2, 19 – 32. Busson, P., McCoy, R., Sadler, R., Gilligan, K., Tursz, T., and Raab-Traub, N. (1992). J. Virol. 66, 3257–3262. Cesarman, E., Chang, Y., Moore, P. S., Said, J. W., and Knowles, D. M. (1995). N. Engl. J. Med. 332, 1186–1191. Cesarman, E., and Knowles, D. M. (1997). Semin. Diagn. Pathol. 14, 54 – 66. Cesarman, E., Nador, R. G., Bai, F., Bohenzky, R. A., Russo, J. J., Moore, P. S., Chang, Y., and Knowles, D. M. (1996). J. Virol. 70, 8218 – 8223. Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M., and Moore, P. S. (1994). Science 266, 1865 –1869. Chang, Y., Moore, P. S., Talbot, S. J., Boshoff, C. H., Zarkowska, T., Godden, K., Paterson, H., Weiss, R. A., and Mittnacht, S. (1996). Nature 382, 410. Cheng, E. H., Nicholas, J., Bellows, D. S., Hayward, G. S., Guo, H. G., Reitz, M. S., and Hardwick, J. M. (1997). Proc. Natl. Acad. Sci. USA 94, 690 – 694. Choi, J., B.S. Lee, S. Shim, M. LI, and J.U. Jung. (1999a). J. Virol. Choi, J. K., M. Li, S. Shim, and J.U. Jung. (1999b). Manuscript in preparation. Choi, J. K., Mackey, J., Lackner, A. A., and Jung, J. U. (in press). Cludts, I., and Farrell, P. J. (1998). J. Virol. 72, 1862–1869. Cohen, J. I., and Lekstrom, K. (1999). J. Virol. 73, 7627–7632. Cooper, N. R. (1991). Immunol. Today 12. Dalla-Favera, R., Lombardi, L., Pelicci, P. G., Lanfrancone, L., Cesarman, E., and Neri, A. (1987). Ann. N.Y. Acad. Sci. 511, 207–218. Damania, B., DeMaria, M., Jung, J. U., and Desrosiers, R. C. (2000). J. Virol. 74, 2721– 2730.
76
Blossom Damania and Jae U. Jung
Damania, B., Li, M., Choi, J. K., Alexander, L., Jung, J. U., and Desrosiers, R. C. (1999). J. Virol. 73, 5123–5131. Dawson, C. W., Dawson, J., Jones, R., Ward, K., and Young, L. S. (1998). J. Virol. 72, 9016 – 9024. Derfuss, T., Fickenscher, H., Kraft, M. S., Henning, G., Lengenfelder, D., Fleckenstein, B., and Meinl, E. (1998). J. Virol. 72, 5897– 5904. Desrosiers, R. C. (1981). J. Virol. 39, 497– 509. Desrosiers, R. C., Bakker, A., Kamine, J., Falk, L. A., Hunt, R. D., and King, N. W. (1985). Science 228, 184–187. Desrosiers, R. C., Burghoff, R. L., Bakker, A., and Kamine, J. (1984). J. Virol. 49, 343 – 348. Desrosiers, R. C., and Falk, L. A. (1982). J. Virol. 43, 352– 356. Desrosiers, R. C., Sasseville, V. G., Czajak, S. C., Zhang, X., Mansfield, K. G., Kaur, A., Johnson, R. P., Lackner, A. A., and Jung, J. U. (1997). J. Virol. 71, 9764 – 9769. Desrosiers, R. C., Silva, D. P., Waldron, L. M., and Letvin, N. L. (1986). J. Virol. 57, 701–705. Devergne, O., Hatzivassiliou, E., Izumi, K. M., Kaye, K. M., Kleijnen, M. F., Kieff, E., and Mosialos, G. (1996). Mol. Cell. Biol. 16, 7098 –7108. Devergne, O., McFarland, E. C., Mosialos, G., Izumi, K. M., Ware, C. F., and Kieff, E. (1998). J. Virol. 72, 7900–7908. de Waal Malefyt, R., Haanen, J., Spits, H., Roncarolo, M. G., te Velde, A., Figdor, C., Johnson, K., Kastelein, R., Yssel, H., and de Vries, J. E. (1991). J. Exp. Med. 174, 915 – 924. DiMaio, D., Lai, C. C., and Klein, O. (1998). Annu. Rev. Microbiol. 52, 397– 421. Dittmer, D., and Kedes, D. H. (1998). Bioessays 5, 367–370. Dittmer, D., Lagunoff, M., Renne, R., Staskus, K., Haase, A., and Ganem, D. (1998). J. Virol. 72, 8309–8315. Djerbi, M., Screpanti, V., Catrina, A. I., Bogen, B., Biberfeld, P., and Grandien, A. (1999). J. Exp. Med. 190, 1025 –1032. Dobbelstein, M., and Shenk, T. (1995). J. Virol. 69, 8027– 8034. Drexler, H. G., Uphoff, C. C., Gaidano, G., and Carbone, A. (1998). Leukemia 12, 1507–1517. Duboise, M., Guo, J., Czajak, S., Lee, H., Veazey, R., Desrosiers, R. C., and Jung, J. U. (1998a). J. Virol. 72, 6770–6776. Duboise, S. M., Guo, J., Czajak, S., Desrosiers, R. C., and Jung, J. U. (1998b). J. Virol. 72, 1308–1313. Duboise, S. M., Lee, H., Guo, J., Choi, J. K., Czajak, S., Simon, M., Desrosiers, R. C., and Jung, J. U. (1998c). J. Virol. 72, 2607–2614. Dupin, N., Fisher, C., Kellam, P., Ariad, S., Tulliez, M., Franck, N., van Marck, E., Salmon, D., Gorin, I., Escande, J. P., Weiss, R. A., Alitalo, K., and Boshoff, C. (1999). Proc. Natl. Acad. Sci. USA 96, 4546–4551. Duro, D., Schulze, A., Vogt, B., Bartek, J., Mittnacht, S., and Jansen-Durr, P. (1999). J. Gen. Virol. 80, 549–555. Eliopoulos, A. G., Blake, S. M., Floettmann, J. E., Rowe, M., and Young, L. S. (1999). J. Virol. 73, 1023–1035. Eliopoulos, A. G., Dawson, C. W., Mosialos, G., Floettmann, J. E., Rowe, M., Armitage, R. J., Dawson, J., Zapata, J. M., Kerr, D. J., Wakelam, M. J., Reed, J. C., Kieff, E., and Young, L. S. (1996). Oncogene 13, 2243 –2254. Eliopoulos, A. G., and Young, L. S. (1998). Oncogene 16, 1731–1742. Ellis, M., Chew, Y. P., Fallis, L., Freddersdorf, S., Boshoff, C., Weiss, R. A., Lu, X., and Mittnacht, S. (1999). EMBO J. 18, 644 – 653. Ensser, A., Pfinder, A., Muller-Fleckenstein, I., and Fleckenstein, B. (1999). J. Virol. 73, 10551– 1055. Epstein, M. A., Achong, B., and Barr., Y. (1964). Lancet. 702–703. Falk, K., Gratama, J. W., Rowe, M., Zou, J. Z., Khanim, F., Young, L. S., Oosterveer, M. A., and Ernberg, I. (1995). J. Gen. Virol. 76, 779 –790.
EBV, KSHV, and HVS
77
Fleckenstein, B. (1979). Biochim. Biophys. Acta. 560, 301– 342. Floettmann, J. E., Ward, K., Rickinson, A. B., and Rowe, M. (1996). Virology 223, 29 – 40. Flore, O., Rafii, S., Ely, S., O’Leary, J. J., Hyjek, E. M., and Cesarman, E. (1998). Nature 394, 588–592. Fodor, W. L., Rollins, S. A., Bianco-Caron, S., Rother, R. P., Guilmette, E. R., Burton, W. V., Albrecht, J. C., Fleckenstein, B., and Squinto, S. P. (1995). J. Virol. 69, 3889 – 3892. Fossiez, F., Banchereau, J., Murray, R., Van Kooten, C., Garrone, P., and Lebecque, S. (1998). Int. Rev. Immunol. 16, 541– 551. Franken, M., Devergne, O., Rosenzweig, M., Annis, B., Kieff, E., and Wang, F. (1996). J. Virol. 70, 7819–7826. Friborg, J., Kong, W., Hottiger, M. and Nable, G. (1999). Nature 402, 889 – 894. Friedman, H. M., Wang, L., Fishman, N. O., Lambris, J. D., Eisenberg, R. J., Cohen, G. H., and Lubinski, J. (1996). J. Virol. 70, 4253 – 4260. Fries, K. L., Miller, W. E., and Raab-Traub, N. (1999). Virology 264, 159 –166. Fruehling, S., and Longnecker, R. (1997). Virology 235, 241–251. Gao, S. J., Boshoff, C., Jayachandra, S., Weiss, R. A., Chang, Y., and Moore, P. S. (1997). Oncogene 15, 1979–1985. Geck, P., Whitaker, S. A., Medveczky, M. M., Last, T. J., and Medveczky, P. G. (1994). Virus Genes 8, 25–34. Geras-Raaka, E., Arvanitakis, L., Bais, C., Cesarman, E., Mesri, E. A., and Gershengorn, M. C. (1998a). J. Exp. Med. 187, 801– 806. Geras-Raaka, E., Varma, A., Clark-Lewis, I., and Gershengorn, M. C. (1998b). Biochem. Biophys. Res. Commun. 253, 725 –727. Geras-Raaka, E., Varma, A., Ho, H., Clark-Lewis, I., and Gershengorn, M. C. (1998c). J. Exp. Med. 188, 405–408. Gershengorn, M. C., Geras-Raaka, E., Varma, A., and Clark-Lewis, I. (1998). J. Clin. Invest. 102, 1469–1472. Gessain, A., Sudaka, A., Briere, J., Fouchard, N., Nicola, M. A., Rio, B., Arborio, M., Troussard, X., Audouin, J., Diebold, J., et al. (1996). Blood 87, 414 – 416. Gires, O., Zimber-Strobl, U., Gonnella, R., Ueffing, M., Marschall, G., Zeidler, R., Pich, D., and Hammerschmidt, W. (1997). EMBO J. 16, 6131– 6140. Glenn, M., Rainbow, L., Aurad, F., Davison, A., and Schulz, T. F. (1999). J. Virol. 73, 6953 – 6963. Godden-Kent, D., Talbot, S. J., Boshoff, C., Chang, Y., Moore, P., Weiss, R. A., and Mittnacht, S. (1997). J. Virol. 71, 4193 – 4198. Greensill, J., Sheldon, J. A., Renwick, N. M., Beer, B. E., Norley, S., Gondsmij, J., and Schulz, T. F. (2000). J. Virol. 74, 1572–1577. Grossman, S. R., Johannsen, E., Tong, X., Yalamanchili, R., and Kieff, E. (1994). Proc. Natl. Acad. Sci. USA 91, 7568 –7572. Gruter, P., Tabernero, C., von Kobbe, C., Schmitt, C., Saavedra, C., Bachi, A., Wilm, M., Felber, B. K., and Izaurralde, E. (1998). Mol. Cell. 1, 649 – 659. Guo, H. G., Browning, P., Nicholas, J., Hayward, G. S., Tschachler, E., Jiang, Y. W., Sadowska, M., Raffeld, M., Colombini, S., Gallo, R. C., and Reitz, M. S., Jr. (1997a). Virology 228, 371–378. Guo, J., Duboise, M., Lee, H., Li, M., Choi, J. K., Rosenzweig, M., and Jung, J. U. (1997b). J. Virol. 71, 7092–7096. Guo, J., Williams, K., Duboise, S. M., Alexander, L., Veazey, R., and Jung, J. U. (1998). J. Virol. 72, 3698–3704. Hammerschmidt, W., and Sugden, B. (1989). Nature 340, 393 – 397. Harada, S., and Kieff, E. (1997). J. Virol. 71, 6611– 6618. Harris, S. L., Frank, I., Yee, A., Cohen, G. H., Eisenberg, R. J., and Friedman, H. M. (1990). J. Infect. Dis. 162, 331– 337.
78
Blossom Damania and Jae U. Jung
Hatzivassiliou, E., Miller, W. E., Raab-Traub, N., Kieff, E., and Mosialos, G. (1998). J. Immunol. 160, 1116–1121. Hayes, D. P., Brink, A. A., Vervoort, M. B., Middledorp, J. M., Meijer, C. J., and Van Der Brule, A. J. (1999). Mol. Pathol. 2, 97–103. Henderson, S., Huen, D., Rowe, M., Dawson, C., Johnson, G., and Rickinson, A. (1993). Proc. Natl. Acad. Sci. USA 90, 8479 – 8483. Hollyoake, M., Stuhler, A., Farrell, P., Gordon, J., and Sinclair, A. (1995). Cancer Res. 55, 4784–4787. Hsu, H., Xiong, J., and Goeddel, D. V. (1995). Cell 81, 495 – 504. Huen, D. S., Henderson, S. A., Croom-Carter, D., and Rowe, M. (1995). Oncogene 10, 549–560. Isaacs, S. N., Kotwal, G. J., and Moss, B. (1992). Proc. Natl. Acad. Sci. USA 89, 628 – 632. Izumi, K. M., Kaye, K. M., and Kieff, E. D. (1997). Proc. Natl. Acad. Sci. USA 94, 1447–1452. Izumi, K. M., and Kieff, E. D. (1997). Proc. Natl. Acad. Sci. USA 94, 12592–12597. Izumi, K. M., McFarland, E. C., Ting, A. T., Riley, E. A., Seed, B., and Kieff, E. D. (1999). Mol. Cell. Biol. 19, 5759– 5767. Jayachandra, S., Low, K. G., Thlick, A. E., Yu, J., Ling, P. D., Chang, Y., and Moore, P. S. (1999). Proc. Natl. Acad. Sci. USA 96, 11566 –11571. Jones, C. H., Hayward, S. D., and Rawlins, D. R. (1989). J. Virol. 63, 101–110. Jung, J. U., and Desrosiers, R. C. (1995). Mol. Cell. Biol. 15, 6506 – 6512. Jung, J. U., Lang, S. M., Friedrich, U., Jun, T., Roberts, T. M., Desrosiers, R. C., and Biesinger, B. (1995a). J. Biol. Chem. 270, 20660–20667. Jung, J. U., Lang, S. M., Jun, T., Roberts, T. M., Veillette, A., and Desrosiers, R. C. (1995b). J. Virol. 69, 7814–7822. Jung, J. U., Stager, M., and Desrosiers, R. C. (1994). Mol. Cell. Biol. 14, 7235 –7244. Jung, J. U., Trimble, J. J., King, N. W., Biesinger, B., Fleckenstein, B. W., and Desrosiers, R. C. (1991). Proc. Natl. Acad. Sci. USA 88, 7051–7055. Kaiser, C., Laux, G., Eick, D., Jochner, N., Bornkamm, G. W., and Kempkes, B. (1999). J. Virol. 73, 4481–4484. Kasolo, F. C., Monze, M., Obel, N., Anderson, R. A., French, C., and Gompels, U. A. (1998). J. Gen. Virol. 79, 3055 – 3065. Khanim, F., Dawson, C., Meseda, C. A., Dawson, J., Mackett, M., and Young, L. S. (1997). J. Gen. Virol. 78, 2987–2999. Kikuta, H., Itakura, O., Taneichi, K., and Kohno, M. (1997). Br. J. Haematol. 99, 790 –793. Kilger, E., Kieser, A., Baumann, M., and Hammerschmidt, W. (1998). EMBO J. 17, 1700 –1709. Kiyotaki, M., Desrosiers, R. C., and Letvin, N. L. (1986). J. Exp. Med. 164, 926 – 931. Klein, J. L., Fickenscher, H., Holliday, J. E., Biesinger, B., and Fleckenstein, B. (1996). J. Immunol. 156, 2754–2760. Knappe, A., Hiller, C., Niphuis, H., Fossiez, F., Thurau, M., Wittmann, S., Kuhn, E. M., Lebecque, S., Banchereau, J., Rosenwirth, B., Fleckenstein, B., Heeney, J., and Fickenscher, H. (1998a). J. Virol. 72, 5797– 5801. Knappe, A., Hiller, C., Thurau, M., Wittmann, S., Hofmann, H., Fleckenstein, B., and Fickenscher, H. (1997). J. Virol. 71, 9124 – 9133. Knappe, A., Thurau, M., Niphuis, H., Hiller, C., Wittmann, S., Kuhn, E. M., Rosenwirth, B., Fleckenstein, B., Heeney, J., and Fickenscher, H. (1998b). J. Virol. 72, 3469 – 3471. Knowles, D. M., Inghirami, G., Ubriaco, A., and Dalla-Favera, R. (1989). Blood 73, 792–799. Komano, J., Maruo, S., Kurozumi, K., Oda, T., and Takada, K. (1999). J. Virol. 73, 9827– 9831. Koomey, J. M., Mulder, C., Burghoff, R. L., Fleckenstein, B., and Desrosiers, R. C. (1984). J. Virol. 50, 662–665. Lagunoff, M., and Ganem, D. (1997). Virology 236, 147–154. Lagunoff, M., Majeti, R., Weiss, A., and Ganem, D. (1999). Proc. Natl. Acad. Sci. USA 96, 5704–5709.
EBV, KSHV, and HVS
79
Laherty, C. D., Hu, H. M., Opipari, A. W., Wang, F., and Dixit, V. M. (1992). J. Biol. Chem. 267, 24157–24160. Le Roux, A., Kerdiles, B., Walls, D., Dedieu, J. F., and Perricaudet, M. (1994). Virology 205, 596–602. Lee, H., Choi, J. K., Li, M., Kaye, K., Kieff, E., and Jung, J. U. (1999). J. Virol. 73, 3913 – 3919. Lee, H., Guo, J., Li, M., Choi, J. K., DeMaria, M., Rosenzweig, M., and Jung, J. U. (1998a). Mol. Cell. Biol. 18, 5219 – 5228. Lee, H., Veazey, R., Williams, K., Li, M., Guo, J., Neipel, F., Fleckenstein, B., Lackner, A., Desrosiers, R. C., and Jung, J. U. (1998b). Nature Med. 4, 435 – 440. Lee, M. A., Diamond, M. E., and Yates, J. L. (1999b). J. Virol. 73, 2974 –2982. Lee, M. A., and Yates, J. L. (1992). J. Virol. 66, 1899–1906. Lekstrom-Himes, J. A., Dale, J. K., Kingma, D. W., Diaz, P. S., Jaffe, E. S., and Straus, S. E. (1996). Clin. Infect. Dis. 22, 22–27. Li, M., Damania, B., Alvarez, X., Ogryzko, U., Ozato, K., and Jung, J. U. (in press). Mol. Cell Biol. Li, M., Lee, H., Guo, J., Neipel, F., Fleckenstein, B., Ozato, K., and Jung, J. U. (1998). J. Virol. 72, 5433–5440. Li, M., Lee, H., Yoon, D. W., Albrecht, J. C., Fleckenstein, B., Neipel, F., and Jung, J. U. (1997). J. Virol. 71, 1984 –1991. Longnecker, R., Druker, B., Roberts, T. M., and Kieff, E. (1991). J. Virol. 65, 3681– 3692. Longnecker, R., Miller, C. L., Miao, X. Q., Marchini, A., and Kieff, E. (1992). J. Virol. 66, 6461–6469. Longnecker, R., Miller, C. L., Miao, X. Q., Tomkinson, B., and Kieff, E. (1993a). J. Virol. 67, 2006–2113. Longnecker, R., Miller, C. L., Tomkinson, B., Miao, X. Q., and Kieff, E. (1993b). J. Virol. 67, 5068–5074. Magrath, I. (1992). Cancer Res. 52, 5529s– 5540s. Magrath, I., Jain, V., and Bhatia, K. (1992). Semin. Cancer Biol. 3, 285 –295. Mann, D. J., Child, E. S., Swanton, C., Laman, H., and Jones, N. (1999). EMBO J. 18, 654 – 663. Mannick, J. B., Cohen, J. I., Birkenbach, M., Marchini, A., and Kieff, E. (1991). J. Virol. 65, 6826–6837. Marchini, A., Tomkinson, B., Cohen, J. I., and Kieff, E. (1991). J. Virol. 65, 5991– 6000. Marshall, D., and Sample, C. (1995). J. Virol. 69, 3624 – 3630. Marshall, W. L., Yim, C., Gustafson, E., Graf, T., Sage, D. R., Hanify, K., Williams, L., Fingeroth, J., and Finberg, R. W. (1999). J. Virol. 73, 5181– 5185. McCarthy, N. J., Hazlewood, S. A., Huen, D. S., Rickinson, A. B., and Williams, G. T. (1996). Adv. Exp. Med. Biol. 406, 83 – 97. Middleton, T., and Sugden, B. (1994). J. Virol. 68, 4067– 4071. Miller, C. L., Burkhardt, A. L., Lee, J. H., Stealey, B., Longnecker, R., Bolen, J. B., and Kieff, E. (1995). Immunity 2, 155 –166. Miller, C. L., Lee, J. H., Kieff, E., and Longnecker, R. (1994). Proc. Natl. Acad. Sci. USA 91, 772–776. Miller, C. L., Longnecker, R., and Kieff, E. (1993). J. Virol. 67, 3087– 3094. Miller, G., Robinson, J., Heston, L., and Lipman, M. (1974). Proc. Natl. Acad. Sci. USA 71, 4006–4010. Mitterer, M., Mair, W., Gatti, D., Sheldon, J., Vachula, M., Coser, P., and Schultz, T. F. (1998). Br. J. Haematol. 102, 1338 –1340. Mittrucker, H. W., Muller-Fleckenstein, I., Fleckenstein, B., and Fleischer, B. (1993). Int. Immunol. 5, 985 –990.
80
Blossom Damania and Jae U. Jung
Miyazaki, I., Cheung, R. K., and Dosch, H. M. (1993). J. Exp. Med. 178, 439 – 447. Mold, C., Bradt, B. M., Nemerow, G. R., and Cooper, N. R. (1988). J. Exp. Med. 168, 949 – 969. Molden, J., Chang, Y., You, Y., Moore, P. S., and Goldsmith, M. A. (1997). J. Biol. Chem. 272, 19625–19631. Moore, K. W., Vieira, P., Fiorentino, D. F., Trounstine, M. L., Khan, T. A., and Mosmann, T. R. (1990). Science 248, 1230 –1234. Moore, P. S., Boshoff, C., Weiss, R. A., and Chang, Y. (1996). Science 274, 1739 –1744. Moore, P. S., and Chang, Y. (1995). N. Engl. J. Med. 332, 1181–1185. Mueller, N. (1991). Ann. Oncol. 2(Suppl. 2), 23 –28. Mueller, N., Evans, A., Harris, N. L., Comstock, G. W., Jellum, E., Magnus, K., Orentreich, N., Polk, B. F., and Vogelman, J. (1989). N. Engl. J. Med. 320, 689 – 695. Muralidhar, S., Pumfery, A. M., Hassani, M., Sadaie, M. R., Azumi, N., Kishishita, M., Brady, J. N., Doniger, J., Medveczky, P., and Rosenthal, L. J. (1998). J. Virol. 72, 4980 – 4988. Murono, S., Yoshizaki, T., Tanaka, S., Takeshita, H., Park, C. S., and Furukawa, M. (1997). Laryngoscope 107, 523 – 526. Murthy, S., Kamine, J., and Desrosiers, R. C. (1986). EMBO J. 5, 1625 –1632. Murthy, S. C., Trimble, J. J., and Desrosiers, R. C. (1989). J. Virol. 63, 3307– 3314. Myer, V. E., Lee, S. I., and Steitz, J. A. (1992). Proc. Natl. Acad. Sci. USA 89, 1296 –1300. Nava, V. E., Cheng, E. H., Veliuona, M., Zou, S., Clem, R. J., Mayer, M. L., and Hardwick, J. M. (1997). J. Virol. 71, 4118 – 4122. Neipel, F., Albrecht, J. C., Ensser, A., Huang, Y. Q., Li, J. J., Friedman-Kien, A. E., and Fleckenstein, B. (1997). J. Virol. 71, 839 – 842. Neipel, F., Albrecht, J. C., and Fleckenstein, B. (1998). J. Natl. Cancer Inst. Monogr. 23, 73 – 77. Nicholas, J., Cameron, K. R., and Honess, R. W. (1992). Nature 355, 362– 365. Nicholas, J., Ruvolo, V., Zong, J., Ciufo, D., Guo, H. G., Reitz, M. S., and Hayward, G. S. (1997a). J. Virol. 71, 1963 –1974. Nicholas, J., Ruvolo, V. R., Burns, W. H., Sandford, G., Wan, X., Ciufo, D., Hendrickson, S. B., Guo, H. G., Hayward, G. S., and Reitz, M. S. (1997b). Nature Med. 3, 287–292. Nicholas, J., Zong, J. C., Alcendor, D. J., Ciufo, D. M., Poole, L. J., Sarisky, R. T., Chiou, C. J., Zhang, X., Wan, X., Guo, H. G., Reitz, M. S., and Hayward, G. S. (1998). J. Natl. Cancer Inst. Monogr. 23, 79 – 88. Nitsche, F., Bell, A., and Rickinson, A. (1997). J. Virol. 71, 6619 – 6628. Noel, J. C., Hermans, P., Andre, J., Fayt, I., Simonart, T., Verhest, A., Haot, J., and Burny, A. (1996). Cancer 77, 2132–2136. Osborne, J., Moore, P. S., and Chang, Y. (1999). Hum. Immunol. 60, 921– 927. Pacheco-Castro, A., Marquez, C., Toribio, M. L., Ramiro, A. R., Trigueros, C., and Regueiro, J. R. (1996). Int. Immunol. 8, 1797–1805. Pagano, J. S. (1994). Cancer 74, 2397–2398. Palefsky, J. M., Berline, J., Penaranda, M. E., Lennette, E. T., Greenspan, D., and Greenspan, J. S. (1996). J. Infect. Dis. 173, 710 –714. Pallesen, G., Hamilton-Dutoit, S. J., and Zhou, X. (1993). Adv. Cancer Res. 62, 179 –239. Panousis, C. G., and Rowe, D. T. (1997). J. Virol. 71, 4752– 4760. Parker, G. A., Crook, T., Bain, M., Sara, E. A., Farrell, P. J., and Allday, M. J. (1996). Oncogene 13, 2541–2549. Parravinci, C., Corbellino, M., Paulli, M., Magrini, U., Lazzarino, M., Moore, P. S., and Chang, Y. (1997). Am. J. Pathol. 151, 1517–1522. Pastore, C., Gloghini, A., Volpe, G., Nomdedeu, J., Leonardo, E., Mazza, U., Saglio, G., Carbone, A., and Gaidano, G. (1995). Br. J. Haematol. 91, 918 – 920. Pathmanathan, R., Prasad, U., Sadler, R., Flynn, K., and Raab-Traub, N. (1995). N. Engl. J. Med. 333, 693–698.
EBV, KSHV, and HVS
81
Pearson, G. R., Luka, J., Petti, L., Sample, J., Birkenbach, M., Braun, D., and Kieff, E. (1987). Virology 160, 151–161. Poole, L. J., Zong, J. C., Ciufo, D. M., Alcendor, D. J., Cannon, J. S., Ambinder, R., Orenstein, J. M., Reitz, M. S., and Hayward, G. S. (1999). J. Virol. 73, 6646 – 6660. Purtilo, D. T., Cassel, C. K., Yang, J. P., and Harper, R. (1975). Lancet 1, 935 – 940. Raab-Traub, N. (1989). Cancer Treat. Res. 47, 285 – 302. Raab-Traub, N., Hood, R., Yang, C. S., Henry, B. d., and Pagano, J. S. (1983). J. Virol. 48, 580–590. Rawlins, D. R., Milman, G., Hayward, S. D., and Hayward, G. S. (1985). Cell 42, 859 – 868. Rickinson, A. B., Young, L. S., and Rowe, M. (1987). J. Virol. 61, 1310 –1317. Robertson, E. S., Lin, J., and Kieff, E. (1996). J. Virol. 70, 3068 – 3074. Rosa, M. D., Gottlieb, E., Lerner, M. R., and Steitz, J. A. (1981). Mol. Cell. Biol. 1, 785 –796. Rose, T. M., Strand, K. B., Schultz, E. R., Schaefer, G., Rankin, G. W., Jr., Thouless, M. E., Tsai, C. C., and Bosch, M. L. (1997). J. Virol. 71, 4138 – 4144. Rother, R. P., Rollins, S. A., Fodor, W. L., Albrecht, J. C., Setter, E., Fleckenstein, B., and Squinto, S. P. (1994). J. Virol. 68, 730 –737. Rouvier, E., Luciani, M. F., Mattei, M. G., Denizot, F., and Golstein, P. (1993). J. Immunol. 150, 5445–5456. Russo, J. J., Bohenzky, R. A., Chien, M. C., Chen, J., Yan, M., Maddalena, D., Parry, J. P., Peruzzi, D., Edelman, I. S., Chang, Y., and Moore, P. S. (1996). Proc. Natl. Acad. Sci. USA 93, 14862–14867. Sadler, R., Wu, L., Forghani, B., Renne, R., Zhong, W., Herndier, B., and Ganem, D. (1999). J. Virol. 73, 5722–5730. Saifuddin, M., Parker, C. J., Peeples, M. E., Gorny, M. K., Zolla-Pazner, S., Ghassemi, M., Rooney, I. A., Atkinson, J. P., and Spear, G. T. (1995). J. Exp. Med. 182, 501– 509. Sample, J., and Kieff, E. (1990). J. Virol. 64, 1667–1674. Sandberg, M., Hammerschmidt, W., and Sugden, B. (1997). J. Virol. 71, 4649 – 4656. Sarid, R., Sato, T., Bohenzky, R. A., Russo, J. J., and Chang, Y. (1997). Nature Med. 3, 293 – 298. Sarid, R., Wiezorek, J. S., Moore, P. S., and Chang, Y. (1999). J. Virol. 73, 1438 –1446. Scholle, F., Longnecker, R., and Raab-Traub, N. (1999). J. Virol. 73, 4767– 4775. Schulze-Gahmen, U., Jung, J. U., and Kim, S. H. (1999). Structure 7, 245 –254. Searles, R. P., Bergquam, E. P., Axthelm, M. K., and Wong, S. W. (1999). J. Virol. 73, 3040 – 3053. Sinclair, A. J., Palmero, I., Holder, A., Peters, G., and Farrell, P. J. (1995). J. Virol. 69, 1292– 1295. Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazals-Hatem, D., Babinet, P., d’Agay, M. F., Clauvel, J. P., Raphael, M., Degos, L., et al. (1995). Blood 86, 1276–1280. Staskus, K. A., Zhong, W., Gebhard, K., Herndier, B., Wang, H., Renne, R., Beneke, J., Pudney, J., Anderson, D. J., Ganem, D., and Haase, A. T. (1997). J. Virol. 71, 715 –719. Stine, J. T., Wood, C., Hill, M., Epp, A., Rapport, C. J., Schweickart, V. L., Endo, Y., Sasaki, T., Simmons, G., Boschoff, C., Clapham, P., Chang, Y., Moore, P., Gray, P. W., and Chantry, D. (2000). Blood 95, 1151–1157. Strand, K., Harper, E., Thormahlen, S., Thonless, M. E., Tsai, C., Rose, T., and Bosch, M. L. (2000). J. Clin. Virol. 16, 253–269. Strockbine, L. D., Cohen, J. I., Farrah, T., Lyman, S. D., Wagener, F., DuBose, R. F., Armitage, R. J., and Spriggs, M. K. (1998). J. Virol. 72, 4015– 4021. Stuart, A. D., Stewart, J. P., Arrand, J. R., and Mackett, M. (1995). Oncogene 11, 1711–1719. Sturzl, M., Hohenadl, C., Zietz, C., Castanos-Velez, E., Wunderlich, A., Ascherl, G., Biberfeld, P., Monini, P., Browning, P. J., and Ensoli, B. (1999). J. Natl. Cancer Inst. 91, 1725–1733. Suzuki, T., Tahara, H., Narula, S., Moore, K. W., Robbins, P. D., and Lotze, M. T. (1995). J. Exp. Med. 182, 477– 486.
82
Blossom Damania and Jae U. Jung
Swaminathan, S., Hesselton, R., Sullivan, J., and Kieff, E. (1993). J. Virol. 67, 7406 –7413. Swaminathan, S., Tomkinson, B., and Kieff, E. (1991). Proc. Natl. Acad. Sci. USA 88, 1546 – 1550. Swanton, C., Mann, D. J., Fleckenstein, B., Neipel, F., Peters, G., and Jones, N. (1997). Nature 390, 184–187. Takeshita, H., Yoshizaki, T., Miller, W. E., Sato, H., Furukawa, M., Pagano, J. S., and Raab-Traub, N. (1999). J. Virol. 73, 5548–5555. Talbot, S. J., Weiss, R. A., Kellam, P., and Boshoff, C. (1999). Virology 257, 84 – 94. Tarodi, B., Subramanian, T., and Chinnadurai, G. (1994). Virology 201, 404 – 407. Theodorakis, P., D’Sa-Eipper, C., Subramanian, T., and Chinnadurai, G. (1996). Oncogene 12, 1707–1713. Thome, M., Schneider, P., Hofmann, K., Fickenscher, H., Meinl, E., Neipel, F., Mattmann, C., Burns, K., Bodmer, J. L., Schroter, M., Scaffidi, C., Krammer, P. H., Peter, M. E., and Tschopp, J. (1997). Nature 386, 517– 521. Thomson, B. J., and Nicholas, J. (1991). Nature 351, 530. Toczyski, D. P., Matera, A. G., Ward, D. C., and Steitz, J. A. (1994). Proc. Natl. Acad. Sci. USA 91, 3463–3467. Tomkinson, B., and Kieff, E. (1992). J. Virol. 66, 2893 –2903. Tong, X., Drapkin, R., Reinberg, D., and Kieff, E. (1995a). Proc. Natl. Acad. Sci. USA 92, 3259–3263. Tong, X., Drapkin, R., Yalamanchili, R., Mosialos, G., and Kieff, E. (1995b). Mol. Cell. Biol. 15, 4735–4744. Tong, X., Wang, F., Thut, C. J., and Kieff, E. (1995c). J. Virol. 69, 585 – 588. Wallach, D. (1997). Nature 388, 123, 125 –126. Waltzer, L., Perricaudet, M., Sergeant, A., and Manet, E. (1996). J. Virol. 70, 5909 – 5915. Wang, D., Liebowitz, D., and Kieff, E. (1985). Cell 43, 831– 840. Wang, D., Liebowitz, D., Wang, F., Gregory, C., Rickinson, A., Larson, R., Springer, T., and Kieff, E. (1988). J. Virol. 62, 4173– 4184. Wang, F., Kikutani, H., Tsang, S. F., Kishimoto, T., and Kieff, E. (1991). J. Virol. 65, 4101–4106. Wei, M. X., and Ooka, T. (1989). EMBO J. 8, 2897–2903. Weiss, L. M., and Chang, K. L. (1992). Semin. Diagn. Pathol. 9, 272–278. Whitby, D., Boshoff, C., Luppi, M., and Torelli, G. (1997). Science 278, 1971–1972; discussion 1972–1973. Yao, Q. Y., Ogan, P., Rowe, M., Wood, M., and Rickinson, A. B. (1989). Int. J. Cancer. 43, 61– 66. Yao, Z., Fanslow, W. C., Seldin, M. F., Rousseau, A. M., Painter, S. L., Comeau, M. R., Cohen, J. I., and Spriggs, M. K. (1995). Immunity 3, 811– 821. Yao, Z., Maraskovsky, E., Spriggs, M. K., Cohen, J. I., Armitage, R. J., and Alderson, M. R. (1996). J. Immunol. 156, 3260 – 3266. Yasukawa, M., Inoue, Y., Kimura, N., and Fujita, S. (1995). J. Virol. 69, 8114– 8117. Yates, J., Warren, N., Reisman, D., and Sugden, B. (1984). Proc. Natl. Acad. Sci. USA 81, 3806–3810. Yates, J. A. C. S. (1988). Cancer Cells 6, 197–205. Yoon, D. W., Lee, H., Seol, W., DeMaria, M., Rosenzweig, M., and Jung, J. U. (1997). Immunity 6, 571–582. Zhong, W., and Ganem, D. (1997). J. Virol. 71, 1207–1212. Zhong, W., Wang, H., Herndier, B., and Ganem, D. (1996). Proc. Natl. Acad. Sci. USA 93, 6641–6646. Zimring, J. C., Goodbourn, S., and Offermann, M. K. (1998). J. Virol. 72, 701–707. Zong, J. C., Ciufo, D. M., Alcendor, D. J., Wan, X., Nicholas, J., Browning, P. J., Rady, P. L., Tyring, S. K., Orenstein, J. M., Rabkin, C. S., Su, I. J., Powell, K. F., Croxson, M., Foreman, K. E., Nickoloff, B. J., Alkan, S., and Hayward, G. S. (1999). J. Virol. 73, 4156 – 4170.
Genetic Predisposition and Somatic Diversification in Tumor Development and Progression Darryl Shibata* and Lauri A. Aaltonen† *Department of Pathology Norris Cancer Center University of Southern California School of Medicine Los Angeles, California 90033 †Department of Medical Genetics Haartman Institute University of Helsinki FIN-00014 Helsinki, Finland
I. Introduction II. Hereditary Colorectal Cancer Syndromes A. Familial Adenomatous Polyposis B. Peutz-Jeghers Syndrome C. Juvenile Polyposis D. Hereditary Nonpolyposis Colorectal Cancer III. Tumor Mutations and Molecular Clocks: Gateways to the Fourth Dimension A. Controversies in Evolution B. Tumor Progression C. MS Loci as Molecular Target Clocks D. Experimental Approach E. Experimental Results F. Potential Clock Problems G. Summary References
Studies on human cancer predisposition syndromes have contributed significantly to our understanding on tumor initiation and progression. Work performed on hereditary colon cancer has been particularly fruitful. Much of the molecular background of the various intestinal polyposis syndromes, such as familial adenomatous polyposis (FAP), juvenile polyposis, and Peutz-Jeghers syndrome, has been revealed, pinpointing several key cancer-associated genes. Studies on hereditary nonpolyposis colorectal cancer (HNPCC) have revealed a novel mechanism of tumorigenesis; genomic instability caused by defective DNA mismatch repair (MMR). Understanding the molecular background of these diseases helps us to understand tumor initiation in the affected individuals. Relatively little is known about the details of tumor progression in hereditary and sporadic
Advances in CANCER RESEARCH Vol. 80 0065-230X/01 $35.00
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
84
Darryl Shibata and Lauri A. Aaltonen
neoplasia. Certain additional gene mutations can be associated with advancing stages of the disease, but the pace and tempo of the process have remained obscure. A high mutation rate in MMR-deficient tumors has provided a new approach in the analysis of human tumor dynamics. Microsatellite (MS) sequences are frequently mutated in MMR deficient tumors. The high mutation rate allows the use of microsatellite mutations as a tool for analyzing the past patterns of tumor progression. This approach is similar to the use of MS mutations in studying human evolution and migrations. Such tumor studies have revealed progression pathways that differ from the classic adenoma–cancer sequence. The reasons why and how molecular clocks may reveal something new about a well-studied problem are discussed. © 2000 Academic Press.
I. INTRODUCTION The existence of hereditary human cancer predisposition syndromes has been acknowledged for decades, but only recently has science been able to elucidate some of their molecular background. Typically dominantly inherited susceptibility alleles may confer to approximately 10% of all human cancers. The spectrum of mutated genes is wide, including tumor suppressor genes, oncogenes, and genes involved in the maintenance of genomic instability. Many of the genes involved in malignancy have been identified through studies on hereditary cancer susceptibility. While hereditary cancer is a rare disease, an inherited predisposition to cancers of the breast and colon appears to be relatively common (Ellisen et al., 1998; Cannon-Albright et al., 1988; Aaltonen et al., 1998). In view of cancer research in general, hereditary colon cancer syndromes have played a major role in elucidating genes and mechanisms involved in tumorigenesis (Kinzler and Vogelstein, 1996). Hereditary colorectal cancer syndromes can be divided into two based on the presence or absence of intestinal polyposis in the affected individuals. Familial adenomatous polyposis (FAP), Peutz-Jeghers syndrome (PJS), and juvenile polyposis ( JP) are the main polyposis syndromes. In Cowden syndrome, hamartomatous intestinal polyposis is one feature, but predisposition to intestinal cancer has not been documented. Hereditary nonpolyposis colorectal cancer (HNPCC) is characterized by susceptibility to colorectal and other cancers in the absence of florid polyposis (Phillips et al., 1994). Studies have revealed much of the molecular background of these syndromes, and the increased knowledge has contributed greatly to our understanding of the malignant process. This review briefly presents the recent advances in the field of hereditary colorectal cancer syndromes and has a special focus on tumor clock studies that arose from the discovery of microsatellite instability (MSI) in HNPCC colorectal cancers.
From Tumor Predisposition to Somatic Diversification
85
II. HEREDITARY COLORECTAL CANCER SYNDROMES A. Familial Adenomatous Polyposis FAP is the most common of the various polyposis syndromes. The existence of 100 or more adenomatous polyps in the intestine is considered to be the diagnostic criterion, although in young individuals the number may be smaller. Lesions can occur throughout the gastrointestinal tract. Typically the number of adenomas in florid polyposis is several hundreds or thousands. Although the risk of malignant transformation in a single polyp may be no higher than in a sporadic adenoma, the large number of lesions explains why colorectal cancer risk is close to 100% by the age of 40 (Phillips et al., 1994). Attenuated forms of the disease exist, and colorectal cancer tends to occur later in these kindreds (Lynch et al., 1993). Polyps frequently occur in the stomach, and sometimes also in the biliary tract (Watanabe et al., 1978; Järvinen et al., 1983). Cancer risk is not limited to the gastrointestinal tract, but malignant tumors occur also in the liver, thyroidea, and brain (Plail et al., 1987; Kingston et al., 1983; Li et al., 1987; Garber et al., 1988; Kropilak et al., 1989). Other manifestations include predisposition to desmoid tumors and osteomas (Bussey, 1975; Utsunomiya and Nakamura, 1975; Bülow et al., 1984). The FAP phenotype with extraintestinal features is sometimes referred to as Gardner’s syndrome, although both forms of disease are caused by a single pleiotropic gene (Nishisho et al., 1991). Congenital hypertrophy of the retinal pigment epithelium (CHRPE) segregates in some FAP families (Traboulsi et al., 1987). FAP is caused by germline mutations in the adenomatous polyposis coli (APC) gene. APC was identified in 1991 (Nishisho et al., 1991; Kinzler et al., 1991; Groden et al., 1991; Joslyn et al., 1991). Subsequent work revealed clear phenotype–genotype correlations. For example, individuals with attenuated forms of the disease typically display truncating mutations close to the 5⬘ end of the gene (Lynch et al., 1993; Spirio et al., 1992, 1993), and the occurrence of CHRPE is associated with certain types of genetic defects (Olschwang et al., 1993). Allelic losses in 5q had already suggested prior to these studies that most sporadic colorectal cancers have a somatic defect in the adenomatous polyposis gene (Solomon et al., 1987). APC mutations occur frequently in the smallest of neoplastic colonic lesions, and thus it is considered to be the gatekeeper gene in the colonic epithelium (Kinzler and Vogelstein, 1996). The function of APC has been studied extensively, and many different roles have been proposed. It seems that one key action of the protein is to bind -catenin, in this way controlling the WNT signaling pathway. Mutant APC
86
Darryl Shibata and Lauri A. Aaltonen
is unable to bind -catenin, -catenin is allowed to move into nucleus, interacts with transcription factors such as TCF-4, and results in activated transcription of the WNT target genes. A prominent oncogene upregulated through this system is C-MYC (He et al., 1998). An interesting new twist to the FAP story is evidence that germline APC mutations can influence the types and frequencies of somatic mutations. Certain mutant germline alleles are associated with somatic losses of heterozygosity of their normal allele, whereas others are associated with more subtle mechanisms of mutation (Spirio et al., 1998; Lamlum et al., 1999).
B. Peutz-Jeghers Syndrome PJS is characterized by hamartomatous intestinal polyposis and mucocutaneous melanin spots (Morson, 1962). The polyposis typically affects small bowel, and the spots are detected most easily as freckle-like lesions around the mouth. The number of polyps is smaller than in FAP. Whereas melanin spots are typical for PJS, not all affected individuals display them. The spots may also disappear later in life. The pathognomonic feature is the histology of the polyps. Although the patients may present with multiple polyps of mixed histology, some lesions should display a prominent, tree-like smooth muscle cell core characteristic of a Peutz-Jeghers polyp (Phillips et al., 1994). Solitary polyps may occur without hereditary predisposition. Neoplasia has been reported in PJS polyps, suggesting the possiblity of a hamartoma–carcinoma sequence (Narita et al., 1987; Hizawa et al., 1993). Cancer risk is not limited to the gastrointestinal tract. PJS patients are also predisposed to breast cancer as well as gynecological malignancies (Giardiello et al., 1987; Hizawa et al., 1993; Boardman et al., 1998). Diagnostic criteria for PJS are (1) three or more histologically confirmed Peutz-Jeghers polyps, (2) any number of Peutz-Jeghers polyps with a family history of PJS, (3) characteristic, prominent, and mucocutaneous pigmentation with a family history of PJS, or (4) any number of Peutz-Jeghers polyps and characteristic, prominent, and mucocutaneous pigmentation. Some melanin pigmentation is often present in unaffected individuals. Thus prominent pigmentation is required in diagnostic criteria. The molecular background of PJS has been revealed. Deletions in the PJS polyps pinpointed a candidate locus in 19p, linkage analysis in PJS kindreds confirmed the finding (Hemminki et al., 1997), and a positional cloning effort facilitated by resources provided by the Human Genome Project identified the gene as LKB1 serine/threonine kinase. This gene was initially cloned by Dr. Nezu and was published as a sequence in GenBank. The positional cloning effort discovered the presence of LKB1 in 19p as the gene was detected in direct cDNA selection experiments (Hemminki et al., 1998). De-
From Tumor Predisposition to Somatic Diversification
87
tails of the function of LKB1 remain unclear, but kinase and growth suppressive functions of the gene have been demonstrated (Tiainen et al., 1999).
C. Juvenile Polyposis JP is an autosomal dominant hamartomatous polyposis syndrome where the polyps do not display a smooth muscle cell core. Instead, the lesions are typically spherical and contain dilated crypts (McColl et al., 1964). The number of lesions varies between affected individuals, but is lower than in FAP and comparable with PJS. Sporadic juvenile polyps are considered benign, but juvenile polyps, which occur in the context of hereditary juvenile polyposis, may progress to neoplasia (Jass et al., 1988). Syndromatic features such as cardiac and skeletal anomalies and mental retardation occasionally occur (Desai et al., 1998). Diagnostic criteria are (1) more than five juvenile polyps of the colorectum, (2) juvenile polyps throughout the GI tract, or (3) any number of juvenile polyps with a family history of JP (Jass et al., 1988). Other syndromes that display hamartomatous gastrointestinal polyps should be ruled out by history, physical examination, or pathology. One JP predisposition gene has been identified as SMAD4/DPC4 (Howe et al., 1998), although genetic heterogeneity is likely. SMAD4 is a key intracellular mediator of signaling through the TGF-b growth inhibitory pathway.
D. Hereditary Nonpolyposis Colorectal Cancer The cardinal feature of HNPCC is predisposition to colorectal and endometrial cancer. The lifetime risk of malignancy is approximately 80% (Dunlop et al., 1997; Aarnio et al., 1999) and the typical age at diagnosis is 40 to 45 years. Also, cancers of the small intestine, ureter, and renal pelvis are strongly associated with HNPCC (Vasen et al., 1999). Although florid polyposis is absent, HNPCC colorectal cancers (CRCs) are likely to arise from polyps or mucosa adjacent to polyps and occasionally patients are diagnosed with multiple adenomatous lesions. The diagnostic criteria for HNPCC, the so-called Amsterdam criteria, are as follows (Vasen et al., 1991). (1) At least three relatives should have histologically verified CRC; one of them should be a first-degree relative to the other two. (2) At least two successive generations should be affected. (3) In one of the relatives, CRC should be diagnosed under 50 years of age. In addition, tumors should be verified by pathological examination and the different polyposis syndromes have to be excluded. However, these criteria ignore extracolonic tumors, some of which are
88
Darryl Shibata and Lauri A. Aaltonen
clearly associated with the condition. Thus the international collaborative group on HNPCC has proposed revised criteria (Amsterdam criteria II). (1) At least three relatives should have an HNPCC-associated cancer (CRC, endometrium, small bowel, ureter, or renal pelvis cancer). (2) At least two successive generations should be affected. (3) In one of the relatives, HNPCCassociated cancer should be diagnosed under 50 years of age. In addition, tumors should be verified by pathological examination and the different polyposis syndromes have to be excluded (Vasen et al., 1991). Linkage studies identified the first HNPCC loci in 1993 (Peltomäki et al., 1993; Lindblom et al., 1993), and to date mutations in five different genes have been shown to be associated with HNPCC (Leach et al., 1993; Bronner et al., 1994; Papadopoulos et al., 1994; Nicolaides et al., 1994; Akiyama et al., 1997; Miyaki et al., 1997). A subset of sporadic tumors and almost all HNPCC tumors display microsatellite instability (Aaltonen et al. 993, Thibodeau et al., 1993; Ionov et al., 1993). This phenomenon gave a decisive clue to the underlying mechanism. Yeast deficient in DNA MMR exhibited similar genomic instability (Strand et al., 1993), and indeed mutations in human MMR genes were shown to be associated with HNPCC. MMR genes to date shown to be mutated in HNPCC are MLH1, PMS1, PMS2, MSH2, and MSH6 (Leach et al., 1993; Bronner et al., 1994; Papadopoulos et al., 1994; Nicolaides et al., 1994; Akiyama et al., 1997; Miyaki et al., 1997). Of note, the exact role of PMS1 in MMR remains to be demonstrated. A HNPCC patient has one defective and one normal allele of a MMR gene in each normal cell. Such cells are proficient in MMR, although rare dominant-negative mutations have been described (Parsons et al., 1995). Somatic loss of the wild-type allele, typically through loss of heterozygosity (Hemminki et al., 1994), results in a MMR defect. Of note, sporadic MMR-deficient colorectal cancers (approximately 10–15% of all colorectal cancers) (Kinzler and Vogelstein, 1996) often exhibit deficiencies in MLH1 expression secondary to methylation of its promoter region (Kane et al., 1997). Cells deficient in MMR acquire a dramatically increased mutation rate, which can be easily demonstrated by microsatellite repeat length analysis. Tumor cells have low replication fidelity and display microsatellite marker alleles that are not present in the normal tissue. The following section discusses the use of MS loci as molecular tumor clocks in HNPCC MSI⫹ tumors. Molecular clocks are commonly used to recreate the past of species and populations. It should be possible to translate similar approaches to understand the progression of tumors. Unexpectedly, the histories recorded by MSI⫹ tumor genomes appear to differ from the classic adenoma–cancer sequence. There are fundamental reasons why and how molecular clocks may reveal something new about well-studied problems.
From Tumor Predisposition to Somatic Diversification
89
III. TUMOR MUTATIONS AND MOLECULAR CLOCKS: GATEWAYS TO THE FOURTH DIMENSION A. Controversies in Evolution Tumors evolve through time. A tumor different yesterday will be different tomorrow. Tumor progression has been compared to a “Darwinian” struggle with succession by increasingly more “fit” clones. Although much is known about how tumors evolve (Fouls, 1954; Nowell, 1976; Kinzler and Vogelstein, 1996), a brief review of species evolution illustrates potential complexities. Compared to the monolithic story of creation, a number of different histories or phylogenetic trees are consistent with evolution. The simplest tree is a ladder of progression (Fig. 1). Although a ladder is intuitively appealing, modern phylogenetic trees are characterized by branches (Fig. 2). Species are related by a last most recent common ancestor whose phenotype is often unknown or referred to as a “missing link.” Direct traces of the past are recorded in fossils. These fossils reconstruct past species and provide remarkable records of prehistoric worlds. Although the past was already well characterized from the fossil record,
Fig. 1 Familiar ladder of evolution taken from the book “Wonderful Life” by Gould (1989). The legend to his figure states “My books are dedicated to debunking this picture of evolution.”
90
Darryl Shibata and Lauri A. Aaltonen
? Fig. 2 Phylogenetic trees usually branch as species are related by a last most recent common ancestor or “missing link.” Even though chimpanzees and humans are genetically >99% identical, divergence occurred about five million years ago.
the ability to sequence DNA led to new efforts based on genetic comparisons. Greater sequence differences are consistent with greater times since divergence. Although commonly used, molecular clocks are controversial as they are quantitative and therefore poorly understood by the mathematically challenged. In addition, the legacy recorded in present-day genomes is often not confirmed by classic approaches. For example, one molecular clock analysis (Gibbons, 1998) placed the divergence of mammals in the time of the dinosaurs (Fig. 3). However, there is not a shred of supporting evidence—appropriate mammalian fossils appear after dinosaur fossils. Either the molecular clock analysis or the fossil record is misleading. However, an alternative possibility is that both approaches accurately describe different aspects of evolution. The fossil record likely reconstructs the dominant populations and phenotypes of the past. However, which fossils, if any, represent ancestors of present-day species? This question is problematic as most fossils represent dead ends, ancestral phenotypes are unknown, and infrequent ancestors may not be represented in the fossil record. In contrast, molecular clocks are designed to trace lineages but tell little about past dead ends or phenotypes. Except for the present, molecular clocks dispense with the physical aspects of evolution. Because lineages can be maintained by small numbers of individuals of unexpected phenotypes, the ancestors responsible for present-day species may not be apparent in the fossil record. Modern mammals were not present among dinosaurs, but (not surprising) their lineages were and had already separated into their distinct fates. Genetic divergence can precede detectable phenotypic divergence.
From Tumor Predisposition to Somatic Diversification
91
Fig. 3 Molecular clocks place the divergence of modern mammals in the time of the dinosaurs (Source: S. Kumar and S. B. Hedges; Gibbons, 1998). This result is controversial, as in the fossil record, mammals emerge and diverge after the dinosaurs extinction. Of course mammalian lineages were present during the age of the dinosaurs, but their evolution is largely unrecorded by fossils. Molecular clocks can trace divergence even if past ancestors are infrequent or of unknown phenotypes. Species can diverge before they emerge or attain their final phenotypes.
A comparison between molecular clock and direct approaches is presented in Table I. If ancestors are infrequent, molecular clocks can reveal pathways that may be invisible by direct approaches. However, such findings are controversial as the missing links behave like “ghosts”—they are apparent by molecular clocks but otherwise elusive to direct observations. To add to this confusion, molecular clocks fail to provide any clues to what these “ghosts” might look like. Does one believe ones eyes or a mathematical time
92
Darryl Shibata and Lauri A. Aaltonen
Table I Comparative Abilities to Recreate the Past: Molecular Clocks versus Direct Approachesa
Molecular clocks Direct approaches
Frequent ancestors
Occult ancestors
Dead ends
Past phenotypes
Yes Yes
Yes No
No Yes
No Yes
aDirect approaches are clearly superior unless ancestors are occult.
machine? Unless one believes sequence comparisons can trace phylogenies, it is easy to dismiss molecular clocks as broken. However, if evolution progresses through occult ancestors or unexpected phenotypes, then the gateway to this past is through molecular clocks.
B. Tumor Progression Tumor progression lacks the controversy of specie evolution. The adenoma–cancer sequence is a well-accepted pathway of colorectal cancer progression (Kinzler and Vogelstein, 1996) and follows principles outlined by Nowell (1976). A ladder represents progression (Fig. 4), implying short branches and a lack of “missing links” or dead ends. The adenoma–cancer sequence has been inferred by examining specimens from different patients as it is difficult and unethical to observe precursors progressing to cancers. Presumably, unrelated tumors of different grades and stages represent different phases of a single pathway. Experimental findings gathered over decades are consistent with this progression ladder.
Fig. 4 The classic adenoma–cancer sequence. This ladder of progression lacks dead ends or missing links, implying branches are very short. The adenoma–cancer sequence, like the fossil record, is a physical or visible record of changes, as progenitors must undergo expansion in order to be “found.” Therefore, similar to Fig. 3, it is possible that progenitors that fail to undergo immediate clonal expansion may be present. The presence of these invisible progenitors can only be revealed with molecular clocks.
From Tumor Predisposition to Somatic Diversification
93
There are several reasons why molecular clocks have not been fully exploited to reconstruct tumor histories. First, there seems no reason to reconstruct the past as fundamental principles are already known (Fig. 4). Second, identical somatic mutations are often present in adjacent adenoma– cancer pairs (see, for example, Vogelstein et al., 1988), intuitive genetic evidence of a direct relationship. However, chimpanzees and humans are genetically >99% identical and, by the same “reasoning,” on the same pathway of evolution. Quantitative sequence analysis can translate the small genetic differences between humans and chimpanzees into a five-million-year old branch or “missing link” (Deka et al., 1995). A final and more practical lack of tumor clock applications are relatively low mutation rates in most tumors compared to times of progression. If a cell divides every day for 70 years, only about 25,000 divisions are possible. With mutation rates ⬍10⫺6 at most loci in most tumors (Loeb, 1991), a molecular clock approach is impractical as hundreds of years may past before any mutation is expected. The situation changes dramatically when DNA MMR is lost. Mutation rates at MS loci increase ⬃100-fold to as high as ⬃0.01 per division (Shibata et al., 1994; Bhattacharyya et al., 1994) and only 70 divisions are needed for a 50% probability of mutation. Therefore, measurable numbers of mutations are expected to accumulate in MMR-deficient tumors. The challenge is to translate multiple MS mutations into a history.
C. MS Loci as Molecular Tumor Clocks There are two essential elements in recreating a tumor history. The first is to define a tumor tree and the second is to count the number of mutations along its branches.
1. A TUMOR TREE A tumor tree amenable to a clock analysis is illustrated in Fig. 5. The start of the tree is defined as the somatic loss of DNA MMR and the end is the time of removal. The intervening branches are simplified due to the bottleneck nature of multistep tumor progression (Fouls, 1954; Nowell, 1976; Kinzler and Vogelstein, 1996). With clonal succession, only a single cell is selected to progress. Regardless of the number of past succession cycles, the final tumor or clonal expansion arises from a single final founder cell. Progression from the start of the tree to this final founder cell can be represented by a single lineage as all other ancestors are dead ends (Fig. 6). The final founder cell separates mutations into two groups. Mutations in the final founder cell will be present in all tumor cells. Mutations arising during clonal expansion will be present in only some tumor cells. Common mu-
94
Darryl Shibata and Lauri A. Aaltonen
Fig. 5 A tumor tree amenable to a clock analysis. All cells in the final clonal expansion arise from a single final founder cell. Because of the bottleneck nature of progression, the pathway between this final founder cell and an earlier progenitor can be represented by a single lineage regardless of the number of intervening cycles of clonal succession. All other lineages are dead ends. (Note that tumor trees are less complicated than eukaryotic trees as tumors lack sex.) The start is defined as the somatic loss of MMR, which triggers a ⬃100-fold increase in the MS mutation rate. Mutations common to all tumor cells arise before clonal expansion, and heterogeneous mutation uniquely present in only some tumor cells arise with clonal expansion. The relative numbers of these mutations determine branch lengths.
Fig. 6 A shortcoming of molecular clocks is the inability to recreate histories of past clonal expansions. All of these scenarios yield the same tumor tree (Fig. 5). This weakness, however, allows tracing of lineages regardless of past abundance or phenotype.
From Tumor Predisposition to Somatic Diversification
95
tations record the branch length preceding the final founder cell and unique or heterogeneous mutations record the history of clonal expansion.
2. COUNTING MS MUTATIONS MS mutations are defined as changes in the number of repeat units. We employ dinucleotide CA-repeat, noncoding MS loci. Changes in the number of repeat units predominately occur through unrepaired “slippage” during DNA replication (Streisinger et al., 1966; Strand et al., 1993), inherently linking mutation to cell division. Although potentially many repeats can be deleted or inserted at one time, studies with MMR-deficient cell lines illustrate that most mutations involve changes of a single repeat unit, and both additions and deletions are observed (Shibata et al., 1994; Bhattacharyya et al., 1994). This type of mutation is called stepwise mutation (Kimura and Ohta, 1978). MS loci have been used to model human migrations (Bowcock et al., 1994; Goldstein et al., 1995; Jorde et al., 1997). Simple arithmetic cannot count stepwise mutations as mutations may cancel. However, mutations are readily “counted” with simulations or mathematical models (Shibata et al., 1996; Tsao et al., 1997; Tsao et al., 1999). It is beyond the scope of this review to detail computational biology, but essentially the width or variance (S2) of a MS distribution is proportional to the number of divisions. Application of stepwise mutation to our tumor tree is relatively straightforward (Figs. 7 and 8). Consider a single cell that has just lost MMR. At this start, all alleles are of germline sizes as somatic MS mutations do not occur in normal tissues of HNPCC patients (Aaltonen et al., 1993). The greater the number of subsequent divisions in the single cell ancestral lineage leading to the final founder, the greater the probability that
Fig. 7 Counting MS mutations. In a tumor population, net drift is difficult with stepwise MS mutation, as additions are as likely as deletions. Therefore, alleles tend to form a bell-shaped distribution centered around the allele of the original founder cell. However, drift from germline (⌬germline) is possible in the single cell lineage leading to the final founder cell as mutations do not cancel. Variance of the tumor population alleles (S2alleles) is proportional to the number of divisions that proceed the final founder, and variance of the distribution of ⌬germline from 20 to 30 MS loci (S2loci) is proportional to the number of divisions that precede the final founder. Calculating these variances entails genotyping of hundreds of tumor alleles.
96
Darryl Shibata and Lauri A. Aaltonen
Fig. 8 MS allele gel patterns and tumor histories. If loss of MMR occurs at the time of clonal expansion, initially all tumor alleles will be at the germline size. With time, tumor alleles will become polymorphic, but collective drift from germline is difficult. In contrast, if loss of MMR precedes clonal expansion, drift from germline (⌬germline) is possible. The analysis with a single locus is relatively uninformative, but estimates of time become more robust when 20 – 30 loci are examined.
an allele may drift from germline. Early in clonal expansion, all cells have the alleles initially present in the final founder. With further division, the tumor becomes polymorphic as each cell independently acquires new mutations. However, with stepwise additions and deletions, alleles will drift around the sizes of the final founder cell. Translation of MS mutations into branch lengths requires the identification of unique and common tumor alleles. Polymorphic alleles uniquely present in only some cells arise during clonal expansion. Variance of a tumor MS allelic distribution (S2alleles) is proportional to the time since clonal expansion. The common allele or mode of this distribution likely represents the allele in the final founder cell. A “genotype” of the final founder cell is recreated by determining the most common MS allele at many different loci.
From Tumor Predisposition to Somatic Diversification
97
Differences between germline and “final founder” alleles (⌬germline) at 20– 30 different loci form a distribution whose variance (S2loci) is proportional to the number of divisions between loss of MMR and the final founder cell (Fig. 7).
D. Experimental Approach Tumors are populations of cells. Individual cells are difficult to isolate so to estimate a tumor allelic distribution, DNA is diluted to essentially single molecules prior to polymerase chain reaction. We sample 10 –30 alleles at 20–30 different MS loci. Microdissection minimizes contamination from normal cells, but inevitably human tumors are mixtures of normal and tumor cells. Alleles from normal cells (whose germline sizes are determined by examining normal tissues) must be subtracted to obtain tumor distributions (Fig. 9). Male patients and X chromosome MS loci simplify the approach. In this way, each allele represents a single cell as MMR-deficient tumors typically lack aneuploidy (Lengauer et al., 1997). In addition, to avoid a lower size constraint (Goldstein and Pollock, 1997), loci are chosen such that germline sizes contain more than 15 CA-repeat units. It is our observation that loci seldom drift below a size of 12 CA-repeat units. The MS distributions expected under different scenarios can be simulated. The single lineage between loss of MMR and the final founder simplifies the simulations. Final founder clonal expansion is more complicated as many growth scenarios (exponential, constant, and so on) are possible. However, we find little differences (⬍20%) between S2alleles values and numbers of divisions with a variety of growth scenarios. Measurements of S2alleles cannot distinguish between different types of clonal expansions but should provide reasonable estimates on the number of divisions since the founder cell. Loss of MMR may occur before, after, or at the time of clonal expansion.
Fig. 9 Estimation of tumor allele distributions. Human tumors are mixtures of alleles from normal and tumor cells. The germline size is determined by examining normal tissue. The contributions of normal cells to the frequency at this germline size can be eliminated with either truncation or subtracting the estimated contribution when the tumor distribution includes the germline size.
98
Darryl Shibata and Lauri A. Aaltonen
Fig. 10 Simulations assuming a rate of 0.005 mutations per division and a final tumor size of one billion cells. The final founder cell is indicated by filled circles. If loss of MMR and clonal expansion occur together, S 2loci is near zero whereas S 2alleles is high. If loss of MMR precedes clonal expansion, S 2loci is greater than S 2alleles. By measuring S 2alleles or S 2loci, the branch lengths of a tumor tree (Fig. 5) are specified. Note that S 2alleles is relatively insensitive to the type of clonal expansion (gradual or immediate).
We exclude the possibility that loss of MMR occurs after clonal expansion as a late loss of MMR would be difficult to detect (Tomlinson et al., 1996) and somatic MS mutations are found throughout MSI⫹ tumors (Shibata et al., 1994). Consider tumors with equal numbers of divisions since loss of MMR but different histories (Fig. 10). If loss of MMR occurs at the time of clonal expansion, MS loci will be highly polymorphic but centered around germline sizes (S2alleles high, S2loci low). Collective drift from germline is difficult as additions are as likely as deletions. In contrast, if loss of MMR occurs before clonal expansion, drift from germline is more likely (S2loci high) as it occurs in the single cell lineage leading to the final founder cell (Fig. 5). Drift from germline (S2loci) reflects the branch length between loss of MMR and the final founder, and the degree of loci polymorphism (S2alleles) reflects time since clonal expansion. Therefore, a tumor history can be recreated by measuring S2loci and S2alleles.
1. Calibrating the MS Molecular Clock To calibrate our clock and check its assumptions, a single cell of the MMRdeficient colorectal cancer cell line HCT116 was isolated, expanded for 20 days, and then four separate sublines were established from single cells (Fig. 11). After 1 year, single clones (“final founders”) were reisolated from each subline and expanded for 20 divisions. Cells divided once per day. Alleles in
From Tumor Predisposition to Somatic Diversification
99
Fig. 11 Tissue culture validation of the MS molecular clock. A single HCT116 MMR deficient cell is selected as the “start.” By definition, every allele is at “germline.” Subsequently, four sublines are maintained for 332 days, then single cells are again isolated (“final founders”) and expanded for 20 more days (352 total days). The alleles at 24 MS loci were sampled and S 2loci was determined for each subline. These values were consistent with our MS clock model as they were within the 95% confidence intervals (dotted lines) of the simulations. Note that S 2alleles was ⬃0 as clonal expansion was allowed for only 20 divisions.
100
Darryl Shibata and Lauri A. Aaltonen
the final expansions were sampled at 24 different MS loci. As expected, alleles were not polymorphic (S2alleles ⬃ 0) as clonal expansion was allowed for only 20 divisions. Drift from the starting “germline” alleles was evident (S2loci between 1.1 and 1.8) with up to 4 repeat unit differences (Fig. 11). Drift was variable between sublines and loci. This experiment was simulated 1000 times on a computer, assuming a mutation rate of 0.005 per division (a value consistent with studies of MMRdeficient cell lines) (Shibata et al., 1994; Bhattacharyya et al., 1994) and one division per day. Different results due to the stochastic nature of MS mutation are reflected in the plotted mean and 95% confidence intervals in Fig. 11. Experimental S2loci values representing four experimental “trials” were within the simulated 95% confidence intervals. Clones isolated from earlier time points also had S2loci values within these 95% confidence intervals (data not shown). Therefore, our model is consistent with this experimental calibration. This experiment also illustrates the bottleneck nature of tumor progression. Cell lines were maintained by conventional passages and not as single cell lineages. However, only numbers of divisions preceding the final founder cell and the history of clonal expansion affect final MS distributions. Clone sizes preceding final founders are irrelevant.
E. Experimental Results The approach was applied to MSI⫹ colorectal tumors in three patients (Tsao et al., 1999). It is possible to select a most common allele or mode from the bell-shaped tumor MS allelic distributions (Fig. 12). Figure 13 illustrates the distribution of drift from germline (⌬germline) of the most common alleles at multiple loci. This distribution of loci drift is broader than the allelic distributions (S2loci > S2alleles) and is substantially greater than the drift observed with the 1-year cell line experiments (Fig. 11). Trees based on tumor-specific S2loci and S2alleles values are illustrated in Fig. 14. Assuming one division per day (a value consistent with intestinal stem cell studies) (Potten and Loeffler, 1990), one can estimate times since loss of MMR or clonal expansion. Intervals since loss of MMR were between 1600 and 3400 divisions (4.4 to 9.2 years), and times since clonal expansion were between 91 and 420 divisions. Estimated confidence intervals were about ⫹/⫺50% (Table II).
1. FINDINGS CONSISTENT WITH AN ADENOMA–CANCER SEQUENCE As predicted (Fouls, 1954; Nowell, 1976; Kinzler and Vogelstein, 1996), each tumor history was unique. Loss of MMR preceded terminal clonal ex-
From Tumor Predisposition to Somatic Diversification
101
Fig. 12 MS allele frequency distributions. Tumor DNA was diluted to essentially single alleles prior to polymerase chain reaction. After subtraction of alleles from normal contaminating cells (see Fig. 9), the most common allele is chosen to represent drift from germline (⌬germline) or the allele of the final founder cell. Variances (S2alleles) of the distributions are proportional to the time since clonal expansion. Differences between the modes of the adjacent adenoma– cancer pairs infer the early divergence illustrated in Fig. 16.
pansion, as expected since somatic MS mutations are found throughout MSI⫹ tumors (Shibata et al., 1994). Terminal clonal expansions were generally less than a year old, consistent with progression by cycles of succession. Total times since loss of MMR and clinical presentation were relatively short (⬍10 years), consistent with the accelerated progression expected of a mutator phenotype (Loeb, 1991).
2. UNEXPECTED FINDINGS Most progression occurs before terminal clonal expansion. Although this finding is not surprising for cancers, adenomas, rather than marking a start of progression, also had relatively long intervals before terminal expansion. The order imposed by the classic ladder of progression (Fig. 4) was not evi-
102
Darryl Shibata and Lauri A. Aaltonen
Fig. 13 Distributions of drift from germline (⌬germline) at 29 – 30 MS loci for tumors from patient I. As expected from random drift, some alleles are at germline, or larger or smaller than germline. Variances (S 2loci) of these distributions are proportional to the intervals between loss of MMR and the final founder for each tumor. Tumor S 2loci values (between 7.7 and 9.2) are much greater than with the 1-year tissue culture experiments (Fig. 11).
dent with comparisons between tumor histories (Fig. 14). There was no clear relationship between tumor age and classic stage.
3. INTERVAL TUMORS: HEART OF DARKNESS Although molecular clocks probe the past, a shortcoming is the inability to determine past phenotypes or dead ends (Table I). For every tumor tree illustrated in Fig. 14, a number of progression scenarios can precede final ex-
Fig. 14 Tumor trees. Each history was different. Divisions before clonal expansion were much greater than after the start of expansion. There is no correlation with tumor age and classical adenoma–cancer stage as even adenomas were nearly as old or older than the cancers. Arrows indicate negative clinical examinations (assuming one division per day).
Table II Estimated Confidence Intervals
Patient I
II
III
Tumor Adenoma/cancer-1 Adenoma 1.0 cm Cancer Dukes’ C Cancer-2 Dukes’ B Adenoma/cancer Adenoma 1.0 cm Cancer Dukes’ B Adenoma-1 0.5 cm Cancer Dukes’ B Adenoma-2 0.5 cm
aNumber of MS loci examined.
Na
S 2 alleles
Expansion divisions
30 29 30
1.6 0.88 1.6
350 190 350
28 28 25 29 27
1.3 1.2 0.96 0.42 1.9
280 260 210 91 420
Total divisions
Age (years)
95% CI (years)
Clinical interval
8.3 7.7 9.2
1900 1700 2100
5.2 4.6 5.7
2.3–7.2 2.0–6.6 2.5–7.9
— — 0.5 years
15.8 9.8 7.5 10.3 6.7
3400 2100 1700 2200 1600
9.2 5.9 4.6 5.8 4.4
3.6–13 2.4–8.3 1.9–6.6 2.5–8.2 2.0–6.3
— — 2.0 years — 2.3 years
S 2 loci
104
Darryl Shibata and Lauri A. Aaltonen
pansion (Fig. 6). However, part of the past is known for tumors that appear shortly after negative clinical examinations. Colons of HNPCC patients are examined periodically due to their high risks of cancer. For these interval tumors, clinically visible progression is limited to the intervals between negative examinations and removal. Negative examinations (indicated by black arrows in Fig. 14) preceded three tumors by 0.5 to 2.3 years. At these negative clinical examinations, our histories indicate the presence of at least one progenitor cell that had already lost MMR and accumulated at least half of the MS mutations eventually found in their final tumors. Therefore, genetic progression appears to have preceded clinically detectable phenotypic progression. For discussion, we compare phenotypic and genotypic progression of cancer-2 in patient I (Fig. 15). Consistent with multistep progression, molecular clocks provide evidence of an accumulation of mutations over about 2100 divisions or 5.7 years since loss of MMR. However, an adenoma was not visible 6 months prior to removal of this cancer, suggesting a much shorter progression interval. Perhaps an adenoma was simply missed at the time of the negative examination. This possibility cannot be excluded. Perhaps all progression occurred in a 6-month interval. Accelerated progression is expected by a mutator phenotype (Loeb, 1991), so a 6-month adenoma–cancer sequence is extreme but possible. Increasing the rate 10-fold from 0.005 to
Fig. 15 Heart of darkness. As one travels back in time, a series of adenomas are expected based on the classic adenoma–cancer sequence. This expectation is largely untested, as most tumors present unexpectedly. However, in some cases, tumors arise shortly after negative clinical examinations, suggesting that all progression occurs within this defined interval. In this interval cancer, nothing was clinically visible 6 month prior to its presentation. The clock analysis suggests a much longer period (5.7 years) of genetic progression. The cancer was already present but in its early stages of clonal expansion. Although nothing was visible, the cancer had already accumulated more than 90% of its divisions since the loss of MMR. Molecular clocks can document this previously occult prologue before visible neoplasia.
From Tumor Predisposition to Somatic Diversification
105
0.05 MS mutations per division similarly compresses genetic progression from ⬃2000 divisions to ⬃200 divisions. Therefore, it is possible to match the adenoma–cancer sequence with genetic progression if we invoke a mutation rate higher than observed with MMR-deficient cell cultures or mice (Shibata et al., 1994; Bhattacharyya et al., 1994; Tsao et al., 1997; Yao et al., 1999) or if we believe that the clinical examination falsely missed a precursor. An alternative allows genetic progression in the absence of phenotypic progression. Although mutations can theoretically accumulate without altering the phenotype, direct approaches inevitably link genetic and phenotypic progression as experimentally a tumor must be identified before mutations are detected. Mutations in occult progenitors are “invisible” as occult progenitors are not sampled. In contrast, lineages preceding clonal expansion can be traced with molecular clocks even if they are maintained by as few as a single cell and lack altered phenotypes. The start measured by our clock analysis is the loss of the normal repair allele in a single HNPCC cell, consistent with Knudson’s hypothesis (Knudson, 1996). However, loss of MMR is unlikely to have immediate phenotypic consequences as MS mutations accumulate in normal cells of mice (Tsao et al., 1997; Yao et al., 1999) and rare humans with congenital MMR deficiencies (Parsons et al., 1995; Ricciardone et al., 1999; Wang et al., 1999). Although no precursor was visible 6 months prior to removal of this cancer, instead of a relatively “de novo” pathway, molecular clocks reveal a longer interval of genetic progression and the presence at the time of the negative examination of an occult progenitor that had already accumulated greater than 90% of the final MS mutations. An example of differences between occult and visible progression is the “late” occurrence of p53 mutations in colorectal cancer (Kinzler and Vogelstein, 1996). About half of colorectal cancers have p53 mutations, whereas p53 mutations are rare in adenomas. According to the adenoma–cancer sequence, p53 mutations occur at the transition between adenomas and cancers. However, like the problem of fossils and mammalian evolution (Fig. 3), detection of p53 mutations is dependent on clonal abundance. Cells may acquire p53 mutations but will not be detected until expansion. The adenoma– cancer sequence cannot account for occult progenitors and therefore mutations occur when they appear. In contrast, with lineage tracing and molecular clocks, p53 and other mutations can accumulate in any order and throughout progression. Therefore, p53 mutations are associated with cancers but do not necessarily occur only “late” in progression.
4. ADENOMA–CANCER DIVERGENCE Successive clonal expansions are closely related in an adenoma–cancer ladder. Genotypes should be similar between adjacent adenoma–cancer pairs as proximity suggests a direct relationship (Sugarbaker et al., 1985). Using cor-
106
Fig. 16 eages.
Darryl Shibata and Lauri A. Aaltonen
Tumor trees indicating an early divergence between adjacent adenoma–cancer lin-
relation coefficients, we compared (Tsao et al., 1999) MS genotypes between different tumors and parts of tumors of adjacent adenoma–cancer pairs. Consistent with independent origins, two tumors arising in the same patient but at different times and sites (metachronous) had very different mutations. Consistent with recent clonal expansion, two portions of the same adenoma or cancer had very similar mutations. Inconsistent with a close relationship, MS alleles were different between an adenoma and its adjacent cancer. Trees derived from this quantitative analysis are illustrated in Fig. 16. Adjacent adenomas and cancers progressed along a common lineage for less than half of the progression since loss of MMR. This early divergence is still consistent with clonal origins and some mutations in common between adjacent adenoma–cancer pairs. A surreal aspect is that despite early lineage divergence, direct observations may still document cancers physically emerging from adenomas. However, early adenoma–cancer divergence implies that current adenomas are dead end as the majority of their progression had nothing in common with their cancers. The adenomas were not direct pre-
From Tumor Predisposition to Somatic Diversification
107
cursors to the cancers, although the cancer precursors were likely contained in the adenomas. What is the nature of the “missing links” or common ancestors between the adjacent adenomas and cancers? The adenoma–cancer model implies that the common ancestor between an adenoma and a cancer is an adenoma. However, an alternative possibility suggested by interval tumors (Fig. 15) is an occult ancestor, lacking detectable clonal expansion or an altered phenotype. The start is a key difference between progression documented by molecular clocks and the adenoma– cancer sequence. The start of the adenoma–cancer sequence is dependent on clonal expansion, and therefore subsequent progression to cancer must occur in an adenoma. In contrast, because the start documented by molecular clocks is independent of phenotype or clonal expansion, progression may occur before adenoma formation. If the majority of genetic progression can occur without detectable clonal expansion, then adenomas may be dispensable as obligate cancer precursors, or the cancer ancestor may be a minor population in an adenoma. Regardless of the phenotype of a common adenoma–cancer ancestor, early divergence documents multilineage progression (Tsao et al., 1999) instead of a ladder along a single increasingly more “fit” and frequent lineage. At least two and perhaps other occult lineages progressed in parallel. A parallel strategy may be more effective for tumorigenesis considering the multiple mutations and combinations of mutations in human tumors. In this sense, tumors arise by “accidental” combinations rather than combinations whose intermediates allowed immediate selection and succession.
F. Potential Clock Problems Perhaps the biggest problem is the lack of evidence that any of the “occult” tumor trees outlined in Figs. 14 and 16 exist! The evidence is recorded in the genotypes of the tumors but tangible proof is otherwise absent. We have no idea of the phenotype of the common adenoma–cancer precursor and no prospects of ever “capturing” one. Such is the nature and controversy of molecular clocks (Table I). Another question is whether genetic progression documented by noncoding MS mutations is relevant. The pathway of an individual tumor is unique and the same tree should be reconstructed regardless of the mutations used. Although it would be better to associate mutations in appropriate selective loci with phenotypes (as in the adenoma–cancer sequence), such a diagram is not possible with molecular clocks as past phenotypes are undetermined. MS mutations serve as surrogates for the underlying genetic progression in selective loci, which ultimately confer a tumor phenotype. The start marked by loss of MMR appears to be an important milestone as mutation rates sub-
108
Darryl Shibata and Lauri A. Aaltonen
Fig. 17 Variable mutation rates can distort tumor trees.
sequently increase about 100-fold. MSI⫹ tumors bear characteristic scars of this event as mutations in short mononucleotide repeats of APC, TGF-b RII, Bax, and other genes are frequently present in MSI⫹ but not MSI⫺ tumors (Huang et al., 1996; Markowitz et al., 1995; Rampino et al., 1997). Many of these mutations may accumulate in the occult progenitors postulated by the MS clocks, consistent with the large number of mutations required to confer a neoplastic phenotype to normal human cells (Hahn et al., 1999). Final potential problems are with assumptions underlying a MS tumor clock. One key assumption is constant mutation rates. Although the disorganization of tumors may disrupt mitotic and mutation rates, the majority of progression measured by our trees appears to occur in occult precursors. Physiologic alterations are less likely in phenotypically normal progenitors. Figure 17 illustrates the distortion to our trees if mutation rates change with progression. If mutation rates increase with progression (Nowell, 1976), it is possible to move adenoma–cancer divergence to more recent times as fewer divisions are needed to generate differences. However, our clock already assumes high mutation rates and experimental evidence suggests rate changes are unlikely during progression. MMR-deficient tumor cell lines (Shibata et al., 1994; Bhattacharyya et al., 1994) (Fig. 10) and phenotypically normal mouse tissues (Tsao et al., 1997; Yao et al., 1994) exhibit rates of ⬃0.0025 to 0.005 mutations per division. Therefore, normal and tumor MMR-deficient cells exhibit comparable and very high mutation rates. Mutation rates may vary in some MSI⫹ cell lines (Richards et al., 1995), although this finding has been difficult to reproduce (Meuth et al., 1997). The other factor favoring a constant rate is that we measure the change in
From Tumor Predisposition to Somatic Diversification
109
Fig. 18 Evidence of random MS mutations. Metachronous tumors arise from essentially identical genetic backgrounds and environments. The final genotypes are different, indicating that MS loci mutate randomly. Note that by chance, genotypes at some loci will be similar.
numbers of CA-repeat units, a specific type of mutation linked to cell division from unrepaired slippage after DNA replication (Streisinger et al., 1966; Strand et al., 1993). MMR activity is essentially absent in human cell extracts deficient in MLH1 or MSH2 (Parsons et al., 1993; Umar et al., 1994), and complementation restores MMR (Koi et al., 1994). Studies in yeast illustrate that losses of MLH1 or MSH2 lead to similar mutation rates (Marsischky et al., 1996), suggesting that loss of MMR is catastrophic rather than stepwise due to sequential losses of more repair components. Another potential problem is that MS mutations may not occur randomly: alleles may tend to either contract or expand. Although mononucleotide poly(A) repeats tend to contract (Ionov et al., 1993), a similar bias is not apparent with CA-repeat loci. We can specifically test for random drift of MS loci as HNPCC patients are prone to multiple tumors. Do multiple tumors arising from identical genetic backgrounds and similar environments accumulate the same MS mutations? Figure 18 illustrates that MS mutations are sometimes the same or different between metachronous tumors, as expected of random mutation.
G. Summary Tumor pathways revealed by MS molecular clocks are different from the classic adenoma–cancer sequence. As outlined, there are fundamental reasons why trees derived from molecular clocks may have different and deeper branches than any record dependent on abundance. Can mutations accu-
110
Darryl Shibata and Lauri A. Aaltonen
mulate without immediate phenotypic consequences? Is every adenoma a precursor or are some dead ends (Koretz, 1993; Stryker et al., 1987)? Our lineages follow basic principles of multistep progression (Foulds, 1954; Nowell, 1976) with clonal origins and the accumulation of mutations over time. The trees, specific for individual tumors, may ultimately allow treatment customized to individual patients. The primary difference is a change from a monolithic adenoma–cancer ladder to branching pathways with variable lengths, multiple lineages, dead ends, missing links, and occult progenitors. If all MMR-deficient progenitors undergo clinically detectable clonal expansion along a single lineage, then the molecular clock analysis is clearly wrong as MSI⫹ phenotypic and genetic progression should be identical. However, if mutations can accumulate without immediately conferring a phenotype, or if some visible progenitors are dead ends, then lineages underlying progression to cancer will never be seen by direct approaches. Further studies support this view (Tsao et al., 2000). Molecular clocks are modern gateways that reveal this previously occult prologue before visible neoplasia.
REFERENCES Aaltonen, L. A., Peltomaki, P., Leach, F. S., Sistonen, P., Pylkkanen, L., Mecklin, J.-P., Järvinen, H., Powell, S., Jen, J., Hamilton, S., Petersen, G., Kinzler, K., Vogelstein, B., and de la Chapelle, A. (1993). Science 260, 812– 6. Aaltonen, L. A., Salovaara, R., Kristo, P., Canzian, F., Hemminki, A., Peltomäki, P., Chadwick, R. B., Percesepe, A., Kääriäinen, H., Ahtola, H., Eskelinen, M., Härkönen, N., Julkunen, R., Kangas, E., Ojala, S., Tulikoura, J., Valkamo, E., Järvinen, H., Mecklin, J.-P., and de la Chapelle, A. (1998). N. Engl. J. Med. 338, 1481–1487. Aarnio, M., Sankila, R., Pukkala, E., Salovaara, R., Aaltonen, L. A., de la Chapelle, A., Peltomaki, P., Mecklin, J. P., and Jarvinen, H. J. (1999). Int. J. Cancer 81, 214 –218. Akiyama, Y., Sato, H., Yamada, T., Nagasaki, H., Tsuchiya, A., Abe, R., Yuasa, Y. (1997). Cancer Res. 57, 3920–3923. Bhattacharyya, N. P., Skandalis, A., Ganesh, A., Groden, J., and Meuth, M. (1994). Proc. Natl. Acad. Sci. USA 91, 6319 – 6323. Boardman, L. A., Thibodeau, S. N., Schaid, D. J., Lindor, N. M., McDonnell, S. K., Burgart, L. J., Ahlquist, D. A., Podratz, K. C., Pittelkow, M., and Hartmann, L. C. (1998). Ann. Intern. Med. 128, 896 – 899. Bowcock, A. M., Ruiz-Linares, A., Tomfohrde, J., Minch, E., Kidd, J. R., and Cavalli-Sforza, L. L. (1994). Nature 368, 455 – 457. Bronner, C. E., Baker, S. M., Morrison, P. T., Warren, G., Smith, L. G., Lescoe, M. K., Kane, M., Earabino, C., Lipford, J., Lindblom A., et al. (1994). Nature 368, 258 –261. Bülow, S., Søndergaard, J. O., Witt, I. N., Larsen, E., and Tetens, G. (1984). Dis. Colon Rectum 27, 105 –108. Bussey, H. J. R. (1975). Johns Hopkins University Press, Baltimore 1. Cannon-Albright, L. A., Skolnick, M. H., Bishop, D. T., Lee, R. G., and Burt, R. W. (1988). N. Engl. J. Med. 319(9), 533 – 537. Deka, R., Jin, L., Shriver, M. D., Yu, L. M., DeCroo, S., Hundrieser, J., Bunker, C. H., Ferrell, R. E., and Chakraborty, R. (1995). Am. J. Hum. Genet. 56, 461– 474.
From Tumor Predisposition to Somatic Diversification
111
Desai, D. C., Murday, V., Phillips, R. K., Neale, K. F., Milla, P., and Hodgson, S. V. (1998). J. Med. Genet. 35(6), 476 – 481. Dunlop, M. G., Farrington, S. M., Carothers, A. D., Wyllie, A. H., Sharp, L., Burn, J., Liu, B., Kinzler, K. W., and Vogelstein, B. (1997). Hum. Mol. Genet. 105 –110. Ellisen, L. W., and Haber, D. (1998). Annu. Rev. Med. 49, 425 – 436. Foulds, L. (1954). Cancer Res. 14, 327– 339. Garber, J. E., Li, F. P., Kingston, J. E., Krush, A. J., Strong, L. C., Finegold, M. J., Bertario, L., Bulow, S., Filippone, A., Jr., Gedde-Dahl, T., Jr., et al. (1988). J. Natl. Cancer Inst. 80, 1626 – 1628. Giardiello, F. M., Welsh, S. B., Hamilton, S. R., Offerhaus, G. J., Gittelsohn, A. M., Booker, S. V., Krush, A. J., Yardley, J. H., and Luk, G. D. (1987). N. Engl. J. Med. 316, 1511–1514. Gibbons, A. (1998). Science 280, 675 – 676. Goldstein, D. B., Linares, A. R., Cavalli-Sforza, L. L., and Feldman, M. W. (1995). Proc. Natl. Acad. Sci. USA 92, 6723 – 6727. Goldstein, D. B., and Pollock, D. D. (1997). J. Hered. 88, 335 – 342. Gould, S. J. (1989). “Wonderful Life.” Norton, New York. Groden, J., Thliveris, A., Samowitz, W., Carlson, M., Gelbert, L., Albertsen, H., Joslyn, G., Stevens, J., Spirio, L., Robertson, M., et al. (1991). Cell 66, 589 – 600. Hahn, W. C., Counter, C. M., Lundberg, A. S., Beijersbergen, R. L., Brooks, M. W., and Weinberg, R. A. (1999). Nature 400, 464 – 468. He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da Costa, L. T., Morin, P. J., Vogelstein, B., and Kinzler, K. W. (1998). Science 281, 1509 –1512. Hemminki, A., Markie, D., Tomlinson, I., Avizienyte, E., Roth, S., Loukola, A., Bignell, G., Warren, W., Aminoff, M., Höglund, P., Järvinen, H., Kristo, P., Pelin, K., Ridanpää, M., Salovaara, R., Toro, T., Bodmer, W., Olschwang, S., Olsen, A. S., Stratton, M. R., de la Chapelle, A., and Aaltonen, L. A. (1998) Nature 391, 184 –187. Hemminki, A., Peltomäki, P., Mecklin, J.-P., Järvinen, H., Salovaara, R., Nyström-Lahti, M., de la Chapelle, A. and Aaltonen, L. A. Nature Genet. Hemminki, A., Tomlinson, I., Markie, D., Jarvinen, H., Sistonen, P., Bjorkqvist, A. M., Knuutila, S., Salovaara, R., Bodmer, W., Shibata, D., de la Chapelle, A., and Aaltonen, L. A. (1997). Nature Genet 15, 87– 90. Hizawa, K., Mitsuo, I., Matsumoto, T., Kohrogi, N., Kinoshita, H., Yao, T., and Fujishima, M. (1993). Cancer 72, 2777–2781. Hizawa, K., Mitsuo, I., Matsumoto, T., Kohrogi, N., Yao, T., and Fujishima, M. (1993). Dis. Colon Rectum 36, 953 – 957. Howe, J. R., Roth, S., Ringold, J. C., Summers, R. W., Järvinen, H. J., Sistonen, P., Tomlinson, I. P. M., Houlston, R. S., Bevan, S., Mitros, F. A., Stone, E. M., and Aaltonen, L. A. (1998). Science 280, 1086 –1088. Huang, J., Papadopoulos, N., McKinley, A. J., Farrington, S. M., Curtis, L. J., Wyllie, A. H., Zheng, S., Willson, J. K. V., Markowitz, S. D., Morin, P., Kinzler, K. W., Vogelstein, B., and Dunlop, M. G. (1996). Proc. Natl. Acad. Sci. USA 93, 9049 – 954. Ionov, Y., Peinado, M. A., Malkhosyan, S., Shibata, D., and Perucho, M. (1993). Nature 363, 558–561. Ionov, Y., Peinado, M. A., Malkhosyan, S., Shibata, D., and Perucho, M. (1993). Nature 363, 558–561. Järvinen, H. J., Nyberg, M., and Peltokallio, P. (1983). Dis. Colon Rectum 26, 525 – 528. Jass, J. R., Williams, C. B., Bussey, H. J. R., and Morson, B. C. (1988). Histopathology 13, 619 – 630. Jorde, L. B., Rogers, A. R., Bamshad, M., Watkins, W. S., Krakowiak, P., Sung, S., Kere, J., and Harpending, H. C. (1997). Proc. Natl. Acad. Sci. USA 94, 3100 – 3103. Joslyn, G., Carlson, M., Thliveris, A., Albertsen, H., Gelbert, L., Samowitz, W., Groden, J., Stevens, J., Spirio, L., and Robertson, M., et al. (1991). Cell 66, 601– 613.
112
Darryl Shibata and Lauri A. Aaltonen
Kane, M. F., Loda, M., Gaida, G. M., Lipman, J., Mishra, R., Goldman, H., Jessup, J. M., and Kolodner, R. (1997). Cancer Res. 57: 808 – 811. Kimura, M., and Ohta, T. (1978). Proc. Natl. Acad. Sci. USA 75, 2868 –2872. Kingston, J. E., Herbert, A., Draper, G. J., and Mann, J. R. (1983). Arch. Dis. Childhood 58, 959–962. Kinzler, K. W., Nilbert, M. C., Su, L.-K., Vogelstein, B., Bryan, T. M., Levy, D. B., Smith, K. J., Preisinger, A. C., Hedge, P., McKechnie, D., et al. (1991). Science 53, 661– 665. Kinzler, K. W., and Vogelstein, B. (1996). Cell 87, 159 –170. Knudson, A. G. (1996). J. Cancer Res. Clin. Oncol. 122, 135 –140. Koi, M., Umar, A., Chauhan, D. P., Cherian, S. P., Carethers, J. M., Kunkel, T. A., and Boland, C. R. (1994). Cancer Res. 54, 4308 – 4312. Koretz, R. L. (1993). Ann. Intern. Med. 118, 63 – 68. Kropilak, M., Jagelman, D. G., Fazio, V. W., Lavery, I. L., and McGannon, E. (1989). Dis. Colon Rectum 32, 778–782. Lamlum, H., Ilyas, M., Rowan, A., Clark, S., Johnson, V., Bell, J., Frayling, I., Efstathiou, J., Pack, K., Payne, S., Roylance, R., Gorman, P., Sheer, D., Neale, K., Phillips, R., Talbot, I., Bodmer, W., and Tomlinson, I. (1999). Nature Med. 5, 1071–1075. Leach, F. S., Nicolaides, N. C., Papadopoulos, N., Liu, B., Jen, J., Parsons, R,, Peltomäki, P., Sistonen, P., Aaltonen, L. A., Nyström-Lahti, M., Guan, X.-Y., Fournier, R. E. K., Todd, S., Lewis, T., Leach, R. J., Naylor, S. L., Weissenbach, J., Mecklin, J.-P., Järvinen, H., Petersen, G. M., Hamilton, S. R., Green, J., Jass, J., Watson, P., Lynch, H. T., Trent, J. M., de la Chapelle, A., Kinzler, K. W., and Vogelstein, B. (1993). Cell 75, 1215 –1225. Lengauer, C., Kinzler, K. W., and Vogelstein, B. (1997). Nature 386, 623 – 627. Li, F. P., Thurber, W. A., Seddon, J., and Holmes, G. E. (1987). JAMA 257, 2475 –2477. Lindblom, A., Tannergard, P., Werelius, B., and Nordenskjold, M. (1993). Nature Genet. 5(3), 279–282. Loeb, L. A. (1991). Cancer Res. 51, 3075 – 3079. Lynch, H. T., Smyrk, T. C., Lanspa, S. J., Jenkins, J. X., Lynch, P. M., Cavalieri, J., and Lynch, J. F. (1993). Cancer 71, 2709 –2714. Markowitz, S., Wang, J., Myeroff, L., Parsons, R., Sun, L., Lutterbaugh, J., Fan, R. S., Marsischky, G. T., Filosi, N., Kane, M. F., and Kolodner, R. (1996). Genes Dev. 10, 407– 420. McColl, I., Bussey, H. J. R., Veale, A. M. O., and Morson, B. C. (1964). Proc. R. Soc. Med. 57, 896–897. Meuth, M., Richards, B., and Schneider, B. (1999). Science 283, 641. Miyaki, M., Konishi, M., Tanaka, K., Kikuchi-Yanoshita, R., Muraoka, M., Yasuno, M., Igari, T., Koike, M., Chiba, M., and Mori, T. (1997). Nature Genet. 17, 271–272. Morson, B. C. (1962). Dis. Colon Rectum 5, 337– 344. Narita, T., Eto, T., and Ito, T. (1987). Am. J. Surg. Pathol. 11, 76 – 81. Nicolaides, N. C., Papadopoulos, N., Liu, B., Wei, Y. F., Carter, K. C., Ruben, S. M., Rosen, C. A., Haseltine, W. A., Fleischmann, R. D., Fraser, C. M., et al. (1994). Nature 371, 75 – 80. Nishisho, I., Nakamura, Y., Miyoshi, Y., Miki, Y., Ando, H., Horii, A., Koyama, K., Utsunomiya, J., Baba, S., and Hedge, P. (1991). Science 253, 665 – 669. Nowell, P. C. (1976). Science 194, 23 –28. Olschwang, S., Tiret, A., Laurent-Puig, P., Muleris, M., Parc, R., and Thomas, G. (1993). Cell 75, 959–968. Papadopoulos, N., Nicolaides, N. C., Wei, Y. F., Ruben, S. M., Carter, K. C., Rosen, C. A., Haseltine, W. A., Fleischmann, R. D., Fraser, C. M., Adams, M. D., et al. (1994). Science 263, 1625–1629. Parsons, R., Li, G. M., Longley, M., Fang, W. H., Papadopoulos, N., Jen, J., de la Chapelle, A., Kinzler, K. W., Vogelstein, B., and Modrich, P. (1993). Cell 75, 1227–1236. Parsons, R., Li, G. M., Longley, M., Modrich, P., Liu, B., Berk, T., Hamilton, S. R., Kinzler, K. W., and Vogelstein, B. (1995). Science 268, 738 –740.
From Tumor Predisposition to Somatic Diversification
113
Parsons, R., Li, G. M., Longley, M., Modrich, P., Liu, B., Berk, T., Hamilton, S. R., Kinzler, K. W., and Vogelstein, B. (1995). Science 268, 738 –740. Peltomäki, P., Aaltonen, L. A., Sistonen, P., Pylkkänen, L., Mecklin, J.-P., Järvinen, H., Green, J., Jass, J., Weber, J., Leach, F., Petersen, G., Hamilton, S., de la Chapelle, A., and Vogelstein, B. (1993). Science 260, 810 – 812. Phillips, R. K. S., Spigelman, A. D., and Thomson, J. P. S. (eds.) (1994). “Familial Adenomatous Polyposis and Other Polyposis Syndromes.” Edward Arnold, London. Plail, R. O., Bussey, H. J. R., Glazer, G., and Thomson, J. P. S. (1987). Br. J. Surg. 74, 377– 380. Potten, C. S., and Loeffler, M. (1990). Development 110, 1001–1020. Rampino, N., Yamamoto, H., Ionov, Y., Li, Y., Sawai, H., Reed, J. C., and Perucho, M. (1997). Science 275, 967– 969. Ricciardone, M. D., Ozcelik, T., Cevher, B., Ozdag, H., Tuncer, M., Gurgey, A., Richards, B., Zhang, H., Phear, G., and Meuth, M. (1997). Science 277, 1523 –1526. Shibata, D., Navidi, W., Salovaara, R., Li, Z. H., and Aaltonen, L. A. (1996). Nature Med. 2, 676–681. Shibata, D., Peinado, M. A., Ionov, Y., Malkhosyan, S., and Perucho, M. (1994). Nature Genet. 6, 273–281. Solomon, E., Voss, R., Hall, V., Bodmer, W. F., Jass, J. R., Jeffreys, A. J., Lucibello, F. C., Patel, I., and Rider, S. H. (1987). Nature 328, 616 – 619. Spirio, L., Olschwang, S., Groden, J., et al. (1993). Cell 75, 951– 957. Spirio, L., Otterud, B., Stauffer, D., Lynch, H., Lynch, P., Watson, P., Lanspa, S., Smyrk, T., Cavalieri, J., Howard, L., et al. (1992). Am. J. Hum. Genet. 51, 92–100. Spirio, L. N., Samowitz, W., Robertson, J., Robertson, M., Burt, R. W., Leppert, M., and White, R. (1998). Nature Genet. 20, 385 – 388. Strand, M., Prolla, T. A., Liskay, R. M., and Petes, T. D. (1993). Nature 365, 274 –276. Streisinger, G., Okada, Y., Emrich, J., Newton, J., Tsugita, A., Terzaghi, E., and Inouye, M. (1966). Cold Springs Harbor. Symp. Quant. Biol. 31, 77– 84. Stryker, S. J., Wolff, B. G., Culp, C. E., Libbe, S. D., Ilstrup, D. M., and MacCarty, R. L. (1987). Gastroenterology 93, 1009 –1013. Sugarbaker, J. P., Gunderson, L. L., and Wittes, R. E. (1985). “Cancer: Principles and Practices in Oncology” (V. T. DeVita, Jr., S. Hellman, and S. A. Rosenberg, eds.), pp. 800 – 803. Lippincott, Philadelphia. Thibodeau, S. N., Bren, G., and Schaid, D. (1993). Science 260, 816 – 819. Tiainen, M., Ylikorkala, A., and Mäkela, T. P. (1999). Proc. Natl. Acad. Sci. USA 96, 9248 – 9251. Tomlinson, I. P. M., Novelli, M. R., and Bodmer, W. F. (1996). Proc. Natl. Acad. Sci. USA 93, 14800–14803. Traboulsi, E. I., Krush, A. J., Gardner, E. J., Booker, S. V., Offerhaus, G. J., Yardley, J. H., Hamilton, S. R., Luk, G. D., Giardiello, F. M., Welsh, S. B., et al. (1987). N. Engl. J. Med. 316, 661–667. Tsao, J. L., Davis, S. D., Baker, S. M., Liskay, R. M., and Shibata, D. (1997). Am. J. Pathol. 151, 573–579. Tsao, J. L., Tavaré, S., Salovaara, R., Jass, J. R., Aaltonen, L. A., and Shibata, D. (1999). Am. J. Pathol. 154, 815 – 824. Tsao, J. L., Yatabe, Y., Salovaara, R., Jarvinen, H. J., Mecklin, J. P., Aaltonen, L. A., Tavaré, S., and Shibata, D. (2000). Proc. Natl. Acad. Sci. USA 97, 1236 –1241. Umar, A., Boyer, J. C., and Kunkel, T. A. (1994). Science 266, 814 – 816. Utsunomiya, J., and Nakamura, T. (1975). Br. J. Surg. 62, 45 – 51. Uzunalimoglu, O., Cetinkaya, H., Tanyeli, A., Erken, E., and Ozturk, M. (1999). Cancer Res. 59, 290–293. Vasen, H. F., Watson, P., Mecklin, J. P., and Lynch, H. T. (1999). Gastroenterology 116, 1453 – 1456.
114
Darryl Shibata and Lauri A. Aaltonen
Vasen, H. F. A., Mecklin, J.-P., Meera Khan, P., and Lynch, H. T. (1991). Dis Colon Rectum 34, 424–425. Vogelstein, B., Fearon, E. R., Hamilton, S. R., Kern, S. E., Preisinger, A. C., Leppert, M., Nakamura, Y., White, R., Smits, A. M., and Bos, J. L. (1988). N. Engl. J. Med. 319, 525 – 532. Wang, Q., Lasset, C., Desseigne, F., Frappaz, D., Bergeron, C., Navarro, C., Ruano, E., and Puisieux, A. (1999). Cancer Res. 59, 294 –297. Watanabe, H., Enjoji, M., Yao, T., and Ohsato, K. (1978). Hum. Pathol. 9, 269 –283. Yao, X., Buermeyer, A. B., Narayanan, L., Tran, D., Baker, S. M., Prolla, T. A., Glazer, P. M., Liskay, R. M., and Arnheim, N. Proc. Natl. Acad. Sci. USA 96, 6850 – 6855. Zborowska, E., Kinzler, K. W., Vogelstein, B., et al. (1995). Science 268, 1336 –1338.
Primary Effusion Lymphoma: A Liquid Phase Lymphoma of Fluid-Filled Body Cavities Gianluca Gaidano* and Antonino Carbone† *Division of Internal Medicine Department of Medical Sciences Amedeo Avogadro University of Eastern Piedmont 28100 Novara, Italy †Division of Pathology Centro di Riferimento Oncologico IRCCS Istituto Nazionale Tumori 33081 Aviano, Italy
I. Definition of Primary Effusion Lymphoma A. Cytomorphology and Pathology B. Phenotype and Genotype II. Histogenes of Primary Effusion Lymphoma III. Pathogenesis of Primary Effusion Lymphoma A. Viruses B. Karyotypic Alterations and Molecular Lesions C. Cell Cycle Abnormalities D. Cytokine Deregulation E. Met/Hepatocyte Growth Factor Interactions F. Adhesion Molecules G. Antigen Stimulation and Selection IV. Epidemiology of Primary Effusion Lymphoma V. Clinical Features of Primary Effusion Lymphoma VI. Radioimaging of Primary Effusion Lymphoma VII. Differential Diagnosis of Primary Effusion Lymphoma VIII. Therapy of Primary Effusion Lymphoma IX. Perspectives References
Primary effusion lymphoma (PEL) is a B-cell neoplasm characterized by infection of the tumor clone by human herpesvirus type-8/Kaposi’s sarcoma-associated herpesvirus (HHV-8/KSHV) and by liquid growth in fluid-filled body spaces. During its entire clinical course, the lymphoma tends to remain localized to the serous body cavities with no formation of solid tumor masses. The epidemiology of PEL points to a close link with underlying immunodeficiency of the host, as most cases develop in individuals severely immunocompromised because of preexisting acquired immunodeficiency syndrome. The Advances in CANCER RESEARCH Vol. 80 0065-230X/01 $35.00
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
116
Gianluca Gaidano and Antonino Carbone
histogenesis and pathogenesis of PEL have been clarified to a sizeable extent by intensive investigations performed since the disease recognition in 1995. PEL is composed of postgerminal center B cells, which bridge immunoblastic and anaplastic features and typically display a non-B, non-T phenotype consistent with late stages of B-cell differentiation. HHV-8/KSHV is thought to play a major role in PEL pathogenesis via expression of several viral latent genes, which have the potential to affect B-cell growth. Other factors involved in PEL pathogenesis include deregulation of cytokine and growth factor autocrine loops, molecular alterations of the tumor DNA, cell cycle abnormalities, stimulation and selection by antigen, and infection by Epstein–Barr virus, which occurs in 70% of PEL cases. In the years since the disease discovery, the distinctiveness of the biological and clinicopathological features of PEL has prompted its recognition as an independent lymphoma category by the World Health Organization classification system of hematologic neoplasms. © 2000 Academic Press.
I. DEFINITION OF PRIMARY EFFUSION LYMPHOMA Since its recognition in 1995, primary effusion lymphoma (PEL) is a wellcharacterized disease which is classified as an independent nosologic entity by the World Health Organization (WHO) classification of neoplastic diseases of the hematopoietic and lymphoid tissues (Harris et al., 1999). The distinguishing features of PEL are infection of the tumor clone by human herpesvirus type-8/Kaposi’s sarcoma herpesvirus (HHV-8/KSHV) and liquid phase growth in fluid-filled spaces, generally the serous cavities, in the absence of tumor mass formation. Lymphomas consistent with PEL had been reported since 1989 (Knowles et al., 1989; Walts et al., 1990; Green et al., 1995). However, it was only after the discovery of HHV-8/KSHV that PEL, initially called body cavity-based lymphoma, could be differentiated from all other known types of lymphomas based on the consistent association with infection by this novel herpesvirus (Carbone et al., 1996; Cesarman et al., 1995a; Chang et al., 1994; Pastore et al., 1995). Intensive investigations performed since the disease recognition have clarified that PEL is a rare lymphoma of HHV-8/KSHV-infected, preterminally differentiated B cells, which preferentially develops in severely immunocompromised patients, typically exemplified by human immunodeficiency virus (HIV)-infected individuals. To date, PEL can be easily recognized from other lymphomas and malignant effusions based on the peculiar epidemiological, clinical, morphological, and molecular features of the disease.
A. Cytomorphology and Pathology Morphologically, PEL cells bridge the features of large cell immunoblastic plasmacytoid lymphoma and of anaplastic large cell lymphoma (Carbone et
Primary Effusion Lymphoma
117
al., 1996; Cesarman et al., 1995a; Jaffe, 1996; Nador et al., 1996) (Fig. 1). Cells are markedly atypical, usually large (15–25 m in diameter), irregularly shaped, possess abundant amphophilic to deeply basophilic cytoplasm, and a moderate-to-high nuclear-to-cytoplasmic ratio. Nuclei are usually large, variably chromatic and pleomorphic (Ansari et al., 1996; Ascoli et al., 1998; Carbone et al., 1996; Cesarman et al., 1995a; Gessain et al., 1997; Jaffe, 1996; Jones et al., 1996; Karcher and Alkan, 1997; Komanduri et al., 1996; Mansour et al., 1998; Nador et al., 1996; Vadmal et al., 1998). One or more prominent, centrally located eosiniphilic nucleoli are generally present. Scattered mitotic figures, many atypical, are also frequently observed. Occasional giant pleomorphic cells contain highly irregular to hyperconvoluted nuclei and some of these cells may be binucleated, resembling the Reed–Sternberg cells of Hodgkin’s lymphoma (Carbone et al., 1996; Nador et al., 1996). Cells displaying nuclear fragmentation and karyopyknosis may also be present in PEL specimens, consistent with a certain degree of apoptosis. Reactive cells, including small lymphocytes, macrophages, and rare mesothelial cells, may be admixed with the neoplastic population. The basic pathologic feature of PEL is a diffuse spreading along the serous membranes without markedly infiltrative or destructive growth patterns (Carbone and Gaidano, 1997; Komanduri et al., 1996; Nador et al., 1996). As seen at autopsy or incidentally revealed by a computed tomography scan (Fig. 2), PEL present as multiple small tumor foci involving the serous membranes, which appear irregularly thickened (Carbone and Gaidano, 1997; Komanduri et al., 1996; Morassut et al., 1998). Most PEL initially affect one single serous cavity, generally the pleural cavity (Ansari et al., 1996; Ascoli et al., 1998; Carbone et al., 1996; Carbone and Gaidano, 1997; Cesarman et al., 1995a; Gessain et al., 1997; Jaffe, 1996; Jones et al., 1996; Karcher and Alkan, 1997; Komanduri et al., 1996; Mansour et al., 1998; Nador et al., 1996; Vadmal et al., 1998). In addition to serous cavities, a bona fide case of PEL localized solely to the subarachnoid space and growing in liquid phase in the absence of tumor masses has been identified (Ely et al., 1999). The detection of PEL in liquid-filled spaces other than the serous cavities suggests that the general feature of PEL is a peculiar tropism for fluid-filled body cavities. Although PEL usually remain localized to body cavities throughout the clinical course of the lymphoma, extension into tissues underlying the serous membranes, including the omentum and the outer parts of the gastrointestinal tract wall, may occasionally occur (Ascoli et al., 1998; Carbone et al., 1996; Carbone and Gaidano, 1997; Cesarman et al., 1995a; Gessain et al., 1997; Jaffe, 1996; Jones et al., 1996; Karcher and Alkan, 1997; Komanduri et al., 1996; Mansour et al., 1998; Nador et al., 1996; Vadmal et al., 1998). Involvement of mediastinal lymph nodes, visceral lymphatics, or other superficial and deep lymph nodes, with or without parenchimal infiltration, has been observed in some cases. Involvement of the bone marrow is absolutely
118
Gianluca Gaidano and Antonino Carbone
exceptional, although peripheral blood invasion has been documented in one case (Boshoff et al., 1998).
B. Phenotype and Genotype Typically, PEL exhibit a non-B, non-T indeterminate immunophenotype, as they lack expression of surface immunoglobulin and of B (e.g., CD19 and CD79a)- and T (e.g., CD3 and CD5)-cell associated antigens (Ansari et al., 1996; Ascoli et al., 1998; Carbone et al., 1996; Cesarman et al., 1995a; Gessain et al., 1997; Jaffe, 1996; Jones et al., 1996; Karcher and Alkan, 1997; Komanduri et al., 1996; Mansour et al., 1998; Nador et al., 1996; Vadmal et al., 1998). Expression of the CD45 antigen confirms the hematolymphoid derivation of PEL cells, and positivity for the CD138/syndecan-1 molecule, coupled to immunogenotypic features (see later), indicates that the lymphoma reflects an advanced stage of B-cell differentiation, close to plasma cells (preplasma cells) (Gaidano et al., 1997b) (Fig. 3). In addition to CD45 and CD138/syndecan-1, PEL cells generally express various phenotypic markers associated with activation, including CD30, CD38, CD71, and epithelial membrane antigen (EMA) (Fig. 3). Expression of the CD20 B-cell antigen and of very low levels of cytoplasmic immunoglobulin (Ig) molecules may occur in a small fraction of PEL cases, consistent with the B-cell lineage derivation of the disease. Despite the indeterminate phenotype, PEL is consistently represented by a monoclonal B-cell population, as documented by immunogenotypic studies (Cesarman et al., 1995a; Nador et al., 1996). Also, by mRNA in situ hybridization techniques, PEL show restriction in the expression pattern of Ig light chains (Carbone et al., 1996). Taken together, the immunophenotypic and immunogenotypic characteristics of PEL suggest that this lymphoma represents the malignant counterpart of a B-cell that has reached a mature stage of development and is conceivably shifting toward terminal plasma cell differentiation. At the molecular level, PEL display genetic features that distinguish this lymphoproliferation from all other identified categories of lymphoma (Ansari et al., 1996; Ascoli et al., 1998; Carbone et al., 1996; Cesarman et al., 1995a; Gessain et al., 1997; Jaffe, 1996; Jones et al., 1996; Karcher and Alkan, 1997; Komanduri et al., 1996; Mansour et al., 1998; Nador et al., 1996; Vadmal et al., 1998). Infection of the tumor clone by HHV-8/KSHV constitutes the genetic hallmark of the disease, occurs in all cases of PEL, and is assumed to be a sine qua non for PEL diagnosis. In addition to infection by HHV-8/KSHV, PEL is also frequently infected by Epstein–Barr virus (EBV), particularly in acquired immunodeficiency syndrome (AIDS)-related cases, whereas most PEL of HIV-negative hosts are EBV negative. Finally, PEL are consistently devoid of rearrangements of BCL-1, BCL-2, BCL-6, and c-MYC, which are detected at sustained frequencies in other types of ag-
Primary Effusion Lymphoma
119
gressive B-cell lymphomas (Carbone et al., 1996; Cesarman et al., 1995a; Gaidano et al., 1999; Nador et al., 1996).
II. HISTOGENESIS OF PRIMARY EFFUSION LYMPHOMA In recent times, the field of B-cell lymphoma histogenesis has progressed rapidly due to the increasing availability of histogenetic markers of lymphoid cells (Gaidano and Carbone, 2000; Kuppers et al., 1999). In normal B-cell physiology, the presence, or absence, of these histogenetic markers denotes different stages of lymphoid differentiation, allowing the distinction of mature B cells into virgin (i.e., pregerminal center) B cells, germinal center B cells, and postgerminal center (i.e., either memory B cells or plasma cells) B cells (Fig. 4). Because these histogenetic markers are also retained on neoplastic transformation, a model of lymphoma histogenesis has been developed based on the combination of markers associated with the tumor clone (Fig. 4). Genotypic markers of B-cell histogenesis are represented by mutations of Ig variable (IgV) genes and of the BCL-6 protooncogene (Capello et al., 2000b; Kuppers et al., 1999; Pasqualucci et al., 1998; Shen et al., 1998). Somatic hypermutation of IgV genes is a process by which mutations are introduced at a high rate into IgV genes (Kuppers et al., 1999). As a result, some B-cell mutants in germinal centers produce antibodies with increased affinity for the immunizing antigen and are positively selected. In parallel to somatic IgV hypermutation, normal B cells transiting through the germinal center accumulate point mutations of the BCL-6 protooncogene (Capello et al., 2000b; Pasqualucci et al., 1998; Shen et al., 1998). BCL-6 mutations are somatic in nature, are often multiple in the same clone, and may be biallelic. The sequences affected by these mutations lie in the proximity of the BCL6 promoter and overlap with the major cluster of chromosomal breakpoints. Because mutations of IgV and BCL-6 are somatically acquired by B cells at the time of germinal center transit (Fig. 4), positivity for these mutations indicates that a given lymphoma derives from germinal center or postgerminal center B cells. The distinction between germinal center and postgerminal center B-cell lymphomas is made possible by phenotypic markers of histogenesis, including expression of the BCL-6 protein and of the CD138/syndecan-1 antigen (Fig. 4). BCL-6 encodes a POZ/zinc finger trascriptional repressor, which, in the B-cell lineage, is expressed selectively by germinal center B cells, but not by immature B-cell precursors or differentiated plasma cells (BajalicaLangercrantz et al., 1997; Cattoretti et al., 1995). CD138/syndecan-1 is a member of the syndecan family, which, among mature B cells, selectively
120
Gianluca Gaidano and Antonino Carbone
Fig. 4 A proposed model for the histogenesis of PEL compared to that of other types of AIDSrelated lymphomas. The model is based on genotypic and phenotypic markers of B-cell histogenesis. Genotypic markers include mutations of IgV and BCL-6 genes, which are accumulated at the time of germinal center (GC) transit and therefore denote histogenetic derivation from GC-related B cells (either GC or post-GC B cells). Mutations of IgV and/or BCL-6 genes occur in most PEL and other AIDS-related lymphomas, corroborating their histogenesis from GCrelated B cells. Phenotypic markers are based on the expression profile of the BCL-6 protein and CD138/syndecan-1 (syndecan-1) antigen throughout physiologic B-cell maturation. B cells within the GC display the BCL-6+ /syndecan-1⫺ phenotype, whereas B cells that have exited the germinal center and have undergone further maturation toward the plasma cell stage exhibit the BCL-6⫺ /syndecan-1+ phenotype. Lymphomas displaying the BCL-6+ /syndecan-1⫺ phenotype, i.e., Burkitt lymphoma (BL) and large noncleaved cell lymphoma (LNCCL), are postulated to originate from germinal center B cells. Conversely, lymphomas displaying the BCL-6⫺ / syndecan-1+ phenotype, i.e., immunoblastic plasmacytoid lymphoma (IBPL) and PEL, are postulated to derive from post-GC, preterminally differentiated B cells.
clusters with the plasma cell stage of differentiation (Bernfield et al., 1992; Carey, 1997). On these bases, lymphomas may be histogenetically distinguished into: (i) lymphomas devoid of somatic IgV and BCL-6 hypermutation, which derive from naive, pregerminal center B cells; (ii) lymphomas associated with somatic IgV and/or BCL-6 hypermutation, as well as BCL-6 protein expression, and thus closely reflecting germinal center B cells; and (iii) lymphomas associated with somatic IgV and/or BCL-6 hypermutation, as well as CD138/
Primary Effusion Lymphoma
121
syndecan-1 positivity, which conceivably represent lymphomas of postgerminal center B cells. Based on this model, PEL is thought to originate from germinal center-related B cells, as the lymphoma frequently harbors mutations of IgV and BCL-6 genes (Fais et al., 1999; Gaidano et al., 1999; Matolcsy et al., 1998). Because PEL display the BCL-6 — /syn-1+ phenotype, the lymphoma is regarded as a neoplasm of postgerminal center, preterminal B cells, which have migrated to the serous membranes and selectively localized at such sites (Fig. 4) (Gaidano et al., 1997b; Carbone et al., 1998b). Further refinement of PEL histogenesis may be expected from the availability of novel phenotypic markers. One such marker may be represented by MUM-1/ICSAT (for multiple myeloma-1/interferon consensus sequencebinding protein for activated T cells), a lymphocyte-specific member of the interferon regulatory factor family of transcription factors, which is involved in a translocation of multiple myeloma (Iida et al., 1997; Tsuboi et al., 2000; Yoshida et al., 1999). Evidence has shown that MUM-1/ICSAT expression identifies a stage of B-cell differentiation corresponding to transition from BCL-6 positivity (germinal center B cells) to CD138 expression (immunoblasts and plasma cells) (Gaidano and Carbone, 2000; Tsuboi et al., 2000).
III. PATHOGENESIS OF PRIMARY EFFUSION LYMPHOMA Most studies of PEL pathogenesis have focused on viral infection by HHV8/KSHV. These studies have highlighted several mechanisms by which HHV8/KSHV may exert its transforming ability and have led to the notion that HHV-8/KSHV is an essential pathogenetic requirement for PEL insurgence and growth (Boshoff and Weiss, 1998; Moore and Chang, 1998; Sarid et al., 1999a; Schulz, 1998; Schulz and Moore, 1999). However, because PEL is represented in all cases by a monoclonal proliferation, it is unlikely that PEL pathogenesis may be recapitulated solely by viral infection. Rather, as exemplified by the case of other virus-associated human lymphomas (Klein, 1994; Smith and Green, 1991), it is conceivable that PEL development and growth require the accumulation of molecular lesions of cellular cancer related loci. Because many cases of PEL are coinfected by EBV, it has been postulated that this virus may play a role in PEL development. Also, based on the example of other B-cell lymphomas arising in the setting of immunodeficiency (Gaidano et al., 1998), multiple additional mechanisms are likely to be involved in PEL pathogenesis, including reduced immunosurveillance against virus-infected B cells, HIV-induced alteration of cell migration, B-cell stimulation and selection by antigen, deregulation of several cytokine loops, signal transduction abnormalities, as well as alterations in cellular adhesion molecules.
122
Gianluca Gaidano and Antonino Carbone
A. Viruses PEL is the one disease that has been discovered as a distinct nosologic entity based on its peculiar virologic features. HHV-8/KSHV is a sine qua non for PEL diagnosis and a major player in PEL pathogenesis. In addition, EBV and HIV are thought to contribute to PEL development.
1. HUMAN HERPESVIRUS TYPE-8/KAPOSI’S SARCOMA-ASSOCIATED HERPESVIRUS HHV-8/KSHV is a gamma herpesvirus that was originally identified in Kaposi’s sarcoma lesions from HIV-infected individuals (Chang et al., 1994). The structural and functional characterization of HHV-8/KSHV has been reviewed extensively elsewhere and is out of the scope of this work (Boshoff and Weiss, 1998; Moore and Chang, 1998; Sarid et al., 1999a; Schulz, 1998; Schulz and Moore, 1999). Human diseases associated with HHV-8/KSHV infection include PEL, all epidemiological variants of Kaposi’s sarcoma, and multicentric Castleman’s disease (Cesarman et al., 1995a; Gaidano et al., 1996b; Moore and Chang, 1995; Soulier et al., 1995). Among HIV-related neoplasms, HHV-8/KSHV infection of the tumor population clusters with PEL and Kaposi’s sarcoma, whereas it is consistently negative in systemic non-Hodgkin’s lymphoma, primary central nervous system lymphoma, Hodgkin’s lymphoma, and anogenital neoplasia of both men and women (Antinori et al., 1999; Cesarman et al., 1995a; Gaidano et al., 1996b, 1997a). Extensive screening studies from different geographical areas of the world have defined that HHV-8/KSHV infection of the tumor clone is selective for PEL among lymphomas, including other types of lymphoma affecting the body cavities (see also later in this review) (Cesarman et al., 1995a, 1996a; Feuillard et al., 1997; Gaidano et al., 1996b; Gessain et al., 1997; Otsuki et al., 1996; Pastore et al., 1995; Uphoff et al., 1998). The only possible exception may be rare cases of primary bowel lymphoma arising in HIV-infected individuals (DePond et al., 1997). The lymphotropism of HHV-8/KSHV is well documented in health and disease. Conceivably, the lymphoid system represents a reservoir from which the virus reactivates on immunosuppression (Ambroziak et al., 1995; Bigoni et al., 1996). Immunosuppression appears to be a major factor in driving the emergence of HHV-8/KSHV-related disorders, including PEL, as HHV8/KSHV infection in many immunocompetent individuals remains totally subclinical with no evidence of active disease (Boshoff and Weiss, 1998; Moore and Chang, 1998; Sarid et al., 1999a; Schulz, 1998; Schulz and Moore, 1999). Consistent with this notion, PEL is very uncommon, even in populations in which the seroprevalence of HHV-8/KSHV infection is relatively high (Carbone et al., 1996).
Primary Effusion Lymphoma
123
The number of HHV-8/KSHV DNA copies in PEL cells is high, oscillating between 20 and more than 50 copies per cell (Carbone et al., 1996; Cesarman et al., 1995a). HHV-8/KSHV in PEL is present primarily in a latent state, although, both in vivo and in vitro, there appears to be a small, but consistent, population of tumor cells in which HHV-8/KSHV infection is lytic (Boshoff and Weiss, 1998; Dupin et al., 1999; Moore and Chang, 1998; Sarid et al., 1998, 1999a; Schulz, 1998; Schulz and Moore, 1999). In accordance with latent HHV-8/KSHV infection, the viral DNA appears to be predominantly in the nucleus in episomal structures, although complete or incomplete viral particles may be seen in few cells harboring lytic infection (Hsi et al., 1998; Said et al., 1996a, 1999). Despite the marked genotypic heterogeneity of HHV-8/KSHV in human populations, development of PEL in a given patient associates with one single viral genotype (Gao et al., 1999), consistent with the monoclonality of infection (Russo et al., 1996). No specific genotypic variant of HHV-8/KSHV preferentially associates with PEL, and the viral genotypes found in this lymphoma reflect their geographical distribution in the population of origin (Gao et al., 1999). The virus genome harbors several genes that are homologous to, and conceivably pirated from, mammalian genes encoding cellular proteins involved in the control of growth and differentiation of human cells (Boshoff and Weiss, 1998; Moore and Chang, 1998; Sarid et al., 1999a; Schulz, 1998; Schulz and Moore, 1999). These include inhibitors of apoptosis (viral BCL2 and viral FLIP), cytokines (viral interleukin-6 and viral macrophage inhibitory proteins), cell cycle regulators (viral cyclin), signal transducers (viral G-protein coupled receptor), and transcription factors involved in growth regulation and antiviral responses (viral interferon regulatory factor) (Russo et al., 1996). Many of these genes are expressed solely in the lytic phase of the viral cycle and therefore their pathogenetic contribution to latently infected tumors remains uncertain (Boshoff and Weiss, 1998; Moore and Chang, 1998; Sarid et al., 1998, 1999a; Schulz, 1998; Schulz and Moore, 1999). However, a cluster of viral genes with oncogenic potential is consistently expressed by latently infected PEL cells, suggesting a direct transforming activity of HHV-8/KSHV (Boshoff and Weiss, 1998; Dittmer et al., 1998; Moore and Chang, 1998; Sarid et al., 1999a; Schulz, 1998; Schulz and Moore, 1999; Talbot et al., 1999). To date, a role of HHV-8/KSHV genes in PEL pathogenesis has been attributed to latent nuclear antigen (LANA), viral cyclin, and viral IL-6, although the pathogenetic contribution of several other genes is under investigation. The role of viral cyclin and viral IL-6 is discussed in later sections of this review. LANA, also known as ORF73 (for open reading frame 73), is expressed by virtually all latently infected PEL cells (Fig. 5). The molecule has an essential function for HHV-8/KSHV episomal replication, as LANA tethers the viral DNA to chromosomes during mitosis to enable the efficient
124
Gianluca Gaidano and Antonino Carbone
segregation of HHV-8/KSHV episomes to progeny cells (Ballestas et al., 1999; Sarid et al., 1999b). LANA, however, also exerts functions that may directly affect cell fate. In fact, LANA interacts with the tumor suppressor protein p53 and represses its transcriptional activity, thus promoting cell survival and/or growth by altering p53 function (Friborg et al., 1999). In this respect, LANA may play a key role in promoting the expansion of HHV-8/ KSHV-infected tumor cells.
2. EPSTEIN–BARR VIRUS EBV infection occurs in 70 –80% of PEL and is preferentially associated with AIDS-related cases (Ansari et al., 1996; Ascoli et al., 1998; Carbone et al., 1996; Carbone and Gaidano, 1997; Cesarman et al., 1995a; Gessain et al., 1997; Jaffe, 1996; Jones et al., 1996; Karcher and Alkan, 1997; Komanduri et al., 1996; Mansour et al., 1998; Nador et al., 1996; Vadmal et al., 1998). EBV infection in PEL is generally monoclonal, suggesting that the virus infects the tumor cells since the early phases of clonal expansion, and is typically latent (Carbone et al., 1996; Cesarman et al., 1995a; Horenstein et al., 1997). The EBV latency program of PEL is consistent with latency I (Horenstein et al., 1997; Klein et al., 1989). In accordance with the latency I phenotype, the expression of EBV latent genes in PEL is restricted to EBER mRNAs and to EBNA-1, a gene required for replication and maintenance of viral episomes and displaying some oncogenic potential (Komano et al., 1998; Kube et al., 1999; Wilson et al., 1996). The profile of EBV antigen expression in PEL closely reflects the phenotypic profile of EBV-positive Burkitt’s lymphoma and markedly differs from that displayed by AIDS-related, large cell immunoblastic plasmacytoid lymphoma, which usually expresses a latency II phenotype (positivity for EBNA-1 and LMP-1) (Carbone et al., 1998b). The difference in the EBV expression pattern between PEL and large cell immunoblastic plasmacytoid lymphoma is surprising, as the two lymphomas share a number of features, including development as a late complication of AIDS in severely lymphopenic patients, frequency of EBV infection of the tumor clone, morphologic similarity, and expression of CD138/syndecan-1 denoting an advanced stage of B-cell differentiation (Carbone et al., 1998b; Gaidano et al., 1998). It is possible that HHV-8/KSHV coinfection modulates the expression of EBV antigens or, alternatively, that the preplasma cell stage of differentiation of PEL is not permissive for latency II expression. The absence of significant expression of the major EBV growth transforming factors EBNA-2 and LMP-1 suggests that EBV is not singly responsible for PEL growth, at least based on conventional models of EBV transformation of B cells. This notion is further substantiated by the occur-
Primary Effusion Lymphoma
125
rence of cases of PEL that are devoid of EBV infection, as well as by the selection of EBV negative clones during the cell line establishment of EBV positive PEL (Arvanitakis et al., 1996; Boshoff et al., 1998; Carbone et al., 1998a; Gaidano et al., 1999; Katano et al., 1999; Renne et al., 1996; Said et al., 1996b). However, it has been hypothesized that cell transformation in tumors expressing the EBV latency I phenotype may be mediated by pathways alternative to EBNA-1. Such alternative transforming pathways may be related, at least in part, to a class of noncoding, although highly expressed, small mRNAs termed EBER (Komano et al., 1999). Because EBER are expressed in PEL (Carbone et al., 1996; Horenstein et al., 1997), it is possible that these mRNAs play a role in the development and growth of these lymphomas. Genotypic analysis of EBV infection in PEL, performed with multiple polymorphic markers, has revealed one single EBV genotype in each individual case, consistent with the monoclonality of infection (Fassone et al., 2000a). Some studies have hypothesized that, in EBV positive lymphomas displaying the latency I phenotype, viral tumorigenicity may be ascribed to specific mutations in the DNA-binding/dimerization domain of the EBNA-1 gene (Bhatia et al., 1996; Gutierrez et al., 1997, 1998). PEL, however, does not preferentially associate with a given EBV genotypic variant (Fassone et al., 2000a). Rather, comparative analysis of EBV genetic variability in AIDSrelated PEL and in peripheral blood mononuclear cells of HIV positive individuals without lymphoma suggests that the representation of EBV genotypes in PEL reflects the overall prevalence of EBV variants in the HIV positive population (Fassone et al., 2000a).
3. HUMAN IMMUNODEFICIENCY VIRUS The role of HIV in PEL development is not recapitulated solely by immunodeficiency. Rather, HIV-1 Tat, a viral protein that transactivates viral and cellular genes, altering the adhesion and migratory behavior of target cells, may play a direct role in the pathogenesis of AIDS-related PEL (Chirivi et al., 1999). In fact, Tat significantly augments the motility of PEL cells in vitro through chemotactic properties that are dependent on a collaboration between the RGD and the basic domain of the molecule (Chirivi et al., 1999). The chemotactic role of Tat in inducing lymphoma migration has also been shown in the case of AIDS-related Burkitt’s lymphoma (Chirivi et al., 1999). An alternative mechanism through which Tat may influence lymphomagenesis is increased cellular adhesion of tumor cells to the endothelium, thus bringing the tumor clone in close contact with growth and/or survival factors (Chirivi et al., 1999). This mechanism remains to be proved in the case of AIDS-related PEL.
126
Gianluca Gaidano and Antonino Carbone
B. Karyotypic Alterations and Molecular Lesions A commonly shared view of non-Hodgkin’s lymphoma pathogenesis is that each specific category of the disease associates with a well-defined molecular pathway that drives the clinical and pathological behavior of the disease (Gaidano and Dalla-Favera, 2000). Such molecular pathways involve genetic alterations of cancer-related genes and, in some cases, viral infection of the tumor clone. The validity of this assumption is demonstrated by the identification of a variety of molecular pathways in non-Hodgkin’s lymphomas and by the cloning of several protooncogenes, which are selectively and consistently altered in a given B-cell neoplasm (Gaidano and Dalla-Favera, 2000; Harris et al., 1994). With respect to PEL, however, molecular studies performed to date have failed to reveal a genetic lesion of cellular cancer related genes consistently associated with all cases of the disease. Also, PEL are devoid of the chromosomal translocations associated with other aggressive B-cell non-Hodgkin’s lymphomas, including translocations of c-MYC, BCL-6, and BCL-2 (Carbone et al., 1996; Cesarman et al., 1995a; Gaidano et al., 1999; Nador et al., 1996). To date, the sole recurrent molecular lesion of a cellular protooncogene associated with PEL is represented by mutations of BCL-6, occurring in approximately 70% of cases (Gaidano et al., 1999). Although these mutations serve to clarify PEL histogenesis, denoting its origin from germinal centerrelated B cells, their pathogenetic significance is unclear, especially since PEL cells fail to express the BCL-6 protein (Carbone et al., 1998b; Gaidano et al., 1999). Occasional cases of PEL have been found to display molecular alterations frequently observed in human neoplasms in general, such as mutations of p53, RAS, BAX, and microsatellite instability (Gaidano et al., 1997c, 2000; Nador et al., 1996). Conceivably, these alterations are secondary molecular lesions that intervene during tumor progression. The current lack of knowledge regarding cellular cancer-related genes associated with PEL does not mean that the lymphoma is devoid of molecular lesions targeting cellular DNA. Rather, based on the example of all other known virus-infected lymphomas (Klein, 1994; Smith and Green, 1991), the consistent monoclonality of PEL suggests that the disease results from the interplay between viral infection and accumulation of genetic alterations of the tumor clone DNA. Consistent with this hypothesis, PEL generally display complex karyotypes with numerous chromosomal alterations (Ansari et al., 1996; Boshoff et al., 1998; Drexler et al., 1998; Gaidano et al., 1999; Katano et al., 1999; Polito et al., 1996). Although cytogenetic investigations of PEL are still in their infancy, some studies employing advanced cytogenetic techniques have pointed to numerical and structural changes that may be recurrent in different cases, namely trisomy 12, either complete or partial, trisomy 7, and chromosomal aberrations of bands 1q21–25, including
Primary Effusion Lymphoma
127
inversion or trisomies (Gaidano et al., 1999). If confirmed by systematic cytogenetic studies of PEL, it may be postulated that these chromosomal sites harbor cancer-related loci relevant to PEL development.
C. Cell Cycle Abnormalities Investigations of cell cycle abnormalities in PEL have been prompted by knowledge that the lymphoma expresses a viral-(v-)cyclin that displays highest sequence similarity to the cellular D-type cyclins, a group of positive cell cycle regulators favoring G1 to S progression (Cesarman et al., 1996b; Chang et al., 1996; Li et al., 1997; Sherr, 1996). The effects of cellular D-type cyclins are mediated by cyclin-dependent kinases (CDK) and are negatively regulated by CDK inhibitors, including p27Kip1 (Sherr, 1996). Conversely, the effects of v-cyclin are mediated by the CDK but are resistant to CDK inhibitors (Godden-Kent et al., 1997; Swanton et al., 1997). In normal lymphoid tissues and in most subtypes of non-Hodgkin’s lymphoma, overexpression of p27Kip1 is inversely correlated with proliferation (Erlanson et al., 1998; Sanchez-Beato et al., 1997). PEL, though, consistently express p27Kip1 protein, despite the high proliferative rate of the lymphoma clone, suggesting that p27Kip1 may be unable to drive cell cycle arrest in PEL cells (Carbone et al., 2000) (Fig. 6). Abrogation of the inverse relationship between P27Kip1 expression and proliferation in PEL is associated with the tumor cell expression of v-cyclin (Fig. 6), whereas cellular cyclin D is absent in this lymphoma (Carbone et al., 2000). The coexistence of p27Kip1 expression and high proliferative index is a selective feature of PEL among lymphomas involving the serous body cavities, as secondary lymphomatous effusions generally display the inverse relationship between p27Kip1 positivity and growth fraction observed in most other types of nonHodgkin’s lymphoma (Carbone et al., 2000). These observations suggest a model in which PEL cells express high levels of P27Kip1, which, however, is unable to inactivate v-cyclin and cannot exert its physiologic function of negative regulator of cell cycle progression. Therefore, PEL would escape from P27Kip1-mediated control through substitution of the P27Kip1 physiologic target cyclin D with the HHV-8/KSHV encoded v-cyclin that is resistant to P27Kip1 activity (Carbone et al., 2000).
D. Cytokine Deregulation The role of cytokines in the pathogenesis of PEL has been investigated to a certain extent. These studies have revealed a peculiar profile of cytokines, characterized by the secretion of large amounts of interleukin-6 (IL-6), IL-10,
128
Gianluca Gaidano and Antonino Carbone
and vascular endothelial growth factor (VEGF). Some PEL cases also release oncostatin M. Apart from human IL-6, PEL also express viral IL-6 (vIL-6), which is encoded by the HHV-8/KSHV genome. Because human IL-6, vIL6, IL-10, and VEGF play a role in PEL pathogenesis in vitro and/or in vivo, interfering with these cytokine loops may provide a rationale for novel therapeutic approaches to this lymphoma.
1. INTERLEUKIN-6 PEL cells produce two types of IL-6: cellular IL-6, which is encoded by the human genome, and vIL-6, which is encoded by the HHV-8/KSHV genome (Cannon et al., 1999; Drexler et al., 1999; Foussat et al., 1999; Jones et al., 1999; Moore et al., 1996; Nicholas et al., 1997; Pastore et al., 1998; Staskus et al., 1999; Teruya-Feldstein et al., 1998). vIL-6 exhibits 24.7% amino acid identity to human IL-6 and 24.2% identity to murine IL-6, suggesting that it may be the result of viral piracy of a useful cellular gene (Moore et al., 1996; Nicholas et al., 1997). vIL-6 supports the growth of IL-6-dependent cell lines, indicating that it is a functional homologue of cellular IL-6, exploiting, at least in part, the signal transduction mechanism proper of cellular IL-6 (Aoki et al., 1999). Similar to the human homologue, vIL-6 is a multifunctional cytokine capable of promoting hematopoiesis, plasmacytosis, and angiogenesis (Aoki et al., 1999). The transforming potential of vIL-6 is documented by experimental animal models showing that the viral cytokine is tumorigenic for NIH 3T3 cells and that this effect is mediated, at least in part, by induction of VEGF leading to intense vascularization of the tumor (Aoki et al., 1999). Based on the classification scheme of HHV-8/KSHV genes proposed by Sarid et al. (1998), vIL-6 is considered to be a class II gene since it is expressed constitutively and also undergoes increased expression on induction of the lytic phase of the viral cycle. In PEL cells in vivo, vIL-6 is not uniformly expressed by the whole tumor population, but rather is restricted to a fraction of cells (Cannon et al., 1999; Staskus et al., 1999). Notably, the proportion of cells expressing vIL-6 among HHV-8/KSHV-related disoders is far more abundant in diseases of lymphoid cells, namely PEL and multicentric Castleman’s disease, than in Kaposi’s sarcoma (Cannon et al., 1999; Staskus et al., 1999). Variation in the levels of vIL-6 expression is potentially due to the tissue- and cell-specific environments of infection as well as interactions with other infectious agents. Because PEL cells express the IL-6 receptor, a pathogenetic role of the cytokine had been hypothesized since the early phases of PEL research. To date, the pathogenetic role of IL-6 is strengthened by experimental evidence indicating that both human IL-6 and vIL-6 act as autocrine growth factors for PEL in vitro and/or in reconstruction experiments in animal models (Asou
Primary Effusion Lymphoma
129
et al., 1998; Drexler et al., 1999; Foussat et al., 1999; Jones et al., 1999). Clinical trials performed in AIDS-related systemic non-Hodgkin’s lymphomas have shown that inhibition of human IL-6 delays tumor progression and relieves B symptoms (Emilie et al., 1994). This evidence, combined with the pivotal role of IL-6 and vIL-6 in PEL growth, prompted investigations aimed at defining the therapeutic value of anti-IL-6 agents in the management of PEL.
2. INTERLEUKIN-10 PEL produce and release large amounts of IL-10 both in vitro and in vivo (Asou et al., 1998; Drexler et al., 1999; Foussat et al., 1999; Jones et al., 1999; Pastore et al., 1998). Whereas IL-10 production by other B-cell lymphomas associates with EBV infection (Benjamin et al., 1992; Pastore et al., 1998), both EBV positive and EBV negative PEL are capable of IL-10 release (Asou et al., 1998; Drexler et al., 1999; Foussat et al., 1999; Jones et al., 1999; Pastore et al., 1998). The precise role of IL-10 in PEL growth is debated, as experiments aimed at IL-10 inhibition have yielded controversial results (Jones et al., 1999; Asou et al., 1998). In other AIDS-related lymphomas, though, IL-10 is a well-established autocrine growth factor (Masood et al., 1995), pointing to a potential role in PEL. The IL-10 produced by PEL may also contribute to pathogenesis in an indirect fashion by affecting the interplay among HIV, T cells, and neoplastic B cells (Spits and de Waal Malefyt, 1992). The cytokine may in fact modulate the host immune response against the tumor and may increase HIV infection by activating the virus from latently and acutely infected monocytic cells and by increasing CCR5 expression in monocytes (Hagenbaugh et al., 1997; Matsuda et al., 1994; Sozzani et al., 1998; Zeidler et al., 1997)
3. VASCULAR ENDOTHELIAL GROWTH FACTOR The critical role of VEGF in PEL pathogenesis has been appraised. Several PEL cell lines produce high levels of VEGF representative of the three VEGF-secreted isoforms: VEGF121, VEGF145, and VEGF165 (Aoki and Tosato, 1999). The precise mechanism causing deregulated VEGF production in PEL is not known, although HHV-8/KSHV has the potential to promote VEGF secretion through vIL-6 and through the virally encoded G-protein coupled receptor (Aoki et al., 1999; Bais et al., 1998). Because VEGF is released by PEL cells in the surrounding environment, it is conceivable that the cytokine contributes to effusion formation through the increased vascular permeability of serous membrane vessels (Senger et al., 1983; Shibuya, 1995). In line with this hypothesis, VEGF neutralization by specific antibodies prevents PEL growth and effusion formation in animal models (Aoki
130
Gianluca Gaidano and Antonino Carbone
and Tosato, 1999). The release of high concentrations of VEGF by PEL cells is also consistent with the marked degree of angiogenesis associated with the in vivo growth of PEL cells (Carbone and Gaidano, 1997; Picchio et al., 1997). The effect of VEGF released by PEL is mainly paracrine, as the proliferation of PEL cells, although expressing VEGF receptors, is not affected by VEGF (Aoki and Tosato, 1999). Deregulation of VEGF appears to be a feature common to all HHV-8/ KSHV-related disorders, although the precise mechanism may vary depending on the disease. In Kaposi’s sarcoma, VEGF is thought to favor angiogenesis, thus promoting vascularization and nutrient supply to virally infected cells (Brown et al., 1996; Cornali et al., 1996; Liu et al., 1997; Masood et al., 1997). In multicentric Castleman’s disease, VEGF expression by nonlymphoid cells has been associated with the excessive vascularization of the germinal centers, which is typically observed in this disorder (Foss et al., 1997). In contrast to Kaposi’s sarcoma and multicentric Castleman’s disease, in which the cytokine mainly acts via promoting tumor vascularization, the role exerted by VEGF in PEL would be essentially to accelerate vascular permeability (Aoki and Tosato, 1999).
4. OTHER CYTOKINES In vitro, PEL cells fail to produce IL-1␣, IL-1, IL-2, IL-3, IL-4, IL-5, IL7, IL-8, IL-12, IL-13, TNF␣, TNF, IFNg, TGF2, bFGF, PDGF, MIP-1␣, LIF, G-CSF, GM-CSF, and SCF (Asou et al., 1998; Drexler et al., 1999; Pastore et al., 1998). Absent production of TNF and of IL-12 distinguishes the cytokine profile of PEL from that of other AIDS-related lymphomas (Fassone et al., 2000b; Pastore et al., 1998). Conversely, a fraction of PEL cell lines produces oncostatin M, although the precise pathogenetic role of this cytokine has not been assessed (Drexler et al., 1999). Finally, exogeneous IFN␣ and IFNg are able to suppress the clonal growth of PEL cells (Asou et al., 1998). Intriguingly, IFN␣ inhibits HHV-8/KSHV reactivation in PEL cells, although this phenomenon is unlikely to explain the growth inhibition of latently infected PEL cells (Monini et al., 1999).
E. Met/Hepatocyte Growth Factor Interactions The Met protooncogene encodes a tyrosine kinase cell surface receptor capable of autophosphorylation whose physiological function is to serve as a receptor for the hepatocyte growth factor (HGF) (Giordano et al., 1992; Maggiora et al., 1997). Among lymphoid tissues, expression of Met has been reported in germinal center centroblasts, some B-cell lymphomas, and, in as-
Primary Effusion Lymphoma
131
sociation with HGF expression, in plasma cells of multiple myeloma (Borset et al., 1996a,b; Jucker et al., 1994; van der Woort et al., 1997; Weimar et al., 1997). HGF is a pleotropic cytokine of mesenchymal origin that possesses both mitogenic and motogenic properties, as it promotes cell proliferation and angiogenesis and also causes the spread of target epithelial cells (Chirgadze et al., 1998; Jiang et al., 1999). Because of its motogenic properties, HGF has also been designated “scatter factor” (Chirgadze et al., 1998; Jiang et al., 1999). In lymphoid tissues, HGF production is mainly restricted to multiple myeloma plasma cells, which also express the HGF receptor Met (Borset et al., 1996a,b). PEL have been shown to consistently coexpress Met and HGF mRNA and protein (Capello et al., 2000a). The Met receptors expressed by PEL cells are functionally competent and are able to mediate the signaling induced by binding of their cognate ligand HGF (Capello et al., 2000a). HGF molecules produced by PEL cells are released into the surrounding microenvironment and are functionally active. Among mature B-cell neoplasms, coexpression of Met and HGF appears to be relatively specific for PEL and multiple myeloma, as other types of B-cell non-Hodgkin’s lymphoma may occasionally express either Met or, more rarely, HGF but generally fail to coexpress the two molecules (Borset et al., 1996a,b; Capello et al., 2000a). The clustering of Met/HGF coexpression with PEL and multiple myeloma corroborates the notion that PEL is a tumor of preterminally differentiated B cells. Because Met and HGF are also coexpressed by Kaposi’s sarcoma spindle cells (Maier et al., 1996; Naidu et al., 1994), it is possible that Met/HGF coexpression observed in PEL and in Kaposi’s sarcoma may be related, directly or indirectly, to an effect induced by HHV-8/KSHV. Coexpression of Met and HGF bears potential implications for the pathogenesis of PEL, as the Met receptor in this lymphoma is basally activated through autocrine production of HGF (Capello et al., 2000a). In other cell types, Met activation by HGF stimulates tumorigenesis and increases cell adhesion to extracellular matrix molecules (Giordano et al., 1992; Maggiora et al., 1997; van der Woort et al., 1997; Weimar et al., 1997). The putative involvement of Met and HGF in PEL pathogenesis is reinforced by the observation that fibroblasts of serous cavities produce significant amounts of HGF, which, therefore, may be involved in both an autocrine and a paracrine fashion in PEL growth (Yashiro et al., 1996). Finally, because HGF has angiogenetic properties, the release of the cytokine by PEL cells adhering to the serosa may stimulate vessel formation. Indeed, growth of PEL cells in an animal model is accompanied by a marked degree of vascularization (Picchio et al., 1997). Similarly, autoptic studies of PEL patients have revealed that angiogenesis is a feature of serous cavities invaded by PEL cells (Carbone and Gaidano, 1997).
132
Gianluca Gaidano and Antonino Carbone
F. Adhesion Molecules The growth pattern of PEL is typically characterized by a liquid phase growth in association with confined spreading along the serous membranes without invasive or destructive growth patterns. To date, the reasons for the peculiar growth pattern of PEL are not clarified and the field of PEL cell adhesion mechanisms has received relatively little attention when compared to investigations of other features of this lymphoma. Initial studies focused on molecules regulating cell-to-extracellular matrix interactions in the B-cell lineage, such as CD138/syndecan-1, a member of the syndecan family (Gaidano et al., 1997b). As a group, syndecans are cell surface heparan sulfate proteoglycans that comprise an extracellular domain containing heparan sulfate chains, a transmembrane domain, and a short cytoplasmic domain (Bernfield et al., 1992; Carey, 1997). CD138/syndecan-1 has been shown to bind several extracellular matrix molecules via its heparan sulfate chains, including fibrillar collagens, fibronectin, thrombospondin, and tenascin (Bernstein et al., 1992; Carey, 1997). Among mature B cells, CD138/syndecan-1 is selectively expressed by plasma cells and has been proposed to mediate cell adhesion to collagen (Bernstein et al., 1992; Carbone et al., 1997b; Carey, 1992). The invariable expression of CD138/syndecan1 by PEL may cause enhanced adhesiveness to extracellular matrix components and may therefore account, at least in part, for the lack of invasive growth pattern of this lymphoma (Gaidano et al., 1997b). Indeed, CD138/ syndecan-1 expressed by PEL cells is effective in mediating cell adhesion to type I collagen substrates (Gattei et al., 1999). PEL associates with surface levels of CD138/syndecan-1 as elevated as those detected in multiple myeloma plasma cells, which use this surface proteoglycan to remain tightly anchored to the bone marrow stroma (Gaidano et al., 1997b; Gattei et al., 1999; Wijdenes et al., 1996). Curiously, however, CD138/syndecan-1 molecules expressed by PEL display a larger molecular weight than that of plasma cells due to a different representation of glycosaminoglycan chains attached to an identical protein backbone (Gattei et al., 1999). It is possible that the specific CD138/syndecan-1 isoforms expressed by PEL cells might entail peculiar binding properties and functions, which, consequently, might influence the interactions between tumor cells and their microenvironment. The pivotal role of CD138/syndecan-1 in the biology of PEL is also suggested by the demonstration that PEL cells lack other major proteoglycans, including syndecan-2, syndecan-4, and, possibly, -glycan (Gattei et al., 1999). The unusual propensity of PEL to involve predominantly body cavity surfaces could be the result of a peculiar homing pattern induced by HHV-8/ KSHV infection. Available data mainly derived from PEL cell lines and few
Primary Effusion Lymphoma
133
primary samples point to heterogeneity in the expression of homing receptors with no univocal pattern (Boshoff et al., 1998; Carbone et al., 1998a). Difficulties in understanding the biological mechanism of PEL growth pattern are made greater by the fact that tumor cells are potentially able to form solid tumor masses, as observed in a minority of PEL patients and in animal models (Carbone et al., 1996; Komanduri et al., 1996; Nador et al., 1996; Picchio et al., 1997).
G. Antigen Stimulation and Selection The development of systemic AIDS-related lymphoma is often preceded by persistent generalized lymphadenopathy (PGL), indicating the presence of antigen-induced, chronic B-cell stimulation and selection, which has been formally demonstrated by molecular investigations of IgV genes (Gaidano et al., 1998). By analogy, it has been postulated that antigen stimulation and selection may also play a role in PEL development. Indeed, most PEL investigated to date expressed IgV genes carrying a high load of somatic mutations consistent with antigen stimulation and selection (Fais et al., 1999; Matolcsy et al., 1998). Because clinically evident PEL fail to express surface Ig molecules, it is conceivable that the antigen exerted its role at the early stages of the evolution of the malignant clone.
IV. EPIDEMIOLOGY OF PRIMARY EFFUSION LYMPHOMA Characterization of the epidemiological features of PEL has been hampered by the infrequency of the disease and by the failure to recognize this lymphoma as a distinct nosologic entity during most of the AIDS epidemic, i.e., until 1995. Despite the lack of rigorous epidemiological studies of this lymphoma, all published reports of PEL reveal common features providing descriptive hints of PEL epidemiology (Ansari et al., 1996; Ascoli et al., 1998; Carbone et al., 1996; Cesarman et al., 1995a; Dotti et al., 1999; Gessain et al., 1997; Jaffe, 1996; Jones et al., 1996, 1998; Karcher and Alkan, 1997; Komanduri et al., 1996; Mansour et al., 1998; Nador et al., 1996; Vadmal et al., 1998). First, the overwhelming majority of PEL associates with the host’s overt and severe immunodeficiency due to HIV. Second, PEL may also develop in the context of other immunodeficiency settings. Third, cases of PEL developing in the general population (i.e., with no known cause
134
Gianluca Gaidano and Antonino Carbone
of HIV-induced or iatrogenic immunodeficiency) selectively affect elder individuals. Since the initial report of the disease, most cases of PEL have been reported in HIV-infected individuals. Available estimates from a series of lymphomas consecutively observed at an Italian institution have defined that PEL accounts for approximately 4% of all AIDS-related lymphomas, but only for 0.3% of aggressive lymphomas in HIV negative patients (Carbone and Gaidano, 1997). Virtually all AIDS-related PEL develop in men, with homosexuality being the predominant, although not the exclusive, risk factor for HIV infection (Ansari et al., 1996; Ascoli et al., 1998; Carbone et al., 1996; Cesarman et al., 1995a; Gessain et al., 1997; Jaffe, 1996; Jones et al., 1996; Karcher and Alkan, 1997; Komanduri et al., 1996; Mansour et al., 1998; Nador et al., 1996; Vadmal et al., 1998). Male sex and homosexuality have also been frequent features of PEL in geographic areas, such as southern Europe, in which risk factors other than homosexuality prevail in the HIV-infected population (Carbone et al., 1996; Gaidano et al., 1999). These observations are consistent with the fact that sexual transmission is the predominant mode of spread of HHV-8/KSHV and that homosexuality is also the major risk factor for other HHV-8/KSHV-related disorders, namely Kaposi’s sarcoma (Boshoff and Weiss, 1998; Moore and Chang, 1998; Sarid et al., 1999a; Schulz, 1998; Schulz and Moore, 1999). Apart from AIDS, PEL has also been reported in association with other immunodeficiency conditions, namely iatrogenic immunodeficiency following solid organ transplantation (Dotti et al., 1999; Jones et al., 1998). The association of PEL with posttransplant immunodeficiency is not surprising given the relatively frequent occurrence of HHV-8/KSHV activation and Kaposi’s sarcoma development in patients who have been iatrogenically immunocompromised (Ho, 1998; Hudnall et al., 1998; Regamey et al., 1998). Because these patients are closely monitored in the follow-up after transplantation, cases of posttransplant PEL may be of great value in providing information concerning clinical, immunological, and molecular events preceding the development of the lymphoma. Although overt immunodeficiency appears to be a major risk factor for PEL development, rare cases of this disease have been reported in HIV negative individuals of both sexes with no history of transplantation (Carbone et al., 1996; Cobo et al., 1999; Nador et al., 1996; Said et al., 1996b; TeruyaFeldstein et al., 1998). A striking common feature of these cases is represented by advanced age, generally occurring in the eight or ninth decade. Because immune function is thought to decrease in the elder population, it is conceivable that a currently unrecognized mechanism of immunodeficiency may favor PEL in geriatric patients. Notably, several elderly PEL patients displayed a relative degree of CD4 lymphocytopenia, although the precise cause of such immune alteration is not known.
Primary Effusion Lymphoma
135
V. CLINICAL FEATURES OF PRIMARY EFFUSION LYMPHOMA Presentation of PEL reflects the signs and symptoms of malignant effusions in general and depend on the body cavity involved by the lymphoma. Because PEL is an aggressive lymphoma, symptoms tend to progress rapidly. Physical examination is generally unrevealing, except for signs common to all malignant effusions. Among HIV-infected individuals, PEL appears to be a manifestation of advanced AIDS, as it generally develops in patients with markedly decreased CD4 counts, frequently below 50/l (Ansari et al., 1996; Ascoli et al., 1998; Carbone et al., 1996; Carbone and Gaidano, 1997; Cesarman et al., 1995a; Gessain et al., 1997; Jaffe, 1996; Jones et al., 1996; Karcher and Alkan, 1997; Komanduri et al., 1996; Mansour et al., 1998; Nador et al., 1996; Vadmal et al., 1998). PEL is the first manifestation of AIDS in a minority of cases and the lymphoma generally presents as a secondary manifestation of HIV infection. The median age of AIDS-related PEL patients is slightly older than the median age usually associated with other AIDS-related lymphomas. Because of the peculiar growth behavior of PEL, standard staging procedures utilized for lymphoma are of limited value in this disease. Although HHV-8/KSHV infection is strictly linked to both Kaposi’s sarcoma and PEL, the two diseases do not necessarily run in parallel. In particular, AIDS-related PEL may develop in the absence of concomitant Kaposi’s sarcoma in a significant proportion of cases (Carbone et al., 1996; Cesarman et al., 1995a; Karcher and Alkan, 1997; Komanduri et al., 1996; Nador et al., 1999), suggesting that host factors may complement HHV-8/KSHV in determining which disease will develop in a given patient. The precise relationship between PEL and multicentric Castleman’s disease, a lymphoproliferation associated with HHV-8/KSHV positivity and immunodeficiency, remains unexplored, although several patients have been concomitantly affected by both diseases (Teruya-Feldstein et al., 1998). Also, it is not known whether PEL is preceded by a polyclonal expansion of HHV-8/KSHV positive B cells, as it has been suggested in the case of systemic AIDS-related lymphomas preceded by persistent generalized lymphadenopathy and expansion of B cells carrying EBV infection (Gaidano et al., 1998). Intriguingly, in a posttransplant patient with pericardial PEL, the lymphoma had been preceded by long-standing polyclonal plasmacytic infiltrates in the myocardium, suggesting that PEL may result from selection of a B-cell clone in the context of reactive B-cell hyperplasia ( Jones et al., 1998). A polyclonal plasmacytic hyperplasia harboring HHV-8/KSHV infection has also been observed in other iatrogenically immunosuppressed patients at risk for PEL development (Matsushima et al., 1999).
136
Gianluca Gaidano and Antonino Carbone
VI. RADIOIMAGING OF PRIMARY EFFUSION LYMPHOMA PEL displays distinct radiologic features when compared to other types of aggressive lymphomas (Morassut et al., 1997). Conventional chest X-rays performed in pleural PEL show bilateral or unilateral effusion in the absence of parenchymal opacities or mediastinal enlargment (Morassut et al., 1997). Computerized tomography scans of the chest and abdomen reveal the presence of an effusion in one or more of the serous body cavities in conjunction with diffuse slight thickening of the serous membrane (Morassut et al., 1997). Plaque-like or nodular thickening of the serous membranes is absent or minimal when investigated by computerized tomography scans, which also rule out the presence of solid tumor and node- or tissue-based lymphoma masses in most PEL cases. The diffuse slight thickening of the serous membranes revealed by computerized tomography scans reflects the basic pathologic feature of PEL, i.e., a lymphomatous infiltration of serosal surfaces adjacent to the site of primary malignant effusion (Carbone and Gaidano, 1997; Komanduri et al., 1996).
VII. DIFFERENTIAL DIAGNOSIS OF PRIMARY EFFUSION LYMPHOMA PEL needs to be differentiated from other lymphomas involving the body cavities, particularly when approaching immunodeficient patients in whom effusions complicate lymphoma at a relatively sustained frequency (Beck, 1998; DeCamp et al., 1997) (Fig. 7). Based on pure clinical and/or radioimaging grounds, PEL can be differentiated easily from secondary lymphomatous effusions, which complicate a tissue-based lymphoma through a contiguous spread of tumor cells (Carbone et al., 1996; Carbone and Gaidano, 1997). Also, secondary lymphomatous effusions closely mimick phenotypic and genotypic features of the corresponding tissue-based lymphoma and are consistently devoid of HHV-8/KSHV infection (Carbone et al., 1996; Carbone and Gaidano, 1997). A more subtle diagnosis consists in differentiating PEL from other types of lymphomas primarily involving the serous body cavities (Fig. 7). These include primary lymphomatous effusions other than PEL and the pyothoraxassociated lymphoma. A certain number of Burkitt’s lymphomas, mainly occurring in the context of AIDS, present as primary lymphomatous effusions without mass formation (Carbone et al., 1996, 1997a; Nador et al., 1996). The differential diagnosis of these cases from PEL is not feasible on clinical
Primary Effusion Lymphoma
137
Fig. 7 Classification and differential diagnosis of non-Hodgkin’s lymphomas involving the serous body cavities and presenting as lymphomatous effusion. The grid also emphasizes the clinical, morphological and biological heterogeneity of these lymphomas. HIV, human immunodeficiency virus; HHV-8/KSHV, human herpesvirus type-8/Kaposi’s sarcoma-associated herpesvirus; EBV, Epstein–Barr virus; PAL, pyothorax-associated lymphoma; IBPL, immunoblastic plasmacytoid lymphoma; ALCL, anaplastic large cell lymphoma; BL, Burkitt’s lymphoma.
and/or radioimaging grounds and requires morphology studies by an expert pathologist and analysis of virologic, phenotypic, and genotypic markers. The most specific biological markers discriminating PEL from Burkitt’s lymphoma presenting as primary lymphomatous effusion are represented by HHV-8/KSHV infection, which clusters with PEL, and by translocation of the c-MYC protooncogene, which segregates with Burkitt’s lymphoma. The differential diagnosis of PEL from pyothorax-associated lymphoma is eased by the fact that the latter consistently presents with a tumor mass localized in the body cavities and only rarely gives rise to a lymphomatous effusion (Cesarman et al., 1996a; Iuchi et al., 1987, 1989). Also, the pyothoraxassociated lymphoma associates with and is preceded by long-standing pyothorax and is devoid of HHV-8/KSHV sequences (Iuchi et al., 1987, 1989; Cesarman et al., 1996a).
VIII. THERAPY OF PRIMARY EFFUSION LYMPHOMA The prognosis of PEL is strikingly poor, with a mean survival approximating few months in most reported series, and no optimal chemothera-
138
Gianluca Gaidano and Antonino Carbone
peutic regimen has been defined for this rare subset of lymphomas (Carbone et al., 1996; Komanduri et al., 1996; Nador et al., 1996). The reasons for the poor prognosis of PEL are probably multifactorial and may include a peculiar drug resistance of these lymphomas as well as the fact that PEL occurs late in the AIDS natural history, when patients are markedly debilitated and severely immunocompromised. Notably, the host’s performance and immunological status has prevented the use of chemotherapy in many PEL patients. Because conventional chemotherapy fails to control PEL and because antiretroviral drugs have been shown to be active against Kaposi’s sarcoma in vivo (Bower et al., 1999; Lebbe et al., 1998), anecdotical reports have attempted to treat PEL with highly active antiretroviral therapy (HAART). Results have been discordant, with one continued clinical remission, one transitory partial remission, and a failure (Oksenhendler et al., 1998; Spina et al., 1998). Because HAART drugs do not have a direct effect on HHV-8/ KSHV, the potential benefit of HAART may be solely accounted by downregulation of HIV Tat or other cellular cytokines as well as immune reconstitution (Harrington et al., 1997). Knowledge of PEL biology may potentially help design novel therapeutic strategies for this lymphoma. For example, such therapies may interfere with the requirement of IL-6 and VEGF for PEL growth. Indeed, initial experiments in animal models have shown that antibodies disrupting the IL-6 and VEGF circuit are able to inhibit, or at least retard, PEL expansion (Aoki and Tosato, 1999; Foussat et al., 1999). Because the growth of most PEL is confined to closed spaces, which are easily accessible, i.e., the pleural and peritoneal serous cavities, the use of novel biological agents againt PEL may be eased by the possibility to attain high concentrations of the drug while limiting its systemic effects.
IX. PERSPECTIVES Since the discovery of PEL, a considerable amount of knowledge has been gained concerning the biology and clinicopathological features of this rare lymphoma. Although PEL per se does not represent a public health issue, investigators have been attracted by the peculiarity of this lymphoma, which may provide a valuable model to understand lymphomagenesis and may be exploited as an unlimited reservoir of HHV-8/KSHV for biological studies of the virus. Notably, PEL has revealed to be instrumental in determining the genomic sequence of HHV-8/KSHV as well as in establishing the expression pattern and function of several of the genes harbored by the virus (Boshoff
Primary Effusion Lymphoma
139
and Weiss, 1998; Moore and Chang, 1998; Russo et al., 1996; Sarid et al., 1999a; Schulz, 1998; Schulz and Moore, 1999). Also, the case of PEL has contributed substantially to formulating a model for the histogenesis of Bcell lymphoma based on differentiation markers and has exemplified the concept that a B-cell lymphoma may derive from germinal center-related cells even in the absence of evident germinal center involvement (Gaidano et al., 1998, 1999; Gaidano and Carbone, 2000). A major instrument toward the understanding of PEL pathogenesis and of HHV-8/KSHV biology has been gained with the establishment and detailed characterization of a number of PEL cell lines representative of EBV positive and negative, as well as AIDS-related and -unrelated, PEL (Arvanitakis et al., 1996; Boshoff et al., 1998; Carbone et al., 1997a, 1998a; Cesarman et al., 1995b; Drexler et al., 1998; Gaidano et al., 1996a; Katano et al., 1999; Renne et al., 1996). The use of PEL cell lines has been instrumental for the first serodiagnosis assays of HHV-8/KSHV infection (Boshoff and Weiss, 1998; Moore and Chang, 1998; Sarid et al., 1999a; Schulz, 1998; Schulz and Moore, 1999). Also, manipulation of PEL cell lines with the induction of lytic phase infection has allowed the grouping of HHV-8/KSHV genes into different classes depending on their expression pattern in latency as opposed to lytic phase (Boshoff and Weiss, 1998; Moore and Chang, 1998; Sarid et al., 1998, 1999a; Schulz, 1998; Schulz and Moore, 1999). Conceivably, also in the future PEL cell lines will represent an indispensable tool for the understanding of HHV-8/KSHV biology. Independent of the use of PEL as a viral reservoir for HHV-8/KSHV studies, this lymphoma poses several unresolved issues, which may reveal information of general validity in the field of lymphomagenesis. For example, identification of the cellular molecules responsible for the scarce cohesiveness and liquid growth pattern of PEL may provide insights into the mechanisms responsible for cell-to-cell and cell-to-extracellular matrix adhesion of normal and neoplastic B cells. Also, large multicentric investigations of PEL epidemiology before and after the introduction of HAART may facilitate the understanding of how the immune system controls HHV-8/KSHV in health and disease.
ACKNOWLEDGMENTS Work by the authors described in this review has been supported by Istituto Superiore di Sanità, II Programma Nazionale di Ricerca sull’AIDS 1998—Progetto Patologia, Clinica e Terapia dell’AIDS, Rome, Italy; Fondazione “Piera Pietro e Giovanni Ferrero,” Alba, Italy; and Progetto di ricerca finalizzata “Nuovi marcatori molecolari e sierologici nella linfomagenesi virusassociata,” Ministero della Sanita’, Rome, Italy.
140
Gianluca Gaidano and Antonino Carbone
REFERENCES Ambroziak, J. A., Blackbourn, D. J., Herndier, B. G., Glogau, R. G., Gullett, J. H., McDonald, A. R., Lennette, E. T., and Levy, J. A. (1995). Science 268, 582– 583. Ansari, M. Q., Dawson, D. B., Nador, R., Rutherford, C., Schneider, N. R., Latimer, M. J., Picker, L., Knowles, D. M., and McKenna, R. W. (1996). Am. J. Clin. Pathol. 105, 221–229. Antinori, A., Larocca, L. M., Fassone, L., Cattani, P., Capello, D., Cingolani, A., Saglio, G., Fadda, G., Gaidano, G., and Ortona, L. (1999). Brain Pathol. 9, 199 –208. Aoki, Y., Jaffe, E. S., Chang, Y., Jones, K., Teruya-Feldstein, J., Moore, P. S., and Tosato, G. (1999). Blood 93, 4034 – 4043. Aoki, Y., and Tosato, G. (1999). Blood 94, 4247– 4254. Arvanitakis, L., Mesri, E. A., Nador, R. G., Said, J. W., Asch, A. S., Knowles, D. M., and Cesarman, E. (1996). Blood 88, 2648 –2654. Ascoli, V., Lo Coco, F., Artini, M., Levrero, M., Fruscalzo, A., and Mecucci, C. (1997). Hum. Pathol. 28, 101–104. Ascoli, V., Mastroianni, C. M., Galati, V., Sirianni, M. C., Fruscalzo, A., Pistilli, A., and Lo Coco, F. (1998). Haematologica 83, 8 –12. Asou, H., Said, J. W., Yang, R., Munker, R., Park, D. J., Kamada, N., and Koeffler, H. P. (1998). Blood 91, 2475–2481. Bais, C., Santomasso, B., Coso, O., Arvanitakis, L., Raaka, E. G., Gutkind, J. S., Asch, A. S., Cesarman, E., Gershengorn, M. C., Mesri, E. A., and Gershengorn, M. C. (1998). Nature 391, 86–89. Bajalica-Lagercrantz, S., Piehl, F., Lagercrantz, J., Lindahl, J., Weber, G., Kerckaert, J. P., Porwit MacDonald, A., and Nordenskjoold, M. (1997). Leukemia 11, 594 – 598. Ballestas, M. E., Chatis, P. A., and Kaye, K. M. (1999). Science 284, 641– 644. Beck, J. M. (1998). Clin. Chest Med. 19, 341– 349. Benjamin, D., Knobloch, T. J., and Dayton, M. A. (1992). Blood 80, 1289 –1298. Bernfield, M., Kokenyesi, M., Kato, M., Hinkes, M. T., Spring, J., Gallo, R. L., and Lose, E. J. (1992). Annu. Rev. Cell. Biol. 8, 365 – 393. Bhatia, K., Raj, A., Gutierrez, M. I., Judde, J.-G., Spangler, G., Venkatesh, H., and Magrath, I. T. (1996). Oncogene 13, 177–181. Bigoni, B., Dolcetti, R., de Lellis, L., Carbone, A., Boiocchi, M., Cassai, E., and Di Luca, D. (1996). J. Infect. Dis. 173, 542– 549. Borset, M., Hjorth-Hansen, H., Seidel, C., Sundan, A., and Waage, A. (1996a). Blood 88, 3998–4004. Borset, M., Lien, E., Espevik, T., Helseth, E., Waage, A., and Sundan, A. (1996b). J. Biol. Chem. 271, 24655–24661. Boshoff, C., Gao, S.-J., Healy, L. E., Matthews, S., Thomas, A. J., Coignet, L., Warnke, R. A., Strauchen, J. A., Matutes, E., Kamel, O. W., Moore, P. S., Weiss, R. A., and Chang, Y. (1998). Blood 91, 1671–1679. Boshoff, C., and Weiss, R. A. (1998). Kaposi’s sarcoma-associated herpesvirus. Adv. Cancer Res. 75, 57–86. Bower, M., Fox, P., Fife, K., Gill, J., Nelson, M., and Gazzard, B. (1999). AIDS 13, 2105 –2111. Brown, L. F., Tognazzi, K., Dvorak, H. F., and Harrist, T. J. (1996). Am. J. Pathol. 148, 1065 – 1074. Cannon, J. S., Nicholas, J., Orenstein, J. M., Mann, R. B., Murray, P. G., Browning, P. J., DiGiuseppe, J. A., Cesarman, E., Hayward, G. S., and Ambinder, R. F. (1999). J. Infect. Dis. 180, 824–828. Capello, D., Gaidano, G., Gallicchio, M., Gloghini, A., Medico, E., Vivenza, D., Buonaiuto, D., Fassone, L., Avanzi, G. A., Saglio, G., Prat, M., and Carbone, A. (2000a). Leukemia, 14, 811–815.
Primary Effusion Lymphoma
141
Capello, D., Vitolo, U., Pasqualucci, L., Quattrone, S., Migliaretti, G., Fassone, L., Ariatti, C., Vivenza, D., Gloghini, A., Pastore, C., Lanza, C., Nomdedeu, J., Botto, B., Freilone, R., Buonaiuto, D., Zagonel, V., Gallo, E., Palestro, G., Saglio, G., Dalla-Favera, R., Carbone, A., and Gaidano, G. (2000b). Blood 95, 651– 659. Carbone, A., Cilia, A. M., Gloghini, A., Canzonieri, V., Pastore, C., Todesco, M., Cozzi, M., Perin, T., Volpe, R., Pinto, A., and Gaidano, G. (1997a). Int. J. Cancer 73, 562– 569. Carbone, A., Cilia, A. M., Gloghini, A., Capello, D., Todesco, M., Quattrone, S., Volpe, R., and Gaidano, G. (1998a). Br. J. Haematol. 102, 1081–1089. Carbone, A., and Gaidano, G. (1997). Br. J. Haematol. 97, 515 – 522. Carbone, A., Gaidano, G., Gloghini, A., Larocca, L. M., Capello, D., Canzonieri, V., Antinori, A., Tirelli, U., Falini, B., and Dalla-Favera, R. (1998b). Blood 91, 747–755. Carbone, A., Gloghini, A., Bontempo, D., Monini, P., Tirelli, U., Volpe, R., Browning, P. J., and Gaidano, G. (2000). Am. J. Pathol., 156, 1209–1215. Carbone, A., Gloghini, A., Gattei, V., Degan, M., Improta, S., Aldinucci, D., Canzonieri, V., Perin, T., Volpe, R., Gaidano, G., Zagonel V., and Pinto, A. (1997b). Blood 89, 3787– 3794. Carbone, A., Gloghini, A., Vaccher, E., Zagonel, V., Pastore, C., Dalla Palma, P., Branz, F., Saglio, G., Volpe, R., Tirelli, U., and Gaidano, G. (1996). Br. J. Haematol. 94, 533 – 543. Carey, D. J. (1997). Biochem. J. 327, 1–16. Cattoretti, G., Chang, C. C., Cechova, K., Zhang, J., Ye, B. H., Falini, B., Louie, D. C., Offit, K., Chaganti, R. S., and Dalla Favera, R. (1995). Blood 86, 45 – 53. Cesarman, E., Chang, Y., Moore, P. S., Said, J. W., and Knowles, D. M. (1995a). N. Engl. J. Med. 332, 1186–1191. Cesarman, E., Moore, P. S., Rao, P. H., Inghirami, G., Knowles, D. M., and Chang, Y. (1995b). Blood 86, 2708–2714. Cesarman, E., Nador, R. G., Aozasa, K., Delsol, G., Said, J. W., and Knowles, D. M. (1996a). Am. J. Pathol. 149, 53 – 57. Cesarman, E., Nador, R. G., Bai, F., Bohenzky, R. A., Russo, J. J., Moore, P. S., Chang, Y., and Knowles, D. M. (1996b). J. Virol. 70, 8218 – 8223. Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M., and Moore, P. S. (1994). Science 266, 1865 –1869. Chang, Y., Moore, P. S., Talbot, S., Boshoff, C. H., Zarkowska, T., Godden-Kent, D., Paterson, H., Weiss, R. A., and Mittnacht, S. (1996). Nature 382, 410. Chirgadze, D. Y., Hepple, J., Byrd, R. A., Sowdhamini, R., Blundell, T. L., and Gherardi, E. (1998). FEBS Lett. 430, 126 –129. Chirivi, R. G. S., Taraboletti, G., Bani, M. R., Barra, L., Piccinini, G., Giacca, M., Bussolino, F., and Giavazzi, R. (1999). Blood 94, 1747–1754. Cobo, F., Hernandez, S., Hernandez, L., Pinyol, M., Bosch, F., Esteve, J., Lopez-Guillermo, A., Palacin, A., Raffeld, M., Montserrat, E., Jaffe, E. S., and Campo, E. (1999). J. Pathol. 189, 288–293. Cornali, E., Zietz, C., Benelli, R., Weninger, W., Masiello, L., Breier, G., Tschachler, E., Albini, A., and Sturzl, M. (1996). Am. J. Pathol. 149, 1851–1869. DeCamp, M. M., Jr., Mentzer, S. J., Swanson, S. J., and Sugarbaker, D. J. (1997). Chest 112, 291S-295S. DePond, W., Said, J. W., Tasaka, T., de Vos, S., Kahn, D., Cesarman, E., Knowles, D. M., and Koeffler, H. P. (1997). Am. J. Surg. Pathol. 21, 719 –724. Dittmer, D., Lagunoff, M., Renne, R., Staskus, K., Haase, A., and Ganem, D. (1998). J. Virol. 72, 8309–8315. Dotti, G., Fiocchi, R., Motta, T., Facchinetti, B., Chiodini, B., Borleri, G. M., Gavazzeni, G., Barbui, T., and Rambaldi, A. (1999). Leukemia 13, 664 – 670. Drexler, H. G., Uphoff, C. C., Gaidano, G., and Carbone, A. (1998). Leukemia 12, 1507–1517. Drexler, H. G., Meyer, C., Gaidano, G., and Carbone, A. (1999). Leukemia 13, 634 – 640.
142
Gianluca Gaidano and Antonino Carbone
Dupin, N., Fisher, C., Kellam, P., Ariad, S., Tulliez, M., Franck, N., van Marck, E., Salmon, D., Gorin, I., Escande, J.-P., Weiss, R. A., Alitalo, K., and Boshoff, C. (1999). Proc. Natl. Acad. Sci. USA 96, 4546–4551. Ely, S., Powers, J., Lewis, D., Chang, S., Rubio, A., O’Leary, J., and Knowles, D. M. (1999). Hum. Pathol. 30, 981– 984. Emilie, D., Wijdenes, J., Gisselbrecht, C., Jarrousse, B., Billaud, E., Blay, J. Y., Gabarre, J., Gaillard, J. P., Brochier, J., and Raphael, M. (1994). Blood 84, 2472–2479. Erlanson, M., Portin, C., Linderholm, B., Lindh, J., Roos, G., and Landberg, G. (1998). Blood 92, 770–777. Fais, F., Gaidano, G., Capello, D., Gloghini, A., Ghiotto, F., Roncella, S., Carbone, A., Chiorazzi, N., and Ferrarini, M. (1999). Leukemia 13, 1093 –1099. Fassone, L., Bhatia, K., Gutierrez, M., Capello, D., Gloghini, A., Dolcetti, R., Vivenza, D., Ascoli, V., Lo Coco, F., Pagani, L., Dotti, G., Rambaldi, A., Raphael, M., Tirelli, U., Saglio, G., Magrath, I. T., Carbone, A., and Gaidano, G. (2000a). Leukemia, 16, 271–277. Fassone, L., Gaidano, G., Ariatti, C., Vivenza, D., Capello, D., Gloghini, A., Cilia, A. M., Buonaiuto, D., Rossi, D., Pastore, C., Carbone, A., and Saglio, G. (2000b). Leukemia Lymphoma, in press. Feuillard, J., Aubin, J.-T., Poirel, L., Davi, F., Kujas, M., Rousselet, M.-C., Angonin, R., Raphael, M., and Agut, H. (1997). J. Med. Virol. 53, 277–281. Foss, H. D., Araujo, I., Demel, G., Klotzbach, H., Hummel, M., and Stein, H. (1997). J. Pathol. 183, 44–50. Foussat, A., Wijdenes, J., Bouchet, L., Gaidano, G., Neipel, F., Balabanian, K., Galanaud, P., Couderc, J., and Emilie, D. (1999). Eur. Cytokine Netw. 10, 501– 508. Friborg, J., Jr., Kong, W., Hottiger, M. O., and Nabel, G. J. (1999). Nature 402, 889 – 894. Gaidano, G., Capello, D., Cilia, A. M., Gloghini, A., Perin, T., Quattrone, S., Migliazza, A., Lo Coco, F., Saglio, G., Ascoli, V., and Carbone, A. (1999). Gene Chrom. Cancer 24, 16 –23. Gaidano, G., Capello, D., Pastore, C., Antinori, A., Gloghini, A., Carbone, A., Larocca, L. M., and Saglio, G. (1997a). J. Infect. Dis. 175, 1193 –1197. Gaidano, G., and Carbone, A. (2000). Leukemia, 14, 563–566. Gaidano, G., Carbone, A., and Dalla-Favera, R. (1998). Am. J. Pathol. 152, 623 – 630. Gaidano, G., Cechova, K., Chang, Y., Moore, P. S., Knowles, D. M., and Dalla-Favera, R. (1996a). Leukemia 10, 1237–1240. Gaidano, G., and Dalla-Favera, R. (2000). In “Hematology. Basic Principles and Practice” (R. Hoffman, E. J. Benz, Jr., S. J. Shattil, B. Furie, H. J. Cohen, L. EL Silberstein, and P. McGlaved, eds.), 3rd Ed., pp. 1213 –1229. Churchill Livingstone, New York. Gaidano, G., Gloghini, A., Gattei, V., Rossi, F. M., Cilia, A. M., Godeas, C., Degan, M., Perin, T., Canzonieri, V., Aldinucci, D., Saglio, G., Carbone, A., and Pinto A. (1997b). Blood 90, 4894–4900. Gaidano, G., Pastore, C., Gloghini, A., Capello, D., Tirelli, U., Saglio, G., and Carbone A. (1997c). Hum. Pathol. 28, 748 –750. Gaidano, G., Pastore, C., Gloghini, A., Cusini, M., Nomdedeu, J., Volpe, G., Capello, D., Vaccher, E., Bordes, R., Tirelli, U., Saglio, G., and Carbone, A. (1996b). AIDS 10, 941– 949. Gaidano, G., Vivenza, D., Forconi, F., Capello, D., Gloghini, A., Bhatia, K., Gutierrez, M., Gallicchio, M., Avanzi, G. C., Fassone, L., Ariatti, C., Buonaiuto, D., Cingolani, A., Saglio, G., Tirelli, U., Larocca, L. M., Dalla-Favera, R., and Carbone, A. (2000). Gene Chrom. Cancer 27, 177–182. Gao, S.-J., Zhang, Y.-J., Deng, J.-H., Rabkin, C. S., Fiore, O., and Jenson, H. B. (1999). J. Infect. Dis. 180, 1466 –1476. Gattei, V., Godeas, C., Degan, M., Rossi, F. M., Aldinucci, D., and Pinto, A. (1999). Br. J. Haematol. 104, 152–162. Gessain, A., Briere, J., Angelin-Duclos, C., Valensi, F., Merle Beral, H., Davi, F., Nicola, M.-A.,
Primary Effusion Lymphoma
143
Sudaka, A., Fouchard, N., Gabarre, J., Troussard, X., Dulmet, E., Audouin, J., Diebold, J., and de The, G. (1997). Leukemia 11, 266 –272. Giordano, S., di Renzo, M. F., Olivero, M., Mondino, A., Zhen, Z., Medico, E., Comoglio, P. M. (1992). Eur. J. Cancer Prev. 1(Suppl. 3), 45 – 49. Godden-Kent, D., Talbot, S. J., Boshoff, C., Chang, Y., Moore, P., Weiss, R. A., and Mittnacht, S. (1997). J. Virol. 71, 4193 – 4198. Green, I., Espiritu, E., Ladanyi, M., Chaponda, R., Wieczorek, R., Gallo, L., and Feiner, H. (1995). Modern Pathol. 8, 39 – 45. Gutierrez, M. I., Raj, A., Spangler, G., Sharma, A., Hussain, A., Judde, J.-G., Tsao, S. W., Yuen, P. W., Joab, I., Magrath, I. T., and Bhatia, K. (1997). J. Gen. Virol. 78, 1663 –1670. Gutierrez, M. I., Spangler, G., Kingma, D., Raffeld, M., Guerrero, I., Misad, O., Jaffe, E. S., Magrath, I. T., and Bhatia, K. (1998). Blood 92, 600 – 606. Hagenbaugh, A., Sharma, S., Dubinett, S. M., Wei, S. H. Y., Aranda, R., Cheroutre, H., Fowel, D. J., Binder, S., Tsao, B., Locksley, R. M., Moore, K. W., and Kronenberg, M. (1997). J. Exp. Med. 185, 2101–2110. Harrington, W., Jr., Sieczkowski, L., Sosa, C., Chan-a-Sue, S., Cai, J. P., Cabral, L., and Wood, C. (1997). Lancet 349, 774 –775. Harris, N. L., Jaffe, E. S., Diebold, J., Flandrin, G., Muller-Hermelink, H. K., Vardiman, J., Lister, T. A., and Bloomfield, C. D. (1999). J. Clin. Oncol. 17, 3835 – 3849. Harris, N. L., Jaffe, E. S., Stein H., Banks, P. M., Chan J. K. C., Cleary, M., Delsol, G., de WolfPeeters, C., Falini, B., Gatter, K. C., Grogan, T. M., Isaacson, P. C., Knowles, D. M., Mason, D. Y., Müller-Hermelink, H.-K., Pileri, S. A., Piris, M. A., Ralfkiaer, E., and Warnke, R. A. (1994). Blood 84, 1361–1392. Ho, M. (1998). N. Engl. J. Med. 339, 1391–1392. Horenstein, M. G., Nador, R. G., Chadburn, A., Hyjek, E. M., Inghirami, G., Knowles, D. M., and Cesarman, E. (1997). Blood 90, 1186 –1191. Hsi, E. D., Foreman, K. E., Duggan, J., Alkan, S., Kauffman, C. A., Aronow, H. D., and Nickoloff, B. J. (1998). Am. J. Surg. Pathol. 22, 493 – 499. Hudnall, S. D., Rady, P. L., Tyring, S. K., and Fish, J. C. (1998). J. infect. Dis. 178, 1791–1794. Iida, S., Rao, P. H., Butler, M., Corradini, P., Boccadoro, M., Klein, B., Chaganti, R. S. K., and Dalla-Favera, R. (1997). Nature Genet. 17, 226 –230. Iuchi, K., Ichimiya, A., Akashi, A., Mizuta, T., Lee, Y. E., Tada, H., Mori, T., Sawamura, K., Lee, Y. S., Furuse, K., Yamamoto, S., and Aozasa, K. (1987). Cancer 60, 1771–1775. Iuchi, K., Aozasa, K., Yamamoto, S., Mori, T., Tajima, K., Minato, K., Mukai, K., Komatsu, H., Tagaki, T., Kobashi, Y., Yamabe, H., and Shimoyama, M. (1989). Jpn. J. Clin. Oncol. 19, 249–257. Jaffe, E. S. (1996). Am. J. Clin. Pathol. 105, 141–143. Jiang, W., Hiscox, S., Matsumoto, K., and Nakamura, T. (1999). Crit. Rev. Oncol. Hematol. 29, 209–248. Jones, D., Ballestas, M. E., Kaye, K. M., Gulizia, J. M., Winters, G. L., Fletcher, J., Scadden, D. T., and Aster, J. C. (1998). N. Engl. J. Med. 339, 444 – 449. Jones, D., Weinberg, D. S., Pinkus, G. S., and Renshaw, A. A. (1996). Am. J. Clin. Pathol. 106, 359–364. Jones, K. D., Aoki, Y., Chang, Y., Moore, P. S., Yarchoan, R., and Tosato, G. (1999). Blood 94, 2871–2879. Jucker, M., Gunther, A., Gradl, G., Fonatsch, C., Krueger, G., Diehl, V., and Tesch, H. (1994). Leukemia Res. 18, 7–16. Karcher, D. S., and Alkan, S. (1997). Hum. Pathol. 28, 801– 808. Katano, H., Hoshino, Y., Morishita, Y., Nakamura, T., Satoh, H., Iwamoto, A., Herndier, B., and Mori, S. (1999). J. Med. Virol. 58, 394 – 401. Klein, G. (1989). Cell 58, 5– 8.
144
Gianluca Gaidano and Antonino Carbone
Klein, G. (1994). Antibiot. Chemother. 46, 110 –116. Knowles, D. M., Inghirami, G., Ubriaco, A., and Dalla-Favera, R. (1989). Blood 73, 792–799. Komanduri, K. V., Luce, J. A., McGrath, M. S., Herndier, B. G., and Ng, V. L. (1996). J. Acquired Imm. Def. Syndr. Hum. Retr. 13, 215 –226. Komano, J., Maruo, S., Kurozumi, K., Oda, T., Takada, K. (1999). J. Virol. 73, 9827– 9831. Komano, J., Sugiura, M., and Takada, K. (1998). J. Virol. 72, 9150 – 9156. Kube, D., Vockerodt, M., Weber, O., Hell, K., Wolf, J., Haier, B., Grasser, F. A., MullerLantzsch, N., Kieff, E., Diehl, V., and Tesch, H. (1999). J. Virol. 73, 1630 –1636. Kuppers, R., Klein, U., Hansmann, M. L., and Rajewsky, K. (1999). N. Engl. J. Med. 341, 1520–1529. Lebbe, C., Blum, L., Pellet, C., Blanchard, G., Verola, O., Morel, P., Danne, O., and Calvo, F. (1998). AIDS 12, F45 – 49. Li, M., Lee, H., Yoon, D. W., Albrecht, J. C., Fleckenstein, B., Neipel, F., and Jung, J. U. (1997). J. Virol. 71, 1984–1991. Liu, Z. Y., Ganju, R. K., Wang, J. F., Ona, M. A., Hatch, W. C., Zheng, T., Avraham, S., Gill, P., and Groopman, J. E. (1997). J. Clin. Invest. 99, 1798 –1804. Maggiora, P., Gambarotta, G., Olivero, M., Giordano, S., Di Renzo, M. F., and Comoglio, P. M. (1997). J. Cell. Physiol. 173, 183 –186. Maier, J. A. M., Mariotti, M., Albini, A., Comi, P., Prat, M., Comoglio, P., and Soria, M. R. (1996). Int. J. Cancer 65, 168 –172. Mansour, G., Charlotte, F., Calvez, V., Davi, F., and Merle-Beral, H. (1998). Acta Cytol. 42, 371–373. Masood, R., Cai, J., Zheng, T., Smith, D. L., Naidu, Y., and Gill, P. S. (1997). Proc. Natl. Acad. Sci. USA 94, 979–984. Masood, R., Zhang, Y., Bond, M. W., Scadden, D. T., Moudgli, T., Law, R., Kaplan, M. H., Jung, B., Espina, B. M., Lunardi-Iskadar, Y., Levine, A. M., and Gill, P. (1995). Blood 85, 3423–3430. Matolcsy, A., Nador, R. G., Cesarman, E., and Knowles, D. M. (1998). Am. J. Pathol. 153, 1609–1614. Matsuda, M., Salazar, F., Petersson, M., Masucci, G., Hansson, J., Pisa, P., Zhang, Q. J., Masucci, M. G., and Kiessling, R. (1994). J. Exp. Med. 180, 2371–2376. Matsushima, A. Y., Strauchen, J. A., Lee, G., Scigliano, E., Hale, E. E., Weisse, M. T., Burstein, D., Kamel, O., Moore, P. S., and Chang, Y. (1999). Am. J. Surg. Pathol. 23, 1393 – 1400. Monini, P., Carlini, F., Sturzl, M., Rimessi, P., Superti, F., Franco, M., Melucci-Vigo, G., Cafaro, A., Goletti, D., Sgadari, C., Butto’ S., Leone, P., Chiozzini, C., Barresi, C., Tinari, A., Bonaccorsi, A., Capobianchi, M. R., Giuliani, M., di Carlo, A., Andreoni, M., Rezza, G., and Ensoli, B. (1999). J. Virol. 73, 4029 – 4041. Moore, P. S., Boshoff, C., Weiss, R. A., and Chang, Y. (1996). Science 274, 1739 –1744. Moore, P. S., and Chang, Y. (1995). N. Engl. J. Med. 332, 1181–1185. Moore, P. S., and Chang, Y. (1998). Trends Genet. 14, 144 –150. Morassut, S., Vaccher, E., Balestreri, L., Gloghini, A., Gaidano, G., Volpe, R., Tirelli, U., and Carbone, A. (1997). Radiology 205, 459 – 463. Nador, R., Cesarman, E., Chadburn, A., Dawson, D. B., Ansari, M. Q., Said, J., and Knowles, D. M. (1996). Blood 88, 645 – 656. Naidu, Y. M., Rosen, E. M., Zitnick, R., Goldberg, I., Park, M., Naujokas, M., Polverini, P. J., and Nickoloff, B. J. (1994). Proc. Natl. Acad. Sci. USA 91, 5281– 5285. Nicholas, J., Ruvolo, V. R., Burns, W. H., Sandford, G., Wan, X., Ciufo, D., Hendrickson, S. B., Guo, H.-G., Hayward, G. S., and Reitz, M. (1997). Nature Med. 3, 287–292. Oksenhendler, E., Clauvel, J.-P., Jouveshomme, S., Davi, F., and Mansour, G. (1998). Am. J. Hematol. 57, 266 (letter).
Primary Effusion Lymphoma
145
Otsuki, T., Kumar, S., Ensoli, B., Kingma, D. W., Yano, T., Stetler-Stevenson, M., Jaffe, E. S., and Raffeld, M. (1996). Leukemia 10, 1358 –1362. Pasqualucci, L., Migliazza, A., Fracchiolla, N., William, C., Neri, A., Baldini, L., Chaganti, R. S., Klein, U., Kuppers, R., Rajewsky, K., and Dalla Favera, R. (1998). Proc. Natl. Acad. Sci. USA 95, 11816 –11821. Pastore, C., Gaidano, G., Ghia, P., Fassone, L., Cilia, A. M., Gloghini, A., Capello, D., Buonaiuto, D., Gonella, S., Roncella, S., Carbone, A., and Saglio, G. (1998). Br. J. Haematol. 103, 143–149. Pastore, C., Gloghini, A., Volpe, G., Nomdedeu, J., Leonardo, E., Mazza, U., Saglio, G., Carbone, A., and Gaidano, G. (1995). Br. J. Haematol. 91, 918 – 920. Picchio, G. R., Sabbe, R. E., Gulizia, R. J., McGrath, M., Herndier, B., and Mosier, D. E. (1997). Virology 238, 22–29. Polito, P., Canzonieri, V., Cilia, A. M., Gloghini, A., Carbone, A., and Gaidano, G. (1996). Cancer 78, 1142–1143. Regamey, N., Tamm, M., Wernli, M., Witschi, A., Thiel, G., Cathomas, G., and Erb, P. (1998). N. Engl. J. Med. 339, 1358 –1363. Renne, R., Zhong, W., Herndier, B., McGrath, M., Abbey, N., Kedes, D., and Ganem, D. (1996). Nature Med. 2, 342– 346. Russo, J. J., Bohenzky, R. A., Chien, M. C., Chen, J., Yan, M., Maddalena, D., Parry, J. P., Peruzzi, D., Edelman, I. S., Chang, Y., and Moore, P. S. (1996). Proc. Natl. Acad. Sci. USA 93, 14862–14867. Said, J. W., Cjien, K., Takeuchi, S., Tasaka, T., Asou, H., Cho, S. K., deVos, S., Cesarman, E., Knowles, D. M., and Koeffler, H. P. (1996a). Blood 87, 4937– 4943. Said, J. W., Shintaku, P., Asou, H., deVos, S., Baker, J., Hanson, G., Cesarman, E., Nador, R., and Koeffler, H. P. (1999). Arch. Pathol. Lab. Med. 123, 257–260. Said, J. W., Tasaka, T., Takeuchi, S., Asou, H., de Vos, S., Cesarman, E., Knowles, D. M., and Koeffler, H. P. (1996b). Blood 88, 3124 – 3128. Sánchez-Beato, M., Sáez, A. I., Martínez-Montero, J. C., Mateo, M. S., Sánchez-Verde, L., Villuendas, R., Troncone, G., and Piris, M. A. (1997). Am. J. Pathol. 151, 151–160. Sarid, R., Fiore, O., Bohenzky, R., Chang, Y., and Moore, P. S. (1998). J. Virol. 72, 1005 –1012. Sarid, R., Olsen, S. J., and Moore, P. S. (1999a). Adv. Virus Res. 52, 139 –232. Sarid, R., Wiezorek, J. S., Moore, P. S., and Chang, Y. (1999b). J. Virol. 73, 1438 –1446. Schulz, T. F. (1998). J. Gen. Virol. 79, 1573 –1591. Schulz, T. F., and Moore, P. S. (1999). Trends Microbiol. 7, 196 –200. Senger, D. R., Galli, S. J., Dvorak, A. M., Perruzzi, C. A., Harvey, V. S., and Dvorak, H. F. (1983). Science 219, 983 – 985. Shen, H. M., Peters, A., Baron, B., Zhu, X., and Storb, U. (1998). Science 280, 1750 –1752. Sherr, C. J. (1996). Science 274, 1672—1677. Shibuya, M. (1995). Adv. Cancer Res. 67, 281– 316. Smith, M. R., and Green, W. (1991). J. Clin. Invest. 87, 761–766. Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazals-Hatem, D., Babinet, P., d’Agay, M. F., Clauvel, J. P., Raphael, M., Degos, L., and Sigaux, F. (1995). Blood 86, 1276 – 1280. Sozzani, S., Ghezzi, S., Iannolo, G., Luini, W., Borsatti, A., Polentarutti, N., Sica, A., Locati, M., Mackay, C., Wells, T. N., Biswas, P., Vicenzi, E., Poli, G., and Mantovani, A.(1998). J. Exp. Med. 187, 439–444. Spina, M., Gaidano, G., Carbone, A., Capello, D., and Tirelli, U. (1998). AIDS 12, 955 – 956 (letter). Spits, H., and de Waal Malefyt, R. (1992). Int. Arch. Allergy Immunol. 99, 8 –15. Staskus, K., Sun, R., Miller, G., Racz, P., Jaslowski, A., Metroka, C., Brett-Smith, H., and Haase, A. T. (1999). J. Virol. 73, 4181– 4187.
146
Gianluca Gaidano and Antonino Carbone
Swanton, C., Mann, D. J., Fleckenstein, B., Neipel, F., Peters, G., and Jones, N. (1997). Nature 390, 184–187Int. Arch. Allergy Immunol.,L-10 Talbot, S. J., Weiss, R. A., Kellam, P., and Boshoff, C. (1999). Virology 257, 84 – 94. Teruya-Feldstein, J., Zauber, P., Setsuda, J. E., Berman, E. L., Sorbara, L., Raffeld, M., Tosato, G., and Jaffe, E. S. (1998). Lab. Invest. 78, 1637–1642. Tsuboi, K., Iida, S., Inagaki, H., Kato, M., Hayami, Y., Hanamura, I., Miura, K., Harada, S., Kikuchi, M., Komatsu, H., Banno, S., Wakita, A., Nakamura, S., Eimoto, T., and Ueda, R. (2000). MUM1/IRF4 expression as a frequent event in mature lymphoid malignancies. Leukemia, 14, 449–456. Uphoff, C. C., Carbone, A., Gaidano, G., and Drexler, H. G. (1998). Leukemia 12, 1806 –1809. Vadmal, M. S., Smilari, T. F., Brody, J. P., Koduru, P., and Hajdu, S. I. (1998). Acta Cytol. 42, 374–376. van der Woort, R., Taher, T. E. I., Keehnen, R. M. J., Smit, L., Groenink, M., and Pals, S. T. (1997). J. Exp. Med. 185, 2121–2131. Walts, A. E., Shintaku, P. I., and Said, J. W. (1990). Am. J. Pathol. 94, 170 –175. Weimar, I. S., de Jong, D., Muller, E. J., Nakamura, T., van Goorp, J. M. H. H., de Gast, G. C., and Gerritsen, W. R. (1997). Blood 89, 990 –1000. Wijdenes, J., Voojis, W. C., Clement, C., Post, J., Morard, P., Vita, N., Laurent, P., Sun, R.-X., Klein, B., and Dore, J. M. (1996). Br. J. Haematol. 94, 318 – 323. Wilson, J. B., Bell, J. L., and Levine, A. J. (1996). EMBO J. 15, 3117– 3126. Yashiro, M., Chung, Y. S., Inoue, T., Nishimura, S., Matsuoka, T., Fujihara, T., and Sowa, M. (1996). Int. J. Cancer 67, 289 –293. Yoshida, S., Nakazawa, N., Iida, S., Hayami, Y., Sato, S., Wakita, A., Shimizu, S., Taniwaki, M., and Ueda, R. (1999). Leukemia 13, 1812–1816. Zeidler, R., Eissner, G., Meissner, P., Uebel, S., Tampe’, R., Lazis, S., and Hammerschmidt, W. (1997). Blood 90, 2390 –2397.
Dimensions of Antigen Recognition and Levels of Immunological Specificity Neil S. Greenspan Institute of Pathology Case Western Reserve University Cleveland, Ohio 44106
I. Introduction II. Logical Preliminaries: Boundaries of Categories and Categories of Boundaries III. Monovalent Recognition A. The Orthodox View B. Limitations of the Orthodox View IV. Multivalent Recognition V. Specificity of Cellular Activation VI. Organismal Specificity VII. Conclusions References
Although recognition and specificity are among the most fundamental concepts in immunology, there is a common tendency to equate these notions with the fit, especially in terms of molecular shape, between interacting molecules. Even in the case of monovalent recognition, there are factors that contribute to the energetics of the interaction that are not readily accounted for by detailed structural analysis of the interacting (epitopic and paratopic) molecular surfaces. Consequently, recognition involves more than just the three spatial dimensions and time. Factors such as solute–solvent interactions, molecular crowding, and confinement, not directly related to the details of the intermolecular interface, can play crucial roles in determining both intrinsic affinity and differential intrinsic affinity. Furthermore, stating that a given structural subunit (e.g., amino acid) is recognized in a given noncovalent interaction does not clarify whether the structural subunit in question participates in the interaction through van der Waals contact, contribution to intrinsic affinity, or differential contribution to relative intrinsic affinities for two or more different ligands. Additional factors become relevant in considering the specificity exhibited in multivalent interactions, cell activation, and activation of the whole immune system. Therefore, specificity as defined for a monovalent binding event can diverge from specificity as it is defined for higher-order interactions. A corollary of this conclusion is that the composition of epitopes and paratopes, defined in terms of the structural elements for which substitutions have an effect on the specificity-defining measurement, can differ in different contexts despite complete conservation of the structures that physically make direct contact. An analysis of specificity at the organismal level suggests that the immune system does not recognize or respond to substances that corre-
Advances in CANCER RESEARCH Vol. 80 0065-230X/01 $35.00
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
148
Neil S. Greenspan
spond precisely to either nonself substances or to dangerous substances. An alternative notion for the molecular origins of immunological discrimination does not require that there be any single reason for immune responsiveness. This concept of what the immune system recognizes and responds to derives from the recognition that the ultimate function of the immune system is to contribute to survival and reproductive success through any available means. © 2000 Academic Press.
I. INTRODUCTION Specific recognition of antigen molecules is appropriately and widely regarded as one of the critical attributes of the immune response. Immunological specificity, even when manifested at the level of the whole organism, is conventionally attributed to molecules known as the antigen-specific receptors of B lymphocytes and T lymphocytes. The antigen-specific B lymphocyte receptors are referred to as immunoglobulins or antibodies (Ig, Ab) generically and when expressed in soluble form and as B-cell receptors (BCR) when expressed on the cell surface. The T lymphocyte receptors, expressed on the plasma membrane, that directly recognize antigen are referred to as T-cell receptors (TCR). Frequently, the attribution of specificity at a molecular level is carried further by associating the function of molecular recognition with the variable (V) domains (as opposed to the constant, or C, domains) and then, still more precisely, with the hypervariable (HV) regions present in all Ig and TCR V domains. From a perspective that takes into account thermodynamic as well as structural concepts, the formulation just given, while valuable, is incomplete even for the case of monovalent recognition where the sole end point is noncovalent binding. Furthermore, the attribution of specificity to molecular structures is less straightforward than is often presumed. In fact, the complete specification of the components of the relevant site on the antigen (epitope) or antigen-specific receptor (paratope) can vary with the nature of the question motivating the analysis. Applying this line of argument to multivalent binding, cellular activation, and, ultimately, organismal level immune responsiveness suggests that specificity is itself difficult to specify as a single concept. Instead, as will be developed later, it is more usefully regarded as a family of scale-dependent concepts. The next section reviews some issues of a logical nature that will be of use in the subsequent sections. The second section recounts the now-familiar immunological tale of how the monovalent specificity of antibodies (or BCRs) and TCRs derives from the unique primary and tertiary structures (shapes) associated with these clonally distributed receptors. Then, the limitations of this framework in accounting for experimental results will be examined. Next, the added complexities of bivalent or multivalent recognition will be
Dimensions of Antigen Recognition
149
explored. In the fourth section, the interactions encompassed in activating individual lymphocytes will be assessed in terms of the conventional thinking regarding lymphocyte specificity for antigen. The focus will be on B lymphocyte activation, but parallel arguments apply to T lymphocyte activation. We will consider a revised perspective that holds that the functional specificity of a B or T lymphocyte is not determined solely by the structure of the endogenously synthesized antigen-specific receptor molecules, which implies that cell and receptor specificity can, in at least one meaningful sense, diverge. The final section offers a preliminary analysis of specificity at the organismal level. It will be suggested that the immune system, strictly speaking, cannot be regarded as recognizing or responding to all and only what is nonself or to all and only what is dangerous. Instead, an alternative basis for immunological discrimination that is more compatible with the precepts of evolutionary biology is suggested.
II. LOGICAL PRELIMINARIES: BOUNDARIES OF CATEGORIES AND CATEGORIES OF BOUNDARIES It is difficult to imagine designing experiments to test hypotheses, or interpreting such experiments, without resort to deductive reasoning. Inevitably, because it is categories that are the substrate for such reasoning, the issue of how the boundaries of categories are defined will influence the direction and end points of the thought process. In fact, as argued later, not only is it crucial where one, metaphorically speaking, places a category boundary, it is also critical to determine what classes of category boundaries are to be permitted. The type of category that most individuals, and most immunologists, reflexively press into cognitive service corresponds to the classical set found in logic and mathematics. Membership in such a set is defined by the possession of one or a few characteristic properties that are common to all elements of the set, and preferably, not shared by any entities that are not members of the set (Vilenkin, 1968). A mathematical example of such a set would be even integers. If an integer is divisible by two without remainder, it is an even number. Any integer not satisfying this property is not an even number. For such a category, the category boundary is readily represented, as in Venn diagrams, by an idealized, infinitesimally thin line (Fig. 1A). Unfortunately for biologists in general, and immunologists in particular, many categories relevant to experimental investigation seem ill-suited to this classificatory framework imported from mathematics (Elsasser, 1981). The issue can be framed as follows: Does membership in a given biological or immunological category (i.e., assignment of a given category label) uniformly
150
Neil S. Greenspan
Dimensions of Antigen Recognition
151
imply the possession of a particular attribute or group of attributes? Not surprisingly for entities subject to mutation and selection (from macromolecules to organisms), the answer is frequently no. Consider the definition of immunoglobulins (antibodies). It might seem like a reasonable characteristic property of immunoglobulins that they possess heavy and light chains, but there is an immunoglobulin isotype in camels that has only heavy chains (Hamers-Casterman et al., 1993). If one wanted to specify the presence of heavy chain constant domains corresponding to an Fc region in antibodies as a characteristic property, one would be rewarded for most isotypes in most species, but ducks produce an antibody isotype with no Fc region (Magor et al., 1992). Examples of this sort are commonplace in dealing with labels for biological entities. Two types of variation that frustrate attempts to classify biological entities using categories that correspond to classical sets are frequently encountered (Figs. 1B and 1C) (Greenspan and Cooper, 1995; Van Regenmortel, 1998). First, there is simple quantitative variation along one scale. Of particular relevance to our present focus, one might consider what level of contribution to binding energy (free energy of complex formation) should be regarded as sufficient to be noted. The issue can therefore be framed as follows: Is there a threshold energy such that it is more important to know if any given energetic contribution falls on one side or the other of that threshold than it is to know the numerical magnitude of that contribution? Categories with quantitative membership functions and imprecise boundaries can handle this first sort of variation and are referred to as fuzzy sets (Kosko, 1993; Klir, 1995). Whereas an element is or is not a member of a classical set, an element can have partial membership in a fuzzy set ranging continuously over the interval from zero to one. Second, there is variation in the absence or presence (degree of presence) of one or more of a set of attributes, i.e., variation (discrete or continuous) on many scales. Categories with membership dependent on any of a group of attributes have been referred to as polytopic classes (Beckner, 1986), polythetic sets (Needham, 1983), or radial categories (Lakoff, 1987). In this sort of category, membership is not absolutely dependent on possession of a single attribute or set of attributes, and it can be the case that no single attribute is Fig. 1 Schematic illustration of different categories of category boundaries. (A) Conventional boundary for a classical set is an idealized, infinitesimally thin line that permits absolute certainty as to whether a given element is a member of the category. (B) Boundary for a so-called fuzzy set depicting quantitative variation in the extent of category membership. (C) Geometric representation of the boundary of a polythetic category requires multiple dimensions corresponding to variation in the presence (degree of presence) or absence of independent attributes, where presence of any of several attributes alone is sufficient for category membership. (D) Boundaries of some categories can reveal new structure (and complexity) with progressively finer scales of resolution. The sets of points referred to as fractals exemplify this notion.
152
Neil S. Greenspan
sufficient for membership in the category. For example, consider the mother– offspring relationships arising from such practices as adoption, remarriage, in vitro fertilization, and surrogate motherhood. There is no single attribute or set of attributes which apply to all individuals who might be regarded as mothers. As another concrete example, consider a sport, such as baseball, that has many precise rules. Consider changing one rule. Is the resulting game still baseball? Apparently, the baseball fans in the United States have accepted that whether (National League) or not (American League) the pitcher comes to bat, the game is still baseball. As Needham (1983) has noted: “The conventional definition of a conceptual class is that its members must possess certain properties in common. Vygotsky has shown, however, that this definition is unrealistic, and Wittgenstein that it is logically unnecessary.” Additional complications arise from two further factors. One factor relates to the fact that the answers to some questions vary with the scale of measurement or assessment (Mandelbrot, 1983) (Fig. 1D). Mandelbrot considers the example of determining the length of a coastline, which has an irregular shape on many scales of measurement. He notes that the value determined for the length of a coastline will tend to increase as the unit of measurement chosen decreases. The second factor, which relates to the realization that some categories embody similarities in multiple dimensions, is the simplifying assumption that categories of real entities are logically “pure.” A particularly relevant example is provided by the assumption underlying the generation of all organismal phylogenies on the basis of comparing nucleotide sequences at one or a few loci from each organism. This implicit assumption is essentially that all of the genes in a given genome are equally representative of the species. As noted by Shapiro (1999) and Doolittle (1999) (see later), the existence of lateral gene transfer casts doubt on this assumption, especially for prokaryotes but possibly even for eukaryotes. An important, current, and more thoroughly immunological example of such categorical impurity relates to the common practice of referring to cytokines as either “proinflammatory” or “anti-inflammatory.” While such terminology offers simplicity in thought and convenience in usage, it obscures the unavoidable fact that most cytokines have effects on inflammation that are multifaceted (Sporn, 1997; Kushner, 1998). For example, some immunologists refer to interleukin-4 (IL-4) as being “anti-inflammatory” because it reduces monocyte expression of the interleukin-1 and tumor necrosis factor genes (Essner et al., 1989) and increases monocyte expression of the interleukin-1 receptor antagonist (Orino et al., 1992). However, IL-4 is also associated with monocyte production of monocyte chemotactic protein and endothelial cell production of interleukin-6 (Colotta et al., 1992). Similarly conflicting effects can be identified for many, if not most, cytokines.
Dimensions of Antigen Recognition
153
The quest for a classical category of substances that elicit immune responses is at the root of much thinking about the fundamental nature of immune recognition. The assumption implicit in this quest is that entry into the category of “the immunogenic” is controlled by a single attribute or set of attributes shared by all immunogenic substances. However, even if we choose a single definition for “causation,” the causal basis for immunogenicity can differ for different substances. Some antigens (proteins) are immunogens primarily due to the ability to provide, following proteolysis, one or more peptides able to bind noncovalently to conventional host class I or class II major histocompatibility complex molecules. Not surprisingly, immunogenic polysaccharides cannot be immunogenic on this basis. Instead, nonmitogenic polysaccharides are immunogenic, with reference to B cells, primarily due to their abilities to cross-link antigen-specific surface immunoglobulin molecules (Mond et al., 1995). Other properties of potential immunogens, such as the ability to elicit production of various cytokines, are additional independent factors that can, but may not, contribute to immunogenicity.
III. MONOVALENT RECOGNITION A. The Orthodox View Immunologists frequently represent an antigen as a simple geometric shape (or a group of such shapes), fitting neatly into the binding site of an antigenspecific receptor possessing a virtually identical shape of slightly larger dimensions. This image, which dominates thinking about immunological recognition, is promulgated to varying degrees in the leading textbooks (e.g., Abbas et al., 1997; Janeway and Travers, 1997; Kuby, 1997) and is also exploited in reviews (e.g., Burdette and Schwartz, 1987) and even in original reports. Even when the interacting molecules are represented as detailed molecular models, the thought process regarding the causal factors that account for the interaction can remain strikingly limited to the extent of shape complementarity. This emphasis on molecular shape as the key to understanding molecular recognition, in general, or immunological recognition in particular, can be traced back to Emil Fischer and Paul Ehrlich at the end of the 19th century and the beginning of the 20th century, respectively (Lemieux, 1994; Karush, 1962). Their ideas were updated, postquantum mechanics, primarily by Linus Pauling (Pauling and Delbrück, 1940; Pauling, 1962). As Pauling wrote (originally in 1945), “It may be emphasized that this explanation of specificity, as due to a complementariness in structure which permits nonspecific
154
Neil S. Greenspan
intermolecular forces to come into fuller operation than would be possible for noncomplementary structures, is the only explanation which the present knowledge of molecular structure and intermolecular forces provides” (Pauling, 1962). Thus, Pauling exploited his unsurpassed knowledge of molecular structure and bonding to bring the concept of molecular complementarity, first expounded by Fischer and Ehrlich, into the era of modern chemistry and molecular biology. His views on molecular recognition carried enormous influence in biology and immunology. Pauling’s insights regarding the role of molecular complementarity in biomolecular interactions may be regarded as a necessary step in the development of our understanding of molecular recognition in biology. Unfortunately, his influence, coupled with the seductive simplicity of the concept of molecular complementarity, may have contributed to the slowness with which a fuller picture of molecular recognition has gained acceptance by a majority of investigators interested in the molecular and cellular aspects of biology. Pauling’s early notions do not take adequate account of numerous factors now known to contribute to intermolecular affinity and specificity. These factors include solvation, atomic mobility and conformational adjustments, volume exclusion effects, and confinement effects. Knowledge of some of these factors may have developed too late for Pauling to have incorporated them into his conceptual scheme, but one can readily imagine that his perspective was primarily molded by his interest in and ability to determine molecular structure (shape) and lacked comparable influence from thermodynamics. In this light, it is interesting to note the professional context in which Pauling’s career, and the careers of his students, developed. As Dudley Herschbach (1992) relates, Pauling had told him of the stark gap in perspective encountered by his students when, in the course of interviews for academic positions in the early 1930s, they presented their data on the determination of molecular structures by electron diffraction. “The physical chemistry faculty in the audiences had done their Ph.D.s in thermochemistry, and so imbibed a tradition which emphasized that it did not need to postulate the existence of molecules” (Herschbach, 1992)! So, perhaps it is not surprising that Pauling’s conceptions of molecular recognition emphasized structural details and paid less attention to thermodynamic considerations. Nevertheless, the ultimate causal basis for intermolecular binding is the free energy change associated with complex formation. A fundamental attribute of this quantity is that it applies to the entire system of which the reactants and the complex are components. Furthermore, it is a measure of the relative stability of the complex in relation to the free species in the context of the complete chemical system. Consequently, destabilization of the unbound versus the bound reactants, as well as stabilization of the complex, can produce a greater observed affinity between the reactants. These basic
Dimensions of Antigen Recognition
155
principles are often not incorporated into discussions of the molecular basis of immunological recognition and specificity. The next section explores how and why a perspective based on energetics may differ in some respects from a perspective that focuses solely on receptor and ligand structure. The divergence between these perspectives is magnified in biology because biomolecules are typically large polymers with substantial potential for conformational variation over time (Weber, 1975; Karplus and McCammon, 1983; McCammon and Harvey, 1987).
B. Limitations of the Orthodox View It is easy to understand how immunologists in the first half of this century would have found the concept of the contact-based epitope appealing. This molecular entity of unique shape appeared to explain all that needed explaining: how antibodies latched onto antigens, how strong the interactions were, and how one antibody could discriminate between a cognate antigen and other antigens of varying degrees of relatedness to the cognate molecule. In the intervening years, a large body of evidence has accumulated that pertains to the early assumptions regarding the nature of antigen– antibody interactions and other noncovalent interactions of biological and medical significance. These studies suggest ways in which the contact-based epitope concept is not fully satisfactory despite its historical and continuing value in thinking about molecular recognition. One significant factor in noncovalent interactions between two (or more) biological molecules that is not accounted for in Pauling’s original formulation of the molecular complementarity concept is the structural dynamics of macromolecules, such as proteins and nucleic acids (McCammon and Harvey, 1987). Conformational flexibility has been suggested to play a critical role in noncovalent interactions involving antibodies (Rini et al., 1992; Bhat et al. 1994), enzymes (Koshland, 1976), DNA-binding proteins (Lesser et al., 1993; Spolar and Record, 1994), and other receptors, such as the TCR (Garcia et al., 1998). A striking example of the importance of molecular flexibility to molecular interaction has been provided by Rasmussen et al. (1992), who studied the binding activity of crystalline ribonuclease cooled to temperatures just above (228⬚K) or just below (212⬚K) 220⬚K. This latter temperature corresponds to the midpoint of a broad temperature-dependent transition in the dynamic properties of proteins. According to molecular dynamics simulations, above 220⬚K atomic fluctuations include anharmonic motions of groups of bonded (covalently connected) and nonbonded (noncovalently interacting) atoms, whereas below 220⬚K, atomic fluctuations are primarily harmonic vibrations of individual atoms. Rasmussen et al. (1992), using high-resolution
156
Neil S. Greenspan
X-ray diffraction, found that at 212⬚K, ribonuclease no longer binds substrate or inhibitor, whereas at 228⬚K both substrate and inhibitor bind normally. Thus, noncovalent interaction cannot proceed if the macromolecular receptor is “frozen” in its preferred conformation. At least for some molecules, it is clear that the structure of a receptor or a ligand following complex formation can be substantially different than the structure of the same receptor or ligand in the unbound state (Hua et al., 1991; Rini et al., 1992). A key implication of this finding is that the ultimate extent of complementarity between receptor and ligand in complex cannot necessarily be predicted from the time-averaged structures of the two reactants in the unbound state. Furthermore, because some amount of free energy will be expended to achieve the conformation of a bound molecule, starting from the unbound conformation, there will be no simple relationship between the extent of final complementarity between receptor and ligand and the free energy of complex formation (affinity). These comments suggest that neither the extent of complementarity as calculated for the receptor and ligand in their respective unbound conformations nor the extent of postcomplex complementarity can necessarily be linearly related to affinity. Furthermore, there is not likely to be any simple relationship between the magnitudes of complementarity characterizing the relationships between a receptor and two different ligands and the differential in free energy change (affinity) associated with complex formation. Thus, even an algorithm that was universally accepted as the best for quantitating intermolecular complementarity could not be expected to yield values that would directly correlate, with arbitrary accuracy, with affinity or specificity as measured in kilocalories per mole. In this regard, it is interesting that one algorithm proposed as a measure of shape complementarity by Lawrence and Colman (1993) varies in a manner that does not correlate well with the intrinsic affinities characterizing various antibody–antigen (or other receptor–ligand) complexes (Table I). For example, the lysozyme-HyHEL5 complex is characterized by the highest intrinsic affinity (1 ⫻ 1011 M⫺1) found for the five complexes in Table 1, but it is also associated with the lowest value for Sc (0.65) seen among these five complexes. Clearly, a much larger sample of complexes is needed to draw definitive conclusions. Nevertheless, to the extent that the algorithm of Lawrence and Colman is considered a valid measure of shape complementarity, and the complexes in Table I are representative of antibody–protein antigen complexes, it is fair to question the degree to which variation in shape complementarity alone can explain variation in antibody–antigen intrinsic affinity. One accepted, nonstructural approach to determining the structural elements involved in a functional site is to determine which mutations affect the functional activities associated with that site. Whereas, it is to be expected that many substitutions for contact residues will have significant effects on
157
Dimensions of Antigen Recognition
Table I Relationship between values for the Shape Complementarity Statistic of Lawrence and Colman (Sc) and values for Intrinsic Affinity Characterizing Interactions between Antibodies (Ab) and Protein Antigens (Ag)a
Ag/Ab complex
Sc
Affinity
Influenza tern N9-NC41b,d Lysozyme/D1.3e,f
0.67 ⫾ 3 0.65 0.66 ⫾ 1 0.66 ⫾ 2
Lysozyme/HyHEL-10g lysozyme/HyHEL-5h
0.68 ⫾ 2 0.65 ⫾ 1
2 ⫻ 107 1 ⫻ 109 1.2 ⫻ 107 2.7 ⫻ 108 4.5 ⫻ 107 4.5 ⫻ 1010 1 ⫻ 1011
Influenza whale N9-NC10b,c,d
Interface (Å2)
Resolution (Å)
858
2.0
1212 674
2.5 2.5
1031 941
3.0 2.5
aModified from Lawrence and Colman (1993), with permission. Affinity (and some S ) values for each c complex from reports corresponding to superscripts. bFrom Gruen et al. (1993). cFrom Gruen et al. (1994) dFrom Malby et al. (1994). eFrom Hawkins et al. (1993). fFrom Harper et al. (1987). gFrom Lavoie et al. (1992). hFrom Chacko et al. (1995).
the propensity for complex formation, it has been found that some substitutions for contact residues have modest to insignificant effects on binding (Tulip et al., 1992; Lavoie et al., 1992; Hawkins et al. 1993). What is also clear from studies of this sort is that amino acid substitutions at positions of noncontact amino acids can have effects on intrinsic affinity for a given ligand as dramatic as substitutions at sites of some contact amino acids (Hua et al., 1991; Cunningham and Wells, 1993; Clackson and Wells, 1995). Thus, one can conceive of an epitope, or other site, as being defined by a matrix of amino acid substitutions and their respective effects on the free energy change of complex formation. Such a genetically defined epitope is likely to be overlapping, in terms of amino acid composition, with the contactbased epitope, but in most cases it will be nonidentical (Fig. 2). Some noncontact residues will be energetically important and some contact residues will be energetically unimportant (Greenspan, 1997; Greenspan and Di Cera, 1999). One method of defining epitopes through the analysis of mutations that has gained widespread currency is the systematic replacement of each wildtype amino acid believed to be part of an epitope or paratope with alanine (Cunningham and Wells, 1989), referred to as alanine scanning mutagenesis. If the wild-type amino acid is alanine, another amino acid that is considered a conservative substitution for alanine is used. The rationale for us-
158
Neil S. Greenspan
Fig. 2 Venn diagrams depicting the relationship between the set of amino acids in the hypervariable regions of antibody variable domains and the set of amino acids that determine, directly or indirectly, the extent of complementarity between a given paratope and a given epitope. “⭋” within a subset indicates that there are no amino acids in that subset, and “Y” within a subset indicates that there are amino acids in that subset. All hypervariable residues participate in determining the interface between a particular paratope and a particular epitope and all residues participating in the interface are hypervariable (top). In contrast, consistent with available evidence, there are hypervariable residues that do not participate in determining the interface between a particular paratope and a particular epitope, and there are residues in the framework regions of variable domains (nonhypervariable residues) that do participate in determining the interface between paratope and epitope (bottom). There are greater than 50 hypervariable residues per variable (V) module (VH ⫹ VL), but there are typically only 20 or fewer V domain amino acids that contact any given epitope. Reproduced from N. S. Greenspan (1997). In “Concepts in Chemistry: A Contemporary Challenge,” (D. H. Rouvray, ed.), pp. 383–403. Research Studies Press Limited, Taunton, Somerset, England, with permission.
ing alanine is that the side chain of alanine, a single methyl group, is smaller than any other side chain except for glycine. Therefore, it is assumed that substitution of any amino acid with alanine eliminates contacts without introducing any additional perturbations of the native structure. Glycine is not
Dimensions of Antigen Recognition
159
a good choice for such systematic replacements despite having a smaller side chain (a single H atom) than alanine, because the minimal glycine side chain permits backbone conformations that are much less likely with any other amino acid. This unusual backbone flexibility potentially introduces unwanted perturbations into the protein structure. Interpretation of the results from such alanine scanning mutagenesis is not as straightforward as is frequently assumed to be the case (Di Cera, 1998; Greenspan and Di Cera, 1999). Investigators typically attribute the difference in the free energy of complex formation (with a given molecular partner) between wild-type and alanine-substituted molecules to the wild-type amino acid. This assumption is valid only if the removal of the wild-type side chain, and its replacement with the (typically) smaller alanine side chain, has no other effects on the energetics of the protein. It is often the case that such additional perturbations exist. This assertion is supported by the fact that for the studies published so far, the free energy of complex formation for the wild-type receptor and the ligand of interest is not equal in magnitude to the sum of the individual contributions attributed to the mutated amino acids (Di Cera, 1998a,b). A particularly relevant example of the differences between contact-based and mutation-based definitions of epitopes or paratopes is provided by the immunological terminology pertaining to the primary structural variation of antibody V domains. Hypervariable regions, as already noted, consist of those positions in the V domain amino acid sequence that vary the most, from antibody to antibody, with respect to amino acid identity, as originally noted by Wu and Kabat (1970). It appeared sensible to Wu and Kabat that the differing antigen specificities of two distinct antibodies would be attributable to those amino acid residues that differed between the two different antibody V modules. Thus, these authors concluded that the amino acid positions that varied the most were the most likely to contribute to contact with the antigen. Wu and Kabat (1970), therefore, also referred to these residues as complementarity-determining residues (CDR). Based on X-ray diffraction analysis of complexes of antibody Fab fragments and protein antigens, it is now clear that in any given antibody–antigen complex, most of the HV or CDR residues do not make contact with the antigen and not all of the contact residues are necessarily from the HV (or CDR) regions within the V domains (Amit et al., 1986; Sheriff et al., 1987; Padlan et al., 1989) (Fig. 2). Furthermore, while most of the contact residues are drawn from the HV regions, variation in some framework residues, which do not directly contact antigen, can decisively influence the conformation of HV loops (Chothia et al., 1989) and in this sense serve as CDR. Therefore, it is unfortunate that amino acids at hypervariable positions have been equated with CDR. While the two sets of residues are overlapping, they are not identical for any given antibody in its interaction with a given antigen and they are not even iden-
160
Neil S. Greenspan
tical in the general case, averaging over all antibodies and antibody–antigen complexes (Fig. 2). Another factor that was not explicitly considered in the initial conception of complementarity was the role of solvent molecules and counterions. Pauling’s initial conception involved assessing the extent of complementarity between receptor and ligand exclusively on the basis of the structural features of the reactants proper. Even after several crystallographic structures of antibody–protein antigen complexes had been solved in the late 1980’s it was still believed that such interactions were characterized “by the almost total exclusion of water from the interface” (Davies and Padlan, 1990). However, these early structures were solved at resolutions that may not have permitted the visualization of bound water molecules in the epitope–paratope interface. For example, in a later paper, Bhat et al. (1994) refined the structure of the complex between the Fv fragment from mAb D1.3 and hen egg lysozyme and found that there were more bound waters associated with the complex than the sum of bound waters associated with the separate, unbound reactants. Although the magnitude of the influence of such bound water molecules on the energetics of antibody–antigen union has been questioned (van Oss, 1995), there have been reports suggesting that bound water molecules can influence both receptor–ligand energetics (Colombo et al., 1992) and receptor specificity (Quiocho et al., 1989). While crystallographers are typically focused on interactions that operate over distances of a few angstroms, empirical studies have detected much longer-range interactions of both electrostatic (Getzoff et al., 1992) and nonelectrostatic (Leckband et al., 1992) origins. An example of long-range electrostatic effects, which have been termed electrostatic guidance, involves an enhanced association rate of an ion for the enzyme superoxide dismutase. It is not clear that the magnitudes of such effects can be reliably predicted simply based on first principles and inspection of a high-resolution structure of the relevant receptor–ligand complex. So, if such long-range forces are involved in a given interaction, it might be difficult to fully explain that receptor–ligand interaction solely by reference to the details of the contact interface that give rise to short-range forces and effects. An additional set of factors likely to be relevant in biological systems involve what have been referred to as volume exclusion (Minton, 1993; reviewed in Zimmerman and Minton, 1993) and confinement effects (Minton, 1992; reviewed in Zimmerman and Minton, 1993). Volume exclusion effects apply when the total solute (e.g., protein) concentration is high. The free energy changes associated with the formation of molecular complexes under these conditions can be substantially altered relative to the situation in which the same complexes form in an environment characterized by a low overall protein or solute concentration. In evaluating the potential significance of these effects, it is worth noting
Dimensions of Antigen Recognition
161
that total protein concentration is typically in the range of 65–80 mg/ml in blood and can be over 300 mg/ml intracellularly. The contrast with the usual protein concentrations in typical in vitro media of approximately 10 mg/ ml (or less) is marked. These effects on affinities are enhanced when the predominant background solute species is smaller than the receptors or ligands of interest. Minton offers the following scenario. Imagine a site (e.g., a paratope) that, in the absence of crowding effects, binds more strongly to an epitope that is part of a smaller ligand A than to an epitope associated with a larger ligand B. This site may reverse this preference as the concentration of background species increases (Minton, 1993) (Fig. 3). Thus, despite the fact that the structures involved in these latter interactions have not been altered in any way by the perturbations in the system, the specificity as defined in thermodynamic terms has been substantially altered consequent to changes in the concentrations of molecular species that a purely structural perspective would suggest are irrelevant to the interaction. Similarly, the presence of large numbers of fibers or of membranes, creating compartments that confine macromolecules to regions of dimensions only slightly larger than those of the molecules themselves, can substantially alter the chemical potentials of these molecules (Minton, 1992). Consequently, the free energy changes associated with complex formation can be substantially altered in comparison to the same interactions occurring in bulk solution. In general, confinement, like molecular crowding, tends to enhance molecular association. Calculations suggest that, particularly inside of cells where fibrous elements have been estimated to occupy approximately 20% of the total volume of the cytoplasm, such effects can be quantitatively significant. According to Minton (1992), the magnitude of the confinement-mediated enhancement of molecular association will be influenced by the shape and size of the confining compartment and by the shape and size of the resulting aggregates. The key conclusion that can be drawn from the existence of volume exclusion and confinement effects is that, as noted earlier, a free energy change for complex formation reflects many factors that are not apparent from the local structural features of the interface between receptor and ligand. Another way of stating this point is that the magnitude of the free energy change associated with the union of receptor and ligand takes into account the composition and attributes of a molecular system, which includes receptor and ligand but which also includes many other molecular species. Standard thinking about molecular specificity engenders indifference to these other molecular species. However, the concentrations or changes in concentration of these other molecules can have effects on the specific interaction under consideration of a magnitude approximating the magnitude of the free energy change attributable to the intermolecular forces that are typically considered (Zimmerman and Minton, 1993).
162
Neil S. Greenspan
Fig. 3 Schematic illustration of the theoretical influence of molecular crowding on the thermodynamics of molecular discrimination exhibited by a receptor (Minton, 1993). At low background protein concentration, the monovalent receptor exhibits a higher intrinsic affinity for ligand 1 than for ligand 2. When the background protein concentration passes a threshold (i.e., under conditions of molecular crowding), the absolute value of the magnitude of the free energy of complex formation becomes greater for ligand 2 than for ligand 1, which has less shape complementarity than ligand 1 with respect to the receptor but is larger. Thus, while molecular shape influences the energetics of noncovalent interaction, it does not absolutely dictate the affinity between two biomolecules.
A clear example of the imperfect correlation of a measured thermodynamic parameter with the theoretical parameter corresponding to a particular molecular interaction was reported by Naghibi et al. (1995). In this study,
Dimensions of Antigen Recognition
163
calorimetric titrations of RNase A with cytidine 2⬘-monophosphate (2⬘CMP) at different temperatures were used to determine the enthalpy changes associated with the RNase A/2⬘-CMP interaction. The equilibrium constants determined calorimetrically were then used in the van’t Hoff equation to calculate so-called van’t Hoff enthalpies. The discrepancies between experimental and calculated enthalpy values approached 50%. Naghibi et al. (1995) argued that the discrepancies may arise because the observed enthalpy corresponds to a complex equilibrium involving steps in addition to the complexation of receptor and ligand. These other steps in the equilibrium are difficult to identify but probably include interactions between solution components, including solvent, and the receptor, ligand, or receptor– ligand complex. The preceding paragraphs discuss insufficiently appreciated factors contributing to the overall free energy change characterizing the formation of a complex. Sharp and Englander (1994) have pointed out an important distinction pertinent to the attribution of energies to individual bonds involved in a complex. If one asks how much free energy can be attributed to an individual noncovalent contact, or to the set of contacts associated with a single amino acid, the answer must necessarily involve a difference between two states. Sharp and Englander make their argument in the context of protein folding. In this setting, the magnitude of the free energy attributed to a given bond can vary significantly, depending on the exact comparison made. In one case, one compares the folded protein with and without the bond(s) of interest (microscopic or in situ bond energy). Alternatively, one assesses the contribution of the given bond to the energetic difference between the folded protein and the unfolded protein (system bond energy). Furthermore, they pointed out that the relative contributions of enthalpy and entropy to microscopic and system free energies, respectively attributed to the same contact, can be widely divergent. A similar analysis should apply to the process of noncovalent complex formation (Fig. 4). At least two baseline states can be relevant in considering the formation of a particular contact in the context of the formation of a receptor–ligand complex: (1) the same receptor–ligand complex minus the one bond (or set of bonds) or (2) the unbound receptor and unbound ligand. Consequently, in this setting, the microscopic bond energy corresponds to the difference in free energy between the complex without the particular bond formed (all other bonds characterizing the interaction are already in place) and with that particular bond formed. The system bond energy would then correspond to the free energy contribution, attributable to the one bond of interest, in progressing from the unbound reactants (none of the other bonds characterizing the interaction are already formed) to the equilibrium state of the fully formed complex. This equilibrium state will average over the times for individual contacts when they are and are not formed. Conse-
164
Neil S. Greenspan
Fig. 4 Consider receptor(R) and ligand (L) as sets of atoms (circles on stalks) that can make noncovalent contacts (contacts between circles). One can ask how much any given contact contributes to the free energy of complex formation between R and L. There are two answers to this question depending on whether the comparison is taken to be (1) the complex of R and L with all contacts formed, except the one of interest (crosshatched circles), versus the complex with all contacts (including the one of interest) formed, or (2) the situation where R and L are independent (unbound) versus the situation where the complex is formed and the contact of interest is in its equilibrium state (varying between formed and unformed states). In the first case (left), the energy contribution of the contact is referred to as the micro or in situ bond energy, and in the second case (right), the energy contribution of the contact is referred to as the system bond energy. These two bond energies, both attributed to the same contact, can be of substantially different magnitude. In addition, the magnitudes of the enthalpic and entropic contributions attributed to a single contact can vary even more substantially than the free energy contributions so attributed.
quently, end point states, as well as baseline states, differ between microscopic and system definitions of the energy attributed to a single noncovalent contact.
Dimensions of Antigen Recognition
165
What is the maximal magnitude of monovalent specificity? There is probably no single answer to this question as posed, if only because the appropriate measure of specificity is not uniquely specified. Nevertheless, it is clear that there is an upper bound to monovalent specificity, however defined, as ligand recognition cannot be perfect and, therefore, molecular discrimination cannot be absolute. The impossibility of perfect recognition or discrimination can be understood in both thermodynamic and structural terms. First, perfect fit and absolute discrimination would imply infinite intrinsic affinity (negative free energy change of complex formation), which is not physically plausible (Alberts et al., 1989). Second, the convexity of atoms prevents perfect shape complementarity between antibody (receptor) and antigen (ligand) (Náray-Szabó, 1993). These arguments from first principles, for the universality of degenerate molecular recognition, have been investigated at a theoretical level (Inman, 1974, 1978; Perelson and Oster, 1979). In addition, they are supported by experimental evidence that even antibodies elicited following two or more immunizations exhibit recognition for multiple ligands (Keitel et al., 1997; Kramer et al., 1997; Pinilla et al., 1998). There is also compelling evidence for the degeneracy of T-cell recognition of both MHC molecules (Sette and Sidney, 1998) and nominal antigen peptide (Hemmer et al., 1998). The impossibility of a perfect intermolecular fit and absolute molecular discrimination presumably contributes to selective forces that have favored immune system mechanisms that rely on multivalent recognition of antigen and on cellular recognition of antigen-containing complexes that involves multiple receptors of distinct structure.
IV. MULTIVALENT RECOGNITION Multivalent interactions, where two or more sites on a receptor simultaneously contact two or more sites on a ligand, are of importance for a vast range of biological phenomena, including many antibody–antigen interactions, classical pathway complement activation, interactions between immune complexes and Fc receptors on leukocytes, cell–cell interactions, cell– extracellular matrix interactions, signal transduction, and the regulation of gene transcription in lymphocytes and other cells. Analysis of multivalent interactions is inherently more complex than analysis of monovalent interactions (Crothers and Metzger, 1972; DeLisi, 1976; Karush, 1976; Jencks, 1981). A major source of this complexity is the existence of cooperative effects involving distinct binding sites. While zero cooperativity is a formal possibility, cooperativity (positive, negative, or both) is common. In cases where positive and negative cooperativity are present together, the net effect depends on factors such as epitope distribution. Consider the case where a receptor molecule, such as an IgG antibody, with
166
Neil S. Greenspan
two identical binding domains interacts with a ligand (antigen) with two identical epitopes. It may appear obvious that each paratope contributes equally to the binding. This statement is true in one sense, as the intrinsic affinities of the two paratopes for the individual epitopes on the ligand are identical. Averaged over many encounters between the same antibody and the same bivalent antigen, the two paratopes of any individual antibody molecule would be expected to contribute equally. However, in another sense (see later), it is not true that the two paratopes contribute equivalently. This nonequivalence is testimony to the fact that there are more dimensions to the process of molecular recognition than the mere three required in describing the shape of a molecule or its intermolecular contact sites. In a single antibody–antigen interaction, the equilibrium association constants characterizing, respectively, the initial paratope–epitope interaction and the (temporally) second, structurally identical, paratope–epitope interaction will frequently be unequal. In the (temporally) second interaction, the linkage between the two molecules provided by the first paratope–epitope bond increases the effective concentrations of both paratope and epitope and diminishes the entropic penalty to be attributed to the second paratope on binding. On this basis, the equilibrium constant of the second interaction can correspond to a higher affinity, which contributes to positive cooperativity between the sites. If the orientation and the distance between the epitopes are nonoptimal for the paratopes, then the equilibrium association constant for the temporally second reaction may be decreased, relative to the first reaction. On that basis, a form of negative cooperativity between the paratopes can be exhibited. Jencks suggested (1981) that one can define intrinsic free energies of complex formation characterizing the interactions between distinct receptor sites and distinct ligand sites and a coupling free energy, which is derived primarily from alterations in rotational and translational entropy. Williams and Westwell (1998) have pointed out that in addition to the entropic basis for positively cooperative binding of a bivalent or multivalent molecule, there is also an enthalpic contribution. Their argument is that the restriction of motion consequent to the binding of the first paratope will assist the binding (greater enthalpic contribution) by the temporally second paratope. They further suggest that this enthalpic effect is particularly pronounced for a binding site of relatively low intrinsic (monovalent) affinity when the other paratope, to which it is physically linked, binds relatively more tightly to its corresponding epitope (Williams and Westwell, 1998). Another key point is that in analyzing a multivalent interaction, particularly where two or more qualitatively different sites are involved, one must keep track of how the coupling free energy term is accounted for. It can be attributed to one or the other sites, or it can be kept separate, depending on the purpose of the analysis, but correct conclusions require that it be clear how the coupling free energy is being handled.
Dimensions of Antigen Recognition
167
It is clear that structural determinants of the coupling free energy can be located at sites physically separated from the actual contact-mediating sites on the receptor or the ligand. Consequently, variation in structural elements distant from the interface-forming elements can exert substantial influence on both the functional affinity characterizing multivalent interactions and on the selectivity of such interactions (Greenspan and Cooper, 1995). Furthermore, alterations in the binding of ligands at one site when a ligand binds to a distant site are not necessarily mediated through readily visualized conformation-altering signals transmitted to the contact residues (of the site with modified reactivity). Instead, such changes in binding activity may represent structurally subtle (verging on undetectable) pathways of energetic linkage (Williams and Westwell, 1998; Freire, 1999) or energetic costs for aligning sites for simultaneous engagement (Del Rio et al., 1993). As noted by Williams and Westwell (1998), the mere “tightening” (or “loosening”) of the internal structure of a macromolecule on binding by one ligand can be sufficient to account for altered affinities for additional ligands. Gross changes in molecular shape, as are frequently invoked by immunologists, are not necessarily required. Therefore, the descriptions of the sites that determine affinity and specificity, where the latter refers to discrimination among targets, are not necessarily identical in monovalent and multivalent settings, even when the conformations of the contact sites are identical within the limits of experimental analysis (Greenspan and Cooper, 1995). This conclusion applies in two senses: (1) the quantitative contributions to affinity or specificity of amino acids that participate in contact with ligand can differ in monovalent and multivalent situations and (2) the amino acid substitutions that affect affinity or specificity, beyond some biologically relevant functional threshold, can differ in monovalent and multivalent contexts. In other words, the description of an epitope or paratope, defined in terms of the structural elements affecting affinity or relative affinity between a cognate ligand and one or more noncognate ligands, is not absolute but can vary with context. It follows that two multivalent species with equal numbers of the same recognition site may exhibit different patterns of relative binding (ligand discrimination) for multivalent targets that differ in the two- or threedimensional distribution of the same target epitope or that differ in the fine structure of repeated epitopes. For example, we have compared the binding patterns of a murine monoclonal antibody (mAb) of the IgG3 subclass to the binding patterns of IgG1 and IgG2b mAbs expressing the identical heavy and light chain variable domains. All three of these mAbs have specificity for the terminal, nonreducing N-acetylglucosamine (GlcNAc) residues of the cell wall polysaccharide of group A streptococci. They also bind to both naturally occurring (Turner et al., 1990) and synthetic (Greenspan, 1988) GlcNAc-conjugated proteins. Using three strains of streptococci expressing high, intermediate, and low
168
Neil S. Greenspan
densities of cell wall GlcNAc, we found that the IgG3 mAb bound more effectively to all three bacterial strains than either the IgG1 or the IgG2b mAbs (Cooper et al., 1993). Furthermore, whereas the IgG3 bound best to the intermediate GlcNAc density strain, the IgG1 and IgG2b mAbs both bound best to the high GlcNAc density strain. F(ab⬘)2 fragments from both IgG3 and IgG1, which retain bivalency but lack the Fc region, also behaved like the IgG1 and IgG2b mAbs. In general, comparable results were obtained using either flow cytometry or solid-phase enzyme-linked immunosorbent assay (ELISA) to make these comparisons. Somewhat more complicated differences in relative binding among GlcNAc-specific IgG mAbs were also observed using GlcNAc–protein conjugates in ELISA and in assays based on a real-time biosensor device (BIAcore). Results from the biosensor experiments suggested that the differences between the IgG3 mAb and the IgG1 and IgG2b mAbs also extended to kinetic as well as equilibrium parameters. IgG3 appeared to have a slower dissociation rate and a slightly faster association rate than the other two mAbs in interactions with a solid-phase GlcNAc–protein conjugate (Cooper et al., 1994). Thus, our comparisons among the GlcNAc-specific murine mAbs (IgG3, IgG1, and IgG2b) indicate that identical complementarity, defined at the level of single sites (epitope or paratope), does not guarantee identical extent or specificity (discrimination among multivalent antigens) of binding. A study of the binding of three bivalent proteins, expressing identical DNA-binding domains linked to one another through distinct molecular structures, to cognate and noncognate DNA sequences, reached a similar conclusion (Cuenoud and Schepartz, 1993). The context dependence of multivalent specificity has also been demonstrated by Horan et al. (1999), who investigated binding of a multivalent lectin to two different carbohydrate ligands displayed at varying densities. They found that the lectin bound more strongly to one carbohydrate ligand at lower ligand densities and bound better to the second carbohydrate ligand at higher ligand densities. These results suggest that the concept of complementarity as it is applied to one contact-mediating site could be generalized to a more global measure of the magnitude of complementarity between multivalent receptors and ligands. This extended form of complementarity would take into account not only the “molecular fit” of each of the individual sites that engage in direct physical contact, but also the positive and negative cooperative effects between sites, such as the costs of bringing these sites into proper alignment for simultaneous interaction. In the example cited earlier, the IgG3 mAb would be regarded as more globally complementary, in the extended sense, than are the IgG1 or IgG2b mAbs with respect to the multivalent GlcNAc arrays on the streptococcal surfaces. In contrast, all three mAbs would be regarded as having identical complementarity, of the standard monovalent sort, for the GlcNAc epitopes. Ultimately, the free energy change associated with complex formation will be the most definitive measure for quantitating complementarity in the ex-
Dimensions of Antigen Recognition
169
Fig. 5 Schematic illustration of three different conceptualizations of a paratope (epitope) as a set of amino acid residues or, alternatively, as a set of atoms. Each circle above represents an amino acid residue (atom) in a simplified, hypothetical antibody. The top and bottom rows of circles correspond to V module FR residues or amino acid residues in the C domains, and the middle two rows of circles correspond to HV residues. In the case of the “classical paratope set,” amino acid residues are either part of the paratope or not depending only on whether the residue in question participates in contacting a given antigen. Amino acid residues belong to the “fuzzy paratope set” to different degrees, as indicated by the crosshatching of each circle. In this case, the degree of membership in the “paratope set” is correlated with the extent to which each residue contributes to the free energy of complex formation. A similar approach could be based on other variables characterizing the complex, such as the extent of contribution to buried surface area. If the paratope is conceived of as a polythetic category, then elements of the “paratope set” include, in this simplified scheme, amino acid residues that contribute to the free energy of complex formation (i.e., stabilize the complex) or that mediate contact between antibody and antigen. Some residues contribute in both senses, whereas others contribute in only one sense or the other. The most realistic concept of a “paratope set” might include variable degrees of set membership as well as permit set membership on the basis of only a subset of relevant properties. Reproduced, in modified form, from Greenspan and Cooper, Immunol. Today 16, 226–230 (1995) and from Greenspan (1997). In “Concepts in Chemistry: A Contemporary Challenge” (D. H. Rouvray, ed.), pp. 383 – 403. Research Studies Press Limited, Taunton, Somerset, England, with permission.
Fig. 6 Venn diagrams depicting two extremes in the relationships among the structural correlates of intermolecular contact, affinity, and specificity. Each of these sets is composed of elements corresponding to amino acids or atoms that are constituents of an antibody (or other receptor) or antigen (or other ligand). For the purposes of illustration, assume that the diagrams refer to an antibody of interest. Then, the simplest possible situation is where all amino acids of the antibody that participate in intermolecular contact with cognate antigen also contribute substantially to the free energy of complex formation (affinity) with cognate antigen and to the differential free energy of complex formation (specificity) that characterizes the binding of antibody to cognate versus noncognate antigen (top). In contrast, a situation is depicted where a given amino acid or atom (of the antibody) can belong to any one of the seven logically possible subsets (bottom). Experimental evidence suggests that the situation depicted at the top is
Dimensions of Antigen Recognition
171
tended, multivalent sense, although other measures of multivalent complementarity might be devised. These considerations suggest new ways for conceptualizing epitopes, paratopes, or other sites of noncovalent interaction (Fig. 5) (Greenspan and Cooper, 1995). In terms of the set theoretic concepts introduced earlier, a protein epitope or a paratope is conventionally regarded as a classical set of amino acids or atoms. From this perspective, all amino acids (atoms) of an antigen or antibody are either members, respectively, of the epitope or paratope set, or they are not members, where membership is based on completely sharing or failing to share one or more essential attributes. As noted earlier, alternatives to classical sets include fuzzy sets and polythetic categories. Conceptualization of an epitope (paratope) as a fuzzy set would permit varying degrees of membership in the set as a function of variables, including (1) quantitative contribution to the free energy change associated with complex formation, (2) contribution to the difference in free energy change associated with formation of two or more different complexes, or (3) the area of contact (e.g., buried molecular surface area). An epitope as a polythetic class would include structural elements as members that belong to the category for different reasons such that two members of the category may share no attribute in common. Therefore, while prototype elements of the epitope (paratope) set might contribute to affinity, differential affinity, and contact (Fig. 6, top), some elements included in the site might contribute in only one or two of these different roles (Fig. 6, bottom). The apparent contributions attributed to various structural subunits may also vary as a function of the level of resolution of the analysis of noncovalent binding (Greenspan, 1992).
V. SPECIFICITY OF CELLULAR ACTIVATION In the previous sections, the end point for assessing the specificity, or lack thereof, attributable to a particular receptor was simply binding: the formation of a noncovalent complex. When the specificity of individual immunological cells (B or T lymphocytes) is under consideration, the simplest asnot accurate, and that most, perhaps all, of the subsets pictured in the bottom are populated in actual biomolecular interactions. For example, contact residues might not be energetically important residues and, conversely, important affinity-determining or specificity-determining residues might not be contact residues. ⭋, subset is empty; Y, subset is nonempty, i.e., there is a at least one amino acid (or atom) that is an element of that subset. Reproduced from Greenspan (1997). In “Concepts in Chemistry: A Contemporary Challenge” (D. H. Rouvray, ed.), pp. 383–403. Research Studies Press Limited, Taunton, Somerset, England, with permission.
172
Neil S. Greenspan
sumption is that the specificity of the cell is equivalent to the specificity of the receptor; i.e., the specificity of a B or T lymphocyte can be inferred from what binds noncovalently to the antigen-specific receptors of that cell. However, a reasonable alternative point of view is that the ultimate end point(s) for assessing the specificity of a cell must be higher-level cellular functions that follow from events in the signal transduction pathways activated by antigen-specific receptors, such as cell replication, cytokine production, or cytotoxicity. If one accepts this perspective, then one is obligated to consider the implications for cellular specificity of findings relating to the roles of numerous B and T lymphocyte surface molecules sometimes referred to as coreceptors or costimulators. These implications are examined in detail for B lymphocytes. Numerous reports on the activation requirements of B lymphocytes document roles of cell surface molecules other than the surface immunoglobulin. These reports show that engagement of cell surface molecules (by their natural ligands) such as CD19 (Tedder et al., 1997), CD21 (Griffioen et al., 1991; Dempsey et al., 1996; Mongini et al., 1997), CD22 (Nadler et al., 1997; Cornall et al., 1998), and CD32 (Wilson et al., 1987; Choquet et al., 1993) influences whether and to what degree (or in what ways) B cells are activated following interaction with antigenic complexes. It has been suggested that these molecules, and the intracellular molecules with which they interact, regulate signals associated with binding to membrane immunoglobulin positively in some cases (CD19 and CD21) and negatively (CD22 and CD32) in others. Furthermore, a single coreceptor can exhibit both positive and negative influences on cellular activation. For example, Fujimoto et al. (1999) suggested that CD19 and CD22 interact functionally in regulating B-cell activation through the BCR such that ligation of CD19 elicits signals from CD22 that feedback negatively on the CD19-associated signals. As an example of the significance of the contributions of non-BCR cell surface molecules to B-cell activation and specificity, consider the report of Dempsey et al. (1996). They studied the ability of hen egg lysozyme (HEL) to elicit antibodies in mice. They found that if one to three copies of a CR2(CD21)-binding fragment of C3b (C3d) were covalently attached to HEL then the antigen was as much as 1000-fold more immunogenic. If the presence or absence of C3d influences whether B cells are activated sufficiently to give rise to antibody-secreting cells, then one has to admit that the ligation of CR2, as well as surface immunoglobulin, plays a role in discrimination by B cells between activating and nonactivating ligands. If a clonal B-cell population expressing a single cell surface immunoglobulin receptor is presented with cognate antigen and a series of unrelated antigens under conditions ideal for the activation of B cells, the odds are that the B cells will respond significantly to only the cognate antigen. There would be a nonzero but low probability of cross-reaction with and activation by
Dimensions of Antigen Recognition
173
one or more randomly chosen antigens. If the B cells in question responded by production of soluble immunoglobulin only for the cognate antigen, it would conform to normal immunological usage to say that the B cells were specific for the cognate antigen but not for the noncognate antigens. Even if one of the noncognate antigens bound to the surface immunoglobulin of the B cells, but still failed to elicit activation leading to antibody production, the B cells would be regarded as lacking specificity for this antigen based on the assay of secreted immunoglobulin. By that assay, binding to the BCR without activation would be invisible. Now consider the situation where the different substances offered to the B cells contain identical epitopes but differ in epitope spacing or the presence of complement-derived fragments, such as C3d. It would still be appropriate to investigate the ability of the clonal B cells to respond or not (discriminate) among these various substances. Imagine that one antigen preparation stimulates an antibody response from the clonal population of B cells and a second preparation fails to elicit such a response. Given such a result, it would again be appropriate to summarize the result by saying that the B cells are specific for the first preparation but not for the second preparation. If it was the case that the only difference between the preparations was the presence or absence of C3d, it would appear that the ligation or absence of ligation (by C3d) of CR2 was the critical determinant of B-cell activation or its absence (i.e., discrimination). If, in contrast to this example, the activating preparation was altered solely by changing a single amino acid in the epitope recognized by the surface immunoglobulin of the clonal B cells, it would be acceptable to attribute the discrimination (i.e., the specificity) at least partly to that single amino acid. Similarly, if a single amino acid change in the variable domains of the surface immunoglobulin led to the loss of an otherwise robust antibody response, it would be considered fair to assign to the position of that mutation a degree of control over immunological specificity. Therefore, from a logical perspective, alterations in the presence (degree of presence) or absence of CD21 or its ligand should be eligible for such attributions of control over specificity as assessed by antibody production. There are two fundamental, and related, implications of this line of argument. First, the specificity attributed to a soluble or cell surface antibody molecule, or to the variable domains of these receptors, as assessed by noncovalent binding, is not necessarily identical to the specificity of the B cell secreting or displaying that antibody as assessed by the functional end point of antibody production. An example of just such a divergence between the specificities of a T-cell receptor and a T-cell has been explicitly noted (Zheng and Liu, 1997). Current immunological usage discourages recognition of this possibility. Second, the specificity of the B cell as assessed by the functional end point
174
Neil S. Greenspan
of antibody production is not solely attributable to the amino acid sequences of the antigen-specific receptor. The hypervariable regions, often equated with the complementarity-determining regions, are defined after all as those positions (loci) in the polypeptide chain at which variation in amino acid sequence affects binding. A parallel approach can be adopted for defining immunological specificity at the cellular level. Then, specificity must be attributed to those loci at which variation affects the presence (degree of presence) or absence of the functional measure of interest. If variations in the level of expression or engagement of CD21 influence B-cell activation by various antigenic preparations, then some of the discriminatory activity should be attributed to the CD21 locus. Thus, all of the cellular level functional specificity cannot be said to originate from (variation in) the variable domains of the antigen-specific receptor. It has been suggested that the first century of immunology was focused on specificity and that the second will be focused on regulation (Paul, 1987). Given the widely accepted view that the functions of costimulatory molecules contribute to immune regulation, the just-described considerations suggest that there is no clear boundary between specificity and regulation.
VI. ORGANISMAL SPECIFICITY Evaluating immunological specificity at a systemic or organismal level is subject to the sort of definitional complexity that we have already encountered in discussing specificity and related concepts at simpler levels of biological organization. Standard measures of organismal antigen-specific responses are typically anatomically localized. Historically, the most common measurement has probably been serum antibody concentration. This measure provides no direct information on antibody levels in other body fluids, such as mucosal secretions; nor does it indicate the magnitude or anatomic distribution of T lymphocyte responses. Nevertheless, we will have to accept end points, such as serum antibody concentration, as meaningful indicators of organismal immune responses as the only truly global organismal measures, such as mortality, body weight, or physical activity, can be difficult to relate to specific diseases let alone antigens. At the organismal level of analysis, new phenomena can come into play that are not relevant in studies of isolated molecules or cells. Interactions between elements of the immune system can influence the specificity ultimately detected. For example, serum antibody specificity in many assays is a population phenomenon, arising out of the participation of antibodies produced by different clones in activities such as binding to antigen, precipitation, agglutination, neutralization, or activating complement or Fc receptor-bearing cells (Talmage, 1959; Inman, 1974).
Dimensions of Antigen Recognition
175
It is likely that different measures of organismal immune responses will not correlate absolutely. There is no reason to expect serum antibody levels and cytotoxic T-cell activity to necessarily increase or decrease in parallel as the immunological stimulus is varied. In fact, given the very different activation requirements of various types of lymphoid cells, it is to be expected that some immunogens will favor one type of response over another. Therefore, specificity at the organismal level will be difficult to reduce to a single scale of measurement, and one number will not suffice to capture all of the relevant information. We will, to some extent, have to face the operational nature of immunological specificity as manifested by the whole immune system (Zinkernagel, 1996). As might be anticipated, the list of factors influencing relevant end points grows in moving the focus from the level of activating individual cells to the level of activating the immune system. The consequence of the effects of variation in anatomical route, dosage, timing of multiple administrations, host genotype, lymphoid population dynamics, and so on is, at least potentially, a further loosening of the correlation between monovalent binding specificity and functional specificity. While no antigen-specific immune response will be forthcoming in the complete absence of antigen-binding receptors of appropriate structure, the presence of any particular constellation of such receptors will be compatible, contingent on these other system parameters, with responses that vary in magnitude over a fairly broad range. One aspect of immunological specificity, at the level of the whole organism, has assumed greater prominence in immunological discourse than had been the case for some years. This change in status was prompted in part by the general maturing of the field of cellular immunology, including the accumulation of experimental data from genetically altered mice. A further impetus to renewed interest in this question was created by specific proposals (Janeway, 1992; Matzinger, 1994; Matzinger and Fuchs, 1996) claiming to improve on the conventional wisdom that the immune system distinguishes between self and nonself. The proposal that has received the widest attention is that associated with Matzinger and Fuchs (1996), which proclaims that the chief criterion for immune system discrimination is dangerousness. This section evaluates the evidence for this claim as well as for claims that the immune system distinguishes between self and nonself (Burnet, 1959; Talmage, 1957). The comments on the latter distinction will also be of some relevance to the view that the immune system distinguishes between noninfectious self and infectious nonself ( Janeway, 1992). The view presented here is perhaps most consistent with that offered by Zinkernagel (1996), who suggested that the major factors determining immune responsiveness, such as the sites of antigen localization, are not intrinsic properties of the antigen but hinge on the context within which the antigen meets the immune system (see earlier discussion). A critique of the danger hypothesis, offered by Langman and Cohn (1996), differs in focus from that presented below.
176
Neil S. Greenspan
Fig. 7 (Top) Burnet’s proposal that what is immunogenic is nonself and that what is nonself is immunogenic, i.e., that the immune system responds to nonself. (Bottom) Some immunogenic susbtances are self (not nonself ) and some nonself substances are not immunogenic, in addition to there being substances that are both nonself and immunogenic.
In his classic monograph describing the clonal selection theory of the immune response, Burnet (1959) suggested that the immune system distinguishes between self (no antibody response) and nonself (antibody response). The thesis, at its simplest, is that the sets of immunogenic substances and nonself substances are identical (Fig. 7, top). This proposal sounds reasonable and is consistent with a rough correlation between immunogenicity and the phylogenetic distance between the species of origin for the immunogen and the host species (Crumpton, 1974). However, further analysis reveals many immunological phenomena that are not satisfactorily accounted for if the immune system rigorously distinguishes between self and nonself. Of course, this latter statement is correct only if the term “nonself” is defined by criteria that are not primarily immunological. It has become commonplace for immunologists to refer to substances as “nonself” when the intended meaning is limited to “that to which the immune system responds.” If nonself is defined in this immunological sense, then it becomes tautological to claim that the immune system responds to nonself but not to self. Before proceeding to examine the evidence bearing on the extent to which the immune system distinguishes between self and nonself, it will be valuable
Dimensions of Antigen Recognition
177
to consider the difficulties encountered in choosing definitions for “self” and “nonself.” Matzinger (1994) gave a hint of the problems on this score, and she cites examples of candidate criteria for “self” molecules, including (1) all molecules contained within the healthy (noninfected) body of the host, (2) all molecules encoded by the host genome, (3) all molecules whose biosynthesis is encoded by the host germline genome, (4) all molecules whose biosynthesis is encoded by the host genome contained in somatic cells, (5) all molecules encoded by the host genome and not expressed solely in immunologically sequestered sites, and (6) all gene products expressed by cells specialized for antigen presentation. What is clear is that multiple reasonable definitions for self (or nonself) are possible. These difficulties can get even more vexing. If a protein molecule differs from a host-encoded molecule by a single amino acid out of hundreds or thousands of amino acids, is the entire gene product nonself or is just a part of that gene product nonself? Definitive answers to these questions are unlikely to be found in the current immunological literature. Furthermore, there are levels of immunological recognition or response. It is reasonable to use any of a variety of standard end points for B and T lymphocyte responses, such as serum antibody production, numbers of antibody-secreting cells, cellular proliferation, cytokine secretion or numbers of cytokine-secreting cells, and magnitude of cytotoxicity. One might expect that the assays for these various end points will not always provide exactly parallel measures of immune responsiveness, and furthermore, each assay has a characteristic sensitivity. For each assay, there will, therefore, be a somewhat arbitrary lower limit to what can be counted as a meaningful response. The existence of haptens provides clear evidence that foreignness alone is not sufficient for the elicitation of an immune response. In fact, all repeat pharmacotherapy would be useless, due to neutralizing antibodies, if the introduction of any foreign substance led inexorably to an immune response. Similarly, some pathogen-derived (i.e., nonself) molecules, such as the capsular polysaccharide of group B Neisseria meningitidis (Lepow, 1988), are poorly immunogenic, even in healthy adults. Of course, as may be the case with the N. meningitidis capsular polysaccharide, the lack of immunogenicity may be related to similarities with host molecules. The lack of a maternal immune response to the paternally encoded antigens of the fetus also indicates that the immune system does not necessarily respond to foreign antigens, although this particular failure of response could be regarded as a special case. Failure of the immune system to recognize or respond to molecules that are indeed foreign is complemented by numerous settings in which the immune system recognizes or responds to self molecules. The discoveries of Zinkernagel and Doherty (1974) suggested that conventional T lymphocytes
178
Neil S. Greenspan
“recognize” self major histocompatibility complex (MHC) molecules in the act of recognizing foreign protein antigens. This interpretation has now been supported by structural and biophysical analyses of complexes of T-cell receptor, class I MHC molecule, and nominal antigen peptide (Garboczi et al., 1996; Garcia et al., 1996). Beyond the fact that recognition (noncovalent binding) of peptides derived from foreign, pathogen-encoded proteins inextricably involves the recognition of self class I or class II MHC molecules, it is clear that immune responses to self molecules can be generated. Apparently healthy individuals can have circulating rheumatoid factors, antibodies that bind to the Fc regions of self IgG antibodies, and the incidence is greater after age 60 years (Bartfeld, 1969). There is also evidence from studies in mice that rheumatoid factors are produced routinely as a consequence of immunization (Dresser, 1978; Nemazee and Sato, 1983). There is also abundant evidence for significant concentrations of other autoantibodies in the circulations of healthy people and mice (Schwartz and Stollar, 1985; Casali et al., 1987). In summary, the original proposal by Burnet that the immune system distinguishes between self and nonself may be regarded as only a very rough guide to system-wide immunological specificity, and it is not entirely satisfactory. Unless “nonself” is tautologically defined as that to which the immune system responds, the set of nonself substances will not correspond precisely to the set of substances that are recognized or responded to by the immune system (Fig. 7, bottom). These conclusions apply regardless of which of the multiple reasonable (and nonequivalent) definitions of self or nonself are adopted. What of the notion that the immune system is roused only by dangerous substances? This thesis is promulgated in a series of papers by Matzinger and Matzinger and Fuchs. It is based in part on the inadequacies of the self/nonself formulation (Matzinger, 1994) and might be seen by some to be more explicitly based on evolutionary considerations. However, the author argues that on immunological and evolutionary grounds, the so-called “danger hypothesis” is also unsatisfactory. The thesis under consideration, at its simplest, is essentially that the set of dangerous substances will correspond to the set of substances that are recognized or responded to by the immune system (Fig. 8, top). Rigorous evaluation of this notion first requires that there be, as discussed earlier in considering self/nonself discrimination, some agreement on how “recognition” or “response” is to be interpreted, and similarly it is crucial to define “dangerous.” As with the self/nonself distinction, one can make the proposition trivially true by defining “dangerous” as “that to which the immune system responds.” However, if the thesis is to have any conceptual significance, then “dangerous” must take on some other definition. In applying their ideas to tumor immunology, Matzinger and Fuchs (1996) made the following state-
Dimensions of Antigen Recognition
179
Fig. 8 (Top) The proposal that what is immunogenic is dangerous and that what is dangerous is immunogenic, i.e., the immune system responds to dangerous substances. (Bottom) Some immunogenic susbtances are not dangerous and some substances that are dangerous are not immunogenic, in addition to there being susbtances that are both dangerous and immunogenic.
ment: “In this model, cancers do not appear dangerous to the immune system, so that the default response of T cells to tumors is to be turned off.” Thus, in this context, they appear to be defining dangerous as “that to which the immune system responds.” The definition of danger, as admitted by the architects of the danger model, is problematic, and they consider more than one definition of “danger.” One suggestion is that dangerous substances (or microbes) are those that “cause cell stress or necrotic cell death” (Matzinger and Fuchs, 1996). Necrosis-inducing entities certainly overlap with those that might be considered dangerous on other grounds, but there are also clearly entities that are dangerous even if they do not cause necrosis, at least as their first and primary actions. It is also the case that the induction of necrosis of host tissues can be highly dose dependent. Thus, even endogenous (nonimmunogenic) molecules, such as some cytokines, can cause necrosis at excessive concentrations. Third, small molecules that can cause necrosis, but that cannot elicit immune responses, can be very dangerous. If, for the time being, we adopt a colloquial definition of dangerous, we can then ask if the immune system responds to all and only dangerous sub-
180
Neil S. Greenspan
stances. Alternatively, we can ask if it responds to some nondangerous substances or fails to respond to some dangerous substances. The answer to the latter two questions is unquestionably affirmative. First, consider whether there are substances that are effective immunogens despite not being dangerous, at least in relative terms. Examples in this category include allergens. Cat dander, mite feces, and grass pollen hardly pose devastating threats to the host, yet antibody responses can be mounted to these substances. Penicillin is another example of a substance that is not inherently dangerous to human cells, but most individuals treated with penicillin make IgG antibodies to it (Saxon et al., 1987). Furthermore, penicillin becomes highly dangerous due to a particular form of immune response, an IgE antibody response (Saxon et al., 1987). Among the most striking failures of the danger model is that it does not take into account the most significant immunological contribution to medicine: vaccines. Vaccines are substances for which dangerousness and immunogenicity can be dissociated. More specifically, vaccines are substances that retain immunogenicity despite having intentionally been designed to exhibit reduced dangerousness. There are numerous examples of pathogenic viruses (e.g., measles) and bacteria (e.g., salmonella) that have been attenuated (made less dangerous) but have retained their immunogenicity. Subunit vaccines also represent effective immunogens posing considerably reduced levels of danger compared to the wild-type pathogens from which they are derived. In our own studies on the factors influencing the immunogenicity of pneumococcal conjugate vaccines, we have found that antibody responses can be elicited in mice following immunization with a conjugate, consisting of a capsular polysaccharide and a nontoxic carrier protein, in the absence of adjuvant (McCool et al., 1999). Neither component of this vaccine is dangerous by any normal definition of the term. In fact, the carrier protein CRM197 (Uchida et al., 1972) is a variant of diphtheria toxin that differs from the toxin by a single amino acid substitution that renders it nontoxic (Giannini et al., 1984). A third class of nondangerous immunogens corresponds to alloantigens. When patients receive blood transfusions, a fraction of patients will produce antibodies to erythrocyte alloantigens expressed by the transfused erythrocytes (Giblett, 1990). The only danger to the host arises from the destruction of the transfused erythrocytes by the immune response. In this context, perhaps the most striking example of an alloantibody response is the maternal response to fetal erythrocytes expressing paternal antigens, such as the Rh system D antigen, not expressed by the mother (Whittle, 1992). In this setting, the antigenic material, fetal erythrocytes, poses no danger to the mother and would not be expected to elicit much inflammation. It is not clear how these responses can be accounted for within the framework of the danger model without destroying the explanatory power of the model.
Dimensions of Antigen Recognition
181
Second, are there dangerous substances, or substances that contribute to the dangerousness of pathogens or cells, that fail to elicit immune responses? As noted previously, group B N. meningitidis is a human pathogen that can cause fatal meningitis, but the capsular polysaccharide is a very poor immunogen (even in the context of the whole organism), even in adult hosts (Lepow, 1988). Other capsular polysaccharides, which are virulence factors, are also poor immunogens, especially in the very young and in individuals with various types of immunocompromise. Having raised the issue of immune responses to polysaccharides, it is worth noting that Matzinger’s scheme, as presented, completely ignores this aspect of the immune response. Also problematic for the danger hypothesis are substances or mircoorganisms that are dangerous, such as penicillin, only or primarily because of the immune or inflammatory response that is mounted. Thus, for these molecules or molecular complexes, the immunogenicity precedes the dangerousness instead of the other way around. Lipopolysaccharide is dangerous in strains of mice that can respond to it, while it is not dangerous, or is less dangerous, in mice of the C3H/HeJ strain (Freudenberg et al., 1986). These mice do not respond to lipopolysaccharide with the inflammation-related processes triggered in mice of other strains. Similarly, the mouse mammary tumor virus is rendered more dangerous by virtue of the immune response to it. The virus actually exploits lymphocytes to transport viral progeny to receptive cells elsewhere in the body of the host (Golovkina et al., 1998). Thus, the set of dangerous substances does not appear to be identical with the set of immunogenic substances (Fig. 8, bottom), and immune system discrimination cannot be satisfactorily described by reference to dangerousness or nonselfness. If one accepts this last assertion, one is then led to ask: Is there an alternative formulation that is satisfactory? A preliminary answer is that the immune system responds to those substances that meet the following criterion: the potential to respond to the substance in question increases, on average, net reproductive fitness (or genetic success). Thereby, the question of immune system discrimination is returned to an evolutionary framework for evaluation of the functional capability of the immune system. The failure of both the self/nonself and the dangerous/nondangerous distinctions to account for the range of immunogenicities encountered in the molecular universe can be traced to an error that is fundamentally an error of logic. Both schemes are implicitly based on the assumption that there is a single attribute that can account for the elicitation of an immune response. This assumption is unlikely to be correct due to the origin of the immune system through an evolutionary process based, at least in part, on random variation and selection. The key implication stemming from this evolutionary origin of the immune system is that whatever the original reasons for the occurrence of a given component of the immune system, once in place other uses might be “discovered” and exploited. Living systems subject to natural selection exhibit opportunism and can
182
Neil S. Greenspan
evolve in response to multiple selection pressures in parallel or in series (temporally speaking). This fact has consequences for the usefulness of schemes for classifying organisms and their physiological systems. In the case of the immune system, the consequence is that there are multiple reasons that might account for why a given substance elicits an immune response. Returning to our earlier discussion of categories, the set of criteria for elicitation of an immune response is more likely to be a polythetic category than a classical set. Matzinger (1994) was therefore essentially correct when she noted that the “immune system makes its own definitions.” A sense of the perspective that the author is attempting to convey is captured by Jonathan Weiner (1994) in his informative and beautifully written description of the work of Peter and Rosemary Grant. The Grants have studied the evolution of the finches of the Galápagos Island, Daphne Major, for close to three decades. As Weiner says: “As more and more ecologists and evolutionists watch life up close and long term, the way the Grants are observing Daphne Major, they see that these categories are not as fixed as they had imagined. . . . Nature is fluid.” That the categories of biology will need to mirror this fluidity is brought home by the forceful analysis of Doolittle (1999) cited earlier in the section on logical peliminaries. Doolittle discussed the profound implications of evidence for extensive lateral gene transfer for the construction of organismal phylogenies. He noted that the available evidence suggests that the genomes of most archaea and bacteria (the precursors of the nuclear genomes of eukaryotes) are composed of genes originating in different species. “If “chimerism” or “lateral gene transfer” cannot be dismissed as trivial in extent or limited to special categories of genes, then no hierarchical universal classification can be taken as natural” (Doolittle, 1999). Thus, according to Doolittle, molecular evolutionists will fail to discover the “true tree” of life not because of methodological inadequacies or because of poor judgment in choosing which gene sequences to study, but because a tree cannot adequately represent the history of life. At this most basic level of biological categories (i.e., genomes), it turns out that the heterogeneity of gene origins is inconsistent with the representation of genomes as classical sets of genes.
VII. CONCLUSIONS The noncovalent binding of ligand by receptor clearly depends on the extent of shape complementarity and chemical complementarity characterizing the interacting molecular surfaces, but just as clearly, other factors can exert an influence on the interaction. Because the free energy change of complex formation takes into account the entire chemical system, and not just
Dimensions of Antigen Recognition
183
the receptor (paratope) and the ligand (epitope), the dimensions required to describe the process extend beyond the dimensions sufficient for assessing mere spatial fit, the dimension for time, and even dimensions that correspond to chemical properties of atoms in the intermolecular interface. These points may be accepted by biophysicists and physical biochemists, but they are frequently ignored in the discussion of experimental results involving molecular interactions of immunological interest. It is also apparent that understanding the specificity of a monovalent interaction between an immunological receptor and an antigen is not equivalent to understanding the specificity manifested in interactions between the same antigen, in a multivalent form, and a soluble multivalent receptor (e.g., IgM or IgG). Furthermore, the specificity attributed to an antigen-specific lymphocyte, on the basis of a measurement of cellular function (e.g., cytokine secretion), will not necessarily correspond precisely to the specificity of noncovalent binding exhibited by the antigen-specific receptor expressed by that lymphoid cell. This point can be extended to the immune system as a whole. Such considerations suggest that it may be better to conceptualize specificity as a family of related but nonidentical concepts, i.e., as a polythetic set of concepts rather than as a classical set of concepts. Furthermore, at the level of the entire immune system, the ultimate requirements for the elicitation of an adaptive (i.e., antigen-specific) immune response are not satisfactorily accounted for on the basis of the extent to which the molecules in question are regarded as (nontautologically) nonself or dangerous. Thus, the category of immunogenic substances may also best be regarded as a polythetic category.
ACKNOWLEDGMENT The author’s work is supported by the following grant from the National Institutes of Health, Department of Health and Human Services: AI41657.
REFERENCES Abbas, A. K., Lichtman, A. H., and Pober, J. S. (1997). “Cellular and Molecular Immunology, 3rd Ed. Saunders, Philadelphia. Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K., and Watson, J. D. (1989). “Molecular Biology of the Cell, 2nd Ed., p. 94. Garland, New York/London. Bartfeld, H. (1969). Ann. N.Y. Acad. Sci. 168, 30 – 38. Beckner, M. (1968). “The Biological Way of Thought.” University of California Press, Berkeley, CA.
184
Neil S. Greenspan
Bhat, T. N., Bentley, G. A., Boulot, G., Greene, M. I., Tello, D., Dall’Acqua, W., Souchon, H., Schwarz, F. P., Mariuzza, R. A., and Poljak, R. J. (1994). Proc. Natl. Acad. Sci. USA 91, 1089–1093. Burdette, S., and Schwartz, R. S. (1987). N. Engl. J. Med. 317, 219 –224. Burnet, F. M. (1959). “The Clonal Selection Theory of Acquired Immunity.” Vanderbilt Univ. Press, Nashville, TN. Casali, P., Burastero, S. E., Nakamura, M., Inghirami, G., and Notkins, A. L. (1987). Science 236, 77–81. Chacko, S., Silverton, E., Kam-Morgan, L., Smith-Gill, S., Cohen, G., and Davies, D. (1995). J. Mol. Biol. 245, 261–274. Choquet, D., Partiseti, M., Amigorena, S., Bonnerot, C., and Fridman, W. (1993). J. Cell Biol. 121, 355–363. Chothia, C., Lesk, A. M., Tramontano, A., Levitt, M., Smith-Gill, S. J., Air, G., Sheriff, S., Padlan, E., Davies, D., Tulip, W. R., Colman, P. M., Spinelli, S., Alzari, P. M., and Poljak, R. J. (1989). Nature 342, 877– 883. Clackson, T., and Wells, J. A. (1995). Science 267, 383 – 386. Colombo, M. F., Rau, D. C., and Parsegian, V. A. (1992). Science 256, 655 – 659. Colotta, F., Sironi, M., Borre, A., Luini, W., Maddalena, F., and Mantovani, A. (1992). Cytokine 4, 24 –28. Cooper, L. J. N., Robertson, D., Granzow, R., and Greenspan, N. S. (1994). Mol. Immunol. 31, 577–584. Cooper, L. J. N., Shikhman, A. R., Glass, D. D., Kangisser, D., Cunningham, M. W., and Greenspan, N. S. (1993). J. Immunol. 150, 2231–2242. Cornall, R. J., Cyster, J. G., Hibbs, M. L., Dunn, A. R., Otipoby, K. L., Clark, E. A., and Goodnow, C. C. (1998). Immunity 8, 497– 508. Crothers, D. M., and Metzger, H. (1972). Immonochemistry 9, 341– 357. Crumpton, M. J. (1974). Antigens 2, 1–78. Cuenoud, B., and Schepartz, A. (1993). Science 259, 510 – 513. Cunningham, B. C., and Wells, J. A. (1989). Science 244, 1081–1085. Davies, D. R., and Padlan, E. A. (1990). Annu. Rev. Biochem. 59, 439 – 473. DeLisi, C. (1976). “Antigen Antibody Interactions.” Springer-Verlag, Berlin. Del Rio, S., and Setzer, D. (1993). J. Mol. Biol. 233, 567– 579. Dempsey, P. W., Allison, M. E., Akkaraju, S., Goodnow C. C., and Fearon, D. T. (1996). Science 271, 348–350. Di Cera, E. (1998a). Adv. Prot. Chem. 51, 59 –119. Di Cera, E. (1998b). Chem. Rev. 98, 1563 –1591. Doolittle, W. F. (1999). Science 284, 2124 –2128. Dresser, D. W. (1978). Nature 274, 480 – 483. Elsasser, W. M. (1981). Progr. Theor. Biol. 6, 23 – 62. Essner, R., Rhoades, K., McBride, W. H., Morton, D. L., and Economou, J. S. (1989). J. Immunol. 142, 3857–3861. Freire, E. (1999). Proc. Natl. Acad. Sci. USA 96, 10118 –10122. Freudenberg, M. A., Keppler, D., and Galanos, C. (1986). Infect. Immun. 51, 891– 895. Fujimoto, M., Bradney, A. P., Poe, J. C., Steeber, D. A., and Tedder, T. F. (1999). Immunity 11, 191–200. Garboczi, D. N., Ghosh, P., Utz, U., Fan, Q. R., Biddison, W. E., and Wiley, D. C. (1996). Nature 384, 134–141. Garcia, K. C., Degano, M., Pease, L. R., Huang, M., Peterson, P. A., Teyton, L., and Wilson, I. A. (1998). Science 279, 1166 –1172. Garcia, K. C., Scott, C. A., Brunmark, A., Carbone, F. R., Peterson, P. A., Wilson, I. A., and Teyton, L. (1996). Nature 384, 577– 581, 1996.
Dimensions of Antigen Recognition
185
Getzoff, E. D., Cabelli, D. E., Fisher, C. L., Parge, H. E., Viezzoli, M. S., Banci, L. and Hallewell, R. A. (1992). Nature 358, 347– 351. Giannini, G., Rappuoli, R., and Ratti, G. (1984). Nucleic. Acids Res. 12, 4063 – 4069. Giblett, E. R. (1990). In “Hematology” (W. J. Williams, E. Beutler, A. J. Erslev, and M. A. Lichtman, eds.), 4th Ed., p. 1601. McGraw-Hill, New York. Golovkina, T. V., Dudley, J. P., and Ross, S. R. (1998). J. Immunol. 161, 2375 –2382. Greenspan, N. S. (1992). Bull. Inst. Pasteur 90, 267–279. Greenspan, N. S. (1997). In “Concepts in Chemistry: A Contemporary Challenge” (D. H. Rouvray, ed.), pp. 383– 403. Research Studies Press Limited, Taunton, Somerset, England. Greenspan, N. S., and Cooper, L. J. N. (1995). Immunol. Today 16, 226 –230. Greenspan, N. S., Dacek, D. A., and Cooper, L. J. N. (1988). J. Immunol. 141, 4276 – 4282. Greenspan, N. S., and Di Cera, E. (1999). Nature Biotechnol. 17, 936 – 937. Griffioen, A. W., Rijkers, G. T., Janssens-Korpela, P., and Zegers, B. J. M. (1991). Infect. Immun. 59, 1839–1845. Gruen, L. C., McInerney, T. L., Webster, R. G., and Jackson, D. C. (1993). J. Protein Chem. 12, 255–259. Gruen, L. C., McKimm-Breschkin, J. L., Caldwell, J. B., and Nice, E. C. (1994). J. Immunol. Methods 168, 91–100. Hamers-Casterman, C., Atarhouch, T., Muyldermans, S., Robinson, G., Hamers, C., Songa, E. B., Bendahman, N., and Hamers, R. (1993). Nature 363, 446 – 448. Harper, M., Lema, F., Boulot, G. and Poljak, R. J. (1987). Mol. Immunol. 24, 97–108. Hawkins, R. E., Russell, S. J., Baier, M., and Winter, G. (1993). J. Mol. Biol. 234, 958 – 964. Hemmer, B., Vergelli, M., Gran, B., Ling, N., Conlon, P., Pinilla, C., Houghten, R., McFarland, H. F., and Martin, R. (1998). J. Immunol. 160, 3631– 3636. Herschbach, D. R. (1992). In “The Chemical Bond: Structure and Dynamics” (A. Zewail, ed.), pp. 175–222. Academic Press, Boston. Horan, N., Yan, L., Isobe, H., Whitesides, G. M., and Kahne, D. (1999). Proc. Natl. Acad. Sci. USA 96, 11782–11786. Hua, Q. X., Shoelson, S. E., Kochoyan, M., and Weiss, M. A. (1991). Nature 354, 238 –241. Inman, J. K. (1974). In “The Immune System: Genes, Receptors, Signals” (E. E. Sercarz, A. R. Williamson, and C. F. Fox, eds.), pp. 37– 52. Academic Press, New York. Inman, J. K. (1978). In “Theoretical Immunology” (G. I. Bell, A. S. Perelson, and G. H. Pimbly, eds.), pp. 243–278. Academic Press, New York. Janeway, C. A., Jr. (1992). Immunol. Today 13, 11–16. Janeway, C. A., Jr., and Travers, P. (1997). “Immunobiology: The Immune System in Health and Disease,” 3rd Ed. Current Biology Ltd./Garland Publishing Inc., London/New York. Jencks, W. P. (1981). Proc. Natl. Acad. Sci. USA 78, 4046 – 4050. Karplus, M., and McCammon, J. A. (1983). Annu. Rev. Biochem. 53, 263 – 300. Karush, F. (1962). Adv. Immunol. 2, 1– 40. Karush, F. (1976). Contemp. Topics Molec. Immunol. 5, 217–228. Keitel, T., Kramer, A., Wessner, H., Scholz, C., Schneider-Mergener, J., and Hohne, W. (1997). Cell 91, 811–820. Klir, G. J., and Yuan, B. (1995). “Fuzzy Sets and Fuzzy Logic: Theory and Applications.” Prentice Hall PTR, Upper Saddle River, NJ. Koshland, D. E. (1976). FEBS Lett. 62, E47-E52. Kosko, B. (1993) “Fuzzy Thinking: The New Science of Fuzzy Logic.” Hyperion, New York. Kramer, A., Keitel, T., Winkler, K., Stocklein, W., Hohne, W., and Schneider-Mergener, J. (1997). Cell 91, 799 –809. Kuby, J. (1997). “Immunology,” 3rd Ed. Freeman, New York. Kushner, I. (1998). Cytokine Growth Factor Rev. 9, 191–196.
186
Neil S. Greenspan
Lakoff, G. (1987). “Women, Fire, and Dangerous Things: What Categories Reveal about the Mind.” The University of Chicago Press, Chicago. Langman, R. E., and Cohn, M. (1996). J. Immunol. 157, 4273– 4276. Lavoie, T. B., Drohan, W. N., and Smith-Gill, S. J. (1992). J. Immunol. 148, 503 – 513. Lawrence, M. C., and Colman, P. M. (1993). J. Mol. Biol. 234, 946 – 950. Leckband, D. E., Israelachvili, J. N., Schmitt, F.-J., and Knoll, W. (1992). Science 255, 1419 – 1421. Lemieux R. U., and Spohr, U. (1994). Adv. Carbohydr. Chem. Biochem. 50, 1–20. Lepow, M. L. (1988). In “Vaccines” (S. A. Plotkin and E. A. Mortimer, Jr., eds.), p. 265. Saunders, Philadelphia. Lesser, D. R., Kurpiewski, M. R., Waters, T., Connolly, B. A., and Jen-Jacobson, L. (1993). Proc. Natl. Acad. Sci. USA 90, 7548 –7552. Magor, K. E., Warr, G. W., Middleton, D., Wilson, M. R., and Higgins, D. A. (1992). J. Immunol. 149, 2627–2633. Malby, R. L., Tulip, W. R., Harley, V. R., McKimm-Breschkin, J. L., Laver W., Webster R. G., and Colman, P. M. (1994). Structure 2, 733 –746. Mandelbrot, B. B. (1983). “The Fractal Geometry of Nature.” Freeman, New York. Matzinger, P. (1994). Annu. Rev. Immunol. 12, 991–1045. Matzinger, P., and Fuchs, E. J. (1996). J. NIH Res. 8, 35 – 39. McCammon J. A., and Harvey, S. C. (1987). “Dynamics of Proteins and Nucleic Acids.” Cambridge Univ. Press, Cambridge. McCool, T. L., Harding, C. V., Greenspan, N. S., and Schreiber, J. R. (1999). Infect. Immun. 67, 4862–4869. Minton, A. P. (1992). Biophys. J. 63, 1090 –1100, 1992. Minton, A. P. (1993). J. Mol. Recog. 6, 211–214. Mond, J. J., Lees, A., and Snapper, C. M. (1995). Annu. Rev. Immunol. 13, 655 – 692. Mongini, P. K. A., Vilensky, M. A., Highet, P. F., and Inman, J. K. (1997). J. Immunol. 159, 3782–3791. Nadler, M. J. S., Mclean, P. A., Neel, B. G., and Wortis, H. (1997). J. Immunol. 159, 4233 – 4243. Naghibi, H., Tamura, A., and Sturtevant, J. M. (1995). Proc. Natl. Acad. Sci USA 92, 5597– 5599. Náray-Szabó, G. (1993). J. Mol. Recog. 6, 205 –210. Needham, R. (1983). “Against the Tranquility of Axioms.” University of California Press, Berkeley, CA. Nemazee, D. A., and Sato, V. L. (1983). J. Exp. Med. 158, 529 – 545. Orino, E., Sone, S., Nii, A., and Ogura, T. (1992). J. Immunol. 149, 925 – 931. Padlan, E. A., Silverton, E. W., Sheriff, S., Cohen, G. H., Smith-Gill, S. J. and Davies, D. R. (1989). Proc. Natl. Acad. Sci. USA 86, 5938 – 5942. Paul, W. E. (1987). J. Immunol. 139, 1–6. Pauling, L., and Delbrück, M. (1940). Science 92, 77–79. Pauling, L. (1945, 1962). In “The Specificity of Serological Reactions” (K. Landsteiner), pp. 275–293. The President and Fellows of Harvard College (1945) and Dover Publications (1962), Inc., New York. Perelson, A. S., and Oster, G. F. (1979). J. Theor. Biol. 81, 645 – 670. Pinilla, C., Appel, J. R., Campbell, G. D., Buencamino, J., Benkirane, N., Muller, S., and Greenspan, N. S. (1998). J. Mol. Biol. 283, 1013 –1025. Quiocho, F. A., Wilson, D. K., and Vyas, N. K. (1989). Nature 340, 404 – 407. Rasmussen, B. F., Stock, A. M., Ringe, D., and Petsko, G. A. (1992). Nature 357, 423 – 424. Rini, J. M., Schulze-Gahmen, U. and Wilson, I. A. (1992). Science 255, 959 – 965. Saxon, A., Beall, G. N., Rohr, A. S., and Adelman, D. C. (1987). Ann. Intern. Med. 107, 204 – 215.
Dimensions of Antigen Recognition
187
Schwartz R. S., and Stollar, B. D. (1985). J. Clin. Invest. 75, 321– 327. Sette, A., and Sidney, J. (1998). Curr. Opin. Immunol. 10, 478 – 482. Shapiro, J. A. (1999). ASM News 65, 201–207. Sharp, K. A., and Englander, S. W. (1994). Trends Biochem. Sci. 19, 526 – 529. Sheriff, S., Silverton, E. W., Padlan, E. A., Cohen, G. H., Smith-Gill, S. J., Finzel, B. C., and Davies, D. R. (1987). Proc. Natl. Acad. Sci. USA 84, 8075 – 8079. Spolar, R. S., and Record, T., Jr. (1994). Science 263, 777–784. Sporn, M. B. (1997). Kidney Intl. 51, 1352–1354. Talmage, D. W. (1957). Annu. Rev. Med. 8, 239 –256. Talmage, D. W. (1959). Science 129, 1643–1648. Tedder, T. F., Inaoki, M., and Sato, S. (1997). Immunity 6, 107–118. Tulip, W. R., Varghese, J. N., Webster, R. G., Laver, W. G., and Colman, P. M. (1992). J. Mol. Biol. 227, 149–159. Turner, J. R., Tartakoff, A. M., and Greenspan, N. S. (1990). Proc. Natl. Acad. Sci. USA 87, 5608–5612. Uchida, T., Pappenheimer, A. M., Jr., and Harper, A. A. (1972). Science 175, 901– 903. van Oss, C. J. (1995). Mol. Immunol. 32, 199 –211. Van Regenmortel, M. H. V. (1998). J. Immunol. Meth. 216, 37– 48. Vilenkin, N. Ya. (1968). “Stories about Sets.” Academic Press, New York. Weber, G. (1975). Adv. Prot. Chem. 29, 1– 83. Weiner, Jonathan. (1994). “The Beak of the Finch: A Story of Evolution in Our Time.” Alfred A. Knopf, New York. Whittle, M. J. (1992). Arch. Dis. Childhood 67, 65 – 68. Williams, D. H., and Westwell, M. S. (1998). Chem. Soc. Rev. 27, 57– 63. Wilson, H. A., Greenblatt, D., Taylor, C. W., Putney, J. W., Tsien, R. Y., Finkelman, F. D., and Chused, T. M. (1987). J. Immunol. 138, 1712–1718. Wu, T. T., and Kabat, E. A. (1970). J. Exp. Med. 132, 211–250. Zheng, P., and Liu, Y. (19970. J. Exp. Med. 186, 1787–1791. Zimmerman, S. B, and Minton, A. P. (1993). Annu. Rev. Biophys. Biomol. Struct. 22, 27– 65. Zinkernagel, R. M. (1996). Science 271, 173 –178. Zinkernagel, R. M., and Doherty, P. C. (1974). Nature 248, 701–702.
This Page Intentionally Left Blank
Topoisomerase I-Mediated DNA Damage Philippe Pourquier and Yves Pommier Laboratory of Molecular Pharmacology Division of Basic Sciences National Cancer Institute National Institutes of Health Bethesda, Maryland 20892
I. II. III. IV. V. VI. VII. VIII.
Introduction Structural Domains of Top1 Top1 Functions and Protein Interactions The Top1 Catalytic Cycle and Cleavage Complexes Anticancer Top1 Poisons Suppression and/or Enhancement of Top1 Cleavage Processing of Top1-Mediated DNA Lesions Conclusions References
Topoisomerase I is a ubiquitous and essential enzyme in multicellular organisms. It is involved in multiple DNA transactions including DNA replication, transcription, chromosome condensation and decondensation, and probably DNA recombination. Besides its activity of DNA relaxation necessary to eliminate torsional stresses associated with these processes, topoisomerase I may have other functions related to its interaction with other cellular proteins. Topoisomerase I is the target of the novel anticancer drugs, the camptothecins. Recently a broad range of physiological and environmentally-induced DNA modifications have also been shown to poison topoisomerases. This review summarizes the various factors that enhance or suppress top1 cleavage complexes and discusses the significance of such effects. We also review the different mechanisms that have been proposed for the repair of topoisomerase I-mediated DNA lesions. © 2000 Academic Press.
I. INTRODUCTION Topoisomerases control DNA structure by relaxing DNA supercoils and by resolving intertwined DNA strands as they arise during DNA transactions, particularly cell division (Wang, 1996). This is possible because DNA topoisomerases generate transient DNA strand breaks. There are two types
Advances in CANCER RESEARCH Vol. 80 0065-230X/01 $35.00
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
190
Philippe Pourquier and Yves Pommier
of DNA topoisomerases. Type II topoisomerases (top2 ␣ and top2  in human cells) act as dimers and introduce DNA double-strand breaks (Wang, 1996). In yeast, top2 activity is essential for the separation of condensed chromosomes during mitosis (Gangloff et al., 1999). Knockout studies of the top2  demonstrated an essential role for this enzyme in neuromuscular development in mice because embryos die shortly after birth from a defect in motor axon growth (Yang et al., 2000). There are two subtypes of topoisomerases I, types IA and IB. The only type IA topoisomerase in eukaryotes is topoisomerase III [top3 ␣ and top3  in human, mouse, and Drosophila (Hanai et al., 1996; Ng et al., 1999; Seki et al., 1998)]. Top3 ␣ is essential in early embryogenesis (Li and Wang, 1998). Top3 only removes negative supercoils and forms DNA single-strand breaks by becoming covalently linked to the 5⬘ terminus of the broken DNA (Goulaouic et al., 1999). Top3 ␣ is required for recombination during meiosis in yeast (Gangloff et al., 1999; Li and Wang, 1998). Type IB topoisomerases (topoisomerase I, top1) are ubiquitous and extremely conserved among species from viruses to humans (Gupta et al., 1995). In yeast, top1 is not essential probably because it can be substituted by other topoisomerases (Thrash et al., 1984; Uemura and Yanagida, 1984). Conversely, top1 is essential for multicellular organisms such as Drosophila and mouse because top1-null embryos fail to develop (Lee et al., 1993; Morham et al., 1996). The poxviruses top1 has been studied extensively. Vaccinia top1 differs from eukaryotic top1 by its high DNA sequence selectivity (Palaniyar et al., 1996), its resistance to the top1 inhibitor camptothecin, and its cytosolic localization (Shuman, 1991). Both top2 and top1 are the primary targets of a variety of chemotherapeutic drugs used to treat human cancers. No top3 inhibitor has been reported so far. The cytotoxicity of topoisomerase inhibitors is attributed to the stabilization of the enzyme–DNA covalent cleavage intermediates, which are referred to as cleavage complexes (see Section V). A broad range of physiological and environmentally induced DNA modifications have also been shown to poison topoisomerases. This review summarizes the various factors that enhance or suppress top1 cleavage complexes and discusses the significance of such effects. We will also review the different mechanisms that have been proposed for the repair of top1-mediated DNA lesions.
II. STRUCTURAL DOMAINS OF Top1 Top1 enzymes share a common organization with four domains: the aminoterminal domain, the core domain, the linker region, and the C-terminal domain (Fig. 1) (Champoux, 1998; Gupta et al., 1995). Crystal structures of the vaccinia and human top1 enzymes have been determined (Cheng et al.,
Top 1-Mediated DNA Damage
191
Fig. 1 Domain organization of the human topoisomerase I. The four functional domains are delimitated by horizontal arrows and amino acids residues are numbered from the amino (residue 1) to the carboxy (residue 765) terminus. Csd, core subdomain; NTS, nuclear translocation signals.
1998; Redinbo et al., 1998; Stewart et al., 1998). The C-terminal domain is the most conserved region across species. It contains the catalytic tyrosine (tyrosine 723 for human top1), which is essential for DNA cleavage–religation (Champoux, 1981). The core domain is also relatively conserved and is divided into three subdomains (cds I, II, and III; Fig. 1). It has been proposed to bind preferentially to supercoiled DNA (Champoux, 1998). The linker region is less conserved among eukaryotic enzymes and is dispensable for catalytic activity (Stewart et al., 1996). In the crystal structure of the human top1, the linker domain protrudes from the core of the enzyme and probably controls the rotation of the uncleaved strand during DNA relaxation (Stewart et al., 1998) (see Section IV). The N terminus domain is the most variable region. It is missing in viral enzymes and is dispensable for catalytic activity. The N terminus domain is important for top1 interactions with other proteins (see Section III) and contains nuclear localization signals (Champoux, 1998).
III. Top1 FUNCTIONS AND PROTEIN INTERACTIONS Because of its ability to introduce transient DNA single-strand breaks, top1 plays a pivotal role in removing the torsional stress linked to the accumulation of supercoils generated by helix-tracking proteins such as replication and/or transcription complexes (Champoux, 1990; Wang, 1996). This may explain why top1 has been found to cleave preferentially transcribing genes (Gilmour et al., 1986; Kroeger and Rowe, 1992; Stewart et al., 1990; Zhang et al., 1988).
192
Philippe Pourquier and Yves Pommier
Top1 can also promote illegitimate DNA recombinations because it can religate 5⬘-hydroxyl DNA termini (Christiansen et al., 1993; Christiansen and Westergaard, 1994; Henningfeld and Hecht, 1995; Pommier et al., 1995; Pourquier et al., 1997a; Shuman, 1992; Svejstrup et al., 1991). Therefore, top1 can then act as a DNA strand transferase (Fig. 2B). Even though there is no direct evidence for illegitimate DNA recombination catalyzed by top1 in vivo, integration sites for SV40 and hepadnavirus coincide with top1 cleavage sites (Bullock et al., 1985; Hino et al., 1989; Pourquier et al., 1999a; Wang and Rogler, 1991). In vitro, human top1 can linearize the open circular DNA of duck hepadnavirus forming an intermediate that could be integrated into the host genome (Pourquier et al., 1999a). Top1 from the vaccinia virus is also capable of causing lambda prophage excision by recombination and was shown to be structurally related to site-specific recombinases (Cheng et al., 1998). The DNA recombination activity of vaccinia top1 is used in commercially available kits for cloning reactions (TOPO TA Cloning, Invitrogen, Carlsbad, CA). In addition to its DNA-nicking–closing activity, top1 has other functions, which are at least in part related to the ability of the enzyme to interact with other proteins (Table I).
Table I Reported Protein Interactions for Mammalian Top1 Name TATA-binding protein Topors 23 RNA pol I Nucleolin Hsp70 HMG, histone H1 SFII/ASF (splicing factor) PSF/p54nrb SV40 large T antigen Werner syndrome helicase Caseine kinase PKC Ubiquitin coupling factors hUbC9 (small ubiquitin-like coupling factor) Caspase 3 and 6 PARP p53
Potential outcome of the interaction Increased transcription initiation by stimulating TFIID-TFIIA association Recruitment of RNA polymerases to their transcription sites Unknown Regulation of ribosomal gene transcription Recruitment of top1 (and indirectly RNA pol I) to the nucleolus Top1 chaperone Increased top1 activity in vitro (role in the regulation of transcription?) RNA splicing (role of top1 kinase activity) Increased top1 activity in vitro (role in RNA splicing?) Regulation of top1 cleavage. Gyrase activity? Recombinational repair? Top1 phosphorylation Top1 phosphorylation Top1 degradation by the 26S proteasome SUMO conjugation of top1 Cleavage of top1 during apoptosis? Top1 inactivation? Top1 activation. Potential recruitment of repair factors?
Top 1-Mediated DNA Damage
193
Top1 appears involved in RNA metabolism at the level of transcription. It interacts directly with the TATA-binding protein (TBP) and is probably recruited to the RNA–polymerase II transcription complex by TFIID. This interaction increases transcription initiation (but not the elongation) by stimulating the formation of TFIID–TFIIA complexes in promoter regions (Kretzschmar et al., 1993; Merino et al., 1993; Shykind et al., 1997). Interestingly, the DNA cleavage activity of top1 is not required for this transcriptional activity, as a catalytically inactive top1 mutant (Y723F) is still able to stimulate transcription initiation (Shykind et al., 1997). More recently, a 23-kDa protein of unknown function and a nuclear protein called topors containing a RING-type zinc finger domain and an arginine–serine (RS)-rich domain were identified using a yeast two-hybrid/in vitro-binding screen utilizing the 250 first amino acids of top1 (Haluska et al., 1999). Based on sequence homology with other proteins involved in transcription regulation, it has been proposed that topors might recruit RNA polymerase II to its transcription site via interaction with top1 (Haluska et al., 1999). A similar hypothesis was proposed for RNA polymerase I recruitment either by direct interaction with top1 (Rose et al., 1988) or through nucleolin, which is known to bind the N terminus of top1 and to be colocalized to the nucleolus (Bharti et al., 1996). In the nucleolus, top1 interacts with Hsp70, which may act as a top1 chaperone (Ciavarra et al., 1994). Top1 also binds in a tight complex with HMG proteins and histone H1, which enhance its activity (Javaherian and Liu, 1983). Top1 may also play a role in RNA splicing. Top1 has been found to possess a specific kinase activity and to phosphorylate RNA-splicing factors from the SR protein family such as SF2/ASF (SRp30a) (Rossi et al., 1996). Camptothecin blocks the top1 kinase activity and the phosphorylation of the SR protein in vitro (Rossi et al., 1996). Both the C-terminal and N-terminal (first 174 amino acids) regions of top1 are required for ATP binding and binding of top1 to SF2/ASF, respectively (Labourier et al., 1998). Top1 might also recruit SR kinase cofactors (Haluska et al., 1999). Interaction with another splicing factor, the pyrimidine tract binding protein-associated splicing, factor (PSF), which is involved in the second step of RNA splicing, has also been reported (Straub et al., 1998). The direct association with PSF occurs in complex with the nuclear RNA-binding protein of 54 kDa (p54nrb) of unknown function. This association stimulates top1-relaxing activity in vitro (Straub et al., 1998). The SV40 large T antigen helicase can interact directly with top1 in vitro (Simmons et al., 1996) and regulate top1 activities in different ways. This interaction involves both the amino terminus (amino acids 1–139) and the carboxy terminus (residues 383–765) of top1 (Haluska et al., 1998). Top1 can facilitate DNA unwinding and consequently elongation by T antigen during SV40 replication (Simmons et al., 1998). The top1–T antigen complex has also been proposed to act as a gyrase, ensuring the removal of positive su-
194
Philippe Pourquier and Yves Pommier
percoiling that accumulates ahead of the replication fork (Simmons et al., 1996). Direct interaction between top1 and large T antigen can suppress top1 cleavage complexes and top1-relaxing activity (Pommier et al., 1998a). This inhibition has been proposed to contribute to the maintenance of negative DNA supercoiling in the immediate vicinity of the T antigen-binding site at the replication origin, which might facilitate replication initiation (Pommier et al., 1998a). The Werner syndrome’s helicase was found to copurify with top1 and PCNA (Lebel et al., 1999). Such a topoisomerase–helicase interaction has also been shown between RecQ helicases (sgs-1, Bloom syndrome’s, and Werner syndrome’s helicases) and top3 as well as top2 (Gangloff et al., 1994; Ng et al., 1999; Watt et al., 1995). The association of helicases with topoisomerases is functionally logical, as DNA unwinding by helicases generates negative supercoiling, which would be relieved by topoisomerases. Top1 is a phosphoprotein in vivo and can be phosphorylated in vitro by serine/theronine protein kinases such as casein kinase II, protein kinase C, or protein kinase NII (Cardellini et al., 1994; Cardellini and Durban, 1993; Durban et al., 1985; Kordiyak et al., 1994; Pommier et al., 1990; Samuels et al., 1989). Conversely, phosphorylation by tyrosine kinases has been reported to inhibit top1 catalytic activity (Tse-Dinh et al., 1984). In vivo, top1 copurifies with casein kinase II or casein kinase II-like proteins (Turman and Douvas, 1993) and with protein kinase C (Pommier et al., 1990). Top1 phosphorylation and dephosphorylation are also cell cycle dependent (D’Arpa and Liu, 1995). Thus, phosphorylation may regulate the activity of top1, its association with other proteins in vivo, and its sensitivity to camptothecin (Pommier et al., 1990). Top1 has been reported to be multiubiquitinated in response to camptothecin treatment and to be consequently proteolyzed by the 26S proteasome (Desai et al., 1997; Fu et al., 1999). A correlation with the rates of top1 degradation and CPT sensitivity has been reported among a collection of colon and breast cancer cell lines (Desai et al., 1999), which suggests that ubiquitination and degradation of top1 play a role in CPT sensitivity in tumors. Studies suggest that top1 is also conjugated in vivo to the small ubiquitin-related protein SUMO-1 by the UBC9 enzyme (Mao et al., 1999). Top1 is a substrate for caspase 3 and, to a lesser extent, caspase 6, which cleave the putative DDVD146 and EEED170 sites. The cleavage products comigrate with top1 fragments in apoptotic cells (Samejima et al., 1999). Cleavage by caspases separates the N terminus domain from the catalytic segment of top1 and might inactivate the enzyme by preventing its association with other cellular factors, including nuclear transport systems. Poly(adenosine-diphosphoribosylation) of top1 by poly(ADP-ribose) polymerase (PARP) inactivates top1 in vitro and in nuclear extracts from yeast (Ferro et al., 1984; Kasid et al., 1989; Park et al., 1991). Poly(ADP-ribosy-
Top 1-Mediated DNA Damage
195
lation) of top1 also occurs following X-ray or UV irradiation in cancer cells and is associated with enzyme inactivation without a concomitant reduction of protein levels (Boothman et al., 1994). PARP activation by a broad range of DNA lesions (Chatterjee and Berger, 1998; de Murcia and Menissier de Murcia, 1994) might prevent top1-mediated DNA damage by inactivating top1 (see Section V). PARP-deficient hamster cells are hypersensitive to camptothecin (Chatterjee et al., 1989), which suggests that poly(ADP-ribose) polymerase modification of top1 plays a role in the repair of top1– cleavage complexes and/or may inactivate the enzyme to prevent further top1-mediated illegitimate recombination following DNA damage (Boothman et al., 1994). Top1 can be coimmunoprecipitated with the tumor suppressor p53 protein in vivo and in vitro (Albor et al., 1998; Gobert et al., 1996; Gobert et al., 1999). p53 has been reported to stimulate the DNA-relaxing activity of top1, camptothecin-mediated cleavage complexes, and phosphorylation of the SF2/ASF splicing factor in vitro (Albor et al., 1998; Gobert et al., 1996, 1999). The C terminus region of the p53 protein (amino acids 302–321) has been shown to be important for this interaction (Albor et al., 1998; Gobert et al., 1999). Mutant p53 polypeptides, which are transcriptionally inactive, remain able to stimulate top1, and mutant p53 was shown to be constitutively associated with top1 in HT29 cells. Stimulation of top1 activities (including the recombinase activity of top1) has been invoked as a mechanism for increased genomic instability in p53 mutant cells (Gobert et al., 1999). In normal cells, association of p53 with top1 appears to activate top1 in response to bleomycin (Gobert et al., 1999). Another study reported that wildtype p53 is associated with top1 in untreated B lymphoblastoid cells and that both proteins in this complex are poly ADP-ribosylated after ␥ irradiation (Smith and Grosovsky, 1999). There is, however, no direct experimental evidence to support or argue against a role of top1 in DNA repair. It is possible that in response to DNA damage, top1 would be functionally altered in opposite ways by PARP (inhibition) and p53 (stimulation).
IV. THE Top1 CATALYTIC CYCLE AND CLEAVAGE COMPLEXES DNA relaxation by top1 can be divided in four steps, which are schematized in Fig. 2A. Step 1: Noncovalent DNA binding. The eukaryotic top1 enzyme binds with high preference to double-stranded DNA (Been and Champoux, 1984; Christiansen et al., 1993; Jaxel et al., 1991; Shuman, 1991) and most efficiently to bent or supercoiled DNA (Camilloni et al., 1988; Caserta et al.,
196
Philippe Pourquier and Yves Pommier
1989; Krogh et al., 1991). The binding footprint is approximately 20 bp with the cleavage site centrally located (Stevnsner et al., 1989). The crystal structure of an amino-truncated form of top1 in the noncovalent complex with DNA revealed that top1 contacts both strands of the DNA by adopting a “clamp” configuration (Redinbo et al., 1998). The observed interactions are primarily between the protein and the phosphates and are mostly located 5⬘ from the cleavage site (up to the ⫺5 position) with the exception of few phosphate residues 3⬘ from the cleavage site on the scissile strand (up to ⫹3 position) (Stewart et al., 1998). The ⫺1 and ⫹2 bases are the only bases directly contacted by the enzyme (Stewart et al., 1998). Step 2: Cleavage of one strand of the DNA duplex [Fig. 2A (1)]. A covalent phosphodiester bond is formed by transesterification between the hydroxyl group of the catalytic tyrosine (tyrosine 723 for human top1, see Fig. 1) and the 3⬘-phosphate residue of the DNA at the break site generated by the enzyme (Champoux, 1981; Lynn et al., 1989). These covalent DNA– top1 complexes are referred to as “cleavage complexes” and can be isolated on rapid denaturation of top1 by a strong detergent such as sodium dodecylsulfate (SDS). Cleavage requires a bipartite mode of action, i.e., interaction of top1 with scissile and nonscissile DNA strands (Christiansen et al., 1993). The sites of top1-mediated DNA cleavage are frequent in human genes, which is consistent with DNA relaxation at many sites during transcription and replication. In the absence of drug, the only significant base preference is on the scissile strand for T at the ⫺1 position relative to the cleavage site (Been et al., 1984; Bonven et al., 1985; Jaxel et al., 1991). Step 3: Controlled rotation [Fig. 2A (2)]. This step allows the relaxation of supercoiled DNA by successive changes of the linking number by steps of one. In the case of human top1, a “controlled rotation” mechanism has been proposed based on biochemical evidence and crystal structure data indicating a transient interaction between the negatively charged DNA phosphates of the cleaved strand and the positively charged residues of the linker domain and the nose cone segment of top1 (Stewart et al., 1998). During unwinding, these interactions would slow down the free rotation of the cleaved strand around the intact strand. Step 4: Religation is the reverse of the cleavage reaction [Fig. 2A (3)]. This transesterification reaction is between the 5⬘-hydroxyl residue of the cleaved strand, which serves as the nucleophile, and the top1–DNA 3⬘-tyrosyl phosphodiester bond. In normal conditions, top1-mediated cleavage and religation are in equilibrium and only a few cleavage complexes can be detected because the religation step is favored. Top1 can also religate exogenous DNA strands bearing a 5⬘-hydroxyl. Such nonhomologous religation can occur when top1–DNA complexes are stabilized by top1 inhibitors or by DNA lesions (see Sections V and VI). As illustrated in fig. 2B (1⬘), top1 cleavage of a double-stranded substrate with
Top 1-Mediated DNA Damage
197
Fig. 2 Topoisomerase I catalytic cycle. (A) Top1-mediated relaxation of supercoiled DNA. The different steps are cleavage (1), controlled rotation of the cleaved strand around the intact strand (2), and intramolecular religation (3). CPT: Camptothecin inhibits the religation step. Numbers (⫺3 to ⫹3) correspond to the numbering convention for bases flanking the cleavage site (base at position ⫺1 is covalently linked to top1). (B) Top1-mediated intermolecular religation. (1⬘) Top1-mediated irreversible cleavage complex (“suicide”) due to the presence of a nick at the ⫹1 position opposite the cleavage site; (2⬘) dissociation of the cleaved DNA from the top1 covalent complex; and (3⬘) intermolecular religation of a nonhomologous double-stranded DNA (dashed lines) can lead to recombination.
198
Philippe Pourquier and Yves Pommier
a nick on the nonscissile strand across from the cleavage site generates a DNA double-strand break with the 3⬘ end covalently linked to top1. Such aborted top1–DNA complexes are also referred to as irreversible covalent complexes or “suicide complexes” and can promote illegitimate (nonhomologous) recombination in vitro and probably in vivo (Christiansen and Westergaard, 1994; Henningfeld and Hecht, 1995; Pourquier et al., 1997a; Shuman, 1992). Suicide complexes can religate a nonhomologous doublestranded DNA [shown in dashed line in Fig. 2B (3⬘)], resulting in an illegitimate recombination (Pourquier et al., 1997a). As mentioned in Section VI, many substrates have been used in vitro to generate such recombinogenic intermediates (Christiansen et al., 1993; Christiansen and Westergaard, 1994; Henningfeld and Hecht, 1995; Pommier et al., 1995; Pourquier et al., 1997a; Shuman, 1992; Svejstrup et al., 1991).
V. ANTICANCER Top1 POISONS Top1 inhibitors have been reviewed in detail (Pommier, 1999; Pommier et al., 1998b). Table II summarizes the drugs that act as top1 poisons. Two camptothecin derivatives (topotecan and irinotecan) have been approved by the FDA. Topotecan (Hycamtin, SmithKline Beecham) is used for the treatment of cisplatin-refractory ovarian carcinoma and for second-line therapy in small cell lung cancer (SCLC). Irinotecan (CPT-11, Camptosar, Pharmacia) has been approved in the United States for the treatment of colorectal cancer. Current clinical trials indicate that camptothecin derivatives will be useful in a wide variety of human malignancies. Other camptothecin derivatives are in phase I/II clinical trials: exatecan mesylate (DX-8951f ), 9aminocamptothecin, and rubitecan (9-nitrocamptothecin). Because of the demonstrated anticancer activity of camptothecins and because of the limitations of camptothecins (rapid reversibility of the cleavage complexes on drug removal, instability of the active lactone form of camptothecins at physTable II Examples of Top1 Inhibitors Clinically relevant camptothecin derivatives Topotecan (Hycamtin) Irinotecan (CPT-11, Camptosar) Exatecan mesylate (DX-8951f) 9-Aminocamptothecin Rubitecan (9-nitrocamptothecin) Homocamptothecin
Noncamptothecin derivatives Indolocarbazoles (NB-506, rebeccamycin) Intoplicine Ecteinascidin 743 Hoechst 33342 Nitidine, fagaronine Indenoisoquinolines
199
Top 1-Mediated DNA Damage
Table III Mechanistic Classification of DNA Lesions Leading to Accumulation of Top1 Cleavage Complexes
Inhibition of DNA religation Strand break Scissile strand Nonscissile strand Single mismatch Contiguous mismatches Mispaired loop Abasic site Base adducts O6-methylguanine Ethenoadenine BaP-DE dA (intercalation) Intercalation/base stacking Camptothecins Top1 poisons Ara-C Ultraviolets photoproducts Enhancement of cleavage 8-Oxoguanine BaP-DE dG (minor groove alkylator) O6-methylguanine Cytosine methylation
Position
Reversibility
Between ⫹1 and ⫹6 Between ⫺1 and ⫹10 ⫹1 or ⫺5 or ⫺6 ⫹1 to ⫹3 or ⫹1 to ⫹6 See Fig. 4C ⫹1 or ⫹2 ⫹3
Irreversible ⫽ ICC a Irreversible ⫽ ICC Reversible Irreversible ⫽ ICC Irreversible ⫽ ICC Irreversible ⫽ ICC Reversible
⫹1 ⫹1 ⫹1 ⫺1/⫹1 or ⫹1/⫹2
Reversible Reversible Irreversible ⫽ ICC
⫹1 Undefined
Reversible Reversible Reversible Reversible
⫹1 or ⫹2 or ⫺1 ⬎2 bp away ⫹1 ⫺4
Reversible Reversible Reversible Reversible
aIrreversible covalent complex, also referred to as suicide complex.
iological pH), noncamptothecin inhibitors are being developed. These noncamptothecin derivatives generally bind to DNA by intercalation or/and by minor groove interactions (Pommier, 1996). Therefore, it is likely that they might target other nuclear proteins in addition to top1. Indolocarbazoles, intoplicine (DNA intercalators), and ecteinascidin 743 (minor groove alkylator) are in clinical trial. Top1 inhibitors reversibly stabilize the enzyme cleavage complexes by inhibiting their religation (see Fig. 2A and Table III). Although the drug-binding sites have not been structurally determined, evidence to date suggests that the drugs bind at the interface of the enzyme and the DNA break by stacking with the DNA base(s) immediately flanking the cleavage site (see Fig. 3) (Pommier et al., 1998b). Therefore, top1 inhibitors represent a prime example of drugs that inactivate bimacromolecular complexes (top1–DNA complexes) by forming ternary complexes in which the drugs alter the enzyme–DNA interactions and prevent their dissociation.
200
Philippe Pourquier and Yves Pommier
Fig. 3 Position-specific effects of single DNA lesions on topoisomerase I activity. (A) Lesions that lead to an accumulation of top1 cleavage complexes. (B) Lesions that suppress top1-mediated DNA cleavage.
Because top1 cleavage complexes are reversible on drug removal and because their toxicity can be prevented by replication inhibition (D’Arpa et al., 1990; Holm et al., 1989; Hsiang et al., 1989; Kaufmann et al., 1991), it is
Top 1-Mediated DNA Damage
201
generally accepted that the drug-induced cleavage complexes are only potentially lethal. They are converted into lethal lesion after collision with replication forks or other DNA-tracking factors (see Fig. 5).
VI. SUPPRESSION AND/OR ENHANCEMENT OF Top1 CLEAVAGE COMPLEXES BY DNA DAMAGE Genomic DNA is constantly submitted to accidental damage from various endogenous and environmental sources, and cells have developed sophisticated repair systems that can recognize and remove specific lesions and maintain genomic integrity (Lindahl and Wood, 1999). Because topoisomerases are frequently introducing transient breaks into genomic DNA, the effects of a broad range of DNA damages on topoisomerase activity have been examined. Alterations of top2 activity by DNA strand interruptions, mismatches, abasic sites, and sugar modifications have been reviewed (Cline and Osheroff, 1999; Kingma and Osheroff, 1998) and will not be discussed here. Figure 3 and Table III summarize the relationship between the nature and the localization of various DNA lesions and their effects on top1 cleavage complexes. Strikingly, and regardless of their nature, these DNA modifications can have opposite effects depending on their localization relative to the top1 cleavage site (indicated between positions ⫺1 and ⫹1 in Fig. 3). In general, single lesions immediately downstream (at positions ⫹1, ⫹2, or ⫹3) from the cleavage site lead to an accumulation of top1 cleavage complexes (Fig. 3A). In contrast, lesions immediately upstream from the cleavage site (positions ⫺1, ⫺2, ⫺3, and to a lesser extent abasic sites at positions ⫺4, ⫺5, or ⫺6) have a suppressive effect on top1-mediated cleavage (Fig. 3B). This position-dependent repartition may directly reflect the molecular interactions of the enzyme with its DNA substrate as exemplified by the recent crystal structure of top1 complexed with DNA (Redinbo et al., 1998; Stewart et al., 1998). DNA strand breaks can be produced by ionizing radiations but also by base elimination as a result of base alkylation or repair by endonuclease action. Single base gaps can result from the processing of abasic sites, base damage, or uracil misincorporation by the base excision repair system (Friedberg et al., 1995; Lindahl and Wood, 1999). After recognition by a specific DNA glycosylase, misincorporated or modified bases are processed into abasic sites, which upon conversion by AP endonucleases or AP lyases lead to nicks and further base elimination (Friedberg et al., 1995; Lindahl and Wood, 1999). Polymerase and ligase activities then fill the gap. The presence of single nicks or single base gaps immediately downstream from the top1 site (between bases ⫺1/⫹1, and ⫹1/⫹2) induce irreversible
202
Philippe Pourquier and Yves Pommier
Fig. 4 Schematic representation of three possible mechanisms by which DNA single-strand breaks and mismatches can lead to the formation of irreversible top1 covalent complexes (suicide complexes). (A) If the single-strand break is in the nonscissile strand within 4 – 6 bp from the top1 cleavage site, the DNA segment generated by top1 cleavage 3⬘ from (to the right of ) the top1 cleavage site can dissociate and lead to top1 covalent complex and a DNA doublestrand break. In this way, top1 can convert single-strand breaks to double-strand breaks. (B) If the break is on the upper strand within four to six bases 3⬘ from the top1 cleavage site, the top1 cleavage complex generates a short single strand that can dissociate from the nonscissile (lower) strand. Finally, the presence of a mispaired loop (bulge) immediately downstream of the top1 cleavage site on the nonscissile strand generates a base gap by stretching out of the DNA after top1 cleavage (C).
Fig. 5 Potential mechanisms for the repair of top1-mediated DNA damage. Cleavage complexes are generally reversible (top). Replication fork collisions generate both replication-mediated double-strand breaks (right) that might be repaired by homologous recombination and/ or nonhomologous end joining, and top1 covalent complexes (suicide complexes). Covalent complexes can also be formed by top1 on damaged DNA (see Table III and Fig. 4). Several pathways can repair top1 covalent complexes (bottom half of the figure). To date, the best characterized pathways are by TDP action and ubiquitination. Dashed arrows indicate hypothetical pathways for resolving top1 covalent complexes.
204
Philippe Pourquier and Yves Pommier
top1 cleavage (Fig. 3A) (Christiansen et al., 1993; Christiansen and Westergaard, 1999; Pourquier et al., 1997a; Shuman, 1992). Irreversible top1 cleavage complexes can also be detected in the presence of CPT when a single nick is present between bases ⫹2 and ⫹6 of the nonscissile strand (Pourquier et al., 1997a). It is possible that camptothecin alters the DNA structure and facilitates the dissociation of the DNA immediately downstream from the top1 cleavage site (Fig. 4A). By cleaving the DNA strand opposite to the nick, top1 leads to the production of an irreversible doublestrand break with top1 remaining covalently attached to the 3⬘ end of the cleaved strand (Figs. 2B and 4A). This may explain the synergism between ionizing radiation and camptothecin derivatives (Chen et al., 1997; Mattern et al., 1991; Roffler et al., 1994). Using homopolymeric substrates, it has been demonstrated that nicks could recruit top1 and induce irreversible cleavage complexes in the absence of drug. These nicks are located as far as 6 (scissile strand) and 10 (nonscissile strand) bases downstream from the top1 site (Christiansen and Westergaard, 1999) (Fig. 3A and Figs. 4A and 4B). The irreversible top1 covalent complexes can be repaired by the top1 excision repair systems (see Section VII and Fig. 5). They can also promote illegitimate recombinations (see Fig. 2B). Recombinations are most efficient when at least 2 bases, at the 5⬘ end of the incoming DNA that becomes religated by top1, are complementary to the bases present downstream (to the right in Fig. 4A), from the top1 cleavage site on the nonscissile strand (Christiansen and Westergaard, 1999). Presence of a single nick on the DNA strand opposite to the cleavage site between bases ⫺5/⫺4 or ⫺4/⫺3 suppresses top1-mediated DNA cleavage (Pourquier et al., 1997a) (Fig. 3B). This suppression is probably due to DNA structure alterations by the mismatch and loss of optimum enzyme–DNA contacts. Base mismatches are frequent and have been estimated to approximately 100–500 per human cell per day (Lindahl, 1993). They can arise spontaneously after polymerase errors during DNA synthesis (Friedberg et al., 1995) and by cytosine deamination, leading to U:G mismatches. Treatments with thymidilate synthetase inhibitors also lead to uracil misincorporation as a result of depletion of the thymidylate pools and increase of the dUTP pool. Mismatches are repaired specifically by the mismatch repair (MMR) system in eukaryotic cells (Kolodner and Marsischky, 1999; Lindahl and Wood, 1999). Using nuclear extracts, we found that top1 acted efficiently on DNA oligonucleotides, which suggests that it is possible that top1 could bind to mismatched DNA in vivo (Yeh et al., 1994). Top1 cleavage complexes tend to accumulate in the presence of mismatches either immediately downstream from the top1 cleavage site (position ⫹1) or a few bases upstream from it (positions ⫺5 or ⫺6) (Fig. 3A and Table III). These cleavage complexes are due to an inhibition of the religation step (trapping) of the cleav-
Top 1-Mediated DNA Damage
205
age complexes, which nevertheless remain salt reversible (Pourquier et al., 1997b; Yeh et al., 1994) (Table III). The extent of top1 trapping depends on the degree of mispairing and is usually more pronounced in the case of mismatches where hydrogen bonding and DNA torsion angles are deeply altered (Pourquier et al., 1997b; Yeh et al., 1994). Mismatches can lead to irreversible top1 cleavage complexes when there are three or more contiguous mispaired bases downstream from the top1 cleavage site (Christiansen and Westergaard, 1999). The molecular interpretation of this phenomenon is that religation of the cleavage complex requires the alignment of the 5⬘hydroxyl DNA end with the scissile phosphotyrosine bond for an SN2-type reaction. Conversely, the presence of a single base mismatch upstream from a preexisting top1 site (positions ⫺3 or ⫺4 on the uncleaved strand) suppresses top1-mediated DNA cleavage (Fig. 3B) (Pourquier et al., 1997b). This suppression is consistent with the suppressive effect observed for single nicks in the same locations and confirms the importance of the DNA structure in that region for optimum DNA–top1 interactions. Short mispaired loops can be formed in DNA as a result of polymerase slippage (Kunkel, 1993). These lesions are substrates for the mismatch repair pathway (Friedberg et al., 1995; Jiricny, 2000). We found that the presence of a bulge immediately downstream from a top1 site induces irreversible cleavage complexes (Pourquier et al., 1997b). After DNA cleavage, the relaxation of the DNA structure probably renders the 5⬘-hydroxyl out of reach for religation, resulting in a gap (Fig. 4C). Although such lesions were not reversible in our experiments, religation has been observed in vitro for long gapped substrates forming hairpin structures that would eventually bring the 5⬘-hydroxyl in proximity to the top1–DNA phosphotyrosyl bond (Henningfeld and Hecht, 1995). Abasic sites constitute the most common endogenous lesions found in DNA, with an estimated 10,000 lesions per human cell per day (Lindahl, 1993). They arise spontaneously by hydrolysis of the glycosidic bond primarily to purine bases. They are also produced during the course of excision repair of base damage from cell metabolism, such as oxidation or alkylation, or during excision of exogenous damage introduced by ionizing radiations, environmental carcinogens, or drugs (DNA-alkylating agents) used in cancer chemotherapy (Friedberg et al., 1995; Lindahl and Wood, 1999). Uracil DNA glycosylases also process uracils into abasic sites (Friedberg et al., 1995). Globally, the suppressive and trapping effects of single abasic sites mirror those obtained with uracil misincorporations (Fig. 3). Mapping at the nucleotide level showed that suppression of top1 cleavage by single abasic sites on the scissile strand extends up to 11 bases upstream from the cleavage site (Stevnsner et al., 1989). In contrast, abasic sites at the ⫹1 or ⫹2 positioins relative to the top1 cleavage site result in irreversible top1 trapping (Pourquier et al., 1997b) (Fig. 3A and Table III). At the molecular level, these
206
Philippe Pourquier and Yves Pommier
observations are consistent with those obtained with base mismatches. Base pairing and base stacking appear necessary for optimum alignment of the hydroxyl group of the 5⬘ base (base ⫹1) to attack the 3⬘-tyrosyl phosphodiester bond during the religation step of the top1 reaction. Oxidized bases represent a very common type of endogenous lesions (Dizdaroglu, 1992). They result from the attack of oxygen radicals that are generated by various forms of oxidative stresses, such as lipid peroxidation, inflammation, cellular respiration, and near-ultraviolet light (Lindahl, 1993; Friedberg et al., 1995). 7,8-Dihydro-8-oxoguanine (8-oxoG) is the most representative form of oxidized bases. Steady-state levels of 8-oxoG have been estimated to vary between ⬍100 and 60,000 residues per normal mammalian cell (Helbock et al., 1998; Klungland et al., 1999). 8-oxoG is highly mutagenic because replicating DNA polymerases incorporate A opposite 8oxoG (Shibutani et al., 1991), leading to G-T transversion (Wood et al., 1990). Pyrimidines also undergo oxidation in vivo and can generate potentially mutagenic derivatives, such as 5-hydroxycytosine (5-ohC) (Feig et al., 1994; Purmal et al., 1994). Oxidized bases are removed by specific glycosylases [formamidopyrimidine DNA glycosylase (Fpg) or the oxoguanine DNA glycosylase] from the base excision repair pathway or by nucleases from the nucleotide excision repair pathway (Croteau and Bohr, 1997). 8-oxoG and 5-ohC can induce reversible top1 cleavage complexes when they are incorporated at the ⫺1, ⫹1, or ⫹2 positions relative to a top1 site (Fig. 3A, Table III). In contrast to camptothecins or to base mismatches or abasic sites (described earlier), 8-oxoG induces the accumulation of top1 cleavage complexes by enhancing the noncovalent binding of the enzyme to the 8-oxoGcontaining DNA, while having no detectable effect on top1-mediated DNA religation (Pourquier et al., 1999b). The lack of effect of 8-oxoG on top1mediated DNA religation is consistent with the fact that the 8-oxo group does not alter base pairing significantly and mainly results in the addition of a hydrogen bond acceptor in the DNA major groove. Molecular modeling shows that asparagine 722, which is next to the catalytic tyrosine (723; see Fig. 1), could form a hydrogen bond, with the 8-oxo group pointing in the major groove of the DNA. Consistently, mutation of the residue to histidine markedly enhances top1 cleavage complexes (Pourquier et al., 1999b). Base alkylation is most commonly produced by electrophilic attack on positions N7 or O6 of guanine by DNA-alkylating agents used as anticancer agents or by carcinogenic compounds such as methylmethanesulfonate (MMS), methylnitronitrosoguanidine (MNNG), or methylnitrosourea (MNU) (Friedberg et al., 1995). The methyl group on position O6 can be selectively removed from guanines by being transferred to cysteine residues of a specific repair enzyme, the O6-methylguanine transferase (Pieper, 1998). A study using chemical alkylation of guanines reported that N7 alkylation had a suppressive effect on top1 cleavage (Stevnsner et al., 1989). However, this
Top 1-Mediated DNA Damage
207
effect is difficult to interpret at the molecular level because of the possible alkylation of multiple purines in the vicinity of the top1 site. Using purified oligonucleotides we found that the presence of O6-methylguanine at position ⫹1 of the scissile strand increases top1 cleavage complexes by inhibiting top1-mediated religation and by enhancing top1-mediated cleavage (data unpublished) (Fig. 3 and Table III). Base alkylation can also produce bulky adducts such as 1,N6-ethenoadenine (⑀A). ⑀A adducts can derive from adenine by cyclization with twocarbon reactive species such as the vinyl chloride metabolite, chloroacetaldehyde (Guengerich, 1992). They have also been detected in normal hepatocytes, suggesting their endogenous formation through reaction with lipid peroxidation metabolites (el Ghissassi et al., 1995). ⑀A is a substrate of the 3-methyladenine DNA glycosylase and is repaired by the base excision repair pathway. Incorporation of an ⑀A at the ⫹1 position increases top1 cleavage complexes by inhibiting the religation step of the top1 reaction (Table III), which is consistent with the importance of base pairing and DNA structure immediately downstream from the top1 cleavage site (Pourquier et al., 1998). When DNA is exposed to UV, particularly UVB (290- to 320-nm wavelength), adjacent pyrimidines become covalently linked by cycloaddition. These reactions generate two four-membered ring photoproducts: cyclobutane pyrimidine dimers and pyrimidine (6,4)pyrimidone (6,4 photoproducts) (Friedberg et al., 1995). A dose of 0.3 J/m2 of UV light generates approximately 10,000 cyclobutane pyrimidine dimers per mammalian genome (Lindahl and Wood, 1999). UV lesions are recognized and removed by the nucleotide excision repair pathway. They can also be bypassed by specific DNA polymerases such as polymerase , which incorporate incorrect nucleotides inducing predominantly G:C to A:T transitions (Friedberg et al., 1995; Lindahl and Wood, 1999). A pyrimidine dimer DNA glycosylase can also process UV photoproducts into abasic sites (Friedberg et al., 1995). The effects of UV photoproducts on top1 activity have only been studied in long DNA fragments after global UV irradiation but not in oligonucleotides with defined lesions. Such studies demonstrated a reversible accumulation of top1 cleavage complexes when UV dimers were present in the close vicinity of the top1 cleavage site, suggesting transmission of the distortion caused by UV dimers into the neighboring sequence (Lanza et al., 1996; Subramanian et al., 1998). One study also reported accumulation of top1 cleavage complexes following UV irradiation in human cancer cells (Subramanian et al., 1998) using a cesium chloride gradient-based technique to isolate top1– DNA complexes from treated cells. This technique is commonly referred to as the ICE assay (immuno complex of enzyme assay). Benzo[a]pyrene (BaP) is a prominent environmental carcinogenic polycyclic hydrocarbon found in car exhausts, tobacco smoke, dyes, and cooked
208
Philippe Pourquier and Yves Pommier
meat. Metabolic epoxidation produces a pair of diastereoisomers in which the benzylic hydroxyl group is either cis (DE1) or trans (DE2) to the epoxide oxygen. Only the DE2 (⫹) adduct is highly carcinogenic and alkylates the exocyclic N2 group of guanine (for review, see Dipple et al., 1999). The resulting adducts lie in the DNA minor groove and can induce top1 cleavage four to six nucleotides away from the adducted base on both DNA strands (Fig. 3A). These minor groove adducts can also suppress top1 cleavage when the adducted base is at the ⫹1 position relative to the top1 cleavage site (Pommier et al., 2000b) (Fig. 3B). Top1–DNA adducts can be detected in mammalian cells treated with the carcinogenic (⫹)-BaP DE, which suggests that top1 cleavage complexes might be associated with the carcinogenic DNA lesions induced by the BaP DE adducts (Pommier et al., 2000b). The BaP DE adduct can also form at adenine N6. In this case, the polycyclic aromatic portion is intercalated in the DNA (for review, see Dipple et al., 1999). We found that these intercalated adducts can trap top1 cleavage complexes irreversibly (see Table III) when the BaP is intercalated between base pairs ⫺1 and ⫹1 or ⫹1 and ⫹2 (Fig. 3A) (Pommier et al., 2000a). This observation is consistent with the drug-stacking model proposed for topoisomerase inhibitors (for review, see Pommier et al., 1998b) and provides a molecular mechanism for the trapping of top1 cleavage complexes by DNA intercalators (see Section V). Our current hypothesis is that upon DNA cleavage by top1, the ⫹1 base on the scissile strand can rotate out of the DNA helix, thereby providing a binding (stacking) site for the intercalator or camptothecin. Hence the drug and the ⫹1 base would compete for the same site. In the case of the intercalated BaP adduct, this reaction would be irreversible (Table III). These observations underline the progress made in our understanding of the molecular contacts between topoisomerases and their DNA substrates and the potential of such structures to elucidate the molecular interactions of various ligands, including carcinogenic adducts, as well as antibacterial and anticancer drugs. 1--d-Arabinofuranosylcytosine (ara-C) is a nucleoside analog used in cancer chemotherapy for the treatment of acute leukemias and other hematopoietic malignancies (Grant, 1998). It differs from cytosine by the presence of an hydroxyl in position 2⬘ of the sugar residue. At relatively low concentrations, ara-CTP is a competitor of polymerases ␣ and  and does not halt replication completely. It is incorporated into the DNA and introduces subtle changes in the backbone torsion angles and base stacking. We have found that ara-C incorporation at the ⫹1 position of a preexisting top1 cleavage site inhibits religation and increases top1 cleavage complexes (camptothecin mimetic effect) (Fig. 3A and Table III). In ara-C-treated cells, we were able to detect an enhancement of the top1 cleavage complexes that was inhibited by aphidicolin, demonstrating that incorporation of ara-C in genomic DNA is essential for top1 trapping. Moreover, top1-deficient cells, which are
Top 1-Mediated DNA Damage
209
highly resistant to CPT, were also cross-resistant to ara-C, suggesting a new mechanism for ara-C cytotoxicity via top1 trapping (Pourquier et al., 2000). Cytosine DNA methylation in CpG islands is a vital and precisely regulated phenomenon in mammalian cells. It controls gene expression and is associated with modifications of chromatin structure (Bird and Wolffe, 1999). Top1 cleavage has been shown to be affected by cytosine methylation (Leteurtre et al., 1994) (Fig. 3 and Table III). Thus as described earlier, a broad range of DNA alterations can alter top1 catalytic activity. Depending on the position of the lesions, cleavage complexes are either enhanced or inhibited. What is the significance of such findings? Two hypotheses can be envisaged. First, top1 might trigger cell death by being trapped at damaged sites when the cells cannot cope with severe DNA lesions. The second hypothesis is that top1 may tag the DNA lesions to be repaired. So far, however, there is no evidence for a direct involvement of top1 involvement in DNA repair.
VII. PROCESSING OF Top1-MEDIATED DNA LESIONS Top1-mediated DNA damage represents unique types of DNA lesions (Fig. 5). In the case of reversible cleavage complexes (see Table III), it is generally accepted that DNA lesions are most commonly formed after collision of an advancing fork of replication (or transcription) with a stabilized top1–DNA complex (Fig. 5, top) (for review, see Pommier et al., 1998b). DNA damage resulting from such collisons can be decomposed in three components (Fig. 5). First, the irreversible covalent complex with top1 covalently linked to the 3⬘-DNA terminus of the break. Second, DNA double-strand breaks consisting of the 5⬘ end of the cleaved strand annealed to the newly synthesized strand. Third, the single-stranded region corresponded to the partially replicating lagging DNA strand. The replication-mediated DNA double-strand breaks (DSB) can cause cell cycle arrest and cell death. The DSB repair pathways may recognize these lesions. In yeast, S. cerevisiae, the major pathway uses homologous recombination between the broken strands and a homologous chromosome or a sister chromatid. It involves the Rad51/52/54/55/57 system. Yeast cells deficient in Rad52 are hypersensitive to camptothecin (Eng et al., 1988; Nitiss and Wang, 1988). In mammalian cells, the error-prone recombinational repair of DSB involves nonhomologous end joining, which involves specialized protein complexes: DNA end-binding proteins, Ku and DNA-dependent protein kinase (DNA-PK), the Rad50/Mre11/NBS1 complex, and the ligase IV/Xrcc4 complex (Critchlow and Jackson, 1998; Jeggo, 1998; Paull and Gellert, 1999). A role for DNA-PK in the cellular response to camptothecin
210
Philippe Pourquier and Yves Pommier
has been invoked because DNA-PK is activated by replication-mediated DNA damage in camptothecin-treated cells and because human glioblastoma MO-59J cells deficient in the DNA-PK catalytic subunit are hypersensitive to CPT (Shao et al., 1999). A role for the Rad50/Mre11/NBS1 complex seems plausible because cells deficient in the Nijmegen breakage syndrome gene (NBS1) are approximately threefold hypersensitive to CPT (Kraakman-van der Zwet et al., 1999). Cells derived from patients with ataxia telangiectasia (AT), which are deficient in the ATM kinase (related to DNA-PK), are also hypersensitive to CPT (Johnson et al., 1999; Smith et al., 1989), which suggests that ATM plays a role in the transduction of signals in response to top1-mediated DNA damage. The signals are not yet clearly defined. They might involve replication complexes, which might be ordered to arrest to prevent replication damage in the presence of top1 cleavage complexes. A final observation concerning top1-mediated DNA double-strand breaks is that the 5⬘ ends of replication-mediated DNA double-strand breaks are phosphorylated rapidly in cells treated with camptothecin, which suggests that a cellular polynucleotide kinase is activated in response to top1 poisoning (Strumberg et al., 2000). The bottom part of Fig. 5 summarizes the possible pathways for the repair of top1 covalent complexes. We refer to this repair as “top1 excision repair.” Although different mechanisms might be involved possibly in combination, the discovery of a specific 3⬘-tyrosylphophodiesterase (TDP) activity capable of cleaving the phosphotyrosyl bond between the enzyme and the DNA is a major step in elucidating specific repair mechanisms for the removal of top1 covalent complexes (Yang et al., 1996). The corresponding gene named TDP1 is conserved among eukaryotes, from yeast to humans (Pouliot et al., 1999). However, removal of top1 by TDP1 might not be the only repair pathway. TDP1 inactivation in yeast does not confer CPT resistance unless the cells also have a Rad9 checkpoint alteration (Pouliot et al., 1999). Furthermore, purified TDP1 does not have the 3⬘-phosphatase activity that would be required to produce a 3⬘-hydroxyl DNA end that could be extended by repair polymerases, and the TDP enzyme is not efficient at removing top1 covalent complexes unless top1 is proteolyzed extensively (Yang et al., 1996). As mentioned in Section III, ubiquitination and consequent proteolysis by the 26S proteasome happen quickly after camptothecin treatment. Therefore, it is possible that the degradation of top1 is directly involved in the repair of top1 cleavage complexes after ubiquitination of the enzyme. One can also speculate that partial degradation might facilitate the action of TDP1 for cleavage of the tyrosylphosphodiester bond. Top1 covalent complexes might also potentially be repaired by nucleotide excision repair (NER) (Sastry and Ross, 1998). According to this hypothesis, the top1–DNA adduct would be removed by endonuclease cleavage to the 5⬘ side of the top1 covalent complex. A few genetic observations support
Top 1-Mediated DNA Damage
211
such a possibility. MCF7/C4 cells selected for their resistant to CPT were found to have an enhanced nucleotide excision repair activity (Fujimori et al., 1996). Also, Cockayne syndrome (CS) cells deficient in either of the two transcription-coupled repair (TC-NER) factors, CSA or CSB, are hypersensitive to CPT (Squires et al., 1993). However, some Xeroderma pigmentosum cell lines deficient for other NER factors (XP factors) are not hypersensitive to CPT (Squires et al., 1993). Such a difference could be directly attributed to the nonisogenic systems used in these studies or could simply reflect the complexity of the NER pathways. Figure 5 also shows at the bottom left a third potential pathway to reverse the top1 covalent complexes by nonhomologous recombination. Because top1 has been shown to possess strand transferase activity in vitro, attack of the tyrosylphosphodiester bond by a 5⬘-hydroxyl group of a single-strand DNA could free top1 from its trapped site. However, this would generate DNA mutations.
VIII. CONCLUSIONS In addition to its important activity as a DNA-relaxing enzyme, topoisomerase I has potential deleterious effects by inducing DNA damage when it processes DNA with various types of endogenous or environmental alterations. The frequency and consequences of top1 alterations in response to DNA damage are not yet known. However, the possibility of trapping top1 irreversibly with altered DNA substrates should facilitate the analyses of the biochemical pathways involved in the repair/processing of the top1 covalent (suicide) complexes. Top1 has become a major target for the development of anticancer agents since the introduction of camptothecin derivatives in the clinic, and it is likely that novel noncamptothecin inhibitors will soon be introduced in clinical trials. Understanding the cellular responses and repair mechanisms for top1–DNA covalent cleavage complexes and replicationmediated DNA damage should provide opportunities to identify cellular markers for drug activity and new targets for drugs, which, in association with the existing top1 inhibitors, should improve the effectiveness of anticancer regiments.
REFERENCES Albor, A., Kaku, S., and Kulesz-Martin, M. (1998). Cancer Res. 58, 2091–2094. Been, M. D., Burgess, R. R., and Champoux, J. J. (1984). Nucleic Acids Res. 12, 3097– 3114.
212
Philippe Pourquier and Yves Pommier
Been, M. D., and Champoux, J. J. (1984). J. Mol. Biol. 180, 515 – 531. Bharti, A. K., Olson, M. O., Kufe, D. W., and Rubin, E. H. (1996). J. Biol. Chem. 271, 1993 – 1997. Bird, A. P., and Wolffe, A. P. (1999). Cell 99, 451– 454. Bonven, B. J., Gocke, E., and Westergaard, O. (1985). Cell 41, 541– 551. Boothman, D. A., Fukunaga, N., and Wang, M. (1994). Cancer Res. 54, 4618 – 4626. Bullock, P., Champoux, J. J., and Botchan, M. (1985). Science 230, 954 – 958. Camilloni, G., Di Martino, E., Caserta, M., and di Mauro, E. (1988). Nucleic Acids Res. 16, 7071–7085. Cardellini, E., Bramucci, M., Gianfranceschi, G. L., and Durban, E. (1994). Biol. Chem. Hoppe Seyler 375, 255–259. Cardellini, E., and Durban, E. (1993). Biochem. J. 291, 303 – 307. Caserta, M., Amadei, A., Di Mauro, E., and Camilloni, G. (1989). Nucleic Acids Res. 17, 8463 – 8474. Champoux, J. J. (1981). J. Biol. Chem. 256, 4805 – 4809. Champoux, J. J. (1990). In “Mechanistic Aspects of Type-I Topoisomerases” ( J. C. Wang and N. R. Cozarelli, eds.), pp. 217–242. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Champoux, J. J. (1998). Prog. Nucleic Acid Res. Mol. Biol. 60, 111–132. Chatterjee, S., and Berger, N. A. (1998). In “DNA Damage and Repair” (J. A. Nickoloff and M. F. Hoekstra, eds.), Vol. 2, pp. 487– 525. Humana Press, Totowa, NJ. Chatterjee, S., Cheng, M. F., Trivedi, D., Petzold, S. J., and Berger, N. A. (1989). Cancer Commun. 1, 389 –394. Chen, A. Y., Okunieff, P., Pommier, Y., and Mitchell, J. B. (1997). Cancer Res. 57, 1529 –1536. Cheng, C., Kussie, P., Pavletich, N., and Shuman, S. (1998). Cell 92, 841– 850. Christiansen, K., Svejstrup, B. D., Andersen, A. H., and Westergaard, O. (1993). J. Biol. Chem. 268, 9690–9701. Christiansen, K., and Westergaard, O. (1994). J. Biol. Chem. 269, 721–729. Christiansen, K., and Westergaard, O. (1999). Biochim. Biophys. Acta 1489, 249 –262. Ciavarra, R. P., Goldman, C., Wen, K. K., Tedeschi, B., and Castora, F. J. (1994). Proc. Natl. Acad. Sci. USA 91, 1751–1755. Cline, S. D., and Osheroff, N. (1999). J. Biol. Chem. 274, 29740 –29743. Critchlow, S. E., and Jackson, S. P. (1998). Trends Biochem. Sci. 23, 394 – 398. Croteau, D. L., and Bohr, V. A. (1997). J. Biol. Chem. 272, 25409–25412. D’Arpa, P., Beardmore, C., and Liu, L. F. (1990). Cancer Res. 50, 6919 – 6924. D’Arpa, P., and Liu, L. F. (1995). Exp. Cell Res. 217, 125 –131. de Murcia, G., and Menissier de Murcia, J. (1994). Trends Biochem. Sci. 19, 172–176. Desai, S. D., Liu, L. F., Vazquez-Abad, D., and D’Arpa, P. (1997). J. Biol. Chem. 272, 24159 – 24164. Desai, S. D., Wu, J., and Liu, L. F. (1999). Proc. Am. Assoc. Cancer Res. 40, 155. Dipple, A., Khan, Q. A., Page, J. E., Pontén, I., and Szeliga, J. (1999). Int. J. Oncol. 14, 103 – 111. Dizdaroglu, M. (1992). Mutat. Res. 275, 331– 342. Durban, E., Goodenough, M., Mills, J., and Busch, H. (1985). EMBO J. 4, 2921–2926. el Ghissassi, F., Barbin, A., Nair, J., and Bartsch, H. (1995). Chem. Res. Toxicol. 8, 278 –283. Eng, W. K., Faucette, L., Johnson, R. K., and Sternglanz, R. (1988). Mol. Pharmacol. 34, 755 – 760. Feig, D. I., Sowers, L. C., and Loeb, L. A. (1994). Proc. Natl. Acad. Sci. USA 91, 6609 – 6613. Ferro, A. M., McElwain, M. C., and Olivera, B. M. (1984). Cold Spring Harb. Symp. Quant. Biol. 49, 683 –690.
Top 1-Mediated DNA Damage
213
Friedberg, E. C., Walker, G. C., and Siede, W. (1995). “DNA Repair and Mutagenesis.” ASM Press, Washington, DC. Fu, Q., Kim, S. W., Chen, H. X., Grill, S., and Cheng, Y. C. (1999). Mol. Pharmacol. 55, 677– 683. Fujimori, A., Gupta, M., Hoki, Y., and Pommier, Y. (1996). Mol. Pharmacol. 50, 1472–1478. Gangloff, S., de Massy, B., Arthur, L., Rothstein, R., and Fabre, F. (1999). EMBO J. 18, 1701– 1711. Gangloff, S., McDonald, J. P., Bendixen, C., Arthur, L., and Rothstein, R. (1994). Mol. Cell Biol. 14, 8391–8393. Gilmour, D. S., Pflugfelder, G., Wang, J. C., and Lis, J. T. (1986). Cell 44, 401– 407. Gobert, C., Bracco, L., Rossi, F., Olivier, M., Tazi, J., Lavelle, F., Larsen, A. K., and Riou, J. F. (1996). Biochemistry 35, 5778– 5786. Gobert, C., Skladanowski, A., and Larsen, A. K. (1999). Proc. Natl. Acad. Sci. USA 96, 10355 – 10360. Goulaouic, H., Roulon, T., Flamand, O., Grondard, L., Lavelle, F., and Riou, J. F. (1999). Nucleic Acids Res. 27, 2443 –2450. Grant, S. (1998). Adv. Cancer Res. 72, 197–233. Guengerich, F. P. (1992). Chem. Res. Toxicol. 5, 2– 5. Gupta, M., Fujimori, A., and Pommier, Y. (1995). Biochim. Biophys. Acta 1262, 1–14. Haluska, P., Jr., Saleem, A., Edwards, T. K., and Rubin, E. H. (1998). Nucleic Acids Res. 26, 1841–1847. Haluska, P., Jr., Saleem, A., Rasheed, Z., Ahmed, F., Su, E. W., Liu, L. F., and Rubin, E. H. (1999). Nucleic Acids Res. 27, 2538 –2544. Hanai, R., Caron, P. R., and Wang, J. C. (1996). Proc. Natl. Acad. Sci. USA 93, 3653 – 3657. Helbock, H. J., Beckman, K. B., Shigenaga, M. K., Walter, P. B., Woodall, A. A., Yeo, H. C., and Ames, B. N. (1998). Proc. Natl. Acad. Sci. USA 95, 288 –293. Henningfeld, K. A., and Hecht, S. M. (1995). Biochemistry 34, 6120 – 6129. Hino, O., Ohtake, K., and Rogler, C. E. (1989). J. Virol. 63, 2638 –2643. Holm, C., Covey, J. M., Kerrigan, D., and Pommier, Y. (1989). Cancer Res. 49, 6365 – 6368. Hsiang, Y. H., Lihou, M. G., and Liu, L. F. (1989). Cancer Res. 49, 5077– 5082. Javaherian, K., and Liu, L. F. (1983). Nucleic Acids Res. 11, 461– 472. Jaxel, C., Capranico, G., Kerrigan, D., Kohn, K. W., and Pommier, Y. (1991). J. Biol. Chem. 266, 20418–20423. Jeggo, P. A. (1998). Radiat. Res. 150, S80 –S91. Jiricny, J. (2000). Nature Genet. 24, 6– 8. Johnson, R. T., Gotoh, E., Mullinger, A. M., Ryan, A. J., Shiloh, Y., Ziv, Y., and Squires, S. (1999). Biochem. Biophys. Res. Commun. 261, 317– 325. Kasid, U. N., Halligan, B., Liu, L. F., Dritschilo, A., and Smulson, M. (1989). J. Biol. Chem. 264, 18687–18692. Kaufmann, W. K., Boyer, J. C., Estabrooks, L. L., and Wilson, S. J. (1991). Mol. Cell. Biol. 11, 3711–3718. Kingma, P. S., and Osheroff, N. (1998). Biochim. Biophys. Acta 1400, 223 –232. Klungland, A., Rosewell, I., Hollenbach, S., Larsen, E., Daly, G., Epe, B., Seeberg, E., Lindahl, T., and Barnes, D. E. (1999). Proc. Natl. Acad. Sci. USA 96, 13300 –13305. Kolodner, R. D., and Marsischky, G. T. (1999). Curr. Opin. Genet. Dev. 9, 89 – 96. Kordiyak, G. J., Jakes, S., Ingebritsen, T. S., and Benbow, R. M. (1994). Biochemistry 33, 13484–13491. Kraakman-van der Zwet, M., Overkamp, W. J., Friedl, A. A., Klein, B., Verhaegh, G. W., Jaspers, N. G., Midro, A. T., Eckardt-Schupp, F., Lohman, P. H., and Zdzienicka, M. Z. (1999). Mutat. Res. 434, 17–27.
214
Philippe Pourquier and Yves Pommier
Kretzschmar, M., Meisterernst, M., and Roeder, R. G. (1993). Proc. Natl. Acad. Sci. USA 90, 11508–11512. Kroeger, P. E., and Rowe, T. C. (1992). Biochemistry 31, 2492–2501. Krogh, S., Mortensen, U. H., Westergaard, O., and Bonven, B. J. (1991). Nucleic Acids Res. 19, 1235–1241. Kunkel, T. A. (1993). Nature 365, 207–208. Labourier, E., Rossi, F., Gallouzi, I. E., Allemand, E., Givita, G., and Tazi, J. (1998). Nucleic Acids Res. 26, 2955 –2962. Lanza, A., Tornaletti, S., Rodolfo, C., Scanavini, M. C., and Pedrini, A. M. (1996). J. Biol. Chem. 271, 6978–6986. Lebel, M., Spillare, E. A., Harris, C. C., and Leder, P. (1999). J. Biol. Chem. 53, 37795 – 37799. Lee, M. P., Brown, S. D., Chen, A., and Hsieh, T. S. (1993). Proc. Natl. Acad. Sci. USA 90, 6656–6660. Leteurtre, F., Kohlhagen, G., Fesen, M. R., Tanizawa, A., Kohn, K. W., and Pommier, Y. (1994). J. Biol. Chem. 269, 7893 –7900. Li, W., and Wang, J. C. (1998). Proc. Natl. Acad. Sci. USA 95, 1010 –1013. Lindahl, T. (1993). Nature 362, 709 –715. Lindahl, T., and Wood, R. D. (1999). Science 286, 1897– 905. Lynn, R. M., Bjornsti, M. A., Caron, P. R., and Wang, J. C. (1989). Proc. Natl. Acad. Sci. USA 86, 3559–3563. Mao, Y., Liu, A., and Liu, L. F. (1999). Proc. Am. Assoc. Cancer Res. 40, 208. Mattern, M. R., Hofmann, G. A., McCabe, F. L., and Johnson, R. K. (1991). Cancer Res. 51, 5813–5816. Merino, A., Madden, K. R., Lane, W. S., Champoux, J. J., and Reinberg, D. (1993). Nature 365, 227–232. Morham, S. G., Kluckman, K. D., Voulomanos, N., and Smithies, O. (1996). Mol. Cell. Biol. 16, 6804–6809. Ng, S. W., Liu, Y., Hasselblatt, K. T., Mok, S. C., and Berkowitz, R. S. (1999). Nucleic Acids res. 27, 993–1000. Nitiss, J., and Wang, J. C. (1988). Proc. Natl. Acad. Sci. USA 85, 7501–7505. Palaniyar, N., Fisher, C., Parks, R., and Evans, D. H. (1996). Virology 221, 351– 354. Park, J. K., Kim, W. J., Park, Y. S., Choi, H. S., Yu, J. E., Han, D. M., and Park, S. D. (1991). Cell. Mol. Biol. 37, 739 –744. Paull, T. T., and Gellert, M. (1999). Genes Dev. 13, 1276–1288. Pieper, R. O. (1998). In “DNA Damage and Repair” ( J. A. Nickoloff and M. F. Hoekstra, eds.), Vol. 2, pp. 33–49. Humana Press, Totowa, NJ. Pommier, Y. (1996). Semin. Oncol. 23, 3–10. Pommier, Y. (1999). Opin. Oncol. Endocr. Metab. Invest. Drugs 1, 168 –169. Pommier, Y., Jenkins, J., Kohlhagen, G., and Leteurtre, F. (1995). Mutat. Res. 337, 135 –145. Pommier, Y., Kerrigan, D., Hartman, K. D., and Glazer, R. I. (1990). J. Biol. Chem. 265, 9418 – 9422. Pommier, Y., Kohlhagen, G., Laco, G. S., Sayer, J. M., Kroth, H., and Jerina, D. M. (2000a). Submitted for publication. Pommier, Y., Kohlhagen, G., Pourquier, P., Sayer, J. M., Kroth, H., and Jerina, D. M. (2000b). Proc. Natl. Acad. Sci. USA, 10, 2040 –2045. Pommier, Y., Kohlhagen, G., Wu, C., and Simmons, D. T. (1998a). Biochemistry 37, 3818 – 3823. Pommier, Y., Pourquier, P., Fan, Y., and Strumberg, D. (1998b). Biochim. Biophys. Acta 1400, 83–105. Pouliot, J. J., Yao, K. C., Robertson, C. A., and Nash, H. A. (1999). Science 286, 552– 555. Pourquier, P., Bjornsti, M. A., and Pommier, Y. (1998). J. Biol. Chem. 273, 27245 –27249.
Top 1-Mediated DNA Damage
215
Pourquier, P., Jensen, A. D., Gong, S. S., Pommier, Y., and Rogler, C. E. (1999a). Nucleic Acids Res. 27, 1919–1925. Pourquier, P., Pilon, A. A., Kohlhagen, G., Mazumder, A., Sharma, A., and Pommier, Y. (1997a). J. Biol. Chem. 272, 26441–26447. Pourquier, P., Takebayashi, Y., Urasaki, Y., Gioffre, C., Kohlhagen, G., and Pommier, Y. (2000). Proc. Natl. Acad. Sci. USA 97, 1885–1890. Pourquier, P., Ueng, L. M., Fertala, J., Wang, D., Park, H. J., Essigmann, J. M., Bjornsti, M. A., and Pommier, Y. (1999b). J. Biol. Chem. 274, 8516 – 8523. Pourquier, P., Ueng, L. M., Kohlhagen, G., Mazumder, A., Gupta, M., Kohn, K. W., and Pommier, Y. (1997b). J. Biol. Chem. 272, 7792–7796. Purmal, A. A., Kow, Y. W., and Wallace, S. S. (1994). Nucleic Acids Res. 22, 3930 – 3935. Redinbo, M. R., Stewart, L., Kuhn, P., Champoux, J. J., and Hol, W. G. (1998). Science 279, 1504–1513. Roffler, S. R., Chan, J., and Yeh, M. Y. (1994). Cancer Res. 54, 1276 –1285. Rose, K. M., Szopa, J., Han, F. S., Cheng, Y. C., Richter, A., and Scheer, U. (1988). Chromosoma 96, 411–416. Rossi, F., Labourier, E., Forne, T., Divita, G., Derancourt, J., Riou, J. F., Antoine, E., Cathala, G., Brunel, C., and Tazi, J. (1996). Nature 381, 80 – 82. Samejima, K., Svingen, P. A., Basi, G. S., Kottke, T., Mesner, P. W., Jr., Stewart, L., Durrieu, F., Poirier, G. G., Alnemri, E. S., Champoux, J. J., Kaufmann, S. H., and Earnshaw, W. C. (1999). J. Biol. Chem. 274, 4335 – 4340. Samuels, D. S., Shimizu, Y., and Shimizu, N. (1989). FEBS Lett. 259, 57– 60. Sastry, S., and Ross, B. M. (1998). J. Biol. Chem. 273, 9942– 9950. Seki, T., Seki, M., Onodera, R., Katada, T., and Enomoto, T. (1998). J. Biol. Chem. 273, 28553 – 28556. Shao, R. G., Cao, C. X., Zhang, H., Kohn, K. W., Wold, M. S., and Pommier, Y. (1999). EMBO J. 18, 1397–1406. Shibutani, S., Takeshita, M., and Grollman, A. P. (1991). Nature 349, 431– 434. Shuman, S. (1991). J. Biol. Chem. 266, 1796 –1803. Shuman, S. (1992). J. Biol. Chem. 267, 16755 –16758. Shykind, B. M., Kim, J., Stewart, L., Champoux, J. J., and Sharp, P. A. (1997). Genes Dev. 11, 397–407. Simmons, D. T., Melendy, T., Usher, D., and Stillman, B. (1996). Virology 222, 365 – 374. Simmons, D. T., Roy, R., Chen, L., Gai, D., and Trowbridge, P. W. (1998). J. Biol. Chem. 273, 20390–20396. Smith, H. M., and Grosovsky, A. J. (1999). Carcinogenesis 20, 1439 –1443. Smith, P. J., Makinson, T. A., and Watson, J. V. (1989). Int. J. Radiat. Biol. 55, 217–231. Squires, S., Ryan, A. J., Strutt, H. L., and Johnson, R. T. (1993). Cancer Res. 53, 2012–2019. Stevnsner, T., Mortensen, U. H., Westergaard, O., and Bonven, B. J. (1989). J. Biol. Chem. 264, 10110–10113. Stewart, A. F., Herrera, R. E., and Nordheim, A. (1990). Cell 60, 141–149. Stewart, L., Ireton, G. C., and Champoux, J. J. (1996). J. Biol. Chem. 271, 7602–7608. Stewart, L., Redinbo, M. R., Qiu, X., Hol, W. G., and Champoux, J. J. (1998). Science 279, 1534–1541. Straub, T., Grue, P., Uhse, A., Lisby, M., Knudsen, B. R., Tange, T. O., Westergaard, O., and Boege, F. (1998). J. Biol. Chem. 273, 26261–26264. Strumberg, D., Pilon, A. A., Smith, M., Hickey, R., Malkas, L., and Pommier, Y. (2000). Mol. Cell. Biol. 20, 3977–3987. Subramanian, D., Rosenstein, B. S., and Muller, M. T. (1998). Cancer Res. 58, 976 – 984. Svejstrup, J. Q., Christiansen, K., Gromova, I. I., Andersen, A. H., and Westergaard, O. (1991). J. Mol. Biol. 222, 669 – 678.
216
Philippe Pourquier and Yves Pommier
Thrash, C., Voelkel, K., DiNardo, S., and Sternglanz, R. (1984). J. Biol. Chem. 259, 1375 – 1377. Tse-Dinh, Y. C., Wong, T. W., and Goldberg, A. R. (1984). Nature 312, 785 –786. Turman, M. A., and Douvas, A. (1993). Biochem. Med. Metab. Biol. 50, 210 –225. Uemura, T., and Yanagida, M. (1984). EMBO J. 3, 1737–1744. Wang, H. P., and Rogler, C. E. (1991). J. Virol. 65, 2381–2392. Wang, J. C. (1996). Annu. Rev. Biochem. 65, 635 – 692. Watt, P. M., Louis, E. J., Borts, R. H., and Hickson, I. D. (1995). Cell 81, 253 –260. Wood, M. L., Dizdaroglu, M., Gajewski, E., and Essigmann, J. M. (1990). Biochemistry 29, 7024–7032. Yang, S. W., Burgin, A. B., Jr., Huizenga, B. N., Robertson, C. A., Yao, K. C., and Nash, H. A. (1996). Proc. Natl. Acad. Sci. USA 93, 11534 –11539. Yang, X., Li, W., Prescott, E. D., Burden, S. J., and Wang, J. C. (2000). Science 287, 131–134. Yeh, Y. C., Liu, H. F., Ellis, C. A., and Lu, A. L. (1994). J. Biol. Chem. 269, 15498 –15504. Zhang, H., Wang, J. C., and Liu, L. F. (1988). Proc. Natl. Acad. Sci. USA 85, 1060 –1064.
Index
A Adenomatous polyposis genetic predisposition, 85 – 86 molecular clock effects adenoma–cancer divergence, 105 –107 adenoma–cancer sequence, 100–101 Adenovirus E1a protein, see E1a protein AG1296, lung fibrosis treatment, 26 –27 9-Aminocamptothecin, topoisomerase I inhibition, 198 Anoikis, sensitization and tumor suppression by E1a protein, 44 – 46 Antibodies, antigen recognition, see Antigens Antigens herpesvirus saimiri superantigen, 73 primary effusion lymphoma pathogenesis, 133 recognition, 147–183 cellular activation specificity, 171–174 monovalent recognition, 153 –165 limitations, 155 –165 orthodox view, 153 –165 multivalent recognition, 165–171 organismal specificity, 174 –182 overview, 147–149, 182–183 research methods, 149–153 SV40 large T antigen, topoisomerase I interactions, 192–194 Apoptosis, antiapoptotic genes, 63 – 65 vBcl-2 protein, 64 vFLIP protein, 64 – 65 Atherosclerosis, platelet-derived growth factor role disease development, 16 –18 treatment, 25–26
B BARF-1 protein, characteristics, 65 B-cell lymphoma, see Primary effusion lymphoma
Bcl-2 protein, Epstein–Barr virus homolog, 64 BDLF2 protein, characteristics, 62– 63
C Cadherin, epithelial conversion, 41– 43 Camptosar, topoisomerase I inhibition, 198 Camptothecins, topoisomerase inhibition anticancer activity, 198 –201 targeting mechanisms, 189 –190, 194 –195 Cancer, see also specific types genetic predisposition colorectal cancer syndromes, 85 – 88 familial adenomatous polyposis, 85 – 86 hereditary nonpolyposis cancer, 87–88 juvenile polyposis, 87 Peutz–Jeghers syndrome, 84, 86 – 87 molecular clocks, 89 –110 adenoma–cancer divergence, 105 – 107 adenoma–cancer sequence, 100–101 calibration, 98 –100 evolution controversies, 89– 92 experimental approach, 97–100 experimental results, 100 –107 interval tumors, 102–105 MS loci, 93 –100 mutation counting, 95 – 97 potential problems, 107–109 tumor progression, 92– 93 tumor tree, 93 – 95 overview, 83 – 84, 109 –110 platelet-derived growth factor role disease development, 13 –16 autocrine stimulation, 13 –14 ligand-independent receptor activation, 14 –15 paracrine PDGF effects, 15–16 treatment, 24 –25
218 Cancer (continued) topoisomerase I poisons, 198 –201 tumor suppression, see Tumor-suppressors Cardiovascular system, platelet-derived growth factor function, 12 Caseine kinase, topoisomerase I interactions, 192, 194 Caspase, topoisomerase I interactions, 192 CD138/syndecan-1, primary effusion lymphoma pathogenesis, 132–133 Cell cycle, abnormalities in primary effusion lymphoma, 127 c-Fms protein, characteristics, 65 CGP53716 atherosclerosis treatment, 25 –26 lung fibrosis treatment, 26 Colorectal cancer syndromes, genetic predisposition, 85–88 familial adenomatous polyposis, 85 – 86 hereditary nonpolyposis cancer, 87– 88 juvenile polyposis, 87 Peutz–Jeghers syndrome, 84, 86 – 87 CPT-11, topoisomerase I inhibition, 198, 204, 211 C-terminal-binding protein, epithelial conversion, 42–46 Cyclins, viral homologs Epstein–Barr virus, 62– 63 herpesvirus saimiri, 63 viral-encoded cyclins, 62– 63 Cytokines, deregulation in primary effusion lymphoma, 127–130 interleukin-6, 128–129 interleukin-10, 129 minor cytokines, 130 vascular endothelial growth factor, 129 – 130
D
␦EF1/ZEB protein, epithelial conversion, 42– 46 DNA mismatch repair, genetic predisposition in cancer, 89–110 adenoma–cancer divergence, 105 –107 adenoma–cancer sequence, 100–101 calibration, 98–100 evolution controversies, 89– 92 experimental approach, 97–100 experimental results, 100 –107 interval tumors, 102–105
Index
MS loci, 93 –100 mutation counting, 95 – 97 overview, 83 – 84, 109 –110 potential problems, 107–109 tumor progression, 92– 93 tumor tree, 93 – 95 topoisomerase I-mediated damage, 189 – 211 anticancer top1 poisons, 198 –201 catalytic cycle, 195 –198 cleavage complexes, 195 –198, 201–209 DNA lesion processing, 209 –211 enhancement, 201–209 functions, 191–195 overview, 189 –190, 211 protein interactions, 191–195 structural domains, 190 –191 suppression, 201–209 DX-8951f, topoisomerase I inhibition, 198
E E1a protein, tumor suppression, 39 – 46 anoikis sensitization, 44 – 46 epithelial conversion, 41– 44 mechanisms, 41– 44 phenomenology, 41 historical development, 40 – 41 overview, 39 – 40 EBER proteins, characteristics, 68 EBNA-1, characteristics, 71 EBNA-2, characteristics, 70 EBNA-3, characteristics, 71 EBNA-LP, characteristics, 71 E-cadherin, epithelial conversion, 41– 43 Ecteinascidin 743, topoisomerase I inhibition, 198 Embryogenesis, platelet-derived growth factor role, 9 –11 Epithelial conversion, E1a protein role, 41– 44 mechanisms, 41– 44 phenomenology, 41 Epstein–Barr virus comparative gene product analysis antiapoptotic genes, 64 cellular gene homologues BARF-1, 65 BDLF2, 62– 63 EBERs, 68 LMP1, 56 – 57 LMP2A, 60 – 61
Index
major transforming genes, 56 – 57 overview, 51–55, 73 signal modulators, 60 – 61 unique genes, 70 –71 EBNA-1, 71 EBNA-2, 70 EBNA-3, 71 EBNA-LP, 71 vBcl-2, 64 primary effusion lymphoma pathogenesis, 124–125 Evolution, tumor mutations and molecular clocks, 89–92 Exatecan mesylate, topoisomerase I inhibition, 198
F Fagoronine, topoisomerase I inhibition, 198 Familial adenomatous polyposis, genetic predisposition, 85– 86
G Gammaherpesviruses, see specific viruses Glomerulonephritis, platelet-derived growth factor role disease development, 18 –19 treatment, 27
H Helicase, topoisomerase I interactions, 192, 194 Hepatocyte growth factor, Met interactions in primary effusion lymphoma, 130–132 Heredity, cancer predisposition colorectal cancer syndromes, 85 – 88 familial adenomatous polyposis, 85 – 86 hereditary nonpolyposis cancer, 87– 88 juvenile polyposis, 87 Peutz–Jeghers syndrome, 84, 86 – 87 molecular clocks, 89 –110 adenoma–cancer divergence, 105 –107 adenoma–cancer sequence, 100–101 calibration, 98–100 evolution controversies, 89– 92 experimental approach, 97–100 experimental results, 100 –107 interval tumors, 102–105 MS loci, 93–100 mutation counting, 95 – 97
219 potential problems, 107–109 tumor progression, 92– 93 tumor tree, 93 – 95 overview, 83 – 84, 109 –110 Herpesvirus, gamma gene products, comparative analysis, 51–74 cellular gene homologues, 62–70 antiapoptotic genes, 63 – 65 complement inhibitory genes, 69 –70 EBV genes BARF-1, 65 BDLF2, 62– 63 EBERs, 68 vCSF-1R, 65 vIL-10, 65 – 66 HVS genes HSURs, 69 vcyclin, 63 vGCR, 67– 68 vIL-17, 68 KSHV genes MIPs, 66 – 67 Nut-1/T1.1 RNAs, 69 Orf 72, 63 vcyclin, 63 vGCR, 67– 68 vIL-6, 66 vBcl-2 protein, 64 vFLIP protein, 64 – 65 viral-encoded cyclins, 62– 63 viral-encoded small RNAs, 68 – 69 virocrines, 65 – 68 major transforming genes, 56 – 60 EBV LMP1, 56 – 57 HVS STP, 58 KSHV K1, 58 – 60 overview, 51– 55, 73 signal modulators, 60 – 62 EBV LMP2A, 60 – 61 HVS Tip, 61– 62 KSHV K15, 61 unique genes, 70 –73 EBV genes, 70 –71 HVS genes, 73 KSHV genes, 72 Herpesvirus saimiri comparative gene product analysis cellular gene homologues HSURs, 69 vcyclin, 63 vGCR, 67– 68 vIL-17, 68
220 Herpesvirus saimiri (continued) overview, 51–55, 73 signal modulators, Tip, 61– 62 unique genes, viral superantigen, 73 transformation proteins, 58 HMG protein, topoisomerase I interactions, 192–193 Hoechst 33342, topoisomerase I inhibition, 198 HSP70 protein, topoisomerase I interactions, 192–193 Human herpesvirus type-8, primary effusion lymphoma pathogenesis, 122–124 Human immunodeficiency virus, primary effusion lymphoma pathogenesis, 125 Hycamtin, topoisomerase I inhibition, 198
I Indenoisoquinolines, topoisomerase I inhibition, 198 Indolocarbazoles, topoisomerase I inhibition, 198 Interleukin-6 deregulation in primary effusion lymphoma, 128–129 Kaposi’s sarcoma-associated herpesvirus homolog, 66 Interleukin-10 deregulation in primary effusion lymphoma, 129 Epstein–Barr virus homolog, 65 – 66 Interleukin-17, herpesvirus saimiri homolog, 68 Intoplicine, topoisomerase I inhibition, 198 Irinotecan, topoisomerase I inhibition, 198
K Kaposin, characteristics, 72 Kaposi’s sarcoma-associated herpesvirus comparative gene product analysis antiapoptotic genes, vFLIP, 64 – 65 cellular gene homologues MIPs, 66–67 Nut-1/t1.1 RNAs, 69 Orf 72, 63 vGCR, 67–68 vIL-6, 66 major transforming genes, K1, 58 – 60 overview, 51–55, 73
Index
signal modulators, K15, 61 unique genes kaposin, 72 LANA, 72 vIRF, 72 primary effusion lymphoma pathogenesis, 122–124 K1 protein, characteristics, 58 – 60 K15 protein, characteristics, 61
L LANA protein, characteristics, 72 Leflunomide, platelet-derived growth factorsignaling inhibition, 24 LMP1 protein, characteristics, 56 – 57 LMP2A protein, characteristics, 60 – 61 Lung fibrosis, platelet-derived growth factor role development, 18, 26 –27 treatment, 26 –27 Lymphoma, see Primary effusion lymphoma
M Met protooncogene, hepatocyte growth factor interactions in primary effusion lymphoma, 130 –132 MIP proteins, characteristics, 66 – 67 Mismatch repair, genetic predisposition in cancer, 89 –110 adenoma–cancer divergence, 105 –107 adenoma–cancer sequence, 100–101 calibration, 98 –100 evolution controversies, 89– 92 experimental approach, 97–100 experimental results, 100 –107 interval tumors, 102–105 MS loci, 93 –100 mutation counting, 95 – 97 overview, 83 – 84, 109 –110 potential problems, 107–109 tumor progression, 92– 93 tumor tree, 93 – 95 Molecular clocks, cancer predisposition role, 89 –110 evolution controversies, 89– 92 experimental approach, 97–100 calibration, 98 –100 experimental results, 100 –107 adenoma–cancer divergence, 105 –107 adenoma–cancer sequence, 100–101
Index
interval tumors, 102–105 unexpected findings, 101–102 MS loci, 93–100 mutation counting, 95 – 97 tumor tree, 93– 95 overview, 83–84, 109 –110 potential problems, 107–109 tumor progression, 92– 93
N NB-506, topoisomerase I inhibition, 198 Nitidine, topoisomerase I inhibition, 198 9-Nitrocamptothecin, topoisomerase I inhibition, 198 Nucleolin, topoisomerase I interactions, 192
O Orf 15 protein, characteristics, 70 Orf 72 protein, characteristics, 63 Orf 73 protein, characteristics, 72 Orf 74 protein, characteristics, 67– 68 Orf K4 protein, characteristics, 66 – 67
P PARP protein, topoisomerase I interactions, 192 Peutz–Jeghers syndrome, genetic predisposition, 84, 86–87 Platelet-derived growth factor receptors characteristics, 4 drug target role, 19 –27 antagonists, 19 –23 receptor dimerization antagonists, 22 receptor interactions, 21–22 receptor kinase blocking antagonists, 22–23 atherosclerosis treatment, 25 –26 cancer treatment, 24–25 glomerulonephritis treatment, 27 lung fibrosis treatment, 26 –27 intracellular signal transduction activation, 5–6 ligand-independent receptor activation, 14–15 Platelet-derived growth factors antagonist development, 19 –27 atherosclerosis treatment, 25 –26 cancer treatment, 24–25 future research directions, 27–28
221 genetic approaches, 23 glomerulonephritis treatment, 27 ligand interfering antagonists, 21–22 lung fibrosis treatment, 26 –27 overview, 1–2 receptor dimerization antagonists, 22 receptor interactions, 21–22 receptor kinase blocking antagonists, 22–23 compartmentalization, 4 disease development role, 13 –19 atherosclerosis, 16 –18, 25 –26 cancer, 13 –16 autocrine stimulation, 13 –14 ligand-independent receptor activation, 14 –15 paracrine PDGF effects, 15–16 treatment, 24 –25 glomerulonephritis, 18 –19, 27 lung fibrosis, 18, 26 –27 future research directions, 27–28 in vivo functions, 9 –13 embryonic development, 9 –11 tissue homeostasis, 12–13 vascular system, 12 wound healing, 11–12 intracellular signal transduction, 5 – 9 modulation, 8 – 9 receptor activation, 5 – 6 SH2 domain protein role, 6 – 8 isoform characteristics, 3, 5 processing mechanisms, 4 production, cell types, 3 – 4 target cells, 4 – 5 Polyposis syndromes, genetic predisposition familial adenomatous polyposis, 85 – 86 juvenile polyposis, 87 molecular clocks adenoma–cancer divergence, 105 –107 adenoma–cancer sequence, 100–101 Peutz–Jeghers syndrome, 86 – 87 p53 protein, topoisomerase I interactions, 192, 195 Primary effusion lymphoma clinical features, 135 description, 116 –118 cytomorphology, 116 –117 genotype, 118 pathology, 116 –117 phenotype, 118 differential diagnosis, 136 –137 epidemiology, 133 –134
222
Index
Primary effusion lymphoma (continued) histogenesis, 119–121 overview, 115–116, 138 –139 pathogenesis, 116–117, 121–133 adhesion molecules, 132–133 antigen stimulation and selection, 133 cell cycle abnormalities, 127 cytokine deregulation, 127–130 interleukin-6, 128 –129 interleukin-10, 129 minor cytokines, 130 vascular endothelial growth factor, 129–130 karyotypic alterations, 126 –127 Met/hepatocyte growth factor interactions, 130–132 molecular lesions, 126 –127 viruses, 122–125 Epstein–Barr virus, 124 –125 human herpesvirus type-8, 122–124 human immunodeficiency virus, 125 Kaposi’s sarcoma-associated herpesvirus, 122–124 radioimaging, 136 therapy, 137–138 Protein kinase C, topoisomerase I interactions, 194 PSF/p54nrb protein, topoisomerase I interactions, 192–193
S
R
T
Rebeccamycin, topoisomerase I inhibition, 198 Rectal cancer, see Colorectal cancer syndromes Renal disease, platelet-derived growth factor role disease development, 18 –19 treatment, 27 Respiratory fibrosis, platelet-derived growth factor role development, 18, 26 –27 treatment, 26–27 RNA, herpesvirus gamma gene product comparative analysis, cellular gene homologues KSHV Nut-1/T1.1 RNAs, 69 viral-encoded small RNAs, 68 – 69 RNA pol I, topoisomerase I interactions, 192 RPR101511A, atherosclerosis treatment, 25 Rubitecan, topoisomerase I inhibition, 198
TATA-binding protein, topoisomerase I interactions, 192–193 Theronine protein kinase, topoisomerase I interactions, 194 Tip protein, characteristics, 61– 62 Tissue development, homeostasis, plateletderived growth factor role, 12–13 Topoisomerase I, DNA damage mediation, 189 –211 anticancer top1 poisons, 198 –201 catalytic cycle, 195 –198 cleavage complexes, 195 –198, 201–209 DNA lesion processing, 209 –211 enhancement, 201–209 functions, 191–195 overview, 189 –190, 211 protein interactions, 191–195 structural domains, 190 –191 suppression, 201–209 Topors, topoisomerase I interactions, 192
Saimiri transformation proteins, characteristics, 58 Sarcoma-associated herpesvirus, see Kaposi’s sarcoma-associated herpesvirus SELEX aptamers atherosclerosis treatment, 25 glomerulonephritis treatment, 27 Serine protein kinase, topoisomerase I interactions, 194 SFII/ASF splicing factor, topoisomerase I interactions, 192–193, 195 SH2 domain proteins, intracellular signal transduction, 6 – 8 Signal transduction activation, platelet-derived growth factor role, 5 – 9 modulation, 8 – 9 receptor activation, 5 – 6 SH2 domain protein role, 6 – 8 signal interference, 23 viral modulator proteins, 60 – 62 EBV LMP2A, 60 – 61 HVS Tip, 61– 62 KSHV K15, 61 Simian virus-40 large T antigen, topoisomerase I interactions, 192–194 STI-571, platelet-derived growth factor receptor kinase inhibition, 24
223
Index
Topotecan, topoisomerase I inhibition, 198 Tumors, see Cancer Tumor-suppressors, adenovirus E1a protein, 39–46 anoikis sensitization, 44 – 46 epithelial conversion, 41– 44 mechanisms, 41– 44 phenomenology, 41 historical development, 40 – 41 overview, 39–40 ␣- and -Tyrosine kinase receptors characteristics, 4 drug target role, 19 –27 antagonists, 19 –23 receptor dimerization antagonists, 22 receptor interactions, 21–22 receptor kinase blocking antagonists, 22–23 atherosclerosis treatment, 25 –26 cancer treatment, 24–25 glomerulonephritis treatment, 27 lung fibrosis treatment, 26 –27 intracellular signal transduction activation, 5–6 ligand-independent receptor activation, 14–15
U Ubiquitin coupling factors, topoisomerase I interactions, 192, 202
V Vascular endothelial growth factor, deregulation in primary effusion lymphoma, 129 –130 Vascular system, platelet-derived growth factor function, 12 vBcl-2 protein, characteristics, 64 vCSF-1 protein, characteristics, 65 vFLIP protein, characteristics, 64 – 65 vGCR protein, characteristics, 67– 68 vIL-6 protein, characteristics, 66 vIL-10 protein, characteristics, 65 – 66 vIL-17 protein, characteristics, 68 vIRF protein, characteristics, 72
W Werner syndrome helicase, topoisomerase I interactions, 192, 194 Wound healing, platelet-derived growth factor role, 11–12
This Page Intentionally Left Blank