A Practical Guide to Cellular and Molecular Research Methods in Immunology, 2nd Edition

1

A PRACTICAL GUIDE TO

CELLULAR AND MOLECULAR RESEARCH METHODS IN IMMUNOLOGY John R. Gordon, Ph.D. Department of Veterinary Microbiology, University of Saskatchewan, Saskatoon, CANADA

SECOND EDITION © 1998, John R. Gordon tel: 306-966-7214; FAX: 306-966-7244 email: [email protected]

--------------------------------------------------------------------------Front cover: top left - In situ hybridization autoradiography of mouse skin tissues undergoing a passive cutaneous anaphylaxis response following intravenous allergen challenge. The tissue was harvested at 8 h post-challenge and was probed with a 35S-α1 (I) collagen cRNA probe, which hybridizes specifically with fibroblasts activated by mast cell TNFα and TGFβ (Gordon & Galli, J Exp Med 180: 2027, 1994). top right - Northern blot autoradiograph of mRNA from Cl.MC/C57.1 mast cells challenged via the FcεRI for varying periods of time. The blot was probed with a 32P-TNFα cDNA and washed at high stringency (Gordon & Galli, J Exp Med 174: 103, 1991). bottom left - Antigen-driven IFNγ and IL-4 production in splenocyte cultures from BALB/c mice vaccinated (dy 0) and boosted (dy 14) with a range of doses of ovalbumin (0.05 - 10 µg) in the context of alum (taken from Schneider & Gordon, manuscript in preparation) bottom right - Chemotaxis assay of the eosinophil chemotactic activities of extracts from the skin of an eosinophilic epitheliotropic T cell lymphoma patient. The tissues contained high levels of MCP-3, and moderate levels of RANTES & GM-CSF (Hull, Saxena & Gordon, manuscript in preparation)

2

TABLE OF CONTENTS 1.0 INFLAMMATION 1.1 Purification of mononuclear and polymorphonuclear cells .............. 4 1.2 Isolation of cells from the peritoneal cavities of mice ...................... 8 1.3 Adherence purification of monocytes .............................................. 9 1.4 Antibody- or C3b-dependent phagocytosis ..................................... 10 1.5 Activation of macrophages .............................................................. 12 1.6 Monokine Bioassays........................................................................ 14 1.6.1 Assay for IL-1 activity ......................................................... 14 1.6.2 Assay for IL-6 activity ......................................................... 17 1.6.3 Cytotoxicity assay for TNFα ............................................... 19 1.7. Neutrophil chemotaxis assay.......................................................... 21 1.8. FcεRI-dependent activation of mast cells ....................................... 24 2.0 ANTIBODIES: PURIFICATION & CHARACTERIZATION 2.1 Hybridoma cell culture with production of monoclonal antibodies ... 26 2.2 Affinity purification of IgG antibodies ............................................... 27 2.2.1 Avid-AL affinity chromatography ........................................ 27 2.2.2 Protein A-Sepharose affinity chromatography ................... 29 2.3 Preparation of IgM antibodies.......................................................... 31 2.4 Analysis & characterization of immunoglobulins.............................. 33 2.4.1 Polyacrylamide gel electrophoresis of immunoglobulins .... 33 2.4.2 Western blotting to detect immunoglobulins ...................... 35 3.0 T CELL AND B CELL RESPONSES 3.1 C'-dependent depletion of CD4+ and CD8+ T Cells ........................ 37 3.2 MACS purification (or depletion) of CD4+ and CD8+ T Cells .......... 39 3.3 Assessment of T cell proliferation ................................................... 41 3.4 Plaque Forming Cell (PFC) assay for IgM-producing cells .............. 44 3.5 ELISPOT assays for single cytokine- or Ab-producing cells ............ 45 3.6 ELISA assay for detection of antigen-specific antibodies ................ 49 3.7 In vivo assessment of T cell responses ........................................... 51 3.8 Immunohistochemical detection of cytokines in tissues .................. 53 4.0 MOLECULAR ANALYSIS OF CYTOKINE mRNA EXPRESSION 4.1 Northern blotting ........................................................................... 55 4.1.1 Purification of cellular RNA ................................................ 55 4.1.2 Electrophoresis of RNA & transfer to membranes ............. 58 4.1.3 32P-labelled cDNA probe synthesis ................................... 61 4.1.4 Pre-hybridization, hybridization, and washing .................... 63 4.1.5 Detection of mRNA bands ................................................. 65 4.2 In Situ hybridization ...................................................................... 67 4.2.1 Probe synthesis & purification ........................................... 67 4.2.2 Preparation of slides for hybridization ................................ 71 4.2.3 Hybridization of 35S-cRNA riboprobes to cellular mRNA ... 74

3

4.2.4 Post-hybridization washing & autoradiography .................. 76 4.2.5 Autoradiograph development & counter-staining ............... 78 4.3 Semi-quantitative RT-PCR to detect cytokine mRNA ................. 79 4.3.1 First strand cDNA Synthesis using Oligo(dT) priming ........ 80 4.3.2 PCR amplification of the target cDNA ................................ 81 4.3.2 Detection of RT-PCR products .......................................... 82 APPENDICES 5.1 APPENDIX A -- GENERAL METHODS .......................................... 83 5.1.1 Anti-sheep RBC antisera ................................................... 83 5.1.2 Cell counting ...................................................................... 83 5.1.3 C3b opsinization of yeast ................................................... 84 5.1.4 Cytocentrifuge preparations ............................................... 85 5.1.5 Dialysis tubing .................................................................... 85 5.1.6 Fixation of tissues for ISH or IHC ...................................... 85 5.1.7 Lung cells (single cell suspension) .................................... 86 5.1.8 Lysis of red blood cells ...................................................... 86 5.1.8.1 Hypotonic lysis with H2O ..................................... 86 5.1.8.2 Lysis with ammonium chloride ............................. 86 5.1.9 Opsinization of SRBC with antibody .................................. 87 5.4.10 Protein assay in microtiter plates ..................................... 87 5.1.11 Splenocytes (single cell suspensions) ............................. 87 5.1.12 Splenocytes (spleen cell-conditioned medium)................ 88 5.1.13 Staining Protocols ............................................................ 89 5.1.13.1 Giemsa stains .................................................... 89 5.1.13.1.1 Wrights-Giemsa staining ...................... 89 5.1.13.1.2 Giemsa staining of tissue sections ....... 89 5.1.13.2 Gills hematoxylin for IHC.................................... 90 5.1.13.3 Toluidine blue staining (ISH counter-stain) ........ 90 5.1.14 Standard curves (e.g., cytokines) .................................... 90 5.1.15 TESPA-treatment of glass slides ..................................... 91 5.2 APPENDIX B -- REAGENTS & SOLUTIONS CELLULAR IMMUNOLOGY REAGENTS ................................... 92 Acidified isopropanol ......................................................... 92 Actinomycin D ................................................................... 92 Alsevers solution ............................................................... 92 Ammonium chloride .......................................................... 92 Ammonium sulfate (saturated solutions) ........................... 92 Borate-buffered saline....................................................... 92 ELISPOT & ELISA Carbonate Coating buffer ................... 92 Isotonic Percoll Density Gradient Medium ........................ 93 PAGE running buffer ......................................................... 93 PAGE 2x sample prep buffer ............................................ 93 PAGE gel fix buffer ........................................................... 93 Phosphate-buffered saline (PBS) ..................................... 93

4

Giemsa Stain .................................................................... 93 Giemsa Stock Solution ...................................................... 93 0.4% Trypan Blue ............................................................. 94 MOLECULAR BIOLOGY REAGENTS Agarose/formaldehyde/MOPS gel (for Northerns) ............ 94 Cesium Chloride (for isolation of total cellular RNA) ......... 94 DEPC-treated water (& other solutions) ............................ 94 Dithiothreitol ...................................................................... 94 EDTA (0.5M) ..................................................................... 94 Guanidinium Isothiocyanate (GSCN) ............................... 94 ISH 10x salts ..................................................................... 94 ISH hybridization buffer ..................................................... 95 Northern blotting pre-hyb/hybridization solution ................ 95 MOPS (1 M) ...................................................................... 95 5X MOPS Buffer ............................................................... 95 Phenol (salt-saturated) ...................................................... 95 Reagents for purifying DNA from agarose gels ................. 96 General purpose restriction endonuclease buffers ........... 96 RNA sample prep buffer (Northern analysis) .................... 96 RNA sample dye/loading buffer ........................................ 96 RNAse A ........................................................................... 96 Salmon sperm DNA .......................................................... 96 Sodium acetate (3M) ......................................................... 96 20X SSC (4 liters) ............................................................. 97 STE buffer ......................................................................... 97 5.3 APPENDIX C -- TISSUE CULTURE MEDIA Click's medium ............................................................................. 98 DMEM .......................................................................................... 98 DMEM-0% FCS ........................................................................... 98 DMEM-10% FCS. ........................................................................ 98 DMEM-10% normal horse serum................................................. 98 HBSS (Ca++ and Mg++-free) ...................................................... 98 MEM ............................................................................................ 98 RPMI 1640 ................................................................................... 98 RPMI-0% FCS. ............................................................................ 98 RPMI-10% FCS ........................................................................... 98 5.4 APPENDIX D -- MAINTENANCE OF CELL LINES 7TD1 cells (for assay of IL-6)....................................................... 99 Cl.MC/C57.1 cells (C57 mast cells) ............................................. 99 L-929 cells (for TNF bioassay) ..................................................... 99 LM-1 cells (for assay of IL-1) ....................................................... 99 Pu5-1.8 cells (macrophage cell line) ............................................ 99 5.6 APPENDIX F -- Human cytokine RT-PCR primers......................... 101 5.7 APPENDIX G -- WWW Immunology sites of interest ...................... 102

5

5.7 APPENDIX G -- Selected templates for 96--well plates .................. 103

6

1.0 INFLAMMATION: In the first week of this course we will begin to acquire some of the basic skills needed to examine several components of the inflammatory cascade, a series of responses that are integrally intertwined with the immune system. First we will begin to acquire some basic skills in tissue culture, and the purification of selected cells associated with the immunoinflammatory system (i.e., peripheral blood [PBL] monocytes and neutrophils [PMN or polymorphonuclear cells]). Then we will learn how to identify them using morphologic criteria, and how to assess a couple of functions associated with monocytes/macrophages - phagocytosis (a subfunction of antibody-dependent cellular cytotoxicity) and activation-dependent monokine production. 1.1 Purification of mononuclear and polymorphonuclear cells from mouse peripheral blood. While this protocol is designed specifically for the purification of cells from the peripheral blood, such density gradient systems can also be used for other cell systems (e.g., to purify PMN from glycogen-elicited peritoneal cavity preparations). In general it is better to use polypropylene [p.p.] rather than polystyrene [p.s.] tubes because polypropylene is less "sticky" for the cells and therefore activates them to a lesser extent than polystryrene. On the other hand, polypropylene tubes are more expensive, so this too needs to be taken into account. Materials BALB/c mouse anaesthetic (methoxyfluorane) clinical centrifuge, 15 ml centrifuge tubes, 4 ml round bottom p.s. tubes 23-25 ga needles & 1 ml syringes pipettes/pipettors (micro- and macropipettes) microscope slides (frosted end; & pencil for labeling) sterile surgical tools (optional, for open body cardiac puncture) laminar flow hood, inverted microscope, hemocytometer Reagents anticoagulant (heparin 1000U/ml) DMEM with 1 U/ml heparin or with 3 mg/ml EDTA anticoagulant DMEM-10% FCS (see Appendix A)

7

70% ethanol isotonic Percoll(see Appendix C) RBC sedimentation buffer (4.5% dextran-T500 in PBS) cytocentrifuge METHOD 1. Obtain blood from surgically anaesthetized (or euthanized) mouse either by closed- or open-body cardiac puncture. Withdraw blood slowly into a 1 ml syringe containing 100 µl of heparin, being careful not to hemolyse the red blood cells by using too much back pressure on syringe. Work fairly quickly, or mix the blood with the anticoagulant in the syringe fairly often, so that the blood doesn't coagulate. 2. Mix the blood with the RBC sedimentation buffer (1 volume sed. buffer: 1 volume blood) in the 4 ml tubes and allow the mixture to stand undisturbed on the bench for 20 - 45' (the time can be highly variable, depending on the species of animal) 1. The RBC's will form rouleaux (chains of RBC's) that will

3.

4.

1

sediment out of suspension rather rapidly, leaving you with a leukocyte/plateletrich plasma layer above the settled RBC's. Withdraw the plasma layer and transfer to a 15 ml polypropylene tube. Add 10 - 12 ml of DMEM-anticoagulant to the plasma and sediment the leukocytes out of suspension by centrifugation (1000 rpm for 10') 2, 3. Aspirate the platelet-rich medium, avoiding the cell pellet, and then resuspend the cells by vigorously flicking the tube. When the cell pellet has become a 'paste' on the lower walls of the tube, add ≈5 - 10 ml of tissue culture medium and then gently vortex by hand to ensure that you have a 'single cell suspension' (i.e., no clumps of cells). While the cells are spinning in step 3, prepare a 70% isotonic Percoll gradient cushion by mixing together 1.75 ml isotonic Percoll and 0.75 ml of

RBC do not sediment from bovine blood using this dextran sedimentation protocol. Alternately, with bovine blood, one can either use the density gradients directly with diluted (1:1 with PBS) anticoagulated blood, followed by RBC lysis of the red cell rich-PMN fraction, or use the buffy coat of white blood cells from the top of sedimented whole anticoagulated whole blood and fractionate these cells using density gradient centrifugation as noted. 2 This fairly low speed centrifugation step reduces the platelet contamination of the mononuclear cell fraction of the blood. Platelets are a very rich source of a number of cytokines (including TGFβ) and other potent biologically active mediators. 3 Alternately, the platelet-rich leukocyte-plasma can be loaded directly onto the gradients. This saves some time in the purification procedure, but leaves the mononuclear cell fraction containing high levels of platelets, which can be gotten rid of by a subsequent low-speed spin (i.e., 1000 rpm for 10 min, in the clinical centrifuge)

8

5.

DMEM/heparin/EDTA, in a 15 ml p.p. tube 4. After resuspending the cell pellet from step 3, gently layer this suspension on top of the 70% isotonic Percoll 'cushion', so that there is no mixing of the two layers. Centrifuge the cell gradients for ≈25 min at ≈2000 rpm (room temperature) in the clinical centrifuge, and allow the centrifuge rotor to coast to a stop (i.e., no brake). The completed gradient will appear much as it did before spinning, but now the PMN and RBC will reside as a pellet at the bottom of the tube and the mononuclear cells (monocytes and lymphocytes) will reside as a band of cells at the interface between the tissue culture medium and the isotonic Percoll. To harvest the mononuclear cells, simply pipette the cells directly from the interface, trying to avoid aspirating any substantial volume of the Percoll. Transfer the cells to a new tube and dilute any of the density gradient medium by topping up the tube with additional medium. To harvest the PMN, carefully aspirate the remaining Percoll solution, then resuspend the pelleted cells by flicking the tube and then adding a large volume of medium. If the PMN are badly contaminated with red blood cells, these can by lysed by hypotonic lysis or ammonium chloride (see Appendix D).

70%

C

4

Alternately, one can use other density gradient media, such as Ficoll-Hypaque or Lymphocyte Separation Medium (see ALTERNATE PROTOCOL), which is useful for the preparation of mononuclear cells from an array of species. Furthermore, LSM gradients are run for only 15-25 min.

9

6.

7.

8.

Wash both cell preparations (i.e., PMN and mononuclear cells) as above, and resuspend the cells in a minimal volume (e.g., 1 ml) of medium. Remove 20 µl of each preparation for cell counting by hemocytometer and determine the cell numbers and viabilities (see Appendix D). If the mononuclear cell fraction is heavily contaminated with platelets, rewash at low speed (i.e., 800 rpm for 10'). Prepare cytocentrifuge slides of the cells by applying 5x104 cells in ≈100 µl of medium to each slide assembly and centrifuging them for 5 min at 1500 rpm. Allow the sedimented cells to dry well before staining them with Giemsa solution (see Appendix D). If you have sufficient cells remaining, set them up in culture at a cell density of 3x106 cells/ml and challenge both the monocytes and PMN with endotoxin as in §1.1.

1.1a ALTERNATE PROTOCOL 1 (for rapid mononuclear cell gradients) Rather than using Percoll or Ficoll-Paque gradients to separate the mononuclear cells from the other leukocytes, one can use Lymphocyte Separation Medium (LSM; Organon-Technika), which seems to be useful across a wide array of species (e.g., human, bovine, equine, murine, ovine). The procedures employed are essentially identical to those for the Percoll gradients, with the exception that the cells are centrifuged on the gradients at 1500 rpm (i.e., ≈400xg) for 15 - 30 min. Thus the spin is shorter and at a much lower speed (which may be desirable in terms of the harshness of cellular treatment as well as in term so the times involved). The drawback to using an abbreviated centrifugation time is that neutrophils will not sediment to the bottom of the gradients in this time, but instead will remain suspended in and can be recovered from the LSM rather than as a pellet at the bottom of the tube. Materials all materials required for the Percoll isolation procedure (§1.1) Reagents all reagents required for the Percoll isolation procedure (§1.1) Lymphocyte Separation Medium (LSM; Organon-Technika Inc) METHOD 1-3. Obtain leukocyte/platelet-rich plasma as in the Percoll procedure (§1.1).

10

4.

5. 6.

Pipette 3 ml of LSM into a 15 ml p.p. conical centrifuge tube, then carefully overlay this with either the platelet-rich leukocyte-plasma or with platelet depleted, washed white blood cells. Centrifuge the gradients for 15 - 25 min 5 at 1500 rpm in the clinical centrifuge (i.e., ≈ 400xg). Harvest the mononuclear cells as a band from the top of the density gradient medium, as in §1.1 - step 5, and wash them as in §1.1 - step 6.

1.1b ALTERNATE PROTOCOL 2 (fractionation of leukocyte sub-populations) The individual leukocyte populations (i.e., monocytes, lymphocytes, basophils, eosinophils and neutrophils) can be at least partially purified as discrete bands directly from continuous density gradients. These are relatively easy to generate as custom gradients which can be tailored for individual needs by simply changing the low and high density "ends" of the gradient. TABLE . Examples of useful density ranges for fractionating various cell populations

Materials all materials required for the Percoll isolation procedure (§1.1) a continuous density gradient pouring apparatus (commercial or "home-made") Percoll solutions of the required density6 Reagents all reagents required for the Percoll isolation procedure (§1.1)

5

Fifteen minutes is usually adequate to fully purify the mononuclear cells from the polymorphonuclear cells and is sufficient to sediment any contaminating red blood cells, but is is not adequate to sediment the neutrophils in the LSM. A longer spin time (e.g., 25') is required to sediment these cells. 6 The formula for calculating the volumes of materials needed to achieve specific densities with Percoll is: , where

11

METHOD 1-3. Obtain leukocyte/platelet-rich plasma as in the Percoll procedure (§1.1). 4. Pour the continuous density gradients by placing low density Percoll in the first chamber and high density Percoll in the second chamber. The medium is best delivered from the gradient pourer into the individual tubes using a peristaltic or other pump -- as the high density medium empties from the second chamber into the centrifuge tube, it is replaced and thereby diluted by low density medium. The second chamber should be equipped with a mixer or stirrer to ensure rapid and complete mixing of the reagents during this process. By steadily withdrawing the delivery needle as the centrifuge tube fills, you will generate a gradient of continuously decreasing density, with the density at the bottom of the gradient being equal to that of the medium in chamber 2 and that at the top of the gradient being equal to that of the medium in chamber 1. mixer

peristaltic pump centrifuge tube deliv ery tubing or needle

flow low density Percoll (chamber1)

5.

6.

high density Percoll (chamber 2)

w ithdraw needle w ith adv ancing gradient

When the gradient formation is complete, very carefully load the peripheral blood leukocytes to be fractionated on top of the gradients. Since the low density medium may be of a density very similar to that of the medium in which the cells are resuspended, great care may to be needed to avoid mixing of the cells and gradient medium. Run the gradients for 25 min at ≈2000 rpm in the clinical centrifuge, just as in §1.1, and harvest them in an analogous manner. However, what you will notice with these gradients is that there are multiple bands, the precise number and

12

7.

their locations depending on the species and immune status of the blood donor. For example, quiescent eosinophils of humans and horses will run at a density equivalent to about _____g/ml, while activated eosinophils are hypodense, and will run as a discrete band at a density of about _____g/ml. Harvest each band into a separate tube. Wash the cells from each band using an appropriate medium for your purposes (e.g., DMEM-10% or RPMI-10%) and count them using a hemocytometer. The cells can be morphologically identified on stained cytocentrifuge preparations.

13

1.2 Isolation of cells from the peritoneal cavities of mice. The serosal (abdominal or peritoneal) cavity of mice is a rich source of macrophages which are easily purified by simply flushing the cavity and performing a plastic adherence step (see §1.4). In this section, we will simply examine the method for lavage of the serosal cavity. Materials BALB/c mouse anaesthetic (methoxyfluorane) clinical centrifuge, 15 ml centrifuge tubes, 4 ml round bottom p.s. tubes 23-25 ga needles & 10 ml syringes pipettes/pipettors (micropipettes and macropipettes) sterile surgical tools (optional, for open body cardiac puncture) laminar flow hood inverted microscope hemocytometer Reagents Ca++Mg++-free-HBSS (HBSS) DMEM-10% FCS (see Appendix A) 70% ethanol cytocentrifuge METHOD 1. Euthanize mouse with methoxyfluorane and cervical dislocation, and then wet its abdomen with 70% ethanol. Fully reflect the abdominal skin dorsally and ventrally, being careful to not tear any holes in the abdominal wall (small holes discovered during step 2 can be clamped off using hemostats). 2. Using a ≈25 ga needle, inject ≈10 ml of HBSS into the peritoneal cavity, through the abdominal wall, and then massage the distended gut to wash the serosal cells into the HBSS. 3. Slowly withdraw the fluid using a ≈23 ga needle on a 10 ml syringe and transfer the wash solution to a 50 ml polypropylene tube. 4. Repeat the wash with another 10 ml of HBSS and pool the two washings. 5. Wash the cells by centrifugation and resuspend to the desired cell density, in the desired medium. Determine the cell numbers using a hemocytometer.

14

1.3 Adherence purification of monocytes or macrophages Monocytes or macrophages can be easily purified by taking advantage of the fact that they adhere rapidly and tenaciously to plastic (polystyrene, but not polypropylene) surfaces. So in this procedure, you will simply take the total mononuclear cell fraction from PBL as well as the total peritoneal lavage population and place the cells into the wells of multi-well microscope slides, a particularly convenient format for the experiments we will be doing. Macrophage adherence ostensibly works much better in the absence of protein (e.g., FCS), so this protocol will be performed using DMEM-0% FCS. Materials/Reagents all materials for purification of mononuclear and PMN from mouse PBL (§ 1.1) or peritoneal macrophages (§1.2) plastic petri dishes or multi-well microscope slides DMEM-0% FCS DMEM-10% FCS METHOD 1. Resuspend the mononuclear or serosal cells at ≈3x106 cells/ml in DMEM-0% FCS and add 300 µl of the cell suspension to each well of the multiwell slide. 2. Incubate the cells at 37˙C in the CO2 incubator for ≈3 h. 3.

4.

Remove the non-adherent cells by repeatedly pipetting the culture medium directly onto the cell monolayer that has formed on the bottom of each well. If you are not thorough enough at this stage, large numbers of lymphocytes will remain with the monocytes/macrophages on the plastic/glass surface. Remove the resuspended, non-adherent cells by aspirating the medium (save the aspirates if you want to retain the monocyte-depleted lymphocyte preparation). Repeat this procedure as needed, monitoring the success of washing by direct visual observation under the inverted microscope. To remove the cells from the plastic, you can either remove the medium from the cells and replace it with 0.02% EDTA in saline, and then transfer the dishes onto ice for 10-15 min. By smoothly scraping the bottom of the dish with a cell scraper, 90 - 95% of the adherent cells will be dislodged as viable cells - wash the cells and resuspend in DMEM-10% FCS. Alternately, the cells can be removed by treating with EDTA and trypsin (this eliminates the need for scraping, but increases the wear and tear on the macrophage surface proteins).

15

5.

To activate the cells in situ, just add LPS to a final concentration of ≈1-10 µg/ml.

16

1.4 Antibody- or C3b-dependent phagocytosis by macrophages In this assay we will explore the potentials for macrophages to specifically interact with cells that have been targeted by the humoral immune system. That is, antibody-coated cells can be phagocytosed or otherwise killed by macrophages that bind the target via the FcγR. We will use the classical example of opsinized (i.e., antibody- [or C'-] coated) sheep red blood cell phagocytosis by purified PBL monocytes. This is the basis for antibody-dependent cellular cytotoxicity (ADCC) by immunoinflammatory cells against multiple types of cellular targets (e.g., tumour cells, bacterial cells, etc...). Materials monolayers of PBL monocytes in 8-well multi-well slides (§ 1.3); or use peritoneal lavage cells from normal or proteose/peptone-injected mice humidified 37˙C CO2 incubator clinical centrifuge & tubes sterile eppendorf tubes Reagents C3b-coated zymosan beads (§5.4.12) 0.5% suspension of SRBC in PBS anti-SRBC-coated SRBC (§5.4.13). normal mouse serum (heat-inactivated at 56˙C for 30 min) DMEM-10% FCS METHOD 1. Take the monocyte/macrophage monolayers, in multi-well slides out of the 37˙C incubator and to pairs of the wells add either 20 µl of either: the antibody-coated SRBC, normal SRBC suspension, C3b-coated zymosan, or 'activated' zymosan suspension. Incubate the cells/slides for 60 min at 37˙C. 2. Remove the slides from the incubator and wash the free SRBC or zymosan from the cultures by resuspending the sedimented cells with your pipetter and aspirating the contents. Examine the cells using the phase contrast condenser of the inverted microscope to determine the extent to which the SRBC/zymosan particles have been internalized by the macrophages (i.e., are very dull by phase contrast) or remain in the extracellular compartment (i.e., are very bright

17

by phase contrast). Return the cells to the 37˙C incubator and periodically check them again to follow the internalization of the particles.

3.

5.

At the end of the experiment, take the well casing from the slide itself and fix the cells by immersion in 100% ethanol for ≈2 min. Allow the slides to air dry, and stain the slides with Giemsa stain (Appendix D). Calculate the mean numbers (+/- SEM) of SRBC or zymosan particles in the macrophages in each treatment group. To do this, you will count the numbers of SRBC contained within 25 macrophages in each of ten 40x microscope fields, for each well on the slide. Perform an ANOVA test to determine the statistical significance of your results, and plot the data (including means, SEM, and probability values) on a graph.

18

1.5 Activation of macrophages with bacterial lipopolysaccharide Monocytes or macrophages can be activated by the addition of many different kinds of reagents (e.g., immune complexes, interferon-γ, bacterial products, etc..). In this protocol, we will use the bacterial cell wall product lipopolysaccharide (LPS) to activate cultures of Pu5-1.8 (Pu5) cells, a murine macrophage cell line; Pu5 cells were one of the original lines used in the cloning of murine TNFα. While we will be using this cell line (in order to save the lives of a number of mice), precisely the same protocol and approximately the same results would be obtained if we were to use freshly purified monocytes or macrophages. Later in the week we will then determine the extent to which you have activated the cells by quantifying their secretion of a number of monokines (i.e., IL-1, IL-6, and TNFα). Materials laminar flow hood humidified 37˙C CO2 incubator subconfluent monolayer cultures of Pu5-1.8 cells in DMEM-10% FCS clinical centrifuge & tubes inverted microscope sterile eppendorf tubes cell scraper -20˙C freezer & freezer bags Reagents bacterial endotoxin, 1 mg/ml DMEM-0% FCS (E. coli lipopolysaccharide; LPS) DMEM-10% FCS (see Appendix A) METHOD 1. Take a look at the growing Pu5 cells under the inverted microscope to get a feeling of how they 'should' look under normal conditions. 2. Using a cell scraper, dislodge the Pu5 cells from the plastic and then transfer them to a 50 ml centrifuge tube. Remove 20 µl of the cell suspension for cell counting with the hemocytometer. 3. While counting the Pu5 cells, sediment them by centrifugation (10 min at ≈1500 rpm in the clinical centrifuge). To resuspend them in fresh DMEM-10% FCS, completely aspirate the supernatant from the tubes, and then very briskly and repeatedly flick the tube with the cell pellet to disperse the pellet. Dispersal will

19

4.

5.

6.

7.

be complete when the pellet has become a paste on the walls of the tube. Add sufficient DMEM-10% FCS to bring the cells to a concentration of 3x106 cells/ml, and then dispense the cell suspension into the wells of 24-well plates, at 1 ml per well. You will need 8 wells of cells (4 wells of unstimulated cells & 4 wells of stimulated cells) for todays experiment, as well as 4 wells which contain medium but no cells (LPS-medium controls) Add LPS (to a final concentration of 10 µg/ml) to the 4 'stimulated cells' wells and to the 4 'LPS-medium control' wells, and an equivalent amount of DMEM to the 4 wells of unstimulated Pu5 cells. Return the cultures to the 37˙C CO2 incubator. Label the eppendorf tubes with your initials, the date, and the sample information (e.g., Pu5 supn't. + [or -] LPS; 1 [or 6, or 24] h). In addition to the supernatants from the cell cultures, save several aliquots of the DMEM-10% FCS that was used for the cultures (as medium controls) At 1, 6, and 24 h post-challenge, examine the cells to get a feeling for whether the LPS has affected them in any visible manner. At each time, also harvest the culture medium from the appropriate wells, centrifuge them for a few minutes at full speed in the microfuge, and then aliquot each one into four eppendorf tubes (200 µl/tube). Store all aliquots in the -20 freezer (long-term storage requires a -80 freezer). At the end of the experiment, place all of the plasticware & cells in the contaminated-discard pan.

20

1.6 Monokine Bioassays: 1.6.1 Assay for IL-1 activity In this assay, we will depend on the property of LM-1 cells (a sub-clone of the ATCC cell line D10.G4) to proliferate in the presence of IL-1. While D10.G4 cells, like thymocytes, proliferate in response to IL-1 in the presence of sub-mitogenic doses of PHA or ConA, LM-1 cells do not need the PHA or ConA to respond to IL-1. Before the assay, the cells are rendered more sensitive to IL-1 by starving them of this cytokine for ≈5-7 days. The cell proliferation will be measured by examining the abilities of the cells in each well of the 96-well plates to take up and reduce the dye MTT to an insoluble blue-black formazan precipitate within their mitochondria. Thus the assays measures the mitochondrial activity of the cells, not the numbers of cells. While this is a very convenient parameter, it carries with it some problems, such as the influence agents that affect mitochondrial activity can have on the results. Materials humidified CO2 incubator 96-well tissue culture plates micropipetters, tips multi-channel pipetter clinical centrifuge, tubes 15 ml 15 ml centrifuge tubes hemocytometer ELISA plate reader (with a 595 nm wavelength filter) Reagents LM-1 cells which have not been fed fresh IL-1-containing medium for 5-7 days, and which were washed and held overnight in Click's-10% FCS without conditioned medium (i.e., IL-1-starved LM-1 cells) Click's-10% FCS without conditioned medium (Click's-10% FCS-CM-) recombinant mouse IL-1 (our present stock soln is at a concentration of 7.5 ng/µl) MTT, (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide), 5 mg/ml in PBS (stable for 2-3 wks at 4˙C) acidified isopropanol (see Appendix C)

21

METHOD 1. Starve the LM-1 cells 4-7 days before assay (feed them fresh conditioned medium some 4-7 days before the assay, and then do not feed them again). The night before the assay, wash the cells in fresh Click's-10% FCS-CM- and leave them in culture overnight. 2. On the day of the assay, resuspend the LM-1 cells to 4X105 cells/ml in Click's10% FCS-CM- and dispense into the 96-well plates at 100 µl/well, using a template pattern similar to the one depicted. 1

2

3

4

5

6

7

8

9

10 11 12

A B C D

standards (pg/ml) 0.5 5.0

50

plate blank (A1-H1) 500

cytokine standards (4 doses) test samples (10/plate)

E F

medium control 'plate-effect' blank w ells

G H

3.

-Do not add any cells to the first column (i.e., wells A1, B1, ..., H1) of each plate, but do add all other reagents (e.g., Click's without IL-1) -- this will be the plate blank. -Do not use the outer wells of the plate for any samples (there is an 'edge-effect' of the plates), but add DMEM-0% FCS to these wells. -Always include a medium-only control (i.e., the same medium as that used for the experimental treatments, but which has not been exposed to the experimental cells). Use the same volume of experimental medium as that used in the test samples wells -- if you have multiple doses of test samples, use equivalent multiple doses of medium controls. -In this format, one plate will accept 10 experimental samples, each done in quadruplicate. Add 80 µl of Click's-10% FCS-CM-, and 20 µl of appropriately diluted rmIL-1 standard (like all samples and standards, in quadruplicate sets of wells) to a series of wells to achieve final doses of 0.5, 5.0, 50 and 500 pg/ml (see Appendix D, Generation of standard curves).

22

4.

In parallel sets of quadruplicate wells, run samples (LPS-stimulated Pu5 cell culture supernatants) and medium controls (DMEM-10% FCS + 10 µg/ml LPS) at required volumes (usually 5-20 µl/well). Bring the final volume of each well to 200 µl with Click's-10% FCS-CM-, and return the cells to the 37˙C humidified CO2 incubator for 3 - 5 days.

5.

To measure the extent of the IL-1-driven LM-1 cell proliferation in each well, use the micropipetter to add 20 µl of MTT stock solution (5 mg/ml) to each well, and then return the plates to the humidified 37˙C CO2 incubator for 1 - 2 h.

6.

(Optional: centrifuge the plates for 10 min at 1500 rpm to sediment cells.) Carefully remove 150 µl of medium from each well in the plate, and add 100 µl of acidified isopropanol to each well. Agitate the plates on the ELISA plate shaker for ≈3 minutes, and then read the plates on the ELISA plate reader, set at a reading wavelength of 595 nm. Download the data to a 3-1/2" Macintoshformatted floppy disc. Use the Microplate manager program to crunch your data, and Statview+ to perform the statistical analyses. Plot your results as a bar graph (+/- SEM) using the Cricket III program provided.

7.

23

1.6.2 Assay for IL-6 activity Like the IL-1 assay, the IL-6 assay depends on the fact that 7TD1 cells proliferate strongly in response to low concentrations of IL-6. Again, we will measure this response using the MTT dye method. Materials humidified CO2 incubator 96-well tissue culture plates micropipetters, tips multi-channel pipetter clinical centrifuge, tubes 15 ml 15 ml centrifuge tubes hemocytometer ELISA plate reader (with a 595 nm wavelength filter) Reagents 7TD1 cells in RPMI-10% FCS supplemented with rhIL-6 (80 pg/ml) RPMI-10% FCS (see Appendix B) recombinant human IL-6 (rhIL-6; our stock solution is at 100 ng/ml) MTT (5 mg/ml in PBS) acidified isopropanol METHOD 1. Wash the 7TD1 cells two times in RPMI-10% FCS, and resuspend to a concentration of 2.5x104 cells/ml in RPMI-10% FCS. 2. Add 100 µl of cells to each well in plate, using the same or a similar sample plate format to that indicated in §1.5.1 (IL-1 assay). 3. Add cytokine standards (2.5, 25, 250 & 2500 pg/ml final concentration) in 20 µl of RPMI-10% FCS, and add your samples and experimental medium controls in appropriate volumes. In this assay, we will use 1.0, 2.0, and 5.0 µl of the LPSstimulated Pu5 cell culture supernatants, so you will need three sets of 'medium controls', each containing 1.0, 2.0 or 5.0 µl of DMEM-10% FCS supplemented with 10 µg/ml of LPS. 4. Return the plates to the 37˙C CO2 incubator for 3 days. 5.

After 3 days, add 20 ul of MTT solution (5 mg/ml) to each well (including plate blank wells), and return plates to the incubator for ≈1-2 hr. When the

24

6. 7.

mitochondria in each of the cells are plainly visible at 40x magnification, centrifuge the plates and remove 150 µl of medium from each well. Add 100 µl of acidified isopropanol (lysis buffer) to each well, vortex vigorously in the ELISA plate shaker for ≈3 min, and then leave the plates on your bench overnight. The next morning, read the plates at 595 nm wavelength on the ELISA plate reader and download the data to a 3-1/2" Macintosh-formatted floppy disc. Use the Microplate manager program to crunch your data, and Statview to perform the statistical analyses. Plot your results as a bar graph (+/- SEM) using the Cricket III program provided.

25

1.6.3 Cytotoxicity assay for TNFα bioactivity TNFα activity is usually detected using a cytotoxicity assay. L929 cells (or at least many of its sub-lines) are sensitive to TNFα such that this cytokine kills the cells over ≈18 h. However, the cytotoxic effects of this cytokine are markedly diminished by the presence of other proteins (e.g., FCS), so that as much as possible, the assay should be run the absence of other proteins. Finally, L929 cells are most sensitive to the effects of TNFα when the assay is run in the presence of a low levels of a transcription inhibitor (e.g., actinomycin D). Materials humidified CO2 incubator 96-well tissue culture plates micropipetters, tips multi-channel pipetter clinical centrifuge, tubes 15 ml 15 ml centrifuge tubes hemocytometer ELISA plate reader (with a 595 nm wavelength filter) Reagents L-929 cells in DMEM-10% normal horse serum (NHS). DMEM-0% NHS recombinant murine TNFα standards (diluted as in Appendix D) Actinomycin-D (stock 5 mg/ml in 95% ethanol) MTT (5 mg/ml PBS) Acidified isopropanol (lysis buffer) METHOD 1. On the day before the assay, harvest L929 cells from a flask by trypsinization (remove DMEM-10 % NHS medium and add DMEM-0% NHS medium. Add ≈4 - 5 drops of 1% trypsin/≈10 ml of medium and allow the typsin to digest the cells off of the plastic. This process can be expedited by watching the cells and, when they are beginning to lift well, but many still remain attached, forcefully slapping the flask down on your thigh. All cells will be dislodged instantaneously.

26

2.

Wash the dislodged cells in DMEM-10% NHS medium, resuspend them to 4.5x105 cells/ml, and dispense 70 µl to each well of a 96-well plate (for plate format, see §1.5.1; IL-1 assay). Return plate to the 37˙C CO2 incubator.

3.

The next day, just prior to running the assay, remove all of the serum-containing medium from the wells by inverting the plate and vigorously flicking it. Add 180 µl of DMEM-0% NHS containing 2.5 µg/ml of actinomycin D (i.e., a 2000-fold dilution of the stock Act D). Add TNFα standards (0.04, 0.4, 4.0 and 40 units/well), control medium, and experimental samples (LPS-stimulated Pu5 cell supernatants & controls) to their appropriate wells, each in a 20 µl total volume, so that the total well volumes equal 200 µl. Return plate to the 37˙C CO2 incubator overnight.

4.

5. 6.

7.

8.

The next day, examine the cells under the inverted microscope to get a feeling for the relative levels of L929 cell death in each well. Add 20 µl of MTT (5 mg/ml PBS) to each well (including plate blank wells), and again return the plates to the incubator. After 45 - 60', re-examine the cells to confirm that adequate levels of MTT conversion to formazan dye have occurred in the mitochondria (see §1.5.1, IL-1 assay) and then remove 150 µl of medium from each well in the plate and replace it with 100 µl of acidified isopropanol. Vortex the plates on an ELISA plate shaker to solubilize the formazan dye, and read the plates on the ELISA plate reader at 595 nm wavelength. Calculate the cytotoxicity in each of the wells using the formula: percent cytotoxicity = mean OD590 medium control wells - OD590 experimental well x 100 mean OD590 medium control wells

9.

Calculate the mean (+/- SEM) cytotoxicities for the standards and each treatment group, express them in terms of units (+/- SEM) of TNF activity (a unit of TNF activity is that amount of cytokine required to kill 50% of the cells in the assay) and graph your results. Perform a statistical analysis to confirm that your results are meaningful.

27

1.7. Neutrophil chemotaxis assay Neutrophils are attracted in large numbers into inflammatory foci (e.g., loci of C' cascade activation, bacterial infections), where they are important to the clearance of bacteria or other insults both by virtue of their abilities to phagocytose the offenders, as well as through their toxic secretory products. These cells have receptors for an array of chemoattractants, including bacterial products (e.g., formyl-methionyl-leucyl-phenylalanine; fMLP), complement split products (e.g., C3a, C5a), and an array of chemokines (e.g., IL-8 or CINC in rodents). For this exercise, we will purify neutrophils from the peripheral blood of mice as in §1.1, then use these cells to study the chemoattractant activities of fMLP and C3a/C5a (i.e., zymosan-activated serum;§5.4.11 ), as represented in zymosan-activated sera (i.e., C3a, C5a).. Materials humidified CO2 incubator microchemotaxis chamber (NeuroProbe Inc) PVP-free (PVPF) polycarbonate cell migration filters (5 µm pore size; Millipore or NeuroProbe) micropipetters, tips purified peripheral blood granulocytes Reagents DMEM-0% FCS media Ca/Mg--HBSS f-met-leu-phe bacterial tripeptide zymosan-activated serum (§ 5.4.11) interleukin 8 (or CINC) METHOD 1. Generate a neutrophil-rich population from the peripheral blood, using dextran sedimentation (or if your experiments require purified cells, percoll-purified neutrophils), adjusting the population to a final concentration of 2x106 cells/ml of HBSS. 2. Prepare the chemoattactants for use in the assay, allowing approximately 30 µl of each chemoattractant dilution. Dilute the zymosan-activated serum (ZAS) to final concentrations of 1:10, 1:100; 1:1000, and 1:10000; the fMLP to final

28

3.

4.

5.

6.

7.

8.

concentrations of 10-6, 10-7, 10-8, 10-9, and 10-10 M; and the recombinant IL-8 to concentrations ranging from 50 pg/ml to 1000 ng/ml. Putative chemoattractant-containing biological samples should be diluted to 1:10, 1:20, 1:40, 1:80 and 1:160, as first estimates with unknowns. To the bottom chamber of each well (samples should be run in duplicate, if not quadruplicate) add sufficient chemoattractant to completely fill the wells (do not overfill them, as interwell smearing of chemoattractant may occur when placing the polycarbonate membrane is step 4 -- a very slight convex surface to the sample is ideal). Place the PVPF-free Nucleopore membrane (shiny side up) on top of the wells, being careful not to smear the chemoattractants between wells. (PVPcontaining membranes will not retain cells that migrate completely through the pores in the assay, allowing them to drop off the membranes into the bottom chambers after completely traversing the porous membranes - thus, a complete assessment of the chemotactic response with these membranes would require enumerating the cells associated with the membranes, as well as those in the lower chambers.) Place the plastic gasket on top of the membrane, and the top half of the apparatus on top of the gasket and firmly screw the lug-nuts down, such the a tight seal is created in each well. Add 50 µl of the responder cell population to each well, being careful to not generate air bubbles which will create an air-lock on top of the membranes (and thereby exclude cells from the membranes). Put the tip of your pipette just at the surface of the Nucleopore membrane, without contacting it, and quickly expel the 50 µl of chemoattractant - with a bit of practice, this will become easy for you. Place the chambers in a plastic dish containing damp paper towels in the 37˚C CO2 incubator, allowing 90 min for the neutrophils to respond to the chemoattractants. Eosinophils also respond in this time frame (i.e., ≈90 min) while monocytes and lymphocytes will call for 2.5-4 hr incubation times to respond. Upon completion of the incubation period, disassemble the apparatus and carefully clamp the ends of the membrane with "bull-dog" or other suitable clamps, then remove the cells which settled onto the upper surface of the membranes in each well by scraping the upper surface across a scraper (e.g., a fairly sharp-edged glass microscope slide clamped into a ring-stand clamp).

29

9.

Allow the membrane to air-dry, then stain with a suitable staining solution (e.g., Diff-Quick). After air-drying again, the membranes can be dipped in xylene to "clear" them and mounted in "Permount" or other mounting medium on glass slides. Mount the membranes with the bottom side of the membranes uppermost, so that the cells which have migrated completely through the membranes are most apparent. The nuclei of the cells that are still within the membrane pores will be visible as dark blue or purple shapes within the otherwise clear-tolight purple pores. 10. Count the cells with have migrated completely through the membranes, as well as those within the pores

30

1.8. FcεRI-dependent activation of mast cells Mast cells are found in increased numbers at the host's interface with its environment (e.g., skin, airways, intestinal tract) and seem to subserve a number of obvious functions (e.g., allergen-reactivity), but also perhaps some less obvious ones. For this class, we will take advantage of the fact that they produce very high levels of some cytokines and use them as a positive control for some of our experiments. Cl.MC/C57.1 cells produce higher levels of IL-4 than purified, fully differentiated Th2 lymphocytes, and higher levels of TNF than LPS-stimulated macrophages. Mast cells can be activated by cross-linking (i.e., bridging) adjacent FcεRbound IgE molecules on the cell surface, so in these experiments we will sensitize some Cl.MC/C57.1 cells with a monoclonal IgE anti-DNP antibody, and then challenge with DNP-conjugated human serum albumin (DNP30-40HSA). 7 The 2 hour supernatants from these cells will contain abundant TNFα, and the cells will contain very high levels of TNFα mRNA. Materials humidified CO2 incubator T75 flasks hemocytometer micropipetters, tips clinical centrifuge, tubes 15 ml polypropylene 4 ml culture tubes Reagents DMEM-10% FCS media Cl.MC/C57.1 cells in DMEM-10% FCS. MAb IgE anti-DNP (ascites fluid; use at 1:3000 for Cl.MC/C57.1 cells). DNP30-40HSA(stock solution, 1 mg/ml; use at 50 to 100 ng/ml). METHOD

7

Expression of the FcεRI is inducible in mast cells, and this is at least in part regulated the concentrations of exogenous IgE, such that in the presence of high concentrations of IgE, mast cells express more IgE receptors. Thus, freshly purified tissue mast cells, which will likely have the vast majority of their existing FcεRI occupied by IgE antibodies of irrelevant specificities, can be best sensitized with IgE of the desired specificity by incubating the cells overnight in high concentrations of the antibody.

31

1.

2.

3.

Obtain some Cl.MC/C57.1 cells and adjust the cell concentration to 3 X 106 cells/ml. You will only need ≈0.5 ml of mast cell supernatant/time point, so set up ≈3 ml of cells (i.e., 9x106 cells in 3 ml). Add MAb IgE anti-DNP to the tube of C57 cells to a final IgE dilution of 1:3000, and incubate the cells for 30 - 60' at room temperature in order to saturate the cells' high affinity IgE receptors. Wash the cells two times with DMEM-10% FCS and resuspend them again at 3x106 cells/ml. Bring the cells to 37˙C by placing them in a water bath. Add DNP30-40HSA to the cells to a final concentration of 10 ng/ml and place the tubes upright and lightly capped in the 37˙C CO2 incubator for 15 - 20 min to allow them to gas (i.e., exchange CO2 into the tube). After this, cap the tubes tightly and lay them on their side in the incubator (or use a slowly moving rotator at 37˙C).

4.

At each of the indicated times after allergen challenge (i.e., 0.5, 1, 2, and 4 h), remove a tube of cells from the CO2 incubator and sediment the cells by centrifugation (≈8-10' @ 1500 rpm), and then aliquot the supernatants into labelled eppendorf tubes (100 µl/tube). Freeze the aliquots at -20C (or -80C for longer term storage). The cells can be either discarded (as in our first Cl.MC/C57.1 experiment), fixed (e.g., for our in situ hybridization experiments), or processed for total cellular RNA extraction (e.g., our Northern analysis experiments).

32

2.0 ANTIBODIES: PURIFICATION & CHARACTERIZATION: In the second week of the course, we will grow up anti-mouse CD4 and antimouse CD8 monoclonal antibody-producing hybridoma cell lines, purify the IgG antibodies from the anti-CD4 cell culture supernatants by affinity chromatography, and analyse the purified antibodies and total culture supernatants by polyacrylamide gel electrophoresis and Western blotting. We will then functionally characterize the antibodies by using them for negative selection of CD4 and CD8 cells from mouse splenocyte populations. We will follow the success of depleting each of these populations using two-colour fluorescence activated cell sorter (FACS) analysis of the spleen cells.

2.1 Hybridoma cell culture with production of monoclonal antibodies Materials T75 tissue culture flasks clinical centrifuge and 50 ml polypropylene tubes Reagents GK1.5 (anti-CD4) and TIB 211 (anti-CD8) hybridoma cells RPMI-10% FCS METHOD 1. Set up two T75 (i.e., 75 cm2) tissue culture flasks, one each for the TIB 211 and GK1.5 cells. Start each flask as a ≈40 ml culture, at a cell density of ≈105 cells/ml of RPMI-5% FCS medium. 2. Allow the cells to continue growing until the medium has gone completely yellow (acidic) and the cells have essentially all died (about 5 - 7 days; terminal cultures). 3. Collect the supernatant from each flask and centrifuge it for 15 min at 12,000 rpm in the RC-5B superspeed centrifuge to sediment all particulate matter. 4. Aliquot the supernatants and either process expeditiously or store at -20˙C or 80˙C (for longer-term storage).

33

2.2 Affinity purification of IgG antibodies 2.2.1 Avid-AL affinity chromatography AVID-AL is a popular new matrix with a natural affinity for IgG from a wide array of species, including rat. Thus, we will use it to purify the rat anti-mouse CD4 IgG antibodies from the GK1.5 hybridoma supernatants. Briefly, we will pour minicolumns of the Avid-AL matrix and run the hybridoma supernatants over the columns, thereby binding the IgG antibodies to the matrix. Following a washing step to remove the non-specifically bound proteins, we will elute the IgG using a low pH buffer, neutralize the eluate, dialyse it against PBS and concentrate it if necessary. Materials T75 tissue culture flasks clinical centrifuge and 50 ml polypropylene tubes AVID-AL IgG affinity column matrix 10 ml polyprep column, or 5-10 ml syringe and glass wool dialysis tubing centrifugal concentrators (e.g., Centricon tubes) Reagents AVID-CHROM Ig pure kit for purification of IgG -column binding buffer (>1M proprietary salt) -neutral elution buffer (1M Tris [pH 7.4], 20% glycerol) -regeneration buffer (buffered methanol) GK1.5 (anti-CD4 hybridoma) cells in RPMI-10% FCS PBS METHOD 1. Collect the supernatant from a 4 day culture of GK1.5 cells (see §2.1) and centrifuge it for 15 min at 2,500 rpm in clinical centrifuge to sediment all particulate matter, and then filter the supernatant through a 0.45 µm filter. pH the supernatant to 7.2 - 7.4. 2. Set up the affinity matrix column by pipetting ≈1.5 ml of a 50% matrix slurry into a 15 ml centrifuge tube and add ≈10 ml of regeneration buffer (methanol). Shake the tube vigorously to disperse the matrix and then sediment the matrix by

34

3.

4.

5.

6.

centrifugation. Resuspend the matrix in ≈5 ml of binding buffer and pour this into a polyprep column. Wash the column with ≈10 ml of binding buffer. Dilute the hybridoma culture supernatant fluid with 2 volumes of binding buffer (to bring the final salt concentration to ≈500 mM), and then run the supernatant through the affinity column matrix several times to saturate the IgG binding capacity of the matrix. Wash the matrix with ≈15 - 20 ml of binding buffer, or until the phenol red from the culture supernatant fluid has leached from the matrix (it will turn from a brown to the lime-green colour). Elute the IgG from the column by running 4 - 5 ml of the neutral elution buffer (1 M Tris [pH 7.5], 20% glycerol) through the column, collecting the eluate into one tube. Regenerate the column with ≈10 ml of regeneration buffer, and store in either binding salt (very short term storage; salts will precipitate with long term storage) or PBS (for longer term storage). Dialyse the elute IgG overnight against three changes of PBS (≈1 liter ea.). After dialysis, determine the protein concentration of the eluted IgG solution using a Coomassie Brilliant Blue (AKA Bio-Rad or Bradford) protein assay (Appendix D) and, if necessary, concentrate the eluted protein using a centrifugal concentrator.

35

2.2.2 Protein A-Sepharose affinity chromatography Protein A from Staphylococcus aureus (Cowan strain) is a molecule with a very high affinity for IgG antibodies, and has been used for several decades as the protein of choice to purify these antibodies. We will use recombinant protein A bound to dextran beads (Sephadex-G50), but in the past people have used the bacteria themselves (fixed, of course) as affinity matrices for this purpose. In general, IgG1 antibodies will only bind to protein A at pH 8.0, while IgG2a and other IgGs will do so a more physiological pH (i.e., pH 7.2) as well as pH 8.0. The elution pH optima of IgG from the protein A columns is isotype-specific, with IgG1 elution being best performed at pH 6.5, IgG2a at pH 4.5, and IgG3 at pH 3.0 (the least hostile or acidic elution conditions available should be employed to prevent acidic hydrolysis of the antibodies) Materials protein A-Sepharose (Pharmacia, or Sigma) clinical centrifuge and 50 ml polypropylene tubes 10 ml polyprep column, or 5-10 ml syringe and glass wool spectrophotometer or UV monitor (equipped for reading OD 260) dialysis tubing Reagents 0.1 M citric acid (pH 4.5) supernatant from a terminal culture of GK1.5 (rat IgG2a anti-CD4 hybridoma) cells PBS (pH 7.2) PBS/20% ethanol 1M Tris (pH 9.0) METHOD 1. Filter the GK1.5 culture supernatant through a 0.45 µm filter and pH it to 7.2 - 7.4. 2. Pipette ≈1 ml of the protein A-Sepharose 50% matrix slurry into the column and wash it with several column volumes of PBS. 3. Run the GK1.5 culture supernatant through the column matrix several times to saturate the IgG binding capacity of the protein A. 4. Wash the column with PBS until no more protein elutes from the column, using a spectrophotometer or UV monitor (OD 260) to confirm the end-point.

36

5.

6.

7. 8.

Elute the IgG from the column by running ≈10 ml of the 0.1 M citric acid elution buffer through the column, collecting the eluate into one milliliter fractions (i.e., 1 ml/tube). In order to minimize the time that the antibodies remain in an acidic environment, we will elute the column directly into 1 M Tris buffer (pH 9.0). Determine the protein contents of the eluted fractions by either determining the OD260 of the fractions, or by use of a protein assay (e.g., Coomassie Brilliant Blue [a.k.a. Bio-Rad, Bradford or CBB] protein assay; Appendix D), and pool the protein-containing fractions. Regenerate the column with ≈10 ml of PBS, and store the matrix in PBS/20% ethanol. Dialyse the eluted IgG overnight against three changes of PBS (≈1 liter ea.). After dialysis, determine the protein concentration of the eluted IgG solution using a and, if necessary, concentrate the eluted protein using a centrifugal concentrator.

37

2.3 Preparation of IgM antibodies IgM antibodies do not adhere well to most of the available immunoglobulin affinity matrices (e.g., protein A, T gel, Avid-Chrom), so alternate methods must be employed to prepare IgM antibodies. A number of methods are available, with the simplest true purification probably being achieved by size exclusion chromatography (IgM pentamers have a molecular mass of ≈750 kD, while IgG and albumin have molecular masses of 150 & 65 kD, respectively). In this session, we will simply enrich for IgM antibodies by differentially "salting out" the IgM protein with ammonium sulfate. High concentrations of ammonium sulfate will cause the proteins in a solution to differentially precipitate out from their solubilized state - at 30% ammonium sulfate saturation, most of the IgM antibodies will precipitate out of solution, while at 45% saturation most of the IgG isotypes and the residual IgM antibodies will precipitate out of solution. Materials beaker and stir bar clinical centrifuge & tubes dialysis tubing 0.45 µm filters pH meter and pH reagents stir plate syringe and 20 ga needle Reagents culture medium from a terminal culture of TIB211 (IgM anti-CD8) hybridoma cells saturated ammonium sulfate solution borate-buffered saline Method 1. As with the IgG purification, generate a 4-day TIB211 hybridoma culture supernatant, sediment the particulate matter by centrifugation, then filter and pH the supernatants as in §2.2. 2. Place the supernatant in a beaker on a stir plate and drip saturated ammonium sulfate into the supernatant, while constantly stirring, to a final ammonium sulfate concentration of 30% (i.e., 0.5 volumes of ammonium sulfate into 1

38

3.

4.

5.

volume of antibody). Use a syringe and 20-23 ga. needle (as required) to drip the ammonium sulfate into the antibody culture supernatant, drop-by-drop. After the 30% ammonium sulfate has precipitated the available proteins in the hybridoma supernatants, allow the stirring to continue for an additional 30 min, then sediment the precipitate by centrifugation (15 min at 2500 rpm). Return the supernatant to the beaker and continue dripping ammonium sulfate into the supernatant to a final ammonium sulfate concentration of 45%, and then sediment that as in step 3. Dissolve the precipitated proteins in borate-buffered saline, dialyse overnight versus an excess of borate-buffered saline, determine the protein concentration using a CBB assay and aliquot and freeze.

39

2.4 Analysis & characterization of immunoglobulins In this section, we will take the anti-CD4 IgG that you have purified, as well as the TIB211 anti-CD8 IgM antibodies and characterize them according to their size (molecular mass) and reactivity with anti-IgG and -IgM antibodies. We will use polyacrylamide gel electrophoresis (PAGE) for the former, and Western blotting for the latter. 2.4.1 Polyacrylamide gel electrophoresis of immunoglobulins PAGE is a powerful technique for confirming the presence of proteins in solutions, although it is lacks the specificity of Western blots in identifying the proteins (beyond their molecular weights). However, it is an ideal method to confirm the homogeneity or lack thereof of purified proteins. Materials PAGE mini-gel apparatus and power pack Reagents Commercial acrylamide/bisacrylamide solution (40% acryl/0.8% bisacryl) Commercial separating and stacking gel buffers ammonium persulfate 10% solution (freshly prepared) isobutyl alcohol (H2O-saturated) PAGE 2x sample prep buffer (for denaturing & reducing the samples) PAGE 5x SDS/run buffer (dilute 1:5 with H2O before use) PAGE gel fix solution (25% isopropanol, 10% acetic acid) rapid Coomassie blue stain (0.006% Coomassie Brilliant Blue G-250 in 10% glacial acetic acid) protein samples biotinylated molecular weight markers (for Western blots) unstained molecular weight markers (for protein staining gels) METHOD 1. Clean the glass plates and gaskets, and assemble the PAGE apparatus. Place a mark on the glass at the 6 cm mark (from the bottom). 2. Mix together in a side-arm flask, 3.9 ml of the acrylamide/bisacrylamide solution, 3.75 ml of the separating gel buffer, and 7.2 ml of H2O. Degas the solution under vacuum for 10 - 15 min. Add 150 µl of ammonium persulfate, and mix once again by swirling gently, and pour the acrylamide separating gel mixture

40

into the PAGE apparatus up to the 6 cm mark, and then overlay the mixture with H2O-saturated isobutyl alcohol. Allow the PAGE gel reagents to polymerize, 3.

4.

5.

6. 7.

8.

8

and then pour off the alcohol overlay and rinse the top of the gel with water. In another side-arm flask, mix together 0.5 ml of the acrylamide/bisacrylamide solution, 4.5 ml of the stacking gel buffer, and degas the solution under vacuum for 10 - 15 min. Add 25 µl of ammonium persulfate, and mix once again by swirling gently, and pipette this solution on top of the polymerized separation gel. Immediately place the well-forming comb in place, with the teeth submersed in the stacking gel solution. Allow the stacking gel to polymerize, and then remove the comb from the top of the stacking gel. Attach the gels/plates to the electrode frame and seal the seams with agarose. Place this assembly into the PAGE run reservoir and fill the reservoir and top of the gel assembly with PAGE run buffer. Prepare samples for the PAGE run while the stacking gel is polymerizing. To do so, mix the protein sample 1:1 with sample prep buffer 8 in an eppendorf tube and place in a boiling water bath for 5 min 9. Remember to run the appropriate molecular weight markers 10, 11. Pulse microfuge the tubes to sediment samples and hold on ice until running them on the gels. Carefully pipette each sample into a well of the gel. 12 Run the gel at 150 volts until the bromophenol blue dye front reaches the bottom of the gel. Turn off the power, disassemble the PAGE gel apparatus. Incubate the gel for 10 - 15 min in isopropanol fix solution, stain it in the rapid Coomassie brilliant blue for 2 h to overnight at room temp, and then destain in several changes of 10% glacial acetic acid over 5-8 h. For permanent storage, the gel can be dried down using a commercially available drying apparatus.

For non-reducing conditions, the sample prep buffer does not contain 2-mercaptoethanol, while for reducing condtions, the buffer should contain ≤10% 2-mercaptoethanol. 9 Load the proteins such that individual protein bands should contain ≈1-2 µg of protein. For complex mixtures of proteins, you will need to run greater amounts of protein in order to visualize the multiple bands in the samples. Thus, for protein A-purified IgG, you could run only 1-2 µg, while for ammonium sulfate precipitated IgM-containing culture supernatants, you would need to run perhaps 20 µg of protein. 10 Unstained molecular weight markers from Gibco/BRL will contain ≈1µg of each marker protein per µl of solution, so that loading 5 µl of marker mix will give you 5 µg of each band in the mixture. 11 For Western blots which are to be probed with an avidin-alkaline phosphatase detection system, load 1.5 µl of marker mix/lane (i.e., a ≈1:20 final dilution of the mix). 12 The wells of the gels will be able to hold ≈30 µl of sample/sample prep buffer

41

2.4.2 Western blotting to detect immunoglobulins In Western blotting, proteins that have been fractionated on PAGE gels are electrophoretically transferred to nitrocellulose or other types of membranes (e.g., derivatized nylon), to which they may differentially bind, and then the protein bands on the membranes are visualized immunochemically, using alkaline phosphatase- or horse radish peroxidase-labelled antibodies and appropriate chromogens. Western blotting is a very sensitive method of detecting proteins to which antibodies already exist. Materials Western blotting transfer apparatus (wet) Whatman #1 filter paper nitrocellulose transfer membrane (do not handle with bare hands) Reagents PAGE gel with separated proteins to be transferred (unfixed) Western blotting transfer buffer TTBS (Tris-buffered saline with 0.1% Tween 20) TTBS-5% Carnation skim milk powder PBST (PBS with 0.05% Tween 20) bromo-chloryl-indoyl phosphate/nitroblue tetrazolium (BCIP/NBT) substrate streptavidin-alkaline phosphatase conjugate (strep-AP; diluted 1:5000 in PBST)

METHOD 1. Equilibrate the gel after electrophoresis to Western blot transfer buffer by incubation for ≈45 min. Also equilibrate a sheet of nitrocellulose (cut to the same size as the half the gel to be used for Western blotting) to the same buffer. 2. Transfer the gel to the gel blotting bracket, such that the gel is sandwiched immediately next to the nitrocellulose (with no air bubbles between the two) and both are sandwiched between two sheets of filter paper, with two 'brillo' pads flanking the filter paper. This arrangement of gel, nitrocellulose membrane and pads (depicted below) is clamped between the Western blotting electrodes such that the gels is on the negative electrode side and the nitrocellulose is on the positive electrode side (the proteins will be negatively charged due to the SDS in the PAGE sample prep buffer).

42

'brillo' pads negative electrode

-

Whatman #1 filter paper PAGE gel

+

nitrocellulose ASSEMBLED TRANSFER ASSEMBY

3.

4. 5.

6.

7.

8.

positive electrode

Set the gel assembly in the gel apparatus, fill it with transfer buffer and then move the whole apparatus to the cold room. Run the transfer at 100 volts for 23 h (IgM may migrate through the nitrocellulose membrane in 3 h). Disassemble the transfer assembly and stain the gel as in §2.4.1. Transfer the nitrocellulose membrane into a large weigh boat containing 15 ml of TTBS-5% Carnation skim milk powder for 2 h to overnight to block the non-specific binding of other proteins to the nitrocellulose membrane. Wash the membrane two times for 5 min each with PBST and place the blot into 15 ml PBST containing biotinylated rabbit anti-rat IgG and IgM (1:1500 final dilution) for 60 min at room temperature. Wash the blot three times 5 min in PBST and place the blot in 15 ml of PBST containing a 1:5000 final dilution of streptavidin-alkaline phosphatase conjugate for 90 min at room temperature. Wash the blot three times 15 min in H2O, and then transfer into 15 ml of freshlyprepared TMS -BCIP/NBT mixture. (To prepare the BCIP-NBT substrate: to 5 ml of 0.1 M Tris (pH 9.5), 0.1 M NaCl, 0.05 M MgCl2, add 22 µl BCIP; mix by inverting then add 16.5 µl NBT and again mix). Incubate for 30 - 40 min until the bands become well-defined, and then wash the blot with H2O and air dry.

9.

Plot the relative migration distances of each of the molecular weight marker proteins on a graph, and use the plot and the migration distances of the bands in the IgG and IgM lanes to interpolate the relative molecular weights of the proteins detected, and thereby confirm their identities.

43

3.0 T CELL AND B CELL RESPONSES: 3.1 C'-dependent depletion of CD4+ and CD8+ T Cells In this exercise, we will learn how to deplete selected populations of cells from a heterogeneous mixture of cell types. Specifically, we will use anti-CD4 or anti-CD8 antibodies and C'-dependent cytotoxicity to deplete all of the CD4+ or CD8+ cells, respectively, in a single cell suspension of mouse splenocytes. We will confirm this depletion by using commercially available fluorescein-labelled anti-CD4 and phycoerythrin-labelled anti-CD8 antibodies to stain the residual cell populations and then we will analyse the composite phenotype of these cells using two-colour FACS (fluorescence-activated cell sorter) techniques. Materials single cell suspension of mouse splenocytes (at 1x107 cells/ml; Appendix D) clinical centrifuge and 4, 15 and 50 ml polypropylene tubes Reagents GK1.5 (anti-CD4 hybridoma) cell supernatants (from a 2-4 day culture) TIB211 (anti-CD8 hybridoma) cell supernatants (from a 2-4 day culture) purified GK1.5 IgG antibodies purified HB121 IgG antibodies (control IgG; specificity: mouse IgG1 anti-human IgE) fluorescein-labelled anti-mouse CD4 IgG antibodies phycoerythrin-labelled anti-mouse CD8 IgG antibodies Low-tox rabbit C' (Cedar Lane) METHOD 1. Label and set up a series of tubes to receive reagents as follows: LABEL

CELLS

ANTIBODY (µg/ml)

COMPLEMENT (µl)

no Ab, no C'

100

0

0; medium only

HB 121 (control)

100

10

100

GK1.5 supn't

100

10

100

GK1.5 IgG

100

10

100

100

1.0

100

100

0.1

100

44

TIB211 supn't

100

10

100

TIB211 IgM (30% AS)

100

10

100

100

1.0

100

100

0.1

100

100

10

100

100

1.0

100

100

0.1

100

TIB211 IgM (45% AS)

2.

3.

4.

5.

6.

Add 100 µl of the splenocyte suspension (i.e., 106 cells) and 100 µl of appropriately diluted antibody (10, 1.0 or 0.1 µg protein from the HB121, GK1.5, or TIB211 preparations) to each tube. Incubate the cells with the antibody for 30 min at room temperature. Add 100 µl of the guinea pig complement to each tube, and incubate the tubes at 37˙C for 30 min. Wash the cells two times with DMEM-10% FCS (8 min at 1500 rpm in the clinical centrifuge). Resuspend the cells to 100 µl in DMEM-10% FCS, and add 3 µl of FITC-labelled anti-CD4 and 3 µl of PE-labelled anti-CD8 IgG to each tube and incubate the cells on ice for 30 min. Wash the cells once more with an excess of DMEM-10% FCS and resuspend to 100 µl with DMEM-10% FCS. Add 100 µl of 1% paraformaldehyde and fix the cells on ice for 30 min, then wash the cells one time with PBS and resuspend to 100 µl with PBS. Store the cells in the refrigerator overnight, for FACS analysis the next day.

45

3.2 MACS purification (or depletion) of CD4+ and CD8+ T Cells In this complementary exercise, we will learn how to use antibody-coated paramagnetic beads that are specific for the isotypes of the anti-CD4 and anti-CD8 antibodies that you generated in §2.1 to purify all of the CD4+ or CD8+ cells, respectively, from a single cell suspension of mouse splenocytes. The real advantage of this system is that the selected populations are not killed or otherwise damaged by the isolation procedure, so that it may be possible to use them for functional studies after the purification procedure -- this is what we do in our lab to purify mast cells from tissues. The potential disadvantage is that in some cases the cell surface marker employed may well, by itself, activate or otherwise alter the physiology of the cells (e.g., anti-CD3 antibodies may activate T cells). We will confirm our depletion by using commercially available fluorescein-labelled anti-CD4 and phycoerythrin-labelled antiCD8 antibodies to stain the residual cell populations and then we will analyse the composite phenotype of these cells using two-colour FACS (fluorescence-activated cell sorter) techniques. Materials single cell suspension of mouse splenocytes (at 1x107 cells/ml; Appendix D) clinical centrifuge and 4, 15 and 50 ml polypropylene tubes Mini-MACS separation column (type MS; capacity 107 positive cells/column) Mini-MACS column magnet (Miltenyi Biotec Gmbh) Reagents GK1.5 (anti-CD4 hybridoma) cell supernatants, purified IgG (§2.1) TIB211 (anti-CD8 hybridoma) cell supernatants, ammonium sulfate ppt. IgM (§2.1) PBS (pH 7.2), containing 5% FCS & 2 mM EDTA (PBS/EDTA) mouse anti-rat IgG-conjugated paramagnetic beads (Miltenyi Biotec) mouse anti-rat IgM-conjugated paramagnetic beads (Miltenyi Biotec) fluorescein-labelled anti-mouse CD4 IgG antibodies phycoerythrin-labelled anti-mouse CD8 IgG antibodies METHOD 1. Label and set up a series of tubes to receive reagents as follows: 2. Add 1 ml of the splenocyte suspension (i.e., 107 cells) and 250 µl of appropriately diluted antibody (HB121, GK1.5, or TIB211; i.e., 25 µg) to each tube. Incubate the cells with the antibody for 30 min at room temperature.

46

3. 4.

5.

6. 7.

8.

9.

8.

13

Wash the cells one time with DMEM-10% FCS (8 min at 1500 rpm in the clinical centrifuge) and resuspend to 300 µl of PBS/EDTA. While the cells are washing, also wash the Mini-MACS column, flushing it through with the PBS/EDTA 13. If air bubbles are present in the column, it may be necessary to back-flush the columns to get rid of the air bubbles. Mount the column in the magnetic holder in preparation for the separation in step 7 below. Add 25 µl of the anti-IgG paramagnetic beads to the GK1.5 tube from step 2 (i.e., 1:40 beads:cells), 25 µl of the anti-IgM beads to the TIB211 tube, and 25 µl of each to the no antibody and HB121 tubes, and incubate for 30 min at 6-12˚C (icewater bath). Wash the cells in PBS/EDTA, resuspending them to 300 µl PBS/EDTA. Apply the washed cells to the column (in the magnetic holder), and collect the flow through, then wash the column two times with an additional 1 ml (each time) of PBS/EDTA, collecting the flow-through each time. Pool the flow through cells, which comprise the marker depleted populations, and wash and count them. Remove the column from the magnet, clamping it to a ring stand, and flush the bound cells out of the column with 2 ml of PBS/EDTA, using the column plunger to assist in this operation, and collecting the eluted cells in a sterile tube.. Wash and count under the hemocytometer the retained cell populations. You will use these counts to compare with those obtained by FACS analysis of the total spleen populations (no Ab treatments). Stain the unselected populations from step 6 with the FITC-anti-CD4 and PE-antiCD8 antibodies at in §3.1, and fix with paraformaldehyde for FACS analysis the next day.

The first 10-20 drop to elute from this wash step will appear quite cloudy (due to elution of matrix residue). You should continue washing at least until the cloudiness of the eluting buffer diminishes to background.

47

3.3 Assessment of T cell proliferation (Blast assay) One of the basic tests in immunology is that of confirming that T cells are responding to antigens as they should, or determining the precise levels at which these cells respond to antigens (specific immunoreactivity of the cells) or mitogens (overall responsiveness of the T cells). Traditionally, immunologists set up the target T cell population (e.g., PBL mononuclear cells, lymph node or spleen cells) in tissue culture, challenged the cells with the antigen of interest and then measured the proliferation of the T cells three days later by ascertaining their uptake of a radiolabelled DNA precursor (e.g., the nucleotide 3H-thymidine). This is a very sensitive assay, but it calls for the use of equipment and facilities specialized for use in handling radioisotopes. More recently, many labs have been using the MTT assay, performed exactly as outlined above for the LM-1 (§IL-1 ASSAY) and 7TD1 (§IL-6 ASSAY) cell proliferation assays, to accomplish the same goal. In this assay, we will examine the overall responsiveness of splenic T cells from BALB/c mice, by challenging the splenocytes with the T cell mitogen concanavalin A (Con A). In order to optimize the system however, we will need to determine the optimal concentrations of spleen cells needed for the assay, as well as the optimal doses of Con A required to induce proliferation. As with most immune responses, too much or too little of either can be inhibitory to the responses we wish to examine. Materials humidified CO2 incubator 96-well tissue culture plates micropipetters, tips multi-channel pipetter clinical centrifuge, tubes 15 ml 15 ml centrifuge tubes hemocytometer ELISA plate reader (with a 595 nm wavelength filter) Reagents BALB/c mouse splenocytes (5x107 nucleated cells/ml) in DMEM-10% FCS DMEM-10% FCS media Concanavalin A (our stock is a 4 mg/ml solution in DMEM)

48

MTT 5 mg/ml in PBS) acidified isopropanol METHOD 1. In one 96-well plate, set up both cell number-response and Con A doseresponse curves using the plate format indicated below, and the volumes indicated in the table. 1

2

3

4

5

6

7

8

9

10 11 12

A B C

cell number-response (cells x106 well)

D

ConA dose-response (µg ConA/ml)

cell numbers titration

E

medium control

F G H

CELL NUMBERS TITRATION

ConA DOSE-RESPONSE CURVE

[CELL]

medium

cells

ConA

[ConA]

medium

cells

ConA

(x106/well)

(µl)

(µl)

(µl)

(µg/well)

(µl)

(µl)

(µl)

0.1

178

2

20

0.1

130

50

20

0.25

175

5

20

0.25

130

50

20

0.5

170

10

20

0.5

130

50

20

1.0

160

20

20

1.0

130

50

20

2.5

130

50

20

2.5

130

50

20

5.0

80

100

20

5

130

50

20

7.5

30

150

20

10

130

50

20

2.

For the cell numbers titration portion of the experiment, use a ConA concentration of 2.5 µg/ml. For the ConA dose-response curve, use a splenocyte concentration of 2.5x106 cells/well. Add sufficient DMEM-10% FCS to each well to bring the well volumes to 180 µl, and then add 20 µl of appropriately diluted ConA to each well (i.e., total well volume of 200 µl). Place the plates in the 37˙C CO2 incubator for three days.

49

3.

4.

5.

At the end of the three days, examine the cells in each well to get a feeling for how the cells have responded to the ConA (strong ConA mitogenic responses will have induced cell clumping). Next, add 20 µl of MTT solution (5 mg/ml) to each well and return the plates to the incubator for 45 - 90 min. Remove 150 µl of medium from each well, taking care not to also aspirate cells from the bottom of the wells. Add 100 µl of acidified isopropanol to each well and place on the ELISA plate shaker for 3 - 4 min, and then read the plate at 595 nm wavelength on the ELISA plate reader. Calculate the mean OD595 (+/- SEM) for each treatment group, perform the statistical analyses and plot your data using bar graphs.

50

3.4 Plaque Forming Cell (PFC) assay for IgM-producing cells Materials sheep red blood cells (SRBC; 2x108/ml), washed in PBS 14 20% (v/v) SRBC in PBS/10%FCS syringes & 27 or 30 ga needles mice PFC assay chambers methoxyfluorane (anaesthetic) Reagents PBS H20 & 10x HBSS for hypotonic lysis of spleen RBC guinea pig serum diluted 1:2 in PBS/10% FCS Method 1. Inject 0.2 ml of the SRBC suspension (i.e., 4x107 cells) either intravenously or intraperitoneally into 8-10 week old mice. 2. Euthanize the mice after 4 days if they were immunized intravenously (or after 5 days if they were vaccinated intraperitoneally), and generate single cell suspensions from their spleens. Lyse the residual splenic red blood cells by hypotonic or ammonium chloride lysis (§5.4.8) and bring the nucleated cells to a final concentration of 5x106 cells/ml 3. To a series of labelled eppendorf tubes, add either 0, 30, 60, or 120 µl of the splenocyte suspension, 30 µl of the 20% SRBC suspension (i.e., in PBS/10% FCS), 30 µl of diluted guinea pig serum and 240, 210, 180, or 120 µl of RPMI-10%, as appropriate to bring the final volume of each tube to 300 µl, and thoroughly mix the contents of each tube. 4. Load 80 µl of the mixture into each assay slide chamber (see diagram below) and seal each with wax.

14

As an estimate of the numbers of SRBC available from the peripheral blood of a sheep, 1 ml of heparin-anticoagulated peripheral blood can yield ≈1x1010 red blood cells after 5-6 washes with PBS

51

low er to appose against bottom slide

microscope slide (2)

double-sided tape gaskets (3)

assembled double-chamber apparatus

5. 6.

splenocyte-SRBC mixture

Incubate the chambers for 1 - 1.5 h at 37˚C. Remove the chambers from the incubator and count the numbers of plaques of red blood cell lysis under the microscope.

52

3.5 ELISPOT assays for single cytokine- or Ab-producing cells A very powerful method to assess the abilities of animals to produce antibodies (Ab) or cytokines in response to antigenic stimulation is the ELISPOT assay. This procedure is used to detect the abilities of individual B or T (or other) cells to secrete their products. We will assess the abilities of splenocytes from BALB/c mice that have been immunized with ovalbumin-alum to produce ovalbumin-specific antibodies of varying isotypes or those of these mice or SRBC-vaccinated mice to produce IL-4 or IFN-γ in response to antigenic challenge in vitro. Thus, we will in effect by phenotyping the CD4+ T cell responses (i.e., Th1 or Th2) of the mice to these immunogens. Materials splenocyte suspensions from mice vaccinated with: - ovalbumin/alum (i.p.: on dy 1 and dy 14; harvest cells on dy 21) - SRBC (i.v.: dy 1, 200 µl of 0.1% SRBC; dy 14, 200 µl of 1% SRBC) pipettes/pipettors clinical centrifuge, 15 ml tubes 96-well ELISPOT plate Reagents anti-mouse IL-4 and anti-mouse IFNγ capture antibodies (1 µg/ml coating buffer stock) bromo-chloryl-indoyl phosphate/nitroblue tetrazolium (BCIP/NBT) substrate biotinylated anti-mouse IL-4 and anti-mouse IFNγ antibodies (detection antibodies) DMEM-10% FCS ELISPOT blocking solution (DMEM-10% FCS) ELISPOT coating buffer (carbonate/bicarbonate, pH 9.4) Lymphocyte separation medium ovalbumin (5 µg/ml coating buffer stock solution) PBST (PBS with 0.05% Tween 20) streptavidin-alkaline phosphatase conjugate (strep-AP; diluted 1:5000 in PBST) METHOD 1. Precoat each of the ELISPOT plates with capture antibodies or antigen (this can be done several days in advance). To do this, to each well of the plate, add the purified anti-IL-4 or anti-IFNγ antibodies in ELISPOT coating buffer at a concentration of 1 µg/ml or the ovalbumin at a concentration of 5 µg/ml. Cover and seal the plates with parafilm and incubate overnight at 4°C.

53

A anti-OVA I gG1, IgG2a, IgM, Ig E antibody ELISPOT

1 A

2

3

1x10e6, no Ag, G1,G2a,M

B C D

F H

5

6

con't 1x10e6, with Ag, G1,G2a,M ,E

no cells, with Ag, G1,G2a,M

E G

4

1x10e6 ce lls with Ag, no biotin A b

7

8

9

1x10e5, with Ag, G1,G2a,M no a-IL-4

10 11 12 con't no IFNg no cells no second ary

no cells

5x10e5, with Ag, G1,G2a,M

anti-IFNg, no second ary no Ag, 1,5,10x10e 5 anti-IL-4, no Ag, 1,5,10x10e 5 no blockin g

(OVA) anti -IL-4, -IFNg ELISPOT

B OVAmice

anti-SRBCmice

1 2 3 4 5 6 7 8 9 10 11 12 no secondary no cells A anti-IL-4, B + ovalbumin, 1,5,10x10e5 C D E

anti-IFNg, + ovalbumin 1,5,10x10e5

F G

anti-IL-4, 1,5,10x10e5, +SRBC

anti-IL-4, 1,5,10x10e5, no SRBC

no anti-IL-4

H no cells

no anti-IFNg anti-SRBCmice

no secondary anti-IFNg, 1,5,10x10e5, no SRBC

anti-IFNg, 1,5,10x10e5, +SRBC

anti-IL-4

anti-IFNg

no blocking

54

2.

3. 4.

5.

6. 7. 8.

The next morning, remove the capture antibody from the wells by inverting the plate and sharply flicking it. Rinse out each well with 200 µl of blocking solution by pipetting the solution up and down several times with a multichannel pipetter (do not touch the bottom of the well with the pipette tips!). Remove the blocking solution, rinse as above and add 100 µl of fresh blocking solution to each well. Incubate the plates at 37°C for a minimum of 1 hour (or until the cells from the next step are ready). Generate a single cell suspension from the spleens of an OVA- and SRBCsensitized mice, and resuspend the cells to 1x107 cells/ml DMEM-10% FCS. Remove the ELISPOT plate from the incubator and dump out the blocking solution. Add 100 µl of spleen cells and 100 µl of antigen (ovalbumin @ 2.5 µg/ml or SRBC @ 1.0% suspension) to each well, and incubate the plates at 37 °C for 8 hours. Do not to disturb the plates while they are incubating, so that each cell secretes all of its cytokine/antibody in only one location. After 8 h, remove the cells from the plate by first agitating the plates on the ELISA plate shaker for ≈3 min, and then inverting them and vigorously flicking the contents from the wells. Continue washing the wells with 200 µl of PBST -vigorously pipette the contents up and down, but do not touch the bottom of the wells, and flick the PBST out as above. Remove the excess PBST by banging the plate upside down on paper towels. Repeat this wash procedure 6 times. Add 100 µl of biotinylated anti-cytokine or anti-isotype antibody (diluted to 1 µg/ml in PBST) to each well, and incubate the plates overnight at 4°C. Wash the plates 5 times with PBST as in step 6, add 100 µl of diluted strep-AP to each well, and incubate the plates for 1.5 h at room temperature. Wash the plates 10 times by repeatedly dunking the plate in a large beaker of distilled-deionized H2O, each time removing all of the H2O from each well as

above (i.e., flicking and banging on paper towels). Careful washing is important, for it will reduce the assay background substantially. 9. Add 100 µl of freshly prepared BCIP/NBT substrate to each well. (To 5 ml of 0.1 M Tris (pH 9.5), 0.1 M NaCl, 0.05 M MgCl2, add 22 µl BCIP, mix by inverting and then add 16.5 µl NBT and again mix; for smaller volumes, use 3.75 ml buffer, 16.5 µl BCIP & 12.37 µl NBT). 10. Incubate the plates at room temperature in the dark until spots develop or the plate background begins to increase (approximately 30-45 minutes).

55

11. To stop the reaction, flick out the substrate and wash the plates 3 times in H2O by the dunking method. Allow them to dry overnight (with the lids off), as the background fades dramatically when the plates dry. 12. Count the spots under low magnification under the dissecting scope, or using an image analyser

56

3.6 ELISA ASSAYS (Enzyme-linked Immunosorbent Assay) The ELISA assay is a powerful method for the detection of specific antigens (be they from pathogens or those specific for antibodies or cytokines). It can detect many antigens with a sensitivity of ≥1 pg/ml, although for many others sensitivities of 100-200 pg/ml are difficult to achieve. There is very little difference between the ELISPOT and ELISA assays - the ELISPOT detects cytokine or antibody production in situ by viable cells while the ELISA detects proteins which are present in a soluble form in biological fluids. The former assay is performed in nitrocellulose paper-lined 96-well plates and utilizes a precipitating indicator dye (so that individual cell traces are detected), while the latter is performed in high protein-binding plastic 96-well plates and employs soluble indicator dyes. While the ELISPOT tells you how many cells are secreting the antigen being detected, the ELISA will quantify the product precisely.

3.6.1 ELISA assay for detection of antigen-specific antibodies In the antigen-specific antibody ELISA, the wells are coated with the nonantigen-specific immunoglobulin standards or the antigen in question, the latter should capture the antigen-specific antibodies from the samples. and then blocked. Subsequently, the wells are blocked with a protein solution that is not recognized by the capture antigen or standards (e.g., DMEM-10% FCS or 1% bovine serum albumin), and then the biological samples are applied. The captured antigen-specific antibodies are then detected precisely as are the cytokines/antibodies in the ELISPOT assay (§3.5)

Materials Immulon-4 ELISA plates pipettes/pipettors Reagents experimental sera or other putative antibody source (e.g., from ova-vaccinated mice) ovalbumin for capture of antigen-specific antibodies IgG1, IgG2a, and IgE standards (commercial or appropriate hybridoma supn't 15) 15

ATCC MAb # (mouse IgG1 anti-human IL-8), ATCC MAb # HB121 (mouse IgG2a anti-human IgE) and ATCC MAb (mouse IgE anti-DNP) ascites fluids work well for the antibody ELISA standards, using ascites fluid dilutions ranging from 1:50 > 1:1,000,000. Alternately, one can use high antibody value reference sera generated by vaccinated of mice with the antigen of interest. For example, BALB/c mice produce a very strong IgE and IgG1 response following intraperitoneal vaccination (dy 0) and boosting (dy

57

biotinylated IgG1, IgG2a, and IgE detection antibodies ELISA carbonate coating buffer PBST (PBS with 0.05% Tween 20) DMEM-10% FCS streptavidin-allkaline phosphatase (SA-AP) or SA-horse radish peroxidase (SA-HRP) 16 3 mM p-nitrophenyl phosphate (in 0.05 M Na2CO3/0.05 mM MgCl2; substrate for SA-AP) 2-2'-azino-di[3-ethyl-benzthiazoline sulfonate (6)] with H2O2 (ABTS; 1 component substrate for SA-HRP) 1% sodium dodecyl sulfate (SDS; optional stop solution for reactions) METHOD 1.

Coat the wells of the Immunolon-4 plates with the antigen to be used for antibody capture (ovalbumin @ 5 µg/ml in carbonate coating buffer) or with the diluted antibody standards, as appropriate. Add 100 µl per well, then cover the plate(s) and incubate overnight at 4°C. 2. Wash the wells 2 times with PBST. To do this, one can either use a squirt bottle of PBST or a multichannel pipettor to fill each of the wells and allow to stand for 30 - 60 seconds, then turn the plate upside down and flick the wash fluid into a sink, then fairly forcefully hit the plate upside down on a stack of paper towels to remove the excess fluid from each well. Block the plates by adding 200 µl of DMEM-10% FCS to each well and incubate, covered, at room temperature for 2 hours. 3. Wash the wells 2 times with PBST as in step 2, and to the ovalbumin-coated sample wells add 100 µl of the samples (diluted ≥1:50 in DMEM-10% FCS) to each well. Add 200 µl of PBST to the antibody standard wells. Cover the plate and incubate overnight at 4 °C. 4. Wash the wells 4 times with PBST. Dilute the biotinylated anti-Ig isotype antibodies to 0.5 - 2.5 µg/ml in PBST (the optimal concentration will need to be determined empirically), and add 100 µl of each per well, as appropriate for each sample or standard. Cover and incubate at room temperature for 90 min.

14) with 5 µg of ovalbumin conjugated to 1 mg of alum. Sera or plasma from these mice can be used as reference standards. 16 In our hands, the streptavidin-horse radish peroxidase/ ABTS enzyme/substrate combination gives vastly superior results to those obtained with the SA-AP/p-nitrophenyl phosphate enzyme/substrate system although, in all honesty, we have not "played" with the latter system sufficiently to suggest that it could not yield equivalent results under the correct circumstances.

58

5.

6.

Wash the wells 8 - 10 times with PBST, and add 100 µl of either SA-HRP (1:5000 in PBST) or SA-AP (1:5000 in PBST) to each well. Incubate at room temperature for 90 min. Wash the plates 8 - 10 times with distilled H2O by the dunking method, making sure to remove the excess fluid as above. Add 100 µl of the ABTS substrate (SAHRP avidin-enzyme conjugate only) or freshly prepared 3 mMp-nitrophenyl

7.

phosphate substrate (SA-AP avidin-enzyme conjugate only) to each well, then place the plates in a dark location (e.g., a drawer works well) and allow the reactions to develop for 20 - 45 min 17 at room temperature. The plates can be read directly at this point, or stop solution may be added to reduce plate to plate variability when reading multiple plates. For the ABTS substrate, the stop the reactions by adding 100 µl of 1% sodium dodecyl sulfate (SDS) to each well. Read the plates using the ELISA plate reader, set at a reading wavelength of 405 nm.

17 If the optical densities of the standards or samples does not come up to a useable level within this 45 min time frame, the plates can be left longer (e.g., several hours or even overnight with particularly weak samples). However, during this time, it is possible that the standards could become overdeveloped, making calibration of the results difficult or impossible.

59

3.6.2 ELISA assay for detection of cytokines Rather than using antigen as the capturing agent, the cytokine ELISA depends on using a cytokine-specific antibody which does not recognize the same cytokine epitope as the biotinylated detection antibody. Thus, monoclonal antibody (MAb) pairs are required and are available routinely from many commercial sources. Alternately, you can use a monoclonal in conjunction with a polyclonal anti-cytokine antisera. However, care must be taken to ensure than the antibodies/antisera employed will only recognize the cytokine of interest and that they will not inappropriately bind to immunoglobulin or other assay reagents and thereby give "false-positive" results. Materials Immulon-4 ELISA plates pipettes/pipettors experimental samples for cytokine assay Reagents cytokine capture and biotinylated detection antibody pairs ELISA carbonate coating buffer PBST (PBS with 0.05% Tween 20) DMEM-10% FCS SA-horse radish peroxidase (SA-HRP) 2-2'-azino-di[3-ethyl-benzthiazoline sulfonate (6)] with H2O2 (ABTS; 1 component substrate for SA-HRP) 1% sodium dodecyl sulfate (SDS; optional stop solution for reactions) METHOD 1. Dilute the capture antibody of each pair to 0.5 - 2.5 µg/ml in coating buffer, as empirically determined, and add 100 µl to the appropriate wells of the ELISA plate. Cover the plate and incubate overnight at 4°C. 2. Wash the wells 2 times with PBST, as above (§3.6.1, step 2), and block the plate by adding 200 µl of DMEM-10% FCS to each well and incubate, covered, at room temperature for 2 hours. 3. Wash the wells 2 times with PBST, and add 100 µl of the standards or samples (diluted in DMEM-10% FCS) to each well. The precise levels of standards to use will depend on the detection limits of the antibody pairs employed, but will often

60

cover the range of from 1 pg/ml to 1500 pg/ml. Cover the plate and incubate overnight at 4 °C. 4. Wash the wells 4 times with PBST. Dilute the biotinylated anti-Ig isotype antibodies to an empirically-determined optimal concentration (usually 0.5 - 2.5 µg/ml) in PBST and add 100 µl of each per well, as appropriate. Cover and incubate at room temperature for ≈90 min. 5. Wash the wells 8 - 10 times with PBST, and add 100 µl of the diluted SA-HRP (1:5000) to each well. Incubate at room temperature for ≈90 min. 6. Wash the plates 8 - 10 times with distilled H2O, making sure to remove excess fluid. Add 100 µl of ABTS substrate to each well and allow the reactions to develop for 20 - 45 min at room temperature. The reactions can be stopped by 7.

adding 100 µl of 1% SDS to each well. Read the plates using the ELISA plate reader, set at a reading wavelength of 405 nm.

61

3.7 In vivo assessment of T cell responses: Th1 versus Th2 responses Materials Ovalbumin- and SRBC-immune mice Tissue processor (for processing biopsies to paraffin blocks) 1 ml syringes and 30 ga needles scalpel blades Reagents Ovalbumin in Ca++/Mg++-free HBSS (40 µg/ml) SRBC in Ca++/Mg++-free HBSS (5% suspension) In situ hybridization fixative 70% ethanol METHOD 1. Set up the antigens for the intradermal skin tests in the 1 ml tuberculin syringes equipped with 30 ga needles. The bevel side of the needle and the calibrated side of the syringe should be aligned if you are going to inject defined volumes based on the calibration of the syringe. 2. Lightly anaesthetize each mouse it turn (i.e., two ovalbumin-sensitized mice and two SRBC-sensitized mice), so that it can be injected intradermally in the ear. If this will take some time, also set up a 15 ml tube (with cotton batting and methoxyfluorane) that you can use during the procedure, in order to keep the mouse anaesthetized on the bench. 3. Inject 25 µl of the 5% SRBC suspension intradermally into the right ear of the mouse and inject 25 µl of the 40 µg/ml ovalbumin solution intradermally into the left ear. 4. Return the mouse to its cage, making sure that you keep it warm (use a heat lamp if necessary) and safe (from any overly dominant littermates) during recovery. 5. At four hours post-injection and then again at 24 h, euthanize one mouse from each group (i.e., one SRBC- and one ovalbumin-sensitized mouse) and take biopsies of the reaction sites. To do this, use a fresh #12 scalpel blade to remove the ear and cut it in half longitudinally, through the middle of the reaction (injection) site. Trim away and discard the tissue from the outside of the ear, away from the injection sites. 6. Transfer each half of the ear into ice-cold ISH fixative and fix the tissue for 3 h on ice. 7. Replace the ISH fixative with ice-cold 70% ethanol and store the tissue in this solution at -20˙C until you are ready for tissue processing.

62

8.

Place the tissues into labelled tissue-tek cassettes and transfer into the tissue processor at the 70% ethanol step. The processor will automatically process the tissue through to molten paraffin. 9. Embed the tissues in paraffin such that the ear tissues are standing straight up in the molds, so that upon sectioning you will obtain cross-sections of the tissue. 10. Cut 6 µm paraffin sections of the tissues and dry them onto slides overnight at 42˙C. 11. Stain the sections with Giemsa stain using the stipulated protocol (§6.4.9.1.2), mount with permount and examine the tissues under the microscope.

63

3.8 Immunohistochemical detection of cytokines in tissues Immunohistochemistry is a powerful tool for the detection of single cells which are positive for any marker of interest for which suitable antibodies exist (e.g., F4/80 antibody-positive MØ, GK1.5-positive CD8 cells, cytokine-secreting cells, etc). It is thus similar to FACS analysis, but has perhaps traditionally been used most often with fixed tissues or cells, allowing one to assess the prevalence of marker expression in situ, within the context of ongoing physiological or pathological processes. The tissues or cells are perhaps best prepared in fixatives such as Bouins or Carnoys, since formaldehyde fixation (especially prolonged fixation) can destroy the "antigenicity" of many epitopes, rendering them much less detectable using standard protocols. In our laboratory, we often use our in situ hybridization fixative (§5.3) for experiments calling for either in situ hybridization (ISH) or immunohistochemistry (IHC). Materials micropipetters ISH-fixed cell suspensions or paraffin-embedded 5-7 µM tissue sections Reagents xylene graded alcohol baths (i.e., 100%, 90%, 70%, 50%) for hydrating tissue sections PBST - PBS containing 0.05% Tween 20 normal goat serum primary anti-cytokine antibody (suitable for immunohistochemistry; e.g., rabbit anti-TNF) biotinylated secondary antibody (e.g., biotinylated goat anti-rabbit IgG antibody; §3.5) commercial streptavidin-alkaline phosphatase (SA-AP; § 3.5) BCIP/NBT (see §3.5) METHOD 1. Run paraffin sections through two xylene baths (10' & 5') to remove the paraffin, then rehydrate the tissues by passing the slides through the graded ethanol baths (2x100%, 90%, 70%, 50%, each < 1 min), then equilibrate to PBST buffer for 2-3'. 2. Circle the tissue sections with wax pencil to reduce the amount of reagents required to saturate the tissue sections in each of the following steps. 3. Incubate the rehydrated tissue sections in 10% normal goat serum for 2 h @ RT in order to block the non-specific binding capacity of the tissue immunoglobulin receptors (FcR) for the antibodies to be used subsequently.

64

Overlay the tissue sections with ≈75 µl of the primary antibody, using empiricallydetermined optimal concentrations of the antibodies (culture supernatants are often used @ 1:5- 1:100; commercial preparations of purified antibodies @ 1:501:250; and monoclonal antibody ascites fluids @ 1:250-1:10,000) ON @ 4C. 5. Wash the tissue sections three times for 5' each in PBST. 6. Overlay the tissue sections with ≈75 µl of the biotinylated secondary antibody, again using empirically-determined optimal concentrations of the antibodies, generally for 2h @ RT. 7. Wash the tissue sections three times for 5' each in PBST. 8. Overlay the tissue sections again, this time with SA-AP diluted to 1:5000 in PBST, and incubate for 90 ' @ RT to label the secondary antibodies in the tissue sections. 9. Wash the tissue sections three times for 5' each in PBST. 10. Overlay the tissue sections with the commercial solution of BCIP/NBT for 20 - 40' @ RT (continue staining until the antigen of interest becomes apparent or until a non-specific general tissue background staining begins to appear). 11. Transfer slides to H2O and counter-stain with a water-based counter-stain such as 4.

Gill's haemotoxylin (§ ) and cover-slip with aqueous mounting medium.

65

4.0 MOLECULAR ANALYSIS OF CYTOKINE mRNA EXPRESSION : 4.1 Northern blotting Northern blotting is much like Western blotting, except that instead of examining the expression of proteins by electrophoretically separating them according to their size and confirming their identities with specific antibodies, you will be examining the expression of the mRNA for the protein by electrophoretically separating them according to their size and confirming their identities with specific cDNA probes. We will examine the methods for the purification of the mRNA, for electrophoresing and blotting it, and for probing the blots. 4.1.1 Purification of cellular RNA While the protocol outlined herein is for the purification of RNA from cells, it is essentially the same as that for tissues, except that with tissues one uses a tissue disrupter or homogenizer. We will be using CsCl gradients to purify the RNA, but many people instead use an acidic phenol-chloroform extraction protocol. I use the former method for purifying large amounts of RNA and the latter for minuscule amounts of RNA -- there are an increasing number of very good mRNA purification kits available on the market as well. Finally, while we will not be isolating mRNA from the total cellular RNA (because our target mRNA species should be highly expressed), for mRNA species that are only weakly expressed, you will need to purify the mRNA from the total cellular RNA pool. Materials samples for RNA extraction (tissues or cultured cells) RNAse-free pipettes, tips, test tubes micropipetters single cell suspensions of activated and control Cl.MC/C57.1 cells (time course of 0, 3 & 6 h) Reagents DEPC-H20 20% lauryl sarcosine 5.5 M GSCN lysis solution 5.7 M CsCl/sodium acetate

66

METHOD 1. At each time in the activation time course, pellet the appropriate tubes of C57 cells by centrifugation, then generate a paste on the tube walls by vigorously flicking the tubes. Add 3 ml of GSCN lysis solution to each tube, and vortex vigorously for ≈30 sec - 1 min. 18 2. For samples homogenized by vortexing only, shear the DNA by forcefully aspirating and ejecting the lysate through an 18 ga. needle, using a 3 ml syringe, and taking care to avoid frothing the samples excessively. (When the DNA is shorn sufficiently, the sample will drip discretely from the tip of the needle rather than coming out as a viscous linear strand.) 3. Pipette 1.0 ml of CsCl density gradient medium into each of 6 polyallomer ultracentrifuge tubes, and then gently overlay the CsCl with the cell lysates. Do not allow the CsCl and samples to mix, and fill the buckets only to ≈2 mm from the top (you will need to leave room for the addition of additional GSCN as required for bucket balancing (step 4). 4. Load the tubes into the SW55Ti rotor buckets and balance the loaded buckets & caps in pairs (i.e., #1 & 4, #2 & 5, #3 & 6), to within 1/100th of a gram. Use GSCN lysis solution to balance the buckets by adding it to each tube with a syringe fitted with an 18 ga needle, one drop at a time. Tighten the lids down - finger-tight only! 5. Fit the buckets onto the SW55Ti rotor, very carefully place the rotor on the centrifuge spindle, being very careful not to damage the overspeed disc on the bottom of the spindle!, and gently close the weighted door. 6. Switch on or set the following centrifuge control options: vacuum on, slow acceleration on, brake off, maximum temperature to ≈30˙C, run temperature to ≈22˙C, rotor speed to 42,000 rpm, run time to ≈20 h, timed operation, and finally, on. Wait for the rotor to come to speed to confirm that everything is operating smoothly. 7. The next day, after the rotor has stopped, switch off the vacuum, open the door and remove the rotor from the spindle, and the buckets from the rotor. Take the tubes from the buckets, wash them out with hot tap water & dry, and check the "O" rings and lubricate using vacuum grease, if necessary. 8. Completely aspirate the liquid contents of the tube using a Pasteur pipette attached to a vacuum apparatus. The last few milliliters are best gotten by turning the tube 18

When extracting RNA from tissues, grind the tissues using a polytron-type homogenizer in GSCN without sarcosine (to avoid foaming), then add the sarcosine after the tissue homogenization. Precentrifuge the homogenized tissues for 30 min to 2 hours in the ultracentrifuge to get rid of any insoluble tissue remnants. In place of a polytron to grind up the tissues, one could also use a mortor and pestle with liguid nitrogen to accomplish the same thing.

67

9.

upside down to allow the fluid to drain to the pipette. Stay away from the gelatin-like pellet of RNA at the bottom of the tube. The pellet will be anywhere from 1 - 8 mm across. One at a time, cut the tubes off about 1 cm above the bottom using a heated scalpel blade, break up the RNA pellet with the tip of the eppendorf tip, and dissolve the pellet in ≈50 - 400 µl of DEPC-H2O (depending on the size of the pellet) by repeated vigorous pipetting. If necessary, repeat the H2O step to make sure you get all of the RNA, transferring both washes into an RNAse-free 1.5 ml eppendorf tube. Close the tube and transfer it to a 65˙C H2O bath for ≈5 min to completely dissolve the RNA,

then briefly microfuge to sediment the contents. 10. Remove 5 µl of the RNA from each tube and transfer to another tube containing 995 µl of H2O. Immediately transfer the stock tubes of RNA to dry ice and then to the 80˙C freezer. Determine the optical density (260 nm and 280 nm wavelength; use quartz cuvettes) of each of the samples. Calculate the OD260:OD280 ratio and the concentrations of the stock RNA solutions as follows: The 260:280 ratio should be between 1.5 and 2.0 (pure nucleotide solutions have an OD260 of 2.0 -- the lower the ratio, the more protein contamination but, practically speaking, ratios of 1.5 are not uncommon and may still yield excellent results with Northern analyses). To calculate the concentration of the stock RNA, multiply the OD260 by 10 to get the concentration in µg/µl (i.e., an OD260 of 0.108 would mean that the stock RNA concentration was 1.08 µg/µl; for a 300 µl solution, that would mean that you had purified 1.08 x 300 = 324 µg of RNA). 11. If your RNA solution is too dilute for subsequent Northern analysis (e.g., 20 µg represent >≈30 µl of RNA), then you will need to concentrate the samples. To do this, take the calculated volume required for 20 µg and transfer it to a new RNAse-free eppendorf tube. Add 0.1 volumes of 3M sodium acetate (pH 7.0) and 2.5 volumes of 100% RNAse-free ethanol, vortex briefly to mix and put in the -80˙C freezer overnight. The next day, microfuge the RNA at 4˙C for 30 min, carefully aspirate the supernatant (avoid the minuscule pellet!) and wash the pellet with ≈500 µl of ice-cold 70% ethanol. Re-microfuge for ≈15 min at 4˙C, aspirate the supernatant again and leave the tubes open on the bench for ≈30 - 60 min to dry. When the ethanol has dried, resuspend the pellet in the required volume of H2O or Northern blot RNA sample prep buffer and dissolve at 65˙C, as above. Store at -80˙C, or on dry ice, until ready to use.

68

4.1.2 Electrophoresis of RNA & transfer to membranes It is critical that the electrophoresis apparatus used is more-or-less free from RNAse contamination. Therefore, it should be reserved for RNA work and should not be used for preparation or analysis of plasmids, a protocol that often depends heavily on the use of RNAses. Materials RNAse-free horizontal gel electrophoresis gel apparatus & power-pack Zeta-bind transfer membrane (or other) RNAse-free glass or plastic pipettes micropipetters & tips filter paper (e.g., Whatman #1) & absorbent paper (e.g., paper towels) Reagents agarose DEPC-H20 ammonium acetate formaldehyde 5X MOPS, 10xSSC 1.2% agarose gel 10 mg/ml ethidium bromide 0.03% methylene blue in 0.3M ammonium acetate RNA sample prep solution (for denaturation of RNA prior to electrophoresis) RNA sample dye/loading solution (for visualization of progress during run) METHOD 1. Wash the Northern blotting apparatus with DEPC-H2O, and then pour a 1.2%

2.

agarose/formaldehyde/MOPS gel (appendix , pg 94) to a depth of about 8-10 mm (since the RNA samples will be negatively charged and will migrate towards the positive electrode, make sure that you position the gel with the wells closest to the negative electrode). When the gel is fully solidified (this can be expedited by doing the last of the cooling step in a refrigerator), remove the comb from the gel and fill up the chamber with 1x MOPS running buffer, covering the gel to a depth of ≈2-3 mm with buffer. To eppendorf tubes containing 20 µg samples of RNA in a volume of 10 - 20 µl of H2O, add ≈15 µl of the RNA sample prep buffer and ≈2 µl of RNA load buffer/dye.

69

3.

4.

Incubate the samples in a 65˙C water bath for 10 min, then briefly pulse microfuge the tubes and hold on ice until ready to use. Load the RNA samples into the wells in the gel, being careful to not puncture the very fragile bottoms of the wells with the pipette tips. Run two sets of samples, one for Northern blotting, and a separate set for staining with ethidium bromide (for confirmation that the RNA samples are intact). When all the samples are loaded, run the gel until the leading dye front is approximately 50 - 75% down the gel. (The leading dye front will migrate just in front of the 18s rRNA, while the trailing dye front will migrate just behind the 28s rRNA in each sample.) Remove the gel from the gel apparatus and carefully cut it to separate the Northern blotting portion from that destined for ethidium bromide staining. Transfer both 'halves' into DEPC-H2O, and incubate the gel in the water bath for 20 min with gentle

rocking. For the half of the gel to be transferred to the nylon membrane, follow steps 5 - 7, for the portion to be stained with ethidium bromide, follow alternate steps 5a 6a. 5. Equilibrate the half for transfer to 10xSSC, by incubating in 10x SSC for 20 min with gentle rocking. 5a. The portion to be stained with ethidium bromide should be incubated for another 20 min in H2O. 6.

Assemble the northern blotting apparatus as follows: Cut a wick of 4 - 5 layers of Whatman #1 filter paper that can run the full length of the gel apparatus gel platform and extend down into the fluid reservoirs. Place the gel, upside-down onto this wick, making sure that there are no air bubbles trapped underneath. Apply a piece of the Zeta-bind membrane (cut the overlap the gel by a few millimeters) directly to the gel, and then apply several more pieces of filter paper, cut to the size of the membrane, directly on top of the transfer membrane, and cover this whole construct with ≈4-5 inches of paper towel, which will absorb the buffer that wicks through the gel and Zeta-bind membrane. Next, cut some large pieces of parafilm membrane and place them around the gel, so that the transfer buffer can only wick into the paper towel by going through the gel. Finally, place a weight on top of the paper towel (e.g., a 500 ml reagent bottle that is ≈ half full) and secure in place.

70

paper towel filter paper nylon membrane gel for blotting filter paper wick 10x SSC gel/blotting apparatus

6a. To the portion of the membrane to be stained with ethidium bromide, transfer the gel into 0.1 M ammonium acetate solution for another 20 min, and then into 0.1 M ammonium acetate containing 0.5 µg/ml ethidium bromide. Stain the gel for ≈45 min and then examine under UV light. If the background is not too high, photograph the gel as is, but if necessary the background can be decreased by further washing with water. 7. For the portion of the gel that was blotted, disassemble the transfer apparatus the next morning and bind the RNA to the membrane by UV cross-linking using the Strata-linker. Place the damp blot on damp filter paper into the irradiation apparatus

8.

and set it to automatically deliver the correct energy to the membrane (auto-crosslink). After cross-linking, the RNA is completely stable, such that the blots can be stored indefinitely at room temperature or in the freezer. (Stored in this manner, they can be successfully probed up to several years later). Assess the integrity of the RNA and the efficiency of transfer by staining the blots in 0.03% methylene blue in 0.3M sodium acetate (pH 5.2) for 45 seconds (or more, if required), then destaining the blots in DEPC-treated distilled water for ≈2 minutes. If the RNA is intact and transferred efficiently, you will readily see the 18s and 28s ribosomal RNA bands on the blots, as well as a subtle smear of mRNA that runs from above the 28 s rRNA band to below the 18 s rRNA band. (If the rRNA bands are not crisp and sharp looking, then some RNA degradation has taken place – the extent of the degradation can be judged readily in this manner.)

71

4.1.3 32P-labelled cDNA probe synthesis The probes used to detect the mRNA species of interest are generated by in vitro labeling of individual cDNAs specific for each mRNA, using the random hexamer method. In this method a solution containing essentially all possible nucleotide hexamers is used to prime the synthesis of secondary stands of cDNA from the denatured primary strands in a reaction in which one of the component deoxynucleotides is 32P-dCTP. The labelled cDNA is then purified from the unbound dCTP by chromatography through Sephadex G-50. Materials cDNAs for each mRNA of interest Plexi-glass 32P-energy-blocking safety shield glass pipettes plastic wrap Geiger counter Reagents 32P-labelled dCTP (Mandel-New England Nuclear; 3000-8000 Ci/mmol) Oligolabelling kit (Pharmacia) containing the random hexamer primers and the Klenow fragment of DNA polymerase. METHOD 1. Mix together 500-1000 ng of purified cDNA and H2O, to a final volume of 34 µl, then

2. 3. 4.

denature the cDNA by heating to 90˚C for 10-15 min. Transfer the cDNA to a 37˚C incubator for 5 min. Add 10µl of the oligolabelling reaction mixture (i.e., NTPs/random hexamer soup), 5 µl of 32P-dCTP, and 1 µl of Klenow fragment. Incubate the reaction mixture overnight at room temperature (or for >3 h @ 37˚C). Purify the 32P-labelled cDNA from the unbound probe by column chromatography (see accompanying diagram). Run the 50 µl reaction mixture over an ≈8 ml Sepharose G-50 column, carefully chasing the 50 µl reaction into the matrix with 2 sequential ≈1 ml aliquots of STE buffer, and eluting the labelled cDNA with STE. Follow the isotope using a Geiger counter, masking from the Geiger counter the column itself and the collection vessel, but not the elution tubing. Thus the Geiger counter will detect all of the elution of label from the column (both that incorporated into the cDNA and that still unincorporated).

72

poly-prep column Seph G-50 unincorporated 32P

beta energy shield (with window @ elution tubing)

beta energy

bound 32P elution tubing gieger counter

collection tubes

5.

6. 7. 8.

Once labelled material begins to read on the Geiger counter (i.e., is in the column elution tubing), begin to collect all of the eluate into one new tube, continuing to do so until this first peak of labelled material, which comprises the 32P-cDNA in its entirety, has eluted. Either collect any residual activity into a second, discard, tube or simply do not elute it from the column, discarding it instead with the column and matrix. Determine the radioactivity present in the labelled cDNA by adding a 5 or 10 µl aliquot of the cDNA to 4 ml of liquid scintillation cocktail and counting it in a β counter. Calculate the volume of column eluate required to yield 1.5x107 cpm of 32P-cDNA, then aliquot and freeze the labelled material until ready for use. 19 Clean up your work area, making sure to monitor all pipettes, shields benches, etc, for 32P contamination. Wipe test all surfaces and equipment to confirm your Geiger counter survey and clean up any remaining contamination using a detergent such as Count-Off (New England Nuclear). Enter your wipe test results in the lab log books.

19 32P

is a highly unstable isotope, so that the labelled probes cannot be stored for any more than 3 days to a week without decaying beyond usefulness.

73

4.1.4 Pre-hybridization, hybridization, and washing (Zeta-Bind nylon membranes) Materials Plexi-glass 32P-energy-blocking safety shield U.V. irradiation apparatus (e.g., Stratalinker) or vacuum oven rotary hybridization oven with hybridization tubes (or water bath, heat-sealable bags, & heat-sealing unit) glass pipettes plastic wrap Geiger counter Reagents 0.1x SSC/0.5% SDS 2x SSC/0.1 % SDS 0.2x SSC/0.1% SDS pre-hyb/hybridization solution 32P-labelled

cDNA probes (TGFβ, TNFα & actin)

METHOD 1. After transfer of the RNA from the gel to the Zeta-bind membrane, cross-link the RNA onto the membranes either by U.V. irradiation or by baking the blot in a vacuum oven (50˙C for 4 h). 2. Block the non-specific 32P-cDNA-binding sites on the membranes by incubating the blot in the hybridization oven for 60 min at 65˙C in ≈15 ml of 0.1X SSC/0.5% SDS. 3. Remove the Northern blot blocking solution from the blot and replace it with ≈15 ml of hybridization solution. Pre-hybridize the blots in this solution for 3 h to overnight at 42˙C. 4. Next, add 1.5x107 cpm of 32P-labelled cDNA probe (≈250 - 1000 µl volume) to the 15 ml of hybridization solution containing the blot. The probe must be boiled before addition to the blot to denature the double-stranded DNA (and allow the anti-sense strand to hybridize to the mRNA on the blots), and should not be allowed to cool before addition to the blot. Incubate the blots with the probe again overnight at 42˙C, making sure that the oven rotator is operating. 5. The next day, remove the very radioactive hybridization solution from the hybridization bottles (discard in the 32P-liquid waste canister), and rinse the bottles twice for 5 min

74

6.

7.

each with 2xSSC/0.1% SDS, discarding the spent washing into the 32P-liquid discard canister. Add 25 - 50 ml of 0.2xSSC/0.1% SDS to each bottle and incubate for 30 min at 42˙C. Repeat this 30 min/42˙C wash a second time, and discard the spent washings into the 32P-liquid discard canister. Remove the blot from the bottle and lay it flat out on a piece of plastic-wrap. Do not allow it to dry at this point, as drying will permanently fix all of the (i.e., specifically and any residual non-specifically bound) 32P-labelled cDNA probe to the blot. Using the Geiger counter, scan the blot to determine whether most, if not all, of the radioactivity is associated with bands at the expected position (molecular mass) on the blot. If it is not, then you need to continue washing the blot(s), increasing the stringency of the washes (i.e., decreasing the SSC concentration &/or increasing the wash temperature) but, most of the time, 60 min at 42˙C in 0.2xSSC/0.1% SDS wash is adequate. If the counts appear to be specifically bound, wrap the blot completely in plastic wrap and either store it in a freezer until ready to proceed or place in the autoradiography exposure cassette (again, do not allow the blot to dry!).

75

4.1.5 Detection of mRNA bands by autoradiography Materials autoradiography exposure cassettes ('enhancing screens' highly desirable) Kodak X-OMAT AR x-ray film automated x-ray film processing unit (or hand processing equipment/solutions) Reagents none, unless processing by hand METHOD 1. In the laboratory, and for autoradiography cassettes without built-in 'enhancing screens', place two 'enhancing screens' into the cassette on top of each other (as in a sandwich), such that their shiny surfaces face one another. Place the probed, plasticwrapped blot in the cassette, outside of the enhancing screen sandwich. 2. In the dark-room, under safelight illumination, place a sheet of x-ray film inside the enhancing screen 'sandwich' (i.e., not in contact with the blot), and then close and lock the cassette. For the much less expensive 'leatherette' cassettes, clamp sheets of plywood or plexiglass to the outside of the cassettes to hold all layers of the assembled exposure apparatus tightly together. 3. Place the exposure cassette in a -80˙C freezer until you are ready to develop the film. The length of time will vary depending on the intensity of the specific mRNA signal (roughly determined with the Geiger counter [see step 7, §NORTHERN BLOTTING: Pre-hybridization, Hybridization, and High-stringency Washing]). If the signal is

4.

5.

readily detectable with the Geiger counter, then a 1 - 3 day exposure is usually adequate, but if it is not easily detectable, then the exposure time may need to be extended to 1 - 3 weeks. You may need to do a short exposure to get a feel for the intensity of the signal, and then adjust the time to get an optimal signal intensity. For development of the film, remove the cassette from the -80˙C freezer and allow it to come to room temperature (this avoids condensation on the film later on). Under safelight illumination, open the cassette, remove the film from between the enhancing screens and feed it into the x-ray film processor. Do not turn on the lights or exit the processing room until you are sure that the film has completely entered the processor (usually there is a signal from the machine). Provided the mRNA signals on the blot are not over-exposed (i.e., have not photographically saturated the film), perform a densitometric analysis of the band

76

intensities of each mRNA band, for both the housekeeping control mRNA (e.g., actin) and the experimental mRNA (e.g., TNFα). Determine the relative signal intensities of each experimental mRNA band by expressing it in terms of the relative amounts of actin mRNA in each lane (ideally, the actin signals will not vary between lanes -- if they do, it is because you loaded different amounts of RNA in each lane).

77

4.2 In Situ hybridization (ISH) In the experimental procedure that we will follow, we will probe activated Cl.MC/C57.1 cells for the expression of TNFα and TGFβ, using 35S-labelled TNFα sense and anti-sense and TGFβ anti-sense cRNA probes. Thus we will be probing cytocentrifuge preps. The cells are fixed in ISH fixative for as short a period as is consistent with good cytoarchitecture, are hydrolysed in HCl and digested with protease to make the mRNA more available to the cRNA probes, briefly fixed again to neutralize any RNAse activity, and blocked with acetic anhydride to reduce non-specific sulfhydryl bond formation between the 35S-labelled probe and the tissues. The tissues are probed and washed at a relatively high temperatures to prevent non-specific annealing of the cRNA probe to other tissue mRNA species, and finally, the mRNA-bound 35ScRNA probes are detected at the cellular level by dipping the slides in a liquid film emulsion and performing in situ autoradiography. ISH is extremely specific, inasmuch as you can detect and identify individual cytokine mRNA-positive cells, but its sensitivity is perhaps one-tenth of that of Northern blotting. 4.2.1 Probe synthesis & purification Materials micropipetters & tips RNAse-free eppendorf tubes Reagents in vitro transcription kit or reagents RNAid RNA purification kit 35S-UTP (12.5 mCi/ml; 1000 Ci/mmol) uridine 5'[α-thio] triphosphate (or, thio-UTP) DEPC-H2O linearized template (i.e., in vitro transcription vector containing cDNA) METHOD 1. Synthesize the cRNA probes by transcribing the cDNA in the linearized in vitro transcription vector (i.e., a vector with SP6, T3 or T7 RNA polymerase recognition sites upstream of the cDNA sequences of interest). For each experiment you will need to generate both sense and anti-sense (reciprocal transcriptional orientation)

78

probes. To accomplish this, for each probe to be prepared add the following ingredients (in order) to a 1.5 ml microcentrifuge tube on the benchtop 2.1 µl 5X transcription salts buffer 1.0 µl 1M DTT 0.5 µl RNAsin 0.5 µl NTP cocktail [10 mM @ ATP, CTP, GTP, and 250 µM UTP] 1.4 µl nuclease-free H2O briefly mix the ingredients before adding the template (the spermidine in the 5x salts could precipitate the DNA in the template if not thoroughly dispersed)

2.0 µl template (linearized plasmid) 2.0 µl 35S-UTP 1.0 µl appropriate RNA polymerase 10.5 µl total volume Briefly vortex the tube, pulse microfuge, and place in a 37˙C H2O bath for 90'. 2.

3.

4. 5.

6.

7.

Remove the DNA template from the reaction mixture by digestion with RNase-free DNase I. To do this add, 2 µl yeast tRNA 1 µl DNAse 1 µl RNAsin briefly vortex the tube and sediment the liquid by a ≈3" pulse-spin incubate the reaction tubes for an additional 15 min @ 37˚C. Add 86 µl DEPC-H2O, vortex, and pulse-spin as above. Remove 1 µl of each reaction mixture and dot it onto a filter paper disc (labelled A), which you then transfer into an empty scintillation vial (also labelled A, for ß-counting; below). Purify the 35S-UTP-labelled cRNA from the reaction mixtures using the RNAid RNA purification kit. Add 300 µl of RNA-binding salt to each tube and vortex. Add 2 µl RNAid-kit 'glass milk' and vortex each tube to disperse the 'glass milk' evenly. Incubate the tubes for 5 min @ room temperature to allow the RNA to bind to the scintered glass. Pulse-spin the tubes for 4 counts (i.e., ≈4 sec; spinning too long will pack the glass into too hard a pellet for subsequent dispersal) and remove and discard the highly radioactive supernatant using a 1 ml pipetman set at 500 µl. Add 400 µl of RNAid kit wash solution to each tube and resuspend the pellet by repeatedly vigorously expelling and not too vigorously aspirating the 400 µl wash solution with a P200 micropipetter set at 150 µl (too vigorous an aspiration action

79

will 'bump' the solution up onto the end of the micropipetter, inside the tip, leaving you with RNAse contamination of your purified preparation). Vortex and pulsespin the tubes for 4 counts, and remove and discard the highly radioactive supernatant using a 1 ml pipetman set at 500 µl, as above. Repeat step 7 for a total of three washes. 8. Resuspend the pellet in 25 µl of DEPC-H2O (this time notice that the pellet can be resuspended very easily), and place the tubes in a 55˚C water bath for 3 min. During this incubation, set up some new, labelled Eppendorf tubes with 25 µl of deionized formamide (this will be the final storage tube for the purified 35S-cRNA). 9. Microfuge the tubes for 3 - 5 min (full speed) to pellet the 'glass milk' and carefully remove the 35S-cRNA (supernatant)) from each tube. It is critical to avoid aspirating any glassmilk at this point, so remove the supernatant 10 µl at a time using your 1 - 10 µl pipetter. Transfer this eluted cRNA into the deionized formamide-Eppendorf tubes (step 8), so that you should now have a total 35ScRNA (i.e., probe) volume of ≈50 µl. 10. Remove 1 µl of this purified probe from each tube, and dot it onto a filter paper disc (labelled B). Transfer the paper disc into another scintillation vial (labelled B) for ß-counting. 11. Transfer the purified probe to a -70˚C freezer until you are ready to use it. 12. Add 4 ml of aqueous-miscible scintillation cocktail to scintillation vials A and B, cap them securely and use a liquid scintillation counter to determine the 35S counts in each tube. 13. Calculate the reaction yields (i.e., ng cRNA synthesized and purified) for each probe generated, as follows (this is a typical in vitro transcription result): You purchased 1 mCi of 35S-UTP (concentration, 1000 Ci/mmol = 1000 mCi/µmol) in a 80 µl volume. The 12.5 mCi/ml of the purchased product equates to 12.0 pmol/µl of isotope, and you used 4 µl or 48 pmol of 35S-UTP/reaction. In addition, the 1 µl of nucleotide cocktail for your in vitro transcription reaction contained 250 pmol of non-radioactive UTP, so that the entire reaction contained 298 pmol of (hot + cold) UTP -- ≈6.2 times the amount of UTP you would detect if you were measuring radioactivity alone. Since we are interested in calculating the amount of cRNA synthesized, not just the UTP content, we must also take into account that the mass of cRNA synthesized contains all four nucleotides (UTP, ATP, CTP & GTP), so that the actual amount of cRNA synthesized will be approximately 6.2

80

x 4 = 24.8 times the levels of 35S-UTP incorporated (this calculation assumes that UTP comprises 25% of the total nucleotide content). Now, using the cpm measured in the 1 µl aliquots taken from the transcription reactions (steps 3 & 10; the total cpm put into the reaction & the total cpm actually incorporated into the cRNA, respectively), we will determine the amounts of cRNA synthesized. The raw data obtained from the 1 µl aliquots taken in steps 3 & 10 is: probe

step 3 (cpm)

step 10 (cpm)

TGFαs

569150

576280

TNFs

823920

768370

TNFαs

596450

494110

specific

probe

pmol 35S

pmol

total cpm

activity of

total cpm

incorp.

cRNA

ng cRNA

No. slides

per rx.

35S

incorp.

into the

synth.

synth.

(11.5 ng

(x107)

(cpm/pmol)

into cRNA

cRNA

(pmol 35S

(pmol/2)

cRNA ea.)

x106

(x106)

probe

x 24.8)

TGFα-s

5.69

1.18

28.8

24.4

605.8

302.9

26.3

TNF-s

8.24

1.72

38.5

22.4

556

278

24.2

TNFα-s

5.96

1.24

24.5

19.75

490.4

245.2

21.3

Thus, for these in vitro transcription reactions, we can probe between 21 and 26 slides for each of the cRNAs.

81

4.2.2 Preparation of slides for hybridization Materials 37˙C water bath 60˙C water bath 90˙C water bath slide-staining apparatus (12 'coplin' jars are adequate) 10 ml glass pipettes (baked or commercial disposable) micropipetters (P200 & P2000) and tips 50 ml graduate centrifuge tubes (adequate for measuring reagents) pH paper strips (0.5 pH unit sensitivity is fine). Reagents 10 M NaOH xylene ethanol (100%, 90%, 70%, & 50%) DEPC-treated H2O (≈500 ml) 0.2 M HCl (16 ml concentrated HCl in 984 ml DEPC-H2O) TE buffer (10mM Tris/1 mM EDTA in H2O) PBS proteinase K (1 - 40 µg/ml in TE; prepare immediately before use, from frozen stocks). 0.2% glycine in PBS (3 ml of 10% glycine IN 147 ml PBS) 4% paraformaldehyde in PBS (dissolve at 60˙C at high pH, then adjust pH to neutral). 0.1 M triethanolamine (prepare just before use) acetic anhydride METHOD 1. Normally, when you are doing ISH with paraffin sections, you need to first de-wax and rehydrate the sections with sequential treatments with xylene and ethanol. Since cytocentrifuge preparations are not embedded in paraffin and are stored already in 70% ethanol, they enter the process at the 70% ethanol stage, and then are treated as with the paraffin sections protocol. Therefore process your slides as appropriate by running them through the following baths (in order and for the specified times): xylene #1- 10 min xylene #2- 5 min

82

100%, 90%, 70%, & 30% ethanol - (4 baths total, ≥30 seconds each). 2. Hydrolyze the overly extensive protein cross-linking in the formaldehyde-fixed tissues by incubating them in 0.2 M HCl for 20 min (this increases the access of your ISH probes to the mRNA). 3. During the 20 min 0.2 M HCl incubation period (i.e., step 2), prepare a fresh solution of 4% paraformaldehyde by adding 6 g of paraformaldehyde to the 150 ml of preheated 60˙C PBS. The paraformaldehyde will not dissolve until the PBS is made basic (i.e., increase the pH) by adding ≈6 drops of 10 M NaOH. Swirl the basic the paraformaldehyde suspension until all of the paraformaldehyde is dissolved, and then neutralize the pH (to ≈7 - 8) by adding ≈600 µl of 1 M HCl. Check the pH of the solution with pH paper (do not dip the paper in the solution, but instead remove 20 - 40 µl aliquots and drop these onto the paper). When the paraformaldehyde is at the correct pH, move it to an ice bath to cool. 4. After the 20 min HCl hydrolysis step, transfer the slides into a TE bath for 5 min 5. Further break down the protein-protein cross-linking (to increase access of the probe to the mRNA) by digesting the cells/tissues with the highest levels of proteinase K that they can take without disintegrating due to over digestion. For cytocentrifuge cells it is often acceptable to use the lower concentration of proteinase K, while for paraffin sections you should use the highest concentration that does not damage the integrity of the tissue (often 25 - 40 µg/ml). Thus, after the TE equilibration (step 4), transfer slides into the proteinase K/TE bath for 15 min @ 37˙C. 6. Neutralize the progression of the proteinase K tissue digestion by immersing the slides in 0.2% glycine in PBS for 2 min 7. Equilibrate the cells/tissues to PBS for 3 min. 8. Neutralize the newly-exposed RNAses in the tissues by "post-fixing" them in the freshly-prepared 4% paraformaldehyde in PBS (from step 3) for 5 - 20 min on ice. While the tissues are in the paraformaldehyde, prepare the triethanolamine solution for the tissue blocking step below. To prepare the 0.1 M triethanolamine, add 3.71g triethanolamine powder to 200 ml DEPC-H2O, and then adjust the pH to 7.5 - 8.0 by adding 200 µl of 10M NaOH (additional NaOH may be needed; again, use pH paper, not a pH meter). 9. Rinse the paraformaldehyde out of the cells/tissues by immersing in PBS for 5 min. 10. Block the non-specific binding sites of the 35S-labelled probes by incubating the cells/tissues in 0.1M triethanolamine containing 0.5% acetic anhydride for 10 min. It is critical that the complete triethanolamine/acetic anhydride blocking solution is

83

prepared fresh immediately (i.e., seconds) before use. Therefore, during the last few seconds of the step 9 PBS rinse, add 1 ml acetic anhydride to the 150 ml bath of 0.1M triethanolamine and immediately immerse the slides in this mixture. After 5 min, briefly remove the slides, add another 500 µl of acetic anhydride (acetic anhydride is extremely labile and 'goes off' within minutes), and continue the blocking step for another 5 min (i.e., total blocking time, 10') 11. Transfer the slides to a 2xSSC bath and hold in this solution until you are ready for the probe application to the tissues (i.e., hybridization step; below).

84

4.2.3 Hybridization of 35S-cRNA riboprobes to cellular mRNA Materials 40 - 65˙C hybridization oven 90˙C water bath micropipetter (P200) and tips pH paper strips (0.5 pH unit sensitivity is fine). Reagents DEPC-treated H2O (≈500 ml) ISH hybridization buffer thio-UTP (non-radioactive; for additional blocking of non-specific binding of 35S-UTP) 35S-UTP-labelled sense and anti-sense cRNA probes (concentrations known) METHOD 1. Calculate the amounts of probe, thio-UTP and hybridization buffer that you will require for your experiment. Base these calculations on: -using a final probe concentration of ≈0.25 ng of probe/µl of final hybridization cocktail/kilobase of cRNA probe complexity. For a 1 kilobase cRNA probe, and applying 45 µl of final hybridization cocktail to each slide, then you will need 45 x 0.25 ng x 1.0 kb = 11.25 ng/slide; -the 45 µl for each slide must include 1.25 µl of thio-UTP -the balance of the 45 µl for each slide comprises hybridization buffer A typical set of calculations for a ISH procedure in which you are going to probe 8 sense (negative control) slides and 20 anti-sense (experimental) slides with 35STNF cRNA probes that have cRNA concentrations of 5 ng/µl is as follows:

cRNA TGF: anti-sense TNF: sense TNF: anti-sense

# slides

Tot. hyb. vol. (45µl ea.)

Vol. thio-UTP (1.25 µl/slide)

Volume cRNA probe* (11.5 ng/slide)

Volume hyb. buffer (tot-thio-probe)

26

1170

32.5

50

1087.5

24

1080

30

50

1000

21

945

27

50

868

85

2.

3.

4. 5.

Add each required reagent to labelled Eppendorf tubes, vortex briefly and hold on ice until ready to use. A few minutes prior to using each probe, place it in a 80 90˙C water bath for 2 min to denature the cRNA, then transfer it back onto ice to quench the renaturation process. One at a time, remove the slides to be probed from the 2xSSC bath, briefly dry the back and the sides of the slides with a clean Kim-wipe (e.g., Kleenex), and place on hybridization tray (over 50% formamide-2xSSC-soaked paper towels in a Tupperware container). Apply 45 µl of the final hybridization mixture to each slide, carefully using the pipette tip to cover most of each tissue section (for cytocentrifuge preps simply placing the 45 µl in the centre of the cell 'patch' is adequate). Use some RNAse-free forceps to carefully overlay the tissue/cells with a baked, siliconized coverslip, taking care to avoid air bubbles. Repeat this procedure in turn with each of the slides and, when finished, cover and seal the hybridization chamber (Tupperware container) and place it in the 45˚C hybridization oven overnight.

86

4.2.4 Post-hybridization washing & autoradiography Materials 37˙C water bath 47˙C water bath 2 coplin jars bath for removing cover slips Geiger counter plexi-glass shield for working with 35S isotope disposal bins Reagents 2x SSC 50% formamide/2xSSC/10 mM 2-mercaptoethanol 4xSSC/TE RNAse A (10 mg/ml) ethanol (i.e., 30, 50, 70, & 90%) each containing 0.3 M ammonium acetate 100% ethanol METHOD 1. Remove each of the slides from the hybridization chamber and place, back-toback, in the metal slide holder (as much as possible, handle the slides by their frosted ends, away from the radioactive area). Immerse the slides in a bath of 2xSSC until each of the coverslips has fallen off of the slides. 2. Transfer slides to a tissue-tek holder and incubate for 30 min at 50˚C in 50% formamide-2xSSC-10mM 2-mercaptoethanol. After 30 min repeat this step, for a total time of 60 min. Discard the 2xSSC solution from step 1, as well as the used contents of the two reagent baths from step 2 in the liquid 35S waste bucket. 3. Equilibrate slides for 15 min at 37˙C in 4X SSC-TE [4X SSC containing 10mM Tris and 1 mM EDTA] 4. Digest the single-stranded 35S-cRNA that is non-specifically bound to the tissues (i.e., not hybridized to mRNA) with RNAse A, by incubating the slides for 30 min at 37˙C in RNAse (20 µg/ml) in 4xSSC-TE. Discard the used RNAse digestion buffer in the liquid 35S waste bucket. 5. Wash the residual RNAse from the slides for 30 min at 37˙C in 4xSSC-TE

87

6.

7.

8.

9.

Perform one final high stringency wash to remove non-specifically bound, digested 35S-UTP (or larger nucleotides) by incubating the slides for 60 min at 50˚C in 50% formamide-2X SSC-10mM 2-mercaptoethanol. Discard the used wash solutions in the liquid 35S waste bucket. Equilibrate the slides to 2xSSC by incubating them for 3-5 min (at room temperature) in this solution, and then dehydrate them by sequentially transferring them through a graded series of ethanol baths (30%, 50%, 70%, and 93%; each containing 0.3M ammonium acetate), keeping the slides in each for ≈30 sec. Complete the dehydration process in a 100% ethanol bath (30 sec) and then transfer the slides to a paper towel on the bench and allow them to air dry for 5 -10 min.

With the slides laid out flat on paper towels, scan each with a Geiger counter to get a feeling for the levels of radioactivity associated with each (this will determine roughly the exposure times for the autoradiography -- short or long exposure time), and label each of them with some sort of identification number. These numbers will need to be visible in the darkroom, under safelight illumination, so they are best done with a magic marker, on a clear section of the glass that will not be come in contact with the autoradiography emulsion (i.e., immediately adjacent to the painted or frosted surface of the slide). Return the slides to tissue-tek holder(s), clearly separated into "early" and "late" development groups. Since all subsequent steps are performed in the darkroom under safelight illumination, remember clearly exactly how you have allocated your slides. Subsequent steps are performed in the darkroom under safelight illumination: 10. Place an aliquot of emulsion in alight-proof holder (half-filled with water) within a 42-45˚C water bath. Allow 10-15 min for the emulsion to melt. Also prewarm a the slide mailer. 11. When the emulsion is melted, fill vertical slide mailer with emulsion. 12. Dip a clean (blank) slide in the emulsion and check for smooth, "bubble-free" coating. One at a time, gently dip each experimental slide in the emulsion, withdraw it and wipe the back with a glass slide or razor blade and then standing vertically against the inner sides of drying boxes. Place the covers on the boxes so that they are light-proof (which will allow you to open the door of the darkroom and walk out) and allow slides to dry for 30 min. Return the unused emulsion from the mailer tube to the centrifuge tube and return it to the refrigerator. 13. When the slides are dry, place each into black slide boxes, wrap in 2 layers of foil, label with tape, and store in a -20˚C freezer.

88

4.2.5 Autoradiograph development & counter-staining Materials staining coplin jars slide staining rack cover slips Reagents Kodak D19 developer (diluted 1:1 with H2O) H2O Kodak rapid fixer running water bath 60% ethanol bath 0.2% toluidine blue in 60% ethanol bath acetone bath (2) xylene bath (2) entellen or permount mounting medium METHOD 1. Remove slides to be developed from the freezer and allow the still foil-wrapped boxes to come to room temperature. 2. In the darkroom, under safelight illumination, transfer the slides to a tissue tek slide holder, and then place them first in the D19 developer for 2.5 min, then in the H2O for 15 sec, and finally in the fixer for 5 min. (Within a minute or two of 3. 4. 5. 6.

transferring the slides into the fixer, it is safe to turn on the lights). Soak the slides in gently running water for ≥2 hours. Transfer slides into 60% ethanol for ≥30 sec, then into the 0.2% toluidine blue in 60% ethanol for ≈30 sec Dip the slides in the water bath 3 times and then transfer to the first acetone bath for 2.5 min, followed by a second acetone bath for another 2.5 min. Transfer to xylene #2 for 2.5 min, then to xylene #1 for 2.5 min (complete submersion is required to remove all H2O, which will irreversibly turn the dehydrated emulsion opaque)

7.

Place a drop of permount on the slides and coverslip carefully, avoiding air bubbles.

89

4.3 Semi-quantitative RT-PCR to detect cytokine mRNA Polymerase chain reaction (PCR) amplification of cDNA from reverse-transcribed mRNA is perhaps the most powerful method of detecting transcripts in cells. PCR primers for most of the human and mouse cytokines are readily available commercially, either as pre-packaged or as custom-synthesized products. The sequences for custom synthesis are obtained from the scientific literature. The protocol proposed herein is a generic one which is based on the GIBCO/BRL product instruction manual for their PCR kit (Cat. No. 18089-011). Protocols specific for individual cytokines (see §5.5, Appendix E: Human cytokine RT-PCR primers) are usually published with the sequences in the literature, and using these will often circumvent your having to develop your own protocol. The method is made semi-quantitative by virtue of amplifying cDNA for both the cytokine of interest, as well as that of a house-keeping gene of interest (e.g., actin -- many propose that the levels of actin mRNA change little as a result of cellular stimulation), then comparing the signals of each reaction after the PCR amplification. The ratios of the cytokine signal to that of actin will change if the mRNA levels for the cytokine were altered as a result the original cell or tissue stimulus or pathophysiologic process(es). Materials thermocycler 42 & 70˙C water baths & an ice bath micropipetter (0.5-10µl) and tips horizontal gel electrophoresis apparatus and powerpac Reagents purified total cellular RNA (see §4.1.1) oligo(dT) DEPC-treated H2O 10x PCR buffer () 50 mM MgCl2 10 mM dNTP mix (dATP, dCTP, dGTP & dTTP) 100 mM dithiothreitol (DTT) M-MLV RT (murine Moloney Leukemia Virus reverse transcriptase; 200 U/ µl) 3' & 5' oligonucleotide primers (target mRNA-specific; e.g., actin & cytokine primers) Taq DNA polymerase

90

agarose TAE buffer ( mM Tris/ mM sodium acetate/ mM EDTA; pH ) ethidium bromide (10 mg/ml) DNA sample prep buffer 100 bp DNA oligonucleotide ladder (molecular weight standards)

4.3.1 First strand cDNA Synthesis using Oligo(dT) priming This procedure is designed to convert 1 to 5µg of total RNA into first strand cDNA 1. Prepare RNA/primer mixtures in sterile 0.5 ml tubes as follows: 1 to 5µg total RNA x µl oligo(dT) 1 µl DEPC water to 12 µl (total volume), then mix and spin briefly. 2. Incubate each sample at 70˚C for 10 min to denature the mRNA and then incubate on ice for at least 1 min. 3. Prepare the following reaction mixture, adding each component in the indicated order (for n samples -- but prepare the reaction mix for n+1 reactions to ensure sufficient levels for all reactions.)

4. 5. 6. 7.

Component Each reaction (µl) 10X PCR buffer 2 50 mM MgCl2 1 10mM dNTP mix 1 0.1M DTT 2 DEPC H2O 1 Add 7 µl of reaction mixture to each RNA/primer mixture, mix gently, and collect by brief centrifugation. Incubate at 42˚C for 5 min. Add 1 µl (200 units) M-MLV RT to each tube, mix and incubate at 42˚C for 50 min. Terminate the reactions at 70˚C for 15 min. Chill the tubes on ice. The samples are now ready for PCR amplification reaction.

91

4.3.2 PCR amplification of the target cDNA The first cDNA may be amplified directly using PCR. Use only 10% of the first strand reaction for PCR. Adding larger amounts of the first strand reaction may actually decrease the amount of product synthesized. 1. Make the 2x stock buffer (recipe for 500µl): 100µl 10x PCR buffer 30µl 50 mM MgCl2 20µl 10mM dNTP mix 350µl DEPC H2O 2. Prepare the following reaction mixture (for n samples), and mix well. 25 x n µl 2x stock buffer 0.5 x n µl 3'-primer 0.5 x n µl 5'-primer 21.5 x n µl H2O 0.5 x n µl Taq DNA polymerase for each reaction, add 2 µl RT reaction product to 48 µl of above mixture (use 0.5ml tubes) and mix well. 3. Place the samples in the thermocycler, programmed as follows: 1 cycle 94˚C 3 min (initial denaturation) 30 cycles: 94˚C 30 sec (cycle internal denaturation) 55˚C 30 sec (primer-target annealing temp) 72˚C 1 min (primer extension rx) hold at 72˚C for 7 min to complete the last extension, then hold indefinitely at 4˚C until ready to analyse. 4. Analyze 5-20 µl of the amplified sample by agarose gel electrophoresis.

92

1.

2.

3. 4.

20

4.3.2 Detection of RT-PCR products Pour a 1.2% agarose-TAE buffer gel, approximately 7 mm thick, with sufficient lanes to run each of the samples and a 100 bp DNA oligonucleotide ladder. (Be sure to allow the gel to polymerize sufficiently such that the bottoms of the well do not break when removing the well-forming comb.) water 32.3 ml agarose 0.26 g 40x TAE buffer 0.825 ml 10 mg/ml ethidium bromide 3.3 µl Heat the water/agarose to boiling in a microwave to dissolve the agarose, then cool this solution to 56˚C and add the TAE and ethidium bromide 20. Prepare the actin and companion cytokine PCR reaction products and 100 bp molecular size standards for gel analysis by heating to 65˚C for 10 min in DNA sample prep buffer containing 1µl ethidium bromide. 5-20 µl of the amplified sample 5-10 µl DNA sample prep buffer 1 µl ethidium bromide Load the samples and 100 bp ladder into the wells and run at 50-70 mA until the lead dye front has migrated approximately 2/3 of the way through the gel. Place the gel on an ultraviolet light-box, and examine the banding patterns and relative amounts of PCR products in each lane using computer-assisted image analysis of the illuminated gel (or alternately by eye). Be sure that the individual band signals have not reached the saturation point for the image analyser, or accurate band comparisons will not be possible.

At temperatures above 56˚C the gel apparatus will warp badly, so do not pour the gel into the mold until it is sufficiently cool

93

APPENDICES: 5.1 APPENDIX A -- GENERAL METHODS 5.1.1 Anti-sheep RBC antisera (preparation of) 1. 2. 3. 4. 5.

Mouse anti-SRBC antiserum can be prepared as follows: Inject BALB/c mice with 200 µl of a10% suspension of SRBC in PBS. Two weeks later inject them again with 200 µl of a 10% SRBC suspension. Approximately one week later collect blood from the mice, and allow it to clot in a glass tube, first for 1 h at room temperature and then overnight at 4˙C. Inactivate the complement (C') cascade activity of the serum by heating it to 56C for 60'. Titrate the serum for SRBC agglutination activity.

5.1.2 Cell counting with a hemocytometer Materials hemocytometer & coverslip single cell suspension of cells to be counted 20 µl micropipetter and tips eppendorf tubes 0.5 ml push button counter microscope Reagents 0.4% trypan blue in saline METHOD 1. Cap and gently invert or otherwise swirl cells several times to ensure an even cellular distribution 2. Withdraw 20 ul of cells to a 0.5 ml eppendorf tube and add an equal volume of 0.4% trypan blue 3. Pipette mixture up and down several times to mix the cells 4. Transfer ≈10 - 20 µl of the cell suspension to the hemocytometer (with coverslip in place). Capillary activity will draw the cells under the cover slip and thereby fill the viewing chamber 5. Examine the cells under the microscope, first at low power setting and when you have your bearings under the scope, switch to higher magnification for actual cell counting. 6. You will note that the chamber is divided up into 9 larger squares, each of which is in turn subdivided. Count the total numbers of cells in each of 5 of the larger squares (e.g., central , left, right, top and bottom ones), noting the cell count in each. You should count all cells that lie inside the boundary lines of the squares, and you should also count the cells that fall on top of the lines delineating two of the four sides (for consistency, pick whichever ones are easiest for you to remember, e.g., I always include those on the top and left-hand side lines).

94

HEMOCYTOMETER FIELD square 1 2 3 4 5 mean

7. 8.

9.

2.8

Determine the numbers of non-viable cells by counting the numbers of cells with nuclei that are stained intensely blue (trypan blue is a vital stain for dying, but not healthy cells). Calculate the mean number of cells (both viable and non-viable) in each of the 5 larger squares. Each of these squares contains total volume of 0.1 mm 3 (or 10-4 cm3). In addition, since you used equal volumes of cell suspension and trypan blue for counting, you have diluted your cells two-fold. Therefore, to calculate the cell concentration (in cells/ml) in your original cell suspension, take the mean numbers of cells in the large squares and multiply by 2 (your dilution factor) and by 104 (volume adjustment). For example, if you had a mean of 24 cells/large square, the concentration of your original cell suspension would be: 24 x 2 x 104 = 48 x 104 cells/ml To calculate the cellular viability in your preparation, use the following formula:

viability (% ) = 10.

cell count 4 3 1 2 4

# unstained cells   × 100  total # stained + unstained cells

Clean your hemocytometer immediately after use, using H2O followed by 70% ethanol, and allow to air dry.

N.B. If your cell preparation includes clumps of cells, you have to decide whether you can get an accurate estimate of the cell numbers with the clumps present. If you feel that the clumps are evenly distributed in your original cell suspension, then you might simply vigorously pipette the cells in the eppendorf tube (i.e., the trypan blue/cell mixture) to disperse the clumped cells and then recount. However, if the cells are very badly clumped, you will have to disperse the cells in the stock suspension, either by vigorous pipetting (which is very inefficient) or by re-centrifuging and dispersing the cell pellet correctly.

5.1.3 C3b opsinization of yeast (zymosan A) 1. 2. 3.

Activate the zymosan A by boiling for 10 min in PBS and then washing with PBS. Resuspend to a final concentration of 10 mg/ml. To coat the zymosan beads with C3b, add 200 µl of fresh mouse serum to 2 mg 'activated' zymosan and incubate for 15 min at 37˙C. Wash the yeast with PBS and store at 4˙C until ready to use.

5.1.4 Cytocentrifuge preparations

95

The cytocentrifuge is simply a centrifuge that deposits cells from a suspension culture directly onto a microscope slide, usually in an area about 6 -8 mm in diameter. It is an ideal way to prepare the cells for microscopic examination. Ideally, you want to have somewhere in the order of 5x104 - 105 cells/slide. Materials cytocentrifuge (with chambers, clamps, filters, etc...) glass microscope slides METHOD 1. prepare cell suspension of ≈5x105 - 106 cells/ml 2. assemble centrifuge chambers with labeled slides and filters in correct orientation and load chambers into the centrifuge. 3. add 50 - 200 µl of cells to each chamber (depending on the cell numbers, concentrations, etc...) 4. centrifuge the cells for 4 - 5 min at ≈1500 rpm 5. when the rotor stops, remove slides from the chambers (being careful not to scrape the cells off of the slides in this process) and allow the cells to air dry (alternately, you can fix the cells in acetone or alcohol for ≈15 sec and then air dry) 6. clean the disassembled chambers and clamp assemblies with H2O and allow to air dry after use. 7. the air-dried cells can be stained immediately or, depending on their purpose, stored either at room temperature or in the freezer.

Dialysis tubing (preparation) Dialysis tubing can be prepared well in advance and stored in the refrigerator for extended periods of time. It is sometimes to convenient to prepare a very large batch so that you will have it on hand whenever you need it. Most dialysis tubing has been treated with glycerol by the manufacturer in order to prevent excessive drying out (and cracking) during storage -- for most purposes, this glycerol should be removed from the tubing before use. Materials hot plate beakers dialysis tubing of required size (and molecular weight cut-off) Reagents 0.05% EDTA (0.5 g/l; or 3.4 ml of 0.5 M stock/996.6 ml H2O) 0.05% Na2CO3 (0.5 g/l H2O) distilled H2O 50%ETOH METHOD 1. cut tubing to suitable sizes, allowing for tying or clamping ends or prepare large sections 2. boil the sections of tubing for ≈10' in 0.05% EDTA 3. boil a second time for 10' in 0.05% Na2CO3. 4. boil a third time for 10' in 0.05% NaCO3. 5. rinse several times with H2O and, finally, store at 4˙C in 50% ethanol (keep the beaker covered with parafilm)

5.1.6 Fixation of tissues for ISH or IHC.

Fix 3-6 mm blocks of tissue for 3 h (or cell suspensions for ≈30 min) on ice in ISH fix (§5.3), then transfer the tissues/cells to 70% ethanol and store at -20˚C until ready to process to paraffin blocks by routine methods. N.B. The signals from both ISH and IHC procedures seem to be superior if the tissues are processed to paraffin expeditiously rather than holding them for prolonged periods in 70% ethanol.

96

5.1.7 Lung cells (single cell suspension) Single cell suspensions of lung cells are very useful for the determination of immunologic reactivity of the lung associated immune compartment. The lungs of animals undergoing strong pulmonary challenges with allergen or other disease agents often contain very high numbers of perivascular and peribronchial lymphoid cells, and in some species these animals also develop discreet collections of BALT. The immunologic reactivity of the lung tissues can be profoundly different than that of the spleen or other non-pulmonary lymphoid organs. Materials mice, anaesthetic, surgical instruments, hemocytometer CO2 incubator, 15 ml polypropylene tubes Reagents DMEM-10%, MEM density gradient media (e.g., Lymphocyte Separation Medium, Percoll...; optional) collagenase (Worthington Scientific); hyaluronidase (Worthington Scientific) MEM containing 1.5 mg/ml collagenase and 0.75 mg/ml hyaluronidase METHOD 1. Obtain lung tissues and dice them finely (to ≤0.5 mm 3) with a scalpel, in MEM medium. 2. Transfer the tissues into fresh MEM containing collagenase/hyaluronidase (≈1 g tissue/10 ml enzyme cocktail) and incubate at 37˚C for 60 min, ideally on a rocker platform. 3. Disperse any undigested fragments of tissue by repeated aspirating through a 20 ga. needle on a10 ml syringe. 4. Filter the digested tissues through ≈4 layers of sterile gauze to remove undigested tissue fragments, and wash the dispersed cells in DMEM-10%. 5. Either use the cells directly or, if necessary, carry on with the purification, fractionating the cells by density gradient centrifugation. 6. Determine the cell yield and viability by direct counting of trypan blue-treated cells using a hemocytometer.

5.1.8 Lysis of red blood cells There are a number of options available for lysing contaminating RBC's in a cell preparation, including commercially available preparations. One of the most simple is hypotonic lysis, which takes advantage of the fact that red cells undergo lysis in H2O very quickly, while nucleated cells are damaged much more slowly. Therefore, a very brief pulse with H2O will lyse all of the red cells and leave the WBC intact. Alternately, you can lyse them by incubation in ammonium chloride lysis solution for 5 min 5.1.8.1 Hypotonic lysis with H2O 1. Sediment all of the cells in your preparation by centrifugation, and aspirate all of the medium from the cell pellet. 2. Briskly flick the tube to resuspend the cell pellet (to an even paste on the walls of the tube). 3. Start a countdown timer set to 25 or 30 seconds and, when it reaches 15 seconds, add 9 volumes of double distilled H2O to the cells and vortex the tube by hand to rapidly disperse the cells throughout the H2O. 4. When the clock reaches 0 seconds, add 1 volume of 10x HBSS to the H2O suspension of cells and rapidly disperse it throughout the cell suspension by swirling or inverting the (capped) tube. TIMING IS CRITICAL! 5. Wash the cells two times in DMEM-0% FCS to get rid of the RBC ghosts (plasma membranes). 5.1.8.2 Lysis with ammonium chloride 1. Perform steps 1 & 2 as above in the hypotonic lysis protocol 2. Resuspend the cells in 5 ml of ammonium chloride lysis solution and let stand for 5 min. 3. Wash the cells two times in DMEM-0% FCS, as above

97

5.1.9 Opsinization of SRBC with antibody 1. 2.

3.

Generate a 0.5% suspension (vol/vol) of sheep red blood cells 21 (SRBC) in PBS. To coat the cells with anti-SRBC, add 50 µl of heat-inactivated mouse anti-SRBC serum to 300 µl of the SRBC suspension, and incubate for 30 min at room temperature. (anti-SRBC antiserum can be generated by vaccinating a mouse with 0.2 ml of 0.1% SRBC, and bleeding it ≈3 wk later). Wash the cells with medium and store at 4˙C until ready to use.

5.4.10 Protein assay in microtiter plates Materials pipettes, tips, multichannel pipetter 96 well plate microplate reader filter paper Whatman #1 Reagents: Bio-Rad concentrated dye reagent protein standard (we will use bovine serum albumin; BSA) METHOD: 1. dilute dye reagent 1:5 with H2O (ie. 1 part reagent + 4 parts H2O), and filter through Whatman #1 filter paper. (store at 4˙C; stable for 2 weeks) 2. dilute BSA standards to a range that should bracket that of the unknowns -- try standards of 5.0, 10, 25, 50, and 100 µg/ml. 3. Pipette 160 µl of standard and sample solution into separate wells of the microtitre plate 4. Add 40 µl of the diluted dye reagent to each well and mix the samples thoroughly by repeated pipetting. Incubate the plates at room temperature for at least 5 min, but no more than 1 h. 5. Measure the absorbance at a wavelength of 595 nm.

5.1.11 Splenocytes (single cell suspensions) Materials BALB/c mouse anaesthetic (methoxyfluorane) clinical centrifuge, 15 ml centrifuge tubes (polypropylene [pp], not polystyrene [ps]) pipettes/pipettors (micropipettes and macropipettes) Reagents DMEM/10% FCS (Appendix B) 70% ethanol optional: sterile surgical tools (scissors, forceps) METHOD:

21

SRBC are obtained by venipuncture (usually the jugular vein) of sheep directly into EDTAcontaining syringes or alternately into regular syringes followed directly by transfer of the blood into EDTA-containing tubes. The cells are washed two times with Alsevers solution (see Appendix C) and resuspended in Alsevers solution, which is a good long-term storage reagent for SRBC.

98

1.

2.

3.

4.

5.

Euthanize a mouse (e.g., BALB/c) by inducing surgical-level anaesthesia with methoxyfluorane and dislocating the cervical spinal column. To dislocate the cervical spine effectively, place the mouse down on the bench in sternal recumbancy (belly down), firmly place an instrument (e.g., forceps or closed scissors) across the back of the neck and holding the mouse in position with this instrument, firmly, but not too forcefully, pull the mouse backwards by the tail. You will hear a popping sound as the neck dislocates. When the mouse ceases breathing (very shortly after step 1), lay it on its right side, and soak the left side with 70% ethanol. Holding the skin over the spleen up into a tent, incise it with a pair of scissors, and then grasp both sides of the incision firmly between the thumb and forefinger of each hand. Pull the skin open and reflect it full back, both dorsally and ventrally. Open the body wall over the spleen with the scissors, pull the spleen up from the other viscera and clip away the vascular attachments and fat. Place the spleen in a petri dish containing DMEM-0%FCS and tease the tissues apart using two pairs of fine, curved forceps. Continue teasing until all of the tissue clumps are dispersed as much as possible. Using a pipette aid (electrical pipetting device) and a 10 ml pipette, vigorously pipette the cells 20 - 25 times, to completely break up the clumps. Filter the dispersed spleen cell preparation through 3 - 4 layers of sterile gauze drawn across the top of a 15 ml centrifuge tube. Remove 20 µl of the filtrate (now a single cell suspension) for hemocytometer counting. Wash the cells once by centrifuging and resuspending to the desired final concentration in the desired medium. For our purposes, this will usually be 3x106 cells/ml of DMEM-10% FCS. From one normal mouse spleen, you may obtain anywhere from 2 - 12x106 nucleated cells.

5.1.12 Splenocytes (spleen cell-conditioned medium) Materials single cell suspension of spleen cells clinical centrifuge, 15 ml centrifuge tubes (polypropylene [pp], not polystyrene [ps]) pipettes/pipettors (micropipettes and macropipettes) T75 tissue culture flasks Reagents: DMEM/10% FCS (Appendix B) concanavalin A (4 mg/ml stock solution in PBS, or DMEM or RPMI, etc..) METHOD 1. Generate a single cell suspension of spleen cells from a normal mouse with a cell concentration of 3x106 cells/ml of DMEM-10% FCS. Set up the cells in a T75 flask. 2. Add ConA to the cultures to a final concentration of 4 µg/ml and place the cells in the CO2 incubator for 4 days. 3. Prior to harvesting the cells, examine the cultures to confirm that the cells have aggregated as they should following ConA stimulation. Provided the cells appear as they should, transfer them to 50 ml centrifuge tubes and sediment the cells by centrifugation for 10 min at 1500 rpm. 4. Aliquot the supernatants and store at either -20˙C or -80˙C. This conditioned medium will keep its activity for many months.

99

5.1.13 Staining Protocols 5.1.13.1 Giemsa stains 5.1.13.1.1 Wrights-Giemsa staining and morphologic identification of PBL Materials cytocentrifuge cell preparations, etc.. Wrights-Giemsa stain (10% Wrights-Giemsa solution in buffer) neutral buffered water METHOD 1. Apply 50 - 100 µl of stain to the cells on each slide, and allow to sit for 10 min. 2. flush the scum from the slide with ≈0.5 ml of buffered water 3. Add 100 µl of neutral buffered water to the cells, incubate for 1 min, then air dry standing up. 4. Mount coverslips on the slides with Permount or Entellen 5. Examine the cells under 40x - 100x power using a compound microscope. The cells can be differentiated based on their staining and morphology, as in figure x. Results The appearances of the different types of mouse PBL following Giemsa staining are demonstrated below. In effect: POLYMORPHONUCLEAR CELLS (all have highly lobulated nuclei) --eosinophils have rather large, red-stained cytoplasmic granules that fill all of the extranuclear compartment of the cells. -- neutrophils have rather small, pale pink-stained cytoplasmic granules that fill the extranuclear compartment of the cells. --in the mouse, basophils are present in such low numbers that some authors state that mice do not have basophils. They appear much like monocytes, with one or two medium-sized deep purple-staining granules. You probably will never see a mouse basophils (unless you begin working with these cells. MONONUCLEAR CELLS (all have round to slightly indented nuclei) -- lymphocytes are present in substantial numbers in a number of compartments. Most circulating lymphocytes are unstimulated ones and appear as very small cells that contain large nuclei. In fact, often the cytoplasm appears as a small rim of powder blue-coloured cytoplasm. Activated lymphocytes (plasma cells) tend to be large, with nuclei the same size as that of the small lymphocytes, but they have abundant cytoplasm. The nuclei are usually very round, with few if any indentations. monocytes are much like large lymphocytes, but the nuclei are usually indented. These are very simplified descriptions of the WBC, but they will probably serve to fulfill most of your needs as far as differentiating these cells.

5.1.13.1.2 Giemsa staining of tissue sections Materials tissue sections on slides Giemsa stain xylene, 100% ethanol (& 95, 70, & 50%) isopropanol METHOD 1. Deparaffinize and rehydrate the tissue sections (2x 5' in xylene; 2x 30" 100% ethanol; 1x 30" 95% ethanol; 1x 30" 70% ethanol; 1x 30" 50% ethanol. 2. Transfer the slides into the Giemsa stain bath & hold for 1 - 2 h . After one hour, rinse the slides with water as in step 3 and briefly look at the sections under the microscope. If they appear sufficiently stained, proceed with step 4, if not continue staining until the desired intensity of stain is achieved.

100

3. 4. 5.

Briefly rinse the slides in tap water. Dehydrate the slides by transferring through three baths (2.5 min each) of isopropanol, one bath (2.5 min) isopropanol/xylene [1:1]; and two baths of xylene (5 min each). Mount coverslips on the slides with Permount or Entellen

5.1.13.2 Gills hematoxylin for IHC Materials Gill's hematoxylin solution (1:5 dilution of commercial stain in H2O) 10% methanol, Tris-buffered saline (TBS), H2O Aqueous mounting medium METHOD 1. Transfer the IHC-stained slides from H2O into the Gill's stain for 45 sec 2. Transfer the slides quickly through 10% methanol (three quick dips to get rid of excess stain). 3. Transfer the slides into the TBS for ≈1 min (to blue or differentiate the stain), then into the H2O bath until ready for cover-slipping. 4. Cover-slip the slides with aqueous mounting medium.

5.1.13.3 Toluidine blue staining (ISH counter-stain) Materials 0.2% toluidine blue in 60% ethanol xylene, 60% ethanol, isopropanol, 50% isopropanol/50% xylene METHOD 1. Place the water-washed, developed ISH slides into the 60% ethanol bath for ≥3 min 2. Transfer the slides to 0.2% toluidine blue in 60% ethanol and hold for 30 seconds, then quickly rinse the excess stain from the slides by dipping in water. 3. Transfer the slides through two changes of isopropanol (2.5 min each), one change of 1:1 isopropanol:xylene (2.5 min), and finally two changes of xylene (also 2-3 min each). 4. Cover-slip the slides with permount.

5.1.14 Standard curves (e.g., cytokines) For a number of different assays, you will need to perform serial dilutions to generate standard curves. Depicted is a typical set of dilutions (this one for TNFα, for use in the L929 cell cytotoxicity assay). 1. Label a series of eppendorf tubes (in this case, 40, 4, 0.4, 0.04, & 0.004 U/well), and add 199 µl of standard dilution medium (DMEM-0% FCS/ActD) to the first and 180µl to the others. 2. To the first tube, add 1 µl of stock cytokine (in this case, 1 µl of stock TNFα = 400 U), such that 20 µl of the resulting solution will contain the amount of cytokine needed for your highest standard concentration (here, 20 µl of the '40' tube will now contain 40 U TNF). Serially transfer 20 µl from each tube to the next tube in the row, such that you are performing serial 10-fold dilutions. Each time you add the 20 µl to the next tube, make sure that you thoroughly mix the tubes before withdrawing the 20 µl for the next step. You don't need to change pipette tips between tubes.

101

1 µl TNF stock

final, TNF U/well:

3.

20µl 40

20µl

20µl .4

4

20µl .004

.04

40

4.0

0.4

Vol TNF/eppendorf:

1 µl

20µl

20µl

Vol. DMEM/ActD:

199 µl

180µl

180µl

0.04 20µl 180µl

1

To add the standards to the plate, start adding the most dilute one to the replicate wells, and sequentially move up the concentration gradient. This way you won't have to change pipette tips for each standard in the series, unless you contaminate a tip in the process.

5.1.15 TESPA-treatment of glass slides for in situ hybridization or histology

1.

2. 3. 4.

Loss of tissue sections from glass slides during ISH or routine histology can be a real problem. Fortunately, it is one that also is easily overcome by pretreating the slides with TESPA (aminopropyltriethoxysilane or organosilane) Load slides into the glass racks and bake for 3 h at 300˙C. Since the glass racks are of cast glass, they break very easily with rapid heating and cooling, so warm and cool them gradually - that means put them in a cold oven and then turn on the heat and also allow them to cool completely before removing them from the oven. Wash the slides in a 2% solution of organosilane in high-grade acetone for ≈1 min with gentle agitation. Rinse the slides in high-grade acetone for 1 min and air-dry. Store the slides at room temperature indefinitely.

(N.B. If section or cell loss from the slides is still a problem, even greater adhesiveness can be achieved by treating the dried slides after step 3 with a 10% formaldehyde solution for ≈60 min, followed by air drying)

102

5.2 APPENDIX B -- REAGENTS & SOLUTIONS CELLULAR IMMUNOLOGY REAGENTS Acidified isopropanol, for use in solubilizing the water-insoluble formazan precipitate formed within the mitochondria of cells cultured in the presence of MTT. To prepare acidified isopropanol, add 376 µl of concentrated HCl to 100 ml of isopropanol. Store at room temperature in an amber or foil-wrapped bottle. Actinomycin D is a potent transcription inhibitor that is used routinely in the TNF assay to increase the sensitivity of the L929 cells to the cytotoxic effects of TNF. We prepare it as a 5 mg/ml solution (or perhaps more accurately suspension) in 95% ethanol. It should be agitated by vigorous pipetting before aliquots are removed for use. Alsevers solution Recipe for 1 liter To 900 ml of H2O, add: 20.5 g dextrose (>114 mM) 7.9 g sodium citrate-2H2O (> 27 mM) dissolve the reagents & adjust pH to 6.1 with 1M citric acid Add H2O to 1000 ml & filter sterilize Ammonium chloride For lysis of red blood cells. Recipe for 1 litre: To 900 ml of H2O, add: 2.42 g Tris 7.56 g NH4Cl pH to 7.2 with HCl Add H2O to 1000 ml & filter sterilize Ammonium sulfate (saturated solutions) Recipe for 100 ml: To 100 ml of H2O, add: 76 g of ammonium sulfate bring to a near boil allow to cool & then sit overnight at room temperature. (the solubility of ammonium sulfate is 76 g/100 ml at 100˙C) Borate-buffered saline For dialysis with purified IgM antibodies. Recipe for 1 liter To 900 ml of H2O, add: 5.72 g sodium borate 8.76 g sodium chloride pH to 8.5 with 1 M NaOH Add H2O to 1000 ml & filter sterilize ELISPOT & ELISA Carbonate Coating buffer Recipe for 1000 ml To 900 ml of H2O, add: 1.6 g Na2CO3 (>15 mM) 2.9 g NaHCO3 (>35 mM) 0.2 g NaN3 (>3.1 mM) dissolve the reagents & adjust the pH to 9.5 with NaOH. Autoclave to sterilize.

103

Isotonic Percoll Density Gradient Medium To prepare any amount of isotonic Percoll, mix together: 9 volumes of stock Percoll (purchased from Pharmacia as a 100% solution) 1 volume of 10x HBSS (Ca++ and Mg++-free) This will make the Percoll isotonic with the cells to be fractionated on the gradients. PAGE running buffer (5x; Tris-glycine) Recipe for 1 litre To 800 ml of H2O , add: 15.1 g Tris base 72 g glycine 5.0 g SDS dissolve contents and add H2O to 1 liter (do not adjust pH) store at 4˙C and dilute 5x with H2O before use PAGE 2x sample prep buffer (denaturing, but not reducing) Recipe for 25 ml To 10 ml of H2O , add: 6.25 ml of PAGE 4x stacking gel buffer 5 ml glycerol 1 g SDS 0.25 mg bromophenol blue add H2O to 25 ml final volume and mix. aliquot and store at -70C PAGE gel fix buffer 25% (vol/vol) isopropanol 10% (vol/vol) acetic acid (can be stored indefinitely at room temperature) Phosphate-buffered saline (PBS) Recipe for 1000 ml To 900 ml of H2O, add: 0.23 g NaH2PO4 (anhydrous; > 1.9 mM) 1.15 g Na2HPO4 (anhydrous; > 8.1 mM) 9.0 g NaCl (>154 mM) dissolve the reagents & adjust the pH to 7.2-7.4 with 1 M NaOH or 1 M HCl. Autoclave to sterilize. It may be convenient for you to make this up as a 10x PBS solution, that can simply be diluted 10-fold and used as is. Giemsa Stain (prepare fresh each time) Recipe for ≈125 ml To 100 ml of distilled water, add: 2.5 ml of Giemsa stock solution 3.0 ml of methanol 11.0 ml of 0.1 M citric acid 6.0 ml of 0.2 M disodium phosphate buffer Briefly stir to mix ingredients before use. Giemsa Stock Solution (for Giemsa stain) Recipe for ≈100 ml To 25 ml of glycerol, add:

104

3.8 g Giemsa powder Heat the glycerol to 60˙C for ≈2 h, and work the stain into the glycerol (either with a mortar and pestle or stirring) Add 75 ml methanol and continue stirring overnight. Store at room temperature indefinitely 0.4% Trypan Blue (in PBS) is a vital dye (i.e., is used with live cells) that is not taken up by viable cells, but is taken up by effete cells. The nuclei of these cells stain an intense blue colour, while fully dead cells or live ones take up no dye. The dead ones can usually be distinguished morphologically from the live ones. For use in hemocytometer counting of cells, dilute the cell samples 1:1 with 0.4% trypan blue.

MOLECULAR BIOLOGY REAGENTS Agarose/formaldehyde/MOPS gel (for electrophoresis of RNA) Recipe for 220 ml gel (scale down as necessary): 137 ml of DEPC-treated H2O 2.64 g agarose dissolve the agarose in the water in the microwave or a boiling water bath & allow the solution to cool to 56˙C, then add: 39 ml of formaldehyde 44 ml of 5x MOPS buffer pour the 56˙C solution into the gel casting apparatus, & allow to cool completely before removing the well combs. Cesium Chloride (for isolation of total cellular RNA) Recipe for 100 ml of CsCl: 95.97 g CsCl 0.83 ml 3M sodium acetate (pH 6.0) Add H2O to 100 ml, DEPC-treat and autoclave DEPC-treated water (& other solutions) All water and solutions for use with RNA must be treated with diethylpyrocarbamate (DEPC) before coming into contact with the RNA. To treat a solution, just add DEPC directly to the solution to 0.1% final concentration with a pipette and shake the solution vigorously to disperse the DEPC (allow any built up pressure to escape from the vessel periodically, i.e., every minute), then allow the treated solution to sit ≈12 h at room temperature or at 37˙C, then autoclave to hydrolyze the residual DEPC. (Tris containing solutions cannot be treated with DEPC, which reacts rapidly with the amines in the Tris) Dithiothreitol (DTT; 1 M) is used in many solutions to prevent non-specific interactions between sulfhydryl groups. It is heavily used for the in situ hybridization protocols employing 35S-UTP probes. For the washing steps of the ISH protocols, 2-mercaptoethanol can be substituted. EDTA (0.5M); pH 8.0 To prepare 100 ml of 0.5 M EDTA, to 18.61 g of EDTA, add ≈90 ml of H2O. To dissolve the EDTA, pH the solution to>pH 8.0 (by adding 10M NaOH). After dissolution of the EDTA, re-adjust pH to 8.0. Guanidinium Isothiocyanate (GSCN); 5.5 M Recipe for 100 ml of 5.5 M GSCN: 64.98 g. guanidine thiocyanate 0.735 g. sodium citrate 0.5 g. sarcosine add DEPC-H2O to 98.6 ml & adjust the pH to 7.0 add 1.39 ml 2-mercaptoethanol and filter sterilize (ref: Okayama, Kawaichi et al., Meth Enzymol 154:3-29)

105

ISH 10x salts (store @ -20˚ or -70˙C) To prepare 10 ml, sequentially add to a 15 ml polypropylene centrifuge tube

106

ISH hybridization buffer (store @ -20˚ or -70˙C) To prepare ≈2.5 ml, sequentially add to a 15 ml polypropylene centrifuge tube: 1200 µl of deionized formamide 480 µl of 50% dextran sulfate (to decrease viscosity, pre-warm in microwave oven, & use a 5 ml pipette) (vortex vigorously at this point to thoroughly disperse the dextran sulfate) 240 µl of 10X salts (vortex before pipetting) 24 µl 1M DTT 24 µl yeast tRNA (10 mg/ml) 480 µl DEPC-H20 2448 µl (≈ total volume) vortex vigorously again to completely mix the reagents & check/adjust the pH (with paper) to 5.5 - 6.0 (use about 10-12 µl of 1M HCl) ISH fixative (prepare fresh each time) To prepare 100 ml, add together: 85 ml of 100% ethanol (RNAse-free) 10 ml of 40% stock formaldehyde (use a high grade of chemical) 5 ml of glacial acetic acid briefly mix, then store on ice until ready for use. Fix 3-6 mm blocks of tissue for 3 h on ice (or cell suspensions for ≈30 min), then transfer the tissues/cells to 70% ethanol and store indefinitely at -20˚C -- although it seems to be better to process tissues to paraffin blocks (by routine methods) than to hold them for prolonged periods in 70% ethanol. Northern blotting pre-hyb/hybridization solution To prepare 30 ml, mix together: 15 ml of deionized formamide 375 µl of salmon sperm DNA (s.s. DNA; boiled) (add the hot DNA to the formamide and vortex vigorously to completely disperse it, and then continue adding the rest of the ingredients 3 ml of 1 M HEPES 1.5 ml of 10 M NaCl 300 µl of 0.5M EDTA (pH 8.0) 3 ml 50X Denhardt's 3 ml of 10% SDS 1.5 ml of 10% Na pyrophosphate 2.32 ml of DEPC-H2O MOPS (1 M) 231.28 g MOPS powder add DEPC-H2O to 1000 ml, and filter sterilize (0.45 µm filter) 5X MOPS Buffer MOPS 0.2 M sodium acetate 50 mM EDTA (pH 8.0) 5 mM Add DEPC- H2O to 1000 ml

(200 ml 1M) (16.6 ml 3M; pH 7) (10 ml 0.5 M)

Phenol (salt-saturated) this recipe produces a very stable phenol solution. It stability largely arises from the extra anti-oxidants added relative to many other recipes (recipe, Dan Tenen, Harvard Medical School) 100g phenol (heat in a 56˙C water bath to melt the phenol 45.4 ml 2 M Tris pH 7.5 59.02 ml DEPC-treated H2O 11.35 ml m-cresol 454 µl 2-mercaptoethanol

107

227 mg hydroxyquinolone Reagents for purifying DNA from agarose gels (store in the dark at 4˙C) NaI solution to dissolve agarose gel. To prepare 100 ml, add together: 90.8 g NaI 1.5 g Na2SO3 add DEPC-H2O to 100 ml & mix the solution filter through Whatman #1 filter paper and then place 0.5 g Na2SO3 into a piece of dialysis tubing, tie off the ends & drop it into NaI solution (to keep it sodium sulfate-saturated. Ethanol wash solution (store at -20C) 50% EtOH 0.1 M NaCl 10 mM Tris (pH 7.5) General purpose restriction endonuclease buffers (no, low, medium & high salt)

reagent Tris/HCl (pH 7.5) MgCl2 dithiothreitol BSA (mg/ml) NaCl

none 100 mM 100 mM 10 mM 1 0M

salt level low 100 mM 100 mM 10 mM 1 0.5 M

medium 100 mM 100 mM 10 mM 1 1.0 M

. high 100 mM 100 mM 10 mM 1 1.5 M

RNA sample prep buffer (Northern analysis) 5X MOPS 200 µl formamide 484 µl formaldehyde 61 µl H2O 186 µl denature RNA in sample prep solution for 15' @ 65C RNA sample dye/loading buffer (for visualization of progress during Northerns) glycerol (final - 50%) 5 ml 0.5M EDTA (pH 8.0) (final - 1 mM) 20µl bromophenol blue (final - 0.4%) 40 mg xylene cyanol (final - 0.4%) 40 mg DEPC-H2O 5 ml add ≈2 µl of loading solution to each sample RNAse A (heat-inactivated to remove DNAse activity; 10 mg/ml) Prepare 10 mg/ml RNAse solution in 10 mM Tris (pH 7.4), 15 mM NaCl. Heat-inactive the DNAse by incubating for 15 min at 70˙C & then aliquot and store @ -20˙C. Salmon sperm DNA weigh out DNA, wet with a little EtOH, then add sufficient H2O to bring the DNA to a final concentration of 10 mg/ml. Shear the DNA by forceful passage through a18 ga needle & denature it by boiling for 10 min. Aliquot and store at -20C. (boil again before use) Sodium acetate (3M) 40.8g sodium acetate H2O, qs to 100 ml; pH > 6.0

108

treat with 0.1% DEPC, and autoclave

109

20X SSC (4 liters) NaCl 701.2 g Na citrate 352.9 g add H2O to 3 liters, pH to 7.0, and then H2O qs to 4 liters. STE buffer Tris EDTA NaCl H2O

10 mM 1 mM 0.1 M

(0.5 ml of 2M) (200µl of 0.5M) (1 ml of 10M) qs to 100 ml

110

5.3 APPENDIX C -- TISSUE CULTURE MEDIA Click's medium, 10% FCS, 2 mM L-glutamine, 1% antibiotic/antimycotic solution (Gibco; stock: 100 U/ml penicillin G, 100 µg/ml streptomycin sulfate, and 0.25 µg/ml amphotericin B), 5x10-5 M 2mercaptoethanol, and 10% Con A-stimulated mouse spleen cell-conditioned media) DMEM (Dulbecco's modified eagles medium; AKA Dulbecco's minimal essential medium). This is a general purpose medium, which can be purchased either pre-made or as a powder, from GIBCO. We generally have ours made up from powder by the Glassware & Media Preparation (GMP) laboratory in the department. In general, they prepare it with a bicarbonate buffer and Lglutamine, so that it is ready to be used as is. However, since L-glutamine degrades at 4˙C, then after a few weeks of storage, you need to supplement the DMEM stocks with L-glutamine. DMEM-0% FCS. For use in situations wherein you don't want any serum in your medium. Use the stock GMP DMEM: to 980 ml of DMEM, add 10 ml of 100x antibiotic/antimycotic solution from GIBCO (stock: 100 U/ml penicillin G, 100 µg/ml streptomycin sulfate, and 0.25 µg/ml amphotericin B), 10 ml of 5x10-3M 2-mercaptoethanol (and, if the medium is old, 10 ml of 100x L-glutamine). DMEM-10% FCS. To 900 ml of DMEM-0% FCS, add 100 ml of heat-inactivated fetal calf serum. Heat-inactivate by incubating the pre-warmed serum in a 56˙C waterbath for 30-45 min. For DMEM-5% FCS, etc, reduce the amounts of FCS proportionately, and increase the amounts of DMEM-0% FCS. DMEM-10% normal horse serum. With the exception that the serum source is different (i.e., normal horse vs fetal calf), this medium is the same as indicated for DMEM-10% FCS. DMEM-10% normal horse serum is used for the L929 cells in the TNF assay. HBSS (Ca++ and Mg++-free) This can either be purchased from GIBCO or prepared from scratch. A recipe for this reagent can be found in Current Protocols in Immunology. It is very convenient to purchase this as a 10x concentrated solution, for use in hypotonic lysis of red blood cells or in diluting Percoll MEM (minimal essential medium) This is an alternate general purpose medium, which can be purchased either pre-made or as a powder, from GIBCO. As with our DMEM, we have ours made by GMP, with bicarbonate buffer and L-glutamine. RPMI 1640 (Roswell Park Memorial Institute medium #1640). This is an alternate general purpose medium, which can be purchased either pre-made or as a powder, from GIBCO. As with our DMEM, we have ours made by GMP, with bicarbonate buffer and L-glutamine. RPMI-0% FCS. For use in situations wherein you don't want any serum in your medium. Use the stock GMP RPMI: to 980 ml of RPMI, add 10 ml of 100x antibiotic/antimycotic solution from GIBCO (stock: 100 U/ml penicillin G, 100 µg/ml streptomycin sulfate, and 0.25 µg/ml amphotericin B), 10 ml of 5x10-3M 2-mercaptoethanol (and, if the medium is old, 10 ml of 100x L-glutamine). RPMI-10% FCS. To 900 ml of RPMI-0% FCS, add 100 ml of heat-inactivated fetal calf serum. Heatinactivate by incubating the pre-warmed serum in a 56˙C waterbath for 30-45 min. For RPMI-5% FCS, etc, reduce the amounts of FCS proportionately, and increase the amounts of RPMI-0% FCS.

111

5.4 APPENDIX D -- MAINTENANCE OF CELL LINES 7TD1 cells (for assay of IL-6). 7TD1 cells are an IL-6 dependent murine hybridoma cell line that can be purchased from the American Type Culture Collection (ATCC #CRL ). They are maintained in RPMI 1640, 10% FCS, L-glutamine, antibiotics, 5x10-5M 2-Me and require a source of IL-6. 7TD1 cells are normally adherent, and are passaged with versene and trypsin. They must be maintained in a subconfluent state (i.e., ≤1x105 cells/ml), or they will lose their IL-6 responsiveness. In our hands, these cells are responsive to bovine, equine, murine and human IL-6. We maintain our cells in recombinant human IL-6. Cl.MC/C57.1 cells (C57 mast cells). Cl.MC/C57.1 cells are an FcεRI-positive, transformed murine mast cell line, that was ostensibly originally derived from the liver of a C57/Bl6 mouse. Recent molecular phenotyping evidence indicates that these cells arose instead from BALB/c mice. They are maintained in DMEM-10% FCS, and are a very potent source of many cytokines. These were the cells originally used to examine the production of many cytokines in mast cells. L-929 cells (for TNF bioassay). The line of L-929 cells that we are using are exquisitely sensitive to the effects of TNFα (ATCC # ). TNF will kill these cells with the kinetics observed with natural cytotoxic cells (i.e., ≈18 h), as opposed to natural killer cells (which require much less time to kill their targets). L929 cells are maintained in DMEM, 10% normal horse serum, L-glutamine, penicillin, streptomycin, fungisone (PSF), and 5x10-5 M 2-mercaptoethanol. The cells are necessarily maintained at sub-confluent levels (over-growth dramatically diminishes their sensitivity to TNF). They comprise an adherent cell line, that is best split by minimal trypsin digestion in medium lacking FCS, followed quickly thereafter by washing with regular growth medium to prevent over-digestion of the cells. LM-1 cells (for assay of IL-1). LM-1 cells comprise a sub-clone of the IL-1-responsive ATCC cell line D10.G4.1. They were sub-cloned by the immunologists at VIDO (U of S), and were selected in part because, unlike thymocytes, they do not require sub-mitogenic doses of mitogens (e.g., ConA or PHA) in order to respond to IL-1. They are maintained in Clicks-10% FCS, supplemented with 10% Con A-stimulated mouse spleen cell-conditioned medium. Pu5-1.8 cells (macrophage cell line) subconfluent monolayer cultures of Pu5-1.8 cells (ATCC #) in DMEM-10% FCS. Pu5 cells were one of the lines originally used to clone murine TNFα, primarily because of the fact that they produce enormous amounts of the cytokine relative to most macrophages or macrophage cell lines. Unlike more cell lines, Pu5 cells always look horribly unhealthy in culture.

112

5.5 APPENDIX E -- Binding affinities of Immunoglobulin G binding matrices

IgG Binding Matrix SPECIES AVID AL TM

Protein A

Protein G

HUMAN

++

++

++

RABBIT

++

++

++

MOUSE

++

++

++

GUINEA PIG

++

++

++

BOVINE

++

++

++

PIG

++

++

++

RAT

++

-

+

GOAT

++

-

++

HORSE

++

-

++

SHEEP

++

-

++

CHICKEN

++

-

-

113

5.6 APPENDIX F -- HUMAN CYTOKINE RT-PCR PRIMERS

CYTOKINE

5' PRIMERS

3' PRIMERS

PCR PRODUCT (BP)

IL-1α 22 5'-ATGGCCAAAGTTCCAGACATGTTTC

5'-GGTTTTCCAGTATCTGAAAGTTCAGT

868

IL-1β

5'-AGCTGATGGCCCTAAACAGATGA

5'-GATCTACACTCTCCAGCTGTAGA

533

IL-2

5'-ATGTACAGGATGCAACTCCTGTCTT

5'-GTTAGTGTTGAGATGATGCTTTGAC

420

IL-3

5'-AATCCAAACATGAGCTGCCTGCC

5'-GGCCCAGAGAGAGAGCTGGAG

496

IL-4

5'-TCACATTGTCACTGCAAATCGACA

5'-TCAGCTCGAACACTTTGAATATTTCT

493

IL-5

5'-ATGCACTTTCTTTGCCAAAGGCAA

5'-GGTTTACTCTCCGTCTTTCTTCT

365

IL-6

5'-TATCTCCCCTCCAGAAGCCCAG

5'-TCTGAGGAGAGCGCGGTCGT

685

IL-7

5'-TCTTTTAGGTATATCTTTGGACTTC

5'-TTTTCAGTGTTCTTTAGTGCCCATC

462

IL-8

5'-GCTTCTAGGACAAGAGCCAGGAAG

5'-CTTGGATACCACAGAGAATGAATTTTT

389

IL-10

5'-TCCTAGAGTCTATAGAGTCGCC

5'-AAGGCATGCACAGCTCAGCACT

625

IL-11

5'-ACATGGCTGTGTTTGCCGCCT

5'-TAAGATCTGGCTTTGGAAGGA

606

IL-13

5'-AAGCCACCCAGCCTATGCATCCG

5'-GATGCTTTCGAAGTTTCAGTTGAACC

471

IRAP

5'-GAATTCCGGGCTGCAGTCAC

5'-AACAGGCAGGCCTGGGCAGTA

578

eotaxin 235'CCCAACCACCTGCTGCTTTAACCTG

5'TGGCTTTGGAGTTGGAGATTTTTGG

207

G-CSF 5'-CTGTGGCACAGTGCACTCTGG

5'-GGAGGGCTTGGCTCAGGGCT

573

GM-CSF 5'-ATGTGGCTGCAGAGCCTGCTGC

5'-TCCAGCCTCATCGGCCGGT

456

LIFa

5'-CCTCGGTTCACAGCACACACTTCAAGA 659

5'-TCTGAAGTGCAGCCCATAATGAAGGT

M-CSF 5'-AAAGTGAAAGTTTGCCTGGGTCCT

5'-GGCCACACACTCACCAGCCG

340

MCP-3 5'-ACCTGCAGATTTATCAATAAGAAAATCCC 5'-CCCGGTCCTGAAATACTTCGTGGACCAGTGGTT 178 MIP-1α 5'-CAGACAGTGGTCAGTCCTTTC

5'-CCCTCAGGCACTCAGCTCTA

379

MIP-2β 5'-GCTTCCCGACGCGTCTGCTGA

5'-GTAAGGGCAGGGACCACCCTG

417

RANTES 5'-GCTGTCATCCTCATTGCTAC

5'-CTCTACTCGATCCTACCTCT

260

SCF

5'-CTGCTCCTATTTATTCCTCTCGTC

5'-TTACACTTCAAACTCTCTCTCTTT

822

TNFα

5'-CTTCTGCCTGCTGCACTTTGGA

5'-TCCCAAAGTAGACCTGCCCAGA

598

Τηε προτοχολ φορ ΡΤ−ΠΧΡ αµπλιφιχατιον οφ ΙΛ−1α, IL-1β , IL-3, -4, -5, -6, -7, -8, -10, -11, & -13, and IRAP, G-CSF, GM-CSF, LIF, M-CSF, MIP1α, MIP2β, SCF & TNFα can be found in Oka et al. (1995). Cytokine mRNA expression patterns in human esophageal cancer cell lines. J Interf. & Cytokine Res 15: 1005-09. 23 The RT-PCR protocol for amplifying eotaxin mRNA is available in Bartels et al. (1996). Human dermal fibroblasts express eotaxin: molecular cloning, mRNA expression, and identification of eotaxin sequence variants. Biochem Biophys Res Commun 25: 1045-51 22

114

5.7 APPENDIX G -- WORLD WIDE WEB Immunology sites of interest The following comprises a list of potentially useful web sites for immunologists.

Immunology (medical Specialties)................... http://galaxy.einet.net/galaxy/Medicine/MedicicalSpecialties/Immunology.htmi The World Wide Web Virtual Library: Immunology (Biosciences)..http://golgi.harvard.edu/biopages/immuno.htmi Medical Research Council of Canada ........................................ ..http://www.mrc.gc.ca/title.html Society homepages American Association of Allergy, Asthma and Immunology...........http://execpc.com/~edi/aaaai.htmi American Association of Immunologists.........................................http://glamdring.ucsd.edu/others/aal/ Australasian Society for Immunology.............................................http://www.wehi.edu.au/societies/ASI/ASI.htmi British Society for Immunology.......................................................http://www.blackci.co.uk/society/bsi/ CanadianSociety for Immunology..................................................http://www.csi.ucalgary.ca/csiweb.nsf Federation of Immunological Societies of Asia-Oceania....................... http://www.microbiology.adelaide.edu.au/fimsa.htm International Society of Experimental Hematology.........................http://www.kcj.com/hema/ National Academy of Science (US).................................................http://www.nas.edu Online services and databases American Type Culture Collection (ATCC)...........................................http://www.atcc.org/ Bionet Electronic Newsgroup Network for Biology (BIOSCI)................http://www.bio.net Centre for Protein Engineering: Home Page (MRC-CPE)....................http://www.mrc-cpe.cam.ac.uk/ European Collection of Animal Cell Culture (ECACC)..........................http://www.ist.unige.it/cldb/descart5.htmi GeneBank (Searches address).................................................... http://www.ncbi.nlm.nih.gov/Web/Search/index.html Immunogenetics database (IMGT Database).......................................http://www.ebi.ac.uk/contrib/imgt/top-imgt.htmi Jackson Laboratories (source of mice)…………………………………..http://www.jax.org/jaxmice Journal of Immunology.........................................................................http://ji.journals.at-home.com/JI Kabat Database of Sequences of Immunological Interest...................http://immuno.bme.nwu.edu Linscott's Directory of Immunological and Biological Reagents....................................................... .........................http://ourworld.compuserve.com/homepages/LINSCOTTSDIRECTORY/ National Center for Biotechnology Information (NCBI).........................http://www.ncbi.nim.nih.gov National Institutes of Health (NIH)........................................................http://www.nih.gov National Library of Medicine (USNLM).................................................http://www.nim.nih.gov/ NCBI WWW Enerez Browser...............................................................http://www3.ncbi.nim.nih.gov/Entrez/index.htmi Vbase: a Directory of Human Immunoglobulin V Genes......................................... ..........................http://www.mrc-cpe.cam.ac.uk/imt-doc/vbase-home-page.htmi Services provided by individuals’ homepages Cytokines and receptors....................http://www.Imb.uni-muenchen.de/groups/ibelgaufts/cytokines.htmi Cytokines and receptors..........................................................http://www.ocms.ox.ac.uk/~smb/cyt_web/ Immunoglobulin structure and function.................................. http://www.path.cam.ac.uk/~mrc7/mikeimages.htmi Immunoglobulin structure and sequences.............................. http://www.biochem.ucl.ac.uk/~martin/antibodies.htmi MHC structure and fanction, CD antigens.............................. http:/histo.cryst.bbk.ac.uk/ Tissue typing............................................................................http://www.umds.ac.uk/elsewhere/tissue/whatl.htmi

115

Veterinary Immunology and Immunopathology 71:

(1999)

pp 115-123 Differential complement activation by bovine IgG2 allotypes FD Bastida-Corcuera, LB Corbeil pp 143-149 Binding of bovine IgG2a and IgG2b allotypes to protein A, protein G, and Haemophilus somnus IgBPs FD Bastida-Corcuera, LB Corbeil

116

5.7 APPENDIX G -- SELECTED TEMPLATES FOR 96--WELL PLATES

1

2

3

4

5

6

7

8

9

10 11 12

1

2

3

4

5

6

7

8

9

10 11 12

1

2

3

4

5

6

7

8

9

10 11 12

A B C D E F G H

A B C D E F G H

A B C D E F G H

117

1

2

3

4

5

6

7

8

9

10 11 12

1

2

3

4

5

6

7

8

9

10 11 12

1

2

3

4

5

6

7

8

9

10 11 12

A B C D E F G H

A B C D E F G H

A B C D E F G H

118

1

2

3

4

5

6

7

8

9

10 11 12

1

2

3

4

5

6

7

8

9

10 11 12

A B C D E F G H

A B C D E F G H

1 A B C D E F G H

2

3

4

5

6

7

8

9

10 11 12

1

INDEX 10xSSC 63 32P-labelled cDNA probe synthesis 66 5X MOPS 63 7TD1 cells 21 actinomycin-D 23 activation of macrophages 16 ammonium persulfate 38 anaesthetic 8, 12, 100 antibody-dependent phagocytosis 14 antibody-coated cells 14 ADCC 14 anticoagulant 8 AVID-AL IgG affinity columns 32 blast assay 46 bromophenol blue dye 39 C'-dependent cytotoxicity 42 capture antibodies 50 cell counting 96 cellular RNA 60 cellular viability 97 Concanavalin A 46 CsCl/sodium acetate 60 cytocentrifuge preparations 97 cytotoxicity assay for TNFα 23 density gradient systems 8 detection antibodies 50 detection of mRNA bands 70 ELISPOT 50 ELISPOT plates 50 fluorescein-labelled anti-CD4 42 Giemsa stain 57 Gill's hematoxylin 102 GK1.5 (anti-CD4) 31 GSCN lysis solution 60 H2O-saturated isobutyl alcohol. 38 hemocytometer 96 heparin 8 IgE anti-DNP antibody 29 IL-1 activity 18 IL-6 activity 21 immunohistochemistry 58 in situ hybridization 72 intradermal skin test 56 isopropanol fix 39 isotonic Percoll 9

2

L-929 cells 23 lauryl sarcosine 60

leukocyte/platelet-rich plasma 9 lipopolysaccharide 16 LM-1 cells 18 low-tox rabbit C' 42 LPS 16 Lymphocyte separation medium 50 mast cells 29 monoclonal antibodies 31 monocyte/macrophage monolayers 14 monokine bioassays 18 morphologic identification of PBL 101 MTT 18 neutrophil chemotaxis assay 25 neutrophils 8 nitrocellulose 40 Northern blot blocking solution 68 Northern blotting 60 Northern blotting apparatus 63 PAGE 2x sample prep buffer 91 PAGE running buffer 91 paraffin section 57 paraformaldehyde 43 PBST 50 percoll 9 peripheral blood 8 phycoerythrin-labelled anti-CD8 antibodies 42 platelet 9 PMN 8 polyacrylamide gel electrophoresis 38 polymorphonuclear cells 8 pre-hybridization (Northerns) 68 radioactive hybridization solution 68 rapid Coomassie blue stain 38 rapid Coomassie brilliant blue 39 RBC sedimentation buffer 9 recombinant human IL-6 21 RNA sample dye/loading solution 63 RNA sample prep solution 63 rouleaux 9 separating gel (PAGE) 38 stacking gel (PAGE) 39 streptavidin-AP conjugate 40, 50 Synthesize the cRNA probes 72

3

T cell responses 56 Th1 versus Th2 responses 56

TIB 211 (anti-CD8) 31 tissue processor 57 TNF activity 24 TNFα standards 23 two-colour FACS 42 unit of TNF activity 24 web sites for immunologists 105 Wrights-Giemsa staining 101 x-ray film 70 Zeta-bind transfer membrane 63